UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Construction of template-assembled pyrimidine-based quartets and quadruplexes Hui, Benjamin Wei Qiang 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2014_september_hui_benjaminweiqiang.pdf [ 18.72MB ]
Metadata
JSON: 24-1.0167249.json
JSON-LD: 24-1.0167249-ld.json
RDF/XML (Pretty): 24-1.0167249-rdf.xml
RDF/JSON: 24-1.0167249-rdf.json
Turtle: 24-1.0167249-turtle.txt
N-Triples: 24-1.0167249-rdf-ntriples.txt
Original Record: 24-1.0167249-source.json
Full Text
24-1.0167249-fulltext.txt
Citation
24-1.0167249.ris

Full Text

CONSTRUCTION OF TEMPLATE-ASSEMBLED PYRIMIDINE-BASED QUARTETS AND QUADRUPLEXES  by Benjamin Wei Qiang Hui  B.Sc., National University of Singapore, 2007 M.Sc., Nanyang Technological University, 2009  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Chemistry)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  May 2014  © Benjamin Wei Qiang Hui, 2014 ii  Abstract  Pyrimidine-based quartets and quadruplexes are unstable and thus are rarely encountered in nature. Uracil (U) and thymine (T) quartets in the solution state have only been found as part of pre-existing G-quadruplex scaffolds and the corresponding quadruplexes have not been reported. Studies on such systems might shed light on their role in nucleic acid topology and stability. This thesis describes the assembly and structural characterization of these motifs in vitro as a result of grafting the respective nucleosides onto resorcinol-based cavitands. These rigid macrocycles serve as molecular templates on which these motifs are preorganized. Reduction of entropic loss improves thermodynamic stability and promotes self-assembly.  A convergent synthetic strategy was employed for accessing these cavitand-nucleoside conjugates. Cavitands and nucleosides were prepared separately using established literature methods, and the final coupling step of the two components entailed a copper (I)-catalyzed azide-alkyne cycloaddition, or a "click" reaction. NMR spectroscopy was used extensively in signal assignment, structure elucidation and oligomeric state analysis. CD spectroscopy was employed in some cases to provide further confirmation of defined structure.   Findings indicated the spontaneous self-assembly of a U-quartet in CDCl3 at both 25 ºC and –20 ºC. In the presence of a metal cation (Sr2+), symmetric homodimerization of two U-quartets occurs at 25 ºC. The corresponding U-quadruplex unit was identified in DMSO-d6 at 25 ºC. The T-quartet was shown to be nonexistent at 25 ºC, but assembles at a low temperature of –40 ºC. iii  No evidence for metal cation uptake was found at 25 ºC. Assembly of the T-quadruplex was confirmed in DMSO-d6 at 25 ºC. In all of these systems, stacking of the nucleobase and triazole linker rings was indicated suggesting π-stacking interactions to be a significant contributor to overall stability. iv  Preface  The directions and goals of this thesis were discussed and agreed upon between the author and research supervisor. All work described in this thesis was performed solely by the author. A version of Chapter 2 has been published. Benjamin Wei-Qiang Hui and John C. Sherman (2012) Synthesis and characterization of a template-assembled synthetic U-quartet. Chem. Comm. 48:109-111. The first draft of the manuscript and all work described therein was completed by the author. A version of Chapter 3 has been published. Benjamin Wei-Qiang Hui and John C. Sherman (2012) A template-assembled synthetic U-quadruplex. ChemBioChem 13:1865-1868. The first draft of the manuscript and all work described therein was completed by the author. A version of Chapter 4 has been published. Benjamin Wei-Qiang Hui and John C. Sherman (2013) Self-assembly of a thymine quartet and quadruplex via an organic template. Tetrahedron Letters 55:1479-1485. The first draft of the manuscript and all work therein was completed by the author. v  Table of Contents  Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  i i  Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  iv  Table of Contents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  v  List of Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  x  List of Figures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  xi  List of Schemes .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  xix  List of Abbreviations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  xxi  Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  xxiii  Dedication .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  xxiv  Chapter 1: Introduction .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  1  1.1  Beyond the covalent bond ............................................................................................... 1 1.2  Introduction to DNA structure ........................................................................................ 2 1.2.1  Historical background ................................................................................................. 2 1.2.2  Overview of nucleotide structure ................................................................................ 5 1.2.3  Natural and unnatural base pairing in DNA ............................................................... 6 1.2.4  X-ray crystal structure of DNA ................................................................................... 8 1.3  Supramolecular nucleobase assemblies in DNA ............................................................ 9 1.3.1  G-quartets and quadruplexes ....................................................................................... 9 1.3.1.1  Telomeric G-quadruplexes ................................................................................ 13 1.3.2  The i-motif ................................................................................................................ 18 1.3.3  Lipophilic G-quartets and quadruplexes ................................................................... 22 vi  1.3.4  Pyrimidine-based quartets ......................................................................................... 25 1.4  Thesis aim and goals ..................................................................................................... 29 Chapter 2: Synthesis and Characterization of a Template-Assembled Synthetic U-Quartet.. .  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  30  2.1  Synopsis ........................................................................................................................ 30 2.2  CPK modeling studies .................................................................................................. 31 2.3  Synthetic strategy .......................................................................................................... 31 2.3.1  Conjugation via the "click" reaction ......................................................................... 33 2.3.2  Synthesis of N-methylated conjugate ....................................................................... 35 2.4  NMR characterization studies ....................................................................................... 36 2.4.1  1H NMR signal assignment ....................................................................................... 36 2.4.1.1  Signal assignment and regiochemical analysis by NOESY .............................. 40 2.4.2  Summary of 1H signal assignments .......................................................................... 41 2.4.3  NMR solution structure ............................................................................................. 44 2.4.4  Variable-temperature 1H NMR studies ..................................................................... 47 2.4.5  Diffusion NMR studies ............................................................................................. 49 2.4.6  Circular dichroism (CD) studies ............................................................................... 53 2.4.6.1  Cation extraction studies ................................................................................... 56 2.5  Experimental section ..................................................................................................... 59 2.5.1  General information .................................................................................................. 59 2.5.2  Synthesis of conjugate 1  (similar procedure employed for the synthesis of 17) ..... 60 2.5.3  Supplementary 1H and 1H-1H COSY spectra ............................................................ 62 Chapter 3: A Template-Assembled Synthetic U-Quadruplex .. . . . . . . . . . . . . . . . . . . . . . . . .  71 vii  3.1  Synopsis ........................................................................................................................ 71 3.2  CPK modeling studies .................................................................................................. 72 3.3  Synthetic strategy .......................................................................................................... 73 3.3.1  Synthesis of conjugate 18  ......................................................................................... 73 3.3.2  Synthesis of N-methylated conjugate ....................................................................... 76 3.4  NMR characterization studies ....................................................................................... 79 3.4.1  1H signal assignment ................................................................................................. 79 3.4.2  Regiochemical analysis and signal assignment by NOESY ..................................... 81 3.4.3  Summary of 1H signal assignments .......................................................................... 83 3.4.4  NMR solution structure elucidation .......................................................................... 87 3.4.5  Variable-temperature NMR studies .......................................................................... 90 3.4.6  Diffusion NMR studies ............................................................................................. 92 3.5  Experimental section ..................................................................................................... 93 3.5.1  General information .................................................................................................. 93 3.5.2  Synthesis of conjugate 18  ......................................................................................... 94 3.5.2.1  Preparation of 5'-OH dinucleoside 23  .............................................................. 94 3.5.2.2  Preparation of 5'-I dinucleoside 24  .................................................................. 95 3.5.2.3  Preparation of 5'-N3 dinucleoside 25  ................................................................ 96 3.5.2.4  Preparation of conjugate 18  via the "click" reaction ........................................ 97 3.5.3  Synthesis of conjugate 27  (procedure similar to that of 18) .................................... 98 3.5.3.1  Preparation of 5'-OH dinucleoside 31  .............................................................. 98 3.5.3.2  Preparation of 5'-I dinucleoside 32  .................................................................. 98 3.5.3.3  Preparation of 5'-N3 dinucleoside 26  ................................................................ 99 viii  3.5.3.4  Preparation of conjugate 27  ............................................................................ 100 3.5.4  Supplementary 1H and 1H-1H COSY spectra .......................................................... 101 Chapter 4: Self-assembly of a Thymine Quartet and Quadruplex via an Organic Template… ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  108  4.1  Synopsis ...................................................................................................................... 108 4.2  CPK modeling studies ................................................................................................ 109 4.3  Synthetic strategy ........................................................................................................ 110 4.3.1  Synthesis of conjugates 33  and 34  ......................................................................... 110 4.3.2  Synthesis of N-methylated analogs ......................................................................... 113 4.4  NMR characterization studies ..................................................................................... 115 4.4.1  1H signal assignments ............................................................................................. 115 4.4.2  Regiochemical analysis by NOESY ....................................................................... 116 4.4.3  Summary of 1H signal assignments ........................................................................ 117 4.4.4  NMR solution structure elucidation ........................................................................ 122 4.4.4.1  Conjugate 33  .................................................................................................. 122 4.4.4.2  Conjugate 34  .................................................................................................. 126 4.4.4.3  Further investigations on the quadruplex ring stacking effect ........................ 130 4.4.5  CD spectroscopic studies of 33  and 40  .................................................................. 136 4.5  Experimental section ................................................................................................... 137 4.5.1  General information ................................................................................................ 137 4.5.2  Synthesis of conjugates 33  and 40  ......................................................................... 138 4.5.3  Synthesis of conjugates 34 , 41  and 47  .................................................................. 139 4.5.3.1  Preparation of 5'-OH dinucleoside 37  ............................................................ 139 ix  4.5.3.2  Preparation of 5'-OH dinucleoside 44  (similar procedure used for 49) ......... 140 4.5.3.3  Preparation of 5'-I dinucleoside 38  ................................................................ 141 4.5.3.4  Preparation of 5'-I dinucleoside 45  (similar procedure used for 50) ............. 142 4.5.3.5  Preparation of 5'-N3 dinucleoside 39  .............................................................. 144 4.5.3.6  Preparation of 5'-N3 dinucleoside 46  (similar procedure used for 51) .......... 144 4.5.3.7  Preparation of conjugate 34  (similar procedure used for 41  and 47) ............ 146 4.5.4  Supplementary 1H and 1H-1H COSY spectra .......................................................... 148 Chapter 5: Conclusion .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  159  5.1  Thesis summary .......................................................................................................... 159 5.2  Future work ................................................................................................................. 163 5.2.1  Synthesis of cavitand 'foot'-based nucleobase conjugates ...................................... 163 5.2.2  Synthesis of amide-linked conjugates ..................................................................... 165 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  169  x  List of Tables  Table 2.1 1H signal assignments of 1  in CDCl3 and DMSO-d6 at 25 ºC ...................................... 42 Table 2.2 1H signal assignments of 17  in CDCl3 and DMSO-d6 at 25 ºC ................................... 43 Table 2.3 H1' diffusion constants (D) of 1  and 17  in CDCl3 at 25 ºC (2.7 mM) .......................... 53 Table 2.4 H1' diffusion constants (D) of 1  and 1•Sr2+ in CDCl3 at 25 ºC (2.7 mM) .................... 58 Table 3.1 1H signal assignments of 18  in DMSO-d6 at 25 ºC ...................................................... 84 Table 3.2 1H signal assignments of 27 in DMSO-d6 at 25 ºC ...................................................... 85 Table 3.3 1H signal assignments of 27 in CDCl3 at 25 ºC ........................................................... 86 Table 3.4 ArH diffusion constants (D) of 18  and 27  in CDCl3 and DMSO-d6 at 25 ºC (2.7 mM)....................................................................................................................................................... 92 Table 4.1 1H signal assignments of 33  at 25 ºC ......................................................................... 118 Table 4.2 1H signal assignments of 34  at 25 ºC ......................................................................... 119 Table 4.3 1H signal assignments of 40  at 25 ºC ......................................................................... 120 Table 4.4 1H signal assignments of 41  at 25 ºC ......................................................................... 121 Table 4.5 Hc diffusion constants (D) of 33  and 40  in CDCl3 at 25 ºC (2.7 mM) ...................... 125 Table 4.6 Diffusion constants (D) of 34  and 41  in CDCl3 and DMSO-d6 at 25 ºC (2.7 mM) .. 129 Table 4.7 1H signal assignments of 47  in DMSO-d6 at 25 ºC .................................................... 133 Table 4.8 Hc" diffusion constants (D) of 34  and 41  in CDCl3 and DMSO-d6 at 25 ºC (2.7 mM)..................................................................................................................................................... 135   xi  List of Figures  Figure 1.1 a) The canonical nucleobases (uracil replaces thymine in RNA). b) DNA nucleotide units consisting of the base, 2'-deoxyribose sugar and 5'-phosphate groups .................................. 3 Figure 1.2 a) The double helix of B-DNA proposed by Watson and Crick. A•T and C•G base pairs are depicted along with the minor and major grooves and directional sense of both strands. b) Molecular structure of a generic oligonucleotide ....................................................................... 4 Figure 1.3 The syn and anti forms of a) adenosine and b) thymidine nucleosides ......................... 5 Figure 1.4 Ribose sugar ring puckering at either C2' or C3' positions ........................................... 6 Figure 1.5 Canonical base pairs of DNA ........................................................................................ 7 Figure 1.6 a) Tautomeric base pairing between guanine and thymine (top) and between adenine and cytosine (bottom). b) Hoogsteen base pairing between 9-methyladenine and 1-methylthymine ................................................................................................................................ 8 Figure 1.7 X-ray crystal structure of DNA dodecamer d(CGCGAATTCGCG) (PDB: 1BNA) showing the double helix. Visualization rendered with USCF Chimera molecular modeling software ........................................................................................................................................... 9 Figure 1.8 a) Hoogsteen hydrogen-bonded G-quartet stabilized by a central cation. b) Helical stack of G-quartets to form a G-quadruplex with a sandwiched central cation coordinated by the O6 atom of each guanine base in a square antiprismatic geometry .............................................. 11 Figure 1.9 a) Cartoon representations of several G-quadruplex patterns. a) All-parallel system derived from poly(G) strands reported by Zimmerman. b) Intramolecular antiparallel system of d[(T4G4)4] reported by Williamson. c) Sundquist's bimolecular antiparallel system adopted by d(T2G4T2G4)2 strands. Guanine bases are represented by blue slabs ............................................ 12 xii  Figure 1.10 a) Schematic of DNA replication resulting in a 3' overhanging region of the lagging parent strand. b) Schematic of Tetrahymena telomere repair by the reverse transcriptase mechanism of telomerase .............................................................................................................. 14 Figure 1.11 a) X-ray crystal structure of Oxytricha telomeric sequence d(G4T4G4) (PDB: 1D59). b) Schematic of diagonal bimolecular over-and-under G-quadruplex adopted by Oxytricha sequence in solution with Na+. c) X-ray crystal structure of Tetrahymena telomeric repeat d(TG4T) with sandwiched Na+ (PDB: 244D). d) X-ray crystal structure of shortened human telomeric repeat d(T TAG3TTAG3T) with sandwiched K+ (PDB: 1K8P). Crystal structures rendered with UCSF Chimera ....................................................................................................... 17 Figure 1.12 a) A hemiprotonated C•CH+ base pair, the building block of i-motif architectures. b) Example of an i-motif: Schematic of an alternating parallel/antiparallel tetra-stranded structure adopted by d(TC5) showing the intercalated hemiprotonated cytosine base-pairs. Blue and grey slabs represent cytosine and thymine bases respectively .............................................................. 19 Figure 1.13 a) X-ray crystal structure of all-parallel d(C4) i-motif tetraplex (PDB: 190D). b) Ditto. View down helical axis. c) X-ray crystal structure of bimolecular i-motif derived from d(TAACCC) (PDB: 200D). Intermolecular A•T base pair is represented by red adenine and green thymine residues. Crystal structures rendered with UCSF Chimera .................................. 20 Figure 1.14 X-ray crystal structure of Tetrahymena telomeric repeat d(AACCCC) showing central i-motif core flanked by terminal adenine residues capable of intermolecular base-pairing (PDB: 294D). Rendered with UCSF Chimera .............................................................................. 21 Figure 1.15 a) Cation-free G-quartet derived from syn-configured guanosine units. b) Bimolecular G-quartet supported by calix[4]arene templates. c) Cation-free G-quartet preorganized by a resorcinol-based cavitand ................................................................................ 23 xiii  Figure 1.16 G-quadruplex assembled from lipophilic guanosine subunits in the presence of K and Cs picrates. Picrate 'clip' further stabilizes the system .................................................................. 25 Figure 1.17 a) G-quadruplex scaffold (blue) capped by a 3' end U-quartet (red). b) U-quartet with imino to O4 hydrogen bonds. NOE interaction between imino and H5 of neighboring base is shown with a red arrow ................................................................................................................. 26 Figure 1.18 Crystal structure of d(TG4T)4 tetraplex with thymine quartet (blue) at the top coordinating a Na+ ion (orange) capping a G-quadruplex scaffold stabilized by Tl3+ ions (red).  Rendered with UCSF Chimera ..................................................................................................... 29 Figure 2.1 Side-on representation of conjugate 1  ......................................................................... 30 Figure 2.2 Condensed structure of 1  with protons labeled ........................................................... 37 Figure 2.3 Expected COSY correlations in a) the cavitand moiety, between Hin/Hout and Hd/methylene 'foot', b) the nucleoside moiety, amongst ribose protons and H5/H6 on uracil ..... 37 Figure 2.4 Himino signal is quenched on exchange with CD3OD ................................................... 38 Figure 2.5 Dihedral angles of a) H2' and H3', eclipsed and therefore yielding a 3J maximum and b) H1' and H2', close to orthogonal thus yielding a 3J minimum. –OR groups represent the isopropylidene moiety ................................................................................................................... 39 Figure 2.6 a) Portion of 400 MHz NOE spectrum of 1  in CDCl3 showing crosspeak between ArH and Hd. b) NOE interaction between ArH and Hd ........................................................................ 40 Figure 2.7 NOE interactions in the a) 1,4 and b) 1,5-regioisomers of 1. c) Portion of 400 MHz NOE spectrum of 1 in CDCl3 showing NOE crosspeaks from Hc to H5a'/H5b' and Ha/Hb ........... 41 Figure 2.8 Portions of 400 MHz 1H NMR spectra of a) 1  and b) 10  in CDCl3 at 25ºC .............. 44 Figure 2.9 Portions of 400 MHz NOE spectrum of 1 in CDCl3 at a) 25 ºC and b) –20 ºC showing crosspeaks between Himino and H5 ................................................................................................ 45 xiv  Figure 2.10 a) Portion of 400 MHz NOE spectrum of 1 in CDCl3 at 25 ºC showing crosspeak between H6 and H1' indicative of syn geometry. b) NOE connection shown between H6 and H1'. c) Model of a uridine residue in 1  showing fitting of the O2 atom in the 'cleft' traced by H2', H3' and H5' protons. H6 and H1' are rendered coplanar ....................................................................... 46 Figure 2.11 a) Portion of 400 MHz NOE spectrum of 1  in CDCl3 at 25 ºC showing crosspeak between H6 and Hc indicative of ring stacking. b) Illustration of proposed U-quartet in 1  with uracil-triazole stacking. NOE between H6 and Hc is shown. Two appendages are displayed. Linkers are omitted for clarity ...................................................................................................... 47 Figure 2.12 Variable temperature 1H spectra of 1  in CDCl3 ........................................................ 48 Figure 2.13 Schematic of a basic DOSY spin echo (SE) pulse sequence. Bulk magnetization is represented by a bolded arrow ...................................................................................................... 51 Figure 2.14 Signal intensity decay curve over 16 points for H1' proton of 1  ............................... 52 Figure 2.15 a) π−π* transition dipoles of a guanine base. b) Overlapping and exciton coupling of transition dipoles in a G-quadruplex ............................................................................................. 54 Figure 2.16 CD spectra of 0.1 mM solutions of 1  and 17  in CHCl3 and MeOH ......................... 55 Figure 2.17 CD spectra of 0.1 mM solutions of 1•Sr2+ in CHCl3 and MeOH .............................. 57 Figure 2.18 Portion of 1H NMR spectrum of 1•Sr2+ showing the imino and picrate aryl proton signals ........................................................................................................................................... 58 Figure 2.19 Proposed structure of 1•Sr2+ complex. Uracil residues are represented by shaded slabs............................................................................................................................................... 59 Figure 2.20 1H NMR spectrum of 1  in CDCl3 at 25 ºC ................................................................ 63 Figure 2.21 1H-1H COSY spectrum of 1  in CDCl3 at 25 ºC ......................................................... 64 Figure 2.22 1H NMR spectrum of 1  in DMSO-d6 at 25 ºC .......................................................... 65 xv  Figure 2.23 1H-1H COSY spectrum of 1  in DMSO-d6 at 25 ºC ................................................... 66 Figure 2.24 1H NMR spectrum of 17  in CDCl3 at 25 ºC ............................................................. 67 Figure 2.25 1H-1H COSY spectrum of 17  in CDCl3 at 25 ºC ...................................................... 69 Figure 2.26 1H NMR spectrum of 17  in DMSO-d6 at 25 ºC ........................................................ 69 Figure 2.27 1H-1H COSY spectrum of 17  in DMSO-d6 at 25 ºC ................................................. 70 Figure 3.1 Side-on representation of conjugate 18 . Outer and inner uridine residues, as well as the 5' and 3' sugar ring positions are labeled to demonstrate directional sense ............................ 72 Figure 3.2 Schematic showing di- and trisubstituted conjugates sterically crowded at the cavitand rim, blocking approach of subsequent residues of 25 . Monosubstituted conjugate not shown ... 76 Figure 3.3 Condensed structure of 18  .......................................................................................... 79 Figure 3.4 1H NMR spectra of 18  in CDCl3 at 25 ºC and 55 ºC .................................................. 80 Figure 3.5 a) Portion of 400 MHz COSY spectrum of 18  in DMSO-d6 showing W-coupling-based COSY crosspeaks between imino and H5 protons. b) W-coupling within uracil shown in bolded bonds ................................................................................................................................. 81 Figure 3.6 a) Portion of 400 MHz NOE spectrum of 18  in DMSO-d6 showing crosspeaks between ArH and Hd and the –CH2- 'feet' (27  exhibits similar correlations and is therefore not shown). b) NOE interactions of said protons ................................................................................ 82 Figure 3.7 a) Portion of 400 Mhz NOE spectrum of 18  in DMSO-d6 showing crosspeaks between triazole protons and flanking methylene groups (27  exhibits similar correlations and is therefore not shown). b) Expected NOE interactions of 1,4-regioisomers of 18  ......................... 83 Figure 3.8 a) Portion of 400 MHz NOE spectrum of 18  in DMSO-d6 showing crosspeaks between both imino protons and H5 protons. b) Portion of 400 Mhz NOE spectrum of 25  in xvi  DMSO-d6 showing mutual imino crosspeaks and with residual H2O in NMR solvent. c) Imino protons labeled on the structure of 25  .......................................................................................... 88 Figure 3.9 a) Portion of 400 MHz NOE spectrum of 18  in DMSO-d6 showing crosspeaks between triazole protons and H6" suggestive of π-stacking. b) Illustration of proposed U-quadruplex of 18  showing planar and non-planar inner and outer U-quartets respectively. Triazole/H6 NOE connections are shown in red arrows .............................................................. 89 Figure 3.10 a) Portion of 400 MHz NOE spectrum of 18 showing H6'/H1' and H6"/H1" crosspeaks indicative of syn glycosidic bonds. b) NOE correlations of the syn conformers shown in 18  .............................................................................................................................................. 90 Figure 3.11 Variable-temperature 1H NMR spectra of 18  in DMSO-d6 ...................................... 91 Figure 3.12 1H NMR spectrum of 18  in DMSO-d6 at 25 ºC ...................................................... 102 Figure 3.13 1H-1H COSY spectrum of 18  in DMSO-d6 at 25 ºC ............................................... 103 Figure 3.14 1H NMR spectrum of 27  in DMSO-d6 at 25 ºC ...................................................... 104 Figure 3.15 1H-1H COSY spectrum of 27  in DMSO-d6 at 25 ºC ............................................... 105 Figure 3.16 1H NMR spectrum of 27  in CDCl3 at 25 ºC ........................................................... 106 Figure 3.17 1H-1H COSY spectrum of 27  in CDCl3 at 25 ºC .................................................... 107 Figure 4.1 Side-on representations of conjugates 33  and 34 . Outer and inner thymidine residues for 34 are labeled, as well as the 5' and 3' ribose ring positions showing the 5' – 3' outer – inner directional sense .......................................................................................................................... 109 Figure 4.2 Portions of 400 MHz 1H spectra of 18  and 34  in CDCl3 at 25 ºC showing the imino proton signals .............................................................................................................................. 116 Figure 4.3 Condensed structures of a) 33  and b) 34  with all protons labeled ........................... 116 xvii  Figure 4.4 Portions of 400 MHz NOE spectra in DMSO-d6 at 25 ºC showing appropriate crosspeaks signifying 1,4-regiochemistry at both triazole rings for a) 33  and b) 34 . Conjugates 40  and 41  displayed similar crosspeaks and are therefore not shown ....................................... 117 Figure 4.5 a) Portions of 400 MHz variable-temperature 1H spectra of 33  in CDCl3. b) Portion of 400 MHz NOE spectrum of 33  in CDCl3 at –40 ºC showing crosspeak between the imino proton and 5-Me indicative of a T-quartet ............................................................................................. 123 Figure 4.6 a) Portion of 400 MHz NOE spectrum of 33  in CDCl3 at –40 ºC showing correlations between Hc, H6 and 5-Me. b) Illustration of proposed twisted T-quartet of 33  illustrating stacked thymine and triazole rings with NOE interactions shown .......................................................... 124 Figure 4.7 a) Portion of 400 MHz NOE spectrum of 33  in CDCl3 at -40 ºC showing the H6/H1' crosspeak indicative of the syn glycosidic bond. b) The syn conformation of 33  with H6/H1' interaction shown ........................................................................................................................ 125 Figure 4.8 Portions of 400 MHz NOE spectrum of 34  in DMSO-d6 at 25 ºC showing a) Imino/5-Me crosspeaks indicative of quadruplex assembly and b) Hc/H5/5-Me crosspeaks indicative of a fully intercalated scaffold. c) Illustration of the quadruplex assembly in 34  with planar outer quartet and propeller-twisted inner quartet. NOE connections are labeled ................................ 127 Figure 4.9 a) Portion of 400 MHz NOE spectrum of 39  in DMSO-d6 at 25 ºC showing mutual imino crosspeaks and to H2O. b) Imino protons labeled in the structure of 39  ......................... 128 Figure 4.10 a) Portion of 400 MHz NOE spectrum of 34  in DMSO-d6 at 25 ºC showing crosspeaks between the H6 and H1 protons of both nucleosides. b) NOE correlations in the syn configuration of 34  ..................................................................................................................... 129 Figure 4.11 Side-on view of conjugate 47  ................................................................................. 130 xviii  Figure 4.12 Portions of 400 MHz NOE spectrum of 47  in DMSO-d6 at 25 ºC showing a) crosspeaks between triazole protons and the respective flanking methylene linkers indicative of uniform 1,4-regiochemistry and b) crosspeaks between H6 and H1 protons of both thymidine residues indicative of all-syn glycosidic bond angles ................................................................. 132 Figure 4.13 Portions of 400 MHz NOE spectrum of 47  in DMSO-d6 at 25 ºC showing a) Hinner/5-Me" crosspeak indicative of an inner T-quartet assembly and b) crosspeaks implying ring stacking. c) Illustration of the proposed assembly in 47  with a distorted outer layer. NOE correlations are labeled with red arrows ..................................................................................... 135 Figure 4.14 CD spectra of 33  and 34  in chloroform and methanol. (Spectrum of 1  in chloroform provided for reference) ............................................................................................................... 136 Figure 4.15 1H NMR spectrum of 33  in DMSO-d6 at 25 ºC ...................................................... 149 Figure 4.16 1H-1H COSY spectrum of 33  in DMSO-d6 at 25 ºC ............................................... 150 Figure 4.17 1H NMR spectrum of 34  in DMSO-d6 at 25 ºC ...................................................... 151 Figure 4.18 1H-1H COSY spectrum of 34  in DMSO-d6 at 25 ºC ............................................... 152 Figure 4.19 1H NMR spectrum of 40  in DMSO-d6 at 25 ºC ...................................................... 153 Figure 4.20 1H-1H COSY spectrum of 40  in DMSO-d6 at 25 ºC ............................................... 154 Figure 4.21 1H NMR spectrum of 41  in DMSO-d6 at 25 ºC ...................................................... 155 Figure 4.22 1H-1H COSY spectrum of 41  in DMSO-d6 at 25 ºC ............................................... 156 Figure 4.23 1H NMR spectrum of 47  in DMSO-d6 at 25 ºC ...................................................... 157 Figure 4.24 1H-1H COSY spectrum of 47  in DMSO-d6 at 25 ºC ............................................... 158 Figure 5.1 Side-on representation of a cavitand with rim and foot positions labeled ................ 163   xix  List of Schemes  Scheme 2.1 Synthesis of cavitand 7  ............................................................................................. 32 Scheme 2.2 Synthesis of 5'-azidouridine 10  ................................................................................ 33 Scheme 2.3 A general 1,4-regioselective "click" reaction ............................................................ 33 Scheme 2.4 Example of a thermal Huisgen cycloaddition ........................................................... 34 Scheme 2.5 Synthesis of conjugate 1  ........................................................................................... 35 Scheme 2.6 Synthesis of a) azide 16  and b) conjugate 17  ........................................................... 36 Scheme 3.1 Synthetic route towards dinucleoside 25  .................................................................. 74 Scheme 3.2 Synthesis of 18  by the Cu-catalyzed "click" reaction ............................................... 75 Scheme 3.3 Original synthetic plan for N-methylated conjugate 27  ........................................... 77 Scheme 3.4 a) Synthesis of propargyl ether 29 . b) Synthesis of azide 26  ................................... 78 Scheme 4.1 Cu-catalyzed "click" reaction between 7  and 35  to access conjugate 33  .............. 110 Scheme 4.2 a) Cu-catalyzed "click" reaction between 7  and 39  to afford conjugate 34 . b) Synthesis of dinucleoside 39  ...................................................................................................... 112 Scheme 4.3 Synthesis of conjugate 40  ....................................................................................... 113 Scheme 4.4 a) Cu-catalyzed "click" reaction between 7  and 46  to afford conjugate 41 . b) Synthesis of dinucleoside 46  ...................................................................................................... 114 Scheme 4.5 a) Cu-catalyzed "click" reaction between 7  and 51  to afford conjugate 47 . b) Synthesis of dinucleoside 51  ...................................................................................................... 131 Scheme 5.1 Proposed synthesis of 'foot'-based tetrauridine-cavitand conjugate 56  .................. 164 Scheme 5.2 Proposed synthesis of conjugates of varying 'feet' lengths ..................................... 165 xx  Scheme 5.3 a) Synthesis of 5'-amino nucleoside 60 . b) DCC-assisted Staudinger ligation between cavitand 59  and nucleoside 60  .................................................................................... 166 Scheme 5.4 Proposed syntheses of nucleosides 63  and 64  ........................................................ 167 Scheme 5.5 Proposed synthesis of conjugate 67  ........................................................................ 168  xxi  List of Abbreviations  1D   one dimensional 2D   two dimensional A   adenine Å   angstrom br   broad Bu   butyl C   cytosine CD   circular dichroism COSY   correlation nuclear magnetic resonance spectroscopy d   doublet dd   doublet of doublets DMAP   4-dimethylaminopyridine DMF   dimethylformamide DMSO   dimethylsulfoxide DMSO-d6  deuterated dimethylsulfoxide DNA   deoxyribonucleic acid DOSY   diffusion-ordered nuclear magnetic resonance spectroscopy EDTA   ethylenediaminetetraacetic acid ESI   electrospray ionization G   guanine GMP   guanosine monophosphate xxii  h   hour HRMS   high resolution mass spectrometry m   multiplet Me   methyl MALDI-TOF  matrix-assisted laser desorption-ionization, time-of-flight MS   mass spectrometry NOE   nuclear Overhauser effect NOESY  nuclear Overhauser effect nuclear magnetic resonance spectroscopy NMR   nuclear magnetic resonance spectroscopy PDB   Protein Databank RNA   ribonucleic acid s   singlet rt   room temperature t   triplet td   triplet of doublets T   thymine TASP   template-assembled synthetic protein TASQ   template-assembled synthetic G-quartet TBAF   tetra-n-butylammonium fluoride TBS   tert-butyldimethylsilyl THF   tetrahydrofuran U   uracil VT   variable-temperature nuclear magnetic resonance spectroscopy xxiii  Acknowledgements  I would like to extend my appreciation to my advisor, Professor John Sherman for helpful discussions and providing me the opportunity to work in his laboratory. I also thank UBC and the Department of Chemistry for financial support in the form of scholarships. My fellow labmates Grant Bare, Jon Freeman and Hui Yang provided much needed support and inspiration during this time, and I am most fortunate to have them as friends. Special thanks go to the UBC NMR and mass spectrometry lab staff, namely Maria Ezhova, Zorana Danilovic, Yun Ling and Marshall Lapawa for their expert assistance.  Most of all, I am grateful to my parents for their unrelenting spiritual, moral and financial support throughout all these years.   xxiv  Dedication  To my parents, and the Creator. 1  Chapter 1: Introduction  1.1  Beyond the covalent bond Supramolecular chemistry is the study of non-covalent interactions within macromolecular systems and how these forces dictate structure.1, 2 Specifically, the understanding of how discrete molecular subunits associate through these forces into cohesive and functional wholes is sought.3, 4 In the pursuit of understanding Nature at the molecular level, the in vitro construction of model biomolecule analogs for study is a persistent challenge. Template-directed self-assembly has emerged as a useful technique allowing facile access to such inherently complex molecular architectures.5 This is achieved by the use of template molecules on which self-assembling components are attached, bringing them into close proximity for interaction, thus alleviating the entropic penalty and consequently increasing the thermodynamic stability of the assembled motifs. Of the numerous types of template molecules designed, from solid state substrates like carbon nanotubes6, 7 and polymer nanofibers8 to biomolecules like peptides9 and DNA10, the utility of organic resorcinol-based cavitands is noteworthy. These compounds represent a broader spectrum of macrocycles with an innate central cavity that are easily synthesized and derivatized, offer excellent chemical stability, and are structurally rigid.11 In addition, the presence of at least a four-fold symmetry allows varying degrees of molecular complexity to be constructed on their surfaces. Our group has made contributions to the field of de novo protein design by the preparation of template-assembled synthetic proteins (TASPs) composed of medium-length peptides covalently bound to cavitand templates. Studies have revealed elevated thermal and kinetic stability of these TASPs vis-à-vis other synthetic systems.12, 13 Slight modification of the 2  amino acid sequences was found to impart hydrolytic activity to the TASPs towards small molecule substrates.14 This has possible implications for their use as enzyme mimics and is highly advantageous due to an expanded substrate scope and negligible loss of activity over time.  1.2  Introduction to DNA structure  1.2.1 Historical background The successful isolation of DNA in the late 19th century was met with little enthusiasm due to its hitherto unknown function. By the early 20th century, the canonical nitrogenous bases had been identified (Figure 1.1a). In 1919, Levene characterized the nitrogenous base, 2'-deoxyribose sugar ring and the phosphate moieties and correctly recognized that these constitute a DNA nucleotide (Figure 1.1b).15 The relative positions of the substituents on the sugar ring were as yet unclear. Extensive as these studies were at the time, there was still no reason to believe that DNA played any part in the transmission of heredity, that role being attributed to proteins as they were thought to be more chemically complex. This mindset persisted until the middle of the century when several groundbreaking experiments proved otherwise. In 1943, Avery, MacLeod and McCarthy, working with the S. pneumoniae bacterium, found that a mixture of live non-virulent Type II-R and killed virulent Type III-S bacterial particles was infective.16 They deduced the only way this could happen was a transfer of genetic information from the virulent to the non-virulent bacteria, effecting their transformation to the virulent type. The agent responsible for this process was isolated and found to be DNA. Definitive evidence that DNA is indeed the hereditary material was uncovered in 1952, when Hershey and Chase found that bacteriophages transfer only their DNA to the host cells at the moment of infection.17 3    Figure 1.1 a) The canonical nucleobases (uracil replaces thymine in RNA). b) DNA nucleotide units consisting of the base, 2'-deoxyribose sugar and 5'-phosphate groups.  The structure of DNA was finally reported in 1953 by Watson and Crick through X-ray diffraction studies on DNA fibers.18, 19 In this monumental work, they elucidated the double helical structure of DNA, comprising two antiparallel polynucleotide strands winding in a right-handed fashion about a lengthwise axis (Figure 1.2). In accordance with Chargaff's rule necessitating a universal 1:1 ratio of purine to pyrimidine nitrogenous bases in DNA,20 they formulated the Watson-Crick complementary base pairing system where adenine (A) pairs with thymine (T), and guanine (G) with cytosine (C) via hydrogen bonds. Within their model, now recognized as B-DNA and the physiological form, the plane of each base pair is perpendicular to the helical axis. The helix twists 36º per base pair, and thus completes a turn every ten base pairs. A rise of 34 Å per turn is consistent with an individual base pair thickness of 3.4 Å. These geometric features confer a topological repeat pattern of major and minor grooves throughout the length of the molecule of fundamental importance to its function. NHN N NH2NHO NNNH2NHNHN O N NH2 HN O NHOCH3AG TC HN O NHOUpurinespyrimidines NHNN O NH2NOOHO 1'a) b) PO-O O- 2'3'4' 5' 12345 678 9 NHNO OH3C 1 23456 GT basesugarphosphate4   Figure 1.2 a) The double helix of B-DNA proposed by Watson and Crick. A•T and C•G base pairs are depicted along with the minor and major grooves and directional sense of both strands. b) Molecular structure of a generic oligonucleotide.  The implications of these findings were profound. Firstly, Watson-Crick base pairing all but precluded the possibility of a static, unchanging base sequence as assumed previously. The pretext for the origin of diversity of all terrestrial life was hence laid. Secondly, the closed double helix renders the bases unexposed to the environment. Therefore, a mechanism for DNA replication and expression yet unknown had to be elucidated. Inadvertently, the floodgates of A TGCOminor major baseOPO-O O O baseOPO-O O-PO-O O O baseO PO-O O O baseO HOa) b)5' 3' 5'3' 5' 3'5  inquiry that were opened with this monumental discovery led to the modern fields of molecular biology and genetics.  1.2.2 Overview of nucleotide structure In a typical 2'-deoxyribonucleotide, the nitrogenous base is bound to the sugar via a β-N-glycosidic bond connecting the anomeric C1' of the furanose ring and the N1 or N9 position of the pyrimidine or purine base respectively. Rotation about this bond allows for two possible spatial conformations: the anti- and syn- forms (Figure 1.3). In native DNA, the anti conformer is adopted because the syn conformer extends the base over the surface of the sugar ring resulting in steric interactions.   Figure 1.3 The syn and anti forms of a) adenosine and b) thymidine nucleosides.  NHNN O NH 2NOOHHO NHNOOOHHO OH3CH6 H1 'H8 H1 ' antiHN N NOH2 N NOOHHO H8H1 ' HN NOOOHHO O CH 3H6H1 ' syn1' 9 1' 1a) b)6  Puckering of the ribose sugar ring to assume an envelope-like conformation causes either the C2' or C3' atom to extend out of the ring plane on the same face as C5' (Figure 1.4). In the C2'-endo conformation, the resultant relative positions of the 5'- and 3'-phosphate linkers gives rise to B-DNA. The C3'-endo species provides the A-DNA form, not normally found under physiological conditions.   Figure 1.4 Ribose sugar ring puckering at either C2' or C3' positions.  1.2.3 Natural and unnatural base pairing in DNA The Watson-Crick base pairing system helped codify organization within the large DNA molecule. A•T base pairs consist of two hydrogen bonds connecting the N1 and amino proton of adenine to H3 and O4 of thymine respectively. The G•C base pair entails three hydrogen bonds connecting the H1, amino proton and O6 of guanine to N3, O2 and amino proton of cytosine respectively. (Figure 1.5)  O baseOPO-O O- 2'5' O 3'1' O PO O-O-base1' 5'C2'-endo C3'-endoOH OH3' 2'7   Figure 1.5 Canonical base pairs of DNA.  Tautomerization is not pronounced in the bases under physiological conditions although the presence of transferable protons allows for it. Guanine and thymine exist predominantly in the keto form, while adenine and cytosine assume the amino form. Gas phase studies conducted on uracil and thymine at elevated temperatures found only trace amounts of the enol tautomer.21 This is noteworthy considering the aromaticity of the heterocyclic ring in the enol. Nonetheless, enolization results in a change of molecular conformation as well as the configuration of the hydrogen bond contacts. As a result, enolic thymine forms an anomalous base pair with guanine possessing three hydrogen bonds, resulting in a point mutation in DNA. Likewise, the minor imino tautomer of cytosine forms two hydrogen bonds with adenine instead of the usual three with guanine. (Figure 1.6a) Interestingly, standard Watson-Crick hydrogen bonding modes do not always apply to canonical base pairs. Crystalline structures of A•T in the form of free bases 9-methyladenine and 1-methylthymine reveal the participation of the adenine N7 instead of N1 (Figure 1.6b).22, 23 This pattern is known as Hoogsteen hydrogen bonding and is especially involved in the stabilization of guanine-based supramolecular assemblies to be discussed in later sections.  NNNNHN H H NONO CH3H NHN N NNO1 34 HHH NONNHHGA T C16 3 28   Figure 1.6 a) Tautomeric base pairing between guanine and thymine (top) and between adenine and cytosine (bottom). b) Hoogsteen base pairing between 9-methyladenine and 1-methylthymine.  1.2.4 X-ray crystal structure of DNA Several problems impeded the unambiguous authentication of the structure of DNA at the time of Watson and Cricks' discovery. Direct observation techniques of biological molecules, such as X-ray crystallography were still in their infancy and required considerable time, effort and material to perform. No synthetic methodologies yet existed that could prepare measurable quantities of short, custom-sequence oligonucleotides for crystallization. Hence, the true structure of DNA proved elusive for almost three decades until Dickerson and co-workers reported the first X-ray crystal structure of a B-DNA duplex featuring the self-complementary dodecameric sequence d(CGCGAATTCGCG) that includes the six-base pair target sequence (GAATTC) of EcoRI, a restriction endonuclease (Figure 1.7).24, 25 The structure was found to be NHN N NNO HHHG 16 NONO CH334 THNNNNHN H H1A NONNH C3 2Ha) NN N N NH3CH H NO N OCH3Hb)9  identical to the Watson-Crick model of B-DNA with the sole exception of base pair orientation, showed to be twisted slightly off-planar in a propeller-like configuration.   Figure 1.7 X-ray crystal structure of DNA dodecamer d(CGCGAATTCGCG) (PDB: 1BNA) showing the double helix. Visualization rendered with USCF Chimera molecular modeling software.26  1.3  Supramolecular nucleobase assemblies in DNA  1.3.1 G-quartets and quadruplexes The propensity of guanine to self-assemble is well-known, owing to its π-electron rich molecular surface and terminally located dipoles encouraging stacking and planar end-on 10  interactions. Empirical evidence of aggregation in vitro was first detected in the form of aqueous gels where solutions of guanosine exhibited this unusual property in the presence of K+.27 In 1962, Gellert and co-workers reported analogous gel-forming activity of guanosine monophosphate (5'-GMP) at varying pH values and concentrations in the presence of sodium salt.28, while K+ and Sr2+ were later found to also induce 5'-GMP gelling with higher thermal stability.29 It was proposed that the GMP residues self-assemble into planar tetrads supported by a network of hydrogen bonds, attaining higher order structure by stacking atop one another to form quadruplexes. In this model, tetrad formation involves a series of eight Hoogsteen hydrogen bonds. Each guanine base contributes a pair of hydrogen bond acceptors (O6 and N7) and a pair of donors (amino H and H1) that are positioned almost 90º relative to one another, giving rise to a four-fold centrosymmetric system (Figure 1.8a). The cation lies within the central cavity, coordinated by O6 of each base. Quadruplex formation ensues with individual quartets engaging in a helical π-stacked fashion approximately 3.25 Å apart with cation positioning dependent on its size (Figure 1.8b). Thermodynamic studies and in silico modeling have determined cation selectivities in the order Sr2+>K+>Na+≥Rb+>Li+>Cs+.30 Apart from size and charge density, the energies of ligand coordination and hydration are implicated.31, 32  11   Figure 1.8 a) Hoogsteen hydrogen-bonded G-quartet. b) Helical stack of G-quartets to form a G-quadruplex with a sandwiched central cation coordinated by the O6 atom of each guanine base in a square antiprismatic geometry.  Structural proof of G-quadruplexes was provided by X-ray diffraction studies on poly(G)-containing RNA fibers. Zimmerman and co-workers reported the observation of parallel tetra-stranded G-quadruplexes (Figure 1.9a).33 The data supported Gellert's planar, fourfold-symmetric quartet model and concerted hydrogen bonding mode, as well as the stacked quadruplex assembly. Geometric measurements revealed a right-handed helicity of approximately 31º per quartet layer. Spatial constraints within this arrangement lead to the adoption of the C3'-endo puckering of the ribose sugar unlike that of ideal B-DNA. Subsequent studies on monomeric GMP co-crystallized with NaCl revealed that individual nucleotides unbound to phosphate-sugar backbones are likewise able to form quartet and quadruplex assemblies,34 demonstrating their profound thermodynamic stability.  G-quadruplexes formed from single and double-stranded oligonucleotides may display fully parallel or both parallel and anti-parallel G repeats, interspaced by non-G linkers providing NHN N NNO H HH NHN NNNO H H HHN NNN N OHHH HNNNN N OHH HG G GGa) b) Mn+7 6112  for hairpin loop formation. Sen and Gilbert characterized an intramolecular G-quadruplex stabilized at physiological salt concentrations with all four component poly(G) strands parallel,35 similar to Zimmerman's system, while Williamson et al. reported an unusual tandem parallel/anti-parallel structure formed made possible by the appropriate syn/anti conformational switches of the guanine bases in each tetrad (Figure 1.9b).36 Sundquist and Klug observed an anti-parallel bimolecular system (Figure 1.9c).37 Subsequent investigations led by Sen probed the role of cations in determining the directional sense of G-quadruplex assemblies.38   Figure 1.9 a) Cartoon representations of several G-quadruplex patterns. a) All-parallel system derived from poly(G) strands reported by Zimmerman. b) Intramolecular antiparallel system of d[(T4G4)4] reported by Williamson. c) Sundquist's bimolecular antiparallel system adopted by d(T2G4T2G4)2 strands. Guanine bases are represented by blue slabs.   5' 5' 5' 5'3' 3' 3' 3' 5' 3'T4T4T45' 3' 3' 5'T2 T2a) b) c)13  1.3.1.1  Telomeric G-quadruplexes In the "end replication problem",39-41 repeated replication of somatic cells results in the gradual truncation of chromosomal DNA at their telomeric end regions due to the inability of DNA polymerase to synthesize the terminal 5' end of the lagging strand without an upstream 3'-hydroxyl group, leaving a characteristic overhanging flap at the 3' end of the leading strand. Over time, this leads to cell senescence and eventually apoptosis unless the excised portion is restored by the action of telomerase. Overexpression of this enzyme results in the unregulated repair of the telomeres, thus immortalizing the cell and ultimately leading to the uncontrolled cell replication and growth characteristic of cancer. The G-richness of the telomeric strand, especially the 3' overhanging region of between 100 – 200 bases in length,42, 43 confers it a high propensity for G-quadruplex formation, thereby implicating these structures in telomerase activity regulation.44 This has led to the design of ligands capable of binding and stabilizing G-quadruplexes as potential anticancer drugs.45-47 The inhibition of DNA helicases involved in recombination by these ligand-quadruplex adducts further evidences the crucial role played by G-quadruplex stability in regulating cell lifespan and replication.48 Prior to the characterization of human telomeres, studies by Blackburn identified the 6-bp telomeric repeat sequence d(TTGGGG) of Tetrahymena,49 although it was still uncertain if the leading or lagging strand was G-rich. The realization that telomerase is in fact a ribonucleoprotein functioning as a reverse transcriptase helped answer that question and address the end replication problem.50, 51 The RNA component of Tetrahymena telomerase was found to contain the sequence r(AACCCCAAC) allowing targeting of the 3' overhang of the leading strand via a 3-bp, codon-like complementary base-pairing. Once in place, polymerase function 14  proceeds to fill in the remaining positions corresponding to a repeat unit. Subsequent cycles of translocation and polymerization gradually replenish the G-rich leading strand, now positively identified as the telomeric strand. Elongation of the C-rich lagging strand is then carried out by the action of DNA polymerase via Okazaki fragments.  Figure 1.10 a) Schematic of DNA replication resulting in a 3' overhanging region of the lagging parent strand. b) Schematic of Tetrahymena telomere repair by the reverse transcriptase mechanism of telomerase. AACCCCAAC5' 3'5'3'3'5' 5'3'5'3'5' 3'5'3'3'5'UnwindingDaughterstrandsynthesis leading lagging Removal ofRNA primersLigation 5'3'5' 3'5'3'3'5' 3' overhangTTGGGGTTG5' 3'3' GGGTTGElongation AACCCCAAC5' 3'TTGGGGTTG5'3'Translocation GGGTTGAACCCCAAC5' 3'TTGGGGTTG5'3' GGGTTG ElongationGGGTTGAACCCCAAC5' 3'TTGGGGTTG5'3' GGGTTGGGGTTG DissociationPolymerase AACCCCAACTTGGGGTTG5'3' GGGTTGGGGTTGCCCAACCCCAAC 3'5'a)b)15  In 1988, Moyzis and co-workers successfully elucidated and cloned the human telomeric repeat d(TTAGGG) which spans over a range of approximately five to eight kilobases.52 Studies in which the fluorescent-labelled telomeric chimera d[(GGGTTA)7•(TAACCC)7] was exposed to the chromosomal material of 91 extant eukaryotic species including humans found their unanimous incorporation into the telomeres, suggesting that the sequences are highly conserved throughout all vertebrates thought to be descended from a common ancestor.53 As with Tetrahymena, telomere repair in humans is mediated by a ribonucleoprotein-based telomerase, differing only in respect to the RNA recognition sequence being the eleven base-pair r(CUAACCCUAAC).54 Discrete telomeric repeat sequences have been shown to spontaneously adopt G-quadruplexes in both the solid and solution states. Kang and co-workers solved the first high resolution X-ray crystal structure of the Oxytricha sequence d(GGGGTTTTGGGG) in the presence of K+ to reveal a bimolecular, antiparallel G-quadruplex with the two strands adjacent and the poly(T) spacers constituting hairpin loops extending laterally out of the quadruplex core (Figure 1.11a).55, 56 Individual bases in each strand were found to alternate between the syn and anti glycosidic bond conformations. Interestingly, with Na+ in the solution state, a remarkably different over-and-under arrangement is adopted with the two hairpin loops diagonal, as characterized via NMR (Figure 1.11b).57 This conformational switching was attributed to the cation effect.58 The crystal structure of the Tetrahymena telomeric repeat d(TGGGGT) was subsequently elucidated by Laughlan and co-workers. The resultant G-quadruplex from this sequence features a tetra-stranded fully parallel framework with all bases in the anti 16  conformation. Stabilizing Na+ ions are positioned coplanar with each G-quartet layer (Figure 1.11c).59 Wang and Patel provided the first structural analysis of the 22-mer human telomeric repeat d[AGGG(TTAGGG)3] in solution via NMR and in silico molecular dynamics simulations.60 The intramolecular Na+-bound G-quadruplex displays alternating parallel and antiparallel poly(G) runs with sequential lateral and diagonal hairpin loops. Nearly a decade later, Parkinson and co-workers presented the first crystal structures of the 22-mer repeat as well as the shorter 12-mer sequence d(TAG3T2AG3T) in the presence of K+ (Figure 1.11d).61 Contrary to expectations, both the resulting intra- and intermolecular G-quadruplexes were found to be fully parallel, maintained by the hairpin loops linking the top of one poly(G) strand to the bottom of another. Consequently, the loops protrude out the sides of the vertical quadruplex scaffold in a propeller-like configuration. All the guanine bases were found to be in the anti conformation with C2'-endo sugar puckering in effect throughout. Consistent with earlier studies, the K+ ions are sandwiched between G-quartet layers and coordinated to the eight carbonyl O6 atoms in the square antiprismatic geometry.      17   Figure 1.11 a) X-ray crystal structure of Oxytricha telomeric sequence d(G4T4G4) (PDB: 1D59). b) Schematic of diagonal bimolecular over-and-under G-quadruplex adopted by Oxytricha sequence in solution with Na+. c) X-ray crystal structure of Tetrahymena telomeric repeat d(TG4T) with sandwiched Na+ (PDB: 244D). d) X-ray crystal structure of shortened human telomeric repeat d(T TAG3TTAG3T) with sandwiched K+ (PDB: 1K8P). Crystal structures rendered with UCSF Chimera.  18  1.3.2  The i-motif The structure-forming potential of C-rich sequences was recognized not long after the discovery of G-quadruplexes. In 1963, Langridge and Rich proposed from X-ray fiber diffraction experiments the possibility of poly(C) oligonucleotides adopting duplexes held together by hemiprotonated C•CH+ base pairs at low pH (Figure 1.12a).62 This novel base pairing was later found to be present in the X-ray crystal structure of acetylcytosine,63 and subsequently in solutions of poly(C) RNA64, 65 and DNA.66 Nearly three decades later, NMR studies by Gehring ascertained the solution structure of the so-called i-motif adopted by the sequence d(TC5) as a tetraplex featuring an intricately intercalated 'zipper' of C•CH+ base pairs provided by two component duplexes (Figure 1.12b).67 Both strands within each duplex were shown to be parallel, and both duplexes are oriented anti-parallel respect to each other. Right-handed helicity confers a twist of roughly 16º between base pairs on each duplex while cross-duplex base pairs are positioned orthogonally. The helical axis runs through the middle of all the base pairs.  The first crystal structure of an i-motif was delivered by Chen and co-workers of d(C4),68 revealing the expected intercalated C•CH+ base pairs and directional sense of the strands (Figure 1.13a and b). Consistent with the solution structure, the helical twist was ascertained to be right-handed with an approximate 12.4º offset between layers. All bases were found to be in the anti conformation and sugar puckering was variable depending on their positions within the molecule, with the C4'-exo configuration being in majority. This allows some degree of structural freedom within the framework. Interestingly, base stacking was found to involve only the exocyclic heteroatoms (O2 and N4) as auxiliaries of the greater π-ring system, resulting in a 19  3.1 Å helical rise as opposed to 3.4 Å for B-DNA. Similar geometries have been documented in other pyrimidine-based structures.69  Figure 1.12 a) A hemiprotonated C•CH+ base pair, the building block of i-motif architectures. b) Example of an i-motif: Schematic of an alternating parallel/antiparallel tetra-stranded structure adopted by d(TC5) showing the intercalated hemiprotonated cytosine base-pairs. Blue and grey slabs represent cytosine and thymine bases respectively. In 1995, the crystal structure of d(TAACCC), the vertebrate C-rich telomeric repeat was reported by Kang and co-workers,70 describing a largely analogous intercalated C•CH+ region to a previous study on d(CCCT) (Figure 1.13c).71 However, helical rotation is inhomogeneous throughout, with an average of 19.7º. The C3'-endo sugar pucker features predominantly. N ONNH H NONNHHHC C5 '5 '3' 3'5 '3' 3'5 'a) b)20  Interestingly, an intramolecular Hoogsteen A•T base pair exists in each strand, greatly stabilizing the overhanging hairpin loops. In addition, intermolecular Watson-Crick A•T base pairs between duplexes serve to lock the overall structure in place. Five years later, the solution structure of the extended 22-mer sequence d[(CCCTAA)3CCCT] was solved by Phan and colleagues.72, 73 The intramolecular i-motif identified presented a distinct major and minor groove bridged by the 3-bp AAT linkers.  Figure 1.13 a) X-ray crystal structure of all-parallel d(C4) i-motif tetraplex (PDB: 190D). b) Ditto. View down helical axis. c) X-ray crystal structure of bimolecular i-motif derived from d(TAACCC) (PDB: 200D). Intermolecular A•T base pair is represented by red adenine and green thymine residues. Crystal structures rendered with UCSF Chimera. 21  An anomalous i-motif assembled from the Tetrahymena telomeric repeat d(AACCCC) features unusual terminal adenine clusters made out of A•A base pairing between residues of adjacent strands.74 The hydrogen bonding mode involves novel amino to N7 interactions giving rise to a rather complicated tetraplex in which the poly(C) regions extend out of an interwoven central adenine core (Figure 1.14).  Figure 1.14 X-ray crystal structure of Tetrahymena telomeric repeat d(AACCCC) showing central i-motif core flanked by terminal adenine residues capable of intermolecular base-pairing (PDB: 294D). Rendered with UCSF Chimera.  22  1.3.3  Lipophilic G-quartets and quadruplexes The biological significance of G-quadruplexes has prompted the preparation and study of synthetic analogous systems as model systems.75 A number of these studies have entailed the derivatization of the guanosine subunits, largely affecting their solubility in water at physiological conditions and necessitating the use of organic solvents. As discrete G-quartets are never found in nature due to their instability, their construction in vitro has been made possible only with the use of substrate control or template molecules. Sessler reported cation-free G-quartets assembled from an unnatural guanosine derivative in which the guanine moiety is blocked at the C8 position with a bulky dimethylaniline group (Figure 1.15a).76 The added steric bulk drives the adoption of the syn configuration and in turn G-quartet formation. Under normal circumstances, guanosine monomers tend to aggregate into linear 'ribbons'. A guanosine-bound calix[4]arene dimer reported by Davis represents one of the pioneering examples of templated G-quartets (Figure 1.15b).77 Each conjugate bore four guanosine residues covalently linked to a calix[4]arene macrocyle in a 1,3-alternate fashion. Quartet formation proceeds via end-on interaction between two guanosines of each subunit in the presence of either metal cations or in hydrated CDCl3. This system was found to perform well as an ionophore for extracting cations into organic solvent. Several years later, Nikan and Sherman provided the first examples of fully lipophilic template-assembled synthetic G-quartets (TASQs) (Figure 1.15c).78 In these systems, four guanosine subunits were covalently linked to the rims of rigid resorcinol-based cavitands bearing aliphatic pendant 'feet' to confer lipophilicity. Remarkably, in the absence of cations, the guanine bases spontaneously assemble into a quartet  23   Figure 1.15 a) Cation-free G-quartet derived from syn-configured guanosine units. b) Bimolecular G-quartet supported by calix[4]arene templates. c) Cation-free G-quartet preorganized by a resorcinol-based cavitand. NHNN O NH2NO ORORRO(H3C)2N HN N NOH2N NO ORORRO N(CH3)2anti syn NN N NAO H HH NN NNNO H H HN NNN N OHHH NNNN N OHH HAr Ar ArArcation-free G-quartetOO OOBuO OBu OBuBuO O HN NHNN ONH2NOTBSOTBSOONHHN NNOH2N N O OTBSOTBS O NHHNNNO NH2NO OTBSOTBSONHHNN NOH2N NOTBSOTBSO OO ORR O RRGG GG OO ORR O RRGG GGXX X = M+, H2Ob)a)OO O OO O O OC11H23 C11H23C11H23 C11H23O OOONNNOO O NNNOO O NNN O O O N NN OO OHN NNNO NH2 NHNN N O NH2HNN N NOH2NHN N NNOH2Nc)24  in CDCl3 at ambient conditions as evidenced by NMR. Subsequent cationic studies determined quartet assembly with Na+, K+ and Sr2+, while interestingly Cs+ affords a dimeric quadruplex.79 More recently, Monchaud reported the assembly of G-quartets on EDTA-based80 as well as porphyrin81 templates. These 'DOTASQs' and 'PorphySQs' display strong G-quadruplex affinities that mimic natural ligand binding modes. Synthetic lipophilic G-quadruplexes have been prepared from modified guanosine monomers. One of the earliest examples was reported by Davis and Gottarelli comprising two stacked G-quartets of 3', 5'-didecanoyl-2'-deoxyguanosine units, stabilized by a sandwiched, octacoordinated K+ ion in the canonical square antiprismatic fashion.82 A larger hexadecameric assembly involving four stacked quartets of 5'-silyl-2', 3'-O-isopropylidene guanosine units in the presence of K+ and Cs+ picrates was crystallized from CDCl3.83 The X-ray crystal structure shows three K+ ions sandwiched between the quartet layers while a single Cs+ ion rests atop the terminal quartet. Further stabilization is provided via novel hydrogen bonding between the guanosine amino protons uninvolved in Hoogsteen hydrogen bonding and the four picrate counteranions (Figure 1.16). Interestingly, the cations lie co-linearly along the central axis forming an ion channel. Its utility as an ionophore has been demonstrated. Further investigations showed that in the presence of divalent cations such as Sr2+ and Ba2+,84, 85 spontaneous modification of the assembly occurs to provide a complex composed of two cation-stabilized octads. The reduced number of cations is attributed to their greater electrostatic repulsion. On the other hand, a more stable quadruplex is ensured with the increased positive charge density.   25   Figure 1.16 G-quadruplex assembled from lipophilic guanosine subunits in the presence of K and Cs picrates. Picrate 'clip' further stabilizes the system.  The crystal structure of a lipophilic G-quadruplex derived from the dimerization of two TASQs was reported by Nikan and Sherman.86 Face-on dimerization of the G-quartets sandwiches a Na+ ion in an encapsulated supramolecular system.  1.3.4  Pyrimidine-based quartets The search for novel structures besides the ubiquitous guanine and cytosine-based motifs discussed so far is of importance because of their possible involvement in overall structure stability. Advances in analytical and computational techniques have allowed the identification and characterization of several unnatural quartet assemblies.  Uracil (U)-quartets were first reported by Cheong and Moore in an RNA quadruplex of sequence r(UGGGGU) in the solution state (Figure 1.17a).87 NMR studies located the U-quartet at the 3' end of the all-parallel structure, assembled via imino H3•O4 hydrogen bond contacts K+K+K+Cs+ N HN H O- N+O- O N+O-ON+O- ONHNN O NH2NO OOTBSO K/Cs(pic)CHCl326  between each of the uracil bases (Figure 1.17b). This arrangement positions the imino proton and H5 of adjacent bases within range for NOE interaction, resulting in a characteristic cross-peak on the 2D NOESY spectrum. Several ab initio studies have correlated this bonding mode to an energy minimum.88-90  Figure 1.17 a) G-quadruplex scaffold (blue) capped by a 3' end U-quartet (red). b) U-quartet with imino to O4 hydrogen bonds. NOE interaction between imino and H5 of neighboring base is shown with a red arrow. U-quartets have also been unambiguously identified in the solid state. Lippert reported the crystal structure of a 1-methyluracil/sodium tetrachloroaurate adduct showing the bases arranged in a planar quartet with the expected imino H3•O4 hydrogen bond framework.91 Na+ is positioned in-plane within the central cavity and is coordinated by the O4 atoms in a square planar geometry. A more recent report documents U-quartets formed out of 1-hexyluracil NN OO HNN OO H N NO OHN NOOHRR RR3 443 334 4H5H6H5H6 H5 H6H6H5U UU U5' 5' 5' 5'3' 3' 3'3'U U U Ua) b)27  subunits and stabilized in the presence of heavy, non-essential Ag+.92 The cations are located out of plane and coordinated to the O4 atoms in a square pyramidal fashion. Organization within the lattice is reminiscent of lipid bilayers with the hydrophobic n-hexyl chains buried exposing the U-quartets. Deng and Sundaralingam presented the first crystal structure of a U-quartet as part of a quadruplex derived from r(UGGGGU) in the presence of Sr2+.93 As with the solution structure,87 the U-quartet was found at the 3' end. A notable difference, however, observes the uracil bases tapered inwards into the central cavity at an approximately 30º incline. Maintaining this conformation is the anti glycosidic conformation of the bases and C2'-endo sugar puckering. Sundaralingam subsequently observed a Na+-bound U-quartet at the 3' end of a guanine-modified tetraplex r(UBrdG)r(AGGU), where BrdG represents 8-bromodeoxyriboguanine.94 Geometric properties of the quartet are similar with the Sr2+-based system with further stabilization from water bridges connecting O2 on uracil and a phosphodiester oxygen atom.  In 2010, Xu et al. showed that the quadruplex r(UAGGGU)4 containing a 3' end U-quartet is significantly more thermally stable than the modified sequence r(UUAGGG) without one.95 Replacement of the uracil O4 atoms with sulfur resulted in structure destabilization, confirming not only the role of the U-quartet in overall quadruplex stability, but also the involvement of O4 in quartet formation.  Like uracil, thymine has been shown to exhibit quartet formation via the imino H3•O4 hydrogen bonding mode. Computational studies by Gu and Leszczynski revealed a higher stabilization energy for a non-planar T-quartet and assigned stronger hydrogen bonding for an off-planar, propeller twisted-type configuration compared to an ideal plane.89 Adoption of this conformation is a consequence of the additional steric bulk introduced by the 5-Me groups. 28  Nevertheless, T-quartets have been observed, albeit incorporated in pre-existing G-quadruplex scaffolds. Patel and Hosur solved the NMR solution structure of quadruplex d(TGGTGGC)4.96 Observed NOE correlations between the imino H3s and 5-Me protons of the T4 residues confirmed the presence of the internal T-quartet. Molecular dynamics simulations predicted its conformation to be in agreement with Gu and Leszczynski's model. T1 residues were found to adopt a quartet at low pH (5.0) and temperature (5 ºC).  The crystal structure of d(TGGGGT)4 co-crystallized with Na+ and Tl+ reported by Subirana et al. reveals a lattice consisting of stacked quadruplexes, their interfaces at which are located T-quartets stabilized by slightly off-planar Na+ cations while Tl+ is distributed throughout the G-quadruplex regions.97 A single unit is shown in Figure 1.18. Consistent with previous findings the quartets assume the propeller-twisted configuration. More recently, Sket and Plavec solved the solution structure of the same quadruplex, revealing a T-quartet at the 5' end.98 Interestingly, on replacing the 5' end thymines with uracils, a stacked quadruplex dimer ensues sandwiching a U-quartet, similar to that of the crystal structure reported by Deng and Sundaralingam for r(UGGGGU)4.  29   Figure 1.18 Crystal structure of d(TG4T)4 (PDB: 1S47) with top thymine quartet (blue) coordinating a Na+ ion (orange) capping a G-quadruplex scaffold stabilized by Tl3+ ions (red).  Rendered with UCSF Chimera.  1.4  Thesis aim and goals With ever-increasing evidence of the intrinsic role of hitherto poorly documented and understood uncommon nucleobase motifs, the impetus for this thesis arose from the standpoint of their in vitro construction via a synthetic organic approach for characterization and study. Our group has in recent years demonstrated the profound templating ability of resorcinol-based cavitands. With this in mind, could the substrate scope of these templates be expanded to include the rare pyrimidine tetrads like uracil and thymine? Could a degree of complexity be added by the installation of the corresponding quadruplexes? It is hoped that the synthesis and study of these systems might bestow on them more attention and shed more light on their topological significance. 30  Chapter 2: Synthesis and Characterization of a Template-Assembled Synthetic U-Quartet  2.1  Synopsis The present study documents the design and synthesis of tetra-coupled uridine-cavitand conjugate 1 (Figure 2.1). Characterization was carried out using NMR and CD spectroscopic techniques to obtain evidence of the adoption of an unprecedented cation-free U-quartet by the pendant uracil moieties under lipophilic conditions. The system showcases the chemical versatility of cavitands to adapt to different solvent environments and accept a wide range of substrates. Their profound ability to preorganize discrete units of otherwise unstable nucleobase motifs with well-defined topology is also reflected. These assemblies may serve as models for thermal and kinetic stability studies.   Figure 2.1 Side-on representation of conjugate 1.  O OC11H23 C11H23 O OC11H23C11H23O O O OO O O ONNNOO OHN NOO NNNOO O HNN OO NNN O O OHN NO O NNN O O OHNNO O131   2.2 CPK modeling studies To assess the feasibility of a quartet assembly adopted by the four uracil bases of 1 , a space-filling Corey-Pauling-Koltun (CPK) model was constructed and examined to obtain information on conformational characteristics and pinpoint the presence of possible steric and electrostatic interactions. With glycosidic bond angles set to anti, the predominant conformation in native nucleic acids, the model revealed that a planar U-quartet could in fact be assembled over the rim of the cavitand architecture without torsional or steric strain. This arrangement also projects the hydrophobic isopropylidene groups installed on the ribose ring outwards into the extraneous environment, which may further promote its assembly under lipophilic conditions. The potential for ring stacking between the uracil and underlying triazole rings was also demonstrated, allowing for π-π interactions that may further stabilize the scaffold.  2.3  Synthetic strategy Towards the synthesis of 1 , a convergent strategy was employed that involved first the preparation of cavitand 7  and 5'-azido-2', 3'-O-isopropylidene uridine 10 . Preparation of 7  was carried out in five steps according to literature procedures (Scheme 2.1).99 Acid-catalyzed electrophilic aromatic substitution of resorcinol 2  with dodecanal provided resorcinarene octol 3  in quantitative yield. Treatment with N-bromosuccinimide (NBS) yielded the brominated derivative 4 , whereupon it was heated with bromochloromethane in the presence of K2CO3 as a base in a sealed pressure tube to afford the fully bridged cavitand 5  expediently.100 Halogen-lithium exchange with n-butyllithium followed by the addition of trimethyl borate B(OMe)3 and subsequent H2O2 oxidation gave tetrol 6 . Final treatment with propargyl bromide with K2CO3 base provided the propargylated cavitand template 7 . 32    Scheme 2.1 Synthesis of cavitand 7.  Synthesis of 10101 began with the acetalization of uridine 8  with acetone in the presence of mineral acid catalyst to afford 2',3'-O-isopropylidene derivative 9 . Treatment with CBr4, PPh3 and NaN3 in a modified Mitsunobu procedure gave access to 10  in good yield (Scheme 2.2).  OHHO MeOH, refluxH+ (cat.)C11H23 O H C11H23OHHO 4 2-butanoneNBSC11H23OHHO 4Br THF, – 78 oCn-BuLiB(OMe)3H2O2/NaOHCH2BrClK2CO3DMSO, 90 oCsealed tube C11H23O 4BrOC11H23O 4OHO BrK2CO3acetone, reflux C11H23O 4OO2 34 56 733   Scheme 2.2 Synthesis of 5'-azidouridine 10.  2.3.1 Conjugation via the "click" reaction The Cu(I)-catalyzed azide-alkyne cycloaddition between azides and alkynes is the quintessential "click" reaction (Scheme 2.3) and provides a 1,4-disubstituted 1,2,3-triazole product exclusively. Developed by K. B. Sharpless in 2002,102 the reaction involves the in situ reduction of an inorganic Cu(II) precatalyst by an appropriate reductant, most commonly sodium ascorbate. The resultant reactive Cu(I) species metalates the terminal alkyne position to form a Cu(I)-acetylide complex, which interacts with the azide reactant to initiate the catalytic cycle. The overall result is the coalescing of the azide and alkyne moieties to close the triazole ring. Density functional theory (DFT) studies have delivered a plausible mechanism for the reaction.103   Scheme 2.3 A general 1,4-regioselective "click" reaction. NHO ONO OHOHHO H2SO4 (cat.)acetone, reflux NHO ONO OOHO CBr4PPh3NaN3DMF, rt NHO ONO OON38 9 10R1 N3 + R2 Cu2+ (cat.)Na ascorbatesolvent NNNR1 R21,4-regioisomer34  The forerunner of the "click" reaction is the Huisgen reaction, a thermally driven 1,3-dipolar cycloaddition between alkyl azides and terminal alkynes.104 Pioneered by Rolf Huisgen, an early example is shown in Scheme 2.4 with the reaction between benzyl azide 11 and phenyl propargyl ether 12  to provide a mixture of 1,4 and 1,5-disubstituted triazoles 13  and 14  in close to a 1:1 ratio. The major shortcoming of this reaction is its lack of regioselectivity, which is circumvented by the Cu-catalyzed variant. The reaction therefore sees extensive use in bioconjugation where regioselectivity is imperative. Practical advantages include its robustness and versatility. It proceeds in a wide range of solvents and tolerates numerous functional groups. In addition, the reaction proceeds cleanly and is completely atom economical, facilitating work-up procedures.   Scheme 2.4 Example of a thermal Huisgen cycloaddition.  The key step for the synthesis of conjugate 1  employed the Cu(I)-catalyzed "click" reaction between the alkynyl and azide moieties of 7  and 10  respectively. The use of this reaction is desirable for several reasons: The length of the triazole backbone introduced between the nucleosides and the cavitand platform confers some measure of conformational flexibility. The π systems of the triazole and uracil rings could potentially participate in stabilizing stacking interactions. Ph N 3 + O Ph neat, 92 ºC NN NPh OPh + NN NPh OPh1 4 1 511 12 13 141.6                :                 135  In the presence of a catalytic amount of copper (II) sulfate with sodium ascorbate as the reductant, the reaction between 7  and 10 proceeded smoothly under mild heating in DMSO to afford 1  in moderate yield (Scheme 2.5). MALDI-TOF mass spectrometry confirmed its identity as the tetra-coupled species. The compound was found to exhibit good solubility in chloroform and methanol.   Scheme 2.5 Synthesis of conjugate 1.  2.3.2 Synthesis of N-methylated conjugate For subsequent control experiments, conjugate 17 was designed and prepared (Scheme 2.6). Methylation of all uracil imino positions in this molecule precludes hydrogen bonding, both intra- and intermolecular, thus preventing quartet assembly as well as higher-order aggregation. The synthetic procedure was identical to that of 1  with the exception of the extra N-methylation step of 9  to provide 15 , and finally 16 .  C11H23O 4OO + NHO ONO OON3 cat. Cu2+Na ascorbate C11H23O 4O ONNN NHO ONO OODMSO, 60 ºC 17 1036   Scheme 2.6 Synthesis of a) azide 16 and b) conjugate 17.  2.4  NMR characterization studies  2.4.1  1H NMR signal assignment Being symmetric and synthesized from enantiomerically pure starting materials, conjugates 1  and 17  display a single set of 1H NMR resonances in both CDCl3 (Figures 2.20 and 24) and DMSO (Figures 2.22 and 2.26). Signal assignment was performed with the use of 1H and 1H-1H COSY NMR (spectra provided in the Experimental Section), with 1H-1H NOESY employed to reveal important spatial characteristics and regiochemistry. Conjugate 17  was assigned and characterized in all manners identical to 1 , and therefore will not be discussed in NHO ONO OOHO 9 MeIK2CO3DMF-acetone,reflux NO ONO OOHO 15 Me CBr4PPh3NaN3DMF, rt NO ONO OON3 16 MeC11H23O 4OO + NO ONO OON3 cat. Cu2+Na ascorbate C11H23O 4O ONNN NO ONO OODMSO, 60 ºC 177 16 MeMea)b)37  the following sections. Figure 2.2 shows the condensed structure of 1  with all protons labeled. Important COSY correlations are illustrated in Figure 2.3.   Figure 2.2 Condensed structure of 1 with protons labeled.   Figure 2.3 Expected COSY correlations in a) the cavitand moiety, between Hin/Hout and Hd/methylene 'foot', b) the nucleoside moiety,  amongst ribose protons and H5/H6 on uracil.  C11H23O 4O ONNN NO ONO OOH5 H6 H1'H2'H4' H3'HcH5b'H5a'HaHb HoutHinArH HdHiminoO 4O O NO ONO OOH3C CH3H5H6 H1'H2'H4'H3'H5b'H5a'HoutHinArH Hd HiminoC10 H21 HHa) b)38  The acidic Himino proton is expected to have the largest chemical shift. Deuterium exchange with CD3OD results in complete signal loss, confirming its identity (Figure 2.4). H5 and H6 are readily identified by their relatively large coupling constants (3J ~ 8.0 Hz) typical of cis-alkene protons. H6 is located downfield of H5 due to its proximity to the electronegative N1 atom of uracil as well as the resonance effect of the enone.   Figure 2.4 Himino signal is quenched on exchange with CD3OD.  The ribose ring protons follow the Karplus rule governing coupling constant magnitude and COSY crosspeak intensities.105, 106 This is especially evident in the H1'/H2' and H3'/H4' interactions, where their approximately orthogonal dihedral angles cause attenuation or loss of signal intensity. In other cases non-orthogonal (H4' to H5a'/H5b') and near-eclipsed (H2' to H3') protons give rise to clearly visible and intense crosspeaks respectively. Representative examples are shown in Figure 2.5. Assignment of this series of protons begins with H1', being most 39  deshielded and located furthest downfield. From this position, consecutively upfield assignments are made based on the appropriate COSY data.   Figure 2.5 Dihedral angles of a) H2' and H3', eclipsed and therefore yielding a 3J maximum and b) H1' and H2', close to orthogonal thus yielding a 3J minimum. –OR groups represent the isopropylidene moiety.  Within the cavitand scaffold, geminal coupling between the upper bridge methylene protons (Hin and Hout) results in a fairly large coupling constant (2J ~ 7.0 Hz) and strong COSY correlation. A large chemical shift difference separates them; Hout is located almost 2.0 ppm downfield of Hin, shielded by the anisotropic current of the cavitand as it extends inwards towards the cavitand cavity, while Hout projects outwards and is deshielded. The benzylic methine proton (Hd) on the lower cavitand bridge couples with its methylene neighbour on the long chain aliphatic 'foot'. The aryl proton (ArH) is assigned based on the typical chemical shift value of a benzene ring, although its proximity to Hd in space makes its unambiguous identification by 1H-1H NOESY possible (vide infra).  H1 'RO ring H H1 'ringH2' ringRO ORring H2' ??a) b)40  2.4.1.1  Signal assignment and regiochemical analysis by NOESY 1H-1H NOESY is a powerful tool that allows identification of proton correlations through space and is used extensively in structure elucidation and confirmation. As expected, the NOE spectrum of 1  reveals the correlation between ArH and Hd (Figure 2.6).   Figure 2.6 a) Portion of 400 MHz NOE spectrum of 1 in CDCl3 showing crosspeak between ArH and Hd. b) NOE interaction between ArH and Hd.  The triazole proton (Hc) is easily identified by NOE correlations with both pairs of flanking methylene linkers (Ha/Hb, H5a'/H5b') (Figure 2.7). This also confirms the 1,4-regiochemistry of the triazole moiety expected of the regioselective Cu(I)-catalyzed "click" reaction, as the distance between Hc and H5a'/H5b' in the 1,5-regioisomer exceeds that required for minimal NOE interaction (~ 5 Å).      41   Figure 2.7 NOE interactions in the a) 1,4 and b) 1,5-regioisomers of 1. c) Portion of 400 MHz NOE spectrum of 1 in CDCl3 showing NOE crosspeaks from Hc to H5a'/H5b' and Ha/Hb.  2.4.2  Summary of 1H signal assignments Remaining protons to be assigned include those of the isopropylidene methyl groups on the ribose sugar as well as the long aliphatic chain cavitand 'feet'. These protons are located in the typical alkyl chemical shift region. Tables 2.1 and 2.2 lists all protons in 1  and 17  with the corresponding COSY and/or NOESY data used in their assignment.      42  Proton δH CDCl3 (ppm) δH DMSO-d6 (ppm)  COSY correlation NOESY correlation Himino 10.74 11.46   H5 5.71 5.61 H6  H6 6.98 7.64 H5  H1' 5.62 5.77 H2'*  H2' 5.08 5.12 H1'*, H3'  H3' 5.04 4.89 H2', H4'**  H4' 4.58 4.40 H3'**, H5a'/H5b'  H5a' 4.75 4.75 H4', H5b'  H5b' 4.75 4.65 H4', H5a'  Ha 5.05 4.94  Hc Hb 5.16 4.94  Hc Hc 7.74 8.20  Ha/Hb, H5a'/H5b' Hd 4.77 4.58 -CH2- 'feet' ArH Hin 4.37 4.28 Hout  Hout 5.79 5.93 Hin  ArH 6.85 7.29  Hd -CH2- 'feet' 2.20 2.33 Hd  long chain 'feet' 1.29 – 1.38 1.24 – 1.30   terminal CH3 0.92 0.85   isoprop. CH3 1.29 1.29   * Expected but unobservable COSY signals. ** Very weak COSY signals.  Table 2.1 1H signal assignments of 1 in CDCl3 and DMSO-d6 at 25 ºC. 43  Proton δH CDCl3 (ppm) δH DMSO-d6 (ppm)  COSY correlation NOESY correlation N-Me 3.30 3.15   H5 5.74 5.75 H6  H6 7.18 7.70 H5  H1' 5.60 5.82 H2'*  H2' 5.04 5.13 H1'*, H3'  H3' 5.04 4.94 H2', H4'*  H4' 4.58 4.42 H3'*, H5a'/H5b'**  H5a' 4.67 4.76 H4'**, H5b'  H5b' 4.77 4.64 H4'**, H5a'  Ha 5.05 4.94  Hc Hb 5.05 4.94  Hc Hc 7.67 8.20  Ha/Hb, H5a'/H5b' Hd 4.67 4.58 -CH2- 'feet' ArH Hin 4.32 4.28 Hout  Hout 5.74 5.91 Hin  ArH 6.80 7.30  Hd -CH2- 'feet' 2.17 2.33 Hd  long chain 'feet', isoprop. CH3 1.25 – 1.28 1.25 – 1.28   terminal CH3 0.88 0.86   isoprop. CH3 1.54 1.47   * Expected but unobservable COSY signals. ** Very weak COSY signals.  Table 2.2 1H signal assignments of 17 in CDCl3 and DMSO-d6 at 25 ºC.  44  2.4.3  NMR solution structure The 1H NMR spectra of 1  show a significant downfield shift (~ 1 ppm) of Himino in DMSO-d6 (Figure 2.22) relative to CDCl3 (Figure 2.20), indicating a greater deshielded state therein. This is expected, as DMSO is a strong hydrogen bond acceptor. Any hydrogen-bonded assembly adopted by 1  in CDCl3 is therefore destabilized in DMSO. In order to obtain more evidence of structure in 1  in CDCl3, the 1H NMR spectrum of 1  was compared with that of free nucleoside 10  (Figure 2.8).   Figure 2.8 Portions of 400 MHz 1H NMR spectra of a) 1 and b) 10 in CDCl3 at 25 ºC.  A significant downfield shift from 8.3 to 10.7 ppm (ΔδΗ ∼ 2.5 ppm) for Himino occurs on attachment of the uracil moieties to the cavitand, indicating deshielding of these protons likely caused by hydrogen bonding in structure assembly. To probe the nature of this structure, NOESY was performed which revealed a crosspeak between Himino and H5 (Figure 2.9a), the key correlation used to authenticate U-quartets.87 The low intensity of this crosspeak suggests a 45  loosely coordinated U-quartet. On lowering the temperature to –20 ºC, Himino shifts further downfield to 11.5 ppm, close to that reported for the imino proton of guanine residues in the TASQs characterized by the Sherman group,78 thereby indicating a greater degree of hydrogen bonding and a more tightly associated quartet. The increased intensity of the Himino/H5 crosspeak further supports this notion (Figure 2.9b). This crosspeak is absent in free nucleoside 10 , demonstrating the necessity of the cavitand template in quartet assembly and rules out intramolecular NOE between the enol tautomer of uracil to H5 in 1 . Also, no crosspeak was detected between the N-Me and H5 protons of 17 as expected, showing the essential nature of the imino protons and thus hydrogen bonding in the assembly.   Figure 2.9 Portions of 400 MHz NOE spectrum of 1 in CDCl3 at a) 25 ºC and b) –20 ºC showing crosspeaks between Himino and H5.  Interestingly, the presence of a crosspeak between H6 and H1' (Figure 2.10a) indicates syn glycosidic bonds (Figure 2.10b). This is unexpected as such a configuration usually places the nucleobase and ribose moieties in direct steric conflict. In the case of uracil, the O2 atom would extend directly over the surface of the ribose ring. However, CPK modeling demonstrated 46  the feasibility of the syn configuration by accommodating O2 in a proton 'cleft' mapped out by H2', H3' and H5' (Figure 2.10c). This positions H6 and H1' in a co-planar fashion well within NOE range.   Figure 2.10 a) Portion of 400 MHz NOE spectrum of 1 in CDCl3 at 25 ºC showing crosspeak between H6 and H1' indicative of syn geometry. b) NOE connection shown between H6 and H1'. c) Model of a uridine residue in 1 showing fitting of the O2 atom in the 'cleft' traced by H2', H3' and H5' protons. H6 and H1' are coplanar.  As discussed in Section 2.2.1, stacking of the uracil and triazole rings is possible and deemed feasible by CPK modeling. These interactions may confer added stability to the U-quartet. Evidence for this stacking was provided by an NOE crosspeak observed between H6 and 47  Hc, positioning the two rings in close proximity (Figure 2.11a). No crosspeak is present between H5 and Hc due to their increased spatial distance exceeding the NOE threshold (Figure 2.11b).   Figure 2.11 a) Portion of 400 MHz NOE spectrum of 1 in CDCl3 at 25 ºC showing crosspeak between H6 and Hc indicative of ring stacking. b) Illustration of proposed U-quartet in 1 with uracil-triazole stacking. NOE between H6 and Hc is shown. Two appendages are displayed. Linkers are omitted for clarity.  2.4.4  Variable-temperature 1H NMR studies The thermal stability of the U-quartet was assessed by measuring its 1H NMR spectrum at temperatures ranging from –20 ºC to 55 ºC (Figure 2.12). As the temperature is increased, the most pronounced trend is the upfield shift of Himino to about 10.2 ppm at 55 ºC, reflecting its increasingly shielded state as a result of weakening hydrogen bonds not necessarily amounting to complete denaturation. 48   Figure 2.12 Variable temperature 1H spectra of 1 in CDCl3. 49  Small upfield chemical shifts are also observed for several non-exchangeable protons with increasing temperature (Hout: ΔδH = 0.08 ppm, H5: ΔδH = 0.08 ppm, H6: ΔδH = 0.07 ppm). These are likely caused by conformational changes arising from hydrogen bond weakening, positioning these protons further within the anisotropic field of the cavitand ring. Nevertheless, the VT spectra demonstrate that some of the integrity of the U-quartet is maintained at elevated temperatures.  2.4.5  Diffusion NMR studies Diffusion is the translational motion of particles through a liquid or gas. As part of independent studies on Brownian motion, Einstein and Smoluchowski first described the phenomenon as a function of temperature, now known as the Einstein relation (Equation 1). D = µ KBT                                                             (1) Where D and µ  denote the diffusion constant and mobility of the particle respectively. The Stokes-Einstein equation is a variant of the Einstein relation applicable to the diffusion of spherical particles in a liquid of low Reynolds number (Equation 2). D = KBT6??r                                                               (2) Where η represents the viscosity of the liquid and r is the hydrodynamic (or Stokes) radius of the particle. This equation therefore provides a good approximation of the Van der Waal's radius of a spherical particle if its diffusion constant D is known. As D is also proportional to molecular weight as determined by Chapman et al. (Equation 3),107 50  D1D2 = M2M13                                                              (3) the oligomeric state of the species can be determined by comparing its D value to that of a control compound, usually one that is structurally similar but incapable of intermolecular aggregation due to the lack of required functionalities.  Several methods exist for the experimental determination of D. Among them, diffusion-ordered NMR spectroscopy (DOSY) has distinguished itself in recent years due to its practical convenience and expeditious delivery of highly accurate measurements as a result of advances in NMR technology. The technique allows molecular diffusion to be quantified by the application of magnetic pulsed field gradients along the length of the sample.108 Most modern spectrometers are fitted with variable z-gradient probes to provide this capability. The basic gradient spin echo pulse (SE) sequence developed by Stejskal and Tanner applies a field gradient after the initial 90ºx radiofrequency pulse. The gradient causes a dephasing of magnetization. After a certain diffusion time Δ, a second field gradient is applied to refocus the magnetization (Figure 2.13). The physical translation of nuclei during Δ results in the attenuation of signal intensity,109 the degree of which depends on the durations of Δ and the gradient pulse (δ), as well as the gradient strength (g) as defined by the relation110 I = I 0 e ?D?2 g 2?2 (???3 )                                                    (4) where I denotes the observed signal intensity, I0 the original signal intensity, D the diffusion constant and γ the gyromagnetic ratio of the observed nucleus. Other pulse sequences have since been developed and are routinely used, such as the bipolar pulse longitudinal eddy current delay 51  (BPLED) sequence110 that compensates for physical phenomena such as eddy currents to improve data accuracy.   Figure 2.13 Schematic of a basic DOSY spin echo (SE) pulse sequence. Bulk magnetization is represented by a bolded arrow.  In a typical DOSY experiment, values of Δ and δ are adjusted via a series of 1D experiments to obtain at least 95% signal attenuation. With these optimized values, the 2D experiment is conducted with a linear gradient ramp, usually with 16 steps. This allows the fitting of the exponential curve of signal intensity versus gradient strength according to Equation 4. Figure 2.14 shows the curve fit of the H1' proton of 1  as an example. All DOSY measurements reported in this thesis are extracted from similar curves of selected protons for the corresponding z xy dephasingpulsed field gradient z xy diffusion (?)z xy rephasingpulsed field gradient z xySignal reduction dueto diffusion52  compounds. The diffusion constant D can then be extracted from the slope of the line plotted from Equation 5, derived from Equation 4. ln II 0 = ?D(2?? g ?)2 (?? ?3) = ?DQ                                               (5) More conveniently, the advent of software-based algorithms such as SimFit allows direct calculation of D values based on longitudinal (T1) and transverse (T2) relaxation times.   Figure 2.14 Signal intensity decay curve over 16 points for H1' proton of 1.  As a diagnostic tool for aggregation, DOSY has been used extensively by our group, as well as in the characterization of resorcinarene111, 112 and rosette-based oligomers113. The technique was employed to ascertain the unimolecular nature of 1  in CDCl3 and thus confirm the 53  existence of a singular, discrete U-quartet in solution. Solutions of 1  and 17  in CDCl3 at identical concentrations (2.7 mM) and temperatures (25 ºC) were analyzed. The H1' proton of each compound was observed and D values were calculated by the SimFit algorithm. Experiments were repeated thrice and the average values with standard error are tabulated in Table 2.3.      Table 2.3 H1' diffusion constants (D) of 1 and 17 in CDCl3 at 25 ºC (2.7 mM).  A diffusion constant ratio of close to unity shows that the oligomeric states of the two species are identical. Since 17  is unable to engage in hydrogen bonding, it can be concluded that both compounds are unimolecular in CDCl3 under ambient conditions.  2.4.6  Circular dichroism (CD) studies Chiral chromophores differentially absorb left and right circularly polarized light as a function of wavelength in a phenomenon known as circular dichroism (CD).114 The absorption difference can be measured spectroscopically. Asymmetric secondary structures adopted by chiral chromophores exhibit unique spectral profiles enabling characterization of such motifs as α-helices and β-sheets of polypeptides.115 Compound D (x10-10 m2 s-1) Ratio 1 3.71 ± 0.10 0.99 17 3.67 ± 0.10 54   Guanine has two absorption bands usually found in the middle-ultraviolet region at 250 and 279 nm attributed to π-π* transitions (2.15a).116, 117 Exciton coupling due to transition dipole moment alignment of stacked guanine residues in G-quadruplexes cause absorption band splitting into positive and negative CD signals, usually accompanied by signal intensification (Figure 2.15b). Studies on poly(G) systems have observed the positive exciton couplet at 260 nm and the negative at 240 nm.118-120 These characteristic properties allow identification of these assemblies by CD spectroscopy as an alternative to NMR techniques.  Figure 2.15 a) π−π* transition dipoles of a guanine base. b) Overlapping and exciton coupling of transition dipoles in a G-quadruplex.  In contrast, CD data pertaining to uridine is uncommon, and for U-quartets unknown. Eyring and co-workers provided the first spectral traces of uridine and its derivatives in several solvents.121 Consistent across all the measured spectra are absorption bands with maxima positioned around 200 and 270 nm. Evidence for π-π* transitions in effect was also presented, 250 nm279 nma) b)55  although the contribution of n-π* transitions was not ruled out. More recently, an extensive computational analysis supports the operation of π-π* transitions in both absorption bands.122  The CD spectrum of 1  in chloroform reveals a single positive absorption peak with λmax ~ 245 nm (Figure 2.16). Due to the absorption limit of chloroform, observation below 230 nm is not possible. The presence of a negative peak to suggest exciton coupling in a quartet thus could not be established. On switching the solvent to methanol, a bathochromic shift to λmax ~ 255 nm occurs along with signal dampening, suggesting quartet denaturation. To rule out solvatochromic shifting, spectra of 17  were obtained in chloroform and methanol and were found to be indistinguishable with λmax ~ 255 nm. It is noteworthy that the spectrum of 1 in methanol is identical to that of 17  in both chloroform and methanol. This indicates the nonexistence of a quartet in a methanolic solution of 1 .  Figure 2.16 CD spectra of 0.1 mM solutions of 1 and 17 in CHCl3 and MeOH. 56  2.4.6.1  Cation extraction studies Cation binding has been displayed by several G-quadruplex-supported U-quartets described in Chapter 1 and is a property allowing their potential use as artificial ionophores. The behaviour of 1  in the presence of metal cations was investigated. This was performed by treating chloroform solutions of 1  with the picrate salts of Na+, K+ and Sr2+ for a duration of one week, after which the solutions were centrifuged, the supernatants collected and diluted to the desired concentration and subjected to CD and NMR spectroscopy. The picrate salts were prepared according to literature procedures.123  Na+ and K+ were found not to be taken up by 1  i.e. the measured spectra are identical to that of cation-free 1  in chloroform. In the presence of Sr(pic)2 however, an induced CD signal of the picrate anions manifests as a broad absorption band from 300 – 450 nm (Figure 2.17). This suggests the sequestering of Sr2+ by the conjugate in chloroform and a conjugate-metal picrate complex (henceforth denoted as 12•Sr2+, stoichiometry explained below) assembles, positioning the picrate anions in a chiral environment. λmax for this species was observed at ~ 245 nm, indicating the continued presence of the U-quartet. On switching the solvent to methanol, the picrate signal is extinguished and a bathochromic shift occurs with the new λmax ~ 255 nm, indicating the denaturing of both the complex and U-quartet.  57   Figure 2.17 CD spectra of 0.1 mM solutions of 12•Sr2+ in CHCl3 and MeOH.  The 1H NMR spectrum of the complex shows the picrate aryl proton signal at ~ 8.7 ppm. Integration of the signal reveals a 2 : 1 stoichiometric ratio of the conjugate to Sr(pic)2 (Figure 2.18), indicating the dimeric nature of 12•Sr2+. This was confirmed by DOSY measurements, with the observed D value of H1' for the complex being 84% that of 1 (Table 2.4). This is in close agreement with the theoretical ratio (80%) derived from Equation 3 (Section 2.4.5) for bimolecular with respect to unimolecular spherical systems.  58   Figure 2.18 Portion of 1H NMR spectrum of 12•Sr2+ showing the imino and picrate aryl proton signals.      Table 2.4 H1' diffusion constants (D) of 1 and 12•Sr2+ in CDCl3 at 25 ºC (2.7 mM).  Attempts to crystallize the complex from a variety of solvent systems for X-ray crystallographic analysis proved unsuccessful. The complex is predicted to be a symmetric homodimer with two interfaced U-quartets from two molecules of 1  sandwiching a Sr2+ cation, with the picrate anions loosely associated with the assembly (Figure 2.19).  Compound D (x10-10 m2 s-1) Ratio 1 3.71 ± 0.10 0.84 12•Sr2+ 3.11 ± 0.10 59   Figure 2.19 Proposed structure of 12•Sr2+ complex. Uracil residues are represented by red slabs.  2.5  Experimental section  2.5.1  General information 1H NMR spectra were measured on a Bruker Avance 400 MHz spectrometer in CDCl3 [using CHCl3 (for 1H, δ = 7.26) as internal standard] or in DMSO-d6 [using DMSO (for 1H, δ = 2.50) as internal standard]. Chemical shifts are reported in ppm from tetramethylsilane. 13C NMR spectra were measured on a Bruker Avance 400 MHz spectrometer in CDCl3 [using CDCl3 (for 13C, δ = 77.0) as internal standard. Chemical shifts are reported in ppm from tetramethylsilane. The following abbreviations are used to explain the multiplicities: s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet, br = broad. 2D NOESY spectra were acquired with tmix = 800 ms and d1 = 1500 ms. COSY45 spectra were obtained with d1 = 1500 ms. DOSY experiments were carried out on a Bruker Avance 400inv spectrometer equipped with a 5mm BBI Z-gradient Sr2+ O- N+O-ON+-O ON+O-O• 260  probe (inverse broadband probe with z-gradient coil). All measurements were performed using a BPLED gradient pulse sequence (ledbpgp2s). The length of the diffusion gradient was optimized for each sample to obtain at least 95% signal attenuation due to diffusion. Δ and δ values respectively were found to be 65 ms and 4000 ms (for 1  and 1•Sr2+), 65 ms and 5000 ms (for 17). Eddy current (te) was set at 5 ms. All measurements were taken at 298K with sample concentrations of 2.7 mM. Diffusion coefficients were generated using the SimFit function on Bruker XWinNMR software. MALDI-TOF mass analyses were performed on a Bruker Biflex IV spectrometer in the reflectron mode using 2,5-dihydroxybenzoic acid (DHB) as the matrix. Circular dichroism (CD) spectroscopy was performed on a Jasco J-810 spectrophotometer. Each spectrum is an average of three scans corrected for the baseline. All spectra were acquired with samples in a 1 mm path length quartz cuvette. Flash column chromatography was performed using Silicycle 60 silica gel and eluting solvents were used directly from their commercial bottles. Solvents and reagents for reactions were purchased commercially and used without further purification.  2.5.2  Synthesis of conjugate 1 (similar procedure employed for the synthesis of 17) To a stirred solution of cavitand 7 (35.6 mg, 0.0345 mmol) and nucleoside 10 (46.9 mg, 0.152 mmol) in argon-purged DMSO (4 mL) was added a solution of copper(II) sulfate pentahydrate (87 µL, 0.04 M in argon-purged Milli-Q water, 0.00345 mmol) followed by a solution of sodium ascorbate (87 µL, 0.4 M in argon-purged Milli-Q water, 0.0345 mmol). The reaction was stirred at 60 °C for 20 h. The solvent was then removed in vacuo and the residue 61  suspended in water. A few drops of ammonium hydroxide were added to remove the copper catalyst and the mixture was suction filtered. The residue, crude 1 , was washed with deionized water and allowed to air dry, whereupon it was purified via step gradient flash chromatography (100% ethyl acetate – ethyl acetate : methanol 98 : 2 – ethyl acetate : methanol 95 :5) to afford conjugate 1  in 47% yield (42.5 mg, 0.0163 mmol).  Compound 1 : White solid; 1H (400 MHz, CDCl3) δ(ppm) 0.92 (12H, t, J = 4 Hz, CH3 feet), 1.29 – 1.38 (96H, m, long chain aliphatic feet and isopropylidene CH3), 2.20 (8H, m, CH2 feet), 4.37 (4H, d, J = 8 Hz, Hin), 4.56 – 4.60 (4H, m, H4′), 4.71 – 4.79 (12H, m, H5′a and H5′b and Hd), 5.02 – 5.05 (8H, m, H3′, Ha or Hb?), 5.08 (4H, dd, J = 1.6, 8.0 Hz, H2′), 5.16 (4H, d, J = 12.0 Hz, Ha or Hb?), 5.62 (4H, d, J = 1.6 Hz, H1′), 5.71 (4H, dd, J = 4.0, 8.0 Hz, H5), 5.79 (4H, d, J = 8.0 Hz, Hout), 6.85 (4H, s, ArH), 6.98 (4H, d, J = 8.0 Hz, H6), 7.74 (4H, s, Hc), 10.74 (4H, s, imino H); 1H (400 MHz, DMSO-d6) δ(ppm) 0.85 (12H, t, J = 6.8 Hz, CH3 feet), 1.24 – 1.30 (84H, m, long chain aliphatic feet and isopropylidene CH3), 1.45 (12H, s, isopropylidene CH3), 2.33 (8H, m, CH2 feet), 4.28 (4H, d, J = 7.2 Hz, Hin), 4.40 (4H, m, H4′), 4.58 (4H, t, J = 8.0 Hz, Hd), 4.65 (4H, dd, J = 7.2, 14.0 Hz, H5′b), 4.75 (4H, dd, J = 5.2, 14.0 Hz, H5′a), 4.89 (4H, dd, J = 4.0, 6.4 Hz, H3′), 4.94 (8H, s, Ha and Hb), 5.12 (4H, dd, J = 1.6, 6.4 Hz, H2′), 5.61 (4H, d, J = 8.0 Hz, H5), 5.77 (4H, d, J = 2.0 Hz, H1′), 5.93 (4H, d, J = 7.2 Hz, Hout), 7.29 (4H, s, ArH), 7.64 (4H, d, J = 8.0 Hz, H6), 8.20 (4H, s, Hc), 11.46 (4H, s, imino H); 13C (100 MHz, CDCl3) δ(ppm) 163.8, 151.0, 148.4, 145.4, 144.4, 143.3, 139.1, 124.8, 115.0, 114.7, 103.4, 99.6, 96.3, 86.5, 84.5, 82.0, 67.6, 52.0, 37.1, 32.0, 30.1, 29.9, 29.7, 29.4, 28.2, 27.3, 25.6, 22.9, 14.1, 1.2; MS(MALDI-TOF): Found: m/z 2608.0. Calcd for C136H181N20O32: (M+H)+ 2608.0. 62  Compound 17 : Yield: 47%. White solid; 1H (400 MHz, CDCl3) δ(ppm) 0.88 (12H, t, J = 7.2 Hz, CH3 feet), 1.25 – 1.28 (84H, m, long chain aliphatic feet and isopropylidene CH3), 1.54 (12H, s, isopropylidene CH3), 2.17 (8H, m, CH2 feet), 3.30 (12H, s, NMe), 4.32 (4H, d, J = 7.2 Hz, Hin), 4.46 – 4.50 (4H, m, H4′), 4.65 – 4.70 (8H, m, H5′a and Hd), 4.77 (4H, dd, J = 3.6, 14.0 Hz, H5′b), 4.98 – 5.09 (16H, m, H2′ and H3′ and Ha and Hb), 5.60 (4H, d, J = 1.2 Hz, H1′), 5.73 – 5.75 (8H, m, H5 and Hout), 6.80 (4H, s, ArH), 7.18 (4H, d, J = 8.0 Hz, H6), 7.67 (4H, s, Hc); 1H (400 MHz, DMSO-d6) δ(ppm) 0.86 (12H, t, J = 6.4 Hz, CH3 feet), 1.25 – 1.28 (84H, m, long chain aliphatic feet and isopropylidene CH3), 1.47 (12H, s, isopropylidene CH3), 2.33 (8H, m, CH2 feet), 3.15 (12H, s, NMe), 4.28 (4H, d, J = 7.2 Hz, Hin), 4.40 – 4.44 (4H, m, H4′), 4.58 (4H, t, J = 8.0 Hz, Hd), 4.64 (4H, dd, J = 7.6, 14.0 Hz, H5′b), 4.76 (4H, dd, J = 5.2, 14.0 Hz, H5′a), 4.92 – 4.96 (12H, m, Ha and Hb and H3′), 5.13 (4H, dd, J = 1.6, 6.4 Hz, H2′), 5.75 (4H, d, J = 8.0 Hz, H5), 5.82 (4H, d, J = 1.6 Hz, H1′), 5.91 (4H, d, J = 7.2 Hz, Hout), 7.30 (4H, s, ArH), 7.70 (4H, d, J = 8.0 Hz, H6), 8.20 (4H, s, Hc); 13C (100 MHz, CDCl3) δ(ppm) 162.7, 151.1, 148.2, 145.2, 144.3, 141.4, 139.2, 124.4, 114.9, 114.8, 102.4, 99.7, 97.1, 86.7, 84.7, 82.3, 77.4 (overlapped), 67.4, 52.2, 37.2, 32.2, 30.2, 30.1, 29.95, 29.89, 29.6, 28.2, 27.8, 27.3, 25.4, 22.9, 14.3; MS(MALDI-TOF): Found: m/z 2686.0 Calcd for C140H188N20O32Na: (M+Na)+ 2686.1.  2.5.3  Supplementary 1H and 1H-1H COSY spectra Spectra begin on the following page. 63   Figure 2.20 1H NMR spectrum of 1 in CDCl3 at 25 ºC. 64   Figure 2.21 1H-1H COSY spectrum of 1 in CDCl3 at 25 ºC. 65   Figure 2.22 1H NMR spectrum of 1 in DMSO-d6 at 25 ºC. 66   Figure 2.23 1H-1H COSY spectrum of 1 in DMSO-d6 at 25 ºC. 67   Figure 2.24 1H NMR spectrum of 17 in CDCl3 at 25 ºC. 68   Figure 2.25 1H-1H COSY spectrum of 17 in CDCl3 at 25 ºC. 69   Figure 2.26 1H NMR spectrum of 17 in DMSO-d6 at 25 ºC.  70   Figure 2.27 1H-1H COSY spectrum of 17 in DMSO-d6 at 25 ºC.71  Chapter 3: A Template-Assembled Synthetic U-Quadruplex  3.1  Synopsis In the previous chapter, the ability of a cavitand template to stabilize an inherently unstable U-quartet structure was demonstrated. As an extension of this work, we sought to introduce an additional degree of molecular and structural complexity to the system, not only to pose a synthetic challenge, but also to approach a more natural model on which energetic and synergetic studies might provide more insight on nucleic acid topology and stability. Towards this goal, the construction of a U-quadruplex on our cavitand template was envisaged.  This chapter describes the synthesis and characterization of conjugate 18 (Figure 3.1) in which four uracil-based dinucleoside units are coupled with a lipophilic cavitand. Of note in the design of this molecule is the 5' – 3' directional sense of the dinucleoside moiety, starting from the outer residue. If assembled, an all-parallel two-tiered U-quadruplex would result from this arrangement. As with conjugate 1 , triazole rings provide the backbone of the system. Extensive NMR spectroscopy was performed for complete 1H signal assignment of 18  and to ascertain the assembly of a U-quadruplex in solution. 72   Figure 3.1 Side-on representation of conjugate 18. Outer and inner uridine residues, as well as the 5' and 3' sugar ring positions are labeled to demonstrate directional sense.  3.2  CPK modeling studies The addition of an outer layer of uridine nucleosides was expected to add a considerable amount of steric bulk and restrict torsional movement of the inner layer, potentially disrupting quartet assembly within and in turn destabilizing a quadruplex assembly. Surprisingly however, CPK modeling of 18  showed that, with an all-syn glycosidic bond configuration, a quadruplex could potentially be assembled via the stacking of the two uracil layers with a clearly defined central cavity of size compatible with the common quadruplex-stabilizing cations such as Na+, K+ and Sr2+. The model also demonstrated the possibility of triazole ring intercalation to form a fully stacked, alternating triazole-uracil-triazole-uracil scaffold resulting from ring π-π interactions.  O OC11H23 C11H23 O OC11H23C11H23O O O OO O O ONNNOOHN NOO NNNOO HNN OO NNN O OHN NO O NNN O OHNNO ONN NOHN NO O O ONNNO OOHN NO O NNNO HNN OOOO NN N ONH NO O OOouterinner 5'3'5'1873  3.3  Synthetic strategy  3.3.1  Synthesis of conjugate 18 The preparation of 18  entailed the coupling of cavitand 7  and dinucleoside derivative 25 , itself prepared in several steps (Scheme 3.1). Literature procedures were followed towards 5'-silyl protected intermediate 22 ,124 beginning with the treatment of 2'-deoxyuridine 19  with TBSCl in the presence of DMAP as a nucleophilic catalyst to give 5'-TBS-protected 20 . Generation of the 3'-alkoxide by deprotonation with sodium hydride followed by SN2 substitution with propargyl bromide provided 3'-propargyl ether derivative 21 , which was then coupled with 10  in a Cu-catalyzed "click" reaction to access 22 . Removal of the 5'-TBS group on 22  was found to proceed cleanly by treatment with TBAF, unmasking the hydroxyl group on 23 . However, direct azidation to 25  via the CBr4-based Mitsunobu process described for the synthesis of 10  was found to be ineffective here. TLC analysis of the reaction mixture after 15 hours revealed a significant amount of starting material 23  remaining. The sluggish reaction presumably results from the additional uridine unit, which could swivel around to obstruct reagent access to the 5'-OH. Elevating the reaction temperature to 80 ºC could not circumvent this problem and produced unidentified products as detected by TLC. Therefore, an indirect approach was taken in which the Appel iodination of 23  was first performed with less sterically bulky reagents (I2, imidazole) to access the 5'-I intermediate 24  expediently and cleanly.125 Subsequent SN2 substitution with NaN3 then afforded 5'-azido dinucleoside 25 .  74   Scheme 3.1 Synthetic route towards dinucleoside 25.  The Cu-catalyzed "click" reaction between 7  and 25  under the same reaction conditions used for the synthesis of 1  was unable to proceed to completion. After 24 hours, TLC analysis revealed multiple spots that were confirmed by MALDI-TOF mass spectrometry to correspond to incomplete conjugation of varying degrees. This is again attributed to the size of 25 , which on successive attachment to 7  would cause increasing steric crowding on the cavitand rim, hindering the approach of subsequent residues of 25  to the propargyl sites (Figure 3.3). Apart from an increase of the reaction temperature, a switch of the reductant from sodium to the more potent cesium ascorbate was made in the hope of driving the reaction to completion. Indeed, NHO ONOHO OH TBSCl4-DMAPpy, rt NHO ONOTBSO OH NaH BrTHF, rt NHO ONOTBSO O CuSO4•5H2ONa ascorbateEtOH/H2ONHO ONOTBSO O N NN NHO ONOO O TBAFTHF, rt NHO ONOHO O N NN NHO ONOO O I2PPh3DMF, rtNHO ONOI O N NN NHO ONOO O NaN3DMF, 80 ºC NHO ONON3 O N NN NHO ONOO Oimidazole1019 20 2122 2324 2575  under these conditions the reaction proceeded cleanly after a period of 24 hours to afford the tetra-coupled conjugate 18 as the sole product, confirmed by MALDI-TOF analysis (Scheme 3.2). The compound was found to be soluble in chloroform and only slightly so in methanol.   Scheme 3.2 Synthesis of 18 by the Cu-catalyzed "click" reaction. C11H23O 4OO + cat. Cu2+Cs ascorbate C11H23O 4O O NNNDMSO, 80 ºC 187 NHO ONON3 O N NN NHO ONOO O25 24 hNHO ONOO N NN NHO ONOO O76   Figure 3.2 Schematic showing di- and trisubstituted conjugates sterically crowded at the cavitand rim, blocking approach of subsequent residues of 25. Monosubstituted conjugate not shown.  3.3.2  Synthesis of N-methylated conjugate For subsequent control studies, the preparation of a conjugate with fully methylated imino positions to exclude hydrogen bonding was undertaken. Synthesis was expected to begin smoothly from dinucleoside 25  with a single methylation step via treatment with excess amounts O OO NNN RH H ONN NR H OO NNN RH H ONN NR HOHOO NNN RH H ONN NR HH ONN NR HH1,2-disubstituted 1,3-disubstitutedtrisubstitutedH77  of iodomethane and K2CO3 base to provide the N-methylated derivative 26 , which would then be coupled with cavitand 7  to access conjugate 27 (Scheme 3.3). However, methylation of both imino positions on 25  in a single operation proved impossible. Reaction mixtures were found by LC-MS to contain only singly methylated product in addition to the starting material after 20 hours under refluxing conditions.   Scheme 3.3 Original synthetic plan for N-methylated conjugate 27.  Synthesis of 26  was therefore performed beginning with the N-methylation of 20  to afford 28 . Propargylation of the 3'-OH position provided propargyl ether 29  (Scheme 3.4a), which was then coupled with 16  in a Cu-catalyzed "click" reaction to give dinucleoside 30 . Subsequent transformations towards azide 26  were effected with identical methods to that of 25  (Scheme 3.4b). NHO ONON3 O N NN NHO ONOO O25 MeI (2.5 equiv.)K 2CO3 (3 equiv.)DMF-acetone,reflux NO ONON3 O N NN NO ONOO O26 Me Me 7CuSO4•5H2O (cat.)Cs ascorbateDMSO, 80 oC24 hC11H23O 4O O NNN27 NO ONOO N NN NO ONOO OMe Me78   Scheme 3.4 a) Synthesis of propargyl ether 29. b) Synthesis of azide 26.  CuSO4•5H2ONa ascorbateEtOH/H2O, 80 oCNO ONOTBSO O N NN NO ONOO O TBAFTHF, rt NO ONOHO O N NN NO ONOO O I2PPh3DMF, rtNO ONOI O N NN NO ONOO O NaN3DMF, 80 ºC NO ONON3 O N NN NO ONOO Oimidazole30 3132 26NHO ONOTBSO OH20 MeIK2CO3acetone-DMF,reflux NO ONOTBSO OH28 Me NaH BrTHF, rt NO ONOTBSO O29 MeNO ONOTBSO O29 Me NO ONO OON3 16 Me+Me Me Me MeMe Mea)b)Me Me79  The Cu-catalyzed "click" reaction between cavitand 7  and azide 26  under the same reaction conditions for the synthesis of 18  proceeded cleanly to afford conjugate 27  in moderate yield (second step of Scheme 3.3), and its identity was confirmed by MALDI-TOF analysis.  3.4  NMR characterization studies  3.4.1  1H signal assignment Significant 1H signal broadening of 18  in CDCl3 is observed at both room temperature and 55 ºC, and only ArH is resolved (Figure 3.5). This is indicative of intermolecular aggregation. Signal assignment was therefore performed in DMSO-d6 with 1H-1H COSY. 27  was assigned in CDCl3 and DMSO-d6. 1H and 1H-1H COSY spectra for both compounds are included in the Experimental Section. Figure 3.4 shows the condensed structure of 18  with all protons labeled. 27  differs only by both N-methyl groups and therefore is not shown.   Figure 3.3 Condensed structure of 18. C11H23O 4O ONNN NO ONOO N NN NO ONOO OArH HdHoutHinHa Hb Hc"H5a" H5b"H5"H6" HinnerH1"H2a"H2b"Ha' Hb'Hc' H5a'H5b' HouterH6'H5' H1'H2'H3'H4'H3"H4"1880   Figure 3.4 1H NMR spectra of 18 in CDCl3 at 25 ºC and 55 ºC.  Signal overlap is widespread in the NMR spectra of 18  in DMSO-d6 due to the similar chemical shifts of protons in both ribose rings as well as the linker methylene protons, necessitating group assignment. Nevertheless, important signals for structure determination remain resolved, such as the imino, H5 and H6 and Hc protons.  Imino protons (Hinner and Houter) were identified by exchange with CD3OD with observed quenching of both signals. In addition, weak COSY crosspeaks arising from W-couplings with the H5 protons (H5' and H5") provide further evidence of their identity (Figure 3.6). Houter is assigned further downfield due to anisotropic deshielding. The H5' and H5" protons, which are overlapped, were in turn identified by COSY interactions with their respective H6 partners (H6' and H6") and the characteristic 3J coupling constants (~ 8 Hz), calculated from the H6 doublets.  81   Figure 3.5 a) Portion of 400 MHz COSY spectrum of 18 in DMSO-d6 showing W-coupling-based COSY crosspeaks between imino and H5 protons. b) W-coupling within uracil shown in bolded bonds.  All protons attached to the cavitand architecture were assigned by the appropriate COSY and NOESY correlations as applied to 1 .  3.4.2  Regiochemical analysis and signal assignment by NOESY NOE spectra of 18  and 27 in DMSO-d6 revealed strong correlations between ArH and Hd, as well as to the methylene -CH2- 'feet' (Figure 3.7). It is noted that the actual Hd signal is overlapped with that of Ha and Hb, but since the spatial distance between ArH and Ha/Hb far exceeds that required for NOE interaction, the observed crosspeak corresponds to the ArH/Hd connection.  82   Figure 3.6 a) Portion of 400 MHz NOE spectrum of 18 in DMSO-d6 showing crosspeaks between ArH and Hd and the –CH2- 'feet' (27 exhibits similar correlations and is therefore not shown). b) NOE interactions of said protons.  Both triazole protons (Hc' and Hc") were identified by their NOE correlations with the respective methylene linkers (Hc': Ha'/Hb' and H5a'/H5b', Hc": Ha/Hb and H5a"/H5b") (Figure 3.8). These also confirm the 1,4-regiochemistry expected of the Cu-catalyzed "click" reaction in both triazole rings of 18  and 27 .  83   Figure 3.7 a) Portion of 400 Mhz NOE spectrum of 18 in DMSO-d6 showing crosspeaks between triazole protons and flanking methylene groups (27 exhibits similar correlations and is therefore not shown). b) Expected NOE interactions of 1,4-regioisomers of 18.  3.4.3  Summary of 1H signal assignments Signal assignments for 18  and 27  are listed in Tables 3.1 through 3.3 with appropriate COSY and/or NOESY correlations used in their identifications included. Overlapped signals are group assigned and specified on the list.         84  Proton δH DMSO-d6 (ppm)  COSY correlation NOESY correlation Houter 11.46 H5'  Hinner 11.33 H5"  Hc' 8.10  Ha'/Hb', H5a'/H5b' Hc" 8.15  Ha/Hb, H5a"/H5b" H6' 7.65 H5'  H6" 7.57 H5"  H5' 5.62 H6'  H5" 5.62 H6"  ArH 7.27  Hd H1' 5.75 H2'  H1" 6.09 H2a"/H2b"  H2' 5.11 H1', H3'*  H2a"/H2b" 2.25 – 2.29 H2b"/H2a"*  H3' 4.88 H2', H4'  Hout 5.91 Hin  Ha/Hb 4.96 Hb/Ha  H5a'/H5b', H5a"/H5b", Ha'/Hb', Hd 4.55 – 4.76   H3", H4', H4", Hin 4.26 – 4.39   -CH2- 'feet' 2.15 – 2.22 Hd  long chain 'feet', isopropylidene CH3 1.20 – 1.41   terminal CH3 0.85   *Correlation indistinguishable due to signal overlapping in the region. Table 3.1 1H signal assignments of 18 in DMSO-d6 at 25 ºC.  85                     Table 3.2 1H signal assignments of 27 in DMSO-d6 at 25 ºC.    Proton δH DMSO-d6 (ppm)  COSY correlation NOESY correlation N-Me 3.09   N-Me 3.13   Hc' 8.10  Ha'/Hb', H5a'/H5b' Hc" 8.13  Ha/Hb, H5a"/H5b" H6' 7.70 H5'  H6" 7.61 H5"  H5', H5", H1' 5.73 – 5.79 H6', H6", H2'  ArH 7.26  Hd H1" 6.11 H2a"/H2b"  H2' 5.11 H1', H3'*  H3', Ha/Hb 4.89 – 4.96 H2'/H4'*, Hb/Ha  Hout 5.88 Hin  H5a'/H5b', H5a"/H5b", Ha'/Hb', Hd 4.55 – 4.77   H3", H4', H4", Hin 4.25 – 4.39   H2a"/H2b", -CH2- 'feet' 2.15 – 2.22 H2b"/H2a"*, Hd  long chain 'feet', isopropylidene CH3 1.22– 1.42   terminal CH3 0.83   *Correlation indistinguishable due to signal overlapping in the region. 86                   Table 3.3 1H signal assignments of 27 in CDCl3 at 25 ºC.      Proton δH DMSO-d6 (ppm)  COSY correlation NOESY correlation N-Me 3.25   N-Me 3.30   Hc' 7.63   Hc" 7.76   H6' 7.12 H5' H5' H6" 7.02 H5" H5" H5', H5", Hout 5.68 – 5.76 H6', H6"  ArH 6.82   H1' 5.53   H1" 6.13 H2a"/H2b"  H2', H3', H4', H5a', H5b', H3", H4", H5a", H5b", Ha, Hb, Ha', Hb', Hd, Hin 4.28 – 5.09   H2a"/H2b", -CH2- 'feet' 2.10 – 2.38 H2b"/H2a"  long chain 'feet', isopropylidene CH3 1.27– 1.40   terminal CH3 0.88   87  3.4.4  NMR solution structure elucidation NOESY performed on 18  in DMSO-d6 at 25 ºC revealed correlations between both the imino protons (Hinner and Houter) and the H5 protons, suggesting the assembly of both the inner and outer U-quartets to form a quadruplex (Figure 3.9a). These crosspeaks are of noticeably different intensities, and the more intense crosspeak is assigned to Hinner (11.33 ppm) due to the expected tighter association of the inner U-quartet, capped by the more loosely bound outer quartet to yield a weaker crosspeak (Houter = 11.46 ppm). In contrast, no crosspeaks were observed between the N-Me groups and H5 protons of 27 in DMSO-d6, indicating the absence of quartets as expected due to the lack of imino protons.   Free dinucleoside 25  also shows no NOE correlation between its imino and H5 protons in DMSO-d6, affirming the indispensability of the cavitand template in directing structure assembly. Water-mediated exchange between the imino protons is evident in the form of intense mutual crosspeaks as well as with residual water in the solvent (Figure 3.9b). Imino protons are labeled in Figure 3.9c. Neither of these correlations are found in the NOE spectrum of 18 , indicating that the imino protons therein are unexposed to the solvent, possible only in a closed quadruplex system, and that hydrogen bonding involving the imino protons is in effect, slowing their exchange.  88   Figure 3.8 a) Portion of 400 MHz NOE spectrum of 18 in DMSO-d6 showing crosspeaks between both imino protons and H5 protons. b) Portion of 400 Mhz NOE spectrum of 25 in DMSO-d6 showing mutual imino crosspeaks and with residual H2O in NMR solvent. c) Imino protons labeled on the structure of 25.  The assembly of hydrogen-bonded structures in DMSO is unusual, but not unprecedented. Base pairing and self-association of nucleosides in DMSO has been reported.126-129 Stabilization of the system in 18  could arise not only from the energy of formation of eight hydrogen bonds (via the assembly of both quartets), but also from stacking of the uracil and triazole rings. This is evidenced by observed NOE correlations between Hc" and H6" as well as Hc' and H6" indicating close proximity of the inner triazole, inner uracil and outer triazole moieties (Figure 3.10a). The lack of a Hc'/H6' crosspeak suggests the non-planarity of the outer quartet, in turn giving rise to a more weakly associated quartet as described earlier in this section. Thus, a planar inner quartet is proposed which provides optimum hydrogen bond lengths according to the theoretical model, and the outer quartet 'dipped' inwards. This arrangement has 89  been observed in the solid state,93 and has been assigned longer and thereby weaker hydrogen bonds by the theoretical model.89 A visualization of the structure is provided in Figure 3.10b.   Figure 3.9 a) Portion of 400 MHz NOE spectrum of 18 in DMSO-d6 showing crosspeaks between triazole protons and H6" suggestive of π-stacking. b) Illustration of proposed U-quadruplex of 18 showing planar and non-planar inner and outer U-quartets respectively. Triazole/H6 NOE connections are shown in red arrows.  Syn glycosidic bonds were confirmed at both ribose rings with the observation of NOE crosspeaks between H6' and H1' as well as H6" and H1" (Figure 3.11a). This is shown in Figure 3.11b. 90   Figure 3.10 a) Portion of 400 MHz NOE spectrum of 18 showing H6'/H1' and H6"/H1" crosspeaks indicative of syn glycosidic bonds. b) NOE correlations of the syn conformers shown in 18.  3.4.5  Variable-temperature NMR studies The temperature dependence of the 1H NMR spectrum of 18  in DMSO-d6 was investigated (Figure 3.12). Pronounced upfield chemical shifts of both imino signals are observed at elevated temperatures with simultaneous signal broadening, suggesting the gradual disassembly of the U-quadruplex via hydrogen bond denaturation and an increasingly rapid exchange of the imino protons. Small upfield shifts of the Hc, H5 and H6 protons are also observed, indicating slight conformational changes of the triazole and uracil moieties with increasing temperature. The spectra show that the quadruplex retains some degree of its integrity over the observed temperature range. 91   Figure 3.11 Variable-temperature 1H NMR spectra of 18 in DMSO-d6. 92  3.4.6  Diffusion NMR studies DOSY NMR was performed on DMSO-d6 and CDCl3 solutions of 18  and 27  at identical concentration (2.7 mM) and temperature (25 ºC). The ArH proton was observed as it is the only isolated signal resolved for 18  in CDCl3. D values were computed and generated by the SimFit algorithm. Measurements were taken thrice and the average values with standard error are reported in Table 3.4.  Solvent 18 27 Ratio CDCl3 1.95 ± 0.10 3.07 ± 0.10 0.64 DMSO-d6 0.71 ± 0.10 0.73 ± 0.10 0.97  Table 3.4 ArH diffusion constants (D) of 18 and 27 in CDCl3 and DMSO-d6 at 25 ºC (2.7 mM).  Measured D values for both 18  and 27  in DMSO-d6 are in close agreement, indicating an identical oligomeric state of the two compounds. Since no intermolecular aggregation is possible for 27 , both compounds are unimolecular in DMSO. In CDCl3, the measured D value of 18  is 64% that of 27 , consistent with the theoretical ratio calculated for a termolecular with respect to a unimolecular system. This confirms the earlier hypothesis of the aggregation of 18  in CDCl3.    93  3.5  Experimental section  3.5.1  General information 1H NMR spectra were measured on a Bruker Avance 400 MHz in DMSO-d6 [using DMSO (for 1H, δ = 2.50) as internal standard] or in CDCl3 [using CHCl3 (for 1H, δ = 7.26) as internal standard]. Chemical shifts are reported in ppm from tetramethylsilane. 13C NMR spectra were measured on a Bruker Avance 400 MHz spectrometer in DMSO-d6 [using DMSO (for 13C, δ = 39.5) as internal standard] or in CDCl3 [using CHCl3 (for 13C, δ = 77.0) as internal standard]. The following abbreviations are used to explain the multiplicities: s = singlet, d = doublet, dd = doublet of doublets, t = triplet, td = triplet of doublets, q = quartet, m = multiplet, br = broad. 2D NOESY spectra were acquired with tmix = 800 ms and d1 = 1500 ms. COSY45 spectra were acquired with d1 = 1500 ms. DOSY experiments were carried out on a Bruker Avance 400inv spectrometer equipped with a 5mm BBI Z-gradient probe (inverse broadband probe with z-gradient coil). All measurements were performed using a BPLED gradient pulse sequence (ledbpgp2s). The length of the diffusion gradient was optimized for each sample to obtain at least 95% signal attenuation due to diffusion. Δ and δ values respectively were found to be 65 ms and 5 ms (for 18  and 27  in CDCl3), 65 ms and 10 ms (for 18 in DMSO-d6), 65 ms and 10.4 ms (for 27  in DMSO-d6). Eddy current (te) was set at 5 ms. All measurements were taken at 298K with sample concentrations of 2.7 mM. Diffusion coefficients were generated using the SimFit function on the XWinNMR software. MALDI-TOF mass analyses were performed on a Bruker Biflex IV spectrometer in the reflectron mode using 2,5-dihydroxybenzoic acid (DHB) as the matrix. Flash column chromatography was performed using Silicycle 60 silica gel and eluting 94  solvents were used directly from their commercial bottles. Solvents and reagents for reactions were purchased commercially and used without further purification.  3.5.2  Synthesis of conjugate 18  3.5.2.1  Preparation of 5'-OH dinucleoside 23 To a stirred solution of 22  (1.31 g, 1.90 mmol) in THF (19 mL) was added TBAF (2.3 mL of a 1.0 M solution in THF, 2.28 mmol), and the mixture was stirred for 1 h. The solvent was then removed in vacuo and the residue re-dissolved in CHCl3. The solvent was removed in vacuo once again, and the crude material was purified by flash column chromatography using step gradient elution (CHCl3 : EtOH 9 : 1 – CHCl3 : EtOH 4 : 1) to afford 23  in 96% yield (1.04 g, 1.81 mmol). Compound 23 : White solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.27 (3H, s, isopropylidene CH3), 1.46 (3H, s, isopropylidene CH3), 2.07 – 2.14 (1H, m, H2b"), 2.25 – 2.32 (1H, m, H2a"), 3.56 – 3.58 (2H, m, H5a" and H5b"), 3.97 – 4.00 (1H, m, H4"), 4.19 – 4.20 (1H, m, H3"), 4.35 – 4.38 (1H, m, H4'), 4.56 (2H, s, Ha' and Hb'), 4.65 (1H, dd, J = 7.6, 14.0 Hz, H5b'), 4.75 (1H, dd, J = 5.2, 14.0 Hz, H5a'), 4.88 (1H, dd, J = 4.0, 6.4 Hz, H3'), 5.07 (1H, t, J = 5.2 Hz, hydroxyl OH), 5.12 (1H, dd, J = 1.6, 6.4 Hz, H2'), 5.63 (2H, m, H5' and H5"), 5.76 (1H, d, J = 1.6 Hz, H1'), 6.09 (1H, dd, J = 5.6, 8.0 Hz, H1"), 7.66 (1H, d, J = 8.4 Hz, H6'), 7.84 (1H, d, J = 8.0 Hz, H6"), 8.13 (1H, s, Hc'), 11.30 (1H, s, H1), 11.46 (1H, s, H2); 13C (100 MHz, DMSO-d6) δ(ppm) 162.3, 162.1, 149.5, 149.3, 142.9, 142.6, 139.4, 123.6, 112.4, 100.95, 100.89, 92.4, 84.4, 83.8, 83.2, 95  82.7, 80.5, 78.1, 60.8, 60.5, 50.3, 35.6, 25.9, 24.1; ESIHRMS: Found: m/z 598.1882. Calcd for C24H29N7O10Na: (M+Na)+ 598.1874.  3.5.2.2  Preparation of 5'-I dinucleoside 24 To a stirred solution of 4 (1.044 g, 1.814 mmol) in DMF (8 mL) was added PPh3 (1.571 g, 6 mmol), imidazole (0.82 g, 12.04 mmol) and I2 (1.456 g, 5.735 mmol, 4 portions over 5 mins) in that order. The reaction was stirred at room temperature for 4 h, whereupon the solvent was removed in vacuo. H2O (10 mL) was added to the residue and the mixture was extracted with CHCl3 (3 x 50 mL). The combined organic extracts were washed with brine and dried over anhydrous MgSO4. After evaporation of the solvent, the crude material was purified by flash column chromatography using step gradient elution (CHCl3 : EtOH 19 : 1 – CHCl3 : EtOH 9 : 1) to afford 5  in 81% yield (1.007g, 1.469 mmol). Compound 24 : White foamy solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.30 (3H, s, isopropylidene CH3), 1.48 (3H, s, isopropylidene CH3), 2.26 – 2.39 (2H, m, H2a" and H2b"), 3.42 (1H, dd, J = 6.4, 10.4 Hz, H5a" or H5b"?), 3.51 (1H, dd, J = 6.8, 10.4 Hz, H5a" or H5b"?), 4.07 (1H, td, J = 2.4, 6.8, 6.8 Hz, H4"), 4.15 – 4.18 (1H, m, H3"), 4.37 – 4.41 (1H, m, H4'), 4.62 – 4.67 (3H, m, Ha', Hb', H5b'), 4.77 (1H, dd, J = 4.8, 14.0 Hz, H5a'), 4.90 (1H, dd, J = 4.0, 6.4 Hz, H3'), 5.15 (1H, dd, J = 1.6, 6.4 Hz, H2'), 5.65 (1H, dd, J = 2.0, 7.6 Hz, H5'), 5.70 (1H, dd, J = 2.0, 8.0 Hz, H5"), 5.79 (1H, d, J = 2.0 Hz, H1'), 6.15 (1H, dd, J = 6.0, 8.4 Hz, H1"), 7.69 – 7.73 (2H, m, H6' and H6"), 8.18 (1H, s, Hc'), 11.38 (1H, d, J = 2.0 Hz, H1), 11.48 (1H, d, J = 2.0 Hz, H2); 13C (100 MHz, DMSO-d6) δ(ppm) 163.3, 162.9, 150.4, 150.3, 143.63, 143.59, 140.6, 124.7, 113.4, 96  102.2, 101.9, 93.4, 85.4, 84.7, 83.7, 83.1, 81.5, 80.8, 61.9, 51.3, 35.2, 26.9, 25.1, 7.6; ESIHRMS: Found: m/z 708.0899. Calcd for C24H28N7O9NaI: (M+Na)+ 708.0891.  3.5.2.3  Preparation of 5'-N3 dinucleoside 25 To a stirred solution of 5  (482.9 mg, 0.7045 mmol) in DMF (2.5 mL) was added NaN3 (91.6 mg, 1.409 mmol). The reaction was then stirred at 80 ºC for 4 h, whereupon the solvent was removed in vacuo. H2O (10 mL) was added to the residue and the mixture was extracted with CHCl3 (3 x 50 mL). The combined organic extracts were washed with brine and dried over anhydrous MgSO4. After evaporation of the solvent, the crude material was purified by flash column chromatography using step gradient elution (CHCl3 : EtOH 19 : 1 – CHCl3 : EtOH 9 : 1) to provide 2  in 83% yield (352 mg, 0.586 mmol). Compound 25 : White foamy solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.28 (3H, s, isopropylidene CH3), 1.46 (3H, s, isopropylidene CH3), 2.27 – 2.32 (2H, m, H2a" and H2b"), 3.52 – 3.61 (2H, m, H5a" and H5b"), 4.04 – 4.07 (1H, m, H4"), 4.14 – 4.17 (1H, m, H3"), 4.35 – 4.39 (1H, m, H4'), 4.58 (2H, s, Ha' and Hb'), 4.63 (1H, dd, J = 8.0, 14.0 Hz, H5b'), 4.75 (1H, dd, J = 5.2, 14.0 Hz, H5a'), 4.88 (1H, dd, J = 4.0, 6.4 Hz, H3'), 5.12 (1H, dd, J = 1.2, 6.0 Hz, H2'), 5.65 (2H, m, H5' and H5"), 5.77 (1H, d, J = 1.2 Hz, H1'), 6.12 (1H, t, J = 6.8 Hz, H1"), 7.67 – 7.70 (2H, m, H6' and H6"), 8.15 (1H, s, Hc'), 11.37 (1H, s, H1), 11.47 (1H, s, H2); 13C (100 MHz, DMSO-d6) δ(ppm) 163.3, 162.9, 150.4, 150.3, 143.7, 143.6, 140.7, 124.6, 113.4, 102.2, 101.9, 93.4, 85.4, 84.5, 83.7, 82.2, 81.5, 78.8, 62.0, 51.8, 51.3, 35.4, 26.8, 25.1; ESIHRMS: Found: m/z 623.1945. Calcd for C24H28N10O9Na: (M+Na)+ 623.1938.   97  3.5.2.4  Preparation of conjugate 18 via the "click" reaction To a stirred solution of cavitand 3 (30.7 mg, 0.0224 mmol) and nucleoside 2 (60.6 mg, 0.1008 mmol) in argon-purged DMSO (2.7 mL) was added a solution of copper(II) sulfate pentahydrate (75 µL, 0.04 M in argon-purged Milli-Q water, 0.00298 mmol) followed by a solution of cesium ascorbate, freshly prepared from the stoichiometric reaction between cesium carbonate and ascorbic acid (75 µL, 0.4 M in argon-purged Milli-Q water, 0.0298 mmol). The reaction was stirred at 80 °C for 24 h. The solvent was then removed in vacuo and the residue suspended in water. A few drops of ammonium hydroxide were added to remove the copper catalyst and the mixture was suction filtered. The residue, crude 1 , was washed with deionized water and allowed to suction dry, whereupon it was purified via step gradient flash chromatography (CHCl3 : MeOH 9 : 1 – CHCl3 : MeOH 85 : 15) to afford conjugate 1  in 36% yield (30.2 mg, 0.008 mmol). Compound 18 : White glassy solid; 1H (400 MHz, DMSO-d6) δ(ppm) 0.84 (12H, t, J = 7.2 Hz, CH3 feet), 1.20 – 1.41 (96H, m, long chain aliphatic feet and isopropylidene CH3), 2.15 – 2.22 (8H, m, CH2 feet), 2.25 – 2.29 (8H, m, H2a" and H2b"), 4.26 – 4.39 (16H, m, Hin, H3", H4', H4"), 4.55 – 4.76 (28H, m, Hd, Ha', Hb', H5a', H5b', H5a", H5b"), 4.88 (4H, dd, J = 4.0, 6.4 Hz, H3'), 4.96 (8H, s, Ha and Hb), 5.11 (4H, dd, J = 0.8, 6.4 Hz, H2'), 5.60 – 5.64 (8H, m, H5' and H5"), 5.75 (4H, s, H1'), 5.91 (4H, d, J = 5.6 Hz, Hout), 6.09 (4H, t, J = 6.8 Hz, H1"), 7.27 (4H, s, ArH), 7.57 (4H, d, J = 8.0 Hz, H6"), 7.65 (4H, d, J = 8.0 Hz, H6'), 8.10 (4H, s, Hc'), 8.15 (4H, s, Hc"), 11.33 (4H, s, Hinner), 11.46 (4H, s, Houter); 13C (100 MHz, DMSO-d6) δ(ppm) 163.9, 163.5, 150.94, 150.91, 148.1, 144.4, 144.2, 144.1, 141.2, 139.4, 125.72, 125.69, 125.2, 114.0, 102.7, 102.5, 94.0, 86.0, 85.4, 84.3, 82.1, 79.6, 62.7, 51.94, 51.88, 35.9, 31.9, 30.0, 29.9, 29.7, 29.4, 28.4, 27.4, 98  25.7, 22.7, 14.5; MS(MALDI-TOF): Found: m/z 3776.1. Calcd for C184H233N40O48: (M+H)+ 3773.1.  3.5.3  Synthesis of conjugate 27 (procedure similar to that of 18)  3.5.3.1  Preparation of 5'-OH dinucleoside 31 The procedure for the preparation of 31  was similar to that of 23 . Compound 31 : 96% yield; White foamy solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.28 (3H, s, isopropylidene CH3), 1.47 (3H, s, isopropylidene CH3), 2.08 – 2.15 (1H, m, H2b"), 2.28 – 2.33 (1H, m, H2a"), 3.14 (3H, s, N-Me), 3.15 (3H, s, N-Me), 3.52 – 3.61 (2H, m, H5a" and H5b"), 3.98 – 4.00 (1H, m, H4"), 4.19 – 4.21 (1H, m, H3"), 4.36 – 4.40 (1H, m, H4'), 4.56 (2H, s, Ha' and Hb'), 4.63 (1H, dd, J = 7.6, 14.0 Hz, H5b'), 4.75 (1H, dd, J = 4.8, 14.0 Hz, H5a'), 4.91 (1H, dd, J = 4.0, 6.4 Hz, H3'), 5.10 (1H, t, J = 5.2 Hz, hydroxyl OH), 5.14 (1H, dd, J = 1.6, 6.4 Hz, H2'), 5.76 (1H, d, J = 2.4 Hz, H5'), 5.78 (1H, d, J = 2.4 Hz, H5"), 5.80 (1H, d, J = 1.6 Hz, H1'), 6.12 (1H, dd, J = 6.0, 8.0 Hz, H1"), 7.73 (1H, d, J = 8.0 Hz, H6'), 7.90 (1H, d, J = 8.4 Hz, H6"), 8.13 (1H, s, Hc'); 13C (100 MHz, DMSO-d6) δ(ppm) 162.0, 161.8, 150.4, 150.3, 143.5, 141.7, 138.4, 124.5, 113.2, 100.7, 94.1, 85.4, 85.1, 84.7, 83.54, 83.50, 81.2, 78.7, 61.6, 61.1, 51.0, 36.7, 27.0, 26.9, 26.6, 24.8; ESIHRMS: Found: m/z 626.2171. Calcd for C26H33N7O10Na: (M+Na)+ 626.2187.  3.5.3.2  Preparation of 5'-I dinucleoside 32 The procedure for the preparation of 32  was similar to that of 24 . Compound 32 : 82% yield; White foamy solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.29 (3H, s, isopropylidene CH3), 1.48 (3H, s, isopropylidene CH3), 2.28 – 2.39 (2H, m, H2a" and H2b"), 3.16 99  (3H, s, N-Me), 3.17 (3H, s, N-Me), 3.42 (1H, dd, J = 6.4, 10.4 Hz, H5a" or H5b"), 3.51 (1H, dd, J = 6.4, 10.4 Hz, H5a" or H5b"), 4.09 (1H, td, J = 2.0, 6.4, 6.4 Hz, H4"), 4.15 – 4.18 (1H, m, H3"), 4.38 – 4.43 (1H, m, H4'), 4.62 – 4.68 (3H, m, Ha', Hb', H5b'), 4.78 (1H, dd, J = 4.8, 14.0 Hz, H5a'), 4.93 (1H, dd, J = 4.0, 6.4 Hz, H3'), 5.16 (1H, dd, J = 2.0, 6.8 Hz, H2'), 5.78 – 5.84 (3H, m, H5', H5", H1'), 6.18 (1H, dd, J = 6.4, 7.6 Hz, H1"), 7.74 (1H, d, J = 2.0 Hz, H6'), 7.76 (1H, d, J = 2.0 Hz, H6"), 8.17 (1H, s, Hc'); 13C (100 MHz, DMSO-d6) δ(ppm) 162.2, 161.9, 150.64, 150.55, 143.6, 141.9, 138.9, 124.8, 113.4, 101.2, 100.9, 94.4, 85.8, 85.7, 83.7, 83.3, 81.4, 80.8, 61.9, 51.3, 35.5, 27.3, 27.2, 26.9, 25.1, 7.4; ESIHRMS: Found: m/z 714.1415. Calcd for C26H33N7O9I: (M+H)+ 714.1385.  3.5.3.3  Preparation of 5'-N3 dinucleoside 26 The procedure for the preparation of 26  was similar to that of 25 . Compound 26 : 91% yield; White foamy solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.29 (3H, s, isopropylidene CH3), 1.48 (3H, s, isopropylidene CH3), 2.30 – 2.33 (2H, m, H2a" and H2b"), 3.16 (3H, s, N-Me), 3.17 (3H, s, N-Me), 3.54 – 3.64 (2H, m, H5a" and H5b"), 4.07 – 4.10 (1H, m, H4"), 4.16 – 4.19 (1H, m, H3"), 4.38 – 4.42 (1H, m, H4'), 4.59 (2H, s, Ha' and Hb'), 4.65 (1H, dd, J = 7.6, 14.0 Hz, H5b'), 4.78 (1H, dd, J = 4.8, 14.0 Hz, H5a'), 4.93 (1H, dd, J = 4.4, 6.4 Hz, H3'), 5.16 (1H, dd, J = 1.6, 6.4 Hz, H2'), 5.78 – 5.84 (3H, m, H1', H5', H5"), 5.77 (1H, d, J = 1.2 Hz, H1'), 6.17 (1H, t, J = 6.8 Hz, H1"), 7.74 (1H, d, J = 2.0 Hz, H6'), 7.76 (1H, d, J = 2.0 Hz, H6"), 8.16 (1H, s, Hc'); 13C (100 MHz, DMSO-d6) δ(ppm) 162.2, 161.9, 150.7, 150.6, 143.6, 141.9, 139.0, 124.8, 113.4, 101.1, 100.9, 94.4, 85.7, 83.7, 82.3, 81.4, 78.8, 62.1, 51.8, 51.3, 35.7, 27.3, 27.2, 26.8, 25.1; ESIHRMS: Found: m/z 629.2438. Calcd for C26H33N10O9: (M+H)+ 629.2432.  100  3.5.3.4  Preparation of conjugate 27 The procedure for the preparation of 27  was similar to that of 18 . Compound 27 : 36% yield; White glassy solid; 1H (400 MHz, DMSO-d6) δ(ppm) 0.83 (12H, t, J = 6.4 Hz, CH3 feet), 1.22 – 1.42 (96H, m, long chain aliphatic feet and isopropylidene CH3), 2.22 – 2.29 (16H, m, CH2 feet, H2a", H2b"), 3.09 (3H, s, N-Me), 3.13 (3H, s, N-Me), 4.25 – 4.39 (16H, m, Hin, H3", H4', H4"), 4.55 – 4.77 (28H, m, Hd, Ha', Hb', H5a', H5b', H5a", H5b"), 4.89 – 4.96 (12H, m, H3', Ha, Hb), 5.11 (4H, dd, J = 0.8, 6.4 Hz, H2'), 5.73 – 5.79 (12H, m, H1', H5', H5"), 5.88 (4H, d, J = 6.0 Hz, Hout), 6.11 (4H, t, J = 6.8 Hz, H1"), 7.26 (4H, s, ArH), 7.61 (4H, d, J = 8.0 Hz, H36"), 7.70 (4H, d, J = 8.0 Hz, H6'), 8.10 (4H, s, Hc'), 8.13 (4H, s, Hc"); 1H (400 MHz, CDCl3) δ(ppm) 0.88 (12H, t, J = 6.4 Hz, CH3 feet), 1.27 – 1.40 (96H, m, long chain aliphatic feet and isopropylidene CH3), 2.10 – 2.38 (12H, m, CH2 feet, H2a", H2b"), 3.25 (12H, s, N-Me), 3.30 (12H, s, N-Me), 4.28 – 5.09 (60H, m, H2', H3', H4', H5a', H5b', H3", H4", H5a", H5b", Ha, Hb, Ha', Hb', Hd, Hin), 5.53 (4H, s, H1'), 5.68 – 5.76 (12H, m, Hout, H5', H5"), 6.13 (4H, t, J = 6.0 Hz, H1"), 6.82 (4H, s, ArH), 7.02 (4H, d, J = 8.0 Hz, H6"), 7.12 (4H, d, J = 8.0 Hz, H6'), 7.63 (4H, s, Hc'), 7.76 (4H, s, Hc"); 13C (100 MHz, DMSO-d6) δ(ppm) 162.2, 161.9, 150.5, 147.4, 143.8, 143.6, 143.5, 141.9, 138.9, 138.8, 125.1, 124.7, 113.4, 101.1, 100.9, 94.4, 86.0, 85.6, 83.8, 81.9, 81.4, 78.9, 66.63, 66.60, 62.1, 51.3, 37.0, 35.5, 31.4, 29.33, 29.27, 29.11, 29.08, 28.8, 27.7, 27.2, 27.1, 26.8, 25.0, 22.1, 13.9; 13C (100 MHz, CDCl3) δ(ppm) 162.70, 162.65, 151.0, 148.2, 145.4, 144.3, 144.2, 141.3, 139.2, 139.1, 138.2, 124.8, 124.3, 114.8, 102.3, 99.7, 97.2, 87.3, 86.6, 84.6, 82.3, 82.2, 78.9, 77.4 (overlapped), 67.4, 63.3, 52.2, 51.5, 37.2, 36.9, 32.1, 30.2, 30.1, 30.0, 29.92, 29.90, 29.85, 29.6, 22.9, 14.3, 1.2; MS(MALDI-TOF): Found: m/z 3887.8. Calcd for C192H249N40O48: (M+H)+ 3885.3.  101  3.5.4  Supplementary 1H and 1H-1H COSY spectra Spectra begin on the following page. 102   Figure 3.12 1H NMR spectrum of 18 in DMSO-d6 at 25 ºC. 103   Figure 3.13 1H-1H COSY spectrum of 18 in DMSO-d6 at 25 ºC. 104   Figure 3.14 1H NMR spectrum of 27 in DMSO-d6 at 25 ºC. 105   Figure 3.15 1H-1H COSY spectrum of 27 in DMSO-d6 at 25 ºC. 106   Figure 3.16 1H NMR spectrum of 27 in CDCl3 at 25 ºC. 107   Figure 3.17 1H-1H COSY spectrum of 27 in CDCl3 at 25 ºC.108  Chapter 4: Self-assembly of a Thymine Quartet and Quadruplex via an Organic Template  4.1  Synopsis The previous chapters have described both uracil-based quartet and quadruplex constructs assembled from uridine units covalently coupled to a lipophilic cavitand. It was next sought to investigate the propensity of template-supported thymidine residues to adopt similar T-quartet and quadruplexes. Computational studies have indicated the decreased stability of T-quartets due to the additional steric bulk of the 5-Me group on thymine.89 Nevertheless, Bare and Sherman recently reported a discrete T-quartet assembled at the foot of a hydrophilic cavitand in methanol.130 This provided the impetus for the construction and characterization of its lipophilic counterpart, as well as the quadruplex.  This chapter documents the synthesis and characterization of conjugates 33  and 34 , which are the thymine analogs of 1  and 18  respectively (Figure 4.1). Comprehensive spectral studies were performed on the conjugates for complete 1H NMR signal assignment and to probe for the assembly of a quartet and quadruplex.  109   Figure 4.1 Side-on representations of conjugates 33 and 34. Outer and inner thymidine residues for 34 are labeled, as well as the 5' and 3' ribose ring positions showing the 5' – 3' outer – inner directional sense.  4.2  CPK modeling studies In contrast to the U-quartets of 1  and 18 , CPK models of 33 and 34  with the T-quartets set in-plane show the steric conflict between the projecting 5-Me group of each thymine base with the O2 atom of its neighbor. This leads to two possible structural modifications as proposed by theoretical models: 1) the tilting of the thymine rings in a propeller-twisted configuration to position the methyl groups off-plane or 2) an increase of the interbase distance leading to the O OC11H23 C11H23 O OC11H23C11H23O O O OO O O ONNNOO OHN NOO NNNOO OHNN OO NNN O O OHN NO O NNN O O OHNNO OMe Me Me Me33O OC11H23 C11H23 O OC11H23C11H23O O O OO O O ONNNOOHN NOO NNNOO HNN OO NNN O OHN NO O NNN O OHNNO ONN NOHN NO O O ONNNO OOHN NO O NNNO HNN OOOO N N N ONH NO O OOouterinner 5'3'5'34MeMe MeMe MeMe Me Me110  lengthening of the hydrogen bonds. The former allows for hydrogen bond lengths close to that of a U-quartet, while the latter maintains a planar but more weakly associated T-quartet. The CPK models do not provide information as to which state might be favored, but reflect theoretical expectations of unstable T-quartets relative to U-quartets.  4.3  Synthetic strategy  4.3.1  Synthesis of conjugates 33 and 34 The synthesis of 33  involved the Cu-catalyzed "click" coupling between cavitand 7  and azide 35 (Scheme 4.1). Molecular weight confirmation was provided by MALDI-TOF analysis. The conjugate is soluble in chloroform and methanol. 35  itself was prepared from 5-methyluridine via a similar procedure to that of 10 .   Scheme 4.1 Cu-catalyzed "click" reaction between 7 and 35 to access conjugate 33.  C11H23O 4OO + NHO ONO OON3 cat. Cu2+Na ascorbate C11H23O 4O ONNN NHO ONO OODMSO, 60 ºC 337 35Me Me20 h111  The preparation of conjugate 34  entailed the Cu-catalyzed "click" reaction between cavitand 7  and dinucleoside 39 (Scheme 4.2a), which was prepared via a similar procedure to that of 25 with the exception of the TBAF deprotection of silyl ether 36 (Scheme 4.2b). DMF was used as the solvent in this step due to the aggregation of 36  in THF to form an insoluble gel. This was also observed for 38  and 39 in chloroform. Thus, purification of these compounds could not be performed with standard silica gel column chromatography, and instead were re-precipitated and dried. These crude compounds were found to be sufficiently pure by NMR and were used directly in subsequent steps. The molecular weight of 34  was confirmed by MALDI-TOF analysis and it is freely soluble in chloroform and DMSO.  112   Scheme 4.2 a) Cu-catalyzed "click" reaction between 7 and 39 to afford conjugate 34. b) Synthesis of dinucleoside 39.  NHO ONOTBSO O N NN NHO ONOO O TBAFDMF, rt NHO ONOHO O N NN NHO ONOO O I2PPh3DMF, rtNHO ONOI O N NN NHO ONOO O NaN3DMF, 80 ºC NHO ONON3 O N NN NHO ONOO Oimidazole36 3738 39Me Me Me MeMe Me Me MeC11H23O 4OO + cat. Cu2+Cs ascorbate C11H23O 4O O NNNDMSO, 80 ºC 347 NHO ONON3 O N NN NHO ONOO O39 24 hNHO ONOO N NN NHO ONOO OMe Mea)b)Me Me113  4.3.2  Synthesis of N-methylated analogs Conjugates 40  and 41  with fully methylated imino positions were prepared via similar methods as those of uracil-based 17  and 27  respectively (Schemes 4.3 and 4.4). Molecular weight confirmation was provided by MALDI-TOF analysis. 40  exhibits good solubility in chloroform and methanol, and 41  in chloroform.   Scheme 4.3 Synthesis of conjugate 40.  C11H23O 4OO + NO ONO OON3 cat. Cu2+Na ascorbate C11H23O 4O ONNN NO ONO OODMSO, 60 ºC 407 42Me Me20 hMe Me114   Scheme 4.4 a) Cu-catalyzed "click" reaction between 7 and 46 to afford conjugate 41. b) Synthesis of dinucleoside 46.   NO ONOTBSO O N NN NO ONOO O TBAFTHF, rt NO ONOHO O N NN NO ONOO O I2PPh3DMF, rtNO ONOI O N NN NO ONOO O NaN3DMF, 80 ºC NO ONON3 O N NN NO ONOO Oimidazole43 4445 46Me Me Me MeMe Me Me MeC11H23O 4OO + cat. Cu2+Cs ascorbate C11H23O 4O O NNNDMSO, 80 ºC 417 NO ONON3 O N NN NO ONOO O46 24 hNO ONOO N NN NO ONOO OMe Mea)b)Me MeMe Me Me MeMe Me Me MeMe Me Me Me115  4.4  NMR characterization studies  4.4.1  1H signal assignments The 1H NMR spectrum of 33  in CDCl3 at room temperature is broadened with respect to 1 , likely due to conformational exchange. The imino, Hc, H6, ArH and 5-Me signals were assigned in CDCl3 and are listed in Table 4.1. Full signal assignment was completed in DMSO-d6, and the 1H and 1H-1H COSY spectra are appended in the Experimental Section. Figure 4.3a shows the condensed structure of 33  with all protons labeled. N-methylated analog 40  was likewise fully assigned in DMSO-d6 and the Hc, ArH, N-Me and 5-Me signals were assigned in CDCl3. Severe signal broadening is observed for 34  in CDCl3 at room temperature, similar to 18 . In this case, the imino signals are resolved into two distinguishable peaks, whereas in 18 they are coincided (Figure 4.2). Full 1H signal assignment of 34  was carried out in DMSO-d6, and the 1H and 1H-1H COSY spectra are provided in the Experimental Section. Figure 4.3b shows the condensed structure of 34  with all protons labeled. N-methylated analog 41  was likewise fully assigned in DMSO-d6 and the Hc, ArH, N-Me and 5-Me signals were assigned in CDCl3.  116   Figure 4.2 Portions of 400 MHz 1H spectra of 18 and 34 in CDCl3 at 25 ºC showing the imino proton signals.   Figure 4.3 Condensed structures of a) 33 and b) 34 with all protons labeled.  4.4.2  Regiochemical analysis by NOESY As with the previously reported conjugates, the 1,4-regiochemistry of all triazole moieties in 33 , 34 , 40  and 41  was confirmed via NOE correlations between the respective Hc and flanking methylene linker protons (Figure 4.4). 33C11H23O 4O ONNN NO ONO OO5-Me H6 H1'H2'H4' H3'HcH5b'H5a'HaHb HoutHinArH HdHiminoC11H23O 4O ONNN NO ONOO N NN NO ONOO OArH HdHoutHinHa Hb Hc"H5a" H5b"5-Me"H6" HinnerH1"H2a"H2b"Ha' Hb'Hc' H5a'H5b' HouterH6'5-Me' H1'H2'H3'H4'H3"H4"34a) b)117   Figure 4.4 Portions of 400 MHz NOE spectra in DMSO-d6 at 25 ºC showing appropriate crosspeaks signifying 1,4-regiochemistry at both triazole rings for a) 33 and b) 34. Conjugates 40 and 41 displayed similar crosspeaks and are therefore not shown.  4.4.3  Summary of 1H signal assignments Tables 4.1 through 4.4 summarize the 1H signal assignments for 33 , 34 , 40  and 41  respectively.            118  Proton δH CDCl3 (ppm) δH DMSO-d6 (ppm)  COSY correlation NOESY correlation Himino 10.87 11.43   5-Me 1.92 1.72 H6 H6 H6 7.00 7.42 5-Me (long range) 5-Me H1'  5.74 H2'*  H2'  5.03 H1'*, H3'  H3'  4.88 H2', H4'**  H4'  4.38 H3'**, H5a'/H5b'  H5a'  4.74 H4', H5b'  H5b'  4.65 H4', H5a'  Ha/Hb  4.93  Hc Hc 7.70 8.18  Ha/Hb, H5a'/H5b' Hd  4.55 -CH2- "feet" ArH Hin  4.26 Hout  Hout  5.90 Hin  ArH 6.84 7.27  Hd -CH2- 'feet'  2.31 Hd  long chain 'feet', isoprop. CH3  1.22 – 1.44   terminal CH3  0.84   * Expected but unobservable COSY signals. ** Weak COSY signals.  Table 4.1 1H signal assignments of 33 at 25 ºC.    119  Proton δH CDCl3 (ppm) δH DMSO-d6 (ppm)  COSY correlation NOESY correlation Houter  11.45   Hinner  11.31   Hc'  8.11  Ha'/Hb', H5a'/H5b' Hc"  8.17  Ha/Hb, H5a"/H5b" H6'  7.47 5-Me' 5-Me' H6"  7.36 5-Me" 5-Me" 5-Me'  1.74 H6' H6' 5-Me"  1.77 H6" H6" ArH 6.81 7.27  Hd H1'  5.74 H2'  H1"  6.10 H2a"/H2b"  H2'  5.07 H1', H3'*  H2a"/H2b", -CH2- 'feet'   2.16 – 2.29 H2b"/H2a"*  H3'  4.88 H2', H4'  Hout  5.90 Hin  Ha/Hb  4.97 Hb/Ha  H5a'/H5b', H5a"/H5b", Ha'/Hb', Hd    4.53 – 4.77   H3", H4', H4", Hin  4.28 – 4.39   long chain 'feet', isopropylidene CH3  1.23 – 1.43   terminal CH3  0.84   * Correlation indistinguishable due to signal overlapping in the region. Table 4.2 1H signal assignments of 34 at 25 ºC.  120  Proton δH CDCl3 (ppm) δH DMSO-d6 (ppm)  COSY correlation NOESY correlation N-Me 3.32 3.16   5-Me 1.88 1.78 H6 H6 H6 7.02 7.51 5-Me 5-Me H1'  5.80 H2'*  H2'  5.08 H1'*, H3'  H3', Ha/Hb  4.93 – 4.95 H2', Hb/Ha  H4'  4.40 H3'**, H5a'/H5b'  H5a'/H5b'  4.65 – 4.79 H4', H5b'/H5a'  Hc 7.66 8.18  Ha/Hb, H5a'/H5b' Hd  4.58 -CH2- "feet" ArH Hin  4.26 Hout  Hout  5.89 Hin  ArH 6.79 7.27  Hd -CH2- 'feet'  2.30 Hd  long chain 'feet', isoprop. CH3  1.24 – 1.46   terminal CH3  0.85   * Expected but unobservable COSY signals. ** Weak COSY signals. Table 4.3 1H signal assignments of 40 at 25 ºC.      121  Proton δH CDCl3 (ppm) δH DMSO-d6 (ppm)  COSY correlation NOESY correlation N-Me 3.27 3.12   N-Me 3.32 3.16   Hc' 7.62 8.10  Ha'/Hb', H5a'/H5b' Hc" 7.73 8.15  Ha/Hb, H5a"/H5b" 5-Me' 1.85 1.79 H6' H6' 5-Me" 1.91 1.80 H6" H6" H6' 6.98 7.54 5-Me' 5-Me' H6" 6.80 7.41 5-Me" 5-Me" H1'  5.77 H2'  H1"  6.14 H2a"/H2b"  H2'  5.09 H1'*, H3'  H2a"/H2b", -CH2- 'feet'  2.19 – 2.35 H2b"/H2a"*, Hd  H3', Ha/Hb  4.90 – 4.97 H2', H4'*, Hb/Ha  H3", H4', H4", Hin  4.25 – 4.41   H5a'/H5b', H5a"/H5b", Ha'/Hb', Hd  4.51 – 4.79   Hout  5.88 Hin  ArH 6.78 7.26  Hd long chain 'feet', isoprop. CH3  1.22 – 1.44   terminal CH3  0.84   * Correlation indistinguishable due to signal overlapping in the region. Table 4.4 1H signal assignments of 41 at 25 ºC.   122  4.4.4  NMR solution structure elucidation  4.4.4.1  Conjugate 33 1H NMR spectra of 33  in CDCl3 recorded at 25, –20 and –40 ºC show a steady downfield shift of the imino proton as the temperature is decreased, indicating its increasingly deshielded, hydrogen bound state (Figure 4.5a). At –20 and –40 ºC, a second, weaker imino signal of similar chemical shift is observed approximately 0.1 ppm downfield and upfield respectively of the more intense parent signals. NOESY performed at room temperature and –20 ºC shows no correlation between the imino and 5-Me protons, indicating the absence of quartets. The two imino signals observed at –20 ºC might thus arise from an observable exchange between major and minor non-quartet hydrogen-bound states whose conformations are unknown. At –40 ºC, the crosspeak is apparent for the imino signal at 11.8 ppm (Figure 4.5b), and not for the other, suggesting a major T-quartet species in exchange with a minor non-quartet state possibly identical to that found at –20 ºC with the same chemical shift (11.7 ppm). In accordance with the theoretical model,89 this T-quartet is proposed to adopt the more energetically favorable propeller-twist arrangement. In contrast, no correlations between the N-Me and 5-Me positions of 40  were observed at –40 ºC in CDCl3, confirming the central importance of the imino proton in the T-quartet assembly.  123   Figure 4.5 a) Portions of 400 MHz variable-temperature 1H spectra of 33 in CDCl3. Hydrogen-bound species not equivalent to, but approaching an ideal T-quartet are proposed to give rise to the signals at –20 ºC. Major species at –40 ºC is attributed to ideal T-quartet with minor non-ideal species in existence. b) Portion of 400 MHz NOE spectrum of 33 in CDCl3 at –40 ºC showing crosspeak between the imino proton and 5-Me indicative of a T-quartet.  Proximity between the thymine bases and underlying triazole linkers of 33  was indicated by observed NOE correlations between Hc and both H6 and 5-Me (Figure 4.6a) positions at –40 ºC, suggesting the stacking of these ring systems (Figure 4.6b). These interactions are neither observed at 25 ºC nor at –20 ºC confirming the lack of structure at these temperatures.  124   Figure 4.6 a) Portion of 400 MHz NOE spectrum of 33 in CDCl3 at –40 ºC showing correlations between Hc, H6 and 5-Me. b) Illustration of proposed twisted T-quartet of 33 illustrating stacked thymine and triazole rings with NOE interactions shown.  The syn glycosidic conformation of the thymine bases in 33  is evidenced by the characteristic NOE correlation between H6 and H1' (Figure 4.7).  125   Figure 4.7 a) Portion of 400 MHz NOE spectrum of 33 in CDCl3 at -40 ºC showing the H6/H1' crosspeak indicative of the syn glycosidic bond. b) The syn conformation of 33 with H6/H1' interaction shown.  The oligomeric state of 33  in CDCl3 at room temperature with respect to 40  was determined by DOSY NMR. Table 4.5 lists the measured diffusion constants of Hc for both compounds that are in close agreement, indicating their identical oligomeric states. Since 40  is unable to form hydrogen bonds, it is assumed to be unimolecular under the present conditions, and therefore 33  is also unimolecular.       Table 4.5 Hc diffusion constants (D) of 33 and 40 in CDCl3 at 25 ºC (2.7 mM). Compound D (x10-10 m2 s-1) Ratio 33 3.69 ± 0.10 0.95 40 3.46 ± 0.10 126  Attempts to conduct DOSY measurements at –40 ºC were unsuccessful due to instrument limitations. Temperature stability is crucial in DOSY experiments, as any fluctuation generates convection currents in the solvent, especially one of low viscosity such as CDCl3, resulting in inaccurate measurements. Maintenance of a stable temperature as low as –40 ºC was not possible with the current instrumentation, and intermittent temperature spikes of up to 1 ºC were observed. Reliable readings thus could not be obtained. This problem could not be circumvented with the use of smaller diameter NMR tubes. It is noted, however, that the 1H NMR spectrum of 33  in CDCl3 at –40 ºC shows no evidence of aggregation as the signals remain well resolved.  4.4.4.2  Conjugate 34 The NOE spectrum of 34  in DMSO-d6 at room temperature shows crosspeaks of different intensities between both sets of imino protons and the respective 5-Me positions, consistent with a quadruplex assembly composed of a more tightly bound inner quartet (Hinner = 11.32 ppm, 5-Me" = 1.77 ppm) capped by an outer quartet (Houter = 11.45 ppm, 5-Me' = 1.75 ppm) similar to the U-quadruplex system reported in 18 (Figure 4.8a). It is proposed that the inner T-quartet assumes the propeller-twisted configuration, allowing for shorter and thus stronger hydrogen bonds, while the outer T-quartet is planar giving rise to longer and weaker hydrogen bonds and hence a more weakly associated system. NOE connections between Hc" and H6", as well as Hc' to both H6' and H6", position all four ring systems (both triazole and both thymine) in close proximity indicating intercalation of the triazole and thymine rings in a fully stacked quadruplex (Figure 4.8b). Thus, ring stacking via π-π interactions is expected to be a major contributor to the stability of this scaffold since thymine systems are unstable with respect 127  to uracil. This was investigated and is discussed in Section 4.4.4.3. A visualization of the proposed assembly is presented in Figure 4.9c. NOE interactions are also displayed therein.   Figure 4.8 Portions of 400 MHz NOE spectrum of 34 in DMSO-d6 at 25 ºC showing a) Imino/5-Me crosspeaks indicative of quadruplex assembly and b) Hc/H5/5-Me crosspeaks indicative of a fully intercalated scaffold. c) Illustration of the quadruplex assembly in 34 with planar outer quartet and propeller-twisted inner quartet. NOE connections are labeled.  NOESY performed on 41  in DMSO-d6 at 25 ºC revealed no correlations between either sets of N-Me and 5-Me signals, confirming the absence of quartets as expected. Likewise, no correlations were found between the imino and 5-Me protons of dinucleoside 39 , although water-mediated exchange between the imino protons is apparent from their mutual crosspeaks as 128  well as to residual water in the NMR solvent (Figure 4.9), a process also observed in the uracil analog 25 . Solvent exclusion by the closed, hydrogen bound quadruplex system in 34  precludes this process.   Figure 4.9 a) Portion of 400 MHz NOE spectrum of 39 in DMSO-d6 at 25 ºC showing mutual imino crosspeaks and to H2O. b) Imino protons labeled in the structure of 39.  Syn glycosidic bonds are present in both the ribose rings of 34  as represented by NOE crosspeaks between H6' and H1" as well as H6" and H1" (Figure 4.10).  129   Figure 4.10 a) Portion of 400 MHz NOE spectrum of 34 in DMSO-d6 at 25 ºC showing crosspeaks between the H6 and H1 protons of both nucleosides. b) NOE correlations in the syn configuration of 34.  DOSY measurements of 34  and 41  revealed the unimolecularity of both compounds in DMSO-d6 at room temperature, as the diffusion constant for the observed Hc" protons are in close agreement to within 4%. In CDCl3, the ArH protons were observed instead due to the overlap of Hc' and Hc" for 34 . The diffusion constant for 34  in CDCl3 was found to be 81% that of 41 , revealing its bimolecular state and confirming the earlier hypothesis of the aggregation of 34 in CDCl3. Table 4.6 summarizes all the measured diffusion constants for both conjugates.       Table 4.6 Diffusion constants (D) of 34 and 41 in CDCl3 and DMSO-d6 at 25 ºC (2.7 mM). Solvent Signal 34 41 Ratio CDCl3 ArH 2.66 ± 0.10 3.29 ± 0.10 0.81 DMSO-d6 Hc" 0.68 ± 0.10 0.71 ± 0.10 0.96 130  4.4.4.3  Further investigations on the quadruplex ring stacking effect To obtain further insight on the effect of ring stacking on the quadruplex assembly of 34 , hemimethylated conjugate 47  was designed in which only the outer thymine imino positions are methylated (Figure 4.11).   Figure 4.11 Side-on view of conjugate 47.  47  was accessed by the Cu-catalyzed "click" reaction between cavitand 7  and dinucleoside 51 (Scheme 4.5a), prepared with similar chemistry to that of 39  and 46  (Scheme 4.5b).  O OC11H23 C11H23 O OC11H23C11H23O O O OO O O ONNNOOHN NOO NNNOO HNN OO NNN O OHN NO O NNN O OHNNO ONN NON NO O O ONN NO OON NO O NNNO NN OOOONN N ON NO O OOouterinner 5'3'5'47MeMe MeMe MeMe Me Me MeMeMeMe131   Scheme 4.5 a) Cu-catalyzed "click" reaction between 7 and 51 to afford conjugate 47. b) Synthesis of dinucleoside 51.  Assignment of the 1H NMR signals was completed in DMSO-d6 with the use of 1H-1H COSY and NOESY techniques as with all other conjugates described thus far in this work. 1,4-NHO ONOTBSO O N NN NO ONOO O TBAFTHF, rt NHO ONOHO O N NN NO ONOO O I2PPh3DMF, rtNHO ONOI O N NN NO ONOO O NaN3DMF, 80 ºC NHO ONON3 O N NN NO ONOO Oimidazole48 4950 51Me Me Me MeMe Me Me MeC11H23O 4OO + cat. Cu2+Cs ascorbate C11H23O 4O O NNNDMSO, 80 ºC 477 NHO ONON3 O N NN NO ONOO O51 24 hNHO ONOO N NN NO ONOO OMe Mea)b)Me MeMe MeMe MeMe Me132  regiochemistry at both triazole rings and all-syn glycosidic bonds were likewise confirmed with the observation of the appropriate NOE correlations (Figure 4.12). Table 4.7 lists all the signal assignments, and the 1H and 1H-1H COSY spectra are provided in the Experimental Section.   Figure 4.12 Portions of 400 MHz NOE spectrum of 47 in DMSO-d6 at 25 ºC showing a) crosspeaks between triazole protons and the respective flanking methylene linkers indicative of uniform 1,4-regiochemistry and b) crosspeaks between H6 and H1 protons of both thymidine residues indicative of all-syn glycosidic bond angles.          133  Proton δH DMSO-d6 (ppm)  COSY correlation NOESY correlation N-Me 3.16   Hinner 11.31   Hc' 8.09  Ha'/Hb', H5a'/H5b' Hc" 8.16  Ha/Hb, H5a"/H5b" H6' 7.54 5-Me' 5-Me' H6" 7.36 5-Me" 5-Me" 5-Me' 1.80 H6' H6' 5-Me" 1.77 H6" H6" ArH 7.27  Hd H1' 5.78 H2'  H1" 6.10 H2a"/H2b"  H2' 5.09 H1', H3'*  H2a"/H2b", -CH2- 'feet' 2.16 – 2.28 H2b"/H2a"*  H3' 4.91 H2', H4'  Hout 5.90 Hin  Ha/Hb 4.98 Hb/Ha  H5a'/H5b', H5a"/H5b", Ha'/Hb', Hd 4.55 – 4.79   H3", H4', H4", Hin 4.27 – 4.41   long chain 'feet', isopropylidene CH3 1.23 – 1.43   terminal CH3 0.85   * Correlation indistinguishable due to signal overlapping in the region. Table 4.7 1H signal assignments of 47 in DMSO-d6 at 25 ºC.  134  The assembly of the inner T-quartet of 47  in DMSO-d6 is indicated by an NOE correlation observed between Hinner and 5-Me" (Figure 4.13a). No crosspeak was observed between the N-Me and 5-Me' groups, ruling out the presence of an outer quartet as expected. Evidence of ring stacking was provided by Hc"/H6" and Hc'/H6' correlations (Figure 4.13b). Unlike 34 , the Hc'/H6" connection was not observed, but a Hc'/5-Me" crosspeak is visible instead to indicate proximity between the outer triazole and inner thymine. This could be due to a conformational distortion of the outer N-methylated thymine layer as a result of additional steric bulk imparted by the N-Me groups (Figure 4.13c), thereby rotating the triazole rings to position Hc' close to 5-Me" instead of H6". No evidence of a quartet assembly was observed in the NOE spectrum of 33 (lacking the outer layer) in DMSO-d6, unmasking the crucial role of ring stacking in stabilizing the inner quartet of 47  and the overall quadruplex of 34 . π-π interactions are believed to be the driving force of this stacking. Of course, the contribution of the outer U- and T-quartets of 18  and 34  respectively towards overall U- and T-quadruplex stability is not discounted, and instead is believed to be substantial. Rather, the synergy of hydrogen bonding and π-π interactions in the stabilization of these otherwise unstable motifs has been demonstrated.  135   Figure 4.13 Portions of 400 MHz NOE spectrum of 47 in DMSO-d6 at 25 ºC showing a) Hinner/5-Me" crosspeak indicative of an inner T-quartet assembly and b) crosspeaks implying ring stacking. c) Illustration of the proposed assembly in 47 with a distorted outer layer. NOE correlations are labeled with red arrows.  DOSY measurements confirmed that 47  remains unimolecular in DMSO-d6 with the diffusion constant of Hc within 1% of 41  (Table 4.8).       Table 4.8 Hc" diffusion constants (D) of 34 and 41 in CDCl3 and DMSO-d6 at 25 ºC (2.7 mM). Compound D (x10-10 m2 s-1) Ratio 47 0.70 ± 0.10 0.99 41 0.71 ± 0.10 136  4.4.5  CD spectroscopic studies of 33 and 40 The CD spectra of 33  and 40  in both chloroform and methanol at room temperature are indistinguishable with λmax values at approximately 260 nm, indicating identical structural states and substantiating the NMR evidence of the non-existence of a quartet in 33 under these conditions (Figure 4.14). The spectrum of 1 in chloroform is provided for reference. Treatment of 33  with strontium picrate Sr(pic)2 yielded no evidence of metal-induced quartet assembly, with the resultant spectrum indistinguishable from the others. These results further demonstrate the instability of the T-quartet in the solution state under ambient conditions, even in the presence of metal cations.   Figure 4.14 CD spectra of 33 and 34 in chloroform and methanol. (Spectrum of 1 in chloroform provided for reference) 137  4.5  Experimental section  4.5.1  General information 1H NMR spectra were measured on a Bruker Avance 400 MHz in DMSO-d6 [using DMSO (for 1H, δ = 2.50) as internal standard] or in CDCl3 [using CHCl3 (for 1H, δ = 7.26) as internal standard]. 13C NMR spectra were measured on a Bruker Avance 400 MHz spectrometer in DMSO-d6 [using DMSO (for 13C, δ = 39.5) as internal standard]. Chemical shifts are reported in ppm from tetramethylsilane. The following abbreviations are used to explain the multiplicities: s = singlet, d = doublet, dd = doublet of doublets, t = triplet, td = triplet of doublets, q = quartet, m = multiplet, br = broad. 2D NOESY spectra were acquired with tmix = 800 ms and d1 = 1500 ms. COSY spectra were acquired with d1 = 1500 ms. DOSY experiments were carried out on a Bruker Avance 400inv spectrometer equipped with a 5mm BBI Z-gradient probe (inverse broadband probe with z-gradient coil). All measurements were performed using the BPLED (ledbpgp2s) pulse sequence. The length of the diffusion gradient was optimized for each sample to obtain at least 95% signal attenuation due to diffusion. Δ and δ values respectively were found to be 60 ms and 3.6 ms (for 33  in CDCl3), 60 ms and 4 ms (for 40 in CDCl3),  60 ms and 3 ms (for 34 in CDCl3), 60 ms and 4.4 ms (for 41  in CDCl3), 65 ms and 10 ms (for 34 , 41  and 47  in DMSO-d6) . Eddy current (te) was standardized at 5 ms. All measurements were taken at 298K with sample concentrations of 2.7 mM. Curve fits and diffusion coefficients were generated using the SimFit algorithm on the Bruker Topspin 2.1 software. MALDI-TOF mass analyses were performed on a Bruker Autoflex spectrometer in the reflectron mode using 2,5-dihydroxybenzoic acid (DHB) as the matrix. Flash column chromatography was performed using Silicycle 60 silica gel and eluting solvents were used 138  directly from their commercial bottles. Solvents and reagents for reactions were purchased commercially and used without further purification.  4.5.2  Synthesis of conjugates 33 and 40 To a stirred solution of cavitand 7 (42.1 mg, 0.0307 mmol) and nucleoside 35 (44.7 mg, 0.138 mmol) in argon-purged DMSO (3.8 mL) was added a solution of CuSO4•5H2O (102 µL, 0.04 M in argon-purged Milli-Q water, 0.00408 mmol) followed by a solution of sodium ascorbate (102 µL, 0.4 M in argon-purged Milli-Q water, 0.0408 mmol). The reaction was stirred at 60 °C for 20 h. The solvent was then removed in vacuo and the residue suspended in water. A few drops of ammonium hydroxide were added to remove the copper catalyst and the mixture was suction filtered. The residue, crude 33 , was washed with deionized water and allowed to suction dry, whereupon it was purified via step gradient flash chromatography (CHCl3 : MeOH 49 : 1 – CHCl3 : MeOH 19 : 1) to afford pure 33  in 44% yield (25.6 mg, 0.0096 mmol). Compound 33 : White glassy solid; 1H (400 MHz, DMSO-d6) δ(ppm) 0.84 (12H, t, J = 6.4 Hz, CH3 feet), 1.22 – 1.44 (96H, m, long chain aliphatic feet and isopropylidene CH3), 1.72 (12H, s, 5-Me), 2.31 (8H, br, -CH2- feet), 4.26 (4H, d, J = 7.2 Hz, Hin), 4.38 (4H, m, H4'), 4.55 (4H, t, J = 8.0 Hz, Hd), 4.65 (4H, dd, J = 6.8, 13.6 Hz, H5b'), 4.74 (4H, dd, J = 4.8, 14.4 Hz, H5a'), 4.87 – 4.89 (4H, m, H3'), 4.93 (8H, s, Ha, Hb), 5.03 (4H, dd, J = 1.6, 6.4 Hz, H2'), 5.74 (4H, s, H1'), 5.90 (4H, d, J = 6.8 Hz, Hout), 7.27 (4H, s, ArH), 7.42 (4H, s, H6), 8.18 (4H, s, Hc), 11.43 (4H, s, NH); 13C (100 MHz, DMSO-d6) δ(ppm) 163.8, 150.3, 147.5, 143.8, 143.5, 138.7, 138.7, 124.9, 113.5, 110.0, 92.6, 84.7, 83.5, 81.3, 66.6, 51.1, 31.3, 29.2, 29.08, 29.06, 28.8, 27.7, 26.8, 25.1, 22.1, 13.9, 11.9; MS(MALDI-TOF): Found: m/z 2665.8. Calcd for C140H189N20O32: (M+H)+ 2664.1. 139   The synthesis of 40  was carried out following the same procedure with the coupling of cavitand 7  to nucleoside 42 . Compound 40 : White powdery solid; 1H (400 MHz, DMSO-d6) δ(ppm) 0.85 (12H, t, J = 6.8 Hz, CH3 feet), 1.24 – 1.46 (96H, m, long chain aliphatic feet and isopropylidene CH3), 1.78 (12H, s, 5-Me), 2.30 (8H, br, -CH2- feet), 3.16 (12H, s, N-Me), 4.26 (4H, d, J = 5.2 Hz, Hin), 4.40 – 4.41 (4H, m, H4'), 4.55 – 4.60 (4H, m, Hd), 4.65 – 4.79 (8H, m, H5a', H5b'), 4.93 – 4.95 (12H, m, H3', Ha, Hb), 5.08 (4H, d, J = 5.2 Hz, H2'), 5.80 (4H, s, H1'), 5.89 (4H, d, J = 5.2 Hz, Hout), 7.27 (4H, s, ArH), 7.51 (4H, s, H6), 8.18 (4H, s, Hc); 13C (100 MHz, DMSO-d6) δ(ppm) 163.9, 150.4, 147.4, 143.8, 143.5, 138.7, 137.2, 125.0, 113.4, 108.6, 93.6, 85.0, 83.6, 81.3, 66.6, 51.1, 31.3, 29.2, 29.10, 29.06, 28.8, 27.7, 27.4, 26.8, 25.1, 22.1, 13.9, 12.5; MS(MALDI-TOF): Found: m/z 2720.6. Calcd for C144H197N20O32: (M+H)+ 2720.2.  4.5.3  Synthesis of conjugates 34, 41 and 47  4.5.3.1  Preparation of 5'-OH dinucleoside 37 To a stirred solution of 36  (0.40 g, 0.56 mmol) in DMF (6 mL) was added TBAF (0.7 mL of a 1.0 M solution in THF, 0.67 mmol), and the mixture was stirred for 2 h. The solvent was then removed in vacuo and the residue was co-evaporated thrice with toluene. The crude material was purified by flash column chromatography (CHCl3 : EtOH 9 : 1) to afford 37  in 56% yield (0.19 g, 0.31 mmol). Compound 37 : White flaky solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.29 (3H, s, isopropylidene CH3), 1.48 (3H, s, isopropylidene CH3), 1.77 (3H, s, 5-Me), 1.78 (3H, s, 5-Me), 140  2.09 – 2.27 (2H, m, H2a'', H2b"), 3.53 – 3.63 (2H, m, H5a" and H5b"), 3.95 – 3.97 (1H, m, H4"), 4.20 – 4.22 (1H, m, H3"), 4.35 – 4.39 (1H, m, H4'), 4.57 (2H, s, Ha' and Hb'), 4.65 (1H, dd, J = 7.6, 14.0 Hz, H5b'), 4.76 (1H, dd, J = 4.8, 14.0 Hz, H5a'), 4.89 (1H, dd, J = 4.4, 6.4 Hz, H3'), 5.08 – 5.12 (2H, m, H2', hydroxyl OH), 5.76 (1H, d, J = 1.6 Hz, H1'), 6.11 (1H, dd, J = 5.6, 8.0 Hz, H1"), 7.49 (1H, s, H6'), 7.70 (1H, s, H6"), 8.14 (1H, s, Hc'), 11.31 (1H, s, H2), 11.46 (1H, s, H1); 13C (100 MHz, DMSO-d6) δ(ppm) 163.9, 163.7, 150.5, 150.3, 143.9, 138.8, 136.0, 124.6, 113.5, 109.6, 109.5, 92.6, 84.9, 84.6, 83.8, 83.5, 81.3, 79.1, 61.7, 61.5, 51.2, 36.3, 26.9, 25.1, 12.3, 11.9; ESIHRMS: Found: m/z 604.2374. Calcd for C26H34N7O10: (M+H)+ 604.2367.  4.5.3.2  Preparation of 5'-OH dinucleoside 44 (similar procedure used for 49) To a stirred solution of 43  (1.13 g, 1.52 mmol) in THF (15 mL) was added TBAF (1.8 mL of a 1.0 M solution in THF, 1.82 mmol), and the mixture was stirred for 2 h. The solvent was then removed in vacuo and the residue re-dissolved in CHCl3. The solvent was removed in vacuo once again, and the crude material was purified by flash column chromatography using step gradient elution (CHCl3 : EtOH 49 : 1 – CHCl3 : EtOH 19 : 1) to afford 44  in 96% yield (0.92 g, 1.46 mmol). Compound 44 : White flaky solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.29 (3H, s, isopropylidene CH3), 1.48 (3H, s, isopropylidene CH3), 1.83 (3H, s, 5-Me), 1.84 (3H, s, 5-Me), 2.12 – 2.33 (2H, m, H2a", H2b''), 3.17 (3H, s, N-Me), 3.18 (3H, s, N-Me), 3.54 – 3.64 (2H, m, H5a" and H5b"), 3.98 – 4.00 (1H, m, H4"), 4.21 – 4.23 (1H, m, H3"), 4.38 – 4.42 (1H, m, H4'), 4.57 (2H, s, Ha' and Hb'), 4.66 (1H, dd, J = 7.6, 14.0 Hz, H5b'), 4.77 (1H, dd, J = 4.8, 14.0 Hz, H5a'), 4.92 (1H, dd, J = 4.0, 6.0 Hz, H3'), 5.10 – 5.14 (2H, m, H2', hydroxyl OH), 5.79 (1H, d, J = 1.6 141  Hz, H1'), 6.16 (1H, dd, J = 6.0, 8.0 Hz, H1"), 7.57 (1H, s, H6'), 7.78 (1H, s, H6"), 8.14 (1H, s, Hc'); 13C (100 MHz, DMSO-d6) δ(ppm) 162.9, 162.8, 150.5, 150.4, 143.8, 137.3, 134.4, 124.7, 113.4, 108.5, 108.4, 93.6, 85.1, 84.9, 84.7, 83.6, 81.2, 78.8, 61.7, 61.4, 51.2, 36.6, 27.5, 27.4, 26.8, 25.1, 13.0, 12.5; ESIHRMS: Found: m/z 654.2493. Calcd for C28H37N7O10Na: (M+Na)+ 654.2500. Compound 49 : White flaky solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.29 (3H, s, isopropylidene CH3), 1.48 (3H, s, isopropylidene CH3), 1.78 (3H, s, 5-Me), 1.82 (3H, s, 5-Me), 2.10 – 2.26 (2H, m, H2a", H2b''), 3.18 (3H, s, N-Me), 3.54 – 3.62 (2H, m, H5a" and H5b"), 3.95 (1H, d, J = 1.6 Hz, H4"), 4.20 – 4.21 (1H, m, H3"), 4.37 – 4.41 (1H, m, H4'), 4.57 (2H, s, Ha' and Hb'), 4.66 (1H, dd, J = 7.6, 14.0 Hz, H5b'), 4.78 (1H, dd, J = 4.8, 14.0 Hz, H5a'), 4.92 (1H, dd, J = 4.4, 6.4 Hz, H3'), 5.11 – 5.12 (2H, m, H2', hydroxyl OH), 5.79 (1H, d, J = 1.6 Hz, H1'), 6.11 (1H, dd, J = 6.0, 8.4 Hz, H1"), 7.57 (1H, s, H6'), 7.70 (1H, s, H6"), 8.14 (1H, s, Hc'), 11.30 (1H, s, H2); 13C (100 MHz, DMSO-d6) δ(ppm) 163.7, 163.0, 150.4, 143.8, 137.4, 135.9, 124.7, 113.5, 109.5, 108.6, 93.7, 85.2, 84.6, 83.8, 83.6, 81.3, 79.1, 61.8, 61.5, 51.2, 36.3, 27.4, 26.9, 25.1, 12.6, 12.3; ESIHRMS: Found: m/z 640.2341. Calcd for C27H35N7O10Na: (M+Na)+ 640.2343.  4.5.3.3  Preparation of 5'-I dinucleoside 38 To a stirred solution of 37  (0.19 g, 0.31 mmol) in DMF (3 mL) was added PPh3 (0.27 g, 1.04 mmol), imidazole (0.14 g, 2.08 mmol) and I2 (0.25 g, 1.0 mmol, 4 portions over 5 mins) in that order. The reaction was stirred at room temperature overnight, whereupon the solvent was removed in vacuo. H2O (10 mL) was added to the residue and the mixture was extracted with CHCl3 (3 x 50 mL). The combined organic extracts were washed with brine and dried over 142  anhydrous MgSO4. After evaporation of the solvent, the crude material was reprecipitated from CHCl3 to afford 38  in 89% yield (0.2 g, 0.28 mmol). Compound 38 : White solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.29 (3H, s, isopropylidene CH3), 1.48 (3H, s, isopropylidene CH3), 1.77 (3H, s, 5-Me), 1.81 (3H, s, 5-Me), 2.23 – 2.39 (2H, m, H2a" and H2b"), 3.40 – 3.54 (2H, m, H5a", H5b"), 4.04 – 4.07 (1H, m, H4"), 4.16 – 4.18 (1H, m, H3"), 4.36 – 4.40 (1H, m, H4'), 4.62 – 4.68 (3H, m, Ha', Hb', H5b'), 4.77 (1H, dd, J = 4.8, 14.0 Hz, H5a'), 4.89 (1H, dd, J = 4.0, 6.0 Hz, H3'), 5.09 (1H, dd, J = 1.6, 6.4 Hz, H2'), 5.76 (1H, d, J = 2.0 Hz, H1'), 6.16 (1H, dd, J = 6.0, 8.8 Hz, H1"), 7.50 (1H, s, H6'), 7.56 (1H, s, H6''), 8.17 (1H, s, Hc'), 11.36 (1H, s, H2), 11.48 (1H, s, H1); 13C (100 MHz, DMSO-d6) δ(ppm) 163.9, 163.6, 150.4, 150.3, 143.7, 138.9, 136.0, 124.7, 113.5, 109.9, 109.6, 92.6, 84.9, 84.3, 83.5, 82.9, 81.3, 80.9, 61.9, 51.2, 35.0, 26.9, 25.1, 12.1, 12.0, 7.6; ESIHRMS: Found: m/z 714.1379. Calcd for C26H33N7O9I: (M+H)+ 714.1385.  4.5.3.4  Preparation of 5'-I dinucleoside 45 (similar procedure used for 50) To a stirred solution of 44  (0.92 g, 1.46 mmol) in DMF (6 mL) was added PPh3 (1.26 g, 4.81 mmol), imidazole (0.66 g, 9.62 mmol) and I2 (1.18 g, 4.67 mmol, 4 portions over 5 mins) in that order. The reaction was stirred at room temperature overnight, whereupon the solvent was removed in vacuo. H2O (10 mL) was added to the residue and the mixture was extracted with CHCl3 (3 x 50 mL). The combined organic extracts were washed with brine and dried over anhydrous MgSO4. After evaporation of the solvent, the crude material was purified by flash column chromatography using step gradient elution (CHCl3 : EtOH 49 : 1 – CHCl3 : EtOH 24 : 1) to provide 45  in 60% yield (0.64 g, 0.86 mmol). 143  Compound 45 : White foamy solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.29 (3H, s, isopropylidene CH3), 1.48 (3H, s, isopropylidene CH3), 1.83 (3H, s, 5-Me), 1.86 (3H, s, 5-Me), 2.25 – 2.40 (2H, m, H2a" and H2b"), 3.17 (3H, s, N-Me), 3.19 (3H, s, N-Me), 3.40 – 3.55 (2H, m, H5a", H5b"), 4.08 (1H, td, J = 2.0, 6.4, 6.4 Hz, H4"), 4.17 – 4.18 (1H, m, H3"), 4.38 – 4.42 (1H, m, H4'), 4.59 – 4.69 (3H, m, Ha', Hb', H5b'), 4.78 (1H, dd, J = 4.8, 14.4 Hz, H5a'), 4.92 (1H, dd, J = 4.4, 6.4 Hz, H3'), 5.11 (1H, dd, J = 1.6, 6.4 Hz, H2'), 5.79 (1H, d, J = 1.6 Hz, H1'), 6.21 (1H, dd, J = 6.0, 8.4 Hz, H1"), 7.58 (1H, s, H6'), 7.61 (1H, s, H6"), 8.17 (1H, s, Hc'); 13C (100 MHz, DMSO-d6) δ(ppm) 163.0, 162.7, 150.6, 150.4, 143.6, 137.4, 134.5, 124.9, 113.5, 108.9, 108.6, 93.7, 85.4, 85.2, 83.6, 83.1, 81.3, 80.8, 61.9, 51.2, 35.2, 27.6, 27.5, 26.9, 25.1, 12.8, 12.6, 7.5; ESIHRMS: Found: m/z 742.1694. Calcd for C28H37N7O9I: (M+H)+ 742.1698. Compound 50 : Yield: 86%. White flakes; 1H (400 MHz, DMSO-d6) δ(ppm) 1.29 (3H, s, isopropylidene CH3), 1.48 (3H, s, isopropylidene CH3), 1.81 (3H, s, 5-Me), 1.83 (3H, s, 5-Me), 2.22 – 2.39 (2H, m, H2a" and H2b"), 3.18 (3H, s, N-Me), 3.39 – 3.54 (2H, m, H5a", H5b"), 4.05 (1H, td, J = 1.6, 6.4, 6.4 Hz, H4"), 4.16 – 4.17 (1H, m, H3"), 4.37 – 4.42 (1H, m, H4'), 4.61 – 4.69 (3H, m, Ha', Hb', H5b'), 4.78 (1H, dd, J = 4.8, 14.4 Hz, H5a'), 4.92 (1H, dd, J = 4.4, 6.4 Hz, H3'), 5.11 (1H, dd, J = 1.6, 6.4 Hz, H2'), 5.79 (1H, d, J = 1.6 Hz, H1'), 6.16 (1H, dd, J = 6.0, 8.4 Hz, H1"), 7.56 (1H, s, H6'), 7.58 (1H, s, H6"), 8.17 (1H, s, Hc'), 11.37 (1H, s, H2); 13C (100 MHz, DMSO-d6) δ(ppm) 163.6, 162.9, 150.4, 143.6, 137.4, 136.0, 124.8, 113.5, 109.9, 108.6, 93.7, 85.2, 84.3, 83.6, 82.9, 81.3, 80.9, 61.9, 51.2, 35.0, 27.5, 26.9, 25.1, 12.6, 12.1, 7.6; ESIHRMS: Found: m/z 750.1368. Calcd for C27H34N7O9NaI: (M+Na)+ 750.1360.  144  4.5.3.5  Preparation of 5'-N3 dinucleoside 39 To a stirred solution of 38  (0.2 g, 0.28 mmol) in DMF (2.5 mL) was added NaN3 (37 mg, 0.56 mmol). The reaction was then stirred at 80 ºC for 3 h, whereupon the solvent was removed in vacuo. H2O was added and the mixture was extracted with EtOAc (3 x 25 mL). The combined organic extracts were washed with brine and dried over anhydrous MgSO4. After evaporation of the solvent, the residue was taken up in cold acetone, triturated, suction filtered and washed twice with cold acetone. The resultant white powder 39  was collected (61.5 mg, 0.1 mmol, 36% yield) and pure enough (vide NMR) for use. Compound 39 : White solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.30 (3H, s, isopropylidene CH3), 1.49 (3H, s, isopropylidene CH3), 1.78 (3H, s, 5-Me), 1.81 (3H, s, 5-Me), 2.24 – 2.37 (2H, m, H2a" and H2b"), 3.56 – 3.64 (2H, m, H5a" and H5b"), 4.06 – 4.07 (1H, m, H4"), 4.18 – 4.19 (1H, m, H3"), 4.38 – 4.39 (1H, m, H4'), 4.57 – 4.69 (3H, m, H5b', Ha', Hb'), 4.77 (1H, dd, J = 5.2, 14.0 Hz, H5a'), 4.90 (1H, t, J = 4.4 Hz, H3'), 5.10 (1H, d, J = 6.4 Hz, H2'), 5.77 (1H, s, H1'), 6.16 (1H, t, J = 6.4 Hz, H1"), 7.51 (1H, s, H6'), 7.54 (1H, s, H6''), 8.16 (1H, s, Hc'), 11.37 (1H, s, H2), 11.48 (1H, s, H1); 13C (100 MHz, DMSO-d6) δ(ppm) 163.9, 163.6, 150.5, 150.3, 143.7, 138.9, 136.0, 124.7, 113.5, 109.9, 109.6, 92.6, 84.9, 84.2, 83.5, 82.1, 81.3, 78.9, 62.0, 51.9, 51.2, 35.2, 26.9, 25.1, 12.1, 11.9; ESIHRMS: Found: m/z 651.2247. Calcd for C26H32N10O9Na: (M+Na)+ 651.2251.  4.5.3.6  Preparation of 5'-N3 dinucleoside 46 (similar procedure used for 51) To a stirred solution of 45  (0.63 g, 0.84 mmol) in DMF (3 mL) was added NaN3 (0.11 g, 1.69 mmol). The reaction was then stirred at 80 ºC for 3 h, whereupon the solvent was removed 145  in vacuo. H2O was added and the mixture was extracted with CHCl3 (3 x 50 mL). The combined organic extracts were washed with H2O, brine and dried over anhydrous MgSO4. After evaporation of the solvent, the crude material was purified by flash column chromatography using step gradient elution (CHCl3 : EtOH 49 : 1 – CHCl3 : EtOH 47 : 3) to provide 46  in 84% yield (0.47 g, 0.71 mmol). Compound 46 : White foamy solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.29 (3H, s, isopropylidene CH3), 1.48 (3H, s, isopropylidene CH3), 1.83 (3H, s, 5-Me), 1.86 (3H, s, 5-Me), 2.25 – 2.37 (2H, m, H2a" and H2b"), 3.17 (3H, s, N-Me), 3.18 (3H, s, N-Me), 3.54 – 3.64 (2H, m, H5a" and H5b"), 4.05 – 4.09 (1H, m, H4"), 4.17 – 4.19 (1H, m, H3"), 4.37 – 4.41 (1H, m, H4'), 4.59 (2H, s, Ha' and Hb'), 4.66 (1H, dd, J = 7.6, 14.0 Hz, H5b'), 4.78 (1H, dd, J = 4.4, 14.0 Hz, H5a'), 4.92 (1H, dd, J = 4.4, 6.4 Hz, H3'), 5.11 (1H, dd, J = 1.6, 6.4 Hz, H2'), 5.79 (1H, d, J = 2.0 Hz, H1'), 6.19 (1H, t, J = 6.4 Hz, H1"), 7.58 (2H, s, H6', H6''), 8.15 (1H, s, Hc'); 13C (100 MHz, DMSO-d6) δ(ppm) 163.0, 162.7, 150.6, 150.4, 143.6, 137.4, 134.5, 124.8, 113.5, 108.8, 108.6, 93.7, 85.3, 85.2, 83.6, 82.2, 81.3, 78.9, 62.1, 51.8, 51.2, 35.4, 27.6, 27.4, 26.8, 25.1, 12.8, 12.6; ESIHRMS: Found: m/z 679.2567. Calcd for C28H36N10O9Na: (M+Na)+ 679.2564. Compound 51 : Yield: 95%. White foamy solid; 1H (400 MHz, DMSO-d6) δ(ppm) 1.29 (3H, s, isopropylidene CH3), 1.48 (3H, s, isopropylidene CH3), 1.80 (3H, s, 5-Me), 1.82 (3H, s, 5-Me), 2.22 – 2.35 (2H, m, H2a" and H2b"), 3.18 (3H, s, N-Me), 3.53 – 3.62 (2H, m, H5a" and H5b"), 4.03 – 4.07 (1H, m, H4"), 4.16 – 4.17 (1H, m, H3"), 4.37 – 4.41 (1H, m, H4'), 4.59 (2H, s, Ha' and Hb'), 4.66 (1H, dd, J = 8.0, 14.4 Hz, H5b'), 4.78 (1H, dd, J = 4.8, 14.0 Hz, H5a'), 4.92 (1H, dd, J = 4.4, 6.4 Hz, H3'), 5.11 (1H, dd, J = 2.0, 6.8 Hz, H2'), 5.79 (1H, d, J = 1.6 Hz, H1'), 6.14 (1H, t, J = 6.0 Hz, H1"), 7.53 (1H, s, H6'), 7.58 (1H, s, H6''), 8.16 (1H, s, Hc'), 11.37 (1H, s, H2); 13C (100 MHz, 146  DMSO-d6) δ(ppm) 163.6, 162.9, 150.4, 143.6, 137.4, 136.0, 124.8, 113.5, 109.9, 108.6, 93.7, 85.2, 84.1, 83.6, 82.1, 81.3, 78.9, 62.0, 51.9, 51.2, 35.2, 27.4, 26.8, 25.1, 12.6, 12.1; ESIHRMS: Found: m/z 665.2416. Calcd for C27H34N10O9Na: (M+Na)+ 665.2408.  4.5.3.7  Preparation of conjugate 34 (similar procedure used for 41 and 47) To a stirred solution of cavitand 7 (25.7 mg, 0.0188 mmol) and nucleoside 39 (53.4 mg, 0.085 mmol) in argon-purged DMSO (2.3 mL) was added a solution of CuSO4•5H2O (63 µL, 0.04 M in argon-purged Milli-Q water, 0.0025 mmol) followed by a solution of cesium ascorbate, freshly prepared from the stoichiometric reaction between cesium carbonate and ascorbic acid (63 µL, 0.4 M in argon-purged Milli-Q water, 0.025 mmol). The reaction was stirred at 80 °C for 24 h. The solvent was then removed in vacuo and the residue suspended in water. A few drops of ammonium hydroxide were added to remove the copper catalyst and the mixture was suction filtered. The residue, crude 34 , was washed with deionized water and allowed to suction dry, whereupon it was purified with flash column chromatography (CHCl3 : MeOH 9 : 1) to afford pure 34  in 37% yield (26.8 mg, 0.007 mmol). Compound 34 : White glassy solid; 1H (400 MHz, DMSO-d6) δ(ppm) 0.84 (12H, t, J = 6.4 Hz, CH3 feet), 1.23 – 1.43 (96H, m, long chain aliphatic feet and isopropylidene CH3), 1.74 (12H, s, 5-Me'), 1.77 (12H, s, 5-Me''), 2.16 – 2.29 (16H, m, -CH2 feet, H2a", H2b"), 4.28 – 4.39 (16H, m, Hin, H3", H4', H4"), 4.53 – 4.77 (28H, m, Hd, Ha', Hb', H5a', H5b', H5a", H5b"), 4.88 (4H, dd, J = 4.0, 6.0 Hz, H3'), 4.97 (8H, s, Ha and Hb), 5.07 (4H, dd, J = 1.6, 6.4 Hz, H2'), 5.74 (4H, d, J = 1.6 Hz, H1'), 5.90 (4H, d, J = 5.6 Hz, Hout), 6.10 (4H, t, J = 7.2 Hz, H1"), 7.27 (4H, s, ArH), 7.36 (4H, s, H6"), 7.47 (4H, s, H6'), 8.11 (4H, s, Hc'), 8.17 (4H, s, Hc"), 11.31 (4H, s, Hinner), 11.45 (4H, s, 147  Houter); 13C (100 MHz, DMSO-d6) δ(ppm) 163.8, 163.5, 150.4, 150.3, 147.5, 143.7, 143.6, 143.5, 138.8, 138.7, 135.8, 125.0, 124.6, 113.4, 109.9, 109.5, 92.6, 84.8, 84.3, 83.5, 81.5, 81.3, 79.0, 62.0, 51.2, 31.4, 29.3, 29.20, 29.15, 29.0, 28.7, 27.7, 26.7, 25.0, 22.1, 13.9, 12.0, 11.9; MS(MALDI-TOF): Found: m/z 3887.5. Calcd for C192H249N40O48: (M+H)+ 3885.3. Compound 41 : Yield: 42%. White glassy solid; 1H (400 MHz, DMSO-d6) δ(ppm) 0.84 (12H, t, J = 6.4 Hz, CH3 feet), 1.23 – 1.43 (96H, m, long chain aliphatic feet and isopropylidene CH3), 1.79 (12H, s, 5-Me'), 1.80 (12H, s, 5-Me''), 2.19 – 2.35 (16H, m, CH2 feet, H2a", H2b"), 3.12 (12H, s, N-Me), 3.16 (12H, s, N-Me), 4.25 – 4.41 (16H, m, Hin, H3", H4', H4"), 4.51 – 4.79 (28H, m, Hd, Ha', Hb', H5a', H5b', H5a", H5b"), 4.90 – 4.97 (12H, m, H3', Ha, Hb), 5.09 (4H, d, J = 6.4 Hz, H2'), 5.77 (4H, s, H1'), 5.88 (4H, d, J = 6.0 Hz, Hout), 6.14 (4H, t, J = 6.4 Hz, H1"), 7.26 (4H, s, ArH), 7.41 (4H, s, H6"), 7.54 (4H, s, H6'), 8.10 (4H, s, Hc'), 8.15 (4H, s, Hc"); 13C (100 MHz, DMSO-d6) δ(ppm) 163.4, 163.2, 150.94, 150.89, 147.9, 144.2, 144.0, 139.2, 137.8, 134.9, 125.5, 125.2, 113.9, 109.3, 109.0, 94.3, 86.1, 86.02, 85.98, 85.7, 84.1, 82.2, 81.94, 81.86, 81.8, 79.4, 62.6, 51.7, 40.9, 31.8, 29.8, 29.7, 29.58, 29.55, 29.3, 28.2, 27.92, 27.88, 27.2, 25.5, 22.6, 14.4, 13.1; MS(MALDI-TOF): Found: m/z 4000.5. Calcd for C200H265N40O48: (M+H)+ 3997.5. Compound 47 : Yield: 83%. White solid; 1H (400 MHz, DMSO-d6) δ(ppm) 0.85 (12H, t, J = 6.4 Hz, CH3 feet), 1.23 – 1.43 (96H, m, long chain aliphatic feet and isopropylidene CH3), 1.77 (12H, s, 5-Me''), 1.80 (12H, s, 5-Me'), 2.16 – 2.28 (16H, m, CH2 feet, H2a", H2b"), 3.16 (12H, s, N-Me), 4.27 – 4.41 (16H, m, Hin, H3", H4', H4"), 4.55 – 4.79 (28H, m, Hd, Ha', Hb', H5a', H5b', H5a", H5b"), 4.91 (4H, dd, J = 4.4, 6.0 Hz, H3'), 4.98 (8H, s, Ha, Hb), 5.09 (4H, dd, J = 1.2, 6.4 Hz, H2'), 5.78 (4H, s, H1'), 5.90 (4H, d, J = 5.2 Hz, Hout), 6.10 (4H, t, J = 7.2 Hz, H1"), 7.27 (4H, s, ArH), 7.36 (4H, s, H6"), 7.54 (4H, s, H6'), 8.09 (4H, s, Hc'), 8.16 (4H, s, Hc"), 11.31 (4H, s, 148  Hinner); 13C (100 MHz, DMSO-d6) δ(ppm) 163.6, 162.9, 150.4, 150.3, 147.5, 143.7, 143.5, 138.7, 137.4, 135.9, 125.1, 124.7, 113.4, 109.9, 108.6, 93.8, 85.2, 84.4, 83.6, 81.6, 81.3, 79.0, 62.0, 51.2, 31.3, 29.31, 29.26, 29.1, 28.8, 27.7, 27.4, 26.8, 25.0, 22.1, 13.9, 12.6, 12.0; MS(MALDI-TOF): Found: m/z 3940.9. Calcd for C196H257N40O48: (M+H)+ 3941.4.  4.5.4  Supplementary 1H and 1H-1H COSY spectra Spectra begin on the following page.  149   Figure 4.15 1H NMR spectrum of 33 in DMSO-d6 at 25 ºC. 150   Figure 4.16 1H-1H COSY spectrum of 33 in DMSO-d6 at 25 ºC. 151   Figure 4.17 1H NMR spectrum of 34 in DMSO-d6 at 25 ºC. 152   Figure 4.18 1H-1H COSY spectrum of 34 in DMSO-d6 at 25 ºC. 153   Figure 4.19 1H NMR spectrum of 40 in DMSO-d6 at 25 ºC. 154   Figure 4.20 1H-1H COSY spectrum of 40 in DMSO-d6 at 25 ºC. 155   Figure 4.21 1H NMR spectrum of 41 in DMSO-d6 at 25 ºC. 156   Figure 4.22 1H-1H COSY spectrum of 41 in DMSO-d6 at 25 ºC. 157   Figure 4.23 1H NMR spectrum of 47 in DMSO-d6 at 25 ºC. 158   Figure 4.24 1H-1H COSY spectrum of 47 in DMSO-d6 at 25 ºC.159  Chapter 5: Conclusion  5.1  Thesis summary Nucleic acid topology is a derivative of the complex interweaving of structural motifs adopted by the constituent nucleobases, and is essential for normal cellular function. Directing this topology are intermolecular forces such as electrostatic interactions, hydrogen bonding and π stacking. G-quartets and quadruplexes are prime examples of tertiary nucleic acid structure, and their ubiquity in the telomeric end regions has implicated their involvement in such fundamental biological processes as replication, senescence and apoptosis. Pharmaceutical targeting of these structures has therefore been one of the foci of anticancer therapy. Construction of these motifs for in vitro model studies has been facilitated by organic template molecules that lower the entropic penalty of organizing multiple guanine subunits, thereby increasing thermodynamic stability. This approach has been used extensively by our group with the use of rigid, resorcinol-based cavitands to stabilize discrete G-quartets in both lipophilic and hydrophilic media. These template-assembled synthetic G-quartets (TASQs) have been shown to be viable substrates for drug binding assays.  Extension of these systems from bicyclic guanine-based to monocyclic pyrimidine-based assemblies was the driving force behind this thesis. Uracil and thymine-based quartets are rare due to their inherent instability, and when encountered, are always confined within G-quadruplex scaffolds and have been shown to augment the thermal stability of these structures. Corresponding U- and T-quadruplexes have not been reported until now. Further study of these systems in vitro might pave the way towards a greater understanding on their effects on overall nucleic acid stability and topology. As a major goal of this thesis, it was envisioned that discrete 160  U- and T-quartets and quadruplexes could be stabilized by cavitand templates in solution. Following this, these motifs were prepared by the conjugation of uridine and thymidine units to cavitands via the copper (I)-catalyzed azide-alkyne cycloaddition, commonly referred to as the "click" reaction.  Chapter 2 describes the synthesis and characterization of conjugate 1  that involved the installation of four uridine nucleosides on a lipophilic cavitand bearing pendant long-chain aliphatic 'feet'. Preliminary 1H NMR spectroscopic analysis in CDCl3 indicated involvement of the bound uracil bases in hydrogen bonding in contrast with the free nucleoside. NOESY experiments ascertained the assembly of a cation-free, all-syn U-quartet at room temperature, which becomes more tightly associated at –20 ºC. This was confirmed by variable temperature spectra observing a greater degree of hydrogen bonding with decreasing temperature. A planar U-quartet is proposed. DOSY NMR was instrumental in establishing the unimolecular state of the conjugate. Evidence for stacking of the uracil and underlying triazole rings via π-π interactions was also presented and believed to further stabilize the quartet. CD spectroscopic analysis indicated that the U-quartet is destabilized in a polar protic solvent such as methanol, a hydrogen bond disruptor.  Cationic extraction studies were also performed to investigate the affinity of the U-quartet towards metal cations such as K+, Na+ and Sr2+, which are known to bind and stabilize guanine-based architectures. These cations were introduced in the form of their metal picrate salts. K+ and Na+ were found not to be taken up, while Sr2+ is sequestered by the conjugate to possibly form a symmetric homodimer in chloroform. 1H and DOSY experiments provided indication of the bimolecular nature of the complex, while CD spectral traces observed its denaturation in methanol. 161   Chapter 3 details efforts towards the construction of an unprecedented U-quadruplex in the solution state as an extension of the work in the previous Chapter. The design, synthesis and characterization of conjugate 18 , composed of four uridine dinucleoside residues coupled to a cavitand template was completed. Preliminary 1H NMR in CDCl3 revealed a severely broadened spectrum indicative of higher order aggregation. NOESY elucidated the assembly of a cation-free, two-tiered U-quadruplex in DMSO-d6 at room temperature with all uridine residues configured syn. Evidence that the quadruplex is closed to the extraneous solvent environment was also presented. Added stability is potentially derived from stacking of the uracil and triazole rings via π-π interactions. Further NOE evidence suggests a non-planar outer U-quartet. A planar inner quartet and 'dipped' non-planar outer quartet is proposed. Variable temperature studies demonstrated that the quadruplex is thermally stable up to about 80 ºC. DOSY measurements substantiated the unimolecular state of 18  in DMSO-d6. Corresponding measurements in CDCl3 indicated the tetrameric aggregation of the conjugate in this solvent, confirming the preliminary hypothesis.  Chapter 4 reports the assembly of a T-quartet and quadruplex to further reflect the templating ability of cavitands, especially when extended to more unstable systems. The synthesis and characterization of conjugates 33  and 34 , cavitands bound to four thymidine-based nucleosides and dinucleosides respectively, was completed. Signal broadening was observed for both compounds in CDCl3 at room temperature. Variable temperature 1H NMR of 33  observed the presence of two differentially hydrogen-bonded species at low temperature (–20 and –40 ºC), indicating conformational exchange to be in operation and the cause of the signal broadening at room temperature. NOESY at –40 ºC in CDCl3 uncovered the presence of a stacked, all-syn T-quartet as the major species in addition to a non-quartet minor species. CD 162  spectroscopy further demonstrated the absence of assembly at room temperature. Treatment of 33  with Sr(pic)2 observed no induced CD signal to suggest uptake of the Sr2+ cation and consequent structure assembly. 34  was found to assemble a cation-free, two-tiered T-quadruplex in DMSO-d6 at room temperature. The inner quartet is proposed to adopt a propeller-twisted arrangement, while the outer quartet remains planar. DOSY indicated the unimolecular state of this quadruplex, while dimerization of the conjugate was found in CDCl3. Evidence for a fully ring-stacked scaffold as the result of intercalation of all triazole and thymine rings was also found. The significant stabilizing role played by π-π interactions was qualified by NOESY studies on a hemimethylated conjugate.  The work presented in this thesis highlights the first reported examples of discrete, intramolecular uracil and thymine-based quartets and quadruplexes in the solution state, successfully addressing the main aim of the thesis. Characterization of these assemblies in organic media has been facilitated by the exceptional lipophilicity conferred by the long chain aliphatic C11 'feet' of the cavitand templates. Most notably, the indispensable role of the templates in directing self-assembly and stabilizing these nucleobase scaffolds was demonstrated throughout this work.        163  5.2  Future work  5.2.1  Synthesis of cavitand 'foot'-based nucleobase conjugates The basket-like geometry of cavitands gives rise to a upper 'rim' tapering into a narrower bottom 'foot' (Figure 5.1). Self-assembly at the 'foot' position has not been investigated in our group, with the exception of a T-quartet reported in polar protic solvent.130 This narrower position should, in principle, be able to better stabilize tetranucleoside-based assemblies by positioning the self-assembling components in closer proximity.   Figure 5.1 Side-on representation of a cavitand with rim and foot positions labeled.  Linker lengths could be easily modified in the first step of cavitand synthesis i.e. condensation of resorcinol and various aldehyde and masked aldehyde subunits to give the corresponding octols. For example, 2-methylresorcinol 52  can be condensed with 2,3-dihydrofuran to form the macrocyclic octol 53 , which on bridging provides cavitand 54 . This synthesis has been reported.131 Subsequent deprotonation of the pendant alcoholic 'feet' with a strong base like sodium hydride and treatment with propargyl bromide could be effected to yield 55 . Coupling with the appropriate nucleosides or dinucleosides e.g. 10  can then proceed by the Cu-catalyzed "click" reaction to access the corresponding conjugates e.g. 56 (Scheme 5.1). O OR R O ORRX O O OX X O X 'rim''foot'164   Scheme 5.1 Proposed synthesis of 'foot'-based tetrauridine-cavitand conjugate 56.  Alternatively, the condensation of terminal alkynyl aldehydes with 52  could provide cavitands of varying 'feet' lengths, allowing investigation of their effect on the stability of quartets and quadruplexes (Scheme 5.2).  OHHO MeOHH+ (cat.) OHHO 452 53Me O Me OH DMSO, 90 oCO 4MeO 54 BrCH2BrClK2CO3sealed tubeOH 1. NaHTHF O 4MeO 55 O 10Cu2+ (cat.)Na ascorbateDMSONHO ONOO OO 4MeO 56 O N N N2.165   Scheme 5.2 Proposed synthesis of conjugates of varying 'feet' lengths.  5.2.2  Synthesis of amide-linked conjugates The conjugation of nucleosides to cavitand templates with amide linkages is also envisioned. This concept is derived from peptide nucleic acids (PNA), synthetic analogs of DNA and RNA, whose backbones are comprised entirely of amide bonds.132-135 PNA duplexes have been shown to have greater thermal stability than their DNA counterparts due to the lack of negatively charged phosphate groups and the resultant absence of electrostatic repulsion.136 For this reason, PNA oligomers have been used as antisense markers for therapeutic applications.137-139 They are also resistant to enzymatic degradation by both nucleases and proteases,140 which are unable to recognize them as substrates.  Use of the amide linker in nucleoside-cavitand conjugates may be advantageous for its smaller size compared to the triazole ring, and for having greater rotational freedom. The conjugation may be effected by a Staudinger ligation141, 142 between an amine and carboxylic OHHO MeOHH+ (cat.) OHHO 452 57Me MeOHn nO 4MeO 58 n N NN NHO ONOO O166  acid in the presence of DCC coupling reagent and DMAP as catalyst. Cavitands such as 59  with carboxyl-functionalized rims have been reported. 5'-amino nucleosides e.g. 60  can be readily prepared by the reduction of the 5'-azido derivatives with triphenylphosphine in the Staudinger reduction, or with hydrogen gas over a palladium-carbon catalyst. Successful condensation of these two reactants affords the desired conjugate 61 . Scheme 5.3 shows the proposed synthesis of 60  and 61 .   Scheme 5.3 a) Synthesis of 5'-amino nucleoside 60. b) DCC-mediated Staudinger ligation between cavitand 59 and nucleoside 60.  C11H23O 4O O OH +NHO ONOO ON3 PPh3aq. workuporH2Pd/CMeOH10 NHO ONOO OH2N 6059 NHO ONOO OH2N 60 DCCDMAP (cat.) C11H23O 4O O NH61HNO ONO O Oa)b)167  This methodology could also be translated to an amide-linked dinucleoside for the construction of a representative quadruplex system. The synthesis of the dinucleoside could begin with the coupling of derivatized nucleosides 63  and 64 . Preparation of 63  can be achieved with the reduction of the uracil analog of anti-retroviral drug 3'-azidothymidine (AZT) 62 , which can be prepared following a literature procedure,143 while 64  can be accessed with the oxidation of 9  with standard chromium (VI) chemistry (Scheme 5.4) or several other methods.   Scheme 5.4 Proposed syntheses of nucleosides 63 and 64.  DCC coupling of 63  and 64  provides 5'-hydroxyl dinucleoside 65 . Functional group transformation to the 5'-amino group of 66 could be achieved over several steps. A final DCC coupling of 66  to cavitand 59 is then effected to afford conjugate 67  (Scheme 5.5).  NHO ONOO OOH 9 [O] NHO ONOO OOH 64ONHO ONON3OH H2Pd/C62 NHO ONONH2OH 63MeOH168   Scheme 5.5 Proposed synthesis of conjugate 67.  Construction of longer length oligomers could then be pursued to function as potential model systems for various bioassays. Such systems may also find use as deep channel ionophores, or as DNA or RNA targeting vectors for antisense studies. NHO ONOO OOH 64ONHO ONONH2OH 63 + DCCDMAP (cat.) NHO ONONHOH O NHOONOO ONHO ONONHNH2 O NHOONOO O65 steps59DCCDMAP (cat.)66 C11H23O 4O O67HNO ONO NHNH O HNO ONO O O169  References  (1) Lehn, J.-M. Science 1993 , 260, 1762 – 1763. (2) Lehn, J.-M.; In Supramolecular Chemistry: Concepts and Perspectives; Wiley-VCH, 1995. (3) Fyfe, M. C.; Stoddart, J. F. Acc. Chem. Res. 1997 , 30, 393-401 (4) Seidel, S. R.; Stang, P. J. Acc. Chem. Res. 2002 , 35, 972-983 (5) Correa-Duarte, M. A.; Perez-Juste, J.; Sanchez-Iglesias, Ana.; Glersig, M.; Liz-Marzan, L. M. Angew. Chem. Int. Ed. 2005 , 44, 4375-4378 (6) Georgakilas, V.; Gournis, D.; Tzitzios, V.; Pasquato, L.; Guldi, D. M.; Prato, M. J. Mater. Chem. 2007 , 17, 2679-2694 (7) Lee, C. H.; Tian, L.; Abbas, A.; Kattumenu, R.; Singamaneni, S. Nanotechnology 2007 , 22, 275311 (8) Dickerson, M. B.; Sandhage, K. H.; Naik, R. R. Chem. Rev. 2008 , 108, 4935-4978 (9) Singh, Y.; Dolphin, G. T.; Razkin, J.; Dumy, P. ChemBioChem 2006 , 7, 1298-1314 (10) Aldaye, F. A.; Palmer, A. L.; Sleiman, H. F. Science 2008 , 321, 1795-1799 (11) Cram, D. J. Science 1983 , 219, 1177-1183 (12) Gibb, B. C.; Mezo, A. R.; Causton, A. S.; Fraser, J. R.; Tsai, F. C. S.; Sherman, J. C. Tetrahedron 1995 , 51, 8719-8732 (13) Mezo, A. R.; Sherman, J. C. J. Am. Chem. Soc. 1999 , 121, 8983-8994 (14) Yang, H.; Sherman, J. C. Bioorg. Med. Chem. Lett. 2013 , 23, 1752-1753 (15) Levene, P. J Biol Chem 1919 , 40, 415-424 (16) Avery, O.; MacLeod, C.; McCarty M. J Exp. Med. 1944 , 79, 137-158 (17) Hershey, A.; Chase, M. J. Gen. Physiol. 1952 , 36, 39-56 170  (18) Watson, J. D.; Crick, F. H. C. Nature 1953 , 171, 737-738 (19) Watson, J. D.; Crick, F. H. C. Nature 1953 , 171, 964-967 (20) Chargaff, E.; Lipshitz, R.; Green, C. J. Biol. Chem. 1952 , 195, 155-160 (21) Tsuchiya, Y.; Tamura, T.; Fujii, M. J. Phys. Chem. 1988 , 92, 1760-1765 (22) Hoogsteen, K. Acta Crystallogr. 1959 , 12, 822-823 (23) Hoogsteen, K. Acta Crystallogr. 1963 , 16, 907-916 (24) Wing, R. M.; Drew, H. R.; Takano, T.; Broka, C.; Tanaka, S.; Itakura, K.; Dickerson, R. E. Nature 1980 , 287, 755-758 (25) Drew, H. R.; Wing, R. M.; Takano, T.; Broka, C.; Tanaka, S.; Itakura, K.; Dickerson, R. E. Proc. Natl. Acad. Sci. U.S.A . 1981 , 78, 2179-2183 (26) Pettersen, E. F.; Goddard, T. D.; Huang, C. C.; Couch, G. S.; Greenblatt, D. M.; Meng, E. C.; Ferrin, T. E. J. Comput. Chem. 2004 , 25, 1605-1612 (27) Bang, I. Biochem. Z. 1910 , 26, 293-311 (28) Gellert, M.; Lipsett, M. N.; Davies, D. R. Proc. Natl. Acad. Sci. U. S. A . 1962 , 48, 2013-2018 (29) Chantot, J. F.; Guschlba, W. FEBS Lett. 1969 , 4, 173-176 (30) Wlodarczyk, A.; Grzybowski, P.; Patkowski, A.; Dobek, A. J. Phys. Chem. B 2005 , 109, 3594-3605 (31) Hud, N. V.; Smith F. W.; Anet, F. A. L.; Feigon, J. Biochemistry 1996 , 35, 15383-15390 (32) Gu, J. ; Leszczynski, J. J. Phys. Chem A , 2002 , 106, 529-532 (33) Zimmerman, S. B.; Cohen, G. H.; Davies, D. R. J. Mol. Biol. 1975 , 92, 181-191 (34) Zimmerman, S. B. J. Mol. Bio. 1976 , 106, 663-672 (35) Sen, D.; Gilbert, W. Nature 1988 , 334, 364-366 171  (36) Williamson, J. R.; Raghuraman, M. K.; Cech, T. R. Cell 1989 , 59, 871-880 (37) Sundquist, W. I.; Klug, A. Nature 1989 , 342, 825-829 (38) Sen, D.; Gilbert, W. Nature 1990 , 344, 410-414 (39) Watson, J. D. Nat. New Biol. 1972 , 239, 197-201 (40) Olovniko, A. J. Theor. Biol. 1973 , 41, 181-190 (41) Levy, M. Z.; Allsopp, R. C.; Futcher, A. B.; Greider, C. W.; Harley, C. B. J. Mol. Bio. 1992 , 225, 951-960 (42) Makarov, V. L.; Hirose, Y.; Langmore, J. P. Cell 1997 , 88, 657-666 (43) Wright, W. E.; Tesmer, V. M.; Huffman, K. E.; Levene, S. D.; Shay, J. W. Genes Dev. 1997 , 11, 2801-2809 (44) Cuesta, J.; Read, M. A.; Neidle, S. Mini Rev. Med. Chem. 2003 , 3, 11-21 (45) Neidle, S.; Read, M. A. Biopolymers 2000/2001 , 56, 195-208 (46) Kerwin, S. M. Curr. Pharm. Des. 2000 , 6, 441-478 (47) Cairns, D.; Anderson, R. J.; Perry, P. J.; Jenkins, T. C. Curr. Pharm. Des. 2002 , 8, 2491-2504 (48) Li, J.-L.; Harrison, R. J.; Reszka, A. P.; Brosh Jr., R. M.; Bohr, V. A.; Neidle, S.; Hickson, I. D. Biochemistry 2001 , 40, 15194-15202 (49) Greider, C. W.; Blackburn, E. H. Nature 1989 , 337, 331-337 (50) Greider, C. W.; Blackburn, E. H. Cell 1985 , 43, 405-413 (51) Greider, C. W.; Blackburn, E. H. Cell 1987 , 51, 887-898 (52) Moyzis, R. K.; Buckingham, J. M.; Cram, L. S.; Dani, M.; Deaven, L. L.; Jones, M. D.; Meyne, J.; Ratliff, R. L.; Wu, J. R. Proc. Natl. Acad. Sci. U. S. A . 1988 , 85, 6622-6626 172  (53) Meyne, J.; Ratliff, R. L.; Moyzis, R. K. Proc. Natl. Acad. Sci. U. S. A . 1989 , 86, 7049-7053 (54) Feng, J. L.; Funk, W. D.; Wang, S. S.; Weinrich, S. L.; Avilion, A. A.; Chiu, C. P.; Adams, R. R.; Chang, E.; Allsopp, R. C.; Yu, J.; et al. Science 1995 , 269, 1236-1241 (55) Kang, C.; Zhang, X.; Ratliff, R.; Moyzis, R.; Rich, A. Nature 1992 , 356, 126-131 (56) Smithfeigon, F. W. J. Nature 1992 , 356, 164-168 (57) Smith, F. W.; Schultze, P.; Feigon, J. Structure 1995 , 3, 997-1008 (58) Haider, S.; Parkinson, G. N.; Neidle, S. J. Mol. Bio. 2002 , 320, 189-200 (59) Laughlan, G.; Murchie, A. I.; Norman, D. G.; Moore, M. H.; Moody, P. C.; Lilley, D. M.; Luisi, B. Science 1994 , 265, 520-524 (60) Wang, Y.; Patel, D. J. Structure 1993 , 1, 263-282 (61) Parkinson, G. N.; Lee, M. P. H.; Neidle, S. Nature 2002 , 417, 876-880 (62) Langridge, R.; Rich, A. Nature 1963 , 198, 725-728 (63) Marsh, R. E.; Bierstedt, R.; Eichhorn, E. L. Acta. Crystallogr. 1962 , 15, 310-316 (64) Akrnimiski, E. O.; Sander, C.; Ts'o, P. O. P. Biochemistry 1963 , 2, 340-344 (65) Hartman Jr., J. A.; Rich, A. J. Am. Chem. Soc. 1965 , 87, 2033-2039 (66) Inman, R. B. J. Mol. Bio. 1964 , 9, 624-637 (67) Gehring, K.; Leroy, J.-L.; Gueron, M. Nature 1993 , 363, 561-565 (68) Chen, L.; Cai, L.; Zhang, X.; Rich, A. Biochemistry 1994 , 33, 13540-13546 (69) Green, D. W.; Mathews, F. S.; Rich, A. J. Biol. Chem. 1962 , 237, 3573-3575 (70) Kang, C.; Berger, I.; Lockshin, C.; Ratliff, R.; Moyzis, R.; Rich, A. Proc. Natl. Acad. Sci. U. S. A . 1995 , 92, 3874-3878 173  (71) Kang, C.; Berger, I.; Lockshin, C.; Ratliff, R.; Moyzis, R.; Rich, A. Proc. Natl. Acad. Sci. U. S. A . 1994 , 91, 11636-11640 (72) Phan, A. T.; Gueron, M.; Leroy, J.-L. J. Mol. Biol. 2000 , 299, 123-144 (73) Phan, A. T.; Leroy, J.-L. J. Biomol. Struct. Dyn. 2000 , 17, 245-251 (74) Cai, L.; Chen, L.; Raghavan, S.; Ratliff, R.; Moyzis, R.; Rich, A. Nucleic Acids Res. 1998 , 26, 4696-4705 (75) Davis, J. T.; Spada, G. P. Chem. Soc. Rev. 2007 , 36, 296-313 (76) Sessler, J. L.; Sathiosatham, M.; Doerr, K.; Lynch, V.; Abboud, K. A. Angew. Chem. Int. Ed. 2000 , 112, 1356-1359 (77) Kotch, F. W.; Sidorov, V.; Lam, Y. F.; Kayser, K. J.; Li, H.; Kaucher, M. S.; Davis, J. T. J. Am. Chem. Soc. 2003 , 125, 15140-15150 (78) Nikan, M.; Sherman, J. C. Angew. Chem. Int. Ed. 2008 , 47, 4900-4902 (79) Nikan, M.; Sherman, J. C. J. Org. Chem. 2009 , 74, 5211-6218 (80) Stefan, L.; Guedin, A.; Amrane, S.; Smith, N.; Denat, F.; Mergny, J.-L.; Monchaud, D. Chem. Commun. 2011 , 47, 4992-4994 (81) Xu, H. J.; Stefan, L.; Haudecoeur, R.; Vuong, S.; Richard, P.; Denat, F.; Barbe, J. M.; Gros, C. P.; Monchaud, D. Org. Biomol. Chem. 2012 , 10, 5212-5218 (82) Marlow, A. L.; Mezzina, E.; Spada, G. P.; Masiero, S.; Davis, J. T.; Gottarelli, G. J. Org. Chem. 1999 , 64, 5116-5123 (83) Forman, S. L.; Fettinger, J. C.; Pieraccini, S.; Gottarelli, G.; Davis, J. T. J. Am. Chem. Soc. 2000 , 122, 4060-4067 (84) Shi, X. D.; Fettinger, J. C.; Davis, J. T. J. Am. Chem. Soc. 2001 , 123, 6738-6739 (85) Shi, X. D.; Fettinger, J. C.; Davis, J. T. Angew. Chem. Int. Ed. 2001 , 40, 2827-2831 174  (86) Nikan, M.; Patrick, B. O.; Sherman, J. C. ChemBioChem 2012 , 13, 1413-1415 (87) Cheong, C.; Moore, P. B. Biochemistry 1992 , 31, 8406-8414 (88) Zhao, X.; Meng, F. J. Mol. Struct.: THEOCHEM 2006 , 770, 157-162 (89) Gu, J.; Leszczynski, J. J. Phys. Chem. A  2001 , 105, 10366-10371 (90) Meyer, M.; Steinke, T.; Brandl, M.; Suhnel, J. J. Comput. Chem. 2001 , 22, 109-124 (91) Witkowski, H.; Freisinger, E.; Lippert, B. Chem. Commun. 1997 , 1315-1316 (92) Barcelo-Oliver, M.; Estarellas, C.; Terron, A.; Garcia-Raso, A.; Frontera, A. Chem. Commun. 2011 , 47, 4646-4648 (93) Deng, J.; Xiong, Y.; Sundaralingam, M. Proc. Natl. Acad. Sci. U. S. A . 2001 , 98, 13665-13670 (94) Pan, B.; Xiong, Y.; Shi, K.; Sundaralingam, M. Structure 2003 , 11, 825-831 (95) Yan, X.; Ishizuka, T.; Kimura, T.; Komiyama, M. J. Am. Chem. Soc. 2010 , 132, 7231-7233 (96) Patel, P. K.; Hosur, R. V. Nucleic Acids Res. 1999 , 27, 2457-2464 (97) Cacares, C.; Wright, G.; Gouyette, C.; Parkinson, G.; Subirana, J. A. Nucleic Acids Res. 2004 , 32, 1097-1102 (98) Sket, P.; Plavec, J. J. Am. Chem. Soc. 2010 , 132, 12724-12732 (99) Cram, D. J.; Jaeger, R.; Deshayes, K. J. Am. Chem. Soc. 1993 , 115, 10111-10116 (100) Roman, E.; Peinador, C.; Mendoza, S.; Kaifer, A. E. J. Org. Chem. 1999 , 64, 2577-2578 (101) Liu, F.; Austin, D. J. J. Org. Chem. 2001 , 66, 8643-8645 (102) Rostovtsev, V.; Green, L. G.; Fokin, V. V.; Sharpless, K. B. Angew. Chem. Int. Ed. 2002 , 41, 2596-2599 175  (103) Himo, F.; Lovell, T.; Hilgraf, R.; Rostovtsev, V.; Noodleman, L.; Sharpless, K. B. J. Am. Chem. Soc. 2005 , 127, 210-216 (104) Huisgen, R. Angew. Chem. Int. Ed. 1963 , 2, 633-645 (105) Karplus, M. J. Chem. Phys. 1959 , 30, 11-15 (106) Karplus, M. J. Am. Chem. Soc. 1963 , 85, 2870-2871 (107) Waldeck, A. R.; Kuchel, P. W.; Lennon, A. J.; Chapman, B. E. Prog. Nucl. Magn. Reson. 1997 , 30, 39-68 (108) Stejskal, E. O.; Tanner, J. E. J. Chem. Phys. 1965 , 42, 288-292 (109) Price, W. S. Concepts Magn. Reson. 1997 , 9, 299-336 (110) Cohen, Y.; Avram, L.; Frish, L. Angew. Chem. Int. Ed. 2005 , 44, 520-554 (111) Evan-Salem, T.; Baruch, I.; Avram, L.; Cohen, Y.; Palmer, L. C.; Rebek, J. Proc. Natl. Acad. Sci. U. S. A . 2006 , 103, 12296-12300 (112) Avram, L.; Cohen, Y. J. Am. Chem. Soc. 2002 , 124, 15148-15149 (113) Timmerman, P.; Weidmann, J. L.; Jolliffe, K. A.; Prins, L. J.; Reinhoudt, D. N.; Shinkai, S.; Frish, L.; Cohen, Y. J. Chem. Soc., Perkin Trans. 2 2000 , 2077-2089 (114) Berova, N.; Di Bari, L.; Pescitelli, G. Chem. Soc. Rev. 2007 , 36, 914-931 (115) Fasman, G. D., Ed.; In Circular Dichroism and the Conformational Analysis of Biomolecules; Plenum Press: New York, 1996  (116) Clark, L. B. J. Am. Chem. Soc. 1994 , 116, 5265-5270 (117) Fulsher, M. P.; Serrano-Andres, L.; Roos, B. O. J. Am. Chem. Soc. 1997 , 119, 6168-6176 (118) Balagurumoorthy, P.; Brahmachari, S. K.; Mohanty, D.; Bansal, M.; Sasisekharan, V. Nucleic Acids Res. 1992 , 20, 4061-4067 (119) Gray, D. M.; Bollum, F. J. Biopolymers 1974 , 13, 2087-2102 176  (120) Jin, R.; Gaffney, B. L.; Wang, C.; Jones, R. A.; Breslauer, K. J. Proc. Natl. Acad. Sci. U. S. A . 1992 , 89, 8832-8836 (121) Miles, D. W.; Robins, M. J.; Robins, R. K.; Winkley, M. W.; Eyring, H. J. Am. Chem. Soc. 1969 , 91, 824-831 (122) Bureekaew, S.; Hasegawa, J.; Nakatsuji, H. Chem. Phy. Lett. 2006 , 425, 367-371 (123) Wong, K. H.; Ng, H. L. J. Coord. Chem. 1981 , 11, 49-55 (124) Lucas, R.; Neto, V.; Bouazza, A. H.; Zerrouki, R.; Granet, R.; Krausz, P.; Champavier, Y. Tetrahedron Lett. 2008 , 49, 1004-1007 (125) McGee, D. P. C.; Martin, J. C. Can. J. Chem. 1986 , 64, 1885-1889 (126) Wang, S. M.; Li, N. C. J. Am. Chem. Soc. 1968 , 90, 5069-5074 (127) Schweighart, F. K.; Moll, C.; Li, N. C. J. Mag. Res. 1970 , 2, 35-41 (128) Dyllick-Brenzinger, C.; Sullivan, G. R.; Pang, P. P.; Roberts, J. D. Proc. Natl. Acad. Sci. U. S. A . 1980 , 77, 5580-5582 (129) Petersen, S. B.; Led, J. J. J. Am. Chem. Soc. 1981 , 103, 5308-5313 (130) Bare, G. A. L.; Sherman, J. C. J. Org. Chem. 2013 , 78, 8198-8202 (131) Mezo, A. R.; Sherman, J. C. J. Org. Chem. 1998 , 63, 6824-6829 (132) Nielsen, P. E.; Egholm, M.; Berg, R. H.; Buchardt, O. Science 1991 , 254, 1497-1500 (133) Corey, D. R. Trends Biotechnol. 1997 , 15, 224-229 (134) Nielsen, P. E.; Egholm, M. Curr. Issues Mol. Biol. 1999 , 1, 89-104 (135) Egholm, M.; Buchardt, O.; Nielsen, P. E.; Berg, R. H. J. Am. Chem. Soc. 1992 , 114, 1895-1897 (136) Uhlmann, E.; Peyman, A.; Breipohl, G.; Will, D. W. Angew. Chem. Int. Ed. 1998 , 37, 2796-2823 177  (137) Demidov, V. V. Drug Discov. Today 2002 , 7, 153-155 (138) Nielsen, P. E. Curr. Opin. Struct. Biol. 1999 , 9, 353-357 (139) Henvey, J. C.; Peffer, N. J.; Bisi, J. E. Science 1992 , 258, 1481-1485 (140) Demidov, V. V.; Potaman, V. N.; Frank-Kamenetskii, M. D.; Egholm, M.; Buchardt, O.; Sonnichsen, S. H.; et al. Biochem. Pharmacol. 1994 , 48, 1310-1313 (141) Saxon, E.; Bertozzi, C. R. Science 2000 , 287, 2007-2010 (142) Lin, F. L.; Hoyt, H. M.; van Halbeek, H.; Bergman, R. G.; Bertozzi, C. R. J. Am. Chem. Soc. 2005 , 127, 2686-2695 (143) Czernecki, S.; Valery, J.-M. Synthesis 1991 , 239-240  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0167249/manifest

Comment

Related Items