Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of the tyrosines in the carboxyl tail of connexin43 in regulating cytoskeletal rearrangements… Pournia, Farnaz 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2015_may_pournia_farnaz.pdf [ 4.28MB ]
Metadata
JSON: 24-1.0167176.json
JSON-LD: 24-1.0167176-ld.json
RDF/XML (Pretty): 24-1.0167176-rdf.xml
RDF/JSON: 24-1.0167176-rdf.json
Turtle: 24-1.0167176-turtle.txt
N-Triples: 24-1.0167176-rdf-ntriples.txt
Original Record: 24-1.0167176-source.json
Full Text
24-1.0167176-fulltext.txt
Citation
24-1.0167176.ris

Full Text

THE ROLE OF THE TYROSINES IN THE CARBOXYL TAIL OF CONNEXIN43 IN REGULATING CYTOSKELETAL REARRANGEMENTS IN B-LYMPHOCYTES  by  FARNAZ POURNIA  B.Sc., The University of British Columbia, 2011  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF  THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Cell and Developmental Biology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2015  © Farnaz Pournia, 2015  ii Abstract                Cellular processes requiring cytoskeletal rearrangements such as adhesion, spreading, immune synapse formation, and migration are crucial for normal B-lymphocyte (B cell) development and for immune responses. Our lab has shown that the gap junction protein connexin43 (Cx43) is both necessary and sufficient for promoting B cell adhesion, B cell receptor (BCR)-mediated spreading, B cell motility and migration. The carboxyl tail (CT) of Cx43 is important for these effects and the hypothesis is that specific regions of the CT contain sites important for interactions that can influence these processes. To identify these regions, a series of deletions and point mutations in the CT of Cx43 were made.  These mutated proteins were expressed in mouse B cell lines and examined for localization, cell surface expression and for their effect on supporting cell spreading in response to BCR-signaling, the latter assay being used as one ‘read-out’ for cytoskeletal rearrangements.  With regard to BCR-mediated cell spreading, the data in this thesis from the Cx43 deletions showed that the amino acids in the Cx43 CT between 246 and 307 are the most important, and that amino acids between 307 and 382 are less critical. In addition, since one of the most important proximal signaling events after BCR signaling is the activation of different protein tyrosine kinases, the effects of different tyrosine mutations in the Cx43 CT were examined. Three point mutations at tyrosine (Y) 247, 265 and 267 to phenylalanine (F), and a double mutant, Y247F/Y265F, were made and their effect on BCR-mediated spreading assessed. All of these tyrosine mutations in the Cx43 CT were found to impede BCR-mediated cell  iii spreading. These findings have helped to better define the region of the Cx43 CT critical for regulating cytoskeletal rearrangements in response to BCR signaling. Future studies will identify other important residues of the CT, with the goal to identify the importance of these sites.  These results will provide novel insights into understanding basic B lymphocyte responses that contribute to immune function, and can lead to identifying potential targets for the development of therapeutics to treat immune diseases.    iv Preface:  Published Work   A version of Figure 3.4.B, 3.8.A-B and 3.9.A-B were published and reproduced with permission: Letitia Falk, May Dang-Lawson, José Luis Vega, Farnaz Pournia, Kate Choi, Caren Jang, Christian C. Naus and Linda Matsuuchi. (2014). Mutations of Cx43 that affect B Cell spreading in response to BCR Signalling.  Biology Open 3, 1-7.  doi:10.1242/bio20147328 I was responsible for the following experiments: a) Figure 3.4.B in collaboration with Letitia Falk. I was responsible for the experiments using J558μm3 +Y247F and J558μm3 +Y24F/Y265F and the data in the figure. b) Figure 3.8.A-B in collaboration with Letitia Falk. I was responsible for the experiments using J558μm3 +Y247F, J558μm3 +Y265F and J558μm3 +Y247F/Y265F and the data in the figure. c) Figure 3.9 A-B in collaboration with Letitia Falk.  I was responsible for the experiments using J558μm3 +Y247F, J558μm3 +Y265F and J558μm3 +Y247F/Y265F and the data in the figure.    v  A version of Figure 3.5.A and C was published and reproduced with permission: Steven Machtaler, Kate Choi, May Dang-Lawson, Letitia Falk, Farnaz Pournia, Christian C., Naus and Linda Matsuuchi. (2014). The role of gap junction forming protein Connexin43 in B lymphocyte motility and migration. FEBS Letters 588, 1249-1258. doi:10.1016/j.febslet.2014.01.027  a) Figure 3.5.A both Letitia Falk and I were responsible for the experiments and data in the figure.  b) I was responsible for the experiments and the data in the Figure 3.5.C.    vi Table of Contents Abstract ..................................................................................................................... ii Preface: ..................................................................................................................... iv Table of Contents..................................................................................................... vi List of Tables ........................................................................................................... xii List of Figures ........................................................................................................ xiii List of Abbreviations .............................................................................................. xv Acknowledgements .............................................................................................. xxii Chapter 1: Introduction ............................................................................................ 1 1.1 The immune system .................................................................................. 1 1.2 B Lymphocytes ......................................................................................... 4 1.3 The BCR ................................................................................................. 10  Structure of BCR .......................................................................... 10 1.3.1 BCR signaling .............................................................................. 14 1.3.2 BCR-mediated cell spreading ....................................................... 18 1.3.31.4 Connexins ............................................................................................... 25  Structure and organization ........................................................... 26 1.4.11.5 Connexin43 (Cx43) ................................................................................. 33  Proteins interacting with the CT of Cx43 ...................................... 38 1.5.1 Regulation of Cx43 through phosphorylation ............................... 45 1.5.2 The role of Cx43 in the immune response .................................... 48 1.5.3 The role of Cx43 in cytoskeleton-dependent processes ............... 52 1.5.41.6 Rationales, aims and hypothesis ............................................................ 58  vii Chapter 2: Materials and Methods ........................................................................ 61 2.1 Materials ................................................................................................. 61  Plasmids ....................................................................................... 61 2.1.1 Plasmids created .......................................................................... 62 2.1.22.1.2.1 Construction of NAP2-Δ258 Cx43-EGFP ..................................... 62 2.1.2.2 Construction of NAP2-Δ307 Cx43-EGFP ..................................... 64 2.1.2.3 Construction of NAP2-Y247F Cx43-EGFP ................................... 64 2.1.2.4 Construction of NAP2-Y247F/Y265F Cx43-EGFP ....................... 65  Additional expression vectors created in the Matsuuchi Lab that 2.1.3were used in this study-(NAP2-Y267F) Cx43-EGFP ...................................... 65  Antibodies and Cell Trackers ....................................................... 71 2.1.4 Cell Lines ..................................................................................... 77 2.1.52.2 Molecular biology techniques .................................................................. 80  Bacterial transformation ............................................................... 80 2.2.1 DNA preparation .......................................................................... 81 2.2.2 Restriction endonuclease digestion .............................................. 82 2.2.3 Agarose gel electrophoresis ......................................................... 83 2.2.4 Gel Extraction of DNA .................................................................. 84 2.2.5 DNA ligation ................................................................................. 84 2.2.6 Site-directed mutagenesis ............................................................ 85 2.2.72.3 Tissue Culture ......................................................................................... 86  Cell culture ................................................................................... 86 2.3.1 DNA transfection and enrichment of the transfected cells ............ 87 2.3.2 viii  Cell Stimulation ............................................................................ 88 2.3.32.4 Biochemical Procedures ......................................................................... 89  Cell lysis and preparation of samples ........................................... 89 2.4.1 SDS-PAGE and western blotting .................................................. 91 2.4.2 Protein expression profile of the parental cell lines ...................... 93 2.4.32.5 Flow Cytometry ....................................................................................... 94  Sample preparation and staining .................................................. 94 2.5.1 Data collection and analysis ......................................................... 96 2.5.22.6 B Cell Antigen Receptor-mediated cell spreading ................................... 96 2.7 Immunofluorescence Procedures and Confocal microscopy .................. 99  Sample preparation and staining .................................................. 99 2.7.12.7.1.1 Staining fixed cell samples ........................................................... 99 2.7.1.2 Labelling of live cells to detect intracellular organelles ............... 100  Image acquisition and analysis .................................................. 101 2.7.22.8 Statistics................................................................................................ 102 Chapter 3: Results ................................................................................................ 103 3.1 Protein expression in B cell lines .......................................................... 103  Rationale .................................................................................... 103 3.1.1 Expression of Cx43 and BCR in different B cell lines ................. 104 3.1.23.2 The importance of the region between amino acids 258-307 of the connexin43 carboxyl tail for BCR-mediated cell spreading .............................. 109  Rationale .................................................................................... 109 3.2.1 Expression of Cx43 CT truncations in the B cell line J558μm3 .. 110 3.2.2 ix  The importance of amino acids 258-307 in the Cx43 CT for BCR-3.2.3mediated cell spreading in J558μm3 cells .................................................... 117 3.3 The importance of tyrosine 247, 265 and 267 of the connexin43 carboxyltail for BCR-mediated cell spreading .................................................. 121  Rationale .................................................................................... 121 3.3.1 Expression of tyrosine (Y) mutants in the carboxyl-tail of Cx43 3.3.2(Y247F,    Y265F, Y247F/Y265F and Y267F) in the B cell lines J558μm3 and WEHI231 122  Localization of tyrosine (Y) mutants in the carboxyl-tail of Cx43 3.3.3(Y247F, Y265F, Y247F/Y265F) expressed in WEHI231 cells with surface BCR and markers specific for intracellular organelles .......................................... 125  Carboxyl tail truncation (Δ246) and tyrosine mutants (Y247F, 3.3.4Y265F and Y247F/Y265F) of Cx43 do not have a dominant negative effect on BCR-mediated spreading in WEHI231 cells ................................................. 129  Expression of tyrosine (Y) mutants in the carboxyl-tail of Cx43 3.3.5(Y247F, Y265F, Y247F/Y265F) do not have an effect on cell size of  J558μm3 cells 131  Localization of tyrosine (Y) mutants in the carboxyl-tail of Cx43 3.3.6(Y247F, Y265F, Y247F/Y265F) expressed in J558μm3 cells with surface BCR and markers specific for intracellular organelles .......................................... 134  The importance of tyrosine (Y) 247 and 265 in the carboxyl tail of 3.3.7Cx43 for BCR- mediated cell spreading in J558μm3 cells ........................... 138  x  The importance of tyrosine (Y) 267 in the carboxyl tail of Cx43 for 3.3.8BCR- mediated cell spreading in J558μm3 cells .......................................... 143 Chapter 4: Discussion .......................................................................................... 147 4.1 Summary of main findings..................................................................... 147 4.2 Questions about the results .................................................................. 154 4.3 Model: how the CT of Cx43 could influence cytoskeletal remodelling ... 156 4.4 Future Directions ................................................................................... 163  Further deletions and point mutations ........................................ 163 4.4.14.4.1.1 Additional deletion mutants: deletion at aa 270 within the CT region of Cx43 163 4.4.1.2 Additional point mutations: Key proline and serine residues ...... 164  Essential regions and residues of the Cx43 CT for other 4.4.2cytoskeletal dependent processes in B cells ................................................ 167  Site specific phosphorylation of Cx43 CT upon BCR stimulation 168 4.4.3 Making chimeric constructs consist of CD8 or CD40 + CT of Cx434.4.4 169  Additional future directions ......................................................... 172 4.4.54.5 Conclusion ............................................................................................ 173 References ............................................................................................................ 175 Appendices ........................................................................................................... 205 Appendix A ............................................................................................................. 205 A.1 Confirmation of Δ258 Cx43-EGFP by DNA sequencing ....................... 205 A.2 Confirmation of Δ307 Cx43-EGFP by DNA sequencing ....................... 207  xi A.3 Confirmation of Y247F Cx43-EGFP by DNA sequencing ..................... 209 A.4 Confirmation of construction of Y247F/Y265F Cx43-EGFP by DNA sequencing ...................................................................................................... 211   xii List of Tables Table 2.1  Summary of the deletion and point mutations in the Cx43 CT used in this study. ........................................................................................................................ 67 Table 2.2  Custom ordered primer sets for site-directed mutagenesis. ..................... 70 Table 2.3 - List of Primary Antibodies used for Western blotting .............................. 73 Table 2.4  List of Secondary Antibodies used for Western blotting ........................... 74 Table 2.5 List of Antibodies used for Immunofluorescence Staining ......................... 75 Table 2.6 List of Live-Cell Trackers used to Label Intracellular Organelles .............. 76 Table 2.7  List of parental cell lines used in the studies ............................................ 78 Table 2.8 List of transduced cell lines used in the studies ........................................ 79 Table 3.1 List of expected molecular weights for proteins in profile ........................ 104 Table 3.2 List of expected molecular weights for Cx43 mutants ............................. 113   xiii List of Figures Figure 1.1 B Lymphocyte Development. ..................................................................... 9 Figure 1.2 Structure of the B-cell antigen receptor (BCR) in the plasma membrane. 13 Figure 1.3 BCR-induced signaling pathways. ........................................................... 17 Figure 1.4  BCR-mediated cell spreading and immune synapse formation upon Ag encounter. ................................................................................................................. 24 Figure 1.5  Structure of Connexin43. ........................................................................ 29 Figure 2.1  Expression of an in-frame EGFP fused at the CT of Δ258 Cx43-EGFP. 69 Figure 2.2  Schematic diagram and an image representative of the B cell spreading assay. ....................................................................................................................... 98 Figure 3.1 Protein expression of Cx43 and the BCR in B cell lines. ....................... 108 Figure 3.2 Characterization of J558μm3 cells expressing Δ258 and Δ307 Cx43-EGFP. ..................................................................................................................... 116 Figure 3.3 The importance of amino acids 258-307 of the Cx43 CT for BCR-mediated cell spreading in J558μm3 cells. ............................................................................. 120 Figure 3.4 Expression of Tyr point and double point mutations of Cx43-EGFP in J558μm3 and WEHI231 cells. ................................................................................. 124 Figure 3.5 Localization of the Tyr mutants in the CT of the Cx43-EGFP with the cell surface BCR and intracellular organelles in WEHI231 cells. ................................... 128 Figure 3.6 CT mutants of Cx43-EGFP did not have a dominant negative effect on BCR-mediated cell spreading in WEHI231 cells. .................................................... 130 Figure 3.7 Expression of CT mutants of the Cx43-EGFP did not affect the cell size. Expression of transfected mIgM and CD19 in J558μm3 cells. ................................ 133  xiv Figure 3.8 Localization of the Tyr mutants in the CT of Cx43-EGFP with the cell surface BCR and intracellular organelles in J558μm3 cells. ................................... 137 Figure 3.9 The importance of tyrosine (Y) 247 and 265 in the carboxyl tail of Cx43 for  BCR- mediated cell spreading in J558μm3 cells. .................................................... 141 Figure 3.10 The importance of tyrosine (Y) 267 in the carboxyl tail of Cx43 for BCR- mediated cell spreading in J558μm3 cells. ............................................................. 146 Figure 4.1 Model showing how the CT of Cx43 could influence cytoskeletal     remodelling. ............................................................................................................ 161 Figure 4.2 Linear depiction of the CT of Cx43 showing multiple modification and interaction sites. ...................................................................................................... 166    xv List of Abbreviations  2-ME βmercaptoethanol -/- Complete gene knockout +/- Heterozygous gene knockout #        Number  oC    Celsius α- Anti μg Microgram μl Micro liter A                   Alanine A20 h.IgM       A20 cells expressing human IgM aa        Amino acid aas        Amino acids Ab        Antibody Ag   Antigen Amp   Ampicillin APC Antigen presenting cell Arp2/3 Actin-Related protein-2/3 ATTC American type culture collection ATP Adenosine triphosphate BCA        Bicinchoninic acid BCR B cell antigen receptor BM Bone marrow BSA Bovine serum albumin Blk  B Lymphocyte kinase   Btk Bruton’s tyrosine kinase   C Cysteine   Ca2+ Calcium cAMP Cyclic Adenosine monophosphate CCLP C-C motif chemokine ligand  xvi CD Cluster of differentiation Cdc42 Cell division control protein 42 homolog CK-1 Casein kinase 1 cKO Conditional knock out CL Cytoplasmic loop CLP Common lymphoid progenitor CLR        C-type lectin receptor CMV        CytoMegalovirous CO2        Carbon dioxide CO-IP        Co- Immunoprecipitation cSMAC       Central supramolecular activation complex c-Src        Cellular Src CT        Carboxyl tail Cx        Connexin Cx43        Connexin43 Cxs        Connexins CXCL        C-X-C motif chemokine  ligand D        Aspartic acid DAG        Diacylglycerol DC        Dendritic cell DMSO       Dimethyl sulfoxide DN        Dominant negative DNA        Deoxyribonucleic acid dSMAC       Distal supramolecule activation complex E        Glutamic acid ER        Endoplasmic reticulum EL        Extracellular loop EBF1        Early B cell factor1 ECL        Enhanced chemiluminescence E.Coli        Escherichia Coli EEA1        Early antigen-1  xvii EGFP        Enhanced green fluorescence protein ER         Endoplasmic reticulum ERK        Extracellular signal-regulated kinase F                          Phenylalanine FACS         Fluorescence-activated cell sorting F-actin        Filamentous actin FBS         Fetal bovine serume FITC         Fluoroscein isothiocyanate FSC         Forward scatter measurement  FRAP         Fluorescence recovery after photobeaching FRET         Fluorescence resonance energy transfer g         Gram G                          Glycine G-actin        Globular actin      GAP         GTPase activating protein GDP                     Guanosine diphosphate GEF         Guanine exchange factor GJ         Gap junction GJs         Gap junctions GJIC         Gap junction intercellular communication GOF                     Gain-of–function  GTP         Guanosine triphosphate H         Hours HC         Hemichannels  HIP55   Hematopoietic progenitor kinase 1- interacting protein of 55  HRP                     Horseradish peroxidase HSC         Hematopoietic stem cells HS1         Hematopoietic lineage cell-specific protein 1 HSC          Hematopoietic stem cells ICAM-1        Intercellular adhesion molecule-1 IDT         Integrated DNA Technologies  xviii IF         Immunofluorescence  Ig         Immunoglobulin IGEPAL        Octylphenoxypolyethoxyethanol Ig-V         Immunoglobulin variable IP         Immunoprecipitation  ITAM         Immunoreceptor tyrosine-based activation motif IRES         Internal ribosome entry site IS         Immune synapse JIR         Jackson ImmunoResearch Labs K+         Potassium K         Lysine kDa         Kilodalton KO         Knockout ODDD        Oculodentodigital dysplasia L         Leucine LB         Luria-Bertani or Lysogeny Broth Lck         Lymphocyte-specific protein tyrosine kinase LFA-1         Leukocyte function-associated molecule-1 LMPP         Lymphoid primed multipotent progenitor  LOF         Loss-of –function LPS         Lipopolysaccharide Lyn         Lck/Yes Novel tyrosine kinase M         Methionine mAb         Monoclonal antibody MAGUK        Membrane-associated guanylate kinase  MAPK         Mitogen-activated protein kinase MFI         Mean fluorescence intensity  MHC         Major histocompatibility complex mIgM         Membrane IgM min         Minutes ml                         Milliliter   xix mm         Millimeter mM         Millimolar MMP                    Multipotent progenitor MW         Molecular Weight NaCl         Sodium chloride Nedd4        Neural-precursor-cell-expressed-developmentally down- regulated 4                          NK         Natural killer ng          Nanogram nm                        Nanometer NMR         Nuclear magnetic resonance NP         Hapten nitrophenyl NT         Amino terminal P         Proline PAGE         Polyacrylamide gel electrophoresis PAMP         Pathogen-associated molecular patterns Panx         Pannexin PALS         Periarteriolar lymphoid sheet PBS         Phosphate buffer saline PCR         Polymerase chain reaction PDGF         Platelet-drived growth factor PDZ         ZO-1 homology PE         Phycoerythin PFA         Paraformaldehyde pH         Power of hydrogen   Phe         Phenylalanine  PIP3         Phosphatidylinosiotol (3,4,5)-tri phosphate PI3K         Phosphoinositol-3 Kinase PKA         Protein Kinase A PKC         Protein Kinase C PLCγ         Phsopholipase C γ PM         Plasma membrane  xx PMSF         Phenylmethylsulfonyl fluoride pSMAC        Peripheral supramolecular  activation complex PTK         Protein tyrosine kinase pY         Phosph-tyrosine R         Arginine RIAM         Rap1-GTPase interacting adaptor protein RIPA         Radioimmunoprecipitation assay rpm         Revolutions per minute RE         Restriction endonuclease RPMI         Roswell Park Memorial Institute RT         Room temperature S         Serine SDS                     Sodium dodecyl sulfate Sec         Seconds SH2         Src homology 2 SH3         Src homology 3 shRNA        Short hairpin RNA siRNA         Small interfering RNA Syk         Spleen tyrosine kinase T         Threonine TBE         Tris/Borate/EDTA TBS         Tris buffered saline TBST         TBS + 1% Tween-20 TCR         T cell receptor TEM         Trans endothelial migration TFH         Follicular helper T cells         Th         T helper TLR         Toll-like receptor TM         Transmembrane TM1         First Transmembrane TM2         Second Transmembrane  xxi TM3         Third Transmembrane TM4         Fourth Transmembrane TNF         Tumor necrosis factor Tyr         Tyrosine v         Voltage V         Valine VCAM-1        Vascular adhesion molecule-1 VLA-4         Very late antigen-4 v-Src         Viral Src W         Tryptophan WEHI         Walter and Eliza Hall Institute  WT         Wild Type Y         Tyrosine ZO-1         Zona Occludens-1 ZO-2         Zona Occludens-2  xxii Acknowledgements          I would like to first thank my supervisor Dr. Linda Matsuuchi for her constant support, encouragement and patience during my studies. I appreciate her effort in training and walking me through the steps of conducting research as well as science communication. I would also like to thank Dr. Michael Gold for many constructive ideas and suggestions during weekly lab meetings and Journal clubs. As well, I’d like to thank my committee members Dr. Christian Naus and Dr. Ninan Abraham for their advice and helpful suggestions regarding my project.             I would like to thank both present and past members of the Matsuuchi lab for training, collaboration and also many wonderful days in the lab: Letitia Falk, Kate Choi, May Dang-Lawson and Dr. Marcia Graves. I would also like to thank present and past members of the Gold lab for training and helpful suggestions: Sonja Christian, Jia Wang, Dr. Spencer Freeman, Madison Bolger-Munro and Dr. Libin Abraham.            Finally, I like to thank my parents, Dr. Farrokh Pournia and Ladan Mehrpouya for their constant and un-conditional support over the years, encouragement for coming to Canada to pursue my studies and interests. You are my source of inspiration and motivation. Special thanks are due to my grandfather Jalal Pournia who made me familiar with the world and its wonders from the very early ages through his wonderful stories and teachings. 1  Chapter 1: Introduction  1.1  The immune system       The immune system is the body’s defense against various disease causing  micro-organisms such as bacteria, viruses, fungi and parasites. The immune system also can protect the body from cancer by identifying cancer cells expressing abnormal surface markers and mount a response against them (Finn, 2012). The immune system is evolutionarily conserved among metazoans, and in mammals is composed of the innate and the adaptive immune systems.            The innate immune system includes the initial physical barriers and specialized general (not antigen specific) cells, which provide protection and rapid responses to infectious agents. The physical barriers include the skin, the internal epithelial cell layers, mucosa and also additional support from the resident flora that line the gastro-intestinal, respiratory and reproductive tracts. The barriers also include different classes of antimicrobial components present in the blood, extracellular fluid and epithelial secretions (Murphy, 2011). For example, antimicrobial enzymes such as lysozyme (Medzhitov and Janeway, 2000) digest bacterial cell walls. Enzymes like these in tears and saliva are secreted by phagocytes, and in the small intestine secreted by specialized epithelial cells.  Antimicrobial peptides are another class of antimicrobial components, which are secreted by epithelial cells and phagocytes and 2  incorporated onto mucosal surfaces and tissues. Three important classes of antimicrobial peptides in mammals include defensins (Gudmundsson and Agerberth, 1999), cathelicidins (Lehrer and Ganz, 2002), and histatins (Shimada, 2006; Piludu et al., 2006). Antimicrobial peptides lyse the cell membrane of pathogens (Murphy, 2011). The third class of antimicrobial components, known as the complement system, is composed of multiple plasma proteins, which target pathogens for lysis, as well as for phagocytosis by cells of the innate immune system (Murphy, 2011). The physical barriers are broad and fairly non-specific and if they are penetrated by the disease-causing pathogens, cells of the innate immune system come into play to eliminate the invading pathogen.            Cells of the innate immune system such as neutrophils, eosinophils, basophils, mast cells, dendritic cells and macrophages, identify and eliminate the disease-causing pathogens (Murphy, 2011). Innate immune cells recognize pathogen-associated molecular patterns (PAMPs) using receptors such as Toll-like receptors (TLRs) and C-type lectin receptors (CLR), leading ultimately to cell activation (Janeway and Medzhitov, 2002; Medzhitov and Janeway, 2002; Akira et al., 2006; Medzhitov, 2007). This results in elimination of the infectious pathogens by phagocytosis or by secretion of anti-microbial factors from cytotoxic granules from granulocytes such as neutrophils, eosinophils, basophils and mast cells (Murphy, 2011). The migration of innate immune cells to the site of infection, the extension of cell protrusions to probe for pathogens, and the process of engulfment of pathogens by phagocytosis, are all processes dependent on rearrangement of the innate cell’s 3  cytoskeleton (Torres and Coates, 1999; Chimini and Chavier, 2000; Diakonova et al., 2002). Activation of innate immune cells also results in secretion of cytokines and chemokines that recruit cells of the adaptive immune system (Takeda and Arika, 2001; Kobayashi et al., 2002).            Innate immune responses are only able to defend the body against pathogens with defined molecular patterns (PAMPs), while the cells of the adaptive immune system recognize a variety of different pathogens using receptors that recognize a wider variety of antigens and epitopes. Cells of the adaptive immune system include B and T lymphocytes (cells), which express specialized, antigen-specific receptors as a result of recombination of the variable and diversity gene segments that encode these receptors. Lymphocytes with unique receptor specificity are able to recognize and respond to specific pathogens, become activated, and differentiate into cell types that fight the pathogen (Gold and Matsuuchi, 1995). Cells of the adaptive immune system also remember specific antigens (“memory”), and induce a stronger, more specific response during subsequent encounters with the antigen. Specific antigen (Ag) recognition by B or T cells with unique receptor specificity results in activation, signaling, and clonal expansion of that specific B or T cell clone. In the case of B cells, binding of the B cell antigen receptor (BCR) on a single unique B cell and BCR signaling, results in clonal expansion and maturation of immature B cells into antibody (Ab) producing plasma cells that secrete antibodies that recognize the specific antigen (Gold et al., 2000; Gold, 2002; Le Bien and Tedder, 2008; Pieper et al., 2013). These antibodies can prevent infection via complement activation, 4  neutralization, and opsonization (Gold and Matsuuchi, 1995). A small fraction of the newly generated B cell clones do not differentiate into plasma cells; yet persist as dormant memory cells in the germinal centers. Memory B cells provide a fast recall response against subsequent exposure to previously encountered pathogens (Gatto and Brink, 2010). In the case of T cells, sub-types of T cells are involved in different processes leading to pathogen elimination. Cytotoxic (CD8+) T cells directly destroy the infected cells by releasing toxic substances from intracellular granules. T helper (Th) (CD4+) cells assist other cells of the immune system, for example Th1 cells recruit and activate macrophages that can phagocytose pathogens. Th2 cells produce cytokines that activate B cells, leading to antibody-mediated elimination of pathogens. Small subsets of antigen-specific T cells (can be CD4+ or CD8+) persist as long-term memory cells (Broerer et al., 2011). In summary, adaptive immunity, also referred to as acquired immunity, provides specific, long lasting protection by means of antigen-specific B and T lymphocytes.    1.2  B Lymphocytes                    B lymphocytes (B cells) are major players of the adaptive immune system. B cells are initially generated from hematopoietic stem cells (HSCs) in specific niches of the bone marrow, and in mammals, further develop and mature in secondary lymphoid organs such as the spleen and lymph nodes (Pieper et al., 2013).  The 5  sequential steps in this process are summarized graphically in Figure 1.1.  Differentiation of HSCs into B cells relies on interactions of the HSCs with adhesion molecules, chemokines and cytokines secreted by stromal cells, and also on the activation of transcription factors such as early B cell factor1 (EBF1), E2A and Pax5 which induce cell fate decisions (Hardy and Hayakawa, 2001; Bartholdy and Matthias, 2004; Pillai et al, 2004; Hardy et al., 2007; Nutt and Kee et al., 2007; Pillai and Cariappa, 2009). HSCs need to interact with cells and generate signals that drive development of the B cell lineage; therefore, HSCs migrate away from osteoblasts in the bone marrow to the niches close to the endothelium that contain a large number of reticular cells, which express high levels of the chemokine, CXCL12 (Adams and Scadden, 2006; Nagasawa, 2006). HSCs make several lineage commitments including becoming multipotent progenitors (MPP), lymphoid primed multipotent progenitors (LMPP), and common lymphoid progenitors (CLP), that lead to the earliest B cell precursor, Pre-Pro-B cells (Nagasawa, 2006; Pieper et al., 2013) (Figure 1.1.D). These B cell precursors then migrate to regions within the bone marrow that provide signals for further B cell development, and this leads to the rearrangement of the gene segments that encode the variable regions of the heavy and light chains of the B cell antigen receptor (BCR). B cells are released from the bone marrow as immature and naïve cells expressing a complete membrane bound BCR (Pieper et al., 2013) and migrate to secondary lymphoid organs for further development and maturation (Figure 1.1.A).   6                  The immature B cells released from the bone marrow migrate to the spleen in response to chemokines, go through the processes of negative and positive selection, and develop into mature B cells (Figure 1.1.B). Immature B cells migrate from the bone marrow into the blood towards the spleen in response to chemokines CXCL13, CCL19 and CCL21 produced by the follicular dendritic cells in the white pulp of the spleen (Gunn et al., 1998; Lo et al, 2003). In the blood as well as in peri-arteriolar lymphoid sheets (PALS), site of B cell entry to the spleen, B cells go through the process of negative selection. The process begins by binding of the BCR on immature B cells to soluble self-antigen within the blood, or antigen trapped in PALS, and results in apoptosis and elimination of the self-reactive immature B cells (Healy et al. 1997; Su and Rawlings, 2002). Once in the spleen, the immature B cells undergo positive selection in order to monitor for the presence of a completely functional BCR. For this purpose, the immature B cells migrate into primary follicles where they interact with self- antigens presented by follicular dendritic cells.  This results in BCR signaling and development into mature B cells. Weak BCR signaling leads to the development of marginal zone B cells, while moderately strong BCR signaling leads to the development of mature follicular B cells. Additionally, very strong BCR signaling results in apoptosis or anergy (Su and Rawlings, 2002; Pillai et al., 2004; Pillai and Cariappa, 2009). Migration of immature B cells from the bone marrow to spleen, as well as migration to specific niches within the spleen is crucial for normal B cell development. Thus for immature and mature B cells normal development relies on the ability of the cells to rearrange their cytoskeleton in a signaling-dependent manner in order to sequentially migrate to different locations.  7             Mature B cells recognize antigen (Ag) and mount an immune response. Follicular B cells are the most common subset of the mature B cells constituting around 70% of the total splenic cells. These cells reside in the B cell follicles but are also very motile, exit their niches, and then migrate to other lymphatic sites to search for antigens (Allman and Pillai, 2008) (Figure 1.1.D). Antigen encounter and recognition by the BCR drives B cell activation, proliferation and differentiation. In the spleen when naïve mature follicular B cells recognize Ag by their BCR, they internalize the antigen, degrade, and present portions of the Ag using the major histocompatibility complex II (MHCII) to follicular helper T cells (TFH) (Shekhar and Yand, 2012). At the same time B cells migrate to the border of the follicles and the T cell zone, the B-T boundary, (Okada and Cyster, 2006) where they receive help from TFH cells. The TFH cells express co-stimulatory molecules in response to MHC II-peptide recognition and also secrete cytokines IL-4, IL-5, IL6, IL-21, and IFNγ that drive B cell activation and differentiation (Cannos et al., 2006; Fazilleau et al., 2009). Activated B cells migrate to an extra follicular region or re-enter follicles. Those in an extra follicular region proliferate and differentiate into short-lived plasma cells, and those that re-enter the follicles form germinal centers and differentiate into long-lived plasma cells (Oracki et al., 2010). A graphical summary of the processes is presented in Fig 1.1.C. Mobility of the B cells into the specific niches of the secondary lymphoid organs is a cytoskeletal dependent process that allows B cells to interact with other cells of the immune system resulting in B cell activation and the mounting of an immune response.   8             Antibody secreting plasma cells migrate from their site of antigen-driven differentiation into target effector tissues as well as into the bone marrow. Once plasma cells are generated, they migrate to target effector tissues such as sites of inflammation and to mucosal surfaces. This migration often involves cell movement through tissue cell layers, processes that require changes in cell shape, extension of protrusions, and squeezing through cell junctions.  Additionally, plasma cells migrate to the bone marrow where they are responsible for long-term Ab production in the serum. The migration of plasma cells is coordinated by chemokine receptors, their responses to gradients of chemokines, as well as binding to tissue specific adhesion molecules (Kunkel and Butcher, 2003).  The motility of B cells post-differentiation (i.e plasma cells) is another example of the importance of cytoskeletal dependent processes for the generation of the immune response.            Overall, cellular processes requiring cytoskeletal rearrangements such as adhesion, spreading, polarity, immune synapse formation, motility, and migration are crucial for normal B-lymphocyte development, as well as for immune responses (Figure 1.1).    9   CA BDFigure 1.1 B Lymphocyte Development. The importance of B Lymphocyte motility for B cell development and the immune response (A,C-D); including overview of the B cell development (B), as described above in section 1.2. A. B lymphocytes are generated form the HSCs in the specific niches of the bone marrow (BM) and exit to the circulatory system as immature and naïve cells. B. Within the BM, HSCs migrate to the specific niches of the BM where stromal cells provide chemokines such as CXCL12 that determine B cell lineage development. HSCs make several lineage commitments leading to generation of the earliest B cell precursor, Pre-Pro B cells. These cells migrate to specific niches, responding to signals for further B cell development, including those that promote rearrangements of the gene segments encoding variable regions of the BCR. B cells are released from the BM expressing a complete membrane bound BCR. C. Within the spleen, B cells go through the processes of negative (eliminating self-reactive B cells) and positive selection (choosing B cells with functional BCRs) and develop into mature B cells. Immature B cells migrate to the primary follicles for the positive selection process where weak BCR signaling leads to formation of marginal zone B cells, and moderate BCR signaling leads to formation of mature follicular B cells. Those B cells that encounter Ag are activated, proliferate and differentiate into plasma cells and memory cells. Plasma cells migrate to target effector tissues and to the BM. D. Mature B cells exit the spleen and migrate to other secondary lymphoid organs such as lymph nodes in search for antigens. These images were drawn using information in references Adkins et al., 2004 and Pieper et al., 2013. 10  1.3  The BCR             The B cell antigen receptor (BCR) is located on the surface of   B lymphocytes and functions in antigen binding and signaling that are essential for B cell development, B cell survival and the immune response.     Structure of BCR 1.3.1               The BCR is a protein complex containing an antigen binding subunit, which is non-covalently associated to a signaling component (Hombach et al., 1990a; Hombach et al., 1990b; Reth, 1992). A schematic representation of the BCR expressed by the cells used in this thesis is shown in Figure 1.2. The antigen-binding subunit is membrane-bound immunoglobulin (mIg) containing heavy and light chains linked via disulfide bonds (Reth, 1992). There are two types of the light chain constant regions, lambda (λ) and kappa (κ) (Langman and Cohn, 1995) with molecular weights of 25-28 kDa, that can combine with the Ig heavy chains (Gold and Matsuuchi, 1995). Each BCR contains two light chains, which 60% in human and 95% in mice are κ. Each light chain is composed of one variable domain and one constant domain. Gene segments encoding the variable region are recombined in order to make unique binding sites that generate the specificity for each BCR when 11  the encoded protein is combined with the Ig heavy chain (Tonegawa, 1983). There are two possible heavy chain isotypes that can exist in membrane-bound isoforms, IgM and IgD with molecular weights ranging from 50-75 kDa, depending on the isotype. Some isoforms like IgG can also exist in subtypes like IgG1, IgG2a and IgG2b.  Each BCR contains two heavy chains, which varies according to the developmental stage of the B cells (Reth, 1992). Gene segments that encode the variable and diversity regions of the heavy chain genes are also recombined in order to create unique binding sites that when combined with the light chains gives each BCR a unique binding specificity (Roth and Craig, 1988; Pike and Ratcliffe, 2002).                The BCR on immature and mature B cells exist as membrane IgM and membrane IgM and IgD isoforms respectively, assembled with the Ig- signaling subunit, and these are responsible for the signaling events that drive B cell development and activation.  The BCR depicted in Figure 1.2 is representative of the BCR that was used in this thesis.  Specifically this is a membrane IgM containing BCR with light chains that when combined bind the hapten nitrophenyl (NP). This BCR is over-expressed on the surface of a sub-line of J558μm3 cells (Reth et al., 1987; Hombach et al., 1988; Justement et al., 1990), which is a murine plasmacytoma cell line that has lost expression of its normal, secreted IgA antibody. The BCR is composed of murine mIgM composed of μ heavy chains, λ light chains and Ig-.   12                The signaling component of the BCR is a composed of two transmembrane polypeptides, Igα (CD79a, mb-1) and Igβ (CD79b, B29), which are also required for proper trafficking of the BCR to the cell surface (Matsuuchi et al. 1992; LeBien, 1998). Igα is a 34 kDa membrane protein (Hombach et al., 1988) encoded by the mb-1 gene (Sakaguchi et al., 1988) and Igβ is a 39 kDa membrane protein encoded by the B29 gene (Hermason et al., 1988). The two parts of the signaling component are linked together by disulfide bonds (Hombach et al., 1990a). Igα and Igβ cytoplasmic tails contain Immunoreceptor Tyrosine-based Activation Motifs (ITAMs) (Reth, 1989; Reth, 1992), which are phosphorylated upon BCR stimulation by protein tyrosine kinases (PTKs) such as the Src-family kinase Lyn (Kurosaki, 2002). The phosphorylated tyrosines create SH2 domain binding motifs, recruiting additional PTKs, including Syk, and additional Src family kinases (like Blk), recruitment steps that are essential steps for initiating BCR signaling pathways (Kurosaki, 2002; Roli et al., 2002).   13                     Figure 1.2 Structure of the B-cell antigen receptor (BCR) in the plasma membrane. This schematic depicts the BCR that was used in the studies of this thesis, including membrane IgM (Igμ heavy chain), and λ light chain. The BCR contains two subunits (Ag binding subunit and signaling subunit) that are associated non-covalently. The Ag binding subunit is a mIg containing two heavy chains (dark blue-Igμ here) and two light chains (green-λ here) linked via disulfide bonds. The signaling subunit composed of Igα (CD79a, mb1), shown in red and Igβ (CD79b, B29), shown in yellow. The cytoplasmic domains of Igα/β contain ITAMs which include key tyrosine (Tyr) residues that are phosphorylated by PTKs. Also on Igα, two Tyr residues are located outside the ITAM. This figure was drawn using information in references Reth, 1995 and Treanor, 2012.  14   BCR signaling 1.3.2             The signaling initiated through the BCR is crucial for B cell development, B cell survival and the immune response. Igα and Igβ, the signaling component of the BCR, are first expressed in pro-B cells and mutations in the cytoplasmic domain of the proteins, in particular where the ITAMs are located, results in arresting the B cells in the pro-B cell stage (Karen and Melamed, 2005). Once a complete pre-BCR, including mIg and Ig-α/β subunit is expressed on the surface of pre-B cells, antigen-independent tyrosine kinase-dependent signaling begins which induces proliferation (Geier and Schlissel, 2006). BCR signaling is required for the B cell to pass through essential developmental checkpoints.                In immature B cells expressing a mature BCR, cross-linking of the BCR is involved in negative and positive selection leading to development of mature follicular and marginal zone B cells (see section 1.2) (Su and Rawlings, 2002; Pillai and Cariappa, 2009).                 Mature naïve B cells encounter antigens as soluble forms, or on the surface of antigen presenting cells (APCs) in the lymph nodes and in the spleen. This initiates BCR microcluster formation and signaling pathways downstream of the BCR, which results in activation of B cells (Harwood and Batista, 2008). BCR induced signaling pathways are summarized graphically in Figure 1.3. BCR induced signaling starts by phosphorylation of the ITAMs on the Ig-α/β subunit by PTKs such as Lck/ 15  Yes, Lyn, Fyn, B lymphocyte kinase (Blk) and Lymphocyte-specific protein tyrosine kinase (Lck)  (Gold et al., 1990; Kurosaki, 2002). The phosphorylated tyrosines of the Ig-α/β subunit create SH2 domain binding motifs, which serve as recruitment sites for additional PTKs including spleen tyrosine kinase (Syk) and additional Src family kinases, and this results in signal amplification (Takata et al., 1994; Kurosaki, 2002; Rolli et al., 2002). Syk influences the phosphorylation of CD19, a BCR co-receptor, which enhances signaling. Moreover, Syk phosphorylates a number of B cell adaptor proteins that recruit signaling complexes leading to the activation of the phosphoinositide-3 kinase (PI3K) pathway, the phospholipase C gamma (PLCγ) pathway, the Ras-Raf-Erk pathway, and other mitogen-activated protein kinase (MAPK) pathways, as well as the recruitment of the small Rho and Rap GTPases (Gold et al., 2000; Gold et al., 2002; Defranco et al., 2006). BCR induced signaling and consequent B cell activation results in B cell proliferation and differentiation, as well as immediate and proximal modifications to the actin cytoskeleton (Gold et al., 2000).                 BCR signaling pathways are similar in immature and mature B cells; however, the outcome is different. Crosslinking of the BCR on immature B cells, results in the elimination of self-reactive and non-functional BCR expressing B cells (Su and Rawlings, 2002; Pillai and Cariappa, 2009). However, crosslinking of the BCR on mature B cells results in activation and proliferation (Gold et al., 2000; Pieper et al. 2013). One possibility is that the different outcomes of BCR signaling are due to differences in the expression levels of the signaling effectors (Benschop et al., 2001). 16  Different levels for the signaling molecules such as Syk, PLCγ2 as well as Ca2+ release have been reported for immature versus mature B cells (Benschop et al., 2001). Additionally, immature B cells express approximately five times more surface mIgM compared to mature cells (Koncz et al., 2002). On the same note, immature B cells exiting the bone marrow do not express surface mIgD while mature splenic B cells express high levels of mIgD (Geisberger et al., 2006). The different outcome of BCR signaling in immature versus mature B cells can also be attributed to the duration of activation of the signaling molecules (Gauld et al., 2002). Similar BCR signaling pathways resulting in different outcomes in immature versus mature B cells can be explained by differences in the expression levels of the signaling molecules as well as differences in the duration of the periods of activation.    17                 Figure 1.3 BCR-induced signaling pathways.  Upon encountering Ag, crosslinking of the BCR initiates BCR signaling. The BCR-induced signaling starts by phosphorylation of the Tyr residues in the ITAM of the Igα/β by PTKs such as Lyn. The phosphorylated Tyr create SH2 binding motifs serving as recruitment sites for additional PTKs such as Syk and additional Src family kinases. Syk phosphorylates a number of B cell adaptor proteins that recruit signaling complexes leading to activation of the PI3K, Ras/Raf/ERK, MAPKs, PLCγ, as well as Rap GTPases. BCR-induced assembly of signalosomes leads to production of secondary messengers such as Ca2+ and DAG that contribute to the activation of GEFs for Rap GTPases. The Rap1 GTPase affects the activities of various actin binding and regulating proteins; therefore, influencing actin dynamics. Additionally, studies by Machtaler et al., 2011 showed that the presence of Cx43 influences antigen-, integrin-, and chemokine-mediated activation of Rap1 GTPase in B lymphocytes. This figure was drawn using the information in references Gold et al., 2002; Boss et al., 2005; Freeman et al., 2011; Machtaler et al., 2011; Pieper et al., 2013.  18   BCR-mediated cell spreading  1.3.3               BCR signaling mediated by antigen presenting cells (APCs) induces cytoskeletal rearrangements. This allows for spreading of the B cells across the APCs which enhances Ag gathering to amplify the BCR signals to the required level for B cell activation (Harwood and Batista, 2009; Harwood and Batista, 2010).  The encounter of Ags by B cells on the surface of APCs, for example macrophages or dendritic cells, increases integrin mediated adhesion of the B cell and the APC, followed by rapid spreading of the B cell membrane across the APC’s membrane (Fleire et al., 2006; Harwood and Batista, 2010). BCR-mediated membrane spreading allows for better scanning and the gathering of more Ag for generation of stronger BCR signaling (Harwood and Batista 2010). At this stage, microclusters of Ag bound BCRs are formed, which are signaling platforms that function in the recruitment and activation of signalosomes, comprised of a variety of intracellular signaling molecules (Fleire at al., 2006; Depoil et al., 2008; Harwood and Batista, 2008). BCR signaling is initiated and propagated from the microcluster sites (Harwood and Batista, 2009), which are rich in phospho-tyrosines (pY) and lack the presence of the protein phosphatase CD45 (Depoil et al., 2008). Formation of large, effective BCR microclusters is dependent on cytoskeletal rearrangements, as BCR signaling leads to disassembly of actin filaments, increasing the mobility of the BCRs in the membrane (Treanor et al., 2010). The release of the BCR from confinement by actin disassembly should theoretically increase their opportunities to form 19  microclusters and thus enhance signaling. Studies using single-particle tracking by Freeman et al. shows that in fact actin severing- mediated reduction in the spatial confinement of the BCR increases BCR mobility, leading to enhanced signaling (Freeman et al., 2015). Actin polymerization is also shown to be required for BCR microcluster formation as inhibitors of the actin polymerization prevent microcluster formation  (Harwood and Batista, 2010). This was further explained in a study by Freeman et al. showing that actin depolymerization is a pre-requisite for actin reorganization required for the microcluster formation (Freeman et al., 2011), as well as for enhancing signaling (Freeman et al., 2015). The later study showed toll-like receptor ligands enhance BCR-mediated signaling, and that remodeling of the actin cytoskeleton is also critical for lamellopodia formation during B cell spreading (Krause and Gautreau, 2014). The ability of the B cell to cluster its BCRs, change its shape, and rearrange its cytoskeleton are important early events critical for B cell activation. A graphical summary of BCR-mediated cell spreading and immunological synapse formation is shown in Figure 1.4.                BCR- mediated spreading is followed by contraction of the membrane allowing for windows of mobility of surface receptors, and this leads to formation of the immunological synapse (IS) between the APCs and the B cells. The IS contains the Ag-BCR clusters in a central area called the central supramolecular activation complex (cSMAC) which is surrounded by the peripheral supramolecular activation complex (pSMAC) containing leukocyte function-associated molecule-1 (LFA-1, CD11a/CD18, αLβ2) and very late antigen-4 (VLA-4, α4β1) (Kurosaki et al., 2010). 20  LFA-1 and VLA-4 on the surface of B cells bind to intercellular adhesion molecule-1 (ICAM-1) and vascular adhesion molecule-1 (VCAM-1), respectively, on the surfaces of the APCs. The integrin mediated adhesion of the B cells to the APCs is critical for IS formation and subsequent B cell activation (Carraso and Batista, 2006). The IS also contains an outer most ring, the distal supramolecular activation complex (dSMAC), where the phosphatase CD45 is located (Evans et al., 2009). BCR-mediated spreading and subsequent IS formation enables maximum Ag gathering, prolonged BCR signaling and Ag internalization (Carrasco et al., 2004; Fleire et al., 2006; Natkanski et al., 2013). B cell spreading and IS formation are important early events of B cell activation that are required for Ag presentation to T helper cells, and in receiving their help. These cytoskeletal dependent processes are crucial events for B cell activation (Harwood and Batista 2010).                  Crosslinking of the BCR initiates assembly of signalosomes and production of secondary messengers, which results in activation of the Rap1 GTPase (Stone, 2011), and contributing to enhancement of cytoskeletal dynamics (Bos, 2005; Lin et al., 2007). Triggering of BCR signaling initiates assembly of signalosomes consisting of PLCγ2, PI3K, Bruton’s tyrosine kinase (Btk) and Vav, which together lead to the production of second messengers including Ca2+, diacylglycerol (DAG) and phosphatidylinositol (3,4,5)-tri-phosphate (PIP3) (Kurosaki et al., 2010). Ca2+ and DAG contribute to the activation of the members of guanine exchange factors (GEFs) specific for the Ras family and Rap family of GTPases (Stone, 2011). GEFs activate small GTPases by promoting GDP disassociation and permitting GTP binding (Vigil 21  et al., 2010). The small GTPases are molecular switches that cycle between an active GTP-bound form and inactive GDP-bound form. The inactive GDP-bound from is made as a result of intrinsic GTPase activity of the molecule and is accelerated by GTPase activating proteins (GAPs). The GTPases regulate signaling cascades by switching on and off the signal propagation (Vigil et al., 2010). The Rap1 GTPase is the master regulator of cytoskeletal dynamics in B lymphocytes and in other cell types (Lin et al., 2008; Lin et al., 2009; Lin et al., 2010; Freeman et al., 2010). Rap1 regulates actin polymerization, cell polarity and integrin activation, which are all important in processes like adhesion, spreading and migration (Bos, 2005). It has also been shown that Rap1 activation is required for B cell spreading, adhesion, IS formation and migration (McLeod et al., 1998; McLeod et al., 2004; Lin et al., 2008; Lin et al., 2009; Lin et al., 2010). The Rap1 GTPase affects the activity of various actin-binding and regulating proteins therefore, influencing actin dynamics (Bos, 2005).                  The Rap1 GTPase promotes cytoskeletal dependent processes such as adhesion, spreading and migration through affecting the function of various effector proteins that coordinate cytoskeletal dynamics (Krause et al., 2003; Lafuente et al., 2004; Gerard et al., 2007; Abram and Lowell, 2009; Freeman et al., 2011). In the case of adhesion, Rap1 activation results in recruitment and activation of Rap effector proteins RAPL, an adaptor protein member of Ras association domain family, and Rap1-GTPase interacting adaptor protein (RIAM), which both play roles 22  in integrin localization and activation including talin activation (Katagiri et al., 2003; Katagiri et al., 2006; Han et al., 2006). Talin is the major adaptor protein, which connects β integrins to F-actin (Burridge and Connel, 1983; Burridge et al., 1990; Crithcley et al., 1999; Crithcley, 2009). Activation of talin and subsequent integrin binding is important for integrin activation mediated by inside-out signaling (Luo et al., 2007), leading to cell adhesion (Abram and Lowell, 2009). Cofilin is another effector protein that is regulated by Rap1 GTPase activation. Activation of cofilin results in severing actin filaments, a pre-requisite for actin reorganization, which is critical for cytoskeletal dependent processes such as B cell spreading (Freeman et al., 2011). Moreover, binding of Rap-GTP to RIAM results in recruitment and activation of protein complexes with the final outcome of actin polymerization and filament extension (Krause et al., 2003). Lastly, active Rap promotes the activation of small Rho GTPases, cell division control protein 42-homolog (Cdc42) and Rac through recruiting their GEFS Vav2 and Tiam1. Active Cdc42 and Rac stimulate Arp2/3-mediated actin nucleation (Gerard et al., 2007). The Rap1 GTPase binds and activates a number of effector proteins, which promote actin cytoskeletal dynamics; therefore, promoting cytoskeletal dependent processes such as adhesion, spreading and migration.                 Recent studies in the Matsuuchi Lab have shown that the presence of Connexin43 (Cx43), a member of Gap Junction protein family, influences antigen-, integrin-, and chemokine-mediated activation of Rap1 GTPase in B-lymphocytes. Additionally, studies by our group have also shown the importance of Cx43 for 23  cytoskeletal dependent processes such as adhesion, spreading, cell shape, motility and directed migration, which are all crucial cellular processes involved in B cell development and immune responses (Machtaler et al. 2011; Machtaler et al., 2014; Falk et al., 2014). Additional details about the importance of Cx43 in cytoskeletal-dependent processes will be explained in the next section of this Introduction.   24                    Figure 1.4  BCR-mediated cell spreading and immune synapse formation upon Ag encounter.  B cells interacting with Ags on the surface of the APCs and consequent BCR signaling results in cytoskeletal rearrangements, facilitating B cell membrane spreading, followed by membrane contraction. This figure shows the contact site of a B cell upon encounter with an APC. Ag-induced BCR signaling results in spreading of the B cell membrane (shown in the middle diagram) across the APC membrane. Spreading enhances the ability of the B cell to gather antigen; therefore, this can amplify BCR signaling for B cell activation. During B cell spreading, cytoskeletal restrictions are removed leading to the formation of microclusters of Ag bound BCR (red) that can serve as signaling platforms. BCR signaling also leads to disassembly and reassembly of actin filaments, allowing for increased mobility of BCRs and formation of larger microclusters. The spreading is followed by membrane contraction leading to IS formation (shown in the right diagram). At this stage, Ag-BCR clusters are located in the cSMAC (red) central area and the integrins including LFA-1 and VLA-4 are located in the pSMAC (blue) area. The phosphatase CD45 (yellow) is located in the outer most area of the IS, dSMAC. IS formation facilitates prolonged BCR signaling and Ag internalization. BCR-mediated spreading and subsequent IS formation are important early events of B cell activation. This drawing is inspired by Fleire et al., 2006; Carraso and Batista, 2006; Evans et al., 2009; Harwood and Batista, 2010; Treanor et al., 2010.   25  1.4 Connexins           Connexins (Cxs) are members of the gap junction family of proteins important for forming intercellular channels, the gap junctions (GJs), between adjacent cells (Simon and Goodnough, 1998; Evans and Martin, 2002; Saez et al., 2003; Söhl and Willecke, 2004) and hemichannels (HCs) between cells and their environment in vertebrates (Scemes et al., 2009).  GJs and HCs constitute a direct and rapid means of cell-cell and cell-environment communication, respectively (Evans and Martin, 2002; Scemes et al., 2009), which are important for signal propagation and coordination of cellular processes in multicellular organisms (Barr et al., 1965; Lawrence et al., 1978; Campos et al., 1993; White and Paul, 1999; Daniel et al. 2001). GJs play important roles in embryonic development, tissue homeostasis, transport of metabolites in non-vascularized tissue, cell growth, and differentiation, as well as in the coordinated contraction of excitable cells (Willecke et al., 2002; Saez et al, 2003; Goodenough and Paul, 2003). GJs allow for the exchange of small metabolites up to 1 kDa in size (glucose, amino acids, nucleotides), second messengers (Ca2+, cAMP, cGMP, IP3) and ions (Na+, K+) (Goodenough and Paul, 2009; Laird 2010) as well as larger molecules such as siRNAS or micro-RNAs (Valiunas et al., 2005). HCs play an important role in regulation of cellular levels of Ca2+, NAD+ and ATP (Bruzzone et al., 2001; Braet et al., 2003). In addition to Cxs, which form GJs in vertebrates, the gap junction family of proteins also includes the pannexins (Panx), proteins analogous to connexins that form hemichannels in 26  vertebrates, as well as the Innexins, the Px homologs in invertebrates (Bauer et al., 2005; Barbe et al., 2006; Scemes et al., 2009).          In addition to channel and hemichannel roles, connexins are also shown to have channel-independent functions with respect to cell morphology and motility in different cell types (Vinken et al., 2012; Matsuuchi and Naus, 2013). More details about the channel-independent functions of Cx43 are discussed in section 1.5.4. Moreover by identifying a large number of Cx interacting proteins including cytoskeletal elements, junctional proteins and enzymes (kinases and phosphatases) Cxs are now perceived not only as channel forming proteins but also as signaling complexes that regulate numerous cell functions (Dbouk et al., 2009).    Structure and organization  1.4.1             All members of the Cx family share the same membrane topology of four transmembrane domains, but are different in the length of the cytoplasmic loop (CL) and the carboxy-terminal tail (CT) (Gülistan et al, 2007; Dbouk et al., 2009). Cx proteins contain four hydrophobic transmembrane domains (TM) that form the channel pore. The third transmembrane domain (TM3) is the most amphipathic one; therefore, was predicted to line the aqueous channel (Zimmer et al., 1987), which was confirmed later by structural studies (Bogdanov et al., 2005). All the Cx isoforms 27  share a high degree of conservation in the four TMs, which are connected by two extracellular loops (EL). The two conserved ELs contains three conserved cysteine (C) residues that form the disulfide bonds with the opposing Cxs on the adjacent cells, thus leading to the docking of the paired hemichannels (Saez et al., 2003). In addition to the four transmembrane domains and the extracellular loops, Cxs also contain three cytoplasmic domains. These three domains include a short amino terminal (NT) region, a loop between transmembrane domains 2 and 3 (CL) and the carboxy-terminal tail (CT). All the cytoplasmic domains are predicted to form α-helices separated by hinge domains, which makes the domains flexible (Sorgen et al., 2004a). Furthermore, the predicted structure of the three cytoplasmic domains suggest possible regulation of channel-gating by a ball-and-chain model, with protein-protein interactions regulating voltage sensitivity (Evans and Martin, 2002). The differences between the Cx isoforms are mainly due to differences in the length and the sequence of the CL and the CT, regions that are proposed to allow for different interactions and functions (Sosinky and Nicholson, 2005). The CT domain varies widely in length and is thought to be the main regulatory domain by providing sites for post-translational modifications and protein-protein interactions (Solan and Lampe, 2009; Palatinus et al., 2012; Vega et al., 2012). Mice that are engineered to lack the CT domain of Cx43 after aa 258 (Δ258) die shortly after birth (Maass et al., 2004). The CT domain of Cx43, including the known and potential modification and protein-protein interaction sites are described in detail in section 1.5.1 and 1.5.2.   28         The Cx protein depicted in Figure 1.5 is representative of Cx43, the most abundant and ubiquitously expressed connexin (Laird, 2006), which is the protein, studied in this thesis.         Connexin genes are categorized into three groups (α, β and γ) according to gene structure, sequence identity, and specific motifs (Harris, 2001). Most connexins share a common gene structure consisting of two exons separated by one intron of variable length. The coding region of the gene is flanked by a 5’-untranslated region and a 3’-untranslated region. The second exon contains the coding region for the Cx protein (Söhl and Willecke, 2004).     29     Figure 1.5  Structure of Connexin43.Schematic representation of the structure of a single Cx43 protein in a lipid bilayer, including the proposed modification and protein-protein interaction sites in the CT. Cx43 is composed of four transmembrane domains (green), two extracellular loops (EL1 and EL2), and three cytoplasmic domains including the amino terminal (NT), cytoplasmic loop (CL) and the carboxyl terminal (CT). Each of the EL1 and EL2 loops contain 3 conserved Cys residues. Circles represent relevant amino acids residues, numbered according to their sequence from N- to C-terminus. Yellow stars represent Tyr (Y) residues that were the subject of the studies in this thesis. The CT of Cx43 contains multiple putative protein-protein interaction sites including a microtubule binding domain (aa 234-243), a proline-rich region (P274-P284) which is an SH3 binding domain, a PY motif (aa 282-286) which is a Nedd4 binding domain, a Tyr-based sorting signal (aa 286-289) and a PDZ-1 binding domain (aa 379-382). Also the CT of Cx43 includes multiple Ser (S) and Tyr (Y) residues, that can be targets of different kinases (Src, MAPK, PKC, CK1, PKA) as indicated. Phosophorylated Y265 is a proposed SH2 binding site. The information in this figure was inspired by Solan and Lampe, 2005.  30          Connexin monomers assemble into hexameric hemichanels, expressed on the cell surface, which in combination with another hemichannels on the surface of an adjacent cell form classical GJs (Evans and Martin, 2002; Gülistan et al., 2007; Goodenough and Paul, 2009). Six Cx monomers oligomerize to make a hemichannel or connexon which trafficks to the plasma membrane (Solan and Lampe, 2005). Docking of the two connexons from the adjacent cells is mediated by disulfide bonds forming between cysteine residues on the extracellular loops of the proteins (Foote et al., 1998; Tong et al., 2007). The two connexons together form an impenetrable β-barrel structure that makes the GJ channel (Foote et al., 1998). Groups of GJs aggregate into large clusters, termed gap junctional plaques, and these mediate the coordinated channel functions in tissues (Paul and Lampe 2005; Gülistan et al., 2007; Dbouk et al., 2009), and these plaques are rapidly turned over and internalized (Beardslee et al.,1998; Laird, 2005; Su and Lau, 2012; Solan and Lampe 2014).  There are 21 and 20 different Cx isoforms expressed in human and mice respectively (Söhl and Willecke, 2004). Different Cxs are named for their approximate molecular weight in kilodaltons (kDa), deduced by the protein sequence. For example, Cx43 has the molecular weight of approximately 43 kDa determined by mobility using SDS-PAGE gel electrophoresis (Willecke et al., 2002; Saez et al., 2003; Sohl and Willecke, 2004).  Connexons can be made up of the same Cx monomers called homomeric GJs or of a mix of different Cx monomers, termed heteromeric GJs (Gemal et al., 2008). In a same way GJs can be made of two identical connexons, homotypic, or two different connexons, heterotypic (Yeager et al., 1998; Willecke et al., 2002). These complex interactions increase the structural and functional variety 31  of GJs, which in turn can influence the specificity of the molecules that can pass through the channel (Nicholson et al., 2000; Goldberg et al., 2004; Weber et al., 2004). Connexins are building blocks of the GJs and HCs allowing for exchange of specific molecules up to 1 kDa, like ions, second messengers and small metabolites (Goodenough and Paul, 2009; Laird 2010). In addition, Cxs are also perceived as signaling complexes that regulate cell functions including cytoskeletal dependent processes (Dbouk et al., 2009; Matsuuchi and Naus, 2013).          Connexin biosynthesis, assembly, trafficking, internalization and degradation are highly regulated. Most Cxs are co-translationally inserted into the endoplasmic reticulum (ER) (Segretain and Falk, 2004) where chaperone proteins recognize mis-folded proteins and also prevent premature oligomerization (Das et al., 2009). Oligomerization into connexons occurs sequentially throughout protein transport through the secretory pathway, beginning in the ER and completed in the trans-golgi network (Musil and Googenough, 1993; Segretain and Falk, 2004; Laird, 2006).  Connexons (meaning in hemichannel form) are packaged in secretory vesicles and then transported to the plasma membrane using molecular motor proteins and microtubule tracks (Lauf et al., 2002). Connexin hexamers are transported to the plasma membrane in closed conformation (Bukauskas et al., 1995) and can either form non-junctional HCs in unopposed areas of the cell membrane or diffuse laterally to the periphery of existing GJ plaques where they form GJs with connexons on the adjacent cell (Harris, 2001; Lauf et al., 2002). Cxs have a very short half-life of 1-5 h (Laird et al., 1991; Beardslee et al., 1998).  Cx proteins contain amino acid 32  sequences in their CTs that are reported to be internalization signals, and older connexons from the centre of the GJ plaque are internalized into vesicular structures called annular junctions which either fuse with lysosomes or are targeted to the proteosomal pathway for degradation (Laing and Beyer, 1995; Musil et al., 2000; Jordan et al., 2001; Leithel et al., 2003; Qin et al., 2003, Laird, 2006; Leithe et al., 2009). Phosphorylation of specific residues by different kinases is found to regulate several stages of the Cxs’ life cycle including trafficking, assembly/disassembly, internalization, degradation and the gating of HCs or GJs. The level of connexin phosphorylation is different throughout the cell cycle with a 2.5 fold increase during S phase and 4.5 fold increase during M phase, compared to G0/G1 phase (Kanemitsu et al., 1998). Phosphorylation is the main regulator throughout several stages of the Cxs’ life cycle including trafficking, assembly/disassembly, degradation and gating as well as gap junction communication through the cell cycle. Additionally phosphorylation of Cxs leads to changes in localization and to changes in the nature of the interacting proteins that bind to Cx. These different interacting partners could influence many aspects of the Cx protein’s functions (Solan and Lampe, 2005 and 2009).   33   1.5 Connexin43 (Cx43)            Cx43 is the most abundantly and ubiquitously expressed Cx present in 34 tissues and 46 cell types, including lymphocytes (Laird, 2006; Solan and Lampe, 2009). Cx43, coded by the GJA1 gene, is also the most well-studied of the Cxs. The knock out of Cx43 in mice results in death shortly after birth due to heart malformation due to a swelling of the right ventricular outflow tract and obstruction of the blood flow into the lungs (Reaume et al., 1995). This finding emphasizes the importance of classical GJ channels between adjacent cells in cardiac tissues, that rely on coordinated cellular responses of groups of cells, working together.  Subsequent studies using mouse models with conditional knockouts or mice with Cx levels altered by in utero electroporation techniques also showed the importance of Cx43 in the developing brain (Elias et al., 2007; Cina et al., 2009). In addition, disruption in the distribution of Cx43 in GJ plaques leads to slow healing of wounds in the skin, epileptic seizures in the brain, and arrhythmias in the heart (Poelzing and Rosenbaun, 2004; Danik et al., 2004; Severs et al., 2008; Laird, 2008; Dobrowolski and Willecke, 2009). Mutations of Cx43 are also linked to the inherited human disease oculodentodigital dysplasia (ODDD). In this autosomal dominant genetic disorder, a number of different Cx43 point mutations have effects on many tissues causing multiple, variable craniofacial, limb, ocular and dental anomalies, which are often associated with neurological disorders. Mutations of Cx43 that are linked to 34  ODDD rarely occur in the CT domain. In fact only two mutations at location amino acid 253, an alanine (A) and aa 260 (C) have been reported in ODDD patients. This might be an indicative of the importance of the CT domain for survival (Laird, 2006; Gong et al., 2006; Gong et al., 2007; McLachlan et al., 2008; Paznekas et al., 2009; Tong et al., 2009; Tsui et al., 2011; Lorentz et al., 2012; Huang et al., 2013; Stewart et al., 2013; Laird, 2014). Cx43 is the most widely expressed and the most studied member of the Cx family with the indications of the CT being an important regulatory domain (Solan and Lampe, 2009; Palatinus et al., 2012).            The CT of Cx43 is important for channel and non-channel functions and is perceived as the main regulatory domain. Mice that lack the CT domain after aa 258 (Δ258) die shortly after birth due to a defect in the formation of the epidermal barrier (Maass et al., 2004). Also expression of CT truncated Cx43 at aa 256 (Δ256) in fibroblasts resulted in reduced basal growth, decreased mitogenic response to platelet-derived growth factor (PDGF), and inhibited cell motility (Moorby, 2000). Additionally, work by Bates et al. (2007) and Crespin et al. (2010), revealed the importance of the CT domain in glioma invasion and cytoskeletal changes, respectively. Moreover, the importance of the Cx43 CT (aa 246-382) in BCR-mediated cell spreading, LFA-1 mediated adhesion of B lymphocytes, motility, and chemokine directed migration, was shown in work by the Matsuuchi lab (Machtaler et al., 2011; Falk et al., 2014; Machtaler, PhD thesis 2011; Machtaler et al., 2014). Lastly, The CT is also reported to play a significant role in gap junction organization 35  in cardiomyocytes (Palatinus et al., 2012). The importance of the Cx43 CT for Cx functions has been established in different tissues.             The CT domain of Cx43 contains multiple modification and protein-protein interaction sites, which are the key determinants of GJ and HC functions as well as non-channel functions of Cx43 (Solan and Lampe, 2009; Palatinus et al., 2012; Vinken et al., 2012; Kameritsch et al., 2012; Matsuuchi and Naus, 2013).   The CT of Cx43 contains approximately 150 aa extending from the cytoplasmic face of the fourth transmembrane (TM4) domain (Solan and Lampe, 2009; Palatinus et al., 2012). Structural prediction modeling and 15N-HSQC NMR experiments on a fusion protein containing aa 252-382 reveal the tail as predominantly a random coil containing two α- helixes located between aa 311-325 and 339-345 (Sorgen et al., 2002 and 2004a).  Several known functional domains including phosphorylation sites exist in the CT (Solan and Lampe, 2009). Moving from the TM4 to the C- terminus, the juxtamembrane region located between aa 234-243 contains a tubulin-binding site, enriched in lysine (K), glycine (G), valine (V), arginine, (R) and proline (P). Moreover direct interaction of Cx43 with microtubules has been shown (Giepman et al, 2001b and c; Giepmans, 2004). The CT contains many serine (S), threonine (T) and tyrosine (Y) residues that can be phosphorylated, and some of these residues have been shown to be phosphorylated by kinases in vitro, and in some cases in cell and tissue culture cell lines (Solan and Lampe, 2005; Solan and Lampe, 2009).  Y247 and Y265 are able to be phosphorylated by Src, which according to a published model, occurs through binding of the Src homology 3 (SH3) domain to an SH3- 36  binding site (a proline-rich region P274-P284), leading to phosphorylation of Y265.  Phosphorylated Y265 creates a potential Src homology 2 (SH2) binding site, a phospho-tyrosine residue in a hydrophobic pocket, which can facilitate the phosphorylation of Y247. The phosphorylation of the two tyrosines results in GJ channel closure and downregulates GJ intercellular communication (GJIC) (Kanemitsu, 1997; Lin et al., 2001). The proline-rich region also corresponds to the consensus of a protein-protein interaction PY-motif (xPPxY, where x can be any aa). This motif overlaps with a putative tyrosine-based sorting signal (Yxxϕ, where ϕ is a hydrophobic aa), that is thought to facilitate internalization of proteins containing such a signal. Mutations in the tyrosine-based sorting signal including mutations at Y286, tripled the half-life of Cx43 indicating the importance of this motif for Cx43 turnover (Thomas et al., 2003). The PY motif located between aa 282-286 binds to the tryphtophan (W)-W domain of Nedd4 (neural-precursor-cell-expressed-developmentally down-regulated 4) (Leykauf et al., 2006; Su and Lau 2012). Multiple serine residues are phosphorylated with different kinases including mitogen-activated protein kinase (MAPK), protein kinase C (PKC), casein kinase 1 (CK1) and protein kinase A (PKA) (Solan and Lampe, 2005; Solan and Lampe, 2009). More details of the phosphorylation of specific serine residues by different kinases, and the functional role of these modifications is discussed in section 1.5.2. There is a PSD95, disks large, ZO-1 homology (PDZ-1) binding domain located at the very end of the CT, aa 379-382. Direct association of Cx43 with zona occludens-1 protein with Cx43 has been reported in multiple tissues, with a function mainly in regulating GJ size (Toyofuku  et al.,1998; Hunter et al., 2003; Giepmans, 2004). Additionally, titration 37  NMR experiments determined that the PDZ-2 domain of ZO-1 affects the last 19 aa of the CT (Sorgen et al., 2004a). The Cx43 CT contains many known regulatory sites, with most of them located between aa 260-290, and within the last 20 residues (Solan and Lampe, 2009).             Binding partners of Cx43 influence the structure and function of the protein. (Solan and Lampe, 2009; Palatinus et al., 2012). Structural studies by Sorgen and colleagues showed that binding partners of Cx43 could considerably alter the secondary structure of Cx43, with some of the alterations being located far from the interaction site. This group showed that the SH3 binding domain (Src binding site) could partially displace the CT-PDZ2 binding site (the last 19 aa) (Sorgen et al., 2004a). This finding can explain the previously known disruption of Cx43CT-ZO1 interaction upon c-Src binding which leads to down-regulation of GJIC (Toyofuku et al., 2001; Duffy et al., 2004). Additionally it has been shown that acidification (pH 5.8-6.5) using solvents induces dimerization of the Cx43 CT in vitro (Sorgen et al., 2004b). Dimerization suggests a potential way for intramolecular interactions to occur, in which the CT interacts with itself or other domains of Cx43. Also dimerization may affect the affinity of the CT for specific molecular partners (Sorgen et al., 2004b). The Cx43 CT is thought of as platform through which Cx binding proteins could interact and promote signaling (Solan and Lampe, 2009).   38    Proteins interacting with the CT of Cx43 1.5.1              Proteins interacting with Cx43 have been reported in the reviews by Giepmans in 2004, Herve et al. in 2007 and Olk et al. in 2009. Several proteins identified as interactors with GJ proteins localized at adherence and tight junctions were identified as well (Giepmans, 2004). Studies indicate that Cx cytoplasmic domains are associated with multiprotein complexes, termed the Nexus. Functional roles of the interactions were identified with respect to trafficking of Cxs to, within, and from the plasma membrane, in regulation of GJ-mediated intercellular communication, and in channel independent effects with respect to control of cell growth, regulation of cell migration, and cytoskeletal effects (Olk et al. 2009). Interacting proteins include cytoskeletal and scaffolding proteins which will be discussed in this section as well as different kinases, which will be discussed in section 1.5.2. It is now widely accepted that the connexin CT domain forms a site for anchoring multiprotein complexes (Duffy et al., 2002; Gülistan et al., 2007; Dbouk et al., 2009).              The growing list of potential Cx43 interacting proteins, especially the cytoskeletal and scaffolding proteins (Olk et al., 2009), supports the channel-independent functions of Cx43, including cytoskeletal regulation and cell migration (Matsuuchi and Naus, 2013). It should be noted that characterization of physical 39  interaction of proteins is not an easy task and positive results identified by co-localization and co-immunoprecipitation should not be interpreted as direct protein-protein interactions. These data can be interpreted as a possible interaction that might be indirect and mediated by linker proteins.               Association of actin filaments with Cx43 was identified in various cell types using different methods. Co-localization of F-actin and Cx43 in the tip of cell processes in cultured rat astrocytes was identified using a combination of atomic force microscopy and immunocytochemistry (Yamene et al., 1999). Additionally co-localization of Cx43 with F-actin was detected in human tenocytes, a mechano-sensitive cell type in tendons, in which the co-localization increases with mechanical strain (Wall et al., 2007). Furthermore, association of F-actin with Cx43 was identified in murine C2C12 myoblasts by co-immunoprecipitation (Squecco et al., 2006), and in murine cardiac neural crest cells by co-immunoprecipitation and co-localization studies (Xu et al., 2006). The association of Cx43 and actin is affected by phosphorylation of Cx43. In cultured mouse astrocytes, hypoxia-induced de-phosphorylation of Cx43 reduced actin association, whereas application of phosphatase inhibitors preserved the interaction (Li et al., 2005). Additionally, application of a MAPK inhibitor blocked the Cx43-actin association in murine C2C12myblasts (Squecco et al., 2006). Lastly, Cx43-actin association was identified during neural migration along radial glia, in the form of actin containing puncta (using immunofluorescence microscopy) and down-regulation of Cx43 resulted in a decrease in the number of the actin puncta (Elias et al., 2007).  F-actin is a putative 40  Cx43 interacting protein with phosphorylation being indicated as an important regulatory factor for Cx43-protein interactions (Olk et al., 2009). Finally, although actin has been shown to co-localize or co-immunoprecipitate with Cx43, a direct physical interaction has not been verified. Therefore, it remains a likely possibility that Cx43 is connected to the actin cytoskeleton by linker proteins (Olk et al., 2009).               Myosin II is a putative Cx43 interacting protein. Bundles of myosin II, the major protein responsible for the generation of cytoskeletal tension, together with actin fibers co-localize with GJ (Murray et al., 1997). Additionally, myosin II is found in association with annular gap junctions that are being internalized for degradation. It is suggested that myosin II together with actin is providing the contractile forces for Cx43 endocytosis/internalization/uptake (Murray et al., 1997; Olk et al., 2009). Inhibition of myosin II activity using the drug blebbistatin resulted in reduced association of Cx43 and actin filaments. This suggests that actin and myosin II together may play a role in stabilizing GJ at the plasma membrane (Wall et al., 2007). Lastly, myosin II is an important player in cell migration, where it acts with actin to move the cell body forward and retracts the rear of the cell (Conti and Adelstein, 2008), as well as regulating Cx’s influence on cell motility (Iacobas et al., 2003; Xu et al., 2006; Elias et al., 2007; Machtaler et al., 2011 and 2014, Falk et al., 2014; reviewed by Matsuuchi and Naus, 2013; Olk et al.2009). Myosin II interacting with Cx43 may play a role in internalization, the stability of Cx43 at the plasma membrane, as well as in cytoskeletal regulation.   41              Microtubules directly interact with Cx43 and play a role in trafficking. Tubulin is the first cytoskeletal protein that was found to directly bind to Cx43 using pull-down experiments (Giepmans et al. 2001b and b). Alpha (α-) and β-tubulin were found by pull-down assays to bind to the CT of Cx43 in different cell types (Giepmans et al. 2001a; Singh and Lampe, 2003; Butkevich et al., 2004). Microtubules mediate the trafficking of connexons to the plasma membrane. Vesicles containing Cx43 are carried and delivered to specific locations of plasma membrane via microtubules (Shaw et al., 2007), a standard method by which proteins are delivered to the cell surface via the constitutive secretory pathway.               Cx43 also potentially interacts with a number of different actin binding proteins including α-catinin, cortactin, and drebrin. Alpha (α)-catinin links the cytoskeleton to different transmembrane proteins, regulating the activity of diverse receptors, and functioning as a scaffold to connect the cytoskeleton to various signaling pathways (Otey and Carpen, 2004). Close association of Cx43 and α-catinin was identified by co-localization and co-immunoprecipitation assays in cardiac neural crest cells (Xu et al., 2006). Cortactin, short for cortical actin binding protein, is an actin-binding protein, which plays a role in multiple actin-dependent processes such as adhesion, spreading, endocytosis, and migration in different cell types, as well as invasion and metastasis of tumor cells (Bryce et al., 2005; Ammer and Weed, 2008; Lai et al., 2009). Cortactin has also been shown to play a role in Rho, a small GTPase, and tyrosine kinase signaling events (Weed and Parsons, 2001). Association of Cx43 with cortactin was identified using co-immunoprecipitation and 42  co-localization studies in murine C2C12 myoblasts. This interaction is dependent on p38 MAPK activation, suggesting that phosphorylation of Cx43 plays a role in its interaction with cytoskeletal elements (Squecco et al., 2006). In addition, association of tyrosine-phosphorylated cortactin with Cx43 was identified in seminiferous tubules (Vitale et al., 2009).     Drebrin, developmentally regulated brain protein, is an actin binding protein, which was found to interact with the Cx43 CT using the techniques that favor direct interactions. Pull-down assays using a Cx43 CT showed an association with drebrin in mouse brain homogenates. Fluorescence resonance energy transfer (FRET) microscopy confirmed the close proximity of the two proteins.  Additionally, interaction of the two proteins is suggested by co-localization detected at the regions of cell-cell contact. Moreover, siRNA depletion of drebrin resulted in dephosphorylation of Cx43 and impaired cell coupling because of GJ internalization (Butkevich et al., 2004). Drebrin is suggested to have a role in forming ordered complexes between the Cx43 and the actin cytoskeleton to promote GJ stability, as well as formation of stabilized membrane domains containing GJs (Butkevich et al., 2004; Majoul et al., 2007). Association of Cx43 with multiple actin binding proteins is now widely recognized (reviewed by Giepmans et al., 2004; Harve et al., 2007; Olk et al., 2009).               B-lymphocytes do not express cortactin and drebrin; however, they express a hematopoietic specific homolog of the cortactin family called HS1 (hematopoietic 43  lineage cell-specific protein 1), as well as a drebrin homolog called HIP55 (hematopoietic progenitor kinase 1-interactin protein of 55 kDa) respectively (Kitamure, 1989). Both HIP55 and HS1 have been shown to be important players of immune synapse formation and function in T cells (Larbolette et al., 1999; LeBras et al., 2004; Gomez et al. 2006).               A growing list of cytoskeletal proteins that potentially interact with Cx43 includes EB1 (a microtubule plus-end-tracking protein) (Shaw at el., 2007), ezrin (potentially mediating interaction between membrane proteins and cytoskeleton) (Niggili and Rossy, 2008), IQGAP1 (a scaffolding protein known as the fundamental regulator of cytoskeletal function) (Briggs and Sacks, 2004), spectrin (a membrane-associate actin binding protein) (Toyofuku et al., 1998; Ursitti et al., 2007), protein 4.1 (stabilized spectrin-actin association) (Singh and Lampe, 2003), vinculin ( an actin binding protein involved in linkage of adhesion molecule to the actin cytoskeleton) (Xu et al., 2006) and lastly vimentin (the intermediate filament functions as an organizer of multiple proteins involved in attachment, migration and cell signaling) ( Singh and Lampe, 2003). It is suggested that Cx43 forms an anchoring site for multiprotein complexes at submembrane microdomains, providing a means of spatio-temporal organization of scaffolding and signaling proteins (Duffy et al., 2002; Olk et al., 2009).                Cx43 also interacts with zona occludens-1 and -2 (ZO-1 and ZO-2). The ZO-1 protein is the most widely studied binding partner of the Cx43 CT. Direct interaction 44  was identified between the PDZ domain of ZO-1 and the cytoplasmic end of the Cx43 CT (Toyofuku et al., 1998; Giepmans and Moolenaar, 1998). Further work has shown that the ZO-1 binding domain is composed of the last 19 aa of the CT where it interacts with the ZO-1 dimer (Fanning et al., 2007; Xiao et al., 2011). Also interaction of Cx43 with ZO-2 protein was identified using methods that favor direct interaction (Singh and Lampe, 2003; Singh et al., 2005). Both ZO-1 and -2 are members of the membrane-associated guanylate kinase (MAGUK) family of proteins that function in protein targeting, signal transduction and determination of cell polarity (Anderson, 1996; Hartsock and Nelson 2008; Palatinus et al., 2012). ZO-1 has been shown to regulate internalization of GJs, and the size and transition of uncoupled connexons into gap GJs (Palatinus et al., 2012). ZO-1 and -2 members of the MAGUK family were found as Cx43 interacting proteins.              Lastly, down-regulation of Cx43 results in varied regulation of cytoskeletal proteins. For example cDNA microarray analysis of cultured Cx43 knock-out astrocytes, show up-regulation of four actin binding proteins caldesmon1, protein 4.1, drebrin 1, and calponin 2. Furthermore, siRNA knock down of Cx43 resulted in up-regulation of actin and downregulation of Ser-3-phosphorylated cofilin (does not bind to F- and G-actin) (Iacobas et al. 2003).               In recent years the Cx43 CT is believed to associate with multiprotein complexes, in particular, adaptors that can anchor Cx43 to the cytoskeleton, and related proteins such as scaffolding, integral membrane receptors, and signaling 45  molecules. The composition of this multiprotein complex may change in response to various stimuli. These interactions are important for GJ function as well as for enabling Cxs to interact with various cellular signaling pathways. The non-channel function of Cxs including cytoskeletal regulation, cell morphology and motility can also be facilitated through interactions with protein complexes that regulate cytoskeletal rearrangements (Olk et al., 2009).     Regulation of Cx43 through phosphorylation 1.5.2               Phosphorylation of Cx43 regulates multiple aspects of the Cx43 life cycle including trafficking, assembly into GJ plaques, disassembly, degradation, and gating of GJ channels (Lampe and Lau, 2004; Solan and Lampe, 2005; Solan and Lampe, 2009; Solan and Lampe, 2014). The CT of Cx43 contains multiple serines, threonines, and tyrosines that can be phosphorylated, and these are probably the only phosphorylation sites of importance since for Cx43, the CL and the NT do not contain any known phosphorylation sites  (Lampe and Lau, 2000; Lampe and Lau, 2004). Many protein kinases including Src, MAPK, PKC, CK1 and PKA phosphorylate Cx43 (Solan and Lampe, 2005 and 2009), resulting in different outcomes, which will be discussed below. Cx43 has three electrophoretic isoforms due to phosphorylation when analyzed by SDS-PAGE, including a faster migrating form P0 or NP, and two slower migrating forms P1 and P2 (Musil et al., 1990). It is 46  perceived that the higher shift in mass is not due to the mass of phosphate group, 80 Da, but is due to covalent modifications and possible conformational changes of the protein that are reflected in altered electrophoretic motility on these types of gels (Lampe et al., 2006; Solan et al., 2007).  Recent studies have linked specific phosphorylation sites to specific changes in electrophoretic migration (Solan et al., 2003; Solan and Lampe, 2009). Details of specific phosphorylation sites and their function are discussed below.               Direct phosphorylation of Y247 and Y265 of Cx43 by Src was identified, which results in down-regulation of GJIC (Swenson et al., 1990; Kanemitsu et al., 1997; Lin et al., 2001; Solan and Lampe, 2008). In addition, in a study using several phospho-specific antibodies, it was shown that activation of v-Src also leads to phosphorylation of S262, S279/S282 (also a MAPK target (Warn-Cramer et al., 1996)) and S368 (a PKC target (Reynhourt et al., 1999; Martinez et al., 2002)).  These studies also showed that there was a decrease in phosphorylation of S364/S365 (a PKA target (Shah et al., 2002)) (Solan and Lampe, 2008). Lastly, binding of c-Src to the SH3 binding domain of Cx43 disturbs the interaction of Cx43 and ZO-1 leading to down-regulation of GJIC (Toyofuku et al., 2001; Duffy et al., 2004). v- and c-Src phosphorylate Cx43, with most of the reports revealing a function in down-regulation of GJ intercellular communication (Lau et al.,1996; Toyofuku et al.,1999; Giepmanns et al., 2001a; Duffy et al., 2004).   47               Multiple serine residues in the Cx43 CT are phosphorylated with different kinases and these play different functional roles. S255, S279 and S282 are phosphorylated by MAPK and function in down-regulation of GJ intercellular communication (Kanemitsu and Lau, 1993; Warn-Cramer et al., 1998; Cameron et al., 1993; Cottrel et al., 2003; reviwed by Lampe and Lau, 2004; Solan and Lampe, 2009). Phosphorylation at these sites does not lead to a change in protein migration detected by SDS/PAGE (Solan and Lampe, 2008). S262 as well as S368 are phosphorylated by PKC in vitro (Saez et al., 1997; Lampe et al., 2000). Phosphorylation of S262 appears to be an event that can induce conformational changes in many cell types, as detected by causing a protein migration shift to the P2 position (Solan and Lampe, 2008). In contrast, phosphorylation of S368 does not affect protein migration of Cx43 (Solan et al., 2003). Phosphorylation of S255 is reported to influence DNA synthesis; therefore, potentially playing a role in cell-cycle progression in cardiac myocytes (Doble et al., 2004). Phosphorylation of S368 leads to reduction in channel conductance (Lampe et al., 2000; Ek-Vitorin et al., 2006). S325, S328 and S330 are phosphorylated by CK1 in vitro and show a shift in protein migration to the P2 position. Phosphorylation at these sites is reported to be important for GJ assembly (Cooper and Lampe, 2002). Several tandem serines including S364, S365, S369, S373 can be phosphorylated by PKA promoting GJ coupling (Imanaga et al., 2004). S364 and S365 are phosphorylated upon increase of cAMP levels leading to increased trafficking of Cx43 through the secretory pathway to form GJ plaques (TenBroek et al., 2001 Yogo et al., 2002; Yogo et al., 2006). Differential phosphorylation of Cx43 by different kinases is the most well studied 48  regulator of GJ life cycle and function. Additionally, the phosphorylation of Cx43 affects both structure and function of the protein, leading to changes in localization, channel selectivity, as well as the cohort of interacting proteins (Solan and Lampe, 2009). Locations of the phosphorylation sites are illustrated in Fig 1.5.    The role of Cx43 in the immune response 1.5.3               Cx43 is expressed in lymphoid organs as well as in cells of the immune system, including peripheral lymphocytes (Evans and Martin, 2002). Cx43 is expressed in the bone marrow, spleen, thymus and other lymphoid tissues as well as in immune cells (Krenaces and Rosendaal, 1995; Krenaces et al., 1997; Alves et al., 1998; Oviedo-Orta and Evans, 2004). Cx43 is expressed in macrophages (Beyer et al. 1991, Alves et al. 1996, and Kwak et al. 2002), dendritic cells (DCs), and natural killer cells (NKs) (Oviedo-Orta et al., 2000; Oviedo-Orta et al., 2001). Expression of Cx43 was also identified in endothelial cells (Polacek et al., 1993; Polacek et al., 1997). GJIC participates in key immunological events such as immunoglobulin secretion and cytokine production (Oviedo-Orta et al., 2001), transendothelial migration (TEM) of leukocytes (Zahler et al., 2003), peptide transfer and cross-presentation (Neijssen et al., 2005; Mendoza-Naranjo et al., 2007), and DC activation (Matsue et al., 2006). It is suggested that Cx43 expression in different organs and cell types of the immune system allows for extensive and complex cross-talk 49  between the cells of the immune system (reviewed by Oviedo-Orta and Evans 2004). For example, it was shown recently that Cx43 accumulates at the IS during T cell priming and that it mediated bidirectional cross talk between the DCs and the T cells regulating Ca2+ signals and T cell activation (Mendoza-Naranjo et al., 2011). Studies by the same group also identified functional gap junctions between the NKs and DCs as well as between the NKs and tumor cells, which function in NK cell activation and antitumor effector responses, respectively (Tittarelli et al., 2014). Cx43 is expressed in the cells of the immune system and GJIC is involved in important immunological processes.              Cx43 is expressed in B lymphocytes with different functional roles reported in the past literature. Expression of Cx43 as well as Cx40 at both mRNA and protein levels were reported in B cells (Oviedo-Orta et al., 2000). Heterozygous Cx43+/- mice have reduced numbers of both B and T cells identified using the membrane markers IgM and CD19 for B cells, and CD4 and CD3 for T cells (Montecino-Rodriguez et al., 2000). Hematopoietic defects in heterozygous mice disappeared 4 weeks after birth, in addition, induced Cx43 deletion in adult mice did not alter lymphocyte numbers in the peripheral blood. These findings suggest the importance of Cx43 for lymphocyte formation during embryogenesis or during hematopoietic stress, but not for steady-state hematopoiesis (Montecino-Rodriguez et al., 2000; Presley et al., 2005). Lipopolysaccharide (LPS) stimulation increases Cx43 expression in both B and T lymphocytes (Jara et al., 1995). Inflammation induced by lysosome injections into the mouse’s footpad increased expression of Cx43 in the 50  light zone of germinal centers of the lymph node, where B cell fate decisions are made. This suggests a potential role for Cx43 in germinal centre organization and B cell differentiation (Krenacs et al., 2005). Cx43 is also shown to have a role in intercellular communication (Oviedo-Orta et al., 2000; Oviedo-Orta et al., 2001) as well as in channel-independent function (Machtaler et al., 2011; Machtaler et al., 2014; Falk et al., 2014; reviewed by Matsuuchi and Naus, 2013) in lymphocytes, which will be discussed later in this section. Cx43 is expressed in B cells with functional roles reported during embryogenesis and B cell differentiation as well as GJIC and non-channel function with respect to cytoskeletal rearrangements.                Cx43 functions in GJIC between the lymphocytes (Oviedo-Orta et al., 2000; Oviedo-Orta et al., 2002). GJ coupling in lymphocytes was first identified in 1972 using microelectrode studies of isolated human peripheral blood lymphocytes (Oliveria-Castro and Barcinski, 1974). Today, GJ coupling is identified between B and T cells, different type of B cells (Oviedo-Orta et al., 2000) and also between B cells and follicular dendritic cells (Krenaces et al., 2005). Calcein, a GJ permeant fluorescent dye, was transferred between lymphocytes that are in contact. Using two classes of GJ inhibitors, highly specific Cx mimetic peptides and 18-α-Glycyrrhetinic acid, the dye transfer was inhibited (Oviedo-Orta et al., 2000). Moreover using Cx mimetic peptides, which bind to the two extracellular loops of Cx43, as a GJ inhibitor in mixed human B and T lymphocyte cultures, resulted in reduced immunoglobulin and (Oviedo-Orta et al., 2001) and cytokine secretion (Oviedo-Orta et al., 2000) in vitro. Cx43 plays a role in direct communication between the lymphocytes.  51                Studying GJIC in leukocytes is relatively difficult due to their migratory behavior as well as formation of transient cell-cell contacts. However, HCs can play a role in various immune responses. The effects of HC activity are mostly attributed to Panxs, but increasing evidence of HC activities suggest that Cx HCs may also play a role in immune responses. For example, ATP release through HCs has been identified as a mechanism for signal amplification in neutrophil and macrophage chemotaxis (Chen et al., 2006), macrophage-mediated lysis as well as T cell activation (Mendoza-Naranjo et al., 2011). ATP release via HCs can function as an autocrine or paracrine signal leading to stimulation of purinergic receptors, which results in opening of both Panx and Cx HCs and Ca2+ influx (Baroja-Mazo et al., 2012). Cx43 HC activity can potentially play a role during immune responses.              In addition to a function in intercellular communication, Cx43 also has channel-independent function in lymphocytes (Oviedo-Orta et al., 2002; Machtaler et al., 2011; Machtaler et al., 2014). Studies examining GJIC between lymphocytes and endothelial cells during TEM revealed transfer of calcein from the endothelial cells to the lymphocytes. However, inhibition of dye transfer using Cx mimetic peptides had little influence on TEM (Oviedo-Orta et al., 2002). The results suggest a channel independent function for Cx43 during TEM.  Here Cx43 might play a role in adhesion of lymphocytes to the endothelial cells or in influencing the migratory behavior of the lymphocytes during TEM. This can be interpreted by taking into consideration the channel independent functions of Cx43 reported in neurons and cardiac neural crest 52  cells with respect to cell adhesion and migration (Fushinki et al., 2003; Xu et al., 2006; Bates et al., 2007; Cina et al., 2009). Briefly, it has been shown that Cx43 is important for BCR-mediated cell spreading responses, B cell adhesion, and B cell migration, cellular processes that rely on regulated reorganization of the cytoskeleton (Machtaler et al., 2011; Machtaler et al., 2014). More details about channel-independent function of Cx43 is discussed in section 1.5.4.    The role of Cx43 in cytoskeleton-dependent processes 1.5.4              Two channel-independent functions of Cx43 with respect to control of cellular life cycle (Vinken et al., 2012) and cytoskeletal dependent processes (Kameritsch et al., 2012; Matsuuchi and Naus, 2013) are known. Cx43 is known to have channel independent functions in different cell types including cardiac neural crest cells (Xu et al., 2006), epithelial cells (Simpson et al., 2009), neural cells (Fushinki et al., 2003; Bates et al., 2007; Cina et al., 2009), and lymphocytes (Machtaler et al., 2011; Machtaler et al., 2014). Studies have revealed the importance of Cx43 expression on cellular processes that are dependent on rearrangements of the cytoskeleton, thereby affecting cell polarity, adhesion, cell spreading, motility and migration (Kameritsch et al., 2012; Matsuuchi and Naus, 2013).   53               Cx43 plays a role in cell polarity and directional movement of cardiac neural crest cells (CNCs) (Xu et al., 2006). The Cx43 knockout (KO) mice exhibit heart developmental anomalies some of which are associated with abnormal CNCs deployment (Reaume et al., 1995; Li et al., 2002; Huston and Kirby, 2003; Walker et al., 2005). CNCs are a subset of neural crest cells, ectomesenchymal cells derived by epithelial-mesenchyme cell transformation from the dorsal neural tube, that migrate from the site of the neural tube to the heart, and are important for the formation of the cardiovascular system (Kirby and Waldo, 1995). In Cx43 KO mice or transgenic mice over-expressing a dominant-negative form of Cx43, the migration of neural crest cells is inhibited (Huang et al. 1998).  Using time-lapse imaging, the extension of protrusions and cell movement in specific directions was assessed for Cx43+/+, Cx43-/- (knockout), and over-expressing Cx43 CNCs (Xu et al., 2006). While Cx43 +/+ and the cells reconstituted with wild type Cx43 had cellular processes/protrusions on only one side of the cell, with retraction of the cell membrane being predominate at the other side of the cell, Cx43-/- CNCs show extension and retraction of cell processes/protrusions at many locations around the periphery. Additionally, using immuno-staining, altered localization of focal adhesions, as well as noticeable differences in the organization of the actin cytoskeleton was detected in the Cx43-/- CNCs. These findings are consistent with an essential role for Cx43 in modulation of CNCs polarity and directional movement (Xu et al., 2006).    54              Cx43 plays an important role in the proper response of epithelial cells during wound healing in vitro (Simpson et al., 2008). In an unbiased screen by Simpson et al., 2008, using siRNA knockdown libraries, to identify genes that regulated epithelial cell migration, the gene GJA1, encoding Cx43, was identified as one of the major hits with high confidence. Furthermore, down regulation of GJA1 resulted in accelerated migration of MCF-10A epithelial cells tested in a wound-healing assay. Time-lapse imaging of the epithelial cells transfected with siRNA targeting GJA1 showed reduced cell-cell adhesion, and reduced polarity of the cells, whereas faster migration by cells was noted at the wound edge. Tracking the migration pattern of single cells revealed frequent changes in the direction of the cells, impaired retraction of the tail of the cell resulting in formation of elongated tails, as well as displays of multiple protrusions per cell (Simpson et al. 2008). Cx43 is thus identified to play a role in motility and migration of epithelial cells. The association of Cx43 with migratory processes in epithelial cells is similar to the findings in neural crest cells. Also similar effects of Cx43 are identified in neurons, which suggest a more global role for Cx43 in regulating fundamental cellular processes that involve the cytoskeleton in many different cell types (Matsuuchi and Naus, 2013).                  In the nervous system, Cx43 expression is found to be necessary for neuronal migration guided by radial glial cells during neocortex development in mice. Impairing Cx43 expression resulted in an alteration in the pattern of neuronal migration (Fushiki et al., 2003; Elias et al., 2007; Cina et al., 2009). Additionally, involvement of Cx43 in neural migration by mediating adhesion was detected (Elias 55  et al., 2007). Further studies uncovered important roles for the CT of Cx43 with respect to neural migration during neocortex formation (Cina et al., 2009) and also in glioma migration (Bates et al., 2007).  Cina et al. 2009 showed that a conditional knockout of Cx43 (Cx43cKO) in mouse embryo brains disturbs neural migration during development. It was discovered that the migration defect in Cx43cKO mice can be rescued by reconstitution of full-length, wild type Cx43, but not by Cx43 with the CT truncated at aa 258 (K258stop) (Cina et al., 2009).  In an attempt to find the specific region of the Cx43 CT between aa 258 and 382 (the end of the protein) that was the most important for these effects on neural migration, using the same reconstitution approach in Cx43cKO mice, the region between aa 258-305 was found to be the most influential (Cima Cina, PhD dissertation, 2010, unpublished). Cx43 and more specifically the CT of Cx43 is important for neural migration during development (Cina et al., 2009) as well as glioma invasion and cytoskeletal changes in glioma cells (Bates et al., 2007, Crespin et al., 2010).   Cx43 is important for cytoskeletal dependent processes such as cell spreading, adhesion (Machtaler et al., 2011), motility and migration in B lymphocytes (Machtaler et al., 2014). Recent studies in the Matsuuchi lab show that Cx43 influences BCR-mediate spreading, LFA-1-mediated adhesion, (Machtaler et al., 2011), motility and chemokine (C-X-C motif) ligand 12 [CXCL12]-mediated- directed migration of B lymphocytes (Machtaler et al., 2014). Using both loss-of–function (LOF) and gain-of–function (GOF) approaches, the importance of Cx43 for the cytoskeletal dependent processes described above that are important for B cell 56  development and immune response were discovered. Additionally, the influence of Cx43 on BCR-, LFA-1, and CXCL12- mediated activation of the Rap1 GTPase (Machtaler et al., 2011; Machtaler et al., 2014) was discovered. The Rap1GTPase is known as the master regulator of cytoskeletal events in B cells (Lin et al., 2007; Lin et al., 2009; Lin et al., 2010; Freeman et al., 2010). Details of Rap1 GTPase function and cytoskeletal regulation were discussed in section 1.3.3. Furthermore, the importance of the Cx43 CT (aa 246-382) in BCR-mediated cell spreading (Machtaler et al., 2011 and Falk et al., 2014), LFA-1-mediated adhesion and sustained Rap1GTPase activation has been identified (Machtaler et al., 2011). These results, consistent with that in neurons, indicate a role for the CT of Cx43, with respect to cellular events that clearly involve changes in the cytoskeleton.  The CT of Cx43 could influence cytoskeletal rearrangements by regulating channel function or by serving as a docking site for important regulatory proteins.  There is little evidence that B lymphocytes form classical GJ pores with other B lymphocytes but they can form HCs (Falk et al., 2014).  Work in the Matsuuchi lab by Falk et al., 2014 clearly showed that in B lymphocytes, blocking HC activity using pharmacologic agents did not block BCR-mediated cell spreading.  Moreover, expression of mutated Cx43 with defects reported to block channel function also did not block BCR-mediated cell spreading (Falk et al., 2014).  Thus we turned our focus to ask if Cx43 was involved in the recruitment of proteins that directly or indirectly lead to Rap1 GTPase activation, influence cytoskeletal reorganization, or possibly provide anchoring sites for adaptor proteins that regulate actin dynamics. Since the 57  likely region of Cx43 that could serve as a binding target is the CT, this was the first region we explored.   58   1.6 Rationales, aims and hypothesis     Rationales:             The CT of Cx43 (aa 246-382) is important for B cell spreading and adhesion, cytoskeletal dependent processes that are important for B cell activation (Machtaler et. al., 2011; Falk et al., 2014), yet the exact mechanism by which the CT is involved is not known. In line with this, work by Bates et al., (2007), Crespin et al., (2010), and Cina et al., (2009) have shown the importance of the Cx43 CT in glioma invasion, cytoskeletal changes in glioma cells, and neural migration during development, respectively. In an attempt to find the specific region of the Cx43 CT that was the most important for effects on neural migration, using the reconstitution approach in Cx43cKO mice, the region between aa 258-305 was found to be the most influential (Cima Cina, PhD dissertation, 2010, unpublished). The CT of Cx43, containing about 150 aa, encompasses most of the proposed modification and protein-protein interaction sites (Solan and Lampe, 2009; Palatinus et al., 2012).  It is also possible that Cx43 could act through these modification and/or protein-protein interaction sites by influencing cytoskeletal regulating signaling pathways or by providing an anchoring site for scaffolding and cytoskeletal interacting proteins that could influence cytoskeletal dynamics at the membrane. The role of Cx43 in regulation of 59  cytoskeletal rearrangements in B lymphocytes will be useful in understanding B cell functions.           We predict that the results of this current study as well as future studies will provide novel insights into understanding the underlying cellular mechanisms by which B cells’ cytoskeletal rearrangements are regulated. Since the same cytoskeleton changes are necessary for changes in cell morphology, adhesion, motility and migration of a number of cell types including tumor cells and neuronal cells, elucidating the role of Cx43 as a possible cytoskeletal adaptor protein and regulator of cytoskeletal dynamics and cell migration could contribute to the dissection of the fundamental process of cell movement and how this is used during tumor dissemination and cancer progression.          Aims:          My project was designed to build on these past findings to further define the specific region within the aa 246-382 of the Cx43 CT, as well as to identify precise residues that are important, using BCR-mediated B cell spreading as a readout for cytoskeletal rearrangements.     60            Hypothesis:  1) Certain region(s) within the Cx43 CT especially those that encompass modification and/or protein-protein interaction sites are important for BCR-mediated B cell spreading.   2) Specific residues within the CT of Cx43, especially those  that are targets of phosphorylation i.e. tyrosine (Y) influence BCR-mediated spreading of B cells.    61  Chapter 2: Materials and Methods     2.1 Materials    Plasmids 2.1.1    The NAP2 expression vector encoding cDNA for Wild-Type (WT) rat connexin43 fused to enhanced green fluorescent protein (Cx43-EGFP) or Cx43 with the carboxyl tail (CT) truncated at aa246 (Δ246 Cx43)-EGFP, and the AP2 expression vector encoding EGFP were received as gifts from Dr. Christian Naus (Dept. Cellular and Physiological Sciences, Life Sciences Institute, UBC, Vancouver, Canada). The original AP2 expression vector was designed and synthesized in the Nalbantoglue Lab, McGill University, Montreal, Quebec. AP2 is a bicistronic, nonsplicing murine retroviral expression vector including a multiple cloning site (MCS) under a CytoMegalovirous (CMV) promoter and EGFP under internal ribosome entry site (IRES) promoter (Galipeau et al., 1999). The NAP2 retroviral expression vector was made by removing the IRES and the EGFP regions of the AP2 plasmid (Mao et al., 2000). The NAP2 expression vector encoding WT rat Cx43 with in-frame EGFP fused to the CT (Cx43-EGFP) was made by insertion of Cx43-EGFP cDNA into the vector’s MCS (Mao et al., 2000). The NAP2 expression vector, encoding Δ246 Cx43-EGFP that was used in studies by the Naus lab (Fu et al., 62  2004; Bates et al., 2007), was from Dr. Dale Laird (University of Western Ontario, London, Canada) (Langlois et al., 2008).   Plasmids created 2.1.2     Additional plasmids with Cx43 cDNAs that contained deletions or contained point mutations were created (Table 2.1) by employing site-directed mutagenesis (Section 2.2.6) using the WT Cx43-EGFP cDNA (in the NAP2 expression vector, Mao et al., 2000) and custom designed primer pairs (Table 2.2).   2.1.2.1 Construction of NAP2-Δ258 Cx43-EGFP         Additional deletion mutants of the Cx43 CT were made to determine the regions of the Cx43 CT important for BCR-mediated cell spreading (Table 2.1). The Δ258 Cx43-EGFP (in the NAP2 expression vector) was used to determine if the region between aa246 (used in the studies by Machtaler et al., 2011) and aa258, including tyrosine 247, is sufficient to support B cell spreading. Δ258 Cx43-EGFP as well as Δ307 Cx43-EGFP (Section 2.1.2.2) were made by insertion of restriction enzyme (RE) cut sites at the proper locations in the WT Cx43-EGFP cDNA (in the NAP2 plasmid), followed by RE digestion and re-ligation of the plasmid. A BglII RE 63  cut site was inserted right before the EGFP start codon by using the Quick Lightning Site-Directed Mutagenesis kit and custom primer pairs (Table 2.2) (Fig 2.1A). The inserted BglII site (6 base pairs) eventually replaced 18 base pairs of the linker sequence between WT Cx43 and EGFP (Figure 2.1A). The only existing BglII site in the NAP2 expression vector was previously changed to an Xbal site (by May Dang-Lawson, using site-directed mutagenesis and custom primer pairs); therefore, BglII digestion will only occur at the desired locations. The insertion of a BglII site right before EGFP (Cx43-BglII-EGFP in NAP2) was confirmed by sequencing by the NAPS Unit, UBC (www.msl.ubc.ca/services/naps), and the new construct was used as a template for further insertion of RE sites.  A BglII site was inserted after aa 258 (258-BglII/BglII-EGFP) shown in Fig 2.1B and in a separate reaction after aa 307 (307-BglII/BglII-EGFP) using site-directed mutagenesis and custom primer pairs (Table 2.2). The insertion of the RE sites was confirmed by sequencing. The newly constructed 258-BglII/BglII-EGFP was digested by BglII RE (New England BioLabs (NEB)-Hitchin, UK) and re-ligated using T4 DNA Ligase (Invitrogen, Carlsbad, CA, USA). Consequently Δ258 Cx43-EGFP was made and the deletion of the sequences was confirmed by sequencing (Appendix A1). In the newly made Δ258 Cx43-EGFP a BglII  site (AGATCT) appears after aa 258 and before the EGFP start codon (Fig 2.1B). This BglII site replaces the previously existing 18 base pairs at the end of WT Cx43 and serves as a linker between Cx43 and EGFP (Fig 2.1B).  These 6 base pairs allows for the expression of an in-frame EGFP tag at the carboxyl terminal end of the CT truncated Cx43.  64   2.1.2.2 Construction of NAP2-Δ307 Cx43-EGFP                               Construction of Δ307 Cx43-EGFP in the NAP2 (Table 2.1) expression vector was performed in a manner similar to the construction of Δ258 Cx43-EGFP as explained above.  Different custom primer pairs (Table 2.2) were used to insert a BglII site after aa 307 using the Cx43-BglII-EGFP in NAP2 as the template. Again a BglII site (AGATCT) appears after aa307 and before the EGFP start codon, which allows for the expression of an in-frame EGFP tag at the carboxyl terminal end of the CT truncated Cx43 (similar to Δ258 Cx43-EGFP shown in Fig 2.1). The deletion of the sequence was confirmed by sequencing (Appendix A2).   2.1.2.3 Construction of NAP2-Y247F Cx43-EGFP              Two tyrosine (Y) residues in the CT of Cx43, Y247 and Y265, are putative Src-binding sites (Swenson et al., 1990; Kanemitsu et al., 1997; Lin et al., 2001; Lin et al., 2006; Solan and Lampe, 2008) and Y265 has been shown to be important for supporting BCR-mediated B cell spreading (Falk et al., 2014). Y247 was replaced with phenylalanine (Y247F) in WT Cx43-EGFP in the NAP2 plasmid (Table 2.1) 65  using site-directed mutagenesis and custom primer pairs (Table 2.2). The mutation was confirmed by sequencing (Appendix A3).  2.1.2.4 Construction of NAP2-Y247F/Y265F Cx43-EGFP        Cx43 mutated at both tyrosine Y247 and Y265 (Y247F/Y265F) (Table 2.1) was made by replacing Y247 with phenylalanine using the Y265F Cx43-EGFP in the NAP2 plasmid.  This was done using site-directed mutagenesis and custom primer pairs made for the construction of Y247F Cx43-EGFP (Table 2.2). The mutation was confirmed by sequencing (Appendix A4).    Additional expression vectors created in the Matsuuchi Lab that were 2.1.3used in this study-(NAP2-Y267F) Cx43-EGFP               Tyrosine 265 of Cx43 (Table 2.1) was replaced with phenylalanine in WT Cx43-EGFP in the NAP2 plasmid using site-directed mutagenesis and custom primer pairs by Letitia Falk (Falk et al., 2014).               Tyrosine 267 of Cx43 (Table 2.1) was replaced with phenylalanine in the WT Cx43-EGFP in the NAP2 plasmid using site-directed mutagenesis and the custom primer pairs shown below: 66  (Y267F-Fr 5’GATCTCCAAAATACGCCTTCTTCAATGGCTGCTCCTCACC3’ and Y267F-Rv 5’GGTGAGGAGCAGCCATTGAAGAAGGCGTATTTTGGAGATC3’) This was done by May Dang-Lawson.  Both of these expression vectors were used in this thesis.    67         Construct Name  Schematic Representative         of Mutated Cx43              Description   WT Cx43-EGFP (in NAP2)  WT Cx43-EGFP (380 aa- the last 2 aa were replaced by aa- encoding the linker, see Fig 2.1) Received from the Naus Lab (Mao et al., 2000)   Δ246 Cx43-EGFP  (in NAP2)  Δ246Cx43-EGFP Received from the Naus Lab (originally form Laird Lab-Langlois et al., 2008) Used in previous Matsuuchi Lab studies (Machtaler et al., 2011) This was used as a control in the studies in this thesis   Δ258 Cx43-EGFP  (in NAP2)  Δ258Cx43-EGFP Was made for this study by Farnaz Pournia The CT of Cx43 was truncated after aa258 and fused to EGFP    Δ307 Cx43-EGFP (in NAP2)  Δ307Cx43-EGFP Was made for this study by Farnaz Pournia The CT of Cx43 was truncated after aa307 and fused to EGFP Table 2.1  Summary of the deletion and point mutations in the Cx43 CT used in this study.  Mutations noted in red font in the description column are the new mutations that were made and used in this study. Mutations noted in black font were previously made in the Matsuuchi Lab and used as controls in this study. 68         Construct Name  Schematic Representative         of Mutated Cx43              Description   Y247F Cx43-EGFP  (in NAP2)  Y247F Cx43-EGFP Was made for this study by Farnaz Pournia Tyrosine (Y) 247 was replaced by phenylalanine (F)    Y265F Cx43-EGFP  (in NAP2)  Y265F Cx43-EGFP Was made by Letitia Falk (Falk et a., 2014) Tyrosine (Y) 265 is replaced by phenylalanine (F) This was used as a control in the studies in this thesis   Y247F/Y265F Cx43-EGFP (in NAP2)  Y247F/Y265F Cx43-EGFP Was made for this study by Farnaz Pournia Tyrosine (Y) 247 and 265 were replaced by phenylalanine (F)    Y267F Cx43-EGFP  (in NAP2)  Y267F Cx43-EGFP Was made for this study by May Dang-Lawson Tyrosine (Y) 267 was replaced by phenylalanine (F)   69           A B Figure 2.1  Expression of an in-frame EGFP fused at the CT of Δ258 Cx43-EGFP. A) Shows the aa sequence at the end of WT Cx43, WTCx43-EGFP in the NAP2 expression vector and insertion of BglII RE site before the start of EGFP. WT Cx43 (first line) ends in aa 381: L, aa382: E (single amino acid code). Second line shows the aa sequence of Cx43-EGFP in NAP2 expression vector. The last two aa L and E were changed to D and P. This is followed by 4 aa: P, V, A, T which together act as a linker sequence between Cx43 and EGFP. Third line shows the insertion of a BglII RE  site before the start of EGFP by exchanging the two aa A and T before the start M of EGFP to R and S. The box shows the types of aas mentioned in this Figure. B) A zoomed in view of the NAP2 expression vector encompassing Cx43 cDNA that two BglII RE sites have been inserted after aa 258 and before the start of EGFP. Dashed boxes show where the BglII enzyme digests the DNA. Upon RE digestion and ligation using T4 DNA ligase enzyme, two aas, arginine (R) and serine (S) remain between the Cx43 aa258 and the start of EGFP. The 6 base pairs coding for R and S allow for expression of in-frame EGFP fused at the CT of Δ258 Cx43 (Δ258 Cx43-EGFP). A similar approach was taken to make the Δ307 Cx43-EGFP in the NAP2 expression vector. The truncated constructs were compared to Cx43-EGFP shown in the box. 70    Resulting Mutation         Primer Names                Primer Sequence                    (5’-3’)  Description         WT Cx43  Cx43 Fr1 GTCAGCTTGGGGTGATGAAC Binds coding strand of Cx43-used for sequencing Cx43 Fr2 GAGATCCCTGCCCCCACCAGG Cx43 Rv CCTCGAAGACAGACTTGAAG         BglII-EGFP BglII-egfp Fr CTGGATCCACCGGTCAGATCTATGGTGAGCAAGGGC Binds to WT Cx43-EGFP template and replaces the 6 bp before EGFP with a BglII site BglII-egfp Rv GCCCTTGCTCACCATAGATCTGACCGGTGGATCCAG  258-BglII/BglII-EGFP 258- BglII Fr CCACTGAGCCCATCAAAAAGATCTGGATCTCCAAAATACGCC Binds to WT Cx43-BglII-EGFP template and replaces the 6 bp after aa 258 with a    BglII site 258-BglII Rv GGCGTATTTTGGAGATCCAGATCTTTTTGATGGGCTCAGTGG  307-BglII/BglII-EGFP 307- BglII Fr AACAAGCAAGCTAGCGAGAGATCTTGGGCGAACTACAGCGCA Binds to WT Cx43- BglII -EGFP template and replaces the 6 bp after aa 307 with a BglII site 307- BglII Rv TGCGCTGTAGTTCGCCCAAGATCTCTCGCTAGCTTGCTTGTT             Y247F Y247F Fr CGCGTGAAGGGAAGAAGCGATCCTTTCCACGCCACCACTGGCCC Binds to WT Cx43-EGFP template and replaces tyrosine 247 with a phenylalanine Y24F Rv GGGCCAGTGGTGGCGTGGAAAGGATCGCTTCTTCCCTTCACGCG          Y247/Y265F Y24F Fr CGCGTGAAGGGAAGAAGCGATCCTTTCCACGCCACCACTGGCCC Binds to Y265F Cx43-EGFP template and replaces tyrosine 247 with a phenylalanine Y24F Rv GGGCCAGTGGTGGCGTGGAAAGGATCGCTTCTTCCCTTCACGCG  Table 2.2  Custom ordered primer sets for site-directed mutagenesis.  Primers were ordered through Integrated DNA Technologies (IDT) (Coralville, Iowa, USA) 71   Antibodies and Cell Trackers 2.1.4    The polyclonal goat α-mouse IgM (μ heavy chain specific, #115-005-020) antibody (Ab) used for cell stimulation, immunoblotting (Table 2.3), immunofluorescence staining (Table 2.5), and for coating glass coverslips for the cell spreading assay (Section 2.6) was purchased from Jackson ImmunoResearch Laboratories (JIR) (West Grove, PA, USA).                 The polyclonal rabbit anti-mouse Igα extracellular domain Ab and the polyclonal rabbit anti-mouse Igβ extracellular domain Ab (Table 2.3) were gifts from Dr. Richard Meagher and Elizabeth McKinney- Abeome (University of Georgia, Athens, GA, USA) (Dylke et al. 2007).                The pan monoclonal anti-phosphotyrosine antibody (PY20) from BioLegend (Table2.3a) was tested to determine its ability to detect phosphotyrosines in B cells upon BCR stimulation. This was done since the past efforts in the lab (Letitia Falk, MSc thesis, 2013) failed to show BCR-induced tyrosine phosphorylation of endogenously-expressed or transfected Cx43 in B cells using the lab’s anti-phosphotyrosine antibodies, 4G10. The monoclonal anti-phosphotyrosine antibody 4G10 (prepared in the lab by May Dang-Lawson, (Gold et al., 1990; Richards et al., 1996) and also monoclonal rabbit α-mouse antibody specific for Cx43 phosphorylated on Y265 (gift from Dr. Paul Lampe, Fred Hutchinson Cancer 72  Research Centre, Seattle, WA, USA; Solan and Lampe, 2008) were used in the previous studies. Testing PY20 on BCR-stimulated B cells was done in hopes of finding other anti-phosphotyrosine antibodies that might detect phosphorylated resides on Cx43 in stimulated B cells. The PY20 antibody along with other available pan-anti-phosphotyrosine antibodies such as monoclonal antibody PY100 (Cell Signaling Technology, Santa Cruz, CA, USA, #9441) and monoclonal antibody PSR-45 (Abcam, Cambridge, MA, USA, #ab6639) have been purchased and are being tested for use in future studies that aim to identify tyrosine phosphorylation of Cx43 upon BCR stimulation in B cells.                In collaboration with Dr. Paul Lampe (Fred Hutchinson Cancer Research Centre, Seattle, WA, USA) phosphorylation of specific tyrosine residues (Y247 and Y265) of Cx43 after BCR stimulation was tested using the panel of Lampe lab monoclonal antibodies (Solan and Lampe, 2008). Frozen lysates (Section 2.4.1) from unstimulated and BCR-stimulated (Section 2.3.3) Cx43-transfected J558μm3 and WEHI231 B cells were couriered to the Lampe Lab.   These lysates were analyzed by SDS-PAGE followed by immunoblotting (Section 2.4.4), and tested for phosphorylation of Cx43 on tyrosine 247 and tyrosine 265. The phosphospecific antibodies (rabbit α-Cx43 PY247 and rabbit α-Cx43 PY265) used in the Lampe lab were made by ordering through ProSci Inc., Poway, CA, commercial antibody preparations against synthetic peptides (Solan and Lampe, 2008), and these antibodies have been used in the field to show modification of Cx43 in a variety of cell types (Norris et al., 2008; Marquea-Rosado et al., 2012; Li et al., 2014). 73        A complete list of antibodies used for western blotting is shown in Tables 2.3 and 2.4.  Table 2.3 - List of Primary Antibodies used for Western blotting Abeome (Athens, GA, USA). BioLegend (San Diego, CA, USA) FH: Fred Hutchinson Cancer Research Centre (Seattle, WA, USA). FS: Fisher Scientific (Fair Lawn, NJ, USA). JIR: Jackson ImmunoResearch Labs (West Grove, PA, USA). Sigma-Aldrich (Saint Louis, MO, USA). Southern Biotech (Birmingham, AL, USA). SS: SynapticSystem (Goettingrn, Germany).  CT: Carboxyl terminus. NT: Amino terminus. GFP: Green Fluorescent Protein PY: phosphotyrosine.   Antibody Recognizes   Dilution Used                    Host      (Formulation)        Company     Catalog # Mouse IgM  (μ chain specific)       1:3000 Polyclonal goat      JIR 115-005-020 Human IgM (Fc5μ specific)       1:3000    Polyclonal goat       JIR 100-005-043 Mouse IgG (Fcϒ specific)       1:3000 Polyclonal goat       JIR 115-005-008 Mouse Igα (CD79a/mb1-extracellular domain)       1:1000 Polyclonal rabbit    Abeome N/A Mouse Igβ (CD79b/b29-extracellular domain)       1:1000 Polyclonal rabbit   Abeome N/A Mouse λ light chain       1:3000 Polyclonal goat Southern Biotech 1060-01 Mouse κ light chain       1:3000 Polyclonal goat Southern Biotech 1050-01 Mouse Cx43 (CT: aa363-382)       1:1000 Polyclonal rabbit Sigma-Aldrich C6219 Mouse Cx43 (NT: aa1-20)       1:250 Monoclonal mouse FH Cx43NT1 PY20       1:3333 Monoclonal mouse  BioLegend    309301 GFP       1:1000 Polyclonal rabbit SS 132002 Mouse Actin       1:3000 Monoclonal mouse FS 691001 74    Bio-Rad (Hercules, CA, USA and Mississauga, ON, Canada)              Secondary antibodies conjugated to the enzyme horseradish peroxidase (HRP) for use in chemiluminescence detection were purchased from Bio-Rad (Mississauga, ON, Canada). Polyclonal rabbit α-goat IgG (H+L)–HRP (#172-1034), polyclonal goat α-rabbit IgG (H+L)–HRP (#170-6515) and goat α-mouse IgG (H+L)–HRP (#170-6516) from Bio-Rad were used in the studies (Table 2.4)               Fluorophore-conjugated antibodies used for flow-cytometry analysis and fluorescence-activated cell sorting (FACS) were purchased from eBiosciences (San Diego, CA, USA). Monoclonal phycoerythin (PE) conjugated rat α-mouse IgM (#12-5790-81) was used for flow-cytometry analysis and FACS sorting (section 2.5). Monoclonal PE conjugated rat α–mouse CD19 (# 12-0193-81) was used for flow-cytometry analysis (section 2.5).     Antibody Recognizes  Conjugation to     Dilution    Used                  Host      Company    Catalog # Goat IgG           (H+L)     HRP   1: 3000 Rabbit Bio-Rad 172-1034 Rabbit IgG           (H+L)     HRP   1:3000 Goat Bio-Rad 170-6515 Mouse IgG           (H+L)     HRP   1:3000 Goat Bio-Rad 170-6516 Table 2.4  List of Secondary Antibodies used for Western blotting 75             Complete list of antibodies, primary and secondary, used for staining fixed samples (Section 2.7.1) are listed in Table 2.6. Secondary antibodies are conjugated to different fluorophores as mentioned in the table.    Antibody Recognizes  Dilution Used         Host  (Formulation)      Company     Catalog # Primary Antibodies Mouse IgM  (μ chain specific)     1:100 Polyclonal  goat      JIR  115-005-020 Early Endosome (EEA1)     1:200 Monoclonal rabbit Cell Signaling  3288 Secondary Antibodies Goat IgG (H+L) 1:100 Rabbit (Alexa Flour 647) Life Technologies (Molecular Probes)  A-21446 Rabbit IgG (H+L) 1:100 Goat (Alexa Flour 647) Life Technologies (Molecular Probes)  A-21245  Cell Signaling Technology (Santa Cruz, CA, USA). JIR: Jackson ImmunoReseacrh Labs (West Grove, PA, USA). Molecular Probes-Life Technologies (Carlsbad, CA, USA).    Laser at 633 nm was used to visualize Alexa Flour 647 (Section 2.7.2).     Table 2.5 List of Antibodies used for Immunofluorescence Staining 76              Intracellular organelle trackers were used for live cell staining (Section 2.7.1). Endoplasmic reticulum (ER) Tracker (#E34250) and Lysosome Tracker  (#L-7528) were purchased from Molecular Probes-Life Technologies (Carlsbad, CA, USA). For more details about the trackers used see Table 2.6.    Intracellular  Organelle Detected     Full Name of the Tracker          Specificity  Fluorescent Dye  ER ER-Tracker TM Red  (BODIPY ® RT Glibenclamide)  Sulphonylurea receptors of ATP-sensitive K+ channels-prominent on ER BODIPY ® RT Lysosome Lyso-Tracker ® Red DND-99 Acidic organelles  DND-99   Laser at 543 nm was used to visualize the red fluorophore in the trackers (Section 2.7.2).                        DAPI incorporated into ProLong ® Gold Antifade Mountant (#P-36931) from Molecular probes, Life Technologies was used to stain the nucleus. Laser at 405 nm was used to visualize DAPI (Section 2.7.2).              Rhodamine Phalloidin (#415) form Molecular probes, Life Technologies was used for the staining of F-actin. Laser at 543 nm was used to visualize F-actin (Section 2.7.2). Laser at 488 nm was used to visualize EGFP (Section 2.7.2). Table 2.6 List of Live-Cell Trackers used to Label Intracellular Organelles 77   Cell Lines 2.1.5    The B cell lines used in these studies include the J558μm3, WEHI231, A20 and 5TGM1 cell lines. The J558μm3 cell line is a mouse plasmacytoma expressing a transfected, 4-chain (membrane IgM (µ, ), Ig-α and Ig-β) BCR at the cell surface. These cells were received as a gift from Dr. Louis Justement (University of Alabama, Birmingham, AL, USA (Reth et al.,1987; Hombach et al.,1988; Justement et al.,1990)), as well as other versions being a standard cell line used by the Matsuuchi lab (Dylke et al., 2007; Machtaler et al., 2011).  WEHI231 cells are a mouse B cell lymphoma (immature) that was obtained from the American Type Culture Collection (ATCC) (#CRL-1702).  These cells express a membrane IgM (µ, ), Ig-α and Ig-β containing BCR on the cell surface (Christian et al., 2003; McLeod et al., 2004; Durand et al., 2006).  A20 cells are a mouse B cell lymphoma (mature, but not terminally differentiated) that was obtained from ATCC (#TIB-208). These cells normally express a membrane IgG (, ), Ig-α and Ig-β containing BCR on the cell surface (Christian et al., 2003; McLeod et al., 2004; Durand et al., 2006).  A20 h.IgM cells (expressing a human IgM containing BCR) were gift from D. Lanker (Institute Curie, Paris, France (Lanker et al. 2002)). A different mouse plasmacytoma, 5TGM1, (Dallas et al., 1999; Oyajobi et al., 2003) with no BCR expression was received from B. Oyajobi (University of Texas, San Antonio, TX, USA). The J558μm3 cells were previously transduced with Cx43-EGFP or EGFP-alone (Machtaler et al., 2011).  WEHI231 and A20 cells express Cx43 endogenously but can be transduced with 78  Cx43-EGFP to overexpress the protein (Machtaler et al., 2014).  All of these cells were characterized for their BCR and Cx43 protein expression profile (Section 2.1.5.2). A complete list of cell lines used in the studies and for protein profiling / characterization is shown in the Table 2.7.       Cell Line       Name             Cell Type   Developmental             Stage       Disease    Source WEHI231 B Lymphocyte Immature B cell lymphoma ATTC (#CRL-1702) A20 B Lymphocyte Mature Reticulum cell sarcoma ATTC (#TIB-208) A20.hIgM  B Lymphocyte Mature  D.Lanker J558μm3 B Lymphocyte Terminally differentiated, plasma cell Myeloma Dr. L. Justement 5TGM1 B Lymphocyte Terminally differentiated, plasma cell Myeloma B. Oyajobi              The BOSC23 retroviral cell line was a gift from Dr. Warren S. Pear (Massachusetts Institute of Technology, Cambridge, MA, USA (Pear et al., 1993)).              J558μm3 or WEHI231 cells were transduced with retrovirus containing WT or mutated Cx43-EGFP plasmid DNA (Table 2.1) or the AP2 plasmid, encoding EGFP, (Section 2.1.1) using the retroviral packing cell line, BOSC23 (Pear et al., 1993). A complete list of transduced cell lines used for these studies is shown in table 2.8.   Table 2.7  List of parental cell lines used in the studies 79   Cell Line  Expressing  Retroviral Vector  Promoter  Bacterial Drug Resistance   Eukaryotic Drug Resistance       J558μm3   EGFP      AP2       CMV        Amp R         Hygromicin Puromycin Neomycin (Reth et al., 1987, Hombach et al., 1988 and Justement et al. 1990)  Cx43-EGFP            NAP2 Y247F Cx43-EGFP Y265 Cx43-EGFP Y247F/Y265F Cx43-EGFP Y267F Cx43-EGFP Δ246 Cx43-EGFP Δ258 Cx43-EGFP Δ307 Cx43-EGFP     WEHI231 EGFP      AP2            - Cx43-EGFP         NAP2 Y247F Cx43-EGFP Y265 Cx43-EGFP Y247F/Y265F Cx43-EGFP Δ246 Cx43-EGFP                       The NAP2 expression vector does not contain a eukaryotic drug resistance gene. The drug resistance in J558μm3 cells is due to previous transfection of the BCR components (Reth et al.,1987; Hombach et al., 1988; Justement et al., 1990).  Table 2.8 List of transduced cell lines used in the studies 80  2.2 Molecular biology techniques    Bacterial transformation 2.2.1                                         Transformation of competent strains of Escherichia Coli (E.coli) was done using standard techniques, according to the manufacturer’s instructions. The competent DH5α E.coli (#18265017) from Invitrogen (Carlsbad, CA, USA) and ultra-competent XL10-GOLD E.coli (#200314) form Stratagene (Agilent Technologies, Santa Clara, CA, USA) were used at 45 μl per reaction. Briefly, 2 or 5 ng of appropriate DNA or 2 or 5 μl of Dpn-I treated DNA (Section 2.2.6) in doubled distilled water was added to DH5α or XL10-GOLD bacterial cells and incubated on ice for 30 min. This was followed by a heat shock at 42oC for 20 sec (DH5α cells) or 30 sec (XL10-GOLD cells). The reaction mixture was incubated on ice for 2 min prior to the addition of 900 μl of warm Luria Bertani (LB) broth (Bertani, 2004-10 g/L bacto-tryptone (#21175, BD Biosciences, Palo Alto, CA, USA), 5 g/L bacto-yeast extract (#212750, BD Biosciences) and 10 g/L NaCl (#BP358-212, Fisher Scientific, Fair Lawn, NJ, USA), at pH 7.0. Reactions were incubated at 37oC with shaking at 225 rpm (on a Lab Line Orbit Environ Shaker (Melrose Park, IL, USA)) for 1 h. Lastly, 200 μl of the mixture was plated on LB agar plates (LB media containing 20 g/L agar (#214010, BD Biosciences), with 100 μg/L ampicillin (Amp) (# A9518, Sigma-Aldrich) 81  for selection). Plates were incubated at 37oC overnight and colonies were isolated from the plates.    DNA preparation 2.2.2               Purifying small or large volume of plasmid DNA was done according to a standard lab protocol (Green and Sambrook, 2012).  Single bacterial colonies were used to inoculate 8 of LB broth containing 100 μg/ml Amp, and the resulting bacterial cultures were used to make bacterial glycerol stocks (with 10% glycerol in a total volume of bacterial culture, and stored at minus 80oC) and also to purify small volumes of plasmid DNA.                       Briefly, single bacterial colonies were added to 8 ml of LB broth containing 100 μg/ml Amp and were incubated at 37oC overnight (16-18 h) in 14 ml round bottom polypropylene tubes (#352059, BD Falcon, Franklin Lakes, NJ, USA) while shaking at 225 rpm (on the same shaker mentioned in Section 2.2.1). Nine hundred µl of the bacterial culture was mixed with100 μl glycerol (#BP229-1, Fisher Scientific) to make bacterial glycerol stocks. The remaining 7 ml of the bacterial culture was used to purify small volumes of plasmid DNA using the Qiagen Miniprep Kit (QIA prep Spin Mini Prep Kit, #2717,Qiagen, Venlo, Limburg, Netherlands) according to manufacturer’s instructions. Bacteria were pelleted from the overnight culture by centrifugation at 3,000 rpm for 5 min in a Sorvall RC5C (Mandel Scientific, Guelph, 82  ON, Canada) and then the bacteria were lysed. DNA was isolated by ethanol precipitation and collection by centrifugation. Isolated DNA was re-suspended in 30 μl of double distilled water. DNA concentration and purity was assessed by a Nanodrop 1000 spectrometer (Thermo Scientific, Waltham, MA, USA).              A portion of the bacterial glycerol stock (30 µl) was used to inoculate 200-300 ml of LB broth containing 100 μg/ml Amp and the bacterial culture was used to purify a larger volume of plasmid DNA. The inoculation was done using a 500 ml Erlenmeyer flask, with shaking of the culture over night, similar to what has been explained above. Plasmid DNA purification was done using Invitrogen PureLink HiPure Maxiprep kit (#K210017) according to manufacturer’s instructions. Purified DNA was re-suspended and assessed as described earlier in this section.    Restriction endonuclease digestion 2.2.3                Restriction enzymes (RE) from NEB were added to purified plasmid DNA according to the manufacturer’s instructions and incubated at 37oC in a polymerase chain reaction (PCR) machine (PTC-100 thermal cycle, MJ Research Inc., Waltham, MA, USA) for 1.5 h. The PCR machine was used for incubation to avoid any shaking or spilling the small reaction volume in a water bath. The resulting digested DNA was analyzed by agarose gel electrophoresis (Section 2.2.4) for identification of the size 83  of the DNA fragments.  For construction of NAP2-Δ258 Cx43-EGFP (Section 2.1.2.1) and NAP2-Δ307 Cx43-EGFP (Section 2.2.2.2) DNA bands corresponding to 7.5 kDa were excised out of the gels and the DNA was purified from the gel (Section 2.2.5) to be used for DNA ligation (Section 2.2.6).    Agarose gel electrophoresis 2.2.4              Whole plasmid DNA and restriction endonuclease digested DNA were separated on 1% agarose gels according to standard lab protocol (Sambrook and Russel, 2001). Ultra pure agarose (#15510-027, Invitrogen) was dissolved in Tris/Borate/EDTA (TBE) (1% Tris-buffered ethylene diamine tetraacetic acid (EDTA), 90  mM Tris-HCL (#BP152-5, Fisher Scientific) pH 8.2, 90 mM boric acid (#A73-500 Fisher Scientific), 2 mM EDTA (#BP120500, Fisher Scientific)) and 0.1% SYBERsafe (#533102, Molecular probes Life Technologies,) was added to stain the DNA. The gel mixture was poured into a Horizon 58 horizontal gel electrophoresis apparatus (Gibco, Life Technologies) and the molten agarose allowed to solidify. DNA samples were mixed with an appropriate volume of DNA sample buffer (0.04% bromophenol blue (#161-0404 BioRad), 0.04% xylene cyanol, and 10% sucrose) prior to loading into gel wells. The 2-Log DNA Ladder (#N3200L, NEB) (0.1-10 Kb) was used as molecular weight size standards.  Agarose gels (1%) containing prepared DNA samples were run at 100 V for 1 h and DNA bands were imaged using ultraviolet light 84  in an alpha imager EC MultiImage light cabinet and Alpha Imager software (Alpha Innoteach, San Leonardo, CA, USA).    Gel Extraction of DNA 2.2.5                               DNA bands were excised out of 1%agarose gels and the DNA was purified using a QIAquick Gel Txtraction kit (#28704,Qiagen) according to manufacturer’s instructions. Briefly, the gel containing the DNA was mixed with the reaction buffer (provided with kit) and melted at 50 oC. DNA was purified based on a bind-wash-elute protocol.     DNA ligation 2.2.6                   DNA ligation of digested DNA was done using T4 DNA ligase (#15224-017, Invitrogen) according to manufacturer’s instructions. Ligation was done at 14oC in a polymerase chain reaction (PCR) machine (PTC-100 thermal cycle, MJ Research Inc.) overnight (16-18 h).  The PCR machine was used for incubation to avoid any shaking or spilling the small reaction volume in a water bath.    85    Site-directed mutagenesis 2.2.7               Site-directed mutagenesis was performed using the QuickChange Lightening Site-directed mutagenesis kit (#210518, Stratagene) according to manufacturer’s instructions. Reactions were run on a PCR machine (Veriti 96 well Thermal Cycler, Applied Biosystems, Life Technologies) at 95oC for 2 min, then 95oC for 20 sec, 60oC for 10 sec and 68oC for 4 min for 18 cycles, This was followed by the last stage, 68oC for 5 min. Primers used for the PCR reaction, were custom ordered through IDT (Table 2.2). The PCR product was used to transform super-competent XL-GOLD cells (Site-directed mutagenesis kit, Stratagene) and cultured overnight. DNA was purified from the bacterial culture using Qiagen Miniprep Kit (QIA prep Spin Mini Prep Kit) (Section 2.2.2). The desired mutations were confirmed by sequencing the purified DNA by the NAPS Unit (UBC, Vancouver; http://www.msl.ubc.ca/services/naps).   86   2.3 Tissue Culture          Cell culture 2.3.1              Suspension cells (the cell lines mentioned in Section 2.1.5 except BOSC23 cells) were maintained in 10 cm polystyrene tissue culture dishes (#353003, BD Falcon) in 10 ml of Roswell Park Memorial Institute (RPMI)-160 medium (#21870-076, Gibco, Life Technologies) supplemented with 10% heat inactivated fetal bovine serum (HI-FBS) (#12483-020, Invitrogen), 2 mM L-glutamine, (#G-8540 Sigma-Aldrich), 1 mM sodium pyruvate (#P5280, Sigma-Aldrich), 50 units/ml penicillin-50 μg/ml streptomycin (#15140122, Invitrogen) and 50 μM β-mercaptoethanol (2-ME) (#M7154, Sigma-Aldrich). Cells were maintained in a direct heat incubator (ThermoForma, Waltham, MA, USA) at 37oC and 5% CO2 atmosphere. Cells were passaged every 2-3 days as needed to be kept at approximately 1-10 x 105 cell/ml. Suspension cells were passaged by centrifugation 1,500 rpm for 5 min or 700 rpm for 10 min in an IEC Centra-CL3R refrigerated centrifuge (Thermo Electron Corporation, Waltham, MA, USA) and re-suspension in fresh media.                   Adherent cells (BOSC23) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (#11960, Gibco, Life Technologies) supplemented as described before for RPMI with the exception of 2-ME. For passage of the adherent cells, after removal of the media by aspiration, cells were first washed with 2 ml of PBS 87  (#10010-023, Gibco) followed by 2 min incubation with 2 ml of trypsin (25200072, Gibco, Life Technologies) to detach the cells from the tissue culture dish. The rest of the procedure was performed similarly to that explained for suspension cells earlier.                 For long-term storage, 3 x 106 cells were frozen in liquid nitrogen in 1 ml of HI-Fetal Bovine Serum (FBS) with 10% dimethyl sulfoxide (DMSO) (#191418, MP Biomedical, Santa Ana, CA, USA).         DNA transfection and enrichment of the transfected cells 2.3.2              J558μm3 and WEHI231 cells were transduced with expression vectors encoding WT or mutated Cx43-EGFP or EGFP alone (Table 2.1), using the retroviral packing cell line, BOSC23. First, plasmid DNA was introduced into the BOSC23 cells by a calcium phosphate precipitation transfection procedure (Krebs et al. 1999), and the cells were incubated for up to 72 h to allow for the production of retroviruses. The viral supernatant (the tissue culture media) was collected after 24, 48 and 72 h of the initial transfection, filtered through 0.2 μm syringe filter (WVR, Randor, PA, USA) and the supernatant used to infect 0.5 x 106 cells of the appropriate lymphoid cell line (Table 2.8). After 2-3 days, transduced cells were sorted by FACS, selecting for EGFP positive cells and IgM positive (+) cells (Section 2.1.4 for antibodies used and Section 2.5 for the procedures). Cell populations were periodically re-sorted to maintain high levels of expression of the desired proteins.  88    Cell Stimulation 2.3.3              Stimulation of the cells by BCR cross-linking was done using goat α-mouse IgM (JIR) using standard lab protocols (Gold et al., 1990,Christian et al., 2003 and McLeod et al., 2004). Cells (5 x 106 per stimulation time point) were washed once with PBS (#10010-023, Gibco) and re-suspended in 0.5 ml of quinsaline (25 mM Sodium Hepes pH 7.4 (#H3375, Sigma-Aldrich), 125 mM NaCl, 5 mM KCl (#BP358-12 and #P217 respectively, Fisher Scientific), 1 mM CaCl2 (#C1016, Sigma-Aldrich), 1 mM Na2HPO4 ( #S374, Fisher Scientific), 0.5 mM MgSo4 (#M63, Fisher Scientific), 1 g/L glucose (#D16-500, Fisher Scientific), 2 ml  L-glutamine (#C8540, Sigma-Aldrich), 1 mM sodium pyruvate (#P280 Sigma-Aldrich), and 50 μM 2-ME (#M7154, Sigma-Aldrich)). Cells were stimulated with 20 μg/ ml goat α-mouse IgM (JIR) (Section 2.1.4) and incubated in a 37oC water-bath for the corresponding time. Reactions were stopped by addition of 0.5 ml of 1:100 sodium pervanadate (#13721-39-6, Sigma-Adrich) and cells were lysed (Section 2.5) for detection of changes upon BCR stimulation using various biochemical assays (Burnette, 1981; McLeod et al., 1998 and 2002; Corley, 2005; Dylke et al., 2007; Machtaler et al., 2011).   89  2.4 Biochemical Procedures   Cell lysis and preparation of samples 2.4.1              When probing for Cx43 was intended, cells were lysed (Machtaler et al., 2011 and 2014; Falk et al. 2014) in cold modified K buffer (Troxell et al., 1999), followed by sonication, and incubation of the lysates in 370C. Cells (5 x 106) were lysed in 300 μl of cold lysis buffer (1% Triton X-100 (#BP15, Fisher Scientific), 1% Igepal (#CA-630, Sigma-Aldrich), 50 mM CaCl2 (#C1016, Sigma- Aldrich), in PBS) (Troxell et al., 1999) containing protease inhibitors, 10 μg/ml leupeptin (#L2884, Sigma), 1 μg/ml aprotinin (#981532, Roche, Basel, Switzerland), 1 mM pepstatin (#P4265, Sigma-Aldrich), 1 mM sodium vanadate (#S6508, Sigma-Aldrich), and 1 mM phenylmethylsulfonyl fluride (PMSF) (#837091, Roche). Samples were sonicated for 10 sec with a Misonix XL sonicator ultrasonic cell processor (Misonix Incorporate, Farmingdale, NY, USA) followed by incubation on ice for 10 min. To remove cellular debris, cell lysates were centrifuged at 14,000 rpm for 10 min and pellets were discarded. A portion of the lysate (10 µl) was used to measure protein concentration using a bicinchoninic acid (BCA) assay kit (#23225, Pierce Biotechnologies, Rockford, IL, USA) according to manufacturer’s instructions. Lysates were diluted 1:5 with 5X reducing sample buffer (62.5 mM Tris-HCl pH 6.8, 4% glycerol (#BP229-1, Fisher Scientific), 2.5% sodiumdodecylsulfate (SDS) #161-0301, Bio Rad), 0.02% bromophenol blue (#B0126, Sigma-Aldrich), 100 mM diothiothreitol (#D0632, Sigma-Aldrich)) and incubated in a 37oC water bath for 1 h. Incubation of samples with 90  reducing sample buffer, denatures the proteins and coats them with a net negative charge. Samples were then analyzed by SDS- polyacrylamide gel electrophoresis (SDS-PAGE) (Section 2.4.2).                When probing for the BCR or generally for proteins other then Cx43, cells were lysed in a standard cold RIPA lysis buffer and the lysates incubated in a boiling water bath for 5 min (Freeman et al., 2011). Cells (5 x 106) were lysed in 300 μl of cold radioimmunoprecipitation assay (RIPA) lysis buffer (30 mM Tris-HCL pH 7.4, 150 mM NaCl, 1% IGEPAL, 0.5% sodium deoxycholate (#D6750, Sigma-Aldrich), 0.1% SDS, 2 mM EDTA) supplemented with protease inhibitors as described before. Centrifugation was used to remove particulates, BCA protein determination assays, and dilution of the lysates with SDS-PAGE reducing sample buffer was done in the same way as described earlier in this section. Lysates were then incubated in a boiling water bath for 5 min and used immediately for loading onto SDS-PAGE gels (Section 2.2.4).  In some cases lysates were stored at -20 oC for later use.    91    SDS-PAGE and western blotting  2.4.2                   Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)  and Western blotting were done according to standard procedures (Burnette, 1981, and Corley, 2005). Lysates, prepared as described in section 2.4.1, were loaded into 1.5 mm, 10% polyacrylamide (#161-0144 Bio Rad) mini gel and the proteins were separated at 200 V for 1 h. If lysates were frozen at -20oC, they were re-boiled for 5 min or re-incubated at 37oC water bath for 1 h (according to the initial procedure, Section 2.4.1) prior to loading on the gel.  Portions of the samples (30 μg protein, according to BCA assay results, Section 2.4.1) were loaded into each lane of 10% polyacrylamide gel that was prepared according to standard lab procedures (Dylke et al., 2007). Precision Plus Protein Kaleidoscope standard (#161-0375, Bio Rad) or Blue Eye pre-stained Protein Ladder (#PM007-0500, Toronto, ON, Canada) was always loaded beside the samples and was used to estimate the molecular weight of the proteins. Gels were run in a dual vertical mini gel apparatus with water-cooling system (CBS Scientific, Del Mar, CA, USA) in running buffer (50 mM Tris, 0.4% glycine (#BP381-1, Fisher Scientific), 0.1% SDS), first at 160 V for the stacking gel and then at 200 V for separating gel for the total of 1 h.               Separated proteins were transferred from the polyacrylamide gel onto nitrocellulose membranes (#162-0115, Bio Rad) using a Bio Rad Mini TransBlot ® 92  transfer apparatus filled with transfer buffer (20 mM Tris-HCl, 150 mM glycine, 20% methanol (#A412-4, Fisher Scientific)) at a constant voltage of 100 V for 1 h or at 15 V over night. Successful transfer of protein was confirmed by the presence of the Protein Ladder on the membrane and soaking the filter in a 0.1 % PonceauS (#P7170, Sigma-Aldrich) solution that will also stain the other proteins on the filter.              After transferring the proteins, the nitrocellulose membranes were blocked, washed, incubated with primary and secondary antibodies (Table 2.3 and Table 2.4), washed again, and treated with Amersham enhanced chemiluminescence (ECL) reagent, exposed to autoradiography films, and the films were developed using a Kodak X-OMAT 1000A (MedTec Marketing Group, Burnaby, B.C) film processor.  Specifically, the membranes were blocked in Tris buffer saline (TBS) (2.5 g/LTris, 8.8 g/L NaCl, pH 8.0) containing 5% skim milk powder (Safeway Canada, Calgary, AB, Canada) at room temperature on a Lab Line Orbit Shaker (Lab Line Instruments Inc, Melrose Park, IL, USA) for 30 min. When probing with phospho-antibodies such as PY20 (BioLegend) was intended, blocking was done using 5% bovine serum albumin (BSA) (# Bp1600-100, Fisher Scientific) in TBS.  Membranes were then incubated at 4oC with TBS containing 5% milk (or BSA for anti-phospho-antibodies) and primary antibody (Table 2.3) on the shaker overnight. On the day after, the excess antibody was removed by 3 successive 10 min washes with TBS containing 0.1% Tween 20 (#BP337, Fisher Scientific)(TBST). Membranes were then incubated with TBS containing 5% milk or BSA and HRP-conjugated secondary antibody (Table 2.4) at room temperature for 1 h while shaking. Excess antibody was removed by 3 93  successive 10 min washes with TBST. Nitrocellulose membranes were then incubated with 1 ml of the ECL Western Blotting Detection Reagent (#RPN2106VV1/2, GE Health Care) for 1 min. In a dark room, ECL treated membranes, were exposed to Classic Blue Autoradiography Film BX (#EBA45Mandel Scientific) for different amounts of time (usually between 10 sec-2 min) and the films were developed with a Kodak X-OMAT 1000A processor.              If re-probing was needed, membranes were first stripped by three 20 min washes, with TBS with pH 1.67-1.83 while shaking and then re-probed according to the protocol described above.     Protein expression profile of the parental cell lines 2.4.3      J558μm3 cells, J558μm3 cells transfected with Cx43-EGFP or EGFP, WEHI231, A20, A20 h.IgM and 5TGM1 mouse cell lines were used for profiling protein expression with respect to Cx43, EGFP and the BCR. Cells were lysed and prepared (Section 2.4.1) for Western blotting (Section 2.4.2).  Blots were probed using primary (Table 2.3) and secondary antibodies (Table 2.4) to detect protein expression in each of the cell lines (Section 3.1). When required, blots were stripped by washing 3 times, 20 min each, with TBS, pH 1.67-1.83. Blots were then re-probed with different primary and secondary antibodies (Table 2.3 and Table 2.4). 94  2.5 Flow Cytometry          Sample preparation and staining  2.5.1                            Sample preparation and staining for flow cytometry analysis was done according to the fluorophore-conjugated antibodies’ manufacturer’s instruction (www.bdbiosciences.com/ca/flowcytometry) with some modifications.  To assess the cell surface expression of various proteins, cells were stained with specific antibodies by suspension in PBS containing 2% FBS (2% FACS buffer) and incubation on ice with 2 μg/ml of fluorophore-conjugated Ab for 30 min. Cells (1 x 106) of each cell type were first washed once with PBS by centrifugation at 1500 rpm for 5 min. Then the cells were re-suspended in 50 μl of 2% FACS buffer in a 96-well round bottom plate (#353971, BD Biosciences) and incubated with 2 μg/ml of the appropriate Ab (Section 2.1.4, PE-conjugated α-mouse IgM or PE-conjugated α-CD19) on ice for 30 min. An additional 100 μl of 2% FACS buffer was added after the staining period to make a final 150 μl and cells were washed by centrifugation of the plate at 1500 rpm for 5 min at 2oC in an Allegra X-14R Centrifuge (Beckman Coulter Inc., Brea, CA, USA). This was repeated two more times in 150 μl of the FACS buffer and at the end cells were re-suspended in 500 μl of 5% FACS buffer in polystyrene or polypropylene FACS tubes (#352054 and #352063 respectively, BD Falcon). Cells were transported on ice and protected from light to UBC Flow Cytometry Facility (www.ubcflow.ca).  95                 For FACS sorting of the transduced cells, 1 x 10 6 J558μm3 cells were stained with PE-conjugated anti-mouse IgM (eBioscience) as described above and re-suspended in 5% FACS buffer. Transduced WEHI231 cells were re-suspended in 500 μl of the FACS buffer and transported to UBC Flow Cytometry Facility (www.ubcflow.ca).              Sorting was done by UBC Flow Cytometry Facility. BD FACSAria IIu and BD Influx instruments (BD Biosciences) were used. Transduced J558μm3 cells were sorted for EGFP+ and PE+ population for Cx43 and IgM expression respectively. Transduced WEHI231 cells were sorted for EGFP+ population for Cx43 expression. Cells were re-sorted periodically to prevent loss of either Cx43-EGFP or IgM expression.    96    Data collection and analysis 2.5.2               Samples were processed using a BD LSRII Flow Cytometer (BD Biosciences) by appropriate lasers according to the fluorophore conjugated to the Ab and using a BD FACS Diva software (BD Biosciences). Gating was used to exclude debris and dead cells based on forward scatter/ side scatter (FSC/SSC) plot generated by FlowJo Flow cytometry Analysis software (Tree Star Inc., Ashland, OR, USA). Mean fluorescence intensity (MFI) was determined using FlowJo.   2.6 B Cell Antigen Receptor-mediated cell spreading                 Cell spreading assays were done using a fixed time course as described (Lin et al., 2008; Santos Argumedo et al., 1997) and diagrammed in Fig 2.2. . In preparation for the spreading assay, appropriate numbers of 12 mm glass coverslips (#353047, BC Falcon) were sterilized with 100% methanol and placed in a 24-well polystyrene tissue culture plate until they were air-dried completely. In order to coat the coverslips with antibody, they were covered with 500 μl of PBS containing 40 μg/ml of goat α-mouse IgM (JIR) and placed on a shaker at 4oC overnight. 97            On the day of experiment, coverslips in 24 well dishes were first washed 3 times with PBS then covered with 300 μl of warm complete RPMI-160 medium (Section 2.3.1).  J558μm3 cells (3 x 106 cells) and WEHI231 cells (1 X105 cells), in complete RPMI-160, were then added to the wells containing coverslips at the right time point, incubated in an 37oC incubator with 5% CO2, and allowed to settle onto the coverslip.  Cells were fixed with 500 μl of 4% paraformaldehyde (PFA) (#15710, Electron Microscopy Science, Hartfield, PA, USA) in PBS for 15 min, washed once with PBS and then permeablized with 0.5% Triton X-100 in PBS for 10 min. Cells were washed once with PBS and then incubated with 300 μl of 1:40 rhodamine-phalloidin (Molecular Probes) (Section 2.1.4) in PBS covered from light for 30 min to stain F-actin. At the end coverslips were washed 3 times with PBS to remove any excess solutions and mounted onto 3 x 1” glass microscope slides (# 12-550-123, Fisher Scientific) using ProLong Gold anti-fade reagent supplemented with DAPI (#P36935, Molecular Probes, Life Technologies). Coverslips were immobilized by nail polish, samples dried overnight, and imaged on the same day or stored in -20oC for later analysis.                The contact areas between the spreading cells and coverslips were imaged using Olympus Fluoview1000 confocal microscope viewed using 100X objective (LSI Imaging; http://lsi.ubc.ca/resources/facilities/imaging). The contact areas were quantified using Image Pro Plus 6.2 analysis software (Media Cybernetics, Rockville, MD, USA) and stated as μm2. 98     Figure 2.2  Schematic diagram and an image representative of the B cell spreading assay. Top row: schematic of B cell spreading assay. Coverslips were coated with anti-BCR and cells were incubated on the coverslips for different time points (shown here: 0 and 30 min). The 0 min time point is representative of <3 min between placing the cells on coverslips and fixing. Engagement of the BCR on the cells triggers BCR signaling which results in B cell spreading. Bottom row: image representative of the contact area at 0 and 30 min, imaged with a confocal microscope using 100X objective (LSI Imaging; http://lsi.ubc.ca/resources/facilities/imaging/). The contact area between the spreading cells and the coverslip was measured via actin staining (marked by rhodamin-palloidin). The schematic diagram shown on top row of the Fig was adapted from Letitia Falk MSc thesis (2013, UBC, Vancouver).  Size bar = 10 µm.  99   2.7  Immunofluorescence Procedures and Confocal microscopy   Sample preparation and staining 2.7.1         2.7.1.1 Staining fixed cell samples                                       Immunofluorescence procedures were done as previously described in Falk et al., 2014 and Machtaler et al., 2011 and 2014. Glass coverslips (12 mm) were sterilized with 100% methanol and coated by placing 500 μl of 1:10 Poly-L-Lysine (#P4707, Sigma-Aldrich) and incubated on a shaker at room temperature for 30 min. Coated coverslips were washed 3 times with PBS and then 3 x 105 cells in complete RMPI-160 medium were added and allowed to settle and adhere for 5 min in an 37oC incubator with 5% CO2.  Cells were fixed with 500 μl of 4% PFA in PBS for 15 min. Excess PFA was removed by washing once with PBS. If needed cells were permeabilized with 500 μl of 0.5% Triton X-100 in PBS for 10 min. For staining the surface BCR, cells were not permeablized with detergents, and the samples proceeded directly to the blocking step. For staining all other intracellular organelles cells were permeablized with detergent (0.5% Triton X-100), washed once with PBS and then proceeded to the blocking step.  Cells were blocked with 500 μl of 3% bovine serum albumin (BSA) (BP#1699-100, Fisher Scientific) in PBS for 30 min.  Next, cells were incubated in 300 μl of 1:100 (or diluted according to the recommendations of the primary Ab’s manufacturer’s suggestions) (Table 2.5) in 100  blocking solution (3% BSA in PBS) for 30 min. Excess primary antibody was removed by washing 3 times with PBS.   Cells were then incubated in 300 μl of 1:100 (or diluted according to the recommendations of the secondary Ab’s manufacturer) (Table 2.5), in blocking solution, for 30 min. At the end, cells were washed 3 times with PBS and mounted onto 3 x 1” glass microscope slides as described in Section 2.6. Samples were imaged on the same day or stored in -20oC for later analysis.   2.7.1.2 Labelling of live cells to detect intracellular organelles                   In order to label live cells to detect intracellular organelles (described in Falk et al., 2014), cells (5 X105) were centrifuged and re-suspended in 500 μl of PBS containing 1 μl of the appropriate live cell tracker (Table 2.6), in a 24- well plate polystyrene tissue culture plate, and incubated for 30 min in a 37oC incubator with 5% CO2. Next the labelling solution was removed by centrifugation and aspiration, and the cells were re-suspended in PBS and incubated for 5 min to remove the excess tracker. Finally, cells were re-suspended and incubated in 500 μl warm, complete RPMI-160 media for 5 min before adding the cells to 24 well plates containing poly-L-Lysine coated glass cover slips (Section 2.7.1.1). Cells and coverslips were incubated in a 37oC incubator with 5% CO2 to for 5 min to allow for them to settle onto the coverslip and to adhere. Cells were fixed onto the coverslips, 101  which were then mounted onto glass slices and stored as described above (Section 2.7.1.1).   Image acquisition and analysis 2.7.2               Images were acquired using the 100X objective on the Oympus FV1000 confocal microscope (http://facilities.lsi.ubc.ca/olympus-fluoview-fv1000-laser-scanning-confocal-microscope-lsi3-fv1000-inverted/).  The contact area was quantified using Image Pro 6.2 analysis software (Media Cybernetics, Rockville, MD, USA) and the mean contact area for each cell type was calculated and presented as μm2 using GraphPad Prism 6 software (GraphPad, La Jolla, CA, USA). Both the microscope and the imaging software were part of Life Sciences Institute Imaging Facility (http://lsi.ubc.ca/resources/facilities/imaging). Size bars were drawn using the Image Pro 6.2 analysis software.    102   2.8 Statistics             To analyze significance, a Tukey’s test was used to compare the means to either a positive or negative control using GraphPad Prism 6 software.  Asterixes (*) represent significance base on 95% confidence interval (P: 0.01 to 0.05): *, (P: 0.001 to 0.01): **, (P: 0.0001-0.001): ***, (P< 0.0001): ****.       Standard procedures in the lab require that each experiment be repeated for a minimum of 3 independent trials.    103  Chapter 3:  Results   3.1 Protein expression in B cell lines   Rationale 3.1.1               Mouse B cell lines, including J558μm3, WEHI231, A20 and 5TGM1 were tested for expression of various components of the BCR as well as endogenous Cx43 and transfected Cx43-EGFP by Western Blot. Having knowledge of the expression profile with respect to the BCR and in particular for Cx43 was important for choosing the proper cell lines for further experiments in this thesis. The WEHI231 and A20 cell lines have been used in the lab for many years and often are used as control cells since it is known that they express the BCR and Cx43 (Steven Machtaler, PhD dissertation, UBC, 2012; Machtaler et al., 2011).  The wild type J558µm3 cell line, and versions expressing transfected Cx43 proteins were also previously described by Machtaler et al., 2011.  Details about the cell lines are described in section 2.1.5.    104   Expression of Cx43 and BCR in different B cell lines 3.1.2              B cell lines that are available in the lab and used for my thesis experiments were tested for expression of Cx43 and the BCR to help choose the best cell lines in the following experiments. Expected molecular weights (MW) for the proteins as detected by western blot are summarized in table 3.1.                  Protein        Expected Molecular Weight                   (kDa)   Endogenous and transfected Cx43 Cx43 42-46 Cx43-EGFP 66-69  BCR (Antigen- binding subunit)  Igμ (heavy chain in mIgM) 65 Igγ (heavy chain in mIgG) 53 Igλ (light chain) 25-28 Igκ (light chain) 25-28  BCR (signaling subunit)  Igα (CD79a, mb-1) 34 Igβ (CD79b, B29) 39 EGFP 23 Actin 42-45                   Table 3.1 List of expected molecular weights for proteins in profile                 expression   105               The expression of Cx43 in B cell lines was previously done by Steven Machtaler (Machtaler et al., 2011) and I extended this work and also looked at expression of all the BCR components (both Ag binding and signaling subunits). Endogenous Cx43 was detected by western blot in WEHI231 and A20 cells at the expected molecular weight (MW) of 42-43 kDa and some times with a slower migrating band at 44-45 kDa. Endogenous Cx43 was not detected in J558μm3  (Fig 3.1.A) and 5TGM1 (data not shown). Cx43-EGFP in transduced J558μm3 cells was detected at higher molecular weight around 66-67 kDa due to being fused to EGFP. Also in some cases a slower migrating band at 68-69 kDa was noticed (Fig 3.1.A).          The expression of BCR with respect to both Ag-binding and signaling subunits was shown by western blot. Appropriate antibodies for immunoblotting were used according to the previous knowledge of BCR expression for heavy and light chains as well as the Igα/β chains (Christian et al., 2003; McLeod et al., 2004; Durand et al., 2006; Reth et al., 1987; Hombach et al.,1988; Justement et al.,1990; Dylke et al., 2007; Machtaler et al., 2011). In summary WEHI231 cells express mIgM (μ heavy chain), Igκ and Igα/β, A20 cells express mIgG (heavy chain, Igκ and Igα/β, J558μm3 cells express transfected mIgM, Igλ and Igα/β (Figure 3.1. B-E). A20 cells transduced with human mIgM (A20.hIgM) also show expression of Igμ along with Igdata not shown). Igα in WEHI231 cells and Igβ in WEHI231, A20, and J558μm3 cells show a smear of slower migrating bands, which is typically characteristic of their glycosylated state (Wilson et al., 2009). The 5TGM1 cells express Ig and Igκ; however, the MW for Ig is less than the expected MW of the surface BCR. 106  Considering the fact that 5TGM1 cells are plasma cells and the MW of secreted antibodies is less than membrane-bound ones (Alt et al.1980; Kehry et al., 1980), it is suggested that the detected IgG in 5TGM1 cells is secreted Ab and not the membrane BCR. Results of protein profile expression with respect to Cx43 and the BCR are shown in Fig 3.1.  107               A) Cx43  B) BCR  (Ag-binding subunit-IgM and κ) C) BCR  (Ag-binding subunit-IgG and λ)  D) BCR  (signaling subunit-Igα) E) BCR  (signaling subunit-Igβ) 108     Figure 3.1 Protein expression of Cx43 and the BCR in B cell lines.  A) Cx43 expression. Western blot showing expression of endogenous Cx43 at 42-43 kDa and in some cases slower migrating band at 44-45 kDa as well as stably transduced Cx43-EGFP at 66-67 kDa and slower migrating band at 68-69 kDa. The J558μm3 +Cx43 (F.P) cell population were made by Farnaz Pournia and J558μm3 +Cx43 (L.F) were made by Letitia Falk. Sigma anti-Cx43 Ab was used as described in the section 2.1.4. The blot was stripped and re-probed with the next Ab in the column in the following sequence, the monoclonal anti-Cx43 amino terminus, followed by anti-GFP, and lastly a strip and re-probe with anti-actin. Actin was used as a loading control. B) BCR expression (Ag binding subunit-IgM and κ). Western blot showing expression of the mIgM heavy and κ chains in different B cell lines. In the schematic of the BCR drawn to the left of the blots, the chains probed for are depicted in red. Blot was stripped and re-probed with the next Ab in the column of images. Actin was used as a loading control. C) BCR expression (Ag binding subunit- IgG and λ). Western blot showing expression of mIgM and λ in different B cell lines. Blot was stripped and re-probed with the next Ab. Schematic BCR on the left shows the location of IgG and λ in red. D) BCR expression (signaling subunit-Igα). Western blot showing expression of Igα (red chain in schematic BCR). Blot was stripped and re-probed with anti-actin as a control. E) BCR expression (signaling subunit-Igβ). Western blot showing expression of Igβ (red chain in schematic BCR). Blot was stripped and re-probed with anti-actin as a control. The antibodies used to detect the BCR antigen-binding component and the signaling subunit were described in the section 2.1.4 and shown in Table 2.3 and Table2.4.  Data shown is representative of two independent replicates.  Note that the difference in color of the images in panel A versus the other panels is due to differences in whether the films were scanned in color or in black & white.  109  After confirming the expression of Cx43 and the BCR in these B cell lines, appropriate subclones were chosen for the experiments in this thesis. The Cx43-negative J558μm3 cells that can be transduced with WT and/or mutated forms of Cx43-EGFP by retroviral infection, which was previously established as a GOF system with respect to BCR-mediated cell spreading (Machtaler et al., 2011), was chosen as the main cell line for the studies in my thesis. The WEHI231 cell line that expresses endogenous Cx43 but can be transduced with WT and mutated forms of Cx43-EGFP (Falk et al., 2014) was chosen to study potential dominant negative (DN) interference effects by new Cx43 mutants.   3.2  The importance of the region between amino acids 258-307 of the connexin43 carboxyl tail for BCR-mediated cell spreading   Rationale 3.2.1              The importance of Cx43 CT (aa 246-382) in BCR-mediated B cell spreading was discovered previously in the Matsuuchi Lab (Machtaler et al., 2011). However, which specific residue(s) within the CT domain, as well the mechanism by which the CT could influence the regulation of cytoskeletal rearrangement is not understood. Similarly, the importance of the CT has been shown in other cell systems, for example the CT was discovered to be key for glioma invasion (Bates et al., 2007), for 110  neural migration during development (Cina et al., 2009), and for cytoskeletal changes in glioma (Crespin et al., 2010).  Additionally the region of the CT located between aa 258-305 was found to be the most influential in neural migration (Cima Cina, Chapter 4, PhD dissertation, 2010, unpublished). Since there are common themes between the cellular mechanisms that underlie neural migration and cytoskeletal dependent processes in B-lymphocytes (Matsuuchi and Naus, 2013), we decided to explore if the region encompassing aa 258-307 are important for BCR-mediated cell spreading. Identifying the regions of the Cx43 CT that are most influential for BCR-mediated cell spreading, gives us a starting point for identifying the specific amino acids that could be modified and/or be protein-protein interaction sites that influence B cell responses.    Expression of Cx43 CT truncations in the B cell line J558μm3 3.2.2                To find out the regions of the Cx43 CT (aa 246-382) that are most important for BCR-mediated cell spreading, two deletions were made, one after aa 258 (Δ258) and one after aa 307 (Δ307) (methods as described in sections 2.1.2.1 and 2.1.2.2). Each of these deletions removes potential modification sites and protein-protein interaction sites that might be important for B cell responses. A schematic representation of the deletions in the CT, depicted in a linear format for easier comparisons, is shown in Figure 3.2.A. This schematic shows the different deletions of the CT and highlights the Tyr residues, which are a focus of this thesis. The Δ307 111  truncation of the CT removes the PDZ-1 binding domain at aa 379-382 and multiple serine residues that are proposed targets of phosphorylation by different kinases (previously discussed in section 1.5.2 and Figure 1.5), as well as Tyr 313 (Solan and Lampe, 2005; Solan and Lampe, 2009). The Δ258 truncation, in addition to the regions removed by the Δ307 truncation, also removes the proline-rich region (SH3 binding site) at aa 274-284, the PY motif (Nedd4 biding site) at aa 282-286, the Tyr-based sorting signal (important for internalization) at aa 286-289, multiple serine residues as proposed targets of MAPK phosphorylation, as well as Tyr 265 (SH2 binding site) and Tyr 267, 286, 301 (Solan and Lampe, 2009; Palatinus et al., 2012). The Δ258 and Δ307 Cx43 constructs were made such that the proteins are fused to EGFP at the C-terminus, and were placed in a retroviral expression vector. The deletions were confirmed by sequencing by the NAPS Unit, UBC (www.msl.ubc.ca/services/naps), (see Appendices A1 and A2). The J558μm3 cell line was stably transduced by retroviral infection (section 2.3.2).  Cell populations were enriched by FACS sorting for EGFP-positive cells , which were those cells expressing mutated forms of Cx43 (section 2.5). Afterwards protein expression was checked by western blot, FACS analysis and immunofluorescence microscopy.                  Expression of Δ258 and Δ307 Cx43-EGFP in J558μm3 cells was checked by western blot and flow cytometery analysis (Figure 3.2 B-C). Since the truncated proteins are missing a large section of the CT, lower MWs are expected. Table 3.2 shows the expected MW for different Cx43-EGFP mutants as detected by western blot. In western blot analysis when an anti-Cx43 Ab that detects the very end of the 112  Cx43 CT (aa 363-382; Sigma Aldrich, see Table 2.3) was used, Δ258 and Δ307Cx43-EGFP were not detected. This confirms the absence of this section of the CT in the Cx43 mutant proteins. The same blot was stripped and re-probed with anti-Cx43 Ab that detects the Cx43 NT (aa 1-20; Fred Hutchinson Research Centre monoclonal Ab, see Table 2.3) and this time the Δ258 and Δ307Cx43-EGFP were detected at the expected MWs. The latter blot also detects a lower MW band for WT and the mutant proteins, which follow the same trend with respect to MWs. The lower MW band was also detected for Δ246Cx43-EGFP in the same conditions in a separate experiment (data not shown). At this point, we are not sure what these lower MW bands could represent, but one possibility is that it is a degradation product. EGFP expression was detected in WT and mutant Cx43 expressing cells. Expression of Cx43 and the BCR (important for signaling in BCR-mediated cell spreading) were checked by FACS analysis to make sure the cells were expressing similar levels of the proteins.     113                Notes:  1) The slower migrating bands due to phosphorylation of Cx43 were not considered when stating the expected MWs.  2) Point mutations of Cx43 are not predicted to change the expected MW.                                  Localization of Δ258 and Δ307 Cx43-EGFP in J558μm3 cells were compared to localization of WTCx43-EGFP by immunofluorescence (IF) (Figure 3.2.D). To ensure that CT truncations did not alter trafficking and localization of Cx43, the localization of the mutants were compared to WT Cx43. The proteins were visualized by using their EGFP tag and confocal images (i.e. confocal slices) were taken through the middle of the cells that were responding in a BCR-mediated cell Table 3.2 List of expected molecular weights for Cx43 mutants                  Protein        Expected Molecular Weight  (kDa)    Cx43                                       WT Cx43 43 Δ246 Cx43 28 Δ258 Cx43 29.5 Δ307 Cx43 35  Cx43-EGFP WT Cx43-EGFP 66 Δ246 Cx43-EGFP 51 Δ258 Cx43-EGFP 52.5 Δ307 Cx43 58  Point mutants of Cx43    66 114  spreading assay (section 2.6.). The IF images showed that the CT truncations did not change the localization when compare to the WT.   115     A D C B 116    Figure 3.2 Characterization of J558μm3 cells expressing Δ258 and Δ307 Cx43-EGFP. A) Schematic showing the deletions and point mutations studied in this thesis using a linear depiction of the CT. The schematic shows the Tyr residues that are removed by each of the deletions. Tyr point mutations to Phe, at aa positions 247, 265 and 267, that will be discussed later in this theses, are indicated by yellow stars. B) Western blots showing the expression of transduced Δ258 and Δ307 Cx43-EGFP in J558μm3 cells. The blot was stripped and re-probed with the next Ab in the column, sequentially, as described in Figure 3.1, panel A. Actin was used as a loading control. Data shown is representative of two independent experiments. C) Cx43 (left panel) and BCR (right panel) expression by flow cytometery analysis. Cx43 expression in transduced J558μm3 cells was compared to non-transduced cells using the EGFP tag. BCR (IgM) expression was assessed in transduced J558μm3 cells by staining for IgM using a PE conjugated Ab and comparison to non-stained cells. Data shown is representative of two independent experiments. D) Localization of WT and mutant Cx43 by IF. Localization of Δ258 and Δ307 Cx43-EGFP (green ring) were compared to WT Cx43-EGFP (green ring) and EGFP (filled green) in J558μm3 cells. Confocal images were taken, using 100x objective, though the middle of the cells that were subjected to the cell spreading assay. Scale bar = 10μm. Data shown is representative of three independent experiments.  117    The importance of amino acids 258-307 in the Cx43 CT for BCR-3.2.3mediated cell spreading in J558μm3 cells       BCR-mediated cell spreading is an important early event for Ag gathering and for B cell activation (Harwood and Batista 2009; Harwood and Batista, 2010). The cell spreading process is commonly used as read-out for cytoskeletal rearrangements (Lin et al., 2008; Freeman et al., 2011; Machtaler et al., 2011; Falk et al., 2014). The established GOF system of J558μm3 cells expressing WT or mutated Cx43-EGFP (Machtaler et al., 2011) was used to assess the spreading of J558μm3 cells expressing Δ258 or Δ307 Cx43-EGFP. These results would narrow down the specific region(s) of the CT that influences cytoskeletal rearrangements and provide a more focused target for this thesis. The results for cells expressing the Δ307 deletion would identify if the residues that are removed between position 308 and 382, which include key serines important for channel gating at Ser 325, 328, 330, 364, 365, and 368, are necessary (or not necessary) for BCR-mediated cell spreading.  The results for cells expressing the Δ258 when compared to the cells expressing the Δ246 (Machtaler et al., 2011) would identify if the Y247 and S255 alone, are sufficient to support BCR-mediated cell spreading.   BCR-mediated spreading of J558μm3 cells expressing Δ258 or Δ307 Cx43-EGFP was tested as described in section 2.6. The results are shown in Fig 3.3.A 118  where the insets are single cell representatives of the same field of view, and Fig 3.3.B is the quantification of the contact area of the cells with surface of the coverslip (spreading area). The significance of the data was identified based on a Tukey’s test using a 95% confidence interval. Cells expressing Δ307 Cx43-EGFP showed a very significant increase in the mean contact area over time. Also when comparing the mean contact area to the cells expressing WT Cx43 there was no significant difference at the 15 min time point. In the representative replicate shown here, the mean contact area at 30 min showed a significant decrease when compared to the WT one. However this is not a repeating theme and in some cases the mean contact area for cells expressing Δ307 was higher than those expressing WT CX43 (data not shown). J558μm3 cells expressing EGFP alone and not conjugated to Cx43 were used as negative control. These cells showed no increase in spreading area over time. Also when compared to the cells expressing WT Cx43-EGFP, there was a very significant decrease in the spreading area for both of the time points. The results showed that removal of the Cx43 CT beyond aa 307 does not impede the BCR-mediated cells spreading in J558μm3 cells.              Expression of Δ258 Cx43-EGFP did not support BCR-mediated cell spreading. The J558μm3 cells expressing Δ258 Cx43-EGFP did not show significant increase in the mean spreading area over time. Also when comparing the mean contact area to the cells expressing WT Cx43 there is a very significant decrease at both 15 and 30 min time points. The results showed that removal of the Cx43 CT 119  beyond aa 258 impeded BCR-mediated cells spreading in Δ258 Cx43-EGFP transduced J558μm3 cells.              Taken together, the results from testing the spreading of the J558μm3 cells expressing Δ258 or Δ307 Cx43-EGFP in comparison to WT Cx43 showed that removal of the CT beyond aa 307 did not impede B cell spreading; however, removing the residues beyond aa 258 impeded spreading. These findings suggest the importance of the region located between aa 258-307 of the Cx43 CT for supporting BCR-mediated cell spreading in J558μm3 cells.    120   A B Figure 3.3 The importance of amino acids 258-307 of the Cx43 CT for BCR-mediated cell spreading in J558μm3 cells. A) Confocal images of spreading of J558μm3 cells expressing Δ258 (D258) or Δ307 (D307) Cx43-EGFP compared to the controls. Images were taken at the contact area of the cells and coverslips using an Olympus Fluoview1000 confocal microscope and the 100x objective. Cells were stained for actin (red) using rhodamine-phalloidin. WT and mutant Cx43 were visualized using the EGFP tag (green). In the last column shows cells expressing the vector containing EGFP alone. Merge= yellow and scale bars = 10μm. Number of cells that were quantified per samples for 15 and 30 min time points is >100 and for 0 time point is >20-25. B) Spreading was quantified by measuring the contact area of the cells at the surface of the coverslips at the time points indicated after BCR stimulation. Asterixes (*) denoate significant differences determined by P-value differences. (P: 0.01 to 0.05): *, (P: 0.001 to 0.01): **, (P: 0.0001-0.001): ***, (P< 0.0001): ****. Data shown is representative of three independent experiments.  121   3.3 The importance of tyrosine 247, 265 and 267 of the connexin43 carboxyltail for BCR-mediated cell spreading    Rationale 3.3.1              The importance of the Cx43 CT (defined by the first CT deletion studied by our lab; aa 246-382) in BCR-mediated B cell spreading was discovered previously (Machtaler et al., 2011) and the results of chapter 3.2 of this thesis identified the region located between aa 258-307 to be the most influential. However, which specific residues that are the most important are not known. Since Cx43 is identified as a target of phosphorylation upon BCR and chemokine (CXCL12) stimulation (Machtaler et al., 2011; Machtaler et al., 2014, Kate Choi, MSc thesis, UBC, 2012) phosphorylation sites such as Tyr and Ser are considered potential key players. One of the most important proximal signaling events after BCR stimulation is activation of different families of protein Tyr kinases (Gold, 2002; Pieper et al., 2013). Tyr 247 and Tyr 265 of Cx43 have been reported to be phosphorylated by Src-family kinases (Swenson et al., 1990; Kanemitsu et al., 1997; Lin et al., 2006; Solan and Lampe, 2008). Additionally the importance of Tyr 265 for effective B cell spreading was discovered (Letitia Falk, MSc thesis, UBC, 2013; Falk et al., 2014) when the studies in this thesis were in progress. Accordingly, other Tyr residues of the Cx43 CT were chosen as potential important residues for supporting BCR-mediated B cell 122  spreading. Knowing the specific residues of the Cx43 CT that are most influential for this process, will be useful in identifying the potential interacting proteins and eventually to the understanding of the mechanism by which Cx43 could influence cytoskeletal regulation in B lymphocytes.     Expression of tyrosine (Y) mutants in the carboxyl-tail of Cx43 (Y247F,    3.3.2Y265F, Y247F/Y265F and Y267F) in the B cell lines J558μm3 and WEHI231                 Two B cell lines, J558μm3 and WEHI231 cells were stably transduced with expression vectors containing Cx43-EGFP Tyr mutants (see section 2.3.2) and expression was checked by western blot (Fig 3.4 B-C). The Tyr point mutation at location 247 to phenylalanine (F) was made using the cDNA of WT Cx43 EGFP or the cDNA bearing Y265 mutation (previously made in the Matsuuchi Lab by Letitia Falk) in the NAP2 expression vector (section 2.1.2.3 and 2.1.2.4, respectively). The point mutations were confirmed by sequencing by the NAPS Unit, UBC (www.msl.ubc.ca/services/naps), (see Appendices A 3 and A4).  The resulting Y247F Cx43-EGFP and Y247F/Y265F Cx43-EGFP constructs were used to transduce J558μm3 and WEHI231cells by retroviral infection. An additional Tyr point mutation at location 267 was made in the lab by May Dang-Lawson (section 2.1.3) and the expression vector was used to transduce J558μm3 cells. These cells were also used in the studies in this thesis. Cell populations were enriched by FACS sorting for 123  EGFP-positive cells, which were those cells expressing mutated forms of Cx43 (section 2.5).  These single point mutations are not expected to change the MW of Cx43; therefore, the expected MW is the same as WTCx43-EGFP (Table 3.2).                Expression of Tyr single point or double point mutations was checked by western blot. In J558μm3 cells (Fig 3.4.B) the mutant proteins were detected at the MW expected for WT Cx43-EGFP, higher than Cx43 alone due to the EGFP fusion. Also a lower MW band was detected for cells expressing WT, Y247F and Y247F/Y265F Cx43. These lower MW bands might be the internally translated isoforms that auto-regulate trafficking of Cx43 (Smyth and Shaw, 2013). A version of Fig 3.4.B was published in Falk et al., 2014, and I am a mid-author. Expression of Y267F Cx43 in J558μm3 cells was also detected in a similar way by western blot (data not shown). In WEHI231 cells overexpressing WT and mutant Cx43-EGFP (Figure 3.4.C) two bands with different MW were detected with anti-Cx43 Ab. One band was detected at a lower MW consistent with MW of the endogenous Cx43 expressed by WEHI231 cells. Also there was band detected at higher MW consistent with the MW of Cx43-EGFP. In WEHI231 +Δ246 Cx43-EGFP cells, only one band corresponding to the MW of endogenous Cx43 was detected and no band was detected at higher MW corresponding to the MW of Cx43-EGFP when using anti-Cx43 Ab that detects the CT (Ab source, Sigma-Aldrich, see Table 2.3). This is expected since the region that this anti- Cx43 Ab detects is removed in Δ246 Cx43-EGFP. Expression of WT and mutant Cx43-EGFP in J558μm3 and WEHI231 cells was confirmed by western blot analysis. 124     A MW (kDa) B (Ab against CT) (Ab against CT) MW (kDa) C Figure 3.4 Expression of Tyr point and double point mutations of Cx43-EGFP in J558μm3 and WEHI231 cells. A) Schematic showing the Try point mutations in the Cx43 CT. The Y265F (black) was previously made and studied in the Matsuuchi lab. Y247F (red), double Tyr mutations Y247F/Y265F as well as Y267F (red) were made and studied in this thesis. B) Western blot showing expression of transduced Y247F, Y265F and Y247F/Y265F Cx43-EGFP in J558μm3 cells.  The blot was stripped and re-probed with the next Ab in the column, as previously described in Figures 3.1 and 3.2. Actin was used as a loading control. Data shown is representative of three independent experiments. A version of this figure was published in Falk et al., 2014 C) Western blot showing expression of stably transduced Y247F, Y265F and Y247F/Y265F Cx43-EGFP in WEHI231 cells.  Blot was stripped and re-probed with the next Ab in the column. Data shown is representative of two independent replicates.  Note that the difference in color of the gels was due to scanning the films in color versus in black & white.  125                 Both the J558μm3 and WEHI231 cells over expressing Tyr point and double mutations of Cx43 were further characterized and used in functional assays in dominant negative (DN) experiments, and in Gain-of-Function (GOF) experiments, respectively. The data for WEHI231 cells will be presented first, followed by the data using J558μm3 cells.    Localization of tyrosine (Y) mutants in the carboxyl-tail of Cx43 (Y247F, 3.3.3Y265F, Y247F/Y265F) expressed in WEHI231 cells with surface BCR and markers specific for intracellular organelles                To determine if Tyr point and double mutations of the Cx43 CT did not alter trafficking and localization of Cx43 to the plasma membrane and other intracellular organelles, co-localization of Cx43 with the cell surface BCR was assessed using immunofluorescence (Figure 3.5.A). WEHI231 cells were fixed but not permeablized with detergents (section 2.7.1.1and table 2.5) and then stained for mIgM (heavy chain of the BCR in WEHI231 cells). This way only the cell surface BCR is visualized. The WT and mutant forms of Cx43 were visualized by using their EGFP tag, and their localization with surface BCR was compared. Confocal images (slices) were taken through middle of the cells and the results showed that Tyr point mutations had no major effect on localization of Cx43-EGFP and the surface BCR when compared 126  to the WT Cx43 in WEHI231 cells. A version of Fig 3.5.A was published in Machtaler et al., FEBS Letters, 2014, and I am a mid-author.                To further determine if Tyr point mutations of Cx43 did not alter trafficking of Cx43, the co-localization of mutated Cx43-EGFP with markers for the endoplasmic reticulum (ER) was assessed using IF (Figure 3.5B). WEHI231 cells expressing Y247F Cx43-EGFP were labeled using an ER tracker applied to living cells, and then the cells were fixed (section 2.7.1.2 and table 2.6). Confocal images showed that the Y247F point mutation had no major effect on localization with the ER marker when compared to WT Cx43-EGFP in WEHI231 cells.                To add to previous studies in the lab, the localization of over-expressed Cx43-EGFP with the actin in WEHI231 cells was assessed using IF (Figure 3.5C). Previous studies by Steven Machtaler (PhD dissertation, UBC 2012; Machtaler et al., 2014) showed a close link between F-actin, and Cx43 was assessed by fluorescence recovery after photo-bleaching (FRAP) in presence or absence of chemical disturbance of the F-actin. The reviewers asked for a separate experiment showing the co-localization of Cx43-EGFP and F-actin using a more conventional approach. Thus, WEHI231 cells over-expressing Cx43-EGFP were fixed, permeablized and stained for F-actin (using rhodamine phalloidin) (section 2.7.1.1) and Cx43 was visualized using the EGFP tag. Confocal images were taken through the middle of the cells and the WEHI231 + Cx43-EGFP cells were compared to those over-expressing only EGFP. The Cx43-EGFP was co-localized with F-actin in WEHI231 127  cells. A version of Fig 3.5.C was published in Machtaler et al., FEBS Letters 2014, and I am a mid-author.   128    A) Surface BCR Staining C) F-actin staining B) ER labeling Figure 3.5 Localization of the Tyr mutants in the CT of the Cx43-EGFP with the cell surface BCR and intracellular organelles in WEHI231 cells.  A) Localization with the surface BCR. Cells were fixed but not permeablized and stained for mIgM (BCR) (red). WT and mutant Cx43 were visualized using the EGFP tag (green) and merge is in yellow. In the last column on the right side green is EGFP alone. Confocal images were taken through the middle of the cells using a 100x objective. Scale bar =10μm. Data shown is representative of two independent experiments. B) Localization with the ER. WEHI231 cells expressing Y247F Cx43-EGFP along with control cells were labeled live with an ER tracker and then fixed. Confocal images were taken through the middle of the cells using a 100x objective. Green= WT or mutant Cx43-EGFP, except the last images to the right in which green is EGFP. ER= red, merge=yellow and scale bar =10μm. Data shown is representative of a single experiment. C) Localization with F-actin. Cells were fixed, permeablized and stained for F-actin (rhodamine phalloidin). Confocal images were taken though the middle of the cells using a100x objective. Cx43= green, actin =red, merge= yellow and scale bar= 10μm. Data shown is representative of two independent experiments. A version of Figures 3.5 A and C were published in Machtaler et al., FEBS Letters, 2014.  129   Carboxyl tail truncation (Δ246) and tyrosine mutants (Y247F, Y265F and 3.3.4Y247F/Y265F) of Cx43 do not have a dominant negative effect on BCR-mediated spreading in WEHI231 cells              Previous findings in the Matsuuchi Lab showed that the T154A point mutation in the third transmembrane region of the Cx43 (channel-blocking mutant) had a dominant negative (DN) effect on BCR-mediated cell spreading of WEHI231 cells (Letitia Falk, MSc thesis, UBC, 2013; Falk et al., 2014). Here we tested if the Cx43 CT mutants, including Δ246, Y247F, Y265F, Y247F/Y265F had DN effects on BCR-mediated spreading of WEHI231 cells. According to the literature the T154A mutation of Cx43 has a DN affect by forming heteromeric channels with WT Cx43 connexin proteins, thus leading to a closed gap junction (Beahm et al., 2006). We tested if the expression of Δ246 or Tyr point or double mutants of Cx43-EGFP had negative effects on the endogenous Cx43 expressed in WEHI231 cells and if this would be reflected in effects on BCR-mediated spreading. WEHI231 cells were stably transduced with Δ246 or Tyr point or double mutation Cx43-EGFP using retroviral infection (section 2.5) and tested for BCR-mediated spreading (section 2.6). The results showed that neither the Cx43 CT truncation (Δ246) nor the Tyr mutations (Y247F, Y265F and Y247/Y265F) had dominant negative effects on BCR-mediated cell spreading (Figure 3.6B). This could mean either the heteromeric connexons were not formed, or if formed, were not able to compete with the WT Cx43 and thus cell spreading was supported. 130   A B Figure 3.6 CT mutants of Cx43-EGFP did not have a dominant negative effect on BCR-mediated cell spreading in WEHI231 cells. A) Schematic showing the potential hetermomeric connexons formed by intermixing of Δ246 Cx43-EGFP (red) and endogenous Cx43 (blue), shown at the left side, and intermixing of Tyr point or double mutants of Cx43-EGFP (red) and endogenous Cx43 (blue), shown at the right side. B) Confocal images of spreading of WEHI231 cells expressing the channel blocking mutant (T154A) or CT truncation or point mutants (Δ246, Y247F, Y265F, Y257/Y265) Cx43-EGFP, compared to the controls. In the T154A column, the white arrows show the cells overexpressing T154A Cx43-EGFP (yellow), with the smaller spreading area compared to the non-transduced ones (red). Images were taken at the contact area of the cells and the surface of the coverslips on an Olympus Fluoview1000 confocal microscope using the100x objective. Cells were stained for actin (red) using rhodamine-phalloidin. WT and mutant Cx43 were visualized using the EGFP tag (green). In the last column, the green is representative of EGFP alone. Merge= yellow and scale bars = 10μm. Data shown representative of three independent experiments.  131    Expression of tyrosine (Y) mutants in the carboxyl-tail of Cx43 (Y247F, 3.3.5Y265F, Y247F/Y265F) do not have an effect on cell size of  J558μm3 cells               Since Cx43 was overexpressed in J558μm3 cells, it was needed to determine if the excess Cx43 at the plasma membrane cause an increase in the cell size. The over expression of WT or mutant Cx43-EGFP in the cells might lead to an increase in the cell area, which could confound the results of cell spreading assay. Relative cell size was compared by flow cytometry (section 2.5) using forward scatter measurement (FSC). Expression of WT or mutants Cx43-EGFP as well as EGFP did not affect the cell size when compared to the non-transduced cells (Figure 3.7A).                The expression of transfected mIgM and CD19 (a co-receptor of BCR) were checked using flow cytometery (section 2.5.1). The expression of transfected mIgM was checked using forward scatter measurement (FSC) by flow cytometery in the J558μm3 cells overexpressing WT or mutant Cx43 (Figure 3.7B). This is important since the main readout for this thesis (BCR-mediated cell spreading) is happening downstream of BCR signaling. The results showed that the cells are expressing the similar levels of the protein; therefore, any difference in the results of cell spreading could not be due to differences in the mIgM levels. Additionally expression of CD19, a co-receptor of BCR, which enhances BCR signaling (Gold, 2002; Pieper, 2013), 132  was assessed in J558μm3 cells. The results showed the CD19 is not expressed in this cell line (Figure 3.7.C).  133    A) FSC comparison B) mIgM expression C) CD19 expression Figure 3.7 Expression of CT mutants of the Cx43-EGFP did not affect the cell size. Expression of transfected mIgM and CD19 in J558μm3 cells. A) Comparison of the cell size using flow cytometery analysis. The FSC of J558μm3 cells overexpressing WT or mutant Cx43 or EGFP was compared to the non-transduced cells. Samples were processed using a BD LSRII Flow Cytometer (BD Biosciences) at UBC Flow Cytometry Facility (www.ubcflow.ca). Mean fluorescence intensity was determined using FlowJo software (Tree Star Inc., Ashland, OR, USA). Data shown is representative of three independent experiments. B) mIgM expression by flow cytometery analysis. J558μm3 cells expressing WT or CT mutants of the Cx43-EGFP or EGFP were stained with fluorophore-conjugated anti-IgM. Expression of IgM in these cells were compared to non-transduced ones which were not stained for IgM. Samples were processed using a BD LSRII Flow Cytometer at the UBC Flow Cytometry Facility and analyzed using FlowJo software. Data shown is representative of three independent experiments. C) CD19 expression by flow cytometery analysis. J558μm3 cells expressing WT or CT mutants of the Cx43-EGFP or EGFP were stained with fluorophore-conjugated anti-CD19. Expression of CD19 was assessed using a BD LSRII Flow Cytometer as described ablove. Data shown is representative of three independent experiments.  134    Localization of tyrosine (Y) mutants in the carboxyl-tail of Cx43 (Y247F, 3.3.6Y265F, Y247F/Y265F) expressed in J558μm3 cells with surface BCR and markers specific for intracellular organelles             To determine if Tyr point and double mutations of the Cx43 CT did not alter trafficking and localization of Cx43 to the plasma membrane and other intracellular organelles, co-localization of Cx43 with the cell surface BCR was assessed using immunofluorescence (Figure 3.8.A). J558μm3 cells were fixed but not permeablized with detergents (section 2.7.1.1) and then stained for mIgM (heavy chain of the BCR transfected into J558μm3 cells). This way only the cell surface BCR is visualized. The WT and mutant forms of Cx43 were visualized by using their EGFP tag, and their localization with surface BCR was compared. Confocal images (slices) were taken through middle of the cells and the results showed that Tyr point mutations had no major effect on localization of Cx43-EGFP and the surface BCR when compared to the WT Cx43 in J558μm3 cells. A version of Fig 3.8.A was published in Falk et al., Biology Open, 2014, and I am a mid-author.                To further determine if Tyr point and double mutations of Cx43 did not alter trafficking of Cx43, the co-localization of mutated Cx43-EGFP with markers for the endoplasmic reticulum (ER), early endosome (EEA1) and lysosome was assessed using IF (Figure 3.8B). J558μm3 cells expressing Tyr point and double mutations of the CT of Cx43-EGFP were labeled using an ER tracker applied to living cells, and 135  then the cells were fixed (section 2.7.1.2 and table 2.6). Confocal images showed that the CT Tyr point and double mutations of Cx43 had no major effect on localization with the ER marker when compared to WT Cx43-EGFP (Figure 3.8.B- top row). To determine co-localization with early endosomes, J558μm3 cells were fixed, permeablized with detergents and then stained with antibody for early endosome marker EEA1 (section 2.7.1.1 and table 2.5). Confocal images showed that the CT Tyr point and double mutations of Cx43 had no major effect on localization with the EEA1 marker when compared to WT Cx43-EGFP (Figure 3.3.B- middle row). Lastly, to determine co-localization with lysosome, J558μm3 cells were labeled using a lysosome tracker applied to living cells, and then the cells were fixed (section 2.7.1.2 and table 2.6). Confocal images showed that the CT Tyr point and double mutations of Cx43 had no major effect on localization with the lysosome marker when compared to WT Cx43-EGFP (Figure 3.3.B- bottom row). In summary CT Tyr point and double mutations of Cx43 did not alter co-localization of Cx43 with intracellular markers including ER, early endosome and lysosome when compare to WT Cx43-EGFP in J558μm3 cells. A version of Fig 3.8.A-B was published in Falk et al., Biology Open, 2014, and I am a mid-author.    136       A) Surface BCR staining B) Intracellular organelles labeling and staining  137     Figure 3.8 Localization of the Tyr mutants in the CT of Cx43-EGFP with the cell surface BCR and intracellular organelles in J558μm3 cells. A) Localization with the surface BCR. Cells were fixed but not permeablized and stained for mIgM (BCR) (red). WT and mutant Cx43 were visualized using the EGFP tag (green) and merge is in yellow. In the last column on the right side green is EGFP alone. Confocal images were taken through the middle of the cells using a 100x objective. Scale bar =10μm. Data shown is representative of three independent experiments. B) Localization with the intracellular markers. Cells were labeled live with an ER tracker and then fixed (top row). Confocal images were taken through the middle of the cells using a 100x objective. Green= WT or mutant Cx43-EGFP, except the last images to the right in which green is EGFP. ER= red, merge=yellow and scale bar =10μm. Data shown is representative of three independent experiments. In the middle row, cells were fixed, permeablized and stained with anti-EEA1 antibody. Confocal images were taken as described above. Green= WT or mutant Cx43-EGFP, except the last images to the right in which green is EGFP. EEA1= purple,  merge=white and scale bar =10μm. Data shown is representative of three independent experiments. In the last row, cells were labeled live with a lysosome tracker and then fixed. Confocal images were taken as described previously. Green= WT or mutant Cx43-EGFP, except the last images to the right in which green is EGFP. lysosome= red, merge=yellow and scale bar =10μm. Data shown is representative of three independent experiments. A version of Figures 3.8.B was published in Falk et al., Biology Open, 2014.  138   The importance of tyrosine (Y) 247 and 265 in the carboxyl tail of Cx43 3.3.7for BCR- mediated cell spreading in J558μm3 cells             As mentioned earlier, BCR-mediated cell spreading is an important early event for Ag gathering and for B cell activation (Harwood and Batista 2009; Harwood and Batista, 2010) and the cell spreading process is commonly used as read-out for cytoskeletal rearrangements (Lin et al., 2008; Freeman et al., 2011; Machtaler et al., 2011; Falk et al., 2014). The established GOF system of J558μm3 cells expressing WT or mutated Cx43-EGFP (Machtaler et al., 2011) was used to assess the spreading of J558μm3 cells expressing Y247F or Y265F or Y247F/Y265F Cx43-EGFP. With regard to Y265F Cx43-EGFP, the initial experiments were done by previous MSc student, Letitia Falk (Letitia Falk, MSc thesis, UBC, 2013; Falk et al., 2014), and I contributed to some of the repeats of the experiments. The results of this section for cells expressing Y247F and Y265FCx43-EGFP were published in Falk et al., Biology Open, 2014, and I am a mid-author.                 BCR-mediated spreading of J558μm3 cells expressing Y247F or Y265F or Y247F/Y265F Cx43-EGFP was tested as described in section 2.6. The results are shown in Fig 3.9.A where the insets are single cell representatives of the same field of view, and Fig 3.9.B is the quantification of the contact area of the cells with surface of the coverslip (spreading area). The significance of the data was identified based 139  on a Tukey’s test using a 95% confidence interval. While cells expressing WT Cx43-EGFP showed a very significant increase in the mean contact area over time, this is not the case for cells expressing single or double Tyr point mutations. In the case of cells expressing Y265F Cx43-EGFP, there was a significant increase in the spreading area when comparing 0 to 15 min time points. However, the spreading area at 15 min time point is significantly smaller when compared to the cells expressing WT Cx43-EGFP at 15 min. Also the significant increase in the contact are (0 to 15 min) for cells expressing Y265F Cx43-EGFP is not a repeating theme and did not occur in all the experiments. For all other Tyr point or double mutation of the CT of Cx43, cells did not show a significant increase in the contact area. Additionally all the cells expressing the mutant proteins showed a very significant decrease in the contact area when compared to the cells expressing the WT protein for both 15 and 30 min time points. J558μm3 cells expressing EGFP alone and not conjugated to Cx43 were used as negative control. These cells showed no increase in spreading area over time. Also when compared to the cells expressing WT Cx43-EGFP, there was a very significant decrease in the spreading area for both of the time points. The results showed that tyrosine residues at location 247 and 265 of the CT of Cx43 are important for supporting BCR-mediated cells spreading in J558μm3 cells. A version of Figure 3.9 A-B was published in Falk et al., Biology Open, 2014, and I am a mid-author.   140    A) B) 141    Figure 3.9 The importance of tyrosine (Y) 247 and 265 in the carboxyl tail of Cx43 for  BCR- mediated cell spreading in J558μm3 cells. A) Confocal images of spreading of J558μm3 cells expressing Y247F or Y265F or Y247F/Y265F Cx43-EGFP compared to the controls. Images were taken at the contact area of the cells and coverslips using an Olympus Fluoview1000 confocal microscope and the 100x objective. Cells were stained for actin (red) using rhodamine-phalloidin. WT and mutant Cx43 were visualized using the EGFP tag (green). In the last column shows cells expressing the vector containing EGFP alone. Merge= yellow and scale bars = 10μm. Number of cells that were quantified per samples for 15 and 30 min time points is >100 and for 0 time point is >20-25. B) Spreading was quantified by measuring the contact area of the cells at the surface of the coverslips at the time points indicated after BCR stimulation. Asterixes (*) denote significant differences determined by P-value differences. (P: 0.01 to 0.05): *, (P: 0.001 to 0.01): **, (P: 0.0001-0.001): ***, (P< 0.0001): ****. Data shown is representative of three independent experiments.  142             As mentioned earlier, Cx43 was previously identified as a target of phosphorylation upon BCR stimulation (Machtaler et al., 2011; Kate Choi, MSc thesis, UBC, 2012). However, it is not known if the phosphorylation occurs on serine, threonine or tyrosine residues. Also, studies described above in this thesis and Falk et al., 2014, showed the importance of tyrosine residues at location 247, 265 and 267 for supporting BCR-mediated cell spreading in J558μm3 cells. Therefore we started preliminary experiments with the goal of identifying phosphorylation of specific tyrosine residues of the CT of Cx43 upon BCR stimulation.                   The pan monoclonal anti-phosphotyrosine antibody (PY20) (section 2.1.4 and table 2.3) was tested to determine its ability to detect phosphotyrosines in B cells upon BCR stimulation. This was done since the past efforts in the lab (Letitia Falk, MSc thesis, 2013) failed to show BCR-induced tyrosine phosphorylation of endogenously-expressed or transfected Cx43 in B cells using the lab’s pan-anti-phosphotyrosine antibodies, 4G10. The monoclonal anti-phosphotyrosine antibody 4G10 (prepared in the lab by May Dang-Lawson (Gold et al., 1990; Richards et al., 1996) and also a monoclonal rabbit α-mouse antibody specific for Cx43 phosphorylated on Y265 (gift from Dr. Paul Lampe, Fred Hutchinson Cancer Research Centre, Seattle, WA, USA; Solan and Lampe, 2008) were used in the previous studies. Testing an additional pan-anti-phosophotyrosine antibody, PY20, on BCR-stimulated B cells was done in hopes of finding other antibodies that could detect phosphorylated resides on Cx43 in stimulated B cells. The results showed 143  appearance of bands corresponding to the MW of endogenous Cx43 upon BCR stimulation but there were many background bands as well (data not shown). The right way to pursue identification of specific tyrosine phosphorylation upon BCR stimulation is using monoclonal Cx43 phosphotyrosine specific antibodies. For this purpose, we started collaboration with Dr. Paul Lampe (Fred Hutchinson Cancer Research Centre, Seattle, WA, USA) to test phosphorylation of specific tyrosine residues (Y247 and Y265) and serine residues of Cx43 after BCR stimulation using the panel of Lampe lab monoclonal antibodies (Solan and Lampe, 2008) (section 2.1.4).  This collaboration is successful, but the results are beyond the scope of this thesis, and will be pursued in the future work of Matsuuchi Lab.    The importance of tyrosine (Y) 267 in the carboxyl tail of Cx43 for BCR- 3.3.8mediated cell spreading in J558μm3 cells                After identifying the importance of Tyr 247 and 265 of the CT of Cx43 for supporting the BCR-mediated cell spreading of J558μm3 cells, the importance of other tyrosine residues of the Cx43 CT were investigated. The next Tyr that was studied is Y267. Unlike Y247 and Y265, there is no published data regarding phosphorylation of Y267. However, this Tyr residue and all other Tyr residues of the CT of Cx43 are potent targets of phosphorylation. The Y267 is located very close to Y265, the known SH2 binding site; therefore, mutation at Y267 might interfere with 144  phosphorylation of Y265 and creating a SH2 binding site. According to a model phosphorylation of Y265 and creating the SH2 binding site leads to phosphorylation of Y247 (Lin et al., 2001). Therefore Y267 might influence phosphorylation of both Y265 and Y247. Consequently Tyr 267 was the next Tyr residue that was studied in the context of supporting BCR-mediated spreading in J558μm3 cells.                 The B cell line, J558μm3 was stably transduced with expression vector containing Y267F Cx43-EGFP (see section 2.3.2) and expression was checked by western blot (data not shown) and IF (Figure 3.10.B). The Y point mutation at location 267 to F was made in the lab by May Dang-Lawson using the cDNA of WT Cx43 EGFP in the NAP2 expression vector (section 2.1.3). The point mutation was confirmed by sequencing by the NAPS Unit, UBC (www.msl.ubc.ca/services/naps).  The resulting Y267F Cx43-EGFP construct was used to transduce J558μm3 cells by retroviral infection (section 2.3.2). Cell populations were enriched by FACS sorting for EGFP-positive cells which were those cells expressing mutated forms of Cx43 (section 2.5). Expression of Y267F Cx43-EGFP in J558μm3 cells was checked by western blot (data not shown) where the mutant protein was detected at the MW expected for WT Cx43-EGFP, higher than Cx43 alone due to the EGFP fusion (table 3.2). Also localization of Y267F Cx43-EGFP was compared to localization of WT Cx43-EGFP by IF (Figure 3.10.B). The proteins were visualized by using their EGFP tag and confocal images (slices) were taken through the middle of the cells that were responding in a BCR-mediated cell spreading assay (section 2.6.). The results 145  showed that mutation at Y267F of Cx43-EGFP did not change the localization when compared to the WT (Figure 3.10.B).                BCR-mediated spreading of J558μm3 cells expressing Y267F Cx43-EGFP was tested as described in section 2.6. The results are shown in Fig 3.10.C, where the insets are single cell representatives of the same field of view, and Fig 3.9.B is the quantification of the contact area of the cells with surface of the coverslip (spreading area). The significance of the data was identified based on a Tukey’s test using a 95% confidence interval. While cells expressing WT Cx43-EGFP showed a very significant increase in the mean contact area over time, this is not the case for cells expressing Y267F Cx43-EGFP. Additionally all the cells expressing the mutant protein showed a very significant decrease in the contact area when compared to the cells expressing the WT protein for both 15 and 30 min time points. J558μm3 cells expressing EGFP alone and not conjugated to Cx43 were used as negative control. These cells showed no increase in spreading area over time. Also when compared to the cells expressing WT Cx43-EGFP, there was a very significant decrease in the spreading area for both of the time points. The results showed that tyrosine residue at location 267 of the CT of Cx43 is important for supporting BCR-mediated cells spreading in J558μm3 cells.  146   A) D) C) B) Figure 3.10 The importance of tyrosine (Y) 267 in the carboxyl tail of Cx43 for BCR- mediated cell spreading in J558μm3 cells. A) Schematic showing the Y267F point mutation in the Cx43 CT B) Localization of WT and mutant Cx43 by IF. Localization of Y267F Cx43-EGFP (green ring) was compared to WT Cx43-EGFP (green ring) and EGFP (filled green) in J558μm3 cells. Confocal images were taken, using 100x objective, though the middle of the cells that were subjected to the cell spreading assay. Scale bar = 10μm. Data shown is representative of three independent experiments. C) Confocal images of spreading of J558μm3 cells expressing Y267F Cx43-EGFP compared to the controls. Images were taken at the contact area of the cells and coverslips using an Olympus Fluoview1000 confocal microscope and the 100x objective. Cells were stained for actin (red) using rhodamine-phalloidin. WT and mutant Cx43 were visualized using the EGFP tag (green). In the last column shows cells expressing the vector containing EGFP alone. Merge= yellow and scale bars = 10μm. Number of cells that were quantified per samples for 15 and 30 min time points is >100 and for 0 time point is >20-25. B) Spreading was quantified by measuring the contact area of the cells at the surface of the coverslips at the time points indicated after BCR stimulation. Asterixes (*) denoate significant differences determined by P-value differences. (P: 0.01 to 0.05): *, (P: 0.001 to 0.01): **, (P: 0.0001-0.001): ***, (P< 0.0001): ****. Data shown is representative of three independent experiments.  147  Chapter 4: Discussion   4.1 Summary of main findings         In this thesis, I showed that the amino acids up to 307 of the carboxyl tail of Cx43 were important for supporting BCR-mediated cell spreading in B lymphocytes. I also showed that the tyrosine residues numbered 247, 265 and 267 were significant players in supporting B cell spreading. This thesis identifies a specific region within the CT of Cx43, including the tyrosines at locations 247 and 267, as important for cell spreading in B cells. The importance of Y265 was first identified when the studies of this thesis were in progress and reported previously (Letitia Falk, MSc thesis, UBC, 2013; Falk et al., 2014). BCR-mediated cell spreading was the first readout used to test for cytoskeletal rearrangement. This work provides tools and confirms the basis for exploring other important domain(s) and residue(s) of the Cx43 CT as well as the interacting proteins for cytoskeletal dependent processes such as adhesion, spreading, migration and transendothelial migration which are vital processes for B cell development and immune response.      148   Chapter 3.2: The importance of the region between amino acids 258-307 of                         the connexin43 carboxyl tail for BCR-mediated cell spreading                          Using the established GOF system in the Matsuuchi Lab, the importance of the amino acids located between 258-307 of the CT of Cx43 for BCR-mediated cell spreading was identified. It was found previously that expression of WT Cx43-EGFP in the mouse B cell line (J558μm3 cells) that does not express Cx43 is sufficient to support BCR-induced cell spreading (Machtaler et al., 2011). J558μm3 cells have been used previously to study BCR structure and receptor signaling (Reth et al., 1987; Hombach et al.,1988; Justement et al.,1990). Additionally, the importance of Cx43 CT (aa 246-382) in BCR-mediated B cell spreading was discovered using the same system (Machtaler et al., 2011). However, which specific domain(s) within the CT, as well the mechanism by which the CT could influence the regulation of cytoskeletal rearrangement is not understood. In order to find the domains that are most influential for the spreading response, the same GOF system was used with two different Cx43 CT truncations. The J558μm3 cells were transduced with Δ258 or Δ307 Cx43-EGFP and tested for BCR-mediated cell spreading. The results were compared to the previously made cell line, J558μm3 + Δ246 Cx43-EGFP to identify the significant region of the Cx43 CT for B cell spreading. The results showed that the expression of Δ307 Cx43-EGFP supports BCR-mediated cell spreading while expression of Δ258 Cx43-EGFP did not (Figure 149  3.3 A-B). In conclusion, the region of the CT of Cx43 located between aa 258-307 was identified as an important region for supporting B cell spreading in J558μm3 cells, while amino acids after position 307 to the end of the protein (amino acid 382) are likely less important.                        The CT of Cx43 up to aa 307 contains multiple modification and protein-protein interaction sites that could potentially influence cytoskeletal regulation in B lymphocytes. There are multiple tyrosine and serine residues located in this region, which are potential as well as known phosphorylation sites in different systems (Solan and Lampe 2005; Solan and Lampe, 2009). This phosphorylation sites could serve as putative binding sites for signaling and/or scaffolding proteins (Giepmans, 2004; Lampe and Lau, 2004,Solan and Lampe, 2009). Phosphorylation of Y265 creates an SH2 binding site (Giepman, 2004; Solan and Lampe, 2009; Palatinus et al., 2012), which can serve as a recruiting site for signaling and/or scaffolding proteins. Additional phosphorylation could alter the secondary structure of Cx43 leading to availability of other interaction sites (Sorgen et al., 2004a). The CT of Cx43 up to aa 307 also contains a proline-rich region between P274-P284, which is a SH3 biding site (Giepmans, 2004; Palatinus et al., 2012). This domain could serve as a recruitment site for signaling or scaffolding proteins containing an SH3 domain. In conclusion, the specific domains of the CT of Cx43 could serve as a platform for recruitment of signaling and/or scaffolding protein that can influence cytoskeletal dynamics at the membrane.   150   Chapter 3.3 : The importance of tyrosine 247, 265 and 267 of the                         connexin43 carboxyl tail for BCR-mediated cell spreading                          Using the same established GOF system as before, the importance of tyrosine residues at location 247, 265 and 267 of the CT of Cx43 was identified as supporting BCR-mediated cell spreading. The J558μm3 cells were transduced with expression vectors encoding mutated Cx43 containing Y247F, Y265F, Y247F/Y265F or Y267F Cx43-EGFP, and first the localization of the mutant proteins was compared with the WT protein in the context of intracellular organelles (Figure 3.8 A-B). To determine if tyrosine point and double mutations of Cx43 did or did not alter trafficking of Cx43 to the plasma membrane, where it has the most effect, the co-localization of mutated Cx43-EGFP with markers for the ER, early endosome (EEA1) and lysosome was assessed using IF. The results showed that the CT Tyr point and double mutations of Cx43 did not alter co-localization of Cx43 with intracellular markers when compared to WT Cx43-EGFP in J558μm3 cells.  Once it was found that these single or double point mutations did not alter the trafficking of Cx43, the cells were tested for BCR-mediated cell spreading. The results showed that single point mutations Y247F, Y265F or Y267F, as well as the double point mutations Y247F/Y265F impeded BCR-mediated cell spreading in J558μm3 cells (Figure 3.9 1-B and Figure 3.10 C-D). In conclusion the tyrosine residues of the CT of Cx43 151  numbered 247, 265 and 267 are important for supporting BCR-mediated cell spreading in J558μm3 cells.                  The tyrosine residues of the Cx43 CT as potential phosphorylation sites could participate in signaling cascades or provide an anchoring site for cytoskeletal regulating proteins at the membrane. Previous studies in the Matsuuchi Lab showed that Cx43 is a target of phosphorylation upon BCR and chemokine (CXCL12) stimulation (Kate Choi, MSc thesis, UBC, 2012; Machtaler et al., 2011; Machtaler et al., 2014). However, up to this point in the study, the specific tyrosine residue’s phosphorylation upon stimulation had not been identified. One of the most  important proximal signaling events after BCR engagement is the activation of different families of protein tyrosine kinases, including Src family kinases. Also direct phosphorylation of Y247 and Y265 by Src is well studied (Swenson et al., 1990; Kanemitsu et al., 1997; Lin et al., 2006; Solan and Lampe, 2008). Therefore, we hypothesized that the activation of Src upon BCR stimulation might contribute to the phosphorylation of tyrosine residues of the Cx43 CT. The phosphorylated Cx43 then might contribute to the signalosome formed upon BCR signaling leading to cytoskeletal rearrangements. In line with this, BCR induced activation of Rap1 GTPase, a master regulator of cytoskeletal rearrangements in B lymphocytes (Lin et al., 2008; Lin et al., 2009; Lin et al., 2010; Freeman et al., 2010) is affected by Cx43 expression (Machtaler et al., 2011). In addition, previous findings in the Matsuuchi lab showed that Cx43 is important for the BCR-induced phosphorylation of multiple 152  components of BCR signaling pathways, specifically Lyn, Syk, Btk, PLCγ2, Erk, cofilin and HS1 (Kate Choi, MSc thesis, UBC, 2012). As for Y267, unlike Y247 and Y265, there is no published data regarding phosphorylation of Y267; however, this tyrosine is also by nature a potent target of phosphorylation. Additionally, the Y267 is located very close to Y265, the known SH2 binding site; therefore, mutation at Y267 might interfere with phosphorylation of Y265 and creating an SH2 binding site. According to a the model for the phosphorylation of Y265 and the creation of the SH2 binding site, this important events leads to phosphorylation of Y247 (Lin et al., 2001). Therefore Y267 might influence phosphorylation of both Y265 and Y247. Phosphorylation of the Cx43 CT at tyrosine residues could lead into participation of Cx43 in signaling pathways leading to enhancing cytoskeletal dynamics in B cells. Also the phosphorylation sites might act as anchoring sites for different proteins at the plasma membrane.                  The tyrosine residues of the Cx43 CT as potential phosphorylation sites could provide anchoring sites for cytoskeletal regulating proteins in close proximity of the plasma membrane. In recent years the Cx43 CT is believed to associate with multiprotein complexes, in particular, adaptors that can anchor Cx43 to the cytoskeleton, and related proteins such as scaffolding, integral membrane receptors, and signaling molecules. These interactions are important for GJ function as well as for enabling Cxs to interact with various cellular signaling pathways. The channel-independent function of Cx43 including cytoskeletal regulation, cell morphology and motility can also be facilitated through interactions with protein complexes that 153  regulate cytoskeletal rearrangements (Olk et al., 2009). The phosphorylation sites could directly serve as recruitment sites or lead to conformational changes (Sorgen et al., 2004b) that increase the affinity of Cx43 for specific proteins. Potential proteins that might connect Cx43 to cytoskeleton are discussed in section 4.3.   Concluding remarks from chapter 3.2 and 3.3:              The results of chapter 3.2 and 3.3 collectively showed that the amino acids of the Cx43 CT up to aa 307 are the most important for supporting BCR-mediated cell spreading in J558μm3 cells. However, amino acids located before the aa 258 are not sufficient to support the cell spreading by themselves. For example Y247, which is located within the identified significant region (up to aa 307), was identified as a key residue for cell spreading. Though, this residue by itself is not sufficient for spreading as cells express Δ258 Cx43-EGFP were not able to make a spreading response. These findings suggest that the function of Y247 is dependent on other domains and /or residues within the Cx43 CT up to aa 307. In line with this,  Src phosphorylation of the CT was proposed to start by binding of the Src SH3 domain to the proline-rich region (P274-P280) of the Cx43 CT, which results in phosphorylation by Src of Y265. The phosphorylated Y265 forms an SH2 binding site that could lead to more Src kinase binding and subsequent phosphorylation of Y247 154  (Lin et al 2001). This model shows the importance of other domains of the CT for phosphorylation of Y247. In summary the amino acids of the Cx43 CT up to the aa 307 are significant for supporting BCR-mediated cell spreading in J558μm3. However, the function of amino acids located before the aa 258 such as Y247F and potentially S255 is dependent on existence of other domain with the CT up to aa 307.   4.2 Questions about the results         The Δ246 and Δ258 Cx43-EGFP expressed in cells appeared as a thicker rim in immunofluorescence studies when compared to cells expressing the WT and Δ307 Cx43-EGFP expression vectors. While revisiting the previously made Δ246 Cx43-EGFP in terms of localization with the surface BCR and intracellular organelles, I noticed that this protein also appears by immunofluorescence as a thicker ring around the cell periphery when compare to the WT protein (Figure 3.8 A-B). Also this was a re-occurring theme, noticed in the cells that were subjected to a spreading assay (in a confocal slice through the middle of the cell) as well as the cells stained or labeled for the surface BCR and intracellular markers respectively. Additionally, in some cases larger “aggregates” (immunofluorescence staining) of Δ246 Cx43-EGFP was noticed inside the cells when compared to the WT. This intracellular form was mainly co-localized with the ER marker (Figure 3.8 B). Later I also noticed this thick 155  green rim in the cells expressing Δ258 Cx43-EGFP, but not in the cells expressing Δ307 Cx43-EGFP (Figure 3.2 D) nor in cells expressing any of the tyrosine point or double mutations (Figure 3.8 A-B).  The Δ246 and Δ258 Cx43-EGFP appear as a thicker rim at the cell periphery when compared to the WT and Tyr point or double mutations. This could mean that the removal of the CT beyond aa 258, but before 307 could affect internalization of Cx43.          The CT of Cx43 contains a PY motif and a tyrosine-based sorting signal located in the region of aa 258-307, which are important for Cx43 internalization (Thomas et al., 2003; Leykauf et al., 2006; Su and Lau 2012). The PY motif (xPPxY, where x can be any aa) located between aa 282-286 binds to the W-W domain of Nedd4, a ubiquitin ligase possibly responsible for Cx ubiquitination at the plasma membrane (Leykauf et al., 2006; Girao et al., 2009). The PY motif overlaps with a putative tyrosine-based sorting signal (Yxxϕ, where ϕ is a hydrophobic aa), that is thought to facilitate internalization of proteins containing such a signal. Mutations in the tyrosine-based sorting signal including mutations at Y286, tripled the half-life of Cx43 indicating the importance of this motif for Cx43 turnover (Thomas et al., 2003). Taking into consideration that these two sites are removed in the Δ246 and Δ258 Cx43-EGFP, it is possible that internalization of the CT truncated Cx43 is different form the WT. Considering the very short half-life of 1-5 h (Laird et al., 1991; Beardslee et al., 1998), I suggest that the Δ246 and Δ258 Cx43-EGFP have possible altered internalization and persist at the plasma membrane while the newly synthesized Cx43 arrives and this results in the thick rim of Cx43 at the cell periphery 156  observed by immunofluorescence. Future experiments with the focus on Cx43 internalization for example by using fluorescence recovery after photobleaching (FRAP) can reveal more details about this phenotype, but are beyond the scope of this thesis.   4.3 Model: how the CT of Cx43 could influence cytoskeletal remodelling                     The Cx43 CT could influence cytoskeletal rearrangements by recruiting proteins that directly or indirectly lead to Rap1 GTPase activation, thereby influencing cytoskeletal reorganization, or by providing anchoring sites for actin-regulatory adaptor proteins at the plasma membrane. Phosphorylation of Cx43 upon BCR stimulation (Kate Choi MSc thesis, UBC, 2012; Machtaler et al., 2011) could create target binding sites for signaling and/or adaptor and cytoskeleton linker proteins that could influence cytoskeletal reorganization. Also, the phosphorylation could result in a conformational change in the Cx43 CT, which exposes protein-protein interaction domains. Studies by Sorgen et al show that protein binding to the Cx43 CT could potentially alter the secondary structure of Cx43 even at sites far from the protein-protein interaction place. These findings suggest that the CT can act as a platform for the binding partners through which they can interact and signal  (Sorgen et al. 2004). These protein-protein interactions at the CT might directly or indirectly influence Rap1 GTPase activation as it was shown previously that the Δ246 Cx43 disturbed 157  sustained BCR-induced Rap1 GTPase activation (Machtaler et al., 2011). Also the protein-protein interactions might provide an anchoring site close to the plasma membrane for cytoplasmic proteins that influence cytoskeleton dynamics.  The Cx43 CT could influence cytoskeletal reorganization through interactions with HIP55 and HS1. Reports indicate a possible interaction of Cx43 with actin-binding proteins, drebrin (Butkevich et al., 2004) and cortactin (Squecco et al., 2006, and Vitale et al., 2010) in different cell types. B lymphocytes do not express drebrin and cortactin; however, they express hematopoietic specific homologs HIP55 (also known as mABP-1 or SH3P7) and HS1 respectively (Kitamure, 1989). HIP55 is reported to be recruited to the immune synapse (IS) in T cells and regulate T cell receptor signaling and endocytosis (Le Bras et al., 2004). HS1 is found to function as an actin-regulatory adaptor protein at the IS in T cells (Gomez et al. 2006). Additionally, structural studies of HIP55 (Worth et al., 2013) and HS1 (Hao et al., 2005) suggest that it is physically possible for Cx43 to interact with the two actin-binding proteins. Interestingly, HS1 is shown to interact with HIP55 in B cells where it is assumed to play a role in BCR-mediated cytoskeletal rearrangements (Muzio et al., 2007). Consequently, It was suggested that the CT of Cx43 recruits actin-binding proteins HIP55/HS1, which then work with proteins, likely GEFs that affect Rap1 activation (Steven Machtaler PhD dissertation, 2012). I also believe that it is also possible that Cx43 CT could act as an anchoring site for actin-binding proteins likely HIP55/HS1 and possibly other cytoplasmic proteins that could influence actin dynamics at the membrane.  158    HIP55 and HS1 are strong candidates through which Cx43 could influence cytoskeletal dynamics. HIP55 contains an SH3 domain (Ensenat et al., 1999) therefore, it could bind to the proline-rich domain of the CT of Cx43. Additionally HIP55 contains an actin-binding domain (Ensenat et al., 1999) so it is possible for HIP55 to connect Cx43 to the actin cytoskeleton.   HIP55 was identified as a key component of the immunological synapse in T cells where it modulates T cell activation by connecting the actin cytoskeleton and the T cell receptor (TCR) to gene activation and to the endocytosis process (Le Bras et al., 2004). Additional studies confirmed the importance of HIP55 as an adaptor protein for TCR signaling and immune responses in T cells (Han et al., 2005). HS1 like HIP55 also contains an SH3 domain and an F-actin binding domain (Hao et al., 2005). Therefore, HS1 could also bind to the proline-rich domain of the CT of Cx43 and connect it to the actin cytoskeleton. HS1 is suggested to bind to actin-related protein (Arp) 2/3 through its N-terminal and modulate Arp2/3 mediated actin polymerization (Hao et al., 2005). One possibility is that Cx43 binds to the SH3 domain of HS1, which is close to HS1’s C-terminal and provide an anchoring site for the cytoplasmic protein close to the plasma membrane so that HS1 can interact with Arp2/3 and facilitate actin nucleation. Additionally, the importance of HS1 for immune synapse formation in T cells (Gomez et al., 2006) and in trafficking and homing of 159  leukemic B cells has been reported (Scielzo et al., 2010). Based on the information provided, the actin binding proteins, HIP55 and HS1 are considered candidates through which the Cx43 CT could affect cytoskeleton remodeling.  In addition to HIP55 and HS1 other actin binding proteins have been shown to directly or indirectly interact with Cx43, such as ZO-1 (Toyofuku et al., 1998; Giepmans and Mooleaner et al., 1998; Giepmans, 2004), vinculin, ezrin, IQGAP1 and α-catinin (Xu et al., 2006; Olk et al., 2009).  These could potentially link Cx43 to the regulation of cytoskeletal rearrangements.              Incorporating this information described above, we propose a molecular model of how Cx43 could influence cytoskeletal rearrangements (Figure 4.1). Upon initial BCR signaling, one thought is that the phosphorylated sites or exposed protein-protein interaction domains due to conformational change in the CT, interact with the adaptor proteins (possibly HS1 and/or HIP55) that might direct or indirectly influence sustained activation Rap1GTPase, a master regulator of cytoskeletal rearrangements (Lin et al., 2010).  These interactions could influence BCR-mediated cell spreading (Steve Machtaler PhD dissertation, 2011). A second possibility is that the CT of Cx43 provides anchoring sites for actin-binding proteins, again possibly HS1 and/or HIP55 that could influence actin dynamics and reorganization of the cytoskeleton at the plasma membrane. This model explains two possible ways that the CT of Cx43 influences the regulation of B cell cytoskeletal events. Determining the specific regions and amino acids within the CT that are essential for B-cell spreading can 160  help explain the underlying molecular mechanisms responsible for cytoskeletal changes.    161     Figure 4.1 Model showing how the CT of Cx43 could influence cytoskeletal     remodelling. Cx43 (orange) is a target of BCR (blue and green) signalling and is phosphorylated upon BCR crosslinking (I). Ag engagement or anti-BCR crosslinking of the BCR results in recruitment of Src family kinases such as Lyn (pink) and Syk (purple), which initiate BCR signalling. These protein tyrosine kinases could potentially account for phosphorylation of Cx43 upon BCR stimulation. The phosphorylated sites of Cx43 could act as putative binding spot for signaling and/or cytoskeleton adaptor and linker proteins (II). Also phosphorylation of Cx43 could result in conformational changes in the CT, which exposes protein-protein interaction domains (II). The interaction (possibly with HS1 and/or HIP55) might direct or indirectly influence sustained activation of Rap1GTPase; therefore, regulating cytoskeletal rearrangements and B cell spreading (1). A second possible mechanism is the phosphorylated or exposed regions, could serve as anchoring site for actin-binding proteins (likely HS1 and/or HIP55) that could influence actin dynamics and cytoskeletal remodeling at the plasma membrane (2). Mutating the potential phosphorylation sites (red), could block the interactions that are involved in enhancing cytoskeletal dynamics at the membrane; therefore, impede the BCR-mediated cell spreading (III).    162                By mutating the potential phosphorylation sites, we confirmed the importance of these residues for BCR-mediated spreading.  One approach to identify the interacting proteins is by the development of a Cx43 CT that can be easily isolated from the plasma membrane and thus usable in co-immunoprecipitation assays performed using a variety of different detergents.  The construction of a chimeric protein containing the Cx43 tail fused in frame to a different membrane protein that is easily isolated is a standard approach in the B cell field (Sutherland et al., 1996).  To achieve this, the Matsuuchi lab is constructing chimeras containing the extracellular and transmembrane domains of CD8 and the CT of Cx43 (CD8:CT).  Alternatively we can also construct chimeras containing the extracellular and transmembrane domains of CD40 and CT of Cx43 (CD40:CT). It is anticipated that the chimeric proteins will allow for the recovery of multi-protein Cx43-containing complexes from the plasma membrane as in previous studies (Sutherland et al., 1996; Hanissian and Geha, 1997; Jabara et al., 1998; Morio et al., 1999). This approach is favored since the previous attempts to co-immunoprecipitate Cx43 along with interacting proteins have failed (Steven Machtaler, PhD dissertation, UBC, 2012; Matsuuchi lab, unpublished; Naus lab unpublished). Details are discussed in section 4.4.4.    163   4.4 Future Directions    Further deletions and point mutations 4.4.1  4.4.1.1 Additional deletion mutants: deletion at aa 270 within the CT region of Cx43         Amino acids of the Cx43 CT up to aa 307 were identified to be important for BCR-mediated spreading. The next step is to introduce a deletion within the CT at aa 270 to be able to distinguish the importance of the two notable sites located in this region, the proline-rich (P274-P284) region encompassing S279 and S282 (MAPK target) and/or Y265 (the Src kinase target). Knowing the exact region within the CT that is important for BCR-mediated spreading, can help lead to the identification of other proteins that could interact with Cx43 and influence cytoskeletal reorganization. A linear depiction of Cx43 CT showing multiple modification and interaction sites is shown in Figure 4.2.   There are two possible outcomes with respect to spreading of J558μm3 cells expressing Δ270 Cx43-EGFP. One is that cells expressing Δ270 Cx43-EGFP are 164  able to spread on anti-IgM coated coverslips. If this holds true, it supports the importance of Y247 and Y265 for B-cell spreading. The second possible outcome is that cells expressing Δ270 Cx43 are not able to spread which reveals a possible role for S279/S282, and the proline-rich region (P274-P284). The proline-rich region is suggested to be essential for Src binding, and the phosphorylation of Y265 and Y247 (Lin et al. 2001). Additionally the proline-rich region could potentially serve as a binding site for other SH3-domain-containing proteins such as cytoskeletal linkers and adaptors.  Lastly, if the cells are not spreading, it is also possible that both the proline-rich region and Y265 work together in a manner to be determined, and are both important for BCR-mediated spreading.    4.4.1.2 Additional point mutations: Key proline and serine residues                   Further insight can be achieved by additional proline and serine point and multiple mutations within the CT and testing their effects on B cell spreading. Point mutations P277L, P280L, P283L as well as the triple mutations could be used to investigate the influence of the Src-SH3 binding site. Also point mutations S255A, S268A, S279A, S282A (MAPK targets (Warn-Cramer et al., 1996)) and also quadruple mutations could be used to look at the influence of MAPK on BCR-mediated cell spreading. MAPK is also activated upon BCR signaling (Gold et al., 2000; Gold et al., 2002; Defranco et al., 2006) therefore, the serine residues that are 165  potential targets of phosphorylation by MAPK (Solan and Lampe 2005; Solan and Lampe 2009) are of special interest. Furthermore, in a study using several phospho-specific antibodies, it was shown that activation of v-Src also leads to phosphorylation of S262, S279/S282 (MAPK targets) and S368 (a PKC target (Reynhourt et al., 1999; Martinez et al., 2002) (Solan and Lampe, 2008). These findings, along with the results of this thesis showing the importance of tyrosines as potential Src phosphorylation sites for BCR-mediated cell spreading, make the serine residues very attractive sites to explore. The study by Solan and Lampe in 2008, also showed that there was a decrease in phosphorylation of S364/S365 (a PKA target (Shah et al., 2002)) (Solan and Lampe, 2008). So the point and double mutation S365A and S365A would also be of interest. Identifying the key sites of the CT of Cx43 will assist in pinpointing where potential interacting proteins could bind an important step in understanding cytoskeletal regulation in B cells.   166          Figure 4.2 Linear depiction of the CT of Cx43 showing multiple modification and interaction sites.  This diagram shows the potential phosphorylation  sites including tyrosine residues (Y, red) and serine residues (S, green) as well as protein-protein interaction sites located within the CT of Cx43. Potential binding sites for different kinases as well as binding sites for an SH2, SH3 and PDZ domain are shown. Dashed line show the location of CT truncations that were used in this study. Y247, Y265 and Y267 (boxed) were found in this thesis to be important for supporting B cell spreading.  167    Essential regions and residues of the Cx43 CT for other cytoskeletal 4.4.2dependent processes in B cells                   Cell lines expressing mutant Cx43-EGFP can be used to study the effect of the CT truncations, point or multiple mutations on cytoskeletal dependent processes such as adhesion, motility, directed migration and transendothelial migration which are all vital for B cell development and immune responses. Up to this point, we used the ‘B cell spreading assay’ as the read-out for BCR mediated changes in the cytoskeletal architecture.  However there are other cell processes that rely on rearrangements of the cytoskeleton, and these could utilize different combinations of associated proteins to mediate these events (Machtaler et al., 2011 and Machtaler et al., 2014).  In addition to cell spreading, the effect of the truncation and point mutations in the CT of Cx43 could be tested for effects on cell adhesion, process extension using real time imaging, motility (using a bead clearing assay), directed migration toward chemokines using a transwell assay, movement through endothelial cell layers using an adaption of the transwell assay, formation of immune synapses (using a bead binding assay), endocytosis (of the BCR) as well as testing for the activation of various signaling pathways downstream of the BCR and chemokine receptors. These experiments will reveal if the same region and/ or residues of the Cx43 CT are important for regulation of the cytoskeletal rearrangements in diverse cytoskeletal dependent processes in B lymphocytes. Since these processes are happening downstream of different signaling pathways 168  incorporating different molecules, different domains of the Cx43 CT and different interacting protein might be involved.    Site specific phosphorylation of Cx43 CT upon BCR stimulation 4.4.3               In support of the importance of tyrosine residues of the Cx43 CT in B cells, we have started a collaboration with Dr. Paul Lampe (Fred Hutchinson Research Institute, Seattle, WA, USA), to look at inducible phosphorylation of the Tyr and Ser residues of the Cx43 CT upon BCR stimulation. Previous efforts in the Matsuuchi lab  (Letitia Falk, MSc thesis, 2013) failed to show BCR-induced tyrosine phosphorylation of endogenously-expressed or transfected Cx43 in B cells using the lab’s anti-phosphotyrosine antibodies, 4G10, as well as commercially available reagents (section 2.1.4 and table 2.3). Monoclonal antibodies specific for Cx43 phosphorylated on Y265 (gift from Dr. Paul Lampe; Solan and Lampe, 2008) were used in the previous studies by Letitia Falk, but these experiments were not successful. In July of 2014, a collaboration with Dr. Paul Lampe on the phosphorylation of specific tyrosine residues (Y247 and Y265) of Cx43 after BCR stimulation (as well as specific phosphorylation of serine residues) was tested using the panel of Lampe lab monoclonal antibodies (Solan and Lampe, 2008). Frozen lysates (Section 2.4.1) from unstimulated and BCR-stimulated (Section 2.3.3) Cx43-transfected J558μm3 and WEHI231 B cells were couriered to the Lampe Lab.    169  These lysates were analyzed by SDS-PAGE followed by immunoblotting (Section 2.4.4), and tested for phosphorylation of Cx43 on tyrosine 247 and tyrosine 265. The phosphospecific antibodies (rabbit α-Cx43 PY247 and rabbit α-Cx43 PY265) (section 2.1.4; Solan and Lampe, 2008) have been used in the field to show modification of Cx43 in a variety of cell types (Norris et al., 2008; Marquea-Rosado et al., 2012; Li et al., 2014). The results showed that Y247 is inducibly phosphorylated after BCR signaling (data not shown and beyond the scope of this thesis).  This finding reconfirms the importance of Y247 of the CT of Cx43 in responses downstream of BCR signaling. We will continue our collaboration with Dr. Paul Lampe to look at other specific sites, mainly the key serine residues, and their phosphorylation after BCR and possibly chemokine (CXCL12) stimulation.    Making chimeric constructs consist of CD8 or CD40 + CT of Cx43  4.4.4              Chimeric constructs consisting of CD8 or CD40 extracellular and transmembrane domains joined to the CT of Cx43 gives us a powerful tool to address different questions with respect to role of Cx43 CT in the regulation of cytoskeletal remodeling in B lymphocytes. Previous attempts to co-immunoprecipitate Cx43 along with interacting proteins at the plasma membrane (PM) have failed (Steven Machtaler, PhD dissertation, UBC, 2012). Therefore, making chimeric constructs CD8: CT (CD8 + CT of Cx43) and CD40: CT (CD40 + 170  CT of Cx43) have been considered. These constructs encode proteins that are smaller than Cx43 monomers and don’t form hexamers.  Thus in theory they should be easier to solubilize from the plasma membrane and co-immunoprecipitate with interacting proteins from the plasma membrane. CD8 is a transmembrane protein that functions as a co-receptor with the TCR (Gao and Jakobsen, 2000). CD8 forms a dimer with immunoglobulin variable (Ig-V)-like extracellular domain and short intracellular tail (Leahy et al., 1992). Chimeric proteins consisting of CD8 and the cytoplasmic tail of CD40 have been used successfully by many in the past including the Gold lab (Sutherland et al. 1996; Hanissian and Geha, 1997; Jabara et al., 1998; Morio et al., 1999). It is likely that a similar chimeric approach by making CD8: CT should form a dimer expressed at the PM and supply a valuable tool to look at protein interactions with cytosolic components.  If the protein is successfully expressed and localized to the PM of the B cell lines available in our lab, multiple questions can be asked, and more importantly, the hope is that the CD8: CT chimera will be more easily solubilized from the PM thus allowing for better co-immunoprecipitation experiments and other experiments to look at proteins associated with the Cx43 cytoplasmic tail (Musil and Goodenough, 1991; reviewd by Solan and Lampe in Chapter 11 of Connexins: A Guide 2009; Steven Machtaler PhD dissertation, UBC, 2012; Millan et al. 1999). CD40 is a member of tumor necrosis factor (TNF) receptor super family and is found to function in broad variety of immune and inflammatory responses including antigen presenting cell (APC) activation and development of memory B cells. CD40 is an integral membrane protein expressed on the surface of multiple immune cells including B cells 171  (Banchereau et al., 1994) and forms a trimer at the PM (Ashkenazi et al. 1998). Chimeric protein consists of CD40: CT should ideally form a trimer expressed at the PM, an interesting contrast to the chimera made with CD8, which is predicted to form a dimer.    Having the chimeric receptors like those explained above, expressed at the PM of B cell lines, and easily recovered in co-immunoprecipitation studies, we can investigate the importance of Cx43 wild type CT in BCR-mediated spreading as well as making chimeras using various truncated tails or Cx43 tails with mutations.  We believe that chimeras such as these give us the best chance of experimentally identifying the binding partners of Cx43, including the proposed ones, HIP55 and HS1. One caveat associated with the chimeric approach is that these structures are not forming a hexamer at the PM. Since Cx43 normally forms hexamers, the results obtained from chimeric structures might not be hundred percent reflective of the physiology of Cx43. Despite that potential caveat, chimeric receptors consisting of CD8 or CD40 + CT of Cx43 gives us a tool to ask different questions regarding the role of the Cx43 CT in regulating cytoskeletal rearrangements in B cells.   172    Additional future directions 4.4.5               More insight into the importance of Cx43 CT for normal splenic B cell development as well as immune responses can be achieved by establishing new collaborations with Dr. Christian Naus and Dr. Paul Lampe to look at the splenic B cells from different mice with genetically engineered mutations in the Cx43 CT. The Naus lab works with mice engineered to lack the CT domain of Cx43 (Δ258) (Mass et al., 2004) as well as mice containing Cx43 CTs with multiple serine to alanine mutations, generated in collaboration with the Lampe lab. Splenic B cells from these mice can be studied in terms of development and in terms of various cytoskeletal-dependent processes such as adhesion, spreading, motility and directed migration, which are important for both B cell development and immune responses. A more specific approach would be making B cell specific conditional knockout mice by crossing Cx43-floxed mice (Liao et al., 2001) with mb-1/Cre mice (Hobeika et al., 2006).   These conditional knockouts have been in progress but our lab has had problems with the various breeding pairs and have been delayed in terms of generating the appropriate mice.   173   4.5 Conclusion            Connexin43 is shown to be both necessary and sufficient for promoting B cell adhesion, BCR-mediated spreading, as well as for B cell motility and migration. All these cellular processes are dependent on the ability of the cells to rearrange their cytoskeletal elements and play vital roles in normal B cell development as well as immune responses. Additionally, the importance of the carboxyl tail (from aa 246 to 382) of Cx43 for LFA-1 mediated adhesion, BCR-mediated spreading and sustained BCR- and CXCL12- induced Rap1 activation has been shown (Machtaler et al., 2011; Machtaler et al., 2014). However, how the Cx43 CT could influence the regulation of cytoskeletal dynamics in B cells is not understood. The work in this thesis showed that the amino acids of the Cx43 CT up to the 307 residues are important for supporting BCR-mediated cell spreading in B lymphocytes. Additionally the importance of three tyrosine residues at locations 247, 265 and 267 of the Cx43 CT for supporting BCR-mediated B cell spreading was identified. This thesis also showed that the aas of the CT located between aa 246-258 are not sufficient by themselves for supporting B cell spreading. It was shown that the function of these residues including Y247 is dependent on the existence of aas up to aa 307.  Knowing the specific interaction sites within the CT of Cx43 that support B cell spreading will help in identifying the interacting proteins and eventually will lead to discovering the underlying mechanism by which Cx43 influence regulation of cytoskeletal 174  rearrangements in B lymphocytes. These results will provide novel insights into understanding basic B lymphocyte responses that contribute to immune function, and can lead to identification of potential targets for the development of therapeutics to treat immune diseases.   175  References  Abraham, C. L. and Lowell, C. A. (2009). The Ins and outs of leukocyte integrin signaling. Annu Rev Immunol. 27, 339-362.  Abrams, C. K. and Scherer, S. S. (2011). Gap junctions in inherited human disorders of the central nervous system. Biochim Biophys Acta. 1818, 2030-2047.  Adams, G. B. and Scadden, D. T. (2006). The hematopoietic stem cell in its place. Nat Immunol. 7, 333-337.  Adkins, B., Leclerc, C. and Marshall-Clarke, S. (2004). Neonatal adaptive immunity comes of age. Nat Rev Immunol. 4, 553-564.  Akira, S., Uematsu, S. and Takeuchi, O. (2006). Pathogen recognition and innate immunity. Cell. 124, 783-801.  Allman, D. and Pillai, S. (2008). Peripheral B cell subsets. Curr Opin Immunol. 20, 149-157.  Alt, F. W., Bothwell, A. L. M., Knapp, M., Siden, E., Mather, E., Koshland, M. and Baltimore, D. (1980). Synthesis of secreted and membrane-bound immunoglobulin mu heavy chain is directed by mRNAs that differ at their 3’ ends. Cell. 20, 293-301.  Alves, L. A. Coutinho-Silva, R., Persechini, P.M., Spray, D. C., Savino, W. and Campos de Carvalho, A. C. (1996). Are there functional gap junctions or junctional hemichannels in macrophages? Blood 88, 328-334.   Ammer, A. G. and Weed, S. A. (2008). Cortactin branches out: roles in regulating protrusive actin dynamics. Cell Motil Cytoskeleton.65, 687-707.  Anderson, J. M. (1996). Cell signaling MAGUK magic. Curr Biol. 6, 382-384. Ashkenazi, A. and Dixit, V. M. (1998). Death receptors: signaling and modulation. Science 281(5381), 1305-8.   Banchereau, J., Bazan, F., Blanchard, D., Briere, F., Galizzi, J. P., vanKooten, C., Liu, Y. J., Rousset, F. and Saelands, S. (1994) The CD40 antigen and its ligand. Annul Rev Immunol 12, 881-922.  Barbe, M. T., Monyer, H. and Bruzzone, R. (2006). Cell-cell communication beyond connexins: the pannexin channels. Physiology (Bethesda). 21, 103-114.   176   Baroja-Mazo, A., Barbera-Cremades, M. and Pelegrin, P. (2012). The participation of plasma membrane hemichannels to purinergic signaling. Biochim Biophys Acta. 1828, 79-93.  Barr, L., Deway, M. and Berger, W. (1965). Propagation of actin potentials and the structure of the nexus in cardiac muscle. J Gen Physiol. 48, 797-823.  Bartholdy, B. and Matthias, P. (2004). Transcriptional control of B cell development and function. Gene. 327, 1-23.  Bates, D. C., Sin, W. C., Aftab, Q. and Naus C. C. (2007). Connexin43 enhances glioma invasion by a mechanism involving the carboxy terminus. Glia. 55, 1554-1564.  Bauer, R., Löer, B., Ostrowski, K., Martini, J., Weimbs, A., Lechner, H. and Hoch, M. (2005). Intercellular communication: the Dorosophila innexin multiprotein family of gap junction proteins. Chem Biol. 12, 515-526.  Beahm, D. L., Oshima, A., Gaietta, G. M., Smock, A. E., Zucker, S. N., Tolue, M. M., Chandrasekhar, A., Nicholson, B. J. and Sosinky, G. E. (2006). Mutation of a conserved threonine in the third transmembrane helix of alpha- and beta- connexins creates a dominant-negative closed gap junction channel. J Biol Chem. 281, 7994-8009.     Beardslee, M. A., Laing, J. G., Beyer, E. C. and Saffitz, J. E. (1998). Rapid turnover of connexin43 in the adult rat heart. Cir Res. 83, 629-635.  Benschop, R. J., Brandl, E., Chan, A. C. and Cambier, J. C. (2001). Unique signaling properties of B cell sntigen receptor  in mature and immature B cells: implications for tolerance and activation. J Immunol. 167, 4172-4179.  Bertani, G. (2004). Lysogeny at mid-twentieth centry; P1, P2, and other experimental systems. J. Bacteriol. 186, 595-600.  Beyer, E. C. and Steinberg, T. H. (1991). Evidence that gap junction protein connexin-43 is the ATP-induced pore of mouse macrophages, J. Biol. Chem. 266, 7971-7974.  Bodganov, M., Zhang, W., Xie, J. and Dowhan, W. (2005). Transmembrane protein topology mapping by the substituted cysteine accessibility methos (SCAM): application to lipid-specific membrane protein topogenesis. Methods. 36, 148-171.  Boss, J. L. (2005). Linking Rap to cell adhesion. Curr Opin Cell Biol. 17, 123-128. 177   Braet, V., Vandamme, W., Martin, P. E., Evans, W. H. and Leybaert, L. (2003b). Photoliberating inositol-1,4,5-triphosphate triggers ATP release that is blocked by connexin mimetic peptide gap 26. Cell Calcium. 33, 37-48.  Briggs, M. W. and Sacks, D. B. (2003). IQGAP proteins are integral components of cytoskeletal regulation. EMBO Rep. 4, 571-574.  Broerer, F., Apasov, S. G., Sitkovsky, M. V and Eden, W. (2011).  T cell subsets and T-cell mediated immunity. Principles of Immunopharmacology. Springer. New York, NY.   Bruzzone, S., Guida, L., Zocchi, E., Franco, L. and De Flora, A. (2001). Connexin 43 hemi channels mediate Ca2+- regulated transmembrane NAD+ fluxes in intact cells. FASEB J. 15, 10-12.  Bryce, N. S., Clark, E. S., Leysath, J. L. Currie, J. D., Webb, D. J. and Weaver, A. M. (2005). Cortactin promotes cell motility by enhancing lamellipodial persistence. Curr Biol. 15, 1276-1285.  Bukauskas, F. F., Elfgang, C., Willecke, K. and Weingrant, R. (1995). Biophysical properties of gap junction channels formed by mouse connexin40 in induced pairs of transfected human HeLa cells. Biophys J. 68, 2289-2298.  Burnette, W.N. (1981). Western Blotting: Electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal. Biochem. 112, 195-203. Burridge, K. and Connel, L. (1983). A new protein of adhesion plaques and ruffling membrane. JCB. 97, 359-367.  Burridge, K., Nuckolls, G., Otey, C., Pavalko, F., Simon, K. and Turner, C. (1990). Actin-membrane interaction in focal adhesions. Cell Differ Dev. 32, 337-342.  Butkevich, E., Hulsmann, S., Wenzel, D., Shirao, T., Duden, R. and Majul, I. (2004). Drebrin Is a Novel Connexin-43 Binding Partner that Links Gap Junctions to the Submembrane Cytoskeleton. Curr Biol 14, 650-658.  Cameron, S. J., Malik, S., Akaike, M., Lerner-Marmarosh, N., Yan, C., Lee, J. D., Abe, J. and Yang, J. (2003). Regulation of epidermal growth factor-induced connexin 43 gap junction communication by big mitogen- activated protein kinase1/ERK5 but not ERK1/2 kinase activation. J Biol Chem. 278, 18682-18688.    178   Campos de Carvalho, A. C., Moreno, A., Melman, A., Hertzberg, E., Christ, G. and Spray, D. (1993). Gap junctions formed of Cx43 are found between smooth muscle cells of human corpus cavernosum. J. Urol. 149, 1568-1575.  Cannos, J. L., Yu, L. J., Jankovic, D., Crotty, S., Horai, R., Kirby, M., Anderson, S., Cheever, A. W., Sher, A. and Schwartzberg, P.L. (2006). SAP regulates T cell mediated help for humoral immunity by a mechanism distinct  from cytokine regulation. J Exp Med. 203, 1551-1565.  Carrasco, Y. R. and Batista, F. D. (2006). B cell activation by membrane-bound antigen is facilitated by interaction of VLA-4 with VCAM-1. EMBO J. 25, 889-899.  Carrasco, Y. R., Fleire, S. J., Cameron, T., Dustin, M. L. and Batista, F. D. (2004). LFA-1/ICAM-1 interaction lowers the threshold of B cell activation by facilitating B cell adheshionand synapse formation. Immunity. 20, 589-599.  Chen, Y., Corriden, R., Inoue, Y., Yip, L., Hashiguchi, N., Zinkerangel, A., Nizet, V., Insel, P. A. and Junger, W. G. (2006). ATP release guides neutrophil chemotaxis via P2Y2 and A3 receptors. Science 314, 1792-1795.  Chimini, G. and Chavier, P. (2000). Function of Rho family proteins in actin dynamics during phagocytosis and engulfment. Nat Cell Biol. 2, E191-196.  Choi, K. (2012). The role of connexin 43 in B cell receptor signaling and the high throuput screen for novel B cell receptor signaling inhibitors. MSc thesis, UBC Vancouver.  Christian, S. L., Lee, R. L., McLeod, S. J., Burgess, A. E., Li, A. H. Y., Dang-Lawson, M., Lin, K. B. L., and Gold, M. R. (2003). Activation of the Rap GTPase in B Lymphocytes modulates B cell antigen receptor-induced activation of Akt but has no effect on MAPK activation. J. Biol Chem. 278, 41756-41767.   Cina, C., (2010). The function of connexin 43 in neural migration and cortical development.  PhD Dissertation, UBC, Vancouver.   Cina, C., Maass, K., Theis, M., Willecke, K., Bechberger, J.F. and Naus, C. C. (2009). Involvement of the cytoplasmic C-terminal domain of connexin43 in neural migration. J Neurosci. 29, 2009-2021.  Conti, M. A. and Adelstein, R. S. (2008). Nonmuscle myosin II moves in new directions. J Cell Sci. 121, 11-18.   179   Cooper, C. D. and Lampe, P. D. (2002). Casein kinase 1 regulates connexin43 gap junction assembley. J Biol Chem. 277, 44962-44968.  Corley, R. B. (2005). A guide to methods in the biomedical sciences. Springer p. New York.  Cottrel, G. T., Lin, R., Warn-Cramer, B. J., Lau, A. F. and Burt, J. M. (2003). Mechanism of v-Src- and mitogen-activated protein kinase-induced reduction of gap junction communication. Am J Physiol Cell Physiol. 284, C511-520.  Crespin, S., Bechberger, J., Mensil, M., Naus, C.C. and Sin, W-C. (2010). The carboxy-terminal tail of Connexin43 Gap Junction protein is sufficient to mediate cytoskeletal changes in human Glioma cells. J Cell Biochem. 110, 589- 597.  Critchley, D. R. (2009). Biochemical and structural properties of integrin-associated cytoskeletal protein Talin. Annu Rev Biophys. 38, 235-254.  Critchley, D. R., Holt, M. R., Barry, S. T., Priddle, H., Hemmings, L. and Norman, J. (1999). Integrin-mediated cell adhesion: the cytoskeleton connection. Biochem Soc Symp. 65, 79-99.  Dallas, S. L., Garrett, I. R., Oyayobi, B. O., Dallas, M. R., Boyce, B. F., Bauss, F., Radl, J. and Mundy, G. R. (1999). Ibandronate reduces osteolytic lesions but not tumour burden in a murine model of myeloma bone disease. Blood 93, 1697-1706.  Daniel, E., Thomas, J., Ramnarian, M., Bowes, T. and Jury, J. (2001). Do gap junctions couple interstitial cells of cajal pacing and neurotransmission to gastrointestinal smooth muscle? Neurogastroenterol Motil. 13, 297-307.  Danik, S. B., Lin, F., Zhang, J., Suk, H. J., Morley, G. E., Fishman, G. I. and Gutstein, D. E. (2004). Modulation of cardiac gap junction expression and arrhythmic susceptibility. Circ Res. 95, 1035-1041.   Das, S., Smith, T. D., Sarma, J. D., Ritzenthaler, J. D., Maza, J.,  Kaplan, B. E., Cunningham, L. A., Suaud, L., Hubbard, M. J. and Rubenstein, R. C. (2009). ERp29 restrict connexin43 oligomerization in the endoplasmic reticulum. Mol Biol Cell. 20, 2593-2604.  Dbouk, H. A., Mroue, R. M., El-Sabban, M. E. and Talhouk, R. S. (2009). Connexins: a myriad of functions extending beyond assembly of gap junction channels. Cell Commun Signal. 7:4.   180   Defranco, A. L., Richaards, J. D., Blum, J. H., Stevens, T. L. Law, D. A., Chan, V.W. F., Datta, S. K., Foy, S. P., Hourihane, S. L., Gold, M. R. and Matsuuchi, L. (2006). Signal transduction by the B-cell antigen receptor.  Ann NY Acad Sci. 766, 195-201.  Depoil, D. Fleire, S., Treanor, B. L., Weber, M., Harwood, N.E., Marchbank, K. L., Tybulewicz, V. L. and Batista, F. D. (2008). CD19 is essential for B cell activation by promoting B cell receptor-antigen microcluster formation in response to membrane-bound ligand. Nat Immunol. 9, 63-71.  Diakonova, M., Bokoch, G. and Swason, J. A. (2002). Dynamics of sytoskeletal proteins during FCγ receptor-mediated phagocytosis. Mol. Biol. Cell. 13, 402-422.  Doble, B. W., Dang, X., Ping, P., Fundrich, R. P., Nickel, B. E., Jin, Y., Cattini, P. A. and Kardami, E. (2004). Phsophorylation of serine 262 in the gap junction protein connexin-43 regulates DNA synthesis in cell-cell contact forming cardiomyocytes. J Cell Sci. 117, 507-514.  Dobrowolski, R. and Willecke, K. (2009). Connexin-caused genetic diseases and corresponding mouse models. Antioxid Redox Signaling. 11, 283-295.  Duffy, H. S., Ashton, A. W., O’Donnell, P., Coombs, W., Taffet, S. M., Delmar, M. and Spray, D. C. (2004). Regulation of connexin43 protein complex by intracellular acidification. Cir Res. 94, 215-222.  Duffy, H. S., Sorgen, P. L., Girvin, P., O’Donnell, P., Coombs, W., Taffet, M., Delmar, M. and Spray, D. C. (2002). pH-dependent intramolecular binding and structure involving Cx43 cytoplasmic domains. J Biol Chem. 277, 36706-306714.  Durand, C. A., Westendorf, J., Tse, K.W.K. and Gold, M. R (2006). The Rap GTPases mediate CXCL-13- and sphingosine1- phosphate-induced chemotaxis, adhesion and Pyk2 tyrosine phosphorylation in B Lymphocytes. Eur. J. Immunol. 36, 2235-2249.   Dylke, J., Lopes, J., Dang-Lawson, M., Machtaler, S. and Matssuchi, L. (2007). Role of the extracellular and transmembrane domain of Igα/β in assembly of the B cell antigen receptor (BCR). Immunol. Lett.112, 47-57.   Ek-Vitron, J. F., King, T. J., Heyman, N. S., Lampe, P. D. and Burt, J. M. (2006). Selectivity of connexin 43 channels is regulated through protein kinase C-dependent phosphorylation. Circ Res. 98, 1498-1505.  Elias, L. A., Wang, D. D. and Kriegstein A. R. (2007). Gap junction adhesion is necessary for radial migration in neocortex. Nature. 488, 901-907.  181       Ensenat, D., Yao, Z., Wang, X. S., Kori, R., Zhou, G., Lee, S. C. and Tan, T. (1999). A novel Src homology 3 domain-containing adaptor protein, HIP-55, that interacts with hematopoietic progenitor kinase1. J Biol Chem. 274, 33945-33950.       Evans, W. H. and Marin, P. E. M. (2002). Gap junctions: structure and function (review). Mol Member Biol. 19, 121-136.  Evans, R., Patzak, I., Svensson, L., De Filippo, K., Jones, K., McDowall, A. and Hogg, W. (2009). Integrins in Immunity. J Cell Sci. 122, 215-225.  Falk, L. (2013). The contribution of different domains of connexin 43 to cytoskeletal rearrangements in B-lymphocytes. MSc thesis, UBC, Vancouver.   Falk, L., Dang-Lawson, M., Vega, J. L., Pournia, F., Choi, K., Jang, C., Naus, C.C. and Matsuuchi, L. (2014). Mutations of Cx43 that affect B Cell spreading in response to BCR Signalling. Biology Open 3, 1-7.  Fanning, A. S., Little, B. P., Rahner, C., Utepbergenov, D., Walter, Z. and Anderson, J. M. (2007). The uique-5 and -6 motifs of ZO-1 regulate tight junction strand localization and scaffolding properties. Mol. Biol. Cell. 18, 721-731.  Fazilleau, N. L., McHeyzer-Williams, L. J., Rosen, H. and McHeyzer-Williams, M. G. (2009). The function of follicular helper T cells is regulated by the strength of the T cell antigen receptor binding . Nat Immunol. 10, 375-384.  Finn, O. J. (2012). Immuno-oncology: understanding the function and dysfunction of the immune system in cancer. Ann Oncol. 23 (supp8) viii6-viii9.   Fleire, S. J., Goldman, J. P., Carrasco, Y. R., Weber, M., Bray, D. and Batista, F. D. (2006). B cell ligand discrimination through a spreading and contraction response. Science. 312, 738-741.  Foote, C. I., Zhou, L., Zhu, X. and Nicholson. (1998). The pattern of disulfide linkages in the extracellular loop regions of connexin32 suggests a model for the docking interface of gap junctions. J Cell Biol. 140, 1187-1197.  Freeman, S. A., Jaumouillé, V., Choi, K., Hsu, B. E., Wong, H. S., Abraham, L., Graves, M. L. Coombs, D., Roskelley, C. D., Das, R., Grinstein, S. and Gold, M. R. (2015). Toll-like receptor ligands sensitize B-cell receptor signaling by reducing actin-dependent spatial confinement of the receptor. Nat Commun. 6, 6168.   182   Freeman, S. A., Lei, V., Dang-Lawson, M., Mizuno, K., Roskelley, C. D. and Gold, M. R. (2011). Cofilin-mediated F-actin severing is regulated by the Rap GTPase and controls the cytoskeletal dynamics that drive lymphocyte spreading and BCR microcluster formation. J Immunol. 187, 5887-5900.  Freeman, S. A., McLeod, S. J., dukowski, J., Austin, P., Lee, C. C., Millen-Martin, B., Kubes, P., McCafferty, D. M., Gold, M. R. and Roskelley, C. D. (2010). Prevention the activation or cycling of Rap1GTPase alters adhesion and cytoskeletal dynamics and blocks metastatic melanoma cell extravasation into lungs. Cancer Res. 70, 4590-4601.  Fu, C. T., Bechberger, J. F., Ozog, M. A., Bernard, P. and Naus, C. C. (2004). CCN3(NOV) interacts with connexin43 in C6 glioma cells. J. Biol. Chem. 279, 36943-36950.   Fushinki, S., Perez Velazquez, J., Zhang, L., Bechberger, J. F., Carlen P. L. and Naus, C. C. (2003). Changes in neural migration in neocortex of connexin43 null mutant mice. Neuropathol. Exp. Neurol. 62, 304-314.  Galipeau, J., Li, H., Paquin, A., Sicilia, F., Karpati, G. and Nalbantoglu, J. (1999).  Vesicular stomatitis virus G pseudotyped retrovector mediates effective in vivo suicide gene delivery in experimental brain cancer. Cancer Res. 59, 2384-2394.  Gao, G. and Jakobsen, B. (2000). Molecoular interaction of co-receptor CD8 and MHC ClassI: the molecular basis for functional coordination with the T cell receptor. Immunol today 21(12), 630-6.  Gatto, D. and Brink, R. (2010). The germinal center reaction. J. Allergy Clin Immunol. 125, 898-907.  Gauld, S. B., Blair, D., Moss, C. A., Reid, S.D. and Harnett, M. M. (2002). Differential roles for extracellulart regulated kinase-mitogen-activated protein kinase in B cell antigen receptor-induced apoptosis and CD40-mediated rescue of WEHI-231 immature B cells. J Immunol. 168, 3855-3864.  Geier, J. K. and Schilssel, M. S. (2006). Pre-BCR signaling and control of Ig gene rearrangements. Semin Immunol. 18, 31-39.   Geiberger, R., Lamers, M. and Achatz, G. (2006). The riddle of the dual expression of IgM and IgD. Immunology. 18, 427-439.  Gemal, J., Lin, X., Collins, R., Veenstra, R. D. and Beyer, E.C. (2008). Cx30.2 can from heteromeric gap junction channels with other cardiac connexins. Biochem Biophys Res. 369, 388-394.  183   Gerard, A., Mertens, A. E. E., van der Kerman, R. A. and Collard, J. G. (2007). The par polarity complex regulates Rap1- and chemokine-induced T cell polarization. J Cell Biol. 176, 863-875.  Giepmans, B. N. (2004). Gap junctions and connexin-interacting proteins. Cardiovasc Res. 62, 233-245.  Giepmans, B. and Moolenaar, W. (1998). The gap junction protein connexin43 interacts with second PDZ domain of the zona occludens-1 protein. Curr Biol. 8, 931-934.  Giepmans, B. N., Hengeveld, T., Postma, F. R. and Moolenaar, W. H. (2001a). Interaction of c-Src with gap junction protein connexin43. Role in the regulation of cell-cell communication. J Biol Chem. 276, 8544-8549.  Giepmans, B. N., Verlaan, I., Hengeveld, T., Janssen, H., Calafat, J., Falk, M. M. and Moolenaar, W. H. (2001b). Gap junction protein connexin-43 interacts directly with microtubules. Curr Biol. 11, 1364-1368.  Giepmans, B. N., Verlaan, I. and Mooleanaar, W. H. (2001c). Connexin-43 interactions with ZO-1 and alpha and beta tubulin. Cell Commun Adhes. 8, 219-223.  Ginsberg, M. H. (2006). Reconstructing and deconstructing agonist-induced activation of integrin αIIb and β3. Curr Biol.16, 1796-1806.  Girao, H., Catarino, S. and Pereira, P. (2009). EPs15 interacts with the ubiquitinated Cx43 and mediate its internalization. Exp Cell Res. 315, 3587-3597.  Gold, M. R. (2002). To make antibodies or not: signaling by the B-cell antigen receptor. Trends Pharmacol Sci. 23, 316-324.  Gold, M. R. and Matsuuchi, L. (1995). Signal transduction by the antigen receptors of B and T lymphocytes. Int Rev Cytol. 157, 181-276.  Gold, M. R., Ingham, R. J., McLeod, S. J., Christian, S. L., Scheid, M .P., Duronio, V., Santos, L. and Matsuuchi, L. (2000). Targets of B-cell antigen receptor signaling:the phosphatidylinositol 3-kinase/Akt/glucogen synthesis kinase-3 signaling pathway and the Rap1GTPase. Immunol Rev. 176, 47-68.  Gold, M. R., Law, D. A. and DeFranco, A. L. (1990). Stimulation of protein tyrosine phosphorylation by the B-lymphocytes antigen receptor. Nature. 345, 810-813.  Goldberg, G. S., Valiuans, V. and Brink, P. R. (2004). Selective permeability of gap junction channels. Biochim Biophys Acta. 1662, 96-101.  184   Gomez, T. S., McCarney, S. D., Carrizosa, E., Labno, C. M., Comiskey, E. O., Noiz, J. C., Zhu, P., Freedman, B. D., Clark, M. R., Rawlings, D. J., Billadeau, D. D. and Burkhardt, J. K. (2006). HS1 functions as an essential Actin-regulatory adaptor protein at the IS. Immunity. 24, 741-752.  Gong, X. Q., Shao, Q., Langlois, S., Bai, D. and Laird, D. W. (2007). Differential potency of dominant negative connexin43 mutants in oculodentodigital dysplasia. J Biol Chem. 282, 19190-19202.    Gong, X. Q., Shao, Q., Lounsburg, C. S., Bai, D. and Laird, D. W. (2006). Functional characterization of a GJA1 frame-shift mutation causing oculodentodigital dysplasia and keratodermas. J Biol Chem. 281, 19190-19202.  Goodenough, D. A. and Paul, D. L. (2003). Beyond the gap: functions of unpaired connexon channels. Nat Rev Mol Cell Biol. 4, 285-295.  Goodenough, D. A. and Paul, D. L. (2009). Gap junctions. Cold Spring Harb Perspect Biol. 1:a002576.  Green, M. R. and Sambrook, J. (2012). Molecular cloning : a laboratory manual. 4th ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.   Gudmundsson, G. H. and Agerberth, B. (1999). Neutrophil antimicrobial peptides multifunctional effector molecules in the mammalian immune system. J Immunol Methods. 232, 45-54.  Gülistan, M., Gabriele, R. and White, T. W. (2007). Gap junctions: basic structure and function. J Invest, Dermatol. 127, 2516-2524.  Gunn, M. D., Ngo, V. N., Ansel, K. M., Ekland, E. H., Cyster, J. G. and Williams, L. T. (1988). A b-cell-homing chemokine made in lymphoid follicles activates Burkitt’s lymphoma receptor-1. Nature. 391, 799-803.  Han, J., Lim, C., J., Watanabe, N., Soriani, A., Ratnikov, B., Calderwood, D. A., Puzon-McLaughlin, W., Lafuente, E. M., Boussiotis, V. A., Shattil, S. J. and  Hardy, R. R. and Hayyakawa, K. (2001). B cell development pathways. Annu Rev Immunol. 19, 595-621.  Han, J., Shui, J. W., Zhang, X., Zheng, B., Han, S. and Tan, T. H. (2005). HIP-55 is important for T-cell proliferation, cytokine production and immune responses. Mol Cell Biol. 25, 6869-6878.  Hanissian, S. H. and Geha, R. S. (1997). Jack3 is associated with CD40 and is critical for CD40 induction of gene expression in B cells. Immunity. 4, 397-387. 185   Hao, J. J., Zhu, J., Zhou, K., Smith., N. and Zhzn, X. The coiled-coil domain is required for HS1 to bind to F-actin and activate Arp2/3 comples (2005). JBC 280, 37988-37994.  Hardsock, A. and Nelson, W. J. (2008). Adherens and tight junctions: structure, function and connections to the actin cytoskeleton. Biochim Biophys Acta. 1778, 660-669.  Hardy, R. R., Kincade, P.W. and Dorshkind, K. (2007). The protean nature of cells in the B lymphocyte lineage. Immunity. 26, 703-714.  Haris, A. L. (2001). Emerging issues of connexin channels: biophysics fill the gap. Q Rev Biophys. 34, 325-472.   Harwood, N. E. and Batista, F. D. (2008). New insight into the early molecular events underlying B cell activation. Immunity. 28, 608-619.  Harwood, N. E. and Batista, F. D. (2009). Early events in B cell activation. Annu Rev Immunol. 28, 185-210.  Harwood, N. E. and Batista, F. D. (2010). The cytoskeleton coordinates the early events of B-cell activation. Cold Spring Harb Prespect  Biol.  Healy, J. L., Dolmetsch, R. E., Timmerman, L. A., Cyster, J. G., Thomas, M. L., Crabtree, G. R., Lewis, R. S. and Goodnow, C. C. (1997). Different nuclear signals are activated by the B cell receptor during positive versus negative selection. Immunity. 6, 419-428.  Hermason, G. G., Eisenberg, D., Kincade, P.W. and Wall, R. (1988). B29: A member of the immuneglobulin gene superfamilyexclusively expressed on B-lineage cells. Proc Natl Acad Sci U S A. 85, 6890-6894.  Herve, J. C., Bourmeyster, N., Sarrouile, D. and Duffy, H.S. (2007). Gap junctional complexes: from partners to functions. Prog Biophys Mol Biol. 94, 29-65.  Hobeika, E., Thiemann, S., Storch, B., Jumma, H., Nielsen, P., Pelanda, R. and Reth, M. (2006).Testing gene function early in the B cell lineage in mb-1cre mice. Proc Natl Acad Sci U S A. 103,13789-13794.  Hombach, J., Leclercq, L., Radbruch, A., Rajewsky, K. and Reth, M. (1988). A novel 34-kd protein co-isolated with the IgM molecule in surface IgM expressing cells. EBMO. 7, 3451-3456.  186  Hombach, J., Lottspeich, F. and Reth, M. (1990a). Identification of the genes encoding the IgM-alpha and Ig-beta components of the IgM antigen receptor complex by amino-terminal sequencing. Eur J Immonol. 20, 2795-2799.  Hombach, J., Tsubata, T., Leclercq, L., Stappert, H. and Reth, M (1990b). Molecular components of the B-cell antigen receptor complex of the IgM class. Nature, 343, 760-762.  Huang, G. Y., Cooper, E. S., Waldo, K., Kirby, M. L., Gilula, N. B. and Lo, C. W. (1998). Gap junction mediated cell-cell communication modulated mouse neural crest migration. J Cell Biol. 143, 1725-1734.  Huang, T., Shao, Q., MacDonald, A., Xin, L., Lorentz, R., Bai, D. and Laird, D. W. (2013). Autosomal recessive GJA1 (Cx43) gene mutations cause oculodentodigital dysplasia by distinct mechanism. J Cell Sci. 126, 2857-2866.  Hunter, A. W., Jourdan, J. and Gourdie, R. G. (2003). Fusion of GFP to the carboxyl terminus of connexin43 increases gap junction size in HeLa cells. Cell Commun Adh. 10, 211-214.  Huston, M. R. and Kirby, M. L. (2003). Neural crests and cardiovascular development: a 20-year perspective. Birth Defects Res C Embryo Today. 69, 2-13.  Iacobas, D. A., Urban-Maldonado, M., Iacobas, S., Scemes, E. and Spray, D. C. (2003). Array analysis of gene expression in connexin-43 null astrocytes. Physiol Genomics. 15, 177-190.   Imanaga, I., Hai, L., Ogeawa, K., Matsumura, K. and Mayama, T. (2004). Phosphorylation of connexin in functional regulation of the cardiac gap junction. Exp Clin cardiol. 9, 161-164.  Jabara, H. H., Buckley, R. H., Roberts, J. L., Lefranc, G., Loiselet, J., Khalil, J. and Geha, S. (1998). Role of JAK3 in CD40-mediated signaling. Blood 92, 2435-2440.   Janeway, C. A. Jr. and Medshitov, R. (2002). Innate immune recognition. Annu Rev Immunol. 20, 197-216.  Jara, P. I., Boric, M. P. and Saez, J. C. (1995). Leukocytes express connexin 43 after activation with lipopolysaccharide and appear to form gap junctions with endothelial cells after ischemic-reperfusion. Proc Natl Acad Sci U S A. 92, 7011-7015.  Jordan, K., Chodock, R., Hand, A. R. and Laird, D. W. (2001). The origin of annular junctions: a mechanism of gap junction internalization. J Cell Sci. 114, 763-773.  187  Justement, L. B., Wienands, J., Hombach, J., Reth, M. and Cambier, J. C. (1990). Membrane IgM and IgD molecoules fail to transduce Ca2+ mobilizing signals when expressed on differentiated B lineage cells. J. Immunol. 144, 3732-3280.  Kameritsch, P., Pogoda, K. and Pohl, U. (2012). Channel-independent influence of connexin 43 on cell migration. Biochim Biophys Acta. 1818, 1993-2001.  Kanemitsu, M. Y. and Lau, A. F. (1993). Epidermal growth factor stimulates the disruption of gap junctional communication and Connexin43 phosphorylation independent of 12-O-tetradecanoylphorbol 13-acetate- sensitive protein kinase C: the possible involvement of mitogen-activated protein kinase. Mol Biol Cell. 4, 837-848.  Kanemitsu, M. Y., Jiang, W. and Eckhart, W. (1998). Cdc2-mediated phosphorylation of the gap junction protein connexin43, during mitosis. Cell Growth Differ. 9,13-21.   Kanemitsu, M. Y., Lenora, W. M., Simon, L. S., Lau, A. F. and Eckhart, W. (1997). Tyrosine phosphorylation of Connexin 43 by V-Src is mediated by SH2 and SH3 domain interactions. J Biol Chem. 272, 22824-22831.  Karen, Z. and Melamed, D. (2005).Antigen receptor signaling competence and determination of B cell fate in B-lymphopoiesis. Histol Histopathol. 20, 187-196.  Katarigi, K., Imamura, M. and Kinashi, T. (2006). Spatiotemporal regulation of the kinase Mst1 by binding protein RAPL is critical for lymphocyte polarity and adhesion. Nat Immunol. 7, 919-928.  Katagiri, K., Maeda, A., Shimonaka, M. and Kinashi, T. (2003). RAPL, a Rap1-binding molecule that mediates Rap1-induced adhesion through spatial regulation of LFA-1. Nat Immunol. 7, 741-748.   Kehry, M., Ewald, S., Douglas, R., Sibley, C., Raschke, W., Fambrough, D. and Hood, L. (1980). The immunoglobulin μ chains of membrane-bound and secreted IgM molecules differ in their C-terminal segments. Cell. 21, 393-406.   Kirby, M. L. and Waldo, K. L. (1995). Neural crest and cardiovascular patterning. Circ. Res. 77, 211-215.  Kitamura, D., Kaneko, H. Miyagoe, Y. Ariyasu, T. and Watanabe, T. (1989). Isolation and characterization of a novel human gene expressed specifically in the cells of hematopoetic lineage. Nucleic Acids Res. 17, 9367-9379.  Kobayashi, M., Fukuda, M. and Nakayama, J. (2009). Role of sulfated O-glycans expressed by high endothelial venule-like vessels in pathogenesis of chronic inflammatory gastrointestinal diseases. Biol Pharm Bull. 32, 774-779.  188  Koncz, G., Bodor, C., Kovesdi, D., Gati, R. and Sarmy, G. (2002). BCR mediated signal transduction in imaature and mature B cells. Immunol Lett. 82, 41-49.  Krause, M. and Gautreau, A. (2014). Streeing cell migration: lamellipodium dynamics and regulation of directional. Nat Rev Mol Cell Biol. 15, 577-590. Krause, M. Dent, E. W., Bear, J. E., Loureiro, J. J. and Gertler, F. B. (2003). ENA/VASP proteins: regulators of the actin cytoskeleton and cell migration. Annu Rev Cell Dev Biol. 19, 541-564.   Krebs, D. L., Yang, Y., Dang, M., Haussmann, J. and Gold, M. R. (1999). Rapid and efficient retrovirus-mediated gene transfer into B cell lines. Method. Cell Sci. 21, 57-68.  Krenacs, T. and Rosendaal, M. (1995). Immunohistological detection of gap junctions in human lymphoid tissue: connexin 43 in follicular dendiritic and lymphoendothelial cells. J Histochem Cytochem. 11, 1125-1137.  Krenacs, T., van Dartel, M., Lindhout, E. and Rosendaal, M.  (1998). Direct cell/cell communication in the lymphoid germinal center: connexin43 gap junctions functionally couple follicular dendritic cells to each other and to B lymphocytes. Eur J Immunol. 27, 1489-1497.  Kunkel, E. J. and Butcher, E. C. (2003). Plasma-cell homing. Nat Rev Immunol. 10, 822-829.  Kurosaki, T. (2002). Regulation of B-cell signal transduction and fate decision. Auu Rev Immunol. 28, 21-25.  Kurosaki, T., Shinohara, H. and Baba, Y. (2010). B cell signaling and fate decision. Annu Rev Immunol. 28, 21-55.  Kwak, B. R., Mulhaupt, F., Veillard, N., Gros, D. B. and Mach, F. (2002). Alerted pattern of vascular connexin expression in atherosclerotic plaques, Arterioscler. Thromb. Vasc. Biol. 22, 225-230.     Lafuente, E. M., van Puijenbroek, A. A. F. L., Krause, M., Carman, C. V., Freeman, G. J., Berezovskaya, A., Constantine, E., Springer, T. A., Gertler, T. A. and Boussiotis, V. A. (2004). Riam an Ena/VASP and profiling ligand, interacts with Rap1-GTP and mediate Rap1-induced adhesion. Dev Cell. 7, 585-595.  Lai, F. P., Szczodrak, M., Oelkers, J. M., Ladwein, M., Acconica, F., Benesch, S., Auinger, S., Faix, J., Small, J. V., Polo, S., Stradal, T. E. and Rottner, K. (2009). Cortactin promotes migration and platlet-drived growth factor-induced actin reorganization by signaling to Rho-GTPases. Mol Biol Cell. 20, 3209-3223.  189  Laing, J. C. and Beyer, E. C. (1995). The gap junction protein connexin43 is degraded by the ubiquitin-proteasome pathway. J Biol Chem. 270, 26399-26403.  Laird, D. W. (2005). Connexin phosphorylation as a regulatory event linked to gap junction internalization and degradation. Biochim Biophys Acta. 1711, 172-182.  Laird, D. W. (2006). Life cycle of connexins in health and disease. Biochem J. 394, 527-543.  Laird, D. W. (2008). Closing the gap on autosomal dominant connexin-26 and connexin-43 mutants linked to human disease. J Biol Chem. 283, 2997-3001.  Laird, D. W. (2010). The gap junction proteome and its relationship to disease. Trends Cell Biol. 20, 92-101.  Laird, D. W. (2014). Syndromic and non-syndromic disease-linked Cx43 mutations. FEBS Lett. 588, 1339-1348.  Laird, D. W., Puranum, K. L. and Revel, J. P. (1991). Turnover and phosphorylation dynamics of connexin43 gap junction protein in cultured cardiac myocytes. Biochem J. 296, 503-507.  Lampe, P. D. and Lau, A. F. (2000). Regulation of gap junctions by phosphorylation of connexins. Arch Biochem Biophys. 384, 205-215.  Lampe, P. D. and Lau, A. F. (2004). The effects of connexin phosphorylation on gap junctional communication. Int J Biochem Cell Biol. 36, 1171-1186.  Lampe, P. D., TenBroek, E. M., Burt, J. M., Kurata, W. E., Johnson, R. G. and Lau, A. F. (2000). Phosphorylation of connexin43 on serine368 by protein kinase C regulates gap junctional communication. J Cell Biol. 126, 1503-1512.  Lampe, P. D., Cooper, C. D., King, T. J. and Burt, J. M. (2006). Analysis of connexin43 phosphorylated at S325, S328 and S330 in normix and ischemic heart. J cell Sci. 119, 3435-3442.   Langlois, S., Cowan, K. N., Shao, Q., Cowan, B. J. and Laird, D. W. (2008). Caveolin-1 and -2 interact with connexin43 and regulate gap junction intercellular communication in Keratinocytes. Mol. Biol. Cell. 19, 912-928.  Langman, R. E.  and Cohn, M. (1995). The propotion of B-cell subsets expressin [kappa] and [lambda] light chains changes following antigenic selection. Immunol Today. 16, 141-144.   190  Lanker, D. H., Vincent-Schneider, V., Briken, T., Yokozeki, G., Raposo, G. and Bonnerot., C. (2002). Dynamics of major histocompatibility complex class II compartments during B cell receptor-mediated cell activation. J. Exp. Med. 195, 461-472.  Larbolette, O., Wollscheid, B., Scheweikert, J., Nielsen, P. J. and Wienands, J. (1999). SH3P7 is a cytoskeleton adaptor protein and is coupled to signal transduction from lymphocyte antigen receptors. Mol Cell Biol. 19, 1539-1564.  Lau, A. F., Kurata, W. E., Kanemitsu, M., Y., Loo, L. W., Warn-Cramer, nB. J., Eckhart, W. and Lampe, P.D (1996). Regulation of connexin43 function by activated tyrosine protein kinases. J. Bioenerg Biomember. 4, 359-368.  Lauf, U., Giepmans, B. N., Lopez, P., Bracnnot, S., Chen, S. C. and Falk, M. M. (2002). Proc Natl Acad Sci USA. 99, 10446-10451.   Lawrence, T. S. Beers, W. H. and Gilulu, T. B. (1978). Transmission of hormonal stimulation by cell-to-cell communication. Nature. 272, 501-506.   Leahy, D. J., Axel, R. and Hendrickson, W. A. (1992). Crystal structure of a soluble form of the human T Cell co-receptor CD8 at 2.6 resolution. Cell 68(6), 1145-62.   LeBien, T. W. (1988). B–cell lymphopoiesis in mouse and human. Curr Opin in Immunol. 10, 188-195.  LeBien, T. W. and Tedder, T. F. (2008). B Lymphocytes: how they develop and function. Blood. 112, 1570-1580.  Le Bras, S., Foucault, I., Foussat, A., Brignone, C., Acuto, O. and Deckert, M. (2004). Recruitment of actin-binding protein HIP55 to the immunological synapse regulates T cell receptoe signaling and endocytosis. J. Biol Chem 279, 15550-15560.   Lehrer, R. I. and Ganz, T. (2002). Cathelicidins: a family of endogenous antimicrobial peptides. Curr Opin Hematol 9, 18-22  Leithe, E., Cruciani, V., Sanner, T., Mikalsen, S. O. and Rivedal, E. (2003). Recovery of gap junctional intercellular communication after phorbol ester treatment requires proteasomal degradation of protein kinase C. Carcinogenesis. 24, 1239-1245.   Leithe, E. Kjenseth, A., Sirnes, S., Stenmark, H., Brech, A. and Rivedal, E. (2009). Ubiquitylation of gap junction protein connexin-43 signal its trafficking from early endosomes to lysosomes in a process mediated by Hrs and Tsg101. J Cell Sci. 122, 3883-3893.  191  Leykauf, K., Salek, M., Bomke, J., Frech, M., Lehmann, W. D., Durst, M. and Alouso, A. (2006). Ubiquitin protein ligase Nedd4 binds to connexin43 by a phosphorylation-modulated process. J cell Sci. 119, 3634-3642.    Li, W., Hertzberg, E. L. and Spray, D. C. (2005). Regulation of connexin43-protein binding in astrocytes in response to chemichal ischemia/hypoxia. J Biol Chem. 280, 7941-7948.  Li, H., Spagnol, G., Naslavsky, N., Caplan, S., and Sorgen, P.L. (2014). TC-PTP directly interacts with connexin43 to regulate gap junction intercellular communication. J. Cell Sci. 127, 3269-3279.  Li, W. E., Waldo, K., Linask, K. L., Chen, T., Wessels, A., Parmacek, M. S., Kirby, M. L. and Lo, C. W. (2002). An essential role for connexin43 gap junctions in mouse artery development. Development. 129, 2031-2042.  Liao, Y., Day, K., Damon, D. and Duling, B. (2001). Endothelial cell-specific knockout of connexin 43 causes hypotension and bradycardia in mice. Proc Natl Acad Sci U S A. 98, 9989-9994.  Lin, K. B., Tan, P., Freeman,S. A. and Gold, M. R. (2010). Rap GTPase-mediated adhesion and migration: a target for limiting the dissemination of B-cell lymphomas? Cell Adh Migr. 4, 327-332.  Lin, K. B., Tan, P., Freeman, S. A., Lam, M., McNagny, K. and Gold M.R. (2009). The Rap GTPases regulate the migration, invasiveness and in vivo dissemination of B-cell lymphomas. Oncogene. 29, 608-615.  Lin, K. B, Freeman, S. A., Zabetian, S.,  Brugger, H., Weber, M., Lei, V., Dang-Lawson, M., Tse, K. V., Santamaria, R., Batista, F. D. and Gold, M. R. (2008). Rap1 regulates B cell morphology, immune synapse formation and signaling by particulate B cell receptor ligands.  Immunity 28, 75-87.  Lin, R., Warn-Craner, B. J., Kurata, W. E. and Lau, A. F. (2001). V-Src phosphorylation of connexin43 on Tyr247 and Tyr265 disturbs gap junctional communication. J Cell Biol. 154, 815-827.  Lo, C. G., Lu, T. T. and Cyster, J. G. (2003). Integrin-dependence of lymphocyte entry into the splenic white pulp. J Exp Med. 197, 352-361.  Lorentz, R., Shao, Q., Huang, T., Fishman, G. I. and Laird, D. W. (2012). Charactrization of gap junction proteins in the bladder of Cx43 mutant mouse models of oculodentodigital dysplasia. J Member Biol. 245, 345-355.  192  Luo, B. H., Carman, C. V. and Springer, T. A. (2007). Structural basis of integrin regulation and signaling. Annu Rev Immunol. 25, 619-647.   Maas, K., Ghanem, A., Kim, J. S., Saathoff, M., Urschel, S., Kirfel, G., Grummer, R., Kretz, M., Lewalter, T., Tiemann, K., Winterhager, E., Herzog, V. and Willecke, K. (2004). Defective epidermal barrier in neonatal mice lacking the C-terminal region of connexin43. Mol Biol Cell. 15,4597-4608.  Machtaler, S. (2012). The role of BCR signaling and the gap junction protein Cx43 in B Lymphocyte cytoskeletal rearrangements. PhD Dissertation, UBC, Vancouver.   Machtaler, S., Choi, K., Dang-Lawson, M., Falk, L., Pournia, F., Naus, C.C. and Matsuuchi, L. (2014). The role of gap junction forming protein Connexin43 in B Lymphocyte motility and migration. FEBS Lett. 588, 1249-1258.   Machtaler, S., Dang-Lawson, M., Choi, K., Jang, C. Naus, C. C. and Matsuuchi, L. (2011). The gap junction protein connexin43 regulates B-Lymphocyte spreading and adhesion. J Cell Sci. 124, 2611-2621.  Majoul, I., Shirao, T., Sekino, Y. and Duden, R. (2007). Many faces of drebrin: from building dendritic spines to shaping neurite-like cell processes. Histochem Cell Biol. 127, 355-361.    Mao, A. J., Bechberger, J., Lidington, D., Galipeau, J., Laird, D. W. and Naus, C. C. (2000). Neuronal differentiation and growth control of neuro-2a cells after retroviral gene delivery of connexin43. J. Biol. Chem. 275, 34407-34414.   Marquez-Rosado, L., Solan, J. L., Dunn, C. A., Norris, R. P. and Lampe, P. D. (2012). Connexin43 phosphorylation in brain, cardiac, endothelial and epithelial tissues. Biochim. Biophys. Acta, 1818, 1985-1992. Martinez, A. D., Hayrapetyan, V., Moreno, A. P. and Beyer, E. C. (2002). Connexin43 and connexin 45 from heteromeric gap junction channels in which individual components determine permeability and regulation. Circ Res. 90, 1100-1107.   Matsue, H., Yao, J., Matsue, K., Nagasaka, A., Sugiyama, H., Aoki, R., Kitamura, M. and Shimada, S. (2006). Gap junction-mediated intercellular communication between dendritic cells (DCs) is required for effective activation of Dcs. J Immunol. 176, 181-190.   Matsuuchi, L. and Naus, C. C. (2013) Gap junction proteins on the move: Connexins, the cytoskeleton and migration. Biochim Biophys Acta. 1828, 94-104.   193  Matsuuchi, L., Gold, M. R., Travis, A., Grosschedl, R., DeFranco, A. L. and Kelly, R. B. (1992). The membrane IgM-associated proteins MB-1 and Ig-beta are sufficient to promote surface expression of partially functional B-cell antigen receptor in a nonlymphoid cell line. Proc Nat1 Acad Sci U S A. 89, 3404-3408.  McLachlan, E., Plante, I., Shao, Q., Tong, D., Kidder, G. M., Bernier, S. M. and Laird, D. W. (2008). ODDD-linked Cx43 mutants reduce endogenous Cx43 expression and function in osteoblasts and inhibit late stage differentiation. J Bone Miner Res. 23, 928-938.  McLeod, S. J., Ingham, R. J., Bos, J. L., Kurosaki, T. and Gold M. R. (1998). Activation of Rap1 GTPase by the B cell antigen receptor. J Biol Chem. 2731, 29218-29223.  McLeod, S. J., Li, A. H. Y., Lee, R. L., Burgess, A. E. and Gold M. R. (2002). The Rap GTPases regulate B cell migration towards the chemokine SDF-1 (CXCL12). Potential role for Rap2 in promoting B cell migration. J. Immunol. 169, 1365-1371. McLeod, S. J., Shum, A. J., Lee, R. L., Takei, F. and Gold, M. R. (2004). The Rap GTPase regulate integrin-mediated adhesion, cell spreading, actin polymerization and PyK2 tyrosine phosphorylation in B Lymphocytes. J Biol Chem 279, 12009-12019.    Medzhitov, R. (2007). Recognition of microorganism and activation of the the immune response. Nature. 449, 819-826.  Medzhitov, R. and Janeway, C. A. Jr. (2000). Innate immune recognition : mechanisims and pathways. Immunol Rev. 173, 89-97.  Medzhitov, R. and Janeway, C. A. Jr. (2002). Decoding the patterns of self and nonself by the innate immune system. Science. 296, 298-300.  Mendoza-Naranjo, A., Bouma, G., Pereda, C., Ramirez, M., Webb, K. F., Tittarelli, A., Lopez, M. N., Kalergis, A. M., Thrasher, A. J. and Becker, D. L. (2011). Functional gap junction accumulate at the immunological synapse and contribute to T cell activation. J Immunol. 187, 3121-3132.  Mendoza-Naranjo, A., Saez, D., Johansson, C., Raminez, M., Mandakovic, D., Pereda, C., Lopez, M. N., Kiessling, R., Saez, J. C. and Salazar-Onfary, L. (2007). Functional gap junctions facilitate melanoma antigen transfer and cross-presentation between human dendritic cells. J Immunol. 178, 6949-6957.  Millan, J., Cerny, J., Horejsi, V. and Alonsa, M. A. (1999). CD4 segregate into specific detergent resistant T-cell microdomains. Tissue Antigen 54, 33-40.  194  Montecino-Rodriguez, E., Leathers, H. and Dorshkind, K. (2000). Expression of connexin 43 (Cx43) is critical for normal hematopoiesis. Blood. 96, 917-924.  Moorby, C. D. (2000). A connexin 43 mutant lacking the carboxyl cytoplasmic domain inhibits both growth and motility of mouse 3T3 fibroblasts. Mol Carciong. 28, 23-30.  Morio, T., Hanissian, S. H., Bacharier, L. B., Teraoka, H., Nanoyama, S., Seki, M., Kondo, J. Nakano, H., Lee, S-K., Geha, R. and Yata, J-i. (1999). Ku in the cytoplasm associates with CD40 in human B cells and translocate into the nucleus following incubation with IL-4 and anti-CD40 mAB. Immunity 11(3), 339-348.  Murphy, K., Travers, D. and Walport, M. (2011). Janeway’s Immunobiology. Garland Science, Taylor and Francis Group, New York, NY.  Murray, S. A., Williams, S. Y., Dillard, C. Y., Narayanan, S. K. and McMaulery, J. (1997). Relationship of cytoskeletal elements to annular gap junction expression in human adrenal cortical tumor cells in culture. Exp Cell Res. 234, 398-344.  Musil, L.S. and Goodenough, D. A. (1991). Biochemical analysis of Cx43 intracellular transport, phosphorylation and assembly into gap junction plaques. J Cell Biol 115, 1357-74.  Musil, L. S. and Goodenough, D. A. (1993). Multisubunit assembly of an integral plasma membrane channel protein, gap junction connexin43, occurs after exit from the ER. Cell. 74, 1065-1077.   Musil, L. S., Cunningham, B. A. and Goodenough, D. A. (1990). Differential phosphorylation of the gap junction protein connexin43 in junctional communication-component and- deficient cell lines. J Cell Biol. 111, 2077-2088.  Musil, L. S., Le, A. C., VanSlyke, J. K. and Roberts, L. M. (2000). Regulation of connexin degradation as a mechanism to increase gap junction assembly and function. J Biol Chem. 275, 25207-25215.  Muzio, M., Scielzo, C., Frenquelli, M., Bachi, A., De Palma, M., Alessio, M., Ghia, P. and Caligaris-Cappio, F. (2007). HS1 complexes with cytoskeleton adapters in normal and malignant chronic lymphocytic leukemia B cells. Leukemia. 21, 2067-2070.  Nagasawa, T. (2006). Microenvironmental niches in the bone marrow required for B-cell development. Nat Rev Immunol. 6, 107-116.  Natkanski, E., Lee, W-Y., Mistry, B., Molloy, J. E. and Tolar.P (2013). B cells use mechanical energy to discriminate antigen affinities. Science 340, 1587-190.   195  Neijssen, J., Herberts, C., Drijfhout, J. W., Reits, E., Janssen, L. and Neefjes, J. (2005). Cross-presentation by intercellular peptide transfer through gap junctions. Nature. 434, 83-88.  Nicholson, B. J., Weber, D. A. Cao, F., Chang, H., Lampe, P. and Goldberg, G. (2000). The molecular basis of selective permeability of connexin is complex and includes both size and charge. Braz J Med Biol Res. 33, 369-378.  Niggli, V. and Rossy, J (2008). Ezrin/radexin/moesin: versatile controllers of signaling molecules and of cortical cytoskeleton. Int J Biochem Cell Biol. 40, 344-349.  Norris, R. P., Freudzon, M., Mehlmann, L. M., Cowan, A. E., Simon, A. M. Paul, D. L., Lampe, P. D. and Jaffe, L. A. (2008). Luteinizing hormone causes MAP kinase-dependent phosphorylation and closure of connexin43 gap junctions in mouse ovarian follicles : one of two paths to meiotic resumption. Development. 135, 3229-3238.   Nutt, S. L. and Kee, B. L. (2007). The transcriptional regulation of B cell lineage commitment. Immunity. 26, 715-725.  Okada, T. and Cyster, J. G. (2006).  B cell migration and interactions in the early phase of antibody reponses. Curr Opin Immunol. 18, 278-285.  Oliveira-Castro, G. M. and Barcinski, M. A. (1974). Calcium-induced uncoupling in communicating human lymphocytes. Biochim Biophys Acta. 352, 338-343.  Olk, S., Zoidi, G. and Dermitez, R. (2009). Connexins, Cell Motility ,and the Cytoskeleton. Cell Motil Cytoskeleton. 66, 1000-1016. Oracki, S. A., Walker, J. A., Hibbs, M. L., Corcoran, L. M. and Tarlinton, D. M. (2010). Plasma cell development and survival. Immunol Rev. 237, 140-159.  Otey, C. A. and Carpen, O. (2004). Alhpa-actinin revisited: a fresh look at an old player. Cell Motil Cytoskeleton. 58, 104-111.   Oviedo-Orta, E. and Evans, H. W. (2004) Gap junctions and connexin-mediated communication in the immune system. Biochim Biophys Acta. 1662, 102-112.  Oviedo-Orta, E., Hoy, T. and Evans, W. H. (2000). Intercellular communication in immune system: differential expression of connexin 40 and 43, and perturabation of gap junction channel functions in peripheral blood and tonsil human lymphocyte subpopulations. Immunology. 99, 578-590.  Oviedo-Orta, E., Gasque, P. and Evans, H. W. (2001). Immunoglobulin and cytokine expression in mixed lymphocyte cultures is reduced by disruption of gap junction intercellular communication, FASEB J. 15, 768-774. 196   Oyajobi, B. O., Franchin, G., Williams, P. J., Pulkrabek, D., Gupta, A., Munoz, S., Grubbs, B., Zhao, M., Chen, D., Sherry, B. and Mundy, G. R. (2003). Dual effects of macrophage inflammatory protein-1α on osteolysis tumor burden in the murine 5TGM1 model of myeloma bone disease. Blood 102, 311-319. Palatinus, J. A., Rhett, M. and Goudie, R. G. (2012). The connexin 43 carboxyl terminus and cardiac gap junction organization. Biochim Biophys Acta 1818, 1831-1843.  Paznekas, W. A., Karczeski, B., Vermeer, S., Lowry, R. B., Delatycki, M., Laurence, F., Kovisito, P. A., Van Maldergem, L., Boyadjiev, S. A. and Bodurtha, J. N. (2009). GJA1 mutations, variants, and connexin 43 dysfunction as it relates to oculodentodigital dysplasia phenotype. Hum Mutat. 30, 724-733.  Pear, W. S., Nolan, G. P., Scott, M. L. and Baltimore, D. (1993). Production of high-titer helper-free retroviruses by transient transfection. P Natl. Acad. Sci. 90, 8392-8396. Pieper, K., Grimbacher, B. and Eibel, H. (2013). B-cell biology and development. J Allergy Clin Immunol. 131, 959-971.  Pike, K. A. and Ratcliffe, M. J. H. (2002). Cell surface immuneglobulin  receptors in B cell development. Semin Immonol. 174, 2012-2020.   Pillai, S. and Cariappa, A. (2009). The follicular versus marginal zone B lymphocyte cell fate decision. Nat Rev Immunol. 9, 767-777.   Pillai, S., Cariappa, A. and Moran, S. T. (2004). Positive selection and lineage commitment during peripheral B-lymphocyte development. Immunol Rev. 197, 206-218. Piludu, M., Lantini, M. S., Cossu, M., Piras, M., Oppenheim, F. G., Helmerhorst, E. J., Siqueria, W. and Hand, A. R. (2006). Salivary histatins in human deep posterior lingual gland (of von Ebner). Arch Oral Biol. 51, 967-973.  Poelzing, S. and Rosenbaum, D. S. (2004). Connexin43 expression produces arrhythmia substrate in heart failure. Am J Physiol Heart Circ Physiol. 287, H1762-H1770.   Polacek, D., Bech, F., McKindey, J. F. and Davies, P. F. (1997). Connexin 43 gene expression in the rabbit aterial wall : effects of hypercholesterolemia, ballon injury and their combination. J. Vasc. Res. 34, 19-30.  197  Polacek, D., Lal, R., Volin, M. V. and Davies, P. F. (1993). Gap junctional communication between vascular cells-induction of connexin43 massenger RNA in macrophage foam cells of atherosclerotic lesions. Am J Pathol. 142, 593-606.  Presley, C. A., Lee, A. W., Kastl, B., Igbinosa, I., Yamada, Y., Fishmann, G. I., Gutstein, D. E. and Cancelas, J. A. (2005). Bone marrow connexin-43 expression is critical for hematopoietic regeneration after chemotherapy. Cell Commun Adhes. 12, 307-317.  Qin, H., Shao, Q., Igdoura, S. A., Alaoui-Jamali, M. A. and Laird, D. W. (2003). Lysosomal and proteasomal degredation play distinct role in the life cycle of Cx43 in gap junctional intercellular communication deficient- and –competent breast tumor cells. J Biol Chem. 278, 30005-30014.  Reaume, A., de Sousa, P., Kulkarni, S., Langille, B., Zhu, D., Davies, T., Juneja, S., Kidder, G. and Rossant, J. (1995). Cardiac malformation in neonatal mice lacking connexin43. Science. 267, 1831-1834.  Reth, M. (1989). Antigen receptor tail clue. Nature. 338, 383-384. Reth, M. (1992). Antigen receptors on B lymphocytes. Annu Rev Immunol. 10, 97-121.  Reth, M., Petrac, E., Wiese, P., Lobel, L. and Alt, F. W. (1987). Activation of Vx gene rearrangement in pre-B cells follow the expression of membrane-bound immunoglobulin heavy chains. EMBO. 6, 3299-3305.  Reynhourt, J. K., Lampe, P. D and Johnson, R. G. (1992). An activator of protein kinase C inhibits gap junction communication between cultured bovine lens cells. Exp Cell Res. 198, 337-342. Richards, J.D., Gold, M. R., Hourihane, S. L., DeFranco, A. L. and Matsuuchi, L. (1996). Reconstitution of B cell antigen receptor-induced signaling events in a nonlymphoid cell line by expressing the Syk protein-tyrosine kinase. J Biol Chem. 271, 6458-66. Rolli, V., Gallwitz, M., Wossning, T., Flemming, A., Schamel, W. W., Zürnc, C. and Reth, M. (2002). Amplification of B-cell antigen receptor signaling by Syk/ITAM positive feedback loop. Mo Cell. 10, 1057-1069.  Roth, D. B. and Craig, N. L. (1988). VDJ Recombination: A transposase goeas to work. Cell. 94, 411-414.  Saez, J. C. Berthoud, V. M., Branes, M. C. Martinez, A. D. and Beyer, E. C. (2003). Plasma membrane channels formed by connexins: their regulation and functions. Physiol Rev. 83, 1359-1400. 198   Saez, J. C., Nairn, A. C., Czerink, A. J., Fishman, G. I., Spray, D. C. and Hertzberd, E. L. (1997). Phosphorylation of connexin43 and the regulation of neonatal rat carciac myocyte gap junctions. Mol Cell Cardiol. 29, 2131-2145.   Sakaguchi, N., Kasiwamura, S. I., Kimoto, M., Thalmann, P. and Melchers, F. (1988). B lymphocyte lineage-restricted expression of mb-1, a gene with CD-3 like structural properties. Embo J. 7, 3457-34-64.  Sambrook, J. and Russell, D. (2001). Molecular cloning: a laboratory manual. 3rd ed. Cold spring Harbor Laboratory Press, Cold Spring Harbor, New York.  Santos-Argumedo, L., Kincade, P.W., Partida-Sánchez, S. and Parkhouse, R. M. (1997). CD44- stimulated dendrite formation ('spreading') in activated B cells. Immunology 90, 147-153. Scemes, E., Spray, D. and Meda, P. (2009). Connexins, pannexins, innexins: novel roles of “hemi-channels”. Pflugers Arch. 457, 1207-1226.  Scielzo, C., Bertilaccio, M. T., Simonetti, G., Dagklis, A., Ten Hacken, E., Fazi, C., Muzio, M., Caiolfa, V., Restuccia, U., Bachi, A., Rocchi, M., Ponzoni, M., Chia, P. and Caligaris-Cappio, F. (2010). HS1 has a central role in the trafficking and homing of leukemic B cells. Blood. 116, 3537-3546.  Segretain, D. and Falk, M. M. (2004). Regulation of connexin biosynthesis, assembly, gap junction formation and removal. Biochim Biophys Acta. 1662, 3-21.  Severs, N. J., Bruce, A. F., Dupont, E. and Rothery, S. (2008). Remodeling of gap junctions and connexin expression in diseased myocardium. Cardiovasc Res. 80, 9-19.  Shah, M. M., Martinez, A. M. and Fletcher, W. H. (2002). The connexin43 gap junction protein is phosphorylated by protein kinase A and protein kinase C : in vivo and in vitro studies. Mol Cell Biochem. 238, 57-68.   Shaw, R. M., Fay, A. J., Puthenveedu, M. A., von Zastrow, M., Jan Y. N. and Jan, L. Y. (2007). Microtubule plus-end-tracking proteins target gap junctions directly from cell interior to adherence junctions. Cell. 128, 547-560.   Shekhar,S. and Yang, X. (2012). The darker side of follicular helpet T cells; from autoimmunity to immunedeficiency. Cell Mol Immunol. 168, 2172-2138.  Shimada, T. (2006), Salivary proteins as defense against dietary tannins. J  Chem Echol. 32, 1149-1163.   199  Simon, A. M. and Goodenough, D. A. (1998). Diverse functions of vertebrate gap junctions. Trends Cell Biol. 8, 477-483.  Simpson, K. J., Selfors, L.M., Bui, J., Reynolds, A., Leak, D., Khvorova , A. and Brugge. J.S. (2008). Identification of genes that regulate epithelial cell migration using an siRNA screening approach. Nat. Cell Biol. 10, 1027-1038.   Singh, D. and Lampe, P.D. (2003). Identification of connexin043 interacting proteins. Cell Commun Adhes. 10, 215-220.  Singh, D., Solan, J. L., Taffet, S. M., Javier, R. and Lampe, P. D. (2005). Connexin43 interacts with zona occludens-1 and-2 proteins in a cell cycle stage specific manner. J Biol Chem. 280, 30416-30421.  Smyth, J. W. and Shaw, R. M. (2013). Autoregulation of connexin43 gap junction formation by internally translated isoforms. Cell Rep. 5, 611-618.    Söhl, G. and Willecke, K. (2004). Gap junctions and the connexin protein family. Cardiovasc Res. 62, 228-232.  Solan, J. L. and Lampe, P. D. (2005). Connexin phosphorylation as a regulatory event linked to gap junction channel assembly. Biochim Biophys Acta. 1711, 154-163.  Solan, J. L. and Lampe, P. D. (2008). Connexin43 in LA-25 cells with active v-src is phosphorylated on Y247, Y265, S262, S279/282 and S368 via multiple signaling pathway. Cell Commun. Adhes. 15, 75-84. Solan, J. L. and Lampe, P. D. (2009). Connexin43 phosphorylation: structural changes and biological effects. Biochem J. 419, 261-272.  Solan, J. L., and Lampe, P. D. (2009). Chapter 11 of Connexins: A guide-Edited by Harris, A., and Locke, D. Springer. ISBN: 978-1-934115-64-6.  Solan, J. L. and Lampe, P. D. (2014). Specific Cx43 phosphorylation events regulate gap junction turnover in vivo. FEBS Lett. 588, 1423-1429. Solan, J. L., Fry, M. D., TenBroek, E. M. and Lampe, P.D. (2003). Connexin43 phophorylation at S368 is acute during S and G2/M and in response to protein kinase C activation. J cell Sci. 116, 2203-2211.  Solan, J. J., Marquez-Rosado, L., Sorgen, P. L., Thornton, P. J., Gafken, P.R. and Lapme, P. D. (2007). Phosphorylation at S365 is gatekeeper event that changes the structure of Cx43 and prevents down-regulation by PKC. J Cell Biol. 179, 1301-1309.  200  Sorgen, P.L., Duffy, H. S., Cahill, S. M., Coombs, W., Spray, D. C., Delmar, M. and Grivin, M. E. (2002). Sequence-specific resonance assignment of the carboxyl terminal domain of connexin43. J Biomol NMR. 23, 245-246.  Sorgen, P.L., Duffy, H. S., Sahoo, P., Coombs, W., Delmar, M. and Spray, D. C. (2004a). Structural changes in the carboxyl terminus of the gap junction protein connexin 43 indicates signaling between biding domains for c-Src and  Zonula Occludensa-1. J Biol Chem. 279, 54695- 54701.  Sorgen, P. L., Duffy, H. S., Spray, D. C. and Delmar, M. (2004b). PH-dependent dimerization of carboxyl terminal domain of Cx43. Biophys J. 87, 574-581.  Sosinky, G. E. and Nicholson, B. J. (2005). Structural organization of gap junction channels. Biochim Biophys Acta. 1711, 99-125.  Squecco, R., Sassoli, C., Nuti, F., Martinesi, M., Chellini, F., Nosi, D., Zec-chi-Orlandini, S. Francini, F., Formigli, L. and Meacci, E. (2006). Sphingosine 1-phosphate induces myoblast differentiation through Cx43 protein expression: A role for gap junction-dependent and –independent function. Mol Biol Cell. 17, 4896-4910.  Stewart, M. K. G., Gong, X. Q., Barr, K. J., Bai., D. Fishman, G. I. and Laird, D. W. (2013). Mammary gland defects are revealed by genetically –modified mice harboring an oculodentodigital dysplasia-linked Cx43 mutant. Biochem J. 449, 401-413.  Stone, J. C. (2011). Regulation and function of the Ras GRPfamily of Ras activators in blood cells. Genes Cancer. 2, 320-334.   Su, V. and Lau, A. F. (2012). Ubiquitination, intercellular trafficking and degradation of connexins. Arch Biochem Biophys. 524, 16-22.  Su, T. T. and Rawlings, D. J. (2002). Transitional B lymphocyte subsets operate as distinct chechpoints in murine splenic  B cell development. J Immunol. 168, 2101-2110.  Sutherland, C. L., Heath, A.W., Pelech, S. L., Young, P. R. and Gold, M.R. (1996). Differential activation of the ERK, JNK, p38 mitogen-protein activated kinases by CD40 and the B cell antigen receptor. J of Immunol 157 (8), 3381-3390.   Swenson, K. I., Piwnica-Worms, H., McNamee, H. and Paul, D. L. (1990). Tyrosine phosphorylation of the gap junction protein connexin43 is required for pp60Src-induced inhibition of communication. Cell Regul. 1, 989-1002.  201  Takata, M., Sabe, H., Hata, A., Inazu, T., Homma, Y., Nukada, T., Yamamura, H. and Kurosaki, T. (1994). Tyrosine kinases Lyn and Syk regulate B cell receptor-coupled Ca2+ mobilization through distinct pathways. MBO J. 13, 1341-1349.  Takeda, K. and Akira, S. (2001). Roles of Toll-like receptors in innate immune responses. Genes to Cell. 6, 733-742.  TenBroek, E. M., Lampe, P. D., Solan, J. L., Reynhout, J. K. and Johnson, R. G. (2001). Ser364 of connexin43 and the upregulation of gap junction assembly by cAMP. J Cell Biol. 155, 1307-1318.  Thomas, M. A., Zosso, N., Sceri, I., Demaurex, N., Chanson, M. and Staub, O. (2003). A tyrosine-based sorting signal is involeved in connexin43 stability and gap junction turnover. J Cell Sci. 116, 2213-2222.   Tittarelli, A., Mendoza-Naranjo, A., Farias, M., Guerrero, I., Ihara, F., Wennerberg, E., Riquelmes, S., Gleisner, A., Kalergis, A., Lundqvist, A., Lopez, M. N., Chambers, B. J. and Salazar-Onfary, F. (2014). J Immunol. 192, 1313-1319.   Tonegawa, S. (1983). Somatic generation of antibody diversity. Nature 302, 575-581.  Tong, D., Li, T. Y., Naus, K. E., Bai, D. and Kidder, G. M. (2007). In vivo analysis of undoucked connexin43 gap junction hemichannels in ovarian granulosa cells. J Cell Sci. 120, 4016-4024.  Tong, D., Lu, X., Wang, H. X., Plante, I., Lui, E., Laird, D. W., Bai, D and Kidder, G. M. (2009). A dominant loss-of-function GJA1 (Cx43) mutants impairs parturition in the mouse. Biol Reprod. 80, 1099-1106.  Torres, M. and Coates, T. D. (1999). Function of cytoskeletal in human neutrophils and methods for evaluation. J Immunol Methods. 232, 89-109.  Toyofuku, T., Akamatsu, Y., Zhang, H., Kuzuya, T., Tada, M. and Hori, M. (2001). C-Src regulated the interaction between connexin-43 and ZO-1 in cardiac myocytes. J Biol Chem. 276, 1780-1788.  Toyofuku, T., Yabuki, M., Otsu, K., Kuzuya, T. and Tad, M. (1998). Direct association of the gap junction protein connexin-43 with ZO-1 in cardiac myocytes. J Biol Chem. 273, 12725-12731.  Toyofuku, T., Yabuki, M., Otsu, K., Kuzuya, T. and Tad, M. (1999). Functional role of c-Src in gap junctions of the cardiomyopathic heart. Circ Res. 85, 672-681.  Treanor, B. (2012). B-cell receptor: from resting state to activate. Immunology. 136, 21-27. 202   Treanor, B., Depoil, D., Gonzalez-Granja, A., Barral, P., Weber, M., Dushek, O., Bruckbauer, A. and Batista, F. D. (2010). The membrane skeleton controls diffusion dynamics and signaling through the B cell receptor. Immunity. 32, 187-199.  Troxell, M.L., Chen, Y. T., Cobb, N., Nelson, W. J. and Marrs, A. J. (1999). Cadherin function in junctional complex rearrangement and posttranslational control of cadherin expression. Am. J. Physiol. 276, C404-18. Tsui, E., Hill, K. A., Laliberte, A. M., Paluzzi, D., Kisilevsky, I., Shao, Q., Heathcote, G. J., Laird, D. W., Kidder, G. M. and Hutnik, C. M.L. (2011). Ocular pathology relevant to glaucoma in a Gja Jrt/+ mouse model of human oculodentodigital dysplasia. Invest Ophthumol Vis Sci. 52, 3539-3547.  Ursitti, J. A., Petrich, B. G., Lee, P. C., Reseneck, W. G., Ye, X., Yang, J., Randall, W. R., Bloch, R. J. and Wang, Y. (2007). Role of an alternatively spliced form of alphaII-spectrin in localization of connexin 43 in cardiomyocytes and regulation by stress-activated protein kinase. J Mol Cell Cardiol. 42, 572-581.  Valiunas, V., Polosina, Y. Y., Miller, H., Potapova, I. A., Valiuniene, L., Doronin, S., Mathias, R. T., Robinson, R. B., Rosen, M. R., Cohen, M. R. and Brink, P. R. (2005). Connexin-specific cell-to-cell transfer of short interfering RNA by gap junctions. J Physiol. 568, 459-468.  Vega, J. L., Baeza, E., Berthoud, V. M. and Sáez, J. C. (2012). Connexins as Substrates for Protein Kinases and Phosphoprotein Phosphatases. Biochemistry, Genetics and Molecular Biology. InTech. Rijeka, Croatia.   Vigil, D., Cherfils, J., Rossman, K. L. and Der, C. J. (2010). Ras superfamily GEFs and GAPs: validated and tractable for cancer therapy? Nat Rev Cancer. 10, 842-857.  Vinken, M., Decrocke, E., Leybaert, L. Bultynck, G., Himpens, B., Vanhaecke, T. and Rogires, V. (2012). Non-channel function of connexins in cell growth and cell death. Biochim Biophys Acta. 1818, 2002-2008.  Vitale, M. L., Akpovi, C. D. and Pelletier, R. (2009). Cortactin/tyrosine-phosphorylated cortactin interaction with connexin43 in mouse seminiferous tubules. Microsc Res Tech. 72, 856-867.  Vitetta, E. S., Baur, S. and Uhr, J. W. (1971). Cell surface immunoglobulin II. Isolation and characterization of immunoglobulin from mouse splenic lymphocytes. Exp Med. 134, 242-264.  Walker, D. L., Vacha, S. J., Kirby, M. and Lo, C. W. (2005). Connexin43 deficiency causes dysregulation of coronary asculogenesis. Dev. Biol. 284, 479-498.   203   Wall, M. E., Otey, C., Qi, J. and Banes, A. J. (2007). Cx43 is localized with actin in tenocytes. Cell Motil Cytoskeleton. 64, 121-130.  Warn-Cramer, B. J., Cottrell, C. T., Burt, J. M. and Lau, A. F. (1998). Regulation of connexin-43 gap junctional intercellular communication by mitogen-activated protein kinase. J Biol Chem. 273, 9188-9196.  Warn-Cramer, B. J., Lampe, P. D. Kurata, W. E., Kanemitsu, M. Y., Loo, L. W., Eckhart, W. and Lau, A. F. (1996). Charactrization of mitogen-activated protein kinase phosphorylation sites on the connexin-43 gap junction protein. J Biol chem. 271, 3779-3786.  Weber, P. A., Chang, H. C., Spaeth, K. E., Nitsche, J. M. and Nicholson, B. J. (2004). The permeability of gap junction channels to probes of different size is dependent on connexin composition and permeant-pore  affinities. (2004). Biophys J. 87, 958-973.  Weed, S. A. and Parsons, J. T. (2001). Cortactin: coupling membrane dynamics to cortical actin assembly. Oncogene. 20, 6418-6434.  White, T. and Paul D. (1999). Genetic Diseases and gene knockouts reveal diverse connexin functions. Annu. Rev. Physiol. 61, 283-310.  Willecke, K. Eiberger, J., Degen, J., Eckardt, D., Romualdi, A., Guldenagel, M., Deutsch, U. and Sohl, G. (2002). Structural and functional diversity of connexin genes in the mouse and human genome. Biol Chem. 383, 725-737.  Wilson, N., Simpson, R. and Cooper-Liddell, C. (2009). Introductory glycosylation analysis using SDS-PAGE and peptide mass fingerprinting. Methods Mol Biol., 534, 205-215.  Worth, D.C., Daly, C. N., Geraldo, S., Oozeer, F. and Gordon-Weeks, P. R. (2013). Drebrin contains a cryptic F-actin-bundling activity regulated by Cdk5 phosphorylation. JCB 202, 793-806.  Xiao, F., Weng, J., Fan, K. and Wang, W. (2011). Detailed regulatory mechanism of the interaction between ZO-1 PDZ2 and Connexin43 revealed by MD stimulation. PLOS One. 6, e21527.  Xu, X., Francis, R., Wei, C. J., Linask, K. L. and Lo, C. W. (2006). Connexin 43- mediated  modulation of polarized cell movement and directional migration of cardiac neural crest cells. Development. 133, 3629-3639.   204  Yamene, Y., Shiga, H., Asou, H., Haga, H., Kawabata, K., Abe, K. and Ito, E. (1999). Dynamics of astrocyte adhesion as analyzed by a combination of atomic force microscopy and immune-cyto-chemistry: the involvement of actin filaments and connexin 43 in the early stage of adhesion. Arch Histol Cytol. 62, 355-361.   Yeager, M., Unger, V. M. and Falk, M.M. (1988). Synthesis, assembly and structure of gap junction intercellular channels. Curr Opin Struct Biol. 8, 517-524.  Yogo, K., Ogawa, T., Akiyama, M., Ishida, N. and Takeya, T. (2002). Identification and functional analysis of  novel phosphorylation sites in Cx43 in rat primary granulosa cells. FEBS Lett. 531, 132-136.  Yogo, K., Ogawa, T., Akiyama, M., Ishida-kitagawa, N., Sasada, H., Sato, E. ans Takeya, T. (2006). PKA implicated in the phosphorylation of Cx43 induced by stimulation with FSH in rat granulosa cells. J Repord Dev. 52, 321-328.  Zahler, S., Hoffmann, A., Gloe, T. and Pohl, U. (2003). Gap-junctional coupling between neutrophils and endothelial cells: a novel modu;ator of transendothelial migration. J Leukoc Biol. 73, 118-1126.  Zimmer, B. D., Green, C. R., Evans, W. H. and Gilula, N. B. (1987). Topological analysis of the major protein in isolated intact rat liver gap junctions and gap junction-drived single membrane structure. J Biol Chem. 262, 7751-7763.   205  Appendices  Appendix A    A.1 Confirmation of Δ258 Cx43-EGFP by DNA sequencing  An expression vector containing the cDNA for rat Δ258 Cx43-EGFP was made as described in section 2.1.2.1. The deletion was confirmed using DNA sequencing by the NAPS Unit, UBC (www.msl.ubc.ca/services/naps) (Figure A1). Sequencing data revealed the removal of base pairs after base pair 774 from the start codon (corresponding to aa 258). Also the insertion of a BglII site after the nucleotides corresponding to aa 258 and before the start codon for EGFP was confirmed. This BglII site functions as a linker between Δ258 Cx43 and EGFP. Afterwards, the sequence was subjected to a Blast analysis using the NCBI blast tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to make sure that the Δ258 Cx43 sequence (base pairs 1-774) matched the rat WT Cx43 nucleotide sequence up to the base pair numbered 774.   206                    A1. Confirmation of the Δ258 Cx43-EGFP construct by DNA sequencing. The expression vector containing Δ258 Cx43-EGFP was sequenced using the custom designed primer pairs (table 2.2) by the NAPS unit at UBC. The sequencing result showed the removal of base pairs after the base pair 774 (corresponding to aa 258) (red), from the Cx43 start codon (first green). Also insertion of a BglII site (purple) in between the nucleotides that corresponded to aa 258 and the start codon for EGFP (second green) was confirmed.   207   A.2 Confirmation of Δ307 Cx43-EGFP by DNA sequencing   An expression vector containing the cDNA for rat Δ307 Cx43-EGFP was made as described in section 2.1.2.2. The deletion was confirmed using DNA sequencing by the NAPS Unit, UBC (www.msl.ubc.ca/services/naps) (Figure A2). Sequencing data revealed the removal of base pairs after the base pair 921 from the start codon (corresponding to aa 307). Also the insertion of a BglII site after the nucleotides corresponding to aa 307 and before the start codon for EGFP was confirmed. This BglII site functions as a linker between Δ307 Cx43 and EGFP. Afterwards the sequence was subjected to a Blast analysis using the NCBI blast tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to make sure that the Δ307 Cx43 sequence (base pairs 1-921) matched the rat WT Cx43 nucleotide sequence up to the base pair numbered 921.   208                    A2. Confirmation of the Δ307 Cx43-EGFP construct by DNA sequencing. The expression vector containing Δ307 Cx43-EGFP was sequenced using the custom designed primer pairs (table 2.2) by the NAPS unit at UBC. The sequencing result showed the removal of base pairs after the base pair 921 (corresponding to aa 307) (red), from the Cx43 start codon (first green). Also insertion of a BglII site (purple) in between the nucleotides that corresponded to aa 258 and the start codon for EGFP (second green) was confirmed.   209   A.3 Confirmation of Y247F Cx43-EGFP by DNA sequencing  An expression vector containing a cDNA for rat Y247F Cx43-EGFP was made as described in section 2.1.2.3. The point mutation was confirmed using DNA sequencing by the NAPS Unit, UBC (www.msl.ubc.ca/services/naps) (Figure A3). Sequencing data revealed the exchange of the base pairs located at 739-741 from the start codon of Cx43 (corresponding to aa 247) from TAC (coding tyrosine) to TTC (coding phenylalanine), on the coding strand of the cDNA. Afterwards the sequence was subjected to a Blast analysis using (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to make sure that the only difference with the WT Cx43 cDNA was the nucleotide change corresponding to the Y247F point mutation. The results showed that last two amino acids (6 base pairs) of the Cx43 cDNA were different from the nucleotide sequence of WT rat Cx43. This change was also previously identified by previous MSc student in the Matsuuchi Lab, Letitia Falk. In fact, aa 381, a leucine (L) and aa 382, a glutamic acid (E) are replaced with aspartic acid (D) and proline (P). This means that the cDNA that we have is intact up to aa 380, followed by 6 base pairs that encode two amino acids that function as a short linker, followed by EGFP (Figure 2.1.A).     210                A3 Confirmation of the Y247F Cx43-EGFP construct by DNA sequencing. The expression vector containing Y247F Cx43-EGFP was sequenced using the custom designed primer pairs (table 2.2) by the NAPS unit at UBC. Base pairs located at 739-741(corresponding to aa 247) from the start codon of Cx43 (green) are exchanged from TAC (coding Y) to TTC (coding F) (red) on the coding strand of the cDNA. The base pairs located at 793-795 (corresponding to aa 265) (black-underlined) are unchanged. The cDNA for Cx43 in this expression vector ends at aa 380 (base pair 1140) (orange) instead of aa 382 (base pair 1146).   211   A.4 Confirmation of construction of Y247F/Y265F Cx43-EGFP by DNA sequencing  Expression vector containing cDNA for rat Y247F/Y365F Cx43-EGFP was made using a template that contained Y265F point mutation (section 2.1.2.4) . The resultant double mutations was confirmed using DNA sequencing by the NAPS Unit, UBC (www.msl.ubc.ca/services/naps) (Figure A4). Sequencing data revealed the exchange of the base pairs located at 739-741 from the start codon of Cx43 (corresponding to aa 247) from TAC (coding tyrosine) to TTC (coding phenylalanine) on the coding strand of the cDNA. Also the previously made mutation at base pairs 793-795 (corresponding to Y265) from TAC (coding tyrosine) to TTC (coding phenylalanine) was confirmed. Afterward the obtained sequence was blasted using the NCBI blast tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to make sure that the difference with the WT Cx43 cDNA are only the Y247F and Y265F point mutations. As mentioned in the A3 section cDNA for rat Cx43 in this expression vector contains 380 aa.    212               A4 Confirmation of the Y247F/Y265F Cx43-EGFP construct by DNA sequencing. The expression vector containing Y247F/Y265F Cx43-EGFP was sequenced using the custom designed primer pairs (table 2.2) by the NAPS unit UBC. Base pairs located at 739-741(corresponding to aa 247) from the start codon of Cx43 (green) are exchanged from TAC (coding Y) to TTC (coding F) (light red) on the coding strand of the cDNA. DNA sequencing also showed the previously made Y265F mutation. The base pairs located at 793-795 (corresponding to aa 265) are exchanged from TAC (coding Y) to TTC (coding F) (dark red). The cDNA for Cx43 in this expression vector ends with nucleotide sequences encoding aa 380 (base pair 1140) (orange) instead of aa 382 (base pair 1146).  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0167176/manifest

Comment

Related Items