UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Inverse regulation of biofilm formation and swarming motility in Pseudomonas aeruginosa by the transcriptional… Ho, Ryan Calvin 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2015_may_ho_ryan.pdf [ 1.1MB ]
Metadata
JSON: 24-1.0167120.json
JSON-LD: 24-1.0167120-ld.json
RDF/XML (Pretty): 24-1.0167120-rdf.xml
RDF/JSON: 24-1.0167120-rdf.json
Turtle: 24-1.0167120-turtle.txt
N-Triples: 24-1.0167120-rdf-ntriples.txt
Original Record: 24-1.0167120-source.json
Full Text
24-1.0167120-fulltext.txt
Citation
24-1.0167120.ris

Full Text

    Inverse Regulation of Biofilm Formation and Swarming Motility in Pseudomonas aeruginosa by the transcriptional regulator GbuR  by  Ryan Calvin Ho B.Sc., University of Manitoba, 2011.  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (MICROBIOLOGY AND IMMUNOLOGY)   THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)   January 2015 © Ryan Calvin Ho, 2015 ii  Abstract  Pseudomonas aeruginosa inversely regulates biofilm formation and swarming motility, which provides the advantage of allowing it to adapt to environmental conditions. These two surface-associated behaviors represent distinct infection states, with swarming being associated with an acute lifestyle, and biofilm formation exemplifying a chronic lifestyle. Thus the inverse regulation of biofilm formation and swarming motility has important implications for the mode of infection, which in turn influences the interaction between P. aeruginosa and an affected host. Recent studies have also shown that the inverse regulation of biofilm formation and swarming motility is under the control of a number of regulatory genes. Characterization of these genes will therefore provide insights into this regulatory phenomenon and its effect on virulence in P. aeruginosa.  The aim of this study was to investigate the inverse regulation of biofilm formation and swarming motility by the transcriptional regulator GbuR. It was shown that mutation in gbuR resulted in a severe swarming defect, while biofilm formation was enhanced. Transcriptome analysis defined the modest regulon of gbuR, revealing a number of genes potentially involved in inversely regulating biofilm formation and swarming motility.         iii  Preface This dissertation is the original and unpublished work of the author R. Ho. Experiments were designed, carried out, and analyzed by the author R. Ho.                              iv  Table of Contents   Abstract .......................................................................................................................................... ii Preface ........................................................................................................................................... iii Table of Contents ......................................................................................................................... iv List of Tables ................................................................................................................................ vi List of Figures .............................................................................................................................. vii List of Abbreviations .................................................................................................................. vii Acknowledgements ...................................................................................................................... ix  1 Introduction 1.1 Pseudomonas aeruginosa ............................................................................................... 1 1.2 P. aeruginosa swarming motility .................................................................................... 2 1.3 P. aeruginosa biofilm formation..................................................................................... 2 1.4 Regulation of biofilm formation and swarming motility ................................................ 3 1.5 Regulation of acute and chronic lifestyle in P. aeruginosa ............................................ 5 1.6 Aims of this study ........................................................................................................... 6  2 Materials and Methods 2.1 Strains, plasmids, primers, and growth conditions ......................................................... 7 2.2 Biofilm assays ................................................................................................................. 8 2.3 Biofilm cultivation in flow chambers and microscopy ................................................... 8 2.4 Swarming assays ............................................................................................................. 8 2.5 Swimming and twitching assays ..................................................................................... 9 2.6 Minimum inhibitory concentration (MIC) determination............................................... 9 2.7 Congo red assay ............................................................................................................ 10 2.8 gbuR deletion mutant construction ............................................................................... 10 2.9 Complementation of the gbuR mutation ....................................................................... 10 2.10 RNA extraction from swarming cells and cDNA synthesis ......................................... 11 2.11 DNA microarray experiments ....................................................................................... 12 v  2.12 RT-qPCR experiments .................................................................................................. 12  3 Results 3.1 Swarming defect of the gbuR mutant............................................................................ 14 3.2 Enhanced biofilm formation of the gbuR mutant ......................................................... 16 3.3 Swimming and twitching of the gbuR mutant .............................................................. 18 3.4 Antibiotic susceptibility of the gbuR mutant ................................................................ 20 3.5 Microarray analysis of the gbuR mutant ....................................................................... 21  4 Discussion 4.1 Effect of gbuR on biofilm formation and swarming motility ....................................... 24 4.2 Growth defect of the gbuR deletion mutant .................................................................. 26 4.3 Genes regulated by gbuR .............................................................................................. 26 4.4 Involvement of gbuR in antibiotic resistance................................................................ 30 4.5 Complementation of the gbuR mutant .......................................................................... 30 4.6 Future areas of research ................................................................................................ 30 4.7 Conclusion .................................................................................................................... 31  References .....................................................................................................................................33  Appendix A: Full list of genes differentially regulated under swarming conditions in the gbuR mutant ............................................................................................................................................41         vi  List of Tables Table 1. Bacterial strains used in this study ....................................................................................7 Table 2. Plasmids used in this study ...............................................................................................7 Table 3. Primers used in this study ...............................................................................................11 Table 4. MICs of the PA14 WT and gbuR mutant to various antibiotics .....................................21 Table 5. Selected list of genes differentially regulated under swarming conditions in the gbuR mutant ............................................................................................................................................23 Appendix A: Full list of genes differentially regulated under swarming conditions in the gbuR mutant ............................................................................................................................................41                  vii  List of Figures Figure 1. Swarming motility of the PA14 WT and gbuR mutant .................................................22 Figure 2. Swarming surface coverage of the PA14 WT and gbuR mutant ...................................23 Figure 3. Static biofilm assay of the PA14 WT and gbuR mutant ................................................26 Figure 4. Congo red binding of the PA14 WT and gbuR mutant .................................................27 Figure 5. Biofilm formation of the PA14 WT and gbuR mutant in the flow cell .........................28 Figure 6. Swimming motility of the PA14 WT and gbuR mutant ................................................30 Figure 7. Twitching motility of the PA14 WT and gbuR mutant .................................................31               viii  List of Abbreviations Ap – Ampicillin Cb - Carbenicillin CF - Cystic fibrosis CFTR - Cystic fibrosis transmembrane conductance regulator CLSI - Clinical and laboratory standards institute CLSM - Confocal laser scanning microscopy di-GMP - Diguanylate guanosine monophosphate DNA - Deoxyribonucleic acid Gm - Gentamicin Kan - Kanamycin RNA - Ribonucleic acid T3SS - Type 3 secretion system        ix  Acknowledgements  I would like to thank my supervisor, Dr. Robert E. W. Hancock for the opportunity to be part of his lab group and for his guidance during this research project. I would also like to thank César de la Fuente-Núñez, Manjeet Bains, and Lucia Fernández-Llamas for their invaluable help in this project. Lastly, a special thanks to my committee members Drs. Eltis and Thompson for their expertise and advice as well as the members of the Hancock lab for their encouragement.             1  1 Introduction 1.1 Pseudomonas aeruginosa   Pseudomonas aeruginosa is a ubiquitous environmental bacterium that can be found residing in water, soil, or associating with plants and animals, and is notable for its ability to adapt and survive many environmental challenges (7,59). This Gram negative bacterium is an adept opportunistic pathogen that often causes problematic and in some cases fatal infections (84). While this bacterium does not usually affect healthy hosts, it is particularly problematic for immunocompromised individuals (35,61). It is one of the leading pathogens associated with nosocomial infections such as pneumonia, urinary tract infections, and bacteremia (8,20,65). P. aeruginosa is also the most prevalent pathogen associated with eventually-fatal chronic lung infections in individuals with the genetic disease cystic fibrosis (3,14,24). The lung infections caused by P. aeruginosa are the most common cause of death in cystic fibrosis patients (14,39).   An interesting feature of P. aeruginosa is the regulation of surface-associated behaviors. When encountering a surface, P. aeruginosa coordinates individual cells to engage in a diverse set of behaviors that include biofilm formation and swarming motility (74,88). Biofilms are communities of bacteria notable for causing chronic infections, while motile populations of bacteria are associated with acute infections (6,50). Thus the choice between a sessile or motile lifestyle is an important decision that has implications for the interaction of P. aeruginosa and the affected host (74).  1.2 P. aeruginosa swarming motility  Swarming motility is a process that results in the rapid, multi-cellular, and coordinated movement of bacteria across a moist surface of intermediate viscosity (53,88). This form of motility is present in many genera of Gram-negative and Gram-positive flagellated bacteria and is the fastest known mode of surface translocation, allowing cells to move several micrometers per second (51,88). Cells with the ability to swarm gain the advantage of being able to rapidly colonize a nutrient rich environment as well as host tissues (88). In P. aeruginosa swarming occurs on semi-solid surfaces and results in the rapid 2  outgrowth of the swarm colony, forming a characteristic dendritic appearance in strain PA14 (85). It is dependent on a number of important factors including a functional flagellum, type IV pili, and the production of rhamnolipids, which act as a biosurfactant (11,26,54). Furthermore swarming is nutritionally dependant. It is induced under nitrogen limiting conditions and in response to certain amino acids (when provided as the sole nitrogen source) and has also been shown to be dependent on the carbon source as well (5,11). During the swarming process, physical changes occur to differentiate P. aeruginosa cells into swarmer cells (48). This involves cell elongation and as well as the addition of a second polar flagellum (normally P. aeruginosa has only one polar flagellum) (11,48).  While the exact role of swarming in P. aeruginosa has not been conclusively demonstrated, it is speculated to be an important means for dissemination, such as in the viscous mucosal surfaces of the lungs during infection, and nutrient acquisition (2,88). There is also evidence that suggests this form of motility plays a role in P. aeruginosa virulence. A study by Overhage et al. (76) observed that during swarming, P. aeruginosa had increased resistance to antibiotics and an upregulation in virulence factor production compared to planktonic cells. In addition, other studies have demonstrated that swarming is important for certain virulence traits in other bacteria such as the colonization of the urinary tract, upregulation of virulence proteins, and invasion of host cells by Proteus mirabilis (1,2,80,89).  1.3 P. aeruginosa biofilm formation  Bacteria growing on surfaces often form biofilms. Biofilms are sessile communities of surface attached microbes that are enclosed in a self-produced extracellular matrix (18,40). The biofilm growth state represents a complex bacterial adaptation that provides cells within the biofilm protection against unfavorable environmental conditions, such as the presence of antibiotics and the host immune response (17,23). The biofilm can also act as a source of planktonic bacteria that can disperse from the biofilm, move to other sites and multiply rapidly (41,74).  The ability to form biofilms plays a significant role in bacterial infections. Biofilms are responsible for ~80% of bacterial infections in humans, including lung infections in cystic fibrosis patients, infection of chronic wounds, otitis media, and implant and catheter 3  associated infections (23,77). For P. aeruginosa, biofilm formation is important in pathogenesis as the biofilms formed by P. aeruginosa are associated with chronic infections, affording protection against antibiotics and the host immune response (19,23,29,63). Perhaps one of the best examples of this is typified in individuals with the eventually fatal genetic disease cystic fibrosis, resulting from the mutation of the cystic fibrosis transmembrane conductance regulator gene (CFTR) (19,37,67). This mutation causes abnormal sodium and chloride ion transport across the epithelial membrane that results in heavy fluid and mucus build up in the lungs (49,77). The altered lung environment allows P. aeruginosa to colonize and form biofilms, ultimately giving rise to a chronic lung infection (42,46). Biofilms formed in the lungs by P. aeruginosa of cystic fibrosis patients contribute to increased antibiotic resistance making these infections extremely difficult to treat with conventional antibiotic therapy and to date current therapies unable to eradicate them (16,57,67).  The biofilm may also act as a source of disseminated infection by shedding planktonic microbes in a process termed dispersal, and can stimulate chronic and damaging inflammatory responses (74). 1.4 Regulation of biofilm formation and swarming motility  The decision between a motile or sessile lifestyle is a highly regulated process that relies on the input of many environmental signals and the action of regulatory pathways. While the regulation of swarming and biofilm formation are often studied individually, an interesting feature of these two surface associated behaviors is the regulatory relationship between them. A series of studies by the O’Toole research group starting with the characterization of the gene sadB provided evidence that P. aeruginosa inversely regulates biofilm formation and swarming motility. The study on sadB by Caiazza et al. found that it was required for the switch from reversible to irreversible attachment in biofilm formation (10). Compared to the PA14 wild type strain, a sadB mutant was unable to form a mature structured biofilm and instead formed an unstructured mat of cells (10). It was also found that the sadB mutant exhibited a hyper-swarming phenotype when compared to the PA14 wild type strain, and hyper-expression of the sadB gene in contrast resulted in hyper-biofilm formation while swarming was drastically reduced (9). This data suggested that sadB was responsible for inversely regulating biofilm formation and swarming, and that in the wild type strain, sadB acts to promote biofilm formation while repressing swarming (9). Although 4  the function of the sadB product was unknown, it was determined that SadB was able to inversely regulate biofilm formation and swarming motility by increasing the rate of flagellar reversals and through decreasing the production of pel polysaccharide that are a major component of the biofilm matrix (9).  A subsequent study by Merritt et al. found that a second gene, sadC, was acting upstream of the sadB gene and when mutated produced the same effects on biofilm formation and swarming as the sadB mutation (66). The sadC gene encodes a diguanylate cyclase, and in response to an unknown environmental signal produces cyclic di-GMP (66). Cyclic di-GMP is a second messenger used for signal transduction by many bacteria and regulates multicellular behavior and motility (22). Low levels of cellular cyclic di-GMP is correlated with increased motility, while high levels promote biofilm formation (43,79,82). In addition a third gene, bifA, was discovered acting upstream of sadB in the same regulatory pathway (55). Mutation in bifA caused an increase in biofilm formation while swarming motility was inhibited, the opposite phenotype of the sadC and sadB mutations (55). The bifA gene encodes a phosphodiesterase that breaks down cyclic di-GMP resulting in lower levels of the second messenger (55). Thus in the wild type, the sadC gene product acts to increase cyclic di-GMP and this signal is transmitted possibly via sadB to downstream effectors that promote biofilm formation and inhibit swarming. The bifA gene on the other hand responds to environmental signals that promote swarming motility, and when activated for increased expression lowers cyclic di-GMP levels and counteracts the activity of SadC, which results in the stimulation of swarming and inhibits biofilm formation. This regulatory network involving sadB, sadC, and bifA provides an elegant example of the ability of P. aeruginosa to inversely regulate biofilm formation and swarming. The reciprocal relationship suggests that when P. aeruginosa engages in one of these behaviors (swarming or biofilm formation) in response to the environment, it actively inhibits the other, and provides P. aeruginosa with the ability to efficiently coordinate cells to act in unison according to the environmental conditions. Another interesting finding about the regulation of biofilm formation and swarming motility is that they are controlled by a large number of transcriptional regulators (93). A study by Yeung et al. screened a comprehensive P. aeruginosa PA14 transposon mutant 5  library to find mutants with alterations in swarming motility (93). A total of 233 mutants were found to have alterations in swarming motility, and of these 35 were mutations in transcriptional regulator genes (93). Further analysis also revealed that many of these transcriptional regulator genes also had inverse effects on biofilm formation as well, that is mutants with defects in swarming showed increases in biofilm formation and vice versa (93). These findings support the idea that P. aeruginosa inversely regulates biofilm formation and swarming and indicates that these transcriptional regulators may also be involved in this regulatory process. While some of these transcriptional regulators have been studied for their role in the inverse regulation of biofilm formation and swarming, others have remained unstudied in this regulatory aspect and elucidating their role could provide insights into the regulatory network that controls biofilm formation and swarming.   1.5 Regulation of acute and chronic lifestyle in P. aeruginosa P. aeruginosa is an opportunistic pathogen capable of causing acute or chronic infections in susceptible hosts (71). Acute infections are associated with motility and cytotoxicity via the type III secretion system (T3SS), while chronic infections are linked to biofilm formation and reduced cytotoxicity (68). While the role of swarming in P. aeruginosa pathogenesis has not been conclusively demonstrated, swarming has been shown to result in the overexpression of the T3SS and its effectors as well as other virulence related genes (76). Interestingly, evidence suggests that the T3SS and biofilm formation are inversely regulated, indicating that the decision between an acute or chronic lifestyle is controlled by a dedicated regulatory network in P. aeruginosa (38,56,58,87). Part of this regulatory network includes 2 two component regulator sensors, RetS and LadS, which have opposite effects on another sensor GacS (RetS inhibits, LadS activates), which activates its response regulator GacA (38,56,58). GacA in turn increases expression of RsmY and RsmZ, two small regulatory RNAs (sRNAs) which function to sequester and inhibit the post transcriptional regulator RsmA (27,38,58,87). RsmA acts to promote an acute lifestyle by inhibiting the production of pel polysaccharides of the biofilm matrix, and promoting swarming and the expression of the T3SS (44,69,70,90). Thus activation of RetS by an environmental stimulus results in an acute lifestyle, while activation of LadS promotes a chronic lifestyle through their inverse effects on GacS and ultimately RsmA.  6  The positive correlation between swarming and T3SS overexpression suggests that swarming represents an acute infection state, which is distinct from the inversely regulated biofilm formation, representing a chronic infection state. Thus the ability of P. aeruginosa to inversely regulate these two surface associated behaviors may be important in determining the mode of infection. Understanding the basis for the switch between biofilm formation and swarming may therefore provide insights into P. aeruginosa pathogenesis. 1.6 Aims of this study   Previous findings by Yeung et al. (93) showed that at least 18 transcriptional regulators are involved in the regulation of biofilm formation and swarming motility. Many of these transcriptional regulators were also shown to have inverse effects on biofilm formation and swarming motility (93). Thus genes that suppress biofilm formation may also enhance swarming, and vice versa as has been observed for some regulators. Such inverse regulators essentially act as molecular switches from one state to the other, potentially having important implications for the interaction of P. aeruginosa and an affected host. One transcriptional regulator identified in the study, gbuR, was shown to be involved in the inverse regulation of biofilm formation and swarming motility (93). Mutation in gbuR results in a hyper-biofilm and non-swarming phenotype (93). This indicates that gbuR acts as an important switch between biofilm formation, typifying chronic infection, and swarming motility that might influence acute infections in P. aeruginosa. The studies described here investigated the mechanism(s) by which gbuR inversely regulated biofilm formation and swarming motility and its involvement, if any, in virulence factor production in P. aeruginosa.    7  2 Materials and Methods 2.1 Strains, plasmids, primers, and growth conditions Bacterial strains used in this study are described in Table 1 while plasmids are described in Table 2 and primers in Table 3. Cultures were routinely grown in Luria-Bertani (LB) broth, tryptone broth (10 g/liter Bacto tryptone), BM2 minimal medium (62 mM potassium phosphate buffer [pH 7], 7 mM (NH4)2SO4, 2 mM MgSO4, 10 μM FeSO4, 0.4% (wt/vol) glucose), or BM2-swarming medium comprising BM2 with 0.1% (wt/vol) Casamino Acids substituted for 7 mM (NH4)2SO4. For bacterial conjugation, Escherichia coli S17-1 λpir was used as the donor strain (10). P. aeruginosa competent cells were prepared as described previously (13). For the selection or maintenance of plasmids, transposons, and antibiotic cassettes, antibiotics were added to the growth media at the following concentrations: E. coli, 15 μg/ml gentamicin, 50 μg/ml kanamycin, and 100 μg/ml ampicillin; P. aeruginosa, 30 μg/ml gentamicin and 500 μg/ml carbenicillin. Table 1. Bacterial strains used in this study Strain Description Reference P. aeruginosa   PA14 WT Wild type P. aeruginosa PA14 7 gbuR mutant PA14 transposon insertion mutant 7 ΔgbuR gbuR chromosomal deletion mutant of PA14; GmR This study gbuR+ ΔgbuR mutant with pUCP18::gbuR+; CbR  This study PA14 WT gbuR+ Wild type P. aeruginosa PA14 with pUCP18::gbuR+; CbR This study E. coli   S17-1 Donor strain for conjugation  10 Table 2. Plasmids used in this study Plasmid Description  Reference  pUCP18 E. coli-Pseudomonas shuttle vector, ApR, CbR 45 pEX18Ap Suicide plasmid carrying sacBR, ApR 45 pCR-Blunt II-TOPO Plasmid for cloning blunt PCR products, KanR Life Technologies pUCP18::gbuR pUCP18 with gbuR fragment This study   8  2.2 Biofilm assays  Biofilm formation was initially analyzed using a static abiotic surface assay in microtitre plates as described previously (33,34,75). Overnight cultures were diluted (1/100) in BM2 glucose biofilm-adjusted medium (62 mM potassium phosphate buffer [pH 7], 7 mM (NH4)2SO4, 2 mM MgSO4, 10 μM FeSO4, 0.4% [wt/vol] glucose, 0.1% [wt/vol] Casamino Acids) and the diluted culture was inoculated in polystyrene microtiter plates (Falcon, United States) and incubated for 24 h at 37°C. Planktonic cells in the wells were removed and the biofilm cells adhering to the sides of the microtitre wells were stained with 0.1% crystal violet, and the optical density at 595 nm was measured using a microtiter plate reader (Bio-Tek Instruments Inc., United States). 2.3 Biofilm cultivation in flow chambers and microscopy  Biofilms were grown in flow cell chambers with channel dimensions of 1mm by 4mm by 40mm. Silicone tubing (VWR, 0.062 in. [inner diameter] by 0.125 in. [outer diameter] by a 0.032 in. wall) was autoclaved, and the system was then assembled and sterilized by pumping a 0.5% hypochlorite solution through the system at 6 rpm for 30 min. using a Watson Marlow 205S multichannel peristaltic pump. After, the system was rinsed at 6 rpm with sterile water for 30 min. followed by medium at 6 rpm for 30 min. Flow cell chambers were inoculated by injecting 400 μl of an overnight culture diluted to an OD600 of 0.05. After inoculation, chambers were inverted and left without flow for 2 h, after which medium was pumped through the system at a constant rate of 0.75 rpm (3.6 ml/h). Biofilms were grown for 3 days at 37°C before being imaged. Biofilm cells were stained using the Live/Dead BacLight bacterial viability kit (Molecular Probes, Eugene, OR) prior to visualization by microscopy. A 1:5 ratio of SYTO-9 (green fluorescence, live cells) to propidium iodide (PI; red fluorescence, dead cells) was used. Microscopy was performed using a confocal laser scanning microscope (Olympus, Fluoview FV1000), and three-dimensional reconstructions were generated by using the Imaris software package (Bitplane AG). 2.4 Swarming assays  Swarming assays were performed as described previously (33,34,76) on BM2 swarming plates (62 mM potassium phosphate buffer [pH 7], 2 mM MgSO4, 10 μM FeSO4, 9  0.4% [wt/vol] glucose, 0.1% [wt/vol] Casamino Acids, 0.5% [wt/vol] Difco agar). The swarm plates were prepared by pouring 25 ml into each plate, which were then dried briefly. One μl aliquots of mid-log-phase cultures (an optical density at 600nm [OD600] of 0.4 to 0.6) grown in BM2 glucose minimal medium were inoculated in the center of each swarm plate. The swarm plates were incubated at 37°C for 18 h and each swarming assay was carried out a minimum of three times independently. All resulting swarming colonies were analyzed by measuring the surface coverage on the swarm plates using ImageJ software and represented as a percentage of the wild type. 2.5 Swimming and twitching assays  Since P. aeruginosa PA14 shows very poor swimming motility on BM2 glucose swimming plates, which are used for assessing strain PAO1 swimming (76), LB plates with 0.3% (wt/vol) agar were used instead. Plates were prepared by pouring 25 ml into each plate. 1 μl aliquots of mid-log-phase cultures (an optical density at 600nm [OD600] of 0.4 to 0.6) grown in LB broth were inoculated in the center of each plate. After growth for 18 h at 37°C the diameters of the swimming zones were measured.  Twitching motility was assayed on LB plates with 1% (wt/vol) agar as described previously (25,94). Plates were prepared by pouring 20 ml into each plate. Mid-log-phase cultures grown in LB were then stab inoculated using sterile toothpicks into the center of the plate. The diameter of the twitching zone was measured after 24-48 h of growth at 30°C. Three independent experiments were performed for both swimming and twitching assays. 2.6 Minimal inhibitory concentration (MIC) determination  MICs were determined by broth microdilution in accordance with CLSI guidelines by using BM2-glucose medium with a high (2 mM) concentration of Mg2+ (92). MIC assays were performed in polypropylene microtitre plates to prevent binding of peptide antibiotics to polystyrene, which could lead to artificially high MIC values (92). The MIC plates were incubated at 37°C for 24 h, after which the concentration with no visible bacterial growth was considered the MIC.  10  2.7 Congo red assay Congo red binding assays were performed as previously described (32). Overnight cultures grown in tryptone broth were diluted to an OD600 of 0.025. Congo red plates (10 g/liter tryptone broth with 10 g/liter agar, 40 μg/ml Congo red, and 20 μg/ml Coomassie brilliant blue) were then spotted with 1, 5, and 10 μl of the diluted cultures. After inoculation, Congo red plates were incubated for 24 h at 37°C, followed by 48 h at room temperature to assess colony morphology. 2.8 gbuR deletion mutant construction  For the construction of the gbuR deletion mutant, an in-frame deletion of the gbuR gene was achieved by an overlap extension PCR strategy (47). The construct to be used for allelic exchange was generated by amplifying the gentamicin resistance cassette of pPS858 by PCR. Two additional fragments generated by amplifying approximately 1 kb located upstream and downstream of gbuR from PA14 genomic DNA with additional short sequences of overlap with the gentamicin cassette. These three DNA fragments (gentamicin cassette, gbuR upstream region, and gbuR downstream region) were then fused together by PCR and the final product was boosted by a third PCR. The generated construct was then cloned into the pEX18Ap vector carrying a sacB sucrose sensitivity gene (45). This plasmid carrying the generated construct was transformed into E. coli S17-1 λpir and conjugated into P. aeruginosa PA14 to generate an in-frame deletion of the gbuR gene by allelic exchange. Double recombinants were selected by using plates containing gentamicin and 5% (wt/vol) sucrose. The deletion of the gbuR gene was confirmed by PCR and sequencing.  2.9 Complementation of the gbuR mutation  The gbuR deletion mutant was complemented by amplifying the gbuR gene including approximately 500 bp of the upstream and downstream regions from the PA14 genomic DNA by PCR using Phusion High Fidelity DNA polymerase. The forward and reverse primers used were designed from the P. aeruginosa PA14 genome sequence (Pseudomonas Genome Database at www.pseudomonas.com) using the program Primer3 (81). The resultant amplicon generated by the primers (Table 3) was then cloned into pCR-Blunt II-TOPO, using the ZeroBlunt TOPO PCR cloning kit (Invitrogen), and transformed into E. coli S17-1 λpir. 11  This fragment was then excised from the vector using EcoRI and cloned into the broad host range vector pUCP18. The resulting hybrid plasmid, pUCP18::gbuR, was transferred into the gbuR deletion mutant by electroporation and grown on LB plates supplemented with 500 μg/ml carbenicillin to select for strains harboring the pUCP18::gbuR+ construct. The sequence of the construct was verified by sequencing.  Table 3. Primers used in this study Primer Name Primer Sequence  Gm_F CATAAGCCTGTTCGGTTCG Gm_R CGGCGTTGTGACAATTTACC gbuR_F CGCGGAAGCCCTGCTTGCGGCTCCAGTTGAAGTCC gbuR_R CATGGGCTATGGCCGAGCCGAGCTGGCCAGCG Gm_gbuR_F GGTAAATTGTCACAACGCCGCGCAGATGAGCCTGGCCTGAGCCCTAGAGATCGG Gm_gbuR_R CGAACCGAACAGGCTTATGGGTCGGCAAGGCGTTGGACACGGCGAC gbuR_R2 CCTCTGGCGCCGCCTGAACCGCGGCGAGTACGTTACC gbuR_F2 CCTCTGGCGCCGCCTGAACCGCGGCGAGTACGTTACC gbuR-F GGCTGGTGGAGATTCTTGTC gbuR-R ACATGATCGGTCGCATCC 2.10 RNA extraction from swarming cells and cDNA synthesis For RNA extraction from swarming cells, the gbuR mutant and PA14 WT were grown on BM2 swarming plates containing 0.5% (wt/vol) agar for 18 h at 37°C. Cells were then harvested from the leading edge of the dendritic swarm colonies, representing actively swarming cells, for the PA14 WT and the entire non-swarming colony for the gbuR mutant using sterile cotton swabs and resuspended in BM2 swarming media supplemented with RNAprotect reagent (Qiagen, Germany). RNA was then isolated from the cells using a QIAGEN RNeasy mini RNA isolation kit according to the manufacturer’s protocols (QIAGEN Inc., Canada). Contaminating genomic DNA in the RNA samples was then removed by treatment with a DNA free kit (Ambion Inc., Austin, TX). RNA was stored at −80°C with 0.2 U/μl of SUPERase-In RNase inhibitor (Ambion Inc., Austin, TX) and the RNA quality was assessed by agarose gel electrophoresis and spectrophotometrically. The RNA samples were checked for DNA contamination by performing a PCR of the rpsL housekeeping gene, using PA14 genomic DNA as a positive control. cDNA synthesis was carried out by combining 1 μg of RNA with 750 ng of random primers (Invitrogen), which 12  was heated for 10 min at 70°C and then incubated for 10 min at 25°C. Subsequently 0.5 mM dNTPs, 10 mM DDT, and 10, 000 U SuperScriptII (Invitrogen) was added to the reaction mixture and incubated for 1h at 37°C and then 2 h at 42°C. 2.11 DNA microarray experiments Microarrays were performed on three independent cultures and RNA was extracted from swarming cells as described above. The microarray experiment was performed as described previously (76). P. aeruginosa PA14 microarray slides were provided by The Institute for Genomic Research (TIGR) Pathogenic Functional Genomics Resource Center (http://pfgrc.tigr.org/). Seven micrograms of RNA was treated using a Microbe Express kit with the Pseudomonas module (Ambion) to remove rRNA from the samples. Two µg of cDNA was reverse transcribed by using random hexamers (Invitrogen Canada Inc., Burlington, ON, Canada), deoxynucleoside triphosphates (Invitrogen), dUTP (Ambion), and Superscript II reverse transcriptase (Invitrogen) with a PTC-225 Peltier thermal cycler (MJ Research). cDNA labeling, purification, and analysis of the labeling reaction mixture was done using the TIGR “microbial RNA aminoallyl labeling” protocol (pfgrc.tigr.org/protocols/M007.pdf). Treated cDNA was labeled with cyanine-5 (GE Healthcare Canada), and control cDNA was labeled using cyanine-3 (GE Healthcare Canada). The TIGR “hybridization of labeled DNA probes” protocol was used to hybridize labeled cDNA (pfgrc.tigr.org/protocols/M008.pdf). Briefly, 200 pmol of each cyanine-labeled cDNA was mixed and hybridized to the array slides for 18 h in a solution containing 50% formamide, 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 0.1% sodium dodecyl sulfate, and 0.6 μg/μl salmon sperm DNA at 42°C in chambers where the humidity was maintained at 100%. After hybridization, the slides were washed, dried, and scanned with a ScanArray Express scanner and software (Packard BioScience BioChip Technologies). 2.12 RT-qPCR experiments q-PCR was performed using three independent cultures and RNA extraction from swarming cells and cDNA synthesis were performed as described above. The resulting cDNA was used as a template for subsequent qPCR experiments. Analysis was carried out using the ABI Prism 7000 sequence detection system (Applied Biosystems) using the 2-step 13  RT-qPCR kit with SYBR green detection (Invitrogen). The fold change in expression was determined by the comparative threshold cycle (Ct) method by comparison to the rpsL housekeeping gene.   14  3 Results 3.1 Swarming defect of the gbuR mutant  The ability of the gbuR mutant to swarm was assessed on BM2 glucose swarming plates containing 0.5% agar. Both the gbuR transposon and deletion mutant (Fig. 1B,C) displayed a severe swarming defect compared to the PA14 WT (Fig. 1A). Whilst the PA14 WT swarm colony formed characteristic tendrils, none were observed for the gbuR transposon and deletion mutant, which grew as a spot at the inoculation point.  A      B       C      D       Figure 1. Swarming motility of the PA14 WT and gbuR mutant. Mutation of the gbuR gene by transposon mutagenesis and deletion mutagenesis resulted in a severe swarming defect. Complementation of the gbuR deletion mutant was able to partially restore swarming. The swarming colonies of PA14 WT (A), gbuR deletion mutant (B), gbuR transposon mutant (C), and the gbuR complemented strain (D) are shown. Complementation of the gbuR deletion mutant was able to partially restore swarming; 15  however it did not restore swarming back to WT levels. This might be due to a gene dosage effect. However, overexpression of the gbuR gene using the pUCP18 high copy vector in the PA14 WT led no changes in swarming compared to the PA14 WT. Quantification of swarming surface coverage is shown in Fig. 2. It should be noted that the gbuR deletion mutant had a growth defect, resulting in slower growth compared to the PA14 WT, gbuR transposon mutant, and the complemented gbuR deletion mutant. While this may have played a slight role in the non-swarming phenotype of the gbuR deletion mutant, it is unlikely to account for the full swarming defect as even extended incubation (2 days) did not result in observable swarming (data not shown). PA14gbuRgbuR transposon mutantgbuR+PA14 gbuR+05 01 0 01 5 0S tra inSurface Coverage (% of PA14 WT)* ** Figure 2. Swarming surface coverage of the PA14 WT and gbuR mutant. Swarming was assayed on BM2 swarming plates grown at 37°C for 18 h. Surface coverage was measured using ImageJ software and represented as percentage of the PA14 WT. * denotes statistically significant difference (P < 0.05) between the PA14 WT and strains tested as determined by Student’s t test.  16  3.2 Enhanced biofilm formation of the gbuR mutant  The biofilm formation of the gbuR mutant was assessed using a static biofilm assay in polystyrene microtitre plates using BM2 minimal media. Both the gbuR transposon and (to a lesser extent) the deletion mutant formed significantly more biofilm than the PA14 WT (Fig. 3). The enhanced biofilm formation could be restored back to WT levels by complementing the gbuR mutation in the deletion mutant (gbuR+). In addition, overexpression of the gbuR gene using the pUCP18 high copy vector in the PA14 WT resulted in decreased biofilm formation compared to the PA14 WT. While both the gbuR transposon and deletion mutant had increased biofilm formation compared to the PA14 WT, the gbuR transposon mutant had much higher levels of biofilm formation than the deletion mutant. This is likely due to the growth defect of the gbuR deletion mutant, preventing it from forming as robust a biofilm as the gbuR transposon mutant. More importantly, despite the growth defect, the deletion mutant still had increased biofilm formation compared to the PA14 WT.PA14 WTgbuRgbuR+PA14 gbuR+gbuR transposon mutant01234S tra inAbsorbance (595 nm)*** Figure 3. Static biofilm assay of the PA14 WT and gbuR mutant. Biofilms were grown in 96 well microtitre plates at 37°C for 24 h using BM2 minimal media. Both the gbuR deletion and transposon mutant had increased biofilm formation, while overexpression of the gbuR gene resulted in decreased biofilm formation compared to the PA14 WT. Complementation of the gbuR was able to restore biofilm formation back to WT levels. The amount of biofilm formation was quantified by crystal violet staining and subsequent measurement of the 17  optical density at 595 nm. * denotes statistically significant difference (P < 0.05) between the PA14 WT and strains tested as determined by Student’s t test. The biofilm matrix can be composed of polysaccharides, DNA, and proteins (30,62). In P. aeruginosa both the pel and psl loci are involved in the production of polysaccharides that are major components of the biofilm matrix, however in strain PA14, only the pel locus has been identified (15,31,32,96). To investigate whether increased pel polysaccharide production contributed to the hyper-biofilm phenotype of the gbuR mutant, Congo red assays were performed. Congo red has been shown to bind to the pel polysaccharides of the biofilm matrix (36,85). Increased production of the pel polysaccharides results in more Congo red binding, which is indicated by a more intense red color of the colony. The gbuR transposon mutant and the gbuR deletion mutant both showed more Congo red binding compared to the PA14 WT and complementation of the gbuR deletion mutant was able to restore the Congo red binding back to that of the PA14 WT (Fig. 4). A   B   C   D         Figure 4. Congo red binding of the PA14 WT and gbuR mutant. Congo red binding was assayed to determine if increased pel polysaccharide production played a role in the hyper-biofilm formation of the gbuR mutant. Congo red plates were grown at 37°C for 24 h followed by 48 h at room temperature. Increased Congo red binding results in a more intense red color of the colony. Colonies of the gbuR transposon mutant (A), gbuR deletion mutant (B), PA14 WT (C), and the gbuR complemented strain (D) are shown. To further study the effect of the gbuR mutation on biofilm formation, biofilms were grown in flow cells and observed using confocal laser scanning microscopy (CLSM). Biofilms grown in flow cells allow for development of a more mature biofilm and through CLSM the structure of the biofilm can also be characterized. In agreement with the static biofilm assay in microtitre plates, the gbuR deletion mutant was found to have increased biofilm formation compared to the PA14 WT (Fig. 5).  18   A       B  Figure 5. Biofilm formation of the PA14 WT and gbuR mutant in the flow cell. Biofilms in flow cells were grown at 37°C for 3 days using BM2 minimal medium. Biofilms were stained with a live/dead stain and visualized using CLSM. The top left panel represents a top view of the biofilm and the bottom and top right panels represent a side view of the biofilm. Biofilm formation of the PA14 WT (A) and gbuR deletion mutant (B) are shown. 3.3 Swimming and twitching of the gbuR mutant  Both biofilm formation and swarming have been shown to be dependent on a functional flagellum and type IV pili. A study by Köhler et al. found that a mutant unable to produce a flagellum was impaired for swarming motility and a mutant lacking type IV pili was completely unable to swarm (54). With respect to biofilm formation, a study by Klausen et al. showed that flagellum and type IV pili mutants were impaired in biofilm formation, demonstrating the need for a functional flagellum and type IV pili for normal biofilm formation to occur (53). To investigate whether the gbuR mutation had any effect on the flagellum or type IV pili, swimming and twitching assays were performed to test for a functional flagella and type IV pili respectively. Swimming was assessed on 0.3% agar, and twitching was assessed on 1% agar. Defects in either swimming or twitching would indicate that the gbuR gene is involved in regulating aspects of the flagellum or type IV pili. In this 19  case, the dysregulation of the flagellum or type IV pili may be partially responsible for the non-swarming and hyper-biofilm formation observed for the gbuR mutant. There was a slight but significant difference in swimming between the gbuR transposon mutant and the PA14 WT (Figure 6), but no significant difference was found between the gbuR transposon mutant and the PA14 WT in twitching motility (Fig. 7). PA14 WTgbuR transposon mutant05 01 0 01 5 0S tra inDiameter (% of PA14 WT)* Figure 6. Swimming motility of the PA14 WT and gbuR mutant. In-agar swimming motility was assayed on LB plates containing 0.3% agar and grown at 37°C for 18 h. The gbuR transposon mutant had a small but statistically significant difference in swimming motility compared to the PA14 WT. * denotes statistically significant difference (P < 0.05) between the PA14 WT and strains tested as determined by Student’s t test. 20  PA14 WTgbuR transposon mutant05 01 0 01 5 0S tra inDiameter (% of PA14 WT) Figure 7. Twitching motility of the PA14 WT and gbuR mutant. Twitching motility was assayed on LB plates containing 1.0% agar and grown at 30°C for 48 h. The gbuR transposon mutant did not display any significant difference in twitching motility.  3.4 Antibiotic susceptibility of the gbuR mutant  Biofilm formation and swarming motility are both complex adaptations that result in increased antibiotic resistance (76,78). In some cases, genes that regulate biofilm formation and swarming have also been found to modulate antibiotic resistance (94). To assess whether the gbuR mutation had any effect on antibiotic resistance, the minimal inhibitory concentrations (MICs) were assessed for a variety of clinical antibiotics including aminoglycosides, cationic peptides, fluoroquinolones, cephalosporins, and penicillins. The MICs for the gbuR transposon mutant and the PA14 WT are shown in Table 4 for the following antibiotics: ciprofloxacin, tobramycin, polymyxin B, ceftazidime, and pipericillin. 21  For all the antibiotics tested, no differences in MIC values were observed for the gbuR transposon mutant compared to the PA14 WT (Table 4). Table 4. MICs of the PA14 WT and gbuR mutant to various antibiotics.   Strain MIC (g/ml) Ciprofloxacin Tobramycin Polymyxin B Ceftazidime Piperacillin PA14 WT 0.1 2 2 2 4 gbuR mutant 0.1 2 2 2 4 3.5 Microarray analysis of the gbuR mutant  To investigate the contribution of the gbuR gene to the inverse regulation of biofilm formation and swarming, microarray studies were performed with the gbuR transposon mutant compared to the PA14 WT under swarming conditions. For the microarray, RNA was extracted from cells on BM2 swarm plates that had been incubated at 37°C for 18 hours. The microarray revealed that 40 genes were differentially regulated by more than 2-fold, with 30 transcriptionally upregulated and 10 transcriptionally downregulated genes (Table 5; see Supplementary Table 1 for full gene list). It should be noted that PA01 DNA microarray slides were used to analyze the gene expression of the PA14 gbuR transposon mutant and the PA14 WT, since there is no PA14 specific microarray slide available. The PA14 genome is slightly larger than the PA01 genome, 6.5 Mbp compared to 6.3 Mbp, however the PA14 genome is highly similar to the PA01 genome, with more than 92% of the all genes in PA14 being present in PA01.   Analysis of the microarray revealed genes involved in the arginine deiminase pathway, nitrate metabolism, and denitrification. Of the 40 genes found to be differentially regulated, 20 were hypothetical proteins of unknown function and 5 were proteins that had predicted function. The dysregulation of genes involved in the arginine deiminase pathway (arcC and arcD) is noteworthy. It has been reported that gbuR is a regulator of the gbuA gene, which encodes for a guanidobutyrase enzyme that is involved in catalyzing 4-guanidobutyrate to 4-aminobutyrate in the arginine dehydrogenase pathway (73). Although arcC and arcD are not involved in the arginine dehydrogenase pathway, this finding potentially expands the role of gbuR in arginine metabolism by showing its involvement in a different pathway of arginine metabolism.  22  The microarray data also revealed several interesting genes that were differentially expressed. One of these genes, pvdS, encodes for the PvdS sigma factor and was upregulated in the gbuR mutant. The sigma factor PvdS is involved in the regulation of production of pyoverdine, a siderophore (21). Iron not only serves as a signal for biofilm formation, but is required for normal biofilm formation to proceed as well, and P. aeruginosa mutants hindered in the production of pyoverdine show decreased biofilm formation (4). Contrary to the upregulation of pvdS in the microarray, RT-qPCR revealed a 15.1 fold and 6.2 fold downregulation in the gbuR transposon mutant and deletion mutant respectively, compared to the PA14 WT. One other gene of interest, pa-1L, was upregulated in the gbuR mutant. The pa-1L gene encodes the LecA lectin that is an adhesin required for normal biofilm formation and acts to bind cells together and to the surface (28). A study by Diggle et al. looking at the involvement of LecA in biofilm formation found that a mutation in the pa-1L gene resulted in decreased biofilm formation, while overexpression of pa-1L enhanced biofilm formation compared to the WT (28). It has also been shown that pa-1L has a role in P. aeruginosa virulence through adhesion to host tissues (12). Upregulation of the pa-1L gene was confirmed by RT-qPCR, showing a 10.6 fold and 3.3 fold upregulation in the gbuR transposon mutant and deletion mutant respectively, compared to the PA14 WT. Interestingly, the microarray detected an upregulation of the gbuR gene compared to the PA14 WT in the gbuR transposon mutant. RT-qPCR revealed that there was a 9.9 fold upregulation of the gbuR gene in the gbuR transposon mutant while no difference in expression was observed for the gbuR deletion mutant compared to the PA14 WT.        23  Table 5. Selected list of genes differentially regulated under swarming conditions in the gbuR mutant.  Gene Name Probe ID Product Name Fold change p-value ebayes adhA PA5427 alcohol dehydrogenase 6.00 0.027 arcC PA5173 carbamate kinase 6.27 0.024 arcD PA5170 arginine/ornithine antiporter 2.35 0.038 ccpR PA4587 cytochrome c551 peroxidase precursor 2.29 0.043 gbuR PA1422 GbuR 2.34 0.038 ibpA PA3126 heat-shock protein IbpA 3.95 0.018 mexG PA4205 hypothetical protein 2.40 0.038 nasA PA1783 nitrate transporter -4.61 0.020 nirB PA1781 assimilatory nitrite reductase large subunit -5.18 0.043 nirD PA1780 assimilatory nitrite reductase small subunit -3.47 0.023 nirF PA0516 heme d1 biosynthesis protein NirF 3.37 0.040 nirJ PA0511 heme d1 biosynthesis protein NirJ 2.66 0.043 norC PA0523 nitric-oxide reductase subunit C 9.20 0.018 opdD PA4501 probable porin -2.63 0.044 pa1L PA2570 PA-I galactophilic lectin 3.57 0.043 pvdS PA2426 sigma factor PvdS 2.79 0.043         24  4 Discussion 4.1 Effect of gbuR on biofilm formation and swarming motility   In this study, the gene gbuR was characterized in terms of its effect on biofilm formation and swarming motility. Mutation in the gbuR gene resulted in a profound effect on both biofilm formation and swarming motility. Swarming assays revealed that, unlike the PA14 WT where swarming results in the outgrowth of tendrils, the gbuR mutant was completely unable to swarm, forming just a spot of growth at the inoculation point. The complete lack of any swarming motility in the gbuR mutant as shown by the lack of tendril formation indicates that the gbuR mutant is unable to undergo swarm cell differentiation and initiate swarming. The results of the swarming assay suggests that in the PA14 WT, gbuR promotes swarming motility and might do so by acting as a switch for the initiation of swarming and swarm cell differentiation in response to environmental conditions. Using a static biofilm assay in microtitre plates, it was initially observed that biofilm formation was enhanced in the gbuR mutant compared to the PA14 WT. Overexpression of the gbuR gene in PA14 was also shown to reduce biofilm formation compared to the PA14 WT. The enhanced biofilm formation was confirmed by growing more mature biofilms (3 day old biofilms) in flow cells and visualizing them using CLSM. The increased biofilm formation seen in both the microtitre plates (representing an early stage in biofilm development) and the flow cell indicates that the gbuR mutation not only affects early stages of biofilm formation, but also influences later stages during biofilm maturation. To further study the impact of the gbuR mutation on biofilm formation, Congo red assays were performed as Congo red binds to the pel polysaccharides of the biofilm matrix and serves as an indicator for the amount of biofilm formation (36,86). It was observed that mutation in gbuR results in increased Congo red binding compared to the PA14 WT, suggesting that in the gbuR mutant the production of pel polysaccharides is increased and may in part explain the hyper-biofilm formation of the gbuR mutant. Interestingly, the microarray data did not show any genes in the pel locus to be upregulated, even though the gbuR mutant had increased Congo red binding. While it is peculiar that no upregulation of genes in the pel locus was observed, this phenomenon has been observed by others as well (55). A study characterizing the inverse regulation of biofilm formation and swarming by the gene bifA 25  found that mutation in the bifA gene resulted in a hyper-biofilm and non-swarming phenotype (55). The authors were also able to show that the bifA mutant had increased Congo red binding, but q-PCR revealed that none of the genes in the pel locus were upregulated, and it was speculated that the increase in pel polysaccharide production was through another mechanism not involving transcription (55). It is worth noting that the microarray was done under swarming conditions, and although the gbuR mutant cannot swarm, the pel gene locus might not have been upregulated under the tested conditions. However, under biofilm conditions or growth on Congo red plates, it might be possible to see an upregulation of genes in the pel locus for the gbuR mutant. Our data on the effect of the gbuR mutation on biofilm formation suggest that in the PA14 WT, the gbuR gene acts as a repressor of biofilm formation, with one potential mechanism being through the inhibition of polysaccharide production. This could be through another mechanism other than transcription, e.g. translational regulation by a GbuR-induced small RNA or signalling, e.g. via cyclic di-GMP. Given that the gbuR gene promotes swarming motility, the ability to also repress biofilm formation might ensure that P. aeruginosa cells are coordinated and act in unison according to the environmental signals. Swimming and twitching motility assays were performed to determine if there was any altered function of the flagellum or type IV pili in the gbuR mutant. Differences in either swimming (dependant on a functional flagellum) or twitching motility (dependant on type IV pili) would suggest that the gbuR gene is involved in regulating the flagellum or type IV pili, which could in turn affect biofilm formation and swarming motility. No differences were seen in twitching motility between the gbuR transposon mutant and the PA14 WT. However, there was a small but significant difference in swimming motility. Although there is a statistically significant difference in swimming motility, such a small decrease in swimming is unlikely to make a meaningful contribution to the swarming and biofilm phenotypes observed for the gbuR mutant. With no differences in twitching and such a minor decrease in swimming motility, gbuR probably affects biofilm formation and swarming primarily through other means. It is also possible that the gbuR gene has a viscosity dependant effect on the flagellum. A study characterizing the inverse regulation of biofilm formation and swarming motility by the gene, sadB, found that while mutation of the sadB gene did not result in any changes in swimming motility, under higher viscosity conditions similar to 26  swarming, but the mutant was observed to have an increased frequency of flagellar reversal (9). The increased rate of flagellar reversal was speculated to play a role in the hyper-swarming and reduced biofilm phenotype observed for the sadB mutant and presumably the sadB gene acts to decrease flagellar reversal in the WT (9).  Thus it is possible that the gbuR gene has a more profound effect on the function of the flagella under high viscosity conditions through reducing flagellar reversal, which was not tested in this study. The data suggests that in the PA14 WT, the gbuR gene is a regulator that promotes swarming motility, while suppressing biofilm formation. In addition, the reciprocal relationship between swarming motility and biofilm formation in the gbuR mutant indicates that gbuR acts as an inverse regulator of these two surface-associated behaviors. Thus, in response to environmental signals favoring swarming motility, gbuR might act as a molecular switch to promote swarming and at the same time repress biofilm formation, ensuring that the P. aeruginosa cells behave in unison under the appropriate environmental conditions. 4.2 Growth defect of the gbuR deletion mutant  The growth defect of the gbuR deletion mutant brings into question whether the gbuR gene has an actual transcriptional regulatory effect on swarming motility, and if the non-swarming observed for the gbuR mutant was a result of the growth defect. This is unlikely as even with extended incubation (2 days), the gbuR deletion mutant was still unable to swarm. The gbuR deletion mutant also had higher levels of biofilm formation in the static biofilm assay and flow cell despite the growth defect. Thus the non-swarming and hyper-biofilm formation observed for the gbuR deletion mutant are likely the result of the absence of the regulatory effect of gbuR on biofilm formation and swarming, rather than due to a growth defect. 4.3 Genes regulated by gbuR Microarray analysis of the gbuR transposon mutant compared to the PA14 WT under swarming conditions revealed a number of interesting findings about the gbuR regulon. Two genes involved in the arginine deiminase pathway, arcC and arcD, were found to be upregulated in the gbuR mutant. It has been reported that gbuR regulates gbuA, which encodes a guanidobutyrase involved in the arginine dehydrogenase pathway (73). It is 27  surprising that none of the differentially expressed genes are involved in the arginine dehydrogenase pathway, but genes in the arginine deiminase pathway were differentially expressed. This suggests that the gbuR gene has additional functions in arginine metabolism, as a positive regulator of gbuA, which is involved in the arginine dehydrogenase pathway and also as a repressor of the arginine deiminase pathway. The arginine deiminase pathway is induced under limited oxygen conditions, such as during biofilm growth, and also in the absence of nitrate as an electron acceptor, and allows P. aeruginosa to generate ATP by arginine fermentation (64,73). A report by Müsken et al. found that arginine metabolism is essential for the establishment of a robust biofilm and mutants with defects in arginine metabolism were found to be hindered in their ability to form biofilms (72). Exogenous addition of arginine to the growth media was shown to increase biofilm formation, and it was speculated by the authors that arginine was serving as a source of carbon, energy, and nitrogen during biofilm growth (72). It has also been reported that arginine increases biofilm formation while inhibiting swarming motility when provided as the sole nitrogen source (5). In addition, cells grown with arginine as the sole nitrogen source had increased cellular levels of cyclic di-GMP, a signalling molecule that promotes a sessile lifestyle, and it was hypothesized that arginine serves as an environmental signal that promotes biofilm formation (5). In the gbuR mutant, one of the upregulated genes involved in the arginine deiminase pathway, arcD, encodes an arginine/ornithine antiporter. The increased expression of arcD may result in a rise of cellular levels of arginine, which in turn acts as a signal to promote biofilm formation, contributing to the hyper-biofilm formation of the gbuR mutant. Another possibility is that the upregulation of genes in the arginine deiminase pathway is a response of the gbuR mutant to sustain increased biofilm formation. In the PA14 WT, gbuR might act to repress genes of the arginine deiminase pathway, which in turn inhibits biofilm formation given the importance of arginine metabolism in biofilm formation.  The microarray also highlighted some interesting genes that were differentially expressed in the gbuR mutant. One of these genes, pa-1L, was upregulated in the gbuR mutant. pa-1L encodes for the LecA lectin. LecA is an adhesin that binds cells together and is required for biofilm formation to proceed (28). Mutation of the lecA gene results in a defect in biofilm formation and overexpression causes increased biofilm formation (28). The upregulation of pa-1L seen in the gbuR mutant would possibly result in increased production 28  of the LecA adhesin, and this in turn might enhance biofilm formation as has been reported for LecA overexpression (28). A rise in lecA expression might also explain the non-swarming phenotype of the gbuR mutant. Cells bound together by the LecA adhesin would likely have their movement hindered, interfering with their ability to engage in swarming motility. In the PA14 WT, the gbuR gene probably represses the expression of the LecA adhesin, preventing excess biofilm formation and allowing the cells to freely engage in swarming motility. In agreement with this, a previous report found that the LecA lectin was down regulated in actively swarming cells (85). It was speculated by the authors that the decreased expression allowed the fast moving swarming cells to freely migrate, and that this might have been prevented by the LecA lectin (85). The LecA lectin has also been shown to play a role in virulence through adhesion to host tissues (12). A study by Chemani et al. discovered that a lecA mutant had reduced cytotoxicity and adhesion to lung epithelial cells as well as decreased bacterial burden and dissemination in an in vivo lung infection model (12). This suggests a role for gbuR in virulence through the regulation of LecA, although this would require further investigation.  Another gene, pvdS, which encodes a sigma factor, was upregulated in the gbuR mutant. PvdS is responsible for regulating genes that are involved in the production of pyoverdine, a siderophore (21). It has been previously reported that chelated iron serves a signal for biofilm development, and that in iron deplete conditions, biofilm formation is hindered (21). In addition, mutants affected in their ability to produce pyoverdine demonstrated decreased biofilm formation, presumably because of the reduced iron uptake. It is therefore possible that in the gbuR mutant, the upregulation of pvdS results in enhanced production of pyoverdine, which in turn increases the transport of chelated iron. The increased influx of chelated iron may then serve as a signal for biofilm formation resulting in the hyper-biofilm formation observed for the gbuR mutant. In the PA14 WT, one of the functions of the gbuR gene might be to repress the expression of pvdS, resulting in decreased pyoverdine production, lowering the amount of chelated iron and thus repressing biofilm formation. An alternative explanation is that the upregulation of pvdS is a response to low iron conditions in the gbuR mutant. A study comparing the transcriptional profiles of actively swarming cells in the swarming tendrils to non-swarming cells of the swarm center found that cells in the swarm center had upregulated expression of genes involved in pyoverdine 29  production (85). It was suggested that in the centre of the swarm colony, iron is limited, resulting in increased production of pyoverdine, as opposed to swarming cells that still have a ready supply of iron (85). Since the gbuR mutant cannot swarm and thus acquire a fresh supply of nutrients, it is possible that the gbuR mutant is somewhat iron limited, and the upregulation of the pvdS gene might be in response to this. RT-qPCR was unable to confirm the upregulation of the pvdS gene and showed a downregulation of the pvdS gene in both the transposon and deletion mutant. Despite the contradicting results, a pyoverdine assay measuring the absorbance of culture supernatants at 400 nm found increased absorbance in the supernatant of the gbuR mutant compared to the PA14 WT indicating increased pyoverdine production (data not shown). The microarray detected that the gbuR gene was upregulated in the gbuR transposon mutant, and RT-qPCR showed a 9.9 fold upregulation in the transposon mutant, while no difference in expression was found in the gbuR deletion mutant. This may be the result of the gbuR probe or primer still binding to the mutated transcript produced by the transposon mutant. Although it is peculiar that gbuR is upregulated, it may be the case that gbuR is involved only in swarming initiation, as suggested earlier. Thus during later stages of swarming when cells were extracted for RNA isolation (18h), gbuR expression may be abolished in the PA14 WT as it is not required to sustain swarming. Since the gbuR transposon mutant cannot initiate swarming because the GbuR protein is not functional, it may continually express the mutated gbuR transcripts since it is essentially “locked” in trying to initiate swarming. The gbuR transcripts which the probe or primers are binding to may therefore result in the increased expression of gbuR seen in the microarray and RT-qPCR for the transposon mutant. This seems likely as with the deletion mutant where no transcript would be produced, there is no difference in expression compared to the PA14 WT. One would expect the gbuR gene to be downregulated in the deletion mutant, however this may again be the result of gbuR only being involved in swarming initiation. If gbuR is not expressed during later stages of swarming, this would result in no difference in expression between the gbuR deletion mutant and the PA14 WT when the cells were harvested for RNA extraction (18h).  30  4.4 Involvement of gbuR in antibiotic resistance Given that biofilm formation and swarming motility are virulence related processes that both result in increased antibiotic resistance, MICs were determined to see whether gbuR, in addition to inversely regulating biofilm formation and swarming, was also able to influence antibiotic resistance. This study examined the MICs of the gbuR transposon mutant and PA14 WT to a variety of antibiotics including ciprofloxacin, tobramycin, polymyxin B, ceftazidime, and piperacillin. The results of the MICs showed that there was no difference in antibiotic susceptibility between the gbuR transposon mutant and PA14 WT. Despite these findings, it should be noted that the MICs were tested under planktonic conditions in microtitre plates. Whether or not the gbuR gene has any influence on antibiotic resistance during swarming motility or biofilm formation is a possibility and would require further investigation. 4.5 Complementation of the gbuR mutant The gbuR deletion mutant was complemented using the pUCP18 high copy vector carrying a fragment containing the gbuR gene and approximately 500 bp of the upstream and downstream regions. Complementation of the gbuR deletion mutant was able to restore biofilm formation back to WT levels (Fig. 3), however for swarming motility there was only a partial complementation of the swarming defect (Fig. 1,2). The partial complementation of swarming motility is perhaps due to a certain level of expression needed for normal swarming to occur. Expression of the gbuR gene from the pUCP18 high copy vector may therefore be unable to achieve the particular expression level needed to restore swarming back to WT levels.  4.6 Future areas of research  Future directions might look at some potential mechanisms by which the gbuR gene is able to inversely regulate biofilm formation and swarming motility. One potential mechanism is through modulating levels of the signalling molecule cyclic di-GMP. A number of genes that inversely control biofilm formation and swarming have been shown to do so through controlling cyclic di-GMP levels. It would therefore be an interesting avenue of research to examine whether GbuR plays a role in regulating cellular cyclic di-GMP levels as a 31  mechanism to inversely regulate biofilm formation and swarming motility.  The transcriptional analysis done in this study looked at differentially expressed genes of the gbuR mutant and PA14 WT under swarming conditions. However, because gbuR is also involved in regulating biofilm formation, looking at the gene expression of the gbuR mutant compared to the PA14 WT under biofilm conditions would provide a better understanding of the gbuR regulon. For example, genes shown to be upregulated in the gbuR mutant under biofilm conditions would suggest that they are normally repressed by gbuR in the WT and vice versa. Elucidating more about the gbuR regulon might provide insight into how gbuR is able to regulate biofilm formation and also expand on our knowledge about the inverse regulation of biofilm formation and swarming in P. aeruginosa.  Lastly, biofilm formation and swarming motility are two surface-associated behaviors that are both associated with virulence in P. aeruginosa. Biofilms in P. aeruginosa are associated with chronic infections, and swarming represents an acute infection state. The involvement of gbuR in the inverse regulation of biofilm formation and swarming may therefore influence the mode of infection in P. aeruginosa. Future research could look at the gbuR mutant in acute and chronic infection models to determine if the gbuR mutant is altered in its ability to cause acute or chronic infections. Doing so has the possibility to establish gbuR as a gene that influences virulence as well as provide insight into how the inverse regulation of biofilm formation and swarming affects virulence in P. aeruginosa. 4.7 Conclusion  In this study the gbuR gene was investigated for its ability to inversely regulate biofilm formation and swarming motility in P. aeruginosa PA14. It was shown that mutation of the gbuR gene results in a severe defect in swarming motility and enhances biofilm formation, indicating the gene acts to inversely promote swarming and inhibit biofilm formation in the PA14 WT. In addition transcriptional profiling allowed for the regulon of gbuR to be studied, revealing a number of genes under the control of gbuR that were potentially influencing biofilm formation and swarming motility. This project is a starting point for investigations into the gbuR gene and its ability to inversely regulate biofilm formation and swarming motility. Further research can look to reveal the mechanism(s) by which gbuR is able to achieve this and any possible implications this has for virulence in P. 32  aeruginosa.   33  References 1. Allison C, Emody L, Coleman N, & Hughes C. 1994. The role of swarm cell differentiation and multicellular migration in the uropathogenicity of Proteus mirabilis. J. Infect. Dis. 169: 1155-1158. 2. Allison C, Lai HC, Hughes C. 1992. Co-ordinate expression of virulence genes during swarm-cell differentiation and population migration of Proteus mirabilis. Mol. Microbiol. 6: 1583-1591. 3. Banerjee D, Stableforth D. 2000. The treatment of respiratory pseudomonas infection in cystic fibrosis: what drug and which way?. Drugs. 60(5):1053-64. 4.  Banin E, Vasil ML, Greenberg EP. 2005. Iron and Pseudomonas aeruginosa biofilm formation. Proc Natl Acad Sci U S A. 102(31):11076-81. 5. Bernier SP, Ha DG, Khan W, Merritt JH, O'Toole GA. 2011. Modulation of Pseudomonas aeruginosa surface-associated group behaviors by individual amino acids through c-di-GMP signaling. Res Microbiol. 162(7):680-8.  6. Bjarnsholt T. 2013. The role of bacterial biofilms in chronic infections. APMIS Suppl. 136:1-51. 7. Blanc DS, Francioli P, Zanetti G. 2007. Molecular Epidemiology of Pseudomonas aeruginosa in the Intensive Care Units - A Review. Open Microbiol J. 1:8-11. 8. Bodey GP, Bolivar R, Fainstein V, Jadeja L. 1983. Infections caused by Pseudomonas aeruginosa. Rev Infect Dis. 5(2):279-313. 9. Caiazza NC, Merritt JH, Brothers KM, O'Toole GA. 2007. Inverse regulation of biofilm formation and swarming motility by Pseudomonas aeruginosa PA14. J Bacteriol. 189(9):3603-12. 10. Caiazza NC, O'Toole GA. 2004. SadB is required for the transition from reversible to irreversible attachment during biofilm formation by Pseudomonas aeruginosa PA14. J Bacteriol. 186(14):4476-85. 11. Caiazza NC, Shanks RM, O'Toole GA. 2005. Rhamnolipids modulate swarming motility patterns of Pseudomonas aeruginosa. J Bacteriol. 187(21):7351-61 12. Chemani et al. 2009. Role of LecA and LecB lectins in Pseudomonas aeruginosa-induced lung injury and effect of carbohydrate ligands. Infect Immun. 77(5):2065-75. 13. Choi KH, Kumar A, Schweizer HP. 2006. A 10-min method for preparation of highly 34  electrocompetent Pseudomonas aeruginosa cells: application for DNA fragment transfer between chromosomes and plasmid transformation. J. Microbiol. Methods. 64:391-397 14. Cohen-Cymberknoh M, Shoseyov D, Kerem E. 2011. Managing cystic fibrosis: strategies that increase life expectancy and improve quality of life. Am J Respir Crit Care Med. 183(11):1463-71.  15. Colvin KM. 2012. The Pel and Psl polysaccharides provide Pseudomonas aeruginosa structural redundancy within the biofilm matrix. Environ Microbiol. 14(8):1913-28.  16. Conway SP, Brownlee KG, Denton M, Peckham DG. 2003. Antibiotic treatment of multidrug-resistant organisms in cystic fibrosis. Am J Respir Med. 2(4):321-32. 17. Costerton W. 1987. Bacterial Biofilms in Nature and Disease. Ann. Rev. Microbiol. 41:435-64  18. Costerton JW, Lewandowski Z, Caldwell DE, Korber DR, Lappin-Scott HM. 1995. Microbial biofilms. Annu Rev Microbiol. 49:711-45. 19. Costerton JW, Stewart PS, Greenberg EP. 1999. Bacterial biofilms: a common cause of persistent infections. Science. 284(5418):1318-22. 20. Cross A et al. 1983. Nosocomial infections due to Pseudomonas aeruginosa: review of recent trends. Rev Infect Dis. 5 Suppl 5:S837-45. 21. Cunliffe HE, Merriman TR, Lamont IL. 1995. Cloning and characterization of pvdS, a gene required for pyoverdine synthesis in Pseudomonas aeruginosa: PvdS is probably an alternative sigma factor. J Bacteriol. 177(10):2744-50. 22. D'Argenio DA,  Miller SI. 2004. Cyclic di-GMP as a bacterial second messenger. Microbiology. 150(Pt 8):2497-502. 23. Davies D. 2003. Understanding biofilm resistance to antibacterial agents. Nature Reviews Drug Discovery. 2: 114-122  24. Davies JC. 2002. Pseudomonas aeruginosa in cystic fibrosis: pathogenesis and persistence. Paediatr Respir Rev. 3(2):128-34. 25. Deziel E., Comeau Y, Villemur R. 2001. Initiation of biofilm formation by Pseudomonas aeruginosa 57RP correlates with emergence of hyperpiliated and highly adherent phenotypic variants deficient in swimming, swarming, and twitching motilities. J. Bacteriol. 183:1195-1204 26. Déziel E, Lépine F, Milot S, Villemur R. 2003. rhlA is required for the production of a 35  novel biosurfactant promoting swarming motility in Pseudomonas aeruginosa: 3-(3-hydroxyalkanoyloxy)alkanoic acids (HAAs), the precursors of rhamnolipids. Microbiology. 149(Pt 8):2005-13. 27. Diaz MR, King JM, Yahr TL. 2011. Intrinsic and Extrinsic Regulation of Type III Secretion Gene Expression in Pseudomonas Aeruginosa. Front Microbiol. 2:89.  28. Diggle SP et al. 2006. The galactophilic lectin, LecA, contributes to biofilm development in Pseudomonas aeruginosa. Environ Microbiol. 8(6):1095-104. 29. Drenkard E, Ausubel FM. 2002. Pseudomonas biofilm formation and antibiotic resistance are linked to phenotypic variation. Nature. 416(6882):740-3. 30. Flemming HC, Wingender J. 2010. The biofilm matrix. Nature Reviews Microbiology. 8: 623-633 31. Franklin MJ1, Nivens DE, Weadge JT, Howell PL. 2011. Biosynthesis of the Pseudomonas aeruginosa Extracellular Polysaccharides, Alginate, Pel, and Psl. Front Microbiol. 2:167.  32. Friedman L, Kolter R. 2004. Genes involved in matrix formation in Pseudomonas aeruginosa PA14 biofilms. Mol. Microbiol. 51:675-690 33. de la Fuente-Núñez C et al. 2012. Inhibition of bacterial biofilm formation and swarming motility by a small synthetic cationic peptide. Antimicrob Agents Chemother. 56(5):2696-704.  34. de la Fuente-Núñez C, Reffuveille F, Fairfull-Smith KE, Hancock RE. 2013. Effect of nitroxides on swarming motility and biofilm formation, multicellular behaviors in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 57(10):4877-81. 35. Gellatly SL, Hancock REW. 2013. Pseudomonas aeruginosa: new insights into pathogenesis and host defenses. Pathog Dis. 67:159–173. 36. Ghafoor A, Hay ID, Rehm BH. 2011. Role of exopolysaccharides in Pseudomonas aeruginosa biofilm formation and architecture. Appl Environ Microbiol. 77(15):5238-46.  37. Goldberg JB, Pier GB. 2000. The role of the CFTR in susceptibility to Pseudomonas aeruginosa infections in cystic fibrosis. Trends Microbiol. 8(11):514-20. 38. Goodman AL et al. 2004. A signaling network reciprocally regulates genes associated with acute infection and chronic persistence in Pseudomonas aeruginosa. Dev Cell. 7(5):745-54. 36  39. Govan JR, Deretic V. 1996. Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol Rev. 60(3): 539–574. 40. Hall-Stoodley L, Costerton JW, Stoodley P. 2004. Bacterial biofilms: from the Natural environment to infectious diseases. 2:95-108 41. Harmsen M, Yang L, Pamp SJ, Tolker-Nielsen T. 2010. An update on Pseudomonas aeruginosa biofilm formation, tolerance, and dispersal. FEMS Immunol Med Microbiol. 59(3):253-68. 42. Hassett DJ et al. 2010. Pseudomonas aeruginosa biofilm infections in cystic fibrosis: insights into pathogenic processes and treatment strategies. Expert Opin Ther Targets. 14(2):117-30.  43. Hengge R. 2009. Principles of c-di-GMP signalling in bacteria. Nature Reviews Microbiology 7: 263-73. 44. Heurlier K et al. 2004. Positive Control of Swarming, Rhamnolipid Synthesis, and Lipase Production by the Posttranscriptional RsmA/RsmZ System in Pseudomonas aeruginosa PAO1 J. Bacteriol. 186(10): 2936-2945. 45. Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. 1998. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212:77-86 46. Høiby N, Ciofu O, Bjarnsholt T. 2010. Pseudomonas aeruginosa biofilms in cystic fibrosis. Future Microbiol.  5(11):1663-74. 47. Horton R.M, Hunt HD, Ho SN, Pullen JK, Pease LR.1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77:61-68. 48. Inoue T, Shingaki R, Fukui K. Inhibition of swarming motility of Pseudomonas aeruginosa by branched-chain fattyacids. FEMS Microbiol Lett. 281(1):81-6 49. Jiang C, Finkbeiner WE, Widdicombe JH, McCray PB Jr, Miller SS. 1993. Altered fluid transport across airway epithelium in cystic fibrosis. Science. 262(5132):424-7. 50. Josenhans C, Suerbaum S. 2002. The role of motility as a virulence factor in bacteria. Int J Med Microbiol. 291(8):605-14. 51. Kaiser D. 2007. Bacterial Swarming: A Re-examination Review of Cell-Movement 37  Patterns. Curr Biol. 17(14):R561-70. 52. Kearns DB. 2010. A field guide to bacterial swarming motility. Nat Rev Microbiol. 8(9):634-44 53. Klausen M et al. 2003. Biofilm formation by Pseudomonas aeruginosa wild type, flagella and type IV pili mutants. Mol Microbiol. 48(6):1511-24. 54. Köhler T et al. 2000. Swarming of Pseudomonas aeruginosa Is Dependent on Cell-to-Cell Signaling and Requires Flagella and Pili. J Bacteriol. 182(21):5990-6. 55. Kuchma SL et al. 2007. BifA, a cyclic-Di-GMP phosphodiesterase, inversely regulates biofilm formation and swarming motility by Pseudomonas aeruginosa PA14. J Bacteriol. 189(22):8165-78. 56. Kuchma SL, Connolly JP, O'Toole GA. 2005. A three-component regulatory system regulates biofilm maturation and type III secretion in Pseudomonas aeruginosa. J Bacteriol. 187(4):1441-54. 57. Langton Hewer SC, Smyth AR. 2009. Antibiotic strategies for eradicating Pseudomonas aeruginosa in people with cystic fibrosis. Cochrane Database Syst Rev. (4):CD004197. 58. Laskowski MA, Kazmierczak BI. 2006. Mutational analysis of RetS, an unusual sensor kinase-response regulator hybrid required for Pseudomonas aeruginosa virulence. Infect Immun. 74(8):4462-73. 59. Lederberg J et al. 2000. Pseudomonas. Encyclopedia of Microbiology. Second Edition. 3:876-891. 60. Liberati NT et al. 2006. An ordered, non redundant library of Pseudomonas aeruginosa strain PA14 transposon insertion mutants. Proc. Natl. Acad. Sci. U. S. A. 103:2833-38. 61. Lyczak JB, Cannon CL, Pier GB. 2000. Establishment of Pseudomonas aeruginosa infection: lessons from a versatile opportunist. Microbes Infect. 2(9):1051-60. 62. Ma L et al. 2009. Assembly and development of the Pseudomonas aeruginosa biofilm matrix. PLoS Pathog. 5:e1000354. 63. Mah TF et al. 2003. A genetic basis for Pseudomonas aeruginosa biofilm antibiotic resistance. Nature. 426(6964):306-10. 64. Mercenier A, Simon JP, Vander Wauven C, Haas D, Stalon V. 1980. Regulation of enzyme synthesis in the arginine deiminase pathway of Pseudomonas aeruginosa. J Bacteriol. 144(1):159–163. 38  65. Mesaros N et al. 2007. Pseudomonas aeruginosa: resistance and therapeutic options at the turn of the new millenium. Clin Microbiol Infect. 13:560–578. 66. Merritt JH, Brothers KM, Kuchma SL, O'Toole GA. 2007. SadC reciprocally influences biofilm formation and swarming motility via modulation of exopolysaccharide production and flagellar function. J Bacteriol. 189(22):8154-64. 67. Moreau-Marquis S, Stanton BA, O'Toole GA. 2008. Pseudomonas aeruginosa biofilm formation in the cystic fibrosis airway. Pulm Pharmacol Ther. 21(4):595-9. 68. Moscoso JA, Mikkelsen H, Heeb S, Williams P, Filloux A. 2011. The Pseudomonas aeruginosa sensor RetS switches type III and type VI secretion via c-di-GMP signalling. Environ Microbiol. 13(12):3128-38.  69. Mulcahy H et al. 2008. Pseudomonas aeruginosa RsmA plays an important role during murine infection by influencing colonization, virulence, persistence, and pulmonary inflammation. Infect Immun. 76(2):632-8.  70. Mulcahy H, O'Callaghan J, O'Grady EP, Adams C, O'Gara F. 2006. The posttranscriptional regulator RsmA plays a role in the interaction between Pseudomonas aeruginosa and human airway epithelial cells by positively regulating the type III secretion system. Infect Immun. 74(5):3012-5. 71. Murray TS, Ledizet M, Kazmierczak BI. 2010. Swarming motility, secretion of type 3 effectors and biofilm formation phenotypes exhibited within a large cohort of Pseudomonas aeruginosa clinical isolates. J Med Microbiol. 59(Pt 5):511-20. 72. Müsken M, Di Fiore S, Dötsch A, Fischer R, Häussler S. 2010.  Genetic determinants of Pseudomonas aeruginosa biofilm establishment. Microbiology. 156(2):431-441. 73. Nakada Y, Itoh Y. 2002. Characterization and regulation of the gbuA gene, encoding guanidinobutyrase in the arginine dehydrogenase pathway of Pseudomonas aeruginosa PAO1. J Bacteriol. 184(12):3377-84. 74. O’Toole GA. 2008. How Pseudomonas aeruginosa Regulates Surface Behaviors. Microbe. 3: 65-71. 75. O'Toole GA. 2011. Microtiter Dish Biofilm Formation Assay. J Vis Exp. 47:2437 76. Overhage J, Bains M, Brazas MD, Hancock REW. 2008. Swarming of Pseudomonas aeruginosa is a complex adaptation leading to increased production of virulence factors and antibiotic resistance. J Bacteriol. 190(8):2671-9.  39  77. Robert C. De Lisle. 2009. Pass the bicarb: the importance of HCO3–for mucin release. J Clin Invest. 119(9):2535-7.  78. Römling U, Balsalobre C. 2012. Biofilm infections, their resilience to therapy and innovative treatment strategies. J Intern Med.  272(6):541-61.  79. Römling U, Galperin MY, Gomelsky M. 2013. Cyclic di-GMP: the First 25 Years of a Universal Bacterial Second Messenger. Microbiol Mol Biol Rev. 77(1):1-52 80. Rozalski A, Sidorczyk Z, & Kotelko K. 1997. Potential virulence factors of Proteus bacilli. Microbiol. Mol. Biol. Rev. 61: 65-89. 81. Rozen S, Skaletsky HJ. 2000. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 132:365-86. 82. Simm R, Morr M, Kader A, Nimtz M, Römling M. 2004. GGDEF and EAL domains inversely regulate cyclic di-GMP levels and transition from sessility to motility. Mol Microbiol. 53(4):1123-34. 83. Simon R, Priefer U, Pühler A. 1983. A Broad Host Range Mobilization System for In Vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria. Nat. Biotechnol. 1:784791 84. Stover CK et al. 2000. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature. 406: 959-964. 85. Tremblay J, Déziel E. 2010. Gene expression in Pseudomonas aeruginosa swarming motility. BMC Genomics 11: 587 86. Vasseur P, Vallet-Gely I, Soscia C, Genin S, Filloux A. 2005. The pel genes of the Pseudomonas aeruginosa PAK strain are involved at early and late stages of biofilm formation. Microbiology. 151(Pt 3):985-97. 87. Ventre I et al. 2006. Multiple sensors control reciprocal expression of Pseudomonas aeruginosa regulatory RNA and virulence genes. Proc Natl Acad Sci U S A. 103(1):171-6.  88. Verstraeten N et al. 2008. Living on a surface: swarming and biofilm formation. Trends Microbiol. 16(10):496-506 89. Walker KE, Moghaddame-Jafari S, Lockatell CV, Johnson D, Belas R. 1999 ZapA, the IgA-degrading metalloprotease of Proteus mirabilis, is a virulence factor expressed specifically in swarmer cells. Mol. Microbiol. 32: 825-836. 40  90. We Qi, Ma LZ. 2013. Biofilm Matrix and Its Regulation inPseudomonas aeruginosa. Int. J. Mol. Sci. 14(10): 20983-21005 91. West SE, HP Schweizer, Dall C, Sample AK, Runyen-Janecky LJ. 1994. Construction of improved Escherichia-Pseudomonas shuttle vectors derived from pUC18/19 and sequence of the region required for their replication in Pseudomonas aeruginosa. Gene. 148:81-86. 92. Wiegand I, Hilpert K, Hancock REW. 2008. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat. Protoc. 3:163–175 93. Yeung AT et al. 2009. Swarming of Pseudomonas aeruginosa is controlled by a broad spectrum of transcriptional regulators, including MetR. J Bacteriol. 191(18):5592-602. 94. Yeung AT, Bains M, Hancock RE. 2011. The sensor kinase CbrA is a global regulator that modulates metabolism, virulence, and antibiotic resistance in Pseudomonas aeruginosa. J Bacteriol. 193(4):918-31.  95. Yeung AT, Parayno A, Hancock REW. 2012. Mucin Promotes Rapid Surface Motility in Pseudomonas aeruginosa. MBio. 3(3): pii: e00073-12. 96. Zegans ME. 2012. Pseudomonas aeruginosa exopolysaccharide Psl promotes resistance to the biofilm inhibitor polysorbate 80. Antimicrob Agents Chemother. 56(8):4112-22.          41  Appendix A: Full list of genes differentially regulated under swarming conditions in the gbuR mutant.  Gene Name Probe ID Product Name Fold change p-value ebayes adhA PA5427 alcohol dehydrogenase 5.9954 0.0271 arcC PA5173 carbamate kinase 6.2727 0.0241 arcD PA5170 arginine/ornithine antiporter 2.3511 0.0379 ccpR PA4587 cytochrome c551 peroxidase precursor 2.29 0.0426 gbuR PA1422 GbuR 2.3385 0.0379 ibpA PA3126 heat-shock protein IbpA 3.954 0.0181 mexG PA4205 hypothetical protein 2.4034 0.0379 nasA PA1783 nitrate transporter -4.6144 0.0203 nirB PA1781 assimilatory nitrite reductase large subunit -5.1801 0.0426 nirD PA1780 assimilatory nitrite reductase small subunit -3.4734 0.0233 nirF PA0516 heme d1 biosynthesis protein NirF 3.3691 0.0395 nirJ PA0511 heme d1 biosynthesis protein NirJ 2.6559 0.0426 norC PA0523 nitric-oxide reductase subunit C 9.1977 0.0181 opdD PA4501 probable porin -2.6297 0.0442 pa1L PA2570 PA-I galactophilic lectin 3.5661 0.0426 pvdS PA2426 sigma factor PvdS 2.7944 0.0426 PA1555 PA1555 probable cytochrome c 3.4484 0.0203 PA1782 PA1782 probable serine/threonine-protein kinase -2.9905 0.0241 PA4502 PA4502 probable binding protein component of ABC transporter -2.2951 0.0432 PA4504 PA4504 probable permease of ABC transporter -2.203 0.0241 PA4570 PA4570 hypothetical protein 3.0288 0.0181 PA4911 PA4911 probable permease of ABC branched-chain amino acid transporter -3.0548 0.0241 PA0200 PA0200 hypothetical protein 3.8693 0.0241 PA0433 PA0433 hypothetical protein 2.386 0.0241 PA0713 PA0713 hypothetical protein 3.0718 0.0203 PA1414 PA1414 hypothetical protein 6.6023 0.0241 PA1746 PA1746 hypothetical protein 2.9395 0.0203 PA2381 PA2381 hypothetical protein 2.9314 0.0379 PA2485 PA2485 hypothetical protein 2.9533 0.0203 PA3309 PA3309 hypothetical protein 6.1486 0.0181 PA3530 PA3530 hypothetical protein 3.5401 0.0181 PA3572 PA3572 hypothetical protein 4.1986 0.0302 PA3601 PA3601 hypothetical protein 7.4559 0.0233 42  Gene Name Probe ID Product Name Fold change p-value ebayes PA4139 PA4139 hypothetical protein 38.5241 0.0203 PA4352 PA4352 hypothetical protein 3.8742 0.0418 PA4471 PA4471 hypothetical protein 2.7573 0.0181 PA1894 PA1894 hypothetical protein -2.765 0.037 PA1896 PA1896 hypothetical protein -2.6674 0.0203 PA1897 PA1897 hypothetical protein -3.2943 0.0426 PA5027 PA5027 hypothetical protein 3.7833 0.0426 PA5475 PA5475 hypothetical protein 5.1979 0.0302    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0167120/manifest

Comment

Related Items