Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of food chain-derived Listeria monocytogenes and the role of Listeria genomic island… Kovacevic, Jovana 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2014_november_kovacevic_jovana.pdf [ 18.26MB ]
Metadata
JSON: 24-1.0167020.json
JSON-LD: 24-1.0167020-ld.json
RDF/XML (Pretty): 24-1.0167020-rdf.xml
RDF/JSON: 24-1.0167020-rdf.json
Turtle: 24-1.0167020-turtle.txt
N-Triples: 24-1.0167020-rdf-ntriples.txt
Original Record: 24-1.0167020-source.json
Full Text
24-1.0167020-fulltext.txt
Citation
24-1.0167020.ris

Full Text

 Characterization of food chain-derived Listeria monocytogenes and the role of Listeria genomic island (LGI1) in virulence, survival, and tolerance to food-related stress   by Jovana Kovacevic  B.Sc., The University of Alberta, 2005 M.Sc., The University of Alberta, 2007  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Food Science)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)   October 2014  © Jovana Kovacevic, 2014 ii Abstract The presence of Listeria spp. and L. monocytogenes (Lm) was investigated in provincially inspected food processing and retail facilities in British Columbia. Lm (n=56) was recovered in food processing environment (FPE) of dairy, meat and fish facilities, and in ready-to-eat fish products. The majority of Lm belonged to listeriosis causing serotypes 1/2a and 4b. Isolate fingerprinting revealed 14 sequence types, and 38 pulsotypes, with 66% of Lm possessing the full-length inlA, a causally linked virulence determinant. Unexpectedly, 4b serotypes more readily acquired point mutations leading to rifampicin resistance compared to other serotypes (p<0.05). Lm that adapted more quickly to cold (4°C) also more often encoded a full-length inlA. No resistance to antibiotics used in listeriosis treatment was observed; however, a large proportion of isolates possessed resistance or reduced susceptibility (RSC) to ciprofloxacin (CIP, 75%) and clindamycin (CLI, 98%). When eight isolates were experimentally adapted to high concentrations of CIP, minimum inhibitory concentrations (MICs) of benzalkonium chloride (BAC) increased (n=5), gentamicin MICs remained the same (n=6) or increased 2-fold (n=2), and led to RSC to linezolid (n=1) and resistance to CLI (n=8). Tolerance to quaternary ammonium (QAC) sanitizers, BAC and E-San, was also investigated in a clinical Lm strain (08-5578) that possessed a previously uncharacterized island, LGI1. High tolerance to acid, cold, high salt conditions, and QACs was seen. Deletion of LGI1 genes lmo1851, emrE, and sel1, with putative regulatory, efflux, and adhesion functions, respectively, did not affect the acid, cold and salt tolerance, or the adhesion and invasion of TC-7 and HeLa cells. The ΔemrE mutant had impaired growth at sub-lethal concentrations of QACs, and up to three times lower MICs. No change in MICs to aminoglycosides and other antibiotics, acriflavine, and triclosan, was observed for the ΔemrE mutant,  iii suggesting the primary role of EmrE in Lm is to increase its tolerance of QACs. Overall, findings from this research provide evidence that differences in stress survival and virulence potential exist among food chain-derived Lm. However, better understanding of the pressures occurring in FPEs that may contribute to strain persistence, and co-selection of antibiotic and sanitizer resistance mechanisms is needed.   iv Preface The research performed in this thesis was approved by the University of British Columbia Biosafety Committee, Certificate Number B10-0010.  A version of Chapter 2 has been published in a government report [Kovacevic, J. and Environmental Health Services Division, 2010. Occurrence and distribution of Listeria species in facilities producing ready-to-eat foods under provincial inspection authority in British Columbia. B.C. Centre for Disease Control. Available at: http://www.bccdc.ca /NR/rdonlyres/659E872B-A803-4F99-8C6A1902A143CCC7/0/ListeriaReportFINAL withAppendicesJan122011corrected.pdf. Accessed 20 July, 2014.], and a peer-reviewed manuscript [Kovačević, J., Mesak, L.R., and Allen, K.J., 2012. Occurrence and characterization of Listeria spp. in ready-to-eat retail foods from Vancouver, British Columbia. Food Microbiol. 30, 372-378]. It is based on the work I conducted in UBC’s Food Microbiology Laboratory and British Columbia Centre for Disease Control (BCCDC). I was responsible for conducting the research, analysis of data, as well as writing the manuscripts. Allen K.J. and Kosatsky T. were project supervisory authors, while Mesak L.R., was involved in manuscript review and edits.   A version of Chapter 3 has been published in the Applied and Environmental Microbiology journal [Kovacevic, J., Arguedas-Villa, C., Wozniak, A., Tasara, T., and Allen, K.J., 2013. Examination of food chain-derived Listeria monocytogenes of different serotypes reveals considerable diversity in inlA genotypes, mutability, and adaptation to cold temperature. Appl. Environ. Microbiol. 79, 1915-1922]. I was responsible for the majority of the work and manuscript preparation. Arguedas-Villa C. and Wozniak A.  v helped with generation of cold growth adaptation and mutability data, respectively. Allen K.J. drafted the introduction and helped with critical review and editing of the manuscript. The majority of multilocus sequence typing, and serotyping data was obtained from the Canadian National Microbiology Laboratory, where I was also trained and completed parts of the work under the guidance of Dr. Matthew Gilmour. Pulsed-field gel electrophoresis isolate fingerprinting was performed at the BCCDC and Canadian Listeriosis Reference Service Laboratory.   Chapter 4 was published in Food Microbiology [Kovacevic, J., Sagert, J., Wozniak, A., Gilmour, M.W., and Allen, K.J., 2013. Antimicrobial resistance and co-selection phenomenon in Listeria spp. recovered from food and food production environments. Food Microbiol. 34, 319-327]. I was responsible for the majority of the work and manuscript preparation. Wozniak A. helped with co-selection experiments, and Sagert J. performed plasmid screening and prepared the gel shown in Figure 4-2 (page 130). Allen K.J. and Gilmour M.W. were supervisory authors. Allen K.J. drafted the introduction, and helped with critical review and editing of the manuscript.   I performed the research described in Chapter 5. Allen K.J. was involved in the concept formation, and Mesak L.R. and Wałecka-Zacharska E. helped with the generation of mutants.  vi Table of contents Abstract .............................................................................................................................. ii!Preface ............................................................................................................................... iv!Table of contents .............................................................................................................. vi!List of tables ...................................................................................................................... xi!List of figures .................................................................................................................. xiii!List of abbreviations ...................................................................................................... xvi!Acknowledgements .......................................................................................................... xx!Dedication ...................................................................................................................... xxii!Chapter  1: Introduction and literature review .............................................................. 1!1.1! Introduction ............................................................................................................ 1!1.2! Literature review .................................................................................................... 3!1.2.1! The Listeria genus ........................................................................................... 3!1.2.2! Listeria genomics ............................................................................................ 6!1.2.2.1! Listeria genomic island 1 (LGI1) ............................................................. 9!1.2.3! Listeria monocytogenes pathogenesis and listeriosis .................................... 11!1.2.3.1! Invasion and spread in human host cells ................................................. 11!1.2.3.2! Listeriosis manifestation ......................................................................... 14!1.2.4! Listeria monocytogenes virulence factors and their regulation .................... 15!1.2.4.1! Motility, adherence and surface proteins ................................................ 17!1.2.4.2! Invasion and intracellular survival .......................................................... 21!1.2.4.3! Regulation of virulence ........................................................................... 24!1.2.5! Survival mechanisms of Listeria monocytogenes ......................................... 28!1.2.5.1! Sigma B (σB) and other alternative sigma factors ................................... 28!1.2.5.2! Acid stress response ................................................................................ 30!1.2.5.3! Osmotic stress response .......................................................................... 33!1.2.5.4! Temperature induced stress response ...................................................... 33!1.2.6! Listeria monocytogenes in the food industry ................................................ 35!1.2.6.1! Incidence in foods and food processing environments ........................... 36!1.2.6.2! Control and monitoring ........................................................................... 37! vii 1.2.7! Susceptibility of Listeria monocytogenes to antimicrobials ......................... 41!1.2.7.1! Antibiotic resistance ................................................................................ 41!1.2.7.2! Resistance to sanitizers ........................................................................... 43!1.2.7.3! Antimicrobial resistance and co-selection .............................................. 47!1.3! Research objectives and hypotheses .................................................................... 49!Chapter  2: Occurrence and distribution of Listeria spp. in food processing facilities producing ready-to-eat foods, and retail establishments in British Columbia (B.C.), Canada .............................................................................................................................. 52!2.1! Introduction .......................................................................................................... 52!2.2! Materials and methods ......................................................................................... 56!2.2.1! Sample collection from food processing facilities (PF) ................................ 56!2.2.2! Sample collection from retail facilities (RF) ................................................ 59!2.2.3! Isolation of Listeria spp. and confirmation ................................................... 59!2.2.4! Serotyping and genetic fingerprinting .......................................................... 60!2.2.5! Statistical analyses ........................................................................................ 61!2.3! Results .................................................................................................................. 62!2.3.1! Listeria spp. contamination in food processing facilities ............................. 62!2.3.2! Recovery of Listeria spp. from environmental samples ............................... 65!2.3.3! Recovery of Listeria spp. from retail food samples ...................................... 67!2.3.4! L. monocytogenes contamination of RTE foods ........................................... 67!2.3.5! Species distribution among PF and RF, and food categories ........................ 69!2.3.6! Serotype and PFGE pattern distribution among L. monocytogenes isolates 70!2.4! Discussion ............................................................................................................ 72!2.5! Conclusions .......................................................................................................... 80!Chapter  3: Assessment of the population structure, virulence potential, mutability and cold adaptation of food chain-derived Listeria monocytogenes isolates ............... 81!3.1! Introduction .......................................................................................................... 81!3.2! Materials and methods ......................................................................................... 84!3.2.1! Bacterial isolates ........................................................................................... 84!3.2.2! Internalin A sequencing ................................................................................ 84!3.2.3! Multilocus sequence typing .......................................................................... 85!3.2.4! Invasion of Caco-2 cells ................................................................................ 86! viii 3.2.5! Mutation frequency ....................................................................................... 88!3.2.6! Cold growth evaluation ................................................................................. 88!3.2.7! Statistical analysis ......................................................................................... 89!3.2.8! Nucleotide sequence accession numbers ...................................................... 89!3.3! Results .................................................................................................................. 90!3.3.1! Distribution of different sero-, pulso- and sequence types ........................... 90!3.3.2! inlA genotypes and mutability among L. monocytogenes strains ................. 91!3.3.3! Distribution of inlA genotypes across different food processing facilities ... 96!3.3.4! inlA mutations within different serotypes and multilocus sequence types ... 99!3.3.5! Occurrence of inlA PMSCs in isolates recovered from different sources .. 100!3.3.6! Invasion of Caco-2 cells by L. monocytogenes strains possessing truncated  InlA or 3-codon deletion ............................................................................. 100!3.3.7! Cold growth adaptation of strains from different serogroups and sources . 101!3.3.8! Cold growth adaptation of different L. monocytogenes inlA genotypes ..... 104!3.4! Discussion .......................................................................................................... 104!3.5! Conclusions ........................................................................................................ 111!Chapter  4: Antimicrobial resistance and co-selection phenomenon in Listeria spp. recovered from B.C. food and food processing environments ................................... 112!4.1! Introduction ........................................................................................................ 112!4.2! Materials and methods ....................................................................................... 115!4.2.1! Bacterial isolates ......................................................................................... 115!4.2.2! Antimicrobial resistance screening ............................................................. 115!4.2.3! Plasmid profiling of L. monocytogenes isolates with antimicrobial resistance    ..................................................................................................................... 117!4.2.4! Investigation of ciprofloxacin resistance .................................................... 118!4.2.5! Gentamicin and benzalkonium chloride resistance of CIP resistant  L. monocytogenes isolates ........................................................................... 119!4.2.6! Statistical analysis ....................................................................................... 120!4.3! Results ................................................................................................................ 120!4.3.1! Antimicrobial resistance of Listeria spp., and L. monocytogenes serotypes ....    ..................................................................................................................... 120! ix 4.3.2! Antimicrobial resistance of L. monocytogenes from different sources ....... 124!4.3.3! Presence of plasmids in L. monocytogenes isolates .................................... 125!4.3.4! Efflux-mediated resistance to ciprofloxacin among L. monocytogenes strains    ..................................................................................................................... 127!4.3.5! Antimicrobial profiles of L. monocytogenes strains adapted to high  concentrations of ciprofloxacin ................................................................... 130!4.3.6! Gentamicin and benzalkonium chloride resistance of L. monocytogenes  strains adapted to high concentrations of ciprofloxacin ............................. 130!4.4! Discussion .......................................................................................................... 130!4.5! Conclusions ........................................................................................................ 137!Chapter  5: The role of Listeria genomic island 1 (LGI1), in the tolerance of Listeria monocytogenes to antimicrobials and other stresses encountered in the food processing chain ............................................................................................................. 139!5.1! Introduction ........................................................................................................ 139!5.2! Materials and methods ....................................................................................... 143!5.2.1! Bacterial strains ........................................................................................... 143!5.2.2! Screening for LGI1 ..................................................................................... 146!5.2.3! Preparation of L. monocytogenes competent cells ...................................... 149!5.2.4! Generation of deletion mutants ................................................................... 149!5.2.5! Electroporation ............................................................................................ 152!5.2.6! Antimicrobial agents ................................................................................... 152!5.2.7! Minimum inhibitory concentrations ........................................................... 153!5.2.8! Growth in the presence of sub-lethal concentrations of antimicrobials ...... 155!5.2.9! RNA isolation and cDNA preparation ........................................................ 156!5.2.10! Gene expression ........................................................................................ 156!5.2.11! Adhesion and invasion assays ................................................................... 157!5.2.12! Acid stress survival ................................................................................... 159!5.2.13! Cold adaptation ......................................................................................... 159!5.2.14! Salt stress survival ..................................................................................... 160!5.2.15! Statistical analysis ..................................................................................... 161!5.3! Results ................................................................................................................ 161!5.3.1! The presence of LGI1 in L. monocytogenes from the food chain ............... 161! x 5.3.2! Minimum inhibitory concentrations of antimicrobials against L.  monocytogenes ............................................................................................ 162!5.3.3! Growth of WT L. monocytogenes and LGI1 mutants in the presence of sub- lethal concentrations of sanitizers ............................................................... 162!5.3.4! Gene expression in WT L. monocytogenes when exposed to sub-lethal  concentration of BAC ................................................................................. 173!5.3.5! Adhesion and invasion of Δsel1 mutant to TC-7 and HeLa cells ............... 174!5.3.6! Acid tolerance ............................................................................................. 174!5.3.7! Adaptation and growth in cold environment .............................................. 177!5.3.8! Salt tolerance ............................................................................................... 177!5.4! Discussion .......................................................................................................... 179!5.5! Conclusions ........................................................................................................ 185!Chapter  6: Conclusions ................................................................................................ 187!Works cited ..................................................................................................................... 193!Appendices ...................................................................................................................... 219!Appendix A – Chapter 2 supplementary figure .......................................................... 219!Appendix B – Chapter 3 supplementary table ............................................................ 223!  xi List of tables Table 1-1. Major foodborne listeriosis outbreaks reported worldwide. ............................ 38!Table 2-1. List of surfaces sampled in food processing facilities. .................................... 58!Table 2-2. Contingency table for Listeria spp. found in at least one environmental swab sample versus L. monocytogenes found in at least one food sample, and Listeria spp. found in any food sample versus L. monocytogenes found in any food sample, by facility. ........................................................................................................................................... 65!Table 2-3. List of foods contaminated with L. monocytogenes. ....................................... 68!Table 2-4. The number of isolatesa recovered from different types of facilities (food processing, PF, or retail facilities, RF), and different food categories (dairy, fish and meat). ................................................................................................................................ 69!Table 2-5. Serotypes of L. monocytogenes isolates recovered in food processing environments, and raw (RUF) or ready-to-eat (RTE) foods. ............................................ 70!Table 2-6. Distribution of L. monocytogenes (n=111) sero- and pulsotypes, across different facilities (n=15). ................................................................................................. 71!Table 3-1. Serotypes of L. monocytogenes (n=56) isolates characterized in this study, recovered from food processing environments, raw unprocessed foods (RUF) or ready-to-eat (RTE) foods. ................................................................................................................ 91!Table 3-2. Distribution of L. monocytogenes (n=111) sero- and pulsotypes, and their inlA profiles, across different facilities (n=15). ........................................................................ 92!Table 3-3. Number of L. monocytogenes isolates recovered from food processing environments (n=29), raw unprocessed (n=6) and ready-to-eat (n=21) foods with full-length inlA, inlA mutations resulting in premature stop codons (PMSC) or 3-codon deletions. ........................................................................................................................... 97!Table 4-1. Listeria isolates (n=111) recovered from food processing environments, raw unprocessed food, or ready-to-eat foods used in the study. ............................................ 116!Table 4-2. Oligonucleotide primers used for plasmid screening. ................................... 118!Table 4-3. Breakdown of L. monocytogenes isolates of different serotypes, resistant and with reduced susceptibility to antimicrobial agents. ....................................................... 121! xii Table 4-4. Plasmid screening of selected L. monocytogenes strains possessing reduced susceptibility or resistance to clinically relevant antibiotics. .......................................... 126!Table 4-5. Minimum inhibitory concentration of gentamicin (GEN), benzalkonium chloride (BAC), and ciprofloxacin (CIP) in the absence or presence of reserpine in wild type (WT) L. monocytogenes strains recovered from food processing environments and their respective ciprofloxacin adapted strains (CIPR). .................................................... 129!Table 5-1. Bacterial strains and plasmids used in experiments. ..................................... 145!Table 5-2. Oligonucleotide primers used in experiments. .............................................. 147!Table 5-3. List of antimicrobial agents used in experiments. ......................................... 154!Table 5-4. Minimum inhibitory concentrations (MIC) of different antibiotics for L. monocytogenes possessing deletions in LGI1 genes, and wild type (WT) parent strains. ......................................................................................................................................... 162!Table 5-5. Minimum inhibitory concentrations (MIC) of different antimicrobials for L. monocytogenes possessing deletions in LGI1 genes, and wild type (WT) parent strains. ......................................................................................................................................... 162!Table 5-6. Average lag phase duration, maximum growth rate, and maximum optical density rates of Listeria monocytogenes 08-5578 and its LGI1 deletion mutants, Δlmo1851, ΔemrE, and Δsel1, when exposed to sub-lethal concentrations of QAC-based sanitizers, E-San and benzalkonium chloride (BAC) for 24 h at 30°C.  ........................ 167!Table 5-7. Gene expression of L. monocytogenes 08-5578 strain when treated with benzalkonium chloride (10 ppm) sanitizer for 1 h, relative to the control. .................... 173!Table 5-8. Cold growth adaptation of WT L. monocytogenes 08-5578 and its LGI1 deletion mutants based on the lag phase duration (h), growth rate (Δlog10 CFU/h), and maximum density (log10 CFU/ml) reached during incubation at 4°C following a downshift from 37°C. ..................................................................................................... 177!  xiii List of figures Figure 1-1. Genetic organization and putative functions of the Listeria genomic island 1 (LGI1). .............................................................................................................................. 10!Figure 1-2. Listeria monocytogenes infectious process in the human body ..................... 13!Figure 1-3. Intracellular life cycle of L. monocytogenes .................................................. 22!Figure 1-4. A schematic representation of simplified Listeria monocytogenes stress mechanisms discussed in the text and their proposed roles in stress protection/adaptation. ........................................................................................................................................... 31!Figure 2-1. Geographic distribution of facilities producing ready-to-eat foods under provincial inspection authority (n=53) visited during the survey that assessed the prevalence of Listeria spp. in food facilities, by Health Authority regions in British Columbia. .......................................................................................................................... 57!Figure 2-2. The proportion of facilities meeting the criterion of at least one swab collected in each of the three sampling areas, having environmental swab samples positive for Listeria spp. and L. monocytogenes by facility type (A) and sampling area (B). .................................................................................................................................... 62!Figure 2-3. The proportion of facilities meeting the criterion of at least four RTE foods collected having samples positive for Listeria spp. and L. monocytogenes. .................... 64!Figure 2-4. The joint presence of L. monocytogenes in food and other Listeria spp. in the processing environment, for facilities that met the criterion of at least one swab from each of the three sub-environments and no less than four RTE food products collected. Each row represents a facility. ................................................................................................... 66!Figure 2-5. PFGE dendrogram of L. monocytogenes isolates recovered from food processing facilities based on AscI and ApaI patterns; different letters represent unrelated isolates.. ............................................................................................................................. 73!Figure 3-1. Minimum spanning tree of different serotypes of L. monocytogenes derived from the food chain, created using Bionumerics v6.5.. .................................................... 94!Figure 3-2. Minimum spanning tree of L. monocytogenes derived from different sources within the food chain, created using Bionumerics v6.5. ................................................... 95!Figure 3-3. Full-length inlA illustration, with the scale below representing amino acid positions, and types of mutations that occur due to premature stop codons. .................... 96! xiv Figure 3-4. Mutability of different L. monocytogenes inlA genotypes (A) and serotypes (B) assessed by the number of rifampicin-resistant colonies after 48 h growth at 35°C in the presence of 100 µg/ml rifampicin. .............................................................................. 98!Figure 3-5. Invasion efficiency (% of bacteria recovered relative to initial inoculum) of L. monocytogenes isolates possessing inlA PMSC mutations (type 1, 3, 4 and 11) or a 3-codon deletion at amino acid position 738 to 740 (Δ738-740) compared to wild type clinical isolates (08-5578 and EGD-SmR) and a Tn1545-induced non-invasive inlA mutant of EGD-SmR (BUG5). ....................................................................................... 101!Figure 3-6. The distribution of L. monocytogenes isolates recovered from food processing environments (FPE), raw unprocessed (RUF), and ready-to-eat (RTE) foods, within three cold growth adapting groups, when grown at 4°C. ......................................................... 102!Figure 3-7. Lag phase duration (A) and exponential growth rate (B) of 33 L. monocytogenes isolates recovered from food and food processing environments following a down-shift from 37 to 4°C in BHI. .............................................................. 103!Figure 3-8. Identification of L. monocytogenes isolates with or without premature stop codons (PMSC) in inlA as fast (<70 h), intermediate (70-200 h) or slow (>200 h) cold growth adaptors (CGA), following a temperature down-shift from 37 to 4°C in BHI. .. 105!Figure 4-1. Antimicrobial resistance of (A) L. innocua, (B) L. seeligeri, (C) L. monocytogenes, and (D) L. welshimeri isolated from foods and food processing environments in British Columbia. ................................................................................. 122!Figure 4-2. Plasmid profiles of three L. monocytogenes isolates possessing resistance or reduced susceptibility to TET, STR, and LZD, separated using pulsed-field gel electrophoresis. ............................................................................................................... 127!Figure 4-3. The effect of reserpine on L. monocytogenes 1/2a (A) and 4b (B) isolates possessing reduced susceptibility or resistance to ciprofloxacin. ................................... 128!Figure 5-1. Growth of L. monocytogenes 08-5578 (WT) parent strain and its isogenic deletion mutants in the presence of E-San (0.78 ppm) sanitizer at 30°C, based on OD600 (A) and log10 CFU/ml (B) values. ................................................................................... 164!Figure 5-2. Growth of L. monocytogenes 08-5578 (WT) parent strain and its isogenic deletion mutants in the presence of benzalkonium chloride (BAC; 1 ppm) sanitizer at 30°C, based on OD600 (A) and log10 CFU/ml (B) values. ............................................... 165! xv Figure 5-3. Growth of L. monocytogenes 08-5578 (WT) strain and its isogenic deletion mutants in the presence of sanitizers E-San at 1.56 ppm (A), and benzalkonium chloride (BAC) at 2 ppm (B) at 30°C. .......................................................................................... 166!Figure 5-4. Mean lag phase duration (h) of L. monocytogenes isolates possessing LGI1 (n=9) and isolates without LGI1 (n=8) when grown in the presence of sub-lethal concentrations of E-San sanitizer at 0.78 (A) and 1.56 ppm (B), and 1 (C) and 2 ppm (D) of benzalkonium chloride (BAC), at 30°C for 24 h. ....................................................... 168!Figure 5-5. Mean maximum growth rate (OD600 units/h) of L. monocytogenes isolates possessing LGI1 (n=9) and isolates without LGI1 (n=8) when grown in the presence of sub-lethal concentrations of 0.78 (A) and 1.56 ppm (B) of E-San, and 1 (C) and 2 ppm (D) of E-San sanitizer at 0.78 (A) and 1.56 ppm (B), and 1 (C) and 2 ppm (D) of benzalkonium chloride (BAC), at 30°C for 24 h. ........................................................... 169!Figure 5-6. Maximum OD600 values for L. monocytogenes isolates possessing LGI1 (n=9) and isolates without LGI1 (n=8) when grown in the presence of sub-lethal concentrations of E-San sanitizer at 0.78 (A) and 1.56 ppm (B), and 1 (C) and 2 ppm (D) of benzalkonium chloride (BAC), at 30°C for 24 h. ........................................................... 170!Figure 5-7. Growth of L. monocytogenes 08-5578 (WT) strain in the presence of sanitizers E-San at 0.78 and 1.56 ppm (A), and benzalkonium chloride (BAC) at 1 and 2 ppm (B) at 30°C, with (white line markers) and without (black filled line markers) reserpine (R; 20 µg/ml). .................................................................................................. 171!Figure 5-8. Growth of L. monocytogenes ΔemrE mutant in the presence of sanitizers E-San at 0.78 and 1.56 ppm (A), and benzalkonium chloride (BAC) at 1 and 2 ppm (B) at 30°C, with (white line markers) and without (black filled line markers) reserpine (R; 20 µg/ml). ........................................................................................................................ 172!Figure 5-9. Adhesion and invasion efficiencies (% of bacteria recovered relative to the initial inoculum, normalized to 08-5578 strain) of L. monocytogenes WT (08-5578) strain and its isogenic mutant possessing deletion in sel1 gene located on LGI1, compared to a clinical isolate 10403S and a Tn1545-induced noninvasive inlA mutant of EGD-SmR (BUG5), using TC-7 (A and C) and HeLa (B and D) cells. ........................................... 175!Figure 5-10. Growth of L. monocytogenes 08-5578 (WT) strain and its LGI1 mutants in BHI broth adjusted to pH 4.5 (A), pH 3.5 (B) and pH 2.5 (C) with 6 N HCl, at 30°C. . 176!Figure 5-11. Growth of L. monocytogenes 08-5578 (WT) strain and its isogenic LGI1 deletion mutants in BHI containing 5 and 10% of NaCl at 30°C.. ................................. 178!  xvi List of abbreviations  a.a. Amino acid ActA Actin-assembly inducing protein ADI Arginine deiminase Ami Amidase, autolysin AMK Amikacin AMP Ampicillin AMR Antimicrobial resistance ANOVA Analysis of variance ATP Adenosine triphosphate BAC Benzalkonium chloride B.C. British Columbia BCCDC British Columbia Centre for Disease Control BHI Brain heart infusion broth or agar bp Base pair Bsh Bile salt hydrolase BUG5 Tn1545-induced inlA mutant of a EGD-SmR laboratory reference L. monocytogenes strain Caco-2 Human colorectal adenocarcinoma epithelial cells CC Clonal complex cDNA Complimentary deoxyribonucleic acid CFC Close-to-food contact surface CFIA Canadian Food Inspection Agency CFU Colony forming units CHL Chloramphenicol CIP Ciprofloxacin CLI Clindamycin CLSI Clinical and Laboratory Standards Institute CNS Central nervous system Ct Cycle threshold DE Dairy environment sample DF Dairy food sample DMEM Dulbecco’s modified Eagle medium  xvii DMSO Dimethyl sulfoxide DPBS Dulbecco’s phosphate-buffered saline EGD Laboratory reference strain of L. monocytogenes recovered by E. G. D. Murray ERY Erythromycin FBS Fetal bovine serum FC Food contact surface FE Fish environment FF Fish food FOX Cefoxitin FPE Food processing environment FQ Fluoroquinolones GABA γ-aminobutyrate GAD Glutamate decarboxylase GEN Gentamicin HeLa Human cervical cancer cells InlA Internalin A protein InlB Internalin B protein IPM Imipenem KAN Kanamycin LGI1 Listeria genomic island 1 LB Luria-Bertani broth LIPI-1 Listeria pathogenicity island 1 LLO Listeriolysin O Lm Listeria monocytogenes LPD Lag phase duration in hours LZD Linezolid MGR Maximum growth rate MIC Minimum inhibitory concentration ME Meat environment MF Meat food MFS Major facilitator superfamily MHA (-B) Mueller-Hinton agar (with 5% sheep blood)  xviii MLST Multilocus sequence typing MST Minimum spanning tree NAL Nalidixic acid NAPS Nucleic Acid Protein Service Unit at the University of British Columbia ncRNA Non-coding ribonucleic acid NFC Non-food contact surface OD Optical density OE Meat (other) environment OF Meat (other) food PBS Phosphate buffered saline PCR Polymerase chain reaction PF Food processing facilities PFGE Pulsed-field gel electrophoresis PLC Phospholipase C PMSC Premature stop codon Ppm Parts per million PrfA Positive regulatory factor A; virulence regulator QACs Quaternary ammonium compounds qPCR Quantitative real-time polymerase chain reaction QRDR Quinolone resistance-determining regions RIF Rifampicin RF Retail facilities RNA Ribonucleic acid RSC Reduced susceptibility RTE Ready-to-eat RUF Raw, unprocessed food SD Standard deviation SMR Small multidrug resistance family SNP Single nucleotide polymorphism SOE-PCR Splicing by overlap extension polymerase chain reaction SSI-1 Stress survival islet ST Sequence type, based on the multilocus sequence typing  xix STR Streptomycin SXT Cotrimoxazole TC-7 A subclone of Caco-2 cells TET Tetracycline Tm Melting temperature TMP Trimethoprim TSA Tryptic soy agar TSA-YE Tryptic soy agar with yeast extract TSB Tryptic soy broth US The United States of America VAN Vancomycin WT Wild type  xx  Acknowledgements I would like to express my sincere gratitude to Dr. Kevin J. Allen, Dr. David Kitts and Dr. B. Brett Finlay for their support and guidance throughout my graduate research program. I would especially like to thank Dr. David Kitts and Dr. Eunice Li-Chan for providing help and encouragement during my last year of graduate studies.  I thank Dr. Matthew Gilmour and Dr. Brent Skura, my supervisory committee members, for providing valuable discussions and direction in my research.   Special thanks are also owed to Lorraine F. McIntyre, Dr. Kristie Keeney, and Dr. Lili R. Mesak for their expertise, and their patience and guidance during my training and development as a scientist. I am extremely grateful to have had such accomplished and well-rounded scientists to teach and inspire me throughout my studies.    I appreciate the friendship of Dr. Lynn M. McMullen, who instilled the love of food microbiology in me, and greatly influenced my professional and personal growth. She has been a true mentor who inspired me to go beyond what I thought was possible.  I would also like to extend my thanks to the faculty, staff, and my fellow students at the Allen and Finlay laboratories for their assistance, help, and support. Special thanks to Ana Cancarevic, who shared the joys of late night working, endless talks on gene expressions, and conference adventures with me. I also appreciate all the help from Drs. Ewa Wałecka-Zacharska and Anna Woźniak. Sincere thanks to Barbara Wakal for providing encouragement and making me laugh on the days when everything seemed endless and impossible.  I am also very grateful for technical expertise provided by the scientists at the British Columbia Centre for Disease Control, and their generous donation of the Listeria isolates  xxi collection. I would like to extend my thanks to Drs. Monique Rousset (Centre de Recherche des Cordeliers, Paris, France), Pascale Cossart (Instituit Pasteur), Catherine Jumarie (Université du Québec à Montréal, Canada), and Zhaoming Xu (UBC) for providing Caco-2 cells and bacterial controls I used in my experiments. I appreciate the financial support obtained through the Four Year Doctoral Fellowship from the University of British Columbia, the Dr. Karl C. Ivarson Agricultural Scholarship from the Agricultural Institute of Canada Foundation, and the support for the research provided by the National Sciences and Engineering Research Council of Canada.  Finally, I would like to thank my family and friends for their endless support and encouragement throughout this endeavor. In particular, I would like to express my extreme gratitude and love to Jared, for providing unconditional love and taking care of me when I was too busy to eat, and sleep. Your understanding and encouragement provided great inspiration in all my academic achievements.    xxii Dedication  To my family, who provided unconditional love, support, and inspiration during this journey of discovery and personal growth.  1 Chapter  1: Introduction and literature review  1.1 Introduction Listeria monocytogenes is a ubiquitous, psychrotrophic microorganism, naturally present in soil and decaying vegetation. However, in the last two decades L. monocytogenes has received particular interest for concerns related to its presence and persistence in food processing facilities, and subsequent contamination of ready-to-eat (RTE) foods (Gianfranceschi et al., 2003; Little et al., 2009; Low and Donachie, 1997; Van Coillie et al., 2004; Vàzquez-Boland et al., 2001b). Challenges in controlling this widespread bacterium are associated with its unique characteristics that promote its survival in food production environments. These include the ability to form biofilms, grow at refrigeration temperature, and tolerate various extrinsic and intrinsic parameters that are used to control foodborne pathogens (Donnelly, 2001; Rørvik et al., 1995; Tasara and Stephan, 2006; Vàzquez-Boland et al., 2001b). Even with the increased attention given to cleaning and sanitation, and implementation of food safety plans (e.g., Hazard Analysis Critical Control Points), L. monocytogenes continues to contaminate food products and result in foodborne disease. In fact, in most developed countries, including Canada, documented cases of listeriosis are on the rise, for reasons yet unexplained (Allerberger and Wagner, 2010; Clark et al., 2010; Gillespie et al., 2009; Koch and Stark, 2006).   Once L. monocytogenes is ingested, primarily through the consumption of contaminated foods, it elicits a strong immune response in the host. In healthy individuals this typically results in complete eradication of the pathogen or a mild gastrointestinal disturbance (Painter and Slutsker, 2007; Seavey et al., 2008). However, in individuals where  2 immune systems are underdeveloped, suppressed or impaired, such as neonates and young children, pregnant women, people with organ transplants, and those undergoing chemotherapy, the bacteria are able to infect and disseminate rapidly. As a result, a variety of serious conditions result, including septicemia, meningitis, encephalitis, spontaneous abortions, and stillbirths, with mortality rates ranging from 20 to 40% (Bortolussi, 2008; Dussurget et al., 2004; Painter and Slutsker, 2007). In addition to host immune status having a role in the development of severe listeriosis, it has been suggested that some L. monocytogenes strains are more virulent, which can lead to more severe manifestations of the disease (Jacquet et al., 2004; Orsi et al., 2011; Painter and Slutsker, 2007; Wiedmann et al., 1997). While a number of common virulence factors that allow L. monocytogenes to invade and take advantage of host cell processes have been described, more subtle genetic variations that result in increased virulence and/or persistence of some strains are presently not well understood.  More than 95% of listeriosis infections are caused by 1/2a, 1/2b, and 4b serotypes (Graves et al., 2007; Jacquet et al., 2004; McLauchlin et al., 2004). Interestingly, 1/2a serotype strains comprise the majority of Canadian clinical isolates. In particular, a predominant clonal complex (CC8)/epidemic clone has been responsible for sporadic listeriosis in Canada since 1988 (Knabel et al., 2012). Within this complex, the majority of 1/2a strains were found to possess a 50 kb genomic island (LGI1), first identified in a strain associated with the Maple Leaf outbreak and linked to 23 deaths (Gilmour et al., 2010). This island encodes a combination of putative antimicrobial resistance (AMR), stress response, and virulence genes, possibly enhancing L. monocytogenes’ ability to survive in the food chain (Gilmour et al., 2010). However, data on the prevalence of the island, and genetic  3 determinants associated with persistence and/or virulence amongst L. monocytogenes isolates recovered from the Canadian food chain are lacking. Considering that conditions encountered in food processing affect many virulence and stress response factors of L. monocytogenes, it would be prudent to understand the effect they may have on the expression of genes in recently described genomic island LGI1.   The purpose of this thesis, therefore, was to improve our understanding of physiological and genotypic properties of Listeria spp., and in particular L. monocytogenes, originating from the food chain, and to further characterize the role and contribution of LGI1 to L. monocytogenes survival in the food chain.  1.2 Literature review 1.2.1 The Listeria genus The Listeria genus is comprised of at least 15 species, six of which have been studied in detail. These include L. grayi, L. innocua, L. ivanovii, L. monocytogenes, L. seeligeri and L. welshimeri, and the nine recently characterized, L. aquatica, L. cornellensis, L. fleischmannii, L. floridensis, L. grandensis, L. marthii, L. riparia, L. rocourtiae, and L. weihenstephanensis with the species nova designation (Bertsch et al., 2013; den Bakker et al., 2014; Graves et al., 2010; Lang Halter et al., 2013; Leclercq et al., 2010; Orsi et al., 2011). The majority of the species within the genus are avirulent and well adapted to saprophytic life. Listeria monocytogenes and L. ivanovii are the only recognized pathogenic species, with L. monocytogenes being a significant pathogen in humans and animals, while L. ivanovii causes illness almost exclusively in animals (Liu and Busse, 2009; Vàzquez-Boland et al., 2001b). On rare occasions, illnesses caused by atypical L. innocua and  4 L. seeligeri have been reported (Perrin et al., 2003; Rocourt et al., 1986). Taxonomically, the Listeria genus is closely related to the genera Brochothrix, Bacillus, Lactobacillus, and more distantly related to Streptococcus, Lactococcus, Enterococcus and Staphylococcus (Farber and Peterkin, 1991). Furthermore, they are Gram positive, facultatively anaerobic and non-sporulating rods, which can grow at a wide range of temperatures (-0.4 to 50°C), pH conditions (4.4 and greater) and salt concentrations (10%), as well as in biofilm consortia (Farber and Peterkin, 1991; Liu et al., 2005). All Listeria spp. exhibit motility at room temperature (e.g., 20 to 25°C) using peritrichous flagella, while this phenomenon is markedly suppressed at 37°C (Rocourt and Buchrieser, 2007).    Species of Listeria can be differentiated based on their somatic (O) and flagellar (H) antigens. Currently, there are 13 different serotypes of L. monocytogenes, one L. grayi, at least three amongst L. innocua, one L. ivanovii, four amongst L. seeligeri, and two L. welshimeri serotypes (Allerberger, 2003; Liu, 2006). Noticeable heterogeneity in virulence and origins has been reported amongst the 13 L. monocytogenes serotypes. In fact, three different categories have been suggested: serotypes 1/2b, 3b, 4b, 4d and 4e, which are responsible for more than 90% of all the listeriosis and include outbreak causing strains, belong to lineage I; serotypes 1/2a, 1/2c, 3a and 3c are known as lineage II strains, which have been isolated from humans, animals, foods, food processing environments, and sporadic cases of listeriosis but less commonly related to outbreaks; and lineage III strains, including serotypes 4a and 4c, which are exclusively linked to animals (Wiedmann et al., 1997). Although serotyping offers little information regarding virulence properties and relatedness of strains in epidemiological and outbreak settings, it is still used as a “gold standard” in  5 clinical investigations in many reference laboratories, as linkage of particular serotypes to listeriosis has been established (Chen and Knabel, 2008; Graves et al., 2007).   However, assigning strains to specific lineages has been challenging. As different molecular techniques are now available to assess strain relatedness variability in virulence, survival fitness, and host preferences has been observed within L. monocytogenes isolates belonging to the same serotype. Using molecular biology techniques that focus on the genetic content of 4b serotypes has shown that this group of L. monocytogenes, historically linked to a number of large human listeriosis outbreaks, in fact harbors strains of animal origin rarely associated with human listeriosis (Liu, 2006; Ward et al., 2004). Studies employing multilocus sequence typing (MLST), which is based on DNA sequencing to characterize alleles present in seven housekeeping genes, have provided improved knowledge regarding the evolution of L. monocytogenes strains originating from different regions, sources, and time periods (Ragon et al., 2008; Salcedo et al., 2003). Combining MLST with DNA sequencing of virulence-associated genes can contribute to a greater understanding of global distribution and evolution of virulence determinants, as well as improved discriminatory power for epidemiology studies (Zhang et al., 2004). Nucleotide sequence polymorphisms in the inlA gene, which encodes for a protein involved in L. monocytogenes host colonization, have been shown to effectively predict the virulence potential of a strain, as well as suggest the existence of still unknown ecological factors driving the adaptation and selection for virulence-attenuated strains (Knabel et al., 2012; Nightingale et al., 2008; Orsi et al., 2007; Ragon et al., 2008; Tsai et al., 2006).    6 1.2.2 Listeria genomics Listeria has a circular chromosome ranging from 2.7 to 3 Mb in length (Cabanes et al., 2011; Glaser et al., 2001; Kuenne et al., 2013). Their G+C content (i.e. the proportion of guanine and cytosine nucleotides within a genome) is about 39%, placing them into the low G+C content group of bacteria (Kuenne et al., 2013). The first complete L. monocytogenes EGD-e genome became publicly available in 2001 (Glaser et al., 2001). Since then, a large number of L. monocytogenes strains have been sequenced and this is likely to continue to increase in the near future. Presently, there are 39 complete L. monocytogenes genomes available at NCBI’s GenBank (Bécavin et al., 2014), and 187 entries in the genome online database (Pagani et al., 2012) from either completed or on-going projects (Genomes OnLine Database, 2012).   Comparative genomics of Listeria spp. reveal an overall conservation in genome organization (Cabanes et al., 2011; Kuenne et al., 2013; Nelson et al., 2004). Approximately 65% of gene functions have been identified for Listeria spp. (Cabanes et al., 2011; Gilmour et al., 2010). A large number of these genes encode putative transport systems, transcriptional regulators, and surface and secreted proteins. These functions are in accordance with the capacity of Listeria to adapt to a variety of environmental conditions and inhabit different niches (Cabanes et al., 2011). Studies have shown that a number of genes present in 4b serotypes (e.g., L. monocytogenes CLIP80459 and L. monocytogenes F2365) are missing from 1/2a serotypes, particularly L. monocytogenes EGD-e (Doumith et al., 2004; Milillo et al., 2009; Nelson et al., 2004). Most of the differing genes encode for surface proteins, and fitness factors such as genes involved in sugar metabolism and virulence (Cabanes et al., 2011; Nelson et al., 2004).   7  Recently, the three most extensively used L. monocytogenes strains to study virulence, persistence, and stress adaptation, EGD, EGD-e, and 10403S, have been compared for genomic differences (Bécavin et al., 2014). EGD is a reference laboratory L. monocytogenes strain belonging to 1/2a serotype. It was isolated from guinea pigs, and described by E. G. D. Murray in 1926 (Bécavin et al., 2014; Glaser et al., 2001; Murray et al., 1926). Its derivative, EGD-e, was the first isolate to have its whole genome sequenced by the European consortium (Bécavin et al., 2014; Glaser et al., 2001). EGD-e was obtained in 1986 by Trinad Chakraborty, and has been passaged through mice over the years to maintain virulence (Bécavin et al., 2014). Listeria monocytogenes 10403S, where S stands for streptomycin resistance, is a derivative of a 1/2a serotype clinical strain (i.e. 10403) recovered from human skin lesions in Bozeman, Montana, and a reference strain used in many studies in the United States (US) (Bécavin et al., 2014; Edman et al., 1968).   EGD and 10403S strains were found to be genetically similar, with only 317 single nucleotide polymorphisms (SNPs) observed, and both strains belong to clonal complex (CC) 7. In contrast, EGD-e was found genetically highly distinct from both EGD and 10403S. This strain belongs to CC9, and its closest relatives are a 1/2c serotype clinical strain recovered in 1935 and a 3c strain of unknown origins from 1966. As a result, the authors suggest a possibility that EGD-e was originally mislabeled and exchanged for a different strain (Bécavin et al., 2014). The implications of this finding could be significant, as EGD and EGD-e have been used interchangeably in studies that looked at the basis of L. monocytogenes virulence.   Virulence factors of L. monocytogenes are clustered in genomic islands along the chromosome. Listeria pathogenicity island 1 (LIPI-1) is a 9-kb cluster of six virulence  8 determinants that have a major role in L. monocytogenes virulence (Vàzquez-Boland et al., 2001a). Additionally, internalin islets comprising two or more inl genes that occur in different loci on the chromosome aid the bacterium’s invasion of different cell types in the host (Dussurget et al., 2004; Vàzquez-Boland et al., 2001a). Some of the other notable chromosomal loci associated with virulence include Clp (caseinolytic proteases) stress tolerance mediators, Ami amidase protein, and Hpt hexose phosphate transporter, while a number of genes contributing to bacterial invasion of different host cells are also scattered throughout the genome (Schmid et al., 2005; Vàzquez-Boland et al., 2001a).   Recently, a 50 kb operon-like structured region termed LGI1 (Figure 1-1) was discovered in L. monocytogenes isolates originating from Canada (Gilmour et al., 2010). Subsequent testing of the archived clinical isolates revealed the presence of LGI1 in a number of L. monocytogenes strains, some of them dating back to 1988 (Knabel et al., 2012). These findings suggest LGI1 has been in the Canadian L. monocytogenes population for more than two decades. Interestingly, this island has not been reported outside of Canada to date (Knabel et al., 2012). Presently, it is not known whether this island is exclusive to Canadian isolates, or simply has not been observed globally due to limited number of L. monocytogenes genomes currently available. With the next-generation sequencing technologies becoming increasingly available this will likely change in the near future. Our knowledge of the origins and global distribution of LGI1 will likely improve as the genomes of L. monocytogenes isolates originating from different geographical regions become available.    9 1.2.2.1 Listeria genomic island 1 (LGI1) LGI1 has been described in isolates of 1/2a serotype, linked to deli meats and a severe listeriosis outbreak in Canada (Gilmour et al., 2010). Further investigation revealed that serotype 1/2a isolates belonging to CC8, and possessing similar pulsed-field gel electrophoresis (PFGE) patterns (e.g., AscI/ApaI profile LMACI.0001/LMAAI.0001), caused a substantial proportion of the sporadic cases, clusters, and outbreaks in Canada since 1988 (Knabel et al., 2012). Examination of more than 1,000 L. monocytogenes isolates collected from 1995 to 2010 revealed the presence of this clone in 22.3% of isolates, with the nationwide distribution believed to have occurred by the mid-1990s. Among 71 L. monocytogenes isolates examined by Knabel et al. (2012), 49 belonged to CC8, and all but six possessed LGI1.   This island (Figure 1-1) was most likely horizontally acquired due to the presence of putative serine recombinases (e.g., loci 1855-58) and 16 bp imperfect inverted repeats at the borders of the intergenic regions (e.g., loci 1849/50 and 1903/04) (Gilmour et al., 2010). Regions flanking the island are homologous to L. monocytogenes EGD-e lmo1702 and lmo1703 (Gilmour et al., 2010), while coding sequences within LGI1 possess partial homology to sequences found in a number of environmental firmicutes, such as  Desulfitobacterium dehalogenans, D. hafniense, Clostridium kluyveri, and C. ljungdahli (Ziegler, 2012).   Ziegler (2012) observed an increase in minimum inhibitory concentrations (MIC) of benzalkonium chloride (BAC) and benzethonium chloride in three Canadian isolates possessing LGI1, suggesting it may play a role in L. monocytogenes resistance to sanitizers.   10  Figure 1-1. Genetic organization and putative functions of the Listeria genomic island 1 (LGI1). Adapted from Gilmour et al. (2010). Numbers above coding sequences map represent locus tags in L. monocytogenes 08-5578, and putative gene names in italics are denoted below. Different colors denote putative gene functions.  Further, the presence of genes typically involved in stress response, such as a two-component signal transduction system, with a response regulator (locus 1851) and a sensor histidine kinase (locus 1852), and a putative small RNA polymerase sigma-24 subunit (locus 1859), indicates strains possessing LGI1 may be better equipped to battle environmental and/or food processing stresses (Gilmour et al., 2010; Ziegler, 2012). It is also tempting to speculate that, to some extent, the island is contributing to virulence, considering it was found in a number  11 of clinical isolates, spanning more than two decades (Knabel et al., 2012). The presence of genes homologous to type IV secretion-like systems (e.g., virB4, virD4, cpa and tad), as well as a putative adhesin (i.e. sel1) further supports the idea (Gilmour et al., 2010; Ziegler, 2012); though evidence of increased virulence due to LGI1 is currently lacking. In fact, the actual function of genes located on LGI1, and their contribution to fitness and/or virulence of L. monocytogenes have not yet been confirmed.  1.2.3 Listeria monocytogenes pathogenesis and listeriosis As an intracellular pathogen, L. monocytogenes has very successfully evolved to exploit a number of host cell processes. It facilitates its own uptake into cells and further spreads from cell to cell, generally causing little toxicity to the host cell (Cossart and Bierne, 2001; Portnoy et al., 2002). The gastrointestinal tract is the primary entrance route for L. monocytogenes, via contaminated foods (Farber and Peterkin, 1991). Once ingested, L. monocytogenes can either be internalized into professional phagocytes or induce its endocytosis into nonprofessional phagocytic cells, such as epithelial, endothelial and hepatocytic cells, by the use of highly sophisticated mechanisms (Vàzquez-Boland et al., 2001b).   1.2.3.1 Invasion and spread in human host cells There has been some controversy pertaining to the entry point of the bacterium, depending on the infection models used. Earlier studies with mice and rats showed that L. monocytogenes preferentially colonize Peyer’s patches through the use of M-cell epithelium (Marco et al., 1997; Marco et al., 1992). A study by Lecuit et al. (1999)  12 demonstrated that mouse and rat E-cadherin, a receptor for internalin A (InlA) protein that promotes invasion, differs from human E-cadherin. A difference in one amino acid residue (i.e. substitution of proline residue at position 16 seen in human E-cadherin with glutamate in mice and rats) renders cells resistant to InlA-mediated invasion, suggesting that mice and rat models are not representative of the L. monocytogenes invasion of human cells. In contrast, studies with guinea pigs showed that L. monocytogenes penetrates the host cell through Inl-A mediated invasion of intestinal villous epithelium (Lecuit et al., 2001; Rácz et al., 1972). More recently, studies using transgenic mice expressing human E-cadherin, and Madin-Darby canine kidney cells demonstrated that L. monocytogenes invasion and translocation of the small intestine occurs at apical tips of the intestinal villi (Pentecost et al., 2006), villus epithelial folds, and junctions between mucus-secreting goblet cells (Nikitas et al., 2011). While the small intestine is a preferential invasion site for L. monocytogenes, it has been established that the bacterium can also invade the caecum and the colon of the large intestine in gerbils and transgenic mice expressing human E-cadherin (Figure 1-2) (Disson et al., 2008).   Internalization is followed by lysis of the phagocytic vacuole, and bacterial release into the cytosol where it can undergo cell replication and spread into adjacent cells (Cossart and Bierne, 2001). Utilizing the actin-polymerization phenomenon L. monocytogenes is propelled from cell to cell, resulting in rapid dissemination from the small intestine to the liver, spleen, brain, and placenta tissues (Figure 1-2) (Cossart and Bierne, 2001; Dramsi and Cossart, 2003; Vàzquez-Boland et al., 2001b). Most of the bacteria accumulate in the liver, where they are killed by resident macrophages known as Kupffer cells. For any L. monocytogenes that survive, the principal site of multiplication is the hepatocytes  13 (Vàzquez-Boland et al., 2001b). Dissemination is often through macrophages (i.e. white blood cells that take up foreign materials) and dendritic cells (i.e. antigen-presenting cells, responsible for stimulating activation of T cells and immune response), allowing L. monocytogenes to avoid direct contact with the complement system (e.g., plasma proteins that opsonize pathogens and induce a series of inflammatory responses that facilitate pathogen removal) (Geginat and Grauling-Halama, 2008). Successful elimination of L. monocytogenes is dependent on effective innate immunity, also known as a first line of defense in listeriosis infection (e.g., natural killer cells, dendritic cell-primed CD4 T helper cells, and cytokines such as gamma interferon), followed by adaptive immunity (e.g., activation of CD4+ T cells, and expansion of cytotoxic CD8+ T cells) (Mitsuyama, 2008).    Figure 1-2. Listeria monocytogenes infectious process in the human body, following the ingestion of contaminated food (1), colonization of the digestive tract and crossing of the intestinal barrier (2), systemic circulation (3), infection of the liver and spleen (4), crossing of the blood-brain barrier (5), and the placental barrier (6). Re-printed from Cossart and Lebreton (2014) with permission from the authors and Elsevier.   14 1.2.3.2 Listeriosis manifestation  Immunocompetent individuals that develop listeriosis typically exhibit subclinical symptoms, such as those seen in mild gastroenteritis. These symptoms generally resolve within four to five days following infection. In contrast, severe infections often occur in individuals whose immune systems are suppressed (Farber and Peterkin, 1991; Vàzquez-Boland et al., 2001b). Mortality rates associated with listeriosis infections in vulnerable populations and perinatal cases range from 20 to 40%, placing L. monocytogenes amongst the deadliest foodborne pathogens (Clark et al., 2010).   When manifested as a feto-maternal listeriosis, the infection is generally asymptomatic in the mother or it may be present as a mild flu-like illness. However, in most cases this infection leads to spontaneous abortions and stillbirths (Farber and Peterkin, 1991). If the infection of the fetus occurs inside the uterus and the illness symptoms result following the birth or shortly after, this is typically referred to as early-onset listeriosis. A late-onset listeriosis can also present, typically several weeks after the birth. Sepsis and meningitis are often seen in early-onset cases, while meningitis and neonatal growth retardation are usually linked to the late-onset listeriosis (Painter and Slutsker, 2007; Vàzquez-Boland et al., 2001b). Numerous microabscesses and placental villitis have been reported to occur during listeriosis infections in pregnant women, as bacteria in maternal blood infect the trophoblast layer and translocate across the endothelial barrier (Lecuit et al., 2004; Vàzquez-Boland et al., 2001b). More specifically, InlA is believed to mediate attachment to E-cadherin receptors present in villous cytotrophoblasts (i.e. inner layer of trophoblasts) and at the basal and apical plasma membranes of the placental syncytiotrophoblasts (i.e. outer layer of trophoblasts) (Disson et al., 2008; Lecuit, 2005; Lecuit et al., 2004). While earlier studies (Lecuit et al., 2004)  15 suggested that InlA is solely responsible for mediating placental invasion, Disson et al. (2008) demonstrated that functional pathways including both InlA and InlB proteins are necessary for in vivo invasion of the human placenta.  In non-pregnant adults, sepsis, meningitis or meningoencephalitis can be the result of listeriosis, especially in immunocompromised individuals for whom listeriosis is often fatal (Painter and Slutsker, 2007). Infection of the central nervous system (CNS) is typically the result of bacterial dissemination via the bloodstream (Drevets et al., 2004). These infections can occur when L. monocytogenes invade the CNS vasculature using both InlA and InlB mediated internalization, or exploit phagocytes to facilitate invasion of the CNS (Grundler et al., 2013; Vàzquez-Boland et al., 2001b). Infected leukocytes can adhere to endothelial cells of the CNS, which allows L. monocytogenes to be spread from cell to cell, using actin-mediated movement (Vàzquez-Boland et al., 2001b). Additionally, if there are any breaches in oral cavities during the consumption of contaminated food, it is possible that the macrophages and blood phagocytes sent to abrasion sites by the immune system function as L. monocytogenes vehicles thereby aiding spread into cranial nerve neurites (Drevets et al., 2004). Eventually, bacteria are able to reach the CNS, where they result in meningitis, as well as systemic diseases in immunocompromised individuals (Vàzquez-Boland et al., 2001b).   1.2.4 Listeria monocytogenes virulence factors and their regulation Depending on the point of entry, different L. monocytogenes surface proteins are employed. For instance, InlA protein plays a role in the invasion of human enterocyte-like Caco-2 cells, while internalin B (InlB) is involved in invasion of Vero, HeLa, Hep-2 and CHO (i.e.  16 Chinese hamster ovary) cells (Braun et al., 1998; Ireton et al., 1996; Lingnau et al., 1995; Yamada et al., 2006). Besides internalins, other molecular determinants, such as: amidase (Ami), a cell wall hydrolase (p60), fibronectin binding surface protein (FbpA), surface actin-polymerizing protein (ActA), a pore forming toxin, listeriolysin O (LLO), and an unconventional myosin and its ligand vezatin, aid in L. monocytogenes adhesion to and invasion of eukaryotic cells (Dussurget et al., 2004; Sousa et al., 2004).  Once L. monocytogenes adheres to and successfully enters the host cell, intracellular survival is dictated by its ability to avoid the immune system response. Virulence traits important for this stage of the L. monocytogenes life cycle include: phospholipases C (PLC) in concert with LLO, actin filaments, and Hpt (Dussurget et al., 2004; Vàzquez-Boland et al., 2001b).   Generally, the expression of virulence genes is highly dependent on the stage of life cycle, as well as the location and conditions surrounding L. monocytogenes (Chaturongakul et al., 2011; Mueller and Freitag, 2005). Genes encoding the major virulence factors are located in the central virulence gene cluster, LIPI-1, under control of a positive regulatory factor A (PrfA) (Scortti et al., 2007; Sheehan et al., 1995; Vàzquez-Boland et al., 2001a; Vàzquez-Boland et al., 2001b). High temperature (Leimeister-Wachter et al., 1992; Scortti et al., 2007), stress conditions (Sokolovic et al., 1990; Sokolovic et al., 1993), sequestration of extracellular growth medium components (Scortti et al., 2007), and host cell contact (Renzoni et al., 1999) have been shown to trigger the expression of various virulence genes.     17 1.2.4.1 Motility, adherence and surface proteins Flagellar motility plays a role in virulence in a number of pathogens, including Campylobacter jejuni (Grant et al., 1993), Legionella pneumophila, Clostridium difficile, Helicobacter pylori, Salmonella enterica serovar Typhi, and Vibrio cholerae (Salyers and Whitt, 2002). Similarly, peritrichous flagella in L. monocytogenes allow bacterial movement when located outside the host cells. There are about 41 genes responsible for the flagellar complex of Listeria, and the expression is controlled by at least five different regulators: FlaR, PrfA, DegU, MogR, GmaR (Desvaux and Hébraud, 2008).   Flagellar filaments are produced and assembled at growth temperatures between 20 and 25°C. However, the production is significantly decreased at 37°C, the temperature of the human body (Dons et al., 2004). Listeria monocytogenes mutants lacking certain flagellar genes (e.g., lmo0713 and lmo0716) are unable to successfully adhere to and enter nonphagocytic epithelial cells (Bigot et al., 2005). The products encoded by these genes are similar to FliI, flagellar basal body component, and FliF, an ATPase enzyme involved in energizing of the flagellum component export (Bigot et al., 2005). Bigot et al. (2005) observed the presence of flagella for some L. monocytogenes strains at 37°C that led to the decreased adhesion to epithelial cells; however, there was no impact on the survival of L. monocytogenes inside the cytosol. These findings indicate that flagella play an important role in the initial steps of listerial infection, especially if bacteria enter through the gastrointestinal tract. However, once L. monocytogenes are internalized this virulence trait is replaced with other forms of motility more appropriate for the surrounding environment, such as actin-based motility (Vàzquez-Boland et al., 2001b).   18  Actin filaments are used for intracellular movement by L. monocytogenes and L. ivanovii, as well as Shigella flexneri and Rikettsia conori (Cossart, 2000). Some strains of Salmonella and pathogenic Escherichia coli also use this mechanism to alter the cell cytoskeleton and promote infection (Cantarelli et al., 2006; Guiney and Lesnick, 2005). Following the release of L. monocytogenes from the phagocytic vacuole, actin polymerization is rather quickly induced allowing bacteria to move inside the cytosol, and spread from cell to cell (Cossart, 2000; Dussurget et al., 2004; Pfeuffer et al., 2000). ActA, a surface protein responsible for polymerization of actin in L. monocytogenes, mimics cellular eukaryotic protein WASP [Wiscott-Aldrich syndrome protein; (Higgs et al., 1999)]. Similar to WASP, ActA directly activates the Arp2/3 complex, which in turn is responsible for actin filament nucleation and organization (Cossart, 2000; Higgs et al., 1999).   A number of additional actin-binding proteins and ligands that play a role in motility have been identified. These include: α-actinin (Dold et al., 1994); profilin (Theriot et al., 1994); a vasodilator stimulated phosphoprotein (VASP) important in the speed of bacterial movement (Chakraborty et al., 1995); CapZ; and LaXp180, a protein involved in signal transduction associated with microtubule networks (Cossart and Bierne, 2001). However, the exact roles for many of these proteins in motility have not been fully elucidated.  While motility plays an important role in bacterial movement, evasion of adverse conditions and dissemination, adherence is just as important for successful uptake and colonization of the host cells. Several adhesins and autolysins have been found to be important in the initial stage of colonization. They typically play a role in the digestion of cell wall peptidoglycan, regulation of cell growth, cell division, peptide-glycan maturation, protein secretion, as well as pathogenicity (Seveau et al., 2007). It has been suggested that  19 adhesins aid the adherence of bacteria to host surfaces by recognizing molecules analogous to their natural receptors, teichoic and lipoteichoic acids (Dussurget et al., 2004; Milohanic et al., 2001). Autolysins Ami and Auto, found in L. monocytogenes, have been shown to play a role in virulence (Seveau et al., 2007). Mutants possessing deletions in ami exhibited reduced attachment to different cell lines (e.g., human melanoma cell line SK-MEL 28, human enterocyte-like colon carcinoma cell line Caco-2, hepatocellular carcinoma cell line Hep-G2), and attenuated virulence in the liver of mice inoculated intravenously (Milohanic et al., 2001); moreover, isolates with inactivated aut displayed reduced entry into various host cells (e.g., African green monkey kidney cell line Vero, Caco-2, guinea-pig epithelial cell line GPC16, human laryngeal epithelial cell line Hep-2, murine fibroblast cell line L2), and attenuated virulence in guinea pigs (Cabanes et al., 2004).   Similarly, p60 (also known as CwhA), a cell wall hydrolase encoded by the iap gene, is important for the invasion of mouse fibroblasts (Kuhn and Goebel, 1989; Pilgrim et al., 2003). In vitro, p60 is important in cell division, as it breaks the cell chains into single cells (Wuenscher et al., 1993). Listeria monocytogenes mutants lacking this protein have a rough-colony morphology, and decreased ability to spread from cell to cell due to defective actin-tail filaments (Pilgrim et al., 2003). The exact mechanism behind the action of p60 is not well understood, since the invasiveness of p60 mutants seems only slightly diminished in some cells while complete attenuation is observed in others (Kuhn and Goebel, 1989; Pilgrim et al., 2003).  FbpA is another example of a surface protein of L. monocytogenes important in the listerial adherence to host cells. It is highly similar to fibronectin-binding proteins PavA of Streptococcus pneumoniae, Fbp54 of S. pyogenes, and FbpA of S. gordonii (Dussurget et al.,  20 2004). Dramsi et al. (2004) reported FbpA binding to immobilized human fibronectin, while in the presence of exogenous fibronectin it increases adherence of wild-type (WT) L. monocytogenes to Hep-2 cells. In addition, the role of FbpA as a chaperone for other important virulence factors, such as LLO and InlB, has been suggested (Dramsi et al., 2004). It prevents degradation of LLO and InlB (Dussurget et al., 2004). However, a similar effect was not observed for InlA or ActA, suggesting that it may be specifically involved in aiding adherence and invasion of liver and nonepithelial cells (Dramsi et al., 2004).  Recently, Listeria adhesion protein (LAP) has been identified as important for the adherence of L. monocytogenes to intestinal epithelial cells (Pandiripally et al., 1999). LAP is a 104-kD protein, encoded by the aad or lap gene (Kim et al., 2006; Pandiripally et al., 1999). It is expressed in five of the six well characterized Listeria spp., including L. innocua, L. ivanovii, L. monocytogenes, L. seeligeri, and L. welshimeri, but not L. grayi (Jagadeesan et al., 2010). It has been suggested that this protein is unable to re-associate on the surface of non-pathogenic strains, thereby rendering them unable to adhere to mammalian cells (Jagadeesan et al., 2010). Strains of L. monocytogenes not expressing LAP but possessing hemolytic and phospholipase activity exhibited attenuated virulence in Caco-2 cells (Pandiripally et al., 1999). The inability of mutant strains to adhere properly to the target cells indicates that LAP plays a role in adherence and virulence of L. monocytogenes; however, the specific fashion by which LAP adds to virulence has not been fully elucidated. Further, evidence suggests that environmental factors such as nutrient-limiting conditions induce the expression of LAP, while high glucose levels repress the production of LAP (Jaradat and Bhunia, 2002). Since these conditions are present in food processing  21 environments, it has been proposed they may play a role in the subsequent ability of L. monocytogenes to invade human host cells (Jaradat and Bhunia, 2002).   1.2.4.2 Invasion and intracellular survival A number of invasion mechanisms are deployed by L. monocytogenes during the infection process, depending on the location of the bacterium inside the host (Vàzquez-Boland et al., 2001b). Typically, pathogens can recognize a variety of host cell receptors (e.g., transmembrane glycoprotein E-cadherin, C1q complement fraction receptor, the Met receptor for hepatocyte growth) and extracellular matrix components from which they are able to sense their environment and produce virulence factors required for survival in a particular milieu (Vàzquez-Boland et al., 2001b).   Proteins known as internalins play an important role in the uptake of L. monocytogenes that has adhered to, or come into close proximity to the target cell. The most studied internalins in L. monocytogenes are InlA and InlB, which are directly responsible for internalization of L. monocytogenes into various mammalian cells (Figure 1-3). The 800-amino acid long InlA surface protein recognizes and binds to human receptor E-cadherin expressed by a number of cells (e.g., epithelial cells in the intestine, intracerebral microvascular endothelial cells, placenta, hepatocytes and dendritic cells) (Schubert et al., 2001) and has a key role in L. monocytogenes invasion of human epithelial cells (Lecuit et al., 1997). InlA and E-cadherin binding is species specific, and requires recognition of a proline at position 16 in the E-cadherin molecule (Lecuit et al., 1999).   22  Figure 1-3. Intracellular life cycle of L. monocytogenes represented by the bacterial entrance into host cells using internalins InlA and InlB (1), release from the endocytic vacuole using listeriolysin O (LLO) and phosphatidylinositol phospholipase C (PI-PLC) (2), replication in the cytosol (3), polymerization of cellular actin via the recruitment of the Arp2/3 complex using ActA (4), cell to cell spread using actin comet tails (5), and breakdown of the two-membrane vacuole using LLO and phosphatidylcholine-specific phospholipase C (PC-PLC). Re-printed from Cossart and Lebreton (2014) with permission from the authors and Elsevier.  Furthermore, together with the 630-amino acid long InlB protein that interacts with human receptors C1q (i.e. complement fraction receptor) and Met (i.e. receptor for hepatocyte growth), InlA facilitates listerial invasion of the human placenta (Disson et al., 2008) and crossing of the brain barrier (Grundler et al., 2013).  Research has shown that differences linked to inlA affect virulence of L. monocytogenes strains. In particular, a significant proportion (35-45%) of strains recovered from RTE foods have been reported to possess mutations in inlA resulting in a premature stop codon (PMSC) (Felicio et al., 2007; Jacquet et al., 2004; Nightingale et al., 2008), and the production of either a truncated or non-secreted InlA protein. Assays conducted in vitro (Nightingale et al., 2005) and in mammalian models (Nightingale et al.,  23 2008; Roldgaard et al., 2009; Van Stelten et al., 2011) have both shown that strains possessing PMSCs exhibit virulence-attenuated phenotypes. Interestingly, PMSCs are more commonly observed in 1/2a and other serotypes that belong to lineage II strains, and are not associated with 4b strains (Orsi et al., 2011). It has been suggested that lineage II 1/2a strains are better able to survive conditions associated with the food chain, while 4b serotype strains appear more recalcitrant to genetic flux. As such, 4b strains are less likely to acquire or possess plasmids and to experience homologous recombination events that may afford rapid adaptation to niche-specific stresses (Orsi et al., 2011).   Other internalins such as InlC2, InlD, InlE, InlG, InlH, and InlJ have been suggested to contribute to infection, but presently their roles are not well defined (Tsai et al., 2006). Deletion of inlJ (lmo2821 in EGD-e strain), which is present in the genomes of L. monocytogenes but absent from L. innocua (Cabanes et al., 2002; Doumith et al., 2004), resulted in attenuated virulence in intravenously or orally infected mice expressing human E-cadherin (Sabet et al., 2005). Sabet et al. (2008), further demonstrated that this protein is an adhesin specifically expressed during infection in vivo. It is produced and localized on the bacterial surface when L. monocytogenes is in the liver and blood, but not in vitro in brain heart infusion medium or when replicating in the cytosol of tissue-culture cells (e.g., JEG-3 placental cells, HT29 intestinal cells, J774 murine macrophages) (Sabet et al., 2008). While the extent to which InlJ and other internalins contribute to L. monocytogenes virulence remains elusive, together with InlA and InlB they are believed to work in synergy to achieve optimal invasiveness (Dramsi et al., 1995).   In addition to internalins, listeriolysin O (LLO) and phospholipase C (PLC) are extremely important in the intracellular survival of L. monocytogenes. LLO is a member of  24 the pore-forming, cholesterol-dependent cytolysin family, with similarities to some other cytolysins produced by Gram positive bacteria such as Streptococcus, Bacillus, and Clostridium spp. (Salyers and Whitt, 2002). LLO lyses the primary phagosomes engulfing the bacteria upon cell internalization and disrupts the secondary phagosomal membrane during intercellular movement (Figure 1-3) (Gedde et al., 2000). LLO is crucial for listerial survival inside the host, since bacteria that are internalized but cannot breach the vacuolar membrane and exit into the cytosol have very remote chance of survival due to immune response action. Even if the bacteria are able to survive inside the vacuole, the inability of L. monocytogenes to multiply decreases their spread, which consequently results in lower virulence capacity (Cossart et al., 1989; Vàzquez-Boland et al., 2001b).   Similar to LLO, PLCs enzymes aid the escape of L. monocytogenes from the vacuoles into the cytosol and contribute to successful cell to cell spread (Figure 1-3) (Camilli et al., 1991; Grundling et al., 2003). PI-PLC is the enzyme responsible for propagation of L. monocytogenes in the host tissue, due to its activity on phosphatidylinositol (PI) and glycosyl-PI-anchored proteins, while phosphatidylcholine-specific PLC (PC-PLC) is a zinc dependent, broad range enzyme capable of recognizing a range of different substrates and responsible for cleaving most phospholipids (Camilli et al., 1991). The PC-PLC enzyme is excreted in an inactive form, which then needs to be matured and activated with the help of a metalloprotease (Mpl) (Vàzquez-Boland et al., 2001b).  1.2.4.3 Regulation of virulence  The expression of major virulence genes is mediated by PrfA, a positive regulatory factor responsible for activation and repression of genes located on LIPI-1 and a number of other  25 genes on the chromosome (e.g., inlAB, bsh) (Cabanes et al., 2011; Ward et al., 2004). PrfA regulation is subject to the changes in transcriptional activity of the protein, with the amount of PrfA produced being controlled at the transcriptional and translational levels (Johansson et al., 2002; Scortti et al., 2007). It is also thermally regulated, with the expression of PrfA suppressed at temperatures below 30°C and up-regulated as the temperature increases, for example in a warm-blooded host (Kuhn et al., 2008; Scortti et al., 2007). In particular, at low temperatures prfA 5’ untranslated region (UTR) adopts a stable hairpin structure that masks the Shine-Delgarno site and prevents its interaction with the 30S ribosomal subunit, thereby inhibiting translation. In contrast, at high temperatures (e.g., 37°C) this hairpin structure denatures, allowing PrfA translation (Johansson et al., 2002; Loh et al., 2006; Mellin and Cossart, 2012).   A PrfA mutation in EGD, where glycine is replaced with serine at amino acid position 145, results in constitutive expression of the core PrfA regulon [e.g., genes located on LIPI-1, the inlA-inlB operon, inlC (lmo1786), and hpt (lmo0838)] (Bécavin et al., 2014). This leads to higher in vitro (e.g., HeLa, JEG3 cells, and mouse macrophages Raw264) invasion efficiencies compared to EGD-e and 10403S L. monocytogenes strains. Interestingly, the same effect is not observed when the invasion of EGD is tested in mice (Bécavin et al., 2014). Further, when 39 L. monocytogenes genomes were compared, this mutation was observed only in EGD and M7 (i.e. a non-pathogenic serovar 4a strain isolated from cow’s milk) strains. The authors suggest this mutation is likely not advantageous and may be a consequence of repeated passage through mice (Bécavin et al., 2014). prfA mutations resulting in attenuated virulence have also been described (Herler et al., 2001; Miner et al., 2008; Velge et al., 2007). A naturally occurring substitution of lysine with  26 threonine at amino acid position 220 (K220T), and a seven nucleotide insertion in the prfA gene that leads to a PMSC and a truncated protein (PrfAΔ174-237) have been found in low-virulence L. monocytogenes isolates from food products and production environments in France (Roche et al., 2005; Roche et al., 2012). Interestingly, the K220T mutation has been associated with multilocus sequence types (ST) 13, and PrfAΔ174-237 has been seen in isolates belonging to ST31 (Roche et al., 2012).  In addition to PrfA, σB, an alternative sigma factor that plays a role in the general stress response in L. monocytogenes, contributes to regulation of genes encoding internalins (e.g., inlA and inlB) (Kuhn et al., 2008; McGann et al., 2007). One of the PrfA promoters (prfAp2) is partially σB regulated (Kazmierczak et al., 2006; Nadon et al., 2002), however, its contribution to PrfA transcription has been debated. Kazmierczak et al. (2006) demonstrated that σB plays a limited or non-existent role in the activation of PrfA or in the transcription of PrfA-dependent genes during invasion. Instead, they suggest that L. monocytogenes switches from σB-mediated expression of stress response and selected virulence genes to PrfA-mediated expression of virulence genes required for intracellular survival and growth once it senses stressful environment inside the gastrointestinal tract (Kazmierczak et al., 2006).   In the last decade, several other virulence regulators have been identified in L. monocytogenes; however, the regulatory extent and exact functions for most remain elusive (Roche et al., 2008). To date, 16 two-component systems have been described in L. monocytogenes (Mandin et al., 2005). Most of these systems are related to stress sensing and response (e.g., CesR/CesK, involved in beta-lactam resistance; CheY/CheA, involved in chemotaxis; LisR/LisK, implicated in acid stress), with the recently described response regulator VirR playing a role in virulence. A study by Mandin et al. (2005) demonstrated a  27 severe virulence defect in mice and Caco-2 cell lines in the virR deletion mutant. Further, they found that VirR regulates 12 genes that are involved in bacterial surface components modifications. Other regulators, such as DegU, regulate the expression of flagella-specific genes and play a role in in vivo virulence in mice (Knudsen et al., 2004), while a serine-threonine phosphatase (Stp) regulates translation elongation factor (EF)-Tu, and controls bacterial survival inside the host (Archambaud et al., 2005).   Recent RNA studies have identified a number of small non-coding RNAs (ncRNAs) in L. monocytogenes that are absent from L. innocua, and are likely candidates in virulence gene regulation (Christiansen et al., 2006; Mandin et al., 2007; Toledo-Arana et al., 2009). These are divided into cis-acting RNAs that serve as riboswitches and typically affect either transcription or translation; cis-encoded antisense RNAs (asRNAs) that may interfere with RNA polymerase affecting mRNA translation and stability; and trans-encoded RNAs (sRNAs) that modulate translation by base-pairing with target mRNA or direct binding with proteins (Mellin and Cossart, 2012; Toledo-Arana et al., 2009). Among some of the well-studied and described L. monocytogenes ncRNAs are the translational attenuator and RNA thermosensor regulating the translation of PrfA (Johansson et al., 2002; Loh et al., 2006), and an asRNA regulator of the flagellar biosynthetic genes and their repressor, MogR (Toledo-Arana et al., 2009). A number of other ncRNAs, with putative regulatory roles, have recently been identified in L. monocytogenes; however, the exact targets and mechanisms of action for most are presently unknown (Mandin et al., 2007; Oliver et al., 2009; Toledo-Arana et al., 2009). As this type of research is still relatively new, the increased availability of next-generation sequencing technologies will likely expand and improve knowledge of non-coding regulatory RNAs in the coming years.   28 1.2.5 Survival mechanisms of Listeria monocytogenes Listeria monocytogenes encounter a variety of stresses as they travel from natural environments such as soil and decaying vegetation to food processing environments and, ultimately, mammalian hosts. These often include fluctuations in temperature, pH and osmolarity, competition with other microorganisms and nutrient limitation (Stack et al., 2008; Wesche et al., 2009). The ability of L. monocytogenes to persist in various environmental niches, and to successfully colonize animal and human hosts is due to a network of sophisticated survival mechanisms. These include a number of virulence factors, approximately 331 transport, 133 surface and 86 secreted proteins, and overall 7% of its coding capacity dedicated to transcriptional regulators (Dussurget et al., 2004).   1.2.5.1 Sigma B (σB) and other alternative sigma factors The crucial component and the main regulator in L. monocytogenes energy-related and environmental stress response network is σB (Oliver et al., 2010). It is one of the four alternative sigma factors found in L. monocytogenes (e.g., σB, σC, σH, σL) (Chaturongakul et al., 2008; Glaser et al., 2001). Sigma factors associate with a core RNA polymerase under appropriate environmental conditions. Through the recognition of specific promoter regions they help initiate and regulate the transcription of specific genes (Chaturongakul et al., 2008; Glaser et al., 2001). Earlier studies demonstrated that σB positively regulates at least 168 genes in L. monocytogenes, while 128 genes are negatively regulated (Kazmierczak et al., 2003; Raengpradub et al., 2008). More recently, Oliver et al. (2009; 2010) showed that the number of genes under σB regulation is strain-dependent, when four strains belonging to lineages I, II, III, and IV were characterized. As many as 400 σB-dependent genes were  29 observed to be positively regulated in at least one of the four strains tested, representing the σB pan-regulon, while 63 genes were identified within the σB core regulon (Oliver et al., 2010). Under normal growth conditions σB is typically maintained inactive through the association with an anti-sigma factor, RsbW (O'Byrne and Karatzas, 2008). When the cells experience stress phosphatase RsbU unphosphorylates an anti-anti-sigma factor, RsbV, which in turn reacts with the anti-sigma factor RsbW (O'Byrne and Karatzas, 2008; Shin et al., 2010). This process leads to dissociation of the σB-RsbW complex, thereby releasing σB and allowing it to induce the expression of appropriate stress response genes (Chaturongakul et al., 2008).   Less is known about the specific targets and mechanisms of action for the other three alternative sigma factors found in L. monocytogenes. The σC and σH-dependent genes have not been characterized; however, studies have shown that σC, belonging to the family of extracytoplasmic function factors, is seen exclusively in lineage II strains, and likely contributes to heat resistance (Zhang et al., 2005; Zhang et al., 2003), while the σH deletion mutants exhibited reduced growth in minimal medium, and alkaline conditions (Rea et al., 2004). Based on the growth of σC and σH-deletion mutants at 4°C, Chan et al. (2008) suggested these sigma factors may be involved in cold adaptation of L. monocytogenes 10403S strain; however, their contribution to listerial growth at 4°C in rich medium could not be demonstrated. A more diverse role has been proposed for σL. A study by Arous et al. (2004) described 77 σL-dependent genes, most of which are involved in carbohydrate and amino acid metabolism. Additional studies used σL deletion mutants to show this sigma factor plays a role in osmotolerance (Okada et al., 2006; Raimann et al., 2009), and growth in the presence of organic acids and cold temperatures (Raimann et al., 2009). Recently,  30 sequencing of the sigL gene in a diverse population of L. monocytogenes strains revealed that strains capable of fast adaptation to refrigeration possessed identical amino acid substitutions, suggesting potential structural and functional changes in the protein that may promote differences in cold growth behavior (Arguedas-Villa et al., 2014).   1.2.5.2 Acid stress response Listeria monocytogenes produces a number of acid shock proteins that aid the bacterium in maintaining its pH homeostasis (e.g., pH 6 to 7) when exposed to acidic environments. Glutamate decarboxylase (GAD), arginine deiminase (ADI), and F0F1ATPase systems (Figure 1-4) play major roles in L. monocytogenes survival in low pH foods, the gastrointestinal environment, or upon excretion from the host cell (Stack et al., 2008).  In particular, the GAD system reduces the proton concentration within the cell and contributes to alkalization of the environment by irreversibly decarboxylating free glutamate present in the environment, and by producing γ-aminobutyrate (GABA). During this reaction, intracellular protons are consumed, GABA is transported outside and glutamate uptake occurs via an antiporter. As a result, the cytosol becomes less acidic and a slight increase in extracellular pH occurs, contributing to pH stability (Hill et al., 2002; Stack et al., 2008). Since glutamate is commonly present in foods, its presence greatly enhances L. monocytogenes survival in acidic conditions (Rundlett and Armstrong, 1994).   The expression of genes involved in the GAD system is acid-induced and to some extent under control of σB (Hill et al., 2002; Stack et al., 2008). Recently, a five-gene operon (e.g., lmo0444 to lmo0448 in EGD-e), termed the stress survival islet (SSI-1), was shown to encode for a glutamate decarboxylase homolog (gadD1), and an antiporter (gadT1) involved  31 in L. monocytogenes adaptation to mildly acidic environments (Ryan et al., 2010). Interestingly, this islet is absent from the majority of strains belonging to serotype 4b (Arguedas-Villa et al., 2014; Stack et al., 2008), suggesting its presence is not required for the survival of L. monocytogenes in the gastrointestinal environment.    Gene$regula*on$$Acid$stress$Cold$Heat$Osmo*c$stress$B$B$An*microbial$stress$GadC$LisR$LisK$Glutamate$ GABA$Glutamate$ GABA$H+$ CO2$GadB,$A$Betaine$C$C$BetL$B$ B$B$B$Carni*ne$OpuC$P$?$P$Glutamate$ProBA$Proline$LisR$P$$Stress$sensing$F1F0$ATPase$ATP$ADP$H+$H+$H+$H+$H+$H+$H+$H+$H+$H+$H+$H+$H+$H+$H+$H+$H+$ H+$H+$ H+$H+$H+$H+$H+$Chaperones$DnaK$ClpC$GroEL$GbuABC$Chaperones$CspA,B,D$SigB$EmrELm$(SMR)$H+$QAC$$sani*zers$MdrL$(MFS)$QAC$$sani*zers$H+$Lde$(MFS)$H+$FQ$Cytoplasm$ArcD$Ornithine$Arginine$ArcA$ArcB$NH3$+$CO2$ATP$ADP$ArcC$CQP$  Figure 1-4. A schematic representation of simplified Listeria monocytogenes stress mechanisms discussed in the text and their proposed roles in stress protection/adaptation. Adapted from Hill et al. (2002). B, betaine; C, carnitine; C-P, Carbamoyl-phosphate; Ceph, cephalosporins; FQ, fluoroquinolones; GABA, gamma-aminobutyrate; LM, lincosamides; P, proline; circled P, phosphate; QAC, quaternary ammonium compounds; SMR, small multidrug resistance; MFS, major facilitator superfamily; ML, macrolides. Intermittent arrows represent putative functions.    32  In addition to the GAD system, Listeria spp. utilize the ADI system when faced with acidic environments. The ADI system is comprised of three enzymes: arginine deiminase, catabolic ornithine carbamoyltransferase, and carbamate kinase (Ryan, 2006). In this pathway, arginine is converted to ornithine, ammonia and carbon dioxide; ornithine is transported outside the cell via an antiporter, while ammonia reacts with intracellular protons resulting in ammonium ions (NH4+) and increased intracellular pH. In the ADI system, both extracellular and intracellularly synthesized arginine are used, with the latter being more important for the reactions (Stack et al., 2008). Regulation of the ADI system is rather complex and under the influence of at least four regulators: ArgR, Lmo0041, PrfA and σB (Ryan, 2006; Stack et al., 2008).   The third system L. monocytogenes employs under acidic conditions is an F0F1ATPase multisubunit enzyme complex (Cotter et al., 2000). It is based on adenosine triphosphate (ATP) synthesis and/or hydrolysis, and proton translocation. The F0 portion of the enzyme is membrane bound and responsible for proton translocation across the membrane, while F1 is the ATPase component in the cytoplasm, involved in the ATP synthesis and hydrolysis (Stack et al., 2008). Under aerobic conditions this system is typically used to synthesize ATP by utilizing proton influx into the cell, while under anaerobic conditions a proton motive force is generated and protons are excreted. It has been suggested that L. monocytogenes lacks a respiratory chain, but rather has an alternative method for ATP synthesis by the decarboxylation of amino acids (Cotter et al., 2000; Stack et al., 2008). In bacteria that lack a respiratory chain the role of F0F1ATPase system is to create a proton gradient driven by ATP hydrolysis, and expel hydrogen ions, which in turn helps establish pH homeostasis (Cotter et al., 2000; Stack et al., 2008).  33 1.2.5.3 Osmotic stress response  Survival of L. monocytogenes in food processing environments and the gastrointestinal tract requires bacteria to appropriately and quickly respond to wide osmolarity oscillations caused by desiccation and high amounts of salt and sugars present in the intestinal chyme. Bacteria typically accumulate compatible solutes, such as glycine betaine, proline, and carnitine to fight osmotic stress (Bayles and Wilkinson, 2000; Patchett et al., 1992; Sleator et al., 2003a; Sleator et al., 2003b; Stack et al., 2008). Glycine betaine is commonly found in plant tissues, fish and baked goods, while carnitine is predominantly present in mammalian tissues (Beumer et al., 1994; McNeil et al., 1999). Three important ATP-dependent transporters have been identified in L. monocytogenes, BetL and Gbu for transport of glycine betaine, and OpuC responsible for carnitine transport (Sleator et al., 2003a). In addition, various other proteins are up-regulated or down-regulated in order for L. monocytogenes to successfully combat osmotic stress, such as RelA, Ctc, HtrA, KdpE, LisRK, ProBA and BtlA (Stack et al., 2008). Regulation of compatible solutes is rather complex and is believed to occur at transcriptional, translational and post-translational levels (Sleator et al., 2003b). Putative σB promoter binding sites have been found upstream of betL, gbu, and opuC, suggesting σB may play a partial role in their expression. In addition, σA dependent promoters have been described for betL (Hoffmann et al., 2013) and gbu (Sleator et al., 2003b; Spiegelhalter and Bremer, 1998).     1.2.5.4 Temperature induced stress response Heat shock response mechanisms in L. monocytogenes include a variety of molecular chaperones and ATP-dependent proteases (Figure 1-4). Their roles involve maintaining the  34 integrity of cellular proteins during adverse conditions (e.g., proteins GroES, GroEL, DnaK, DnaJ), and preventing the accumulation of altered or misfolded proteins through degradation (e.g., Clp, HtrA) (Liu et al., 2002; Stack et al., 2008). The expression of these genes is tightly regulated, with repressors HrcA and CtsR, and a positive regulator LisRK believed to play important roles (Nair et al., 2000; Stack et al., 2008). In addition, most of the proteins identified in the heat shock response either directly or indirectly contribute to L. monocytogenes virulence (Stack et al., 2008; Stack et al., 2005).   Listeria monocytogenes also elicits a strong stress response comprised of a network of adaptation mechanisms when exposed to cold temperatures. These include changes in the cell membrane [e.g., increase in C15:0 and short chain fatty acids (Jones et al., 1997; Puttmann et al., 1993)], uptake of cryoprotective osmolytes and peptides (Bayles and Wilkinson, 2000; Hoffmann et al., 2013), and the production of cold shock (Csps) and acclimation proteins (Caps), as well as general stress response proteins (Bayles et al., 1996; Liu et al., 2002; Tasara and Stephan, 2006).   Three main Csp family proteins of low-molecular weight (e.g., CspA, CspB, and CspD) have been characterized, and found within the sequenced L. monocytogenes genomes (Bayles et al., 1996; Glaser et al., 2001; Nelson et al., 2004; Phan-Thanh and Gormon, 1995; Tasara and Stephan, 2006). They typically act as chaperones that bind RNA and DNA, promoting transcription and translation function during cold stress (Horn et al., 2007). Recent studies have also demonstrated the role of these proteins in osmotic stress tolerance (Schmid et al., 2009), and the regulation of LLO production (Scharer et al., 2013), suggesting they may play a role in virulence.    35  However, the extent of different mechanisms contributing to strain differences when it comes to cold adaptation and growth of L. monocytogenes are not well understood. Studies have reported differences in the lag phase duration in L. monocytogenes strains of human, food, and food production environment origins (Arguedas-Villa et al., 2014; Arguedas-Villa et al., 2010; Kovacevic et al., 2013a). While three cold adapting groups were observed (i.e. fast, < 70 h lag; intermediate 70 to 200 h lag; and slow, > 200 h lag), these variations could not be attributed to differences in the expression of nine cold adaptation genes (e.g., lmo0501, cspA, cspD, gbuA, lmo0688, pgpH, sigB, sigH, sigL) (Arguedas-Villa et al., 2014), or the presence of SSI-1 (lmo0444-lmo0448) previously linked to improved survival of L. monocytogenes in mildly acidic and osmotic environments (Ryan et al., 2010). Interestingly, fast cold adaptors exhibited five identical substitutions (e.g., Met90Leu, Ser203Ala/Ser203Thr, Ser304Asn, Ser315Asn, and Ile383Thr) in their SigL proteins, suggesting these may play a role in cold stress adaptation. Similarly, an experimentally induced single point mutation in the betL σA-dependent promoter, where one of a string of seven thymines within the spacer region between the -10 and -35 binding sites was deleted, resulted in higher transcript levels under cold stress conditions, and simultaneous increase in L. monocytogenes growth under refrigeration (Hoffmann et al., 2013). However, the extent of this mutation in WT L. monocytogenes strains and possible correlation with cold adapting groups has not been reported.   1.2.6 Listeria monocytogenes in the food industry  Although the widespread distribution of L. monocytogenes in rivers, soils, and industrial and farming effluents has been recognized as inevitable due to the ubiquitous nature and the  36 propensity of Listeria spp. to adapt to arduous conditions, their presence and persistence in food processing environments is of concern. The ability of L. monocytogenes to survive multiple hurdles imposed in food processing, through stress-adaptation mechanisms and formation of biofilms, has highlighted the need for improved food safety plans in food processing facilities (Møretrø and Langsrud, 2004; Wong, 1998). Since it was recognized as an important foodborne pathogen in the 1980s, many efforts have been made to eliminate L. monocytogenes from foods and food processing environments; however, three decades later Listeria are very much present in the food supply worldwide (Bērziņš et al., 2009; Bohaychuk et al., 2006; Garrido et al., 2009; Inoue et al., 2000; Sauders et al., 2009).     1.2.6.1 Incidence in foods and food processing environments The prevalence of Listeria spp., and particularly L. monocytogenes, in foods has been studied extensively, with evidence of listerial growth in almost all food categories (Farber et al., 2007; Ryser, 2007a; Ryser, 2007b; Ryser, 2007c; Uyttendaele et al., 2009). Different levels of contamination have been seen across dairy, meat, fish and produce facilities and their products in different geographical regions; however, in most cases strains or serotypes of L. monocytogenes are not facility category- or food-specific (Kovačević et al., 2012a; Kovačević et al., 2012b; Liu, 2008). Moreover, listerial contamination is frequently linked but not limited to the level of hygiene practiced in a facility, including inadequacies in processing, cleaning and sanitation (Kabuki et al., 2004; Møretrø and Langsrud, 2004; Wong, 1998). Failures in food processing and/or sanitary handling, and inadequate cleaning and sanitation may lead to bacterial build-up and continuous contamination of processing machines and food products with L. monocytogenes (Holah et al., 2004; Lin et al., 2006;  37 Lundén et al., 2002). In fact, a number of large listeriosis outbreaks have occurred in the last decade as a result of L. monocytogenes contaminating food products (Table 1-1) (CDC, 2011; Gaulin et al., 2012; Health Canada, 2011; Weatherill, 2009).  There have been eight listeriosis outbreaks reported in Canada, linked to a variety of RTE foods (Table 1-1) (Clark et al., 2010; Health Canada, 2011). The most notable, however, was the 2008 nationwide outbreak associated with contaminated deli meats that originated from a single food processing facility and resulted in 57 invasive listeriosis cases and 23 deaths (Weatherill, 2009). The originating source of contamination was suspected to be a large commercial slicer (Weatherill, 2009). Environmental sampling records showed the intermittent presence of L. monocytogenes on two processing lines within the facility for almost a year prior to the outbreak. Similar scenarios have been reported in other listeriosis outbreaks where L. monocytogenes in the processing environment led to contamination of RTE products (CDC, 2002; Mead et al., 2006; Olsen et al., 2005). It is well established that food product contamination is associated with food processing environments harboring L. monocytogenes and subsequent post- processing transfer to finished products (Lappi et al., 2004; Lundén et al., 2002; Olsen et al., 2005; Tompkin, 2002). Strains of L. monocytogenes capable of persisting in food-processing environments for up to 12 years and intermittently contaminating products have been reported (Holah et al., 2004; Lundén et al., 2002; Olsen et al., 2005; Senczek et al., 2000).  1.2.6.2 Control and monitoring  In effort to minimize the survival of L. monocytogenes in foods, food additives, such as Carnobacterium maltaromaticum CB1, potassium lactate, sodium acetate, sodium diacetate   38 Table 1-1. Major foodborne listeriosis outbreaks reported worldwide. Adapted from Health Canada’s policy on Listeria monocytogenes in ready-to-eat foods (Health Canada, 2011) and government reports on listeriosis outbreaks worldwide (CDC, 2011; CDC, 2012; CDC, 2013; CDC, 2014; Fretz et al., 2010; NSW Ministry of Health, 2013).  Food type / Year Location Invasive/ Non-invasive No. cases (deaths) Foods Meat and poultry     1987-89 UK and Ireland Invasive 355 (94) Pâté 1990 Australia Invasive 11(6) Pâté 1992 France Invasive 279 (85) Jellied pork tongue 1993 France Invasive 39 (12) Pork rillettes (pâté-like RTE meat) 1998-99 U.S.A. Invasive 108 (14) Meat frankfurters 1999 U.S.A. Invasive 11 Pâté 1999-2000 France Invasive 10 (3) Rillettes (pâté-like RTE meat) 1999-2000 France Invasive 32 (10) Jellied pork tongue 2000 U.S.A. Invasive 30 (7) Deli turkey meat 2000 Australia Non-invasive 31 RTE corned beef and ham 2001 U.S.A. Non-invasive 16 Precooked sliced turkey 2002 U.S.A. Invasive 54 (8) Sliceable turkey deli meats 2008 Canada Invasive 57 (23) RTE deli meats Dairy products     1983 U.S.A. Invasive 49 (14) Pasteurized milk 1983-87 Switzerland Invasive 122 (31) Soft cheese 1985 U.S.A. Invasive 142 (48) Mexican-style fresh cheese 1989-90 Denmark Invasive 26 (6) Blue mould cheese or hard cheese 1994 U.S.A. Invasive 45 Chocolate milk 1995 France Invasive 37 (11) Raw milk soft cheese 1997 France Invasive 14 Soft cheeses 1998-99 Finland Invasive 25 (6) Butter made from pasteurized milk 2000 Canada (Manitoba) Invasive 7 Flat whipping cream 2000-01 U.S.A. Invasive 13 Mexican-style fresh cheese 2001 Sweden Non-invasive > 120 Fresh cheese made from raw milk in a summer farm 2001 Japan Non-invasive 38 Washed-type cheese 2001 Belgium Invasive 2 Frozen ice cream cake 2002 Canada (BC) Invasive 47 Cheese 2002 Canada (Quebec) Invasive 17 Soft and semi-hard raw milk cheese 2002 Canada (British Columbia) Non-invasive 86 Cheese made from pasteurized milk 2003 U.S.A. Invasive 13 (2) Mexican-style fresh cheese  39 Table 1-1. Continued. Food type / Year Location Invasive/ Non-invasive No. cases (deaths) Foods Dairy products      2005 Switzerland Invasive 10 (3) Soft cheese 2007 U.S.A. Invasive 5 (3) Pasteurized milk 2008 Canada (Quebec) Invasive 38 (2) Cheeses 2009-10 Australia, Germany, Czech Republic Invasive 34 (8) Acid curd cheese “Quargel” 2012 U.S.A. Invasive 22 (2) Ricotta salata cheese imported from Italy 2013 U.S.A. Invasive 6 (2) Farmstead Cheeses 2013 Australia Invasive 18 (3) Variety of soft cheeses 2014 U.S.A. Invasive 8 (1) Variety of cheese products Fish and seafood products    1989 U.S.A. Non-invasive 9 (1) Shrimp 1991 Australia (Tasmania) Non-invasive 4 New Zealand produced smoked mussels 1992 New Zealand Invasive 4 (2) Smoked mussels 1994-95 Sweden Invasive 6 (1) “Gravad” rainbow trout and cold- smoked rainbow trout 1996 Canada Invasive 2 Imitation crab meat Unknown Finland Non-invasive 5 Cold-smoked rainbow trout Fruits and vegetables    1981 Canada Invasive 41 (17) Coleslaw mix 1997 Italy Non-invasive 1566 Corn and tuna salad 1998-99 Australia Invasive 6 (5) Commercially prepared fruit salad 2011-12 U.S.A. Invasive 147 (34) Cantaloupe Other foods    1993 Italy Non-invasive 23 Rice salad 2003 UK Invasive 5 Pre-packed sandwiches 2009 Australia Unknown 8 Chicken wrap       40 and sodium lactate, have been approved as growth repressors or inhibitors in Canada (Health Canada, 2011). Health Canada (2011) also encourages processors to use post-processing treatments, such as surface pasteurization of products with hot water, steam, infrared processes and radiant oven heating, or high-pressure processing, in conjunction with antimicrobial treatments. More recently, research on naturally occurring bacteriocins and bacteriophages has shown promise in the control L. monocytogenes in foods and processing environments, respectively (Carlton et al., 2005; Guenther et al., 2009; Ming et al., 1997; Muriana, 1996). However, even with these applications, it has been acknowledged that the complete elimination of L. monocytogenes from the food chain is unrealistic. Instead, efforts should be placed on minimizing the contamination of food products and implementing effective controls in the food processing environments (FAO and WHO, 2004; Health Canada, 2011).   The use of environmental sampling to detect the contamination and spread of Listeria spp. in food processing has been recognized as a valuable tool (Health Canada, 2011). However, in Canada, these practices are required only in federally licensed facilities that export foods out of the province of origin, or country. In a large number of food processing facilities that are licensed by provincial authorities and do not export foods out of province or country, environmental sampling or food testing for Listeria spp. is not required or practiced. As such, there is a concern that consumers are potentially exposed to pathogenic L. monocytogenes, leading to unfavorable health outcomes.     41 1.2.7 Susceptibility of Listeria monocytogenes to antimicrobials 1.2.7.1 Antibiotic resistance If diagnosed promptly, listeriosis can be treated successfully with antibiotics. Ampicillin, in combination with aminoglycosides (e.g., gentamicin) is the preferred line of treatment, while, cotrimoxazole (SXT; sulfamethoxazole with trimethoprim) is often administered to patients with allergies to β-lactams (Hof et al., 1997).  Although resistance to antimicrobials used in listeriosis treatment (i.e. aminopenicillins, aminoglycosides, and SXT) remains rare (Granier et al., 2011; Lyon et al., 2008; Morvan et al., 2010), an increasing trend in resistance or reduced susceptibility to a number of clinically relevant drugs historically effective against Listeria spp. has been reported worldwide (Aureli et al., 2003; Charpentier and Courvalin, 1999; Kovacevic et al., 2013b; Lungu et al., 2011; Morvan et al., 2010; Safdar and Armstrong, 2003; Troxler et al., 2000). In particular, there have been a number of reports describing reduced susceptibility and resistance to ciprofloxacin, clindamycin, and tetracycline in clinical, food and food processing environment (FPE) isolates in North America (Chen et al., 2010; Kovacevic et al., 2013b; Lyon et al., 2008) and Europe (Aureli et al., 2003; Morvan et al., 2010). Within these reports, L. monocytogenes has been shown to harbor genetic elements conferring resistance/reduced susceptibility to ciprofloxacin (lde), chloramphenicol (cat), erythromycin (erm), streptomycin (aad6), and trimethoprim (dfrD) (Chen et al., 2010; Granier et al., 2011; Morvan et al., 2010).   Examination of clinical L. monocytogenes isolates collected in the US from 1955 to 1997 found no resistance to the fluoroquninolone ciprofloxacin and high susceptibility (96.9%) to tetracycline (Safdar and Armstrong, 2003). Similarly, 202 L. monocytogenes  42 isolates recovered from food sources in France from 1996 to 2006 did not exhibit any fluoroquinolone resistance and only two isolates were resistant to tetracycline (Granier et al., 2011); however, when a large collection of clinical strains (n=4,668) collected from 1989 to 2007 in France were examined, 20 (0.4%) and 34 (0.7%) isolates were resistant to ciprofloxacin and tetracycline, respectively, indicating a slow emergence of these phenotypes that had previously been absent or rare in L. monocytogenes (Morvan et al., 2010). Similar concerns have been raised in a recent Canadian study where 7% of food-derived L. monocytogenes were resistant and 67% possessed reduced susceptibility to ciprofloxacin (Kovacevic et al., 2013b). The same study showed that 6% of L. monocytogenes strains from fish possessing plants possessed resistance to tetracycline, while 8% of isolates were resistant in a study by Zhang et al. (2007). Fluoroquinolone resistance has been attributed to active efflux due to over-expression of lde in L. monocytogenes (Godreuil et al., 2003; Jiang et al., 2012; Lismond et al., 2008). This is in contrast to ciprofloxacin resistance observed in E. coli (Vila et al., 1996) and Streptococcus pneumoniae (Piddock et al., 2002), where mutations in the quinolone resistance-determining regions (QRDR) of DNA gyrase and topoisomerase IV confer resistance. In fact, QRDR-based mutations are absent in resistant isolates in L. monocytogenes or do not significantly impact tolerance to ciprofloxacin (Jiang et al., 2012; Lampidis et al., 2002).   Clindamycin resistance seems to vary by geographical region and origin. Studies by Safdar and Armstrong (2003) and Chen et al. (2010) reported 96% of clinical and 69% of food-derived L. monocytogenes isolates from the US were resistant to clindamycin, respectively. In a separate US study by Davis and Jackson (2009), resistance to clindamycin was seen in 21% of L. monocytogenes isolates from animals, food, FPE, and humans, while  43 33% and 65% of food-derived Canadian isolates were resistant or possessed reduced susceptibility, respectively (Kovacevic et al., 2013b). Interestingly, no resistance to clindamycin was observed in clinical isolates from France (Morvan et al., 2010), or from French food and environmental isolates collected between 1996 and 2006 (Granier et al., 2011). The mechanism(s) behind L. monocytogenes resistance to clindamycin is not fully understood, but modifications of 23S ribosomal RNA or the presence of an enzyme capable of modifying clindamycin are believed to contribute to this phenomenon (Chen et al., 2010; Depardieu et al., 2007). Similar mechanisms may be associated with reduced efficacy of chloramphenicol and erythromycin, which raises concerns about the potential for cross-resistance to differing drug classes through a common resistance mechanism and selective pressure (Depardieu et al., 2007).  1.2.7.2 Resistance to sanitizers A number of different hypotheses have been proposed to explain the ability of L. monocytogenes to persist for prolonged periods of time on various surfaces in food processing facilities (Giovannacci et al., 2000; Lundén et al., 2002). Some of these pertain to the conditions practiced and controlled at the facility level. For instance, inadequate cleaning and sanitation practices can promote bacterial persistence through the formation of biofilms (Barbalho et al., 2005; Jeyasekaran et al., 2000). Moreover, particular food environments and surfaces (e.g., rubber and plastics) are more prone to harboring pathogenic microorganisms (Lundén et al., 2002; Wilks et al., 2006; Wong, 1998). Additional hypotheses have been put forward that suggest strain-associated differences in stress adaptation or the capacity to form biofilms influence persistence in the food processing environment (Chae and Schraft, 2000;  44 Lundén et al., 2003). Studies have also suggested that strains exhibit a range of tolerance and resistance to sanitizers commonly used in food processing environments (Jeyasekaran et al., 2000; Lemaître et al., 1998).   Although there have been no reports of L. monocytogenes resistance to concentrations of sanitizer equal to or higher than those commonly recommended by manufacturers when bacteria are grown in a liquid suspension, inter-strain variation in the tolerance of sub-lethal concentrations of different sanitizers has been observed (Aase et al., 2000; Earnshaw and Lawrence, 1998; Lundén et al., 2003). This enhanced tolerance has been attributed to cell membrane modifications that reduce permeability, acquisition of genes conferring resistance, as well as the function of efflux pumps (Casey et al., 2014; Dutta et al., 2013; Elhanafi et al., 2010; Romanova et al., 2006; To et al., 2002).   Casey et al. (2014) reported that approximately 600 genes were up-regulated when a persistent L. monocytogenes serotype 1/2a strain recovered from a cheese processing environment was exposed to sub-lethal concentration (4 ppm) of benzethonium chloride. Sanitizers such as benzethonium chloride and BAC are cationic agents, belonging to the QAC family. They are frequently used as sanitizers in food processing facilities due to their non-corrosive properties (Holah et al., 2002). Studies have shown that in Gram positive bacteria such as Staphylococcus aureus these compounds display ionic and hydrophobic interactions with bacterial cytoplasmic membranes, with the cationic head group positioned outwards and the hydrophobic tails tucked into the lipid bilayer (Casey et al., 2014; Ioannou et al., 2007). This interaction results in the rearrangement and solubilization of hydrophobic cell membrane components (e.g., phospholipids and lipoteichoic acids) leading to cell leakage (Gilbert and Moore, 2005). To battle this stress L. monocytogenes up-regulate genes  45 associated with stress sensing (e.g., cheA/cheY), chemotaxis (e.g., methyl-accepting chemotaxis protein, MCP), and motility (e.g., flaA, fliG, fliM, and fliN) to favor a quick and effective response (Casey et al., 2014). Fatty acid and peptidoglycan biosynthesis and metabolism are simultaneously increased to maintain proper membrane fluidity and reinforce structural integrity and stability of the cell wall, respectively (Casey et al., 2014). A shift in the synthesis of longer saturated fatty acids upon exposure to sub-lethal concentrations of BAC has been observed to decrease membrane fluidity (To et al., 2002). Some of the genes up-regulated during this time include the acpP gene, which is responsible for the expression of the acyl carrier protein; fabHA, fabF, and fabR, which are implicated in the initiation and catalyzation of fatty acid elongation and regulation of membrane phospholipid biosynthesis, respectively; the mur family of peptidoglycan synthesis genes; and mnaA involved in the synthesis of teichoic acids and polysaccharides (Casey et al., 2014). Interestingly, genes involved in cold stress response, such as cspC and cspD, are also up-regulated during QAC exposure, along with many other general stress response genes (e.g., rsbRA, ftsHi), and putative stress proteins (e.g., YloU, involved in alkaline-shock) (Casey et al., 2014). This suggests that many of the stress proteins in L. monocytogenes offer cross-protection during adaptation and survival under harsh environmental conditions.   While these physiological changes occur to some extent in all L. monocytogenes, additional sanitizer-induced stress mechanisms have been noted and may contribute to variation in sanitizer tolerance. For instance, the presence of multi-drug transporters and efflux pumps has been described in isolates of different origins (Casey et al., 2014; Dutta et al., 2013). Romanova et al. (2006) demonstrated increased expression of the mdrL gene responsible for the production of the MdrL chromosomal efflux-pump system when  46 previously sensitive L. monocytogenes isolates were experimentally adapted to BAC. However, this pump did not seem to have a significant effect on the resistance of strains naturally resistant to BAC (Romanova et al, 2006). Recently, several other mechanisms have been described in WT strains possessing high levels of resistance to QACs. Elhanafi et al. (2010) characterized a plasmid-based (pLM80) BAC resistance gene cassette (bcrABC) in a strain that caused a multistate hot-dog outbreak in 1998-99. This plasmid was found to possess three transposable units, with one carrying genes that confer resistance to cadmium and BAC and others carrying either cadmium or BAC resistance (Elhanafi et al., 2010). Located on the cassette are a putative transcriptional regulator of the TetR family (bcrA), followed by two putative small multidrug resistance (SMR) genes, bcrB and bcrC. A subsequent study that examined the distribution of the bcrABC cassette revealed that all but one of 71 BAC resistant L. monocytogenes strains, originating from clinical, food and food processing environments, possessed the cassette (Dutta et al., 2013). Interestingly, it was carried by a plasmid in some isolates, while in others it was chromosomally integrated (Dutta et al., 2013).   More recently, Müller et al. (2013) discovered a transposon (Tn6188)-based BAC resistance determinant in L. monocytogenes strains, predominantly of the 1/2a serotype recovered from foods and food processing environments in the US. It is chromosomally incorporated within the radC gene, and is comprised of three transposase genes (tnpABC), a putative transcriptional regulator of the TetR family, and a protein similar to SMR proteins described in E. coli (e.g., EmrE) and Staphylococcus spp. (e.g., QacC/Smr and QacJ in S. aureus, and QacH in S. saprophyticus). This SMR efflux pump has been termed QacH in L. monocytogenes (Müller et al., 2013).   47  SMR efflux-pump systems have been shown to confer resistance to select antibiotics, such as aminoglycosides in Pseudomonas aeruginosa (Li et al., 2003), tetracycline, erythromycin, and sulfadiazine resistance in E. coli (Yerushalmi et al., 1995), and Mycobacterium smegmatis resistance to quinolones (Li et al., 2004). Resistance due to the activity of SMR pumps has not yet been described in L. monocytogenes. However, other transposons described in some L. monocytogenes isolates confer tolerance to cadmium (e.g., Tn5422), antibiotics (e.g., Tn6198), and arsenic (e.g., Tn554-like) (Müller et al., 2013). Similarly, the MFS efflux pump Lde has been implicated in the resistance of L. monocytogenes to quinolones (e.g., Lde) and dyes (Godreuil et al., 2003). Recently, two additional MFS efflux pumps, MdrM and MdrT, have been described in L. monocytogenes, though these pumps are strongly induced by host bile cholic acid, and are believed to transport endogenous rather than exogenous materials (Quillin et al., 2011).  While there has been no definitive evidence to suggest that proper use of sanitizers in food processing will lead to development of resistant microorganisms, the increased presence of multiple potential resistance mechanisms in L. monocytogenes is alarming. These mechanisms could confer competitive advantages to some L. monocytogenes strains in food processing environments, particularly when they are embedded in equipment niches sheltered from cleaners and sanitizers.   1.2.7.3 Antimicrobial resistance and co-selection While increased tolerance to some sanitizers has been observed in different L. monocytogenes strains, the mechanisms underlying sanitizer resistance are not well understood. Moreover, little is presently known about co-selection phenomenon between  48 commonly used sanitizers and antibiotics. Different mechanisms of BAC resistance have been proposed to explain differences between inherently resistant L. monocytogenes strains and experimentally adapted ones (To et al., 2002). The increase in activity of an efflux pump, encoded by mdrL, confers resistance to BAC when sensitive strains of L. monocytogenes are experimentally adapted to high concentrations of BAC (Romanova et al., 2006). However, the efflux pump MdrL has a minor role in strains inherently resistant to BAC, and other mechanisms such as changes in cell surface antigens and fatty acid profiles (To et al. 2002), and the presence of plasmid- (e.g., bcrABC) and transposon-borne (e.g., qacH) elements have been suggested to contribute to this phenomenon. The extent to which these changes contribute to antibiotic resistance has not been determined.   Additionally, when L. monocytogenes were repeatedly cultured in the presence of triclosan, an antibacterial agent widely used in household cleaning products, up to 16-fold increase in tolerance to gentamicin was observed (Christensen et al., 2011). Similarly, Rakic-Martinez et al. (2011) demonstrated that adaptation of clinical L. monocytogenes strains to ciprofloxacin (2 µg/ml) or BAC (10 µg/ml) leads to a subsequent increase in gentamicin resistance. In a separate study, an increase in gentamicin MIC was observed in only two of eight food chain L. monocytogenes isolates experimentally adapted to ciprofloxacin (30-240 µg/ml) (Kovacevic et al., 2013b). This contrasts with another report where the antimicrobial resistance of food chain isolates adapted to BAC (6-7 µg/ml) did not increase, suggesting the phenomenon may be associated with genetic traits not common in all L. monocytogenes (Aase et al., 2000).   Considering the widespread distribution of L. monocytogenes in nature and its recurring encounter with sanitizers in different food processing environments, a better  49 understanding of the co-selection phenomenon and pressures contributing to antimicrobial resistance in L. monocytogenes is needed.  1.3 Research objectives and hypotheses The overall objective of this research was to improve the understanding of physiological and genotypic properties of Listeria spp., and in particular L. monocytogenes, that are encountered in B.C.’s food chain to better understand the risks posed to consumers with potential exposure to Listeria. The characteristics associated with virulence, enhanced stress resistance and survival along the food chain were investigated in a large proportion of Listeria isolates originating from food processing and retail facilities in B.C. to achieve this objective.  The research described in this thesis was carried out in two parts. The first part focused on investigations of the occurrence and distribution of Listeria spp. in food processing and retail facilities, followed by characterization of the genetic properties associated with population structure and virulence. Phenotypic characteristics pertaining to AMR, adaptive mutability, and adaptation to refrigeration were examined. The results of relevant experiments are described in Chapters 2, 3, and 4. The second part of the thesis research focused on elucidating the role of LGI1 in L. monocytogenes virulence and tolerance to food chain-relevant stresses (e.g., low pH, high salt, low temperature, and sanitizers). Hypotheses and sub-hypotheses were generated based on the putative functions of three selected genes. The results of these experiments are described in Chapter 5.   Thesis hypotheses and sub-hypotheses investigated included:  50 Chapter 2 1. Pathogenic L. monocytogenes are present in dairy, meat and fish processing environments, and ready-to-eat foods distributed in B.C. retail trade. Chapter 3 1. Strains belonging to clonal complexes associated with clinical listeriosis cases, and virulent L. monocytogenes strains possessing wild type inlA genes are present in B.C. food chain. 1.1. Serotype 1/2a is more prone to point mutations than other serotypes. 1.2.  Differences exist in the ability of food chain-derived L. monocytogenes to adapt to cold temperatures. Chapter 4 1. Listeria spp. recovered from the B.C. food chain possess resistance to clinically relevant antimicrobials. 1.1. L. monocytogenes adaptation to high concentrations of ciprofloxacin leads to resistance to benzalkonium chloride.  Chapter 5 1. emrE contributes to enhanced tolerance of L. monocytogenes to  1.1. Antibiotics,  1.2. Quaternary ammonium sanitizers and cationic dye acriflavine.  2. Regulator gene lmo1851 contributes to enhanced survival of L. monocytogenes under 2.1.  Refrigeration,   2.2. Acidic pH, and  2.3. High salt environments.   51 3. sel1 contributes to L. monocytogenes increased adhesion and invasiveness of Caco-2 and HeLa cells.    Findings from this research will provide a better understanding of the characteristics of Listeria isolates consumers may encounter through contaminated foods in B.C. In particular, the data obtained will improve our understanding of virulence and stress response factors, and the contribution of presently uncharacterized genomic island LGI1 to the virulence and stress tolerance of L. monocytogenes. Such knowledge is needed to develop more effective Listeria mitigation strategies, prevent virulent L. monocytogenes from contaminating foods, and to aid the development of future detection methods focusing on virulence profiling rather than species detection.    52 Chapter  2: Occurrence and distribution of Listeria spp. in food processing facilities producing ready-to-eat foods, and retail establishments in British Columbia (B.C.), Canada  2.1  Introduction Listeria monocytogenes is commonly associated with food processing environments and ready to eat (RTE) foods. Although it is an infrequent cause of foodborne disease, L. monocytogenes has been linked to disproportionately high levels of morbidity and mortality (Clark et al., 2010; Weatherill, 2009). Its presence in RTE products is particularly troublesome for pregnant women and their fetuses, young children and the elderly. Mortality rates associated with vulnerable populations can range between 20 and 40% (Clark et al., 2010). Evidence suggests the risk of invasive listeriosis may be even higher if virulent strains of L. monocytogenes in RTE foods are encountered (Chen et al., 2006; Gilmour et al., 2010).  In Canada, eight listeriosis outbreaks linked to a variety of RTE foods have been reported over the years (Clark et al., 2010; Health Canada, 2011). The most notable, however, was the 2008 nationwide outbreak associated with contaminated deli meats that originated from a single food processing facility, and resulted in 57 invasive listeriosis cases and 23 deaths (Weatherill, 2009). The originating source of contamination was suspected to be a large commercial slicer harboring L. monocytogenes (Weatherill, 2009). The facility’s environmental sampling records showed the intermittent presence of L. monocytogenes on two processing lines for almost a year prior to the outbreak. Similar scenarios have been reported in other listeriosis outbreaks where L. monocytogenes in the processing environment  53 led to contamination of RTE products (CDC, 2002; Mead et al., 2006; Olsen et al., 2005). It is well established that food product contamination is associated with food processing environments that harbor L. monocytogenes and thus are the source of subsequent post-processing transfer to finished products (Lappi et al., 2004; Lundén et al., 2002; Olsen et al., 2005; Tompkin, 2002). Numerous studies have focused on the prevalence of Listeria spp. in production environments and contamination patterns in these facilities (Barros et al., 2007; Chasseignaux et al., 2002; Chasseignaux et al., 2001; Eklund et al., 1995; Norton et al., 2001). Strains of L. monocytogenes capable of persisting in food processing environments for up to 12 years and intermittently contaminating products have been reported (Holah et al., 2004; Lundén et al., 2002; Olsen et al., 2005; Senczek et al., 2000). Retail facilities of RTE foods, however, have received less attention and consequently there are fewer data available that examine the prevalence of L. monocytogenes at retail.  Canadian data on the presence of L. monocytogenes in RTE foods have varied across studies (Bohaychuk et al., 2006; Dillon et al., 1994; Farber, 1991; Farber, 2000). As a result, contradicting messages have been conveyed regarding the safety of Canadian RTE foods. In 1991, Farber (1991) reported results of a limited sampling survey of wholesale and retail seafood products originating from Canada and other countries. Based on the low recovery of L. monocytogenes in shrimp and smoked salmon, they concluded the observed levels did not represent a serious health hazard. In 1994, however, a study examining Listeria spp. contamination of retail RTE fish in Newfoundland found 18.3% (11/60) of cod samples were contaminated with L. monocytogenes (Dillon et al., 1994). In contrast, a report on government seafood testing in 2000 revealed L. monocytogenes contamination in 0.3-0.88% of imported products and its absence in domestic products (Farber, 2000). Similarly, a low  54 prevalence of L. monocytogenes in raw and RTE meats from retail outlets in Alberta was reported (Bohaychuk et al., 2006).  Looking at other Canadian provinces, and particularly at B.C., there exist limited data on the occurrence of Listeria spp. in RTE products and the associated risks of listeriosis linked to consumption of contaminated RTE foods. In B.C., there are no provincial regulations or guidelines, which refer specifically to Listeria spp. and/or L. monocytogenes in the environment or in products from provincially licensed but not federally registered dairy, fish and meat processing facilities that produce RTE foods, or retail facilities. While food processing facilities are routinely inspected, environmental and food product testing for Listeria spp. or L. monocytogenes is not considered a requirement.  In dairy processing facilities regulated by the B.C. Milk Industry Act (Anonymous, 1981), microbial testing of RTE dairy products for indicator microorganisms and/or pathogens (including L. monocytogenes) is required on at least six occasions during each six month period. In contrast, in fish processing facilities regulated by the B.C. Fish Inspection Act (Chapter 148) (Anonymous, 1996) there is no specific requirement for foods or environmental samples to be tested, although an inspector may collect samples during investigations or inspections. In meat processing facilities regulated by the Meat Inspection Regulation of the B.C. Food Safety Act (Anonymous, 2004) (slaughterhouses that produce RTE foods under provincial inspection authority) and meat facilities regulated by the Food Premises Regulation of the B.C. Public Health Act (Anonymous, 1999) (e.g., deli, butcher and other processors that produce RTE meat under provincial inspection authority), there are currently no specific regulations or guidelines for control of Listeria spp. or  55 L. monocytogenes; however, according to the B.C. Food Safety Act (Chapter 28) (Anonymous, 2010), inspectors may collect and examine any samples they deem appropriate.  Regardless of the size, retail establishments that sell foods within B.C. are not required to test products or food handling areas for Listeria spp. However, these establishments are inspected at least once per year and their foods tested as part of the provincial Food Quality Check Sampling Program (BCCDC, 2010). This program is primarily educational, with bacteriological tests (e.g., indicator organisms) used as sanitation checks to inform inspectors and producers of the effectiveness of current food handling practices. These procedures, however, do not include testing for Listeria spp. or other foodborne pathogens. Foods produced within B.C. for retail outside of the province are inspected by the federally regulating Canadian Food Inspection Agency (CFIA), and are subject to more intensive microbiological monitoring programs, including testing for Listeria spp. (CFIA, 2011).   Generally, food testing for Listeria spp. that occurs at the food processing level provides little information about the microbial quality and safety of food at retail. This is a concern because L. monocytogenes populations can increase during shipping and prolonged storage, particularly if RTE foods are stored at temperatures above 4°C (Farber, 2000; Glass and Doyle, 1989). Additional handling of RTE foods at the retail level, with such activities as slicing, weighing, and packaging, may increase the potential for cross-contamination (Lin et al., 2006). The current Canadian policy on Listeria allows 100 CFU/g of L. monocytogenes in RTE foods, in which proliferation of the organism to levels above this before the end of the product shelf-life is not possible (Health Canada, 2011). However, extensive microbial challenge of retail products is required to determine listerial growth potential. Failure to  56 control the proliferation of L. monocytogenes using extrinsic and intrinsic mitigation strategies may result in situations where unacceptable levels of the organism exist in products, particularly towards the end of the shelf-life period.  Currently, there is a lack of data on the occurrence of Listeria spp. and L. monocytogenes in RTE foods at food processing and retail levels in B.C. Furthermore, there are inconsistent reports on consumer health risks associated with L. monocytogenes contamination of RTE foods in Canada. Considering that several large listeriosis outbreaks have occurred in Canada in the past, two of them linked to B.C. cheese manufacturers, investigating the presence of L. monocytogenes in the B.C. food chain seems prudent. Therefore, the objectives of the experiments performed in Chapter 2 were three-fold and included: (1) examination of the occurrence and distribution of Listeria spp. and L. monocytogenes in RTE foods and food processing environments of food processing facilities under provincial inspection authority in B.C.; (2) testing of RTE products from retail facilities for the presence of Listeria spp., and L. monocytogenes; and (3) investigation of the relatedness of recovered L. monocytogenes isolates using serotyping and genetic fingerprinting methods.   2.2 Materials and methods 2.2.1 Sample collection from food processing facilities (PF) The selection of PF was guided by three principles: the inclusion of representative facilities and RTE products from three major producer classes, namely dairy, fish and meat; coverage of the geographical territories of B.C.’s Regional Health Authorities; and practicability within a three month sampling period. Overall, 17 dairy, 13 fish, and 23 meat (5  57 slaughterhouses that also produce RTE products, and 18 smaller retail and butcher deli shops) facilities were visited between August and October 2009 (Figure 2-1)1. Overall 262 RTE food samples, and 305 food processing environment swabs (referred to as environmental samples) were collected.   Environmental swabs included 101 samples from non-food contact (NFC) surfaces (Table 2-1), 101 from close-to-food contact (CFC) surfaces, and 103 were obtained from food contact (FC) surfaces.   Figure 2-1. Geographic distribution of facilities producing ready-to-eat foods under provincial inspection authority (n=53) visited during the survey that assessed the prevalence of Listeria spp. in food facilities, by Health Authority regions in British Columbia.                                                 1 Re-printed with permission from the report prepared by Kovacevic, J. and Environmental Health Services Division (2010), available at: http://www.bccdc.ca/NR/rdonlyres/659E872B-A803-4F99-8C6A- 58 Table 2-1. List of surfaces sampled in food processing facilities.  Non-food contact  Close-to-food contact  Food contact Drain  Walls adjacent to food handling surfaces  Work-table Sides/Legs:  Sides/Legs:  Packaging counter Cart  Slicer  Food racks/shelves Conveyor  Packaging table  Slicer Vat Shrink wrapper Cutting board Table Work-table Food bin Refrigerator Vacuum packer Food display basket/bin/insert Doors Counter space Food mold Area under wash-sink Silent cutter Filler bowl Support beams Scale Inside of vat pipes Trolley wheels Cup/jug filler Cutting utensils Bottom shelves of packaging/ wrapping tables Show-case/display cooler door handle and interior  Trolley wheels    Swabs were collected during food processing, and at least three hours after the facility began operations in order to increase the likelihood of obtaining positive results for Listeria spp. Sterile pre-wetted sponge applicators (Qualicum Scientific Ltd., Nepean, ON) were used to swab 30 by 30 cm areas, five times vertically and five times horizontally. Sponges were then placed in sterile bags (Qualicum) and refrigerated for no more than 48 hours. Food samples (150 g) were collected either aseptically in sterile sample bags (Fisherbrand, Thermo Fisher Scientific, Ottawa, ON) or as pre-packaged consumer-ready products. Foods sampled had been produced on the day of the visit, or, in the case of foods normally aged prior to shipment (e.g., aged cheeses and meats), were collected at the end-stage of production ready for shipment to retailers. Samples recovered from dairy processing facilities included milk and fluid dairy products, hard and soft cheeses, yogurt and ice cream. Fish and seafood products primarily included cooked, heat dried or hot smoked salmon products with various flavors (e.g., teriyaki, honey garlic, Cajun, candied), as well as cold smoked and lox salmon  59 products, smoked sablefish, sardines and cooked prawns. Meat samples tested included varieties of beef and pork sausages, “smokies”, pepperoni, prosciuttino salami, meatloaf, hot dogs/wieners, beef and deer jerky, turkey, chicken, ham and beef deli meats, as well as buffalo and bison salami and sausages. While the objective was to examine primarily RTE samples, in a few instances a small number of raw meat samples were collected and tested (n=13).   2.2.2 Sample collection from retail facilities (RF) Ready-to-eat meat and fish products were purchased from seven large chain retail establishments and 10 smaller retailers in the Metro Vancouver area (B.C., Canada) in September and October 2010. Overall, 80 samples were collected: 40 deli meats and 40 RTE fish products. Meat samples included: beer sausage, bologna, cervelat and genoa salami, cheese loaf, chicken and turkey breast, cooked ham, corned beef, meat macaroni loaf, mortadella, variety pack sausages, and different types of pepperoni (e.g., beef, chicken, turkey). Fish samples consisted of different flavored, candied and/ or smoked fish jerky, nuggets, and pepperoni samples, as well as lox, sockeye sticks, smoked steelhead trout, and tuna. Samples (approximately 50 g) were purchased as sliced/weighed deli products or in manufacturer-sealed packaging. Samples were transported to the laboratory in coolers on the day of purchase, and tested prior to best before/expiry date.  2.2.3 Isolation of Listeria spp. and confirmation Samples were analyzed according to Health Canada’s MFLP-74 enumeration (Pagotto et al., 2002) and MFHPB-30 two-step enrichment (Pagotto et al., 2001) methods. Confirmation of  60 Listeria spp. was based on Gram stain, catalase and oxidase reactions, and motility at room temperature. Isolates were speciated by standard biotyping (Microgen Listeria ID, Microgen Bioproducts Ltd., Cam- berley, Surrey, U.K. and API Listeria, BioMerieux, Marcy l’Etoile, France). Where possible, up to three isolates were characterized and saved from each positive sample. Isolates were maintained in 20% peptone glycerol solution, at -80°C.   2.2.4 Serotyping and genetic fingerprinting Listeria monocytogenes isolates (n=111) were serotyped by slide agglutination and antisera prepared according to Seeliger and Höhne (1979) at the Canadian National Microbiology Laboratory. Genetic fingerprinting, based on pulsed-field gel electrophoresis (PFGE), was performed according to PulseNet standardized protocol at the BCCDC Public Health Microbiology and Reference Laboratory (PF isolates) or at the Canadian Listeriosis Reference Service Laboratory (Ottawa, ON) (RF isolates) using restriction enzymes AscI and ApaI. For PF isolates, PFGE patterns were assigned according to the Tenover et al. (1995) criteria. Briefly, identical letter and number combinations represent indistinguishable patterns; the same letter with a different number (e.g., A1, A2) indicates that some variability was observed but isolates are closely related (e.g., changes are consistent with a single genetic event that may lead to two to three band differences); and a different letter indicates that strains are likely not related (i.e. ≥ 7 band differences) (Tenover et al., 1995). For RF isolates patterns were assigned after comparison to the PulseNet Canada database.     61 2.2.5 Statistical analyses A two-tailed Fisher’s exact test was used to assess differences in the proportions of facilities with environment swabs or food samples that were shown to be positive for Listeria spp. (all Listeria species, including L. monocytogenes) and L. monocytogenes, analyzed separately, among the dairy, fish and meat categories, at a 5% level of significance. Inclusion criteria for statistical analyses required that facilities have at least one swab collected in each of NFC, CFC, and FC area sampled (i.e. 51 facilities: 17 dairy, 21 meat, and 13 fish), and at least four RTE samples (i.e. 43 facilities: 17 dairy, 14 meat, and 12 fish).    Contingency table analysis was used to assess the probability of finding Listeria (Listeria spp. and L. monocytogenes, analyzed separately) in foods at a facility given that Listeria were found in the environment at that facility. In contingency tables, each facility was counted in one of four categories: (A) Listeria found in food and Listeria found in environment; (B) Listeria found in food and not found in environment; (C) Listeria not found in food and found in environment; and (D) Listeria not found in food and not found in environment. The odds of finding Listeria in foods when it is present in the environment were calculated as A / C, and the odds of finding Listeria in food when it is not present in the environment were calculated as B / D. The ratio of these odds [(A x D) / (B x C)] indicated the strength of the association between Listeria present in the environment and in foods. All analyses were performed using R software (version 2.10.1; R Foundation for Statistical Computing, Vienna, Austria).      62 2.3 Results 2.3.1 Listeria spp. contamination in food processing facilities Of 51 facilities that met the criterion of at least one swab collected in each of the three sampling areas, Listeria spp.2 were recovered from the processing environments of 21 (41%), while Listeria monocytogenes was found in 11 (22%) facilities. The highest contamination was seen amongst fish processing facilities, followed by meat, and dairy (Figure 2-2A).    NFC surfaces were contaminated with Listeria spp. and L. monocytogenes in 21 (41%) and 10 (20%) facilities, respectively. Listeria spp. (in all cases also L. monocytogenes) were recovered from CFC surfaces in 4 (8%), while 5 (10%) and 2 (4%) facilities had Listeria spp. and L. monocytogenes, respectively, recovered from FC surfaces (Figure 2-2B).            Figure 2-2. The proportion of facilities meeting the criterion of at least one swab collected in each of the three sampling areas, having environmental swab samples positive for Listeria spp. and L. monocytogenes by facility type (A) and sampling area (B). NFC, non-food contact; CFC, close-to-food; FC, food contact surface.                                                  2 Unless specified, Listeria spp. positive sample represents a sample that was identified positive prior to biotyping, and may contain any Listeria species, including L. monocytogenes. All Listeria spp. L. monocytogenes  63 Considering the sub-environments of processing facilities, no significant differences were found in the proportions of dairy, fish, and meat facilities having swabs of drains and other NFC or CFC surfaces positive for Listeria spp. The same comparison for FC surfaces indicated a higher proportion of fish facilities with one or more sample positive for Listeria spp. compared to dairy (5/13 versus 0/17, p=0.009) and meat (5/13 versus 0/21, p=0.005) facilities. Similarly, L. monocytogenes was seen on FC surfaces only in fish facilities, though differences were not statistically significant.  Considering facility contamination based on the presence of Listeria spp. and L. monocytogenes in RTE foods, 43 facilities visited met the criterion of at least four RTE food samples collected in a facility. Of these, 8 (19%) and 5 (12%) had Listeria spp. and L. monocytogenes, respectively, recovered from RTE food samples. There was a higher proportion of fish facilities compared to dairy facilities where one or more food samples were positive for Listeria spp. (6/12 versus 0/17, p=0.002) and L. monocytogenes (5/12 and 0/17, p=0.007). Proportionally more fish than meat facilities had a food sample positive for Listeria spp. (6/12 versus 2/14, p>0.05) and L. monocytogenes (5/12 versus 0/14, p=0.012) (Figure 2-3).   When the overall contamination was examined (i.e. environmental and RTE food), of the 43 facilities that met the criteria of at least one swab collected in each of the three sampling areas (i.e. NFC, CFC, FC) and at least four RTE food samples collected, 11 (26%) had Listeria spp. recovered only from the processing environment, 7 (16%) had Listeria spp. recovered from both environment and RTE foods, and 1 (2%) had Listeria spp. isolated only from foods.  64 All Listeria spp. L. monocytogenes  Figure 2-3. The proportion of facilities meeting the criterion of at least four RTE foods collected having samples positive for Listeria spp. and L. monocytogenes.    Contingency table analysis revealed that facilities where one or more foods were contaminated with Listeria spp. were 15 times (7/18 versus 1/25, prevalence odds ratio 15.3; p=0.005) more likely to have had Listeria spp. in swabs collected from the processing environment than facilities with no Listeria spp. positive foods.    In addition, facilities where one or more foods were contaminated with L. monocytogenes were highly more likely to have Listeria spp. found in swabs from the processing environment than facilities with no L. monocytogenes positive foods (5/18 versus 0/25, prevalence odds ratio infinite, p=incalculable) (Table 2-2). Interestingly, L. monocytogenes was never found in foods when Listeria spp. were not detected somewhere in the processing environment (Figure 2-4).      65 Table 2-2. Contingency table for Listeria spp. found in at least one environmental swab sample versus L. monocytogenes found in at least one food sample, and Listeria spp. found in any food sample versus L. monocytogenes found in any food sample, by facility. Only those facilities that met both environmental swab and food inclusion criteria are included.   L. monocytogenes in food sample   Yes No Total Listeria spp. in environmental swab Yes 5 13 18 No 0 25 25  Total 5 38 43 PPVa 28%     NPVb 100%          Listeria spp. in food sample Yes 5 3 8 No 0 35 35  Total 5 38 43 PPV 63%     NPV 100%     aPositive predictive value: true positive samples divided by the sum of true positive and false positive samples, expressed as %. bNegative predictive value: true negative samples divided by the sum of false negative and true negative samples, expressed as %.    Considering the joint presence of L. monocytogenes in foods and Listeria spp. in swabs of the processing environment, NFC surfaces were contaminated with Listeria spp. in facilities of all three food categories, but FC surfaces were contaminated only in RTE fish facilities (Figure 2-4). Interestingly, Listeria monocytogenes was found only in RTE fish products. In all facilities where food products were contaminated with L. monocytogenes, Listeria spp. were present in the processing environment (Figure 2-4).  2.3.2 Recovery of Listeria spp. from environmental samples Listeria spp. were recovered from 13% (40/305) of all environmental samples, while 7% (21/305) harbored L. monocytogenes. The highest rates of contamination with Listeria spp., and L. monocytogenes were seen in swabs of NFC surfaces, at 30% (30/101) and 13% (13/101), respectively. The proportion of CFC and FC surfaces positive for Listeria spp. was  66 lower, at 5% (5/101) and 6% (6/103), respectively. Listeria monocytogenes was recovered from 4 and 3% of CFC and FC surfaces, respectively.   L. monocytogenesFood Food Contact Close-to-Food Contact Non-Food ContactAt least one Listeria (non L. monocytogenes) environmental swab positivePositive food or swab for L. monocytogenesNo positive food or swab samples in the facility Listeria spp. and L. monocytogenesDairy               RTE      (n=17)Fish                 RTE           (n=12)Meat                RTE              (n=14) Figure 2-4. The joint presence of L. monocytogenes in food and other Listeria spp. in the processing environment, for facilities that met the criterion of at least one swab from each of the three sub-environments and no less than four RTE food products collected. Each row represents a facility.  67  Based on the type of facility, highest contamination of both Listeria spp. and L. monocytogenes occurred in environmental samples from fish facilities, with 23 (29%) and 13 (17%) samples positive, respectively. In dairy facilities, of the 102 environmental samples collected, 9% were positive for Listeria spp., while only 3% harbored L. monocytogenes. Similarly, 7% of 125 environmental samples collected from meat facilities tested positive for Listeria spp., with only 2% culturing L. monocytogenes.  2.3.3 Recovery of Listeria spp. from retail food samples From 80 RTE food samples analyzed, eight (10%) were positive for Listeria spp., with all containing less than 100 CFU/g. Positive samples came from four RF; three small and one large facility. Listeria welshimeri was the most commonly isolated species (4/8), followed by Listeria innocua (2/8) and L. monocytogenes (2/8). Listerial contamination, seen exclusively in RTE fish samples, included smoked and candied salmon and salmon jerky.  2.3.4 L. monocytogenes contamination of RTE foods In RTE foods L. monocytogenes was found exclusively in fish products (Table 2-3). It was recovered from 14 food samples from PF, including 13 hot smoked, heat dried or cooked fish products, and one cold smoked salmon product, and in two fish samples from RF. Further, L. monocytogenes was recovered from four of the contaminated products that had Listeria spp. counts greater than 100 CFU/g; three of which were grossly contaminated with more than 30,000 CFU/g (Table 2-3).     68 Table 2-3. List of foods contaminated with L. monocytogenes.  Food product  Listeria spp. (CFU/g) Species isolated Food processing facilities    Fish Salmon nuggets  < 100 L. monocytogenes  Sockeye salmon candy  < 100 L. monocytogenes  Salmon leather  < 100 L. innocua, L. welshimeri, L. monocytogenes  Salmon leather  < 100 L. welshimeri, L. innocua  Salmon leather  < 100 L. innocua  Cold smoked salmon  < 100 L. monocytogenes  Salmon candy   < 100 L. monocytogenes  Salmon candy  < 100 L. monocytogenes  Teriyaki smoked sablefish  < 100 L. monocytogenes  Spring-wood smoked salmon  < 100 L. monocytogenes  Indian candy salmon  300 L. monocytogenes, L. innocua  Lox whole salmon  < 100 L. innocua  Lox sliced salmon Coho  400 L. innocua  Prawns  < 100 L. innocua  Indian candied salmon  100 L. innocua  Salmon jerky  < 100 L. monocytogenes  Cajun salmon  > 30,000 L. monocytogenes  Shrimp meat  < 100 L. monocytogenes  Teriyaki salmon  > 30,000 L. monocytogenes  Honey garlic salmon  > 30,000 L. monocytogenes Meat Cheese smokie  < 100 L. welshimeri  Hot pepperoni  < 100 L. welshimeri  Prosciuttino salami  < 100 L. innocua Retail facilities    Fish Smoked salmon  < 100 L. monocytogenes  Wild smoked salmon fingers  < 100 L. monocytogenes  Smoked salmon  < 100 L. welshimeri  Wild smoked lox trim  < 100 L. welshimeri  Smoked salmon nuggets  < 100 L. innocua  Smoked salmon jerky  < 100 L. welshimeri  Salmon candy  < 100 L. innocua  Salmon strips  < 100 L. innocua  69 RF samples positive for L. monocytogenes, had less than 100 CFU/g, and were purchased from different RFs. They also originated from different PF; one PF was federally registered and inspected by the CFIA, while the other facility was under provincial inspection authority.   2.3.5 Species distribution among PF and RF, and food categories Up to three isolates were saved from each positive sample, for a total of 253 Listeria isolates recovered from 86 samples: 32 RTE foods, 13 raw foods, and 41 swabs of PF environments. The majority of the isolates were recovered from swabs of food processing environments (n=123). Of the 119 isolates originating from foods, the majority (n=111) originated from PF, and eight were recovered from retail food samples (Table 2-4).    Table 2-4. The number of isolatesa recovered from different types of facilities (food processing, PF, or retail facilities, RF), and different food categories (dairy, fish and meat). Source Dairy  Fish  Meatb Total PF PF RF PF RF Food       L. innocua 0 21 5 9b 0 35 L. monocytogenes 0 39 6 10b 0 55 L. seeligeri 0 0 0 0 0 0 L. welshimeri 0 3 8 29b 0 40 Total 0 63 19 48 0 130        Environment       L. innocua 9 4 - 9 - 22 L. monocytogenes 13 34 - 9 - 56 L. seeligeri 5 28 - 0 - 33 L. welshimeri 0 3 - 9 - 12 Total 27 69 - 27 - 123 aThe number of isolates and positive samples do not add up, as up to three isolates were recovered and archived from a positive sample.  bIsolates from raw meat samples: six L. innocua, 10 L. monocytogenes, and 23 L. welshimeri.   70 Listeria monocytogenes was the most often recovered species (n=111), followed by L. innocua (n=57), L. welshimeri (n=52), and L. seeligeri (n=33). Most of the isolates came from fish processing and retail samples (Table 2-4).   2.3.6 Serotype and PFGE pattern distribution among L. monocytogenes isolates Majority of isolates belonged to listeriosis causing serotypes, including 1/2a (42%) and 4b (37%) serotypes (Table 2-5). Less commonly recovered serotypes included 1/2c (12%), 1/2b (5%), and 3a (4%) (Table 2-5).   When subjected to PFGE, 36 pulsotypes were observed among the various isolates recovered from PF (Figure 2-5; more detail given in Figure A-1 in Appendix A), and two pulsotypes among the retail isolates. Based on the PFGE data, in most instances the three isolates recovered from the same sample were clonal.  PFGE typing of isolates from PF found L. monocytogenes from fish facilities to be the most diverse, with 21 pulsotypes observed (Table 2-6). These isolates were genetically unrelated to isolates from dairy facilities [i.e. ≥ 7 band differences, resulting from changes consistent with three or more independent genetic events (Tenover et al., 1995)].  Table 2-5. Serotypes of L. monocytogenes isolates recovered in food processing environments, and raw (RUF) or ready-to-eat (RTE) foods. Source   No. of L. monocytogenes serotypes Total no. isolates 1/2a 1/2b 1/2c 3a 4b Food processing environment 56 26  3 8 4 15 Fooda       RUF  10 8  0 2 0 0 RTE  45 13  3 3 0 26 Total No. (%) 111 47 (42) 6 (5) 13 (12) 4 (4) 41 (37) aRUF, raw unprocessed food; RTE, ready-to-eat food products.  71 Table 2-6. Distribution of L. monocytogenes (n=111) sero- and pulsotypes, across different facilities (n=15). Facility ID  Type Number of isolates recovered Isolate sourcea Serotypes Pulsotypes  (PFGE)b FPE RUF RTE Food processing facilities d5 Dairy 9 9 - - 1/2a F1, G2 d7 Dairy 1 1 - - 1/2a N1 d11 Dairy 3 3 - - 1/2a G1 f19 Fish 15 12 - 3 1/2c, 3a H1, H4, K2, K3, K4, K5 f20 Fish 21 9 - 12 1/2a, 4b  A1, L1, M1 f21 Fish 10 6 - 4 1/2a, 4b A2, K1, K2, K4, K6, K8, K9 f28 Fish 11 6 - 5 1/2a, 4b B1, H3 f31 Fish 16 1 - 15 1/2a, 4b B1, C1, C2, E1, I1, I2 m38 Meat 3 - 3 - 1/2a, 1/2c H2, J1 m44 Meat 3 - 3 - 1/2a H6 m46 Meat 3 3 - - 1/2a G3, G4 m49 Meat 6 6 - - 1/2a, 1/2b D1, D2, F2, K10 m50 Meat 4 - 4 - 1/2a, 1/2c H5, K7  Total 105      Retail facilities rf7 Fish 3 - - 3 1/2a LMACI.0001 LMAAI.0001 rf11 Fish 3 - - 3 1/2b LMACI.0470 LMAAI.0584  Total 6      aFPE, food processing environment; RUF, raw, unprocessed food; RTE, ready-to-eat food. bPulsotype designation is based on ApaI and AscI enzymes and Tenover et al. (1995) composite designation in the isolate population originating from food processing facilities, where an identical letter/number indicates indistinguishable pattern; same letter and different number indicate closely related isolates and different letters represent unrelated isolates.  Isolates belonging to 1/2a serotype dominated in food processing environments, while serotype 4b was most commonly recovered from RTE foods (Table 2-5). Serotype 3a was  72 seen exclusively amongst isolates from food processing environments, and was present only in one fish facility (f19).  Indistinguishable patterns (K2 and K4) were seen in two fish facilities (f19 and f21) located in the Lower Mainland (Vancouver). Closely related patterns (i.e. 2-3 band differences) were seen in facilities 28 and 31, both located on Vancouver Island, facilities f20 and f21, located in Vancouver, and geographically distant facilities f19 and f28. Closely related patterns (H1 to H4) were also seen amongst fish (f19 and f28) and meat (m38, m44, and m50) facilities, geographically distant from each other. While isolates from dairy facilities were unrelated to those originating from fish facilities, patterns (G1 and G2) found in two dairy facilities (d11 and d5, respectively) were closely related to those seen in a meat facility (m46, patterns G3 and G4) (Figure 2-5).  For retail isolates, PFGE patterns were dissimilar among L. monocytogenes from different samples (LR39, LMACI.0001/ LMAAI.0001, and LR59, LMACI.0470/ LMAAI.0584), but were identical for all L. monocytogenes recovered from respective positive samples.  2.4 Discussion The ubiquitous nature of Listeria has been demonstrated in numerous studies. Listeria species, and in particular L. monocytogenes, have been found in food products and retail and processing environments of fish (Eklund et al., 1995; Food Standards Agency, 2008; Johansson et al., 1999), dairy (Farber et al., 1987; Fox et al., 2009) and meat facilities (Cabedo et al., 2008; Chao et al., 2006; Farber and Daley, 1994). Considerable variability has    73   Figure 2-5. PFGE dendrogram of L. monocytogenes isolates recovered from food processing facilities based on AscI and ApaI patterns; different letters represent unrelated isolates. Sample designations: DE, dairy environment; FF, fish food; FE, fish environment; MF and OF, meat food; ME and OE, meat environment. Dendrogram represents a continuous tree but is split onto two pages for visual clarity; the splitting point is indicated with \\ lines.   74  Figure 2-5. Continued. 75 been noted in the levels of contamination of food and food processing, and retail facilities with Listeria from region to region (Ryser, 2007a; Ryser, 2007b; Ryser, 2007c). The current study demonstrates such variation in the occurrence of Listeria spp. and L. monocytogenes in dairy, fish and meat RTE products from food processing and retail facilities in B.C.  Listeria spp., including L. monocytogenes, were recovered from RTE foods, specifically, smoked fish samples, while the pathogenic species were absent from RTE dairy and meat products. Contamination levels of fish in food processing facilities (28%) were similar to levels of Listeria spp. in retail fish samples (20%). While 20% of fish samples from PF harbored L. monocytogenes, in RF fish samples 5% of isolates were identified as L. monocytogenes. These data show that among different RTE food processing facilities under B.C. provincial inspection authority, the majority of fish processors harbor Listeria spp. Listeria monocytogenes was not recovered from RTE dairy or meat products, and was found at low levels and only on surfaces not in direct food contact in these facilities. In contrast, B.C. fish processing facilities were commonly contaminated with Listeria spp., and in two of the 13 fish processing facilities visited, L. monocytogenes was recovered from FC surfaces. Listeria monocytogenes was also recovered from food products in five fish facilities, in some cases at high levels. Surfaces not in direct contact with RTE foods, such as drains, floors, and legs of tables and carts, were where the highest prevalence of Listeria spp. contamination was found. However, in three of the fish facilities all three types of surfaces (FC, CFC and NFC), and RTE food products, were contaminated with Listeria spp. Interestingly, in two facilities where L. monocytogenes was found in RTE foods the bacteria were recovered only from NFC surfaces. NFC surfaces positive for L. monocytogenes have  76 been reported previously as potential contamination sources and a sensitive predictor for the presence of L. monocytogenes in smoked salmon (Rørvik et al., 1997; Thimothe et al., 2004).   In a study of L. monocytogenes contamination patterns in four smoked fish processing facilities, Thimothe et al. (2004) observed a strong positive relationship (p<0.0001) between L. monocytogenes prevalence in environmental and finished product samples. They also reported a very highly statistically positive relationship between Listeria spp. prevalence in the environment and L. monocytogenes prevalence in the environment, as well as in finished products. While investigating risk factors associated with L. monocytogenes contamination of smoked salmon during processing, Rørvik et al. (1997) reported that the risk of contamination in smoked salmon was positively associated with the presence of L. monocytogenes in drains (relative risk of 3.3). In the current study PFGE data confirmed the presence of genetically indistinguishable strains in drains and other NFC surfaces, and RTE foods (e.g., A1 in facility f20, B1 in facility f28, and H1 in facility f19) (Figure 2-5). These findings confirm that cross-contamination between processing environment and finished product is a likely occurrence in fish processing facilities.   Although Listeria spp. and L. monocytogenes contamination appears to be common in cold and hot smoked fish samples (Dominguez et al., 2001; Hartemink and Georgsson, 1991), the prevalence rate for this organism in RTE fish products from PF reported in the current study was notably higher than the rates described in previous Canadian studies (Farber, 1991; Farber, 2000), and those reported by the European Food Safety Authority (EFSA, 2010). The rates reported in B.C. samples are, however, similar to findings reported by Van Coillie et al. (2004) for Belgian samples, and those observed by Dominguez et al. (Dominguez et al., 2001) for smoked fish and fish pâté samples in Spain.  77  Farber (2000), reported the absence of L. monocytogenes in 196 and 150 Canadian RTE seafood products tested in 1997/1998 and 1998/1999, respectively. This sampling was performed as part of the Canadian Food Inspection Agency’s Quality Management Program. However, limited information was provided regarding the origin of the products and characteristics of facilities from which samples were collected (Farber, 2000). In addition, only a direct plating method was used to test for L. monocytogenes, as opposed to both the direct plating and enrichment methods applied in the current study. The use of a direct plating method may decrease the chance of bacterial detection if microorganisms are sub-lethally injured or present in low numbers.    A Canadian study, also conducted by Farber (1991), examined 113 RTE seafood products from the wholesale level for the presence of L. monocytogenes. Among the 113 samples tested, only 20 salmon products originated from Canada. Overall, 13% (15/113) of the tested products contained L. monocytogenes, which is lower than the 20% (14/71) reported in this thesis. Of the 20 salmon products produced in Canada, 5 (25%) were positive for L. monocytogenes (Farber, 1991). A summary of trends and sources of foodborne outbreaks in Europe reported an overall prevalence of 9.8% for L. monocytogenes in 7,126 RTE fish products, derived from both retail and food processing facilities in 12 European countries (EFSA, 2010). Individual studies from coastal European countries reported varying levels of listerial contamination in retail fish samples (Cabedo et al., 2008; Garrido et al., 2009; Gianfranceschi et al., 2003; Van Coillie et al., 2004). A 2009 study conducted in Spain found Listeria spp. in 18.6 % of smoked salmon samples from retail, with 10 % harboring L. monocytogenes (Garrido et al., 2009). A Spanish study in 2008 (Cabedo et al., 2008) recovered L. monocytogenes from 7.9 % of smoked salmon samples, which is comparable to  78 levels observed at retail in the current study. In Italy (Gianfranceschi et al., 2003) and Belgium (Van Coillie et al., 2004) much higher levels of L. monocytogenes were reported in fish and fish products (27.9 %) and smoked halibut (33.3 %), respectively. However, it is important to note that in many instances direct comparison of results is not possible, as studies were structured differently, and testing procedures often varied from country to country. For instance, the study described here provides contamination levels obtained during a one-time sampling interval, and a small number of retail samples. In contrast, the data described in other studies involved a large number of samples (e.g., EFSA report), and in some cases a longitudinal approach, thus limiting the extent of comparison among studies.  Even though Listeria spp. and L. monocytogenes are common in fish products, listeriosis outbreaks linked to these foods are rare (Farber, 2000; Jinneman et al., 2007). It has been suggested that since cooked fish products generally contain low levels of L. monocytogenes and have a short shelf life, they therefore do not likely represent a serious health hazard (Farber, 2000; Rørvik, 2000). Also, while in some cases high levels of contamination of fish and fish products with L. monocytogenes have been reported, the population health risk is rated low when the low degree of consumption of RTE fish per capita is taken into account (Dominguez et al., 2001).    In this study, fish products were the only RTE foods positive for L. monocytogenes. These microorganisms were not detected in the tested RTE foods produced in dairy or meat facilities. In one particular fish processing facility, three RTE samples contained high levels of L. monocytogenes. Even though a low health risk from RTE fish contaminated with L. monocytogenes has been suggested elsewhere (Dominguez et al., 2001; Farber, 1991), the infective dose for acquiring listeriosis infection is thought to be host and dose dependent  79 (FAO and WHO, 2004; Iwamoto et al., 2008). While a dose of 100 organisms conveys a probability risk for infection ranging from 10─9 to 10─13, a dose of 1,000,000 organisms increases the risk of infection to 10─6 to 10─9 (Iwamoto et al., 2008). Furthermore, persons in vulnerable groups, such as cancer and transplant patients, are 1,000 times more susceptible to the invasive listeriosis compared to healthy persons (FAO and WHO, 2004). Similarly, pregnant women and their newborns have been estimated to be 14 times more likely to acquire invasive listerial infections compared to a normal healthy population (FAO and WHO, 2004). The contaminated products in B.C. were destined for sale to a wide population, potentially including pregnant women and immunocompromised individuals. In addition, findings that the majority of the recovered isolates belonged to listeriosis causing serotypes, 1/2a and 4b, and that some samples were grossly contaminated, are of concern. Hence, a closer look into the production of RTE fish products in B.C. is warranted.    While the complete eradication of L. monocytogenes from food processing facilities is regarded as unrealistic, a correlation between the level of hygiene practiced in a facility and the prevalence of L. monocytogenes has been demonstrated in many studies (Fox et al., 2009; Kabuki et al., 2004; Klausner and Donnelly, 1991; Kozak et al., 1996). To achieve the reduction in L. monocytogenes levels, both stringent and continuous control strategies are required (Tompkin, 2002). Sampling of food processing environments has been suggested as a good tool to assess the level of Listeria control within a facility (Tompkin, 2002). In the 2008 Canada-wide deli meat listeriosis outbreak, longitudinal testing of environmental swabs revealed ongoing contamination of meat processing lines with Listeria spp. prior to the onset of the outbreak. A post-mortem of the outbreak highlighted the importance of following trends in microbial analyses of environmental samples as an early indicator of the potential  80 for contamination of RTE products (Weatherill, 2009). In Canada, federally registered food processing facilities are subject to environmental and end-product testing for Listeria spp. and/or L. monocytogenes; however, this level of inspection is not required nor practiced in most non-federally registered food processing facilities. Findings from the current study suggest that a combination of monitoring and validation of food safety practices, whether through periodic environmental sampling, end-product testing, more rigorous inspection, or a combination of these, is warranted in RTE food processing facilities in B.C. This is especially true for RTE fish processing facilities in B.C., where health inspectors noted that the presence of L. monocytogenes in RTE food samples was often coupled with inadequate sanitation and/or the lack of rigorous food hygiene practices in a facility. However, the absence of Listeria spp. in the great majority of B.C.’s dairy and meat facilities, some of which have previously been implicated in listeriosis outbreaks, suggests these bacteria can be kept at low levels in RTE facilities.  2.5 Conclusions  In summary, the results obtained from this study suggest that while control of L. monocytogenes in B.C.-inspected dairy and meat facilities is effective in limiting food contamination, there is a need for processors and inspectors to initiate improved monitoring and management of contamination by L. monocytogenes in RTE fish processing and retail sectors. Furthermore, considering that the majority of recovered isolates were found to belong to listeriosis causing serotypes, characterization of the genetic and phenotypic properties of the isolates is required in order to assess the risk posed to consumers from the consumption of the foods contaminated with L. monocytogenes.   81 Chapter  3: Assessment of the population structure, virulence potential, mutability and cold adaptation of food chain-derived Listeria monocytogenes isolates  3.1 Introduction Listeria monocytogenes is an environmentally ubiquitous organism that frequently contaminates food processing environments. It is estimated that 99% of listeriosis cases are transmitted through the consumption of contaminated food (Mead et al., 1999; Scallan et al., 2011; Swaminathan and Gerner-Smidt, 2007). In healthy individuals, L. monocytogenes infections are rare, restricted to the gastrointestinal environment, self-limiting, and manifest as gastroenteritis and/or mild flu-like symptoms. In contrast, in susceptible populations (e.g., neonates, the elderly, and immunocompromised), infections become invasive, leading to encephalitis, meningitis, septicemia, and/or spontaneous abortions during the last trimester of pregnancy (McLauchlin et al., 2004). Mortality rates for invasive listeriosis typically range between 20 to 40% (Farber and Peterkin, 1991; Hof et al., 1997; Weatherill, 2009).  Although there are 13 L. monocytogenes serotypes in total, the majority of human disease is caused by 1/2a, 1/2b, and 4b serotypes (Chenal-Francisque et al., 2011; Graves et al., 2007). Historically, lineage I 4b strains have been over-represented in clinical listeriosis cases and are less frequently recovered from foods (Chenal-Francisque et al., 2011; Gray et al., 2004; Jeffers et al., 2001). In contrast, lineage II 1/2a strains have been over-represented in food and environmental samples (Chen et al., 2009; Gray et al., 2004; Swaminathan and Gerner-Smidt, 2007). It has been suggested that positive selection resulted in the adaptation of lineage II strains to a broad range of environmental and stress conditions, whereas lineage  82 I strains that originated from an already pathogenic ancestor likely further adapted to a narrow range of conditions specific to host colonization (Orsi et al., 2011). Interestingly, over the past decade, lineage II 1/2a strains have been increasingly linked to human disease, causing notable listeriosis outbreaks in Switzerland (Bille et al., 2006), the United Kingdom, and two separate 2008 outbreaks in Canada (Gaulin et al., 2012; Weatherill, 2009). With regards to the latter, 1/2a strains comprise the majority of Canadian clinical isolates, followed by 4b (Clark et al., 2010). Reasons for the prevalence of 1/2a strains in human disease in Canada may be linked to a recently identified clonal complex/epidemic 1/2a clone that was identified as a recurring cause of sporadic listeriosis since 1988 (Knabel et al., 2012). Within this complex, the majority of 1/2a strains were found to possess the LGI1 genomic island, which was first identified in an outbreak strain linked to 23 deaths (Gilmour et al., 2010).  Over the past decade, sequence analysis of inlA, which encodes a membrane-bound protein facilitating invasion into non-professional phagocytes, revealed that a significant proportion (45%) of strains recovered from RTE food possess mutations resulting in premature stop codons (PMSCs) in inlA (Nightingale et al., 2008; Van Stelten et al., 2010; Ward et al., 2010). Strains with inlA PMSCs produce either a truncated or secreted InlA (i.e. absence of cell wall anchor), resulting in virulence attenuated phenotypes, as measured both by in vitro cell assays (Felicio et al., 2007; Handa-Miya et al., 2007; Jonquieres et al., 1998; Nightingale et al., 2005; Rousseaux et al., 2004) and in vivo mammalian models (Nightingale et al., 2008; Roldgaard et al., 2009; Van Stelten et al., 2011). As a result, it has been speculated that inactivation of InlA in some way increases strain fitness in environments outside of mammalian hosts, with the exception of 4b serotype (Orsi et al., 2011). While the absence of inlA PMSCs in 4b strains may reflect their over-representation in clinical  83 listeriosis, the contrary is postulated for 1/2a strains. Being frequently recovered in food and food production environments, positive selection for strains with inlA PMSCs may serve as a phase switch that is important for environmental survival of the organism (Orsi et al., 2011). In-line with this, it has been suggested that lineage II 1/2a strains are better able to survive conditions associated with the food chain. Notably, 1/2a and 1/2c (lineage II) strains more frequently possess inlA PMSCs than 1/2b or 3b serotypes, and presently, no inlA PMSC mutations have been reported for 4b strains (Orsi et al., 2011). In general, serotype 4b appears more recalcitrant to genetic flux, being less likely to acquire, or possess plasmids, and to experience homologous recombination events that may afford rapid adaptation to niche-specific stresses (Orsi et al., 2011).  Considering that the majority of strains recovered from the B.C. food chain belonged specifically to serotypes 1/2a and 4b, it seemed prudent to examine genetic properties and the population structure of the isolates. Since inlA mutations have been linked to food chain isolates, and InlA protein is a causally linked virulence determinant, the nature and prevalence of inlA genotypes in L. monocytogenes serotypes recovered from food and food production environments in B.C. were also investigated. Furthermore, since these strains are of food origin it was of interest to examine how L. monocytogenes strains with differing inlA genotypes respond to food chain-relevant conditions. In particular, the reliance on refrigeration to maintain the quality of fresh and RTE foods makes cold temperature a suitable and relevant parameter to examine for characterizing L. monocytogenes response to those conditions. Lastly, whether 1/2a serotypes are more prone to mutations compared to 4b and other serotypes the capacity of these strains to acquire adaptive mutations was also measured.   84 3.2 Materials and methods 3.2.1 Bacterial isolates Listeria monocytogenes used in the experiments were recovered from food processing environment (FPE) swabs (n=29), raw unprocessed food (RUF; n=6), and ready-to-eat (RTE) foods (nprocessing=19, and nretail=2) that were collected from three dairy, five fish, and five meat processing facilities (PF), and two retail facilities (RF) located in B.C. (described in detail in Chapter 2). Using origin of isolation (see Table B-1, Appendix B), serotyping (Figure 2-4, Chapter 2) and PFGE data (Figure 2-5; Chapter 2), a total of 56 different isolates were selected for inclusion in this study. Isolate origins and serotype data for the 56 isolates used in experiments are described in Table 3-1. Listeria monocytogenes cultures were maintained in peptone with 20% glycerol at -80°C. Prior to conducting the experiments, isolates were grown overnight on tryptic soy agar (TSA; Difco, Becton Dickinson Diagnostics, Mississauga, ON, Canada) at 37°C.  3.2.2 Internalin A sequencing Conventional polymerase chain reactions (PCR) were used to amplify the 2.4 kb inlA gene. Briefly, 5 U of AmpliTaq Gold 360 DNA polymerase (Invitrogen, Burlington, ON) was used with one set of custom primers (inlA-JK-F 5’-TAC AAC GAA ACC TGA TAT TG-3’ and inlA-JK-R 5’-GCT AGA TAT AGT CCG AAA AC-3’), each at 0.5 mM, 200 mM dNTPs (Invitrogen), and 50-100 ng DNA template (50-100 ng) obtained using a DNeasy Blood and Tissue kit (Qiagen, Toronto, ON). Thermocycling was performed as follows: initial denaturation was set at 94°C for 2 min; 20 cycles of 94°C for 1 min, 60-50°C for 1 min with touchdown decrease of 0.5°C per cycle, and 72°C for 2.5 min; 20 cycles of 94°C for 1 min,  85 50°C for 1 min, and 72°C for 2.5 min; and a final extension step at 72°C for 7 min (Van Stelten et al., 2010). PCR product was purified using a QIAquick PCR Purification kit (Qiagen) and sequenced at Canada’s Michael Smith Genome Science Centre using the inlA-JK primer set and previously published primers (Van Stelten et al., 2010). Nucleotide sequences were assembled and analyzed with Geneious 5.4 software (Biomatters Ltd., Auckland, New Zealand). The presence of PMSCs was determined by comparing inlA sequence data to L. monocytogenes EGD-e (Glaser et al., 2001).  3.2.3 Multilocus sequence typing Serotype and PFGE data were used to select a subset of isolates (n=56), representing each positive food or environmental sample for MLST analysis (Table B-1). For example, when more than one isolate originated from the same sample, and serotype and PFGE patterns were identical, only one isolate was used in the MLST analysis. MLST was performed using seven housekeeping genes as previously described by Ragon et al. (2008). Briefly, conventional polymerase chain reaction (PCR) was used to amplify the genes. DNA was isolated from overnight cultures grown on TSA (Difco). A single colony was resuspended in 100 µl of 1 x Tris-EDTA buffer, heated at 90°C for 10 min, cooled on ice for 2 min, and spun at 16,000 x g for 5 min. PCR reactions (50 µl) using 1 U of Platinum® Taq DNA polymerase (Invitrogen, Burlington, ON), 0.2 µM of each primer, 2 mM dNTPs (Roche, Mississauga, ON), and template DNA (1 µl) were cycled as follows: 94°C for 5 min; 35 cycles of 94°C for 30 s, 58°C for 30 s and 68°C for 2 min; followed by 68°C for 7 min (BioRad C1000 Thermal Cycler). All amplicons were purified (Amicon Ultra-0.5 ml Centrifugal Filter Devices) and sequenced at the Canadian National Microbiology Laboratory on both strands with an  86 ABI3730 machine (Applied Biosystems), and sequencing primers -20M13 (5’-GTAAAACGACGGCCAGT-3’) and -29M13-Rev (5’-CAGGAAACAGCTA TGACC-3’). Sequences were assembled using BioNumerics (v.6.5, Applied Maths, St. Martens-Latem, Belgium) and subsequently uploaded to the L. monocytogenes MLST database (http://www.pasteur.fr/mlst) maintained by the Institut Pasteur. MLST profile or sequence type (ST) was assigned to each isolate after comparison to the online database. For any novel allele/ST, data were forwarded to the Institut Pasteur for designation of allele and ST numbers. Grouping of STs into clonal complexes (CC) was based on the scheme set by the Institut Pasteur, where STs belonging to the same CC do not have more than one allelic mismatch (Ragon et al., 2008).  Allelic profile-based comparison was performed using a minimum spanning tree (MST) analysis (BioNumerics). This analysis links ST profiles so that the sum of distances (i.e. number of distinct alleles between two STs) is minimized (Ragon et al., 2008). In the MST, each circle represents an ST with a unique number, thus indicating distinct allele combinations of the seven housekeeping genes, while different circle sizes are proportional to the number of tested isolates within an ST profile (Ragon et al., 2008).   3.2.4 Invasion of Caco-2 cells The invasion efficiency of seven representative L. monocytogenes isolates from different serotypes, food and environmental samples, and inlA genotypes were assessed in 24-well tissue culture plates according to Gaillard et al. (1996), with minor modifications. Briefly, Caco-2 cells (~2 x105 cells per well; passages 5 to 20) were cultured in Dulbecco’s modified Eagle’s minimum essential medium (DMEM; HyClone®, Thermo Scientific, Toronto, ON),  87 supplemented with 10% inactivated fetal calf serum (GIBCO, Life Technologies, Burlington, ON), 1% non-essential amino acids (GIBCO), and 1% GlutaMAX (GIBCO) for two days (5% CO2, at 37°C) to reach confluency. Listeria monocytogenes cultures grown statically overnight in brain heart infusion (BHI; Oxoid, Ottawa, ON) broth at 30°C were pelleted by centrifugation (5,939 x g at 22°C; Eppendorf 5415 R), washed once with 1x Dulbecco’s phosphate buffered saline (DPBS; HyClone®) with magnesium and calcium, re-hydrated in DPBS, and adjusted to OD600nm = 0.5 (Genesys 10UV, Thermo Spectronic, Rochester, NY). Prior to infection, L. monocytogenes cultures were diluted in DMEM to approximately 4 x 107 colony forming units (CFU) per ml, as assessed by growth on TSA. Bacterial suspensions (0.5 ml) were added to Caco-2 cells and incubated at 37°C for 1 h to allow bacterial entry. Cells were washed three times, overlaid with fresh DMEM containing gentamicin (10 mg/l), and incubated at 37°C for 2 h. Following incubation, the cell monolayer was washed three times with DPBS and treated with 1% Triton X-100 for 10 min at 37°C. The number of viable bacteria released was quantified by spread plate method on TSA. Listeria monocytogenes EGD-SmR and BUG5 (Tn1545-induced inlA mutant from EGD-SmR) (Gaillard et al., 1991), and 08-5578 (Gilmour et al., 2010), kindly provided by Dr. Pascale Cossart (Institut Pasteur) and Dr. Matthew Gilmour (Public Health Agency of Canada), respectively, were used as controls. The gentamicin concentration used (10 mg/l) was confirmed to kill all extracellular bacteria by spreading post-wash medium onto TSA. Invasion assays for each isolate were carried out in triplicate and repeated twice.     88 3.2.5 Mutation frequency Since differences in the occurrence of PMSCs in inlA exist amongst different serotypes, frequency of isolates (n=56) acquiring mutations following exposure to rifampicin (RIF) was measured. Previously published methodology described for Enterobacteriaceae, with some modifications was applied (Allen and Poppe, 2002; LeClerc et al., 1996). Briefly, isolates were grown overnight at 35°C in BHI broth and adjusted to an OD600nm = 1.0. A 100 µl aliquot was spread onto BHI agar with 100 µg/ml RIF. Following incubation for 48 h at 35°C, the number of CFU was counted. The assay for each isolate was carried out in triplicate and repeated two times. The mean number of colonies for all strains was determined, and comparisons made between strains with and without PMSCs in inlA and across serotypes.  3.2.6 Cold growth evaluation A subset of isolates (n=33) representing L. monocytogenes with full-length inlA, 3-codon deletion (a.a. 738-740), and each type of PMSC observed in our collection was assessed for cold growth adaptation, as described by Arguedas-Villa et al. (2010). In short, a single colony was inoculated into 10 ml BHI and grown overnight at 37°C with shaking (220 rpm) (~109 CFU/ml). Fresh BHI (10 ml) was inoculated with approximately 103 CFU/ml and incubated at 4°C until bacteria reached stationary phase. Growth was monitored by spreading 10-fold serial dilutions prepared in peptone buffered saline onto plate count agar (Oxoid), incubating at 37°C for 24 h, and CFUs were counted. The lag phase duration (LPD) and maximum growth rate (MGR) of each strain were calculated from log converted growth  89 (CFU/ml) data using Dmfit version 2.0 and Microfit version 1.0 programs, based on the models of Baranyi and Roberts (1994).  3.2.7 Statistical analysis Data analysis was performed using GraphPad Prism 6.0 software. The statistical significance of differences in inlA genotypes based on isolate source (FPE, RUF and RTE foods) was assessed using chi-square and Fisher’s exact test (RUF and RTE foods). The Student’s t-test was used to compare invasive inlA genotypes to control strains (08-5578, EGD-SmR or BUG5), and to examine whether differences exist in LPD and MGR between food and environmental strains. Mutability, as indicated by the number of RIFR colonies, among serotypes (1/2a, 1/2c, 3a and 4b) was compared using Kruskal-Wallis test for nonparametric data, followed by Dunn’s multiple comparisons test. Differences between inlA genotypes (no PMSCs vs. PMSCs) were assessed by the Mann-Whitney test. A Fisher’s exact test was performed to assess whether differences existed between cold adapting groups (fast, intermediate) and inlA genotypes (no PMSC vs. PMSCs). For all analyses, differences were considered significant if p was < 0.05.  3.2.8 Nucleotide sequence accession numbers The nucleotide sequences from the isolates in this study have been deposited in GenBank under numbers KC433332 to KC433385.     90 3.3 Results 3.3.1 Distribution of different sero-, pulso- and sequence types  The majority of isolates examined in this chapter belonged to listeriosis causing serotypes, including 37.5% of serotype 1/2a and 4b. Other serotypes, including 1/2b (4%), 1/2c (14%), and 3a (7%), were isolated at lower rates (Table 3-1).  When subjected to PFGE, 36 pulsotypes were observed among the isolates recovered from PF, and two pulsotypes were recovered among the retail isolates (Table 3-2). Strains discriminated by PFGE and serotyping possessed different sequence types (STs). MLST grouped isolates into 14 STs, with one ST found to be novel (ST662). Distinct STs were observed among lineage I and II isolates (Figure 3-1). Two ST120 isolates, belonging to CC8, were recovered from raw meat, and a RTE fish sample. Seven STs (ST1, ST5, ST7, ST9, ST11, ST120, ST321) were common among the isolates described here and isolates associated with clinical cases of listeriosis in Canada reported by Knabel et al. (2012).   The majority of lineage I isolates (serotype 4b and 1/2b) were recovered from food and environmental samples from fish facilities, while lineage II isolates were widespread among all food categories (Figure 3-2). Interestingly, ST2, ST91, and ST296 were seen exclusively in RTE fish, while ST5 and ST662 were found in environmental and food meat samples, respectively.   ST321, which was the most common ST, included isolates recovered from food and environmental samples from meat and fish facilities, but not dairy. ST7 and ST11 were seen in dairy and meat facility environments, but not in fish processing facilities. Only one ST (ST155) was common between dairy and fish facilities (Figure 3-2).   91 Table 3-1. Serotypes of L. monocytogenes (n=56) isolates, characterized in this study, recovered from food processing environments, raw unprocessed foods (RUF) or ready-to-eat (RTE) foods. Source   No. of L. monocytogenes isolates with each serotype Total No. Isolates 1/2a 1/2b 1/2c 3a 4b Food processing environment 29 11 1 5 4 8 Fooda       RUF  6 4 0 2 0 0 RTE  21 6 1 1 0 13 Total No. (%) 56 21 (37.5) 2 (4) 8 (14) 4 (7) 21 (37.5) aRUF, raw unprocessed food; RTE, ready-to-eat food products.  3.3.2 inlA genotypes and mutability among L. monocytogenes strains DNA sequencing of inlA in 54 L. monocytogenes strains originating from food and food processing environment samples recovered from dairy, fish, and meat processing facilities revealed inlA PMSCs in 35% of isolates, while no inlA PMSCs were found in the two isolates from retail samples. Isolates possessing truncated InlA due to PMSC mutations are hereafter referred to as PMSC isolates. Type 3 mutations (amino acid [a.a.] position 700) (Figure 3-3) were the most common PMSC mutation in this collection (10/19), followed by type 4 (6/19) (a.a. position 9), type 11 (2/19) (a.a. position 685), and only a single isolate (1/19) possessed a type 1 mutation (a.a. position 606) (Table 3-3) (Van Stelten et al., 2010). Overall, 41% (22/54) of PF isolates encoded a full-length inlA, while 24% (13/54) had a 3-codon deletion in a.a. positions 738 to 740 (aspartic acid, threonine and serine), hereafter referred to as 3-codon deletion. Two isolates from retail possessed full-length inlA, however, a serotype 1/2a isolate (LR39) possessed eight non-synonymous and 26 synonymous mutations, while 19 non-synonymous and 63 synonymous mutations were observed in the 1/2b isolate (LR59).   92 Table 3-2. Distribution of L. monocytogenes (n=111) sero- and pulsotypes, and their inlA profiles, across different facilities (n=15). Facility ID  Type Number of isolates recovered Isolate sourcea Serotypes Pulsotypes  (PFGE)b inlA genotype (positive/tested) FPE RUF RTE No PMSCc With PMSC Food processing facilities d5 Dairy 9 9 - - 1/2a F1, G2 3/3  - d7 Dairy 1 1 - - 1/2a N1 1/1 - d11 Dairy 3 3 - - 1/2a G1 1/1 - f19 Fish 15 12 - 3 1/2c, 3a H1, H4, K2, K3, K4, K5 - 10/10 f20 Fish 21 9 - 12 1/2a, 4b  A1, L1, M1 8/8 - f21 Fish 10 6 - 4 1/2a, 4b A2, K1, K2, K4, K6, K8, K9 1/4 3/4 f28 Fish 11 6 - 5 1/2a, 4b B1, H3 6/7 1/7 f31 Fish 16 1 - 15 1/2a, 4b B1, C1, C2, E1, I1, I2 10/10 - m38 Meat 3 - 3 - 1/2a, 1/2c H2, J1 1/2 1/2 m44 Meat 3 - 3 - 1/2a H6 1/1 - m46 Meat 3 3 - - 1/2a G3, G4 1/1 - m49 Meat 6 6 - - 1/2a, 1/2b D1, D2, F2, K10 1/3 2/3 m50 Meat 4 - 4 - 1/2a, 1/2c H5, K7 - 3/3 Total 105           93 Table 3-2. Continued. Facility ID  Type Number of isolates recovered Isolate sourcea Serotypes Pulsotypes  (PFGE)b inlA genotype (positive/tested) FPE RUF RTE No PMSCc With PMSC Retail facilities rf7 Fish 3 - - 3 1/2a LMACI.0001 LMAAI.0001 1/1 - rf11 Fish 3 - - 3 1/2b LMACI.0470 LMAAI.0584 1/1 -  Total 6        aFPE, food processing environment; RUF, raw, unprocessed food; RTE, ready-to-eat food. bPulsotype designation is based on ApaI and AscI enzymes and Tenover et al. (1995) composite designation in the isolate population originating from food processing facilities, where an identical letter/number indicates indistinguishable pattern; same letter and different number indicate closely related isolates and different letters represent unrelated isolates. cPMSC, premature stop codon.     94 SerotypeLineage II1/2a3a3c1/2cLineage III4a4cUntypableLineage I4b3b1/2b4e4d3217155916621194 4532531946124443L. monocytogenes Multi-Locus Sequence Typing (MLST) Minimum Spanning Tree (MST)UBC food and environmental panel grouped by serotypeMLST method by Ragon et al. 2008 with alignment and MST created via Bionumerics v6.5; numbers on branches indicate allele differences between connected sequence types (ST); node diameter is in positive correlation to number of isolates; node colour shows isolate serotype.120529657"Lineage II Lineage I SerotypeLineage II1/2a3a3c1/2cLineage III4a4cUntypableLineage I4b3b1/2b4e4d321715512091662119445325319461524443L. monocytogenes Multi-Locus Sequence Typing (MLST) Minimum Spanning Tree (MST)UBC food and environmental panel grouped by serotypeMLST method by Ragon et al. 2008 with alignment and MST creat d via Bionumerics v6.5; numbers on branches indicate allele differences between connected sequence types (ST); node diameter is in positive correlation to number of isolates; node colour shows isolate serotype.Lineage III4a4cUntypablei  I1/23217155120916621194 45325319461524443L. monocytogenes Multi-Locus Sequence Typing (MLST) Minimum Spanning Tree (MST)UBC food and environmental panel grouped by serotypeMLST ethod by Ragon et al. 2008 ith ali e t   cr t  i  Bionu erics v6.5; nu bers on branch s i icate allele iffere cebetween connected sequence types (ST); node dia eter is in positive correlation to nu ber of isolates; node colour sho s isolate serotype.SerotypeLineage II1/2a3a3c1/2cLineage III4a4cUntypableLineage I4b3b1/2b4e4d3217155120916621194 45325319461524443L. monocytogenes Multi-Locus Sequence Typing (MLST) Minimum Spanning Tree (MST)UBC food and environmental panel grouped by serotypeMLST method by Ragon et al. 2008 with alignment and MST created via Bionumerics v6.5; numbers on branches indicate allele differences between connected sequence types (ST); node diameter is in positive correlation to number of isolates; node colour shows isolate serotype.CC8  Figure 3-1. Minimum spanning tree of different serotypes of L. monocytogenes derived from the food chain, created using Bionumerics v6.5. Branch numbers indicate allele differences between connected sequence types; node diameter is in positive correlation to number of isolates; node color shows isolate serotype. Dark shading represents clonal complex 8 (CC8).   95 CC8 19461244433217155916629114433552SourceMeat - FoodFish - EnvironmentalDairy - EnvironmentalFish - FoodMeat - EnvironmentalL. monocytogenes Multi-Locus Sequence Typing (MLST)  Minimum Spanning Tree (MST) UBC food and environmental panel grouped by sourceMLST method by Ragon et al. 2008 with alignment and MST created via Bionumerics v6.5; numbers on branches indicate allele differences between connected sequence types (ST); node diameter is in positive correlation to number of isolates; node colour shows isolate source.12055296Lineage II Lineage I 7" Figure 3-2. Minimum spanning tree of L. monocytogenes derived from different sources within the food chain, created using Bionumerics v6.5. Branch numbers indicate allele differences between connected sequence types; node diameter is in positive correlation to number of isolates; node color shows isolate source. Dark shading represents clonal complex 8 (CC8).      96 9"Type%4%Muta+on%606"Type%1%Muta+on%738(740"Three(Codon"Deletion"685"Type%11%Muta+on%700"Type%3%Muta+on%85" 414" 505" 800"α"Domain%Signal%Pep/de% Leucine"Rich6Repeats% Intergenic%Region% B6Repeats%CWR/%Membrane%Anchor%LPXTG"N1% 1C% Figure 3-3. Full-length inlA illustration, with the scale below representing amino acid positions, and types of mutations that occur due to premature stop codons. CWR, cell wall spanning region; LPXTG, leucine-proline-variable-threonine-glycine peptidoglycan anchored protein.     Since inlA PMSCs have been frequently reported in serotype 1/2a strains, the mutability of 1/2a isolates compared to other serotypes, including 4b, was investigated. Point mutations occurring in the rpoB gene, encoding RNA polymerase beta subunit have been shown to afford resistance to RIF (RIFR) (Wehrli, 1983). Irrespective of serotype, significantly more RIFR colonies were observed in strains not possessing inlA PMSCs compared to those with inlA PMSC mutations (p=0.0015) (Figure 3-4A), suggesting that different environmental and/or clinical pressures influence the mutation rates in inlA and rpoB genes. Correspondingly, significantly more RIFR colonies were observed for 4b serotype strains compared to 1/2a, 1/2c, and 3a strains (p=0.0002) (Figure 3-4B).   3.3.3 Distribution of inlA genotypes across different food processing facilities No PMSCs were seen in inlA of L. monocytogenes isolates recovered from RF, or dairy facilities, while 33% and 60% of isolates from fish and meat facilities, respectively, had PMSCs. Of five fish facilities examined, three facilities had isolates lacking PMSCs, while two facilities had PMSCs in all (10/10) or 75% of recovered isolates (Table 3-2).   97 Table 3-3. Number of L. monocytogenes isolatesa recovered from food processing environments (n=29), raw unprocessed (n=6) and ready-to-eat (n=21) foods with full-length inlA, inlA mutations resulting in premature stop codons (PMSC) or 3-codon deletions. inlA Genotype No. (%) environmental isolates No. (%) food isolates Serotype (No. of strains) Facility ID RUF RTE Without PMSCa 16 (55) 2 (33) 19 (90) 1/2b (1), 1/2a (15), 4b (21) d5, d7, d11, f20, f21, f28, m38, m44, m46, m49 With 3-codon deletion (a.a. 738 - 740) 4 (14) 0 9 (47) 1/2a (1), 4b (12) f20, f31 With PMSC 13 (45) 4 (67) 2 (11)   Type 1 (a.a. 606) 1 (3) 0 0 1/2b (1) f49 Type 3 (a.a. 700) 7 (24) 2 (33) 1 (5) 1/2a (6), 3a (4) f19, f21, f49, f50 Type 4 (a.a. 9) 5 (17) 0 1 (5) 1/2c (6) f19 Type 11 (a.a. 685) 0 2 (33) 0 1/2c (2) f38, f50 aNumbers do not add up, as isolates without PMSCs also include the isolates possessing 3-codon deletion.  More meat facilities (n=3) had L. monocytogenes isolates possessing inlA PMSCs than isolates without mutations (n=2). Two meat facilities had no PMSC mutations in their isolates, one had PMSCs in all isolates (n=3), and two facilities had 50% and 67% of isolates with mutations (Table 3-2). Type 3 mutations were found among isolates from fish and meat facilities, while type 4 was only seen in isolates from fish facilities, and types 1 and 11 only in L. monocytogenes from meat facilities. The most common type of mutation among fish isolates possessing PMSCs was type 3, followed by type 4 mutations. Similarly, type 3 mutations most commonly occurred in isolates from meat facilities, followed by type 11 and type 1 mutations (Appendix B, Table B-1).    98 Isolates with PMSCsIsolates without PMSCs010203040L. monocytogenes inlA genotypeMean number of RIFR coloniesabA.4b 1/2a 1/2b 1/2c 3a010203040L. monocytogenes serotypeMean number of RIFR coloniesabaB. Figure 3-4. Mutability of different L. monocytogenes inlA genotypes (A) and serotypes (B) assessed by the number of rifampicin-resistant colonies after 48 h growth at 35°C in the presence of 100 µg/ml rifampicin. Mutability of each isolate was assayed in triplicate in each experiment, and two independent experiments were performed. Bars represent mean number of colonies, and error bars indicate standard error of the mean. Different letters above the bars represent significant differences (p<0.05) between geno- and serotype groups determined using the Mann-Whitney (A) or Kruskal-Wallis test followed by Dunn’s multiple comparisons test (B). Serotype 1/2b and 3a isolates were excluded from statistical analysis due to small number of isolates examined.   99  Isolates possessing the 3-codon deletion were observed in two fish (f20, f31), but not in dairy or meat facilities (Table 3-2). In one of the facilities (f20), all but one isolate (88%) had this deletion, while 60% of samples had the same codons missing in the other facility (f31). PFGE typing showed these isolates were not clonal. None of the isolates from facilities f20 and f31 possessed PMSCs.   3.3.4 inlA mutations within different serotypes and multilocus sequence types PMSC mutations in inlA were observed in four of the five serotypes examined, including all 1/2c (n=8) and 3a (n=4) isolates, followed by 1/2a (30%; n=6), and one 1/2b (50%; n=2) isolate. Serotypes 1/2a and 3a carried only type 3 mutations while serotype 1/2b had only a type 1 mutation. The only serotype with more than one type of mutation (i.e. type 4 and 11) was 1/2c.  A 3-codon deletion was observed in 13 strains derived from fish processing facilities. With the exception of one 1/2a isolate, this deletion was seen in 4b serotype strains. Overall, 57% of 4b serotype isolates possessed this 3-codon deletion, though no inlA PMSC mutations were found in serotype 4b isolates.  Eleven different STs were observed among full-length inlA genotypes. ST5 and ST321 were seen exclusively in type 1 and type 3 inlA PMSC isolates, respectively. ST9 was associated with type 4 and 11 inlA mutations; however, full-length inlA genotypes were also observed in those STs. The majority of 3-codon deletion isolates were grouped into ST194 (6/13) and ST6 (6/13), while one isolate belonged to ST155. While ST155 and ST194 were also seen among isolates possessing the full-length inlA, ST6 was found exclusively in isolates possessing this 3-codon deletion.   100 3.3.5 Occurrence of inlA PMSCs in isolates recovered from different sources Isolates with inlA PMSC mutations were seen more commonly in FPE samples than RUF and RTE foods (p=0.0068). Further, more isolates from RUF (4/6) carried inlA PMSCs compared to those isolated from RTE (2/21) foods (p=0.011). Nine of the 13, 3-codon deletion mutants were recovered from RTE foods (69%), with the remaining isolates being environmental. Isolates encoding a full-length InlA (i.e. excluding isolates with the 3-codon deletion) were observed predominantly in FPE samples (12/24), followed by RTE (10/24) and RUF (2/24) samples (Table 3-3).  3.3.6 Invasion of Caco-2 cells by L. monocytogenes strains possessing truncated InlA or 3-codon deletion inlA PMSC-encoding isolates exhibited reduced Caco-2 cell invasion phenotypes (Figure 3-5). A 4b isolate (FF46-3) possessing wild type inlA was 2.2 times more invasive (p<0.0001) than a clinical isolate (08-5578) which caused 23 deaths during a 2008 deli meat listeriosis outbreak in Canada. This isolate was also 10.8 times more invasive (p<0.0001) than the laboratory control EGD-SmR strain (Figure 3-5). This phenomenon was observed for another 4b isolate (FF19-1) and a 1/2a strain (FE13-1) possessing the 3-codon deletion, both of which were 4.7 and 7.1 times more invasive (p<0.0001), respectively, compared to the control EDG-SmR strain. When compared to the Canadian deli meat outbreak strain 08-5578, FF19-1 and FE13-1 were as invasive, or 1.4 times more invasive (p=0.006), respectively (Figure 3-5).     101  Figure 3-5. Invasion efficiency (% of bacteria recovered relative to initial inoculum) of L. monocytogenes isolates possessing inlA PMSC mutations (type 1, 3, 4 and 11) or a 3-codon deletion at amino acid position 738 to 740 (Δ738-740) compared to wild type clinical isolates (08-5578 and EGD-SmR) and a Tn1545-induced non-invasive inlA mutant of EGD-SmR (BUG5). Assays for each isolate were carried out in triplicate and repeated two times. Bars represent mean invasion efficiencies, and error bars indicate standard error of the mean. Different symbols above the bars indicate significantly higher invasion efficiency (p <0.05; t-test) when compared to controls 08-5578 (!), EGD-SmR (") or BUG5 (#).   3.3.7 Cold growth adaptation of strains from different serogroups and sources Three cold growth categories were observed among 33 isolates assessed for their ability to adapt to 4°C following downshift from 37°C. The first category included fast adapting strains   102 (n=15) possessing a LPD less than 70 h. The second group was comprised of intermediate cold growth adaptors with LPD ranging between 70 to 200 h, and included the majority of strains (n=13). Finally, five strains adapted slowly to 4°C, possessing a LPD > 200 h.   Fast adapting strains included mainly RTE food-derived isolates, and to a lesser degree, FPE and RUF isolates, while intermediate cold growth adaptors were recovered predominantly from FPE, but also included isolates from RTE and RUF foods (Figure 3-6). Slow growing strains were seen only in FPE and RTE samples (Figure 3-6). No significant differences were observed in LPD or MGR between food and environmental isolates (Figure 3-7).  Fast(<70 h)Intermediate (70-200 h)Slow (>200 h)051015Cold growth adaptationNumber of L. monocytogenes isolatesFPERUFRTE Figure 3-6. The distribution of L. monocytogenes isolates recovered from food processing environments (FPE), raw unprocessed (RUF), and ready-to-eat (RTE) foods, within three cold growth adapting groups, when grown at 4°C. Differences were not statistically significant (p>0.05, chi-square).    103   Food Environment050100150200250300L. monocytogenes sourceLag phase duration (h)A. LPDFood Environment0.000.010.020.030.040.050.06L. monocytogenes sourceIncrease log10 CFU/hB. MGR Figure 3-7. Lag phase duration (A) and exponential growth rate (B) of 33 L. monocytogenes isolates recovered from food and food processing environments following a down-shift from 37 to 4°C in BHI. Each isolate was assayed in duplicate, and two independent growth assays were performed. Middle horizontal lines represent mean values, with standard deviations.    104  The majority of fast adapting strains were of the serotype 4b (53%), followed by 1/2a (40%) and 1/2c (7%) serotypes. Intermediate cold-adaptors were represented predominantly by 1/2a strains (46%), followed by 1/2c, 4b, 3a and 1/2b serotypes, respectively. Of the five slow adapting strains, three were 1/2a and two 4b serotypes.   3.3.8 Cold growth adaptation of different L. monocytogenes inlA genotypes Significant differences in the ability of different isolates to adapt and grow at 4°C, both with and without inlA PMSCs were observed (fast vs. intermediate, p=0.042). Overall, intermediate cold adapting strains more frequently possessed inlA PMSCs (70%) compared to fast (20%) and slow (10%) cold adaptors (Figure 3-8A). In contrast, with the exception of two isolates (serotypes 1/2c and 1/2a), fast adapting strains lacked inlA PMSCs (Figure 3-8B). Notably, isolates possessing a wild type inlA (i.e. full length InlA) or the 3-codon deletion comprised 57% of fast-adapting strains, followed by 26% intermediate, and 17% of slow growing strains (Figure 3-8A).  3.4 Discussion  Results obtained in these series of experiments demonstrated variability in inlA genotypes among L. monocytogenes isolates recovered from foods and processing environments in B.C. that were often unique within food processing facilities. Overall, 34% (19/56) of examined isolates possessed mutations in inlA due to PMSCs, which is lower than the rate reported for food-chain isolates in the United States (US) (45%) (Chen et al., 2011; Ward et al., 2010), but similar to levels reported in France (Jacquet et al., 2004). In addition to previously described inlA mutations, including types 1, 3, 4 and 11, inlA genotypes with a consecutive    105 PMSC(n=10)No PMSC(n=23)02468101214inlA genotypeNumber of L. monocytogenes isolatesFast CGA (<70 h)Intermediate CGA (70-200 h)Slow CGA (>200 h)57%20%70%10%26%17%A.Fast(n=15)Intermediate (n=13)Slow (n=5)02468101214Cold growth adaptationNumber of L. monocytogenes isolatesPMSC mutations in inlANo PMSC in inlA87%13%46%54%80%20%B. Figure 3-8. Identification of L. monocytogenes isolates with or without premature stop codons (PMSC) in inlA as fast (<70 h), intermediate (70-200 h) or slow (>200 h) cold growth adaptors (CGA), following a temperature down-shift from 37 to 4°C in BHI. Differences in cold growth adaptation between fast and intermediate L. monocytogenes inlA genotypes were significant (Fisher’s exact, p=0.042). The percentage of isolates within geno- (A) and phenotypic groups (B) is indicated above bars.   106 3-codon deletion in the amino acid positions 738 to 740 were observed. To date, this phenomenon has been reported only in a single isolate from a meat facility in Portugal (Ferreira et al., 2011). It has been suggested that certain inlA PMSC mutations accumulate at the population level with notable differences in inlA PMSCs occurring in North America compared to European countries (Rousseaux et al., 2004; Van Stelten et al., 2010; Ward et al., 2010). Interestingly, type 11 (a.a. 685) inlA PMSC mutation was seen in B.C. isolates, which to date have not been reported outside of France (Chen et al., 2011; Felicio et al., 2007; Van Stelten et al., 2010; Ward et al., 2010).   MLST data showed grouping of isolates into 14 different STs, 13 of which have been reported worldwide (Chenal-Francisque et al., 2011; Roche et al., 2012) and one (ST662) unique to B.C. isolates. It has been suggested that certain clonal complexes (e.g., CC1, 2, 3 and 9) are widely distributed across continents, while some predominate in specific regions (e.g., CC288 in North America, CC6 in Europe). In agreement with this, CC1, 2, and 9 isolates occurred in the B.C. isolate collection. Interestingly, CC8 isolates have been reported to dominate amongst clinical isolates in Canada (Knabel et al., 2012). Specifically, Knabel et al. (2012) reported that 1/2a serotype isolates, with similar PFGE patterns, and belonging to CC8 have been recurring causes of sporadic and outbreak-linked listeriosis in Canada since 1980s (Knabel et al., 2012). A strain that caused a large listeriosis outbreak in the summer of 2008 and led to 23 deaths of Canadian consumers of deli meat belonged to CC8 (Gilmour et al., 2010; Knabel et al., 2012). Two ST120 isolates, belonging to CC8, were found in the L. monocytogenes collection examined here (OF28-1 and LR39-1). One of the isolates was recovered from a raw meat sample (OF28-1) at a meat facility (m44), while the other originated from a RTE fish sample collected at retail (rf7). Although only two isolates   107 belonging to CC8 were recovered in the current study, considering the link with clinical strains, the presence of CC8 in the food chain-derived isolates is of concern.  While no particular ST has been associated with wild type inlA genotypes, ST9 isolates have been reported to commonly carry inlA mutation types 11, 12, and 14 (Roche et al., 2012). Type 11 inlA mutations were also seen in two of the B.C. ST9 isolates, while six of the isolates possessed type 4 mutations. In addition, ST6 and ST194 carried a 3-codon deletion at amino acid position 742 in French isolates from foods and food processing environments (Roche et al., 2012). Interestingly, ST6, ST194, and ST155 isolates from B.C. possessed a similar 3-codon deletion but at a different amino acid position (738 to 740).  It is well established that frameshift and transition/transversion mutations in inlA can lead to PMSCs, resulting in a truncated or non-secreted InlA. Strains possessing these genotypes are associated with attenuated virulence (Bonazzi et al., 2009; Jonquieres et al., 1998; Nightingale et al., 2005) and are predominantly seen in L. monocytogenes adapted to environmental and food processing niches (i.e. 1/2a serotype strains), and to a lesser degree in clinical strains overrepresented by 4b serotypes (Jacquet et al., 2004; Ward et al., 2010). In-line with this, isolates in the present study belonging to 1/2a, 1/2c, and 3a serotypes possessed inlA PMSC mutations. In general, 4b strains are typically more conserved in their genetic content, exhibit lower recombination rates, and are less likely to possess plasmids and extra-chromosomal elements (Orsi et al., 2011; Orsi et al., 2007; Ragon et al., 2008). Interestingly, when different serotypes were compared in their ability to acquire point mutations leading to RIFR, 4b strains were significantly (p=0.002) more likely to gain mutations conferring resistance than all other serotypes. Considering that 1/2a serotype strains are known to possess mutations in several virulence loci, including actA, inlA, and   108 prfA [reviewed by Orsi et al. (2011)], it was expected 1/2a serotype strains would have higher mutability in this assay. In fact, the opposite was observed, though reasons for this are not clear. This is particularly interesting since positive selection, resulting from the acquisition of advantageous mutations, has been reported to contribute to the evolution of numerous genes in 1/2a strains but is less often reported for 4b serotypes (Dunn et al., 2009; Orsi et al., 2008). Although this assay has not previously been used to examine mutability in L. monocytogenes, it has been used to examine mutation rates in Enterobacteriaceae (Allen and Poppe, 2002; LeClerc et al., 1996) in which comparison to reference strains was made to identify hyper-mutability. Results reported here represent the relative ability of strains to acquire mutations leading to RIFR. Although further work is needed to explore this phenomenon, results obtained for the B.C. population suggest serotype 4b strains may acquire RIFR mutations more readily than 1/2a strains. Interestingly, the opposite is true for the inlA mutations, suggesting different environmental and/or clinical pressures influence the mutation rates in inlA and rpoB genes. Indirectly, these data suggest that there may be a yet unidentified selection pressure for the maintenance of inlA genes encoding a full-length InlA in isolates belonging to 4b serotype.  Highly invasive isolates possessing a 3-codon deletion in inlA (a.a. 738-740) were observed within the B.C. collection, which is contrary to a previous report (Ferreira et al., 2011). These isolates exhibited invasion efficiencies equivalent to or surpassing that of the deli meat outbreak strain (08-5578) that contributed to the deaths of 23 individuals in 2008 (Weatherill, 2009) and the EGD-SmR strain (Figure 3-5). In recent years, strains possessing truncated InlA proteins have been identified as strains with lower invasiveness and, accordingly, have been suggested to present reduced public risk (Nightingale et al., 2005;   109 Nightingale et al., 2008). Although this seems prudent for most inlA genotypes in which PMSCs lead to truncated proteins, this characteristic does not apply to the 3-codon deletion observed amongst B.C. isolates recovered in the present study. In contrast, although the InlA protein is truncated by three amino acids, isolates possessing it remain equally, or more, invasive than control strains, thus indicating they are of considerable risk and should be considered a public health concern. Considering 12 of 13 3-codon deletions were serotype 4b, it would be of interest to compare the internalin gene complement of the single 1/2a isolate with this deletion to the 4b strains harboring the same inlA genotype. It has been shown experimentally that the deletion of a.a. 714 to 766 corresponding to the pre-anchor region did not reduce the invasiveness when the modified inlA gene was transferred to L. innocua (Lecuit et al., 1997). However, the impact of a consecutive deletion of aspartic acid, threonine and serine in positions 738 to 740 in naturally occurring L. monocytogenes strains has not been described before. It is possible that this deletion may affect protein folding in a manner that would enhance bacterial interaction with its human cell surface receptor E-cadherin. However, it is also possible that other virulence-related factors are contributing to invasion. In particular, a host of other internalin genes (inlB, inlC2, inlD, inlE, inlF, inlG, inlH) have been implicated in invasive behavior (Orsi et al., 2011; Raffelsbauer et al., 1998; Tsai et al., 2006). Of these, inlC2, inlD, inlE, and inlJ are common to lineage I and II strains, while inlF, inlG, and inlH have only been observed in lineage II (Orsi et al., 2011; Tsai et al., 2006).  In general, it has been proposed that over-representation of serotype 1/2a (lineage II) in isolates that originate from food and FPEs, is a result of their enhanced capacity to survive food chain conditions, though data substantiating this assertion are often conflicting and   110 limited (Orsi et al., 2011). It has been reported, however, that 4b strains incubated at 4°C for four weeks and subsequently up-shifted to 37°C, indeed possessed shorter LPD than 1/2a isolates (Buncic et al., 2001). This implies 4b strains present in foods may quickly adapt to host temperature, and correspondingly may be more likely to cause disease. The ability of various serotypes recovered from B.C. to adapt and subsequently grow at 4°C following a downshift from 37°C was investigated here. When the 33 strains were examined, three cold-adapting groups were observed, similar to reports previously made among L. monocytogenes derived from different origins (Arguedas-Villa et al., 2010). When sample origin was examined, the majority of fast-adapting strains from B.C. were recovered from RTE foods, though differences were not significant. It is tempting to speculate that wild type inlA genotypes (i.e. full-length) may be an indicator of food chain strain fitness. Support for this stems from observations centering on the absence/presence of inlA PMSCs in respective cold-growth groups. Significantly more intermediate cold adaptor isolates possessed inlA PMSCs (70%) compared to fast-adapting isolates (p=0.042), with only two fast-adaptor isolates shown to encode a PMSC. This observation lends support to the use of inlA as a suitable biomarker to identify high-risk strains, though in this light it may be used as an indicator of increased ability to adapt and grow at refrigeration temperatures. Considering cold temperatures are used in RTE food processing facilities and are relied on to ensure product quality and safety throughout the food supply chain, these strains may possess enhanced ability to persist in FPE. Furthermore, if present in food, L. monocytogenes strains having an inlA gene, which will produce a full-length InlA, may have increased ability to grow to potentially dangerous levels during cold storage, particularly if abusive temperature conditions are encountered.   111 3.5  Conclusions  In summary, inlA mutations were observed in four L. monocytogenes serotypes recovered from the B.C. food continuum. Notably, when the adaptive mutability of isolates to rifampicin was examined, serotype 4b isolates acquired mutations more frequently than all other serotypes. The opposite, however, was true for the inlA mutations. None of the examined 4b serotype strains possessed PMSC mutations in inlA. Interestingly, isolates with the 3-codon inlA deletion (a.a. 738-740) exhibited highly invasive phenotypes, suggesting this inlA genotype may be of public health concern. When the ability of L. monocytogenes isolates to adapt to cold temperature was examined, isolates possessing rapid cold adaption were more likely to encode an inlA gene lacking PMSCs. These results substantiate, in new ways, the assertion that isolates lacking inlA PMSCs are a significant concern. Listeria monocytogenes lacking inlA PMSCs were more commonly recovered from RTE food. Since those isolates adapted more rapidly to refrigeration temperature than isolates with PMSCs, they represent L. monocytogenes of significant concern to food processors and public health authorities.    112 Chapter  4: Antimicrobial resistance and co-selection phenomenon in Listeria spp. recovered from B.C. food and food processing environments  4.1 Introduction Listeria spp. may be recovered from a variety of animals (Fenlon, 1999; Müller, 1988) and environments, including aquatic and non-aquatic sources (Colburn et al., 1990; Fenlon, 1999; Lyautey et al., 2007; Schaffter and Parriaux, 2002; Weis and Seeliger, 1975). This ubiquity challenges the ability of food processors to effectively exclude Listeria from food production environments and, ultimately, food. Of the 15 Listeria species, Listeria monocytogenes is the only species that has been routinely associated with human infections, though L. ivanovii also occasionally causes human disease (Guillet et al., 2010). The recovery of Listeria spp. in food processing facilities is of serious concern to processors since 99% of listeriosis infections are linked to contaminated food (Farber and Peterkin, 1991; Pinner et al., 1992; Scallan et al., 2011; Schuchat et al., 1991). Consumption of L. monocytogenes may lead to a symptomatic infection that varies in severity based on host status. In healthy adults, listeriosis is limited to the gastrointestinal environment and is characterized by mild enteritis and/or influenza-like symptoms (Swaminathan and Gerner-Smidt, 2007). In susceptible populations, including young children, the elderly, and immunocompromised individuals, infections may become invasive (Schlech, 2000). This form of listeriosis often results in severe clinical outcomes, with mortality rates ranging between 20 and 40% (Farber and Peterkin, 1991; Hof et al., 1997; Weatherill, 2009). Clinical presentation of invasive listeriosis may include encephalitis, meningitis, septicemia, and spontaneous abortions during the last trimester of pregnancy (McLauchlin et al., 2004).    113  Considering the morbidity and high mortality rates linked to invasive listeriosis, antibiotic chemotherapy is required to improve clinical outcomes. With the exception of cephalosporins, fosfomycin, and early quinolones, to which innate resistance has been reported (Hof et al., 1997; Morvan et al., 2010), L. monocytogenes is generally considered sensitive to most clinically relevant antibiotics (Hof et al., 1997; Troxler et al., 2000). The treatment course for invasive listeriosis is typically comprised of an aminopenicillin (e.g., ampicillin or amoxicillin) in combination with an aminoglycoside, such as gentamicin (Boisivon et al., 1990; Hof, 2004; Temple and Nahata, 2000). In cases where reduced sensitivity or resistance to beta-lactams is encountered, a number of agents active against Gram positive bacteria may be used, though cotrimoxazole is generally regarded as the second-choice therapeutic option (Boisivon et al., 1990; Hof, 2004; MacGowan, 1990; Temple and Nahata, 2000).  The first report of antibiotic resistant L. monocytogenes was made in 1988. A clinical isolate from a patient with meningitis possessed resistance to chloramphenicol, erythromycin, streptomycin, and tetracycline (Poyart-Salmeron et al., 1990). Although acquired antimicrobial resistance (AMR) is thought to be rare in L. monocytogenes, the aforementioned AMR was encoded on a mobile plasmid shown to be transmissible to other L. monocytogenes strains, enterococci, and Staphylococcus aureus. Since then, increased reports of AMR in L. monocytogenes and other Listeria spp. have been made (reviewed in Charpentier and Courvalin, 1999; Lungu et al., 2011), though the body of literature remains limited compared to other notable foodborne pathogens. In particular, increasing trends of reduced sensitivity to fluoroquinolones and tetracycline were observed in a large collection of clinical isolates (Morvan et al., 2010). Resistance to fluoroquinolones (e.g., ciprofloxacin)   114 has been attributed to an efflux pump, Lde, belonging to the major facilitator superfamily (Godreuil et al., 2003). Notably, repeated exposure to sub-lethal concentrations of benzalkonium chloride (BAC) or ciprofloxacin produced derivative strains that possessed an increased tolerance to respective selective agents (Rakic-Martinez et al., 2011). In these strains, tolerance to gentamicin and other toxic compounds increased as well, thus indicating a co-selection phenomenon (Rakic-Martinez et al., 2011). This observation has significant implications as quaternary ammonium compounds (QACs) are routinely used for the disinfection of food production environment surfaces (McDonnell and Russell, 1999; Merianos, 1991; Rakic-Martinez et al., 2011). As a result, the frequent use of QAC antimicrobials may result in selection for strains possessing reduced susceptibility to a key therapeutic agent.  In British Columbia (B.C.), a survey of dairy, fish, and meat sectors revealed a high prevalence of L. monocytogenes and other listeriae primarily recovered from fish processing facilities (Kovačević et al., 2012a). Furthermore, examination of fish and meat products available at retail in B.C. showed that contaminated fish products possessed strains of considerable public risk (Kovačević et al., 2012b). At this time, a paucity of data describing AMR in L. monocytogenes and other listeriae in Canada exists, with the most recent publication examining resistance in isolates originating from animal feces rather than the food supply (Lyautey et al., 2007). Considering the link between contaminated food, food processing environments, and listeriosis, generating data that will further describe AMR in food-related isolates seems prudent. Therefore, the objective of this research was to determine whether Listeria spp. recovered from the B.C. food supply possessed resistance to clinically relevant antibiotics. In addition, the possibility of whether a similar relationship   115 between reduced susceptibility to ciprofloxacin and antibiotics used in the treatment of listeriosis (e.g., gentamicin), as reported (Rakic-Martinez et al., 2011), also existed within food chain-derived L. monocytogenes isolates was researched. Two hypotheses were structured for investigation: (H1) Listeria spp. recovered from B.C. food chain possess resistance to clinically relevant antimicrobials; (H2) The adaptation of food chain-derived L. monocytogenes to high concentrations of ciprofloxacin leads to resistance to BAC.  4.2 Materials and methods 4.2.1 Bacterial isolates Listeria spp. (n=111) used in this study were recovered from FPE swabs (n=53), raw unprocessed food (RUF; n=18) and ready-to-eat (RTE) foods (n=40) collected from dairy, fish, and meat processing facilities, and retail facilities in B.C. as part of the survey described in Chapter 2. Listeria species in this study included: L. innocua (n=22), L. monocytogenes (n=56), L. seeligeri (n=12), and L. welshimeri (n=21), with isolate origins and serotyping data for L. monocytogenes described in Table 4-1 (more details for L. monocytogenes isolates are given in Table B-1, Appendix B). Bacterial cultures were maintained in peptone with 20% glycerol at -80 °C. Prior to experiments, isolates were grown overnight on tryptic soy agar (TSA; Difco, Becton Dickinson Diagnostics, Mississauga, ON, Canada) at 35°C.  4.2.2 Antimicrobial resistance screening AMR was assessed by disc diffusion assay. Briefly, single colonies of Listeria isolates were inoculated into 10 ml of tryptic soy broth (TSB; Difco) and incubated at 35°C for 18 ± 2 h, with shaking (200 rpm). Following incubation, cultures were diluted to 1 x 107 CFU/ml in   116 tempered 0.75% agar (45°C; Difco), mixed gently, and poured onto Mueller-Hinton agar (MHA; Difco). Once solidified, antimicrobial susceptibility test discs (BBL™ Sensi-Disc™, BD Diagnostics, Sparks, MD, USA) were applied and plates incubated at 35 °C for 24 h. A panel of 18 antimicrobials comprising 11 classes of antibiotics were used: amikacin (AMK; 30 µg), ampicillin (AMP; 10 µg), cefoxitin (FOX; 30 µg), chloramphenicol (CHL; 30 µg), ciprofloxacin (CIP; 5 µg), clindamycin (CLI; 2 µg), erythromycin (ERY; 15 µg), gentamicin (GEN; 10 µg), imipenem (IPM; 10 µg), kanamycin (KAN; 30 µg), linezolid (LZD; 30 µg), nalidixic acid (NAL; 30 µg), rifampin (RIF; 5 µg), streptomycin (STR; 10 µg), cotrimoxazole (SXT; 10 µg), tetracycline (TET; 30 µg), trimethoprim (TMP; 5 µg), and vancomycin (VAN; 10 µg). Zones of inhibition were measured to the nearest millimeter at 24 h. Since no resistance criteria exist for Listeria susceptibility testing in Clinical and Laboratory Standards Institute (CLSI) guidelines for the tested AMs other than AMP and SXT, CLSI criteria for staphylococci were applied (Clinical and Laboratory Standards Institute, 2011). Escherichia coli K-12 MG1655 and Staphylococcus aureus ATCC 25923 were used as quality control strains.  Table 4-1. Listeria isolates (n=111) recovered from food processing environments, raw unprocessed food, or ready-to-eat foods used in the study. Source L. monocytogenes Serotypes  Other Listeria spp.a Total 1/2a 1/2b 1/2c 3a 4b  Total Li Ls Lw Processing environment 29 11 1 5 4 8  24 8 12 4 Foodb            RUF 6 4 0 2 0 0  12 2 0 10 RTE 21 6 1 1 0 13  19 12 0 7 Total 56 21 2 8 4 21  55 22 12 21 aLi, Listeria innocua; Ls, Listeria seeligeri; Lw, Listeria welshimeri. bRUF, raw unprocessed food; RTE, ready-to-eat food products.   117 4.2.3 Plasmid profiling of L. monocytogenes isolates with antimicrobial resistance In L. monocytogenes, plasmid-mediated AMR has been reported for strains displaying CHL, CLI, ERY, STR and TET resistance (Hadorn et al., 1993; Poyart-Salmeron et al., 1990). As such, PCR was used to screen for plasmids in seven strains displaying resistance or reduced susceptibility (RSC) to CLI, TET, STR and LZD. Template DNA was isolated from overnight cultures grown in BHI (10 ml) at 37°C, with shaking (200 rpm). Following incubation, 1 ml of culture was spun (10,000 x g; 1 min), resuspended in 500 µl of deionized water, boiled for 10 min, spun for 10 min at 10,000 x g (4°C), and supernatant was placed in a new microfuge tube. Oligonucleotide primers (Table 4-2) were designed to amplify putative plasmid genes that were annotated following whole-genome sequencing (Sagert, 2013). PCR reactions included 1.0 µM of each oligonucleotide, 50-100 ng of DNA, and 1 U of Platinum Taq polymerase (Invitrogen Canada Inc., Burlington, ON). All reactions were cycled as follows: one cycle at 95°C for 5 min; followed by 35 cycles of 95°C for 30 sec, 55°C for 30 sec and 72°C for 1 min; and a final extension at 72°C for 7 min. Amplicons were visualized (ChemiDoc™ XRS+ System, Bio-Rad, Hercules, CA, USA) on a 1% Tris-Borate-EDTA (TBE; 89 mM Tris-Borate and 2 mM EDTA, pH 8.3, Sigma-Aldrich) agarose gel following electrophoresis for 60 min at 120 V (Bio-Rad Horizontal Electrophoresis System). For strains that were putatively positive for plasmids using the PCR screen, plasmids were isolated using the alkaline extraction method developed by Birnboim and Doly (1979). Listeria monocytogenes 08-5578 was used as a control strain (Gilmour et al., 2010). Isolated plasmids were visualized using pulsed-field gel electrophoresis (PFGE). Briefly, samples were run for 7.5 h in a 1% TBE-agarose gel using an initial switch time of 2.2 sec and final switch time of 63.8 sec with recirculation of 4°C running buffer.   118 Table 4-2. Oligonucleotide primers used for plasmid screening.  Primer Name Sequence (5' - 3') Product Size (bp) p02-mcoF GGTTAAACAAGAGGCTGCTA 442 p02-mcoR TTCTTTTCTTGCTGAAGGAG p17-umuCF ATGTACCGGAAACTGTATGG 467 p17-umuCR TTCAAGAAAGTAGGGGACAA p50-traGF ATTCTGGTACGGCAAAACTA 504 p50-traGR TATCAATCCGCTTGTCTCTT p62-parF GAACAAGCCTTTGCTTATGT 509 p62-parR TCTACCCGTTCTTTTTCTTG p74-cadAF CCGGATAGAGAGCAAGTATG 508 p74-cadAR TGTACTGAAGGCTGAAGGTT p08-ydhKF AGCTTGTTCAACTGGTAACGAAG 480 p08-ydhKR TCGTCAGTTGTCATCCATTTATG p33-yfiSF ATTGCCAGCGCTGCTTATAG 630 p33-yfiSR TACCACAAGCCCTTGTTGTTC p63-bcrBa CGTGTCAGCAGATCTTTGATTAAG 637 p64-bcrCa TTGGCGCAATCTTATTTGAAG aPrimers previously published as p63-qacF (bcrB), and p64-ebrB (bcrC) (Kovacevic et al., 2013b).   4.2.4 Investigation of ciprofloxacin resistance To investigate the nature of CIP resistance, L. monocytogenes isolates (n= 29) with RSC or resistance were grown in the presence of reserpine (20 µg/ml; Sigma Aldrich Canada Co., Oakville, ON), a known efflux pump inhibitor (Godreuil et al., 2003). Briefly, isolates were grown in TSB at 35°C with shaking (200 rpm) for 20 ± 2 h. CIP (Sigma-Aldrich) was dissolved in dimethyl sulfoxide and sterile deionized water, and added (100 µl) to 96-well microtitre plates (CellTreat Scientific Product, Shirley, MA, USA) containing 95 µl of sterile TSB with or without reserpine and 5 µl of overnight culture (1:100 dilution; final concentration was 2 to 4 x 105 CFU/ml). Final concentrations of CIP tested were 0.25, 0.5, 1, 2, and 4 µg/ml. Microtitre plates were incubated at 35°C with shaking (150 rpm) for 20 ± 2 h   119 and optical densities measured at 595 nm (OD595; BioRad iMark™ Microplate Absorbance Reader, Hercules, CA, USA). Additionally, a loopful from each well was applied onto TSA plates and incubated overnight at 35°C to confirm the presence or absence of bacterial growth. Sterility and positive controls were included in each microtitre plate. All assays included two biological and two technical replicates for each isolate.  4.2.5 Gentamicin and benzalkonium chloride resistance of CIP resistant L. monocytogenes isolates Eight L. monocytogenes isolates (four 1/2a and four 4b serotype strains) were experimentally adapted to different concentrations of CIP ranging from 0.25 to 240 µg/ml. Briefly, isolates were grown overnight at 35°C in TSB containing CIP (i.e. maximum tolerated concentration for respective strains), with shaking (200 rpm), and using spread plate method applied onto TSA containing 2-fold higher concentration of CIP than that of the TSB culture. Plates were incubated at 35°C for 24 to 48 h. Up to three resistant colonies were picked, applied onto TSA containing one and a half times higher concentration of CIP than the previous passage, and incubated at 35°C for 24 to 48 h. Following incubation, colonies were transferred to TSB with the same concentration of CIP, and incubated at 35°C for 24 h. The process was terminated once strains achieved tolerance to 240 µg/ml of CIP.   GEN (Sigma-Aldrich) and benzalkonium chloride (BAC; 60% benzyl-dimethyl-dodecyl-ammonium chloride, and 40% benzyl-dimethyl-tetradecyl-ammonium chloride, Sigma-Aldrich) resistance of isolates displaying increased CIP tolerance was determined using microbroth dilution. In short, isolates were grown in TSB containing appropriate concentration of CIP at 35°C with shaking (200 rpm) for 20 ± 2 h. GEN was added (100 µl)   120 to 96-well microtitre plates containing 95 µl TSB and 5 µl of overnight grown culture (1:100 dilution; final concentration corresponding to 2 to 4 x 105 CFU/ml). Final concentrations of GEN were 0.25, 0.5, 1, 2, 4, 8, 16, 32, 64, and 128 µg/ml. The same method was followed for BAC resistance testing, with final concentrations of BAC being 0.31, 0.63, 1.25, 2.5, 5, 7, 10, 20, and 40 µg/ml, as previously described (Rakic-Martinez et al., 2011). Microtitre plates were incubated at 35°C with shaking (150 rpm) for 20 ± 2 h and with OD595nm measured (BioRad). Additionally, a loopful from each well was applied onto TSA plates and incubated overnight at 35°C to confirm the presence or absence of bacterial growth. Sterility and positive controls were included in each microtitre plate. All assays included two biological and two technical replicates for each isolate.   Additionally, following adaptation to high CIP concentrations, AMR disc diffusion assays were repeated for the eight isolates.  4.2.6 Statistical analysis Fisher’s exact test was used to assess the differences among L. monocytogenes 1/2a and 4b serotypes exhibiting resistance or reduced susceptibility to CIP. Results were considered significant when p was <0.05. Data were analyzed using GraphPad Prism 6.0  (GraphPad Software, La Jolla, California, USA) software.  4.3 Results 4.3.1 Antimicrobial resistance of Listeria spp., and L. monocytogenes serotypes All examined strains were sensitive to AMK, AMP, ERY, GEN, IPM, KAN, TMP, SXT and VAN, and resistant to NAL (Figure 4-1). Additionally, Listeria species other than   121 L. monocytogenes were sensitive to LZD, RIF, and STR (Figure 4-1A, B, D). Resistance of L. monocytogenes and other Listeria isolates, respectively, to FOX (98% vs. 89%), CIP (7% vs. 4%), CLI (36% vs. 60%), and TET (5% vs. 7%) was observed, as was RSC to CIP (68% vs. 60%) and CLI (63% vs. 40%). Reduced susceptibility in L. monocytogenes was also seen for LZD (5%), RIF (2%) and STR (5%) (Figure 4-1C), and to CHL for 7% of other listeriae (Figures 4-1A, B, D). FOX resistance was observed among all four species, while CIP resistance was observed only in L. monocytogenes and L. seeligeri, and TET resistance in L. innocua and L. monocytogenes.   Whereas similar AMR profiles for 1/2a and 4b serotypes were observed for LZD and STR, L. monocytogenes belonging to 1/2a were more frequently resistant or exhibited RSC to CIP (19/21) compared to 4b (11/21) (p=0.015); no significant differences were observed when 1/2a was compared to other serotypes. CLI, FOX, and NAL resistance was similar among all serotypes, while RSC to RIF was seen only in a single 1/2c isolate (Table 4-3).    122  Figure 4-1. Antimicrobial resistance of (A) L. innocua, (B) L. seeligeri, (C) L. monocytogenes, and (D) L. welshimeri isolated from foods and food processing environments in British Columbia.     123  Figure 4-1. Continued.   124 Table 4-3. Breakdown of L. monocytogenes isolates of different serotypes, resistant and with reduced susceptibility to antimicrobial agents. Numbers in brackets represent percentage of isolates within each serotype group resistant or with reduced susceptibility to respective antibiotics. Antimicrobial Agents Number of L. monocytogenes (%) 1/2a  (n=21) 1/2b  (n=2) 1/2c  (n=8) 3a  (n=4) 4b  (n=21) Resistant      Ciprofloxacin 3 (14) 0 0 0 1 (5) Clindamycin 11 (52) 2 (100) 1 (13) 0 6 (29) Cefoxitin 20 (95) 2 (100) 8 (100) 4 (100) 21 (100) Nalidixic Acid 21 (100) 2 (100) 8 (100) 4 (100) 21 (100) Tetracycline 3 (14) 0 0 0 0 Reduced Susceptibility      Ciprofloxacin 16 (76) 2 (100) 8 (100) 2 (50) 10 (48) Clindamycin 10 (48) 0 7 (88) 4 (100) 14 (67) Linezolid 1 (5) 0 0 0 2 (10) Rifampin 0 0 1 (13) 0 0 Streptomycin 1 (5) 0 0 0 2 (10)   4.3.2 Antimicrobial resistance of L. monocytogenes from different sources Resistance to FOX, CLI, and NAL was observed for L. monocytogenes isolates regardless of whether they were recovered from food or the processing environment. Additionally, among isolates recovered from FPE and RTE food, respectively, 7% and 10% were resistant to CIP. With respect to TET, 14% of RTE food isolates were resistant, and no resistance was observed in L. monocytogenes from FPE. Interestingly, a number of TET resistant L. monocytogenes isolates from smoked fish samples originating from a single fish processing facility (f31) were recovered. PFGE analysis (Figure A-1, Appendix A) indicated that the isolates were not clonal in origin, and that they did not possess plasmids that would support   125 possible plasmid-mediated horizontal gene transfer. At this time, reasons for selection and/or maintenance of TET resistance within this facility remain unclear.  With regards to RIF, LZD, and STR, RSC was observed for L. monocytogenes in RUF and RTE foods more commonly than in processing environment samples. Reduced susceptibility to both RIF and STR was only observed in food samples, while isolates with RSC to LZD were recovered from FPE (3%) and RTE foods (10%).  4.3.3 Presence of plasmids in L. monocytogenes isolates Using whole genome sequencing data (Gilmour et al., 2010), primers were designed to genes encoded on plasmids but were absent from the L. monocytogenes chromosome. Of the seven strains screened, the presence of umuC, a putative DNA polymerase V and par in three L. monocytogenes isolates exhibiting resistance or reduced susceptibility to TET, STR, and LZD (Table 4-4) were detected. Plasmids of approximately 13 and 60 or 70 kb were recovered in these strains (Figure 4-2).   In addition, one of the isolates (FF11-1) possessed plasmid mediated bcrB and bcrC genes linked to a BAC resistance cassette (Elhanafi et al., 2010) (Table 4-4).   126 Table 4-4. Plasmid screening of selected L. monocytogenes strains possessing reduced susceptibility or resistance to clinically relevant antibiotics. Strain ID Sero-type Origin AMRa Profile Plasmid  p02 mco p17 umuC p50 traG p62 par p74 cadA p08  ydhK p33  yfiS bcrB-bcrC 08-5578b 1/2a Clinical CIPI, CLIR, FOXR, NALR Yes + + + + + + - -                      FF11-1 1/2a Cold-SSc CIPI, CLII, FOXR, NALR, STRI Yes - + + + - - - + FF14-1 4b Hot-SS CIPI, CLII, FOXR, NALR, LZDI No - - - - - - - - FF45-1 4b Spring wood SS CIPI, CLII, FOXR, NALR, LZDI No - - - - - - - - FF63-1 1/2a Salmon jerky CIPI, CLII, FOXR, NALR, TETR No - - - - - - - - FF65-1 1/2a Shrimp meat CLIR, FOXR, NALR, TETR No - - - - - - - - FF66-1 4b Hot-SS CIPI, CLIR, FOXR, NALR, STRI Yes - + - + - - - - FF67-1 4b Hot-SS CLIR, FOXR, NALR, STRI Yes - + - + - - - - aAntimicrobial resistance, I – intermediate, R – resistant. bControl strain from a clinical isolate, described by Gilmour et al. (2010). cSS, smoked salmon.    127  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65  33  655 Figure 2. Plasmid profiles of three L. monocytogenes isolates possessing resistance or reduced 656 susceptibility to TET, STR, and LZD as separated using pulsed-field gel electrophoresis. Lanes 657 1, 2, and 3 are L. monocytogenes isolates possessing pLM0812 (60 kb), pLM5026 (80 kb), and 658 pLM5578, respectively; Lane 4, 5, and 6 are isolates 10-1547, 10-1574, and 10-1577, 659 respectively; and Lane 7 is a supercoiled DNA ladder. 660  661  Figure 4-2. Plasmid profiles of three L. mon cytogenes isolate  possessing resistance or reduced susceptibility to TET, STR, and LZD, separated using pulsed-field gel electro horesis. Lanes 1, 2, and 3 are L. monocytoge es isolates poss ssing pLM0812 (60 kb), pLM5026 (80 kb), and pLM5578, respectively; Lanes 4, 5, and 6 are isolates FF11-1, FF66-1, and FF67-1, respectively; and Lane 7 is a supercoiled DNA ladder.    4.3.4 Eff ux-medi t d resistance to ciproflox cin among L. monocytogenes strains The addition of reserpine, a known inhibitor of efflux pumps, to TSB containing different concentrations of CIP resulted in 0 to 4-fold changes in MICs for wild type (WT) L. monocytogenes strains (Figure 4-3). While all 4b isolates had lower MICs in the presence of reserpine, the MICs of four 1/2a isolates were not affected, which suggests CIP resistance was mediated by a mechanism(s) other than active efflux.    128    Figure 4-3. The effect of reserpine on L. monocytogenes 1/2a (A) and 4b (B) isolates possessing reduced susceptibility or resistance to ciprofloxacin.      129 For eight isolates that were experimentally adapted to high concentrations of CIP (240 µg/ml), a 4 to 30-fold decrease in MICs was observed in the presence of reserpine when compared to respective WT parental strains, therefore indicating that increased resistance to CIP was primarily attributed to increased efflux (Table 4-5).  Table 4-5. Minimum inhibitory concentration of gentamicin (GEN), benzalkonium chloride (BAC), and ciprofloxacin (CIP) in the absence or presence of reserpine in wild type (WT) L. monocytogenes strains recovered from food processing environments and their respective ciprofloxacin adapted strains (CIPR). Strain ID Typea  Minimum Inhibitory Concentration (µg/ml)  GEN BAC CIP CIP with reserpine CIP fold-change DE25-1 WT 4 7 4 2 2  CIPR 4 10 240 30 8 DE26-1 WT 4 5 2 2 0  CIPR 4 7 240 60 4 DE27-1 WT 4 5 4 2 2   CIPR 4 10 240 30 8 FE13-2 WT 4 5 4 2 2  CIPR 4 5 240 15 16 FE16-1 WT 4 5 2 1 2  CIPR 4 5 30 3.75 8 FF5-1 WT 4 5 2 1 2  CIPR 4 5 240 7.5 32 FE79-1 WT 2 2.5 4 1 4  CIPR 4 5 120 15 8 FF46-1 WT 4 2.5 2 1 2  CIPR 8 5 240 15 16 aWT, wild type; CIPR, adapted to high concentrations of CIP.    130 4.3.5 Antimicrobial profiles of L. monocytogenes strains adapted to high concentrations of ciprofloxacin Following adaptation to CIP (240 µg/ml), antibiograms were examined and subsequently compared to respective parental strains. All WT strains exhibited RSC to CIP and CLI, with the exception of FF46-1 isolate which was resistant to CIP, and DE27-1, which possessed resistance to CLI. Following CIP adaptation, all strains became resistant to CLI, and one of the strains (DE27-1) developed RSC to LZD (Table 4-5).  4.3.6 Gentamicin and benzalkonium chloride resistance of L. monocytogenes strains adapted to high concentrations of ciprofloxacin GEN and BAC resistance was also investigated in the eight CIP-adapted strains. No difference in MICs for GEN was observed in six of the adapted strains (Table 4-5). Two strains, however, had a 2-fold increase in the MIC of GEN (Table 4-5). Moreover, increases in MIC (ranging from 1.4 to 2 times) of BAC were observed for five CIP-adapted strains compared to respective parental strains (Table 4-5).  4.4 Discussion In this study, no resistance to AMP and GEN in different Listeria strains was observed; however, the results showed that a large proportion of Listeria isolates recovered from the B.C. food chain possessed resistance or increased tolerance to antimicrobials that are typically effective against listeriae (Safdar and Armstrong, 2003; Troxler et al., 2000). In addition to AMR to antibiotics for which innate resistance of Listeria has been reported previously (Charpentier and Courvalin, 1999; Hof et al., 1997; Troxler et al., 2000), high   131 levels of CIP and CLI tolerance, especially among isolates recovered from food, were observed. With the widespread usage of antimicrobials in clinical and animal production settings, the recovery of listeriae originating from the food chain that possess concerning levels of AMR may not be surprising (Lungu et al., 2011; Poyart-Salmeron et al., 1992). In fact, the emergence of AMR in Listeria spp. has been anticipated (Poyart-Salmeron et al., 1992). One popular theory is that enterococci and streptococci may transmit mobile plasmids encoding AMR determinants to Listeria spp. in farming environments (Charpentier et al., 1995; Lemaître et al., 1998; Poyart-Salmeron et al., 1992). Furthermore, within FPEs, frequent exposure of persistent strains to biocides may promote strains with increasing tolerance to a spectrum of clinically relevant therapeutic agents (Christensen et al., 2011; Rakic-Martinez et al., 2011).  In general, resistance or RSC to FOX and NAL was not unexpected, as Listeria spp. have been found to be inherently resistant to cephalosporins, and NAL is used as a selective agent during Listeria isolation (Hof et al., 1997; Lyon et al., 2008; Troxler et al., 2000; Wieczorek et al., 2012). Whereas resistance to cephalosporins has been ascribed to low-binding affinity to penicillin-binding proteins present in Listeria spp. cytoplasmic membranes (Hof et al., 1997; Troxler et al., 2000), mechanisms underlying NAL resistance remain difficult to determine. Alterations of the amino acid sequence in the quinolone resistance-determining regions (QRDR) of gyrA, and a no observable impact on MICs following exposure to reserpine suggest mutations in DNA gyrase, or other QRDR regions, contribute to the complex mechanism behind NAL resistance in Listeria spp. (Lampidis et al., 2002).   132  In contrast, RSC to CHL, LZD, RIF and STR was surprising, as listerial strains possessing AMR and RSC are rarely encountered (Charpentier et al., 1995; Morvan et al., 2010; Walsh et al., 2001). Conter et al. (2009) found 3.2% and 1.6% of L. monocytogenes from food and FPEs resistant to LZD and RIF, respectively. In the current study, 5 and 2% of L. monocytogenes tested exhibited RSC to LZD and RIF, respectively, while two isolates (L. innocua, L. welshimeri) originating from the same fish processing facility possessed RSC to CHL. Reasons for CHL, LZD, and RIF RSC in food chain isolates are not clear at this time. However, it is notable that when strains were adapted to high concentrations of CIP, one isolate (DE27-1) originally sensitive to LZD developed RSC.   With regards to CIP, CLI, and TET resistance, different incidences have been reported among Listeria spp., as well as among isolates derived from human clinical and food processing sources. Specifically, no resistance to CIP for L. innocua, low levels among L. monocytogenes (2.2%), and high resistance for L. welshimeri (100%) strains, in all cases of diverse origins (i.e. clinical, animal, food, and environmental), was reported by Davis and Jackson (2009). In contrast, Troxler et al. (2000) grouped L. monocytogenes and L. welshimeri as naturally sensitive to CIP, with only two of 32 (6.3%) strains exhibiting resistance and seven (21.9%) with RSC. Reduced susceptibility to CIP was reported for 80% of L. innocua, L. seeligeri, and L. ivanovii, and 16% were resistant (Troxler et al., 2000). In a recent study from Poland (Korsak et al., 2012), only one of 471 (0.2%) L. monocytogenes from a food processing plant possessed resistance to CIP, while United States (US) (Safdar and Armstrong, 2003) and French (Morvan et al., 2010) studies found resistance in 0 and 0.4% of isolates, respectively. In the current study 7% of L. monocytogenes and 17% of L. seeligeri isolates possessed resistance to CIP, while RSC was highest among L. seeligeri   133 (83%), followed by L. monocytogenes (67%), L. innocua (64%) and L. welshimeri (43%). Intriguingly, RSC or resistance to CIP in L. monocytogenes was more common in 1/2a compared to strains belonging to serotype 4b (p=0.015), a phenomenon that has not been reported or explained elsewhere. Resistance to CIP in L. monocytogenes has been attributed almost exclusively to active export of the drug via efflux-pumps. In particular, the lde gene encoding an efflux pump (Lde) contributes to fluoroquinolone resistance (Godreuil et al., 2003; Lismond et al., 2008). Although lde has also been found in CIP sensitive isolates, resistance is believed to result from increased gene expression (Godreuil et al., 2003; Morvan et al., 2010). Interestingly, QRDR-based mutations do not significantly impact tolerance of L. monocytogenes to CIP (Lampidis et al., 2002).   To investigate whether efflux activity contributed to CIP resistance, cells were exposed to reserpine. Notably, reserpine only marginally decreased the MICs of CIP in WT L. monocytogenes strains, suggesting the efflux pumps were not the sole mechanism conferring CIP tolerance in this experiment. However, when strains were adapted to higher concentrations of CIP, reserpine treatment led to a more pronounced increase in CIP sensitivity, indicating efflux-mediated resistance was the primary means by which high-level resistance was generated (Figure 4-3). Interestingly, MICs of experimentally adapted strains in the presence of reserpine were still above that of respective WT parental strains, suggesting another mechanism(s) contributed to increased CIP resistance. This is supported by the observation that four of 14 1/2a strains did not use active efflux for resistance (Figure 4-3A). Rakic-Martinez et al. (2011) noted that L. monocytogenes strains with high CIP MICs exhibited more significant reduction in MICs in the presence of reserpine compared to strains   134 with lower CIP MICs. As such, increased tolerance to CIP may be largely attributed to efflux pump activity, but additional mechanisms of resistance should be investigated.   Resistance to CLI was observed, particularly in L. welshimeri (100%) (Figure 4-1). Similar to CIP, other studies report varying degrees of CLI resistance across Listeria spp. (Chen et al., 2010; Davis and Jackson, 2009; Troxler et al., 2000). While Chen et al. (2010) observed 85% of Listeria spp. from catfish fillets and processing environments in the US were resistant to CLI, another US study examining strains from human, food, animal, and environmental sources found considerably lower (28%) frequency of resistance (Davis and Jackson, 2009). Clindamycin inhibits bacterial protein synthesis by binding to the 50S ribosomal subunit. This mechanism is similar to those linked to reduced ERY and CHL efficacy, which raises concerns about the potential for cross-resistance to differing antibiotic classes through a common mechanism (Depardieu et al., 2007). While no resistance to ERY was observed in the B.C. isolates tested here, RSC to CHL was observed in two strains (Figure 4-1). Interestingly, when eight strains of L. monocytogenes with RSC to CLI were adapted to high concentrations of CIP, they concomitantly became resistant to CLI, for reasons not fully understood. A 2-fold reduction in MICs to ERY and CLI was demonstrated by Mata et al. (2000), when the mdrL gene was disrupted. This gene encodes for a multidrug efflux transporter in Listeria, suggesting this mechanism of resistance may be shared across antimicrobial classes.   While CIP and CLI resistance have been ascribed to efflux-pumps and 23S ribosomal RNA modifications, resistance to TET stems from the acquisition of tet genes conferring resistance through ribosomal protection or efflux (Charpentier et al., 1995; Poyart-Salmeron et al., 1990; Poyart-Salmeron et al., 1992). Strains resistant to TET in the current study were   135 encountered only among L. innocua (4/22) and L. monocytogenes (3/56) isolates. Charpentier et al. (1995) found TET resistance among 6% of L. innocua and L. monocytogenes strains of clinical, food, and environmental sources isolated worldwide. In the current study, all food L. monocytogenes isolates possessing TET resistance originated from a single fish processing facility. Although this suggests that horizontal gene transfer or clonal dissemination occur within this environment, a lack of plasmids and differing pulsotypes do not support this hypothesis. No TET resistant phenotypes were recovered from environmental sources in this facility. Environmental isolates other than L. monocytogenes resistant to TET were, however, recovered in dairy and meat facilities.   The presence of plasmids in L. monocytogenes has been shown to confer resistance to cadmium and BAC. However, differing reports exist on the role of plasmids in AMR (Earnshaw and Lawrence, 1998; Gilmour et al., 2010; Lemaître et al., 1998; Rakic-Martinez et al., 2011; Romanova et al., 2006). Plasmid-mediated resistance to CHL, ERY, STR and TET in L. monocytogenes has been described by Poyart-Salmeron et al. (1990), as well to TET (Slade and Collins-Thompson, 1990) in L. innocua from raw milk, and different species of Listeria by Charpentier et al. (1995). Among the B.C. isolates examined in this study, three L. monocytogenes strains harbored plasmids exhibiting RSC to STR, but did not possess resistance to TET, CHL or ERY. Additionally, their MICs for BAC were comparable to L. monocytogenes strains not carrying plasmids.   Recently, common mechanisms of listerial resistance to CIP and BAC have been proposed (Rakic-Martinez et al., 2011). To investigate the effect of adaptation to high concentrations of CIP on BAC resistance, eight B.C. L. monocytogenes isolates were examined. These included four 1/2a and four 4b serotypes. Following CIP-adaptation, MICs   136 for BAC were up to two times higher in experimentally adapted strains. This is in accordance with findings reported by Rakic-Martinez et al. (2011), where L. monocytogenes strains selected on CIP (2 µg/ml) exhibited up to three times higher MICs of BAC compared to parental strains. The same phenomenon was seen for L. monocytogenes strains selected on BAC (10 µg/ml), with 4- to 8-fold increases in resistance to CIP (Rakic-Martinez et al., 2011). This could explain in part the differences in CIP susceptibility of clinical isolates described by Safdar and Amstrong (2003) and Davis and Jackson (2009) when compared to Listeria spp. derived from the food production sector described herein. As quaternary ammonium compounds, such as BAC, are commonly employed as sanitizers in food processing facilities, bacterial exposure to sub-lethal sanitizer concentrations is a possibility (e.g., persistent strains). This continuous exposure may lend to selection for progeny possessing increasing sanitizer tolerance, and through similar mechanisms of resistance potentially lead to increased tolerance to clinically relevant antibiotics (Rakic-Martinez et al., 2011).   While Rakic-Martinez et al. (2011) also reported increases in GEN MICs from 8 to 64 µg/ml in strains selected on CIP, the same phenomenon was not observed in the experiments described in this chapter. Of the eight CIP adapted strains, MICs for GEN remained the same for six isolates; only two adapted strains (FE79-1, FF46-1) had increased MICs for GEN (Table 4-5). One notable difference between strains examined by Rakic-Martinez et al. (2011) and the B.C. strains described herein, is that the former study examined strains of clinical origin while in the present study CIP adapted strains originated from dairy and fish FPEs and RTE fish samples. These factors cannot be excluded as contributors to the observed differences in AMR phenotypes resulting from increasing CIP   137 exposure (Buncic et al., 2001; Ragon et al., 2008). Furthermore, two strains examined by Rakic-Martinez et al. (2011) possessed plasmid-mediated resistance to cadmium (cadAC) and BAC (bcrABC). Although no difference in GEN resistance was seen between WT plasmid-harboring and cured strains when adapted to CIP, lower MICs of GEN were observed in plasmid-cured strains than those possessing the plasmid. This observation suggests that plasmid encoded factors contribute to GEN resistance (Rakic-Martinez et al., 2011). Strains used in the current study for CIP-adaptation did not harbor plasmids.  4.5 Conclusions In summary, Listeria isolates recovered from the B.C. food chain showed resistance or RSC to antimicrobials to which Listeria have been historically sensitive. Resistance to antimicrobials commonly used in the treatment of listeriosis (e.g., AMP, GEN, SXT) was not observed. However, it is of concern that a high proportion of food chain-derived Listeria, including 1/2a and 4b L. monocytogenes isolates which are frequently linked to listeriosis, possessed reduced susceptibility and resistance to CLI and CIP. Furthermore, a co-selection of strains with increasing tolerance to BAC, CLI and GEN was demonstrated among B.C. strains. These findings highlight current concerns regarding co-selection phenomena associated with different classes of antimicrobial agents used in clinical and food processing settings. Considering the environmental ubiquity of Listeria in nature, its inevitable occurrence in food processing environments, combined with repeated exposure to biocides, there is a need to improve our understanding of potential pressures that may contribute to co-selection of antibiotic and biocide resistance mechanisms. Knowledge of these phenomena, along with their potential for transmissibility, will aid in developing mitigation strategies   138 permitting effective control of Listeria spp. in food processing environments. This in turn will minimize the potential for development of resistance to clinically relevant antibiotics among food chain-derived L. monocytogenes.     139 Chapter  5: The role of Listeria genomic island 1 (LGI1), in the tolerance of Listeria monocytogenes to antimicrobials and other stresses encountered in the food processing chain  5.1 Introduction Despite efforts made by both the food industry and food safety authorities to prevent microbiological contamination of food, pathogenic microorganisms continue to enter the food supply. In the production of ready-to-eat (RTE) foods, Listeria monocytogenes is of particular concern. This foodborne pathogen tolerates various extrinsic and intrinsic parameters that normally minimize bacterial survival and their proliferation in foods (Farber and Peterkin, 1991). The presence of L. monocytogenes in RTE products is particularly troublesome for vulnerable populations that include pregnant women and their fetuses, the young and the elderly, and people with impaired immune systems. In fact, 20 to 40% of foodborne listeriosis infections that occur in high-risk individuals can lead to fatalities (Clark et al., 2010). Evidence suggests the risk to vulnerable populations may be even higher if virulent strains of L. monocytogenes are encountered in RTE foods (Chen et al., 2006; Orsi et al., 2011).   While some L. monocytogenes strains have enhanced abilities to adapt, grow and persist in the food chain, some have evolved to more effectively evade host immune responses (Orsi et al., 2011; Orsi et al., 2007). Genetic variations among different strains are associated with enhanced bacterial survival in food processing and increased, or attenuated virulence (Orsi et al., 2011). For instance, genetic variations in the inlA gene that encodes for a protein involved in the initial invasion and colonization of the gastrointestinal environment,   140 have been shown to affect virulence of L. monocytogenes (Orsi et al., 2011). In particular, attenuated virulence has been reported for isolates with premature stop codons that lead to formation of truncated InlA proteins (Felicio et al., 2007; Handa-Miya et al., 2007; Jonquieres et al., 1998; Nightingale et al., 2005; Rousseaux et al., 2004). Interestingly, these inlA mutations are not associated with serotype 4b isolates recovered from food processing or clinical isolates, but can be frequently seen among lineage II serotypes (i.e. 1/2a, 1/2c, 3a, 3c) that originate from food processing environments (Felicio et al., 2007; Nightingale et al., 2005; Nightingale et al., 2008; Rousseaux et al., 2004). In addition, serotype 4b isolates have been more frequently associated with meningoencephalitis cases than with blood stream infections (Swaminathan and Gerner-Smidt, 2007), and have been the most common serotype causing pregnancy-associated listeriosis (Clark et al., 2010; McLauchlin, 1990). As such, serotype 4b isolates are considered to be the most virulent among the 13 serotypes of L. monocytogenes (Swaminathan and Gerner-Smidt, 2007).  Differences in the ability of isolates to survive stresses encountered in food processing have also been demonstrated (Arguedas-Villa et al., 2014). Listeria monocytogenes isolated from human clinical samples, foods, and processing environments differ in relative abilities to adapt to cold temperatures, although precise mechanisms that result in different adaptation rates have not been described (Arguedas-Villa et al., 2014; Arguedas-Villa et al., 2010; Tasara and Stephan, 2006). Differences in tolerance and resistance of L. monocytogenes to antibiotics and sanitizers commonly used in food processing environments have also been noted (Jeyasekaran et al., 2000; Lemaître et al., 1998). However, many of these properties are both isolate- and situation-specific. As such, they are not linked to a particular serotype or groupings based on molecular sub-typing (e.g.,   141 clonal complexes defined by multilocus sequence typing, virulence types determined by multi-virulence-locus sequence typing). In fact, data that describe molecular properties of L. monocytogenes which would explain serotype differences in their disease causing potential and the severity, as well as their capacity to survive food processing stresses are presently limited (Swaminathan and Gerner-Smidt, 2007).  In Canada, the majority of human listeriosis cases that were reported between 1994 and 2004 were caused by L. monocytogenes isolates belonging to 1/2a serotype (Clark et al., 2010). In particular, a predominant clone (i.e. 1/2a serotype, CC8, single-locus variants of sequence type 120, PFGE profile LMACI.0001/ LMAAI.0001) has caused outbreaks and sporadic cases of listeriosis across Canada for more than two decades (Knabel et al., 2012). Examination of 1,061 L. monocytogenes isolates collected from 1995 to 2010 revealed the presence of this clone in 22.3% of isolates, with the nationwide distribution believed to have occurred by the mid-1990s. This particular PFGE clone was also linked to RTE deli meats implicated in the nationwide outbreak of listeriosis in 2008 (Gilmour et al., 2010). Isolates associated with this outbreak also possessed a previously unreported genomic island, LGI1 (Figure 1-1, Chapter 1) (Gilmour et al., 2010). Subsequent testing of the 71 human clinical L. monocytogenes isolates collected between 1988 and 2010, revealed the presence of LGI1 in 61% of isolates. However, the prevalence of the island among L. monocytogenes isolates recovered from the food chain is presently unknown.   This 50 kb island was shown to encode a combination of putative antimicrobial resistance, stress response, and virulence genes, thereby possibly enhancing the capacity of L. monocytogenes to survive in the food chain and cause human listeriosis (Gilmour et al., 2010). Ziegler (2012) observed an increase in minimum inhibitory concentrations (MIC) of   142 benzalkonium chloride (BAC) and benzethonium chloride in three isolates possessing LGI1, which suggested a potential role in L. monocytogenes resistance to sanitizers. Furthermore, the presence of genes that are typically involved in stress response, such as a two-component signal transduction system possessing a response regulator (locus 1851) and a sensor histidine kinase (locus 1852), and a putative small RNA polymerase sigma-24 subunit (locus 1859), has indicated that strains possessing LGI1 may be better equipped to survive environmental and/or food processing stresses (Gilmour et al., 2010; Ziegler, 2012). It is also tempting to speculate that the island contributes to virulence, considering that it was found in a number of clinical isolates examined over more than two decades (Knabel et al., 2012). The presence of genes homologous to type IV secretion-like systems (e.g., virB4, virD4, cpa and tad), as well as putative adhesin (i.e. sel1) further supports this idea (Gilmour et al., 2010; Ziegler, 2012); albeit evidence of increased virulence due to LGI1 is currently lacking. In fact, the function of genes located on LGI1, and their contribution to fitness and/or virulence of L. monocytogenes have not yet been confirmed.   Considering the genomic content of LGI1, and its prevalence among human clinical isolates in Canada, the overall objective of this research was to elucidate the contribution of LGI1 to virulence, and the potential role it has in the survival of L. monocytogenes under food chain-relevant conditions. To meet the objectives, research in this thesis chapter was carried out in two phases. Firstly, L. monocytogenes isolates recovered from B.C. foods and food processing environments were screened for the presence of LGI1. The second part of the research investigated the role of specific genes located on LGI1 in the survival of L. monocytogenes under stress-induced conditions (e.g., cold temperatures, acidic and saline conditions, sanitizers), and the adherence to and invasion of human cell lines. The research   143 hypotheses generated are based on the putative functions of the three selected genes. These included:  (H1) emrE contributes to enhanced tolerance of L. monocytogenes to antibiotics;  (H2) emrE contributes to enhanced tolerance of L. monocytogenes to quaternary ammonium compounds (QAC) and a cationic dye, acriflavine;  (H3) regulator gene lmo1851 contributes to enhanced survival of L. monocytogenes in acidic pH;  (H4) regulator gene lmo1851 contributes to enhanced survival of L. monocytogenes in cold temperature; (H5) regulator gene lmo1851 contributes to enhanced survival of L. monocytogenes in high salt environments; and  (H6) sel1 contributes to the increased adherence and invasiveness of L. monocytogenes in vitro.   5.2 Materials and methods 5.2.1 Bacterial strains The list of L. monocytogenes (n=56) strains used for LGI1 screening is presented in Table B-1 (Appendix B), and strains are described in detail in Chapter 3.   All LGI1 deletion mutants were generated in L. monocytogenes 08-5578, a clinical strain responsible for the Canadian deli meat listeriosis outbreak in 2008 which does not possess genes that encode previously described small efflux pump systems (e.g., bcrABC and qacH) (Gilmour et al., 2010). Bacterial strains and plasmids used for mutant generation are listed in Table 5-1. Additionally, when phenotype changes in mutants were observed, other   144 strains possessing LGI1 (CC8+/LGI1+, n=8), strains from clonal complex 8 (CC8) that do not possess LGI1 (CC8+/LGI1-, n=4), and strains belonging to serotype 1/2a, but that are not part of CC8 and do not possess LGI1 (1/2a CC8-/LGI1-, n=2) were exposed to identical conditions to investigate whether the same growth behavior was seen across unrelated strains possessing LGI1 (Table 5-1). Listeria monocytogenes EGD-SmR (Gaillard et al., 1986) and 81-0861 (Knabel et al., 2012) strains were used as negative LGI1 serotype 1/2a and 4b controls, respectively.   All media used were from Difco (Difco, Becton Dickinson, Sparks, MD) unless otherwise indicated. Strains and transformants were stored long-term at -80°C in tryptic soy broth (TSB; Acumedia, Neogen, Lansing, MI, US) supplemented with 20% (wt/vol) glycerol (L. monocytogenes), or Luria-Bertani (LB; Difco) broth with 20% glycerol (Escherichia coli). Prior to use, L. monocytogenes strains were recovered from a frozen stocks on tryptic soy agar (TSA; Acumedia) that was supplemented with 0.6% yeast extract (YE; Thermo Fisher Scientific, Ottawa, ON), while E. coli strains were recovered on LB agar, followed by 24 h incubation at 37°C. With the exception of specific sanitizer stress survival studies, which were performed in TSB, brain heart infusion (BHI; Difco) broth was used to grow L. monocytogenes strains prior to stress experiments. Specific conditions are described below for each stress treatment. Recovery of survivors following stress conditions was performed on TSA-YE, incubated at 37°C for 24 to 48 h.      145 Table 5-1. Bacterial strains and plasmids used in experiments. Strains/ plasmids used Description LGI1a Reference Strains used in mutant constructs   L. monocytogenes    08-5578 Wild type, clinical strain (Ontario), serotype 1/2a, CC8 + Gilmour et al. (2010) 08-5578:Δlmo1851 08-5578 with 408 bp in-frame deletion within lmo1851 gene  Δlmo1851 This study 08-5578:ΔemrE 08-5578 with 240 bp in-frame deletion within emrE gene ΔemrE This study 08-5578:Δsel1 08-5578 with 2598 bp in-frame deletion within sel1 gene Δsel1 This study E. coli    DH5-α DH5-α with pKSV7 - Ziegler (2012) One Shot® TOP10 F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL(StrR) endA1 nupG - Invitrogen TOP10:Δlmo1851 TOP10 carrying pKSV7 with 08-5578 lmo1851 insert with deletion Δlmo1851 This study TOP10:ΔemrE TOP10 carrying pKSV7 with 08-5578 emrE insert with deletion ΔemrE This study TOP10:Δsel1 TOP10 carrying pKSV7 with 08-5578 sel1 insert with deletion Δsel1 This study Plasmids used for mutant constructs   pKSV7 Gram-positive and Gram-negative temperature sensitive shuttle vector; CHLR (L. monocytogenes); AMPR  (E. coli) multiple cloning sites; lacZ; β-lac; cat, pE194tsb  Smith and Youngman (1992) pKSV7:Δlmo1851 pKSV7 with 08-5578 lmo1851 insert with deletion  This study pKSV7:ΔemrE pKSV7 with 08-5578 emrE insert with deletion  This study pKSV7:Δsel1 pKSV7 with 08-5578 sel1 insert with deletion  This study Other L. monocytogenes strains used in stress experiments   01-1465 Clinical, human blood (Ontario);  1/2a serotype, CC8c + Knabel et al. (2012) 01-2417 Clinical, human blood (British Columbia); 12/a serotype, CC8 + Knabel et al. (2012) 01-7210 Liverwurst sausage (British Columbia), 1/2a serotype, CC8 + Knabel et al. (2012) 02-4056 Clinical, human blood (Ontario); 1/2a serotype, non CC8 - Knabel et al. (2012) 03-0402 Clinical, human blood (Alberta); 1/2a serotype, CC8 + Knabel et al. (2012) 06-6956 Clinical, human blood (Quebec); 1/2a serotype, non CC8 - Knabel et al. (2012) 08-6040 RTE meat (Ontario); 1/2a serotype, CC8 + Knabel et al. (2012)    146 Table 5-1. Continued. Strains/ plasmids used Description LGI1a Reference 95-0093 Clinical, human blood (Alberta); 1/2a serotype, CC8 + Knabel et al. (2012) 95-0151 Clinical, human blood (Ontario);  1/2a serotype, CC8 + Knabel et al. (2012) 99-3046 Clinical, human blood (Ontario);  1/2a serotype, CC8 - Knabel et al. (2012) 01-5373 Clinical, human blood (Ontario);  1/2a serotype, CC8 - Knabel et al. (2012) 03-5833 Clinical, human blood (Alberta); 1/2a serotype, CC8 - Ziegler (2012) 08-5375 Clinical, human blood (Ontario); 1/2a serotype, CC8 - Knabel et al. (2012) LR39-1 RTE fish (British Columbia); 1/2a serotype, CC8 + This study Controls    EGD-SmR EGD derivative resistant to streptomycin; 1/2a serotype, non CC8 - Gaillard et al. (1986) 81-0861 Coleslaw (Nova Scotia); 4b serotype - Knabel et al. (2012) aListeria genomic island (LGI1) present (+) or absent (-). bThermosensitive replication origin of plasmid pE194. cCC8, clonal complex 8; based on multilocus sequence typing.   5.2.2 Screening for LGI1 Conventional polymerase chain reactions (PCR) were used to screen for the presence of the 50 kb LGI1. Briefly, four sets of primers were used for screening, targeting loci 1859, 1861, 1862, and 1901 (Table 5-2). DNA was isolated from overnight cultures grown on TSA (Acumedia). A single colony was resuspended in 100 µl of 1 x Tris-EDTA buffer, heated at 90°C for 10 min, cooled on ice for 2 min, and spun at 16,000 x g for 5 min. PCR reactions (25 µl), using 5 U of AmpliTaq Gold 360 DNA polymerase (Applied Biosystems, Life Technologies, Carlsbad, California, USA), 0.4 µM of respective primers, 200 µM dNTPs (Invitrogen Canada Inc., Burlington, ON), and template DNA (1 µl) were cycled as follows: 95°C for 5 min; 35 cycles of 94°C for 30s, 52°C for 30 s and 72°C for 20 s; followed by 72°C for 5min. Images of ethidium bromide-stained bands were visualized on 1% agarose gel using Image Master VSD (Amersham Pharmacia Biotech, Uppsala, Sweden). Listeria   147 monocytogenes 08-5578 (Gilmour et al., 2010) strain obtained from the Canadian National Microbiology Laboratory was used as a positive control.  Table 5-2. Oligonucleotide primers used in experimentsa. Primer (Tm)b PCR conditions and oligonucleotide sequence (5’–3’)c Product size (bp) Digestion enzymes Primer effic. (%) LGI1 screening 95°C for 5 min; 35 cycles of 94°C for 30s, 52°C for 30 s and 72°C for 20 s; followed by 72°C for 5 min.    LGI1-1859-F (57°C) AAG  AGC  GCG  AAG  CTG  AAA  GAT  A 77 N/Ad N/A LGI1-1859-R (55°C) CCT  CAT  CTT  GGA  ATC  GTT  CCA   LGI1-1861-F (52°C) GAT  ACT  GGC  GAA  AGC  TTC  TA 316 N/A N/A LGI1-1861-R (50°C) GGT  TTC  GGG  TTA  ATG  ATG  TA   LGI1-1862-F (53°C) GAG  CAA  CAC  CAC  CTA  AGT  TC 299 N/A N/A LGI1-1862-R (52°C) CAG  TCG  CTA  TCG  TAC  TTG  AA   LGI1-1901-F (55°C) TGA  TCC  GCC  GTA  TTA  GCA  AAC 69 N/A N/A LGI1-1901-R (59°C) AAG  CCG  TGC  ATG  ATC  TTC  CT   Mutant construction     emrE 95oC for 2 min; 30 cycles of 95oC for 30 s, 50oC for 30 s, and 72oC for 1.7 min, followed by 72oC for 10 min. 1588 (AD)  N/A SOE-A CCC CTG CAG AGA CCC TCG GCT TTG CGT CC 881 (AB) PstI  SOE-B GCA GGG GTT GTA GGC CTG AAC    SOE-C GTT CAG GCC TAC AAC CCC TGC AAG TTC AAG TAC GAT AGC GAC 707 (CD)   SOE-D CCC GGT ACC GAT GGC GTG AAA ACG GCG GC  KpnI  emrE-XF GCC ACA AAA GGG CAG GTT    emrE-XR TAA AGC TCT CCC GCA GTA CC    lmo1851 95oC for 2 min; 30 cycles of 95oC for 30 s, 52oC for 30 s, and 72oC for 1.3 min, followed by 72oC for 2 min.  1083 (AD)  N/A SOE-A CCC CTG CAG ATC CAT TAG AGC ATC AAT TTG 537 (AB) PstI  SOE-B TTA CTA AAA GAA ATC AGT TCT    SOE-C AGA ACT GAT TTC TTT TAG TAA ATT AGC CAC TTC ATC TTC TAT 546 (CD)   SOE-D CCC GGT ACC CAT TAT AGC AAC TTG ATT GTG  KpnI    148 Table 5-2. Continued.  Primer (Tm)b PCR conditions and oligonucleotide sequence  (5’–3’)c Product size (bp) Digestion enzymes Primer effic.  (%) Mutant construction    sel1 95oC for 2 min; 35 cycles of 95oC for 30 s, 58oC for 30 s, and 72oC for 1.5 min, followed by 72oC for 10 min. 3603 (AD)  N/A SOE-A GG TCT AGA GCT GCT TGA TGA GGT ATG C 501 (AB) XbaI  SOE-B GCA TTC CAC ATT GAC CGC    SOE-C GCG GTC AAT GTG GAA TGC CGG TAA CAG TAG CTT GCT ATC ATC 504 (CD)   SOE-D GG GGT ACC ACA TGA GCC TAT CAG AAT TAA CCC  KpnI  sel1-XF CAT CTA CAC CGA CAA ATA CCG CA    sel1-XR GCA ATC TTG TGC GAG TCT TTC    Quantitative real-time PCR (qRT-PCR) primers    16S rRNA-Fe TTA GCT AGT TGG TAG GGT 318  91.3 16S rRNA-R AAT CCG GAC AAC GCT TGC    emrE-JKq-F GTT GCT ATA GCG GTG ATT GGA GT 102  104.3 emrE-JKq-R GTT CAG GCC TAC AAC CCC TG    lde-JKq-F TCC CAA TGG CTT TCG CAC AA 136  99.4 lde-JKq-R ATT CGA CCT GCA ACC TCA CG    lmo1861-JKq-F GCT TAC AGA AGA AGG AGC GCA 101  99.6 lmo1861-JKq-R CCC TAC GTT GTT CCT GCG G    mdrL-JK2q-F TCG AGC TGG TTG GGG TTT TG 96  97.1 mdrL-JK2q-R ATC CCA ATT GCA TGG CCT GG    sigBq-Ff TGT TGG TGG TAC GGA TG 221  100 sigBq-R CAT TCT GCA ACG CCT C    aAll primers were synthesized by Integrated DNA Technologies, Inc. (Coralville, Iowa, US). bTm, melting temperature in °C. cEndonuclease restriction sites are underlined; regions complementary to SOE-B primers are italicized. dN/A, not applicable. ePrimers validated by Tasara and Stephan (2007). fPrimers designed by Arguedas-Villa et al. (2010).   149 5.2.3 Preparation of L. monocytogenes competent cells A single colony of Listeria monocytogenes 08-5578 was used to inoculate 5 ml of BHI (16 x 150 mm tubes), incubated overnight at 37°C with shaking (200 rpm). Fresh BHI (50 ml) in a 250 ml flask was inoculated with the overnight culture (500 µl), and subsequently incubated at 37°C with shaking, until cells reached OD600 of 0.2 (BioRad iMark! Microplate Absorbance Reader, Hercules, CA, US). Penicillin G (50 µl of 100 mg/ml stock; Sigma-Aldrich, Oakville, Ontario) was added to the culture, which was incubated for additional 2 h at 37°C with shaking (200 rpm). Following incubation, the culture was chilled on ice for 15 min, transferred to four centrifuge tubes (15 ml; Corning™ Polypropylene, Fisher Scientific, Ottawa, ON) and spun at 5,939 x g (Eppendorf 5415 R) for 1 min at 4°C. The supernatant was discarded, and 1.2 ml of HEPES (1 mM; Sigma-Aldrich) with sucrose (0.5 M; Sigma-Aldrich) and glycerol (10% wt/vol; Fisher Scientific) was added to each tube. The contents were gently mixed with a pipet and were spun at 5,939 x g. Supernatants were discarded, and the resulting pellets were re-hydrated with 100 µl of HEPES/sucrose/glycerol solution. Competent cells were used immediately or were stored at -80°C until used.  5.2.4 Generation of deletion mutants Non-polar deletion mutants of putative regulator (lmo1851; locus 1851), adhesin (sel1; locus 1866), and efflux-pump (emrE homolog; locus 1862) genes were generated in L. monocytogenes 08-5578, using the allelic exchange protocol described by Camilli et al. (1993). In summary, splicing by overlap extension (SOE) PCR was used to excise the desired sequences. A list of oligonucleiotide primers, thermocycling conditions, and restriction endonucleases used is provided in Table 5-2. The procedure is based upon removing a   150 portion of sequence between two flanking sequences, followed by splicing of the two flanking regions together. PfuTurbo CX DNA polymerase 2.5 U (Agilent Technologies Inc., Mississauga, ON) was used in all PCR reactions according to the manufacturer’s instructions, with 0.4 µM of each oligonucleotide primer and L. monocytogenes 08-5578 genomic DNA, isolated with the DNeasy Blood and Tissue kit (Qiagen), used as a template. SOE oligonucleotide primers (A and B) were designed to amplify appropriate DNA fragments (Table 5-2) at the 5’ end of the gene of interest. The primer SOE-A included a 5’ restriction endonuclease site. SOE-C and SOE-D primers were designed to amplify appropriate DNA fragments at the 3’ end of the gene of interest. SOE-C primer included an overhang complementary to the primer SOE-B, and SOE-D primer included a second restriction endonuclease site. PCR fragments (e.g., SOE-AB, and SOE-CD) were purified using the QIAquick PCR Purification kit (Qiagen, Toronto, ON), and subsequently used as templates in a PCR reaction with SOE-A and SOE-D primers. Resulting SOE-AD PCR product was electrophoresed (Bio-Rad Horizontal Electrophoresis System) on a 1% agarose gel (Fisher Scientific), and ethidium bromide-stained bands were visualized using Image Master VSD (Amersham Pharmacia Biotech, Uppsala, Sweden) to confirm the presence of a single band of appropriate size. When more than one band was present, the band of the appropriate size was cut out from the agarose gel and further purified using the QIAquick Gel Extraction kit (Qiagen). SOE-AD PCR product and pKSV7 were purified with QIAquick PCR Purification kit (Qiagen), digested with appropriate endonucleases (FastDigest, Fisher Scientific; Table 5-2), and confirmed by running on a 1% agarose gel stained with ethidium bromide (Image Master VSD). Once confirmed, products were purified once more, and SOE-AD PCR product was ligated (T4 ligase, Thermo Scientific) into a suicide shuttle vector pKSV7   151 (Cornell University, Ithaca, NY), which can be expressed in both Escherichia coli and L. monocytogenes (Camilli et al., 1993; Smith and Youngman, 1992). The vector containing the gene of interest was first inserted into E. coli and subsequently electroporated (details described below) into L. monocytogenes. Escherichia coli transformants were selected on LB agar plates containing 100 µg/ml of ampicillin (AMP100; Sigma-Aldrich). Plasmids were obtained from E. coli using GeneJET Plasmid Miniprep Kit (Thermo Scientific). They were sequenced at the Nucleic Acid Protein Service Unit (NAPS) at the University of British Columbia with NAPS-prepared primers (-21M13 and M13R) to confirm the absence of nucleotide deletions and polymorphisms, and subsequently electroporated into competent L. monocytogenes 08-5578 cells. Following the electroporation procedure (described in section 5.2.5), L. monocytogenes were grown on BHI agar plates containing chloramphenicol (10 µg/ml; CHL10), at 30°C. Strains were incubated at this temperature for two days, to promote plasmid replication and integration into the chromosome. Colonies with CHL resistance were used to inoculate BHI broth (5 ml) containing CHL10, and incubated overnight at 37°C, with shaking (100 rpm). Following incubation, 50 µl of culture was used to inoculate 5 ml of fresh BHI broth containing CHL10. Cultures were incubated at 40°C with gentle shaking (100 rpm), and passaged (1:100 dilution) in BHI broth containing CHL10 up to 10 times, forcing the insert carried by pKSV7 to homologously recombine with the cell’s wild type (WT) gene. A second round of passaging (10 to 20 times) in BHI broth without CHL was performed at 30°C (with shaking, 100 rpm), to promote recombination where cells revert to WT phenotype or become mutants. Screening for vector excision was performed by replica plating on BHI plates, and BHI plates containing CHL10. PCR amplification with SOE-A and SOE-D primers was used to confirm the allelic exchange. Mutants were sequenced at NAPS   152 (University of British Columbia) using SOE-A and SOE-D (lmo1851), or XF and XR primers (emrE, and sel1).   5.2.5 Electroporation Competent cells were thawed on ice. Purified plasmid construct (2 µg) was added to 50 µl of One Shot® TOP10 Chemically Competent E. coli cells (Invitrogen), and 100 µl of competent L. monocytogenes 08-5578 cells, mixed and transferred to a pre-chilled (ca. -20°C) cuvette (0.1 cm; Bio-Rad, Hercules, CA). Electroporation was performed using a BioRad Gene Pulser (Bio-Rad, Hercules, CA, US) set to 1.1 kV pulse. Immediately following the treatment 250 µl of S.O.C. medium (Invitrogen) was added to the cuvette containing E. coli, and 1 ml of BHI containing 0.5 M sucrose (Sigma-Aldrich) was added to the cuvette containing L. monocytogenes. Contents were transferred to 1.5 ml sterile tubes (Eppendorf Safe-Lock Tubes™, Fisher Scientific, Ottawa, ON) and incubated at 37°C with shaking (E. coli) to allow expression of the antibiotic resistance gene, or tubes were placed on ice for 5 min (L. monocytogenes), followed by static incubation at 30°C, for up to two hours. Electroporated cells were spread (10 to 150 µl) onto pre-warmed LB plates containing AMP100 (E. coli) or BHI plates containing CHL10 (L. monocytogenes), and incubated at 37°C, overnight. Colonies were confirmed by PCR and appropriate SOE-A and SOE-D primers.   5.2.6 Antimicrobial agents  The list of compounds and concentrations used in experiments is provided in Table 5-3. Antimicrobial agents used in the study included antibiotics: chloramphenicol, ciprofloxacin, erythromycin, gentamicin, and tetracycline; quaternary ammonium compounds (QAC) such   153 as E-San® 10%, a sanitizer containing 5% N-alkyl dimethyl benzyl ammonium chloride (Epsilon Chemicals Ltd, Edmonton, AB), and a benzalkonium chloride (BAC) with alkyl distribution from C8H17 to C16H33 (Acros Organics, New Jersey, US). Other antimicrobial compounds tested included acriflavine (Sigma-Aldrich), a cationic dye used in enrichment media during isolation of Listeria spp.; triclosan [Irgasan, 5-Chloro-2-(2,4-dichlorophenoxy) phenol; Sigma-Aldrich], a broad spectrum antimicrobial agent that inhibits enoyl-acyl-carrier protein reductase in fatty acid synthesis (Russell, 2004); and reserpine (Sigma-Aldrich), an efflux pump inhibitor (Godreuil et al., 2003). Antibiotic stock solutions were prepared according to manufacturer’s instructions, and stored at -20°C for up to two months. Other antimicrobial agents were stored according to the manufacturer’s recommendations (i.e. at 4°C or at room temperature). Working solutions of water-soluble agents (1,000 ppm) were prepared by diluting the concentrated sanitizers in sterile distilled water on the day of the experiment. These were stored at 4°C, and used within 3 h of preparation. CIP was dissolved in dimethyl sulfoxide (DMSO; 1 ml) and sterile deionized water (9 ml), while triclosan was dissolved in 70% ethanol (1 ml of 10,000 ppm transferred to 9 ml of 70% ethanol). A working solution of reserpine (10,000 ppm; Sigma-Aldrich) was prepared in DMSO with 20 µl added to bacterial cultures (total volume 10 ml in TSB). The highest volumes of DMSO used for dissolving CIP and reserpine, and 70% ethanol used for dissolving triclosan, were applied as controls to check for the diluent effect.   5.2.7 Minimum inhibitory concentrations Minimum inhibitory concentration (MIC) of antimicrobials and other compounds listed in Table 5-3 were determined using a slightly modified agar dilution method (e.g., antibiotics,   154 and QACs) described by Elhanafi et al. (2010), and microbroth dilution protocol (e.g., acriflavine and triclosan). Briefly, for the agar dilution method, strains were applied to Mueller-Hinton agar (MHA-B; 1.2% agar, Difco) supplemented with 5% defibrinated sheep blood (Alere Inc., Ottawa, ON), and incubated at 37°C overnight. Two colonies were transferred into 200 µl of Mueller-Hinton broth (Difco), and 5 µl of the suspension was spotted in duplicate onto MHA-B plates containing appropriate concentrations of antimicrobials/other compounds. Following 48 h incubation at 30°C, MICs were determined as the lowest assessed concentration that prevented confluent growth.    Table 5-3. List of antimicrobial agents used in experiments.  Antimicrobial agenta (abbreviation) Concentrations tested (ppm)b Antibiotics  Chloramphenicol (CHL) 2.5, 5, 10, 15, 20 Ciprofloxacin (CIP)) 2.5, 5, 10, 15, 20 Erythromycin (ERY) 1, 2.5, 5, 10, 15 Gentamicin (GEN) 1, 2.5, 5, 10 Tetracycline (TET) 2.5, 5, 10, 15, 30 Quaternary ammonium compounds (QAC)  Benzalkonium chloride (BAC) 5, 10, 20, 25, 20 E-San 2.5, 5, 10, 15, 20 Other compounds  Acriflavine 12, 16, 20, 24 Triclosan 1, 2, 4, 8 Reserpine 20 aAll antibiotics, acriflavine, and triclosan came from Sigma-Aldrich. bppm, parts per million, equivalent to µg/ml.    For MIC determination using the microbroth dilution method, strains were grown in 5 ml of TSB (16 x 150 mm tubes) at 30°C with shaking (200 rpm) for 16-18 h. Following incubation, strains were diluted 1:100 in TSB (final volume 10 ml) and exposed to different concentrations of each antimicrobial agent (Table 5-3) in 96-well plates (Costar®, Corning®   155 Inc., Corning, NY, US), in duplicate. Plates were incubated at 30°C in a SpectraMax M2 (SoftMax Pro 6.3 version software; Molecular Devices, Sunnyvale, California) plate reader, with OD600 measured at 30 min intervals for 24 h. MICs were defined as the lowest concentration that prevented growth. All MIC experiments were performed at least three times.  5.2.8 Growth in the presence of sub-lethal concentrations of antimicrobials Growth of L. monocytogenes in the presence of sub-lethal concentrations of E-San (0.78 and 1.56 ppm), and BAC (1 and 2 ppm), with (20 ppm) or without reserpine (efflux inhibitor) was assessed in a SpectraMax (Molecular Devices, Sunnyvale, California) plate reader at 30°C. Briefly, single colonies were inoculated into 5 ml of TSB (16 x 150 mm tubes) and incubated at 30°C, with shaking (200 rpm). Following 16 h incubation, cultures were diluted 1:100 in TSB containing appropriate concentrations of antimicrobials/compounds. Aliquots (200 µl) for each strain and treatment were transferred in duplicate into specified wells of a 96-well plate. The OD600 levels were monitored at 30 min intervals for 24 h. The OD600 data were fitted to growth curves to obtain the lag phase duration (LPD) and maximum growth rates (MGR), using the DMFit 3.0 Excel add-in program (ComBase, Computational Microbiology Research Group, Institute of Food Research, Colney, Norwich, UK), based on the models by Baranyi and Roberts (1994). Experiments were performed at least three times. Blank controls containing TSB, or TSB with appropriate concentrations of the tested antimicrobial were included in each run and these OD600 values were subtracted from the OD600 values for strains containing respective treatments. The relationship between OD600 measurements and viable cell numbers of the WT L. monocytogenes 08-5578 and deletion   156 mutant strains was derived from counts obtained by the spread plate method on TSA-YE at seven time points (i.e. 0, 1, 3, 5.5, 8, 10, and 24 h) representing early logarithmic, late logarithmic and late stationary growth phases at 30°C.  5.2.9 RNA isolation and cDNA preparation Listeria monocytogenes WT strain was grown in 25 ml of TSB (50 ml tubes; Corning) at 30°C, with shaking (200 rpm). After 14 h incubation 5 ml of the culture were transferred to a sterile 10 ml tube and BAC was added to achieve a 10 ppm concentration; 5 ml were retained as a control. Following 1 h incubation at 30°C with shaking (200 rpm) the cultures were used directly for RNA extraction using the RNA PowerSoil® total RNA isolation kit (MO BIO Laboratories, Inc., Carlsbad, California). Recovered RNA samples were treated with RTS DNase™ (MO BIO), and immediately placed at -80°C or converted to cDNA using the QuantiTect® Reverse Transcription kit (Qiagen, Toronto, ON). RNA was quantified and checked for quality with a spectrophotometer (NanoDrop ND1000, Thermo Scientific, Toronto, ON) and by gel electrophoresis.   5.2.10 Gene expression Quantitative real-time PCR (qRT-PCR) assays examining transcript levels of two known efflux pumps in Listeria (e.g., lde and mdrL), sigB, and LGI1 encoded emrE, lmo1851 and lmo1861 were performed following 1 h exposure of L. monocytogenes 08-5578 strain to 10 ppm BAC. The list of primers used and their efficiencies are provided in Table 5-2. Primers were designed using Geneious 5.4 software (Biomatters Ltd., Aukland, New Zealand) and optimized to achieve specific target gene amplification (product with a single melting peak)   157 and PCR efficiency between 97 and 105% (Table 5-2). cDNA templates derived from L. monocytogenes 08-5578 treated with BAC (10 ppm) for 30 min were used in PCR optimization and amplification efficiency evaluation. Reactions were carried out in a final volume of 20 µl containing 1 µl cDNA template, 10 µl SsoAdvancedTM SYBR® Green Supermix (Bio-Rad), and 0.25 µM forward and reverse oligonucleotides (Table 5-2). Thermocycling conditions included initial denaturation at 95°C for 3 min, followed by 39 cycles at 95°C for 10 sec, 56°C for 5 sec, 72°C for 12 sec, melting curve measurement (65 to 95°C by 0.5°C increments, for 5 sec), and cooling (4°C), using CFX96 Touch™ Real-Time PCR Detection System (BioRad). Target gene transcript levels were quantified using CFX Manager™ Software 3.1 (BioRad), and normalized to the levels of 16S rRNA housekeeping reference gene (Tasara and Stephan, 2007). Cycle threshold (Ct) standard deviation (SD) for all genes was ≤0.3. Gene expression fold change reported represents the means and standard deviations based on three independent assays and each sample run in duplicate.  5.2.11 Adhesion and invasion assays The adhesion and invasion efficiency of L. monocytogenes 08-5578 (WT) and its Δsel1 mutant were assessed according to the protocol described in Chapter 3, section 3.2.4, with slight modifications. Briefly, TC-7 subclone of Caco-2 cells (Chantret et al., 1994), kindly provided by Dr. Monique Rousset (Centre de Recherche des Cordeliers, Paris, France) via Dr. Catherine Jumarie (Université du Québec à Montréal, Canada), and HeLa (ATCC® CCL-2™) cells (1x105 cells per well; passages 5 to 20) were cultured in vented cap, tissue culture treated flasks (growth area 75 cm2; Falcon™, Fisher Scientific, Ottawa, ON) containing 30 ml of Dulbecco’s modified Eagle’s minimum essential medium (DMEM) (HyClone;   158 Thermo Scientific, Toronto, ON) supplemented with 10% inactivated fetal calf serum (Gibco, Life Technologies, Burlington, ON), 1% nonessential amino acids (Gibco), and 1% Gluta-MAX (Gibco) for two days (5% CO2, 37°C) to reach confluence (i.e. non-differentiated cells). Bacterial cultures grown statically overnight in BHI (5 ml; 16 x 150 mm tubes) at 30°C were pelleted by centrifugation (5,939 x g at 22°C; Eppendorf 5415 R), washed once, resuspended in 1x Dulbecco’s phosphate-buffered saline (DPBS) (HyClone) with magnesium and calcium, and adjusted to an optical density at 600 nm (OD600) of 0.5 (Genesys 10UV; Thermo Spectronic, Rochester, NY, US). Prior to infection, bacterial cultures were diluted in DMEM to approximately 5 x106 CFU/ml, as assessed by counts obtained by the spread plate method on TSA-YE. Bacterial suspensions (0.5 ml) were added to Caco-2 and HeLa cells and incubated at 37°C for 30 min or 1 h to allow bacterial adherence and entry, respectively. Infected cells were then washed three times with DPBS, and lysed with sterile ice-cold water for 10 min at 37°C (adhesion) or overlaid with fresh pre-warmed DMEM containing gentamicin (50 mg/l), and incubated at 37°C for 45 min (invasion). Following gentamicin treatment, the cell monolayers were washed three times with DPBS and lysed with sterile ice-cold water for 10 min at 37°C.   The number of viable bacteria was quantified by spreading direct inoculum and serial dilutions (10-1 to 10-4) in DPBS onto TSA-YE plates, incubated at 37°C for 24 to 48 h. Adhesion was reported as average log10 CFU/ml, where starting inoculum and recovered cells for each strain were normalized to those of the WT strain. The invasion efficiency was reported as the percentage of the inoculum recovered by the enumeration of intracellular bacteria, normalized to 08-5578 strain (i.e. set at 100%). Listeria monocytogenes BUG5 (Tn1545-induced inlA mutant from EGD-SmR) (Gaillard et al., 1986), and 10403S, kindly   159 provided by Dr. Pascale Cossart (Institut Pasteur) and Dr. Kendra Nightingale (Texas Tech University), respectively, were used as other 1/2a serotype controls. Assays for each isolate were carried out in duplicate and repeated at least three times.   5.2.12 Acid stress survival Survival of L. monocytogenes 08-5578 and its LGI1 mutant derivatives in acidic conditions was assessed according to protocols described by Ells and Truelstrup Hansen (2011) and Oliver et al. (2010). Briefly, BHI (50 ml) was adjusted to pH of 4.5, 3.5, and 2.5 (Pinnacle pH meter, Nova Analytics Corporation) with 6 N HCl, and 9.9 ml were distributed into sterile tubes (i.e. five for each pH). Overnight cultures (10 µl) grown in BHI at 30°C (with shaking, 200 rpm) were inoculated into 5 ml of fresh BHI. Following incubation for 16 h at 30°C, 2 ml of cultures were spun at 6,000 x g for 10 min at room temperature, washed twice in 0.1% peptone water (2 ml), re-suspended in 2 ml of 0.1% peptone water, and added to pH-adjusted BHI to get 107-108 CFU/ml (counts were confirmed by enumeration on TSA-YE). Cultures were mixed with a vortex mixer and incubated at 30°C, with shaking (200 rpm). A 100-µl aliquot was removed immediately (t=0), and 1, 2, 4, 6, 8, 10 and 24 h after acidification, diluted in buffered peptone water (BPW; Acumedia) and spread onto TSA-YE, in duplicate. Plates were incubated at 37°C, and counts recorded after 24 h. Experiments were repeated three times.  5.2.13 Cold adaptation Cold growth adaptation of L. monocytogenes and its LGI1 mutant derivatives was evaluated according to the protocol described by Arguedas-Villa et al. (2010). Briefly, a single colony   160 of each L. monocytogenes isolate was inoculated into 10 ml BHI (16 x 150 mm tube) and grown overnight at 37°C with shaking (200 rpm) (~109 CFU/ml). Fresh BHI (10 ml) was inoculated with approximately 103 CFU/ml and incubated at 4°C until bacteria reached stationary phase (approximately four to seven weeks). Growth was monitored by spreading 10-fold serial dilutions prepared in peptone-saline on TSA-YE. Plates were incubated at 37°C, and colonies were counted after 24 h. Analysis was carried out at time 0 and weekly until stationary phase was reached. LPD and MGR of each strain were calculated from log-converted growth (CFU/ml) data using the DMfit 3.0 (ComBase) program. LGI1 deletion mutants were compared to the parental strain to determine if phenotypic differences existed in survival or growth following exposure to cold.  5.2.14 Salt stress survival To assess the growth and survival of the isolates at different salt concentrations, L. monocytogenes 08-5578 and its LGI1 mutant derivative strains were exposed to 5, 10, 15 and 20% NaCl (wt/vol; Fisher Scientific), according to the protocol described by Ells and Truelstrup Hansen (2011), with slight modifications. Briefly, 10 µl aliquots of overnight cultures grown in BHI at 30°C, with shaking (200 rpm), were inoculated into 5 ml of fresh BHI (16 x 150 mm tubes). Following incubation for 16 h at 30°C (shaking at 200 rpm), cultures were spun (3,000 x g, 10 min) at room temperature, washed twice in 0.1% peptone water and diluted to 107-108 CFU/ml in BHI containing appropriate concentrations of NaCl (16 x 150 mm tubes). Aliquots (200 µl) for each strain and treatment were transferred in duplicate into specified wells of a 96-well plate. The OD600 levels were monitored in a SpectraMax (Molecular Devices) plate reader at 30°C at 30 min intervals for 24 h. In   161 parallel, cultures exposed to 10 and 20% NaCl concentrations in the tubes were mixed with a vortex mixer and incubated at 30°C, with shaking (200 rpm). A 100 µl aliquot removed immediately (t=0), and after 1, 2, 4, 6, 8, 10, and 24 h, was serially diluted in BPW and spread onto TSA-YE, in duplicate. Plates were incubated at 37°C, and counts were recorded after 24 h. Experiments were repeated three times.  5.2.15 Statistical analysis Data analysis was performed using GraphPad Prism 6.0 software (GraphPad Software, Inc., La Jolla, CA, USA). One-way ANOVA with Dunnett’s multiple comparisons test was used to compare LPD, MGR and maximum OD600 values, and adhesion and invasion efficiencies between strains. Differences (LPD, MGR, maximum OD600) between isolates possessing LGI1 and those without LGI1 were assessed using the Mann-Whitney test. For all analyses, differences were considered significant if the p value was < 0.05.   5.3 Results 5.3.1 The presence of LGI1 in L. monocytogenes from the food chain LGI1 was detected in one (LR39-1) of the two 1/2a L. monocytogenes isolates belonging to CC8 (ST120). The isolate possessing LGI1 was recovered from a retail RTE fish sample. None of the L. monocytogenes or other Listeria spp. isolates recovered from food processing facilities harbored genomic island LGI1.      162 5.3.2 Minimum inhibitory concentrations of antimicrobials against L. monocytogenes No differences were observed between the MICs of the antibiotics against WT parent strain and deletion mutants (Table 5-4). All four strains were sensitive to CHL, ERY, GEN and TET, and exhibited reduced susceptibility to CIP. The L. monocytogenes isolate possessing a deletion in the emrE gene (lt 1862) had two and three times lower MICs for QACs compared to the parent strain, and other mutants (Table 5-5). No differences were observed in MICs for acriflavine or triclosan.  Table 5-4. Minimum inhibitory concentrations (MIC) of different antibiotics against L. monocytogenes possessing deletions in LGI1 genes, and wild type (WT) parent strains. Strain  MIC (µg/ml) Chloramphenicol Ciprofloxacin Erythromycin Gentamicin Tetracycline 08-5578 (WT) 15 5 1a 5 5 08-5578:ΔemrE 15 5 1 5 5 08-5578:Δlmo1851 15 5 1 5 5 08-5578:Δsel1 15 5 1 5 5 aLowest concentration tested.  5.3.3 Growth of WT L. monocytogenes and LGI1 mutants in the presence of sub-lethal concentrations of sanitizers When exposed to sub-lethal concentrations of QAC sanitizers, the ΔemrE mutant showed impaired growth compared to the parent and other mutant strains (Figures 5-1 to 5-3). This effect was particularly pronounced at 1.56 ppm and 2 ppm for E-San and BAC, respectively (Figure 5-3).        163 Table 5-5. Minimum inhibitory concentrations (MIC) of different antimicrobials against L. monocytogenes possessing deletions in LGI1 genes, and wild type (WT) parent strains. Strain MIC (ppm)a Acriflavineb Benzalkonium chloridec E-Sanc Triclosanb 08-5578 (WT) 18 30 20 8 08-5578:ΔemrE 18 10 10 8 08-5578:Δlmo1851 18 30 20 8 08-5578:Δsel1 18 30 20 8 appm, parts per million or µg/ml or µl/ml. bAssessed using microbroth dilution method. cAssessed using agar dilution method.   Significantly longer LPDs were observed with the ΔemrE mutant compared to the parent strain (p<0.0001). The resumption of growth took 2.6 and 2.4 times longer under exposure to E-San and BAC at 0.78 and 1 ppm concentrations, respectively. LPDs ware also four and six times longer than in the parent strain when exposed to E-San and BAC at 1.56 and 2 ppm, respectively (Table 5-6).   Similarly, the ΔemrE mutant grew 1.3 times slower than the parent strain in the presence of E-San and BAC at 0.78 and 1 ppm, and 2.8 and 1.6 times slower when concentrations were increased to 1.56 and 2 ppm, respectively, (Table 5-6). The ΔemrE mutant also had lower maximum OD600 values after 24 h in the presence of sanitizers when compared to the parent strain and other mutants (Table 5-6). Similar LPD, MGR, and maximum OD600 values were observed for Δlmo1851, Δsel1 and the parent strain (Table 5-6).  Significantly shorter LPD (p<0.05) was seen for strains possessing LGI1 than for strains without LGI1 when exposed to sub-lethal concentrations of E-San and BAC sanitizers (Figure 5-4). Similarly, strains possessing LGI1 grew faster (p<0.001), and reached higher   164 maximum OD600 values (p<0.05) in the presence of sub-lethal concentrations of E-San and BAC compared to strains without LGI1 (Figures 5-5 and 5-6).   Figure 5-1. Growth of L. monocytogenes 08-5578 (WT) parent strain and its isogenic deletion mutants in the presence of E-San (0.78 ppm) sanitizer at 30°C, based on OD600 (A) and log10 CFU/ml (B) values. The data shown represent the mean OD600 and log10 CFU/ml values of five and three independent cultures, respectively.    165  Figure 5-2. Growth of L. monocytogenes 08-5578 (WT) parent strain and its isogenic deletion mutants in the presence of benzalkonium chloride (BAC; 1 ppm) sanitizer at 30°C, based on OD600 (A) and log10 CFU/ml (B) values. The data shown represent the mean OD600 and log10 CFU/ml values of five and three independent cultures, respectively.    166  Figure 5-3. Growth of L. monocytogenes 08-5578 (WT) strain and its isogenic deletion mutants in the presence of sanitizers E-San at 1.56 ppm (A), and benzalkonium chloride (BAC) at 2 ppm (B) at 30°C. The data shown represent the mean OD600 values of five independent cultures.       167 Table 5-6. Average lag phase duration, maximum growth rate, and maximum optical density of Listeria monocytogenes 08-5578 and its LGI1 deletion mutants, Δlmo1851, ΔemrE, and Δsel1, when exposed to sub-lethal concentrations of QAC-based sanitizers, E-San and benzalkonium chloride (BAC) for 24 h at 30°C. Values represent mean values from five independent assays, with each sample and treatment measured in duplicate.  Treatment L. monocytogenes strains 08-5578 (WT) ΔemrE Δlmo1851 Δsel1 Lag phase duration (h)    E-San     0.78 ppm 3.31± 0.15 8.45± 1.34*** 3.30± 0.30 3.18± 0.29 1.56 ppm 5.17± 0.50 21.02± 0.79*** 5.16± 0.49 5.10± 0.55 BAC     1 ppm 2.87± 0.39 6.80± 1.40*** 3.10± 0.23 3.02± 0.20 2 ppm 3.16± 0.19 18.58± 0.68*** 3.21± 0.17 3.14± 0.17 TSB 2.68± 0.62 2.79± 0.56 3.04± 0.13 2.96± 0.22 Maximum growth rate (increase in OD600 /h) E-San     0.78 ppm 0.19± 0.03 0.15± 0.02* 0.18± 0.01 0.18± 0.03 1.56 ppm 0.17± 0.02 0.06± 0.04*** 0.17± 0.02 0.16± 0.02 BAC     1 ppm 0.19± 0.01 0.15± 0.01* 0.18± 0.02 0.19± 0.02 2 ppm 0.20± 0.02 0.12± 0.01** 0.17± 0.02 0.18± 0.03 TSB 0.19± 0.03 0.21± 0.03 0.19± 0.02 0.21± 0.03 Maximum optical density (OD600)    E-San     0.78 ppm 0.69± 0.07 0.60± 0.06 0.64± 0.01 0.65± 0.05 1.56 ppm 0.65± 0.06 0.23± 0.18*** 0.63± 0.01 0.63± 0.06 BAC     1 ppm 0.68± 0.07 0.66± 0.11 0.63± 0.01 0.65± 0.06 2 ppm 0.66± 0.07 0.56± 0.04* 0.62± 0.01 0.63± 0.06 TSB 0.67± 0.06 0.73± 0.07 0.67± 0.06 0.70± 0.06 aStatistically significant values are highlighted in bold at p<0.05 (*), p<0.001 (**), and p<0.0001 (***), using one-way ANOVA with Dunnett’s multiple comparisons test.   168  With LGI1 No LGI10510152025L. monocytogenes strainsLag phase duration (h) A. E-San (0.78 ppm)abWith LGI1 No LGI10510152025L. monocytogenes strainsLag phase duration (h) C. BAC (1 ppm)abWith LGI1 No LGI10510152025L. monocytogenes strainsLag phase duration (h) B. E-San (1.56 ppm)abWith LGI1 No LGI10510152025L. monocytogenes strainsLag phase duration (h) D. BAC (2 ppm)ab Figure 5-4. Mean lag phase duration (h) of L. monocytogenes isolates possessing LGI1 (n=9) and isolates without LGI1 (n=8) when grown in the presence of sub-lethal concentrations of E-San sanitizer at 0.78 (A) and 1.56 ppm (B), and 1 (C) and 2 ppm (D) of benzalkonium chloride (BAC), at 30°C for 24 h. Bars represent mean lag phase duration values and error bars indicate standard errors of the mean. Different letters above the bars represent significant differences (p<0.05) between the groups, determined using the Mann-Whitney test.      169  With LGI1 No LGI10.000.050.100.150.200.25L. monocytogenes strainsMaximum growth rate (OD600 units/h)A. E-San (0.78 ppm)abWith LGI1 No LGI10.000.050.100.150.200.25L. monocytogenes strainsMaximum growth rate (OD600 units/h)C. BAC (1 ppm)abWith LGI1 No LGI10.000.050.100.150.200.25L. monocytogenes strainsMaximum growth rate (OD600 units/h)B. E-San (1.56 ppm)abWith LGI1 No LGI10.000.050.100.150.200.25L. monocytogenes strainsMaximum growth rate (OD600 units/h)D. BAC (2 ppm)ab Figure 5-5. Mean maximum growth rate (OD600 units/h) of L. monocytogenes isolates possessing LGI1 (n=9) and isolates without LGI1 (n=8) when grown in the presence of sub-lethal concentrations of 0.78 (A) and 1.56 ppm (B) of E-San, and 1 (C) and 2 ppm (D) of E-San sanitizer at 0.78 (A) and 1.56 ppm (B), and 1 (C) and 2 ppm (D) of benzalkonium chloride (BAC), at 30°C for 24 h. Bars represent mean growth rate values and error bars indicate standard errors of the mean. Different letters above the bars represent significant differences (p<0.001) between the groups, determined using the Mann-Whitney test.      170  With LGI1 No LGI10.00.20.40.60.8L. monocytogenes strainsMaximum OD600A. E-San (0.78 ppm)abWith LGI1 No LGI10.00.20.40.60.8L. monocytogenes strainsMaximum OD600C. BAC (1 ppm)abWith LGI1 No LGI10.00.20.40.60.8L. monocytogenes strainsMaximum OD600B. E-San (1.56 ppm)abWith LGI1 No LGI10.00.20.40.60.8L. monocytogenes strainsMaximum OD600D. BAC (2 ppm)ab Figure 5-6. Maximum OD600 values for L. monocytogenes isolates possessing LGI1 (n=9) and isolates without LGI1 (n=8) when grown in the presence of sub-lethal concentrations of E-San sanitizer at 0.78 (A) and 1.56 ppm (B), and 1 (C) and 2 ppm (D) of benzalkonium chloride (BAC), at 30°C for 24 h. Bars represent mean growth rate values and error bars indicate standard errors of the mean. Different letters above the bars represent significant differences (p<0.05) between the groups, determined using the Mann-Whitney test.     171  The addition of the known efflux inhibitor reserpine to TSB containing lower concentrations of E-San (0.78 ppm) and the two tested BAC concentrations (1 and 2 ppm) only marginally impacted the growth of WT 08-5578 (Figure 5-7). However, at higher concentrations of E-San (1.56 ppm) the effect was more pronounced (Figure 5-7A).    0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0 2 4 6 8 10 12 14 16 18 20 22 24 OD600 Time (h) A. 08-5578 (E-San) E-San (0.78 ppm) E-San (0.78 ppm) R E-San (1.56 ppm) E-San (1.56 ppm) R 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0 2 4 6 8 10 12 14 16 18 20 22 24 OD600 Time (h) B. 08-5578 (BAC) BAC (1 ppm) BAC (1 ppm) R BAC (2 ppm) BAC (2 ppm) R  Figure 5-7. Growth of L. monocytogenes 08-5578 (WT) strain in the presence of sanitizers E-San at 0.78 and 1.56 ppm (A), and benzalkonium chloride (BAC) at 1 and 2 ppm (B) at 30°C, with (white line markers) and without (black filled line markers) reserpine (R; 20 µg/ml). The data shown represent the mean OD600 values of three independent assays. Standard deviation ranged from 0.0010 to 0.24.   172  Longer LPDs were observed when reserpine was added to the ΔemrE mutant cultures containing sub-lethal concentrations of E-San and BAC (Figure 5-8). At higher concentrations of BAC (2 ppm) growth was visibly suppressed, while with the addition of reserpine at 1.56 ppm E-San completely inhibited growth of the ΔemrE mutant (Figure 5-8).   0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0 2 4 6 8 10 12 14 16 18 20 22 24 OD600 Time (h) A. ΔemrE (E-San) E-San (0.78 ppm) E-San (0.78 ppm) R E-San (1.56 ppm) E-San (1.56 ppm) R 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0 2 4 6 8 10 12 14 16 18 20 22 24 OD600 Time (h) B. ΔemrE (BAC) BAC (1 ppm) BAC (1 ppm) R BAC (2 ppm) BAC (2 ppm) R  Figure 5-8. Growth of L. monocytogenes ΔemrE mutant in the presence of sanitizers E-San at 0.78 and 1.56 ppm (A), and benzalkonium chloride (BAC) at 1 and 2 ppm (B) at 30°C, with (white line markers) and without (black filled line markers) reserpine (R; 20 µg/ml). The data shown represent the mean OD600 values of three independent assays. Standard deviation ranged from 0.0004 to 0.29.    173 5.3.4 Gene expression in WT L. monocytogenes when exposed to sub-lethal concentration of BAC When L. monocytogenes 08-5578 was exposed to BAC at 10 ppm for 1 h the highest change (82.4-fold) in the expression of LGI1 genes was seen for lmo1861, a putative MarR-family transcriptional regulator, followed by emrE (49.6), encoding a small multidrug resistance (SMR) efflux pump (Table 5-7). The expression of LGI1 encoded putative response regulator (lmo1851) of a two-component transduction system also increased 2.3-fold, while the expression of sigB, a major stress response regulator in L. monocytogenes, increased 4.1-fold. There was no change in the expression of lde and mdrL, genes encoding for proteins that belong to the major facilitator superfamily (MFS) of multidrug resistance efflux pumps.  Table 5-7. Gene expression of L. monocytogenes 08-5578 strain when treated with benzalkonium chloride (10 ppm) sanitizer for 1 h, relative to the control (TSB). Functional category and gene name Physiological function Fold changea LGI1 encoded   emrE Putative efflux pump 49.6 lmo1851 Putative response regulator of a two-component signal transduction system 2.3 lmo1861 Putative MarR-family transcriptional regulator   82.4 Stress response   lde Major facilitator superfamily efflux pump 1.7 mdrL Major facilitator superfamily efflux pump 0.6 sigB Alternate sigma factor 4.1 aRelative changes in the expression levels for genes of interest were normalized against a housekeeping gene 16S rRNA, encoding the RNA component of the smaller subunit of the bacterial ribosome, and compared to the control grown in TSB without the sanitizer treatment. Results that are >2- fold up-regulated are in bold; Ct standard deviation for all genes was ≤0.3.      174 5.3.5 Adhesion and invasion of Δsel1 mutant to TC-7 and HeLa cells There were no differences in the adhesion or the invasion efficiencies of the Δsel1 and WT strains measured with TC-7 and HeLa cell lines (Figure 5-9). The number of adhered cells for both WT and the Δsel1 deletion mutant strain were similar to those observed for the control strain 10403S (6.4 log10 CFU/ml). Adhesion efficiencies to TC-7 cells was higher for all strains tested, except the inlA deficient mutant BUG5 (Figure 5-9A and B). No differences were observed between the 10403S control strain, and WT and Δsel1 mutant when invasion of TC-7 cells was examined (Figure 5-9C). However, significantly fewer WT (08-5578) and Δsel1 L. monocytogenes could invade HeLa cells than the 10403S control strain (Figure 5-9D).   5.3.6 Acid tolerance No differences were observed between the WT parent (08-5578) strain and LGI1 deletion mutants when strains were grown in BHI that was adjusted to pH 2.5, 3.5, and 4.5 (Figure 5-10). At pH 4.5 bacterial counts remained constant for all four strains, at approximately 7.6 log CFU/ml. When pH was reduced to pH 3.5, bacterial counts started to decline after 10 h, with an overall decrease of approximately 1.5 log CFU/ml within 24 h. Exposure of cells to pH 2.5 resulted in the decrease in bacterial counts for all four strains after approximately 5 h, and no viable bacteria were recovered at 24 h.      175  10403S BUG5 08-5578 (WT) Δsel102468L. monocytogenes strainsAdhered log10 CFU/mlA. TC-7 (adhesion)aaabOther controls10403S BUG5 08-5578 (WT) Δsel102468L. monocytogenes strainsAdhered log10 CFU/mlB. HeLa (adhesion)Other controls10403S BUG5 08-5578 (WT) Δsel104080120160L. monocytogenes strains% Invasion of HeLa cellsD. HeLa (invasion)Other controlsabbb10403S BUG5 08-5578 (WT) Δsel104080120160L. monocytogenes strains% Invasion of TC-7 Caco-2 cellsC. TC-7 (invasion)aaabOther controls Figure 5-9. Adhesion and invasion efficiencies (% of bacteria recovered relative to the initial inoculum, normalized to 08-5578 strain) of L. monocytogenes WT (08-5578) strain and its isogenic mutant possessing deletion in sel1 gene located on LGI1, compared to a clinical isolate 10403S and a Tn1545-induced noninvasive inlA mutant of EGD-SmR (BUG5), using TC-7 (A and C) and HeLa (B and D) cells. Assays for each isolate were carried out in duplicate and repeated four times. Bars show mean adhesion (log10 CFU/ml) and invasion efficiencies (normalized to 08-5578 strain), and error bars indicate standard errors of the mean. Different symbols above the bars indicate significantly higher adhesion or invasion efficiencies (p<0.05; one-way ANOVA with Dunnett’s multiple comparisons test).  176  Figure 5-10. Growth of L. monocytogenes 08-5578 (WT) strain and its LGI1 mutants in BHI broth adjusted to pH 4.5 (A), pH 3.5 (B) and pH 2.5 (C) with 6 N HCl, at 30°C. The data shown represent the mean log10 CFU/ml values from three different experiments. At pH 2.5 after 24 h, counts were below the limit of detection (i.e. 10 CFU/ml) and they were assigned a value of 5 CFU/ml; correspondingly a log10 CFU/ml value of 1.7 represents a sample in which viable cells were not detected.     177 5.3.7 Adaptation and growth in cold environment No differences in the adaptation to cold environment were observed between WT and LGI1 mutants when LPD, MGR, and maximum CFU/ml were measured at 4°C following a downshift from 37°C (Table 5-8). All four strains adapted to cold temperature rapidly, and resumed growth after approximately 2 to 2.5 h following cold exposure (Table 5-8). All four strains reached the stationary phase within approximately three weeks.   Table 5-8. Cold growth adaptation of WT L. monocytogenes 08-5578 and its LGI1 deletion mutants based on the lag phase duration (h), growth rate (Δlog10 CFU/h), and maximum density (log10 CFU/ml) reached during incubation at 4°C following a downshift from 37°C. L. monocytogenes strains LPD (h) (±SD) Growth rate  (Δlog10 CFU/h) Maximum  (log10 CFU/ml) 08-5578 (WT) 2.48 ± 0.74 0.47 ± 0.036 9.22 ± 0.13 ΔemrE 1.55 ± 0.56 0.40 ± 0.0065 9.23 ± 0.19 Δlmo1851 2.68 ± 0.59 0.49 ± 0.073 8.99 ± 0.10 Δsel1 2.37 ± 0.17 0.43 ± 0.056 9.18 ± 0.010   5.3.8 Salt tolerance L. monocytogenes Δlmo1851 mutant strain reached slightly higher maximum OD600 values compared to the parent and other mutant strains when it was grown in BHI containing 5 and 10% NaCl (Figure 5-11). Differences were, however, not statistically significant (p>0.05). No growth was observed in the presence of 15 and 20% NaCl for the WT and mutant strains based on OD600 measurements. Similarly, there was no increase or decrease in viable counts over 24 h in the presence of 15 and 20% NaCl.    178 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 0 2 4 6 8 10 12 14 16 18 20 22 24 OD600 Time (h) A. Growth in the presence of 5% NaCl 08-5578 (WT) ΔemrE Δlmo1851 Δsel1   0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 0 2 4 6 8 10 12 14 16 18 20 22 24 OD600 Time (h) B. Growth in the presence of 10% NaCl  Figure 5-11. Growth of L. monocytogenes 08-5578 (WT) strain and its isogenic LGI1 deletion mutants in BHI containing 5 and 10% of NaCl at 30°C. The data shown represent the mean OD600 values of three independent cultures.    179 5.4 Discussion  Screening of L. monocytogenes isolates derived from the B.C. food chain for the presence of LGI1 revealed that the genomic island was not widespread in the population. In particular, LGI1 was found in only one isolate recovered from a RTE fish sample obtained at retail. This isolate belonged to serotype 1/2a, ST120 and CC8, which is in agreement with the findings by Knabel et al. (2012) and Ziegler (2012), who observed the presence of the island in a predominant clone belonging to 1/2a serotype and CC8, with a specific PFGE profile LMACI.0001/ LMAAI.0001. In fact this clone has been reported responsible for 40% of Canadian listeriosis outbreaks, and 20% of sporadic clinical cases in the last two decades (Ziegler, 2012). While the presence of only two ST120 isolates in the L. monocytogenes collection examined here suggests this sequence type is not prevalent in the B.C. food chain, the presence of LGI1 in one of them is a disconcerting find.   The presence of a number of putative antimicrobial resistance, stress response, and virulence genes on LGI1 could play a significant role in the ability of L. monocytogenes to survive in the food chain and cause human listeriosis (Gilmour et al., 2010; Ziegler, 2012). To investigate this hypothesis, LGI1 deletion mutants were created in L. monocytogenes 08-5578, an isolate that caused a nationwide listeriosis outbreak in Canada in 2008 in which the whole genome sequencing revealed the presence of the genomic island (Gilmour et al., 2010). Three genes located on LGI1 with putative stress response (i.e. ΔemrE, Δlmo1851) and virulence (i.e. Δsel1) functions were deleted. Listeria monocytogenes 08-5578 possessed high tolerance to acidic conditions, refrigeration, and high salt concentrations. However, the putative role of the response regulator of a two-component signal transduction system gene lmo1851 in increased tolerance to the stressors tested could not be confirmed, leading to the   180 rejection of the hypothesis that lmo1851 contributes to enhanced survival of L. monocytogenes in acidic, cold, and high salt conditions. Similarly, deletion of the sel1 gene, encoding for a putative adhesin, did not impact L. monocytogenes adhesion and invasion of TC-7 and HeLa cell lines. These results suggest that sel1 does not affect the virulence potential of L. monocytogenes under the conditions tested, and are cause to reject the hypothesis that this gene contributes to the increased adherence and invasion of L. monocytogenes in vitro.   In contrast, deletion of the emrE gene encoding for a small multidrug resistance (SMR) efflux pump resulted susceptibility to QAC-based sanitizers. MICs of two different QAC-based sanitizers against the ΔemrE mutant were up to three times lower than the WT parent strain. When the ΔemrE mutant was grown in the presence of sub-lethal concentrations of BAC and E-San sanitizers longer lag phase, slower growth rate, and overall lower maximum cell densities (OD600) were observed compared to the WT strain. Furthermore, addition of reserpine, a known efflux pump inhibitor (Godreuil et al., 2003), affected the growth of both the WT and ΔemrE mutant strains in the presence of different concentrations of QAC sanitizers, thus, confirming that increased QAC-tolerance is indeed to due to efflux activity. Collectively, these data demonstrate that LGI1 encoded emrE confers increased tolerance to QAC in L. monocytogenes. This is in agreement with results reported by Ziegler (2012), who observed that MIC values for QACs were higher for isolates possessing the LGI1 genomic island than genetically similar isolates without LGI1.   The role of emrE in QAC tolerance was further confirmed by gene expression analyses. In particular, a significant up-regulation of the emrE expression occurred in the presence of BAC sanitizer, along with the increased expression of the lmo1861 gene, a   181 putative MarR-family regulator. The expression of mdrL, a gene responsible for the production of MdrL chromosomal efflux pump belonging to MFS transporters in L. monocytogenes, was not up-regulated in the current study. This result is not surprising, as mdrL has previously been shown to be over-expressed only in L. monocytogenes that were experimentally adapted to BAC, but not in naturally resistant WT strains (Romanova et al., 2006), such as those tested in the current study. The findings described here also confirm that lde, an additional efflux pump belonging to the MFS efflux transporters, does not have a role in L. monocytogenes resistance to QAC-based sanitizers. This conclusion was expected, as the Lde efflux pump has been linked primarily to quinolone resistance, and is to some degree believed to contribute to L. monocytogenes tolerance to dyes, such as ethidium bromide and acridine orange (Godreuil et al., 2003; Lismond et al., 2008).   When it comes to sanitizer resistance in L. monocytogenes, at least two mechanisms have been described for resistance to QACs in WT strains. The presence of a plasmid-borne or chromosomally encoded bcrABC cassette and transposon (Tn6188)-based QacH efflux pump increases tolerance to QAC-based sanitizers in outbreak, clinical, and food chain L. monocytogenes isolates (Dutta et al., 2013; Elhanafi et al., 2010; Müller et al., 2013). However, QAC-sanitizer resistance due to the presence of an emrE homolog in L. monocytogenes has not been characterized before.   Efflux pumps belonging to the SMR family of proteins are typically 100 to 140 amino acids long, and often confer resistance to aminoglycosides, fluoroquinolones, dyes, and QACs (Bay et al., 2008; Piddock, 2006b; Poole, 2005). The first emrE efflux pump was described in Escherichia coli (i.e. E. coli multidrug resistance E) by Yerushalmi et al. (1995). They established that EmrE contributes to the resistance of E. coli to tetracycline,   182 erythromycin and sulfadiazine. Similar SMR pumps have also been described in Mycobacterium smegmatis (e.g., Mmr), Pseudomonas aeruginosa (e.g., EmrEPae), and Staphylococcus spp. (e.g., QacC/D, QacH); however, substrates for each efflux pump vary depending on the pump and the bacterial species (Piddock, 2006a; Piddock, 2006b; Poole, 2005). Li et al. (2003) demonstrated that an emrE homolog in Pseudomonas aeruginosa contributed to resistance toward ethidium bromide, acriflavine and aminoglycosides (i.e. amikacin, gentamicin, kanamycin, neomycin, and tobramycin), albeit resistance to aminoglycosides was observed only when tested in low-ionic-strength medium. In Mycobacterium smegmatis, an in-frame deletion in the emrE resulted in decreased MICs to ethidium bromide, acriflavine, ciprofloxacin and norfloxacin but had no effect on MICs of chloramphenicol, erythromycin, gentamicin, and tetracycline (Li et al., 2004). In L. monocytogenes, emrE did not appear to contribute to resistance to aminoglycosides, chloramphenicol, ciprofloxacin, tetracycline, and triclosan antimicrobials. It also did not seem to play a role in L. monocytogenes tolerance of acriflavine. This result is not surprising, since L. monocytogenes emrE did not possess any similarity to other well-characterized SMR efflux pumps from Gram negative and Gram positive bacteria. Comparison of the L. monocytogenes emrE region against the genomes present in the National Center for Biotechnology Information database produced a 74% and 72% similarity with a cationic/cationic drug transporter seen in Desulfitobacterium dehalogenans, and a small multidrug resistance protein in Desulfitobacterium hafniense strain, respectively. Desulfitobacterium spp. are anaerobic, motile, Gram positive, rod-shaped bacteria that often reside in environments contaminated by halogenated organic compounds (Villemur et al., 2006). Some homology (66 to 68%) between L. monocytogenes emrE and a predicted   183 multidrug resistance protein in Clostridium ljungdahlii, and QAC-resistance proteins observed in Bacillus thuringiensis serovar kurstaki and B. cereus strains was also observed. The presence of these bacteria in soil and effluents, which are also natural environments for L. monocytogenes, may result in sharing of the genetic material that confers survival under harsh conditions, though more research is needed to explore this hypothesis.   Listeria monocytogenes isolates possessing increased tolerance to QAC-based sanitizers, which are often used in food processing and handling facilities due to their non-corrosive properties, are of special concern to food processors and health authorities. The risk of selecting for sanitizer-resistant microorganisms when sanitizers are used at concentrations recommended by manufacturers is low. However, it should not be overlooked that inadequate cleaning and sanitation practices can result in exposure of L. monocytogenes to sub-lethal concentrations of sanitizers, which in turn will lead to selection pressure for progeny possessing increasing sanitizer tolerance (Rakic-Martinez et al., 2011). Such isolates have an increased chance of survival that may lead to persistence in food processing environments (Lundén et al., 2002; Lundén et al., 2003). This is especially likely to occur if equipment and niches that are difficult to clean and sanitize are encountered (Lundén et al., 2002). Persistent L. monocytogenes strains with enhanced sanitizer tolerance may also be more likely to contaminate foods and result in listeriosis cases, as evidenced by a number of outbreaks implicating L. monocytogenes isolates that do in fact show an increased tolerance to sanitizers (Elhanafi et al., 2010; Lundén et al., 2002). The L. monocytogenes 08-5578 isolate characterized in the current study was implicated in one of the largest listeriosis outbreaks in Canada, with the source of contamination suspected to be a large commercial slicer harboring the bacteria (Weatherill, 2009). Environmental sampling records from this facility showed   184 the intermittent presence of L. monocytogenes on two processing lines for almost a year prior to the outbreak (Weatherill, 2009). Similar scenarios have been reported in other listeriosis outbreaks where L. monocytogenes in the processing environment led to contamination of RTE products (CDC, 2002; Mead et al., 2006; Olsen et al., 2005). In fact, it is well established that food product contamination is associated with food processing environments harboring L. monocytogenes and subsequent post-processing transfer to finished products (Lappi et al., 2004; Lundén et al., 2002; Olsen et al., 2005; Tompkin, 2002). Following proper protocols for cleaning and sanitation of equipment, such as large slicers and conveyor belts that are difficult to disassemble or possess small openings and crevices, is particularly challenging for operators.   An additional concern with isolates possessing efflux pumps that enhance L. monocytogenes tolerance to QAC-based sanitizers is the potential for these isolates to develop enhanced tolerance to antibiotics due to similar mechanisms of action (Poole, 2005). Rakic-Martinez et al. (2011) demonstrated that L. monocytogenes strains selected on sub-lethal concentrations of ciprofloxacin (2 µg/ml) or BAC (10 µg/ml) exhibited higher MICs not only to these agents, but also to several other toxic compounds, including gentamicin, the dye ethidium bromide, and the chemotherapeutic drug tetraphenylphosphonium chloride. While the research performed in this study did not show that emrE increased tolerance to antibiotics relevant to listeriosis treatment (e.g., aminoglycosides), it is important to note that the adaptation to high concentrations of QAC sanitizers and the antibiotic co-selection phenomenon was not investigated. In future research, it would be of interest to investigate whether the co-selection phenomenon can indeed occur in isolates possessing emrE. Additionally, only a small number of antibiotics were tested in the experiments described   185 here. Future studies including additional antimicrobials comprising different classes of antibiotics and sanitizer compounds would be of great interest. Presently, the co-selection phenomenon occurring in L. monocytogenes is not well understood. However, a growing body of evidence suggests that pressures occurring at food processing facilities may contribute to the selection of isolates with enhanced tolerance to different antimicrobials, which is a concern to all food safety stakeholders.  5.5 Conclusions Data from this research provide evidence that LGI1 encoded emrE promotes the survival of L. monocytogenes in the environments where this microorganism may come into contact with cationic compounds, such as QAC-based sanitizers. As QACs are commonly used in the food industry, the presence of efflux pumps, such as BcrB and BcrC, QacH, and EmrE that increase L. monocytogenes tolerance to QACs, is a concern to food safety. While there is presently no evidence that proper use of sanitizers in food processing will lead to development of resistant microorganisms, the exposure of microorganisms to residual QACs and concentrations below those recommended and regarded as adequate to eradicate L. monocytogenes is not an unlikely scenario. This is particularly true if bacteria become embedded in equipment niches that are hard to reach and thus are not properly cleaned and sanitized. Exposure to sub-lethal concentrations of sanitizers may not only lead to persistence, but also select for isolates with increased tolerance to QACs and other antimicrobials with similar modes of action. Presently, the co-selection phenomenon between sanitizers commonly used in food processing and antibiotics relevant in human clinical settings are not well understood. However, sufficient evidence does exist that demonstrates   186 shared mechanisms of resistance between biocides and antibiotics in L. monocytogenes (Christensen et al., 2011; Rakic-Martinez et al., 2011).   Considering the ubiquitous nature of L. monocytogenes and the severity of disease it can cause in high-risk individuals, there is a need for improved knowledge of the survival mechanisms that promote L. monocytogenes persistence in food processing. In particular, a better understanding of mechanisms that confer resistance to injury due to antimicrobials, and the co-selection phenomenon is needed before we can develop more effective targets for future mitigation strategies. Advances in this area would also enhance the successful development of sensitive and specific detection methods for high-risk L. monocytogenes strains.   187 Chapter  6: Conclusions Federally registered food processing facilities in Canada are subject to environmental and end-product testing for Listeria spp. and/or L. monocytogenes. However, this level of inspection is not required or practiced in most non-federally registered food processing facilities, or at the retail level. The presence of Listeria spp. and L. monocytogenes was investigated in RTE food processing and retail facilities under provincial inspection authority in British Columbia (B.C.) to investigate the risks that are posed to consumers. Listeria monocytogenes was recovered from the processing environments in dairy, fish and meat facilities. However, the pathogen was recovered from food contact surfaces and RTE food products only in fish processing facilities. Similarly, L. monocytogenes was recovered from retail RTE fish samples, but not from retail RTE meat products. Thus, while control measures for L. monocytogenes in dairy and meat facilities appear to be effective in limiting contamination, the results indicate that there is a need for facilities and health inspectors to initiate improved monitoring and management of contamination by L. monocytogenes in RTE fish processing and retail sectors.  Genotypic and phenotypic characteristics of the recovered isolates were examined to further assess the risk posed to consumers from the consumption of foods contaminated with L. monocytogenes. More specifically, characteristics associated with virulence (e.g., inlA genotypes), enhanced stress resistance and survival along the food chain (e.g., cold adaptation, adaptive mutability and antimicrobial resistance, the presence of Listeria genomic island 1) were investigated.   Genotypic characterization of the L. monocytogenes strains revealed considerable diversity. Multilocus sequence typing found 14 sequence types (ST) in the examined   188 population. Thirteen of STs have been reported worldwide, and one (ST662) was unique to B.C. isolates. STs associated with clinical cases of listeriosis, namely those belonging to clonal complex 8 (CC8) previously linked to a number of sporadic and outbreak listeriosis cases in Canada, were found in two B.C. isolates. Interestingly, a large proportion (37/56) of L. monocytogenes isolates also possessed the full-length inlA gene. This gene encodes for a protein necessary for invasion of the human gastrointestinal tract, thereby indicating that a large proportion of isolates from the B.C. food chain have the potential to cause human illness.    Phenotypic properties of isolates, based on the serotype profiles, abilities to acquire point mutations that allow L. monocytogenes to survive in the presence of rifampicin antibiotic, and the capacity of strains to adapt to refrigeration, were significantly different. In particular, the majority of isolates recovered from the B.C. food chain belonged to listeriosis causing serotypes, 1/2a and 4b. Interestingly, isolates belonging to 1/2a serotype dominated in food processing environments, while serotype 4b was most commonly recovered from RTE foods. Surprisingly, serotype 4b more readily acquired point mutations that led to rifampicin resistance compared to other serotypes. Reasons for this observation are not clear. While positive selection resulting from the acquisition of advantageous mutations has been reported to contribute to the evolution of numerous genes in 1/2a strains, it is less often seen in 4b serotype strains. In general, 4b strains are typically more conserved in genetic content, exhibiting lower recombination rates, and are less likely to possess plasmids and extra-chromosomal elements. While further work is needed to explore this phenomenon, results obtained in this thesis suggest serotype 4b strains may acquire point mutations more readily than 1/2a strains. Considering that point mutations resulting in rifampicin resistance were   189 more readily observed in 4b serotypes, and that inlA mutations are typically very rare among isolates of this serotype, the results reported here suggest that a selection pressure for the maintenance of inlA genes encoding a full-length InlA exists for serotype 4b.  Of concern is also the observation made that isolates possessing rapid cold adaption (i.e. less than 70 h) were more likely to encode a full-length inlA, a causally linked virulence determinant. These results substantiate the assertion that isolates lacking inlA truncations are a significant concern. In light of these findings, which also showed that isolates with full-length inlA were more commonly recovered from RTE food, there is sufficient evidence to indicate that these isolates represent a significant food safety concern for food processors and public health authorities.  Although no resistance to antibiotics used in listeriosis treatments was observed, the results obtained in the current research show that a large proportion of Listeria isolates recovered from the B.C. food chain possess resistance, or increased tolerance, to antimicrobials typically effective against listeriae. In addition to resistance to antibiotics for which innate resistance of Listeria has been reported previously  high levels of ciprofloxacin and clindamycin tolerance were noted. This observation was especially pronounced in 1/2a serotype isolates recovered from food. With the widespread usage of antimicrobials in clinical and animal production settings, the recovery of listeriae originating from the food chain that possess increased levels of antimicrobial tolerance may not be surprising. It has been hypothesized that enterococci and streptococci may transmit mobile plasmids that encode antimicrobial resistance determinants to Listeria spp. in farming environments. Furthermore, when a co-selection phenomenon was explored in isolates that were experimentally adapted to high concentrations of ciprofloxacin, a reduced sensitivity to   190 disparate antimicrobials occurred. Of particular interest was the finding that adaptation to ciprofloxacin also resulted in the increased resistance to benzalkonium chloride, a quaternary ammonium compound (QAC), and in some strains also led to increased resistance to gentamicin, an antibiotic used in listeriosis treatment. Considering that QACs are commonly used as sanitizers in food processing environments, and that repeated exposure of L. monocytogenes to sanitizers is a plausible and realistic concern in the food processing industry, there is a need for improved understanding of potential pressures contributing to co-selection of antibiotic and sanitizer resistance mechanisms.  The increased tolerance to QAC-based sanitizers in wild type (WT) L. monocytogenes can occur due to plasmid-borne and chromosomally encoded efflux pump genes, such as bcrABC, qacH, and to a lesser degree mdrL. The findings of this thesis provide evidence that a novel efflux pump, encoded by the emrE gene, and located on Listeria genomic island 1 (LGI1) also contributes to increased L. monocytogenes tolerance to QACs. This particular island was discovered during an investigation into the 2008 deli meat outbreak when the genomes of the two L. monocytogenes strains linked to the outbreak were sequenced. Along with emrE, a number of other genes with putative stress response and virulence functions were found on the island, suggesting it may be a factor for the enhanced ability of L. monocytogenes to survive in the food chain. In fact, when one of the outbreak strains, L. monocytogenes 08-5578, was exposed to a variety of stresses, high tolerance to acidic, cold, and high salt conditions, and two QAC sanitizers was observed. Deletion of genes lmo1851, and sel1, with putative regulatory, and adhesion functions, respectively, did not affect the tolerance of the bacterium to acid, cold and high salt conditions, or its adhesion and invasion of human cells (e.g., TC-7 and HeLa). However, an in-frame deletion of the emrE   191 gene resulted in the impaired growth of the strain in the presence of sub-lethal concentrations of two QAC sanitizers, and two to three times lower minimum inhibitory concentration (MIC) values. There was no change in MIC values when ΔemrE mutant was exposed to aminoglycosides and other antibiotics, acriflavine, and triclosan. These data suggest that the primary role of EmrE in L. monocytogenes is to increase its tolerance of QAC sanitizers. Since these sanitizers are commonly used in the food industry, L. monocytogenes strains possessing emrE will have an increased ability to survive in food processing environments. Future research should focus on elucidating the role of other genes located on the island. In particular, the role of a putative MarR regulator (lmo1861) flanking the emrE gene, which was over-expressed during exposure to BAC, a putative rpoE unit that may play a role in stress regulation, as well as the role of a number of vir genes that could enhance virulence should be investigated.  In summary, the research presented in this thesis provides strong evidence that differences in stress survival and virulence potential exist among food chain-derived L. monocytogenes. The research findings also highlight the need for a better understanding of the mechanisms that confer resistance and stress survival in the food chain, in order to control this pathogen in the food industry. Currently, in Canada 100 CFU of L. monocytogenes are permitted per ml or gram of food that does not support the growth of Listeria, or in foods that have a short shelf life (Health Canada, 2011). However, testing of foods and food processing environments is not practiced or required in all the facilities that produce RTE foods for Canadians. Even in facilities that are inspected by the Canadian Food Inspection Agency (CFIA), and undergo more rigorous testing for Listeria spp., L. monocytogenes continues to be frequently found. In 2013, 21 recall notifications due to   192 L. monocytogenes contamination of RTE foods were issued by the CFIA (CFIA, 2014). Of these, 10 were due to separate incidents, where foods from different producers across the country were recalled. Similarly, in 2014 (January to July), 16 separate recalls occurred as a result of various foods being contaminated by L. monocytogenes. These recalls are costly and place economic burden on both the government and food producers. In addition, the current food safety system does not differentiate between low and high-risk L. monocytogenes isolates. Some of these recalls may be removing foods from the shelves that contain low virulence L. monocytogenes strains that do not possess genetic determinants required for human illness. In other instances, we may be allowing a small number of L. monocytogenes strains with high virulence potential in our foods.   Research from this thesis provides strong evidence that some L. monocytogenes strains possess genetic and phenotypic properties that pose higher risk of foodborne illness to consumers than others. Furthermore, findings from the research provide important new information on how L. monocytogenes survive in the food chain. These data highlight the need for better monitoring and detection systems that can capture differences in L. monocytogenes isolates. We should aim to replace the current presence or absence testing with a more risk-based system. However, in order to do this, more sophisticated, yet affordable methods that can differentiate between the low and high-risk L. monocytogenes strains are needed. In addition, greater focus should be placed on understanding the environmental pressures occurring at the food processing level that result in selection of resistant strains and lead to persistence in the food chain. Such knowledge is needed to develop more effective targets for future mitigation strategies, and prevent the establishment of potentially high-risk strains in food processing environments.    193 Works cited Aase, B., Sundheim, G., Langsrud, S., and Rorvik, L.M., 2000. Occurrence of and a possible mechanism for resistance to a quaternary ammonium compound in Listeria monocytogenes. Int. J. Food Microbiol. 62, 57-63. Allen, K.J. and Poppe, C., 2002. Phenotypic and genotypic characterization of food animal isolates of Salmonella with reduced sensitivity to ciprofloxacin. Microb. Drug Resist. 8, 375-383. Allerberger, F., 2003. Listeria: growth, phenotypic differentiation and molecular microbiology. FEMS Immun. Med. Microbiol. 35, 183-189. Allerberger, F. and Wagner, M., 2010. Listeriosis: a resurgent foodborne infection. Clin. Microbiol. Infect. 16, 16-23. Anonymous. 1981. Milk Industry Standards Regulation. Milk Industry Act.  B.C. Reg. 464/81, O.C. 2404/81. Available at: http://www.bclaws.ca/EPLibraries/bclaws_new/document/ID/freeside/10_464_81. Accessed 30 July, 2014. Anonymous. 1996. Fish Inspection Act. Chapter 148. Available at: http://www.bclaws.ca/EPLibraries/bclaws_new/document/ID/freeside/00_96148_01. Accessed 30 July, 2014. Anonymous. 1999. Food Premises Regulation. Public Health Act. B.C. Reg. 210/99, O.C. 774/99 Available at: http://www.bclaws.ca/EPLibraries/bclaws_new/document/ID/freeside/11_210_99. Accessed 30 July, 2014. Anonymous. 2004. Meat Inspection Regulation. Food Safety Act. B.C. Reg. 349/2004, O.C. 798/2004. Available at: http://www.bclaws.ca/EPLibraries/bclaws_new/document/ID/freeside/10_349_2004 - section10. Accessed 30 July, 2014. Anonymous. 2010. Food Safety Act. Chapter 28. [SBC 2002]. Available at: http://www.bclaws.ca/EPLibraries/bclaws_new/document/ID/freeside/00_02028_01. Accessed 30 July, 2014. Archambaud, C., Gouin, E., Pizarro-Cerda, J., Cossart, P., and Dussurget, O., 2005. Translation elongation factor EF-Tu is a target for Stp, a serine-threonine phosphatase involved in virulence of Listeria monocytogenes. Mol. Microbiol. 56, 383-396. Arguedas-Villa, C., Kovacevic, J., Allen, K.J., Stephan, R., and Tasara, T., 2014. Cold growth behaviour and genetic comparison of Canadian and Swiss Listeria monocytogenes strains associated with the food supply chain and human listeriosis cases. Food Microbiol. 40, 81-87. Arguedas-Villa, C., Stephan, R., and Tasara, T., 2010. Evaluation of cold growth and related gene transcription responses associated with Listeria monocytogenes strains of different origins. Food Microbiol. 27, 653-660. Arous, S., Buchrieser, C., Folio, P., Glaser, P., Namane, A., Hebraud, M., and Hechard, Y., 2004. Global analysis of gene expression in an rpoN mutant of Listeria monocytogenes. Microbiol. 150, 1581-1590. Aureli, P., Ferrini, A.M., Mannoni, V., Hodzic, S., Wedell-Weergaard, C., and Oliva, B., 2003. Susceptibility of Listeria monocytogenes isolated from food in Italy to antibiotics. Int. J. Food Microbiol. 83, 325-330.   194 Baranyi, J. and Roberts, T.A., 1994. A dynamic approach to predicting bacterial growth in food. Int. J. Food Microbiol. 23, 277–294. Barbalho, T.C.F., Almeida, P.F., Almeida, R.C.C., and Hofer, E., 2005. Prevalence of Listeria spp. at a poultry processing plant in Brazil and a phage test for rapid confirmation of suspected colonies. Food Control 16, 211-216. Barros, M.A.F., Nero, L.A., Silva, L.C., d'Ovidio, L., Monteiro, F.A., Tamanini, R., Fagnani, R., Hofer, E., and Beloti, V., 2007. Listeria monocytogenes: Occurrence in beef and identification of the main contamination points in processing plants. Meat Sci. 76, 591-596. Bay, D.C., Rommens, K.L., and Turner, R.J., 2008. Small multidrug resistance proteins: a multidrug transporter family that continues to grow. Biochim. Biophys. Acta 1778, 1814-1838. Bayles, D.O., Annous, B.A., and Wilkinson, B.J., 1996. Cold stress proteins induced in Listeria monocytogenes in response to temperature downshock and growth at low temperatures. Appl. Environ. Microbiol. 62, 1116-1119. Bayles, D.O. and Wilkinson, B.J., 2000. Osmoprotectants and cryoprotectants for Listeria monocytogenes. Lett. Appl. Microbiol. 30, 23-27. BCCDC. 2010. Food and your health. Food monitoring. Available at: http://www.bccdc.ca/foodhealth/foodguidelines/FoodMonitoring.htm. Accessed 20 May, 2014. Bécavin, C., Bouchier, C., Lechat, P., Archambaud, C., Creno, S., Gouin, E., Wu, Z., Kuhbacher, A., Brisse, S., Pucciarelli, M.G., Garcia-del Portillo, F., Hain, T., Portnoy, D.A., Chakraborty, T., Lecuit, M., Pizarro-Cerda, J., Moszer, I., Bierne, H., and Cossart, P., 2014. Comparison of widely used Listeria monocytogenes strains EGD, 10403S, and EGD-e highlights genomic variations underlying differences in pathogenicity. MBio 5, e00969-00914. doi:00910.01128/mBio.00969-00914. Bertsch, D., Rau, J., Eugster, M.R., Haug, M.C., Lawson, P.A., Lacroix, C., and Meile, L., 2013. Listeria fleischmannii sp. nov., isolated from cheese. Int. J. Syst. Evol. Microbiol. 63, 526-532. Bērziņš, A., Terentjeva, M., and Korkeala, H., 2009. Prevalence and genetic diversity of Listeria monocytogenes in vacuum-packaged ready-to-eat meat products at retail markets in Latvia. J. Food Prot. 72, 1283-1287. Beumer, R.R., Te Giffel, M.C., Cox, L.J., Rombouts, F.M., and Abee, T., 1994. Effect of exogenous proline, betaine, and carnitine on growth of Listeria monocytogenes in a minimal medium. Appl. Environ. Microbiol. 60, 1359-1363. Bigot, A., Pagniez, H., Botton, E., Frehel, C., Dubail, I., Jacquet, C., Charbit, A., and Raynaud, C., 2005. Role of FliF and FliI of Listeria monocytogenes in flagellar assembly and pathogenicity. Infect. Immun. 73, 5530-5539. Bille, J., Blanc, D.S., Schmid, H., Boubaker, K., Baumgartner, A., Siegrist, H.H., Tritten, M.L., Lienhard, R., Berner, D., Anderau, R., Treboux, M., Ducommun, J.M., Malinverni, R., Genne, D., Erard, P.H., and Waespi, U., 2006. Outbreak of human listeriosis associated with tomme cheese in northwest Switzerland, 2005. Euro Surveill. 11, 91-93. Birnboim, H.C. and Doly, J., 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, 1513-1523.   195 Bohaychuk, V.M., Gensler, G.E., King, R.K., Manninen, K.I., Sorensen, O., Wu, J.T., Stiles, M.E., and McMullen, L.M., 2006. Occurrence of pathogens in raw and ready-to-eat meat and poultry products collected from the retail marketplace in Edmonton, Alberta, Canada. J. Food Prot. 69, 2176-2182. Boisivon, A., Guiomar, C., and Carbon, C., 1990. In vitro bactericidal activity of amoxicillin, gentamicin, rifampicin, ciprofloxacin and trimethoprim-sulfamethoxazole alone or in combination against Listeria monocytogenes. Europ. J. Clin. Microbiol. Infect. Dis. 9, 206-209. Bonazzi, M., Lecuit, M., and Cossart, P., 2009. Listeria monocytogenes internalin and E-cadherin: from structure to pathogenesis. Cell. Microbiol. 11, 693-702. Bortolussi, R., 2008. Listeriosis: a primer. Can. Med. Assoc. J. 179, 795-797. Braun, L., Ohayon, H., and Cossart, P., 1998. The InIB protein of Listeria monocytogenes is sufficient to promote entry into mammalian cells. Molec. Microbiol. 27, 1077-1087. Buncic, S., Avery, S.M., Rocourt, J., and Dimitrijevic, M., 2001. Can food-related environmental factors induce different behaviour in two key serovars, 4b and 1/2a, of Listeria monocytogenes? Int. J. Food Microbiol. 65, 201-212. Cabanes, D., Dehoux, P., Dussurget, O., Frangeul, L., and Cossart, P., 2002. Surface proteins and the pathogenic potential of Listeria monocytogenes. Trends Microbiol. 10, 238-245. Cabanes, D., Dussurget, O., Dehoux, P., and Cossart, P., 2004. Auto, a surface associated autolysin of Listeria monocytogenes required for entry into eukaryotic cells and virulence. Mol. Microbiol. 51, 1601-1614. Cabanes, D., Sousa, S., and Cossart, P., 2011. Listeria genomics, p. 141-170. In: Wiedmann, M. and Zhang, W. (Eds.), Genomics of Foodborne Bacterial Pathogens. Springer, New York. Cabedo, L., Picart i Barrot, L., and Teixidó i Canelles, A., 2008. Prevalence of Listeria monocytogenes and Salmonella in ready-to-eat food in Catalonia, Spain. J. Food Prot. 71, 855-859. Camilli, A., Goldfine, H., and Portnoy, D.A., 1991. Listeria monocytogenes mutants lacking phosphatidylinositol-specific phospholipase C are avirulent. J. Exp. Med. 173, 751. Camilli, A., Tilney, L.G., and Portnoy, D.A., 1993. Dual roles of plcA in Listeria monocytogenes pathogenesis. Mol. Microbiol. 8, 143-157. Cantarelli, V.V., Kodama, T., Nijstad, N., Abolghait, S.K., Iida, T., and Honda, T., 2006. Cortactin is essential for F-actin assembly in enteropathogenic Escherichia coli (EPEC)- and enterohaemorrhagic E. coli (EHEC)-induced pedestals and the alpha-helical region is involved in the localization of cortactin to bacterial attachment sites. Cell. Microbiol. 8, 769-780. Carlton, R., Noordman, W., Biswas, B., De Meester, E., and Loessner, M., 2005. Bacteriophage P100 for control of Listeria monocytogenes in foods: genome sequence, bioinformatic analyses, oral toxicity study, and application. Regul. Toxicol.  Pharmacol. 43, 301-312. Casey, A., Fox, E.M., Schmitz-Esser, S., Coffey, A., McAuliffe, O., and Jordan, K., 2014. Transcriptome analysis of Listeria monocytogenes exposed to biocide stress reveals a multi-system response involving cell wall synthesis, sugar uptake, and motility. Front. Microbiol. 5, 68.   196 CDC, 2002. Centers for Disease Control and Prevention. Outbreak of Listeriosis - Northeastern United States, 2002. Morb. Mortal. Wkly. Rep. 51, 950-951. CDC, 2011. Multistate Outbreak of Listeriosis Associated with Jensen Farms Cantaloupe --- United States, August--September 2011. Morb. Mortal. Wkly. Rep. 60, 1357-1358. CDC. 2012. Multistate outbreak of listeriosis linked to imported frescolina marte brand ricotta salata cheese (final update). Available at: http://www.cdc.gov/listeria/outbreaks/cheese-09-12/. Accessed 20 July, 2014. CDC. 2013. Multistate outbreak of listeriosis linked to Crave Brothers farmstead cheeses (final update). Available at: http://www.cdc.gov/listeria/outbreaks/cheese-07-13/. Accessed 20 July, 2014. CDC. 2014. Multistate outbreak of listeriosis linked to Roos Foods dairy products (final update). Available at: http://www.cdc.gov/listeria/outbreaks/cheese-02-14/. Accessed 20 July, 2014. CFIA. 2011. Food microbiology. National microbiology monitoring program. Available at: http://www.inspection.gc.ca/english/fssa/microchem/micro/microe.shtml. Accessed 20 May, 2014. CFIA. 2014. Complete listing of all recalls and allergy alerts. Available at: http://inspection.gc.ca/about-the-cfia/newsroom/food-recall-warnings/complete-listing/eng/1351519587174/1351519588221?ay=2013&fr=22&fc=0&fd=0&ft=1. Accessed 24 July, 2014. Chae, M.S. and Schraft, H., 2000. Comparative evaluation of adhesion and biofilm formation of different Listeria monocytogenes strains. Int. J. Food Microbiol. 62, 103-111. Chakraborty, T., Ebel, F., Domann, E., Niebuhr, K., Gerstel, B., Pistor, S., Temm-Grove, C.J., Jockusch, B.M., Reinhard, M., Walter, U., and et al., 1995. A focal adhesion factor directly linking intracellularly motile Listeria monocytogenes and Listeria ivanovii to the actin-based cytoskeleton of mammalian cells. EMBO J. 14, 1314-1321. Chan, Y.C., Hu, Y., Chaturongakul, S., Files, K.D., Bowen, B.M., Boor, K.J., and Wiedmann, M., 2008. Contributions of two-component regulatory systems, alternative σ factors, and negative regulators to Listeria monocytogenes cold adaptation and cold growth. J. Food Prot. 71, 420-425. Chantret, I., Rodolosse, A., Barbat, A., Dussaulx, E., Brot-Laroche, E., Zweibaum, A., and Rousset, M., 1994. Differential expression of sucrase-isomaltase in clones isolated from early and late passages of the cell line Caco-2: evidence for glucose-dependent negative regulation. J. Cell Sci. 107 ( Pt 1), 213-225. Chao, G., Deng, Y., Zhou, X., Xu, Q., Qian, X., Zhou, L., and Zhu, B., 2006. Prevalence of Listeria monocytogenes in delicatessen food products in China. Food Control 17, 971-974. Charpentier, E. and Courvalin, P., 1999. Antibiotic resistance in Listeria spp. Antimicrob. Agents Chemotherap. 43, 2103-2108. Charpentier, E., Gerbaud, G., Jacquet, C., Rocourt, J., and Courvalin, P., 1995. Incidence of antibiotic resistance in Listeria species. J. Infect. Dis. 172, 277-281. Chasseignaux, E., Gérault, P., Toquin, M.-T., Salvat, G., Colin, P., and Ermel, G., 2002. Ecology of Listeria monocytogenes in the environment of raw poultry meat and raw pork meat processing plants. FEMS Microbiol. Lett. 210, 271-275.   197 Chasseignaux, E., Toquin, M.-T., Ragimbeau, C., Salvat, G., Colin, P., and Ermel, G., 2001. Molecular epidemiology of Listeria monocytogenes isolates collected from the environment, raw meat and raw products in two poultry- and pork-processing plants. J. Appl. Microbiol. 91, 888-899. Chaturongakul, S., Raengpradub, S., Palmer, M.E., Bergholz, T.M., Orsi, R.H., Hu, Y., Ollinger, J., Wiedmann, M., and Boor, K.J., 2011. Transcriptomic and phenotypic analyses identify coregulated, overlapping regulons among PrfA, CtsR, HrcA, and the alternative sigma factors σB, σC, σH, and σL in Listeria monocytogenes. Appl. Environ. Microbiol. 77, 187-200. Chaturongakul, S., Raengpradub, S., Wiedmann, M., and Boor, K.J., 2008. Modulation of stress and virulence in Listeria monocytogenes. Trends Microbiol. 16, 388-396. Chen, B.Y., Pyla, R., Kim, T.J., Silva, J.L., and Jung, Y.S., 2010. Antibiotic resistance in Listeria species isolated from catfish fillets and processing environment. Lett. Appl. Microbiol. 50, 626-632. Chen, J., Zhang, X., Mei, L., Jiang, L., and Fang, W., 2009. Prevalence of Listeria in Chinese food products from 13 provinces between 2000 and 2007 and virulence characterization of Listeria monocytogenes isolates. Foodborne Pathog. Dis. 6, 7-14. Chen, Y. and Knabel, S.J., 2008. Strain typing, p. 203-240. In: Liu, D. (Ed.), Handbook of Listeria monocytogenes. CRC Press, Boca Raton, FL. Chen, Y., Ross, W., Gray, M., Wiedmann, M., Whiting, R., and Scott, V., 2006. Attributing risk to Listeria monocytogenes subgroups: dose response in relation to genetic lineages. J. Food Prot. 69, 335-344. Chen, Y., Ross, W.H., Whiting, R.C., Van Stelten, A., Nightingale, K.K., Wiedmann, M., and Scott, V.N., 2011. Variation in Listeria monocytogenes dose responses in relation to subtypes encoding a full-length or truncated Internalin A. Appl. Environ. Microbiol. 77, 1171-1180. Chenal-Francisque, V., Lopez, J., Cantinelli, T., Caro, V., Tran, C., Leclercq, A., Lecuit, M., and Brisse, S., 2011. Worldwide distribution of major clones of Listeria monocytogenes. Emerg. Infect. Dis. 17, 1110-1112. Christensen, E.G., Gram, L., and Kastbjerg, V.G., 2011. Sublethal triclosan exposure decreases susceptibility to gentamicin and other aminoglycosides in Listeria monocytogenes. Antimicrob. Agents Chemother. 55, 4064-4071. Christiansen, J.K., Nielsen, J.S., Ebersbach, T., Valentin-Hansen, P., Sogaard-Andersen, L., and Kallipolitis, B.H., 2006. Identification of small Hfq-binding RNAs in Listeria monocytogenes. RNA 12, 1383-1396. Clark, C.G., Farber, J., Pagotto, F., Ciampa, N., Doré, K., Nadon, C., Bernard, K., and Ng, L.-K., 2010. Surveillance for Listeria monocytogenes and listeriosis, 1995-2004. Epidemiol. Infect. 138, 559-572. Clinical and Laboratory Standards Institute, 2011. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-First Informational Supplement (M100-S21). Clinical and Laboratory Standards Institute, Wayne, PA. Colburn, K., Kaysner, C., Abeyta, C., and Wekell, M., 1990. Listeria species in a California coast estuarine environment. Appl. Environ. Microbiol. 56, 2007 - 2011. Conter, M., Paludi, D., Zanardi, E., Ghidini, S., Vergara, A., and Ianieri, A., 2009. Characterization of antimicrobial resistance of foodborne Listeria monocytogenes. Int. J. Food Microbiol. 128, 497-500.   198 Cossart, P., 2000. Actin-based motility of pathogens: the Arp2/3 complex is a central player. Cell. Microbiol. 2, 195-205. Cossart, P. and Bierne, H., 2001. The use of host cell machinery in the pathogenesis of Listeria monocytogenes. Curr. Opin. Immunol. 13, 96-103. Cossart, P. and Lebreton, A., 2014. A trip in the "New Microbiology" with the bacterial pathogen Listeria monocytogenes. FEBS Lett. 588, 2437-2445. Cossart, P., Vicente, M., Mengaud, J., Baquero, F., Perez-Diaz, J., and Berche, P., 1989. Listeriolysin O is essential for virulence of Listeria monocytogenes: direct evidence obtained by gene complementation. Infect. Immun. 57, 3629-3636. Cotter, P.D., Gahan, C.G., and Hill, C., 2000. Analysis of the role of the Listeria monocytogenes F0F1-AtPase operon in the acid tolerance response. Int. J. Food Microbiol. 60, 137-146. Davis, J.A. and Jackson, C.R., 2009. Comparative antimicrobial susceptibility of Listeria monocytogenes, L. innocua, and L. welshimeri. Microb. Drug Res. 15, 27-32. den Bakker, H.C., Warchocki, S., Wright, E.M., Allred, A.F., Ahlstrom, C., Manuel, C.S., Stasiewicz, M.J., Burrell, A., Roof, S., Strawn, L.K., Fortes, E., Nightingale, K.K., Kephart, D., and Wiedmann, M., 2014. Listeria floridensis sp. nov., Listeria aquatica sp. nov., Listeria cornellensis sp. nov., Listeria riparia sp. nov. and Listeria grandensis sp. nov., from agricultural and natural environments. Int. J. Syst. Evol. Microbiol. 64, 1882-1889. Depardieu, F., Podglajen, I., Leclercq, R., Collatz, E., and Courvalin, P., 2007. Modes and modulations of antibiotic resistance gene expression. Clin. Microbiol. Rev. 20, 79-114. Desvaux, M.l. and Hébraud, M., 2008. Analysis of cell envelope proteins, p. 359-393. In: Liu, D. (Ed.), Handbook of Listeria monocytogenes. CRC Press, Boca Raton, FL. Dillon, R., Patel, T., and Ratnam, S., 1994. Occurrence of Listeria in hot and cold smoked seafood products. Int. J. Food Microbiol. 22, 73-77. Disson, O., Grayo, S., Huillet, E., Nikitas, G., Langa-Vives, F., Dussurget, O., Ragon, M., Le Monnier, A., Babinet, C., Cossart, P., and Lecuit, M., 2008. Conjugated action of two species-specific invasion proteins for fetoplacental listeriosis. Nature 455, 1114-1118. Dold, F.G., Sanger, J.M., and Sanger, J.W., 1994. Intact alpha-actinin molecules are needed for both the assembly of actin into the tails and the locomotion of Listeria monocytogenes inside infected cells. Cell Motil. Cytoskeleton 28, 97-107. Dominguez, C., Gomez, I., and Zumalacarregui, J., 2001. Prevalence and contamination levels of Listeria monocytogenes in smoked fish and pâté sold in Spain. J. Food Prot. 64, 2075-2077. Donnelly, C.W., 2001. Listeria monocytogenes: A Continuing Challenge. Nutr. Rev. 59, 183-194. Dons, L., Eriksson, E., Jin, Y., Rottenberg, M.E., Kristensson, K., Larsen, C.N., Bresciani, J., and Olsen, J.E., 2004. Role of flagellin and the two-component CheA/CheY system of Listeria monocytogenes in host cell invasion and virulence. Infect. Immun. 72, 3237-3244. Doumith, M., Cazalet, C., Simoes, N., Frangeul, L., Jacquet, C., Kunst, F., Martin, P., Cossart, P., Glaser, P., and Buchrieser, C., 2004. New aspects regarding evolution and virulence of Listeria monocytogenes revealed by comparative genomics and DNA arrays. Infect. Immun. 72, 1072-1083.   199 Dramsi, S., Biswas, I., Maguin, E., Braun, L., Mastroeni, P., and Cossart, P., 1995. Entry of Listeria monocytogenes into hepatocytes requires expression of InIB, a surface protein of the internalin multigene family. Mol. Microbiol. 16, 251-261. Dramsi, S., Bourdichon, F., Cabanes, D., Lecuit, M., Fsihi, H., and Cossart, P., 2004. FbpA, a novel multifunctional Listeria monocytogenes virulence factor. Molec. Microbiol. 53, 639-649. Dramsi, S. and Cossart, P., 2003. Listeriolysin O- mediated calcium influx potentiates entry of Listeria monocytogenes into human Hep-2 epithelial cell line. Infect. Immun. 71, 3614-3618. Drevets, D.A., Leenen, P.J.M., and Greenfield, R.A., 2004. Invasion of the central nervous system by intracellular bacteria. Clin. Microbiol. Rev. 17, 323-347. Dunn, K.A., Bielawski, J.P., Ward, T.J., Urquhart, C., and Gu, H., 2009. Reconciling ecological and genomic divergence among lineages of Listeria under an "extended mosaic genome concept". Mol. Biol. Evol. 26, 2605-2615. Dussurget, O., Pizarro-Cerda, J., and Cossart, P., 2004. Molecular determinants of Listeria monocytogenes virulence. Ann. Rev. Microbiol. 58, 587-610. Dutta, V., Elhanafi, D., and Kathariou, S., 2013. Conservation and distribution of the benzalkonium chloride resistance cassette bcrABC in Listeria monocytogenes. Appl. Environ. Microbiol. 79, 6067-6074. Earnshaw, A.M. and Lawrence, L.M., 1998. Sensitivity to commercial disinfectants, and the occurrence of plasmids within various Listeria monocytogenes genotypes isolated from poultry products and the poultry processing environment. J. Appl. Microbiol. 84, 642-648. Edman, D.C., Pollock, M.B., and Hall, E.R., 1968. Listeria monocytogenes L forms. I. Induction maintenance, and biological characteristics. J. Bacteriol. 96, 352-357. EFSA, 2010. The community summary report on trends and sources of zoonoses, zoonotic zgents, antimicrobial resistance and foodborne outbreaks in the European Union in 2008. EFSA Journal 1496, 1-288. Eklund, M.W., Poysky, F.T., Paranjpye, R.N., Lashbrook, L.C., Peterson, M.E., and Pelroy, G.A., 1995. Incidence and sources of Listeria monocytogenes in cold-smoked fishery products and processing plants. J. Food Prot. 58, 502-508. Elhanafi, D., Dutta, V., and Kathariou, S., 2010. Genetic characterization of plasmid-associated benzalkonium chloride resistance determinants in a Listeria monocytogenes strain from the 1998-1999 outbreak. Appl. Environ. Microbiol. 76, 8231-8238. Ells, T.C. and Truelstrup Hansen, L., 2011. Increased thermal and osmotic stress resistance in Listeria monocytogenes 568 grown in the presence of trehalose due to inactivation of the phosphotrehalase-encoding gene treA. Appl. Environ. Microbiol. 77, 6841-6851. FAO and WHO. 2004. Risk assessment of Listeria monocytogenes in ready-to-eat foods: interpretative summary. Available at: http://www.who.int/foodsafety/publications/micro/en/mra4.pdf. Accessed 20 October, 2013. Farber, J.M., 1991. Listeria monocytogenes in fish products. J. Food Prot. 54, 922-924,. Farber, J.M., 2000. Present situation in Canada regarding Listeria monocytogenes and ready-to-eat seafood products. Int. J. Food Microbiol. 62, 247-251.   200 Farber, J.M. and Daley, E., 1994. Presence and growth of Listeria monocytogenes in naturally-contaminated meats. Int. J. Food Microbiol. 22, 33-42. Farber, J.M., Johnston, M.A., Purvis, U., and Loit, A., 1987. Surveillance of soft and semi-soft cheeses for the presence of Listeria spp. Int. J. Food Microbiol. 5, 157-163. Farber, J.M., Pagotto, F., and Scherf, C., 2007. Incidence and behavior of Listeria monocytogenes in meat products, p. 503-570. In: Ryser, E.T. and Marth, E.H. (Eds.), Listeria, Listeriosis, and Food Safety, Third Edition. CRC Press, Boca Raton. Farber, J.M. and Peterkin, P.I., 1991. Listeria monocytogenes, a food-borne pathogen. Microbiol. Mol. Biol. Rev. 55, 476-511. Felicio, M.T., Hogg, T., Gibbs, P., Teixeira, P., and Wiedmann, M., 2007. Recurrent and sporadic Listeria monocytogenes contamination in alheiras represents considerable diversity, including virulence-attenuated isolates. Appl. Environ. Microbiol. 73, 3887-3895. Fenlon, D.R., 1999. Listeria monocytogenes in the natural environment, p. 21-38. In: Ryser, E.T. and Marth, E.H. (Eds.), Listeria, Listeriosis, and Food Safety. Marcel Decker Inc., New York. Ferreira, V., Barbosa, J., Stasiewicz, M., Vongkamjan, K., Moreno Switt, A., Hogg, T., Gibbs, P., Teixeira, P., and Wiedmann, M., 2011. Diverse geno- and phenotypes of persistent Listeria monocytogenes isolates from fermented meat sausage production facilities in Portugal. Appl. Environ. Microbiol. 77, 2701-2715. Food Standards Agency. 2008. A microbiological survey of retail smoked fish with particular reference to the presence of Listeria monocytogenes. Available at: http://www.foodbase.org.uk/results.php?f_report_id=261. Accessed 4 February, 2014. Fox, E., O'Mahony, T., Clancy, M., Dempsey, R., O'Brien, M., and Jordan, K., 2009. Listeria monocytogenes in the Irish dairy farm environment. J. Food Prot. 72, 1450-1456. Fretz, R., Sagel, U., Ruppitsch, W., Pietzka, A., Stoger, A., Huhulescu, S., Heuberger, S., Pichler, J., Much, P., Pfaff, G., Stark, K., Prager, R., Flieger, A., Feenstra, O., and Allerberger, F., 2010. Listeriosis outbreak caused by acid curd cheese Quargel , Austria and Germany 2009. Euro Surveill. 15,  Available at: http://www.ncbi.nlm.nih.gov/pubmed/20144447. Accessed 20 July, 2014. Gaillard, J.L., Berche, P., Frehel, C., Gouln, E., and Cossart, P., 1991. Entry of L. monocytogenes into cells is mediated by internalin, a repeat protein reminiscent of surface antigens from gram-positive cocci. Cell 65, 1127-1141. Gaillard, J.L., Berche, P., and Sansonetti, P., 1986. Transposon mutagenesis as a tool to study the role of hemolysin in the virulence of Listeria monocytogenes. Infect. Immun. 52, 50-55. Gaillard, J.L. and Finlay, B.B., 1996. Effect of cell polarization and differentiation on entry of Listeria monocytogenes into the enterocyte-like Caco-2 cell line. Infect. Immun. 64, 1299-1308. Garrido, V., Vitas, A.I., and García-Jalón, I., 2009. Survey of Listeria monocytogenes in ready-to-eat products: Prevalence by brands and retail establishments for exposure assessment of listeriosis in Northern Spain. Food Control 20, 986-991. Gaulin, C., Ramsay, D., and Bekal, S., 2012. Widespread listeriosis outbreak attributable to pasteurized cheese, which led to extensive cross-contamination affecting cheese retailers, Quebec, Canada, 2008. J. Food Prot. 75, 71-78.   201 Gedde, M.M., Higgins, D.E., Tilney, L.G., and Portnoy, D.A., 2000. Role of listeriolysin O in cell-to-cell spread of Listeria monocytogenes. Infect. Immun. 68, 999-1003. Geginat, G. and Grauling-Halama, S., 2008. Innate immunity, p. 397-426. In: Liu, D. (Ed.), Handbook of Listeria monocytogenes. CRC Press, Boca Raton, FL. Genomes OnLine Database. 2012. GOLD: Genomes OnLine Database v.5. Available at: http://www.genomesonline.org/index. Accessed 15 June, 2014. Gianfranceschi, M., Gattuso, A., Tartaro, S., and Aureli, P., 2003. Incidence of Listeria monocytogenes in food and environmental samples in Italy between 1990 and 1999: Serotype distribution in food, environmental and clinical samples. Eur. J. Epidemiol. 18, 1001-1006. Gilbert, P. and Moore, L.E., 2005. Cationic antiseptics: diversity of action under a common epithet. J. Appl. Microbiol. 99, 703-715. Gillespie, I.A., McLauchlin, J., Little, C.L., Penman, C., Mook, P., Grant, K., and O'Brien, S.J., 2009. Disease presentation in relation to infection foci for non-pregnancy- associated human listeriosis in England and Wales, 2001 to 2007. J. Clin. Microbiol. 47, 3301-3307. Gilmour, M., Graham, M., Van Domselaar, G., Tyler, S., Kent, H., Trout-Yakel, K., Larios, O., Allen, V., Lee, B., and Nadon, C., 2010. High-throughput genome sequencing of two Listeria monocytogenes clinical isolates during a large foodborne outbreak. BMC Genomics 11, 120. doi:110.1186/1471-2164-1111-1120. Giovannacci, I., Ermel, G., Salvat, G., Vendeuvre, J.L., and Bellon-Fontaine, M.N., 2000. Physicochemical surface properties of five Listeria monocytogenes strains from a pork-processing environment in relation to serotypes, genotypes and growth temperature. J. Appl. Microbiol. 88, 992-1000. Glaser, P., Frangeul, L., Buchrieser, C., Rusniok, C., Amend, A., Baquero, F., Berche, P., Bloecker, H., Brandt, P., Chakraborty, T., Charbit, A., Chetouani, F., Couvo, E., de Daruvar, A., Dehoux, P., Domann, E., Dominguez-Bernal, G., Duchaud, E., Durant, L., Dussurget, O., Entian, K.-D., Fsihi, H., Portillo, F.G.-D., Garrido, P., Gautier, L., Goebel, W., Gomez-Lopez, N., Hain, T., Hauf, J., Jackson, D., Jones, L.-M., Kaerst, U., Kreft, J., Kuhn, M., Kunst, F., Kurapkat, G., Madueo, E., Maitournam, A., Vicente, J.M., Ng, E., Nedjari, H., Nordsiek, G., Novella, S., de Pablos, B., Perez-Diaz, J.-C., Purcell, R., Remmel, B., Rose, M., Schlueter, T., Simoes, N., Tierrez, A., Vazquez-Boland, J.-A., Voss, H., Wehland, J., and Cossart, P., 2001. Comparative genomics of Listeria species. Science 294, 849-852. Glass, K.A. and Doyle, M.P., 1989. Fate of Listeria monocytogenes in processed meat products during refrigerated storage. Appl. Environ. Microbiol. 55, 1565-1569. Godreuil, S., Galimand, M., Gerbaud, G., Jacquet, C., and Courvalin, P., 2003. Efflux pump Lde is associated with fluoroquinolone resistance in Listeria monocytogenes. Antimicrob. Agents Chemother. 47, 704-708. Granier, S.A., Moubareck, C., Colaneri, C., Lemire, A., Roussel, S., Dao, T.T., Courvalin, P., and Brisabois, A., 2011. Antimicrobial resistance of Listeria monocytogenes isolates from food and the environment in France over a 10-year period. Appl. Environ. Microbiol. 77, 2788-2790. Grant, C.C., Konkel, M.E., Cieplak, W., Jr., and Tompkins, L.S., 1993. Role of flagella in adherence, internalization, and translocation of Campylobacter jejuni in nonpolarized and polarized epithelial cell cultures. Infect. Immun. 61, 1764-1771.   202 Graves, L., Hunter, S., and Swaminathan, B., 2007. Subtyping Listeria monocytogenes, p. 283-304. In: Ryser, E.T. and Marth, E.H. (Eds.), Listeria, Listeriosis, and Food Safety, Third Edition. CRC Press, Boca Raton. Graves, L.M., Helsel, L.O., Steigerwalt, A.G., Morey, R.E., Daneshvar, M.I., Roof, S.E., Orsi, R.H., Fortes, E.D., Millilo, S.R., den Bakker, H.C., Wiedmann, M., Swaminathan, B., and Sauders, B.D., 2010. Listeria marthii sp. nov., isolated from the natural environment, Finger Lakes National Forest. Intl. J. Syst. Evol. Microbiol. 60, 1280-1288. Gray, M.J., Zadoks, R.N., Fortes, E.D., Dogan, B., Cai, S., Chen, Y., Scott, V.N., Gombas, D.E., Boor, K.J., and Wiedmann, M., 2004. Listeria monocytogenes isolates from foods and humans form distinct but overlapping populations. Appl. Environ. Microbiol. 70, 5833-5841. Grundler, T., Quednau, N., Stump, C., Orian-Rousseau, V., Ishikawa, H., Wolburg, H., Schroten, H., Tenenbaum, T., and Schwerk, C., 2013. The surface proteins InlA and InlB are interdependently required for polar basolateral invasion by Listeria monocytogenes in a human model of the blood-cerebrospinal fluid barrier. Microbes Infect. 15, 291-301. Grundling, A., Gonzalez, M.D., and Higgins, D.E., 2003. Requirement of the Listeria monocytogenes broad-range phospholipase PC-PLC during infection of human epithelial cells. J. Bacteriol. 185, 6295-6307. Guenther, S., Huwyler, D., Richard, S., and Loessner, M.J., 2009. Virulent bacteriophage for efficient biocontrol of Listeria monocytogenes in ready-to-eat foods. Appl. Environ.  Microbiol. 75, 93-100. Guillet, C., Join-Lambert, O., Le Monnier, A., Leclercq, A., Mechaï, F., Mamzer-Bruneel, M.F., Bielecka, M.K., Scortti, M., Disson, O., and Berche, P., 2010. Human listeriosis caused by Listeria ivanovii. Emerg. Infect. Dis. 16, 136-138. Guiney, D.G. and Lesnick, M., 2005. Targeting of the actin cytoskeleton during infection by Salmonella strains. Clin. Immunol. 114, 248-255. Hadorn, K., Hachler, H., Schaffner, A., and Kayser, F.H., 1993. Genetic characterization of plasmid-encoded multiple antibiotic resistance in a strain of Listeria monocytogenes causing endocarditis. Eur. J. Clin. Microbiol. Infect. Dis. 12, 928-937. Handa-Miya, S., Kimura, B., Takahashi, H., Sato, M., Ishikawa, T., Igarashi, K., and Fujii, T., 2007. Nonsense-mutated inlA and prfA not widely distributed in Listeria monocytogenes isolates from ready-to-eat seafood products in Japan. Int. J. Food Microbiol. 117, 312 - 318. Hartemink, R. and Georgsson, F., 1991. Incidence of Listeria species in seafood and seafood salads. Int. J. Food Microbiol. 12, 189-195. Health Canada. 2011. Policy on Listeria monocytogenes in ready-to-eat foods. Available at: http://www.hc-sc.gc.ca/fn-an/legislation/pol/policy_listeria_monocytogenes_2011-eng.php. Accessed 20 October, 2013. Herler, M., Bubert, A., Goetz, M., Vega, Y., Vazquez-Boland, J.A., and Goebel, W., 2001. Positive selection of mutations leading to loss or reduction of transcriptional activity of PrfA, the central regulator of Listeria monocytogenes virulence. J. Bacteriol. 183, 5562-5570.   203 Higgs, H.N., Blanchoin, L., and Pollard, T.D., 1999. Influence of the C terminus of Wiskott-Aldrich syndrome protein (WASp) and the Arp2/3 complex on actin polymerization. Biochem. 38, 15212-15222. Hill, C., Cotter, P.D., Sleator, R.D., and Gahan, C.G.M., 2002. Bacterial stress response in Listeria monocytogenes: jumping the hurdles imposed by minimal processing. Int. Dairy J. 12, 273-283. Hof, H., 2004. An update on the medical management of listeriosis. Expert Opin. Pharmacother. 5, 1727-1735. Hof, H., Nichterlein, T., and Kretschmar, M., 1997. Management of listeriosis. Clin. Microbiol. Rev. 10, 345-357. Hoffmann, R.F., McLernon, S., Feeney, A., Hill, C., and Sleator, R.D., 2013. A single point mutation in the listerial betL σA-dependent promoter leads to improved osmo- and chill-tolerance and a morphological shift at elevated osmolarity. Bioengineered 4, 401-407. Holah, J.T., Bird, J., and Hall, K.E., 2004. The microbial ecology of high-risk, chilled food factories; evidence for persistent Listeria spp. and Escherichia coli strains. J. Appl. Microbiol. 97, 68-77. Holah, J.T., Taylor, J.H., Dawson, D.J., and Hall, K.E., 2002. Biocide use in the food industry and the disinfectant resistance of persistent strains of Listeria monocytogenes and Escherichia coli. Symp. Ser. Soc. Appl. Microbiol. 92, 111S-120S. Horn, G., Hofweber, R., Kremer, W., and Kalbitzer, H.R., 2007. Structure and function of bacterial cold shock proteins. Cell. Mol. Life Sci. 64, 1457-1470. Inoue, S., Nakama, A., Arai, Y., Kokubo, Y., Maruyama, T., Saito, A., Yoshida, T., Terao, M., Yamamoto, S., and Kumagai, S., 2000. Prevalence and contamination levels of Listeria monocytogenes in retail foods in Japan. Int. J. Food Microbiol. 59, 73-77. Ioannou, C.J., Hanlon, G.W., and Denyer, S.P., 2007. Action of disinfectant quaternary ammonium compounds against Staphylococcus aureus. Antimicrob. Agents Chemother. 51, 296-306. Ireton, K., Payrastre, B., Chap, H., Ogawa, W., Sakaue, H., Kasuga, M., and Cossart, P., 1996. A role for phosphoinositide 3-kinase in bacterial invasion. Science 274, 780-782. Iwamoto, M., Olson, C., and Schlundt, J., 2008. Listeriosis. In: Heymann, D.L. (Ed.), Control of Communicable Diseases Manual. American Public Health Association Press, Washington, DC. Available at: http://www.unboundmedicine.com/ccdm/ub/view/Communicable-Diseases/460047/all/Listeriosis. Accessed 30 July, 2014. Jacquet, C., Doumith, M., Gordon, J.I., Martin, P.M.V., Cossart, P., and Lecuit, M., 2004. A molecular marker for evaluating the pathogenic potential of foodborne Listeria monocytogenes. J Infect. Dis. 189, 2094-2100. Jagadeesan, B., Koo, O.K., Kim, K.-P., Burkholder, K.M., Mishra, K.K., Aroonnual, A., and Bhunia, A.K., 2010. LAP, an alcohol acetaldehyde dehydrogenase enzyme in Listeria, promotes bacterial adhesion to enterocyte-like Caco-2 cells only in pathogenic species. Microbiol. 156, 2782-2795. Jaradat, Z.W. and Bhunia, A.K., 2002. Glucose and nutrient concentrations affect the expression of a 104-kilodalton Listeria adhesion protein in Listeria monocytogenes. Appl. Environ. Microbiol. 68, 4876-4883.   204 Jeffers, G.T., Bruce, J.L., McDonough, P.L., Scarlett, J., Boor, K.J., and Wiedmann, M., 2001. Comparative genetic characterization of Listeria monocytogenes isolates from human and animal listeriosis cases. Microbiol. 147, 1095-1104. Jeyasekaran, G., Karunasagar, I., and Karunasagar, I., 2000. Effect of sanitizers on Listeria biofilms on contact surfaces. Asian Fish. Sci. 13, 209-213. Jiang, X., Zhou, L., Gao, D., Wang, Y., Wang, D., Zhang, Z., Chen, M., Su, Y., Li, L., Yan, H., and Shi, L., 2012. Expression of efflux pump gene lde in ciprofloxacin-resistant foodborne isolates of Listeria monocytogenes. Microbiol. Immunol. 56, 843-846. Jinneman, K.C., Wekell, M.M., and Eklund, M.W., 2007. Incidence and behavior of Listeria monocytogenes in fish and seafood, p. 617-653. In: Ryser, E.T. and Marth, E.H. (Eds.), Listeria, Listeriosis and Food Safety, Third Edition. CRC Press, Boca Raton, FL. Johansson, J., Mandin, P., Renzoni, A., Chiaruttini, C., Springer, M., and Cossart, P., 2002. An RNA thermosensor controls expression of virulence genes in Listeria monocytogenes. Cell 110, 551-561. Johansson, T., Rantala, L., Palmu, L., and Honkanen-Buzalski, T., 1999. Occurrence and typing of Listeria monocytogenes strains in retail vacuum-packed fish products and in a production plant. Int. J. Food Microbiol. 47, 111-119. Jones, C.E., Shama, G., Jones, D., Roberts, I.S., and Andrew, P.W., 1997. Physiological and biochemical studies on psychrotolerance in Listeria monocytogenes. J. Appl. Microbiol. 83, 31-35. Jonquieres, R., Bierne, H., Mengaud, J., and Cossart, P., 1998. The inlA gene of Listeria monocytogenes LO28 harbors a nonsense mutation resulting in release of internalin. Infect. Immun. 66, 3420-3422. Kabuki, D.Y., Kuaye, A.Y., Wiedmann, M., and Boor, K.J., 2004. Molecular subtyping and tracking of Listeria monocytogenes in Latin-style fresh-cheese processing plants. J. Dairy Sci. 87, 2803-2812. Kazmierczak, M.J., Mithoe, S.C., Boor, K.J., and Wiedmann, M., 2003. Listeria monocytogenes σB regulates stress response and virulence functions. J. Bacteriol. 185, 5722-5734. Kazmierczak, M.J., Wiedmann, M., and Boor, K.J., 2006. Contributions of Listeria monocytogenes σB and PrfA to expression of virulence and stress response genes during extra- and intracellular growth. Microbiol. 152, 1827-1838. Kim, K.-P., Jagadeesan, B., Burkholder, K.M., Jaradat, Z.W., Wampler, J.L., Lathrop, A.A., Morgan, M.T., and Bhunia, A.K., 2006. Adhesion characteristics of Listeria adhesion protein (LAP)-expressing Escherichia coli to Caco-2 cells and of recombinant LAP to eukaryotic receptor Hsp60 as examined in a surface plasmon resonance sensor. FEMS Microbiol. Lett. 256, 324-332. Klausner, R.B. and Donnelly, C.W., 1991. Environmental sources of Listeria and Yersinia in Vermont dairy plants. J. Food Prot. 54, 607-611. Knabel, S.J., Reimer, A., Verghese, B., Lok, M., Ziegler, J., Farber, J., Pagotto, F., Graham, M., Nadon, C.A., and Gilmour, M.W., 2012. Sequence typing confirms that a predominant Listeria monocytogenes clone caused human listeriosis cases and outbreaks in Canada from 1988 to 2010. J. Clin. Microbiol. 50, 1748-1751.   205 Knudsen, G.M., Olsen, J.E., and Dons, L., 2004. Characterization of DegU, a response regulator in Listeria monocytogenes, involved in regulation of motility and contributes to virulence. FEMS Microbiol. Lett. 240, 171-179. Koch, J. and Stark, K., 2006. Significant increase of listeriosis in Germany - Epidemiological patterns 2001-2005. Euro. Surveill. 11, pii=631. Available at: http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=631. Accessed 30 July, 2014. Korsak, D., Borek, A., Daniluk, S., Grabowska, A., and Pappelbaum, K., 2012. Antimicrobial susceptibilities of Listeria monocytogenes strains isolated from food and food processing environment in Poland. Int. J. Food Microbiol. 158, 203-208. Kovacevic, J., Arguedas-Villa, C., Wozniak, A., Tasara, T., and Allen, K.J., 2013a. Examination of food chain-derived Listeria monocytogenes of different serotypes reveals considerable diversity in inlA genotypes, mutability, and adaptation to cold temperature. Appl. Environ. Microbiol. 79, 1915-1922. Kovačević, J., McIntyre, L.F., Henderson, S.B., and Kosatsky, T., 2012a. Occurrence and distribution of Listeria species in facilities producing ready-to-eat foods in British Columbia, Canada. J. Food Prot. 75, 216-224. Kovačević, J., Mesak, L.R., and Allen, K.J., 2012b. Occurrence and characterization of Listeria spp. in ready-to-eat retail foods from Vancouver, British Columbia. Food Microbiol. 30, 372-378. Kovacevic, J., Sagert, J., Wozniak, A., Gilmour, M.W., and Allen, K.J., 2013b. Antimicrobial resistance and co-selection phenomenon in Listeria spp. recovered from food and food production environments. Food Microbiol. 34, 319-327. Kozak, J., Balmer, T., Byrne, R., and Fisher, K., 1996. Prevalence of Listeria monocytogenes in foods: Incidence in dairy products. Food Control 7, 215-221. Kuenne, C., Billion, A., Mraheil, M.A., Strittmatter, A., Daniel, R., Goesmann, A., Barbuddhe, S., Hain, T., and Chakraborty, T., 2013. Reassessment of the Listeria monocytogenes pan-genome reveals dynamic integration hotspots and mobile genetic elements as major components of the accessory genome. BMC Genomics 14, 47. doi:10.1186/1471-2164-1114-1147. Kuhn, M. and Goebel, W., 1989. Identification of an extracellular protein of Listeria monocytogenes possibly involved in intracellular uptake by mammalian cells. Infect. Immun. 57, 55-61. Kuhn, M., Scortti, M., and Vázquez-Boland, J.A., 2008. Pathogenesis, p. 97-136. In: Liu, D. (Ed.), Handbook of Listeria monocytogenes. CRC Press, Boca Raton, FL. Lampidis, R., Kostrewa, D., and Hof, H., 2002. Molecular characterization of the genes encoding DNA gyrase and topoisomerase IV of Listeria monocytogenes. J. Antimicrob. Chemother. 49, 917-924. Lang Halter, E., Neuhaus, K., and Scherer, S., 2013. Listeria weihenstephanensis sp. nov., isolated from the water plant Lemna trisulca taken from a freshwater pond. Int. J. Syst. Evol. Microbiol. 63, 641-647. Lappi, V.R., Thimothe, J., Nightingale, K.K., Gall, K., Scott, V.N., and Wiedmann, M., 2004. Longitudinal studies on Listeria in smoked fish plants: impact of intervention strategies on contamination patterns. J. Food Prot. 67, 2500-2514. LeClerc, J.E., Li, B., Payne, W.L., and Cebula, T.A., 1996. High mutation frequencies among Escherichia coli and Salmonella pathogens. Science 274, 1208-1211.   206 Leclercq, A., Clermont, D., Bizet, C., Grimont, P.A.D., Le Fleche-Mateos, A., Roche, S.M., Buchrieser, C., Cadet-Daniel, V., Le Monnier, A., Lecuit, M., and Allerberger, F., 2010. Listeria rocourtiae sp. nov. Int. J. Syst. Evol. Microbiol. 60, 2210-2214. Lecuit, M., 2005. Understanding how Listeria monocytogenes targets and crosses host barriers. Clin. Microbiol. Infect. 11, 430-436. Lecuit, M., Dramsi, S., Gottardi, C., Fedor-Chaiken, M., Gumbiner, B., and Cossart, P., 1999. A single amino acid in E-cadherin responsible for host specificity towards the human pathogen Listeria monocytogenes. EMBO J. 18, 3956-3963. Lecuit, M., Nelson, D.M., Smith, S.D., Khun, H., Huerre, M., Vacher-Lavenu, M.C., Gordon, J.I., and Cossart, P., 2004. Targeting and crossing of the human maternofetal barrier by Listeria monocytogenes: Role of internalin interaction with trophoblast E-cadherin. Proc. Natl. Acad. Sci. U. S. A. 101, 6152-6157. Lecuit, M., Ohayon, H., Braun, L., Mengaud, J., and Cossart, P., 1997. Internalin of Listeria monocytogenes with an intact leucine-rich repeat region is sufficient to promote internalization. Infect. Immun. 65, 5309-5319. Lecuit, M., Vandormael-Pournin, S., Lefort, J., Huerre, M., Gounon, P., Dupuy, C., Babinet, C., and Cossart, P., 2001. A transgenic model for listeriosis: Role of internalin in crossing the intestinal barrier. Science 292, 1722-1725. Leimeister-Wachter, M., Domann, E., and Chakraborty, T., 1992. The expression of virulence genes in Listeria monocytogenes is thermoregulated. J. Bacteriol. 174, 947-952. Lemaître, J.P., Echchannaoui, H., Michaut, G., Divies, C., and Rousset, A., 1998. Plasmid-mediated resistance to antimicrobial agents among listeriae. J. Food Prot. 61, 1459-1464. Li, X.Z., Poole, K., and Nikaido, H., 2003. Contributions of MexAB-OprM and an EmrE homolog to intrinsic resistance of Pseudomonas aeruginosa to aminoglycosides and dyes. Antimicrob. Agents Chemother. 47, 27-33. Li, X.Z., Zhang, L., and Nikaido, H., 2004. Efflux pump-mediated intrinsic drug resistance in Mycobacterium smegmatis. Antimicrob. Agents Chemother. 48, 2415-2423. Lin, C.-M., Takeuchi, K., Zhang, L., Dohm, C.B., Meyer, J.D., Hall, P.A., and Doyle, M.P., 2006. Cross-contamination between processing equipment and deli meats by Listeria monocytogenes. J. Food Prot. 69, 71-79. Lingnau, A., Domann, E., Hudel, M., Bock, M., Nichterlein, T., Wehland, J., and Chakraborty, T., 1995. Expression of the Listeria monocytogenes EGD inlA and inlB genes, whose products mediate bacterial entry into tissue culture cell lines, by PrfA- dependent and -independent mechanisms. Infect. Immunol. 63, 3896-3903. Lismond, A., Tulkens, P.M., Mingeot-Leclercq, M.P., Courvalin, P., and Van Bambeke, F., 2008. Cooperation between prokaryotic (Lde) and eukaryotic (MRP) efflux transporters in J774 macrophages infected with Listeria monocytogenes: studies with ciprofloxacin and moxifloxacin. Antimicrob. Agents Chemother. 52, 3040-3046. Little, C.L., Sagoo, S.K., Gillespie, I.A., Grant, K., and McLauchlin, J., 2009. Prevalence and level of Listeria monocytogenes and other Listeria species in selected retail ready-to-eat foods in the United Kingdom. J. Food Prot. 72, 1869-1877. Liu, D., 2006. Identification, subtyping and virulence determination of Listeria monocytogenes, an important foodborne pathogen. J. Med. Microbiol. 55, 645 - 659.   207 Liu, D., 2008. Epidemiology, p. 27-59. In: Liu, D. (Ed.), Handbook of Listeria monocytogenes. CRC Press, Boca Raton, FL. Liu, D. and Busse, H.-J., 2009. Listeria, p. 207-220. In: Liu, D. (Ed.), Molecular Detection of Foodborne Pathogens. CRC Press, Boca Raton. Liu, D., Lawrence, M.L., Ainsworth, A.J., and Austin, F.W., 2005. Comparative assessment of acid, alkali and salt tolerance in Listeria monocytogenes virulent and avirulent strains. FEMS Microbiol. Lett. 243, 373-378. Liu, S., Graham, J.E., Bigelow, L., Morse, P.D., 2nd, and Wilkinson, B.J., 2002. Identification of Listeria monocytogenes genes expressed in response to growth at low temperature. Appl. Environ. Microbiol. 68, 1697-1705. Loh, E., Gripenland, J., and Johansson, J., 2006. Control of Listeria monocytogenes virulence by 5'-untranslated RNA. Trends Microbiol. 14, 294-298. Low, J.C. and Donachie, W., 1997. A review of Listeria monocytogenes and listeriosis. Vet. J. 153, 9-29. Lundén, J.M., Autio, T.J., and Korkeala, H.J., 2002. Transfer of persistent Listeria monocytogenes contamination between food-processing plants associated with a dicing machine. J. Food Prot. 65, 1129-1133. Lundén, J.M., Autio, T.J., Markkula, A., Hellstrom, S., and Korkeala, H.J., 2003. Adaptive and cross-adaptive responses of persistent and non-persistent Listeria monocytogenes strains to disinfectants. Int. J. Food Microbiol. 82, 265-272. Lungu, B., O'Bryan, C.A., Muthaiyan, A., Milillo, S.R., Johnson, M.G., Crandall, P.G., and Ricke, S.C., 2011. Listeria monocytogenes: antibiotic resistance in food production. Foodborne Path. Dis. 8, 569-578. Lyautey, E., Lapen, D.R., Wilkes, G., McCleary, K., Pagotto, F., Tyler, K., Hartmann, A., Piveteau, P., Rieu, A., Robertson, W.J., Medeiros, D.T., Edge, T.A., Gannon, V., and Topp, E., 2007. Distribution and characteristics of Listeria monocytogenes isolates from surface waters of the South Nation river watershed, Ontario, Canada. Appl. Environ. Microbiol. 73, 5401-5410. Lyon, S.A., Berrang, M.E., Fedorka-Cray, P.J., Fletcher, D.L., and Meinersmann, R.J., 2008. Antimicrobial resistance of Listeria monocytogenes isolated from a poultry further processing plant. Foodborne Pathog. Dis. 5, 253-259. MacGowan, A.P., 1990. Listeriosis--the therapeutic options. J. Antimicrob. Chemother. 26, 721-722. Mandin, P., Fsihi, H., Dussurget, O., Vergassola, M., Milohanic, E., Toledo-Arana, A., Lasa, I., Johansson, J., and Cossart, P., 2005. VirR, a response regulator critical for Listeria monocytogenes virulence. Molec. Microbiol. 57, 1367-1380. Mandin, P., Repoila, F., Vergassola, M., Geissmann, T., and Cossart, P., 2007. Identification of new noncoding RNAs in Listeria monocytogenes and prediction of mRNA targets. Nucleic Acids Res. 35, 962-974. Marco, A.J., Altimira, J., Prats, N., Lopez, S., Dominguez, L., Domingo, M., and Briones, V., 1997. Penetration of Listeria monocytogenes in mice infected by the oral route. Microb. Pathog. 23, 255-263. Marco, A.J., Prats, N., Ramos, J.A., Briones, V., Blanco, M., Dominguez, L., and Domingo, M., 1992. A microbiological, histopathological and immunohistological study of the intragastric inoculation of Listeria monocytogenes in mice. J. Comp. Pathol. 107, 1-9.   208 Mata, M.T., Baquero, F., and Perez-Diaz, J.C., 2000. A multidrug efflux transporter in Listeria monocytogenes. FEMS Microbiol. Lett. 187, 185-188. McDonnell, G. and Russell, A.D., 1999. Antiseptics and disinfectants: activity, action, and resistance. Clin. Microbiol. Rev. 12, 147-179. McGann, P., Wiedmann, M., and Boor, K.J., 2007. The alternative sigma factor sigma B and the virulence gene regulator PrfA both regulate transcription of Listeria monocytogenes internalins. Appl. Environ. Microbiol. 73, 2919-2930. McLauchlin, J., 1990. Distribution of serovars of Listeria monocytogenes isolated from different categories of patients with listeriosis. Eur. J. Clin. Microbiol. Infect. Dis. 9, 210-213. McLauchlin, J., Mitchell, R.T., Smerdon, W.J., and Jewell, K., 2004. Listeria monocytogenes and listeriosis: a review of hazard characterisation for use in microbiological risk assessment of foods. Int. J. Food Microbiol. 92, 15-33. McNeil, S.D., Nuccio, M.L., and Hanson, A.D., 1999. Betaines and related osmoprotectants. Targets for metabolic engineering of stress resistance. Plant Physiol. 120, 945-949. Mead, P., Slutsker, L., Dietz, V., McCaig, L., Bresee, J., Shapiro, C., Griffin, P., and Tauxe, R., 1999. Food-related illness and death in the United States. Emerg. Infect. Dis. 5, 607 - 625. Mead, P.S., Dunne, E.F., Graves, L., Wiedmann, M., Patrick, M., Hunter, S., Salehi, E., Mostashari, F., Craig, A., Mshar, P., Bannerman, T., Sauders, B.D., Hayes, P., Dewitt, W., Sparling, P., Griffin, P., Morse, D., Slutsker, L., and Swaminathan, B., 2006. Nationwide outbreak of listeriosis due to contaminated meat. Epidemiol. Infect. 134, 744-751. Mellin, J.R. and Cossart, P., 2012. The non-coding RNA world of the bacterial pathogen Listeria monocytogenes. RNA Biol. 9, 372-378. Merianos, J.J., 1991. Quaternary ammonium antimicrobial compounds, p. 225–255. In: Block, S.S. (Ed.), Disinfection, sterilization and preservation, 4th ed. Lea & Feigner, Malvern, PA. Milillo, S., Badamo, J., and Wiedmann, M., 2009. Contributions to selected phenotypic characteristics of large species- and lineage-specific genomic regions in Listeria monocytogenes. Food Microbiol 26, 212 - 223. Milohanic, E., Jonquières, R., Cossart, P., Berche, P., and Gaillard, J.-L., 2001. The autolysin Ami contributes to the adhesion of Listeria monocytogenes to eukaryotic cells via its cell wall anchor. Molec. Microbiol. 39, 1212-1224. Miner, M.D., Port, G.C., Bouwer, H.G., Chang, J.C., and Freitag, N.E., 2008. A novel prfA mutation that promotes Listeria monocytogenes cytosol entry but reduces bacterial spread and cytotoxicity. Microb. Pathog. 45, 273-281. Ming, X., Weber, G.H., Ayres, J.W., and Sandine, W.E., 1997. Bacteriocins applied to food packaging materials to inhibit Listeria monocytogenes on meats. J. Food Sci. 62, 413-415. Mitsuyama, M., 2008. Adaptive immunity, p. 427-448. In: Liu, D. (Ed.), Handbook of Listeria monocytogenes. CRC Press. Møretrø, T. and Langsrud, S., 2004. Listeria monocytogenes: biofilm formation and persistence in food-processing environments. Biofilms 1, 107-121. Morvan, A., Moubareck, C., Leclercq, A., Herve-Bazin, M., Bremont, S., Lecuit, M., Courvalin, P., and Le Monnier, A., 2010. Antimicrobial resistance of Listeria   209 monocytogenes strains isolated from humans in France. Antimicrob. Agents Chemother. 54, 2728-2731. Mueller, K.J. and Freitag, N.E., 2005. Pleiotropic enhancement of bacterial pathogenesis resulting from the constitutive activation of the Listeria monocytogenes regulatory factor PrfA. Infect. Immun. 73, 1917-1926. Müller, A., Rychli, K., Muhterem-Uyar, M., Zaiser, A., Stessl, B., Guinane, C.M., Cotter, P.D., Wagner, M., and Schmitz-Esser, S., 2013. Tn6188 - a novel transposon in Listeria monocytogenes responsible for tolerance to benzalkonium chloride. PLoS ONE 8, e76835. doi:76810.71371/journal.pone.0076835. Müller, H.E., 1988. Absence of Listeria species in lower animals. Ann. Inst. Pasteur. Microbiol. 139, 727-730. Muriana, P.M., 1996. Bacteriocins for control of Listeria spp. in food. J. Food Prot. 56, 54-63. Murray, E.G.D., Webb, R.A., and Swann, M.B.R., 1926. A disease of rabbits characterized by a large mononuclear leucocytosis, caused by a hitherto undescribed bacillus Bacterium monocytogenes (n. sp.). J. Pathol. Bacteriol. 29, 407-439. Nadon, C.A., Bowen, B.M., Wiedmann, M., and Boor, K.J., 2002. Sigma B contributes to PrfA-mediated virulence in Listeria monocytogenes. Infect. Immun. 70, 3948-3952. Nair, S., Derre, I., Msadek, T., Gaillot, O., and Berche, P., 2000. CtsR controls class III heat shock gene expression in the human pathogen Listeria monocytogenes. Mol. Microbiol. 35, 800-811. Nelson, K., Fouts, D., Mongodin, E., Ravel, J., DeBoy, R., Kolonay, J., Rasko, D., Angiuoli, S., Gill, S., Paulsen, I., Peterson, J., White, O., Nelson, W., Nierman, W., Beanan, M., Brinkac, L., Daugherty, S., Dodson, R., Durkin, A., Madupu, R., Haft, D., Selengut, J., Van Aken, S., Khouri, H., Fedorova, N., Forberger, H., Tran, B., Kathariou, S., Wonderling, L., Uhlich, G., Bayles, D., Luchansky, J., and Fraser, C., 2004. Whole genome comparisons of serotype 4b and 1/2a strains of the food-borne pathogen Listeria monocytogenes reveal new insights into the core genome components of this species. Nucleic Acids Res. 32, 2386 - 2395. Nightingale, K., Windham, K., Martin, K., Yeung, M., and Wiedmann, M., 2005. Select Listeria monocytogenes subtypes commonly found in foods carry distinct nonsense mutations in inlA, leading to expression of truncated and secreted Internalin A, and are associated with a reduced invasion phenotype for human intestinal epithelial cells. Appl. Environ. Microbiol. 71, 8764-8772. Nightingale, K.K., Ivy, R.A., Ho, A.J., Fortes, E.D., Njaa, B.L., Peters, R.M., and Wiedmann, M., 2008. inlA premature stop codons are common among Listeria monocytogenes isolates from foods and yield virulence-attenuated strains that confer protection against fully virulent strains. Appl. Environ. Microbiol. 74, 6570-6583. Nikitas, G., Deschamps, C., Disson, O., Niault, T., Cossart, P., and Lecuit, M., 2011. Transcytosis of Listeria monocytogenes across the intestinal barrier upon specific targeting of goblet cell accessible E-cadherin. J. Exp. Med. 208, 2263-2277. Norton, D.M., McCamey, M.A., Gall, K.L., Scarlett, J.M., Boor, K.J., and Wiedmann, M., 2001. Molecular studies on the ecology of Listeria monocytogenes in the smoked fish processing industry. Appl. Environ. Microbiol. 67, 198-205.   210 NSW Ministry of Health. 2013. Listeriosis health alert. Available at: http://www.health.nsw.gov.au/news/Pages/Listeria-Health-Alert.aspx. Accessed 20 July, 2014. O'Byrne, C.P. and Karatzas, K.A.G., 2008. The role of sigma B (σB) in the stress adaptations of Listeria monocytogenes: Overlaps between stress adaptation and virulence. Adv. Appl. Microbiol. 65, 115-140. Okada, Y., Okada, N., Makino, S.-i., Asakura, H., Yamamoto, S., and Igimi, S., 2006. The sigma factor RpoN (σ54) is involved in osmotolerance in Listeria monocytogenes. FEMS Microbiol. Lett. 263, 54-60. Oliver, H.F., Orsi, R.H., Ponnala, L., Keich, U., Wang, W., Sun, Q., Cartinhour, S.W., Filiatrault, M.J., Wiedmann, M., and Boor, K.J., 2009. Deep RNA sequencing of L. monocytogenes reveals overlapping and extensive stationary phase and sigma B-dependent transcriptomes, including multiple highly transcribed noncoding RNAs. BMC Genomics 10, 641. doi:610.1186/1471-2164-1110-1641. Oliver, H.F., Orsi, R.H., Wiedmann, M., and Boor, K.J., 2010. Listeria monocytogenes σB has a small core regulon and a conserved role in virulence but makes differential contributions to stress tolerance across a diverse collection of strains. Appl. Environ. Microbiol. 76, 4216-4232. Olsen, S.J., Patrick, M., Hunter, S.B., Reddy, V., Kornstein, L., MacKenzie, W.R., Lane, K., Bidol, S., Stoltman, G.A., Frye, D.M., Lee, I., Hurd, S., Jones, T.F., LaPorte, T.N., Dewitt, W., Graves, L., Wiedmann, M., Schoonmaker-Bopp, D.J., Huang, A.J., Vincent, C., Bugenhagen, A., Corby, J., Carloni, E.R., Holcomb, M.E., Woron, R.F., Zansky, S.M., Dowdle, G., Smith, F., Ahrabi-Fard, S., Ong, A.R., Tucker, N., Hynes, N.A., and Mead, P., 2005. Multistate outbreak of Listeria monocytogenes infection linked to delicatessen turkey meat. Clin. Infect. Dis. 40, 962-967. Orsi, R.H., den Bakker, H.C., and Wiedmann, M., 2011. Listeria monocytogenes lineages: Genomics, evolution, ecology, and phenotypic characteristics. Int. J. Med. Microbiol. 301, 79-96. Orsi, R.H., Ripoll, D.R., Yeung, M., Nightingale, K.K., and Wiedmann, M., 2007. Recombination and positive selection contribute to evolution of Listeria monocytogenes inlA. Microbiol. 153, 2666-2678. Orsi, R.H., Sun, Q., and Wiedmann, M., 2008. Genome-wide analyses reveal lineage specific contributions of positive selection and recombination to the evolution of Listeria monocytogenes. BMC Evol. Biol. 8, 233. doi:210.1186/1471-2148-1188-1233. Pagani, I., Liolios, K., Jansson, J., Chen, I.M., Smirnova, T., Nosrat, B., Markowitz, V.M., and Kyrpides, N.C., 2012. The Genomes OnLine Database (GOLD) v.4: status of genomic and metagenomic projects and their associated metadata. Nucleic Acids Res. 40, D571-579. Pagotto, F., Daley, E., Farber, J., and Warburton, D., 2001. Isolation of Listeria monocytogenes from all food and environmental samples. MFHPB-30, p. 1-15. In: Warburton, D. (ed.), Compendium of Analytical Methods. Health Canada Methods of Microbiological Analysis of Foods. Polyscience Publications Inc., Montreal. Pagotto, F., Daley, E., and Farber, J.M., 2002. Enumeration of Listeria monocytogenes in foods. MFLP-74, p. 1-5. In: Warburton, D. (ed.), Compendium of Analytical Methods. Health Canada Methods of Microbiological Analysis of Foods. Polyscience Publications Inc., Montreal.   211 Painter, J. and Slutsker, L., 2007. Listeriosis in Humans, p. 85-109. In: Ryser, E.T. and Marth, E.H. (Eds.), Listeria, Listeriosis, and Food Safety, Third Edition. CRC Press, Boca Raton. Pandiripally, V.K., Westbrook, D.G., Sunki, G.R., and Bhunia, A.K., 1999. Surface protein p104 is involved in adhesion of Listeria monocytogenes to human intestinal cell line, Caco-2. J. Med. Microbiol. 48, 117-124. Patchett, R.A., Kelly, A.F., and Kroll, R.G., 1992. Effect of sodium chloride on the intracellular solute pools of Listeria monocytogenes. Appl. Environ. Microbiol. 58, 3959-3963. Pentecost, M., Otto, G., Theriot, J.A., and Amieva, M.R., 2006. Listeria monocytogenes invades the epithelial junctions at sites of cell extrusion. PLoS Pathog. 2, e3. doi:10.1371/journal.ppat.0020003. Perrin, M., Bemer, M., and Delamare, C., 2003. Fatal case of Listeria innocua bacteremia. J. Clin. Microbiol. 41, 5308-5309. Pfeuffer, T., Goebel, W., Laubinger, J., Bachmann, M., and Kuhn, M., 2000. LaXp180, a mammalian ActA-binding protein, identified with the yeast two-hybrid system, co-localizes with intracellular Listeria monocytogenes. Cell. Microbiol. 2, 101-114. Phan-Thanh, L. and Gormon, T., 1995. Analysis of heat and cold shock proteins in Listeria by two-dimensional electrophoresis. Electrophoresis 16, 444-450. Piddock, L.J., 2006a. Clinically relevant chromosomally encoded multidrug resistance efflux pumps in bacteria. Clin. Microbiol. Rev. 19, 382-402. Piddock, L.J., 2006b. Multidrug-resistance efflux pumps - not just for resistance. Nat. Rev. Microbiol. 4, 629-636. Piddock, L.J., Johnson, M.M., Simjee, S., and Pumbwe, L., 2002. Expression of efflux pump gene pmrA in fluoroquinolone-resistant and -susceptible clinical isolates of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 46, 808-812. Pilgrim, S., Kolb-Maurer, A., Gentschev, I., Goebel, W., and Kuhn, M., 2003. Deletion of the gene encoding p60 in Listeria monocytogenes leads to abnormal cell division and loss of actin-based motility. Infect. Immun. 71, 3473-3484. Pinner, R.W., Schuchat, A., Swaminathan, B., Hayes, P.S., Deaver, K.A., Weaver, R.E., Plikaytis, B.D., Reeves, M., Broome, C.V., and Wenger, J.D., 1992. Role of foods in sporadic listeriosis. II. Microbiologic and epidemiologic investigation. The Listeria Study Group. JAMA 267, 2046-2050. Poole, K., 2005. Efflux-mediated antimicrobial resistance. J. Antimicrob. Chemother. 56, 20-51. Portnoy, D.A., Auerbuch, V., and Glomski, I.J., 2002. The cell biology of Listeria monocytogenes infection. J. Cell Biol. 158, 409-414. Poyart-Salmeron, C., Carlier, C., Trieu-Cuot, P., Courtieu, A.L., and Courvalin, P., 1990. Transferable plasmid-mediated antibiotic resistance in Listeria monocytogenes. Lancet 335, 1422-1426. Poyart-Salmeron, C., Trieu-Cuot, P., Carlier, C., MacGowan, A., McLauchlin, J., and Courvalin, P., 1992. Genetic basis of tetracycline resistance in clinical isolates of Listeria monocytogenes. Antimicrob. Agents Chemother. 36, 463-466. Puttmann, M., Ade, N., and Hof, H., 1993. Dependence of fatty acid composition of Listeria spp. on growth temperature. Res. Microbiol. 144, 279-283.   212 Quillin, S.J., Schwartz, K.T., and Leber, J.H., 2011. The novel Listeria monocytogenes bile sensor BrtA controls expression of the cholic acid efflux pump MdrT. Mol. Microbiol. 81, 129-142. Rácz, P., Tenner, K., and Mérö, E., 1972. Experimental Listeria enteritis. I. An electron microscopic study of the epithelial phase in experimental listeria infection. Lab. Invest. 26, 694-700. Raengpradub, S., Wiedmann, M., and Boor, K.J., 2008. Comparative analysis of the σB-dependent stress responses in Listeria monocytogenes and Listeria innocua strains exposed to selected stress conditions. Appl. Environ. Microbiol. 74, 158-171. Raffelsbauer, D., Bubert, A., Engelbrecht, F., Scheinpflug, J., Simm, A., Hess, J., Kaufmann, S.H., and Goebel, W., 1998. The gene cluster inlC2DE of Listeria monocytogenes contains additional new internalin genes and is important for virulence in mice. Mol. Gen. Genet. 260, 144-158. Ragon, M., Wirth, T., Hollandt, F., Lavenir, R., Lecuit, M., Le Monnier, A., and Brisse, S., 2008. A new perspective on Listeria monocytogenes evolution. PLoS Pathog. 4, e1000146. doi:1000110.1001371/journal.ppat.1000146. Raimann, E., Schmid, B., Stephan, R., and Tasara, T., 2009. The alternative sigma factor σL of L. monocytogenes promotes growth under diverse environmental stresses. Foodborne Path. Dis. 6, 583-591. Rakic-Martinez, M., Drevets, D.A., Dutta, V., Katic, V., and Kathariou, S., 2011. Listeria monocytogenes strains selected on ciprofloxacin or the disinfectant benzalkonium chloride exhibit reduced susceptibility to ciprofloxacin, gentamicin, benzalkonium chloride, and other toxic compounds. Appl. Environ. Microbiol. 77, 8714-8721. Rea, R.B., Gahan, C.G., and Hill, C., 2004. Disruption of putative regulatory loci in Listeria monocytogenes demonstrates a significant role for Fur and PerR in virulence. Infect. Immun. 72, 717-727. Renzoni, A., Cossart, P., and Dramsi, S., 1999. PrfA, the transcriptional activator of virulence genes, is upregulated during interaction of Listeria monocytogenes with mammalian cells and in eukaryotic cell extracts. Mol. Microbiol. 34, 552-561. Roche, S., Velge, P., and Liu, D., 2008. Virulence determination, p. 241-270. In: Liu, D. (Ed.), Handbook of Listeria monocytogenes. CRC Press, Boca Raton, FL. Roche, S.M., Gracieux, P., Milohanic, E., Albert, I., Virlogeux-Payant, I., Temoin, S., Grepinet, O., Kerouanton, A., Jacquet, C., Cossart, P., and Velge, P., 2005. Investigation of specific substitutions in virulence genes characterizing phenotypic groups of low-virulence field strains of Listeria monocytogenes. Appl. Environ. Microbiol. 71, 6039-6048. Roche, S.M., Grepinet, O., Kerouanton, A., Ragon, M., Leclercq, A., Temoin, S., Schaeffer, B., Skorski, G., Mereghetti, L., Le Monnier, A., and Velge, P., 2012. Polyphasic characterization and genetic relatedness of low-virulence and virulent Listeria monocytogenes isolates. BMC Microbiol. 12, 304. doi:310.1186/1471-2180-1112-1304. Rocourt, J. and Buchrieser, C., 2007. The genus Listeria and Listeria monocytogenes, p. 1-20. In: Ryser, E.T. and Marth, E.H. (Eds.), Listeria, Listeriosis, and Food Safety, Third Edition. CRC Press, Boca Raton.   213 Rocourt, J., Hof, H., Schrettenbrunner, A., Malinverni, R., and Bille, J., 1986. Acute purulent Listeria seeligeri meningitis in an immunocompetent adult. Schweiz. Med. Wochenschr. 116, 248-251. Roldgaard, B.B., Andersen, J.B., Hansen, T.B., Christensen, B.B., and Licht, T.R., 2009. Comparison of three Listeria monocytogenes strains in a guinea-pig model simulating food-borne exposure. FEMS Microbiol. Lett. 291, 88-94. Romanova, N.A., Wolffs, P.F.G., Brovko, L.Y., and Griffiths, M.W., 2006. Role of efflux pumps in adaptation and resistance of Listeria monocytogenes to benzalkonium chloride. Appl. Environ. Microbiol. 72, 3498-3503. Rørvik, L.M., 2000. Listeria monocytogenes in the smoked salmon industry. Int. J. Food Microbiol. 62, 183-190. Rørvik, L.M., Caugant, D.A., and Yndestad, M., 1995. Contamination pattern of Listeria monocytogenes and other Listeria spp. in a salmon slaughterhouse and smoked salmon processing plant. Int. J. Food Microbiol. 25, 19-27. Rørvik, L.M., Skjerve, E., Knudsen, B.R., and Yndestad, M., 1997. Risk factors for contamination of smoked salmon with Listeria monocytogenes during processing. Int. J. Food Microbiol. 37, 215-219. Rousseaux, S., Olier, M., Lemaitre, J.P., Piveteau, P., and Guzzo, J., 2004. Use of PCR-restriction fragment length polymorphism of inlA for rapid screening of Listeria monocytogenes strains deficient in the ability to invade Caco-2 cells. Appl. Environ. Microbiol. 70, 2180-2185. Rundlett, K.L. and Armstrong, D.W., 1994. Evaluation of free D-glutamate in processed foods. Chirality 6, 277-282. Russell, A.D., 2004. Whither triclosan? J. Antimicrob. Chemother. 53, 693-695. Ryan, S., 2006. PhD thesis, Molecular and phenotypic characterisation of selected acid resistance systems in Listeria monocytogenes. University College Cork, Cork, Ireland. Ryan, S., Begley, M., Hill, C., and Gahan, C.G., 2010. A five-gene stress survival islet (SSI-1) that contributes to the growth of Listeria monocytogenes in suboptimal conditions. J. Appl. Microbiol. 109, 984-995. Ryser, E., 2007a. Incidence and behavior of Listeria monocytogenes in cheese and other fermented dairy products, p. 405-501. In: Ryser, E.T. and Marth, E.H. (Eds.), Listeria, Listeriosis, and Food Safety, Third Edition. CRC Press, Boca Raton. Ryser, E., 2007b. Incidence and behavior of Listeria monocytogenes in poultry and egg products, p. 571-615. In: Ryser, E.T. and Marth, E.H. (Eds.), Listeria, Listeriosis, and Food Safety, Third Edition. CRC Press, Boca Raton. Ryser, E., 2007c. Incidence and behavior of Listeria monocytogenes in unfermented dairy products, p. 357-403. In: Ryser, E.T. and Marth, E.H. (Eds.), Listeria, Listeriosis, and Food Safety, Third Edition. CRC Press, Boca Raton. Sabet, C., Lecuit, M., Cabanes, D., Cossart, P., and Bierne, H., 2005. LPXTG protein InlJ, a newly identified internalin involved in Listeria monocytogenes virulence. Infect. Immun. 73, 6912-6922. Sabet, C., Toledo-Arana, A., Personnic, N., Lecuit, M., Dubrac, S., Poupel, O., Gouin, E., Nahori, M.A., Cossart, P., and Bierne, H., 2008. The Listeria monocytogenes virulence factor InlJ is specifically expressed in vivo and behaves as an adhesin. Infect. Immun. 76, 1368-1378.   214 Safdar, A. and Armstrong, D., 2003. Antimicrobial activities against 84 Listeria monocytogenes isolates from patients with systemic listeriosis at a comprehensive cancer center (1955-1997). J. Clin. Microbiol. 41, 483-485. Sagert, J., 2013. M.Sc. Thesis, Characterization of Listeria monocytogenes plasmids that were newly identified in whole-genome sequences of listeriosis outbreak isolates. University of Manitoba, Winnipeg, MB. Salcedo, C., Arreaza, L., Alcala, B., de la Fuente, L., and Vazquez, J.A., 2003. Development of a multilocus sequence typing method for analysis of Listeria monocytogenes clones. J. Clin. Microbiol. 41, 757-762. Salyers, A.A. and Whitt, D.D., 2002. Listeria monocytoges, a doubly motile pathogen, p. 398-406. In: Salyers, A.A. and Whitt, D.D. (Eds.), Bacterial Pathogenesis. A Molecular Aproach, Second Edition. ASM Press, Washington, DC. Sauders, B.D., Sanchez, M.D., Rice, D.H., Corby, J., Stich, S., Fortes, E.D., Roof, S.E., and Wiedmann, M., 2009. Prevalence and molecular diversity of Listeria monocytogenes in retail establishments. J. Food Prot. 72, 2337-2349. Scallan, E., Hoekstra, R.M., Angulo, F.J., Tauxe, R.V., Widdowson, M.A., Roy, S.L., Jones, J.L., and Griffin, P.M., 2011. Foodborne illness acquired in the United States—major pathogens. Emerg. Infect. Dis. 17, doi: 10.3201/eid1701.P11101. Schaffter, N. and Parriaux, A., 2002. Pathogenic-bacterial water contamination in mountainous catchments. Water Res. 36, 131-139. Scharer, K., Stephan, R., and Tasara, T., 2013. Cold shock proteins contribute to the regulation of listeriolysin O production in Listeria monocytogenes. Foodborne Pathog. Dis. 10, 1023-1029. Schlech, W.F., III, 2000. Foodborne listeriosis. Clin. Infect. Dis. 31, 770-775. Schmid, B., Klumpp, J., Raimann, E., Loessner, M.J., Stephan, R., and Tasara, T., 2009. Role of cold shock proteins in growth of Listeria monocytogenes under cold and osmotic stress conditions. Appl. Environ. Microbiol. 75, 1621-1627. Schmid, M.W., Ng, E.Y.W., Lampidis, R., Emmerth, M., Walcher, M., Kreft, J., Goebel, W., Wagner, M., and Schleifer, K.-H., 2005. Evolutionary history of the genus Listeria and its virulence genes. Syst. Appl. Microbiol. 28, 1-18. Schubert, W.-D., Göbel, G., Diepholz, M., Darji, A., Kloer, D., Hain, T., Chakraborty, T., Wehland, J., Domann, E., and Heinz, D.W., 2001. Internalins from the human pathogen Listeria monocytogenes combine three distinct folds into a contiguous internalin domain. J. Molec. Biol. 312, 783-794. Schuchat, A., Swaminathan, B., and Broome, C.V., 1991. Epidemiology of human listeriosis. Clin. Microbiol. Rev. 4, 169-183. Scortti, M., Monzó, H.J., Lacharme-Lora, L., Lewis, D.A., and Vázquez-Boland, J.A., 2007. The PrfA virulence regulon. Microbes Infect. 9, 1196-1207. Seavey, M., Verch, T., and Paterson, Y., 2008. Anticancer vaccine strategies, p. 481-511. In: Liu, D. (Ed.), Handbook of Listeria monocytogenes. CRC Press. Seeliger, H. and Höhne, K., 1979. Serotyping of Listeria monocytogenes and related species. Meth. Microbiol. 13, 31-49. Senczek, D., Stephan, R., and Untermann, F., 2000. Pulsed-field gel electrophoresis (PFGE) typing of Listeria strains isolated from a meat processing plant over a 2-year period. Int. J. Food Microbiol. 62, 155-159.   215 Seveau, S., Pizarro-Cerda, J., and Cossart, P., 2007. Molecular mechanisms exploited by Listeria monocytogenes during host cell invasion. Microbes Infect. 9, 1167-1175. Sheehan, B., Klarsfeld, A., Msadek, T., and Cossart, P., 1995. Differential activation of virulence gene expression by PrfA, the Listeria monocytogenes virulence regulator. J. Bacteriol. 177, 6469-6476. Shin, J.-H., Brody, M.S., and Price, C.W., 2010. Physical and antibiotic stresses require activation of the RsbU phosphatase to induce the general stress response in Listeria monocytogenes. Microbiol. 156, 2660-2669. Slade, P.J. and Collins-Thompson, D.L., 1990. Listeria, plasmids, antibiotic resistance, and food. Lancet 336, 1004. Sleator, R.D., Francis, G.A., O'Beirne, D., Gahan, C.G., and Hill, C., 2003a. Betaine and carnitine uptake systems in Listeria monocytogenes affect growth and survival in foods and during infection. J. Appl. Microbiol. 95, 839-846. Sleator, R.D., Gahan, C.G., and Hill, C., 2003b. A postgenomic appraisal of osmotolerance in Listeria monocytogenes. Appl. Environ. Microbiol. 69, 1-9. Smith, K. and Youngman, P., 1992. Use of a new integrational vector to investigate compartment-specific expression of the Bacillus subtilis spollM gene. Biochimie 74, 705-711. Sokolovic, Z., Fuchs, A., and Goebel, W., 1990. Synthesis of species-specific stress proteins by virulent strains of Listeria monocytogenes. Infect. Immun. 58, 3582-3587. Sokolovic, Z., Riedel, J., Wuenscher, M., and Goebel, W., 1993. Surface-associated, PrfA-regulated proteins of Listeria monocytogenes synthesized under stress conditions. Mol. Microbiol. 8, 219-227. Sousa, S., Cabanes, D., El-Amraoui, A., Petit, C., Lecuit, M., and Cossart, P., 2004. Unconventional myosin VIIa and vezatin, two proteins crucial for Listeria entry into epithelial cells. J. Cell Sci. 117, 2121-2130. Spiegelhalter, F. and Bremer, E., 1998. Osmoregulation of the opuE proline transport gene from Bacillus subtilis: contributions of the sigma A- and sigma B-dependent stress-responsive promoters. Mol. Microbiol. 29, 285-296. Stack, H., Hill, C., and Gahan, C., 2008. Stress responses, p. 61-96. In: Liu, D. (Ed.), Handbook of Listeria monocytogenes. CRC Press, Boca Raton, FL. Stack, H.M., Sleator, R.D., Bowers, M., Hill, C., and Gahan, C.G., 2005. Role for HtrA in stress induction and virulence potential in Listeria monocytogenes. Appl. Environ. Microbiol. 71, 4241-4247. Swaminathan, B. and Gerner-Smidt, P., 2007. The epidemiology of human listeriosis. Microbes Infect. 9, 1236-1243. Tasara, T. and Stephan, R., 2006. Cold stress tolerance of Listeria monocytogenes: A review of molecular adaptive mechanisms and food safety implications. J. Food Prot. 69, 1473-1484. Tasara, T. and Stephan, R., 2007. Evaluation of housekeeping genes in Listeria monocytogenes as potential internal control references for normalizing mRNA expression levels in stress adaptation models using real-time PCR. FEMS Microbiol. Lett. 269, 265-272. Temple, M.E. and Nahata, M.C., 2000. Treatment of listeriosis. Ann. Pharmacother. 34, 656-661.   216 Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A., Murray, B.E., Persing, D.H., and Swaminathan, B., 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33, 2233. Theriot, J.A., Rosenblatt, J., Portnoy, D.A., Goldschmidt-Clermont, P.J., and Mitchison, T.J., 1994. Involvement of profilin in the actin-based motility of L. monocytogenes in cells and in cell-free extracts. Cell 76, 505-517. Thimothe, J., Nightingale, K.K., Gall, K., Scott, V.N., and Wiedmann, M., 2004. Tracking of Listeria monocytogenes in smoked fish processing plants. J. Food Prot. 67, 328-341. To, M.S., Favrin, S., Romanova, N., and Griffiths, M.W., 2002. Postadaptational resistance to benzalkonium chloride and subsequent physicochemical modifications of Listeria monocytogenes. Appl. Environ. Microbiol. 68, 5258-5264. Toledo-Arana, A., Dussurget, O., Nikitas, G., Sesto, N., Guet-Revillet, H., Balestrino, D., Loh, E., Gripenland, J., Tiensuu, T., Vaitkevicius, K., Barthelemy, M., Vergassola, M., Nahori, M.A., Soubigou, G., Regnault, B., Coppee, J.Y., Lecuit, M., Johansson, J., and Cossart, P., 2009. The Listeria transcriptional landscape from saprophytism to virulence. Nature 459, 950-956. Tompkin, R.B., 2002. Control of Listeria monocytogenes in the food-processing environment. J. Food Prot. 65, 709-725. Troxler, R., Von Graevenitz, A., Funke, G., Wiedemann, B., and Stock, I., 2000. Natural antibiotic susceptibility of Listeria species: L. grayi, L. innocua, L. ivanovii, L. monocytogenes, L. seeligeri and L. welshimeri strains. Clin. Microbiol. Infect. 6, 525-535. Tsai, Y.H.L., Orsi, R.H., Nightingale, K.K., and Wiedmann, M., 2006. Listeria monocytogenes internalins are highly diverse and evolved by recombination and positive selection. Infect. Genet. Evol. 6, 378-389. Uyttendaele, M., Busschaert, P., Valero, A., Geeraerd, A.H., Vermeulen, A., Jacxsens, L., Goh, K.K., De Loy, A., Van Impe, J.F., and Devlieghere, F., 2009. Prevalence and challenge tests of Listeria monocytogenes in Belgian produced and retailed mayonnaise-based deli-salads, cooked meat products and smoked fish between 2005 and 2007. Int. J. Food Microbiol. 133, 94-104. Van Coillie, E., Hadewig, W., Marc, H., Lieve, H., and Nancy, R., 2004. Prevalence and typing of Listeria monocytogenes in ready-to-eat food products on the Belgian market. J. Food Prot. 67, 2480-2487. Van Stelten, A., Simpson, J.M., Chen, Y., Scott, V.N., Whiting, R.C., Ross, W.H., and Nightingale, K.K., 2011. Significant shift in median guinea pig infectious dose shown by an outbreak-associated Listeria monocytogenes epidemic clone strain and a strain carrying a premature stop codon mutation in inlA. Appl. Environ. Microbiol. 77, 2479-2487. Van Stelten, A., Simpson, J.M., Ward, T.J., and Nightingale, K.K., 2010. Revelation by single-nucleotide polymorphism genotyping that mutations leading to a premature stop codon in inlA are common among Listeria monocytogenes isolates from ready-to-eat foods but not human listeriosis cases. Appl. Environ. Microbiol. 76, 2783-2790.   217 Vàzquez-Boland, J.A., Domínguez-Bernal, G., Gonzàlez-Zorn, B., Kreft, J., and Goebel, W., 2001a. Pathogenicity islands and virulence evolution in Listeria. Microb. Infect. 3, 571-584. Vàzquez-Boland, J.A., Kuhn, M., Berche, P., Chakraborty, T., Dominguez-Bernal, G., Goebel, W., Gonzalez-Zorn, B., Wehland, J., and Kreft, J., 2001b. Listeria pathogenesis and molecular virulence determinants. Clin. Microbiol. Rev. 14, 584-640. Velge, P., Herler, M., Johansson, J., Roche, S.M., Temoin, S., Fedorov, A.A., Gracieux, P., Almo, S.C., Goebel, W., and Cossart, P., 2007. A naturally occurring mutation K220T in the pleiotropic activator PrfA of Listeria monocytogenes results in a loss of virulence due to decreasing DNA-binding affinity. Microbiol. 153, 995-1005. Vila, J., Ruiz, J., Goni, P., and De Anta, M.T., 1996. Detection of mutations in parC in quinolone-resistant clinical isolates of Escherichia coli. Antimicrob. Agents Chemother. 40, 491-493. Villemur, R., Lanthier, M., Beaudet, R., and Lepine, F., 2006. The Desulfitobacterium genus. FEMS Microbiol. Rev. 30, 706-733. Walsh, D., Duffy, G., Sheridan, J.J., Blair, I.S., and McDowell, D.A., 2001. Antibiotic resistance among Listeria, including Listeria monocytogenes, in retail foods. J. Appl. Microbiol. 90, 517-522. Ward, T., Gorski, L., Borucki, M., Mandrell, R., Hutchins, J., and Pupedis, K., 2004. Intraspecific phylogeny and lineage group identification based on the prfA virulence gene cluster of Listeria monocytogenes. J. Bacteriol. 186, 4994 - 5002. Ward, T.J., Evans, P., Wiedmann, M., Usgaard, T., Roof, S.E., Stroika, S.G., and Hise, K., 2010. Molecular and phenotypic characterization of Listeria monocytogenes from U.S. Department of Agriculture Food Safety and Inspection Service surveillance of ready-to-eat foods and processing facilities. J. Food Prot. 73, 861-869. Weatherill, S. 2009. Listeriosis Investigative Review. Report of the independent investigator into the 2008 listeriosis outbreak, [WWW document]. Available at: http://www.phac-aspc.gc.ca/alert-alerte/listeria_200808-eng.php. Accessed 20 June, 2014. Wehrli, W., 1983. Rifampin: mechanisms of action and resistance. Rev. Infect. Dis. 5 Suppl 3, S407-411. Weis, J. and Seeliger, H.P., 1975. Incidence of Listeria monocytogenes in nature. Appl. Microbiol. 30, 29-32. Wesche, A.M., Gurtler, J.B., Marks, B.P., and Ryser, E.T., 2009. Stress, sublethal injury, resuscitation, and virulence of bacterial foodborne pathogens. J. Food Prot. 72, 1121-1138. Wieczorek, K., Dmowska, K., and Osek, J., 2012. Prevalence, characterization, and antimicrobial resistance of Listeria monocytogenes isolates from bovine hides and carcasses. Appl. Environ. Microbiol. 78, 2043-2045. Wiedmann, M., Bruce, J., Keating, C., Johnson, A., McDonough, P., and Batt, C., 1997. Ribotypes and virulence gene polymorphisms suggest three distinct Listeria monocytogenes lineages with differences in pathogenic potential. Infect. Immun. 65, 2707 - 2716. Wilks, S.A., Michels, H.T., and Keevil, C.W., 2006. Survival of Listeria monocytogenes Scott A on metal surfaces: implications for cross-contamination. Int. J. Food Microbiol. 111, 93-98.   218 Wong, A., 1998. Biofilms in food processing environments. J. Dairy Sci. 81, 2765 - 2770. Wuenscher, M.D., Kohler, S., Bubert, A., Gerike, U., and Goebel, W., 1993. The iap gene of Listeria monocytogenes is essential for cell viability, and its gene product, p60, has bacteriolytic activity. J. Bacteriol. 175, 3491-3501. Yamada, F., Ueda, F., Ochiai, Y., Mochizuki, M., Shoji, H., Ogawa-Goto, T., Sata, T., Ogasawara, K., Fujima, A., and Hondo, R., 2006. Invasion assay of Listeria monocytogenes using Vero and Caco-2 cells. J. Microbiol. Methods 66, 96-103. Yerushalmi, H., Lebendiker, M., and Schuldiner, S., 1995. EmrE, an Escherichia coli 12-kDa multidrug transporter, exchanges toxic cations and H+ and is soluble in organic solvents. J. Biol. Chem. 270, 6856-6863. Zhang, C., Nietfeldt, J., Zhang, M., and Benson, A.K., 2005. Functional consequences of genome evolution in Listeria monocytogenes: the lmo0423 and lmo0422 genes encode σC and LstR, a lineage II-specific heat shock system. J. Bacteriol. 187, 7243-7253. Zhang, C., Zhang, M., Ju, J., Nietfeldt, J., Wise, J., Terry, P.M., Olson, M., Kachman, S.D., Wiedmann, M., Samadpour, M., and Benson, A.K., 2003. Genome diversification in phylogenetic lineages I and II of Listeria monocytogenes: identification of segments unique to lineage II populations. J. Bacteriol. 185, 5573-5584. Zhang, W., Jayarao, B.M., and Knabel, S.J., 2004. Multi-virulence-locus sequence typing of Listeria monocytogenes. Appl. Environ. Microbiol. 70, 913-920. Zhang, Y., Yeh, E., Hall, G., Cripe, J., Bhagwat, A.A., and Meng, J., 2007. Characterization of Listeria monocytogenes isolated from retail foods. Int. J. Food Microbiol. 113, 47-53. Ziegler, J., 2012. M.Sc. Thesis, The distribution, diversity and functional characterization of the Listeria genomic Island 1. University of Manitoba, Winnipeg, MB.    219 Appendices Appendix A – Chapter 2 supplementary figure      220                  Figure A-1. PFGE patterns for L. monocytogenes isolates from food processing facilities, recovered from August to October 2009; with the exception of 160687 isolate, which was recovered from facility d5, during a follow-up inspection in March 2010. Sample designations: DE, dairy environment; FF, fish food; FE, fish environment; MF and OF, meat food; ME and OE, meat environment. Dendrograms represents continuous trees but are split onto three pages for visual clarity; the splitting point is indicated with \\ lines. PFGE-ApaI1009080706050PFGE-AscIOE90-2OE90-3OE90-1FF63-2FF64-1FF64-2FF64-3FF66-3FF67-1FF67-2FF66-1FE13-2FE13-3FE14-1FE14-2FE14-3FE16-1FE16-2FE16-3FF14-1FF14-2FF14-3FF15-1FF15-2FF15-3FF19-1FF19-2FF19-3FF5-3FF6-2FE64-3ListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriamonocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.DrainDrainDrainSalmon jerkyCajun salmonCajun salmonCajun salmonTeriyaki SalmonHoney Garlic SalmonHoney Garlic SalmonTeriyaki SalmonDrainDrainWork-table legsWork-table legsWork-table legsWork-table lower shelfWork-table lower shelfWork-table lower shelfSalmon candySalmon candySalmon candySalmon candySalmon candySalmon candyTeriyaki smoked sablefishTeriyaki smoked sablefishTeriyaki smoked sablefishSockeye Salmon CandySalmon LeatherPackaging Table Legs...............................PFGE-ApaI1009080706050PFGE-AscIOE90-2OE90-3OE90-1FF63-2FF64-1FF64-2FF64-3FF66-3FF67-1FF67-2FF66-1FE13-2FE13-3FE14-1FE14-2FE14-3FE16-1FE16-2FE16-3FF14-1FF14-2FF14-3FF15-1FF15-2FF15-3FF19-1FF19-2FF19-3FF5-3FF6-2FE64-3ListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriamo ocyt.mo ocyt.mo ocyt.monocyt.mo ocyt.mo ocyt.mo ocyt.monocyt.monocyt.monocyt.monocyt.mo ocyt.mo ocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.DrainDrainDrainSalmon jerkyCajun salmonCajun salmonCajun salmonTeriyaki SalmonHoney Garlic SalmonHoney Garlic SalmonTeriyaki SalmonDrainDrainWork-table legsWork-table legsWork-table legsWork-table lower shelfWork-table lower shelfWork-table lower shelfSalmon candySalmon candySalmon candySalmon candySalmon candySalmon candyTeriyaki smoked sablefishTeriyaki smoked sablefishTeriyaki smoked sablefishSockeye Salmon CandySalmon LeatherPackaging Table Legs...............................PFGE-ApaI1009080706050PFGE-ApaIOE90-2OE90-3OE90-1FF63-2FF64-1FF64-2FF64-3FF66-3FF67-1FF67-2FF66-1FE13-2FE13-3FE14-1FE14-2FE14-3FE16-1FE16-2FE16-3FF14-1FF14-2FF14-3FF15-1FF15-2FF15-3FF19-1FF19-2FF19-3FF5-3FF6-2FE64-3ListeriaListeriaListeriaListeriaListeriaListeriaListeriaList riaListeriaListeriaList riaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaList riaList riaList riaListeriaListeriaListeriamonocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.mo ocyt.DrainDrainDrainSalmon jerkyCajun salmonCajun salmonCajun salmonTeriyaki SalmonHoney Garlic SalmonHoney Garlic SalmonTeriyaki SalmonDrainDrainWork-table legsWork-table legsWork-table legsWork-table lower shelfWork-table lower shelfWork-table lower shelfSalmon candySalmon candySalmon candySalmon candySalmon candySalmon candyTeriyaki smoked sablefishTeriyaki smoked sablefishTeriyaki smoked sablefishSockeye Salmon CandySalmon LeatherPackaging Table Legs...............................PFGE ApaI Sample ID Sample description PFGE AscI   221          Figure A-1. Continued.  FF6-2FE64-3FE65-1FE65-2FE66-1FE66-2FE66-3FF45-1FF45-2FF45-3FF46-3FF66-2160687.OF28-1OF28-2OF28-3MF28-2MF28-3FF63-1FF63-3FF65-1FF65-2FF65-3FF67-3FF46-1MF28-1FE11-2FE11-3FE10-2FE10-3FE7-1FE7-2FE8-2FE8-3FF1-1FF1-2FF1-3OF64-2FE13-1160686.160686.ListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriamonocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.Monocyt.Monocyt.Monocyt.monocyt.monocyt.monocyt.monocyt.LMACI.0623LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0081LMACI.0081LMAAI.0873LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0024LMAAI.0871LMAAI.0871Salmon LeatherPackaging Table LegsSlicerSlicerWork TableWork TableWork TableSpring wood smoked salmonSpring wood smoked salmonSpring wood smoked salmonIndian Candy SalmonTeriyaki SalmonT8383Pork breakfast sausage (raw)Pork breakfast sausage (raw)Pork breakfast sausage (raw)Pork breakfast sausage (raw)Pork breakfast sausage (raw)Salmon jerkySalmon jerkyShrimp MeatShrimp MeatShrimp MeatHoney Garlic SalmonIndian Candy SalmonPork breakfast sausage (raw)Cutting boardCutting boardTable LegTable LegDrainDrainSink LegSink LegSalmon nuggetSalmon nuggetSalmon nuggetHot Italian sausage (raw)DrainT8341T8359.........................................FF6-2FE64-3FE65-1FE65-2FE66-1FE66-2FE66-3FF45-1FF45-2FF45-3FF46-3FF66-2160687.OF28-1OF28-2OF28-3MF28-2MF28-3FF63-1FF63-3FF65-1FF65-2FF65-3FF67-3FF46-1MF28-1FE11-2FE11-3FE10-2FE10-3FE7-1FE7-2FE8-2FE8-3FF1-1FF1-2FF1-3OF64-2FE13-1160686.160686.ListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriamonocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.Monocyt.Monocyt.Monocyt.monocyt.monocyt.monocyt.monocyt.LMACI.0623LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0081LMACI.0081LMAAI.0873LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0024LMAAI.0871LMAAI.0871Salmon LeatherPackaging Table LegsSlicerSlicerWork TableWork TableWork TableSpring wood smoked salmonSpring wood smoked salmonSpring wood smoked salmonIndian Candy SalmonTeriyaki SalmonT8383Pork breakfast sausage (raw)Pork breakfast sausage (raw)Pork breakfast sausage (raw)Pork breakfast sausage (raw)Pork breakfast sausage (raw)S l on jerkyS l on jerkyShri p MeaShri p MeaShri p MeaHoney Garlic SalmonIndian Candy SalmonPork breakfast sausage (raw)Cutting boardCutting boardT ble LegT ble LegDrainDrainSink LegSink LegS lmon nuggetS lmon nuggetS lmon nuggetHot Italian sausage (raw)DrainT8341T8359.........................................FF6-2FE64-3FE65-1FE65-2FE66-1FE66-2FE66-3FF45-1FF45-2FF45-3FF46-3FF66-2160687.OF28-1OF28-2OF28-3MF28-2MF28-3FF63-1FF63-3FF65-1FF65-2FF65-3FF67-3FF46-1MF28-1FE11-2FE11-3FE10-2FE10-3FE7-1FE7-2FE8-2FE8-3FF1-1FF1-2FF1-3OF64-2FE13-1160686.160686.ListeriListeriListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriListeriListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriListeriListeriaListeriaListeriaListeriaListeriListeriListeriListeriaListeriaListeriaListeriaonocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.onocyt.onocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.Monocyt.Monocyt.Monocyt.monocyt.monocyt.monocyt.monocyt.LMACI.0623LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0036LMACI.0081LMACI.0081LMAAI.0873LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0412LMAAI.0024LMAAI.0871LMAAI.0871Salmon LeatherPackaging Table LegsSlicerSlicerWork TableWork TableWork TableSpring wood smoked salmonSpring wood smoked salmonSpring wood smoked salmonIndian Candy SalmonTeriyaki SalmonT8383Pork breakfast sausage (raw)Pork breakfast sausage (raw)Pork breakfast sausage (raw)Pork breakfast sausage (raw)Pork breakfast sausage (raw)Salmon jerkySalmon jerkyShrimp MeatShrimp MeatShrimp MeatHoney Garlic SalmonIndian Candy SalmonPork breakfast sausage (raw)Cutting boardCutting boardTable LegTable LegDrainDrainSink LegSink LegSalmon nuggetSalmon nuggetSalmon nuggetHot Italian sausage (raw)DrainT8341T8359.........................................  222           Figure A-1. Continued.  OE59 1OE59-2FE79-2FF5-1FF5-2DE37-1ListeriaListeriaListeriaListeriaListeriaListeriamonocyt.monocyt.monocyt.monocyt.monocyt.monocyt.DrainDrainSlicerSockeye Salmon CandySockeye Salmon CandyDrain......160686.160686.160687.160687.160687.160687.160687.DE26-1DE26-2DE26-3DE27-1DE27-2DE27-3OE59-3DE61-1DE61-2DE61-3OE43-1OE43-2OE43-3DE25-1DE25-2DE25-3FE10-1FE19-1FE19-2FF11-1FF11-2FF11-3OF61-1OF61-2OF64-1FE7-3FE11-1FE19-3FE20-1FE20-2FE20-3FE8-1--ListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriai t rii t rii t rimonocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.Monocyt.Monocyt.Monocyt.Monocyt.Monocyt.Monocyt.monocyt.Monocyt.Monocyt.Monocyt.monocyt.monocyt.monocyt.Monocyt.Monocyt.Monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.t.t.tLMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0118LMACI.0118LMACI.0118LMACI.0118LMACI.0118LMACI.0118LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0005LMAAI.0005LMAAI.0005LMAAI.0005LMAAI.0005LMAAI.0005LMAAI.0213LMAAI.0213LMAAI.0213T8341T8359T8367T8388T8397T8401T8407cinder blocks under sinkcinder blocks under sinkcinder blocks under sinkDraining rackDraining rackDraining rackDrainDrainDrainDrainDrainDrainDrainFloor drainFloor drainFloor drainTable LegDrainDrainCold smoked salmonCold smoked salmonCold smoked salmonBratwurst sausage (raw)Bratwurst sausage (raw)Hot Italian sausage (raw)DrainCutting boardDrainCart LegsCart LegsCart LegsSink Legr ir ili r.........................................OE59 1OE59-2FE79-2FF5-1FF5-2DE37-1ListeriaListeriaListeriaListeriaListeriaListeriamonocyt.monocyt.monocyt.monocyt.monocyt.monocyt.DrainDrainSlicerSockeye Salmon CandySockeye Salmon CandyDrain......160686.160686.160687.160687.160687.160687.160687.DE26-1DE26-2DE26-3DE27-1DE27-2DE27-3OE59-3DE61-1DE61-2DE61-3OE43-1OE43-2OE43-3DE25-1DE25-2DE25-3FE10-1FE19-1FE19-2FF11-1FF11-2FF11-3OF61-1OF61-2OF64-1FE7-3FE11-1FE19-3FE20-1FE20-2FE20-3FE8-1--ListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriai t rii t rii t rimonocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.Monocyt.Monocyt.Monocyt.Monocyt.Monocyt.Monocyt.monocyt.Monocyt.Monocyt.Monocyt.monocyt.monocyt.monocyt.Monocyt.Monocyt.Monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.t.t.tLMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0118LMACI.0118LMACI.0118LMACI.0118LMACI.0118LMACI.0118LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0005LMAAI.0005LMAAI.0005LMAAI.0005LMAAI.0005LMAAI.0005LMAAI.0213LMAAI.0213LMAAI.0213T8341T8359T8367T8388T8397T8401T8407cinder blocks under sinkcinder blocks under sinkcinder blocks under sinkDraining rackDraining rackDraining rackDrainDrainDrainDrainDrainDrainDrainFloor drainFloor drainFloor drainTable LegDrainDrainCold smoked salmonCold smoked salmonCold smoked salmonBratwurst sausage (raw)Bratwurst sausage (raw)Hot Italian sausage (raw)DrainCutting boardDrainCart LegsCart LegsCart LegsSink Legr ir ili r.........................................OE59 1OE59-2FE79-2FF5-1FF5-2DE37-1ListeriaListeriaListeriaListeriaListeriaListeriamonocyt.monocyt.monocyt.monocyt.monocyt.monocyt.DrainDrainSlicerSocke e Salmon CandySocke e Salmon CandyDrain......160686.160686.160687.160687.160687.16 687.16 687.DE26-1DE26-2DE26-3DE27-1DE27-2DE27-3OE59-3DE61-1DE61-2DE61-3OE43-1OE43-2OE43-3DE25-1DE25-2DE25-3FE10-1FE19-1FE19-2FF11-1FF11-2FF11-3OF61-1OF61-2OF64-1FE7-3FE11-1FE19-3FE20-1FE20-2FE20-3FE8-1OE59-1OE59-2FE79 2ListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriaListeriamonocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.Monocyt.Monocyt.Monocyt.Monocyt.Monocyt.Monocyt.monocyt.Monocyt.Monocyt.Monocyt.monocyt.monocyt.monocyt.Monocyt.Monocyt.Monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocyt.monocytLMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0081LMACI.0118LMACI.0118LMACI.0118LMACI.0118LMACI.0118LMACI.0118LMAAI 0871LMAAI 0871LMAAI 0871LMAAI 0871LMAAI 0871LMAAI 0871LMAAI 0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0871LMAAI.0005LMAAI.0005LMAAI.0005LMAAI.0005LMAAI.0005LMAAI.0005LMAAI.0213LMAAI.0213LMAAI.0213T8341T8359T8367T8388T8397T8401T8407cinder blocks under sinkcinder blocks under sinkcinder blocks under sinkDrai ing rackDrai ing rackDrai ing rackDraiDraiDraiDraiDraiDraiDraiFloor drainFloor drainFloor drainTable LegDraiDraiCold smoked salmonCold smoked salmonCold smoked salmonBratwurst sausage (raw)Bratwurst sausage (raw)Hot Italian sausage (raw)DraiCutting boardDraiCart LegsCart LegsCart LegsSink Legrainrainlicer.........................................  223 Appendix B – Chapter 3 supplementary table    224 Table B-1. Summary of mutability, cold growth adaptation, and invasion efficiency of different inlA genotypes amongst 56 L. monocytogenes isolates recovered from foods and food processing environments of dairy, meat and fish processing facilities.      Cold growth adaptationc inlA Genotyped    Isolate ID Fac. type Sourcea Sero-type No. of RIFR coloniesb (SEM) Cold growth phenotype Lag phase duration  (h) Growth rate (Δlog10CFU/h) Protein length (a.a.) PMSC/ inlA mutation type MLST PFGE Mean % invasion efficiency (SEM) Food processing facilities DE 25-1 Dairy FPE 1/2a 6.5 ± 1.0 Slow 248.9 ± 44.2 0.0050 ± 0.0006 800 N/A 7 G2  DE 26-1 Dairy FPE 1/2a 9.3 ± 2.1 N/A N/A N/A 800 N/A 11 F1  DE 27-1 Dairy FPE 1/2a 7.5 ±3.0 Intermediate 141.2 ± 6.0 0.011 ± 0.002 800 N/A 11 F1  DE 37-3 Dairy FPE 1/2a 1.8 ± 1.0 Intermediate 187.2 ± 68.9 0.0020 ± 0.001 800 N/A 155 N1  DE 61-1 Dairy FPE 1/2a 7.3 ± 1.1 Slow 201.2 ± 65.7 0.0035 ± 0.001 800 N/A 7 G1  MF 28-1 Meat RUF 1/2c 6.2 ± 3.2 N/A N/A N/A 685 11 9 H2 0.027 ± 0.003 MF 28-2 Meat RUF 1/2a 6.0 ± 4.8 Intermediate 141.3 ± 6.0 0.0018 ± 0.0005 800 N/A 662 J1  FF 1-1 Fish RTE 1/2c 4.2 ± 0.7 Intermediate 167.9 ± 54.1 0.0025 ± 0.0006 8 4 9 H1  FE 7-1 Fish FPE 1/2c 10.3 ± 5.9 N/A N/A N/A 8 4 9 H1 0.034 ± 0.007 FE7-3 Fish FPE 3a 5.3 ± 1.8 Intermediate 168.6 ± 89.2 0.0025 ± 0.001 699 3 321 K5  FE8-1 Fish FPE 3a 4.3 ± 1.4 Intermediate 153.7 ± 22.4 0.0013 ± 0.0009 699 3 321 K3  FE8-2 Fish FPE 1/2c 3.7 ± 1.7 N/A N/A N/A 8 4 9 H1  FE10-1 Fish FPE 3a 10.7 ± 0.9 N/A N/A N/A 699 3 321 K4  FE10-2 Fish FPE 1/2c 14.0 ± 4.4 Intermediate 149.8 ± 15.5 0.0015 ± 0.0006 8 4 9 H1  FE11-1 Fish FPE 3a 6.8 ± 1.6 N/A N/A N/A 699 3 321 K2**  FE11-2 Fish FPE 1/2c 2.7 ± 1.0 N/A N/A N/A 8 4 9 H4  FE11-3 Fish FPE 1/2c 2.8 ± 0.9 Intermediate 175.9±17.5 0.0020 ± 0.003 8 4 9 H4  FE13-1 Fish FPE 1/2a 4.8 ± 0.7 N/A N/A N/A 797 Δ738-740 155 L1 7.19 ± 0.6 FE13-2 Fish FPE 4b 31.7 ± 4.6 N/A N/A N/A 797 Δ738-740 194 A1  FE14-1 Fish FPE 4b 43.7 ± 13.4 N/A N/A N/A 800 N/A 194 A1  FE16-1 Fish FPE 4b 26.5 ± 2.9 N/A N/A N/A 797 Δ738-740 194 A1                                           225      Cold growth adaptationc inlA Genotyped    Isolate ID Fac. type Sourcea Sero-type No. of RIFR coloniesb (SEM) Cold growth phenotype Lag phase duration  (h) Growth rate (Δlog10CFU/h) Protein length (a.a.) PMSC/ inlA mutation type MLST PFGE Mean % invasion efficiency (SEM) Food processing facilities FF5-1 Fish RTE 4b 51.2 ± 19.3 Slow 293.2 ± 22.9 0.027 ± 0.006 797 Δ738-740 194 M1  FE19-1 Fish FPE 1/2a 23.8 ± 9.2 Slow 245.1 ± 26.7 0.0027 ± 0.001 699 3 321 K9  FE20-1 Fish FPE 1/2a 45.2 ± 17.9 N/A N/A N/A 699 3 321 K1  FF6-2 Fish RTE 4b 19.7 ± 2.0 Slow 222.2 ± 76.5 0.030 ± 0.0007 800 N/A 2 A2  FF11-1 Fish RTE 1/2a 4.0 ± 0.3 Intermediate 156.2 ± 17.3 0.0013 ± 0.0009 699 3 321 K6  FF14-1 Fish RTE 4b 30.0 ± 6.2 N/A N/A N/A 797 Δ738-740 194 A1  FF15-1 Fish RTE 4b 48.0 ± 6.5 Fast 7.1 ± 3.6 0.0018 ± 0.0009 797 Δ738-740 194 A1  FF19-1 Fish RTE 4b 29.3 ± 7.7 Fast 39.2 ± 40.0 0.0018 ± 0.002 797 Δ738-740 194 A1 4.76 ± 0.5 FE64-3 Fish FPE 4b 16.7 ± 3.4 N/A N/A N/A 800 N/A 1 B1  FE65-1 Fish FPE 4b 47.8 ± 37.1 N/A N/A N/A 800 N/A 1 B1  FE66-1 Fish FPE 4b 92.3 ± 69.7 N/A N/A N/A 800 N/A 1 B1  FE66-3 Fish FPE 4b 14.3 ± 2.8 Fast 25.7 ± 12.5 0.0025 ± 0.001 800 N/A 1 B1  FE79-1 Fish FPE 4b 33.8 ± 7.2 N/A N/A N/A 797 Δ738-740 6 E1  FF45-1 Fish RTE 4b 15.3 ± 1.4 Fast 42.4 ± 9.5 0.0018 ± 0.002 800 N/A 1 B1  FF46-1 Fish RTE 1/2a 2.2 ± 1.5 Fast 50.7 ± 8.6 0.0013 ± 0.001 800 N/A 9 H3  FF46-3 Fish RTE 4b 35.5 ± 26.1 Intermediate 136.8 ± 4.7 0.057 ± 0.008 800 N/A 1 B1 10.91 ± 1.1 FF63-1 Fish RTE 1/2a 39.2 ± 11.2 Fast 18.8 ± 2.5 0.0015 ± 0.001 800 N/A 91 I2  FF63-2 Fish RTE 4b 8.7 ± 2.8 Fast 46.3 ± 19.1 0.0008 ± 0.0009 797 Δ738-740 6 C1  FF64-1 Fish RTE 4b 17.8 ± 4.4 Fast 42.7 ± 79.8 0.0015 ± 0.0006 797 Δ738-740 6 C1  FF65-1 Fish RTE 1/2a 11.2 ± 5.3 Fast 56.7 ± 19.9 0.0018 ± 0.0005 800 N/A 91 I1  FF66-1 Fish RTE 4b 20.7 ± 4.5 Fast 64.0 ± 27.2 0.0008 ± 0.0005 797 Δ738-740 6 C2  FF66-2 Fish RTE 4b 13.2 ± 1.6 N/A N/A N/A 800 N/A 1 B1  FF67-1 Fish RTE 4b 10.3 ± 2.7 N/A N/A N/A 797 Δ738-740 6 C1  FF67-2 Fish RTE 4b 10.0 ± 1.6 Fast 63.6 ± 6.5 0.0020 ± 0.0008 797 Δ738-740 6 C1  FF67-3 Fish RTE 1/2a 18.3 ± 5.7 Intermediate 164.6 ± 5.3 0.0015 ± 0.0006 800 N/A 91 I2  OF28-1 Meat RUF 1/2a 52.8 ± 12.2 Fast 68.6 ± 7.1 0.0035 ± 0.002 800 N/A 120 H6                 226      Cold growth adaptationc inlA Genotyped    Isolate ID Fac. type Sourcea Sero-type No. of RIFR coloniesb (SEM) Cold growth phenotype Lag phase duration  (h) Growth rate (Δlog10CFU/h) Protein length (a.a.) PMSC/ inlA mutation type MLST PFGE Mean % invasion efficiency (SEM) Food processing facilities OE43-1 Meat FPE 1/2a 50.2 ± 25.2 Intermediate 133.4 ± 18.8 0.0035 ± 0.0017 800 N/A 7 G4  OE59-1 Meat FPE 1/2a 7.2 ± 1.6 Fast 67.6 ± 8.8 0.0023 ± 0.0009 699 3 321 K10  OE59-3 Meat FPE 1/2a 1.3 ± 0.4 Fast 48.5 ± 33.8 0.0033 ± 0.001 800 N/A 11 F2  OF61-1 Meat RUF 1/2a 18.8 ± 7.8 N/A N/A N/A 699 3 321 K7 0.011 ± 0.001 OF64-1 Meat RUF 1/2a 7.7 ± 2.3 N/A N/A N/A 699 3 321 K7  OF64-2 Meat RUF 1/2c 4.0 ± 1.5 Fast 55.9 ± 21.3 0.0028 ± 0.003 684 11 9 H5  OE90-1 Meat FPE 1/2b 4.5 ± 1.0 Intermediate 93.5 ± 14.5 0.0025 ± 0.001 605 1 5 D2 0.006 ± 0.001 Retail facilities LR39-1 Retail (fish) RTE 1/2a 13.7 ± 2.2 N/A N/A N/A 800 N/A 120 LMACI.0001/ LMAAI.0001  LR59-1 Retail (fish) RTE 1/2b 6.8 ± 0.7 N/A N/A N/A 800 N/A 296 LMACI.0470/  LMAAI.0584   aFPE, food processing environment; RUF, raw unprocessed food; RTE, ready-to-eat food. bNumber of colonies resistant to rifampicin (100 µg/ml) after 24 hr growth at 37°C. SEM, standard error of the mean. cCold adaptation of isolates when grown at 4°C following a downshift from 37°C in BHI. N/A, not assessed. dinlA genotypes include mutations resulting in premature stop codons (PMSCs) or codon deletions (Δ). e% of bacteria recovered from Caco-2 cells relative to initial inoculum; measured in triplicate and repeated two times. Invasion efficiency was compared to wild type clinical isolates 08-5578 (5.04±0.32%) and EGD-SmR (1.01±0.09%), and a Tn1545-induced non-invasive inlA mutant of EGD-SmR, BUG5 (0.009±0.0008%).   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0167020/manifest

Comment

Related Items