UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Regulation and transport of apolipoprotein A-I into the central nervous system and therapeutic potential… Stukas, Katrina Sophie Claire 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2014_november_stukas_katrina.pdf [ 5.17MB ]
Metadata
JSON: 24-1.0166993.json
JSON-LD: 24-1.0166993-ld.json
RDF/XML (Pretty): 24-1.0166993-rdf.xml
RDF/JSON: 24-1.0166993-rdf.json
Turtle: 24-1.0166993-turtle.txt
N-Triples: 24-1.0166993-rdf-ntriples.txt
Original Record: 24-1.0166993-source.json
Full Text
24-1.0166993-fulltext.txt
Citation
24-1.0166993.ris

Full Text

REGULATION AND TRANSPORT OF APOLIPOPROTEIN A-I INTO THE CENTRAL NERVOUS SYSTEM AND THERAPEUTIC POTENTIAL IN ALZHEIMER’S DISEASE by  Katrina Sophie Claire Stukas  Honours B.Sc., University of Victoria, 2008  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Pathology and Laboratory Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)   September 2014  © Katrina Sophie Claire Stukas, 2014 ii  Abstract Patients with Alzheimer’s Disease (AD) exhibit substantial cerebrovascular damage, including the accumulation of β-amyloid (Aβ) peptides within the vessel wall. Mid-life vascular risk factors increase the risk of AD potentially via the loss of beneficial or gain of toxic functions in circulating high density lipoprotein (HDL). Low plasma levels of apolipoprotein A-I (apoA-I), the primary protein component of HDL, increase AD risk and correlate with cognitive decline, and preliminary preclinical evidence supports a role of apoA-I in mediating removal of cerebrovascular Aβ, suppressing neuroinflammation, and enhancing cognitive function. Our strategy was to perturb peripheral and central nervous system (CNS) apoA-I levels through genetic modification of proteins known to regulate apoA-I metabolism and via indirect and direct pharmacological manipulation of apoA-I to delineate its CNS transport, regulation and therapeutic potential in AD.  Loss of ATP binding cassette transporter A1 (ABCA1), which effluxes cholesterol onto lipid-poor apoA-I to generate immature pre-β-HDL, lead to significant parallel decreases of circulating and CNS apoA-I, while stimulation of ABCA1 activity with an Liver-X-Receptor (LXR) agonist substantially increased apoA-I levels selectively in the CNS, solubilized Aβ and improved cognitive function in AD mice. Although apoA-I was increased independent of ABCA1, ABCA1 was required to observe LXR-mediated cognitive benefits, suggesting lipidation of apolipoproteins is a critical regulator of their function. Pre-β-HDL appear to be the more biologically relevant species regarding CNS health, as loss of lecithin-cholesterol acetyl transferase (LCAT), which esterifies free cholesterol to generate mature α-HDL, does not impact AD pathology in vivo. Intravenously injected human apoA-I gains access to the CNS predominantly via the blood cerebrospinal fluid barrier, where it is bound, internalized, and transported by the epithelial cells of the choroid plexus in a specific receptor mediated fashion. Weekly injection of reconstituted HDL, formulated to enrich the pre-β pool, into symptomatic AD mice transiently decreased plasma Aβ levels but was unable to modulate brain Aβ, neuroinflammation, or endothelial activation in the experimental paradigm used. Collectively, these data identified ABCA1 generated apoA-I pre-β-HDL species as a key population of HDL subspecies for modulating AD pathology in vivo. iii  Preface Sections of the Introduction have been previously published as an invited review article; Stukas S, Robert J, Wellington CL. High Density Lipoproteins and Cerebrovascular Integrity in Alzheimer’s Disease. 2014. Cell Metabolism; 19(4):574-91. The concepts, structure and content of this review were designed by myself, with assistance and editing by Dr. Jerome Robert and Dr. Cheryl Wellington. I was responsible for the majority of the writing in addition to generating the table and figures, while Dr. Jerome Robert completed the section on peripheral HDL function and Dr. Cheryl Wellington wrote the section regarding the benefits of exercise.  A version of Chapter 2 has been published in two manuscripts, the first being; Donkin JJ, Stukas S, Hirsch-Reinshagen V, Namjoshi D, Wilkinson A, May S, Chan J, Fan J, Collins J, Wellington CL. ATP-binding cassette transporter A1 mediates the beneficial effects of the liver X receptor agonist GW3965 on object recognition memory and amyloid burden in amyloid precursor protein/presenilin 1 mice. 2010. Journal of Biological Chemistry; 285(44):34144-54. All work from this chapter was carried out in the laboratory of Dr. Cheryl Wellington. Experimental design, analysis and writing were carried out by Dr. James Donkin and myself with assistance from Dr. Cheryl Wellington. Specifically, I was responsible for protein extraction, immunoblotting, and ELISA measurements, data analysis, figure generation, and assisting in writing the manuscript, specifically the results section for data I had generated. Contributions of co-authors for Donkin et al:  Dr. James Donkin was responsible for experimental design, animal work, including behavior and tissue collection, and histological analysis. In addition he undertook the majority of the writing with respect to the introduction and discussion.  Dr. Veronica Hisrch-Reinshagen was responsible for collecting cerebrospinal fluid in addition to assisting with tissue collection. She also contributed significantly with respect to the interpretation and discussion of data.  Dhananjay Namjoshi assisted with tissue collection.  Anna Wilkinson, Sharon May, and Dr. Jianjia Fan provided technical assistance with respect to immunoblotting and ELISAs. iv   Jeniffer Chan was responsible for all animal genotyping and qRT PCR.  Dr. Jon Collins provided the GW3965 compound. A second manuscript that continued further in depth analysis of the prior study was also published and represented in Chapter 1; Stukas S, May S, Wilkinson A, Donkin J, Wellington CL. The LXR agonist GW3965 increases apoA-I protein levels in the central nervous system independent of ABCA1. 2012. Biochimica et Biophysica Acta; 1821(3): 536-46. The experiments, analysis, figures, and text were completed by myself that were then edited by Dr. Cheryl Wellington, while other co-authors provided technical support as described above.  A version of Chapter 3 has been previously published; Stukas S, Freeman L, Lee M, Wilkinson A, Ossoli A, Vaisman B, Demosky S, Chan J, Hisrch-Reinshagen V, Remaley AT,  Wellington CL. LCAT deficiency does not impair amyloid metabolism in APP/PS1 mice. 2014. Journal of Lipid Research, June 20, epublication ahead of print. This work was done in collaboration with the laboratory of Dr. Alan Remaley at the National Institute of Health (NIH). The original experimental design was constructed by Dr. Veronica Hirsch-Reinshagen, and modified by myself, Lita Freeman and Drs. Wellington and Remaley. I was responsible for 75% of the experimental work, construction of the figures and text, with editing assistance from Drs. Wellington and Remaley.  Contributions of co-authors:  Lita Freeman performed the native immunoblotting of plasma and denaturing immunoblotting for plasma LCAT and apoA-I, in addition to coordination samples and experimental setup at the NIH.  Anna Wilkinson, Michael Lee, and Jeniffer Chan provided technical assistance in running denaturing immunoblots of brain tissue, histological analysis and mouse genotyping.  Alice Ossoli and Dr. Boris Vaisman performed the qRT PCR measurements of LCAT in cortical and liver tissue samples.  Stephen Demosky performed the analysis of plasma LCAT activity under the guidance and instruction of Dr. Boris Vaisman.  v  A version of Chapter 4 is currently under revision; Stukas S, Robert J, Lee M, Kulic I, DeValle N, Carr M, Fan F,  Namjoshi D, Lemke K, Chan J, Wilson T, Wilkinson A, Chapanian R, Kizhakkedathu JN , Oda MN and Wellington CL. Intravenously injected human apolipoprotein A-I rapidly enters the central nervous system via the choroid plexus. This work was carried out primarily in the laboratory of Dr. Wellington in collaboration with Dr. Michael Oda at Children’s Hospital Oakland Research Institute, in Oakland California and Dr. Jayachandran Kizhakkedathu at the University of British Columbia. I was responsible for experiment design and concepts, the majority (90%) of experimental work, data analysis, figure generation, and writing of the manuscript. Drs. Wellington, Oda, and Robert also assisted with editing the manuscript. Contributions of co-authors:  Dr. Jerome Robert provided invaluable assistance for apoA-I transport assays and primary culture in addition to contributing significantly to the discussion and interpretation of results.  Michael Lee provided considerable technical assistance in collecting and processing tissues and histological analysis.  Dr. Jianjia Fan, Dhananjay Namjoshi, and Michael Carr assisting in tissue collection.  Jeniffer Chan, Anna Wilkinson, and Tammy Wilson provided technical assistance with qRT PCR, immunoblotting, and ELISAs.  Nicole DeValle and Kalistyn Lemke were responsible for production of the recombinant apoA-I protein in addition to training myself to produce, purify and label this protein that was overseen by Dr. Michael Oda.  Drs. Chapanian and Kizhakkedathu performed the kinetic analysis to calculate elimination half-lives.   All animal procedures were approved by the Canadian Council of Animal Care (CCAC) and the University of British Columbia Committee on Animal Care (protocol identification A09 0916, A10 0231, A14 0003). I successfully completed the training requirements of the CCAC and the National Institutional Animal User Training Program (NIAUT) (certificate number 2750-08), in addition to UBC Rodent Biology and Husbandry (certificate RBH-617-09), UBC Rodent Anesthesia (certificate RA-335-09) and UBC Rodent Surgery (certificate RSx-361-10). vi  Table of Contents Abstract .......................................................................................................................................... ii Preface ........................................................................................................................................... iii Table of Contents ......................................................................................................................... vi List of Tables ............................................................................................................................... xii List of Figures ............................................................................................................................. xiii List of Abbreviations ................................................................................................................. xvi Acknowledgements .................................................................................................................... xxi Chapter 1: Introduction ................................................................................................................1 1.1 Summary ......................................................................................................................... 1 1.2 AD: Epidemiology and Pathology .................................................................................. 2 1.2.1 Definition .................................................................................................................... 2 1.2.2 Neuropathology........................................................................................................... 5 1.2.3 The Amyloid Hypothesis ............................................................................................ 6 1.2.4 Pathways to Aβ Degradation and Clearance from the CNS ....................................... 8 1.2.4.1 Proteolytic Degradation ...................................................................................... 9 1.2.4.2 Transport Across the BBB ................................................................................ 11 1.2.4.3 Perivascular Drainage and Transport across the BCSFB ................................. 12 1.3 Clinical and Pathological Evidence of Altered Cerebrovascular and Barrier Function in AD ....................................................................................................................................... 15 1.3.1 The BBB and BCSFB Regulate Entry and Egress of Substances from the Brain .... 15 1.3.2 Impaired CBF and Glucose Metabolism are Early Clinical Features of AD ............ 16 1.3.3 Morphological and Functional Changes to the Cerebrovasculature in AD .............. 17 1.3.4 Effect of Amyloid Deposition on BBB and BCSFB Integrity and Function ............ 19 1.3.4.1 Aβ Deposition in the Cerebrovasculature and Choroid Plexus ........................ 19 1.3.4.2 Aβ Disrupts BBB Integrity and Normal Cerebrovascular Function ................. 20 1.3.4.3 Aβ Induced Damage to the BCSFB .................................................................. 20 1.4 Comorbid Conditions Associated with Increased AD Risk Affect Cerebrovascular Function .................................................................................................................................... 21 1.4.1 Hypertension Contributes to Vessel Stiffening and Brain Hypoperfusion ............... 21 vii  1.4.2 Endothelial Function is Compromised in T2DM and CVD ..................................... 22 1.5 HDL Metabolism .......................................................................................................... 23 1.5.1 Peripheral Generation of HDL .................................................................................. 24 1.5.2 CNS Generation of HDL .......................................................................................... 26 1.5.3 ABCA1 Regulates ApoA-I and ApoE Levels and Lipidation .................................. 26 1.6 Impact of HDL on Vascular Health and its Potential Contributions to AD ................. 27 1.6.1 HDL and eNOS Activation ....................................................................................... 27 1.6.2 HDL, Inflammation and Oxidation ........................................................................... 29 1.6.3 HDL, Endothelial Repair and BBB Integrity ............................................................ 29 1.7 Apolipoproteins in Aβ Metabolism and Cerebrovascular Health ................................. 30 1.7.1 ApoE ......................................................................................................................... 30 1.7.1.1 Isoform .............................................................................................................. 30 1.7.1.2 Lipidation .......................................................................................................... 31 1.7.1.3 Aβ Independent Mechanisms ............................................................................ 32 1.7.2 ApoA-I ...................................................................................................................... 33 1.7.2.1 Source of ApoA-I in the CNS ........................................................................... 33 1.7.2.2 Putative Role of ApoA-I in AD Pathology and Progression ............................ 34 1.8 Therapeutic Approaches Targeting HDL and Cerebrovascular Health ........................ 35 1.8.1 HDL and ApoA-I Infusion ........................................................................................ 36 1.8.2 ApoA-I Mimetic Peptides ......................................................................................... 38 1.8.3 Small Molecule HDL Modulators ............................................................................ 39 1.8.3.1 CETP Inhibitors ................................................................................................ 39 1.8.3.2 Endothelial Lipase Inhibitors ............................................................................ 41 1.8.3.3 Niacin ................................................................................................................ 42 1.8.4 Therapies Targeting HDL Function and Reverse Cholesterol Transport ................. 43 1.8.4.1 Liver X Receptor and Retinoid X Receptor Agonists ...................................... 43 1.9 Summary, Hypothesis, and Specific Objectives ........................................................... 44 Chapter 2: Regulation of Lipoprotein Metabolism and ABCA1-Dependency of the Liver-X-Receptor Agonist GW3965 in APP/PS1 Mice ...........................................................................46 2.1 Summary ....................................................................................................................... 46 viii  2.2 Introduction ................................................................................................................... 46 2.3 Methods......................................................................................................................... 51 2.3.1 Animals and GW3965 delivery ................................................................................ 51 2.3.2 Behavioural Testing .................................................................................................. 51 2.3.3 Novel Object Recognition......................................................................................... 51 2.3.4 Morris Water Maze ................................................................................................... 52 2.3.5 CSF, Plasma, and Tissue Collection ......................................................................... 53 2.3.6 Plasma Lipid Analysis .............................................................................................. 53 2.3.7 Protein Extraction ..................................................................................................... 53 2.3.8 Immunoblotting......................................................................................................... 53 2.3.9 Aβ ELISA ................................................................................................................. 54 2.3.10 Histology ............................................................................................................... 54 2.3.11 Statistical Analysis ................................................................................................ 55 2.4 Results ........................................................................................................................... 55 2.4.1 Modulation of Plasma Lipid and Lipoprotein Levels by GW3965 .......................... 55 2.4.2 GW3965 Increases CNS ABCA1 and ApoE Protein Levels in a Dose-Dependent Manner .................................................................................................................................. 57 2.4.3 ABCA1 is Required to Observe Increased CSF ApoE in Response to GW3965 ..... 58 2.4.4 GW3965 Selectively Increases CNS ApoA-I Independent of ABCA1 .................... 61 2.4.5 GW3965 Increases Soluble Pools of Aβ but Does Not Affect Insoluble Aβ or Amyloid Deposition .............................................................................................................. 62 2.4.6 ABCA1 is Required for GW3965-Mediated Improvements in Object and Spatial Memory ................................................................................................................................. 65 2.5 Discussion ..................................................................................................................... 66 2.6 Supplemental Information ............................................................................................ 72 2.6.1 Supplemental Methods.............................................................................................. 72 2.6.1.1 mRNA Extraction and qRT PCR ...................................................................... 72 2.6.1.2 Denaturing Immunoblotting for APP and CTFs ............................................... 73 2.6.1.3 Dot Blot Analysis of Total and Oligomeric Aβ ................................................ 73 2.6.2 Supplemental Figures................................................................................................ 73 ix  Chapter 3: Lipoprotein and Amyloid Metabolism Following Blockage of High Density Lipoprotein Maturation by Lecithin Cholesterol Acyltransferase .........................................76 3.1 Summary ....................................................................................................................... 76 3.2 Introduction ................................................................................................................... 76 3.3 Methods......................................................................................................................... 79 3.3.1 Animals ..................................................................................................................... 79 3.3.2 CSF, Plasma, and Tissue Collection ......................................................................... 79 3.3.3 Plasma Lipid and Lipoprotein Analysis .................................................................... 79 3.3.4 Plasma LCAT Activity Assay ................................................................................... 80 3.3.5 Protein Extraction ..................................................................................................... 80 3.3.6 Immunoblotting......................................................................................................... 80 3.3.7 Aβ ELISA ................................................................................................................. 81 3.3.8 Histology ................................................................................................................... 81 3.3.9 mRNA Extraction and qRT PCR .............................................................................. 82 3.3.10 Statistical Analysis ................................................................................................ 82 3.4 Results ........................................................................................................................... 82 3.4.1 LCAT Expression and Plasma Activity is not Affected by Aging or the Onset of Amyloid Deposition in APP/PS1 Mice ................................................................................ 82 3.4.2 LCAT Deficiency Selectively Reduces Plasma and CNS ApoA-I ........................... 84 3.4.3 Aβ and Amyloid Deposition are not increased by Loss of LCAT in APP/PS1 Mice ..   ................................................................................................................................... 86 3.5 Discussion ..................................................................................................................... 87 3.6 Supplemental Information ............................................................................................ 89 3.6.1 Supplemental Methods.............................................................................................. 89 3.6.1.1.1 Immunoblotting ........................................................................................... 89 3.6.2 Supplemental Figures................................................................................................ 89 Chapter 4: ApolipoproteinA-I in the Central Nervous System: Transport and Therapeutic Development .................................................................................................................................91 4.1 Summary ....................................................................................................................... 91 4.2 Introduction ................................................................................................................... 92 x  4.3 Methods......................................................................................................................... 93 4.3.1 Animals ..................................................................................................................... 93 4.3.2 ApoA-I and HDL Preparation ................................................................................... 94 4.3.2.1 Recombinant HapoA-I ...................................................................................... 94 4.3.2.2 Serum-derived HapoA-I.................................................................................... 94 4.3.2.3 CSL-111 ............................................................................................................ 94 4.3.3 Intravenous Injections ............................................................................................... 95 4.3.3.1 C57Bl/6 Mice .................................................................................................... 95 4.3.3.2 APP/PS1 Mice .................................................................................................. 95 4.3.4 CSF, Plasma, and Tissue Collection ......................................................................... 95 4.3.5 Protein Extraction ..................................................................................................... 96 4.3.6 Immunoblotting......................................................................................................... 96 4.3.7 ELISAs ...................................................................................................................... 97 4.3.8 Imaging and Histology .............................................................................................. 97 4.3.8.1 Maestro Fluorescent Imaging ........................................................................... 97 4.3.8.2 Immunohistochemical Detection of hapoA-I, IgG, Lectin ............................... 97 4.3.8.3 Measurement of Amyloid Burden using Thioflavin S and Resorufin .............. 98 4.3.8.4 Immunohistological Detection of Microglia and Astrocytes ............................ 98 4.3.9 Primary Human Choroid Plexus Epithelial Cell (hCEpiC) Culture and HapoA-I Binding and Transport Studies.............................................................................................. 98 4.3.10 Kinetic Modeling .................................................................................................. 99 4.3.11 Statistics .............................................................................................................. 100 4.4 Results ......................................................................................................................... 100 4.4.1 In Mice, Steady State Endogenous ApoA-I Levels in CSF and Perfused Brain Tissue are Approximately 0.01% and 10% of its Levels in Plasma and Liver, Respectively ....... 100 4.4.2 Intravenously Injected Alexa647-hapoA-I Shows Dose-Dependent Uptake ......... 101 4.4.3 Intravenously Injected Alexa647-hapoA-I Rapidly Localizes to Cerebral Ventricles and the Choroid Plexus ....................................................................................................... 102 4.4.4 Elimination of Alexa647-hapoA-I from the CNS ................................................... 104 4.4.5 HapoA-I Transport across the Blood-CSF Barrier (BCSFB) ................................. 106 xi  4.4.6 In Symptomatic APP/PS1 Mice CSL-111 Specifically Reduces Circulating Aβ40 24 Hours After a Single Injection ............................................................................................ 107 4.4.7 Brain Aβ Metabolism is not Altered Following Chronic Injections of CSL-111 into Symptomatic APP/PS1 Mice .............................................................................................. 110 4.4.8 Evidence of Neuroinflammation and Endothelial Activation in Symptomatic APP/PS1 Mice .................................................................................................................... 112 4.4.9 Brain Levels of ABCA1, LDLR, and ApoE are not Affected by CSL-111 ........... 114 4.5 Discussion ................................................................................................................... 115 4.6 Supplemental Information .......................................................................................... 120 4.6.1 Supplemental Methods............................................................................................ 120 4.6.1.1 Animals ........................................................................................................... 120 4.6.1.2 Intravenous Injection of Evans Blue Dye to Test BBB Permeability ............. 120 4.6.1.3 mRNA Extraction and qRT PCR .................................................................... 120 4.6.1.4 hCEpiC Co-localization and Transport Assays .............................................. 121 4.6.2 Supplemental Figures.............................................................................................. 121 Chapter 5: Discussion and Concluding Remarks ...................................................................126 5.1 Summary and Significance ......................................................................................... 126 5.2 Toward Leveraging HDL Modifying Therapeutics for AD ....................................... 130 5.3 Contribution of Vascular Dysfunction and Cerebrovascular Amyloid Angiopathy to AD Pathology and Presentation .............................................................................................. 131 5.3.1 Detection and Removal of CAA ............................................................................. 131 5.3.2 Removal of Amyloid from the Brain Parenchyma and Cerebrovasculature: Benefit or Hazard ............................................................................................................................. 132 5.3.3 Looking Forward – the Future of ApoA-I based HDL in AD ................................ 135 References ...................................................................................................................................136 Appendices ..................................................................................................................................201 Appendix A Transgenic Mouse Models of Alzheimer’s Disease Mentioned in this Thesis. . 202 Appendix B Master Antibody List Used for Immunoblotting and Immunohistochemistry in this Thesis. .............................................................................................................................. 203 xii  List of Tables Table 1.1 Concentration of apoE and apoA-I containing lipoprotein particles in CSF. ............... 33 Table 2.1 Experimental design and outcome measures for mouse models of AD administered synthetic LXR agonists, TO901317 and GW3965 ....................................................................... 68  xiii  List of Figures Figure 1.1 Alzheimer’s Disease neuropathology and disease progression. .................................... 4 Figure 1.2 APP processing via the amylodogenic and non-amylodogenic pathways .................... 6 Figure 1.3 Major pathways leading to the degradation and clearance of Aβ from the CNS .......... 9 Figure 1.4 Basic structural anatomy of the BBB, BCSFB, and brain-CSF interfaces. ................. 15 Figure 1.5 Structural and functional damage to the BBB and BCSFB in AD. ............................. 19 Figure 1.6 Generation and maturation of central nervous system and peripheral high density lipoprotein species. ....................................................................................................................... 25 Figure 1.7 Effects of high density lipoproteins on functions and survival of endothelial cells. ... 28 Figure 2.1 ABCA1 mediates the efflux of cholesterol and phopholipids onto lipid-poor apolipoprotein acceptors. .............................................................................................................. 48 Figure 2.2 A schematic representation of the potential mechanism of liver X receptors in Alzheimer’s disease. ..................................................................................................................... 50 Figure 2.3 High-dose GW3965 significantly elevates plasma HDL-C, LDL-C,  total cholesterol, and apoE in mice. .......................................................................................................................... 56 Figure 2.4 Dose-dependent increase of cortical and hippocampal ABCA1 and apoE in response to GW3965 in APP/PS1 mice. ...................................................................................................... 58 Figure 2.5 High dose GW3965 significantly alters CSF lipoprotein size and levels in APP/PS1 mice. .............................................................................................................................................. 60 Figure 2.6 ApoA-I protein levels are increased in brain but not liver tissue in an ABCA1-independent manner following high dose GW3965 treatment in APP/PS1 mice. ....................... 61 Figure 2.7 High dose GW3965 significantly increases carbonate soluble cortical Aβ in both APP/PS1 WT and APP/PS1 ABCA1-/- mice. .............................................................................. 63 Figure 2.8 Thioflavin S positive amyloid deposits are unaffected by GW3965 administration... 64 Figure 2.9 ABCA1 is required for GW3965-mediated improvement in object and spatial memory in APP/PS1 mice. .......................................................................................................................... 65 Figure 2.10 GW3965 up-regulates cortical apoE mRNA in a dose-dependent manner in APP/PS1 ABCA1-/- mice. ............................................................................................................................ 73 Figure 2.11 APP production and processing are unaffected by loss of ABCA1 or GW3965. ..... 74 xiv  Figure 2.12 No net change in the ratio of oligomeric to total Aβ in APP/PS1 WT and ABCA1-/- mice following low or high dose GW3965 in chow. .................................................................... 74 Figure 2.13 No change to cortical total or vascular amyloid burden in APP/PS1 mice fed high dose GW3965 from 8 to 10 months of age. .................................................................................. 75 Figure 3.1 LCAT mediated cholesterol esterification and maturation of HDL in the CNS and circulation. .................................................................................................................................... 78 Figure 3.2 Expression, levels and plasma activity of LCAT is unaffected by age or the accumulation of Aβ and amyloid. ................................................................................................. 83 Figure 3.3 Deletion of LCAT in APP/PS1 mice significantly reduces HDL-C, specifically α-migrating particles ........................................................................................................................ 84 Figure 3.4 CNS ApoA-I is significantly reduced in APP/PS1 LCAT-/- mice.............................. 85 Figure 3.5 Loss of LCAT does not have a substantial effect on levels of soluble or insoluble Aβ40 or Aβ42 in the cortex or hippocampus. ............................................................................... 86 Figure 3.6 Parenchymal and vascular amyloid deposition is independent of LCAT in APP/PS1 mice. .............................................................................................................................................. 87 Figure 3.7 Size and distribution of apoE-containing lipoprotein particles in the CSF of 15-16m old male and female APP/PS1 WT (+/+) and LCAT-/- (-/-) mice. .............................................. 90 Figure 3.8 Protein levels of ABCA1, LDLR, LRP, and SR-BI in the cortex and hippocampus of 15-16 month old male APP/PS1 WT and LCAT-/- mice. ............................................................ 90 Figure 4.1 Steady state endogenous apoA-I levels in WT mice. ................................................ 100 Figure 4.2 Dose-dependent increase of Alexa647-hapoA-I in plasma, liver, kidney and brain . 101 Figure 4.3 Dose-dependent accumulation of Alexa647-hapoA-I in cerebral ventricles and the choroid plexus. ............................................................................................................................ 102 Figure 4.4 Alexa647-hapoA-I is internalized by choroid plexus epithelial cells. ...................... 103 Figure 4.5 Alexa647-hapoA-I is retained in cerebral ventricles up to 6h after a single injection...................................................................................................................................................... 104 Figure 4.6 Alexa647-hapoA-I accumulates in the CNS for up to 2h prior to elimination. ........ 105 Figure 4.7 In vitro uptake, binding, cell association and transport of hapoA-I by primary hCEpiC...................................................................................................................................................... 106 xv  Figure 4.8 Acute plasma profiles of hapoA-I, HDL-C, and Aβ in symptomatic APP/PS1 mice following a single intravenous injection of 60 mg/kg CSL-111. ................................................ 108 Figure 4.9 Aβ levels in brain are unaffected despite minor fluctuations in circulating plasma Aβ40 following 4 weekly injections of 60 mg/kg of CSL-111. ................................................. 109 Figure 4.10 Measurement of total and vascular amyloid burden following 4 weekly injections of saline or 60 mg/kg in aged APP/PS1 mice. ................................................................................ 111 Figure 4.11 Enhanced expression and recruitment of microglia and astrocytes in the presence of amyloid deposits. ........................................................................................................................ 113 Figure 4.12 Neuroinflammation and endothelial activation in the brains of APP/PS1 mice following 4 weekly injections of saline or 60 mg/kg CSL-111. ................................................. 114 Figure 4.13 Brain levels of apoE and major receptors involved in lipoprotein metabolism in 12.5m old non-transgenic and transgenic APP/PS1 mice following 4 weekly injections of saline or 60 mg/kg. ................................................................................................................................ 115 Figure 4.14 ApoA-I mRNA is negligible is murine brain tissue and primary human choroid plexus epithelial cells. ................................................................................................................. 121 Figure 4.15 Immunohistochemical detection of plasma IgG in the choroid plexus of mice injected with saline or increasing doses of Alexa647-hapoA-I. ................................................. 122 Figure 4.16 Abundant Evans Blue uptake in the liver, kidney, and plasma but not brain.......... 122 Figure 4.17 Endogenous apoA-I protein levels in the CNS parallel plasma levels in ABCA1-/- and SR-BI-/- mice. ...................................................................................................................... 123 Figure 4.18 Internalized Alexa647-hapoA-I does not co-localize with a lysosomal marker in hCEpiC. ....................................................................................................................................... 123 Figure 4.19 Co-localization of internalized recombinant Alexa647-hapoA-I and serum derived Alexa488-hapoA-I in hCEpiC. ................................................................................................... 124 Figure 4.20 Temperature dependent transport of 125I-hapoA-I by primary hCEpiC. ................. 125 Figure 5.1 Influences of lipoproteins on Alzheimer’s Disease development. ............................ 129 xvi  List of Abbreviations 125I iodine-125 AA Alzheimer's Association Aβ β-amyloid AβP Aβ plaques ABC ATP binding cassette ABCA1 ATP binding cassette transport A1 ABCA7 ATP binding cassette transport A7 ABCB1 ATP binding cassette transport B1 ABCG1 ATP binding cassette transport G1 ABI ankle-brachial index ACE angiotensin-converting enzyme ACS acute coronary syndrome AD Alzheimer's Disease ADRDA Alzheimer's Disease and Related Disorders Association AICD amyloid precursor protein intracellular domain ANOVA analysis of variance  apoA-I apolipoprotein A-I apoA-II apolipoprotein A-II apoA-IV apolipoprotein A-IV apoC-I apolipoprotein C-I apoC-II apolipoprotein C-II apoC-III apolipoprotein C-III apoD apolipoprotein D apoE apolipoprotein E apoJ apolipoprotein J APP amyloid precursor protein ARIA amyloid related imaging abnormalities ATP adenosine triphosphate BACE-1 β-site APP cleaving enzyme-1 BBB blood-brain barrier BCSFB blood-CSF barrier BCEC brain capillary endothelial cell BP blood pressure Br brain CAA cerebrovascular amyloid angiopathy CAD coronary artery disease CASI Cognitive Ability Screening Instrument Cb cerebellum xvii  CBF cerebral blood flow cDNA complementary deoxyribonucleic acid CE cholesterol ester CERAD Consortium to Establish a Registry for AD CETP cholesterol ester transfer protein CHD coronary heart disease CHO Chinese hamster ovary CNS central nervous system CP choroid plexus CRP C reactive protein CSF cerebrospinal fluid CT computed tomography CTF C terminal fragment CTF-α C terminal fragment α CTF-β C terminal fragment β CVD cardiovascular disease Cx cortex DAPI 4',6-diamidino-2-phenylindole Dut Dutch ECE endothelin-converting enzyme E.coli Escherichia coli  EDTA ethylenediaminetetraacetic acid  EL endothelial lipase ELISA enzyme-linked immunosorbent assay  eNOS endothelial nitric oxide synthase ERK extracellular signal-regulated kinases  FC free cholesterol FDG fluorodeoxyglucose 18F  FITC fluorescein isothiocyanate  GAPDH glyceraldehyde 3-phosphate dehydrogenase GFAP glial fibrillary acidic protein  GuHCl guanidine hydrochloride h hour hapoA-I human apolipoprotein A-I hCEpiC human choroid plexus epithelial cell HCl hydrochloride HDL high density lipoprotein HDL-C high density lipoprotein cholesterol HEK human embryonic kidney xviii  HL hepatic lipase HRP horseradish peroxidase HUVEC human umbillical vein endothelial cell Iba-1 ionized calcium-binding adapter molecule 1 ICAM-1 intracellular adhesion molecule 1 IDE insulin degrading enzyme IDOL inducible degrader of LDLR IFN-α interferon α IgG immunoglobulin G IHC immunohistochemistry IL interleukin IL-1β interleukin 1β IL-6 interleukin 6 IL-8 interleukin 8 Ind Indiana Iow Iowa ISF interstitial fluid IVUS intravascular ultrasonography  LCAT lecithin-cholesterol acetyltransferase LDL low density lipoprotein LDL-C low density lipoprotein cholesterol LDLR low density lipoprotein receptor Lon London LRP-1 low density lipoprotein receptor-related protein 1 LRP-2 low density lipoprotein receptor-related protein 2 LXR liver X receptor LXR-α liver X receptor α LXR-β liver X receptor β m month MAPK mitogen-activated protein kinase MCAo middle cerebral artery occlusion MCI mild cognitive impairment MCP1 monocyte chemoattractant protein 1 min minute MLAs medium-sized arteries  MMP matrix metalloproteinase MMP-3 matrix metalloproteinase 3 MMP-9 matrix metalloproteinase 9 MMSE mini-mental state exam xix  MRI magnetic resonance imaging mRNA messenger ribonucleic acid MWM Morris Water Maze NFκB nuclear factor kappa-light-chain-enhancer of activated B cells NFT neurofibrillary tangle NIA National Institute on Aging NINCDS National Institute of Neurological and Communicative Disorders and Stroke NIRF near-infrared fluorescence  NO nitric oxide NOR novel object recognition ns non-significant NSAID non-steroidal antiinflammatory drug PAD peripheral artery disease PAGE polyacrylamide gel electrophoresis pBCEC porcine brain capillary endothelial cell PBS phosphate buffered saline PC phospatidylcholine PET positron emission tomography Pgp P-glycoprotein PI3K phosphoinositide 3-kinase PIB Pittsburgh compound B Pl plasma PLTP phospholipid transfer protein PON-1 paraoxonase-1 PPAR peroxisome proliferator-activated receptor PPAR-α peroxisome proliferator-activated receptor α PPAR-γ peroxisome proliferator-activated receptor γ PS-1 presenilin-1 PS-2 presenilin-2 PVDF polyvinylidene fluoride  RAGE receptor for advanced glycation endproducts RAP receptor associated protein RAR retinoic acid receptor rcf relative centrifugal force RCT reverse cholesterol transport RIPA radioimmunoprecipitation assay buffer RXR retinoid X receptor s second S1P sphingosine-1 phosphate  xx  S1P1/3 S1P receptor 1/3  S1P3 S1P receptor 3  sAPP soluble amyloid precursor protein sAPP-α soluble amyloid precursor protein α sAPP-β soluble amyloid precursor protein β SDS sodium dodecyl sulfate  SLAs small leptomeningeal arteries  SNP small nucleotide polymorphism SPECT single-photon emission computed tomography SR-BI scavenger receptor BI SREBP1c sterol regulatory element binding protein 1c SREBP2 sterol regulatory element binding protein 2 Swe Swedish t1/2 half-life T2DM type 2 diabetes mellitus TC total cholesterol Tg transgenic TGF-β1 transforming growth factor β1 TLR toll like receptor TLR-2 toll like receptor 2 TLR-4 toll like receptor 4 TNF-α tumor necrosis factor α TR targeted replacement VCAM-1 vascular cell adhesion molecule 1 VLDL very low density lipoprotein VRF vascular risk factor VSMC vascular smooth muscle cell WT wild type ZO-1 zonula occludin 1    xxi  Acknowledgements This work would not have been possible without the generous funding support from the Canadian Institute for Health Research (CIHR) and Alzheimer’s Society of Canada. I am incredibly grateful for salary support provided by a CIHR Vanier Canada Graduate Scholarship and UBC Four Year Doctoral Fellowship.  I am profoundly indebted to my supervisor and “adopted mother” Dr. Cheryl Wellington, who has shaped me into the scientist and person I am today. Thank you for providing me with the opportunities and freedom to explore my passion for science while continually challenging and encouraging me to do more than I thought possible. I feel incredibly blessed to have completed my PhD journey in such a supportive environment, surrounded by colleagues who have provided not only scientific contributions but friendship and laughter as well. Thank you to Wellington laboratory members both past and present, specifically Drs Veronica Hirsch-Reinshagen, James Donkin, Iva Kulic, and Braydon Burgess for providing at the bench mentorship and guidance, Anna Wilkinson, Jeniffer Chan, and Tammy Wilson for countless hours of technical support, and my fellow students Dr. Jianjia Fan, Dhananjay Namjoshi, and Tom Cheng who have stood shoulder to shoulder with me through all the highs and lows of my degree. To “my” undergraduate students Sharon May, Michael Carr, Michael Lee, and Katherine Tourigny; not only did you contribute to my scientific endeavors but you provided me with the incredible opportunity to be a mentor and it has been heartfelt and so rewarding to watch you all grow. I would like to especially thank Dr. Jerome Robert for providing invaluable contributions, both technical and scientific, to this work and for challenging me to grow as a scientist. I will cherish and be forever grateful for his continued energy, optimism, and friendship.  I consider myself incredibly fortunate to have received guidance and encouragement from many outstanding mentors during my PhD. I would like to thank the members of my supervisory committee, Drs Catherine Pallen, Haydn Pritchard, Neil Cashman, and Jacqueline Quandt for their continued input, patience and guidance; my committee helped me to make hard decisions and gave me such a wealth of encouragement and support, both personally and professionally. I would also like to acknowledge the generosity of our collaborators, Drs. Michael Oda and Alan Remaley, for not only providing reagents and performing analysis, but for continued support and influential insights which were vital to this work. xxii   Finally, I am eternally grateful for the unconditional support, encouragement and love of my parents, Vidas Stukas and Hilary Dawson, sister, Anna Stukas, husband, Gordon Shannon, and best friend, Jennifer Spalding.  I could not have done it without them.  1  Chapter 1: Introduction  1.1 Summary Alzheimer’s Disease (AD) is the leading cause of senile dementia and represents a rapidly growing burden to the healthcare system.1 In the last decade, it has become apparent that in addition to the amyloid plaques and neurofibrillary tangles (NFTs) that define AD, most AD patients also have biochemical, morphological, and functional changes to the cerebrovasculature, suggesting that cerebrovascular damage is an important aspect of AD.2, 3 Many elderly patients with AD also present with a variety of co-morbid conditions, such as cardiovascular disease (CVD), type 2 diabetes mellitus (T2DM), hypertension, hypercholesterolemia, obesity, and stroke, all of which have been implicated as risk factors for AD.1, 4-7 One commonality between these co-morbidities is the reduction, or more importantly the dysfunction, of circulating high density lipoproteins (HDL), lipoprotein particles composed of apolipoproteins bound to and encapsulating cholesterol, phospholipids, other proteins, enzymes, and even micro RNAs.8-12  Lipoprotein metabolism in the brain is based on particles that resemble HDL that use apolipoprotein (apo) E as their primary protein component whereas apoA-I is the primary protein component of circulating peripheral HDL.13-15 ApoE is intimately involved in the risk and progression of AD; inheritance of the APOE4 allele results in a 4 to greater than 10-fold dose-dependent increase risk of AD,16 increased amyloid deposition in brain tissue and the cerebrovasculature, increased tau phosphorylation, breakdown of the blood-brain barrier (BBB), and dysregulation of cerebral blood flow (CBF) and glucose metabolism.17-19  While not produced with the central nervous system (CNS), apoA-I is found in cerebrospinal fluid (CSF) at roughly equimass concentrations to apoE. Low serum apoA-I levels, which are reduced by 20-30% in AD patients,20-24 increase the relative risk for AD development25 and may correlate to cognitive deficits in symptomatic AD patients.22, 26 Preclinical work using transgenic AD mouse models has revealed a potential role for apoA-I in cognitive function, selective reduction of cerebrovascular amyloid burden, and suppression of neuroinflammation.27, 28 In this dissertation the regulation, transport, and therapeutic potential of apoA-I based HDL is explored.  2  1.2 AD: Epidemiology and Pathology 1.2.1 Definition AD, first described by Alois Alzheimer in 1906,29 is a progressive neurodegenerative disorder that has become the most common cause of senile dementia, inflicting 40% of persons over aged 85.1 Clinically, Alzheimer noted diminished mental capacity in his patient, including loss of memory, reduced comprehension, aphasia, mood swings, disorientation, and psychosocial impairment.30 Histologically post mortem, Alzheimer described extensive neuronal loss and the two pathological features that would come to define the disease: the presence of abnormally thick prominent neurofibrils (‘tangles’) and the presence of military foci of an unknown substance throughout the cortex (‘plaques’) (Figure 1.1).29, 31  In 2011, a working group created by the National Institute on Aging (NIA) in conjunction with the Alzheimer’s Association (AA) set out to update the criteria for the clinical diagnosis of AD originally defined in 1984 by the National Institute of Neurological and Communicative Disorders and Stroke (NINCDS) and Alzheimer’s Disease and Related Disorders Association (ADRDA).32, 33 This group was further divided into three major committees focused on the newly defined stage of disease progression: asymptomatic preclinical,34 symptomatic pre-dementia (mild cognitive impairment (MCI)),35 and dementia due to AD.36 A fourth group was tasked with updating the neuropathological criteria for AD that was set forth by the NIA in 1997.37 Hyman et al. proposed a new ABC scoring system for AD neuropathology where each morphological change is graded as 0, 1, 2, or 3 (Figure 1.1):38 A: β-amyloid (Aβ) /amyloid plaque burden modified from Thal et al.39 determined by Aβ immunohistochemistry (IHC) or thioflavin S staining B: Neurofibrillary tangle (NFT) stage modified from Braak40, 41 determined by sensitive silver staining or tau IHC C: Neuritic plaque score modified from the Consortium to Establish a Registry for AD (CERAD)42 determined using thioflavin S or modified Bielschowsky The need for two separate criteria regarding Aβ deposits stems from their complex morphological features. Neuritic plaques are composed of compact, fibrillar Aβ deposits (also referred to as amyloid) surrounded by dystrophic neuritis that frequently, but not always, have phopho-tau immunoreactivity.42 However, there are also non-neuritic amyloid structures referred 3  to as diffuse plaques, cotton wool plaques, amyloid lakes, and subpial bands in addition to a continuum of Aβ deposits that range from small oligomers and protofibrils to mature fibrils.38 Clinically, the diagnosis of probable AD is given when the patient meets the criteria of a dementia disorder with an insidious onset and a clear history of worsening with cognitive deficit(s) in one or more of the following categories: amnestic presentation (impairment of learning and recall) or nonamnestic presentation (language, visuospatial and executive dysfunction).36 One of the largest changes made to the new criteria is the inclusion of biomarkers that increase the certainty of diagnosis. These biomarkers are divided into two broad categories: those associated with Aβ accumulation, which occurs early in the disease process, and those associated with signs of neuronal degeneration or injury, which occur later.34  Biomarkers of brain Aβ amyloidosis include reduced CSF Aβ42 and increased amyloid tracer binding on positron emission tomography (PET), while markers of neuronal degeneration or injury include increased CSF total or phospho-tau, decreased fluorodeoxyglucose 18F (FDG) uptake on PET, and brain atrophy observed on structural magnetic resonance imaging (MRI) (Figure 1.1). 43, 44 Although these are the pathological and clinical definitions of AD, the field is beginning to realize and acknowledge the complexity of AD depending on what ‘form’ of AD they have, how long the disease has been present, and the potential existence of other co-morbidities, leading some researchers to postulate that AD may be more of a syndrome than a single disease. 4   Figure 1.1 Alzheimer’s Disease neuropathology and disease progression. Alzheimer’s Disease (AD) is defined pathologically by the presence of amyloid plaques and neurofribillary tangles (NFT). A) Photomicrograph of a section from the cerebral neocortex of an Alzheimer disease brain stained using double-label immunohistochemistry for β-amyloid (Aβ) (reddish brown), and microtubule-associated protein tau (black). Aβ plaques (AβPs; blue arrows) are roughly spherical and extracellular, whereas neurofibrillary tangles (NFTs; green arrows) develop within neurons. Note that some of the dystrophic neurites in the AβPs contain aberrant tau protein pathology (black), which is biochemically identical to that seen in intracellular NFTs.  These AβPs have been described to be “neuritic plaques.” Scale bar = 50 μm. While not a defining feature, up to 80% of AD subjects also have deposition of Aβ within the cerebral vessels. B) Light micrograph of pan-Aβ immunohistochemistry showing deposits of Aβ within the small leptomeningeal arteries (SLAs) and medium-sized arteries (MLAs). A cortical artery with cerebral amyloid angiopathy (CxA) is surrounded by plaques of Aβ in the brain parenchyma. Scale bars = 100 μm C) Confocal microscopy image of Congo red stained preparation Immunohistochemistry: Aβ (brown) and tau (black) A B C D Immunohistochemistry: Vascular Aβ (brown; red) 5  showing amyloid (red) in the basement membranes (as outlined by collagen IV staining) surrounding smooth muscle cells (dark spaces) in the tunica media. Scale bar = 50 μm. D) Schematic timeline depicting the progression of clinical and neuropathological featurest of AD as patients progress from asymptomatic preclinical, to mild cognitive impairment (MCI) and finally into symptomatic AD.  Figures used with permission from: A) 45 B,C) 46 D) 34, 47  1.2.2 Neuropathology Despite the vast evolution of our knowledge surrounding its intricacies, the neuropathology of AD continues to be defined by the presence of amyloid plaques and NFTs.38  In 1986, three independent groups identified the main component of intraneuronal paired-helical filaments found to accumulate in AD as abnormally phosphorylated tau protein.48-50 Tau is a microtubule associated protein that functions to stabilize microtubules in neurons in addition to participating in neuronal differentiation and polarization. It is thought that the hyperphosphorylation of tau weakens its affinity for microtubule binding and increases its propensity for self aggregation.51 Unlike NFT, which can also be found in other pathologies such as frontotemporal dementia with parkinsonism, chromosome 17 type52-54 and chronic traumatic encephalopathy,55 amyloid plaques are thought to be more specific to AD.56 The main component of amyloid plaques both in the brain parenchyma57 and cerebrovasculature56  is Aβ, which are peptides that exist in several structural forms including: insoluble fibrils with distinctive β-pleated sheets, oligomers and pools of non fibrillar amorphous and soluble forms. Aβ peptides are derived via sequential proteolytic processing of the amyloid precursor protein (APP).58 APP, a type I transmembrane glycoprotein found throughout the brain, is processed via two principle pathways: the amylodogenic pathway, which leads to the production of Aβ peptides and the anti- amylodogenic pathway, which precludes Aβ formation (Figure 1.2).59-63 The majority (90%) of APP is first cleaved by α-secretase yielding a soluble secreted ectodomain (sAPP-α),64, 65 and an 83 amino acid long membrane bound C terminal fragment (CTF-α) that is further cleaved by γ-secretase to release the APP intracellular domain (AICD)66-68  and non-toxic p3 peptide.62 Alternatively, a minority of APP can be cleaved in an different location by β-secretase, also referenced to as β-site APP cleaving enzyme 1 (BACE-1), to give sAPP-β and CTF-β, which is then cleaved by γ-secretase to liberate Aβ peptides 38-46 amino acids in length into the extracellular space.61, 62, 69     6    Figure 1.2 APP processing via the amylodogenic and non-amylodogenic pathways Nonamyloidogenic pathway (left): Amyloid precursor protein (APP) is initially cleaved by α-secretase, which cuts through the putative β-amyloid (Aβ) sequence, releasing soluble APPα into the extracellular environment. APP C terminal fragment (CTF) α is then cleaved by γ-secretase, yielding the APP intracellular domain (AICD) and inert p3 peptide. Amyloidogenic pathway (right): APP is cleaved by β-secretase to release soluble APP-β and CTF-β. CTF-β is then cleaved by γ-secretase to yield Aβ peptides 38-46 amino acids in length. Figure used with permission from. 70  Of these peptides, Aβ40 and Aβ42 are quantitatively the most important.71 Compared to Aβ40, Aβ42 contains two extra hydrophobic amino acids (alanine and isoleucine) at the C terminal, making it much more hydrophobic and prone to self aggregation. Immature diffuse amyloid plaques are composed exclusively of Aβ42, which then recruits the more soluble Aβ40 to form mature neuritic plaques.72 Conversely, Aβ40 appears to deposit preferentially in the cerebrovasculature, and cerebral amyloid angiopathy (CAA) deposits therefore contain a higher ratio of Aβ40:Aβ42 over parenchymal amyloid deposits.73-77 However, studies with transgenic mice have shown that Aβ42 is necessary for both parenchymal and vascular amyloid depositions, solidifying the concept that Aβ42 acts as a nidus for subsequent amyloid formation.78  1.2.3 The Amyloid Hypothesis According to the amyloid cascade hypothesis, the accumulation of Aβ in amyloid plaques within the brain is the primary force driving AD neuropathology. Genetic, animal model, and biochemical evidence supports a causal role of Aβ in AD.  However, as plaque burden does not 7  always correlate with cognitive status, the amyloid hypothesis has been modified in recognition that oligomeric Aβ rather than amyloid plaques per se may represent the key toxic species.71, 79, 80  Following the identification and cloning of APP, researchers began to identify dominantly inherited missense mutations flanking and within the Aβ sequence and in the presenilin (PS) 1 (PS-1) and PS-2 genes, which encode enzymes that are part of the γ secretase complex. These mutations are sufficient to alter the amount, length or aggregation properties of the Aβ produced, resulting in early onset or familial AD (<60 years of age), accounting for 2-3% of the AD population (Alzheimer Disease and Frontotemporal Dementia Mutation Database; http://www.molgen.ua.ac.be/ADMutation).81 To date, 24 mutations (plus duplications) have been reported for APP, 185 for PS-1, and 13 for PS-2, the majority of which induce early-onset AD by increasing the ratio of Aβ42:Aβ40 by enhancing Aβ42 production. Such is the case for all currently identified mutations in PS-182 and PS-283, 84 and mutations in APP located just beyond the C-terminus of Aβ, such as the Austrian (Thr714Ile),85 Iranian (Thr714Ala),86 French (Val715Met),87 German (Val715Ala),88 Florida (Ile716Val),89 and London (Val717Ile)90 mutations. Conversely, mutations located at the amino terminus of Aβ, such as the Swedish mutation (APPKM670/671NL),91 increase the total amount of Aβ produced, while those located mid-sequence, such as the Dutch (Glu693Gln)74 and Arctic (Glu693Gly),92 increase the propensity of Aβ to aggregate by altering its primary structure. Further supporting a causative role for APP processing in dementia, patients with trisomy 21 (Down’s syndrome) inherit an extra copy of APP, leading them to inevitably develop AD pathology presumably due to a gene-dosage effect.93-95 In Down syndrome patients, Aβ42 is deposited first, by 15-20 years of age, followed by Aβ40 at approximately 30-years of age, and finally NFT appear.96-98 Researchers have utilized these mutations in APP, PS-1, and PS-1 to develop close to 70 different transgenic mouse models of AD (for full list see http://www.alzforum.org/res/com/tra) (Appendix A  Transgenic Mouse Models of Alzheimer’s Disease). Although these models do not completely recapitulate AD pathology, they do develop age -dependent increases of intracellular and extracellular Aβ and amyloid deposits in the brain parenchyma and cerebrovasculature.99, 100 The accumulation of Aβ in the CNS of these mice is sufficient to impair cognitive function,99 trigger and aggravate neuroinflammation,101 and precede or potentially cause NFT in transgenic mice that co-express human tau.102-104 One of the greatest challenges of currently available 8  animal models is that they are based upon known genetic mutations that are responsible for AD in 2-3 % of this patient population; for the vast majority of AD patients, the disease process appears much more intricate and complicated.  Unlike early-onset AD, which can be explained by rare fully penetrating mutations in APP, PS-1 and PS-1, there is no clear mode of transmission for the majority (95-99%) of AD patients who develop late-onset or sporadic AD (also referred to simply as AD in this text), leading to the hypothesis that a combination of genetic, environmental, and life exposure determine lifetime risk.81 The most established genetic risk factor for late-onset AD is inheritance of the APOE4 allele that increases AD risk by 3-fold when inherited in a single copy and greater than 9-fold for homozygotes, in addition to decreasing the age of onset.16, 105, 106 Substantial pre-clinical and clinical evidence has demonstrated that APOE4 is associated with earlier and greater Aβ and amyloid deposition, which is now believed to result from impaired Aβ degradation and clearance from the CNS.107, 108 One of the major arguments against the amyloid hypothesis is that there is very poor correlation between the severity of dementia and density of fibrillar plaque load.109-115 This is also observed in select mouse models of AD, where impaired cognitive function and other pathological features of AD can present well before the onset of amyloid plaques.116-122 Rather, there is a much better correlation between “soluble Aβ” levels and the extent of synaptic loss and severity of cognitive impairment.123-127 In vitro and in vivo animal models and clinical work has identified sodium dodecyl sulfate (SDS) stable soluble low-n oligomers of Aβ as the toxic species that may also function as the building block of insoluble amyloid deposits.80, 120, 122, 128, 129   1.2.4 Pathways to Aβ Degradation and Clearance from the CNS Somewhat surprisingly, the production of Aβ peptides is not unique to AD pathology, but a constitutive process that is a product of normal cell metabolism throughout life, confirmed by its secretion from primary cells in culture and its presence in the plasma and CSF of healthy individuals.69, 130, 131 Therefore, it is thought that disruption in Aβ homeostasis, either via increased production or impaired degradation and clearance, leads to its net accumulation in the brain and subsequent toxicity. As Aβ production is unaffected in late-onset AD patients,132 age or genetic-related defects in Aβ degradation and clearance are thought to lead to the net  9   Figure 1.3 Major pathways leading to the degradation and clearance of Aβ from the CNS β-amyloid (Aβ) peptides are cleared from the central nervous system (CNS) via three major routes: proteolytic degradation, transport across the blood-brain barrier (BBB), and perivascular drainage into the lymphatic system or transport across the blood-cerebrospinal fluid barrier (BCSFB).  Enzymatic degradation: Aβ peptides are degraded by a number of intra and extracellular proteolytic enzymes. The two major proteases are neprilysin and insulin degrading enzyme (IDE), with other proteases such as matrix metalloproteinase (MMP), endothelin-converting enzymes (ECE), angiotensin-converting enzyme, and plasmin.  BBB transport: Aβ peptides can also be cleared across the BBB by low density lipoprotein receptor related protein 1 (LRP-1) or P glycoprotein (Pgp) mediated transport, while blood to brain transport is mediated by receptor advanced glycation end products (RAGE).  Perivascular drainage: Aβ drains in the interstitial fluid (ISF) via the perivascular lymphatic pathway along the basement membranes of endothelial cells in capillaries and then between the basement membranes of vascular smooth muscle cells (VSMC) in the arterioles and arteries. From here, Aβ is taken up and degraded or transported by the VSMC via LRP-1, drained into the lymph, or enters into the CSF for transport across the BCSFB via LRP-1 and LRP-2.  accumulation of Aβ within the CNS.108, 133, 134 Aβ peptides are catabolized by three major pathways: 1- intra and extracellular enzymatic degradation by metalloproteases 2- transport across the BBB, and 3- drainage along the perivascular pathway where interstitial fluid (ISF) is filtered through  vascular smooth muscle cells (VSMC) and drained into the lymphatic system or transported across the blood-CSF-barrier (BCSFB) (Figure 1.3).3, 135-137  1.2.4.1 Proteolytic Degradation Significant in vitro and in vivo work has identified a number of zinc-metalloproteases, namely neprilysin, insulin degrading enzyme (IDE), endothelin-converting enzymes (ECEs), angiotensin-converting enzyme (ACEs), and matrix metalloproteinase (MMPs) , in addition to serine and aspartyl proteases, such as plasmin and cathepsin D, that are capable of intracellular and extracellular Aβ degradation (Figure 1.3).135 In 2000, Iwata et al. identified neprilysin as the 10  key protease involved in the rate limiting step of Aβ degradation by co-injecting multiple-radiolabeled synthetic peptides into the brain.138 Neprilysin is a type II membrane associated peptidase139  that is almost exclusively expressed by neurons.140 Neprilysin messenger ribonucleic acid (mRNA), protein, and activity are significantly reduced in the brains of AD patients brains,141, 142 suggesting that decreased neprilysin activity may in part account for the increase of Aβ, or conversely that Aβ decreases neprilysin activity. Iwata et al. went on to demonstrate that endogenous murine Aβ40 and Aβ42 levels are increased up to 2-fold following infusion of neprilysin inhibitors or in neprilysin deficient mice.138, 143 While neprilysin is known to degrade Aβ monomers, whether it can also degrade oligomers is disputed. In vitro, neprilysin was shown to degrade synthetic Aβ oligomers,144 but it was not able to degrade naturally secreted Aβ oligomers isolated from cultured cells.145 Both Huang et al.146 and Farris et al.147 observed a significant increase of Aβ and amyloid deposition in brain, and a 2-fold increase of the steady state levels and half life of Aβ in the ISF when neprilysin-/- mice were crossed onto the APP23 or hAPP J9 AD transgenic backgrounds, respectively. However, while Aβ oligomers were increased in the hAPP J9 neprilysin-/- mice,147 there was no change observed in the APP23 neprilysin-/- mice.146 Conversely, over-expression of neuronal neprilysin by 8-fold in hAPP J20 mice led to a 50- 90% reduction of soluble Aβ and prevented amyloid plaque formation,145, 148 while ex vivo gene delivery of neprilysin in fibroblasts implanted into the brain of AD mice decreased amyloid burden by 30-70%.149 However, neprilysin overexpression was not able to reduce Aβ oligomer formation or improve deficits in spatial learning and memory.148  In addition to neprilysin, IDE, ECE-1 and 2, and MMP-2 and 9 also act to degrade Aβ.135 IDE is the major protease for cytosolic monomeric Aβ, and is found predominantly in the cytosol of microglia and localized to the cell surface of neurons and in the CSF.150, 151 In mice, deletion of IDE led to a 40-60% increase of endogenous murine Aβ in addition to hyperinsulemia and glucose intolerance, as insulin is also a substrate for IDE.152 In humans, rare polymorphisms in IDE have been identified that increase AD risk.153 However, changes in IDE expression and activity in AD subjects are debated as: no change142 and a decrease154 in IDE activity and protein levels have both been reported. Total deletion of ECE-1 or 2,155  MMP-2 or 9156 lead to a 20-30% increase in endogenous Aβ40 and Aβ42 in wild-type mice, and an even more profound increase in the levels and half-life of human Aβ40 and Aβ42 in Tg2576 ECE-/- ,157 Tg2576 MMP-2-/- 11  and Tg2576 MMP-9-/- mice.156 Although MMPs are relatively weak endogenous regulators of Aβ, they play a vital role in their ability to degrade amyloid fibrils and are stimulated by Aβ deposits.156, 158 Lastly, ACE159, 160 can also degrade Aβ, although its significance in vivo is not known as neither murine155  nor human157 Aβ is increased following ACE deletion in wild-type or Tg2576 mice.   1.2.4.2 Transport Across the BBB Together, low density lipoprotein (LDL) receptor related protein-1 (LRP-1) and receptor for advanced glycation endproducts (RAGE) mediate the bidirectional transport of Aβ from brain to blood and blood to brain, respectively (Figure 1.3).161 Within the neurovascular unit, LRP-1 is expressed by the vascular endothelium, VSMC, pericytes, astrocytes, and neurons.162 LRP-1 was identified as the major efflux receptor for Aβ at the BBB in a series of elegant in vivo experiments whereby radiolabeled Aβ was injected into the brain tissue of mice to allow tracking of its clearance into the plasma coupled with various methodologies to block LRP-1 function, including anti-LRP-1 antibodies, pre-injection with receptor associated protein (RAP), and phosphorothioate antisense oligomer directed against LRP-1.163-166 Following CNS microinjection, the clearance curve reflecting total efflux of 125I-Aβ40 from the CNS was bi-exponential, representing a rapid elimination across the BBB (t1/2 34.6 ± 3.6min), and a slower elimination via bulk ISF flow (t1/2 239.0 ± 12.5min).163 Proportionally, 5 hours after injection, 73.8% of 125I-Aβ40 was transported across the BBB, 10.7% was removed via bulk ISF flow, and 15.6% was sequestered within the brain parenchyma.163 Importantly, greater than 96% of 125I-Aβ40 detected in CSF and plasma was not degraded, suggesting that the intact peptide is transported across the BBB and out of the CSF, presumably via the choroid plexus.163 Efflux from the CNS is further influenced by peptide length; compared to 125I-Aβ40, the efflux of 125I-Aβ42 from the CNS is 1.9-times slower.166 Whether apoE promotes or impedes Aβ efflux remains contested: the amount of 125I-Aβ40 cleared over half-an hour is reduced by 30-40% in apoE-/- mice;163 however, association of 125I-Aβ40 with recombinant human apoE prior to cerebral microinjection also reduces the rate of CNS clearance by 80%,166 suggesting differential effects of apoE on the speed, efficiency, and route of Aβ transport. Intriguingly, transport via the ISF bulk flow is equivalent for free and pre-complexed 125I-Aβ40 and 125I-Aβ42, suggesting that 12  this efflux route may be via a more general mechanism. Aβ transport capacities are also reduced by 55-65% in older animals, coinciding with decreased LRP-1 expression in the cerebrovascular endothelium, which is also observed in transgenic AD mice and AD subjects, reducing Aβ efflux.163, 164, 167 Aβ homeostasis is further disrupted by increased RAGE expression in the vascular endothelial cells of AD subjects, promoting Aβ influx.167-170 In addition to endothelial cells, RAGE is also expressed on the surface of microglia and neurons where it binds to monomers, oligomers, and aggregates of Aβ.169-171 At the BBB, in addition to mediating Aβ transport from the circulation to the brain parenchyma, RAGE also mediates nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB)-dependent endothelial cell activation and generation of endothelin-1 which suppresses CBF.170, 172   Some studies observed little to no effect of RAP-mediated LRP-1 blockage on Aβ40 efflux across the BBB, prompting the search for alternative pathways.165, 173, 174 P-glycoprotein (Pgp), also known as multidrug resistance protein 1 or adenosine triphosphate (ATP) binding cassette (ABC) B1, is highly expressed on the luminal side of brain capillary endothelial cells and can bind to both Aβ40 and Aβ42 and mediate their transport from brain to blood.175-177 Radiolabeled Aβ40 and Aβ42 microinjected into the CNS of Pgp-/- mice is cleared at half the rate of wild-type mice, Aβ and amyloid deposits are enhanced in Tg2576 mice on a Pgp-/- background, and Pgp levels and activity are compromised in living AD subjects,178, 179 verifying its important involvement in Aβ efflux from the brain.176 Of interest, in brain sections from AD subjects, histological Aβ deposits are inversely correlated with the level of Pgp staining in the brain vasculature.180   1.2.4.3 Perivascular Drainage and Transport across the BCSFB Aβ is also transported along the perivascular pathway in the ISF, where it is either degraded or transported by the VSMC, drained into the cervical lymph nodes, or joins with the CSF and is transported across the BCSFB.136, 181 While CSF is primarily produced by the choroid plexus (see section 1.3.1), ISF is derived partly from blood and partly from tissue metabolism and is estimated to drain at a rate of 0.11-0.29 µL/minute/g brain tissue in rats, comparable to the average lymphatic drainage in the periphery.182, 183 As the ependymal cells lining the cerebral ventricles lack tight junctions (Figure 1.4), a portion of ISF drains into CSF, potentially 13  contributing up to one-third of the total CSF volume. Conversely, some of the CSF in the subarachnoid space may recycle into the arterial perivascular space to join the circulating ISF, allowing a bidirectional interchange of solutes between the ISF and CSF.183-185 There are key anatomical differences between humans and non-primates that need to be considered when dissecting clearance via the ISF or CSF. In humans, lymphatic drainage of CSF and ISF are largely separate, as the majority of CSF drains into the blood via the arachnoid villi,136, 186 which are much less developed and therefore utilized to a lesser extent in non-primates.187-189 Further, in rodents there is communication and interchange between CSF in the subarachnoid space and ISF in the brain parenchyma that does not occur in humans due to the presence of the pia mater and glia limitans, a complex network of glial cells which form a physical barrier.183, 186, 190   Although perivascular drainage of Aβ via the ISF has long been postulated, it wasn’t until 2008 that the detailed mechanisms were elucidated (Figure 1.3).191 By injecting fluorescent soluble tracers, 3 kDa dextran and 40 kDa ovalbumin, into the corpus striatum of mice, Carare et al. determined that within 5 minutes the tracers quickly diffused through the brain parenchyma and were found in the basement membranes of the capillaries and surrounding the basement membranes of the VSMC of the tunica media in artery walls. Three hours later, some tracer was found within the VSMC and surrounding perivascular macrophages, indicating uptake. As no tracer was found in the basement membranes of the arterial endothelium, the perivascular drainage pathway appears to travel along the basement membranes of endothelial cells at the level of the capillary and then drain between the VSMC, transporting  soluble antigens but not cells from the brain parenchyma to the lymph nodes.191 Follow-up studies using labeled Aβ40 and Aβ42 in mice and rats has confirmed that Aβ also follows this perivascular drainage route,192-194 albeit at a fraction of the clearance rate compared to its efflux across the BBB.163, 166 Theoretical studies suggest that the contrary wave that follows each pulse wave of the intracranial arteries, which is known to drive CSF movement,195 drives the flow of ISF in the opposite direction to blood flow.196 If this model is correct, then ISF flow would be decreased and the potential for solutes, such as Aβ, would be increased in conditions were vasculature function is compromised, such as in aging and AD.197 Indeed, perivascular drainage and solute clearance is significantly reduced when blood perfusion is impaired following cardiac arrest, in aged wild-type mice, and in AD transgenic mice that have vascular amyloid deposits.191, 193, 198 14  Consistent with the proposed perivascular drainage route, Aβ deposits are found in the perivascular space around capillaries and are found five-times more frequently around arteries than veins. 199-201 LRP-1, the major receptor responsible for Aβ efflux across the BBB, also appears to be involved in Aβ transport within cerebral VSMC, as targeted deletion of LRP-1 in VSMC led to Aβ accumulation and exacerbated amyloid plaque and CAA formation in APP/PS1 mice.202  Finally, while less well characterized, Aβ can also be transported across the BCSFB via LRP-1 and LRP-2, also referred to as megalin (Figure 1.3).181, 203-205 Aβ injected intracerebroventricularly into rats is eliminated from the CSF with a half life of 17.3 min, and this process is significantly attenuated by co-treatment with RAP or anti-LRP-1 antibodies.205 In guinea pigs, transport of soluble Aβ40 bound to apoJ from the blood to the CSF via the choroid plexus is almost completely abolished following treatment with anti-megalin antibodies or RAP.203 In rodents, it is estimated that 10-15% of Aβ can enter the CSF via the ISF.163 Further, efflux across the BCSFB may also play a more important compensatory role in AD where clearance across the BBB is impaired; in contrast to what is observed in cerebrovascular endothelial cells, in the choroid plexus there are no changes to RAGE expression, while megalin expression is decreased, and both LRP-1 and Pgp are increased during normal aging in rats, suggesting the potential for enhanced Aβ efflux capacity .163, 206 In patients with idiopathic or secondary normal pressure hydrocephalus, ventricular and lumbar CSF Aβ are reduced while brain Aβ is increased, leading to amyloid deposits in 20-75% of cases in an age-dependent manner.181 Blocking CSF re-absorption via kaolin injection induces the accumulation of Aβ in the CSF and choroid plexus prior to accumulation within the perivascular space and cortical parenchyma in aged rats.207, 208 Together, these studies highlight the presence of and importance of Aβ clearance from the CSF in preventing Aβ accumulation within the brain parenchyma and vasculature.   15   Figure 1.4 Basic structural anatomy of the BBB, BCSFB, and brain-CSF interfaces.  A) Entry and exit of compound in the brain is tightly regulated by the presence of two barriers: the blood brain barrier (BBB) and blood-cerebrospinal fluid (CSF) barrier (BCSFB). B) The BCSFB is formed by the tight junction expressing ciliated epithelial cells that line the choroid plexus. The blood vessels suppling the choroid plexus are unusual in that they are fenestrated, allowing entry of materials into the stromal compartment. C) The BBB is formed by tight junction expressing endothelial cells lining the cerebrovasculature. In the arterioles and arteries the endothelial cells are surrounded by a layer of vascular smooth muscle cells (VSMC) that regulate vessel tone. This role is replaced by the pericytes in the case of capillaries. Almost the entire length of the vessel is in contact with the end feet of nearby astrocytes which regulate the local environment. D) Unlike the epithelial cells of the choroid plexus, the ependymal cells that line the cerebral ventricles lack tight junction proteins, thereby allowing free interchange between the CSF and brain tissue via gap junctions  1.3 Clinical and Pathological Evidence of Altered Cerebrovascular and Barrier Function in AD  1.3.1 The BBB and BCSFB Regulate Entry and Egress of Substances from the Brain Together, the BBB and BCSFB tightly regulate transport of blood components into the brain parenchyma and CSF, respectively (Figure 1.4). The core of the BBB is formed by endothelial cells joined by specialized tight and adherens junction proteins, allowing them to form a highly selective and sensitive barrier that regulates the transport of nutrients into and egress of waste products out of the brain (Figure 1.4).3, 209 Surrounding the endothelium is a layer of VSMC in the arteries and arterioles or pericytes in the capillaries, which work to regulate CBF.210 An 16  almost complete glial sheath composed of astrocyte end-feet encompasses the cerebrovasculature, with neuronal projections and occasional microglia cells located in close proximity. Together, the endothelial, glial, and neuronal cells forms what is referred to as the neurovascular unit.3 The BCSFB is formed by tight-junction expressing epithelial cells of the choroid plexus (Figure 1.4).181, 185, 209 The choroid plexus is composed of villi covered by unstratified ciliated cuboidal epithelial cells that are separated from the central vascular unit by a thin regular basement membrane and connective stroma. Unlike the BBB, the vascular endothelial cells lining the vessels supplying the choroid plexus are fenestrated, with 30-50 nm intercellular gaps.211 Although the surface area of the choroid plexus capillaries is 5000-times smaller than those supplying the brain parenchyma, blood flow to the choroid plexus is estimated to be 4-7 times greater than the cerebrum in monkeys and dogs.212 In addition to forming a barrier between blood and CSF, the choroid plexus is responsible for actively synthesizing and secreting two-thirds of total CSF volume, with the remaining one-third coming from ISF drainage.184 The choroidal epithelium has intense enzymatic activity, half that of the kidney,213 and expresses over 40 carries for different molecules, conferring precise regulation over CSF content and production.214, 215 While there are restrictive barriers formed by tight-junction expressing cells between the blood and brain and blood and CSF, gap junctions present between ependymal cells lining the cerebral ventricles allows for free exchange between the CSF and brain tissue (Figure 1.4).185, 209  1.3.2 Impaired CBF and Glucose Metabolism are Early Clinical Features of AD The brain is a markedly vascularized organ with a very high energy demand, using 20% of the body’s cardiac output, 20% of oxygen consumption, and 25% of glucose consumption. As such, even minor perturbations in CBF can profoundly affect neuronal health.216, 217 In AD patients, CBF is reduced by 10%–30% in the tempoparietal, frontal and posterior cingulate cortex and hippocampus, and the extent of CBF impairment correlates with disease severity.218-221 Reduced CBF and/or CBF dysregulation is detectable prior to cognitive decline, brain atrophy, or amyloid accumulation in older subjects at risk for AD,222-228 and is also observed in several AD mouse models prior to plaque development.229 Furthermore, glucose uptake and utilization, as measured 17  by FDG-PET, is decreased in AD and MCI patients230-232 as well as in transgenic animal models of AD.229 These observations raise important questions as to whether vascular dysfunction contributes causally to AD rather than being a result of amyloid and NFT formation. As vascular changes can be documented prior to the onset of cognitive impairment or amyloid accumulation, a two-hit vascular hypothesis has been proposed by Zlokovic et al. stating that initial insults to the vascular system lead to BBB dysfunction and oligaemia, leading to a cascade of detrimental events that culminate in AD.3 Progressive neuropathological changes may drive further cerebrovascular dysfunction, resulting in the marked damage to the cerebrovasculature that is observed post mortem.  1.3.3 Morphological and Functional Changes to the Cerebrovasculature in AD Brain tissue from AD patients often shows greatly reduced microvascular density, with many of the remaining vessels appearing tortuous, twisted, or string-like. Increased deposition of extracellular matrix proteins, including collagen, heparin sulfate proteoglycan, and laminin, thickens the basement membranes of cerebrovascular endothelial cells, which themselves are lost as AD progresses. In addition to these morphological changes, the contractile ability of the vessel is impaired due to substantial atrophy of VSMCs in arteries and arterioles and reduced pericyte density in small capillaries.233, 234 These changes are observed in both AD subjects as well as multiple preclinical mouse models of AD.235 The subsequent stiffening of the cerebral vessel results in a decreased ability to meet the brain’s demand for oxygen and key nutrients as well as remove neurotoxic substances (Figure 1.5).  Tight-junction expressing endothelial cells in the CNS form the core regulatory unit of the BBB. In AD, endothelial expression of tight junction proteins and their adaptor molecules is decreased, potentially due to increased expression of MMPs.236 Subsequently, BBB integrity is compromised,237 resulting in increased bulk fluid flow and CNS access of potentially damaging serum proteins such as immunoglobulin G (IgG), albumin, thrombin, plasmin, and fibrin.3 Microvessels extracted from AD brain tissue appear to be irreversibly activated, expressing increased levels of nitric oxide (NO); cytokines such as tumor necrosis factor alpha (TNF-α), transforming growth factor β1 (TGF-β1), interleukin-1β (IL-1β), and IL-6; chemokines such as monocyte chemoattractant protein 1 (MCP-1) and IL-8; prostaglandins; MMPs; and leukocyte 18  adhesion molecules including intracellular adhesion molecule 1 (ICAM-1), vascular adhesion molecule 1 (VCAM-1), and E-selectin.238 This activation leads to aberrant angiogenesis, increased inflammation, and oxidative stress (Figure 1.5). There appears to be some discrepancy in the field with respect to angiogenesis in AD, as there are data to support both pro and anti-angiogenic responses in the brains of AD subjects.238 Multiple studies have noted a decrease in brain microvascular density in AD subjects 239, 240 and transgenic AD mouse models 241with in vitro data supporting the hypothesis that Aβ and amyloid are anti-angiogenic and inhibit endothelial cell proliferation.242, 243 However, another research group observed an increase in microvascular density in the brains of both human AD subjects and aged APP transgenic mice, with in vivo analysis suggesting that the decrease of tight junction protein expression observed was directly related to the increase in microvascular density associated with aberrant angiogenesis rather than cellular apoptosis of functional vessels. 244Further, the same group demonstrated that active Aβ immunization of APP transgenic mice, both prior to and after the onset of pathology, reversed the observed hypervascularity and significantly decreased amyloid burden.245 The BCSFB also exhibits marked structural and functional changes in AD.181, 246 Structurally, there is a significant 10-30% reduction in epithelial cell height, thickening of the basement membrane, fibrosis and calcification of the stroma, appearance of Biondi bodies, and accumulation of lipofuscin deposits.247-252 Due to increased ventricular volume and reduced secretion, CSF turnover is significantly reduced to 0.75-1.5 times per day,253, 254 compared to 3 times a day in healthy elderly humans.255 Isolated choroid plexus epithelia from AD patients and AD transgenic animal models also exhibit increased oxidative stress and NO production, mitochondrial dysfunction, and abnormal patterns of stress proteins (Figure 1.5).256-259   19   Figure 1.5 Structural and functional damage to the BBB and BCSFB in AD. Blood-brain barrier (BBB) (Left): β-amyloid (Aβ) peptides aggregate and accumulate within the vascular smooth muscle cells (VSMC) in addition to the brain parenchyma. The cerebrovasculature isolated from Alzheimer’s Disease (AD) patients exhibits a profound loss of capillary density, appearance of tortuous vessels, and a thickening of the basement membrane due to increased deposition of extracellular matrix proteins. There is substantial atrophy to the VSMCs and pericytes, leading to dysfunctional vasodilation and constriction. Barrier integrity is compromised due to a loss of tight junction protein expression by the vascular endothelial cells that are irreversibly activated, exhibit enhanced expression of pro-inflammatory cytokines, chemokines, cellular adhesion molecules, and proteases.  Blood-cerebrospinal fluid (CSF) barrier (BCSFB) (Right): Aβ peptides also deposit within the epithelial cells that make up the choroid plexus. There is a significant decrease of cell height and general atrophy of the choroidal epithelium. There is also an accumulation of Biondi bodies and lipofuscin deposits within the epithelium. Akin to the BBB, the basement membrane is thickened due to deposition of extracellular matrix proteins, in addition to marked calcification. Functionally, tight junction protein expression and mitochondrial content is decreased, leading to compromised barrier function and oxidative stress. Further, production and turnover of CSF by the choroid is significantly impaired in AD.  1.3.4 Effect of Amyloid Deposition on BBB and BCSFB Integrity and Function 1.3.4.1 Aβ Deposition in the Cerebrovasculature and Choroid Plexus In addition to parenchymal amyloid plaques, approximately 80% of AD patients exhibit Aβ accumulation in the walls of capillaries, arterioles, and small- and medium-sized arteries of the 20  cerebral cortex and leptomeninges, which is known as CAA.260, 261 Aβ and amyloid deposits are also found within the epithelial cells of the choroid plexus.257-259, 262 Aβ transport across the BBB, BCSFB, and via the perivascular drainage pathway are critical to clearing Aβ from the CNS, and as such, progressive impairments in the clearance of Aβ peptides due to aging and AD pathology will propel CAA development and amyloid deposition in the choroid plexus, leading to structural and functional changes.3, 136, 181  1.3.4.2 Aβ Disrupts BBB Integrity and Normal Cerebrovascular Function Aβ deposits within the tunica media eventually lead to atrophy and acellular replacement of the VSMC layer, which impairs vasomotor function and weakens the vessel wall, likely contributing to neurovascular damage observed in AD.263 Although endothelial cells appear to remain relatively untouched by CAA, in vitro experiments show that addition of vasculotrophic Aβ40 peptides to confluent monolayers of human brain endothelial cells increases inflammation and enhances attachment and transendothelial migration of peripheral blood monocytes.264-266 Exposure of human or rodent cultured endothelial cells to Aβ40 also leads to decreased levels of several tight junction and adherens proteins, including claudin-1 and claudin-5, occludin, and zonula occludin 1 (ZO-1),267-270 while microvessels isolated from CAA cases also show a significant loss of occludin, claudin-5, and ZO-1.271 Aβ may also impact vascular tone by altering the reaction to vasoconstrictors and vasodilators. In vivo, APP overexpression significantly and selectively impairs endothelium-dependent cortical microcirculation,272 which is highly correlated to brain Aβ concentration and replicated by topical neocortical superfusion of Aβ40, but not Aβ42, in wild-type mice.273 Ex vivo, Aβ40 causes endothelium-dependent vasoconstriction in normal blood vessels,274, 275 and intrathecal injection of Aβ40 into wild-type and APP transgenic mice impairs the responses to several endothelium dependent vasodilators.276 Taken together, both in vitro and in vivo results suggest that Aβ impairs BBB integrity and alters vascular tone.  1.3.4.3 Aβ Induced Damage to the BCSFB In vitro and ex vivo evidence supports a causal role for Aβ accumulation and aggregation in choroid plexus dysfunction.181, 246 Treatment of primary rat choroid plexus epithelial cells with 21  Aβ42 stimulates NO production, impairs mitochondrial respiratory chain function, induces oxidative stress, and leads to cell death. Further, these experimental conditions also increase MMP-9 expression and decrease ZO-1 expression, compromising barrier integrity.258 Compositional changes to CSF in AD patients also appears to effect Aβ aggregation and subsequent toxicity; CSF from AD subjects has a diminished capacity to inhibit Aβ42 oligomer and fibril formation compared to CSF obtained from healthy age-matched control subjects ex vivo.277, 278   1.4 Comorbid Conditions Associated with Increased AD Risk Affect Cerebrovascular Function If cerebrovascular deficits contribute to the pathogenesis of AD, then it is reasonable to hypothesize that conditions that affect vascular health would increase AD risk. Aging, which is one of the strongest environment risk factors for AD,1 decreases CNS microvascular density, increases the number of tortuous and string vessels, and enhances deposition of collagen in the basement membrane, thickening and stiffening the vessel, resulting in reduced CBF. There is additional evidence of vessel hyperpermeability and BBB dysfunction in the aging brain.197, 279 In addition to normal aging, a large body of epidemiological evidence suggests that several midlife vascular risk factors (VRFs), such as hypertension, T2DM, CVD, and dyslipidemia, may also contribute to an increased risk for vascular dementia and AD later in life.1, 4-7 Importantly, the presence of VRF can exacerbate the clinical presentation and increase the rate of cognitive decline in MCI and AD patients.280-283  1.4.1 Hypertension Contributes to Vessel Stiffening and Brain Hypoperfusion Hypertension is the most validated midlife VRF for AD. Many longitudinal studies observe a positive relationship between high blood pressure (BP) at midlife and increased risk for AD 15–20 years later.4, 5 Individuals with hypertension also have increased senile plaque and NFT loads compared to normotensive controls.284 However, results from cross-sectional studies are more confounding, as some find increased risk with high BP,285, 286 while others find no association.287, 288 As one of the documented effects of chronic hypertension is arterial stiffening, measurement of ankle BP or the ankle-brachial index (ABI) is thought to be a better predictor of cognitive 22  decline than systolic BP.289-292 The Honolulu-Asia Aging Study found that low ABI significantly increased the risk of dementia and vascular dementia with hazard ratios of 1.66 and 2.5, respectively. Low ABI may be particularly detrimental for carriers of the detrimental APOE4 allele, with a hazard ratio of 1.43.293 A recent prospective 18-year follow-up study found a significant association between elevated ankle BP and clinical dementia at follow up even in individuals with normal brachial BP (hazard ratio 1.58).294 Elevated pulse wave velocity, which is another measure of arterial stiffness, was reported to increase the risk of cognitive decline in the Maine-Syracuse Longitudinal Study,295 Baltimore Longitudinal Study of Aging,296 and a third independent study,297 but not in the Rotterdam Study.298  Chronic hypertension impairs cerebral autoregulation, which normally ensures that CBF remains relatively constant (within 80%– 120% of baseline) despite changes to systemic BP.299 In patients with chronic hypertension, the body compensates by increasing the threshold for mean arterial pressure at which CBF is maintained. The danger is that the brain then becomes more vulnerable to hypoperfusion if blood pressure drops.300 Supporting this concept, a recent study comparing cognitively healthy adults who were either normotensive or hypertensive found that longitudinal decreases in blood pressure were associated with increased CSF tau phosphorylation and memory decline only in the hypertensive cohort.301 These changes to cerebral autoregulation may explain why some studies have found that low BP can also increase dementia risk.302  1.4.2 Endothelial Function is Compromised in T2DM and CVD Next to hypertension, T2DM and various forms of CVD are the most robust midlife risk factors for AD.4 Data from cross-sectional and longitudinal epidemiological studies indicate that T2DM increases the relative risk of AD by 1.4- to 4.4-fold, with inheritance of the APOE4 allele further worsening disease odds.7 There is a moderate association (odds ratio 1.3–2.2) of midlife atherosclerosis and coronary artery disease (CAD) with increased risk of AD,303-306 with AD incidence increasing with the severity of CVD.303, 306  Although many mechanisms may explain their contribution to AD, the significant impact that T2DM and CVD have on the vascular system cannot be ignored. It is well established that endothelial cells lining peripheral vessels are dysfunctional in T2DM and CVD, with imbalanced 23  production and secretion of vasodilators and vasoconstrictors that lead to poor vascular tone and vessel stiffening. Endothelial expression of adhesion molecules is also increased, which enhances the transmigration of inflammatory cells into the vessel wall.307, 308 In the case of atherosclerosis, vessel walls stiffen with the formation and subsequent calcification of atheroma, which alters blood flow and pressure. Given the importance of endothelial cell health and blood flow to the brain, it will be important in future studies to determine whether T2DM and CVD have similar effects on cerebrovascular endothelial cells and the neurovascular unit.  In addition to endothelial dysfunction, the plasma lipid profile of T2DM309 and CVD310 patients is altered compared to that of healthy controls. Typically, the levels of apoA-I and HDL cholesterol (HDL-C) are decreased, whereas total cholesterol and LDL cholesterol (LDL-C) are increased. More important, HDL isolated from T2DM and CVD patients is dysfunctional, exhibiting loss of beneficial functions and potentially gain of toxic function (detailed in section 1.6). Specifically, HDL isolated from these patients inhibits rather than stimulates NO production; it fails to reduce cellular adhesion molecule expression and subsequent leukocyte rolling; and it fails to promote endothelial cell health and repair, thus turning HDL into a pro-inflammatory and pro-oxidative stress moiety.8-12 Importantly, in addition to the well-established protective effects of HDL and apoA-I on CVD risk,311 increased HDL-C and apoA-I levels are also associated with decreased AD risk,25, 312-314 while hypercholesterolemia is associated with an increased risk of AD.315-322  1.5 HDL Metabolism  In the aqueous environment of blood, lymph, ISF, and CSF, neutral lipids are transported on lipoprotein particles consisting of a cholesterol ester and triglyceride rich core with the more amphipathic free cholesterol and phospholipids on the exposed shell, encapsulated and stabilized by apolipoproteins. Plasma lipoproteins separated by size and buoyant density fall into one of four major categories, where the denser lipoproteins are smaller in diameter but denser due to increased protein: lipid ratio: chylomicrons, very LDL (VLDL), LDL, and HDL.323 Plasma HDL is an extremely heterogeneous class of lipoproteins and as such, several classification schemes have been developed to identify distinct HDL subclasses, often by shape, buoyant density, size, or lipid and protein content.324 Plasma HDL consists of a heterogeneous mixture of small 24  discoidal and spherical particles that range in diameter from ≤8 nm (discoid) and 8-12 nm (spherical) with a density of 1.063 – 1.21 g/ml. Further subpopulations of HDL can be fractionated by two main methods: ultracentrifugation and two-dimensional gel electrophoresis. Ultracentrifugation, which separates HDL based on size and density, splits spherical HDL into two further subpopulations: large, light lipid-rich HDL2 (density 1.063-1.125 g/ml) and small, dense, protein-rich HDL3 (density 1.125-1.21 g/ml). Using two-dimensional gel electrophoresis, which separates particles based on size and charge, pre-β and α-migrating HDL particles are identified. Pre-β-HDL are small, dense, discoidal lipoprotein particles composed of apoA-I, phospholipids and free cholesterol, while α-HDL are larger, spherical (with the exception of α4 which is discoidal) lipoprotein particles made up of apoA-I, apoA-II and other apolipoproteins, phospholipids, free cholesterol, triglyceride, and a cholesterol ester core.324 As apoB, the central apolipoprotein of chylomicrons, VLDL, and LDL, is absent from the CNS, lipoprotein metabolism in the brain and CSF is based entirely on a variant of plasma HDL.13, 15, 325-330 Lipoprotein particles isolated from astrocyte conditioned medium are discoidal, with a diameter of 9-17 nm and density of 1.00-1.12 g/ml, with apoE and apoJ as the major apolipoproteins present.15, 329 Conversely, lipoprotein particles isolated from CSF are mainly spherical, with a diameter of 11-20 nm and density of 1.063-1.12 g/ml. ApoE and apoA-I are the major apolipoproteins present in the CSF by mass, with apoA-II, apoA-IV, apoD, apoCI, apoCIII, and apoJ also present to a lesser  extent.13, 327-330  1.5.1 Peripheral Generation of HDL ApoA-I, which composes 70% of HDL protein by mass, is synthesized and secreted exclusively from the liver and intestine (Figure 1.6).331 Newly secreted apoA-I is lipidated by the ABC transporter A1 (ABCA1), which effluxes phospholipids and cholesterol onto apoA-I to produce small and lipid-poor discoidal-shaped lipoprotein particles. Overall, in mice, hepatocytes generate approximately 70-80% of the total HDL found in plasma, whereas enterocytes generate the remaining 30%.332, 333 HDL becomes increasingly lipidated in extrahepatic tissues through the  25   Figure 1.6 Generation and maturation of central nervous system and peripheral high density lipoprotein species. Left: In the brain, apolipoprotein (apo) E secreted by astrocytes is lipidated by ATP binding cassette (ABC) transporter A1 (ABCA1) to form discoidal particles ranging from 9-17 nm in diameter. ApoE-containing lipoprotein particles can be taken up either by low density lipoprotein receptor (LDLR) or LDL receptor-related protein 1 (LRP-1) to supply cholesterol to the cell, and the majority of the endocytosed apoE is recycled. These apoE lipoprotein particles are present in the interstitial fluid (ISF) and cerebrospinal fluid (CSF). CSF apoE lipoproteins are mature spherical particles that contain a cholesterol ester core generated through lecithin-cholesterol acetyltransferase (LCAT) activity. Right: In the periphery, lipid-poor apoA-I is synthesized by hepatocytes and enterocytes where it is lipidated by ABCA1 to form discoidal pre-β HDL particles. Further lipids are added by the cholesterol transporters ABCG1 and scavenger receptor BI (SR-BI), and LCAT activity generates the cholesterol ester core found in spherical α-HDL particles. A number of enzymes, such as phospholipid transfer protein (PLTP) and cholesterol ester transfer protein (CETP), remodel these HDL particles generating a mix of size and density particles. ApoA-I containing HDL gain access to the CSF by a currently unknown mechanism. Figure used with permission from19  actions of ABCA1 in addition to other cellular cholesterol transporters such as ABCG1334-336 and potentially scavenger receptor BI (SR-B1).337, 338 In addition to receptor mediated transport, cholesterol and phospholipids can also diffuse in a bidirectional manner between the cell membrane and lipoprotein particle. Lecithin-cholesterol acyltransferase (LCAT) then generates spherical α-migrating HDL by esterifying free cholesterol to form the cholesterol ester core.339-341 Further maturation of HDL particles occurs in plasma via exchange of lipids and proteins with triglyceride-rich remnant lipoprotein particles via cholesterol ester transfer protein 26  (CETP),342, 343 phospholipid transfer protein (PLTP),344, 345 endothelial lipase (EL),346 and hepatic lipase (HL) (Figure 1.6).347, 348   1.5.2 CNS Generation of HDL Compared to the periphery, much less is known about lipoprotein metabolism within the CNS. ApoA-I, apoA-II, apoA-IV apoC-I, apoC-II, apoC-III, apoD, apoE and apoJ have all been detected in CSF. 13, 327, 328, 330 Of these, apoE and apoA-I are the most abundant both present at concentrations of ~2 – 4 µg/mL, or 4.4% and 0.26% of their respective plasma values in humans (Table 1.1).327, 349-351 mRNA for apoC-I, apoD, apoE and apoJ has been detected in the CNS, suggesting the remaining apolipoproteins found in CSF may be derived from the periphery.325 ApoE, the major apolipoprotein in the brain, is synthesized and secreted by astrocytes and, to a lesser extent, microglia.13, 14. Newly synthesized apoE-containing lipoprotein particles are lipidated by ABCA1 to form discoidal particles 9–15 nm in diameter (Figure 1.6).15, 329 In contrast, CSF lipoproteins are 11–20 nm spherical particles with a similar density to the small, dense HDL3 particles found in plasma (Figure 1.6).13, 15, 327, 349 Although their specific activities in brain lipoprotein metabolism have not been extensively detailed, ABCA7, LCAT, PLTP, and CETP are detectable in brain tissue and CSF.352, 353  1.5.3 ABCA1 Regulates ApoA-I and ApoE Levels and Lipidation The most well documented regulator of HDL levels is ABCA1, which participates in the rate limiting step of HDL biogenesis, namely the transfer of cellular cholesterol and phospholipids onto a lipid poor apolipoprotein acceptor (Figure 1.6).331 ABCA1-mediated lipidation of apoA-I or apoE has repeatedly been identified as a critical regulator of apolipoprotein levels and function both in the periphery and CNS.353-357 Patients with Tangier Disease have mutations in ABCA1 rendering plasma HDL-C and apoA-I virtually absent due to rapid catabolism of poor-lipidated apoA-I by the kidney,358-361 a phenotype that is recapitulated in mice deficient in ABCA1.362, 363 Notably, the remaining low level of apoA-I containing HDL species in Tangier Disease patients migrates in the preβ1-HDL population, indicating that these discoidal particles can form in the complete absence of ABCA1 activity.364 In the CNS, total ablation of ABCA1 in mice results in a 60-80% reduction of apoE in the brain parenchyma and CSF, attributed to 27  increased catabolism of poorly-lipidated apoE by mechanisms that remain to be fully elucidated.365-370 ABCA1-deficient mice also have a marked reduction of apoA-I in CSF and cortical lysates366, 369, 370  and CSF apoA-I and apoE particles isolated from ABCA1−/− mice are poorly lipidated.365, 366, 369, 371 Conversely, mice over-expressing ABCA1 exhibit a robust increase in plasma HDL-C, apoA-I, and apoE levels and are protected from aortic atherosclerosis.372-375 Brain-specific over-expression of ABCA1 by 6-fold or greater protected against amyloid formation in PDAPP mice despite no changes to the net levels of apoE or apoA-I in brain tissue.376 Conversely, brain-specific deletion of ABCA1 in C57Bl.6 mice reduced CNS apoE as expected, but surprisingly brain tissue and CSF apoA-I were increased while plasma HDL-C levels were decreased,377 suggesting that peripheral and CNS ABCA1 may exert differential effects on apoA-I metabolism.  1.6 Impact of HDL on Vascular Health and its Potential Contributions to AD Although HDL is best known for its pivotal role in reverse cholesterol transport (RCT), the process by which excess cholesterol is removed from cells and transported to the liver for  excretion from the body,311 several lines of evidence suggest that HDL and apoA-I also possess several potent vasoprotective properties. These include improving vascular function, inhibiting inflammation, suppressing endothelial cell apoptosis and platelet aggregation, preventing lipid oxidation, as well as stimulating endothelial repair (Figure 1.7).12, 378    1.6.1 HDL and eNOS Activation In peripheral vessels, plasma HDL regulates vascular tone by stimulating endothelial nitric oxide synthase (eNOS) activity, which increases the production of NO to relax the vessel. There are several mechanisms by which HDL stimulates NO production in endothelial cells. First, vasorelaxation requires HDL to interact with the endothelial SR-BI; lipid free apoA-I is insufficient for eNOS activation.379 Second, HDL-associated lysophospholipids activate eNOS-dependent NO production when bound to the sphingosine-1 phosphate receptor 3 (S1P3) receptor.380 Third, efflux of cholesterol to HDL by ABCG1 releases the inhibitory interaction of eNOS with caveolin-1 in endothelial cells, thereby inducing NO production.381, 382 Finally,  28   Figure 1.7 Effects of high density lipoproteins on functions and survival of endothelial cells.  Figure used with permission from 383 paraoxonase 1 (PON1) is an HDL-associated protein implicated in endothelial NO production (Figure 1.7).9  In addition to glial synthesis, apoE is also produced in the liver, kidney, spleen and macrophages and is a component of several lipoprotein species in plasma, including HDL.384 Plasma apoE, which is hypothesized not to intermingle with brain-derived apoE,385 can be found within atherosclerotic plaques in the peripheral vasculature and can also induce endothelial NO production in cultured peripheral endothelial cells.386 For example, stimulation of EA.hy926 endothelial cells with  conditioned media from Chinese hamster ovary (CHO) cells transfected with human APOE2, APOE3, or APOE4 showed an isoform specific pattern of NO production with E2>E3>>E4.387 Additionally, apoE activates NO production in human umbilical vein endothelial cells (HUVECs) by suppressing the inhibitory caveolin-1/eNOS interaction.388  29  Importantly, the capacity of plasma HDL to induce endothelial NO production is highly heterogeneous and compromised in chronic diseases, including CAD, chronic kidney disease, and T2DM.9, 10, 389, 390 Although the mechanisms by which these diseases inhibit this function of HDL remain elusive, an increase of HDL-associated myeloperoxidase content and activity in diabetic patients and a decrease in PON1 and sphingosine-1-phosphate (S1P) in CAD patients have been suggested to reduce HDL function. In chronic kidney disease patients, HDL has increased symmetric dimethylarginine content compared to HDL from healthy controls, which shifts HDL from SR-BI to Toll-like receptor 2 (TLR-2) signaling, consequently reducing NO production and increasing hypertension.390 Importantly, the relationship of HDL composition and cerebrovascular endothelial NO production remains to be determined.  1.6.2 HDL, Inflammation and Oxidation Both HDL and apoA-I exert potent anti-inflammatory activity on endothelial cells in vitro and in vivo, inhibiting inflammatory cytokine expression and suppressing the expression of adhesion molecules such as VCAM-1 and ICAM-1, subsequently lowering monocyte adhesion (Figure 1.7).391-395 ApoE also modulates the vascular inflammatory response by inhibiting VCAM-1 expression.386 In vitro experiments suggest that reduced apoA-I levels or apoA-I modifications such as glycation, myeloperoxidase- mediated oxidation, and increased serum amyloid A content may inhibit the anti-inflammatory properties of HDL.396-400  HDL and apoA-I are also well known to reduce lipid oxidation in the vasculature and inhibit endothelial thrombotic activation.378 ApoE also possesses allele dependent (E2 > E3 > E4) antioxidant activity in vitro.401 In addition, the antioxidant properties of HDL are impaired in patients with acute coronary syndrome and ischemic cardiomyopathy.402, 403 An important future endeavor will be to determine the degree to which these functions are retrained within the cerebrovasculature.  1.6.3 HDL, Endothelial Repair and BBB Integrity Microvascular disease is a distinct and underappreciated pathology associated with AD. In the periphery, HDL promotes repair of damaged endothelial cells and inhibits endothelial cell apoptosis, properties that are dependent on apoA-I (Figure 1.7).12, 378 Additionally, HDL is the 30  major plasma transporter of S1P, which enhances endothelial integrity and barrier function.404 In the peripheral vasculature, reduced apoJ and increased apoC-III levels in HDL of CAD patients impairs the antiapoptotic functions of HDL on endothelial cells and may shift HDL from an anti- to a proinflammatory particle.11 Endothelial repair after carotid injury in mice is also reduced after injection of HDL from CAD and chronic kidney disease patients.9, 390 Finally, in vitro, HDL from diabetic patients reduces the endothelial proliferative effects of HDL in an SR-BI-dependent manner.405 Key unanswered questions are whether circulating plasma HDL from healthy subjects can promote repair of cerebrovascular endothelial damage and whether this function is compromised in patients with CAD or T2DM.  1.7 Apolipoproteins in Aβ Metabolism and Cerebrovascular Health 1.7.1 ApoE 1.7.1.1 Isoform The putative roles of apoE and its isoform-specific effects on AD pathogenesis have been well studied, though there is still much to learn.107, 108 ApoE has well-documented roles in Aβ metabolism, including transport of Aβ across the BBB, via the ISF and CSF, and in maintaining BBB integrity.18 ApoE4 is dysfunctional in all of these domains, as apoE4 slows Aβ clearance192, 406-408 and promotes BBB injury in mice.409-411 The presence of APOE4 therefore leads to earlier and more extensive amyloid deposition that can be detected in living subjects using Pittsburgh Compound B (PIB) or fluorbetapir PET imaging,231, 412-415 although the resolution of current techniques does not allow a clear distinction between parenchymal and vascular amyloid burden.416-419 Some studies suggest that the risk and severity of CAA is also increased in APOE4 carriers,420, 421 although other studies found that the APOE2 allele is overrepresented in patients with CAA.422, 423 In a recent study, although CAA load and brain regions impacted by CAA were highest in APOE4/APOE4 brains, CAA was also increased in APOE2/APOE3 subjects compared to APOE3/APOE3 subjects, indicating that both APOE4 and APOE2 alleles may impart risk.424 One hypothesis to account for these observations is that apoE4 enhances Aβ deposition within the cerebrovascular walls, while apoE2 increases the risk for hemorrhage of amyloid-laden cerebral blood vessels.425 In AD mouse models, CAA is increased when APOE4 is expressed compared to the APOE3 or APOE2 transgenes.426 Mechanistically, apoE4 retards Aβ clearance 31  across the BBB and via the perivascular drainage pathway,192, 406-408 potentially driving CAA formation and BBB breakdown. Binding of Aβ to apoE4 also shifts BBB-mediated clearance primarily from LRP1 to VLDLR,406 which has a much slower rate of internalization.427 In contrast to the detrimental effect of apoE4 on Aβ clearance, both transgenic and gene therapy approaches show that apoE2 promotes Aβ removal and decreases plaque burden.407, 428, 429 A recently study by Hudry et al.429 demonstrated that intraventricular injection of adeno-associated virus constructs expressing human APOE isoforms resulted in stable transduction of the choroid plexus and ependymal cells that led to widespread distribution of transduced apoE, including its presence in ISF. Importantly, even modest expression, namely 10% of endogenous murine apoE, significantly accelerated Aβ clearance with apoE2 > apoE3 > apoE4 in symptomatic animals. The observed changes in Aβ metabolism corresponded with preservation of synaptic integrity in the vicinity of plaques, and no overt neurotoxicity or BBB damage was observed.429   1.7.1.2 Lipidation Lipidation of apoE by the cholesterol and phospholipid transporter ABCA1 is a critical determinant of apoE function in Aβ degradation and clearance.357 Total body deficiency of ABCA1 leads to a marked decrease of soluble and increase of insoluble brain apoE, decrease of plasma and CSF apoA-I, and an increase of insoluble Aβ and amyloid burden with no change to APP production or processing in three out of the four Alzheimer’s models studied.367, 368, 371 Recently, Fitz et al.430 explored how lipidation of apoE affects Alzheimer’s pathology in vivo in the context of apoE isoform by crossing APP/PS1 APOE3 targeted replacement (TR) or APOE4 TR to ABCA1-/+ mice. Haploinsufficiency of ABCA1 significantly exacerbated cognitive deficits, increased both soluble and insoluble Aβ40 and Aβ42 and amyloid deposits, and reduced Aβ clearance in the ISF of APOE4 but not APOE3 APP/PS1 mice. Of interest, in APP/PS1 ABCA1-/+ APOE4 mice, the authors noted a decrease in CNS and plasma apoA-I, plasma Aβ42 and HDL-C, with a strong negative correlation between plasma HDL-C and amyloid burden, suggesting that plasma lipoproteins are also involved in Aβ clearance.430 Conversely, brain-specific over-expression of ABCA1 by 6-fold or more376 or administration of synthetic liver-X-receptor (LXR) agonists which up-regulate ABCA1 leads to a mild-modest increase of CNS 32  apoE and improvements in learning and memory with431-435 or without369, 436, 437 changes to Aβ and/or amyloid burden. However, as ABCA1 also catalyzes the lipidation of apoA-I produced in the periphery, deleting total ABCA1 activity using genetic methods or increasing ABCA1 activity using systemic administration of small molecules that induce ABCA1 expression will therefore affect both apoA-I and apoE levels and function in plasma and the CNS. The relative contributions of these two pools of lipoproteins on neuropathological and behavioral outcomes are not clear.  Another potential player in the lipidation of apoE is ABCA7. ABCA7 is highly expressed in the brain and, when overexpressed in human embryonic kidney (HEK) cells, can mediate the transfer of phospholipids, and to a lesser extent cholesterol, to apoA-I, apoA-II, and discoidal apoE lipoprotein complexes.438-440 ABCA7 is also implicated in the host defense system, with critical roles in sterol regulatory element binding protein 2 (SREBP-2)-regulated phagocytic activity in response to infection or injury.441 Importantly, ABCA7 has been identified as a susceptibility locus for AD.442-444 In African Americans, the effect size of the ABCA7 rs115550680 single nucleotide polymorphism (SNP) is comparable to that of apoE4.444 In transgenic AD mice, deletion of ABCA7 leads to increased Aβ and amyloid deposits,445 but effects on cognitive function are reportedly mild.446 Further research will be required to delineate the potential mechanisms by which ABCA7 influences AD risk and whether its effects are exerted via apoE.  1.7.1.3 Aβ Independent Mechanisms ApoE4 also affects cerebrovascular health independently of its role in Aβ metabolism.18 In cognitively normal APOE4 adults, decreased CBF and altered functional MRI connectivity are evident prior to amyloid development or decreased CSF Aβ42 levels.223, 225-228, 447-449 ApoE4 is also associated with reduced glucose metabolism in cognitively normal older people, again independent of amyloid deposition.450 Postmortem analyses of AD patients show that BBB breakdown is more pronounced in APOE4 carriers451 and apoE4 is less able than apoE3 to maintain BBB integrity through LRP1-mediated signaling to pericytes, which suppresses inflammation.452 Reduced CBF, vascular abnormalities, BBB damage, and leakage of serum proteins into the extravascular space are observed in young APOE4 and APOE-/- mice, attributed  33  Table 1.1 Concentration of apoE and apoA-I containing lipoprotein particles in CSF. Reference Species ApoE ApoA-I   Plasma µg/ml CSF µg/ml % Plasma µg/ml CSF µg/ml % Roher, 2009350 human  10   3.2  Koch, 2001327 human 68±46 3±2 4.41 1410±480 3.7±0.8 0.26 Deemester, 2000349 human  2.89±0.91   0.96±0.47  Song 1998351 human  4.16±1.79   3.72±1.8  Pitas, 198713 human  60%   40%  Saito, 1997453 monkey 21.6±5.6 0.62±0.05 2.9 1350±190 1.3±0.18 0.1 Pitas, 198713 dog     6.5-9.5 0.5 Chiba 1997454 rat 400±130 2.96±1.7 0.74 760±210 0.07±0.055 0.01 Abbreviations: apo, apolipoprotein; CSF, cerebrospinal fluid  to the activation of MMP in pericytes. Importantly, these vascular defects precede neuronal dysfunction.452 Lastly, aged apoE4 mice develop thickening of the basement membranes even in the absence of detectable loss in capillary density.192  1.7.2 ApoA-I 1.7.2.1 Source of ApoA-I in the CNS Next to apoE, apoA-I is the most abundant apolipoprotein in CSF, present at 0.07 – 4 µg/ml or 0.01 – 0.5% of plasma levels depending on the species13, 327, 349-351, 453, 454 (Table 1.1) and is readily detectable in murine brain tissue lysates.376, 377, 432 In addition to apoE- and apoA-I-containing lipoprotein particles in CSF, some authors have also reported a fraction of particles that contain both apoE and apoA-I,327, 328 while others have not.13 No overt differences in CSF lipoprotein or lipid composition have been found between different APOE isoforms. One subtle reported difference is that 20% of apoE forms both homo- and heterodimers with apoA-II in the CSF of APOE3 carriers, but not in APOE4 carriers.15, 327, 329, 349, 455-457 Although in vitro cultures of porcine brain capillary endothelial cells (pBCEC) have been reported to express and secrete apoA-I,458 apoA-I mRNA is not detectible in rodent or fetal human brain tissue459, 460 suggesting that, in these species, apoA-I enters the CNS by crossing the BBB and/or BCSFB, following production by hepatocytes and enterocytes and subsequent 34  secretion in the plasma. While the transport of apoA-I in peripheral aortic endothelial cells is dependent on ABCA1 and the ectopic beta ATPase,461, 462 whether apoA-I is also transported across the endothelial cells of the BBB is not clear. Human serum albumin nanoparticles covalently modified with apoA-I can be detected by electron microscopy within BCEC and brain tissue parenchyma 30min after injection into the tail vein of rats or mice.463 In vitro, apoA-I coating increased the transcytosis of protamine-oligonucleotide nanoparticles (‘proticles’) across confluent monolayers of porcine BCEC via SR-BIs, as this enhanced transport was abolished when blocking antibodies against SR-BI were used.464 Recently, BBB transport of plasmids encoding interferon alpha (IFN-α) alone or fused to apoA-I was measured by examining the concentration of IFN-α and its target genes in the brain following hydrodynamic infusion in mice. Fusion of IFN-α to apoA-I changed its mode of transport into the brain from diffusion to a saturable mechanism independent of SR-BI.465 Clearly, more research is needed to determine the mechanism(s) by which apoA-I enters the CNS and whether it is the naked apolipoprotein or the intact HDL particle that is crossing.  1.7.2.2 Putative Role of ApoA-I in AD Pathology and Progression Despite its presence in CSF, the role of apoA-I in CNS lipoprotein metabolism and potentially AD pathogenesis remains understudied. Several studies have observed reduced circulating levels of apoA-I in AD patients compared to age-matched healthy controls,20-24 and decreased apoA-I levels have also been reported in brain tissue and CSF of probable466 and neuropathologically confirmed AD patients.350, 467 A study examining data collected from the Honolulu-Asian Aging Study found that men in the highest quartile of serum apoA-I concentration had a significantly lower risk of dementia (hazard ratio 0.25).25 Very recently, a study by Shih et al. found that decreased levels of serum apoA-I could be used to discriminate AD from non-demented age-matched control subjects and that the levels of apoA-I positively correlated with Mini-Mental State Examination (MMSE) and Cognitive Ability Screening Instrument (CASI) scores.26 However, two conflicting studies reported no changes in frontal lobe or CSF levels of apoA-I in AD patients, regardless of APOE genotype.468, 469 Prospective studies designed and powered to assess the levels, and perhaps more important, the function of apoA-I bearing HDL with respect 35  to disease onset and progression are needed to determine if reductions or damage to apoA-I-HDL are potentially a contributing causative factor, or are a manifestation of other pathology.  Despite the unclear association between CNS apoA-I levels and AD pathophysiology, insights into an intriguing association between apoA-I and CAA have been generated in preclinical experiments using transgenic AD mouse models. Transgenic over-expression of human apoA-I by 2-fold from its endogenous promoter in liver and intestine selectively reduced cerebrovascular amyloid by 44% in APP/PS1 mice without affecting total or parenchymal Aβ loads or Aβ production compared to APP/PS1 controls.27 These mice also exhibited a marked decrease in the number of activated astrocytes, with a non-significant decrease in microglial activation. Conversely, deficiency of apoA-I led to increased levels of vessel-extracted Aβ40 and Aβ42 by 10-fold and 1.5-fold, respectively, in APP/ PS1 apoA-I-/- mice compared to littermate APP/PS1 controls.28 Although no behavioral deficits were observed in aged apoA-I-/- mice, deletion of apoA-I from APP/PS1 mice exacerbated deficits in spatial learning and memory retention as analyzed by Morris water maze (MWM)28 while over-expression of human apoA-I prevented cognitive decline in APP/PS1 hapoA-I transgenic mice.27 These studies demonstrate that apoA-I originally derived from hepatocytes or enterocytes can affect cognitive function and cerebrovascular amyloid burden in vivo. In vitro, both lipid-free and lipidated apoA-I bind Aβ40 and Aβ42, inhibit its aggregation into fibrils, and reduce Aβ-induced cytotoxicity, oxidative stress, and neuronal degeneration in cell culture.28, 470, 471 In BV2 microglial cells, apoA-I can enhance the proteolytic degradation of intracellular Aβ42.434 Although binding to apoJ has been shown to expedite clearance of Aβ40 across the BBB,166 whether apoA-I has any effect on the bi-directional brain-blood or brain-CSF transport of Aβ has not be determined. Given the known pleiotropic beneficial effects of apoA-I on peripheral endothelial cells, there is a considerable potential for apoA-I to provide similar support to the endothelial cells of the CNS.  1.8 Therapeutic Approaches Targeting HDL and Cerebrovascular Health While much remains unknown about the involvement of apoA-I based HDL in AD, the protective effects of HDL for cardiovascular disease (CVD) have been well established for decades, and major efforts are underway to develop HDL-based therapies for atherosclerosis and acute coronary syndrome (ACS). Infusion of HDL- or apoA-I-based formulations, small 36  molecules designed to augment HDL and apoA-I levels, apoA-I mimics, and therapies aimed at improving HDL function and reverse cholesterol transport (RCT), are the four major approaches that have reached clinical development with respect to HDL therapeutics.472 Of critical importance is the increased recognition that assays of specific HDL subfractions or HDL functional properties, rather than the static measures of HDL cholesterol (HDL-C) levels that are currently used in the clinic, are likely to be required for success in CVD indications.473 Given that several approaches to improving HDL function are in active development for CVD, and improving either apoE or apoA-I function provides neuropathological and cognitive benefits in preclinical AD studies, targeting the cerebrovasculature via HDL could be a potentially desirable approach for AD.  1.8.1 HDL and ApoA-I Infusion Infusion of reconstituted or recombinant HDL particles into the circulation is a direct approach to increase HDL levels. Substantial preclinical evidence has demonstrated that the administration of apoA-I is associated with the inhibition of atherosclerosis,474-477 accompanied by enhanced macrophage RCT,478 inhibition of vascular and endothelial inflammatory pathways,393, 479 and phospholipid oxidation.480  The first studies used recombinant dimeric apoA-I Milano, a naturally occurring genetic variant of apoA-I that protects from CVD despite reduced circulating HDL-C levels,481 combine with phosphatidylcholine (PC) called ETC-216. Despite the ability of ETC-216 to promote atheroma regression as measured by intravascular ultrasonography (IVUS) in a phase II clinical trial, studies were abruptly halted due to severe adverse events triggered by bacterial contaminants.482 Despite these setbacks, researchers went to great lengths to significantly modify the strain of E.coli used in manufacturing and have now generated the second generation of ETC-216, now called MDCO-216, which has completed the initial safety testing in non-human primates.483  A second approach is to use purified native apoA-I and phospholipid. CSL-111, a preparation of human apoA-I purified from serum reconstituted with soy phosphatidylcholine (PC),484 was investigated in the ERASE Trial in 183 patients with ACS given 4 weekly infusions of CSL-111 at 40 mg/kg. Although the reduction in atheroma volume was significantly 37  decreased compared to baseline measurements in CSL-111 patients (-3.4%), there were no significant differences between terminal IVUS measurements among placebo control and CSL-111.485 CSL-112 is a reformulated version that, immediately after infusion into rabbits, was found to disproportionately increase the cholesterol efflux capacity of HDL. The rapid rise in cholesterol efflux capacity coincides with the remodeling of CSL-112 into low molecular weight particles that promote ABCA1-mediated cholesterol efflux.486 In healthy subjects, a single infusion of CSL-112 led to an immediate reduction in HDL particle size, increased cholesterol efflux capacity, and net exit of tissue cholesterol to HDL.487  A third approach is to use autologous delipidated HDL which is re-infused back into the donor patient following selective lipid removal from their own HDL.488 In a small clinical study, preβ-HDL levels were increased by 30-fold in 28 ACS patients given 7 weekly infusions of autologous delipidated HDL compared to placebo controls. However, similar to the situation with CSL-111, while autologous delipidated HDL decreased atheroma volume by 5.2% compared to baseline, there was no significant difference between HDL and placebo treated patients.488 Lastly, RVX-208 is a synthetic small molecule belonging to the quinazoline family which increases apoA-I transcription by binding to the bromodomains of the Bromodomain and Extra Terminal family.489, 490 RVS208 was recently evaluated in the Phase 2b ASSURE clinical trial, which is a 26-week, double-blind, randomized, parallel group, placebo-controlled trial with 324 subject with low HDL-C levels. The RVX-208-treated group showed mild increases in apoA-I (4%) and HDL-C (6%), and decreases in plasma C reactive protein (CRP), but failed to meet their primary endpoint of reducing atheroma volume.491 Interestingly, further analysis of the ASSURE trial data revealed that patients on a combination of RVX-208 and rosuvastatin  performed much better than those on RVX-208 and atorvostatin, potentially due to the differential regulation of peripheral ABCA1 expression between different statin formulations.492  Clinically, an exploratory Phase Ia trial with RVX-208 that enrolled 24 subjects (6 per group) for a double-blind, placebo-controlled, dose-escalation study was reported to lead to a clear but nonsignificant 12%–14% increase in plasma Aβ40 levels in subjects given 8 mg/kg/day for 7 days compared with placebo controls.493 In the ASSERT Phase II clinical population, 299 patients with stable coronary artery disease (CAD) on statins given 150 mg of RVX-208 twice 38  daily for 12 weeks. Plasma Aβ40 was increased 13.4% in the quartile with the lowest plasma Aβ40 at enrollment compared to placebo controls.494 These intriguing observations support the hypothesis that RVX-208 can stimulate the release of Aβ40 from the brain, consistent with the effects of genetic upregulation of apoA-I levels in AD mice. Further evaluations of RVX-208 in the modulation of AD pathogenesis using double-blind placebo controlled clinical trials are eagerly awaited.  1.8.2 ApoA-I Mimetic Peptides An alternative to injecting full length apoA-I is to use apoA-I mimetic peptides that maintain the important functional properties of the holoprotein. The most readily used apoA-I mimetic is the 4F peptide that consists of 18 amino acids which share the lipid binding properties of full length apoA-I via the use of amphipathic helices.495 In mouse models of artherosclerosis, oral administration of the D4-F peptide reduced plaque size, lipid and macrophage content in addition to stimulating pre-β-HDL production and ABCA1 and SR-BI mediated cholesterol efflux, rendering isolated HDL anti-inflammatory, and reducing platelet aggregation.496-500 In a small study where patients with coronary heart disease (CHD) were given a single ascending dose of D4-F (N=8 per group), isolated HDL demonstrated an increased ability to inhibit LDL-induced monocyte chemotactic activity in cultures of human aortic endothelial cells, with no changes to plasma lipid or lipoprotein levels and low bioavailability.501 In a second study, patients with CHD were given L-4F either via daily intravenous injections for 7 days, or via subcutaneous injections daily for 28 days. Isolated HDL did not show improvements in anti-inflammatory or paraoxonase activity; in fact, there was a significant 49% up-regulation of plasma CRP in patients injected intravenously with L4-F.502 The effects of D4-F have been tested in a mouse model of brain arteriole inflammation503 and AD.504 LDLR-/- mice fed a western diet were given 300 µg/mL of D4-F in their drinking water for 6-8 weeks, resulting in a dose of approximately 750 µg/mouse/day. Treatment with D4-F reduced the number of activated microglia associated with the brain arterioles and decreased the levels of proinflammatory cytokines, monocyte chemoattractant protein-1, and macrophage inflammatory protein-1α, indicating that D4-F reduced hyperlipidemia-induced arteriole inflammation. Additionally, D4-F reduced hyperlipidemia-induced arteriole wall 39  thickness and improved cognitive function.503 APP/PS1 mice co-treated with 200 µg/mL of D4-F and 10 µg/mL prevastatin for 3 months demonstrated improved spatial memory and memory retention with a significant reduction in hippocampal amyloid and soluble Aβ compared to mice given the scrambled control peptide and prevastatin. In addition, there was a reduction in activated microglia and astrocytes, and decreased brain tissue TNFα and IL-1β in the D4-F and prevastatin treated APP/PS1 mice.504 These results suggest that D4-F may reduce neuroinflammation and benefit cognitive function by a currently unknown mechanism. Further investigation into the use of apoA-I mimetic peptides in AD is highly warranted.  1.8.3 Small Molecule HDL Modulators A second major approach is via the development of small molecule inhibitors aimed at slowing the rate of HDL catabolism, thereby increasing the pool of circulating HDL available.472 The main avenues currently being explored are: inhibition of cholesterol ester transport protein (CETP), niacin, and inhibition of endothelial lipase (EL).  1.8.3.1 CETP Inhibitors CEPT is the enzyme responsible for shuttling cholesterol esters (CE) from HDL to low density lipoprotein (LDL) and very low density lipoprotein (VLDL) in exchange for triglycerides, and thus inhibition of this process leads to a robust increase of HDL-C.505, 506 Although torcetrapib, a first generation CETP inhibitor, failed in the ILLUMINATE Phase III clinical trial due to adverse off target effects and worsening of primary endpoint measures,507 three second generation CEPT inhibitors, dalcetrapib (Roche), anacetrapib (Merck), and evacetrapib (Lily), are in or have recently completed Phase III clinical trials for patients with ACS.506  In the Phase III dal-OUTCOME trial, despite a 31-40% increase of HLD-C, dalcetrapib failed to reduce the risk of recurrent cardiovascular events and was thus terminated at the interim analysis as recommended by the safety advisory board.508 Further analysis in the dal-ACUTE509 and dal-PLAQUE510 studies in a sub-set of ACS patients provided further insight into dalcetrapibs effect on HDL metabolism and inflammation. Although dalcetrapib significantly increased HDL-C (33.7%), apoA-I (11.8%), and non-ABCA1 mediated cholesterol efflux,509 there was no significant reduction in serum inflammatory biomarkers, including C reactive 40  protein (CRP), interleukin 6 (IL-6), soluble P-selectin, E-selectin, intracellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), or markers of plaque inflammation, such as matrix metaloprotease (MMP) 3 and 9.510 Treatment of 1623 patients with CHD or equivalent disorder with anacetrapib or placebo for 76 weeks in the DEFINE Phase III clinical trial resulted in a significant and robust decrease of plasma LDL-C (39.8%) and increase of plasma HDL-C (138.1%). In a two year extension study of DEFINE involving 803 of the original study participants, plasma LDL-C was still reduced by 39.9% and HDL-C increased by 153.3% compared to baseline measures with no safety concerns.511 Favorable changes in plasma lipid profiles were maintained even after a 12 week washout period. However, this was most likely due to the incredibly long half life of anacetrapib; ~40% of maximal anacetrapib concentrations were still in circulation following the 12 week washout, with low levels of drug being detected in patients who have been off anacetrapib for 2.5 to 4 years, potentially due to accumulation in adipose tissue.512 The second Phase III clinical trial for anacetrapib, REVEAL, with the primary outcome measure being occurrence of coronary events commenced in April of 2011, with results expected in January of 2017. Lastly, evacetrapib has recently completed trials to determine its safety, efficacy, tolerability, and pharmacokinetics in a population of 165 Japanese men with elevated LDL-C or low HDL-C. Following 12-weeks of evacetrapib, HDL-C was increased by 136% and LDL-C decreased by 22% in the highest dose administered, with plasma lipids returning to baseline levels following a 4-6 week washout period, with an estimated drug half life of 30-50 hours.513  The use of CETP inhibitors in AD has never been broached; however the theory of elevating HDL-C while decreasing LDL-C is theoretically beneficial. Although CETP is present in human brain tissue and CSF,352 the ability of current CETP inhibitors to cross the BBB or the role of CETP in brain lipoprotein maturation, and thus the effect of its inhibition, are completely unknown. Inhibition of CETP primarily produces large lipid rich HDL without effecting preβ-HDL or ABCA1-dependent cholesterol efflux, and thus may not be as beneficial to the brain where our data suggests that immature or pre-β-HDL may be the more important subspecies for removing amyloid. Further, neither dalcetrapib510 nor anacetrapib514 improved the profile of proinflammatory markers in serum in vivo or ability of isolated HDL-C to suppress macrophage toll like receptor (TLR) 4 mediated inflammatory responses. As inflammation and endothelial 41  activation are likely a large contributing factor to the demise of cerebrovascular health, the ability of HDL to modulate these factors will be key in designing a potential therapeutic.   1.8.3.2 Endothelial Lipase Inhibitors Endothelial lipase (EL) is synthesized and bound to vascular endothelial cells where it acts as a phospholipase for HDL.346 As over-expression of EL reduces HDL-C in mice346, 515 and EL null mice516 and humans516, 517 have increased HDL-C, inhibition of EL activity is a potential strategy for raising HDL-C therapeutically.518 Whether EL is pro-atherogenic, anti-atherogenic, or neutral remains contested. One the one hand, some studies have found a positive association between plasma EL concentration and coronary artery calcification, features of the metabolic syndrome,519 and inflammation520, suggesting  a pro-atherogenic role. Supporting this, carriers of EL variants associated with increased plasma HDL-C have been found to be protected from CAD risk521, although two separate studies did not find this association.522, 523 The discovery and subsequent streamlining of potent, selective substituted phenylboronic acid EL inhibitors will hopefully shed some light on the role of EL in HDL metabolism and CVD risk.524 Little is known about the role or regulation of EL lipase in CNS lipoprotein metabolism. EL is synthesized and secreted by the brain, expressed within the CA3 pyramidal cells of the hippocampus, ependymal cells of the ventricles, and some cortical layers in mice.525, 526 In vitro, EL mRNA and protein has also been detected in porcine brain capillary endothelial cells (pBCEC).527 In mice, neurodegeneration induced by injection with kainic acid results in a rapid increase of EL mRNA in the piriform cortex, hippocampus, thalamus and neocortex, while no changes are observed following focal cerebral ischemia.526 In pBCEC, administration of LXR, peroxisome-proliferator activated receptor (PPAR) α or γ agonists was found to decrease EL expression and activity, potentially modifying HDL turnover at the level of the BBB.527 It is well established that HDL can inhibit adhesion molecule expression and the interaction of leukocytes with the vascular endothelium, thereby decreasing inflammation. Interestingly, this protective effect of HDL is blocked in the presence of general lipase inhibitors. Ahmed et al demonstrated that EL was both necessary and sufficient for HDL repression of cytokine induced VCAM-1 expression via the induction of PPARα in aortic endothelial cells.528 It will therefore be critical to determine if HDL can likewise inhibit adhesion molecule expression and leukocyte adhesion to 42  the cerebrovascular endothelium and whether EL is involved in this process prior to development of EL inhibitors for AD.  1.8.3.3 Niacin Niacin, the first antidyslipidemic agent discovered, still remains the most potent agent for increasing HDL-C and apoA-I levels, presumably via the niacin receptor, GPR109A,529 and other yet as identified pathways. Not only does niacin boost HDL-C levels, but it also has the potential to improve endothelial function by decreasing inflammatory markers such as CRP and lipoprotein associated phospholipase-A2, and reduce lipoprotein(a), apoB, and LDL cholesterollevels, themselves a risk factor for CHD. However, niacin usage is also associated with side effects such as flushing, hyperglycemia and hyperuricemia.529 Despite slowing the progression530 or causing the regression531 of atherosclerosis in previous studies, combination therapy of extended release niacin and simvastatin failed to meet its primary endpoint of decreasing adverse coronary events in the Phase III AIM-HIGH study of 3414 patients with CAD, PAD or cerebrovascular disease and metabolic syndrome, leading to its termination 3 years into the study due to lack of efficacy.532 Despite these findings, a recent meta-analysis of 11 trials involving 9,959 CHD patients given niacin showed a significant decrease of cardiovascular and major CHD events with niacin use; somewhat surprisingly these findings were not significantly associated with the magnitude of HDL-C difference following niacin administrations, suggesting that other important markers need to be followed up on.533 Results from a second large Phase III clinical trial, HPS2-THRIVE, are being awaited.  Although niacin has not been studied in the context of AD, a substantial body of work has been performed regarding the therapeutic potential of niacin in rat stroke models. Administration of niacin to rats following middle cerebral artery occlusion (MCAo): improves functional outcome, promotes angiogenesis and vascular remodeling, increases synaptic plasticity, and stimulates neurite outgrowth while increasing axonal density.534-538 In mouse models of Parkinson’s Disease, nicotinamide has shown broad neuroprotective effects, exhibiting a dose dependent sparing of striatal dopamine levels and substantia nigra pars compacta neurons.539 These results suggest that niacin may be beneficial to AD via the up-regulation of HDL and potential neuroprotective effects.  43   1.8.4 Therapies Targeting HDL Function and Reverse Cholesterol Transport As critical HDL functions, including RCT, inhibition of inflammation and oxidative stress, and promoting endothelial cell health and integrity, are compromised in CVD378 and T2DM,10 therapies targeting not only increasing HDL-C levels but improving or restoring its functionality are of critical importance.   1.8.4.1 Liver X Receptor and Retinoid X Receptor Agonists Liver X receptors (LXRs) are nuclear transcription factors that dimerize with retinoid X receptor (RXR) and regulate expression of target genes involved in cholesterol metabolism, inflammation, and glucose metabolism. LXR agonists are best known for their ability to induce RCT by stimulating the expression of ABCA1, ABCG1, and apoE, and inhibiting pro-inflammatory cytokine production via NFκB.540 Despite a plethora of success in pre-clinical models, clinical evaluation with LXR agonists has been stalled due to the induction of hepatic steatosis and plasma hypertriglyceridemia.541-543 Research is continuing to try and identify LXR agonists with tissue specific activity, such as GW6340 which is an intestinal specific LXR agonist,544 or to generate LXRβ specific agonists.545 Interest in the RXR agonist bexarotene surged when Cramer et al. demonstrated a rapid clearance of soluble Aβ and amyloid and a reversal of memory, social, and olfactory deficits in APP/PS1, APPPS1-21, and Tg2576 transgenic AD mouse models.546 Bexarotene, like LXR agonists, also stimulates expression of ABCA1, ABCG1, and apoE in the CNS.546, 547 However, questions arose when four independent laboratories attempted to repeat the results. While all of the studies observed increased CNS ABCA1 and apoE levels, only two observed decreases in soluble Aβ,548, 549 and none observed any change in amyloid plaque burden or number.548-551 Both Fitz et al. and Tesseur et al. observed cognitive benefits even in the absence of changes to amyloid burden, but the authors noted that interpretation of their results was confounded due to the negative side effects of bexarotene.548, 551 The discrepancies among these studies could be because plaque burden is poorly correlated with cognition and memory,552 which has also been observed in humans.115 The most recent study using bexarotene failed to reduce plaque burden or provide any cognitive benefit to APP/PS1 mice.553  Although bexarotene is currently approved 44  for use in lymphoma and is entering phase I clinical trials for AD, patients treated with bexarotene can develop combined dyslipidemia with increased triglyceride and VLDL-C and reduced HDL-C levels, changes that are caused by increased CETP activity,554 and can also rapidly develop hypothyroidism.555  Given that LXR agonists can be efficacious in reversing arthrosclerosis, diabetes, and AD pathology in mice, interest in developing more specific or selective LXR agonists still continues.556 However, as clinical proof of concept still remains elusive for safe LXR agonists, methods to improve HDL function independent of LXR/RXR modulators are highly desirable.  1.9 Summary, Hypothesis, and Specific Objectives Cerebrovascular dysfunction contributes significantly to the clinical presentation and pathoetiology of AD. Deposition and aggregation of Aβ within VSMCs leads to inflammation, oxidative stress, impaired vasorelaxation and disruption of BBB integrity. Epidemiological evidence strongly suggests that mid-life vascular risk factors, such as hypertension, cardiovascular disease, diabetes, and dyslipidemia increase the relative risk for AD. These co-morbidities are all characterized by low and/or dysfunctional HDL, itself is a candidate risk factor for AD. HDL performs a wide variety of critical functions in the periphery and CNS. In addition to lipid transport, peripheral HDL regulates vascular health via mediating vasorelaxation, reducing inflammation and oxidative stress and promoting endothelial cell survival and integrity. ApoA-I, the primary protein component of peripheral HDL, while only synthesized in the liver and intestine, is readily detectable in both CSF and brain tissue. Preliminary in vitro and in vivo evidence suggests that apoA-I based HDL can remove amyloid deposited in the cerebral vasculature, attenuate neuroinflammation and preserve cognitive function. However, very little is known about the details of how apoA-I enters the CNS, its metabolism once there, and how it exerts its potential protective effects on the cerebral endothelium. The overarching hypothesis of this thesis is that apoA-I may serve as a point of communication and physiological link between the periphery and CNS and further be of therapeutic potential for AD by facilitating Aβ clearance and protecting the cerebrovascular endothelium. These questions were analyzed in three specific aims: 45   Aim 1: To delineate ABCA1-dependent and independent responses to GW3965, a synthetic LXR agonist, in symptomatic APP/PS1 mice.  Aim 2: To evaluate peripheral and CNS lipoprotein metabolism and AD pathology following blockade of HDL maturation by LCAT.  Aim 3: Identify the route of entry and turnover of apoA-I in the CNS of mice and therapeutic potential of HDL infusion with respect to changes in Aβ accumulation and distribution. 46  Chapter 2: Regulation of Lipoprotein Metabolism and ABCA1-Dependency of the Liver-X-Receptor Agonist GW3965 in APP/PS1 Mice   2.1  Summary ATP binding cassette (ABC) transport A1 (ABCA1) mediates the rate limiting step in high density lipoprotein (HDL) generation, effluxing cellular cholesterol and phospholipids onto lipid-poor apolipoprotein acceptors. In the periphery, apolipoprotein (apo) A-I is the major acceptor, while this role is filled by apoE in the central nervous system (CNS). Total body deletion of ABCA1 leads to a profound reduction in both apoA-I and apoE, which translates into increased amyloid burden in mouse models of Alzheimer’s disease (AD). Conversely, brain-specific over-expression of ABCA1 by 6-fold or greater prevents amyloid deposition, suggesting a role for ABCA1 in β-amyloid (Aβ) metabolism. ABCA1 expression and activity are strongly induced by agonists of the liver X receptor (LXR), nuclear transcription factors that regulate a number of key genes involved in cholesterol homeostasis. While synthetic LXR agonists, including TO901317 and GW3965, have proven efficacious in improving cognitive function while reducing Aβ and/or amyloid burden, the specific role of ABCA1 in mediating these beneficial results is unknown. Here we report that feeding symptomatic APP/PS1 mice, with or without functional ABCA1, GW3965 compounded in chow for 2 months results in the dose dependent increase of both apoE and soluble Aβ independent of ABCA1. Although not a direct LXR target gene, apoA-I protein was selectively and markedly increased in the CNS by GW3965, surprisingly independent of ABCA1. However, ABCA1 was required to observe improvements in cognitive function; supporting the hypothesis that lipidation is a critical regulator of apolipoprotein function.  2.2 Introduction One of the major pathological hallmarks of AD is the presence of amyloid plaques, composed mostly of aggregated Aβ peptides derived from sequential proteolytic processing of amyloid precursor protein (APP).71 In addition, to parenchymal amyloid, 60-80% of AD subjects also have amyloid deposited within the smooth muscles cells of the cerebrovasculature.260, 261 In 95-99% of Alzheimer’s subjects, APP production and processing are not affected, leading the 47  scientific community to hypothesize that faulty Aβ degradation and clearance lead to its net accumulation within the CNS.  It is well established that amyloid burden in humans follows an isoform dependent pattern of apoE4>apoE3>apoE2.16, 557, 558 In contrast to human apoE, murine apoE exists in only one isoform with limited homology to human apoE. Amyloid burden is robust in AD mice expressing murine apoE and nearly abrogated in apoE-deficient mice.559-565 Reconstitution of human apoE isoforms into AD mice greatly delays amyloid deposition relative to murine apoE, but retains the human isoform-specific influence on amyloid accumulation.407, 426, 562, 566, 567 Taken together, the relative amyloid burden across murine and human apoE is: murine apoE>>apoE4>apoE3>apoE2>>apoE-/-. These observations clearly show that apoE affects amyloid burden in vivo.   In vivo, neither apoE isoform nor gene dose significantly affects the rate of Aβ production from APP,407, 568 leading to the consensus that apoE is largely involved in modulating the clearance of Aβ peptides from the brain. ApoE modulates Aβ clearance via  each of the three known pathways of, including proteolytic degradation, egress across the blood-brain-barrier via both direct and competitive interactions with apoE receptors including members of the low density lipoprotein (LDL) receptor (LDLR) family and interstitial fluid drainage; whether apoE aids or impedes degradation and clearance is still widely debated as results vary depending on the model system used.136, 161 It is important to note, however, that apoE isoform, levels, lipidation status and receptor interaction are all important variables.  With respect to apoE levels, most studies suggest that apoE promotes retention of Aβ in the brain, as brain-to-blood transport of radiolabeled Aβ injected into the brain is slowed when premixed with apoE compared to free Aβ.406 Also supporting this viewpoint is the observation that amyloid burden is lower in hemizygous APOE3 and APOE4 APP/PS1-21 and hAPP J20 AD mice compared to homozygous controls.568, 569 Intriguingly, as a recent microdialysis study showed that very little apoE is actually associated with Aβ in brain interstitial fluid, apoE may retard Aβ clearance from brain to blood by competing with Aβ for binding to the low density lipoprotein receptor related protein 1 (LRP-1).408 However, another study found that there was significant interaction between apoE and Aβ, and that the levels of soluble apoE- Aβ decreased in an isoform specific manner apoE4<apoE3<apoE2,570 implying that the putative interactions 48  between apoE and Aβ vary depending on the experimental conditions. Additionally, brain-specific over-expression of LDLR, the major apoE receptor,571 leads to significantly decreased brain apoE levels and significantly reduced amyloid and Aβ loads, presumably by accelerating apoE uptake.572, 573 How apoE is involved in Aβ metabolism is not completely understood, as net levels of apoE are only one part of the equation; the degree to which apoE is lipidated also significantly affects function. Lipidation of apoE in the CNS is performed by ABCA1,365, 366 akin to ABCA1-mediated lipidation of apoA-I in the periphery.357 Plasma and cerebrospinal fluid (CSF) apoA-I are markedly reduced in mice deficient in ABCA1 while CSF and brain tissue apoE are decreased by 60-80%.362, 365, 366 ABCA1-/- mice display increased insoluble Aβ and amyloid deposition when crossed onto the TgSwDI,368 APP23,371 and PDAPP367 mouse models of AD. Conversely, selective brain over-expression of ABCA1 by 6-fold or more is sufficient to prevent the formation of amyloid plaques without altering the net levels of CNS apoE or apoA-I in PDAPP mice.376   Figure 2.1 ABCA1 mediates the efflux of cholesterol and phopholipids onto lipid-poor apolipoprotein acceptors. ABCA1 mediates the rate-limiting step of HDL generation, the efflux of cellular lipids onto apolipoprotein acceptors. In the CNS, ABCA1 expressed by astrocytes lipidates newly secreted apoE, while in the periphery hepatic and intestinal ABCA1 lipidate newly synthesized apoA-I. ABCA1 expressed in other tissue can also participate in lipid efflux of recycled particles. In the absence of ABCA1, only lipid poor apolipoprotein species exist, which are turned over rapidly, reducing total levels. 49  Modified with permission from 19  Consistent with the hypothesis that ABCA1-mediated lipidation of apoE affects Aβ metabolism are the results of genetic and pharmacological manipulation of pathways regulated by α and β LXRs. LXRα/β are ligand-activated transcription factors of the nuclear hormone receptor superfamily that regulate transcription of genes involved in lipid and cholesterol metabolism, inflammation, and glucose metabolism by forming obligate heterodimeric complexes with retinoid X receptors (RXR).540 Genetic deficiency of either LXRα or LXRβ in APP/PS1 mice increases amyloid burden, leading numerous laboratories to pursue the use of synthetic LXR agonists, such as TO901317 and GW3965, in an attempt to harness their pluripotent beneficial effects for use in AD (Figure 2.2).574 Both TO901317 and GW3965 cross the blood-brain barrier (BBB) and activate LXRα and LXRβ, efficiently inducing expression of LXR target genes including ABCA1 and apoE.575-577 Treatment of multiple AD mouse models with either compound has been shown to improve cognitive function, increase ABCA1 and apoE, and reduce insoluble Aβ and/or amyloid.433-436 However, existing LXR agonists have the unavoidable side effect of activating fatty acid synthase and sterol response element- binding protein-1c (SREBP1c) in the liver, which leads to hypertriglyceridemia and hepatic steatosis, particularly in species such as humans that express cholesterol ester transfer protein (CETP).541-543 As a result, the therapeutic potential of LXR agonists remains untapped. 50   Figure 2.2 A schematic representation of the potential mechanism of liver X receptors in Alzheimer’s disease. Figure used with permission from 574   Determining which LXR target genes mediate the beneficial effects of LXR agonists on behavior and neuropathology may offer insights into new strategies that avoid the undesirable side effects. This study was designed to assess the specific contribution of ABCA1 in the response to GW3965, a synthetic LXR agonist, in APP/PS1 mice. We generated female APP/PS1 mice with and without functional ABCA1 (APP/PS1 WT and APP/PS1 ABCA1-/-) that were then fed control diet or GW3965 compounded in chow to yield 2.5 mg/kg/day (referred to as low dose) or 33 mg/kg/day (referred to as high dose) from 8 to 10-months of age. Here we report that high dose GW3965 significantly increases cortical and hippocampal apoE and soluble 51  Aβ independent of ABCA1. Further, although not a direct LXR target, apoA-I was selectively increased in brain tissue and CSF of APP/PS1 WT and brain tissue of APP/PS1 ABCA1-/- mice. However, ABCA1 was required to see GW3965-mediated cognitive benefits, suggesting that lipidation or apoE and/or apoA-I containing HDL are important for cognitive function.  2.3 Methods 2.3.1 Animals and GW3965 delivery APP/S1 (line 85) mice (Jackson Laboratories) co-express two transgenes from the murine prion promoter: a chimeric mouse/human APP cDNA containing the Swedish (K670M/N671L) mutations and the human PS1 gene deleted for exon 9. APP/PS1 mice are maintained on a mixed F1 C3H/H3J x C57Bl/6 background and develop Aβ deposition and cognitive deficits by 6-7 months of age. ABCA1-deficient APP/PS1 mice were generated by crossing APP/PS1 mice ABCA1−/− mice followed by one backcross. ABCA1+/+ littermates were generated using a similar backcrossing strategy to control for admixture of genetic background in experimental cohorts. GW3965 (3-[3-[N-(2-chloro-3- trifluoromethylbenzyl)-(2,2-dephenylethyl)-amino]propyloxy]phenylacetic acid hydrochloride) was generously provided by Dr. Jon Collins (GlaxoSmithKline) and compounded (Research Diets) into chow (PMI LabDiet 5010, containing 24% protein, 5.1% fat and 0.03% cholesterol) at either 10 mg/kg, resulting in an average dose of 2.5 mg/kg/d/mouse (low dose) or at 120 mg/kg to result in an average dose of 33mg/kg/d/mouse (high dose). APP/PS1 mice with or without ABCA1were treated from 8 to 10 months of age (2 month duration).  2.3.2 Behavioural Testing Animals were housed for 10 days prior to behavioral testing in a quiet room with a reversed 12h dark/12-h light cycle. All testing was performed during the dark cycle.  2.3.3 Novel Object Recognition  The novel object recognition (NOR) task, which uses cortical and hippocampal inputs, was administered as described.578 The objects to be discriminated were made of biologically neutral materials and weighted to prevent movement in the open field. Twenty-four hours prior to 52  training, mice were habituated to an empty open field (35.5 x 61 x 35.5 cm) for 10min. During training, mice were placed in the center of the open field, which did not contain shavings, in a brightly lit testing room. The time spent exploring two identical objects (yellow, plastic duck-shaped toys) located in the north and south quadrant, spaced equidistant from the walls and animal, was quantified. The definition of exploring was that the mouse was sniffing, climbing on, or touching the object and was a body length or less away from the object (i.e. less than 3 cm) while facing the object or orientated toward it. Trials were tracked using an overhead digital camera and analyzed using the ANY-maze video tracking software (Stoelting). Between each trial, the open field was cleaned with 70% ethanol to eliminate olfactory cues. Four hours after training, mice were tested. For testing, one of the identical objects was replaced with a novel object (purple, plastic hippopotamus-shaped toy) of similar size. The side of the open field with the novel object was alternated for each mouse to avoid a side preference. The time spent exploring the identical and novel objects were recorded. An increased percentage of time spent exploring the novel object (duration spent with novel object/(duration spent with novel object x duration spent with familiar object)  x 100) is considered an index of enhanced cognitive performance in this task. The training and testing trails were each 5min long.  2.3.4 Morris Water Maze Hippocampal-dependent spatial memory was examined using the Morris water maze (MWM).579 The water maze consisted of a plastic pool (100 cm in diameter and 54 cm high). An overhead video camera coupled to a computer and tracking software (ANY-maze video tracking system, Stoelting) was used to track movements. The water remained a constant temperature of 22–25 °C and was made opaque with non-toxic, water-based, white tempera paint. Distinct geometric shapes were attached to the walls of the pool on three sides, and the experimenter and computer system were hidden. Mice were assessed for latency to find a hidden platform that remained in the same quadrant of the pool for the entire training period. The training consisted of 4 blocks of trials, with 4 trials per block and a 5min trial interval. Each trial lasted until the mouse climbed onto the hidden platform within 60s, and the escape latency onto the platform was recorded.  53  2.3.5 CSF, Plasma, and Tissue Collection Mice were anesthetized by intraperitoneal administration of a mixture of 20 mg/kg xylazine (Bayer) and 150 mg/kg ketamine (Bimeda-MTC). CSF was isolated from the cisterna magna as described.580 Blood was collected via cardiac puncture, placed into tubes containing ethylenediaminetetraacetic acid (EDTA) and centrifuged at 21,000 relative centrifugal force (rcf) for 10min and stored at -80oC until use. Animals were then perfused for 7min at 8 mL/min with phosphate buffered saline (PBS) containing 2,500 U/L heparin. Liver and brain were extracted and the cortex and hippocampus were dissected and snap frozen separately at -80°C. Half of the brain was placed into 10% neutral buffered formalin followed by 30% sucrose in PBS for histological analysis.  2.3.6 Plasma Lipid Analysis Plasma lipid levels including total cholesterol (TC), HDL cholesterol (HDL-C), and LDL cholesterol were determined using commercially available kits (Wako) according to the manufacturer's instructions.  2.3.7 Protein Extraction Cortex and hippocampus samples from APP/PS1 WT and ABCA1-/- mice were homogenized in 8-volumes of ice cold carbonate buffer (100 mM Na2CO3, 50 mM NaCl pH 11.5) containing cOmplete protease inhibitor (Roche Applied Science) in a Tissuemite homogenizer for 20s, sonicated at 20% output for 10s, and clarified by centrifugation at 16,600 relativce centrifugal force (rcf) for 45min at 40C. The supernatant (carbonate-soluble fraction) was removed and neutralized by adding approximately 1.5-volumes of 1M Tris pH 6.8 to give a final pH of approximately 7.4. The remaining pellet was re-suspended in guanidine hydrochloride (GuHCl) extraction buffer (5M GuHCl, 50mM Tris HCl pH 7.4). Protein concentrations were determined using a BCA Assay (Pierce).   2.3.8 Immunoblotting For denaturing immunoblotting, equal volumes of CSF (5 µL), plasma (1 µL) or tissue lysate (50-75 µg) were electrophoresed through 10% sodium dodecyl sulfate (SDS)- polyacrylamide 54  gel electrophoresis (PAGE), transferred to polyvinylidene fluoride (PVDF) membranes (Millipore), probed for ABCA1, apoE, apoA-I using the antibody conditions outlined in Appendix B  followed by HRP-conjugated secondary antibodies. Blots were developed using enhanced chemiluminescence (Amersham) and quantified by densitometry using ImageJ software (NIH). Protein levels were normalized to GAPDH or albumin, which were used as loading controls for tissue, CSF and plasma, and expressed as fold difference compared to controls. Each sample was analyzed at least in duplicate on independent gels. For analysis of CSF apoE particles, 10 µL of CSF was pooled from two mice and electrophoresed through 6% native polyacrylamide gels and then processed as stated above.  2.3.9 Aβ ELISA Human Aβ40 and Aβ42 levels were quantified by commercial enzyme-linked immunosorbent assay (ELISA) kits (Invitrogen; KMB3482, KMB3442) following the manufacturer’s instructions. Levels Aβ40 and Aβ42 were normalized to total protein.  2.3.10 Histology Twenty-five µm thick, coronal sections were cut on a cryostat from fixed brains from the genu of the corpus callosum to the most caudal hippocampus. Sections were immersed for 10min in 1% thioflavin S solution followed by washing and dehydration in increasing ethanol concentrations from 10 to 70% followed by xylene. Slides were mounted in dibutyl phthalate xylene mounting medium and visualized within 24h. Quantification of amyloid load was performed from 4-6 half brain sections, 300 µm apart, spanning the entire length of the hippocampus. Each section was compiled of 15 stitched images at 40x magnification. This systematic sampling strategy was chosen to account for subregional variations of hippocampal size and potential variations in plaque burden. Images were viewed via fluorescein isothiocyanate (FITC) fluorescence using a BX61 microscope and quantitated using Image Pro software (Media cybernetics). Areas of the regions of interest were outlined manually. The plaque/amyloid area within the field of interest (hippocampus or entire half brain) was identified by color and intensity level threshold, this level was maintained throughout the experiment. Amyloid load (defined as the sum of thioflavin S 55  staining area measured/sum of field analyzed x 100) was calculated for each section and then averaged across sections for each individual mouse.   2.3.11 Statistical Analysis Data were analyzed by either a One Way or Two Way analysis of variance (ANOVA) followed by a Bonferroni post-test for normally distributed data or Kruskal-Wallis test followed by a Dunns Multiple Comparison test for nonparametric data, performed by GraphPad Prism v5.0.  2.4 Results 2.4.1 Modulation of Plasma Lipid and Lipoprotein Levels by GW3965 To delineate the ABCA1-dependency of the response to GW3965, we fed APP/PS1 mice with or without functional ABCA1 either a control diet or GW3965 compounded in chow to yield 2.5 mg/kg/day, referred to as low dose, or 33 mg/kg/day, referred to as high dose, from 8 to 10-months of age. At the completion of the study, behavior tests were performed, animals were sacrificed, and samples were collected for analysis. We began by assessing the impact of GW3965 on cholesterol, lipoprotein, and apolipoprotein levels circulating in plasma obtained from fasted mice (Figure 2.3). As expected, in APP/PS1 mice lacking ABCA1, total, HDL, and LDL associated cholesterol were reduced to 13% (p=0.0294), 3.5% (p=0.10), and 23% (p=0.0286) of APP/PS1 WT mice fed normal chow. Following GW3965 administration, total cholesterol, HDL-C, and LDL-C displayed a dose-dependent increase in both APP/PS1 WT and APP/PS1 ABCA1-/- mice (Figure 2.3A-C). In APP/PS1 WT mice fed high dose GW3965, total cholesterol was increased by 120% (p<0.01), HDL-C by 136% (p<0.05), and LDL-C by 127% (p<0.01). In APP/PS1 ABCA1-/- mice, the increases observed were of an even greater magnitude: total cholesterol, HDL-C, and LDL-C increased by 359% (non significant (ns)), 306% (p<0.05), and 129% (ns) in mice fed high dose GW3965 compared to APP/PS1 ABCA1-/- controls, although only increased HDL-C was statistically significant. Plasma triglycerides were not significantly increased in any of the groups (data not shown).  Levels of apoA-I, the major apolipoprotein contained on plasma HDL, and apoE, found on plasma LDL, VLDL and to a lesser extent HDL, were measured by denaturing  56   Figure 2.3 High-dose GW3965 significantly elevates plasma HDL-C, LDL-C,  total cholesterol, and apoE in mice. A-C) Lipids were measured using commercially available colourmetric kits in plasma taken from APP/PS1 WT (white) and APP/PS1 ABCA1-/- (black) mice fed a control diet (C) or GW3965 in chow at 2.5 mg/kg/day (low dose=LD) or 33 mg/kg/day (high dose=HD) from 8-10m of age. Graphs represent mean ± SEM, with N= 3-4 per group. Plasma levels of D) apoE and E) apoA-I were determined by denaturing immuoblotting. Graph represents mean ± SEM, with N= 3-11. Bottom panels are representative immunoblots probed for apoE (top, left) or apoA-I (top, right) with albumin (bottom) as a loading control. For both apoE and apoA-I a light and dark exposure of the same immunoblot are shown as apoE and apoA-I are significantly lower in APP/PS1 ABCA1-/- mice. * represents p<0.05 by One Way ANOVA followed by Bonferroni post-test. For non-parametric data, $ represents p<0.05, $$ p<0.01 determined by Kruskal-Wallis test followed by a Dunns Multiple Comparison test. All statistics compare GW3965 treated animals to control animals within the same genotype.   immunoblotting (Figure 2.3D,E). As expected, both apoA-I and apoE were dramatically reduced by 86% (p=0.005) and 75% (p=0.005) in APP/PS1 ABCA1-/- mice compared to APP/PS1 WT controls. ApoE was increased by 60% (p<0.05) in APP/PS1 mice fed high dose GW3965, while apoE levels in APP/PS1 ABCA1-/- mice were elevated to reach baseline levels of apoE in APP/PS1 WT control mice, or 340% (p<0.05) compared to APP/PS1 ABCA1-/- control mice. In contrast, high-dose GW3965 did not significantly alter plasma apoA-I in either genotype, A B CD EapoE (light)albuminapoE (dark)apoA-I (light)albuminapoA-I (dark)57  although a mild 30% increase (p<0.05) did reach statistical significance in low dose APP/PS1 mice.  2.4.2 GW3965 Increases CNS ABCA1 and ApoE Protein Levels in a Dose-Dependent Manner Next we measured the levels of ABCA1 and apoE, both direct LXR targets, in the brain tissue of APP/PS1 WT and APP/PS1 ABCA1-/- mice fed low or high dose GW3965 (Figure 2.4). ABCA1, a highly sensitive LXR target gene, was robustly increased by 280% (p<0.001) and 480% (p<0.001) in cortical and hippocampal lysates, respectively, from APP/PS1 WT mice fed high dose GW3965 (Figure 2.4A,B). ApoE was also increased by high dose GW3965, although the magnitude of response was much smaller in comparison to ABCA1. In APP/PS1 WT mice, cortical and hippocampal apoE were increased by 40% (p<0.05) and 60% (p<0.01) compared to control mice, respectively. Surprisingly, the GW3965-mediated increase of apoE in APP/PS1 ABCA1-/- mice (95-105% of APP/PS1 ABCA1-/- controls) was greater in magnitude than that observed in mice with functional ABCA1. However, apoE levels even in GW3965 treated APP/PS1 ABCA1-/- mice were still slightly below that of APP/PS1 controls, and only reached statistical significance in the cortex (Figure 2.4C,D). To further investigate these results, we measured cortical apoE mRNA by QRT PCR. ApoE mRNA was significantly up-regulated in APP/PS1 ABCA1-/- mice fed both low dose (222%, p<0.05) and high dose (302%, p<0.05) GW3965, while apoE mRNA levels remained unchanged in APP/PS1 WT mice (Figure 2.10), suggesting that increased apoE protein in APP/PS1 WT mice is mainly due to post translational stabilization caused by enhanced ABCA1 lipidation, whereas apoE up-regulation in APP/PS1 ABCA1-/- mice is mainly due to increased transcription.   58    Figure 2.4 Dose-dependent increase of cortical and hippocampal ABCA1 and apoE in response to GW3965 in APP/PS1 mice.  Protein levels of A,B) ABCA1 and C,D) apoE were determined in carbonate soluble A,C) cortical and B,D) hippocampal lysates  by denaturing immunoblotting in APP/PS1 WT (white) and APP/PS1 ABCA1-/- (black) mice fed control diet (C) or GW3965 in chow at 2.5 mg/kg/day (low dose=LD) or 33 mg/kg/day (high dose=HD) from 8-10m of age. Graphs represent mean ± SEM, with N= 3-12 per group.  Bottom panels are representative immunoblots probed for ABCA1 (top, left hand side) or apoE (top, right hand side) in addition to either actin (bottom, left hand side) or GAPDH ( bottom, right hand side) as a loading control. Dashed line represents where two independent blots were merged together for the purpose of presentation. For normally distributed data * represents p<0.05, *** p<0.001 by One Way ANOVA followed by Bonferroni post-test. For non-parametric data, $ represents p<0.05 determined by Kruskal-Wallis test followed by a Dunns Multiple Comparison test. All statistics compare GW3965 treated animals to control animals within the same genotype.   2.4.3 ABCA1 is Required to Observe Increased CSF ApoE in Response to GW3965 As both ABCA1 and apoE are elevated in brain tissue, we anticipated that we would observe alterations to the levels and potentially lipidation of apoE in the CSF. CSF obtained from APP/PS1 WT and APP/PS1 ABCA1-/- mice fed control, low dose, or high dose GW3965 was subjected to native immunoblotting and probed with an antibody against apoE in order to determine particle size and distribution (Figure 2.5). Consistent with brain tissue results, low dose GW3965 did not significantly affect apoE in the CSF of APP/PS1 WT or ABCA1-/- animals. However, when fed high dose GW3965, there was a dramatic increase in lipidated CSF apoE in APP/PS1 WT mice (Figure 2.5A). Although APP/PS1 ABCA1-/- high dose GW3965 mice displayed a significant increase in cortical apoE, these results did not translate to the CSF, as CSF apoE remained unchanged relative to APP/PS1 ABCA1-/- controls. As native C DapoEGAPDHA BABCA1actin59  immunoblotting is not quantitative, we further subjected CSF from APP/PS1 mice to denaturing immunoblotting (Figure 2.5C,D). Unfortunately we were not able to analyze APP/PS1 ABCA1-/- mice due to sample availability and technical limitations. At high dose GW3965, CSF apoE was increased 70% over control levels in APP/PS1 WT mice, a similar magnitude to what was observed in cortical and hippocampal lysates (Figure 2.5C,D). We further probed these blots for apoA-I, as it is located in the CSF at relatively equimass concentrations to apoE.13, 349-351, 453 Surprisingly, although it does not contain a canonical LXR response element in its promoter, we observed a robust 310% increase in apoA-I in the CSF of APP/PS1 WT mice fed high dose GW3965 compared to control animals (Figure 2.5D), leading us to further examine the response of apoA-I in response to GW3965.  60   Figure 2.5 High dose GW3965 significantly alters CSF lipoprotein size and levels in APP/PS1 mice. The size and distribution of apoE-containing lipoprotein particles in the CSF of A) APP/PS1 and B) APP/PS1 ABCA1-/- mice fed control (C), low dose (LD), or high dose (HD) GW3965 from 8-10m of age was determined by native immunoblotting against apoE (top panel), with albumin used as a loading control (bottom panel). The total CSF levels of C) apoE and D) apoA-I in APP/PS1 mice were determined by denaturing immunoblotting against apoE or apoA-I (top panel) with albumin as a loading control (bottom panel). Graphs represent mean ± SEM, with N= 4-5 per group. $ represents p<0.05 determined by Kruskal-Wallis test followed by a Dunns Multiple Comparison test.   C LD HD C LD HDAPP/PS1 WT APP/PS1 ABCA1-/-apoE17 nm12.2 nm8.1 nm7.1 nm17 nm12.2 nm8.1 nm7.1 nmalbuminapoEalbuminapoA-IalbuminA BC D61   Figure 2.6 ApoA-I protein levels are increased in brain but not liver tissue in an ABCA1-independent manner following high dose GW3965 treatment in APP/PS1 mice.  Protein levels of apoA-I in A) liver B) cortical and C) hippocampal tissue lysates were determined by denaturing immunoblotting in APP/PS1 WT (white) and APP/PS1 ABCA1-/- (black) mice fed control (C) diet or GW3965 in chow at 2.5 mg/kg/day (low dose=LD) or 33 mg/kg/day (high dose=HD) from 8-10m of age. Graphs represent mean ± SEM, with N= 3-8 per group. Bottom panels representative immunoblots probed for apoA-I (top panel) and GAPDH (bottom panel) used as a loading control. For normally distributed data ** represents p<0.01, *** p<0.001 by One Way ANOVA followed by Bonferroni post-test. For non-parametric data, $ represents p<0.05 determined by Kruskal-Wallis test followed by a Dunns Multiple Comparison test. All statistics compare GW3965 treated animals to control animals within the same genotype.   2.4.4 GW3965 Selectively Increases CNS ApoA-I Independent of ABCA1 ApoA-I is synthesized mainly in the liver, and to lesser extent intestine, and is released from these tissues into the circulation.331 ApoA-I detected in the CSF and brain tissue is hypothesized to be derived from the circulation, as apoA-I mRNA is not present in rodent or human brain.459, 460 Similar to the pattern observed for plasma apoA-I (Figure 2.6E), liver apoA-I was unresponsive to GW3965 in both APP/PS1 WT and ABCA1-/- mice (Figure 2.6A) as measured by denaturing immunoblotting. We were therefore surprised to see a significant dose dependent increase of apoA-I in cortical and hippocampal lysates in both APP/PS1 WT and ABCA1-/- mice in response to GW3965 (Figure 2.6B,C). In APP/PS1 mice, apoA-I was increased by 40% (ns) and 120% (p<0.01) in the cortex and by 100% (p<0.01) and 150% (p<0.001) in the hippocampus of mice fed low and high dose GW3965 compared to chow fed controls, respectively. The response of apoA-I in APP/PS1 ABCA1-/- mice was even more substantial than their WT counterparts, such that apoA-I in high dose GW3965 fed ABCA1-/- animals reached levels apoA-IGAPDHA B C62  observed in treated APP/PS1 mice. ApoA-I was increased by 46% (ns), and 253% (p<0.05) in the cortex and by 420% (p<0.05) and 495% (ns) in the hippocampus of APP/PS1 ABCA1-/- mice fed low or high dose GW3965 compared to APP/PS1 ABCA1-/- chow fed controls, respectively (Figure 2.6). These results suggest that apoA-I, while not a direct LXR target, is selectively very sensitive to GW3965, independent of ABCA1.   2.4.5 GW3965 Increases Soluble Pools of Aβ but Does Not Affect Insoluble Aβ or Amyloid Deposition Sequential proteolytic cleavage of APP by β followed by γ-secretase yields Aβ peptides 40-43 amino acids in length. The species most relevant to AD include Aβ42, which is more fibrillogenic and prone to depositing in parenchymal amyloid plaques, and Aβ40, which is more vasculotrophic and prone to depositing in vascular smooth muscle cells as cerebral amyloid angiopathy (CAA).71 Denaturing immunoblotting showed no significant difference in APP holoprotein levels or C-terminal fragments (CTFs) in any treatment group, indicating that neither ABCA1 genotype nor GW3965 significantly affects APP production or processing (Figure 2.11). Levels of Aβ40 and Aβ42 were measured by ELISA in brain regions serially extracted with carbonate, where the soluble pool of Aβ is located, and GuHCl, where insoluble Aβ aggregates reside (Figure 2.7). In general, high dose GW3965 caused a significant increase in soluble Aβ in both APP/PS1 WT and APP/PS1 ABCA1-/- mice. Specifically, following high dose GW3965 administration, soluble cortical Aβ40 and Aβ42 were increased by 416% (p<0.01) and 86% (p<0.001) in APP/PS1 WT mice and by 182% (p<0.01) and 132% (p<0.05) in APP/PS1 ABCA1-/- mice compared to their genotype matched control groups (Figure 2.7A,B). In the hippocampus, Aβ40 and Aβ42 were increased by 242% (p<0.001) and 133% (p<0.05) in APP/PS1 WT mice given high dose GW3965 compared to control mice (Figure 2.7C,D). In contrast to the substantial changes observed in soluble Aβ, the only significant finding for insoluble Aβ was a 48% (p<0.01) decrease in cortical guanidine-soluble Aβ40 in APP/PS1 WT high dose GW3965 mice compared to controls (Figure 2.7E-H).   63   Figure 2.7 High dose GW3965 significantly increases carbonate soluble cortical Aβ in both APP/PS1 WT and APP/PS1 ABCA1-/- mice. The concentration of Aβ40 and Aβ42 in serially extracted A-D) carbonate soluble (white/back) and E-H) GuHCl soluble (light/dark gray) cortical and hippocampal lysates was determined by commercial ELISA and expressed relative to total protein concentration as determined by lowery assay. Mice were fed a control diet (C) or GW3965 in chow at 2.5 mg/kg/day (low dose=LD) or 33 mg/kg/day (high dose=HD) from 8-10m of age. Graphs represent mean ± SEM, with N= 4-10 per group. For normally distributed data *** represents p<0.001 by One Way ANOVA followed by Bonferroni post-test. For non-parametric data, $ represents p<0.05, $$ p< 0.01 determined by Kruskal-Wallis test followed by a Dunns Multiple Comparison test. All statistics compare GW3965 treated animals to control animals within the same genotype.   Because neurotoxicity has been suggested to correlate better with oligomeric rather than total levels of Aβ122, 581 we performed dot blot experiments on carbonate-soluble cortical extracts using the oligomer-specific A11 antibody and the 6E10 antibody that detects all forms of Aβ. The 40-80% increase of oligomeric Aβ observed in both high dose GW3965 treated genotypes was paralleled by a 65-85% increase in total Aβ, resulting in no net change in the ratio of oligomeric to total Aβ (Figure 2.12). Lastly, we examined amyloid deposition histologically by staining coronal half brain sections with thioflavin S, which binds to the β pleated sheets found in mature amyloid fibrils (Figure 2.8). Amyloid burden in whole brain and hippocampus were quantified using threshold  A B C DE F G H64   Figure 2.8 Thioflavin S positive amyloid deposits are unaffected by GW3965 administration. Coronal half brain sections from 10-month old APP/PS1 WT (white) and APP/PS1 ABCA1-/- (black) were stained with thioflavin S to detect mature amyloid following 2 months on either control diet (C), or GW3965 at either 2.5 mg/kg/day (low dose=LD) or 33 mg/kd/day (high dose=HD). Amyloid burden was quantified using threshold analysis in A) whole brain and B) hippocampus. Graphs represent mean ± SEM, with N 2-6 per group. For each animal, 5-6 sections were analyzed and averaged such that each N represents an independent animal.  analysis and expressed as percent of area measured. Although ABCA1 deficiency is reported to enhance amyloid burden in TgSwDI,368 APP23,371 and PDAPP367 AD mouse models, APP/PS1 mice crossed to an ABCA1-/- background do not exhibit increased amyloid burden consistent with our previous report.368 Amyloid burden in whole brain was reduced from 0.32 ± 0.06% in APP/PS1 control mice to 0.18 ± 0.04% in APP/PS1 mice given high dose GW3965, and similarly from 0.34 ± 0.06% to 0.20 ± 0.04% in hippocampus, these results did not achieve statistical significance. Amyloid burden was unchanged in APP/PS1 ABCA1-/- mice regardless of diet (Figure 2.8A,B).  As apoA-I has previously been implicated in facilitating clearance of vascular amyloid27 we also quantified cortical vascular amyloid burden in APP/PS1 mice fed control or high dose GW3965 diet (Figure 2.13). Neither total nor vascular amyloid burden was decreased in the cortex of GW3965 treated APP/PS1 mice, suggesting that elevating apoA-I prior to versus post pathological development may have different effects. Overall, these results suggest that GW3965 has the greatest impact on soluble Aβ, potentially solubilizing Aβ aggregates to aid in Aβ clearance.   A B65   Figure 2.9 ABCA1 is required for GW3965-mediated improvement in object and spatial memory in APP/PS1 mice. Cognitive testing in APP/PS1 WT and APP/PS1 ABCA1-/- mice was conducted at 10m of age following a 2m period where mice were fed control diet or GW3965 compounded in chow to yield 2.5 mg/kg/day (low dose=LD) or 33 mg/kg/day (high dose-HD). A) Novel object recognition (NOR). Time spent exploring the novel (left bar, N) and familiar object (right bar) was graphed as % of total time spent exploring both objects. During the training phase objects presented were identical and all groups were graphed together. Statistics were analyzed by Student’s unpaired T-test. B, C) Latency to locate hidden platform in Morris Water Maze (MWM) over 4 days in the same cohort of mice as above split into B) APP/PS1 treated and C) APP/PS1 ABCA1-/- treated.  * represents p<0.05, ** p<0.01 by Two Way ANOVA followed by Bonferroni post-test where all GW3965 treated groups were compared to APP/PS1 controls. Data was split into two graphs for visual clarity. All graphs represent mean ± SEM, with N= 8-19, with the exception of APP/PS1 ABCA1-/- HD where an N= 4 was used.   2.4.6 ABCA1 is Required for GW3965-Mediated Improvements in Object and Spatial Memory To determine whether ABCA1 contributes to improved cognition upon GW3965 treatment, we evaluated APP/PS1 mice with and without ABCA1 in both novel object recognition (NOR) and Morris Water Maze (MWM) tasks (Figure 2.9).  AB CN N N N N N66  NOR tests working-memory by comparing the differential exploration pattern of familiar versus novel objects in rodents.578 For NOR, all animals displayed equal preference for identical objects, indicating that the presence of amyloid deposits or lack of ABCA1 did not affect baseline exploratory behaviour (Figure 2.9A). As expected, wild-type C57Bl/6 mice showed a significance preference for the novel object during the testing phase, spending 60% (p=0.0001) of their time exploring the novel object. In comparison, control APP/PS1 mice showed no distinction between the novel and familiar object during testing, indicative of impaired working memory. Both low and high dose GW3965 significantly improved memory performance of APP/PS1 mice to near wild-type C57Bl/6 levels, whereas no treatment strategy was able to achieve significant improvements in NOR performance of APP/PS1 ABCA1-/- mice.  The MWM maze is used to test hippocampal-dependent spatial memory.579 In the MWM task, wild-type mice readily learned the location of the hidden platform, as their latency to find the platform decreased steadily every day such that by the 4th day, time was decreased to 48% of day 1 (Figure 2.9B). APP/PS1 control mice, however, did not show any significant decreases in escape latency over 4 days of trials, averaging 41s to find the platform. APP/PS1 mice given either low or high dose GW3965 showed significant improvements in MWM performance, with a 15-30% decrease in latency time by the third and fourth trial (Figure 2.9B). As observed with NOR, neither dose of GW3965 significantly lowered latency time in APP/PS1 ABCA1-/- mice compared to APP/PS1 control animals (Figure 2.9C).   2.5 Discussion LXR are master regulators of cholesterol homeostasis, controlling expression of a number of genes involved in lipid and lipoprotein metabolism, including ABCA1 and apoE.540 LXR agonists have clear beneficial effects on cognitive and biochemical end points when used in mouse models of AD, however results with respect to Aβ and amyloid are somewhat mixed (Table 2.1). Improved cognitive function, measured by contextual fear conditioning (CFC), MWM, and NOR, has been consistently reported with both TO901317 and GW3965 in multiple mouse models of AD.433-437 However, Aβ and amyloid outcome measures are more varied; some reporting decreases specifically to soluble Aβ,431 decreased insoluble Aβ with no changes to soluble levels,432-434 decreases in both soluble and insoluble Aβ,435 and either no change436, 437 or 67  decreased amyloid deposits.434 As ABCA1 is a sensitive and robust LXR target gene that regulates both the levels and lipidation of apoA-I and apoE, we designed this study to determine the ABCA1 dependency of LXR-mediated changes in APP/PS1 mice, and further, the dose-dependence of those changes. Here we report that high dose GW3965 significantly increases CNS apoE, apoA-I, and soluble Aβ independent of ABCA1, while lipidation of CSF apoE and improved cognitive function require functional ABCA1 in APP/PS1 mice. 68   Table 2.1 Experimental design and outcome measures for mouse models of AD administered synthetic LXR agonists, TO901317 and GW3965 Reference Agonist Dose; route Duration AD model Age ABCA1 apoE Aβ amyloid Behavior       mRNA Protein mRNA protein    Koldamova 2005431 TO 50mg/kg/d; oral gavage 6d, 1x/d APP23 11wk - 200% - NC ↓ sol. Aβ40/42 - - Lefterov 2007432 TO 20mg/kg/d; oral gavage 4wk, 5d/wk APP23 5-7m 50% - 30% 200% ↓ insol. Aβ  - Riddell 2007433 TO 50 mg/kg/d; oral gavage 7d, 1x/d Tg2576 (M) 20wk  20-150%  30% 75% ↓ insol. Aβ42 - CFC Vanmierlo 2011436 TO 30 mg/kg/d; chow 67d APPSLxPS1 (M) 21-23m 400% - 400% - - NC object location Fitz 2010435 TO 25 mg/kg/d; chow (HFD) 4m APP23 (M+F) 9-13m 100% 100% 15% 100% ↓ sol/insol. Aβ40/42 ↓ MWM 3wk 4-5m -  - - ↓ sol. Aβ40/42 - - Jiang, 2008434 GW 33 mg/kg/d; chow 4m Tg2576 8-12m - 90% - 56% ↓ Aβ40/42 ↓ - 6d 20wk - - - - - - CFC Donkin, 2010369 GW 33 mg/kg/d; chow 8wk APP/PS1 8-10m - 275-480% NC 43-55% ↑ sol. Aβ40/42  NOR, MWM Fitz, 2014437 TO 25 mg/kg/d; chow 50d APP23 (M+F) 11-12.2m - 75% - 100% NC NC RAM, CFC Abbreviations: CFC, contextual fear conditioning; d, day; GW, GW3965; HFD, high fat diet; insol, insoluble; m, month; MWM, morris water maze; NOR, novel object recognition; RAM, radial arm water maze; sol, soluble; T0, T0901317; wk, week 69   ABCA1 regulates the lipidation, and therefore levels, of both apoA-I and apoE, as poorly lipidated apolipoproteins are more rapidly catabolized by the kidney in the periphery and by a currently unknown mechanism in the CNS.331, 357 As expected, deletion of ABCA1 in APP/PS1 mice resulted in a 75 and 85% reduction in plasma apoE and apoA-I, respectively, and 50-60% reduction in apoE and apoA-I in brain tissue lysates (Figure 2.3;Figure 2.4;Figure 2.6). ApoE is thought not to cross the BBB385 and as such circulating and CNS pools of apoE do not interact; however, apoA-I is most likely derived from the circulation as mRNA is not detectable in murine brain tissue. The magnitude of decrease observed in brain tissue apoA-I in APP/PS1 ABCA1-/- mice is not as substantial as that observed in the plasma, potentially implying that ABCA1 mediated-apoA-I metabolism in the CNS is distinct from that found in the periphery. Of interest, Karasinska et al. reported a profound increase of apoA-I protein levels in brain tissue and CSF in mice with brain specific deletion of ABCA1 (ABCA1−b/−b), which was accompanied by a specific increase of scavenger receptor BI (SR-BI) in the brain capillaries, and a surprising decrease in plasma HDL-C levels even though ABCA1 levels were normal in liver and intestine, tissues that generate at least 90% of peripheral HDL.377 Although it is possible that the brain can differentially regulate apoA-I uptake, the discrepancies observed between plasma and brain levels of apoA-I may also be a result of the methods used for quantification, as denaturing immunoblotting is only semi-quantitative and has a restricted linear range.  ApoE and apoA-I both responded in a dose-dependent manner to GW3965 independent of ABCA1, but the pattern and potential mechanism of increase are likely quite different. ApoE, which contains an LXR response element in its promoter, was increased in both plasma and brain tissue (Figure 2.3;Figure 2.4). Interestingly, apoE appeared more sensitive and responsive to GW3965 in APP/PS1 ABCA1-/- mice, although even maximal up-regulation only equated apoE levels in ABCA1-/- to WT APP/PS1 control mice. While ABCA1 was not required to elevate brain tissue apoE, the robust increase in high lipidated apoE observed in CSF was dependent on functional ABCA1, as expected (Figure 2.5). Therefore, the increase of apoE in APP/PS1 ABCA1-/- mice may potentially be detrimental, as lipidation of apoE is a critical determinant of its function.  70  On the other hand, apoA-I is not a direct LXR target gene, and up-regulation of apoA-I protein levels was CNS specific as apoA-I remained unchanged in the liver and plasma. The dynamic response of cortical and hippocampal apoA-I was greater than that of apoE, increasing up to 300% in APP/PS1 WT CSF, and 150% in APP/PS1 WT and over 400% in APP/PS1 ABCA1-/- brain tissue (Figure 2.6). Few studies have examined transcriptional or post-transcriptional effects of natural and synthetic LXR agonists on apoA-I levels. Of most relevance, Lefterov et al. reported a profound 1200% increase in soluble brain apoA-I, compared to 200% increase in apoE, in APP23 mice given 20 mg/kg/day of TO901317 by oral gavage 5 days a week for a total of 4 weeks.432 However, Fitz et al. saw no significant difference in brain apoA-I levels in the same AD model fed 25 mg/kg/day of TO901317 compounded in chow for 4 months, although the mice were also on a high fat diet which may alter the results.435 In vitro, LXR regulation of apoA-I expression has been studied in hepatic, intestinal and gall bladder epithelial cells in addition to chondrocytes and lymph. Huuskonen et al.345 demonstrated that treatment of Hep3B and HepG2 hepatocytes with TO901317 increased ABCA1 and apoE mRNA levels and enhanced lipid efflux but reduced apoA-I mRNA and protein levels and lowered apoA-I secretion. Mechanistically, the LXR response was localized to the binding site of the transcriptional factor hepatic nuclear factor (HNF) -4 in the apoA-I promoter that normally promotes apoA-I expression. The authors concluded that ligand-bound LXR displaces HNF4 and enhances chicken ovalbumin upstream promoter transcription factor binding, a transcriptional inhibitor that acts as a homodimer or a heterodimer in combination with retinoic acid receptor (RAR), RXR and possibly LXR.345 In the same study, Huuskonen et al. also showed that treatment of CaCO-2 intestinal epithelial cells with TO901317 increased ABCA1 and apoE mRNA and lipid efflux, but had no effect on apoA-I mRNA or protein levels.345 Another group observed an increase in apoA-I gene expression without any impact on apoA-I mass following treatment of CaCO-2 cells with 9-cis retinoic acid, an RAR agonist, in combination with 22-hydroxycholesterol, an LXR agonist, whereas no effect was seen using 9-cis retinoic acid treatment alone.582 The combination of 9-cis retinoic acid and 22-hydroxycholesterol also increased apoA-I mRNA and protein levels in gall bladder epithelial cells, which was accompanied by increased basolateral secretion of apoA-I.583 In cultured chondrocytes, TO90131 increased apoA-I mRNA and protein levels.584 Lastly, treatment of rats with 56 mg/kg of 71  TO90131 for 5 days caused increased HDL-C transport and apoA-I secretion in lymph, with an increase of ABCA1 and apoA-I mRNA levels in the proximal and distal intestine but no change in apoA-I mRNA levels in the liver.585 These studies support the hypothesis that the response of target genes to LXR agonists may depend on the precise combination of genetic elements that regulate transcriptional activation and the specific combination of co-regulators that are present in specific tissues and cell types. Whether brain cells contain distinct co-regulator signature profiles for LXR-regulated genes now becomes an important question to address. It is possible that LXR agonists affect apoA-I turnover or transport into the CNS. For example, endothelial lipase (EL) is synthesized and secreted by brain capillary endothelial cells (BCEC) and over-expression of EL enhances hydrolysis of extracellular HDL.527 Treatment of BCEC with the LXR agonist 24-OH cholesterol, the peroxisome proliferator-activated receptor (PPAR) α agonist bezafibrate, or the PPARγ agonist piglitazone, decreases EL mRNA and protein expression in cell culture.527 These observations raise the possibility that catabolism of apoA-I at the BBB may be suppressed by LXR-mediated decreases in EL activity, leading to a potentially greater pool of apoA-I that could enter the CNS. The route of entry, and whether specific receptors are involved in apoA-I transport is also unknown. In cultured aortic endothelial cells, ABCA1 mediates the transcytosis of lipid-poor apoA-I,461 while SR-B1 and ABCG1 mediate HDL transcytosis.586 Finally, the pathways of apoA-I catabolism in the CNS are not known. Both cubilin and megalin, the receptors responsible for apoA-I degradation in the kidney, are strongly expressed in the brain during early rodent development, but whether they degrade apoA-I in the adult CNS is unknown.587 ApoE, on the other hand, is bound and internalized by several apoE receptors in the CNS, the most important being LDLR which is known to be reduced following LXR mediated activation of the inducer degrader of LDLR (IDOL).588  Although apoE, apoA-I, and Aβ were regulated independent of ABCA1, our data clearly demonstrates that ABCA1 plays a very important role in LXR-mediated restoration of cognitive function. At both low and high dose GW3965, APP/PS1 WT mice displayed a significant preference for the novel object, and displayed reduced latencies in finding the hidden platform in the MWM. That ABCA1-dependent memory can be substantially improved in the absence of reduced Aβ and amyloid suggests that the net levels of Aβ and amyloid are not the most sensitive correlate to cognitive function, something that has been previously noted in human clinical 72  studies.115 In vitro, lipidated apoE and apoA-I facilitate degradation of Aβ by microglia, a process that is greatly impaired in ABCA1-/- or apoE-/- primary microglia.434 Therefore it is possible there are subtle but physiologically relevant changes to discreet pools of Aβ that we are not detecting. LXR agonists also have other potent capabilities not examined here, such as the suppression of neuroinflammation, which may have also been affected.432, 589  In conclusion, this study highlights the critical role ABCA1 plays in HDL metabolism, as even though net apoE and apoA-I levels are increased in APP/PS1 ABCA1-/- mice given GW3965, functional ABCA1 is required for cognitive benefits. This study also illuminates both ABCA1 and LXR-mediated regulation of apoA-I, and their potential differences in the periphery and CNS. Further, as apoA-I can cross the BBB and/or blood-CSF barrier, it may serve as a point of communication that coordinates peripheral and CNS lipid metabolic systems.   2.6 Supplemental Information 2.6.1 Supplemental Methods 2.6.1.1 mRNA Extraction and qRT PCR Ribonucleic acid (RNA) was extracted from cortex using Trizol (Invitrogen) and treated with DNAseI prior to complementary deoxyribonucleic acid (cDNA) synthesis. cDNA was generated using oligodT primers and Taqman Reverse transcription reagents (Applied Biosystems). Primers were designed using Primer Express software (Applied Biosystems). Sequences are: murine apoE forward (5′ AACCGCTTCTGGGATTACCT 3′) and reverse (5′ TGTGTGACTTGGGAGCTCTG 3′) and murine β-actin forward (5′ ACGGCCAGGTCATCACTATTG 3′) and reverse (5′ CAAGAAGGAAGGCTGGAAAAG3′). Quantitative real time polymerase chain reaction (qRT PCR) was done with Sybr green reagents (Applied Biosystems) on an ABI 7000. Cycling conditions were 50 °C for 2min, 95 °C for 10min, then 40 cycles at 95 °C for 15s and 60 °C for 1min, followed by dissociation at 95 °C for 15s, 60 °C for 20s, and 95 °C for 15s. Each sample was assayed at least in duplicate, normalized to β-actin and analyzed with 7000 system SDS software v1.2 (Applied Biosystems) using the relative standard curve method.  73  2.6.1.2 Denaturing Immunoblotting for APP and CTFs APP and APP-CTF were analyzed by resolving 25 µg of cortical carbonate lysate through 4–12% NuPAGE BisTris gradient gels (Invitrogen, NP0335). Following transfer to a PVDF membrane, blots were probed for holo-APP, APP-CTF, or actin as a loading control using the conditions outlined in Appendix A. Immunoblots were developed and quantified as described in 2.3.8.  2.6.1.3 Dot Blot Analysis of Total and Oligomeric Aβ 2 to 4 µg of cortical carbonate soluble lysate was spotted onto a dry nitrocellulose membrane and allowed to absorb. Following rehydration in 20% methanol and blocking in a solution of 5% milk in TBS, blots were probed with an antibody against amino acid residues 1-17 of Aβ to detect total Aβ, or an antibody raised to specifically detect oligomeric structures, A11, as outlined in Appendix B  . Blots were developed and quantified as described in 2.3.8.  2.6.2 Supplemental Figures  Figure 2.10 GW3965 up-regulates cortical apoE mRNA in a dose-dependent manner in APP/PS1 ABCA1-/- mice. ApoE mRNA was measured by qRT PCR in the cortex of 10m old APP/PS1 WT (white) and APP/PS1 ABCA1-/- (black) mice following administration of 2.5 mg/kg/day (low dose=LD) or 33 mg/kg/day (high dose-HD) of GW3965 in chow. Graph represents mean ± SEM, with N= 2-8. $ represents p<0.05 determined by Kruskal-Wallis test followed by a Dunns Multiple Comparison test. All statistics compare GW3965 treated animals to control animals within the same genotype.   74    Figure 2.11 APP production and processing are unaffected by loss of ABCA1 or GW3965. A) APP holoprotein and its cleavage products B) APP-CTFα and C) APP-CTFβ were quantified by denaturing immunoblotting in carbonate-soluble cortical lysates from APP/PS1 mice with (white) and without (black) functional ABCA1 fed GW3965 compounded in chow at low dose (LD) or high dose (HD) from 8-10m of age. Graphs represent mean ± SEM, with N= 7-9 except for APP/PS1 ABCA1-/- where N= 4.     Figure 2.12 No net change in the ratio of oligomeric to total Aβ in APP/PS1 WT and ABCA1-/- mice following low or high dose GW3965 in chow. Nitrocellulose membranes were spotted with equal amounts of cortical carbonate extracts in duplicate and immunoblotted against A) oligomeric Aβ using the A11 antibody and B) total Aβ using the 6E10 antibody and quantified using densitometry. Values are expressed relative to APP/PS1 control animals. C) the ratio of oligomeric to total Aβ  was determined for each animal. Graphs represent mean ± SEM, with N= 7-9 except for APP/PS1 ABCA1-/- where N= 4. ** represents p<0.01, *** p<0.001 as determined by One Way ANOVA and bonferroni post-test.   A B CA B C75    Figure 2.13 No change to cortical total or vascular amyloid burden in APP/PS1 mice fed high dose GW3965 from 8 to 10 months of age. Coronal half brain sections from APP/PS1 WT mice fed either control diet (C), or GW3965 at 33 mg/kd/day (high dose=HD) were stained with thioflavin S to detect mature amyloid fibrils. A) Total amyloid burden (parenchymal + vascular) was determined in the cortex using intensity thresholding and expressed as percent of total cortical area. B) Vascular amyloid in the cortex was identified by morphology and quantified using the same threshold cut-off as total amyloid. Graphs represent mean ± SEM with an N= 5 per group. For each animal, 5-6 sections were analyzed and averaged such that each N represents an independent animal.     A B76  Chapter 3:  Lipoprotein and Amyloid Metabolism Following Blockage of High Density Lipoprotein Maturation by Lecithin Cholesterol Acyltransferase  3.1 Summary A key step in plasma high density lipoprotein (HDL) maturation from discoidal to spherical particles is the esterification of cholesterol to cholesteryl ester, which is catalyzed by lecithin cholesterol acyltransferase (LCAT). HDL-like lipoproteins in cerebrospinal fluid (CSF) are spherical, whereas nascent lipoprotein particles secreted from astrocytes are discoidal, suggesting that LCAT may play a similar role in the central nervous system (CNS). In plasma, apolipoprotein (apo) A-I is the main LCAT activator, while in the CNS it is apoE. ApoE is directly involved in the pathological progression of Alzheimer’s disease (AD), including facilitating β-amyloid (Aβ) clearance from the brain, a function that requires its lipidation by ABCA1. However, whether further particle maturation by LCAT is also required for Aβ clearance is unknown. Here we characterized the impact of LCAT deficiency on CNS lipoprotein metabolism and amyloid pathology. Deletion of LCAT from APP/PS1 mice resulted in a pronounced decrease of apoA-I in plasma that was paralleled by decreased apoA-I levels in CSF and brain tissue, while apoE levels were unaffected. Furthermore, LCAT deficiency did not increase Aβ or amyloid in APP/PS1 LCAT-/- mice. Finally, LCAT expression and plasma activity were unaffected by age or the onset of Alzheimer’s like pathology in APP/PS1 mice. Taken together, these results suggest that apoA-I and apoE-containing discoidal HDL do not require LCAT-dependent maturation to mediate efficient Aβ clearance.  3.2 Introduction Since the 1993 discovery that inheritance of the apoE4 allele increases risk and decreases the age of onset of late-onset AD,16 the putative roles of apoE in AD pathogenesis have been a topic of intensive focus.107 It has been well established that apoE isoform,407, 426, 562, 566, 567  levels568, 569 and lipidation status367, 368, 371, 376 both serve as important variables in determining pathological development of AD in mice. However, whether lipoprotein particle maturity and conformation affect apoE or apoA-I containing HDLs ability to mediate Aβ clearance remains unknown. 77  Similar to apoA-I-containing HDL particles in plasma, apoE-containing HDL-like particles in the CNS exist in two major structural conformations depending on their maturation state. In vitro, astrocytes, and to a lesser extent, microglia, secrete several nascent discoidal apoE particles ranging from 7.5 to 17 nm in diameter that contain 0-18% of their cholesterol as esters.14, 15, 329, 590 By contrast, apoE and apoA-I containing lipoprotein particles in CSF are 11-20 nm spherical particles containing 70% of their cholesterol in the esterified form, with a similar density to α-HDL found in plasma.13, 15, 327, 349 Plasma HDL maturation is catalyzed by LCAT, which esterifies free cholesterol to cholesteryl ester to form the lipid core critical for conversion of discoidal preβ-HDL to mature spherical α-HDL.591 In plasma, HDL maturation maintains the gradient of free cholesterol between the cell membrane and HDL surface, thereby driving cholesterol efflux, a key process in reverse cholesterol transport (RCT).591 Plasma α-HDL and apoA-I levels are dramatically reduced in LCAT-/- mice,341, 592 however the macrophage RCT pathway is largely preserved.593 Whether LCAT is pro or antiatherogenic remains contested, as results from both animal and human studies are conflicting.591 In the CNS, we have previously shown that LCAT is secreted by astrocytes and is capable of esterifying free cholesterol contained on glial derived nascent apoE-containing particles (Figure 3.1).594 ApoE is hypothesized to be the major LCAT activator in the CNS, as apoE is sufficient to stimulate esterification of endogenous cholesterol in glial-conditioned media (39). ApoA-I, which is not synthesized within the CNS but is found in CSF, is also capable of activating glial-derived LCAT to esterify cholesterol.594 The levels and activity of LCAT in CSF are estimated to be 2.2 – 2.5% of serum LCAT.349, 595 In young C57Bl.6 mice, LCAT deficiency leads to a dramatic increase in apoE and a concurrent decrease of apoA-I levels in CSF,594 suggesting that LCAT activity may in part regulate CSF apoE and apoA-I levels.    78    Figure 3.1 LCAT mediated cholesterol esterification and maturation of HDL in the CNS and circulation. Figure adapted with permission from 19 LCAT activity in the CSF of AD subjects has been reported to be up to 50% lower than in cognitively normal subjects.349 It is not known whether this association may be related to Aβ metabolism, such that reduced LCAT may impair Aβ clearance. It is also not known whether aging or the presence of Aβ may impair LCAT activity. To address the question of whether Aβ clearance requires LCAT-mediated maturation of apoA-I or apoE-bearing HDL-like particles, we assessed the impact of LCAT deficiency on soluble and aggregated Aβ levels as well as parenchymal and vascular amyloid burden in the APP/PS1 model of AD. We also assessed the impact of aging and Aβ accumulation on LCAT expression and activity. Here we report that protein levels and plasma activity of LCAT are not altered by age and/or Aβ accumulation and that neither Aβ nor amyloid levels are increased in the absence of LCAT. We conclude that LCAT-mediated cholesterol esterification and maturation of apoE-containing lipoproteins in the CNS is not required for apoE’s role in Aβ metabolism.  79  3.3 Methods 3.3.1 Animals APP/PS1 mice (Jackson Laboratories) were crossed with LCAT-/- animals followed by one backcross to generate male APP/PS1 LCAT-/- mice, which were analyzed at 15-16 months of age. Additional studies were performed on male APP/PS1 mice between 5-16 months of age. Animals were maintained on a standard chow diet (PMI LabDiet 5010).   3.3.2 CSF, Plasma, and Tissue Collection Procedures were performed as described in 2.3.5.  3.3.3 Plasma Lipid and Lipoprotein Analysis Plasma HDL-cholesterol (HDL-C) was determined using commercially available kits (Wako) according to the manufacturer’s instructions. Plasma lipoprotein species were further analyzed by separating them based on size and charge and staining for lipids using Sudan Black. Hydragel 15 Lipoprotein(E) kits (Sebia, 4134) were purchased from Sebia, Inc. 10 µl of plasma was loaded into each  well of the applicator and left at room temperature for 5min . A Hydragel 15 Lipoprotein(E) gel was quickly blotted with thin filter paper to absorb excess liquid on the surface of the gel according to manufacturer’s instructions. After the 5min loading period, the applicator was placed perpendicular to the Hydragel, 3-4 cm from the bottom of the gel, After a 10 min application of sample to the gel, the applicator was removed and the gel was subjected to electrophoresis in 1X barbital buffer (Sigma, B5934-12VL, 1 vial dissolved in 1l distilled water) in a Titan Gel electrophoresis apparatus (Helena Laboratories) with 25 ml Barbital Buffer per side.The gel was run for 40min at 100 V using a BioRad PowerPac 100 power supply. After the run, the gel was placed in Fixing Solution (3% methanol, 57% ethanol and 10% glacial acetic acid in distilled water) for 10 min. The gel was then dried in a 60oC oven (3 h – overnight), incubated in staining solution (54% ethanol in distilled water containing 200 µl Sudan Black per 40 ml final volume) for 10 – 15 min, destained in Discoloring Solution (45% Ethanol in distilled water) for 5 min, and then dried in a 60oC oven for 10 min.  80  3.3.4 Plasma LCAT Activity Assay LCAT activity in plasma was assayed as described before596 with modifications.597 Briefly, artificial substrate for LCAT, [1,2-3H(N)]-cholesterol (Perkin Elmer, NET139001MC)  labeled liposomes were prepared as previously described.597  Each plasma sample was analyzed in triplicate using 2 µl per measurement. Tubes with 60 µl of labeled liposomes and 2 µl of plasma were incubated for 30 min at 37°C, after which the reaction was stopped by 1 ml of cold ethanol. Tubes were kept at −20 °C for 2-12 h and then centrifuged at 13,000 × g for 10 min at 4 °C. The supernatant was evaporated in a SpeedVac and then dissolved in 30 µl of chloroform with addition of unlabeled cholesterol and cholesterol ester (CE) markers. Substrate and product of LCAT reaction were separated by thin layer chromatography using flexible silica polyester backed plates (Whatman, 4410221). The free cholesterol (FC) and cholesteryl oleate spots on the plates were localized by standard staining in the chamber with iodine vapor, then transferred into scintillation vials and counted. The results obtained were used to calculate the coefficient of esterification (ratio CE/FC) and specific LCAT activity in nmol/ml/h. In these calculations, the original amount of free cholesterol in the reaction was calculated as the cholesterol in liposomes plus free cholesterol taken with 2 µl of plasma.598   3.3.5 Protein Extraction A serial carbonate guanidine hydrochloride (GuHCl) extraction was conducted as described in 2.3.7. For measurement of LCAT, cortex and liver samples were homogenized in 8-volumes of ice cold RIPA lysis buffer containing cOmplete protease inhibitor (Roche Applied Science) in a Tissuemite homogenizer for 20 s, sonicated at 20% output for 10 s, and centrifuged at 8600 relative centrifugal force (rcf) for 10 min at 40C. Protein concentrations were determined using a BCA Assay (Pierce).  3.3.6 Immunoblotting Equal volumes of CSF (5 µl), plasma (1 µl) or tissue lysate (50-75 µg) were electrophoresed through 10% sodium dodecyl sulfate (SDS)- polyacrylamide gel electrophoresis (PAGE), transferred to polyvinylidene fluoride (PVDF) membranes (Millipore), probed with antibodies against apoA-I and apoE using conditions outlined in Appendix B   followed by horseradish 81  peroxidase (HRP)-conjugated secondary antibodies. For LCAT immunoblots, 1.5 µl of plasma was electrophoresed through Novex NuPAGE 4–12% Bis-Tris gels (Invitrogen) and proteins were transferred to PVDF membranes and probed against LCAT as outlined in Appendix B. Blots were developed using enhanced chemiluminescence (Amersham) and quantified by densitometry using ImageJ software (NIH). Protein levels were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or albumin and expressed as fold difference compared to controls. Each sample was analyzed at least in duplicate on independent gels.  3.3.7 Aβ ELISA Aβ enzyme-linked immunosorbent assays (ELISAs) were performed using commercial kits as outlined in 2.3.9.  3.3.8 Histology Five 25 m sagittal sections spaced approximately 300 µM apart spanning the entire length of the hippocampus were analyzed per animal. Sections were mounted on SuperFrost Plus glass slides (Fisher Scientific), immersed for 10min in 1% thioflavin S solution, washed with water, and coverslipped using Vectashield Hard Set mounting medium (Vector Laboratories). An additional two sections per mouse were first stained with resorufin, which selectively binds vascular amyloid.599 Sections were washed with PBS, permeabilized for 30 min in PBS containing 0.25% triton-X 100 (PBS-T), stained with 1 µM resorufin in PBS-T for 30 min, followed by 3 washes in PBS, 1 wash in 1:1 PBS and ethanol, and 3 washes in PBS. Sections were then mounted and stained with thioflavinS as described above. Images were taken using a BX61 fluorescent microscope (Olympus) and quantified using Image Pro (Media cybernetics) software. Amyloid within the area of interest (cortex, hippocampus, thalamus or cortical vessels) was identified by intensity-level threshold. Amyloid load (defined as the sum of thioflavin S positive area /total area analyzed X 100) was calculated for each section and then averaged across sections for each individual mouse. Total amyloid (parenchymal + vascular) was measured using thioflavin S while vascular amyloid in the cortex was measured using both thioflavin S and resorufin.  82  3.3.9 mRNA Extraction and qRT PCR Liver and brain cortex tissue were homogenized in Trizol with a Precellys24 homogenizer and RNA was extracted and purified with a PureLink Mini Kit followed by quantification using a nanodrop spectrophotometer at 260 nm. Absorbance at 230 and 280 nm was also measured to determine nucleic acid purity. One µg of RNA was reverse-transcribed to complementary deoxyribonucleic acid (cDNA) by TaqMan Reverse Transcriptase Reagents Kit (Life Technologies) and 40 ng of cDNA was used for quantitative polymerase chain reaction (qPCR) reaction. LCAT gene expression in liver and brain cortex was evaluated through Real Time (RT) PCR assay by TaqMan method. Mm00500505_m1 probe (Life Technologies) was utilized for LCAT evaluation and β-actin was utilized as housekeeping gene (4352341E probe, Life Technologies). Data were calculated by the comparative CT (ΔΔCT) method with normalization of the raw data to β-actin and expressed as fold-change relative to the 5 month old APP/PS1 mice prior to amyloid deposition.   3.3.10 Statistical Analysis Data were analyzed by either an unpaired two-tailed students t-test or One Way analysis of variance (ANOVA) followed by a Bonferroni post-test for normally distributed data or a Mann Whitney test or Kruskal-Wallis test followed by a Dunns Multiple Comparison test for nonparametric data performed by GraphPad Prism v5.0.  3.4 Results 3.4.1 LCAT Expression and Plasma Activity is not Affected by Aging or the Onset of Amyloid Deposition in APP/PS1 Mice As there has been a single report of decreased CSF LCAT activity in human AD subjects 349, we first determined if age and/or the presence of Aβ deposits impacts LCAT expression or activity in APP/PS1 mice. As amyloid deposition and behavioural deficits have been reported to start between 6-8 months of age in this line, we analyzed male APP/PS1 mice at 5 months of age, prior to disease onset, at 11 months of age, where mice demonstrate moderate pathology, and at 15.5 months of age, the age of the mice used in this study when pathology is very pronounced. Neither liver nor cortical LCAT mRNA was significantly changed with age (Figure 3.2A). We  83   Figure 3.2 Expression, levels and plasma activity of LCAT is unaffected by age or the accumulation of Aβ and amyloid. LCAT mRNA, protein levels, and activity in addition to plasma apoA-I levels were measured in 5, 11, and 15.5m old male APP/PS1 mice. Plasma from young LCAT-/- mice, denoted as simply -/-, was used as a reference control. LCAT mRNA in the A) liver and cortex of APP/PS1 mice were measured by qRT-PCR. B) Plasma LCAT protein levels were measured by denaturing immunoblotting. C) Plasma levels of apoA-I were measured by denaturing immunoblotting. D) The activity of plasma LCAT was measured by determining the coefficient of esterification, defined by the ratio of cholesterol ester: free cholesterol, following incubation of plasma with 3H-cholesterol labeled liposomes. E) Plasma αHDL levels were quantified as a secondary measure of LCAT activity. Plasma samples were subjected to native gel electrophoresis through Sebia gels and stained with Sudan Black, which binds to lipids. Purified human HDL and LDL were run for comparison. Graphs represent mean ± SEM with an N= 3-10 per group. Data was analyzed using a Kruskal-Wallis Test followed by a Dunn’s Multiple Comparison Test.  next measured the total circulating levels of plasma LCAT and apoA-I, which is the major physiological activator of LCAT in plasma. There was a non-significant 27% increase in plasma LCAT levels and a non-significant 36% increase of plasma apoA-I (data not shown) in 15.5 month-old APP/PS1 mice compared to 5 month old APP/PS1 mice (Figure 3.2B). However, plasma LCAT activity, measured directly using artificial liposome substrates ex vivo (Figure 3.2D), and measured indirectly by quantifying the relative abundance of plasma  C DAβpreβα-/- 5m 15.5m11mB-/- 5m 15.5m11mLCATPlasmaPlasma84   Figure 3.3 Deletion of LCAT in APP/PS1 mice significantly reduces HDL-C, specifically α-migrating particles A) Plasma apoA-I protein levels were measured by denaturing immunoblotting. B) Total plasma HDL-C was measured using a commercial enzymatic kit. C) Plasma samples were subjected to native gel electrophoresis through Sebia gels and stained with Sudan Black, which binds to lipids. Purified human HDL and LDL were run for comparison. Graphs represent mean ± SEM with an N 5-6 per group. Data was analyzed using A) Mann-Whitney test and B) Student’s unpaired t-test.  α-migrating HDL (Figure 3.2D), was unaffected by age or the onset of amyloid deposition. Although it would have been ideal to measure LCAT activity in the CSF of these animals, these experiments are not feasible due to the low yield of CSF and dilute LCAT levels in CSF.    3.4.2 LCAT Deficiency Selectively Reduces Plasma and CNS ApoA-I Next we analyzed plasma lipoprotein levels and distribution following total body deletion of LCAT from male APP/PS1 mice. As expected, plasma apoA-I and total HDL-C were dramatically reduced to 14% and 8% of APP/PS1 wild-type (WT) littermate control levels (Figure 3.3A, B). Plasma lipoprotein subspecies were further characterized by separating whole plasma using Sebia gels, which separate lipoprotein particles based on surface charge, followed by Sudan black staining to detect lipids. As expected, deletion of LCAT from APP/PS1 mice results in an almost complete absence of mature α-migrating HDL and an enrichment of lipoproproteins at the gel origin, which most likely includes chylomicrons (Figure 3.3C).591 These results are consistent with previous characterization of young male LCAT-/- mice on a C57Bl.6 background,592 indicating that advanced age and the onset of amyloid pathology does not influence the robust plasma lipoprotein phenotype induced by LCAT deficiency. apoA-IalbuminA BβpreβαWT LCAT-/-CAPP/PS185   Figure 3.4 CNS ApoA-I is significantly reduced in APP/PS1 LCAT-/- mice. Protein levels of A) apoA-I and B) apoE were measured by denaturing immunoblotting in cortical (far left), and hippocampal (centre) lysates in addition to CSF (far right). Values are expressed for each region compared to APP/PS1 WT controls. Graphs represent mean ± SEM with an N= 3-6 per group, except for CSF where an N= 2 per group was used. Data was analyzed using a Student’s unpaired t-test (cortical apoA-I) or Mann Whitney test (hippocampal apoA-I).  We then assessed the impact of LCAT deficiency on the levels of apoA-I and apoE-containing lipoprotein particles in the CNS. While apoA-I is considered the major physiological  activator of LCAT in the plasma,591 this role is believed to be filled by apoE in the CNS.594 In parallel to the observations in plasma, the level of apoA-I in the cortex, hippocampus, and CSF of APP/PS1 LCAT-/- mice were reduced to 30% (p<0.0001), 10% (p=0.0571), and 11% of APP/PS1 WT littermate controls (Figure 3.4A). Conversely, loss of LCAT did not affect apoE  levels in either brain tissue or CSF (Figure 3.4B). Further, the size and distribution of apoE-containing lipoprotein particles in CSF were similar between APP/PS1 WT and APP/PS1 LCAT-/- mice (Figure 3.7). Lastly, we investigated whether LCAT deficiency impacts CNS expression of key receptors involved in cholesterol and lipoprotein metabolism, namely ABCA1, LDLR, LRP-1 and scavenger receptor BI (SR-BI) (Figure 3.8). The absence of LCAT has no effect on cortical and hippocampal levels of ABCA1 and LRP-1 (Figure 3.8A, C), but was associated with a 40% increase in hippocampal LDLR levels (Figure 3.8B; p=0.0317) and a 71% decrease in hippocampal SR-BI (Figure 3.8; p=0.0357).  apoEGAPDH/albumin+/+ -/-+/+ -/- +/+ -/-apoA-I+/+ -/- +/+ -/- +/+ -/-GAPDH/albuminA BLCAT LCAT86   Figure 3.5 Loss of LCAT does not have a substantial effect on levels of soluble or insoluble Aβ40 or Aβ42 in the cortex or hippocampus. Levels of carbonate soluble A) Aβ40 B) Aβ42 and GuHCl soluble C) Aβ40 and D) Aβ42 were measured by commercial ELISA. Graphs represent mean ± SEM with an N= 5-6 per group. Data was analyzed using a Mann Whitney test.   3.4.3 Aβ and Amyloid Deposition are not increased by Loss of LCAT in APP/PS1 Mice If LCAT-mediated lipoprotein maturation is required for efficient Aβ clearance, we hypothesized that LCAT deficiency would elevate Aβ levels and amyloid burden in vivo. Overall, no consistent and significant changes were observed in either soluble or aggregated Aβ levels or in total or vascular amyloid burden (Figure 3.5;Figure 3.6). In contrast to the expected observation of increased Aβ levels, we were surprised to find a 46% decrease (p=0.0173) in cortical levels of carbonate soluble Aβ42 in APP/PS1 LCAT-/- mice, albeit this was the only significant change detected for Aβ levels (Figure 3.5). Notably, the ratio of Aβ40:Aβ42 was increased by 70% in carbonate and guanidine soluble cortical lysates (p=0.0357 carbonate soluble, p=0.1181 GuHCl soluble) and by 130% in guanidine soluble hippocampal lysates (p=0.0087). Histological analysis using thioflavin S, which detects total amyloid, and resorufin staining, which specifically binds to vascular amyloid,599 revealed no change in total or cerebrovascular amyloid burden between APP/PS1 WT and APP/PS1 LCAT-/- mice (Figure 3.6).  A BC D87   Figure 3.6 Parenchymal and vascular amyloid deposition is independent of LCAT in APP/PS1 mice. Representative images taken at 100x of coronal half brain sections from A) APP/PS1 WT and B) APP/PS1 LCAT-/- stained with thioflavin S (thioS) to visualize total amyloid deposition. Scale bar represents 2 mM C) Amyloid burden is expressed as percent % of total area measured, in the cortex (Cx), hippocampus (Hp) and thalamus (Th). Graphs represent mean ± SEM with an N= 4-5 per group and 4-5 sections per mouse. A subset of sections was further co-stained with thioflavin S (green) and resorufin (red), which binds only to vascular amyloid. Representative images taken at 100x of coronal half brain sections from D) APP/PS1 WT and E) APP/PS1 LCAT-/- showing parenchymal (arrow) and vascular (arrowhead) amyloid deposition in the cortex. Scale bar represents 200 µm F) Quantification of vascular amyloid burden in the cortex expressed as percent of cortical area using either thioflavin S or resorufin. Graph represents mean ± SEM with an N= 3-6 per group. For each animal, 2-4 sections were analyzed and averaged such that each N represents an independent animal.    3.5 Discussion Although LCAT is well characterized with respect to its impact on peripheral HDL metabolism,591 little is known about its function in the CNS. While the initial lipidation of glial-derived apoE by ABCA1 is a critical determinant in its ability to mediate Aβ degradation and clearance,368, 371, 376 it is unknown whether the generation of the cholesterol ester core by LCAT  A B CAPP/PS1 WT APP/PS1 LCAT-/-DEFResorufin MergeThioS88  is also required. Our data show that total body deletion of LCAT, which blocks HDL lipoprotein maturation, does not significantly impair Aβ or amyloid deposition in APP/PS1 mice (Figure 3.5;Figure 3.6). This finding provides strong support for the hypothesis that Aβ clearance is mediated by nascent discoidal rather than mature spherical CNS and circulating lipoproteins. As  APP/PS1 mice develop vascular amyloid deposits much later than parenchymal deposits, we specifically designed our study to investigate Aβ and amyloid load at 15 months of age when both total and vascular deposits are robust. However, we cannot rule out the possibility that LCAT deficiency may have altered the age of onset of Aβ or amyloid deposition.   One major finding of this study is that neither age nor the presence of amyloid deposits affects LCAT expression in liver and cortex, plasma LCAT levels or plasma LCAT activity in the APP/PS1 mouse model (Figure 3.2). In contrast, a 50% decrease in CSF LCAT activity in human AD subjects compared to age-matched non-demented controls has been previously reported.349 Although it would be ideal to measure LCAT activity in the CSF of APP/PS1 mice, the small volume of CSF (approximately 10 ul per mouse) obtained from mice and predicted LCAT levels and activity (2.5% of that in serum) pose significant challenges to this experiment.349 Future studies will be needed to determine if CSF LCAT levels are consistently reduced in AD subjects and, if so, whether this is correlated with other AD-relevant CSF biomarker changes including Aβ and tau. As APP/PS1 mice do not develop neurofibrillary tangles nor marked neurodegeneration, these mice may not model all of the components of AD pathology that may act in concert to suppress LCAT activity in human CSF.  It is also important to note that both apoE and apoA-I lipoproteins may affect Aβ and amyloid metabolism. Lefterov et al. previously reported a robust and specific increase of cerebrovascular amyloid angiopathy (CAA) in 12-month old APP/PS1 mice that were crossed onto a total apoA-I knockout background,28 suggesting that apoA-I specifically affects vascular amyloid levels. We observed no change in vascular amyloid burden in APP/PS1 LCAT-/- mice (Figure 3.6F), despite a 70-90% reduction in plasma and CNS apoA-I (Figure 3.3A; Figure 3.4A). However, LCAT-deficient mice are not equivalent to apoA-I deficient mice, as approximately 10% of apoA-I remains in the absence of LCAT and much of this apoA-I is believed to be in the pre-β form.341, 592 It is therefore possible that pre-β apoA-I HDL is more important or more efficient than α-HDL with respect to amyloid clearance within the 89  cerebrovasculature. Although not specifically measured in our study, there have been previous reports of increased plasma pre-β HDL in LCAT-deficient mice341, 592 and in human subjects with mutant LCAT alleles resulting in increased ABCA1-mediated cholesterol efflux.600 Given these results, additional research will be required to further delineate Aβ clearing and potential vasoprotective properties of pre-β apoA-I HDL to allow for therapies targeted at enhancing the levels or function of this specific subpopulation of lipoprotein particles.   3.6 Supplemental Information 3.6.1 Supplemental Methods 3.6.1.1.1 Immunoblotting Native immunoblotting for apoE in CSF was conducted by running 10 µl of CSF through 6% native PAGE, transferring to a PVDF membrane (Millipore) and probed with antibodies against apoE and albumin using the conditions outlined in Appendix B.  For detection of ABCA1, LDLR, LRP-1, and SR-BI, equal amounts of tissue lysate (50-75 µg) were electrophoresed through 10% SDS-polyacrylamide gels, transferred to PVDF membranes (Millipore), probed using the antibodies outlined in Appendix B. Blots were developed and quantified as described in 3.3.5.  3.6.2 Supplemental Figures  17.7nm12.2nm8.1nm7.1nm+/+ +/+-/- -/- LCATAPP/PS1apoEalbuminmale female90  Figure 3.7 Size and distribution of apoE-containing lipoprotein particles in the CSF of 15-16m old male and female APP/PS1 WT (+/+) and LCAT-/- (-/-) mice. CSF lipoprotein particles were separated by size, specifically diameter, under non-denaturing conditions via native-PAGE and probed with an apoE antibody (top panel) and albumin antibody (bottom panel), used to demonstrate equal loading. ApoE-particles <7.1nm are classified as ‘lipid-poor’.    Figure 3.8 Protein levels of ABCA1, LDLR, LRP, and SR-BI in the cortex and hippocampus of 15-16 month old male APP/PS1 WT and LCAT-/- mice. Equal amounts of carbonate soluble cortical and hippocampal lysates were subjected to denaturing-PAGE and immunoblotting and quantified using densitometry. Graphs represent mean ± SEM for A) ABCA1 B) LDLR C) LRP-1 and D) SR-BI with an N= 5-6 per group with the exception of hippocampal SR-BI APP/PS1 LCAT -/- where an N= 3 was used. Statistics were determined using a Mann-Whitney test.   91  Chapter 4: ApolipoproteinA-I in the Central Nervous System: Transport and Therapeutic Development 4.1 Summary Cerebrovascular dysfunction contributes significantly to the pathoetiology of Alzheimer’s disease (AD). Midlife vascular risk factors, such as hypertension, cardiovascular disease, diabetes, and dyslipidemia, increase the relative risk for AD. These comorbidities are all characterized by low and/or dysfunctional high-density lipoprotein (HDL), which itself is a candidate risk factor for AD. In addition to lipid transport, HDL enhances vasorelaxation, reduces inflammation and oxidative stress, and promotes endothelial cell survival and integrity. In mouse models of AD, apolipoprotein (apo) A-I, the primary protein component of HDL, reduces neuroinflammation, suppresses cerebrovascular β-amyloid (Aβ) deposition, and protects cognitive function, making it an intriguing potential therapeutic target. Although only produced by the liver and intestine, apoA-I is abundant in cerebrospinal fluid (CSF) and detectible in brain tissue lysates, suggesting it can enter the central nervous system (CNS) by a currently unknown mechanism. Here we report that in mice, human apoA-I (hapoA-I) injected intravenously rapidly and strongly localizes to the lateral cerebral ventricle where it found within the epithelial cells of the choroid plexus. HapoA-I accumulates in the brain for 2 hours (h), after which it is eliminated with a half-life of 10.3h. In vitro, hapoA-I is specifically bound, internalized and transported across confluent monolayers of primary human choroid epithelial cells. Although intravenous injection of CSL-111, a form of reconstituted HDL containing apoA-I and phosphatidylcholine (PC), results in a significant 50% reduction of plasma Aβ40 24h after injections, neither soluble nor insoluble pools of Aβ were altered in the brains of symptomatic AD mice following 4 weekly injections. We also observed a non-significant decrease in endothelial nitric oxide synthase (eNOS) and vascular cellular adhesion molecule 1 (VCAM-1) in the brains of APP/PS1 mice injected with CSL-111 compared to saline controls, warranting further research into potential abilities to reduce cerebrovascular endothelial activation and inflammation.    92  4.2 Introduction Plasma HDL is an extremely heterogeneous class of lipoproteins that comprises over 200 individual lipid species and over 80 different proteins in normolipidemic plasma.601, 602 HDL is best known for its pivotal role in reverse cholesterol transport, in which cholesterol is removed from peripheral tissues and transported back to the liver for excretion into the bile. However, HDL and its principal protein component, apoA-I, also possess several potent vasoprotective properties, including stimulating endothelial repair, inhibiting inflammation, suppressing endothelial cell apoptosis and platelet aggregation, and preventing lipid oxidation.311  Despite comprising only 2.5% of body mass, the highly vascularized brain consumes 20% of the body’s cardiac output, 20% of oxygen consumption and 25% of glucose consumption.3 Cerebrovascular dysfunction is increasingly recognized to contribute to the pathogenesis of several neurological disorders, including AD. Most AD patients have biochemical, morphological, and functional changes to the cerebrovasculature, including accumulation of amyloid in cerebral blood vessels, which is known as cerebral amyloid angiopathy (CAA), in addition to the parenchymal amyloid plaques and neurofibrillary tangles that define AD.3, 19 Furthermore, several comorbidities that increase AD risk, including hypertension, stroke, hypercholesterolemia, cardiovascular disease (CVD), and type II diabetes mellitus (T2DM)1, 4 all converge upon vascular dysfunction. Intriguingly, HDL function is also impaired in many of these comorbidities.8-12 While therapeutic efforts targeted at increasing the quantity and/or improving the quality of HDL for use in various forms of CVD are being extensively explored,12, 472 whether the same principles can be applied to AD remains untouched. One such approach is to directly augment apoA-I and/or HDL by infusing recombinant or reconstituted apoA-I or HDL. CSL-111 consists of native apoA-I purified from human serum combined with soy PC at a ratio of 1:150, resulting in two discoidal particle populations following reconstitution; one with a ratio of 1:100 that measures 12.6 ± 2.8 nm and a second with a ratio of 1:200 that measures 17.7 ± 4.2 nm.484 Intravenous infusion of CSL-111 increases plasma HDL cholesterol (HDL-C), specifically immature preβ HDL likely through generation of smaller HDL in vivo from the injected particle, and enhances both ATP binding cassette (ABC) transporter A1 (ABCA1) and scavenger receptor B-I (SR-BI) mediated cholesterol efflux ex vivo.603-605 Clinical trials involving either a single or 4 93  weekly infusions of CSL-111 yielded significant improvements in the atherosclerotic plaque characteristic index and coronary score compared to baseline in coronary artery disease (CAD) patients,485 reductions in atherosclerotic plaque lipid and VCAM-1 expression in patients with a lesion in the superficial femoral artery,395 and reduced platelet aggregation606  and increased the anti-inflammatory properties of HDL607 in T2DM patients. In addition, a recent publication by De Nardo and Latz et al. identified the ability of CSL-111 to substantially attenuate inflammation via induction of the transcriptional regulator ATF3 in immune cells which decreases the expression and secretion of toll-like receptor (TLR)-induced pro-inflammatory cytokines.479 Given its ability to enhance pre-β HDL levels and improve HDL function, CSL-111 may also have possible marketing potential as a therapeutic strategy for AD. The specific aims of this study were two-fold: first, characterize the route by which circulating apoA-I gains access to the CNS and its turnover once there and second, determine whether CSL-111 produces any beneficial effects with respect to Aβ metabolism, neuroinflammation, or cerebrovascular activation in the APP/PS1 mouse model of AD. Following intravenous injection in young C57Bl/6 mice, hapoA-I rapidly targets the choroid plexus where it is found within the choroidal epithelium. Our data show that, in vitro, hapoA-I is specifically bound and transported across primary human choroid plexus epithelial cells (hCEpiC), suggesting that hapoA-I enters the CNS primarily by crossing the blood-CSF barrier (BCSFB). While plasma Aβ40 is specifically reduced by up to 50% 24h following injection with CSL-111, Aβ and amyloid within the CNS were unchanged following 4 weekly injections of CSL-111 in symptomatic APP/PS1 mice.   4.3 Methods 4.3.1 Animals C57Bl/6 and apoA-I-/- mice (Jackson Laboratories) were used at 3-5 months of age. APP/PS1 mice (Jackson Laboratories, line 85) co-express two transgenes from the murine prion promoter: a chimeric mouse/human APP650 cDNA containing the Swedish (K670M/N671L) mutations, and the human PS1 gene deleted for exon 9. APP/PS1 mice are maintained on a mixed C3H/H3J C57Bl/6 background. Experiments were designed such that APP/PS1 mice and aged-matched 94  non-transgenic littermate controls were sacrificed at 12.6 months (range 12.3-13.0 months). All animals were maintained on a chow diet (PMI LabDiet 5010).   4.3.2 ApoA-I and HDL Preparation 4.3.2.1 Recombinant HapoA-I  HapoA-I was expressed in Escherichia coli (E.coli) from plasmids encoding full length hapoA-I containing an N-terminal histidine tag and one of five C-terminal cysteine substitution mutations (S231C, K239C, L240C, T242C, or Q243C). Protein was purified with a His-trap chelating column (GE Healthcare), equimolar amounts of each mutant were pooled and endotoxin was removed using EndoTrap Red Endotoxin Removal Column (Hyglos). Final endotoxin levels were <10 EU/mg as measured by Limulus Amebocyte Lysate Kinetic-QCL Assay (Lonza Bioscience). For in vivo and in vitro experiments, hapoA-I was labeled using Alexa Fluor®647 C2  maleimide following the manufacturer’s instructions (Invitrogen; A-20347) at a molar ratio of 1:1. For in vitro cell association, binding, and transport assays, hapoA-I was radiolabeled with 125I as previously described.608 Briefly, 1 mg of apoA-I was incubated with 37 mCi of iodine and 0.5 ml of iodobeads (Pierce) for 15min at room temperature and separated using size-exclusion chromatography.  Assays were performed with 5 µg/ml of 125I-hapoA-I.  4.3.2.2 Serum-derived HapoA-I Lipid-poor hapoA-I, derived from the serum of healthy human donors, was provided by CSL Behring. For experiments using fluorescence, hapoA-I was labeled with Alexa Fluor®488 carboxylic acid, tetrafluorophenyl ester using a commercial kit according to the manufacturers’ instructions (Invitrogen; A-10235).  4.3.2.3 CSL-111 CSL-111, provided by CSL Behring, is composed of purified serum derived hapoAI and soybean PC, combined at a molar ratio of 1:150.485 The preparation was supplied as a lyophilized powder that was stored at -20°C protected from light until use. The lyophilized powder was solubilised in sterile double distilled tissue culture grade water, yielding a 25 mg/ml stock. Following 95  solubilisation, small aliquots were made and frozen at -20°C until use to minimize free-thaw cycles.  4.3.3 Intravenous Injections 4.3.3.1 C57Bl/6 Mice For dose response studies, mice were injected with 7.5 – 120 mg/kg of Alexa647-hapoA-I or saline. Tissue was collected 2h post-injection. For timecourse studies, mice were injected with 60 mg/kg Alexa647-hapoA-I and tissue was collected 0.5 – 24h post injection. In a subset of studies, blood from the tail vein was taken 1min post injection to determine experimental T=0 plasma hapoA-I concentration.  4.3.3.2 APP/PS1 Mice For timecourse studies, 12.6 month old transgenic APP/PS1 mice were injected with 60 mg/kg of CSL-111 or saline. Blood samples were taken from the saphenous vein 1, 4, and 8h post injection. Twenty-four hours after injection tissue samples were collected. For therapeutic studies, 11.6 month old transgenic and non-transgenic littermate control APP/PS1 mice were injected once a week for 4 weeks with either saline or 60 mg/kg CSL-111. Immediately prior to the first injection and 24h after injection blood was taken from the saphenous vein. On day 30, one week after the 4th injection, mice were fasted for 4h and tissue was collected as described below.  4.3.4 CSF, Plasma, and Tissue Collection Mice were anesthetized with 20 mg/kg xylazine (Bayer), 150 mg/kg ketamine (Bimeda-MTC) intraperitoneally. CSF was isolated from the cistern magna as described370, and only samples that contained < 20 red blood cells per mm3 were used for subsequent analyses. Ethylenediaminetetraacetic acid (EDTA) blood was collected via cardiac puncture, centrifuged at 21000 relative centrifugal units (rcf) for 10 minutes (min) at 20 °C and stored at -80 °C. Animals were perfused for 7min at 8 ml/min with phosphate buffered saline containing 2,500 U/l heparin. Tissues (liver, kidney, and brain) were removed, weighed, and snap frozen at -80 °C. Half of the 96  brain was fixed in 10% neutral buffered formalin followed by cryoprotection in 30% sucrose prior to cryostat sectioning for histological analysis.  4.3.5 Protein Extraction For murine apoA-I, tissues were homogenized in 8 volumes of ice-cold radioimmunoprecipitation assay (RIPA) buffer, sonicated at 20% output for 10s, and then centrifuged at 8600 rcf for 10min at 4 °C. For hapoA-I enzyme linked immunosobent assays (ELISAs), tissues were homogenized in 2-volumes of ice-cold phosphate buffered saline (PBS) containing a cOmplete protease inhibitor tablet (Roche Diagnostics), and sonicated at 20% output for 10s. For APP/PS1 mice, half brains were extracted with 8 volumes of ice-cold carbonate buffer (100mM Na2CO3, 50 mMNaCl, pH 11.5) containing cOmplete protease inhibitor (Roche Applied Science) in a Tissuemite homogenizer at full speed for 20s and then sonicated at 20% output for 10s. After incubating on ice for 10min, lysates were clarified by centrifugation at 16,600 rcf for 45min at 4 °C. The supernatant (carbonate-soluble fraction) was removed and neutralized by adding approximately 1.5-volumes of 1 M Tris pH 6.8 to give a final pH of approximately 7.4. The pellet (carbonate insoluble fraction) was resuspended in 8 volumes of 5 M guanidine hydrochloride in 50mM Tris-HCl (GuHCl), pH 8.0, at room temperature for 2.5–3h with continuous rotation to evaluate plaque-associated Aβ. Brain tissue from all animals was extracted in an identical manner, and all fractions were aliquoted and immediately frozen at -80 °C until analysis. Protein concentrations were determined using BCA Protein Assay (Pierce).  4.3.6 Immunoblotting Equal volumes of CSF (5 µl), plasma (1-5 µl) or tissue lysate (150-200 µg) were subject to denaturing immunoblotting using 10% sodium dodecyl sulfate (SDS)- polyacrylamide gel electrophoresis (PAGE). Following electrophoretic transfer to polyvinylidene fluoride (PVDF) membranes (Milipore), immunoblots were probed using the antibody conditions outlined in Appendix B in conjunction with horseradish peroxidase (HRP)-conjugated secondary antibodies. Blots were developed using enhanced chemiluminescence (Amersham) and quantified by densitometry using ImageJ software (NIH). Protein levels were normalized to glyceraldehyde 3-97  phosphate dehydrogenase (GAPDH) or albumin and expressed as fold difference compared to controls. Each sample was analyzed at least in duplicate on independent gels.  4.3.7 ELISAs HapoA-I in plasma, CSF, and tissue lysates was quantified using commercial ELISAs from Alerchek (A70101) for work done with recombinant hapoA-I or from MABtech (3710-1HP) for work done with serum derived hapoA-I. Human Aβ40 and Aβ42 were measured in half brains serially extracted with carbonate and GuHCl using commercial kits from Invitrogen (KMB3482, KMB3442). Levels of interleukin (IL) 1β (IL-1β), IL-6, and tumor necrosis factor (TNF)-α were measured in half brain carbonate extracted using commercial kits from R&D (555240; 559603; 555268). For tissue and cells data was normalized to total protein concentration.  4.3.8 Imaging and Histology 4.3.8.1 Maestro Fluorescent Imaging Image cubes of intact fixed half brains were collected using an excitation filter of 575-605 nm, emission filter 645 nm and acquisition settings of 630-850 nm collected in 10 nm steps (Maestro Imaging system, PerkinElmer). Images were unmixed using real component analysis and quantified using threshold segmentation.   4.3.8.2 Immunohistochemical Detection of hapoA-I, IgG, Lectin For immunohistochemical analysis, three to four 25-40 m sagittal sections spaced 500 µm apart were analyzed per animal. Floating sections were blocked for 1h with 5% normal goat serum in PBS, stained with Cy3- anti-mouse immunoglobulin G (IgG) for 36-48h at 4 °C, washed with PBS and stained overnight with fluorescein-conjugated tomato lectin to visualize endothelial and epithelial cells. For antibody specifics see Appendix B. Sections were washed with PBS and mounted on SuperFrost Plus glass slides (Fisher Scientific) using Vectashield Hard Set mounting medium (Vector Laboratories). Images were taken using a BX61 fluorescent microscope (Olympus) and quantified using Image Pro (Media cybernetics) software using the following filters: Alexa488 for fluorescein; TexRed for Cy3; and Cy5 for Alexa647. Confocal images were taken with a Leica SP5 microscope using the following settings: Fluorescein was excited with an 98  Argon laser at 458 nm, emission 500-560 nm; Cy3 was excited with a HeNe laser at 545 nm, emission 550-650 nm; Alexa647 was excited with a HeNe laser at 633 nm, emission collected 650-720 nm. Images were analyzed using LAS Lite software (Leica).   4.3.8.3 Measurement of Amyloid Burden using Thioflavin S and Resorufin Three 25 µm coronal sections spaced ~250-300 µm starting from the hippocampus were chosen for histological quantification of parenchymal and vascular amyloid burden by co-staining with thioflavin S and resorufin as described in Chapter 3.3.7.   4.3.8.4 Immunohistological Detection of Microglia and Astrocytes Half-brains from 12.5 month old APP/PS1 mice given 4 weekly intravenous injections of saline or 60 mg/kg CSL-111, or aged matched non-transgenic APP/PS1 littermate controls injected with saline were sectioned on a cryostat to yield 25 µm coronal sections. Two to three sections per mouse spaced approximately 250-300 µm apart were chosen for analysis. Sections were blocked with 5% normal goat serum (NGS) in PBS for 1h, incubated with primary antibody overnight at 4ºC, washed 4 times 5min in PBS, followed by a 1h incubation in 1:200 Cy5-conjugated donkey anti-rabbit IgG (Jackson ImmunoResearch, 711-175-152). Stained sections were then washed 4 times 5min in PBS and mounted onto Superfrost Plus glass slides (Fisher Scientific, 12-550-15) using Vectashield Hard Set mounting (Vector Laboratories, H-1400) and imaged at 100x using a BX61 upright fluorescent microscope (Olympus) using the TexRed filter set. For details regarding primary antibodies see Appendix B.   4.3.9 Primary Human Choroid Plexus Epithelial Cell (hCEpiC) Culture and HapoA-I Binding and Transport Studies Primary hCEpiC (Science Cell Research Laboratories) were cultivated using epithelial cell medium supplemented with epithelial growth factor and 2% FBS (Science Cell Research Laboratories). For internalization assays, hCEpiC were seeded at 5 x104 cells per well onto rat-tail collagen-coated coverslips in 24-well dishes and grown until confluent (~2d). On the assay day, cells were washed once with DMEM containing 0.1% FBS (treatment media) and then incubated with 100 µg/ml Alexa647-hapoA-I in treatment media 1h at 37 °C. Cells were washed 99  twice with PBS, fixed in 3.75% paraformaldehyde for 30min and washed with 0.5M Tris HCl pH 8. After two additional PBS washes, cells were mounted in 0.1 M Tris-HCL, pH 9.5, and glycerol (3:7) containing 50 mg/ml of n-propyl gallate as anti-fading reagent containing 4',6-diamidino-2-phenylindole (DAPI) (1 ng/ml, Sigma) onto SuperFrost Plus glass slides (Fisher Scientific). Radiolabeling, cell binding, cell association and transport assays were performed as described.608 For cellular binding, hCEpiC were seeded at 8x104 cells per well in 12-well dishes in growth media and grown until confluent (~2d). On the assay day, cells were washed once and then incubated at 4 °C for 1h with 5 µg/ml of 125I-labeled hapoA-I alone, or competed with 40-fold excess of non-labeled hapoA-I or BSA in DMEM containing 0.2% lipid-free BSA and 10mM Hepes. For cellular association and transport studies, hCEpiC were seeded at 8-10x104 cells per well onto rat-tail collagen-coated 0.3 cm2 0.4 µm transwell inserts (Corning; 353095) in growth media. Barrier formation was confirmed by measuring permeability to 4 kDa FITC-dextran (permeability < 5 x10-6 cm/s). On the assay day, cells were washed once and then incubated at 37 °C for 1h with 5 µg/ml of 125I-labeled hapoA-I alone, or competed with 40-fold excess of non-labeled hapoA-I or BSA in DMEM containing 0.2% lipid-free BSA and 10mM Hepes. After 1h, cells were washed once with Tris wash buffer (50 mM Tris–HCl, 0.15 mol/l NaCl, pH 7.4) containing 2 mg/ml BSA followed by two quick washes with Tris wash buffer without BSA. Cells were then solubilized in 180 (transport) or 500 (binding) µl of 0.1 M NaOH for 30min at room temperature. Radioactivity in the cell lysate or basolateral media was measured using a Beckman γ-counter. The concentration of 125I-hapoA-I per well was normalized to total protein concentration (ng/mg), and then expressed relative to cells treated with 125I-hapoA-I alone for each experiment.  4.3.10 Kinetic Modeling The half-life of hapoA-I in plasma was determined by fitting the experimental data to a two compartment decay model using the following equation: P = Ae-αt + Be-βt. For tissue, data was normalized to initial values except for brain which peaked at 2h, and the first order elimination half-lives were determined form the slopes of lines fitted to the natural logarithm of normalized experimental data at different time points. The fitting of the equation to experimental data was done using Origin 7.0.  100   Figure 4.1 Steady state endogenous apoA-I levels in WT mice. A) Representative apoA-I immunoblots of plasma (Pl) and CSF from C57Bl/6 and apoA-I-/- mice. 5 µl of diluted plasma (1:4,000 to 1:32,000) and undiluted CSF were subjected to denaturing gel electrophoresis followed by immunoblotting. B) A standard curve was generated using serially diluted plasma to determine the relative amount of apoA-I in CSF by densitometry. Graphs represent mean ± SEM N=8 mice. C) 25-150 µg of liver (Lv), and 150 µg cortex (Cx), hippocampus (Hp) and cerebellum (Cb) lysates were subjected to denaturing gel electrophoresis followed by immunoblotting against apoA-I. D) Graphs represent mean ± SEM N=4 mice.  4.3.11 Statistics Normally distributed data were analyzed by one-way analysis of variance (ANOVA) with Bonferroni post-test. Non-parametric data was analyzed using a Kruskal Wallis test with Dunns post-test. All analyses were performed by GraphPad Prism v5.0.   4.4 Results 4.4.1 In Mice, Steady State Endogenous ApoA-I Levels in CSF and Perfused Brain Tissue are Approximately 0.01% and 10% of its Levels in Plasma and Liver, Respectively We started by quantifying the steady state levels of endogenous murine apoA-I in peripheral compared to CNS compartments in C57Bl/6 mice. As sensitive ELISAs for murine apoA-I are not commercially available, immunoblot analysis was used. Equal volumes of serially diluted plasma and undiluted CSF were compared (Figure 4.1). Liver lysates were similarly diluted and compared to lysates from cortex, hippocampus and cerebellum of well-perfused C57Bl/6 and apoA-I-/- mice (Figure 4.1C). Densitometric analysis shows that CSF levels of murine apoA-I  apoA-I-/-1:4000 1:8000 1:16000 1:32000 CSFapoA-IPlasmaCSFPlA BC DLv Cx Hp Cb Lv Cx150 100 50 25apoA-I-/-WTapoA-IGAPDHµg of protein101   Figure 4.2 Dose-dependent increase of Alexa647-hapoA-I in plasma, liver, kidney and brain Mice were injected with 7.5-120 mg/kg of Alexa647-hapoA-I. 2h post injection, tissue lysates were prepared from perfused mice. hapoA-I concentrations in A) plasma and perfused B) liver, C) kidney and D) brain determined by ELISA and normalized to total protein concentration for tissues. Graphs represent mean ± SEM with N= 2 (30 mg/kg), 4 (7.5 mg/kg), 5 (15 mg/kg), and 6 (60 and 120 mg/kg) mice.  are approximately 0.01 ± 0.003 % of plasma levels, and 10-15% of liver levels across three brain regions (Figure 4.1B,D). Extrapolating our results from a previous quantification of plasma apoA-I in C57Bl/6 mice (1.1 ± 0.1 mg/ml609), our data suggest that CSF apoA-I levels are ~0.11 µg/ml (Figure 4.1). As mRNA was absent from murine cortical tissue and primary hCEpiC (Figure 4.14), the apoA-I we detect in the CNS is most likely exclusively derived from the circulation following expression by the liver and intestine.  4.4.2 Intravenously Injected Alexa647-hapoA-I Shows Dose-Dependent Uptake  To study uptake of plasma-derived apoA-I into the CNS, mice were injected intravenously via the tail vein with 7.5 – 120 mg/kg Alexa647-hapoA-I and 2h after injection, plasma was collected, animals were perfused, and lysates were prepared from liver, kidney and brain tissues for hapoA-I quantification by ELISA. As expected, plasma levels of hapoA-I increase with increasing injected dose (Figure 4.2). In liver, the concentration of hapoA-I rapidly increases between 7.5 to 60 mg/kg and begins to plateau at 120 mg/kg (Figure 4.2B). In kidney, hapoA-I levels again show a direct relationship with injected dose, reflecting the role of the kidney in clearing lipid-poor apoA-I (Figure 4.2C). As only a small proportion of injected hapoA-I reaches the brain, the dose-dependency curve is more variable than for other tissues. Nevertheless, we observed that brain levels of hapoA-I reached roughly 1.5-2.5 ng/mg for animals injected at 15, 30 and 60 mg/kg, whereas injection at 120 mg/kg led to a further increase to 5.95 ± 1.08 ng/mg (Figure 4.2D). Peak concentrations of hapoA-I, after injection with 120  A B DC102   Figure 4.3 Dose-dependent accumulation of Alexa647-hapoA-I in cerebral ventricles and the choroid plexus. Mice were injected intravenously with saline or 7.5-120 mg/kg of Alexa647- hapoA-I. 2h post-injection, mice were perfused and half brains were fixed. A) Maestro fluorescent imaging of the intact fixed half brain. B) Quantification of the fluorescence using Maestro imaging. Raw signal was measured in photon x 106/cm2/s for each mouse and subsequently converted to fold difference with the saline injected control set to 1, allowing for combination of data from two independent experiments. Graphs represent mean ± SEM N= 2-6. C) 100x fluorescent images of sectioned brain tissue, showing accumulation of fluorescence in the choroid plexus of the lateral ventricle. Scale bar represents 500 µm. D) Regional quantification of Alexa647-hapoA-I in the choroid plexus expressed as positive % of total area. Graphs represent mean ± SEM N= 2-3 mice  mg/kg, reached 1260 ± 72 µg/mL in plasma, 0.083 ± 0.009 µg/mg in liver, and 0.142 ± 0.028 µg/mg in kidney (Figure 4.2A-C). Importantly, hapoA-I levels in brain are ~ 5-15 % of those found in liver, which is comparable to the relative steady-state levels for endogenous murine apoA-I (Figure 4.1D).  4.4.3 Intravenously Injected Alexa647-hapoA-I Rapidly Localizes to Cerebral Ventricles and the Choroid Plexus We next determined the regional distribution of Alexa647-hapoA-I within the CNS using semi-quantitative imaging. Maestro fluorescent imaging of intact half brains demonstrates dose-dependent accumulation of fluorescence within the cerebral ventricles between 7.5 and 120 mg/kg (Figure 4.3A, B) that was also observed within the choroid plexus when sagittal sections  A BDsaline 7.5 mg/kg 15 mg/kg 30 mg/kg 60 mg/kg 120 mg/kgC7.5 mg/kgDose hapoA-IDose hapoA-I15 mg/kg 30 mg/kg 60 mg/kg 120 mg/kgsaline103   Figure 4.4 Alexa647-hapoA-I is internalized by choroid plexus epithelial cells. Representative confocal images of the choroid plexus taken at 200x magnification from mice injected with A) saline or B) 60 mg/kg Alexa647-hapoA-I 0.5h post-injection. Sagittal sections were co-stained with lectin (green) to visualize endothelial and epithelial cells and Cy3-conjugated IgG (blue) as a plasma marker. The Alexa647 signal from hapoA-I is shown in red. Images are scaled to 50 % of the original size. C) Enlarged view of B) shown at full size for a selected region of each channel as depicted by the white box outline. Scale bar represents 50 µm  were examined by microscopy (Figure 4.3C, D). IgG is also visible within the choroid plexus, but does not show the dose-dependent accumulation observed for hapoA-I (Figure 4.15). To further investigate the localization within the choroid plexus, we performed confocal microscopy to determine the precise localization of Alexa647-hapoA-I compared to plasma IgG. In both saline and Alexa647-hapoA-I-injected mice, IgG staining is most intense within the fenestrated  A saline B 60mg/kg Alexa647 hApoA-IlectinIgGhapoA-ImergelectinIgGhapoA-ImergeC104   Figure 4.5 Alexa647-hapoA-I is retained in cerebral ventricles up to 6h after a single injection. A) Representative Maestro fluorescent images of perfused intact half brains 0.5-24h following intravenous injection with saline or 60 mg/kg of Alexa647-hapoA-I. B) Quantification of fluorescence in photon x 106/cm2/s was measured for each mouse and graphed following subtraction of background signal found in controls. Graphs represent mean ± SEM N= 2 (0.5h), 4 (2h), and 5 (6, 24h) mice.  vascular endothelium, with only faint extravascular staining visible (Figure 4.4A, B). In contrast, the Alexa647 signal is intensely localized within the epithelial cells of the choroid plexus (Figure 4.4B, C), suggesting its cellular uptake. We then confirmed blood-brain barrier (BBB) integrity by co-injecting Evans Blue dye into a subgroup of animals 0.5h prior to sacrifice. As expected, plasma, liver, and kidney samples stain deep blue indicative of Evans Blue uptake bound to albumin (Figure 4.16A), yet the brain remains pale, indicating that hapoA-I treatment did not compromise BBB integrity (Figure 4.16B). Evans Blue dye is visible within the lateral ventricle when half brains are visualized using fluorescent imaging, reflecting the known transport of ~0.1-0.3% of plasma albumin into the CSF under normal circumstances (Figure 4.16C).209 Taken together, these observations suggest that circulating hapoA-I may gain access to CSF via transport across the choroid plexus.  4.4.4 Elimination of Alexa647-hapoA-I from the CNS The turnover of hapoA-I in the CNS was examined by monitoring the distribution and clearance rate of Alexa647-hapoA-I injected intravenously at 60 mg/kg. Maestro imaging showed detectable ventricular fluorescence within 0.5h of injection, peak intensity between 2h to 6h, and thereafter a decline of signal intensity (Figure 4.5). As this imaging method is only semi-quantitative, we also performed ELISA analyses on plasma and perfused tissue lysates to establish hapoA-I concentrations (Figure 4.6). HapoA-I  measured 1577 ± 192 µg/ml in plasma taken 1min post injection, in good agreement with the theoretical maximum plasma hapoA-I  A Bsaline 0.5h 2h 6 h 24hTime post injection105   Figure 4.6 Alexa647-hapoA-I accumulates in the CNS for up to 2h prior to elimination. Mice were injected with saline or 60 mg/kg of Alexa647-hapoA-I. After 0.5, 1, 2, 3, 6, or 24h, mice were perfused and the concentrations of hapoA-I in A) plasma, B) liver, C) kidney, D) brain, and E) CSF was determined by commercial ELISA and normalized to total protein concentration in tissues. Graphs represent mean ± SEM N= 2 (3h), 3 (0.5h), 4 (1, 2h) or 5 (6, 24h) for tissue and an N= 3 for CSF samples.  concentration, 1250 µg/ml, given the total mg of hapoA-I injected and theoretical plasma volume based on body weight (Figure 4.6A). Using a two compartment decay model, the half-life of plasma hapoA-I during the short distribution phase was calculated as 0.9h, after which turnover slowed to give a half-life of 10.9h during the elimination phase. Peak hapoA-I concentrations in liver, 0.027 ± 0.005 µg/mg, and kidney, 0.326 ± 0.174 µg/mg, were detected at the earliest assessed time point, after which they were eliminated by first order decay for the first two hours with half-lives of 14.3h (R2=0.998) in liver, and 2.1h (R2=0.939) in kidney (Figure 4.6B-C). In contrast, hapoA-I concentrations in brain increased to peak 2h post injection at 2.96 ± 0.56 ng/mg, after which it was also eliminated by first order decay with a half-life of 10.3h between 2-24h (R2=0.976). By 24h, the levels of hapoA-I in plasma, liver, kidney, and brain were 9.4%, 14.1%, 1.9%, and 11.9% of their maximum concentrations, respectively. As the Alexa647 signal due to hapoA-I appears abundant in the cerebral ventricles (Figure 4.3;Figure 4.5), we also measured hapoA-I in CSF by ELISA. The concentration of hapoA-I in CSF fluctuates between 0.08-0.1 µg/ml for the first 6h post injection, but is not detectable by 24h (Figure 4.6E). These concentrations equate to 0.008-0.012% of plasma levels, similar to the 0.01% ratio determined for steady-state endogenous murine apoA-I (Figure 4.1B). As the  volume of CSF collected per animal is very small (i.e. 5-10 µl), the concentration of hapoA-I is close to the limit of detection for the ELISA kits used, which potentially explains some of the variability observed and the lack of signal at 24h compared to plasma and tissues.  A B DC E106   Figure 4.7 In vitro uptake, binding, cell association and transport of hapoA-I by primary hCEpiC. Representative merged fluorescent images taken at 400x of hCEpiC incubated A) without or B) with 100 µg/ml Alexa647-hapoA-I for 1h, depicting DAPI-stained nuclei (blue) and Alexa647-hapoA-I (red). Scale bar represents 25 µm. C) Specific binding (4oC), D) cell association (37oC), and E) transport (37oC) of hapoA-I was measured by incubating 5 µg/ml 125I-hapoA-I in the absence or presence of a 40-fold excess of unlabeled hapoA-I or BSA for 1h. Graphs represent mean ± SD, from 3 independent experiments each measured in triplicate to quadruplicate. $$ p<0.01by Kruskal-Wallis test followed by Dunn multiple comparison post test. *** p<0.001 by one-way analysis of variance with Bonferroni post-test.  4.4.5 HapoA-I Transport across the Blood-CSF Barrier (BCSFB) Although intravenously injected hapoA-I clearly gains access to the CSF, the mechanisms of its transport are unknown. We began by determining if endogenous murine apoA-I levels in the plasma and CSF are altered in ABCA1-/- and SR-BI-/- mice (Figure 4.17), as both transporters are believed to contribute to apoA-I transport in vitro across aortic461 and brain vascular464 endothelial cells. ABCA1 lipidates apoA-I to form nascent discoidal particles, while SR-BI catalyzes selective uptake of cholesterol from HDL particles311. Deficiency of ABCA1 causes a significant 85% reduction of apoA-I levels in plasma (p<0.001) and CSF (p=0.0159) and a 71% reduction in brain apoA-I (p=0.001) (Figure 4.17A). In SR-B1 deficient animals, plasma, CSF, and brain apoA-I levels were not significantly altered (Figure 4.17B). As CNS apoA-I levels directly parallel those found in plasma, ABCA1 and SR-BI-independent transport pathways exist in mice to allow for transport of apoA-I into the CSF in their absence. We then performed in vitro experiments using cultures of primary human epithelial cells derived from the choroid plexus, known as hCEpiC. HapoA-I internalization, binding and transport by hCEpiC was characterized using recombinant hapoA-I labelled with either BC DAEhapoA-I DAPI107  Alexa647 or 125I (Figure 4.7). Using fluorescent microscopy, internalized Alexa647-hapoA-I was located in peri-nuclear vesicles (Figure 4.7A), that did not co-localize with a commercially available LysoTracker® probe (Figure 4.18), suggesting that internalized apoA-I is not routed for degradation following internalization but may be transported through the cell to be re-secreted. Importantly, recombinant Alexa647-hapoA-I and Alexa488 labeled serum-derived hapoA-I strongly co-localized in hCEpiC, suggesting that epithelial uptake is not altered by the mutations present in the recombinant Alexa647-hapoA-I protein (Figure 4.19). For binding and transport assays, cells were incubated with 125I-hapoA-I alone or in the presence of 40-fold excess unlabeled hapoA-I or BSA as a specific or non-specific competitor, respectively. 125I-hapoA-I binding (Figure 4.7C), measured at 4ºC to prevent internalization, and 125I-hapoA-I cell association (Figure 4.7D), measured at 37 ºC to allow for binding and internalization, were decreased by 38% (p<0.01) and 52% (p<0.01), respectively, in the presence of 40-fold excess unlabeled hapoA-I. Next, we measured the ability of hCEpiC grown on transwell inserts to transport 125I-hapoA-I from the apical to basolateral compartment and found that 36% of 125I-hapoA-I transport was competed with excess unlabelled hapoA-I, suggesting that transport across hCEpiC is specific rather than diffusional (Figure 4.7E). To further analyze the transport capacity of hCEpiC, this experiment was repeated at 16°C to avoid fusion of vesicles with the plasma membrane. The specific transport of 125I-hapoA-I at 16°C was abolished (Figure 4.20), again supporting a cellular transport. The absence of competition with a 40-fold excess of BSA indicates the high specificity of the apoA-I cell binding, association and transport through hCEpiC. Taken together, these data provide strong support that hapoA-I is bound, internalized, and transported across primary human epithelial cells derived from the choroid plexus.  4.4.6 In Symptomatic APP/PS1 Mice CSL-111 Specifically Reduces Circulating Aβ40 24 Hours After a Single Injection Once we established the route of entry and half-life of hapoA-I in young, healthy C57Bl/6 mice, we transitioned into the APP/PS1 mouse model of AD to test the therapeutic potential of hapoA-I based HDL. For these experiments we utilized CSL-111, which consists of serum derived hapoA-I reconstituted with soy PC at a ratio of 1:150.484 CSL-111 has previously been shown 108   Figure 4.8 Acute plasma profiles of hapoA-I, HDL-C, and Aβ in symptomatic APP/PS1 mice following a single intravenous injection of 60 mg/kg CSL-111.  12.5 month old female APP/PS1 mice were injected with saline or 60 mg/kg CSL-111 and plasma samples were taken immediately prior to and 1, 4,8, and 24h post injection. A) hapoA-I was measured by ELISA. B) Total HDL cholesterol (HDL-C) was measured in unfractionated plasma using a commercial kit. C) Aβ40 and D) Aβ42 were measured by commercial ELISA. Graphs represent mean ± SEM with N= 7 mice per group, where ** p<0.01 by One Way ANOVA and Bonferroni post-test compared to baseline measures.  Plasma HDL-C, Aβ40, and Aβ42 are expressed as a percentage of the value obtained for each mouse at baseline, immediately prior to injection.  to elevate circulating pre-β HDL and enhance both ABCA1 and SR-BI mediated cholesterol efflux in both mouse and man.395, 485, 605, 606 Therefore, to determine the acute effects of CSL-111, we administered a single intravenous injection of saline or 60 mg/kg of CSL-111 to 12.6m old female APP/PS1 mice and took serial plasma samples immediately prior to and 1, 4, 8, and 24h post injection (Figure 4.8). As expected, hapoA-I concentration quickly decreased by 44% from 1368 ± 130 µg/ml to 904 ± 123 µg/ml between 1 and 4h post injection, after which the rate of elimination slowed such that 25%, 338 ± 49 µg/ml, of maximal plasma hapoA-I concentration remained 24h post injection (Figure 4.8A). HapoA-I was still detectable at 3% of its maximum in plasma 72h post injection (data not shown). One hour post injection plasma HDL-C was increased by ~30% in mice injected with CSL-111; however this did not reach statistical significance (Figure 4.8B).  BDAC109   Figure 4.9 Aβ levels in brain are unaffected despite minor fluctuations in circulating plasma Aβ40 following 4 weekly injections of 60 mg/kg of CSL-111.  11.6 month old female APP/PS1 mice were injected once a week with either saline or 60 mg/kg CSL-111 for a total of 4 weeks and plasma samples were taken 24h after injection (marked by arrow). On day 30, mice were fasted for 4h and plasma and brain tissue were collected for analysis. Plasma levels of A) Aβ40 and B) Aβ42 were measured by ELISA. Graphs represent mean ± SEM. For Aβ40 in saline injected mice N= 4 (D9, D23) or N= 9 (D0, D2, D16, D30); in CSL-111 injected mice N= 6 (D9, D23), or N= 14 (D0, D2, D16, D30). For Aβ42 N= 4 (saline injected) or N= 6 (CSL-111 injected) for all timepoints. Data is expressed as % of the baseline measurement taken prior to the first injection for each mouse. * implies p< 0.05 by One-Way ANOVA and Bonferroni post-test compared to baseline measurement. At the termination of the study (day 30), brains were serially extracted with carbonate (soluble) followed by guanidine HCl (GuHCl) (insoluble) buffers and levels of C,D) Aβ40  and E,F) Aβ42 were measured by ELISA and normalized to total protein concentration. Each symbol represents an independent animal.   Next we measured circulating human Aβ40 and Aβ42 levels to determine if CSL-111 was affecting the removal or degradation of Aβ from the CNS. The mutant human APP and PS1 transgenes are driven by the murine prion promoter, and thus the majority of human Aβ detected in circulation is from neuronal origin. However, expression is not exclusive to neuronal cells as murine prion promoter expression is also detectable to an appreciable extent in the heart.610 While saline had no effect on plasma Aβ40 or Aβ42, plasma Aβ40 was selectively and significantly decreased by 50% (p<0.01) 24h after injection with CSL-111 (Figure 4.8C,D). To determine whether CSL-111 was increasing clearance of Aβ40 from the plasma via the liver or AECBD F110  kidney we attempted to measure Aβ40 in these organs; unfortunately, levels of Aβ40 were below the limit of detection.  4.4.7 Brain Aβ Metabolism is not Altered Following Chronic Injections of CSL-111 into Symptomatic APP/PS1 Mice Next we sought to determine whether repeated injections of CSL-111 could exert beneficial effects with respect to Aβ degradation and clearance, neuroinflammation and endothelial activation in symptomatic APP/PS1 mice. To do so, we injected 11.6m old female APP/PS1 mice with either saline or 60 mg/kg CSL-111 once a week for a total of 4 weeks (average age at sacrifice 12.6m). Blood samples were taken immediately prior to starting the injection scheme in addition to 24h after each injection so that we could monitor plasma Aβ over the duration of the treatment. On day 30, one week following the 4th and final injection, mice were fasted and tissue was collected for analysis. As seen with the acute study, plasma Aβ40, but not Aβ42, was reduced by 25-55% 24h after injection with CSL-111 (Figure 4.9A,B). Specifically, plasma Aβ40 was reduced to 76.6 ± 9.5%, 108.4 ± 14.2%, 63.9 ± 8.4% and 44.5 ± 8.3% (p<0.05) on days 2, 9, 16, and 23, respectively, compared to pre-injection values. Inconsistency in plasma Aβ40 results may be due to its variable nature, requiring a much higher N than expected to clearly delineate results. For example, on day 9 there was a single mouse in the CSL-111 group whose values of plasma Aβ40 was increased by 70%, thus skewing the results. Surprisingly, on day 30 plasma Aβ40 and Aβ42 were increased by ~35% and ~240% in both saline and CSL-111 injected mice (Figure 4.9A,B). As mice were fasted for 4h prior to blood and tissue collection on day 30, versus not fasted for previous blood samplings, these results suggest that plasma Aβ levels, especially Aβ42, may be sensitive to the fed versus fasted state. To determine whether CSL-111 also had an effect on brain Aβ metabolism we measured brain Aβ40 and Aβ40 (Figure 4.9C-F) and amyloid burden (Figure 4.10). CSL-111 did not reduce soluble or insoluble brain Aβ40 or Aβ40 compared to saline injected controls (Figure 4.9C-D). As apoA-I has been postulated to specifically affect vascular amyloid burden,27, 28 we quantified cortical amyloid burden histologically using thioflavinS, which binds to the β-pleated sheet structure found in mature amyloid plaques, and resorufin, which binds specifically to  111   Figure 4.10 Measurement of total and vascular amyloid burden following 4 weekly injections of saline or 60 mg/kg in aged APP/PS1 mice. 11.5 month old female APP/PS1 mice were injected once a week with either saline or CSL-111 and on day 30 brain tissue was collected for analysis. Half brains were fixed and serial 25 µm coronal sections were generated. 3 sections per mouse, spaced 250 µm apart, were co-stained with thioflavin S, which detects total amyloid, and resorufin, which binds specifically to vascular amyloid. A) Representative fluorescent tiled images depicting thioflavin S (green) and resorufin (red) co-staining in saline and CSL-111 injected mice. B) 100x image showing thioflavin S (thioS) and resorufin positive cortical meningeal vessels (arrowhead) compared to thioflavin S positive parenchymal amyloid (arrow). Amyloid burden was quantified using intensity-thresholding (ImagePro) and expressed as % of cortical area. C) Quantification of total cortical amyloid burden as measured by thioflavin S staining. D) Quantification of cortical vascular amyloid burden using both thioflavin S and resorufin. For each mouse, an average was obtained from the 3 sections analyzed and graphed such that each symbol represents an independent animal.  vascular amyloid .599 Neither total nor vascular cortical amyloid burden were altered when mice were injected with CSL-111 (Figure 4.10), suggesting that CSL-111 mediated decreases in circulating Aβ40 does not translate to changes in brain Aβ metabolism under the injection paradigm used with aged APP/PS1 mice.  ABResorufin MergeThioSsaline CSL-111C D112  4.4.8 Evidence of Neuroinflammation and Endothelial Activation in Symptomatic APP/PS1 Mice Deposition of Aβ in brain tissue and within the smooth muscle cells of the cerebrovascular network undoubtedly leads to a detrimental cascade of events resulting in chronic neuroinflammation and cerebrovascular activation and dysfunction.238, 611 As HDL is known to reduce inflammation and endothelial activation in the periphery12 we characterized these pathologies in our AD mouse model and whether weekly injections of CSL-111 had any effect on these outcome measures.  Histologically, there was a very robust response of both microglia and astrocytes to the presence of amyloid deposits in vivo (Figure 4.11). Microglia in non-transgenic mice, as observed by ionized calcium-binding adapter molecule 1 (Iba-1) immunohistochemistry, appear evenly dispersed throughout the brain tissue with thin extensive processes characteristic of resting microglia (Figure 4.11A). In contrast, there was a substantial increase of activated microglia that appeared to be localized in clusters, presumably surrounding amyloid plaques, in transgenic APP/PS1 mice (Figure 4.11A). Astrocyte staining, detected using glial fibrillary acidic protein (GFAP), in non-transgenic mice appeared most intense around the larger corticomeningeal and penetrating cortical vessels and along the corpus callosum (Figure 4.11B). Once again, expression of the human APP and PS1 transgenes lead to an obvious recruitment and activation of astrocytes which were now found throughout the cortex, hippocampus and thalmus in somewhat concentric clusters (Figure 4.11B). However, there did not appear to be any gross differences in morphology or abundance of microglia or astrocytes between transgenic APP/PS1 mice injected with saline or CSL-111, although there may be more subtle changes occurring that require further in depth analysis. Although levels of the pro-inflammatory cytokines IL-6, IL-1β and TNF-α were not altered by the presence of the APP/PS1 transgene or CSL-111 (Figure 4.12A-C), there was evidence of increased levels of eNOS and VCAM-1 protein (Figure 4.12D,E) detected in brain lysates from APP/PS1 transgenic mice indicating possible vascular activation. Although eNOS and VCAM-1 were ~10-20% lower in APP/PS1mice injected with CSL-111 compared to saline, these results did not achieve statistical significance.  113   Figure 4.11 Enhanced expression and recruitment of microglia and astrocytes in the presence of amyloid deposits.  Coronal half brain sections from aged-matched non-transgenic APP/PS1 mice and transgenic APP/PS1 mice given 4 weekly injections of either saline or 60 mg/kg CSL-111 were stained with A) Iba-1 to detect microglia and B) GFAP to detect astrocytes. Approximately 50-60 individual images taken at 100x were tiled together to visualize the whole brain. %.   A: Iba-1B: GFAPNon trasngenic saline CSL-111Non trasngenic saline CSL-111114   Figure 4.12 Neuroinflammation and endothelial activation in the brains of APP/PS1 mice following 4 weekly injections of saline or 60 mg/kg CSL-111. 11.5 month old female APP/PS1 mice were injected once a week for 4 weeks with either saline (grey)or  CSL-111 (black) and on day 30 brain tissue was collected for analysis. Age matched non-transgenic littermate controls given 4 weekly injections of saline were used for comparison (white).Half brains were extracted with carbonate buffer for analysis.  A) IL-6 B) IL-1β and C) TNF-α were measured by ELISA and normalized to protein concentration. Levels of A) total eNOS and B) VCAM-1 were determined by denaturing immunoblotting. Graphs represent mean ± SEM with an N = 5-7 per group. * p< 0.05, ** p< 0.01 by One-Way ANOVA and Bonferroni post test.  4.4.9 Brain Levels of ABCA1, LDLR, and ApoE are not Affected by CSL-111 Lastly we examined whether the APP/PS1 transgene or CSL-111 influenced protein levels of key players in CNS lipoprotein metabolism and Aβ metabolism, namely: ABCA1, LDLR, SR-BI, and apoE. There was a significant 50-100% increase in brain ABCA1 (p<0.01), LDLR (p<0.001), and apoE (p<0.001) in APP/PS1 saline injected mice compared to non-transgenic littermate controls (Figure 4.13A-C). While ABCA1, LDLR, and apoE were also increased in APP/PS1 mice injected with CSL-111, the magnitude of increase in ABCA1 and LDLR was 10-20% smaller compared to saline injected controls, although not significantly different (Figure 4.13A-C). Interestingly, while SR-BI was significantly increased by 40% in APP/PS1 saline  115   Figure 4.13 Brain levels of apoE and major receptors involved in lipoprotein metabolism in 12.5m old non-transgenic and transgenic APP/PS1 mice following 4 weekly injections of saline or 60 mg/kg. 11.5 month old female APP/PS1 mice were injected once a week with either saline (grey) or CSL-111 (black) and on day 30 brain tissue was collected for analysis. Age matched non-transgenic littermate controls given 4 weekly injections of saline were used for comparison (white).Half brains were extracted with carbonate buffer for analysis.  Half brain levels of A) ABCA1 B) apoE C) LDLR and D) SR-BI were determined by denaturing immunoblotting.Graphs represent mean ± SEM with an N = 5-7 per group. * p< 0.05,** p< 0.001, *** p<0.001 by One-Way ANOVA and Bonferroni post test.   mice (p<0.05), CSL-111 injections decreased brain SR-BI levels back to non-transgenic levels (p<0.05) (Figure 4.13D).  4.5 Discussion Potential roles for apoA-I-containing HDL in cerebrovascular health and AD pathogenesis are emerging from both epidemiological and animal studies.19 The levels, and more importantly, cholesterol efflux capacity and vasoprotective properties of HDL decrease during aging612 and ABCA1GAPDHWT saline CSL-111apoEGAPDHWT saline CSL-111LDLRGAPDHWT saline CSL-111SR-BIGAPDHWT saline CSL-111BADC116  even more so in co-morbid conditions such as CVD and T2DM8-12 that are associated with increased AD risk.1, 4 Decreased apoA-I levels in serum,22 brain tissue and CSF350, 466, 467 of AD subjects have been reported, albeit two other studies468, 469 found no difference in CNS apoA-I. As apoA-I is found in the CSF of many species, despite being synthesized only in liver and intestine,19 this study was designed primarily to explore the mechanisms by which circulating apoA-I accesses the CNS and further whether elevation of circulating apoA-I-HDL could reduce Aβ deposition, neuroinflammation, and activation of the cerebrovascular endothelium. Our findings suggest that nearly all detectable injected apoA-I gains access to the CNS via uptake by epithelial cells of the choroid plexus via a specific cellular mechanism(s), which may retain a portion of internalized apoA-I in addition to secreting internalized apoA-I into CSF.  Previous studies examining apoA-I entry into the CNS have focused primarily on endothelial transport, and although we did not observe clear evidence of injected apoA-I located within or adjacent to endothelial cells, we cannot rule out the possibility that some apoA-I gains access to the CNS by transport across the BBB. Protamine-oligonucleotide nanoparticles (‘proticles’) coated with apoA-I exhibited increased uptake, transcytosis, and delivery across in vitro primary porcine BCEC cultured on transwells.464 Incubation with an anti-SR-BI antibody blocked apoA-I-induced increase in proticle transport,464 consistent with SR-BI mediating the uptake of HDL-associated cholesterol esters613 and phosphatidylcholine614 in pBCEC in vitro. In contrast, deletion of murine SR-BI did not affect brain apoA-I levels in this study (Figure 4.16) as well as in a previous report,615 it is possible that pBCEC may have specific apoA-I transport mechanisms not found in rodents.  Endothelial and epithelial cells may also have distinct mechanisms by which apoA-I transport is regulated. In aortic endothelial cells, ABCA1 and the ectopic beta ATPase mediate cell surface internalization and transport of lipid free apoA-I,461, 462 whereas ABCG1 and SR-BI are required for the binding and transcytosis of the holo-HDL particle.586 In the kidney, apoA-I is filtered by epithelial cells in the renal proximal tubule by a combination of the multiligand endocytic receptors cubilin, megalin, and amnionless.616 Endocytosis of cubilin-apoA-I complexes is triggered by binding to megalin, also known as low density lipoprotein receptor related protein 2 (LRP-2), which delivers cubilin and associated ligands to the lysosome for degradation.616 Megalin is expressed at the apical membrane in the choroid plexus of multiple 117  species,209 while cubilin has been found in the choroid plexus of the developing rat up to embryonic day 15,587 though its expression patterns within the adult CNS are unknown. Although megalin and cubilin function in kidney epithelium as canonical endocytic/catabolic receptors,616 megalin at the choroid plexus may participate in receptor-mediated transcytosis of a variety of ligands including: insulin-like growth factor,617 leptin259 and apoJ.203 Furthermore, cerebrovascular endothelial cells express tight and adherens junction proteins to form the BBB, whereas endothelial cells in the capillaries that supply the choroid plexus are fenestrated, a common feature of nonsinusoidal fenestrated microvasculature found in other tissues such as the proximal tubules of the kidney, pancreas and adrenal cortex.209 Barrier properties are derived from the choroidal epithelium, which, in addition to actively producing CSF, expresses apical belt-like tight junctions to form the BCSFB. The BCSFB barrier includes a multitude of specific transporters and receptors that govern the entry and exit of many compounds into and out of the CSF.209 Whether megalin, cubilin, or other transporters may participate in apoA-I transcytosis across the BCSFB is not yet known. There are potential caveats to our study that might exert a degree of influence on our findings. Although the use of recombinant hapoA-I containing mutations is one such caveat, we observed strong co-localization between recombinant and serum-derived hapoA-I in hCEpiC (Figure 4.18), and a similar peak brain concentration (2-3 ng/mg) following intravenous injection of 60 mg/kg of serum-derived hapoA-I (data not shown), indicating that fundamental CNS transport appears similar between these two hapoA-I preparations. Due to lack of murine apoA-I ELISAs, calculations of endogenous apoA-I levels are based on semi-quantitative denaturing immunoblotting, which has limited dynamic range. Plasma levels of apoA-I in WT C57Bl/6 mice have been estimated to be 1.1 ± 0.1 mg/mL based on protein mass quantitation following single radial immunodiffusion.609 Our immunoblot data show that steady-state murine CSF apoA-I levels are approximately 0.01 % of state-state plasma levels, or ~0.11 µg/mL in CSF (Figure 4.1). These values are similar to previously reported CSF apoA-I levels in rat, measured by ELISA, at 0.07 ± 0.055 µg/mL, or 0.01 % of plasma values.454 Notably, tissue hapoA-I measurements may be an underestimation as hapoA-I levels in liver and kidney measured by ELISA are ~20 % and ~10 % of those calculated using fluorescence (data not shown) as the presence of the C-terminal mutations in the recombinant hapoA-I decreases antibody affinity 118  (data not shown). Unfortunately, fluorescence was insufficiently sensitive to quantify hapoA-I levels in brain or CSF. ApoA-I uptake into the CSF may also be influenced by species, age, and barrier integrity in addition to steady-state plasma levels. For example, hapoA-I in the CSF of APP/PS1 mice crossed to hapoA-I transgenic mice, where plasma HDL is doubled and plasma hapoA-I measures 2.43 ± 0.96 mg/mL,609 reaches 3 ± 1 µg/mL, representing 0.12 % of plasma levels,27 or nearly 10-fold the CSF levels measured here. However, these 10-month old transgenic AD mice may also have a compromised BBB and/or BCSFB, compared to the 3-5 month old C57Bl/6 mice used in this study.  Like the cerebrovasculature, the choroid plexus develops structural and functional damage in AD.181, 618 In aging and even more so in AD, epithelial cell atrophy contributes to a 50% or greater decrease in CSF production, which, in conjunction with increased ventricular volume, results in a lower flow and turnover of CSF.618 Concomitantly, the concentration of potentially toxic peptides and metabolites increases, and the ventricular sink action that draws catabolites from the interstitial fluid (ISF) into the CSF via a concentration gradient is markedly decreased.181, 618 As LRP1 mediated clearance of Aβ across the BBB is compromised in AD,3 the brain may depend more heavily on reabsorption of ISF Aβ by CSF for transport across the BCSFB.181, 618 Together, multiple mechanisms may lead to increased Aβ deposition in the choroid plexus, confirmed histologically in post mortem AD subjects and APP/PS1 transgenic AD mice.257, 258 Aβ deposition is associated with a reduction in mitochondrial activity, increased generation of reactive oxygen species and expression of caspases 3 and 9, ultimately leading to increased apoptosis.257, 258 Interestingly, apoA-II exhibited increased oxidative damage in the choroid plexus of AD subjects; further suggesting HDL metabolism at the choroid plexus may be impaired in advanced AD.257  Both HDL levels and cholesterol efflux capacity decline with age.612 It is not known whether the onset of age-related dysfunction in either cerebrovascular endothelial cells or choroid epithelial cells correlate with age-related reductions in HDL or apoA-I levels. Although HDL and apoA-I have demonstrated beneficial functions in promoting endothelial cell health and function,12 it is not known whether these effects may extend to cerebrovascular endothelial cells or choroid epithelial cells. In the APP/PS1 mouse model of AD there are obvious signs of microglia and astrocyte activation and recruitment (Figure 4.20) in addition to up-regulation of 119  eNOS and VCAM-1 protein levels in brain tissue (Figure 4.11) in response to marked Aβ and amyloid deposition (Figure 4.9;Figure 4.10) at 12.5 months-of-age compared to non-transgenic littermate controls. We observed the novel finding that CSL-111 lead to a selective 50% decrease in plasma Aβ40 24h after injection; however we were unable to confirm if this was due to enhanced peripheral clearance as levels in the liver and kidney were below the limit of detection. The lack of change in brain Aβ following CSL-111 injection may be at least partially explained by the differences in Aβ40 concentration in the plasma versus brain tissue. While Aβ40 in both plasma and carbonate soluble brain measured ~2 ng/mL, Aβ40 in guanidine-soluble brain extract was 200-times this – 400 ng/mL. To see any treatment effect it may therefore be necessary to increase the frequency of CSL-111 injections to prolong exposure to hapoA-I in circulation and CSF, as by 72h hapoA-I has been almost completely excreted. However, repeated injections will also mount an immune response, a challenge that limits the feasibility of this approach. Additionally, as the mice used in this study have severe Aβ and amyloid pathology by the onset of the injection scheme, it may not be possible to retroactively solubilize and remove aggregated Aβ. Therefore, another approach to determine efficacy would be to initiate treatment earlier in disease progression. While not statistically significant, we observed a 10-20% decrease of brain eNOS and VCAM-1 protein when APP/PS1 mice were injected with CSL-111 compared to saline controls (Figure 4.11). As these measurements were carried out in half brain homogenates, it will be imperative to selectively isolate the vasculature from these brains and carry out additional immunohistological analysis for markers of endothelial cell health and barrier integrity to better characterize the selective response of the vessel. Although we did not observe significant reductions in various markers of AD pathology in symptomatic APP/PS1 mice following repeated injections of CSL-111, our preliminary results in addition to the known integral involvement of the choroid plexus in resolving neuroinflammation warrants further investigation.619  120  4.6 Supplemental Information 4.6.1 Supplemental Methods 4.6.1.1 Animals DBA, C57Bl/6, and ABCA1-/-mice were obtained from Jackson Laboratories. Female SR-BI -/- mice were generously provided by Dr. Bernardo Trigatti. All mice are on a C57Bl/6 genetic background except for ABCA1-/- mice, which are on a DBA background. Animals were maintained on a standard chow diet (PMI LabDiet 5010).  4.6.1.2 Intravenous Injection of Evans Blue Dye to Test BBB Permeability A 2% solution of Evans blue dye (Sigma) in saline was injected at 4ml/kg into the tail vein 30min prior to sacrifice in mice injected with saline, 7.5 or 120 mg/kg Alexa647-hapoA-I 1.5h earlier. Pictures of liver, kidney, brain, and plasma were taken to illustrate the distribution and uptake of Evans blue which binds to plasma albumin. As Evans blue is also fluorescent, images of intact half brains were acquired using the Maestro fluorescent imager using the same conditions as described in Chapter 4.3.8.1.   4.6.1.3 mRNA Extraction and qRT PCR RNA was extracted from tissues and cells using Trizol (Invitrogen) and treated with DNAseI prior to cDNA synthesis. cDNA was generated using oligodT primers and Taqman Reverse transcription reagents (Applied Biosystems). Primers were designed using Primer Express software (Applied Biosystems). Sequences are: murine apoA-I forward (5′ GACCTGCGCCATAGTCTGATG 3′) and reverse (5′ TCAGAGTCTCGCTGGCCTTG 3′), murine β-actin forward (5′ ACGGCCAGGTCATCACTATTG 3′) and reverse (5′ CAAGAAGGAAGGCTGGAAAAG 3′), human apoA-I forward 5' ACCACGCCAAGGCCACCGAG 3' and reverse reverse 5' CTCGAGCGCTCAGGAAGCT 3', and human GAPDH forward: 5'CCTGCACCACCAACTGCTTA 3'and reverse: 5'CATGAGTCCTTCCACGATACCA 3'. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was done with Sybr green reagents (Applied Biosystems) on an ABI StepOne Plus. Cycling conditions were 50 °C for 2 min 95 °C for 10 min, then 40 cycles at 95 °C for 15 s and 60 °C for 1 min, followed by dissociation at 95 °C for 15 s, 60 °C for 20 s, and 121  95 °C for 15 s. Each sample was assayed at least in duplicate, normalized to β-actin or GAPDH and analyzed with 7000 system SDS software v1.2 (Applied Biosystems) using the relative standard curve method.  4.6.1.4 hCEpiC Co-localization and Transport Assays hCEpiC were seeded as described in the main text. On the assay day, cells were incubated with or without 100 µg/ml Alexa647-hapoA-I and 200 nm LysoTracker Green DND-26 (Invitrogen) in DMEM containing 0.1% FBS for 2h. Serum derived lipid-poor hapoA-I (CSL Behring) was labeled with Alexa Fluor®488 carboxylic acid, tetrafluorophenyl ester using a commercial kit according to the manufacturers’ instructions (Invitrogen; A-10235) For co-localization experiments, cells were seeded as detailed in chapter 4.3.9 and incubated with 50 µg/ml of Alexa647-hapoA-I and 50 µg/ml of Alexa488-hapoA-I in DMEM containing 0.1% FBS for 0.5-4h. Cells were fixed and imaged as described in Chapter 4.3.9. Transport assays of 125I-hapoA-I at 16°C were conducted as described in Chapter 4.3.9.  4.6.2 Supplemental Figures  Figure 4.14 ApoA-I mRNA is negligible is murine brain tissue and primary human choroid plexus epithelial cells. The relative expression of apoA-I mRNA was measured using qRT PCR. A) murine (m) apoA-I mRNA was measured in the liver (Lv) and cortex (Cx) of C57Bl.6 mice and cortex of apoA-I-/- mice. B) human (h) apoA-I mRNA measured in cell cultures of immortalized hepatocytes, HepG2, and primary epithelial cells from the choroid plexus, hCEpiC.  BA122    Figure 4.15 Immunohistochemical detection of plasma IgG in the choroid plexus of mice injected with saline or increasing doses of Alexa647-hapoA-I. Mice were injected intravenously with saline or 7.5-120mg/kg of Alexa647- hapoA-I in saline. Fixed, perfused half brains taken 2h post injection were sectioned and stained with a Cy3 conjugated antibody against murine IgG. A) Representative fluorescent images of IgG in the choroid plexus taken at 100x. Scale bar represents 500 µm.  B) Graphical representation of percent area covered by IgG quantified using ImagePro software. Graph represents mean ± SEM with an N = 2 (30 mg/kg, 60 mg/kg), 3 (7.5 mg/kg, 120 mg/kg), or 4 (15 mg/kg) group from two independent experiments.    Figure 4.16 Abundant Evans Blue uptake in the liver, kidney, and plasma but not brain. Mice were co-injected with a 2% solution of Evans blue (EB) in addition to either saline or Alexa647-hapoA-I. Following perfusion, tissue samples were removed and photographed to compare the relative uptake of Evans blue which binds to albumin in circulation. A) Scanned image of kidney, liver, and plasma showing abundant dark blue staining in those mice injected with Evans blue regardless of Alexa647-hapoA-I B) Scanned image of brains taken from corresponding mice C) Fluorescent imaging of the same half brains depicted above revealing minimal uptake of Evans blue labeled plasma albumin into the ventricular system. BAsaline cont. 7.5 mg/kg 15 mg/kg 30 mg/kg 60 mg/kg 120 mg/kgDose hapoA-IkidneyliverplasmaFluorescenceBCVisible lightVisible lightbrainbrain123    Figure 4.17 Endogenous apoA-I protein levels in the CNS parallel plasma levels in ABCA1-/- and SR-BI-/- mice. ApoA-I protein levels in plasma (Pl), CSF, and brain tissue (Br) were determined by denaturing immunoblotting in A) ABCA1-/- and B) SR-BI-/- mice. Graphs represent mean ± SEM where values are expressed relative to age, sex, and strain-matched controls with an N = 4-11 per group. P-values were determined using a Student’s unpaired t-test for normally distributed data (plasma, brain) or Mann Whitney test for nonparametric data (CSF).    Figure 4.18 Internalized Alexa647-hapoA-I does not co-localize with a lysosomal marker in hCEpiC. Representative merged fluorescent image taken at 400x of hCEpiC co-incubated with 100 µg/ml Alexa647-hapoA-I and 200 nm Lysotracker for 2h. Scale bar represents 25 µm. A BapoA-IAlbumin/GAPDHapoA-IAlbumin/GAPDH+/+ -/- +/+ -/- +/+ -/- +/+ -/- +/+ -/- +/+ -/-ABCA1 SR-BIhapoA-I LysotrackerDAPI124   Figure 4.19 Co-localization of internalized recombinant Alexa647-hapoA-I and serum derived Alexa488-hapoA-I in hCEpiC. Representative merged fluorescent images taken at 400x of hCEpiC co-incubated with 50 µg/ml Alexa647-hapoA-I (recombinant; red) and Alexa488-hapoA-I (serum derived; green) for 0.5-4h. Cell nuclei were stained with DAPI (blue). Scale bar represents 25 µm. Alexa647 Alexa488 merge0.5h1h2h4h125   Figure 4.20 Temperature dependent transport of 125I-hapoA-I by primary hCEpiC. Transport of hapoA-I was measured by incubating 5 µg/mL 125I-hApoA-I in the absence or presence of a 40-fold excess unlabeled hapoA-I for 1h at either 37°C or 16°C. Graph represents mean ± SD, N=3 per condition.  126  Chapter 5: Discussion and Concluding Remarks 5.1 Summary and Significance Lipoprotein metabolism in the central nervous system (CNS) is based entirely on a variant of particles akin to peripheral high density lipoprotein (HDL), using apolipoprotein (apo) E as their major protein component where this role is filled by apoA-I in the periphery.326 While apoE-containing HDL have been well characterized and validated in the risk, development, and progression of Alzheimer’s Disease (AD),107 interest in the potential role of apoA-I-containing HDL has developed as research into the role of cerebrovascular dysfunction in AD has surged.3 HDL exhibits a loss of beneficial function or gain of toxic function in co-morbidies that increase AD risk, such as cardiovascular disease (CVD) and type 2 diabetes mellitus (T2DM).10, 12, 378 In a recent study, low plasma apoA-I was identified as a marker for the presence of AD that correlated with the level of cognitive decline,22, 26 add credence to the hypothesis that apoA-I based HDL are dysfunctional and potentially contribute to the pathogenesis of AD, specifically with respect to deposition of amyloid and endothelial activation in the cerebrovasculature. The goal of this thesis was to identify regulatory and transport mechanisms responsible for the entry and control of apoA-I found within the CNS and further delineate potentially beneficial subsets within the HDL population and their therapeutic utility. In Chapter 2 we identified the critical role of ATP binding cassette (ABC) transport A1 (ABCA1), which regulates the lipidation and levels of both apoA-I and apoE, in Liver-X-receptor (LXR) agonist mediated improvements in cognitive function. Intriguingly, while not a direct LXR target, we observed a significant and CNS specific elevation of apoA-I that occurred even in APP/PS1 ABCA1 deficient mice where circulating levels of apoA-I are barely detected. These results suggest that, while loss of ABCA1 reduces baseline plasma and CNS apoA-I levels in a parallel fashion, activation of the LXR pathway and its target genes can increase apoA-I transport into the CNS. Next, we sought to determine how specific sub-fractions of apoA-I HDL impacted AD pathology. In Chapter 3 we demonstrated that total body loss of lecithin cholesterol acetyltransferase (LCAT), which generates the cholesterol ester core found in mature sphereical α-HDL, virtually eliminated mature α-HDL, leaving only immature discoidal pre-β HDL in circulation. Due to limitations in quantity of CSF collected and the low concentrations of lipoproteins in CSF compared to plasma, it is not possible to directly measure the effect of 127  LCAT deficiency on apoE-lipoprotein maturation and structure. Akin to the observations in ABCA1 deficient animals, loss of LCAT  leads to a profound parallel reduction in plasma, cerebrospinal fluid (CSF), and brain tissue apoA-I; however, unlike ABCA1 deficient mice, apoE levels and lipidation were not affected by loss of LCAT. Despite dramatically reduced mature apoA-I HDL levels, deposition of Aβ and amyloid in the brain tissue and cerebrovasculature were not altered in APP/PS1 LCAT-/- mice, suggesting that low levels of circulating pre-β HDL (whether apoA-I or apoE-derived) are sufficient to maintain Aβ clearance from both parenchymal and cerebrovasculature compartments. Given the increasing interest in factors that affect cerebrovascular function as a much understudied element of AD pathophysiology, we next sought to characterize the route of entry and metabolism of apoA-I in the CNS in order to test the therapeutic potential of pre-β apoA-I-bearing HDL in AD. In Chapter 4 we identified the blood-CSF barrier (BCSFB) as the primary point of entry for apoA-I into the CNS, where the epithelial cells of the choroid plexus bind, take up, and transport apoA-I via a yet to be identified specific cellular receptor mediated mechanism. As apoA-I does not co-localize with the lysosome, our results suggest that apoA-I may be secreted by the choroidal epithelium intact into the CSF where it can then enter the brain tissue as well. Once within the CNS, apoA-I reaches peak concentration 2-3 h post injection and subsequently is turned over with a terminal half-life of 10.3 h, comparable to the terminal half-life of apoA-I in plasma of 10.9 h. Intravenous injection of CSL-111, a mixture of serum-derived human apoA-I and phosphatidylcholine which stimulates preβ HDL formation and cholesterol efflux, into symptomatic APP/PS1 mice decreases plasma Aβ40 by ~50% 24 h after injection but does not alter brain Aβ or amyloid levels following weekly injections over 1 month. While not significant, markers of brain endothelial activation were decreased in CSL-111 injected mice compared to saline controls, warranting further investigation. This thesis lays the groundwork for identifying the involvement of apoA-I based HDL in AD by identifying the transport of circulating apoA-I across the BCSFB and highlighting the importance of pre-β-HDL in cerebrovascular health and AD pathogenesis. Together, we propose that apoE-containing HDL, originating from the CNS, and apoA-I containing HDL, originating from the periphery, act synergistically to protect the cerebrovasculature by clearing Aβ, supporting barrier integrity, reducing inflammation, and promoting cellular health (Figure 5.1). 128   129   Figure 5.1 Influences of lipoproteins on Alzheimer’s Disease development. Top: under normal circumstances, apoE- and apoA-I- containing lipoproteins have direct protective effects on the vasculature. In the CNS compartment, apoE promotes BBB integrity by inhibiting MMP activation in pericytes as well as facilitating clearance of Aβ. From the luminal side of the vessel, HDL particles in blood work to protect endothelial cell health and repair by signaling in anti-inflammatory and antiapoptotic pathways and promoting NO secretion to cause vasorelaxation. In addition, apoA-I lipoproteins are present within the CSF and positively influence the perivascular drainage of Aβ in an unknown manner. Middle-left: Inheritance of the APOE4 allele is detrimental, as apoE4 appears to exhibit both loss of beneficial function and gain of toxic function. ApoE4 impairs BBB integrity by activating MMPs in pericytes, leading to the degradation of tight and adheren junction proteins within endothelial cells. ApoE4 also slows clearance of Aβ across the BBB by shifting clearance from LRP-1 to VLDLR, which has a much slower rate of endocytosis. In addition, there is atrophy of the VSMC layer and thickening of the basement membrane in the CNS vessels of APOE4 carriers, impairing vessel contraction that negatively impacts CBF and Aβ clearance. Middle-right: Vascular and metabolic disorders, such as CAD and T2DM impair HDL function and promote so-called dysfunctional HDL in the blood compartment. The vasoprotective effects are then lost, and in certain HDL become proinflammatory and proapoptotic. In addition, impairment of NO production reduces VSMC relaxation, leading to potential impairment in Aβ perivascular drainage and subsequent CAA. Bottom: A model of potential synergy between genetic and environmental risk factors on lipoprotein function that exacerbates AD pathogenesis via dysfunctional apoE-lipoproteins in the CNS and dysfunctional HDL in the blood compartment.  Figure used with permission from 19130   5.2 Toward Leveraging HDL Modifying Therapeutics for AD Despite decades of intense activity, discovery of an effective disease-modifying therapeutic for AD has consistently failed, particularly for APOE4 carriers. Although there is a growing consensus that vascular risk factor (VRF) comorbidities contribute to AD pathology and cognitive decline, clinical trials with statins,620, 621 antihypertensive,622 anti-inflammatory agents,623 and immunotherapy624, 625 in symptomatic AD patients have not proven successful, possibly because these treatments were initiated beyond the therapeutic window for efficacy. Therapeutic strategies targeted at increasing the amount or functionality of apoA-I-containing HDL are currently underway for use in the cardiovascular field and are now being actively used in preclinical and clinical work (see Chapter 1.8 for details). 472 Of these strategies, the use of synthetic LXR agonists and direct injection of reconstituted HDL were explored in this thesis. As detailed extensively in Chapter 2, multiple groups have shown efficacy of synthetic LXR agonists in mouse models of AD.369, 431-437 LXR agonists are thought to work in the CNS via upregulation of ABCA1 and apoE; however, we also show in Chapter 2 that the LXR agonist GW3965 significantly increases apoA-I selectively in the CNS, suggesting that LXR agonists may also regulate genes involved in apoA-I transport or metabolism in the CNS. As systemic exposure to LXR agonists will also affect HDL levels and function in plasma, it will be interesting to determine how much of the beneficial effect of LXR agonists in AD mice may be due to changes in peripherally derived apoA-I-based HDL versus CNS-derived apoE. Clinical development of LXR agonists for AD has been limited, as in addition to the adverse side effects mentioned above, patients treated with the LXR agonist LXR-623 developed CNS-related adverse effects, including delirium in the highest two doses evaluated in a single ascending dose study in healthy subjects.626  There is preliminary support for the use of apoA-I/HDL infusions in AD as detailed in Chapter 4 of this thesis. While our study using CSL-111 in symptomatic APP/PS1 mice did not yield any statistically significant changes, our results hint at the possible involvement of CSL-111 in neuroinflammation and cerebrovascular endothelial activation, which warrants further investigation. It will also be critical to determine if injection of CSL-111, or any variant of reconstituted HDL, is able to impact cognitive function in preclinical AD mouse models. Although behavior testing was attempted in Chapter 4, the test utilized lacked the sensitivity and 131  specificity to answer the question asked given the cohort size. Given that the injected hapoA-I is all but absent from circulation 72-hours post injection, increasing the number of injections per week may be necessary to maintain a sufficient degree of elevation in plasma HDL and hapoA-I to mediate an effect on the CNS, without inducing an anti-hapoA-I immune response in the treated mice. CSL-112 is a related reconstituted hapoA-I particle that is currently undergoing active clinical investigation for coronary artery disease.486 We were unable to access this formulation for our studies, but the greatly enhanced ability of CSL-112 to promote remodeling of endogenous HDL to the pre-β form may be a critical factor essential for successfully removing vascular Aβ deposits and repairing damaged cerebral vessels.   5.3 Contribution of Vascular Dysfunction and Cerebrovascular Amyloid Angiopathy to AD Pathology and Presentation The presence, contribution, and significance of cerebrovascular dysfunction in the pathoetiology and clinical presentation of AD are becoming increasingly recognized. Early clinical manifestation of compromised cerebrovascular function and integrity, such as the reduction to cerebral blood flow (CBF) and glucose uptake, combine with the obvious presence of CAA and vascular abnormalities in a large proportion of AD patients emphasize the need to take the cerebrovascular network in account when designing therapeutics and clinical trials and establishing biomarkers.   5.3.1 Detection and Removal of CAA When considering Aβ and amyloid deposition, few studies quantify vascular amyloid while deposition of amyloid in the choroid plexus is highly understudied. Thus, the ability of current therapeutic approaches for AD to remove pre-existing CAA is scant. While LXR agonists have proven successful in reducing parenchymal and ISF Aβ and/or amyloid,431-435, 437 pre-existing CAA deposits could not be removed by GW3965, as shown in Chapter 2, or T0901317479 in two separate studies. Further, as shown in Chapter 4 infusion of CSL-111 into symptomatic APP/PS1 mice also could not remove CAA. A large proportion of preclinical and clinical studies using active or passive Aβ immunization have observed either no change or even an increase in CAA627-632, although two preclinical studies have reported a decrease.632, 633 Genetic studies in 132  transgenic mice where CAA has been reduced27 or increased28, 367, 371 were following life-long exposure to over-expressed or deleted apoA-I and ABCA1, calling into question whether these changes were due to the production or clearance of CAA. Thankfully, the techniques and technologies available for the accurate quantification of CAA are beginning to evolve.100 Typically CAA is quantified histologically post mortem following staining with a congophillic dye, such as congo red, thioflavin S, or X-34, or ELISA measurements following biochemical separation of brain vasculature from tissue. Histological techniques rely on the user to be able to distinguish between vascular and parenchymal amyloid as these dyes bind both species. With some exceptions, in preclinical models of AD CAA is often 1-2 orders of magnitude lower than parenchymal amyloid, making the quantification of subtle differences much more difficult. Recently, resorufin was identified to bind specifically to vascular amyloid at low concentration, removing some of the uncertainty following histological quantification.599 Likewise, other techniques that specifically recognize cerebrovascular Aβ, such as vascular-specific Aβ antibodies634 and 18F-styrylpyridine derivative positron emission tomography (PET) ligands,635 are currently undergoing preclinical and clinical development. These probes can be used in conjunction with sophisticated light based microscopy techniques, such as two-photon microscopy and optical coherence tomography, to allow for submicrometer resolution of cerebral vessels. In preclinical models, CAA progression can be monitored in real time via the use of cranial windows; for example, the location and progression of CAA is quite different between the Tg2576636 and APP/PS1637 models of AD. The use of two-photon microscopy in conjunction with other non-invasive imaging techniques such as magnetic resonance imaging (MRI), computer tomography (CT), positron emission tomography (PET), single-photon emission computed tomography (SPECT), and near-infrared fluorescence (NIRF) allow for real time, 3D analysis of not only CAA development, but vascular morphology and remodeling, cerebral blood flow, BBB integrity, cell migration, and microhemorrhage.100  5.3.2 Removal of Amyloid from the Brain Parenchyma and Cerebrovasculature: Benefit or Hazard One critical unanswered question is whether removal of pre-existing amyloid deposits will be beneficial or detrimental to cerebrovascular health. If Aβ clearance pathways via the BBB, 133  BCSFB, and perivascular drainage route are compromised, mobilization of parenchymal amyloid could potentially aggravate vascular amyloid burden and worsen the situation. Removal of CAA could potentially further harm vascular function or lead to structural collapse as in advanced CAA the VSMC layer of the arteriole has been replaced with amyloid. One prominent example of such a concern are the amyloid related imaging abnormalities (ARIA) that have been documented in a subset AD subjects624, 638 and AD transgenic animals631, 632, 639 given bapineuzumab. Bapineuzumab is a humanized analog of the murine 3D6 antibody that targets the N terminal of Aβ and has been used in immunotherapy approaches targeted at removal of both insoluble and soluble Aβ. In 2014, two Phase III clinical trials of bapineuzumab in AD patients failed to meet their primary outcome of improving cognition and functional ability, despite significant reductions in amyloid burden and CSF phosphor-tau in APOE4 carriers.624 More worrisome was the increased prevalence of ARIA associated with bapineuzumab use. There are two types of ARIA: ARIA-E which presents as vasogenic edema and sulcal effusions, and ARIA-H, which presents with microhemorrhages and haemosiderin deposits.638 The prevalence of ARIA-E and ARIA-H was significantly higher in AD patients on bapineuzumab in both phase II638 and phase III624 clinical trials compared to placebo controls, with the risk of ARIA increasing with drug and APOE4 allele dosage.624, 638. By analyzing PDAPP mice vaccinated with 3D6 for a period of 1-36 weeks, Zago et al were able to determine that morphological abnormalities, microhemorrhage, and deposition of  Aβ  in the capillaries was associated with the removal of vascular amyloid, which was then resolved with continued treatment.639 In contrast, the risk of ARIA was not affected in AD patients625 or AD transgenic mice631, 632 given solanezumab, a humanized analog of the murine 266 antibody which targets the central domain of Aβ, and therefore only recognizes the soluble form of Aβ. It will be critical to determine if cerebrovascular risk factors, such as low HDL-C, T2DM, metabolic syndrome, or CAD, predisposes AD patients to the risk of ARIA following removal of vascular amyloid. Carare et al have postulated that the lack of removal or aggravation of CAA observed in immunotherapy models627-631 is due to compromise in the perivascular drainage route for Aβ.640 To validate this hypothesis, perivascular drainage efficiency was monitored using 3 kDa soluble fluorescent dextran in mice that were actively immunized with ovalbumin and then challenged with a subsequent intracerebral injection of ovalbumin. The researchers noted that ovalbumin, 134  immunoglobulin G (IgG) and complement C3 co-localized in the basement membrane of the artery wall within 24h after immunization. This co-localization was associated with a significant transient reduction in dextran drainage along the perivascular route that was restored to baseline levels 7 days after immunization.640 The failure and potential adverse events associated with attempted removal of brain and cerebrovascular Aβ support a call for therapies that take into account vascular health that could stand on their own, or more likely work synergistically with more conventional Aβ targeted therapies. Wilcock et al. combine Aβ42 active immunization with the non-steroidal anti-inflammatory drug (NSAID) NCX-2216, a novel NO releasing flurbiprofen derivative.630 In this study 10-month old Tg2576 crossed to the M146L PS1 mutant (APP+PS1) were given a total of 8 vaccinations with Aβ42 over a period of 10 months, NCX-2216 alone, or a combination of the two and analysis was performed at 20-months of age. While vaccination with Aβ42 or administration of NCX-2216 alone both reduced Aβ and parenchymal amyloid deposits, there were no synergistic action detected between the two. Further, Aβ42 vaccination significant increased CAA, microhemorrhage, and microglial activation, an effect that was not lessened by the co-treatment with NCX-2216. However, it should be noted that there was a very limited sample size (N=3) for the co-treatment group, which may mask any protective effects of the NSAID.630 In a very recent study, Fitz et al. co-treated 11-month old APP23 mice by passive immunization with the HJ3.4 IgG antibody, which recognizes the N terminal of Aβ and therefore both soluble and insoluble forms, in the presence or absence of the LXR agonist T0901317 compounded in chow at a dose of 25 mg/kg/day for a total of 50 days.437 Passive immunization and administration of LXR agonist both alone and in combination therapy restored contextual fear conditioning and radial arm water maze behavior to the level of non-transgenic mice. However, none of the treatment paradigms decreased the levels of dense core or diffuse amyloid plaque, insoluble or soluble levels of Aβ, oligomeric Aβ or microhemorrhage. There was a significant decrease in brain interstitial fluid (ISF) Aβ40 and a non-significant decrease in Aβ42 with all three treatment strategies administered over a 15 day period. However, when tested by two-way ANOVA, there was no interaction detected between immunization and LXR agonist in any of the experimental paradigms measured.437 Additional studies with different co-treatment strategies and experimental design specifically targeted at protecting or promoting 135  cerebrovascular health will need to be conducted to determine the potential utility of a multiple drug approach to AD.  5.3.3 Looking Forward – the Future of ApoA-I based HDL in AD The work in this thesis and current literature support a role for apoA-I-based HDL in the development and potentially pathological development of AD. Given the acknowledged contributions of VRF to AD risk and the morphological, biochemical, and functional changes of the cerebrovasculature in the disease, further research regarding apoA-I in AD is highly justified. Although there is substantial circumstantial evidence, the mechanism(s) underlying any contribution of apoA-I-based HDL in AD pathophygiology needs to be further elucidated.  Levels of HDL-C decrease with age, estimated at 1% per year after age 50,641, 642 and the remaining HDL becomes dysfunctional in its ability to mediate cholesterol efflux due to structural and compositional changes.643, 644 It will be paramount to determine if and how the levels, and more importantly the functional properties, of HDL are impacted prior to and throughout the development of AD pathogenesis and whether there is any correlation between the two. Although much more difficult, it will also be important to measure the content of apoA-I-containing lipoprotein fractions in the CSF to determine if the relative ratio of plasma to CSF apoA-I is altered and what this could imply with respect to altered transport. While there is preliminary preclinical evidence of HDL-modifying therapies in literature and this thesis, much more detailed work will be required to determine efficacy and proof of principle. Lastly, as HDL-modifying therapies for the treatment of cardiovascular disease evolve and are implemented in the clinical setting, following this patient population into later life will play a pivotal role in determining if apoA-I based HDL, or any measure by which vascular function can be improved, may impact AD risk or development.  136  References  1. Mayeux R, Stern Y. Epidemiology of alzheimer disease. Cold Spring Harbor perspectives in medicine. 2012;2 2. de la Torre JC. Critical threshold cerebral hypoperfusion causes alzheimer's disease? Acta neuropathologica. 1999;98:1-8 3. Zlokovic BV. Neurovascular pathways to neurodegeneration in alzheimer's disease and other disorders. Nature reviews. Neuroscience. 2011;12:723-738 4. Duron E, Hanon O. Vascular risk factors, cognitive decline, and dementia. Vascular health and risk management. 2008;4:363-381 5. Faraco G, Iadecola C. Hypertension: A harbinger of stroke and dementia. Hypertension. 2013;62:810-817 6. Shepardson NE, Shankar GM, Selkoe DJ. Cholesterol level and statin use in alzheimer disease: I. Review of epidemiological and preclinical studies. Archives of neurology. 2011;68:1239-1244 7. Vagelatos NT, Eslick GD. Type 2 diabetes as a risk factor for alzheimer's disease: The confounders, interactions, and neuropathology associated with this relationship. Epidemiologic reviews. 2013 8. Ansell BJ, Navab M, Hama S, Kamranpour N, Fonarow G, Hough G, Rahmani S, Mottahedeh R, Dave R, Reddy ST, Fogelman AM. Inflammatory/antiinflammatory properties of high-density lipoprotein distinguish patients from control subjects better than high-density lipoprotein cholesterol levels and are favorably affected by simvastatin treatment. Circulation. 2003;108:2751-2756 9. Besler C, Heinrich K, Rohrer L, Doerries C, Riwanto M, Shih DM, Chroni A, Yonekawa K, Stein S, Schaefer N, Mueller M, Akhmedov A, Daniil G, Manes C, Templin C, Wyss C, Maier W, Tanner FC, Matter CM, Corti R, Furlong C, Lusis AJ, von Eckardstein A, Fogelman AM, Luscher TF, Landmesser U. Mechanisms underlying adverse effects of hdl on enos-activating pathways in patients with coronary artery disease. The Journal of clinical investigation. 2011;121:2693-2708 10. Sorrentino SA, Besler C, Rohrer L, Meyer M, Heinrich K, Bahlmann FH, Mueller M, Horvath T, Doerries C, Heinemann M, Flemmer S, Markowski A, Manes C, Bahr MJ, Haller H, von Eckardstein A, Drexler H, Landmesser U. Endothelial-vasoprotective effects of high-density lipoprotein are impaired in patients with type 2 diabetes mellitus but are improved after extended-release niacin therapy. Circulation. 2010;121:110-122 137  11. Riwanto M, Rohrer L, Roschitzki B, Besler C, Mocharla P, Mueller M, Perisa D, Heinrich K, Altwegg L, von Eckardstein A, Luscher TF, Landmesser U. Altered activation of endothelial anti- and proapoptotic pathways by high-density lipoprotein from patients with coronary artery disease: Role of high-density lipoprotein-proteome remodeling. Circulation. 2013;127:891-904 12. Luscher TF, Landmesser U, von Eckardstein A, Fogelman AM. High-density lipoprotein: Vascular protective effects, dysfunction, and potential as therapeutic target. Circulation research. 2014;114:171-182 13. Pitas RE, Boyles JK, Lee SH, Hui D, Weisgraber KH. Lipoproteins and their receptors in the central nervous system. Characterization of the lipoproteins in cerebrospinal fluid and identification of apolipoprotein b,e(ldl) receptors in the brain. The Journal of biological chemistry. 1987;262:14352-14360 14. Fagan AM, Holtzman DM, Munson G, Mathur T, Schneider D, Chang LK, Getz GS, Reardon CA, Lukens J, Shah JA, LaDu MJ. Unique lipoproteins secreted by primary astrocytes from wild type, apoe (-/-), and human apoe transgenic mice. The Journal of biological chemistry. 1999;274:30001-30007 15. LaDu MJ, Gilligan SM, Lukens JR, Cabana VG, Reardon CA, Van Eldik LJ, Holtzman DM. Nascent astrocyte particles differ from lipoproteins in csf. Journal of neurochemistry. 1998;70:2070-2081 16. Strittmatter WJ, Saunders AM, Schmechel D, Pericak-Vance M, Enghild J, Salvesen GS, Roses AD. Apolipoprotein e: High-avidity binding to beta-amyloid and increased frequency of type 4 allele in late-onset familial alzheimer disease. Proceedings of the National Academy of Sciences of the United States of America. 1993;90:1977-1981 17. Holtzman DM, Herz J, Bu G. Apolipoprotein e and apolipoprotein e receptors: Normal biology and roles in alzheimer disease. Cold Spring Harbor perspectives in medicine. 2012;2:a006312 18. Zlokovic BV. Cerebrovascular effects of apolipoprotein e: Implications for alzheimer disease. JAMA neurology. 2013;70:440-444 19. Stukas SR, J.; Wellington, CL. High density lipoproteins and cerebrovasular integrity in alzheimer's disease. Cell Metabolism. 2014 20. Kawano M, Kawakami M, Otsuka M, Yashima H, Yaginuma T, Ueki A. Marked decrease of plasma apolipoprotein ai and aii in japanese patients with late-onset non-familial alzheimer's disease. Clinica chimica acta; international journal of clinical chemistry. 1995;239:209-211 138  21. Kuriyama M, Takahashi K, Yamano T, Hokezu Y, Togo S, Osame M, Igakura T. Low levels of serum apolipoprotein a i and a ii in senile dementia. The Japanese journal of psychiatry and neurology. 1994;48:589-593 22. Merched A, Xia Y, Visvikis S, Serot JM, Siest G. Decreased high-density lipoprotein cholesterol and serum apolipoprotein ai concentrations are highly correlated with the severity of alzheimer's disease. Neurobiology of aging. 2000;21:27-30 23. Fan P, Liu Y, Zhang Z, Liu B, Ge W, Ye S, Cheng Y, Chen J. [serum apolipoprotein a i, b100 and e levels and apolipoprotein e polymorphism in patients with alzheimer's disease and multiple infarction dementia in chinese population]. Hua xi yi ke da xue xue bao = Journal of West China University of Medical Sciences = Huaxi yike daxue xuebao / [bian ji zhe, Hua xi yi ke da xue xue bao bian wei hui]. 2001;32:389-391 24. Liu HC, Hu CJ, Chang JG, Sung SM, Lee LS, Yuan RY, Leu SJ. Proteomic identification of lower apolipoprotein a-i in alzheimer's disease. Dementia and geriatric cognitive disorders. 2006;21:155-161 25. Saczynski JS, White L, Peila RL, Rodriguez BL, Launer LJ. The relation between apolipoprotein a-i and dementia: The honolulu-asia aging study. American journal of epidemiology. 2007;165:985-992 26. Shih YH, Tsai KJ, Lee CW, Shiesh SC, Chen WT, Pai MC, Kuo YM. Apolipoprotein c-iii is an amyloid-beta-binding protein and an early marker for alzheimer's disease. Journal of Alzheimer's disease : JAD. 2014 27. Lewis TL, Cao D, Lu H, Mans RA, Su YR, Jungbauer L, Linton MF, Fazio S, LaDu MJ, Li L. Overexpression of human apolipoprotein a-i preserves cognitive function and attenuates neuroinflammation and cerebral amyloid angiopathy in a mouse model of alzheimer disease. The Journal of biological chemistry. 2010;285:36958-36968 28. Lefterov I, Fitz NF, Cronican AA, Fogg A, Lefterov P, Kodali R, Wetzel R, Koldamova R. Apolipoprotein a-i deficiency increases cerebral amyloid angiopathy and cognitive deficits in app/ps1deltae9 mice. The Journal of biological chemistry. 2010;285:36945-36957 29. Alzheimer A, Stelzmann RA, Schnitzlein HN, Murtagh FR. An english translation of alzheimer's 1907 paper, "uber eine eigenartige erkankung der hirnrinde". Clinical anatomy. 1995;8:429-431 30. Maurer K, Volk S, Gerbaldo H. Auguste d and alzheimer's disease. Lancet. 1997;349:1546-1549 31. Graeber MB, Mehraein P. Reanalysis of the first case of alzheimer's disease. European archives of psychiatry and clinical neuroscience. 1999;249 Suppl 3:10-13 139  32. McKhann G, Drachman D, Folstein M, Katzman R, Price D, Stadlan EM. Clinical diagnosis of alzheimer's disease: Report of the nincds-adrda work group under the auspices of department of health and human services task force on alzheimer's disease. Neurology. 1984;34:939-944 33. Jack CR, Jr., Albert MS, Knopman DS, McKhann GM, Sperling RA, Carrillo MC, Thies B, Phelps CH. Introduction to the recommendations from the national institute on aging-alzheimer's association workgroups on diagnostic guidelines for alzheimer's disease. Alzheimer's & dementia : the journal of the Alzheimer's Association. 2011;7:257-262 34. Sperling RA, Aisen PS, Beckett LA, Bennett DA, Craft S, Fagan AM, Iwatsubo T, Jack CR, Jr., Kaye J, Montine TJ, Park DC, Reiman EM, Rowe CC, Siemers E, Stern Y, Yaffe K, Carrillo MC, Thies B, Morrison-Bogorad M, Wagster MV, Phelps CH. Toward defining the preclinical stages of alzheimer's disease: Recommendations from the national institute on aging-alzheimer's association workgroups on diagnostic guidelines for alzheimer's disease. Alzheimer's & dementia : the journal of the Alzheimer's Association. 2011;7:280-292 35. Albert MS, DeKosky ST, Dickson D, Dubois B, Feldman HH, Fox NC, Gamst A, Holtzman DM, Jagust WJ, Petersen RC, Snyder PJ, Carrillo MC, Thies B, Phelps CH. The diagnosis of mild cognitive impairment due to alzheimer's disease: Recommendations from the national institute on aging-alzheimer's association workgroups on diagnostic guidelines for alzheimer's disease. Alzheimer's & dementia : the journal of the Alzheimer's Association. 2011;7:270-279 36. McKhann GM, Knopman DS, Chertkow H, Hyman BT, Jack CR, Jr., Kawas CH, Klunk WE, Koroshetz WJ, Manly JJ, Mayeux R, Mohs RC, Morris JC, Rossor MN, Scheltens P, Carrillo MC, Thies B, Weintraub S, Phelps CH. The diagnosis of dementia due to alzheimer's disease: Recommendations from the national institute on aging-alzheimer's association workgroups on diagnostic guidelines for alzheimer's disease. Alzheimer's & dementia : the journal of the Alzheimer's Association. 2011;7:263-269 37. Hyman BT, Trojanowski JQ. Consensus recommendations for the postmortem diagnosis of alzheimer disease from the national institute on aging and the reagan institute working group on diagnostic criteria for the neuropathological assessment of alzheimer disease. Journal of neuropathology and experimental neurology. 1997;56:1095-1097 38. Hyman BT, Phelps CH, Beach TG, Bigio EH, Cairns NJ, Carrillo MC, Dickson DW, Duyckaerts C, Frosch MP, Masliah E, Mirra SS, Nelson PT, Schneider JA, Thal DR, Thies B, Trojanowski JQ, Vinters HV, Montine TJ. National institute on aging-alzheimer's association guidelines for the neuropathologic assessment of alzheimer's disease. Alzheimer's & dementia : the journal of the Alzheimer's Association. 2012;8:1-13 39. Thal DR, Rub U, Orantes M, Braak H. Phases of a beta-deposition in the human brain and its relevance for the development of ad. Neurology. 2002;58:1791-1800 140  40. Braak H, Braak E. Neuropathological stageing of alzheimer-related changes. Acta neuropathologica. 1991;82:239-259 41. Braak H, Alafuzoff I, Arzberger T, Kretzschmar H, Del Tredici K. Staging of alzheimer disease-associated neurofibrillary pathology using paraffin sections and immunocytochemistry. Acta neuropathologica. 2006;112:389-404 42. Mirra SS, Heyman A, McKeel D, Sumi SM, Crain BJ, Brownlee LM, Vogel FS, Hughes JP, van Belle G, Berg L. The consortium to establish a registry for alzheimer's disease (cerad). Part ii. Standardization of the neuropathologic assessment of alzheimer's disease. Neurology. 1991;41:479-486 43. Trojanowski JQ, Vandeerstichele H, Korecka M, Clark CM, Aisen PS, Petersen RC, Blennow K, Soares H, Simon A, Lewczuk P, Dean R, Siemers E, Potter WZ, Weiner MW, Jack CR, Jr., Jagust W, Toga AW, Lee VM, Shaw LM, Alzheimer's Disease Neuroimaging I. Update on the biomarker core of the alzheimer's disease neuroimaging initiative subjects. Alzheimer's & dementia : the journal of the Alzheimer's Association. 2010;6:230-238 44. Hampel H, Burger K, Teipel SJ, Bokde AL, Zetterberg H, Blennow K. Core candidate neurochemical and imaging biomarkers of alzheimer's disease. Alzheimer's & dementia : the journal of the Alzheimer's Association. 2008;4:38-48 45. Nelson PT, Alafuzoff I, Bigio EH, Bouras C, Braak H, Cairns NJ, Castellani RJ, Crain BJ, Davies P, Del Tredici K, Duyckaerts C, Frosch MP, Haroutunian V, Hof PR, Hulette CM, Hyman BT, Iwatsubo T, Jellinger KA, Jicha GA, Kovari E, Kukull WA, Leverenz JB, Love S, Mackenzie IR, Mann DM, Masliah E, McKee AC, Montine TJ, Morris JC, Schneider JA, Sonnen JA, Thal DR, Trojanowski JQ, Troncoso JC, Wisniewski T, Woltjer RL, Beach TG. Correlation of alzheimer disease neuropathologic changes with cognitive status: A review of the literature. Journal of neuropathology and experimental neurology. 2012;71:362-381 46. Weller RO, Preston SD, Subash M, Carare RO. Cerebral amyloid angiopathy in the aetiology and immunotherapy of alzheimer disease. Alzheimer's research & therapy. 2009;1:6 47. Jack CR, Jr., Knopman DS, Jagust WJ, Shaw LM, Aisen PS, Weiner MW, Petersen RC, Trojanowski JQ. Hypothetical model of dynamic biomarkers of the alzheimer's pathological cascade. Lancet neurology. 2010;9:119-128 48. Grundke-Iqbal I, Iqbal K, Tung YC, Quinlan M, Wisniewski HM, Binder LI. Abnormal phosphorylation of the microtubule-associated protein tau (tau) in alzheimer cytoskeletal pathology. Proceedings of the National Academy of Sciences of the United States of America. 1986;83:4913-4917 141  49. Nukina N, Ihara Y. One of the antigenic determinants of paired helical filaments is related to tau protein. Journal of biochemistry. 1986;99:1541-1544 50. Kosik KS, Joachim CL, Selkoe DJ. Microtubule-associated protein tau (tau) is a major antigenic component of paired helical filaments in alzheimer disease. Proceedings of the National Academy of Sciences of the United States of America. 1986;83:4044-4048 51. Mandelkow EM, Mandelkow E. Biochemistry and cell biology of tau protein in neurofibrillary degeneration. Cold Spring Harbor perspectives in medicine. 2012;2:a006247 52. Hutton M, Lendon CL, Rizzu P, Baker M, Froelich S, Houlden H, Pickering-Brown S, Chakraverty S, Isaacs A, Grover A, Hackett J, Adamson J, Lincoln S, Dickson D, Davies P, Petersen RC, Stevens M, de Graaff E, Wauters E, van Baren J, Hillebrand M, Joosse M, Kwon JM, Nowotny P, Che LK, Norton J, Morris JC, Reed LA, Trojanowski J, Basun H, Lannfelt L, Neystat M, Fahn S, Dark F, Tannenberg T, Dodd PR, Hayward N, Kwok JB, Schofield PR, Andreadis A, Snowden J, Craufurd D, Neary D, Owen F, Oostra BA, Hardy J, Goate A, van Swieten J, Mann D, Lynch T, Heutink P. Association of missense and 5'-splice-site mutations in tau with the inherited dementia ftdp-17. Nature. 1998;393:702-705 53. Poorkaj P, Bird TD, Wijsman E, Nemens E, Garruto RM, Anderson L, Andreadis A, Wiederholt WC, Raskind M, Schellenberg GD. Tau is a candidate gene for chromosome 17 frontotemporal dementia. Annals of neurology. 1998;43:815-825 54. Spillantini MG, Murrell JR, Goedert M, Farlow MR, Klug A, Ghetti B. Mutation in the tau gene in familial multiple system tauopathy with presenile dementia. Proceedings of the National Academy of Sciences of the United States of America. 1998;95:7737-7741 55. Roberts GW. Immunocytochemistry of neurofibrillary tangles in dementia pugilistica and alzheimer's disease: Evidence for common genesis. Lancet. 1988;2:1456-1458 56. Glenner GG, Wong CW. Alzheimer's disease: Initial report of the purification and characterization of a novel cerebrovascular amyloid protein. Biochemical and biophysical research communications. 1984;120:885-890 57. Masters CL, Simms G, Weinman NA, Multhaup G, McDonald BL, Beyreuther K. Amyloid plaque core protein in alzheimer disease and down syndrome. Proceedings of the National Academy of Sciences of the United States of America. 1985;82:4245-4249 58. Haass C, Kaether C, Thinakaran G, Sisodia S. Trafficking and proteolytic processing of app. Cold Spring Harbor perspectives in medicine. 2012;2:a006270 59. Kang J, Lemaire HG, Unterbeck A, Salbaum JM, Masters CL, Grzeschik KH, Multhaup G, Beyreuther K, Muller-Hill B. The precursor of alzheimer's disease amyloid a4 protein resembles a cell-surface receptor. Nature. 1987;325:733-736 142  60. Tanzi RE, Gusella JF, Watkins PC, Bruns GA, St George-Hyslop P, Van Keuren ML, Patterson D, Pagan S, Kurnit DM, Neve RL. Amyloid beta protein gene: Cdna, mrna distribution, and genetic linkage near the alzheimer locus. Science. 1987;235:880-884 61. Estus S, Golde TE, Younkin SG. Normal processing of the alzheimer's disease amyloid beta protein precursor generates potentially amyloidogenic carboxyl-terminal derivatives. Annals of the New York Academy of Sciences. 1992;674:138-148 62. Haass C, Selkoe DJ. Cellular processing of beta-amyloid precursor protein and the genesis of amyloid beta-peptide. Cell. 1993;75:1039-1042 63. Naslund J, Jensen M, Tjernberg LO, Thyberg J, Terenius L, Nordstedt C. The metabolic pathway generating p3, an a beta-peptide fragment, is probably non-amyloidogenic. Biochemical and biophysical research communications. 1994;204:780-787 64. Esch FS, Keim PS, Beattie EC, Blacher RW, Culwell AR, Oltersdorf T, McClure D, Ward PJ. Cleavage of amyloid beta peptide during constitutive processing of its precursor. Science. 1990;248:1122-1124 65. Sisodia SS, Koo EH, Beyreuther K, Unterbeck A, Price DL. Evidence that beta-amyloid protein in alzheimer's disease is not derived by normal processing. Science. 1990;248:492-495 66. Gu Y, Misonou H, Sato T, Dohmae N, Takio K, Ihara Y. Distinct intramembrane cleavage of the beta-amyloid precursor protein family resembling gamma-secretase-like cleavage of notch. The Journal of biological chemistry. 2001;276:35235-35238 67. Sastre M, Steiner H, Fuchs K, Capell A, Multhaup G, Condron MM, Teplow DB, Haass C. Presenilin-dependent gamma-secretase processing of beta-amyloid precursor protein at a site corresponding to the s3 cleavage of notch. EMBO reports. 2001;2:835-841 68. Weidemann A, Eggert S, Reinhard FB, Vogel M, Paliga K, Baier G, Masters CL, Beyreuther K, Evin G. A novel epsilon-cleavage within the transmembrane domain of the alzheimer amyloid precursor protein demonstrates homology with notch processing. Biochemistry. 2002;41:2825-2835 69. Seubert P, Vigo-Pelfrey C, Esch F, Lee M, Dovey H, Davis D, Sinha S, Schlossmacher M, Whaley J, Swindlehurst C, et al. Isolation and quantification of soluble alzheimer's beta-peptide from biological fluids. Nature. 1992;359:325-327 70. Fagan AM, Perrin RJ. Upcoming candidate cerebrospinal fluid biomarkers of alzheimer's disease. Biomarkers in medicine. 2012;6:455-476 71. Masters CL, Selkoe DJ. Biochemistry of amyloid beta-protein and amyloid deposits in alzheimer disease. Cold Spring Harbor perspectives in medicine. 2012;2:a006262 143  72. Iwatsubo T, Odaka A, Suzuki N, Mizusawa H, Nukina N, Ihara Y. Visualization of a beta 42(43) and a beta 40 in senile plaques with end-specific a beta monoclonals: Evidence that an initially deposited species is a beta 42(43). Neuron. 1994;13:45-53 73. Suzuki N, Iwatsubo T, Odaka A, Ishibashi Y, Kitada C, Ihara Y. High tissue content of soluble beta 1-40 is linked to cerebral amyloid angiopathy. The American journal of pathology. 1994;145:452-460 74. Levy E, Carman MD, Fernandez-Madrid IJ, Power MD, Lieberburg I, van Duinen SG, Bots GT, Luyendijk W, Frangione B. Mutation of the alzheimer's disease amyloid gene in hereditary cerebral hemorrhage, dutch type. Science. 1990;248:1124-1126 75. Van Broeckhoven C, Haan J, Bakker E, Hardy JA, Van Hul W, Wehnert A, Vegter-Van der Vlis M, Roos RA. Amyloid beta protein precursor gene and hereditary cerebral hemorrhage with amyloidosis (dutch). Science. 1990;248:1120-1122 76. Herzig MC, Winkler DT, Burgermeister P, Pfeifer M, Kohler E, Schmidt SD, Danner S, Abramowski D, Sturchler-Pierrat C, Burki K, van Duinen SG, Maat-Schieman ML, Staufenbiel M, Mathews PM, Jucker M. Abeta is targeted to the vasculature in a mouse model of hereditary cerebral hemorrhage with amyloidosis. Nature neuroscience. 2004;7:954-960 77. Van Dorpe J, Smeijers L, Dewachter I, Nuyens D, Spittaels K, Van Den Haute C, Mercken M, Moechars D, Laenen I, Kuiperi C, Bruynseels K, Tesseur I, Loos R, Vanderstichele H, Checler F, Sciot R, Van Leuven F. Prominent cerebral amyloid angiopathy in transgenic mice overexpressing the london mutant of human app in neurons. The American journal of pathology. 2000;157:1283-1298 78. McGowan E, Pickford F, Kim J, Onstead L, Eriksen J, Yu C, Skipper L, Murphy MP, Beard J, Das P, Jansen K, Delucia M, Lin WL, Dolios G, Wang R, Eckman CB, Dickson DW, Hutton M, Hardy J, Golde T. Abeta42 is essential for parenchymal and vascular amyloid deposition in mice. Neuron. 2005;47:191-199 79. Hardy J, Selkoe DJ. The amyloid hypothesis of alzheimer's disease: Progress and problems on the road to therapeutics. Science. 2002;297:353-356 80. Walsh DM, Selkoe DJ. A beta oligomers - a decade of discovery. Journal of neurochemistry. 2007;101:1172-1184 81. Tanzi RE. The genetics of alzheimer disease. Cold Spring Harbor perspectives in medicine. 2012;2 82. Sherrington R, Rogaev EI, Liang Y, Rogaeva EA, Levesque G, Ikeda M, Chi H, Lin C, Li G, Holman K, Tsuda T, Mar L, Foncin JF, Bruni AC, Montesi MP, Sorbi S, Rainero I, Pinessi L, Nee L, Chumakov I, Pollen D, Brookes A, Sanseau P, Polinsky RJ, Wasco W, Da Silva HA, Haines JL, Perkicak-Vance MA, Tanzi RE, Roses AD, Fraser PE, 144  Rommens JM, St George-Hyslop PH. Cloning of a gene bearing missense mutations in early-onset familial alzheimer's disease. Nature. 1995;375:754-760 83. Levy-Lahad E, Wasco W, Poorkaj P, Romano DM, Oshima J, Pettingell WH, Yu CE, Jondro PD, Schmidt SD, Wang K, et al. Candidate gene for the chromosome 1 familial alzheimer's disease locus. Science. 1995;269:973-977 84. Rogaev EI, Sherrington R, Rogaeva EA, Levesque G, Ikeda M, Liang Y, Chi H, Lin C, Holman K, Tsuda T, et al. Familial alzheimer's disease in kindreds with missense mutations in a gene on chromosome 1 related to the alzheimer's disease type 3 gene. Nature. 1995;376:775-778 85. Kumar-Singh S, De Jonghe C, Cruts M, Kleinert R, Wang R, Mercken M, De Strooper B, Vanderstichele H, Lofgren A, Vanderhoeven I, Backhovens H, Vanmechelen E, Kroisel PM, Van Broeckhoven C. Nonfibrillar diffuse amyloid deposition due to a gamma(42)-secretase site mutation points to an essential role for n-truncated a beta(42) in alzheimer's disease. Human molecular genetics. 2000;9:2589-2598 86. Pasalar P, Najmabadi H, Noorian AR, Moghimi B, Jannati A, Soltanzadeh A, Krefft T, Crook R, Hardy J. An iranian family with alzheimer's disease caused by a novel app mutation (thr714ala). Neurology. 2002;58:1574-1575 87. Ancolio K, Dumanchin C, Barelli H, Warter JM, Brice A, Campion D, Frebourg T, Checler F. Unusual phenotypic alteration of beta amyloid precursor protein (betaapp) maturation by a new val-715 --> met betaapp-770 mutation responsible for probable early-onset alzheimer's disease. Proceedings of the National Academy of Sciences of the United States of America. 1999;96:4119-4124 88. De Jonghe C, Esselens C, Kumar-Singh S, Craessaerts K, Serneels S, Checler F, Annaert W, Van Broeckhoven C, De Strooper B. Pathogenic app mutations near the gamma-secretase cleavage site differentially affect abeta secretion and app c-terminal fragment stability. Human molecular genetics. 2001;10:1665-1671 89. Eckman CB, Mehta ND, Crook R, Perez-tur J, Prihar G, Pfeiffer E, Graff-Radford N, Hinder P, Yager D, Zenk B, Refolo LM, Prada CM, Younkin SG, Hutton M, Hardy J. A new pathogenic mutation in the app gene (i716v) increases the relative proportion of a beta 42(43). Human molecular genetics. 1997;6:2087-2089 90. Goate A, Chartier-Harlin MC, Mullan M, Brown J, Crawford F, Fidani L, Giuffra L, Haynes A, Irving N, James L, et al. Segregation of a missense mutation in the amyloid precursor protein gene with familial alzheimer's disease. Nature. 1991;349:704-706 91. Mullan M, Crawford F, Axelman K, Houlden H, Lilius L, Winblad B, Lannfelt L. A pathogenic mutation for probable alzheimer's disease in the app gene at the n-terminus of beta-amyloid. Nature genetics. 1992;1:345-347 145  92. Kamino K, Orr HT, Payami H, Wijsman EM, Alonso ME, Pulst SM, Anderson L, O'Dahl S, Nemens E, White JA, et al. Linkage and mutational analysis of familial alzheimer disease kindreds for the app gene region. American journal of human genetics. 1992;51:998-1014 93. Olson MI, Shaw CM. Presenile dementia and alzheimer's disease in mongolism. Brain : a journal of neurology. 1969;92:147-156 94. Mann DM, Yates PO, Marcyniuk B. Alzheimer's presenile dementia, senile dementia of alzheimer type and down's syndrome in middle age form an age related continuum of pathological changes. Neuropathology and applied neurobiology. 1984;10:185-207 95. Motte J, Williams RS. Age-related changes in the density and morphology of plaques and neurofibrillary tangles in down syndrome brain. Acta neuropathologica. 1989;77:535-546 96. Rumble B, Retallack R, Hilbich C, Simms G, Multhaup G, Martins R, Hockey A, Montgomery P, Beyreuther K, Masters CL. Amyloid a4 protein and its precursor in down's syndrome and alzheimer's disease. The New England journal of medicine. 1989;320:1446-1452 97. Mann DM, Pickering-Brown SM, Siddons MA, Iwatsubo T, Ihara Y, Asami-Odaka A, Suzuki N. The extent of amyloid deposition in brain in patients with down's syndrome does not depend upon the apolipoprotein e genotype. Neuroscience letters. 1995;196:105-108 98. Lemere CA, Blusztajn JK, Yamaguchi H, Wisniewski T, Saido TC, Selkoe DJ. Sequence of deposition of heterogeneous amyloid beta-peptides and apo e in down syndrome: Implications for initial events in amyloid plaque formation. Neurobiology of disease. 1996;3:16-32 99. LaFerla FM, Green KN. Animal models of alzheimer disease. Cold Spring Harbor perspectives in medicine. 2012;2 100. Klohs J, Rudin M, Shimshek DR, Beckmann N. Imaging of cerebrovascular pathology in animal models of alzheimer's disease. Frontiers in aging neuroscience. 2014;6:32 101. Akiyama H, Barger S, Barnum S, Bradt B, Bauer J, Cole GM, Cooper NR, Eikelenboom P, Emmerling M, Fiebich BL, Finch CE, Frautschy S, Griffin WS, Hampel H, Hull M, Landreth G, Lue L, Mrak R, Mackenzie IR, McGeer PL, O'Banion MK, Pachter J, Pasinetti G, Plata-Salaman C, Rogers J, Rydel R, Shen Y, Streit W, Strohmeyer R, Tooyoma I, Van Muiswinkel FL, Veerhuis R, Walker D, Webster S, Wegrzyniak B, Wenk G, Wyss-Coray T. Inflammation and alzheimer's disease. Neurobiology of aging. 2000;21:383-421 146  102. Oddo S, Caccamo A, Kitazawa M, Tseng BP, LaFerla FM. Amyloid deposition precedes tangle formation in a triple transgenic model of alzheimer's disease. Neurobiology of aging. 2003;24:1063-1070 103. Lewis J, Dickson DW, Lin WL, Chisholm L, Corral A, Jones G, Yen SH, Sahara N, Skipper L, Yager D, Eckman C, Hardy J, Hutton M, McGowan E. Enhanced neurofibrillary degeneration in transgenic mice expressing mutant tau and app. Science. 2001;293:1487-1491 104. Gotz J, Chen F, van Dorpe J, Nitsch RM. Formation of neurofibrillary tangles in p301l tau transgenic mice induced by abeta 42 fibrils. Science. 2001;293:1491-1495 105. Rebeck GW, Reiter JS, Strickland DK, Hyman BT. Apolipoprotein e in sporadic alzheimer's disease: Allelic variation and receptor interactions. Neuron. 1993;11:575-580 106. Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC, Small GW, Roses AD, Haines JL, Pericak-Vance MA. Gene dose of apolipoprotein e type 4 allele and the risk of alzheimer's disease in late onset families. Science. 1993;261:921-923 107. Verghese PB, Castellano JM, Holtzman DM. Apolipoprotein e in alzheimer's disease and other neurological disorders. Lancet neurology. 2011;10:241-252 108. Kanekiyo T, Xu H, Bu G. Apoe and abeta in alzheimer's disease: Accidental encounters or partners? Neuron. 2014;81:740-754 109. Katzman R. Alzheimer's disease. The New England journal of medicine. 1986;314:964-973 110. Terry RD, Masliah E, Salmon DP, Butters N, DeTeresa R, Hill R, Hansen LA, Katzman R. Physical basis of cognitive alterations in alzheimer's disease: Synapse loss is the major correlate of cognitive impairment. Annals of neurology. 1991;30:572-580 111. Dickson DW, Crystal HA, Bevona C, Honer W, Vincent I, Davies P. Correlations of synaptic and pathological markers with cognition of the elderly. Neurobiology of aging. 1995;16:285-298; discussion 298-304 112. Giannakopoulos P, Herrmann FR, Bussiere T, Bouras C, Kovari E, Perl DP, Morrison JH, Gold G, Hof PR. Tangle and neuron numbers, but not amyloid load, predict cognitive status in alzheimer's disease. Neurology. 2003;60:1495-1500 113. Ingelsson M, Fukumoto H, Newell KL, Growdon JH, Hedley-Whyte ET, Frosch MP, Albert MS, Hyman BT, Irizarry MC. Early abeta accumulation and progressive synaptic loss, gliosis, and tangle formation in ad brain. Neurology. 2004;62:925-931 114. Jack CR, Jr., Lowe VJ, Weigand SD, Wiste HJ, Senjem ML, Knopman DS, Shiung MM, Gunter JL, Boeve BF, Kemp BJ, Weiner M, Petersen RC, Alzheimer's Disease Neuroimaging I. Serial pib and mri in normal, mild cognitive impairment and alzheimer's 147  disease: Implications for sequence of pathological events in alzheimer's disease. Brain : a journal of neurology. 2009;132:1355-1365 115. Johnson KA, Fox NC, Sperling RA, Klunk WE. Brain imaging in alzheimer disease. Cold Spring Harbor perspectives in medicine. 2012;2:a006213 116. Moechars D, Dewachter I, Lorent K, Reverse D, Baekelandt V, Naidu A, Tesseur I, Spittaels K, Haute CV, Checler F, Godaux E, Cordell B, Van Leuven F. Early phenotypic changes in transgenic mice that overexpress different mutants of amyloid precursor protein in brain. The Journal of biological chemistry. 1999;274:6483-6492 117. Chapman PF, White GL, Jones MW, Cooper-Blacketer D, Marshall VJ, Irizarry M, Younkin L, Good MA, Bliss TV, Hyman BT, Younkin SG, Hsiao KK. Impaired synaptic plasticity and learning in aged amyloid precursor protein transgenic mice. Nature neuroscience. 1999;2:271-276 118. Mucke L, Masliah E, Yu GQ, Mallory M, Rockenstein EM, Tatsuno G, Hu K, Kholodenko D, Johnson-Wood K, McConlogue L. High-level neuronal expression of abeta 1-42 in wild-type human amyloid protein precursor transgenic mice: Synaptotoxicity without plaque formation. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2000;20:4050-4058 119. Westerman MA, Cooper-Blacketer D, Mariash A, Kotilinek L, Kawarabayashi T, Younkin LH, Carlson GA, Younkin SG, Ashe KH. The relationship between abeta and memory in the tg2576 mouse model of alzheimer's disease. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2002;22:1858-1867 120. Dineley KT, Xia X, Bui D, Sweatt JD, Zheng H. Accelerated plaque accumulation, associative learning deficits, and up-regulation of alpha 7 nicotinic receptor protein in transgenic mice co-expressing mutant human presenilin 1 and amyloid precursor proteins. The Journal of biological chemistry. 2002;277:22768-22780 121. Wu CC, Chawla F, Games D, Rydel RE, Freedman S, Schenk D, Young WG, Morrison JH, Bloom FE. Selective vulnerability of dentate granule cells prior to amyloid deposition in pdapp mice: Digital morphometric analyses. Proceedings of the National Academy of Sciences of the United States of America. 2004;101:7141-7146 122. Lesne S, Koh MT, Kotilinek L, Kayed R, Glabe CG, Yang A, Gallagher M, Ashe KH. A specific amyloid-beta protein assembly in the brain impairs memory. Nature. 2006;440:352-357 123. Lue LF, Kuo YM, Roher AE, Brachova L, Shen Y, Sue L, Beach T, Kurth JH, Rydel RE, Rogers J. Soluble amyloid beta peptide concentration as a predictor of synaptic change in alzheimer's disease. The American journal of pathology. 1999;155:853-862 148  124. McLean CA, Cherny RA, Fraser FW, Fuller SJ, Smith MJ, Beyreuther K, Bush AI, Masters CL. Soluble pool of abeta amyloid as a determinant of severity of neurodegeneration in alzheimer's disease. Annals of neurology. 1999;46:860-866 125. Wang J, Dickson DW, Trojanowski JQ, Lee VM. The levels of soluble versus insoluble brain abeta distinguish alzheimer's disease from normal and pathologic aging. Experimental neurology. 1999;158:328-337 126. Naslund J, Haroutunian V, Mohs R, Davis KL, Davies P, Greengard P, Buxbaum JD. Correlation between elevated levels of amyloid beta-peptide in the brain and cognitive decline. JAMA : the journal of the American Medical Association. 2000;283:1571-1577 127. Cairns NJ, Ikonomovic MD, Benzinger T, Storandt M, Fagan AM, Shah AR, Reinwald LT, Carter D, Felton A, Holtzman DM, Mintun MA, Klunk WE, Morris JC. Absence of pittsburgh compound b detection of cerebral amyloid beta in a patient with clinical, cognitive, and cerebrospinal fluid markers of alzheimer disease: A case report. Archives of neurology. 2009;66:1557-1562 128. Kokubo H, Kayed R, Glabe CG, Yamaguchi H. Soluble abeta oligomers ultrastructurally localize to cell processes and might be related to synaptic dysfunction in alzheimer's disease brain. Brain research. 2005;1031:222-228 129. Jacobsen JS, Wu CC, Redwine JM, Comery TA, Arias R, Bowlby M, Martone R, Morrison JH, Pangalos MN, Reinhart PH, Bloom FE. Early-onset behavioral and synaptic deficits in a mouse model of alzheimer's disease. Proceedings of the National Academy of Sciences of the United States of America. 2006;103:5161-5166 130. Haass C, Schlossmacher MG, Hung AY, Vigo-Pelfrey C, Mellon A, Ostaszewski BL, Lieberburg I, Koo EH, Schenk D, Teplow DB, et al. Amyloid beta-peptide is produced by cultured cells during normal metabolism. Nature. 1992;359:322-325 131. Shoji M, Golde TE, Ghiso J, Cheung TT, Estus S, Shaffer LM, Cai XD, McKay DM, Tintner R, Frangione B, et al. Production of the alzheimer amyloid beta protein by normal proteolytic processing. Science. 1992;258:126-129 132. Mawuenyega KG, Sigurdson W, Ovod V, Munsell L, Kasten T, Morris JC, Yarasheski KE, Bateman RJ. Decreased clearance of cns beta-amyloid in alzheimer's disease. Science. 2010;330:1774 133. Wildsmith KR, Holley M, Savage JC, Skerrett R, Landreth GE. Evidence for impaired amyloid beta clearance in alzheimer's disease. Alzheimer's research & therapy. 2013;5:33 134. Tanzi RE, Moir RD, Wagner SL. Clearance of alzheimer's abeta peptide: The many roads to perdition. Neuron. 2004;43:605-608 135. Saido T, Leissring MA. Proteolytic degradation of amyloid beta-protein. Cold Spring Harbor perspectives in medicine. 2012;2:a006379 149  136. Weller RO, Subash M, Preston SD, Mazanti I, Carare RO. Perivascular drainage of amyloid-beta peptides from the brain and its failure in cerebral amyloid angiopathy and alzheimer's disease. Brain pathology. 2008;18:253-266 137. Zlokovic BV, Yamada S, Holtzman D, Ghiso J, Frangione B. Clearance of amyloid beta-peptide from brain: Transport or metabolism? Nature medicine. 2000;6:718-719 138. Iwata N, Tsubuki S, Takaki Y, Watanabe K, Sekiguchi M, Hosoki E, Kawashima-Morishima M, Lee HJ, Hama E, Sekine-Aizawa Y, Saido TC. Identification of the major abeta1-42-degrading catabolic pathway in brain parenchyma: Suppression leads to biochemical and pathological deposition. Nature medicine. 2000;6:143-150 139. Roques BP, Noble F, Dauge V, Fournie-Zaluski MC, Beaumont A. Neutral endopeptidase 24.11: Structure, inhibition, and experimental and clinical pharmacology. Pharmacological reviews. 1993;45:87-146 140. Fukami S, Watanabe K, Iwata N, Haraoka J, Lu B, Gerard NP, Gerard C, Fraser P, Westaway D, St George-Hyslop P, Saido TC. Abeta-degrading endopeptidase, neprilysin, in mouse brain: Synaptic and axonal localization inversely correlating with abeta pathology. Neuroscience research. 2002;43:39-56 141. Wang DS, Lipton RB, Katz MJ, Davies P, Buschke H, Kuslansky G, Verghese J, Younkin SG, Eckman C, Dickson DW. Decreased neprilysin immunoreactivity in alzheimer disease, but not in pathological aging. Journal of neuropathology and experimental neurology. 2005;64:378-385 142. Wang S, Wang R, Chen L, Bennett DA, Dickson DW, Wang DS. Expression and functional profiling of neprilysin, insulin-degrading enzyme, and endothelin-converting enzyme in prospectively studied elderly and alzheimer's brain. Journal of neurochemistry. 2010;115:47-57 143. Iwata N, Tsubuki S, Takaki Y, Shirotani K, Lu B, Gerard NP, Gerard C, Hama E, Lee HJ, Saido TC. Metabolic regulation of brain abeta by neprilysin. Science. 2001;292:1550-1552 144. Kanemitsu H, Tomiyama T, Mori H. Human neprilysin is capable of degrading amyloid beta peptide not only in the monomeric form but also the pathological oligomeric form. Neuroscience letters. 2003;350:113-116 145. Leissring MA, Farris W, Chang AY, Walsh DM, Wu X, Sun X, Frosch MP, Selkoe DJ. Enhanced proteolysis of beta-amyloid in app transgenic mice prevents plaque formation, secondary pathology, and premature death. Neuron. 2003;40:1087-1093 146. Huang SM, Mouri A, Kokubo H, Nakajima R, Suemoto T, Higuchi M, Staufenbiel M, Noda Y, Yamaguchi H, Nabeshima T, Saido TC, Iwata N. Neprilysin-sensitive synapse-150  associated amyloid-beta peptide oligomers impair neuronal plasticity and cognitive function. The Journal of biological chemistry. 2006;281:17941-17951 147. Farris W, Schutz SG, Cirrito JR, Shankar GM, Sun X, George A, Leissring MA, Walsh DM, Qiu WQ, Holtzman DM, Selkoe DJ. Loss of neprilysin function promotes amyloid plaque formation and causes cerebral amyloid angiopathy. The American journal of pathology. 2007;171:241-251 148. Meilandt WJ, Cisse M, Ho K, Wu T, Esposito LA, Scearce-Levie K, Cheng IH, Yu GQ, Mucke L. Neprilysin overexpression inhibits plaque formation but fails to reduce pathogenic abeta oligomers and associated cognitive deficits in human amyloid precursor protein transgenic mice. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2009;29:1977-1986 149. Hemming ML, Patterson M, Reske-Nielsen C, Lin L, Isacson O, Selkoe DJ. Reducing amyloid plaque burden via ex vivo gene delivery of an abeta-degrading protease: A novel therapeutic approach to alzheimer disease. PLoS medicine. 2007;4:e262 150. Qiu WQ, Walsh DM, Ye Z, Vekrellis K, Zhang J, Podlisny MB, Rosner MR, Safavi A, Hersh LB, Selkoe DJ. Insulin-degrading enzyme regulates extracellular levels of amyloid beta-protein by degradation. The Journal of biological chemistry. 1998;273:32730-32738 151. Vekrellis K, Ye Z, Qiu WQ, Walsh D, Hartley D, Chesneau V, Rosner MR, Selkoe DJ. Neurons regulate extracellular levels of amyloid beta-protein via proteolysis by insulin-degrading enzyme. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2000;20:1657-1665 152. Farris W, Mansourian S, Chang Y, Lindsley L, Eckman EA, Frosch MP, Eckman CB, Tanzi RE, Selkoe DJ, Guenette S. Insulin-degrading enzyme regulates the levels of insulin, amyloid beta-protein, and the beta-amyloid precursor protein intracellular domain in vivo. Proceedings of the National Academy of Sciences of the United States of America. 2003;100:4162-4167 153. Zhang Y, Wang B, Wan H, Zhou Q, Li T. Meta-analysis of the insulin degrading enzyme polymorphisms and susceptibility to alzheimer's disease. Neuroscience letters. 2013;541:132-137 154. Stargardt A, Gillis J, Kamphuis W, Wiemhoefer A, Kooijman L, Raspe M, Benckhuijsen W, Drijfhout JW, Hol EM, Reits E. Reduced amyloid-beta degradation in early alzheimer's disease but not in the appsweps1de9 and 3xtg-ad mouse models. Aging cell. 2013;12:499-507 155. Eckman EA, Watson M, Marlow L, Sambamurti K, Eckman CB. Alzheimer's disease beta-amyloid peptide is increased in mice deficient in endothelin-converting enzyme. The Journal of biological chemistry. 2003;278:2081-2084 151  156. Yin KJ, Cirrito JR, Yan P, Hu X, Xiao Q, Pan X, Bateman R, Song H, Hsu FF, Turk J, Xu J, Hsu CY, Mills JC, Holtzman DM, Lee JM. Matrix metalloproteinases expressed by astrocytes mediate extracellular amyloid-beta peptide catabolism. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2006;26:10939-10948 157. Eckman EA, Adams SK, Troendle FJ, Stodola BA, Kahn MA, Fauq AH, Xiao HD, Bernstein KE, Eckman CB. Regulation of steady-state beta-amyloid levels in the brain by neprilysin and endothelin-converting enzyme but not angiotensin-converting enzyme. The Journal of biological chemistry. 2006;281:30471-30478 158. Yan P, Hu X, Song H, Yin K, Bateman RJ, Cirrito JR, Xiao Q, Hsu FF, Turk JW, Xu J, Hsu CY, Holtzman DM, Lee JM. Matrix metalloproteinase-9 degrades amyloid-beta fibrils in vitro and compact plaques in situ. The Journal of biological chemistry. 2006;281:24566-24574 159. Carvalho KM, Franca MS, Camarao GC, Ruchon AF. A new brain metalloendopeptidase which degrades the alzheimer beta-amyloid 1-40 peptide producing soluble fragments without neurotoxic effects. Brazilian journal of medical and biological research = Revista brasileira de pesquisas medicas e biologicas / Sociedade Brasileira de Biofisica ... [et al.]. 1997;30:1153-1156 160. Hu J, Igarashi A, Kamata M, Nakagawa H. Angiotensin-converting enzyme degrades alzheimer amyloid beta-peptide (a beta ); retards a beta aggregation, deposition, fibril formation; and inhibits cytotoxicity. The Journal of biological chemistry. 2001;276:47863-47868 161. Sagare AP, Bell RD, Zlokovic BV. Neurovascular dysfunction and faulty amyloid beta-peptide clearance in alzheimer disease. Cold Spring Harbor perspectives in medicine. 2012;2 162. Herz J, Bock HH. Lipoprotein receptors in the nervous system. Annual review of biochemistry. 2002;71:405-434 163. Shibata M, Yamada S, Kumar SR, Calero M, Bading J, Frangione B, Holtzman DM, Miller CA, Strickland DK, Ghiso J, Zlokovic BV. Clearance of alzheimer's amyloid-ss(1-40) peptide from brain by ldl receptor-related protein-1 at the blood-brain barrier. The Journal of clinical investigation. 2000;106:1489-1499 164. Deane R, Wu Z, Sagare A, Davis J, Du Yan S, Hamm K, Xu F, Parisi M, LaRue B, Hu HW, Spijkers P, Guo H, Song X, Lenting PJ, Van Nostrand WE, Zlokovic BV. Lrp/amyloid beta-peptide interaction mediates differential brain efflux of abeta isoforms. Neuron. 2004;43:333-344 165. Ito S, Ohtsuki S, Terasaki T. Functional characterization of the brain-to-blood efflux clearance of human amyloid-beta peptide (1-40) across the rat blood-brain barrier. Neuroscience research. 2006;56:246-252 152  166. Bell RD, Sagare AP, Friedman AE, Bedi GS, Holtzman DM, Deane R, Zlokovic BV. Transport pathways for clearance of human alzheimer's amyloid beta-peptide and apolipoproteins e and j in the mouse central nervous system. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism. 2007;27:909-918 167. Donahue JE, Flaherty SL, Johanson CE, Duncan JA, 3rd, Silverberg GD, Miller MC, Tavares R, Yang W, Wu Q, Sabo E, Hovanesian V, Stopa EG. Rage, lrp-1, and amyloid-beta protein in alzheimer's disease. Acta neuropathologica. 2006;112:405-415 168. Yan SD, Yan SF, Chen X, Fu J, Chen M, Kuppusamy P, Smith MA, Perry G, Godman GC, Nawroth P, et al. Non-enzymatically glycated tau in alzheimer's disease induces neuronal oxidant stress resulting in cytokine gene expression and release of amyloid beta-peptide. Nature medicine. 1995;1:693-699 169. Yan SD, Chen X, Fu J, Chen M, Zhu H, Roher A, Slattery T, Zhao L, Nagashima M, Morser J, Migheli A, Nawroth P, Stern D, Schmidt AM. Rage and amyloid-beta peptide neurotoxicity in alzheimer's disease. Nature. 1996;382:685-691 170. Deane R, Du Yan S, Submamaryan RK, LaRue B, Jovanovic S, Hogg E, Welch D, Manness L, Lin C, Yu J, Zhu H, Ghiso J, Frangione B, Stern A, Schmidt AM, Armstrong DL, Arnold B, Liliensiek B, Nawroth P, Hofman F, Kindy M, Stern D, Zlokovic B. Rage mediates amyloid-beta peptide transport across the blood-brain barrier and accumulation in brain. Nature medicine. 2003;9:907-913 171. Sturchler E, Galichet A, Weibel M, Leclerc E, Heizmann CW. Site-specific blockade of rage-vd prevents amyloid-beta oligomer neurotoxicity. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2008;28:5149-5158 172. Mackic JB, Stins M, McComb JG, Calero M, Ghiso J, Kim KS, Yan SD, Stern D, Schmidt AM, Frangione B, Zlokovic BV. Human blood-brain barrier receptors for alzheimer's amyloid-beta 1- 40. Asymmetrical binding, endocytosis, and transcytosis at the apical side of brain microvascular endothelial cell monolayer. The Journal of clinical investigation. 1998;102:734-743 173. Shiiki T, Ohtsuki S, Kurihara A, Naganuma H, Nishimura K, Tachikawa M, Hosoya K, Terasaki T. Brain insulin impairs amyloid-beta(1-40) clearance from the brain. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2004;24:9632-9637 174. Ito S, Ueno T, Ohtsuki S, Terasaki T. Lack of brain-to-blood efflux transport activity of low-density lipoprotein receptor-related protein-1 (lrp-1) for amyloid-beta peptide(1-40) in mouse: Involvement of an lrp-1-independent pathway. Journal of neurochemistry. 2010;113:1356-1363 153  175. Lam FC, Liu R, Lu P, Shapiro AB, Renoir JM, Sharom FJ, Reiner PB. Beta-amyloid efflux mediated by p-glycoprotein. Journal of neurochemistry. 2001;76:1121-1128 176. Cirrito JR, Deane R, Fagan AM, Spinner ML, Parsadanian M, Finn MB, Jiang H, Prior JL, Sagare A, Bales KR, Paul SM, Zlokovic BV, Piwnica-Worms D, Holtzman DM. P-glycoprotein deficiency at the blood-brain barrier increases amyloid-beta deposition in an alzheimer disease mouse model. The Journal of clinical investigation. 2005;115:3285-3290 177. Meredith JE, Jr., Thompson LA, Toyn JH, Marcin L, Barten DM, Marcinkeviciene J, Kopcho L, Kim Y, Lin A, Guss V, Burton C, Iben L, Polson C, Cantone J, Ford M, Drexler D, Fiedler T, Lentz KA, Grace JE, Jr., Kolb J, Corsa J, Pierdomenico M, Jones K, Olson RE, Macor JE, Albright CF. P-glycoprotein efflux and other factors limit brain amyloid beta reduction by beta-site amyloid precursor protein-cleaving enzyme 1 inhibitors in mice. The Journal of pharmacology and experimental therapeutics. 2008;326:502-513 178. Deo AK, Borson S, Link JM, Domino K, Eary JF, Ke B, Richards TL, Mankoff DA, Minoshima S, O'Sullivan F, Eyal S, Hsiao P, Maravilla K, Unadkat JD. Activity of p-glycoprotein, a beta-amyloid transporter at the blood-brain barrier, is compromised in patients with mild alzheimer disease. Journal of nuclear medicine : official publication, Society of Nuclear Medicine. 2014 179. van Assema DM, Lubberink M, Bauer M, van der Flier WM, Schuit RC, Windhorst AD, Comans EF, Hoetjes NJ, Tolboom N, Langer O, Muller M, Scheltens P, Lammertsma AA, van Berckel BN. Blood-brain barrier p-glycoprotein function in alzheimer's disease. Brain : a journal of neurology. 2012;135:181-189 180. Vogelgesang S, Cascorbi I, Schroeder E, Pahnke J, Kroemer HK, Siegmund W, Kunert-Keil C, Walker LC, Warzok RW. Deposition of alzheimer's beta-amyloid is inversely correlated with p-glycoprotein expression in the brains of elderly non-demented humans. Pharmacogenetics. 2002;12:535-541 181. Serot JM, Zmudka J, Jouanny P. A possible role for csf turnover and choroid plexus in the pathogenesis of late onset alzheimer's disease. Journal of Alzheimer's disease : JAD. 2012;30:17-26 182. Szentistvanyi I, Patlak CS, Ellis RA, Cserr HF. Drainage of interstitial fluid from different regions of rat brain. The American journal of physiology. 1984;246:F835-844 183. Abbott NJ. Evidence for bulk flow of brain interstitial fluid: Significance for physiology and pathology. Neurochemistry international. 2004;45:545-552 184. Sakka L, Coll G, Chazal J. Anatomy and physiology of cerebrospinal fluid. European annals of otorhinolaryngology, head and neck diseases. 2011;128:309-316 154  185. Johanson CE, Stopa EG, McMillan PN. The blood-cerebrospinal fluid barrier: Structure and functional significance. Methods in molecular biology. 2011;686:101-131 186. Weller RO. Microscopic morphology and histology of the human meninges. Morphologie : bulletin de l'Association des anatomistes. 2005;89:22-34 187. Cserr HF, DePasquale M, Harling-Berg CJ, Park JT, Knopf PM. Afferent and efferent arms of the humoral immune response to csf-administered albumins in a rat model with normal blood-brain barrier permeability. Journal of neuroimmunology. 1992;41:195-202 188. Kida S, Pantazis A, Weller RO. Csf drains directly from the subarachnoid space into nasal lymphatics in the rat. Anatomy, histology and immunological significance. Neuropathology and applied neurobiology. 1993;19:480-488 189. Boulton M, Flessner M, Armstrong D, Mohamed R, Hay J, Johnston M. Contribution of extracranial lymphatics and arachnoid villi to the clearance of a csf tracer in the rat. The American journal of physiology. 1999;276:R818-823 190. Kida S, Weller RO, Zhang ET, Phillips MJ, Iannotti F. Anatomical pathways for lymphatic drainage of the brain and their pathological significance. Neuropathology and applied neurobiology. 1995;21:181-184 191. Carare RO, Bernardes-Silva M, Newman TA, Page AM, Nicoll JA, Perry VH, Weller RO. Solutes, but not cells, drain from the brain parenchyma along basement membranes of capillaries and arteries: Significance for cerebral amyloid angiopathy and neuroimmunology. Neuropathology and applied neurobiology. 2008;34:131-144 192. Hawkes CA, Sullivan PM, Hands S, Weller RO, Nicoll JA, Carare RO. Disruption of arterial perivascular drainage of amyloid-beta from the brains of mice expressing the human apoe epsilon4 allele. PloS one. 2012;7:e41636 193. Hawkes CA, Gatherer M, Sharp MM, Dorr A, Yuen HM, Kalaria R, Weller RO, Carare RO. Regional differences in the morphological and functional effects of aging on cerebral basement membranes and perivascular drainage of amyloid-beta from the mouse brain. Aging cell. 2013;12:224-236 194. Ball KK, Cruz NF, Mrak RE, Dienel GA. Trafficking of glucose, lactate, and amyloid-beta from the inferior colliculus through perivascular routes. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism. 2010;30:162-176 195. Alperin NJ, Lee SH, Loth F, Raksin PB, Lichtor T. Mr-intracranial pressure (icp): A method to measure intracranial elastance and pressure noninvasively by means of mr imaging: Baboon and human study. Radiology. 2000;217:877-885 155  196. Schley D, Carare-Nnadi R, Please CP, Perry VH, Weller RO. Mechanisms to explain the reverse perivascular transport of solutes out of the brain. Journal of theoretical biology. 2006;238:962-974 197. Brown WR, Thore CR. Review: Cerebral microvascular pathology in ageing and neurodegeneration. Neuropathology and applied neurobiology. 2011;37:56-74 198. Arbel-Ornath M, Hudry E, Eikermann-Haerter K, Hou S, Gregory JL, Zhao L, Betensky RA, Frosch MP, Greenberg SM, Bacskai BJ. Interstitial fluid drainage is impaired in ischemic stroke and alzheimer's disease mouse models. Acta neuropathologica. 2013;126:353-364 199. Weller RO, Massey A, Newman TA, Hutchings M, Kuo YM, Roher AE. Cerebral amyloid angiopathy: Amyloid beta accumulates in putative interstitial fluid drainage pathways in alzheimer's disease. The American journal of pathology. 1998;153:725-733 200. Preston SD, Steart PV, Wilkinson A, Nicoll JA, Weller RO. Capillary and arterial cerebral amyloid angiopathy in alzheimer's disease: Defining the perivascular route for the elimination of amyloid beta from the human brain. Neuropathology and applied neurobiology. 2003;29:106-117 201. Utter S, Tamboli IY, Walter J, Upadhaya AR, Birkenmeier G, Pietrzik CU, Ghebremedhin E, Thal DR. Cerebral small vessel disease-induced apolipoprotein e leakage is associated with alzheimer disease and the accumulation of amyloid beta-protein in perivascular astrocytes. Journal of neuropathology and experimental neurology. 2008;67:842-856 202. Kanekiyo T, Liu CC, Shinohara M, Li J, Bu G. Lrp1 in brain vascular smooth muscle cells mediates local clearance of alzheimer's amyloid-beta. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2012;32:16458-16465 203. Zlokovic BV, Martel CL, Matsubara E, McComb JG, Zheng G, McCluskey RT, Frangione B, Ghiso J. Glycoprotein 330/megalin: Probable role in receptor-mediated transport of apolipoprotein j alone and in a complex with alzheimer disease amyloid beta at the blood-brain and blood-cerebrospinal fluid barriers. Proceedings of the National Academy of Sciences of the United States of America. 1996;93:4229-4234 204. Crossgrove JS, Li GJ, Zheng W. The choroid plexus removes beta-amyloid from brain cerebrospinal fluid. Experimental biology and medicine. 2005;230:771-776 205. Fujiyoshi M, Tachikawa M, Ohtsuki S, Ito S, Uchida Y, Akanuma S, Kamiie J, Hashimoto T, Hosoya K, Iwatsubo T, Terasaki T. Amyloid-beta peptide(1-40) elimination from cerebrospinal fluid involves low-density lipoprotein receptor-related protein 1 at the blood-cerebrospinal fluid barrier. Journal of neurochemistry. 2011;118:407-415 156  206. Pascale CL, Miller MC, Chiu C, Boylan M, Caralopoulos IN, Gonzalez L, Johanson CE, Silverberg GD. Amyloid-beta transporter expression at the blood-csf barrier is age-dependent. Fluids and barriers of the CNS. 2011;8:21 207. Klinge PM, Samii A, Niescken S, Brinker T, Silverberg GD. Brain amyloid accumulates in aged rats with kaolin-induced hydrocephalus. Neuroreport. 2006;17:657-660 208. Silverberg GD, Miller MC, Machan JT, Johanson CE, Caralopoulos IN, Pascale CL, Heile A, Klinge PM. Amyloid and tau accumulate in the brains of aged hydrocephalic rats. Brain research. 2010;1317:286-296 209. Strazielle N, Ghersi-Egea JF. Physiology of blood-brain interfaces in relation to brain disposition of small compounds and macromolecules. Molecular pharmaceutics. 2013;10:1473-1491 210. Bell RD, Winkler EA, Sagare AP, Singh I, LaRue B, Deane R, Zlokovic BV. Pericytes control key neurovascular functions and neuronal phenotype in the adult brain and during brain aging. Neuron. 2010;68:409-427 211. Dohrmann GJ, Bucy PC. Human choroid plexus: A light and electron microscopic study. Journal of neurosurgery. 1970;33:506-516 212. Faraci FM, Mayhan WG, Heistad DD. Effect of serotonin on blood flow to the choroid plexus. Brain research. 1989;478:121-126 213. Zheng W, Shen H, Blaner WS, Zhao Q, Ren X, Graziano JH. Chronic lead exposure alters transthyretin concentration in rat cerebrospinal fluid: The role of the choroid plexus. Toxicology and applied pharmacology. 1996;139:445-450 214. Segal MB. Transport of nutrients across the choroid plexus. Microscopy research and technique. 2001;52:38-48 215. Spector R. Nature and consequences of mammalian brain and csf efflux transporters: Four decades of progress. Journal of neurochemistry. 2010;112:13-23 216. de la Torre JC. Cerebral hemodynamics and vascular risk factors: Setting the stage for alzheimer's disease. Journal of Alzheimer's disease : JAD. 2012;32:553-567 217. Zlokovic BV. The blood-brain barrier in health and chronic neurodegenerative disorders. Neuron. 2008;57:178-201 218. Jagust WJ, Eberling JL, Reed BR, Mathis CA, Budinger TF. Clinical studies of cerebral blood flow in alzheimer's disease. Annals of the New York Academy of Sciences. 1997;826:254-262 219. Johnson KA, Jones K, Holman BL, Becker JA, Spiers PA, Satlin A, Albert MS. Preclinical prediction of alzheimer's disease using spect. Neurology. 1998;50:1563-1571 157  220. Hanyu H, Sato T, Hirao K, Kanetaka H, Iwamoto T, Koizumi K. The progression of cognitive deterioration and regional cerebral blood flow patterns in alzheimer's disease: A longitudinal spect study. Journal of the neurological sciences. 2010;290:96-101 221. Kim SM, Kim MJ, Rhee HY, Ryu CW, Kim EJ, Petersen ET, Jahng GH. Regional cerebral perfusion in patients with alzheimer's disease and mild cognitive impairment: Effect of apoe epsilon4 allele. Neuroradiology. 2013;55:25-34 222. Smith CD, Andersen AH, Kryscio RJ, Schmitt FA, Kindy MS, Blonder LX, Avison MJ. Altered brain activation in cognitively intact individuals at high risk for alzheimer's disease. Neurology. 1999;53:1391-1396 223. Bookheimer SY, Strojwas MH, Cohen MS, Saunders AM, Pericak-Vance MA, Mazziotta JC, Small GW. Patterns of brain activation in people at risk for alzheimer's disease. The New England journal of medicine. 2000;343:450-456 224. Ruitenberg A, den Heijer T, Bakker SL, van Swieten JC, Koudstaal PJ, Hofman A, Breteler MM. Cerebral hypoperfusion and clinical onset of dementia: The rotterdam study. Annals of neurology. 2005;57:789-794 225. Lind J, Persson J, Ingvar M, Larsson A, Cruts M, Van Broeckhoven C, Adolfsson R, Backman L, Nilsson LG, Petersson KM, Nyberg L. Reduced functional brain activity response in cognitively intact apolipoprotein e epsilon4 carriers. Brain : a journal of neurology. 2006;129:1240-1248 226. Wishart HA, Saykin AJ, Rabin LA, Santulli RB, Flashman LA, Guerin SJ, Mamourian AC, Belloni DR, Rhodes CH, McAllister TW. Increased brain activation during working memory in cognitively intact adults with the apoe epsilon4 allele. The American journal of psychiatry. 2006;163:1603-1610 227. Sheline YI, Morris JC, Snyder AZ, Price JL, Yan Z, D'Angelo G, Liu C, Dixit S, Benzinger T, Fagan A, Goate A, Mintun MA. Apoe4 allele disrupts resting state fmri connectivity in the absence of amyloid plaques or decreased csf abeta42. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2010;30:17035-17040 228. Wierenga CE, Clark LR, Dev SI, Shin DD, Jurick SM, Rissman RA, Liu TT, Bondi MW. Interaction of age and apoe genotype on cerebral blood flow at rest. Journal of Alzheimer's disease : JAD. 2013;34:921-935 229. Nicolakakis N, Hamel E. Neurovascular function in alzheimer's disease patients and experimental models. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism. 2011;31:1354-1370 230. Herholz K. Cerebral glucose metabolism in preclinical and prodromal alzheimer's disease. Expert review of neurotherapeutics. 2010;10:1667-1673 158  231. Jagust WJ, Bandy D, Chen K, Foster NL, Landau SM, Mathis CA, Price JC, Reiman EM, Skovronsky D, Koeppe RA, Alzheimer's Disease Neuroimaging I. The alzheimer's disease neuroimaging initiative positron emission tomography core. Alzheimer's & dementia : the journal of the Alzheimer's Association. 2010;6:221-229 232. Shin J, Lee SY, Kim SJ, Kim SH, Cho SJ, Kim YB. Voxel-based analysis of alzheimer's disease pet imaging using a triplet of radiotracers: Pib, fddnp, and fdg. NeuroImage. 2010;52:488-496 233. Iadecola C. Neurovascular regulation in the normal brain and in alzheimer's disease. Nature reviews. Neuroscience. 2004;5:347-360 234. Zlokovic BV. Neurovascular mechanisms of alzheimer's neurodegeneration. Trends in neurosciences. 2005;28:202-208 235. Lee JH, Bacskai BJ, Ayata C. Genetic animal models of cerebral vasculopathies. Progress in molecular biology and translational science. 2012;105:25-55 236. Rosenberg GA. Matrix metalloproteinases and their multiple roles in neurodegenerative diseases. Lancet neurology. 2009;8:205-216 237. Farrall AJ, Wardlaw JM. Blood-brain barrier: Ageing and microvascular disease--systematic review and meta-analysis. Neurobiology of aging. 2009;30:337-352 238. Grammas P. Neurovascular dysfunction, inflammation and endothelial activation: Implications for the pathogenesis of alzheimer's disease. Journal of neuroinflammation. 2011;8:26 239. Buee L, Hof PR, Delacourte A. Brain microvascular changes in alzheimer's disease and other dementias. Annals of the New York Academy of Sciences. 1997;826:7-24 240. Edelberg JM, Reed MJ. Aging and angiogenesis. Frontiers in bioscience : a journal and virtual library. 2003;8:s1199-1209 241. Paris D, Patel N, DelleDonne A, Quadros A, Smeed R, Mullan M. Impaired angiogenesis in a transgenic mouse model of cerebral amyloidosis. Neuroscience letters. 2004;366:80-85 242. Paris D, Townsend K, Quadros A, Humphrey J, Sun J, Brem S, Wotoczek-Obadia M, DelleDonne A, Patel N, Obregon DF, Crescentini R, Abdullah L, Coppola D, Rojiani AM, Crawford F, Sebti SM, Mullan M. Inhibition of angiogenesis by abeta peptides. Angiogenesis. 2004;7:75-85 243. Grammas P, Botchlet T, Fugate R, Ball MJ, Roher AE. Alzheimer disease amyloid proteins inhibit brain endothelial cell proliferation in vitro. Dementia. 1995;6:126-130 159  244. Biron KE, Dickstein DL, Gopaul R, Jefferies WA. Amyloid triggers extensive cerebral angiogenesis causing blood brain barrier permeability and hypervascularity in alzheimer's disease. PloS one. 2011;6:e23789 245. Biron KE, Dickstein DL, Gopaul R, Fenninger F, Jefferies WA. Cessation of neoangiogenesis in alzheimer's disease follows amyloid-beta immunization. Scientific reports. 2013;3:1354 246. Alvira-Botero X, Carro EM. Clearance of amyloid-beta peptide across the choroid plexus in alzheimer's disease. Current aging science. 2010;3:219-229 247. Serot JM, Bene MC, Faure GC. Comparative immunohistochemical characteristics of human choroid plexus in vascular and alzheimer's dementia. Human pathology. 1994;25:1185-1190 248. Serot JM, Bene MC, Foliguet B, Faure GC. Altered choroid plexus basement membrane and epithelium in late-onset alzheimer's disease: An ultrastructural study. Annals of the New York Academy of Sciences. 1997;826:507-509 249. Serot JM, Bene MC, Foliguet B, Faure GC. Morphological alterations of the choroid plexus in late-onset alzheimer's disease. Acta neuropathologica. 2000;99:105-108 250. Serot JM, Foliguet B, Bene MC, Faure GC. Choroid plexus and ageing in rats: A morphometric and ultrastructural study. The European journal of neuroscience. 2001;14:794-798 251. Miklossy J, Kraftsik R, Pillevuit O, Lepori D, Genton C, Bosman FT. Curly fiber and tangle-like inclusions in the ependyma and choroid plexus--a pathogenetic relationship with the cortical alzheimer-type changes? Journal of neuropathology and experimental neurology. 1998;57:1202-1212 252. Wen GY, Wisniewski HM, Kascsak RJ. Biondi ring tangles in the choroid plexus of alzheimer's disease and normal aging brains: A quantitative study. Brain research. 1999;832:40-46 253. Silverberg GD, Heit G, Huhn S, Jaffe RA, Chang SD, Bronte-Stewart H, Rubenstein E, Possin K, Saul TA. The cerebrospinal fluid production rate is reduced in dementia of the alzheimer's type. Neurology. 2001;57:1763-1766 254. Silverberg GD, Mayo M, Saul T, Rubenstein E, McGuire D. Alzheimer's disease, normal-pressure hydrocephalus, and senescent changes in csf circulatory physiology: A hypothesis. Lancet neurology. 2003;2:506-511 255. May C, Kaye JA, Atack JR, Schapiro MB, Friedland RP, Rapoport SI. Cerebrospinal fluid production is reduced in healthy aging. Neurology. 1990;40:500-503 160  256. Anthony SG, Schipper HM, Tavares R, Hovanesian V, Cortez SC, Stopa EG, Johanson CE. Stress protein expression in the alzheimer-diseased choroid plexus. Journal of Alzheimer's disease : JAD. 2003;5:171-177 257. Perez-Gracia E, Blanco R, Carmona M, Carro E, Ferrer I. Oxidative stress damage and oxidative stress responses in the choroid plexus in alzheimer's disease. Acta neuropathologica. 2009;118:497-504 258. Vargas T, Ugalde C, Spuch C, Antequera D, Moran MJ, Martin MA, Ferrer I, Bermejo-Pareja F, Carro E. Abeta accumulation in choroid plexus is associated with mitochondrial-induced apoptosis. Neurobiology of aging. 2010;31:1569-1581 259. Dietrich MO, Spuch C, Antequera D, Rodal I, de Yebenes JG, Molina JA, Bermejo F, Carro E. Megalin mediates the transport of leptin across the blood-csf barrier. Neurobiology of aging. 2008;29:902-912 260. Gorelick PB, Scuteri A, Black SE, Decarli C, Greenberg SM, Iadecola C, Launer LJ, Laurent S, Lopez OL, Nyenhuis D, Petersen RC, Schneider JA, Tzourio C, Arnett DK, Bennett DA, Chui HC, Higashida RT, Lindquist R, Nilsson PM, Roman GC, Sellke FW, Seshadri S, American Heart Association Stroke Council CoE, Prevention CoCNCoCR, Intervention, Council on Cardiovascular S, Anesthesia. Vascular contributions to cognitive impairment and dementia: A statement for healthcare professionals from the american heart association/american stroke association. Stroke; a journal of cerebral circulation. 2011;42:2672-2713 261. Jellinger KA. Prevalence and impact of cerebrovascular lesions in alzheimer and lewy body diseases. Neuro-degenerative diseases. 2010;7:112-115 262. Stopa EG, Berzin TM, Kim S, Song P, Kuo-LeBlanc V, Rodriguez-Wolf M, Baird A, Johanson CE. Human choroid plexus growth factors: What are the implications for csf dynamics in alzheimer's disease? Experimental neurology. 2001;167:40-47 263. Attems J, Jellinger K, Thal DR, Van Nostrand W. Review: Sporadic cerebral amyloid angiopathy. Neuropathology and applied neurobiology. 2011;37:75-93 264. Fiala M, Zhang L, Gan X, Sherry B, Taub D, Graves MC, Hama S, Way D, Weinand M, Witte M, Lorton D, Kuo YM, Roher AE. Amyloid-beta induces chemokine secretion and monocyte migration across a human blood--brain barrier model. Molecular medicine. 1998;4:480-489 265. Giri R, Shen Y, Stins M, Du Yan S, Schmidt AM, Stern D, Kim KS, Zlokovic B, Kalra VK. Beta-amyloid-induced migration of monocytes across human brain endothelial cells involves rage and pecam-1. American journal of physiology. Cell physiology. 2000;279:C1772-1781 161  266. Giri R, Selvaraj S, Miller CA, Hofman F, Yan SD, Stern D, Zlokovic BV, Kalra VK. Effect of endothelial cell polarity on beta-amyloid-induced migration of monocytes across normal and ad endothelium. American journal of physiology. Cell physiology. 2002;283:C895-904 267. Marco S, Skaper SD. Amyloid beta-peptide1-42 alters tight junction protein distribution and expression in brain microvessel endothelial cells. Neuroscience letters. 2006;401:219-224 268. Gonzalez-Velasquez FJ, Kotarek JA, Moss MA. Soluble aggregates of the amyloid-beta protein selectively stimulate permeability in human brain microvascular endothelial monolayers. Journal of neurochemistry. 2008;107:466-477 269. Tai LM, Holloway KA, Male DK, Loughlin AJ, Romero IA. Amyloid-beta-induced occludin down-regulation and increased permeability in human brain endothelial cells is mediated by mapk activation. Journal of cellular and molecular medicine. 2010;14:1101-1112 270. Hartz AM, Bauer B, Soldner EL, Wolf A, Boy S, Backhaus R, Mihaljevic I, Bogdahn U, Klunemann HH, Schuierer G, Schlachetzki F. Amyloid-beta contributes to blood-brain barrier leakage in transgenic human amyloid precursor protein mice and in humans with cerebral amyloid angiopathy. Stroke; a journal of cerebral circulation. 2012;43:514-523 271. Carrano A, Hoozemans JJ, van der Vies SM, Rozemuller AJ, van Horssen J, de Vries HE. Amyloid beta induces oxidative stress-mediated blood-brain barrier changes in capillary amyloid angiopathy. Antioxidants & redox signaling. 2011;15:1167-1178 272. Iadecola C, Zhang F, Niwa K, Eckman C, Turner SK, Fischer E, Younkin S, Borchelt DR, Hsiao KK, Carlson GA. Sod1 rescues cerebral endothelial dysfunction in mice overexpressing amyloid precursor protein. Nature neuroscience. 1999;2:157-161 273. Niwa K, Younkin L, Ebeling C, Turner SK, Westaway D, Younkin S, Ashe KH, Carlson GA, Iadecola C. Abeta 1-40-related reduction in functional hyperemia in mouse neocortex during somatosensory activation. Proceedings of the National Academy of Sciences of the United States of America. 2000;97:9735-9740 274. Thomas T, Thomas G, McLendon C, Sutton T, Mullan M. Beta-amyloid-mediated vasoactivity and vascular endothelial damage. Nature. 1996;380:168-171 275. Townsend KP, Obregon D, Quadros A, Patel N, Volmar C, Paris D, Mullan M. Proinflammatory and vasoactive effects of abeta in the cerebrovasculature. Annals of the New York Academy of Sciences. 2002;977:65-76 276. Niwa K, Carlson GA, Iadecola C. Exogenous a beta1-40 reproduces cerebrovascular alterations resulting from amyloid precursor protein overexpression in mice. Journal of 162  cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism. 2000;20:1659-1668 277. Ono K, Noguchi M, Matsumoto Y, Yanase D, Iwasa K, Naiki H, Yamada M. Cerebrospinal fluid of alzheimer patients promotes beta-amyloid fibril formation in vitro. Neurobiology of disease. 2005;20:233-240 278. Ikeda T, Ono K, Elashoff D, Condron MM, Noguchi-Shinohara M, Yoshita M, Teplow DB, Yamada M. Cerebrospinal fluid from alzheimer's disease patients promotes amyloid beta-protein oligomerization. Journal of Alzheimer's disease : JAD. 2010;21:81-86 279. Oakley R, Tharakan B. Vascular hyperpermeability and aging. Aging and disease. 2014;5:114-125 280. Mielke MM, Rosenberg PB, Tschanz J, Cook L, Corcoran C, Hayden KM, Norton M, Rabins PV, Green RC, Welsh-Bohmer KA, Breitner JC, Munger R, Lyketsos CG. Vascular factors predict rate of progression in alzheimer disease. Neurology. 2007;69:1850-1858 281. Mielke MM, Leoutsakos JM, Tschanz JT, Green RC, Tripodis Y, Corcoran CD, Norton MC, Lyketsos CG. Interaction between vascular factors and the apoe epsilon4 allele in predicting rate of progression in alzheimer's disease. Journal of Alzheimer's disease : JAD. 2011;26:127-134 282. Helzner EP, Luchsinger JA, Scarmeas N, Cosentino S, Brickman AM, Glymour MM, Stern Y. Contribution of vascular risk factors to the progression in alzheimer disease. Archives of neurology. 2009;66:343-348 283. Goldstein FC, Levey AI, Steenland NK. High blood pressure and cognitive decline in mild cognitive impairment. Journal of the American Geriatrics Society. 2013;61:67-73 284. Sparks DL, Scheff SW, Liu H, Landers TM, Coyne CM, Hunsaker JC, 3rd. Increased incidence of neurofibrillary tangles (nft) in non-demented individuals with hypertension. Journal of the neurological sciences. 1995;131:162-169 285. Starr JM, Whalley LJ, Inch S, Shering PA. Blood pressure and cognitive function in healthy old people. Journal of the American Geriatrics Society. 1993;41:753-756 286. Cacciatore F, Abete P, Ferrara N, Paolisso G, Amato L, Canonico S, Maggi S, Varricchio M, Rengo F. The role of blood pressure in cognitive impairment in an elderly population. Osservatorio geriatrico campano group. Journal of hypertension. 1997;15:135-142 287. Morris MC, Scherr PA, Hebert LE, Glynn RJ, Bennett DA, Evans DA. Association of incident alzheimer disease and blood pressure measured from 13 years before to 2 years after diagnosis in a large community study. Archives of neurology. 2001;58:1640-1646 163  288. Ninomiya T, Ohara T, Hirakawa Y, Yoshida D, Doi Y, Hata J, Kanba S, Iwaki T, Kiyohara Y. Midlife and late-life blood pressure and dementia in japanese elderly: The hisayama study. Hypertension. 2011;58:22-28 289. Hietanen H, Paakkonen R, Salomaa V. Ankle and exercise blood pressures as predictors of coronary morbidity and mortality in a prospective follow-up study. Journal of human hypertension. 2010;24:577-584 290. Hietanen HJ, Paakkonen R, Salomaa V. Ankle blood pressure and pulse pressure as predictors of cerebrovascular morbidity and mortality in a prospective follow-up study. Stroke research and treatment. 2011;2010:729391 291. Ix JH, Katz R, Peralta CA, de Boer IH, Allison MA, Bluemke DA, Siscovick DS, Lima JA, Criqui MH. A high ankle brachial index is associated with greater left ventricular mass mesa (multi-ethnic study of atherosclerosis). Journal of the American College of Cardiology. 2010;55:342-349 292. Tarumi T, Sugawara J, Tanaka H. Association between ankle blood pressure and central arterial wave reflection. Journal of human hypertension. 2011;25:539-544 293. Laurin D, Masaki KH, White LR, Launer LJ. Ankle-to-brachial index and dementia: The honolulu-asia aging study. Circulation. 2007;116:2269-2274 294. Hietanen H, Pietila A, Kahonen M, Salomaa V. Ankle blood pressure and dementia: A prospective follow-up study. Blood pressure monitoring. 2013;18:16-20 295. Elias MF, Robbins MA, Budge MM, Abhayaratna WP, Dore GA, Elias PK. Arterial pulse wave velocity and cognition with advancing age. Hypertension. 2009;53:668-673 296. Waldstein SR, Rice SC, Thayer JF, Najjar SS, Scuteri A, Zonderman AB. Pulse pressure and pulse wave velocity are related to cognitive decline in the baltimore longitudinal study of aging. Hypertension. 2008;51:99-104 297. Hanon O, Haulon S, Lenoir H, Seux ML, Rigaud AS, Safar M, Girerd X, Forette F. Relationship between arterial stiffness and cognitive function in elderly subjects with complaints of memory loss. Stroke; a journal of cerebral circulation. 2005;36:2193-2197 298. Poels MM, van Oijen M, Mattace-Raso FU, Hofman A, Koudstaal PJ, Witteman JC, Breteler MM. Arterial stiffness, cognitive decline, and risk of dementia: The rotterdam study. Stroke; a journal of cerebral circulation. 2007;38:888-892 299. van Beek AH, Claassen JA, Rikkert MG, Jansen RW. Cerebral autoregulation: An overview of current concepts and methodology with special focus on the elderly. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism. 2008;28:1071-1085 164  300. Zazulia AR. Regulation of cerebral blood flow in untreated mild-to-moderate hypertension. American journal of hypertension. 2009;22:344 301. Glodzik L, Rusinek H, Pirraglia E, McHugh P, Tsui W, Williams S, Cummings M, Li Y, Rich K, Randall C, Mosconi L, Osorio R, Murray J, Zetterberg H, Blennow K, de Leon M. Blood pressure decrease correlates with tau pathology and memory decline in hypertensive elderly. Neurobiology of aging. 2014;35:64-71 302. Morris MC, Scherr PA, Hebert LE, Bennett DA, Wilson RS, Glynn RJ, Evans DA. The cross-sectional association between blood pressure and alzheimer's disease in a biracial community population of older persons. The journals of gerontology. Series A, Biological sciences and medical sciences. 2000;55:M130-136 303. Hofman A, Ott A, Breteler MM, Bots ML, Slooter AJ, van Harskamp F, van Duijn CN, Van Broeckhoven C, Grobbee DE. Atherosclerosis, apolipoprotein e, and prevalence of dementia and alzheimer's disease in the rotterdam study. Lancet. 1997;349:151-154 304. Kalmijn S, Foley D, White L, Burchfiel CM, Curb JD, Petrovitch H, Ross GW, Havlik RJ, Launer LJ. Metabolic cardiovascular syndrome and risk of dementia in japanese-american elderly men. The honolulu-asia aging study. Arteriosclerosis, thrombosis, and vascular biology. 2000;20:2255-2260 305. Newman AB, Fitzpatrick AL, Lopez O, Jackson S, Lyketsos C, Jagust W, Ives D, Dekosky ST, Kuller LH. Dementia and alzheimer's disease incidence in relationship to cardiovascular disease in the cardiovascular health study cohort. Journal of the American Geriatrics Society. 2005;53:1101-1107 306. van Oijen M, de Jong FJ, Witteman JC, Hofman A, Koudstaal PJ, Breteler MM. Atherosclerosis and risk for dementia. Annals of neurology. 2007;61:403-410 307. Eringa EC, Serne EH, Meijer RI, Schalkwijk CG, Houben AJ, Stehouwer CD, Smulders YM, van Hinsbergh VW. Endothelial dysfunction in (pre)diabetes: Characteristics, causative mechanisms and pathogenic role in type 2 diabetes. Reviews in endocrine & metabolic disorders. 2013;14:39-48 308. Vanhoutte PM, Shimokawa H, Tang EH, Feletou M. Endothelial dysfunction and vascular disease. Acta physiologica. 2009;196:193-222 309. Taskinen MR. Diabetic dyslipidaemia: From basic research to clinical practice. Diabetologia. 2003;46:733-749 310. Emerging Risk Factors C, Di Angelantonio E, Sarwar N, Perry P, Kaptoge S, Ray KK, Thompson A, Wood AM, Lewington S, Sattar N, Packard CJ, Collins R, Thompson SG, Danesh J. Major lipids, apolipoproteins, and risk of vascular disease. JAMA : the journal of the American Medical Association. 2009;302:1993-2000 165  311. Mineo C, Shaul PW. Novel biological functions of high-density lipoprotein cholesterol. Circulation research. 2012;111:1079-1090 312. Bonarek M, Barberger-Gateau P, Letenneur L, Deschamps V, Iron A, Dubroca B, Dartigues JF. Relationships between cholesterol, apolipoprotein e polymorphism and dementia: A cross-sectional analysis from the paquid study. Neuroepidemiology. 2000;19:141-148 313. Reitz C, Tang MX, Schupf N, Manly JJ, Mayeux R, Luchsinger JA. Association of higher levels of high-density lipoprotein cholesterol in elderly individuals and lower risk of late-onset alzheimer disease. Archives of neurology. 2010;67:1491-1497 314. Zuliani G, Cavalieri M, Galvani M, Volpato S, Cherubini A, Bandinelli S, Corsi AM, Lauretani F, Guralnik JM, Fellin R, Ferrucci L. Relationship between low levels of high-density lipoprotein cholesterol and dementia in the elderly. The inchianti study. The journals of gerontology. Series A, Biological sciences and medical sciences. 2010;65:559-564 315. Kivipelto M, Helkala EL, Laakso MP, Hanninen T, Hallikainen M, Alhainen K, Soininen H, Tuomilehto J, Nissinen A. Midlife vascular risk factors and alzheimer's disease in later life: Longitudinal, population based study. Bmj. 2001;322:1447-1451 316. Kivipelto M, Helkala EL, Laakso MP, Hanninen T, Hallikainen M, Alhainen K, Iivonen S, Mannermaa A, Tuomilehto J, Nissinen A, Soininen H. Apolipoprotein e epsilon4 allele, elevated midlife total cholesterol level, and high midlife systolic blood pressure are independent risk factors for late-life alzheimer disease. Annals of internal medicine. 2002;137:149-155 317. Kivipelto M, Ngandu T, Fratiglioni L, Viitanen M, Kareholt I, Winblad B, Helkala EL, Tuomilehto J, Soininen H, Nissinen A. Obesity and vascular risk factors at midlife and the risk of dementia and alzheimer disease. Archives of neurology. 2005;62:1556-1560 318. Solomon A, Kivipelto M, Wolozin B, Zhou J, Whitmer RA. Midlife serum cholesterol and increased risk of alzheimer's and vascular dementia three decades later. Dementia and geriatric cognitive disorders. 2009;28:75-80 319. Kuo YM, Emmerling MR, Bisgaier CL, Essenburg AD, Lampert HC, Drumm D, Roher AE. Elevated low-density lipoprotein in alzheimer's disease correlates with brain abeta 1-42 levels. Biochemical and biophysical research communications. 1998;252:711-715 320. Lesser G, Kandiah K, Libow LS, Likourezos A, Breuer B, Marin D, Mohs R, Haroutunian V, Neufeld R. Elevated serum total and ldl cholesterol in very old patients with alzheimer's disease. Dementia and geriatric cognitive disorders. 2001;12:138-145 166  321. Lesser GT, Haroutunian V, Purohit DP, Schnaider Beeri M, Schmeidler J, Honkanen L, Neufeld R, Libow LS. Serum lipids are related to alzheimer's pathology in nursing home residents. Dementia and geriatric cognitive disorders. 2009;27:42-49 322. Notkola IL, Sulkava R, Pekkanen J, Erkinjuntti T, Ehnholm C, Kivinen P, Tuomilehto J, Nissinen A. Serum total cholesterol, apolipoprotein e epsilon 4 allele, and alzheimer's disease. Neuroepidemiology. 1998;17:14-20 323. Vance DEV, J.E. Biochemistry of lipids, lipoproteins and membranes. Boston: Elsevier; 2002. 324. Camont L, Chapman MJ, Kontush A. Biological activities of hdl subpopulations and their relevance to cardiovascular disease. Trends in molecular medicine. 2011;17:594-603 325. Beffert U, Danik M, Krzywkowski P, Ramassamy C, Berrada F, Poirier J. The neurobiology of apolipoproteins and their receptors in the cns and alzheimer's disease. Brain research. Brain research reviews. 1998;27:119-142 326. Ladu MJ, Reardon C, Van Eldik L, Fagan AM, Bu G, Holtzman D, Getz GS. Lipoproteins in the central nervous system. Annals of the New York Academy of Sciences. 2000;903:167-175 327. Koch S, Donarski N, Goetze K, Kreckel M, Stuerenburg HJ, Buhmann C, Beisiegel U. Characterization of four lipoprotein classes in human cerebrospinal fluid. Journal of lipid research. 2001;42:1143-1151 328. Borghini I, Barja F, Pometta D, James RW. Characterization of subpopulations of lipoprotein particles isolated from human cerebrospinal fluid. Biochimica et biophysica acta. 1995;1255:192-200 329. DeMattos RB, Brendza RP, Heuser JE, Kierson M, Cirrito JR, Fryer J, Sullivan PM, Fagan AM, Han X, Holtzman DM. Purification and characterization of astrocyte-secreted apolipoprotein e and j-containing lipoproteins from wild-type and human apoe transgenic mice. Neurochemistry international. 2001;39:415-425 330. Roheim PS, Carey M, Forte T, Vega GL. Apolipoproteins in human cerebrospinal fluid. Proceedings of the National Academy of Sciences of the United States of America. 1979;76:4646-4649 331. Lewis GF, Rader DJ. New insights into the regulation of hdl metabolism and reverse cholesterol transport. Circulation research. 2005;96:1221-1232 332. Brunham LR, Kruit JK, Iqbal J, Fievet C, Timmins JM, Pape TD, Coburn BA, Bissada N, Staels B, Groen AK, Hussain MM, Parks JS, Kuipers F, Hayden MR. Intestinal abca1 directly contributes to hdl biogenesis in vivo. The Journal of clinical investigation. 2006;116:1052-1062 167  333. Timmins JM, Lee JY, Boudyguina E, Kluckman KD, Brunham LR, Mulya A, Gebre AK, Coutinho JM, Colvin PL, Smith TL, Hayden MR, Maeda N, Parks JS. Targeted inactivation of hepatic abca1 causes profound hypoalphalipoproteinemia and kidney hypercatabolism of apoa-i. The Journal of clinical investigation. 2005;115:1333-1342 334. Kennedy MA, Barrera GC, Nakamura K, Baldan A, Tarr P, Fishbein MC, Frank J, Francone OL, Edwards PA. Abcg1 has a critical role in mediating cholesterol efflux to hdl and preventing cellular lipid accumulation. Cell Metab. 2005;1:121-131 335. Baldan A, Tarr P, Lee R, Edwards PA. Atp-binding cassette transporter g1 and lipid homeostasis. Current opinion in lipidology. 2006;17:227-232 336. Wang N, Lan D, Chen W, Matsuura F, Tall AR. Atp-binding cassette transporters g1 and g4 mediate cellular cholesterol efflux to high-density lipoproteins. Proceedings of the National Academy of Sciences of the United States of America. 2004;101:9774-9779 337. Krieger M. Scavenger receptor class b type i is a multiligand hdl receptor that influences diverse physiologic systems. The Journal of clinical investigation. 2001;108:793-797 338. Trigatti BL, Krieger M, Rigotti A. Influence of the hdl receptor sr-bi on lipoprotein metabolism and atherosclerosis. Arteriosclerosis, thrombosis, and vascular biology. 2003;23:1732-1738 339. Kuivenhoven JA, van Voorst tot Voorst EJ, Wiebusch H, Marcovina SM, Funke H, Assmann G, Pritchard PH, Kastelein JJ. A unique genetic and biochemical presentation of fish-eye disease. The Journal of clinical investigation. 1995;96:2783-2791 340. Kuivenhoven JA, Pritchard H, Hill J, Frohlich J, Assmann G, Kastelein J. The molecular pathology of lecithin:Cholesterol acyltransferase (lcat) deficiency syndromes. Journal of lipid research. 1997;38:191-205 341. Ng DS, Francone OL, Forte TM, Zhang J, Haghpassand M, Rubin EM. Disruption of the murine lecithin:Cholesterol acyltransferase gene causes impairment of adrenal lipid delivery and up-regulation of scavenger receptor class b type i. The Journal of biological chemistry. 1997;272:15777-15781 342. Inazu A, Brown ML, Hesler CB, Agellon LB, Koizumi J, Takata K, Maruhama Y, Mabuchi H, Tall AR. Increased high-density lipoprotein levels caused by a common cholesteryl-ester transfer protein gene mutation. The New England journal of medicine. 1990;323:1234-1238 343. Inazu A, Jiang XC, Haraki T, Yagi K, Kamon N, Koizumi J, Mabuchi H, Takeda R, Takata K, Moriyama Y, et al. Genetic cholesteryl ester transfer protein deficiency caused by two prevalent mutations as a major determinant of increased levels of high density lipoprotein cholesterol. The Journal of clinical investigation. 1994;94:1872-1882 168  344. Bruce C, Chouinard RA, Jr., Tall AR. Plasma lipid transfer proteins, high-density lipoproteins, and reverse cholesterol transport. Annual review of nutrition. 1998;18:297-330 345. Huuskonen J, Olkkonen VM, Jauhiainen M, Ehnholm C. The impact of phospholipid transfer protein (pltp) on hdl metabolism. Atherosclerosis. 2001;155:269-281 346. Jaye M, Lynch KJ, Krawiec J, Marchadier D, Maugeais C, Doan K, South V, Amin D, Perrone M, Rader DJ. A novel endothelial-derived lipase that modulates hdl metabolism. Nature genetics. 1999;21:424-428 347. Connelly PW. The role of hepatic lipase in lipoprotein metabolism. Clinica chimica acta; international journal of clinical chemistry. 1999;286:243-255 348. Rosenson RS, Brewer HB, Jr., Davidson WS, Fayad ZA, Fuster V, Goldstein J, Hellerstein M, Jiang XC, Phillips MC, Rader DJ, Remaley AT, Rothblat GH, Tall AR, Yvan-Charvet L. Cholesterol efflux and atheroprotection: Advancing the concept of reverse cholesterol transport. Circulation. 2012;125:1905-1919 349. Demeester N, Castro G, Desrumaux C, De Geitere C, Fruchart JC, Santens P, Mulleners E, Engelborghs S, De Deyn PP, Vandekerckhove J, Rosseneu M, Labeur C. Characterization and functional studies of lipoproteins, lipid transfer proteins, and lecithin:Cholesterol acyltransferase in csf of normal individuals and patients with alzheimer's disease. Journal of lipid research. 2000;41:963-974 350. Roher AE, Maarouf CL, Sue LI, Hu Y, Wilson J, Beach TG. Proteomics-derived cerebrospinal fluid markers of autopsy-confirmed alzheimer's disease. Biomarkers : biochemical indicators of exposure, response, and susceptibility to chemicals. 2009;14:493-501 351. Song H, Seishima M, Saito K, Maeda S, Takemura M, Noma A, Kondo A, Manabe M, Urakami K, Nakashima K. Apo a-i and apo e concentrations in cerebrospinal fluids of patients with acute meningitis. Annals of clinical biochemistry. 1998;35 ( Pt 3):408-414 352. Yu C, Youmans KL, LaDu MJ. Proposed mechanism for lipoprotein remodelling in the brain. Biochimica et biophysica acta. 2010;1801:819-823 353. Vance JE, Hayashi H. Formation and function of apolipoprotein e-containing lipoproteins in the nervous system. Biochimica et biophysica acta. 2010;1801:806-818 354. Zannis VI, Koukos G, Drosatos K, Vezeridis A, Zanni EE, Kypreos KE, Chroni A. Discrete roles of apoa-i and apoe in the biogenesis of hdl species: Lessons learned from gene transfer studies in different mouse models. Annals of medicine. 2008;40 Suppl 1:14-28 355. Lee JY, Parks JS. Atp-binding cassette transporter ai and its role in hdl formation. Current opinion in lipidology. 2005;16:19-25 169  356. Koldamova R, Fitz NF, Lefterov I. The role of atp-binding cassette transporter a1 in alzheimer's disease and neurodegeneration. Biochimica et biophysica acta. 2010;1801:824-830 357. Koldamova R, Fitz NF, Lefterov I. Atp-binding cassette transporter a1: From metabolism to neurodegeneration. Neurobiology of disease. 2014 358. Bodzioch M, Orso E, Klucken J, Langmann T, Bottcher A, Diederich W, Drobnik W, Barlage S, Buchler C, Porsch-Ozcurumez M, Kaminski WE, Hahmann HW, Oette K, Rothe G, Aslanidis C, Lackner KJ, Schmitz G. The gene encoding atp-binding cassette transporter 1 is mutated in tangier disease. Nature genetics. 1999;22:347-351 359. Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van Dam M, Yu L, Brewer C, Collins JA, Molhuizen HO, Loubser O, Ouelette BF, Fichter K, Ashbourne-Excoffon KJ, Sensen CW, Scherer S, Mott S, Denis M, Martindale D, Frohlich J, Morgan K, Koop B, Pimstone S, Kastelein JJ, Genest J, Jr., Hayden MR. Mutations in abc1 in tangier disease and familial high-density lipoprotein deficiency. Nature genetics. 1999;22:336-345 360. Tall AR, Wang N. Tangier disease as a test of the reverse cholesterol transport hypothesis. The Journal of clinical investigation. 2000;106:1205-1207 361. Lee JY, Timmins JM, Mulya A, Smith TL, Zhu Y, Rubin EM, Chisholm JW, Colvin PL, Parks JS. Hdls in apoa-i transgenic abca1 knockout mice are remodeled normally in plasma but are hypercatabolized by the kidney. Journal of lipid research. 2005;46:2233-2245 362. Aiello RJ, Brees D, Francone OL. Abca1-deficient mice: Insights into the role of monocyte lipid efflux in hdl formation and inflammation. Arteriosclerosis, thrombosis, and vascular biology. 2003;23:972-980 363. Moore RE, Navab M, Millar JS, Zimetti F, Hama S, Rothblat GH, Rader DJ. Increased atherosclerosis in mice lacking apolipoprotein a-i attributable to both impaired reverse cholesterol transport and increased inflammation. Circulation research. 2005;97:763-771 364. Asztalos BF, Brousseau ME, McNamara JR, Horvath KV, Roheim PS, Schaefer EJ. Subpopulations of high density lipoproteins in homozygous and heterozygous tangier disease. Atherosclerosis. 2001;156:217-225 365. Hirsch-Reinshagen V, Zhou S, Burgess BL, Bernier L, McIsaac SA, Chan JY, Tansley GH, Cohn JS, Hayden MR, Wellington CL. Deficiency of abca1 impairs apolipoprotein e metabolism in brain. The Journal of biological chemistry. 2004;279:41197-41207 366. Wahrle SE, Jiang H, Parsadanian M, Legleiter J, Han X, Fryer JD, Kowalewski T, Holtzman DM. Abca1 is required for normal central nervous system apoe levels and for 170  lipidation of astrocyte-secreted apoe. The Journal of biological chemistry. 2004;279:40987-40993 367. Wahrle SE, Jiang H, Parsadanian M, Hartman RE, Bales KR, Paul SM, Holtzman DM. Deletion of abca1 increases abeta deposition in the pdapp transgenic mouse model of alzheimer disease. The Journal of biological chemistry. 2005;280:43236-43242 368. Hirsch-Reinshagen V, Maia LF, Burgess BL, Blain JF, Naus KE, McIsaac SA, Parkinson PF, Chan JY, Tansley GH, Hayden MR, Poirier J, Van Nostrand W, Wellington CL. The absence of abca1 decreases soluble apoe levels but does not diminish amyloid deposition in two murine models of alzheimer disease. The Journal of biological chemistry. 2005;280:43243-43256 369. Donkin JJ, Stukas S, Hirsch-Reinshagen V, Namjoshi D, Wilkinson A, May S, Chan J, Fan J, Collins J, Wellington CL. Atp-binding cassette transporter a1 mediates the beneficial effects of the liver x receptor agonist gw3965 on object recognition memory and amyloid burden in amyloid precursor protein/presenilin 1 mice. The Journal of biological chemistry. 2010;285:34144-34154 370. Stukas S, May S, Wilkinson A, Chan J, Donkin J, Wellington CL. The lxr agonist gw3965 increases apoa-i protein levels in the central nervous system independent of abca1. Biochimica et biophysica acta. 2012;1821:536-546 371. Koldamova R, Staufenbiel M, Lefterov I. Lack of abca1 considerably decreases brain apoe level and increases amyloid deposition in app23 mice. The Journal of biological chemistry. 2005;280:43224-43235 372. Singaraja RR, Bocher V, James ER, Clee SM, Zhang LH, Leavitt BR, Tan B, Brooks-Wilson A, Kwok A, Bissada N, Yang YZ, Liu G, Tafuri SR, Fievet C, Wellington CL, Staels B, Hayden MR. Human abca1 bac transgenic mice show increased high density lipoprotein cholesterol and apoai-dependent efflux stimulated by an internal promoter containing liver x receptor response elements in intron 1. The Journal of biological chemistry. 2001;276:33969-33979 373. Singaraja RR, Fievet C, Castro G, James ER, Hennuyer N, Clee SM, Bissada N, Choy JC, Fruchart JC, McManus BM, Staels B, Hayden MR. Increased abca1 activity protects against atherosclerosis. The Journal of clinical investigation. 2002;110:35-42 374. Joyce CW, Amar MJ, Lambert G, Vaisman BL, Paigen B, Najib-Fruchart J, Hoyt RF, Jr., Neufeld ED, Remaley AT, Fredrickson DS, Brewer HB, Jr., Santamarina-Fojo S. The atp binding cassette transporter a1 (abca1) modulates the development of aortic atherosclerosis in c57bl/6 and apoe-knockout mice. Proceedings of the National Academy of Sciences of the United States of America. 2002;99:407-412 375. Wellington CL, Brunham LR, Zhou S, Singaraja RR, Visscher H, Gelfer A, Ross C, James E, Liu G, Huber MT, Yang YZ, Parks RJ, Groen A, Fruchart-Najib J, Hayden MR. 171  Alterations of plasma lipids in mice via adenoviral-mediated hepatic overexpression of human abca1. Journal of lipid research. 2003;44:1470-1480 376. Wahrle SE, Jiang H, Parsadanian M, Kim J, Li A, Knoten A, Jain S, Hirsch-Reinshagen V, Wellington CL, Bales KR, Paul SM, Holtzman DM. Overexpression of abca1 reduces amyloid deposition in the pdapp mouse model of alzheimer disease. The Journal of clinical investigation. 2008;118:671-682 377. Karasinska JM, Rinninger F, Lutjohann D, Ruddle P, Franciosi S, Kruit JK, Singaraja RR, Hirsch-Reinshagen V, Fan J, Brunham LR, Bissada N, Ramakrishnan R, Wellington CL, Parks JS, Hayden MR. Specific loss of brain abca1 increases brain cholesterol uptake and influences neuronal structure and function. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2009;29:3579-3589 378. Riwanto M, Landmesser U. High-density lipoproteins and endothelial functions: Mechanistic insights and alterations in cardiovascular disease. Journal of lipid research. 2013;54:3227-3243 379. Yuhanna IS, Zhu Y, Cox BE, Hahner LD, Osborne-Lawrence S, Lu P, Marcel YL, Anderson RG, Mendelsohn ME, Hobbs HH, Shaul PW. High-density lipoprotein binding to scavenger receptor-bi activates endothelial nitric oxide synthase. Nature medicine. 2001;7:853-857 380. Nofer JR, van der Giet M, Tolle M, Wolinska I, von Wnuck Lipinski K, Baba HA, Tietge UJ, Godecke A, Ishii I, Kleuser B, Schafers M, Fobker M, Zidek W, Assmann G, Chun J, Levkau B. Hdl induces no-dependent vasorelaxation via the lysophospholipid receptor s1p3. The Journal of clinical investigation. 2004;113:569-581 381. Terasaka N, Yu S, Yvan-Charvet L, Wang N, Mzhavia N, Langlois R, Pagler T, Li R, Welch CL, Goldberg IJ, Tall AR. Abcg1 and hdl protect against endothelial dysfunction in mice fed a high-cholesterol diet. The Journal of clinical investigation. 2008;118:3701-3713 382. Terasaka N, Westerterp M, Koetsveld J, Fernandez-Hernando C, Yvan-Charvet L, Wang N, Sessa WC, Tall AR. Atp-binding cassette transporter g1 and high-density lipoprotein promote endothelial no synthesis through a decrease in the interaction of caveolin-1 and endothelial no synthase. Arteriosclerosis, thrombosis, and vascular biology. 2010;30:2219-2225 383. von Eckardstein A, Rohrer L. Transendothelial lipoprotein transport and regulation of endothelial permeability and integrity by lipoproteins. Current opinion in lipidology. 2009;20:197-205 384. Mahley RW. Apolipoprotein e: Cholesterol transport protein with expanding role in cell biology. Science. 1988;240:622-630 172  385. Linton MF, Gish R, Hubl ST, Butler E, Esquivel C, Bry WI, Boyles JK, Wardell MR, Young SG. Phenotypes of apolipoprotein b and apolipoprotein e after liver transplantation. The Journal of clinical investigation. 1991;88:270-281 386. Stannard AK, Riddell DR, Sacre SM, Tagalakis AD, Langer C, von Eckardstein A, Cullen P, Athanasopoulos T, Dickson G, Owen JS. Cell-derived apolipoprotein e (apoe) particles inhibit vascular cell adhesion molecule-1 (vcam-1) expression in human endothelial cells. The Journal of biological chemistry. 2001;276:46011-46016 387. Sacre SM, Stannard AK, Owen JS. Apolipoprotein e (apoe) isoforms differentially induce nitric oxide production in endothelial cells. FEBS letters. 2003;540:181-187 388. Yue L, Bian JT, Grizelj I, Cavka A, Phillips SA, Makino A, Mazzone T. Apolipoprotein e enhances endothelial-no production by modulating caveolin 1 interaction with endothelial no synthase. Hypertension. 2012;60:1040-1046 389. Gomaraschi M, Ossoli A, Favari E, Adorni MP, Sinagra G, Cattin L, Veglia F, Bernini F, Franceschini G, Calabresi L. Inflammation impairs enos activation by hdl in patients with acute coronary syndrome. Cardiovascular research. 2013;100:36-43 390. Speer T, Rohrer L, Blyszczuk P, Shroff R, Kuschnerus K, Krankel N, Kania G, Zewinger S, Akhmedov A, Shi Y, Martin T, Perisa D, Winnik S, Muller MF, Sester U, Wernicke G, Jung A, Gutteck U, Eriksson U, Geisel J, Deanfield J, von Eckardstein A, Luscher TF, Fliser D, Bahlmann FH, Landmesser U. Abnormal high-density lipoprotein induces endothelial dysfunction via activation of toll-like receptor-2. Immunity. 2013;38:754-768 391. Calabresi L, Franceschini G, Sirtori CR, De Palma A, Saresella M, Ferrante P, Taramelli D. Inhibition of vcam-1 expression in endothelial cells by reconstituted high density lipoproteins. Biochemical and biophysical research communications. 1997;238:61-65 392. Cockerill GW, Rye KA, Gamble JR, Vadas MA, Barter PJ. High-density lipoproteins inhibit cytokine-induced expression of endothelial cell adhesion molecules. Arteriosclerosis, thrombosis, and vascular biology. 1995;15:1987-1994 393. Dimayuga P, Zhu J, Oguchi S, Chyu KY, Xu XO, Yano J, Shah PK, Nilsson J, Cercek B. Reconstituted hdl containing human apolipoprotein a-1 reduces vcam-1 expression and neointima formation following periadventitial cuff-induced carotid injury in apoe null mice. Biochemical and biophysical research communications. 1999;264:465-468 394. Navab M, Imes SS, Hama SY, Hough GP, Ross LA, Bork RW, Valente AJ, Berliner JA, Drinkwater DC, Laks H, et al. Monocyte transmigration induced by modification of low density lipoprotein in cocultures of human aortic wall cells is due to induction of monocyte chemotactic protein 1 synthesis and is abolished by high density lipoprotein. The Journal of clinical investigation. 1991;88:2039-2046 173  395. Shaw JA, Bobik A, Murphy A, Kanellakis P, Blombery P, Mukhamedova N, Woollard K, Lyon S, Sviridov D, Dart AM. Infusion of reconstituted high-density lipoprotein leads to acute changes in human atherosclerotic plaque. Circulation research. 2008;103:1084-1091 396. Hedrick CC, Thorpe SR, Fu MX, Harper CM, Yoo J, Kim SM, Wong H, Peters AL. Glycation impairs high-density lipoprotein function. Diabetologia. 2000;43:312-320 397. Nobecourt E, Tabet F, Lambert G, Puranik R, Bao S, Yan L, Davies MJ, Brown BE, Jenkins AJ, Dusting GJ, Bonnet DJ, Curtiss LK, Barter PJ, Rye KA. Nonenzymatic glycation impairs the antiinflammatory properties of apolipoprotein a-i. Arteriosclerosis, thrombosis, and vascular biology. 2010;30:766-772 398. Undurti A, Huang Y, Lupica JA, Smith JD, DiDonato JA, Hazen SL. Modification of high density lipoprotein by myeloperoxidase generates a pro-inflammatory particle. The Journal of biological chemistry. 2009;284:30825-30835 399. Van Lenten BJ, Hama SY, de Beer FC, Stafforini DM, McIntyre TM, Prescott SM, La Du BN, Fogelman AM, Navab M. Anti-inflammatory hdl becomes pro-inflammatory during the acute phase response. Loss of protective effect of hdl against ldl oxidation in aortic wall cell cocultures. The Journal of clinical investigation. 1995;96:2758-2767 400. Zheng L, Nukuna B, Brennan ML, Sun M, Goormastic M, Settle M, Schmitt D, Fu X, Thomson L, Fox PL, Ischiropoulos H, Smith JD, Kinter M, Hazen SL. Apolipoprotein a-i is a selective target for myeloperoxidase-catalyzed oxidation and functional impairment in subjects with cardiovascular disease. The Journal of clinical investigation. 2004;114:529-541 401. Miyata M, Smith JD. Apolipoprotein e allele-specific antioxidant activity and effects on cytotoxicity by oxidative insults and beta-amyloid peptides. Nature genetics. 1996;14:55-61 402. Patel PJ, Khera AV, Jafri K, Wilensky RL, Rader DJ. The anti-oxidative capacity of high-density lipoprotein is reduced in acute coronary syndrome but not in stable coronary artery disease. Journal of the American College of Cardiology. 2011;58:2068-2075 403. Patel PJ, Khera AV, Wilensky RL, Rader DJ. Anti-oxidative and cholesterol efflux capacities of high-density lipoprotein are reduced in ischaemic cardiomyopathy. European journal of heart failure. 2013 404. Sattler K, Levkau B. Sphingosine-1-phosphate as a mediator of high-density lipoprotein effects in cardiovascular protection. Cardiovascular research. 2009;82:201-211 405. Pan B, Ma Y, Ren H, He Y, Wang Y, Lv X, Liu D, Ji L, Yu B, Wang Y, Chen YE, Pennathur S, Smith JD, Liu G, Zheng L. Diabetic hdl is dysfunctional in stimulating 174  endothelial cell migration and proliferation due to down regulation of sr-bi expression. PloS one. 2012;7:e48530 406. Deane R, Sagare A, Hamm K, Parisi M, Lane S, Finn MB, Holtzman DM, Zlokovic BV. Apoe isoform-specific disruption of amyloid beta peptide clearance from mouse brain. The Journal of clinical investigation. 2008;118:4002-4013 407. Castellano JM, Kim J, Stewart FR, Jiang H, DeMattos RB, Patterson BW, Fagan AM, Morris JC, Mawuenyega KG, Cruchaga C, Goate AM, Bales KR, Paul SM, Bateman RJ, Holtzman DM. Human apoe isoforms differentially regulate brain amyloid-beta peptide clearance. Science translational medicine. 2011;3:89ra57 408. Verghese PB, Castellano JM, Garai K, Wang Y, Jiang H, Shah A, Bu G, Frieden C, Holtzman DM. Apoe influences amyloid-beta (abeta) clearance despite minimal apoe/abeta association in physiological conditions. Proceedings of the National Academy of Sciences of the United States of America. 2013;110:E1807-1816 409. Hafezi-Moghadam A, Thomas KL, Wagner DD. Apoe deficiency leads to a progressive age-dependent blood-brain barrier leakage. American journal of physiology. Cell physiology. 2007;292:C1256-1262 410. Methia N, Andre P, Hafezi-Moghadam A, Economopoulos M, Thomas KL, Wagner DD. Apoe deficiency compromises the blood brain barrier especially after injury. Molecular medicine. 2001;7:810-815 411. Nishitsuji K, Hosono T, Nakamura T, Bu G, Michikawa M. Apolipoprotein e regulates the integrity of tight junctions in an isoform-dependent manner in an in vitro blood-brain barrier model. The Journal of biological chemistry. 2011;286:17536-17542 412. Drzezga A, Grimmer T, Henriksen G, Muhlau M, Perneczky R, Miederer I, Praus C, Sorg C, Wohlschlager A, Riemenschneider M, Wester HJ, Foerstl H, Schwaiger M, Kurz A. Effect of apoe genotype on amyloid plaque load and gray matter volume in alzheimer disease. Neurology. 2009;72:1487-1494 413. Morris JC, Roe CM, Xiong C, Fagan AM, Goate AM, Holtzman DM, Mintun MA. Apoe predicts amyloid-beta but not tau alzheimer pathology in cognitively normal aging. Annals of neurology. 2010;67:122-131 414. Rowe CC, Ellis KA, Rimajova M, Bourgeat P, Pike KE, Jones G, Fripp J, Tochon-Danguy H, Morandeau L, O'Keefe G, Price R, Raniga P, Robins P, Acosta O, Lenzo N, Szoeke C, Salvado O, Head R, Martins R, Masters CL, Ames D, Villemagne VL. Amyloid imaging results from the australian imaging, biomarkers and lifestyle (aibl) study of aging. Neurobiology of aging. 2010;31:1275-1283 415. Fleisher AS, Chen K, Liu X, Ayutyanont N, Roontiva A, Thiyyagura P, Protas H, Joshi AD, Sabbagh M, Sadowsky CH, Sperling RA, Clark CM, Mintun MA, Pontecorvo MJ, 175  Coleman RE, Doraiswamy PM, Johnson KA, Carpenter AP, Skovronsky DM, Reiman EM. Apolipoprotein e epsilon4 and age effects on florbetapir positron emission tomography in healthy aging and alzheimer disease. Neurobiology of aging. 2013;34:1-12 416. Bacskai BJ, Frosch MP, Freeman SH, Raymond SB, Augustinack JC, Johnson KA, Irizarry MC, Klunk WE, Mathis CA, Dekosky ST, Greenberg SM, Hyman BT, Growdon JH. Molecular imaging with pittsburgh compound b confirmed at autopsy: A case report. Archives of neurology. 2007;64:431-434 417. Johnson KA, Gregas M, Becker JA, Kinnecom C, Salat DH, Moran EK, Smith EE, Rosand J, Rentz DM, Klunk WE, Mathis CA, Price JC, Dekosky ST, Fischman AJ, Greenberg SM. Imaging of amyloid burden and distribution in cerebral amyloid angiopathy. Annals of neurology. 2007;62:229-234 418. Lockhart A, Lamb JR, Osredkar T, Sue LI, Joyce JN, Ye L, Libri V, Leppert D, Beach TG. Pib is a non-specific imaging marker of amyloid-beta (abeta) peptide-related cerebral amyloidosis. Brain : a journal of neurology. 2007;130:2607-2615 419. Ikonomovic MD, Klunk WE, Abrahamson EE, Mathis CA, Price JC, Tsopelas ND, Lopresti BJ, Ziolko S, Bi W, Paljug WR, Debnath ML, Hope CE, Isanski BA, Hamilton RL, DeKosky ST. Post-mortem correlates of in vivo pib-pet amyloid imaging in a typical case of alzheimer's disease. Brain : a journal of neurology. 2008;131:1630-1645 420. Premkumar DR, Cohen DL, Hedera P, Friedland RP, Kalaria RN. Apolipoprotein e-epsilon4 alleles in cerebral amyloid angiopathy and cerebrovascular pathology associated with alzheimer's disease. The American journal of pathology. 1996;148:2083-2095 421. Chalmers K, Wilcock GK, Love S. Apoe epsilon 4 influences the pathological phenotype of alzheimer's disease by favouring cerebrovascular over parenchymal accumulation of a beta protein. Neuropathology and applied neurobiology. 2003;29:231-238 422. Olichney JM, Hansen LA, Hofstetter CR, Lee JH, Katzman R, Thal LJ. Association between severe cerebral amyloid angiopathy and cerebrovascular lesions in alzheimer disease is not a spurious one attributable to apolipoprotein e4. Archives of neurology. 2000;57:869-874 423. Tian J, Shi J, Bailey K, Lendon CL, Pickering-Brown SM, Mann DM. Association between apolipoprotein e e4 allele and arteriosclerosis, cerebral amyloid angiopathy, and cerebral white matter damage in alzheimer's disease. Journal of neurology, neurosurgery, and psychiatry. 2004;75:696-699 424. Nelson PT, Pious NM, Jicha GA, Wilcock DM, Fardo DW, Estus S, Rebeck GW. Apoe-epsilon2 and apoe-epsilon4 correlate with increased amyloid accumulation in cerebral vasculature. Journal of neuropathology and experimental neurology. 2013;72:708-715 176  425. McCarron MO, Nicoll JA. Apolipoprotein e genotype and cerebral amyloid angiopathy-related hemorrhage. Annals of the New York Academy of Sciences. 2000;903:176-179 426. Fryer JD, Simmons K, Parsadanian M, Bales KR, Paul SM, Sullivan PM, Holtzman DM. Human apolipoprotein e4 alters the amyloid-beta 40:42 ratio and promotes the formation of cerebral amyloid angiopathy in an amyloid precursor protein transgenic model. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2005;25:2803-2810 427. Li Y, Cam J, Bu G. Low-density lipoprotein receptor family: Endocytosis and signal transduction. Molecular neurobiology. 2001;23:53-67 428. Dodart JC, Marr RA, Koistinaho M, Gregersen BM, Malkani S, Verma IM, Paul SM. Gene delivery of human apolipoprotein e alters brain abeta burden in a mouse model of alzheimer's disease. Proceedings of the National Academy of Sciences of the United States of America. 2005;102:1211-1216 429. Hudry E, Dashkoff J, Roe AD, Takeda S, Koffie RM, Hashimoto T, Scheel M, Spires-Jones T, Arbel-Ornath M, Betensky R, Davidson BL, Hyman BT. Gene transfer of human apoe isoforms results in differential modulation of amyloid deposition and neurotoxicity in mouse brain. Science translational medicine. 2013;5:212ra161 430. Fitz NF, Cronican AA, Saleem M, Fauq AH, Chapman R, Lefterov I, Koldamova R. Abca1 deficiency affects alzheimer's disease-like phenotype in human apoe4 but not in apoe3-targeted replacement mice. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2012;32:13125-13136 431. Koldamova RP, Lefterov IM, Staufenbiel M, Wolfe D, Huang S, Glorioso JC, Walter M, Roth MG, Lazo JS. The liver x receptor ligand t0901317 decreases amyloid beta production in vitro and in a mouse model of alzheimer's disease. The Journal of biological chemistry. 2005;280:4079-4088 432. Lefterov I, Bookout A, Wang Z, Staufenbiel M, Mangelsdorf D, Koldamova R. Expression profiling in app23 mouse brain: Inhibition of abeta amyloidosis and inflammation in response to lxr agonist treatment. Molecular neurodegeneration. 2007;2:20 433. Riddell DR, Zhou H, Comery TA, Kouranova E, Lo CF, Warwick HK, Ring RH, Kirksey Y, Aschmies S, Xu J, Kubek K, Hirst WD, Gonzales C, Chen Y, Murphy E, Leonard S, Vasylyev D, Oganesian A, Martone RL, Pangalos MN, Reinhart PH, Jacobsen JS. The lxr agonist to901317 selectively lowers hippocampal abeta42 and improves memory in the tg2576 mouse model of alzheimer's disease. Molecular and cellular neurosciences. 2007;34:621-628 434. Jiang Q, Lee CY, Mandrekar S, Wilkinson B, Cramer P, Zelcer N, Mann K, Lamb B, Willson TM, Collins JL, Richardson JC, Smith JD, Comery TA, Riddell D, Holtzman 177  DM, Tontonoz P, Landreth GE. Apoe promotes the proteolytic degradation of abeta. Neuron. 2008;58:681-693 435. Fitz NF, Cronican A, Pham T, Fogg A, Fauq AH, Chapman R, Lefterov I, Koldamova R. Liver x receptor agonist treatment ameliorates amyloid pathology and memory deficits caused by high-fat diet in app23 mice. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2010;30:6862-6872 436. Vanmierlo T, Rutten K, Dederen J, Bloks VW, van Vark-van der Zee LC, Kuipers F, Kiliaan A, Blokland A, Sijbrands EJ, Steinbusch H, Prickaerts J, Lutjohann D, Mulder M. Liver x receptor activation restores memory in aged ad mice without reducing amyloid. Neurobiology of aging. 2011;32:1262-1272 437. Fitz NF, Castranio EL, Carter AY, Kodali R, Lefterov I, Koldamova R. Improvement of memory deficits and amyloid-beta clearance in aged app23 mice treated with a combination of anti-amyloid-beta antibody and lxr agonist. Journal of Alzheimer's disease : JAD. 2014 438. Wang N, Lan D, Gerbod-Giannone M, Linsel-Nitschke P, Jehle AW, Chen W, Martinez LO, Tall AR. Atp-binding cassette transporter a7 (abca7) binds apolipoprotein a-i and mediates cellular phospholipid but not cholesterol efflux. The Journal of biological chemistry. 2003;278:42906-42912 439. Abe-Dohmae S, Ikeda Y, Matsuo M, Hayashi M, Okuhira K, Ueda K, Yokoyama S. Human abca7 supports apolipoprotein-mediated release of cellular cholesterol and phospholipid to generate high density lipoprotein. The Journal of biological chemistry. 2004;279:604-611 440. Chan SL, Kim WS, Kwok JB, Hill AF, Cappai R, Rye KA, Garner B. Atp-binding cassette transporter a7 regulates processing of amyloid precursor protein in vitro. Journal of neurochemistry. 2008;106:793-804 441. Tanaka N, Abe-Dohmae S, Iwamoto N, Yokoyama S. Roles of atp-binding cassette transporter a7 in cholesterol homeostasis and host defense system. Journal of atherosclerosis and thrombosis. 2011;18:274-281 442. Hollingworth P, Harold D, Sims R, Gerrish A, Lambert JC, Carrasquillo MM, Abraham R, Hamshere ML, Pahwa JS, Moskvina V, Dowzell K, Jones N, Stretton A, Thomas C, Richards A, Ivanov D, Widdowson C, Chapman J, Lovestone S, Powell J, Proitsi P, Lupton MK, Brayne C, Rubinsztein DC, Gill M, Lawlor B, Lynch A, Brown KS, Passmore PA, Craig D, McGuinness B, Todd S, Holmes C, Mann D, Smith AD, Beaumont H, Warden D, Wilcock G, Love S, Kehoe PG, Hooper NM, Vardy ER, Hardy J, Mead S, Fox NC, Rossor M, Collinge J, Maier W, Jessen F, Ruther E, Schurmann B, Heun R, Kolsch H, van den Bussche H, Heuser I, Kornhuber J, Wiltfang J, Dichgans M, Frolich L, Hampel H, Gallacher J, Hull M, Rujescu D, Giegling I, Goate AM, Kauwe JS, Cruchaga C, Nowotny P, Morris JC, Mayo K, Sleegers K, Bettens K, Engelborghs S, De 178  Deyn PP, Van Broeckhoven C, Livingston G, Bass NJ, Gurling H, McQuillin A, Gwilliam R, Deloukas P, Al-Chalabi A, Shaw CE, Tsolaki M, Singleton AB, Guerreiro R, Muhleisen TW, Nothen MM, Moebus S, Jockel KH, Klopp N, Wichmann HE, Pankratz VS, Sando SB, Aasly JO, Barcikowska M, Wszolek ZK, Dickson DW, Graff-Radford NR, Petersen RC, Alzheimer's Disease Neuroimaging I, van Duijn CM, Breteler MM, Ikram MA, DeStefano AL, Fitzpatrick AL, Lopez O, Launer LJ, Seshadri S, consortium C, Berr C, Campion D, Epelbaum J, Dartigues JF, Tzourio C, Alperovitch A, Lathrop M, consortium E, Feulner TM, Friedrich P, Riehle C, Krawczak M, Schreiber S, Mayhaus M, Nicolhaus S, Wagenpfeil S, Steinberg S, Stefansson H, Stefansson K, Snaedal J, Bjornsson S, Jonsson PV, Chouraki V, Genier-Boley B, Hiltunen M, Soininen H, Combarros O, Zelenika D, Delepine M, Bullido MJ, Pasquier F, Mateo I, Frank-Garcia A, Porcellini E, Hanon O, Coto E, Alvarez V, Bosco P, Siciliano G, Mancuso M, Panza F, Solfrizzi V, Nacmias B, Sorbi S, Bossu P, Piccardi P, Arosio B, Annoni G, Seripa D, Pilotto A, Scarpini E, Galimberti D, Brice A, Hannequin D, Licastro F, Jones L, Holmans PA, Jonsson T, Riemenschneider M, Morgan K, Younkin SG, Owen MJ, O'Donovan M, Amouyel P, Williams J. Common variants at abca7, ms4a6a/ms4a4e, epha1, cd33 and cd2ap are associated with alzheimer's disease. Nature genetics. 2011;43:429-435 443. Karch CM, Jeng AT, Nowotny P, Cady J, Cruchaga C, Goate AM. Expression of novel alzheimer's disease risk genes in control and alzheimer's disease brains. PloS one. 2012;7:e50976 444. Reitz C, Jun G, Naj A, Rajbhandary R, Vardarajan BN, Wang LS, Valladares O, Lin CF, Larson EB, Graff-Radford NR, Evans D, De Jager PL, Crane PK, Buxbaum JD, Murrell JR, Raj T, Ertekin-Taner N, Logue M, Baldwin CT, Green RC, Barnes LL, Cantwell LB, Fallin MD, Go RC, Griffith P, Obisesan TO, Manly JJ, Lunetta KL, Kamboh MI, Lopez OL, Bennett DA, Hendrie H, Hall KS, Goate AM, Byrd GS, Kukull WA, Foroud TM, Haines JL, Farrer LA, Pericak-Vance MA, Schellenberg GD, Mayeux R, Alzheimer Disease Genetics C. Variants in the atp-binding cassette transporter (abca7), apolipoprotein e 4,and the risk of late-onset alzheimer disease in african americans. JAMA : the journal of the American Medical Association. 2013;309:1483-1492 445. Kim WS, Li H, Ruberu K, Chan S, Elliott DA, Low JK, Cheng D, Karl T, Garner B. Deletion of abca7 increases cerebral amyloid-beta accumulation in the j20 mouse model of alzheimer's disease. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2013;33:4387-4394 446. Logge W, Cheng D, Chesworth R, Bhatia S, Garner B, Kim WS, Karl T. Role of abca7 in mouse behaviours relevant to neurodegenerative diseases. PloS one. 2012;7:e45959 447. Dennis NA, Browndyke JN, Stokes J, Need A, Burke JR, Welsh-Bohmer KA, Cabeza R. Temporal lobe functional activity and connectivity in young adult apoe varepsilon4 carriers. Alzheimer's & dementia : the journal of the Alzheimer's Association. 2010;6:303-311 179  448. Filippini N, MacIntosh BJ, Hough MG, Goodwin GM, Frisoni GB, Smith SM, Matthews PM, Beckmann CF, Mackay CE. Distinct patterns of brain activity in young carriers of the apoe-epsilon4 allele. Proceedings of the National Academy of Sciences of the United States of America. 2009;106:7209-7214 449. Filippini N, Ebmeier KP, MacIntosh BJ, Trachtenberg AJ, Frisoni GB, Wilcock GK, Beckmann CF, Smith SM, Matthews PM, Mackay CE. Differential effects of the apoe genotype on brain function across the lifespan. NeuroImage. 2011;54:602-610 450. Jagust WJ, Landau SM, Alzheimer's Disease Neuroimaging I. Apolipoprotein e, not fibrillar beta-amyloid, reduces cerebral glucose metabolism in normal aging. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2012;32:18227-18233 451. Zipser BD, Johanson CE, Gonzalez L, Berzin TM, Tavares R, Hulette CM, Vitek MP, Hovanesian V, Stopa EG. Microvascular injury and blood-brain barrier leakage in alzheimer's disease. Neurobiology of aging. 2007;28:977-986 452. Bell RD, Winkler EA, Singh I, Sagare AP, Deane R, Wu Z, Holtzman DM, Betsholtz C, Armulik A, Sallstrom J, Berk BC, Zlokovic BV. Apolipoprotein e controls cerebrovascular integrity via cyclophilin a. Nature. 2012;485:512-516 453. Saito K, Seishima M, Heyes MP, Song H, Fujigaki S, Maeda S, Vickers JH, Noma A. Marked increases in concentrations of apolipoprotein in the cerebrospinal fluid of poliovirus-infected macaques: Relations between apolipoprotein concentrations and severity of brain injury. The Biochemical journal. 1997;321 ( Pt 1):145-149 454. Chiba H, Akita H, Hui SP, Takahashi Y, Nagasaka H, Fuda H, Kobayashi K. Effects of triamcinolone on brain and cerebrospinal fluid apolipoprotein e levels in rats. Life sciences. 1997;60:1757-1761 455. Rebeck GW, Alonzo NC, Berezovska O, Harr SD, Knowles RB, Growdon JH, Hyman BT, Mendez AJ. Structure and functions of human cerebrospinal fluid lipoproteins from individuals of different apoe genotypes. Experimental neurology. 1998;149:175-182 456. Montine KS, Bassett CN, Ou JJ, Markesbery WR, Swift LL, Montine TJ. Apolipoprotein e allelic influence on human cerebrospinal fluid apolipoproteins. Journal of lipid research. 1998;39:2443-2451 457. Guyton JR, Miller SE, Martin ME, Khan WA, Roses AD, Strittmatter WJ. Novel large apolipoprotein e-containing lipoproteins of density 1.006-1.060 g/ml in human cerebrospinal fluid. Journal of neurochemistry. 1998;70:1235-1240 458. Mockel B, Zinke H, Flach R, Weiss B, Weiler-Guttler H, Gassen HG. Expression of apolipoprotein a-i in porcine brain endothelium in vitro. Journal of neurochemistry. 1994;62:788-798 180  459. Elshourbagy NA, Boguski MS, Liao WS, Jefferson LS, Gordon JI, Taylor JM. Expression of rat apolipoprotein a-iv and a-i genes: Mrna induction during development and in response to glucocorticoids and insulin. Proceedings of the National Academy of Sciences of the United States of America. 1985;82:8242-8246 460. Zannis VI, Cole FS, Jackson CL, Kurnit DM, Karathanasis SK. Distribution of apolipoprotein a-i, c-ii, c-iii, and e mrna in fetal human tissues. Time-dependent induction of apolipoprotein e mrna by cultures of human monocyte-macrophages. Biochemistry. 1985;24:4450-4455 461. Cavelier C, Rohrer L, von Eckardstein A. Atp-binding cassette transporter a1 modulates apolipoprotein a-i transcytosis through aortic endothelial cells. Circulation research. 2006;99:1060-1066 462. Cavelier C, Ohnsorg PM, Rohrer L, von Eckardstein A. The beta-chain of cell surface f(0)f(1) atpase modulates apoa-i and hdl transcytosis through aortic endothelial cells. Arteriosclerosis, thrombosis, and vascular biology. 2012;32:131-139 463. Zensi A, Begley D, Pontikis C, Legros C, Mihoreanu L, Buchel C, Kreuter J. Human serum albumin nanoparticles modified with apolipoprotein a-i cross the blood-brain barrier and enter the rodent brain. Journal of drug targeting. 2010;18:842-848 464. Kratzer I, Wernig K, Panzenboeck U, Bernhart E, Reicher H, Wronski R, Windisch M, Hammer A, Malle E, Zimmer A, Sattler W. Apolipoprotein a-i coating of protamine-oligonucleotide nanoparticles increases particle uptake and transcytosis in an in vitro model of the blood-brain barrier. Journal of controlled release : official journal of the Controlled Release Society. 2007;117:301-311 465. Fioravanti J, Medina-Echeverz J, Ardaiz N, Gomar C, Parra-Guillen ZP, Prieto J, Berraondo P. The fusion protein of ifn-alpha and apolipoprotein a-i crosses the blood-brain barrier by a saturable transport mechanism. Journal of immunology. 2012;188:3988-3992 466. Puchades M, Hansson SF, Nilsson CL, Andreasen N, Blennow K, Davidsson P. Proteomic studies of potential cerebrospinal fluid protein markers for alzheimer's disease. Brain research. Molecular brain research. 2003;118:140-146 467. Castano EM, Roher AE, Esh CL, Kokjohn TA, Beach T. Comparative proteomics of cerebrospinal fluid in neuropathologically-confirmed alzheimer's disease and non-demented elderly subjects. Neurological research. 2006;28:155-163 468. Harr SD, Uint L, Hollister R, Hyman BT, Mendez AJ. Brain expression of apolipoproteins e, j, and a-i in alzheimer's disease. Journal of neurochemistry. 1996;66:2429-2435 181  469. Song H, Saito K, Seishima M, Noma A, Urakami K, Nakashima K. Cerebrospinal fluid apo e and apo a-i concentrations in early- and late-onset alzheimer's disease. Neuroscience letters. 1997;231:175-178 470. Koldamova RP, Lefterov IM, Lefterova MI, Lazo JS. Apolipoprotein a-i directly interacts with amyloid precursor protein and inhibits a beta aggregation and toxicity. Biochemistry. 2001;40:3553-3560 471. Paula-Lima AC, Tricerri MA, Brito-Moreira J, Bomfim TR, Oliveira FF, Magdesian MH, Grinberg LT, Panizzutti R, Ferreira ST. Human apolipoprotein a-i binds amyloid-beta and prevents abeta-induced neurotoxicity. The international journal of biochemistry & cell biology. 2009;41:1361-1370 472. Degoma EM, Rader DJ. Novel hdl-directed pharmacotherapeutic strategies. Nature reviews. Cardiology. 2011;8:266-277 473. Fisher EA, Feig JE, Hewing B, Hazen SL, Smith JD. High-density lipoprotein function, dysfunction, and reverse cholesterol transport. Arteriosclerosis, thrombosis, and vascular biology. 2012;32:2813-2820 474. Badimon JJ, Badimon L, Fuster V. Regression of atherosclerotic lesions by high density lipoprotein plasma fraction in the cholesterol-fed rabbit. The Journal of clinical investigation. 1990;85:1234-1241 475. Chiesa G, Monteggia E, Marchesi M, Lorenzon P, Laucello M, Lorusso V, Di Mario C, Karvouni E, Newton RS, Bisgaier CL, Franceschini G, Sirtori CR. Recombinant apolipoprotein a-i(milano) infusion into rabbit carotid artery rapidly removes lipid from fatty streaks. Circulation research. 2002;90:974-980 476. Parolini C, Marchesi M, Lorenzon P, Castano M, Balconi E, Miragoli L, Chaabane L, Morisetti A, Lorusso V, Martin BJ, Bisgaier CL, Krause B, Newton RS, Sirtori CR, Chiesa G. Dose-related effects of repeated etc-216 (recombinant apolipoprotein a-i milano/1-palmitoyl-2-oleoyl phosphatidylcholine complexes) administrations on rabbit lipid-rich soft plaques: In vivo assessment by intravascular ultrasound and magnetic resonance imaging. Journal of the American College of Cardiology. 2008;51:1098-1103 477. Shah PK, Nilsson J, Kaul S, Fishbein MC, Ageland H, Hamsten A, Johansson J, Karpe F, Cercek B. Effects of recombinant apolipoprotein a-i(milano) on aortic atherosclerosis in apolipoprotein e-deficient mice. Circulation. 1998;97:780-785 478. Zhang Y, Zanotti I, Reilly MP, Glick JM, Rothblat GH, Rader DJ. Overexpression of apolipoprotein a-i promotes reverse transport of cholesterol from macrophages to feces in vivo. Circulation. 2003;108:661-663 479. De Nardo D, Labzin LI, Kono H, Seki R, Schmidt SV, Beyer M, Xu D, Zimmer S, Lahrmann C, Schildberg FA, Vogelhuber J, Kraut M, Ulas T, Kerksiek A, Krebs W, 182  Bode N, Grebe A, Fitzgerald ML, Hernandez NJ, Williams BR, Knolle P, Kneilling M, Rocken M, Lutjohann D, Wright SD, Schultze JL, Latz E. High-density lipoprotein mediates anti-inflammatory reprogramming of macrophages via the transcriptional regulator atf3. Nature immunology. 2014;15:152-160 480. Nicholls SJ, Dusting GJ, Cutri B, Bao S, Drummond GR, Rye KA, Barter PJ. Reconstituted high-density lipoproteins inhibit the acute pro-oxidant and proinflammatory vascular changes induced by a periarterial collar in normocholesterolemic rabbits. Circulation. 2005;111:1543-1550 481. Sirtori CR, Calabresi L, Franceschini G, Baldassarre D, Amato M, Johansson J, Salvetti M, Monteduro C, Zulli R, Muiesan ML, Agabiti-Rosei E. Cardiovascular status of carriers of the apolipoprotein a-i(milano) mutant: The limone sul garda study. Circulation. 2001;103:1949-1954 482. Nissen SE, Tsunoda T, Tuzcu EM, Schoenhagen P, Cooper CJ, Yasin M, Eaton GM, Lauer MA, Sheldon WS, Grines CL, Halpern S, Crowe T, Blankenship JC, Kerensky R. Effect of recombinant apoa-i milano on coronary atherosclerosis in patients with acute coronary syndromes: A randomized controlled trial. JAMA : the journal of the American Medical Association. 2003;290:2292-2300 483. Kempen HJ, Gomaraschi M, Bellibas SE, Plassmann S, Zerler B, Collins HL, Adelman SJ, Calabresi L, Wijngaard PL. Effect of repeated apoa-imilano/popc infusion on lipids, (apo)lipoproteins, and serum cholesterol efflux capacity in cynomolgus monkeys. Journal of lipid research. 2013;54:2341-2353 484. Lerch PG, Fortsch V, Hodler G, Bolli R. Production and characterization of a reconstituted high density lipoprotein for therapeutic applications. Vox sanguinis. 1996;71:155-164 485. Tardif JC, Gregoire J, L'Allier PL, Ibrahim R, Lesperance J, Heinonen TM, Kouz S, Berry C, Basser R, Lavoie MA, Guertin MC, Rodes-Cabau J, Effect of r HDLoA-S, Efficacy I. Effects of reconstituted high-density lipoprotein infusions on coronary atherosclerosis: A randomized controlled trial. JAMA : the journal of the American Medical Association. 2007;297:1675-1682 486. Diditchenko S, Gille A, Pragst I, Stadler D, Waelchli M, Hamilton R, Leis A, Wright SD. Novel formulation of a reconstituted high-density lipoprotein (csl112) dramatically enhances abca1-dependent cholesterol efflux. Arteriosclerosis, thrombosis, and vascular biology. 2013;33:2202-2211 487. Easton R, Gille A, D'Andrea D, Davis R, Wright SD, Shear C. A multiple ascending dose study of csl112, an infused formulation of apoa-i. Journal of clinical pharmacology. 2013 488. Waksman R, Torguson R, Kent KM, Pichard AD, Suddath WO, Satler LF, Martin BD, Perlman TJ, Maltais JA, Weissman NJ, Fitzgerald PJ, Brewer HB, Jr. A first-in-man, 183  randomized, placebo-controlled study to evaluate the safety and feasibility of autologous delipidated high-density lipoprotein plasma infusions in patients with acute coronary syndrome. Journal of the American College of Cardiology. 2010;55:2727-2735 489. McLure KG, Gesner EM, Tsujikawa L, Kharenko OA, Attwell S, Campeau E, Wasiak S, Stein A, White A, Fontano E, Suto RK, Wong NC, Wagner GS, Hansen HC, Young PR. Rvx-208, an inducer of apoa-i in humans, is a bet bromodomain antagonist. PloS one. 2013;8:e83190 490. Picaud S, Wells C, Felletar I, Brotherton D, Martin S, Savitsky P, Diez-Dacal B, Philpott M, Bountra C, Lingard H, Fedorov O, Muller S, Brennan PE, Knapp S, Filippakopoulos P. Rvx-208, an inhibitor of bet transcriptional regulators with selectivity for the second bromodomain. Proceedings of the National Academy of Sciences of the United States of America. 2013;110:19754-19759 491. Nicholls SJ, Gordon A, Johannson J, Ballantyne CM, Barter PJ, Brewer HB, Kastelein JJ, Wong NC, Borgman MR, Nissen SE. Apoa-i induction as a potential cardioprotective strategy: Rationale for the sustain and assure studies. Cardiovascular drugs and therapy / sponsored by the International Society of Cardiovascular Pharmacotherapy. 2012;26:181-187 492. Resverlogix. Further analysis of the assure data finds a responder group for rvx-208 with statistically significant regression of coronary atherosclerosis. 2013 493. Resverlogix. Rvx-208 exploratory study illustrates early potential for alzheimer’s disease. 2008 494. Resverlogix. Resverlogix assert trial data illustrates potential for rvx-208 in alzheimer's disease. 2011 495. Van Lenten BJ, Wagner AC, Anantharamaiah GM, Navab M, Reddy ST, Buga GM, Fogelman AM. Apolipoprotein a-i mimetic peptides. Current atherosclerosis reports. 2009;11:52-57 496. Navab M, Anantharamaiah GM, Hama S, Garber DW, Chaddha M, Hough G, Lallone R, Fogelman AM. Oral administration of an apo a-i mimetic peptide synthesized from d-amino acids dramatically reduces atherosclerosis in mice independent of plasma cholesterol. Circulation. 2002;105:290-292 497. Navab M, Anantharamaiah GM, Reddy ST, Hama S, Hough G, Grijalva VR, Wagner AC, Frank JS, Datta G, Garber D, Fogelman AM. Oral d-4f causes formation of pre-beta high-density lipoprotein and improves high-density lipoprotein-mediated cholesterol efflux and reverse cholesterol transport from macrophages in apolipoprotein e-null mice. Circulation. 2004;109:3215-3220 184  498. Li X, Chyu KY, Faria Neto JR, Yano J, Nathwani N, Ferreira C, Dimayuga PC, Cercek B, Kaul S, Shah PK. Differential effects of apolipoprotein a-i-mimetic peptide on evolving and established atherosclerosis in apolipoprotein e-null mice. Circulation. 2004;110:1701-1705 499. Navab M, Anantharamaiah GM, Hama S, Hough G, Reddy ST, Frank JS, Garber DW, Handattu S, Fogelman AM. D-4f and statins synergize to render hdl antiinflammatory in mice and monkeys and cause lesion regression in old apolipoprotein e-null mice. Arteriosclerosis, thrombosis, and vascular biology. 2005;25:1426-1432 500. Buga GM, Navab M, Imaizumi S, Reddy ST, Yekta B, Hough G, Chanslor S, Anantharamaiah GM, Fogelman AM. L-4f alters hyperlipidemic (but not healthy) mouse plasma to reduce platelet aggregation. Arteriosclerosis, thrombosis, and vascular biology. 2010;30:283-289 501. Bloedon LT, Dunbar R, Duffy D, Pinell-Salles P, Norris R, DeGroot BJ, Movva R, Navab M, Fogelman AM, Rader DJ. Safety, pharmacokinetics, and pharmacodynamics of oral apoa-i mimetic peptide d-4f in high-risk cardiovascular patients. Journal of lipid research. 2008;49:1344-1352 502. Watson CE, Weissbach N, Kjems L, Ayalasomayajula S, Zhang Y, Chang I, Navab M, Hama S, Hough G, Reddy ST, Soffer D, Rader DJ, Fogelman AM, Schecter A. Treatment of patients with cardiovascular disease with l-4f, an apo-a1 mimetic, did not improve select biomarkers of hdl function. Journal of lipid research. 2011;52:361-373 503. Buga GM, Frank JS, Mottino GA, Hendizadeh M, Hakhamian A, Tillisch JH, Reddy ST, Navab M, Anantharamaiah GM, Ignarro LJ, Fogelman AM. D-4f decreases brain arteriole inflammation and improves cognitive performance in ldl receptor-null mice on a western diet. Journal of lipid research. 2006;47:2148-2160 504. Handattu SP, Garber DW, Monroe CE, van Groen T, Kadish I, Nayyar G, Cao D, Palgunachari MN, Li L, Anantharamaiah GM. Oral apolipoprotein a-i mimetic peptide improves cognitive function and reduces amyloid burden in a mouse model of alzheimer's disease. Neurobiology of disease. 2009;34:525-534 505. Barter PJ, Brewer HB, Jr., Chapman MJ, Hennekens CH, Rader DJ, Tall AR. Cholesteryl ester transfer protein: A novel target for raising hdl and inhibiting atherosclerosis. Arteriosclerosis, thrombosis, and vascular biology. 2003;23:160-167 506. Rader DJ, deGoma EM. Future of cholesteryl ester transfer protein inhibitors. Annual review of medicine. 2014;65:385-403 507. Barter PJ, Caulfield M, Eriksson M, Grundy SM, Kastelein JJ, Komajda M, Lopez-Sendon J, Mosca L, Tardif JC, Waters DD, Shear CL, Revkin JH, Buhr KA, Fisher MR, Tall AR, Brewer B, Investigators I. Effects of torcetrapib in patients at high risk for coronary events. The New England journal of medicine. 2007;357:2109-2122 185  508. Schwartz GG, Olsson AG, Abt M, Ballantyne CM, Barter PJ, Brumm J, Chaitman BR, Holme IM, Kallend D, Leiter LA, Leitersdorf E, McMurray JJ, Mundl H, Nicholls SJ, Shah PK, Tardif JC, Wright RS, dal OI. Effects of dalcetrapib in patients with a recent acute coronary syndrome. The New England journal of medicine. 2012;367:2089-2099 509. Ray KK, Ditmarsch M, Kallend D, Niesor EJ, Suchankova G, Upmanyu R, Anzures-Cabrera J, Lehnert V, Pauly-Evers M, Holme I, Stasek J, van Hessen MW, Jones P, on behalf of the dal AI. The effect of cholesteryl ester transfer protein inhibition on lipids, lipoproteins, and markers of hdl function after an acute coronary syndrome: The dal-acute randomized trial. European heart journal. 2014 510. Duivenvoorden R, Mani V, Woodward M, Kallend D, Suchankova G, Fuster V, Rudd JH, Tawakol A, Farkouh ME, Fayad ZA. Relationship of serum inflammatory biomarkers with plaque inflammation assessed by fdg pet/ct: The dal-plaque study. JACC. Cardiovascular imaging. 2013;6:1087-1094 511. Gotto AM, Jr., Kher U, Chatterjee MS, Liu Y, Li XS, Vaidya S, Cannon CP, Brinton EA, Moon JE, Shah S, Dansky HM, Mitchel Y, Barter P, the DI. Lipids, safety parameters, and drug concentrations after an additional 2 years of treatment with anacetrapib in the define study. Journal of cardiovascular pharmacology and therapeutics. 2014 512. Gotto AM, Jr., Cannon CP, Li XS, Vaidya S, Kher U, Brinton EA, Davidson M, Moon JE, Shah S, Dansky HM, Mitchel Y, Barter P, Investigators D. Evaluation of lipids, drug concentration, and safety parameters following cessation of treatment with the cholesteryl ester transfer protein inhibitor anacetrapib in patients with or at high risk for coronary heart disease. The American journal of cardiology. 2014;113:76-83 513. Teramoto T, Takeuchi M, Morisaki Y, Ruotolo G, Krueger KA. Efficacy, safety, tolerability, and pharmacokinetic profile of evacetrapib administered as monotherapy or in combination with atorvastatin in japanese patients with dyslipidemia. The American journal of cardiology. 2014 514. Yvan-Charvet L, Kling J, Pagler T, Li H, Hubbard B, Fisher T, Sparrow CP, Taggart AK, Tall AR. Cholesterol efflux potential and antiinflammatory properties of high-density lipoprotein after treatment with niacin or anacetrapib. Arteriosclerosis, thrombosis, and vascular biology. 2010;30:1430-1438 515. Ishida T, Choi S, Kundu RK, Hirata K, Rubin EM, Cooper AD, Quertermous T. Endothelial lipase is a major determinant of hdl level. The Journal of clinical investigation. 2003;111:347-355 516. Ma K, Cilingiroglu M, Otvos JD, Ballantyne CM, Marian AJ, Chan L. Endothelial lipase is a major genetic determinant for high-density lipoprotein concentration, structure, and metabolism. Proceedings of the National Academy of Sciences of the United States of America. 2003;100:2748-2753 186  517. Edmondson AC, Brown RJ, Kathiresan S, Cupples LA, Demissie S, Manning AK, Jensen MK, Rimm EB, Wang J, Rodrigues A, Bamba V, Khetarpal SA, Wolfe ML, Derohannessian S, Li M, Reilly MP, Aberle J, Evans D, Hegele RA, Rader DJ. Loss-of-function variants in endothelial lipase are a cause of elevated hdl cholesterol in humans. The Journal of clinical investigation. 2009;119:1042-1050 518. Yasuda T, Ishida T, Rader DJ. Update on the role of endothelial lipase in high-density lipoprotein metabolism, reverse cholesterol transport, and atherosclerosis. Circulation journal : official journal of the Japanese Circulation Society. 2010;74:2263-2270 519. Badellino KO, Wolfe ML, Reilly MP, Rader DJ. Endothelial lipase concentrations are increased in metabolic syndrome and associated with coronary atherosclerosis. PLoS medicine. 2006;3:e22 520. Badellino KO, Wolfe ML, Reilly MP, Rader DJ. Endothelial lipase is increased in vivo by inflammation in humans. Circulation. 2008;117:678-685 521. Tang NP, Wang LS, Yang L, Zhou B, Gu HJ, Sun QM, Cong RH, Zhu HJ, Wang B. Protective effect of an endothelial lipase gene variant on coronary artery disease in a chinese population. Journal of lipid research. 2008;49:369-375 522. Vergeer M, Cohn DM, Boekholdt SM, Sandhu MS, Prins HM, Ricketts SL, Wareham NJ, Kastelein JJ, Khaw KT, Kamphuisen PW, Dallinga-Thie GM. Lack of association between common genetic variation in endothelial lipase (lipg) and the risk for cad and dvt. Atherosclerosis. 2010;211:558-564 523. Jensen MK, Rimm EB, Mukamal KJ, Edmondson AC, Rader DJ, Vogel U, Tjonneland A, Sorensen TI, Schmidt EB, Overvad K. The t111i variant in the endothelial lipase gene and risk of coronary heart disease in three independent populations. European heart journal. 2009;30:1584-1589 524. O'Connell DP, LeBlanc DF, Cromley D, Billheimer J, Rader DJ, Bachovchin WW. Design and synthesis of boronic acid inhibitors of endothelial lipase. Bioorganic & medicinal chemistry letters. 2012;22:1397-1401 525. Broedl UC, Jin W, Marchadier D, Secreto A, Rader DJ. Tissue-specific expression pattern of human endothelial lipase in transgenic mice. Atherosclerosis. 2005;181:271-274 526. Paradis E, Clavel S, Julien P, Murthy MR, de Bilbao F, Arsenijevic D, Giannakopoulos P, Vallet P, Richard D. Lipoprotein lipase and endothelial lipase expression in mouse brain: Regional distribution and selective induction following kainic acid-induced lesion and focal cerebral ischemia. Neurobiology of disease. 2004;15:312-325 527. Sovic A, Panzenboeck U, Wintersperger A, Kratzer I, Hammer A, Levak-Frank S, Frank S, Rader DJ, Malle E, Sattler W. Regulated expression of endothelial lipase by porcine 187  brain capillary endothelial cells constituting the blood-brain barrier. Journal of neurochemistry. 2005;94:109-119 528. Ahmed W, Orasanu G, Nehra V, Asatryan L, Rader DJ, Ziouzenkova O, Plutzky J. High-density lipoprotein hydrolysis by endothelial lipase activates pparalpha: A candidate mechanism for high-density lipoprotein-mediated repression of leukocyte adhesion. Circulation research. 2006;98:490-498 529. Gouni-Berthold I, Berthold HK. The role of niacin in lipid-lowering treatment: Are we aiming too high? Current pharmaceutical design. 2013;19:3094-3106 530. Taylor AJ, Sullenberger LE, Lee HJ, Lee JK, Grace KA. Arterial biology for the investigation of the treatment effects of reducing cholesterol (arbiter) 2: A double-blind, placebo-controlled study of extended-release niacin on atherosclerosis progression in secondary prevention patients treated with statins. Circulation. 2004;110:3512-3517 531. Villines TC, Stanek EJ, Devine PJ, Turco M, Miller M, Weissman NJ, Griffen L, Taylor AJ. The arbiter 6-halts trial (arterial biology for the investigation of the treatment effects of reducing cholesterol 6-hdl and ldl treatment strategies in atherosclerosis): Final results and the impact of medication adherence, dose, and treatment duration. Journal of the American College of Cardiology. 2010;55:2721-2726 532. Investigators A-H, Boden WE, Probstfield JL, Anderson T, Chaitman BR, Desvignes-Nickens P, Koprowicz K, McBride R, Teo K, Weintraub W. Niacin in patients with low hdl cholesterol levels receiving intensive statin therapy. The New England journal of medicine. 2011;365:2255-2267 533. Lavigne PM, Karas RH. The current state of niacin in cardiovascular disease prevention: A systematic review and meta-regression. Journal of the American College of Cardiology. 2013;61:440-446 534. Chen J, Cui X, Zacharek A, Jiang H, Roberts C, Zhang C, Lu M, Kapke A, Feldkamp CS, Chopp M. Niaspan increases angiogenesis and improves functional recovery after stroke. Annals of neurology. 2007;62:49-58 535. Cui X, Chopp M, Zacharek A, Roberts C, Buller B, Ion M, Chen J. Niacin treatment of stroke increases synaptic plasticity and axon growth in rats. Stroke; a journal of cerebral circulation. 2010;41:2044-2049 536. Shehadah A, Chen J, Zacharek A, Cui Y, Ion M, Roberts C, Kapke A, Chopp M. Niaspan treatment induces neuroprotection after stroke. Neurobiology of disease. 2010;40:277-283 537. Ye X, Chopp M, Cui X, Zacharek A, Cui Y, Yan T, Shehadah A, Roberts C, Liu X, Lu M, Chen J. Niaspan enhances vascular remodeling after stroke in type 1 diabetic rats. Experimental neurology. 2011;232:299-308 188  538. Yan T, Chopp M, Ye X, Liu Z, Zacharek A, Cui Y, Roberts C, Buller B, Chen J. Niaspan increases axonal remodeling after stroke in type 1 diabetes rats. Neurobiology of disease. 2012;46:157-164 539. Anderson DW, Bradbury KA, Schneider JS. Broad neuroprotective profile of nicotinamide in different mouse models of mptp-induced parkinsonism. The European journal of neuroscience. 2008;28:610-617 540. Im SS, Osborne TF. Liver x receptors in atherosclerosis and inflammation. Circulation research. 2011;108:996-1001 541. Groot PH, Pearce NJ, Yates JW, Stocker C, Sauermelch C, Doe CP, Willette RN, Olzinski A, Peters T, d'Epagnier D, Morasco KO, Krawiec JA, Webb CL, Aravindhan K, Jucker B, Burgert M, Ma C, Marino JP, Collins JL, Macphee CH, Thompson SK, Jaye M. Synthetic lxr agonists increase ldl in cetp species. Journal of lipid research. 2005;46:2182-2191 542. Grefhorst A, Elzinga BM, Voshol PJ, Plosch T, Kok T, Bloks VW, van der Sluijs FH, Havekes LM, Romijn JA, Verkade HJ, Kuipers F. Stimulation of lipogenesis by pharmacological activation of the liver x receptor leads to production of large, triglyceride-rich very low density lipoprotein particles. The Journal of biological chemistry. 2002;277:34182-34190 543. Repa JJ, Liang G, Ou J, Bashmakov Y, Lobaccaro JM, Shimomura I, Shan B, Brown MS, Goldstein JL, Mangelsdorf DJ. Regulation of mouse sterol regulatory element-binding protein-1c gene (srebp-1c) by oxysterol receptors, lxralpha and lxrbeta. Genes & development. 2000;14:2819-2830 544. Yasuda T, Grillot D, Billheimer JT, Briand F, Delerive P, Huet S, Rader DJ. Tissue-specific liver x receptor activation promotes macrophage reverse cholesterol transport in vivo. Arteriosclerosis, thrombosis, and vascular biology. 2010;30:781-786 545. Bradley MN, Hong C, Chen M, Joseph SB, Wilpitz DC, Wang X, Lusis AJ, Collins A, Hseuh WA, Collins JL, Tangirala RK, Tontonoz P. Ligand activation of lxr beta reverses atherosclerosis and cellular cholesterol overload in mice lacking lxr alpha and apoe. The Journal of clinical investigation. 2007;117:2337-2346 546. Cramer PE, Cirrito JR, Wesson DW, Lee CY, Karlo JC, Zinn AE, Casali BT, Restivo JL, Goebel WD, James MJ, Brunden KR, Wilson DA, Landreth GE. Apoe-directed therapeutics rapidly clear beta-amyloid and reverse deficits in ad mouse models. Science. 2012;335:1503-1506 547. Ulrich JD, Burchett JM, Restivo JL, Schuler DR, Verghese PB, Mahan TE, Landreth GE, Castellano JM, Jiang H, Cirrito JR, Holtzman DM. In vivo measurement of apolipoprotein e from the brain interstitial fluid using microdialysis. Molecular neurodegeneration. 2013;8:13 189  548. Fitz NF, Cronican AA, Lefterov I, Koldamova R. Comment on "apoe-directed therapeutics rapidly clear beta-amyloid and reverse deficits in ad mouse models". Science. 2013;340:924-c 549. Veeraraghavalu K, Zhang C, Miller S, Hefendehl JK, Rajapaksha TW, Ulrich J, Jucker M, Holtzman DM, Tanzi RE, Vassar R, Sisodia SS. Comment on "apoe-directed therapeutics rapidly clear beta-amyloid and reverse deficits in ad mouse models". Science. 2013;340:924-f 550. Price AR, Xu G, Siemienski ZB, Smithson LA, Borchelt DR, Golde TE, Felsenstein KM. Comment on "apoe-directed therapeutics rapidly clear beta-amyloid and reverse deficits in ad mouse models". Science. 2013;340:924-d 551. Tesseur I, Lo AC, Roberfroid A, Dietvorst S, Van Broeck B, Borgers M, Gijsen H, Moechars D, Mercken M, Kemp J, D'Hooge R, De Strooper B. Comment on "apoe-directed therapeutics rapidly clear beta-amyloid and reverse deficits in ad mouse models". Science. 2013;340:924-e 552. Landreth GE, Cramer PE, Lakner MM, Cirrito JR, Wesson DW, Brunden KR, Wilson DA. Response to comments on "apoe-directed therapeutics rapidly clear beta-amyloid and reverse deficits in ad mouse models". Science. 2013;340:924-g 553. LaClair KD, Manaye KF, Lee DL, Allard JS, Savonenko AV, Troncoso JC, Wong PC. Treatment with bexarotene, a compound that increases apolipoprotein-e, provides no cognitive benefit in mutant app/ps1 mice. Molecular neurodegeneration. 2013;8:18 554. de Vries-van der Weij J, de Haan W, Hu L, Kuif M, Oei HL, van der Hoorn JW, Havekes LM, Princen HM, Romijn JA, Smit JW, Rensen PC. Bexarotene induces dyslipidemia by increased very low-density lipoprotein production and cholesteryl ester transfer protein-mediated reduction of high-density lipoprotein. Endocrinology. 2009;150:2368-2375 555. Torino F, Barnabei A, Paragliola R, Baldelli R, Appetecchia M, Corsello SM. Thyroid dysfunction as an unintended side effect of anticancer drugs. Thyroid : official journal of the American Thyroid Association. 2013 556. Loren J, Huang Z, Laffitte BA, Molteni V. Liver x receptor modulators: A review of recently patented compounds (2009 - 2012). Expert opinion on therapeutic patents. 2013;23:1317-1335 557. Schmechel DE, Saunders AM, Strittmatter WJ, Crain BJ, Hulette CM, Joo SH, Pericak-Vance MA, Goldgaber D, Roses AD. Increased amyloid beta-peptide deposition in cerebral cortex as a consequence of apolipoprotein e genotype in late-onset alzheimer disease. Proceedings of the National Academy of Sciences of the United States of America. 1993;90:9649-9653 190  558. Polvikoski T, Sulkava R, Haltia M, Kainulainen K, Vuorio A, Verkkoniemi A, Niinisto L, Halonen P, Kontula K. Apolipoprotein e, dementia, and cortical deposition of beta-amyloid protein. The New England journal of medicine. 1995;333:1242-1247 559. Bales KR, Verina T, Dodel RC, Du Y, Altstiel L, Bender M, Hyslop P, Johnstone EM, Little SP, Cummins DJ, Piccardo P, Ghetti B, Paul SM. Lack of apolipoprotein e dramatically reduces amyloid beta-peptide deposition. Nature genetics. 1997;17:263-264 560. Bales KR, Verina T, Cummins DJ, Du Y, Dodel RC, Saura J, Fishman CE, DeLong CA, Piccardo P, Petegnief V, Ghetti B, Paul SM. Apolipoprotein e is essential for amyloid deposition in the app(v717f) transgenic mouse model of alzheimer's disease. Proceedings of the National Academy of Sciences of the United States of America. 1999;96:15233-15238 561. Holtzman DM, Bales KR, Wu S, Bhat P, Parsadanian M, Fagan AM, Chang LK, Sun Y, Paul SM. Expression of human apolipoprotein e reduces amyloid-beta deposition in a mouse model of alzheimer's disease. The Journal of clinical investigation. 1999;103:R15-R21 562. Holtzman DM, Bales KR, Tenkova T, Fagan AM, Parsadanian M, Sartorius LJ, Mackey B, Olney J, McKeel D, Wozniak D, Paul SM. Apolipoprotein e isoform-dependent amyloid deposition and neuritic degeneration in a mouse model of alzheimer's disease. Proceedings of the National Academy of Sciences of the United States of America. 2000;97:2892-2897 563. Holtzman DM, Fagan AM, Mackey B, Tenkova T, Sartorius L, Paul SM, Bales K, Ashe KH, Irizarry MC, Hyman BT. Apolipoprotein e facilitates neuritic and cerebrovascular plaque formation in an alzheimer's disease model. Annals of neurology. 2000;47:739-747 564. Fryer JD, Taylor JW, DeMattos RB, Bales KR, Paul SM, Parsadanian M, Holtzman DM. Apolipoprotein e markedly facilitates age-dependent cerebral amyloid angiopathy and spontaneous hemorrhage in amyloid precursor protein transgenic mice. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2003;23:7889-7896 565. Irizarry MC, Rebeck GW, Cheung B, Bales K, Paul SM, Holzman D, Hyman BT. Modulation of a beta deposition in app transgenic mice by an apolipoprotein e null background. Annals of the New York Academy of Sciences. 2000;920:171-178 566. Fagan AM, Watson M, Parsadanian M, Bales KR, Paul SM, Holtzman DM. Human and murine apoe markedly alters a beta metabolism before and after plaque formation in a mouse model of alzheimer's disease. Neurobiology of disease. 2002;9:305-318 567. Bales KR, Liu F, Wu S, Lin S, Koger D, DeLong C, Hansen JC, Sullivan PM, Paul SM. Human apoe isoform-dependent effects on brain beta-amyloid levels in pdapp transgenic mice. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2009;29:6771-6779 191  568. Kim J, Jiang H, Park S, Eltorai AE, Stewart FR, Yoon H, Basak JM, Finn MB, Holtzman DM. Haploinsufficiency of human apoe reduces amyloid deposition in a mouse model of amyloid-beta amyloidosis. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2011;31:18007-18012 569. Bien-Ly N, Gillespie AK, Walker D, Yoon SY, Huang Y. Reducing human apolipoprotein e levels attenuates age-dependent abeta accumulation in mutant human amyloid precursor protein transgenic mice. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2012;32:4803-4811 570. Tai LM, Bilousova T, Jungbauer L, Roeske SK, Youmans KL, Yu C, Poon WW, Cornwell LB, Miller CA, Vinters HV, Van Eldik LJ, Fardo DW, Estus S, Bu G, Gylys KH, Ladu MJ. Levels of soluble apolipoprotein e/amyloid-beta (abeta) complex are reduced and oligomeric abeta increased with apoe4 and alzheimer disease in a transgenic mouse model and human samples. The Journal of biological chemistry. 2013;288:5914-5926 571. Fryer JD, Demattos RB, McCormick LM, O'Dell MA, Spinner ML, Bales KR, Paul SM, Sullivan PM, Parsadanian M, Bu G, Holtzman DM. The low density lipoprotein receptor regulates the level of central nervous system human and murine apolipoprotein e but does not modify amyloid plaque pathology in pdapp mice. The Journal of biological chemistry. 2005;280:25754-25759 572. Castellano JM, Deane R, Gottesdiener AJ, Verghese PB, Stewart FR, West T, Paoletti AC, Kasper TR, DeMattos RB, Zlokovic BV, Holtzman DM. Low-density lipoprotein receptor overexpression enhances the rate of brain-to-blood abeta clearance in a mouse model of beta-amyloidosis. Proceedings of the National Academy of Sciences of the United States of America. 2012;109:15502-15507 573. Johnson LA, Olsen RH, Merkens LS, DeBarber A, Steiner RD, Sullivan PM, Maeda N, Raber J. Apolipoprotein e-low density lipoprotein receptor interaction affects spatial memory retention and brain apoe levels in an isoform-dependent manner. Neurobiology of disease. 2014;64:150-162 574. Sodhi RK, Singh N. Liver x receptors: Emerging therapeutic targets for alzheimer's disease. Pharmacological research : the official journal of the Italian Pharmacological Society. 2013;72:45-51 575. Schultz JR, Tu H, Luk A, Repa JJ, Medina JC, Li L, Schwendner S, Wang S, Thoolen M, Mangelsdorf DJ, Lustig KD, Shan B. Role of lxrs in control of lipogenesis. Genes & development. 2000;14:2831-2838 576. Lund EG, Peterson LB, Adams AD, Lam MH, Burton CA, Chin J, Guo Q, Huang S, Latham M, Lopez JC, Menke JG, Milot DP, Mitnaul LJ, Rex-Rabe SE, Rosa RL, Tian JY, Wright SD, Sparrow CP. Different roles of liver x receptor alpha and beta in lipid 192  metabolism: Effects of an alpha-selective and a dual agonist in mice deficient in each subtype. Biochemical pharmacology. 2006;71:453-463 577. Miao B, Zondlo S, Gibbs S, Cromley D, Hosagrahara VP, Kirchgessner TG, Billheimer J, Mukherjee R. Raising hdl cholesterol without inducing hepatic steatosis and hypertriglyceridemia by a selective lxr modulator. Journal of lipid research. 2004;45:1410-1417 578. Ennaceur A, Delacour J. A new one-trial test for neurobiological studies of memory in rats. 1: Behavioral data. Behavioural brain research. 1988;31:47-59 579. Morris R. Developments of a water-maze procedure for studying spatial learning in the rat. Journal of neuroscience methods. 1984;11:47-60 580. DeMattos RB, Bales KR, Parsadanian M, O'Dell MA, Foss EM, Paul SM, Holtzman DM. Plaque-associated disruption of csf and plasma amyloid-beta (abeta) equilibrium in a mouse model of alzheimer's disease. Journal of neurochemistry. 2002;81:229-236 581. Tomic JL, Pensalfini A, Head E, Glabe CG. Soluble fibrillar oligomer levels are elevated in alzheimer's disease brain and correlate with cognitive dysfunction. Neurobiology of disease. 2009;35:352-358 582. Grenier E, Maupas FS, Beaulieu JF, Seidman E, Delvin E, Sane A, Tremblay E, Garofalo C, Levy E. Effect of retinoic acid on cell proliferation and differentiation as well as on lipid synthesis, lipoprotein secretion, and apolipoprotein biogenesis. American journal of physiology. Gastrointestinal and liver physiology. 2007;293:G1178-1189 583. Lee J, Tauscher A, Seo DW, Oram JF, Kuver R. Cultured gallbladder epithelial cells synthesize apolipoproteins a-i and e. American journal of physiology. Gastrointestinal and liver physiology. 2003;285:G630-641 584. Gentili C, Tutolo G, Pianezzi A, Cancedda R, Descalzi Cancedda F. Cholesterol secretion and homeostasis in chondrocytes: A liver x receptor and retinoid x receptor heterodimer mediates apolipoprotein a1 expression. Matrix biology : journal of the International Society for Matrix Biology. 2005;24:35-44 585. Sato M, Kawata Y, Erami K, Ikeda I, Imaizumi K. Lxr agonist increases the lymph hdl transport in rats by promoting reciprocally intestinal abca1 and apo a-i mrna levels. Lipids. 2008;43:125-131 586. Rohrer L, Ohnsorg PM, Lehner M, Landolt F, Rinninger F, von Eckardstein A. High-density lipoprotein transport through aortic endothelial cells involves scavenger receptor bi and atp-binding cassette transporter g1. Circulation research. 2009;104:1142-1150 587. Assemat E, Chatelet F, Chandellier J, Commo F, Cases O, Verroust P, Kozyraki R. Overlapping expression patterns of the multiligand endocytic receptors cubilin and 193  megalin in the cns, sensory organs and developing epithelia of the rodent embryo. Gene expression patterns : GEP. 2005;6:69-78 588. Zelcer N, Hong C, Boyadjian R, Tontonoz P. Lxr regulates cholesterol uptake through idol-dependent ubiquitination of the ldl receptor. Science. 2009;325:100-104 589. Zelcer N, Khanlou N, Clare R, Jiang Q, Reed-Geaghan EG, Landreth GE, Vinters HV, Tontonoz P. Attenuation of neuroinflammation and alzheimer's disease pathology by liver x receptors. Proceedings of the National Academy of Sciences of the United States of America. 2007;104:10601-10606 590. Fan J, Stukas S, Wong C, Chan J, May S, DeValle N, Hirsch-Reinshagen V, Wilkinson