Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

DNA:RNA hybrid genome-wide profiling and links to genomic instability Chan, Yujia Alina 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2014_spring_chan_yujiaalina.pdf [ 5.64MB ]
Metadata
JSON: 24-1.0166897.json
JSON-LD: 24-1.0166897-ld.json
RDF/XML (Pretty): 24-1.0166897-rdf.xml
RDF/JSON: 24-1.0166897-rdf.json
Turtle: 24-1.0166897-turtle.txt
N-Triples: 24-1.0166897-rdf-ntriples.txt
Original Record: 24-1.0166897-source.json
Full Text
24-1.0166897-fulltext.txt
Citation
24-1.0166897.ris

Full Text

  DNA:RNA HYBRID GENOME-WIDE PROFILING AND LINKS TO GENOMIC INSTABILITY by Yujia Alina Chan  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate and Postdoctoral Studies (Biochemistry and Molecular Biology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) April 2014  ? Yujia Alina Chan, 2014   ii  Abstract DNA:RNA hybrid formation is emerging as a significant cause of genomic instability in biological systems ranging from bacteria to mammals. However, the scope of cellular pathways that prevent DNA:RNA hybrids and the genomic loci prone to hybrid formation are unclear. In Saccharomyces cerevisiae, DNA:RNA hybrids were found to be prevalent in various RNA processing, DNA repair and kinetochore mutants. In particular, mRNA cleavage and polyadenylation factors were demonstrated to maintain genome integrity by preventing transcription-dependent DNA:RNA hybrid formation. Genome-wide profiling of DNA:RNA hybrids showed that highly transcribed genes are prone to hybrid formation in the absence of hybrid-mitigating enzymes. Furthermore, the hybrid profiles highlight various genetic features prone to hybrid formation and suggest potential functions for DNA:RNA hybrids in antisense transcription regulation. Together, these findings elucidate previously unrecognized pathways that mitigate DNA:RNA hybrid formation as well as the characteristics of hybrid prone genomic regions.  iii  Preface The research described in Chapter 2 was published in ?Stirling PC, Chan YA, Minaker SW, Aristizabal MJ, Barrett I, Sipahimalani P, Kobor MS and Hieter P. 2012. R-loop-mediated genome instability in mRNA cleavage and polyadenylation mutants. Genes & Development 26: 163-175.? This peer-reviewed article was co-written by the three co-first-authors, Peter Stirling, Yujia Chan and Sean Minaker. I performed most of the experiments for and wrote the result sections ?CIN in mCP mutants occurs via R loops? and ?Human FIP1L1 may be required for genome instability?. Irene Barrett performed the siRNA knockdown experiments and advised me in the analysis of the data from human cell line experiments. Peter Stirling was the head writer of the publication and he and Sean W Minaker performed the Rad52 foci screen and ChIP-chip experiments.  The research described in Chapter 3 was published in ?Chan YA, Aristizabal MJ, Lu PYT, Luo Z, Hamza A, Kobor MS, Stirling PC and Hieter P. 2014. Genome-wide profiling of yeast DNA:RNA hybrid prone sites with DRIP-chip. PLoS Genetics 10: DOI 10.1371/journal.pgen.1004288.? I performed most of the experiments and wrote the publication. Peter Stirling and Maria Aristizabal were especially helpful in the analysis of the data, generation of figures and editing of this paper. Maria Aristizabal and Phoebe Lu instructed me in the DRIP experiments and analysis. Zongli Luo walked me through the expression microarray experiments and analysis. Akil Hamza suggested and performed the iron sensitivity assays. The research described in Chapter 4 will constitute a future publication. iv  Table of Contents Abstract ????????????????????????????????.. ii Preface ???????????????????????..????????..... iii Table of Contents ???????????????????????????...... iv List of Tables ?????????????????????????????.... vii List of Figures ??????????????????????????...??.. viii Nomenclature ?..???????.????????????????????..... ix List of Abbreviations ??????????...???????????????...... x Acknowledgements ???????????????????...??????.... xii Dedication ?????????????????????.?????????... xiii 1 Introduction ???????????????????.??????????? 1 1.1 DNA: The blueprint of life .?????.?.???????????????... 1 1.2 Transcription ?????????????..??????????????.. 2 1.3 Chromosomes ????????????..???...???????????. 5 1.4 Cell division ??????????????????..?????????... 6 1.5 Chromosome segregation ????????..??????..?..?????...? 7 1.6 Chromosome instability in cancer ???????..????..?.????...?... 8  1.7 RNA processing defects contribute to genome instability in disease ?????? 10 1.8 R-loops: transcription-mediated genome instability and gene expression changes ... 12 1.9 Research scope ???.....??????????????????..???? 16 2 R-loop-mediated genome instability in mCP mutants ?............................................... 18 2.1 Introduction ???????????????????????????? 18 2.2 Methods ?????????????????????????????.. 19 2.2.1 Strains and plasmids ????????????????????..? 19 2.2.2 Rad52-YFP foci screening and CIN assays ????????????... 19 v  2.2.3 ChIP-chip ????????????????????????...? 19 2.2.4 Yeast chromosome spreads ??????????????????? 20 2.2.5 Mammalian tissue culture ??????????????????..? 21 2.3 Results ?????????????????????????????... 21 2.3.1 Rad52 foci screen of CIN genes ????????????????.... 21 2.3.2 Fragile sites in mCP mutants differ ??????????????...? 23 2.3.3 CIN in mRNA cleavage and polyadenylation mutants occurs via R-loops ... 29 2.3.4 Truncation of FIP1L1 leads to genome instability ?????????? 34 2.3.5 Human FIP1L1 may be required for genomic stability ????????. 35 2.4 Discussion ????????????????????????????.. 37 2.4.1 Profiling fragile site changes in mRNA processing mutants ????..?... 37 2.4.2 Conservation of a CIN phenotype to the human cancer gene FIP1L1 ?.?. 37 2.4.3 DNA:RNA hybrids are a common mechanism of genomic instability ??. 38 3 Genome-wide profiling of DNA:RNA hybrid prone sites in yeast ?????...?? 40 3.1 Introduction ???????????????????????????? 40 3.2 Methods ?????????????????????????????.. 42 3.2.1 Strains and plasmids ????????????????????..? 42 3.2.2 DRIP-chip and qPCR ?????????????????????. 42 3.2.3 Gene expression microarray ??????????????????.. 43 3.2.4 Yeast chromosome spreads ??????????????????? 44 3.2.5 BPS sensitivity assay ?????????????????????. 44 3.3 Results ?????????????????????????????? 44 3.3.1 The genomic distribution of DNA:RNA hybrids ??????????... 44 3.3.2 Cytological profiling of RNA processing mutants for R loop formation ?.. 47 3.3.3 DRIP-chip profiling of R loop forming mutants ??????????? 51 3.3.4 DNA:RNA hybrids are correlated with antisense-associated genes ???.. 55 3.4 Discussion ????????????????????????????.. 61 3.4.1 The genomic profile of DNA:RNA hybrids ????????????.. 61 3.4.2 DRIP-chip analysis of hybrid-resolving mutants ?????????..? 62 3.4.3 Antisense association of DNA:RNA hybrids ???????????? 64 vi  4 Pathways that interact with DNA:RNA hybrids and RNase H ????????? 66 4.1 Introduction ???????????????????????????? 66 4.2 Methods ?????????????????????????????.. 68 4.2.1 Strains and plasmids ????...???????????????...? 68 4.2.2 Synthetic genetic array and growth curve analysis ?????????? 68 4.2.3 Cytological screen for DNA:RNA hybrids ????????????.... 69 4.3 Results ?????????????????????????????? 69 4.3.1 Systematic quantitative analysis of genetic interactions with RNase H ?? 69 4.3.2 Cytological screen for DNA:RNA hybrids ????????????? 71  4.4 Discussion ????????????????????????????.. 76 4.4.1 DNA replication and repair are important to prevent DNA:RNA hybrid formation ?????????????????????????.... 76 4.4.2 Potential links between kinetochore defects and DNA:RNA hybrids ??... 77 5 Concluding Chapter ??????..???????????????????... 78 5.1 RNA processing: a safeguard against R-loop-mediated CIN ????..????.. 78 5.2 R-loops: not just a source of CIN ???????????????????.. 79 5.3 DNA:RNA hybrids arising from defects outside of RNA processing ?????... 81 Bibliography ??????????????????????????.???? 82 Appendix ?...???????????????.???????????.??? 105 vii  List of Tables Table 3.1 List of yeast genes with elevated DNA:RNA hybrid levels ????????.. 49 Table 4.1 Negative genetic interactions with RNase H in S. cerevisiae ???????? 70 Table 4.2 Enrichment of mutants screened for DNA:RNA hybrids ??...??????... 73 Table A1 Yeast strains used in Chapter 2 ??????????????????.... 109 Table A2. CIN phenotypes of mCP, THO, SEN1 and RTT103 mutants ??????.... 110 Table A3 Yeast strains used in Chapter 3 ??????????????????? 111 Table A4 Description of DRIP-chip profiles ????????????????...? 113 Table A5 List of rDNA enriched for DNA:RNA hybrids ???????????...? 114 Table A6 List of telomeric repeat regions enriched for DNA:RNA hybrids ?????... 115 Table A7 List of retrotransposons enriched for DNA:RNA hybrids ????????... 116 Table A8 List of ORFs enriched for DNA:RNA hybrids ????????????? 118 Table A9 List of tRNA genes enriched for DNA:RNA hybrids ??????????.. 155 Table A10 List of snoRNA genes enriched for DNA:RNA hybrids ???????...? 161 Table A11 Lists of open reading frames (ORFs) and antisense-associated ORFs enriched for DNA:RNA hybrids in wild type or modulated at the transcript level by RNase H overexpression ?????????????????????????????. 162 Table A12 GO function sorting of genes modulated at the transcript level by RNase H overexpression ?????????????????????????????. 168 Table A13 Spearman correlation scores for DRIP-chip replicates ?????????.. 171 Table A14 DRIP-qPCR primers ?????????????????????..? 172 Table A15 Yeast strains used in Chapter 4 ??????????????????.. 173 Table A16 SGA-identified negative genetic interactors with rnh1? rnh201? that met the p<0.05 and E-C<-0.2 cutoff ????????????????????????. 179 Table A17 List of strains screened for DNA:RNA hybrids ????????????. 200 Table A18 Quantification of CTF in kinetochore mutants ?.???????????. 205    viii  List of Figures Figure 1.1 An R-loop structure ???????????????????????.. 13 Figure 1.2 Mechanisms of R-loop-mediated genome instability ?..?????????. 14 Figure 2.1 A screen for spontaneous DNA damage in essential CIN genes ??????.. 22 Figure 2.2 Mapping of yeast ?-sites ?????????????????????... 24 Figure 2.3 clp1-ts and pcf11-2 mutant ?-sites link DNA damage to transcription ???? 26 Figure 2.4 3?-end bias of ORFs with increased ?-sites in clp1-ts and pcf11-2 mutants ?? 28 Figure 2.5 Transcription coupled R-loops are the likely cause of CIN in mCP mutants ...... 31 Figure 2.6 Truncation-fusion of FIP1 causes genome instability and DNA damage ??.... 34 Figure 2.7 Loss of human FIP1L1 function causes chromosome instability ?????? 36 Figure 3.1 The genomic profile of DNA:RNA hybrids in WT yeast ????????? 46 Figure 3.2 DNA:RNA hybrid cytological screen of RNA processing mutants ?.???? 50 Figure 3.3 The genomic profile of DNA:RNA hybrids in mutants ?...???????? 52 Figure 3.4 Antisense transcript association of genes associated with DNA:RNA hybrids ... 57 Figure 3.5 Pathways altered at the transcript level by RNase H overexpression ..???? 60 Figure 3.6 Models of antisense gene regulation that may involve DNA:RNA hybrids ?? 61 Figure 4.1 CIN mutants with elevated DNA:RNA hybrid levels ??????????.. 74 Figure 4.2 CIN in kinetochore mutants is suppressed by RNase H overexpression ???.. 75 Figure A1 DNA:RNA hybrid enrichment plot of mock WT sample ????????... 105 Figure A2 GC content of ORFs sorted by transcriptional frequency ????????.. 106 ix  Nomenclature Genes in yeast are italicized. Lower case indicates a mutant form of the gene. ? indicates the deletion of a particular gene (i.e. rnh201? indicates that the gene RNH201 has been removed from the genome). x  List of Abbreviations 6AU   6-azauracil ALF   A-like faker ANOVA  Analysis of variance ARS   Autonomously replicating sequence BiM   Bimater BSA   Bovine serum albumin ChIP-chip  Chromatin immunoprecipitation and microarray CIN   Chromosomal instability CTD   C-terminal domain CTF   Chromosome transmission fidelity DAmP   Decreased abundance by mRNA perturbation DAPI    4?,6-diamidino-2-phenylindole DNA   Deoxyribonucleic acid DRIP-chip  DNA:RNA immunoprecipitation microarray GFP   Green fluorescent protein GO   Gene ontology HR   Homologous recombination HU   Hydroxyurea IP   Immunoprecipitation mCP   mRNA cleavage and polyadenylation mRNA   Messenger RNA ncRNA  Non-coding RNA ORF   Open reading frame PARP   Poly ADP-ribose polymerase  PBS   Phosphate buffered saline qPCR   Quantitative polymerase chain reaction xi  RNA   Ribonucleic acid RPM   Rotations per minute SC   Synthetic complete (medium) SEM   Standard error of the mean SGA   Synthetic genetic array SL   Synthetic lethality SS   Synthetic sickness TAM   Transcription-associated mutagenesis TAR   Transcription-associated recombination Ts   Temperature-sensitive  WT   Wild type YFP   Yellow fluorescent protein YPD    Yeast peptone dextrose (medium) xii  Acknowledgements I thank my supervisor, Philip Hieter and committee members, Ivan Sadowski, Liz Conibear and Samuel Aparicio for their support and advice over the course of my degree. In particular, I thank Phil for being the most generous supervisor I have ever known in terms of supporting my professional development and giving me opportunities to collaborate with leading researchers from other institutes. I thank Peter Stirling, whose dedicated and generous mentorship was crucial to my training. I thank Irene Barrett for her kind advice and help in tissue culture experiments. I thank my collaborators Michael Kobor, Maria Aristizabal, Phoebe Lu, Alice Wang and Grace Leung who aided me in DRIP-chip experiments and analysis conducted at the Kobor laboratory. I thank Zongli Luo for his guidance with expression microarray experiments and analysis. I thank Lamia Wahba and Doug Koshland for sharing their DNA:RNA hybrid immunodetection protocol, RNase H1 plasmid and S9.6 hybridoma. I thank Samuel Aparicio for the provision of the 53BP1-mCherry-expressing HCT116 cell line. I thank Stephen Leppla for his gift of the S9.6 antibody. I acknowledge scholarship support in the form of the Natural Sciences and Engineering Research Council of Canada Alexander Graham Bell Graduate and Postgraduate Scholarships, the University of British Columbia Graduate Entrance Scholarship and Four Year Fellowship, the Faculty of Medicine Roman M Babicki Fellowship in Medical Research, the Faculty of Medicine Harry and Florence Dennison Fellowship in Medical Research, the Michael Smith Laboratories William and Dorothy Gilbert Graduate Scholarship in Biomedical Sciences, and the Department of Biochemistry and Molecular Biology travel award.  I thank my family, friends and colleagues for their enduring support throughout my degree.    xiii  To my younger brother, David Who has already written one thesis And will probably write another one soon.  To my loving parents Who may not understand this thesis But gave me the opportunity and privilege to write one.  To my aunts and grandmothers Who continually show me how far you can get with resilience And my incredible cousins, with whom I went there and back again.  To my dear friends One of whom tried to talk me into writing this thesis on a ski gondola. To POTO and our road trip when we reach 30.  To MMS Who left the city for one week so I could write this thesis And changed my life in the best ways. 1  1 Introduction 1.1 DNA: The blueprint of life  Before it became known as the double helix, deoxyribonucleic acid (DNA) was first discovered by Johann Friedrich Miescher in 1869 as a flocculent substance extracted from the nuclei of cells (Dahm 2008, Miescher 1869, Miescher 1871). Miescher?s careful examination distinguished this substance from other known organic molecules of that time by its high phosphorous content, exclusive localization within the nucleus and, notably, the increase in its quantity prior to cell division (Dahm 2008, Miescher 1869). Scrutinizing the DNA from human leukocytes to salmon spermatozoa, Miescher speculated that this mysterious entity could be the key to a then highly investigated question: How are hereditary traits transmitted from one generation to the next? Although limited by the technologies and knowledge of the time, Miescher was able to generate several prescient ideas about the properties of DNA and its role in fertilization. He proposed that DNA could potentially assemble into a multitude of arrangements to result in the diversity of organisms and that germline cells only possessed half of the full complement of DNA required for the development of an organism (Dahm 2008, Miescher 1892, Miescher 1895).  One of the next groundbreaking discoveries arrived in 1944 when DNA, but not protein, was found to transform a non-pathogenic bacteria into a virulent one (Avery et al. 1944). This ushered DNA into the limelight as the material responsible for storing and conferring hereditary information.  In 1953, the structure of DNA was solved by Rosalind Franklin, Maurice Wilkins, Francis Crick and James Watson, and became known to us as the double helix (Watson and Crick 1953). The structure alongside other findings at the time contributed critical clues to the mechanism by which DNA could replicate itself and be passed from generation to generation. Today, in high school and college classes all over the world, DNA is described to be constituted of four bases: adenine (A), thymine (T), guanine (G) and cytosine (C), where A always pairs with T and G always pairs with C. Each DNA strand has a 5? end and a 3? end. Using licorice sticks and marshmallows to represent the DNA backbone and bases, teachers can demonstrate to elementary school students how two DNA strands that run in opposite directions pair up to form the double helix, which is unzipped during replication so that each strand can serve as a template 2  to create a new complementary strand. Despite this simplicity, these permutations of ATGC encode the blueprints for all diverse forms of life.  To transmit an accurate complement of genomic DNA to daughter cells, DNA must be replicated. Starting at an origin of replication in the genomic DNA, both parent strands of DNA in the double helix are unwound by a helicase enzyme and simultaneously replicated by several DNA polymerases, forming a replication fork (DePamphilis and Wassarman 1980, Schekman et al. 1974). Ribonucleic acid (RNA) primers are used to initiate DNA synthesis in the 5? to 3? orientation by DNA polymerase, which uses the parent DNA strand as a template for replication (DePamphilis and Wassarman 1980). Due to the antiparallel orientation of the DNA strands in the double helix, one strand can be synthesized continuously from 5? to 3? and is called the leading strand, whereas the other strand must be synthesized in the form of Okazaki fragments as the replication fork progresses using a series of RNA primers (DePamphilis and Wassarman 1980, Sakabe and Okazaki 1966). After new DNA strands have been made, RNA primers are replaced with DNA and gaps are sealed to produce a continuous DNA strand (Schekman et al. 1974). By this method, DNA replication is performed in a semi-conservative manner where each of the two daughter double helices retains one parent DNA strand along with a newly synthesized complementary DNA strand (Meselson and Stahl 1958). 1.2 Transcription The central dogma of molecular biology describes the flow of information in a biological system where DNA is transcribed into RNA, which is translated into protein (Crick 1970). Two principles of this dogma are that (i) once information has been transferred into proteins, it cannot be transferred back to the nucleic acids from which it originated, and (ii) proteins perform most operations in the cell. This framework has been repeatedly challenged by the discovery of new informational paths such as proteins that modify DNA or non-coding RNAs (ncRNA) that do not encode proteins but perform regulatory functions (Gibbs 2003, Henikoff 2002, Mattick 2003). Nonetheless, the central dogma highlights two essential processes of the cell, transcription and translation, and is inculcated even at the university level. Conventionally, each DNA unit of heredity is called a gene. Gene expression is regulated in order to ensure that the cell possesses the proper complement of RNA and proteins at any moment. 3  It is interesting to note that the Encyclopedia of DNA Elements (ENCODE) project recently reported in 2012 that only 1% of the human genome encodes proteins while 80% of the genome is transcribed into RNA (Dunham et al. 2012). Deep sequencing and investigation of these RNA transcripts revealed an immensely complex transcriptome, in which RNAs regulate chromatin modifications (Koziol and Rinn 2010, Mattick et al. 2009, Mercer et al. 2011). Furthermore, the mapping of disease-associated genetic mutations found that the vast majority of these mutations localized to non-protein-coding regions of the genome that often instead contain regulatory information controlling gene expression (Mattick 2012). These discoveries dramatically shifted attention from proteins to RNA as a potential reservoir of regulatory molecules (Ball 2013). Similarly, the focus of a large portion of the research community has shifted to transcription and RNA processing, which facilitate the transfer of information from DNA to RNA (Turner 2011). In particular, RNA processing generates enormous diversity at the RNA level by producing several different transcripts from each gene (Brown et al. 2012, Licatalosi and Darnell 2010, Millevoi and Vagner 2010). RNA is a nucleic acid similar to DNA and also encodes information using four different bases. During transcription, RNA polymerase unzips the double helix within a transcription bubble to use DNA as a template for RNA synthesis. Once the complementary RNA transcript has been made, it is translocated by RNA polymerase away from the template DNA, which rehybridizes with the non-template DNA strand (Kaplan 2013). During transcription of messenger RNAs (mRNA) that are later translated into protein, the C-terminal domain (CTD) of the RNA polymerase is dynamically modulated during transcription to recruit different components such as histone modifiers and chromatin remodelers that guide transcription initiation, elongation and termination (Kaplan 2013, Spain and Govind 2011). Phosphorylation of several sites on the CTD occurs during transcription initiation and elongation, and dephosphorylation is required to reuse the RNA polymerase in another round of transcription (Hsin and Manley 2012). The steps of transcription are highly interconnected and factors purposed for certain step are often found to be essential for others (Kaplan 2013, Spain and Govind 2011). For instance, transcription is initiated by transcription factors that recognize promoter regions in the genome and facilitate binding of RNA polymerase, but RNA polymerase activity has recently been found to also determine transcription start site selection and hence the success or failure of transcription initation (Kaplan et al. 2012). Interestingly, in humans, the differential use of promoter regions that are also 4  regulated by transcription factors can result in different RNA transcripts, which may lead to disease and cancer if not properly regulated (Davuluri et al. 2008).  The CTD is an essential interface between transcription and RNA transcript processing. RNA processing factors are recruited to the nascent RNA transcript according to specific modified forms of the CTD (Hsin and Manley 2012). Several RNA processing factors are RNA-binding proteins (Chen and Manley 2009, Filipowicz et al. 2008, Millevoi and Vagner 2010) that bind to RNA polymerase in order to modify RNA transcripts as they are synthesized (i.e. co-transcriptionally) (Darnell 2013). The fact that RNA transcripts are modified co-transcriptionally again provides abundant opportunities for RNA processing regulation based on differences at the level of the genomic DNA (Brown et al. 2012). RNA processing is particularly well studied in the case of mRNAs, which are translated into proteins. One modification is 5? end capping, which occurs early in transcription. The necessary factors and enzymes are recruited by the CTD to pre-mRNA but not to other RNA transcripts (Hsin and Manley 2012, Shuman 2001). Although first discovered in adenovirus-encoded mRNAs, the process of splicing was soon found to be a universal mechanism in eukaryotes (Chow et al. 1977, Gilbert 1978). In splicing, segments of the RNA transcript called introns are excised by the spliceosome so that the remaining segments called exons can be joined. By this process, alternative transcripts can be generated from a single pre-mRNA in different conditions and this is important in the context of cell type differentiation (Amara et al 1982, Chen and Manley 2009, Darnell 1978, Rogers and Wall 1984, Wang et al. 2008). The CTD associates with several key splicing factors and is especially necessary in the case of weaker splicing signals (David and Manley 2011). Transcription elongation rate and epigenetic marks on genomic DNA can also alter splicing (Brown et al. 2012). These epigenetic marks often result from environmental changes to modify gene expression at the transcriptional level (Brickner at al. 2007, Kundu et al. 2007). To add to its complexity, the recruitment of splicing factors can feedback to chromatin modification, transcription elongation, transcription termination and mRNA transport by recruiting additional factors for these processes (Chanarat et al. 2011, de Almeida et al. 2011, Furger et al. 2002, Lin et al. 2008, Martins et al. 2011). The pre-mRNA must also be cleaved and polyadenylated at its 3? end, and alternative polyadenylation is yet another level at which regulation can result in multiple different mature mRNA transcripts (Lutz 2008, Millevoi and Vagner 2010, Wang et al. 2008, Zhang et al. 2005). Once again, the CTD is required to recruit and assemble the complex 5  for 3? processing (Hsin and Manley 2012). Similar to splicing factors, 3? processing factors have been found to affect transcription initiation (Mapendano et al. 2010) and are particularly important to transcription termination by recruiting exonucleases (Gromak et al. 2006, Hsin and Manley 2012, Kaneko et al. 2007, Kim et al. 2004, Proudfoot 2011, West et al. 2004). Certain actively transcribed genes are localized near the nuclear pore complex by transcriptional machinery to expedite export and translation of the mRNA (Akhtar and Gasser 2007). Post-transcriptionally, mRNA transcripts face still more regulation at the level of translation and RNA turnover (Filipowicz et al. 2008, Houseley and Tollervey 2009, Kochetov 2208, Richter 2008, Rodriguez et al. 2008, Sonenberg and Hinnebusch 2009, Turner 2011).  1.3 Chromosomes The human genome is approximately three billion base pairs in total. To fit this much DNA into a cell nucleus, the DNA must be packaged by proteins into the highly condensed form of chromatin. The primary repeating element of chromatin is the ?bead-on-a-string?, which consists of DNA wrapped around a complex of histone proteins called the nucleosome (Kornberg 1977). These ?beads-on-a-string? are compacted even further with the addition of other histones and scaffolding proteins, although the exact in vivo structure of chromatin remains a topic of debate (Grigoryev and Woodcock 2012). Depending on the stage of the cell cycle, chromatin exists in varying states of condensation. In interphase, when the cell is preparing for cell division (see section 1.4), it is in an active state of synthesizing proteins and replicating its DNA. To permit the expression of protein, chromatin is relaxed so that the genetic material is accessible. However, in metaphase, during cell division, chromosomes are highly condensed in preparation for segregation into daughter cells. Each chromosome in an organism is comprised of DNA that encodes unique hereditary genetic information. Humans have two copies each of 23 chromosomes, making a total of 46 chromosomes. However, when human chromosomes were first discovered by Theophilus Painter in 1923 (Painter 1923), they were miscounted and reported to be in the quantity of 48 per human cell for over three decades before being corrected (Tijo and Levan 1956). Nonetheless, Painter made several important observations about chromosomes regarding their size and shape, as well as the determination of human sex by an X or Y chromosome (Painter 1923, Ruddle 2004). Today, the most recognizable form of a chromosome is an ?X?, a four-arm structure connected at 6  a centric point called the centromere. Each half of the ?X? is actually an identical copy of the other half, resulting in both halves being named sister chromatids. During cell division, the centromeres are attached to centrosomes at opposite ends of the cell and pulled apart in anaphase so that each daughter cell receives one set of chromatids. Our understanding of the mechanics of chromosome movement orchestrated by kinetochores and microtubule spindles during cell division is still evolving (Mitchison and Salmon 2001, Paweletz 2001).  1.4 Cell division Cells are the fundamental building block of all living organisms. For organisms to develop and replicate, cells must divide into more cells. This concept is fairly straightforward, belying the complexity of its execution. Cells are membrane-contained units that house a bustling population of proteins and nucleic acids sorted into even more membranous compartments. The idea of splitting a cell in half again and again while retaining a precise complement of DNA and proteins needed for cell functionality is astounding.  Cell division was first described by Walther Flemming in the 1870s, who coined the term mitosis after the thread-like appearance of scaffolds within the dividing nucleus (Mitchison and Salmon 2001, Paweletz 2001). Mitosis begins after chromosomes are replicated during interphase. Mitosis consists of several phases: prophase, prometaphase, metaphase, anaphase and telophase. During prophase, chromosomes are highly condensed and two centrosomes are established at opposite ends of the cell to serve as organizing centers. In prometaphase, microtubules from the centrosomes attach to kinetochores, which are attached to each chromatid at the centromere. Once connected, in metaphase, the kinetochore will pull each chromatid to the end of the cell to which it is attached. However, since sister chromatids are still bound to each other, this results in each chromosome being lined up exactly in the middle of the cell. Anaphase proceeds to break the bonds between sister chromatids so that chromatids of each sister pair are pulled to opposite ends of the cell. In telophase, each chromosome set is re-enveloped in a nuclear membrane. Finally, a separate process called cytokinesis pinches the cell in two so that the two nuclei are separated into daughter cells.  The controls required for the coordination of division were first elucidated in budding and fission yeast also known as Saccharomyces cerevisiae and Schizosaccharomyces pombe respectively 7  (Hartwell 1973, Hartwell 1978). Yeast is easily manipulated and its utility as a model organism for the study of functions conserved in human cells was particularly conveyed in this instance. 148 genetic mutants of S. cerevisiae that exhibited cell division defects were created and characterized in order to elucidate the cell division program and its checkpoints (Hartwell 1973). The research in yeast ultimately served to produce a model of cell division where the cell pauses until certain criteria have been ascertained by checkpoint regulatory molecules that then signal the cell to proceed to the next stage of the cell division cycle (Garber 2001, Hartwell 1978). 1.5 Chromosome segregation DNA is replicated during interphase and segregated into daughter cells during mitosis. Chromosome instability (CIN) describes a condition where a cell is more likely to experience chromosome gains, losses or rearrangements. CIN arises chiefly due to failures in mitosis such as problems with centrosome regulation, kinetochore-microtubule attachment or the mitotic spindle checkpoint that results in missegregation of chromosomes (Crasta et al. 2012, Janssen et al. 2011, Rao and Yamada 2013). For instance, in a situation where one kinetochore is attached to two centrosomes, lagging chromosomes and chromosome missegregation are more frequently observed (Janssen et al. 2011). This can be deleterious to the cell?s genome in many ways as demonstrated by elevated DNA damage and breakage in missegregated chromosomes (Janssen et al. 2011). However, mitotic errors are by no means the only cause of CIN, and new unexpected cellular pathways such as protein turnover and mitochondria function that also serve to prevent CIN were recently discovered (Ben-Aroya et al. 2010, Veatch et al. 2009).  CIN can also be triggered by setbacks during interphase such as faulty DNA repair or DNA replication stress that result in chromosomal structural aberrations (Burrell et al. 2013, Ichijima et al. 2010, Kawabata et al. 2011). During the synthesis phase of interphase, DNA is synthesized by DNA polymerase from origins of replication. The unwinding of DNA and synthesis of new strands creates a replication fork, which can be stalled if it encounters obstacles such as gaps in the DNA, secondary DNA structures or even highly transcribed regions (McGowan 2003, Rothstein et al. 2000). DNA perturbations such as gaps and modified bases can be caused by exogenous or endogenous DNA damaging agents and must be removed to allow DNA replication progression (Paulsen and Cimprich 2007). The cell has a replication checkpoint to detect and repair stalled forks (Osborn et al. 2002, Paulsen and Cimprich 2007). However, 8  unresolved replication intermediates, which often lead to double stranded breaks (DSB) and recombination events in DNA, can evade this checkpoint and persist into mitosis to interfere with chromosome segregation (Cobb et al. 2005, Ichijima et al. 2010, Kawabata et al. 2011). The severe consequences that DNA damage from stalled forks can cause is illustrated by its ability to trigger inhibition of cytokinesis to produce a tetraploid cell that has double the normal chromosome complement (Ichijima et al. 2010, Kawabata et al. 2011).  1.6 Chromosome instability in cancer Cancer is characterized by uncontrolled cell proliferation and tissue invasion, resistance to cell death, abnormal responses to signaling and the ability to trigger angiogenesis for the nutrition of tumors, in which aneuploidy, cytogenetic rearrangements and epigenetics can play a role (Hanahan and Weinberg 2011, Loeb 2011, Stratton 2011). These mutations change the expression and activity of oncogenes and tumor suppressors. In tumors, oncogenes have gain-of-function mutations that perturb cell regulation and growth, whereas tumor suppressor genes acquire loss-of-function mutations that lead to loss of control over cell proliferation. Most human cancers also exhibit increased mutation rate or CIN that often arise from mutations in genome maintenance pathways (Cahill et al. 1999, Hanahan and Weinberg 2011, Loeb 2011, Rao and Yamada 2013, Schvartzman et al. 2010, Stratton 2011). The majority of solid tumors display an abnormal number of chromosomes arising from CIN (Rajagopalan and Lengauer 2004, Thompson and Compton 2011, Weaver and Cleveland 2006).  Significantly, CIN in tumors is associated with poor prognosis and increased drug resistance (Lengauer et al. 1998, McGranahan et al. 2012). Genome instability, especially in the form of CIN, has been found to endow cancers with the advantages of generating a large pool of mutants potentially in oncogenes and tumor suppressor genes, out of which the most aggressive cells are selected (Foijer et al. 2008, Gerlinger et al. 2012, Pfau and Amon 2012, Rao and Yamada 2013, Sieber et al. 2003). CIN leads to an imbalance in important cellular components such as growth factors and further genome instability, which accelerate cancer development and resistance to therapy (Fujiwara et al. 2005, Lengauer et al. 1997, Loeb 2011, Pfau and Amon 2012, Ricke et al. 2008, Schvartzman et al. 2010, Sotillo et al. 2007, Weaver et al. 2007). Tumor suppressor gene loss of heterozygosity can cause an insufficiency in certain genetic contexts that predisposes cells to tumor formation (Baker et al. 2009). These facts make elucidating and harnessing the 9  unique weaknesses of cells with CIN a popular approach to selectively kill cancer cells ideally with minimal harm to normal cells (Hartwell et al. 1997, Kaelin 2005, Porcelli et al. 2012, Rao and Yamada 2013, Soncini et al. 2012).  This approach can capitalize on genetic interactions, where two mutations in combination produce a phenotype that is different from the additive phenotypes of each mutant alone. For instance, when two mutants that are individually viable result in slow growth or death in the double mutant, that negative genetic interaction is called synthetic sickness (SS) or synthetic lethality (SL) respectively (Dobzhansky 1946). One situation where this might occur is when there are two alternative pathways that perform the same function in the cell so that lethality only arises from defects in both pathways. Additionally, in the case of cancer, tumor cells can be reliant on the expression of certain genes, and it is a matter of identifying these genetic crutches to improve the design of cancer therapeutics (e.g. the reliance on WAPL overexpression in cervical tumors; Oikawa et al. 2004). Model organisms such as yeast are commonly used to identify candidate SL interactions that could be conserved in humans and therefore represent potential therapeutic targets to treat cancer (Hartwell et al. 1997, Kaelin 2005). For example, an interaction between RAD27 and RAD54 in yeast was recapitulated in a human colon cancer cell line lacking RAD54B that could be selectively killed by depletion or inhibition of the human homolog of RAD27 (McManus et al. 2009). In the case of CIN, which is best known to arise from dysfunction in DNA repair and mitotic functions (Bell et al. 2011, Jackson and Bartek 2009, Schvartzman et al. 2010), it was discovered that cells lacking the BRCA1 or BRCA2 DNA repair proteins are especially sensitive to a poly ADP-ribose polymerase (PARP) inhibitor (Bryant et al. 2005, Farmer et al. 2005). Clinical trials using PARP inhibitors to treat breast and ovarian cancers with the BRCA1/2 mutations have produced promising results and more knowledge of other cancer genetic markers can aid the development of more efficacious combination therapies to target both PARP and other tumor points of weakness (Lee et al. 2013). The objective of tumor DNA sequencing is to identify gene mutants that drive CIN and tumor development in order to tailor cancer therapeutics according to each patient?s genomic profile. Yet the extent of pathways that contribute to the prevention of CIN remains unclear and annotating the contributions of each mutation found from sequencing is a challenge.  10  Turning again to model organisms, CIN genes are particularly conserved across evolution and are ideal targets for investigation (Gotter et al. 2007, Hou and Zou 2005, Kohler et al. 1997, Merkle et al. 2003, Watrin et al. 2006, Williams and McIntosh 2002). In yeast, simple assays for chromosome rearrangement or loss have revealed several hundred CIN genes encoding different cellular pathways, some of which have been confirmed in humans and other model organisms (Chen and Kolodner 1999, Guacci et al. 1997, Michaelis et al. 1997, Spencer et al. 1990, Stirling et al. 2011, Strunnikov et al. 1993, Yuen et al. 2007). These CIN genes represent targets for investigation to understand how each mutation contributes to CIN and what genetic interactions it may possess. This is especially convenient in yeast through the technology of synthetic genetic array (SGA) where thousands of mutants can be combined pairwise with each other to discover genetic interactions (Costanzo and Boone 2009, Koh et al. 2010, Tong et al. 2001). This list of CIN mutants in yeast (Stirling et al. 2011) also serves as a resource for checking current tumor sequence databases for potential mutants that could contribute to CIN and tumor progression. Ultimately, understanding CIN and the many pathways that contribute to it has extensive implications for cancer therapy, detection and classification.  1.7 RNA processing defects contribute to genome instability in disease Recent functional genomic studies in mammalian cell lines and model organisms have implicated many aspects of RNA processing in the prevention of genome instability (Paulsen et al. 2009, Stirling et al. 2011, Wahba et al. 2011). Among the most obvious consequences of perturbed transcription and RNA processing are changes in gene expression. Many genes that are crucial to the maintenance of genome integrity require accurate co- or post-transcriptional processing (Lopez-Saavedra and Herrera 2010). Producing more, less or altered sets of mRNAs will influence the amount of protein produced and ultimately control the fate of the cell and progression into disease (Chi et al. 2010, Cooper et al. 2009). The impact of RNA processing defects on the cell transcriptome represents another understudied area although perturbation of gene expression is a common phenomenon in human diseases and is a potential source of genome instability (Casimiro et al. 2012, Chou et al. 2013, Li and Lu 2013, Naro and Sette 2013). Mutations and mis-regulation of transcription factors are well documented in tumors and can lead to pleiotropic effects on cell biology (Bywater et al. 2013, Crighton et al. 2003, Dang et al. 2006, Grandori et al. 2005, Zhai and Comai 2000). Recent examples have linked altered 11  chromatin or transcription specifically to expression of genome stability factors (e.g. polycomb modifiers of Aurora A expression; Casimiro et al. 2012, Chou et al. 2013). In addition to these traditional modifiers of gene expression, co- and post-transcriptional activities like splicing and RNA degradation also control gene expression and have been linked to genome instability and cancer (David and Manley 2010, Kim et al. 2008, Li and Manley 2005, Sveen et al. 2011, Tang et al. 2013, Yang et al. 2012). Mutations affecting core components of the splicing machinery are remarkably common in various cancer types including uveal melanoma, colon cancer, lung cancer, breast cancer, pancreatic cancer myelodysplastic syndromes, leukemia and other hematological malignancies (Cohen-Eliav et al. 2013, Furney et al. 2013, Lasho et al. 2012, Meggendorfer et al. 2012, Patnaik et al. 2013, Quidville et al. 2013, Scott and Rebel 2013, Yoshida et al. 2011). In some cases there is evidence that these mutations affect gene expression (Cohen-Eliav et al. 2013, Furney et al. 2013) but the ensuing cellular phenotype relevant to malignancy is not known (Garraway and Lander 2013).  An informational mechanism of genome instability has been suggested for a variety of perturbed splicing conditions. For example, mutations in the yeast CDC5L homologue CEF1 have been shown to promote cell cycle arrest and benomyl sensitivity specifically through defective splicing of the ?-tubulin-encoding TUB1 transcript (Burns et al. 2002). Removal of the single intron from TUB1 restored cell cycle progression in spliceosomal mutants with G2/M arrests but not those with other defects. In an analogous situation in mammalian cells, depletion of the ERH splicing regulator leads to chromosomal instability due to failed splicing of the mitotic motor protein CENP-E and other cell cycle and DNA repair proteins (Weng et al. 2012). The authors identified ERH as a synthetic lethal partner of mutant KRASG13D and they propose that the mechanism of synthetic lethality relates to additional mitotic stress in cells with activating KRAS mutations (Weng et al. 2012). Thus from yeast to humans, disruption of specific splicing factors can change the gene expression program in a way that promotes chromosome instability. While the influence on gene expression is likely a common theme among many of these cancer-associated splicing mutants, there is precedent for splicing factors functioning outside of their roles in gene expression. For example, the proposed direct role of SFPQ/PSF and SR proteins in DNA repair and topoisomerase function (Juge et al. 2010, Rajesh et al. 2011), the function of SF3B1 in polycomb-mediated gene repression (Isono et al. 2005) or the role of factors like 12  ASF/SF2 in preventing transcription-coupled R-loops (Li and Manley 2005). Disruption of any of these activities could lead to genome instability independent of altered gene expression due to splicing defects. Regardless of the mechanism, as is the case for ERH (Weng et al. 2012), spliceosomal mutations can impact genome integrity, and in the model organism S. cerevisiae loss-of-function mutations in many splicing factors result in CIN phenotypes (Stirling et al. 2011). The contributions of individual splicing mutations to tumor genome instability remains to be determined.  1.8 R-loops: transcription-mediated genome instability and gene expression changes There is a long history of directed studies that have mechanistically linked RNA processing defects to transcription-coupled DNA:RNA hybrid formation (Chavez et al. 2000, Chernikova et al. 2012, Dominguez-Sanchez et al. 2011, El Hage et al. 2010, Gallardo et al. 2003, Gan et al. 2011, Gavalda et al. 2013, Gomez-Gonzalez et al. 2011, Gonzalez-Aguilera et al. 2008, Huertas and Aguilera 2003, Jimeno et al. 2002, Li and Manley 2005, Luna et al. 2005, Mischo et al. 2011, Sikdar et al. 2008, Stirling et al. 2012). These elegant mechanistic studies have emerged from several groups and conclusively link DNA:RNA hybrids and the associated R-loop to genome instability through several discrete mechanisms such as transcription-associated recombination and replication fork impediment (Aguilera and Garcia-Muse 2012, Gan et al. 2011). In humans, defects in RNA processing components known to increase R-loop formation, such as the Sen1/Senataxin helicase, RNase H2 and splicing factors, are responsible for certain cancers and neurodegenerative diseases (Crow et al. 2006, Garraway et al. 2013, Reijns et al. 2012, Suraweera et al. 2009, Wang et al. 2011b). However, the prevalence and significance of R-loops in tumor progression remains relatively unexplored despite growing evidence for RNA processing as a protective factor against R-loop-mediated genome instability. First described in vitro in 1976, R-loop structures consist of a DNA:RNA hybrid and a displaced single stranded DNA (ssDNA) (Figure 1.1; Thomas et al. 1976). Since then, R-loops have been revealed to mediate several important cellular processes such as somatic hypermutation at immunoglobulin genes (Chaudhuri et al. 2003, Chaudhuri et al. 2004), mitochondrial DNA replication (Backert 2002, Brown et al. 2008; Kogoma et al. 1997), alternative mRNA degradation in bacteria (Anupama et al. 2011), pause site-dependent transcription termination 13  (Skourti-Stathaki et al. 2011), regulation of chromatin modification (Castellano-Pozo et al. 2013, Ginno et al. 2013, Ginno et al. 2012), telomere length regulation (Balk et al. 2013, Luke et al. 2008, Pfeiffer et al. 2013) and antisense transcription regulation (Marinello et al. 2013, Powell et al. 2013, Sun et al. 2013). Disruption of normal R-loop functions may impact genome integrity but it is the excessive or misregulated R-loop formation that has been most commonly associated with DNA damage and genome instability (Aguilera and Garcia-Muse 2012). For instance, topoisomerase I (Top1) inhibition is known to result in transcription blockage and increased R-loop formation in both yeast and human, which then leads to DSBs and DNA damage response in human and rat cells (El Hage et al. 2010, Marinello et al. 2013, Sordet et al. 2009). The mutagenic and hyper-recombinogenic potential of R-loops has been best described in S. cerevisiae; however, the threat that R-loops pose to genomes has been directly demonstrated in Escherichia coli, yeast, Caenorhabditis elegans, mammalian cells and other systems (Aguilera and Garcia-Muse 2012). A plethora of defects across mRNA export, splicing, 3? end processing, transcription termination, RNA degradation and DNA repair are currently known to contribute to R-loop formation or failure to resolve R-loops (Aguilera and Garcia-Muse 2012). In many R-loop producing mutants, direct removal of DNA:RNA hybrids by overexpression of RNase H has been found to suppress genome instability such as chromosome loss in yeast and DSB formation in mammalian cells (Paulsen et al. 2009, Stirling et al. 2012). These observations provide causal links between unchecked R-loop formation and genome instability through several potential mechanisms discussed below.  Figure 1.1 An R-loop structure.  14  R-loops that form due to abnormalities in RNA processing are recognized sources of transcription-associated mutagenesis (TAM) and transcription-associated recombination (TAR) (Aguilera and Garcia-Muse 2012). R-loop-mediated genome instability may occur from (i) the inability to repair damage resulting from R-loops and/or (ii) inappropriate DNA repair such as transcription-coupled nucleotide excision repair triggered by R-loops (Gaillard and Aguilera 2013). One mechanism of R-loop-mediated genome instability involves the displaced ssDNA serving as a substrate for cytosine deaminases such as AID, which can result in mutagenic recombination to repair the deaminated base (Figure 1.2; Gomez-Gonzalez et al. 2007, Chaudhuri et al. 2004). On a related note, overexpression of the cytosine deaminase APOBEC3A/B is known to cause genome instability in cancer (Burns et al. 2013, Nik-Zainal et al. 2012, Taylor et al. 2013). Another well-supported model of R-loop-mediated DNA damage involves collisions between the transcription and DNA replication machinery (Figure 1.2; Aguilera and Garcia-Muse 2012, Bermejo et al. 2012, Gan et al. 2011). These collisions lead to replication fork stalling that can be resolved through a DSB, which are also mutagenic and contribute to TAM. It is unknown whether R-loop formation is upregulated in cancer and if R-loops are a common cause of genome instability in tumor evolution. One method that is gaining in popularity and could be extended to tumor genome analysis is native bisulfite-treated genome sequencing to probe for R-loop formation sites by means of identifying single-stranded genomic regions that are susceptible to bisulfite (Ginno et al. 2012, Li and Manley 2005, Sun et al. 2013). Evidence strongly suggests that, in the event of a mutation in RNA metabolism or DNA repair that stimulates R-loop formation, the cell becomes predisposed to the various forms of genome instability described.   15  Figure 1.2 Mechanisms of R-loop-mediated genome instability. The black and grey lines are DNA strands. The red line is RNA. RNAP represents RNA polymerase. DNAP represents DNA polymerase. AID is a cytosine deaminase. In addition, R-loops have recently been demonstrated to play important roles in gene regulation via antisense transcript expression, transcription termination and chromatin modification (Ginno et al. 2013, Powell et al. 2013, Sun et al. 2013). Antisense transcripts are produced from the opposite strand and regulate the expression of sense transcripts (Faghihi et al. 2009). They are highly prevalent in the mammalian genome and have been observed at active promoters and most transcribed genes (Faghihi et al. 2009, He et al. 2008). Antisense transcription regulation is hypothesized to work by collision of transcription machineries or recruitment of, or protection against, chromatin modifiers (Camblong et al. 2007, Castelnuovo et al. 2013, Faghihi et al. 2009, Hobson et al. 2012, Imamura et al. 2004, Pandey et al. 2008; Margaritis et al. 2012, Tufarelli et al. 2003, van Dijk et al. 2011). Recent studies have demonstrated a role for R-loops in antisense transcription regulation, which suggests that anomalous R-loop formation can significantly alter gene expression. For instance, work done in mammalian cells and Arabidopsis have shown that R-loops can be formed by antisense transcripts or even inhibit antisense transcription (Marinello et al. 2013, Powell et al. 2013, Sun et al. 2013). Interestingly, Top1-DNA cleavage complexes induced by camptothecin, an anticancer agent, were found to result in accumulation of R-loops at highly transcribed regions and promoter-associated antisense transcripts (Marinello et al. 2013). The effects of this antisense accumulation remain to be determined. However, a study of the Kcnq1ot1 antisense transcript in mammalian cells demonstrated the potential of antisense transcripts in binding chromatin and modulating the activity of methyltransferases to silence gene expression in a lineage-dependent manner (Pandey et al. 2008). In their study of targeted therapies for autism-spectrum disorders, Powell et al. identified a candidate drug that stabilizes R-loops and chromatin decondensation at a gene locus that is critical to the development of the disorder (Powell et al. 2013). Based on computational prediction, many oncogenes, tumor suppressors and genes implicated in neuro-degenerative diseases have been found to be prone to R-loop formation (Wongsurawat et al. 2012). These observations suggest that erroneous R-loop formation may lead to significant alterations in the expression of genes that are key to disease progression, although once again, there has been little research done to address this possibility.   16  1.9 Research scope My thesis investigates the molecular mechanism of CIN in RNA processing mutants, which can provide not only fundamental biological insights but also lead to the development of anti-cancer therapeutics. My research aims to answer three questions: (1) Is CIN in RNA processing mutants dependent on R-loop formation? Through a direct immuno-detection screen of CIN mutants for DNA:RNA hybrids, I identified mutants of the mRNA cleavage and polyadenylation (mCP) complex as key factors in the prevention of R-loop formation. In these mCP mutants, overexpression of RNase H, a DNA:RNA degrading enzyme suppressed the chromosome transmission fidelity (CTF) CIN phenotype, confirming a link between R-loop formation and CIN. The CIN phenotype of FIP1L1, a conserved mCP component, was recapitulated in the human colorectal cell line HCT116 through siRNA knockdown of FIP1L1, which produced increased chromosomal breakage in mitotic cells in metaphase. These findings illuminate how mCP maintains genome integrity by suppressing R-loop formation and suggest that this function may be relevant to certain human cancers. (2) Where do DNA:RNA hybrids form in the genome and how do certain mutants shift this profile compared to wild type?  DNA:RNA hybrid immunoprecipitation microarray (DRIP-chip) analysis was performed in wild type and in the RNase H and Senataxin helicase mutants characterized to have increased R-loop formation. Our profiles show that DNA:RNA hybrids preferentially accumulated at rDNA, Ty1 transposons, telomeric repeat regions and a subset of open reading frames (ORFs). The latter are generally highly transcribed and have high GC content. In our analysis, a Sen1 helicase mutant displayed global increases in hybrid formation while RNase H deletion specifically increased hybrid formation at ORFs with high transcription frequency and at tRNA genes. Interestingly, significant enrichment of DNA:RNA hybrids was detected at ORFs associated with antisense transcripts. Furthermore, expression microarray analysis shows that overexpression of RNase H, which degrades the RNA in DNA:RNA hybrids, significantly affected the expression of genes with antisense transcripts. The profile of loci prone to accumulation of DNA:RNA hybrids provides a resource for understanding the properties of hybrid-forming regions in vivo, supports 17  and extends our knowledge of hybrid-mitigating enzymes and provides new considerations in models of antisense-mediated gene regulation. (3) How prevalent is DNA:RNA hybrid formation amongst CIN mutants?  The immuno-detection screen for elevated DNA:RNA hybrid levels was extended to 300 CIN mutants and an SGA screen was performed to identify genetic interactions with the single and double mutants deficient for RNase H activity. As expected, these screens identified various DNA repair components as the most crucial to DNA:RNA hybrid formation and resolution, having both genetic interactions with RNase H deficient mutants and elevated DNA:RNA hybrid levels. Several kinetochore mutants exhibited elevated DNA:RNA hybrid levels. Overexpression of RNase H was also found to suppress the CTF phenotype in kinetochore mutants, suggesting that DNA:RNA hybrids play a central role in mediating CIN in these mutants. ?  18  2 R-loop-mediated genome instability in mCP mutants 2.1 Introduction In S. cerevisiae, genome-wide screens have culminated in an extensive compilation of nearly 700 CIN genes representing an array of cellular processes (Stirling et al. 2011). This list is a valuable resource for the study of candidate CIN genes in human and also reveals many cellular components for which the mechanism of genome instability is obscure (Andersen et al. 2008, Kanellis et al. 2007, Smith et al. 2004, Stirling et al. 2011, Stirling et al. 2011, Yuen et al. 2007). One more recently appreciated group of CIN genes, associated with DNA damage and increases in mutation and recombination, are subsets of genes involved in transcription and RNA processing. Mutations in topoisomerase I, the Sen1 helicase, the THO/TREX mRNA export complex and the SR protein splicing factor ASF/SF2 have each been linked to genome instability via a common mechanism (El Hage et al. 2010, Gomez-Gonzalez et al. 2009, Li and Manley 2005, Mischo et al. 2011). These mutants induce the formation of persistent, transcription-associated DNA:RNA hybrids which form R-loops. The R-loop structures expose damage-prone ssDNA on the nonsense strand and may act as a block for replication fork progression, consistent with observations that mammalian transcription-associated recombination requires DNA replication (Gomez-Gonzalez et al. 2009, Gottipati et al. 2008, Prado and Aguilera 2005). At present, the extent of cellular processes that contribute to R-loop-based genome instability is unclear.  To identify CIN processes that increase cellular demands on the recombination machinery, we performed a visual screen for Rad52-marked recombination centers in mutants representing >300 essential CIN genes. Remarkably, of 44 strains with increased Rad52 foci, we identified seven subunits of the mRNA cleavage and polyadenylation (mCP) machinery. Chromatin immunoprecipitation and microarray (ChIP-chip) using phosphorylation of H2A as a marker of DNA damage revealed fragile site differences between mCP mutants and wild type (WT) that mapped to a set of transcribed ORFs linked to replication origins, supporting a transcription-dependent mechanism for DNA damage. We directly detected DNA:RNA hybrids in mCP mutants and found that expression of RNase H, which degrades DNA:RNA hybrids, rescues the chromosome transmission defect phenotype of these mutants. Finally, we showed that mutations 19  of the mCP component FIP1 analogous to those seen in cancer cause genome instability and that siRNA knockdown of the human ortholog FIP1L1 causes chromatid breaks in HCT116 cells. Together, our findings support a mechanism for CIN in mCP mutants involving transcription-coupled R-loop formation and suggest that this mechanism may be applicable to human mCP genes mutated in cancer. 2.2 Methods 2.2.1 Yeast strains Yeast strains (S288C derived) were grown in YPD or synthetic complete media lacking the appropriate amino acid where nutritional selection was required. Serial dilution assays and growth curve analysis were performed as described (McLellan et al. 2009, Stirling et al. 2011). Table A1 (appendix) contains a list of yeast strains used in this study. 2.2.2 Rad52-YFP foci screening and CIN assays Rad52 was tagged with YFP and a selectable marker by direct transformation and introduced into the relevant strains by SGA (Tong et al. 2004). Log-phase cultures of an essential CIN mutant expressing Rad52-YFP were shifted from 25?C to 37?C for 3.5 hours and then prepared for microscopy as described (Carroll et al. 2009). Both DIC and fluorescence images were collected with Metamorph (Molecular Devices) and analyzed using ImageJ (http://rsbweb.nih.gov/ij/index.html). For experiments to show transcription dependency, cells growing at 25?C were pretreated with 100?g/mL of 6AU for 20 minutes before shifting to 37?C for 3.5 hours and imaging as for untreated cells. For each putative hit, the experiment was triplicated and ?100 cells were counted per replicate. Budding indices were derived from these images. Chromosome instability assays were performed exactly as described (Spencer et al. 1990, Yuen et al. 2007). 2.2.3 ChIP-chip ChIP-chip experiments were performed exactly as described (Schulze et al. 2009) using a ChIP-grade anti-phospho-Ser129 H2A (ab15083; Abcam), except ts-alleles were inactivated by shifting to 37?C for 3 hours before cross-linking. Data analysis and plotting of enriched features was performed using custom R, MatLab and python scripts essentially as described (Schulze et 20  al. 2009, Takahashi et al. 2011). All profiles were generated in duplicate except the h2a-S129A control. The enrichment threshold was 2.5 fold for all analyses. Features were considered enriched if 25% of the feature length met the enrichment threshold when normalized to the h2a-s129A strain profile and if 10% of the feature met the enrichment criteria for mutants normalized to WT. To determine whether the data recovered more of a particular feature than would be predicted at random a Monte Carlo simulation on the relevant dataset was run using randomly generated start positions for a particular set of features (e.g. ARSs), while maintaining the total number of features within a chromosome (Schulze et al. 2009). 500 simulations were run for each feature to generate a mean and standard deviation. These values were compared to the observed score using the cumulative normal distribution, which calculates the probability of seeing a lower score if a value was selected at random (www.stattrek.com). Transcriptional frequency categories and Rad52 foci counts were compared to controls using a Student?s t-test (http://www.graphpad.com). Overall transcriptional frequencies for smaller samples were compared using the Mann-Whitney test. Significance levels are indicated the main text or figure legends. 2.2.4 Yeast chromosome spreads Cells were grown to mid-log phase in YEPD rich media at 30oC and washed in spheroplasting solution (1.2 M sorbitol, 0.1 M potassium phosphate, 0.5 M MgCl2, pH 7) and digested in spheroplasting solution with 10 mM DTT and 150 ?g/mL Zymolase 20T at 37oC for 20 minutes similar to previously described (Michaelis et al. 1997). The digestion was halted by addition of ice-cold stop solution (0.1 M MES, 1 M sorbital, 1 mM EDTA, 0.5 mM MgCl2, pH 6.4) and spheroplasts were lysed with 1% vol/vol Lipsol and fixed on slides using 4% wt/vol paraformaldehyde/3.4% wt/vol sucrose) (Klein et al. 1992). Chromosome spread slides were incubated with the mouse monoclonal antibody S9.6 (1?g/mL in blocking buffer of 5% BSA, 0.2% milk and 1x PBS). The slides were further incubated with a secondary Cy3-conjugated goat anti-mouse antibody (Jackson Laboratories, #115-165-003, diluted 1:1000 in blocking buffer). For each replicate, at least 100 nuclei were visualized and manually counted to obtain the fraction with detectable DNA:RNA hybrids. Each mutant was assayed at least in triplicate. Mutants were compared to wild type by the student T test. For RNase H treatments, each spread 21  was incubated with 2U of RNase H (Roche) in blocking buffer with 10mM MgCl2 for 15 minutes prior to antibody treatment.  2.2.5 Mammalian tissue culture The HCT116 cell line (ATCC CCL-247) was cultured in McCoy?s 5a Medium Modified plus 10% fetal bovine serum in a 37oC incubator with 5% CO2. siRNAs were obtained from Dharmacon and applied according to the manufacturer instructions. For mitotic chromosome spreads, actively growing cells were treated with 0.1?g/mL colcemid for at least 90 minutes before washing, trypsinization and addition of hypotonic (0.075M KCl, 1% sodium citrate) for 5 minutes are room temperature. Cells were fixed in 3:1 methanol:glacial acetic acid, centrifuged (230 xg x 5 minutes) and fixed again before mounting on clean slides, DAPI staining and visualizing. 2.3 Results 2.3.1 Rad52 foci screening of essential CIN genes Rad52 is essential for homologous recombination and organizes into repair centers in response to double strand breaks and other recombination events (Lisby et al. 2001, Mortensen et al. 2009). Increases in Rad52 foci can therefore indicate a number of genome destabilizing conditions including increased double-strand breaks, inefficient recombination or hyper-recombination (Alvaro et al. 2007). To determine which CIN mutants cause increased or prolonged engagement of the homologous recombination machinery, we introduced an integrated RAD52-YFP fusion under control of its native promoter into the S288C yeast deletion set by synthetic genetic array (SGA) (Tong et al. 2004). The resultant strains expressing a mutant CIN gene and RAD52-YFP were screened visually for increased levels of Rad52 foci over WT. We screened 360 alleles of 305 essential CIN genes, including 306 ts- and 54 DAmP alleles (Stirling et al. 2011). Similar to previous studies we retested mutants with ?15% of cells with Rad52 foci in the primary screen (Alvaro et al. 2007). Triplicate retesting produced a list of 46 alleles in 44 unique genes whose mutation leads to an increased level of Rad52 foci (Figure 2.1).  The largest functional group of mutants with increased Rad52 foci related to DNA replication, especially initiation of replication, consistent with the S-phase function of Rad52 and its role in 22  repairing damage caused by collapsed replication forks (Lisby et al. 2001). Interestingly, mutations in multiple genes involved in the proteasome, Smc5/6 complex, early secretion, transcription and mRNA processing all caused increased rates of Rad52 foci (Figure 2.1). Overall our screen indicates that a large proportion of essential CIN genes (i.e. 14%, 44 of 306 alleles) exhibit significant levels of spontaneous Rad52 foci and that disruption of some unexpected cellular pathways create a requirement for homology-directed DNA repair. Of particular interest was the identification of seven mRNA cleavage and polyadenylation genes in the Rad52 foci screen (Figure 2.1). The mCP machinery is essential for processing nascent RNAs from primary transcript to stable polyadenylated species (Gross and Moore 2001). Interestingly, unlike the majority of mutants identified in the screen, most mCP mutants exhibited Rad52 foci at all cell cycle stages, including G1. In comparison to the largest group of foci genes (i.e. those involved in DNA replication), the role of mCP factors in genome integrity is not well characterized and we decided to characterize it further.  Figure 2.1. A screen for spontaneous DNA damage in essential CIN genes. Percentage of cells with Rad52 foci. Bars are color-coded to denote cell cycle arrest as large budded cell (black), foci formation only in budded cells (dark grey) or foci formation in at all stages (light grey). Multi-member biological groups are labeled above.   23  2.3.2 Fragile sites in mCP mutants differ in transcribed ORFs and near replication origins Phosphorylation of H2A-Ser129 is a mark of DNA damage analogous to human ?-H2AX modification in response to DNA damage and is critical for DSB repair (Downs et al. 2000). Recent analysis of sites of H2A-S129 phosphorylation in the yeast genome revealed a set of fragile loci deemed ?-sites using chromatin immunoprecipitation on microarray (ChIP-chip) (Szilard et al. 2010). It is known that h2a-S129A mutants accumulate Rad52 foci and that both Rad52 function and H2A phosphorylation contribute to efficient DNA repair (Downs et al. 2000, Mortensen et al. 2009, Szilard et al. 2010). We reasoned that mapping differences in fragile sites between WT and mCP mutants could suggest a mechanism for CIN and DNA damage in the mutants. To test this we performed ?-H2A ChIP-chip on the two mCP alleles with the highest levels of Rad52 foci, pcf11-2 and clp1-ts. We applied double-T7 amplified anti-phospho-Ser129-H2A chromatin immunoprecipitates from log-phase WT, mCP mutant or h2a-S129A control cells to a high-density tiling microarray containing 3.2 million probes with an average 5bp resolution and 20bp overlap between probes (Schulze et al. 2009). Normalizing our data to the h2a-S129A control produced a profile of yeast ?-sites (Figure 2.2).  Overall our WT ChIP-chip profiles confirmed the findings of Szilard et al. (2010), for example, identifying ?-sites enriched in subtelomeric regions, replication origins, long terminal repeats, repressed ORFs, MAT and near rDNA and centromeres (Figure 2.2A). Initial examination of the mutant data revealed similar ?-site peak profiles in replicates of clp1-ts, pcf11-2 and WT strains (Figure 2.2A). For example, Figure 2.2B shows similar mutant and WT ?-sites associated with a repressed gene, HXT10, and a replication origin in the indicated 50kb segment of chromosome VI. To highlight regions of increased mutant specific ?-H2A signal, which could be linked to mutant induced DNA damage, we normalized the mutant profiles to that of the WT (Figure 2.2C). Remarkably, we observed apparently reproducible and widespread differences in ?-sites adjacent to replication origins (e.g. ARS603.5 in Figure 2.2C).    24   Figure 2.2. High-resolution mapping of yeast ?-sites. (A) Chromosome VI ?-sites with indicated chromosomal features (purple box = ARS, grey box = ORF, sub-telomeric ?-sites = black bars). (B) WT replicates (black and red) and representative pcf11-2 (blue) and clp1-ts (green) ?-site profiles for part of ChrVI, normalized to h2a-S129A (no H2A phosphorylation). Enriched ?-sites at HXT10, which is repressed in glucose, and ARS605 are indicated. (C) Replicates of pcf11-2 (black, green) and clp1-ts (blue, red) ?-site profiles normalized to WT to identify regions of enhanced signal. The same region of ChrVI from (B) is shown after normalization to the WT ?-site profile. Common differences are marked with a black bar. 25  To quantify the observed connection between mCP mutant ?-site enhancement and ARS-linked sites we scanned a 2kb window on either side of all ARSs for enriched regions ?500bp in length. This analysis found significantly more sites than would be expected at random for both clp1-ts and pcf11-2 mutants (i.e. p=0.99997 for each dataset; Figure 2.3A compares the observed values to the predicted number of peaks if ARS start coordinates were randomized). 64 ARSs met these criteria for 3 of 4 mutant replicates (Figure 2.3A).  Very few ARSs were themselves enriched in the mCP-specific ?-sites; instead the peaks appeared in ORFs in close proximity to the ARS. The peaks of 60 of the 64 ARS-linked sites could be assigned to single genes. 65% of these genes were oriented towards the ARS and had a higher average transcriptional frequency than co-directional genes (Figure 2.3A). These observations are consistent with a mechanism contingent on R-loop formation since they implicate DNA replication, and perhaps collision with the transcription machinery, as a source of DNA damage in mCP mutants. In addition to the ARS-linked mutant specific ?-sites there was mutant-specific ?-H2A enrichment at a set of 918 ORFs throughout the genome. When we examined the transcriptional frequency of these 918 ORFs we found significantly fewer of the lowest transcription category (i.e. <1 mRNA/hr) compared to all ORFs (Figure 2.3B; Holstege et al. 1998). This represents a dramatic shift from the WT ?-sites which strongly enriched repressed or weakly transcribed genes and underrepresented higher transcriptional categories (Figure 2.3B; Szilard et al. 2010). If DNA damage in pcf11-2 and clp1-ts mutants is occurring at transcribed ORFs it is plausible that reducing transcription could mitigate the observed increase in Rad52 foci. To test this hypothesis we treated cells with 6-azauracil (6AU), an inhibitor of transcription elongation, and scored the presence of Rad52 foci. WT cells showed an increase in Rad52 foci when treated with 6AU, indicating that stalling transcription elongation can itself cause repair centers to form (Figure 2.3C). Remarkably, both clp1-ts and pcf11-2 strains showed a significant decrease in Rad52 foci when treated with 6AU (Figure 2.3C). This effect was not seen in the strong hits srm1-ts or cdc24-11 which both retained high levels of spontaneous Rad52 foci in 6AU (Figure 2.3C). We conclude from this experiment that at least some of the DNA damage in mCP mutants is occurring within transcribed regions. Mapping the relative position of ?-site differences within the 918 ORFs, there is a slight bias toward the 3? end of the gene for both pcf11-2 and clp1-ts mutants compared to WT (Figure 26  2.4A). Moreover, examining the 55 genes whose 3? untranslated regions (UTRs) contain a ?-site in both pcf11-2 and clp1-ts profiles (i.e. three of four replicates covered by >50% of a 500-bp window downstream) reveals that the associated genes tend to have higher transcriptional frequencies (Figure 2.4B). Together, these data suggest that at least some transcription occurs at ORFs specifically enriched for ?-H2A in mCP mutants and that damage may be biased to the site of mCP function at 3? ends. One reason that the bias is not more pronounced is that various 3? end processing factors, including the mCP, also affect transcription elongation and could cause damage within genes as well as downstream (Tous et al. 2011).    27  Figure 2.3. clp1-ts and pcf11-2 mutant ?-sites link DNA damage to transcription. (A) Linkage of mutant specific peaks to replication origins. Peaks within 2kb of replication origins were identified in the (mutant-WT) difference profiles and compared (left panel) to predicted values generated by Monte Carlo simulation of randomized ARS positions. * indicates p<0.0001 derived from calculating the cumulative probability (P) on a normal distribution of seeing a score lower than the observed value by chance. The right panel shows the relative orientation, with respect to ARS, of ORFs encompassed by ARS-linked ?-site differences across 3 of 4 mutant replicates. The pointed end indicates the direction of transcription. The transcriptional frequency of colliding ORFs was significantly higher than co-directional ORFs (Mann-Whitney test, *p = 0.027). (B) Transcriptional frequency of ORFs with enhanced ?-H2A signal in WT cells and mCP mutant normalized to WT samples. The distribution of transcription frequencies (Holstege et al. 1998) is shown for all ORFs (grey bars), ORFs covered at least 25% by a WT ?-site (black bars) and ORFs covered at least 10% by a ?-site difference in clp1-ts and pcf11-2 ChIP-chip profiles. (C) Effect of the transcription inhibitor 6AU on Rad52 foci formation in WT and mutant strains. Asterisks indicate for (B) significant deviations from all ORFs within a transcription frequency category and (C) significant differences in Rad52 foci levels (* p<0.05, **p<0.005). 28    29  Figure 2.4. 3?-end bias of ORFs with increased ?-sites in clp1-ts and pcf11-2 mutants. (A) The average plot of ORFs with ?-sites in replicates of WT (upper panel) and ORFs with enhanced ?-sites common to replicates of pcf11-2 and clp1-ts (blue and green respectively, lower panel). MAT score is the relative occupancy by ?-sites and appears lower in the lower panel since it has been normalized to WT (the upper panel was normalized to h2A-S129A). (B) Transcriptional frequency of ORFs associated with mCP mutant-induced ?-H2A signal in their 3?-UTRs. A significant (p<0.01) decrease in repressed genes (<1 mRNA/hr) and concomitant increase in genes with high transcriptional frequencies (16-50 mRNA/hr) is observed in those genes with mCP mutant-induced ?-H2A enrichment in their 3? UTRs.   2.3.3 CIN in mRNA cleavage and polyadenylation mutants occurs via R-loops  Our data show that mutants in the mCP pathway accumulate Rad52 foci and our ChIP-chip data suggest a connection between DNA replication and the role of mCP in transcription. It is known that transcription can act as a replication fork barrier (Deshpande and Newlon 1996, Takeuchi et al. 2003), and that mutations in mCP components can cause transcription termination defects (Birse et al. 1998, Prado and Aguilera 2005). To investigate the connection of these phenotypes to CIN, we first confirmed the reported phenotypes for the five strongest hits by three standard CIN assays, Chromosome Transmission Fidelity (Ctf), BiMater (BiM) and a-like faker (ALF) that test for chromosome rearrangement and loss (Stirling et al. 2011). Mutants in CFT2, CLP1, FIP1, PCF11 and RNA15 had a robust Ctf phenotype and a weak ALF phenotype; RNA15, CLP1 and PCF11 mutants also had a detectable BiM phenotype (Table A2 appendix). Each mCP mutant was also hypersensitive to the genotoxic agents hydroxyurea (HU), cisplatin and bleomycin (Figure 2.5A). These drugs may synergize with the spontaneous DNA damage that occurs in mCP mutants; for example, failed transcription termination in mCP mutants could act as a block to replication forks thereby sensitizing cells to replication inhibitors like HU or cisplatin (Birse et al. 1998, Prado and Aguilera 2005). Indeed, HU and certain mCP mutants both increase recombination rates; thus the effects may be additive (Luna et al. 2005). Our data and the literature support the notion that transcriptional defects underlie genome instability in mCP mutants. One common way by which this occurs is through formation of DNA:RNA hybrids called R-loops. R-loops can expose ssDNA, a substrate for DNA repair proteins, and can also block DNA replication fork progression (Prado and Aguilera 2005, Sikdar 30  et al. 2008, Tuduri et al. 2009). Indeed the identification of pcf11-2 and clp1-ts ?-site differences in ARS-proximal genes, combined with the suppression of Rad52 foci by 6AU make this an especially attractive model. To test this hypothesis we overexpressed a recombinant human RNase H1 enzyme which specifically degrades DNA:RNA hybrids. Analysis of Ctf in pcf11, clp1, fip1, and rna15 mutant strains showed a remarkable suppression by RNase H, which should reduce R-loops, supporting a direct role for R-loops in genome instability (Figure 2.5B). Suppression of Ctf by RNase H was not seen in Ctf control strains representing other biological pathways, for example, rpf1-1 (ribosome biogenesis) or scc2-4 (cohesion) (e.g. Figure 2.5B and C). Thus, RNase H suppression of Ctf is highly specific to mCP mutants. S. cerevisiae encodes at least two endogenous RNase H activities namely, RNH1 and RNH201. Deletion of both RNase H genes, which should increase the frequency of R-loops, in CFT2, CLP1 or RNA15 ts-mutants caused quantifiable growth defects at the semi-permissive temperature of 32?C (Figure 2.5D). These data indicate that mCP mutants require RNase H activity under certain conditions to promote viability, consistent with a detrimental accumulation of DNA:RNA hybrids. To confirm that the mCP mutants accumulate R-loops, we grew cells at the non-permissive temperature of 37?C and then harvested them for chromosome spreads. We performed immunofluorescent detection of DNA:RNA hybrids using the S9.6 monoclonal antibody in chromosome spreads of mCP mutants, rnh1?rnh201? double mutants (positive control), a panel of Rad52 foci forming strains from other biological pathways and WT as a general negative control (Figure 2.5E). For each allele of the mCP machinery tested we observed an increased number of chromosome spreads with detectable DNA:RNA hybrid staining. The rnh1?rnh201? double mutant also showed high levels of DNA:RNA hybrids. These data indicate that in WT cells the action of endogenous RNase H actively suppresses R-loop formation (Figure 2.5E). Indeed the rnh1?rnh201? strain exhibits a strong chromosome instability phenotype (Table A2 appendix). Among the panel of Rad52 foci-forming control strains, only srm1-ts showed an increase in DNA:RNA hybrid staining (Figure 2.5E). SRM1 plays a role in nucleocytoplasmic transport of mRNAs which could account for accumulation of DNA:RNA hybrids in srm1-ts mutant cells. As an antibody specificity control we pre-treated selected chromosome spreads with recombinant RNase H in vitro and found significant reductions in R-loop signal detected after processing (Figure 2.5F). Together these data suggest that mCP mutants specifically accumulate DNA:RNA hybrids which contribute to genome instability. 31   32   Figure 2.5. Transcription coupled R-loops are the likely cause of CIN in mCP mutants. (A) 10-fold serial dilution spot assays of mCP mutant strains on indicated media. ctf4? is included as a genotoxin sensitive control strain. An additional YPD control is included for cisplatin sensitivity because these plates have a different pH. (B) Plate images of Ctf phenotypes for selected mCP mutants and a control Ctf mutant expressing an empty vector or human RNase H1. Significantly fewer colonies with red sectors (p<0.05) are seen when RNase H1 is expressed in mCP but not control Ctf mutants. (C) Quantification of CTF suppression by RNaseH. The proportion of colonies with a visible sector was scored for at least three replicates and compared between empty vector (-, grey bars) and RNaseH (+, white bars) expressing strains. * indicates a significant difference (p<0.05). (D)  Growth curves of mCP mutants with and without the yeast 33  RNase H genes RNH1 and RNH201. (E) Immunofluorescence of DNA:RNA hybrids in chromosome spreads. The left panel shows representative spreads from WT and pcf11-ts10 cells (blue, DNA; red, DNA:RNA hybrid). The right panel shows quantification of the immunofluorescence data for the indicated mutants. Samples significantly different than WT (p<0.05) are indicated with an asterisk. (F) RNaseH suppression of DNA:RNA hybrid signal in mCP ts-mutant chromosome spreads. Pretreatment of chromosome spreads with recombinant RNaseH significantly reduced staining. *p<0.05 students t-test. 2.3.4 Truncation-fusion of yeast FIP1 causes genome instability Our data suggest that the mCP machinery prevents genome instability by suppressing the formation of DNA:RNA hybrids. The human ortholog of the CIN mCP gene FIP1, FIP1L1, comprises the N-terminal moiety of a fusion protein with PDGFR? which plays a causative role in 10-20% of hyper-eosinophilic syndrome / eosinophilic leukemia (Cools et al. 2003, Gotlib and Cools 2008). These oncogenic fusion proteins truncate the C-terminus of FIP1L1 and liberate the tyrosine kinase domain of PDGFR? which becomes dysregulated. While the PDGFR? moiety is responsible for the proliferative phenotype, the impact of the truncation on FIP1L1 function is not clear (Stover et al. 2006). However, the fusion is under control of the FIP1L1 promoter and in vitro colony forming assays indicate that FIP1L1 does have an effect on the fitness of transformed cells (Buitenhuis et al. 2007, Gotlib and Cools 2008). Thus, the role of FIP1L1 may be important to the etiology of this leukemia. To model the putative effects of FIP1 truncation-fusions, we fused a commonly used globular domain (GFP) to two orthologous breakpoints in the yeast FIP1 gene. The fusions Fip11-213-GFP and Fip11-279-GFP correspond to fusions with human exons 7 and 9, respectively, in the most closely related human FIP1L1 isoform, isoform 4 (Figure 2.6A, left panel). Tetrad dissection of heterozygous diploids revealed that each truncation-fusion affected fitness; Fip11-213-GFP did not support viability whereas Fip11-279-GFP produced small colonies (Figure 2.6A, right panel).  As a control, GFP was also fused to the C-terminus of the full-length FIP1 gene which did not appear to affect fitness. Since the Fip11-279-GFP construct was viable, we focused our subsequent characterization on this allele. Similar to the fip1-ts allele we found that Fip11-279-GFP caused a Ctf phenotype not seen 34  in the FIP1-GFP control (Figure 2.5B and 2.6B). In addition, the truncation-fusion protein increased formation of spontaneous Rad52-foci, although in this case the full-length FIP1-GFP also significantly increased focus formation above WT levels albeit not as much as Fip11-279-GFP (Figure 2.6C). This indicates that perturbations of FIP1 function, even those that do not grossly affect fitness, can increase spontaneous DNA damage and supports the idea that human FIP1L1, in the context of a PDGFR? fusion, may be only partly functional. Our data also predict that more severe truncations would further inactivate FIP1L1.    Figure 2.6. Truncation-fusion of FIP1 causes genome instability and DNA damage. (A) Tetrad dissection of truncation-fusions of FIP1 at two orthologous sites to breakpoints seen in human FIP1L1-PDGFR? driven eosinophilic leukemia. The sites of truncation-fusion are indicated in the schematic (left). Presumptive His+ colonies are circled (right). (B) Ctf assay of full-length FIP1-GFP and FIP11-279-GFP. (C) Rad52-YFP foci measurements and (D) DNA:RNA hybrid measurements from FIP1 mutant strains. 35  2.3.5 Human FIP1L1 may be required for genome stability Our examination of CIN phenotypes in yeast is ultimately directed at predicting human genome integrity pathways (Barber et al. 2008, Stirling et al. 2011, Yuen et al. 2007). Therefore, an important confirmation of our data is a cross-species validation of the CIN phenotype. Partial reduction of yeast FIP1 activity, by ts-allele or truncation-fusion, leads to spontaneous Rad52 foci and CIN in yeast cells (Figure 2.1, Figure 2.6 and Table A2 appendix). Thus, we predicted that reduction of human FIP1L1 function would also lead to genome instability in human cells. We transiently reduced the protein levels of FIP1L1 in the near-diploid colorectal cell line HCT116 by transfection with pooled or, as a specificity control, individual siRNAs (Figure 2.7A). We directly assessed chromosome integrity in cells with reduced FIP1L1 by analysis of mitotic metaphase chromosome spreads. When cells were treated with FIP1L1 siRNA, we reproducibly observed a significant increase in the appearance of chromosome breaks and chromosome fragments as compared to cells treated with GAPDH siRNA as a control (p<0.05; Figure 2.7B). The aberrant chromosomal structures resemble the damage seen in chromosome spreads from bleomycin treated cells (Figure 2.7B). In support of this, we found that FIP1L1 siRNA treatment increases the number of 53BP1-mCherry foci (Figure 2.7C and D). 53BP1 foci mark sites of DNA damage and H2AX phosphorylation and have recently been shown to increase in human cells depleted for THO (Dominguez-Sanchez et al. 2011). These data support the hypothesis that, at least for FIP1L1, the essential role of yeast mCP genes in suppressing genome instability may be conserved to human cells.    36    Figure 2.7. Loss of human FIP1L1 function causes CIN. (A) Chromatid breaks in mitotic chromosome spreads from siRNA or bleomycin treated cells. The average of replicate experiments is shown (error bars, SEM; [*] P < 0.05). Western blot of FIP1L1 in siRNA-treated HCT116 cells by single (FIP1L1) or pooled (FIP1L1 and GAPDH control) siRNAs. ?-Tubulin was blotted as a loading control. (B) Representative chromosome spread indicating DNA breaks and fragments (white arrowheads in inset) associated with FIP1L1 siRNA. (C) 53BP1-mCherry foci per nucleus in bleomycin and GAPDH or FIP1L1 siRNA-treated cells ([*] mean foci/nucleus is significantly different, P < 0.001). Values from a representative of three data sets are shown. (D) Representative images of 53BP1-mCherry used to generate data in C. 37  2.4 Discussion 2.4.1 Profiling fragile site changes in Rad52 foci forming mRNA processing mutants By comparing fragile sites in WT and mCP mutant yeast we formulated a putative mechanism involving transcription coupled R-loops which we confirmed by direct tests (Figure 2.2-2.4). The robustness of the WT ?-site profiles to perturbations by different mutants was somewhat surprising but similar to findings in strains lacking RRM3, a helicase which facilitates replisome processivity (Szilard et al. 2010). Despite the similarities in WT and mutant ?-sites, we were able to extract meaningful differences within transcribed ORFs adjacent to ARSs and with a slight bias toward the 3? end of the ORF (Figure 2.2-2.4). These observations are consistent with the function of mCP in transcription termination and 3? end processing of pre-mRNAs and suggest that DNA damage may occur near the site of mCP function. Given the role of mCP in transcription we were surprised that we did not recover the most highly transcribed genes, indeed this category was underrepresented (Figure 2.3B). It is possible that highly transcribed genes may have mechanisms in place to protect the genome from the deleterious effects of high transcription. This idea has been supported by work in mammalian cells showing that highly expressed genes orient co-directionally with replication origins (Huvet et al. 2007, Tuduri et al. 2009). Based on the success of our approach, we predict that mapping changes in fragile sites (e.g. with ChIP-chip of ?-H2A or another DNA repair protein) in other CIN mutant backgrounds could be an informative method to suggest basic mechanisms. 2.4.2 Conservation of a CIN phenotype to the human cancer gene FIP1L1 Our data also suggest that the disruption of human FIP1L1 in eosinophilic leukemia may cause a loss of FIP1L1 function based on homology to yeast (Figure 2.6). Interestingly our truncation-fusion analysis differs from previous truncation only studies of yeast FIP1 where more severe truncations supported viability (Helmling et al. 2001). This could be due to strain background differences but more likely suggests that the fusion protein is more detrimental to function than a simple truncation. In addition, our finding that reduced FIP1L1 levels cause genome instability in a model human cell line has several implications (Figure 2.7). First, it supports literature suggesting that diverse mRNA processing pathways may impinge upon genome integrity across species (El Hage et al. 2010, Gomez-Gonzalez et al. 2009, Li and Manley 2005, Mischo et al. 38  2011, Tuduri et al. 2009). These data also raise the possibility that genome stability in cancers with FIP1L1 truncation-fusion proteins may be impacted by the partial loss of FIP1L1 function. FIP1L1 is dispensable for activation of the PDGFR? kinase activity and therefore it has been proposed that some aspect of its promoter or the presence of an adjacent fragile site is responsible for the frequent observation of FIP1L1-PDGFR? gene fusions (Stover et al. 2006). Recent confirmation of FIP1L1-RARA gene fusions in acute promyelocytic leukemia shows that oncogenic translocation with FIP1L1 is not limited or specific to PDGFR? (Menezes et al. 2011). In addition, FIP1L1-PDGFR? fusions have been found in patients presenting with acute myeloid leukemia, which may have progressed from eosinophilic leukemia, and T-cell non-Hodgkins lymphoma both of which are sometimes associated with aneuploidy (Metzgeroth et al. 2007). Translocation may impact the function of another mCP component, human CLP1, which has been associated with an oncogenic translocation with MLL (Cools et al. 2003, Tanabe et al. 1996). We speculate that one outcome of interrupting FIP1L1 or hCLP1 could be to destabilize the genome of these leukemias and when left untreated, in combination with the acquired proliferative phenotype, facilitate further evolution of the cancer genome. It is worth noting that heterozygous mutation of several other CIN genes has been shown to increase tumor incidence in mouse models (e.g. Bub1, Aurora kinase, CENP-E; Reviewed in (Schvartzman et al. 2010). 2.4.3 DNA:RNA hybrids are a common mechanism of genome instability Our Rad52 screening and ChIP-chip studies suggested a mechanism for genome instability in mCP mutants that involves the formation of transcription coupled R-loops (Figure 2.1-2.3). We support this model directly by rescuing Ctf with RNase H, immunofluorescent detection of DNA:RNA hybrids, and genetic interactions of mCP mutants with yeast RNase H subunits (Figure 2.4). The fact that mCP mutants increase Rad52 foci in G1 cells suggests that DNA replication is not strictly required to elicit foci (Figure 2.1). This is particularly interesting when contrasted to the ChIP-chip data that links damaged sites in mCP mutants to replication origins (Figure 2.3). It may be that mCP mutants cause lesions requiring Rad52 in more than one way and it will be interesting in future studies to determine the relative contributions of transcription and replication to genome stability in these mutants.  R-loops seem to underlie genome instability in a growing number of mutants in the transcription and RNA processing pathways, including SPT2, TOP1, SEN1, THO complex and ASF/SF2 (El 39  Hage et al. 2010, Gomez-Gonzalez et al. 2009, Li and Manley 2005, Mischo et al. 2011, Sikdar et al. 2008, Tuduri et al. 2009). In the literature and this study, R-loops have been linked to various types of genome instability including hyper-recombination, replication defects, DNA damage and chromosome loss. Our recent genome-wide compilation of yeast CIN genes identified dozens of transcription and RNA processing related CIN mutants whose R-loop status is unknown (Stirling et al. 2011). We predict that other CIN mutants in these pathways will also be shown to work via inappropriate R-loop formation. Interestingly, a high-throughput study of spontaneous DNA damage in mammalian cells identified many genes involved in splicing and RNA processing, suggesting that this pathway is generally important for genome integrity across species (Paulsen et al. 2009). Moreover, these authors found that overexpression of RNase H could suppress DNA damage in many instances, supporting the R-loop model for diverse RNA processing pathways (Paulsen et al. 2009). The prevalence of R-loop-mediated CIN in cancer is unclear although it is tempting to speculate that it could occur in cancers where the orthologs of R-loop forming mutant yeast genes are disrupted (e.g. TOP1 or FIP1; (Cools et al. 2003, Iwase et al. 2003)). 40  3 Genome-wide profiling of DNA:RNA hybrid prone sites in yeast 3.1 Introduction Elevated DNA:RNA hybrid formation due to defects in RNA processing pathways leads to genome instability and replication stress across species (Chernikova et al. 2012, El Hage et al. 2010, Gan et al. 2011, Gomez-Gonzalez et al. 2011, Mischo et al. 2011, Stirling et al. 2012, Wahba et al. 2011). R-loops that threaten genome stability often form under abnormal conditions where nascent mRNA is improperly processed or RNA half-life is increased, and RNA can hybridize with template DNA, displacing the non-transcribed DNA strand (Aguilera and Garcia-Muse 2012). A recent study has also found that hybrid formation can occur in trans via Rad51-mediated DNA-RNA strand exchange (Wahba et al. 2013). Persistent R-loops pose a major threat to genome stability through two mechanisms. First, the exposed non-transcribed strand is susceptible to endogenous DNA damage, a mechanism exploited in mammalian cells to promote somatic hypermutation at immunoglobulin genes (Chaudhuri et al. 2003). The second, more widespread mechanism, identified in E. coli, S. cerevisiae, C. elegans and human cells, involves R-loops and stalled transcription complexes blocking DNA replication fork progression (Aguilera and Garcia-Muse 2012, Castellano-Pozo et al. 2012, Dominguez-Sanchez et al. 2011, Gan et al. 2011, Gomez-Gonzalez et al. 2011). R-loop-mediated instability is an area of intense interest primarily because genome instability is considered an enabling characteristic of tumor formation (Hanahan and Weinberg 2011). Moreover, mutations in RNA splicing/processing factors are frequently found in human cancer and neurodegenerative diseases (Garraway and Lander 2013, Papaemmanuil et al. 2011, Suraweera et al. 2009, Wang et al. 2011b). To avoid the deleterious effects of R-loops, cells express enzymes for the removal of abnormally formed DNA:RNA hybrids. The best characterized mechanism for reducing R loop formation is through the action of RNase H, which enzymatically degrades the RNA in DNA:RNA hybrids (Aguilera and Garcia-Muse 2012). In S. cerevisiae, there are two endogenous RNase H enzymes encoded by RNH1 and RNH201. Another extensively studied anti-hybrid factor is the THO/TREX complex which functions to suppress hybrid formation at the level of transcription termination and mRNA packaging (Chavez et al. 2001, Dominguez-Sanchez et al. 2011, Gomez-Gonzalez et al. 2011, Jimeno et al. 2002). Additionally, the Senataxin helicase, yeast Sen1, plays 41  an important role in unwinding RNA in hybrids to mitigate R loop formation and RNA polymerase II transcription-associated genome instability (Mischo et al. 2011). Several other anti-hybrid mechanisms have also been identified including topoisomerases and other RNA processing factors (El Hage et al. 2010, Leela et al. 2013, Luna et al. 2005, Sikdar et al. 2008, Stirling et al. 2012, Wahba et al. 2011, Wahba et al. 2013). To add to the complexity of DNA:RNA hybrid management in the cell, hybrids also occur naturally and have important biological functions (Wahba and Koshland 2013). In human cells, R loop formation facilitates immunoglobulin class switching, protects against DNA methylation at CpG island promoters and plays a key role in pause site-dependent transcription termination (Chaudhuri et al. 2003, Ginno et al. 2012, Ginno et al. 2013, Skourti-Stathaki et al. 2011). Additionally, noncoding (nc)RNA such as antisense transcripts, which are transcribed on the opposite strand from sense transcripts, perform a regulatory role in the expression of sense transcripts (Faghihi and Wahlestedt 2009). The proposed mechanisms of antisense transcription regulation are not clearly understood and involve different modes of action specific to each locus. Current models include antisense-associated chromatin modifications, antisense transcription modulation of transcription regulators, collision of sense and antisense transcription machineries and antisense transcripts expressed in trans interacting with the promoter for sense transcription (Camblong et al. 2009, Castelnuovo et al. 2013, Faghihi and Wahlestedt 2009, Hobson et al. 2012, Pandey et al. 2008, Margaritis et al. 2012, Marinello et al. 2013, van Dijk et al. 2011). More recently, studies in Arabidopsis found an antisense transcript that forms R-loops, which can be differentially stabilized to modulate gene regulation (Sun et al. 2013). Another study in mouse cells found that R loop stabilization can inhibit Ube3a-ATS antisense transcription (Powell et al. 2013). Here we describe a genome-wide profile of DNA:RNA hybrid prone loci in S. cerevisiae by DNA:RNA immunoprecipitation and tiling microarray (DRIP-chip). DNA:RNA hybrids occurred at highly transcribed regions in wild type (WT) cells, including some identified in previous studies. A small-scale cytological screen found that diverse RNA processing mutants had increased hybrid formation and additional DRIP-chip studies revealed specific hybrid-site biases in RNase H and Sen1 mutants. Remarkably, we observed that DNA:RNA hybrids were significantly associated with open reading frames (ORFs) that have corresponding antisense 42  transcripts, suggesting a role for hybrid formation at these loci in gene regulation. Consistently, we found that ORFs whose expression was altered by overexpression of RNase H were also significantly associated with antisense transcripts. These genome-wide analyses enhance our understanding of DNA:RNA hybrid-forming regions in vivo, highlight the role of cellular RNA processing activities in suppressing hybrid formation and implicate DNA:RNA hybrids in a subset of antisense regulated loci. 3.2 Methods 3.2.1 Strains and plasmids All strains are listed in Table A3 (appendix). For RNase H overexpression experiments, recombinant human RNase H1 was expressed from plasmid p425-GPD-RNase H1 (2?, LEU2, GPDpr-RNase H1) and results were compared to an empty control plasmid p425-GPD (2?, LEU2, GPDpr) (Wahba et al. 2011). 3.2.2 DRIP-chip and qPCR DRIP-chip data is available at ArrayExpress E-MTAB-2388. DRIP-chip was performed using the ChIP and tiling microarray protocol described previously (Schulze et al. 2009). Briefly, cells were grown overnight, diluted to 0.15 OD600 and grown to 0.7 OD600. Crosslinking was done with 1% formaldehyde for 20 minutes. Chromatin was purified and sonicated to yield approximately 500 bp fragments. 40 ?g of the anti-DNA:RNA hybrid monoclonal mouse antibody S9.6 (gift from Stephen Leppla) was coupled to 60 ?L of protein A magnetic beads (Invitrogen). DNA was amplified via two rounds of T7 RNA polymerase amplification, labeled and hybridized to Affymetrix 1.0R S. cerevisiae microarrays, which cover the entire yeast genome with a probe resolution of, on average, 5 bp. Samples were normalized to an input using the rMAT software and relative occupancy scores were calculated for all probes using a 300 bp sliding window. All profiles were generated in duplicate and replicates were quantile normalized and averaged. Spearman correlation scores between replicates are listed in Table A13 (appendix). Features were determined to be enriched if at least 50% of the feature encompassed probes above a threshold of 2.5. This criteria is more stringent than a p<0.05 cutoff. Only features found enriched in both replicates were considered. For statistical analysis, GC content and transcriptional frequency distributions, derived from the literature (Holstege et al. 1998), 43  were compared using the Wilcoxon rank sum test. Antisense association was analyzed by the hypergeometric test using R. Statistical analysis of genomic feature enrichment was performed using the Monte Carlo simulation, which randomly generates start positions for the particular set of features and calculates the proportion of that feature that would be enriched in a given DRIP-chip profile if the feature were re-distributed at random (Schulze et al. 2009). 500 simulations were run per feature for each DRIP-chip replicate to obtain mean and standard deviation values. These values were used to calculate the cumulative probability (P) on a normal distribution of seeing a score lower than the observed value by chance (http://www.stattrek.com). qPCR was performed in triplicate on three independent DRIP samples for WT and rnh1?rnh201? following the ChIP-qPCR protocol described previously (Wang et al. 2011a). Primers are listed in Table A14 (appendix). 3.2.3 Gene expression microarray Strains harboring the RNase H1 over-expression plasmid or empty vector were grown in SC-Leucine at 30?C. All profiles were generated in duplicate. Total RNA was isolated from 1 OD600 using a RiboPure Yeast kit (A&B Applied Biosystems), amplified, labeled and fragmented using a Message-Amp III RNA Amplification Kit (A&B Applied Biosystems) and hybridized to a GeneChIP Yeast Genome 2.0 microarray using the GeneChip Hybridization, Wash, and Stain Kit (Affymetrix). Arrays were scanned by the Gene Chip Scanner 3000 7G and expression data was extracted using Expression Consol Software (Affymetrix) with the MAS5.0 statistical algorithm. All arrays were scaled to a median target intensity of 500. A minimum cut off of p-value of 0.05 and signal strength of 100 across all samples were implemented and only transcripts that had over a 2-fold change in the RNase H over-expression strain compared to WT were considered significant. The correlation between duplicate biological samples was: control (r=0.9955), RNase H over-expression (r=0.9719). For statistical analysis, GC content, transcription frequencies and antisense association were analyzed as for DRIP-chip analysis. The microarray data is accessible at GSE46652 on GEO. 44  3.2.4 Yeast chromosome spreads Chromosome spreads were performed as described in Stirling et al. 2012 (see thesis section 2.2.4 for details). Mutants were compared to WT by the Fisher?s exact test. To correct for multiple hypothesis testing, we implemented a cut off of p<0.01 divided by the total number of mutants; Mutants with p<0.00024 were considered significantly different from WT. 3.2.5 BPS sensitivity assay 10-fold serial dilutions of each strain was spotted on 90 ?M BPS plates with FeSO4 concentrations of 0, 2.5, 20 or 100 ?M and grown at 30oC for 3 days (Berthelet et al. 2010). 3.3 Results 3.3.1 The genomic distribution of DNA:RNA hybrids DNA:RNA hybrids have been previously immunoprecipitated at specific genomic sites such as rDNA, selected endogenous loci and reporter constructs (El Hage et al. 2010, Mischo et al. 2011). Subsequently, DRIP-seq of human cells has demonstrated the prevalence of R-loops at CpG island promoters with high GC skew (Ginno et al. 2013). To further investigate the global profile of DNA:RNA hybrid prone loci, we performed genome-wide DRIP-chip analysis of WT S. cerevisiae (ArrayExpress E-MTAB-2388) using the S9.6 monoclonal antibody which specifically binds DNA:RNA hybrids (Boguslawski et al. 1986, Hu et al. 2006). Samples were normalized to a WT genomic DNA input (i.e. sample prior to immunoprecipitation) to generate the averaged WT profile exemplified in Figure 3.1A. To assess the DRIP-chip specificity, we also separately normalized samples to a WT mock DRIP-chip (i.e. sample incubated with beads without antibody) and found that the results were similar to those from the normalization to input. However, in comparing the same samples normalized to mock or the input, we found that normalization to input was much more stringent, resulting in smaller subsets of genes enriched for hybrids. Therefore, we presented the analysis of samples normalized to input rather than the mock. The mock sample normalized to input showed no significant enrichment of DNA:RNA hybrids at sites identified in the WT profiles (Figure A1 appendix). These suggest that the S9.6 antibody was able to immunoprecipitate a specific set of genomic loci with a relatively low level of background noise. DRIP-chip profiles of WT cells normalized to the input revealed on 45  average 2989 peaks covering a total of 1.2 Mb (9.9% of the genome) with an average peak width of 413 bp when a very stringent threshold of 2.5 was used (Table A4 appendix). This was found to be more stringent than using a cutoff of p<0.05, which called 576 ORFs as enriched for DNA:RNA hybrids in WT. In comparison, analyzing only genetic features occupied by peaks above the 2.5 threshold in both replicates results in 237 ORFs enriched for DNA:RNA hybrids in WT, 233 of which meet the p<0.05 cutoff. Although the Spearman correlation score between the two WT replicates is not high (0.56), we analyzed only genetic features identified in both replicates and confirmed that trends observed on average were also observed in each individual replicate.  Our DRIP-chip profiles identified several DNA:RNA hybrid prone sites including the rDNA locus and telomeric repeat regions (Figure 3.1A, Tables A5-6 appendix) consistent with previous studies (Balk et al. 2013, El Hage et al. 2010, Luke et al. 2008, Pfeiffer et al. 2013). In addition, DNA:RNA hybrids were also found to be significantly associated with retrotransposons (Figure 3.1A, Table A7 appendix). We identified DNA:RNA hybrids along the length of a subset of ORFs (Figure 3.1B). These ORFs had significantly higher GC content and transcriptional frequencies compared to all ORFs (Figures 3.1C and D, p<1e-5). Importantly, despite the correlation between DNA:RNA hybrid association and transcriptional frequency, WT DRIP-chip profiles revealed very low correlation when compared to the localization profile of RNA polymerase II subunit, Rpb3 (0.18; Aristizabal et al. 2013). This suggests that the DRIP-chip method was not unduly biased towards DNA:RNA hybrids within transcription bubbles. This work extends our knowledge of DNA:RNA hybrids from a few locus-specific observations from the literature to show that, in WT, there are hundreds of hybrid prone genes that tend to be high in GC content and frequently transcribed (El Hage et al. 2010, Gomez-Gonzalez et al. 2011, Li and Manley 2005). Interestingly, ORFs with high GC content also have high transcriptional frequencies (Figure A2 appendix). Therefore, it is not clear from our findings whether GC content or transcriptional frequency contributed more to DNA:RNA hybrid forming potential. However, these data support the notion of genome-wide co-transcriptional hybrid formation as the major source of endogenous DNA:RNA hybrids.   46    47  Figure 3.1. The genomic profile of DNA:RNA hybrids in WT yeast. (A) DRIP-chip plot of DNA:RNA hybrids in the rDNA region and telomeric ends of chromosome XII. The black line represents the average of two WT replicates. Bars indicate ORFs (grey), rDNA (purple), retrotransposons (green) or ORFs associated with an antisense transcript (red; (Xu et al. 2011)). Grey boxes delineate telomeric repeat regions. Y-axis indicates relative occupancy of DNA:RNA hybrids. X-axis indicates chromosomal coordinates. DNA:RNA hybrid enrichment in telomeric repeat regions, rDNA and retrotransposons were compared with predicted values generated by Monte Carlo simulation of randomized genomic feature positions. P indicates probability of observing a number of enriched features below what was observed (P>0.99997). (B) The averaged DRIP-chip plot of both WT replicates over ORFs enriched for DNA:RNA hybrids. The Y-axis indicates relative occupancy of DNA:RNA hybrids. (C) Distribution of % GC content for all ORFs (n=6602) versus DNA:RNA hybrid-enriched ORFs in WT (n=237). (D) Distribution of transcription frequencies of all ORFs (n=5065; Holstege et al. 1998) versus DNA:RNA hybrid-enriched ORFs in WT with known transcription frequencies (n=166). In C and D, intervals indicate range of the 95% of ORFs closest to the average in each sample. Averages are stated above each bar. Asterisks indicate p<1e-5 for difference between sample and database (Wilcoxon rank sum test). 3.3.2 Cytological profiling of RNA processing mutants for R loop formation Transcription-coupled DNA:RNA hybrids have been shown to accumulate in a diverse set of transcription and RNA processing mutants involved in relieving topological stress, transcriptional repression or termination, RNA cleavage and polyadenylation, RNA packaging and export, or enzymatic removal of DNA:RNA hybrids (Table 3.1; El Hage et al. 2010, Huertas and Aguilera 2003, Mischo et al. 2011, Sikdar et al. 2008, Stirling et al. 2012, Wahba et al. 2011). To gain a broader understanding of factors involved in R loop formation, we screened chromosome spreads of RNA processing, transcription and chromatin modification mutants for DNA:RNA hybrids using the S9.6 antibody. Importantly, all of the mutants screened have been reported to exhibit chromosome instability (CIN) (Stirling et al. 2011). Significantly elevated hybrid levels were found in 22 of the 40 mutants tested compared to WT, including a mutant of SUB2 which has been previously linked to R loop formation (Figure 3.2, Gomez-Gonzalez et al. 2011). We detected hybrids in mutants of several pathways linked to DNA:RNA hybrid 48  formation such as transcription, nuclear export and the exosome (Figure 3.2, Table 3.1). Consistent with findings in metazoan cells, we observed hybrid formation in splicing mutants (Figure 3.2, Table 3.1; Li and Manley 2005). Several rRNA processing mutants were enriched for DNA:RNA hybrids (7 out of the 22 positive hits), likely due to DNA:RNA hybrid accumulation at rDNA genes, a sensitized hybrid formation site (Figure 3.1A; El Hage et al. 2010). It is possible that, as seen in mRNA cleavage and polyadenylation mutants, DNA:RNA hybrid formation may contribute to their CIN phenotypes (Stirling et al. 2012). Currently, there are 52 genes whose disruption has been found to lead to DNA:RNA hybrid accumulation, 21 of which were newly identified by our screen (Table 3.1). The success of this small-scale screen suggests that several RNA processing pathways suppress hybrid formation to some degree and that many DNA:RNA hybrid forming mutants remain undiscovered. 49  Table 3.1. List of yeast genes that affect DNA:RNA hybrid formation. Yeast gene linked to DNA:RNA hybrids Reference Exosome and RNA degradation: DIS3, RRP6, TRF4, XRN1 This study, Luna et al. 2005, Wahba et al. 2013 Helicase: SEN1, SRS2 Mischo et al. 2011, Wahba et al. 2013 mRNA cleavage and polyadenylation: CLP1, CFT2, FIP1, PCF11, RNA14, RNA15 Gavalda et al. 2013, Luna et al. 2005, Stirling et al. 2012 mRNA export: CRM1, MEX67, MTR2, MTR3, NAB2, NUP133, RNA1, SAC3, SRM1, STS1, SUB2, THP1, YRA1 This study, Gallardo et al. 2003, Gonzalez-Aguilera et al. 2008, Jimeno et al. 2002, Luna et al. 2005, Stirling et al. 2012 Miscellaneous processes: ESC2, KAE1, PSH1 This study RNA-binding ribonucleoprotein: NPL3 Santos-Pereira et al. 2013 RNA polymerase II transcription and chromatin modification: BRE1, CDC36, LEO1, MED12, MED13, MOT1, RTT103, SDS3, SIN3, SPT2, TAF5 This study, Chernikova et al. 2012, Sikdar et al. 2008, Wahba et al. 2011, Wahba et al. 2013 RNase H: RNH201, RNH1 This study, Stirling et al. 2012, Wahba et al. 2011 rRNA processing factors: DBP6, DBP7, IMP4, RPF1, SNU13, SNU66 This study Splicing:  MUD2, SNU114, PRP31, YHC1, SNU13, SNU66 This study THO transcription elongation: THO2, HPR1, MFT1, THP2 Chavez et al. 2000, Huertas and Aguilera 2003, Stirling et al. 2012 Topoisomerase: TOP1 El Hage et al. 2010   50  Figure 3.2. DNA:RNA hybrid cytological screen of RNA processing and chromatin modification mutants. Refer to methods for detailed protocol. Asterisks indicate mutants with significantly increased levels of DNA:RNA hybrids compared to WT (p<0.00024). Error bars indicate standard error of the mean. Representative chromosome spreads are shown: blue stain is DNA (DAPI) and the red foci are DNA:RNA hybrids. . 51  3.3.3 DRIP-chip profiling of R loop forming mutants To investigate potential mutant-specific genomic sites of DNA:RNA hybrid enrichment, we performed DRIP-chip analysis in well characterized mutants of RNase H, the THO complex and Sen1 (i.e. rnh1?rnh201?, hpr1? and sen1-1 respectively). The rnh1?rnh201? and hpr1? DRIP-chip profiles identified slightly higher levels of hybrids globally compared to WT (Figure 3.3A, Table A4 appendix). The sen1-1 mutant exhibited a greater increase in the levels of hybrids genome-wide with typically over 16% of the genome covered by DRIP-chip peaks compared to the 9.9% genome coverage in WT (Figure 3.3A, Table A4 appendix). Like WT, all three mutant backgrounds had enrichment of DNA:RNA hybrids at ORFs of high GC content and transcriptional frequencies (Figures 3.3B and C, Table A8 appendix). For RNase H deficient cells, the set of ORFs enriched for hybrids had even higher transcription frequency relative to WT (Figure 3.3C). Of the 152 ORFs enriched for hybrids in rnh1?rnh201?, 71 were found in the 237 ORFs enriched for hybrids in WT. The 81 ORFs specific to rnh1?rnh201? and the 71 ORFs common to WT and rnh1?rnh201? were both significantly more highly transcribed compared to the ORFs specific to WT (Figure 3.3D). This indicates that hybrids in rnh1?rnh201? are selectively enhanced at a subset of very highly transcribed genes, some of which also form detectable hybrids in WT. In rnh1?rnh201? and sen1-1 mutants but not WT or hpr1?, tRNA genes were significantly enriched for DNA:RNA hybrids (Figure 3.3E, Table A9 appendix). DRIP-quantitative PCR (qPCR) of two tRNA genes confirmed increased enrichment of hybrids in rnh1?rnh201? compared to WT (Figure 3.3F). This is consistent with the RNA polymerase II specific roles of the THO complex and a broader role at all transcription units for RNase H and Sen1. A recent study found that genes encoding enzymes responsible for tRNA transcription and modification are increased at the transcript level in the rnh1?rnh201? background (Arana et al. 2012). This may explain the increase in hybrid signal within tRNA genes in rnh1?rnh201?. It is unclear why the 5? upstream region of tRNA genes is enriched for DNA:RNA hybrids in WT and sen1-1 but is not as pronounced in rnh1?rnh201?, although it suggests a difference in hybrid regulation at tRNA genes in these mutant backgrounds (Figure 3.3D). In sen1-1, snoRNA genes were also enriched for hybrids, supporting reports that the sen1-1 mutation results in accumulation of tRNA and snoRNA precursors (Figures 3.3E, Table A10 appendix; (Ursic et al. 1997)).  52   53   54   G       H        01020304050607080WT R0510152025303540WT RFold enrichment of the SUF2 tRNA gene detected by DRIP-qPCR Fold enrichment of the tV(UAC)D tRNA gene detected by DRIP-qPCR WT rnh1? rnh201? T rnh1? rnh201? 55  Figure 3.3. The genomic profile of DNA:RNA hybrids in mutants. (A) DRIP-chip plot of DNA:RNA hybrids in WT, rnh1?rnh201?, hpr1? and sen1-1 at chromosome XII. The average of two replicates per strain is shown. Boxes and lines are shown as in Figure 1 or as indicated. Enriched features are described in the text and were calculated as in Figure 1. (B) Distribution of % GC content of all ORFs (n=6602) versus DNA:RNA hybrid-enriched ORFs in wild type (n=237), rnh1?rnh201? (n=152), hpr1? (n=242) and sen1-1 (n=516). Asterisk indicates significance p<1e-19 for difference between the sample and the database (Wilcoxon rank sum test). (C) Distribution of transcriptional frequencies of all ORFs (n=5065; Holstege et al. 1998) versus DNA:RNA hybrid-enriched ORFs in WT (n=166), rnh1?rnh201? (n=111), hpr1? (n=137) and sen1-1 (n=361). Asterisk indicates significance p<0.001 for difference between the sample and the database. Double asterisk indicates significance p=0.0013 for difference between the sample and WT. In B and C, intervals indicate range of the 95% of ORFs closest to the average in each sample. Averages are stated above each bar. The Wilcoxon rank sum test was used to obtain p-values. (D) Distribution of transcriptional frequencies of all ORFs (n=5065; Holstege et al. 1998) versus DNA:RNA hybrid-enriched ORFs specific to WT, common to WT and rnh1?rnh201?, or specific to rnh1?rnh201?. Intervals indicate range of the 95% of ORFs closest to the average in each sample. Averages are stated above each bar. P values (Wilcoxon rank sum test) indicating significant differences are shown for each pair of datasets indicated by the brackets. (E) DRIP-chip plots of hybrids at a tRNA gene on chromosome IV. (F) DRIP-chip plots of hybrids at a snoRNA gene on chromosome VII. For E and F, colored lines represent the indicated strains. The Y-axis indicates relative occupancy of DNA:RNA hybrids. Purple bars indicate tRNA or snoRNA genes respectively and remaining features are labeled as in Figure 1. P values were determined as for Figure 1. Averaged DRIP-chip plots of all tRNAs and snoRNAs are shown on the right. Fold enrichment of (G) SUF2 tRNA gene and (H) tV(UAC)D tRNA gene detected in WT or rnh1?rnh201? as detected by DRIP-quantitative PCR (qPCR). Error bars indicate standard deviation. 3.3.4 DNA:RNA hybrids are correlated with genes associated with antisense transcripts Certain DNA:RNA hybrid enriched regions identified by our DRIP-chip analysis such as rDNA and retrotransposons are associated with antisense transcripts (Bierhoff et al. 2010, Servant et al. 2012). Therefore, we checked for enrichment of antisense-associated regions in our WT DRIP-56  chip dataset using two genomic datasets annotated for the presence of antisense transcripts (Xu et al. 2011, Yassour et al. 2010). DNA:RNA hybrid enriched ORFs significantly overlapped with antisense-associated ORFs from both datasets. For example, only 11% of all ORFs in the Xu et al. 2011 dataset are antisense-associated while 40% of DNA:RNA hybrid enriched ORFs were found to be antisense-associated (Figure 3.4A, Table A11 appendix). DNA:RNA hybrid signal over antisense-associated ORFs enriched for DNA:RNA hybrids shows that hybrids formed symmetrically over the ORF without obvious biases (Figure 3.4B). RNase H overexpression reduces detectable levels of DNA:RNA hybrids in cytological screens and suppresses genomic instability associated with R loop formation presumably through the degradation of DNA:RNA hybrids (Nakama et al. 2012, Stirling et al. 2011, Wahba et al. 2011). To test for a potential role of hybrids in antisense gene regulation, we performed gene expression microarray analysis of an RNase H overexpression strain compared to an empty vector control (GEO GSE46652). This identified ORFs that were up (n=212) or down (n=88) regulated at the transcript level in response to RNase H overexpression. A significant portion of these ORFs were antisense-associated (Figure 3.4C, Table A11 appendix). ORFs increased at the transcript level had a distribution bias towards high GC content similar to DNA:RNA hybrid enriched ORFs in WT (Figure 3.4D). However, these ORFs and the antisense-associated ORFs enriched for DNA:RNA hybrids tended towards low transcriptional frequencies (Figure 3.4E). These findings suggest that some antisense-associated regions which are normally transcriptionally repressed possess DNA:RNA hybrids. Indeed, ORFs that were both modulated by RNase H overexpression and enriched for DNA:RNA hybrids were found to be significantly more antisense-associated compared to the original set of ORFs that were modulated by RNase H overexpression or the original set of ORFs that were enriched for DNA:RNA hybrids (Figure 3.4F); This shows that antisense-associated genes are far more likely to be both modulated at the transcript level by RNase H overexpression and enriched for DNA:RNA hybrids.   57    58  Figure 3.4. Antisense transcript association of genes associated with DNA:RNA hybrids. (A) Antisense association of DNA:RNA hybrid-enriched ORFs in WT. p-values indicate significant enrichment (hypergeometric test) of antisense-associated ORFs among DNA:RNA hybrid-enriched ORFs compared to each antisense-annotated dataset (Xu et al. 2011, Yassour et al. 2010). (B) The averaged DRIP-chip plot of both WT replicates over antisense-associated ORFs enriched for DNA:RNA hybrids. The Y-axis indicates relative occupancy of DNA:RNA hybrids. (C) Antisense association in all microarray transcripts (n=5033) and RNase H overexpression up- (n=183) or down-regulated transcripts (n=78). p-values indicate significant enrichment (hypergeometric test) of antisense-associated genes compared to all microarray transcripts. (D) Distribution of % GC content of all genes represented on the expression microarray (n=5657), and transcripts up- (n=212) or down-regulated (n=88) by RNase H overexpression. Intervals indicate 95% confidence intervals. Averages are stated above each sample. The p-value indicates a significant increase in GC content of upregulated genes compared to all microarray transcripts (Wilcoxon rank sum test).  (E) Distribution of transcriptional frequencies of all DNA:RNA hybrid-enriched ORFs in WT found in the Xu et al. 2011 dataset (n=112), antisense-associated ORFs enriched for DNA:RNA hybrids (n=44), all microarray transcripts (n=4731) and genes up-regulated (n=156) at the transcript level by RNase H overexpression. Intervals indicate range of the 95% of ORFs closest to the average in each sample. Averages stated above each bar. p-values indicate significant decrease in transcriptional frequency (Wilcoxon rank sum test). (F) Overlap between DNA:RNA hybrid-enriched ORFs and RNase H-modulated transcripts sorted by antisense association according to the Xu et al. 2011 database. For ORFs that are both hybrid-enriched and modulated at the transcript level by RNase H overexpression, the antisense association (66.7%) is significantly higher than those of the parent datasets (40.0% for DNA:RNA hybrid-enriched ORFs, 29.2% for RNase H-modulated ORFs; hypergeometric test p=6.972e-4). The mechanism underlying altered gene expression in cells overexpressing RNase H remains unclear. While the association with antisense transcription is compelling, alternative models exist. One possibility is that the stress of RNase H overexpression triggers certain gene expression programs that coincidentally are antisense regulated. We analyzed gene ontology (GO) terms enriched among ORFs whose expression was changed by RNase H overexpression. ORFs for iron uptake and incorporation such as FET3 and FET4 were strongly activated by RNase H 59  overexpression (Figure 3.5A, Table A12 appendix). This pathway is also perturbed at the transcript level in the rnh1?rnh201? mutant (Arana et al. 2012). Our hypothesis is that RNase H inappropriately activates transcription of these ORFs by perturbing antisense-mediated regulation. Alternatively, changes in RNase H levels may induce increased cellular iron requirements since sensitivity to low iron concentration is associated with DNA damage and repair (Berthelet et al. 2010). We tested the RNase H deletion and sen1-1 mutants for sensitivity to low iron conditions compared to a fet3? positive control (Figure 3.5B). RNase H depletion or overexpression did not induce sensitivity to low iron and the sen1-1 mutant was insensitive to low iron. This suggests that the transcriptional response in cells overexpressing RNase H was due to inappropriate changes in gene expression and not a cellular iron requirement. In concert with our DRIP-chip and microarray analysis, we propose that DNA:RNA hybrids may be an important player in models of antisense-mediated gene regulation (Figure 3.6).   60    Figure 3.5. Pathways altered at the transcript level by RNase H overexpression. (A) Gene Ontology term network of genes up- (left) and down- (right) regulated at the transcript level by RNase H overexpression. Representative terms from Table A12 (appendix) are shown. Node size indicates fold enrichment. Node color indicates the number of genes associated with each term (the darkest indicating the greatest number of genes associated). Edge thickness indicates the number of genes shared between terms. (B) Lack of cellular iron requirement in RNase H mutant strains. Spotting assay on BPS iron plates testing low iron concentration sensitivity of WT versus DNA:RNA hybrid forming mutants.   61   Figure 3.6. Models of antisense gene regulation that may involve DNA:RNA hybrids.  DNA:RNA hybrids may be formed in any of the depicted antisense transcription regulation models involving antisense recruitment of chromatin modifiers or collision with sense transcriptional machinery. (i) Antisense transcript forms a DNA:RNA hybrid that can be differentially stabilized (Sun et al. 2013). (ii) Antisense transcription or the transcript recruits a chromatin modifier such as a histone deacetylase or methyltransferase (Camblong et al. 2007, Castelnuovo et al. 2013). (iii) Sense transcription initiation or elongation is blocked by antisense transcription or transcript (Gelfrand et al. 2011, Hongay et al. 2006, van Werven et al. 2012). (iv) Trans-acting antisense transcript hybridizes to DNA (e.g. promoter) and blocks sense transcription (Camblong et al. 2009, Matsuda and Garfinkel 2009).  3.4 Discussion 3.4.1 The genomic profile of DNA:RNA hybrids Identifying the landscape of genomic loci predisposed to DNA:RNA hybrid formation is of fundamental importance to delineating mechanisms of hybrid formation and the contributions of various cellular pathways. Locus specific tests suggest that DNA:RNA hybrids occur more frequently at regions with high transcriptional frequency, GC content and supercoiling (Chavez et al. 2001, Gomez-Gonzalez et al. 2011, Mischo et al. 2011). Moreover, in rnh201? cells, there is an inverse relationship between GC content and gene expression levels, suggesting that DNA:RNA hybrids accumulate at regions of high GC content and block transcription in the absence of RNase H (Arana et al. 2012). However, it is interesting to note that dA:rU DNA:RNA 62  hybrids are exceptionally unstable (Martin and Tinoco 1980) and may not form stably in the cell or may escape experimental detection. Our DRIP-chip analysis directly showed that ORFs natively enriched for DNA:RNA hybrids in the genome exhibit high transcriptional frequencies and GC content. Recent studies in human cells have also demonstrated that genomic regions with high GC skew are prone to R loop formation in order to obstruct DNA methylation (Ginno et al. 2012, Ginno et al. 2013). However, we were unable to recapitulate these findings in yeast, likely due to the low level of GC skew and lack of DNA methylation in Saccharomyces. This is unsurprising since the best characterized functional element associated with GC-skew, CpG island promoters (Ginno et al. 2012), are not found in yeast. DRIP-chip analysis of WT cells identified hybrid enrichment at rDNA, retrotransposons and telomeric regions. Elevated DNA:RNA hybrid levels and RNA polymerase I pausing are observed at rDNA, and these phenomena are exacerbated by the loss of topoisomerase I and RNase H (El Hage et al. 2010). In addition, we found that the chromosome spreads of several rRNA processing mutants displayed elevated DNA:RNA hybrid levels. Similarly, the sin3? mutant defective in rDNA transcriptional repression exhibits detectable DNA:RNA hybrids at rDNA loci on chromosome spreads and a dramatic increase in rDNA instability (Wahba et al. 2011). Along with previous studies, our DRIP-chip analysis confirms that rDNA is a hybrid prone genomic site and suggest that many factors of rRNA processing and ribosome assembly suppress potentially damaging rDNA:rRNA hybrid formation (El Hage et al. 2010, Wahba et al. 2011). Transcription of telomeres by RNA polymerase II produces telomeric repeat-containing RNAs (TERRA), which associate with telomeres and inhibit telomere elongation in a DNA:RNA hybrid-dependent fashion (Balk et al. 2013, Luke et al. 2008, Pfeiffer et al. 2013). The presence of TERRA-DNA hybrids is supported by the observation of significant hybrid signal at telomeric repeat regions across all DRIP-chip experiments. More broadly, our data and the literature support the notion that transcripts from RNA polymerases I, II and III can be subject to DNA:RNA hybrid formation especially in RNA processing mutant backgrounds.  3.4.2 DRIP-chip analysis of hybrid-resolving mutants We performed genome-wide profiling of DNA:RNA hybrids in several relevant mutant backgrounds and noted key mutant-specific differences. RNase H appeared to be especially important for the prevention of DNA:RNA hybrid accumulation at highly transcribed ORFs. 63  Unexpectedly, there were no outstanding mutant-specific trends in a strain lacking the THO complex component Hpr1. Nonetheless, in the three mutants analyzed by DRIP-chip, the antisense association was reduced relative to wild type, suggesting that a different set of ORFs was enriched for DNA:RNA hybrids in each mutant. In the case of hpr1?, we speculate that due to its mRNA packaging role, DNA:RNA hybrids that accumulate are likely to be associated with the same mRNA-coding regions as in WT. The corresponding mRNAs may have a longer half-life or other properties that do not distinguish them in our DRIP-chip analysis.  The finding that the rnh1?rnh201? mutant had only slightly higher genome coverage compared to WT (Table A4) was unexpected considering reports of increased DNA:RNA hybrid levels in rnh1?rnh201? chromosome spreads (Stirling et al. 2012, Wahba et al. 2011). This suggests that certain sites of DNA:RNA hybrid accumulation in the rnh1?rnh201? background may not be detectable by DRIP-chip. Furthermore, the number of ORFs enriched for DNA:RNA hybrids in the rnh1?rnh201? mutant is considerably lower than that of WT (152 in the mutant compared to 237 in WT), suggesting that additional genetic features such as tRNA genes must be enriched for DNA:RNA hybrids in the rnh1?rnh201? mutant but not in WT. tRNA genes are known to cluster at the nucleolus, which may contribute to the detectable levels of DNA:RNA hybrids since nucleoli often appear as easily discernible foci in chromosome spreads (Haeusler et al. 2008).  In our study, the RNase H deletion and sen1-1 mutants had increased hybrids at tRNA genes, suggesting that they are both required to prevent tDNA:RNA hybrid accumulation. The finding that both tRNA and snoRNA genes were enriched for hybrids in sen1-1 highlights the genome-wide role of Sen1 in RNA polymerase I, II and III transcription termination and transcript maturation (Kawauchi et al. 2008, Rondon et al. 2009, Ursic et al. 1997). In comparison, although often implicated in R loop resolution, the main role of the major endogenous RNase H encoded by RNH201 is to remove RNA incorporated into genomic DNA during DNA replication (Aguilera and Garcia-Muse 2012, Nguyen et al. 2011). Its mechanism of recruitment to R loop formation sites remains to be elucidated. Specifically, the difference in the shape of DNA:RNA hybrid profiles at tRNA genes in rnh1?rnh201? and sen1-1 backgrounds suggests dissimilar recruitment and hybrid degradation mechanisms. The dramatic genome-wide increase in hybrid signal in the sen1-1 mutant compared to WT and the RNase H deletion mutant suggests that 64  other RNases (e.g. exosome, Xrn1) are sufficient to degrade DNA:RNA hybrids in collaboration with Sen1 at various genomic sites in the absence of RNase H. Sen1 has also been recently implicated in the termination of cryptic unstable transcripts (CUTs) via mechanisms that involve the exosome and transcription regulators such as the Set1 histone methyltransferase (Terzi et al. 2011). Presently, there are 925 CUTs defined by sensitivity to exosome degradation, 847 stable unannotated transcripts (SUTs) and 1658 Xrn1 exonuclease-sensitive unstable transcripts (XUTs) identified in the yeast genome (van Dijk et al. 2011, Xu et al. 2009). However, we did not observe a significant overlap in DNA:RNA hybrid peaks in WT or sen1-1 with these datasets of ncRNA. Nevertheless, our DRIP-chip profiles complement ncRNA transcriptomes that have been generated to answer questions about the regulatory functions of genomic SUTs and CUTs (Xu et al. 2009). It is possible that a small subset of these ncRNAs form genomic DNA:RNA hybrids, which could be endogenously managed by RNA processing factors such as Sen1 to regulate their genomic functions.   3.4.3 Antisense association of DNA:RNA hybrids This work provides a resource for future studies seeking to elucidate the localization of DNA:RNA hybrids across antisense-associated regions and the impact of DNA:RNA hybrid removal on genome-wide transcription. We observed that ORFs associated with antisense transcripts were significantly enriched for DNA:RNA hybrids and modulated at the transcript level by RNase H overexpression. Antisense regulation has been reported at mammalian rDNA and yeast Ty1 retrotransposons, which were enriched for DNA:RNA hybrids in our DRIP-chip (Bierhoff et al. 2010, Servant et al. 2012). The role of DNA:RNA hybrids and RNase H in antisense regulation is currently unclear. In yeast, there are several non-exclusive models of antisense gene regulation, some of which propose that the physical presence of antisense transcripts is crucial to antisense gene regulation (Figure 3.6). Recent evidence of the involvement of DNA:RNA hybrids is provided by the locus-specific case in Arabidopsis where stabilization of antisense transcript-mediated R-loops suppresses antisense transcription (Sun et al. 2013). In mammalian cells, R loop formation has been found to inhibit antisense transcription and chromatin decondensation (Powell et al. 2013). Additionally, trans-acting antisense transcripts have been shown to control Ty1 retrotransposon transcription, reverse transcription and retrotransposition (Matsuda and Garfinkel 2009). Another study has shown that trans-acting 65  antisense transcripts that overlap with the sense strand promoter can block sense transcription, potentially by hybridizing with the non-template DNA strand (Camblong et al. 2009). Rad51-mediated hybrid formation in trans has been recently demonstrated and Rad51 may play a similar role in facilitating trans-acting antisense transcripts (Wahba et al. 2013). In any of these models, DNA:RNA hybrids may be formed by the antisense transcript or the sense transcript with genomic DNA. Moreover, DNA:RNA hybrids may play a functional role in antisense transcription regulation as shown by antisense-associated genes both enriched for DNA:RNA hybrids and affected transcriptionally by RNase H overexpression. Experiments comparing the ratio of DNA:RNA hybrids formed by antisense versus sense transcripts under conditions known to regulate the particular gene should be performed in future to elucidate the role of RNase H and DNA:RNA hybrids in antisense regulation.  66  4 Pathways that interact with DNA:RNA hybrids and RNase H 4.1 Introduction A considerable portion of the genome has been recently found to contain DNA:RNA hybrids (covering over 10% of the genome in S. cerevisiae; Chan et al. 2014, and peaks distributed over at least 2000 genes in human; Ginno et al. 2013). Short DNA:RNA hybrids can form in the genome due to mis-incorporation of rNTPs instead of dNTPs during DNA replication. However, current DNA:RNA hybrid immunoprecipitation (DRIP) genome-wide studies (Chan et al. 2014; Ginno et al. 2013) utilize the S9.6 monoclonal antibody, which preferentially binds DNA:RNA hybrids of at least 6 base pairs in length (Philips et al. 2013). Longer DNA:RNA hybrids are commonly associated with transcription-dependent R-loops, which form when RNA transcripts hybridize with template DNA and displace the single stranded non-template DNA strand. R-loops are known to form naturally in the genome to execute a plethora of essential functions in the cell, including immunoglobulin gene somatic hypermutation (Chaudhuri et al. 2003, Chaudhuri et al. 2004), mitochondrial DNA replication (Backert 2002, Brown et al. 2008; Kogoma et al. 1997), alternative mRNA degradation (Anupama et al. 2011), pause site-dependent transcription termination (Skourti-Stathaki et al. 2011), regulation of chromatin remodelers (Castellano-Pozo et al. 2013, Ginno et al. 2013, Ginno et al. 2012), telomerase regulation (Balk et al. 2013, Luke et al. 2008, Pfeiffer et al. 2013) and antisense transcription regulation (Marinello et al. 2013, Powell et al. 2013, Sun et al. 2013). On the other hand, R-loops that form abnormally via defective RNA processing and export pose a severe threat to genome stability and replication fork progression (Aguilera and Garcia-Muse 2012, Chernikova et al. 2012, El Hage et al. 2010, Gan et al. 2011, Gomez-Gonzalez et al. 2011, Mischo et al. 2011, Stirling et al. 2012, Wahba et al. 2011). These deleterious R-loops can normally be removed by enzymes in the cell such as RNase H (Aguilera and Garcia-Muse 2012) and/or Senataxin helicase (Mischo et al. 2011). It is of great interest to dissect the roles of the identified genomic R-loops and differentiate the sites that are prone to R-loop-mediated genome instability from the sites that possess R-loops for an important cellular function.  67  The majority of current efforts have focused on investigating R-loop formation sites in mutants of nuclear export and RNA processing especially since mutations in RNA processing factors are frequently found in cancer and neurodegenerative diseases (Garraway and Lander 2013, Papaemmanuil et al. 2011, Suraweera et al. 2009, Wang et al. 2011b). R-loops have been extensively examined in mutants in various pathways including mRNA cleavage and polyadenylation (Gavalda et al. 2013, Luna et al. 2005, Stirling et al. 2012), transcription-related chromatin modification (Sikdar et al. 2008, Wahba et al. 2011), transcription elongation (Chavez et al. 2000, Huertas and Aguilera 2003) and termination (Mischo et al. 2011), RNA export (Gallardo et al. 2003, Gonzalez-Aguilera et al. 2008, Jimeno et al. 2002, Luna et al. 2005), the exosome (Luna et al. 2005, Wahba et al. 2013) and RNase H (Stirling et al. 2012, Wahba et al. 2011). These studies have been instrumental to the elucidation of characteristics such as high GC content and transcriptional frequency that make certain genomic sites more prone to R-loop formation in a mutant background (Chavez et al. 2001, Gomez-Gonzalez et al. 2011, Mischo et al. 2011). They have also contributed to the detection of consequences of abnormal R-loops such as irregular chromatin condensation in a THO/TREX complex hpr1? mutant (Castellano-Pozo et al. 2013) or RNA polymerase I transcription blocks in a top1? mutant (El Hage et al. 2010). However, the discovery of novel functions and other effects of R-loop mismanagement also relies on approaching R-loop formation from the context of other cellular pathways. For example, the study of telomere elongation regulation led to the finding that telomeric repeat-containing RNAs (TERRA) form DNA:RNA hybrids that inhibit telomerase (Luke et al. 2008). A group that was investigating noncoding RNAs discovered a role for R-loops in antisense transcription regulation (Sun et al. 2013). Another recent study found that the Rad51 homologous recombination (HR) component can mediate DNA:RNA hybrid formation with RNA expressed in trans and proposed potential roles for this activity in DNA break targeting and transcriptional silencing (Wahba et al. 2013). Broader approaches such as genome-wide profiling of DNA:RNA hybrids have also proven likely to identify natural functions of R-loops such as protection of DNA from methylation at CpG promoters in humans (Ginno et al. 2013). With the objective of determining the prevalence of R-loops and potentially uncovering new effects of genomic R-loops, we screened over 300 mutants across different pathways in S. 68  cerevisiae for elevated DNA:RNA hybrid levels and performed an extensive synthetic genetic array (SGA) screen for mutants that interact with RNase H. As predicted, nuclear export and RNA processing were enriched for mutants with increased DNA:RNA hybrids. Interestingly, several DNA replication and repair mutants were found to not only genetically interact with RNase H, but also exhibit increased DNA:RNA hybrids, suggesting that DNA repair plays an important role in the resolution and prevention of hybrid formation. Another unexpected finding was that kinetochore mutants possessed elevated DNA:RNA hybrid levels although the genomic location and possible function of these hybrids remain to be examined. Ultimately, our findings introduce several new pathways to the narrative of genomic R-loops and propose potential new mechanisms of R-loop formation. 4.2 Methods 4.2.1 Strains and plasmids All strains are listed in Table A15 (appendix). For RNase H overexpression experiments, recombinant human RNase H1 was expressed from plasmid p425-GPD-RNase H1 (2?, GPDpr-RNase H1) and results were compared to an empty control plasmid p425-GPD (2?, GPDpr) (Wahba et al. 2011). The chromosome transmission fidelity assay was performed exactly as described (Spencer et al. 1990, Yuen et al. 2007). 4.2.2 Synthetic genetic array and growth curve analysis Synthetic genetic array (SGA) and growth curve analysis were performed as described (McLellan et al. 2011, Stirling et al. 2011). Briefly, rnh1? and rnh201? were marked with URA3 and NatMX4 respectively. The query strains were rnh1?, rnh201? or rnh1? rnh201?, and these were screened against the Boeke non-essential deletion collection and a collection of DAmP and ts alleles representing essential genes (Schuldiner et al. 2005, Ben-Aroya et al. 2008). SGA was performed with biological triplicates as described (Tong et al. 2004). For data collection the replicates were expanded in triplicate for a total of nine replicates and plates were scanned to obtain images for colony size normalization and comparison using Balony software (Young and Loewen 2013). The output is the difference in colony size between the single mutant versus the combined mutant as a proxy for strain fitness accompanied by a measure of statistical significance. Double or triple mutants were recreated 69  by mating each of the single mutants to the query strains, and growth curve analysis was performed to compare their growth fitness.  4.2.3 Cytological screen for DNA:RNA hybrids Chromosome spreads were made as described in Stirling et al. 2012 (see thesis section 2.2.4) and mutants that had over 20% of nuclei with detectable DNA:RNA hybrids in at least 2 replicates were called as positive hits. These hits were also compared to WT using the Fisher exact test and found to be significant if their p-value was below 0.0002 (this comes from setting the cutoff at a p-value<0.05 and implementing multiple hypothesis correction). 4.3 Results 4.3.1 Systematic quantitative analysis of genetic interactions with RNase H Synthetic genetic array (SGA) was used to query the RNase H-deficient mutants: rnh1?, rnh201? or rnh1? rnh201? against ~95% of all genes in S. cerevisiae that were either non-essential gene deletions (Winzeler et al. 1999) or temperature-sensitive (ts; Li et al. 2011) or decreased abundance by mRNA perturbation (DAmP; Breslow et al. 2008) alleles. Negative genetic interactions with p-value<0.05 and an interaction magnitude of less than -0.2 were considered (Table A16 appendix). The double (rnh201? crossed with mutant of interest) and triple (rnh1? rnh201? crossed with mutant of interest) mutants were reconstructed and analysed by tetrad dissection and growth curve analysis (Table 4.1). 34 mutants that met the cutoff criteria were retested in this way and 23 were validated as true negative genetic interactions. Similar testing of mutants that did not meet the cutoff yielded 8 more true negative genetic interactors (i.e. these were initially false negatives) (Table A16 appendix). Out of the 32 validated interactions, 19 were interactions that only appeared or were enhanced in the triple mutant compared to the double mutant (Table 4.1). This suggests that in the case of these 19 interactions, RNH1 was able to compensate for the loss of RNH201 in the double mutant. That is, in the absence of RNH1 and RNH201 in the triple mutant, a much more severe consequence for the cell is attained. Out of the 32 genetic interactors, only rad27?, rfc2-1, rfc5-1, rpn11-14, rtt109? and taf11-2ts were found to have negative genetic interactions with rnh1? compared to the 20 mutants that had negative interactions with rnh201?, suggesting that RNH201 is the key RNase H enzyme in the cell.  70  Table 4.1 Negative genetic interactions with RNase H in S. cerevisiae sorted by gene ontology (GO). Synthetic lethality (SL) interactions were validated by tetrad analysis, with number of tetrads analysed in brackets. Synthetic sickness (SS) interactions or the lack thereof were validated by growth curves (student t test p-value<0.05). GO term annotation Negative genetic interactor Interaction with rnh201? Enhanced interaction with rnh1? rnh201? DNA replication and repair rfc2-1 - SL (8) mph1? - SL (8) rad27? - SL (3) rfc5-1 - SL (8) pol32? - SS ctf4? SS Enhanced SS rfa1-M2 SS Enhanced SS cdc9-1 SS Same as SS with rnh201? mms1? SS Same as SS with rnh201? sgs1? SS Same as SS with rnh201? dbf4-1 SS Same as SS with rnh201? nse1-16 SS Same as SS with rnh201? nse4 DaMP allele SL (4)  Cohesion mcd1-73 - SS HR repair esc2? - SL (6) elg1? SS Enhanced SS xrs2? SS Enhanced SS rad50? SS Enhanced SS rad52? SS Enhanced SS mms21-1 SL (13)  rad59? SS Same as SS with rnh201? 71  GO term annotation Negative genetic interactor Interaction with rnh201? Enhanced interaction with rnh1? rnh201? HR repair rtt109? SS Same as SS with rnh201? smc6-9 SS Same as SS with rnh201? DNA repair mms4? SS Same as SS with rnh201? mus81? SS Same as SS with rnh201? Anaphase promoting complex apc2-8 - SS Transcription and chromatin modification top1? - SL (6) taf11-2ts SS Enhanced SS ada2? SS Same as SS with rnh201? swc4-4 SS Same as SS with rnh201? Mitochondrial ribosome rsm27? - SS Vesicle transport sec22-3 - SS Proteasome rpn11-14 SS Same as SS with rnh201?  4.3.2 Cytological screen for DNA:RNA hybrids To determine the prevalence of DNA:RNA hybrids and their potential roles in mutants defective in various genome stability pathways, we focused on the set of 660 CIN mutants with known GO term annotations in yeast (Stirling et al. 2011). Since DNA:RNA hybrids are associated with CIN (Aguilera and Garcia-Muse 2012), we expected a higher incidence of mutants with increased DNA:RNA hybrid formation in this subset of yeast mutants. In total, 311 CIN mutants representing a variety of pathways were screened for elevated DNA:RNA hybrid levels (Table 4.2, Table A17 appendix). Some of the resultant findings that mRNA cleavage and polyadenylation and rRNA processing mutants have increased DNA:RNA hybrids have been previously published in Stirling et al. 2012 (Figure 2.5E) and Chan et al. 2014 (Figure 3.2). The expanded screen results revealed enrichment of mutants with 72  increased DNA:RNA hybrids across the pathways of nuclear transport, RNA processing, the kinetochore, DNA replication and repair, and chromatin and transcription (Table 4.2). A cutoff was implemented where only mutants with >20% of their nuclei displaying detectable DNA:RNA hybrid staining in at least 2 replicates were subjected to the Fisher exact test with multiple hypothesis correction (p<0.0002) (Figure 4.1). A set of the mutants that had elevated DNA:RNA hybrid levels was confirmed to also have a CTF phenotype, which indicates higher frequencies of chromosome loss and rearrangement. Mutants with a sufficiently strong CTF phenotype were checked for RNase H suppression of this CIN phenotype. Interestingly, although the CTF phenotype was not found to be significantly suppressed in the scc2-4 and xrs2? DNA repair mutants, suppression was observed in the case of several kinetochore mutants when RNase H was overexpressed on a 2? plasmid (Figure 4.2, Table A18 appendix). These kinetochore mutants included cse4-1 and dam1-5 that had significantly higher levels of DNA:RNA hybrids, as well as cep3-1, dsn1-7 and spc105-15 that exhibited detectable DNA:RNA hybrids but did not meet the statistical cutoff. In comparison, the CTF phenotype was not suppressed in the spc34 kinetochore mutant that had a similar level of DNA:RNA hybrids as wild type. This suggests that DNA:RNA hybrid degradation can restore genome integrity in cells with a kinetochore defect that leads to DNA:RNA hybrid accumulation.  73  Table 4.2 Enrichment of mutants screened for DNA:RNA hybrids. The total number of mutants in each GO category in the set of 660 CIN mutants (Total no.), the number of mutants from each category tested (Tested) and the number and percentage of tested mutants that had significantly elevated DNA:RNA hybrid levels (Hits) are shown. GO annotation Total no. (660) Tested (311) Hits (61) RNA processing 46 29 16 (55%) Nuclear transport 21 11 5 (45%) Kinetochore, Spindle, Cell cycle 110 48 13 (27%) DNA repair, Replication 143 63 15 (24%) Chromatin, Transcription 89 43 9 (21%) Proteolysis 21 12 1 (8%) Morphogenesis 40 22 1 (5%) Endomembrane 48 26 1 (4%) Housekeeping 35 16 0 (0%) Mitochondrial 51 17 0 (0%) Ribosome biogenesis, Translation 56 24 0 (0%)   74   Figure 4.1 CIN mutants with elevated DNA:RNA hybrid levels 75   Figure 4.2 CIN in kinetochore mutants is suppressed by RNase H overexpression  76  4.4 Discussion 4.4.1 DNA replication and repair are important to prevent DNA:RNA hybrid formation  Mutants in nuclear transport, RNA processing, and chromatin and transcription are known to cause increased R-loop formation (Chavez et al. 2000, Gallardo et al. 2003, Gavalda et al. 2013, Gonzalez-Aguilera et al. 2008, Huertas and Aguilera 2003, Jimeno et al. 2002, Luna et al. 2005, Mischo et al. 2011, Sikdar et al. 2008, Stirling et al. 2012, Wahba et al. 2011). Therefore, it was not surprising that genes encoding proteins in these pathways were enriched in the set of CIN gene mutants exhibiting increased DNA:RNA hybrid levels (Table 4.2). Instead, the finding that a large fraction of mutants in DNA replication and repair also had increased DNA:RNA hybrids was unexpected. Previous studies have shown that SGS1 and MUS81 are negative genetic interactors of RNase H and are required to repair lagging-strand replication defects when RNase H is defective (Ii and Brill 2005). In the absence of RNase H, postreplication repair pathways are constitutively activated (Lazzaro et al. 2012) and RNase H has also been shown to be essential for mismatch repair and replication fidelity (Ghodgaonkar et al. 2013). These may explain the synthetic sickness of cells lacking RNase H in combination with other DNA repair mutants. However, it was not known that DNA replication and repair mutants also have elevated DNA:RNA hybrid levels compared to wild type (Figure 4.1).  Although, R-loops have been causatively linked to replication fork stalling and the activation of DNA repair pathways (Aguilera and Garcia-Muse 2012, Bermejo et al. 2012, Gan et al. 2011), it is not understood whether the reverse is true: do replication fork stalling and/or improper DNA repair result in R-loop formation? The high enrichment of mutants with DNA:RNA hybrids in genes related to DNA replication and repair pathways suggests that this may be true. The fact that the majority of negative genetic interactions with RNase H stemmed from mutants in DNA replication and repair also raises the possibility that impaired DNA replication and repair may not only hinder the resolution of R-loops, but also contribute to R-loop formation. One hypothesis is that stalled replication forks and DNA repair intermediates can become obstacles to transcription and promote R-loop formation. Future studies of mutants in DNA replication and repair to determine the genomic localization of R-loops may clarify the issue. For instance, if R-loops are found to form at DNA damage-prone 77  genomic regions, this would support the idea that DNA replication and repair defects can contribute to R-loops.  4.4.2 Potential links between kinetochore defects and DNA:RNA hybrids  The surprising finding that kinetochore mutants can result in increased DNA:RNA hybrids raises several questions about the genomic localization of these DNA:RNA hybrids and their potential contribution to CIN. R-loops were recently found to promote histone H3 phosphorylation and chromatin condensation at centromeres in yeast (Castellano-pozo et al. 2013). It is possible that kinetochore defects may result in R-loop formation at centromeres and subsequent chromatin condensation. It has been demonstrated that a certain level of transcription is required for accurate chromosome segregation in yeast and human cells (Chan et al. 2012, Ohkuni and Kitagawa 2011). Furthermore, a subset of RNA polymerase II mutants was found to have genetic interaction profiles that are significantly correlated to those of kinetochore mutants (Braberg et al. 2013). This group of RNA polymerase II mutants was also found to have the CTF phenotype in comparison to RNA polymerase II mutants with genetic profiles dissimilar from those of kinetochore mutants (Braberg et al. 2013). These observations suggest that perturbing RNA polymerase function can result in consequences akin to those of kinetochore dysfunction. Our screen for DNA:RNA hybrids identified as a positive hit the Cse4 loss-of-function mutant. Cse4 is the CenH3/CENP-A homolog in yeast that is incorporated into the centromeric nucleosome and establishes the kinetochore at the centromere. It has been suggested that centromeric transcription may remodel chromatin for the incorporation of CenH3 nucleosomes and establishment of proper centromeric topology (Ohkuni and Kitagawa 2012). In S. pombe, CENP-A incorporation was found to reduce transcription at the yeast centromere (Castillo et al. 2007). It is possible that the Cse4 mutant protein is not properly incorporated into centromeric nucleosomes or does not induce proper topological changes upon incorporation to silence transcription. This might result in R-loop formation due to the accumulation of centromeric transcripts. Removal of these centromeric R-loops might restore centromeric functionality and topology. 78  5 Concluding Chapter 5.1 RNA processing: a safeguard against R-loop-mediated CIN In this thesis I have investigated the mechanism of CIN in RNA processing mutants based on the comprehensive database of CIN genes in S. cerevisiae (Stirling et al. 2011, Stirling et al. 2012). In particular, mRNA cleavage and polyadenylation (mCP) mutants were found to exhibit R-loop-mediated CIN, which could be suppressed by the overexpression of RNase H. This model of R-loop-mediated CIN was further supported by the determination of transcription-dependent Rad52 repair centers and ARS-linked sites of DNA damage. These results add to the growing evidence that various RNA processing pathways impact genome integrity across different organisms (El Hage et al. 2010, Gomez-Gonzalez et al. 2009, Li and Manley 2005, Mischo et al. 2011, Paulsen et al. 2009, Tuduri et al. 2009). It remains to be discovered for other transcription and RNA processing CIN mutants if the CIN phenotype results from R-loops or an alternate mechanism such as erroneous expression of genome maintenance genes. However, cases where the restoration of normal RNA expression of one target gene can suppress cell defects in an RNA processing mutant are rare (Burns et al. 2002). Expressing the functional version of the RNA processing factor would more likely be required, rather than the plethora of possible targets altered in expression. Identification of mutations that promote increased R-loop formation is an important goal because it will reveal a different range of possible genome instability mechanisms compared to mutants that do not have R-loops. The screen described in this thesis for elevated DNA:RNA hybrid levels across 300 CIN mutants in yeast identified several CIN mutants in RNA processing to have increased DNA:RNA hybrids. Further research will be required to determine if the hybrids mediate CIN or play a peripheral role in each mutant. The prevalence of R-loop-mediated CIN in cancer is still unclear although there is increasing evidence that this mechanism may play a role in tumorigenesis. We found that knockdown of a conserved mCP factor, FIP1L1, in human cells caused both DNA damage and CIN phenotypes, suggesting that FIP1L1 translocation fusion mutants in leukemia may play a role in destabilizing the tumor genome. Another mCP component, CLP1 has also been found to be disrupted as part of an oncogenic translocation in leukemia (Cools et al. 2003, Tanabe et 79  al. 1996). Several cancer types also possess mutations in the splicing machinery, and analogous mutations have been linked to R-loop-mediated genome instability in several model organism studies (Cohen-Eliav et al. 2013, Furney et al. 2013, Lasho et al. 2012, Li and Manley 2005, Meggendorfer et al. 2012, Patnaik et al. 2013, Quidville et al. 2013, Scott and Rebel 2013, Yoshida et al. 2011). The cytosine deaminase APOBEC3A/B which causes genome instability in cancer (Burns et al. 2013, Nik-Zainal et al. 2012, Taylor et al. 2013) may also make the ssDNA in R-loops susceptible to mutagenesis. However, these findings are preliminary and more work needs to be done to understand the contribution of these mCP mutants to cancer genome evolution and progression. Significantly, it remains to be determined whether cancer cells with RNA processing defects do indeed have increased R-loop formation and if this contributes to gene expression changes and genome instability. One technique for R-loop formation site determination is native bisulfite sequencing (Ginno et al. 2012, Sun et al. 2013), which could be performed on different tumor cell samples to map the sites of R-loop formation. In combination with tumor transcriptome studies, this should reveal whether the shift in R-loop loci is linked to changes in the transcript levels in tumors. Ideally, this study will culminate in strategies to selectively treat cancer cells with elevated R-loop levels possibly by overwhelming the cell?s capacity for genome instability by expressing more R-loop-targeting DNA modifying enzymes or by inducing synthetic lethality via genetic interactions with genes that are expressed at a different level due to R-loop formation. 5.2 R-loops: not just a source of CIN The findings regarding mCP in this thesis attest to the capacity of R-loops to generate genome instability, and our DRIP-chip studies describe characteristics of genes that predispose them as R-loop formation sites. However, the genome-wide profiling of DNA:RNA hybrids in yeast has revealed several natural regions of DNA:RNA hybrid formation that may not simply be hotspots for deleterious R-loop formation. A growing number of natural functions have been assigned to R-loops, including alternative mRNA degradation (Anupama et al. 2011), pause site-dependent transcription termination (Skourti-Stathaki et al. 2011), recruitment of chromatin remodelers (Ginno et al. 2013, Ginno et al. 2012), telomere length regulation (Balk et al. 2013, Luke et al. 2008, Pfeiffer et al. 2013) and 80  antisense transcription regulation (Marinello et al. 2013, Powell et al. 2013, Sun et al. 2013). The presence of DNA:RNA hybrids at genetic features such as telomeres, rDNA, retrotransposons and antisense-associated genes suggest that these DNA:RNA hybrids may play regulatory roles involving chromatin modification, transcription termination or pausing. More investigation of the effects of R-loops in these regions is necessary to understand their specific and relatively abundant localization. In addition, our gene expression microarray study provides a dataset of genes that are affected at the transcript level by RNase H overexpression presumably by R-loop degradation. The significant enrichment of antisense-associated genes among genes that possess DNA:RNA hybrids and are modulated by RNase H suggests an important role for R-loops and influences current models of antisense transcription regulation. The sequencing and quantification of antisense to sense RNA ratios under conditions of RNase H overexpression can help to clarify the role of DNA:RNA hybrids in antisense regulation. Ultimately, our DRIP-chip profiles are a resource for more loci-specific studies of R-loops and potential natural functions. It is important to note that different and improved protocols may in the future more comprehensively detect all R-loop-prone genomic sites. For example, profiling DNA:RNA hybrids in a strand-specific manner under different conditions would be very useful in interpreting the functions of R-loops. This can potentially identify R-loop formation by antisense transcripts that are regulated by cellular conditions and are linked to the regulation of sense strand transcription. The shift in DNA:RNA hybrid formation sites in the absence of R-loop degrading enzymes such as RNase H and the Senataxin helicase also raise several questions about the potential for any RNA to form R-loops and the specific recruitment of different R-loop degrading enzymes. Our findings suggest differential recruitment and hybrid degradation mechanisms, which need to be examined more closely, possibly through further DRIP profiling experiments under different cellular conditions. The DRIP-chip profiles established by this work also provide a solid starting point and standard of comparison for future profiling studies of DNA:RNA hybrids in different mutant backgrounds or cell environments. The accumulation of DNA:RNA hybrid profiles will eventually elucidate enzymes that cooperate at specific genomic regions to prevent R-loop formation, as well as enzymes that perform regulatory functions in response to environmental changes by modulating DNA:RNA hybrids in the genome. 81  5.3 DNA:RNA hybrids arising from defects outside of RNA processing Studies of DNA:RNA hybrids have primarily concentrated on RNA processing and export mutants such as those of the THO/TREX complex (Aguilera and Garcia-Muse 2012, Gomez-Gonzalez et al. 2009). However, recent findings have shown that DNA:RNA hybrids can occur due to defects in other pathways such as DNA replication (El Hage et al. 2010, Marinello et al. 2013, Sordet et al. 2009) or HR (Wahba et al. 2013). The screen of CIN mutants across various pathways for increased DNA:RNA hybrids found that in addition to RNA processing and export mutants, many kinetochore and DNA repair mutants also displayed higher levels of DNA:RNA hybrids. Significantly, the majority of the mutants found to have negative genetic interactions with RNase H were also found in various DNA replication and repair pathways instead of RNA processing pathways. This suggests that there may be much more severe consequences of R-loop formation in the context of dysfunctional DNA repair. Furthermore, CIN could be suppressed in kinetochore mutants by RNase H overexpression, suggesting that the DNA:RNA hybrids play an important role in the CIN that arises from kinetochore defects. This could be linked to the finding that R-loops cause histone H3 phosphorylation and chromatin compaction at centromeres in both yeast and worms (Castellano-Pozo et al. 2013). It will be interesting to determine whether R-loops form at centromeres in kinetochore mutants and if this causes abnormal chromatin condensation at the centromere and CIN. Although much more investigation will be needed to explain how and where DNA:RNA hybrids are forming in kinetochore mutants, as well as how they contribute to destabilizing the genome, this finding adds a novel page to the existing knowledge about DNA:RNA hybrids.   82  Bibliography Aguilera A and Garcia-Muse T. 2012. R loops: from transcription byproducts to threats to genome stability. Mol Cell 46: 115-124. Akhtar A, Gasser SM. 2007. The nuclear envelope and transcriptional control. Nat Rev Genet 8: 507-517. Alvaro D, Lisby M, Rothstein R. 2007. Genome-wide analysis of Rad52 foci reveals diverse mechanisms impacting recombination. PLoS Genet 3: e228.  Amara SG, Jonas V, Rosenfeld MG, Ong ES, Evans RM. 1982. Alternative RNA processing in calcitonin gene expression generates mRNAs encoding different polypeptide products. Nature 298: 240-244. Andersen MP, Nelson ZW, Hetrick ED, Gottschling DE. 2008. A genetic screen for increased loss of heterozygosity in Saccharomyces cerevisiae. Genetics 179: 1179-1195. Anupama K, Leela JK, Gowrishankar J. 2011. Two pathways for RNase E action in Escherichia coli in vivo and bypass of its essentiality in mutants defective for Rho-dependent transcription termination. Mol Microbiol 82: 1330-1348. Arana ME, Kerns RT, Wharey L, Gerrish KE, Bushel PR, Kunkel TA. 2012. Transcriptional responses to loss of RNase H2 in Saccharomyces cerevisiae. DNA Repair (Amst) 11: 933-941. Aristizabal MJ, Negri GL, Benschopp JJ, Holstege FC, Krogan NJ, Kobor MS. 2013. High-throughput genetic and gene expression analysis of the RNAPII-CTD reveals unexpected connections to SRB10/CDK8. PLoS Genet 9: e1003758. Avery OT, Macleod CM, McCarty M. 1944. Studies of the chemical nature of the substance inducing transformation of pneumococcal types. Induction of transformation by a desoxyribonucleic acid fraction isolated from Pneumococcus Type III. J Exp Med 79: 137-158. Backert S. 2002. R-loop-dependent rolling-circle replication and a new model for DNA concatemer resolution by mitochondrial plasmid mp1. EMBO J 21: 128-136. Baker DJ, Jin F, Jeganathan KB, van Deursen JM. 2009. Whole chromosome instability caused by Bub1 insufficiency drives tumorigenesis through tumor suppressor gene loss of heterozygosity. Cancer Cell 16: 475-486. Balk B, Maicher A, Dees M, Klermund J, Luke-Glaser S, Bender K, Luke B. 2013. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nat Struct Mol Biol 20: 1199-1205. 83  Ball P. 2013. DNA: Celebrate the unknowns. Nature 496: 419-420. Balmain A, Gray J, Ponder B. 2003. The genetics and genomics of cancer. Nat Genet 33 Suppl: 238-244. Barber TD, McManus K, Yuen KW, Reis M, Parmigiani G, Shen D, Barrett I, Nouhi Y, Spencer F, Markowitz S et al. 2008. Chromatid cohesion defects may underlie chromosome instability in human colorectal cancers. Proc Natl Acad Sci U S A 105: 3443-3448.  Bell DW, Sikdar N, Lee KY, Price JC, Chatterjee R, Park HD, Fox J, Ishiai M, Rudd ML, Pollock LM et al. 2011. Predisposition to cancer caused by genetic and functional defects of Mammalian atad5. PLoS Genet 7: e1002245.  Ben-Aroya S, Agmon N, Yuen K, Kwok T, McManus K, Kupiec M, Hieter P. 2010. Proteasome nuclear activity affects chromosome stability by controlling the turnover of Mms22, a protein important for DNA repair. PLoS Genet 6: e1000852. Ben-Aroya S, Coombes C, Kwok T, O?Donnell KA, Boeke JD, Hieter P. 2008. Toward a comprehensive temperature-sensitive mutant repository of the essential genes of Saccharomyces cerevisiae. Mol Cell 30: 248-258. Bermejo R, Lai MS, Foiani M. 2012. Preventing replication stress to maintain genome stability: resolving conflicts between replication and transcription. Mol Cell 45: 710-718. Berthelet S, Usher J, Shulist K, Hamza A, Maltez N, Johnston A, Fong Y, Harris LJ, Baetz K. 2010. Functional genomics analysis of the Saccharomyces cerevisiae iron responsive transcription factor Aft1 reveals iron-dependent functions. Genetics 185: 1111-1128. Bierhoff H, Schmitz K, Maass F, Ye J, Grummt I. 2010. Noncoding transcripts in sense and antisense orientation regulate the epigenetic state of ribosomal RNA genes. Cold Spring Harb Symp Quant Biol 75: 357-364. Birse CE, Minvielle-Sebastia L, Lee BA, Keller W, Proudfoot NJ. 1998. Coupling termination of transcription to messenger RNA maturation in yeast. Science 280: 298-301.  Boguslawski SJ, Smith DE, Michalak MA, Michelson KE, Yehle CO, Patterson WL, Carrico RJ. 1986 Characterization of monoclonal antibody to DNA.RNA and its application to immunodetection of hybrids. J Immunol Methods 89: 123-130. Braberg H, Jin H, Moehle EA, Chan YA, Wang S, Shales M, Benschop JJ, Morris JH, Qiu C, Hu F et al. 2013. From structure to systems: high-resolution, quantitative genetic analysis of RNA polymerase II. Cell 154: 775-788. Breslow DK, Cameron DM, Collins SR, Schuldiner M, Stewart-Ornstein J, Newman HW, Braun S, Madhani HD, Krogan NJ, Weissman JS. 2008. A comprehensive strategy enabling high-resolution functional analysis of the yeast genome. Nat Methods 5: 711-718. 84  Brickner DG, Cajigas I, Fondufe-Mittendorf Y, Ahmed S, Lee PC, Widom J, Brickner JH. 2007. H2A.Z-mediated localization of genes at the nuclear periphery confers epigenetic memory of previous transcriptional state. PLoS Biol 5: e81. Brodsky AS, Silver PA. 2000. Pre-mRNA processing factors are required for nuclear export. RNA 6: 1737-1749. Brown SJ, Stoilov P, Xing Y. 2012. Chromatin and epigenetic regulation of pre-mRNA processing. Hum Mol Genet 21: R90-96. Brown TA, Tkachuk AN, Clayton DA. 2008. Native R-loops persist throughout the mouse mitochondrial DNA genome. J Biol Chem 283: 36743-36751. Bryant HE, Schultz N, Thomas HD, Parker KM, Flower D, Lopez E, Kyle S, Meuth M, Curtin NJ, Helleday T. 2005. Specific killing of BRCA2-deficient tumours with inhibitors of poly(ADP-ribose) polymerase. Nature 434: 913-917.  Burns CG, Ohi R, Mehta S, O?Toole ET, Winey M, Clark TA, Sugnet CW, Ares M Jr, Gould KL. 2002. Removal of a single alpha-tubulin gene intron suppresses cell cycle arrest phenotypes of splicing factor mutations in Saccharomyces cerevisiae. Mol Cell Biol 22: 801-815. Burrell RA, McClelland SE, Endesfelder A, Groth P, Weller MC, Shaikh N, Domingo E, Kanu N, Dewhurst SM, Gronroos E et al. 2013. Replication stress links structural and numerical cancer chromosomal instability. Nature 494: 492-496. Bywater MJ, Pearson RB, McArthur GA, Hannan RD. 2013. Dysregulation of the basal RNA polymerase transcription apparatus in cancer. Nat Rev Cancer 13: 299-314. Cahill DP, Kinzler KW, Vogelstein B, Lengauer C. 1999. Genetic instability and darwinian selection in tumours. Trends Cell Biol 9: M57-60.  Camblong J, Iglesias N, Fickentscher C, Dieppois G, Stutz F. 2007. Antisense RNA stabilization induces transcriptional gene silencing via histone deacetylation in S. cerevisiae. Cell 131: 706-717. Camblong J, Beyrouthy N, Guffanti E, Schlaepfer G, Steinmetz LM, and Stutz F. 2009. Trans-acting antisense RNAs mediate transcriptional gene cosuppression in S. cerevisiae. Genes Dev 23: 1534-1545.  Campbell PJ, Yachida S, Mudie LJ, Stephens PJ, Pleasance ED, Stebbings LA, Morsberger LA, Latimer C, McLaren S, Lin ML et al. 2010. The patterns and dynamics of genomic instability in metastatic pancreatic cancer. Nature 467: 1109-1113. Carroll SY, Stirling PC, Stimpson HE, Giesselmann E, Schmitt MJ, Drubin DG. 2009. A yeast killer toxin screen provides insights into a/b toxin entry, trafficking, and killing mechanisms. Dev Cell 17: 552-560. 85  Casimiro MC, Crosariol M, Loro E, Li Z, Pestell RG. 2012. Cyclins and cell cycle control in cancer and disease. Genes Cancer 3: 649-657. Castellano-Pozo M, Santos-Pereira JM, Rondon AG, Barroso S, Andujar E, Perez-Alegre M, Garcia-Muse T, Aguilera A. 2013. R loops are linked to histone H3 S10 phosphorylation and chromatin condensation. Mol Cell 52: 583-590. Castellano-Pozo M, Garcia-Muse T, Aguilera A. 2012. R-loops cause replication impairment and genome instability during meiosis. EMBO Rep 13: 923-929. Castelnuovo M, Rahman S, Guffanti E, Infantino V, Stutz F, Zenklusen D. 2013. Bimodal expression of PHO84 is modulated by early termination of antisense transcription. Nat Struct Mol Biol 20: 851-858. Castillo AG, Mellone BG, Partridge JF, Richardson W, Hamilton GL, Allshire RC, Pidoux AL. Plasticity of fission yeast CENP-A chromatin driven by relative levels of histone H3 and H4. PLoS Genet 3: e121. Chan YA, Aristizabal MJ, Lu PYT, Luo Z, Hamza A, Kobor MS, Stirling PC and Hieter P. 2014. Genome-wide profiling of yeast DNA:RNA hybrid prone sites with DRIP-chip. PLoS Genet 10: DOI 10.1371/journal.pgen.1004288. Chan FL, Marshall OJ, Saffery R, Kim BW, Earle E, Choo KH, Wong LH. 2012. Active transcription and essential role of RNA polymerase II at the centromere during mitosis. Proc Natl Acad Sci U S A 109: 1979-1984. Chanarat S, Seizl M, Strasser K. 2011. The Prp19 complex is a novel transcription elongation factor required for TREX occupancy at transcribed genes. Genes Dev 25: 1147-1158. Chaudhuri J, Khuong C, Alt FW. 2004. Replication protein A interacts with AID to promote deamination of somatic hypermutation targets. Nature 430: 992-998. Chaudhuri J, Tian M, Khuong C, Chua K, Pinaud E, Alt FW. 2003. Transcription-targeted DNA deamination by the AID antibody diversification enzyme. Nature 422: 726-730.  Chavez S, Beilharz T, Rondon AG, Erdjument-Bromage H, Tempst P, Svejstrup JQ, Lithgow T, Aguilera A. 2000. A protein complex containing Tho2, Hpr1, Mft1 and a novel protein, Thp2, connects transcription elongation with mitotic recombination in Saccharomyces cerevisiae. EMBO J 19: 5824-5834.  Chavez S, Garcia-Rubio M, Prado F, Aguilera A. 2001. Hpr1 is preferentially required for transcription of either long or G+C-rich DNA sequences in Saccharomyces cerevisiae. Mol Cell Biol 21: 7054-7064. Chavez S, Beilharz T, Rondon AG, Erdjument-Bromage H, Tempst P, Svejstrup JQ, Lithgow T, Aguilera A. 2000. A protein complex containing Tho2, Hpr1, Mft1 and a novel protein, 86  Thp2, connects transcription elongation with mitotic recombination in Saccharomyces cerevisiae. EMBO J 19: 5824-5834.  Chen C, Kolodner RD. 1999. Gross chromosomal rearrangements in Saccharomyces cerevisiae replication and recombination defective mutants. Nat Genet 23: 81-85. Chen M, Manley JL. 2009. Mechanisms of alternative splicing regulation: insights from molecular and genomics approaches. Nat Rev Mol Cell Biol 10: 741-754. Chernikova SB, Razorenova OV, Higgins JP, Sischc BJ, Nicolau M, Dorth JA, Chernikova DA, Kwok S, Brooks JD, Bailey SM, Game JC, Brown JM. 2012. Deficiency in mammalian histone H2B ubiquitin ligase Bre1 (Rnf20/Rnf40) leads to replication stress and chromosomal instability. Cancer Res 72: 2111-2119. Chi P, Allis CD, Wang GG. 2010. Covalent histone modifications?miswritten, misinterpreted and mis-erased in human cancers. Nat Rev Cancer 10: 457-469. Chou CH, Yang NK, Liu TY, Tai SK, Hsu DS, Chen YW, Chen YJ, Chang CC, Tzeng CH, Yang MH. 2013. Chromosome instability modulated by BMI1-AURKA signaling drives progression in head and neck cancer. Cancer Res 73: 953-966. Chow LT, Gelinas RE, Broker TR, Roberts RJ. 1977. An amazing sequence arrangement at the 5? ends of adenovirus 2 messenger RNA. Cell 12: 1-8. Cobb JA, Schleker T, Rojas V, Bjergbaek L, Tercero JA, Gasser SM. 2005. Replisome instability, fork collapse, and gross chromosomal rearrangements arise synergistically from Mec1 kinase and RecQ helicase mutations. Genes Dev 19: 3055-3069. Cohen-Eliav M, Golan-Gerstl R, Siegfried Z, Andersen CL, Thorsen K, Orntoft TF, Mu D, Karni R. 2013. The splicing fractor SRSF6 is amplified and is an oncoprotein in lung and colon cancers. J Pathol 229: 630-639. Cools J, DeAngelo DJ, Gotlib J, Stover EH, Legare RD, Cortes J, Kutok J, Clark J, Galinsky I, Griffin JD et al. 2003. A tyrosine kinase created by fusion of the PDGFRA and FIP1L1 genes as a therapeutic target of imatinib in idiopathic hypereosinophilic syndrome. N Engl J Med 348: 1201-1214.  Cooper TA, Wan L, Dreyfuss G. 2009. RNA and disease. Cell 136: 777-793. Costanzo M, Boone C. 2009. SGAM: an array-based approach for high-resolution genetic mapping in Saccharomyces cerevisiae. Methods Mol Biol 548: 37-53. Crasta K, Ganem NJ, Dagher R, Lantermann AB, Ivanova EV, Pan Y, Nezi L, Protopopov A, Chowdhury D, Pellman D. 2012. DNA breaks and chromosome pulverization from errors in mitosis. Nature 482: 53-58. Crick F. 1970. Central dogma of molecular biology. Nature 227: 561-563. 87  Crow, Y. J., Leitch, A., Hayward, B. E., Garner, A., Parmar, R., Griffith, E., Ali, M., Semple, C., Aicardi, J., Babul-Hirji, R., et al. 2006. Mutations in genes encoding ribonuclease H2 subunits cause Aicardi-Goutieres syndrome and mimic congenital viral brain infection. Nat. Genet. 38: 910-916.  Crighton D, Woiwode A, Zhang C, Mandavia N, Morton JP, Warnock LJ, Milner J, White RJ, Johnson DL. 2003. p53 represses RNA polymerase III transcription by targeting TBP and inhibiting promoter occupancy by TFIIIB. EMBO J 22: 2810-2820. Dahm R. 2008. Discovering DNA: Friedrich Miescher and the early years of nucleic acid research. Hum Genet 122: 565-581. Dang CV, O?Donnell KA, Zeller KI, Nguyen T, Osthus RC, Li F. 2006. The c-Myc target gene network. Semin Cancer Biol 16: 253-264. Darnell JE Jr. 2013. Reflections on the history of pre-mRNA processing and highlights of current knowledge: a unified picture. RNA 19: 443-460. Darnell JE Jr. 1978. Implications of RNA-RNA splicing in evolution of eukaryotic cells. Science 202: 1257-1260. David CJ, Manley JL. 2011. The RNA polymerase C-terminal domain: A new role in spliceosome assembly. Transcription 2: 221-225. David CJ, Manley JL. 2010. Alternative pre-mRNA splicing regulation in cancer: pathways and programs unhinged. Genes Dev 24: 2343-2364. Davuluri RV, Suzuki Y, Sugano S, Plass C, Huang TH. 2008. The functional consequences of alternative promoter use in mammalian genomes. Trends Genet 24: 167-177. de Almeida SF, Grosso AR, Koch F, Fenouil R, Carvalho S, Andrade J, Levezinho H, Gut M, Eick D, Gut I et al. 2011. Splicing enhances recruitment of methyltransferase HYPB/Setd2 and methylation of histone H3 Lys36. Nat Struct Mol Biol 18: 977-983. DePamphilis ML, Wassarman PM. 1980. Replication of eukaryotic chromosomes: a close-up of the replication fork. Annu Rev Biochem 49: 627-666. Dobzhansky T. 1946. Genetics of natural populations; recombination and variability in populations of Drosophila pseudoobscura. Genetics 31: 269-290. Dominguez-Sanchez MS, Barroso S, Gomez-Gonzalez B, Luna R, and Aguilera A. 2011. Genome Instability and Transcription Elongation Impairment in Human Cells Depleted of THO/TREX. PLoS Genet 7: e1002386.  Downs JA, Lowndes NF, Jackson SP. 2000. A role for Saccharomyces cerevisiae histone H2A in DNA repair. Nature 408: 1001-1004.  88  Dunham I, Kundaje A, Aldred SF, Collins PJ, Davis CA, Doyle F, Epstein CB, Frietze S, Harrow J, Kaul R et al. 2012. An integrated encyclopedia of DNA elements in the human genome. Nature 489: 57-74. El Hage A, French SL, Beyer AL, Tollervey D. 2010. Loss of Topoisomerase I leads to R-loop-mediated transcriptional blocks during ribosomal RNA synthesis. Genes Dev 24: 1546-1558. Faghihi MA and Wahlestedt C. 2009. Regulatory roles of natural antisense transcripts. Nat Rev Mol Cell Biol 10: 637-643.  Farmer H, McCabe N, Lord CJ, Tutt AN, Johnson DA, Richardson TB, Santarosa M, Dillon KJ, Hickson I, Knights C, Martin NM, Jackson SP, Smith GC, Ashworth A. 2005. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434: 917-921.  Filipowicz W, Bhattacharyya SN, Sonenberg N. 2008. Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight? Nat Rev Genet 9: 102-114. Foijer F, Draviam VM, Sorger PK. 2008. Studying chromosome instability in the mouse. Biochim Biophys Acta 1786: 73-82. Fujiwara T, Bandi M, Nitta M, Ivanova EV, Bronson RT, Pellman D. 2005. Cytokinesis failure generating tetraploids promotes tumorigenesis in p53-null cells. Nature 437: 1043-1047. Furger A, O?Sullivan JM, Binnie A, Lee BA, Proudfoot NJ. 2002. Promoter proximal splice sites enhance transcription. Genes Dev 16: 2792-2799. Furney SJ, Pedersen M, Gentien D, Dumont AG, Rapinat A, Desjardins L, Turajlic S, Piperno-Neumann S, de la Grange P, Roman-Roman S et al. 2013. SF3B1 Mutations Are Associated with Alternative Splicing in Uveal Melanoma. Cancer Discov 3: 1122-1129. Gaillard H, Aguilera A. 2013. Transcription coupled repair at the interface between transcription elongation and mRNP biogenesis. Biochim Biophys Acta 1829: 141-150. Gallardo M, Luna R, Erdjument-Bromage H, Tempst P, Aguilera A. 2003. Nad2p and the Thp1p-Sac3p complex functionally interact at the interface between transcription and mRNA metabolism. J Biol Chem 278: 24225-24232. Gan W, Guan Z, Liu J, Gui T, Shen K, Manley JL, Li X. 2011. R-loop-mediated genomic instability is caused by impairment of replication fork progression. Genes Dev 25: 2041-2056. Garber K. 2001. Beyond the Nobel Prize: Cell cycle research offers new view of cancer. J Natl Cancer Inst 93: 1766-1768. Garraway LA and Lander ES. 2013. Lessons from the cancer genome. Cell 153: 17-37.  89  Gavalda S, Gallardo M, Luna R, Aguilera A. 2013 R-loop mediated transcription-associated recombination in trf4? mutants reveals new links between RNA surveillance and genome integrity. PLoS One 8: e65541. Gelfand B, Mead J, Bruning A, Apostolopoulos N, Tadigotla V, Nagaraj V, Sengupta AM, Vershion AK. 2011. Regulated antisense transcription controls expression of cell-type-specific genes in yeast. Mol Cell Biol 31: 1701-1709. Gerlinger M, Rowan AJ, Horswell S, Larkin J, Endesfelder D, Gronroos E, Martinez P, Matthews N, Stewart A, Tarpey P et al. 2012. Intratumor heterogeneity and branched evolution revealed by multiregion sequencing. N Engl J Med 366: 883-892. Ghodgaonkar MM, Lazzaro F, Olivera-Pimental M, Artola-Boran M, Cejka P, Reijns MA, Jackson AP, Plevani P, Muzi-Falconi M, Jiricny J. 2013. Ribonucleotides misincorporated into DNA act as strand-discrimination signals in eukaryotic mismatch repair. Mol Cell 50: 323-332. Gibbs WW. 2003. The unseen genome: gems among the junk. Sci Am 289: 26-33. Gilbert W. 1978. Why genes in pieces? Nature 271: 501. Ginno PA, Lott PL, Christensen HC, Korf I, Chedin F. 2012. R-loop formation is a distinctive characteristic of unmethylated human CpG island promoters. Mol Cell 45: 814-825. Ginno PA, Lim YW, Lott PL, Korf IF, Chedin F. 2013. GC skew at the 5? and 3? ends of human genes links R-loop formation to epigenetic regulation and transcription termination. Genome Res Published in Advance July 18, 2013, doi: 10.1101/gr.158436.113. Gomez-Gonzalez B, Garcia-Rubio M, Bermego R, Gaillard H, Shirahige K, Marin A, Foiani M, Aguilera A. 2011. Genome-wide function of THO/TREX in active genes prevents R-loop-dependent replication obstacles. EMBO J 30: 3106-3119. Gomez-Gonzalez B, Aguilera A. 2007. Activation-induced cytidine deaminase action is strongly stimulated by mutations of the THO complex. Proc Natl Acad Sci U S A 104: 8409-8414. Gonzalez-Aguilera C, Tous C, Gomez-Gonzalez B, Huertas P, Luna R, Aguilera A. 2008. The THP1-SAC3-SUS1-CDC31 complex works in transcription elongation-mRNA export preventing RNA-mediated genome instability. Mol Biol Cell 19: 4310-4318. Gotter AL, Suppa C, Emanuel BS. 2007. Mammalian TIMELESS and Tipin are evolutionarily conserved replication fork-associated factors. J Mol Biol 366: 36-52. Gottipati P, Cassel TN, Savolainen L, Helleday T. 2008. Transcription-associated recombination is dependent on replication in Mammalian cells. Mol Cell Biol 28: 154-164.  90  Grandori C, Gomez-Roman Natividad, Felton-Edkins ZA, Ngouenet C, Galloway DA, Eisenman RN, White RJ. 2005. c-Myc binds to human ribosomal DNA and stimulates transcription of rRNA genes by RNA polymerase I. Nat Cell Biol 7: 311-318. Grigoryev SA, Woodcock CL. 2012. Chromatin organization ? the 30 nm fiber. Exp Cell Res 318: 1448-1455. Gromak N, West S, Proudfoot NJ. 2006. Pause sites promote transcriptional termination of mammalian RNA polymerase II. Mol Cell Biol 26: 3986-3996. Gross S, Moore C. 2001. Five subunits are required for reconstitution of the cleavage and polyadenylation activities of Saccharomyces cerevisiae cleavage factor I. Proc Natl Acad Sci U S A 98: 6080-6085. Guacci V, Koshland D, Strunnikov A. 1997. A direct link between sister chromatid cohesion and chromosome condensation revealed through the analysis of MCD1 in S. cerevisiae. Cell 91: 47-57.  Haeusler RA, Pratt-Hyatt M, Good PD, Gipson TA, Engelke DR. 2008. Clustering of yeast tRNA genes is mediated by specific association of condensing with tRNA gene transcription complexes. Genes Dev 22: 2204-2214. Hanahan D and Weinberg RA. 2011. Hallmarks of cancer: the next generation. Cell 144: 646-674. Hartwell LH, Szankasi P, Roberts CJ, Murray AW, Friend SH. 1997. Integrating genetic approaches into the discovery of anticancer drugs. Science 278: 1064-1068. Hartwell LH. 1978. Cell division from a genetic perspective. J Cell Biol 77: 627-637. Hartwell LH, Mortimer RK, Culotti J, Culotti M. 1973. Genetic control of the cell division cycle in yeast: V. Genetic Analysis of cdc Mutants. Genetics 74: 267-286. He Y, Vogelstein B, Velculescu VE, Papadopoulos N, Kinzler KW. 2008. The antisense transcriptomes of human cells. Science  322: 1855-1857. Helmling S, Zhelkovsky A, Moore CL. 2001. Fip1 regulates the activity of Poly(A) polymerase through multiple interactions. Mol Cell Biol 21: 2026-2037.  Helmrich A, Ballarino M, Nudler E, Tora L. 2013. Transcription-replication encounters, consequences and genomic instability. Nat Struct Mol Biol 20: 412-418. Henikoff S. 2002. Beyond the central dogma. Bioinformatics 18: 223-225. Hobson DJ, Wei W, Steinmetz LM, Svejstrup JQ. 2012. RNA polymerase II collision interrupts convergent transcription. Mol Cell 48: 365-374. 91  Holstege FC, Jennings EG, Wyrick JJ, Lee TI, Hengartner CJ, Green MR, Golub TR, Lander ES, Young RA. 1998. Dissecting the regulatory circuitry of a eukaryotic genome. Cell 95: 717-728. Hongay CF, Grisafi PL, Galitski T, Fink GR. 2006. Antisense transcription controls cell fate in Saccharomyces cerevisiae. Cell 127: 735-745. Hou F, Zuo H. 2005. Two human orthologues of Eco1/Ctf7 acetyltransferases are both required for proper sister-chromatid cohesion. Mol Biol Cell 16: 3908-3918. Houseley J, Tollervey D. 2009. The many pathways of RNA degradation. Cell 136: 763-776. Hsin JP, Manley JL. 2012. The RNA polymerase II CTD coordinates transcription and RNA processing. Genes Dev 26: 2119-2137. Hu Z, Zhang A, Storz G, Gottesman S, Leppla SH. 2006. An antibody-based microarray assay for small RNA detection. Nucleic Acids Res 34:e52. Huertas P and Aguilera A. 2003. Cotranscriptionally formed DNA:RNA hybrids mediate transcription elongation impairment and transcription-associated recombination. Mol Cell 12: 711-721. Huvet M, Nicolay S, Touchon M, Audit B, d'Aubenton-Carafa Y, Arneodo A, Thermes C. 2007. Human gene organization driven by the coordination of replication and transcription. Genome Res 17: 1278-1285.  Ichijima Y, Yoshioka K, Yoshioka Y, Shinohe K, Fujimori H, Unno J, Takagi M, Goto H, Inagaki M, Mizutani S, Teraoka H. 2010. DNA lesions induced by replication stress trigger mitotic aberration and tetraploidy development. PLoS One 5: e8821. Ii M, Brill SJ. 2005. Roles of SGS1, MUS81, and RAD51 in the repair of lagging-strand replication defects in Saccharomyces cerevisiae. Curr Genet 48: 213-225. Imamura T, Yamamoto S, Ohgane J, Hattori N, Tanaka S, Shiota K. 2004. Non-coding RNA directed DNA demethylation of Sphk1 CpG island. Biochem Biophys Res Commun 322: 593-600. Isono K, MizuTani-Koseki Y, Komori T, Schmidt-Zachmann MS, Koseki H. 2005. Mammalian polycomb-mediated repression of Hox genes requires the essential spliceosomal protein Sf3b1. Genes Dev 19: 536-541. Iwase S, Akiyama N, Sekikawa T, Saito S, Arakawa Y, Horiguchi-Yamada J, Yamada H. 2003. Both NUP98/TOP1 and TOP1/NUP98 transcripts are detected in a de novo AML with t(11;20)(p15;q11). Genes Chromosomes Cancer 38: 102-105.  Jackson SP, Bartek J. 2009. The DNA-damage response in human biology and disease. Nature 461: 1071-1078.  92  Janssen A, van der Burg M, Szuhai K, Kops GJ, Medema RH. 2011. Chromosome segregation errors as a cause of DNA damage and structural chromosome aberrations. Science 333: 1895-1898. Jimeno S, Rondon AG, Luna R, Aguilera A. 2002. The yeast THO complex and mRNA export factors link RNA metabolism with transcription and genome instability. EMBO J 21: 3526-3535. Juge F, Fernando C, Fic W, Tazi J. 2010. The SR protein B52/SRp55 is required for DNA topoisomerase I recruitment to chromatin, mRNA release and transcription shutdown. PLoS Genet 6: e1001124. Kaelin WG Jr. 2005. The concept of synthetic lethality in the context of anticancer therapy. Nat Rev Cancer 5: 689-698. Kaneko S, Rozenblatt-Rosen O, Meyerson M, Manley JL. 2007. The multifunctional protein p54nrb/PSF recruits the exonuclease XRN2 to facilitate pre-mRNA 3?processing and transcriptional termination. Genes Dev 21: 1779-1789. Kanellis P, Gagliardi M, Banath JP, Szilard RK, Nakada S, Galicia S, Sweeney FD, Cabelof DC, Olive PL, Durocher D. 2007. A screen for suppressors of gross chromosomal rearrangements identifies a conserved role for PLP in preventing DNA lesions. PLoS Genet 3: e134.  Kaplan CD. 2013. Basic mechanisms of RNA polymerase II activity and alteration of gene expression in Saccharomyces cerevisiae. Biochim Biophys Acta 1829: 39-54. Kaplan CD, Jin H, Zhang IL, Belyanin A. 2012. Dissection of Pol II trigger loop function and Pol II activity-dependent control of start site selection in vivo. PloS Genet 8: e1002627. Kawabata T, Luebben SW, Yamaguchi S, Ilves I, Matise I, Buske T, Botchan MR, Shima N. 2011. Stalled fork rescue via dormant replication origins in unchallenged S phase promotes proper chromosome segregation and tumor suppression. Mol Cell 41: 543-553. Kawauchi J, Mischo H, Braglia P, Rondon A, Proudfoot NJ. 2008. Budding yeast RNA polymerases I and II employ parallel mechanisms of transcription termination. Genes Dev 22: 1082-1092. Kim E, Goren A, Ast G. 2008. Insights into the connection between cancer and alternative splicing. Trends Genet 24: 7-10. Kim M, Krogan NJ, Vasiljeva L, Rando OJ, Nedea E, Greenblatt JF, Buratowski S. 2004. The yeast Rat1 exonuclease promotes transcription termination by RNA polymerase II. Nature 432: 517-522. Klein F, Laroche T, Cardenas ME, Hofmann JF, Schweizer D, Gasser SM. 1992. Localization of RAP1 and topoisomerase II in nuclei and meiotic chromosomes of yeast. J Cell Biol 117: 935-948. 93  Kochetov AV. 2008. Alternative translation start sites and hidden coding potential of eukaryotic mRNAs. Bioessays 30: 683-691. Kogoma T. 1997. Stable DNA replication: interplay between DNA replication, homologous recombination, and transcription. Microbiol Mol Biol Rev 61: 212-238. Koh JL, Ding H, Costanzo M, Baryshnikova A, Toufighi K, Bader GD, Myers CL, Andrews BJ, Boone C. 2010. DRYGIN: a database of quantitative gentic interaction networks in yeast. Nucleic Acids Res 38: D502-507. Kohler A, Schmidt-Zachmann MS, Franke WW. 1997. AND-1, a natural chimeric DNA-binding protein, combines an HMG-box with regulatory WD-repeats. J Cell Sci 110: 1051-1062. Kornberg RD. 1977.Structure of chromatin. Annu Rev Biochem 46: 931-954. Koziol MJ, Rinn JL. 2010. RNA traffic control of chromatin complexes. Curr Opin Genet Dev 20: 142-148. Kundu S, Horn PJ, Peterson CL. 2007. SWI/SNF is required for transcriptional memory at the yeast GAL gene cluster. Genes Dev 21: 997-1004. Lasho TL, Jimma T, Finke CM, Patnaik M, Hanson CA, Ketterling RP, Pardanani A, Tefferi A. 2012. SRSF2 mutations in primary myelofibrosis: significant clustering with IDH mutations and independent association with inferior overall and leukemia-free survival. Blood 120: 4168-4171. Lazzaro F, Novarina D, Amara F, Watt DL, Stone JE, Costanzo V, Burgers PM, Kunkel TA, Plevani P, Muzi-Falconi M. 2012. RNase H and postreplication repair protect cells from ribonucleotides incorporated in DNA. Mol Cell 45: 99-110. Lee JM, Ledermann JA, Kohn EC. 2014. PARP inhibitors for BRCA1/2 mutation-associated and BRCA-like malignancies. Ann Oncol 25: 32-40.  Leela JK, Syeda AH, Anupama K, Gowrishankar J. 2013. Rho-dependent transcription termination is essential to prevent excessive genome-wide R-loops in Escherichia coli. Proc Natl Acad Sci U S A 110: 258-263. Lengauer C, Kinzler KW, Vogelstein B. 1998. Genetic instabilities in human cancers. Nature 396: 643-649. Lengauer C, Kinzler KW, Vogelstein B. 1997. Genetic instability in colorectal cancers. Nature 386: 623-627.  Li J, Lu X. 2013. The emerging roles of 3? untranslated regions in cancer. Cancer Lett 337: 22-25. Li X and Manley JL. 2005. Inactivation of the SR protein splicing factor ASF/SF2 results in genomic instability. Cell 122: 365-378. 94  Li Z, Vizeacoumar FJ, Bahr S, Li J, Warringer J, Vizeacoumar FS, Min R, Vandersluis B, Bellay J, Devit M et al. 2011. Systematic exploration of essential yeast gene function with temperature-sensitive mutants. Nat Biotechnol 29: 361-367. Licatalosi DD and Darnell RB. 2010. RNA processing and its regulation: global insights into biological networks. Nat Rev Genet 11: 75-87. Lin S, Coutinho-Mansfield G, Wang D, Pandit S, Fu XD. 2008. The splicing factor SC35 has an active role in transcriptional elongation. Nat Struct Mol Biol 15: 819-826. Lisby M, Rothstein R, Mortensen UH. 2001. Rad52 forms DNA repair and recombination centers during S phase. Proc Natl Acad Sci U S A 98: 8276-8282.  Loeb LA. 2011. Human cancers express mutator phenotypes: origin, consequences and targeting. Nat Rev Cancer 11: 450-457.  Lopez-Saavedra A, Herrera LA. 2010. The role of alternative mRNA splicing in chromosome instability. Mutat Res 705: 246-251. Luke B, Panza A, Redon S, Iglesias N, Li Z, Lingner J. 2008. The Rat1p 5? to 3? exonuclease degrades telomeric repeat-containing RNA and promotes telomere elongation in Saccharomyces cerevisiae. Mol Cell 32: 465-477. Luna R, Jimeno S, Marin M, Huertas P, Garcia-Rubio M, Aguilera A. 2005. Interdependence between transcription and mRNP processing and export, and its impact on genetic stability. Mol Cell 18: 711-722. Lutz CS. 2008. Alternative polyadenylation: a twist on mRNA 3? end formation. ACS Chem Biol 3: 609-617. Mapendano CK, Lykke-Andersen S, Kjems J, Bertrand E, Jensen TH. 2010. Crosstalk between mRNA 3? end processing and transcription initiation. Mol Cell 40: 410-422. Margaritis T, Oreal V, Brabers N, Maestroni L, Vitaliano-Prunier A, Benschop JJ, van Hooff S, van Leenen D, Dargemont C, Geli V, Holstege FC. 2012. Two distinct repressive mechanisms for histone 3 lysine 4 methylation through promoting 3?-end antisense transcription. PLoS Genet 8: e1002952. Marinello J, Chillemi G, Bueno S, Manzo SG, Capranico G. 2013. Antisense transcripts enhanced by camptothecin at divergent CpG-island promoters associated with bursts of topoisomerase I-DNA cleavage complex and R-loop formation. Nucleic Acids Res 41: 10110-10123. Martin FH, Tinoco I Jr. 1980. DNA-RNA hybrid duplexes containing oligo(dA:rU) sequences are exceptionally unstable and may facilitate termination of transcription. Nucleic Acids Res 8: 2295-2299. Martins SB, Rino J, Carvalho T, Carvalho C, Yoshida M, Klose JM, de Almeida SF, Carmo-Fonseca M. 2011. Spliceosome assembly is coupled to RNA polymerase II dynamics at the 3? end of human genes. Nat Struct Mol Biol 18: 1115-1123. 95  Matsuda E and Garfinkel DJ. 2009. Posttranslational interference of Ty1 retrotransposition by antisense RNAs. Proc Natl Acad Sci USA 106: 15657-15662. Mattick JS. 2012. Rocking the foundations of molecular genetics. Proc Natl Acad Sci U S A 109: 16400-16401. Mattick JS, Amaral PP, Dinger ME, Mercer TR, Mehler MF. 2009. RNA regulation of epigenetic processes. Bioessays 31: 51-59. Mattick JS. 2003. Challenging the dogma: the hidden layer of non-protein-coding RNAs in complex organisms. BioEssays 25: 930-939. McGowan CH. 2003. Running into problems: how cells cope with replicating damaged DNA. Mutat Res 532: 75-84. McGranahan N, Burrell RA, Endesfelder D, Novelli MR, Swanton C. 2012. Cancer chromosomal instability: therapeutic and diagnostic challenges. EMBO Rep 13: 528-538. McLellan J, O'Neil N, Tarailo S, Stoepel J, Bryan J, Rose A, Hieter P. 2009. Synthetic lethal genetic interactions that decrease somatic cell proliferation in Caenorhabditis elegans identify the alternative RFC CTF18 as a candidate cancer drug target. Mol Biol Cell 20: 5306-5313.  McManus K, Barrett I, Nouhi Y, Hieter P. 2009. Specific synthetic lethal killing of RAD54B-deficient human colorectal cancer cells by FEN1 silencing. Proc Natl Acad Sci 106: 3276-3281. Meggendorfer M, Roller A, Haferlach T, Eder C, Dicker F, Grossmann V, Kohlmann A, Alpermann T, Yoshida K, Ogawa S et al. 2012. SRSF2 mutations in 275 cases with chronic myelomonocytic leukemia (CMML). Blood 120: 3080-3088. Menezes J, Acquadro F, Perez-Pons de la Villa C, Garcia-Sanchez F, Alvarez S, Cigudosa JC. 2011. FIP1L1/RARA with breakpoint at FIP1L1 intron13: a variant translocation in acute promyelocytic leukemia. Haematologica.  Mercer TR, Gerhardt DJ, Dinger ME, Crawford J, Trapnell C, Jeddeloh JA, Mattick JS, Rinn JL. 2011. Targeted RNA sequencing reveals the deep complexity of the human transcriptome. Nat Biotechnol 30: 99-104. Merkle CJ, Karnitz LM, Henry-Sanchez JT, Chen J. 2003. Cloning and characterization of hCTF18, hCTF8, and hDCC1. Human homologs of a Saccharomyces cerevisiae complex involved in sister chromatid cohesion establishment. J Biol Chem 278: 30051-30056. Meselson M, Stahl F. The replication of DNA in Escherichia coli. Proc Natl Acad Sci 44: 671-682 Metzgeroth G, Walz C, Score J, Siebert R, Schnittger S, Haferlach C, Popp H, Haferlach T, Erben P, Mix J et al. 2007. Recurrent finding of the FIP1L1-PDGFRA fusion gene in 96  eosinophilia-associated acute myeloid leukemia and lymphoblastic T-cell lymphoma. Leukemia 21: 1183-1188.  Michaelis C, Ciosk R, Nasmyth K. 1997. Cohesins: chromosomal proteins that prevent premature separation of sister chromatids. Cell 91: 35-45. Miescher F. 1895. Letter XXXVIII to Wilhelm His. In: His W et al (eds) Die Histochemischen und Physiologischen Arbeiten von Friedrich Miescher ? Aus dem wissenschaftlichen Briefwechsel von F. Miescher, vol 1. F. C. W. Vogel, Leipzig, pp 79-80. Miescher F. 1892. Letter LXXIV to Wilhelm His. In: His W et al (eds) Die Histochemischen und Physiologischen Arbeiten von Friedrich Miescher ? Aus dem wissenschaftlichen Briefwechsel von F. Miescher, vol 1. F. C. W. Vogel, Leipzig, pp 112-116. Miescher F. 1871. Ueber die chemische Zusammensetzung der Eiterzellen. Medicinisch-chemische Untersuchungen 4: 441-460. Miescher F. 1869. Letters I and V to Wilhelm His. In: His W et al (eds) Die Histochemischen und Physiologischen Arbeiten von Friedrich Miescher ? Aus dem wissenschaftlichen Briefwechsel von F. Miescher, vol 1. F. C. W. Vogel, Leipzig, pp 33-41. Millevoi S, Vagner S. 2010. Molecular mechanisms of eukaryotic pre-mRNA 3? end processing regulation. Nucleic Acids Res 38: 2757-2774. Mischo HE, Gomez-Gonzalez B, Grzechnik P, Rondon AG, Wei W, Steinmetz L, Aguilera A, Proudfoot NJ. 2011. Yeast Sen1 helicase protects the genome from transcription-associated instability. Mol Cell 41: 21-32. Mitchison TJ, Salmon ED. 2001. Mitosis: a history of division. Nat Cell Biol 3: E17-21. Mortensen UH, Lisby M, Rothstein R. 2009. Rad52. Curr Biol 19: R676-677.  Nakama M, Kawakami K, Kajitani T, Urano T, Murakami Y. 2012. DNA-RNA hybrid formation mediates RNAi-directed heterochromatin formation. Genes Cells 17: 218-233. Naro C, Sette C. 2013. Phosphorylation-Mediated Regulation of Alternative Splicing in Cancer. Int J Cell Biol 2013: 151839. Nguyen TA, Tak YS, Lee CH, Kang YH, Cho IT, Seo YS. 2011. Analysis of subunit assembly and function of the Saccharomyces cerevisiae RNase H2 complex. FEBS J 278: 4927-4942. Nik-Zainal S, Alexandrov LB, Wedge DC, Van Loo P, Greenman CD, Raine K, Jones D, Hinton J, Marshall J, Stebbings LA et al. 2012. Mutational processes molding the genomes of 21 breast cancers. Cell 149: 979-993.  Ohkuni K, Kitagawa K. 2012. Role of transcription at centromeres in budding yeast. Transcription 3: 193-197. 97  Ohkuni K, Kitagawa K. 2011. Endogenous transcription at the centromere facilitates centromere activity in budding yeast. Curr Biol 21: 1695-1703. Oikawa K, Ohbayashi T, Kiyono T, Nishi H, Isaka K, Umezawa A, Kuroda M, Mukai K. 2004. Expression of a novel human gene, human wings apart-like (hWAPL), is associated with cervical carcinogenesis and tumor progression. Cancer Res 64: 3545-3549. Osborn AJ, Elledge SJ, Zou L. 2002. Checking on the fork: the DNA-replication stress response pathway. Trends Cell Biol 12: 509-516. Painter T. 1923. Studies in mammalian spermatogenesis, II. The spermatogenesis of man. J Exp Zool 37: 291-338. Pandey RR, Mondal T, Mohammad F, Enroth S, Redrup L, Komorowski J, Nagano T, Mancini-Dinardo D, Kanduri C. 2008. Kcnq1ot1 antisense noncoding RNA mediates lineage-specific transcriptional silencing through chromatin-level regulation. Mol Cell 32: 232-246. Papaemmanuil E, Cazzola M, Boultwood J, Malcovati L, Vyas P, Bowen D, Pellagatti A, Wainscoat JS, Hellstrom-Lindberg E, Gambacorti-Passerini C et al. 2011. Somatic SF3B1 mutation in myelodysplasia with ring sideroblasts. N Engl J Med 365: 1384-1395. Patnaik MM, Lasho TL, Finke CM, Hanson CA, Hodnefield JM, Knudson RA, Ketterling RP, Pardanani A, Tefferi A. 2013. Spliceosome mutations involving SRSF2, SF3B1, and U2AF35 in chronic myelomonocytic leukemia: prevalence, clinical correlates, and prognostic relevance. Am J Hematol 88: 201-206. Paulsen RD, Cimprich KA. 2007. The ATR pathway: fine-tuning the fork. DNA Repair (Amst) 6: 953-966. Paweletz N. 2001. Walther Flemming: pioneer of mitosis research. Nat Rev Mol Cell Biol 2: 72-75. Pfau SJ, Amon A. 2012. Chromosomal instability and aneuploidy in cancer: from yeast to man. EMBO Rep 13: 515-527. Pfeiffer V, Crittin J, Grolimund L, Lingner J. 2013. The THO complex component Thp2 counteracts telomeric R-loops and telomere shortening. EMBO J 32: 2861-2871. Philips DD, Garboczi DN, Singh K, Hu Z, LEppla SH, Leysath CE. 2013. The subnanomolar binding of DNA-RNA hybrids by the single-chain Fv fragment of antibody S9.6. J Mol Recognit 26: 376-381. Porcelli L, Quatrale AE, Mantuano P, Silvestris N, Brunetti AE, Calvert H, Paradiso A, Azzariti A. 2012. Synthetic lethality to overcome cancer drug resistance. Curr Med Chem 19: 3858-3873. Powell WT, Coulson RL, Gonzales ML, Crary FK, Wong SS, Adams S, Ach RA, Tsang P, Yamada NA, Yasui DH, Chedin F, Lasalle JM. 2013. R-loop formation at Snord116 98  mediates topotecan inhibition of Ube3a-antisense and allele-specific chromatin decondensation. Proc Natl Acad Sci U S A 110: 13938-13943. Prado F, Aguilera A. 2005. Impairment of replication fork progression mediates RNA polII transcription-associated recombination. EMBO J 24: 1267-1276.  Proudfoot NJ. 2011. Ending the message: poly(A) signals then and now. Genes Dev 25: 1770-1782. Quidville V, Alsafadi S, Goubar A, Commo F, Scott V, Pioche-Durieu C, Girault I, Baconnais S, Le Cam E, Lazar V et al. 2013. Targeting the deregulated spliceosome core machinery in cancer cells triggers mTOR blockade and autophagy.  Cancer Res 73: 2247-2258. Rajagopalan H, Lengauer C. 2004. Aneuploidy and cancer. Nature 432: 338-341. Rajesh C, Baker DK, Pierce AJ, Pittman DL. 2011. The splicing-factor related protein SFPQ/PSF interacts with RAD51D and is necessary for homology-directed repair and sister chromatid cohesion. Nucleic Acids Res 39: 132-145. Rao CV, Yamada HY. 2013. Genomic instability and colon carcinogenesis: from the perspective of genes. Front Oncol 3: 130. Reijns MA, Rabe B, Rigby RE, Mill P, Astell KR, Lettice LA, Boyle S, Leitch A, Keighren M, Kilanowski F et al. 2012. Enzymatic removal of ribonucleotides from DNA is essential for mammalian genome integrity and development. Cell 149: 1008-1022. Richter JD. 2008. Breaking the code of polyadenylation-induced translation. Cell 132: 335-337. Ricke RM, van Ree JH, van Deursen JM. 2008. Whole chromosome instability and cancer: a complex relationship. Trends Genet 24: 457-466. Rodriguez AJ, Czaplinski K, Condeelis JS, Singer RH. 2008. Mechanisms and cellular roles of local protein synthesis in mammalian cells. Curr Opin Cell Biol 20: 144-149. Rogers J, Wall R. 1984. Immunoglobulin RNA rearrangements in B lymphocyte differentiation. Adv Immunol 35: 39-59. Rondon AG, Mischo HE, Kawauchi J, Proudfoot NJ. 2009. Fail-safe transcriptional termination for protein-coding genes in S. cerevisiae. Mol Cell 36: 88-98. Rothstein R, Michel B, Gangloff S. 2000. Replication fork pausing and recombination or ?gimme a break?. Genes Dev 14: 1-10. Ruddle FH. 2004. Theophilus Painter: First steps toward an understanding of the human genome. J Exp Zool A Comp Exp Biol 301: 375-377. 99  Sakabe K, Okazaki R. 1966. A unique property of the replicating region of chromosomal DNA. Biochim Biophys Acta 129: 651-654. Schekman R, Weiner A, Kornberg A. 1974. Multienzyme systems of DNA replication. Science 186: 987-993. Schuldiner M, Collins SR, Thompson NJ, Denic V, Bhamidpati A, Punna T, Ihmels J, Andrews B, Boone C, Greenblatt JF, Weissman JS, Krogan NJ. 2005. Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile. Cell 123: 507-519. Schulze JM, Jackson J, Nakanishi S, Gardner JM, Hentrich T, Haug J, Johnston M, Jaspersen SL, Kobor MS, Shilatifard A. 2009. Linking cell cycle to histone modifications: SBF and H2B monoubiquitination machinery and cell-cycle regulation of H3K79 dimethylation. Mol Cell 35: 626-641. Santos-Pereira JM, Herrero AB, Garcia-Rubio ML, Marin A, Moreno S, Aguilera A. 2013. The Npl3 hnRNP prevents R-loop-mediated transcription-replication conflicts and genome instability. Genes Dev 27: 2445-2458. Schvartzman JM, Sotillo R, Benezra R. 2010. Mitotic chromosomal instability and cancer: mouse modelling of the human disease. Nat Rev Cancer 10: 102-115.  Scott LM, Rebel VI. 2013. Acquired Mutations That Affect Pre-mRNA Splicing in Hematologic Malignancies and Solid Tumors. J Natl Cancer Inst 105: 1540-1549. Servant G, Pinson B, Tchalikian-Cosson A, Coulpier F, Lemoine S, Pennetier C, Bridier-Nahmias A, Todeschini AL, Fayol H, Daignan-Fornier B, Lesage P. 2012. Tye7 regulates yeast Ty1 retrotransposon sense and antisense transcription in response to adenylic nucleotides stress. Nucleic Acids Res 40: 5271-5282. Shuman S. 2001. Structure, mechanism, and evolution of the mRNA capping apparatus. Prog Nucleic Acid Res Mol Biol 66: 1-40. Sieber OM, Heinimann K, Tomlinson IP. 2003. Genomic instability?the engine of tumorigenesis? Nat Rev Cancer 3:701-708. Sikdar N, Banerjee S, Zhang H, Smith S, Myung K. 2008. Spt2p defines a new transcription-dependent gross chromosomal rearrangement pathway. PLoS Genet 4: e1000290. Skourti-Stathaki K, Proudfoot NJ, Gromak N. 2011. Human senataxin resolves RNA/DNA hybrids formed at transcriptional pause sites to promote Xrn2-dependent termination. Mol Cell 42: 794-805. Smith S, Hwang JY, Banerjee S, Majeed A, Gupta A, Myung K. 2004. Mutator genes for suppression of gross chromosomal rearrangements identified by a genome-wide screening in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 101: 9039-9044.  100  Sonenberg N, Hinnerbusch AG. 2009. Regulation of translation initiation in eukaryotes: mechanisms and biological targets. Cell 136: 731-745. Soncini D, Caffa I, Patrone F, Ballestrero A, Nencioni A. 2012. Synthetic lethality-based therapeutics: perspectives for applications in colorectal cancer. Curr Cancer Drug Targets 12: 329-338.  Sordet O, Redon CE, Guirouilh-Barbat J, Smith S, Solier S, Douarre C, Conti C, Nakamura AJ, Das BB, Nicolas E et al. 2009. Ataxia telangiectasia mutated activation by transcription- and topoisomerase I-induced DNA double-strand breaks. EMBO Rep 10:887-893. Sotillo R, Hernando E, Diaz-Rodriguez E, Teruya-Feldstein J, Cordon-Cardo C, Lowe SW, Benezra R. 2007. Mad2 overexpression promotes aneuploidy and tumorigenesis in mice. Cancer Cell 11: 9-23. Spain MM, Govind CK. 2011. A role for phosphorylated Pol II CTF in modulating transcription coupled histone dynamics. Transcription 2: 78-81. Spencer F, Gerring SL, Connelly C, Hieter P. 1990. Mitotic chromosome transmission fidelity mutants in Saccharomyces cerevisiae. Genetics 124: 237-249.  Stephens PJ, McBride DJ, Lin ML, Varela I, Pleasance ED, Simpson JT, Stebbings LA, Leroy C, Edkins S, Mudie LJ et al. 2009. Complex landscapes of somatic rearrangement in human breast cancer genomes. Nature 462: 1005-1010. Stirling PC, Bloom MS, Solanki-Patil T, Smith S, Sipahimalani P, Li Z, Kofoed M, Ben-Aroya S, Myung K, Hieter P. 2011. The complete spectrum of yeast chromosome instability genes identifies candidate CIN cancer genes and functional roles for ASTRA complex components. PLoS Genet 7: e1002057. Stirling PC, Chan YA, Minaker SW, Aristizabal MJ, Barrett I, Sipahimalani P, Kobor MS, Hieter P. 2012. R-loop-mediated genome instability in mRNA cleavage and polyadenylation mutants. Genes Dev 26: 163-175. Stover EH, Chen J, Folens C, Lee BH, Mentens N, Marynen P, Williams IR, Gilliland DG, Cools J. 2006. Activation of FIP1L1-PDGFRalpha requires disruption of the juxtamembrane domain of PDGFRalpha and is FIP1L1-independent. Proc Natl Acad Sci U S A 103: 8078-8083.  Stratton MR. 2011. Exploring the Genomes of Cancer Cells: Progress and Promise. Science 331: 1553-1558. Strunnikov AV, Larionov VL, Koshland D. 1993. SMC1: an essential yeast gene encoding a putative head-rod-tail protein is required for nuclear division and defines a new ubiquitous protein family. J Cell Biol 123: 1635-1648. Sun Q, Csorba T, Skourti-Stathaki K, Proudfoot NJ, Dean C. 2013. R-loop stabilization represses antisense transcription at the Arabidopsis FLC locus. Science 340: 619-621. 101  Suraweera A, Lim Y, Woods R, Birrell GW, Nasim T, Becherel OJ, Lavin MF. 2009. Functional role for senataxin, defective in ataxia oculomotor apraxia type 2, in transcription regulation. Hum Mol Genet 18: 3384-3396. Sveen A, Agesen TH, Nesbakken A, Rognum TO, Lothe RA, Skotheim RI. 2011. Transcriptome instability in colorectal cacner identified by exon microarray analyses: Associations with splicing factor expression levels and patient survival. Genome Med 3: 32. Szilard RK, Jacques PE, Laramee L, Cheng B, Galicia S, Bataille AR, Yeung M, Mendez M, Bergeron M, Robert F et al. 2010. Systematic identification of fragile sites via genome-wide location analysis of gamma-H2AX. Nat Struct Mol Biol 17: 299-305.  Takahashi YH, Schulze JM, Jackson J, Hentrich T, Seidel C, Jaspersen SL, Kobor MS, Shilatifard A. 2011. Dot1 and histone H3K79 methylation in natural telomeric and HM silencing. Mol Cell 42: 118-126.  Tanabe S, Bohlander SK, Vignon CV, Espinosa R,3rd, Zhao N, Strissel PL, Zeleznik-Le NJ, Rowley JD. 1996. AF10 is split by MLL and HEAB, a human homolog to a putative Caenorhabditis elegans ATP/GTP-binding protein in an invins(10;11)(p12;q23q12). Blood 88: 3535-3545.  Tang Y, Horikawa I, Ajiro M, Robles AI, Fujita K, Mondal AM, Stauffer JK, Zheng ZM, Harris CC. 2013 Downregulation of splicing factor SRSF3 induces p53?, an alternatively spliced isoform of p53 that promotes cellular senescence. Oncogene 32: 2792-2798. Taylor BJ, Nik-Zainal S, Wu YL, Stebbings LA, Raine K, Campbell PJ, Rada C, Stratton MR, Neuberger MS. 2013. DNA deaminases induce break-associated mutation showers with implication of APOBEC3B and 3A in breast cancer kataegis. Elife 2: e00534. Terzi N, Churchman LS, Vasiljeva L, Weissman J, Buratowski S. 2011. H3K4 trimethylation by Set1 promotes efficient termination by the Nrd1-Nab3-Sen1 pathway. Mol Cell Biol 31: 3569-3583. Thomas M, White RL, Davis RW. 1976. Hybridization of RNA to double-stranded DNA: formation of R-loops. Proc Natl Acad Sci U S A 73: 2294-2298. Thompson SL, Compton DA. 2011. Chromosomes and cancer cells. Chromosome Res 19: 433-444. Tijo J, Levan A. 1956. The chromosome number in man. Hereditas 42: 1-6. Tong AH, Lesage G, Bader GD, Ding H, Xu H, Xin X, Young J, Berriz GF, Brost RL, Chang M et al. 2004. Global mapping of the yeast genetic interaction network. Science 303: 808-813.  Tong AH, Evangelista M, Parsons AB, Xu H, Bader GD, Page N, Robinson M, Raghibizadeh S, Hogue CW, Bussey H et al. 2001. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science 294: 2364-2368. 102  Tous C, Rondon AG, Garcia-Rubio M, Gonzalex-Aguilera C, Luna R, Aguilera A. 2011. A novel assay identifies transcript elongation roles for the Nup84 complex and RNA processing factors. EMBO J 30: 1953-1964. Tuduri S, Crabbe L, Conti C, Tourriere H, Holtgreve-Grez H, Jauch A, Pantesco V, De Vos J, Thomas A, Theillet C et al. 2009. Topoisomerase I suppresses genomic instability by preventing interference between replication and transcription. Nat Cell Biol 11: 1315-1324.  Tufarelli C, Stanley JA, Garrick D, Sharpe JA, Ayyub H, Wood WG, Higgs DR. 2003. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nat Genet 34: 157-165. Turner M. 2011. Is transcription the dominant force during dynamic changes in gene expression. Adv Exp Med Biol 780: 1-13. Ursic D, Himmel KL, Gurley KA, Webb F, Culbertson MR. 1997. The yeast SEN1 gene is required for processing of diverse RNA classes. Nucleic Acids Res 25: 4778-4785. Van Dijk EL, Chen CL, d?Aubenton-Carafa Y, Gourvennec S, Kwapisz M, Roche V, Bertrand C, Silvain M, Legoix-Ne P, Loeillet S, Nicolas A, Thermes C, Morillon A. 2011. XUTs are a class of Xrn1-sensitive antisense regulatory non-coding RNA in yeast. Nature 475: 114-117. Van Werven FJ, Neuert G, Hendrick N, Lardenois A, Buratowski S, van Oudenaarden A, Primig M, Amon A. 2012. Transcription of two long noncoding RNAs mediates mating-type control of gametogenesis in budding yeast. Cell 150: 1170-1181. Veatch JR, McMurray MA, Nelson ZW, Gottchling DE. 2009. Mitochondrial dysfunction leads to nuclear genome instability via an iron-sulfer cluster defect. Cell 137: 1247-1258. Vogelstein B, Kinzler KW. 2004. Cancer genes and the pathways they control. Nat Med 10: 789-799. Wahba L, Amon JD, Koshland D, Vuica-Ross M. 2011. RNase H and multiple RNA biogenesis factors cooperate to prevent DNA:RNA hybrids from generating genome instability. Mol Cell 44: 978-988. Wahba L and Koshland D. 2013. The Rs of Biology: R-Loops and the Regulation of Regulators. Mol Cell 50: 611-612. Wahba L, Gore SK, Koshland D. 2013. The homologous recombination machinery modulates the formation of RNA-DNA hybrids and associated chromosome instability. Elife 2: e00505. Wang ET, Sandberg R, Luo S, Khrebtukova I, Zhang L, Mayr C, Kingsmore SF, Schroth GP, Burge CB. 2008. Alternative isoform regulation in human tissue transcriptomes. Nature 456: 470-476. 103  Wang AY, Aristizabal MJ, Ryan C, Krogan NJ, Kobor MS. 2011a. Key functional regions in the histone variant H2A.Z C-terminal docking domain. Mol Cell Biol 31: 3871-3884. Wang L, Lawrence MS, Wan Y, Stojanov P, Sougnez C, Stevenson K, Werner L, Sivachenko A, DeLuca DS, Zhang L et al. 2011b. SF3B1 and other novel cancer genes in chronic lymphocytic leukemia. N Engl J Med 365: 2497-2506.  Watrin E, Schleiffer A, Tanaka K, Eisenhaber F, Nasmyth K, Peters JM. 2006. Human Scc4 is required for cohesion binding to chromatin, sister-chromatid cohesion and mitotic progression. Curr Biol 16: 863-874. Watson JD, Crick FH. 1953. Molecular structure of nucleic acids; a structure for deoxyribose nucleic acid. Nature 171: 737-738. Weaver BA, Silk AD, Montagna C, Verdier-Pinard P, Cleveland DW. 2007. Aneuploidy acts both oncogenically and as a tumor suppressor. Cancer Cell 11: 25-36. Weaver BA, Cleveland DW. 2006. Does aneuploidy cause cancer? Curr Opin Cell Biol 18: 658-667. Weng MT, Lee JH, Wei SC, Li Q, Shahamatdar S, Hsu D, Schetter AJ, Swatkoski S, Mannan P, Garfield S et al. 2012. Evolutionarily conserved protein ERH controls CENP-E mRNA splicing and is required for the survival of KRAS mutant cancer cells. Proc Natl Acad Sci U S A 109: E3659-3667. West S, Gromak N, Proudfoot NJ. 2004. Human 5? ? 3? exonuclease Xrn2 promotes transcription termination at co-transcriptional cleavage sites. Nature 432: 522-525. Williams DR, McIntosh JR. 2002. mcl1+, the Schizosaccharomyces pombe homologue of CTF4, is important for chromosome replication, cohesion, and segregation. Eukaryot Cell 1:758-773. Winzeler EA, Shoemaker DD, Astromoff A, Liang H, Anderson K, Andre B, Bangham R, Benito R, Boeke JD, Bussey H et al. 1999. Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 285: 901-906. Wongsurawat T, Jenjaroenpun P, Kwoh CK, Kuznetsov V. 2012. Quantitative model of R-loop forming structures reveals a novel level of RNA-DNA interactome complexity. Nucleic Acids Res 40: e16. Xu Z, Wei W, Gagneur J, Perocchi F, Clauder-Munster S, Camblong J, Guffanti E, Stutz F, Huber W, Steinmetz LM. 2009. Bidirectional promoters generate pervasive transcription in yeast. Nature 457: 1033-1037. Xu Z, Wei W, Gagneur J, Clauder-Munster S, Smolik M, Huber W, Steinmetz LM. 2011. Antisense expression increases gene expression variability and locus interdependency. Mol Syst Biol 15: 468.  104  Yang HW, Kim TM, Song SS, Shrinath N, Park R, Kalamarides M, Park PJ, Black PM, Carroll RS, Johnson MD. 2012. Alternative splicing of CHEK2 and codeletion with NF2 promote chromosomal instability in meningioma. Neoplasia 14: 20-28. Yassour M, Pfiffner J, Levin JZ, Adiconis X, Gnirke A, Nusbaum C, Thompson DA, Friedman N, Regev A. 2010. Strand-specific RNA sequencing reveals extensive regulated long antisense transcripts that are conserved across yeast species. Genome Biol 11: R87.  Yoshida K, Sanada M, Shiraishi Y, Nowak D, Nagata Y, Yamamoto R, Sato Y, Sato-Otsubo A, Kon A, Nagasaki M et al. 2011. Frequent pathway mutations of splicing machinery in myelodysplasia. Nature 478: 64-69. Young BP, Loewen CJ. 2013. Balony: a software package for analysis of data generated by synthetic genetic array experiments. BMC Bioinformatics 14: 354. Yuen KW, Warren CD, Chen O, Kwok T, Hieter P, Spencer FA. 2007. Systematic genome instability screens in yeast and their potential relevance to cancer. Proc Natl Acad Sci U S A 104: 3925-3930.  Zhai W, Comai L. 2000. Repression of RNA polymerase I transcription by the tumor suppressor p53. Mol Cell Biol 20: 5930-5938. Zhang H, Lee JY, Tian B. 2005. Biased alternative polyadenylation in human tissues. Genome Biol 6: R100. 105  Appendix   Figure A1. Plot of mock WT sample (no antibody) normalized to input in the rDNA region and telomeric ends of chromosome XII. Bars indicate ORFs (grey), rDNA (purple), retrotransposons (green) or ORFs associated with an antisense transcript (red; Xu et al. 2011). Grey boxes delineate telomeric repeat regions. Y-axis indicates relative occupancy of DNA:RNA hybrids. X-axis indicates chromosome coordinates. The mock sample did not show significant enrichment of rRNA, tRNAs, snoRNAs, retrotransposons, telomeres or antisense-associated ORFs.  Relative DNA:RNA hybrid occupancy 106    A    107  B   Figure A2. (A) Distribution of % GC content of all ORFs sorted by transcriptional frequency. (B) Distribution of % GC content of ORFs enriched for DNA:RNA hybrids in WT sorted by transcriptional frequency. Intervals indicate 95% confidence intervals. 108  Table A1 Yeast strains used in Chapter 2 YPH number Relevant Genotype Source BY4741 MATa ura3?0 leu2?0 his3?1 met15?0 Jef Boeke SB1 MAT? can1? mfa1?::MFA1pr-HIS3 his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 Ben-aroya et al., 2008 YPH1015 MATa ura3-52 lys2-801 ade2-101 leu2?1 his3?200 CFIII(CEN3.L)::HIS3 SUP11 ctf13-30 Stirling et al. 2011 YPH2087 MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 pcf11-2::KanMX Stirling et al. 2011 YPH2088 MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 pcf11-10::KanMX Stirling et al. 2011 YPH2089 MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 rna15-58::KanMX Stirling et al. 2011 YPH2090 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 clp1-ts::URA3 Stirling et al. 2011 YPH2091 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 fip1-ts::URA3 Stirling et al. 2011 YPH2092 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 cft2-ts::URA3 Stirling et al. 2011 YPH2093 MAT? his3?1 ura3?0 leu2?0 pcf11-2::KanMX Stirling et al. 2011 YPH2094 MAT? his3?1 ura3?0 leu2?0 pcf11-10::KanMX Stirling et al. 2011 YPH2095 MAT? his3?1 ura3?0 leu2?0 lys2?0 rna15-58::KanMX Stirling et al. 2011 YPH2096 MAT? his3?1 ura3?0 leu2?0 lys2?0 clp1-ts::URA3 Stirling et al. 2011 YPH2097 MAT? can1?::MFA1pr-HIS3::LEU2 his3?1 ura3?0 leu2?0 lys2?0 fip1-ts::URA3 Stirling et al. 2011 YPH2098 MAT? can1?::MFA1pr-HIS3::LEU2 his3?1 ura3?0 leu2?0 cft2-ts::URA3 Stirling et al. 2011 YPH2099 MATa/? ura3?0/ura3?0 leu2?0/leu2?0 his3?1/his3?1 pcf11-2::KanMX/pcf11-2::KanMX Stirling et al. 2011 YPH2100 MATa/? ura3?0/ura3?0 leu2?0/leu2?0 his3?1/his3?1 pcf11-10::KanMX/pcf11-10::KanMX Stirling et al. 2011 YPH2101 MATa/? ura3?0/ura3?0 leu2?0/leu2?0 his3?1/his3?1 lys2?0/LYS2 rna15-58::KanMX/rna15-58::KanMX Stirling et al. 2011 YPH2102 MATa/? can1?::MFA1pr-HIS3::LEU2 ura3?0/ura3?0 leu2?0/leu2?0 his3?1/his3?1 Stirling et al. 2011 109  YPH number Relevant Genotype Source lys2?0/lys2?0 clp1-ts::URA3/clp1-ts::URA3 YPH2103 MATa/? can1?::MFA1pr-HIS3::LEU2 ura3?0/ura3?0 leu2?0/leu2?0 his3?1/his3?1 lys2?0/lys2?0 fip1-ts::URA3/fip1-ts::URA3 Stirling et al. 2011 YPH2104 MATa/? can1?::MFA1pr-HIS3::LEU2 ura3?0/ura3?0 leu2?0/leu2?0 his3?1/his3?1 lys2?0/LYS2 cft2-ts::URA3/cft2-ts::URA3 Stirling et al. 2011 YPH2105 MATa his3?1 ura3?0 leu2?0 pcf11-2::NatMX Stirling et al. 2011 YPH2106 MATa his3?1 ura3?0 leu2?0  pcf11-10::NatMX Stirling et al. 2011 YPH2107 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 ura3?0 leu2?0 lys2?0 cft2-ts::URA3 Stirling et al. 2011 YPH2108 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 ura3?0 leu2?0 lys2?0 clp1-ts::URA3 Stirling et al. 2011 YPH2109 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 ura3?0 leu2?0 lys2?0 fip1-ts::URA3 Stirling et al. 2011 YPH2110 MATa his3?1 ura3?0 leu2?0 rna15-58::NatMX Stirling et al. 2011 YPH2111 MATa ura3?0 leu2?0 his3?1 rnh1?::KanMX rnh201?::KanMX Stirling et al. 2011 YPH2112 MAT? ura3?0 leu2?0 his3?1 rnh1?::KanMX rnh201?::KanMX Stirling et al. 2011 YPH2113 MAT? ura3?0 leu2?0 his3?1 rnh1?::KanMX rnh201?::KanMX pcf11-2::NatMX Stirling et al. 2011 YPH2114 MAT? ura3?0 leu2?0 his3?1 rnh1?::KanMX rnh201?::KanMX pcf11-10::NatMX Stirling et al. 2011 YPH2115 MAT? ura3?0 leu2?0 his3?1 rnh1?::KanMX rnh201?::KanMX lys2?0 clp1-ts::URA3 Stirling et al. 2011 YPH2116 MAT? ura3?0 leu2?0 his3?1 rnh1?::KanMX rnh201?::KanMX can1?::MFA1pr-HIS3::LEU2 fip1-ts::URA3 Stirling et al. 2011 YPH2117 MAT? ura3?0 leu2?0 his3?1 rnh1?::KanMX rnh201?::KanMX lys2?0 cft2-ts::URA3 Stirling et al. 2011 YPH2118 MAT? ura3?0 leu2?0 his3?1 rnh1?::KanMX rnh201?::KanMX rna15-58::NatMX Stirling et al. 2011 SB182 MAT? ura3?0 leu2?0 his3?0 lys2?0 bim1?::KanMX Ben-aroya et al., 2008 SB181 MATa/? ura3?0/ura3?0 leu2?0/leu2?0 lys2?0/LYS2 met15?0/MET15 chl1?::KanMX/chl1?::KanMX Ben-aroya et al., 2008 YPH2232 MAT? ura3?0 leu2?0 his3?0 lys2?0 thp2?::KanMX Open Biosystems   110  Table A2. CIN phenotypes of mCP, THO, SEN1 and RTT103 mutants. Assay temperature is indicated beside the CTF scores, ALF and BiM assays were conducted at 30?C unless indicated. >2-fold differences are marked with bold.  Chromosome Transmission Fidelity A-like Faker BiMater Strain % of colonies with visible sector Fold change in median colony number Fold change in median colony number WT 1% (34?C) 1.00 1.00 ctf13-30 (Ctf control) 40% (34?C) - - chl1?/chl1? (BiM control) - - 8.00 bim1? (ALF control) - 11.00 - cft2-ts 21% (32?C) 3.00 1.10 clp1-ts 43% (32?C) 6.00 4.00 fip1-ts 44% (30?C) 3.33 1.40 pcf11-2 85% (30?C) 2.67 8.00 pcf11-10 63% (30?C) 2.67 1.70 rna15-58 63% (30?C) 2.33 6.00 rnh1?rnh201? - 5.56 -  111  Table A3 Yeast strains used in Chapter 3 YPH no. Relevant Genotype Source BY4741 MATa ura3?0 leu2?0 his3?1 met15?0 Jef Boeke YPH2111 MATa ura3?0 leu2?0 his3?1 rnh1?::KanMX rnh201?::KanMX Stirling et al. 2012 YPH2233 MATa ura3?0 leu2?0 his3?0 sen1-1::KanMX Li et al. 2011 YPH2598 MATa ura3?0 leu2?0 his3?1 hpr1?::KanMX  Derived from the hpr1?/HPR1 heterozygous diploid strain from the yeast heterozygous diploid collection (Open Biosystems) YPH2599 MATa ura3?0 leu2?0 his3?0 mot1-1033::KanMX Li et al. 2011 YPH2600 MATa ura3?0 leu2?0 his3?0 taf5-20:KanMX Li et al. 2011 YPH2601 MATa ura3?0 leu2?0 his3?0 cdc36-16::KanMX Li et al. 2011 YPH2602 MATa ura3?0 leu2?0 his3?0 pti1-ts7KanMX Li et al. 2011 YPH2603 MATa ura3?0 leu2?0 his3?0 cet1-2::KanMX Li et al. 2011 YPH2604 MATa ura3?0 leu2?0 his3?0 hrp1-4::KanMX Li et al. 2011 YPH2605 MATa ura3?0 leu2?0 his3?0 sub2-1::KanMX Li et al. 2011 YPH2606 MATa ura3?0 leu2?0 his3?0 rna1-1::KanMX Li et al. 2011 YPH2607 MATa ura3?0 leu2?0 his3?0 srm1-ts::KanMX Li et al. 2011 YPH2608 MATa ura3?0 leu2?0 his3?0 brl1-2221:KanMX Li et al. 2011 YPH2609 MATa ura3?0 leu2?0 his3?0 snu13-L67W::KanMX Li et al. 2011 YPH2610 MATa ura3?0 leu2?0 his3?0 rpf1-1::KanMX Li et al. 2011 YPH2611 MATa ura3?0 leu2?0 his3?0 imp4-2::KanMX Li et al. 2011 YPH2612 MATa ura3?0 leu2?0 his3?0 yhc1-1::KanMX Li et al. 2011 YPH2613 MATa ura3?0 leu2?0 his3?0 prp31-1::KanMX Li et al. 2011 YPH2614 MATa ura3?0 leu2?0 his3?0 snu114-60::KanMX Li et al. 2011 YPH2615 MATa ura3?0 leu2?0 his3?0 prp6-1::KanMX Li et al. 2011 YPH2616 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 dis3?0 rrp4-ts::URA3 Ben-aroya et al. 2008 YPH2617 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 rrp4-ts::URA3 Ben-aroya et al. 2008 YPH2618 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 dbp6-ts::URA3 Ben-aroya et al. 2008 112  YPH no. Relevant Genotype Source YPH2619 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 snp1-ts::URA3 Ben-aroya et al. 2008 YPH2620 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 aar2-ts::URA3 Ben-aroya et al. 2008 YPH2621 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 dib1-ts::URA3 Ben-aroya et al. 2008 YPH2622 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 spp381-ts::URA3 Ben-aroya et al. 2008 YPH2623 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 spp382-ts::URA3 Ben-aroya et al. 2008 YPH2624 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 cwc2-ts::URA3 Ben-aroya et al. 2008 YPH2625 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 lsm2-ts::URA3 Ben-aroya et al. 2008 YPH2626 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 hsh155-ts::URA3 Ben-aroya et al. 2008 YPH2627 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 msl5-ts::URA3 Ben-aroya et al. 2008 YPH2628 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 syf1-ts::URA3 Ben-aroya et al. 2008 YPH2629 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 sts1-ts::URA3 Ben-aroya et al. 2008 YPH2630 MATa can1?::MFA1pr-HIS3::LEU2 his3?1 met15?0 kae1-ts::URA3 Ben-aroya et al. 2008 YPH2631 MATa ura3?0 leu2?0 his3?0 lys2?0 dbp7?::KanMX Open Biosystems YPH2632 MATa ura3?0 leu2?0 his3?0 lys2?0 ssf1?::KanMX Open Biosystems YPH2633 MATa ura3?0 leu2?0 his3?0 lys2?0 mud2?::KanMX Open Biosystems YPH2634 MATa ura3?0 leu2?0 his3?0 lys2?0 snu66?::KanMX Open Biosystems YPH2635 MATa ura3?0 leu2?0 his3?0 lys2?0 psh1?::KanMX Open Biosystems YPH2636 MATa ura3?0 leu2?0 his3?0 lys2?0 esc2?::KanMX Open Biosystems YPH2637 MATa ura3?0 leu2?0 his3?0 lys2?0 rnh1?::KanMX Open Biosystems YPH2638 MATa ura3?0 leu2?0 his3?0 lys2?0 sds3?::KanMX Open Biosystems YPH2639 MATa ura3?0 leu2?0 his3?0 lys2?0 nup133?::KanMX Open Biosystems  113  Table A4 Description of DRIP-chip profiles in wild type, rnh1?rnh201?, hpr1? and sen1-1  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 Number of peaks above threshold 2.5 2517 3460 3896 3531 3194 4001 4326 4004 Total number of base pairs covered in peaks above threshold 2.5 1049781 1415458 1476476 1326116 1576996 1818072 2040008 2050164 % of Saccharomyces cerevisiae genome covered based on above 8.4 11.3 11.8 10.6 12.6 14.5 16.3 16.4 Average peak width in base pairs 417 409 379 376 494 454 472 512  114  Table A5 List of rDNA enriched for DNA:RNA hybrids  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 ETS2-1 ETS2-1 ETS2-1 ETS2-1 ETS2-1 RDN25-1 RDN25-1 ETS2-1 RDN25-1 RDN25-1 RDN25-1 RDN25-1 RDN25-1 ITS2-1 ITS2-1 RDN25-1 ITS2-1 ITS2-1 ITS2-1 ITS2-1 ITS2-1 RDN58-1 RDN58-1 ITS2-1 RDN58-1 RDN58-1 RDN58-1 RDN58-1 RDN58-1 ITS1-1 ITS1-1 RDN58-1 ITS1-1 ITS1-1 ITS1-1 ITS1-1 ITS1-1 RDN18-1 RDN18-1 ITS1-1 RDN18-1 RDN18-1 RDN18-1 RDN18-1 RDN18-1 RDN37-1 RDN37-1 RDN18-1 RDN37-1 RDN37-1 RDN37-1 RDN37-1 RDN37-1 ETS1-1 ETS1-1 RDN37-1 ETS1-1 ETS1-1 ETS1-1 ETS1-1 ETS1-1 NTS2-1 NTS2-1 ETS1-1 RDN5-1 NTS2-1 NTS2-1 NTS2-1 NTS2-1 RDN5-1 RDN5-1 NTS2-1 NTS1-2 RDN5-1 RDN5-1 RDN5-1 RDN5-1 NTS1-2 NTS1-2 RDN5-1 ETS2-2 NTS1-2 NTS1-2 NTS1-2 NTS1-2 ETS2-2 ETS2-2 NTS1-2 RDN25-2 ETS2-2 ETS2-2 ETS2-2 ETS2-2 RDN25-2 RDN25-2 ETS2-2 ITS2-2 RDN25-2 RDN25-2 RDN25-2 RDN25-2 ITS2-2 ITS2-2 RDN25-2 RDN58-2 ITS2-2 ITS2-2 ITS2-2 ITS2-2 RDN58-2 RDN58-2 ITS2-2 ITS1-2 RDN58-2 RDN58-2 RDN58-2 RDN58-2 ITS1-2 ITS1-2 RDN58-2 RDN18-2 ITS1-2 ITS1-2 ITS1-2 ITS1-2 RDN18-2 RDN18-2 ITS1-2 RDN37-2 RDN18-2 RDN18-2 RDN18-2 RDN18-2 RDN37-2 RDN37-2 RDN18-2 ETS1-2 RDN37-2 RDN37-2 RDN37-2 RDN37-2 ETS1-2 ETS1-2 RDN37-2 RDN5-2 ETS1-2 ETS1-2 ETS1-2 ETS1-2 NTS2-2 NTS2-2 ETS1-2 RDN5-3 NTS2-2 NTS2-2 NTS2-2 NTS2-2 RDN5-2 RDN5-2 NTS2-2 RDN5-4 RDN5-2 RDN5-2 RDN5-2 RDN5-2 RDN5-3 RDN5-3 RDN5-2 RDN5-5 RDN5-3 RDN5-3 RDN5-3 RDN5-3 RDN5-4 RDN5-4 RDN5-3 RDN5-6 RDN5-4 RDN5-4 RDN5-4 RDN5-4 RDN5-5 RDN5-5 RDN5-4  RDN5-5 RDN5-5 RDN5-5 RDN5-5 RDN5-6 RDN5-6 RDN5-5  RDN5-6 RDN5-6 RDN5-6 RDN5-6   RDN5-6  115  Table A6 List of telomeric repeat regions enriched for DNA:RNA hybrids  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 TEL01L TEL01L TEL01L TEL01L TEL01L TEL01L TEL01L TEL01L TEL02L TEL02L TEL02L TEL02L TEL02L TEL02L TEL02L TEL02L TEL03L TEL03L TEL03L TEL03L TEL03L TEL04L TEL03L TEL03L TEL04L TEL04L TEL04L TEL04L TEL04L TEL04R TEL04L TEL04L TEL04R TEL04R TEL05L TEL04R TEL04R TEL05L TEL04R TEL04R TEL05L TEL05L TEL06L TEL05L TEL05L TEL05R TEL05L TEL05L TEL05R TEL05R TEL07L TEL05R TEL05R TEL06L TEL05R TEL05R TEL06L TEL06L TEL08L TEL06L TEL06L TEL07L TEL06L TEL06L TEL07L TEL07L TEL09L TEL07L TEL07L TEL07R TEL07L TEL07L TEL07R TEL07R TEL10L TEL07R TEL07R TEL08L TEL07R TEL07R TEL08L TEL08L TEL11L TEL08L TEL08L TEL08R TEL08L TEL08L TEL08R TEL08R TEL12L TEL09L TEL08R TEL09L TEL08R TEL08R TEL09L TEL09L TEL13L TEL10L TEL09L TEL10L TEL09L TEL09L TEL10L TEL10L TEL14L TEL11L TEL10L TEL11L TEL10L TEL10L TEL11L TEL11L TEL15L TEL12L TEL11L TEL12L TEL11L TEL11L TEL12L TEL12L TEL16L TEL12R TEL12L TEL12R TEL12L TEL12L TEL12R TEL12R TEL16R TEL13L TEL12R TEL13L TEL12R TEL12R TEL13L TEL13L  TEL14L TEL13L TEL14L TEL13L TEL13L TEL14L TEL14L  TEL15L TEL14L TEL15R TEL14L TEL14L TEL15L TEL15L  TEL15R TEL15L TEL16L TEL15L TEL15L TEL15R TEL15R  TEL16L TEL15R TEL16R TEL15R TEL15R TEL16L TEL16L  TEL16R TEL16L  TEL16L TEL16L TEL16R TEL16R   TEL16R  TEL16R TEL16R  116  Table A7 List of retrotransposons enriched for DNA:RNA hybrids  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YARCTy1-1 YARCTy1-1 YARCTy1-1 YARCTy1-1 YARCTy1-1 YARCTy1-1 YARCTy1-1 YARCTy1-1 YDRCTy2-1 YBLWTy1-1 YBLWTy1-1 YCLWTy5-1 YBLWTy1-1 YBRWTy1-2 YBLWTy2-1 YBLWTy2-1 YDRCTy1-1 YBRWTy1-2 YBRWTy1-2 YDRCTy2-1 YBRWTy1-2 YCLWTy5-1 YBLWTy1-1 YBLWTy1-1 YDRCTy1-2 YDRCTy1-1 YCLWTy5-1 YDRCTy1-1 YCLWTy5-1 YDRCTy2-1 YBRWTy1-2 YBRWTy1-2 YDRCTy1-3 YDRCTy1-2 YDRCTy1-1 YDRCTy1-2 YDRCTy2-1 YDRCTy1-1 YCLWTy5-1 YCLWTy5-1 YDRWTy1-4 YDRCTy1-3 YDRCTy1-2 YDRCTy1-3 YDRCTy1-1 YDRCTy1-2 YCLWTy2-1 YCLWTy2-1 YERCTy1-1 YDRWTy1-4 YDRCTy1-3 YERCTy1-1 YDRCTy1-2 YDRCTy1-3 YDRCTy2-1 YDRCTy2-1 YERCTy1-2 YDRWTy1-5 YDRWTy1-4 YERCTy1-2 YDRCTy1-3 YDRWTy1-4 YDRCTy1-1 YDRCTy1-1 YGRWTy1-1 YERCTy1-1 YDRWTy1-5 YGRCTy1-2 YDRWTy1-4 YDRWTy1-5 YDRWTy2-2 YDRWTy2-2 YGRCTy1-2 YERCTy1-2 YERCTy1-1 YGRCTy2-1 YDRWTy1-5 YERCTy1-1 YDRCTy1-2 YDRCTy1-2 YGRCTy2-1 YGRWTy1-1 YERCTy1-2 YGRCTy1-3 YERCTy1-1 YERCTy1-2 YDRWTy2-3 YDRWTy2-3 YGRCTy1-3 YGRCTy1-2 YGRWTy1-1 YHRCTy1-1 YERCTy1-2 YGRWTy1-1 YDRCTy1-3 YDRCTy1-3 YHRCTy1-1 YGRCTy1-3 YGRCTy1-2 YLRCTy1-1 YGRWTy1-1 YGRCTy1-2 YDRWTy1-4 YDRWTy1-4 YJRWTy1-1 YHRCTy1-1 YGRCTy1-3 YLRCTy2-2 YGRCTy1-2 YGRCTy2-1 YDRWTy1-5 YDRWTy1-5 YLRCTy1-1 YJRWTy1-1 YHRCTy1-1 YMRCTy1-3 YGRCTy2-1 YGRCTy1-3 YERCTy1-1 YERCTy1-1 YLRWTy1-2 YJRWTy1-2 YJRWTy1-1 YMRCTy1-4 YGRCTy1-3 YHRCTy1-1 YERCTy1-2 YERCTy1-2 YLRCTy2-2 YLRCTy1-1 YJRWTy1-2 YNLCTy1-1 YHRCTy1-1 YJRWTy1-1 YFLWTy2-1 YFLWTy2-1 YMLWTy1-1 YLRWTy1-2 YLRCTy1-1 YNLCTy2-1 YJRWTy1-1 YJRWTy1-2 YGRWTy1-1 YGRWTy1-1 YMLWTy1-2 YLRWTy1-3 YLRWTy1-2 YORCTy2-1 YJRWTy1-2 YLRCTy1-1 YGRCTy1-2 YGRCTy1-2 YMRCTy1-3 YMLWTy1-1 YLRWTy1-3 YPRCTy1-2 YLRCTy1-1 YLRWTy1-2 YGRCTy2-1 YGRCTy2-1 YMRCTy1-4 YMLWTy1-2 YMLWTy1-1 YPRCTy1-4 YLRWTy1-2 YLRWTy1-3 YGRWTy2-2 YGRWTy3-1 YNLCTy1-1 YMRCTy1-3 YMLWTy1-2  YLRWTy1-3 YLRCTy2-2 YGRCTy1-3 YGRWTy2-2 YNLWTy1-2 YMRCTy1-4 YMRCTy1-3  YLRCTy2-2 YMLWTy1-1 YHRCTy1-1 YGRCTy1-3 YNLCTy2-1 YNLCTy1-1 YMRCTy1-4  YMLWTy1-1 YMLWTy1-2 YJRWTy1-1 YHRCTy1-1 YORWTy1-2 YNLWTy1-2 YNLCTy1-1  YMLWTy1-2 YMRCTy1-3 YJRWTy1-2 YILWTy3-1 YORCTy2-1 YOLWTy1-1 YNLWTy1-2  YMRCTy1-3 YMRCTy1-4 YLRCTy1-1 YJRWTy1-1 YPLWTy1-1 YORWTy1-2 YOLWTy1-1  YMRCTy1-4 YNLCTy1-1 YLRWTy1-2 YJRWTy1-2 117  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YPRCTy1-2 YPLWTy1-1 YORWTy1-2  YNLCTy1-1 YNLWTy1-2 YLRWTy1-3 YLRCTy1-1 YPRWTy1-3 YPRCTy1-2 YPLWTy1-1  YNLWTy1-2 YNLCTy2-1 YLRWTy2-1 YLRWTy1-2 YPRCTy1-4 YPRWTy1-3 YPRCTy1-2  YNLCTy2-1 YOLWTy1-1 YLRCTy2-2 YLRWTy1-3  YPRCTy1-4 YPRWTy1-3  YOLWTy1-1 YORWTy1-2 YMLWTy1-1 YLRWTy2-1   YPRCTy1-4  YORWTy1-2 YORCTy2-1 YMLWTy1-2 YLRCTy2-2     YORCTy2-1 YPLWTy1-1 YMRCTy1-3 YMLWTy1-1     YPLWTy1-1 YPRCTy1-2 YMRCTy1-4 YMLWTy1-2     YPRCTy1-2 YPRWTy1-3 YNLCTy1-1 YMRCTy1-3     YPRWTy1-3 YPRCTy1-4 YNLWTy1-2 YMRCTy1-4     YPRCTy1-4  YNLCTy2-1 YNLCTy1-1       YOLWTy1-1 YNLWTy1-2       YORWTy1-2 YNLCTy2-1       YORCTy2-1 YOLWTy1-1       YORWTy2-2 YORWTy1-2       YPLWTy1-1 YORCTy2-1       YPRCTy1-2 YORWTy2-2       YPRWTy1-3 YPLWTy1-1       YPRCTy1-4 YPRCTy1-2        YPRWTy1-3        YPRCTy1-4  118  Table A8 List of ORFs enriched for DNA:RNA hybrids  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YAL069W YAL069W YAL069W YAL069W YAL069W YAL069W YAL069W YAL069W YAL068C YAL063C-A YAL068C YAL068C YAL068W-A YAL068W-A YAL068C YAL068C YAL063C YAL062W YAL038W YAL064C-A YAL068C YAL068C YAL063C YAL065C YAR050W YAL038W YAL037C-B YAL063C-A YAL064W-B YAL064W-B YAL055W YAL064W-B YAR068W YAL037C-B YAL036C YAL053W YAL064C-A YAL064C-A YAL046C YAL063C YBL113W-A YAL013W YAL012W YAL038W YAL063C YAL064W YAL038W YAL062W YBL113C YAL012W YAL005C YAL037C-B YAL053W YAL063C YAL037C-B YAL061W YBL112C YAL004W YAL003W YAL029C YAL038W YAL053W YAL036C YAL060W YBL111C YAL005C YAR050W YAL005C YAL037C-B YAL038W YAL035W YAL055W YBL109W YAL003W YAR068W YAL001C YAL029C YAL037C-B YAL030W YAL044C YBL078C YAR028W YBL113W-A YAR028W YAL026C YAL034C YAL025C YAL038W YBL056W YAR029W YBL113C YBL113W-A YAL021C YAL030W YAL013W YAL037C-B YBL055C YAR042W YBL112C YBL113C YAL013W YAL004W YAL011W YAL036C YBR006W YAR050W YBL111C YBL112C YAL005C YAL005C YAL005C YAL030W YBR011C YAR066W YBL109W YBL111C YAR029W YAR003W YAL003W YAL016C-A YBR021W YAR068W YBL092W YBL109W YAR050W YAR028W YAR015W YAL013W YBR067C YBL113W-A YBL076C YBL108C-A YAR068W YAR050W YAR023C YAL005C YBR069C YBL113C YBL072C YBL098W YAR073W YAR073W YAR042W YAL003W YBR071W YBL112C YBL062W YBL092W YAR075W YAR075W YAR050W YAR002C-A YBR093C YBL111C YBL053W YBL090W YBL113W-A YBL113W-A YAR068W YAR015W YBR104W YBL109W YBL028C YBL084C YBL113C YBL113C YBL113W-A YAR023C YBR122C YBL107W-A YBL003C YBL076C YBL112C YBL112C YBL113C YAR027W YBR134W YBL092W YBR026C YBL007C YBL111C YBL111C YBL112C YAR033W YBR149W YBL081W YBR031W YBL003C YBL109W YBL109W YBL111C YAR042W YBR157C YBL055C YBR064W YBR009C YBL108C-A YBL108C-A YBL109W YAR050W 119  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YBR167C YBL054W YBR071W YBR011C YBL099W YBL076C YBL108C-A YAR068W YBR173C YBR011C YBR078W YBR115C YBL062W YBL062W YBL107W-A YBL113W-A YBR187W YBR016W YBR115C YBR196C YBL053W YBL061C YBL092W YBL113C YBR197C YBR067C YBR116C YCL076W YBL051C YBL058W YBL091C-A YBL112C YBR221W-A YBR069C YBR118W YCL066W YBL047C YBL056W YBL090W YBL111C YCL055W YBR071W YBR121C-A YCL064C YBL007C YBL055C YBL081W YBL109W YCL049C YBR093C YBR121C YCL050C YBR031W YBL007C YBL072C YBL108C-A YCL048W-A YBR108W YBR196C YCL037C YBR049C YBR019C YBL058W YBL107W-A YCL037C YBR115C YBR286W YCL018W YBR059C YBR031W YBL055C YBL091C-A YCL010C YBR118W YBR301W YCR005C YBR067C YBR064W YBL053W YBL090W YCL009C YBR121C-A YCL076W YCR027C YBR093C YBR063C YBL049W YBL089W YCL002C YBR126W-A YCL066W YCR040W YBR112C YBR067C YBL046W YBL081W YCR012W YBR126W-B YCL048W-A YCR099C YBR115C YBR068C YBL030C YBL078C YCR013C YBR149W YCL018W YDL153C YBR118W YBR069C YBL007C YBL072C YCR018C YBR157C YCL011C YDL115C YBR121C-A YBR093C YBR016W YBL071W-A YCR024C-B YBR162C YCR012W YDL063C YBR138C YBR127C YBR031W YBL071C YCR024C-A YBR196C YCR013C YDL055C YBR198C YBR138C YBR035C YBL059W YCR042C YBR289W YCR018C-A YDL035C YBR301W YBR139W YBR040W YBL058W YCR051W YCL076W YCR040W YDL020C YCL076W YBR196C YBR048W YBL055C YCR061W YCL055W YCR089W YDR022C YCL069W YBR202W YBR056W-A YBL054W YDL247W-A YCL050C YCR095C YDR025W YCL068C YBR218C YBR056C-B YBL042C YDL181W YCL037C YCR102W-A YDR028C YCL067C YBR286W YBR067C YBL038W YDL174C YCL018W YDL239C YDR037W YCL066W YBR302C YBR069C YBL030C YDL172C YCL010C YDL229W YDR077W YCL061C YCL076W YBR071W YBL018C YDL160C-A YCL009C YDL228C YDR091C YCL037C YCL069W YBR089C-A YBL003C YDL137W YCR012W YDL153C YDR146C YCL018W YCL068C YBR093C YBR009C YDL128W YCR013C YDL131W YDR166C YCR012W YCL067C YBR108W YBR016W 120  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YDL086W YCR018C YDL107W YDR278C YCR013C YCL066W YBR115C YBR029C YDL086C-A YCR018C-A YDL055C YDR289C YCR018C-A YCR005C YBR116C YBR035C YDL066W YCR020W-B YDL051W YDR340W YCR038W-A YCR021C YBR117C YBR040W YDL046W YCR024C-B YDL050C YDR422C YCR039C YCR037C YBR118W YBR056W-A YDL039C YCR024C-A YDL034W YDR542W YCR040W YCR039C YBR121C-A YBR056C-B YDL008W YCR042C YDR012W YDR545W YCR042C YCR040W YBR121C YBR062C YDR038C YCR044C YDR025W YDR545C-A YCR047C YCR067C YBR157C YBR066C YDR039C YCR049C YDR034C-A YEL077W-A YCR089W YCR092C YBR160W YBR067C YDR040C YCR061W YDR037W YEL077C YCR096C YCR096C YBR162C YBR069C YDR043C YCR088W YDR064W YEL075W-A YCR102W-A YCR097W-A YBR167C YBR071W YDR045C YCR099C YDR077W YEL076C YCR104W YCR104W YBR181C YBR087W YDR050C YDL195W YDR091C YEL076C-A YCR107W YDL248W YBR185C YBR091C YDR072C YDL192W YDR109C YEL034W YDL248W YDL247W-A YBR194W YBR093C YDR075W YDL181W YDR156W YEL034C-A YDL247W-A YDL218W YBR196C YBR107C YDR079W YDL174C YDR181C YEL021W YDL239C YDL182W YBR197C YBR108W YDR086C YDL137W YDR200C YEL020W-A YDL195W YDL153C YBR209W YBR115C YDR133C YDL128W YDR226W YEL020C-B YDL152W YDL145C YBR234C YBR116C YDR135C YDL123W YDR259C YEL009C YDL153C YDL113C YBR236C YBR121C-A YDR187C YDL086W YDR289C YER009W YDL148C YDL039C YBR247C YBR121C YDR221W YDL086C-A YDR340W YER036C YDL140C YDL038C YBR286W YBR122C YDR226W YDL046W YDR382W YER091C YDL115C YDL035C YBR289W YBR132C YDR233C YDL034W YDR385W YER110C YDL039C YDR006C YBR301W YBR145W YDR242W YDR025W YDR418W YER125W YDL038C YDR007W YCL076W YBR157C YDR253C YDR034C-A YDR417C YER180C-A YDL035C YDR037W YCL066W YBR162C YDR259C YDR038C YDR427W YER190W YDR006C YDR038C YCL048W-A YBR167C YDR260C YDR039C YDR432W YER190C-A YDR012W YDR039C YCL037C YBR173C YDR275W YDR040C YDR524C-B YFL068W YDR028C YDR040C YCL018W YBR187W 121  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YDR327W YDR050C YDR534C YFL067W YDR034C-A YDR077W YCL010C YBR194W YDR380W YDR072C YDR540C YFL066C YDR038C YDR091C YCL009C YBR195C YDR498C YDR077W YDR542W YFL065C YDR039C YDR123C YCR012W YBR196C YDR502C YDR079W YDR545W YFL056C YDR040C YDR135C YCR013C YBR197C YDR545W YDR118W YEL077W-A YFL027C YDR077W YDR166C YCR018C-A YBR209W YDR545C-A YDR133C YEL077C YFL013W-A YDR109C YDR171W YCR021C YBR230C YEL077W-A YDR135C YEL075W-A YFR009W-A YDR146C YDR207C YCR024C-B YBR232C YEL077C YDR152W YEL076C YFR057W YDR169C YDR212W YCR040W YBR234C YEL075W-A YDR156W YEL076C-A YGL263W YDR171W YDR213W YCR048W YBR249C YEL076C YDR171W YEL054C YGL262W YDR181C YDR238C YCR049C YBR255C-A YEL076C-A YDR214W YEL034W YGL261C YDR207C YDR253C YCR051W YBR256C YEL075C YDR221W YEL034C-A YGL253W YDR228C YDR259C YCR052W YBR262C YEL073C YDR226W YEL021W YGL245W YDR253C YDR264C YCR060W YBR265W YEL060C YDR242W YEL009C YGL228W YDR289C YDR266C YCR098C YBR278W YEL055C YDR259C YER009W YGL190C YDR292C YDR270W YCR099C YBR289W YEL028W YDR340W YER011W YGL139W YDR310C YDR289C YCR107W YBR301W YEL027W YDR366C YER036C YGL050W YDR382W YDR360W YDL244W YCL076W YEL009C YDR382W YER046W-A YGL014C-A YDR385W YDR381W YDL239C YCL066W YEL004W YDR385W YER102W YGL009C YDR420W YDR385W YDL228C YCL049C YER004W YDR427W YER138W-A YGL008C YDR432W YDR420W YDL186W YCL048W-A YER005W YDR441C YER165W YGR002C YDR433W YDR422C YDL185C-A YCL040W YER024W YDR511W YER177W YGR024C YDR465C YDR428C YDL177C YCL037C YER037W YDR519W YER178W YGR028W YDR473C YDR489W YDL172C YCL018W YER045C YDR524C-B YER180C-A YGR061C YDR485C YDR534C YDL163W YCL010C YER057C YDR534C YER190W YGR128C YDR534C YDR542W YDL158C YCL009C YER060W YDR545W YER190C-A YGR157W YDR542W YDR545W YDL152W YCL005W-A YER062C YDR545C-A YFL068W YGR164W YDR545W YDR545C-A YDL153C YCL007C 122  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YER063W YEL077W-A YFL067W YGR173W YDR545C-A YEL077W-A YDL137W YCL005W YER065C YEL077C YFL066C YGR214W YEL077W-A YEL077C YDL126C YCL004W YER087C-B YEL075W-A YFL065C YGR229C YEL077C YEL075W-A YDL124W YCR012W YER088C YEL076C YFL063W YGR261C YEL075W-A YEL076C YDL121C YCR013C YER089C YEL076C-A YFL039C YGR296W YEL076C YEL076C-A YDL086W YCR018C YER176W YEL075C YFL037W YGR296C-A YEL076C-A YEL075C YDL084W YCR018C-A YER177W YEL060C YFL031W YHL050W-A YEL075C YEL073C YDL068W YCR021C YER185W YEL053W-A YFL031C-A YHL050C YEL049W YEL034W YDL067C YCR024C-B YER189W YEL054C YFL013W-A YHL049C YEL034W YEL034C-A YDL055C YCR024C-A YER190W YEL034W YFL010W-A YHL046C YEL034C-A YER036C YDL043C YCR040W YER190C-A YEL033W YFR009W-A YHL033C YEL021W YER063W YDL038C YCR044C YER190C-B YEL034C-A YFR016C YHL015W YEL009C YER088C YDL037C YCR048W YFL068W YEL021W YFR019W YHR020W YER017C YER095W YDL034W YCR049C YFL067W YEL009C YFR031C-A YHR054W-A YER033C YER110C YDL008W YCR051W YFL066C YEL004W YFR033C YHR055C YER047C YER125W YDR007W YCR060W YFL065C YER009W YFR036W-A YHR145C YER095W YER189W YDR012W YCR082W YFL064C YER019W YGL253W YHR174W YER138W-A YER190W YDR025W YCR107W YFL059W YER035W YGL244W YHR206W YER161C YER190C-A YDR030C YDL198C YFR009W-A YER037W YGL228W YHR218W YER189W YER190C-B YDR033W YDL192W YFR021W YER038W-A YGL149W YHR218W-A YER190W YFL068W YDR034C-A YDL182W YGL208W YER039C YGL147C YHR219W YER190C-A YFL067W YDR038C YDL174C YGL165C YER046W-A YGL139W YIL177W-A YER190C-B YFL066C YDR039C YDL166C YGL115W YER057C YGL123W YIL177C YFL068W YFL065C YDR040C YDL158C YGL077C YER065C YGL123C-A YIL176C YFL067W YFL064C YDR045C YDL157C YGL052W YER088C YGL105W YIL169C YFL066C YFL063W YDR050C YDL137W YGL050W YER089C YGL102C YIL129C YFL065C YFL062W YDR054C YDL134C YGR008C YER138W-A YGL081W YIL082W YFL064C YFL057C YDR077W YDL125C 123  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YGR010W YER154W YGL015C YIL008W YFL063W YFL056C YDR079W YDL124W YGR011W YER167W YGL014C-A YJL225W-A YFL062W YFL039C YDR079C-A YDL123W YGR040W YER175W-A YGL009C YJL225C YFL057C YFL022C YDR087C YDL120W YGR041W YER176W YGL008C YJL223C YFL056C YFR009W-A YDR099W YDL119C YGR049W YER177W YGR023W YJL187C YFL054C YFR051C YDR126W YDL110C YGR062C YER189W YGR027C YJL130C YFL031W YFR052C-A YDR133C YDL100C YGR078C YER190W YGR039W YJL006C YFL031C-A YFR053C YDR156W YDL086W YGR141W YER190C-A YGR061C YJR056C YFL013W-A YGL263W YDR167W YDL086C-A YGR146C YER190C-B YGR079W YKL224C YFL010W-A YGL262W YDR171W YDL067C YGR156W YFL068W YGR086C YKL096W-A YFL010C YGL261C YDR174W YDL055C YGR158C YFL067W YGR090W YKL073W YFR009W-A YGL260W YDR184C YDL046W YGR180C YFL066C YGR136W YKL057C YFR016C YGL250W YDR190C YDL039C YGR192C YFL065C YGR192C YKL014C YFR017C YGL217C YDR210W YDL038C YGR201C YFL064C YGR214W YKR010C YFR033C YGL206C YDR209C YDL037C YGR253C YFL063W YGR228W YKR079C YFR036W-A YGL195W YDR214W YDL034W YGR254W YFL039C YGR229C YKR092C YFR037C YGL192W YDR218C YDL008W YGR269W YFL031W YGR253C YKR102W YGL261C YGL173C YDR221W YDR007W YGR296W YFL014W YGR254W YLL067W-A YGL260W YGL154C YDR226W YDR008C YGR296C-A YFL013W-A YGR261C YLL067C YGL214W YGL139W YDR259C YDR013W YGR296C-B YFR052C-A YGR264C YLL066W-A YGL164C YGL132W YDR278C YDR025W YHL050W-A YGL245W YGR279C YLL066C YGL150C YGL102C YDR289C YDR030C YHL050C YGL223C YGR282C YLL064C YGL139W YGL037C YDR317W YDR034C-A YHL049C YGL212W YGR294W YLL039C YGL110C YGL009C YDR320W-B YDR038C YHL025W YGL209W YGR296W YLL024C YGL009C YGL008C YDR320C-A YDR039C YHL024W YGL208W YGR296C-A YLL020C YGR008C YGR008C YDR327W YDR040C YHL021C YGL106W YHL050W-A YLR029C YGR023W YGR086C YDR340W YDR045C YHL006W-A YGL102C YHL050C YLR044C YGR053C YGR100W YDR363W YDR050C 124  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YHR005C-A YGL072C YHL034W-A YLR045C YGR061C YGR128C YDR371C-A YDR073W YHR008C YGL008C YHL033C YLR050C YGR086C YGR143W YDR377W YDR077W YHR046C YGR041W YHL015W YLR060W YGR128C YGR157W YDR382W YDR078C YHR049W YGR049W YHR020W YLR062C YGR130C YGR158C YDR385W YDR079W YHR051W YGR063C YHR032C-A YLR108C YGR160W YGR192C YDR394W YDR079C-A YHR052W-A YGR074W YHR079C-A YLR109W YGR159C YGR254W YDR408C YDR086C YHR053C YGR079W YHR112C YLR110C YGR196C YGR261C YDR418W YDR087C YHR054C YGR121C YHR145C YLR130C YGR228W YGR264C YDR417C YDR092W YHR054W-A YGR122C-A YHR174W YLR134W YGR229C YGR266W YDR445C YDR106W YHR055C YGR136W YHR211W YLR144C YGR237C YGR279C YDR458C YDR118W-A YHR071W YGR141W YHR214W-A YLR150W YGR254W YGR282C YDR461C-A YDR126W YHR079C-A YGR146C YHR218W YLR154W-A YGR294W YGR294W YDR465C YDR133C YHR083W YGR173W YHR218W-A YLR154W-B YGR296W YGR293C YDR476C YDR139C YHR134W YGR178C YHR219W YLR154W-C YGR296C-A YGR295C YDR485C YDR167W YHR135C YGR192C YIL177W-A YLR154W-E YGR296C-B YGR296W YDR486C YDR171W YHR142W YGR197C YIL177C YLR154W-F YHL050W-A YGR296C-A YDR493W YDR183W YHR174W YGR204W YIL169C YLR154C-G YHL050C YGR296C-B YDR497C YDR185C YHR180W YGR214W YIL163C YLR154C-H YHL049C YHL050W-A YDR502C YDR204W YHR214W-A YGR253C YIL160C YLR155C YHL048W YHL050C YDR511W YDR213W YHR218W YGR254W YIL149C YLR156W YHL046C YHL049C YDR519W YDR214W YHR218W-A YGR259C YIL138C YLR156C-A YHL007C YHL048W YDR524C-B YDR221W YHR219W YGR279C YIL127C YLR157C YHR032W YHL046C YDR534C YDR225W YHR219C-A YGR282C YIL123W YLR157W-D YHR054W-A YHL026C YDR540C YDR226W YIL177W-A YGR296W YIL091C YLR157W-E YHR055C YHR003C YDR541C YDR233C YIL177C YGR296C-A YIL053W YLR157C-C YHR065C YHR052W-A YDR542W YDR253C YIL169C YGR296C-B YIR011C YLR158C YHR079C-A YHR053C YDR545W YDR259C YIL124W YHL050W-A YIR040C YLR159W YHR082C YHR054W-A YDR545C-A YDR268W 125  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YIL121W YHL050C YJL225W-A YLR159C-A YHR089C YHR055C YEL077W-A YDR278C YIL111W YHL049C YJL225C YLR160C YHR131C YHR079C YEL077C YDR284C YIL101C YHL024W YJL216C YLR161W YHR174W YHR079C-A YEL075W-A YDR296W YIL093C YHL015W YJL159W YLR162W YHR211W YHR086W YEL076C YDR305C YIL082W YHR005C-A YJL123C YLR162W-A YHR212W-A YHR103W YEL076C-A YDR320W-B YIL053W YHR008C YJL108C YLR199C YHR213W YHR112C YEL060C YDR320C-A YIL051C YHR032C-A YJL087C YLR249W YHR214W-A YHR134W YEL055C YDR327W YIL034C YHR041C YJL052W YLR303W YHR216W YHR174W YEL053W-A YDR336W YIL033C YHR049W YJL020W-A YLR302C YHR218W YHR211W YEL054C YDR340W YIL003W YHR052W-A YJR009C YLR304C YHR218W-A YHR212W-A YEL051W YDR352W YIR005W YHR053C YJR123W YLR393W YHR219W YHR213W YEL050W-A YDR363W-A YIR011C YHR054W-A YKL224C YLR399W-A YHR219C-A YHR214W-A YEL047C YDR366C YIR017W-A YHR055C YKL202W YLR464W YIL177W-A YHR218W YEL044W YDR371C-A YIR017C YHR062C YKL153W YLR463C YIL177C YHR218W-A YEL034W YDR377W YIR019C YHR070W YKL148C YLR466W YIL176C YHR219W YEL033W YDR382W YJL225W-A YHR071W YKL113C YLR465C YIL171W-A YHR219C-A YEL034C-A YDR384C YJL225C YHR083W YKL111C YLR467W YIL169C YIL177W-A YEL021W YDR385W YJL187C YHR103W YKL096W-A YML133W-B YIL160C YIL177C YEL017C-A YDR388W YJL158C YHR128W YKL086W YML133W-A YIL149C YIL176C YEL009C YDR399W YJL157C YHR134W YKL083W YML133C YIL123W YIL173W YEL004W YDR405W YJL140W YHR135C YKL082C YML086C YIL091C YIL172C YER019C-A YDR408C YJL137C YHR174W YKL060C YML056C YIR019C YIL169C YER026C YDR418W YJL116C YHR183W YKL057C YML016C YIR020C YIL129C YER036C YDR424C YJL108C YHR211W YKL056C YMR006C YIR040C YIL110W YER038W-A YDR428C YJL079C YHR214W YKR010C YMR046W-A YIR041W YIL108W YER039C YDR433W YJL078C YHR214W-A YKR028W YMR125W YJL225W-A YIL082W YER046W-A YDR445C YJL055W YHR218W YKR042W YMR127C YJL225C YIL048W YER056C YDR461C-A 126  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YJR004C YHR218W-A YKR047W YMR145C YJL223C YIL047C-A YER087C-B YDR476C YJR009C YHR219W YKR057W YMR163C YJL222W YIL047C YER102W YDR486C YJR013W YHR219C-A YKR071C YMR205C YJL220W YIL046W YER125W YDR493W YJR020W YIL177W-A YKR078W YMR235C YJL187C YIL035C YER126C YDR502C YJR044C YIL177C YKR092C YMR247W-A YJL162C YIL034C YER138W-A YDR510W YJR087W YIL169C YKR095W-A YMR307C-A YJL159W YIR019C YER150W YDR510C-A YJR088C YIL153W YKR102W YMR309C YJL087C YIR040C YER156C YDR511W YJR104C YIL134W YLL067W-A YMR324C YJL020W-A YIR041W YER165W YDR519W YJR107W YIL124W YLL067C YNL339W-B YJR004C YJL225W-A YER167W YDR524C-B YJR129C YIL122W YLL066W-B YNL339W-A YJR151C YJL225C YER177W YDR527W YJR146W YIL121W YLL066W-A YNL339C YJR161C YJL223C YER180C-A YDR534C YJR147W YIL111W YLL066C YNL338W YKL225W YJL222W-B YER190W YDR545W YJR151C YIL110W YLL065W YNL285W YKL224C YJL222W YER190C-A YDR545C-A YKL192C YIL089W YLL039C YNL166C YKL202W YJL221C YER190C-B YEL077W-A YKL160W YIL082W YLL024C YNL085W YKL148C YJL187C YFL068W YEL077C YKL067W YIL053W YLR029C YNL037C YKL113C YJL159W YFL067W YEL075W-A YKL055C YIL051C YLR043C YNL031C YKL105C YJL158C YFL066C YEL076C YKL051W YIL034C YLR044C YNL010W YKL096W-A YJL153C YFL065C YEL076C-A YKL041W YIL033C YLR045C YNR016C YKL083W YJL143W YFL063W YEL075C YKL023W YIR014W YLR055C YNR076W YKL082C YJL141C YFL058W YEL060C YKR035W-A YJL225W-A YLR058C YOL161C YKL054C YJL130C YFL057C YEL055C YKR035C YJL225C YLR061W YOL013W-A YKL040C YJL116C YFL056C YEL053W-A YKR043C YJL216C YLR062C YOL013C YKR029C YJL087C YFL054C YEL054C YKR044W YJL184W YLR108C YOR053W YKR042W YJL054W YFL039C YEL044W YKR046C YJL159W YLR109W YOR059C YKR047W YJR004C YFL033C YEL034W YKR068C YJL158C YLR110C YOR072W-B YKR092C YJR009C YFL031W YEL034C-A YKR071C YJL153C YLR116W YOR133W YKR102W YJR030C YFL021W YEL028W 127  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YLL067W-A YJL140W YLR134W YOR151C YKR106W YJR143C YFL014W YEL021W YLL067C YJL118W YLR135W YOR290C YLL067W-A YJR151C YFL013W-A YEL017C-A YLL066W-A YJL116C YLR144C YOR297C YLL067C YJR155W YFL010W-A YEL009C YLL066C YJL108C YLR149C-A YOR310C YLL066W-A YJR161C YFR021W YEL004W YLL023C YJL104W YLR150W YOR361C YLL066C YKL224C YFR031C-A YER004W YLR027C YJL083W YLR153C YOR396W YLL065W YKL223W YFR033C YER005W YLR041W YJL079C YLR154W-A YPL283W-B YLL064C YKL211C YFR036W YER009W YLR042C YJL078C YLR154W-B YPL283W-A YLL039C YKL203C YFR052C-A YER010C YLR043C YJL062W-A YLR154W-C YPL283C YLL034C YKL182W YGL261C YER012W YLR044C YJL052W YLR154W-E YPL240C YLL024C YKL171W YGL253W YER019W YLR053C YJL043W YLR154W-F YPL200W YLL013C YKL170W YGL250W YER019C-A YLR073C YJL022W YLR154C-G YPL146C YLR037C YKL169C YGL228W YER024W YLR099C YJL009W YLR154C-H YPL137C YLR045C YKL103C YGL226W YER026C YLR110C YJR009C YLR156W YPL131W YLR060W YKR018C YGL212W YER035W YLR151C YJR077C YLR156C-A YPL128C YLR095C YKR035W-A YGL177W YER038W-A YLR154W-A YJR088C YLR157W-D YPL082C YLR103C YKR035C YGL165C YER039C YLR154W-B YJR104C YLR157W-E YPL050C YLR106C YKR044W YGL164C YER039C-A YLR154W-C YJR107W YLR157C-C YPL042C YLR110C YKR071C YGL147C YER044C YLR154W-E YJR123W YLR159W YPR085C YLR114C YKR102W YGL139W YER045C YLR154W-F YJR129C YLR159C-A YPR109W YLR116W YKR105C YGL135W YER053C YLR154C-G YJR139C YLR161W YPR144C YLR117C YKR106W YGL123W YER056C YLR154C-H YJR141W YLR162W YPR204W YLR125W YLL067W-A YGL123C-A YER057C YLR155C YJR146W YLR162W-A YPR204C-A YLR126C YLL067C YGL106W YER063W YLR156W YJR147W YLR166C  YLR129W YLL066W-A YGL102C YER072W YLR156C-A YKL202W YLR249W  YLR130C YLL066C YGL088W YER087C-B YLR157C YKL201C YLR259C  YLR131C YLL065W YGL061C YER088C YLR157W-D YKL198C YLR303W  YLR134W YLL064C YGL050W YER089C 128  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YLR157W-E YKL192C YLR302C  YLR139C YLL042C YGL009C YER092W YLR157C-C YKL164C YLR304C  YLR144C YLL039C YGL008C YER102W YLR158C YKL153W YLR309C  YLR146C YLL027W YGR008C YER119C YLR159W YKL152C YLR318W  YLR150W YLL024C YGR023W YER125W YLR159C-A YKL151C YLR332W  YLR153C YLL020C YGR022C YER138W-A YLR160C YKL111C YLR340W  YLR154W-A YLL019C YGR027C YER145C YLR161W YKL096W-A YLR339C  YLR154W-B YLL013C YGR028W YER146W YLR162W YKL096W YLR357W  YLR154W-C YLR037C YGR030C YER150W YLR162W-A YKL086W YLR380W  YLR154W-E YLR042C YGR037C YER156C YLR172C YKL060C YLR390W-A  YLR154W-F YLR044C YGR039W YER165W YLR179C YKL057C YLR393W  YLR154C-G YLR045C YGR061C YER167W YLR194C YKL056C YLR429W  YLR154C-H YLR058C YGR062C YER177W YLR245C YKL055C YLR441C  YLR155C YLR060W YGR064W YER178W YLR251W YKL051W YLR442C  YLR156W YLR087C YGR063C YER189W YLR252W YKR013W YLR448W  YLR156C-A YLR092W YGR076C YER190W YLR278C YKR043C YLR461W  YLR157C YLR109W YGR078C YER190C-A YLR295C YKR044W YLR466W  YLR157W-D YLR110C YGR079W YER190C-B YLR297W YKR046C YLR467W  YLR157W-E YLR117C YGR115C YFL068W YLR343W YKR047W YML133W-B  YLR157C-C YLR120C YGR121W-A YFL067W YLR393W YKR057W YML133W-A  YLR158C YLR123C YGR122C-A YFL066C YLR395C YKR095W-A YML133C  YLR159W YLR126C YGR135W YFL065C YLR413W YLL067W-A YML063W  YLR159C-A YLR129W YGR138C YFL064C YLR437C YLL067C YML056C  YLR160C YLR130C YGR146C YFL056C YLR462W YLL066W-B YML047W-A  YLR161W YLR131C YGR159C YFL044C YLR464W YLL066W-A YML047C  YLR162W YLR134W YGR162W YFL039C YLR463C YLL066C YML028W  YLR162W-A YLR139C YGR164W YFL017C YLR466W YLL065W YML024W  YLR176C YLR144C YGR173W YFL010W-A 129  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YLR465C YLL039C YMR006C  YLR177W YLR146C YGR174C YFR007W YLR466C-A YLL038C YMR046W-A  YLR183C YLR153C YGR175C YFR021W YLR467W YLL023C YMR116C  YLR187W YLR154W-A YGR180C YFR029W YLR467C-A YLR027C YMR125W  YLR189C YLR154W-B YGR189C YFR042W YML133W-B YLR030W YMR127C  YLR199C YLR154W-C YGR192C YFR052C-A YML133W-A YLR043C YMR158C-A  YLR206W YLR154W-E YGR201C YGL261C YML133C YLR044C YMR163C  YLR222C YLR154W-F YGR211W YGL254W YML118W YLR050C YMR186W  YLR223C YLR154C-G YGR214W YGL253W YML078W YLR062C YMR205C  YLR249W YLR154C-H YGR228W YGL250W YML054C YLR091W YMR227C  YLR256W YLR155C YGR229C YGL228W YML028W YLR109W YMR303C  YLR259C YLR156W YGR236C YGL226W YMR016C YLR110C YMR309C  YLR303W YLR156C-A YGR245C YGL222C YMR038C YLR121C YMR316C-B  YLR302C YLR157C YGR253C YGL221C YMR046W-A YLR146C YNL339W-B  YLR309C YLR157W-D YGR254W YGL211W YMR054W YLR149C-A YNL339W-A  YLR314C YLR157W-E YGR271C-A YGL208W YMR074C YLR150W YNL339C  YLR336C YLR157C-C YGR275W YGL200C YMR086W YLR153C YNL338W  YLR337C YLR158C YGR279C YGL196W YMR086C-A YLR154W-A YNL308C  YLR340W YLR159W YGR280C YGL187C YMR087W YLR154W-B YNL300W  YLR347W-A YLR159C-A YGR282C YGL166W YMR173W YLR154W-C YNL298W  YLR384C YLR160C YGR287C YGL165C YMR173W-A YLR154W-E YNL285W  YLR390W-A YLR161W YGR290W YGL154C YMR175W YLR154W-F YNL248C  YLR398C YLR162W YGR294W YGL146C YMR181C YLR154C-G YNL234W  YLR399W-A YLR162W-A YGR293C YGL127C YMR182C YLR154C-H YNL228W  YLR399C YLR163C YGR296W YGL123C-A YMR260C YLR155C YNL227C  YLR413W YLR166C YGR296C-A YGL117W YMR303C YLR156W YNL225C  YLR438W YLR188W YGR296C-B YGL106W YMR319C YLR156C-A YNL224C  YLR442C YLR245C YHL050W-A YGL102C 130  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YMR324C YLR157C YNL209W  YLR461W YLR249W YHL050C YGL101W YNL339W-B YLR157W-D YNL196C  YLR462W YLR253W YHL049C YGL098W YNL339W-A YLR157W-E YNL190W  YLR464W YLR256W YHL046W-A YGL089C YNL339C YLR157C-C YNL178W  YLR463C YLR258W YHL046C YGL088W YNL338W YLR158C YNL135C  YLR466W YLR303W YHL019W-A YGL079W YNL333W YLR159W YNL085W  YLR465C YLR302C YHL018W YGL077C YNL323W YLR159C-A YNL079C  YLR466C-A YLR304C YHL015W YGL061C YNL310C YLR160C YNL037C  YLR467W YLR307C-A YHR005C-A YGL053W YNL276C YLR161W YNL011C  YLR467C-A YLR343W YHR007C YGL052W YNL237W YLR162W YNL007C  YML133W-B YLR347W-A YHR007C-A YGL051W YNL187W YLR162W-A YNR010W  YML133W-A YLR372W YHR008C YGL050W YNL153C YLR172C YNR046W  YML133C YLR386W YHR020W YGL047W YNL095C YLR179C YNR076W  YML114C YLR389C YHR040W YGL037C YNL079C YLR206W YOL145C  YML059C YLR393W YHR047C YGL010W YNL074C YLR234W YOL131W  YMR006C YLR397C YHR052W-A YGL009C YNL066W YLR235C YOL127W  YMR043W YLR399W-A YHR053C YGL008C YNL055C YLR236C YOL108C  YMR046W-A YLR413W YHR054W-A YGR008C YNL046W YLR245C YOL106W  YMR077C YLR422W YHR055C YGR016W YNL044W YLR249W YOL086C  YMR173W YLR425W YHR057C YGR017W YNL043C YLR256W YOL083C-A  YMR173W-A YLR451W YHR058C YGR022C YNL020C YLR257W YOL039W  YMR182C YLR461W YHR059W YGR026W YNL010W YLR303W YOR009W  YMR190C YLR462W YHR065C YGR027C YNL004W YLR302C YOR010C  YMR205C YLR464W YHR089C YGR028W YNL003C YLR304C YOR053W  YMR227C YLR463C YHR134W YGR030C YNR002C YLR317W YOR057W  YMR235C YLR466W YHR145C YGR031C-A YNR009W YLR316C YOR063W  YMR261C YLR465C YHR174W YGR036C YNR022C YLR340W YOR083W  YMR273C YLR466C-A YHR179W YGR037C 131  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YOL164W-A YLR339C YOR084W  YMR317W YLR467W YHR211W YGR038W YOL155C YLR343W YOR133W  YMR316C-B YLR467C-A YHR213W YGR039W YOL150C YLR375W YOR139C  YMR322C YML133W-B YHR214W-A YGR040W YOL129W YLR388W YOR181W  YMR323W YML133W-A YHR218W YGR041W YOL125W YLR390W-A YOR232W  YMR324C YML133C YHR218W-A YGR058W YOL105C YLR393W YOR247W  YMR325W YML038C YHR219W YGR061C YOL040C YLR412W YOR248W  YNL339W-B YMR006C YHR219C-A YGR062C YOL012C YLR413W YOR283W  YNL339W-A YMR007W YIL177W-A YGR064W YOL003C YLR438W YOR296W  YNL339C YMR046W-A YIL177C YGR063C YOR036W YLR437C-A YOR339C  YNL338W YMR054W YIL176C YGR074W YOR040W YLR448W YOR344C  YNL330C YMR058W YIL173W YGR076C YOR049C YLR462W YOR369C  YNL308C YMR068W YIL169C YGR078C YOR081C YLR464W YOR375C  YNL300W YMR080C YIL165C YGR079W YOR085W YLR463C YOR396W  YNL271C YMR145C YIL164C YGR086C YOR092W YLR466W YPL283W-B  YNL248C YMR173W YIL160C YGR115C YOR139C YLR465C YPL283W-A  YNL228W YMR173W-A YIL155C YGR121W-A YOR159C YLR466C-A YPL283C  YNL227C YMR181C YIL136W YGR122C-A YOR176W YLR467W YPL240C  YNL224C YMR196W YIL123W YGR128C YOR192C-C YLR467C-A YPL231W  YNL197C YMR197C YIL082W YGR135W YOR213C YML133W-B YPL200W  YNL196C YMR205C YIL062C YGR136W YOR230W YML133W-A YPL187W  YNL176C YMR235C YIL057C YGR138C YOR247W YML133C YPL146C  YNL144W-A YMR304W YIL053W YGR156W YOR248W YML113W YPL142C  YNL059C YMR305C YIL051C YGR163W YOR276W YML063W YPL131W  YNL007C YMR307C-A YIL034C YGR164W YOR277C YML028W YPL121C  YNR044W YMR315W YIL022W YGR172C YOR297C YMR006C YPL106C  YNR046W YMR316C-B YIL003W YGR173W YOR305W YMR013W-A YPL061W  YNR051C YMR320W YIR017W-A YGR174C 132  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YOR306C YMR038C YPL037C  YNR075C-A YMR322C YIR017C YGR175C YOR368W YMR043W YPL020C  YNR076W YMR323W YIR019C YGR180C YOR376W-A YMR046W-A YPR002C-A  YOL166W-A YMR324C YIR020C YGR189C YOR383C YMR054W YPR036W  YOL161C YMR325W YIR036C YGR192C YOR396W YMR058W YPR080W  YOL155C YNL339W-B YIR040C YGR201C YOR396C-A YMR072W YPR136C  YOL145C YNL339W-A YJL225W-A YGR211W YPL283W-B YMR074C YPR143W  YOL105C YNL339C YJL225C YGR213C YPL283W-A YMR086W YPR145W  YOR006C YNL338W YJL223C YGR214W YPL283C YMR087W YPR154W  YOR008C YNL336W YJL222W YGR229C YPL253C YMR122W-A YPR160W-A  YOR009W YNL330C YJL216C YGR243W YPL246C YMR158C-A YPR160C-A  YOR010C YNL298W YJL195C YGR253C YPL233W YMR173W YPR185W  YOR023C YNL248C YJL187C YGR254W YPL154C YMR173W-A YPR187W  YOR053W YNL237W YJL171C YGR269W YPL127C YMR174C YPR204W  YOR086C YNL125C YJL167W YGR268C YPL089C YMR181C   YOR123C YNL118C YJL159W YGR277C YPL073C YMR182C   YOR133W YNL074C YJL158C YGR279C YPL037C YMR186W   YOR140W YNL056W YJL153C YGR282C YPL031C YMR205C   YOR139C YNL055C YJL148W YGR287C YPL018W YMR251W-A   YOR141C YNL053W YJL144W YGR295C YPL017C YMR260C   YOR181W YNL020C YJL127W-A YGR296W YPR036W YMR276W   YOR192C-C YNR044W YJL118W YGR296C-A YPR113W YMR303C   YOR194C YNR046W YJL119C YGR296C-B YPR127W YMR309C   YOR196C YNR073C YJL116C YHL050W-A YPR138C YMR317W   YOR247W YNR075C-A YJL108C YHL050C YPR139C YMR316C-B   YOR248W YNR076W YJL104W YHL049C YPR149W YMR318C   YOR279C YOL161C YJL087C YHL046C YPR160C-A YMR319C   YOR290C YOL155C YJL076W YHL021C 133  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 YPR202W YMR320W   YOR309C YOL126C YJL069C YHL018W YPR203W YNL339W-B   YOR310C YOL105C YJL062W-A YHL015W YPR204W YNL339W-A   YOR329C YOL098C YJL052W YHL002W YPR204C-A YNL339C   YOR330C YOL097C YJL043W YHL002C-A  YNL338W   YOR375C YOR040W YJL027C YHR005C-A  YNL305C   YOR383C YOR042W YJL022W YHR008C  YNL300W   YOR391C YOR069W YJR002W YHR020W  YNL285W   YOR393W YOR086C YJR009C YHR028W-A  YNL246W   YOR394W YOR119C YJR022W YHR039C-A  YNL190W   YOR396W YOR120W YJR023C YHR040W  YNL135C   YOR396C-A YOR122C YJR024C YHR049W  YNL085W   YPL283W-B YOR133W YJR034W YHR051W  YNL078W   YPL283W-A YOR137C YJR044C YHR052W-A  YNL071W   YPL283C YOR140W YJR047C YHR053C  YNL066W   YPL282C YOR139C YJR072C YHR054W-A  YNL052W   YPL281C YOR141C YJR123W YHR055C  YNL043C   YPL240C YOR151C YJR130C YHR057C  YNL037C   YPL231W YOR153W YJR146W YHR058C  YNR004W   YPL190C YOR161W-B YJR147W YHR059W  YNR010W   YPL154C YOR192C-C YJR151C YHR062C  YNR046W   YPL146C YOR197W YJR155W YHR063C  YOL159C-A   YPL131W YOR228C YKL224C YHR067W  YOL155C   YPL121C YOR306C YKL208W YHR069C-A  YOL151W   YPL086C YOR321W YKL202W YHR071W  YOL109W   YPL082C YOR329C YKL183W YHR083W  YOL086C   YPL058C YOR349W YKL164C YHR085W  YOL069W   YPL017C YOR375C YKL148C YHR087W 134  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2  YOL058W   YPL009C YOR384W YKL147C YHR089C  YOL040C   YPR002C-A YOR387C YKL136W YHR100C  YOL039W   YPR080W YOR393W YKL113C YHR101C  YOL012C   YPR087W YOR394W YKL112W YHR121W  YOR010C   YPR088C YOR396W YKL111C YHR128W  YOR040W   YPR104C YOR396C-A YKL096C-B YHR130C  YOR042W   YPR105C YPL283W-B YKL096W-A YHR132C  YOR052C   YPR141C YPL283W-A YKL096W YHR132W-A  YOR057W   YPR160W-A YPL283C YKL087C YHR134W  YOR063W   YPR160C-A YPL282C YKL083W YHR141C  YOR065W   YPR161C YPL278C YKL076C YHR156C  YOR083W   YPR173C YPL240C YKL060C YHR162W  YOR082C   YPR179C YPL231W YKL056C YHR174W  YOR085W   YPR203W YPL224C YKL043W YHR180W  YOR133W   YPR204W YPL222W YKL040C YHR195W  YOR140W   YPR204C-A YPL214C YKR013W YHR211W  YOR139C    YPL203W YKR035W-A YHR213W  YOR161W-A    YPL176C YKR035C YHR214W-A  YOR169C    YPL154C YKR040C YHR218W  YOR170W    YPL128C YKR042W YHR218W-A  YOR181W    YPL105C YKR043C YHR219W  YOR230W    YPL103C YKR047W YHR219C-A  YOR236W    YPL082C YKR048C YIL177W-A  YOR247W    YPL058C YKR057W YIL177C  YOR248W    YPR036W YKR063C YIL176C  YOR283W    YPR085C YKR068C YIL169C  YOR296W    YPR105C YKR069W YIL156W-A 135  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2  YOR297C    YPR109W YKR083C YIL156W-B  YOR306C    YPR110C YKR095W-A YIL155C  YOR332W    YPR145W YKR099W YIL142W  YOR331C    YPR149W YKR102W YIL136W  YOR369C    YPR160W YLL067W-A YIL124W  YOR383C    YPR160W-A YLL067C YIL123W  YOR396W    YPR160C-A YLL066W-B YIL114C  YOR396C-A    YPR161C YLL066W-A YIL111W  YPL283W-A    YPR173C YLL066C YIL101C  YPL283W-B    YPR178W YLL065W YIL089W  YPL283C    YPR181C YLL064C YIL082W  YPL246C    YPR203W YLL053C YIL074C  YPL240C    YPR204W YLL044W YIL062C  YPL238C    YPR204C-A YLL039C YIL053W  YPL234C     YLL024C YIL051C  YPL154C     YLL023C YIL049W  YPL131W     YLL021W YIL046W  YPL127C     YLL020C YIL040W  YPL037C     YLR016C YIL034C  YPL035C     YLR042C YIL006W  YPL031C     YLR043C YIL004C  YPL018W     YLR044C YIL003W  YPL017C     YLR048W YIR014W  YPR002C-A     YLR050C YIR019C  YPR036W     YLR058C YIR040C  YPR036W-A     YLR060W YJL225W-A  YPR052C     YLR062C YJL225C 136  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2  YPR053C     YLR074C YJL223C  YPR080W     YLR075W YJL190C  YPR113W     YLR079W YJL187C  YPR136C     YLR085C YJL173C  YPR138C     YLR086W YJL171C  YPR143W     YLR103C YJL164C  YPR149W     YLR109W YJL163C  YPR154W     YLR110C YJL161W  YPR160C-A     YLR120W-A YJL158C  YPR183W     YLR123C YJL157C  YPR202W     YLR130C YJL153C  YPR203W     YLR134W YJL145W  YPR204W     YLR135W YJL144W  YPR204C-A     YLR136C YJL140W       YLR144C YJL127W-A       YLR147C YJL127C-B       YLR149C-A YJL124C       YLR150W YJL120W       YLR153C YJL118W       YLR154W-A YJL119C       YLR154W-B YJL116C       YLR154W-C YJL108C       YLR154W-E YJL104W       YLR154W-F YJL083W       YLR154C-G YJL079C       YLR154C-H YJL062W-A       YLR155C YJL055W 137  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2       YLR156W YJL054W       YLR156C-A YJL052W       YLR157C YJL035C       YLR157W-D YJL030W       YLR157W-E YJR009C       YLR157C-C YJR011C       YLR158C YJR013W       YLR159W YJR012C       YLR159C-A YJR014W       YLR160C YJR034W       YLR161W YJR044C       YLR162W YJR047C       YLR162W-A YJR050W       YLR167W YJR057W       YLR177W YJR058C       YLR179C YJR072C       YLR180W YJR074W       YLR191W YJR077C       YLR198C YJR082C       YLR199C YJR083C       YLR201C YJR104C       YLR202C YJR115W       YLR205C YJR116W       YLR206W YJR130C       YLR212C YJR135C       YLR218C YJR146W       YLR235C YJR147W 138  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2       YLR236C YJR151C       YLR245C YJR151W-A       YLR249W YJR155W       YLR256W YJR161C       YLR262C-A YKL224C       YLR299C-A YKL214C       YLR303W YKL196C       YLR302C YKL192C       YLR304C YKL183W       YLR316C YKL164C       YLR330W YKL160W       YLR332W YKL159C       YLR331C YKL150W       YLR334C YKL148C       YLR340W YKL141W       YLR339C YKL127W       YLR349W YKL111C       YLR350W YKL103C       YLR380W YKL099C       YLR390W-A YKL096W-A       YLR393W YKL096W       YLR403W YKL086W       YLR421C YKL071W       YLR426W YKL069W       YLR437C YKL067W       YLR438W YKL060C       YLR441C YKL056C 139  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2       YLR449W YKL055C       YLR461W YKL053C-A       YLR462W YKL051W       YLR464W YKL043W       YLR463C YKL040C       YLR466W YKL038W       YLR465C YKL026C       YLR466C-A YKR013W       YLR467W YKR035W-A       YLR467C-A YKR035C       YML133W-B YKR040C       YML133W-A YKR043C       YML133C YKR044W       YML129C YKR046C       YML113W YKR047W       YML077W YKR061W       YML074C YKR068C       YML056C YKR076W       YML054C YKR085C       YML047W-A YKR095W-A       YML030W YKR099W       YML028W YKR102W       YML015C YLL067W-A       YMR006C YLL067C       YMR043W YLL066W-B       YMR046W-A YLL066W-A       YMR074C YLL066C 140  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2       YMR077C YLL064C       YMR087W YLL053C       YMR107W YLL044W       YMR112C YLL042C       YMR116C YLL039C       YMR123W YLL038C       YMR127C YLL027W       YMR158W-B YLL024C       YMR159C YLL023C       YMR172C-A YLL014W       YMR173W YLR004C       YMR173W-A YLR016C       YMR186W YLR028C       YMR198W YLR036C       YMR202W YLR037C       YMR205C YLR038C       YMR242C YLR042C       YMR260C YLR043C       YMR261C YLR044C       YMR263W YLR046C       YMR294W-A YLR050C       YMR303C YLR058C       YMR307W YLR059C       YMR316C-B YLR062C       YMR322C YLR063W       YMR324C YLR073C       YNL339W-B YLR074C 141  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2       YNL339W-A YLR085C       YNL339C YLR091W       YNL338W YLR099C       YNL332W YLR103C       YNL300W YLR109W       YNL286W YLR110C       YNL285W YLR120C       YNL283C YLR120W-A       YNL281W YLR121C       YNL266W YLR122C       YNL265C YLR123C       YNL240C YLR130C       YNL228W YLR134W       YNL227C YLR135W       YNL215W YLR136C       YNL213C YLR143W       YNL209W YLR144C       YNL206C YLR146W-A       YNL196C YLR147C       YNL191W YLR149C-A       YNL190W YLR150W       YNL186W YLR153C       YNL176C YLR154W-A       YNL174W YLR154W-B       YNL166C YLR154W-C       YNL165W YLR154W-E       YNL162W YLR154W-F 142  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2       YNL135C YLR154C-G       YNL112W YLR154C-H       YNL104C YLR155C       YNL091W YLR156W       YNL085W YLR156C-A       YNL079C YLR157C       YNL055C YLR157W-D       YNL037C YLR157W-E       YNL024C YLR157C-C       YNL017C YLR158C       YNR022C YLR159W       YNR032C-A YLR159C-A       YNR042W YLR160C       YNR041C YLR161W       YNR044W YLR162W       YNR046W YLR162W-A       YNR050C YLR165C       YNR055C YLR172C       YNR076W YLR177W       YOL164W-A YLR178C       YOL161C YLR179C       YOL159C-A YLR191W       YOL155C YLR194C       YOL150C YLR195C       YOL147C YLR198C       YOL106W YLR199C       YOL105C YLR201C 143  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2       YOL097C YLR205C       YOL086C YLR206W       YOL065C YLR218C       YOL054W YLR235C       YOL047C YLR236C       YOL012C YLR245C       YOR008C YLR249W       YOR010C YLR256W       YOR015W YLR257W       YOR053W YLR262C-A       YOR056C YLR286W-A       YOR057W YLR292C       YOR063W YLR295C       YOR083W YLR303W       YOR082C YLR304C       YOR123C YLR328W       YOR133W YLR329W       YOR139C YLR330W       YOR159C YLR332W       YOR161W-B YLR340W       YOR181W YLR349W       YOR192C-C YLR348C       YOR197W YLR350W       YOR198C YLR353W       YOR202W YLR361C-A       YOR209C YLR364W       YOR226C YLR377C 144  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2       YOR227W YLR380W       YOR228C YLR388W       YOR244W YLR389C       YOR247W YLR390W       YOR248W YLR393W       YOR254C YLR411W       YOR270C YLR412W       YOR271C YLR421C       YOR276W YLR426W       YOR277C YLR437C       YOR297C YLR453C       YOR309C YLR462W       YOR310C YLR464W       YOR323C YLR463C       YOR332W YLR466W       YOR331C YLR465C       YOR344C YLR466C-A       YOR369C YLR467W       YOR375C YLR467C-A       YOR383C YML133W-B       YOR391C YML133W-A       YOR396W YML133C       YOR396C-A YML129C       YPL283W-B YML125C       YPL283W-A YML113W       YPL283C YML109W       YPL282C YML094W 145  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2       YPL281C YML088W       YPL250C YML078W       YPL240C YML077W       YPL237W YML058W       YPL238C YML055W       YPL234C YML054C       YPL233W YML051W       YPL215W YML029W       YPL200W YML028W       YPL189C-A YML015C       YPL187W YMR006C       YPL181W YMR040W       YPL163C YMR043W       YPL152W YMR046W-A      YPL146C YMR071C       YPL142C YMR072W       YPL131W YMR073C       YPL119C-A YMR074C       YPL106C YMR086W       YPL090C YMR087W       YPL086C YMR112C       YPL037C YMR116C       YPL004C YMR123W       YPR002C-A YMR124W       YPR036W YMR127C       YPR039W YMR132C       YPR052C YMR160W 146  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2       YPR080W YMR161W       YPR092W YMR173W       YPR109W YMR173W-A      YPR110C YMR178W       YPR145W YMR180C       YPR149W YMR181C       YPR154W YMR182C       YPR156C YMR195W       YPR159C-A YMR202W       YPR160W-A YMR205C       YPR160C-A YMR214W       YPR163C YMR222C       YPR168W YMR225C       YPR169W-A YMR241W       YPR170W-B YMR245W       YPR176C YMR244C-A       YPR185W YMR251W       YPR203W YMR260C       YPR204W YMR262W       YPR204C-A YMR263W        YMR271C        YMR303C        YMR305C        YMR314W        YMR315W        YMR315W-A       YMR316C-B 147  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2        YMR319C        YMR324C        YNL339W-B        YNL339W-A        YNL339C        YNL338W        YNL324W        YNL323W        YNL310C        YNL304W        YNL300W        YNL286W        YNL285W        YNL284C        YNL283C        YNL282W        YNL281W        YNL280C        YNL279W        YNL246W        YNL240C        YNL239W        YNL213C        YNL191W        YNL166C        YNL165W        YNL162W 148  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2        YNL159C        YNL158W        YNL153C        YNL135C        YNL130C-A        YNL113W        YNL114C        YNL086W        YNL079C        YNL078W        YNL066W        YNL063W        YNL062C        YNL056W        YNL055C        YNL052W        YNL046W        YNL043C        YNL042W        YNL024C-A        YNL024C        YNL010W        YNL003C        YNR002C        YNR009W        YNR010W        YNR032C-A 149  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2        YNR041C        YNR044W        YNR046W        YNR050C        YNR055C        YNR075C-A        YOL164W        YOL161C        YOL159C-A        YOL159C        YOL155W-A        YOL155C        YOL147C        YOL142W        YOL137W        YOL129W        YOL123W        YOL122C        YOL118C        YOL116W        YOL112W        YOL106W        YOL097W-A        YOL097C        YOL094C        YOL086C        YOL058W 150  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2        YOL051W        YOL047C        YOL039W        YOL037C        YOL012C        YOL005C        YOR008C-A        YOR010C        YOR016C        YOR039W        YOR042W        YOR044W        YOR052C        YOR053W        YOR083W        YOR082C        YOR092W        YOR104W        YOR105W        YOR133W        YOR139C        YOR159C        YOR161W-B        YOR163W        YOR167C        YOR173W        YOR176W 151  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2        YOR181W        YOR184W        YOR192C-C        YOR202W        YOR226C        YOR228C        YOR230W        YOR236W        YOR238W        YOR244W        YOR247W        YOR248W        YOR251C        YOR271C        YOR276W        YOR277C        YOR283W        YOR285W        YOR297C        YOR305W        YOR309C        YOR310C        YOR323C        YOR327C        YOR329W-A        YOR332W        YOR331C 152  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2        YOR344C        YOR367W        YOR368W        YOR375C        YOR376W-A        YOR383C        YOR389W        YOR396W        YOR396C-A        YPL283W-B        YPL283W-A        YPL283C        YPL266W        YPL250C        YPL246C        YPL244C        YPL238C        YPL234C        YPL233W        YPL196W        YPL194W        YPL189C-A        YPL187W        YPL181W        YPL163C        YPL162C        YPL154C 153  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2        YPL149W        YPL148C        YPL131W        YPL109C        YPL108W        YPL099C        YPL098C        YPL088W        YPL041C        YPL037C        YPL031C        YPL024W        YPL018W        YPL002C        YPR002C-A        YPR011C        YPR036W        YPR040W        YPR051W        YPR050C        YPR052C        YPR053C        YPR057W        YPR061C        YPR062W        YPR063C        YPR066W 154  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2        YPR074C        YPR080W        YPR092W        YPR100W        YPR099C        YPR105C        YPR109W        YPR113W        YPR114W        YPR134W        YPR138C        YPR149W        YPR153W        YPR154W        YPR160W-A        YPR160C-A        YPR167C        YPR168W        YPR183W        YPR202W        YPR203W        YPR204W        YPR204C-A  155  Table A9 List of tRNA genes enriched for DNA:RNA hybrids  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 tK(CUU)C tE(UUC)B tA(UGC)A tA(UGC)A tK(CUU)C tA(UGC)A tA(UGC)A tA(UGC)A tT(AGU)D tG(GCC)C tV(UAC)B tV(UAC)B  tE(CUC)D tG(GCC)B tG(GCC)B tK(CUU)E1 tK(CUU)C tS(AGA)B tC(GCA)B  tQ(UUG)D1 tC(GCA)B tS(AGA)B tH(GUG)E2 tL(CAA)C tP(AGG)C tS(AGA)B  tY(GUA)D tS(AGA)B tD(GUC)B tE(UUC)E3 tM(CAU)C tG(GCC)C tD(GUC)B  tK(CUU)E1 tD(GUC)B tE(UUC)B tA(AGC)F tX(XXX)D tK(CUU)C tP(AGG)C  tH(GUG)E2 tE(UUC)B tG(GCC)C tH(GUG)G1 tH(GUG)E2 tM(CAU)C tG(GCC)C  tA(AGC)F tE(UUC)C tK(CUU)C tV(AAC)H tE(UUC)E3 tT(AGU)D tK(CUU)C  tE(UUC)G3 tG(GCC)C tL(CAA)C tD(GUC)I1 tE(UUC)E1 tV(UAC)D tQ(UUG)C  tV(AAC)G2 tK(CUU)C tT(AGU)D tE(UUC)K tG(GCC)F2 tI(AAU)D tT(AGU)D  tS(AGA)J tL(CAA)C tS(AGA)D2 tA(AGC)K2 tA(AGC)F tE(CUC)D tV(UAC)D  tD(GUC)J2 tT(AGU)C tE(CUC)D tD(GUC)N tG(GCC)F1 tX(XXX)D tQ(UUG)D2  tV(AAC)L tT(AGU)D tK(CUU)D2 tV(AAC)O tE(UUC)G2 tL(CAA)D tI(AAU)D  tI(AAU)L1 tI(AAU)D tL(CAA)D  tG(GCC)G2 tG(GCC)D2 tS(AGA)D2  tD(GUC)L2 tS(AGA)D2 tQ(UUG)D1  tE(UUC)G3 tG(GCC)E tE(CUC)D  tY(GUA)M2 tE(CUC)D tD(GUC)D  tK(CUU)G3 tK(CUU)E1 tF(GAA)D  tE(UUC)P tX(XXX)D tG(GCC)E  tD(GUC)I1 tS(UGA)E tX(XXX)D   tK(CUU)D2 tK(CUU)E1  tH(GUG)K tH(GUG)E2 tK(CUU)D2   tL(CAA)D tH(GUG)E2  tE(UUC)L tK(CUU)E2 tL(CAA)D   tS(AGA)D1 tK(CUU)E2  tG(GCC)M tS(AGA)E tY(GUA)D   tQ(UUG)D1 tE(UUC)E3  tD(GUC)N tE(UUC)E2 tG(GCC)E   tD(GUC)D tR(ACG)E  tN(GUU)N1 tV(AAC)E2 tK(CUU)E1   tG(GCC)D2 tE(UUC)E1  tN(GUU)P tF(GAA)F tS(UGA)E   tK(CUU)D1 tH(GUG)E1   tG(GCC)F2 tA(UGC)E   tG(GCC)E tE(UUC)E2   tS(GCU)F tH(GUG)E2   tK(CUU)E1 tV(AAC)E2 156  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2   tA(AGC)F tK(CUU)E2   tS(UGA)E tG(GCC)F2   tG(GCC)F1 tI(AAU)E1   tH(GUG)E2 tA(AGC)F   tW(CCA)G1 tR(ACG)E   tK(CUU)E2 tK(CUU)F   tK(UUU)G2 tI(AAU)E2   tE(UUC)E3 tG(GCC)F1   tC(GCA)G tM(CAU)E   tS(AGA)E tV(AAC)G3   tL(CAA)G3 tE(UUC)E1   tR(UCU)E tH(GUG)G1   tW(CCA)G2 tE(UUC)E2   tE(UUC)E1 tK(CUU)G2   tG(GCC)G2 tV(AAC)E2   tH(GUG)E1 tE(UUC)G2   tE(UUC)G1 tG(GCC)F2   tE(UUC)E2 tV(AAC)G1   tG(UCC)G tS(GCU)F   tV(AAC)E1 tD(GUC)G2   tV(AAC)G2 tA(AGC)F   tV(AAC)E2 tS(AGA)G   tK(CUU)G3 tY(GUA)F2   tN(GUU)F tR(UCU)G2   tV(AAC)H tG(GCC)F1   tG(GCC)F2 tL(CAA)G3   tS(AGA)H tH(GUG)G1   tS(GCU)F tG(GCC)G2   tA(AGC)H tK(CUU)G2   tA(AGC)F tH(GUG)G2   tF(GAA)H2 tW(CCA)G1   tK(CUU)F tE(UUC)G1   tP(UGG)H tE(UUC)G2   tG(GCC)F1 tE(UUC)G3   tQ(UUG)H tF(GAA)G   tV(AAC)G3 tV(AAC)G2   tE(UUC)J tD(GUC)G2   tH(GUG)G1 tK(CUU)G3   tD(GUC)J3 tS(AGA)G   tK(CUU)G2 tV(AAC)H   tW(CCA)J tK(UUU)G2   tE(UUC)G2 tT(AGU)H   tL(UAA)J tC(GCA)G   tV(AAC)G1 tA(AGC)H   tM(CAU)J3 tR(UCU)G2   tD(GUC)G2 tH(GUG)H   tS(AGA)J tL(CAA)G3   tS(AGA)G tK(CUU)I   tD(GUC)J4 tW(CCA)G2   tR(UCU)G2 tD(GUC)I1   tW(CCA)K tG(GCC)G2   tL(CAA)G3 tD(GUC)I2   tS(AGA)L tE(UUC)G1   tG(GCC)G2 tE(UUC)I 157  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2   tA(UGC)L tR(UCU)G1   tH(GUG)G2 tT(AGU)J   tQ(UUG)L tE(UUC)G3   tE(UUC)G1 tE(UUC)J   tI(UAU)L tL(GAG)G   tE(UUC)G3 tD(GUC)J3   tV(AAC)L tG(UCC)G   tV(AAC)G2 tR(UCU)J2   tG(GCC)M tV(AAC)G2   tK(CUU)G3 tS(AGA)J   tP(UGG)M tT(UGU)G2   tV(AAC)H tD(GUC)J1   tA(AGC)M2 tV(AAC)H   tT(AGU)H tR(UCU)J1   tY(GUA)M1 tT(AGU)H   tS(AGA)H tD(GUC)J2   tG(UCC)N tS(AGA)H   tA(AGC)H tD(GUC)J4   tD(GUC)N tA(AGC)H   tF(GAA)H2 tE(UUC)K   tI(AAU)N1 tF(GAA)H1   tP(UGG)H tH(GUG)K   tL(UAA)N tF(GAA)H2   tH(GUG)H tD(GUC)K   tN(GUU)N1 tP(UGG)H   tQ(UUG)H tK(CUU)K   tV(AAC)O tV(CAC)H   tI(AAU)I1 tA(AGC)K2   tW(CCA)P tQ(UUG)H   tK(CUU)I tS(AGA)L   tE(UUC)P tI(AAU)I1   tD(GUC)I1 tQ(UUG)L   tC(GCA)P2 tK(CUU)I   tD(GUC)I2 tV(AAC)L    tD(GUC)I1   tE(CUC)I tD(GUC)L1    tD(GUC)I2   tE(UUC)I tD(GUC)L2    tT(AGU)I1   tT(AGU)J tE(UUC)L    tE(UUC)J   tE(UUC)J tG(GCC)M    tA(AGC)J   tD(GUC)J3 tS(AGA)M    tD(GUC)J3   tR(UCU)J2 tV(AAC)M1    tR(UCU)J2   tG(GCC)J1 tV(AAC)M2    tM(CAU)J1   tS(AGA)J tK(CUU)M    tW(CCA)J   tD(GUC)J1 tE(UUC)M    tL(UAA)J   tR(UCU)J1 tH(GUG)M 158  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2    tM(CAU)J3   tD(GUC)J2 tD(GUC)M    tS(AGA)J   tV(AAC)J tG(UCC)N    tR(UCU)J1   tK(CUU)J tD(GUC)N    tD(GUC)J2   tG(GCC)J2 tI(AAU)N1    tD(GUC)J4   tD(GUC)J4 tN(GUU)N1    tR(UCU)K   tE(UUC)K tN(GUU)N2    tW(CCA)K   tR(UCU)K tG(GCC)O1    tK(UUU)K   tV(AAC)K1 tV(AAC)O    tS(AGA)L   tH(GUG)K tT(AGU)O1    tA(UGC)L   tD(GUC)K tW(CCA)P    tQ(UUG)L   tK(CUU)K tE(UUC)P    tL(UAG)L1   tA(AGC)K2 tN(GUU)P    tI(UAU)L   tS(AGA)L     tV(AAC)L   tA(UGC)L     tL(UAA)L   tQ(UUG)L     tN(GUU)L   tA(AGC)L     tI(AAU)L2   tV(AAC)L     tP(UGG)L   tN(GUU)L     tD(GUC)L1   tI(AAU)L2     tX(XXX)L   tD(GUC)L1     tD(GUC)L2   tI(AAU)L1     tE(UUC)L   tD(GUC)L2     tG(GCC)M   tE(UUC)L     tP(UGG)M   tR(UCU)M2     tS(AGA)M   tG(GCC)M     tA(AGC)M1   tS(AGA)M     tV(AAC)M1   tV(AAC)M1  159  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2    tW(CCA)M   tV(AAC)M2     tV(AAC)M2   tK(CUU)M     tK(CUU)M   tV(AAC)M3     tM(CAU)M   tE(UUC)M     tV(AAC)M3   tH(GUG)M     tA(AGC)M2   tD(GUC)M     tQ(CUG)M   tY(GUA)M2     tY(GUA)M1   tG(UCC)N     tH(GUG)M   tD(GUC)N     tG(UCC)N   tT(AGU)N2     tT(AGU)N2   tI(AAU)N1     tI(AAU)N1   tN(GUU)N1     tP(AGG)N   tI(AAU)N2     tL(UAA)N   tN(GUU)N2     tT(AGU)N1   tG(UCC)O     tN(GUU)N2   tG(GCC)O1     tG(UCC)O   tT(AGU)O2     tG(GCC)O1   tV(AAC)O     tR(ACG)O   tN(GUU)O1     tT(AGU)O2   tD(GUC)O     tG(CCC)O   tW(CCA)P     tV(AAC)O   tE(UUC)P     tA(UGC)O   tC(GCA)P1     tG(GCC)O2   tI(AAU)P2     tP(UGG)O1   tG(GCC)P1     tK(UUU)O   tN(GUU)P     tM(CAU)O1   tG(GCC)P2  160  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2    tW(CCA)P        tE(UUC)P        tM(CAU)P        tF(GAA)P1        tK(UUU)P        tC(GCA)P2        tI(AAU)P2      161  Table A10 List of snoRNA genes enriched for DNA:RNA hybrids  Wild type replicate rnh1? rnh201? replicate hpr1? replicate sen1-1 replicate 1 2 1 2 1 2 1 2 SNR3 SNR68 SNR46 SNR52 SNR30 SNR3 SNR18 SNR18 SNR69 SNR3 SNR38 SNR39  SNR54 SNR56 SNR56 SNR76 SNR42 SNR54 SNR54  SNR75 SNR13 SNR161 SNR75 SNR54 SNR76 SNR72  SNR9 SNR80 SNR43 SNR9 SNR78 SNR75 SNR24   SNR52 SNR33 SNR59 SNR77 SNR24    SNR82 SNR189  SNR76 SNR45    SNR10 SNR80  SNR75     SNR46 SNR4  SNR73     SNR48 SNR52  SNR72     SNR38 SNR82  SNR9     SNR69 SNR10  SNR45     SNR30 SNR46       SNR34 SNR32       SNR54 SNR68       SNR77 SNR128       SNR76 SNR38       SNR75 SNR69       SNR72 SNR79       SNR24 SNR61       SNR40 SNR34       SNR9 SNR77       SNR35 SNR76       SNR17A SNR75       SNR8 SNR24       SNR31 SNR40       SNR51 SNR58       SNR45 SNR9        SNR35        SNR17A       SNR31        SNR5        SNR51        SNR45  162  Table A11 Lists of open reading frames (ORFs) and antisense-associated ORFs enriched for DNA:RNA hybrids in wild type or modulated at the transcript level by Rnase H overexpression ORFs in both wild type replicates  ORFs upregulated by Rnase H  ORFs downregulated by Rnase H  Antisense-associated ORFs in both wild type replicates Antisense-associated ORFs upregulated by Rnase H  Antisense-associated ORFs downregulated by Rnase H YBL055C YAL039C YBR056W YBR011C YAL061W YCL055W YBR011C YAL061W YBR083W YBR067C YAL062W YER060W YBR067C YAL062W YBR139W YBR069C YBL005W YHL024W YBR069C YBL005W YBR184W YBR093C YBL049W YIL015W YBR071W YBL043W YCL027W YBR149W YBR093C YIL072W YBR093C YBL049W YCL055W YBR157C YBR117C YIL073C YBR149W YBL054W YCR075C YCL055W YCL025C YFR015C YBR157C YBR047W YEL024W YCR018C YCL049C YDL181W YCL009C YBR050C YER060W YCR042C YCR021C YDL227C YCL010C YBR054W YER067W YER057C YCR073C YDR380W YCL037C YBR072W YER080W YER065C YHR096C YER060W-A YCL055W YBR093C YHL024W YER088C YHR139C YGR221C YCR012W YBR105C YHL028W YHL024W YKL071W YJL157C YCR018C YBR117C YHR016C YHR049W YKL163W YJL170C YCR042C YBR238C YHR153C YHR135C YKL220C YJR048W YCR061W YBR295W YIL015W YIL033C YKR046C YLR042C YEL004W YBR296C YIL072W YIL034C YKR075C YLR258W YEL009C YCL025C YIL073C YIL111W YDL129W YLR273C YEL060C YCL049C YIL124W YIL121W YDR256C YMR250W YER037W YCR021C YKL035W YKL051W YDR406W YNL279W YER057C YCR073C YKL096W YKR044W YDR476C YOR065W YER065C YEL065W YKL148C YKR046C YDR481C YOR378W YER088C YER028C YKR003W YDL046W YGL156W  YER089C YER037W YFR015C YDL086W YGL205W  YER176W YER045C YFR053C YDL128W YGR121C  YER177W YER081W YDL003W YDL137W YGR233C  YHL024W YER103W YDL018C YDL181W YGR239C  YHR008C YER145C YDL181W YDR135C YJL079C  YHR049W YER175C YDL227C YDR221W YJL116C  YHR071W YER185W YDR342C YGR041W YLR121C  YHR083W YHL016C YDR380W YGR049W YML054C  163  ORFs in both wild type replicates  ORFs upregulated by Rnase H  ORFs downregulated by Rnase H  Antisense-associated ORFs in both wild type replicates Antisense-associated ORFs upregulated by Rnase H  Antisense-associated ORFs downregulated by Rnase H YHR134W YHL035C YDR503C YJL078C YML123C  YHR135C YHL040C YER060W-A YJL079C YMR181C  YHR174W YHR071W YGL032C YJL116C YMR182C  YIL033C YHR088W YGL047W YJL140W YMR195W  YIL034C YHR096C YGL229C YJR147W YMR251W  YIL051C YHR136C YGR109C YLR179C YMR319C  YIL053W YHR139C YGR205W YMR038C YNL024C  YIL111W YIL019W YGR221C YMR181C YNL095C  YIL121W YIR026C YJL059W YMR182C YNL141W  YIL124W YKL071W YJL102W YMR260C YNL144C  YKL051W YKL078W YJL137C YMR319C YNL237W  YKL055C YKL163W YJL157C YNL066W YNL277W  YKL192C YKL178C YJL164C YOL012C YNR060W  YKR044W YKL220C YJL170C YOL155C YOL154W  YKR046C YKR024C YJR048W YOR230W YOL155C  YDL046W YKR046C YLL002W YOR306C YOR049C  YDL086W YKR075C YLR042C YPL031C YOR107W  YDL128W YDL039C YLR049C  YOR134W  YDL137W YDL048C YLR183C  YOR267C  YDL174C YDL049C YLR258W  YOR306C  YDL181W YDL129W YLR273C  YOR381W  YDR050C YDL182W YLR452C  YOR384W  YDR072C YDR070C YML027W  YKL068W-A  YDR079W YDR242W YML047C    YDR135C YDR256C YML100W    YDR221W YDR270W YMR199W    YDR226W YDR281C YMR232W    YDR242W YDR345C YMR250W    YDR259C YDR399W YMR284W    YGL208W YDR403W YNL092W    YGR041W YDR406W YNL130C    YGR049W YDR441C YNL246W    YGR141W YDR465C YNL274C    YGR192C YDR476C YNL279W    YGR253C YDR481C YNR044W    YGR254W YDR523C YOL007C    164  ORFs in both wild type replicates  ORFs upregulated by Rnase H  ORFs downregulated by Rnase H  Antisense-associated ORFs in both wild type replicates Antisense-associated ORFs upregulated by Rnase H  Antisense-associated ORFs downregulated by Rnase H YHR005C-A YGL121C YOL049W    YJL078C YGL156W YOL107W    YJL079C YGL158W YOR065W    YJL116C YGL205W YOR374W    YJL140W YGL209W YOR378W    YJL158C YGL256W YPL003W    YJR009C YGR032W YPL061W    YJR088C YGR035C YPL123C    YJR104C YGR043C YPL256C    YJR129C YGR052W YPR160W    YJR147W YGR121C YIL009C-A    YLR027C YGR138C     YLR043C YGR142W     YLR044C YGR161C     YLR110C YGR233C     YLR172C YGR239C     YLR179C YGR243W     YLR245C YGR249W     YLR343W YGR280C     YLR413W YJL033W     YML028W YJL079C     YMR038C YJL109C     YMR054W YJL116C     YMR074C YJL144W     YMR087W YJR097W     YMR173W YLL013C     YMR181C YLL027W     YMR182C YLL051C     YMR260C YLL053C     YMR319C YLR074C     YNL066W YLR099C     YOL012C YLR121C     YOL040C YLR136C     YOL155C YLR168C     YOR040W YLR205C     165  ORFs in both wild type replicates  ORFs upregulated by Rnase H  ORFs downregulated by Rnase H  Antisense-associated ORFs in both wild type replicates Antisense-associated ORFs upregulated by Rnase H  Antisense-associated ORFs downregulated by Rnase H YOR085W YLR213C     YOR230W YLR214W     YOR247W YLR297W     YOR297C YLR343W     YOR306C YLR346C     YOR383C YML054C     YPL017C YML123C     YPL018W YMR011W     YPL031C YMR058W     YPL037C YMR094W     YPL127C YMR102C     YPL154C YMR145C     YPL246C YMR181C     YPR036W YMR182C     YPR113W YMR195W     YPR138C YMR251W     YPR149W YMR265C     YCR024C-B YMR269W      YMR271C      YMR316W      YMR319C      YNL014W      YNL024C      YNL037C      YNL065W      YNL077W      YNL095C      YNL112W      YNL141W      YNL142W      YNL144C      YNL217W      YNL231C      YNL234W      YNL237W     166  ORFs in both wild type replicates  ORFs upregulated by Rnase H  ORFs downregulated by Rnase H  Antisense-associated ORFs in both wild type replicates Antisense-associated ORFs upregulated by Rnase H  Antisense-associated ORFs downregulated by Rnase H  YNL240C      YNL277W      YNR060W      YOL052C-A      YOL059W      YOL154W      YOL155C      YOL158C      YOR049C      YOR062C      YOR100C      YOR107W      YOR134W      YOR153W      YOR252W      YOR267C      YOR306C      YOR316C      YOR337W      YOR338W      YOR339C      YOR344C      YOR381W      YOR382W      YOR383C      YOR384W      YPL012W      YPL019C      YPL088W      YPL093W      YPL110C      YPL135W      YPL156C      YPL171C      YPL201C     167  ORFs in both wild type replicates  ORFs upregulated by Rnase H  ORFs downregulated by Rnase H  Antisense-associated ORFs in both wild type replicates Antisense-associated ORFs upregulated by Rnase H  Antisense-associated ORFs downregulated by Rnase H  YPL250C      YPR002W      YPR015C      YPR061C      YPR065W      YPR112C      YPR157W      YPR167C      YML058W-A      YER053C-A      YKL068W-A      168  Table A12 GO function sorting of genes modulated at the transcript level by RNase H overexpression Genes downregulated by RNase H overexpression at the transcript level GO term Fold enrichment Corrected p value Uncorrected p value Number of annotations List size Total annotations Population size FDR rate Expected false positives multi-organism cellular process 7.15 2.51E-06 5.62E-09 14 88 126 5664 0.00% 0 multi-organism process 6.83 4.63E-06 1.04E-08 14 88 132 5664 0.00% 0 conjugation with cellular fusion 7.22 3.07E-05 6.88E-08 12 88 107 5664 0.00% 0 conjugation 7.15 3.41E-05 7.64E-08 12 88 108 5664 0.00% 0 response to pheromone 7.38 9.05E-05 2.03E-07 11 88 96 5664 0.00% 0 cellular response to pheromone 7.75 0.00021 4.70E-07 10 88 83 5664 0.00% 0 energy reserve metabolic process 13.25 0.000294 6.57E-07 7 88 34 5664 0.00% 0 response to pheromone involved in conjugation with cellular fusion 8.28 0.000467 1.04E-06 9 88 70 5664 0.00% 0 reproduction 3.06 0.000598 1.34E-06 22 88 463 5664 0.00% 0 cellular process involved in reproduction 3.25 0.000789 1.76E-06 20 88 396 5664 0.00% 0 sexual reproduction 4.33 0.001361 3.04E-06 14 88 208 5664 0.00% 0 cytogamy 28.61 0.002888 6.46E-06 4 88 9 5664 0.00% 0 glycogen metabolic process 12.07 0.00347 7.76E-06 6 88 32 5664 0.00% 0 169  Genes downregulated by RNase H overexpression at the transcript level glycogen biosynthetic process 15.32 0.006038 1.35E-05 5 88 21 5664 0.00% 0 energy derivation by oxidation of organic compounds 4.78 0.006792 1.52E-05 11 88 148 5664 0.00% 0 Genes upregulated by Rnase H overexpression at the transcript level GO term Fold enrichment Corrected p value Uncorrected p value Number of annotations List size Total number of annotations Population size FDR rate Expected false positives iron ion homeostasis 10.15245 2.21E-12 3.81E-15 19 212 50 5664 0.00% 0 iron assimilation 24.04528 6.86E-10 1.18E-12 9 212 10 5664 0.00% 0 cellular iron ion homeostasis 10.01887 2.47E-09 4.26E-12 15 212 40 5664 0.00% 0 iron chelate transport 23.74843 1.71E-08 2.95E-11 8 212 9 5664 0.00% 0 iron coordination entity transport 18.49637 4.44E-08 7.66E-11 9 212 13 5664 0.00% 0 siderophore transport 23.37736 4.20E-07 7.24E-10 7 212 8 5664 0.00% 0 iron assimilation by chelation & transport 23.37736 4.20E-07 7.24E-10 7 212 8 5664 0.00% 0 cellular metal ion homeostasis 6.792453 1.30E-06 2.25E-09 15 212 59 5664 0.00% 0 metal ion homeostasis 6.679245 1.68E-06 2.90E-09 15 212 60 5664 0.00% 0 cation homeostasis 4.488453 2.72E-06 4.70E-09 21 212 125 5664 0.00% 0 ion homeostasis 4.259229 3.17E-06 5.47E-09 22 212 138 5664 0.00% 0 ion transport 3.137221 4.72E-06 8.14E-09 31 212 264 5664 0.00% 0 chemical homeostasis 3.89254 1.75E-05 3.02E-08 22 212 151 5664 0.00% 0 transition metal ion transport 7.167971 0.000106 1.83E-07 11 212 41 5664 0.00% 0 170  Genes upregulated by Rnase H overexpression at the transcript level cellular ion homeostasis 3.662812 0.001682 2.90E-06 17 212 124 5664 0.00% 0 cellular cation homeostasis 3.851096 0.001703 2.94E-06 16 212 111 5664 0.00% 0 cellular chemical homeostasis 3.440823 0.004011 6.92E-06 17 212 132 5664 0.00% 0 iron ion transport 10.68679 0.005605 9.66E-06 6 212 15 5664 0.00% 0 homeostatic process 2.6279 0.006414 1.11E-05 24 212 244 5664 0.00% 0 copper ion transmembrane transport 13.35849 0.008788 1.52E-05 5 212 10 5664 0.00% 0  171  Table A13 Spearman correlation scores for DRIP-chip replicates  Wild type replicate 1 Wild type replicate 2 rnh1? rnh201? replicate 1 rnh1? rnh201? replicate 2 hpr1? replicate 1 hpr1? replicate 2 sen1-1 replicate 1 sen1-1 replicate 2 Wild type replicate 1   0.5621 0.5029 0.5836 0.4511 0.5291 0.6423 0.6856 Wild type replicate 2     0.5564 0.5695 0.7251 0.5988 0.6716 0.7159 rnh1? rnh201? replicate 1       0.8042 0.7476 0.722 0.6316 0.5607 rnh1? rnh201? replicate 2         0.6656 0.7696 0.6092 0.6291 hpr1? replicate 1           0.7558 0.7262 0.6495 hpr1? replicate 2             0.6018 0.5687 sen1-1 replicate 1               0.8335 sen1-1 replicate 2                  172  Table A14 DRIP-qPCR primers Genomic Target Gene Type Forward Primer Reverse Primer SUF2 tRNA gene TATGATTCTCGCTTAGGGTGCGGGAGG CATTAACATTGGTCTTCTCCAGCTTACTC tV(UAC)D tRNA gene GGTCCAATGGTCCAGTGGTTCAAGACGTCGCCTTTACACGGCGAAG CATCGTTGCTGGGACCC Intergenic region on chromosome V Reference gene GGCTGTCAGAATATGGGGCCGTAGTA CACCCCGAAGCTGCTTTCACAATAC 173  Table A15 Strains used in chapter 4 YPH no. Relevant Genotype Source BY4741 MATa ura3?0 leu2?0 his3?1 met15?0 Jef Boeke TBA MAT? ura3?0 leu2?0 his3?1 rnh1?::NatMX  Chan et al. 2014 TBA MAT? ura3?0 leu2?0 his3?1 rnh201?::URA3 Chan et al. 2014 TBA MAT? ura3?0 leu2?0 his3?1 rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 rfc2-1::KanMX Li et al. 2011 TBA MATa ura3?0 leu2?0 his3?0 rfc2-1::KanMX rnh1?::NatMX Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 rfc2-1::KanMX  rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 rfc2-1::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 rfc5-1::KanMX Li et al. 2011 TBA MATa ura3?0 leu2?0 his3?0 rfc5-1::KanMX rnh1?::NatMX Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 rfc5-1::KanMX  rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 rfc5-1::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 rfa1-M2::KanMX Li et al. 2011 TBA MATa ura3?0 leu2?0 his3?0 rfa1-M2::KanMX rnh1?::NatMX Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 rfa1-M2::KanMX  rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 rfa1-M2::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 cdc9-1::KanMX Li et al. 2011 TBA MATa ura3?0 leu2?0 his3?0 cdc9-1::KanMX rnh1?::NatMX Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 cdc9-1::KanMX  rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 cdc9-1::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 nse1-16::KanMX Li et al. 2011 TBA MATa ura3?0 leu2?0 his3?0 nse1-16::KanMX rnh1?::NatMX Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 nse1-16::KanMX  rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 nse1-16::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 dbf4-1 ::KanMX Li et al. 2011 TBA MATa ura3?0 leu2?0 his3?0 dbf4-1::KanMX rnh1?::NatMX Chan et al. 2014 174  YPH no. Relevant Genotype Source TBA MATa ura3?0 leu2?0 his3?0 dbf4-1::KanMX  rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 dbf4-1::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 mcd1-73::KanMX Li et al. 2011 TBA MATa ura3?0 leu2?0 his3?0 mcd1-73::KanMX rnh1?::NatMX Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 mcd1-73::KanMX  rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 mcd1-73::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 smc6-9::KanMX Li et al. 2011 TBA MATa ura3?0 leu2?0 his3?0 smc6-9::KanMX rnh1?::NatMX Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 smc6-9::KanMX  rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 smc6-9::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 swc4-4::KanMX Li et al. 2011 TBA MATa ura3?0 leu2?0 his3?0 swc4-4::KanMX rnh1?::NatMX Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 swc4-4::KanMX  rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 swc4-4::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 apc2-8::KanMX Li et al. 2011 TBA MATa ura3?0 leu2?0 his3?0 apc2-8::KanMX rnh1?::NatMX Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 apc2-8::KanMX  rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 apc2-8::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 sec22-3::KanMX Li et al. 2011 TBA MATa ura3?0 leu2?0 his3?0 sec22-3::KanMX rnh1?::NatMX Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 sec22-3::KanMX  rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 sec22-3::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 rpn11-14::KanMX Li et al. 2011 TBA MATa ura3?0 leu2?0 his3?0 rpn11-14::KanMX rnh1?::NatMX Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 rpn11-14::KanMX  rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 rpn11-14::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 mph1?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 mph1?::KanMX rnh1?::NatMX  Chan et al. 2014 175  YPH no. Relevant Genotype Source TBA MATa ura3?0 leu2?0 his3?0 lys2?0 mph1?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 mph1?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad27?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad27?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad27?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad27?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 mms1?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 mms1?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 mms1?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 mms1?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 pol32?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 pol32?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 pol32?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 pol32?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 sgs1?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 sgs1?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 sgs1?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 sgs1?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 ctf4?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 ctf4?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 ctf4?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 ctf4?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 esc21?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 esc2?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 esc2?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 esc2?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 elg1?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 elg1?::KanMX rnh1?::NatMX  Chan et al. 2014 176  YPH no. Relevant Genotype Source TBA MATa ura3?0 leu2?0 his3?0 lys2?0 elg1?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 elg1?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad59?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad59?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad59?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad59?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 xrs2?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 xrs2?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 xrs2?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 xrs2?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad50?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad50?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad50?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad50?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad52?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad52?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad52?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rad52?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rtt109?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rtt109?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rtt109?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rtt109?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 mms4?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 mms4?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 mms4?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 mms4?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 top1?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 top1?::KanMX rnh1?::NatMX  Chan et al. 2014 177  YPH no. Relevant Genotype Source TBA MATa ura3?0 leu2?0 his3?0 lys2?0 top1?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 top1?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 ada2?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 ada2?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 ada2?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 ada2?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rsm27?::KanMX Open Biosystems TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rsm27?::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rsm27?::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 lys2?0 rsm27?::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 mms21-1::KanMX Breslow et al. 2008 TBA MATa ura3?0 leu2?0 his3?0 mms21-1::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 mms21-1::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 mms21-1::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 nse4::KanMX Breslow et al. 2008 TBA MATa ura3?0 leu2?0 his3?0 nse4::KanMX rnh1?::NatMX  Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 nse4::KanMX rnh201?::URA3 Chan et al. 2014 TBA MATa ura3?0 leu2?0 his3?0 nse4::KanMX rnh1?::NatMX rnh201?::URA3 Chan et al. 2014 TBA MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 cep3-1::KanMX p425-GPD Chan et al. 2014 TBA MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 cep3-1::KanMX p425-GPD-RNase H1 Chan et al. 2014 TBA MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 cse4-1::KanMX p425-GPD Chan et al. 2014 TBA MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 cse4-1::KanMX p425-GPD-RNase H1 Chan et al. 2014 TBA MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 dam1-5::KanMX p425-GPD Chan et al. 2014 178  YPH no. Relevant Genotype Source TBA MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 dam1-5::KanMX p425-GPD-RNase H1 Chan et al. 2014 TBA MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 dsn1-7::KanMX p425-GPD Chan et al. 2014 TBA MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 dsn1-7::KanMX p425-GPD-RNase H1 Chan et al. 2014 TBA MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 spc105::KanMX p425-GPD Chan et al. 2014 TBA MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 spc105::KanMX p425-GPD-RNase H1 Chan et al. 2014 TBA MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 spc34::KanMX p425-GPD Chan et al. 2014 TBA MATa his3?1 ura3?0 leu2?0 lys2?0 ade2-101::NatMX CFVII(RAD2.d)::LYS2 spc34::KanMX p425-GPD-RNase H1 Chan et al. 2014  179  Table A16 SGA-identified negative genetic interactors with rnh1? rnh201?? that met the p<0.05 and E-C<-0.2 cutoff Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description Not able to validate, dead at 32oC -1.296 0.000486 qri1-ts1 YDL103C UDP-N-acetylglucosamine pyrophosphorylase; catalyzes the formation of UDP-N-acetylglucosamine (UDP-GlcNAc), important in cell wall biosynthesis, protein N-glycosylation, and GPI anchor biosynthesis; protein abundance increases in response to DNA replication stress Tested -1.175 7.10E-06 rfc2-1 YJR068W Subunit of heteropentameric Replication factor C (RF-C), that acts as a clamp loader of the proliferating cell nuclear antigen (PCNA) processivity factor for DNA polymerases delta and epsilon  -1.050 1.60E-05 pol1-2 YNL102W Catalytic subunit of DNA polymerase I alpha-primase complex, required for initiation of DNA replication during mitotic DNA synthesis and premeiotic DNA synthesis  -1.033 5.81E-07 YMR232W YMR232W Cytoplasmic protein localized to the shmoo tip; required for the alignment of parental nuclei before nuclear fusion during mating  -1.009 1.43E-06 YNL077W YNL077W Chaperone with a role in SUMO-mediated protein degradation; member of the DnaJ-like family; conserved across eukaryotes; overexpression interferes with propagation of the [Psi+] prion; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies; forms nuclear foci upon DNA replication stress 180  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description  -0.976 4.97E-08 TAF9 YMR236W Subunit of TFIID and SAGA complexes, involved in RNA polymerase II initiation and chromatin modification  -0.954 0.003599 YMR238W YMR238W Putative mannosidase, essential glycosylphosphatidylinositol (GPI)-anchored membrane protein required for cell wall biogenesis in bud formation  -0.927 0.000184 YNL068C YNL068C Forkhead family transcription factor; plays a major role in the expression of G2/M phase genes; positively regulates transcriptional elongation; negative role in chromatin silencing at HML and HMR Tested -0.907 0.000172 sec22-3 YLR268W R-SNARE protein; assembles into SNARE complex with Bet1p, Bos1p and Sed5p; cycles between the ER and Golgi complex; involved in anterograde and retrograde transport between the ER and Golgi; synaptobrevin homolog  -0.907 0.001031 YNL070W YNL070W Component of the TOM (translocase of outer membrane) complex responsible for recognition and initial import steps for all mitochondrially directed proteins; promotes assembly and stability of the TOM complex  -0.892 0.002865 YMR233W YMR233W Non-essential sumoylated protein of unknown function; similar to components of human SWI/SNF complex including SMRD3; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm, nucleus and nucleolus; TRI1 has a paralog, UAF30, that arose from the whole genome duplication 181  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description  -0.872 0.001929 YNL085W YNL085W Protein that forms a complex with Pbp1p; may mediate posttranscriptional regulation of HO; allelic variation affects mitochondrial genome stability, drug resistance; forms cytoplasmic foci upon DNA replication stress Tested -0.859 5.15E-06 YKL113C YKL113C 5' to 3' exonuclease, 5' flap endonuclease, required for Okazaki fragment processing and maturation as well as for long-patch base-excision repair  -0.857 3.71E-07 YNL071W YNL071W Dihydrolipoamide acetyltransferase component (E2) of pyruvate dehydrogenase complex, which catalyzes the oxidative decarboxylation of pyruvate to acetyl-CoA Tested -0.853 0.001255 cdc9-1 YDL164C DNA ligase found in the nucleus and mitochondria, an essential enzyme that joins Okazaki fragments during DNA replication; also acts in nucleotide excision repair, base excision repair, and recombination  -0.841 2.64E-06 YMR230W YMR230W Protein component of the small (40S) ribosomal subunit; homologous to mammalian ribosomal protein S10, no bacterial homolog; RPS10B has a paralog, RPS10A, that arose from the whole genome duplication  -0.830 0.006155 RRP5 YMR229C RNA binding protein involved in synthesis of both 18S and 5.8S rRNAs; component of both the ribosomal small subunit (SSU) processosome and the 90S preribosome; has binding preference for single stranded tracts of U's; relocalizes from nucleolus to nucleus upon DNA replication stress 182  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description  -0.819 0.003402 YMR237W YMR237W Member of the ChAPs family (Chs5p-Arf1p-binding proteins); members include Bch1p, Bch2p, Bud7p, and Chs6p; ChAPs family proteins form the exomer complex with Chs5p to mediate export of specific cargo proteins from the Golgi to the plasma membrane; may interact with ribosomes; protein abundance increases and forms cytoplasmic foci in response to DNA replication stress; BCH1 has a paralog, BUD7, that arose from the whole genome duplication  -0.818 7.82E-05 YCL061C YCL061C S-phase checkpoint protein required for DNA replication; stabilizes Pol2p at stalled replication forks during stress, where it forms a pausing complex with Tof1p and is phosphorylated by Mec1p; protects uncapped telomeres  -0.815 0.006384 nop2-6 YNL061W Probable RNA m(5)C methyltransferase, essential for processing and maturation of 27S pre-rRNA and large ribosomal subunit biogenesis; localized to the nucleolus; constituent of 66S pre-ribosomal particles  -0.803 0.004715 RNT1 YMR239C Nuclear dsRNA-specific ribonuclease (RNase III); involved in rDNA transcription, rRNA processing and U2 snRNA 3' end formation by cleavage of a stem-loop structure at the 3' end of U2 snRNA; involved in polyadenylation-independent transcription termination; involved in the cell wall stress response, regulating the degradation of cell wall integrity and morphogenesis checkpoint genes 183  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description  -0.786 0.001446 YMR228W YMR228W Mitochondrial RNA polymerase specificity factor; has structural similarity to S-adenosylmethionine-dependent methyltransferases and functional similarity to bacterial sigma-factors; Mtf1p interacts with and stabilizes the Rpo41p-promoter complex, enhancing DNA bending and melting to facilitate pre-initiation open complex formation  -0.785 0.000119 YNL069C YNL069C Ribosomal 60S subunit protein L16B; N-terminally acetylated, binds 5.8 S rRNA; transcriptionally regulated by Rap1p; homologous to mammalian ribosomal protein L13A and bacterial L13; RPL16B has a paralog, RPL16A, that arose from the whole genome duplication  -0.752 0.001001 dsl1-DC30 YNL258C Peripheral membrane protein needed for Golgi-to-ER retrograde traffic; forms a complex with Sec39p and Tip20p that interacts with ER SNAREs Sec20p and Use1p; component of the ER that interacts with coatomer  -0.73 0.006749 YNL107W YNL107W Subunit of both the NuA4 histone H4 acetyltransferase complex and the SWR1 complex, may function to antagonize silencing near telomeres; interacts with Swc4p  -0.722 6.66E-06 YLR014C YLR014C Zinc finger transcription factor containing a Zn(2)-Cys(6) binuclear cluster domain, positively regulates transcription of URA1, URA3, URA4, and URA10, which are involved in de novo pyrimidine biosynthesis, in response to pyrimidine starvation; activity may be modulated by interaction with Tup1p 184  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description Tested -0.679 0.001661 YOL006C YOL006C Topoisomerase I, nuclear enzyme that relieves torsional strain in DNA by cleaving and re-sealing the phosphodiester backbone; relaxes both positively and negatively supercoiled DNA; functions in replication, transcription, and recombination  -0.672 0.005118 gcd10-506 YNL062C Subunit of tRNA (1-methyladenosine) methyltransferase with Gcd14p  -0.647 0.000527 IMP4 YNL075W Component of the SSU processome, which is required for pre-18S rRNA processing Tested -0.644 5.85E-05 mms21-1 YEL019C SUMO ligase and component of the SMC5-SMC6 complex; this complex plays a key role in the removal of X-shaped DNA structures that arise between sister chromatids during DNA replication and repair Tested -0.634 1.73E-05 YDR369C YDR369C Component of the Mre11 complex, which is involved in double strand breaks, meiotic recombination, telomere maintenance, and checkpoint signaling Tested -0.634 0.000215 YIR002C YIR002C 3'-5' DNA helicase involved in error-free bypass of DNA lesions; binds to flap DNA in an error-free bypass pathway and stimulates the activity of Rad27p and Dna2p  -0.575 0.00694 nop2-3 YNL061W Probable RNA m(5)C methyltransferase, essential for processing and maturation of 27S pre-rRNA and large ribosomal subunit biogenesis; localized to the nucleolus; constituent of 66S pre-ribosomal particles 185  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description Not reproducible -0.569 0.002278 gcd14-4 YJL125C Subunit of tRNA (1-methyladenosine) methyltransferase, with Gcd10p, required for the modification of the adenine at position 58 in tRNAs, especially tRNAi-Met; first identified as a negative regulator of GCN4 expression  -0.560 0.00018 YNL073W YNL073W Mitochondrial lysine-tRNA synthetase, required for import of both aminoacylated and deacylated forms of tRNA(Lys) into mitochondria and for aminoacylation of mitochondrially encoded tRNA(Lys) Tested -0.559 0.002475 smc6-9 YLR383W Component of the SMC5-SMC6 complex; this complex plays a key role in the removal of X-shaped DNA structures that arise between sister chromatids during DNA replication and repair; homologous to S. pombe rad18  -0.549 4.93E-05 YMR224C YMR224C Subunit of the MRX complex with Rad50p and Xrs2p; complex functions in repair of DNA double-strand breaks and in telomere stability; exhibits nuclease activity that appears to be required for MRX function; widely conserved; forms nuclear foci upon DNA replication stress -0.534 7.60E-05 YNL064C YNL064C Type I HSP40 co-chaperone; involved in regulation of HSP90 and HSP70 functions; critical for determining cell size at Start as a function of growth rate; involved in protein translocation across membranes  -0.532 0.000743 pol1-1 YNL102W Catalytic subunit of the DNA polymerase I alpha-primase complex, required for the initiation of DNA replication 186  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description  -0.515 0.000667 YNL083W YNL083W ADP/ATP transporter; member of the Ca2+-binding subfamily of mitochondrial carriers, with two EF-hand motifs; transport activity of either Sal1p or Pet9p is critical for viability; polymorphic in different S. cerevisiae strains Not reproducible -0.514 7.12E-05 mss4-103 YDR208W Phosphatidylinositol-4-phosphate 5-kinase, involved in actin cytoskeleton organization and cell morphogenesis  -0.495 5.56E-05 POL30 YBR088C Proliferating cell nuclear antigen (PCNA), functions as the sliding clamp for DNA polymerase delta; may function as a docking site for other proteins required for mitotic and meiotic chromosomal DNA replication and repair Tested -0.488 0.000508 YOR144C YOR144C Subunit of an alternative replication factor C complex important for DNA replication and genome integrity; suppresses spontaneous DNA damage; involved in homologous recombination-mediated repair and telomere homeostasis; required for PCNA (Pol30p) unloading during DNA replication  -0.486 0.000155 taf5-20 YBR198C Subunit (90 kDa) of TFIID and SAGA complexes, involved in RNA polymerase II transcription initiation and in chromatin modification Tested -0.484 0.000383 YML032C YML032C Protein that stimulates strand exchange by facilitating Rad51p binding to single-stranded DNA; anneals complementary single-stranded DNA; involved in the repair of double-strand breaks in DNA during vegetative growth and meiosis 187  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description not able to validate -0.482 0.007678 rsc8-ts16 YFR037C Component of the RSC chromatin remodeling complex; essential for viability and mitotic growth Tested -0.466 0.003486 YMR190C YMR190C Nucleolar DNA helicase of the RecQ family; involved in genome integrity maintenance; regulates chromosome synapsis and meiotic joint molecule/crossover formation; potential role as repressor of a subset of rapamycin responsive genes; rapidly lost in response to rapamycin in Rrd1p-dependent manner; similar to human BLM and WRN proteins implicated in Bloom and Werner syndromes; forms nuclear foci upon DNA replication stress Tested -0.455 0.004099 YNL250W YNL250W Subunit of MRX complex with Mre11p and Xrs2p; complex is involved in processing double-strand DNA breaks in vegetative cells, initiation of meiotic DSBs, telomere maintenance, and nonhomologous end joining; forms nuclear foci upon DNA replication stress Not able to validate -0.451 0.004523 ssl1-T242I YLR005W Component of the core form of RNA polymerase transcription factor TFIIH, which has both protein kinase and DNA-dependent ATPase/helicase activities and is essential for transcription and nucleotide excision repair; interacts with Tfb4p  -0.447 0.001396 YDL072C_14 YDL072C Protein of unknown function; YET3 null mutant decreases the level of secreted invertase; homolog of human BAP31 protein; protein abundance increases in response to DNA replication stress 188  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description  -0.438 9.77E-05 YPL024W_14 YPL024W Subunit of the RecQ (Sgs1p) - Topo III (Top3p) complex; stimulates superhelical relaxing and ssDNA binding activities of Top3p; involved in response to DNA damage; functions in S phase-mediated cohesion establishment via a pathway involving the Ctf18-RFC complex and Mrc1p  -0.430 0.007521 NOP2 YNL061W Probable RNA m(5)C methyltransferase, essential for processing and maturation of 27S pre-rRNA and large ribosomal subunit biogenesis; localized to the nucleolus; constituent of 66S pre-ribosomal particles  -0.426 0.006312 YNL098C YNL098C GTP-binding protein; regulates nitrogen starvation response, sporulation, and filamentous growth; farnesylation and palmitoylation required for activity and localization to plasma membrane; homolog of mammalian Ras proto-oncogenes; RAS2 has a paralog, RAS1, that arose from the whole genome duplication Tested -0.412 0.000739 mcd1-73 YDL003W Essential alpha-kleisin subunit of the cohesin complex; required for sister chromatid cohesion in mitosis and meiosis; apoptosis induces cleavage and translocation of a C-terminal fragment to mitochondria  -0.410 0.000118 YKL139W YKL139W Catalytic (alpha) subunit of C-terminal domain kinase I (CTDK-I); phosphorylates both RNA pol II subunit Rpo21p to affect transcription and pre-mRNA 3' end processing, and ribosomal protein Rps2p to increase translational fidelity; similar to the Drosophila dCDK12 and human CDK12 and probably CDK13 189  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description  -0.409 0.000642 YOR008C YOR008C Sensor-transducer of the stress-activated PKC1-MPK1 kinase pathway; involved in maintenance of cell wall integrity; required for mitophagy; involved in organization of the actin cytoskeleton  -0.398 0.000782 YBL058W YBL058W UBX (ubiquitin regulatory X) domain-containing protein that regulates Glc7p phosphatase activity and interacts with Cdc48p; interacts with ubiquitylated proteins  -0.396 0.000136 YJL092W YJL092W DNA helicase and DNA-dependent ATPase involved in DNA repair and checkpoint recovery, needed for proper timing of commitment to meiotic recombination and transition from Meiosis I to II; blocks trinucleotide repeat expansion; affects genome stability Tested -0.391 8.73E-05 nse1-16 YLR007W Component of the SMC5-SMC6 complex; this complex plays a key role in the removal of X-shaped DNA structures that arise between sister chromatids during DNA replication and repair  -0.389 0.002834 YMR242C YMR242C Ribosomal 60S subunit protein L20A Tested -0.389 0.002438 apc2-8 YLR127C Subunit of the Anaphase-Promoting Complex/Cyclosome (APC/C), which is a ubiquitin-protein ligase required for degradation of anaphase inhibitors, including mitotic cyclins, during the metaphase/anaphase transition; component of the catalytic core of the APC/C; has similarity to cullin Cdc53p 190  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description Tested -0.377 0.002802 YBR098W YBR098W Subunit of the structure-specific Mms4p-Mus81p endonuclease that cleaves branched DNA; involved in recombination, DNA repair, and joint molecule formation/resolution during meiotic recombination Tested -0.368 0.001327 dbf4-1 YDR052C Regulatory subunit of Cdc7p-Dbf4p kinase complex; required for Cdc7p kinase activity and initiation of DNA replication; phosphorylates the Mcm2-7 family of proteins; cell cycle regulated; relative distribution to the nucleus increases upon DNA replication stress  -0.362 0.009887 YDL160C_14 YDL160C Cytoplasmic DExD/H-box helicase, stimulates mRNA decapping; coordinates distinct steps in mRNA function and decay, interacts with both the decapping and deadenylase complexes, may have a role in mRNA export and translation; C-terminus of Dhh1p interacts with Ngr1p and promotes POR1, but not EDC1 mRNA decay; forms cytoplasmic foci upon DNA replication stress  -0.359 0.00046 YPR036W YPR036W Subunit H of the eight-subunit V1 peripheral membrane domain of the vacuolar H+-ATPase (V-ATPase), an electrogenic proton pump found throughout the endomembrane system; serves as an activator or a structural stabilizer of the V-ATPase  -0.352 0.000213 YHR191C YHR191C Subunit of a complex with Ctf18p that shares some subunits with Replication Factor C and is required for sister chromatid cohesion 191  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description Tested -0.347 0.000776 rpn11-14 YFR004W Metalloprotease subunit of the 19S regulatory particle of the 26S proteasome lid; couples the deubiquitination and degradation of proteasome substrates; involved, independent of catalytic activity, in fission of mitochondria and peroxisomes; protein abundance increases in response to DNA replication stress  -0.333 1.21E-05 YML107C YML107C Protein required for nuclear retention of unspliced pre-mRNAs along with Mlp1p and Pml1p; anchored to nuclear pore complex via Mlp1p and Mlp2p; found with the subset of nuclear pores farthest from the nucleolus; may interact with ribosomes Not able to validate -0.331 0.007127 gfa1-97 YKL104C Glutamine-fructose-6-phosphate amidotransferase; catalyzes the formation of glucosamine-6-P and glutamate from fructose-6-P and glutamine in the first step of chitin biosynthesis; GFA1 has a paralogous region, comprising ORFs YMR084W-YMR085W, that arose from the whole genome duplication  -0.323 0.002275 YNL065W YNL065W Plasma membrane transporter of the major facilitator superfamily; member of the 12-spanner drug:H(+) antiporter DHA1 family; confers resistance to short-chain monocarboxylic acids and quinidine; involved in the excretion of excess amino acids; AQR1 has a paralog, QDR1, that arose from the whole genome duplication; relocalizes from plasma membrane to cytoplasm upon DNA replication stress 192  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description  -0.322 0.003807 cep3-2 YMR168C Essential kinetochore protein, component of the CBF3 complex that binds the CDEIII region of the centromere; contains an N-terminal Zn2Cys6 type zinc finger domain, a C-terminal acidic domain, and a putative coiled coil dimerization domain Not able to validate -0.313 0.009702 sly1-ts YDR189W Hydrophilic protein involved in vesicle trafficking between the ER and Golgi; SM (Sec1/Munc-18) family protein that binds the tSNARE Sed5p and stimulates its assembly into a trans-SNARE membrane-protein complex  -0.304 0.001619 mob2-20 YFL034C-B Activator of Cbk1p kinase; component of the RAM signaling network that regulates cellular polarity and morphogenesis; activation of Cbk1p facilitates the Ace2p-dependent daughter cell-specific transcription of genes involved in cell separation; similar to Mob1p Not reproducible -0.302 0.001274 esa1-D414 YOR244W Catalytic subunit of the histone acetyltransferase complex (NuA4); acetylates four conserved internal lysines of histone H4 N-terminal tail and can acetylate histone H2A; required for cell cycle progression and transcriptional silencing at the rDNA locus and regulation of autophagy  -0.293 0.000241 YLR015W YLR015W Subunit of COMPASS (Set1C) complex, which methylates Lys4 of histone H3 and functions in silencing at telomeres; has a C-terminal Sdc1 Dpy-30 Interaction (SDI) domain that mediates binding to Sdc1p; similar to trithorax-group protein ASH2L 193  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description  -0.291 0.000673 YGR180C YGR180C Ribonucleotide-diphosphate reductase (RNR) small subunit; the RNR complex catalyzes the rate-limiting step in dNTP synthesis and is regulated by DNA replication and DNA damage checkpoint pathways via localization of the small subunits; relocalizes from nucleus to cytoplasm upon DNA replication stress; RNR4 has a paralog, RNR2, that arose from the whole genome duplication  -0.286 0.009136 YBR094W YBR094W Putative tubulin tyrosine ligase associated with P-bodies; forms cytoplasmic foci upon DNA replication stress Tested -0.285 0.001058 YDR448W YDR448W Transcription coactivator, component of the ADA and SAGA transcriptional adaptor/HAT complexes Not able to validate -0.283 0.000176 YIR023W YIR023W Positive regulator of genes in multiple nitrogen degradation pathways; contains DNA binding domain but does not appear to bind the dodecanucleotide sequence present in the promoter region of many genes involved in allantoin catabolism  -0.274 0.003392 YGL108C YGL108C Protein of unknown function, predicted to be palmitoylated; green fluorescent protein (GFP)-fusion protein localizes to the cell periphery; protein abundance increases in response to DNA replication stress  -0.265 0.005391 YDR323C YDR323C Multivalent adaptor protein that facilitates vesicle-mediated vacuolar protein sorting by ensuring high-fidelity vesicle docking and fusion, essential for targeting of vesicles to the endosome and vacuole inheritance 194  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description Tested -0.264 0.002563 YPR135W YPR135W Chromatin-associated protein, required for sister chromatid cohesion; interacts with DNA polymerase alpha (Pol1p) and may link DNA synthesis to sister chromatid cohesion  -0.262 0.008619 YNL087W YNL087W ER protein involved in ER-plasma membrane tethering; one of 6 proteins (Ist2p, Scs2p, Scs22p, Tcb1p, Tcb2p, Tcb3p) that connect ER to plasma membrane (PM) and regulate PM phosphatidylinositol-4-phosphate (PI4P) levels by controlling access of Sac1p phosphatase to its substrate PI4P in the PM; contains 3 calcium and lipid binding domains; mRNA is targeted to bud; TCB2 has a paralog, TCB1, that arose from the whole genome duplication  -0.253 0.000234 YLR315W YLR315W Central kinetochore protein and subunit of the Ctf19 complex; mutants have elevated rates of chromosome loss; orthologous to fission yeast kinetochore protein cnl2  -0.252 0.000899 YBR093C YBR093C Repressible acid phosphatase (1 of 3) that also mediates extracellular nucleotide-derived phosphate hydrolysis; secretory pathway derived cell surface glycoprotein; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2  -0.251 0.002048 YER095W YER095W Strand exchange protein, forms a helical filament with DNA that searches for homology; involved in the recombinational repair of double-strand breaks in DNA during vegetative growth and meiosis 195  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description Tested -0.248 0.00016 YJR043C YJR043C Third subunit of DNA polymerase delta, involved in chromosomal DNA replication; required for error-prone DNA synthesis in DNA damage  -0.246 0.00994 YGL240W_14 YGL240W Processivity factor required for the ubiquitination activity of the anaphase promoting complex (APC), mediates the activity of the APC by contributing to substrate recognition; involved in cyclin proteolysis; contains a conserved DOC1 homology domain  -0.244 0.007812 YDL045W-A YDL045W-A Mitochondrial ribosomal protein of the small subunit; contains twin cysteine-x9-cysteine motifs  -0.244 0.007262 YBR039W YBR039W Gamma subunit of the F1 sector of mitochondrial F1F0 ATP synthase, which is a large, evolutionarily conserved enzyme complex required for ATP synthesis Tested -0.239 0.000112 YDL059C YDL059C Protein involved DNA DSB repair; repairs breaks in DNA during vegetative growth via recombination and single-strand annealing; anneals complementary single-stranded DNA; forms nuclear foci upon DNA replication stress; required for loading of Rad52p to DSBs  -0.236 0.008541 YBL038W YBL038W Mitochondrial ribosomal protein of the large subunit Not reproducible -0.227 0.000924 YMR048W YMR048W Replication fork factor; required for fork pausing; component of DNA replication checkpoint; required for accurate chromosome segregation; forms nuclear foci upon DNA replication stress 196  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description  -0.225 0.002762 YDR495C YDR495C Component of CORVET tethering complex; cytoplasmic protein required for the sorting and processing of soluble vacuolar proteins, acidification of the vacuolar lumen, and assembly of the vacuolar H+-ATPase  -0.224 0.001864 YNL213C YNL213C Protein of unknown function; null mutant lacks mitochondrial DNA and cannot grow on glycerol; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies Tested -0.224 0.009316 rfa1-M2 YAR007C Subunit of heterotrimeric Replication Protein A (RPA), a highly conserved single-stranded DNA binding protein involved in DNA replication, repair, and recombination  -0.221 0.003924 YBL098W YBL098W Kynurenine 3-mono oxygenase, required for the de novo biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p; putative therapeutic target for Huntington disease  -0.218 0.002153 YJL127C YJL127C Putative histone acetylase in transcriptional silencing, sequence-specific activator of histone genes, binds specifically and cooperatively to pairs of UAS elements in core histone promoters, functions at or near the TATA box -0.213 0.004051 YGR105W YGR105W Integral membrane protein that is required for vacuolar H+-ATPase (V-ATPase) function, although not an actual component of the V-ATPase complex; functions in the assembly of the V-ATPase; localized to the yeast endoplasmic reticulum (ER) 197  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description  -0.213 0.001386 YNL136W YNL136W Subunit of the NuA4 histone acetyltransferase complex, acetylates the N-terminal tails of histones H4 and H2A Not able to validate -0.212 0.008568 cdc37-ts YDR168W Essential Hsp90p co-chaperone; necessary for passage through the START phase of the cell cycle; stabilizes protein kinase nascent chains and participates along with Hsp90p in their folding  -0.211 0.001115 YHR064C YHR064C Hsp70 protein that interacts with Zuo1p (a DnaJ homolog) to form a ribosome-associated complex that binds the ribosome via the Zuo1p subunit; also involved in pleiotropic drug resistance via sequential activation of PDR1 and PDR5; binds ATP  -0.207 0.00427 YDR529C YDR529C Subunit 7 of the ubiquinol cytochrome-c reductase complex, which is a component of the mitochondrial inner membrane electron transport chain; oriented facing the mitochondrial matrix; N-terminus appears to play a role in complex assembly  -0.205 0.001307 YBL099W YBL099W Alpha subunit of the F1 sector of mitochondrial F1F0 ATP synthase, which is a large, evolutionarily conserved enzyme complex required for ATP synthesis; phosphorylated  -0.203 0.00267 YHR120W YHR120W DNA-binding protein of the mitochondria involved in repair of mitochondrial DNA, has ATPase activity and binds to DNA mismatches; has homology to E. coli MutS; transcription is induced during meiosis 198  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description  -0.203 0.001349 YDR017C YDR017C Inositol hexakisphosphate (IP6) and inositol heptakisphosphate (IP7) kinase; generation of high energy inositol pyrophosphates by Kcs1p is required for many processes such as vacuolar biogenesis, stress response and telomere maintenance  -0.201 0.008909 YLR410W YLR410W Inositol hexakisphosphate (IP6) and inositol heptakisphosphate (IP7) kinase; IP7 production is important for phosphate signaling; involved in cortical actin cytoskeleton function, and invasive pseudohyphal growth analogous to S. pombe asp1 Interactors that missed the cutoff but were validated as true interactors Tested -0.512 0.150472 YDL105W YDL105W Component of the SMC5-SMC6 complex; this complex plays a key role in the removal of X-shaped DNA structures that arise between sister chromatids during DNA replication and repair Tested -0.407 0.013313 YDR363W YDR363W Sumo-like domain protein; prevents accumulation of toxic intermediates during replication-associated recombinational repair; roles in silencing, lifespan, chromatid cohesion and the intra-S-phase DNA damage checkpoint; RENi family member Tested -0.599 0.158943 YBR087W YBR087W Subunit of heteropentameric Replication factor C (RF-C), acts as a clamp loader of the proliferating cell nuclear antigen (PCNA) processivity factor for DNA polymerases delta and epsilon 199  Comments if interaction was tested E-C P-value Name of allele Systematic name Gene description Tested -0.117 0.03631 YGR215W YGR215W Mitochondrial ribosomal protein of the small subunit Tested -0.184 0.008541 YLL002W YLL002W Histone acetyltransferase critical for cell survival in the presence of DNA damage during S phase; acetylates H3-K56 and H3-K9; involved in non-homologous end joining and in regulation of Ty1 transposition; interacts physically with Vps75p Tested -0.08 0.089621 YPR164W YPR164W Subunit of an E3 ubiquitin ligase complex involved in replication repair; stabilizes protein components of the replication fork such as the fork-pausing complex and leading strand polymerase, preventing fork collapse and promoting efficient recovery during replication stress; regulates Ty1 transposition; involved with Rtt101p in nonfunctional rRNA decay Tested -0.251 0.406659 YML015C YML015C TFIID subunit (40 kDa), involved in RNA polymerase II transcription initiation, similar to histone H3 with atypical histone fold motif of Spt3-like transcription factors Tested -0.402 0.032811 YGR002C YGR002C Component of the Swr1p complex that incorporates Htz1p into chromatin; component of the NuA4 histone acetyltransferase complex Tested -0.165 0.025826 YDR386W YDR386W Subunit of Mms4p-Mus81p endonuclease; cleaves branched DNA; involved in DNA repair, replication fork stability and joint molecule formation/resolution during meiotic recombination; promotes template switching during break-induced replication 200  Table A17 List of strains screened for DNA:RNA hybrids Kinetochore Proteolysis Mitochondria Endomembrane Morphogenesis DNA replication and repair Chromatin and transcription Ribosome and translation Nuclear Transport Housekeeping spc25-1 scl1-ts tom40-ts srp101-47 act1-119 scc2-4 SPT2 gcd1-502 NUP84 FEN2 SGO1 pre6-ts tom22-ts srp102-510 pfy1-14 scc4-ts YTA7 sup45-ts THP1 fad1-ts okp1-5 pup2-ts dre2-ts bet4-ts srv2-ts smc1-259 ASF1 sup35-ts NUP120 fol2-ts dam1-5 pre10-ts atm1-ts sec12-4 cdc42-1 smc3-1 LGE1 hyp2-2 cse1-1 SHM2 cse4-1 pre1-1 isd11-ts sec17-1 cof1-5 SGS1 CBF1 ipi1-ts crm1-1 MET22 glc7-12 cic1-2 MRPL27 sly1-ts cdc24-11 RRM3 EST3 erb1-ts  pro3-ts ipl1-2 rpn6-1 ALO1 trs130-ts cdc12-td RAD18 ESC1 kre33-ts  pgk1-ts CNN1 rpn5-1 acc1-ts yip1-4 inn1-ts RAD50 NPT1 rli1-ts  tpi1-ts sgt1-3 rpn1-821 acp1-ts bet1-1 qri1-ts1 RAD59 taf2-1 rpl42A-ts  GLY1 CHL4 UBR1 ETR1 sec14-3 smp3-1 RDH54 taf4-18 rps20-ts  ADE2 CDH1 UFO1 rib3-ts sec39-2 gpi10-ts MMS1 taf1-1 pwp1-ts  ADE5,7 201  Kinetochore Proteolysis Mitochondria Endomembrane Morphogenesis DNA replication and repair Chromatin and transcription Ribosome and translation Nuclear Transport Housekeeping MAD2  ACO1 myo2-16 gpi17-ts MMS4 taf7-ts1 rlp7-ts  ADK1 BUB1  OMA1 ret2-1 pbn1-ts TOF1 taf8-7 SRP40  DJP1 dsn1-7  MET7 use1-ts gab1-1 MUS81 taf10-ts utp5-ts  SSZ1 SLI15  yor060c-ts vti1-2 MUC1 nse4-ts2 rpb3-ts grs1-ts  ZUO1 BUB3  RRG9 CDC50 pkc1-1 RAD51 tfa1-ts cdc60-ts  ura6-4 cep3-1  mas1-1 erg20-ts gfa1-97 RAD52 MED6-ts frs1-ts   nnf1-17   cmd1-1 ugp1-ts MPH1 tfa2-45 frs2-ts   spc105-15   cdc1-4 kre5-ts2 RTT109 pob3-L78R gus1-ts   KRE28   ATG17 BIG1 XRS2 tfb1-1 gln4-ts   nsl1-5   VAC8 CYK3 CSM3 tfb3-ts tad3-ts   SHE1   VPS62 SSK1 smc6-9 rpc11-ts trm5-1   CTF3   VPS64  RAD1 rpc37-ts pop7-ts   CKS1   VID22  RAD10 ssl1- rpr2-ts   202  Kinetochore Proteolysis Mitochondria Endomembrane Morphogenesis DNA replication and repair Chromatin and transcription Ribosome and translation Nuclear Transport Housekeeping T242I ask1-2   ero1-1  RAD27 rpo21-1    ame1-4   ICE2  DDC1 sgv1-35    glc7-10     DUN1 spn1-ts    SKP1     MEC3 ssu72-2    tub4-Y445D    MRC1 CTK2    CIN8     MRE11 mcm1-ts    CTF19     nse3-ts     ctf13-30     eco1-1     spc42-11     pol1-1     nuf2-61     pol30-ts     NBL1     POL32     spc34-ts     cdc9-1     YBP2     DIA2     203  Kinetochore Proteolysis Mitochondria Endomembrane Morphogenesis DNA replication and repair Chromatin and transcription Ribosome and translation Nuclear Transport Housekeeping spc24 10-1    CTF4     MCM22     DPB3     cbf2-1     cdc7-4     duo1-2     LRS4     MCM16     CSM1     CIK1     cdc2-7     mif2-3     psf2-ts     stu1-5     rvb2-ts     MTW1     mcm2-1     spc110-220    orc1-ts     CDC28     ELG1          rfc2-1          rfc4-20          rfc5-1     204  Kinetochore Proteolysis Mitochondria Endomembrane Morphogenesis DNA replication and repair Chromatin and transcription Ribosome and translation Nuclear Transport Housekeeping      DCC1          CTF18          rfa1-M2          rsc8-ts21          arp9-1          SWC5          swc4-4          TOP1          TOP3      205  Table A18 Quantification of CTF phenotype in kinetochore mutants Strain Empty vector average fraction of colonies with sectors No. of replicatesRNase H expression average fraction of colonies with sectors No. of replicatesp-value for difference between empty vector and RNase H expression dam1-5 0.304 7 0.007 11 0.001 cse4-1 0.552 11 0.083 4 0.011 dsn1-7 0.423 12 0.057 5 0.014 cep3-1 0.300 11 0.044 12 0.005 spc105-15 0.407 3 0.148 3 0.034 spc34 0.156 3 0.144 3 0.607   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0166897/manifest

Comment

Related Items