Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Roles of microRNAs in Coxsackievirus B3 induced viral myocarditis Ye, Xin 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


24-ubc_2014_spring_ye_xin.pdf [ 6.76MB ]
JSON: 24-1.0166853.json
JSON-LD: 24-1.0166853-ld.json
RDF/XML (Pretty): 24-1.0166853-rdf.xml
RDF/JSON: 24-1.0166853-rdf.json
Turtle: 24-1.0166853-turtle.txt
N-Triples: 24-1.0166853-rdf-ntriples.txt
Original Record: 24-1.0166853-source.json
Full Text

Full Text

ROLES OF MICRORNAS IN COXSACKIEVIRUS B3  INDUCED VIRAL MYOCARDITIS by Xin Ye B.Sc., Peking University, 2006  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  The Faculty of Graduate and Postdoctoral Studies (Pathology and Laboratory of Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  October 2013  ? Xin Ye, 2013    ii Abstract Coxsackievirus B3 (CVB3) induced viral myocarditis, characterized by inflammation and cell death in the myocardium, is one of the leading causes of sudden unexpected death in infants and young adults. Both direct virus- and immune-mediated injuries contribute to the damage in the infected organs. A clear understanding of the virus-induced host cell signaling alterations would be key to elucidating the pathogenesis of viral myocarditis and to improve therapeutic strategies. Recently discovered microRNAs (miRNAs) are small endogenous non-coding RNAs widely involved in gene regulation controlling developmental processes and disease pathogenesis including cardiac diseases and viral infections. In this dissertation, the main objective is to investigate the roles of miRNAs in CVB3 replication and pathogenesis of myocarditis. I hypothesize that 1) CVB3 infection alters host miRNA expression profiles to benefit its own replication; and 2) the dysregulated miRNAs contributes to the damage and dysfunction of cardiomyocytes. I used in vitro (cultured cells) and in vivo (mouse) models  to explore the changes of host miRNAs? expression during CVB3 infection. miRNA microarray and quantitative-reverse transcription-PCR (q-RT-PCR) revealed that miR-126, miR-203 and miR-21 were upregulated by CVB3 infection. Further studies on these three miRNAs demonstrated their unique roles in regulating viral replication and cellular pathology in the myocardium. miR-126 was induced by CVB3 infection through  the ERK1/2-ETS1/2 signal pathway. I found that increased miR-126 in turn enhanced activation of ERK1/2 and degradation of ?-catenin through targeting SPRED1, LRP6 and WRCH1. This targeting benefited CVB3 replication and promoted virus-induced cell death. miR-203 was upregulated by the activation of the PKC/AP-1 cascade during CVB3 infection. I showed that miR-203 targeted ZFP-148 and supported cell survival and growth, which provided favorable environment for CVB3 replication. I further conducted the first investigation on the role of miR-21 in cell-cell connections among cardiomyocytes during CVB3 infection. I showed that miR-21 upregulation induced desmin degradation and desmosome disorganization via ubiquitin-proteasome pathway by targeting YOD1 and that miR-21 directly targeted VCL and disrupts fascia adherens. Together, my findings have shed light on the host-virus interactions in signal transduction pathways and provided new therapeutic strategies against CVB3-induced heart diseases. iii Preface The following chapters are mainly built on the foundation of three manuscripts. These three manuscripts are under the umbrella of one CIHR research grant [MOP231119], to which I contributed part of the experimental design and most of the preliminary data. I worked closely with Dr. Maged Gomaa Hemida, a postdoctoral fellow in the lab, on these projects and we are co-first authors on two of the three articles (Chapter 3 and 4). Chapter 3 is based on a research article (by Ye X, Hemida MG, Qiu Y, Hanson PJ, Zhang HM, Yang D) entitled ?MiR-126 promotes coxsackievirus replication by mediating cross-talk of ERK1/2 and Wnt/?-catenin signal pathways?, published in Cell Mol Life Sci. (2013 Jun 30. [Epub ahead of print]). I designed all the experiments and contributed to the majority of the data. Dr. Hemida worked with me on the q-RT-PCR experiments and part of the western blot (WB) analysis. I interpreted the data together and discussed the organization of the article. I contributed about 70% of the writing for the final manuscript. Chapter 4 is based on another article (by Hemida MG, Ye X, Zhang HM, Hanson PJ, Liu Z, McManus BM, Yang D)  entitled ?MicroRNA-203 enhances coxsackievirus B3 replication through targeting zinc finger protein-148?, published in Cell Mol Life Sci. (2013 Jan;70(2):277-91). I contributed to most of the in vivo experiments for mice infection, cardiac miRNA isolation and microarray data analysis, q-RT-PCR, miRNA target prediction and validation and part of the WB analysis. I analyzed the results together with Dr. Hemida and contributed about 30% of writing. Chapter 5 is based on a manuscript in preparation (Upregulated miR-21 disrupts cell-cell interaction in cardiomyocytes during Coxsackievirus infection. Ye X, Zhang HM, Qiu Y, Hanson PJ, Hemida MG, Wei W, Hoodless PA and YangD). I contributed to all experiments and analysis except part of the mice heart histology and miRNA microarray which were conducted by commercial service and the electronic microscopy (EM) performed partially by our institute internal service. I contributed ~80% of the writing for the final manuscript. Copyright permissions have been obtained from the journals. In addition, part of the introductory section were adapted from several review papers which I co-authored (Hemida MG, Ye X, Thair S, Yang D. Exploiting the therapeutic potential of microRNAs in viral diseases: expectations and limitations. Mol Diagn Ther. 2010;14(5):271-82; Qiu Y, Ye X, Hemida MG, Zhang HM, Hanson PJ and Yang D. Application of microRNAs in RNA nanotechnology and antiviral therapeutics. RNA iv Nanotechnology and Therapeutics, 2013. Taylor & Francis Books (in press); Yang D, Zhang HM, Ye X, Zhang L, Dai H. New trends in the development of treatments of viral myocarditis. Diagnosis and Treatment of Myocarditis. 2013. pp:167-196. InTech. DOI: 10.5772/54103). Besides the above work, I also conducted side projects on anti-CVB3 treatment using small RNA molecules during my PhD studies, resulting in one first-author manuscript (Ye X, Liu Z, Hemida MG, Yang D. Targeted delivery of mutant tolerant anti-coxsackievirus artificial microRNAs using folate conjugated bacteriophage Phi29 pRNA. PLoS One. 2011;6(6):e21215) and two first-author review articles (Ye X, Hemida MG, Zhang HM, Hanson PJ, Qiu Y, Yang D. Current advances in Phi29 pRNA biology and its application in drug delivery. Wiley Interdiscip Rev RNA. 2012;3(4):469-81. Ye X, Yang D. Recent advances in biological strategies for targeted drug delivery. Cardiovasc Hematol Disord Drug Targets; 2009; 9(3):206-221). During the collaboration with other members in our laboratory and with other research groups, I co-authored in another 9 peer-reviewed articles. All the animal researches were performed according to the animal experiment guidelines (Guide for the Care and Use of Laboratory Animals of the Canadian Council on Animal Care) following the protocols approved by the Animal Care Committee of Faculty of Medicine, University of British Columbia (A11-0052).            v Table of contents Abstract ......................................................................................................................................................... ii Preface ......................................................................................................................................................... iii Table of contents ........................................................................................................................................... v  List of tables ................................................................................................................................................. ix List of figures ................................................................................................................................................ x  List of abbreviations ................................................................................................................................... xii Acknowledgements .................................................................................................................................... xvi Chapter 1: Introduction ................................................................................................................................. 1 1.1. Overview of myocarditis .................................................................................................................... 1 1.1.1. Definition, history and epidemiology of myocarditis ................................................................. 1 1.1.2. Etiology of myocarditis ............................................................................................................... 2 1.1.3. Pathogenesis of viral myocarditis ............................................................................................... 4 1.1.4. Treatment of myocarditis ............................................................................................................ 6 1.2.   Coxsackievirus B3 (CVB3) ............................................................................................................. 7 1.2.1. History of CVB3 discovery and infection breakouts .................................................................. 7 1.2.2. CVB3 viral structure and gene functions .................................................................................... 8 1.2.3. CVB3 lifecycle .......................................................................................................................... 11 1.2.4. CVB3 induced alteration in host cell signaling......................................................................... 14 1.3.  microRNA (miRNAs) ..................................................................................................................... 18 1.3.1. Discovery and biogenesis of miRNA ........................................................................................ 18 1.3.2. Regulation of miRNA expression ............................................................................................. 20 1.3.3. miRNA in heart development and pathology............................................................................ 22 1.3.4. miRNAs in infectious disease ................................................................................................... 25 1.3.5. miRNA in CVB3 infection ....................................................................................................... 26 1.4. Research hypothesis and objectives ................................................................................................. 29 1.4.1. Background/Rationale ............................................................................................................... 29 vi 1.4.2. Hypothesis................................................................................................................................. 29 1.4.3. Specific aims and experimental design ..................................................................................... 29 Chapter 2 Materials and Methods ............................................................................................................... 32 2.1. Cell culture ....................................................................................................................................... 32  2.2. In vitro and in vivo infection of CVB3 ............................................................................................ 32 2.3. UV irradiation of CVB3 ................................................................................................................... 33 2.4. Inhibitor treatment ........................................................................................................................... 33 2.5. Viral plaque assay ............................................................................................................................ 33 2.6. MTS cell viability assay ................................................................................................................... 34 2.7. Desmin ubiquitination assay ............................................................................................................ 34 2.8. Hematoxylin and eosin (H&E) staining and echocardiography....................................................... 34 2.9. RNA extraction, miRNA microarray and quantitative reverse transcriptase PCR (q-RT-PCR) ..... 34 2.10. Regular q-RT-PCR for detection of CVB3 2A and desmin RNA ................................................. 35 2.11. Transfection of miRNA mimics, siRNAs and miRNA inhibitors ................................................. 36 2.12. Western blot (WB) ......................................................................................................................... 37 2.13. Immunofluorescence staining and confocal microscopy ............................................................... 38 2.14. Antibodies ...................................................................................................................................... 38 2.15. Electronic microscopy (EM) .......................................................................................................... 39 2.16. Live-cell confocal imaging ............................................................................................................ 39 2.17. Constructs ...................................................................................................................................... 40 2.18. Luciferase assay ............................................................................................................................. 42 2.19. Statistical analysis .......................................................................................................................... 42 Chapter 3: Roles of miR-126 in CVB3 replication and virus-induced cell death ....................................... 43 3.1. Background ...................................................................................................................................... 43 3.1.1. miR-126 structure and its expression ........................................................................................ 43 3.1.2. miR-126 in cardiac diseases and infectious diseases ................................................................ 43 3.1.3. miR-126 regulated signal pathways .......................................................................................... 44 vii 3.1.4. Roles of ERK1/2 and ?-catenin in CVB3 infection .................................................................. 44 3.2. Rationale .......................................................................................................................................... 45  3.3. Hypothesis and specific aims ........................................................................................................... 46 3.4. Results .............................................................................................................................................. 46  3.4.1. CVB3 infection induces miR-126 expression through the ERK1/2-ETS cascade .................... 46 3.4.2. miR-126 promotes CVB3 replication ....................................................................................... 52 3.4.3. miR-126 promotes CVB3 replication by targeting SPRED1 .................................................... 54 3.4.4. miR-126 sensitizes cells to CVB3-induced cell death and enhances viral progeny release ..... 61 3.4.5. miR-126 sensitizes cells to CVB3-induced cell death by targeting WRCH1 and LRP6 and promoting ?-catenin degradation ........................................................................................................ 64 3.5. Discussion ........................................................................................................................................ 73 3.6. Limitation and solutions .................................................................................................................. 77 3.7. Future directions .............................................................................................................................. 78 Chapter 4: miR-203 regulates CVB3 infection by targeting ZFP-148 ....................................................... 80 4.1. Background ...................................................................................................................................... 80 4.1.1. miR-203 structure and regulation of its expression .................................................................. 80 4.1.2. miR-203 in viral infection ......................................................................................................... 80 4.1.3. Zinc-finger protein-148 (ZFP-148) in cell cycle and apoptosis ................................................ 81 4.2. Rationale .......................................................................................................................................... 81  4.3. Hypothesis and specific aims ........................................................................................................... 82 4.4. Results .............................................................................................................................................. 82  4.4.1. CVB3 infection upregulates miR-203 in HL-1 cardiomyocytes and mouse heart.................... 82 4.4.2. Upregulation of miR-203 is through the activation of PKC/AP-1 cascade .............................. 86 4.4.3. ZFP-148 is a novel target gene of miR-203 .............................................................................. 89 4.4.4. miR-203 promotes CVB3 replication ....................................................................................... 92 4.4.5. Silencing of ZFP-148 with specific siRNAs benefits CVB3 replication .................................. 95 4.4.6. Transfection of miR-203 mimics promotes cell survival .......................................................... 96 viii 4.4.7. Suppression of ZFP-148 by miR-203 leads to the differential expression of cell cycle regulators ............................................................................................................................................ 98  4.5. Discussion ...................................................................................................................................... 100 4.6. Limitation and solutions ................................................................................................................ 105 4.7. Future directions ............................................................................................................................ 105 Chapter 5: miR-21 disrupts cell-cell interactions of cardiomyocytes during Coxsackievirus infection ... 107 5.1. Background .................................................................................................................................... 107 5.1.1. miR-21 structure and regulation of its expression .................................................................. 107 5.1.2. miR-21 in cardiac and infectious diseases .............................................................................. 108 5.1.3. Intercalated disks (ICDs) in cardiac functions ........................................................................ 108 5.2. Rationale ........................................................................................................................................ 109 5.3. Hypothesis and specific aims ......................................................................................................... 109 5.4. Results ............................................................................................................................................ 110  5.4.1. miR-21 expression is upregulated by CVB3 infection both in vivo and in vitro .................... 110 5.4.2. miR-21 suppresses desmin expression and disrupts desmosome organization during CVB3 infection ............................................................................................................................................ 111  5.4.3. miR-21 promotes desmin degradation through the ubiquitin-proteasome pathway ............... 114 5.4.4. miR-21 specifically targets YOD1 .......................................................................................... 117 5.4.5. Suppression of YOD1 induces desmin degradation and desmosome disruption .................... 120 5.4.6. miR-21 interrupts fascia adherens in human cardiomyocytes by targeting vinculin (VCL) ... 125 5.5. Discussion ...................................................................................................................................... 131 5.6. Limitation and solutions ................................................................................................................ 134 5.7. Future directions ............................................................................................................................ 135 Chapter 6 Closing remarks ........................................................................................................................ 137 6.1. Research summary and conclusion ................................................................................................ 137 6.2. Research significance ..................................................................................................................... 138 Bibliography ............................................................................................................................................. 142 ix List of tables Table 1. Etiology of myocarditis................................................................................................................... 3 Table 2. Cardiac miRNAs regulated by transcriptional factors .................................................................. 21 Table 3. miRNAs involved in cardiac pathology ........................................................................................ 25 Table 4. miRNAs in CVB3 infection .......................................................................................................... 28 Table 5. Primers for q-PCR ........................................................................................................................ 36 Table 6. Oligoes and Primers for luciferase constructs............................................................................... 41 Table 7. Top 10 conserved targets of miR-126 predicted by using TargetScan ......................................... 64 Table 8. Top 10 potential targets of miR-21 predicted by TargetScan ..................................................... 118                 x List of figures Figure 1. Three phases of viral myocarditis .................................................................................................. 6 Figure 2. Genome organization of CVB3 ................................................................................................... 10 Figure 3. CVB3 replication cycle ............................................................................................................... 13 Figure 4. Brief summary of signal transduction networks during CVB3 infection .................................... 17 Figure 5. Biogenesis of miRNAs ................................................................................................................ 19 Figure 6. CVB3 infection upregulates miR-126 through ERK-ETS cascade. ............................................ 49 Figure 7. ETS-1/2 phosphorylation associates with miR-126 induction during CVB3 infection. .............. 51 Figure 8. miR-126 levels after transfection of miR-126 mimic or its inhibitor. ......................................... 52 Figure 9. miR-126 promotes CVB3 replication. ......................................................................................... 53 Figure 10. miR-126 promotes CVB3 replication by targeting SPRED1 and enhancing ERK1/2 activation. .................................................................................................................................................................... 57  Figure 11. Knockdown of SPRED1 enhances CVB3 replication in HeLa cells and inhibition of miR-126 supresses CVB3 replication in HL-1 cells. ................................................................................................. 59 Figure 12. ERK1/2 inhibitor blocks the effect of miR-126 on VP-1 upregulation but not on the cell death or viral progeny release. .............................................................................................................................. 60  Figure 13. miR-126 enhances CVB3-induced CPE and cell death. ............................................................ 62 Figure 14. Inhibition of caspase-3 activation alleviates the effect of miR-126 on cell death and viral particle release. ........................................................................................................................................... 63  Figure 15. LRP6 and WRCH1 are specific targets of miR-126. ................................................................. 66 Figure 16. Design of luciferase reporter constructs for LRP6 and WRCH1. .............................................. 67 Figure 17. Regulation of GSK-3?/?-catenin cascade by miR-126 through targeting WRCH1 and LRP6. 69 Figure 18. Knockdown of LRP6 or WRCH1 sensitizes the cells to CVB3-induced cell death and enhances viral progeny release. .................................................................................................................................. 71  Figure 19. miR-126 inhibitors represses ?-catenin degradation and caspase-3 activation in HUVEC cells. .................................................................................................................................................................... 72  Figure 20. A proposed model of regulatory roles of miR-126 in CVB3 infection. .................................... 76 xi Figure 21. CVB3 infection alters cardiac miRNA expression profiles. ...................................................... 84 Figure 22. CVB3 infection upregulates miR-203. ...................................................................................... 85 Figure 23. CVB3 induces upregulation of miR-203 through activation of PKC and differential regulation of downstream AP-1 family transcription factors JunB and c-Jun. ............................................................ 87 Figure 24. Silencing of JunB with siRNAs markedly reduces miR-203 expression. ................................. 88 Figure 25. ZFP-148 is a novel target of miR-203. ...................................................................................... 91 Figure 26. miR-203 expression promotes CVB3 replication in HeLa cells................................................ 94 Figure 27. Silencing of ZFP-148 with specific siRNA promotes CVB3 replication. ................................. 95 Figure 28. miR-203 expression enhances HeLa cell growth. ..................................................................... 97 Figure 29. miR-203 expression induces differential expression of downstream responsive genes of ZFP-148. ............................................................................................................................................................. 99  Figure 30. ZFP-148 regulates p53, p21Waf1 and p27Kip1 in CVB3 infection. ......................................... 99 Figure 31. A putative model of miR-203 action leading to enhanced CVB3 replication. ........................ 104 Figure 32. CVB3 infection induces miR-21 expression. .......................................................................... 110 Figure 33. miR-21 levels after transfection of miRNA mimics or inhibitors in HL-1 cells. .................... 112 Figure 34. miR-21 downregulates desmin expression and disrupts desmosome structures. .................... 113 Figure 35. miR-21 promotes desmin degradation through ubiquitin-proteasome pathway. ..................... 116 Figure 36. miR-21 targets YOD1. ............................................................................................................. 119 Figure 37. YOD1 regulated desmin degradation during CVB3 infection................................................. 123 Figure 38. miR-21 and YOD1 siRNA induce co-localization of desmin and proteasome. ...................... 124 Figure 39. miR-21 targets VCL. ............................................................................................................... 127 Figure 40. miR-21 levels after transfection of miRNA mimics or inhibitors in different cell lines. ........ 127 Figure 41. miR-21 interrupts fascia adherens during CVB3 infection. .................................................... 129 Figure 42. Kocking down of VCL interrupts fascia adherens. ................................................................. 130 Figure 43. A putative model of miR-21 regulation on ICD integrity during CVB3 infection. ................. 134  xii List of abbreviations AA: amino acids  ACE: angiotensin-converting enzyme  Ago: Argonaute  APC: antigen presenting cell  ARB: angiotensin-II receptor blockers  ATM: ataxia-telangiectasia mutated  AUF-1: AU-rich element RNA-binding protein 1 BM-MSCs : bone marrow-derived mesenchymal stem cells  BMP: bone morphogenetic protein  CAR: coxsackievirus-adenovirus receptor  CDK: cyclin-dependent kinase  CDKI: cyclin-dependent kinase inhibitor  CPE: cytopathic effect  CRE: cis-acting replication element  CVA: Coxsackie group A serotypes CVB: Coxsackie group B serotypes Cx43: Connexin-43 DAF: decay-accelerating factor  DCM: dilated cardiomyopathy  DMEM: Dulbecco's modified Eagle's medium  DUB: dequibiquiting enzyme  DYRK2: dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 dpi: day post infection EBV: Epstein-Barr virus  ECM: extracellular matrix eIF4G: eukaryotic initiation factor 4G  xiii ELISA: enzyme-linked immunosorbent assay  EM: electronic microscopy  EMT: epithelial to mesenchymal transition  ER: Endoplasmic reticulum  ERAD: endoplasmic reticulum (ER)-associated degradation  ERK1/2: extracellular signal regulated kinase1/2 ES: embryonic stem  FAK: focal adhesion kinase  FBS: fetal bovine serum  GHI: glycosylphosphatidylinositol  GSK-3?: glycogen synthase kinase 3? HCV: hepatitis C virus HDACi: Histone deacetylase inhibitors  H&E: Hematoxylin and eosin  HH: Hedgehog  HIV: human immunodeficiency virus  hpi: hours post infection  HPV: human papillomaviruses  HUVEC: human umbilical vein endothelial cell ICD: Intercalated disks  IL: interleukin  IFN: interferon IRES: internal ribosome entry site  IRF3: IFN regulatory factor 3 IVIG: Intravenous immunoglobulin KDa: kilodalton KO: knockout  xiv KSHV: Kaposi's sarcoma-associated herpesvirus LNA: locked nucleic acid  LV: left ventricular  MAVS: mitochondrial antiviral signaling  MCK: muscle creatine kinase  MKP-1: mitogen-activated protein kinase phosphatase  MMP: metalloproteinases  Mut: mutant MyD88: myeloid differentiation factor-88 MOI: multiplicity of infection MTS: (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt) NFIB: NFIB nuclear factor I/B NK cells: natural killer cells nt: nucleotides  ORF: open reading frame  OTU: ovarian tumor  PABP: poly(A)-binding protein  PBS: phosphate buffer saline  PCBP: poly(C)-binding proteins  pfu/mL: plaque forming units per mL  PFV: primate foamy virus  PKC: protein kinase C  PI3K: phophatidyl-3-kinase  Pri-miRNA: primary miRNA precursors  PTBP: Polypyrimidine tract-binding protein  q-RT-PCR: quantitative reverse transcriptase PCR  xv Rb: retinoblastoma  RISC: RNA-induced silencing complex  RNF: ring finger protein  ROS: reactive oxygen species  RSV: respiratory syncytial virus  RT: reverse transcription  SCR: short consensus repeat sh: sham siRNA: small interfering RNAs  SOCS3: suppressor of cytokine signalling-3 SPRY1: sprouty homolog 1 TBK1: TNFR-associated factor family member-associated NF-kB activator-binding kinase 1 THBS1: Thrombospondin 1 TIMP: tissue inhibitor of metalloproteinase TNF: tumor necrosis factor TLR: Toll-like receptors UPS: ubiquitin-proteasome system  UTR: untranslated region VCAM-1: vascular cell adhesion molecule 1 VCL: vinculin  VPg: viral genome linked protein VSV: vesicular stomatitis virus WB: western blot wt: wide type YOD1: OTU Deubiquinating Enzyme 1 Homolog ZEB1: Zinc finger E-box-binding homeobox 1  xvi Acknowledgements  I dedicate this dissertation to my dear parents, Jianying and Yagen. Their selfless caring and guidance has been nurturing my growth and providing continuous support on my journey to seek the science. Their hard work and endurance brings me the courage to face the failures and hold on to my dreams. I greatly appreciate the guidance of my grandfather, Min, whose wisdom and optimism is my spiritual compass. I would like to thank my beloved wife, Wei. As a soul mate, she gives me her love, unrelenting support and continuous encouragement. As a research scientist, she provides invaluable suggestions and critics for my studies.   I am enormously grateful for my supervisor Dr. Decheng Yang who provided me this opportunity to pursue graduate study at UBC. His patient guidance, continuous encouragement and inspiring advice foster my development to an independent researcher. His mentoring on my experimental design and data interpretation has greatly enhanced my research skills.  He also gives me chances to participating in writing research grants, reviewing manuscripts and supervising undergraduate students and fresh graduate students. Particularly, he allows me to volunteer as a part-time lab manager to improve my leadership, communication and management skills. Most importantly, I thank him for giving me freedom to explore my research and encouraging me to participate in various research projects. These well-rounded training experiences would be the invaluable foundation of my future career. I would also like to express my gratitude to my colleagues at the James Hogg Research Centre. Our Research Associate Dr. Huifang Mary Zhang trained me for the experiment skills and provided great help in my projects. She is a mentor and a friend who gives me valuable suggestions and help not only in research but also in daily life. Post-doctoral fellow Dr. Maged Gomaa Hemida worked closely with me on my research projects and greatly accelerated the progress. My peers Zhen Liu, Ye Qiu and Paul Hanson provided valuable suggestions and technical support for my study and made our lab a fun place to work at. I acknowledge the support from Jingchun Zhang in Dr. Honglin Luo?s Lab, Zongshu Luo in Dr. Bruce McManus? lab, Dr. David Walker and Fanny Chu in Transmission Electron Microscope Core, Claire Smits, Tatjana Bozin, Lynne Carter and Lubos Bohunek from the GEM. xvii I am thankful for my supervisory committee (Dr. Haydn Pritchard, Dr. Helene Cote, Dr. Wan Lam and Dr. Cathie Garnis) for their inspiring advice and critical comments to improve my research and their guidance in completion of the program and pursuing for future career. The project in this dissertation was funded by a CIHR research grant and a four-year PhD fellowship from University of British Columbia.                 1 Chapter 1: Introduction 1.1. Overview of myocarditis 1.1.1. Definition, history and epidemiology of myocarditis Myocarditis is an inflammatory cardiac disease defined by the infiltration of immune cells and necrosis/apoptosis of cardiomyocytes without an ischemic injury according to the Dallas criteria [1, 2]. It carries potential for significant morbidity due to end-stage cardiac failure and accounts for ~20% of sudden, unexpected death in young adults under 40 [3]. The immune response in the heart frequently leads to structural and functional defects in the myocardium, resulting in chest pain, arrhythmia, dyspnoea and malaise [4]. End stage myocarditis frequently progresses to dilated cardiomyopathy (DCM), a severe cardiac failure requiring heart transplantation [5]. As much as 9-16% of new onset DCM patients show evidence of prior myocarditis [6].  The term ?myocarditis? was initially introduced by Sobernheim in 1837 and further classified by Feidler in 1899 [7]. Due to disparities in clinical presentation and the recognition of coronary artery disease as the major cause of heart dysfunction at the beginning of the 20th century, the significance of ?myocarditis? was under-estimated. It was not until the 1960s that histological methods based on endomyocardial biopsy were applied to confirm the diagnosis of myocarditis, which significantly promoted the advance of myocarditis research [8]. In 1986, the Dallas criteria were proposed to standardize the diagnosis of myocarditis. These guidelines classified the myocarditis into different categories. According to the initial biopsies, it was sub-grouped to active myocarditis (myocardial necrosis with adjacent inflammatory infiltrate), borderline myocarditis (sparse inflammatory infiltrate and non-apparent myocyte damage) and negative myocarditis (no inflammation or myocytolysis). According to the subsequent biopsies, myocarditis can be further divided into persistent, healing and healed myocarditis [9]. Based on the types of inflammatory infiltrate, myocarditis can also be described as lymphocytic, eosinophilic, granulomatous or giant cell myocarditis. However, it is now well recognized that these traditional histopathological criteria should not be considered as the gold standard for the diagnosis of myocarditis since the routine 4-6 sampling in live patients are insufficient to obtain definitive diagnosis, which requires at least 17 samples as demonstrated by postmortem analysis [10]. Another now 2 seldom used classification method proposed by Lieberman divided myocarditis into fulminant, subacute, chronic active and chronic persistent subtypes [11]. Recently, a value of >14 leukocytes/mm2 with the presence of T lymphocytes >7 cells/mm2 has been considered a realistic cut off to reach a diagnosis of myocarditis [12]. Due to the low sensitivity of diagnosis and disagreement among pathologists, the exact incidence of myocarditis is unknown. On the basis of unselected routine autopsies performed over a 10-year period in a defined area in Sweden, the frequency of myocarditis is about 1.06% [13]. A recent retrospective study showed a 0.005% incidence during emergency department visits [14]. The results vary from different studies and are affected by the population and diagnostic criteria. Development of better diagnosis strategies would be necessary to achieve a more definitive understanding on the significance of the disease. 1.1.2. Etiology of myocarditis Myocarditis is a very heterogeneous disease associated with a broad array of etiologies including both infectious and non-infectious inducers (Table 1) [1, 15]. Non-infectious agents such as toxins, autoimmune disorders, and allergies have been identified to trigger myocarditis [16]. Infectious exposures such as viruses, bacteria, and protozoa are the prevalent triggers for myocarditis. Bacteria myocarditis is less common with a post-mortem rate from 0.2%-1.5% [17]. Toxin produced by bacteria, such as clostridium and diphtheria, can induce severe damage in the myocardium. The most common protozoan is Trypanosoma cruzi that causes Chagas disease with high prevalence in Central and South America and low occurrence in the United States [18, 19]. Cardiotropic viruses are the most frequently identified pathogens in acute myocarditis in North America and Western Europe [20-22]. Virus-induced myocarditis is usually termed as viral myocarditis. There are more than 20 viruses associated with viral myocarditis with different prevalences according to the geographic regions [16]. In Japan, serologic studies indicate a close connection between the hepatitis C virus (HCV) with myocarditis [23]. In Western Europe, Parvovirus B19 is recently the most commonly detected virus in endomyocardial biopsy samples with human herpesvirus-6 and enterovirus ranked NO.2 and 3, respectively [24]. Enteroviruses, particularly Coxsackievirus group B serotypes (CVB), such as CVB3, have been traditionally perceived 3 as the common pathogens in viral myocarditis, accounting for 30%-50% of all cases in North America [25].  Table 1. Etiology of myocarditis Infectious Immune-related Toxin Bacterial:  Brucella; Corynebacterium diphtheria; gonococcus; Haemophilus influenza; meningococcus, mycobacterium; Mycoplasma pneumonia; pneumococcus; salmonella; Serratia marcescens; staphylococcus; Streptococcus pneumonia; Strep. pyogenes ; Treponema pallidum; Tropheryma whippelii; Vibrio cholerae Allergens:  acetazolamide, amitriptyline; cefaclor; colchicines; furosemide; isoniazid, lidocaine; methyldopa; penicillin; phenylbutazone; phenytoin; reserpine; streptomycin; tetanus toxoid; tetracycline; thiazides Drugs:  amphetamines; anthracyclines; catecholamines; cocaine; cyclophosphamide; ethanol; fluorouracil; hemetine; interleukin-2; lithium; trastuzumab Spirochetal:  borrelia and leptospira Fungal:  Actinomyces; aspergillus; blastomyces; candida; coccidioides; Cryptococcus; histoplasma; mucormycoses, nocardia; sporothrix Allograft Rejection:  heart-transplant rejection Heavy metals:  copper; iron;  lead Protozoal: Toxoplasma gondii; Trypanosoma cruzi Autoimmune Diseases: Chagas? disease; Chlamydia pneumonia; Churg?Strauss syndrome; inflammatory bowel disease; giant-cell myocarditis; insulindependent diabetes mellitus; Kawasaki?s disease; myasthenia gravis; polymyositis; Sarcoidosis; Scleroderma;  systemic lupus erythematosus; thyrotoxicosis; Wegener?s granulomatosis Physical agents:  electric shock; hyperpyrexia; radiation Parasitic:  Ascaris; Echinococcus granulosus; Paragonimus westermani; schistosoma; Taenia solium; Trichinella spiralis; visceral larva migrans; Wuchereria bancrofti Miscellaneous:  arsenic; azides;  bee and wasp stings;  carbon monoxide; inhalants;  phosphorus; scorpion bites; snake bites; spider bites Rickettsial: Coxiella burnetii; Rickettsia rickettsii; Rick. tsutsugamushi Viral: Coxsackievirus; cytomegalovirus; dengue virus; echovirus; encephalomyocarditis; Epstein?Barr virus; hepatitis A virus; hepatitis C virus; herpes simplex virus, herpes zoster; human immunodeficiency virus; nfluenza A virus; influenza B virus; Junin virus; lymphocytic choriomeningitis; measles virus; mumps virus; parvovirus; poliovirus; rabies virus; respiratory syncytial virus; rubella virus; rubeola; vaccinia virus; varicella?zoster virus; variola virus; yellow fever virus  Three categories of etiological factors are listed as adapted from the review by Feldman and McNamara [1]. Coxsackievirus ranks top in the viral category for causing myocarditis [26]. 4 1.1.3. Pathogenesis of viral myocarditis CVB3-induced viral myocarditis is habitually viewed as a chronic sequence of three distinct pathological phases in murine models: 1) acute viral infection phase also called viremic stage; 2) sub-acute phase also known as inflammatory stage; and 3) chronic phase or remodeling stage [4, 27] (Fig. 1).  During the acute viremic phase (0-4 day post infection, dpi), prominent viral infection can be detected in blood, spleen, pancreas and myocardium [28]. Intense viral replication inflicts direct cardiomyocyte injury, necrosis and apoptosis, contributing to the subsequent disease progression [29, 30]. At this stage, the host immune response mounted by innate immunity plays the central role. Several cytokines such as interleukin (IL)-1, IL-6, IL-18, tumor necrosis factor (TNF) and interferons (IFN) are induced in the myocardium by myeloid differentiation factor-88 (MyD88), contributing to the infiltration of inflammatory cells [31-34]. Knockout (KO) of MyD88 improves survival rates in CVB3 infected mice with much decreased levels of viral replication, viral receptor, p56lck and inflammation [31]. The expression of cytokines triggers the remodeling of the extracellular matrix (ECM) by regulating metalloproteinases (MMP) and their tissue inhibitors (TIMP) [35]. Toll-like receptors (TLRs) have also been found to be involved in viral myocarditis. TLRs are responsible for recognizing microbial pathogens and activate innate immune system as a defense against pathogen invasion [36]. More than 10 members have been identified in this family and TLR3 and TLR4 are reported to be detected in the heart [37]. TLR3 deficiency causes earlier mortality and increased viral replication in encephalomyocarditis virus infected mice [38]. Supprisingly, TLR4 deficiency leads to a temporal increase in CVB3 replication at 2 dpi but significantly decreases cardiac CVB3 titer at 12 dpi [39]. It is suggested that this is associated with the inhibition in IL-1? and IL-18 levels in TLR4 KO mice but further studies are needed to validate such speculation and elucidate the underlying mechanisms. The sub-acute phase spans from 5 dpi to 14 dpi when antiviral neutralizing antibodies titers reach the highest levels to eliminate the myocardial CVB infection and therefore it is difficult to detect the presence of active viral progeny [40]. This stage features an intense inflammatory response evoked by viral infection including activation of natural killer (NK) cells, myocardial infiltration by T cells and macrophages, induction of cell adhesion molecules, and further innate immunity responses [31, 41-44]. 5 The activated NK cells, probably induced by IL-2, diminish the virus infected cardiomyocytes to limit the viral spread [45]. Deficiency in NK cell production increases viral titers and myocardial injury in murine viral myocarditis models [41]. However, cytotoxic molecules such as perforin produced by NK cells may exacerbate the myocardial necrosis and lymphocyte infiltration [46]. In the meantime, viral infection induces expression of pro-inflammatory cytokines such as B7-1, B7-2, and CD40 on cardiomyocytes, which carry an antigen presenting cell (APC)-like function to trigger the attack from antigen-specific T cells [42, 47]. Intramyocardial expression of various cytokines and chemokines also induces and maintains ECM remodeling, regulates cardiomyocyte apoptosis, and contributes to the decrease in left ventricular (LV) function [48-52].  The chronic phase (15-90 dpi) begins with the complete clearance of progeny viruses from the blood and peripheral tissues though viral proteins may persist for a longer period [53-55]. During this stage, the inflammatory response subsides with low levels of infiltration and cytokine expression, contributing to the remodeling of ECM via the regulation of MMP and TIMP [56]. Despite the gradual healing, continued inflammation induces mobilization of fibroblast precursors that can lead to fibrosis, calcification, and scarring of the myocardium, ventricular dilation and cardiac hypertrophy, resulting in irreversible tissue destruction [57-59]. In some patients, persistent infection of low-level CVB3 without significant viral replication or progeny induces expression of regulatory cytokine IL-18, proinflammatory cytokine TNF-?, and immunosuppressive/fibrogenic cytokine tumor growth factor-?, which lead to a persisting myocarditis, chronic depression of LV function and LV dilatation, and final progression to DCM [60, 61]. 6  Figure 1. Three phases of viral myocarditis In murine viral myocarditis model, three distinct pathological phases have been described: 1) acute viral infection phase also called viremic stage; 2) sub-acute phase also known as inflammatory stage; and 3) chronic phase or remodeling stage. Each stage is corresponding to a certain post infection time point and characterized by some essential events as listed.  1.1.4. Treatment of myocarditis There are several treatment strategies for myocarditis and subsequent DCM but none of them is very effective or specific. Antiviral therapy seems plausible for viral myocarditis. In patients with persistent viral infection and chronic DCM, interferon treatment has been found to alleviate the viral load and improve LV functions [62]. The major limitation of this method is that most cases of myocarditis are diagnosed weeks after initial viral infection when the inflammation is the dominant factor for the disease, resulting in very moderate effect for administration of antiviral drugs. Anti-inflammatory drugs or immunosuppressants are treatments targeting the inflammation process but found to be not effective. Nonsteroidal anti-inflammatory drugs have been tested in several studies with the attempt to suppress the inflammation during myocarditis but the results actually showed enhanced inflammation and myocardium damage [63, 64]. Immunosuppressants were also found to be disappointing in treating acute myocarditis and idiopathic DCM but showed some beneficial effect in chronic virus-negative DCM [65, 66]. 7 Intravenous immunoglobulin (IVIG) is a method combining antiviral and immunemodulating effects but only showed some effect in improving LV function in children, not in adults [67-69]. For patients suffering severe myocarditis and DCM, standard heart failure therapy including beta-blockers, diuretics, angiotensin-converting enzyme (ACE) inhibitors or angiotensin-II receptor blockers (ARBs) may be considered [22]. Cardiac transplantation is the final option for patients who are refractory to optimal medial therapy.  1.2.   Coxsackievirus B3 (CVB3) 1.2.1. History of CVB3 discovery and infection breakouts The coxsackieviruses belong to the Picornaviridae family in the genus termed enterovirus which are transmitted by the fecal-oral route [70]. ?Pico? means ?very small? and ?rna? indicates the genomic components of these viruses. The coxsackieviruses were first discovered by Drs. Gilbert Dalldorf and Grace Sickles who had been studying the disease polio [71]. This discovery was motivated by the search of mouse-adaptive poliovirus to establish a newer and cheaper animal model than monkeys to investigate the disease. The virus they isolated from the feces of children with paralysis showed some unusual features which associated paralysis with destruction lesions of the skeletal muscles but not the central nervous system as occurs in poliovirus. This virus also differs from traditional poliovirus in that it can only infect suckling mice but not the adult ones. In 1949, Dalldorf suggested to call this new isolate as Coxsackie virus after the name of the small town in New York where the specimens were obtained. From then on, at least 29 serotypes of Coxsackieviruses divided into two groups (23 for A and 6 for B) have been identified [72, 73]. The categorization of Coxsackieviruses was initially based on their histopathology characteristics. The group A viruses trigger generalized myositis while the group B viruses show a broad tissue tropism in infants causing a slow, spastic paralytic death with destruction in multiple organs including the pancreas, heart,  liver and central nervous system [74]. The group A viruses (CVA) was found to be associated with herpangina, severe sore throat, and hand-foot-and-mouth disease [75, 76] while the group B serotypes were the etiological agents of Iceland's pleurodynia, a severe human disease with pain in the chest [77]. According to the United States National Enterovirus Surveillance System, 52,812 enterovirus detections were reported from 1970 to 2005 among which the incidences of 8 Coxsackieviruses accounted for 32% with CVAs for 7.6% and CVBs for 24.4%, indicating a serious health threat from these viruses  [78]. Particularly, CVBs only have 6 serotypes but comprise more than 20% of all the cases of the infection, indicating their importance in this genus. 1.2.2. CVB3 viral structure and gene functions All the 6 members in the CVB group have been reported to be associated with myocarditis while CVB3 is the most common one [25, 70, 79-83]. Like other picornaviruses, CVB3 is a small, non-enveloped virus containing a single, positive-stranded RNA genome packed in a capsid composed of 4 viral proteins VP-1-4. Its 7400- nucleotides (nt) long genome consists of a single long open reading frame (ORF) flanked by 5? and 3? untranslated regions (UTR) which is essential for its replication [84] (Fig. 2). This ORF is translated into a single polyprotein that is cleaved into three intermediate proteins P1, P2 and P3 by 2A and 3C viral proteases. The P1 precursor is processed by viral protease 3CD into VP0, VP1 and VP3 while VP0 further maturates to VP2 and VP4 [85].  These four proteins are structural foundations for the viral capsid responsible for the encapsulation of the viral genome as well as the attachment and entry of the virus through coxsackievirus-adenovirus receptor (CAR). Particularly, VP-2 has been found to enable CVB3 to utilize a secondary receptor, decay-accelerating factor (DAF) for infection [86]. The capsid composed of these proteins is constructed from 12 pentameric units with each unit assembled from 5 protein protomers (60 protomers for each capsid) [87, 88]. P2 and P3 are cleaved by viral protease 3C/3CD into 7 non-structural proteins including the followings: 1) one RNA-dependent-RNA polymerase (3D) in charge of the viral genome replication [89], 2) two viral proteases (2A and 3C) controlling cleavage of host and viral proteins [70, 90], 3) an ATPase (2C) facilitating the viral RNA synthesis and vesicle formation [91], 4) a viral genome linked protein (VPg) (3B) initiating the viral genome duplication [92], 5) two intracellular proteins (2B and 3A) targeting the host Golgi complex and inhibiting host protein transit as well as modulating the permeability of cellular membrane structures to promote virus release [93, 94]. There are also three intermediates. 3AB acts as a membrane anchor for 3D polymerase to support viral genome replication [95]. 2BC regulates the host membrane structures alteration to interfere with the host protein secretion [96]. 3CD is the precursor of 3C and 3D and carries partial protease functions to process the P1 subunit of the viral polyprotein [85]. It has also been found to 9 interact with ribonucleoprotein complex with poly(C)-binding proteins (PCBP) on coxsackievirus stem-loop I to support viral RNA replication [89]. The 741-nt 5? UTR (Fig. 2) of CVB3 is a highly organized region containing 7 domains essential for both viral RNA replication and viral gene translation [97]. The domain I, also called the cloverleaf structure (nt 1-88) is associated with the negative-strand RNA synthesis during viral genome replication [97, 98].  The domain III-V (nt 210-529) of the 5? UTR interacts with the La protein and possibly the 3? end of the viral genome to form a replication loop structure for viral RNA synthesis [99]. It is generally agreed that domains II-VI (nt 127-608) house the cis-acting internal ribosome entry site (IRES) initiating the cap-independent translation of viral genes [97]. There are many cellular proteins, such as PCBP2 [100], La [101], Polypyrimidine tract-binding protein (PTBP) [102], binding to CVB3 IRES to support viral gene translation. The 99-nt 3? UTR of CVB3 is also highly structured harboring 3 major stem-loop domains X, Y and Z (Fig. 2) with a poly-A tail [103]. Interactions among these stem-loops enable the formation of kissing-pair tertiary structures facilitating the origin of viral replication [104]. CVB3 3? UTR binds to PTBP [102], La [99], both of which also interact with CVB3 5? UTR. Recent evidence indicates that this region is also targeted by host AU-rich element RNA-binding protein 1 (AUF-1) that regulates the stability of viral genome [105]. Although the exact function of the poly-A tail is still unclear, a potential role in viral RNA stability is suggested considering the role of its cellular counterparts [106]. 10  Figure 2. Genome organization of CVB3 The 7400-nt long CVB3 genome is composed of a 5? UTR, a single long ORF and a 3?UTR. The 5? UTR contains 7 domains with the major function for IRES-driven viral protein translation and initiation of viral RNA replication. The ORF encodes 11 proteins carries different functions as indicated. The 3? UTR harbors 3 domains which are important for viral RNA replication. This figure was adapted from the review article by P. Sean and B. L. Semler [107].          11  1.2.3. CVB3 lifecycle CVB3 can infect a wide range of cell types such as epithelial cells (RD cells) [108], endothelial cells (human umbilical vein endothelial cell, HUVEC) [109], cancer cells (HeLa) [110], cardiomyocytes (HL-1) [111], etc. The initiation of the CVB3 life cycle starts with the primary attachment of CVB3 onto the host cellular DAF receptors which induce the recruitment of CAR receptors mediating the internalization of the virus [112-114] (Fig. 3). DAF is composed of four short consensus repeats (SCRs), each about 60 amino acids (AA) long and folded into a ?-structure stabilized by disulfide bridges [115-118]. The SCRs are linked to a glycosylphosphatidylinositol (GPI)-anchored C-terminal domain which mediates the interaction between DAF and p56lck kinase, an Src-family protein tyrosine kinase that contributes to the myocardial injury during CVB3 infection [119]. CAR receptor is a transmembrane protein located in the tight junctions. It comprises an extracellular domain including two immunoglobulin-like motifs (D1 and D2), a transmembrane ?-helical domain, and a highly conserved cytoplasmic tail [120]. It has been suggested that only the extracellular domain is necessary and sufficient for viral infection while the other two domains are dispensable in this regard [121]. In polarized cells such as intestinal epithelial cells, CAR is buried in the tight junction complex and not accessible to the virus approaching from the apical surface. A sophisticated strategy is employed by CVB3 to achieve the access to CAR. The virus clusters DAF and lipid raft on the host cellular membrane to activate Abl, a non-receptor tyrosine kinase, resulting in actin polymerization and remodeling to facilitate virus movement. This process also activates Fyn, a Src-family kinase that phosphorylates caveolin-1 and enables the internalization of virus into endocytic vesicles for the viral entry without the aid of dynamin [122, 123]. In non-polarized cells like HeLa, CVB3 entry is not affected by the DAF binding process though dynamin and lipid rafts are still required for the viral entry through CAR [123]. The expression levels of the receptors partially explain the viral tissue tropism and the correlation between the age of patients and their susceptibility to CVB3 infection. High expression of CAR in the heart, brain, pancreas, prostate and testis makes them the major target organs of Coxsackievirus compared with the liver, lung and intestine which show lower levels of CAR [124-126]. It is also generally accepted that CAR expression decreases with the age so that younger patients are more vulnerable to CVB3 infection [127]. However, it is worthy to 12 note that receptor expression is not the only factor that determines CVB3 tissue tropism. Host proteins interacting with the 5? UTR of CVB3 genome, such as La protein, may also contribute to the viral tissue tropism [128]. Following the internalization and uncoating of CVB3 through CAR, the positive-stranded viral genomic RNA enters the cytoplasm and serves as the template for both viral genome replication and viral protein translation via an IRES-driven mechanism as mentioned above [129, 130]. The viral genomic RNA replication can be thought of as a two-step process: 1) synthesis of the negative complementary strand RNA using the parental viral genome as the template; 2) synthesis of nascent daughter positive-stranded RNA using the negative-stranded RNA as the template. This process initiates with the uridylylation of VPg (VPg-pU-pU) by viral 3D. The VPg-pU-pU acts as the peptide primer for the onset of the RNA synthesis starting from the 3? poly-A tail of the viral genome [131]. According to the study in poliovirus, a ribonucleoprotein complex consisting of PCBP, 3CD, and domain I in the viral 5?UTR is essential for the negative-strand RNA synthesis via circularization of the viral genome for the VPg uridylylation [132-134]. A cis-acting replication element (CRE) located in the 2C-coding region of CVB3 genome also affects the synthesis of negative-strand RNAs, which is slightly different from poliovirus in that CRE is only involved in the synthesis of the positive-strand RNA [135]. The circulated viral genome facilitates the delivery of replication complex to the viral poly-A tail where viral 3D polymerase uses the adenylate residues as the template for VPg uridylylation [131]. Following uridylylation, the negative strand viral RNA elongates until the viral 3D polymerase reaches the 5? terminus of the parental positive-stranded viral genome [136]. After the negative-strand RNA synthesis, the parental genomes and the nascent negative-strand RNAs bind to each other to form a heteroduplex called replicative form. The two strands separate from each other and the negative-strand RNAs serve as templates for the production of new positive-strand viral genomes [137-139].  For positive-strand synthesis, the domain I in the 5? UTR and CRE in 2C region are also required. 5? domain I is the template for the synthesis of 3? corresponding region in the negative-strand RNAs, which guides the initiation of new positive-strand RNAs [140, 141]. This process begins with the recruitment of the replication complex containing VPg-pU-pU to the 3? end of the negative-strand RNAs and ends when the replication complex reaches the 5? terminus on the 13 negative-strand template [141]. However, unlike the synthesis of negative-strand RNAs, the production of positive-strand viral genome is much more efficient. It is suggested that uridylylation of VPg during the synthesis of positive-strand RNAs occurs on the 2C-cre region followed by the recruitment of VPg-pU-pU to the 3? end of the negative-strand template, enabling excessive uridylylated VPg for synthesizing multiple positive-strand RNAs on a single copy of negative-strand template simultaneously [142, 143]. In the meanwhile, the positive viral RNA genome directs the translation of viral polyproteins which are further processed to viral structural and non-structural proteins by 2A and 3C [85]. The newly synthesized viral proteins and genomes are integrated to complete virions which are released from the host cells through the induction of cell death [144]. These virions further infect surrounding cells/tissues and start a new life cycle. From viral entry to progeny release, CVB3 requires about 8-9 hours to complete a whole cycle [115, 145, 146].  Figure 3. CVB3 replication cycle 1. CVB3 attaches to host receptor; 2. Intracellular trafficking of virions; 3&4. Translation and maturation of viral proteins; 5&6. Synthesis of negative and positive viral genome (RNA replication); 7. Assembly of new virions; 8. Release of virions. 14 1.2.4. CVB3 induced alteration in host cell signaling  Like most other viruses, CVB3 modulates the host signal transduction networks to either benefit its own replication or to induce cellular damages (Fig. 4). One of the most essential changes is the switch of protein translation initiation from a cap-dependent manner to a cap-independent one, resulting in host cell shutoff. CVB3 proteases 2A and 3C cleave host translational machinery components eukaryotic initiation factor 4G (eIF4G) and poly(A)-binding protein (PABP) to inhibit cap-dependent protein translation [90, 147, 148]. The C-terminal eIF4G cleavage product stimulates viral IRES-driven protein translation  [149]. The interruption of host protein machinery and massive production of viral proteins brings stress conditions to the host cells. Endoplasmic reticulum (ER) stress is caused by the unfolded proteins with the downregulation of p58IPK chaperons and activation of pro-apoptotic signaling like CHOP and SREBP1 during CVB3 infection [150]. Another pro-apoptotic signal is the activation of Cyr61 and p38 MAPK, downstream of JNK, triggering caspase-3 cleavage at the later stage of infection [151, 152]. It is also suggested that viral proteases 2A and 3C cleave caspase-3 to induce cell apoptosis [90, 153]. Caspase activation following cytochrome c release is a prominent event during CVB3 infection, which is important for viral progeny release [144, 154-156]. Caspase-3 activation provokes the production of reactive oxygen species (ROS) in infected cells as a proceeding signal for expression and secretion of pro-inflammatory cytokines [152].  It is noteworthy that caspase inhibitors are not capable of fully retrieving cell viability during CVB3 infection. Other pathways such as glycogen synthase kinase 3? (GSK-3?)/?-catenin cascade are also involved in this process [156]. Interestingly, CVB3 downregulates the propapoptotic gene Nip21 to prevent early cell death and benefit viral replication [157]. The above findings indicate that CVB3 regulates host cellular stress conditions and cell death, contributing to a preferable environment for viral replication and disease progression. Tyrosine phosphorylation plays an essential role in supporting CVB3 replication. As mentioned above, entry of CVB3 requires the facilitation of tyrosine kinase p56lck, Fyn and Abl [119, 122]. Another important event is a biphasic activation (tyrosin and threonine phosphorylation) of extracellular signal regulated kinase1/2 (ERK1/2), which has been demonstrated to be a pivotal pillar in the signal network during CVB3 infection [145]. The early peak at 10-20 min post infection is probably associated with the 15 internalization of CVB3 into endosomes and the Arf6 mediated trafficking of CVB3 into an unproductive compartment during viral entry [158]. The second wave of activation starting from 6-7 hours post infection (hpi) is necessary for effective viral replication, evidenced by significant inhibition in viral protein synthesis and progeny production in the presence of ERK1/2 inhibitors [145]. This activation is probably triggered by the cleavage of RasGAP by CVB3 3C protease [159]. Though the exact role of ERK1/2 during CVB3 infection still needs further investigation, some clues have been provided by Affymetrix Genechip data (GEO accession: GSE697). By comparing between the ERK1/2 inhibitor U0126 treated group and a control group, several potential ERK1/2 downstream genes have been identified. For example, IFIT3, a host defense gene against viral infection was found to be induced by U0126. IFIT3 is reported to be induced by IFN and exert anitival effect [160]. Recently?it is suggested that IFIT3 potentiates the antiviral signaling by bridging TNFR-associated factor family member-associated NF-kB activator-binding kinase 1 (TBK1) and mitochondrial antiviral signaling (MAVS) complex. This results in the phosphorylation and nuclear translocation of IFN regulatory factor 3 (IRF3). IRF3 recruits p300/CBP and triggers the early production of IFN-?, defending against the viral infection [161]. CVB3 infection has been found to cleave MAVS to attenuate the IFN signaling [162]. This leads to the speculation that ERK1/2 inhibitor may increase the production of IFIT3 to enhance the IFN signaling, counteracting the viral protease. Another example is the dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 (DYRK2), a negative regulator of G1/S transition in cell cycle [163]. Inhibition of ERK1/2 signaling decreases DYK2, which may promote the G1/S transition. Previous studies showed that CVB3 infection blocking the cell cycle at the G1/S boundary and that cells arrested at G1/S state are beneficial for viral replication [164, 165]. Thus ERK1/2 may regulate the viral replication through modulating the cell cycle progress.  The critical role of the phophatidyl-3-kinase (PI3K)/Akt pathway in supporting CVB3 replication has also been demonstrated. Activation of PI3K/Akt cascade is induced at the later stage of infection and inhibition of this pathway impairs viral production [166]. Phosphorylation of Akt is dependent on integrin-linked kinase (ILK), which also plays a positive role in CVB3 replication [167]. CVB3 infection induces expression of Interferon-gamma-inducible GTPase (IGTP), which activates focal adhesion kinase 16 (FAK) and the Akt pathway [168]. GSK3?, a downstream kinase of the PI3K/Akt pathway, is activated following CVB3 infection via tyrosine phosphorylation, resulting in the degradation of ?-catenin and subsequent cytopathic effect (CPE) in host cells [156].  The ubiquitin-proteasome system (UPS) is a major protein degradation system in mammalian cells that plays a pivotal role in CVB3 infection. Inhibition of UPS markedly inhibits CVB3 replication without affecting viral entry [146]. CVB3 polymerase 3D has been found to be ubiquitinated, which is essential for viral replication [169]. Several host proteins are degraded through UPS during CVB3 infection, including cyclin D1 and p53 which are responsible for the cell cycle arrest and ?-catenin involved in regulating CPE [156, 164]. UPS may also be associated with the ERK1/2 activation during CVB3 infection. UPS-mediated degradation of mitogen-activated protein kinase phosphatase (MKP-1) sustains ERK1/2 signaling while inhibition of UPS deactivates ERK1/2 with increased level of MKP-1 [170, 171]. Thus, MKP-1 may be inhibited by UPS during CVB3 infection, partially contributing to the ERK1/2 activation. Work in a murine viral myocarditis model also implies that UPS is involved in the pathogenesis of the disease as application of proteasome inhibitor attenuates damage in the myocardium [172]. Similar to UPS, an important role of autophagy was recently demonstrated in CVB3 infection. Inhibition of autophagosome formation using small interfering RNAs (siRNAs) significantly reduces viral replication while autophagy inducers promote CVB3 replication [173]. 17  Figure 4. Brief summary of signal transduction networks during CVB3 infection CVB3 infection induces activation of JNK, p38, GSK3?/?-catenin, ERK, Akt and other signal pathways to facilitate the viral entry, replication and progeny release. Some of these pathways also contribute to the cytopathogenesis such as cell death.            18 1.3.  microRNA (miRNAs) 1.3.1. Discovery and biogenesis of miRNA In 1993, Ambros and co-workers discovered a novel C. elegans gene, lin-4, a non-coding gene producing a small RNA that represses the expression of lin-14, through base-pairing with its 3? UTR [174]. This unveiled a whole new area of gene regulation research in endogenous small RNAs-now widely known as miRNAs. The second C. elegans miRNA, called let-7 was discovered 7 years later with the function of suppressing multiple genes including lin-41, lin-14, lin-28, lin-42, and daf-12 [175]. Currently, more than 1000 miRNAs (and counting) have been identified in human [176]. They are vastly involved in physiological and pathological conditions. miRNAs are highly conserved among different organisms and share homologous sequences, similar biogenesis process, and targeting interactions [177].   The biogenesis of miRNAs starts with the transcription of miRNA genes by RNA polymerase II (Pol II), or occasionally, Pol III, to generate primary miRNA precursors (pri-miRNAs), which may contain cap structure or poly-A tail as normal mRNAs [178-180] (Fig. 5). Though miRNA-coding sequences can be identified in annotated genes for mRNAs or other RNAs, which are often referred to as the host genes for the miRNAs, pri-miRNAs are not so well characterized and miRNA genes have not been well defined experimentally. The transcription of pri-miRNA can be driven by either individual promoter region (intergenic miRNA) or share the same promoter with the parental mRNA encoded by the miRNA genes (intragenic miRNA) [181]. The processing mechanisms of pri-miRNA into mature miRNAs can be categorized into two groups, canonical and non-canonical. In the canonical pathway, pri-miRNAs are cleaved by Drosha and DGCR8 into pre-miRNAs, hairpin structured miRNA precursors with the length of 60-70 nt [182, 183]. Pre-miRNA is then exported by Exp5 and Ran-GTP to the cytoplasm, where GTP is replaced by GDP and the pre-miRNA cargo is released [184-187]. Pre-miRNAs are then cleaved by Dicer to produce a miRNA duplex intermediate of ?22 basepairs [188-190]. The RNA duplex then binds to an Argonaute (Ago) protein with one of the two strands acting as the mature miRNA to assemble an RNA-induced silencing complex (RISC) while the other strand discarded [191, 192]. The relative thermodynamic stability determines the selection of the strand for maturation [193]. This process is also supported by some RNA and Dicer binding proteins, such as TRBP and PACT [194, 19 195]. The non-canonical processing strategy requires only part of the above mentioned machinery. Transcription of pri-miRNAs is similar to the canonical ones but the production of pre-miRNAs depends on splicing rather than Drosha-mediated cleavage [196]. Some non-canonical miRNAs bypass Dicer and use Ago2 for cleavage of pre-miRNAs, or even directly use pri-miRNA for processing by Dicer [197, 198]. RNA editing is frequently associated with miRNA biogenesis. miRNA precursors and mature miRNAs are susceptible to modification by RNA adenosine deaminase, which converts adenosine into inosine residues that can form basepairs with cytosines or uracils, resulting in the alteration in miRNA processing and targeting recognition [199, 200].  Figure 5. Biogenesis of miRNAs miRNAs are transcribed from the encoded genes as the precursor format pri-miRNA. Pri-miRNAs are cleaved by Drosha and DGCR8 into pre-miRNAs, which are transported out of the nucleus into the cytoplasm by Exportin5 and Ran-GTP. Pre-miRNAs are then further processed by Dicer into miRNA duplex with one of the strands loaded onto RISC for further binding with the targeting sites on mRNAs.   20 1.3.2. Regulation of miRNA expression miRNA expression levels vary spatially and temporally in different organs and tissues and the change of miRNA profiles is closely associated with the pathogenesis of many diseases [201]. In addition, the overall expression levels of different miRNAs in the whole organism are also distinct from each other. Therefore, it would be interesting and important to better understand the regulation of miRNA levels. The modulation of miRNA expression can take place either at the transcriptional level, or at the post-transcriptional level. For regulation at transcriptional-level, it is mainly determined by transcriptional factors [202] (Table 2). More than 30 miRNAs have been found to be regulated by transcription factor. For miRNAs that are enriched in the heart, miR-1 and 133a are controlled by SRF, MyoD, Mef2, and myogenin [203, 204]. miR-21 is regulated by androgen receptor, AP-1, STAT3, Gfi1, and REST [205-209]. miR-126 is regulated by ETS-1/2 [210]. Binding of the transcriptional factor to the promoter region of the miRNA genes positively or negatively affects the expression of the corresponding miRNAs. During the organism development or disease progression, modification in transcription factor levels or activities are reflected by the alteration of miRNA expression profiles. Pol II binding efficiency also influences miRNA transcription [211]. The binding of Pol II is affected by chromatin structure and histone post-translational modification [212-214]. There are currently ~30 known epigenetically regulated miRNAs [214]. Detection of transcriptional change of miRNAs requires the measurement of pri-miRNAs. Post-transcriptional modifications are mainly conducted by components in the miRNA processing machineries or other RNA binding proteins. As Drosha initiates the pri-miRNA cleavage, it is a key factor in controlling miRNA profiles. Considering the complexity of the human genome and the billions of nt of RNA transcribed, it requires a strict discretion by Drosha to choose the proper transcripts for further processing to generate about 1000 miRNAs effectively. Therefore, it is very likely that the secondary structures of the hairpin-containing RNAs would significantly influence the recognition and processing by Drosha [215]. It is suggested that an ~80-nt hairpin structure with a single-stranded RNA extension located outside this hairpin is necessary for the Drosha processing [216]. This differential processing acts as a rate-limiting factor to control the miRNA expression level globally. Transportation of pri-miRNA to the cytoplasm depends on Exp 5. Abundance in Exp 5 would enhance the expression of miRNAs but it is 21 still not clear whether Exp 5 differentially regulates miRNA expression [217]. Like Drosha, Dicer also shows preferences in pre-miRNA cleavage, which is influenced by the flexibility in terminal loop region [218]. Ago2 prefers a 5? uridine residue in a miRNA for the recognition of the guide strand to form RISC [219]. Stable Ago2 expression differentially regulates miRNA production but the underlying mechanism is still unclear [220]. RNA binding proteins affect miRNA expression by interfering with RNA processing. The most thoroughly characterized example is Lin-28 and its close homolog, Lin-28B, which inhibits let-7 expression by binding to the terminal loop region, leading to suppression in pri-miRNA cleavage by Drosha and pre-miRNA cleavage by Dicer [221-225]. let-7 carries tumor-suppressing functions while Lin-28 and Lin-28a are often highly expressing in cancers, which suggests a role of this regulatory pathway in cancer diseases [225]. Other RNA binding proteins affecting miRNA processing are hnRNP A1 [226], KH-type splicing regulatory protein [227], p72 and p68 RNA helicases [228], SMAD [229], p53 [230], the estrogen receptor [231], Ars2 [232] and SF2/ASF [233]. These proteins carry chaperon functions and have a broad range of substrates. The specific mechanism of their regulation on miRNA processing still needs further clarification. Table 2. Cardiac miRNAs regulated by transcriptional factors miRNAs Transcription regulators Let-7 NF??, Myc miR-1, 133a SRF, MyoD, Mef2, myogenin miR-15a c-myb miR-21 Androgen receptor, AP-1, STAT3, Gfi1, REST miR-22 Myc miR-23a/b c-Myc, NFATc3 miR-24 BMP2, Smad3 miR-26a Myc miR-27 RUNX1 miR-29 NF??, YY1, Polycomb miR-30b BMP2, NF?? miR-30c C/EBP?, BMP2 miR-125b NF??, CDX2 miR-126 ETS-1/2 miR-133b Pitx3 miR-143 NF?B, SRF, myocardin, Nkx2-5 miR-451 GATA-1 miR-499 MyoD, Myf5, Myogenin, Eos The data are summarized based on a reviewer article by X. Zhang and Y. Zeng [202] and a database by J. Wang [234]. 22 1.3.3. miRNA in heart development and pathology As essential gene regulators, miRNAs are widely involved in organ development and disease pathogenesis such as cancer, viral infection, immune deficiency, neurodegeneration, and cardiovascular diseases [235]. The heart is the first organ to function during vertebrate embryogenesis. miRNA-mediated post-transcriptional gene regulation is essential for cardiovascular development as evidenced by generating loss-of-function mutations in genes that encode enzymes essential for miRNA biogenesis, such as Dicer, Drosha, Ago2, and DGCR8. Mice lacking these miRNA biogenesis machinery components die too early in the embryo development to analyze the role of miRNAs in cardiovascular development [236]. Conditional KO of Dicer during early heart development was achieved by using an Nkx2.5 promoter?driven Cre recombinase (Nkx2.5-Cre), leading to pericardial edema and defects in the ventricular myocardium [237]. This model also demonstrates that miRNAs play important roles in the cardiac outflow tract morphogenesis and chamber septation [238]. Another conditional Dicer KO model using an ?-myosin heavy chain (?-MHC/Myh6)-Cre driver line shows that Dicer deficiency in cardiac myocytes causes DCM and embryonic death of mutant mice between postnatal days 0 and 4, indicating the essential functions of miRNAs in cardiomyocytes [239]. Deletion of DGCR8 using a muscle creatine kinase (MCK)-Cre driver line leads to a similar DCM phenotype [240]. Conditional KO of Dicer in postnatal mice cardiomyocytes yields sudden death in young mice and induces massive hypertrophy and fibrotic lesions in older ones [241].  There are 18 miRNAs or miRNA families composing ~90% of the cardiac miRNAs, including miR-1/206, let-7, miR-15/16/195/424/497, miR-22, miR-23, miR-24, miR-26, miR-27, miR-29, miR-30, miR-125/351, miR-126, miR-133, miR-143, miR-208, miR-378, miR-451 and miR-499 [240]. Among them, miR-1 and miR-133 have been found to cooperatively promote mesoderm differentiation in embryonic stem (ES) cells but counteract with each in the cardiomyocyte differentiation [242]. KO of miR-1 or miR-133 is not fully fetal lethal but significantly affects cardiac development and functions [237, 243]. miR-1 deletion causes deregulation of multiple cardiac genes such as Gata6, Hand1, Hrt2 etc., resulting in further ventricular-septum defects and cardiac dysfunction [237]. The absence of miR-133 leads to ectopic expression of smooth muscle genes in the heart and aberrant cardiomyocyte proliferation 23 [243]. The miR-15 family exhibits dynamic regulation during cardiac development and facilitates this process by fine-tuning the cell cycle progression/arrest [244]. miR-27 is found to be gradually upregulated during heart development and may contribute to this event by targeting Mef2c [245]. miR-125b negatively regulates mesodermal differentiation of ES cells by targeting Lin28 and thus may not be beneficial for heart development [246]. In zebra fish, knockdown of miR-143 causes abnormal development of the cardiac chambers by regulating adductin-3 [247]. miR-208 KO in mice shows mild cardiac dysfunction with slight reduction in contractility, increase in LV diameter, and ectopic expression of fast skeletal muscle contractile protein genes [248]. miR-499 has been found to facilitate the differentiation of cardiomyocytes from bone marrow-derived mesenchymal stem cells (BM-MSCs), indicating its role in heart development [249]. Besides the above miRNAs that directly modulate cardiomyocyte differentiation or heart structure, other heart enriched miRNAs also contribute to other events in cardiac development. miR-24, miR-126 and miR-451 regulate hematopoiesis [250-252]. miR-143 and miR-126 modulate angiogenesis [253, 254]. The role of some cardiac abundant miRNAs, such as let-7, miR-22, miR-23, miR-26, miR-29, miR-30 and miR-378, in heart development still needs future study. miRNAs are also fundamental factors in cardiac diseases (Table 3). The miRNA profiles change significantly during heart dysfunctions including cadiomyocyte hypertrophy, ischemic cardiomyopathy, DCM, arrhythmia and fibrosis [255, 256]. In cardiac hypertrophy, miR-21, miR-23a, miR-24, miR-125, miR-129, miR-195, miR-199, miR-208 and miR-212 are often upregulated while miR-1, miR-133, miR-29, miR-30, and miR-150 are often downregulated [255, 257-259]. Among the upregulated miRNAs, overexpression of miR-23a [257, 260], miR-23b[257], miR-24 [224], miR-195 [224], miR-199a [261] and miR-208 [262], provokes heart hypertrophy. For the downregulated miRNAs, knockdown of miR-133 triggers heart hypertrophy [263] while overexpression of miR-1 attenuates this process [264]. Other cardiac enriched miRNAs are also regulating (also regulates) heart hypertrophy. These include pro-hypertrophic miR-22 [265], miR-27b [266] and miR-499 [267] and anti-hypertrophic let-7 [268], miR-26 [269], miR-30a [270] and miR-378 [271]. The role of miR-21 on cardiac hypertrophy is still controversial. Some studies indicate an induction of cardiomyocyte hypertrophy by miR-21 in vitro and indirectly in 24 vivo via fibroblasts [258, 272] while there is also evidence showing an anti-hypertrophic effect of miR-21 in isolated cardiomyocytes [273]. Ischemic cardiomyopathy is featured by severe cardiomyocyte death [274]. miR-1 and miR-133 exhibit opposite effects on the apoptosis of cardiac cells. miR-1 targets Hsp60 and Hsp70 to promote cell apoptosis while miR-133 inhibits caspase-9 to hinder cell death [275]. The miR-15 family is upregulated in the infarcted region of the cardiac tissue in response to ischemic injury while inhibition of these miRNAs protects cardiomyocytes from death and alleviates ischemic cardiomyopathy [276]. miR-21 [277], miR-199a [278], miR-24 [279] and miR-499 [280] are downregulated during cardiac ischemic injury and replenishment of these miRNAs protects cardiomyocytes from death and attenuates disease progression. Downregulation of pro-apoptotic miR-320 and upregulation of anti-apoptotic miR-144/451 are probably cellular defenses against ischemic injury [281, 282]. In DCM, miR-1, miR-29b, miR-7 and miR-378 are downregulated while miR-214, miR-342, miR-125b and miR-181b are upregulated [283]. Target deletion of miR-1 or miR-22 leads to DCM [237, 284]. miR-199/214 cluster is involved in the regulation of ubiquin proteasome system in end-stage DCM [285]. miR-208 is associated with lower myosin heavy chain (MHC) (mentioned before) expression in DCM and may contribute to disease progression [286]. Cardiac arrhythmia is mainly caused by irregular cardiac conduction through ion channels. miR-1 targets gap junction proteins Cx43 and Kir2.1 in potassium channel and HCN2/HCN4 in pacemaker channel and contributes to arrhythmia [287, 288]. The role of miR-133 in arrhythmia is multifaceted. Similar to miR-1, miR-133 inhibits HCN2 and disrupts pacemaker channel [288]. It also increases QT intervals (time between Q wave and T wave) in surface electrocardiographic recordings and action potential durations in isolated ventricular myocytes by regulating KChIP2 [289]. Fibrosis is a common event during cardiac remodeling. miR-21, miR-24, miR-29, miR-30 and miR-133 are involved in regulating this process. miR-21 promotes fibroblast survival and fibrosis possibly through inhibition of sprouty homolog 1 (SPRY1) to enhance ERK1/2 signaling [272]. miR-21 also shows some positive effect in MMP-2 expression via repression of phosphatase and tensin homolog [290]. miR-24 attenuates fibrosis and decreases the differentiation and migration of cardiac fibroblasts by regulating TGF-? signaling [291]. miR-29 is a key regulator in collagen expression and predicted to target a whole set of genes involved in fibrosis, indicating its role in modulating fibrosis 25 [292]. miR-30 and miR-133 regulate connective tissue growth factor to control the remodeling of myocardial matrix [293]. The ongoing investigation on miRNAs in cardiac diseases could provide a deeper insight into the understanding of the vast gene regulatory circuits in the pathogenesis.   Table 3. miRNAs involved in cardiac pathology  1.3.4. miRNAs in infectious disease Host miRNAs are widely involved in viral infection as mediators for host-virus interactions through regulating various signal pathways. Respiratory syncytial virus (RSV) [294], primate foamy virus (PFV) [295], human immunodeficiency virus (HIV) [296], influenza virus [297], HCV [298], Epstein-Barr virus (EBV) [299], human papillomaviruses (HPV) [300], and many other viruses have been reported to profoundly influence cellular miRNA expression during infection. On one hand, viruses are capable of altering host miRNA expression profiles to optimize the cellular environment for replication or contribute to cytopathogenesis. For example, Hendra virus stimulates host miR-146a to enhance viral replication by targeting ring finger protein (RNF) 11 and increasing NF-?B activity [301]. HIV miRNAs Associated cardiac pathology let-7 cardiac hypertrophy miR-1 cardiomyocyte differentiation, cardiac hypertrophy, cardiomyocyte death, DCM, arrhythmia miR-133 cardiomyocyte proliferation, cardiac hypertrophy, cardiomyocyte death,  arrhythmia, ECM remodeling miR-15 cell cycle progress/arrest, cardiomyocyte death miR-27 cardiac hypertrophy miR-21 cardiac hypertrophy, cardiomyocyte death, fibrosis miR-22 cardiac hypertrophy miR-23a/b cardiac hypertrophy miR-24 cardiac hypertrophy, cardiomyocyte death, fibrosis miR-26a cardiac hypertrophy miR-29 DCM, fibrosis miR-30a cardiac hypertrophy, fibrosis, ECM remodeling miR-125b mesodermal differentiation, DCM miR-126 angiogenesis miR-143 angiogenesis miR-208 cardiac hypertrophy, DCM miR-378 cardiac hypertrophy, DCM miR-451 cardiomyocyte death miR-499 cardiomyocyte differentiation, cardiac hypertrophy, cardiomyocyte death 26 downregulates the miR-17-92 cluster to promote HIV transcriptional elongation by targeting PCAF [302]. EBV induces miR-155 to modulate transcriptional regulatory factors [303]. On the other hand, some cellular miRNAs have been found to inhibit viral infection as part of the host defense network. For instance, miR-32 limits the replication of PFV by directly targeting the viral genome [304]. miR-24 and miR-93 defend the host cells against  vesicular stomatitis virus (VSV) infection by suppressing viral protein genes [305]. As host miRNAs may play positive or negative roles in viral infection, they may partially determine the tissue tropism of viral infection. This speculation is supported by the evidence that HCV mainly infects liver cells, where miR-122 is the most abundant miRNA and greatly benefits HCV replication [306]. Another example is that PFV normally replicates primarily in salivary glands [307], where miR-32, which suppresses PFV replication, is not expressed [308]. In contrast, PFV does not infect 293T cells that express high level of miR-32 [304]. Some viruses also encode miRNAs that potentially target either cellular or viral genes, enabling their role in regulating the latent-lytic infection switch, modulating immune response or supporting viral replication by promoting cell growth and survival. Some viruses, like SV40, EBV and HSV, encode viral miRNAs as antisense to the viral transcripts to maintain the latent infection stage and avoid the attack by the host immune response [309-313]. EBV miR-BART1-5p, miRBART16, and miR-BART17-5p suppress viral protein LMP1 to support cell growth and inhibit apoptosis [314]. For cellular genes targeted by viral miRNAs, the best example is Kaposi's sarcoma-associated herpesvirus (KSHV). Thrombospondin 1 (THBS1) is targeted by multiple KSHV miRNAs, leading to the enhancement of angiogenesis and cell growth [315]. BCLAF1 is targeted by KSVH miR-K5, promoting lytic infection [316]. Cellular transcriptional factor MAF is targeted by KSHV miR-K11, resulting in the reprogramming of endothelial cells that contributes to oncogenesis [317]. Besides KSHV, EBV also regulates host genes through its own viral miRNAs.  Host PUMA is suppressed by EBV miR-BART5 to maintain cell survival [318]. EBV also downregulates CXCL11 expression via miR-BHRF1-3 to inhibit host defenses [319]. 1.3.5. miRNA in CVB3 infection There has no miRNA identified yet in the CVB3 genome. However, host miRNAs have been found to actively regulate CVB3-host interactions (Table 4). Both in vivo and in vitro studies have 27 demonstrated that CVB3 infection induces substantial changes in host miRNA expression profiles that provide feedback on viral replication or host cytopathogenesis. Some of the studies also shed light on the possible treatment(s) for CVB3 induced diseases. Chun-Nan Lee and Pan-Chyr Yang? group led the first investigation on the relationship between CVB3 and host miRNAs [320]. Using in vitro infection model, they found CVB3 infection led to increase of miR-141. They identified eIF4E, a cap-binding protein, as a novel target of miR-141 which is partially responsible for the shut-off of host protein translation. Inhibition of miR-141 suppressed CVB3 replication by attenuating the switch from cap-dependent to cap-independent protein translation initiation. They also identified EGR1 as the transcription factor that activated miR-141 expression but the mechanism of EGR1 activation during CVB3 infection still needs further investigations. Maarten Corsten and colleagues conducted the first thorough in vivo study on miRNA profile during CVB3 infection [321]. Using CVB3 infected mice and human patients with viral myocarditis, they identified the differentially expressed miRNAs during CVB3 infection. In particular, they found that miR-155 was strongly induced at 7 dpi. Further analysis showed that the upregulated miR-155 co-localized with infiltrated inflammatory cells. Inhibition of miR-155 attenuated cardiac damage and inflammation in CVB3-induced viral myocarditis. They identified PU.1, an inhibitor of dendritic cell antigen presentation to T cells, as the target of miR-155 that was involved in regulating inflammation. Interestingly, miR-155 inhibition did not directly affect viral replication or myocyte viability while it improved survival and cardiac function. This indicates that miR-155 is involved in regulating the inflammation process rather than cardiomyocyte functions. miR-1 is increased in CVB3 infected mice, which leads to the downregulation Connexin-43 (Cx43) [322]. This indicates a possible mechanism by which CVB3 impairs the host cellular gap junction and triggers arrhythmias as Cx43 is one of the major gap-junction components [323]. Jin He and co-workers found that miR-21 was downregulated in CVB3 infected mice, something that may be associated with CVB3-induced cardiomyocyte apoptosis by targeting PDCD4 [324]. However, this is contradictory to Maarten?s study mentioned earlier which showed the upregulation of miR-21 during CVB3 infection in vivo [321]. One may argue that the different mice strains used in the two studies affect the results but another study by Yan Li Liu?s group also found miR-21 was increased during CVB3 infection using the same virus and 28 mice strain as He?s report [325]. In Liu?s study, they found that miR-21 and miR-146b were increased in CVB3 infected mice while miR-451 was decreased. Further investigation indicates that miR-21 and miR-146b contributed to the differentiation of TH-17 (Helper T (Th) cells that produce interleukin17 (IL-17)), stimulating the inflammation of the myocardium though the detailed mechanism of this regulation has not been studied.  It is speculated that heart abundant miRNAs that benefit CVB3 replication may contribute to the tissue tropism of CVB3. However, there have not been many studies on this topic yet. miR-1 and miR-133 are the most abundant miRNAs in the heart and there is no evidence that they promote CVB3 replication [264]. miR-10a* has been shown to support CVB3 replication by directly targeting the viral genome and its expression is relatively high in the heart [326]. miR-342-5p suppresses CVB3 biosynthesis by targeting its coding region and this miRNA?s expression is relatively low in the heart [327]. It would be interesting to evaluate a larger number of more heart-enriched or non-enriched miRNAs on CVB3 replication to provide deeper insights on the miRNA regulated CVB3 tissue tropism.  Table 4. miRNAs in CVB3 infection  The miRNAs involved in CVB3 infection are listed above. ?NA? indicates not reported yet.      miRNAs change target function miR-141 up eIF4E host protein translation shutoff miR-155 up PU.1 inflammation stimulation miR-1 up Cx43 gap junction disruption miR-21 down PDCD4 cardiomyocyte death inhibition miR-21 up NA TH-17 differentiation miR-146b up NA TH-17 differentiation miR-451 down NA NA miR-10a* NA CVB3 genome promote viral replication miR-342-5p NA CVB3 genome inhibit viral replication 29 1.4. Research hypothesis and objectives 1.4.1. Background/Rationale  CVB3-induced myocarditis is a common inflammatory cardiac disease threatening the health of children and young adults but no accurate early diagnosis method, or effective or specific treatment is currently available. A clear understanding of the virus-induced change in the host cell signaling alteration is essential for elucidating the pathogenesis of CVB3 caused diseases and improving the therapeutic strategies. Investigations in disease mechanism were traditionally focused on genes functions and direct signal transductions. This limits the full understanding of disease development and the search for strategies to cure diseases. miRNAs are recently discovered gene regulators and serve as the mediators of different signal pathways to connect them and assemble a big complete signal network regulating the disease progression. They have been demonstrated to be pivotal players in cardiac diseases and viral infections. Some evidence has indicated that miRNAs are involved in CVB3 infection. Further exploration in the roles of miRNAs in the CVB3 induced viral myocarditis will provide critical clues for the pathogenesis and treatment of this disease.  1.4.2. Hypothesis  CVB3 infection induces alterations of host miRNA expression profiles, which in turn affect CVB3 replication and thus its pathogenesis in viral myocarditis.  1.4.3. Specific aims and experimental design Aim 1: To identify the differentially expressed  miRNA candidates caused by CVB3 infection In vitro and in vivo infections of CVB3 were conducted using cell lines or A/J mice, respectively. Mouse cardiac RNAs were isolated for microarray analysis of the global changes of miRNA expression profiles. Cellular and mouse heart RNAs were also isolated for q-RT-PCR detection of a specific miRNA. The miRNAs which show significantly up- or down-regulated expression compared with sham controls were selected as miRNA candidates for further investigation. In this dissertation, I mainly focused on three miRNA candidates, miR-126, miR-203 and miR-21. I also explored the mechanism of miRNA expression change by studying the potential transcriptional factors involved in regulating the miRNA 30 levels. Inhibitors of the specific transcriptional factors were applied to confirm their involvement in miRNA expression alterations during CVB3 infection. Aim 2: To investigate the effect of the cellular miRNA(s) on CVB3 infection By manipulating the cellular level of these miRNAs using miRNA mimics or inhibitors, I evaluated the effect of the miRNA candidates on CVB3 replication. Viral protein synthesis was measured by WB and viral progeny release was quantified by plaque assay. The potential miRNA targets involved in CVB3 replication were validated by WB and luciferase assay. I used siRNA to knockdown those miRNA targets to mimic the miRNA function. The expression of the miRNA targets was also restored by overexpression vectors to block the effect of miRNAs on CVB3 replication. Aim3: To determine the roles of candidate miRNAs in the pathogenesis of viral myocarditis I mainly focused on the role of miRNAs in CVB3-induced cell death and disruption of cell-cell contacts, which are essential to the myocardium damage. Bioinformatic tools (i.e. TargetScan) were employed for the prediction of potential genes targeted by miRNA candidates. Genes involved in cell death or cell-cell interaction were identified and the miRNA targeting effect was validated by WB and luciferase assay. The roles of the target genes in cardiomyocyte biology/pathology were further investigated by using siRNA to downregulate their expression or using overexpression vector to increase their level in the presence of corresponding miRNAs. Cell death was evaluated by morphology observation, WB detection of caspase-3 activation and MTS ((3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt) assay. Cell-cell interactions were determined by WB detection of junction signals, immunofluorescence staining and EM. As mentioned above, three miRNA candidates were investigated in this thesis, including miR-126, miR-203 and miR-21, which composed the three major research chapters. The first one (Chapter 3) is on the CVB3-induced upregulation of miR-126 through  ERK1/2-ETS1/2 signal pathway. I found that the increased miR-126 expression enhanced activation of ERK1/2 and degradation of ?-catenin through targeting SPRED1 (sprouty-related, EVH1 domain containing 1), LRP6 and WRCH1. This targeting benefited CVB3 replication and promoted virus-induced cell death. The second one (Chapter 4) describes the upregulation of miR-203 by activation of PKC/AP-1 cascade during CVB3 infection. I demonstrated 31 that miR-203 targeted ZFP-148 and supported cell survival and growth, which provided favorable environment for CVB3 replication. The third one (Chapter 5) discusses the findings on the miR-21-induced desmin degradation and desmosome disorganization which are ubiquitin-proteasome pathway by targeting YOD1 during CVB3 infection. I also found that miR-21 directly targeted VCL and disrupted fascia adherens.                       32 Chapter 2 Materials and Methods 2.1. Cell culture HeLa cells (for chapter 3-5) (American Type Culture Collection), were cultured in Dulbecco's modified Eagle's medium (DMEM) (Lonza) supplemented with 10% fetal bovine serum (FBS) (Sigma) and 100 ?g/ml of penicillin-streptomycin (Life Technologies) at 37 ?C with 5% CO2. Cardiomyocyte HL-1 cells (for chapters 3-5) were obtained from Dr. William C. Claycomb. (Louisiana State University Medical Center) and maintained in Claycomb medium (Sigma) with 100 mM norepinephrine bitartrate (Sigma), 4 mM L-Glutamine (Sigma) and 10% FBS. HUVEC cells (for chapter 3) were purchased from Lonza and cultured using EGMTMBulletKitTM (Lonza). NIH 3T3 and HEK 293T cells were cultured in DMEM with 10% FBS and 1% nonessential amino acids (Life Technologies). Immortalized human cardiomyocytes (for chapter 5) were purchased from Applied Biological Materials and cultured in Prigrow I medium with 10% FBS. 2.2. In vitro and in vivo infection of CVB3 CVB3 (Kandolf strain) was generated from a full-length cDNA clone (provided by Reinhard Kandolf, University of T?bingen) and amplified in HeLa cells. Virus stocks were aliquoted and stored at -80 ?C. Virus titers were measured at the beginning of each experiment by plaque assay. For infection, non-transfected cells were seeded to 6-well plates one day before virus treatment. Transfected cells were subjected to viral infection 48 h post transfection. Cells were washed with PBS twice before adding the viruses diluted with serum free medium. After 1 h of incubation with viruses, cells were washed with PBS twice again and overlaid with complete culture medium. Sham infection (negative control) was performed by adding a same volume of non-infected HeLa cell culture supernatant. The infection doses were 10 MOI (multiplicity of infection) for HeLa and HL-1 cells, 100 MOI for HUVEC and 50 MOI for immortalized human cardiomyocytes due to their different susceptibilities. Cell morphologies were photographed at room temperature under a phase contrast microscope (TMS-F, Nikon) with a 10? objective (100 ? magnification), connected with a camera (Coolpix 8400, Nikon).  In vivo infection was conducted in A/J mice. All mouse experiments were performed according to the animal experiment guidelines following the protocols approved by the Animal Care Committee of 33 Faculty of Medicine, University of British Columbia. Male A/J mice (4-week old) were purchased from Jackson Laboratory. Mice were infected by intraperitoneally inoculation with 5?103 plaque-forming unit (pfu) of CVB3 or sham-infected with phosphate buffer saline (PBS) (Sigma). With respect to group size, for microarray analysis, n=3 for each group (sham or CVB3, 4 dpi or 7 dpi). For q-PCR and WB analysis, for sham groups n=5 while for CVB3 groups n=7. 2.3. UV irradiation of CVB3 Diluted virus (1 mL) was transferred to a 2-ml tube and then irradiated in a UV Stratalinker 1800 (Stratagene) for 30 min. The tube was kept on ice at a distance of 5 cm from the UV bulb. The virus was then tested by infection of HeLa cells and WB detection of the absence of VP-1 to confirm the successful irradiation 2.4. Inhibitor treatment  Cells were serum starved overnight and treated with ERK1/2 inhibitor U0126 (Cell Signaling Technology) (20 ?M), caspase-3 inhibitor Z-VAD (Cedarlane Labs) (50 ?M), PKC inhibitors GF109203X (Calbiochem) (50-100 nM) or equal volume of DMSO (0.1% in culture medium) (Sigma) starting from 30 min prior to infection. Cells were then incubated with CVB3 at 10 MOI for 1 h. After infection, cells were washed with PBS and replenished with serum-free medium with DMSO, U0126 or Z-VAD. For proteasome inhibitor treatment, cells were first transfected with miRNA mimics or siRNAs for 6 h and then incubated with proteasome inhibitor MG132 (Santa Cruz) or equal volume of DMSO  (0.1% in culture medium) (Sigma) at 10 ?M for 24 h. Cellular proteins were then collected at 48 h post transfection for further western blot analysis as described in section 2. 12. 2.5. Viral plaque assay CVB3 plaque assays were performed as previously described [103]. Briefly, sample supernatants were serially diluted and added onto HeLa cells in 6-well plates (8?105 cells/well). After incubation for 1 h, cells were washed with PBS twice again, overlaid with 0.75% soft agar medium and incubated for 3 days. Cells were fixed with Carnoy's fixative for 30 min and stained with 1% crystal violet. The viral 34 plaques were counted manually. The virus titers were calculated as the plaque forming units per mL (pfu/mL). All the assays were conducted at least three times. 2.6. MTS cell viability assay Cell viability was analyzed by CellTiter 96? AQueous One Solution Cell Proliferation Assay (MTS) (Promega) following the manufacturer?s instructions as described previously [103]. Briefly, MTS reagents were added into the wells and incubated for 2 h. The absorbance at 490 nm was measured by using an enzyme-linked immunosorbent assay (ELISA) reader (SLT Lab Instruments). All the assays were performed at least in triplicate and the data were normalized to that of sham infected samples (set as 100%). 2.7. Desmin ubiquitination assay Desmin from the cultured cells was pulled down by desmin antibody (Abcam) using Pierce Crosslink IP Kit (Thermo Scientific) following the manufacturer?s instructions. The enriched desmin was then separated by 6% SDS PAGE and immunoanalyzed by using a polyclonal anti-ubiquitin antibody (Thermo Scientific). 2.8. Hematoxylin and eosin (H&E) staining and echocardiography The hearts were collected at 4 dpi and 7 dpi. The evaluation of myocarditis based on H&E staining and heart functional measurement by echocardiography were conducted by the methods described previously [328]. Briefly, heart function was measured using two-dimensional echocardiography (Sonos 5500, Philips) with a 12 MHz S-12 probe (Sonos 5000). Parasternal long and short axis images at the level of the mitral valve and papillary muscles were taken. The measurements were normalized to the mouse?s body weight. For H&E staining, the hearts were collected and fixed in 10% formalin. Tissues were then embedded in paraffin and sectioned for standard H&E staining to evaluate cardiac inflammation and damage. 2.9. RNA extraction, miRNA microarray and quantitative reverse transcriptase PCR (q-RT-PCR) Tissue or cellular RNAs were extracted using miRCURY? RNA isolation kits (Exiqon) according to the manufacturer?s instructions. Part of the mice heart RNAs (4 dpi and 7 dpi) were submitted to Exiqon (Denmark) for miRNA microarray analysis as describe previously [329]. Heart 35 RNAs and cellular RNAs were then reverse transcribed (RT) using TaqMan MicroRNA reverse transcription kit (Life Technologies) and miRNA levels were detected by TaqMan MicroRNA Assay (Life Technologies) using relative quantitative methods. In brief, 50 ng of total RNAs were transcribed in a 15 ?L of RT reaction containing 3 ?L of stem-loop RT primers, 1 ? RT buffer, 1 mM of each dNTPs, 0.25 U/?L RNase inhibitor, and 3 U/?L MultiScribe? reverse transcriptase. The RT reaction was conducted using PCR thermal cycler (9700, Applied Biosystems) for 30 min at 16 ?C, 30 min at 42 ?C, 5 min at 85 ?C and then held at 4 ?C. Real-time PCR for each miRNA was prepared in 20 ?L of reaction mixture containing 1.33 ?L of RT product, 10 ?L of 2? TaqMan universal PCR master mix and 1 ?L of TaqMan probe. The PCR was conducted using an Applied Biosystems 7900HT Fast Real-Time PCR System at 95 ?C for 10 min, followed by 40 cycles of 95 ?C for 15 sec and 60 ?C for 1 min. U6, a small non-coding RNA, was detected as the endogenous control for data normalization. The fold change was calculated as 2 ??CT ? K, where ??CT= ?[CTmiRNA?CTU6] and K is a constant. All the fold changes were normalized to that of control samples, which were set as 1.00. All real-time RT-PCR experiments were performed in triplicates with no-template as a negative control. 2.10. Regular q-RT-PCR for detection of CVB3 2A and desmin RNA For quantification of CVB3 RNA in the supernatants from miR-203 transfected and CVB3 infected cells, oligonucleotide primers targeting CVB3 2A gene were synthesized (Table 5). Equal amounts of supernatants from the miR-CL or miR-203 groups were subjected to RNA isolation using QIAamp Viral RNA Mini Kit (Qiagen) and then reverse-transcribed using superscript III first strand cDNA synthesis kit (Life Technologies). q-PCR was conducted using TaqMan Real-Time PCR Master Mixes (Life Technologies). For desmin q-PCR, the cellular total RNAs were reverse transcribed by superscript III first-strand synthesis system (Life Technologies) and detected using QuantiTect SYBR Green PCR master mix (Qiagen). GAPDH was detected as endogenous control. Primers are listed in Table 5. All q-RT-PCR experiments were repeated in triplicates with no-template as a negative control.     36 Table 5. Primers for q-PCR  2.11. Transfection of miRNA mimics, siRNAs and miRNA inhibitors miRNA mimics (Ambion? Pre-miR? miRNA Precursors, negative control #1 (miR-CL), miR-126, miR-203 and miR-21), and miR inhibitors (Ambion? Anti-miR? miRNA Inhibitors, negative control #1 (CL-in), miR-126 inhibitor (126-in) and miR-21 inhibitor (21-in)), which are chemically modified, single stranded RNAs designed to specifically bind to and inhibit endogenous miRNA molecules were obtained from Life Technologies. siRNAs ON-Target Plus Non-targeting pool (scrambled control); ON-Target plus SmartPool Human SPRED1 L-016638-00-0005; ON-Target plus SmartPool Human LRP6 L-003845-00-0005; ON-Target plus SmartPool Human WRCH1 L-009882-00-0005; ON-Target plus SmartPool Mice YOD1 L-057897-01-0005) were purchased from Dharmacon. JunB siRNA and the corresponding scramble controls were obtained from Santa Cruz Inc. VCL-siRNA, ZFP-148 siRNA and the corresponding scramble controls were purchased from Life Technologies. One day before transfection, cells were seeded onto 6-well plates (HeLa, NIH 3T3, and HEK 293T: 2?105 cells/well; HL-1 and immortalized human cardiomyocytes: 1?105 cells/well; HUVEC: 3?105 cells/well, HEK) and reached approximately 50% confluence by the time of transfection. Transfection was conducted using Oligofectamine (Life Technologies) for HeLa cells and Lipofectamin RNAiMax (Life Technologies) for NIH 3T3, HEK 293T, HL-1 and immortalized human cardiomyocytes according to the manufacturer?s instructions. For oligofectamine-mediated transfection, cells were washed with PBS twice and incubated Oligo name Sequence 5?-3? CVB2A-F GCTTTGCAGACATCCGTGATC CVB2A-R CAAGCTGTGTTCCACATAGTCCTTCA CVB3-2A probe FAM-TGTGGCTGGAAGATGATGCAATGGA-TRAMRA Desmin-F GTTTCAGACTTGACTCAGGCAG Desmin-R TCTCGCAGGTGTAGGACTGG GAPDH-F AGGTCGGTGTGAACGGATTTG GAPDH-R TGTAGACCATGTAGTTGAGGTCA 37 with 1 mL of transfection complexes containing 3 ?L of Oligofectamine? and 0.1 (final 0.1 nM) or 1 pmol (final 1 nM) of miRNA mimics, 50 pmol (final 50 nM) of miRNA inhibitors or 100 pmol (final 100 nM) of siRNAs for 6 h. Culture medium (500 ?L) containing 3? the normal concentration of serum was then added into the original transfection medium in the wells and incubated for another 42 h. For serum starvation treatment in Chapter 3, cells were replenished with serum free culture medium at 24 h post transfection and subjected to infection or other experimental procedures at around 24 h after serum starvation. For RNAiMax-mediated transfection, 200 ?L mixture containing 6 ?L of RNAiMax and  10 pmol (final 10 nM) of miRNA micmis, 50 pmol (final 50 nM) of miRNA inhibitors or 100 pmol (final 100 nM) of siRNAs were directly added onto the cells cultured in complete medium and incubated with the cells for 48 h. 2.12. Western blot (WB) Cells or tissues were washed with PBS and lysed in RIPA lysis buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % SDS, 1 % sodium deoxycholate, 1 mM PMSF, and complete protease inhibitor cocktail (1 tablet/10 mL, Roche)). Samples were briefly sonicated at 40 Hz for 30 seconds and centrifuged at 13,000 ? g for 20 min and the supernatants were collected. Protein concentration was determined by the Bradford assay (Bio-Rad) using fat-free-bovine serum albumin (BSA) as the standard. Equal amounts of proteins were separated by (SDS)-PAGE and transferred to nitrocellulose membranes (Pall Corporation). For proteins >150 kilodalton (kDa), 7 % gels were used. For proteins between 30 kDa and 150 kDa, 10% gels were used. For proteins smaller than 30 kDa, 16% gels were employed. The membranes were blocked with 5% skim milk in TBST buffer (25 mM Tris-HCl, 137 mM NaCl, 0.1% (v/v) Tween-20, pH 7.6) for 1 h and probed with primary antibodies at 4 ?C overnight and then incubated with corresponding secondary antibodies at room temperature for 1 h. The signals were then detected by ECL reagents (Syngene). For signals with similar molecular weights, membranes were stripped with Restore Western Blot Stripping Buffer (Thermo Scientific), washed with TBST, blocked with 5% milk and re-probed with primary and secondary antibodies.  38 2.13. Immunofluorescence staining and confocal microscopy Cells cultured on glass cover slips (Thermo Fisher) were washed with PBS and fixed with methanol/acetone (1:1) for 20 min at -20?C. Cells were then washed with TBS for twice and blocked with 2.5% bovine serum albumin (BSA) (Sigma) in TBS for 1 h at room temperature followed by incubation with primary antibodies diluted in blocking buffer for overnight at 4 ?C. Cells were then washed with TBS for 5 times (5 min/time) at room temperature. Secondary antibodies diluted in blocking buffer were then added into the samples and incubated for 1 h at room temperature. Samples were then washed with TBS for 5 times (5 min/time) at room temperature. The cover slips were mounted in nail oil onto microscope glass slides (Thermo Fisher) with DAPI (DAKO). Images were captured using a Leica AOBS SP2 confocal microscope (Leica, Allendale, NJ) and analyzed by Volocity software. 2.14. Antibodies For WB, the primary antibodies used were as follows: VP-1 (monoclonal) (DAKO); ?-actin (monoclonal) (Sigma); p-ETS-1 (T38) (polyclonal) and p-ETS-2 (T72) (polyclonal) (Life Technologies); GAPDH (monoclonal), p21waf1 (polyclonal), p27kip1 (polyclonal), Rb (polyclonal), cyclin D1 (monoclonal), cyclin E (monoclonal), t-ETS-1 (C-4) (monoclonal), t-ETS-2 (H-140) (polyclonal), t-ERK1/2 (MK1) (monoclonal) and caspase-3 (E-8) (monoclonal) (Santa Cruz); SPRED1 (polyclonal) (Millipore); LRP6 (C5C7) (monoclonal), p-ERK1/2 (Thr202/Tyr204) (monoclonal), p-GSK-3? (Ser9) (monoclonal), GSK-3? (27C10) (monoclonal), desmin (monoclonal), ?-catenin (polyclonal), pan-caderin (polyclonal), ?-E-catenin (polyclonal), phosphorylated protein kinase c (p-PKC) (polyclonal), p-cJun (monoclonal) and JunB (monoclonal) (Cell Signaling Technology); WRCH1 (polyclonal) (Abcam); Bcl-X (polyclonal) and ?-catenin (monoclonal) (BD Transduction Laboratories); ZFP-148 (polyclonal) and YOD1 (polyclonal) (Aviva Systems Biology). Goat anti-mouse or Goat anti-rabbit secondary antibodies were purchased from Santa Cruz. Signal intensities were quantified by using ImageJ program. The ratios of interested signals to the loading control (?-actin or the corresponding total proteins) were first calculated and then normalized to one of the samples (usually the control samples, set as 1.00). For immunoluorescence staining, primary antibodies for desmin (1:200) (monoclonal) (Cell Signaling Technology), ?-E-catenin (1:100) (polyclonal) (Cell Signaling Technology), pan-caderin 39 (polyclonal) (1:100) (Cell Signaling Technology) and Anti-20S Proteasome ?1, 2, 3, 5, 6, & 7-Subunits Mouse (1:100) (MCP231) antibody (monoclonal) (Millipore) were used. Alexa Fluor? 488 Goat Anti-Rabbit IgG and Alexa Fluor? 594 Goat Anti-Mouse IgG from Life Technologies were used as secondary antibodies (1:300). 2.15. Electronic microscopy (EM) Cultured cells were washed with 0.1M sodium cacodylate buffer and fixed in the primary fixing solution (2.5 % glutaraldehyde (Polysciences) in 0.1 M sodium cacodylate buffer) for 1 h. Cells were washed with 0.1M sodium cacodylate buffer for 3?10 min and fixed with secondary fixation solution (1% osmium tetroxide (Polysciences) and 1% potassium ferrocyanide in 0.1 M sodium cacodylate buffer) for 1 h followed by three washes with distilled water (10 min each). Cells were scraped from the culture dish and collected in 1.5 mL eppendorf tubes. Dehydration was conducted by incubating with increasing concentrations of acetone (30%, 50%, 70% and 90% for 15 min each) followed by 100% acetone (3?10 min). The samples were infiltrated with acetone:Eponate 12 resin (Ted Pella) (1:1) mixture for 1.5 h and then with acetone:Eponate 12 resin 2:1 for overnight. The next day, samples were further infiltrated with 100% Eponate 12 resin for 6 h, embedded in 100% Epon in flat embedding mould and incubated at 60-65 ?C. Samples were cut into thin sections of 60 nm thickness using a UC6 Ultramicrotome and viewed on a Tecnai 12 transmission electron microscope (FEI Inc.) For each treatment, 10 random regions were selected for calculating the desmosome number. 2.16. Live-cell confocal imaging Live-cell confocal imaging was performed according to a published method [330] with some modifications. Briefly, HeLa cells were plated in 35-mm glass bottom culture dishes (MatTek Culture Ware, Ashland, MA) for 24 h and then transfected with the miRNA mimics using Oligofectamine (Life Technology). The microscope incubator was maintained at 37 oC, and the CO2 concentration was adjusted to 5%. Observation of cell morphology was performed at 24 and 48 h post transfection under a Leica confocal microscope (TCS SP2) using differential interference contrast.  40 2.17. Constructs Reporter vectors were constructed based on pmir-GLO Dual-Luciferase miRNA Target Expression Vector purchased from Promega. Sequences of miRNA targeting sites were obtained from the 3? UTR of LRP6 or WRCH1, and cloned into the vector. Oligos (for chapter 3 and 5) for wt or mut targeting sites were synthesized and annealed using oligo annealing buffer (Promega) (Table 6). The annealed fragments were inserted into the 3? end of firefly luciferase gene in the reporter vector. The pmir-GLO vector contains a Renilla luciferase gene as a transfection efficiency control.  For the ZFP-148 3? UTR luciferase reporter vector in Chapter 5, total RNAs from HeLa cells were extracted as described above. A fragment of ZFP-148 3?UTR spanning the region (nts 7061-7504) was amplified by RT-PCR using one set of forward and reverse oligonucleotide primers containing the PmeI and XbaI restriction enzyme sites at their 5? ends, respectively. The first strand synthesis was performed using the Superscript III First Strand Synthesis Kit (Life Technologies), followed by the regular PCR method as described in the manufacturer?s instructions. The obtained PCR fragments were cloned into the pmir-GLO vector at the PmeI and XbaI sites. The obtained clones were confirmed by both restriction enzyme digestion and DNA sequencing. Using the obtained clone containing the partial ZFP-148 3?UTR as a template, two mutant reporter constructs (ZFP-148-3?UTR-Mut-1 and ZFP-148-3?UTR-Mut-2) were generated by site-directed mutagenesis within the miR-203 seed match region. Briefly, two mutagenic oligonucleotide primers containing the desired mutations, flanked by unmodified nucleotide sequences were designed. For mutagenic PCR, a 50 ml of reaction mixture containing 10 ng of DNA template, two mutagenic oligonucleotides, and Pfu DNA polymerase (Thermo Scientific) was prepared. PCR was performed with 18 thermal cycles with denaturing temperature at 95 ?C for 45 seconds, followed by annealing temperature at 56 ?C for 50 seconds and then 72 ?C extension for 2 minutes per kb plasmid length. Finally, the mutants were identified by adding 10 units of the DpnI restriction enzyme to the reaction mixture and incubated at 37 ?C for 1 h to digest the DNA (mutation destroyed the DpnI site). Two ?l of the DpnI-treated DNA were used to transform E. coli DH10B competent cells. The obtained mutants were confirmed by sequencing. 41 For overexpression of SPRED1 and YOD1, the SPRED1 (Human cDNA clone) and YOD1 (mouse cDNA clone) overexpression plasmids as well as the corresponding empty vector were purchased from Origene. The vectors (2 ?g/well for 6-well plates) were co-transfected with miRNA mimics (1 or 10 pmol/well) using LipofectemineTM 2000 (5 ?L/well). At 24 h post transfection, cells were replenished with serum free culture medium overnight and infected with CVB3 as described above.  Table 6. Oligoes and Primers for luciferase constructs  PmeI and XbaI restriction enzyme sites are underlined. Mutation sites are indicated with shadowing. Oligo name Sequence 5?-3? LRP6-wt-F AAACTTGTTCATTGACTTTGGTACGATTGGTGT LRP6-wt-R CTAGACACCAATCGTACCAAAGTCAATGAACAAGTTT LRP6-mut-F AAACTTGTTCATTGACTTTGGCGATATTGGTGT LRP6-mut-R CTAGACACCAATATCGCCAAAGTCAATGAACAAGTTT WRCH1-wt-F AAACATAGAATAGTAAAGGTACGATTATACT WRCH1-wt-R CTAGAGTATAATATCGCCTTTACTATTCTATGTTT WRCH1-mut-F AAACATAGAATAGTAAAGGCGATATTATACT WRCH1-mut-R CTAGAGTATAATATCGCCTTTACTATTCTATGTTT YOD1-wt-F AAACAAAGGAACACTTTATTTGAATAAGCTAGTTTGTT YOD1-wt-R CTAGAACAAACTAGCTTATTCAAATAAAGTGTTCCTTTGTTT YOD1-mut-F AAACAAAGGAACACTTTATTTGAACCCACTAGTTTGTT YOD1-mut-R CTAGAACAAACTAGTGGGTTCAAATAAAGTGTTCCTTTGTTT VCL-wt-F AAACCGCTAAAAAACTACATTTATAAGCTAGGATTTGTT VCL-wt-R CTAGAACAAATCCTAGCTTATAAATGTAGTTTTTTAGCGGTTT VCL-mut-F AAACCGCTAAAAAACTACATTTACCCACTAGGATTTGTT VCL-mut-R CTAGAACAAATCCTAGTGGGTAAATGTAGTTTTTTAGCGGTTT ZNF148-wt-F GCCGGTTTAAACGCCCGTAAGTTTGAGGTGA ZNF148-wt-R GCGTTCTAGACCAAGTTCCCTTCAGACAGC ZNF148-mut1-F TGTAGCAAAGCCTCTGAGTAGAAAGAATTTTGCAACAA ZNF148-mut1-R TTCTTTCTACTCAGAGGCTTTGCTACAATAATAAAAAG ZNF148-mut2-F TCATAACTACCTCTGAATAATTCTAAACTTTCTACATT ZNF148-mut2-R TTAGAATTATTCAGAGGTAGTTATGAAATATGAAGAGA 42 2.18. Luciferase assay  The reporter constructs were then co-transfected with miRNA mimics using LipofectemineTM 2000 (Life Technologies) following the manufacturer?s instructions. Briefly, HeLa cells (1?105 cells/well) were plated in 24-well plates for 24 h and then added with the transfection solution containing the constructed luciferase reporter plasmids (wt or mut, 150 ng/well), the miRNA mimics (1 pmol/well) and  LipofectamineTM 2000 (1 ?L/well). Two days post transfection, firefly and Renilla luciferase activities were measured using the Dual-Glo luciferase analysis system (Promega) according to the manufacturer?s protocol. Briefly, the transfected cells were lysed with 100 ?L/well of passive lysis buffer (Promega) and then 20 ?L of the lysates were mixed with 100 ?L of LAR II Luciferase Assay Substrate. The firefly luciferase activity was measured immediately using an ELISA reader (TECAN). One hundred ?L of Stop & Glo? solution was then added and the Renilla luciferase activity was detected using the same ELISA reader. All the assays were performed in triplicates. The firefly to Renilla luciferase activity ratios were calculated and normalized to the miR-CL control group which was set as 1.0. 2.19. Statistical analysis All experiments were repeated at least three times. The Student?s t-test was used for the comparison between the control groups and the experiment groups. Error bars represent means ?SD. A p value < 0.05 (labeled with ?*?) in two-tailed tests was considered as statistically significant. ?**? was used for labeling differences with p value < 0.01.          43 Chapter 3: Roles of miR-126 in CVB3 replication and virus-induced cell death 3.1. Background 3.1.1. miR-126 structure and its expression miR-126 is located in the intron of an endothelial enriched gene, Egfl7, and thus highly expressed in endothelial cells [254]. The pre-miR-126 can be processed to both miR-126 (also referred to as miR-126-3p) and miR-126* (miR-126-5p) with the star strand showing much lower expression level. This miRNA is highly conserved in various organisms, suggesting its essential biological functions. Early northern blot detected no miR-126 expression in cardiomyocytes [254] but later q-PCR data with higher sensitivities showed that miR-126 expression level is comparatively higher in cardiomyocytes than in other adherent nonmyocytes [264]. Recent data from next generation sequencing in HL-1 mouse cardiomyocytes showed that miR-126 accounts for ~0.1% as compared to miR-1 for ~6.5% [331]. The estimated copy number of miR-126 in the heart is more than 6000/cell [332] but the exact quantity in cardiomyocytes still needs further investigation using single cell microRNA profiling [333]. miR-126 level is altered in many diseases such as cancer [334], cardiovascular diseases [335] and infectious diseases [336]. The expression of miR-126 can be further induced by stress conditions such as hypoxia in cardiomyocytes [337]. The expression of miR-126 is usually co-regulated with its parental transcripts Egfl7. Transcriptional factors ETS-1 and ETS-2 have been found to regulate miR-126 levels [210]. It is also found that the promoter region of miR-126 can be methylated to reduce it expression in breast cancer [334].  3.1.2. miR-126 in cardiac diseases and infectious diseases miR-126 is enriched in the heart [338] and involved in cardiovascular diseases [256, 339]. miR-126 is a pro-angiogenic factor as evidenced in KO models in mice and zebrafish [254, 339]. miR-126 deficiency leads to late embryonic or neonatal death (40%) with severe vascular abnormalities [254]. miR-126 is decreased in angiogenic early outgrowth cells from patients with chronic heart failure, which contributes to the limited capacity of cardiac neovascularization and function in those patients [335].  miR-126 is also altered in endothelial progenitor cells in patients with chronic heart failure [340]. Hypoxia and HSAC inhibitors induced miR-126 expression to activate ERK1/2 and Akt pathways, 44 contributing to cardioprotection by enhancing cell survival and pro-angiogenic processes [337]. Increased level of circulating miR-126 is positively associated with myocardial infarction and may contribute to the angiogenesis process in myocardium towards post-infarct remodeling [341, 342]. In the endomyocardial biopsy tissues obtained from patients with DCM, miR-126 level is lower than control group [343]. miR-126 has also been found to be altered during viral infection. miR-126 is downregulated in HCV positive splenic marginal zone lymphoma though it is not clear whether this is directly caused by the viral infection [344]. miR-126 is increased in Andes virus infected cells, which may serve as a host defense counteracting the virus-induced increase in vascular permeability via SPRED1, a target of miR-126 [336]. However, the exact roles of miR-126 in infectious diseases are still unclear. 3.1.3. miR-126 regulated signal pathways miR-126 has been demonstrated to regulate multiple signal pathways. The most widely studied pathways under the regulation of miR-126 are ERK1/2 and Akt pathways. It has been reported in several studies that miR-126 target SPRED1, an inhibitor of ERK1/2 signaling, and thus augment the activation of ERK1/2 [254, 336, 339, 345]. miR-126 targets  PIK3R2 to trigger Akt pathway activation [339]. Beside these two pathways, miR-126 also modulate adhesion molecules such as vascular cell adhesion molecule 1 (VCAM-1) [346] and Crk [347], cell growth/ cell cycle signals IRS-1 [348], EGFL7 [349], PAK1 [350], VEGF-A [351] and SOX2 [352], TNF-alpha-induced signaling pathway signal TOM-1 [353], hematopoietic cell differentiation signal c-Myb [354], angiogenesis signal SDF-1 [355] and mammalian Hox gene HOXA9 [356]. The wide regulation of miR-126 on signal transduction networks indicates its essential biological function. 3.1.4. Roles of ERK1/2 and ?-catenin in CVB3 infection CVB3 has adopted many strategies to hijack host cellular machineries to benefit its own replication. The viral infection can lead to systematical changes of host gene transcription and translation, resulting in dramatic reprogramming of the signal transduction networks [357-360]. The ERK1/2 signaling pathway has been found to be one of the most critical pillars of these networks during CVB3 infection. I and others have observed that CVB3 infection induces ERK1/2 phosphorylation and that the inhibition of ERK1/2 activation attenuated viral replication and subsequent cell death [145, 361]. Recent 45 reports also showed that ERK1/2 regulates the entry of CVB3 into the host cells [158]. It is speculated that ERK1/2 phosphorylation is triggered by viral protease-mediated cleavage of RasGAP during CVB3 infection [159]. ERK1/2 activation also requires the presence of Src family kinase p56lck [362]. ?-catenin is another essential signal involved in CVB3 infection. Our group previously showed that CVB3 infection activates GSK-3? through tyrosine kinase during early infection, leading to the inhibition of ?-catenin. This signal pathway induces CPE and subsequent cell death that benefits viral progeny release [156]. However, the mechanism for GSK-3? activation still needs further investigations. 3.2. Rationale Viruses are obligate parasites and interact with their hosts by manipulating cellular signal transduction to either evade the host immune responses to maximize their replication or initiate viral progeny release to further infect surrounding healthy tissue [363]. CVB3 has been found to induce host cell death at the late stage of infection to facilitate the viral progeny release, enabling the infection of surrounding cells [144, 154, 155]. The ERK1/2 pathway is activated and essential for CVB3 replication. However, it is unknown yet whether its upstream negative regulator, SPRED1 [364], is involved in CVB3 infection. GSK-3? mediated degradation of ?-catenin triggers CPE and cell death during CVB3 infection. However, it is not clear why the activity of GSK-3? is only transiently increased at approximately 1 hpi while the degradation of ?-catenin starts much later (5-7 hpi). It is also unknown whether other upstream regulators of GSK-3?/?-catenin cascade, such as mediators in the Wnt signaling pathways [365], regulate this process. miRNAs play essential roles in viral infection. However, most studies until now focus on the regulation of a specific pathway by miRNAs while the modulation of cross-talk among multiple pathways by a single miRNA in viral infection has not been well-studied. miR-126 is a heart enriched miRNA [338] involved in cardiovascular diseases [256, 339]  but its function in CVB3-induced infectious heart disease is still entirely unknown. It is not clear whether miR-126 is a positive or negative regulator in CVB3 infection. To address this issue, I explored the expression of miR-126 during CVB3 infection and investigated its effect on viral replication and cytopathogenesis with a particular focus on ERK1/2 and GSK-3?/?-catenin pathways. 46 3.3. Hypothesis and specific aims The objective of this chapter is to elucidate the CVB3-induced alterations of miR-126 expression and the subsequent effect on viral replication. I HYPOTHESIZE that CVB3 infection induces miR-126 upregulation and in turn benefits viral replication. The SPECIFIC AIMS for this chapter are as follows: Aim 1. To investigate the influence of CVB3 infection on host miR-126 expression level Aim 2. To study the effect of altered miR-126 level on CVB3 replication Aim 3. To identify the signal pathways regulated by miR-126 contributing to CVB3 replication 3.4. Results 3.4.1. CVB3 infection induces miR-126 expression through the ERK1/2-ETS cascade To investigate the roles of miR-126 in CVB3 infection, particularly the association between viral infection phases and miR-126 expression levels, HeLa cells were infected with CVB3 and the miR-126 levels were detected by q-RT-PCR. At the early stages of infection (0-1 h), no significant change of miR-126 expression was detected between CVB3-infected and sham-infected (sh) control cells (Fig. 6a). A temporal decrease of miR-126 expression was observed at 3 hpi but a robust increase (1.5-2 folds) appeared afterwards (Fig. 6b). Prolonged infection (16 h) of CVB3 further induced miR-126 (3-5 folds) with a positive correlation between viral titers and levels of miR-126 induction (Fig. 6c).  To elucidate the mechanism by which CVB3 upregulates host miR-126, the expression of ETS-1 and ETS-2, two transcription factors involved in miR-126 induction, was detected [210]. Surprisingly, both ETS-1 and ETS-2 declined gradually throughout the course of CVB3 infection (Fig. 6d). As the activities of ETS-1/2 are enhanced by ERK1/2-mediated phosphorylation at threonine 38 (T38) for ETS-1 and (T72) for ETS-2 [366], I thus further examined the phosphorylation levels of ERK1/2 and ETS-1/2. The data showed that ERK1/2 had a temporal phosphorylation at 30 min followed by a continuous activation starting from 5 hpi. The later ERK1/2 activation correlated well with the elevated phosphorylation levels of ETS-1/2 (Fig. 6d). In prolonged infection with a low virus titer, ETS-1/2 phosphorylation was also enhanced (Fig. 6d). Similar correlations between miR-126 induction and ERK1/2-ETS phosphorylation were also found in cardiomyocytes HL-1 and HUVEC cells (Fig. 7 a-d). 47 In addition, I used UV-inactivated CVB3, which can only enter the cells by endocytosis but not conduct successful replication to infect HeLa cells. The results showed that UV-treated CVB3 failed to initiate the expression of VP-1 and induce miR-126 upregulation (Fig. 7 e-f). To further confirm the association between ERK1/2-ETS phosphorylation and miR-126 induction during CVB3 infection, I treated the cells with ERK1/2 inhibitor U0126. I found that U0126 dramatically inhibited ERK1/2 and ETS phosphorylation compared with DMSO (control) during CVB3 infection (Fig. 6e). Correspondingly, miR-126 level was downregulated significantly when treated with U0126 during CVB3 infection (Fig. 6f). These data imply that CVB3 infection induces miR-126 through ERK1/2-ETS signal cascade. 48        49 Figure 6. CVB3 infection upregulates miR-126 through ERK-ETS cascade. (a, b and c) Time- and viral titer-dependent regulation of miR-126 by CVB3 in HeLa cells. Cells were infected with CVB3 at indicated titer and time points. Cellular RNAs were isolated for detection of miR-126 using real-time RT-PCR. All data were normalized to the sham-infected samples. (?*? (p < 0.05) or ?**? (p < 0.01), n=6. (d) ERK1/2 and ETS-1/2 phosphorylation in CVB3 infected HeLa cells. Cells were infected by as indicated. Cellular proteins were isolated for WB detection of indicated signal proteins. ?-actin was detected as a loading control. (e) Inhibition of ERK1/2 blocks ETS phosphorylation during CVB3 infection. HeLa cells were treated with U0126 or DMSO (control) and then infected with CVB3. WB was conducted to detect the indicated signal proteins. p-ETS stands for the phosphorylated ETS while t-ETS stands for the total level of ETS proteins. (f) Inhibition of ERK1/2 suppresses miR-126 upregulation during CVB3 infection. HeLa cells were treated with U0126 or DMSO and then infected as indicated. miR-126 levels were detected by q-RT-PCR.    50      51 Figure 7. ETS-1/2 phosphorylation associates with miR-126 induction during CVB3 infection. HL-1 (a, c) or HUVEC cells (b, d) were infected by CVB3 as indicated. Cellular RNAs were isolated for q-RT-PCR detection of miR-126 level (a, b). p < 0.01, n=6. Cellular proteins were isolated for WB detection of viral protein (VP-1), p-ERK1/2 (phospho-ERK1/2), t-ERK1/2 (total ERK1/2), p-ETS-1 (phosphorylation of ETS-1 at T38), t-ETS-1 (total ETS-1), p-ETS-2 (phosphorylation of ETS-2 at T72), t-ETS-2 (total ETS-2), and ?-actin (loading control) (c, d). Hela cells were infected with PBS, UV-irradiated CVB3 or normal CVB3 for 7 h. VP-1 was detected as an indicator for viral replication (e). miR-126 levels were measured by q-RT-PCR (f). p < 0.01, n=4.                      52 3.4.2. miR-126 promotes CVB3 replication To study the effect of CVB3-induced miR-126 expression on host-virus interactions, I first transfected cells with miRNA mimics to test their effect on CVB3 replication. Two different concentrations (0.1 and 1 nM) were used to evaluate potential dose-dependent effect. q-RT-PCR showed that miR-126 mimics increased cellular miR-126 levels at 48 h post transfection compared to the scrambled control miRNA mimics (miR-CL) (Fig. 8a). The cells were then infected with CVB3 for 7 h. WB results showed that 0.1 nM and 1 nM of miR-126 mimics led to increased viral protein (VP-1) expression by 1.8- and 2.2-fold, respectively (Fig. 9a). Viral plaque assay using the collected supernatants post infection demonstrated that miR-126 significantly enhanced viral progeny release and this effect was positively correlated to the miR-126 concentration as well (Fig. 9c). To confirm that the above observation was not due to the non-specific effect of miRNA overexpression, I applied miRNA inhibitors to knock down the endogenous miR-126 level. Q-RT-PCR showed the successful inhibition of cellular miR-126 by miR-126 inhibitor (126-in) compared to control (CL-in) (Fig. 8b). In contrast to miR-126 mimics, 126-in significantly suppressed VP-1 expression by 50% and viral progeny release by 80% compared to the control inhibitor (Fig. 9b and 9d). Together, our results show that miR-126 benefits CVB3 replication.  Figure 8. miR-126 levels after transfection of miR-126 mimic or its inhibitor. HeLa cells were transfected as indicated. At 48 h post transfection, cellular RNAs were isolated for detection of mature miR-126 using q-RT-PCR. The data were normalized to that of control samples. p < 0.01, n=3. 53  Figure 9. miR-126 promotes CVB3 replication. HeLa cells were transfected with miRNA mimics (a, c) or miRNA inhibitors (b, d) as indicated for 48 h. Cells were then infected by CVB3 at 10 MOI for 7 h. Total proteins were isolated for detection of VP-1 by WB as an indicator for viral replication (a, b). The intensities of the bands were measured by ImageJ and the signal ratios were listed below. p < 0.05, n=3. Viral titer was determined by plaque assay using the supernatants collected at 7 hpi. p < 0.05, n=3 (c, d). 54 3.4.3. miR-126 promotes CVB3 replication by targeting SPRED1 SPRED1 has been reported as a miR-126 target gene that negatively regulates the ERK1/2 signaling pathway [339]. Further, the ERK1/2 pathway is known to be essential for CVB3 replication [145, 367]. However, the role of SPRED1 in making the connection among these factors has not been studied. Thus, investigation of this question may elucidate the underlying mechanism by which miR-126 regulates CVB3 replication. To this end, I transfected the cells with miR-126 mimics (0.1 nM) or 126-in (50 nM) to explore their influences on SPRED1 and ERK1/2 activation and subsequently on CVB3 replication. In all four groups (miR-CL, miR-126, CL-in and 126-in), a significant reduction in SPRED1 was found in CVB3 infected cells (10 MOI, 7 h) compared to control (no virus, sh-7 h). In miR-126 mimic transfected samples, the SPRED1 level was much lower than that of the miR-CL group (Fig. 10a). Corresponding to the inhibition in SPRED1 expression, miR-126 mimic enhanced the ERK1/2 activation after CVB3 infection (Fig. 10a). On the contrary, when treated with 126-in to knock down cellular miR-126, SPRED1 levels were increased while ERK1/2 activation was decreased during viral infection (Fig. 10a).  To further confirm that SPRED1 downregulation by miR-126 benefits CVB3 replication, I overexpressed SPRED1 in the presence of miR-126 by co-transfection. WB results showed that compared with empty vector (miR-CL+Vec), overexpression of SPRED1 (miR-CL+SPRED1) inhibited both VP-1 production and ERK1/2 phosphorylation by approximately 30% (Fig. 10b). When the SPRED1 overexpression vector was co-transfected with miR-126 (miR-126+SPRED1), the VP-1 expression and ERK1/2 activation was almost restored to the levels in the miR-CL+Vec group. In addition, SPRED1 overexpression reduced the viral progeny release by ~50% in the absence of miR-126, but it failed to completely diminish the effect of miR-126 on viral progeny release as evidenced by the production of more viral plaque in the miR-126+SPRED1 group than in the miR-CL+Vec group  (p < 0.05) (Fig. 10c). I also used siRNA to knock down the expression of SPRED1. I found that SPRED1 siRNA inhibited the SPRED1 expression and increased both ERK1/2 phosphorylation and VP-1 synthesis during CVB3 infection (Fig. 11a). Viral plaque assay also showed that SPRED1 siRNA enhanced viral release by approximately 2 folds (Fig. 11b). To further confirm the role of miR-126 in SPRED1 inhibition and 55 ERK1/2 activation, I also tested the miR-126 effect on CVB3 replication using HL-1 cells. The results showed that the miR-126 inhibitor suppressed cellular miR-126 expression, ERK1/2 activation, VP-1 synthesis and viral progeny release in HL-1 cells (Fig. 11c-e). 56   57 Figure 10. miR-126 promotes CVB3 replication by targeting SPRED1 and enhancing ERK1/2 activation. (a) miR-126 suppressed SPRED1 and enhanced ERK1/2 phosphorylation. HeLa cells were transfected with miRNA mimics (0.1 nM) or miRNA inhibitors (50 nM) and then infected with CVB3 as indicated. Cellular proteins were applied to WB detection of indicated signals. The intensities of the bands were measured by ImageJ and the signal ratios were listed. (b) Overexpression of SPRED1 partially reversed the effect of miR-126 on VP-1 production and ERK1/2 activation. HeLa cells were co-transfected with miRNA mimics (0.1 nM) and SPRED1 plasmid or empty vector (Vec) and infected with CVB3 as indicated. The signals were detected by WB. The intensities of the bands were measured by ImageJ and the signal ratios were listed. p < 0.05, n=3. (c) Overexpression of SPRED1 inhibited viral progeny release. HeLa cells were co-transfected with miRNA mimics and SPRED1 plasmid and then infected with CVB3. Viral titers were determined by plaque assay using the supernatants. p < 0.05 (?*?), p < 0.01 (?**?), n=3.  58      59  Figure 11. Knockdown of SPRED1 enhances CVB3 replication in HeLa cells and inhibition of miR-126 suppresses CVB3 replication in HL-1 cells. (a) Knockdown of SPRED1 enhanced ERK1/2 phosphorylation and VP-1 production. HeLa cells were transfected with scrambled siRNA (si-Scr) or SPRED1 siRNA (si-SPRED1) and then infected with CVB3. (b) Knockdown of SPRED1 moderately enhanced viral progeny release. Supernatants from the siRNA-transfected and CVB3-infected samples were collected for plaque assay. p < 0.01, n=4. (c) miR-126 inhibitor reduced cellular miR-126 level in HL-1 cells. HL-1 cells were transfected with control inhibitor (CL-in) or miR-126 inhibitor (126-in) at 50 nM. At 48 h post transfection, cellular RNAs were isolated for detection of mature miR-126 using q-RT-PCR. These data were normalized to that of CL-in. p < 0.01, n=3. (d) miR-126 inhibitor downregulated VP-1 expression and ERK1/2 phosphorylation in HL-1 cells. CL-in or 126-in transfected HL-1 cells were infected with CVB3 as indicated. Cellular proteins were isolated for WB detection of indicated signals. (e) miR-126 inhibitor suppressed viral progeny release in HL-1 cells. Viral titer was evaluated by plaque assay using the supernatants collected at 24 hpi at 10 MOI. p < 0.05, n=3.  To validate that VP-1 upregulation by the miR-126-SPRED1 cascade is indeed through the ERK1/2 pathway, I treated cells with ERK1/2 inhibitor U0126 in the presence of miR-126 mimics or SPRED1 siRNA. Though miR-126 and SPRED1 siRNA still successfully inhibited SPRED1, their effect on upregulation of VP-1 was no longer observed in the presence of U0126 which inhibited ERK1/2 activation (Fig. 12a).  This indicates that ERK1/2 activation is necessary downstream effectors for miR-126-SPRED1 pathway to promote CVB3 replication. Surprisingly, in the presence of U0126, a ~7-fold increase in viral progeny release was still observed in miR-126 transfected cells (8.25?106 pfu/mL) compared to miR-CL (1.23?106 pfu/mL) (Fig. 12b). In contrast, U0126 efficiently diminished the effect of SPRED1 siRNA on viral progeny release (Fig. 12c). This indicates that other miR-126 targets may also contribute to CVB3 progeny release in addition to SPRED1. The above data showed that suppression of SPRED1 by miR-126 enhanced ERK1/2 activation and viral replication during CVB3 infection. 60  Figure 12. ERK1/2 inhibitor blocks the effect of miR-126 on VP-1 upregulation but not on the cell death or viral progeny release. HeLa cells were transfected with miR-126 mimics or SPRED1 siRNAs. At 48 h post transfection, cells were serum starved overnight, treated with DMSO or U0126 and infected with CVB3 at 10 MOI for 7 h in the presence of DMSO or U0126. VP-1 production and ERK1/2 activation were measured by WB (a). Supernatants were collected for plaque assay (b and c). p < 0.01, n=5.              61 3.4.4. miR-126 sensitizes cells to CVB3-induced cell death and enhances viral progeny release As mentioned above, neither SPRED1 overexpression nor ERK1/2 inhibition can completely block the effect of miR-126 on enhancing viral progeny release, which indicates that other mechanisms of miR-126 action also play an important role in this regard. Previous studies showed that CVB3 induced CPE and cell death is essential to viral progeny release [144, 154, 156]. I therefore investigated whether miR-126 would affect virus-induced CPE and cell death. Morphological data showed that transfection of miR-126 mimics induced more degenerative changes (cell rounding and detaching) and CPE in CVB3 infected cells than in miR-CL cells (Fig. 13a). This miR-126-induced cell morphological degeneration was also dose dependent, suggesting that miR-126 enhances CVB3-induced cell death. In support of this observation, I conducted WB to detect pro-caspase-3 cleavage after CVB3 infection. As expected, I found a substantial elevation of pro-caspase-3 cleavage in the miR-126 groups compared to miR-CL (Fig. 13b).  This increased cleavage is particularly apparent in cells transfected with higher concentrations of miR-126. In contrast to miR-126 mimics, 126-in significantly suppressed the virus-induced CPE and caspase-3 activation post CVB3 infection (Fig. 13c-d). To quantify the effect of miR-126 on cell death during CVB3 infection, I conducted MTS assay. The results showed that miR-126 mimic transfected at 0.1 nM led to ~25% and ~50% reduction in cell survival compared with miR-CL at 7 and 16 hpi, respectively (Fig. 13e). When the concentration of miR-126 increased, the reduction in cell survival was also enhanced. I also confirmed this effect by using 126-in, which increased cell survival by 1.2 and 2 folds at 7 and 16 hpi, respectively (Fig. 13f). Together, our results showed that miR-126 sensitized the cells to CVB3-induced cell death. 62  Figure 13. miR-126 enhances CVB3-induced CPE and cell death. HeLa cells were transfected with miRNA mimics (a, b and e) or miRNA inhibitors (c, d and f) as indicated for 48 h. Cells were then infected by CVB3 at 10 MOI for 7 h or 0.05 MOI for 16 h. The morphologies of cells were observed under a phase contrast microscope. Magnification, 100 ?; Scale bar, 30 ?m (a, c). Caspase-3 cleavage was evaluated by WB as an indicator of cell apoptosis (b, d). Cell survival rates were measured by MTS assay (e, f). P < 0.01, n=5.  63 To test whether the enhanced cell death mediated by miR-126 expression benefits viral progeny release, I used caspase-3 inhibitor Z-VAD to suppress virus-induced cell apoptosis. Cells were transfected with miR-CL or miR-126, treated with Z-VAD and then infected with CVB3. The results showed that Z-VAD inhibited the effect of miR-126 on cell death (Fig. 14a). Though miR-126 still effectively suppressed SPRED1 and increased VP-1 in the presence of Z-VAD (Fig. 14b), its influence on viral progeny release was reduced from 10 folds (in DMSO group) to 4 folds (in Z-VAD group) (Fig. 14c). Particularly, miR-126+Z-VAD showed similar viral progeny release level to miR-CL+DMSO. These results indicated that miR-126 enhances the CVB3-induced cell death which benefits viral release.  Figure 14. Inhibition of caspase-3 activation alleviates the effect of miR-126 on cell death and viral particle release. HeLa cells were transfected with miRNA mimics (0.1 nM). At 48 h post transfection, cells were serum starved overnight, treated with DMSO or Z-VAD (50?M) and then infected with CVB3 at 10 MOI for 7 h in the presence of DMSO or Z-VAD. Cell survival rates were measure by MTS assay (a) (p < 0.01 n=4). Indicated signals were measured by WB (b). Supernatants were collected for plaque assay (c) (?**? p <0.01; ?*?, p < 0.05. n=4). 64 3.4.5. miR-126 sensitizes cells to CVB3-induced cell death by targeting WRCH1 and LRP6 and promoting ?-catenin degradation To explore the signal transduction pathways regulated by miR-126 during the process of CVB3-induced CPE and cell death, I searched for its potential targets in a miRNA target database, the TargetScan [368]. A total of 154 targets were identified, with 25 conserved and 129 non-conserved ones. Conservation was determined by the sequence homology among different species. Among the top 10 conserved targets across different species, I selected LRP6, a receptor of the Wnt/?-catenin signaling pathway [369], for further investigation. This is due to our previous finding that ?-catenin is a major signal molecule contributing to CVB3 induced CPE and cell death [156] (Fig. 15a and Table 7). Another Wnt signaling related gene, WRCH1, is one of the non-conserved potential targets of miR-126 (Fig. 15a). I thus further studied these two genes during CVB3 infection and their regulation by miR-126. Table 7. Top 10 conserved targets of miR-126 predicted by using TargetScan     Rank Target gene Representative transcript Gene name Total context+ score Aggregate Pct 1 PTPN9 NM_002833 protein tyrosine phosphatase, non-receptor type 9 -0.52 <0.1 2 PLXNB2 NM_012401 plexin B2 -0.48 0.55 3 RGS3 NM_021106 regulator of G-protein signaling 3 -0.4 0.56 4 KANK2 NM_001136191 KN motif and ankyrin repeat  domains 2 -0.38 <0.1 5 EFHD2 NM_024329 EF-hand domain family, member D2 -0.32 0.56 6 CAMSAP1 NM_015447 calmodulin regulated spectrin-associated protein 1 -0.31 0.56 7 ZNF219 NM_001101672 zinc finger protein 219 -0.3 0.54 8 SPRED1 NM_152594 sprouty-related, EVH1 domain containing 1 -0.3 0.56 9 LRP6 NM_002336 low density lipoprotein receptor-related protein 6 -0.29 0.56 10 RNF165 NM_152470 ring finger protein 165 -0.29 0.56 65 To study how miR-126 regulates LRP6 and WRCH1, I transfected HeLa cells with miR-126 or miR-CL mimics at the final concentration of 0.1 nM and detected the expression levels of these genes. WB results showed that miR-126 suppressed the expression of LRP6 and WRCH1 compared to the control  (Fig. 15b). In addition, correlated to the upregulation of miR-126 after CVB3 infection (Fig. 6b), the expression levels of LRP6 and WRCH1 were downregulated in CVB3-infected samples compared to the sham-infected ones. These results suggested that miR-126 can suppress the expression of LRP6 and WRCH1. To verify that LRP6 and WRCH1 are true targets of miR-126, I constructed luciferase reporter vectors harboring either wild-type (wt) or mutant (mut) miR-126 targeting sites in the WRCH1 or LRP6 3?UTR. The mutations were introduced by changing four base-pairs in the seed match regions (Fig. 16). Luciferase assay showed that miR-126 significantly decreased the luciferase activities in both LRP6 and WRCH1 reporter constructs containing the wt 3?UTR but not the mut ones (Fig. 15c), indicating that WRCH1 and LRP6 are two novel targets of miR-126.   66  Figure 15. LRP6 and WRCH1 are specific targets of miR-126. (a) Prediction of miR-126 target on LRP6 and WRCH1. Bioinformatic prediction was conducted using TargetScan. The base pairing between miR-126 and its potential target sites are listed. The ?G-U? paring is labeled with ???. The perfect matching between the seed region and seed-match region is boxed. (b) miR-126 suppressed the expression of LRP6 and WRCH1. HeLa cells were transfected with miR-126 (0.1 nM) and infected with CVB3 as indicated. Cellular proteins were collected for WB analysis of the expression of LRP6 and WRCH1. (c) Validation of miR-126 targeting on LRP6 and WRCH1 by luciferase assay. HeLa cells were co-transfected with miR-126 or miR-CL and luciferase reporter vectors harboring the wt or mut targeting sites. Firefly and Renilla luciferase activities were detected by dual luciferase assay and the firefly/Renilla luciferase ratios were calculated. All data were normalized to that of cells co-transfected with miR-CL and wt reporter vector (set as 1.0). p < 0.01, n=4. 67  Figure 16. Design of luciferase reporter constructs for LRP6 and WRCH1. (a) Schematic structure of pmir-GLO dual-luciferase reporter constructs. Wt or mut binding sites of miR-126 were inserted at the 3? end of firefly luciferase gene. Mutations were introduced by changing four nucleotides (shown in red) in the seed math region (boxed). The ?G-U? paring was labelled with ???. (b) Oligonucleotides containing wt or mut seed-match sequence of miR-126 target genes. Sequences containing the miR-126 binding sites were obtained from the 3?UTR of LRP6 or WRCH1. PmeI (showed in red) and XbaI (showed in blue) restriction enzymes sites were added to the 5? or 3? end of the oligonucleotides as indicated for cloning. The two strands were annealed together and inserted into pmir-GLO vector according to the instructions of manufacturer. The wt or mut seed match regions were underlined.     68 To understand the roles of LRP6 and WRCH1 in miR-126-mediated Wnt/?-catenin signaling pathway, I examined the downstream effector gene expression after CVB3 infection. I first confirmed that miR-126 mimic suppressed the expression of LRP6 and WRCH1 while miR-126 inhibitor enhanced their expression (Fig. 17a). Previous studies showed that GSK-3? induces ?-catenin degradation and this process plays important roles in CVB3 induced CPE and viral progeny release [156]. However, GSK-3? phosphorylation inhibits its activity in inducing ?-catenin degradation [156] while LRP6 and the homolog of WRCH1, cdc42, are associated with GSK-3?/?-catenin cascade [365, 370]. I therefore tested the GSK-3? phosphorylation and ?-catenin degradation after miR-126 transfection and CVB3 infection. Significant inhibition of GSK-3? phosphorylation and increases in ?-catenin degradation were observed in miR-126 transfected cells (Fig. 17a). This finding was confirmed by using miR-126 inhibitor, which promoted GSK-3? phosphorylation and preserved ?-catenin from degradation (Fig. 17a). To further investigate the roles of LRP6 and WRCH1 in GSK-3?/?-catenin cascade during CVB3 infection, I used siRNAs to knock down their expression levels. As expected, inhibition of these two genes by siRNAs promoted ?-catenin degradation (Fig. 17b-c). WRCH1 siRNA suppressed GSK-3? phosphorylation, similar to the function of miR-126. LRP6 siRNA showed almost no effect on GSK-3? phosphorylation. In addition, LRP6 and WRCH1 siRNA had little effect on VP-1 levels (Fig. 17b-c). These data indicate that miR-126 promotes ?-catenin degradation by targeting LRP6 and WRCH1. 69  Figure 17. Regulation of GSK-3?/?-catenin cascade by miR-126 through targeting WRCH1 and LRP6. (a) miR-126 regulates GSK-3? phosphorylation and ?-catenin degradation. HeLa cells were transfected with miRNA mimics (0.1 nM) or miRNA inhibitors (50 nM) and infected with CVB3. Indicated signals were detected by WB. (b, c) Knocking down of LRP6 or WRCH1 inhibited GSK-3? phosphorylation and enhanced ?-catenin degradation. HeLa cells were transfected with LRP6 siRNA (b) or WRCH1 siRNA (c) and infected with CVB3. Indicated signals were detected by WB.    70 I then further confirmed the roles of LRP6 and WRCH1 on CVB3-induced cell death and viral progeny release. Consistent with the ?-catenin degradation data, both siRNAs significantly enhanced the virus-induced cell death as evidenced by caspase-3 activation and MTS assay data (Fig. 18a-c). As mentioned above, CVB3 induces cell death to benefit its progeny release [144, 154, 155]. As expected, LRP6 and WRCH1 siRNAs both enhanced viral progeny release (Fig. 18d-e). To further confirm the targeting effect of miR-126 on LRP6 and WRCH1, I repeated the test using another human cell line, HUVEC. I found that miR-126 inhibitor successfully repressed cellular miR-126 levels, preserved LRP6 and WRCH1 expression, increased GSK-3? phosphorylation, delayed ?-catenin degradation and inhibited CVB3-induced caspase-3 activation (Fig. 19). The above findings reveal that miR-126 targets LRP6 and WRCH1 and promotes ?-catenin degradation through regulating GSK-? activity, contributing to virus-induced cell death and viral progeny release.        71  Figure 18. Knockdown of LRP6 or WRCH1 sensitizes the cells to CVB3-induced cell death and enhances viral progeny release. HeLa cells were transfected with siRNAs targeting LRP6 or WRCH1 and then infected with CVB3. Caspase-3 activation was detected by WB (a). Cell survival rates were measured by MTS assay (b-c) and viral progeny release was quantified by plaque assay (d-e). p < 0.01, n=4. 72  Figure 19. miR-126 inhibitors represses ?-catenin degradation and caspase-3 activation in HUVEC cells. (a) miR-126 inhibitor downregulated miR-126 expression. Cells were transfected with miR-126 inhibitor and infected with CVB3 as indicated. Cellular miR-126 was quantified by q-RT-PCR. The data were normalized to that of miR-126 inhibitor-transfected and sham-infected samples. p < 0.01, n=4 (b) Inhibition of miR-126 suppressed ?-catenin degradation and caspase-3 activation during CVB3 infection. HUVEC cells were transfected and infected as indicated. WB was conducted to detect the indicated signals. 73 3.5. Discussion Virus-host interactions determine viral pathogenesis and are modulated by a complicated signaling network. miRNA, as a novel regulator in gene expression, plays an essential role in this interplay [371]. To study the functional role of miRNAs in CVB3 replication and cytopathogenicity, I selected a heart-abundant miRNA, miR-126, to study its regulatory role in the signaling network governing the replication of this cardiotropic virus. I found that miR-126 expression was regulated in a dynamic manner coinciding with the activity of transcription factor ETS. During CVB3 infection, miR-126 was upregulated following ETS activation. By targeting SPRED1, miR-126 enhanced ERK1/2 activation that supported CVB3 replication. In addition, I identified two novel targets of miR-126, LRP6 and WRCH1, in the Wnt/?-catenin signal pathway. Suppression of these two target genes by miR-126 sensitized the cells to virus-induced cell death and promoted viral progeny release in the late stages of infection.  Upon further analysis, I found that CVB3 upregulated miR-126 in a time and viral titer dependent manner. During the early phase of infection (3 hpi), miR-126 was transiently decreased, which could be explained by the overall inhibition of host RNA synthesis by CVB3 infection [372]. In later stages of infection, miR-126 was highly induced. I speculated that this was regulated by transcription factors ETS-1/2. A recent study showed that silencing of ETS-1/2 suppressed the expression of miR-126 and identified the binding sites of ETS-1/2 on miR-126 promoter region [210]. It is, however, not clear whether this regulation is mainly dependent on the total level of ETS proteins or their activity, which is regulated by their phosphorylation mediated by ERK1/2 [366]. Our results showed that CVB3 infection induced gradual downregulation of total ETS-1 and ETS-2 proteins, which may be due to the shutdown of host protein translation [320]. However, the phosphorylation of ETS-1/2 increased at the late stages of infection, coinciding with the activation of the ERK1/2 signaling and the induction of miR-126 at the same phase. This observation was confirmed in three different cell types and further solidified by experiment using UV-inactivated CVB3. It has been reported that UV-inactivated CVB3 cannot induce ERK1/2 signaling [145]. Our experiment showed that when infected with UV-irradiated CVB3, miR-126 was not induced. Importantly, ERK1/2 inhibitor U0126 suppressed the phosphorylation of ETS and 74 upregulation of miR-126 during CVB3 infection, further supporting the previous data. These findings reveal a novel mechanism of miR-126 regulation mediated by ERK1/2-ETS cascade. On the other hand, the upregulated miR-126 targets SPRED1 and in turn enhances ERK1/2 activation and CVB3 replication. ERK1/2 activation is essential to CVB3 replication [145], but it is not clear whether its upstream negative regulator, SPRED1 [364], is involved in regulating viral replication. Here, I showed that CVB3 infection downregulates SPRED1, correlating well with the induction of miR-126.  The suppression of SPRED1 by miR-126 or siRNA is beneficial to ERK1/2 activation and CVB3 replication. This notion was further supported by using the ERK1/2 inhibitor U0126, which blocked the effect of miR-126 or SPRED1 siRNA on VP-1 upregulation. The above findings suggest a positive feedback loop of ERK1/2?ETS?miR-126?SPRED1?ERK1/2 that is hijacked by CVB3 for the sake of its own replication. Previous report showed that Marek?s disease virus dowregulated miR-126 in T-lymphoma cells [373], suggesting that the alteration of miR-126 during viral infection depends on the virus species. Our studies provide new evidence to support the notion that the virus hijacks host miRNA expression. I observed that overexpression of SPRED1 did not fully block the effect of miR-126 on viral progeny release, indicating other signals may be involved in this regulation. In search for other signals, I found that miR-126 enhanced CVB3-induced cell death through GSK-3?/?-catenin cascade by targeting LRP6 and WRCH1. Our colleagues previously found that virus-induced CPE, cell death, and subsequent viral progeny release are partially mediated by ?-catenin degradation via GSK-3? [156]. However, some major questions were not clear. First, GSK-3? activation peaked at 1 hpi but declined to normal level afterwards; while the degradation of ?-catenin starts long after 1 hpi (from 5 hpi) [156]. Why is there such a delay and how does this transient activation of GSK-3? continue to support the degradation of ?-catenin until the end stage of infection? Second, CVB3 infection induces dramatic phosphorylation of GSK-3? at later stage of infection [166] and phosphorylation of GSK-3? inhibits its activity. Then why does the GSK-3? activity remain quite stable at the late stage of infection as evidenced by the activity assay [156]? What are the factors involved in to maintain GSK-3? activity? Here, I showed that miR-126 mimic enhanced ?-catenin degradation while miR-126 inhibitor suppressed this process.  These actions are at least partially through regulation of LRP6 and WRCH1 expression. The effect of WRCH1 on ?-catenin 75 activity has not been studied previously, but the homolog of WRCH1, cdc42, was shown to stabilize ?-catenin through inhibiting GSK-3? activity via phosphorylation [365]. This implies that WRCH1 may have comparable functions as its homolog in ?-catenin signaling. I did not find significant effect of LRP6 on GSK-3? phosphorylation, which is consistent with previous findings showing that LRP6 directly inhibits ?-catenin degradation by preventing phosphorylation of ?-catenin by GSK-3? [374]. Our findings suggest that increases in miR-126 during the late stage of viral infection contribute to the downregulation of LRP6 and WRCH1. The decline of WRCH1 may counteract the phosphorylation of GSK-3? to extend its activity, while the suppression of LRP6 makes ?-catenin more sensitive to GSK-3? mediated degradation. Thus, both target gene suppressions by miR-126 play an important role in the continuation of GSK-3?-mediated ?-catenin degradation and the further facilitation of CVB3-induced cell death and progeny release. In summary, I identified miR-126 as a novel regulator of CVB3 replication. This miRNA has three specific targets, SPRED1, LRP6 and WRCH1, distributed in the ERK1/2 and Wnt/?-catenin signal pathways.  Through suppression of these three genes during viral infection, miR-126 can coordinate the collaboration of these two signal pathways, which maintains a dynamic balance of viral particle formation and release to initiate new infections. This regulatory process of host-virus interactions is beneficial to the CVB3 life cycle. To our knowledge, this is the first report on the miRNA-mediated cross talk of different signal pathways during picornaviral infection. These findings enrich our understanding of the functional roles of miRNAs in viral replication (Fig. 20) and provide novel insights into the development of therapeutic strategies.   76   Figure 20. A proposed model of regulatory roles of miR-126 in CVB3 infection. CVB3 infection induces ERK1/2 phosphorylation, which triggers the activation of ETS transcription factors, leading to miR-126 upregulation. On one hand, miR-126 targets SPRED1 and initiates a positive feedback loop of ERK1/2 signaling pathway to accelerate the viral replication (orange arrows). On the other hand, miR-126 suppresses LRP6 and WRCH1 to inhibit Wnt/?-catenin cascade and promote virus-induced cell death, contributing to viral progeny release in the late stage of infection. Blue arrows indicate down-regulation and red arrows indicate up-regulation.  77 3.6. Limitation and solutions In this study, I used both miRNA mimics and miRNA inhibitors to validate the functions of miR-126 on CVB3 replication and cytopathogenesis. I also used siRNA to further confirm the involvement of downstream targets in CVB3 replication and virus-induced cell death. However, several supplemental experiments could be added to strengthen my observations. First, we observed that longer infection at 16 hpi with low viral titre at 0.05 MOI induced a higher level of miR-126 compared with 7 h infection at 10 MOI. This might be explained by the fact that high viral tire induced cell death too early to allow maximum production of miR-126. However, it is also possible that miR-126 is partially induced by virus-triggered host cytokines so that longer exposure to cytokines induces higher levels of miR-126.  In fact, multiple cytokines have been found to activate ERK signals [375]; thus activated ERK may activate the ETS-miR-126 cascade. Considering that those cytokines are released from the cells, one option to test this hypothesis is to use the supernatant from the infected cells to treat non-infected cells. The viruses in those supernatants should be removed by filteration or antibody neutralization before testing their functions in inducing microRNAs. This could be further confirmed by using cytokine receptor deficient cells which do not respond to those cytokines. Second, U0126 is an ERK1/2 inhibitor and thus restricts CVB3 replication. The inhibition of miR-126 by U0126 during CVB3 infection could be an indirect effect due to the inhibited CVB3 replication since U0126 does not diretly suppress ETS-1/2 phosphorylation. Application of ETS-1/2 phosphorylation inhibitors or ETS-1/2 mutants which can no longer be phosphorylated would be additional approaches to further validate the regulation of miR-126 by ETS-1/2. Third, in the 21-in treated cells, CVB3 infection still induced SPRED1 downregulation, this indicates that other mechanism may be involved in SPRED1 inhibition, for example transcipitional inhibition or disruption of cap-dependent protein translcation due to viral protease mediated cleavage of host transcriptional and translational machineries. Further evaluation on the SPRED1 mRNA using q-PCR and luciferase assay using vectors harboring SPRED1 5?UTR will deepen the understanding on the regulation of SPRED1 by CVB3 infection. Fourth, a rescue experiment using co-transfection of miR-126 and LRP6 or WRCH1 overexpression vector would further confirm the regulation of these signals in regulating CVB3-induced CPE. I could have also used Wnt luciferase reporter assay to show the inhibition of general Wnt signal 78 activity in the presence of miR-126. In addition, parts of the experiments were conducted using HeLa cells, which are human cervical cancer cells rather than cardiomyocytes. I could not use mice cardiomyocytes for validating the effect of LRP6 and WRCH1 since only human LRP6 and WRCH1 contains miR-126 targeting sites. A human cardiomyocyte cell line would be an ideal model for this validation. 3.7. Future directions In this chapter, I showed that miR-126 is regulated by ETS-1/2 phosphorylation during CVB3 infection. However, it is by no means a conclusive mechanism of miRNA induction by CVB3. As mentioned above, miRNAs expressions can be regulated by both transcriptional factors and epigenetic modifications of their promoters. It would be interesting to investigate more thoroughly the transcription activity and methylation status of miR-126 promoters. For example, a promoter bashing analysis by constructing different fragments of the miR-126 promoter linked with a reporter gene could be used to study which region is responsible for the transcriptional activity during CVB3 infection. The corresponding transcriptional factors can be predicted using bioinformatic tools and further validated by siRNAs or inhibitors. The methylation status could be easily evaluated by methylation assay to identify potential epigenetic modification. This could add another layer of regulation of miRNA expression by CVB3. The positive feedback loop between miR-126 and ERK1/2 is beneficial to CVB3 replication under the current experiment condition. However, as miR-126 also enhances virus-induced cell death, it would be reasonable to speculate that overall viral production might become limited by miR-126 during long-term infection due to massive cell death. It would be worthy to study how CVB3 controls the induction of miR-126 and why the increase of miR-126 only starts in the late infection stage. Also, the reason why early ERK1/2 activation at around 15 min post infection does not induce miR-126 still needs further elucidation. Wnt signaling is an essential pathway regulating multiple biological processes besides cell survival. It is also a fundamental pathway in heart function. The understanding of the roles of this pathway in CVB3 induced viral myocarditis is still very limited. My in vitro model here sheds some light 79 on the function of this pathway in inducing cell death, which is probably associated with the cardiomyocyte damage during CVB3 infection. It is however still unknown how miR-126-Wnt cascade is regulated in vivo, particularly in the late stage of viral myocarditis. Further investigation on the involvement of Wnt signaling in cardiac hypertrophy and remodeling may contribute to a deeper understanding of the role of miR-126 in regulating the pathogenesis of viral myocarditis.                   80 Chapter 4: miR-203 regulates CVB3 infection by targeting ZFP-148 4.1. Background 4.1.1. miR-203 structure and regulation of its expression miR-203 was originally identified as a miRNA enriched in keratinocytes promoting epithelia differentiation by targeting p63 to restrict the cell proliferation and inhibit the cell pluripotency  [376]. In human, it is located in a region of chromosome 14, which encodes about 12% of the known miRNA genes [377]. miR-203 is also expressed in lung, esophagus, cervix and trachea but almost undetectable in the normal heart, indicating that miR-203 is not essential for normal heart functions [378]. Besides its role in skin development, miR-203 is also dysregulated in a variety of cancers such as colon [379], liver [380], ovary [381], pancreas [382], and prostate cancer [383]. In epithelial cells, the expression of miR-203 is mainly controlled by the protein kinase C (PKC)/AP-1 pathway. The suppression of c-Jun and the activation of JunB promote the transcription of miR-203 [384]. Another upstream pathway of c-Jun is Hedgehog (HH), which also positively regulates miR-203 level in basal cell carcinoma [385]. One suppressor of miR-203 is the transcriptional factor Zinc finger E-box-binding homeobox 1 (ZEB1), which is involved in the activation of the epithelial to mesenchymal transition (EMT) process [386]. In addition, miR-203 expression is reduced in keratinocytes when the function of p53 is compromised [387]. Similar to miR-126, miR-203 is also regulated by epigenetic modification [388]. The hypermethylation of the miR-203 promoter region causes significant downregulation of its expression in metastatic breast cancer cells. 4.1.2. miR-203 in viral infection The role of miR-203 in viral infection has not been extensively studies. Cancer inducing viruses such as EBV [389] and HPV16 [390] have been shown to modulate the expression of miR-203, which may contribute to the tumor incidence. Sendai virus that mainly affects the respiratory system can cause the accumulation of miR-203 in host cells via the induction of IFN, which destabilizes the IFN-induced targets IFIT1/ISG56 [391]. This indicates that miR-203 is a negative feedback effector of the immune response. miR-203 is also upregulated by Rabies virus infection in the brain [392]. However, the detailed mechanism of miR-203 regulation or its exact function in viral infection still needs further investigations. 81 4.1.3. Zinc-finger protein-148 (ZFP-148) in cell cycle and apoptosis ZFP-148, also known as ZBP-89, is a Kruppel-type zinc-finger transcription factor recognizing the GC-rich region on the targeted gene promoter [393]. In human, it maps to chromosome 3q21 and is composed of 794 AA residues divided to 9 domains, each encoded by an individual exon and carrying distinct functions [394]. ZFP-148 is a bifunctional transcriptional factor that can be either an activator or a repressor for different targeted genes and it regulates cell growth, apoptosis and cancer [395]. It activates p53 and p21waf1 to induce cell cycle arrest [396, 397]. ZFP-148 overexpression results in the accumulation of p53 and in cell growth arrest at S phase through its interaction with the DNA-binding and carboxy-terminal domains of p53 [396, 398]. Mutation of p53 inhibits the functions of ZFP-148 in cell cycle arrest [399]. p21waf1 is a cyclin-dependent kinase (CDK) inhibitor controlling cell cycle progression by direct binding to cyclin/CDK complexes [400]. Both direct and indirect regulation of p21waf1 by ZFP-148 have been reported, and these can be either p53-dependent or independent [397, 401]. During the treatment of histone deacetylase inhibitors (HDACi), ZFP-148 forms a transcription factor complex with ataxia-telangiectasia mutated (ATM) kinase and p300, where ATM phosphorylates ZFP-148 at Ser202 to potentiate the expression of p21waf1 [402]. In addition to its role in cell cycle arrest, ZFP-148 also triggers apoptosis. ZFP-148 triggers p53-independent apoptosis characterized by caspase activation, PARP cleavage and Bcl-2 family (Mcl-1 and Bcl-xL) proteins repression accompanied by activation of all three MAP kinase subfamilies: JNK1/2, ERK1/2 and p38 MAP kinase [403]. Further investigation suggested that only JNK1/2 is required for this process as inhibition of JNK1/2 significantly reduces the ZFP-148-inudced cell death while ERK1/2 and p38 are not involved. ZFP-148 also maintains the constitutive expression of STAT1 contributing to the IFN?-mediated p53-independent apoptosis [404, 405]. Under some circumstances, ZFP-148 may also potentiate the p53-induced cell death [399]. 4.2. Rationale In Chapter 3, I showed that CVB3 infection in cultured cells induced upregulation of miR-126. However, the global changes of miRNA expression profiles in the in vivo CVB3 infection have not been well identified. Therefore, I performed microarray analyses of miRNA expression profiles in CVB3 infected A/J mouse hearts. I found that a number of miRNA expression was altered and that miR-203 was 82 one of the most upregulated candidates at early infection. Previous studies on miR-203 have been focused on its role in skin cells but little is known about miR-203 in cardiomyocytes or infectious disease.  It is entirely unknown how CVB3 infection regulates miR-203 expression or whether miR-203 affects CVB3 replication. Thud I further explored the regulatory mechanism of miRNA-203 expression and the involvement of miR-203 in CVB3 infection of the target cells.  4.3. Hypothesis and specific aims In this chapter, I aim to elucidate the regulatory role of miR-203 during CVB3 infection. I HYPOTHESIZE that CVB3 infection induces miR-203 upregulation and in turn promotes viral replication. The SPECIFIC AIMS for this chapter are the following: Aim 1. To investigate the influence of CVB3 infection on host miR-203 expression level Aim 2. To study the effect of the altered miR-203 expression on CVB3 replication Aim 3. To identify the signals regulated by miR-203 contributing to CVB3 replication 4.4. Results 4.4.1. CVB3 infection upregulates miR-203 in HL-1 cardiomyocytes and mouse heart  To identify miRNA candidates regulating CVB3-induced viral myocarditis, I performed microarray analysis of miRNA expression profiles in the hearts of CVB3 infected mice. Briefly, 4-week old A/J mice were inoculated with CVB3 or PBS control (sham). At 4 dpi and 7 dpi, mice hearts were harvested. Infiltration of leukocytes and cardiomyocyte necrosis were observed in CVB3 infected groups with 7 dpi samples showed more severe cardiac damage (Fig. 21a). VP-1 expression was detected as an indicator for successful infection. As shown in Fig. 21b, only CVB3 infected mice hearts exhibited VP-1 expression but not the sham controls which are not infected (Fig. 21b). Heart RNA was isolated and subjected to microarray analysis. miRNAs with more than 2-fold changes in their expression levels were selected as top miRNA candidates. This cut-off was set merely based on the sensitivity of microarray analysis in which 2-fold is a popular cut-off. As showed in the heat map in Fig. 21c, 16 miRNAs were upregulated and 2 were downregulated at 4 dpi in CVB3 infected samples compared with the control group while 15 miRNAs were increased and 8 were decreased at 7 dpi. I also conducted q-RT-PCR to 83 confirm the alteration of several miRNA candidates including miR-203, miR-222 and miR-574 (Fig. 22a).  Among those miRNAs, I found that miR-203 is an interesting one as it is conserved between human and mice but it is not a heart enriched miRNA and its role in cardiomyocytes has not been clearly revealed. I thus further confirmed the upregulation of miR-203 during CVB3 infection using HL-1 cardiomyocytes (Fig. 22b). The results showed that miR-203 is robustly induced both in vitro and in vivo during CVB3 infection.   84  Figure 21. CVB3 infection alters cardiac miRNA expression profiles. (a) H&E staining of sham or CVB3 infected mice heart. (b) VP-1 detection of CVB3 infected mice heart using WB. (c) Partial heat map of differentially expressed miRNAs (p< 0.05, fold change > 2) in CVB3 infected A/J mice heart compared with sham infected controls.  The color refers to the Log2 value of miRNA expression levels. Red color indicates upregulation and green color stands for downregulation. 85  Figure 22. CVB3 infection upregulates miR-203. (a) Comparisons between microarray and q-RT-PCR evaluations of altered miRNAs in CVB3 infected mice hearts. p < 0.05 (?*?), p < 0.01 (?**?), n=3 for microarray and n=5 for q-PCR. (b) miR-203 is induced by CVB3 infection in HL-1 cells. HL-1 cells were infected as indicated. Cellular miR-203 levels were detected by q-RT-PCR. p< 0.01, n=4. 86 4.4.2. Upregulation of miR-203 is through the activation of PKC/AP-1 cascade  To explore the signaling pathway leading to the upregulation of miR-203 in CVB3-infected heart, I first examined the activation of PKC and its downstream transcription factor AP-1 family proteins c-Jun and JunB since this cascade activation is essential for miR-203 upregulation in human keratinocytes during differentiation[384].  Our WB analyses using cell lysates from CVB3-infected murine heart tissues, HeLa cells and HL-1 cardiomyocytes demonstrated that CVB3 infection induced upregulation of p-PKC and further upregulated JunB and downregulated p-cJun compared to the sham-infected controls (Fig. 23a). These data were further solidified by the experiments in which addition of PKC inhibitor GF109203X significantly suppressed expression of both AP-1 (JunB, p-cJun) and CVB3 protein VP-1 in a dose-dependent manner (Fig. 23b).  As JunB and cJun are positive and negative regulators of miR-203 expression respectively in human kerantinocytes, [384] our data suggest that miR-203 upregulation in CVB3-infected mouse heart depends on activation of the PKC/AP-1 cascade. To support this notion, I further measured the miRNA-203 expression by Q-RT-PCR and showed that inhibition of PKC with a specific inhibitor reduced AP-1-regulated expression of miR-203 in HeLa cell (Fig. 23c) and HL-1 cardiomyocytes  (Fig. 23d). To further confirm the involvement of JunB in the upregulation of miR-203 during CVB3 infection, I used specific siRNA to knockdown JunB and found that this siRNA markedly reduced JunB and CVB3 VP-1 expression (Fig. 24 a, b and d). Interestingly, p-cJun was found to be upregulated (Fig. 24 a and c). I also checked the effect of JunB-siRNA on miR-203 expression levels and found a marked reduction (at least 3 folds) (Fig. 24e). These data confirmed that CVB3 infection induces miR-203 expression through the PKC/AP-1 cascade.   87  Figure 23. CVB3 induces upregulation of miR-203 through activation of PKC and differential regulation of downstream AP-1 family transcription factors JunB and c-Jun. (a) Cell lysates from CVB3-infected or sham-infected mouse hearts, HL-1 cardiomyocytes and HeLa cells were used to conduct WB analysis.  (b) Suppression of PKC with specific inhibitor GF109203X blocked the PKC/AP-1activation. Both HeLa cells and HL-1 cells were treated with either the PKC inhibitor (PKCI) or DMSO and then infected with CVB3.  AP-1 (JunB and c-Jun) proteins were detected by WB analysis.  miR-203 expression in CVB3-infected HeLa cells (c) and HL-1 cells (d) was measured by Q-RT-PCR. p <0.05, n=3. 88   Figure 24. Silencing of JunB with siRNAs markedly reduces miR-203 expression. (a) HeLa cells were transfected with JunB siRNAs or control siRNAs and then infected with CVB3. Cell lysates were used for WB analysis of JunB, p-cJun and CVB3VP-1. ?-actin was used as a loading control. (b-d) Densitometry analyses of expression levels of JunB, p-cJun, and VP-1.  p <0.05, n=3. (e) Q-RT-PCR to detect downregulation of miR-203 in cells transfected with JunB siRNA and then infected with CVB3 as described in (a). 89 4.4.3. ZFP-148 is a novel target gene of miR-203  To investigate the signal pathways contributed to the miR-203 effect on CVB3 replication, I sought to identify its target genes. Bioinformatic analyses using TargetScan ( program showed that ZFP-148 is one of the top predicted targets, which also include p63, suppressor of cytokine signalling-3 (SOCS3) and V-abl Abelson murine leukemia viral oncogene homolog-1 (ABL-1). As p63, SOCS3 and ABL-1 have already been reported as targets of miRNA-203, [406]  I selected ZFP-148 for further study. Sequence analysis revealed that ZFP-148 has three target sites within its 3?UTR, located at nts 1263-1269, 4180-4186, and 4533-4539 (named site-1, -2 and -3, respectively) (Fig. 25a). Site-1 is closed to the 5? end region of the 3?UTR while the sites-2 and site-3 are close each other and located near the 3? end region. Sequence alignment shows that these three sites are highly conserved among human, mice, chimpanzee and monkey. Fig. 25b shows the hybridization of the miR-203 to site-3, one representative target of the three, in the ZFP-148 3?UTR. To confirm the targeting of ZFP-148 by miR-203 experimentally, I detected ZFP-148 expression by WB analysis after transfection of HeLa cells with miR-203 mimics.  Fig. 25c shows marked down-regulation of ZFP-148 expression in the miR-203 mimics transfected cells compared to the control. Meanwhile, I confirmed significant downregulation of ZFP-148 in mouse heart at day 4 pi (Fig. 25d), correlating to the upregulation of miR-203 (Fig. 22). To validate ZFP-148 as a true target of miR-203, a luciferase reporter plasmid, carrying a 3?UTR fragment of  ZFP-148 (nts 7061-7504) containing the downstream two sites (site-2 and site-3) of miR-203 (Fig. 25a), was constructed. Two mutant constructs, ZFP-148-3?UTR-Mut-1 and ZFP-148-3?UTR-Mut-2, were also generated by site-directed mutagenesis of the miR-203 seed match sequence (Fig. 25e). The luciferase reporter constructs were co-transfected with miR-203 or miR-CL mimics into HeLa cells. The luciferase assay data revealed that HeLa cells co-transfected with Wt ZFP-148-3?UTR (containing two binding sites) and miR-203 mimics (Wt+miR-203) showed an up to 70% reduction in the relative luciferase activity compared to the control cells co-transfected with  ZFP-148-3?UTR and miR-CL mimics (Wt+miR-CL) (Fig. 25f). In contrast, when one site or both sites together were mutated, miR-203 showed no significant targeting effect on reporter gene expression, indicating that ZFP-148 is a novel and specific target gene of miR-203. 90        91 Figure 25. ZFP-148 is a novel target of miR-203. (a) Physical map of three binding sites of miR-203 within the 3?UTR of ZFP-148 and the sequence alignment of these binding sites within mouse, human, chimpanzee, and Rhesus monkey. The numbers above the sequences indicate the nucleotide positions of these sites. The seed match sequences are highlighted and boxed. (b) Partial base pairing of miR-203 with binding site-3 in the 3?UTR of ZFP-148.  (c) miR-203 expression suppressed ZFP-148 translation. Total proteins were prepared from HeLa cells transfected with either miR-203 or control (miR-CL) mimics and then infected with CVB3 or sham-infected with PBS. ZFP-148 expression was detected using a specific antibody. GAPDH expression was a loading control. (d) ZFP-148 expression was inhibited in CVB3-infected mouse heart at day 4 pi.  ZFP-148 was detected by WB analysis. (e) Diagram of luciferase reporter plasmids.  A fragment of the 3?UTR of ZFP-148 carrying miR-203 binding site-2 and -3 was inserted downstream of the Renilla luciferase gene. The ZFP-148-3?UTR mutant-1 (Mut-1) construct was designed to have several point mutations, which are underlined, in both binding sites; while the Mut-2 was constructed by point mutations at only binding site-3. (f) Luciferase reporter assay. HeLa cells were transfected with different combinations of the ZFP-148-3?UTR (Wt) or mutant (Mut) plasmid or vector only (pmir-GLO) and miR-203 as indicated. Luciferase reporter assay was conducted and the relative luciferase activity was calculated after normalizing the data against that of HeLa cells cotransfected with Wt + miR-CL, which was set as 1.0. Data are means ?SD. p <0.05, n=3.              92 4.4.4. miR-203 promotes CVB3 replication  To study the positive effect of miR-203 upregulation on CVB3 replication, I transfected HeLa cells with either miR-203 or miR-CL mimics for 48 h and then infected with CVB3 at 10 MOI or sham-infected with PBS for 6 h. Q-RT-PCR showed that miR-203 mimics transfected cells had an approximate 15-log2 increase in miR-203 expression compared to the control cells (Fig. 26a). The enhanced CVB3 replication efficiency was evaluated by Q-RT-PCR to detect viral RNA transcription (Fig. 26b) and WB to detect CVB3 VP-1 protein production (Fig. 26c), respectively. This promotion of CVB3 replication by miR-203 was further confirmed by viral plaque assay, showing a significant increase in viral particle release in miR-203 expressing cells compared to the control (Fig. 26d). Meanwhile, inhibition of the endogenous levels of miR-203 in both HeLa and HL-1 cells using specific inhibitors resulted in marked reduction of miR-203 expression (Fig. 26 e and f) respectively and caused significant downregulation of CVB3-VP-1 expression in both cell lines (Fig. 26 g and h).  93         94  Figure 26. miR-203 expression promotes CVB3 replication in HeLa cells. (a) Q-RT-PCR to detect mature miR-203 levels in HeLa cells transfected with miR-203 or miR-CL mimics. U6 was used as an endogenous control to normalize the results. (b) Q-RT-PCR to measure CVB3 RNA expression. HeLa cells were transfected as described above and then infected with CVB3. RNAs extracted from the cell culture supernatants were used to measure the CVB3 RNA using primers targeting viral 2A gene. The data of the control was set as 1.0.  (c) WB to detect CVB3 VP-1 expression. HeLa cells were transfected and then infected with CVB3 as described above. The protein lysates were collected for WB analysis. ?-actin served as a loading control. (d) Viral plaque assay. HeLa cell culture supernatants described in (b) were employed to determine CVB3 particle formation by plaque assay on HeLa cell monolayers. (e and f) Q-RT-PCR to detect miRNA-203 expression levels after treatment of HeLa cells (e) and HL-1 cells (f) with miR-203 inhibitors for 48 h and then infection with 10 MOI of CVB3 for 5 and 8 h, respectively. U6 RNA was used to normalize our data as an endogenous control. (g and h) WB to detect VP-1 in HeLa (g) and HL-1 (h) cells transfected with miR-203 inhibitors or control inhibitors and then infected with CVB3. p <0.05 n=3.                95 4.4.5. Silencing of ZFP-148 with specific siRNAs benefits CVB3 replication  To further verify the effect of ZFP-148 downregulation on CVB3 replication, I transfected HeLa cells with specific siRNAs to silence the ZFP-148 expression and then infected the cells with CVB3 for 6 h. The suppression of the ZFP-148 expression and the effect on CVB3 replication were detected by WB analysis and viral plaque assay, respectively. Fig. 27a demonstrated that ZFP-148 expression was dramatically suppressed and CVB3 VP-1 production was significantly increased in cells transfected with ZFP-148 siRNAs compared to the control transfected with scrambled siRNAs. These data were further confirmed by plaque assay, showing that silencing of the ZFP-148 resulted in a significant increase of CVB3 progeny release (Fig. 27b).     Figure 27. Silencing of ZFP-148 with specific siRNA promotes CVB3 replication. (a) HeLa cells were transfected with ZFP-148-specific siRNA or scrambled siRNA and then infected with CVB3 for 6 h or sham-infected with PBS. ZFP-148 and CVB3 VP-1 expression was detected by WB analysis. (b) Viral particle releases. Cell culture supernatants collected from HeLa cell culture described in (a) above were used for plaque assay to detect CVB3 particle release. p <0.05, n=3.    96 4.4.6. Transfection of miR-203 mimics promotes cell survival  In further elucidating the mechanism by which miR-203 promotes CVB3 replication, I speculated that miR-203 expression might promote host cell growth and thus provided favorable conditions for CVB3 replication. To test this hypothesis, I first examined the morphological changes in miR-203 expressing HeLa cells by live cell confocal imaging. Fig. 28a shows that miR-203 expression (panel B and D) promoted cell proliferation at both 24 and 48 h post transfection compared to the control cells transfected with miR-CL (panel A and C).  This miR-203-promoted cell growth was further verified by cell viability assay at 24 and 48 h post transfection. Fig. 28b demonstrates that cells transfected with miR-203 mimics had a 20 % increase in cell survival compared to the control samples at both 24 and 48 h post transfection. This is likely because miR-203 (but not miR-CL) expression can counteract the unfavorable effects created by transfection reagents and resume the normal environment for cell growth. Further analysis by WB revealed the upregulation of the survival markers (Bcl-2 and Bcl-xL) as well as the downregulation of the apoptotic marker (Bcl-xS) in miR-203 mimics transfected  HeLa cells (Fig. 28c) and HL-1 cardiomyocytes (Fig. 28d) that were either sham- or CVB3-infected for 6 h. In addition, I also detected the activation of caspase-3 and demonstrated that miR-203 expression suppressed the cleavage of pro-caspase-3 in HeLa cells (Fig. 28e)) and HL-1 cells (Fig. 28f). Here, it is worth mentioning that the image of cleavage product of caspase-3 is weak. This is probably due to UPS-mediated protein degradation caused by viral infection or other cellular stresses [169].  97  Figure 28. miR-203 expression enhances HeLa cell growth. (a) Morphological changes. HeLa cells were transfected as described above and cell morphology was analyzed by live cell confocal imaging at 24 and 48 h post transfection. (b) MTS cell viability assay. HeLa cells were transfected as described above and MTS assay was conducted at 24 and 48 h post-transfection. The miR-CL transfected group (24 h) was defined as 100% survival (control). p <0.05, n=3. (c and d) WB analyses of Bcl-2 family proteins in miR-203 or miR-CL mimics transfected HeLa cells (c) and HL-1 cardiomyocytes (d) respectively at 6 hpi. (e and f) WB analyses of pro-caspase-3 cleavage in miR-203 or miR-CL mimics transfected HeLa cells and HL-1 cells respectively at 6 hpi. 98 4.4.7. Suppression of ZFP-148 by miR-203 leads to the differential expression of cell cycle regulators  The data presented above suggest that miR-203 enhances CVB3 replication likely through promoting host cell viability. Thus, I next investigated the signaling pathways leading to the enhanced cell survival/growth in the conditions of suppression of ZFP-148 expression by miR-203.  I detected the expression levels of the downstream genes of ZFP-148 involved in cell cycle regulation, which include cyclin-dependent kinase inhibitors (p21Waf1 and, p27Kip1), tumor suppressors (retinoblastoma (Rb) and p53) and cell cycle progression genes (cyclin E and cyclin D1), [395, 407]  in miR-203 mimics transfected HeLa cells infected with CVB3 or sham-infected with PBS.  Fig. 29a demonstrated that these cell cycle arrest genes and tumor suppressor genes were markedly downregulated; while the cell cycle progression genes (cyclin E and cyclin D1) were significantly upregulated in the miR-203 expressing cells compared to the control. These data were further confirmed by experiments using HL-1 cardiomyocytes (Fig. 29b). It is worth noting that in CVB3-infected samples, the changes in expression levels of certain responsive genes such as p21, p53 and Rb were not dramatic compared to that in sham-infected cells.  This is probably due to the shut-down of host gene expression by CVB3 infection and thus masked the effect of miRNA-203.  The effect of ZFP-148 suppression by miR-203 on downstream gene expression was further verified in HeLa cells by silencing ZFP-148 with siRNA, which showed the downregulation of p53, p21Waf1 and p27Kip1 (Fig. 30a). Finally, I also demonstrated the downregulation of p53, p21Waf1 and p27Kip1 as well as the upregulation of DCM gene makers GATA4 and Mef2a in CVB3-infecetd mouse hearts used for microarray analysis of miRNA expression profiles (Fig. 30b). 99  Figure 29. miR-203 expression induces differential expression of downstream responsive genes of ZFP-148. HeLa cells (a) and HL-1 cell (b) were transfected and infected as indicated. WB analyses were conducted to detect the expression of cell cycle regulators or tumour suppressors using indicated antibodies.  Figure 30. ZFP-148 regulates p53, p21Waf1 and p27Kip1 in CVB3 infection. (a) HeLa cells were transfected with ZFP-148-specific siRNA or scrambled siRNA and then infected with CVB3 for 6 h or sham-infected with PBS. Expression of ZFP-148 responsive genes p53, p21Waf1 and p27Kip1 was detected by WB analysis. (b) CVB3 regulates ZFP-148 downstream signals. CVB3 infected mice hearts at 4 dpi were subjected to WB detection of indicated signals. 100 4.5. Discussion To identify the miRNA candidates regulating CVB3 infectivity and replication, I performed miRNA microarray analyses and identified a number of differentially expressed miRNAs in CVB3 infected heart of A/J mice, an established viral myocarditis mouse model. One of the significantly up-regulated candidate miRNAs was miR-203 and its expression level was increased ~2 fold compared to the sham-infected control mice. In cultured cardiomyocytes, CVB3 infection induced more than 10-fold upregulation in miR-203 level. These data suggest the involvement of miR-203 in CVB3 infection. In particular, miR-203 is not enriched in cardiomyocytes, making it an interesting candidate for further investigation. To explore the signalling pathway leading to miR-203 upregulation, I focused on the analyses of the PKC/AP-1 cascade, as AP-1, a transcription factor consisting of homodimers or heterodimers of the Jun and Fos families of nuclear proteins, [408] is known to be involved in cell differentiation, proliferation and apoptosis [409]. Although it has been reported that miR-203 up-regulation is modulated through the PKC/AP-1 activation during keratinocyte differentiation, [384] there is no report on the transcriptional regulation of miR-203 in a virus-infected cardiomyocyte model system. Our data demonstrated that CVB3 infection of mouse heart or HL-1 cardiomyocytes activated PKC and further upregulated JunB, a positive regulator of miR-203 and meanwhile down-regulated c-Jun, a negative regulator of miR-203 [384].  These data were further solidified by using siRNAs targeting JunB, which suppressed JunB, upregulated p-cJun and subsequently downregulated miR-203 expression.  These data suggest that miR-203 upregulation in CVB3-infected heart is through the activation of the PKC/AP-1 cascade. miR-203 has been previously described as one of the skin abundant miRNAs and promotes differentiation by repressing 'stemness' [376]. It was also found to be over-expressed in pancreatic adenocarcinoma and rheumatoid arthritis [410]. To elucidate the biological function of miR-203 upregulation during CVB3 infection, I conducted bioinformatic prediction and found a number of target candidates for miR-203, which included ZFP-148 and several known targets, such as p63, SOCS3, ABL-1, etc [376, 384].  ZFP-148 was chosen as a candidate for further study not only because it is an unknown new target of miR-203 but also for the following reasons: i) ZFP-148 is a transcription factor that 101 regulates the expression of many cell cycle regulatory genes, such as p21WAF1 and p27KIP1 as well as the genes for apoptosis induction pathways [411, 412]; ii) ZFPs act as antiviral agents for many viruses and inhibit viral replication through different mechanisms inducing inhibition of the viral RNA synthesis and induction of host cell apoptosis [413, 414]; iii) ZFP-148 was reported to be involved in the pathogenesis of many diseases, such as colon cancer development, neuroectodermal tumours, and myocardial infarction [415, 416]; and iv) bioinformatic predictions showed that ZFP-148 has three miR-203 target sites (with high scores) and two of these sites are close to each other and located near the 3? end region of the 3?UTR (nts 4180-4186 and 4533-4539) [417]. This structural organization supports the current knowledge that one given miRNA usually has more than one binding site within the 3?UTR of the target gene and presents in a cluster manner [418]. Both WB data and luciferase analysis of the ZFP-148 3? UTR demonstrated that ZFP-148 is a true target of miR-203. To study the effect of suppression of ZFP-148 by miR-203 on cellular signal networks associating with CVB3 replication, I first demonstrated that transfection of miR-203 mimics promoted cell growth and enhanced CVB3 replication, which is supported by the increased cell viability and decreased activation of caspase-3. Similar results were obtained by transfection of cells with siRNAs targeting ZFP-148, showing that upon suppression of ZFP-148, CVB3 replication was enhanced. These data provide evidence to support the fact that miR-203 benefits CVB3 replication by targeting ZFP-148, which is involved in the regulation of cells growth [395, 419, 420]. To further elucidate the mechanism by which miR-203 promotes CVB3 replication by targeting ZFP-148, I performed experiments to characterize the expression of downstream responsive genes of ZFP-148 in the signal transduction pathway leading to cell survival and growth.  ZFP-148 is known as a potent repressor of the Bcl-xL, one of the pro-survival proteins in the BcL-2 family [403].  I found that Bcl-xL was up-regulated while Bcl-xS (a proapoptotic marker in the BcL-2 family) was down-regulated in miR-203 mimics transfected HeLa and HL-1 cells. ZFP-148 also promotes a number of cell cycle repressors, such as p53, p21 Waf1 and p27 Kip1, through binding to the GC rich region of its promoter [396, 397]. Inhibition of ZFP-148 by miR-203 contributes to the progression of cell cycle by suppressing these cell cycle regulators, which is evidenced by upregulation of cell cycle progression genes (cyclin D-1 and cyclin E) and the downregulation of the 102 tumour suppressors, p53 and Rb, in miRNA-203 expressing HeLa cells and HL-1 cells. This seems contradictory to the previous findings that CVB3 infection induces cell cycle arrest and cells arrested at G1/S phase promotes CVB3 replication [164, 165]. However, overexpression of p53 actually inhibits CVB3 replication [421], indicating that the cell cycle repressors are not simply beneficial for CVB3. In our findings, the inhibition of these cell cycle repressors by miR-203/ZFP-148 cascade may support CVB3 replication though further investigation is needed to determine whether this is a direct effect from cell cycle progression. Previous studies also reported that p21Waf1 was involved in the inhibition of cardiac hypertrophy and DCM occurrence through inhibiting ROCK kinases [422]. Our data demonstrated the downregulation of p21Waf1 in the miR-203 mimics transfected cells compared to the control group. This downregulation of p21Waf1 may contribute to the CVB3-induced DCM. This speculation was further supported by the downregulation of p21Waf1 as well as the upregulation of hypertrophic markers, Mef2a and GATA4, in CVB3-infected mouse hearts at 4 dpi even though the remodelling of the heart is not obvious at this early time point (data not shown). Based on all these data, I proposed a signal transduction model whereby CVB3-induced up-regulation of miR-203 expression inhibits ZFP-148 translation, which results in differential regulation of downstream pro-survival and pro-apoptotic genes, leading to enhanced cell growth and creation of an optimal survival environment to support CVB3 infection and replication (Fig. 31). This signal pathway produces a positive feedback loop at the early stage of CVB3 infection to continue the promotion of CVB3 replication.  However, at late stage of infection, when viruses reach a high titre, they will induce cell apoptosis and damage the cardiomyocytes, which is likely the underlying mechanism of viral pathogenesis. It is interesting to compare miR-126 and miR-203 in CVB3 replication. As I mentioned in chapter 3, miR-126 promotes ERK signaling and thus enhances viral replication. This miRNA also potentiates GSK-3? to trigger ?-catenin degradation and cell death, resulting in more viral progeny release. In this chapter, miR-203, on the other hand, shows pro-survival effect and also enhances viral replication. This seems contradictory but they are actually two different mechanisms. miR-126 affects the ERK signal pathway which supports CVB3 replication. The exact role of ERK in CVB3 replication is still not clear 103 but ERK is indicated to coordinate apoptosis and necrosis during CVB3 infection [423]. Prevetion of early host cell death by ERK will benefit viral replication. miR-126 also promotes ?-catenin degradation and cell death, this seems a total opposite effect to ERK activation. However, it is important to notice that miR-126 only enhances the CVB3-induced ?-catenin degradation and cell death. Without viral infection, miR-126 has no effect on cell apoptosis or cell survival. This indicates that miR-126 does not trigger the cell death process by itself. It is only a facilitator for viral progeny release. For miR-203, we have not identified the ealiest time point of induction during CVB3 infection. If miR-203 is induced at early stage of infection, it is likely to modulate cell survival and growth to support viral replication. If miR-203 is induced at late time points after 5-6 hpi, there is probably not enough time for this miRNA to quickly alter the cell cylcle or growth to enhance viral replication. However, another possibility is that miR-203 is induced by cytokines in the non-infected cells or somehow can be transported from the infected cells to the non-infected cells. This would prime the uninfected cells to be amenable for future infection by the virus. Further investigation on these possible mechanisms will be very important to elucidate the exact role of miR-203 in CVB3 replication. In summary, our data demonstrated that CVB3 infection caused up-regulation of miR-203 expression. miR-203 expression down-regulated ZFP-148 mRNA translation by specifically targeting its 3?UTR, which resulted in differential expression of its downstream target genes, such as cell cycle regulators, tumour suppressors and Bcl-2 family proteins, which in turn promotes cell survival to foster CVB3 replication. To our knowledge, this is the first report on ZFP-148 as a novel target of miR-203 as well as the connection between the miR-203 targeting of ZFP-148 and the pathogenesis of CVB3-induced myocarditis. Therefore, our finding may provide potential strategy in developing anti-CVB3 interventions.   104  Figure 31. A putative model of miR-203 action leading to enhanced CVB3 replication. CVB3 infection induces upregulation of miR-203 via the PKC-AP-1 signalling cascade, which in turn suppresses its target gene ZFP-148 expression. The suppression of ZFP-148 translation results in downregulation of pro-apoptotic/cell cycle arrest genes and upregulation of prosurvival/cell growth genes, leading to cell survival/growth, which benefits CVB3 replication. Persistent infection of CVB3 triggers a positive feedback loop for viral infection and replication, which subsequently causes target cell injury and disease. The thin arrows indicate up- or down-regulation of gene expression. 105 4.6. Limitation and solutions In this study, both miRNA mimics and miRNA inhibitors were used to confirm the effect of miR-203 on CVB3 replication. I also used siRNAs to knock down ZFP-148 to confirm it as a downstream target of miR-203 involved in CVB3 replication and cell cycle regulation. However, several supplemental experiments could be added to strengthen these findings. First, the PKC inhibitor and JunB siRNA can cause reduction in viral replication and thus may inhibit the miR-203 induction indirectly. Application of  constructs containing the wt or mutant miR-203 promoter region for  JunB binding will be an ideal experiment to validate the regulation of miR-203 by this signal pathway during CVB3 infection. Second, overexpression of ZFP-148 in the presence of miR-203 mimics to inhibit the effect of miR-203 on CVB3 replication would further confirm whether miR-203 promotes CVB3 replication through targeting ZFP-148. Also, I only tested two of the three targeting sites in the ZFP-148 3? UTR. A more intensive investigation could be added to identify the differential targeting preference using more constructs containing individual mutations or mutation combinations. In addition, the cell growth induced by miR-203 can be further evaluated using flow cytometry to quantify the cells at different proliferation stages. 4.7. Future directions In this chapter, I showed that miR-203 induced by PKC/AP-1 cascade during CVB3 infection exhibits a positive feedback on CVB3 replication by targeting ZFP-148 to promote cell growth and survival. Further investigations would reveal more details for this study. First of all, the mechanism of miR-203 induction during CVB3 infection is not conclusive yet. Other transcriptional factors may be identified using promoter bashing methods. Also, similar to miR-126, miR-203 expression can be modified by epigenetic changes. It would be an interesting topic to fully screen the methylation status of different miRNA promoters during CVB3 infection, which may open a new area to study the influence on host epigenetics by CVB3 infection. In addition, I found that miR-203 inhibitor could suppress the replication of CVB3. As miR-203 is normally low in the heart and may not carry essential function for the cardiomyocytes, it could be a penitential therapeutic strategy to treat CVB3 infection by suppressing miR-203 in the infected organs. This would require further tests using in vivo mouse infection models to verify 106 the effectiveness of miR-203 inhibitors in reducing viral load in the heart. Possible side effects should also be identified before further drug development or clinical trial.  Furthermore, the role of miR-203 in cardiomyocyte injury during infection is still not very clear. Though I showed that miR-203 promotes cell growth and survival during early viral infection, more investigations are still needed to identify more signal pathways involved in cardiomyocytes functions. Particularly, cardiomyocytes are usually terminally differentiated and not dividing. Therefore, miR-203 may not regulate their proliferation but instead promotes cell hypertrophy. I showed in this chapter that CVB3 infection induces upregulation of some hypertrophy related genes such as Mef2a and GATA4 in the heart. It would be interesting to explore further and determine whether miR-203 can promote or inhibit the hypertrophy signals during CVB3 infection. In addition, miR-203 has been found to target p63. Recent studies showed that p63 is also important for cardiac development during embryonic stages [424]. Cardiac repair after heart hypertrophy or failure requires cardiac stem cell differentiation into mature cardiomyocytes [425]. When miR-203 is induced, it is possible that p63 will be repressed, which may impair the differentiation of cardiac stems and delay the regeneration process. These speculations need experimental evidence and would be very interesting topic.             107 Chapter 5: miR-21 disrupts cell-cell interactions of cardiomyocytes during Coxsackievirus infection 5.1. Background 5.1.1. miR-21 structure and regulation of its expression miR-21 is located at chromosome 17q23.2 near the 3? UTR of a coding gene, vacuole membrane protein-1 (VMP1) [426]. The conventional miR-21 transcript initiates from the intron 11 of VMP1 while a new isoform of miR-21 transcript, VMP1-miR-21, initiating from the coding region of VMP1 has been characterized recently [426]. The regulation of miR-21 expression is a complicated process including both transcriptional and post-transcriptional modification. Several promoters have been reported for miR-21 transcription. The first one is located at 2.4-3.4kb upstream of the miR-21 hairpin with the presence of a ?CCAAT? box transcriptional control element instead of a classic ?TATA? box [427]. This promoter is regulated by STAT3 as evidenced by a reporter assay [205]. A second promoter known as miPPR-21 was discovered at 3.3-3.7 kb upstream of the miR-21 hairpin but it has a small overlap (~60 bp) with the previously mentioned one [208]. This region functions separately from the previous one and is mainly regulated by AP-1, Ets/PU.1 and STAT3. This regulation is sustained by miR-21-mediated inhibition of NFIB nuclear factor I/B (NFIB) which binds to miPPR-21 and suppresses the expression of miR-21. Additional promoter regions have also been identified from within the terminal intronic regions of VMP1 [205, 428]. Other miR-21 transcription regulators that have been reported include EGFR [429], estrogen receptor [430] and Gfi1 [206]. There is also a positive feedback regulation of miR-21 by the ERK1/2 signalling [431]. Besides transcription factors, epigenetic modification has also been found to regulate miR-21 expression [432]. The post-transcriptional regulation of miR-21 is mainly mediated by bone morphogenetic protein (BMP) and TGF?/smad pathways, which increase the Drosha-mediated pri-miRNA processing by recruiting pri-miR-21 to the processing complex containing the RNA helicase p68 [229]. The unique feature of this regulation is its specificity due to the ligand-mediated induction rather than a global enhancement of miRNA processing. More recently, PTEN was identified as a negative 108 regulator of miR-21 by blocking the interactions between Drosha and RNH1 (a RNA regulatory protein) which is required for proper processing of pri-miR-21 [433]. 5.1.2. miR-21 in cardiac and infectious diseases miR-21 level is high in the heart and dramatically altered during the development of cardiac diseases such as cardiac hypertrophy [434], fibrosis [435] and myocardial infarction [277], indicating its pivotal role in controlling the pathogenesis of cardiac diseases. miR-21 regulates both fibroblast and cardiomyocyte functions. It is reported that miR-21 promotes myocardial remodeling through enhancing ERK1/2-MAPK pathway that stimulates fibroblast survival and activation [272]. However, the role of miR-21 in cardiac pathology is controversial. One study showed that neither enhancement nor suppression of miR-21 affects the morphology, size or number of the cultured primary cardiomyocytes [272] while another report demonstrated that miR-21 induces cardiomyocyte outgrowth [434]. Cardioprotective roles of miR-21 have been suggested by several studies using the hypertrophy [273] or ischemia models [436] in which miR-21 attenuates hypertrophic growth and inhibits the cadiomyocyte death but genetic knock-out experiment and locked nucleic acid (LNA) inhibition studies suggest no essential role of miR-21 in pathological cardiac remodeling [437].  miR-21 is also actively involved in viral infections. EBV upregulates miR-21 and contributes to B-cell transformation [438]. HCV also induces miR-21 expression to evade the host immune system [439]. The expression and role of miR-21 in CVB3 infection remain controversial. Jin He and co-workers found that miR-21 was downregulated in CVB3 infected mice, resulting in the upregulation of PDCD4 and cardiomyocyte apoptosis [324]. However, two other reports showed that CVB3 infection upregulates miR-21 [321, 325]. The latter indicated that miR-21 promotes the differentiation of TH-17 for inflammation process while detailed mechanism has not been identified [325].  5.1.3. Intercalated disks (ICDs) in cardiac functions ICDs are essential cell-cell connections including desmosomes, fascia adherence junctions and gap junctions. They are critical structures for cardiac functions and associated with pathogenesis of heart diseases [440]. Desmosomes are responsible for anchoring cell membranes to the intermediate filament to maintain the proper cell-cell connections during physical stresses such as contraction of the heart [441]. 109 Adherence junctions link the cell membranes to cytoskeleton components like actin [442]. Gap junctions are composed of connexons channeling electronic and metabolic signals [443]. Disorganization of these structures will result in pathological heart conditions such as hypertrophy, DCM and arrhythmia [440, 444, 445] 5.2. Rationale miR-21 is an essential miRNA carrying ubiquitous roles in biological processes and regulating a variety of diseases including heart dysfunction [446]. In the previous chapter, I found that miR-21 is among the most upregulated miRNAs in CVB3 infected heart tissues, indicating its essential role in CVB3-induced cardiac dysfunction.  miR-21 has been found to enhance the formation of gap junction by targeting SPRY2 and triggering the redistribution of Connexin 43 and ?-catenin [434]. Gap junction is one of three major components of cardiac ICDs, which are pivotal structures maintaining the cardiac integrity and cell-cell communication among cardiomyocytes for normal heart function such as regular beating. The disruption of ICD results in severe cardiac dysfunction with similar symptoms to CVB3-induced heart failure including DCM and arrhythmia [440, 444, 445]. However, whether and how miR-21 would regulate desmosomes or adherence junctions in cardiomyocytes is entirely unknown. In this chapter, I explored how miR-21 regulates the expression and localization of ICD genes and elucidated the underlying mechanism. 5.3. Hypothesis and specific aims In this chapter, I aim to investigate the regulation of ICD gene expressions by miR-21 during CVB3 infection. I HYPOTHESIZE that CVB3 infection induces miR-21 upregulation, leading to disruption of ICDs in cardiomyocytes.  The SPECIFIC AIMS for this chapter are: Aim 1. To determine CVB3-induced upregulation of miR-21 Aim 2. To verify the specific targeting of miR-21 on genes encoding ICD proteins Aim 3. To delineate the molecular mechanism by which miR-21 expression induces disruption of ICDs 110 5.4. Results 5.4.1. miR-21 expression is upregulated by CVB3 infection both in vivo and in vitro As mentioned in Chapter 4, microarray data shows that miR-21 expression is upregulated at both 4 dpi and 7 dpi in CVB3-infected mice hearts (Fig. 21c). I further conducted q-RT-PCR to confirm such induction. The results showed a 2-3 fold increase in CVB3 infected mouse hearts compared with controls.  The induction of miR-21 in the CVB3 infected group is greater at 7 dpi than 4 dpi (Fig. 32a). An in vitro infection model was then used to validate the induction of miR-21 in cardiomyocytes by CVB3. HL-1 cells and immortalized human cardiomyocytes were infected with CVB3 and the cellular RNAs were used to detect miR-21 expression levels by q-RT-PCR. Compared to sham control, CVB3 infection triggered a 5-10 fold upregulation in the infected cells (Fig. 32b). These results demonstrated that CVB3 infection induces miR-21 upregulation.   Figure 32. CVB3 infection induces miR-21 expression. (a) Quantification of microarray analysis and q-RT-PCR detection of miR-21 expression during viral infection. 4-week old A/J mice were infected with CVB3 or sham infected with PBS. Cardiac total RNAs were isolated for microarray (as shown in Fig. 21c) or q-RT-PCR detection of miR-21 level. All data were normalized to U6 RNA and then further normalized to data of sham-infected control at 4 dpi. p < 0.05 (?*?), p < 0.01 (?**?), n=3 for microarray and n=5 for q-PCR. (b) miR-21 induction by CVB3 infection in vitro. HL-1 cells or immortalized human cardiomyocytes were infected by CVB3 as indicated. miR-21 levels were detected by q-RT-PCR. p < 0.05, n=4. 111 5.4.2. miR-21 suppresses desmin expression and disrupts desmosome organization during CVB3 infection To explore the effect of miR-21 upregulation on desmosome formation, I transfected HL-1 cells with 10 nM of miR-21 mimics or 50 nM of miR-21 inhibitor (21-in) and then detected the expression of ?-catenin (plakoglobin), one of the major intracellular components in desmosome, and desmin, the intermediate filaments closely associating with desmosomes. miR-CL and CL-in were also included in the experiments as scrambled controls. As shown in Fig. 33, transfection of miR-21 mimics led to ~10-fold increase in miR-21 level compared with the control (miR-CL). This increased level is similar to the level induced by CVB3 infection. In addition, miR-21 inhibitor reduced miR-21 expression by ~90% compared with the control (CL-in). In sham-infected controls, transfection of miR-21 mimics inhibited desmin expression while 21-in increased desmin expression. A robust reduction in desmin expression was found in CVB3 infected cells compared with the sham-infected control. Transfection of miR-21 mimics enhanced suppression of desmin expression while treatment of 21-in substantially attenuated the downregulation of desmin during CVB3 infection (Fig. 34a). On the contrary, miR-21 showed no significant influence on ?-catenin level though CVB3 infection indeed suppressed ?-catenin, indicating other mechanisms may be involved in the regulation of ICD gene expression during CVB3 infection. I then investigated the desmosome structures using EM. As shown in Fig. 34b, in the control group, compact and well-organized desmosomes were observed with typical opposing electron dense plaques anchoring on the cell membranes. In contrast, most miR-21 mimics transfected cells demonstrated no apparent desmosomes despite multiple cell-cell contacts. In a few miR-21 mimics transfected cells, desmosome-like structures with much thinner and also shorter electron dense plaques were identified. miR-CL group presented an average of 12.6 desmosomes per 10,000 square microns while miR-21 mimics transfected group only exhibited an average of 1.6 desmosome-like structures per 10,000 square microns. These data indicated that increased miR-21 level downregulates desmin and damages desmosome structures in cardiomyocytes. 112   Figure 33. miR-21 levels after transfection of miRNA mimics or inhibitors in HL-1 cells. HL-1 cells were transfected with miRNA mimics or inhibitors as indicated. miR-21 levels were measured at 48 h post transfection by q-RT-PCR and normalized to U6 RNA. p <0.01, n=4. 113  Figure 34. miR-21 downregulates desmin expression and disrupts desmosome structures. (a) miR-21 inhibits desmin expression during CVB3 infection. HL-1 cells were transfected and infected as indicated. Desmin, ?-catenin and ?-actin were detected by WB. (b) miR-21 expression disrupts desmosome structures. miR-CL or miR-21 transfected HL-1 cells were subjected to EM analysis of desmosomes. Lower (3900?) and higher magnification (37000?) views of desmosomes were indicated. FA: Fascia adherens. DS: desmosome. In miR-21 mimic transfected cells, desmosome-like structures with shortened and thinner electron dense plaques were observed.   114 5.4.3. miR-21 promotes desmin degradation through the ubiquitin-proteasome pathway To reveal the mechanism by which miR-21 suppresses desmin expression, I first evaluated the levels of desmin transcription. Q-RT-PCR results showed that neither CVB3 infection nor miR-21 transfection/inhibition could cause alterations in desmin mRNA levels (Fig. 35a). This suggests that the change of desmin expression occurs at the post-transcriptional level. I then performed bioinformatic prediction using the miRWalk software [447] to search for potential miR-21 targeting sites on desmin mRNA but no site was found in the 5?UTR, coding region and the 3? UTR, indicating no direct targeting effect of miR-21 on desmin translation. Previous studies reported that desmin undergoes cleavage by proteases such as cysteine protease and caspase [448, 449]. However, our WB results showed no cleavage products despite robust decrease in desmin production in the miR-21 mimics transfected samples (Fig. 35b). Recently, it was reported that desmin is susceptible to degradation via ubiquitin-proteasome pathway [450]. I thus further determined whether miR-21 regulates desmin ubiquitination. To this end, desmin was pulled down by immunoprecipitation and then the ubiquitinated desmin (ubi-desmin) was detected by an anti-ubiquitin antibody. I found that CVB3 infection and transfection of miR-21 mimics induced poly-ubiquitination of desmin proteins, while 21-in suppressed desmin ubiquitination compared to their corresponding controls (Fig. 35c). In CVB3 infected cells, transfection of miR-21 further intensified the ubiquitination of desmin, while 21-in alleviated this process. To further confirm the involvement of ubiquitin-proteasome pathway in miR-21 mediated desmin reduction, I applied proteasome inhibitor MG132 to block this pathway immediately after transfection of miR-21. As shown in Fig. 35d, compared with DMSO control group, MG132 eliminated the effect of miR-21 on desmin downregulation. These data indicated that miR-21 promotes desmin degradation through ubiquitin-proteasome pathway.   115       116 Figure 35. miR-21 promotes desmin degradation through ubiquitin-proteasome pathway. (a) Neither miR-21 nor CVB3 infection affects desmin transcription. HL-1 cells were transfected and infected as indicated. Cellular total RNAs were isolated and subjected to q-RT-PCR detection of desmin. Data was normalized to GAPDH that served as an endogenous control. (b) miR-21 does not induce desmin cleavage. HL-1 cells were transfected with miR-CL or miR-21 and analyzed by WB detection of desmin. No cleaved bands of desmin were observed. (c) miR-21 enhances desmin ubiquitination during CVB3 infection. HL-1 cells were transfected and infected as indicated. Desmin was pulled down from different samples and analyzed by WB detection of ubiquitin. (d) Proteasome inhibitor blocks the effect of miR-21 on desmin degradation. HL-1 cells were transfected as indicated. DMSO or MG132 were added after transfection. Proteins were extracted to detect the desmin levels.                    117 5.4.4. miR-21 specifically targets YOD1  To understand the mechanism by which miR-21 induces desmin ubiquitination, I performed a bioinformatic search for the miR-21 potential target genes using TargetScan [451]. Among the top 10 predicted targets, YOD1 (OTU Deubiquitinating  Enzyme 1 Homolog) is involved in the ubiquitin-proteasome pathway (Table 8). Two conserved targeting sites were identified within the 3? UTR of YOD1 mRNA (Fig. 36a). YOD1 is a deubiquitinating enzyme that removes ubiquitin residues from the ubiquitinated proteins, facilitating the dislocation of mis-folded proteins from the endoplasmic reticulum (ER) for further degradation [452]. It is however not clear whether YOD1 regulates the degradation of normal cytosolic protein. To verify whether YOD1 is a true target of miR-21, I first measured the expression level of YOD1 in miR-21 transfected cells. WB results showed that miR-21 transfection led to a  reduction in YOD1 level compared with miR-CL. YOD1 was also decreased in CVB3 infected sample in comparison to the sham-infected control. Such reduction was enhanced by transfection of miR-21 mimics (Fig. 36b). To validate the effect of miR-21 on endogenous YOD1 expression, I used 21-in to knockdown cellular miR-21 and blocked the induction of miR-21 by CVB3 infection. YOD1 was increased in 21-in transfected samples compared with CL-in. Importantly, the suppression of YOD1 by CVB3 infection was partially attenuated by 21-in transfection (Fig. 36b). To validate the direct targeting effect of miR-21 on YOD1 3?UTR, I cloned one of the two miR-21 targeting sites of YOD1 into a dual-luciferase reporter vector. I also constructed a mutated targeting site by changing 4 base-pairs (bp) to disrupt the targeting effect of miR-21. Luciferase reporter assay showed that miR-21 caused ~40% reduction in the luciferase activity of the reporter vector harboring the wide type targeting sites but not the mutant one (Fig. 36c). These data demonstrated that miR-21 plays an essential role in downregulating YOD1 in CVB3 infection.      118  Table 8. Top 10 potential targets of miR-21 predicted by TargetScan  Rank Target gene Representative transcript Gene name Total context+ score 1 ZNF367 NM_153695 zinc finger protein 367 -0.76 2 GPR64 NM_001079858 G protein-coupled receptor 64 -0.57 3 YOD1 NM_018566 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) -0.49 4 PHF14 NM_014660 PHD finger protein 14 -0.49 5 PLEKHA1 NM_001001974 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 -0.46 6 PIKFYVE NM_015040 phosphoinositide kinase, FYVE finger containing -0.45 7 PBRM1 NM_018165 polybromo 1 -0.45 8 GATAD2B NM_020699 GATA zinc finger domain containing 2B -0.44 9 SCML2 NM_006089 sex comb on midleg-like 2 (Drosophila) -0.44 10 VCL NM_003373 vinculin -0.44 119  Figure 36. miR-21 targets YOD1. (a) Bioinformatic prediction of miR-21 targeting sites in the 3? UTR of murine YOD1 mRNA. Mutated targeting sites were designed for luciferase assay control. (b) miR-21 suppressed YOD1 expression. HL-1 cells were transfected and infected as indicated. YOD1 expression levels were measured by WB. (c) Luciferase assay to validate miR-21 targeting effect on YOD1 translation. HL-1 cells were co-transfected with miRNA mimics and luciferase reporter vectors harboring wt or mut YOD1 3?UTR fragments. Dual luciferase assay was conducted to compare the relative luciferase activity (Firefly/Renilla) among different groups. p <0.01, n=4.   120 5.4.5. Suppression of YOD1 induces desmin degradation and desmosome disruption To determine whether the YOD1 suppression by miR-21 accounts for the degradation of desmin during CVB3 infection, I utilized siRNA to knockdown endogenous YOD1, which mimicked the effect of miR-21. As shown in Fig. 37a, compared with the scrambled control siRNA (si-Scr), YOD1 siRNA successfully suppressed YOD1 expression in both sham and CVB3 infected cells. Similar to miR-21 mimic transfection, YOD1 siRNAs robustly decreased the desmin expression level. In CVB3 infected samples, desmin was further downregulated by knocking down of YOD1. I also found more ubiquitination of desmin proteins in YOD1 siRNA transfected cells than in the control group in both sham and CVB3 infected samples (Fig. 37b). Application of MG132 to inhibit proteasome activity blocked the degradation of desmin protein, which is consistent with the miR-21 mimic transfection results (Fig. 37c).  To further investigate the role of YOD1 in miR-21-mediated desmin degradation during CVB3 infection, I overexpressed YOD1 in CVB3 infected or miR-21 mimic transfected cells by plasmid transfection. Similar levels of desmin were found in sham and CVB3 infected cells in the presence of YOD1 expression constructs, while the empty vector failed to rescue the loss of desmin during infection (Fig. 37d). The overexpression of YOD1 also eliminated the effect of miR-21 on desmin degradation as evidenced by similar levels of desmin in miR-CL and miR-21 transfected cells in the presence of YOD1 expression vector (Fig. 37d). These data indicate that overexpression of YOD1 could counteract the effect of miR-21 on desmin degradation and that YOD1 is responsible for the miR-21 mediated degradation of desmin during CVB3 infection.  Further, I examined the effect of YOD1 siRNAs on desmosome structure and desmin distribution. EM data showed that knocking down of YOD1 resulted in substantially fewer and weaker desmosomes than the control samples. These are evidenced by the thinner and shorter electron dense plaques and fewer desmosome-like structure (1.1/1000 square microns) in YOD1 siRNA-transfected cells than in the control group (11.2/1000 square microns)  (Fig. 37e). I then investigated the effect of miR-21 mimics and YOD1 siRNA on the distribution of desmin protein. Immunofluorescence staining data showed that in control groups (miR-CL or si-Scr), desmin was mainly localized along the cell borders where the cells contact 121 each other. On the contrary, transfection of miR-21 mimics or knocking down of YOD1 with specific siRNAs induced even distribution of desmin proteins in the cytoplasmic area (Fig. 38a). More importantly, I found that the redistribution of desmin triggered by miR-21 mimics or YOD1 siRNA was accompanied by increased (2-3 folds) co-localization of desmin with proteasomes, which was verified by the Pearsons Correlation analysis (Fig. 38b). These results support our findings that miR-21 induced suppression of YOD1 promotes desmin degradation through the ubiquitin-proteasome pathway during CVB3 infection, which contributes to the damage in desmosomes. 122        123 Figure 37. YOD1 regulated desmin degradation during CVB3 infection. (a) Knocking down of YOD1 downregulates desmin. HL-1 cells were transfected with scrambled control siRNA or YOD1 siRNA and then infected by CVB3. The indicated proteins were detected by WB. (b) YOD1 siRNA enhances desmin ubiquitination. HL-1 cells were transfected and infected as indicated. Desmin was immunoprecipitated and analyzed by WB detection of ubiquitin. (c) Proteasome inhibitor blocks the YOD1 siRNA?mediated desmin degradation. HL-1 cells were transfected as indicated. DMSO or MG132 were added after transfection. Proteins were extracted to detect the desmin levels. (d) Overexpression of YOD1 inhibits desmin degradation. HL-1 cells were transfected with empty vector or YOD1 expression vector and infected with CVB3 or co-transfected with miRNA mimics. Desmin and YOD1 expression levels were evaluated by WB. (e) YOD1 siRNA disrupts desmosomes. HL-1 cells were transfected with scrambled siRNA or YOD1 siRNAs and the desmosome structures were analyzed by EM. Lower (3900?) and higher (37000?) magnification views of desmosomes were indicated. FA: Fascia adherens. DS: desmosome. 124  Figure 38. miR-21 and YOD1 siRNA induce co-localization of desmin and proteasome. HL-1 cells were transfected as indicated. Cells were subjected to immunofluorescence detection of desmin and proteasome. Nucleuses were detected by DAPI. Images were captured by confocal microscope (a) and co-localization was analyzed by the Volocity program using Pearson?s Correlation as an indicator. p < 0.05, n=4 (b). 125 5.4.6. miR-21 interrupts fascia adherens in human cardiomyocytes by targeting vinculin (VCL) Among the top 10 miR-21 targets I predicted above, another gene that is closely related to cell-cell connections and cardiac function is VCL. VCL is an essential component of fascia adherens that maintain cardiac structures [440]. I found that miR-21 has one conserved targeting sites in VCL 3? UTR of human and mice; while human VCL contains an additional miR-21 targeting sites (Fig. 39a). I first performed luciferase assay to evaluate the targeting effect of miR-21 on the conserved site. The results showed that miR-21 inhibited the luciferase activity of the reporter vector harboring the wt targeting site but not the mutant one, indicating the specific recognition of this site by miR-21 (Fig. 39b). I then measured the expression of VCL in different human and mice cell lines that transfected with miR-21 mimics. Interestingly, in all three human cell lines, immortalized human cardiomyocytes, HeLa cells and HEK 293T cells, miR-21 mimics inhibited VCL (Fig. 39c). In contrast, in the two mouse cell lines tested, NIH 3T3 and HL-1 cells, despite the successful transfection as evidenced by q-RT-PCR results (Fig. 40), only minimal inhibitory effect of miR-21 on VCL expression was observed (Fig. 39c). This indicates that the immortalized human cardiomyocytes would be a better tool to study the role of miR-21 in fascia adherens.  126      127 Figure 39. miR-21 targets VCL. (a) Bioinformatic prediction of miR-21 targeting sites in human and mice VCL 3? UTR. Mutant targeting sites were designed for luciferase assay. (b) Luciferase assay to validate miR-21 targeting effect on VCL translation. HeLa cells were co-transfected with miRNA mimics and luciferase reporter vectors harboring wt or mut VCL 3?UTR fragments. Dual luciferase assay was conducted to compare the relative luciferase activity (Firefly/Renilla) among different groups. p < 0.05, n=4 (c) miR-21 suppresses VCL expression in human cells but not mouse cell lines. Different human and mouse cell lines were transfected with miR-21 mimics and VCL levels were measured by WB.   Figure 40. miR-21 levels after transfection of miRNA mimics or inhibitors in different cell lines. Difference cell lines were transfected with miRNA mimics or inhibitors as indicated. miR-21 levels were measured by q-RT-PCR and normalized to U6. p < 0.01, n=4. 128 I thus transfected these cells with either miR-21 mimics to increase the miR-21 level or 21-in to suppress the induction of miR-21 by CVB3. The signals associated with fascia adherens was then detected by WB. The results showed that miR-21 downregulated VCL, pan-cadherin and ?-E-catenin but upregulated ?-catenin. 21-in produced opposite effect to miR-21 mimics by increasing VCL, pan-cadherin and ?-E-catenin while decreasing ?-catenin (Fig. 41a). Knocking down of VCL using siRNAs showed similar effect to that of miR-21 in the inhibition of pan-cadherin and ?-E-catenin (Fig. 42a). I further analyzed the fascia adherens by investigating the distribution of pan-cadherin and ?-E-catenin using immunofluorescence staining. In control cells, both signals were well aligned with the cell-cell connection boarder lines. However, when transfected with miR-21 mimics or VCL siRNA, pan-cadherin and ?-E-catenin were disorganized with the loss of clear cell contact sites (Fig. 41b, 42b). These data imply that miR-21 targets VCL and interrupts fascia adherens during CVB3 infection.  129  Figure 41. miR-21 interrupts fascia adherens during CVB3 infection. HL-1 cells were transfected and infected as indicated. Signals involved in fascia adherens were detected by WB (a). Distribution of pan-cadherin and ?-E-catenin were detected by immunofluorescence staining and confocal microscopy (b). Blue represents the nucleus stained by DAPI and green shows the expression of pan-cadherin or ?-E-catenin as indicated. Arrows label the localization of pan-cadherin or ?-E-catenin along the cell borders where cardiomyocytes contact with each other. 130  Figure 42. Kocking down of VCL interrupts fascia adherens. HL-1 cells were transfected as indicated. Signals involved in fascia adherens were detected by WB (a). Distribution of pan-cadherin and ?-E-catenin were investigated by immunofluorescence staining and confocal microscopy (b). Arrows indicate the localization of pan-cadherin or ?-E-catenin along the cell borders where cardiomyocytes contact with each other. 131 5.5. Discussion Several studies have been reported on the role of host miRNAs on regulating the replication of CVB3 and the activation of inflammation processes [320, 321, 325, 453]. However, research on miRNA in cardiomyocyte pathology in viral myocarditis, particularly the regulation of cell-cell connections which are fundamental to cardiac structures and functions, is still missing. This study is the first to reveal the role of miR-21 in modulating ICDs in the myocardium during CVB3 infection. I identified two new targets of miR-21, YOD1 and VCL. Suppression of YOD1 by miR-21 promotes desmin degradation and desmosome disorganization. Targeting of VCL by miR-21 directly triggers the reduction and disorientation of fascia adherens components including pan-cadherin and ?-E-catenin. These findings provide a new perspective to understand the role of miRNAs in viral myocarditis. The differential expression of miR-21 caused by CVB3 infection is controversial. Both up- and down-regulation of miR-21 expression during CVB3 infection have been reported [321, 324, 325]. In our study, I found that CVB3 infection induced miR-21 expression in both in vivo and in vitro models. Q-RT-PCR results also indicated an enhanced upregulation of miR-21 with longer periods of infection. It is worth noting that different studies used different mouse strains including C3H, BALB/c and A/J. In addition, different endogenous controls such as GAPDH and U6 were also used in different studies. These may partially explain the inconsistency of the data.  Considering that three independent groups including ours found that miR-21 is increased and that the transcriptional factors controlling miR-21 expression, such as AP-1 [208], STAT3 [454] and p38 [455], are all activated by CVB3 infection [423, 453, 456], I would argue that miR-21 is indeed induced by CVB3 infection.  ICDs are composed of three major sub-components, desmosomes, fascia adherens and gap junctions [440]. They are the anchoring pillar to stabilize the cardiac structures and the bridging cable to transmit signals among cardiomyocytes. Deficiency in ICDs caused both constitutional and functional damage to the myocardium. CVB3 infection has been found to affect endothelial tight junction [457] but its effect on cardiomyocyte ICDs is not clear. miR-21 has been identified as one of the most important miRNAs regulating heart diseases, particularly in cardiac hypertrophy [273, 434]. However, its role in modulating ICDs organization has very limitedly been investigated. Desmosomes are symmetrical protein 132 complexes connecting adjacent cardiomyocytes. They are tightly linked with desmin, an intermediate filament facilitating the anchoring of desmosomal plaques [458]. Mutation or knockout of desmin frequently causes DCM [459-462], a heart disease that often developes in the end stage of viral myocarditis [4]. Knockout of desmin leads to fibrosis and ischemia in the heart with the loss of myocardium strength and integrity [463]. Cardiomyocytes lacking desmin show disorganized myofibrils which are separated from ICDs, resulting in a reduction in desmosome numbers [464]. In this study, I found that desmin levels were reduced by miR-21 mimic transfection and CVB3 infection. Knockdown of miR-21 can rescue the desmin levels during CVB3 infection, suggesting the regulatory role of miR-21 on desmin in CVB3-induced myocarditis. Our results showed that neither miR-21 transfection nor CVB3 infection affected desmin mRNA levels, indicating that the regulation is at the post-transcriptional level. This conclusion is further supported by the findings that neither direct targeting sites of miR-21 in desmin mRNA was found nor the protease-mediated cleavage of desmin was detected in WB analysis. Recent studies reported the loss of desmin due to ubiquitination by Trim32 during muscle atrophy [450], indicating the important role of ubiquitin-proteasome system in modulating desmin level. I found that CVB3 infection and miR-21 mimic transfection enhanced desmin ubiquitination while 21-in produced an opposite effect. In addition, application of proteasome inhibitor suppressed the miR-21-mediated desmin degradation. These data suggest that CVB3-induced miR-21 expression causes desmin degradation through the ubiquitin-proteasome pathway. Importantly, I further demonstrated that the suppressed desmin levels eventually led to quantity reduction and structure disorganization of desmosomes. In search for the underlying mechanism by which miR-21 promotes desmin degradation, I identified a novel target of miR-21, YOD1, a deubiquitinating enzyme (DUB) in the ovarian tumor (OTU) family that removes ubiquitin residues from poly-ubiquitinated proteins [438]. It is involved in the degradation of misfolded proteins in ER. DUBs in the OTU family have been found to be capable of stabilizing some proteins. OTUB1 stabilizes c-IAP1 by counteracting its ubiquitination process [465]. OTUB1 also enhances the stability of p53 by suppressing its ubiquitination [466]. The role of YOD1 in protein stabilization is unknown. By using siRNA to knock down YOD1, I found that desmin ubiquitination and degradation was enhanced. Treatment of proteasome inhibitor blocked the effect of 133 YOD1 siRNAs on desmin suppression, suggesting that YOD1 is essential to stabilize desmin. YOD1 siRNAs also caused disruption of desmosomes. These results are in line with the role of miR-21 in promoting desmin degradation. Furthermore, overexpression of YOD1 attenuated the effect of CVB3 infection and/or miR-21 transfection on desmin degradation. Interestingly, both miR-21 and YOD1 siRNA induced the re-distribution of desmin, resulting in increased co-localization of desmin and proteasomes. These findings suggest that YOD1 possesses a similar function to OTUB1 to stabilize certain cellular proteins and that suppression of YOD1 expression during CVB3 infection is the cause of desmosome damage. Another major component of ICD is fascia adherens. VCL is one of the major components of fascia adherens. Cardiomyocytes specific excision of VCL results DCM and sudden death in young mice [467], all of which are typical consequences of CVB3-induced myocarditis. Suppression of VCL by miR-21 leads to the inhibition of pan-cadherin and ?-E-catenin during CVB3 infection. This also causes disorientation of pan-cadherin and ?-E-catenin localization. The disappearance of distinct cell-cell connection sites supports the notion that VCL is essential for cell-cell contacts in cardiomyocytes. Targeting of VCL by miR-21 yields a negative regulatory effect on fascia adherens during CVB3 infection.   In conclusion, I revealed a novel role of miR-21 on controlling the integrity of cardiomyocyte ICDs through targeting YOD1 and VCL. The disorganization of desmosomes and fascia adherens caused by miR-21 expression during CVB3 infection may contribute to the pathogenesis of viral myocarditis (Fig. 43). Based on the understanding of the underlying mechanism of miR-21 function, new strategies can be developed for drug targeting to protect the integrity of the myocardium, which can be use to prevent or treat viral myocarditis. 134  Figure 43. A putative model of miR-21 regulation on ICD integrity during CVB3 infection. CVB3 infection induces miR-21 upregulation, leading to the inhibition of YOD1 and VCL expression. YOD1 suppression causes desmin degradation through UPS, leading to destabilization of desmosomes. Direct targeting of VCL by miR-21 disrupts fascia adherens.   5.6. Limitation and solutions Using both miRNA mimics and miRNA inhibitors, I showed the influences of miR-21 on ICD proteins during CVB3 infection. The major finding of this study is the degradation of desmin mediated by miR-21 via the UPS. I used UPS inhibitors, protein ubiquitination assay and confocal imaging to triple-confirm this regulatory pathway. However, there are still more investigations that could be added to improve this study. First, the EM detection of desmosomes could be more specific by using desmin antibody to indicate their locations rather than only showing the electron dense plaques. Second, more desmosome components, such as desmocolin, desmoglein, desmoplakin and plankophilin, could have been evaluated by WB and immunofluorescence staining to further investigate the alterations in 135 desmosomes. Third, in vitro ubiquitination assay in the presence of recombinant YOD1 or YOD1 mutants could provide a more direct evidence of the effect of YOD1 on desmin degradation. In addition, the targeting of VCL by miR-21 could be further evaluated by luciferase assay using reporter plasmids containing wt or mut 3?UTR of the target gene as described above.  In addition, primary human cardiomyocytes rather than the immortalized cells should be used to test the role of miR-21 on fascia adherens. EM detection on the fascia adherens structures could also have been used to further confirm the disruption of cell-cell interactions by miR-21. Moreover, though I have shown that CVB3 infection leads to dysregulation of ICD protein levels and miR-21 inhibition would alleviate such changes, EM observation of CVB3 infected samples should be performed by using miR-21 inhibitors, which may strengthen the conclusion. 5.7. Future directions In this chapter, I demonstrated that miR-21 induced by CVB3 infection enhances ubiquitination-mediated degradation of desmin and suppresses VCL expression, contributing to the disruption of cardiomyocyte ICDs. Further investigations are necessary to achieve better understanding of the molecular mechanism of miR-21-mediated regulation of gene expression involved viral pathogenesis. As mentioned above, miR-21 expression can be regulated by several transcriptional factors and can also be modified by epigenetic change or post-transcriptional processing. Though some of the transcription factors such as AP-1 and STAT3 are activated by CVB3 infection, it is still unclear which one is responsible for the miR-21 induction. In addition, investigation of epigenetic modifications of transcriptional promoter or post-transcriptional changes of miRNA processing would also be an interesting study.  Desmosomes are essential structure to maintain the integrity of the heart architecture and its proper functions. Here I used in vitro infection models to show the role of miR-21 in regulating desmosome stabilities. The follow-up step would be in vivo study using mouse models to determine whether inhibition of miR-21 can improve the outcome of CVB3-induced myocarditis. To achieve this goal, miRNA mimics and inhibitors will be administered into the infected animals. Cardiac functions and 136 histopathology, particularly the integrity of ICDs, will be evaluated using the approaches described above for the in vitro studies. YOD1 has been found to be involved in the endoplasmic reticulum-associated degradation (ERAD) of misfolded lumenal proteins [452]. ERAD is an essential process for restoring the proper ER function during ER stress conditions. CVB3 infection has been found to induce ER stress [150]. In this regard, the role of miR-21/YOD1 cascade in CVB3 induced ER stress will be worth exploring. Inhibition of YOD1 by miR-21 may repress the ERAD pathway, which prevents the clearance of misfolded proteins from ER during CVB3 infection. This would lead to a prolonged ER stress that ultimately triggers cell apoptosis and cardiomyocyte damage.  VCL deficiency has been found to be associated with DCM [468], which is a serious heart dysfunction frequently developed at the late stage of CVB3 infection. However, it is unknown whether VCL is involved in CVB3-induced DCM. Though miR-21 does not target VCL in mice, using shRNAs expressed by lenti-virus vectors to knockdown VCL, it may answer whether downregulation of VCL can exacerbate the CVB3-induced DCM. On the other hand, transgenic mice overexpressing VCL may help to explore the therapeutic potential of VCL in attenuating CVB3-induced heart dysfunction. It might also be possible to apply miR-21 inhibitors in primates with DCM since they share the same targeting sites as human. This experiment may test the potential of miR-21 in serving as a therapeutic target for DCM.      137 Chapter 6 Closing remarks 6.1. Research summary and conclusion In this dissertation, I reported the miRNA profile changes induced by CVB3 infection. Particularly, I focused on three miRNAs, miR-126, miR-203 and miR-21. A summary of major findings are listed below. Chapter 3: Roles of miR-126 in CVB3 replication and virus-induced cell death 3.1 CVB3 infection induces miR-126 expression through the ERK1/2-ETS cascade  3.2 miR-126 promotes CVB3 replication 3.3 miR-126 promotes CVB3 replication by targeting SPRED1 3.4 miR-126 sensitizes cells to CVB3-induced cell death and enhances viral progeny release 3.5 miR-126 sensitizes cells to CVB3-induced cell death by targeting WRCH1 and LRP6 and promoting ?-catenin degradation Chapter 4: miR-203 regulates CVB3 infection by target ZFP-148 4.1 CVB3 infection upregulated miR-203 in HL-1 cardiomyocytes and mouse heart. 4.2 Upregulation of miR-203 is through the activation of PKC/AP-1 cascade. 4.3 ZFP-148 is a novel target gene of miR-203 4.4 miR-203 promotes CVB3 replication  4.5 Silencing of ZFP-148 with specific siRNAs benefits CVB3 replication  4.6 Transfection of miR-203 mimics promotes cell survival  4.7 Suppression of ZFP-148 by miR-203 leads to the differential expression of cell cycle regulators Chapter 5: miR-21 alters cell-cell interaction in cardiomyocytes during Coxsackievirus infection 5.1 miR-21 expression is upregulated by CVB3 infection both in vivo and in vitro 5.2 miR-21 suppresses desmin expression and disrupts desmosome organization during CVB3 infection 5.3 miR-21 promotes desmin degradation through the ubiquitin-proteasome pathway 5.4 miR-21 specifically targets YOD1  138 5.5 Suppression of YOD1 induces desmin degradation and desmosome disruption 5.6 miR-21 interrupts fascia adherens in human cardiomyocytes by targeting VCL. In conclusion, CVB3 infection modified host miRNA expression profiles to widely alter cellular signal pathway networks, providing a favorable environment for viral replication and contributing to the cytopathogensis such as cell apoptosis, cell cycle progression and cell-cell interaction disruption. These altered miRNAs are with great potential to be developed into therapeutic tools or targets for treating CVB3-induced myocarditis or DCM. 6.2. Research significance and future investigations CVB3 is one of the most prevalent etiological factors causing viral myocarditis and subsequent DCM that accounts for most cases of heart transplantations. In this dissertation, I conducted an in-depth analysis on the host miRNA profile during CVB3 infection, providing a new perspective on understanding the host-virus interactions. Using the three miRNAs significantly upregulated by CVB3 infection, I showed that miRNAs play essential roles not only in the viral replication but also in the cytopathogenesis of cardiomyocytes. This could serve as a foundation for further investigating the signal transductions during CVB3 infection as well as for developing novel therapeutic strategies. An interesting question is why miRNAs-mediated post-transcriptional silencing even matters considering that CVB3 induces host cell protein translation shut-off by cleavage of translation initiation factors [147]. Then a following question would be why the host translational shut-off is important since the virus has already inhibited the host mRNA transcription [469]. For the second question, we would argue that the translational shut-off mainly inhibits the production of proteins from the exsiting mRNAs in the cells; while the transcriptional inhibition would prevent the synthesis of de novo mRNAs. For the first question, it would be important to note that CVB3 inhibits cap-dependet translation initiation but not the cap-independent ones. Some host mRNAs also contain an IRES which can be expressed in a cap-independent manner [470]. A miRNA-mediated translational regulation may provide additional control for the virus to manipulate host protein levels. Also, compared with the global inhibition of translation by cleavage of host translational machinery, miRNA-mediated regulation is more specific, allowing the virus 139 to finetune certain signal pathways. This seeming redundancy in protein translation inhibition may be the evidence of sophisticated regulation of host cellular functions by viruses. Another concern for the miRNA function in viral infection is the timing. As shown in Chapter 3, miR-126 is induced at around 5 hpi, which means that it will not be until 5 hpi, the miRNA starts to inhibit the de novo translation of proteins. However, the average half lives of host proteins are more than 5 h [471]. The life cycle for CVB3 is about 8 h. This raises the question how the miRNA will be beneficial to viral replication since it needs at least 10 h to allow the targeted protein level starts to decline. To answer this question, it would be essential to understand that the host-virus interaction is a two-direstion communication rather than a one-way system. The host cells have also evoluted a whole defense system to counteract the viral infection. This system triggers the expression of a set of defense genes to interrupt the viral replication [357]. In this regard, the miRNA-mediated inhibition on fresh protein production may contribute to the suppression of the host defense response. In addion, the virus life cycle does not necessarily equals to the life span of the infected cells as cell lysis may not be the only option of CVB3 transmission. We and others found that more than 70% of cells are still alive at 10 hpi at 10 MOI [151]. Recent studies showed that CVB3 can be transmitted in a direct cell-cell route through induced cell protrutions [330]. These findings indicate that the virus may continue to replicate in the cells after a complete cycle as long as the cells were not lysed. This provides an opportunity for the miRNAs to play a role in the viral replication or subsequent cytopathogenesis. Furthermore, it is still not clear yet the miRNAs are induced by direct viral infection or the virus-activated cytokines. It is entirely possible that the infected cells secrete cytokines, which trigger the miRNA expression profile change in surrounding uninfected cells, resulting in a prefereable status for those cells to be further infected. It will be worthy to explore further into these hypotheses. Recently, it was reported that viral infection triggers the host anti-viral response, which inhibits the host RNAi machinery at round 8 hpi [472]. This adds another layer of commlexity onto the virus-host interactions mediated by the miRNAs. The study showed that transfection of short double-stranded RNA mimics or infection with HSV or Sendai virus would lead to 30-50% reduction in the host RNAi effiency. This raises the question that whether the functions of the CVB3-upregulated host miRNA will be 140 compromised due to the global inhibition in host RNAi machinery. However, it is noteworthy that this virus-induced inhibition on host RNAi is mediated by the MAVS. Knocking down of MAVS almost entirely block this inhibition. Though the transfection of CVB3 genome in a replication form (double-stranded) can be recognized by MAVS [473], CVB3 protease 3C can effectively cleave MAVS as early as 3 hpi, at the same time when the viral genome starts to replicate [162], indicating a sophisticated mechanism employed by the virus to rescue the host RNAi machinery. In addition, even though CVB3 infection indeed suppresses the host RNAi machinery to some extend, the virus-induced upregulation of some miRNAs beneficial to viral replication may compensate this inhibition. We have been arbitually thought that viruses will boost certain host miRNAs to promote their replication but the fold changes of most of miRNAs are not very hight during viral infection, at least in our cases. Is it possible that viruses actually just try to maintain the proper functional level of the miRNAs to strike a balance between viral replication and host cell survival. Intense viral replication may simply kill the host too early, which is not ultimately beneficial for the virus in evolution. In this regard, the virus may not need to induce dramatical change of the host miRNA profiles but just need to subtly adjust the levels of some miRNAs to counteract the inhibition of host RNAi machinery. Indeed, all the above speculations would require further investigations. In my study, knocking down of miR-126 or miR-203 significant inhibited the replication of CVB3, suggesting their potential in treating the viral infection in the early stage of viral myocarditis when the virus still replicates intensively. The inhibition of miR-126 may also attenuate the direct cardiomyocyte damage by preventing the cell apoptosis. This may however affect the clearance of virus by the immune system considering the essential roles of cell apoptosis in immune response [474]. Additional caution is also needed for the application of miR-126 inhibitor due to the functions of miR-126 in angiogenesis. Inhibition of miR-126 at the late stage of viral myocarditis may negatively regulate the cardiac remodeling by inducing blood vessel malfunction. Cardiomyocytes specific inhibition of miR-126 using ligands-based target delivery may reduce such risks. Different from miR-126 and miR-203, miR-21 seems to participate in the cardiomyocyte cytopathogenesis rather than the viral replication. I did not see much difference in viral replication when 141 overexpressing or knocking down miR-21 compared with the controls (data not shown). On the contrary, the ICD components in cardiomyocytes are significantly altered by miR-21. The disruption of ICDs by CVB3 infection is a new discovery. Though it is known that CVB infection requires CAR receptor which is located in the tight junction sites in epithelial cells [127], the influence of CVB3 on cell-cell interactions, particularly the cardiomyocyets communication, is poorly understood. My study here shows a novel mechanism by which CVB3 interrupts the cell-cell connections, which probably contributes to the loss of cardiac integrity and the cause of arrhythmia. Inhibition of miR-21 during CVB3 infection is a potential strategy to counteract such pathological changes and improve the cardiac function. Considering the controversial role of miR-21 in cardiac functions and pathology, in vivo studies are necessary to confirm the feasibility of targeting miR-21 for therapeutic purposes. miRNAs are essential gene regulators and powerful tools for future therapies. As shown in this dissertation and many other studies, one miRNA can be involved in multiple signal pathways, which could present advantages but also downsides for the miRNA based treatment. This means that manipulating several essential pathways simultaneously using one single drug is possible but also implies that it may produce potential side effects. Modification on miRNA sequences and target delivery using receptor ligands may enhance its efficiency and specificity. In addition, combination of several miRNA or miRNA inhibitors may achieve a better effect than using a single one. In our study, inhibition of all three miRNAs, miR-126, miR-203 and miR-21 may both suppress viral replication and attenuate the cardiac injury. Together, the study on miRNA regulation in viral myocarditis would benefit the development of novel effective therapeutic methods to treat this disease.        142 Bibliography 1. Feldman, A.M. and D. McNamara, Myocarditis. N Engl J Med, 2000. 343(19): p. 1388-98. 2. Baughman, K.L., Diagnosis of myocarditis: death of Dallas criteria. Circulation, 2006. 113(4): p. 593-5. 3. Drory, Y., et al., Sudden unexpected death in persons less than 40 years of age. Am J Cardiol, 1991. 68(13): p. 1388-92. 4. Dennert, R., H.J. Crijns, and S. Heymans, Acute viral myocarditis. Eur Heart J, 2008. 29(17): p. 2073-82. 5. Adwani, S.S., et al., Heart transplantation for dilated cardiomyopathy. Arch Dis Child, 1995. 73(5): p. 447-52. 6. Felker, G.M., et al., Underlying causes and long-term survival in patients with initially unexplained cardiomyopathy. N Engl J Med, 2000. 342(15): p. 1077-84. 7. William Dec, G., Introduction to Clinical Myocarditis, in Myocarditis, L. Cooper, Jr., Editor 2003, Humana Press. p. 257-281. 8. Sakakibara, S. and S. Konno, Endomyocardial biopsy. Jpn Heart J, 1962. 3: p. 537-43. 9. Aretz, H.T., et al., Myocarditis. A histopathologic definition and classification. Am J Cardiovasc Pathol, 1987. 1(1): p. 3-14. 10. Hauck, A.J., D.L. Kearney, and W.D. Edwards, Evaluation of postmortem endomyocardial biopsy specimens from 38 patients with lymphocytic myocarditis: implications for role of sampling error. Mayo Clin Proc, 1989. 64(10): p. 1235-45. 11. Lieberman, E.B., et al., Clinicopathologic description of myocarditis. J Am Coll Cardiol, 1991. 18(7): p. 1617-26. 12. Basso, C., et al., Classification and histological, immunohistochemical, and molecular diagnosis of inflammatory myocardial disease. Heart Fail Rev, 2012. 13. Gravanis, M.B. and N.H. Sternby, Incidence of myocarditis. A 10-year autopsy study from Malmo, Sweden. Arch Pathol Lab Med, 1991. 115(4): p. 390-2. 14. Freedman, S.B., et al., Pediatric myocarditis: emergency department clinical findings and diagnostic evaluation. Pediatrics, 2007. 120(6): p. 1278-85. 15. May, L.J., D.J. Patton, and D.S. Fruitman, The evolving approach to paediatric myocarditis: a review of the current literature. Cardiol Young, 2011. 21(3): p. 241-51. 16. Blauwet, L.A. and L.T. Cooper, Myocarditis. Prog Cardiovasc Dis, 2010. 52(4): p. 274-88. 17. Wasi, F. and J. Shuter, Primary bacterial infection of the myocardium. Front Biosci, 2003. 8: p. s228-31. 143 18. Higuchi, M.D., et al., Association of an increase in CD8+ T cells with the presence of Trypanosoma cruzi antigens in chronic, human, chagasic myocarditis. Am J Trop Med Hyg, 1997. 56(5): p. 485-9. 19. Schmunis, G.A., Prevention of transfusional Trypanosoma cruzi infection in Latin America. Mem Inst Oswaldo Cruz, 1999. 94 Suppl 1: p. 93-101. 20. Kuhl, U., et al., High prevalence of viral genomes and multiple viral infections in the myocardium of adults with "idiopathic" left ventricular dysfunction. Circulation, 2005. 111(7): p. 887-93. 21. Mahrholdt, H., et al., Presentation, patterns of myocardial damage, and clinical course of viral myocarditis. Circulation, 2006. 114(15): p. 1581-90. 22. Kindermann, I., et al., Update on myocarditis. J Am Coll Cardiol, 2012. 59(9): p. 779-92. 23. Matsumori, A., Hepatitis C virus infection and cardiomyopathies. Circ Res, 2005. 96(2): p. 144-7. 24. Maisch, B. and S. Pankuweit, Standard and etiology-directed evidence-based therapies in myocarditis: state of the art and future perspectives. Heart Fail Rev, 2012. 25. Grumbach, I.M., et al., Adenoviruses and enteroviruses as pathogens in myocarditis and dilated cardiomyopathy. Acta Cardiol, 1999. 54(2): p. 83-8. 26. Yoder, J.D., et al., The crystal structure of a coxsackievirus B3-RD variant and a refined 9-angstrom cryo-electron microscopy reconstruction of the virus complexed with decay-accelerating factor (DAF) provide a new footprint of DAF on the virus surface. J Virol, 2012. 86(23): p. 12571-81. 27. Liu, P.P. and J.W. Mason, Advances in the understanding of myocarditis. Circulation, 2001. 104(9): p. 1076-82. 28. Klingel, K. and R. Kandolf, The role of enterovirus replication in the development of acute and chronic heart muscle disease in different immunocompetent mouse strains. Scand J Infect Dis Suppl, 1993. 88: p. 79-85. 29. Huber, S.A., et al., Apoptosis in coxsackievirus B3-induced myocarditis and dilated cardiomyopathy. Ann N Y Acad Sci, 1999. 887: p. 181-90. 30. Chow, L.H., K.W. Beisel, and B.M. McManus, Enteroviral infection of mice with severe combined immunodeficiency. Evidence for direct viral pathogenesis of myocardial injury. Lab Invest, 1992. 66(1): p. 24-31. 31. Fuse, K., et al., Myeloid differentiation factor-88 plays a crucial role in the pathogenesis of Coxsackievirus B3-induced myocarditis and influences type I interferon production. Circulation, 2005. 112(15): p. 2276-85. 32. McManus, B.M., et al., Direct myocardial injury by enterovirus: a central role in the evolution of murine myocarditis. Clin Immunol Immunopathol, 1993. 68(2): p. 159-69. 33. Seko, Y., et al., Expression of cytokine mRNAs in murine hearts with acute myocarditis caused by coxsackievirus b3. J Pathol, 1997. 183(1): p. 105-8. 144 34. Kishimoto, C., et al., Role of MIP-2 in coxsackievirus B3 myocarditis. J Mol Cell Cardiol, 2000. 32(4): p. 631-8. 35. Li, J., et al., Collagen degradation in a murine myocarditis model: relevance of matrix metalloproteinase in association with inflammatory induction. Cardiovasc Res, 2002. 56(2): p. 235-47. 36. Medzhitov, R., P. Preston-Hurlburt, and C.A. Janeway, Jr., A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature, 1997. 388(6640): p. 394-7. 37. Zarember, K.A. and P.J. Godowski, Tissue expression of human Toll-like receptors and differential regulation of Toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokines. J Immunol, 2002. 168(2): p. 554-61. 38. Hardarson, H.S., et al., Toll-like receptor 3 is an essential component of the innate stress response in virus-induced cardiac injury. Am J Physiol Heart Circ Physiol, 2007. 292(1): p. H251-8. 39. Fairweather, D., et al., IL-12 receptor beta 1 and Toll-like receptor 4 increase IL-1 beta- and IL-18-associated myocarditis and coxsackievirus replication. J Immunol, 2003. 170(9): p. 4731-7. 40. Tomioka, N., et al., Effects of prednisolone on acute viral myocarditis in mice. J Am Coll Cardiol, 1986. 7(4): p. 868-72. 41. Godeny, E.K. and C.J. Gauntt, Murine natural killer cells limit coxsackievirus B3 replication. J Immunol, 1987. 139(3): p. 913-8. 42. Kishimoto, C., et al., Immunologic behavior of lymphocytes in experimental viral myocarditis: significance of T lymphocytes in the severity of myocarditis and silent myocarditis in BALB/c-nu/nu mice. Circulation, 1985. 71(6): p. 1247-54. 43. Seko, Y., et al., Expression of major histocompatibility complex class I antigen in murine ventricular myocytes infected with Coxsackievirus B3. Circ Res, 1990. 67(2): p. 360-7. 44. Seko, Y., et al., Expression of intercellular adhesion molecule-1 in murine hearts with acute myocarditis caused by coxsackievirus B3. J Clin Invest, 1993. 91(4): p. 1327-36. 45. Godeny, E.K. and C.J. Gauntt, Involvement of natural killer cells in coxsackievirus B3-induced murine myocarditis. J Immunol, 1986. 137(5): p. 1695-702. 46. Koike, H., et al., Reduction of viral myocarditis in mice lacking perforin. Res Commun Mol Pathol Pharmacol, 2001. 110(3-4): p. 229-37. 47. Seko, Y., et al., Expression of costimulatory molecules B7-1, B7-2, and CD40 in the heart of patients with acute myocarditis and dilated cardiomyopathy. Circulation, 1998. 97(7): p. 637-9. 48. Rutschow, S., et al., Myocardial proteases and matrix remodeling in inflammatory heart disease. Cardiovasc Res, 2006. 69(3): p. 646-56. 145 49. Huber, S.A., A.M. Feldman, and D. Sartini, Coxsackievirus B3 induces T regulatory cells, which inhibit cardiomyopathy in tumor necrosis factor-alpha transgenic mice. Circ Res, 2006. 99(10): p. 1109-16. 50. Seko, Y., et al., Expression of tumour necrosis factor (TNF) receptor/ligand superfamily co-stimulatory molecules CD40, CD30L, CD27L, and OX40L in murine hearts with chronic ongoing myocarditis caused by coxsackie virus B3. J Pathol, 1999. 188(4): p. 423-30. 51. Huber, S.A., A. Mortensen, and G. Moulton, Modulation of cytokine expression by CD4+ T cells during coxsackievirus B3 infections of BALB/c mice initiated by cells expressing the gamma delta + T-cell receptor. J Virol, 1996. 70(5): p. 3039-44. 52. Shioi, T., A. Matsumori, and S. Sasayama, Persistent expression of cytokine in the chronic stage of viral myocarditis in mice. Circulation, 1996. 94(11): p. 2930-7. 53. Lindner, D., et al., Protective Function of STAT3 in CVB3-Induced Myocarditis. Cardiol Res Pract, 2012. 2012: p. 437623. 54. Wang, Y.X., et al., Antiviral and myocyte protective effects of murine interferon-beta and -{alpha}2 in coxsackievirus B3-induced myocarditis and epicarditis in Balb/c mice. Am J Physiol Heart Circ Physiol, 2007. 293(1): p. H69-76. 55. Li, Y., et al., Enteroviral capsid protein VP1 is present in myocardial tissues from some patients with myocarditis or dilated cardiomyopathy. Circulation, 2000. 101(3): p. 231-4. 56. Page-McCaw, A., A.J. Ewald, and Z. Werb, Matrix metalloproteinases and the regulation of tissue remodelling. Nat Rev Mol Cell Biol, 2007. 8(3): p. 221-33. 57. Kim, H.S., et al., alpha-Lipoic acid attenuates coxsackievirus B3-induced ectopic calcification in heart, pancreas, and lung. Biochem Biophys Res Commun, 2013. 432(2): p. 378-83. 58. Chow, L.H., C.J. Gauntt, and B.M. McManus, Differential effects of myocarditic variants of Coxsackievirus B3 in inbred mice. A pathologic characterization of heart tissue damage. Lab Invest, 1991. 64(1): p. 55-64. 59. Klingel, K., et al., Ongoing enterovirus-induced myocarditis is associated with persistent heart muscle infection: quantitative analysis of virus replication, tissue damage, and inflammation. Proc Natl Acad Sci U S A, 1992. 89(1): p. 314-8. 60. Gluck, B., et al., Persistent expression of cytokines in the chronic stage of CVB3-induced myocarditis in NMRI mice. J Mol Cell Cardiol, 2001. 33(9): p. 1615-26. 61. Kyu, B., et al., Cardiac persistence of cardioviral RNA detected by polymerase chain reaction in a murine model of dilated cardiomyopathy. Circulation, 1992. 86(2): p. 522-30. 62. Kuhl, U., et al., Interferon-beta treatment eliminates cardiotropic viruses and improves left ventricular function in patients with myocardial persistence of viral genomes and left ventricular dysfunction. Circulation, 2003. 107(22): p. 2793-8. 146 63. Khatib, R., M.P. Reyes, and F.E. Smith, Enhancement of Coxsackievirus B3 replication in Vero cells by indomethacin. J Infect Dis, 1990. 162(4): p. 997-8. 64. Costanzo-Nordin, M.R., et al., A nonsteroid anti-inflammatory drug exacerbates Coxsackie B3 murine myocarditis. J Am Coll Cardiol, 1985. 6(5): p. 1078-82. 65. Wojnicz, R., et al., Randomized, placebo-controlled study for immunosuppressive treatment of inflammatory dilated cardiomyopathy: two-year follow-up results. Circulation, 2001. 104(1): p. 39-45. 66. Frustaci, A., M.A. Russo, and C. Chimenti, Randomized study on the efficacy of immunosuppressive therapy in patients with virus-negative inflammatory cardiomyopathy: the TIMIC study. Eur Heart J, 2009. 30(16): p. 1995-2002. 67. Amabile, N., et al., Outcome of acute fulminant myocarditis in children. Heart, 2006. 92(9): p. 1269-73. 68. Drucker, N.A., et al., Gamma-globulin treatment of acute myocarditis in the pediatric population. Circulation, 1994. 89(1): p. 252-7. 69. McNamara, D.M., et al., Controlled trial of intravenous immune globulin in recent-onset dilated cardiomyopathy. Circulation, 2001. 103(18): p. 2254-9. 70. Marchant, D., et al., The impact of CVB3 infection on host cell biology. Curr Top Microbiol Immunol, 2008. 323: p. 177-98. 71. Dalldorf, G. and G.M. Sickles, An Unidentified, Filtrable Agent Isolated From the Feces of Children With Paralysis. Science, 1948. 108(2794): p. 61-2. 72. Landry, M.L., et al., Use of guinea pig embryo cell cultures for isolation and propagation of group A coxsackieviruses. J Clin Microbiol, 1981. 13(3): p. 588-93. 73. He, W., et al., Complete genome sequence of a coxsackievirus B3 isolated from a Sichuan snub-nosed monkey. J Virol, 2012. 86(23): p. 13134-5. 74. Crowell, R.L. and B.J. Landau, A short history and introductory background on the coxsackieviruses of group B. Curr Top Microbiol Immunol, 1997. 223: p. 1-11. 75. Kravis, L.P., et al., Herpangina; clinical and laboratory aspects of an outbreak caused by group A Coxsackie viruses. Pediatrics, 1953. 11(2): p. 113-9. 76. Born, W., [Hand-foot-mouth (Coxsackie A) disease]. Hautarzt, 1968. 19(6): p. 276-7. 77. Thordarson, O.T., B. Sigurdsson, and H. Grimsson, Isolation of Coxsackie virus from patients with epidemic pleurodynia. J Am Med Assoc, 1953. 152(9): p. 814-5. 78. Khetsuriani, N., et al., Enterovirus surveillance--United States, 1970-2005. MMWR Surveill Summ, 2006. 55(8): p. 1-20. 79. Verma, N.A., et al., Outbreak of life-threatening coxsackievirus B1 myocarditis in neonates. Clin Infect Dis, 2009. 49(5): p. 759-63. 147 80. Heim, A., et al., Antiviral activity of WIN 54954 in coxsackievirus B2 carrier state infected human myocardial fibroblasts. Antiviral Res, 1998. 37(1): p. 47-56. 81. Lee, Y.T., et al., Images in cardiovascular medicine. Disruption of dystrophin in acute fulminant coxsackieviral B4 infection. Circulation, 2006. 113(6): p. e76-7. 82. Hu, Y.F., et al., Full genome sequence of a novel coxsackievirus B5 strain isolated from neurological hand, foot, and mouth disease patients in China. J Virol, 2012. 86(20): p. 11408-9. 83. Peng, T., et al., Characterization of enterovirus isolates from patients with heart muscle disease in a selenium-deficient area of China. J Clin Microbiol, 2000. 38(10): p. 3538-43. 84. Dunn, J.J., et al., Genomic determinants of cardiovirulence in coxsackievirus B3 clinical isolates: localization to the 5' nontranslated region. J Virol, 2000. 74(10): p. 4787-94. 85. Leong, L.E.C., C.T. Cornell, and B.L. Semler, Processing determinants and functions of cleavage products of picornavirus polyproteins., in Molecular Biology Of Picornaviruses, B.L. Semler and E. Wimmer, Editors. 2002. p. 187-197. 86. Bergelson, J.M., et al., Coxsackievirus B3 adapted to growth in RD cells binds to decay-accelerating factor (CD55). J Virol, 1995. 69(3): p. 1903-6. 87. Muckelbauer, J.K., et al., Structure determination of coxsackievirus B3 to 3.5 A resolution. Acta Crystallogr D Biol Crystallogr, 1995. 51(Pt 6): p. 871-87. 88. He, Y., et al., Interaction of coxsackievirus B3 with the full length coxsackievirus-adenovirus receptor. Nat Struct Biol, 2001. 8(10): p. 874-8. 89. Bell, Y.C., B.L. Semler, and E. Ehrenfeld, Requirements for RNA replication of a poliovirus replicon by coxsackievirus B3 RNA polymerase. J Virol, 1999. 73(11): p. 9413-21. 90. Chau, D.H., et al., Coxsackievirus B3 proteases 2A and 3C induce apoptotic cell death through mitochondrial injury and cleavage of eIF4GI but not DAP5/p97/NAT1. Apoptosis, 2007. 12(3): p. 513-24. 91. De Palma, A.M., et al., The thiazolobenzimidazole TBZE-029 inhibits enterovirus replication by targeting a short region immediately downstream from motif C in the nonstructural protein 2C. J Virol, 2008. 82(10): p. 4720-30. 92. Pathak, H.B., et al., Picornavirus genome replication: assembly and organization of the VPg uridylylation ribonucleoprotein (initiation) complex. J Biol Chem, 2007. 282(22): p. 16202-13. 93. Cornell, C.T., et al., Coxsackievirus B3 proteins directionally complement each other to downregulate surface major histocompatibility complex class I. J Virol, 2007. 81(13): p. 6785-97. 94. van Kuppeveld, F.J., et al., Coxsackievirus protein 2B modifies endoplasmic reticulum membrane and plasma membrane permeability and facilitates virus release. EMBO J, 1997. 16(12): p. 3519-32. 148 95. Gruez, A., et al., The crystal structure of coxsackievirus B3 RNA-dependent RNA polymerase in complex with its protein primer VPg confirms the existence of a second VPg binding site on Picornaviridae polymerases. J Virol, 2008. 82(19): p. 9577-90. 96. Cornell, C.T., et al., Inhibition of protein trafficking by coxsackievirus b3: multiple viral proteins target a single organelle. J Virol, 2006. 80(13): p. 6637-47. 97. Bailey, J.M. and W.E. Tapprich, Structure of the 5' nontranslated region of the coxsackievirus b3 genome: Chemical modification and comparative sequence analysis. J Virol, 2007. 81(2): p. 650-68. 98. Gamarnik, A.V. and R. Andino, Switch from translation to RNA replication in a positive-stranded RNA virus. Genes Dev, 1998. 12(15): p. 2293-304. 99. Cheung, P., et al., Specific interaction of HeLa cell proteins with coxsackievirus B3 3'UTR: La autoantigen binds the 3' and 5'UTR independently of the poly(A) tail. Cell Microbiol, 2007. 9(7): p. 1705-15. 100. Sean, P., J.H. Nguyen, and B.L. Semler, Altered interactions between stem-loop IV within the 5' noncoding region of coxsackievirus RNA and poly(rC) binding protein 2: effects on IRES-mediated translation and viral infectivity. Virology, 2009. 389(1-2): p. 45-58. 101. Ray, P.S. and S. Das, La autoantigen is required for the internal ribosome entry site-mediated translation of Coxsackievirus B3 RNA. Nucleic Acids Res, 2002. 30(20): p. 4500-8. 102. Verma, B., S. Bhattacharyya, and S. Das, Polypyrimidine tract-binding protein interacts with coxsackievirus B3 RNA and influences its translation. J Gen Virol, 2010. 91(Pt 5): p. 1245-55. 103. Ye, X., et al., Targeted delivery of mutant tolerant anti-coxsackievirus artificial microRNAs using folate conjugated bacteriophage Phi29 pRNA. PLoS One, 2011. 6(6): p. e21215. 104. Melchers, W.J., et al., Kissing of the two predominant hairpin loops in the coxsackie B virus 3' untranslated region is the essential structural feature of the origin of replication required for negative-strand RNA synthesis. J Virol, 1997. 71(1): p. 686-96. 105. Wong, J., et al., Cytoplasmic redistribution and cleavage of AUF1 during coxsackievirus infection enhance the stability of its viral genome. FASEB J, 2013. 27(7): p. 2777-87. 106. Wang, Z. and M. Kiledjian, The poly(A)-binding protein and an mRNA stability protein jointly regulate an endoribonuclease activity. Mol Cell Biol, 2000. 20(17): p. 6334-41. 107. Sean, P. and B.L. Semler, Coxsackievirus B RNA replication: lessons from poliovirus. Curr Top Microbiol Immunol, 2008. 323: p. 89-121. 108. Carson, S.D., et al., Variations of coxsackievirus B3 capsid primary structure, ligands, and stability are selected for in a coxsackievirus and adenovirus receptor-limited environment. J Virol, 2011. 85(7): p. 3306-14. 149 109. Carson, S.D., et al., Expression of the coxsackievirus and adenovirus receptor in cultured human umbilical vein endothelial cells: regulation in response to cell density. J Virol, 1999. 73(8): p. 7077-9. 110. Chung, S.K., et al., Internalization and trafficking mechanisms of coxsackievirus B3 in HeLa cells. Virology, 2005. 333(1): p. 31-40. 111. Pinkert, S., et al., Virus-host coevolution in a persistently coxsackievirus B3-infected cardiomyocyte cell line. J Virol, 2011. 85(24): p. 13409-19. 112. Selinka, H.C., et al., Comparative analysis of two coxsackievirus B3 strains: putative influence of virus-receptor interactions on pathogenesis. J Med Virol, 2002. 67(2): p. 224-33. 113. Hafenstein, S., et al., Interaction of decay-accelerating factor with coxsackievirus B3. J Virol, 2007. 81(23): p. 12927-35. 114. Shafren, D.R., et al., Coxsackieviruses B1, B3, and B5 use decay accelerating factor as a receptor for cell attachment. J Virol, 1995. 69(6): p. 3873-7. 115. Lukacik, P., et al., Complement regulation at the molecular level: the structure of decay-accelerating factor. Proc Natl Acad Sci U S A, 2004. 101(5): p. 1279-84. 116. Brodbeck, W.G., et al., Structure/function studies of human decay-accelerating factor. Immunology, 2000. 101(1): p. 104-11. 117. Nicholson-Weller, A. and C.E. Wang, Structure and function of decay accelerating factor CD55. J Lab Clin Med, 1994. 123(4): p. 485-91. 118. Davitz, M.A., Decay-accelerating factor (DAF): a review of its function and structure. Acta Med Scand Suppl, 1987. 715: p. 111-21. 119. Liu, P., et al., The tyrosine kinase p56lck is essential in coxsackievirus B3-mediated heart disease. Nat Med, 2000. 6(4): p. 429-34. 120. Cohen, C.J., et al., The coxsackievirus and adenovirus receptor is a transmembrane component of the tight junction. Proc Natl Acad Sci U S A, 2001. 98(26): p. 15191-6. 121. Wang, X. and J.M. Bergelson, Coxsackievirus and adenovirus receptor cytoplasmic and transmembrane domains are not essential for coxsackievirus and adenovirus infection. J Virol, 1999. 73(3): p. 2559-62. 122. Coyne, C.B. and J.M. Bergelson, Virus-induced Abl and Fyn kinase signals permit coxsackievirus entry through epithelial tight junctions. Cell, 2006. 124(1): p. 119-31. 123. Patel, K.P., C.B. Coyne, and J.M. Bergelson, Dynamin- and lipid raft-dependent entry of decay-accelerating factor (DAF)-binding and non-DAF-binding coxsackieviruses into nonpolarized cells. J Virol, 2009. 83(21): p. 11064-77. 124. Tomko, R.P., R. Xu, and L. Philipson, HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proc Natl Acad Sci U S A, 1997. 94(7): p. 3352-6. 150 125. Bergelson, J.M., et al., The murine CAR homolog is a receptor for coxsackie B viruses and adenoviruses. J Virol, 1998. 72(1): p. 415-9. 126. Walters, R.W., et al., Basolateral localization of fiber receptors limits adenovirus infection from the apical surface of airway epithelia. J Biol Chem, 1999. 274(15): p. 10219-26. 127. Carson, S.D., Receptor for the group B coxsackieviruses and adenoviruses: CAR. Rev Med Virol, 2001. 11(4): p. 219-26. 128. Cheung, P.K., et al., Specific interactions of mouse organ proteins with the 5'untranslated region of coxsackievirus B3: potential determinants of viral tissue tropism. J Med Virol, 2005. 77(3): p. 414-24. 129. Yang, D., et al., In vitro mutational and inhibitory analysis of the cis-acting translational elements within the 5' untranslated region of coxsackievirus B3: potential targets for antiviral action of antisense oligomers. Virology, 1997. 228(1): p. 63-73. 130. Wimmer, E., C.U. Hellen, and X. Cao, Genetics of poliovirus. Annu Rev Genet, 1993. 27: p. 353-436. 131. Paul, A.V., et al., Protein-primed RNA synthesis by purified poliovirus RNA polymerase. Nature, 1998. 393(6682): p. 280-4. 132. Parsley, T.B., et al., Poly (rC) binding protein 2 forms a ternary complex with the 5'-terminal sequences of poliovirus RNA and the viral 3CD proteinase. RNA, 1997. 3(10): p. 1124-34. 133. Teterina, N.L., et al., Requirements for assembly of poliovirus replication complexes and negative-strand RNA synthesis. J Virol, 2001. 75(8): p. 3841-50. 134. Lyons, T., et al., Poliovirus 5'-terminal cloverleaf RNA is required in cis for VPg uridylylation and the initiation of negative-strand RNA synthesis. J Virol, 2001. 75(22): p. 10696-708. 135. van Ooij, M.J., et al., Structural and functional characterization of the coxsackievirus B3 CRE(2C): role of CRE(2C) in negative- and positive-strand RNA synthesis. J Gen Virol, 2006. 87(Pt 1): p. 103-13. 136. Flanegan, J.B. and D. Baltimore, Poliovirus-specific primer-dependent RNA polymerase able to copy poly(A). Proc Natl Acad Sci U S A, 1977. 74(9): p. 3677-80. 137. Yogo, Y. and E. Wimmer, Poly (A) and poly (U) in poliovirus double stranded RNA. Nat New Biol, 1973. 242(119): p. 171-4. 138. Nomoto, A., et al., The location of the polio genome protein in viral RNAs and its implication for RNA synthesis. Nature, 1977. 268(5617): p. 208-13. 139. Pettersson, R.F., V. Ambros, and D. Baltimore, Identification of a protein linked to nascent poliovirus RNA and to the polyuridylic acid of negative-strand RNA. J Virol, 1978. 27(2): p. 357-65. 140. Andino, R., G.E. Rieckhof, and D. Baltimore, A functional ribonucleoprotein complex forms around the 5' end of poliovirus RNA. Cell, 1990. 63(2): p. 369-80. 151 141. Sharma, N., B.J. O'Donnell, and J.B. Flanegan, 3'-Terminal sequence in poliovirus negative-strand templates is the primary cis-acting element required for VPgpUpU-primed positive-strand initiation. J Virol, 2005. 79(6): p. 3565-77. 142. Goodfellow, I.G., D. Kerrigan, and D.J. Evans, Structure and function analysis of the poliovirus cis-acting replication element (CRE). RNA, 2003. 9(1): p. 124-37. 143. Baltimore, D., M. Girard, and J.E. Darnell, Aspects of the synthesis of poliovirus RNA and the formation of virus particles. Virology, 1966. 29(2): p. 179-89. 144. Carthy, C.M., et al., Bcl-2 and Bcl-xL overexpression inhibits cytochrome c release, activation of multiple caspases, and virus release following coxsackievirus B3 infection. Virology, 2003. 313(1): p. 147-57. 145. Luo, H., et al., Coxsackievirus B3 replication is reduced by inhibition of the extracellular signal-regulated kinase (ERK) signaling pathway. J Virol, 2002. 76(7): p. 3365-73. 146. Luo, H., et al., Proteasome inhibition reduces coxsackievirus B3 replication in murine cardiomyocytes. Am J Pathol, 2003. 163(2): p. 381-5. 147. Lamphear, B.J., et al., Mapping the cleavage site in protein synthesis initiation factor eIF-4 gamma of the 2A proteases from human Coxsackievirus and rhinovirus. J Biol Chem, 1993. 268(26): p. 19200-3. 148. Kerekatte, V., et al., Cleavage of Poly(A)-binding protein by coxsackievirus 2A protease in vitro and in vivo: another mechanism for host protein synthesis shutoff? J Virol, 1999. 73(1): p. 709-17. 149. Borman, A.M., et al., elF4G and its proteolytic cleavage products: effect on initiation of protein synthesis from capped, uncapped, and IRES-containing mRNAs. RNA, 1997. 3(2): p. 186-96. 150. Zhang, H.M., et al., Coxsackievirus B3 infection activates the unfolded protein response and induces apoptosis through downregulation of p58IPK and activation of CHOP and SREBP1. J Virol, 2010. 84(17): p. 8446-59. 151. Kim, S.M., et al., Coxsackievirus B3 infection induces cyr61 activation via JNK to mediate cell death. J Virol, 2004. 78(24): p. 13479-88. 152. Si, X., et al., Stress-activated protein kinases are involved in coxsackievirus B3 viral progeny release. J Virol, 2005. 79(22): p. 13875-81. 153. Calandria, C., et al., Individual expression of poliovirus 2Apro and 3Cpro induces activation of caspase-3 and PARP cleavage in HeLa cells. Virus Res, 2004. 104(1): p. 39-49. 154. Carthy, C.M., et al., Caspase activation and specific cleavage of substrates after coxsackievirus B3-induced cytopathic effect in HeLa cells. J Virol, 1998. 72(9): p. 7669-75. 155. Yuan, J.P., et al., Coxsackievirus B3-induced apoptosis and caspase-3. Cell Res, 2003. 13(3): p. 203-9. 152 156. Yuan, J., et al., Inhibition of glycogen synthase kinase 3beta suppresses coxsackievirus-induced cytopathic effect and apoptosis via stabilization of beta-catenin. Cell Death Differ, 2005. 12(8): p. 1097-106. 157. Zhang, H.M., et al., Nip21 gene expression reduces coxsackievirus B3 replication by promoting apoptotic cell death via a mitochondria-dependent pathway. Circ Res, 2002. 90(12): p. 1251-8. 158. Marchant, D., et al., ERK MAP kinase-activated Arf6 trafficking directs coxsackievirus type B3 into an unproductive compartment during virus host-cell entry. J Gen Virol, 2009. 90(Pt 4): p. 854-62. 159. Huber, M., et al., Cleavage of RasGAP and phosphorylation of mitogen-activated protein kinase in the course of coxsackievirus B3 replication. J Virol, 1999. 73(5): p. 3587-94. 160. Schmeisser, H., et al., Identification of alpha interferon-induced genes associated with antiviral activity in Daudi cells and characterization of IFIT3 as a novel antiviral gene. J Virol, 2010. 84(20): p. 10671-80. 161. Liu, X.Y., et al., IFN-induced TPR protein IFIT3 potentiates antiviral signaling by bridging MAVS and TBK1. J Immunol, 2011. 187(5): p. 2559-68. 162. Mukherjee, A., et al., The coxsackievirus B 3C protease cleaves MAVS and TRIF to attenuate host type I interferon and apoptotic signaling. PLoS Pathog, 2011. 7(3): p. e1001311. 163. Becker, W., Emerging role of DYRK family protein kinases as regulators of protein stability in cell cycle control. Cell Cycle, 2012. 11(18): p. 3389-94. 164. Luo, H., et al., Ubiquitin-dependent proteolysis of cyclin D1 is associated with coxsackievirus-induced cell growth arrest. J Virol, 2003. 77(1): p. 1-9. 165. Feuer, R., et al., Cell cycle status affects coxsackievirus replication, persistence, and reactivation in vitro. J Virol, 2002. 76(9): p. 4430-40. 166. Esfandiarei, M., et al., Protein kinase B/Akt regulates coxsackievirus B3 replication through a mechanism which is not caspase dependent. J Virol, 2004. 78(8): p. 4289-98. 167. Esfandiarei, M., et al., Novel role for integrin-linked kinase in modulation of coxsackievirus B3 replication and virus-induced cardiomyocyte injury. Circ Res, 2006. 99(4): p. 354-61. 168. Liu, Z., et al., Focal adhesion kinase mediates the interferon-gamma-inducible GTPase-induced phosphatidylinositol 3-kinase/Akt survival pathway and further initiates a positive feedback loop of NF-kappaB activation. Cell Microbiol, 2008. 10(9): p. 1787-800. 169. Si, X., et al., Ubiquitination is required for effective replication of coxsackievirus B3. PLoS One, 2008. 3(7): p. e2585. 170. Lin, Y.W., S.M. Chuang, and J.L. Yang, ERK1/2 achieves sustained activation by stimulating MAPK phosphatase-1 degradation via the ubiquitin-proteasome pathway. J Biol Chem, 2003. 278(24): p. 21534-41. 153 171. Wong, J., et al., Inhibition of the extracellular signal-regulated kinase signaling pathway is correlated with proteasome inhibitor suppression of coxsackievirus replication. Biochem Biophys Res Commun, 2007. 358(3): p. 903-7. 172. Gao, G., et al., Proteasome inhibition attenuates coxsackievirus-induced myocardial damage in mice. Am J Physiol Heart Circ Physiol, 2008. 295(1): p. H401-8. 173. Wong, J., et al., Autophagosome supports coxsackievirus B3 replication in host cells. J Virol, 2008. 82(18): p. 9143-53. 174. Lee, R.C., R.L. Feinbaum, and V. Ambros, The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell, 1993. 75(5): p. 843-54. 175. Reinhart, B.J., et al., The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature, 2000. 403(6772): p. 901-6. 176. Kozomara, A. and S. Griffiths-Jones, miRBase: integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res, 2011. 39(Database issue): p. D152-7. 177. Lee, C.T., T. Risom, and W.M. Strauss, Evolutionary conservation of microRNA regulatory circuits: an examination of microRNA gene complexity and conserved microRNA-target interactions through metazoan phylogeny. DNA Cell Biol, 2007. 26(4): p. 209-18. 178. Cullen, B.R., Transcription and processing of human microRNA precursors. Mol Cell, 2004. 16(6): p. 861-5. 179. Aukerman, M.J. and H. Sakai, Regulation of flowering time and floral organ identity by a MicroRNA and its APETALA2-like target genes. Plant Cell, 2003. 15(11): p. 2730-41. 180. Tam, W., Identification and characterization of human BIC, a gene on chromosome 21 that encodes a noncoding RNA. Gene, 2001. 274(1-2): p. 157-67. 181. Chien, C.H., et al., Identifying transcriptional start sites of human microRNAs based on high-throughput sequencing data. Nucleic Acids Res, 2011. 39(21): p. 9345-56. 182. Lee, Y., et al., The nuclear RNase III Drosha initiates microRNA processing. Nature, 2003. 425(6956): p. 415-9. 183. Denli, A.M., et al., Processing of primary microRNAs by the Microprocessor complex. Nature, 2004. 432(7014): p. 231-5. 184. Yi, R., et al., Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev, 2003. 17(24): p. 3011-6. 185. Bohnsack, M.T., K. Czaplinski, and D. Gorlich, Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA, 2004. 10(2): p. 185-91. 186. Lund, E., et al., Nuclear export of microRNA precursors. Science, 2004. 303(5654): p. 95-8. 187. Kim, V.N., MicroRNA precursors in motion: exportin-5 mediates their nuclear export. Trends Cell Biol, 2004. 14(4): p. 156-9. 154 188. Hutvagner, G., et al., A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science, 2001. 293(5531): p. 834-8. 189. Provost, P., et al., Ribonuclease activity and RNA binding of recombinant human Dicer. EMBO J, 2002. 21(21): p. 5864-74. 190. Grishok, A., et al., Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell, 2001. 106(1): p. 23-34. 191. Hammond, S.M., et al., Argonaute2, a link between genetic and biochemical analyses of RNAi. Science, 2001. 293(5532): p. 1146-50. 192. Hutvagner, G. and P.D. Zamore, A microRNA in a multiple-turnover RNAi enzyme complex. Science, 2002. 297(5589): p. 2056-60. 193. Khvorova, A., A. Reynolds, and S.D. Jayasena, Functional siRNAs and miRNAs exhibit strand bias. Cell, 2003. 115(2): p. 209-16. 194. Chendrimada, T.P., et al., TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature, 2005. 436(7051): p. 740-4. 195. Lee, Y., et al., The role of PACT in the RNA silencing pathway. EMBO J, 2006. 25(3): p. 522-32. 196. Ruby, J.G., C.H. Jan, and D.P. Bartel, Intronic microRNA precursors that bypass Drosha processing. Nature, 2007. 448(7149): p. 83-6. 197. Cheloufi, S., et al., A dicer-independent miRNA biogenesis pathway that requires Ago catalysis. Nature, 2010. 465(7298): p. 584-9. 198. Babiarz, J.E., et al., Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs. Genes Dev, 2008. 22(20): p. 2773-85. 199. Luciano, D.J., et al., RNA editing of a miRNA precursor. RNA, 2004. 10(8): p. 1174-7. 200. Blow, M.J., et al., RNA editing of human microRNAs. Genome Biol, 2006. 7(4): p. R27. 201. Landgraf, P., et al., A mammalian microRNA expression atlas based on small RNA library sequencing. Cell, 2007. 129(7): p. 1401-14. 202. Zhang, X. and Y. Zeng, Regulation of mammalian microRNA expression. J Cardiovasc Transl Res, 2010. 3(3): p. 197-203. 203. Zhao, Y., E. Samal, and D. Srivastava, Serum response factor regulates a muscle-specific microRNA that targets Hand2 during cardiogenesis. Nature, 2005. 436(7048): p. 214-20. 204. Rao, P.K., et al., Myogenic factors that regulate expression of muscle-specific microRNAs. Proc Natl Acad Sci U S A, 2006. 103(23): p. 8721-6. 205. Loffler, D., et al., Interleukin-6 dependent survival of multiple myeloma cells involves the Stat3-mediated induction of microRNA-21 through a highly conserved enhancer. Blood, 2007. 110(4): p. 1330-3. 206. Velu, C.S., A.M. Baktula, and H.L. Grimes, Gfi1 regulates miR-21 and miR-196b to control myelopoiesis. Blood, 2009. 113(19): p. 4720-8. 155 207. Ribas, J., et al., miR-21: an androgen receptor-regulated microRNA that promotes hormone-dependent and hormone-independent prostate cancer growth. Cancer Res, 2009. 69(18): p. 7165-9. 208. Fujita, S., et al., miR-21 Gene expression triggered by AP-1 is sustained through a double-negative feedback mechanism. J Mol Biol, 2008. 378(3): p. 492-504. 209. Singh, S.K., et al., REST maintains self-renewal and pluripotency of embryonic stem cells. Nature, 2008. 453(7192): p. 223-7. 210. Harris, T.A., et al., Ets-1 and Ets-2 regulate the expression of microRNA-126 in endothelial cells. Arterioscler Thromb Vasc Biol, 2010. 30(10): p. 1990-7. 211. Bar, M., et al., MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries. Stem Cells, 2008. 26(10): p. 2496-505. 212. Paranjape, S.M., R.T. Kamakaka, and J.T. Kadonaga, Role of chromatin structure in the regulation of transcription by RNA polymerase II. Annu Rev Biochem, 1994. 63: p. 265-97. 213. Hartzog, G.A. and J.W. Tamkun, A new role for histone tail modifications in transcription elongation. Genes Dev, 2007. 21(24): p. 3209-13. 214. Sato, F., et al., MicroRNAs and epigenetics. FEBS J, 2011. 278(10): p. 1598-609. 215. Feng, Y., et al., Drosha processing controls the specificity and efficiency of global microRNA expression. Biochim Biophys Acta, 2011. 1809(11-12): p. 700-7. 216. Zeng, Y. and B.R. Cullen, Efficient processing of primary microRNA hairpins by Drosha requires flanking nonstructured RNA sequences. J Biol Chem, 2005. 280(30): p. 27595-603. 217. Yi, R., et al., Overexpression of exportin 5 enhances RNA interference mediated by short hairpin RNAs and microRNAs. RNA, 2005. 11(2): p. 220-6. 218. Zhang, X. and Y. Zeng, The terminal loop region controls microRNA processing by Drosha and Dicer. Nucleic Acids Res, 2010. 38(21): p. 7689-97. 219. Frank, F., N. Sonenberg, and B. Nagar, Structural basis for 5'-nucleotide base-specific recognition of guide RNA by human AGO2. Nature, 2010. 465(7299): p. 818-22. 220. Zhang, X., P.R. Graves, and Y. Zeng, Stable Argonaute2 overexpression differentially regulates microRNA production. Biochim Biophys Acta, 2009. 1789(2): p. 153-9. 221. Heo, I., et al., Lin28 mediates the terminal uridylation of let-7 precursor MicroRNA. Mol Cell, 2008. 32(2): p. 276-84. 222. Newman, M.A., J.M. Thomson, and S.M. Hammond, Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing. RNA, 2008. 14(8): p. 1539-49. 223. Viswanathan, S.R., G.Q. Daley, and R.I. Gregory, Selective blockade of microRNA processing by Lin28. Science, 2008. 320(5872): p. 97-100. 224. Nam, Y., et al., Molecular basis for interaction of let-7 microRNAs with Lin28. Cell, 2011. 147(5): p. 1080-91. 156 225. Piskounova, E., et al., Lin28A and Lin28B inhibit let-7 microRNA biogenesis by distinct mechanisms. Cell, 2011. 147(5): p. 1066-79. 226. Guil, S. and J.F. Caceres, The multifunctional RNA-binding protein hnRNP A1 is required for processing of miR-18a. Nat Struct Mol Biol, 2007. 14(7): p. 591-6. 227. Ruggiero, T., et al., LPS induces KH-type splicing regulatory protein-dependent processing of microRNA-155 precursors in macrophages. FASEB J, 2009. 23(9): p. 2898-908. 228. Fukuda, T., et al., DEAD-box RNA helicase subunits of the Drosha complex are required for processing of rRNA and a subset of microRNAs. Nat Cell Biol, 2007. 9(5): p. 604-11. 229. Davis, B.N., et al., SMAD proteins control DROSHA-mediated microRNA maturation. Nature, 2008. 454(7200): p. 56-61. 230. Suzuki, H.I., et al., Modulation of microRNA processing by p53. Nature, 2009. 460(7254): p. 529-33. 231. Yamagata, K., et al., Maturation of microRNA is hormonally regulated by a nuclear receptor. Mol Cell, 2009. 36(2): p. 340-7. 232. Gruber, J.J., et al., Ars2 links the nuclear cap-binding complex to RNA interference and cell proliferation. Cell, 2009. 138(2): p. 328-39. 233. Wu, H., et al., A splicing-independent function of SF2/ASF in microRNA processing. Mol Cell, 2010. 38(1): p. 67-77. 234. Wang, J., et al., TransmiR: a transcription factor-microRNA regulation database. Nucleic Acids Res, 2010. 38(Database issue): p. D119-22. 235. Li, Y. and K.V. Kowdley, MicroRNAs in common human diseases. Genomics Proteomics Bioinformatics, 2012. 10(5): p. 246-53. 236. Park, C.Y., Y.S. Choi, and M.T. McManus, Analysis of microRNA knockouts in mice. Hum Mol Genet, 2010. 19(R2): p. R169-75. 237. Zhao, Y., et al., Dysregulation of cardiogenesis, cardiac conduction, and cell cycle in mice lacking miRNA-1-2. Cell, 2007. 129(2): p. 303-17. 238. Saxena, A. and C.J. Tabin, miRNA-processing enzyme Dicer is necessary for cardiac outflow tract alignment and chamber septation. Proc Natl Acad Sci U S A, 2010. 107(1): p. 87-91. 239. Chen, J.F., et al., Targeted deletion of Dicer in the heart leads to dilated cardiomyopathy and heart failure. Proc Natl Acad Sci U S A, 2008. 105(6): p. 2111-6. 240. Rao, P.K., et al., Loss of cardiac microRNA-mediated regulation leads to dilated cardiomyopathy and heart failure. Circ Res, 2009. 105(6): p. 585-94. 241. da Costa Martins, P.A., et al., Conditional dicer gene deletion in the postnatal myocardium provokes spontaneous cardiac remodeling. Circulation, 2008. 118(15): p. 1567-76. 242. Ivey, K.N., et al., MicroRNA regulation of cell lineages in mouse and human embryonic stem cells. Cell Stem Cell, 2008. 2(3): p. 219-29. 157 243. Liu, N., et al., microRNA-133a regulates cardiomyocyte proliferation and suppresses smooth muscle gene expression in the heart. Genes Dev, 2008. 22(23): p. 3242-54. 244. Porrello, E.R., et al., MiR-15 family regulates postnatal mitotic arrest of cardiomyocytes. Circ Res, 2011. 109(6): p. 670-9. 245. Chinchilla, A., et al., MicroRNA profiling during mouse ventricular maturation: a role for miR-27 modulating Mef2c expression. Cardiovasc Res, 2011. 89(1): p. 98-108. 246. Wang, J., et al., MicroRNA-125b/Lin28 pathway contributes to the mesendodermal fate decision of embryonic stem cells. Stem Cells Dev, 2012. 21(9): p. 1524-37. 247. Deacon, D.C., et al., The miR-143-adducin3 pathway is essential for cardiac chamber morphogenesis. Development, 2010. 137(11): p. 1887-96. 248. van Rooij, E., et al., Control of stress-dependent cardiac growth and gene expression by a microRNA. Science, 2007. 316(5824): p. 575-9. 249. Zhang, L.L., et al., MiR-499 induces cardiac differentiation of rat mesenchymal stem cells through wnt/beta-catenin signaling pathway. Biochem Biophys Res Commun, 2012. 420(4): p. 875-81. 250. Wang, Q., et al., MicroRNA miR-24 inhibits erythropoiesis by targeting activin type I receptor ALK4. Blood, 2008. 111(2): p. 588-95. 251. Sturgeon, C.M., et al., Primitive erythropoiesis is regulated by miR-126 via nonhematopoietic Vcam-1+ cells. Dev Cell, 2012. 23(1): p. 45-57. 252. Rasmussen, K.D., et al., The miR-144/451 locus is required for erythroid homeostasis. J Exp Med, 2010. 207(7): p. 1351-8. 253. Daubman, S., MicroRNAs in angiogenesis and vascular smooth muscle cell function. Circ Res, 2010. 106(3): p. 423-5. 254. Wang, S., et al., The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesis. Dev Cell, 2008. 15(2): p. 261-71. 255. Ikeda, S., et al., Altered microRNA expression in human heart disease. Physiol Genomics, 2007. 31(3): p. 367-73. 256. Small, E.M., R.J. Frost, and E.N. Olson, MicroRNAs add a new dimension to cardiovascular disease. Circulation, 2010. 121(8): p. 1022-32. 257. van Rooij, E., et al., A signature pattern of stress-responsive microRNAs that can evoke cardiac hypertrophy and heart failure. Proc Natl Acad Sci U S A, 2006. 103(48): p. 18255-60. 258. Cheng, Y., et al., MicroRNAs are aberrantly expressed in hypertrophic heart: do they play a role in cardiac hypertrophy? Am J Pathol, 2007. 170(6): p. 1831-40. 259. Sayed, D., et al., MicroRNAs play an essential role in the development of cardiac hypertrophy. Circ Res, 2007. 100(3): p. 416-24. 158 260. Lin, Z., et al., miR-23a functions downstream of NFATc3 to regulate cardiac hypertrophy. Proc Natl Acad Sci U S A, 2009. 106(29): p. 12103-8. 261. Song, X.W., et al., MicroRNAs are dynamically regulated in hypertrophic hearts, and miR-199a is essential for the maintenance of cell size in cardiomyocytes. J Cell Physiol, 2010. 225(2): p. 437-43. 262. Callis, T.E., et al., MicroRNA-208a is a regulator of cardiac hypertrophy and conduction in mice. J Clin Invest, 2009. 119(9): p. 2772-86. 263. Care, A., et al., MicroRNA-133 controls cardiac hypertrophy. Nat Med, 2007. 13(5): p. 613-8. 264. Ikeda, S., et al., MicroRNA-1 negatively regulates expression of the hypertrophy-associated calmodulin and Mef2a genes. Mol Cell Biol, 2009. 29(8): p. 2193-204. 265. Huang, Z.P., et al., MicroRNA-22 regulates cardiac hypertrophy and remodeling in response to stress. Circ Res, 2013. 112(9): p. 1234-43. 266. Wang, J., et al., Cardiomyocyte overexpression of miR-27b induces cardiac hypertrophy and dysfunction in mice. Cell Res, 2012. 22(3): p. 516-27. 267. Shieh, J.T., et al., Elevated miR-499 levels blunt the cardiac stress response. PLoS One, 2011. 6(5): p. e19481. 268. Yang, Y., et al., Thioredoxin 1 negatively regulates angiotensin II-induced cardiac hypertrophy through upregulation of miR-98/let-7. Circ Res, 2011. 108(3): p. 305-13. 269. Zhang, Z.H., et al., MicroRNA-26 was decreased in rat cardiac hypertrophy model and may be a promising therapeutic target. J Cardiovasc Pharmacol, 2013. 270. Pan, W., et al., MiR-30-regulated autophagy mediates angiotensin II-induced myocardial hypertrophy. PLoS One, 2013. 8(1): p. e53950. 271. Ganesan, J., et al., MiR-378 controls cardiac hypertrophy by combined repression of mitogen-activated protein kinase pathway factors. Circulation, 2013. 127(21): p. 2097-106. 272. Thum, T., et al., MicroRNA-21 contributes to myocardial disease by stimulating MAP kinase signalling in fibroblasts. Nature, 2008. 456(7224): p. 980-4. 273. Tatsuguchi, M., et al., Expression of microRNAs is dynamically regulated during cardiomyocyte hypertrophy. J Mol Cell Cardiol, 2007. 42(6): p. 1137-41. 274. Anversa, P., et al., Ischemic cardiomyopathy: myocyte cell loss, myocyte cellular hypertrophy, and myocyte cellular hyperplasia. Ann N Y Acad Sci, 1995. 752: p. 47-64. 275. Xu, C., et al., The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, HSP70 and caspase-9 in cardiomyocytes. J Cell Sci, 2007. 120(Pt 17): p. 3045-52. 276. Hullinger, T.G., et al., Inhibition of miR-15 protects against cardiac ischemic injury. Circ Res, 2012. 110(1): p. 71-81. 159 277. Dong, S., et al., MicroRNA expression signature and the role of microRNA-21 in the early phase of acute myocardial infarction. J Biol Chem, 2009. 284(43): p. 29514-25. 278. Rane, S., et al., Downregulation of miR-199a derepresses hypoxia-inducible factor-1alpha and Sirtuin 1 and recapitulates hypoxia preconditioning in cardiac myocytes. Circ Res, 2009. 104(7): p. 879-86. 279. Qian, L., et al., miR-24 inhibits apoptosis and represses Bim in mouse cardiomyocytes. J Exp Med, 2011. 208(3): p. 549-60. 280. Wang, J.X., et al., miR-499 regulates mitochondrial dynamics by targeting calcineurin and dynamin-related protein-1. Nat Med, 2011. 17(1): p. 71-8. 281. Ren, X.P., et al., MicroRNA-320 is involved in the regulation of cardiac ischemia/reperfusion injury by targeting heat-shock protein 20. Circulation, 2009. 119(17): p. 2357-66. 282. Zhang, X., et al., Synergistic effects of the GATA-4-mediated miR-144/451 cluster in protection against simulated ischemia/reperfusion-induced cardiomyocyte death. J Mol Cell Cardiol, 2010. 49(5): p. 841-50. 283. Naga Prasad, S.V., et al., Unique microRNA profile in end-stage heart failure indicates alterations in specific cardiovascular signaling networks. J Biol Chem, 2009. 284(40): p. 27487-99. 284. Gurha, P., et al., Targeted deletion of microRNA-22 promotes stress-induced cardiac dilation and contractile dysfunction. Circulation, 2012. 125(22): p. 2751-61. 285. Baumgarten, A., et al., TWIST1 regulates the activity of ubiquitin proteasome system via the miR-199/214 cluster in human end-stage dilated cardiomyopathy. Int J Cardiol, 2013. 286. Satoh, M., et al., Expression of microRNA-208 is associated with adverse clinical outcomes in human dilated cardiomyopathy. J Card Fail, 2010. 16(5): p. 404-10. 287. Zhang, Y., et al., Overexpression of microRNA-1 causes atrioventricular block in rodents. Int J Biol Sci, 2013. 9(5): p. 455-62. 288. Luo, X., et al., Down-regulation of miR-1/miR-133 contributes to re-expression of pacemaker channel genes HCN2 and HCN4 in hypertrophic heart. J Biol Chem, 2008. 283(29): p. 20045-52. 289. Matkovich, S.J., et al., MicroRNA-133a protects against myocardial fibrosis and modulates electrical repolarization without affecting hypertrophy in pressure-overloaded adult hearts. Circ Res, 2010. 106(1): p. 166-75. 290. Roy, S., et al., MicroRNA expression in response to murine myocardial infarction: miR-21 regulates fibroblast metalloprotease-2 via phosphatase and tensin homologue. Cardiovasc Res, 2009. 82(1): p. 21-9. 291. Wang, J., et al., MicroRNA-24 regulates cardiac fibrosis after myocardial infarction. J Cell Mol Med, 2012. 16(9): p. 2150-60. 160 292. van Rooij, E., et al., Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis. Proc Natl Acad Sci U S A, 2008. 105(35): p. 13027-32. 293. Duisters, R.F., et al., miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remodeling. Circ Res, 2009. 104(2): p. 170-8, 6p following 178. 294. Thornburg, N.J., S.L. Hayward, and J.E. Crowe, Respiratory Syncytial Virus Regulates Human MicroRNAs by Using Mechanisms Involving Beta Interferon and NF-kappa B. Mbio, 2012. 3(6). 295. Cameron, J.E., et al., Epstein-Barr virus latent membrane protein 1 induces cellular MicroRNA miR-146a, a modulator of lymphocyte signaling pathways. J Virol, 2008. 82(4): p. 1946-1958. 296. Sun, G.H., et al., Interplay between HIV-1 infection and host microRNAs. Nucleic Acids Res, 2012. 40(5): p. 2181-2196. 297. Li, Y., et al., MicroRNA Expression and Virulence in Pandemic Influenza Virus-Infected Mice. J Virol, 2010. 84(6): p. 3023-3032. 298. Braconi, C., et al., Hepatitis C Virus Proteins Modulate MicroRNA Expression and Chemosensitivity in Malignant Hepatocytes. Clinical Cancer Research, 2010. 16(3): p. 957-966. 299. Motsch, N., et al., MicroRNA Profiling of Epstein-Barr Virus-Associated NK/T-Cell Lymphomas by Deep Sequencing. Plos One, 2012. 7(8). 300. Kaczkowski, B., et al., A Decade of Global mRNA and miRNA Profiling of HPV-Positive Cell Lines and Clinical Specimens. Open Virol J, 2012. 6: p. 216-31. 301. Stewart, C.R., et al., Promotion of Hendra virus replication by microRNA 146a. J Virol, 2013. 87(7): p. 3782-91. 302. Triboulet, R., et al., Suppression of microRNA-silencing pathway by HIV-1 during virus replication. Science, 2007. 315(5818): p. 1579-82. 303. Yin, Q., et al., MicroRNA-155 is an Epstein-Barr virus-induced gene that modulates Epstein-Barr virus-regulated gene expression pathways. J Virol, 2008. 82(11): p. 5295-306. 304. Lecellier, C.H., et al., A cellular microRNA mediates antiviral defense in human cells. Science, 2005. 308(5721): p. 557-60. 305. Otsuka, M., et al., Hypersusceptibility to vesicular stomatitis virus infection in Dicer1-deficient mice is due to impaired miR24 and miR93 expression. Immunity, 2007. 27(1): p. 123-34. 306. Jopling, C.L., et al., Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science, 2005. 309(5740): p. 1577-81. 307. Linial, M.L., Foamy viruses are unconventional retroviruses. J Virol, 1999. 73(3): p. 1747-55. 308. Park, N.J., et al., Salivary microRNA: discovery, characterization, and clinical utility for oral cancer detection. Clinical Cancer Research, 2009. 15(17): p. 5473-7. 309. Sullivan, C.S., et al., SV40-encoded microRNAs regulate viral gene expression and reduce susceptibility to cytotoxic T cells. Nature, 2005. 435(7042): p. 682-6. 161 310. Pfeffer, S., et al., Identification of microRNAs of the herpesvirus family. Nat Methods, 2005. 2(4): p. 269-76. 311. Barth, S., et al., Epstein-Barr virus-encoded microRNA miR-BART2 down-regulates the viral DNA polymerase BALF5. Nucleic Acids Res, 2008. 36(2): p. 666-75. 312. Tang, S., et al., An acutely and latently expressed herpes simplex virus 2 viral microRNA inhibits expression of ICP34.5, a viral neurovirulence factor. Proc Natl Acad Sci U S A, 2008. 105(31): p. 10931-6. 313. Tang, S., A. Patel, and P.R. Krause, Novel less-abundant viral microRNAs encoded by herpes simplex virus 2 latency-associated transcript and their roles in regulating ICP34.5 and ICP0 mRNAs. J Virol, 2009. 83(3): p. 1433-42. 314. Lo, A.K., et al., Modulation of LMP1 protein expression by EBV-encoded microRNAs. Proc Natl Acad Sci U S A, 2007. 104(41): p. 16164-9. 315. Samols, M.A., et al., Identification of cellular genes targeted by KSHV-encoded microRNAs. PLoS Pathog, 2007. 3(5): p. e65. 316. Ziegelbauer, J.M., C.S. Sullivan, and D. Ganem, Tandem array-based expression screens identify host mRNA targets of virus-encoded microRNAs. Nat Genet, 2009. 41(1): p. 130-4. 317. Hansen, A., et al., KSHV-encoded miRNAs target MAF to induce endothelial cell reprogramming. Genes Dev, 2010. 24(2): p. 195-205. 318. Choy, E.Y., et al., An Epstein-Barr virus-encoded microRNA targets PUMA to promote host cell survival. J Exp Med, 2008. 205(11): p. 2551-60. 319. Xia, T., et al., EBV microRNAs in primary lymphomas and targeting of CXCL-11 by ebv-mir-BHRF1-3. Cancer Res, 2008. 68(5): p. 1436-42. 320. Ho, B.C., et al., Enterovirus-induced miR-141 contributes to shutoff of host protein translation by targeting the translation initiation factor eIF4E. Cell Host Microbe, 2011. 9(1): p. 58-69. 321. Corsten, M.F., et al., MicroRNA profiling identifies microRNA-155 as an adverse mediator of cardiac injury and dysfunction during acute viral myocarditis. Circ Res, 2012. 111(4): p. 415-25. 322. Xu, H.F., et al., MicroRNA- 1 represses Cx43 expression in viral myocarditis. Mol Cell Biochem, 2012. 362(1-2): p. 141-8. 323. Guerrier, A., et al., Gap junctions and cell polarity: connexin32 and connexin43 expressed in polarized thyroid epithelial cells assemble into separate gap junctions, which are located in distinct regions of the lateral plasma membrane domain. J Cell Sci, 1995. 108 ( Pt 7): p. 2609-17. 324. He, J., et al., MiR-21 confers resistance against CVB3-induced myocarditis by inhibiting PDCD4-mediated apoptosis. Clin Invest Med, 2013. 36(2): p. E103-11. 325. Liu, Y.L., et al., MicroRNA-21 and -146b are involved in the pathogenesis of murine viral myocarditis by regulating TH-17 differentiation. Arch Virol, 2013. 162 326. Tong, L., et al., MiR-10a* up-regulates coxsackievirus B3 biosynthesis by targeting the 3D-coding sequence. Nucleic Acids Res, 2013. 41(6): p. 3760-71. 327. Wang, L., et al., MiR-342-5p suppresses coxsackievirus B3 biosynthesis by targeting the 2C-coding region. Antiviral Res, 2012. 93(2): p. 270-9. 328. Yuan, J., et al., CXCL10 inhibits viral replication through recruitment of natural killer cells in coxsackievirus B3-induced myocarditis. Circ Res, 2009. 104(5): p. 628-38. 329. Ralfkiaer, U., et al., Diagnostic microRNA profiling in cutaneous T-cell lymphoma (CTCL). Blood, 2011. 118(22): p. 5891-900. 330. Paloheimo, O., et al., Coxsackievirus B3-induced cellular protrusions: structural characteristics and functional competence. J Virol, 2011. 85(13): p. 6714-24. 331. Humphreys, D.T., et al., Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function. PLoS One, 2012. 7(2): p. e30933. 332. Liang, Y., et al., Characterization of microRNA expression profiles in normal human tissues. BMC Genomics, 2007. 8: p. 166. 333. Tang, F., et al., MicroRNA expression profiling of single whole embryonic stem cells. Nucleic Acids Res, 2006. 34(2): p. e9. 334. Zhang, Y., et al., miR-126 and miR-126* repress recruitment of mesenchymal stem cells and inflammatory monocytes to inhibit breast cancer metastasis. Nat Cell Biol, 2013. 15(3): p. 284-94. 335. Jakob, P., et al., Loss of angiomiR-126 and 130a in angiogenic early outgrowth cells from patients with chronic heart failure: role for impaired in vivo neovascularization and cardiac repair capacity. Circulation, 2012. 126(25): p. 2962-75. 336. Pepini, T., et al., Andes virus regulation of cellular microRNAs contributes to hantavirus-induced endothelial cell permeability. J Virol, 2010. 84(22): p. 11929-36. 337. Shi, H., et al., Synergistic induction of miR-126 by hypoxia and HDAC inhibitors in cardiac myocytes. Biochem Biophys Res Commun, 2013. 430(2): p. 827-32. 338. Liu, B., et al., MiR-126 restoration down-regulate VEGF and inhibit the growth of lung cancer cell lines in vitro and in vivo. Lung Cancer, 2009. 66(2): p. 169-75. 339. Fish, J.E., et al., miR-126 regulates angiogenic signaling and vascular integrity. Dev Cell, 2008. 15(2): p. 272-84. 340. Qiang, L., et al., Expression of miR-126 and miR-508-5p in endothelial progenitor cells is associated with the prognosis of chronic heart failure patients. Int J Cardiol, 2013. 341. Zampetaki, A., et al., Prospective study on circulating MicroRNAs and risk of myocardial infarction. J Am Coll Cardiol, 2012. 60(4): p. 290-9. 342. Zhu, H. and G.C. Fan, Role of microRNAs in the reperfused myocardium towards post-infarct remodelling. Cardiovasc Res, 2012. 94(2): p. 284-92. 163 343. Satoh, M., et al., A cellular microRNA, let-7i, is a novel biomarker for clinical outcome in patients with dilated cardiomyopathy. J Card Fail, 2011. 17(11): p. 923-9. 344. Peveling-Oberhag, J., et al., Dysregulation of global microRNA expression in splenic marginal zone lymphoma and influence of chronic hepatitis C virus infection. Leukemia, 2012. 26(7): p. 1654-62. 345. Meng, S., et al., Downregulation of microRNA-126 in endothelial progenitor cells from diabetes patients, impairs their functional properties, via target gene Spred-1. J Mol Cell Cardiol, 2012. 53(1): p. 64-72. 346. Harris, T.A., et al., MicroRNA-126 regulates endothelial expression of vascular cell adhesion molecule 1. Proc Natl Acad Sci U S A, 2008. 105(5): p. 1516-21. 347. Li, X., et al., Regulation of miRNA expression by Src and contact normalization: effects on nonanchored cell growth and migration. Oncogene, 2009. 28(48): p. 4272-83. 348. Zhang, J., et al., The cell growth suppressor, mir-126, targets IRS-1. Biochem Biophys Res Commun, 2008. 377(1): p. 136-40. 349. Sun, Y., et al., miR-126 inhibits non-small cell lung cancer cells proliferation by targeting EGFL7. Biochem Biophys Res Commun, 2010. 391(3): p. 1483-9. 350. Zou, J., et al., Two functional microRNA-126s repress a novel target gene p21-activated kinase 1 to regulate vascular integrity in zebrafish. Circ Res, 2011. 108(2): p. 201-9. 351. Khella, H.W., et al., Exploring the role of miRNAs in renal cell carcinoma progression and metastasis through bioinformatic and experimental analyses. Tumour Biol, 2012. 33(1): p. 131-40. 352. Otsubo, T., et al., MicroRNA-126 inhibits SOX2 expression and contributes to gastric carcinogenesis. PLoS One, 2011. 6(1): p. e16617. 353. Oglesby, I.K., et al., miR-126 is downregulated in cystic fibrosis airway epithelial cells and regulates TOM1 expression. J Immunol, 2010. 184(4): p. 1702-9. 354. Grabher, C., et al., Zebrafish microRNA-126 determines hematopoietic cell fate through c-Myb. Leukemia, 2011. 25(3): p. 506-14. 355. van Solingen, C., et al., MicroRNA-126 modulates endothelial SDF-1 expression and mobilization of Sca-1(+)/Lin(-) progenitor cells in ischaemia. Cardiovasc Res, 2011. 92(3): p. 449-55. 356. Shen, W.F., et al., MicroRNA-126 regulates HOXA9 by binding to the homeobox. Mol Cell Biol, 2008. 28(14): p. 4609-19. 357. Taylor, L.A., et al., Host gene regulation during coxsackievirus B3 infection in mice: assessment by microarrays. Circ Res, 2000. 87(4): p. 328-34. 358. Zhang, Z.C., et al., Microarray analysis of extracellular matrix genes expression in myocardium of mouse with Coxsackie virus B3 myocarditis. Chin Med J (Engl), 2004. 117(8): p. 1228-31. 164 359. Rassmann, A., et al., Proteome alterations in human host cells infected with coxsackievirus B3. J Gen Virol, 2006. 87(Pt 9): p. 2631-8. 360. Hammer, E., et al., Viral myocarditis induced by Coxsackievirus B3 in A.BY/SnJ mice: analysis of changes in the myocardial proteome. Proteomics, 2010. 10(9): p. 1802-18. 361. Cunningham, K.A., N.M. Chapman, and S.D. Carson, Caspase-3 activation and ERK phosphorylation during CVB3 infection of cells: influence of the coxsackievirus and adenovirus receptor and engineered variants. Virus Res, 2003. 92(2): p. 179-86. 362. Opavsky, M.A., et al., Enhanced ERK-1/2 activation in mice susceptible to coxsackievirus-induced myocarditis. J Clin Invest, 2002. 109(12): p. 1561-9. 363. Granville, D.J., et al., Interaction of viral proteins with host cell death machinery. Cell Death Differ, 1998. 5(8): p. 653-9. 364. Wakioka, T., et al., Spred is a Sprouty-related suppressor of Ras signalling. Nature, 2001. 412(6847): p. 647-51. 365. Wu, X., et al., Cdc42 controls progenitor cell differentiation and beta-catenin turnover in skin. Genes Dev, 2006. 20(5): p. 571-85. 366. Foulds, C.E., et al., Ras/mitogen-activated protein kinase signaling activates Ets-1 and Ets-2 by CBP/p300 recruitment. Mol Cell Biol, 2004. 24(24): p. 10954-64. 367. Lim, B.K., et al., Coxsackievirus B3 replication is related to activation of the late extracellular signal-regulated kinase (ERK) signal. Virus Res, 2005. 113(2): p. 153-7. 368. Garcia, D.M., et al., Weak seed-pairing stability and high target-site abundance decrease the proficiency of lsy-6 and other microRNAs. Nat Struct Mol Biol, 2011. 18(10): p. 1139-46. 369. Zeng, X., et al., Initiation of Wnt signaling: control of Wnt coreceptor Lrp6 phosphorylation/activation via frizzled, dishevelled and axin functions. Development, 2008. 135(2): p. 367-75. 370. Wu, G., et al., Inhibition of GSK3 phosphorylation of beta-catenin via phosphorylated PPPSPXS motifs of Wnt coreceptor LRP6. PLoS One, 2009. 4(3): p. e4926. 371. Sullivan, C.S. and D. Ganem, MicroRNAs and viral infection. Mol Cell, 2005. 20(1): p. 3-7. 372. Esfandiarei, M. and B.M. McManus, Molecular biology and pathogenesis of viral myocarditis. Annu Rev Pathol, 2008. 3: p. 127-55. 373. Morgan, R., et al., Sequence conservation and differential expression of Marek's disease virus microRNAs. J Virol, 2008. 82(24): p. 12213-20. 374. Cselenyi, C.S., et al., LRP6 transduces a canonical Wnt signal independently of Axin degradation by inhibiting GSK3's phosphorylation of beta-catenin. Proc Natl Acad Sci U S A, 2008. 105(23): p. 8032-7. 165 375. Saud, K., R. Herrera-Molina, and R. Von Bernhardi, Pro- and anti-inflammatory cytokines regulate the ERK pathway: implication of the timing for the activation of microglial cells. Neurotox Res, 2005. 8(3-4): p. 277-87. 376. Yi, R., et al., A skin microRNA promotes differentiation by repressing 'stemness'. Nature, 2008. 452(7184): p. 225-9. 377. Bueno, M.J., et al., Genetic and epigenetic silencing of microRNA-203 enhances ABL1 and BCR-ABL1 oncogene expression. Cancer Cell, 2008. 13(6): p. 496-506. 378. Sonkoly, E., et al., MicroRNAs: novel regulators involved in the pathogenesis of psoriasis? PLoS One, 2007. 2(7): p. e610. 379. Schetter, A.J., et al., MicroRNA expression profiles associated with prognosis and therapeutic outcome in colon adenocarcinoma. JAMA, 2008. 299(4): p. 425-36. 380. Furuta, M., et al., miR-124 and miR-203 are epigenetically silenced tumor-suppressive microRNAs in hepatocellular carcinoma. Carcinogenesis, 2010. 31(5): p. 766-76. 381. Iorio, M.V., et al., MicroRNA signatures in human ovarian cancer. Cancer Res, 2007. 67(18): p. 8699-707. 382. Greither, T., et al., Elevated expression of microRNAs 155, 203, 210 and 222 in pancreatic tumors is associated with poorer survival. Int J Cancer, 2010. 126(1): p. 73-80. 383. Saini, S., et al., Regulatory Role of mir-203 in Prostate Cancer Progression and Metastasis. Clin Cancer Res, 2011. 17(16): p. 5287-98. 384. Sonkoly, E., et al., Protein kinase C-dependent upregulation of miR-203 induces the differentiation of human keratinocytes. J Invest Dermatol, 2010. 130(1): p. 124-34. 385. Sonkoly, E., et al., MicroRNA-203 functions as a tumor suppressor in basal cell carcinoma. Oncogenesis, 2012. 1: p. e3. 386. Wellner, U., et al., The EMT-activator ZEB1 promotes tumorigenicity by repressing stemness-inhibiting microRNAs. Nat Cell Biol, 2009. 11(12): p. 1487-95. 387. McKenna, D.J., et al., MicroRNA 203 expression in keratinocytes is dependent on regulation of p53 levels by E6. J Virol, 2010. 84(20): p. 10644-52. 388. Zhang, Z., et al., Epigenetic Silencing of miR-203 Upregulates SNAI2 and Contributes to the Invasiveness of Malignant Breast Cancer Cells. Genes Cancer, 2011. 2(8): p. 782-91. 389. Yu, H., et al., Epstein-Barr virus downregulates microRNA 203 through the oncoprotein latent membrane protein 1: a contribution to increased tumor incidence in epithelial cells. J Virol, 2012. 86(6): p. 3088-99. 390. Greco, D., et al., Human papillomavirus 16 E5 modulates the expression of host microRNAs. PLoS One, 2011. 6(7): p. e21646. 166 391. Buggele, W.A. and C.M. Horvath, MicroRNA Profiling of Sendai Virus-Infected A549 Cells Identifies miR-203 as an Interferon-Inducible Regulator of IFIT1/ISG56. J Virol, 2013. 87(16): p. 9260-70. 392. Zhao, P., et al., Infection with street strain rabies virus induces modulation of the microRNA profile of the mouse brain. Virol J, 2012. 9: p. 159. 393. Merchant, J.L., et al., ZBP-89, a Kruppel-like zinc finger protein, inhibits epidermal growth factor induction of the gastrin promoter. Mol Cell Biol, 1996. 16(12): p. 6644-53. 394. Law, D.J., S.A. Tarle, and J.L. Merchant, The human ZBP-89 homolog, located at chromosome 3q21, represses gastrin gene expression. Mamm Genome, 1998. 9(2): p. 165-7. 395. Zhang, C.Z., G.G. Chen, and P.B. Lai, Transcription factor ZBP-89 in cancer growth and apoptosis. Biochim Biophys Acta, 2010. 1806(1): p. 36-41. 396. Bai, L. and J.L. Merchant, ZBP-89 promotes growth arrest through stabilization of p53. Mol Cell Biol, 2001. 21(14): p. 4670-83. 397. Merchant, J.L., L. Bai, and M. Okada, ZBP-89 mediates butyrate regulation of gene expression. J Nutr, 2003. 133(7 Suppl): p. 2456S-2460S. 398. Chen, G.G., et al., ZBP-89 reduces the cell death threshold in hepatocellular carcinoma cells by increasing caspase-6 and S phase cell cycle arrest. Cancer Lett, 2009. 283(1): p. 52-8. 399. Okada, M., et al., P53 mutants suppress ZBP-89 function. Anticancer Res, 2006. 26(3A): p. 2023-8. 400. Nakanishi, M., et al., Two different bindings of p21 Cdk inhibitor to cyclin/Cdk complex. Leukemia, 1997. 11 Suppl 3: p. 356-7. 401. Bai, L., et al., Recruitment of ataxia-telangiectasia mutated to the p21(waf1) promoter by ZBP-89 plays a role in mucosal protection. Gastroenterology, 2006. 131(3): p. 841-52. 402. Bai, L. and J.L. Merchant, ATM phosphorylates ZBP-89 at Ser202 to potentiate p21waf1 induction by butyrate. Biochem Biophys Res Commun, 2007. 359(3): p. 817-21. 403. Bai, L., et al., ZBP-89-induced apoptosis is p53-independent and requires JNK. Cell Death Differ, 2004. 11(6): p. 663-73. 404. Cuesta, N., et al., IFN regulatory factor-2 regulates macrophage apoptosis through a STAT1/3- and caspase-1-dependent mechanism. J Immunol, 2007. 178(6): p. 3602-11. 405. Bai, L. and J.L. Merchant, Transcription factor ZBP-89 is required for STAT1 constitutive expression. Nucleic Acids Res, 2003. 31(24): p. 7264-70. 406. Moffatt, C.E. and R.J. Lamont, Porphyromonas gingivalis induction of microRNA-203 expression controls suppressor of cytokine signaling 3 in gingival epithelial cells. Infect Immun, 2011. 79(7): p. 2632-7. 407. Lowe, S.W. and C.J. Sherr, Tumor suppression by Ink4a-Arf: progress and puzzles. Curr Opin Genet Dev, 2003. 13(1): p. 77-83. 167 408. Hess, J., P. Angel, and M. Schorpp-Kistner, AP-1 subunits: quarrel and harmony among siblings. J Cell Sci, 2004. 117(Pt 25): p. 5965-73. 409. Shaulian, E. and M. Karin, AP-1 in cell proliferation and survival. Oncogene, 2001. 20(19): p. 2390-400. 410. Stanczyk, J., et al., Altered expression of microRNA-203 in rheumatoid arthritis synovial fibroblasts and its role in fibroblast activation. Arthritis Rheum, 2011. 63(2): p. 373-81. 411. Luo, L., et al., Microarray-based approach identifies differentially expressed microRNAs in porcine sexually immature and mature testes. PLoS One, 2010. 5(8): p. e11744. 412. Schmittgen, T.D., et al., A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res, 2004. 32(4): p. e43. 413. Sera, T., Inhibition of virus DNA replication by artificial zinc finger proteins. J Virol, 2005. 79(4): p. 2614-9. 414. Zimmerman, K.A., et al., Zinc finger proteins designed to specifically target duck hepatitis B virus covalently closed circular DNA inhibit viral transcription in tissue culture. J Virol, 2008. 82(16): p. 8013-21. 415. Law, D.J., E.M. Labut, and J.L. Merchant, Intestinal overexpression of ZNF148 suppresses ApcMin/+ neoplasia. Mamm Genome, 2006. 17(10): p. 999-1004. 416. Yuan, J., et al., A phosphorothioate antisense oligodeoxynucleotide specifically inhibits coxsackievirus B3 replication in cardiomyocytes and mouse hearts. Lab Invest, 2004. 84(6): p. 703-14. 417. Rajewsky, N., microRNA target predictions in animals. Nat Genet, 2006. 38 Suppl: p. S8-13. 418. He, L. and G.J. Hannon, MicroRNAs: small RNAs with a big role in gene regulation. Nat Rev Genet, 2004. 5(7): p. 522-31. 419. Feng, Y., et al., The transcription factor ZBP-89 suppresses p16 expression through a histone modification mechanism to affect cell senescence. FEBS J, 2009. 276(15): p. 4197-206. 420. Salmon, M., G.K. Owens, and Z.E. Zehner, Over-expression of the transcription factor, ZBP-89, leads to enhancement of the C2C12 myogenic program. Biochim Biophys Acta, 2009. 1793(7): p. 1144-55. 421. Gao, G., et al., Proteasome activator REGgamma enhances coxsackieviral infection by facilitating p53 degradation. J Virol, 2010. 84(21): p. 11056-66. 422. Hauck, L., et al., Critical role for FoxO3a-dependent regulation of p21CIP1/WAF1 in response to statin signaling in cardiac myocytes. Circ Res, 2007. 100(1): p. 50-60. 423. Jensen, K.J., et al., An ERK-p38 subnetwork coordinates host cell apoptosis and necrosis during coxsackievirus B3 infection. Cell Host Microbe, 2013. 13(1): p. 67-76. 424. Rouleau, M., et al., TAp63 is important for cardiac differentiation of embryonic stem cells and heart development. Stem Cells, 2011. 29(11): p. 1672-83. 168 425. Nadal-Ginard, B., et al., Myocyte death, growth, and regeneration in cardiac hypertrophy and failure. Circ Res, 2003. 92(2): p. 139-50. 426. Ribas, J., et al., A novel source for miR-21 expression through the alternative polyadenylation of VMP1 gene transcripts. Nucleic Acids Res, 2012. 40(14): p. 6821-33. 427. Cai, X., C.H. Hagedorn, and B.R. Cullen, Human microRNAs are processed from capped, polyadenylated transcripts that can also function as mRNAs. RNA, 2004. 10(12): p. 1957-66. 428. Ozsolak, F., et al., Chromatin structure analyses identify miRNA promoters. Genes Dev, 2008. 22(22): p. 3172-83. 429. Seike, M., et al., MiR-21 is an EGFR-regulated anti-apoptotic factor in lung cancer in never-smokers. Proc Natl Acad Sci U S A, 2009. 106(29): p. 12085-90. 430. Bhat-Nakshatri, P., et al., Estradiol-regulated microRNAs control estradiol response in breast cancer cells. Nucleic Acids Res, 2009. 37(14): p. 4850-61. 431. Shen, L., et al., Feedback regulations of miR-21 and MAPKs via Pdcd4 and Spry1 are involved in arsenite-induced cell malignant transformation. PLoS One, 2013. 8(3): p. e57652. 432. Hulf, T., et al., Discovery pipeline for epigenetically deregulated miRNAs in cancer: integration of primary miRNA transcription. BMC Genomics, 2011. 12: p. 54. 433. Kim, Y.J., et al., PTEN modulates miR-21 processing via RNA-regulatory protein RNH1. PLoS One, 2011. 6(12): p. e28308. 434. Sayed, D., et al., MicroRNA-21 targets Sprouty2 and promotes cellular outgrowths. Mol Biol Cell, 2008. 19(8): p. 3272-82. 435. Bauersachs, J., miR-21: a central regulator of fibrosis not only in the broken heart. Cardiovasc Res, 2012. 96(2): p. 227-9; discussion 230-3. 436. Cheng, Y., et al., MicroRNA-21 protects against the H(2)O(2)-induced injury on cardiac myocytes via its target gene PDCD4. J Mol Cell Cardiol, 2009. 47(1): p. 5-14. 437. Patrick, D.M., et al., Stress-dependent cardiac remodeling occurs in the absence of microRNA-21 in mice. J Clin Invest, 2010. 120(11): p. 3912-6. 438. Rosato, P., et al., Differential regulation of miR-21 and miR-146a by Epstein-Barr virus-encoded EBNA2. Leukemia, 2012. 26(11): p. 2343-52. 439. Chen, Y., et al., HCV-induced miR-21 contributes to evasion of host immune system by targeting MyD88 and IRAK1. PLoS Pathog, 2013. 9(4): p. e1003248. 440. Sheikh, F., R.S. Ross, and J. Chen, Cell-cell connection to cardiac disease. Trends Cardiovasc Med, 2009. 19(6): p. 182-90. 441. Garrod, D.R., et al., Hyper-adhesion in desmosomes: its regulation in wound healing and possible relationship to cadherin crystal structure. J Cell Sci, 2005. 118(Pt 24): p. 5743-54. 442. Jamora, C. and E. Fuchs, Intercellular adhesion, signalling and the cytoskeleton. Nat Cell Biol, 2002. 4(4): p. E101-8. 169 443. Noorman, M., et al., Cardiac cell-cell junctions in health and disease: Electrical versus mechanical coupling. J Mol Cell Cardiol, 2009. 47(1): p. 23-31. 444. Perriard, J.C., A. Hirschy, and E. Ehler, Dilated cardiomyopathy: a disease of the intercalated disc? Trends Cardiovasc Med, 2003. 13(1): p. 30-8. 445. Li, J. and G.L. Radice, A new perspective on intercalated disc organization: implications for heart disease. Dermatol Res Pract, 2010. 2010: p. 207835. 446. Kumarswamy, R., I. Volkmann, and T. Thum, Regulation and function of miRNA-21 in health and disease. RNA Biol, 2011. 8(5): p. 706-13. 447. Dweep, H., et al., miRWalk--database: prediction of possible miRNA binding sites by "walking" the genes of three genomes. J Biomed Inform, 2011. 44(5): p. 839-47. 448. Baron, C.P., S. Jacobsen, and P.P. Purslow, Cleavage of desmin by cysteine proteases: Calpains and cathepsin B. Meat Sci, 2004. 68(3): p. 447-56. 449. Chen, F., et al., Caspase proteolysis of desmin produces a dominant-negative inhibitor of intermediate filaments and promotes apoptosis. J Biol Chem, 2003. 278(9): p. 6848-53. 450. Cohen, S., et al., Ubiquitylation by Trim32 causes coupled loss of desmin, Z-bands, and thin filaments in muscle atrophy. J Cell Biol, 2012. 198(4): p. 575-89. 451. Lewis, B.P., C.B. Burge, and D.P. Bartel, Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell, 2005. 120(1): p. 15-20. 452. Ernst, R., et al., The otubain YOD1 is a deubiquitinating enzyme that associates with p97 to facilitate protein dislocation from the ER. Mol Cell, 2009. 36(1): p. 28-38. 453. Hemida, M.G., et al., MicroRNA-203 enhances coxsackievirus B3 replication through targeting zinc finger protein-148. Cell Mol Life Sci, 2013. 70(2): p. 277-91. 454. Iliopoulos, D., et al., STAT3 activation of miR-21 and miR-181b-1 via PTEN and CYLD are part of the epigenetic switch linking inflammation to cancer. Mol Cell, 2010. 39(4): p. 493-506. 455. Perdiguero, E., et al., p38/MKP-1-regulated AKT coordinates macrophage transitions and resolution of inflammation during tissue repair. J Cell Biol, 2011. 195(2): p. 307-22. 456. Yasukawa, H., et al., The suppressor of cytokine signaling-1 (SOCS1) is a novel therapeutic target for enterovirus-induced cardiac injury. J Clin Invest, 2003. 111(4): p. 469-78. 457. Ju, Y., et al., Coxsackievirus B3 affects endothelial tight junctions: possible relationship to ZO-1 and F-actin, as well as p38 MAPK activity. Cell Biol Int, 2007. 31(10): p. 1207-13. 458. Kartenbeck, J., et al., Specific attachment of desmin filaments to desmosomal plaques in cardiac myocytes. EMBO J, 1983. 2(5): p. 735-42. 459. McLendon, P.M. and J. Robbins, Desmin-related cardiomyopathy: an unfolding story. Am J Physiol Heart Circ Physiol, 2011. 301(4): p. H1220-8. 460. Balogh, J., et al., Hearts from mice lacking desmin have a myopathy with impaired active force generation and unaltered wall compliance. Cardiovasc Res, 2002. 53(2): p. 439-50. 170 461. Taylor, M.R., et al., Prevalence of desmin mutations in dilated cardiomyopathy. Circulation, 2007. 115(10): p. 1244-51. 462. Paulin, D. and Z. Li, Desmin: a major intermediate filament protein essential for the structural integrity and function of muscle. Exp Cell Res, 2004. 301(1): p. 1-7. 463. Li, Z., et al., Cardiovascular lesions and skeletal myopathy in mice lacking desmin. Dev Biol, 1996. 175(2): p. 362-6. 464. Milner, D.J., et al., Disruption of muscle architecture and myocardial degeneration in mice lacking desmin. J Cell Biol, 1996. 134(5): p. 1255-70. 465. Goncharov, T., et al., OTUB1 modulates c-IAP1 stability to regulate signalling pathways. EMBO J, 2013. 32(8): p. 1103-14. 466. Sun, X.X., K.B. Challagundla, and M.S. Dai, Positive regulation of p53 stability and activity by the deubiquitinating enzyme Otubain 1. EMBO J, 2012. 31(3): p. 576-92. 467. Zemljic-Harpf, A.E., et al., Cardiac-myocyte-specific excision of the vinculin gene disrupts cellular junctions, causing sudden death or dilated cardiomyopathy. Mol Cell Biol, 2007. 27(21): p. 7522-37. 468. Tangney, J.R., et al., Novel role for vinculin in ventricular myocyte mechanics and dysfunction. Biophys J, 2013. 104(7): p. 1623-33. 469. Kundu, P., et al., Shutoff of RNA polymerase II transcription by poliovirus involves 3C protease-mediated cleavage of the TATA-binding protein at an alternative site: incomplete shutoff of transcription interferes with efficient viral replication. J Virol, 2005. 79(15): p. 9702-13. 470. Jackson, R.J., The current status of vertebrate cellular mRNA IRESs. Cold Spring Harb Perspect Biol, 2013. 5(2). 471. Eden, E., et al., Proteome half-life dynamics in living human cells. Science, 2011. 331(6018): p. 764-8. 472. Seo, G.J., et al., Reciprocal inhibition between intracellular antiviral signaling and the RNAi machinery in mammalian cells. Cell Host Microbe, 2013. 14(4): p. 435-45. 473. Feng, Q., et al., MDA5 detects the double-stranded RNA replicative form in picornavirus-infected cells. Cell Rep, 2012. 2(5): p. 1187-96. 474. Feig, C. and M.E. Peter, How apoptosis got the immune system in shape. Eur J Immunol, 2007. 37 Suppl 1: p. S61-70.   


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items