UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Investigation of Breadfruit (Artocarpus altilis) for use in the control of the yellow fever mosquito… Glover, Matthew Aaron 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2015_november_Glover_Matthew.pdf [ 3.55MB ]
Metadata
JSON: 24-1.0166634.json
JSON-LD: 24-1.0166634-ld.json
RDF/XML (Pretty): 24-1.0166634-rdf.xml
RDF/JSON: 24-1.0166634-rdf.json
Turtle: 24-1.0166634-turtle.txt
N-Triples: 24-1.0166634-rdf-ntriples.txt
Original Record: 24-1.0166634-source.json
Full Text
24-1.0166634-fulltext.txt
Citation
24-1.0166634.ris

Full Text

INVESTIGATION OF BREADFRUIT (ARTOCARPUS ALTILIS) FOR USE IN THE CONTROL OF THE YELLOW FEVER MOSQUITO AEDES AEGYPTI  by  Matthew Aaron Glover  B.Sc., The University of British Columbia, 2013  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in  THE COLLEGE OF GRADUATE STUDIES  (Biology)  THE UNIVERSITY OF BRITISH COLUMBIA  (Okanagan)    August 2015  © Matthew Aaron Glover, 2015  ii Abstract  Insect borne diseases such as malaria, yellow fever and Dengue fever are among the most economically devastating diseases present on our planet. Traditional knowledge from the Pacific islands suggests using the male inflorescences of breadfruit (Artocarpus altilis) as a mosquito repellent. The cultivation of breadfruit as a source of starch to bolster food sustainability in developing nations has grown in the past ten years.  Thus, the use of male inflorescences as a novel source of mosquito repellents or insecticides presents a valuable secondary product from breadfruit that could be made alongside its primary role as a food source. In order to investigate the potential for biogenic amines such as serotonin and melatonin sourced from plants such as breadfruit, an in depth investigation of the toxicity and its associated underlying mechanism must be elucidated. In Chapter 2, breadfruit male inflorescences were processed using two different extraction methods. The first was a methanol extraction method and the second was a cold-pentane extraction method.  These extracts were tested in a larvicidal bioassay with Aedes aegypti larvae. Methanol extracts showed significantly greater toxicity than the pentane extracts and all future work in subsequent chapters was done on methanol extracts. In Chapter 3, methanol extracts of multiple varieties of breadfruit including two Artocarpus altilis and Artocarpus mariannensis hybrids: ulu afa and Lipet, Artocarpus camansi and a mixed Artocarpus sample were chemically characterized. It was determined that all varieties of extract tested contained serotonin. As well, a wide variety of compounds were putatively identified in the extracts with the majority being fatty acids, phenols, and terpenes previously associated with biological activity towards insects. In Chapter 4, toxicity values for each variety of Artocarpus were assessed with the mixed Artocarpus sample being the highest in insecticidal activity. Haemolymph serotonin wasn shown to significantly decrease after breadfruit extract exposure, even though the serotonin gene pathway transcripts were largely unaffected, suggesting that this change is not transcriptionally regulated.   iii Preface  The majority of the contents of Chapter 1 have been prepared as a manuscript for review to be submitted for publication: Glover, M.A, Rheault, M.R., Saxena, P.K., and Murch. S.J. (2015) Phytochemicals that target serotonin receptors for insect control. Manuscript prepared for the Journal of Pineal Research.  Chapters 2, 3 and 4 contain data made possible from the field collection of breadfruit (Artocarpus altilis) and breadnut (Artocarpus camansi) from the National Tropical Botanical Garden’s (NTBG) Kahanu Garden in Hana, Maui, USA with the help of Ian Cole and Dr. Diane Ragone. Chapter 2 contains data using methanol extracts prepared by Dr. Susan J. Murch Chapter 3 contains DPPH and GC-MS data run at the Natural Food And Health Prodcuts Research Group (NRG) Lab at the British Columbia Institute for Technology (BCIT) with the assistance of Michael Chan, James Findlay, and Xiaohui Zhang. Chapter 3 and 4 also contain UPLC-MS data run at the Plant Metabolomics Lab at the University of British Columbia Okanagan campus with the assistance of Teesha Baker, Fiona Tymm and Dr. Susan Murch.   iv Table of Contents  Abstract .................................................................................................................................... ii Preface ..................................................................................................................................... iii Table of Contents ................................................................................................................... iv List of Tables ......................................................................................................................... vii List of Figures ....................................................................................................................... viii List of Abbreviations ............................................................................................................. xi Acknowledgements ............................................................................................................... xii Chapter 1 : Introduction ........................................................................................................ 1 1.1 Discovery of Serotonin and Melatonin in Plants ...................................................................... 1 1.2 Biosynthesis of Serotonin and Melatonin in Plants .................................................................. 1 1.3 The Roles of Serotonin and Melatonin in Plant Physiology ..................................................... 4 1.4 Breadfruit .................................................................................................................................. 4 1.5 Serotonin and Melatonin in Insects .......................................................................................... 7 1.6 Biosynthesis of Serotonin and Melatonin in Insects ................................................................. 7 1.7 5-HT Receptors in Vertebrates and Invertebrates ..................................................................... 8 1.8 Biogenic Amine Receptors as Targets for Insecticide Development ....................................... 9 1.9 Serotonin in Regulation of Digestion and Diuresis in Insects ................................................ 11 1.10 Model Systems to Investigate the Role of Serotonin in the Insect Gut ................................ 14 1.11 Plant Serotonin in Insect Physiology .................................................................................... 16 1.12 Plant Extract Activity on Insect Larva .................................................................................. 17 1.13 Insect Repellent Activity of Plant Extracts ........................................................................... 19 1.14 Insect Serotonin Metabolism as a Target for Insecticides .................................................... 19 1.15 Plant Serotonin for Insect Biocontrol ................................................................................... 20 1.16 Research Hypothesis and Objectives .................................................................................... 20 Chapter 2 : Investigation of Different Extraction Methods of Breadfruit (Artocarpus altilis) on Insecticidal Activity of Yellow Fever Mosquito (Aedes aegypti) larvae ........................................................................................................................ 22 2.1 Chapter Summary ................................................................................................................... 22  v 2.1.1 Insect Rearing .................................................................................................................. 22 2.1.2 Plant Tissue Collection .................................................................................................... 23 2.1.3 Methanol Tissue Extraction ............................................................................................. 23 2.1.4 Pentane Tissue Extraction ............................................................................................... 24 2.1.5 24-hour LC50 and LC90 Determination ............................................................................ 24 2.2 Results .................................................................................................................................... 25 2.3 Discussion ............................................................................................................................... 27 Chapter 3 : Chemical Characterization of Breadfruit Extracts ....................................... 28 3.1 Chapter Summary ................................................................................................................... 28 3.2 Materials and Methods ........................................................................................................... 28 3.2.1 Plant Tissue Collection .................................................................................................... 28 3.2.2 Methanol Tissue Extraction ............................................................................................. 28 3.2.3 Determination of Antioxidant Activity by DPPH ........................................................... 29 3.2.4 GC-MS of Breadfruit Extracts......................................................................................... 30 3.2.5 5-HT Detection in Breadfruit Extracts by UPLC-MS ..................................................... 30 3.2.6 Data Analysis and Statistics ............................................................................................ 31 3.3 Results .................................................................................................................................... 31 3.3.1 Antioxidant Activity by DPPH ........................................................................................ 31 3.3.2 GC-MS of Breadfruit Extracts......................................................................................... 32 3.3.3 5-HT Detection in Breadfruit Extracts by UPLC-MS ..................................................... 33 3.4 Discussion ............................................................................................................................... 38 3.4.1 DPPH Assay of Extracts .................................................................................................. 38 3.4.2 GC-MS Data of Extracts ................................................................................................. 38 3.4.3 UPLC-MS Data of Extracts ............................................................................................. 40 3.4.4 Concluding Remarks ....................................................................................................... 40 Chapter 4 : Examination of the 5-HT Pathway in Aedes aegypti ..................................... 41 4.1 Chapter summary .................................................................................................................... 41 4.2 Materials and Methods ........................................................................................................... 42 4.2.1 Insect Rearing .................................................................................................................. 42 4.2.2 Plant Tissue Collection .................................................................................................... 42 4.2.3 Methanol Tissue Extraction ............................................................................................. 42 4.2.4 Larvicidal Activity of Breadfruit Methanol Extracts ...................................................... 42  vi 4.2.5 Quantification of 5-HT in Larval Haemolymph after Breadfruit Exposure by UPLC-MS…… ............................................................................................................................ 43 4.2.6 Real-time PCR Gene Expression of 5-HT Pathway ........................................................ 44 4.2.6.1 Larval Tissue Collection after Breadfruit Extract Exposure .................................... 44 4.2.6.2 Adult Tissue Collection after Blood/Sugar Feeding ................................................ 44 4.2.6.3 mRNA Extraction from Aedes aegypti tissues ......................................................... 45 4.2.6.4 cDNA Synthesis ....................................................................................................... 46 4.2.6.5 Primer Design .......................................................................................................... 46 4.2.6.6 Quantitative Real Time PCR .................................................................................... 49 4.2.7 Data Analysis and Statistics ............................................................................................ 50 4.3 Results .................................................................................................................................... 50 4.3.1 Larvicidal Toxicity of Breadfruit Extracts ...................................................................... 50 4.3.2 Serotonin Quantification in Larval Haemolymph after Breadfruit Extract Exposure ...................................................................................................................................... 51 4.3.3 mRNA Extraction ............................................................................................................ 54 4.3.4 Primer Design .................................................................................................................. 56 4.3.5 qPCR Reference Gene Stability Analysis ....................................................................... 58 4.3.6 Quantitative Real Time PCR of Larval Heads after Breadfruit Extract Exposure .......... 60 4.3.7 Quantitative Real Time PCR of Adult Whole Body, Midgut and Malpighian Tubules after 3 h, 12 h and 24 h post blood feeding .................................................................... 62 4.3.8 Quantitative Real Time PCR of Heads of Adults after 3h, 12h and 24h post blood feeding. ........................................................................................................................................ 68 4.4 Discussion ............................................................................................................................... 70 4.4.1 Insecticidal Activity of Breadfruit Extract Varieties ....................................................... 70 4.4.2 5-HT and Melatonin in Haemolymph after Breadfruit Extract Variety Specific Exposure.. .................................................................................................................................... 70 4.4.3 Effect of Breadfruit Extract Exposure on 5-HT Pathway Gene Regulation .................... 71 4.4.4 Effect of Adult Blood/Sugar Feeding on 5-HT Pathway Gene Regulation ..................... 72 4.4.5 Concluding Remarks ....................................................................................................... 73 Chapter 5 : Conclusion ......................................................................................................... 75 References .............................................................................................................................. 79   vii List of Tables   Table 2.1 Larvicidal activity of pentane and methanol Artocarpus altilis extracts ............... 26 Table 3.1 UPLC-MS transitions and voltages ........................................................................ 31 Table 4.1 UPLC-MS transitions and voltages ........................................................................ 43 Table 4.2 qPCR primer sequences for 5-HT pathway genes and reference genes for Aedes aegypti .......................................................................................................... 48 Table 4.3 RNA extraction yields, 260/280 and 260/230 ratios for female adult whole body RNA samples ................................................................................................. 55 Table 4.4 qPCR primer efficiencies, R2, slope values and intercepts for Aedes aegypti 5-HT pathway genes and reference genes .............................................................. 57 Table 4.5 Stability analysis results of reference genes in breadfruit extract exposed 4th instar larval head gene study .................................................................................. 58 Table 4.6 Stability analysis sesults of reference genes in adult blood fed/sugar fed whole body, midgut and Malpighian tubule gene study ........................................ 58 Table 4.7 Stability analysis results of reference genes in adult blood fed/sugar fed head gene study ............................................................................................................... 59   viii List of Figures  Figure 1.1 Biosynthetic Pathway for serotonin and melatonin in both animals and plants ...................................................................................................................... 3 Figure 1.2 Photographs of breadfruit (Artocarpus altilis) from the NTBG Kahanu Garden site. Mature fruiting breadfruit tree (left). Immature fruit and male inflorescence (top right). Artocarpus camansi (breadnut) fruit (bottom right).  Photo by Matthew Glover (June 19, 2014). ............................................... 6 Figure 1.3 Biosynthetic pathway for dopamine and octopamine and their intermediates from tyrosine ........................................................................................................ 10 Figure 1.4 Diagram of the Aedes aegypti alimentary canal with major ion and water movement in the major osmoregulatory tissues ................................................... 12 Figure 1.5 Photograph of female Aedes aegypti taken during a blood meal with the formation of a urine droplet apparent only minutes after onset of blood feeding. Photo credit: Jan Vozenilek ................................................................... 13 Figure 1.6  Schematic drawing of the Ramsay assay to test urine production of extracted insect Malpighian tubules. .................................................................... 15 Figure 1.7 Schematic drawing of the principal and stellate cells of Aedes aegypti Malpighian tubules indicating the effect of 5-HT excitation of the V-type H+ ATPase leading to increased Na+/K+ transport from the haemolymph to the tubule lumen. .................................................................................................. 15 Figure 1.8 Life cycle of Aedes aegypti .................................................................................. 17 Figure 3.1 Antioxidant activity displayed as μmol trolox equivalents (TE)/100 g in three varieties of Artocarpus methanol extract. Bars represent mean ± 1 SEM (N=3). Bars with different letters indicate significantly different antioxidant activity as determined by a one-way ANOVA with Tukey’s HSD multiple comparisons test............................................................................ 32 Figure 3.2 Range of 5-HT (serotonin) detected in 3 varieties of Artocarpus extract determined by UPLC-MS (N=3). Due to large range in data, statistics were not run and data is shown to be purely representational of range as well as positive 5-HT presence. ....................................................................................... 34  ix Figure 3.3  Sample chromatogram of 5-HT (serotonin) detected in 3 varieties of Artocarpus extract determined by UPLC-MS. Retention time (minutes) for serotonin was the same for all samples and matched serotonin standards. Panels indicate methanol extract samples from A) Artocarpus altilis ulu afa B) Artocarpus altilis Lipet C) Artocarpus camansi. ............................................ 35 Figure 4.1 Representative image of a 3-hour blood fed female adult Aedes aegypti (A), 3-hour sugar fed female adult Aedes aegypti (B), and an unfed female adult Aedes aegypti (C). ................................................................................................ 45 Figure 4.2 Serotonin (A) and melatonin (B) (pg/L) in the haemolymph of 4th instar larval Aedes aegypti after exposure to 4 different Artocarpus methanol extracts (black) compared to a 4% methanol control (white). Bars represent mean ± 1 SEM (N=5). Bars with asterisks (*) indicate significantly different gene expression from control (One-Way ANOVA with Dunnett’s multiple comparisons test). .................................................................................. 52 Figure 4.3  Sample chromatogram of 5-HT (Serotonin) detected in haemolymph of 4th instar Aedes aegypti after exposure to 4 varieties of Artocarpus extract determined by UPLC-MS (N=5). Retention time (minutes) for serotonin was the same for all samples and matched serotonin standards. Panels indicate haemolymph samples from larvae exposed to A) 4% methanol B) mixed Artocarpus extract C) Artocarpus altilis Lipet extract D) Artocarpus camansi extract E) Artocarpus altilis ulu afa extract. .......................................... 53 Figure 4.4  Representative 1% agarose non-denatured RNA gel with 3 hour blood fed and 3 hour sugar fed Female adult head mRNA.  Lanes contain the following: 1: 5 μL Quick-Load® 100 bp DNA ladder (New England BioLabs), 2-7: 1 μL RNA, 4 μL ultra-pure water, 1 μL 6x Blue Gel Loading Dye (New England BioLabs), 8: 5 μL Quick-Load® 1kb DNA ladder (New England BioLabs)............................................................................ 56 Figure 4.5 Normalized mRNA expression of TRH (A), AAADC (B), SNAT288 (C), SNAT222 (D), SNAT220 (E) and ASMT (F) in the head of 4th instar larval Aedes aegypti after exposure to 4 different Artocarpus methanol extracts (black) compared to a 4% methanol control (white). Bars represent mean ±  x 1 SEM (N=3). Bars with asterisks (*) indicate significantly different gene expression from control (One-Way ANOVA with Dunnett’s multiple comparisons test).................................................................................................. 61 Figure 4.6 Normalized mRNA expression of TRH (A), AAADC (B), SNAT288 (C), SNAT222 (D), SNAT220 (E) and ASMT (F) in the whole body of female adult Aedes aegypti after 3h, 12h, and 24h post blood feeding (black) and sugar feeding (white). Bars represent mean ± 1 SEM (N=3). Bars within the same time period or within the same feeding treatment with different letters indicate significantly different gene expression (Two-Way ANOVA with Holm-Sidak multiple comparisons test)....................................................... 63 Figure 4.7 Normalized mRNA expression of TRH (A), AAADC (B), SNAT288 (C), SNAT222 (D), SNAT220 (E) and ASMT (F) in the midgut of female adult Aedes aegypti after 3h, 12h, and 24h post blood feeding (black) and sugar feeding (white). Bars represent mean ± 1 SEM (N=3). Bars within the same time period or within the same feeding treatment with different letters indicate significantly different gene expression (Two-Way ANOVA with Holm-Sidak multiple comparisons test). .............................................................. 65 Figure 4.8 Normalized mRNA expression of TRH (A), AAADC (B), SNAT288 (C), SNAT222 (D), SNAT220 (E) and ASMT (F) in the Malpighian tubule of female adult Aedes aegypti after 3h, 12h, and 24h post blood feeding (black) and sugar feeding (white). Bars represent mean ± 1 SEM (N=3). Bars within the same time period or within the same feeding treatment with different letters indicate significantly different gene expression (Two-Way ANOVA with Holm-Sidak multiple comparisons test). ...................................... 67 Figure 4.9 Normalized mRNA expression of TRH (A), AAADC (B), SNAT288 (C), SNAT222 (D), SNAT220 (E) and ASMT (F) in the head of female adult Aedes aegypti after 3h, 12h, and 24h post blood feeding (black) and sugar feeding (white). Bars represent mean ± 1 SEM (N=3). Bars within the same time period or within the same feeding treatment with different letters indicate significantly different gene expression (Two-Way ANOVA with Holm-Sidak multiple comparisons test). .............................................................. 69  xi List of Abbreviations  5-HT   5-hydroxytryptamine (serotonin) AAADC  Aromatic amino acid decarboxylase ASMT   Acetylserotonin methyl transferase cDNA   complimentary DNA GC-MS  Gas chromatography mass spectrometry HG   Hindgut IAA   indoleacetic acid LC-MS  Liquid chromatography mass spectrometry LLOD   Lower limit of detection LLOQ   Lower limit of quantification MT   Malpighian tubule mRNA   messenger RNA Mel   Melatonin MG   Midgut PCR   polymerase chain reaction RT-PCR  reverse transcriptase polymerase chain reaction qPCR   quantitative real time polymerase chain reaction SNAT   Serotonin-N-acetyl transferase TPH   Tryptophan hydroxylase (vertebrate) TRH   Tryptophan hydroxylase (insect) WB   whole body   xii  Acknowledgements  I would like to thank my supervisor Dr. Mark Rheault, I would never have been here if he hadn’t taken me on as an undergraduate so many years ago. I’ve learned so much since starting in the Rheault Lab. Thank you as well to Dr. Susan Murch for introducing me to the breadfruit project and allowing me to visit the Kahanu Garden in Hana, Maui, Hawaii for an amazing experience. A graduate student couldn’t ask for more than what you both have offered. I would also like to thank my committee members throughout the past two years: Dr. Paula Brown and Dr. Miranda Hart. I would also like to thank Dr. Diane Ragone, without her this kind of research on breadfruit would not be possible. I am grateful to my friends and lab mates Nicholas Chow and Paige Zeniuk for making many early mornings and late nights of dissecting mosquitoes far more enjoyable than I thought possible and for both of your endless help and support throughout this project, this thesis would never have been completed without the two of you. I’d also like to thank all the other members of the Rheault Lab who assisted me along the way: Ian Cole, Melissa Cruz, Zerihun Demissie, Molly-Rae Walker and Emily Bernie. I’d also like to thank those from both the Murch Lab and the Brown Lab who assisted me in the chemistry that was so far beyond me: Teesha Baker, Broc Glover, Jensen Lund, Michael Chan, Jamie Findlay, and Xiaohui Zhang.   I also extend my thanks to the Breadfruit Institute, National Tropical Botanical Garden, Canadian Foundation for Innovation (CFI), and the Natural Sciences and Engineering Council of Canada (NSERC) for funding my research.  Finally I wish to thank my friends and family, especially my parents for all of their support. And most of all, I’d like to thank Caitlyn for her never-ending support both academically and non-academically across the last 4 years. I wouldn’t be here without you.    1 Chapter 1 :   Introduction  1.1 Discovery of Serotonin and Melatonin in Plants   Serotonin (5-hydroxytryptamine, 5-HT), an amine most commonly known for its role as a neurotransmitter in animals, was originally discovered in 1952 (Erspamer and Asero, 1952). Shortly thereafter, serotonin was also reported to be present in the legume Mucuna pruriens in 1954 (Bowden et al., 1954), indicating that serotonin may not be limited to the animal kingdom.  Throughout the late 1960s and early 1970s numerous studies investigated plant serotonin (Leete, 1967; Applewhite, 1972; 1973; Schneider and Wightman, 1973) eventually lead to its detection in > 40 plant species from 20 plant families (Roshchina, 2001). High levels of serotonin have been detected in nuts, butternuts, walnuts and hickory nuts (Feldman and Lee, 1985). Serotonin is also found in moderate quantities in fruits such as plantain (30.3 µg/g); pineapple (17.0 µg/g); banana (15.0 µg/g); kiwi fruit (5.8 µg/g); plums (4.7 µg/g) and tomatoes (3.2 µg/g) (Feldman and Lee, 1985).  The concentration of serotonin varies widely with 12.6 ng/100 g present in the sweet cherry cultivar ‘Van’ to 25–400 mg/ kg in walnuts and hickory nuts (Juglans regia) (Ramakrishna, 2011).   Immunolocalization in rice shows that serotonin concentrations are highest in the vascular parenchyma cells (Kang et al., 2007).  Melatonin (N-acetyl-5-methoxytryptamine), a compound derived from serotonin, has also since been shown to exist in plant species. It was first described in harvested plant tissues in 1995 (Dubbels et al, 1995; Hattori et al, 1995) and in growing plants in 1997 (Murch et al., 1997).   Melatonin has now been detected in more than 150 plants including traditional Chinese medicinal herbs (Chen et al., 2000), seeds and fruit of the edible plants (Manchester, 2000) and many other species (reviewed in Arno, 2014).  Concentrations of melatonin range from 6 pg•g−1 in the shoots of Ipomoea nil L. to 34 μg•g−1 in the root of Glycyrrhiza uralensis Fisch (Arnao, 2014).    1.2 Biosynthesis of Serotonin and Melatonin in Plants  Studies with in vitro-grown axenic plantlets of the medicinal species St. John’s wort (Hypericum perforatum L.) demonstrated that serotonin and melatonin were synthesized by  2 plants and were therefore not simply an artifact of an associated microorganism (Murch et al., 2001; 2002).   Biosynthesis of serotonin and melatonin in plants has now been described in both radioisotope tracer and molecular studies (Murch et al., 2001; Kang et al. 2007; 2011; 2012; Park et al. 2009; 2011; Figure 1.1).  Both serotonin and melatonin are derived from tryptophan and auxin (Murch et al., 2000), where tryptophan is metabolized to serotonin in two steps: (a) tryptophan is converted into tryptamine and (b) tryptamine is metabolized to serotonin (Murch et al., 2000). Serotonin is then acetylated followed by conversion of N-acetyl serotonin into melatonin (Murch et al., 2000; Bajwa et al, 2014).  Serotonin is generally present in high levels in plants and is not a rate-limiting factor for melatonin biosynthesis (Bajwa et al, 2014). Recently, the genes encoding four consecutive enzymes, namely tryptophan decarboxylase (TDC), tryptamine 5-hydroxylase (T5H), serotonin N-acetyl transferase (SNAT) and N-acetyl serotonin methyl transferase (ASMT), involved in converting L-tryptophan into melatonin were characterized (Kang et al., 2007, 2011, 2012; Park et al., 2011). Interestingly, it was found that the order of the reactions involved in serotonin biosynthesis in plants appears to be different than the animal biosynthetic pathway. Notably, the order of the hydroxylation and decarboxylation reactions is reversed (Figure 1; Stehle, 2011).     3  Figure 1.1 Biosynthetic Pathway for serotonin and melatonin in both animals and plants    4  1.3 The Roles of Serotonin and Melatonin in Plant Physiology  Despite its established presence in plants, the role of serotonin in plant metabolism is not fully understood; however, various mechanisms have been suggested including maintenance of cellular integrity, plant morphogenesis, delaying senescence, and cytoprotection (Murch et al., 2001; Kang et al., 2007, 2009; Ishihara et al., 2008; Lazar et al., 2013).  External application of serotonin has been shown to have an auxin-like effect on root elongation (Csaba and Pal, 1982; Murch et al., 2001; Murch and Saxena, 2004), while endogenous serotonin seems to accumulate in anthers at the critical stage of microspore differentiation (Murch et al., 2002).  In most instances, the role of serotonin is described in relation to the closely related indoleamine, melatonin. The relative ratios of serotonin and melatonin have several physiological functions in plants including regulation of photoperiod responses and light/dark cycles, regulation of plant growth and developmental pathways, root branching and secondary root growth, detoxification of reactive oxygen species and reduction of the physiological impact of environmental stresses such as heavy metals, UV radiation, temperature fluctuations and drought (reviewed in: Murch and Saxena, 2001; Paredes et al., 2009; Posmyk and Janas, 2009; Zhang et al., 2013; Feng et al., 2014). Most recently, melatonin was found to delay leaf senescence in an auxin-induced Arabidopsis mutant (Shi et al., 2015).  The possibility that serotonin or melatonin may be anti-herbivory compounds in plants has not previously been considered.  1.4 Breadfruit  Breadfruit, Artocarpus altilis (Parkinson) Fosberg, is a traditional crop food source in Melanesia, Micronesia and Polynesia. This Oceanic crop source provides large potential for food production due to its high fruit yield and its geographical overlap with regions where food is scarce (Navarro et al. 2007). When cooked, breadfruit flesh can be incorporated as a dietary staple and is directly comparable to other starchy carbohydrate products such as sweet potato and white rice. It is also an excellent source of dietary fiber (Ragone and Cavaletto, 2006). The fruits themselves are oblong, being approximately 12–20 cm wide and  5 12 cm long, and have a color ranging from light green to yellow as maturity progresses (Ragone, 1997). Fruit yields can differ significantly, ranging between 100 – 600+ fruits per year per tree. The individual fruits range from 1–6 kg depending primarily on specific variety and age (Fownes and Raynor, 1993; Ragone, 1997).  Artocarpus altilis is one of a number of tree species grown for their fruit within the Genus Artocarpus (Moraceae) alongside jackfruit (Artocarpus heterophyllus Lamarck) and champedak (Artocarpus integer (Thunberg) Merrill) (Purseglove, 1968). Two morphologically distinct variants of breadfruit exist: Artocarpus altilis and Artocarpus mariannensis Trécul (Trécul, 1847). These two species are involved in introgression resulting in a large number of hybridized forms and a large variety of breadfruit that consists of traits from both species. Morphological variations between fruits can include seedless to seeded fruits, deeply lobed leaves to leaves lacking lobing, as well as variation in fruit surface from relatively smooth to quite sharp and spiny (Fosberg, 1960; Coenan and Barrau, 1961; Ragone, 1991). Artocarpus altilis is often identified as having moderate lobing of the leaves, reaching approximately 2/3 the distance to the midrib, and paler yellow/yellow-green fruit that is rarely seeded. In contrast, Artocarpus mariannensis is more often associated with leaf lobes reaching less than ½ way to the midrib and fruits with stronger green coloration that are always seeded (Ragone, 1991). There is also a 3rd variety of breadfruit, which is described as a separate species under the name Artocarpus camansi Blanco (breadnut) that has very spiny fruit that are always seeded. Artocarpus camansi has historically been associated as a subspecies within traditional Artocarpus altilis but is actually a valid species due to its seeded nature separating it from modern Artocarpus altilis (Blanco, 1837; Quisumbing, 1940; Coronel; 1983). Artocarpus altilis can be both diploid (2n=56) and triploid (3n=84) whereas Artocarpus mariannensis and Artocarpus camansi are both diploid (2n=56) (Barrau, 1976; Jarrett, 1959; Ragone, 1991). In addition to its use as a food source, breadfruit can also produce a number of secondary products such as timber and medicine (Ragone, 1997). The male inflorescences alone have multiple uses including being pickled or candied and eaten, along with pain reduction if toasted flowers are rubbed on aching gums (Massal and Barrau, 1954; Morton, 1987). The burning of male inflorescences has also been used in traditional Oceanic cultures  6 to produce a smoke that repels mosquitoes and reduces the likelihood of mosquito biting (Olson, 1991; Jones et al. 2012). This observation suggests that breadfruit may be a novel source for insect repellent and/or insecticide development. Recent work has also shown that many tryptophan and tryptamine compounds such as 5-HT are in high abundance in Artocarpus altilis extract derived from the male inflorescences (personal communication, Murch and Turi). This thesis attempts to elucidate whether or not the 5-HT present in breadfruit has a toxic and/or physiological effect on mosquitoes. The basis for this research direction is presented in the following sections.  Figure 1.2 Photographs of breadfruit (Artocarpus altilis) from the NTBG Kahanu Garden site. Mature fruiting breadfruit tree (left). Immature fruit and male inflorescence (top right). Artocarpus camansi (breadnut) fruit (bottom right).  Photo by Matthew Glover (June 19, 2014).    7 1.5 Serotonin and Melatonin in Insects  Serotonin is an important stimulating hormone for diuresis, or the production of urine, in blood feeding insects. Early experiments showed that when a serotonin analogue, 5,7-dihydroxytryptamine, was injected into the gut of Rhodnius prolixus 24 h prior to blood feeding, the insects fed significantly less than normal, produced little to no immediate urine and did not undergo typical cuticle plasticization (stretching of the cuticle to accommodate increased volume) (Maddrell et al. 1993).  While the role of the serotonin in diuresis has been well described, the function of melatonin in insects is still poorly understood. As in vertebrates, melatonin in invertebrates is associated with diurnal cycles and circadian rhythms. In vertebrates, melatonin levels peak during the night (Hardeland et al. 1995). Measurements of melatonin levels and the time of day at which they peak have varied between species and within different tissues within a single species in the reported literature. In the vinegar fly, Drosophila melanogaster, melatonin peaks during the day whereas in the damselfly, Enallagma civile, there is no clear pattern and melatonin fluctuates drastically (Hintermann et al. 1996; Tilden et al. 1994). Melatonin in the cricket (Gryllus bimaculatus) peaked during the night in the compound eye, brain and palp whereas melatonin peaked during the day in other tissues such as the cercus, ovipositor, hind leg, and ovary indicating a difference in function of melatonin in differing tissues of the body (Itoh et al., 1995).  1.6 Biosynthesis of Serotonin and Melatonin in Insects  Serotonin and melatonin biosynthesis in insects is similar to the metabolic pathway described for plants (Figure 1.1).  The main precursor is also tryptophan, which is hydroxylated by tryptophan hydroxylase (TRH) to form 5-hydroxytrytophan.  Tryptophan hydroxylation by TRH has been shown to be the rate-limiting step in production of serotonin (Livingstone and Tempel, 1983; Neckameyer and White, 1992).  In a subsequent reaction, DOPA decarboxylase (DDC) converts 5-hydroxytryptophan to 5-hydroxytryptamine (serotonin) (Vömel and Wegner, 2008; Reiter et al., 2010; Figure 1.1). Melatonin is then synthesized by a similar process to that described in plants, and involves a reversible two- 8 step N-acetylation and methyl addition (Sugden, 1989; Slominksi et al., 2002; Dempsey et al., 2014). The biosynthetic pathway in animals leading to the production of the biogenic amines octopamine, tyramine and dopamine from tyrosine has also been characterized (Figure 1.3). It is interesting that while serotonin production is completed by a two-step reaction from tryptophan with the first step of hydroxylation and the second being decarboxylation. Both pathways produce octopamine and norepinephrine from tyrosine using a similar two-step reaction occurs except that decarboxylation is the first step and hydroxylation is the second step. It is worth noting that the DOPA decarboxylase involved in dopamine synthesis from DOPA is the same DOPA decarboxylase from the decarboxylation of 5-hydroxytryptophan to 5-hydroxytryptamine (Figure 1.1).  1.7 5-HT Receptors in Vertebrates and Invertebrates  The majority of our current knowledge of the 5-HT receptors present in insects is based on homology with well-characterized vertebrate 5-HT receptors. Barring a few exceptions, the following classifications are based primarily on sequence homology, second messenger pathway association and pharmacology (Hannon and Hoyer, 2008; Nichols and Nichols, 2008). The 5-HT1A, 5-HT1B and 5-HT5 receptors are associated with inhibiting cAMP synthesis, 5-HT2α and 5-HT2β are associated with increasing cytosolic Ca2+ levels and 5-HT4, 5-HT6, and 5-HT7 are associated with promoting cAMP synthesis (ibid). All of the 5-HT receptors are G-protein coupled receptors. In the honeybee brain, affinity of [3H]-serotonin for 5-HT receptors is high (97% affinity) (Erber et al., 1993), however the addition of the non-selective 5-HT1, 5-HT2 and 5-HT7 receptor blocker methysergide effectively reduces the binding of [3H]-serotonin. In contrast, selective blockers such as ketanserin (5-HT2), 8-OH-DPAT (5-HT1A, 5-HT7) and buspirone (5-HT1A) do not entirely reduce binding of [3H]-serotonin indicating that [3H]-serotonin can be used to label a multiple 5-HT receptors. Expression patterns of the various 5-HT receptors differ heavily between different insect species and even across short spans of developmental time in the same insect. For example in Drosophila melanogaster, through both qPCR and in situ hybridization, the  9 transcripts for the 5-HT2α receptor can be seen as early as 3 hours after embryonic development (Colas et al., 1995). It was also shown that the 5-HT2α receptor coexpresses with the developmental pair-rule gene fushi-tarazu in even numbered segments during development (ibid). Later in development, Nichols showed that expression of 5-HT2α in the brain changes between regions of the brain during just the duration of 3rd instar larval development (2007).   1.8 Biogenic Amine Receptors as Targets for Insecticide Development  Biogenic amines such as octopamine and tyramine can act as neuromodulators in insects and invertebrates much like serotonin, melatonin and dopamine (Orchard, 1982). Octopamine and tyramine act as invertebrate analogues to epinephrine and norepinephrine, respectively (Lange, 2009). These compounds, along with other biogenic amines can act as neuromodifier hormones that change the responsiveness of other nervous tissue to a stimulus and produce a different response. For example, low levels of serotonin in vertebrates can lead to behaviors such as aggression whereas increased levels of serotonin and octopamine increase aggression in insects such as crickets (Collins and Miller, 1977). It has been shown that octopamine does not initiate an aggression response, but acts as a neuromodulator to enhance aggression by lowering the threshold of serotonin required to initiate an aggressive response, thereby promoting that behavior indirectly (Adamo et al., 1995). Levels of biogenic amine neuromodulators such as octopamine, dopamine and serotonin in the mushroom bodies of the brain of worker honeybees increase with age (Alaux et al. 2009a) and artificially raising levels of either octopamine or tyramine can cause premature advancement or slower advancement towards mature adult foraging behavior (Alaux et al. 2009b). Octopamine has also been extensively implicated in increasing heart rate during flight in locusts (Orchard et al., 1993). In a similar fashion, octopamine also stimulates production of adipokinetic hormone (the insect equivalent of glucagon) for mobilization of fat stores in order to provide energy for flight (Yakovlev and Gordya, 2012). 5-HT can act in a similar fashion where it can modify muscle responsiveness to excitatory neurotransmitters such as L-glutamate in order to increase rates of muscle contraction (Tamashiro and Yoshino, 2014). Tyramine however lacks a fully developed knowledge base, with primary knowledge  10 indicating that it acts in opposition to octopamine (similar to norepinephrine in vertebrates) (Lange, 2009).   Figure 1.3 Biosynthetic pathway for dopamine and octopamine and their intermediates from tyrosine  The biogenic amine L-DOPA is synthesized by a similar tyrosine hydroxylase in plants and L-DOPA has been shown to act as a highly active allelochemical in the legume Mucuna piriens (Pattison et al., 2002; Vadivel and Janardhanan, 2001).  Quite recently, work by Meyer et al. (2012) and Nuss et al. (2015) have shown success in the testing of receptors of the biogenic amine neuromodulator dopamine as targets  11 for insecticide development. Notably, a number of dopamine receptor antagonists were shown to act as successful insecticidal agents in initial studies using 3rd instar Aedes aegypti and Culex quinquefasciatus. This recent research brings to light the potential for utilizing biogenic amines such as dopamine, serotonin, and octopamine receptors and the associated G-protein coupled receptor (GPCR) pathways as novel targets for insecticidal development for control of insect vector diseases such as Dengue fever, yellow fever and Malaria.  1.9 Serotonin in Regulation of Digestion and Diuresis in Insects  The study of serotonin in insects has concentrated primarily around its association with digestion and feeding. Serotonergic neurons from the mesothoracic ganglion innervate the digestive tract and control gut contraction (Orchard, 2006). These neurons release serotonin into the haemolymph (blood) of blood feeding insects such as Rhodnius prolixus during feeding (Lange et al. 1989). In cockroaches, serotonin reduces feeding behavior when artificially injected into the haemolymph (Cohen, 2001). However, French et al. later showed that injection of 5-HT directly into the haemolymph causes no change in food intake whereas direct injection into the brain resulted in a significant reduction of food intake (2014). It was also shown that serotonin levels in the honeybee (Apis mellifera) vary across age with higher serotonin levels later in life as well as differing serotonin levels in honeybees from different levels of the social hierarchy (Wagener-Hulme et al. 1999; Schulz and Robinson, 1999). One of the most important functions of serotonin in insects is its use in diuretic responses. There are two primary diuretic hormones present that act synergistically in insects, the first being a diuretic hormone, now referred to as cortico-tropin-releasing factor-related peptide (CRF) as well as serotonin (Maddrell et al. 1991; Orchard, 2006; Te Brugge et al. 2011).  When an insect feeds, food is passed through the pre-oral cavity past the crop and foregut and arrives at the midgut (Figure 1.4). The midgut is the primary site of digestion and absorption of the insect digestive system. The highly alkaline environment (pH = 9 to 11) in some Dipterans and Lepidopterans helps degrade food for digestion and allow nutrients to move passively across the peritrophic membrane and then be absorbed across midgut epithelial villar cells (House, 1974; Dadd, 1975). Nutrients and fluids are absorbed across the midgut epithelium, analogous to the mammalian small intestine and are carried to tissues via  12 haemolymph (Moffett et al. 2012). The Malpighian (renal) tubules in insects arise at the junction of the midgut and hindgut.  The Malpighian tubules are blind-ended tubular structures that are single cell thick (Phillips 1981; Figure 1.4). The number of Malpighian tubules can vary from two in Coccids to >250 in Orthopterans (Phillips, 1981). These structures perform the same functions of detoxification and filtration of blood and the elimination of waste as the mammalian kidney, but utilize an ATP-driven ion transport ultrafiltration process as opposed to pressure filtration found in mammalian kidneys. Ions are actively transported from the haemolymph to the tubule lumen, generating an osmotic pressure gradient, which drives water transport into the tubule. Subsequently in more proximal regions of the tubules ions and nutrients may be selectively reabsorbed back into the haemolymph with the remaining filtrate being left to pass from the tubules into the hindgut (Figure 1.4). The hindgut is responsible for further modification of the ultrafiltrate with additional selective ion and water reabsorption, a physiological function analogous to the mammalian large intestine. Remaining undigested food and ultrafiltrate is then excreted (Figure 1.4).     Figure 1.4 Diagram of the Aedes aegypti alimentary canal with major ion and water movement in the major osmoregulatory tissues   13 The small size of insects and their high surface area to volume ratio increases their susceptibility to desiccation, thus requiring insects to have tight control and regulation of mechanisms responsible for ion and water homeostasis (Maddrell et al., 1991). Insects that imbibe periodic blood meals have an urgent need to effectively absorb nutrients while quickly eliminating excess fluid obtained during feeding (Figure 1.5). The kissing bug Rhodnius prolixus can ingest up to 10 times its’ unfed weight during a blood meal (Lange et al. 1989). Female mosquitoes can take up a similar relative volume during a blood meal as well (Figure 1.5). This results in a marked increase in mass and volume of the organism, the excess water volume, ions and toxins present in the blood can pose a major threat to homeostasis, additionally impeding the insect’s capability to avoid capture by predators (O’Donnell, 2009; Figure 1.5).   Figure 1.5 Photograph of female Aedes aegypti taken during a blood meal with the formation of a urine droplet apparent only minutes after onset of blood feeding. Photo credit: Jan Vozenilek    14 1.10 Model Systems to Investigate the Role of Serotonin in the Insect Gut  The importance of serotonin in the regulation of gut function and urination in insects has been investigated with several model systems.  In Rhodnius prolixus, serotonin was shown to increase 14-fold in the haemolymph in response to feeding (Lange et al. 1989).   Further details of the physiological mechanisms of serotonin responses in the insect gut can be made by isolating the Malpighian tubules and exposing the tissues to individual compounds or crude extracts in order to determine if the rate of fluid secretion and ion concentrations of urine and haemolymph can be determined by the Ramsay assay (Maddrell et al. 1998). Isolated Malpighian tubules treated with serotonin in a Ramsay assays (Figure 1.6) showed increased secretion rates, which could be completely blocked by serotonin receptor antagonists ketanserin and spiperone (Maddrell et al. 1991).  Feeding stimulates the release of serotonin into the haemolymph by the abdominal neurons and the serotonin binds to receptors on the basolateral membrane of the Malpighian tubules causing an increase in cyclic AMP (adenosine 3',5'-cyclic monophosphoric acid) in the Malpighian tubule principal cells (Lange et al. 1989; Figure 1.7). Cyclic AMP stimulates the activity of an apical membrane bound H+ V-type ATPase, increasing the rate of proton transport across the apical membrane (Maddrell et al., 1969; Barrett and Orchard, 1990, Montoreano et al. 1990; Maddrell et al., 1993; Figure 1.7). This protomotive force drives cation transporters exchanging Na+/K+ for H+ (Weng et al. 2003, Rheault et al. 2007). The increase in ion concentration in the lumen of the tubule drives passive water transport through aquaporins across both membranes from the haemolymph into the tubule. The location of the H+ V-type ATPase and the Na+ and K+/H+ exchange transporter is reversed to the basolateral membrane in the proximal tubule causing active ion transport to occur out of the tubule lumen and into the haemolymph to recover K+, Cl- and water (Patrick et al. 2006; Figure 1.7).  In insects, the H+ V-type ATPase and its associated cation/H+ exchange transporter provide the vast majority of ion transport (Weng et al. 2003; Figure 1.7).    15  Figure 1.6  Schematic drawing of the Ramsay assay to test urine production of extracted insect Malpighian tubules.    Figure 1.7 Schematic drawing of the principal and stellate cells of Aedes aegypti Malpighian tubules indicating the effect of 5-HT excitation of the V-type H+ ATPase leading to increased Na+/K+ transport from the haemolymph to the tubule lumen.   16 1.11 Plant Serotonin in Insect Physiology  The presence of high levels of serotonin in plant tissues, especially in the outer cells of the vasculature, may indicate a new role for serotonin as an anti-herbivory compound.  It is likely that insects consuming high levels of serotonin in plant tissues would experience significant physiological symptoms including an inability to regulate fluids leading to desiccation or bloating.  As a result, serotonin and related compounds produced by plants may find interesting new applications as natural larvicidal, insecticidal and deterrent applications.  The potential for insect control varies depending on the stage of the insect life cycle (Figure 1.8).    17  Figure 1.8 Life cycle of Aedes aegypti  1.12 Plant Extract Activity on Insect Larva  The majority of data currently available has targeted the larval stage of the insect life cycle in aquatic systems (Figure 1.8) and most are oil-soluble extracts that float on the water surface.  Several effective plant extracts have been identified including: camphor (Cinnamonum camphora), lemon (Citrus lemon), frankincense (Boswellia carteri), dill (Anethum graveolens), myrtle (Myrtus communis), juniper (Juniperus communis), black pepper (Piper nigrum), verbena (Lippia citridora), sandalwood (Santalum album), thyme  18 (Thymus serpyllum), amyris (Amyris balsamifera), cedar (Juniperus virginiana), and helichrysum (Helichrysum italicum) (Amer and Melhorn, 2006).  Park et al. (2011) demonstrated that oil extracts of Eucalyptus globulus, Melaleuca dissitiflora, Melaleuca quinquenervia and Melaleuca linariifolia had significant larvicidal activity with greater than 80% mortality of 3rd instar Aedes aegypti.  Composition analysis revealed that the essential oils were composed primarily of allyisothiocyante, p-cymene, (-)-limonene, (+)-limonene, γ-terpenene, α-terpenene and (E)-nerolidol (Park et al. 2011). In a similar study, a variety of essential oils including Cinnamomum zeylanicum, Cuminum cyminum, Curcuma longa, Cyperus scariosus, Juniperus macropoda, Ocimum basilicum, Nigella sativa, Pimpinella anisum, Rosmarinus officinalis, and Zingiber officinale were tested against 4th instars of three mosquito species, Aedes aegypti, Anopheles gambiae, and Culex quinquefasciatus with all but Rosmarinus officinalis yielding LC50 values ranging between 50 ppb and 325 ppb (Prajapati et al. 2005). Treatments of Hypericum polyanthemum on larval Aedes aegypti yielded not only 24 hour larval mortality of 43.1% at an oil exposure of 100 ppb but also determined that the major components (benzopyrans and precocenes) prevented pupation in 4th instars and adult emergence in pupa (da Silva et al. 2013). In 2008, Hyptis fruticosa, Hyptis petinata and Lippia gracillis essential oil showed LC50 values for Aedes aegypti larvae of 502, 366 and 98 ppm, respectively (Silva et al. 2008). It was then shown that the three oils contained primarily thymol, 1,8-cineole, γ-terpenene, carvacrol, β-caryophyllene, caryophyllene oxide, and R-limonene. Of these isolated terpenes, 1,8 cineole and β-caryophyllene had the lowest mortality with LC50 values of 1381 and 1202 ppm respectively, whereas R-limonene, carvacrol, and thymol displayed significantly more mortality with LC50 values of 37, 70, and 79 ppm respectively (Silva et al. 2008).  A separate study determined that the primary constituent of steam distilled essential oil derived from Trachyspernum ammi seeds were composed predominantly of thymol (66.96%) and several other terpenoids, p-cymene (17.39%), γ-terpenene (10.12%) and β-pinene (2.26%) (Pandey et al. 2009). Together these studies suggest that plants produce a range of compounds with serotonin-like structures that have larvicidal activity. One advantage to such plant-based serotonin mimics is the capacity to produce a water-soluble, indoleamine-rich plant extract.  Such products are increasingly desirable as a recent study in West Africa indicated that the use of typical organophosphate- and pyrethroid-based chemical insecticides on the cotton agricultural pest  19 Bemisia tabaci was inadvertently increasing resistance in the malaria vector Anopheles gambiae (Gnankiné et al. 2013).  Therefore, there is a need for a treatment that is easily dissolved in water, effective at low doses, with few applications and targets a specific core physiological response to prevent the development of resistance and to mitigate damage to non-target species (Gnankiné et al. 2013).   1.13 Insect Repellent Activity of Plant Extracts  The use of plant extracts in insect repellent and insecticide use in insect pests such as adult mosquitoes has been widely practiced by many indigenous cultures around the planet for thousands of years. This can be accomplished by volatilizing plant essential oil or by burning plant tissue to yield smoke. A recent study demonstrated that smoke generated from Corymbia citriodora, Ocimum suave, Otostegia integrifolia, Ocimum lamiifolium and Olea europaea were all effective at preventing landings of both Aedes aegypti and Anopheles gambiae with Corymbia citriodora being comparable to commercially available 10% N,N-diethyl-meta-toluamide (DEET) (Dube et al., 2011). The same plants also showed repellent effects by release of volatile compounds alone without burning (ibid). It was also shown that the essential oil of Juniperus macropoda, Pimpinella officinalis and Zingiber officinale have strong ovicidal effects whereas Cinnamomum zelyanicum, Cuminum cyminum, and Rosmarinus officinalis possess strong repellent effects against adults of Aedes aegypti, Anopheles stephensi and Culex quinquefasciatus (Prajapati et al., 2005).  Traditional indigenous knowledge was used to identify the male inflorescences of Artocarpus altilis as a potential source of insect repellent phytochemistry and both smoke and ethanol extracts effectively repelled mosquitoes in a bioassay (Jones et al., 2012).   1.14 Insect Serotonin Metabolism as a Target for Insecticides    Esquivel et al. (2014) recently suggested the Malpighian tubules, and more specifically, the V-type H+-ATPase response post blood feeding as a likely candidate for novel insecticide development after seeing transcriptomic changes in the tubules within 24 hours of taking a blood meal. By targeting this system in blood feeding insects, it is possible  20 that new insecticides and insect repellents may be developed that reduces widespread toxic effects in non-target organisms.  1.15 Plant Serotonin for Insect Biocontrol  Insects such as Rhodnius prolixus, Aedes aegypti and Anopheles gambiae are vectors for some of the most economically damaging diseases to humankind including Chagas’ Disease, yellow fever Dengue fever, and malaria, respectively. There are approximately 225 million cases and 1 million deaths per year due to malaria (Murray et al. 2012).  Mosquitoes belonging to the genus Aedes alone are responsible for 50 to 100 million infections per year, primarily in the form of Dengue fever (Halstead, 2007).  The serotonin receptors in the Malpighian tubules are a novel target for development of natural insecticide for biological control.  The isolated Malpighian tubule bioassay (Figure 1.6) is an ideal system for screening plant extracts for specific activity on insect renal function, as it can be used to measure indicators of overall renal function such as fluid secretion and urine solute concentration. It may even be used to measure specific targeted roles of the tubules such as drug detoxification from the haemolymph. Alternatively, or in conjunction, systems typically used for heterologous protein expression such as Xenopus laevis oocytes or mammalian cell lines that express one or more 5-HT receptors could be used for a larger scale approach to test 5-HT receptor activity from biofractionated extract components from a multitude of plant species. Further studies have the potential to confirm plant-based serotonin as an important regulator of insect physiology and insecticidal plant extracts.   1.16 Research Hypothesis and Objectives   This thesis investigated two hypotheses. The first hypothesis was that extracts of male inflorescences of breadfruit (Artocarpus altilis) and related species are toxic to mosquito larva.  To determine the relative levels of toxicity of breadfruit inflorescence extracts, I designed the following research objectives: a) To optimize the method of extraction of breadfruit male inflorescences  21 b) To determine the phytochemical profile of breadfruit male inflorescence extracts  c) To optimize the methods for application of breadfruit extracts to insect larva. The second hypothesis of the thesis was that breadfruit male inflorescence extracts are toxic to insect larva through mediation of 5-HT metabolism in the gut.  This hypothesis was investigated with the following objectives: a) To identify and quantify 5-HT and melatonin in the haemolymph of mosquitoes after extract exposure b)  To determine the expression patterns of 5-HT synthesis enzymes in the tissues of larval Aedes aegypti before and after exposure. This research will enable the development of an optimized breadfruit extract for use as an insect repellent/insecticide.    22 Chapter 2 :   Investigation of Different Extraction Methods of Breadfruit (Artocarpus altilis) on Insecticidal Activity of Yellow Fever Mosquito (Aedes aegypti) larvae  2.1 Chapter Summary  The burning of breadfruit male inflorescences has been used in traditional Oceanic cultures to produce a smoke that repels mosquitoes and reduces the likelihood of mosquito biting (Olson, 1991; Jones et al. 2012). To optimize chemical extracts of male inflorescences, I compared two different extraction methods, methanol and pentane, and determined insecticidal activities.  Methanol extracts were significantly more toxic toward mosquito larvae than the pentane extracts. This difference indicates that a compound, or likely a family of compounds, has been extracted with methanol but not extracted by pentane. I hypothesize that these compounds are polar in nature based on the extraction method and the properties of the methanol.   2.1.1 Insect Rearing  Aedes aegypti were obtained from a colony reared at the University of British Columbia Okanagan. Larvae were hatched in 9"x13" polypropylene hatching trays in ultrapure water in an incubator maintained at 27°C, 80% relative humidity, and on a 12:12 hr light:dark cycle. Larval mosquitoes were fed ad libitum a 3:1 mixture of Tetramin© fish flakes (Tetramin©, Blacksburg, Virginia, USA) and dry active yeast (MP Biomedicals, Solon, Ohio, USA), respectively. Rearing water was changed once every 2 days until larva underwent metamorphosis into the non-feeding pupal stage. Emergent adults were collected by gentle vacuum into 12"x12" mesh cages. Cages were kept at ambient room temperature (22-25°C) and humidity on a 12:12 hr light:dark cycle. Adults were fed a 10% (w/v) sugar water solution. In addition, adults were fed sterilized sheep’s blood once per week (Cedarlane Laboratories, Burlington, Ontario, Canada). Three days post blood meal an egg-laying dish containing P5 Filter paper (Fisher Scientific, Pittsburgh, Pennsylvania, USA)  23 saturated with distilled water was placed in the cages containing adults. Adults were allowed to lay eggs for 5 days before the filter paper and eggs were collected.  2.1.2 Plant Tissue Collection  The Breadfruit Institute manages the world’s largest curated collection of breadfruit cultivars representing 34 Pacific Island groups, the Philippines, Indonesia, Honduras and the Seychelles. The germplasm collection is comprised of 326 well-documented trees representing the breadfruit complex of Artocarpus altilis, Artocarpus camansi, A. mariannensis, and A. altilis x A. mariannensis hybrids (Jones et al. 2011). The trees were collected from 1978–2004 and are conserved at Kahanu Garden in Maui (20°47’57.07” N, 156°02’18.42” W).  The orchard occupies a single 12 acre site at an elevation of about 15 m with a mean maximum temperature of 27.1 ºC, mean minimum temperature of 19.7 ºC, an average of 2051 mm of rain each year (Western Regional Climate Center; http://wrcc.dri.edu/), in a soil that is described as ‘‘Hana Very Stony Silt Clay Loam’’ (http://websoilsurvey.nrcs.usda.gov) derived from volcanic ash, it is typically well draining, slightly/moderately acidic and contains approximately 8% organic matter in the surface layer. A base of deep lava subtends the soil surface layer.  Soil nutrient analysis of this location was previously published (Jones et al. 2011). The mature trees produce male inflorescences at regular intervals as described in Jones et al., (2010).  To get sufficient tissue for preliminary studies, inflorescences were collected from many trees and pooled into a bulk sample. The inflorescences were dried in the sun for approximately 4 days and shipped to UBC Okanagan for further processing.  Samples visibly contaminated with fungus were not used for experiments and discarded.  2.1.3 Methanol Tissue Extraction  Methanol extractions for the insect larvicidal bioassay consisted of dried ground Artocarpus altilis male inflorescence material that was added to 500 mL of reagent grade methanol (Fisher Scientific, Toronto, Ontario) in a 1 L glass bottle and shaken at 50 rpm at room temperature for 24 hours. The methanol extract was vacuum filtered prior to drying.  24 Methanol was removed by rotovap (Buchi Rotovap, VWR, Mississauga, ON) and the residual extracts were stored at –20 ºC until further analysis. Dried extract was re-suspended in DMSO prior to larval exposures. Recovery of extract from breadfruit inflorescences averaged 1.38 ± 0.05 grams (N=2) per 15.00 g or ~9% of plant material by methanol extraction.  2.1.4 Pentane Tissue Extraction  A 1:2 ratio (w/v) of plant material to pentane was premixed in an Erlenmeyer flask and dispensed into a custom built apparatus for pressurized solvent extraction.  Water at 80 ºC – 90 ºC was pumped through a circulating water jacket to warm the metal cylinder until the internal temperature was sufficient to generate pentane steam.  Heating continued until an internal pressure of 75–80 psi was achieved and the extraction was held at these conditions for one hour. The system was then cooled to reduce the pressure and a ball valve at the base of the cylinder was opened and the pentane extract was collected into a 1000 mL round bottom flask.  Pentane was removed by rotovap (Buchi Rotovap, VWR, Mississauga, ON) and the residual extracts were stored at –20 ºC until further analysis. Dried extract was re-suspended in DMSO prior to larval exposures. Recovery of extract from breadfruit inflorescences averaged 38 grams per kg or ~ 4 % from starting plant material.  2.1.5 24-hour LC50 and LC90 Determination  One milliliter of the DMSO extract mixture was added to 100 mL polyethylene beakers containing 99 mL of ultra-pure water. The final concentration of DMSO in all samples was 1%. A minimum of seven concentrations were used for final analysis. Solutions were stirred with a glass rod and twenty 4th instar larvae were added to each polyethylene beaker containing 100 mL of exposure fluid. Both female and male 4th instars were used for larvicidal experiments. Beakers were covered with petri dishes to minimize evaporation and mortality was assessed after 24 hours. Five replicates were used for each experiment. Controls contained 100 mL ultrapure water or 99 mL ultrapure water and 1 mL DMSO. The  25 24-hour LC50 and LC90 values were calculated by probit analysis using IBM SPSS Statistics v20 (International Business Machines Corps, Armonk, New York, USA)  2.2 Results  Two different extraction methods, namely methanol and pentane, were used on pooled variety male inflorescence samples of Artocarpus altilis. The pentane extract yielded extremely low mortality, regardless of the concentration used during the larvicidal assay. A maximum mortality value of 2.00 ± 1.22% was obtained with the pentane extract of Artocarpus altilis at a maximum concentration of 5000 mg/L of extract. No mortality was observed between 0 and 1000 mg/L whereas the same mortality of 2.00 ± 1.22% was observed at both 2000 mg/L and 5000 mg/L. In comparison, the methanol extract yielded no mortality between 0 and 50 mg/L, but increased to 4.00 ± 1.87% death at 191 mg/L, and 21.00 ± 4.85% death at 381 mg/L. The methanol extract achieved a maximum observed mortality value of 70.00 ± 1.22% at a concentration of 964 mg/L. The low solubility of both the methanol and pentane extracts in the 1% DMSO water solution prevented higher concentrations than those listed above from being tested.  Due to a lack of mortality, it was not possible to determine a 24-hour LC50 and LC90 for the pentane extract of Artocarpus altilis. However, despite the lack of a complete mortality curve including both 0% and 100% mortality with the methanol extract of Artocarpus altilis, a 24-hour LC50 and LC90 could be determined. This mortality curve, provided an LC50 of 752 mg/L and an LC90 of 1158 mg/L for the methanol extract. Due to the lack of flanking points on either side of the probit analysis, the error for both values is quite large (Table 2.1). Taken together, the lack of a 24-hour LC50 and LC90 for the pentane extract and the high values for the methanol extract 24-hour LC50 and LC90 imply very low toxicity relative to values obtained for other plant extracts in the literature (Table 2.1). 26 Table 2.1 Larvicidal activity of pentane and methanol Artocarpus altilis extracts  Plant Essential Extract LC50 (mg/L) LC50 Lower CI LC50 Upper CI LC90 (mg/L) LC90 Lower CI LC90 Upper CI Publication Artocarpus altilis (methanol) 752 641 906 1158 987 1441  Artocarpus altilis (pentane) Max mortality of 2.0% obtained at 5000 mg/L  Hyptis fruticosa 502 499 505 n/a n/a n/a Silva et al. 2008 Hyptis petinata 366 363 369 n/a n/a n/a Silva et al. 2008 Lippia gracillis 98 96 100 n/a n/a n/a Silva et al. 2008 Citrillus colocynthis 75 63 86 538 390 687 Rahuman & Venkatesan 2008 Trichosanthes anguina 554 482 626 2235 1742 2728 Rahuman & Venkatesan 2008 Coccinia indica 309 267 351 1339 1024 1637 Rahuman & Venkatesan 2008 Momordica charantia 199 173 225 780 605 955 Rahuman & Venkatesan 2008 Eucalyptus citriodora 58 53 63 88 78 104 Zhu et al. 2006 Cinnamomum cassia 80 70 88 123 109 151 Zhu et al. 2006 Nepeta cataria (catnip oil) 70 65 76 97 88 112 Zhu et al. 2006  27 2.3 Discussion   The toxicity of breadfruit inflorescence extracts in Aedes aegypti larvae was analyzed and the methanol breadfruit extract was significantly more toxic than the pentane extract.  The apparent difference in toxicity level of the methanol versus pentane breadfruit extracts may be attributed to the different chemical properties of the two solvents, and by extension their ability to preferentially extract certain compounds.  Methanol is a universal extraction solvent and can extract both non-polar organic compounds and polar organic molecules. It is commonly used a solvent in the manufacturing of vitamins, hormones and pharmaceuticals and is miscible with water, ethanol, ketones and organic solvents (MERCK Online Index). In contrast, pentane is only able to extract non-polar organic compounds from the plant material. The extracted non-polar organic compounds are expected to be similar and/or the same as those extracted with methanol. Both extracts are also unlikely to include terpenes and other volatile compounds typically associated with insect toxicity due to the high temperature rotoevaporation step during their preparation. As such, the observed toxicity difference between the two extraction methods is likely due to the presence of one or more polar compounds in the methanol extract, which are inherently absent in the pentane extract. The possibility that additional polar compounds exist in the methanol extract warrants further investigation. Interestingly, the results thus far do not preclude a role for serotonin or other biogenic amines in the observed toxicity of the methanol extract. Serotonin is a relatively polar organic compound and would therefore, if present, be expected to appear among the compounds extracted by methanol.      28 Chapter 3 :   Chemical Characterization of Breadfruit Extracts  3.1  Chapter Summary  In the original breadfruit male inflorescence extracts described in Chapter 2, the specific variety of breadfruit was not identified.  One objective of this chapter was to determine whether different cultivars have different insecticidal activity using 2 hybrids, ‘ulu afa’ and ‘Lipet’ (Artocarpus altilis x Artocarpus marianensis) and Dugdug (Artocarpus camansi) in comparison to the previous mixed Artocarpus altilis sample.  Phytochemical characterization included identification of volatiles, potential to detoxify reactive oxygen species (ROS) and neurological indoleamines.   3.2 Materials and Methods  3.2.1 Plant Tissue Collection  The Breadfruit Institute manages the world’s only curated collection of breadfruit cultivars representing 34 Pacific Island groups, the Philippines, Indonesia, Honduras and the Seychelles. The germplasm collection is comprised of 326 well documented trees representing the breadfruit complex of Artocarpus altilis, Artocarpus camansi, A. mariannensis, and A. altilis x A. mariannensis hybrids (Jones et al. 2011; Chapter 2). Inflorescences were harvested from the trees in Hana in June of 2014 at different stages of ripeness and shipped to Canada. Upon arrival it was determined that many of the shipped samples had been contaminated by unidentified fungi. Samples which were not visually contaminated were isolated and used in all subsequent studies.   3.2.2 Methanol Tissue Extraction  Methanol extractions for the insect larvicidal bioassay consisted of dried ground Artocarpus altilis male inflorescences material that was added to 500 mL of reagent grade methanol (Fisher Scientific, Toronto, Ontario) in a 1 L glass bottle and shaken at 50 rpm at  29 room temperature for 24 hours. Methanol was removed by rotovap (Buchi Rotovap, VWR, Mississauga, ON) and the residual extracts were stored at -20 ◦C until further analysis. Dried extract was re-suspended in methanol prior to analysis. Samples representing Artocarpus altilis ulu afa, Artocarpus altilis Lipet, and Artocarpus camansi were dried and resuspended twice in order to further fractionate known quantities for multiple samplings. The mixed sample was processed as in Chapter 2 with only one drying and resuspension in methanol.  3.2.3 Determination of Antioxidant Activity by DPPH  Radical scavenging activity (antioxidant activity) was determined using a colorimetric assay using 2,2-diphenyl-1-picrylhydrazyl (DPPH). Methanolic extracts of each of the 3 varieties of Artocarpus (Artocarpus altilis ulu afa, Artocarpus altilis Lipet, and Artocarpus camansi) were prepared by adding 1.64 mg of dried methanol extract to 10 mL of HPLC-grade methanol.  A DPPH solution was made by dissolving 40 mg DPPH and 1L HPLC-grade methanol. A trolox solution was made by dissolving 25 mg trolox in 50 mL HPLC-grade methanol. Both DPPH and trolox solutions were stored at 4°C  and were wrapped in aluminum foil until use. Experimental samples were prepared by adding 0.1 mL, 0.2 mL, 0.3 mL, and 0.4 mL Artocarpus altilis methanol extracts to 4 falcon tubes in triplicate. 10 mL of DPPH solution was added to each tube. These 12 tubes were prepared for each of the 3 varieties of Artocarpus altilis extracts. Trolox standards consisted of adding 0.1 mL, 0.2 mL, 0.3 mL, and 0.4 mL trolox standard with 10 mL DPPH solution each run with 3 technical replicates. All falcon tubes were then placed on a wrist shaker at 100 rpm for 1 hour at 22°C. Absorbance values for trolox standards were then measured at 517 nm on a spectrophotometer. The mass of extract added to each falcon tube was plotted against the absorbance at 517 nm. The trolox standard formed a standard curve that allowed the determination of DPPH degradation in the breadfruit extract samples. The determination of antioxidant activity was measured as μmol trolox equivalents (TE)/100 g.    30 3.2.4 GC-MS of Breadfruit Extracts   Breadfruit methanol extracts were analyzed by capillary gas chromatography mass spectrometry (GC-MS) to identify potential metabolites present in the 4 varieties of Artocarpus. A 1 µL aliquot of sample was injected (splitless) into an Agilent 7890A GC (Agilent , Mississauga, ON, Canada) coupled to an Agilent 5975C inert MSD (Agilent) and equipped with an J&W DB-5ms Ultra Inert capillary column, 20 m x 0.180 mm i.d. with 0.18 µm film (Agilent). The instrument was operating with the following parameters:  oven conditions, initial temperature of 80°C for 1 min, increased by 2°C/min to 114°C, and held for 1 min., then increased by 0.5°C/min to 118°C and held for 1 min. then increased by 2°C/min to 185°C, then finally increased to 310°C at a rate of 5°C/min and held for 2 min. (total run time 88.5 min.); initial injection inlet temperature was set at 250°C; under constant flow at 0.4 ml/min of helium carrier gas; mass spectrometer detector low/high mass ranges set at 40/550; mass spectrometer ion source temperature set at 280°C; mass spectrometer source temperature set at 230°C. Identity of compounds was determined/putatively determined on the basis of their match spectra against the NIST Mass spectral Search Program for the NIST/EPA/NIH Mass Spectral Library Version 2.0g. build, May 19, 2011 (NIST, Gaithersbury, MD, USA).  3.2.5 5-HT Detection in Breadfruit Extracts by UPLC-MS   A previously optimized method for detection and quantification was used for the analysis of serotonin (5-HT) (Turi et al., 2014) with minor revision. In brief, a series of dilutions of each breadfruit methanol extract was made with acidified methanol (80:20 methanol:0.1N trichloroacetic acid).  Indoleamines were separated and identified from a 10 µL injection on a reverse phase column (150 x 2.1 mm, 1.7 μm C18 BEH; Waters, Mississauga, ON) using an Acquity Ultra Performance Liquid Chromatograph (I-Class UPLC; Waters).  A gradient of 0.1% formic acid (Eluent A) and acetonitrile (Eluent B) [(A%:B%): 0.0 min, 90:10; 0.5 min, 90:10; 3.5 min, 40:60; 4.2 min, 5:95; 6.5 min, 5:95; 7.0 min, 90:10; 10.0 min, 90:10] was used for elution of 5-HT with a flow rate of 0.300 mL/min. 5-HT was detected and quantified with a tandem mass spectrometer (Xevo TQ-S triple  31 quadrupole mass spectrometer, Waters, Mississauga, ON) using the MRM transitions in Table 3.1. The capillary voltage was 3500 V, desolvation gas rate was 800 L/hr, cone gas rate was 150 L/hr, desolvation temperature was 550°C and the source temperature was 150°C for all analyses. The linear range for 5-HT was 25-200 ng/L. The lower limits of detection (LLOD) and quantification (LLOQ) were 1.56 and 6.25 ng/mL, respectively. 5-HT was quantified in samples using the 273 m/z daughter ion.  Table 3.1 UPLC-MS transitions and voltages   Cone voltage (V) Collision voltage (V) MRM Transition 5-HT 45 27 177 > 115 5-HT 45 10 177 > 160   3.2.6 Data Analysis and Statistics  Final statistical analysis of all data was performed and final graphical output was prepared using GraphPad™ Prism v6 for Mac OSX (GraphPad Software Inc., San Diego, California, USA). DPPH analyzed using One-Way ANOVA with a Tukey’s HSD post-hoc test (p<0.05). DPPH data was expressed as mean ± standard error of the mean (SEM) with a p<0.05 considered significant unless corrected for multiple comparisons with a preferred correction method of Holm-Sidak.  3.3 Results  3.3.1 Antioxidant Activity by DPPH  Radical scavenging activity, as determined through a DPPH assay, differed significantly between the 3 varieties of Artocarpus methanol extract tested. As shown in Figure 3.1, Artocarpus camansi (breadnut) exhibited the lowest radical scavenging activity. In comparison, Artocarpus altilis ulu afa exhibited 41% higher activity relative to Ar.  32 camansi, while Artocarpus altilis Lipet showed 140% higher activity than Artocarpus camansi, and Artocarpus altilis Lipet was 70% higher activity than Artocarpus altilis ulu afa.  Figure 3.1 Antioxidant activity displayed as μmol trolox equivalents (TE)/100 g in three varieties of Artocarpus methanol extract. Bars represent mean ± 1 SEM (N=3). Bars with different letters indicate significantly different antioxidant activity as determined by a one-way ANOVA with Tukey’s HSD multiple comparisons test.  3.3.2 GC-MS of Breadfruit Extracts  Exploratory GC-MS profiling of the extracts from the 4 varieties of Artocarpus methanol extracts described previously were performed. Comparisons to the NIST database of MS data allowed putative identification of a large number of compounds as seen in Table  33 3.3 that include a number of compounds within the triterpenoids, sterols and fatty acids previously associated with insecticidal or insect repellent activity (Jones et al., 2012).  3.3.3 5-HT Detection in Breadfruit Extracts by UPLC-MS  UPLC-MS analysis was used to determine the presence/quantity of serotonin in three different breadfruit extracts (Figure 3.2). All 3 extracts contained 5-HT with large ranges in values with Artocarpus altilis Lipet having the lowest between 91.78 – 872.89 ng 5-HT/g, and Artocarpus altilis Lipet and Artocarpus camansi having ranges of serotonin between 649.55 – 3250.39 and 541.97 – 3843.32 ng 5-HT/g respectively. A sample gram of UPLC-MS detection of 5-HT from a breadfruit extract is shown in Figure 3.3.                      34     Figure 3.2 Range of 5-HT (serotonin) detected in 3 varieties of Artocarpus extract determined by UPLC-MS (N=3). Due to large range in data, statistics were not run and data is shown to be purely representational of range as well as positive 5-HT presence.  35  Figure 3.3  Sample chromatogram of 5-HT (serotonin) detected in 3 varieties of Artocarpus extract determined by UPLC-MS. Retention time (minutes) for serotonin was the same for all samples and matched serotonin standards. Panels indicate methanol extract samples from A) Artocarpus altilis ulu afa B) Artocarpus altilis Lipet C) Artocarpus camansi. 36 Table 3.3 GC-MS Profiling Data    A.camansi Lipet ulu afa Mixed  RT (min)  Putative Compound Assignment   % Identity Match  Compound Class/Use  14.0-14.3 Resorcinol 74.4 75.8 52.9 0 Phenol 19.5 3,7-Nonadienoic acid, 4,8-dimethyl-, methyl ester, (E)- 68.4 0 0 0 Fatty acid ester 31.746 Phenol, 5-methoxy-2-(methoxymethyl)- 89.3 0 0 0 Phenol 38.2-38.6 α-Cadinol 0 61.1 67.3 64.7 Sesquiterpenoid alcohol 39.24 Azulene, 1,4-dimethyl-7-(1-methylethyl)-; vetivazulene 0 0 0 52.8 Flavour/perfume, cosmetics 40 Guanine 63.3 0 90 0 Nucleobase 41 Blumenol C; Vomifoliol 0 0 0 68.8 Glycoside often found in mangos and grapes 41.8 Cyclopentaneundecanoic acid, methyl ester 53.3 0 0 0 Fatty acid ester 43.1 Ambucetamide 68.8 51 0 0 Antispasmodic drug… 44.1 Methyl tetradecanoate 69.6 72.9 0 0 Fatty acid ester 0 2-Cyclohexen-1-one, 4-hydroxy-3,5,5-trimethyl-4-(3-oxo-1-butenyl)- 0 0 0 63.8 (+/-)-6-Hydroxy-3-oxo-alpha-ionone; related to vomifoliol 49.9 Pentadecanoic acid, methyl ester 69.3 73.7 75.8 0 Fatty acid ester 51.5 Pentadecanoic acid 0 0 0 73.2 Fatty acid 53.2-53.9 Hexadecanoic acid, methyl ester 55 0 56.1 0 Fatty acid ester 54.7-55.2 Hexadecanoic acid, methyl ester 81.4 84.8 76 69.5 Fatty acid ester 57.1 n-Hexadecanoic acid 0 0 0 78.8 Fatty acid 60.1 Heptadecanoic acid, methyl ester 72.5 66.2 0 0 Fatty acid ester 63.1 9,12,15-Octadecatrienoic acid, methyl ester, (Z,Z,Z)- 57.4 53.5 0 0 Fatty acid ester 64.3 Methyl stearate 85.4 79.6 81 0 Fatty acid ester 67.8 5,8,11,14-Eicosatetraenoic acid, methyl ester, (all-Z)- 0 53.1 0 0 Fatty acid ester 69.6 Eicosanoic acid, methyl ester 54.4 74.6 63.5 0 Fatty acid ester 70.1 9-Octadecenamide, (Z)-l oleamide 88.6 92.5 87.8 0 Fatty acid amide 72.4 11-(3,4-Dimethyl-5-pentyl-2-furyl)-dodecanoic acid, methyl ester 91.4 96.8 0 0 Fatty acid ester 73 Hexadecanoic acid, 2-hydroxy-1-(hydroxymethyl)ethyl ester 0 0 62.3 0 Monoglyceride 73.5 Docosanoic acid, methyl ester 53.3 65.1 0 0 Fatty acid ester 75.1 Tricosanoic acid, methyl ester 77.1 0 0 0 Fatty acid ester  37  Table 3.3 GC-MS Profiling Data                    76.7 Tetracosanoic acid, methyl ester 84.6 83.7 0 0 Fatty acid ester 77.8-78 Squalene 53 61.8 0 64.3 Triterpene 80 9(11)-Dehydroergosteryl benzoate 0 62 0 0 Triterpenoid 81.3 Stigmastan-3,5-diene 69.7 0 0 0 Triterpenoid 82.8 Ergosterol 75.5 80.5 83.6 0 Sterol 89.9-83.1 Campesterol 63.8 0 60 58.1 Sterol 83.2-83.4 Stigmasterol 73.8 74.5 73.2 70.4 Sterol 84 4α,14-Dimethyl-5α-ergosta-8,24(28)-dien-3β-ol ; Obtusifoliol  0 53.2 0 0 Sterol 84.1 Lup-20(29)-en-3-one 0 70.7 71.3 0 Triterpene 84.2 γ-Sitosterol 74.6 74.9 78.1 74.5 Sterol 84.3-84.5 Stigmasta-5,24(28)-dien-3-ol, (3β,24Z)-; Avenasterol 55.6 50.5 57.6 58.7 Sterol 84.7 Ursa-9(11), 12-dien-3-yl acetate 0 0 80.1 77.3 Triterpene ester 85-85.2 9,19-Cyclolanost-24-en-3-ol, (3β)-; Cycloartenol 65.6 0 0 56.1 Sterol 85.3-85.6 Lanosta-8,24-dien-3-ol, acetate, (3β)-; Lanosterol acetate 73.6 65.1 65.1 57.2 Sterol acetate 85.7-86.3 12-Oleanen-3-yl acetate, (3α)- 70 52.2 66.1 0 Triterpenoid 86.4 9,19-Cyclolanost-24-en-3-ol, acetate 70.8 0 0 0 Sterol acetate 86.6 D:A-Friedooleanan-3-ol, (3α)- 0 64.1 0 0 Triterpenoid 86.7 Friedelan-3-one 81 0 0 0 Triterpenoid 86.8-87 9,19-Cyclolanostan-3-ol, 24-methylene-, acetate, (3β)- 79.5 74.8 76.1 72.2 Sterol  38 3.4 Discussion  3.4.1 DPPH Assay of Extracts  It was determined that the three specific varieties of Artocarpus extract differed significantly in their levels of radical scavenging activity by DPPH assay with Lipet being the highest and A. camansi being the lowest. It was hypothesized that radical scavenging activity and serotonin and melatonin levels may increase in a linear fashion as both these compounds can act as effective radical scavenging molecules (Gülçin et al., 2002; Gülçin et al., 2003). This is in part attributed to the phenol ring component of the indole-ring backbone as well as the hydroxyl on the serotonin (Gülçin, 2007). Alternatively, Artocarpus extracts that possess more or less free radical activity could potential disrupt the delicate equilibrium that is established between tryptophan, serotonin and melatonin and their intermediates, thus significantly altering relative indoleamine levels. This could be linked to future data regarding other components present in the extract that may have free radical producing or scavenging activity.  3.4.2 GC-MS Data of Extracts  Exploratory GC-MS profiling of compounds in the 3 varieties of Artocarpus methanol extract yielded interesting results. The mixed sample was quite different than the other three extracts, which were all relatively similar in compounds detected. Some of this difference may be accounted for by the unintentional extra handling and processing by the addition of an extra drying and resuspension step that the ulu afa, Lipet and A. camansi samples underwent, whereas the mixed extract was dried and resuspended only once. This second drying may account for why the mixed sample has an abundance of perfume compounds (such as azulene and vomifoliol). Azulene is another compound used in the beauty and cosmetic industry as well as having anti-spasmodic, anti-microbial, and anti-inflammatory properties (Andersen and Teufel, 1999); USFDA, 1996). Azulene is also a structural isomer of naphthalene, which is the primary ingredient in mothballs, where naphthalene vapors can build up and become toxic to both larval and adult forms of many  39 Lepidopterans (Jo and Lee, 2011). The presence of these compounds may offer insight to explain potential differences in toxicity between the different variety extracts. Resorcinol (1,3-dihydroxybenzene) is a phenol identified in the three specific variety extracts (ulu afa, Lipet and A. camansi) but not in the mixed sample. Phenolic compounds have been shown to possess highly toxic effects to aquatic organisms and many have been shown to have carcinogenic effects (do Ceu Silva et al., 2003). Resorcinol specifically has little data related to its toxicology (Kahru et al., 2000). Resorcinol however has been used in the cosmetic field as both a disinfectant and an exfoliating agent and in acne treatment (Guedes et al., 2011). Phenol and resorcinol have been shown to display acute toxicity in brine shrimp larvae (Artemia franciscana) (Guedes et al., 2011).  Fatty acids and fatty acid esters have been linked in previous studies such as Jones et al. (2012) to biting deterrent effects in adult female mosquitoes such as Aedes aegypti. Compounds identified in extracts tested for biting deterrent effects included a variety of terpenes and fatty acids such as pentadecanoic acid and naphthalene related derivatives (Jones et al. 2012). It is likely that some of these fatty acids could contribute to the innate ability of breadfruit male inflorescence smoke to deter mosquito biting (Olson, 1991).  A number of triterpenes were also identified by GC-MS, and this offers possibilities to match to the literature where a tripterpene oleanolic acid derivative was extracted with methanol from a number of Cucurbitaceae plants (such as Citrullus colocynthis and Coccinia indica) and showed very effective LC50 values against Culex quinquefasciatus, Aedes aegypti and Anopheles stephensi (5.6 mg/L, 5.0 mg/L and 4.8 mg/L) (Senthilkumar et al., 2012). Due to the basic oleanolic acid triterpene backbone being associated with effective larvicidal activity in mosquitoes, it would be expected that since several of these Artocarpus extracts contain these compounds, the various variety specific extracts may possess significant larvicidal activity. It is however possible that these compounds are present in doses capable of detection and putative identification by GC-MS but not to significantly increase larvicidal activity of the extracts.      40 3.4.3 UPLC-MS Data of Extracts  Utilization of methanol extracts of Artocarpus tissue was considered to be sub-optimal for precise quantification of 5-HT. Variations between technical replicates varied greatly, resulting in 5-HT data being expressed as a range, primarily indicating the presence of 5-HT to confirm previous unpublished results. In order to achieve a more precise measure of 5-HT within dried Artocarpus male inflorescence tissue, fresh tissue would be required to perform a more suitable extraction method to allow better separation and quantification using UPLC-MS.  3.4.4 Concluding Remarks  In summary, we have further characterized methanol extracts from four varieties of Artocarpus, Artocarpus altilis ulu afa, Artocarpus altilis Lipet, Artocarpus camansi as well as a mixed Artocarpus methanol extract. The information determined here can be utilized to better understand the biological effects of these extracts on mosquitoes, both adults and larvae. The GC-MS data provides multiple paths for continuing research. The first to biofractionate and identify individual compounds present in Artocarpus methanol extracts and start single component analysis with regards to biological effects such as larvicidal activity. The second to further examine if serotonin and melatonin or associated compounds are present and in what levels in the extract as well as their effect on biological tissue. Our data suggests that there are compounds present in methanol extracts of previously established importance in the literature towards insect-repellent or insecticidal activity.  41 Chapter 4 :   Examination of the 5-HT Pathway in Aedes aegypti  4.1 Chapter summary  Insects and other arthropods serve as vectors for 6 of the 17 neglected tropical diseases, as reported by the World Health Organization (WHO). Mosquitoes such as Aedes aegypti and Anopheles gambiae are responsible for carrying some of the most economically damaging diseases including Dengue fever, yellow fever and malaria. It is therefore imperative that research efforts be funneled into the development of newer and more effective methods of control of the insect vectors for these diseases. The research contained herein aims to elucidate a new biological pathway with which to target insecticide or insect repellent development. Furthermore, by investigating breadfruit (Artocarpus altilis) and its closely associated varieties, this research explores the possibility of isolating secondary products from breadfruit with insecticidal or insect repellent properties for commercial production. The objective of this investigation was to determine whether the chemical extracts of breadfruit male inflorescences have a physiological effect on specific tissues of both larval and adult Aedes aegypti. It was determined that the methanol extract of a mixed variety sample of Artocarpus held more insecticidal activity in larvae water-borne assays than the single varieties studied here. It was determined that the majority of these extracts resulted in a decreased concentration of serotonin in the haemolymph of 4th instar Aedes aegypti larvae. These extracts caused little change on the 5-HT synthetic pathway gene transcription in larval head samples.  After blood feeding, adult tissues showed the most significant changes in gene expression in the midgut, but surprisingly not the Malpighian tubules, even though serotonin is well described to interact with the tubules in blood feeding insects.       42  4.2 Materials and Methods  4.2.1 Insect Rearing  Rearing of Aedes aegypti larvae and adults was as described in section 2.1.1.  4.2.2 Plant Tissue Collection  Plant tissue collect was as described in section 3.2.1.  4.2.3 Methanol Tissue Extraction  Methanol extractions for the insect larvicidal bioassay was as described in section 3.2.2.  4.2.4 Larvicidal Activity of Breadfruit Methanol Extracts  One milliliter of the methanol/extract mixture was added to 100 mL polyethylene beakers containing 24 mL of ultra-pure water. The final concentration of methanol in all samples was 4%. A minimum of six concentrations was used for final analysis. All four varieties of breadfruit extract were tested. Solutions were stirred with a glass rod and twenty 4th instar larvae were added to each polyethylene beaker containing 25 mL of exposure fluid. Both female and male 4th instars were used for larvicidal experiments. Beakers were loosely covered with plastic wrap and mortality was assessed after 24 hours. Mortality was assessed by a complete lack of motile response to touching with a glass probe. Five replicates were used for each experiment. Negative controls contained 25 mL ultrapure water or 24 mL ultrapure water and 1 mL methanol.     43 4.2.5 Quantification of 5-HT in Larval Haemolymph after Breadfruit Exposure by UPLC-MS  Haemolymph was collected from 4th instar larval Aedes aegypti after exposure to all 4 breadfruit extracts as well as from control exposed larvae (4% methanol). Aedes aegypti larvae were blotted on VWR Light-Duty Tissue Wipers (VWR International, Radnor, PA, USA) and then placed under mineral oil and the head was removed with fine forceps. The resulting aqueous bubble of haemolymph was collected and pooled with other larvae until at least 0.5 μL was present. 0.5 μL of haemolymph was then pipetted into a clean PCR tube and capped and immediately flash frozen in liquid nitrogen.  Five biological replicates were collected for each of the four breadfruit extract exposures and one control exposure (4% methanol). Frozen haemolymph samples were transferred to the -80°C for storage until analysis. At each step, care was taken to minimize the exposure of haemolymph samples to the presence of light to prevent degradation of indoleamines prior to analysis. A previously optimized LC-MS method was used for the analysis of 5-HT and melatonin (Turi et al., 2014) with minor modifications. A 5 µL injection was made on a reverse phase column (30 x 3.0 mm, 2.6 μm C18 Kinetex; Phenomenex, Torrance, CA) using the same instrumentation previously described (see section 3.2.5). The linear range for 5-HT and MEL was 25-200 ng/L. The lower limits of detection (LLOD) and quantification (LLOQ) for 5-HT were both 1.57 ng/mL, respectively. The lower limits of detection (LLOD) and quantification (LLOQ) for MEL were 0.89 and 3.55 ng/mL, respectively. 5-HT was quantified in samples using the 273 m/z daughter ion. MEL was quantified in samples using the 159 m/z daughter ion.  Table 4.1 UPLC-MS transitions and voltages   Cone voltage (V) Collision voltage (V) MRM Transition 5-HT 45 27 177 > 115 5-HT 45 10 177 > 160 MEL 30 23 233 > 159 MEL 30 15 233 > 174   44  4.2.6 Real-time PCR Gene Expression of 5-HT Pathway 4.2.6.1 Larval Tissue Collection after Breadfruit Extract Exposure  Fourth instar larvae were exposed to concentrations of methanol Artocarpus extract at concentrations of approximately 24-hour LC25 for all four Artocarpus extract varieties. Tissues were collected from 4th instar larval Aedes aegypti following exposure to Artocarpus methanol extract for 24 hours. For each exposure, three biological samples, each consisting of 25 heads were isolated in liquid nitrogen in a 1.5 mL tube and then stored at -80°C. Extract exposure concentrations chosen for qPCR analysis were the highest possible dosage before reaching 25% mortality as at least 75 larvae were needed. These concentrations were 128.2 mg/L Artocarpus altilis ulu afa, 195.2 mg/L for Artocarpus altilis Lipet, 127.9 mg/L for Artocarpus camansi (breadnut) and 162.6 mg/L for the mixed sample.  4.2.6.2 Adult Tissue Collection after Blood/Sugar Feeding  5-15 day old female mosquitoes were fed either a 10% (w/v) sugar solution or sheep (Ovis aries) blood (Cedarlane Laboratories, Burlington, Ontario, Canada; CL2581), both heated in a jacketed glass beaker with 37°C water. Mosquitoes were allowed to feed for 20 minutes. Mosquitoes were removed at 3 hours, 12 hours and 24 hours post blood feeding and sacrificed by freezing at -20°C for 30 minutes before beginning dissection and isolation of tissues. Only adult female mosquitoes that had clearly fed were used for tissue dissection and collection (see Figure 4.1). Dissections were performed in Aedes aegypti saline that consisted of 2.25 g NaCl, 0.246 g KCl, 0.809 g CaCl2, 0.0842 g MgSO4, 0.645 g Arginine, 2.072 g Leucine, 0.633 g Proline, 1.49 g Histidine and 6.553 g HEPES in 1 L DEPC-treated Milli-Q® water.  For each exposure, three biological samples, each consisting of a pool of 5 whole bodies, 25 heads, 50 midguts, or 250 Malpighian tubules were isolated in liquid nitrogen in a 1.5 mL tube and then stored at -80°C (Clark and Bradley, 1997; Rheault et al., 2006).    45  Figure 4.1 Representative image of a 3-hour blood fed female adult Aedes aegypti (A), 3-hour sugar fed female adult Aedes aegypti (B), and an unfed female adult Aedes aegypti (C).  4.2.6.3 mRNA Extraction from Aedes aegypti tissues  Total RNA was extracted using the BioRad Aurum Total RNA mini Kit as per instructions for spin columns with animal tissues (BioRad, Hercules, California, USA). Each sample was ground with an RNA free pestle before adding 700 μL lysis buffer and homogenized using a roto-stat homogenizer (Polytron 1200 E, Kinematica, Bohemia, New York, USA). Samples were then spun at 13000 g for 3 minutes at 4°C. The lysate was then  46 added to 700 μL of 60% ethanol and mixed. The solution was then added onto a RNA binding column and spun at 13000 g for 60 seconds at 4°C. The RNA binding column was then washed with 700 μL of low stringency wash solution and spun at 13000 g for 30 seconds at 4°C. 80 μL DNAse was then added to each column and incubated at room temperature for 25 minutes. The RNA binding column was then washed with 700 μL of high stringency wash solution and spun at 13000 g for 30 seconds at 4°C. The RNA binding column was then washed with 700 μL of low stringency wash solution and spun at 13000 g for 30 seconds at 4°C. The RNA binding column was then dried by spinning at 13000 g for 2 minutes at 4°C. Total RNA was then eluted off the column by adding 40 μL of elution solution preheated to 70°C and incubated on the column for 60 seconds. RNA was eluted into a fresh 1.5 mL tube by spinning at 13000 g for 2 minutes at 4°C. RNA purity and quantity was assessed using a Biophotometer Plus with Hellma® TrayCell (Eppendorf, Hamburg, Germany) and RNA integrity was verified using electrophoresis on a 1% non denaturing agarose gel stained with SYBR® Safe (Invitrogen).   Isolated total RNA was stored at -80°C until further use.  4.2.6.4 cDNA Synthesis  Samples containing 1 μg of total RNA with an optical density (OD) absorption ratio (OD260 nm/OD280 nm) between 1.5 and 2.5 were selected to synthesize cDNA using iScript™ cDNA synthesis kit (Bio-Rad, Mississauga, ON, Canada).  cDNA was stored at -20°C for subsequent analysis. cDNA was diluted 20-fold in ultra-pure water prior to use for qPCR analysis.  4.2.6.5 Primer Design  Gene candidates for serotonin pathway genes were identified in the Aedes aegypti genome by querying the NCBI database based on identified 5-HT pathway enzymes present in the fellow Dipteran Drosophila melanogaster and orthologues in humans. Primers were designed using Geneious R7 (BioMatters, Auckland, New Zealand) to span intron/exon junctions. Reverse transcription polymerase chain reaction (RT-PCR) was used to confirm  47 correct amplicon size and specificity.  In addition, a BLAST search of the primers was performed to ensure specific binding. Primers for the reference genes actin (actin), 60S ribosomal protein L24 (60Srpl24) and RPS6 (AaegRPS6) were obtained from previously published data (Marusalin et al., 2012; Figueira-Mansur et al., 2013). Primer sequences, amplicon lengths and gene accession numbers are listed in Table 4.2. It should be noted that for the serotonin-N-acetyltransferase (SNAT) genes that there were three putative genes identified in the Aedes genome which share no more than 25% amino acid sequence identity to each other. In order to test all three putative genes, rrimers were designed for all 3 variants. 48 Table 4.2 qPCR primer sequences for 5-HT pathway genes and reference genes for Aedes aegypti  Gene Name Forward Primer (5’->3’) Reverse Primer (5’->3’) Forward Primer Size (bp) Reverse Primer Size (bp) Forward Primer Sequence Reverse Primer Sequence Amplicon Size (bp) Accession Number Source TRH aaTPHqF1045 aaTPHqR1140 20 20 ATGTACGGAAGGCAGGATTC GCTGACATTCTTCGCTTCGG 95 XM_011495372 (NCBI) custom AAADC aaAAADCqF326 aaAAADCqR444 20 20 AGCGTACCCAGGAAGAACAC AACTCCTCCAAGCAAACCTG 118 XM_001648214 (NCBI) custom SNAT288 aaSNAT288qF215 aaSNAT288qR340 22 23 ATGAGGTTGACACGAACATTTC ACTCTCCTAGGTTGACAAAAGTG 125 XM_001661350 (NCBI) custom SNAT222 aaSNAT222qF372 aaSNAT222qR485 23 21 GTTCGATGTGGACAAAATTTTCG CGATCCAAAGCAAGTTCTTCG 113 XM_001663072 (NCBI) custom SNAT220 aaSNAT220qF388 aaSNAT220qR487 19 20 CACTTGCACTTCTTGGCGG TCGTTCCACATTTCACAGCG 99 XM_001661123 (NCBI) custom ASMT aaASMT404qF aaASMT503qR 20 20 TGAAGTTCACAGAAGCTTGC CCACCGGCCTTATCTAATGG 99 XM_001660361 (NCBI) custom Actin aaactinqF1 aaactinqR1 20 20 TCCCATACCGTCCCAATCTA TCTCCTTGATGTCACGAACG 166 XM_0016590 (NCBI) Marusalin et al. 2012 RPL24 aarpl24qF1 aarpl24qR1 19 18 AATGAAGATCGGCCTTTGC AGGACGGTCCACTTCACC 162 AAEL01951 (Vectorbase) Marusalin et al. 2012 RPS6 AaegRPS6-F AaegRPS6-R 23 20 TAAAATGAAGTTGAACGTATCGT  AGATGGTCAGCGGTGATTTC  126 XM_001647882  (NCBI) Figueira-Mansur et al. 2013            49 4.2.6.6 Quantitative Real Time PCR  Quantitative real-time PCR (qPCR) was performed to assess the relative expression of putative 5-HT pathway enzyme gene mRNA within the whole body, head, midgut and Malpighian tubules in A. aegypti larvae. Primer efficiencies were calculated using six, 5-fold serial dilutions of whole body cDNA to create a standard curve of relative fluorescence.  Efficiencies, R2 values, slopes and y-intercepts of the standard curves were calculated by CFX96™ Manager Software (Bio-Rad).  Optimum primer annealing temperatures were determined by a thermal gradient that was used to choose a single annealing temperature that was used in all further analysis.  Each reaction was performed in two technical replicates and no template and no reverse transcription controls were included for each primer. Inter run calibrators for each primer set (Hellemans et al., 2007), using 3 hour sugar fed whole body cDNA as a template, were performed on each experimental plate (Vermeulen et al., 2009) to account for instrument variation.  Each 20 μL reaction contained 10 μL SsoFast™ EvaGreen®Supermix (Bio-Rad), 2 μL of 1:20 dilution of cDNA template that was synthesized from 1 μg of RNA, and 500 nmol l-1 each of forward and reverse primer in nuclease free water.  Reactions were performed using the CFX96™ Real-Time Detection system (Bio-Rad) on a C1000™ Thermal Cycler (Bio-Rad) at the following cycling conditions: 30 s enzyme activation step at 95°C, followed by 39 cycles of 5 s denaturing at 95°C and 5 s annealing/extension at 57°C (determined by thermal gradient to be optimal for all primer sets).  Following 40 cycles for amplification, a melt curve analysis was conducted to confirm the presence of a single specific amplicon in the absence of non specific products by incrementally increasing the block temperature from 65-95°C in steps of 0.5°C for 5 s after an initial denaturing at 95°C for 10 s. mRNA expression was normalized to 2 reference genes, Actin and 60Srpl24; whose coefficients of variance (CV) (synonymous with % RSD) and M values (the difference of reference gene expression between samples) of which were found to be within the acceptable range for heterogeneous samples (Hellemans et al., 2007).  Parameters of stability (CV and M value) were calculated using BioRad CFX Manager Software (BioRad, Hercules, California, USA) through a Target Stability Analysis.  Results of these analyses indicated the two most stable reference genes that yielded a mean CV < 0.5  50 and a mean M < 1.0.  Normalized expression values were calculated using CFX96™ Manager Software (Bio-Rad), which uses the geometric mean of the relative quantities of the reference genes to derive a normalization factor that was then applied to the genes of interest (Hellemans et al., 2007).   4.2.7 Data Analysis and Statistics  When possible LC50 and LC90 values were calculated by Probit analysis using IBM SPSS Statistics (International Business Machines Corps, Armonk, New York, USA). UPLC-MS analysis of serotonin and melatonin larval haemolymph after exposure to breadfruit methanol extracts was analyzed using One-Way ANOVA with a Dunnett’s post hoc test and corrected for multiple comparisons.  Larval head qPCR mRNA expression data was analyzed using One-Way ANOVA with a Dunnett’s post hoc test and corrected for multiple comparisons. Adult whole body, head, midgut and Malpighian tubule mRNA expression data was analyzed using a Two-Way ANOVA with a Holm-Sidak multiple comparisons post hoc test. To determine if differences in gene expression were significantly different, two successive criteria had to be met.  First, relative fold differences between mean expression values had to have greater than a 2-fold change (Bubner et al., 2004).  Second, fold differences in expression had to be determined to be mathematically significant by the applied statistical test.  Final statistical analysis of mRNA expression and UPLC-MS data was performed and final graphical output was prepared using GraphPad™ Prism v6 for Mac OSX (GraphPad Software Inc., San Diego, California, USA). All data was expressed as mean ± standard error of the mean (SEM).  4.3 Results  4.3.1 Larvicidal Toxicity of Breadfruit Extracts  LC50 values for ulu afa, Lipet and A. camansi were unable to be determined as a result of a limited quantity of male inflorescence. However, dose dependent responses were seen up  51 to a maximum of 22.0%, 25.0% and 31.0% mortality at the maximum concentrations tested of 513 mg/L, 1562 mg/L, and 1023 mg/L for ulu afa, Lipet and A. camansi, respectively. For the mixed variety sample, where there were not limited quantities of extract, an LC50 of 652 mg/L (95% Confidence Interval: 557 – 771 mg/L) and an LC90 of 3950 mg/L (95% Confidence Interval: 2957 – 5705 mg/L).   4.3.2 Serotonin Quantification in Larval Haemolymph after Breadfruit Extract Exposure  After extraction of haemolymph from 4th instar Aedes aegypti larvae after a 24 hour exposure to three known Artocarpus methanol extracts and a mixed sample, serotonin and melatonin concentrations could be determined by UPLC-MS analysis (Figure 4.2). Serotonin in the control treatment of 4% methanol had serotonin concentrations of 116.4 pg/L. The larval haemolymph did not change significantly when larvae were exposed to Artocarpus altilis Lipet extracts but decreased significantly when exposed to Artocarpus altilis ulu afa, Artocarpus camansi, and the mixed Artocarpus sample by 2.7, 4.0 and 2.7 fold, respectively. Melatonin was detected in control at 1.47 fg/L, with no significant change after exposure to any Artocarpus extract. A sample chromatogram of UPLC-MS detection of 5-HT from a breadfruit extract is shown in Figure 4.3.     52  Figure 4.2 Serotonin (A) and melatonin (B) (pg/L) in the haemolymph of 4th instar larval Aedes aegypti after exposure to 4 different Artocarpus methanol extracts (black) compared to a 4% methanol control (white). Bars represent mean ± 1 SEM (N=5). Bars with asterisks (*) indicate significantly different gene expression from control (One-Way ANOVA with Dunnett’s multiple comparisons test).             53  Figure 4.3  Sample chromatogram of 5-HT (Serotonin) detected in haemolymph of 4th instar Aedes aegypti after exposure to 4 varieties of Artocarpus extract determined by UPLC-MS (N=5). Retention time (minutes) for serotonin was the same for all samples and matched serotonin standards. Panels indicate haemolymph samples from larvae exposed to A) 4% methanol B) mixed Artocarpus extract C) Artocarpus altilis Lipet extract D) Artocarpus camansi extract E) Artocarpus altilis ulu afa extract.  54   4.3.3 mRNA Extraction  A demonstration of RNA extraction yields, 260/280 and 260/230 ratios for the whole body adult female blood fed/sugar fed samples used for gene expression analysis of 5-HT pathway genes is shown in Table 4.3.   55 Table 4.3 RNA extraction yields, 260/280 and 260/230 ratios for female adult whole body RNA samples Sample Name Concentration (ng/μL) 260/280 260/230 3hrBF WB1 174.90 2.27 2.38 3hrBF WB2 127.20 2.39 N/A 3hrBF WB3 211.30 2.18 2.62 3hrSF WB1 207.50 2.15 2.20 3hrSF WB2 88.50 2.40 2.37 3hrSF WB3 349.10 2.13 1.80 12hrBF WB1 328.00 2.18 2.18 12hrBF WB2 294.60 2.15 2.04 12hrBF WB3 177.00 2.27 1.70 12hrSF WB1 95.00 2.13 1.65 12hrSF WB2 162.30 2.07 1.62 12hrSF WB3 199.40 2.10 1.88 24hrBF WB1 323.20 2.30 2.40 24hrBF WB2 384.90 2.21 2.01 24hrBF WB3 342.40 2.24 2.28 24hrSF WB1 101.10 2.00 1.78 24hrSF WB2 89.50 1.82 1.44 24hrSF WB3 163.80 1.99 1.67 Abbreviations: SF: sugar fed BF: blood fed  3h, 12h, 24h indicate hours post sugar/blood feeding   An example of the RNA agarose gel results indicating presence of single 18s and 28s bands and lack of degraded RNA is displayed in Figure 4.3. Invertebrate 28s ribosomal subunit RNA contains a cryptic nick that results in cleavage of the 28s subunit and therefore this band may be absent when visualized through agarose gel electrophoresis. Note the presence of a single 18s/28s rRNA band at approximately 1 kb. This is due to the presence of  56 a “cryptic nick” in insect rRNA, where hydrogen bonds connecting two fragments of the 28s rRNA are denatured and split, leaving two individual fragments that migrate through an agarose gel at approximately the same rate as the 18s rRNA.   Figure 4.4  Representative 1% agarose non-denatured RNA gel with 3 hour blood fed and 3 hour sugar fed Female adult head mRNA.  Lanes contain the following: 1: 5 μL Quick-Load® 100 bp DNA ladder (New England BioLabs), 2-7: 1 μL RNA, 4 μL ultra-pure water, 1 μL 6x Blue Gel Loading Dye (New England BioLabs), 8: 5 μL Quick-Load® 1kb DNA ladder (New England BioLabs).  4.3.4 Primer Design  Efficiencies, R2 values, slopes and y-intercepts of the standard curves were calculated by CFX96™ Manager Software (Bio-Rad) and are presented in Table 4.4.      57 Table 4.4 qPCR primer efficiencies, R2, slope values and intercepts for Aedes aegypti 5-HT pathway genes and reference genes Gene Name Forward Primer Reverse Primer Efficiency (%) Slope Y Intercept R2 TRH aaTPHqF1045 aaTPHqR1140 100.9 % -3.301 18.964 0.988 AAADC aaAAADCqF326 aaAAADCqR444 108.7 % -3.129 21.825 0.989 SNAT288 aaSNAT288qF215 aaSNAT288qR340 103.1 % -3.250 22.070 0.989 SNAT222 aaSNAT222qF372 aaSNAT222qR485 105.7 % -3.193 18.944 0.988 SNAT220 aaSNAT220qF388 aaSNAT220qR487 105.6 % -3.191 24.792 0.968 ASMT aaASMT404qF aaASMT503qR 101.7 % -3.282 22.174 0.995 Actin aaactinqF1 aaactinqR1 106.5 % -3.167 15.748 0.997 RPL24 aarpl24qF1 aarpl24qR1 100.0 % -3.321 13.812 0.999 RPS6 AaegRPS6-F AaegRPS6-R 106.3 % -3.180 15.676 0.990  58 4.3.5 qPCR Reference Gene Stability Analysis  Stability analyses of reference genes used in all gene studies are presented in Tables 4.5, 4.6 and 4.7.  Table 4.5 Stability analysis results of reference genes in breadfruit extract exposed 4th instar larval head gene study Gene Coefficient of Variance M Value Rpl24 0.1179 0.3179 RPS6 0.1028 0.3179 Mean 0.1104 0.3179  Table 4.6 Stability analysis sesults of reference genes in adult blood fed/sugar fed whole body, midgut and Malpighian tubule gene study Gene Coefficient of Variance M Value Rpl24 0.3379 0.9617 RPS6 0.3594 0.9617 Mean 0.3486 0.9617   59 Table 4.7 Stability analysis results of reference genes in adult blood fed/sugar fed head gene study Gene Coefficient of Variance M Value Rpl24 0.4569 2.6369 RPS6 1.5155 2.6369 Mean 0.9862 2.6369  60 4.3.6 Quantitative Real Time PCR of Larval Heads after Breadfruit Extract Exposure  After exposure to four different varieties of breadfruit methanol extract for 24 hours, there was no significant change in expression in TRH, AAADC, SNAT288, SNAT220, and ASMT in larval heads relative to control (4% methanol). Whereas SNAT222 expression was 2.0 fold and 4.0 fold lower than control in Artocarpus camansi exposed and mixed Artocarpus exposed larval heads, respectively.   61  Figure 4.5 Normalized mRNA expression of TRH (A), AAADC (B), SNAT288 (C), SNAT222 (D), SNAT220 (E) and ASMT (F) in the head of 4th instar larval Aedes aegypti after exposure to 4 different Artocarpus methanol extracts (black) compared to a 4% methanol control (white). Bars represent mean ± 1 SEM (N=3). Bars with asterisks (*) indicate significantly different gene expression from control (One-Way ANOVA with Dunnett’s multiple comparisons test).   62 4.3.7 Quantitative Real Time PCR of Adult Whole Body, Midgut and Malpighian Tubules after 3 h, 12 h and 24 h post blood feeding  TRH in the whole body does not significantly change at any time point after sugar feeding. After blood feeding, TRH expression was 5.6 fold higher at 3 hours and 4.2 fold at 24 hours. Blood fed TRH increased 65% from 3 to 24 hours. AAADC also showed no difference in expression at any time after sugar feeding. AAADC increased at 12 and 24 hours post blood feeding by 4.6 and 5.6 fold higher than 3 hours post blood feeding. Like the previous genes, SNAT288 also showed no change in transcript levels at any time after sugar feeding. Blood feeding however increased 3.3 fold from 3 to 12 hours and then dropped back down at 24 hours post feeding. Transcript levels of both SNAT222 and SNAT220 were unaffected by blood feeding but were higher at 3 hours post feeding than either 12 or 24 hours. ASMT transcript showed a similar trend to SNAT222 and SNAT220 with higher expression at 3 hours than 12 and 24 hours.  63  Figure 4.6 Normalized mRNA expression of TRH (A), AAADC (B), SNAT288 (C), SNAT222 (D), SNAT220 (E) and ASMT (F) in the whole body of female adult Aedes aegypti after 3h, 12h, and 24h post blood feeding (black) and sugar feeding (white). Bars represent mean ± 1 SEM (N=3). Bars within the same time period or within the same feeding treatment with different letters indicate significantly different gene expression (Two-Way ANOVA with Holm-Sidak multiple comparisons test).   64 TRH did not change over time in either blood fed or sugar fed midguts. At 12 hours however, blood fed TRH levels were 14.1 fold higher than sugar fed, with no significant different at 3 or 24 hours. There was no significant difference in expression of AAADC, SNAT222 and SNAT220 at any time with sugar or blood feeding. SNAT288 was 5.6 fold higher at 3 hours, 5.2 fold higher at 12 hours in blood fed midguts than sugar fed midguts with no different at 24 hours. ASMT expression was only different between blood and sugar fed midguts at 3 hours with 12.1 fold higher expression. Expression of ASMT dropped at 12 and 24 hours to no difference between blood and sugar fed.  65  Figure 4.7 Normalized mRNA expression of TRH (A), AAADC (B), SNAT288 (C), SNAT222 (D), SNAT220 (E) and ASMT (F) in the midgut of female adult Aedes aegypti after 3h, 12h, and 24h post blood feeding (black) and sugar feeding (white). Bars represent mean ± 1 SEM (N=3). Bars within the same time period or within the same feeding treatment with different letters indicate significantly different gene expression (Two-Way ANOVA with Holm-Sidak multiple comparisons test).   66 There was no significant difference in expression in TRH, AAADC, SNAT288 and ASMT at any time point after sugar feeding or blood feeding. With SNAT222 expression, there was no change in sugar fed expression or in blood fed expression over time but at 3 h, 12 h and 24 h sugar fed was always significantly higher than blood fed. SNAT220 expression after sugar feeding decreased from 3 to 24 hours by 2.5 fold.   67  Figure 4.8 Normalized mRNA expression of TRH (A), AAADC (B), SNAT288 (C), SNAT222 (D), SNAT220 (E) and ASMT (F) in the Malpighian tubule of female adult Aedes aegypti after 3h, 12h, and 24h post blood feeding (black) and sugar feeding (white). Bars represent mean ± 1 SEM (N=3). Bars within the same time period or within the same feeding treatment with different letters indicate significantly different gene expression (Two-Way ANOVA with Holm-Sidak multiple comparisons test).   68 4.3.8 Quantitative Real Time PCR of Heads of Adults after 3h, 12h and 24h post blood feeding  There were no significant changes in the head of adult female gene expression across time after blood or sugar feeding or between sugar and blood fed treatment groups for AAADC, SNAT222, SNAT220 or ASMT. There was however an effect on TRH where the 24-hour post blood feeding expression levels were significantly higher by 3.5 fold however there was no significant difference between either 3 hour and 12 hour post blood feeding or 12 hour and 24 hour post blood feeding. There was no significant change in TRH expression across any time point when female mosquitoes were fed sugar water. SNAT288 expression also changed in response to blood feeding with transcripts levels being 3.1 fold higher in blood fed than sugar fed female heads. Expression of SNAT288 was also higher at 3 hours post blood feeding than 12 and 24 hours post feeding by 4.0 and 4.9 fold respectively.    69  Figure 4.9 Normalized mRNA expression of TRH (A), AAADC (B), SNAT288 (C), SNAT222 (D), SNAT220 (E) and ASMT (F) in the head of female adult Aedes aegypti after 3h, 12h, and 24h post blood feeding (black) and sugar feeding (white). Bars represent mean ± 1 SEM (N=3). Bars within the same time period or within the same feeding treatment with different letters indicate significantly different gene expression (Two-Way ANOVA with Holm-Sidak multiple comparisons test).   70 4.4 Discussion  4.4.1 Insecticidal Activity of Breadfruit Extract Varieties  Between the four samples of Artocarpus extracts tested, it was determined that the mixed sample was considered to be the most potent as a waterborne insecticide. However, in order to truly assess the potential of these extracts as an insecticide, drastically larger quantities of extract would need to be acquired for future studies as well as improved methods for collecting, extracting and storing extracts to increase accuracy of experimentation. The 24 hr LC50 value obtained here for the mixed sample after methanol extraction not only agrees with the 24 hr LC50 value (Ch.2 LC50 = 752 mg/L, Ch.4 LC50 = 652 mg/L) determined during earlier in Chapter 2 but also increases the precision of the LC50 and LC90 model for better comparison to literature data (Ch.2 Confidence Range = 641-906 mg/L, Ch.4 Confidence Range = 557-771 mg/L).  4.4.2 5-HT and Melatonin in Haemolymph after Breadfruit Extract Variety Specific Exposure  The results from the breadfruit exposure on 5-HT and melatonin in the haemolymph of larvae were unexpected. We hypothesized that there would likely be an increase in 5-HT and/or melatonin after exposure due to previous results indicating that 5-HT was high in Artocarpus altilis. Instead, Artocarpus altilis ulu afa, Artocarpus camansi and the unidentified mixed Artocarpus extract all caused a significant decrease in serotonin but no change in melatonin was detected. We expect that this is a compound other than serotonin in the extract having a direct effect on reducing serotonin by potentially either degrading serotonin back to one of its precursors, 5-hydroxytryptophan or tryptophan, or stimulating some biological mechanism with larval Aedes aegypti tissues to reduce 5-HT content such as increasing excretion and removal of serotonin.  As the quantitative real time PCR results suggest that there is little transcriptional regulatory effect on the pathway, it is most likely that the serotonin is excreted rather than metabolized. Due to serotonin’s small molecular weight (172 g/mol) and monovalent positive charge at physiological pH, serotonin would  71 likely be categorized as a Type I organic cation. This would indicate that serotonin would likely be transported through the same organic cation transporters (ORCTs) as drugs such as tetraethylammonium (TEA), cimetidine, etc. Future studies could also examine if the effect of breadfruit extract exposure on mosquito tissues alters organic cation transporter activity at the protein level or at the transcriptional regulation level. Also of note was that the concentration of serotonin in the haemolymph determined for control 4th instar larvae in this study differs from previous reported values (Clark and Bradley, 1987).  Few studies have directly tried to quantify serotonin within haemolymph, with most studies creating saline artificially altered concentrations of serotonin in order to determine direct effect of Malpighian tubule secretion rate via a Ramsay assay. Clark and Bradley saw that the threshold concentration to significantly increase tubule secretion rate in Ramsay assays was 10 nmol/L 5-HT and that the tubule’s 5-HT mediated secretion increase was saturated at 10 μmol/L (1995). Clark and Bradley’s study on larval 5-HT activity in higher salinity water is the only study that has ever directly quantified the concentration of 5-HT in Aedes aegypti larvae (1997). They determined a 5-HT concentration under control conditions to be approximately 50 nmol/L by HPLC. Whereas our UPLC-MS technique with a value of approximately 0.59 pmol/L, indicating a discrepancy between the value Clark and Bradley determined and the value determined here by nearly 10000 fold.   4.4.3 Effect of Breadfruit Extract Exposure on 5-HT Pathway Gene Regulation  It was noted that there was little to no difference in expression between a control methanol exposure and the 4 varieties of Artocarpus extract tested. The only significant differences were in SNAT222, with decreased transcript levels in Artocarpus camansi and the mixed Artocarpus extract. Two possible conclusions may be drawn from this result: either that the extract concentrations in order to cause significant shifts in this gene pathway expression are simply higher than possible within this experiment or the second, and more likely, that there is simply little effect on the 5-HT pathway by the chemical components within these methanol extracts of Artocarpus. This is interesting due to the result seen above where serotonin values in larval haemolymph decreased in the majority of Artocarpus extract variety exposures.   72   4.4.4 Effect of Adult Blood/Sugar Feeding on 5-HT Pathway Gene Regulation  Upon initial examination of the whole body, midgut and Malpighian tubule, large relative differences on the effect of feeding on the 5-HT pathway genes were identified. The whole body showed significant changes in gene expression between blood and sugar fed conditions but for each gene this changed primarily between 3 hours and 12 hours post feeding, wth 24 hours post feeding rarely causing a change. This is likely due to the time it takes a female to process a blood meal, with the 3 hour and 12 hour post feeding representing time points where the female is still processing the blood meal whereas by 24 hours, the majority of the meal has likely been processed. The midgut however showed a more consistent change primarily at 3 hours between blood fed and sugar fed conditions, whereas the Malpighian tubule showed relatively little difference across time or feeding treatment. As both the midgut and Malpighian tubules act as sites for detoxification and digestion, and osmoregulation respectively, with serotonin playing a role on both tissues, this was surprising. Based on viewing of the female mosquito midgut under a light microscope, it can be clearly seen that the midgut is surrounded by neurons responsible for innervating the gut. It was initially believed that these neurons associated with the midgut but absent with the Malpighian tubules were primarily responsible for the difference in changes in 5-HT pathway gene expression between the midgut and Malpighian tubules. The head was then processed for gene expression analysis in order to examine nervous tissue more directly for changes in 5-HT pathway gene regulation. As noted above, there was little to no difference present in the head across both treatment groups and time points as well. This leads to an interesting result as two possibilities can be proposed: the first that the neurons present that are associated with the midgut have a different or addition role(s) on 5-HT pathway regulation and therefore 5-HT and melatonin metabolism, or the second, that the neurons are in fact not involved in transcriptional regulation of 5-HT and melatonin metabolism and the midgut cells themselves are at least partially responsible for this regulation. These possibilities introduce new research directions to continue forward with  73 investigation of the 5-HT and melatonin pathway and its control by feeding. It would not be possible to collect the midgut-associated neurons directly due to their small size and inability to isolate this tissue from associated midgut tissue in the required quantities to achieve sufficient RNA extraction and test for transcriptional regulation of these pathway genes.  It is to be noted that the heads of Aedes aegypti were considered to be less than optimal for examination of CNS tissue directly. This is due to the fact that there is a noticeable discoloration present from the eye pigment that is carried through the RNA extraction process and carried into the subsequent cDNA RT-PCR and final qPCR reactions. Boncristiani et al. noticed the presence of PCR inhibitors in the compound eyes of the honeybee Apis mellifera (2011); they found it was possible to remove this contamination with the use of an RNA clean-and-concentrate kit manufactured by Qiagen. When the same procedure was applied on the Aedes aegypti female head RNA samples the contaminating presence was still present. In future studies, to obtain a truly more accurate result, the brain itself would need to be isolated without the presence of the eye tissue and related pigment during the RNA extraction process to avoid the presence of mature eye pigments leading to downstream contamination.   4.4.5 Concluding Remarks  In summary, we have contributed to the overall knowledge base surrounding the potential use for serotonin and other biogenic amines and their associated biological response pathways as targets for insecticidal development. We have confirmed our previous results that a methanol extract of Artocarpus is indeed toxic but have yet to elucidate the exact compound, or number of compounds, that contributes to this toxicity. It was shown that Artocarpus extracts significantly reduce the serotonin in larval haemolymph, leading to potential disruption of its wide variety of downstream roles. Interestingly however, there was little effect of Artocarpus extracts on the mRNA transcript levels of the genes responsible for the flux between tryptophan, serotonin and melatonin in larvae. This however does not eliminate the possibility that the 5-HT pathway is regulated at the protein level.  qPCR only determines changes in transcriptional regulation. In order to assess the effects of breadfruit extracts on protein expression it would be necessary to perform Western blot experiments to  74 determine effcts on protein expression. In addition experiments examining the activity of functionally isolated protein could also be performed. In the adults however, it was shown that the Malpighian tubules, a major site within blood feeding insects due to its role in post-prandial diuresis have no change in the 5-HT pathway transcription. Our data suggests that the change is likely associated with either the midgut tissue itself, or is caused by associated neuronal tissue that lies alongside and innervates the gut.   75 Chapter 5 :   Conclusion  This research was designed to explore a new avenue of research, the potential for plant sourced biogenic amines, serotonin and melatonin to be utilized as insecticidal or insect repellent agents against the blood feeding disease vector Aedes aegypti. We attempted to partially elucidate the mechanism of action of the traditional cultural use of the smoke from the male inflorescence of breadfruit (Artocarpus altilis) as an adult mosquito repellent. This research could potentially lead to the development of a novel secondary product from breadfruit growth across the world in areas where insect borne diseases are most prevalent and overlap heavily with world hunger.  The neuromodulating biogenic amines serotonin and melatonin were chosen due to their frequent presence in many plant species such as breadfruit, but also because these compounds, specifically serotonin, play a very special role in blood feeding insect physiology. Serotonin acts as a second diuretic hormone in blood feeding insect disease vectors such as Rhodnius prolixus, Aedes aegypti and Anopheles gambiae. A brief review of the roles of serotonin and melatonin in both plants and animals, with a focus on insects can be found in Chapter 1.   In this thesis we sought to utilize an insect bioassay, looking for insecticidal activity in larvae, for candidate extraction methods and breadfruit varieties to examine in further depth. In Chapter 2, an extraction method was chosen for future studies due to differences in mortality between methanol and pentane extraction methods, with pentane extracts yielding nearly no toxicity while methanol extracts were moderately toxic. In Chapter 3, we would to investigate the chemical characteristics of methanol extracts from a number of different breadfruit varieties to determine if there was a difference in chemicals extracted between varieties. We also confirmed the presence of serotonin in the extract using UPLC-MS and identified that there were significantly different levels of antioxidant activity between three varieties of breadfruit including two Artocarpus altilis and Artocarpus mariannensis hybrids, ulu afa and Lipet as well as breadnut, Artocarpus camansi. These same extracts as well as an mixed Artocarpus variety sample, were tested for compounds detectable by GC-MS. Many compounds were putatively identified as fatty acids or terpene based compounds that have  76 both been implicated in numerous studies with insecticidal and insect repellent activity. The putative identity of these compounds provides potential targets for future studies of insect bioassay activity. In Chapter 4, we tested insecticidal activity of multiple breadfruit extracts, and found insecticidal activity across all varieties with higher insecticidal activity in the mixed Artocarpus variety methanol extract. Further investigation and repeated studies to verify these results are needed and were not possible to complete within the scope of this thesis due to extremely limited breadfruit male inflorescence tissue available. In order to further examine the biological effect of these extracts on Aedes aegypti we also examined 5-HT and melatonin content in the haemolymph of larval mosquitoes, where we found that while melatonin concentration remained unchanged, three of the four extracts significantly reduced 5-HT content within the haemolymph. We also examined mRNA transcript levels of the four 5-HT pathway genes in larval Aedes aegypti after breadfruit exposure and found there was little change in 5-HT pathway gene transcriptional regulation.  In order to better understand the 5-HT pathway as a target for insecticide development, we also examined the effect of blood and sugar feeding on the mRNA transcripts of this pathway as 5-HT changes rapidly in blood feeding insects during times of feeding. We found that the whole body and the midgut responded with significant changes in 5-HT pathway gene transcription but no significant changes were detected in either the head of Malpighian tubules. This implies that either the midgut epithelial tissue itself or the associated neuronal tissue that innervates the gut are the sites for alterations in 5-HT pathway regulation. This implies new significance that despite the Malpighian tubules being the primary site of 5-HT diuretic activity in blood feeding insects, the midgut may potentially be a new tissue to target for pesticide development. In future studies, a number of issues encountered during this thesis need to be addressed. The largest problem encountered was the incredibly limited amount of starting tissue material of the individual three Artocarpus extracts. An abundance of tissue was collected at the Kahanu Garden site in Hana, Maui but samples were not sufficiently dried before shipping back to research facilities at BCIT and UBC Okanagan, leading to a vast  77 majority of our collected sample being unusable for experimentation, including the loss of a number of other varieties of Artocarpus samples. After this loss, the flowering seasons of most of the trees collected from was over and new male inflorescences could not be collected within that season. For future studies, breadfruit male inflorescences collected in Maui will be more thoroughly dried before shipping back to research labs in Canada and the number of varieties available for examination will be far greater. Our larvicidal information as well as the 5-HT haemolymph data and the GC-MS profiling indicates that our mixed Artocarpus sample has potentially more biological activity than other varieties, necessitating further research to better elucidate chemical profiles between varieties as well as their individual potential for insecticide development and testing. Another potential issue that can be resolved in future studies is the inconsistency of extraction and sample processing before chemical or biological experimentation, where in this thesis, some extracts were dried and resuspended multiple times and some were only dried and resuspended once, potentially drastically changing their chemical profiles with regards to the presence of terpenes and other volatiles. It is also expected that by removing the drying step of the extraction method a far greater quantity and variety of volatiles will be present.   This thesis did however indicate the possibility for the use of breadfruit as an insecticidal agent against mosquitoes such as Aedes aegypti. The reduction of serotonin in the haemolymph after exposure to Artocarpus extracts contradicts the initial hypothesis of this thesis. However, this opens up new possibilities for mechanisms of toxicity since lower serotonin concentrations within the haemolymph could also have detrimental effects on the animal’s health. Mosquito larvae reside in freshwater environments and therefore have tissue fluid that is hyperosmotic relative to their environment, resulting in a constant influx of water into the organism’s tissues. Hence, fluid secretion is critical in removing water passively taken up from the environment. Reduction of serotonin concentration in the haemolymph after Artocarpus extract exposure would lead to decreased fluid secretion rates, leading to potentially dangerous accumulation of water within tissues. Whereas in both larvae and adults, secretion of ions into the tubules to drive fluid secretion and diuresis are critical in order to excrete metabolic waste products and environmentally accumulated drugs. By limiting the potential for fluid secretion, the ability of the animal to excrete harmful drugs could be significantly reduced, offering potential for Artocarpus extracts (or its isolated  78 chemical components) to be used as a synergistic additive to be used alongside traditional pesticide drugs to increase toxicity without increasing dosage or by allowing the reduction of externally applied dosage without reducing the toxic effect on the organism.    79 References Adamo, S.A., Linn, C.E., Hoy, R.R. 1995. The role of neurohormonal octopamine during “fight or flight” behavior in the field cricket Gryllus bimaculatus. J. Exp. Biol. 198: 1691-1700. Alaux, C., Le Conte, Y., Adams, H.A., et al. 2009a. Regulation of brain gene expression in honey bees by brood pheromone. Genes Brain Behav. 8: 309-319. Alaux, C., Sinha, S., Hasadsri, L., et al. 2009b. Honey bee aggression supports a link between gene regulation and behavioral evolution. Proc. Natl. Acad. Sci. USA. 106: 15400-15405. Amer, A., Mehlhorn, H., 2006. Larvicidal effects of various essential oils against Aedes, Anopheles, and Culex larvae (Diptera, Culicidae). Parasitol. Res. 99: 466-472. Arnao, M.B., Hernández-Ruiz, J.,2006. The physiological function of melatonin in plants. Plant Signal Behav. 1:89–95 Arnao, M.B., 2014. Phytomelatonin: Discovery, Content, and Role in Plants. Advances in Botany. Volume 2014, Article ID 815769, http://dx.doi.org/10.1155/2014/815769. Bajwa, V.S., Murch, S.J., Saxena, P.K., 2014. Melatonin Rich Plants: Production, Significance in Agriculture and Human Health In Production of Biomass and Bioactive Compounds Using Bioreactor Technology, Springer, pp 445-468. Barrau, J. 1796. Breadfruit and relatives. Pp. 201-202 in Evolution of Crop Plants (N.W. Simmonds, ed.). Longman, London. Barrett, M., Orchard, I., 1990. Serotonin-induced elevation of cAMP levels in the epidermis of the blood sucking bug, Rhodnius prolixus. J. Insect Physiol. 36, 625-633. Berlin, J., Rogenhagen, C., Peter, D., Fecker, L.F., Goddijn, O.J.M., Hoge, J.H.C. 1993. Increased production of serotonin by suspension and root cultures of Peganum harmala transformed with a tryptophan decarboxylase cDNA clone from Catharanthus roseus. Transgenic Research 2:336-344.  Blanco, M. 1837. Flora de Filipinas. C. Lopez, Manila. Boncristiani, H., Li, J., Evans, J., Pettis, J., Chen, Y. 2011. Scientific note on PCR inhibitors in the compound eyes of honey bees Apis mellifera. Apidologie, 42(4): 457-460. Bowden, K., Brown, B.G., Batty, J.E., 1954. 5-hydroxytryptamine: Its occurrence in cowhage (Mucuna pruriens). Nature. 174:925-6. do Ceu Silva, M., Gaspar, J., Silva, I.D., Leao, D., Rueff, J. 2003. Induction of chromosomal  80 aberrations by phenolic com- pounds: possible role of reactive oxygen species. Mutat. Res. 540: 29–42  Chen, G., Huo, Y., Tan, D.X., Liang, Z., Zhang, W., Zhang, Y., 2003. Melatonin in Chinese medicinal herbs. Life. Sci. 73:19–26 Clark, T.M., Bradley, T.J. 1995. Stimulation of Malpighian tubules from larval Aedes aegypti by secretagogues. J. Insect. Physiol. 42(6): 593-602. Clark, T.M., Bradley, T.J. 1997. Malpighian Tubules of Larval Aedes aegypti Are Hormonally Stimulated by 5-Hydroxytryptamine in Response to Increased Salinity. Archives of Insect Biochemistry and Physiology 34:123–141  Colas, J.F., Launay, J.M., Kellermann, O., Rosay, P., Maroteaux, L., 1995. Drosophila 5- HT2 serotonin receptor: coexpression with fushi-tarazu during segmentation. Proceedings of the National Academy of Sciences U S A 92, 5441e5445.  Collins, C., Miller, T. 1977. Studies on the action of biogenic amines on cockroach heart. 67: 1-15. Coenan, J. and Barrau, J. 1961. The breadfruit tree in Micronesia. South Pacific Commossion Bull. 11(4): 37-39, 65-67. Cohen, R.W., 2001. Diet balancing in the cockroach Rhyparobia madera: does serotonin regulate this behavior? J. Insect. Behav. 14, 361-367. Cook, H., Orchard, I., 1990. Effects of 5,7-DHT upon feeding and serotonin content of various tissues in Rhodnius prolixus. J. Insect. Physiol. 5: 361-367. Coronel, R.E. 1983. Rimas and kamansi. Promising fruits of the Philippines. Pp. 379-396. College of Agriculture, University of the Philippines at Los Banos. Csaba, G., Pál, K., 1982. Effects of insulin, triiodothyronine, and serotonin on plant seed development. Protoplasma. 110:1, 20-22  Dadd, R.H., 1975. Alkalinity within the midgut of mosquito larvae with a1kaline­ active digestive enzymes. J. Insect Physiol. 21, 1847-53 Dempsey, D.R., Jeffries, K.A., Anderson, R.L., Carpenter, A.M., Opsina, S.R., Merkler, D.J. 2014. Identification of an arylalkylamine N-acetyltransferase from Drosophila melanogaster that catalyzes the formation of long chain N-acylserotonins. FEBS Letters 588, 594-599. Dube, F.F., Tadesse, K., Birgersson, G., Seyoum, E., Tekie, H., Ignell, R., Hill, S.R., 2011. Fresh, dried or smoked? Repellent properties of volatiles emitted from ethnomedicinal plant leaves against malaria and yellow fever vectors in Ethiopia. Malaria Journal 10, 375  81 Erber, J., Kloppenburg, P., Scheidler, A., 1993. Neuromodulation by serotonin and octopamine in the honeybee: behaviour, neuroanatomy and electrophysiology. Experientia 49, 1073e1083.  Erspamer V., Asero B., 1952. Identification of enteramine, specific hormone of enterochromaffine cell, as 5-hydroxytryptamine. Nature 169: 800–801 Esquivel, C.J., Cassone, B.J. and Piermarani., P.M., 2014. Transcriptomic evidence for a dramatic functional transition of the Malpighian tubules after a blood meal in the Asian tiger mosquito Aedes albopictus. PLoS Negl. Trop. Dis. 8(6): e2929. Feldman, J.M., Lee, E.M., 1985. Serotonin content of foods: Effect on urinary excretion of 5-hydroxy indoleacetic acid. Am. J. Clin. Nutr. 42:639-43. Figueira-Mansur, J., Ferreira-Pereira, A., Mansur, J.F., Franco, T.A., Alvarenga, E.S.L., Sorgine, M.H.F., Neves, B.C., Melo, A.C.A., Leal, W.S., Masuda, H., Moreira, M.F. 2013. Silencing of P-glycoprotein increases mortality in temephos-treated Aedes aegypti larvae. Insect Molecular Biology 22(6): 648-658. Fosberg, F.R. 1960. Introgression in Artocarpus in Micronesia. Brittonia 12: 101-113. Fownes, J.H. and Raynor, W.C. 1993. Seasonality and yield of breadfruit cultivars in the indigenous agroforestry system of Pohnpei, Federated States of Micronesia. Trop. Agric. (Trinidad) 70: 103-109. French, A.S., Simcock, K.L., Rolke, D., Gartside, S.E., Blenau, W., Wright, G.A., 2014. The role of serotonin in feeding and gut contractions in the honeybee. J. Insect Phys. 61, 8-15. Gnankiné, O., Bassolé, I.H.N., Chandre, F., Glitho, I., Akogbeto M., Dabiré, R.K. and Martin, T., 2013. Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector strategies in West Africa. Acta Tropica 128: 7-17. Guedes, S.F., Mendes, B., Leitão, A.L. 
 2011. Resorcinol degradation by a Penicillium chrysogenum strain under osmotic stress: mono and binary substrate matrices with phenol. Biodegradation. 22: 409–419  Gülçin, İ., Büyünkokuroğlu, M.E., Oktay, M., Küfrevioğlu, Ö.İ. 2002. On the in vitro antioxidant properties of melatonin. J Pineal Res. 33: 167-171 Gülçin, İ., Büyünkokuroğlu, M.E., Küfrevioğlu, Ö.İ. 2003. Metal chelating and hydrogen peroxide scavenging effects of melatonin. J Pineal Res. 34: 278-281.  82 Gülçin, İ. 2007. Measurement of antioxidant ability of melatonin and serotonin by the DMPD and CUPRAC methods as trolox equivalent. Journal of Enzyme Inhibition and Medicinal Chemistry, 23(6): 871–876.Halstead, S.B., 2007. Dengue. Lancet 370: 1644–1652. Hannon, J., Hoyer, D., 2008. Molecular biology of 5-HT receptors. Behavioural Brain Research 195, 198e213. Hardeland, R., Balzer, I., Poeggeler, B., Fuhrberg, B. and Uria, H.G., 1995. On the primary functions of melatonin in evolution: mediation of photoperiodic signals in a unicell, photooxidation, and scavenging of free radicals. J. Pineal Res. 18, 104–111. Hattori, A., Migitaka, H., Iigo, M., Itoh, M., Yamamoto, K., Ohtani-Kaneko, R., Hara, M., Suzuki, T., Reiter, R.J., 1995. Identification of melatonin in plants and its effects on plasma melatonin levels and binding to melatonin receptors in vertebrates. Biochem. Mol. Biol. Int. 35:627 Hedlund, P.B., Sutcliffe, J.G., 2004. Functional, molecular and pharmacological advances in 5-HT7 receptor research. TRENDS in Pharmacological Sciences. 25(9): 481-486. Hellemans, J., Mortier, G., De Paepe, A., Speleman, F. and Vandesompele, J. (2007). qBase relative quantification framework and software for management and automated analysis of real‐ time quantitative PCR data. Genome Biology 8, R19. Hintermann, E., Grieder, N.C., Amherd, R., Brodbeck, D., Mayer, U.A., 1996. Cloning of an arylalkylamine N-acetyltransferase (aaNAT1) from Drosophila melanogaster expressed in the nervous system and gut. Proc. Natl. Acad. Sci. U.S.A. 93, 12315–12320. Hiripi, L., Downer, R.G.H., 1993. Characterization of serotonin binding sites in Insect (Locusta migratoria) Brain. Insect. Biochem. Molec. Biol. 23 (2):303-307. House, H. L., 1974. Digestion. In: The Physiology of Insecta , ed . M. Rock­ stein, 5:63- 1 17. New York: Academic. 2nd ed. Ishihara, A., Hashimoto, Y., Miyagawa, H., Wakasa, K., 2008. Induction of serotonin accumulation by feeding of rice striped stem borer in rice leaves. Plant Signal Behav. 3:714-6. Itoh, M.T., Hattori, A., Sumi, Y., Suzuki, T., 1995. Day-night changes in melatonin levels in different organs of the cricket (Gryllus bimaculatus). J. Pineal. Res. 18, 165-169. Jarrett, F.M. 1959. Studies in Artocarpus and allied genera, III. A revision of Artocarpus subgenus Artocarpus. J. Arnold Arboretum 15:298-326.    83 Jo, W.K., Lee, J.H. .2011. Naphthalene and benzene levels in microenvironments associated with potential exposure: new and old apartments with moth repellents, and cabins of passenger cars. International Journal of Environmental Analytical Chemistry, 91:15, 1412-1424 Jones, A.M., Klun, J.A., Cantrell, C.L., Ragone, D., Chauhan, K.R., Brown, P.N., Murch, S.J., 2012. Isolation and identification of mosquito (Aedes aegypti) biting deterrent fatty acids from male inflorescences of breadfruit (Artocarpus altilis) (Parkinson) Fosberg). J. Ag. Food Chem. 60: 3867-3873. Kahru, A., Pollumaa, L., Reiman, R., Ratsep, A., Liiders, M., Maloveryan, A. 2000. The toxicity and biodegradability of eight main phenolic compounds characteristic to the oil-shale industry wastewaters: a test battery approach. Environ. Toxicol. 15: 431–442  Kang, S., Kang, K., Lee, K., Back, K., 2007. Characterization of rice tryptophan decarboxylases and their direct involvement in serotonin biosynthesis in transgenic rice. Planta 227:263–272. Kang, K., Kim, Y.S., Park, S., Back, K., 2009. Senescence-induced serotonin biosynthesis and its role in delaying senescence in rice leaves. Plant Physiol. 150:1380-1393. Kang, K., Kong, K., Park, S., Natsagdorj, U., Kim, Y.S., Back, K., 2011. Molecular cloning of a plant N-acetylserotonin methyltransferase and its expression characteristics in rice. J. Pineal. Res. 50:304–309. Kang, K., Lee, K., Park, S., Byeon, Y., Back, K., 2012. Molecular cloning of rice serotonin N‐ acetyltransferase, the penultimate gene in plant melatonin biosynthesis. J. Pineal. Res. 55:7–13 Lange, A. 2009. Tyramine: From octopamine precursor to neuroactive chemical in insects. General and Comparative Endocrinology 162: 18–26  Lange, A.B., Orchard, I., Barrett, M.F., 1989. Changes in haemolymph serotonin levels associated with feeding in the blood-sucking bug Rhodnius prolixus. J. Insect. Physiol. 35(5): 393-399. Livingstone, M.S., Tempel, B.L., 1983. Genetic dissection of monoamine neuro- transmitter synthesis in Drosophila. Nature 303, 67e70.  Lucas, M.P., Ragone, D., 2012. National Tropical Botanical Garden, “Will Breadfruit Solve the World Hunger Crisis?,” ArcNews, pgs. 6 and 7 (http://www.esri.com/news/arcnews/summer12articles/will-breadfruit-solve-the-world-hunger-crisis.html)   84 Maddrell, S.H.P., Pilcher, D.E.M., Gardiner, B.O.C., 1969. Stimulatory effect of 5-hydroxytryptamine (serotonin) on the secretion by Malpighian tubules of insects. Nature 222, 784-785. Maddrell, S.H.P., Pilcher, D.E.M., Gardiner, B.O.C., 1971. Pharmacology of the Malpighian tubules of Rhodnius and Carausius: the structure-activity relationship of tryptamine analogues and the role of cyclic AMP. J. Exp. Biol. 54: 779-804. Maddrell, S.H.P., Lane, N. J., Harrison, J. B., Overton, J.A., Moreton, R.B., 1988. The initial stages in the action of an insecticidal δ-endotoxin of Bacillus thuringiensis var. israelensis on the epithelial cells of the Malpighian tubules of the insect Rhodnius prolixus. J. Cell Sci. 90, 131–144. Maddrell, S.H.P., Herman, W.S., Mooney, R.L., Overton, J.A., 1991. 5-hydroxytryptamine: a second diuretic hormone in Rhodnius prolixus. J. Exp. Biol. 156: 557-566. Maddrell, S.H.P., Herman, W.S., Farndale, R.W., Riegel, J.A., 1993. Synergism of hormones controlling epithelial transport in an insect. J. Exp. Biol. 174: 65-80. Marusalin, J., Matier, B.J., Rheault, M.R. and Donini, A. (2012). Aquaporin homologs and water transport in the anal papillae of the larval mosquito, Aedes aegypti. Journal of Comparative Physiology B. DOI:10.1007/S00360-012-0679-2.  Manchester, L.C., Tan, D.X., Reiter, R.J., Park, W., Monis, K., Qi, W., 2000. High levels of melatonin in the seeds of edible plants: possible function in germ tissue protection. Life. Sci. 67:3023–3029. Massal, E. and Barrau, J. 1954. Pacific subsistence crops: breadfruit. South pacific Bull 4(4): 24-26. McCann, F.V., Reece, R.W., 1967. Neuromuscular transmission in insects: effect of injected chemical agents. Comp. Biochem. Physiol. 21:115-24. Meyer, J.M., Ejendal, K.F.K., Avramova, L.V., Garland-Kuntz, E.E., Giraldo-Caldero ́n, G.I., et al. .2012. A ‘‘Genome-to-Lead’’ Approach for Insecticide Discovery: Pharmacological Characterization and Screening of Aedes aegypti D1-like Dopamine Receptors. PLoS Negl Trop Dis 6(1): e1478. doi:10.1371/journal.pntd.0001478  Moffet, D.F., Jagadeshwaran, U., Wang, Z., Davis, H.M., Onken, H., Goss, G.G., 2012. Signaling by intracellular Ca2+ and H+ in larval mosquito (Aedes aegypti) midgut epithelium in response to serosal serotonin and lumen pH. J. Insect. Phys. 58, 506-512. Montoreano, R., Triana, F., Abate, T., Rangal-Aldao, R., 1990. Cyclic AMP in the Malpighian tubule fluid and in the urine of Rhodnius prolixus. Gen. Comp. Endocrinol. 77, 136-142.  85 Morton, J. 1987. Breadfruit. Pp. 50-58 in Fruits in Warm Climates. Morton Collectanea. University of Miami, Coral Gables, Florida. Murch, S.J., Simmons, C.B., Saxena, P.K., 1997. Melatonin in feverfew and other medicinal plants. Lancet 350:1598–1599. Murch, S.J., KrishnaRaj, S., Saxena, P.K., 2000. Tryptophan is a precursor for melatonin and serotonin biosynthesis in in vitro regenerated St. John’s wort (Hypericum perforatum L. cv.Anthos) plants. Plant. Cell. Rep. 19:698–704. Murch, S.J., Campbell, S.S.B., Saxena, P.K., 2001. The role of serotonin and melatonin in plant morphogenesis: Regulation of auxin induced root organogenesis in in vitro-cultured explants of St. John’s wort (Hypericum perforatum L.). In Vitro Cell Dev. Biol. Plant. 37:786-93. Murray, C.J., Rosenfeld, L.C., Lim, S.S., Andrews, K.G., Foreman, K.J., et al., 2012. Global malaria mortality between 1980 and 2010: a systematic analysis. Lancet 379: 413–31 Navarro, M., Malres, S., Labouisse, J.P., and Roupsard, O. 2007. Vanuatu breadfruit project: Survey on Botanical Diversity and Traditional Uses of Artocarpus altilis. Acta Hortic. 757:81-88. Neckameyer, W.S., White, K., 1992. A single locus encodes both phenylalanine hydroxylase and tryptophan hydroxylase activities in Drosophila. Journal of Biological Chemistry 267, 4199e4206.  Nichols, C.D., 2007. 5-HT2 receptors in Drosophila are expressed in the brain and modulate aspects of circadian behaviors. Developmental Neurobiology 67, 752e763.  Nichols, D.E., Nichols, C.D., 2008. Serotonin receptors. Chemical Reviews 108, 1614e1641.  Nishida, R., 2002. Sequestration of defense substances from plants by Lepidoptera. Annu. Rev. Entomol. 47: 57-92. Nuss AB, Ejendal KFK, Doyle TB, Meyer JM, Lang EG, Watts VJ, et al. (2015) Dopamine Receptor Antagonists as New Mode-of-Action Insecticide Leads for Control of Aedes and Culex Mosquito Vectors. PLoS Negl Trop Dis 9(3): e0003515. doi:10.1371/journal.pntd.0003515  Olsson, G. 1991. The socio-economic importance of non-timber products in the South Pacific: focus on Vanuatu. Unasylva 165(42): 24-30. Orchard, I., 2006. Serotonin: a coordinator of feeding-related physiological events in the blood-gorging bug, Rhodnius prolixus. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 144, 316-324.  86 Orchard, I.1982. Octopamine in insects: neurotransmitter, neurohormone, and neuromodulator. Can. J.Zool. 60: 659-669.  Orchard, I., Ramirez, J.M., Lange, A. 1993. A multifunctional role for octopamine in locust flight. Annu. Rev. Entomol. 1993.38:227-49
  O’Donnell, M.J., 2009. Too much of a good thing: how insects cope with excess ions or toxins in the diet. J. Exp. Biol. 212, 363-372. Pandey, S.K., Upadhyay, S. and Tripathi, A.K. 2009. Insecticidal and repellent activities from the essential oil of Trachyspermum ammi (Linn) Sprague seeds against Anopheles stephensi. Parasitol Res. 105: 507-512. Park, H.M., Kim, J., Chang, K.S., Kim, B.S., Yang, Y.J., Kim, G.H., Shin, S.C., Park, I.K., 2009. Larvicidal activity of Myrtaceae essential oils and their components against Aedes aegypti, acute toxicity on Daphnia magna, and aqueous residue. J. Med. Entomol. 48(2): 405-410. Park, S., Lee, K., Kim, Y.S., Back, K., 2011. Tryptamine 5‐ hydroxylase‐ deficient Sekiguchi rice induces synthesis of 5‐ hydroxytryptophan and N‐ acetyltryptamine but decreases melatonin biosynthesis during senescence process of detached leaves. J. Pineal. Res. 52:211–216. Pattison, D.I., Dean, R.T., & Davis, M.J. (2002). Oxidation of DNA, proteins and lipids by DOPA, protein-bound DOPA, and related catechol (amine)s. Toxicology, 177, 23–37. Patrick, M.L., Aimanova, K., Sanders, H.R., Gill, S.S., 2006. P-type Na+/K+-ATPase and V-type H+-ATPase expression patterns in the osmoregulatory organs of larval and adult mosquito Aedes aegypti. J. Exp. Biol 209: 4638-4651. Phillips, J., 1981. Comparative physiology of insect renal function. American Physiological Society R241-R257. Posmyk, M.M., Janas, K.M., 2009. Melatonin in plants. Acta. Physiol. Plant. 31:1–11 Prajapati, V., Tripathi, A.K., Aggarwal, K.K., Khanuja, S.P.S., 2005. Insecticidal, repellent and oviposition-deterrent activity of selected essential oils against Anopeoles stephensi, Aedes aegypti and Culex quinquefasciatus. Bioresrouce Technology 96: 1749-1757. Purseglove, J.W. 1968. Artocarpus altilis. Pp. 379-384. In Tropical Crops. Dicotyledons. Longman. London. Quisumbing, E. 1940. The validity of Artocarpus camansi Blanco.Philippine J. Sci. 72(2): 86-89. Ragone, D. 1991. Collection, Establishment, and Evaluation of a Germplasm Collection of Pacific Island Breadfruit. PhD Dissertation. University of Hawaii, Honolulu.   87 Ragone, D. 1997. Breadfruit. Artocarpus altilis (Parkinson) Fosberg. Promoting the conservation and use of underutilized and neglected crops. 10. Intl. Plant Genetic Reseources Inst., Rome. Ragone, D. and Cavaletto, C.G., 2006. Sensory evaluation of fruit quality and nutritional composition of 20 breadfruit (Artocarpus, Moraceae) cultivars. Econ. Bot. 60:335-346. Reiter, R.J., Tan, D.X., Fuentes-Broto, L., 2010. Melatonin: a multitasking molecule. Progress in Brain Research 181: 127-151. Regnault-Roger, C., Vincent, C., Arnason J.T., 2012. Essential oils in insect control: Low-Risk Products in a High Stakes World. Annu. Rev. Entomol 57: 405-424. Rheault, M.R., Okech, B.A., Kee, S.B.W., Miller, M.M., Meleshkevitch, E.A., Linser, P.J., Doudko, D.Y., Harvey, W.R., 2007. Molecular cloning, Phylogeny and localization of AgNHA1: the first Na+/H+ antiporter (NHA) from a metazoan, Anopheles gambiae. J. Exp. Biol. 210, 3848-3861. Roshchina, V.V., 2001. Neurotransmitters in plant life. Science Publishers, Enfield; 4-81. Runge, F.F., 1820. Neueste phytochemische entdeckungen zur begründung einer wissenschaftlichen phytochemie. 1:144-159.  Schulz, D.J., Robinson, G.E., 1999. Biogenic amines and division of labor in honey bee colonies: behaviorally related changes in the antennal lobes and age-related changes in the mushroom bodies. J. Comp. Physiol. 184, 481–488. Senthilkumar, A., Tikar, S.N., Gopalan, N., Sundaramoorthy, P., Venkatesalu, V. 2012. Larvicidal potential of different solvent extracts and oleanolic acid derivative from Coccinia indica against vector mosquitoes, Toxicological & Environmental Chemistry, 94:7, 1342-1349, DOI: 10.1080/02772248.2012.705288  Silva, W.J., Dória, G.A.A., Maia, R.T., Nunes, R.S., Carvalho, G.A., Blank, A.F., ALves, P.B., Marçal, R.M., Cavalcanti, S.C.H., 2008. Effects of essential oils on Aedes aegypti larvae: Alternatives to environmentally safe insecticides. Bioresource Technology 99: 3251-3255. da Silva, O.S., da Silva, F.C., de Barros, F. M.C., da Silva, J.L.R., de Loreto Bordignon, S.A., Eifler-Lima, V.L., von Poser, G.L., Prophiro, J.S., 2013. Larvicidal activity and growth inhibiting activites of extract and benzopyrans from Hypericum polyanthemum (Guttiferae) against Aedes aegypti (Diptera: Culicidae). Industrial Crops and Products. 45: 236-239. Slominski, A., Semak, I., Pisarchik, A., Sweatman, T., Szczesniewski, A., Wortsman, J., 2002. Conversion of L-tryptophan to serotonin and melatonin in human melanoma cells. FEBS Lett 511:102–106.  88 Stehle, J.H., Saade, A., Rawashdeh, O., Ackermann, K., Jilg, A., Sebestény, T., Maronde, E., 2011. A survey of molecular details in the human pineal gland in the light of phylogeny, structure, function and chronobiological diseases. J. Pineal. Res. 51:17–43 Sugden, D., 1989. Melatonin biosynthesis in the mammalian pineal gland. Cell Mol Life Sci 45:922–932. Tamashiro, H., Yoshino, M. 2014. Signaling pathway underlying the octopaminergic modulation of myogenic contraction in the cricket lateral oviduct. Journal of Insect Physiology 71: 30–36 Te Brugge, V., Paluzzi, J.P., Schooley, D.A., Orchard, I., 2011. Identification of the elusive peptidergic diuretic hormone in the blood-feeding bug Rhodnius prolixus: a CRF-related peptide. J. Exp. Biol. 214, 371–381. Teufel, D.R. 1999. Final report on safety assessment of Azulene. Int. J. Toxicol. 18: 27–32. Theobald, F.V., 1901. Monog. of the Culicidae. 1, 21. Tilden, A.R., Anderson, W.J. and Hutchison, V.H., 1994. Melatonin in two species of damselfly, Ischnura verticalis and Enallagma civile. J. Insect Physiol. 40, 775–780. Trécul, A. 1847. Mémoire sur la Famille des Artocarpées. Ann. Sci. Nat. Bot. Sect. III. 8:38-64. Turi, C.E., Axwik, K.E., Smith, A., Jones, A.M.P., Saxena, P.K., Murch, S.J. 2014. Galanthamine, an anti-cholinesterase drug, effects plant growth and develop- ment in Artemisia tridentata Nutt. via modulation of auxin and neurotransmitter signaling. Plant Signaling & Behavior. 9:e28645; PMID: 24690897; http://dx.doi.org/10.4161/psb.28645  USFDA Frequency of Use of Cosmetic Gradients, FDA Data Base, United States Food and Drug Administration, Washington, DC, 1996. Vadivel, V., Janardhanan, K. 2001. Nutritional and anti-nutritional attributes of the under-utilized legume. Cassia floribunda Cav. Food Chemistry, 73, 209–215.  Vermeulen, J., Pattyn, F., De Preter, K., Vercruysse, L., Derveaux, S., Mestdagh, P., Lefever, S., Hellemans, J., Speleman, F. and Vandesompele, J. (2009). External oligonucleotide standards enable cross laboratory comparison and exchange of real time quantitative PCR data. Nucleic Acids Research 37(21), e138. Vömel, M., Wegener, C., 2008. Neuroarchitecture of aminergic systems in the larval ventral ganglion of Drosophila melanogaster. PLoS ONE 3(3): e1848. Doi:10.1371/journal.pone.0001848 Wagener-Hulme, C., Kuehn, J.C., Schulz, D.J., Robinson, G.E. 1999. Biogenic amines and division of labor in honey bee colonies. J. Comp. Physiol. 184, 471–479.  89 Weng, X.H., Huss, M., Wieczorek, H., Beyenbach, K.W., 2003. The V-type H+-type ATPase in Malpighian tubules of Aedes aegypti: localization and activity. J. Exp. Biol. 206: 2211-2219. World Health Organization. 2014. Factsheet N°387: Vector-borne diseases.  Woskresensky, A., 1842. "Über das Theobromin". Liebigs Annalen der Chemie und Pharmacie 41: 125–127.  Yakovlev, A.Y., Gordya, N.A. 2012. Hormonal influence on antimicrobial peptide biosynthesis by a blowfly Calliphora vicina R.-D. (Diptera, Calliphoridae) fat body cells. Entomologicheskoe Obozrenie. 91(3): 498-505.    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0166634/manifest

Comment

Related Items