Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of hippocalcin-like protein 1 (HPCAL1), a neuronal calcium sensor protein in the retina Tam, Aleeza Hoi Ting 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2015_september_tam_aleeza.pdf [ 3.22MB ]
Metadata
JSON: 24-1.0166605.json
JSON-LD: 24-1.0166605-ld.json
RDF/XML (Pretty): 24-1.0166605-rdf.xml
RDF/JSON: 24-1.0166605-rdf.json
Turtle: 24-1.0166605-turtle.txt
N-Triples: 24-1.0166605-rdf-ntriples.txt
Original Record: 24-1.0166605-source.json
Full Text
24-1.0166605-fulltext.txt
Citation
24-1.0166605.ris

Full Text

 CHARACTERIZATION OF HIPPOCALCIN-LIKE PROTEIN 1 (HPCAL1), A  NEURONAL CALCIUM SENSOR PROTEIN IN THE RETINA   by   Aleeza Hoi Ting Tam   B.Sc., The University of British Columbia, 2010      A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF  THE REQUIREMENTS FOR THE DEGREE OF   MASTER OF SCIENCE   in   The Faculty of Graduate and Postdoctoral Studies  (Biochemistry and Molecular Biology)      THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)    August 2015    © Aleeza Hoi Ting Tam, 2015 ii  Abstract   Hippocalcin-like protein 1 (HPCAL1) is a neuronal calcium sensor (NCS) protein found in the brain and in the retina.  NCS proteins have important roles in signaling pathways including phototransduction; however, the role of HPCAL1 in the retina remains unresolved.  The objective of this thesis is to characterize HPCAL1 and identify its potential interacting partners in the retina.   The first part of the thesis examines the localization and characteristics of HPCAL1 using a variety of biochemical assays. The presence of HPCAL1 in the retina was confirmed with RT-PCR, Western blotting analysis, and immunofluorescence microscopy.  Since NCS proteins respond to intracellular calcium level changes, HPCAL1 was expressed and isolated from both mammalian cells and E. coli to study its calcium binding properties and other characteristics.  Results from a gel mobility shift assay and a fluorescence assay clearly indicated that HPCAL1 undergoes conformational changes upon calcium binding.  Furthermore, membrane association assays confirmed that retinal HPCAL1 possesses the calcium-myristoyl switch mechanism which responds to the presence or absence of calcium. NCS proteins often interact with other proteins to perform their functions; therefore, the second part of the study involves the use of mass spectrometry in an attempt to identify calcium-dependent interacting partners of HPCAL1.  Over 300 potential interacting partners were identified, and selected proteins were subjected to co-immunoprecipitation and Western blotting analysis or co-localization studies using immunofluorescence microscopy in order to confirm their interactions with HPCAL1.  TorsinA has been identified as a calcium-dependent interacting partner to HPCAL1; however, further studies will have to be conducted to determine the iii  significance of this interaction and to confirm other potential interacting partners that were identified in the mass spectrometry analysis.   The results of this study provide important technical information on the biochemical characterization of HPCAL1 and the properties of HPCAL1 in the retina.  Not only has the identification of potential interacting partners of HPCAL1 provided first insights at its possible role or function in the retina, it has also pointed out the potential for identifying interacting partners of other NCS proteins using mass spectrometry.       iv  Preface   The first part of this study (Chapter 2) was initiated by Ms. Shabnam Rostamirad and Mr. Anthony Chan.  Isolation of mouse tissues was performed by Dr. Jiao Wang.  HPCAL1 monoclonal antibodies were generated by Ms. Rostamirad and Ms. Theresa Hii previously.  Retinal sections were prepared by Mr. Hidayat Djajadi.        The second part of this study (Chapter 3) was performed as part of a collaboration with Dr. Leonard Foster from the Department of Biochemistry and Molecular Biology at The University of British Columbia.  The dimethyl labeling, liquid chromatography/mass spectrometry, and protein identification and quantitation were performed by Ms. Jenny Moon of the Foster laboratory.   I performed other experimental work and wrote this thesis.  A copy of this thesis was edited by Dr. Robert Molday.            v  Table of Contents   Abstract .......................................................................................................................................... ii Preface ........................................................................................................................................... iv Table of Contents .......................................................................................................................... v List of Tables ................................................................................................................................ ix List of Figures ................................................................................................................................ x List of Abbreviations .................................................................................................................. xii Acknowledgements .................................................................................................................... xvi Chapter 1: Introduction ............................................................................................................... 1 1.1 Vision .................................................................................................................................... 1 1.1.1 The vertebrate eye .......................................................................................................... 1 1.1.2 The retina ....................................................................................................................... 3 1.1.3 The photoreceptors......................................................................................................... 6 1.1.4 Phototransduction .......................................................................................................... 8 1.2 EF-hand calcium sensor protein superfamily ....................................................................... 9 1.2.1 Neuronal calcium sensor proteins ................................................................................ 11 1.2.2 Functions of NCS proteins ........................................................................................... 14 1.2.3 Visinin-like proteins..................................................................................................... 17 1.2.4 Hippocalcin-like protein 1 ........................................................................................... 21 1.3 Thesis investigation ............................................................................................................ 22 Chapter 2: Characterization of the neuronal calcium sensor protein HPCAL1 in retina ... 24 2.1 Introduction ......................................................................................................................... 24 2.2 Methods............................................................................................................................... 25 2.2.1 Materials ...................................................................................................................... 25 2.2.2 DNA constructs ............................................................................................................ 25 vi  2.2.3 Gene Expression by RT-PCR ...................................................................................... 26 2.2.4 Expression of HPCAL1 in HEK293T.......................................................................... 26 2.2.5 Isolation of HEK293T membranes .............................................................................. 26 2.2.6 Purification of HPCAL1 from HEK293T .................................................................... 27 2.2.7 Expression of HPCAL1 in COS-7 ............................................................................... 27 2.2.8 Immunofluorescence microscopy of COS-7 ................................................................ 27 2.2.9 Immunofluorescence microscopy of retina .................................................................. 28 2.2.10 Isolation of retina membranes .................................................................................... 28 2.2.11 Membrane association assays with HEK293T and bovine retina membranes .......... 29 2.2.12 Calcium binding fluorescence assay .......................................................................... 29 2.2.13 Expression of HPCAL1 in E. coli .............................................................................. 30 2.2.14 Purification of HPCAL1 from E. coli ........................................................................ 30 2.2.15 Mobility shift assay .................................................................................................... 31 2.2.16 Cloning, expression, and purification of class B NCS proteins ................................. 31 2.2.17 Characterization of HPCAL1 monoclonal antibodies ............................................... 31 2.2.18 SDS-PAGE and Western blots................................................................................... 32 2.3 Results ................................................................................................................................. 32 2.3.1 Hpcal1 mRNA expression was examined by RT-PCR ............................................... 32 2.3.2 Expression and purification in HEK293T cells ........................................................... 34 2.3.3 Localization of HPCAL1 in transfected COS-7 cells .................................................. 35 2.3.4 Localization of HPCAL1 in the retina by immunofluorescence microscopy .............. 36 2.3.5 HPCAL1 displays the calcium-myristoyl switch in retina .......................................... 37 2.3.6 HPCAL1 reversibly associates with HEK293T membranes ....................................... 39 2.3.7 Calcium binding fluorescence assay ............................................................................ 41 2.3.8 Expression and purification of HPCAL1 from E. coli ................................................. 42 vii  2.3.9 HPCAL1 mobility shift assay ...................................................................................... 44 2.3.10 Expression of class B NCS proteins .......................................................................... 45 2.3.11 Characterization of HPCAL1 monoclonal antibodies using Western blots............... 46 2.3.12 Characterization of HPCAL1 monoclonal antibodies using immunofluorescence ... 48 microscopy ............................................................................................................................ 48 2.4 Discussion ........................................................................................................................... 50 Chapter 3: Attempts to identify potential interacting partners of HPCAL1 ........................ 57 3.1 Introduction ......................................................................................................................... 57 3.2 Methods............................................................................................................................... 58 3.2.1 Materials ...................................................................................................................... 58 3.2.2 DNA constructs ............................................................................................................ 58 3.2.3 Cloning and expression of GST-tagged HPCAL1 and GST ....................................... 58 3.2.4 Generation of CNBr-coupled GST-HPCAL1 Sepharose and GST Sepharose ............ 58 3.2.5 Preparation of bovine retina homogenate .................................................................... 59 3.2.6 Pull-down assay ........................................................................................................... 59 3.2.7 Dimethyl labeling......................................................................................................... 59 3.2.8 LC/MS and protein identification/quantitation ............................................................ 60 3.2.9 Cloning and expression of potential interacting proteins ............................................ 61 3.2.10 Expression of HPCAL1 and potential interacting proteins in HEK293T and COS-7 cells ....................................................................................................................................... 62 3.2.11 Immunoprecipitation .................................................................................................. 62 3.2.12 Immunofluorescence microscopy .............................................................................. 62 3.3 Results ................................................................................................................................. 63 3.3.1 Expression and purification of GST-tagged HPCAL1 ................................................ 63 3.3.2 Potential interacting partners of HPCAL1 were identified from the pull-down assay 64 viii  3.3.3 Co-immunoprecipitation of HPCAL1 and its potential interacting partners ............... 70 3.3.4 Co-localization of HPCAL1 and its potential interacting partners using immunofluorescence microscopy ......................................................................................... 73 3.4 Discussion ........................................................................................................................... 75 Chapter 4: Conclusions and future directions ......................................................................... 81 References .................................................................................................................................... 85 Appendices ................................................................................................................................... 97 Appendix 1: Proteins identified in all three replicates of the pull-down experiment ............... 97 Appendix 2: Proteins identified by mass spectrometry and their medium/light (EDTA/calcium) ratios .......................................................................................................................................... 99                       ix  List of Tables   Table 1.1 Summary of the mammalian members of the neuronal calcium sensor protein family 16  Table 2.1 Summary of the HPCAL1 monoclonal antibody characterization studies ................... 47  Table 3.1 Proteins identified by mass spectrometry analysis from the pull-down assays ............ 66  Table 3.2 Summary of the EDTA/calcium ratios for the three proteins selected for confirmation studies ........................................................................................................................................... 69 Table A.1 Proteins that were identified in all three replicates of the pull-down experiment and had at least one EDTA/calcium ratio of greater than 2 ................................................................. 97 Table A.2 Medium/light (EDTA/calcium) ratios for potential interacting proteins of HPCAL1 identified by mass spectrometry ................................................................................................... 99 Table A.3 Count and variability of medium/light ratios for the proteins listed in Table A.2..... 115                   x  List of Figures   Figure 1.1 Anatomy of the vertebrate eye ...................................................................................... 2 Figure 1.2 Organization of the vertebrate retina ............................................................................. 5 Figure 1.3 Rod and cone photoreceptors ........................................................................................ 7 Figure 1.4 Structure of NCS proteins ........................................................................................... 13 Figure 1.5 Dendrogram of the visinin-like proteins (VSNLs) ...................................................... 20 Figure 2.1 Gene expression of Hpcal1 by RT-PCR ..................................................................... 33 Figure 2.2 Expression and immunoaffinity purification of HPCAL1 from transfected HEK293T cells ............................................................................................................................................... 34 Figure 2.3 Immunofluorescence localization of HPCAL1 expressed in COS-7 cells .................. 35 Figure 2.4 Localization of HPCAL1 in retina by immunofluorescence microscopy ................... 36 Figure 2.5 HPCAL1 associates with bovine retinal membranes in the presence of calcium ....... 38 Figure 2.6 HPCAL1 associates with membranes in the presence of calcium in a reversible manner........................................................................................................................................... 40 Figure 2.7 Calcium binding induces conformational changes to HPCAL1.................................. 41 Figure 2.8 Expression of myristoylated and non-myristoylated HPCAL1 in E. coli ................... 43 Figure 2.9 Calcium binding of HPCAL1-1D4 in a mobility shift assay ...................................... 44 Figure 2.10 Purification of class B NCS proteins ......................................................................... 45 Figure 2.11 Characterization of the HPCAL1 monoclonal antibodies using immunofluorescence microscopy .................................................................................................................................... 49 Figure 2.12 Sequence alignment of class B NCS proteins ........................................................... 56 Figure 3.1 Purification of GST-tagged HPCAL1 ......................................................................... 63 Figure 3.2 Representative SDS gel of elutions from the pull-down assay ................................... 65 xi  Figure 3.3 Co-immunoprecipitation of HPCAL1 and its potential interacting partners............... 72 Figure 3.4 Immunofluorescence localization of HPCAL1 and 4.1G or torsinA co-expressed in COS-7 cells ................................................................................................................................... 74                      xii  List of Abbreviations   AD  Alzheimer’s disease ANKRD33 Ankyrin repeat domain-containing protein 33  ARF1  ADP-ribosylation factor 1 ATP  Adenosine triphosphate CaBP  Calcium-binding protein CaM  Calmodulin CaMK  Calmodulin-dependent protein kinase cAMP  Cyclic adenosine monophosphate cDNA  Complementary DNA cGMP  Cyclic guanosine monophosphate CHAPS 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid CID  Collision-induced dissociation CNBr  Cyanogen bromide CNG  Cyclic-nucleotide gated COS  CV-1 in Origin with SV40 genes DAPI  4′,6-diamidino-2-phenylindole DNA  Deoxyribonucleic acid EDTA  Ethylenediaminetetraacetic acid ER  Endoplasmic reticulum ERK  Extracellular signal-regulated kinase ESI  Electrospray ionization FDR  False discovery rate   xiii  GAP  GTPase activating protein GCAP  Guanylate cyclase activating protein GC  Guanylate cyclase GCL  Ganglion cell layer GDP  Guanosine diphosphate GPCR   G-protein coupled receptor GST  Glutathione S-transferase GTP  Guanosine triphosphate HCD  Higher-energy collisional dissociation HEK  Human embryonic kidney HEPES  4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid  HPCAL1 Hippocalcin-like protein 1 HPLC  High performance liquid chromatography IF  Immunofluorescence Ig  Immunoglobulin IL1RAPL  Interleukin-1 receptor accessory protein-like INL  Inner nuclear layer IPL  Inner plexiform layer IPTG  Isopropyl β-D-1-thiogalactopyranoside IS  Inner segment KChIP  Voltage-gated potassium channel-interacting protein kb  Kilobase   kDa  KiloDalton xiv  Kv  Voltage-gated potassium channel LC/MS Liquid chromatography/mass spectrometry M  Molar MAPK  Mitogen-activated protein kinase MS  Mass spectrometry NCS  Neuronal calcium sensor NFAT   Nuclear factor of activated T cells NMR  Nuclear magnetic resonance  NVP-1  Neural visinin-like protein 1 ONL  Outer nuclear layer OPL  Outer plexiform layer OS  Outer segment PAGE  Polyacrylamide gel electrophoresis PBS  Phosphate-buffered saline PDE  Phosphodiesterase  PHOX2B Paired-like homeobox 2b PI4KIIIβ Phosphatidylinositol 4-kinase class III β PM  Plasma membrane PMRS  Plasma membrane redox system PVDF  Polyvinylidene fluoride RFU  Relative fluorescence unit Rho  Rhodopsin RNA  Ribonucleic acid xv  RPE  Retinal pigment epithelium  RT-PCR Reverse-transcription polymerase chain reaction  SDS  Sodium dodecyl sulfate STAGE Stop and go extraction Th  Thomson VILIP  Visinin-like protein  VSNL  Visinin-like protein WGA  Wheat germ agglutinin                    xvi  Acknowledgements   I would like to thank Dr. Robert Molday for the opportunity to work in his laboratory and for his advice during my studies.  Dr. Molday introduced me to the exciting field of membrane proteins and has provided valuable insight on how to be a successful scientist.    I would also like to thank the members of my supervisory committee, Dr. Leonard Foster and Dr. Filip Van Petegem, for their support and advice throughout my studies.  I also greatly appreciate the support, help, and advice from all the present and past members of the Molday laboratory.  Thank you to Ms. Laurie Molday, Ms. Theresa Hii, Ms. Karen Chang, Mr. Hidayat Djajadi, Dr. Madhavan Chalat, Dr. Martin Bush, Mr. Fabian Garces, Ms. Angela Liou; and past lab members Dr. Christiana Cheng, Dr. Jiao Wang, Dr. Jonathan Coleman, Dr. Faraz Quazi, Dr. Seifollah Azadi, Mr. Thomas Jefferies, Mr. Anthony Chan, Ms. Sue Shang, Ms. Kayla To, and Mr. Joel Samuels.  All of you made my time in the lab fun and memorable.   I would also like to thank my family for their love and support.  Thank you to my friends for not only their love and support, but also for their push. And of course, special thanks to dearest Alex, for everything.                    1  Chapter 1: Introduction   1.1 Vision  Vision is one of the most important and incredible of the five senses.  Without colour, brightness, shape, and motion, one cannot fully experience what the world has to offer.  The complex process that transforms external light signals into beautiful images perceived by our brain starts at the eye.  The first stage of visual processing, phototransduction, is the process in which photons are converted into electrical responses and occurs in the light-sensing organelles of photoreceptors. 1.1.1 The vertebrate eye  The eye consists of three main layers (Figure 1.1; McIlwain, 1996; Rodieck, 1998).  The outermost layer, the sclera, is the tough and fibrous layer that provides protection to the eye.  External light first reaches the cornea, which is continuous with the sclera, and enters the eye through the pupil. The iris controls the contraction or dilation of the pupil in order to regulate the amount of light that enters the eye.  Both the cornea and the lens help focus light onto the retina at the posterior of the eye (McIlwain, 1996; Rodieck, 1998).  The choroid, continuous with the iris, is the middle layer of the eye and has vasculature which provides oxygen and nutrients to the retina.  The vitreous humor, a clear gel found between the lens and the retina, maintains the shape of the eye.  The retina, the innermost layer of the eye, contains light-sensitive neuronal cells that are responsible for processing and transmitting visual information through signaling cascades to the optic nerve, which then relays this information to the brain (Rodieck, 1998).     2      Figure 1.1 Anatomy of the vertebrate eye    The eye has three main layers.  The sclera is a tough and fibrous layer that provides protection to the eye.  The choroid lies between the sclera and the retina, and provides nutrients and oxygen to the retina.  The retina is a neuronal tissue containing photoreceptors and other neurons involved in phototransduction.  Light travels through the cornea, aqueous humor, lens, and vitreous humor before reaching the retina.  Modified from Kolb, 2012, (http://webvision.med.utah.edu/).      3  1.1.2 The retina The retina is a ~0.2 mm central nervous tissue that lines the inner surface of the eye (Sung and Chuang, 2010).  It is composed of three main cellular layers which are responsible for sensing light and initiating a cascade of chemical and electrical events.  Impulses are sent to the brain through the optic nerve in order to obtain visual information.  Several layers of neurons are present in the retina and they are interconnected through synapses (Figure 1.2).   Five classes of neuronal cells make up three main cell layers in the retina: the photoreceptors including rod and cone cells; the intermediate neurons including bipolar, amacrine, and horizontal cells; and the ganglion cells (Hoon et al., 2014; Sung and Chuang, 2010).  In addition, the Müller glial cells provide metabolic and homeostatic support to the retina (Hoon et al., 2014).  Light enters the eye and is captured by the photoreceptors, which make up the first layer or outer part of the retina.  The nuclei of the photoreceptors make up the outer nuclear layer (ONL), while the nuclei of the intermediate neurons make up the inner nuclear layer (INL).  The synaptic junctions between the axons and dendrites of the neurons compose the inner and outer plexiform layers (IPL, OPL, respectively).  Specifically, synapses between photoreceptors and bipolar cells make up the OPL.  Moreover, horizontal cell dendrites and amacrine cell dendrites span laterally across the retina to form synapses with photoreceptors and with bipolar cells, respectively.  These synapses among amacrine, bipolar, and horizontal cells make up the IPL.  Ganglion cells make up the third layer of the retina and their dendrites form synapses with bipolar cells within the IPL.  Classically, the photoreceptors are the only neurons that are directly sensitive to light; however, a subtype of ganglion cells are also photosensitive.  Excitation of ganglion cells is modulated by amacrine cells (Hoon et al., 2014; Sung and Chuang, 2010).    4  When light is detected by photoreceptors, hyperpolarization and neurotransmitter release processes occur in order for bipolar cells to transmit the signal within the plexiform layers and through the INL to reach the ganglion cells.  The axons of the ganglion cells are myelinated and extend to form the optic nerve, and the signal is transmitted to the visual cortex of the brain.     5     Figure 1.2 Organization of the vertebrate retina  The retina consists of three layers of neuronal cells: the photoreceptor (PR) layer containing rods and cones; the intermediate layer containing bipolar, horizontal, and amacrine cells; and the ganglion cell layer.  Light travels through the ganglion cell layer and the intermediate layer before reaching the photoreceptors.  Visual information is transmitted and processed by the intermediate neurons and the ganglion cells to finally reach their axons which form the optic nerve.  Adapted with permission from Bramall et al., 2010.  6  1.1.3 The photoreceptors Photoreceptors consist of two types of cells known as cones and rods (Figure 1.3).  In most vertebrates, the rod photoreceptor is the predominant cell type in the retina, as rods outnumber cones by ~20-fold.  In humans, there are ~120 million rod cells and ~6-7 million cone cells (Osterberg, 1935).  Rods are extremely sensitive to light and are 100 times more sensitive than cones (Hoon et al., 2014).  They can even detect a single photon; therefore, they function in dim light and contain the visual pigment rhodopsin which absorbs light at 500 nm (Rieke, 2000; Sampath and Rieke, 2004).  Cones function well in different intensities of light and respond with faster kinetics than rods.  They often have conically-shaped outer segments, and photopigments sensitive to 420 nm (blue), 534 nm (green), or 564 nm (red) wavelengths of light are packed into outer segment disc membranes.   Both rod and cone photoreceptors are highly polarized cells and are made up of five different regions called the outer segment (OS), the connecting cilium, the inner segment (IS), the cell body, and the synapse.  Structurally, rods are long and thin, while cones are shorter and thicker.  The rod outer segment is the cylindrical, light-sensing portion of the cell containing 1000 to 2000 membranous discs surrounded by a separate plasma membrane (PM).  It is also the home to rhodopsin and auxiliary proteins involved in phototransduction (Polans et al., 1996).  Rhodopsin, a member of the G-protein coupled receptor (GPCR) family, is the main protein component (>90%) of the bilayered disc membranes (McBee et al., 2001).  In contrast, there are less OS discs in cones and these discs are continuous with the PM.  The OS discs undergo a continuous renewal process.  Phagocytosis of aged discs occurs daily at the onset of light in the retinal pigment epithelium, where discs are ingested, taken up as phagosomes, and finally  7  degraded by lysosomes.  New discs are added to the base of the OS, and the entire OS is renewed in a period of about ten days (Young, 1971).    For both rods and cones, the connecting cilium links the OS and the IS.  The IS contains the cellular machinery such as the endoplasmic reticulum (ER), the Golgi apparatus, and mitochondria which are necessary for biosynthesis, vesicular trafficking, and other tasks in the cell.  The cell body contains the nucleus and makes up the ONL, while the synapse makes up the OPL.      Figure 1.3 Rod and cone photoreceptors  There are two types of photoreceptors in the vertebrate retina: rods and cones.  Rods function in dim light, while cones function in all intensities of light and are responsible for colour vision.  They are highly polarized neurons and consist of five different regions: outer segment (OS), connecting cilium (CC), inner segment (IS), cell body (CB), and synapse (Syn).  The OS is the light-sensing organelle and the IS contains the cellular machinery.  RPE is the retinal pigment epithelium.  Adapted with permission from Swaroop et al., 2010.   8  1.1.4 Phototransduction Phototransduction is the key process in vision where photoreceptors convert light into electrical signals that excite the brain (Rodieck, 1998).  This process is initiated in the outer segments and is assisted by the inner segments which synthesize opsin, the seven-transmembrane apo-protein of rhodopsin (Filipek et al., 2003; McBee et al., 2001).  After its synthesis in the inner segments, opsin maturation happens in the ER and Golgi membranes before it is transported through the connecting cilium to the outer segments.  The chromophore of rhodopsin, 11-cis-retinal, is covalently attached to the polypeptide chains of each opsin within the transmembrane domain.  When a photon is absorbed by rhodopsin, the chromophore isomerizes to all-trans retinal and opsin changes from its inactive to its active form.  The photoactivated form, called Meta II, recruits and binds intracellular G proteins and peripheral membrane proteins including the heterotrimeric G protein transducin.  After the exchange of GDP for GTP, the α-subunit of transducin binds to the γ-subunit of phosphodiesterase (PDE) and activates PDE to hydrolyze cGMP to 5’-GMP.  This causes a rapid decrease in intracellular cGMP; cGMP-gated cationic channels on the plasma membrane close resulting in a reduction in the influx of Na+ and Ca2+ into the outer segments.  This results in membrane hyperpolarization (Fesenko et al., 1985).  Voltage-gated calcium channels also close, which results in decreased Ca2+ concentrations at the synapse, lowering neurotransmitter release.  The signal cascade continues and results in electrical impulses sent to the visual cortex of the brain (Arnis and Hofmann, 1993).   To recover to the dark state, the bound GTP on transducin is hydrolyzed by GTPase activating protein (GAP) when GAP interacts with the α-subunit of transducin (He et al., 1998).  At low Ca2+ concentrations, rhodopsin kinase dissociates from recoverin and is now able to  9  phosphorylate rhodopsin (Chen et al., 1995).  Phosphorylated rhodopsin has a lower affinity for transducin and binds to arrestin which deactivates it, resulting in termination of the phototransduction cascade.  Opsin recombines with the chromophore to regenerate rhodopsin.  Calcium levels decrease as the Na+/Ca2+-K+ exchanger extrudes Ca2+ from the OS; guanylate cyclase activating protein (GCAP) is activated and binds guanylate cyclase 1 (GC1) which converts GTP to cGMP (Gorczyca et al., 1995).  This increase in cGMP causes the cGMP-gated channels to open, allowing Na+ and Ca2+ to enter, and ultimately the photoreceptor returns to the dark state.  1.2 EF-hand calcium sensor protein superfamily Calcium is the trigger to many cell signaling events and calcium signaling is crucial to the control of neuronal function.  Calcium sensor proteins are sensitive to changes in calcium concentration in the cell, which then interact with their target proteins and play important roles in many physiological processes.  The best-studied Ca2+-binding protein is the ubiquitous protein calmodulin (CaM) (Faas et al., 2011), which can bind four Ca2+ ions with its four EF-hands (Chattopadhyaya et al., 1992).  It has well-conserved amino acid sequences in all eukaryotes (Ikura and Ames, 2006) and 100% identical amino acid sequences in vertebrates (McCue et al., 2010).  CaM has been known to interact with and activate many enzymes and channels upon calcium entering the cell.  For instance, one important pathway that CaM functions in is the activation of calcium/calmodulin-dependent protein kinases (CaMKs) (Burgoyne, 2007); specifically, CaMKII has a significant role in synaptic plasticity (Lisman et al., 2002).  Furthermore, CaM also activates photoreceptor cGMP-gated channels (Hsu and Molday, 1993).  Calcineurin, a protein phosphatase, is also another calmodulin target (Burgoyne, 2007).  It  10  participates in dephosphorylation that activates the transcription factor NFAT (nuclear factor of activated T cells) (Hogan et al., 2003).   Not only diverse in sequence, but also in function, are the S100 proteins (Ikura and Ames, 2006).  The S100 proteins have a diverse range of physiological functions, including roles in cell cycle control, transcription, and secretion.  They only have two EF-hands, but these proteins typically form stable homodimers or heterodimers (Ikura and Ames, 2006).  Their isoforms are coded by 24 human genes and these genes typically have 40-60% sequence identity (Marenholz et al., 2004).  The best characterized S100 protein is S100B, which is highly expressed in the brain and has been linked to neurodegenerative diseases such as Alzheimer’s disease (Ikura and Ames, 2006).   Since neuronal calcium signaling has great diversity, other EF-hand proteins with predominantly neuronal expression have been discovered.  One EF-hand family discovered in recent years is the Ca2+-binding proteins (CaBPs) (Haeseleer et al., 2000) or caldendrins (Seidenbecher et al., 1998).  Five mammalian CaBP genes exist in humans and they appeared during evolution in vertebrates (Burgoyne, 2007).  The CaBPs share structural similarities and sequence homology with calmodulin (Haynes et al., 2012).  The best characterized member of the CaBP family is CaBP4.  It localizes to synaptic terminals in the retina, and its function is modulated by protein kinase C ζ.  There is increased CaBP4 phosphorylation in light-adapted tissue and it has been suggested to assist in the regulation of presynaptic Ca2+ signals in the photoreceptors (Lee et al., 2007).  Another protein family, the subject of this thesis, is the neuronal calcium sensor (NCS) proteins.    11  1.2.1 Neuronal calcium sensor proteins  Neuronal calcium sensor (NCS) proteins are involved in a variety of calcium signaling cascades such as neurotransmitter release, ion channel modulation, and cyclic nucleotide metabolism (Braunewell and Gundelfinger, 1999; Burgoyne and Weiss, 2001).  In contrast to calmodulin, NCS proteins are primarily expressed in neurons and in retinal photoreceptors, and only possess at most 20% identity to calmodulin (Burgoyne, 2007).  They are characterized by four EF-hand motifs and an N-terminal myristoyl group (Figure 1.4; Zozulya and Stryer, 1992).  An EF-hand is a helix-loop-helix structural motif, where the interhelical loop is composed of core amino acid residues, with sequence (D-X-D/N-X-D/N-X-Y-(X)4-E), involved in coordinative Ca2+ binding (Braunewell, 2012; Ikura and Ames, 2006).   To date, there are five classes of NCS proteins (A-E), each defined based on amino acid sequences (Table 1.1).  Mammals have a set of 14 highly conserved NCS genes and these genes range from 22-55% identity (Ikura and Ames, 2006).  They encode NCS-1, five visinin-like proteins (VSNLs), recoverin, three guanylyl cyclase-activating proteins (GCAPs), and four voltage-gated potassium (Kv) channel-interacting proteins (KChIPs) (Burgoyne, 2007).  NCS-1, making up class A, is thought of as the primordial NCS protein, and is the most widely expressed of them all (McCue et al., 2010).  It was first discovered in Drosophila melanogaster as frequenin (Pongs et al., 1993) and later in Saccharomyces cerevisiae (Hendricks et al., 1999).  In contrast to other NCS proteins, NCS-1 is not specific to neurons; it is also expressed in neuroendocrine cells (McFerran et al., 1998) and in several non-neuronal cell types at low levels.  Class B contains the visinin-like proteins (VSNLs).  Recoverin and GCAPs, composing class C and D respectively, are expressed in retina of all species, whereas the other NCS proteins are expressed in neurons to various degrees (Paterlini et al., 2000).  Lastly, class E comprises the  12  KChIPs.  KChIP2 and its splice variants are expressed only in cardiac myocytes (Kuo et al., 2001), whereas KChIP3, or DREAM, is expressed in the cerebellar granular cortex (Hammond et al., 2003).      The first EF-hand of all NCS family members cannot bind Ca2+ because of inactivating substitutions in the EF-hand loop (Burgoyne, 2007).  Furthermore, this EF-hand has the greatest sequence variability in NCS proteins, making it a possible interaction site with target proteins (Braunewell and Klein-Szanto, 2009).  Exceptions are recoverin and KChIP1, which only have two functional EF-hands able to bind Ca2+ (Burgoyne, 2007; Burgoyne et al., 2004).   Upon calcium binding, all NCS proteins adopt a similar structure, one that is more compact and globular than the well-known dumb-bell shape of Ca2+-bound calmodulin (Burgoyne, 2007).  For instance, recoverin, whose structure has been studied extensively by X-ray crystallography and NMR studies (Flaherty et al., 1993), is composed of two domains connected by a bent linker and forms a compact structure in the absence of Ca2+.   Many NCS proteins possess motifs that allow them to associate to membranes.  NCS proteins in classes A-D and KChIP1 are myristoylated at the N-termini (McCue et al., 2010).  One phenomenon observed for some NCS proteins including recoverin and the visinin-like proteins is the calcium-myristoyl switch mechanism (Ames et al., 1997; O’Callaghan et al., 2003; Spilker et al., 2002a).  Upon calcium binding, a conformational shift occurs and the myristoyl group of these proteins becomes exposed and is able to reversibly associate with membranes.  At resting calcium concentrations, these proteins remain cytosolic.  First described for recoverin (Ames et al., 1997), this calcium-dependent localization to membranes may be the key for NCS proteins to selectively activate neuronal signaling pathways.  As for recoverin, not only does the conformational shift allow it to associate with membranes, a hydrophobic surface  13  is also revealed which mediates the interaction with the target protein rhodopsin kinase (Ames et al., 2006).  A different mechanism must be at work for the KChIP proteins, as they lack myristoylation and thus do not have a calcium-myristoyl switch (Ikura and Ames, 2006).  Certain isoforms of KChIP2, KChIP3, and KChIP4 have palmitoylation motifs (McCue et al., 2010).    Figure 1.4 Structure of neuronal calcium sensor (NCS) proteins  NCS proteins are characterized by four EF-hands (EF1 to 4), three of which are able to bind calcium.  An amino (N)-terminal myristoyl group is found in most family members.        14  1.2.2 Functions of NCS proteins Since NCS proteins are almost exclusively expressed in the central nervous system, they are important for regulating many cellular events in neurons and in retinal photoreceptors.  Genetic studies have shown that individual NCS proteins have essential functions that cannot be replaced by other proteins in the family (Burgoyne, 2007).  In contrast to calmodulin which has multiple diverse target proteins, NCS proteins have more specialized functions (Ikura and Ames, 2006).  This could be due to the fact that NCS proteins have an approximately 10-fold higher affinity for Ca2+ when compared to calmodulin, so NCS proteins can be activated at lower Ca2+ concentrations (McCue et al., 2010).  Even though there is high sequence homology between NCS proteins, the expression profile for each of these proteins is generally unique, suggesting that each protein has distinct functions in different cell types (Burgoyne and Weiss, 2001; Paterlini et al., 2000; Rhodes et al., 2004).   Recoverin, the best characterized NCS protein (Ikura and Ames, 2006), is found only in retinal rod photoreceptors and is involved in light adaptation by inhibiting rhodopsin kinase and reactivating rhodopsin for the next round of phototransduction (Stephen et al., 2008).  Knocking out recoverin results in decreased sensitivity to dim light and reduced signal transmission in phototransduction (Burgoyne, 2007).  It also has an additional, uncharacterized effect on visual sensitivity unrelated to rhodopsin kinase (Sampath et al., 2005).     Another class of NCS proteins with a specific role in light adaptation is the guanylyl cyclase activating proteins (GCAPs).  They regulate retinal guanylyl cyclases (GCs) 1 and 2 during phototransduction and are the only activators known for these GCs (Palczewski et al., 2004).  At low concentrations of Ca2+ in the light, the GCAPs interact with and activate the GCs, but at higher concentrations of Ca2+ in the dark, GCAPs become inhibitors of the GCs through an  15  “activator-inhibitor” transition (Dizhoor and Hurley, 1996).  One interesting fact about the GCAPs is that even though both GCAP1 and GCAP2 are expressed in rod cells and have the same function, they have different Ca2+ binding affinities for GC activation, which means that both proteins are required for GC activation over the whole physiological Ca2+ range (Koch, 2006).   NCS-1 has multiple functions (Burgoyne, 2007; Ikura and Ames, 2006).  Mammalian NCS-1 is involved in the regulation of voltage-gated Ca2+ channels (Weiss et al., 2000) and K+ channels (Nakamura et al., 2001), while both the mammalian and yeast NCS-1 are involved in vesicular trafficking in the late secretory pathway (Hama et al., 1999).  More specifically, it has been shown to interact with mammalian Golgi-associated PI4KIIIβ in the modulation of phosphatidylinositol-dependent trafficking steps (Hendricks et al., 1999; Zhao et al., 2001) and also associate with ARF1, a small GTPase regulating PI4KIIIβ (Haynes et al., 2005, 2007).  Pathologically, NCS-1 has been linked to schizophrenia and bipolar disorders, as patients have up-regulated NCS-1 (Koh et al., 2003).  It also interacts with interleukin-1 receptor accessory protein-like (IL1RAPL), a protein that is mutated in patients with X-linked mental retardation (Bahi et al., 2003).   As their name suggests, KChIPs interact with voltage-gated potassium channels of the Kv4 family (An et al., 2000).  KChIP1 has a potential role in the GABAergic inhibitory system (Xiong et al., 2009), while knocking out KChIP2, expressed in the heart, confers susceptibility to ventricular tachycardia (Kuo et al., 2001).  KChIP3 has been documented to be involved in transcriptional regulation (Carrión et al., 1999) and is also implicated in Alzheimer’s disease as it plays a role in the processing of presenilins and amyloid precursor protein (Buxbaum et al., 1998; Jo et al., 2005).   16  Table 1.1 Summary of the mammalian members of the neuronal calcium sensor protein family   The five classes of NCS proteins are summarized and some functions of each protein are listed.  Modified from Burgoyne, 2007.  Class First appearance in evolution Mammalian protein Expressed human splice variants Functions / Roles (non-inclusive) A Flies NCS-1 1 Regulation of neurotransmission, regulation Ca2+ and K+ channels, neuronal growth and survival, vesicular trafficking, phosphatidylinositol metabolism B Nematodes Hippocalcin 1 MAPK signaling, learning and memory, hippocampus long term depression Neurocalcin δ 1 Guanylyl cyclase activation VILIP-1 1 Modulation of nicotinic and guanylyl cyclase receptors, modulation of cAMP signaling VILIP-2 1 Modulation of presynaptic Cav2.1 channels VILIP-3 1 Modulation of ERK1 and ERK2 MAPK signaling C Fish Recoverin 1 Light adaptation D Fish GCAP1 1 Regulation of retinal guanylyl cyclases GCAP2 1 Regulation of retinal guanylyl cyclases GCAP3 1 Regulation of retinal guanylyl cyclases E Insects KChIP1 3 Regulation of Kv4 channels, GABAergic inhibition KChIP2 5 Regulation of Kv4 channels KChIP3 2 Regulation of Kv4 channels, regulation of transcription, processing of presenilins KChIP4 6 Regulation of Kv4 channels      17  1.2.3 Visinin-like proteins Compared to other subgroups of NCS proteins, less is known about class B or the visinin-like proteins (VSNLs); however, studies to date indicate that they appear to modulate various signal transduction pathways such as cyclic nucleotide and MAPK signaling (Braunewell and Klein-Szanto, 2009).  This class of NCS proteins first appeared in Caenorhabditis elegans and consists of visinin-like protein-1 (VILIP-1), visinin-like protein-2 (VILIP-2), visinin-like protein-3 (VILIP-3; also known as hippocalcin-like protein 1, HPCAL1), hippocalcin, and neurocalcin δ (Burgoyne, 2007).  They are 191-193 amino acid proteins displaying 67 to 92% amino acid identity (Braunewell and Gundelfinger, 1999; Burgoyne and Weiss, 2001; Spilker et al., 2002b), and can be divided into two branches (Figure 1.5).  The first branch consists of VILIP-1 and VILIP-2, which are 89% homologous, while the second branch consists of hippocalcin and HPCAL1, which are 94% identical, and neurocalcin δ, which is 90% identical to hippocalcin and HPCAL1 (Spilker et al., 2002b).  VSNLs have a consensus sequence, M-G-X3-S, for N-terminal myristoylation.   A mRNA expression study was conducted which described the expression of VILIP-1, VILIP-2, VILIP-3, and hippocalcin in the rat brain (Paterlini et al., 2000).  VILIP-1 mRNA is widely distributed in most brain areas, except in the caudate-putamen.  VILIP-2 and hippocalcin show overlapping expression patterns in the forebrain, including the neocortex, hippocampus, and caudate-putamen.  VILIP-3 is expressed at highest levels in the cerebellum, but expression seems to be limited to Purkinje and granule cells (Paterlini et al., 2000).  Hippocalcin is also detected in other brain regions including the cerebellum, specifically in Purkinje cells (Saitoh et al., 1993).  Neurocalcin δ was initially seen as a species ortholog of VILIP-3, but cDNA of both proteins was cloned from human fetal brain (Wang et al., 2001).  18  In addition to expression in the brain, VSNLs are also expressed in neurons of the retina and the olfactory pathway.  In the retina of various species, VILIP-1 and neurocalcin δ are expressed in subsets of bipolar, amacrine, and ganglion cells (Krishnan et al., 2004; Lenz et al., 1992; Nakano et al., 1992; De Raad et al., 1995).  In rat olfactory epithelium, VILIP-1, hippocalcin, and neurocalcin δ are expressed in a subset of olfactory receptor neurons.  Furthermore, VILIP-1 has also been shown to be expressed in heart, liver, lung, and testis in human and rat, and also in the stomach and skin in rat (Gierke et al., 2004).     VILIP-1, initially cloned as neural visinin-like protein 1 (NVP-1) from rat (Kuno et al., 1992) and visinin-like protein from chicken (Lenz et al., 1992), is the founding member of this subfamily.  VILIP-1 is strongly expressed in cerebellar granule cells, whereas VILIP-3 expression is strongest in Purkinje cells of the cerebellum (Hamashima et al., 2001; Spilker et al., 2000).  mRNA and protein expression have also been observed in other regions of the brain including the cortex and hippocampus (Spilker and Braunewell, 2003).  Specifically, both proteins were co-localized in hippocampal neurons, where there was strong expression for VILIP-1 in many neurons and lower expression for VILIP-3 in a subset of neurons (Spilker et al., 2000).  In terms of function, VILIP-1 has been shown to modulate the activity of the nicotinic acetylcholine receptor (Lin et al., 2002) and the guanylyl cyclase receptor (Braunewell et al., 2001).  It also has a modulatory effect on cAMP signaling (Braunewell and Gundelfinger, 1997).  Similar to KChIP3, it has been implicated in the etiology of Alzheimer’s disease, first being associated with amyloid plaques in diseased brains (Schnurra et al., 2001) and later acting as a cerebrospinal fluid biomarker for Alzheimer’s disease (Tarawneh et al., 2011).   VILIP-2, also known as hippocalcin-like protein 4 or HPCAL4, has a role in the modulation of presynaptic P/Q-type Ca2+ channels (Cav2.1),  contributing to short-term synaptic  19  plasticity (Leal et al., 2012).  Specifically, myristoylated VILIP-2 decreases the rate of inactivation and reduces the inactivation of Ca2+ currents of the Cav2.1 channel during repetitive depolarizations (Lautermilch et al., 2005), affecting the time course and amount of neurotransmitter release.  Hippocalcin has been shown to be involved in MAPK signaling, as hippocalcin-deficient knockout mice show deficits in learning behaviours (Kobayashi et al., 2000).  It also serves as a calcium-induced activator of slow afterhyperpolarizing channels in hippocampal neurons that are important for learning and memory (Tzingounis et al., 2007; Villalobos and Andrade, 2010).  Hippocalcin is also responsible for calcium extrusion from neurons in order to protect them from calcium-dependent excitotoxin damage in the hippocampus (Masuo et al., 2007).  Furthermore, it has been genetically linked to neurodegenerative diseases as it is a calcium sensor for hippocampal long term depression (Jo et al., 2010).  Hippocalcin also has a role in cyclic nucleotide signaling in the olfactory system.  It has been observed to activate olfactory adenylyl cyclase, but inhibit olfactory guanylyl cyclase, at high Ca2+ concentrations (Mamman et al., 2004).   Neurocalcin δ has been shown to bind to several proteins in neurochemical protein interaction studies; these proteins include S100L/K, myelin basic protein, glyceraldehyde-3-phosphate dehydrogenase, and tubulin L chain (Okazaki et al., 1995).  In addition, a direct interaction with actin has been demonstrated for both neurocalcin δ and VILIP-1 (Ivings et al., 2002; Lenz et al., 1996).  In the retina, neurocalcin δ localizes to the inner plexiform layer (Krishnan et al., 2004).  Further studies showed that neurocalcin δ co-express with ROS-GC1 in retinal amacrine and ganglion cells, where they might be influencing synaptic signaling processes (Krishnan et al., 2004; Kumar et al., 1999) and regulating ROS-GC activity  20  (Venkataraman et al., 2008).  In the olfactory epithelium, neurocalcin δ interacts with and activates the olfactory guanylyl cyclase (Duda et al., 2004).     Figure 1.5 Dendrogram of the visinin-like proteins (VSNLs)  The relationships between the VSNLs are shown based on amino acid similarity.  Percentage (%) amino acid identities are indicated.  The dendrogram was generated by ClustalW2, http://www.ebi.ac.uk/Tools/phylogeny/clustalw2_phylogeny/, with details from Braunewell and Klein-Szanto, 2009.      21  1.2.4 Hippocalcin-like protein 1 As mentioned above, HPCAL1 (hippocalcin-like protein 1), also known as VILIP-3 (visinin-like protein-3), is a member of class B neuronal calcium sensor (NCS) proteins.  It was first cloned as NVP-3 from rat (Kajimoto et al., 1993) , as hHLP2/BDR-1 from human (Kobayashi et al., 1994), and as REM-1 from chicken (Braunewell, 2012; Kraut et al., 1995).  In addition to its neuronal expression, HPCAL1 is also expressed on the periphery; it has been detected in cells of the hematopoietic system, in the gut, and also in the kidney, spleen, and testis.  In contrast to VILIP-1, little is known about the signaling activities of HPCAL1.  Its function is generally unclear, with previous studies mainly conducted in the brain.  It has been shown to be expressed primarily in cerebellar Purkinje cells, and that it exhibits the calcium-myristoyl switch mechanism (Spilker et al., 2000).  Specifically, Spilker et al. demonstrated the translocation of HPCAL1 from the cytosolic to the particulate fraction in a calcium-dependent manner in experiments with cerebellar homogenates (Spilker et al., 2002b).  It has been proposed that HPCAL1 modulates ERK1 and ERK2 (extracellular signal-regulated kinase 1 and 2) MAPK (mitogen-activated protein kinase) signaling, as a difference in the degree of ERK1/2-phosphorylation was detected in transfected PC12 cells as compared to non-transfected cells (Spilker et al., 2002b).  This proposed function was in agreement with a later finding that HPCAL1 associates with intracellular juxtanuclear membranes and granular structures in neurons (Spilker and Braunewell, 2003).  Another study found that HPCAL1 interacts with cytochrome b5 with a yet determined functional significance (Oikawa et al., 2004).  Cytochrome b5 interacts with cytochrome b5 reductase which is found in the ER-perinuclear region in microsomal membranes (Oikawa et al., 2004).  The possible significance of this interaction is that cytochrome b5 is in the PMRS family (Hyun et al., 2006) and that the PMRS, which serves  22  as the electron source for energy metabolism and recycling of antioxidants, is impaired in Alzheimer’s disease (AD) (Hyun et al., 2010).  This possibly implicates HPCAL1 in the etiology of AD.  More recently, it has been proposed that HPCAL1 acts as an enhancer of cAMP levels in the epithelial cell line NbE-1 (Braunewell, 2012; Tang et al., 2012).  In addition, HPCAL1 has been identified as a binding partner of PHOX2B.  Wang et al. demonstrated that this interaction is implicated in neuroblastoma, as mutational disruption of this interaction is a contributing factor to the predisposition of this disease (Wang et al., 2014).  Lastly, Chen et al. generated and characterized anti-HPCAL1 monoclonal antibodies that may be used in the early diagnosis of pancreatic cancer, as HPCAL1 is expressed in most pancreatic cancer cell lines (Chen et al., 2014).  The localization and function of HPCAL1 in the retina is unknown, with no previous studies published outside of our laboratory.   1.3 Thesis investigation HPCAL1 was identified in a proteomics study of photoreceptor outer segments (Kwok et al., 2008).  Although studies have been conducted to look at the expression profile and possible function of HPCAL1 in the brain, its role in the retina remains mysterious.  Like recoverin, HPCAL1 might be involved in calcium signaling in the retina, and alteration in its function might lead to impaired vision; therefore, studies on HPCAL1 might provide new and interesting insight on its possible role in the retina.   Chapter 2 of this thesis describes characterization studies conducted on HPCAL1.    Using monoclonal antibodies generated in our laboratory, attempts were made to investigate the localization of HPCAL1 in the mammalian retina.    Chapter 3 outlines the approach and the results from an attempt to identify potential interacting partners of HPCAL1 in bovine retina.  As mentioned above, other NCS proteins have  23  important roles in vision.  In many cases, these proteins interact with effector proteins; therefore, it would be interesting to determine if HPCAL1 might have any potential interacting partners and possibly aid in elucidating its function in the retina.  Lastly, Chapter 4 provides a summary of the studies and future directions for this research project.           24  Chapter 2: Characterization of the neuronal calcium sensor protein HPCAL1 in retina   2.1 Introduction  Neuronal calcium sensor (NCS) proteins, belonging to the superfamily of EF-hand calcium sensor proteins, have important functions in the brain and in the retina.  Like calmodulin, NCS proteins such as recoverin and guanylyl cyclase activating proteins have well-documented roles in phototransduction and are essential for vision.  Furthermore, several NCS proteins have been associated with neurodegenerative diseases, highlighting the significant roles that these proteins play in neuronal function.    Hippocalcin-like protein 1 (HPCAL1), also known as visinin-like protein-3 (VILIP-3), is a member of the visinin-like protein subclass of NCS proteins.  In contrast to some NCS proteins that have been studied extensively and are well characterized, not a lot is known about HPCAL1.  Studies on this protein had been conducted in the brain previously and had localized it mainly to the cerebellum, but its function was not fully elucidated.  Furthermore, its localization and function in the retina have not been investigated, which made HPCAL1 an interesting subject to study.   In 2008, Kwok et al. identified HPCAL1 in a proteomics study of rod photoreceptors conducted in our laboratory, and this was the first direct evidence of HPCAL1 expression in the retina (Kwok et al., 2008).  In addition, it was identified to be an interacting partner to ankyrin repeat domain-containing protein 33 (ANKRD33), further suggesting a role for HPCAL1 in the retina (Rostamirad, 2010).  Upon this finding, studies on HPCAL1 began in our laboratory and started with the generation of monoclonal antibodies against HPCAL1 (Rostamirad, 2010).   In this investigation, we have characterized the monoclonal antibodies mentioned above and investigated the localization of HPCAL1 in the retina.  We have also expressed and studied  25  HPCAL1, including its localization and calcium binding properties, in mammalian and bacterial expression systems.   2.2 Methods 2.2.1 Materials Oligonucleotides were ordered from Integrated DNA Technologies (Coralville, IA).  Agarose, SYBR® Safe DNA Gel Stain, and 1 kb Plus DNA Ladder were from Invitrogen (Carlsbad, CA).  Pfu polymerase was from Fermentas (Burlington, ON); Taq polymerase, restriction enzymes, Antarctic phosphatase, T4 DNA ligase were from New England Biolabs (Ipswich, MA). 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES), Trizma base, β-mercaptoethanol, and Triton™ X-100 were purchased from Sigma-Aldrich (St. Louis, MO).  Tetrasodium EDTA, sodium borate, sucrose, calcium chloride, and sodium chloride were obtained from Fisher Scientific (Pittsburgh, PA).  CHAPS was from Anatrace (Maumee, OH).  cOmplete™ Protease Inhibitor Cocktail Tablets were from Roche (Basel, Switzerland).  1D4 peptide (TETSQVAPA) was purchased and synthesized from Biomatik (Cambridge, ON).    Bromophenol blue, 40% acrylamide solution, and protein standards were from Bio-Rad Laboratories (Hercules, CA).  The Rho 1D4 antibody was obtained from the UBC University-Industry Liaison Office (Vancouver, BC).     2.2.2 DNA constructs  1D4-tagged HPCAL1 in pcDNA3 and in pET11d were made previously in our laboratory by Shabnam Rostamirad and Anthony Chan respectively.  HPCAL1 was cloned into pcDNA3 using KpnI and XhoI, and into pET11d using NcoI and BamHI.  The HPCAL1 cDNA clone was purchased from IMAGE Consortium (MGC: 148864 IMAGE: 8275233).  26  2.2.3 Gene Expression by RT-PCR RNA was isolated from tissues of 6-month-old C57/B6 mice using the RNeasy Mini Kit (Qiagen, Venlo, Netherlands) as per the manufacturer’s instructions.  Tissues included the heart, liver, spleen, lung, kidney, brain, testis, retina, cerebellum, hippocampus, stem cord, cerebral cortex, and olfactory bulb.  Random primed cDNA was prepared with the iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories).  Hpcal1 gene expression was measured using gene-specific primers.  Actin was used as a control for comparison.  The PCR was run for 35 cycles using Taq polymerase.  The conditions were as follows: 95°C, 2.5 min; 95°C, 0.5 min; 55°C, 0.5 min; 72°C, 1 min; 72°C, 15 min.  Three replicates were performed for both Hpcal1 and actin for each tissue.   2.2.4 Expression of HPCAL1 in HEK293T  HEK293T cells (American Type Culture Collection, Manassas, VA) in 10 cm dishes were transfected at 30% to 40% confluence with 10 µg of HPCAL1-1D4 in pcDNA3 by the calcium phosphate method (Chen and Okayama, 1987).  The growth medium was replaced 24 h later and the cells were harvested 24 h after that. 2.2.5 Isolation of HEK293T membranes  Transfected HEK293T cells were harvested with buffer (20 mM Tris, pH 7.4, 0.1 mM CaCl2).  Cells were homogenized with 22-gauge and 26-gauge needles, and the homogenate was left on ice for 30 min.  The homogenate was then layered onto 60% sucrose in buffer (20 mM Tris, pH 7.4, 150 mM NaCl, 0.1 mM CaCl2), and centrifuged in a TLS-55 rotor at 24,000 rpm at 4°C for 30 min in an Optima ultracentrifuge (Beckman Coulter, Brea, CA).  Membranes were isolated from the top of the 60% sucrose, washed in buffer (10 mM Tris, pH 7.4, 150 mM NaCl, 0.1 mM CaCl2), and subjected to centrifugation at 40,000 rpm at 4°C for 15 min with a TLA-110  27  rotor.  The resulting membrane pellet was resuspended in buffer (10 mM Tris pH 7.4, 150 mM NaCl, 0.1 mM CaCl2, 5% glycerol). 2.2.6 Purification of HPCAL1 from HEK293T  Transfected HEK293T cells were harvested and slowly added to buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 0.2 mM CaCl2) containing 20 mM CHAPS and cOmplete protease inhibitor.  Cells were solubilized with constant stirring at 4°C for 30 min and then subjected to centrifugation at 40,000 rpm at 4°C for 10 min with a TLA-110 rotor in the Optima ultracentrifuge to remove insoluble materials.  The soluble fraction was incubated with Rho 1D4-Sepharose 2B at 4°C for 1 h.  The matrix was washed with 500 µL of buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 0.2 mM CaCl2, 10 mM CHAPS) six times and the protein was eluted with 50 µL of 1D4 peptide in wash buffer at room temperature for 30 min twice.    2.2.7 Expression of HPCAL1 in COS-7 COS-7 cells (American Type Culture Collection) were transfected with HPCAL1-1D4 in pcDNA3 using the calcium phosphate method in six-well plates containing poly-L-lysine-treated coverslips with 2.5 μg of plasmid per well.  The growth medium was replaced 6 h later and the cells were harvested in 24 h. 2.2.8 Immunofluorescence microscopy of COS-7 COS-7 cells were harvested 24 h post transfection.  Cells were fixed using 4% paraformaldehyde in 100 mM phosphate buffer (PB), pH 7.4, at room temperature for 25 min, then blocked and permeabilized with 10% normal goat serum and 0.2% Triton X-100 in PB for 30 min.  Cells were labeled with Rho 1D4 hybridoma culture fluid (diluted 1:100) for 2 h.  After washing, cells were labeled with goat anti-mouse secondary antibody tagged with Alexa Fluor® 488 conjugate (Invitrogen, diluted 1:1000) and nuclei were stained with 4’,6-diamidino-2- 28  phenylindole (DAPI, diluted 1:2000) for 30 to 60 min.  Double labeling studies were performed with Rho 1D4 hybridoma fluid for HPCAL1 and with wheat germ agglutinin antibody with the Alexa Fluor® 594 conjugate (Invitrogen, diluted 1:500).  Controls were performed as above but with non-transfected cells.  Samples were visualized and images were taken using a Zeiss LSM 700 confocal microscope (Oberkochen, Germany). 2.2.9 Immunofluorescence microscopy of retina Cryosections of mouse retina fixed in 4% paraformaldehyde in 100 mM PB, pH 7.4, were blocked and permeabilized with 10% normal goat serum and 0.2% Triton X-100 in PB at room temperature for 30 min.  The primary antibodies, hybridoma culture fluids diluted in PB containing 2.5% normal goat serum and 0.1% Triton X-100, were applied to the sections and left to incubate at room temperature overnight.  Next day, sections were washed with PB and labeled with anti-mouse secondary antibody conjugated with Alexa Fluor 488 and nuclei were stained with DAPI for 1 h.  Controls were performed as above but excluded the primary antibody labeling.  Samples were visualized and images were taken using a Zeiss LSM 700 confocal microscope. 2.2.10 Isolation of retina membranes Crude bovine retina were homogenized in buffer (10 mM Tris, pH 7.4, 3 mM CaCl2, cOmplete protease inhibitor) with 22-gauge and 26-gauge needles, and the homogenate was left on ice for 30 min.  The homogenate was then layered onto 60% sucrose in buffer (20 mM Tris, pH 7.4, 150 mM NaCl, 3 mM CaCl2), and centrifuged in a TLS-55 rotor at 24,000 rpm at 4°C for 30 min in an Optima ultracentrifuge.  Membranes were isolated from the top of the 60% sucrose, washed in buffer (10 mM Tris, pH 7.4, 150 mM NaCl, 3 mM CaCl2), and subjected to centrifugation at 40,000 rpm at 4°C for 15 min with a TLA-110 rotor.  The resulting membrane  29  pellet was resuspended in buffer (10 mM Tris pH 7.4, 150 mM NaCl, 3 mM CaCl2, 5% glycerol). 2.2.11 Membrane association assays with HEK293T and bovine retina membranes  Membranes isolated from HPCAL1-transfected HEK293T cells were incubated with either 1 mM CaCl2 or 1 mM EDTA at 37°C for 2.5 h.  A half of each sample was collected for centrifugation in a TLA-110 rotor at 30,000 rpm for 10 min in an Optima ultracentrifuge to pellet membranes and obtain soluble fractions.  The other half of each sample was incubated with either 5 mM EDTA or 5 mM CaCl2 at 37°C for 2.5 h, where EDTA was added to the CaCl2-treated sample and CaCl2 was added to the EDTA-treated sample.  Similarly, samples were then centrifuged to obtain the pellet and soluble fractions.  All fractions were subjected to SDS gel electrophoresis and Western blotting analysis.  Band intensities on Western blots were determined using a LI-COR Odyssey® infrared imaging system (LI-COR, Lincoln, NE).  The sum of the densities of pellet (P) and soluble (S) fractions of each treated sample made up 100% and the relative densities for pellet fractions were calculated as percentages.  Mean values ± SD of % HPCAL1 in pellet were calculated from four independent experiments.  Statistical significance was determined using t tests (GraphPad Software Inc., http://www.graphpad.com/quickcalcs/ttest1/).  The membrane association assay with bovine retina membranes was performed similarly as above, except only one treatment was applied, either adding 3 mM CaCl2 or 15 mM EDTA to membranes. 2.2.12 Calcium binding fluorescence assay  HPCAL1, purified from transfected HEK293T in 0.2 mM CaCl2 as described above, was treated with 2 mM EDTA to extract the Ca2+.  The protein sample was excited at 295 nm before  30  and after the addition of EDTA in a fluorescence spectrophotometer (Varian Medical Systems, Palo Alto, CA).  The resulting fluorescence emission spectra were compared to determine if there were any effects on HPCAL1.  Finally, the same sample was treated with excess Ca2+ (10 mM CaCl2), excited, and read to obtain a third spectrum.  2.2.13 Expression of HPCAL1 in E. coli  To express myristoylated HPCAL1, HPCAL1-1D4 in pET11d and pBB131, which encodes for yeast N-myristoyltransferase, were co-transformed into BLR(DE3) competent cells (Novagen, Madison, WI), and cells were plated on agar plates containing ampicillin and kanamycin.  A single colony was picked to grow a 5 mL culture overnight, and this was then used to start a 500 mL culture.  When OD600 of 0.25 was reached, 12.5 mg of myristic acid (100 mg/mL in ethanol) was added to the culture, followed by IPTG induction 30 min later.  The culture was grown at 37°C for an additional 2 to 3 h or until OD600 was greater than 1.  To express non-myristoylated HPCAL1, the same procedure was performed as above except that pBB131 was not transformed into cells and myristic acid was not added. 2.2.14 Purification of HPCAL1 from E. coli  Cultures for both myristoylated and non-myristoylated HPCAL1 were centrifuged at 5,000 rpm at 4°C for 15 min to harvest the cells.  Pellets from 500 mL cultures were resuspended in 10 mL phosphate-buffered saline (PBS) with cOmplete protease inhibitor.  The resuspension was aliquoted into three tubes, put on ice, and sonicated for 30 sec three times using the Ultrasonic Sonifier 150 (Branson, Danbury, CT).  The lysed cells were centrifuged at 15,000 rpm at 4°C for 15 min, and the cleared supernatant was incubated with Rho 1D4-Sepharose 2B at 4°C for 1 h.  The matrix was washed with 50 mL of PBS and the protein was eluted with 1D4 peptide in PBS at room temperature for 30 min twice.     31  2.2.15 Mobility shift assay  Two µg of HPCAL1 from E. coli was incubated with either 5 mM CaCl2 or 5 mM EDTA for 45 min, and then subsequently subjected to gel electrophoresis on a 15% acrylamide gel. 2.2.16 Cloning, expression, and purification of class B NCS proteins Class B NCS genes, including hippocalcin, neurocalcin δ, visinin-like 1, and visinin-like 2, were amplified with gene-specific primers using mouse retina cDNA.  Primer sequences were as follows: hippocalcin – forward: 5’- GCGGGATCCATGGGCAAGCAGAACAGCAAGC -3’, reverse: 5’- GCGCGGCCGTCAGAACTGGGAGGCGCTGCT -3’; neurocalcin δ – forward: 5’-GCGGGATCCATGGGAAAACAGAACAGCA -3’, reverse: 5’- GCGCGGCCGTCAGAACTGGCCGGCGCTG -3’; visinin-like 1 – forward: 5’-GCGGGATCCATGGGGAAACAGAATAGCAAAC -3’, reverse: 5’- GCGCGGCCGTCATTTCTGAATGTCACACTGCAG -3’; visinin-like 2 – forward: 5’- GCGGAATTCATGGGGAAAAACAACAGCAAGCT -3’, reverse: 5’- GCGCTCGAGCTACTTCTGCATGTCACACTGCA -3’.  The amplicons were cloned in frame with glutathione S-transferase (GST) in the pGEX-4T-1 vector (GE Healthcare, Wauwatosa, WI) using BamHI and EagI for hippocalcin, neurocalcin δ, visinin-like 1, and EcoRI and XhoI for visinin-like 2.  The clones were sequenced and transformed into BL21 competent cells (Novagen) for E. coli expression.  GST fusion proteins were purified from bacterial cultures on S-hexylglutathione-agarose (Sigma-Aldrich). 2.2.17 Characterization of HPCAL1 monoclonal antibodies  GST fusion proteins (HPCAL1, hippocalcin, neurocalcin δ, VILIP-1, and VILIP-2) were subjected to gel electrophoresis using acrylamide gels with large wells and transferred onto PVDF membranes.  Membranes were cut into vertical strips 2-3 mm wide and subjected to  32  Western blotting analysis.  Strips were incubated with hybridoma culture fluids of the antibodies for 1 h, incubated with Luminata™ Classico Western HRP substrate for 2 min for detection (Millipore, Billerica, MA), and exposed to X-ray film for chemiluminescent signal (Kodak, Rochester, NY). 2.2.18 SDS-PAGE and Western blots Proteins were separated by SDS gel electrophoresis typically on 10% polyacrylamide gels and were either stained with Coomassie Blue or transferred to Immobilon™-FL membranes (Millipore) in buffer containing 25 mM Tris, pH 8.3, 192 mM glycine, 15-20% methanol. Membranes were blocked in 1% milk in PBS for 30 min and incubated with primary antibodies diluted in PBS for 1 h.  Membranes were then washed with PBST (PBS containing 0.05% Tween 20), incubated for 40 min with goat anti-mouse conjugated with IR dye 680 (LI-COR) in PBST containing 0.5% milk (diluted 1:20,000), and washed with PBST prior to data collection on a LI-COR Odyssey infrared imaging system.  2.3 Results 2.3.1 Hpcal1 mRNA expression was examined by RT-PCR  The expression of Hpcal1 mRNA in various tissues of 6-month-old C57/B6 mice was examined by RT-PCR.  Gene-specific primers were used to amplify Hpcal1, while actin was used as a positive control.  A 500-bp Hpcal1 fragment was detected in almost all tissues examined (Figure 2.1).  Relative Hpcal1 expression was high in retina, cerebellum, stem cord, and lung.  There was moderate expression in hippocampus, cerebral cortex, and heart; while low levels of expression were observed for liver, spleen, kidney, spinal cord, and olfactory bulb.  The testis did not show any Hpcal1 expression.   33     Figure 2.1 Gene expression of Hpcal1 by RT-PCR  The relative gene expression of Hpcal1 was measured using gene-specific primers on cDNA prepared from RNA isolated from different mouse tissues. The relative gene expression of the housekeeping gene actin was used as a loading control.  Expression was observed in all tissues examined except in testis.      34  2.3.2 Expression and purification in HEK293T cells  Expression of HPCAL1 in HEK293T cells was investigated by transfection using the calcium phosphate method.  After a 48 h transfection, HPCAL1 showed a good level of expression.  Since the HPCAL1 construct used has a 1D4 tag, cells were solubilized with CHAPS and HPCAL1 was purified using Rho 1D4-Sepharose 2B and eluted with 1D4 peptide.  As shown in Figure 2.2, the elution containing HPCAL1 had a high degree of purity, with no additional bands observed on the Coomassie blue-stained gel.    Figure 2.2 Expression and immunoaffinity purification of HPCAL1 from transfected HEK293T cells  HEK293T cells were transfected with the 1D4-tagged HPCAL1 plasmid.  HEK293T cell extracts (Input) were incubated with the Rho 1D4 immunoaffinity matrix.  The input fraction, the unbound fraction (Unbound) and the 1D4 peptide-eluted fraction (Elution) were analyzed on a SDS gel stained with Coomassie blue, and the Western blot was labeled with Rho 1D4 antibody.        35  2.3.3 Localization of HPCAL1 in transfected COS-7 cells The subcellular distribution of the HPCAL1 was investigated using a mammalian expression system.  COS-7 cells were transfected with 1D4-tagged HPCAL1 in pcDNA3 using the calcium phosphate method.  As shown in Figure 2.3, HPCAL1 localized to the plasma membrane (left panel).  To verify whether HPCAL1 labeling was on the plasma membrane, double labeling studies were performed with the plasma membrane marker wheat germ agglutinin (WGA, middle panel).  Co-localization was indeed observed, as indicated by the white arrows on Figure 2.3 (right panel).     Figure 2.3 Immunofluorescence localization of HPCAL1 expressed in COS-7 cells   COS-7 cells were transfected with the 1D4-tagged HPCAL1 plasmid.  The cells were double-labeled with the Rho 1D4 antibody for HPCAL1 (green) and the wheat germ agglutinin (WGA) antibody (red) as a plasma membrane marker.  Co-localization was observed with WGA as indicated by the arrows.  Nuclei were stained with DAPI (blue).       36  2.3.4 Localization of HPCAL1 in the retina by immunofluorescence microscopy Cryosections of mouse retina were labeled with HPCAL1 monoclonal antibody 9G3 to determine the cellular and subcellular distribution of HPCAL1 within the retina (Figure 2.4).  Immunolabeling was observed on some cells in the inner nuclear layer, at synapses in the inner plexiform layer, and in the ganglion cell layer of the retina.  The apparent labeling in the outer plexiform layer was of retinal blood vessels and not of HPCAL1.  The control was labeled with secondary antibody only and some retinal blood vessels were labeled.     Figure 2.4 Localization of HPCAL1 in retina by immunofluorescence microscopy  Cryosections of mouse retina were labeled with HPCAL1-9G3 antibody (green) and nuclei were stained with DAPI (blue).  The control sample was labeled with secondary antibody only.  Labeling was observed in the inner nuclear layer, the inner plexiform layer, and the ganglion cell layer as indicated by the white arrows.  OS, outer segments; IS, inner segments; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer.      37  2.3.5 HPCAL1 displays the calcium-myristoyl switch in retina  After examining the retinal localization of HPCAL1 by immunofluorescence microscopy, we wanted to see if HPCAL1 displays the calcium-myristoyl switch mechanism in retina.  Membranes isolated from bovine retinas were treated with either CaCl2 or EDTA.  After an incubation period, the samples was centrifuged to collect membrane and soluble fractions, and all fractions were subjected to SDS gel electrophoresis.  As shown in Figure 2.5, in the presence of Ca2+, almost all HPCAL1 was in the membrane fraction; whereas when Ca2+ was chelated with EDTA, a portion of the HPCAL1 originally associated to membranes was now found in the soluble fraction.  This is consistent with the calcium-myristoyl switch mechanism observed for some NCS proteins, where in the presence of Ca2+, the myristoyl tail of the protein becomes extruded from the hydrophobic pocket and is available to associate with membranes.  In the absence of Ca2+, the myristoyl group remains sequestered in the hydrophobic pocket.    38     Figure 2.5 HPCAL1 associates with bovine retinal membranes in the presence of calcium  Membranes were isolated from bovine retinas, treated with CaCl2 or EDTA, and centrifuged to collect the membrane and soluble fractions.  In the presence of calcium, the majority of HPCAL1 was found in the membrane fraction; whereas when EDTA was added, HPCAL1 dissociated from membranes and was found in the soluble fraction.  This Western blot was labeled with HPCAL1-3G6 antibody.    39  2.3.6 HPCAL1 reversibly associates with HEK293T membranes  This experiment was conducted to determine whether HPCAL1 associates with membranes in a reversible manner.  Membranes, prepared from HPCAL1-transfected HEK293T cells, were first treated with CaCl2 or EDTA, and then with EDTA or CaCl2, respectively.  After the first set of conditions, there was significantly more HPCAL1 associating with membranes in the presence of Ca2+ than in the EDTA-treated sample.  In the CaCl2-treated sample, ~75% HPCAL1 was in the pellet or membrane fraction, as shown in Figure 2.6B, and about ~56% HPCAL was in the EDTA-treated sample.  This difference is statistically significant after four independent experiments.  Upon the reverse treatments, opposite trends were observed.  Specifically, the addition of EDTA caused a ~13% decrease in HPCAL1 in the pellet as compared to after the initial Ca2+ addition.  In addition, there was a statistically significant ~15% increase of HPCAL in the pellet following the addition of Ca2+ to the initially EDTA-treated sample.  Therefore, membrane association of HPCAL1 seemed to be reversible upon the addition or removal of calcium.                    40  A   B      Figure 2.6 HPCAL1 associates with membranes in the presence of calcium in a reversible manner    (A) Representative Rho 1D4 antibody-labeled Western blot.  Membranes were prepared from HPCAL1-transfected HEK293T cells. Membranes were first treated with CaCl2 or EDTA, and then with EDTA or CaCl2, respectively. HPCAL1 association with membranes was dependent on the presence of calcium, and this translocation seemed to be reversible upon the removal of calcium.  The same phenomenon was also observed vice versa.   (B) Quantification of Western blots as shown in (A) by measuring the densities of HPCAL1 immunoreactivities.  The sum of the densities of pellet (P) and soluble (S) fractions of each treated sample made up 100% and the relative densities for pellet fractions were calculated as percentages.  Mean values ± SD of % HPCAL1 in pellet were calculated from four independent experiments.  Statistically significant differences (p < 0.05) are denoted with ‘*’.  41  2.3.7 Calcium binding fluorescence assay HPCAL1-1D4 was purified from transfected HEK293T cells in the presence of 0.2 mM CaCl2.  The protein was excited at 295 nm and emitted maximum fluorescence of ~440 relative fluorescence units (RFU) at 340 nm (blue spectrum on Figure 2.7).  When ~2 mM EDTA was added to the protein, the emission maximum decreased to ~375 RFU (orange spectrum).  Subsequently, when excess calcium was added, the emission maximum returned to ~440 RFU (yellow spectrum).  These observed changes in fluorescence indicate that the protein underwent conformational changes upon calcium binding or extraction.  Since the fluorescence emission maximum returned to the original state following the re-addition of calcium to the EDTA-treated sample, this indicates that the changes in conformation are reversible.    Figure 2.7 Calcium binding induces conformational changes to HPCAL1    HPCAL1-1D4 was purified from transfected HEK293T cells in the presence of 0.2 mM CaCl2.  The protein was excited at 295 nm and emitted maximum fluorescence of ~440 RFU at 340 nm (blue curve).  When 2 mM EDTA was added to the sample, the emission maximum decreased to ~375 RFU (orange curve).  Subsequently, when excess calcium was added back, the emission maximum returned to ~440 RFU (yellow curve).      42  2.3.8 Expression and purification of HPCAL1 from E. coli HPCAL1 was expressed in E. coli in an attempt to look at the N-terminal myristoylation of the protein.  Myristoylated HPCAL1 was expressed in BLR(DE3) cells by co-transforming 1D4-tagged HPCAL1 in pET11d along with pBB131 encoding yeast N-myristoyltransferase and adding myristic acid to the bacterial culture 30 min prior to IPTG induction.  Cultures were pelleted, pellets were resuspended and lysed, and cleared supernatant was incubated with Rho 1D4-Sepharose for elution with 1D4 peptide.  The same procedure was conducted for the expression and purification of non-myristoylated HPCAL1 except that BLR(DE3) cells were transformed with only pET11d-HPCAL1-1D4 and no myristic acid was added.   For both the myristoylated and non-myristoylated forms, the yield from the Rho 1D4 purification was consistently low, while the purity was not great either, as evident on the elution lanes on the Coomassie-Blue stained gels in Figure 2.8.          43    Figure 2.8 Expression of myristoylated and non-myristoylated HPCAL1 in E. coli  Myristoylated HPCAL1 was expressed and purified from E. coli.  BLR(DE3) cells were co-transformed with pBB131 and pET11d-HPCAL1-1D4.  Myristic acid was added to the culture 30 min prior to IPTG induction.  Cultures were collected when OD600 was greater than 1 and pelleted.  Pellets were subsequently solubilized and cleared supernatant was incubated with 1D4 beads and elutions were performed with 1D4 peptide.  Non-myristoylated HPCAL1 was expressed and purified similar as above, except that BLR(DE3) cells were transformed with only pET11d-HPCAL1-1D4 and no myristic acid was added.  Shown at the top are the Coomassie Blue-stained gels, and at the bottom are the Rho 1D4 antibody-labeled Western blots.      44  2.3.9 HPCAL1 mobility shift assay HPCAL1 obtained from the bacterial expression described above was used for this experiment.  The protein was incubated with either CaCl2 or EDTA.  When these samples were subjected to SDS gel electrophoresis, HPCAL1 displayed a difference in its electrophoretic mobility between the two conditions, indicating that calcium binding induced changes to its shape.  This shift was comparable to that displayed by some other NCS proteins.    Figure 2.9 Calcium binding of HPCAL1-1D4 in a mobility shift assay    Two µg of HPCAL1-1D4, in the presence or absence of calcium (5 mM CaCl2 or 5 mM EDTA), were applied to SDS–PAGE (12% gels) and stained with Coomassie blue.  The Western blot was labeled with Rho 1D4 antibody.      45  2.3.10 Expression of class B NCS proteins  Class B NCS proteins, also known as visinin-like proteins (VSNLs) and including hippocalcin, neurocalcin δ, visinin-like protein-1 (VILIP-1), and visinin-like protein-2 (VILIP-2), were cloned, expressed, and purified from E. coli for use in antibody characterization studies.  They were expressed as GST fusion proteins for easier purification, showed good expression levels, and were pure upon purification with S-hexylglutathione-agarose.  They ran at ~45 kDa on the 10% acrylamide gel (Figure 2.10), consistent with their theoretical molecular weights of ~22 kDa plus the 26 kDa GST tag.    Figure 2.10 Purification of class B NCS proteins  GST fusion proteins, including hippocalcin, neurocalcin δ, VILIP-1, and VILIP-2, were expressed in E. coli and purified for use in antibody characterization studies.  Proteins were subjected to SDS gel electrophoresis and the gel was stained with Coomassie blue.  The Western blot was labeled with α-GST antibody.      46  2.3.11 Characterization of HPCAL1 monoclonal antibodies using Western blots The monoclonal antibodies against HPCAL1 made in our laboratory previously were subjected to cross-reactivity tests.  Purified GST-tagged hippocalcin, neurocalcin δ, VILIP-1, and VILIP-2 were subjected to SDS-PAGE and transferred to PVDF membranes.  Membranes were cut into strips and used for Western blotting analysis using the monoclonal antibodies.  After testing all 33 antibodies, none were specific to HPCAL1.  As illustrated in Table 2.1, these antibodies reacted with either one, two, three, or four of the NCS proteins listed above in addition to HPCAL1.  Nine antibodies labeled HPCAL1 and all four other proteins; 8 antibodies labeled HPCAL1 and three others; 14 antibodies labeled HPCAL1 and two others, and 2 antibodies labeled HPCAL1 and one other protein.      47  Table 2.1 Summary of the HPCAL1 monoclonal antibody characterization studies  Purified HPCAL1 from E. coli was injected into mice to generate monoclonal antibodies.  The specificity of these monoclonal antibodies was examined.  None of the laboratory-generated monoclonal antibodies against HPCAL1 was specific only to HPCAL1.  Using Western blotting analysis, all 33 antibodies were tested against the other class B NCS proteins.  This table illustrates the proteins that each antibody labels (Y = labeled, N/green = did not label; IF, immunofluorescence microscopy).  In summary, 9 antibodies labeled HPCAL1 and all four other proteins, 8 antibodies labeled HPCAL1 and three others, 14 antibodies labeled HPCAL1 and two others, and 2 antibodies labeled HPCAL1 and one other protein.         HPCAL1 Hippocalcin Neurocalcin δ VILIP-1 VILIP-2 Number of other Worked on IF?Antibody proteins labeled 1B3 Y Y Y Y N 3 Y2G6 Y Y Y N N 22G7 Y Y Y N N 23G6 Y Y Y N N 2 Y4G8 Y Y Y N N 2 Y4B1 Y Y Y N N 26B11 Y Y Y Y N 36C1 Minimal N N N Y 1 Y6C11 Y Y Y Minimal Minimal 46E9 Y Y Y Y Minimal 46F2 Y Y Y Y Y 47A4 Y Y Y Y Y 47A6 Y N N Y N 17E1 Y Y Y Y Y 47F6 Y Y Y Y N 3 Y8A10 Y Y Y N N 28A12 Y Y Y Y Y 48D1 Y Y Y N N 28D9 Y Y Y Y N 38D11 Y Y Y N N 29A9 Y Y Y N N 29G3 Y Y Y N N 211D8 Y Y Minimal N N 211F7 Y Y Y Y N 3 Y11G5 Y Y Y N N 2 Y12A4 Y Y Y N Y 3 Y12B9 Y Y N N Minimal 212B 1 Y Y Y Y Y 412D1 Y Y Y N N 212E5 Y Y Y Minimal Minimal 412E7 Y Y Y Y N 312G2 Y Y Y Minimal N 3 Y12G10 Y Y Y Y Y 4 48  2.3.12 Characterization of HPCAL1 monoclonal antibodies using immunofluorescence  microscopy Even though all of the HPCAL1 monoclonal antibodies were cross-reactive, those that immunolabeled less than four of hippocalcin, neurocalcin δ, VILIP-1, and VILIP-2 were applied to cryosections of mouse retina to see if any immunolabeling patterns could be observed using immunofluorescence microscopy.  No correlation has been made so far; however, a few of the antibodies produced interesting labeling, and these were 1B3, 6C1, and 12G2.  For instance, 1B3 clearly labeled the cone photoreceptors, and 6C1 labeled the outer plexiform layer, the Müller cells, and may be the outer segments.  12G2 labeled nuclei in the inner nuclear layer and the ganglion cell layer.  The control was labeled with secondary antibody only.  There were other antibodies that showed labeling, but in those cases the labeling was too weak to confidently describe their locations.        49     Figure 2.11 Characterization of the HPCAL1 monoclonal antibodies using immunofluorescence microscopy  The HPCAL1 monoclonal antibodies were used in immunofluorescence microscopy to examine their reactivity to mouse retina sections.  1B3, 6C1, and 12G2 showed distinct immunolabeling, as indicated by the white arrows.  The control sample was stained with secondary antibody only.  OS, outer segments; IS, inner segments; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer.        50  2.4 Discussion Neuronal calcium sensor (NCS) proteins have important functions in the brain and in the retina.  A few of these, such as recoverin and guanylyl cyclase activating proteins 1 and 2, have well-documented roles in photostransduction.  Hippocalcin-like protein 1 (HPCAL1), in contrast, has not been extensively characterized and has never been studied in the retina.  When HPCAL1 was identified in a proteomics study of photoreceptors (Kwok, 2008) and later identified as an interacting partner to ANKRD33 (Rostamirad, 2010), it was evident that this protein is expressed in the retina and could be playing a significant role.  In this study, characterization of HPCAL1 was carried out and attempts were made to investigate its localization and properties in the retina.     In addition to its neuronal expression, HPCAL1 is also expressed on the periphery; it has been detected in cells of the hematopoietic system and in the gut, and also in the kidney, spleen, and testis.  To start, the relative gene expression of Hpcal1 in various mouse tissues was examined by RT-PCR.  As expected for a NCS protein, expression was observed for retina, cerebellum, hippocampus, cerebral cortex, stem cord, spinal cord, and olfactory bulb; with retina and cerebellum having some of the highest levels.  On the periphery, Hpcal1 was found to be expressed in heart and liver.  Interestingly, the lung had one of the highest relative expression levels, indicating a possible role for HPCAL1 in lung.  Moreover, a low level of expression was observed for spleen and kidney, and this is consistent with a previous study that showed expression in spleen, kidney, and testis (Gierke et al., 2004); however, no expression was detected in testis here.        The expression of HPCAL1 in mammalian cells transfected with the 1D4-tagged plasmid was examined by immunocytochemistry.  HPCAL1 was predominantly localized to the plasma membrane of COS-7 cells, and co-localization was observed with the plasma membrane marker  51  wheat germ agglutinin.  When expressed in HEK293T cells, HPCAL1 can be efficiently purified with Rho 1D4-Sepharose.  This is the first reported HPCAL1 expression in HEK293T cells.  Membranes made from transfected HEK293T cells were used in membrane association experiments.  In the presence of calcium, HPCAL1 preferentially associated with membranes of cell extracts and significantly more HPCAL1 was found in the membrane fractions; whereas when calcium was extracted with EDTA, HPCAL1 dissociated from the membranes and more was then found in the soluble fraction.  Moreover, we showed that this phenomenon is reversible upon calcium extraction. These observations are in agreement with a previous study where NG108-15 cells were stably transfected with HPCAL1 (Spilker and Braunewell, 2003).  This is also consistent with the calcium-myristoyl switch mechanism that is at work for some NCS proteins.  However, in hippocampal primary cultures, HPCAL1 appeared in the whole cell, with high expression in the cytosol and weaker expression in juxtanuclear structures and with a dot-like structure appearance (Spilker and Braunewell, 2003). To examine the calcium binding properties of HPCAL1, a fluorescence assay was conducted to determine the effects of calcium binding.  It was observed that upon the addition or removal of calcium, there was a change in fluorescence emission by HPCAL1 following excitation at 295 nm.  This indicates a conformational shift has occurred in HPCAL1.  Furthermore, these conformational changes seemed to be reversible, as the addition of calcium following chelation with EDTA gave the emission spectrum its original shape with the same emission maximum.  This effect of calcium was further examined with the mobility shift assay.  In the presence of calcium, HPCAL1 displayed an electrophoretic shift on SDS gels, indicating that calcium has an effect on its shape and therefore affects its movement on gels.    52  Monoclonal antibodies against HPCAL1 made previously in our laboratory (Rostamirad, 2010) were employed to study the localization of HPCAL1 in retina using immunofluorescence microscopy.  Previously, HPCAL1 was localized to the cone photoreceptors and the inner and outer plexiform layers (Rostamirad, 2010).  However, a different localization was observed when another monoclonal antibody was used, with HPCAL1 localizing to the synapses in the outer plexiform layer.  Because of this difference, we questioned if the antibodies may be cross-reacting with other proteins.  If the sequence alignment of this subclass of NCS proteins (Figure 2.12) is examined, it would not be surprising if the antibodies are cross-reactive and that it could be difficult to produce a HPCAL1-specific antibody.  As a result, all of the monoclonal antibodies were tested with Western blots to determine if they show cross-reactivity against other class B NCS proteins, including hippocalcin, neurocalcin δ, visinin-like protein-1, and visinin-like protein-2.  Of the 33 antibodies that were available, none of them showed specific reactivity to HPCAL1.   Even though we did not identify a HPCAL1-specific antibody, attempts were made to use some of the monoclonal antibodies to label retina and see if any localization patterns could be deduced from the immunolabeling.  Out of the 24 antibodies tested, 9 of them labeled mouse retina sections; however, some labeled weakly such that it was difficult to conclude where the labeling was.  Only a few antibodies produced localization details that could be interpreted.  Actually, the retinal localization of a few subfamily members have been reported previously and this information could aid in the interpretation of our results.  For instance, neurocalcin δ has been localized to amacrine cells in the inner plexiform layer and in the ganglion cell layer (Krishnan et al., 2004; Kumar et al., 1999; Nakano et al., 1992), while VILIP-1 has been localized to bipolar, amacrine, and ganglion cells (Lenz et al., 1992; De Raad et al., 1995).    53  Three out of the 24 antibodies tested had distinct labeling on mouse retina.  12G2 labeled nuclei in the inner nuclear layer and in the ganglion cell layer.  On Western blots, 12G2 labeled hippocalcin, neurocalcin δ, and minimally VILIP-1 in addition to HPCAL1.  Taken together, the labeling by 12G2 could be of VILIP-1.  Before the antibody characterization was carried out, 9G3 was used to localize HPCAL1 in retina, and labeling was observed on some cells in the inner nuclear layer, on synapses in the inner plexiform layer, and on the ganglion cells (Figure 2.4).  On Western blots, 9G3 labeled hippocalcin and neurocalcin δ in addition to HPCAL1; therefore, 9G3 could be labeling neurocalcin δ.  Next, 1B3 clearly labeled the cone photoreceptors, and this was similar to what was found previously using 3G6 (Rostamirad, 2010).  1B3 and 3G6 both labeled HPCAL1, hippocalcin, and neurocalcin δ on Western blots; perhaps HPCAL1 or hippocalcin is localized to cone photoreceptors.  Lastly, 6C1 labeled the outer plexiform layer and the Müller cells of the retina.  On Western blots, 6C1 only labeled VILIP-2 and minimally HPCAL1; therefore, 6C1 could be specific to and labeling VILIP-2.  If it is, this would be the first report of VILIP-2 localization in retina, as no previous studies have been conducted on VILIP-2 in retina.  These deductions are attempts to explain the observed immunolabeling; however, these antibodies could be labeling more than one protein on retina or these proteins could be localized to the same place, and in these cases, any interpretation would become almost impossible without further studies using more specific antibodies. The exact retinal localization of HPCAL1 remains unclear, but we have enough evidence from previous studies in our laboratory that HPCAL1 does express in retina.  As a result, we examined whether the calcium-myristoyl switch mechanism exists for HPCAL1 in retina.  Membranes isolated from bovine retina were incubated with either calcium or EDTA and then centrifuged to separate and collect the pellet and soluble fractions.  We found that in the presence  54  of calcium, almost all HPCAL1 was found in the pellet or membrane fraction; when EDTA was added, some portion of HPCAL1 dissociated from the membrane and was found in the soluble fraction.  One problem with this experiment was that because we do not have a HPCAL1-specific antibody, the bands we see on Western blots could be of the other class B proteins in addition to HPCAL1.  Nonetheless, this result confirms the observations for the membrane association assays using HEK293T membranes. Next, we attempted to confirm the existence of a myristoyl group at the N-terminus of HPCAL1.  HPCAL1 was expressed in E. coli transformed with or without yeast N-myristoyltransferase and purified on a Rho 1D4 matrix.  An attempt at HPLC was used to investigate if HPCAL1 was myristoylated and the degree of myristoylation for HPCAL1 expressed in E. coli in the presence of myristic acid.  HPLC analysis was not successful as the protein was aggregated and eluted in the void volume as indicated by the observed spectra (data not shown).  However, small amounts of myristoylated and non-myristoylated HPCAL1 that were not aggregated did show different retention times, indicating there is a molecular weight difference or possibly a change in the shape of the protein.  As a result, mass spectrometry (MS) analysis was attempted instead.  Purified proteins were subjected to MS analysis to see if a mass difference could be detected for the N-terminal peptide since the myristoyl group is attached to the N-terminus.  However, for both the myristoylated and non-myristoylated samples, the N-terminal peptides were not detected, possibly due to a low protein concentration.  The inability to purify these proteins at high concentrations has been a recurring problem.  One possible reason is because of aggregation in inclusion bodies, but when an attempt was made to purify the protein from the insoluble pellets by urea denaturation and subsequent renaturation, similar concentrations were obtained.  Other possibilities are that the Rho 1D4 matrix is not efficient in  55  purifying these proteins or more beads need to be used.  Since we were unable to obtain high protein yields, either because of the nature of HPCAL1 or experimental methods, it has been difficult to perform other experiments requiring a set of pure myristoylated and non-myristoylated HPCAL1.  In summary, our studies show that HPCAL1 is present in the retina and we attempted to identify its localization.  We showed that the calcium-myristoyl switch exists in retina and confirmed this using HEK293T cells.  In addition, we showed that calcium binding has significant effects on HPCAL1 conformation.  Even though our monoclonal antibodies are not specific, they could still be a useful tool in other studies.  A HPCAL1-specific antibody will need to be generated to confirm our speculations on the retinal localization of HPCAL1.  To better understand the role of HPCAL1 in the retina, it would be desirable to determine if HPCAL1 has any potential interacting partners, because many NCS proteins function as effectors to their interacting partners.  This will be the subject of the next chapter of this thesis.      56    Figure 2.12 Sequence alignment of class B NCS proteins  Protein sequences of mouse class B NCS proteins were obtained from the NCBI Protein database, http://www.ncbi.nlm.nih.gov/, and aligned using Clustal Omega, www.ebi.ac.uk/Tools/msa/clustalo/.  Neurocalcin, neurocalcin δ; HPCAL1, hippocalcin-like protein 1; VILIP-1, visinin-like protein 1; VILIP-2, visinin-like protein 2.      57  Chapter 3: Attempts to identify potential interacting partners of HPCAL1   3.1 Introduction Calcium sensor proteins have essential roles in vision, and in some cases, they interact with and act on effector proteins.  Calmodulin (CaM) has been known to interact with and activate many enzymes and channels upon calcium entry into the cell.  For example, one important pathway that CaM functions in is the activation of calcium/calmodulin-dependent protein kinases (CaMKs) (Burgoyne, 2007).  Furthermore, CaM also activates photoreceptor cGMP-gated channels (Hsu and Molday, 1993).  In the neuronal calcium sensor (NCS) protein family, recoverin is involved in light adaptation by inhibiting rhodopsin kinase and reactivating rhodopsin for the next round of phototransduction (Stephen et al., 2008).  Moreover, guanylyl cyclase activating proteins (GCAPs) regulate retinal guanylyl cyclases (GCs) 1 and 2 during phototransduction and are the only known activators of these GCs (Palczewski et al., 2004).  At low concentrations of Ca2+ in the light, GCAPs interact with and activate GCs, but at higher concentrations of Ca2+ in the dark, GCAPs become inhibitors of GCs through an “activator-inhibitor” transition (Dizhoor and Hurley, 1996).  Calmodulin and GCAPs are classic examples of proteins acting on effector proteins under calcium regulation. The function of hippocalcin-like protein 1 (HPCAL1) in the retina remains mysterious, but if HPCAL1 acts on an effector channel or enzyme like other calcium sensor proteins, it would be very interesting to determine if HPCAL1 has any potential interacting partners and could aid in elucidating its function in the retina.  In this study, we use peptide dimethylation in a quantitative proteomics approach in an attempt to identify potential interacting partners of HPCAL1.  Using HPCAL1 as bait, a pull-down assay was performed to identify proteins that might be interacting with HPCAL1 in a calcium-dependent manner in bovine retina.  58  3.2 Methods 3.2.1 Materials Q5 Hot Start High-Fidelity DNA Polymerase was purchased from New England Biolabs (Ipswich, MA).  Cyanogen bromide was purchased from Sigma-Aldrich (St. Louis, MO). Additional materials are described in Chapter 2.2.1. 3.2.2 DNA constructs  Bovine HPCAL1 containing a 1D4 tag in pcDNA3 was described in Chapter 2.2.2.  1D4-tagged bovine 4.1G in pcDNA3 was made previously in our laboratory (Cheng and Molday, 2013). 3.2.3 Cloning and expression of GST-tagged HPCAL1 and GST HPCAL1 was amplified with gene-specific primers using the bovine cDNA clone.  Primer sequences were as follows: Forward: 5’- CTTGAATTCATGGGCAAGCAAAACAGC -3’, reverse: 5’- GCGCTCGAGTCAGAACTGACTCGCACT -3’.  The amplicon was cloned in frame with glutathione S-transferase (GST) in the pGEX-4T-1 vector (GE Healthcare, Wauwatosa, WI) using EcoRI and XhoI.  The clones were sequenced and transformed into BL21 competent cells (Novagen, Madison, WI) for E. coli expression.  GST fusion proteins were purified from bacterial cultures on S-hexylglutathione-agarose (Sigma-Aldrich).  Empty pGEX-4T-1 was used to express GST, and GST was purified similarly as above. 3.2.4 Generation of CNBr-coupled GST-HPCAL1 Sepharose and GST Sepharose Purified GST-tagged HPCAL1 and GST were each coupled to CNBr-activated Sepharose 2B in 0.01 M sodium borate, pH 8.4, 0.15 M NaCl at a concentration of 2 mg of protein/mL of packed beads as described by Cuatrecacas (Cuatrecasas, 1970).  59  3.2.5 Preparation of bovine retina homogenate  Fifty frozen bovine retinas were homogenized on ice in 20 mL buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, cOmplete protease inhibitor).  Homogenized tissues were centrifuged at 1,000 rpm for 15 min at 4°C to spin down the insoluble materials.  The fraction containing both soluble and membrane portions was collected. 3.2.6 Pull-down assay  Bovine retina homogenate was treated with 0.2 mM CaCl2, passed through a 22-gauge needle, and centrifuged at 40,000 rpm for 15 min at 4°C in a TLA-110 rotor using an Optima ultracentrifuge (Beckman Coulter, Brea, CA) to separate and harvest membranes and soluble fractions.  Membrane pellets were solubilized in buffer containing 20 mM CHAPS (50 mM HEPES, pH 7.4, 150 mM NaCl, 0.2 mM CaCl2, cOmplete protease inhibitor) and centrifuged to remove the insoluble materials.  Membrane and soluble fractions were each incubated with GST-Sepharose 2B for 1 h at 4°C.  GST-Sepharose was spun down for removal and samples were then incubated with GST-HPCAL1-Sepharose 2B for 2.5 h.  The matrix for the membrane or soluble fraction was washed six times in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 0.2 mM CaCl2, 10 mM CHAPS), split into two fractions, and eluted in the same buffer but with either 0.2 mM CaCl2 or 5 mM EDTA.    3.2.7 Dimethyl labeling  Elutions from the pull-down assay were ran on SDS gel electrophoresis (Figure 3.2, courtesy of Jenny Moon).  Gel was stained with a modified Neuhoff’s colloidal Coomassie Blue G-250 stain called “blue silver” (Candiano et al., 2004), visualized, and cut into pieces.  In-gel digestion was performed as described previously (Shevchenko et al., 1996).  Peptide mixtures  60  were desalted and concentrated using stop-and-go-extraction tips (StageTips) (Rappsilber et al., 2007).   StageTipped and dried peptides were resuspended in 20 μL of 100 mM triethylammonium bicarbonate (Sigma-Aldrich).  Twenty μL of formaldehyde isotopologues were added to samples: 200 mM CH2O (L, light) to the Ca2+-eluted sample and 200 mM C2H2O (M, medium) to the EDTA-eluted sample.  This was followed by the addition of 2 μL of 1 M sodium cyanoborohydride (NaBH3CN) to the L and M samples.  The mixture was incubated in the dark for 1.5 h at room temperature.  The reaction was quenched with 20 μL of 3 M NH4Cl and incubated in the dark for 10 min at room temperature.  Finally, the mixtures were acidified to pH < 2.5 and incubated for 1 h before the two differentially labeled samples were pooled and desalted using a C18 StageTip (3M, St. Paul, MN). 3.2.8 LC/MS and protein identification/quantitation The light- and medium-labeled peptides for each of the membrane and soluble fractions were mixed and analyzed using a linear-trapping quadrupole-Orbitrap mass spectrometer (LTQ-Orbitrap Velos; Thermo Fisher Scientific, Waltham, MA) on-line coupled to an Agilent 1290 Series HPLC using a nanospray ionization source (Thermo Fisher Scientific).  The 2 cm-long, 100 μm-inner diameter fused silica trap column is packed with Aqua® 5 μm C18 beads (Phenomenex, Torrance, CA), and the 50 μm-inner diameter fused silica fritted analytical column is packed with ReproSil-Pur® 3 μm C18-AQ beads (Dr. Maisch HPLC GmbH, Ammerbuch-Entringen, Germany).  Samples were resuspended and loaded in running buffer A which consisted of 0.5% aqueous acetic acid, while buffer B consisted of 0.5% acetic acid and 80% acetonitrile in water.  Standard 90 min gradients were run from 10% B to 32% B over 51 min, from 32% B to 40% B in the next 5 min, increased to 100% B over a 2 min period,  61  held at 100% B for 2.5 min, and then dropped to 0% B for another 20 min to recondition the column.  The sample was loaded on the trap column at 5 μL/min and the analysis was performed at 0.1 μL/min.  The LTQ-Orbitrap was set to acquire a full-range scan at 60,000 resolution from 350 to 1600 Th in the Orbitrap to simultaneously fragment the top fifteen peptide ions by CID in each cycle in the LTQ (minimum intensity 1000 counts).  For combination of HCD and CID runs, the Orbitrap was set to simultaneously fragment the top ten peptide ions by CID and the top five by HCD (resolution 7500) in each cycle in the LTQ (minimum intensity 1000 counts).   The data was searched against a bovine database retrieved from UniProt using Mascot with the following parameters: Trypsin specificity with maximum one missed cleavage site, precursor mass tolerance of 10 ppm, and fragment mass tolerance of 0.6 Da for ESI-TRAP and 0.05 Da for HCD.  Data quantitation was performed with Proteome Discoverer™ software (Thermo Fisher Scientific).  The results are filtered for 1% FDR. 3.2.9 Cloning and expression of potential interacting proteins Genes of potential interacting proteins, including aldolase C, fructose-bisphosphate (aldolase C, Aldoc), and torsinA (Tor1a) were amplified with gene-specific primers and Q5 Hot Start DNA Polymerase using mouse retina cDNA.  Primer sequences were as follows: Aldoc – forward: 5’ - GCGGAATTC ATGCCCCACTCATACCCA -3’, reverse: 5’ - GCGCTCGAGTTACAGATCCTCTTCTGAGATGAGTTTTTGTTCGTAGGCATGGTTGGCGAT -3’; Tor1a – forward: 5’- GCGGAATTCATGAAGCTTGGCCGGGCC -3’, reverse: 5’- GCGCTCGAGTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCGTCATCCAGGTAGTA -3’.  The amplicons were cloned in frame with a Myc tag in the pcDNA3 vector (Invitrogen, Carlsbad, CA) using EcoRI and XhoI.  The clones were sequenced and transformed into DH5α competent cells (Invitrogen).    62  3.2.10 Expression of HPCAL1 and potential interacting proteins in HEK293T and COS-7 cells  HEK293T cells were cultured according to Chapter 2.2.4 and co-transfected with HPCAL1 and 4.1G, aldolase C, or torsinA with 10 μg of each plasmid using the calcium phosphate method.  COS-7 cells were cultured according to Chapter 2.2.7 and transfected in six-well plates containing poly-L-lysine-treated coverslips with 2.5 μg of each plasmid per well.  3.2.11 Immunoprecipitation Co-transfected HEK293T cells were harvested and slowly added to buffer containing 20 mM CHAPS (50 mM HEPES, pH 7.4, 150 mM NaCl, cOmplete protease inhibitor) and either 0.2 mM CaCl2 or 2 mM EDTA.  Cells were solubilized with constant stirring at 4°C for 30 min and then subjected to centrifugation at 40,000 rpm for 10 min at 4°C with a TLA-110 rotor in the Optima ultracentrifuge to remove insoluble materials.  The soluble fraction was incubated with Rho 1D4-Sepharose 2B for 1 h at 4°C.  The matrix was washed with 500 µL of buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 10 mM CHAPS) with either 0.2 mM CaCl2 or 1 mM EDTA six times, and the protein, along with any potential interacting protein, was eluted with 50 µL of 1D4 peptide in wash buffer after two 30 min incubation periods at room temperature.    3.2.12 Immunofluorescence microscopy Transfected COS-7 cells were labeled similarly as described in Chapter 2.2.8.  COS-7 cells were co-transfected with 1D4-tagged HPCAL1 and 4.1G or Myc-tagged torsinA.  Cells were labeled with 9G3 hybridoma culture fluid (1:2) or Rho 1D4 hybridoma culture fluid (1:20) for HPCAL1, and a polyclonal antibody (1:2500; YenZym Antibodies, South San Francisco, CA) for 4.1G (Cheng and Molday, 2013) or a Myc polyclonal antibody (1:200; ab10910; Abcam, Cambridge, UK) for torsinA.  Alexa 488-tagged goat anti-mouse Ig and Alexa 594- 63  tagged goat anti-rabbit Ig secondary antibodies were used at dilutions 1:1000.  Nuclei were stained with DAPI (1:2000).  3.3 Results 3.3.1 Expression and purification of GST-tagged HPCAL1  HPCAL1 was cloned into pGEX-4T-1, expressed, and purified from E. coli for use in the generation of GST-HPCAL1-Sepharose.  HPCAL1 was expressed as a GST fusion protein for easier purification, and it showed good expression levels and purity upon purification with S-hexylglutathione-agarose.  It ran at ~45 kDa on the 10% acrylamide gel when subjected to gel electrophoresis (Figure 3.1), consistent with its theoretical molecular weight of ~22 kDa plus the 26 kDa GST tag.    Figure 3.1 Purification of GST-tagged HPCAL1  GST-tagged HPCAL1 was cloned, expressed in E. coli, and purified on a glutathione-Sepharose column.  The purified protein was subjected to SDS gel electrophoresis. The Coomassie blue- stained gel and the α-GST antibody-labeled Western blot showed that the purified GST-HPCAL1 fusion had a molecular weight of ~45 kDa.      64  3.3.2 Potential interacting partners of HPCAL1 were identified from the pull-down assay  GST-HPCAL1 was immobilized on Sepharose and was incubated with bovine retina in the presence of calcium.  Interacting proteins were eluted with an EDTA-containing buffer or a calcium-containing buffer.  Elutions were subjected to SDS gel electrophoresis, and as shown in Figure 3.2, the EDTA-eluted samples consistently had more intense bands than the calcium-eluted samples, indicating a higher abundance of proteins and the presence of calcium-dependent interacting proteins.  The gel was cut into pieces, in-gel digestion was performed, and peptides were treated with CH2O (light) or C2H2O (medium) and NaBH3CN for dimethyl labeling.  Labeled peptides were then pooled and subjected to LC-LTQ-Orbitrap analysis.  Protein identification was performed using Mascot and data was quantitated with Proteome Discoverer.   After three replicates of the pull-down assay, we had six individual sets of mass spectrometry (MS) data, three from soluble fractions and three from membrane fractions.  When all six sets of data were collated into one file, it provided a list of 321 proteins that were identified in the MS (Table A.2), and of these, ~180 proteins were identified with at least two unique peptides.  In addition, we decided to focus on proteins that appeared in two or three of the replicates, and have medium/light or EDTA-/Ca2+-eluted ratios of greater than two.  These criteria greatly decreased the number of proteins.  Seventy-one proteins appeared in at least two of the three replicates and had EDTA/Ca2+ ratios of greater than two (Table 3.1).  Furthermore, 43 of these 71 proteins appeared in all three replicates and had EDTA/Ca2+ ratios of greater than two (Table A.1).  The aim of this study was to identify potential interacting partners of HPCAL1 and confirm these interactions using co-immunoprecipitation (co-IP) and immunofluorescence (IF)  65  studies.  Therefore, it was necessary to select proteins appropriate for these further experiments.  Three proteins were chosen, and these were 4.1G, aldolase C, and torsinA (Table 3.2).     Figure 3.2 Representative SDS gel of elutions from the pull-down assay  Samples ran were the elutions with EDTA or calcium for both the soluble and membrane fractions of the bovine retina pull-down assay.  Gel was stained with “blue silver”.  Invitrogen BenchMark™ protein standards were used.  Figure courtesy of Jenny Moon.                            66  Table 3.1 Proteins identified by mass spectrometry analysis from the pull-down assays   This is the list of proteins that were identified in at least two of the three replicates of the pull-down assay and had at least one EDTA/calcium ratio of greater than 2.  Mem, membrane fraction; Sol, soluble fraction.  Accession Description Medium/light (EDTA/calcium) ratios    Replicate 1 Replicate 2 Replicate 3    Mem Sol Mem Sol Mem Sol                P29105 Hippocalcin-like protein 1  2.368 2.832 1.381 4.046 1.866 1.867 Q3ZBY4 Fructose-bisphosphate aldolase C 6.688 4.371 5.396 9.866 13.254 10.442 P11179 Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex, mitochondrial  1.476   1.402   2.718 1.179 Q3ZBK2 Redox-regulatory protein FAM213A      9.931   25.864   P81947 Tubulin alpha-1B chain  1.505 2.060 0.802 2.402 1.536 1.355 F2Z4C1 Uncharacterized protein (TUBA1A)  1.505 2.060 0.827 2.402 1.536 1.355 A6QLL8 Fructose-bisphosphate aldolase A   2.628 6.638 7.706 11.611 10.330 Q3MHM5 Tubulin beta-4B chain 1.951 1.623 1.289 2.420 1.525 1.314 G3X7S2 Heat shock protein beta-1    3.791   0.714   0.701 Q148N0 2-oxoglutarate dehydrogenase, mitochondrial  2.921 0.236 2.124   2.863 1.023 P81948 Tubulin alpha-4A chain  2.220 2.030 0.827 3.259 0.870 2.204 P82908 28S ribosomal protein S36, mitochondrial  2.403   3.473       P04695 Guanine nucleotide-binding protein G(t) subunit alpha-1  2.594 0.878 0.895 8.935 1.563 1.307 F1MS42 Uncharacterized protein (Fragment) (MSI1)        9.697   6.102 P60712 Actin, cytoplasmic 1 1.296 1.033   0.435 1.407 1.066 Q08E34 Translocase of outer mitochondrial membrane 70  6.019   5.641   8.218   G3X7R8 Uncharacterized protein (Fragment)  1.867 1.623 0.767 0.241 1.062 1.270 Q5E9A3 Poly(rC)-binding protein 1    4.275   0.401   1.507 P68250-2 Isoform Short of 14-3-3 protein beta/alpha    1.077   0.886 2.794 1.372 Q3SZI4 14-3-3 protein theta    1.077   3.086 2.613 1.669 A5PK75 TOR1A protein      4.113 5.592 10.048 7.079 P02769 Bovine serum albumin precursor   0.553   4.305   1.051 F1MDB2 Uncharacterized protein (LOC100335467)  54.902       16.181   P22439 Pyruvate dehydrogenase protein X component  2.037   1.429   1.832    67  Accession Description Medium/light (EDTA/calcium) ratios    Replicate 1 Replicate 2 Replicate 3    Mem Sol Mem Sol Mem Sol                F1MB08 Alpha-enolase    0.242 0.499 8.349     P63103 14-3-3 protein zeta/delta    1.077   0.122 1.669 1.540 G3X6L2 MOSC domain-containing protein 2, mitochondrial  5.400   10.313   100.000   Q3T0E3 Cytochrome c oxidase assembly protein 3 homolog, mitochondrial 7.317   12.539       G3MX91 Uncharacterized protein (TARDBP)        11.711 3.948 5.220 P62871 Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1    1.135   3.518   1.145 P61602 Neurocalcin-delta      2.929     1.747 P68509 14-3-3 protein eta    1.077   3.379 2.589 1.791 A7Z057 14-3-3 protein gamma    1.077   2.853 100.000 2.773 Q2HJB8 Tubulin alpha-8 chain  1.145 2.091 0.827 5.890 0.870 17.515 P10096 Glyceraldehyde-3-phosphate dehydrogenase    0.642 0.943 3.807 1.986 0.571 Q32L46 5'-nucleotidase, cytosolic III      1.293   2.921 1.467 Q3T0I5 Mitochondrial fission 1 protein    3.673   13.451 4.402 5.888 Q0VCP5 Tripartite motif-containing 32        3.362 8.367 4.153 Q5E9B1 L-lactate dehydrogenase B chain   0.390   0.710   0.977 F1MS84 Uncharacterized protein (Fragment) (NOVA2)    10.491 4.067 1.659   1.536 Q3T0K2 T-complex protein 1 subunit gamma    2.554   3.404   1.104 Q5E947 Peroxiredoxin-1    0.989       2.572 F1MN74 Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial        3.034   1.462 P08239 Guanine nucleotide-binding protein G(o) subunit alpha  2.528 0.759 0.661 10.941 4.992 2.865 A6QQZ0 Ganglioside-induced differentiation-associated protein 1      6.207   16.697   A5D984 Pyruvate kinase     0.416 2.623   1.763 Q0VCU0 Poly(rC)-binding protein 4    5.341   0.523     F1N2P6 Uncharacterized protein (FKBP8)     1.533   100.000   Q08DK4 Mitochondrial glutamate carrier 1  3.204   2.411       P07514 NADH-cytochrome b5 reductase 3      14.384   15.987   P62261 14-3-3 protein epsilon    1.077 1.648 2.193 2.186 3.290 E1B7S3 Uncharacterized protein (EPB41L3)    6.273   3.050   1.682 F1MWG1 Uncharacterized protein (OGDHL) 2.891 0.236 2.097   2.068 0.967 E1BJA2 Uncharacterized protein (AIFM1)      2.272   2.499    68  Accession Description Medium/light (EDTA/calcium) ratios    Replicate 1 Replicate 2 Replicate 3    Mem Sol Mem Sol Mem Sol                Q5E956 Triosephosphate isomerase        0.315 1.709 0.966 E1BNT8 Uncharacterized protein (PLCH2)     12.003 5.952 6.456 4.514 Q76LV2 Heat shock protein HSP 90-alpha    0.563   11.473   1.018 A2VE47 ADP-dependent glucokinase      16.011   39.331   F1N614 Uncharacterized protein   0.923 1.672 0.494 3.167 1.360 Q3SYT6 Calmegin      1.819   3.383   Q2KJH6 Serpin H1      24.069   52.790 83.402 G3MXL3 Uncharacterized protein (Fragment) (KRT3)  0.937 0.796 0.943 0.212 0.908 1.429 Q17QL7 KRT15 protein  1.463 0.687 2.586 0.898   1.121 F1MPU0 Clathrin heavy chain (Fragment)      1.351 0.457 1.996 0.799 E1B991 Uncharacterized protein (KRT2) 0.952 0.679 2.013 1.133 0.838 1.253 F1MBQ0 Uncharacterized protein (Fragment) (DYNC1LI2)    2.997       1.096 E1BDB0 Uncharacterized protein (EPB41L2)    2.275   2.185   1.451 F1MGX0 Uncharacterized protein    0.821   7.137     F1MKZ3 Uncharacterized protein (Fragment) (CADPS)    1.463       10.225 Q9TTK8 Creatine kinase U-type, mitochondrial  5.506 2.865 1.721       F1N1S2 Uncharacterized protein (MAP1B)    3.292 0.745     1.164    69  Table 3.2 Summary of the EDTA/calcium ratios for the three proteins selected for confirmation studies  4.1G, aldolase C, and torsinA were selected from the list of proteins identified by MS.  These proteins were subjected to co-IP and IF studies for confirming their interactions with HPCAL1.  Mem, membrane fraction; Sol, soluble fraction.  Ratios larger than 10 were denoted as “Large.”  In the case that the protein was not detected in a replicate, “N.D.” (not detected) was used.    Accession Description Gene name Medium/light (EDTA/calcium) ratios Replicate 1 Replicate 2 Replicate 3 Mem Sol Mem Sol Mem Sol Q3ZBY4 Fructose-bisphosphate aldolase C ALDOC  6.688 4.371 5.396 9.866 Large Large A5PK75 TOR1A protein TOR1A N.D. N.D. 4.113 5.592 Large 7.079 E1BDB0 4.1G EPB41L2 N.D. 2.275 N.D. 2.185 N.D. 1.451      70  3.3.3 Co-immunoprecipitation of HPCAL1 and its potential interacting partners To confirm the potential interactions of HPCAL1 with 4.1G, aldolase C, and torsinA as observed by mass spectrometry (MS), HEK293T cells were co-transfected with HPCAL1 and one of 4.1G, aldolase C, or torsinA.  HPCAL1 was purified on Rho 1D4-Sepharose and Western blotting was used to determine if 4.1G, aldolase C, or torsinA was pulled down with HPCAL1.  Figure 3.3 shows the Western blots for the co-immunoprecipitation (co-IP) experiment performed for each potential interacting protein, where HPCAL1 was labeled with Rho 1D4 antibody and the potential interacting proteins were labeled with Myc antibody, except for 4.1G which was labeled with its polyclonal antibody.   First of all, 4.1G did not seem to elute with HPCAL1.  The 4.1G polyclonal antibody-labeled Western blot showed that 4.1G expressed well with HPCAL1 in HEK293T cells as shown at ~125 kDa on the Input and Unbound lanes (Figure 3.3A).  A very faint band for 4.1G (indicated by *) could be in the elution of the experiment done in the absence of calcium.  If this band was indeed 4.1G, this result would be contradictory to the MS data where 4.1G was more abundant in the presence of calcium; however, its weak intensity could indicate a mere artifact.  The presence of two additional bands above and below the expected band was probably due to endogenous expression of the long and short forms of 4.1G in HEK293T cells. Figure 3.3B shows the Western blots for HPCAL1 and aldolase C.  Like 4.1G, aldolase C expressed well with HPCAL1 in HEK293T.  Similarly, aldolase C was not eluted with HPCAL1 in both the presence and absence of calcium. Finally, when torsinA was expressed with HPCAL1, it was pulled down in the co-IP experiment in the presence, but not in the absence, of calcium, and indicated a calcium-dependent interaction.  As shown on Figure 3.3C, a band was present on the Myc antibody- 71  labeled Western blot at ~37 kDa (indicated by *), consistent with the theoretical molecular weight of torsinA at 37.8 kDa.                          72  A     B                                   C   Figure 3.3 Co-immunoprecipitation of HPCAL1 and its potential interacting partners  HEK293T cells were transfected with 1D4-tagged HPCAL1 and (A) 4.1G, (B) Myc-tagged aldolase C, or (C) Myc-tagged torsinA.  HEK293T cell extracts (Input) were incubated with the Rho 1D4 immunoaffinity matrix in the presence or absence of calcium.  The input fraction, the unbound fraction (Unbound) and the 1D4 peptide-eluted fraction (Elution) were run on SDS gels and transferred to PVDF.  Western blots for HPCAL1 were labeled with Rho 1D4 antibody, (A) 4.1G was labeled with its polyclonal antibody, (B) aldolase C was labeled with Myc antibody, and (C) torsinA was labeled with Myc antibody.  73  3.3.4 Co-localization of HPCAL1 and its potential interacting partners using immunofluorescence microscopy COS-7 cells were co-transfected with HPCAL1 and 4.1G or torsinA, and subjected to immunolabeling for immunofluorescence (IF) microscopy.  In Figure 3.4A, the cells were double labeled, where HPCAL1 was labeled with 9G3 monoclonal antibody (green) and 4.1G was labeled with its polyclonal antibody (red).  Co-localization was observed at the plasma membrane.  Even though the co-IP gave negative results, this was performed because a 4.1G polyclonal antibody was available in our laboratory. On the other hand, the potential interaction between HPCAL1 and torsinA was supported by the co-IP results, where torsinA was pulled down with HPCAL1 in the presence of calcium.  In light of this, COS-7 cells were co-transfected with 1D4-tagged HPCAL1 and Myc-tagged torsinA.  HPCAL1 was labeled with Rho 1D4 antibody and torsinA was labeled with a polyclonal antibody.  Co-localization was observed in the cytoplasm, possibly in the endoplasmic reticulum.    Lastly, IF was not performed for aldolase C with HPCAL1, because of the negative results for the co-IP experiment and the lack of an aldolase C polyclonal antibody.          74  A    B      Figure 3.4 Immunofluorescence localization of HPCAL1 and 4.1G or torsinA co-expressed in COS-7 cells  COS-7 cells were transfected with the 1D4-tagged HPCAL1 and 4.1G or Myc-tagged torsinA.  (A) Cells were double-labeled with 9G3 antibody for HPCAL1 (green) and 4.1G polyclonal antibody (red).  (B) Cells were double-labeled with Rho 1D4 antibody for HPCAL1 (green) and Myc polyclonal antibody for torsinA (red).  Co-localization was observed in the merge images as indicated by the arrows.  Nuclei were stained with DAPI (blue).      75  3.4 Discussion  To better understand the role of HPCAL1 in the retina, it would be desirable to determine if HPCAL1 has any potential interacting partners, because many NCS proteins function as effectors to their interacting partners.  For this purpose, we designed and performed a pull-down experiment where HPCAL1 was used as bait and incubated with bovine retina homogenates in the presence of calcium.  Any interacting proteins were then eluted by an EDTA-containing buffer or in the same calcium-containing buffer, where calcium-dependent interacting partners would be eluted by the EDTA.  Both elutions were run on SDS gels, and as shown on Figure 3.2, the EDTA-eluted samples had higher protein concentration compared to the calcium-eluted samples.  This was as expected, as the aim of the pull-down assay was to gather calcium-dependent interacting partners of HPCAL1.   Proteins were subjected to in-gel digestion, then processed by reductive dimethylation; the EDTA-eluted sample was labeled with C2H2O (“medium”) and the calcium-eluted sample was labeled with CH2O (“light”).  Peptides were then purified, mixed, and subjected to LC/MS analysis.  This method, called triplex stable isotope labeling technique, is a fast, affordable, sensitive, and accurate approach to perform a quantitative proteomics study (Boersema et al., 2008).  Briefly, isotopomers of formaldehyde and sodium cyanoborohydride are used to incorporate dimethyl labels at the α- and ε-amino groups of all proteolytic peptides.  When three different formaldehyde isotopomers are used, peptide triplets are generated and exhibit a mass difference of at least 4 Da (Boersema et al., 2008).  Here, we were comparing two samples only, so two formaldehyde isotopomers were used, “light” and “medium.”    After three replicates of the pull-down experiment and subsequent MS analysis, we had six individual sets of MS data, three from soluble fractions and three from membrane fractions.   76  When all six sets of data were collated into one file, it provided a list of 321 proteins that were identified in the MS, and of these, ~180 proteins were identified with at least two unique peptides.  To further narrow down this list, we decided to focus on proteins that appeared in at least two replicates, and had medium/light or EDTA-/calcium-eluted ratios of greater than two.  A ratio of two was chosen because it would indicate a relatively significant difference in the abundance of a protein between the two samples and signify a calcium-dependent interacting protein.  71 proteins appeared in at least two of the three experiments and had EDTA/Ca2+ ratios of greater than two.  Of these 71 proteins, 43 proteins appeared in all three replicates and had EDTA/Ca2+ ratios of greater than two.  The objective of this study was to identify an enzyme or channel involved in phototransduction which interacts with HPCAL1 in the retina in a calcium-dependent manner.  Looking at the list of proteins from the MS analyses, we were not able to identify such a protein.  Most of the top hits from the MS were not directly, or at all, involved in phototransduction.  For unknown reasons, there was a number of mitochondrial proteins identified.  In addition, multiple forms of tubulin proteins, 14-3-3 proteins, and guanine nucleotide binding protein subunits were identified.  Tubulin proteins, however, are commonly present in MS data because of their abundance in the cell.  Despite this, all proteins identified in the MS analysis should be accurate, since the false detection rate is only 1%.  Contaminants include human keratins, trypsin, etc.           From the list of proteins identified by MS, three proteins, including 4.1G, aldolase C, and torsinA, were selected for confirmation studies.  First of all, 4.1G was selected because it has a documented role in the retina.  Not only was it detected in a proteomics study on bovine rod outer segment preparations conducted in our laboratory (Kwok et al., 2008), it was also recently identified as a new interacting partner for the cyclic-nucleotide gated (CNG) channels in rod  77  outer segments, where the mode of interaction was studied, but the role of 4.1G in photoreceptors remains unknown (Cheng and Molday, 2013).  In general, proteins in the 4.1 family play significant roles in the assembly and stability of protein complexes in the plasma membrane (Cheng and Molday, 2013).  4.1G, or 4.1 general, is the most widely expressed homolog of the five members in this family discovered to date.  It is expressed in the nervous system (Ohno et al., 2005, 2006; Rose et al., 2008), heart (Pinder et al., 2012), testis (Ohno et al., 2005; Terada et al., 2010), and adrenal gland (Wang et al., 2010).  Importantly, 4.1G has been found in the retina using immunofluorescence microscopy, where it localized to the neuronal synaptic layers and also in the photoreceptor layer (Rose et al., 2008).  This could indicate a similar localization as HPCAL1 in retina.  As discussed in Chapter 2, HPCAL1 monoclonal antibodies made in our laboratory may not be specific to HPCAL1, but a few of these presented immunolabeling at the neuronal synaptic layers specifically and/or in the photoreceptor layer.  Since our laboratory already has a polyclonal antibody against 4.1G, it would be interesting to see if the two proteins co-localize in retina if a HPCAL1-specific antibody becomes available.  Another interesting observation comes from the study of the interaction of 4.1G and CNG channels where MS analysis was performed on proteins that were co-immunoprecipitated with 4.1G from bovine rod outer segments (Cheng and Molday, 2013).  Their list of top proteins identified also included several 14-3-3 proteins and guanine nucleotide binding protein subunit alpha-1, which as mentioned above were also found in our study.  These results may be suggesting a network of interacting proteins. Interestingly, a number of interacting partners have been identified for 4.1G, with the majority being ion channels and receptors, including SERC2 (Pinder et al., 2012), GluR1 and GluR4 (Coleman et al., 2003), parathyroid hormone receptor (Saito et al., 2005), and other  78  receptors.  Specifically, 4.1G has been implicated in increasing the localization of these channels and receptors at the surface membrane, and directing them to lipid rafts where specific networks of signaling proteins assemble in the plasma membrane (Gibson et al., 2012).   Our observation that HPCAL1 co-localized with 4.1G at the plasma membrane when both were co-expressed in COS-7 cells supported the potential interaction discovered by the MS analysis.  Even though the co-IP gave negative results where 4.1G was not pulled down with HPCAL1, there are many reasons why this could happen even if the two proteins do interact.  For instance, it could be a weak interaction that is easily disturbed, or the presence of detergent from solubilisation could destroy the interaction. The second protein selected for confirmation studies was aldolase C.  Aldolase C was identified as one of the top hits in all replicates of the MS analysis and had consistently large EDTA/Ca2+ ratios which indicate a calcium-dependent interaction (Table 3.2).  Three isozymes of aldolases exist, and they are involved in glycolysis and also have non-glycolytic roles such as interacting with vacuolar-H+-ATPases and other molecules (Fujita et al., 2014).  Aldolase C is the brain-specific isozyme and its mRNA expression was found to be highest in the cerebellum, where it was distributed in stripes in the Purkinje cell layer of the cerebellum, and also in the inferior olives and in the sensory neurons of the posterior horn of the spinal cord (Buono et al., 2001).  This finding hinted that aldolase C likely has other functions, like sensory transmission, besides glycolytic functions (Buono et al., 2001).  Aldolase C has also been found in the retina.  Immunocytochemistry showed staining in the ganglion cell layer in mouse, rabbit, and rat; and in the inner nuclear layer in mouse and rabbit (Caffé et al., 1994).  In human retina, the photoreceptor cell layer was labeled; and in mouse, human, and rabbit, the inner segments also displayed weak labeling for aldolase C (Caffé et al., 1994).  This observed species specificity of  79  aldolase C expression in retina further indicated that this protein could have additional unknown functions.    Like 4.1G, aldolase C was not pulled down with HPCAL1 in the co-IP.  Because of this and the lack of a polyclonal antibody against aldolase C, immunofluorescence localization was not performed.   Finally, the last protein examined was torsinA, which appeared in two of the three replicates with high ratios, again indicating a calcium-dependent interaction.  The TOR1A gene has been associated with dystonia 1 or childhood-onset dystonia, a movement disorder characterized by twisting muscle contractions.  The only proven cause of this disease is the three nucleotide deletion, ΔGAG, within the gene TOR1A (Ozelius et al., 1997).  TOR1A encodes torsinA (TOR1A), a 332 amino acid protein that has an ATP-binding domain characteristic of the AAA+ family of ATPases (Neuwald et al., 1999; Ozelius et al., 1997).  AAA+ ATPases induce conformational changes in their substrates which often lead to dissociation of stable protein complexes or aggregates (Vale, 2000).  TorsinA is found in the lumen of the endoplasmic reticulum and is also at the nuclear envelope to some extent (Hewett et al., 2003; Naismith et al., 2004).  It is a widely expressed protein, with highest expression in liver, muscle, pancreas, and some parts of the brain (Ozelius et al., 1997).  With its localization in the ER, torsinA could be functioning as an ATP-dependent chaperone, but there is no evidence as to whether torsinA is involved in this or in other tasks of the ER (Naismith et al., 2004).  If torsinA is important to ER quality control, then its levels should increase after stress, but this did not happen when cells were treated with DTT or tunicamycin to induce ER stress (Hewett et al., 2003).   In contrast to 4.1G and aldolase C, torsinA was pulled down with HPCAL1 in the co-IP experiment.  This was observed only in the presence of calcium, whereas in the absence of  80  calcium, torsinA was not pulled down.  The role of torsinA in the retina is unknown, but since this interaction seems to be calcium-dependent, it is unlikely that torsinA is merely acting as a chaperone protein in the retina.   Overall, this proteomics study provided a first look at both calcium-dependent and calcium-independent potential interacting partners of HPCAL1 in the retina.  Three proteins, 4.1G, aldolase C, and torsinA, were subjected to confirmation studies using co-IP and IF experiments.  Only torsinA was confirmed to be a calcium-dependent interacting partner to HPCAL1 through both sets of experiments.  Further investigation will be necessary to determine its mode of interaction with HPCAL1.                  81  Chapter 4: Conclusions and future directions    Hippocalcin-like protein 1 (HPCAL1) is a neuronal calcium sensor (NCS) protein with unclear functions in retina.  It was previously identified in retina in two separate studies conducted in our laboratory (Kwok et al., 2008; Rostamirad, 2010).  This thesis investigated the characteristics of HPCAL1 in retina and its potential interacting partners in an attempt to elucidate the function of HPCAL1.   Chapter 2 described the characterization of HPCAL1 in retina and confirmed current knowledge on the protein.  First of all, the presence of Hpcal1 was confirmed by performing RT-PCR on various mouse tissues, and Hpcal1 expression was observed not only in retina but also in other tissues.  HPCAL1 was also isolated biochemically and its potential expression and localization patterns were examined in retina.  Second, the effect on calcium binding on HPCAL1 was investigated using protein expressed and isolated from both mammalian cells and bovine retina.  Results of the gel shift assay and the fluorescence assay demonstrated that calcium binding induces conformational changes to HPCAL1, and the membrane association assay confirmed that HPCAL1 displays the calcium-myristoyl switch mechanism.  Furthermore, the localization of HPCAL1 expressed in COS-7 cells was determined to be at the plasma membrane.  To examine the N-terminal myristoylation of HPCAL1, attempts were made to express and purify both myristoylated and non-myristoylated forms of the protein.  However, the yield and level of purity were not optimal.   Next, Chapter 3 described the methods and results of attempts to identify interacting partners of HPCAL1.  It was hypothesized that HPCAL1 might interact with an enzyme or channel involved in phototransduction, similar to the functions of some NCS proteins.  Even though none of the proteins identified are directly involved in phototransduction, results from  82  this mass spectrometry experiment has provided a first glimpse as to what HPCAL1 potentially could be involved in.  Various proteins that showed calcium-dependent interactions with HPCAL1 were identified, as they displayed higher abundance in the mass spectrometry analyses of the pull-down experiment.  Specifically, three proteins (4.1G, aldolase C, torsinA) were selected and subjected to co-immunoprecipitation (co-IP) and/or co-localization experiments.  However, only torsinA was pulled down with HPCAL1 in the presence of calcium in the co-IP studies; the other two proteins were not pulled down at all as indicated by Western blotting analysis.  Despite this, both torsinA and 4.1G showed co-localization with HPCAL1 when each was co-expressed with HPCAL1 in COS-7 cells.  This thesis has provided important technical information for the biochemical characterization and identification of potential protein interactions that exist in retina.  However, many issues remain to be resolved.  First of all, data interpretation was limited at times because of the lack of a HPCAL1-specific antibody.  Even though the generation of a monoclonal antibody specific to HPCAL1 would be very challenging, it would be the necessary next step in determining with confidence the localization of HPCAL1 in retina.  Because of the sequence similarity between visinin-like proteins, it would be difficult to generate an antibody against an epitope unique in HPCAL1; therefore, care and patience would be necessary in designing and manipulating such an antibody.  Cross-reactivity tests, similar to the one described in Chapter 2, would also be essential.  In addition to determining the exact localization of HPCAL1 in retina, a specific antibody would allow for the isolation or purification of HPCAL1 from retina by an immunoprecipitation experiment which employs Sepharose coupled with this antibody.  Such a column would also allow for a pull-down experiment where potential interacting partners in retina could be isolated simply by eluting with SDS and subjecting the eluate to mass  83  spectrometry analysis.  In the event that monoclonal antibodies specific to other class B NCS proteins are generated and discovered, they could be used to study the localization of these proteins in retina and perform further characterization studies. Next, the low yield and poor purity of HPCAL1 expressed and purified from E. coli had hindered the progress of this study.  It remains unclear if protein expression was low or if the purification scheme had unknown problems.  Other vectors could be used to see if the levels of protein expression will improve; moreover, different tags could be used which might also aid in the purification steps.  Furthermore, bacterial growth conditions could be further optimized for the expression of HPCAL1.  If pure myristoylated and non-myristoylated HPCAL1 can be obtained in good quantities, more characterization experiments could be performed.  For instance, myristoylation on HPCAL1 can be confirmed by HPLC or MS; these experiments were attempted, but they did not work well and did not provide the anticipated information, possibly due to insufficient protein.  These two forms of HPCAL1 can also be used to determine whether they display a difference in calcium binding properties and also if the observed HPCAL1 association with membranes is a consequence of the myristoylation or calcium binding. Finding the best bacterial expression and purification conditions for HPCAL1 also has implications for Chapter 3.  GST-tagged HPCAL1 was used as the bait in the pull-down assay; however, it remains uncertain whether the GST tag might have any negative effects on the experiment.  As for the mass spectrometry results obtained so far, further investigation can be applied to the confirmation of other interesting potential interactions with HPCAL1.  If HPCAL1-protein interactions are confirmed, the reverse immunoprecipitation can be performed to further support these observations.  Subsequently, monoclonal antibodies to the interacting protein can be generated which then can be used to detect, localize, and purify the protein from  84  retina.  If the interacting protein is an enzyme or channel, the effect of Ca2+-HPCAL1 on its activity can be measured by biochemical and physiological methods.  Overall, methods described in Chapter 3 can be applied to the identification and confirmation of potential interacting partners of other NCS proteins. In summary, this study has provided important new findings on the properties of HPCAL1 in retina and a first look at potential HPCAL1-protein interactions.  With the further studies that can be performed, more novel insight will be gained in the role of HPCAL1 as a calcium sensor in the retina and in the visual process.                  85  References  Ames, J.B., Ishima, R., Tanaka, T., Gordon, J.I., Stryer, L., and Ikura, M. (1997). Molecular mechanics of calcium-myristoyl switches. Nature 389, 198–202. Ames, J.B., Levay, K., Wingard, J.N., Lusin, J.D., and Slepak, V.Z. (2006). Structural basis for calcium-induced inhibition of rhodopsin kinase by recoverin. J. Biol. Chem. 281, 37237–37245. An, W.F., Bowlby, M.R., Betty, M., Cao, J., Ling, H.-P., Mendoza, G., Hinson, J.W., Mattsson, K.I., Strassle, B.W., Trimmer, J.S., et al. (2000). Modulation of A-type potassium channels by a family of calcium sensors. Nature 403, 553–556. Arnis, S., and Hofmann, K.P. (1993). Two different forms of metarhodopsin II: Schiff base deprotonation precedes proton uptake and signaling state. Proc. Natl. Acad. Sci. U. S. A. 90, 7849–7853. Bahi, N., Friocourt, G., Carrié, A., Graham, M.E., Weiss, J.L., Chafey, P., Fauchereau, F., Burgoyne, R.D., and Chelly, J. (2003). IL1 receptor accessory protein like, a protein involved in X-linked mental retardation, interacts with Neuronal Calcium Sensor-1 and regulates exocytosis. Hum. Mol. Genet. 12, 1415–1425. Boersema, P.J., Aye, T.T., van Veen, T.A.B., Heck, A.J.R., and Mohammed, S. (2008). Triplex protein quantification based on stable isotope labeling by peptide dimethylation applied to cell and tissue lysates. Proteomics 8, 4624–4632. Bramall, A.N., Wright, A.F., Jacobson, S.G., and McInnes, R.R. (2010). The genomic, biochemical, and cellular responses of the retina in inherited photoreceptor degenerations and prospects for the treatment of these disorders. Annu. Rev. Neurosci. 33, 441–472. Braunewell, K.H. (2012). The visinin-like proteins VILIP-1 and VILIP-3 in Alzheimer’s disease-old wine in new bottles. Front. Mol. Neurosci. 5, 1–12. Braunewell, K.-H., and Gundelfinger, E.D. (1997). Low level expression of calcium-sensor protein VILIP induces cAMP-dependent differentiation in rat C6 glioma cells. Neurosci. Lett. 234, 139–142. Braunewell, K.-H., and Gundelfinger, E.D. (1999). Intracellular neuronal calcium sensor proteins: a family of EF-hand calcium-binding proteins in search of a function. Cell Tissue Res. 295, 1–12. Braunewell, K.-H., and Klein-Szanto, A.J. (2009). Visinin-like proteins (VSNLs): interaction partners and emerging functions in signal transduction of a subfamily of neuronal Ca2+-sensor proteins. Cell Tissue Res. 335, 301–316.  86  Braunewell, K.-H., Brackmann, M., Schaupp, M., Spilker, C., Anand, R., and Gundelfinger, E.D. (2001). Intracellular neuronal calcium sensor (NCS) protein VILIP-1 modulates cGMP signalling pathways in transfected neural cells and cerebellar granule neurones. J. Neurochem. 78, 1277–1286. Buono, P., D’Armiento, F.P., Terzi, G., Alfieri, A., and Salvatore, F. (2001). Differential distribution of aldolase A and C in the human central nervous system. J. Neurocytol. 30, 957–965. Burgoyne, R.D. (2007). Neuronal calcium sensor proteins: generating diversity in neuronal Ca2+ signalling. Nat. Rev. Neurosci. 8, 182–193. Burgoyne, R.D., and Weiss, J.L. (2001). The neuronal calcium sensor family of Ca2+-binding proteins. Biochem. J. 353, 1–12. Burgoyne, R.D., O’Callaghan, D.W., Hasdemir, B., Haynes, L.P., and Tepikin, A. V (2004). Neuronal Ca2+-sensor proteins: multitalented regulators of neuronal function. Trends Neurosci. 27, 203–209. Buxbaum, J.D., Choi, E.-K., Luo, Y., Lilliehook, C., Crowley, A.C., Merriam, D.E., and Wasco, W. (1998). Calsenilin: A calcium-binding protein that interacts with the presenilins and regulates the levels of a presenilin fragment. Nat. Med. 4, 1177–1181. Caffé, A.R., von Schantz, M., Szél, A., Voogd, J., and van Veen, T. (1994). Distribution of Purkinje cell-specific Zebrin-II/aldolase C immunoreactivity in the mouse, rat, rabbit, and human retina. J. Comp. Neurol. 348, 291–297. Candiano, G., Bruschi, M., Musante, L., Santucci, L., Ghiggeri, G.M., Carnemolla, B., Orecchia, P., Zardi, L., and Righetti, P.G. (2004). Blue silver: A very sensitive colloidal Coomassie G-250 staining for proteome analysis. Electrophoresis 25, 1327–1333. Carrión, A.M., Link, W.A., Ledo, F., Mellström, B., and Naranjo, J.R. (1999). DREAM is a Ca2+-regulated transcriptional repressor. Nature 398, 80–84. Chattopadhyaya, R., Meador, W.E., Means, A.R., and Quiocho, F.A. (1992). Calmodulin structure refined at 1.7 A resolution. J. Mol. Biol. 228, 1177–1192. Chen, C., and Okayama, H. (1987). High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7, 2745–2752. Chen, C.-K., Inglese, J., Lefkowitz, R.J., and Hurley, J.B. (1995). Ca2+-dependent interaction of recoverin with rhodopsin kinase. J. Biol. Chem. 270, 18060–18066. Chen, Y., Wang, X., Zhao, P., Zhang, Y., and Cao, B. (2014). Development and characterization of monoclonal antibodies against pancreatic cancer marker hippocalcin-like 1 protein. Monoclon. Antib. Immunodiagn. Immunother. 33, 20–27.  87  Cheng, C.L., and Molday, R.S. (2013). Interaction of 4.1G and cGMP-gated channels in rod photoreceptor outer segments. J. Cell Sci. 126, 5725–5734. Coleman, S.K., Cai, C., Mottershead, D.G., Haapalahti, J.-P., and Keinänen, K. (2003). Surface expression of GluR-D AMPA receptor is dependent on an interaction between its C-terminal domain and a 4.1 protein. J. Neurosci. 23, 798–806. Cuatrecasas, P. (1970). Protein purification by affinity chromatography. J. Biol. Chem. 245, 3059–3065. Dizhoor, A.M., and Hurley, J.B. (1996). Inactivation of EF-hands makes GCAP-2 (p24) a constitutive activator of photoreceptor guanylyl cyclase by preventing a Ca2+-induced “activator-to-inhibitor” transition. J. Biol. Chem. 271, 19346–19350. Duda, T., Fik-Rymarkiewicz, E., Venkataraman, V., Krishnan, A., and Sharma, R.K. (2004). Calcium-modulated ciliary membrane guanylate cyclase transduction machinery: Constitution and operational principles. Mol. Cell. Biochem. 267, 107–122. Faas, G.C., Raghavachari, S., Lisman, J.E., and Mody, I. (2011). Calmodulin as a direct detector of Ca2+ signals. Nat. Neurosci. 14, 301–304. Fesenko, E., Kolesnikov, S., and Lyubarsky, A. (1985). Induction by cyclic GMP of cationic conductance in plasma membrane of retinal rod outer segment. Nature 313, 310–313. Filipek, S., Stenkamp, R.E., Teller, D.C., and Palczewski, K. (2003). G Protein-coupled receptor rhodopsin: A prospectus. Annu. Rev. Physiol. 65, 851–879. Flaherty, K.M., Zozulya, S., Stryer, L., and McKay, D.B. (1993). Three-dimensional structure of recoverin, a calcium sensor in vision. Cell 75, 709–716. Fujita, H., Aoki, H., Ajioka, I., Yamazaki, M., Abe, M., Oh-Nishi, A., Sakimura, K., and Sugihara, I. (2014). Detailed expression pattern of aldolase C (Aldoc) in the cerebellum, retina and other areas of the CNS studied in Aldoc-Venus knock-in mice. PLoS One 9, e86679. Gibson, A.W., Li, X., Wu, J., Baskin, J.G., Raman, C., Edberg, J.C., and Kimberly, R.P. (2012). Serine phosphorylation of FcγRI cytoplasmic domain directs lipid raft localization and interaction with protein 4.1G. J. Leukoc. Biol. 91, 97–103. Gierke, P., Zhao, C., Brackmann, M., Linke, B., Heinemann, U., and Braunewell, K.-H. (2004). Expression analysis of members of the neuronal calcium sensor protein family: combining bioinformatics and Western blot analysis. Biochem. Biophys. Res. Commun. 323, 38–43. Gorczyca, W.A., Polans, A.S., Surgucheva, I.G., Subbaraya, I., Baehr, W., and Palczewski, K. (1995). Guanylyl cyclase activating protein. J. Biol. Chem. 270, 22029–22036.  88  Haeseleer, F., Sokal, I., Verlinde, C.L.M.J., Erdjument-Bromage, H., Tempst, P., Pronin, A.N., Benovic, J.L., Fariss, R.N., and Palczewski, K. (2000). Five members of a novel Ca2+-binding protein (CABP) subfamily with similarity to calmodulin. J. Biol. Chem. 275, 1247–1260. Hama, H., Schnieders, E.A., Thorner, J., Takemoto, J.Y., and DeWald, D.B. (1999). Direct involvement of phosphatidylinositol 4-phosphate in secretion in the yeast Saccharomyces cerevisiae. J. Biol. Chem. 274, 34294–34300. Hamashima, H., Tamaru, T., Noguchi, H., Kobayashi, M., and Takamatsu, K. (2001). Immunochemical assessment of neural visinin-like calcium-binding protein 3 expression in rat brain. Neurosci. Res. 39, 133–143. Hammond, P.I., Craig, T.A., Kumar, R., and Brimijoin, S. (2003). Regional and cellular distribution of DREAM in adult rat brain consistent with multiple sensory processing roles. Mol. Brain Res. 111, 104–110. Haynes, L.P., Thomas, G.M.H., and Burgoyne, R.D. (2005). Interaction of neuronal calcium sensor-1 and ARF1 allows bidirectional control of PI(4) kinase β and TGN-plasma membrane traffic. J. Biol. Chem. 280, 6047–6054. Haynes, L.P., Sherwood, M.W., Dolman, N.J., and Burgoyne, R.D. (2007). Specificity, promiscuity and localization of ARF protein interactions with NCS-1 and phosphatidylinositol-4 kinase-IIIβ. Traffic 8, 1080–1092. Haynes, L.P., McCue, H. V, and Burgoyne, R.D. (2012). Evolution and functional diversity of the calcium binding proteins (CaBPs). Front. Mol. Neurosci. 5, 1–13. He, W., Cowan, C.W., and Wensel, T.G. (1998). RGS9, a GTPase accelerator for phototransduction. Neuron 20, 95–102. Hendricks, K.B., Wang, B.Q., Schnieders, E.A., and Thorner, J. (1999). Yeast homologue of neuronal frequenin is a regulator of phosphatidylinositol-4-OH kinase. Nat. Cell Biol. 1, 234–241. Hewett, J., Ziefer, P., Bergeron, D., Naismith, T., Boston, H., Slater, D., Wilbur, J., Schuback, D., Kamm, C., Smith, N., et al. (2003). TorsinA in PC12 cells: Localization in the endoplasmic reticulum and response to stress. J. Neurosci. Res. 72, 158–168. Hogan, P.G., Chen, L., Nardone, J., and Rao, A. (2003). Transcriptional regulation by calcium, calcineurin, and NFAT. Genes Dev. 17, 2205–2232. Hoon, M., Okawa, H., Della Santina, L., and Wong, R.O.L. (2014). Functional architecture of the retina: Development and disease. Prog. Retin. Eye Res. 42C, 44–84. Hsu, Y.-T., and Molday, R.S. (1993). Modulation of the cGMP-gated channel of rod photoreceptor cells by calmodulin. Nature 361, 76–79.  89  Hyun, D.-H., Emerson, S.S., Jo, D.-G., Mattson, M.P., and de Cabo, R. (2006). Calorie restriction up-regulates the plasma membrane redox system in brain cells and suppresses oxidative stress during aging. Proc. Natl. Acad. Sci. U. S. A. 103, 19908–19912. Hyun, D.-H., Mughal, M.R., Yang, H., Lee, J.H., Ko, E.J., Hunt, N.D., de Cabo, R., and Mattson, M.P. (2010). The plasma membrane redox system is impaired by amyloid β-peptide and in the hippocampus and cerebral cortex of 3xTgAD mice. Exp. Neurol. 225, 423–429. Ikura, M., and Ames, J.B. (2006). Genetic polymorphism and protein conformational plasticity in the calmodulin superfamily: Two ways to promote multifunctionality. Proc. Natl. Acad. Sci. U. S. A. 103, 1159–1164. Ivings, L., Pennington, S.R., Jenkins, R., Weiss, J.L., and Burgoyne, R.D. (2002). Identification of Ca2+-dependent binding partners for the neuronal calcium sensor protein neurocalcin δ: interaction with actin, clathrin and tubulin. Biochem. J. 363, 599–608. Jo, D.-G., Jang, J., Kim, B.-J., Lundkvist, J., and Jung, Y.-K. (2005). Overexpression of calsenilin enhances γ-secretase activity. Neurosci. Lett. 378, 59–64. Jo, J., Son, G.H., Winters, B.L., Kim, M.J., Whitcomb, D.J., Dickinson, B.A., Lee, Y.-B., Futai, K., Amici, M., Sheng, M., et al. (2010). Muscarinic receptors induce LTD of NMDAR EPSCs via a mechanism involving hippocalcin, AP2 and PSD-95. Nat. Neurosci. 13, 1216–1224. Kajimoto, Y., Shirai, Y., Mukai, H., Kuno, T., and Tanaka, C. (1993). Molecular cloning of two additional members of the neural visinin-like Ca2+-binding protein gene family. J. Neurochem. 61, 1091–1096. Kobayashi, M., Takamatsu, K., Fujishiro, M., Saitoh, S., and Noguchi, T. (1994). Molecular cloning of a novel calcium-binding protein structurally related to hippocalcin from human brain and chromosomal mapping of its gene. Biochim. Biophys. Acta - Mol. Cell Res. 1222, 515–518. Kobayashi, M., Chikashima, H., and Takamatsu, K. (2000). Title not available. In Sixth European Symposium on Calcium Binding Proteins in Normal and Transformed Cells, (Paris, France). Koch, K.-W. (2006). GCAPs, the classical neuronal calcium sensors in the retina. A Ca2+-relay model of guanylate cyclase activation. Calcium Bind. Proteins 1, 3–6. Koh, P.O., Undie, A.S., Kabbani, N., Levenson, R., Goldman-Rakic, P.S., and Lidow, M.S. (2003). Up-regulation of neuronal calcium sensor-1 (NCS-1) in the prefrontal cortex of schizophrenic and bipolar patients. Proc. Natl. Acad. Sci. U. S. A. 100, 313–317. Kolb, H. (2012). Gross anatomy of the eye.  90  Kraut, N., Frampton, J., and Graf, T. (1995). Rem-1, a putative direct target gene of the Myb-Ets fusion oncoprotein in haematopoietic progenitors, is a member of the recoverin family. Oncogene 10, 1027–1036. Krishnan, A., Venkataraman, V., Fik-Rymarkiewicz, E., Duda, T., and Sharma, R.K. (2004). Structural, biochemical, and functional characterization of the calcium sensor neurocalcin δ in the inner retinal neurons and its linkage with the rod outer segment membrane guanylate cyclase transduction system. Biochemistry 43, 2708–2723. Kumar, V.D., Vijay-Kumar, S., Krishnan, A., Duda, T., and Sharma, R.K. (1999). A second calcium regulator of rod outer segment membrane guanylate cyclase, ROS-GC1: Neurocalcin. Biochemistry 38, 12614–12620. Kuno, T., Kajimoto, Y., Hashimoto, T., Mukai, H., Shirai, Y., Saheki, S., and Tanaka, C. (1992). cDNA cloning of a neural visinin-like Ca2+-binding protein. Biochem. Biophys. Res. Commun. 184, 1219–1225. Kuo, H., Cheng, C., Clark, R.B., Lin, J.J.-C., Lin, J.L.-C., Hoshijima, M., Nguyêñ-Trân, V.T., Gu, Y., Ikeda, Y., Chu, P.-H., et al. (2001). A defect in the Kv channel-interacting protein 2 (KChIP2) gene leads to a complete loss of I(to) and confers susceptibility to ventricular tachycardia. Cell 107, 801–813. Kwok, M.C.M., Holopainen, J.M., Molday, L.L., Foster, L.J., and Molday, R.S. (2008). Proteomics of photoreceptor outer segments identifies a subset of SNARE and Rab proteins implicated in membrane vesicle trafficking and fusion. Mol. Cell. Proteomics 7, 1053–1066. Lautermilch, N.J., Few, A.P., Scheuer, T., and Catterall, W.A. (2005). Modulation of CaV2.1 channels by the neuronal calcium-binding protein visinin-like protein-2. J. Neurosci. 25, 7062–7070. Leal, K., Mochida, S., Scheuer, T., and Catterall, W.A. (2012). Fine-tuning synaptic plasticity by modulation of Ca(V)2.1 channels with Ca2+ sensor proteins. Proc. Natl. Acad. Sci. U. S. A. 109, 17069–17074. Lee, A., Jimenez, A., Cui, G., and Haeseleer, F. (2007). Phosphorylation of the Ca2+-binding protein CaBP4 by protein kinase C ζ in photoreceptors. J. Neurosci. 27, 12743–12754. Lenz, S.E., Henschel, Y., Zopf, D., Voss, B., and Gundelfinger, E.D. (1992). VILIP, a cognate protein of the retinal calcium binding proteins visinin and recoverin, is expressed in the developing chicken brain. Mol. Brain Res. 15, 133–140. Lenz, S.E., Braunewell, K., Weise, C., Nedlina-Chittka, A., and Gundelfinger, E.D. (1996). The neuronal EF-Hand Ca2+-binding protein VILIP: Interaction with cell membrane and actin-based cytoskeleton. Biochem. Biophys. Res. Commun. 225, 1078–1083.  91  Lin, L., Braunewell, K.-H., Gundelfinger, E.D., and Anand, R. (2002). Functional analysis of calcium-binding EF-hand motifs of visinin-like protein-1. Biochem. Biophys. Res. Commun. 296, 827–832. Lisman, J., Schulman, H., and Cline, H. (2002). The molecular basis of CaMKII function in synaptic and behavioural memory. Nat. Rev. Neurosci. 3, 175–190. Mamman, A., Simpson, J.P., Nighorn, A., Imanishi, Y., Palczewski, K., Ronnett, G. V., and Moon, C. (2004). Hippocalcin in the olfactory epithelium: a mediator of second messenger signaling. Biochem. Biophys. Res. Commun. 322, 1131–1139. Marenholz, I., Heizmann, C.W., and Fritz, G. (2004). S100 proteins in mouse and man: from evolution to function and pathology (including an update of the nomenclature). Biochem. Biophys. Res. Commun. 322, 1111–1122. Masuo, Y., Ogura, A., Kobayashi, M., Masaki, T., Furuta, Y., Ono, T., and Takamatsu, K. (2007). Hippocalcin protects hippocampal neurons against excitotoxin damage by enhancing calcium extrusion. Neuroscience 145, 495–504. McBee, J.K., Palczewski, K., Baehr, W., and Pepperberg, D.R. (2001). Confronting complexity: the interlink of phototransduction and retinoid metabolism in the vertebrate retina. Prog. Retin. Eye Res. 20, 469–529. McCue, H. V, Haynes, L.P., and Burgoyne, R.D. (2010). The diversity of calcium sensor proteins in the regulation of neuronal function. Cold Spring Harb. Perspect. Biol. 2, 1–21. McFerran, B.W., Graham, M.E., and Burgoyne, R.D. (1998). Neuronal Ca2+ sensor 1, the mammalian homologue of Frequenin, is expressed in chromaffin and PC12 cells and regulates neurosecretion from dense-core granules. J. Biol. Chem. 273, 22768–22772. McIlwain, J.T. (1996). Introduction to the Biology of Vision (Cambridge, UK: Cambridge University Press). Naismith, T. V, Heuser, J.E., Breakefield, X.O., Hanson, P.I., and De Camilli, P. V (2004). TorsinA in the nuclear envelope. Proc. Natl. Acad. Sci. U. S. A. 101, 7612–7617. Nakamura, T.Y., Pountney, D.J., Ozaita, A., Nandi, S., Ueda, S., Rudy, B., and Coetzee, W.A. (2001). A role for frequenin, a Ca2+-binding protein, as a regulator of Kv4 K+-currents. Proc. Natl. Acad. Sci. U. S. A. 98, 12808–12813. Nakano, A., Terasawa, M., Watanabe, M., Usuda, N., Morita, T., and Hidaka, H. (1992). Neurocalcin, a novel calcium binding protein with three EF-hand domains, expressed in retinal amacrine cells and ganglion cells. Biochem. Biophys. Res. Commun. 186, 1207–1211.  92  Neuwald, A.F., Aravind, L., Spouge, J.L., and Koonin, E. V (1999). AAA+: A class of chaperone-like ATPases associated with the assembly, operation, and disassembly of protein complexes. Genome Res. 9, 27–43. O’Callaghan, D.W., Tepikin, A. V, and Burgoyne, R.D. (2003). Dynamics and calcium sensitivity of the Ca2+/myristoyl switch protein hippocalcin in living cells. J. Cell Biol. 163, 715–721. Ohno, N., Terada, N., Tanaka, J., Yokoyama, A., Yamakawa, H., Fujii, Y., Baba, T., Ohara, O., and Ohno, S. (2005). Protein 4.1 G localizes in rodent microglia. Histochem. Cell Biol. 124, 477–486. Ohno, N., Terada, N., Yamakawa, H., Komada, M., Ohara, O., Trapp, B.D., and Ohno, S. (2006). Expression of protein 4.1G in Schwann cells of the peripheral nervous system. J. Neurosci. Res. 84, 568–577. Oikawa, K., Kimura, S., Aoki, N., Atsuta, Y., Takiyama, Y., Nagato, T., Yanai, M., Kobayashi, H., Sato, K., Sasajima, T., et al. (2004). Neuronal calcium sensor protein visinin-like protein-3 interacts with microsomal cytochrome b5 in a Ca2+-dependent manner. J. Biol. Chem. 279, 15142–15152. Okazaki, K., Obata, N., Inoue, S., and Hidaka, H. (1995). S100β is a target protein of neurocalcin δ, an abundant isoform in glial cells. Biochem. J. 306, 551–555. Osterberg, G. (1935). Topology of the layer of rods and cones in the human retina (Acta Ophthalmol (Copenh)). Ozelius, L.J., Hewett, J.W., Page, C.E., Bressman, S.B., Kramer, P.L., Shalish, C., de Leon, D., Brin, M.F., Raymond, D., Corey, D.P., et al. (1997). The early-onset torsion dystonia gene (DYT1) encodes an ATP-binding protein. Nat. Genet. 17, 40–48. Palczewski, K., Sokal, I., and Baehr, W. (2004). Guanylate cyclase-activating proteins: structure, function, and diversity. Biochem. Biophys. Res. Commun. 322, 1123–1130. Paterlini, M., Revilla, V., Grant, A.L., and Wisden, W. (2000). Expression of the neuronal calcium sensor protein family in the rat brain. Neuroscience 99, 205–216. Pinder, J.C., Taylor-Harris, P.M., Bennett, P.M., Carter, E., Hayes, N.V.L., King, M.D.A., Holt, M.R., Maggs, A.M., Gascard, P., and Baines, A.J. (2012). Isoforms of protein 4.1 are differentially distributed in heart muscle cells: relation of 4.1R and 4.1G to components of the Ca2+ homeostasis system. Exp. Cell Res. 318, 1467–1479. Polans, A., Baehr, W., and Palczewski, K. (1996). Turned on by Ca2+! The physiology and pathology of Ca2+-binding proteins in the retina. Trends Neurosci. 19, 547–554.  93  Pongs, O., Lindemeier, J., Zhu, X.R., Theil, T., Engelkamp, D., Krah-Jentgens, I., Lambrecht, H.-G., Koch, K.W., Schwemer, J., Rivosecchi, R., et al. (1993). Frequenin - A novel calcium-binding protein that modulates synaptic efficacy in the Drosophila nervous system. Neuron 11, 15–28. De Raad, S., Comte, M., Nef, P., Lenz, S.E., Gundelfinger, E.D., and Cox, J.A. (1995). Distribution pattern of three neural calcium-binding proteins (NCS-1, VILIP and recoverin) in chicken, bovine and rat retina. Histochem. J. 27, 524–535. Rappsilber, J., Mann, M., and Ishihama, Y. (2007). Protocol for micro-purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nat. Protoc. 2, 1896–1906. Rhodes, K.J., Carroll, K.I., Sung, M.A., Doliveira, L.C., Monaghan, M.M., Burke, S.L., Strassle, B.W., Buchwalder, L., Menegola, M., Cao, J., et al. (2004). KChIPs and Kv4 α subunits as integral components of A-type potassium channels in mammalian brain. J. Neurosci. 24, 7903–7915. Rieke, F. (2000). Mechanisms of single-photon detection in rod photoreceptors. Methods Enzymol. 316, 186–202. Rodieck, R.W. (1998). The First Steps in Seeing (Sunderland, Massachusetts, USA: Sinauer Associates Inc.). Rose, M., Dütting, E., and Enz, R. (2008). Band 4.1 proteins are expressed in the retina and interact with both isoforms of the metabotropic glutamate receptor type 8. J. Neurochem. 105, 2375–2387. Rostamirad, S. (2010). Identification and characterization of a novel retinal protein, ANKRD33, and its interacting partner HPCAL-1. The University of British Columbia. Saito, M., Sugai, M., Katsushima, Y., Yanagisawa, T., Sukegawa, J., and Nakahata, N. (2005). Increase in cell-surface localization of parathyroid hormone receptor by cytoskeletal protein 4.1G. Biochem. J. 392, 75–81. Saitoh, S., Takamatsu, K., Kobayashi, M., and Noguchi, T. (1993). Distribution of hippocalcin mRNA and immunoreactivity in rat brain. Neurosci. Lett. 157, 107–110. Sampath, A.P., and Rieke, F. (2004). Selective transmission of single photon responses by saturation at the rod-to-rod bipolar synapse. Neuron 41, 431–443. Sampath, A.P., Strissel, K.J., Elias, R., Arshavsky, V.Y., McGinnis, J.F., Chen, J., Kawamura, S., Rieke, F., and Hurley, J.B. (2005). Recoverin improves rod-mediated vision by enhancing signal transmission in the mouse retina. Neuron 46, 413–420.  94  Schnurra, I., Bernstein, H.-G., Riederer, P., and Braunewell, K.-H. (2001). The neuronal calcium sensor protein VILIP-1 is associated with amyloid plaques and extracellular tangles in Alzheimer’s disease and promotes cell death and tau phosphorylation in vitro: a link between calcium sensors and Alzheimer's disease? Neurobiol. Dis. 8, 900–909. Seidenbecher, C.I., Langnaese, K., Sanmartí-Vila, L., Boeckers, T.M., Smalla, K., Sabel, B.A., Garner, C.C., Gundelfinger, E.D., and Kreutz, M.R. (1998). Caldendrin, a novel neuronal calcium-binding protein confined to the somato-dendritic compartment. J. Biol. Chem. 273, 21324–21331. Shevchenko, A., Wilm, M., Vorm, O., and Mann, M. (1996). Mass spectrometric sequencing of proteins from silver-stained polyacrylamide gels. Anal. Chem. 68, 850–858. Spilker, C., and Braunewell, K.-H. (2003). Calcium–myristoyl switch, subcellular localization, and calcium-dependent translocation of the neuronal calcium sensor protein VILIP-3, and comparison with VILIP-1 in hippocampal neurons. Mol. Cell. Neurosci. 24, 766–778. Spilker, C., Richter, K., Smalla, K.-H., Manahan-Vaughan, D., Gundelfinger, E.D., and Braunewell, K.-H. (2000). The neuronal EF-hand calcium-binding protein visinin-like protein-3 is expressed in cerebellar Purkinje cells and shows a calcium-dependent membrane association. Neuroscience 96, 121–129. Spilker, C., Dresbach, T., and Braunewell, K.-H. (2002a). Reversible translocation and activity-dependent localization of the calcium-myristoyl switch protein VILIP-1 to different membrane compartments in living hippocampal neurons. J. Neurosci. 22, 7331–7339. Spilker, C., Gundelfinger, E.D., and Braunewell, K.-H. (2002b). Evidence for different functional properties of the neuronal calcium sensor proteins VILIP-1 and VILIP-3: from subcellular localization to cellular function. Biochim. Biophys. Acta - Proteins Proteomics 1600, 118–127. Stephen, R., Filipek, S., Palczewski, K., and Sousa, M.C. (2008). Ca2+-dependent regulation of phototransduction. Photochem. Photobiol. 84, 903–910. Sung, C.-H., and Chuang, J.-Z. (2010). The cell biology of vision. J. Cell Biol. 190, 953–963. Swaroop, A., Kim, D., and Forrest, D. (2010). Transcriptional regulation of photoreceptor development and homeostasis in the mammalian retina. Nat. Rev. Neurosci. 11, 563–576. Tang, W., Morey, L.M., Cheung, Y.Y., Birch, L., Prins, G.S., and Ho, S. (2012). Neonatal exposure to estradiol/bisphenol A alters promoter methylation and expression of Nsbp1 and Hpcal1 genes and transcriptional programs of Dnmt3a/b and Mbd2/4 in the rat prostate gland throughout life. Endocrinology 153, 42–55.  95  Tarawneh, R., D’Angelo, G., Macy, E., Xiong, C., Carter, D., Cairns, N.J., Fagan, A.M., Head, D., Mintun, M.A., Ladenson, J.H., et al. (2011). Visinin-like protein-1: diagnostic and prognostic biomarker in Alzheimer disease. Ann. Neurol. 70, 274–285. Terada, N., Ohno, N., Saitoh, S., Saitoh, Y., Komada, M., Kubota, H., and Ohno, S. (2010). Involvement of a membrane skeletal protein, 4.1G, for Sertoli/germ cell interaction. Reproduction 139, 883–892. Tzingounis, A. V, Kobayashi, M., Takamatsu, K., and Nicoll, R. a (2007). Hippocalcin gates the calcium activation of the slow afterhyperpolarization in hippocampal pyramidal cells. Neuron 53, 487–493. Vale, R.D. (2000). AAA proteins: Lords of the ring. J. Cell Biol. 150, F13–F19. Venkataraman, V., Duda, T., Ravichandran, S., and Sharma, R.K. (2008). Neurocalcin δ modulation of ROS-GC1, a new model of Ca2+ signaling. Biochemistry 47, 6590–6601. Villalobos, C., and Andrade, R. (2010). Visinin-like neuronal calcium sensor proteins regulate the slow calcium-activated afterhyperpolarizing current in the rat cerebral cortex. J. Neurosci. 30, 14361–14365. Wang, H., Liu, C., Debnath, G., Baines, A.J., Conboy, J.G., Mohandas, N., and An, X. (2010). Comprehensive characterization of expression patterns of protein 4.1 family members in mouse adrenal gland: implications for functions. Histochem. Cell Biol. 134, 411–420. Wang, W., Zhou, Z., Zhao, W., Huang, Y., Tang, R., Ying, K., Xie, Y., and Mao, Y. (2001). Molecular cloning, mapping and characterization of the human neurocalcin delta gene (NCALD). Biochim. Biophys. Acta - Gene Struct. Expr. 1518, 162–167. Wang, W., Zhong, Q., Teng, L., Bhatnagar, N., Sharma, B., Zhang, X., Luther II, W., Haynes, L.P., Burgoyne, R.D., Vidal, M., et al. (2014). Mutations that disrupt PHOXB interaction with the neuronal calcium sensor HPCAL1 impede cellular differentiation in neuroblastoma. Oncogene 33, 3316–3324. Weiss, J.L., Archer, D.A., and Burgoyne, R.D. (2000). Neuronal Ca2+ sensor-1/frequenin functions in an autocrine pathway regulating Ca2+ channels in bovine adrenal chromaffin cells. J. Biol. Chem. 275, 40082–40087. Xiong, H., Xia, K., Li, B., Zhao, G., and Zhang, Z. (2009). KChIP1: a potential modulator to GABAergic system. Acta Biochim Biophys Sin 41, 295–300. Young, R.W. (1971). The renewal of rod and cone outer segments in the rhesus monkey. J. Cell Biol. 49, 303–318. Zhao, X., Várnai, P., Tuymetova, G., Balla, A., Tóth, Z.E., Oker-Blom, C., Roder, J., Jeromin, A., and Balla, T. (2001). Interaction of neuronal calcium sensor-1 (NCS-1) with  96  phosphatidylinositol 4-kinase β stimulates lipid kinase activity and affects membrane trafficking in COS-7 cells. J. Biol. Chem. 276, 40183–40189. Zozulya, S., and Stryer, L. (1992). Calcium-myristoyl protein switch. Proc. Natl. Acad. Sci. U. S. A. 89, 11569–11573.   97  Appendices   Appendix 1: Proteins identified in all three replicates of the pull-down experiment Table A.1 Proteins that were identified in all three replicates of the pull-down experiment and had at least one EDTA/calcium ratio of greater than 2  Accession Description Medium/light (EDTA/calcium) ratios     Replicate 1 Replicate 2 Replicate 3     Mem Sol Mem Sol Mem Sol                 P29105 Hippocalcin-like protein 1  2.368 2.832 1.381 4.046 1.866 1.867 Q3ZBY4 Fructose-bisphosphate aldolase C 6.688 4.371 5.396 9.866 13.254 10.442 P11179 Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex, mitochondrial 1.476   1.402   2.718 1.179 P81947 Tubulin alpha-1B chain 1.505 2.060 0.802 2.402 1.536 1.355 F2Z4C1 Uncharacterized protein (TUBA1A) 1.505 2.060 0.827 2.402 1.536 1.355 A6QLL8 Fructose-bisphosphate aldolase A   2.628 6.638 7.706 11.611 10.330 Q3MHM5 Tubulin beta-4B chain  1.951 1.623 1.289 2.420 1.525 1.314 G3X7S2 Heat shock protein beta-1    3.791   0.714   0.701 Q148N0 2-oxoglutarate dehydrogenase, mitochondrial  2.921 0.236 2.124   2.863 1.023 P81948 Tubulin alpha-4A chain  2.220 2.030 0.827 3.259 0.870 2.204 P04695 Guanine nucleotide-binding protein G(t) subunit alpha-1 2.594 0.878 0.895 8.935 1.563 1.307 P60712 Actin, cytoplasmic 1 1.296 1.033   0.435 1.407 1.066 Q08E34 Translocase of outer mitochondrial membrane 70  6.019   5.641   8.218   G3X7R8 Uncharacterized protein (Fragment)  1.867 1.623 0.767 0.241 1.062 1.270 Q5E9A3 Poly(rC)-binding protein 1    4.275   0.401   1.507 P68250-2 Isoform Short of 14-3-3 protein beta/alpha   1.077   0.886 2.794 1.372 Q3SZI4 14-3-3 protein theta    1.077   3.086 2.613 1.669 P02769 Bovine serum albumin precursor   0.553   4.305   1.051 P22439 Pyruvate dehydrogenase protein X component 2.037   1.429   1.832   F1MB08 Alpha-enolase   0.242 0.499 8.349     P63103 14-3-3 protein zeta/delta   1.077   0.122 1.669 1.540  98  Accession Description Medium/light (EDTA/calcium) ratios     Replicate 1 Replicate 2 Replicate 3     Mem Sol Mem Sol Mem Sol                 G3X6L2 MOSC domain-containing protein 2, mitochondrial  5.400   10.313   100.000   P62871 Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1    1.135   3.518   1.145 P68509 14-3-3 protein eta    1.077   3.379 2.589 1.791 A7Z057 14-3-3 protein gamma    1.077   2.853 100.000 2.773 Q2HJB8 Tubulin alpha-8 chain  1.145 2.091 0.827 5.890 0.870 17.515 P10096 Glyceraldehyde-3-phosphate dehydrogenase    0.642 0.943 3.807 1.986 0.571 Q3T0I5 Mitochondrial fission 1 protein    3.673   13.451 4.402 5.888 Q5E9B1 L-lactate dehydrogenase B chain    0.390   0.710   0.977 F1MS84 Uncharacterized protein (Fragment) (NOVA2)   10.491 4.067 1.659   1.536 Q3T0K2 T-complex protein 1 subunit gamma    2.554   3.404   1.104 P08239 Guanine nucleotide-binding protein G(o) subunit alpha  2.528 0.759 0.661 10.941 4.992 2.865 P62261 14-3-3 protein epsilon   1.077 1.648 2.193 2.186 3.290 E1B7S3 Uncharacterized protein (EPB41L3)   6.273   3.050   1.682 F1MWG1 Uncharacterized protein (OGDHL)  2.891 0.236 2.097   2.068 0.967 E1BNT8 Uncharacterized protein (PLCH2)      12.003 5.952 6.456 4.514 Q76LV2 Heat shock protein HSP 90-alpha    0.563   11.473   1.018 F1N614 Uncharacterized protein    0.923 1.672 0.494 3.167 1.360 G3MXL3 Uncharacterized protein (Fragment) (KRT3)  0.937 0.796 0.943 0.212 0.908 1.429 Q17QL7 KRT15 protein  1.463 0.687 2.586 0.898   1.121 E1B991 Uncharacterized protein (KRT2)  0.952 0.679 2.013 1.133 0.838 1.253 E1BDB0 Uncharacterized protein (EPB41L2)    2.275   2.185   1.451 F1N1S2 Uncharacterized protein (MAP1B)   3.292 0.745     1.164      99  Appendix 2: Proteins identified by mass spectrometry and their medium/light (EDTA/calcium) ratios   Table A.2 Medium/light (EDTA/calcium) ratios for potential interacting proteins of HPCAL1 identified by mass spectrometry  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol P29105 Hippocalcin-like protein 1  61.14 159 10 2.368 2.832 1.381 4.046 1.866 1.867 Q3ZBY4 Fructose-bisphosphate aldolase C 43.68 174 16 6.688 4.371 5.396 9.866 13.254 10.442 P11179 Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex, mitochondrial  43.52 142 14 1.476   1.402   2.718 1.179 P11966 Pyruvate dehydrogenase E1 component subunit beta, mitochondrial  42.34 128 14 1.062 0.725 0.766 0.922 0.815   Q3ZBK2 Redox-regulatory protein FAM213A  38.53 16 8     9.931   25.864   P81947 Tubulin alpha-1B chain  37.92 159 14 1.505 2.060 0.802 2.402 1.536 1.355 F2Z4C1 Uncharacterized protein (TUBA1A) 37.92 158 14 1.505 2.060 0.827 2.402 1.536 1.355 P02070 Hemoglobin subunit beta 35.86 12 4   0.896         A6QLL8 Fructose-bisphosphate aldolase A 34.62 91 13   2.628 6.638 7.706 11.611 10.330 Q2KJD0 Tubulin beta-5 chain  33.78 199 14 1.749 1.623 1.363 1.172 1.540 1.256 Q3MHM5 Tubulin beta-4B chain  33.71 235 14 1.951 1.623 1.289 2.420 1.525 1.314 E1BJB1 Tubulin beta-2B chain  33.71 187 14 1.461 1.610 1.256 0.678 1.204 1.243 Q6B856 Tubulin beta-2B chain  33.71 184 14 1.461 1.610 1.256 0.678 1.328 1.256 E1B9K1 Polyubiquitin-C  32.79 5 2 1.506 2.096         A7MB35 Pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial  32.56 88 11 1.021   0.685   0.945   Q2T9S0 Tubulin beta-3 chain  32.44 165 13 1.867 1.884 1.208 1.172 1.827 1.282 G3X7S2 Heat shock protein beta-1  31.17 6 4   3.791   0.714   0.701 Q3ZBU7 Tubulin beta-4A chain  30.18 161 12 1.951 1.623 0.782 1.143 1.399 1.270  100  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol Q148N0 2-oxoglutarate dehydrogenase, mitochondrial  28.64 103 25 2.921 0.236 2.124   2.863 1.023 P81948 Tubulin alpha-4A chain  28.35 105 11 2.220 2.030 0.827 3.259 0.870 2.204 A5PK67 MGC165862 protein  27.71 2 2             P82908 28S ribosomal protein S36, mitochondrial  27.18 5 2 2.403   3.473       P04695 Guanine nucleotide-binding protein G(t) subunit alpha-1  27.14 45 8 2.594 0.878 0.895 8.935 1.563 1.307 F1MS42 Uncharacterized protein (Fragment) (MSI1) 26.32 18 7       9.697   6.102 P60712 Actin, cytoplasmic 1 26.13 28 8 1.296 1.033   0.435 1.407 1.066 Q08E34 Translocase of outer mitochondrial membrane 70  24.30 57 12 6.019   5.641   8.218   P19120 Heat shock cognate 71 kDa protein  23.23 70 12   1.024 1.739 1.048 1.812 1.276 P21457 Recoverin  22.77 8 4   0.832       0.949 G3X7R8 Uncharacterized protein (Fragment)  22.60 58 8 1.867 1.623 0.767 0.241 1.062 1.270 Q5E9A3 Poly(rC)-binding protein 1  21.91 26 6   4.275   0.401   1.507 P68250-2 Isoform Short of 14-3-3 protein beta/alpha  21.72 11 5   1.077   0.886 2.794 1.372 Q3SZI4 14-3-3 protein theta  21.63 10 5   1.077   3.086 2.613 1.669 A5PK75 TOR1A protein  21.62 18 6     4.113 5.592 10.048 7.079 P02769 Bovine serum albumin precursor 21.25 22 11   0.553   4.305   1.051 F1MDB2 Uncharacterized protein (LOC100335467) 20.90 7 1 54.902       16.181   P22439 Pyruvate dehydrogenase protein X component  20.76 54 9 2.037   1.429   1.832   F1MB08 Alpha-enolase 20.28 27 7   0.242 0.499 8.349     F1MUP9 Uncharacterized protein (VAT1)  19.90 18 5         2.796 1.303 Q29RV0 Cyclin-dependent kinase 4 inhibitor D  19.88 2 2           25.995 F1N206 Dihydrolipoyl dehydrogenase  19.84 48 8 1.183 1.569 1.023   1.041    101  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol F1N690 Dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  19.32 55 11 1.625 1.660 1.422   1.814   P63103 14-3-3 protein zeta/delta  18.78 11 4   1.077   0.122 1.669 1.540 G3X6L2 MOSC domain-containing protein 2, mitochondrial  18.51 18 5 5.400   10.313   100.000   F1MUZ9 60 kDa heat shock protein, mitochondrial  18.32 22 10 1.459 1.850 0.963   1.105 1.106 Q17QV0 Poly(RC) binding protein 3  18.28 11 5   1.696       1.507 Q3T0E3 Cytochrome c oxidase assembly protein 3 homolog, mitochondrial  17.92 5 2 7.317   12.539       G3MX91 Uncharacterized protein (TARDBP) 17.87 54 7       11.711 3.948 5.220 P62871 Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 17.65 27 6   1.135   3.518   1.145 P61602 Neurocalcin-delta  17.62 7 3     2.929     1.747 E1B8C5 Uncharacterized protein (PDK1)  17.12 7 6     1.622   0.767   P68509 14-3-3 protein eta  17.07 9 4   1.077   3.379 2.589 1.791 F1MLB8 ATP synthase subunit alpha  16.82 29 9 1.740 1.355 1.015   1.302 1.496 A7Z057 14-3-3 protein gamma  16.60 10 5   1.077   2.853 100.000 2.773 Q2HJB8 Tubulin alpha-8 chain  16.48 70 6 1.145 2.091 0.827 5.890 0.870 17.515 P10096 Glyceraldehyde-3-phosphate dehydrogenase 16.22 33 4   0.642 0.943 3.807 1.986 0.571 Q32L46 5'-nucleotidase, cytosolic III  16.16 12 4     1.293   2.921 1.467 Q3T0I5 Mitochondrial fission 1 protein  15.79 32 2   3.673   13.451 4.402 5.888 F1MPL4 Nucleoside diphosphate kinase B  15.79 3 2             Q0VCP5 Tripartite motif-containing 32  15.77 25 9       3.362 8.367 4.153 Q5E9B1 L-lactate dehydrogenase B chain 15.57 12 5   0.390   0.710   0.977  102  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol F1MS84 Uncharacterized protein (Fragment) (NOVA2)  15.30 21 6   10.491 4.067 1.659   1.536 Q3T0K2 T-complex protein 1 subunit gamma  14.68 12 7   2.554   3.404   1.104 Q17QC2 Retinol dehydrogenase 13 (All-trans/9-cis)  14.63 6 5         4.774 4.267 Q5E947 Peroxiredoxin-1  14.57 4 3   0.989       2.572 F1MN74 Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial  14.48 15 5       3.034   1.462 P32007 ADP/ATP translocase 3  14.43 8 4 1.923   0.669   1.348   P08239 Guanine nucleotide-binding protein G(o) subunit alpha 14.41 24 4 2.528 0.759 0.661 10.941 4.992 2.865 P00829 ATP synthase subunit beta, mitochondrial  13.45 10 5 1.163   0.782   1.737   A6QQ28 Histone H2B  13.43 4 1   2.974         A6QQZ0 Ganglioside-induced differentiation-associated protein 1  13.41 7 4     6.207   16.697   G3MZK8 S-arrestin  13.24 11 5   0.759         A5D984 Pyruvate kinase  13.18 11 6     0.416 2.623   1.763 Q0VCU0 Poly(rC)-binding protein 4  13.15 7 4   5.341   0.523     F1N2P6 Uncharacterized protein (FKBP8)  13.14 7 4     1.533   100.000   Q08DC9 Cell cycle exit and neuronal differentiation 1  13.01 2 1         4.919 6.465 Q27965 Heat shock 70 kDa protein 1B  12.79 23 6   1.201 1.739 0.728 1.812 1.227 Q08DK4 Mitochondrial glutamate carrier 1  12.73 10 4 3.204   2.411       Q5EAD2 D-3-phosphoglycerate dehydrogenase  12.57 10 5   0.897       0.963 P00423 Cytochrome c oxidase subunit 4 isoform 1, mitochondrial  12.43 2 2     0.924       P07514 NADH-cytochrome b5 reductase 3  12.29 18 4     14.384   15.987   P62261 14-3-3 protein epsilon 12.16 9 3   1.077 1.648 2.193 2.186 3.290  103  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol Q28115 Glial fibrillary acidic protein  12.15 9 5   1.202   0.731   1.041 E1B7S3 Uncharacterized protein (EPB41L3)  11.77 29 11   6.273   3.050   1.682 O02675 Dihydropyrimidinase-related protein 2 11.71 15 5   0.719       0.901 F1MWG1 Uncharacterized protein (OGDHL)  11.58 32 11 2.891 0.236 2.097   2.068 0.967 P02722 ADP/ATP translocase 1  11.41 13 3 1.687   0.722   1.161   Q8SQH5 ADP/ATP translocase 2 11.41 12 3 1.687   0.943   1.115   E1BDR5 Uncharacterized protein  10.51 8 5       1.078   1.345 E1BJA2 Uncharacterized protein (AIFM1)  10.28 10 5     2.272   2.499   Q9NZ50 Gamma-synuclein 10.24 1 1   0.921         M0QVZ6 Keratin, type II cytoskeletal 5  10.12 23 6 1.073 0.761 1.355 0.701 0.753 1.286 P10123 Retinaldehyde-binding protein 1  10.09 7 3   0.748       1.163 Q148E0 Thioredoxin-like protein AAED1  10.09 4 3           1.344 Q5E956 Triosephosphate isomerase  10.04 5 2       0.315 1.709 0.966 Q08DL3 Uncharacterized protein (Fragment) (ZNF385A)  9.90 7 3           2.952 E1BNT8 Uncharacterized protein (PLCH2) 9.84 26 11     12.003 5.952 6.456 4.514 F1MS41 Beta-synuclein  9.70 4 1             Q76LV2 Heat shock protein HSP 90-alpha 9.69 26 6   0.563   11.473   1.018 A6QLG3 PDK3 protein  9.64 8 3 0.891   1.156   0.775   A2VE47 ADP-dependent glucokinase  9.46 12 4     16.011   39.331   P48616 Vimentin  9.44 6 4       0.711     P31408 V-type proton ATPase subunit B, brain isoform  9.39 7 3   1.869         F1MIE2 Uncharacterized protein (SQSTM1)  9.32 4 3           2.763 F1MQB5 Uncharacterized protein (C18H16orf70)  9.24 5 3           1.643  104  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol G5E507 Heat shock protein HSP 90-beta  8.98 18 6   1.549       0.876 Q05752 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 7  8.85 1 1     1.533       P15246 Protein-L-isoaspartate(D-aspartate) O-methyltransferase 8.81 4 2           1.183 F1MC02 Uncharacterized protein (MGLL)  8.75 8 2     4.421       F1N614 Uncharacterized protein  8.67 11 4   0.923 1.672 0.494 3.167 1.360 G3N0W8 Uncharacterized protein (PURB) 8.55 3 2           1.320 E1BNQ4 ATP-dependent (S)-NAD(P)H-hydrate dehydratase  8.51 4 2         6.117   Q3ZBU2 CDGSH iron-sulfur domain-containing protein 1  8.49 1 1     1.696       ENSEMBL:ENSBTAP00000038253 63 kDa protein 8.42 123 5 1.108 0.744 1.350 1.955 0.838 1.385 Q3T0J4 Heme oxygenase (Decycling) 2  8.25 1 1             E1B9F6 Elongation factor 1-alpha  8.23 11 4   1.267 1.239     1.767 P13619 ATP synthase F(0) complex subunit B1, mitochondrial  8.20 4 2     1.253   1.438   Q05KJ0 BCL2-like 1 8.15 3 2       19.675     F1MLE8 Uncharacterized protein (SEC22B)  7.97 2 2         1.544   Q3T087 60S ribosomal protein L11 7.87 1 1   2.566         Q5E9M8 Sideroflexin-1 7.76 2 2         1.840   F1MLW8 Uncharacterized protein (LOC100847119)  7.73 3 2         1.936 1.608 E1B9I1 Uncharacterized protein (C7H19orf70)  7.63 1 1     3.773       E1BF97 Uncharacterized protein  7.63 1 1           2.132 Q3SYT6 Calmegin  7.59 5 3     1.819   3.383    105  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol F1MZU2 Uncharacterized protein (NSF) 7.51 13 5   1.014       1.231 F6QD56 Uncharacterized protein (PLA2G16) 7.50 2 1         4.585   Q2KJH6 Serpin H1  7.42 9 3     24.069   52.790 83.402 G3MXL3 Uncharacterized protein (Fragment) (KRT3)  7.31 25 5 0.937 0.796 0.943 0.212 0.908 1.429 Q2KI38 Chromosome 6 open reading frame 35 ortholog  7.30 1 1             E1BM22 Uncharacterized protein (LOC100300167)  7.14 1 1             Q17QW3 Retinol dehydrogenase 14 (All-trans/9-cis/11-cis)  7.14 2 2         100.000   F1MZ92 Nuclease-sensitive element-binding protein 1  7.10 1 1           1.728 Q17QL7 KRT15 protein  7.06 24 3 1.463 0.687 2.586 0.898   1.121 G5E6I5 Uncharacterized protein (Fragment) (LOC100850482)  7.00 6 2             Q2KJH7 Aldehyde dehydrogenase 18 family, member A1 6.92 6 5           41.334 E1BCK8 Uncharacterized protein  6.90 1 1             F1MQE8 Synaptojanin-2-binding protein  6.90 2 1             F1MPU0 Clathrin heavy chain (Fragment)  6.86 15 11     1.351 0.457 1.996 0.799 Q5EA61 Creatine kinase B-type 6.82 3 2     0.540     1.269 P29104 Hippocalcin-like protein 4 6.81 1 1             E1B991 Uncharacterized protein (KRT2)  6.81 96 4 0.952 0.679 2.013 1.133 0.838 1.253 F6RJ91 Uncharacterized protein (PRPS2)  6.80 2 1   1.132         Q148H7 Keratin, type II cytoskeletal 79  6.73 12 4 1.073   1.106 0.212     F6Q9S4 cAMP-dependent protein kinase type II-beta regulatory subunit  6.70 4 3             Q0P5K3 Ubiquitin-conjugating enzyme E2 N  6.58 1 1   0.558          106  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol G3MYL5 Uncharacterized protein (BHLHE41) 6.42 2 2           1.654 Q3ZBD1 RAB1A, member RAS oncogene family  6.36 4 1   0.701         P01966 Hemoglobin subunit alpha 6.34 1 1   0.744         P02510 Alpha-crystallin B chain  6.29 1 1   1.215         F1MSA6 Uncharacterized protein (KRT34)  6.14 3 2             A4IFP7 ARF5 protein  6.11 2 1   0.554         E1BCB7 40S ribosomal protein S12 (Fragment) 6.06 3 1   14.931         P12344 Aspartate aminotransferase, mitochondrial 6.05 4 2 1.569 0.350         E1BLU0 Uncharacterized protein (CYB5D2)  6.04 1 1           7.465 P61223 Ras-related protein Rap-1b  5.98 2 1   0.925         Q08DF4 Dynamin-1  5.96 5 5   1.279         P13696 Phosphatidylethanolamine-binding protein 1  5.88 1 1           1.643 F1MBQ0 Uncharacterized protein (Fragment) (DYNC1LI2)  5.82 2 2   2.997       1.096 E1BDB0 Uncharacterized protein (EPB41L2)  5.79 12 6   2.275   2.185   1.451 G3MZT0 Uncharacterized protein (PLEKHB1)  5.77 2 1             P02253 Histone H1.2  5.63 1 1             B0JYN4 Family with sequence similarity 96, member A  5.63 1 1             E1BH17 Glutathione S-transferase Mu 1  5.63 1 1           1.228 F1MMU4 Uncharacterized protein (H1FX) 5.61 1 1             Q3T0U2 60S ribosomal protein  5.61 1 1           0.928 Q3ZCH0 Stress-70 protein, mitochondrial  5.60 6 3 1.502 0.702     1.593 1.345 Q32PJ6 Probable cytosolic iron-sulfur protein assembly protein CIAO1  5.60 3 2           1.224  107  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol A6QR61 SNX12 protein  5.56 1 1   1.127         Q1RMR8 Reticulon  5.54 10 2   0.743 0.808 0.616   0.635 Q5E9M9 Mitochondrial Rho GTPase 2  5.50 3 3         100.000   F1MJ70 Uncharacterized protein (Fragment) (HSPA12A) 5.50 4 3           1.455 F1MDX5 Uncharacterized protein 5.45 1 1   14.970         F2Z4E7 Uncharacterized protein (GN=ILF2)  5.38 4 2   3.584         F1MNK0 Uncharacterized protein (GN=BCL2L13)  5.38 1 1             Q5E9F9 26S protease regulatory subunit 7  5.31 2 2             E1BLY0 Uncharacterized protein (GN=TBX2) 5.18 5 3           16.213 Q1RMX3 Bcl-2-like protein 2  5.18 2 1             Q28056 Aspartyl/asparaginyl beta-hydroxylase  5.17 3 2         3.083   F1N4E5 Torsin-1A-interacting protein 1  5.17 11 2         5.795   A1A4J1 6-phosphofructokinase, liver type 5.13 3 3       1.181   1.815 Q0IIG7 Ras-related protein Rab-5A  5.12 2 1   0.861         P22292 Mitochondrial 2-oxoglutarate/malate carrier protein  5.10 1 1             E1B7U1 Uncharacterized protein (Fragment) (GN=MOGS)  4.99 3 3         4.656   P29172-8 Isoform Tau-H of Microtubule-associated protein tau  4.95 1 1           1.735 F1MR06 Uncharacterized protein (Fragment) (ATP1A3)  4.94 7 4     0.781   1.642   F1MGX0 Uncharacterized protein  4.91 7 3   0.821   7.137     P15103 Glutamine synthetase  4.83 4 2             G8JKY8 Reticulon  4.82 1 1       1.568      108  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol A5D9F0 Calcium/calmodulin-dependent protein kinase II delta  4.81 4 2           1.048 A0JNA3 Inosine-5'-monophosphate dehydrogenase 1 4.47 2 2   0.857         E1BA87 Uncharacterized protein (GN=EFNB3) 4.41 2 1         15.077 6.592 F1MBQ2 Uncharacterized protein (Fragment) (GN=UBE2J1)  4.40 1 1         96.914   F1MQU5 Golgi to ER traffic protein 4 homolog  4.40 1 1   10.649         G3MZJ8 Uncharacterized protein  4.31 2 2           100.000 A7MBI5 DPYSL3 protein  4.24 4 2   0.760       0.901 F1MZ49 Uncharacterized protein (Fragment)  4.23 1 1           2.781 Q17QP9 Proteasome (Prosome, macropain) 26S subunit, non-ATPase, 14 4.19 2 1   3.275         F1MUK8 Constitutive coactivator of PPAR-gamma-like protein 1 (Fragment)  4.09 6 3           3.435 E1BHK2 Uncharacterized protein  4.07 2 2   3.397         Q9BGI3 Peroxiredoxin-2  4.02 4 1   1.427       1.188 P02699 Rhodopsin 4.02 2 1         1.856   F1MLW4 Retinol-binding protein 3  3.89 6 4   0.447         P45879 Voltage-dependent anion-selective channel protein 1  3.89 1 1     9.024       Q0IIG5 6-phosphofructokinase, muscle 3.85 5 2   1.746       1.542 Q5E946 Protein DJ-1  3.70 2 1 1.143           Q3SZ65 Eukaryotic initiation factor 4A-II  3.69 1 1   0.705         Q3T165 Prohibitin  3.68 1 1         2.179   E1BCW3 6-phosphofructokinase  3.67 3 2           1.160 Q5E9F1 B-cell receptor-associated protein 31 3.67 2 1     1.284   1.089    109  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol Q29RU3 Coiled-coil domain-containing protein 54 3.66 1 1             Q3T145 Malate dehydrogenase, cytoplasmic  3.59 1 1       2.497     F1N3F2 Uncharacterized protein (GN=IRF2BPL)  3.49 2 2           1.271 P47803 RPE-retinal G protein-coupled receptor  3.44 1 1     1.091       P68002 Voltage-dependent anion-selective channel protein 2 3.40 2 1     0.593       Q9XSJ0 Ubiquitin carboxyl-terminal hydrolase isozyme L5  3.35 1 1   0.810         Q3T147 Spliceosome RNA helicase DDX39B  3.27 1 1             F1MZL6 V-type proton ATPase subunit H  3.23 2 1   1.060         F1MDL3 Uncharacterized protein (Fragment) (GN=STX3) 3.23 1 1         1.653   E1BK69 Uncharacterized protein (GN=UFSP2)  3.20 1 1         8.143   Q2HJ92 Interferon-inducible double-stranded RNA-dependent protein kinase activator A  3.19 1 1             Q32LB3 CXXC-type zinc finger protein 5  3.15 1 1           3.801 E1BM93 Uncharacterized protein (GN=RDH11)  3.13 1 1         6.024   E1BFN6 Uncharacterized protein (GN=DPYS)  3.10 1 1             Q3ZBE9 Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating  3.09 1 1         5.347   Q2TBQ5 60S ribosomal protein L7a  3.01 1 1             Q2HJ97 Prohibitin-2 3.01 1 1         0.660   P39872 60S ribosomal protein L3  2.98 1 1           1.432 Q0VCS9 Ankyrin repeat and MYND domain-containing protein 2  2.94 1 1         7.229   P00514 cAMP-dependent protein kinase type I-alpha regulatory subunit  2.89 2 1           1.129 Q3T169 40S ribosomal protein S3  2.88 1 1              110  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol Q95140 60S acidic ribosomal protein P0  2.83 1 1             E1BFI2 Uncharacterized protein (GN=DHTKD1)  2.82 3 2         1.391   E1BMW9 Uncharacterized protein (GN=PURA)  2.80 2 1   3.315         Q3MHL4 Adenosylhomocysteinase  2.78 1 1           1.210 P12234-2 Isoform B of Phosphate carrier protein, mitochondrial  2.77 2 1     1.576       F1N1A3 Uncharacterized protein (GN=UBQLN1)  2.72 3 1             A7MB28 Protein NDRG3  2.67 1 1   2.429         F1MKZ3 Uncharacterized protein (Fragment) (GN=CADPS) 2.66 3 3   1.463       10.225 F1MWE0 Uncharacterized protein (GN=PSMC3)  2.63 1 1           0.178 E1BNY5 Uncharacterized protein (GN=RUFY3)  2.58 1 1             F1N0E5 T-complex protein 1 subunit delta  2.58 1 1   1.431         P00517 cAMP-dependent protein kinase catalytic subunit alpha  2.56 2 1   6.985         Q1JQD3 Paraoxonase 3  2.54 1 1             A6QPG6 LANCL2 protein  2.54 1 1   2.151         P36225-4 Isoform 4 of Microtubule-associated protein 4  2.53 3 2           1.163 Q2KIV3 RNA binding motif protein 4B  2.51 1 1           2.659 P31404 V-type proton ATPase catalytic subunit A 2.43 1 1           1.162 Q0P5N4 Uncharacterized protein (GN=WWOX)  2.42 1 1     2.333       Q9TTK8 Creatine kinase U-type, mitochondrial 2.40 8 1 5.506 2.865 1.721       E1B763 Uncharacterized protein (GN=AP3M2)  2.39 1 1   1.018         E1BEQ0 Uncharacterized protein (GN=EXD2)  2.39 1 1         8.861   G1K237 Mitochondrial Rho GTPase 2.38 1 1         3.270    111  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol A4IFJ2 SYT5 protein  2.33 2 1             F1MCQ1 Arrestin-C  2.30 1 1   0.934         H2XJE9 Serine/threonine-protein kinase NLK  2.28 1 1           6.428 A6QNX5 Keratin, type II cytoskeletal 78  2.27 1 1             Q08DL0 SLC3A2 protein  2.27 1 1         3.023   E1BNL6 Uncharacterized protein GN=GMEB2  2.24 2 1   2.313         P49410 Elongation factor Tu, mitochondrial  2.21 1 1         1.700   F1MTX7 Aspartate--tRNA ligase, cytoplasmic  2.20 1 1             F1N1S2 Uncharacterized protein GN=MAP1B  2.19 14 4   3.292 0.745     1.164 P61763 Syntaxin-binding protein 1  2.19 1 1           1.003 A6QR07 AGK protein  2.14 1 1         1.435   Q58DW0 60S ribosomal protein L4  2.13 1 1             P48018 Synaptotagmin-1  2.13 2 1     0.436       F6S1Q0 Uncharacterized protein GN=KRT18  2.10 8 1 0.340 0.413         E1BLF5 Uncharacterized protein GN=ARNTL 2.08 1 1           3.847 Q3ZCI9 T-complex protein 1 subunit theta  2.01 1 1             G5E531 T-complex protein 1 subunit alpha  1.98 1 1             F1MMF9 Uncharacterized protein GN=POU2F1  1.98 1 1           6.545 A4FV52 Vesicular glutamate transporter 1 1.96 1 1           0.998 Q3T0D0 Heterogeneous nuclear ribonucleoprotein K  1.94 1 1   0.769         A5D973 Alpha isoform of regulatory subunit A, protein phosphatase 2  1.87 1 1           0.010 F1MEW7 Uncharacterized protein (Fragment) GN=LOC523963  1.81 1 1           3.612 A6QLB5 EML3 protein  1.79 1 1           2.536  112  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol A6QNM9 SLC25A12 protein  1.78 1 1         1.908   Q3SYT8 NADPH--cytochrome P450 reductase  1.77 1 1         5.537   F1N6P2 Uncharacterized protein GN=SURF1  1.77 1 1         1.969   Q29397 Synaptic vesicle glycoprotein 2A  1.75 1 1           1.071 P61286 Polyadenylate-binding protein 1  1.73 1 1   3.597         A6QLT5 UBAP2L protein  1.73 2 2             F1N4N1 Uncharacterized protein GN=TRIP11  1.68 1 1             A6QLY7 Pre-B-cell leukemia transcription factor-interacting protein 1  1.65 1 1         2.996   E1BNQ7 Uncharacterized protein GN=NKX6-1  1.64 1 1     0.814       E1BAZ9 Uncharacterized protein GN=EXOG  1.63 1 1             A7YWC4 ATPase family AAA domain-containing protein 3  1.54 2 1             Q2KJ25 26S proteasome non-ATPase regulatory subunit 12  1.54 2 1   1.774         F1N6R8 Uncharacterized protein (GN=BCAS3)  1.52 1 1             A6QNS3 Active breakpoint cluster region-related protein  1.51 1 1           3.974 Q0IIK5 ATP-dependent RNA helicase DDX1  1.49 1 1             F1MWD3 Uncharacterized protein GN=CCT5 1.48 1 1   0.728         F1N5I4 Uncharacterized protein (Fragment) GN=ADAM11 1.44 1 1           15.582 F1MFT4 Uncharacterized protein (Fragment) GN=HNRNPU  1.43 2 1           1.690 F1MF76 Uncharacterized protein GN=NOMO2  1.39 2 1         3.144   F1MY44 Uncharacterized protein GN=HNRNPM 1.37 1 1             Q08DF6 Metal-regulatory transcription factor 1  1.33 1 1           100.000  113  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol F1N0G9 Uncharacterized protein (Fragment)  1.32 1 1             A4FUX7 ADAM23 protein  1.32 1 1           100.000 F1N1W7 Neural cell adhesion molecule 1 (Fragment)  1.30 1 1     1.246       E1BBW7 Uncharacterized protein GN=FAM134C  1.29 2 1             G3MYJ0 Uncharacterized protein  1.28 2 1   1.079         Q0P5L6 Uncharacterized protein GN=ZW10 1.28 1 1             P53620 Coatomer subunit gamma-1  1.26 1 1   2.070         E1B7W1 Uncharacterized protein GN=THRAP3  1.25 1 1           4.970 G3N348 Uncharacterized protein GN=WFS1 1.24 1 1         2.271   F1N0Y9 Uncharacterized protein (Fragment) GN=ZFR  1.07 1 1           2.538 F1MC70 Uncharacterized protein (Fragment) GN=CCDC170  1.01 1 1 8.148           E1BJG5 Uncharacterized protein  0.98 1 1   1.212         A5D7P7 ABCB6 protein  0.95 4 1             A7MBA2 PSMD1 protein  0.94 1 1             F1MQ32 Uncharacterized protein (Fragment) GN=CCDC171  0.91 5 1             E1BPM4 Uncharacterized protein GN=CHD7  0.85 2 2           2.593 Q59HJ6 Lon protease homolog, mitochondrial  0.83 1 1             E1BE98 Uncharacterized protein GN=XPO1 0.75 1 1             F1MWN4 Uncharacterized protein GN=SFI1 0.64 2 1             E1BKT9 Uncharacterized protein GN=DSP 0.62 3 2 2.031           F1MX60 Uncharacterized protein  0.55 7 1             F1MEW3 Microtubule-associated protein  0.49 1 1           1.072  114  Accession Description ΣCoverage Σ# PSMs Σ# Peptides M/L Ratios      Replicate 1 Replicate 2 Replicate 3      Mem Sol Mem Sol Mem Sol Q9TU23-2 Isoform 2 of Centrosomal protein of 290 kDa  0.45 1 1             E1BDX8 Uncharacterized protein GN=DYNC1H1  0.45 3 2             E1BGK1 Uncharacterized protein GN=ARID4A  0.40 1 1 2.884                                     115  Table A.3 Count and variability of medium/light ratios for the proteins listed in Table A.2  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] Hippocalcin-like protein 1  11 21.7 5 28.1 24 20.4 9 233.1 3 37.6 7 32.6 Fructose-bisphosphate aldolase C 1   5 29.6 5 12.8 12 57.7 9 34.1 17 32.8 Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex, mitochondrial  18 18.9 0 0.0 19 39.4 0 0.0 8 122.5 1   Pyruvate dehydrogenase E1 component subunit beta, mitochondrial  9 31.6 1   26 50.7 1   7 37.9 0 0.0 Redox-regulatory protein FAM213A  0 0.0 0 0.0 7 47.6 0 0.0 5 87.0 0 0.0 Tubulin alpha-1B chain  2 42.3 22 23.4 12 34.8 14 65.4 3 101.7 6 46.2 Uncharacterized protein (TUBA1A) 2 42.3 22 23.4 11 27.6 14 65.4 3 101.7 6 46.2 Hemoglobin subunit beta 0 0.0 4 18.3 0 0.0 0   0 0.0 0 0.0 Fructose-bisphosphate aldolase A 0   2 36.6 4 12.4 10 96.9 5 46.4 12 33.2 Tubulin beta-5 chain  2 27.1 13 29.0 12 13.9 8 1025.0 7 59.5 12 17.8 Tubulin beta-4B chain  3 6.5 15 36.8 10 63.8 12 257.6 7 55.8 12 13.2 Tubulin beta-2B chain  1   18 35.4 12 28.2 6 529.1 7 48.1 15 23.0 Tubulin beta-2B chain  1   18 35.4 12 28.2 6 529.1 7 34.0 14 21.8 Polyubiquitin-C  1   2 20.9 0 0.0 0 0.0 0 0.0 0 0.0 Pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial  17 23.7 0 0.0 20 52.5 0 0.0 5 35.0 0 0.0 Tubulin beta-3 chain  3 17.0 16 25.1 9 71.0 8 1565.4 6 46.7 12 16.0 Heat shock protein beta-1  0 0.0 1   0 0.0 1   0 0.0 3 41.8 Tubulin beta-4A chain  3 6.5 11 35.0 7 23.0 9 1243.0 4 28.1 7 8.5 2-oxoglutarate dehydrogenase, mitochondrial  17 28.7 2 71476.5 17 38.0 0 0.0 12 49.9 2 8.3  116  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] Tubulin alpha-4A chain  2 127.4 17 29.6 7 10.2 8 129.7 1   6 168.9 MGC165862 protein  0 0.0 0 0.0 0   0 0.0 0 0.0 0 0.0 28S ribosomal protein S36, mitochondrial  2 71.2 0 0.0 1   0 0.0 0 0.0 0 0.0 Guanine nucleotide-binding protein G(t) subunit alpha-1  3 47.8 8 37.0 4 39.1 2 30.7 3 70.8 3 11.6 Uncharacterized protein (Fragment) (MSI1) 0 0.0 0   0 0.0 2 26.8 0 0.0 1   Actin, cytoplasmic 1 1   5 31.8 0   3 63.4 2 7.5 3 17.9 Translocase of outer mitochondrial membrane 70  3 9.0 0 0.0 10 38.9 0 0.0 11 24.5 0 0.0 Heat shock cognate 71 kDa protein  0 0.0 8 31.5 1   5 149.4 4 24.8 11 32.0 Recoverin  0   2 59.6 0   0 0.0 0 0.0 1   Uncharacterized protein (Fragment)  1   9 38.2 4 8.2 4 30.5 1   5 20.5 Poly(rC)-binding protein 1  0 0.0 9 25.5 0 0.0 1   0 0.0 5 8.4 Isoform Short of 14-3-3 protein beta/alpha  0 0.0 1   0 0.0 2 543.9 1   5 7.9 14-3-3 protein theta  0 0.0 1   0 0.0 1   1   4 25.9 TOR1A protein  0 0.0 0 0.0 5 127.6 1   2 112.4 1   Bovine serum albumin precursor 0   1   0 0.0 2 137.6 0   3 21.2 Uncharacterized protein (LOC100335467) 1   0 0.0 0   0 0.0 1   0 0.0 Pyruvate dehydrogenase protein X component  8 44.6 0 0.0 9 24.0 0 0.0 9 20.3 0 0.0 Alpha-enolase 0 0.0 6 18.3 2 53.6 2 34.9 0 0.0 0 0.0 Uncharacterized protein (VAT1)  0 0.0 0   0   0   2 44.3 4 14.0 Cyclin-dependent kinase 4 inhibitor D  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 2 728.3 Dihydrolipoyl dehydrogenase  8 12.0 1   8 71.8 0 0.0 4 29.8 0 0.0  117  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] Dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  4 14.2 1   16 30.5 0 0.0 4 126.4 0 0.0 14-3-3 protein zeta/delta  0 0.0 1   0 0.0 1   2 44.0 4 57.7 MOSC domain-containing protein 2, mitochondrial  2 83.5 0 0.0 3 30.5 0 0.0 1   0 0.0 60 kDa heat shock protein, mitochondrial  1   2 22.7 5 12.1 0 0.0 4 15.9 4 25.3 Poly(RC) binding protein 3  0 0.0 3 76.0 0 0.0 0 0.0 0 0.0 3 6.7 Cytochrome c oxidase assembly protein 3 homolog, mitochondrial  1   0 0.0 2 22.1 0 0.0 0 0.0 0 0.0 Uncharacterized protein (TARDBP) 0 0.0 0   0 0.0 7 269.0 3 61.7 10 20.9 Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 0 0.0 8 26.2 0   1   0 0.0 1   Neurocalcin-delta  0 0.0 0 0.0 1   0   0 0.0 1   Uncharacterized protein (PDK1)  0 0.0 0 0.0 2 63.5 0 0.0 3 32.3 0 0.0 14-3-3 protein eta  0 0.0 1   0 0.0 2 13.5 1   3 0.9 ATP synthase subunit alpha  4 5.1 2 7.0 7 19.2 0 0.0 1   2 13.4 14-3-3 protein gamma  0 0.0 1   0 0.0 2 11.6 1   3 14.3 Tubulin alpha-8 chain  1   15 22.0 3 4.5 4 143.6 1   2 2507.7 Glyceraldehyde-3-phosphate dehydrogenase 0   2 32.5 2 4.3 1   2 95.6 3 13.1 5'-nucleotidase, cytosolic III  0   0 0.0 1   0 0.0 2 8.3 3 68.5 Mitochondrial fission 1 protein  0 0.0 1   0   1   1   3 53.1 Nucleoside diphosphate kinase B  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Tripartite motif-containing 32  0 0.0 0   0   1   3 92.2 3 0.1 L-lactate dehydrogenase B chain 0 0.0 1   0   2 94.4 0 0.0 4 5.1 Uncharacterized protein (Fragment) (NOVA2)  0 0.0 2 21.1 1   3 57.4 0 0.0 3 2.9  118  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] T-complex protein 1 subunit gamma  0 0.0 4 20.6 0 0.0 1   0 0.0 2 32.2 Retinol dehydrogenase 13 (All-trans/9-cis)  0 0.0 0 0.0 0 0.0 0 0.0 4 24.2 2 14.7 Peroxiredoxin-1  0 0.0 2 28.1 0 0.0 0 0.0 0 0.0 1   Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial  0 0.0 0   0 0.0 1   0 0.0 1   ADP/ATP translocase 3  1   0 0.0 3 29.0 0 0.0 2 35.2 0 0.0 Guanine nucleotide-binding protein G(o) subunit alpha 2 52.3 2 19.5 1   1   2 29.2 3 8.8 ATP synthase subunit beta, mitochondrial  2 13.4 0 0.0 2 3.4 0 0.0 2 29.1 0 0.0 Histone H2B  0   1   0 0.0 0 0.0 0 0.0 0 0.0 Ganglioside-induced differentiation-associated protein 1  0   0 0.0 1   0 0.0 3 0.8 0 0.0 S-arrestin  0 0.0 5 13.0 0 0.0 0 0.0 0 0.0 0 0.0 Pyruvate kinase  0 0.0 0   1   3 169.1 0 0.0 3 2.5 Poly(rC)-binding protein 4  0 0.0 2 68.0 0 0.0 1   0 0.0 0 0.0 Uncharacterized protein (FKBP8)  0   0 0.0 1   0 0.0 2 0.0 0 0.0 Cell cycle exit and neuronal differentiation 1  0 0.0 0 0.0 0 0.0 0 0.0 1   1   Heat shock 70 kDa protein 1B  0 0.0 4 59.4 1   4 62.5 2 4.8 5 26.8 Mitochondrial glutamate carrier 1  1   0 0.0 3 13.1 0 0.0 0 0.0 0 0.0 D-3-phosphoglycerate dehydrogenase  0 0.0 3 20.0 0 0.0 0 0.0 0 0.0 3 9.9 Cytochrome c oxidase subunit 4 isoform 1, mitochondrial  0 0.0 0 0.0 1   0 0.0 0 0.0 0 0.0 NADH-cytochrome b5 reductase 3  0   0 0.0 3 14.6 0 0.0 5 8.8 0 0.0 14-3-3 protein epsilon 0 0.0 1   1   1   1   2 25.7 Glial fibrillary acidic protein  0 0.0 1   0 0.0 5 66.2 0 0.0 1    119  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] Uncharacterized protein (EPB41L3)  0 0.0 2 112.7 0 0.0 3 164.8 0 0.0 9 20.0 Dihydropyrimidinase-related protein 2 0 0.0 2 2.7 0 0.0 0   0 0.0 3 26.9 Uncharacterized protein (OGDHL)  11 10.4 2 71476.5 6 49.3 0 0.0 5 37.8 1   ADP/ATP translocase 1  3 12.7 0 0.0 2 41.3 0 0.0 3 8.2 0 0.0 ADP/ATP translocase 2 3 12.7 0 0.0 3 66.0 0 0.0 2 6.0 0 0.0 Uncharacterized protein  0 0.0 0 0.0 0 0.0 3 128.4 0 0.0 4 51.3 Uncharacterized protein (AIFM1)  0 0.0 0 0.0 2 12.7 0 0.0 5 22.1 0 0.0 Gamma-synuclein 0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Keratin, type II cytoskeletal 5  1   2 6.6 3 16.3 2 473.5 2 7.8 1   Retinaldehyde-binding protein 1  0 0.0 3 13.6 0 0.0 0 0.0 0 0.0 2 7.8 Thioredoxin-like protein AAED1  0 0.0 0 0.0 0 0.0 0   0 0.0 3 21.5 Triosephosphate isomerase  0 0.0 0 0.0 0 0.0 1   1   2 11.4 Uncharacterized protein (Fragment) (ZNF385A)  0 0.0 0   0 0.0 0   0 0.0 3 4.4 Uncharacterized protein (PLCH2) 0   0 0.0 1   4 87.5 5 45.5 5 19.8 Beta-synuclein  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Heat shock protein HSP 90-alpha 0 0.0 4 22.5 0 0.0 1   0 0.0 2 10.3 PDK3 protein  2 163.1 0 0.0 2 76.9 0 0.0 2 77.7 0 0.0 ADP-dependent glucokinase  0   0 0.0 2 12.2 0 0.0 2 240.4 0 0.0 Vimentin  0 0.0 0   0 0.0 2 22.9 0 0.0 0 0.0 V-type proton ATPase subunit B, brain isoform  0 0.0 2 0.7 0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (SQSTM1)  0 0.0 0   0 0.0 0 0.0 0 0.0 2 11.5 Uncharacterized protein (C18H16orf70)  0 0.0 0   0 0.0 0 0.0 0 0.0 1   Heat shock protein HSP 90-beta  0 0.0 2 30.8 0 0.0 0   0 0.0 2 33.5  120  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 7  0 0.0 0 0.0 1   0 0.0 0 0.0 0 0.0 Protein-L-isoaspartate(D-aspartate) O-methyltransferase 0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 2 5.8 Uncharacterized protein (MGLL)  0   0 0.0 3 31.2 0 0.0 0 0.0 0 0.0 Uncharacterized protein  0 0.0 1   2 5.8 2 3.3 3 53.8 1   Uncharacterized protein (PURB) 0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 2 22.5 ATP-dependent (S)-NAD(P)H-hydrate dehydratase  0   0 0.0 0 0.0 0 0.0 1   0 0.0 CDGSH iron-sulfur domain-containing protein 1  0 0.0 0 0.0 1   0 0.0 0 0.0 0 0.0 63 kDa protein 5 36.3 3 13.7 3 0.3 5 124.1 6 22.9 6 24.9 Heme oxygenase (Decycling) 2  0 0.0 0 0.0 0 0.0 0 0.0 0   0 0.0 Elongation factor 1-alpha  0 0.0 3 45.7 2 44.9 0   0 0.0 1   ATP synthase F(0) complex subunit B1, mitochondrial  0 0.0 0 0.0 1   0 0.0 2 2.0 0 0.0 BCL2-like 1 0 0.0 0 0.0 0 0.0 1   0 0.0 0 0.0 Uncharacterized protein (SEC22B)  0 0.0 0 0.0 0 0.0 0 0.0 2 0.3 0 0.0 60S ribosomal protein L11 0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Sideroflexin-1 0   0 0.0 0   0 0.0 1   0 0.0 Uncharacterized protein (LOC100847119)  0 0.0 0 0.0 0 0.0 0 0.0 1   1   Uncharacterized protein (C7H19orf70)  0 0.0 0 0.0 1   0 0.0 0 0.0 0 0.0 Uncharacterized protein  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Calmegin  0 0.0 0 0.0 1   0 0.0 3 29.7 0 0.0 Uncharacterized protein (NSF) 0 0.0 5 51.3 0 0.0 0 0.0 0 0.0 3 2.5 Uncharacterized protein (PLA2G16) 0 0.0 0 0.0 0 0.0 0 0.0 1   0   Serpin H1  0   0 0.0 1   0 0.0 2 120.5 1    121  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] Uncharacterized protein (Fragment) (KRT3)  2 20.4 1   2 57.9 3 76.4 1   3 16.5 Chromosome 6 open reading frame 35 ortholog  0   0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (LOC100300167)  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Retinol dehydrogenase 14 (All-trans/9-cis/11-cis)  0 0.0 0 0.0 0   0 0.0 1   0 0.0 Nuclease-sensitive element-binding protein 1  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   KRT15 protein  1   3 33.4 1   2 135.4 0 0.0 3 2.5 Uncharacterized protein (Fragment) (LOC100850482)  0   0 0.0 0   0 0.0 0 0.0 0 0.0 Aldehyde dehydrogenase 18 family, member A1 0 0.0 0 0.0 0 0.0 0   0 0.0 4 213.6 Uncharacterized protein  0 0.0 0 0.0 0   0 0.0 0 0.0 0 0.0 Synaptojanin-2-binding protein  0 0.0 0 0.0 0   0 0.0 0 0.0 0 0.0 Clathrin heavy chain (Fragment)  0 0.0 0 0.0 4 52.4 2 102.5 1   5 94.2 Creatine kinase B-type 0 0.0 0 0.0 1   0 0.0 0 0.0 1   Hippocalcin-like protein 4 0 0.0 0 0.0 0 0.0 0   0 0.0 0 0.0 Uncharacterized protein (KRT2)  2 22.8 3 36.1 2 64.8 4 207.1 4 15.3 4 9.6 Uncharacterized protein (PRPS2)  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Keratin, type II cytoskeletal 79  1   0 0.0 2 30.8 1   0   0   cAMP-dependent protein kinase type II-beta regulatory subunit  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Ubiquitin-conjugating enzyme E2 N  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (BHLHE41) 0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 2 17635.1 RAB1A, member RAS oncogene family  0 0.0 1   0 0.0 0   0 0.0 0 0.0 Hemoglobin subunit alpha 0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0  122  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] Alpha-crystallin B chain  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (KRT34)  0   0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 ARF5 protein  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 40S ribosomal protein S12 (Fragment) 0 0.0 1   0 0.0 0   0 0.0 0 0.0 Aspartate aminotransferase, mitochondrial 1   1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (CYB5D2)  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Ras-related protein Rap-1b  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Dynamin-1  0 0.0 4 84.5 0 0.0 0 0.0 0 0.0 0 0.0 Phosphatidylethanolamine-binding protein 1  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Uncharacterized protein (Fragment) (DYNC1LI2)  0 0.0 1   0 0.0 0 0.0 0 0.0 1   Uncharacterized protein (EPB41L2)  0 0.0 2 65.7 0 0.0 2 1228.6 0 0.0 3 28.4 Uncharacterized protein (PLEKHB1)  0 0.0 0 0.0 0 0.0 0   0 0.0 0 0.0 Histone H1.2  0 0.0 0 0.0 0 0.0 0   0 0.0 0 0.0 Family with sequence similarity 96, member A  0 0.0 0 0.0 0 0.0 0   0 0.0 0 0.0 Glutathione S-transferase Mu 1  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Uncharacterized protein (H1FX) 0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 60S ribosomal protein  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Stress-70 protein, mitochondrial  1   1   0 0.0 0 0.0 2 7.6 1   Probable cytosolic iron-sulfur protein assembly protein CIAO1  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 2 20.7 SNX12 protein  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Reticulon  0 0.0 1   2 19.0 1   0 0.0 1   Mitochondrial Rho GTPase 2  0   0 0.0 0 0.0 0 0.0 1   0 0.0  123  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] Uncharacterized protein (Fragment) (HSPA12A) 0 0.0 0   0 0.0 0 0.0 0 0.0 2 1.6 Uncharacterized protein 0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (GN=ILF2)  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (GN=BCL2L13)  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 0   26S protease regulatory subunit 7  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (GN=TBX2) 0 0.0 0 0.0 0 0.0 0   0 0.0 3 48.9 Bcl-2-like protein 2  0 0.0 0 0.0 0 0.0 0   0 0.0 0 0.0 Aspartyl/asparaginyl beta-hydroxylase  0 0.0 0 0.0 0 0.0 0 0.0 3 6.3 0 0.0 Torsin-1A-interacting protein 1  0 0.0 0 0.0 0 0.0 0 0.0 4 14.5 0 0.0 6-phosphofructokinase, liver type 0 0.0 0 0.0 0 0.0 1   0 0.0 2 50.0 Ras-related protein Rab-5A  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Mitochondrial 2-oxoglutarate/malate carrier protein  0 0.0 0 0.0 0 0.0 0 0.0 0   0 0.0 Uncharacterized protein (Fragment) (GN=MOGS)  0   0 0.0 0 0.0 0 0.0 2 77.3 0 0.0 Isoform Tau-H of Microtubule-associated protein tau  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Uncharacterized protein (Fragment) (ATP1A3)  0   0 0.0 4 16.6 0 0.0 1   0 0.0 Uncharacterized protein  0 0.0 2 258.8 0 0.0 1   0 0.0 0 0.0 Glutamine synthetase  0 0.0 0 0.0 0 0.0 0   0 0.0 0 0.0 Reticulon  0 0.0 0 0.0 0 0.0 1   0 0.0 0 0.0 Calcium/calmodulin-dependent protein kinase II delta  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 2 2.1 Inosine-5'-monophosphate dehydrogenase 1 0 0.0 1   0 0.0 0   0 0.0 0 0.0 Uncharacterized protein (GN=EFNB3) 0 0.0 0 0.0 0 0.0 0 0.0 1   1    124  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] Uncharacterized protein (Fragment) (GN=UBE2J1)  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 Golgi to ER traffic protein 4 homolog  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 2 0.0 DPYSL3 protein  0 0.0 1   0 0.0 0 0.0 0 0.0 1   Uncharacterized protein (Fragment)  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Proteasome (Prosome, macropain) 26S subunit, non-ATPase, 14 0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Constitutive coactivator of PPAR-gamma-like protein 1 (Fragment)  0 0.0 0 0.0 0 0.0 0   0 0.0 3 71.1 Uncharacterized protein  0 0.0 2 26.7 0 0.0 0 0.0 0 0.0 0 0.0 Peroxiredoxin-2  0 0.0 1   0 0.0 0   0 0.0 1   Rhodopsin 0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 Retinol-binding protein 3  0 0.0 3 14.5 0 0.0 0 0.0 0 0.0 0 0.0 Voltage-dependent anion-selective channel protein 1  0 0.0 0 0.0 1   0 0.0 0 0.0 0 0.0 6-phosphofructokinase, muscle 0 0.0 2 11.9 0 0.0 0 0.0 0 0.0 1   Protein DJ-1  1   0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 Eukaryotic initiation factor 4A-II  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Prohibitin  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 6-phosphofructokinase  0 0.0 0   0 0.0 0 0.0 0 0.0 2 19.4 B-cell receptor-associated protein 31 0 0.0 0 0.0 1   0 0.0 1   0 0.0 Coiled-coil domain-containing protein 54 0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 0   Malate dehydrogenase, cytoplasmic  0 0.0 0 0.0 0 0.0 1   0 0.0 0 0.0 Uncharacterized protein (GN=IRF2BPL)  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 2 2.6 RPE-retinal G protein-coupled receptor  0 0.0 0 0.0 1   0 0.0 0 0.0 0 0.0  125  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] Voltage-dependent anion-selective channel protein 2 0 0.0 0 0.0 1   0 0.0 0 0.0 0 0.0 Ubiquitin carboxyl-terminal hydrolase isozyme L5  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Spliceosome RNA helicase DDX39B  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 V-type proton ATPase subunit H  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (Fragment) (GN=STX3) 0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 Uncharacterized protein (GN=UFSP2)  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 Interferon-inducible double-stranded RNA-dependent protein kinase activator A  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 CXXC-type zinc finger protein 5  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Uncharacterized protein (GN=RDH11)  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 Uncharacterized protein (GN=DPYS)  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 0   Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 60S ribosomal protein L7a  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Prohibitin-2 0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 60S ribosomal protein L3  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Ankyrin repeat and MYND domain-containing protein 2  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 cAMP-dependent protein kinase type I-alpha regulatory subunit  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   40S ribosomal protein S3  0 0.0 0 0.0 0   0 0.0 0 0.0 0 0.0 60S acidic ribosomal protein P0  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (GN=DHTKD1)  0 0.0 0 0.0 0   0 0.0 1   0 0.0 Uncharacterized protein (GN=PURA)  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Adenosylhomocysteinase  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1    126  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] Isoform B of Phosphate carrier protein, mitochondrial  0 0.0 0 0.0 1   0 0.0 0 0.0 0 0.0 Uncharacterized protein (GN=UBQLN1)  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Protein NDRG3  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (Fragment) (GN=CADPS) 0 0.0 1   0 0.0 0   0 0.0 1   Uncharacterized protein (GN=PSMC3)  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Uncharacterized protein (GN=RUFY3)  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 T-complex protein 1 subunit delta  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 cAMP-dependent protein kinase catalytic subunit alpha  0 0.0 2 12.0 0 0.0 0 0.0 0 0.0 0 0.0 Paraoxonase 3  0 0.0 0 0.0 0   0 0.0 0 0.0 0 0.0 LANCL2 protein  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Isoform 4 of Microtubule-associated protein 4  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 2 4.6 RNA binding motif protein 4B  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   V-type proton ATPase catalytic subunit A 0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Uncharacterized protein (GN=WWOX)  0 0.0 0 0.0 1   0 0.0 0 0.0 0 0.0 Creatine kinase U-type, mitochondrial 1   1   2 15.6 0   0 0.0 0 0.0 Uncharacterized protein (GN=AP3M2)  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (GN=EXD2)  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 Mitochondrial Rho GTPase 0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 SYT5 protein  0 0.0 0 0.0 0   0 0.0 0 0.0 0 0.0 Arrestin-C  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Serine/threonine-protein kinase NLK  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Keratin, type II cytoskeletal 78  0   0 0.0 0 0.0 0 0.0 0 0.0 0 0.0  127  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] SLC3A2 protein  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 Uncharacterized protein GN=GMEB2  0 0.0 1   0 0.0 0   0 0.0 0 0.0 Elongation factor Tu, mitochondrial  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 Aspartate--tRNA ligase, cytoplasmic  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=MAP1B  0 0.0 1   1   0   0 0.0 5 43.3 Syntaxin-binding protein 1  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   AGK protein  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 60S ribosomal protein L4  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Synaptotagmin-1  0 0.0 0 0.0 1   0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=KRT18  2 27.1 1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=ARNTL 0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   T-complex protein 1 subunit theta  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 T-complex protein 1 subunit alpha  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 0   Uncharacterized protein GN=POU2F1  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Vesicular glutamate transporter 1 0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Heterogeneous nuclear ribonucleoprotein K  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Alpha isoform of regulatory subunit A, protein phosphatase 2  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Uncharacterized protein (Fragment) GN=LOC523963  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   EML3 protein  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   SLC25A12 protein  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 NADPH--cytochrome P450 reductase  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 Uncharacterized protein GN=SURF1  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 Synaptic vesicle glycoprotein 2A  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1    128  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] Polyadenylate-binding protein 1  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 UBAP2L protein  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=TRIP11  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Pre-B-cell leukemia transcription factor-interacting protein 1  0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 Uncharacterized protein GN=NKX6-1  0 0.0 0 0.0 1   0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=EXOG  0   0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 ATPase family AAA domain-containing protein 3  0   0   0 0.0 0 0.0 0 0.0 0 0.0 26S proteasome non-ATPase regulatory subunit 12  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (GN=BCAS3)  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Active breakpoint cluster region-related protein  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   ATP-dependent RNA helicase DDX1  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=CCT5 0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein (Fragment) GN=ADAM11 0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Uncharacterized protein (Fragment) GN=HNRNPU  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Uncharacterized protein GN=NOMO2  0 0.0 0 0.0 0 0.0 0 0.0 2 11.7 0 0.0 Uncharacterized protein GN=HNRNPM 0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Metal-regulatory transcription factor 1  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Uncharacterized protein (Fragment)  0   0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 ADAM23 protein  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Neural cell adhesion molecule 1 (Fragment)  0 0.0 0 0.0 1   0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=FAM134C  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0  129  Description Replicate 1 Replicate 2 Replicate 3  Mem Sol Mem Sol Mem Sol  M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] M/L Count M/L Varia bility [%] M/L Count M/L Variability [%] M/L Count M/L Variability [%] Uncharacterized protein  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=ZW10 0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Coatomer subunit gamma-1  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=THRAP3  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Uncharacterized protein GN=WFS1 0 0.0 0 0.0 0 0.0 0 0.0 1   0 0.0 Uncharacterized protein (Fragment) GN=ZFR  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Uncharacterized protein (Fragment) GN=CCDC170  1   0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein  0 0.0 1   0 0.0 0 0.0 0 0.0 0 0.0 ABCB6 protein  0 0.0 0   0   0   0 0.0 0 0.0 PSMD1 protein  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 0   Uncharacterized protein (Fragment) GN=CCDC171  0   0 0.0 0   0 0.0 0   0 0.0 Uncharacterized protein GN=CHD7  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 2 233092635.7 Lon protease homolog, mitochondrial  0   0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=XPO1 0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=SFI1 0 0.0 0   0   0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=DSP 1   0   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein  0   0 0.0 0   0 0.0 0   0 0.0 Microtubule-associated protein  0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 1   Isoform 2 of Centrosomal protein of 290 kDa  0   0 0.0 0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=DYNC1H1  0 0.0 0   0 0.0 0 0.0 0 0.0 0 0.0 Uncharacterized protein GN=ARID4A  1   0 0.0 0 0.0 0 0.0 0 0.0 0 0.0  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0166605/manifest

Comment

Related Items