Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Studies of Rhodobacter capsulatus gene transfer agent recipient capability regulated by quorum-sensing… Brimacombe, Cedric 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2015_september_brimacombe_cedric.pdf [ 7.24MB ]
Metadata
JSON: 24-1.0166531.json
JSON-LD: 24-1.0166531-ld.json
RDF/XML (Pretty): 24-1.0166531-rdf.xml
RDF/JSON: 24-1.0166531-rdf.json
Turtle: 24-1.0166531-turtle.txt
N-Triples: 24-1.0166531-rdf-ntriples.txt
Original Record: 24-1.0166531-source.json
Full Text
24-1.0166531-fulltext.txt
Citation
24-1.0166531.ris

Full Text

Studies of Rhodobacter capsulatus gene transfer agent recipient capability regulated by quorum-sensing and the CtrA response regulator by  Cedric Brimacombe  B.Sc., Queens University 2010  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  Doctor of Philosophy in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES  (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August 2015  © Cedric Brimacombe, 2015 ii  Abstract Gene transfer agents (GTAs) are agents of genetic exchange that resemble small tailed DNA bacteriophages and transfer random segments of the producing cell‟s genome to recipient cells. The canonical GTA is produced by the α-proteobacterium Rhodobacter capsulatus, hereafter referred to as RcGTA. The RcGTA packages ~4 kb segments of genomic DNA, and is produced and released by the lysis of a sub-population of donor cells in the stationary phase of growth. The primary structural gene cluster is a ~ 15 kb genomic region. Production and release of RcGTA is regulated by several host systems, including the GtaI quorum-sensing system, and the CckA/ChpT/CtrA putative phosphorelay system. Prior to this work, studies on RcGTA focused primarily on aspects involved in the production of RcGTA particles, such as gene regulation, DNA packaging, and biological functionality. However essentially nothing was known about how RcGTA delivers DNA to recipient cells. Herein, several key aspects of the capability of a cell to receive an RcGTA carried genetic marker, defined as RcGTA recipient capability, are delineated. Initial studies on the GtaR/I quorum-sensing system showed that gtaR/I are co-transcribed, and indirectly regulate not only transcription of the RcGTA gene cluster, but also RcGTA recipient capability. Part of this quorum-sensing effect was attributed to regulation of capsular polysaccharide production, which was determined to be involved in RcGTA adsorption to cells.  Additionally, it was found that CtrA is essential for, and a regulator of several genes required for RcGTA recipient capability. CtrA was found to regulate a set of natural competence genes involved in DNA entry into the cell and in RecA-mediated homologous recombination. These genes, DprA, ComM, ComEC, and ComF, are all iii  essential for RcGTA recipient capability, and analyses of the encoded proteins were used to propose a pathway for acquisition of RcGTA-borne DNA. These findings indicate that the RcGTA horizontal gene transfer mechanism is a combination of two fundamentally different horizontal gene transfer (HGT) mechanisms, transduction and transformation, generating a very efficient mode of HGT.    iv  Preface During my tenure as a graduate student in Dr. Beatty‟s lab, I had the privilege of working with many excellent peers in a quality research environment. The large majority of the research presented in this thesis was designed and performed by myself, with the invaluable input of my supervisor, Dr. Beatty. I was also given very useful advice from my co-workers Dr. Paul Fogg, Dr. Hao Ding, Alexander Westbye, and Jeanette Beatty. Specific instances where procedures were not fully carried out by me include the construction of the ΔcomEC mutant, done by Jeanette Beatty, the FACS analysis of the dprA and ctrA promoter fusions, done by Dr. Hao Ding, the generous access to the ΔgtaI mutant microarray data, provided by Dr. Andrew Lang and Dr. Ryan Mercer, and the mass spectrometry analysis of the RcDprA protein, done by the UBC proteomics core facility. I am indebted to all those mentioned above, in addition to others not specifically mentioned. Additionally, all data analysis was done by me, and reviewed by Dr. Beatty and other co-authors on publications encompassing the data presented in this thesis.  The majority of the research presented in this thesis has been published, and so I am also indebted to the editors of Molecular Microbiology, and to the anonymous peer reviewers who gave me very useful and productive feedback during the review process. Because there are multiple publications, the relative contributions of each author, and the placement of data within each chapter will be presented in terms of each individual paper in the chronological order in which they were published. All articles were published in the journal Molecular Microbiology. Any material used from publications in this thesis has been done so with explicit permission.  v  Text from sections 3.1.1, 3.1.2, 3.1.3, 3.1.4, 4.1.1, 4.1.2, and Figures 3-1, 3-2, 3-3, 3-4, and 3-5 has been published in Leung, M. M., C. A. Brimacombe, G. B. Spiegelman & J. T. Beatty (2012) The GtaR protein negatively regulates transcription of the gtaRI operon and modulates gene transfer agent (RcGTA) expression in Rhodobacter capsulatus. Mol. Microbiol. 83: 759-774. The data I generated for the manuscript, which is presented in this thesis, includes showing that the gtaRI genes are co-transcribed (Fig 3-1), that the gtaRI system regulates RcGTA production (Fig 3-2), and that RcGTA production is stimulated by multiple N-acyl-homoserine lactones (Fig 3-3 and 3-4). I also performed the control experiment evaluating long-chain acyl-HSL stimulation of RcGTA production in the ΔgtaRI strain (Fig 3-5) during the publishing process after the departure of Dr. M. Leung.  Dr. M. Leung performed all other experiments in this publication, none of which are presented in this thesis. Each co-first author wrote the introduction, results, and discussion sections relevant to their own contributions, which were subsequently merged into a single publication; editing and critical evaluation was done by all co-authors. Experimental design was the work of Drs. J. T. Beatty, M. M. Leung, G. B. Spiegelman, and I.  Text from sections 3.2.1, 3.2.2, 3.2.3, 3.2.4, 3.2.6, 3.2.7, 3.2.9, 4.2, 4.2.1, 4.2.2, 4.2.3, and 4.2.4, and Figures 3-7, 3-8, 3-9, 3-10, 3-11, 3-14, 3-15, 3-16, 3-17, and 3-19, and Table 3-1 and 3-2 has been published in Brimacombe, C. A., A. Stevens, D. Jun, R. Mercer, A. S. Lang & J. T. Beatty (2013) Quorum-sensing regulation of a capsular polysaccharide receptor for the Rhodobacter capsulatus gene transfer agent (RcGTA). Mol. Microbiol. 87: 802-817. In this work, I designed and performed all key experiments presented in the paper and in this thesis. The ΔgtaI microarray data in Table 3-1 was vi  generated by Dr. Ryan Mercer during his tenure in in Dr. Andrew Lang‟s lab at Memorial University. The second author, Aarons Stevens, an undergraduate student whom I mentored, generated the ΔgtaI/Δ1081 double mutant strain presented in Figures 3-15, 3-16, and 3-17, and repeated many key experiments for me. Experimental design and manuscript preparation was done by Dr. J. T. Beatty, and I, and critical evaluation and editing of the manuscript was done by Drs. J. T. Beatty, A. S. Lang, and R. G. Mercer and I. Lastly, D. Jun generated the suicide plasmid pZDJ, and contributed text describing its construction and a map of the plasmid.    Text from sections 3.3.1, 3.3.2, 3.3.3, 3.3.4, 3.3.5, 3.3.6, 3.3.7, 3.3.8, 4.3.1, 4.3.2, 4.3.3, 4.3.4, 4.3.5, and 4.3.6, Figures 3-20, 3-21, 3-22, 3-23, 3-25, 3-26, 3-27, 3-28, 3-29, 3-30, 3-31, and 3-32, Tables 3-4, and 3-5, and Appendix B, are published in Brimacombe, C. A., H. Ding & J. T. Beatty (2014) Rhodobacter capsulatus DprA is essential for RecA-mediated gene transfer agent (RcGTA) recipient capability regulated by quorum-sensing and the CtrA response regulator. Mol. Microbiol. 92: 1260-1278. I designed and performed all key experiments in this paper which are presented in this thesis, with the exception of the construction of the dprA::mCherry promoter fusion construction and FACS analyses, which was done by Dr. H. Ding, and is presented in the paper and in this thesis in Figure 3-32. Drs. J. T. Beatty, H. Ding, and I wrote and edited the manuscript. For data for a final publication in preparation describing the involvement of comEC, comF, and comM homologues in RcGTA recipient capability, and the population-level expression of ctrA, I generated the ΔcomF and ΔcomM knockout strains, and perfomed all experiments with the exception of FACS analysis of ctrA expression (Fig 3-32), which vii  was done by Dr. H. Ding. Additionally, Jeanette Beatty generated the ΔcomEC mutant strain, the construction of which is described in section 2.4.  Lastly, Dr. H. Ding generated to strain SBpG which was used to evaluate the effect over-expression of gtaI on RcGTA-popluation level expression.  viii  Table of Contents Abstract .......................................................................................................................... ii Preface .......................................................................................................................... iv Table of Contents ....................................................................................................... viii List of Tables ............................................................................................................... xv List of Figures ............................................................................................................ xvi List of Symbols ........................................................................................................... xx List of Abbreviations .................................................................................................. xxi Acknowledgements .................................................................................................. xxiii Chapter 1: Introduction ................................................................................................. 1 1.1 Rhodobacter capsulatus ................................................................................... 1 1.2 Mechanisms of horizontal gene transfer and gene transfer agents ................... 2 1.2.1 Conjugation, transformation, and transduction .............................................. 3 1.3 Gene transfer agents, and the RcGTA .............................................................. 8 1.3.1 Regulation of RcGTA gene expression ....................................................... 11 1.3.1.1 Growth phase and population level expression .................................... 11 1.3.1.2 LuxR/I-like quorum-sensing .................................................................. 12 1.3.1.3 GtaR/I-based regulation of RcGTA production ..................................... 16 1.3.1.4 Two-component signal transduction systems ....................................... 16 1.3.1.5 Functionality of CckA-ChpT-CtrA Caulobacter crescentus ................... 18 1.3.1.6 Ccka-ChpT-CtrA functionality in R.capsulatus ..................................... 20 1.4 Goals of my research ...................................................................................... 21 Chapter 2: Materials and Methods ............................................................................. 23 ix  2.1 Bacterial strains and growth conditions ........................................................... 23 2.2 Recombinant DNA techniques and plasmids .................................................. 27 2.3 Construction of markerless mutant strains ...................................................... 32 2.4 Generation of ΔcomEC mutant strain ............................................................. 32 2.5 Complementation of mutant strains ................................................................ 33 2.6 Cloning and purification of 6His-RcDprA ......................................................... 35 2.7 β -galactosidase assays .................................................................................. 36 2.8 Fluorescence microscopy ............................................................................... 37 2.9 ATPase assay ................................................................................................. 42 2.10 Electrophoretic mobility shift assays (EMSA) .................................................. 42 2.11 Nuclease protection assays ............................................................................ 43 2.12 UV-sensitivity assays ...................................................................................... 43 2.13 Bioinformatic analyses and homology modeling ............................................. 44 2.14 RcGTA recipient capability assay ................................................................... 45 2.15 RcGTA adsorption assay ................................................................................ 46 2.16 Western blot .................................................................................................... 47 2.17 Phenol-sulfuric acid carbohydrate quantification ............................................. 47 2.18 Capsule stain .................................................................................................. 48 2.19 Expression analysis of WT and ΔgtaI mutant strains ...................................... 49 2.20 LPS silver stains ............................................................................................. 49 2.21 Surface polysaccharide extraction for inhibition of RcGTA binding ................. 50 2.22 RcGTA transduction assay ............................................................................. 50 2.23 RcGTA-borne DNA tracking assay ................................................................. 51 x  2.24 Plaque assays and phage spot assays ........................................................... 54 Chapter 3: Results....................................................................................................... 55 3.1 Quorum-sensing regulation of RcGTA production .......................................... 55 3.1.1 Co-transcription of gtaR and gtaI ................................................................. 55 3.1.2 Effects of mutations in gtaR and gtaI on RcGTA production ....................... 56 3.1.3 RcGTA production is stimulated by substances produced by other species 58 3.1.4 RcGTA production is stimulated by multiple, specific long-chain acyl-homoserine lactones .............................................................................................. 60 3.1.5 Overexpression of gtaI does not increase RcGTA production ..................... 64 3.2 Quorum-sensing regulation of a capsular polysaccharide receptor for the RcGTA ....................................................................................................................... 67 3.2.1 RcGTA recipient capability and adsorption capability are growth-phase dependent .............................................................................................................. 67 3.2.2 Effects of mutations in gtaR and gtaI on RcGTA recipient capability and attachment to cells ................................................................................................. 68 3.2.3 Analysis of extracellular polysaccharide (EPS) production in the gtaR and gtaI mutant strains .................................................................................................. 71 3.2.4 Microarray and bioinformatics identification of putative EPS biosynthesis genes  .................................................................................................................... 75 3.2.5 Evidence for horizontal gene transfer acquisition of rcc01085 (wzy) ........... 81 3.2.6 Analysis of capsule production and mutagenesis of rcc01081, rcc01085, and rcc01932 ................................................................................................................ 83 xi  3.2.7 RcGTA recipient capability of and RcGTA attachment to strains Δ1081, Δ1085, Δ1932, Δ1085, and 37b4 ........................................................................... 90 3.2.8 Inhibition of RcGTA adsorption by surface polysaccharide extract .............. 93 3.2.9 Mutagenesis of rcc01088 and rcc01823, orphan LuxR homologues in R. capsulatus .............................................................................................................. 95 3.3 A CtrA and GtaI-regulated natural competence-like system is required for import and recombination in RcGTA-borne DNA in recipient cells ............................ 97 3.3.1 RcGTA recipient capability requires CtrA .................................................... 97 3.3.2 Homologous recombination and RcGTA recipient capability ....................... 99 3.3.3 DprA is required in CtrA-dependent RcGTA recipient capability ............... 101 3.3.4 Bioinformatic analyses and predicted structure of RcDprA ....................... 108 3.3.5 RcDprA binds ssDNA and dsDNA independently of nt sequence, but with higher affinity for ssDNA ...................................................................................... 116 3.3.6 RcDprA protects dsDNA from endonuclease digestion ............................. 119 3.3.7 RcDprA increases RecAEc ATPase activity .............................................. 120 3.3.8 dprA and ctrA are expressed in the vast majority of cells within an R. capsulatus population .......................................................................................... 122 3.3.9 Bioinformatic analysis of comEC, comF, and comM ................................. 124 3.3.10  comEC, comF, and comM are required for RcGTA recipient capability .... 126 3.3.11  RcGTA-borne DNA build-up in the periplasmic fraction of ΔcomEC and ΔcomF mutants .................................................................................................... 129 3.3.12  Prevalence of ComEC and ComF in GTA-containing organisms ............. 130 xii  3.3.13 Sensitivity of WT, ΔgtaI, ΔctrA, and com gene mutants to infection by two uncharacterized phages ....................................................................................... 132 Chapter 4: Discussion .............................................................................................. 134 4.1 Quorum-sensing regulation of RcGTA production ........................................ 134 4.1.1 Co-transcription of gtaR and gtaI ............................................................... 135 4.1.2 GtaR negatively regulates RcGTA production and responds to multiple long-chain acyl-homoserine lactones ........................................................................... 136 4.1.3 Analysis of the orphan LuxR homologues rcc01088 and rcc01823 ........... 139 4.2 Quorum-sensing regulation of a capsular polysaccharide receptor for the gene transfer agent of R. capsulatus ................................................................................ 141 4.2.1 Growth phase and gtaRI regulation of RcGTA recipient capability and adsorption capability ............................................................................................ 142 4.2.2 GtaRI regulation of capsule biosynthesis .................................................. 143 4.2.3 Identification of capsule polysaccharide biosynthesis genes ..................... 143 4.2.4 Identification of capsule as a receptor for the RcGTA ............................... 146 4.3 A natural transformation-like system essential for RcGTA recipient capability is regulated by CtrA and quorum-sensing ................................................................... 149 4.3.1 CtrA induction of RcGTA recipient capability ............................................. 150 4.3.2 RecA involvement in RcGTA recipient capability ....................................... 151 4.3.3 Proposed functions of DprA ....................................................................... 152 4.3.4 Comparison to other dprA genes, in terms of regulation and function ....... 153 4.3.5 RcGTA-borne DNA entry and recombination into the genome of recipient cells   .................................................................................................................. 156 xiii  4.3.6 Population level regulation of ctrA and dprA.............................................. 160 4.3.7  Involvement of ctrA and comEC in phage infection .................................... 161 4.3.8 Overall model of the RcGTA HGT process ................................................ 163 Chapter 5: Conclusions and Future Directions ...................................................... 165 5.1 Conclusions .................................................................................................. 165 5.2 Future Directions ........................................................................................... 167 Bibliography .............................................................................................................. 172 Appendices ................................................................................................................ 185 Appendix A .............................................................................................................. 185 A.1 One-way ANOVA results for growth-phase evaluation of RcGTA recipient capability .............................................................................................................. 185 A.2 One-way ANOVA results for mutant evaluation of recipient capability ...... 186 A.3 One-way ANOVA results for mutant evaluation of RcGTA adsorption capability .............................................................................................................. 186 A.4 One-way ANOVA results for mutant evaluation of OM-associated carbohydrate quantification .................................................................................. 187 A.5 One-way ANOVA results for mutant evaluation of OM-associated polysaccharide RcGTA adsorption blocking assay .............................................. 188 A.6 One-way ANOVA results for RcGTA tracking assay qPCR data ............... 188 A.7 One-way ANOVA results for promoter::lacZ analyses ............................... 188 A.8 One-way ANOVA for RcGTA production experiments .............................. 189 Appendix B Full size MUSCLE MSA of DprA amino acid sequences ...................... 191 xiv  Appendix C Standard curves and raw data for RcGTA tracking assay qPCR assays................................................................................................................................. 194 C.1 Standard curves for Gm cassette and puhA qPCR primers ...................... 194 C.2 Raw data for RcGTA tracking assay qPCR analysis ................................. 194 Appendix D Evalulation of phage sensitivity of WT, ΔgtaI, ΔctrA, and com gene mutants .................................................................................................................... 196 D.1 Summary of sensitivity of all strains to two different phagesm, as measured by plaque assay ................................................................................................... 196 D.2 Phage spot assay of serial dilutions of Phage 1 stock on WT, ΔctrA, and ΔcomEC mutants. ................................................................................................ 196  xv  List of Tables Table 2-1. Bacterial strains used in this study, and a brief description of each. ............ 25 Table 2-2. Primers used in this study. ........................................................................... 27 Table 2-3. Plasmid backbones and subsequent constructs used in this study. ............. 38 Table 3-1. Relative transcription of putative EPS/CPS gene cluster and additional required genes as analyzed by microarray analysis.. .................................................... 78 Table 3-2. Bioinformatic analysis of putative EPS/CPS biosynthesis gene cluster and additional related genes. ............................................................................................... 79 Table 3-3. Summary of data obtained with the rcc01088 and rcc01823 mutant strains with respect to RcGTA and CPS production ............................................................... 103 Table 3-5. Annotation of candidate recipient capability genes, known homologues and their functions, and the % identity (%ID) and similarity (%Sim) to homologues. ......... 103 Table 3-6. Presence of ComEC and ComF homologues in other bacterial species that contain functional or putative GTAs, or are naturally competent. ................................ 131  xvi  List of Figures Figure 1-1. Comparison of DNA entry into recipient cells in natural competence systems and in non-contractile phages ......................................................................................... 7 Figure 1-2. Properties of gene transfer agents and the RcGTA .................................... 10 Figure 1-3. Population level expression of RcGTA ........................................................ 12 Figure 1-4. Schematic diagram of canonical LuxRI cognate quorum-sensing pair functionality ................................................................................................................... 15 Figure 1-5. Schematic depiction of two-component and hybrid two-component systems ...................................................................................................................................... 18 Figure 3-1. RT-PCR of the gtaRI bicistronic transcript .................................................. 56 Figure 3-2. Comparison of RcGTA gene expression in QS mutant strains of R. capsulatus ..................................................................................................................... 58 Figure 3-3. RcGTA production in R. capsulatus acyl-HSL synthase mutant strain ΔgtaI in response to the addition of cell-free media from stationary phase cultures ............... 60 Figure 3-4. Comparison of RcGTA gene expression in R. capsulatus WT B10, and the ΔgtaI mutant in the absence and presence of exogenous acyl-HSLs ........................... 63 Figure 3-5. Control experiment comparing RcGTA gene expression in R. capsulatus WT B10, ΔgtaI, and ΔgtaRI mutants in the absence and presence of three exogenously added long-chain acyl-HSLs, C12, C16, and C18 acyl-HSL ......................................... 64 Figure 3-6. Effect of fructose induction of gtaI on RcGTA population level expression . 66 Figure 3-7. Effect of growth phase on RcGTA recipient capability and adsorption ........ 68 Figure 3-8. Comparison of RcGTA recipient capability of QS mutant strains with their ability to adsorb RcGTA particles .................................................................................. 70 xvii  Figure 3-9. Effect of various enzymatic or chemical additives on R. capsulatus pellet formation ....................................................................................................................... 72 Figure 3-10. Evaluation of EPS production in R. capsulatus QS mutants ..................... 74 Figure 3-11. Comparison of rcc01081::lacZ fusion expression in R. capsulatus WT B10, ΔgtaI, ΔgtaR, ΔgtaRI, and ΔgtaI supplemented with C16-acyl-HSL .............................. 76 Figure 3-12. Schematic diagram of an archetypal type group four capsule biosynthesis system in Escherichia coli (Whitfield, 2006) .................................................................. 80 Figure 3-13. Schematic depiction of putative CPS biosynthesis genes and evidence for horizontal gene transfer acquisition of rcc01085 ........................................................... 82 Figure 3-14. Phase contrast microscopy and capsule stain images of WT B10 (WT), ΔgtaI, ΔgtaI + C16-acyl-HSL, ΔgtaR, ΔgtaRI R. capsulatus strains .............................. 84 Figure 3-15. Evaluation of EPS production in R. capsulatus EPS biosynthesis mutants. ...................................................................................................................................... 86 Figure 3-16. Phase contrast microscopy and capsule stain images of WT B10 (WT), ΔgtaI, ΔgtaI + C16-acyl-HSL, ΔgtaR, ΔgtaRI, Δ1081, Δ1081 [p1081], ΔgtaI/Δ1081, ΔgtaI/Δ1081+ C16-acyl-HSL, Δ1932, Δ1932[p1932], Δ1932/ Δ1081, Δ1085 and WT 37b4 R. capsulatus strains ............................................................................................ 89 Figure 3-17. Comparison of WT B10 (WT), Δ1081, Δ1081 [p1081], ΔgtaI Δ1081, ΔgtaI/ Δ1081 + C16-acyl-HSL, Δ1932, Δ1932[p1932], Δ1932/Δ1081, Δ1085 and 37b4 WT strains recipient capability and adsorbtion of RcGTA particles ...................................... 92 Figure 3-18. Representative LPS silver stain of WT, QS, and EPS mutants ................. 93 Figure 3-19. Inhibition of RcGTA adsorption by addition of cell surface extracts .......... 95 xviii  Figure 3-20. Comparison of the relative RcGTA recipient capability of the WT, ΔctrA mutant, and ΔctrA trans complemented strains ............................................................. 99 Figure 3-21. Involvement of homologous recombination in RcGTA recipient capability and associated control experiments ............................................................................ 101 Figure 3-22. Expression of dprA in ΔctrA and ΔgtaI mutants, in in different growth phases ......................................................................................................................... 105 Figure 3-23. Involvement of dprA in RcGTA recipient capability and associated control experiments ................................................................................................................. 108 Figure 3-24. Representative multiple sequence aligment of representative DprA proteins from R. capsulatus, R. palustris, and other naturally competent bacteria .................... 110 Figure 3-25. Bayesian MCMC phylogenetic tree of DprA proteins from a large scale multiple sequence alignment ....................................................................................... 111 Figure 3-26. Structural comparison of RcDprA to other proteins ................................. 114 Figure 3-27. Structural overlay of RcDprA DD3 and other proteins ............................. 116 Figure 3-28. DNA-binding capabilities of RcDprA ....................................................... 117 Figure 3-29. Comparison of dsDNA and ssDNA binding affinities of RcDprA ............. 119 Figure 3-30. RcDprA Endonuclease protection assays ............................................... 120 Figure 3-32. Expression of dprA::mCherry and ctrA::mCherry fusions in WT B10 cells in the stationary phase .................................................................................................... 124 Figure 3-33. RcGTA recipient capability of WT, ΔcomEC, ΔcomF and ΔcomM strains, and the trans complemented strains ΔcomEC(pComEC), ΔcomF(pComF) and ΔcomM(pComM), and relevant control experiments. .................................................. 128 xix  Figure 3-34. Relative residual RcGTA-borne DNA levels in the periplasm of WT, ΔcomEC, and ΔcomF strains, as measured by qPCR ................................................ 130 Figure 4-1.Schematic depiction of Lsr autoinducer 2 import and regulatory system ... 139 Figure 4-2. Possible DNA entry modes of RcGTA-borne DNA into recipient cells ...... 159  xx  List of Symbols Δ  delta µ  mu; micro β  beta α  alpha °  degrees λ  lambda Φ  phi  xxi  List of Abbreviations Amp     ampicillin ATP     adenosine triphosphate AI-2     autoinducer 2 bp     base pair BSA     bovine serum albumin cfu     colony forming unit Cm     chloramphenicol CM     cytoplasmic membrane CPS     capsular polysaccharide DNA     deoxyribose nucleic acid DMSO                        di-methyl sulfoxide dsDNA                       double stranded DNA EDTA     ethylenediaminetetraacetic acid EPS     extracelluar polysaccharide Gm     gentamycin GTA     gene transfer agent HpDprA    Helicobacter pylori DprA HiDprA    Haemophilus influenzae DprA HR     homologous recombination HSL     homoserine lactone ICE                             integrative conjugative element IPTG      isopropyl β-D-1-thiogalactopyranoside kb     kilo-basepairs Km     kanamycin LPS     lipopolysaccharide MUSCLE    multiple sequence comparison by log expectation nt     nucleotide OM     outer membrane ONPG    ortho-nitrophenyl- β-galactoside  xxii  PAGE     polyacrylamide gel electrophoresis PCR     polymerase chain reaction PG     peptidoglycan qPCR     quantitative polymerase chain reaction RcDprA    R. capsulatus DprA RcGTA    R. capsulatus gene transfer agent RF                              Rossman Fold Rif     rifampicin RNA     ribose nucleic acid rmsd                           root-mean-square deviation rpm     rotations per minute RR                             response regulator SAM                           sterile alpha motif SDS     sodium dodecyl-sulfate SK                              sensor kinase SpDprA    Streptococcus pneumoniae DprA SSB     single stranded binding protein ssDNA                       single stranded DNA Tc     tetracycline TMP     tape measure protein TMS                           transmembrane segment UV                              ultra violet  WT     wild type  xxiii   Acknowledgements I have many people to thank for making my graduate school experience such a success and pleasure.  First and foremost, I wish to thank Tom Beatty for his excellence as a PhD supervisor. His encouragement, enthusiasm, and general interest in the advancement in scientific understanding were invaluable in helping me become a better researcher and scientist. I would also like to thank my supervisory committee, Drs Rachel Fernandez, Erin Gaynor, and Michael Murphy for invaluable input into my project. Additional thanks go to Dr. Franck Duong for access to materials for ATPase assays and Michael Carlson for the generous use of this lab space. I also thank Ryan Mercer and Andrew Lang for access to unpublished results, and for useful comments in manuscript preparation.  Thanks also go to other members of the Beatty Lab, especially Jeanette Beatty, with whom I had many, many, conversations with in the mornings, and who made a critical knockout for me, Rafael Saer, with whom I experienced a lot of adventures throughout graduate school, and Alexander Westbye and Dr. Hao Ding for invaluable scientific input into my work.  Lastly, I am grateful to my family and friends for the support over the years, both financially and emotionally.    1  Chapter 1: Introduction 1.1 Rhodobacter capsulatus R. capsulatus is a purple non-sulfur photosynthetic α-proteobacterium commonly found in aquatic freshwater environments (Weaver et al., 1975). It possesses great metabolic diversity, and can grow under anaerobic photosynthetic conditions, aerobically, and lithotrophically (Weaver et al., 1975, Imhoff, 1995). This diversity in metabolism coupled with its ease of cultivation in laboratory conditions has led to the extensive use of R. capsulatus as a model organism for many different types of study.  One of the primary uses for R. capsulatus is in the area of photosynthesis research. R. capsulatus is useful for studying this process because mutation of photosynthesis genes is not lethal, as the organism is able to grow by aerobic respiration (Beatty & Gest, 1981). This allows for investigation into the function of specific photosynthesis genes by studying gene knockouts and other genetic analyses such as site-directed mutagenesis. Other interesting processes for which R. capsulatus has been studied include a variety of its metabolic properties, such as respiratory electron transfer (Myllykallio et al., 2000), oxygen and light signal transduction pathways (Swem et al., 2001), and nitrogen fixation (Masepohl et al., 2002).  There are several useful tools available for genetic studies of R. capsulatus, which have greatly facilitated the study of its biology. The first of these is the complete genome sequence, which has been available since 2010 (Mercer et al., 2010, Strnad et al., 2010). Availability of the genome sequence allowed for the design of whole genome microarrays, which have been used to study genome-wide transcriptional changes 2  under conditions of nutrient deprivation, and in specific regulatory mutants to identify differentially expressed genes (Mercer et al., 2010, Pena-Castillo et al., 2014). Furthermore, a contiguous genome sequence improves the ease of basic genetic studies such as designing gene knockouts and site-directed mutants, and identification of genomic regions of interest, such as those of metabolic pathways, or of bacteriophages. The second of these tools are reliable suicide and complementation plasmids, which allow for direct study of specific genes via gene knockout and complementation studies. The third genetic tool available is a type of genetic exchange element called a gene transfer agent (GTA). The R. capsulatus gene transfer agent (RcGTA) is a particle that resembles a small double stranded (ds) DNA bacteriophage that packages linear pieces of genomic DNA and delivers them to recipient cells (Lang & Beatty, 2000). RcGTA has been used for generating chromosomal gene knockouts, as well as for gene mapping to establish genetic linkages for bacteriochlorophyll and caretoinoid biosynthesis genes by measuring co-transfer frequencies (Yen & Marrs, 1976). The RcGTA has unusual properties that distinguish it from other mechanisms of horizontal gene transfer (HGT), which will be described in the following sections prior to an in-depth description of RcGTA.  1.2 Mechanisms of horizontal gene transfer and gene transfer agents Horizontal gene transfer (HGT) can be defined as the transfer of genetic material between organisms by a mechanism other than reproduction, and is a powerful driver of bacterial evolution (Zhaxybayeva & Doolittle, 2011). HGT contributes to adaptation to environmental stresses (Wolska, 2003, Heuer & Smalla, 2007), and is a key mechanism of the spread of antibiotic resistance (Bush et al., 2011). There are three well defined 3  mechanisms of HGT in bacteria. These are conjugation, transduction, and transformation.   1.2.1 Conjugation, transformation, and transduction Conjugation requires direct cell to cell contact, and involves the transfer of plasmids from donor to recipient cells. In this process, DNA is transferred via a mating bridge structure that is generated by donor cells (Wolska, 2003). Conjugation can be involved in inter- and intra-species bacterial transfer of DNA, as well as inter-kingdom DNA transfer, with the canonical example being the transfer of the Ti plasmid from the bacterium Agrobacterium tumefaciens to plant cells (Piper et al., 1993, Tun-Garrido et al., 2003) in crown gall disease.  Integrative and conjugative elements (ICE) are a variation of conjugation. ICEs are self-transmissible mobile genetic elements which contain both the machinery for conjugation, as well as regulatory systems that control their site-specific integration and excision from the chromosome of cells (Burrus & Waldor, 2004). These elements can remain and divide within the host chromosome, or once excised, be passed on to new hosts. Notably, ICEs cannot be maintained in an extra-chromosomal state, unlike conjugative plasmids (Wozniak & Waldor, 2010). Overall, these elements combine features of lysogenic phages, transposons, and plasmids.  Transformation involves the uptake and recombination of extracellular DNA into the genome of recipient cells, and occurs as part of a cellular process called natural competence. The term “competent‟ refers to the state where bacteria actively take up environmental DNA, whereas the term “transformation” refers to the successful 4  acquisition of a new genetic trait by recombination into the chromosome (Johnston et al., 2014, Dubnau, 1991, Wolska, 2003). It is now clear that natural competence systems are widespread in both Gram-positive and Gram-negative bacteria, and new systems are continually being discovered (Seitz & Blokesch, 2013a, Johnston et al., 2014). To date more than 80 functional natural competence systems have been reported, and homologues of key genes are present in many diverse bacteria (Johnston et al., 2014, Seitz & Blokesch, 2013a). Although some specifics differ, the general mechanisms of natural competence systems are as follows: 1) exogenous DNA is bound by a pilus structure that brings DNA into proximity to the cytoplasmic membrane (the inner membrane in Gram-negative bacteria). DNA is then processed, and transported through the cytoplasmic membrane (CM) by the ComEC transporter in a poorly understood mechanism also involving ComF, resulting in a single-stranded (ss)DNA molecule entering the cytoplasm. The ssDNA is bound by DNA protecting protein A (DprA), which facilitates the formation of recombinase A (RecA) filaments on the ssDNA, after which the incoming ssDNA may be recombined with the recipient cell genome if sequence similarity exists (Johnsborg et al., 2007, Seitz & Blokesch, 2013a, Johnston et al., 2014). There are variations between different bacteria, however this basic architecture and series of steps hold true in all systems that have been studied, with the exception of Helicobacter pylori (Johnston et al., 2014). A schematic is shown in Figure 1-1 (left) Transduction is mediated by bacteriophages (phages), where genomic DNA from the host cell is occasionally packaged into the phage head. The frequency of transduction is dependent on the type of phage; some phages almost always package 5  small amounts of host DNA, such as Mu phages (Lang et al., 2012), whereas others rarely package host DNA  (Miller, 2001). Regardless, the frequency of gene transduction in nature is relatively low. Also of note is that in transduction, DNA enters recipient cells via a phage protein-mediated process, which is fundamentally different from in natural transformation which involves active uptake of DNA by the host.   The mechanism of DNA delivery varies greatly depending on the type of phage, and so the current understanding of the DNA delivery mechanism for each type of phage will be described next.  DNA delivery into host cells during infection by the contractile long-tailed (myoviridae) phage T4 is currently the most thoroughly understood process of phage DNA delivery. Initial binding of phage particles is mediated by tail fibres, which are responsible for host recognition (Rossmann et al., 2004). After binding and correct orientation on the host cell surface, a conformational change triggers the contraction of the tail structure, and the inner proteinaceous tail tube punctures the outer membrane (OM) of the recipient cell. The tail tube then penetrates the peptidoglycan (PG) which is cleaved by the lysozyme domain on the tail tube (gp5), crosses the cytoplasmic membrane, and subsequently functions as a conduit for DNA delivery into the cytoplasm of the host cell (Rossmann et al., 2004, Leiman & Shneider, 2012). DNA entry by short tailed phages (podoviridae), such as T7 or p22, is quite different than in T4 and other myoviridae. After initial binding to the host cell surface via tail fibres, the short tail punctures the OM; proteins present in the head are then injected into the periplasm via the tail prior to DNA entry (Casjens & Molineux, 2012). Some of these proteins may degrade the peptidoglycan, and carry out other functions as well. 6  Subsequently, the short tail is lengthened, or a translocation tube is formed by injected proteins to form a channel into the cytoplasm, allowing DNA delivery (Casjens & Molineux, 2012, Hu et al., 2013).  In addition, it was recently shown that the apparently tail-less phage ΦX174 forms a tail-like structure during infection to span the periplasmic space for DNA transport (Sun et al., 2014), and so the concept of a lengthening tail or tail-like structure may be common.  The mechanism by which non-contractile tailed phage (siphoviridae) DNA travels from the capsid head into the cytoplasm is not well understood in its entirety, and only phages λ and T5 have been studied in any depth (Davidson et al., 2012). Phage λ particles first bind to the OM porin LamB, the initial receptor. After binding, a channel is formed through the OM with properties distinct from the LamB pore itself, implying that the channel is formed by phage proteins (Berrier et al., 2000). In phage T5, in vitro studies of a purified tape measure protein (TMP) protein showed that it forms pores through membranes that would be compatible with acting as a conduit for DNA delivery, and it is thought that the TMP probably acts as a DNA conduit into cells during T5 infection  (Boulanger et al., 2008, Feucht et al., 1990); the TMP of λ may function similarly (Roessner & Ihler, 1984, Davidson et al., 2012). Additionally, λ phage infection requires the bacterial ManY protein, an inner membrane (IM) component of the mannose transport system, for infection (Williams et al., 1986, Elliott & Arber, 1978). However it is not known what the ManY role is in the DNA injection process, or whether it interacts with the TMP. Several other phages require different inner membrane proteins for successful infection, and there is speculation that additional periplasmic and 7  IM proteins are involved in the injection of DNA, depending on the phage (Davidson et al., 2012). A summary of a model is shown in Figure 1-1 (right).  Figure 1-1. Comparison of DNA entry into recipient cells in natural competence systems and in non-contractile phages. Shown on the left are the essential steps of transformation in Gram-negative bacteria via natural competence are shown. Shown on the right is depiction of non-contractile tailed phage DNA entry into cells, derived from studies of phage λ for the receptor models, and phage T5 for tape measure protein (TMP) activity studies. Only the proteins known to be required for phage λ DNA entry are shown for clarity.   8     1.3 Gene transfer agents, and the RcGTA GTAs represent a process of HGT in prokaryotes resembling transduction (Lang & Beatty, 2001), however it is becoming clear that GTAs differ from transducing phages in several key aspects (Lang & Beatty, 2007, Lang et al., 2012). GTAs varying in morphology have been reported, although most resemble small, tailed double-stranded (ds)DNA phages (Solioz, 1975, Rapp & Wall, 1987, McDaniel et al., 2010). The general criteria that define a GTA are: 1) the DNA packaged within the head is insufficient to encode the GTA structural genes; 2) GTAs only package random parts of the producing cell‟s genome; and 3) production of GTAs is controlled by bacterial regulatory systems (Lang & Beatty, 2007, Lang et al., 2012). As a consequence, the frequency of transduction by GTAs is much greater than by generalized transducing phages. A schematic is shown in Figure 1-2A. The best-understood GTA is the RcGTA found in R. capsulatus, and also is the first GTA discovered, by Barry Marrs in 1974 (Marrs, 1974). After some pioneering work on RcGTA, Marrs left academic research around 1981, and it was almost 20 years before research on this GTA resumed (Lang & Beatty, 2000). RcGTA particles morphologically resemble a small tailed phage (Solioz, 1975, Yen et al., 1979); an electron micrograph is shown in Figure 1-2B.  Nucleic acid analysis revealed that random ~4 kb linear, dsDNA fragments of the producing cell genome are packaged within particles (example of the electrophoretic moblity of RcGTA-derived DNA is shown in Fig 1-2C), and so genetic markers are readily transferred from donor to recipient cells (Yen et al., 1979, Solioz et al., 1975). Approximately twenty years later, the RcGTA 9  primary structural gene cluster was discovered, and consists of a ~15 kb region of the chromosome with several homologues of key genuine phage genes such as a major capsid protein and tape measure protein (Lang & Beatty, 2000). Unlike phages, however, additional factors including a holin/endolysin, and predicted attachment factors, are encoded in distant genome regions (~1200 kb and ~670 kb of separation, respectively) from the primary structural genes (Lang et al., 2012, Hynes et al., 2012, Westbye et al., 2013). Homologues of replication, integration, and regulatory genes are also absent. A schematic of the RcGTA primary structural gene cluster and additional factors is shown in Figure 1-2D.  Also of interest is that homologues of the RcGTA primary structural gene cluster are widespread in the α-proteobacteria; furthermore, the cluster is highly conserved within Rhodobacterales, indicating that RcGTA-like HGT is likely a common feature in these bacteria (Lang & Beatty, 2007)       10    Figure 1-2. Properties of gene transfer agents and the RcGTA. A. Schematic depiction of the gene transfer agent HGT mechanism compared to transduction. B. Electron micrograph of an RcGTA particle (taken by A.B.Westbye, unpublished). C. Image of purified RcGTA run on an agarose gel compared to a λ HindIII ladder (Yen et al., 1979). D. Schematic diagram of the RcGTA structural gene cluster and associated genes including the holin/endolysin genes involved in lysis, and the putative attachment factors rcc01079/108, adapted from (Lang et al., 2012).  11  1.3.1 Regulation of RcGTA gene expression Culture growth phase, nutrient availability, and several cellular regulatory systems, including quorum-sensing, and homologues of the Caulobacter crescentus CckA/ChpT/CtrA phosphorelay are key regulators of RcGTA transcription and release from the producing cell (Lang & Beatty, 2002, Mercer et al., 2012, Schaefer et al., 2002).  1.3.1.1 Growth phase and population level expression RcGTA becomes detectable within the cell starting in the early stationary phase, and appears in the growth medium soon thereafter (Solioz, 1975, Florizone, 2006), however the mechanism of release from producing cells remained elusive for many years. Many phages exit host cells via lysis, causing a decrease in culture turbidity, however this is not observable in WT cultures of R. capsulatus, therefore it was possible that RcGTA was being released into the culture supernatant by some other mechanism such as the release of phage particles from intact cells, as observed in phage M13 (Roy & Mitra, 1970). Using an RcGTA primary structural gene cluster promoter fused to an mCherry fluorescent protein gene, it was found that the RcGTA primary gene cluster is expressed in <1% of WT cells in a population in the stationary phase, whereas in overproducer mutants (strains that produce ~104 more RcGTA), ~20-40% of cells express RcGTA (examples shown in Figure 1-3) (Fogg et al., 2012). Furthermore, cell lysis was observable in over-producer strains, suggesting a lytic release pathway (Fogg et al., 2012). Later, it was found that a holin/endoylsin system (rcc00555/556) is co-regulated with RcGTA, and that these genes are necessary for lytic RcGTA release 12  from cells (Hynes et al., 2012, Westbye et al., 2013). Overall, the data indicate that RcGTA is produced in and released by lysis from a small fraction of the population in WT cells (<1%), which explains the lack of observable cell lysis because too tiny a proportion of cells lyse to be visible by conventional means, such as culture turbidity measurements.  Figure 1-3. Population level expression of RcGTA as measured by rcgta::mCherry fluorescence in stationary phase cells. On the left are WT cells, and on the right are RcGTA overproducer mutant cells. Images are of fluorescence, where cells were excited by 561 nm light (fluorescence emission 610 nm), overlain on a light microscopy image of the same cells. Images were taken by Dr. Hao Ding (unpublished).   1.3.1.2 LuxR/I-like quorum-sensing Quorum-sensing (QS) is generally defined as a cell to cell communication mechanism in bacteria that modulates bacterial behavior in response to cell density (Waters & Bassler, 2005). Generally, quorum-sensing involves production of a small diffusible signal molecule, which can range in structure from a small peptide, as in Staphylococcus species (Novick & Geisinger, 2008), through the boron-containing interkingdom signaling autoinducer-2 (AI2) molecule (Schauder et al., 2001), to N-acyl-homoserine lactone molecules (Schuster et al., 2013). Such signaling molecules are 13  typically produced in low amounts, such that at low cell density, there is a low effective concentration. As cell numbers increase, the concentration of the signal increases in tandem with cell density until a threshold, or quorum, is reached. At this point, an auto-inducing loop is activated, where production of the QS signal is amplified, and the behavior of the population alters (Fuqua et al., 1994, Schuster et al., 2013). This happens when the QS signal binds to its cognate transcriptional modulator protein. In the prototypical LuxR/I system, the modulator protein is called LuxR and the autoinducer is an acyl-homoserine lactone that is synthesized by LuxI. LuxR homologues are most often transcriptional activators that require binding of the acyl-HSL to be active, and bind near promoter sequences, such as LasR in Pseudomonas aerginosa, and LuxR in Vibrio fischerii (Kolibachuk & Greenberg, 1993, Schuster et al., 2004). However there is a growing number of examples where the LuxR homologue is a transcriptional repressor that loses DNA-binding affinity after binding of the acyl-HSL signal, such as EsaR in Pantoea stewartii and ExpR of Pectobacterium carotovorum  (Koch et al., 2005, Tsai & Winans, 2010).  LuxR proteins have two domains: an acyl-HSL binding domain similar in structure to PAS domains, and a helix-turn-helix (HTH) DNA binding domain (Zhang et al., 2002, Lintz et al., 2011, Chen et al., 2011a). LuxR homologues dimerize and bind to inverted repeats in the promoter region of regulated genes, and either activate transcription by recruiting RNA polymerase when binding is upstream of the -35 region, or sterically block RNA polymerase by binding near or overtop of the -10 region (Chen et al., 2011a, Schu et al., 2009, Tsai & Winans, 2010). A diagram of positive and negative regulation via LuxR/I-type systems is shown in Figure 1-4. Many cellular behaviors are regulated by this type of QS, with examples 14  being polysaccharide biosynthesis in Pantoea stewartii (von Bodman et al., 1998), extracellular protease production in Pseudomonas aeruginosa (Gambello et al., 1993) and pathogenic plasmid conjugal transfer in Agrobacterium tumefaciens (Piper et al., 1993).     15    Figure 1-4. Schematic diagram of canonical LuxRI cognate quorum-sensing pair functionality. Shown on the top is how positive regulation by LuxR homologues is thought to occur, where acyl-HSL binding facilitates DNA binding upstream of the -35 hexamer. Shown on the bottom is how negative regulation is thought to occur, where the LuxR-type regulator is bound near or overtop of the -10 hexamer, and acyl-HSL binding promotes dissociation from DNA.   16   1.3.1.3 GtaR/I-based regulation of RcGTA production GtaR and GtaI, encoded by R. capsulatus SB1003 genes rcc00328 and 329, respectively, are homologous to LuxR/I-type QS proteins (Leung, 2010). Previous work showed that GtaI (encoded by rcc00329) synthesizes two long acyl-tailed homoserine lactones, C14 and predominantly C16-acylhomoserine lactone (Schaefer et al., 2002). It was also discovered that a ΔgtaI mutant produced ~7 fold less RcGTA in the stationary phase, and that WT levels of production were restored with addition of C16-acyl-HSL (Schaefer et al., 2002). Although the involvement of the predicted C14/C16-acyl-HSL-binding GtaR (encoded by rcc00329) in RcGTA production was not investigated, the sequence was consistent with being a repressor-type LuxR homologue (Leung, 2010). It should also be noted that there are two other (weak) LuxR homologues encoded in the R. capsulatus genome, namely Rcc01088 and Rcc01823, but their involvement in RcGTA production was also not evaluated (Schaefer et al., 2002).  1.3.1.4 Two-component signal transduction systems Two-component signal transduction systems are widespread in all domains of life (Schaller et al., 2011). They generally regulate cellular behavior in response to a specific stimulus, although there are often multiple levels of regulation (Foussard et al., 2001, Laub & Goulian, 2007, Mitrophanov & Groisman, 2008). The general architecture of a two-component system (TCS) consists of two parts: a sensor kinase (SK) and a response regulator (RR). Sensor kinases are typically integral membrane proteins, with a sensor domain (for example a PAS domain), and a histidine kinase (HK) domain within the cytoplasm (Schaller et al., 2011, Capra & Laub, 2012). Response regulators 17  are cytoplasmic proteins containing a receiver domain (REC) and an output domain of some function, often a DNA-binding domain. For the signal to be transduced, the SK sensor domain binds to a ligand causing dimerization, and autophosphorylation of a histidine residue in the HK domain of the protein. This activates the SK to phosphorylate the REC domain on the cognate RR, most often on a conserved aspartic acid residue, activating the output domain to carry out the desired function in response to the stimulus (Bekker et al., 2006, Mitrophanov & Groisman, 2008, Schaller et al., 2011, Capra & Laub, 2012). A schematic is shown in Fig 1-5A A variation of the TCS is the hybrid two-component system, where the SK also contains a REC domain, which is directly phosphorylated on an aspartic acid residue by the HK domain within the same protein. The phosphorylated REC domain subsequently phosphorylates a His residue on a phosphotransfer protein, which finally passes the phosphate group to the REC domain of the RR (Fig 1-5B). Because there are more steps, hybrid TCS allow for more levels of regulation of phosphorylation cascades than simple two-component systems (Capra & Laub, 2012). A classic example of a hybrid TCS is the CckA-ChpT-CtrA system in C. crescentus (Chen et al., 2009b) described in the next section.   18   Figure 1-5. Schematic depiction of two-component and hybrid two-component systems. A. Schematic diagram of canonical two-component signal transduction system. B. Diagram of a hybrid two-component signal transduction system, which includes a receiver domain within the sensor kinase protein, and a phosphotransfer protein. C. Proposed scheme of the CckA-ChpT-CtrA hybrid two-component system in R. capsulatus, where CckA represents the hybrid HK, ChpT represents the phosphotransfer protein, and CtrA represents the response regulator protein. The two black spikes in the CckA model indicate predicted transmembrane segments.   1.3.1.5 Functionality of CckA-ChpT-CtrA Caulobacter crescentus  The CckA-ChpT-CtrA phosphorelay system has been best studied in the bacterium C. crescentus. In this system, CckA is a hybrid HK that contains three predicted domains: an N-terminal PAS domain, a central HK domain, and a C-terminal REC domain. Upon signal binding, CckA dimerizes and a conserved histidine residue becomes phosphorylated in the HK domain. The phosphate group is then passed from 19  the HK domain to an aspartic acid residue within the C-terminal REC domain. CckA then phosphorylates a histidine residue within the the phosphotransfer protein ChpT, which subsequently delivers the phosphate group to an aspartic acid residue in the REC domain of the DNA-binding RR CtrA, altering its conformation and changing its affinity for DNA-binding (Jacobs et al., 2003, Biondi et al., 2006, Wu et al., 1998, Chen et al., 2009b, Siam & Marczynski, 2003). All three of these proteins are essential for C. crescentus viability (Chen et al., 2009b). In C. crescentus, CtrA regulates at least 25% of the 553 cell cycle regulated genes, with at least 95 of these targets being directly regulated. Regulated genes include those essential for flagellar motility, as well as cell division (Laub et al., 2000, Laub et al., 2002). Additionally, CtrA directly binds to the origin of replication and thereby regulates DNA synthesis (Quon et al., 1998). C. crescentus divides asymmetrically, and the CckA-ChpT-CtrA phosphorelay is essential in this process (Chen et al., 2011b).  The CckA-ChpT-CtrA system is conserved in the α-proteobacteria (Greene et al., 2012). The full CtrA regulon has not been characterized in most species, although all systems evaluated have been found to require CtrA for flagellar motility (Greene et al., 2012, Wang et al., 2014). Also of note, CckA, ChpT, and CtrA are not essential for viability in all α-proteobacteria, including R. capsulatus, which allowed for identification of their regulation of RcGTA production on the basis of gene knockouts (Lang & Beatty, 2002). A schematic diagram of the putative CckA/ChpT/CtrA system in R. capsulatus is shown in Figure 1-5C.     20  1.3.1.6 Ccka-ChpT-CtrA functionality in R.capsulatus Because the CckA-ChpT-ChpT system is not essential in R. capsulatus, (as opposed to C. crescentus), and R. capsulatus divides by binary fission generating two identical daughter cells (Weaver et al., 1975), the R. capsulatus cell cycle progression may be different than that of C. crescentus. Furthermore, the non-essentiality of these genes has facilitated their study (Mercer et al., 2012). For comparison, the CckA, ChpT, and CtrA homologues in R. capsulatus are 32%, 24.9%, and 71% identical in amino acid sequence to the C. crescentus proteins, respectively. The first observed defects in R. capsulatus ΔctrA mutants were the abolition of RcGTA production, shown to be due to loss of RcGTA gene transcription, and loss of motility via the greatly decreased transcription of flagellar genes (Lang & Beatty, 2002, Mercer et al., 2012, Lang & Beatty, 2000). A transcriptomic study comparing an R. capsulatus ΔctrA mutant to the parental strain found that loss of ctrA caused pleiotropic effects, with ~6% of all genes in the genome being dysregulated (Mercer et al., 2010). These findings indicated that there were likely uncharacterized defects in the ΔctrA mutant. In other studies, it was found that the cckA and chpT homologues are also important in RcGTA regulation, because null mutants no longer show RcGTA activity in transduction assays; additionally, both mutants are also impaired for motility (Mercer et al., 2012). There were, however, important differences between the ΔctrA and ΔcckA and ΔchpT mutants. In contrast to a total loss of RcGTA production, as observed in the ΔctrA mutant, RcGTA is still produced in the ΔcckA and ΔchpT mutants, however it is not released from cells. Furthermore, a phosphomimetic complement of CtrA was unable to complement either of the ΔcckA or ΔchpT mutant strains for the RcGTA release defect, 21  indicating that there are probably additional levels of regulation as opposed to solely a direct phosphotransfer from CckA to ChpT to CtrA (Mercer et al., 2012, Sciochetti et al., 2002, Fioravanti et al., 2012).   1.4 Goals of my research The specific goals of my research evolved over the course of my project. Initially, I aimed to fully characterize the gtaR/I quorum-sensing system. It was previously established that GtaI regulates RcGTA production (Schaefer et al., 2002), and that GtaR is a negative regulator of gtaRI transcription (Leung et al., 2012), however the involvement of GtaR in RcGTA production had not been evaluated. Additionally, the total QS regulon in R. capsulatus was not known, and so an initial aim was to determine additional functions of the gtaRI QS system. To this end, I found that GtaR does indeed regulate RcGTA production. Additionally, I found that gtaRI also regulate capsule polysaccharide (CPS) production, and that the CPS is a receptor for the RcGTA. This finding altered the trajectory of my studies, and changed my primary goal to characterize factors involved in the capability of recipient cells to receive RcGTA carried genetic markers, as this area had not previously been studied. I later found that a ΔctrA mutant was incapable of receiving RcGTA-carried genetic markers, and this presented another direction of research; I thus made it my goal to figure out the cause of the ΔctrA mutant defect in RcGTA recipient capability. Through many experiments, I eventually determined that homologues of central genes in natural transformation are regulated by CtrA, and are essential for RcGTA recipient capability.  22  The work in this thesis has revealed unique features of the RcGTA in that the capability of recipient cells to receive RcGTA-borne genetic markers in the majority of cells in a culture is co-regulated with RcGTA production in a small percentage of the cells. I also discovered that GTA-borne genes appear to traverse the recipient cell envelope, and recombine in the genome of recipient cells through natural transformation machinery rather than phage machinery. One interpretation of these results is that RcGTA is may be thought of as being a hybrid of natural transformation and transduction, two HGT mechanisms previously thought to be unrelated.  23  Chapter 2: Materials and Methods 2.1  Bacterial strains and growth conditions The E. coli strains DH5α λpir and S17-1 λpir (Simon et al., 1983), and BL21 DE3  were used for cloning, conjugation of plasmids into R. capsulatus, and protein overexpression respectively. E. coli strains were grown at 37 °C, or 30 °C for protein expression, in Luria–Bertani (LB) medium (Sambrook et al., 1989) supplemented with the appropriate antibiotics at the following concentrations (μg ml−1): ampicillin, 100; gentamicin sulphate, 10; kanamycin sulphate, 50, tetracycline hydrochloride, 10; chloramphenicol, 35.  The R. capsulatus strains used in this study were all derviates of the WT isolate B10. The genome sequenced strain of R. capsulatus is SB1003 (Strnad et al., 2010), which is a rifampicin-resistant derivative of B10, and is used in most studies of RcGTA production. All genetic investigations (primer design etc.) were performed using the SB1003 genome as a reference, which was presumed to be essentially identical to that of its parent strain B10 (with the exception of the allele conferring RifR). The RcGTA overproducer mutant DE442 used in this study as a source of RcGTA in many experiments was derived from SB1003 by chemical mutagenesis (Yen et al., 1979), and its genome has recently been sequenced (Ding et al., 2014); the cause of the overproducer phenotype is not well understood, but appears to be due to a point mutation in rcc00280 (H. Ding and J.T. Beatty, unpublished). The strain B10 was used as a parent strain for all mutants described in this thesis.  24   Rhodobacter capsulatus strains (WT B10 (Marrs, 1974) or derivatives thereof) were grown at 30 °C in either YPS complex medium or defined RCV medium (Beatty & Gest, 1981). For RcGTA transduction assays (measuring RcGTA production), strains were growth phototropically in YPS medium at ~30 °C and harvested in the early stationary phase. In experiments were exogenous acyl-HSLs were added, the acyl-HSLs (Cayman Chemical) were dissolved in dimethyl sulfoxide (DMSO), and added to ΔgtaI mutant cultures to a final concentration of 2 µM. To test for exogenous acyl-HSL produced during bacterial growth, R. spheroides 2.4.1 was grown in LB medium under phototropic conditions at ~30 °C and harvested in the stationary phase. P. denitrificans and E. coli MG1655 were grown aerobically at 37 °C in LB medium and harvested in the stationary phase. R. palustris was grown phototropically in YPS complex medium at ~30 °C and harvested in the stationary phase. Cells were removed by centrifugation and the resultant supernatant passed through a 0.2 µM filter. Approximately 2 ml of each filtrate was added to 17 ml phototrophic gtaI cultures, which were then grown to stationary phase and evaluated for RcGTA production. For RcGTA production assays, culture turbidity was used as a measure of the number of cells per milliliter, and monitored by measuring light-scattering with a Klett-Summerson photometer (filter #66; red); 100 Klett units represents approximately 4 x 108 R. capsulatus colony forming units per milliliter. For all other assays, including RcGTA recipient and adsorption capability, pellet capability, OM-associated polysaccharide quantification, capsule stains, conjugation, and growth-rate analysis, R. capsulatus strains were grown  aerobically with shaking at 200 rpm and harvested in the stationary phase for use in assays, unless otherwise specified. When appropriate, media were supplemented with (μg ml−1): gentamicin 25  sulphate, 3; kanamycin sulphate, 10; rifampicin, 80; and tetracycline hydrochloride, 1. In all assays except for RcGTA production, the optical density at 650 nm was used as a measure of the number of R. capsulatus cells per ml; an OD650 of 1 = ∼ 4.5 × 108 cfu ml−1. E. coli culture turbidity was measured at an OD of 600 nm; and OD600 of 1 = ∼ 1 × 109 cfu ml−1. Table 2-1. Bacterial strains used in this study, and a brief description of each.  Strains Description Reference Escherichia coli    DH5αλpir Used for cloning  S17-1λpir used for conjugation of plasmids into R. capsulatus (Simon et al., 1983) BL21(DE3) used for protein expression and purification; contains T7 promoter expression system (also carries DE3 lysogen) Invitrogen MG1655 WT E. coli strain; produces AI-2 (Tavender et al., 2008) ΔluxS derived from MG1655; null mutation in luxS gene; no AI-2 production (Tavender et al., 2008) Rhodobacter capsulatus   WT B10 WT R. capsulatus strain (Weaver et al., 1975) SB1003 WT R. capsulatus strain derived from B10; RifR (Yen & Marrs, 1976) DE442 RcGTA overproducer mutant; RifR; used as RcGTA source (Yen et al., 1979) DE442(pd1080Gm) DE442 containing pd1080Gm; used as Gm resistant RcGTA source A.B. Westbye, unpublished 37b4 WT R. capsulatus strain; has no capsule (Weckesser et al., 1972) ΔgtaI markerless gtaI knockout mutant made in B10 background (Leung, 2010) ΔgtaR markerless gtaR knockout mutant made in B10 background (Leung, 2010) ΔgtaRI markerless gtaR/gtaI double knockout mutant made in B10 background (Leung, 2010) 26  Strains Description Reference WT B10 Rif derivative of B10; spontaneous RifR mutant This study ΔgtaI Rif derivative of ΔgtaI; spontaneous RifR mutant This study ΔgtaR Rif derivative of ΔgtaR; spontaneous RifR mutant This study ΔgtaRI Rif derivative of ΔgtaRI; spontaneous RifR mutant This study Δ1080  markerless rcc01080 knockout mutant made in B10 background This study Δ1080/ΔgtaI markerless rcc01080 knockout mutant made in ΔgtaI background This study Δ1080/Δ1932 markerless rcc01080/rcc01932 double knockout mutant made in B10 background This study Δ1085 markerless rcc01085 (wzy) knockout mutant made in B10 background This study Δ1932 markerless rcc01932 knockout mutant made in B10 background This study ΔctrA markerless ctrA knockout mutant made in B10 background (Leung et al., 2013)  ΔdprA markerless dprA knockout mutant made in B10 background This study ΔrecA (B10S-T7) recA mutant; insertion of T7 RNA polymerase gene into chromosome (Katzke et al., 2010) ΔcomEC comEC knockout mutant (by KIXX disruption) made in B10 background This study ΔcomF markerless comF knockout mutant made in B10 background This study ΔcomM markerless comM knockout mutant made in B10 background This study Δ1088 markerless rcc01088 knockout mutant made in B10 background This study Δ1088/ΔgtaI markerless rcc01088 knockout mutant made in ΔgtaI background This study Δ1823 markerless rcc01823 knockout mutant made in B10 background This study Δ1823/ΔgtaI markerless rcc01823 knockout mutant made in ΔgtaI background This study SBpG WT R. capsulatus strain derived from S1003; RifR; mCherry fused to RcGTA promoter H. Ding, unpublished Rhodobacter sphaeroides 2.4.1 WT R. sphaeorides strain (Puskas et al., 1997) 27  Strains Description Reference Paracoccus dentirificans PD1222 WT P. dentrificans strain (Schaefer et al., 2002) Rhodopseudomonas palustris CGA009 WT R. palustris strain (Hirakawa et al., 2011)  2.2 Recombinant DNA techniques and plasmids Standard methods of DNA purification, restriction enzyme digestion, and other modification techniques were used (Sambrook et al., 1989). All primer sequences, plasmids, and strains used in this study can be found in Tables 2.1 to 2.3. The plasmid pUC19 (Invitrogen) was used for sub-cloning, pIND4, pRK415 and pCM62 as complementation plasmids, pRhoKHi-6 as an expression vector for dprA, pET28a (+) as a 6His tag expression vector for dprA, and pRR5C as a complementation vector for ctrA.  Table 2-2. Primers used in this study. Primer 5'-3' sequence experiment/construct restriction cut site gtaR_comp_up GTATCGGTACCAGCAAAACGACCTTAGGA pIND4R KpnI gtaR_comp_down GTACAGGATCCGAAAGTGTGGTGGTCTGCAT pIND4R BamHI rplQ-gtaR_up CGACGTTTCGGCGAAGGGCG gtaRI co-transcription N/A rplQ-gtaR_down CCGCAGACACTTGTTGAT gtaRI co-transcription N/A gtaR-gtaI_up GCTGCGAAGCTTGGCATCA gtaRI co-transcription N/A gtaR-gtaI_down AATGATGAAACTTTGCCGCC gtaRI co-transcription N/A gtaI-rcc00330_up GCTGGTATCGCCGCTGC gtaRI co-transcription N/A gtaI-rcc00330_down CCTCGGACAGATGCTGCG gtaRI co-transcription N/A 28  Primer 5'-3' sequence experiment/ construct restriction cut site 1081_up_for AATGACGTCGACCCGAGCGTTGCCAGTGCG pUC81up, pZDJΔ1081 SalI 1081_up_rev TTACCGAAGCTTGCCGTCGGTGTTGCAGAC  pUC81up, pZDJΔ1081 HindIII 1081_down_for CGTTACAAGCTTTTCGGGCTTTACGGCCTG pUC81down, pZDJΔ1081 HindIII 1081_down_rev ATTACAGAGCTCAATCGACAGCGCATAGCC pUC81down, pZDJΔ1081 SacI 1081_seq_for CGCGGGTGTCTTGCAC Δ1081 knockout screening N/A 1081_seq_rev GCAAGGGTGGCAAGATT Δ1081 knockout screening N/A 1081_comp_for CGTTACAAGCTTTCAGCCCTGCGCCGCTTC pIND1081 NcoI 1081_comp_rev CGTTACAAGCTTTCAGCCCTGCGCCGCTTC pIND1081 HindIII 1081_lacZ_for CGACGGCGACCTGCAGGGGGTGGGAA pXCA1081 PstI 1081_lacZ_rev TGGCAAGCGCGAGATCTGTGTTGCA pXCA1081 BglII 1932_up_for TAGCAGAGCTCTTGGGGTGATCGTGATGA pUC32up, pZDJΔ1932 SacI 1932_up_rev GTACAAAGCTTAAGACTGACGACCAGAGA pUC32up, pZDJΔ1932 HindIII 1932_down_for GTAGACAAGCTTGGGATCACCCTTGCGCTG pUC32down, pZDJΔ1932 HindIII 1932_down_rev GTACATCTAGACCATCAGCTTGCCGGTGGG pUC32down, pZDJΔ1932 XbaI 1932_comp_for TAGGTGGCCATGGTCCACTCGGCT pIND1932 NcoI 1932_comp_rev TCAGGCTTCCGACATCGCAAGCTTGGGCAT pIND1932 HindIII 1088_up_for GTACATGAGCTCCTTGCCGTCGTTCGAGAT pUC_1088up, pZDJΔ1088 SacI 1088_up_rev GTACATCTAGAGGGTGTCGCGTGATGCGC pUC_1088up, pZDJΔ1088 XbaI 1088_down_for GTACAGTCTAGAGCGGTGGCCGAGGCGGTC pUC_1088down, pZDJΔ1088 XbaI 1088_down_rev GTACATGTCGACGTGGCGCAAGAGCGTGTC pUC_1088down, pZDJΔ1088 SalI 1823_up_for CTAGTCTAGAGAGCTTCGGGTGGTTCTG pUC_1823up, pZDJΔ1823 XbaI 29  Primer 5'-3' sequence experiment/ construct restriction cut site 1823_up_rev CGTACAGGATCCCTTTTCATCACCTC pUC_1823up, pZDJΔ1823 BamHI 1823_down_for CTGACAGGATCCAAGTTGTTCAAGAT pUC_1823down, pZDJΔ1823 BamHI 1823_down_rev CGTATCTAGAGGAAATGGGCAAGAT pUC_1823down, pZDJΔ1823 XbaI 1088_screen_for CTTCCCATCGGCCGATATTGTGGC Δ1088 knockout screening N/A 1088_screen_rev GGCCTTGCCTTCGCGCGTCGGAATG Δ1088 knockout screening N/A 1823_screen_for CTTCCCATCGGCCGATATTGTGGC Δ1823 knockout screening N/A 1823_screen_rev ACTCCGAATCCATGGGAAATGCCTTA Δ1823 knockout screening N/A 1085_up_for CGTACAGAGCTCTGGCGGCGCTTGCG pUC_1085up, pZDJΔ1085 SacI 1085_up_rev GTGACAAAGCTTGAGACACAACTCGA pUC_1085up, pZDJΔ1085 HindIII 1085_down_for CGACAAAGCTTAACTGCGCCAAGACG pUC_1085down, pZDJΔ1085 HindIII 1085_down_rev CGTACATCTAGAGTGACCCGCAGCGC pUC_1085down, pZDJΔ1085 XbaI 1085_screen_for TGCATGAGGTTTCTC Δ1085 knockout screening N/A 1085_screen_rev GTCGACGACGATGCA Δ1085 knockout screening N/A dprA_up_for ATCGAGAGCTCGGGTTACATGCAGGA pUCdprA_up, pZDJΔdprA SacI dprA_up_rev ACTGAAAGCTTGGTGGGGTAAGAAAA pUCdprA_up, pZDJΔdprA HindIII 30  Primer 5'-3' sequence experiment/ construct restriction cut site dprA_down_for ACTGAAAGCTTATCACCCGCCATCCG pUCdprA_down, pZDJΔdprA HindIII dprA_down_rev GGTACAGTCGACAAGATGCGGGGAAT pUCdprA_down, pZDJΔdprA SalI dprA_screen_for AGCCGACGCTCCTGATC ΔdprA knockout screening N/A dprA_screen_rev GCTCCCAGGAATACCAG ΔdprA knockout screening N/A dprA_comp_for TACATAAGCTTTGACGAACACCTACAT pDprA HindIII dprA_comp_rev GGTTATCTAGACCACCGATGTCTGGTA pDprA XbaI dprA_Z_for CTAGACCTGCAGCGGCAAGTTCGTCTTC dprA::lacZ and pDprAmCherry PstI dprA_Z_rev GTGGGGTGAAGGGATCCGGGTAAGA dprA::lacZ and pDprAmCherry BamHI dprA_pet_for GCGGAGGGACATATGAAAACAAGTT pETDprA_full and pRhDprA NdeI dprA_pet_rev CGTACGAATTCTCAACCGCGCCCGGA pETDprA_full and pRhDprA EcoRI dprA_rho_rev CGTAGAGCCGATCAACCGCGCCCGGA pRhDprA SacI IND_seq_for AAAAGAGTGTTGACTTGTGAGCGGA ~100 bp PCR product for Nuclease N/A IND_seq_rev TCAACAGGAGTCCAAGCTCAGCTAAT ~100 bp PCR product for Nuclease N/A pRKseq_for CGCCAGGGTTTTCCCAGTCACG pDprA N/A pRKseq_rev TCCGGCTCGTATGTTGTGTGGA pDprA N/A comF_up_for GCTAGAGCTCGAACAATATCCTTGC pUCF_up, pZDJΔcomF SacI comF_up_rev GCTAGAATTCCACCCGCAAGGCCGC pUCF_up, pZDJΔcomF EcoRI comF_down_for GCATGAATTCTCGGTCGCGGTTCTG pUCF_down, pZDJΔcomF EcoRI comF_down_rev CTTATCTAGACGGTCCGAGGACAGA pUCF_down, pZDJΔcomF XbaI comF_screen_for GCGGCGTCGTCGTGC comF knockout screening N/A comF_screen_re TGCGGGTGGTGTAGATT comF knockout N/A 31  v screening Primer 5'-3' sequence experiment/ construct restriction cut site comM_up_for GTACGAGCTCAACCATTGCGAAACG pUCM_up, pZDJΔcomM SacI comM_up_rev TACAGGATCCGAAAGCCACCGTATA pUCM_up, pZDJΔcomM BamHI comM_down_for GCACGGATCCTCGCCGATCTGGACG pUCM_down, pZDJΔcomM BamHI comM_down_rev GACATCTAGACGGCACCAATGTCGC pUCM_down, pZDJΔcomM XbaI comM_screen_for GGATCTAGGCTACTG ΔcomM knockout screening N/A comM_screen_rev TCCTGAGCGATGATGC ΔcomM knockout screening N/A JAB-rec-2-fwd GTGATCCGGCTCACTCTAGATCAGGTGCG pUCEC XbaI JAB-rec-2-rev GGCAGGCGTTTTCAAGCTTGTCCAGGG pUCEC HindIII comF_comp_for TACAGAGCTCCGCCATAGCTGACCC pComF SacI comF_comp_rev CAGTAAGCTTGGTGTAGATTTCGAC pComF HindIII comM_comp_for CGTAGAGCTCCGCTGGCTCGCTTCGG pComM SacI comM_comp_rev CGTAGGATCCCCGAGGTGCTGCTGC pComM BamHI comEC_comp_for GTACGAGCTCCTCCTGGGTGGCGA pComEC SacI comEC_comp_rev TAGTAAGCTTCTCGTCGAGGATCTG pComEC HindIII gm_for GTTATGGAGCAGCAACGA tracking assay N/A gm_rev GGAGTAGGTGGCTAC tracking assay N/A pctrA_F AGAGAAGCTTCTCTGGTCGCGCATCGG pCtrAmCherry HindIII pctrA_R AGAGGGATCCATCCTGGGTTCTCCGCA pCtrAmCherry BamHI Gm_qPCR_fo GGTGGCTCAAGTATGGGCAT tracking assay N/A Gm_qPCR_rev CGAAAAGATCAAGAGCAGCCC tracking assay N/A puhA_qPCR_for AACGACGACGGCAAGCTCT tracking assay N/A puhA_qPCR_rev GCTTCTTCGTTCTCGACCGA tracking assay N/A 32  2.3 Construction of markerless mutant strains All markerless mutants generated in this study were an in-frame deletion of the majority of the gene, and were constructed from the R. capsulatus B10 strain. Approximately 500-1000 bp of flanking regions of each gene were amplified, and inserted into the pUC19; the specific primers (and restriction cut sites, when present) can be found in Table 2.2. The resultant plasmids were digested with the appropriate enzymes, ligated, and inserted into the suicide plasmid pZDJ (Brimacombe et al., 2013), generating suicide plasmids for deleting the desired gene. Each plasmid was conjugated into R. capsulatus B10 and allowed to recombine into the chromosome, selected by gentamicin resistance. Cells that underwent a second recombination event resulting in loss of the plasmid were selected by aerobic growth on RCV agar medium containing 7% sucrose. Replacement of the WT allele with the mutant (Δ) allele in Gm-sensitive colonies was confirmed by PCR and sequencing. For double mutants (e.g. Δ1081/Δ1932 and Δ1081/ΔgtaI), a single knockout was first made, followed by subsequent analogous procedure to mutate the second allele.  2.4 Generation of ΔcomEC mutant strain  The ORF encoding the predicted ComEC (rcc02362) was amplified by PCR from genome of R. capsulatus strain B10 as an XbaI to HindIII fragment, using the primers JAB-rec-2-Fwd and JAB-rec-2-Rev. The amplified product was cloned into plasmid pUC19, and the gene was disrupted by insertion of a kanamycin resistance-encoding ~1.4-kb SmaI-KIXX cartridge (Barany, 1985) into the unique NruI restriction site (at 1012 bp from start codon) within the comEC coding region. Both orientations of the 33  SmaI-KIXX cartridge were obtained, and confirmed by DNA sequencing.  Both constructs were transformed into E. coli TEC5 (pDPT51) (Taylor et al., 1983) and from these strains, conjugated into the GTA overproducer R. capsulatus strain DE442, derived from Y262 (Yen et al., 1979, Ding et al., 2014). Mutant strains were generated by RcGTA-mediated transfer of the disrupted versions of the genes into the chromosome of WT R. capsulatus strain B10 (Marrs, 1974).  PCR using the original amplification primers and restriction endonuclease analysis were used to confirm the resultant kanamycin-resistant strains.  Strains containing the KIXX cartridge in both orientations had identical phenotypes (data not shown); therefore the mutant strain with KIXX inserted in the forward direction was arbitrarily used for experiments described in this thesis. Knockout construction performed by Jeanette Beatty.   2.5 Complementation of mutant strains Several different complementation strategies were employed over the course of this thesis research. They are listed in chronological order. All primer sequences and restriction cut sites are in Table 2.2.  For complementation of ΔgtaR, the primers gtaR_comp_up and gtaR_comp_down were used to amplify the region ~ 600 bp upstream of the gtaR start codon, the entire gtaR gene itself, as well as the first several codons of the gtaI gene. The resultant amplicon was ligated as a KpnI to BamHI fragment into the vector pIND4 (Ind et al., 2009) to produce the plasmid pIND4R, which was then conjugated in to R. capsulatus ΔgtaRI, resulting in the strain ΔgtaRI(R). For complementation of rcc01081 and rcc01932, the primers 1081_comp_up and 1081_comp_down, and 1932_comp_up 34  and 1932_comp_down were used to amplify the entire rcc01081 and rcc01932 genes respectively. Amplicons were ligated into the multiple cloning site of the plasmid pIND4 as NcoI to HindIII fragments to produce the plasmids pIND1081, and pIND1932. These constructs allow for inducible expression of the rcc01081 and rcc01932 genes under control of an i -D-1- thiogalactopyranoside (IPTG)-inducible lac promoter. The plasmid pIND1081 was then conjugated into R. capsulatus mutant strain Δ1081, and the plasmid pIND1932 was conjugated into the strain Δ1932, generating the strains Δ1081[p1081] and Δ1932[p1932]. For experiments using these complemented strains, the cultures contained 1 mM IPTG during growth to induce expression of each gene. The complementation plasmid pDprA was generated by amplifying the R. capsulatus B10 dprA gene and ∼ 500 bp 5′ of the start codon and ~100 bp 3‟ of the stop codon as a HindIII–XbaI fragment. The resultant amplicon was ligated into the vector pRK415 and verified by DNA-sequencing, resulting in the plasmid pDprA. To generate the expression plasmid pRhDprA the dprA gene was amplified and ligated into the multiple cloning site of the plasmid pRhoKHi-6 (Katzke et al., 2010) as an NdeI–SacI fragment containing the dprA gene from the start codon to 17 bp 3′ of the stop codon, resulting in the plasmid pRhDprA, which contains the dprA gene driven by the aphII promoter. Plasmids were transformed into E. coli S17-1 λpir, and conjugated into recipient R. capsulatus strains. The complementation plasmids pComEC, pComF, and pComM were generated by amplifying the R. capsulatus comEC, comF and comM genes, and ~450 bp 5‟ of the start codons and ~100 bp 3‟ of the stop codons as SacI-HindIII, SacI-HindIII, and SacI-BamHI fragments, respectively. The resultant amplicons were ligated into the vector 35  pCM62, and verified by DNA sequencing. The resultant plasmids, pComEC, pComF and pComM, were conjugated into the ΔcomEC, ΔcomF and ΔcomM strains, respectively, to generate the native promoter-driven trans complemented strains.   2.6 Cloning and purification of 6His-RcDprA The R. capsulatus dprA gene was amplified as an NdeI – EcoRI fragment and ligated into plasmid pET28a (+), generating pETDprA_full. This construct contains an N-terminally 6His tagged RcDprA. pETDprA_full then transformed into E. coli BL21 (DE3) for protein expression. To aid in protein folding, the plasmid pGro7 (Takara) was transformed into this strain, yielding the protein expression strain E. coli Bl21 (DE3)(pETDprA_full)(pGro7). Cultures were grown in LB medium supplemented with 50 μg ml−1 kanamycin sulphate, and 35 μg ml−1 chloramphenicol at 30 °C with shaking at 200 rpm to an OD600 of 0.2. Expression of the groES-groEL chaperones was induced with 1 mg ml−1 arabinose, followed by a further incubation at 30 °C. At an OD600 of 0.5, 6HisDprA expression was induced with 0.5 mM IPTG and cultures grown to an OD600 of 1.0. Cells were harvested by centrifugation, and re-suspended in Buffer A [20% glycerol, 50 mM Tris-HCl (pH 7.4), 300 mM NaCl, 2 mM β-mercaptoethanol, 1× Roche complete mini protease inhibitor] + 10 mM imidazole, followed by treatment with 1 mg ml−1 lysozyme and 1 mg ml−1 DNase I for 1 h on ice. Cells were lysed by French press, cellular debris removed by centrifugation, and the supernatant was loaded onto an Ni2+-nitrilotriacetic acid agarose resin (Qiagen) column and washed with 30 column volumes of Buffer A + 10 mM imidazole. Protein was eluted in Buffer A + 300 mM imidazole, and stored in elution buffer at −80 °C. Protein purity was analyzed by SDS-PAGE and 36  Coomassie blue staining. Samples of RcDprA elutions were boiled for 10 min in sample loading buffer (50 mM Tris-HCl pH 6.8, 2% SDS, 10% glycerol, 0.1% bromophenol blue, 1% β-mercaptoethanol). Samples were then separated on a 12% SDS-PAGE gel and stained with 40% methanol, 10% acetic acid, 0.025% Coomassie blue, and de-stained in 40% methanol, 10% acetic acid. Gels stained with Coomassie blue revealed a band of ∼ 45 kDa, at an estimated purity of > 95% homogeneity. When analyzed by mass spectrometry of tryptic peptides, the band‟s identity was confirmed as the RcDprA protein (data not shown). Protein concentrations were determined in a modified Lowy assay using BSA for the standard curve. 2.7 β -galactosidase assays The β-galactosidase specific activity of cells containing promoter::lacZ fusions were assayed as previously described (Leung, 2010, Leung et al., 2012). Sonication was used to break cells, and total protein was measured using the Lowry method (Peterson, 1983), with BSA as the standard. β-Galactosidase specific activities are presented as units per milligram of total protein. The plasmid p601-g65 was previously generated to evaluate RcGTA transcription (Leung et al., 2012), and was used for the same purpose in this study.  Cultures were grown to the stationary phase in YPS complex medium, and the β-galactosidase specific activity measured.  The rcc01081::lacZ promoter fusion plasmid containing ~ 1.5 kb of sequence 5′ of the rcc01081 start codon was used to evaluate transcription and translation of the rcc01081 gene. The insert was made by PCR amplification using WT R. capsulatus genomic DNA as a template, and the primer set 1081_lacZ_for and 1081_lacZ_rev. The 37  resultant amplicon was digested with PstI and BglII, and ligated into pXCA601. The ligation resulted in a translationally in-frame fusion between the rcc01081 potential start codons and the lacZ coding region. Cultures were grown to the stationary phase in RCV defined medium, and the β-galactosidase specific activity measured. A dprA::lacZ was fusion was created by ligating a ∼ 500 bp BamHI–PstI fragment containing the first 12 amino acids of the dprA coding sequence into the plasmid pXCA601 (Adams et al., 1989)  to generate plasmid pDprALacZ, generated using the primers dprA_Z_for and dprA_Z_rev. The WT, ΔctrA, and ΔgtaI strains containing this plasmid were grown phototrophically in RCV defined medium to the stationary phase, and the β-galactosidase specific activity assayed. For the time-course experiment evaluating dprA::lacZ activity in the WT strain, three separate 125 ml cultures of WT(pDprALacZ) were growth aerobically in RCV defined medium with shaking (200 rpm) at 30 °C. Cultures were inoculated at an OD650 of 0.05, and monitored for turbidity over a 46 h period. During turbidity measurements, samples from each culture were taken at each time point and evaluated for β-galactosidase activity. One way ANOVA analysis of lacZ activities is given in Appendix A7.   2.8 Fluorescence microscopy The mCherry gene was excised from the plasmid pmCherry (Shaner et al., 2004) as a BamHI–EcoRI fragment, and ligated into the plasmid pCM62 (Marx & Lidstrom, 2001), resulting in the plasmid pCMmCherry. The dprA promoter was amplified as a ∼ 450 bp BamHI–PstI fragment that was digested with BamHI to yield a ∼ 315 bp 38  fragment, which was ligated into the plasmid pCMmCherry, to yield an in-frame fusion to the mCherry coding region, including the first nine codons of dprA. This fragment is smaller than the one used for lacZ fusion as there is an endogenous BamHI site within the promoter region that was re-incorporated into the ligation product during the construction of the lacZ construct but not during construction of the mCherry fusion. The resultant construct, pDprAmCherry was conjugated into WT R. capsulatus B10 cells, and evaluated for fluorescence. For the ctrA::mCherry construct, approximately ~1 kb of DNA sequences 5' of the ctrA start codon were PCR-amplified using primers pctrAF and pctrAR, and cloned as a HindIII-BamHI fragment into pCM62::mCherry, (Brimacombe et al., 2014) resulting in an in-frame fusion of the ctrA start codon to mCherry.  Images of stationary-phase R. capsulatus cells grown in RCV defined medium to the stationary phase at 30 °C were taken using a Sony DSC-S75 digital camera mounted on a Zeiss Axioskop fluorescence microscope at 100× magnification. A mercury lamp (HBO 50X) and a Zeiss filter set 15 (excitation: 546 nm/ 12 nm; emission 590 nm) were used to measure mCherry fluorescence.  Table 2-3. Plasmid backbones and subsequent constructs used in this study. Plasmid Features/inserted sequence Reference pUC19 AmpR; LacZα; gene cloning vector Invitrogen pZDJ GmR; gram negative suicide vector; contains sacB gene and tetR promoter (Brimacombe et al., 2014) pXCA601 TcR; promoter probe vector; for construction of promoter::lacZ fusions (Adams et al., 1989) pET28a(+) KanR; protein expression vector for N and C-terminally tagged 6His proteins Novagen 39  Plasmid Features/inserted sequence Reference pGro7 CmR; groES-groEL chaperones driven by araB promoter Takara pmCherry AmpR; pUC; mCherry fluorescence protein (Brimacombe et al., 2014) pCM62 TcR; broad host range cloning vector (Marx & Lidstrom, 2001) pIND4 Expression vector; KanR (Ind et al., 2009) pRhoKHi-6 Expression vector; KanR (Katzke et al., 2010) pRK415 LacZα; broad host range vector; TcR (Keen et al., 1988) φX174 virion φX174 virion DNA; is in single stranded form New England Biolabs φX174 RF1 φX174 replicative form 1 DNA; is in double stranded form New England Biolabs pIIND4R gtaR and ~600bp upstream of the start codon ligated as KpnI-BamHI into pIND4 This Study pUC81up upstream flank of rcc01081 as SalI-HindIII frag; AmpR  This Study pUC81down downstream flank of rcc01081 as HindIII-SacI; AmpR This Study pZDJΔ1081 rcc01081 upstream+downstream ligated into suicide vector; GmR This Study pIND1081 rcc01081 ORF as NcoI-HindIII frag; KmR This Study pUC32up upstream flank of rcc01932 as SacI-HindIII frag; AmpR This Study pUC32down downstream flank of rcc01932 as HindIII-XbaI frag; AmpR This Study pZDJΔ1932 rcc01932 upstream+downstream ligated into suicide vector; GmR This Study pIND1932 rcc01932 ORF as NcoI-HindIII frag; KmR This Study pXCA1081 ~1500bp 5‟ of ORF rcc01081 fused to lacZ; translationally in frame; TcR This Study pRRR ctrA transcriptionally fused to pufA in backbone of pRR5C; GmR (Lang, 2000) pUCdprA_up dprA upstream flanking region ligated into pUC19; AmpR This Study 40  Plasmid Features/inserted sequence Reference pUCdprA_down dprA downstream flanking region ligated into pUC19; AmpR This Study pZDJΔdprA upstream and downstream flanks of dprA fused together in pZDJ; GmR This Study pDprA ~500 bp 5' of dprA, the dprA gene, and ~100 bp downstream ligated into pRK415 This Study pRhDprA dprA gene driven by aphII promoter, in pRhoK; KmR This Study pETDprA_full dprA gene cloned into pET28a(+); has an N-terminal 6His tag, driven by lacI promoter; KmR This Study p601-17 ctrA promoter fused to lacZ in pXCA601; used in conjugation experiments This Study pDprALacZ 450 bp of dprA promoter and first nine codons translationally fused to lacZ in pXCA601 This Study pCMmCherry mCherry gene ligated into PCM62 This Study pDprAmCherry 315 bp of dprA promoter and first nine codons translationally mCherry in pCMmCherry This Study pD51E ctrAD51E and 181 bp of 5' sequence in KpnI site of pRK767 (Mercer et al., 2012) pD51A ctrAD51A and 181 bp of 5' sequence in KpnI site of pRK767 (Mercer et al., 2012) pZDJΔ1081Kan pDJΔ1081 with GmR resistance disrupted by KIXX This Study pUC4::KIXX contains the aminoglycoside 3′-phosphotransferase (aph) gene; AmpR (Barany, 1985) pUCF_up comF upstream flanking region ligated into pUC19; AmpR This Study pUCF_down comF downstream flanking region ligated into pUC19; AmpR This Study pUCM_up comM upstream flanking region ligated into pUC19; AmpR This Study pUCM_down comM downstream flanking region ligated into pUC19; AmpR This Study pUCEC comEC gene and flanking regions ligated into pUC19; AmpR This Study pComF ~500 bp 5' of comF gene, the comF This Study 41  gene, and ~200 bp downstream ligated into pCM62; TcR Plasmid Features/inserted sequence Reference pComM ~500 bp 5' of comM gene, the comM gene, and ~200 bp downstream ligated into pCM62 This Study pComEC ~500 bp 5' of comEC gene, the comEC gene, and ~200 bp downstream ligated into pCM62; TcR This Study pZDJΔcomF upstream and downstream flanks of comF fused together in pZDJ; GmR This Study pZDJΔcomM upstream and downstream flanks of comM fused together in pZDJ; GmR This Study pCtrAmCherry ctrA translationally fused to mCherry in pCMmCherry This Study pUC1088_up rcc01088 upstream flanking region ligated into pUC19; AmpR This Study pUC1088_down rcc01088 downstream flanking region ligated into pUC19; AmpR This Study pUC1823_up rcc01823 upstream flanking region ligated into pUC19; AmpR This Study pUC1823_down rcc01823 downstream flanking region ligated into pUC19; AmpR This Study pZDJΔ1088 upstream and downstream flanks of rcc01088 fused in pZDJ; GmR This Study pZDJΔ1823 upstream and downstream flanks of rcc01823 fused together in pZDJ GmR This Study pUC1085_up rcc01085 upstream flanking region ligated into pUC19 AmpR This Study pUC1085_down rcc01085 downstream flanking region ligated into pUC19 AmpR This Study pZDJΔ1085 upstream and downstream flanks of rcc01085 fused together in pZDJ GmR This Study p601-G5 611 bp 5‟ of the orfg1 start codon cloned into pXCA601 as a PstI-BamHI fragment (Leung et al., 2012)   42  2.9 ATPase assay ATPase assays were performed approximately as previously described (Carter & Karl, 1982, Gruenig et al., 2008). Reactions (50 μl) containing 1× Strand Exchange Buffer [25 mM Tris-acetate pH 7.4, 1 mM 2-mercaptoethanol, 5% (w/v) glycerol, 3 mM potassium glutamate, and 10 mM Mg-acetate], 1.9 μM (nt) [nt refers to equivalent nucleotide concentration; 1.9 µM nt is equivalent to 0.36 nM DNA molecule concentration in this case; such notation used throughout this thesis] ΦX174 virion DNA (ssDNA), 1 μM ET SSB (NEB), and 1 μM RecA (E. coli) (NEB), were incubated at 37°C for 10 min. Reactions were initiated by addition of 3 mM ATP; in reactions where RcDprA was included, this protein was added at the time of ATP addition. Production of  inorganic phosphate was detected colorimetrically by a malachite green system (Carter & Karl, 1982). At the indicated time points,10 μl of each reaction was removed and added to 500 μl of a solution of 0.03% malachite green, 0.3% ammonium molybdate, 0.02% Triton X-100, 0.28 M HCl, followed by vortexing and measurement of the A650. The phosphate concentration was estimated by comparison to standards and values are expressed as mM inorganic phosphate formed per litre (mM l−1). 2.10   Electrophoretic mobility shift assays (EMSA) The DNA molecules used in the EMSAs were either ΦX174 viron (ssDNA) ΦX174 replicative form 1 (dsDNA) (New England Biolabs), pUC19, or a linear dsDNA PCR product generated from the pIND4 plasmid, and purified using a PCR cleanup kit. pUC19 was obtained using a plasmid mini prep kit (Quiagen). To generate linear pUC19 for some experiments, the plasmid was cut with BamHI prior to use. DNA [64 μM nt for 43  ΦX174 ss and dsDNA, and pUC19 plasmid (equivalent to 12 nM and 6 nM, and 5 nM respectively), and 25 nM (6 μM) for the PCR product], was incubated with varying concentrations of RcDprA (0 to 7.8 μM) in 20 μl of Buffer A for 30 min at 37°C. Samples utilizing plasmids were separated on a 1% agarose gel whereas PCR products were separated on a 5% polyacrylamide gel. DNA was visualized by fluorescence after staining with ethidium bromide.  2.11   Nuclease protection assays A PCR product of ∼ 100 bp spanning the multiple cloning site of plasmid pIND4 made using the primers IND_seq_for and IND_seq_rev was purified using a PCR cleanup kit and used as target DNA. This product contains both BamHI and NcoI sites approximately in the middle of the amplified region. Ten µl of reactions containing 25 nM DNA, 1× New England Biolabs Buffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT, pH 7.9), and varying concentrations of RcDprA (0 to 3.9 μM), were incubated for 45 min at 37°C. Ten units of either BamHI or NcoI were then added (except the negative control), and the reactions were incubated for a further 45 min. Protein was then removed by addition of 50 mM ethylenediaminetetraacetic acid (EDTA) and 100 μg ml−1 proteinase K, with incubation at 65°C for 30 min. Samples were separated on a 5% polyacrylamide gel and stained with ethidium bromide to visualize DNA bands. 2.12   UV-sensitivity assays R. capsulatus cultures were grown phototrophically in RCV defined medium at 30°C to late log phase, and diluted in 10 ml portions of fresh RCV to ∼ 104 cfu ml−1. 44  Diluted cultures were exposed to a 15 W germicidal lamp at a distance of 50 cm for 0, 5, 15, or 30 sec as indicated, with gentle swirling. At each time point, 100 μl samples were taken, plated onto RCV agar in serial dilutions, and grown at 30°C for 3 days. The % survival was calculated as the total number of colonies arising from UV-treated samples divided by the total cfu of the non-exposed cells.  2.13   Bioinformatic analyses and homology modeling Sequences of DprA, ComEC, ComF, and ComM homologues available in GenBank (http://www.ncbi.nlm.nih.gov/genbank/) were used for phylogenetic analysis and homology searches. For the in-depth analysis of RcDprA, the phylogenetic analyses were generated using a MUSCLE multiple sequence alignment (Edgar, 2004), and a Bayesian MCMC tree building algorithm (Dereeper et al., 2008, Dereeper et al., 2010); the C-terminal DD3 region was trimmed from the alignment prior to phylogenetic tree construction. The RcDprA structure was modelled using the SWISS-MODEL automated protein structure homology modeling server (Arnold et al., 2006, Kiefer et al., 2009), based on the R. palustris DprA structure (PDB accession 3MAJ). The modelled residue range was 13–381, indicating a full length structural model. A QMEAN Z-Score of −1.727 indicates an accurate structural model (Kiefer et al., 2009). For structural searches of the PDB, a model of the RcDprA DD3 structure was used as a search query (aa 282–383) using the DaliLite v.3 software (Holm & Rosenstrom, 2010). All structural alignments images were generated using the PyMOL software, and rmsd values generated by pairwise comparisons using the Dali pairwise comparison online software (Hasegawa & Holm, 2009). 45   2.14   RcGTA recipient capability assay A rifampicin-resistant RcGTA overproducer strain (Yen et al., 1979), DE442, was used as a source of RcGTA for recipient capability and adsorption experiments. A sample of stationary phase culture grown phototrophically in YPS complex medium (Wall et al., 1975), passed through a 0.2 mm filter, was titred for RcGTA activity, and a diluted stock solution that produced ~ 800 rifampicin-resistant transductants per 100 ml of donor filtrate (with stationary phase B10 cells as a recipient) was used for all experiments. All strains used as RcGTA recipients, other than 37b4, were derived from WT B10. Cells were grown aerobically in RCV defined medium with shaking at 200 rpm to the stationary phase, harvested, and resuspended in an equal volume of G-buffer [10 mM Tris-HCL (pH 7.8), 1 mM MgCl2, 1 mM CaCl2, 1 mM NaCl, 500 mg ml-1 BSA] (Solioz et al., 1975). A transduction assay was then performed, where 100 µl of RcGTA stock, 100 µl of recipient cells, and 400 µl of G-buffer are mixed together. This mixture was incubated for 90 min at 30°C with gentle agitation, after which 900 µl of RCV medium were added, followed by incubation under the same conditions for 3 h. Cells were spread on RCV plates containing rifampicin and incubated aerobically for 3 days. Rifampicin-resistant colonies were counted and the average was corrected by subtracting the number of spontaneous rifampicin-resistant colonies (no addition of RcGTA, usually no more than 3%). Because of variability in total numbers of transductants between individual experiments, RcGTA recipient capability efficiencies are expressed as % WT (B10), with each experimental strain being compared with the WT control within the same experiment. In the case of the growth phase recipient 46  capability experiment, total numbers of rifampicin-resistant colonies from a single representative experiment are shown. The statistical significance of results was evaluated by One-Way ANOVA. A P-value of 0.05 (95% confidence interval) was set as a cut-off for significance; values are given in Appendix A2. 2.15   RcGTA adsorption assay To quantitatively measure the ability of different strains to bind to RcGTA, cells were grown aerobically in RCV defined medium with shaking at 200 rpm to the stationary phase, harvested, and re-suspended at the same density in G-buffer. The first step of a transduction assay was then performed, where 100 µl of RcGTA solution, 100 µl of recipient cells, and 400 µl of G-buffer are mixed together. This mixture was incubated for 90 min at 30°C with gentle agitation, after which this mixture was passed through a 0.2 mm filter. The residual levels of RcGTA in the filtrate (RcGTA that did not adsorb to cells) was quantified by performing another standard transduction assay using 100 µl of this filtrate as the RcGTA donor, and WT R. capsulatus B10 cells as the recipient. As two separate controls, an assay that included no recipient cells for adsorption (no cells), and an assay that contained no RcGTA were also performed. For cell surface extract competitive inhibition assays, WT B10 cells were used as a RcGTA recipient strain in all cases. Because of variability in total numbers between  experiments, adsorption efficiencies are expressed as a percent of the value obtained with no cells, with each experimental strain being compared with the un-adsorbed control (with the exception of the growth curve experiment). The statistical significance of results was evaluated by One-Way ANOVA. A P-value of 0.05 (95% confidence interval) was set as a cut-off for significance; values are given in Appendix A3. 47  2.16   Western blot For RcGTA production assays, cells were harvested from normalized stationary phase cultures of R. capsulatus grown in YPS (described in RcGTA production assay section), lysed by addition of sample loading buffer, and blotted as described below. For RcGTA adsorption assays, filtrate was concentrated 10-fold in a SpeedVac concentrator (Thermo Electron Corp) and samples were boiled for 10 min in sample loading buffer (50 mM Tris-HCl pH 6.8, 2% SDS, 10% glycerol, 0.1% bromophenol blue, 1% β-mercaptoethanol) prior to gel loading. Samples were separated on a 12% SDS-PAGE gel and blotted on to a nitrocellulose membrane (Perkin-Elmer). The blotting was done using a Mini Trans-Blot apparatus (Bio-Rad) according to the manufacturer‟s specifications in electroblot buffer (27.5 mM Tris-Base, 192 mM glycine, 20% methanol) at 100 V constant voltage for ~ 1.5 h. The primary antibody (rabbit) was raised against the R. capsulatus RcGTA capsid protein (Taylor, 2004). Primary antibody binding was detected using a peroxidase-linked anti-rabbit Ig secondary antibody (from donkey) as part of the enhanced chemiluminescence (ECL) kit according to the manufacturer‟s instructions (Amersham).   2.17   Phenol-sulfuric acid carbohydrate quantification Estimation of cell-associated carbohydrate (EPS) relative amounts was done using a modified phenol-sulfuric acid method (Liu et al., 1973). R. capsulatus cells were grown phototrophically to the stationary phase in RCV defined medium, and the cell concentration normalized to 450 Klett units by the addition of medium. The cells from 1 ml of each normalized culture were harvested in a microcentrifuge at 16500 g for 1 min 48  (same centrifugation for all steps), and washed three times in 50 mM NaCl. Cells were re-suspended in 1 ml of 50 mM EDTA and incubated at 37°C for 30 min. Cells were then pelleted, and the resultant supernatant containing LPS and any tightly associated EPS, such as capsule, was subjected to a phenol-sulfuric acid colourimetric carbohydrate quantification in the following manner: 200 µl of the sample and 200 µl of 5% phenol were mixed together in a glass test tube; 1 ml of 93% sulfuric acid was added, and the tube agitated to ensure mixing. Colour was allowed to develop for 10 min. Colour intensity was then measured at 490 nm in a spectrophotometer, and compared with standards of known carbohydrate concentration. The sugar standards were a 50:50 mixture of sucrose and fructose diluted from a stock of known concentration. The statistical significance of results was evaluated by One-Way ANOVA. A P-value of 0.05 (95% confidence interval) was set as a cut-off for significance; values are given in Appendix A4.  2.18   Capsule stain Capsules were negatively stained using Anthony‟s capsule stain (Anthony, 1931). In brief, 1 ml of stationary phase R. capsulatus cultures was harvested by centrifugation, and re-suspended in 1 ml of Carnation skim milk (skim milk powder was re-suspended in H2O at 1% w/v). An inoculating loop of each re-suspended culture was spread onto a clean microscope slide and allowed to dry in the air. Smears were then stained with 1% crystal violet for 5 min, and washed gently and thoroughly with 20% copper sulphate. Slides were then allowed to dry in the air, and subsequently examined using oil-immersion phase contrast microscopy at 1000X magnification. 49  2.19   Expression analysis of WT and ΔgtaI mutant strains Phototrophic cultures for microarray analysis were grown in RCV defined medium at 30°C. Cells were harvested at the logarithmic and stationary phases of growth as determined by culture turbidity. RNA extraction, cDNA synthesis, target labelling and hybridization were all performed as previously described (Mercer et al., 2010). Microarrays for a single sample of each strain in both phases of growth were performed by The Centre for Applied Genomics, The Hospital for Sick Children, Toronto, Canada. The raw data from the scanned arrays were normalized by Robust Multi-Array Analysis (RMA) (Irizarry et al., 2003) in Affymetrix Expression Console v1.1 (Santa Clara, CA) and exported for analyses. The relationships between the gene features on the custom array and the sequenced genome (NCBI Accession Number NC_014034) have been previously described (Mercer et al., 2010). This work was performed primarily by Dr. Ryan Mercer while in Dr. Andrew Lang‟s lab, and was generously shared with me prior to its publication.   2.20   LPS silver stains The LPS from R. capsulatus was visualized as previously described (Tsai & Frasch, 1982). LPS was purified by harvesting 1 ml of culture by centrifugation, followed by three washes in 1 ml of 50 mM NaCl. Cells were then re-suspended in 500 ml of 20 mM EDTA and incubated for 30 min. Cells were then pelleted by centrifugation (14500 rpm for 1 min) and the supernatant (containing LPS) was removed, treated with 0.5 mg/ml proteinase K for 4 h at 50°C, and concentrated in a SpeedVac concentrator 50  (Thermo Electron Corp). For LPS gels, material was loaded and electrophoresed as described in the Western blot section 2.16.  2.21   Surface polysaccharide extraction for inhibition of RcGTA binding Surface polysaccharides (EPS/LPS) were purified in the following manner: 50 ml of each strain was grown aerobically in RCV medium with shaking at 200 rpm until cultures reached the stationary phase. Cells were harvested by centrifugation at 12000 g for 30 min, followed by two consecutive washes in 50 mM NaCl. Cell pellets were re-suspended in 10 ml of 50 mM EDTA, and incubated overnight at room temperature. Cells were then removed by centrifugation, and the resultant supernatant (containing EPS/ LPS) was subsequently treated with proteinase K (1 mg ml-1) for 4 h, followed by heating at 80°C for 1 h to deactivate the protease. Samples were then dialysed against dH2O for 2 days with several buffer changes to remove EDTA, followed by quantification using the phenol-sulfuric acid method. Extracts were added to RcGTA adsorption reactions at a final concentration of 100 mg ml-1. Significance values are given in Appendix A5.  2.22   RcGTA transduction assay Bioassays of RcGTA activity were performed as described (Taylor, 2004) with minor modifications. WT R. capsulatus B10 (sensitive to rifampicin) was used as an RcGTA recipient strain. Donor strains of B10RifR, ΔgtaIRifR, ΔgtaRRifR and ΔgtaRIRifR were grown in YPS medium under phototrophic conditions and collected at stationary phase. 51  Donor strain cultures were normalized to 450 Klett units by addition of YPS medium, and 200 µl of 0.2 mm filtered culture liquid was mixed with 100 µl of the indicator strain cells and 400 µl of G-buffer (Solioz et al., 1975). The entire mixture was incubated for 90 min at ~30 °C with gentle agitation and then 900 µl of RCV medium were added and incubation under the same conditions was continued for 3–4 h. The cells were spread on RCV rifampicin plates and incubated aerobically at 30°C for 2–3 days. The rifampicin resistant colonies were counted (typically over 30 per plate) and the average was corrected by subtracting the number of spontaneous RifR resistant colonies (no addition of RcGTA) (generally between 0 and 3). Because of variability in total numbers of transductants between individual experiments, RcGTA transductions efficiencies are expressed as percent WT (B10), with each experimental strain being compared with the wild-type control within the same experiment. Statistical significance of results was evaluated by one way ANOVA, and values are given in Appendix A8.   2.23   RcGTA-borne DNA tracking assay An RcGTA stock was prepared from a DE442 overproducer mutant harbouring a plasmid containing the rcc01080 gene (pd1080Gm) interrupted by a gentamycin resistance cassette (A. Westbye, unpublished). This RcGTA stock was used because it contains a gentamycin resistance gene that is not present in the WT and mutant R. capsulatus strains studied in our work, and thus can be tracked from extracellular location of DNA, through periplasmic delivery, to entry into the cytoplasm by PCR analysis.  For the tracking assay, WT, ΔcomEC and ΔcomF strains were grown phototrophically in RCV medium to the stationary phase. Cells were harvested by 52  centrifugation and resuspended at an OD650 of 3.0 in G-buffer. A 500 µl sample of RcGTA stock and 500 µl of cells were mixed together and incubated at 30 °C with gentle shaking for 60 min (for the 'No GTA' control, 500 µl of G-buffer and 500 µl of WT cells were mixed together). After a 120 min incubation, cells were harvested by centrifugation, and washed three times in 1 ml of RCV medium. Cells were then resuspended in 1 ml of RCV, and incubated at 30 °C with gentle shaking for an additional 180 min. At this point, 50 µl of each reaction mixture were plated onto RCV + Gm to determine the GmR cfu/ml of each reaction. Cells were then collected by centrifugation and washed an additional 5 times in 1 ml of RCV medium, resuspended in 400 µl of 50 mM EDTA, and incubated at 37 °C for 60 min to disrupt the OM and release periplasmic contents. Cells were pelleted by centrifugation, and the supernatant liquid (containing released OM and periplasmic contents (Hancock, 1984)) was transferred to a fresh microfuge tube. DNA was extracted from the OM/periplasmic and cellular fractions by phenol-chloroform extraction, followed by isopropanol precipitation, and was resuspended in 30 µl of dH20, whereas cytoplasmic (chromosomal) DNA preparations were resuspended in 500 µl of dH20. Wash stringency was evaluated by taking samples after each wash step, and the presence of RcGTA-borne DNA evaluated by PCR using the primers Gm_qPCR_for and Gm_qPCR_rev. RcGTA-borne PCR amplification was undetectable after ~5 washes.  To quantify the amount of RcGTA-borne DNA in the OM/periplasmic fraction, qPCR was used with primers specific for a donor allele. The primers GmqPCR_for and GmqPCR_rev were used to detect the relative amounts of the gentamycin resistance gene in each periplasmic/OM fraction; these primers amplify an 85 bp region within the 53  gentamycin resistance cartridge. Residual periplasm/OM DNA levels were normalized to the level of the chromosomal puhA gene (rcc00659) in the chromosomal DNA fraction of each sample. The puhA gene is an endogenous photosynthesis gene present in R. capsulatus; the primers puhA_qPCR_for and puhA_qPCR_rev were used for quantification.  The SYBR select master mix (Applied Biosystems) was used as per the manufacturer‟s instructions. Reactions of 20 µl containing SYBR select master mix, 400 nM specific primers, and the target template were used to quantify target DNA in an a Applied Biosystems StepOne Plus Real-Time PCR system, using the program: 50 °C 2 min, [95 °C 15 sec, 60 °C 15 sec, 72 °C 60 sec]x40 (amplification), 95 °C 15 sec, 60 °C 15 sec, 95 °C 15 sec (melt curve). Amplicons were clearly distinguishable from primer dimers based on melt-curve analysis. Amplification of targets occurred between 15-25 cycles. As negative controls, reactions containing no DNA template were always included. As positive controls, standard concentrations of DNA containing either the gentamycin resistance cartridge or puhA were included in all qPCR runs, and were used to quantify the amount of DNA present in each test sample. A sample of 1 µl of each DNA re-suspension was used as template in all qPCR reactions. Values are presented as the ratio of residual periplasmic/OM gentamycin cartridge-containing DNA to the level of puhA DNA in the chromosomal fraction of cells. Statistical analysis of results is given in Appendix A6. Standard curves used for calibration of each primer set, and raw qPCR values are given in Appendix 8 and 9, respectively.    54  2.24  Plaque assays and phage spot assays Plaque assays were performed by growing each recipient strain to the stationary phase aerobically in YPS medium at 30 °C. 500 µl aliquots of culture were then transferred to 1.7 ml microfuge tubes, and 10 µl of phage stock added, and the tube inverted to ensure mixing. Mixtures were then incubated at room temperature for 30 minutes, transferred into 5 ml of 0.4% molten agar, followed by gentle swirling and pouring as an overlay onto 1.5% YPS agar plates. Plates were then incubated at 30 °C for 24 hours, and the plaques counted. For phage spot assays, the same procedure was done with each strain except no infecting phage was added, and the different dilutions of phage stocks were dropped as 10 µl spots onto the solidified agar overlay.  Stocks of Phage 1 was obtained by growing DE442 cells to the stationary phase in YPS medium aerobically at 30 °C. Cultures were then passed through a 0.2 µM filter, and the resultant filtrate was used as phage stock. For plaque assays, this stock was diluted 1/500, yielding ~250 plaques per plate. Stocks of Phage 2 were provided by A. B. Westbye, and diluted 1/100 000, yielding ~500 plaques per plate. For spot assays, phage stocks were diluted serially 1/10 in YPS medium, and 10 µl of each dilution dropped onto a cell containing agar overlay.   55  Chapter 3: Results 3.1 Quorum-sensing regulation of RcGTA production This section describes my work on a quorum-sensing system in R. capsulatus, and how this system connects changes in cell culture composition to changes in the production of RcGTA. Figure 3-1 shows the genomic context and organization of the gtaR (signal receptor) and gtaI (signal synthase) genes. My initial work was aimed at confirming whether GtaR and GtaI function as a cognate QS pair. 3.1.1 Co-transcription of gtaR and gtaI The gtaI putative start codon is only 49 bp from the gtaR stop codon, and it was speculated that they are transcribed as an operon (Leung, 2010) because many LuxI/ LuxR-type QS pairs are co-regulated at the transcriptional level. To test this hypothesis, reverse transcription PCR was employed. Total RNA from WT R. capsulatus strain B10 was used to generate cDNA, which was subsequently used as a template in PCR reactions. Primers were designed to amplify the intergenic regions between the gtaR and gtaI genes, and between gtaR, gtaI and the genes located immediately upstream (rcc00327; rplQ) and downstream (rcc00330) (Fig 3-1A). A series of PCR reactions was performed using the cDNA, genomic DNA, or total RNA as template. An amplification product of the region between gtaR and gtaI was obtained using cDNA or genomic DNA as template (Fig 3-1B). In contrast, neither the upstream nor the downstream primer pairs yielded a PCR product from the cDNA template, although products were seen using DNA as a template (Fig 3-1B). None of the primer pairs yielded a product in the 56  RNA negative control. These results show that the gtaR and gtaI genes are co-transcribed, and that this transcription unit does not include either of the flanking genes.  Figure 3-1. RT-PCR of the gtaRI bicistronic transcript. A. Schematic representation of gtaR, gtaI and the two flanking genes rplQ and rcc00330; locations of primer sites designed to amplify across intergenic regions are indicated by the small arrows. B. PCR results using genomic DNA, unfractionated RNA, or cDNA produced from total RNA as the template.  3.1.2 Effects of mutations in gtaR and gtaI on RcGTA production The hypothesis that gtaR and gtaI function as a cognate QS pair that regulates RcGTA gene expression was directly investigated by studying separate knockouts of gtaR (ΔgtaR strain) and gtaI (ΔgtaI strain), and a double knockout of gtaI and gtaR (ΔgtaRI strain). RcGTA expression was evaluated by using the rcgta::lacZ fusion plasmid p601-g65 (Leung, 2010, Leung et al., 2012), western blots probed with anti-RcGTA capsid protein antibodies, and at the functional level by RcGTA transduction bioassays. I found that the orfg1::lacZ expression was lower in the ΔgtaI strain, but not significantly different in the ΔgtaR and ΔgtaRI strains, relative to the WT strain (Fig 3-2A). Furthermore, supplying the ΔgtaI strain with exogenous C16-acyl-HSL restored WT levels of orfg1::lacZ expression, and trans-complementation of the gtaR mutation 57  restored the gtaI mutant phenotype (Fig 3-2A). This is similar to the gtaR gene expression profile in these strains (Leung et al., 2012), and indicates that RcGTA is regulated by the GtaR/I QS system. The amount of RcGTA capsid protein detected in western blots was decreased in the ΔgtaI mutant compared with the WT strain, whereas the ΔgtaR and ΔgtaRI mutants were similar to the WT strain (Fig 3-2B). Addition of exogenous C16- acyl-HSL (2 µM) to the ΔgtaI strain restored WT levels of RcGTA production, and trans-complementation of the ΔgtaRI mutant with an extra chromosomal copy of the gtaR gene [ΔgtaRI(R)] reverted this strain to the ΔgtaI phenotype [Fig 3-2; ΔRI(R)]. The gene transduction assays showed a pattern of results that paralleled the other approaches. The ΔgtaI, ΔgtaR and ΔgtaRI strains yielded 18%, 81% and 116%, respectively, as many transductants as the WT control, whereas the ΔgtaI strain supplemented with C16- acyl-HSL and the ΔgtaRI(R) strain yielded 103% and 7% as many transductants respectively (Fig 3-2C). The similarity in the results of these three independent measures of RcGTA gene expression strongly argues that GtaI and GtaR are part of the same signaling system, because the gtaR mutation reproducibly suppresses the effect of the gtaI mutation, and introduction of the gtaR gene on a plasmid into the double knockout (ΔgtaRI) strain restores the single knockout (ΔgtaI) phenotype. Therefore, in this signalling system, the gtaR mutation is dominant over the gtaI mutation. Furthermore, these results are consistent with GtaR being a negative regulator of transcription, and thus gtaRI being a repressor-based QS system. 58   Figure 3-2. Comparison of RcGTA gene expression in QS mutant strains of R. capsulatus. A. β-Galactosidase activities of strains containing the orfg1::lacZ promoter fusion plasmid p601-g65. B. Western blots of cells probed with RcGTA capsid protein antiserum. C. Frequency of RcGTA-mediated gene transfer. The WT strain B10 is indicated by WT, mutant strains are indicated as ΔgtaI, ΔgtaR and ΔgtaRI, and the GtaR complement is indicated as ΔgtaRI(R); C16 indicates the ΔgtaI culture supplemented with C16 acyl-HSL. Error bars represent the standard deviation of the mean between samples (n = 3).  3.1.3 RcGTA production is stimulated by substances produced by other species Some QS systems respond to non-endogenous acyl-HSLs, such as the LasR/I system in P. aeruginosa (Savka et al., 2011). To evaluate this possibility in R. capsulatus, I tested whether RcGTA production was stimulated by diffusible signal molecules from other bacterial species by adding 2 ml of sterile, cell-free media from 59  stationary phase cultures of different organisms into 17 ml phototrophic ΔgtaI exponential phase cultures. Cultures were grown to the stationary phase and evaluated for RcGTA capsid protein production in western blots probed with antiserum against the capsid protein. Partial restoration of capsid production was observed with addition of culture media from R. capsulatus B10, R. sphaeroides 2.4.1, Paracoccus denitrificans and E. coli MG1655 (Fig 3-3A), whereas Rhodopseduomonas palustris CGA009 and un-inoculated Luria–Bertani (LB) medium failed to elicit a response.  These data were confirmed in an RcGTA transduction assay, where ΔgtaI cultures supplemented with cell-free media from R. sphaeroides 2.4.1, P. denitrificans and E. coli MG1655 cultures yielded 56%, 59% and 34%, respectively, as many transductants as the WT control, whereas an un-supplemented ΔgtaI culture generated only 9 % as many transductants (Fig 3-3B). R. sphaeroides 2.4.1 and P. denitrificans are both known to produce long-chain acyl-HSLs (R. sphaeroides produces 7,8-cis-N-(tetradecenoyl)homoserine lactone, whereas P. denitricans produces C16-acyl-HSL) (Puskas et al., 1997, Schaefer et al., 2002), and so these results represent a bioassay indicating that a variety of acyl-HSLs stimulate the production of RcGTA. However, E. coli MG1655 is not known to synthesize an autoinducer of similar size and structure to long-chain acyl-HSLs, but rather produces a boron-containing substance called AI-2 (Surette et al., 1999). To evaluate whether AI-2 stimulates RcGTA production, the ability of the ΔgtaI strain to respond to growth medium from an E. coli MG1655 ΔluxS strain (produces no AI-2) (Tavender et al., 2008) was tested, and a response similar to medium from WT E. coli MG1655 was observed (data not shown), indicating that AI-2 is not involved. Regardless, these results indicate that R. capsulatus is capable of 60  communicating with a variety of other bacteria by reception of more than one type of signal, and responding by inducing the production of RcGTA.   Figure 3-3. RcGTA production in R. capsulatus acyl-HSL synthase mutant strain ΔgtaI in response to the addition of cell-free media from stationary phase cultures. On the left are data from WT strain B10 and ΔgtaI mutant controls with no addition, and on the right are data from addition of C16-acyl-HSL or sterile LB medium to the ΔgtaI mutant. In the middle are data when added media were from: WT R. capsulatus B10 (+ WT); R. sphaeroides 2.4.1 (R. sph); P. denitrificans (P. den); R. palustris CGA009 (R. pal ); E. coli MG1655 (E. col ). A. Western blot evaluating RcGTA capsid production. B. Frequency of RcGTA-mediated gene transfer relative to the WT strain B10. Error bars represent the standard deviation ofthe mean between samples (n = 3).  3.1.4 RcGTA production is stimulated by multiple, specific long-chain acyl-homoserine lactones To confirm and extend the results obtained by inducing RcGTA gene expression with signals from other species, a wide variety of commercially available acyl-HSLs were tested in bioassays of the ΔgtaI mutant, using the three methods described above 61  for analysis of gtaR and gtaI mutants. A significant restoration of β-galactosidase activity in the ΔgtaI strain was observed with the addition of C12-, C14-, C16-, C16c- and C18-acyl-HSL (Fig 3-4A). The ability of R. capsulatus to respond to C16c-acyl-HSL (N-cis-hexadec-9Z-enoyl-L-homoserine lactone), which has a double bond in the acyl tail, indicates that the length rather than the shape of the HSL acyl tail is important for detection by the R. capsulatus QS system. These findings show that R. capsulatus is capable of responding to multiple exogenous acyl-HSLs by inducing transcription of RcGTA orfg1.  The transcriptional changes in response to multiple acyl-HSLs were paralleled by restoration of RcGTA capsid protein production to approximately the WT level in Western blots of ΔgtaI cells from cultures supplemented with C12-, C14-, C16-, C16c- and C18-acyl-HSL (Fig 3-4B). RcGTA production may be weakly stimulated by short chain acyl-HSLs, as faint bands are visible in response to acyl-HSLs with chain lengths of C4 to C10.  A quantitative measure of the amount of mature, functional RcGTA particles released from ΔgtaI cells in response to the addition of acyl-HSLs was obtained in gene transduction assays. Cell-free culture medium from the ΔgtaI strain generated 13% the number of transductants as the WT strain, whereas supplementation of ΔgtaI cultures with acyl-HSLs yielded 102% (C12), 115% (C14), 103% (C16), 102 % (C16c) and 105% (C18) of the number obtained with a WT donor (Fig 3-4C). Experiments on ΔgtaRI cultures supplemented with C12-, C16-, and C18-acyl-HSL showed little difference in RcGTA capsid protein production and transduction efficiencies, compared with unsupplemented ΔgtaRI cultures (Fig 3-5A and B). Taken together, these data show 62  that R. capsulatus responds to a wide range of N-acylhomoserine lactones, with a maximal response to endogenous acyl-HSLs and those with a similar acyl chain length. Because the ΔgtaI mutant increased RcGTA gene expression in response to acyl-HSLs whereas the ΔgtaRI mutant did not, it appears that these multiple signals modulate the activity of the GtaR protein, and that the ORFs rcc01088 and rcc01823 do not affect the expression of RcGTA genes in response to these signals.    63   Figure 3-4. Comparison of RcGTA gene expression in R. capsulatus WT B10, and the ΔgtaI mutant in the absence and presence of exogenous acyl-HSLs. A. β-Galactosidase activities of strains containing the orfg1::lacZ promoter fusion plasmid p601-g65. B. Western blots of cells probed with RcGTA capsid protein antiserum. C. Frequency of RcGTA-mediated gene transfer. WT, WT strain B10, and ΔgtaI, the ΔgtaI knockout, both with no addition of acyl-HSL. C4-C18, chain length of acyl-HSLs added to cultures of the ΔgtaI mutant. Error bars represent the standard deviation of the mean between samples (n = 3).  64    Figure 3-5. Control experiment comparing RcGTA gene expression in R. capsulatus WT B10, ΔgtaI, and ΔgtaRI mutants in the absence and presence of three exogenously added long-chain acyl-HSLs, C12, C16, and C18 acyl-HSL. A. A western blot showing the amount of RcGTA capsid production within the cells of each strain.  B. The relative transduction efficiency of each strain compared to WT cells. Single replicates of the ΔgtaI and ΔgtaRI mutants are shown, in addition to the ΔgtaI mutant response to each acyl-HSL, as well as the ΔgtaRI strain response to the same acyl-HSLs; the error bar represents the variance between replicates.  3.1.5 Overexpression of gtaI does not increase RcGTA production The long-chain C14 and C16-acyl-HSLs produced by R. capsulatus are hydrophobic molecules, and are thought to primarily associate with the membranes of R. capsulatus. Thus, they may not readily partition into the cytoplasm of other R. 65  capsulatus cells (Schaefer et al., 2002). Furthermore, the gtaRI operon may form an auto-inducing circuit based on the gene organization and direct regulation by GtaR. RcGTA production is induced in a sub-set of cells in a culture (Hynes et al., 2012), and such auto-inducing circuits have been proposed to underlie such processes (Lazdunski et al., 2004). Therefore it was possible that a QS autoinducing circuit is initiated in a sub-population of cells, leading to the observed low frequence of RcGTA production. To test this possibility, a plasmid containing the gtaI coding sequence driven by a fructose inducible promoter was generated (plasmid pGtaI). The logic was that fructose-induction of gtaI would free expression of gtaI from the putative autoinducing circuit, ensuring production of acyl-HSL in all cells.   Expression of gtaI was validated by showing that RcGTA production of a ΔgtaI mutant was restored to WT levels (Fig 3-6A). Plasmid pGtaI was then conjugated into the strain SBpG, which contains an mCherry (fluorescent protein) reporter gene driven by the RcGTA promoter, and still produces WT levels of RcGTA (H. Ding, personal communication). Cultures were grown to the stationary phase, with or without the addition of fructose (12 mM; induces expression of gtaI), and RcGTA production evaluated by transduction assays. The frequency of RcGTA-induced cells in the population was assed by fluorescence microscopy. Induction of gtaI expression did not increase RcGTA transduction above WT levels (Fig 3-6B), nor the frequency of RcGTA expression (3-6C). These data indicate that some other factor(s) is responsible for the restriction of RcGTA expression to a sub-population of cells.   66    Figure 3-6. Effect of fructose induction of gtaI on RcGTA population level expression. A. RcGTA production of WT B10, ΔgtaI, and ΔgtaI(pGtaI)+12 mM fructose cultures. B. RcGTA Production by SBpG, SBpG(pGtaI), and SBpG(pGtaI) supplemented with 12 mM fructose to induce gtaI transcription. C. Fluorescence image where cells were excited by 561 nm light (fluorescence emission 610 nm) overlain on a light microscopy image of the same cells. In all cases, SBpG (referred to as WT), which is a derivative of the SB1003 WT strain with a chromosomal Rcgta::mCherry fusion was used to evaluate RcGTA population level expression in the stationary phase.   67  3.2 Quorum-sensing regulation of a capsular polysaccharide receptor for the RcGTA           This section describes my research on connections between the phase of culture growth and the capability of cells to bind and acquire alleles from RcGTA particles.  3.2.1 RcGTA recipient capability and adsorption capability are growth-phase dependent The effect of growth phase on RcGTA recipient capability of R. capsulatus cells was evaluated by quantifying the number of cells that received and expressed a rifampicin resistance marker from a stock solution of RcGTA of known titre, using cells harvested at different time points during culture growth (Fig 3-7A). The recipient capability of R. capsulatus cells at early growth phases was much less than those at high cell densities, showing a positive correlation between the optical density (OD) of cultures at time of harvest and recipient capability (3-7B). The recipient capability assay does not address whether cells in early growth phases lack an RcGTA receptor molecule, the required recombination machinery, or possibly other factors required for RcGTA-mediated gene transduction.  The possibility of a receptor deficiency was investigated by employing an RcGTA adsorption assay with the same culture samples used as RcGTA recipients. The ability of RcGTA to adsorb to cells was measured by quantifying the transduction efficiency of cell-free (non-adsorbed) RcGTA after incubation with cells. The capability of cells to adsorb RcGTA increased in tandem with the culture density of the culture at time of harvest, indicating that cells adsorbed greater numbers of RcGTA particles in later 68  growth phases (Fig 3-7C). These two types of experiment show that the ability of cells to bind RcGTA particles and acquire a new allele is culture growth phase-dependent, and maximal in the stationary phase. By analogy with the attachment of phage to cell surface-exposed receptors, I hypothesized that a receptor required for RcGTA binding is produced, or becomes available for attachment, as cultures increase in cell concentration.   Figure 3-7. Effect of growth phase on RcGTA recipient capability and adsorption. A. Growth curve of R. capsulatus B10 culture used for recipient capability and adsorption experiments. Error bars represent the variation in OD660 between two duplicate cultures. B. Number of rifampicin-resistant colonies obtained in a transduction assay using equal numbers of cells at different phases of growth as recipients for RcGTA. Error bars represent the variation between two samples (one sample from each culture). C. RcGTA adsorption to cells at different growth phases. The vertical axis shows the number of rifampicin-resistant colonies derived from an adsorption assay.  3.2.2 Effects of mutations in gtaR and gtaI on RcGTA recipient capability and attachment to cells RcGTA production is regulated by the gtaR and gtaI QS genes (Schaefer et al., 2002, Leung et al., 2012). The correlations of the increases in recipient capability and RcGTA cell-adsorption to culture density indicated a possible link to the GtaR/I QS 69  system. To evaluate this possible link, the recipient capability of stationary phase WT, ΔgtaI, ΔgtaR and ΔgtaRI cells, as well as the ΔgtaI mutant supplemented with C16-acyl- HSL was measured. The ΔgtaI mutant yielded on average 7% as many gene recipients as the WT strain, and recipient capability was restored to 109% of the WT level by the addition of exogenous C16-acyl-HSL (Fig 3-7A). The ΔgtaR and ΔgtaRI mutants yielded average recipient frequencies of 103% and 98% of WT respectively (Fig 3-8A).  To determine whether the decrease in the ΔgtaI mutant recipient capability was a result of decreased binding of RcGTA to cells, assays were performed on all the cultures evaluated in the recipient capability experiments described above. The ΔgtaI mutant was greatly impaired in the adsorption of RcGTA particles, and adsorption was restored to WT levels by the addition of C16-acyl-HSL (Fig 3-8B). Furthermore, WT amounts of RcGTA adsorption were observed for the ΔgtaR and ΔgtaRI mutants, with the amounts of cell-free RcGTA inversely proportional to the recipient capability of these mutants (Fig 3-8B). In western blots probed for the RcGTA capsid protein remaining in the filtrate of the adsorption assay, the amounts of capsid paralleled the residual RcGTA activity values, confirming that the amount of RcGTA had decreased (Fig 3-8C). These results indicate that GtaR/I QS regulates the expression of genes encoding a cell surface factor required for maximal RcGTA adsorption to cells. 70   Figure 3-8. Comparison of RcGTA recipient capability of QS mutant strains with their ability to adsorb RcGTA particles. A. RcGTA recipient capability of WT, ΔgtaI, ΔgtaR, ΔgtaRI, and ΔgtaI supplemented with C16-acyl-HSL strains. B. RcGTA adsorption ability of strains (values are presented as a percentage of the number of RifR transductants obtained in the unabsorbed control where no cells were added to the reaction mixture, indicated by %NC). C. Western blot of adsorption assay filtrate probed with RcGTA capsid protein antiserum. Error bars represent the standard deviation between samples (n ≥3).   71  3.2.3 Analysis of extracellular polysaccharide (EPS) production in the gtaR and gtaI mutant strains R. capsulatus WT strain B10 cells form a loose cell pellet when centrifuged and this pellet is partially dissociated with a single inversion of the tube (Fig 3-9). The ΔgtaI mutant, under the same conditions, produces a tight pellet that requires considerable mixing force to resuspend. The ΔgtaR mutant has a loose pellet phenotype, as does the ΔgtaRI double mutant (Fig 3-10A). These results indicate that one or more genes required for the loose pellet phenotype is negatively regulated by the GtaR protein, after binding of acyl-HSL, because disruption of the gtaR gene does not change this phenotype relative to the WT strain, whereas mutation of the gtaR gene suppresses the effects of the gtaI mutation.  The loose cell pellet persisted after several washes in a minimal buffer (50 mM NaCl in dH2O), indicating that the looseness of the cell pellet is a property due to a substance that is tightly associated with cells (data not shown). To evaluate the causative agent of the loose cell pellet phenotype, WT cells were treated with a selection of enzymes or EDTA. Treatment with EDTA, which is known to disrupt the OM of Gram-negative bacteria (Hancock, 1984), or proteinase K, resulted in a tight cell pellet whereas other chemicals and enzymes tested did not have a similar effect (Fig 3-9). These results indicate that the loose pellet phenotype is due to a cellular structure attached to the OM of R. capsulatus B10 cells, and it may involve a protein component.    72   Figure 3-9. Effect of various enzymatic or chemical additives on R. capsulatus pellet formation.  Cells were from a culture of R. capsulatus B10 grown phototrophically in RCV medium, with exception of the indicated culture grown phototrophically in YPS. All enzymes were added to a final concentration of 0.5 mg/ml, and EDTA was added to a concentration of 50 mM. Samples were centrifuged at 16,500 g for 1 min after treatment.   In other bacteria, similar cell pellet phenotypes are caused by EPS such as capsular polysaccharide (Ionescu & Belkin, 2009). Because R. capsulatus B10 has a capsule (Weaver et al., 1975), the possibility that the loose pellet was caused by the production of an EPS that is part of the capsule was investigated. The total amount of EPS and LPS in EDTA extracts of cells was roughly quantified using a phenol-sulfuric acid method, and the levels of cell-associated EPS/ LPS correlated with the loose pellet phenotype. The ΔgtaI strain produced much less EPS/LPS than WT cells, and this production was restored by addition of exogenous C16-acyl-HSL. Furthermore, both the ΔgtaR and ΔgtaRI mutants produced WT levels of EPS/LPS (Fig 3-10B). These results indicate that the GtaR/GtaI QS system regulates EPS/LPS production, but do not determine whether this EPS/LPS is the R. capsulatus capsule, or whether the loose cell pellet phenotype relates to the binding of RcGTA. EDTA extracts contain many molecules associated with the OM, and there was a consistently high background signal 73  when quantifying surface polysaccharides with the phenolsulfuric acid method. Because the phenol-sulfuric acid assay measures total carbohydrate levels, the consistently high background measurements are likely a result of non-capsular polysaccharide (such as LPS) being present in extracts of strains lacking the capsule.  Lastly, liquid cultures of the ΔgtaI, ΔgtaI + C16-HSL, ΔgtaR, and ΔgtaRI appeared similar to WT in RCV defined medium (Fig 3-10C).   74    Figure 3-10. Evaluation of EPS production in R. capsulatus QS mutants. A. Pellet formation of equal numbers of cells of phototrophically grown B10 (WT), ΔgtaI, ΔgtaR, ΔgtaRI, and ΔgtaI + C16-acyl-HSL R. capsulatus strains after centrifugation for 1 min. B. Levels of cell-associated EPS production in an extract of each strain as measured by a phenol-sulfuric acid assay. Error bars represent the standard deviation between samples (n = 3), values were calculated based on standard samples with a known amount of a 1:1 mixture of glucose and fructose. C. Images of tubes of phototrophically grown WT B10 (WT), ΔgtaI, ΔgtaI + C16-HSL, ΔgtaR, and ΔgtaRI strains.   75  3.2.4 Microarray and bioinformatics identification of putative EPS biosynthesis genes To identify genes potentially involved in the production of EPS, microarrays evaluating the relative gene expression in the ΔgtaI mutant versus WT cells [NCBI Gene Expression Omnibus (GEO) database Accession No. GSE41014] were used. A number of potential polysaccharide biosynthesis genes were downregulated in the ΔgtaI mutant relative to the WT strain, between 1.3- and 5.4-fold in the stationary phase (Table 3-1). The putative polysaccharide biosynthesis operon containing ORFs rcc01081-rcc01086, was selected as containing candidate genes for the production of an EPS. The rcc01081-rcc01086 ORFs are annotated in the R. capsulatus strain SB1003 genome as two group 1 glycosyltransferases (GTase), an epimerase, two putative membrane proteins, and a group 1 GTase respectively (Table 3-2). To more accurately annotate these ORFs, I performed BLASTP searches and hydropathicity analyses (Whitfield, 2006, Moreno-Hagelsieb & Latimer, 2008). The top BLASTP hits to Rcc01081-Rcc01086 include components present in both LPS O-antigen biosynthesis systems and capsular polysaccharide biosynthesis operons (Cuthbertson et al., 2009, Raetz & Whitfield, 2002, Whitfield, 2006). These include three GTases, an epimerase, and genes predicted to encode a polysaccharide flippase (wzx) and a polymerase (wzy) (Table 3-1 and 3-2). Hydropathicity analysis of the Rcc01081-Rcc01086 proteins lends support to these annotations, notably the Wzx (encoded by rcc01084) and Wzy (rcc01085) protein homologues. Although the amino acid sequence conservation of Wzx and Wzy proteins is often low, a hydropathy profile of multiple transmembrane segments is a strongly conserved characteristic (Whitfield, 2006). The genes indicated 76  as encoding Wzx- and Wzy-like proteins have a hydropathy profile consistent with eight to nine transmembrane segments (Table 3-2). To verify that that these genes are QS-regulated, the promoter activity of an rcc01081::lacZ in-frame fusion plasmid, which contains approximately 1.5 kb of sequences 5′ of the rcc01081 start codon, was measured. The WT, ΔgtaI, ΔgtaR, ΔgtaRI strains containing this plasmid were grown phototrophically in RCV defined medium to the stationary phase, and the β-galactosidase specific activity measured. The rcc01081::lacZ expression in the ΔgtaI strain was reduced to 25% of the WT activity, and expression was restored to WT levels upon addition of C16-acyl-HSL to cultures (Fig 3-11). Furthermore, both the ΔgtaR and ΔgtaRI strains yielded WT levels of rcc01081::lacZ expression (Fig 3-11), verifying that rcc01081 expression is GtaR/GtaI-regulated.     Figure 3-11. Comparison of rcc01081::lacZ fusion expression in R. capsulatus WT B10, ΔgtaI, ΔgtaR, ΔgtaRI, and ΔgtaI supplemented with C16-acyl-HSL. β-galactosidase activities of strains are indicated on the vertical axis. Error bars represent the variation between two samples.  77  The foregoing analysis prompted a search of the R. capsulatus genome for homologues of the initiating GTases WbaP and WecA, as well as Wzb, Wzc and Wza homologues, which function as machinery for polymer export to the cell surface  (Whitfield, 2006, Cuthbertson et al., 2009). A BLASTP search identified ORFs rcc01932, encoding a WecA homologue (22% amino acid identity), and rcc01958-1960, which encode homologues of: Wzc (Rcc01958); Wzb (Rcc01959); and Wza (Rcc01960); (36%, 46% and 36% amino acid identity, respectively) (Table 3-2). The hydropathy profile of Rcc01932 matched the profile expected for this protein (Table 3-2). The rcc01932 gene (encoding the putative initiating GTase, WecA) is of particular interest because it is down-regulated under the same conditions as the rcc01081-1086 cluster, and could encode an enzyme catalysing a key step (initiation) in polysaccharide chain biosynthesis. A schematic depiction of group 4 capsule biosynthesis adapted from Whitfield et al. (Whitfield, 2006) is given in 3-12. On the basis of these analyses, I hypothesized that rcc01081-rcc01086 and rcc01932 are genes involved in capsule production in R. capsulatus, and that this capsular polysaccharide is important for RcGTA adsorption to cells.            78  Table 3-1. Relative transcription of putative EPS/CPS gene cluster and additional required genes as analyzed by microarray analysis. Values are expressed as the fold change in a gtaI mutant relative to WT, and log versus stationary phase in the WT. All cultures grown in RCV defined medium. Locus Genome Annotation WT/ΔgtaI log1 WT/ΔgtaI stat2 RCV stat/log3 rcc01081 glycosyl transferase, group 1 4.53 3.06 2.02 rcc01082 glycosyl transferase, group 1 4.02 2.83 1.49 rcc01083 Ispl1; UDP-glucuronate 5'-epimerase  2.59 2.16 1.51 rcc01084 membrane protein, putative 2.94 2.12 1.44 rcc01085 hypothetical protein 3.73 2.36 1.48 rcc01086 family 2 glycosyltransferase 2.65 2.92 1.5      rcc01932 glycosyl transferase, family 4 8.93 5.36 3.45 rcc01958 Wzc; tyrosine-protein kinase  1.66 1.39 1.57 rcc01959 Wzb; protein-tyrosine phosphatase 2.08 1.27 1.8 rcc01960 Wza; polysaccharide export protein 2.67 1.75 1.01 1 Ratio of WT to ΔgtaI microarray values for cells grown to the exponential phase of growth. 2 Ratio of WT to ΔgtaI microarray values for cells grown to the stationary phase of growth. 3 Ratio of microarray values of cells in the stationary phase to cells in the exponential phase.                     79  Table 3-2. Bioinformatic analysis of putative EPS/CPS biosynthesis gene cluster and additional related genes. Data shown include best BLASTP hits, pairwise alignment identities, number of predicted transmembrane segments (TMS) as indicated by a hydropathicity plot (window size = 19), and predicted function in EPS/CPS biosynthesis. Locus Genome Annotation BLASTP top hit (*indicates previously studied) % ID # Predicted TMS   Predicted function  rcc01081 glycosyl transferase, group 1 PglA; Campylobacter jejuni* 27.9 0 repeat unit assembly  rcc01082 glycosyl transferase, group 1 WffV; Shigella dysenteriae 39 1 repeat unit assembly  rcc01083 Ispl1; UDP-glucuronate 5'-epimerase IspL; Sinorhizobium meliloti*  54.3 0 repeat unit monosaccharide biosynthesis rcc01084 membrane protein, putative Wzx; Cronobacter malonaticus 21.3 8 repeat unit flippase   rcc01085 hypothetical protein Wzy; Escherichia coli* 22.8 9 polysaccharide polymerase rcc01086 family 2 glycosyltransferase Wbbl; Mycobacterium tuberculosis* 13.1 0 repeat unit assembly   rcc01932 glycosyl transferase, family 4 WecA; Haemophilus influenzae 21.6 9 repeat unit chain initiation  rcc01958 wzc; tyrosine-protein kinase  Wzc; Klebsiella pneumoniae* 35.5 2 polysaccharide export  rcc01959 wzb; protein-tyrosine phosphatase Wzb; Erwinia amylovora* 45.8 1 polysaccharide export rcc01960 wza; polysaccharide export protein Wza;Escherichia coli* 36.3 0 polysaccharide export    80   Figure 3-12. Schematic diagram of an archetypal type group four capsule biosynthesis system in Escherichia coli (Whitfield, 2006). Repeat polymer assembly begins with the attachment of an initial monosaccharide onto a polyisoprenoid lipid undecaprenyol di-phosphate carrier (und-PP) by WecA homologues. Additional monosaccharides are then sequentially attached to the growing glycan chain by additional glycosyltransferases, generating an und-PP-linked repeat unit. The synthesized und-PP-linked repeat units are subsequently flipped into the periplasm in a manner requiring Wzx, where they are polymerized together in either a branched of un-branched fashion by the Wzy protein. Studies in E. coli indicate that the transphosphorylation of Wzc and de-phosphorylation by the Wzb phosphatase is required for continued polymerization. The finished polymer is the transported out of the cell by Wza, which acts as an outer-membrane channel (Whitfield, 2006, Cuthbertson et al., 2009). R. capsulatus proteins predicted to function in this system are indicated by the Rcc number.   81  3.2.5 Evidence for horizontal gene transfer acquisition of rcc01085 (wzy) During the initial analysis of the rcc01081-rcc01086 gene cluster (depicted in Fig 3-13A), a rather striking observation was made. When examining the GC content of the rcc01081-86 region with the Artemis genome viewer, a significant drop from about 66% GC (the genome average) to 48% GC was visible in a gene in the middle of this putative operon (Fig 3-13B). This drop spanned the entire coding sequence of only a single gene, rcc01085, which based on BLAST, hydropathy, and contextual analysis, is the wzy polysaccharide polymerase homologue. Based on this striking difference in GC content, this gene was further analyzed by examining the codon usage using the graphical codon usage analyzer program to compare rcc01085 to the rest of the genome. The codon usage of this gene is also strikingly different (38.24% different than the mean, Fig 3-13C); as an illustration, the rcc01081 result (9.09% different than the mean) is shown, which is typical of other genes in R. capsulatus such as the puhA photosynthesis gene, which is 14.8% different than the mean. These two analyses indicate that rcc01085 may have been acquired by horizontal gene transfer because the codon usage and GC content are so different from the rest of the organism.  82    Figure 3-13. Schematic depiction of putative CPS biosynthesis genes and evidence for horizontal gene transfer acquisition of rcc01085. A. Genomic organization of the rcc01081-1086 gene cluster, and surrounding genes. B. GC content of rcc01081-1086 genomic region with a 2.5 standard deviation cutoff and a window size of 1000. C. Relative codon usage of rcc01081 compared to rcc01085. Relative adaptiveness accounts for number of codons which code each amino acid in the genome.  83  3.2.6 Analysis of capsule production and mutagenesis of rcc01081, rcc01085, and rcc01932 Capsule production in the ΔgtaI, ΔgtaR, ΔgtaRI mutants, and ΔgtaI supplemented with C16-acyl-HSL, was evaluated using a capsule stain (Anthony, 1931) and microscopic examination of cells. When viewed under a miscroscope, all strains were observed to form morphologically normal cells (Fig 3-14A). When capsule stained WT cells were viewed inder a microscope, a lightly stained halo surrounding the cells was visible (Fig 3-14B), indicative of the presence of a capsule. The ΔgtaI mutant lacked this halo, indicating the absence of a capsule. Capsule production was restored in the ΔgtaI mutant by addition of C16-acyl-HSL; furthermore, both the ΔgtaR and ΔgtaRI strains produced capsules similar to those of WT cells (Fig 3-14). These results indicate that the GtaR protein negatively regulates production of the capsule, analogous to the GtaR-regulation of RcGTA production (Leung et al., 2012) and recipient capability.    84   Figure 3-14. Phase contrast microscopy and capsule stain images of WT B10 (WT), ΔgtaI, ΔgtaI + C16-acyl-HSL, ΔgtaR, ΔgtaRI R. capsulatus strains. A. Phase contrast microscopy images of the strains listed above, at 1000X magnification. B. Capsule stain images of WT and QS mutants listed above.   To confirm that the foregoing results were consistent with a capsule biosynthesis defect, the R. capsulatus strain 37b4, a non-encapsulated WT isolate (Omar et al., 1983) was evaluated for capsule production using these assays. The 37b4 strain pelleted tightly, produced less EPS than WT B10 cells, did not have a capsule halo, and formed morphologically normal cultures and cells (Fig 3-15A, B, and C). The properties of strain 37b4 were essentially identical to the ΔgtaI strain phenotype, supporting the idea that the EPS described here is indeed a capsule polysaccharide. To test the hypothesis that the ORFs rcc01081-1086 are involved in capsular polysaccharide production, a marker-less, in-frame deletion mutation of the first ORF in the cluster, rcc01081, annotated as a group 1 glycosyltransferase, was generated. The Δ1081 mutant strain formed a dense cell pellet, similar to the ΔgtaI mutant, and additionally produced significantly less measureable EPS than WT cells when 85  measured by phenol-sulfuric acid quantification (Fig 3-15A and B). Furthermore, the Δ1081 mutation was observed to cause gross cell defects: cultures form a large aggregate of cells when grown phototrophically in RCV medium, which associate as a floating mass when agitated (Fig 3-15C).   86   Figure 3-15. Evaluation of EPS production in R. capsulatus EPS biosynthesis mutants. A. Pellet formation of equal numbers of cells of phototrophically grown B10 (WT), Δ1081, Δ1081 [p1081], ΔgtaI/Δ1081, ΔgtaI/Δ1081+ C16-acyl-HSL, Δ1932, Δ1932[p1932], Δ1932/ Δ1081, Δ1085 and WT 37b4 R. capsulatus strains after centrifugation for 1 min. B. Levels of cell-associated EPS production in an extract of each strain as measured by a phenol-sulfuric acid assay. C. Images of tubes of phototrophically grown WT and EPS mutants. On the far right, images of agitated cultures of Δ1081, ΔgtaI/Δ1081 + C16-HSL, Δ1932, and Δ1085 are shown.  87  Examination of Δ1081 cells by phase contrast microscopy revealed the formation of irregular, filamentous cells in large aggregates (Fig 3-16A). A capsule stain of Δ1081 mutant cells showed that they do not produce an extracellular capsule and the cells are weakly stained with crystal violet/copper sulphate (Fig 3-16B). A trans complemented strain Δ1081[p1081] had WT levels of EPS and no longer aggregated in liquid culture (Fig 3-15); additionally, cells were morphologically normal, and once again produced a capsule (Fig 3-16).  The microarray and rcc01081 promoter::lacZ analysis indicated that the rcc01081-1086 gene cluster is down-regulated in the ΔgtaI mutant. If the phenotype of the Δ1081 mutant strain is due to a block in a polysaccharide biosynthesis pathway that is down regulated in the ΔgtaI mutant, a ΔgtaI/Δ1081 double mutant would be expected to lack the gross morphological defects of the Δ1081 mutant. A marker-less double mutant ΔgtaI/Δ1081 was therefore generated. The cell morphology, culture appearance, pellet formation, levels of EPS and capsule of the double mutant were similar to those of the ΔgtaI mutant in liquid culture. Furthermore, supplementation of ΔgtaI/Δ1081 cultures with C16-acyl-HSL resulted in a phenotype that was similar to that of a Δ1081 single mutant: cells aggregated, yielded tight pellets, produced a low amount of EPS, and lacked a capsule (Fig 3-15 and 3-16). Overall these data indicate that rcc01081 is involved in capsule biosynthesis and is regulated by gtaI.    To evaluate whether rcc01932, which encodes the predicted initiating glycosyltransferase homologous to WecA (Table 3-1 and 3-2), is involved in capsule production, a marker-less, in-frame deletion mutant was made. The Δ1932 mutant strain produced a tight pellet, low levels of EPS, and aggregated in liquid culture, although to a 88  lesser degree than the Δ1081 mutant; this aggregate quickly dissociated with agitation (Fig 3-15A, B, and C). Furthermore, Δ1932 mutant cells were morphologically normal when viewed by phase contrast microscopy, but lacked an observable capsule (Fig 3-16A and B). The Δ1932 mutation was complemented in trans in an equivalent fashion to the Δ1081 mutation, and the complemented strain Δ1932[p1932] was phenotypically similar to WT cells (Fig 3-14 and 3-15). Therefore, it appears that rcc01932 is required for capsule production.  If rcc01081-1086, which are predicted to be involved in polysaccharide biosynthesis, and rcc01932, which is predicted to initiate the reaction for biosynthesis of polysaccharides, do indeed function in the same CPS synthesis pathway, a double mutant of rcc01081 and rcc01932 should have the same phenotype as a Δ1932 single mutant. This is because substrate for Rcc01081 would not be produced by Rcc01932. To test this, a Δ1081/Δ1932 double mutant strain was generated. The Δ1081/ Δ1932 double mutant was morphologically identical to the Δ1932 single mutant in all types of analyses (Fig 3-15 and 3-16). It is particularly worthy of note that mutation of rcc01932 completely offset the gross cell shape defect of the Δ1081 single mutant. Overall, these data are consistent with rcc01081 and rcc01932 functioning in the same CPS biosynthesis system, with Rcc01932 needed to provide a substrate for a subsequent reaction catalyzed by Rcc01081. As a follow-up experiment, an in-frame deletion of rcc01085, encoding the Wzy homologue that appears to have been acquired via HGT, was generated. The Δ1085 mutant a phenotype identical to that of the Δ1081 mutant, which is consistent with the idea that rcc01085 is also involved in capsule biosynthesis (Fig 3-15 and 3-16).  89   Figure 3-16. Phase contrast microscopy and capsule stain images of WT B10 (WT), ΔgtaI, ΔgtaI + C16-acyl-HSL, ΔgtaR, ΔgtaRI, Δ1081, Δ1081 [p1081], ΔgtaI/Δ1081, ΔgtaI/Δ1081+ C16-acyl-HSL, Δ1932, Δ1932[p1932], Δ1932/ Δ1081, Δ1085 and WT 37b4 R. capsulatus strains. A. Phase contrast microscopy images of the strains listed above, at 1000X magnification. B. Anthonys capsule stain images of WT and EPS biosynthesis mutant strains.  90  3.2.7 RcGTA recipient capability of and RcGTA attachment to strains Δ1081, Δ1085, Δ1932, Δ1085, and 37b4 The foregoing sections show that several homologues of CPS genes appear to be regulated by QS, and that these genes are needed to produce a capsule. In this section direct tests of whether these genes, and the capsule, are needed for a cell to acquire a new allele carried by RcGTA. The RcGTA recipient capability and adsorption capability of the strains Δ1081, Δ1081[p1081], ΔgtaI/Δ1081, ΔgtaI/Δ1081 supplemented with C16-acyl-HSL, Δ1932, Δ1932[p1932], Δ1932/Δ1081, Δ1085, and 37b4 was tested. The Δ1081, ΔgtaI/Δ1081, Δ1932, Δ1085, and Δ1932/Δ1081 mutants were greatly impaired in recipient capability (3-17A); this defect was somewhat restored in the Δ1081[p1081] complemented strain, and fully restored in the Δ1932[p1932] strain (Fig 3-17A). Unlike the ΔgtaI mutant, however, recipient capability was not restored to the ΔgtaI/Δ1081 mutant by addition of C16-acyl-HSL (Fig 3-17A), supporting the interpretation that the defect in recipient capability and attachment in the ΔgtaI strain involves down regulation of the rcc01081-1086.  In summary, all strains that lacked a capsule were impaired for RcGTA recipient capability, suggesting that the capsule is involved in binding of RcGTA to cells. This interpretation was confirmed by RcGTA adsorption assays which showed that the Δ1081 and Δ1932, and Δ1932/Δ1081 mutants were impaired in RcGTA adsorption (Fig 3-17B and C). As in the recipient capability experiments, RcGTA-adsorption was not restored in the ΔgtaI/ Δ1081 double mutant by the addition of C16-acyl-HSL (Fig 3-17B and C). To further support the interpretation that the capsule is involved in RcGTA 91  adsorption, the 37b4 strain was tested for recipient capability. Attempts at transduction into 37b4 were unsuccessful, and this strain showed an adsorption defect to the capsule mutants (Fig 3-17). These observations indicate the capsule is needed for maximal adsorption of RcGTA – and hence, acquisition of alleles originating in another cell.     92   Figure 3-17. Comparison of WT B10 (WT), Δ1081, Δ1081 [p1081], ΔgtaI Δ1081, ΔgtaI/ Δ1081 + C16-acyl-HSL, Δ1932, Δ1932[p1932], Δ1932/Δ1081, Δ1085 and 37b4 WT strains recipient capability and adsorbtion of RcGTA particles. A. Relative RcGTA recipient capability of all strains. B. RcGTA adsorption capability of all strains C. Western blot of residual RcGTA in the adsorption assay described in B.  93  3.2.8 Inhibition of RcGTA adsorption by surface polysaccharide extract Although the forgoing results indicate that the rcc01081, rcc01085, and rcc01932 are involved in capsule polysaccharide biosynthesis, mutagenesis of such genes can also cause pleotropic effects (as is seen in the Δ1081 and Δ1085 mutants), and may interfere in other biosynthetic pathways such as LPS O-antigen biosynthesis (Xayarath & Yother, 2007). LPS is often used as a receptor for phage binding to cells (Davidson et al., 2012). Because of this, the possibility that the reduced RcGTA adsorption in our mutants was due to an altered LPS structure was investigated. The LPS of all mutants (with the exception of Δ1085) was visualized by silver staining (Fig 3-18), and no obvious difference in the banding pattern in any of the WT strain B10-derived mutants was evident, indicating that these strains produce a WT LPS. However, there was a difference in LPS banding of the 37b4 strain (Fig 3-18).    Figure 3-18. Representative LPS silver stain comparing B10 (WT), Δ1081, Δ1081 [p1081], Δ gtaI Δ1081, Δ gtaI/ Δ1081 + C16-acyl-HSL, Δ1932, Δ1932[p1932], Δ1932/ Δ1081 and 37b4 WT strains LPS banding pattern on an SDS-PAGE gel.   94  As a further step, it was evaluated whether cell surface extracts from the WT B10 encapsulated strain and non-encapsulated mutants, inhibit RcGTA adsorption to cells. Addition of exogenous WT B10 extracts (which contain CPS), but not extracts from the ΔgtaI or Δ1932 strains (both of which lack CPS), significantly blocked RcGTA adsorption to cells (Fig 3-19A and B). These data support the conclusion that CPS is involved in RcGTA adsorption because binding of RcGTA to cells was reduced in the presence of exogenous CPS, which some RcGTA particles presumably bound to instead of recipient cells.      95   Figure 3-19. Inhibition of RcGTA adsorption by addition of cell surface extracts. A. RcGTA adsorption capability of WT cells as measured by residual RcGTA activity in culture filtrate after incubation with or without surface polysaccharide extracts from WT cells (+WT), ΔgtaI cells (+ΔgtaI extracts), and Δ1932 cells (+Δ1932 extracts). No cells indicates a control where no cells and no extracts were added to the initial binding reaction, and WT indicates positive control reaction were WT cells and RcGTA were mixed together as in a standard adsorption assay. B. Western blot adsorption assay of a residual RcGTA sample, probed with RcGTA capsid protein antiserum.   3.2.9 Mutagenesis of rcc01088 and rcc01823, orphan LuxR homologues in R. capsulatus Orphan LuxR homologues are commonly found in bacteria that have a cognate luxRI-type QS pair in their genome. Often, the orphan LuxR homologues respond to the same acyl-HSL produced by the LuxI homologue that is part of the QS pair to regulate some other behavior, or sometimes a similar or the same response, providing more levels of regulation (Patankar & Gonzalez, 2009). Although it is clear that GtaR is the 96  protein that binds C14/C16 acyl-HSL in the context of RcGTA regulation, the effect of mutagenesis of the other two LuxR homologues encoded by rcc01088 and rcc01823, in terms of RcGTA production was unknown. Because rcc01088 is adjacent to one of the capsule biosynthetic gene clusters, and orphan LuxR homologues sometimes have functions overlapping cognate LuxR homologues with a clear LuxI partner (Patankar & Gonzalez, 2009), either Rcc01088 or Rcc01823, or both, could be involved in CPS or RcGTA regulation and respond to long-chain acyl-HSLs, similarly to GtaR. This hypothesis was initially tested by creating knockouts of rcc01088, rcc01088 and gtaI, rcc01823, and rcc01823 and gtaI. All strains were evaluated for RcGTA production and CPS levels, and it was found that neither single mutant had altered CPS or RcGTA production, and neither double mutant offset the ΔgtaI mutation. Additionally, no other phenotypes were observed and cells appeared completely healthy. Therefore, it is unlikely that either orphan LuxR homologue in R. capsulatus is involved in either CPS or RcGTA regulation, at least in the ways tested, although they may have some other function. Whether they respond to C14/C16 acyl-HSL is also unclear, and requires additional testing. These negative results are summarized in Table 3-3.         97  Table 3-3. Summary of data obtained with the rcc01088 and rcc01823 mutant strains with respect to RcGTA and CPS production. Data obtained in part by Aaron Stevens.  LuxR homologue RcGTA data Capsule data Other data Offsets gtaI mutation? genomic context rcc00328 (gtaR) negative regulator negative regulator RcGTA recipient regulation yes Operon with gtaI rcc01088 no regulation no regulation None; may respond to plant signal (see discussion) no Orphan; adjacent to pip gene rcc01823 no regulation no regulation none no orphan  3.3 A CtrA and GtaI-regulated natural competence-like system is required for import and recombination in RcGTA-borne DNA in recipient cells           During the RcGTA recipient capability experiments described in the previous section, other RcGTA regulator mutants were also tested for the capability of receiving RcGTA-borne alleles. This section describes the results of thos experiments, and how they led me to discover an intriguing connection between the HGT processes of transduction and natural transformation.  3.3.1 RcGTA recipient capability requires CtrA It was found that the recipient capability of a ΔctrA mutant was undetectable (< 10−6 of WT) (Fig 3-20A). In contrast to the ΔgtaI and cell surface polysaccharide mutants, ΔctrA cells had no defect in RcGTA adsorption compared to WT cells (Fig 3-20B), and produced a capsule (Fig 3-20C). Plasmid pRRR (Lang & Beatty, 2002) contains the ctrA coding region transcriptionally fused to the puf operon strong promoter (Young et al., 1998), and introduction of pRRR into the ΔctrA mutant strain resulted in 98  an increase of RcGTA recipient capability to approximately twice that of WT levels (Fig 3-20A), perhaps due to overexpression using this promoter. Taken together, these results indicate that the CtrA protein is required for recipient capability at some stage after adsorption of the RcGTA particle to the cell surface. The CtrA protein has different functions depending on the phosphorylation of the aspartate at residue 51, and D51E and D51A mutants have been used to mimic the phosphorylated and non- phosphorylated forms (respectively) in R. capsulatus and other species (Quon et al., 1996, Reisenauer et al., 1999, Siam & Marczynski, 2003, Mercer et al., 2012, Greene et al., 2012). To explore whether CtrA or CtrA∼P affects RcGTA recipient capability, plasmids that express D51E or D51A mutants of CtrA (Mercer et al., 2012) were introduced into WT and ΔctrA cells. I found that pD51E restored the recipient capability of the ΔctrA mutant to approximately 40% of the WT cells. In contrast, pD51A increased RcGTA recipient capability of the ΔctrA mutant to approximately 210% of WT cells. When in the WT strain, neither the pD51E nor the pD51A plasmids greatly changed RcGTA recipient capability (Fig 3-20A). Therefore, it appears that the non-phosphorylated form of CtrA induces recipient capability to a greater degree than the phosphorylated form. 99   Figure 3-20. A. Comparison of the relative RcGTA recipient capability of the WT, ΔctrA mutant, ΔctrA(pRRR) trans complemented strain, and the WT and ΔctrA strains containing a ctrA trans complementing plasmid that mimics either the phosphorylated (pD51E) and non-phosphorylated (pD51A) states of CtrA. Error bars represent the standard deviation between samples (n≥3). B. RcGTA adsorption capability of WT and ΔctrA strains. C. Pellet ability of WT, ΔgtaI, and ΔctrA strains.   3.3.2 Homologous recombination and RcGTA recipient capability Because the preceding results on the ΔctrA mutant recipient capability indicated that there is a defect at some stage after RcGTA adsorption to cells, I hypothesized that there is a defect in RcGTA-transmitted DNA integration into the genome of this strain. As the first step in testing this hypothesis, the requirement of RecA, which is required for homologous recombination in natural transformation (Johnsborg et al., 2007, Johnston et al., 2014), was tested for recombination between RcGTA-transmitted DNA and the recipient cell genome. The R. capsulatus ΔrecA mutant, B10S-T7, in which the recA gene has been replaced with the phage T7 RNA polymerase gene was available and had been used as a gene expression strain, but no characterization of the recA mutant phenotype was reported (Katzke et al., 2010). As a first step, the capability of the B10S-100  T7 (ΔrecA) strain to acquire a plasmid via conjugative transfer, and integration of a suicide plasmid into the chromosome by homologous recombination was evaluated. The B10S-T7 mutant acquired a broad host-range plasmid p601-17 (Leung et al., 2013) by conjugative transfer at the same frequency as the WT strain (Fig 3-21A), indicating that recA does not affect conjugation recipient capability. However, B10S-T7 was incapable of acquiring a kanamycin resistance gene carried on the suicide plasmid pZDJΔ1081Kan (Fig 3-21B), which has an insert identical to a region on the chromosome and requires homologous recombination for kanamycin resistance to be passed on to progeny. The UV-sensitivity of B10S-T7 was found, as expected, to be hypersensitive (Fig 3-21C). Finally, the RcGTA recipient capability of the B10S-T7 strain was not detectable (Fig 3-21D), although RcGTA particle adsorption to B10S-T7 cells was similar to that of the WT strain (Fig 3-21E). To determine whether the loss of RcGTA recipient capability in the ΔctrA mutant is due to a defect in recA gene expression or RecA activity, the UV sensitivity, ability to acquire a plasmid via conjugative transfer, and frequency of integration of a suicide plasmid into the chromosome of this the ΔctrA strain was evaluated (Fig 3-21A, B, and C), as had been done for the ΔrecA strain B10S-T7. No difference was found between the WT and the  ΔctrA mutant in any of these measures of RecA-dependent processes.  The foregoing results indicate that the ΔrecA strain has a defect in homologous recombination, and that RcGTA recipient capability requires RecA for homologous recombination into the recipient genome. In contrast, the loss of recipient capability in the ΔctrA mutant is not due to a defect in homologous recombination in general. Instead, the defect appears to be specific for RcGTA-mediated gene acquisition. 101   Figure 3-21. Involvement of homologous recombination in RcGTA recipient capability. A. Relative conjugation frequency of the replicative plasmid p601-17 into WT, ΔctrA, and ΔrecA strains, displayed as tranconjugants per recipient cell. Error bars represent the standard deviation between samples (n=3). B. Homologous recombination frequency of the suicide plasmid pZDJΔ1081 into the chromosome of WT, ΔctrA, and ΔrecA strains, displayed as tranconjugants per recipient cell. Error bars represent the standard deviation between samples (n=3). C. UV sensitivity of WT, ΔctrA, and ΔrecA strains. D. Relative RcGTA recipient capability of WT and ΔrecA strains (n= 3). E. Relative RcGTA adsorption capability of WT and ΔrecA strains.   3.3.3 DprA is required in CtrA-dependent RcGTA recipient capability Because CtrA is a transcriptional regulator, I hypothesized that the defective RcGTA recipient capability in the ΔctrA mutant is due to dysregulation of a gene or pathway required for stable acquisition of RcGTA-donated DNA. To identify candidate 102  genes, publicly accessible microarray data [NCBI Gene Expression Omnibus (GEO) database Accession No. GSE1849] from a prior study reporting gene expression in a  ΔctrA mutant relative to the WT strain SB1003 (Mercer et al., 2010) was examined. The search was focused on genes predicted to encode proteins involved in DNA processing or facilitating recombination, or in transport of DNA into the cell. Five candidate genes were found to have decreased transcript levels in the ΔctrA mutant compared to the WT strain and encode proteins homologous to those involved in natural competence. These genes are annotated as comF, radC, comM, rec2 [rec2 is also referred to as comEC in many bacteria (Johnston et al., 2014)], and dprA (Table 3-4 and 3-5). Inspection of another set of publicly accessible microarray data (NCBI GEO database Accession No. GSE41014) showed that comF, radC, comM, and dprA are all down-regulated in the     ΔgtaI mutant relative to the WT strain (Table 3-4 and 3-5)             103  Table 3-4. Candidate recipient capability genes that are down-regulated in the ΔctrA mutant and ΔgtaI mutants compared to WT cells, and that are up-regulated in the stationary phase.    R. capsulatus gene annotation WT/ΔctrA loga WT/ ΔctrA statb WT/ΔgtaI logd WT/ΔgtaI state stat/logc rcc00197 comF 5.35 3.23 3.16 6.11 1.15 rcc00222 radC 7.56 21.74 1.6 2.08 2.84 rcc00460 comM 1.89 2.91 1.93 2.51 1.75 rcc02362 rec2 (comEC) 2.67 4.88 1.77 1.7 2.68 rcc03098 dprA 3.75 9.38 2.23 7.01 5.74 a. Ratio of WT to ΔctrA microarray gene expression values for cells grown to the exponential phase of growth. b. Ratio of WT to ΔctrA microarray gene expression values for cells grown to the stationary phase of growth. c. Ratio of microarray gene expression values of cells in the stationary phase to cells in the exponential phase. d. Ratio of WT to ΔgtaI microarray gene expression values for cells grown to the exponential phase of growth. e. Ratio of WT to ΔgtaI microarray gene expression values for cells grown to the stationary phase of growth.  Table 3-5. Annotation of candidate recipient capability genes, known homologues and their functions, and the % identity (%ID) and similarity (%Sim) to homologues.  gene annotation known homologue e-value %ID; % Sim rcc00197 competence protein F H. influenzae ComF; unkown function 2x10-21 26.2; 42.9 rcc00222 DNA repair protein RadC H. influenzae; unknown function; expressed during competence 5x10-40 32.7; 49.2 rcc00460 competence protein M H. influenzae ComM; unknown function 1x10-138 44.1; 59.7 rcc02362 competence protein H. Influenzae Rec2 (also called ComEC); transporter of ssDNA from periplasm to cytoplasm 1x10-12 18.9; 29.7 rcc03098 DNA protecting protein A S. pneumoniae DprA; transformation dedicated RecA loader; competence shutoff 5x10-52 27.7; 39.5  104  Of the proteins encoded by homologues of these genes, DprA is the best studied, and has been shown to aid in RecA-mediated recombination in natural transformation, but not be essential for homologous recombination (Smeets et al., 2006, Mortier-Barriere et al., 2007). If „RcGTA recipient capability‟ were substituted for „natural transformation‟ in the foregoing sentence, these properties would be consistent with a loss of DprA activity in the ΔctrA mutant. Therefore the R. capsulatus DprA homologue encoded by rcc03098 was selected for study. To validate the published microarray data, the dprA promoter activity of a dprA::lacZ translational fusion plasmid, which contains ∼450 bp of sequence 5′ of the dprA start codon, and the first nine codons of dprA fused to the E. coli lacZ coding sequence, was measured. It was found that the dprA::lacZ expression in the ΔctrA and ΔgtaI mutants was reduced to ∼13% and ∼11% (respectively, relative to the WT expression level), verifying that dprA expression is positively regulated by the ctrA and gtaI genes (Fig 3-22A). Furthermore, the β-galactosidase activity was increased by exposure of the ΔgtaI strain to C16-acyl-HSL (Fig 3-22A), the major acyl-HSL produced by GtaI (Schaefer et al., 2002). Because of the link to QS regulation, expression of the dprA::lacZ fusion in WT cultures at different phases of growth was measured. The β-galactosidase activity increased slowly during the exponential phase, followed by a jump and a subsequent plateau in the stationary phase (Fig 3-22B). These data show that dprA expression is growth phase-regulated, and that QS is a factor in this regulation.     105    Figure 3-22. Expression of dprA in ΔctrA and ΔgtaI mutants, in in different growth phases. A. β-galactosidase activity of a dprA::lacZ translational fusion plasmid, pDprALacZ, in the WT, ΔctrA, ΔgtaI, and ΔgtaI supplemented with C16-acyl-HSL (1 µM) strains. Error bars represent the standard deviation between samples (n≥3). B. Expression of dprA::lacZ in the WT strain over culture growth phases. Cell culture turbidity‟s were monitored using a spectrophotometer (OD 650), with values indicated on the left axis. The dprA::lacZ expression from cells harvested at each time point is indicated in the bar graph below, and values are aligned with the corresponding culture turbidity point above; β-galactosidase activity values are given on the right axis. Error bars represent the standard deviation between triplicate cultures (n=3) in both measures.  To test the hypothesis that dprA is involved in RcGTA recipient capability, a markerless in-frame deletion of the dprA gene was created in the WT strain B10 background. The resultant ΔdprA mutant was unable to acquire an RcGTA-mediated antibiotic resistance marker, just as was found for the ΔctrA mutant (Fig 3-23A). RcGTA adsorption assays showed that ΔdprA mutant cells adsorb RcGTA similarly to WT cells (Fig 3-23B), and pelleting assay indicated that ΔdprA cells produce WT levels of capsule (Fig 3-23C). The expression of the plasmid-borne dprA::lacZ fusion in the 106  ΔdprA strain was similar to the WT levels of expression, indicating that dprA is not auto-regulatory (Fig 3-22A). The ΔdprA mutant was complemented in trans by the plasmid pDprA, containing the dprA gene driven by its native promoter, which restored RcGTA recipient capability to WT levels (Fig 3-23A).  To determine whether expression of dprA is sufficient to restore RcGTA recipient capability to the ΔctrA mutant, in which the native dprA promoter has low activity (five- to nine-fold reduction: Table 3-4 and Fig 3-22A), a plasmid containing a translational fusion of the dprA coding region to the constitutive aphII promoter was generated (pRhDprA); this construct uses the aphII ribosome binding site and promoter sequences. Plasmid pRhDprA was conjugated into the WT, ΔctrA, and ΔdprA strains, and found to restore recipient capability of the ΔdprA mutant to approximately 20% of the WT value, however no restoration was observed for the ΔctrA mutant (Fig 3-23A). The weak complementation of the ΔdprA mutant may be attributible to the non-native sequences flanking the coding region.  Additionally, the pRhoK plasmid with no insert (negative control) did not restore recipient capability to either the ΔdprA or ΔctrA mutant strains (Fig 3-23A). The UV-sensitivity of the ΔdprA mutant was found to be similar to that of the WT strain (Fig 3-23D), in contrast to the ΔrecA mutant strain B10S-T7. Furthermore, the ΔdprA strain acquired a broad host-range plasmid by conjugative transfer at the same frequency as the WT strain (Fig 3-23E), and the frequency of homologous recombination of a suicide plasmid into the chromosome in the ΔdprA strain was the same as the WT strain (Fig 3-23F).  107  The loss of RcGTA recipient capability in the ΔdprA mutant is identical to the loss in the ΔctrA mutant (both undetectable, or < 10−6 of the WT), and is not due to a defect in the general homologous recombination pathway. Instead, there appears to be a process needed specifically for RcGTA-mediated gene acquisition, separate from the general process of homologous recombination. However, the results summarized in Tables 3-4 and 3-5 and Fig 3-23A indicate that dprA is unlikely to be the sole CtrA-regulated gene required for RcGTA recipient capability. This question will be revisited in a following section, after bioinformatic and in vitro analyses of the R. capsulatus DprA protein.       108   Figure 3-23. A. Relative RcGTA recipient capability of WT, ΔdprA, and ΔdprA(pDprA), WT(pRhDprA), ΔctrA(pRhDprA), and ΔdprA(pRhDprA) strains. Error bars represent the standard deviation between samples (n≥3) B. Relative RcGTA adsorption capability of WT and ΔdprA strains. C. Evlaution of capsule production in the ΔdprA mutant versus WT (capsule positive) and ΔgtaI (capsule negative). D. UV sensitivity of WT and ΔdprA strains. E. Relative conjugation frequency of the replicative plasmid p601-17 into WT and ΔdprA strains, displayed as tranconjugants per recipient cell. F. Homologous recombination frequency of the suicide plasmid pZDJΔ1081 into the chromosome of WT and ΔdprA strains, displayed as tranconjugants per recipient cell.   3.3.4 Bioinformatic analyses and predicted structure of RcDprA The predicted amino acid sequence of RcDprA was compared to characterized and putative DprA proteins in a MUSCLE (Edgar, 2004) multiple sequence alignment program (a small, representative alignment is shown in Fig 3-24, a full alignment is shown in Appendix 6), and a Bayesian Markov chain Monte Carlo phylogenetic tree 109  (Dereeper et al., 2008) (Fig 3-25). Also included in the analyses were predicted DprA proteins from a number of bacteria known to be naturally competent, and bacteria known to possess functional or potentially functional GTAs (Johnsborg et al., 2007, Johnston et al., 2014, Lang & Beatty, 2007). From these data, it was evident that all bacterial species known to produce a functional GTA possess a DprA homologue (Fig 3-25), and so this protein may be involved in gene acquisition in many species that produce a GTA. These DprA protein sequences have 14 residues invariant, and 76 residues with conserved properties among the 38 sequences evaluated, and global percentage identities in the range of 27 to 56%. Some of these proteins are known to bind ssDNA and interact directly with RecA, as in S. pneumoniae (Quevillon-Cheruel et al., 2012). Another study described H. pylori DprA residues (notably Arg52 of H. pylori, or 115 in S. pneumoniae) involved in ssDNA binding that are conserved in DprA proteins (Fig 3-24) (Wang et al., 2013, Lisboa et al., 2014). Examination of global (full-length) alignments revealed that some DprA proteins contain an additional C-terminal domain (Fig 3-24, Appendix B). The presence of this domain was noted previously, but was not named (Quevillon-Cheruel et al., 2012, Wang et al., 2013); I therefore call the additional domain „DprA domain 3‟ (DD3). This domain is present in 20/20 of the Gram-negative but only 5/17 of the Gram-positive bacterial DprA sequences compared. The Bayesian phylogenetic tree in Fig 3-25 shows that DprA proteins which lack the DD3 form a distinct clade, indicating an evolutionary divergence from the proteins which contain the DD3. A recently published phylogenetic analysis of DprA revealed a similar trend of Gram-positive DprA proteins forming a distinct clade (Johnston et al., 2014). 110   Figure 3-24. Representative multiple sequence aligment of representative DprA proteins from R. capsulatus, R. palustris, and other naturally competent bacteria. H. influenzae, V. cholera, H. pylori, R. capsulatus, and R. palustris are Gram-negative bacteria, whereas S. pneumoniae and B. subltilis are Gram-positive bacteria. The „DprA domain 3‟ that is more prevalent in Gram-negative bacteria indicated, which can bee seen in the full sized alignment in Appendix 6.111   Figure 3-25. Bayesian MCMC phylogenetic tree of DprA proteins from a large scale multiple sequence alignment. A putative clade, formed by DprA proteins lacking a DD3 is indicated by the dashed circle. 112  There are three crystal structures of DprA proteins available: from S. pneumoniae (SpDprA; PDB 3UQZ); from R. palustris (PDB 3MAJ); and a C-terminally truncated structure of H. pylori DprA (PDB 4LJK). The S. pneumoniae protein (SpDprA, which lacks DD3; Fig 3-24) was shown to bind ssDNA, but not dsDNA (Mortier-Barriere et al., 2007, Quevillon-Cheruel et al., 2012). SpDprA consists of a sterile alpha motif (SAM) linked to a Rossman fold (RF) domain (Fig 3-26A). SAM motifs are often involved in protein–protein interactions, and the SpDprA SAM motif was found to interact with the ComE protein in S. pneumoniae (Mirouze et al., 2013). The SpDprA RF domain was predicted to be involved in DNA binding because RF domains are present in many nucleotide-binding proteins (Rao & Rossmann, 1973), and the RF domain was also found to contain residues essential for DprA dimerization, and interaction with RecA (Quevillon-Cheruel et al., 2012). Although the HpDprA has a DD3, the C-terminally truncated structure (amino acids 5–225) lacks the DD3. The C-terminally truncated HpDprA structure consists only of an RF, similar to that of SpDprA, and lacks an N-terminal SAM motif (Wang et al., 2013) (Fig 3-26A and B). Full-length HpDprA binds both ssDNA and dsDNA; truncated HpDprA retained the capability to bind ssDNA, although dsDNA binding was not studied. The structure of the DprA homologue from R. palustris is available in the PDB, but no study of the protein or gene function has been published. The RpDprA structure contains three domains: the first two are similar to SpDprA, comprised of an N-terminal SAM linked to a RF (Fig 3-26C); the third, C-terminal domain corresponds to the additional C-terminal domain observed in the sequence alignment, the DD3 (Fig 3-24 and 3-26C). It is notable that a similarity of the 113  DD3 to a Z-DNA-binding protein was previously reported (Quevillon-Cheruel et al., 2012).  The R. palustris and R. capsulatus DprA homologues share 43% of sequence identity, and the RcDprA protein structre was modelled on the RpDprA structure using the SWISS-MODEL program (Kiefer et al., 2009). The RcDprA model contains three domains: The N-terminal domain consists of four α-helices (Fig 3-26D), is the overall fold is similar to the N-terminal SAM motif of SpDprA (Fig 3-26A and B), and is essentially identical to that of RpDprA (Fig 3-26C). The central domain of the RcDprA model consists of a RF, similar to the SpDprA, RpDprA and HpDprA structures (Fig 3-26A, B and C). Generally, the first two domains of RpDprA and hence the RcDprA model are very similar to the corresponding domains in SpDprA, and I suggest that these domains endow all three proteins with the same function. A structural overlay of RcDprA and SpDprA (Fig 3-26 E) indicates that the N-terminal two domains of these proteins are similar (rmsd 2.1 Å), with differences primarily in the orientation of the α-helices in the SAM domain, and the absence of a fifth α-helix in RpDprA structure and the RcDprA model compared to SpDprA. RcDprA aligned well with the HpDprA partial structure over the RF domain (rmsd 2.1 Å); however, the truncated HpDprA lacks both the SAM and DD3 domains (Fig 3-26F). Like RpDprA, the C-terminal domain of RcDprA corresponds to a DD3 as observed in the multiple sequence alignment, and consists of four α-helices and two β-sheets (Fig 3-26D).   114   Figure 3-26. Structural comparison of RcDprA to other proteins. A. 3D X-ray crystal structure of DprA from S. pneumoniae (SpDprA), shown as a ribbon schematic. The N and C termini are indicated, and the domains are separated by colour. Red indicates the SAM domain, Green indicates the RF, and yellow indicates the RF extension.  B. 3D structure of truncated H. pylori DprA (HpDprA), shown as a ribbon schematic. The N and C termini are indicated, and the single RF domain is show in orange. C. R. palustis DprA (RpDprA) structure. Red indicates the SAM domain, green indicated the RF, and orange indicates the DD3 domain. The N and C termini are indicated. D. Predicted 3D structure of DprA from R. capsulatus (RcDprA), modelled off DprA from R. palustris. The N and C termini and indicated, and the domains separated by colour. Red indicates the SAM domain, Green indicates the RF, and Yellow indicates the RF extension. Purple indicates the DD3. E. Side view ribbon schematic of superimposed RcDprA (green) and SpDprA (cyan) monomers. The two structures deviate in spatial orientation primarily in the SAM domain, and the presence of the DD3 in RcDprA. The overall fold of the SAM and RF is relatively conserved. The structures align well, with a root-mean-square deviation (rmsd) of 1.8 Å. F. Structural overlay of RcDprA (purple) and truncated HpDprA (green); the two structures align within the RF domain (rmsd 2.1 Å).  To derive more information on possible functions of the RcDprA DD3, a search of protein structures in the PDB using the DD3 alone as a query was performed. The top 115  hits to the DD3 include a Z-DNA-binding protein, hZαADAR1 (Z-score 7.4; PDB 3F21), and a winged helix containing transcriptional repressor protein TtgV (Z-score 7.3; PDB 2XRO) from Pseudomonas putida. The similarity of RcDprA DD3 to a region of the hZαADAR1 protein is consistent with the observation that the RpDprA DD3 resembles a Z-DNA-binding protein (Quevillon-Cheruel et al., 2012). A structural overlay of the RcDprA DD3 model and hZαADAR1 indicates that the two structures are indeed very similar, with the spatial orientation of the three C-terminal α-helices of the DD3 and both β-sheets very similar (rmsd 1.4 Å) to  the equivalent domains in hZαADAR1 (Fig 3-27A). When overlaid with TtgV, the RcDprA DD3 model matches well (rmsd 1.5 Å) with the winged helix domain alone, and shows no structural similarity to the rest of the protein (Fig 3-27B). Both TtgV and hZαADAR1 are dsDNA-binding proteins (Ha et al., 2009, Lu et al., 2010), although TtgV binds to specific sequences within target promoters, whereas hZαADAR1 binding of Z-DNA is relatively non-specific.  The foregoing bioinformatic analyses yielded three major findings. First, both HpDprA and RcDprA contain a homologous DD3 (Fig 3-24 and 3-26D) but unlike the SpDprA and B. subtilis DprA (BsDprA), HpDprA binds both dsDNA and ssDNA (Dwivedi et al., 2013). Second, the RcDprA DD3 exhibits strong similarity to the DNA-binding motifs of the dsDNA-binding proteins TtgV and hZαADAR1. Third, a truncated version of HpDprA lacking the DD3, but containing the RF domain, retained the capability to bind ssDNA (Wang et al., 2013). Based on these data, I hypothesized that RcDprA is able to bind both ssDNA and dsDNA, and that the DD3 confers the capability to bind dsDNA.  116   Figure 3-27. A. Structural overlay of RcDprA DD3 and the TtgV transcriptional regulator protein (rmsd 1.5 Å). TtgV is shown in orange, and the RcDprA DD3 is shown in red. B. Structural overlay of the DD3 of RcDprA (aa 282-383) and the Z-DNA binding protein hZαADAR1. The RcDprA DD3 is labelled in red, and the hZαADAR1 protein structure is shown in green, and the two structures align well (rmsd 1.4 Å).  3.3.5 RcDprA binds ssDNA and dsDNA independently of nt sequence, but with higher affinity for ssDNA To characterize the in vitro activity of RcDprA, I generated a N-terminal 6His-tagged RcDprA expression construct, and purified RcDprA (Fig 3-28A). The capability of purified 6HisRcDprA to bind DNA was evaluated in electrophoretic mobility shift assays (EMSA), using phage ΦX174 virion ssDNA, and ΦX174 replicative form 1 (RF1) supercoiled dsDNA as substrates. The results indicated that RcDprA binds both ssDNA and supercoiled dsDNA, as a clear mobility shift was obtained with both targets (Fig 3-28B and C). Both supercoiled and relaxed forms of plasmid pUC19 showed a mobility shift, as did a linearized plasmid (Fig 3-28D and E), and RcDprA bound a ∼ 100 bp linear dsDNA PCR product (Fig 3-28F). Lastly, a negative control where BSA was added instead of RcDprA failed to shift DNA (Fig 3-28G). In summary, the DNA-binding experiments indicate that RcDprA binds to all forms of DNA tested including ssDNA, supercoiled dsDNA, and linear dsDNA, regardless of sequence composition.  117    Figure 3-28. DNA-binding capabilities of RcDprA. A. Coommassie-blue stained SDS-PAGE gel of purified 6His RcDprA. B. Electrophoretic mobility shift assay (EMSA) of RcDprA binding to ssDNA (ΦX174 virion DNA). The concentration of DNA was held constant at 64 µM nt (equivalent to 12 nM DNA molecules), and the RcDprA concentration was increased incrementally (from 0.488 µM to 7.8 µM). C. EMSA of RcDprA binding to dsDNA (ΦX174 RF1 DNA). The concentration of DNA was held constant at 64 µM nt (equivalent to 6 nM DNA molecules), and the RcDprA concentration was increased incrementally (from 0.488 µM to 7.8 µM). D. EMSA of linearized pUC19 (32 µM; equivalent to 5 nM) E. EMSA of supercoiled and open circular pUC19 (32 µM; equivalent to 5 nM). L indicates a 1 kb ladder (New England Biolabs). F. EMSA of RcDprA binding to linear dsDNA PCR product. The DNA concentration was held constant at 6 µM nt (equivalent to 25 nM DNA molecules), and the protein concentration increased incrementally (from 0.122 µM to 3.9 µM). Nucleoprotein complexes (NPC) can be seen in the wells at high concentrations of RcDprA, as reported for other DprA protein-DNA incteractions. The label Den indicates a lane in which RcDprA (3.9 µM ) was heated to 65 °C for 30 min prior to use. G. Negative control EMSA of BSA binding to linear pUC19.  118   To determine the relative affinity of RcDprA for ssDNA or dsDNA, I performed DNA-binding competition experiments using two different assays. First, in a mixture the amount of each type of DNA was held constant, and the RcDprA concentration increased sequentially. In these experiments the ssDNA band was observed to shift at a lower concentration of DprA than the dsDNA band (Fig 3-29A). Second, the amount of DprA protein was held constant, and different amounts of each type of DNA were added to compete with the binding of the other type of DNA. Addition of dsDNA to a ssDNA binding reaction had a weak effect on RcDprA binding to ssDNA (Fig 3-29B, left). In contrast, addition of ssDNA greatly inhibited RcDprA binding to dsDNA (Fig 3-29B, right). I therefore suggest that, like H. pylori DprA, RcDprA binds ssDNA with greater affinity than dsDNA.       119   Figure 3-29. Comparison of dsDNA and ssDNA binding affinities of RcDprA. A. EMSA containing equimolar amounts of ssDNA (ΦX174 virion) and dsDNA (ΦX174 RF1) (64 µM nt, equivalent to 12 and 6 nM DNA molecules, respectively), and increasing amounts of RcDprA. Bands corresponding to ssDNA and dsDNA are indicated on the left. B. EMSA containing a constant amount of RcDprA (1.95 µM), and different amounts of ssDNA or dsDNA. The middle panel shows a reaction containing a constant amount of ssDNA, and increasing amounts of dsDNA as indicated above the gel. The right most panel shows a reaction containing a constant amount of dsDNA, and increasing amounts of ssDNA as indicated above the gel.   3.3.6 RcDprA protects dsDNA from endonuclease digestion Previous work showed that H. pylori DprA binds dsDNA and protects it from endo- and exonuclease digestion (Dwivedi et al., 2013). The authors concluded that HpDprA diminishes the restriction barrier between strains and thus increases the natural transformation efficiency. I therefore hypothesized that RcDprA protects dsDNA from restriction enzymes, possibly breaching a restriction barrier for incoming RcGTA-carried DNA. I tested this hypothesis by performing in vitro endonuclease protection assays, and found that RcDprA protects linear dsDNA from digestion by the endonucleases BamHI, and NcoI in a concentration-dependent manner (Fig 3-30A and B). I therefore suggest that RcDprA protects cytoplasmic-incoming dsDNA from endonuclease 120  digestion, and speculate that this may be a function of the DD3 of DprA proteins that contain such a domain.  Figure 3-30. RcDprA Endonuclease protection assays.  Shown on the gel is DNA (6 µM nt) alone, or DNA pre-incubated with RcDprA in increasing concentration as indicated by the top bar, followed by digestion with A. NcoI or B. BamHI for 45 min.  3.3.7 RcDprA increases RecAEc ATPase activity Prior studies found that DprA proteins facilitate the nucleation of RecA onto ssDNA by overcoming the single stranded binding protein (SSB) barrier (Mortier-Barriere et al., 2007, Yadav et al., 2013). These effects were seen at low DprA concentrations relative to RecA (subequimolar), and a neutral or negative effect was observed at higher relative concentrations (approaching equimolar). Therefore, I hypothesized that RcDprA functions similarly to facilitate RecA nucleation onto ssDNA. A commonly used indirect measure of RecA nucleation onto ssDNA is its ATPase activity (Yadav et al., 2013). To test whether RcDprA affects RecA nucleation onto ssDNA (1.9 μM), heterologous recombinant E. coli SSB (1 μM) and RecA (RecAEc, 1 μM) were used in a malachite green colorimetric assay (Carter & Karl, 1982). This assay was validated in control reactions showing that activity could be attributed solely to a RecAEc-ssDNA interaction (Fig 3-31).  121  I then tested the effect of adding RcDprA on RecAEc ssDNA dependent ATPase activity. It was found that concentrations of 0.125 μM and 0.25 μM RcDprA increased RecAEc ATPase activity, whereas higher concentrations of 0.5 μM or 1.0 μM had either no effect or a negative effect respectively (Fig 3-31). As another control I tested the ATPase activity of RcDprA (0.25 μM) in a reaction lacking RecAEc, and observed no measureable ATP hydrolysis (Fig 3-31). Previous studies on SpDprA and BsDprA reported that similar low ratios (from 1:12.5 to 1:2.2) of DprA:RecAEc resulted in an increase in ATPase activity in the presence of SSB, whereas higher DprA ratios (1:1.6 to 1:1.1) were inhibitory, and so our results (1:8 and 1:4 for an increase; 1:1 for a decrease) with RcDprA are similar to those observed with previously characterized proteins (Mortier-Barriere et al., 2007, Yadav et al., 2013). I thus conclude that sub-stoichiometric amounts of RcDprA facilitate the loading of RecA onto SSB-coated ssDNA, and may promote the frequency of RcGTA-carried DNA recombination into the R. capsulatus genome.  122   Figure 3-31. Effect of RcDprA addition on RecAEc nucleation onto Ssb coated ssDNA, as measured by ATPase activity. The x-axis indicates elapsed time, and the y-axis indicates relative amounts of hydrolyzed ATP mM/L denotes mM of inorganic phosphate per litre. Controls include no addition of RecAEc, no addition of ΦX174 ssDNA substrate, addition of RcDprA but no RecAEc, and addition of RecAEc in the absence of SSB. A legend indicating the identity of each reaction is visible below the graph, with different colours and line types delineating each different reaction mixture. A representative data set is shown. Experiments were performed at least three times with reproducible results.    3.3.8 dprA and ctrA are expressed in the vast majority of cells within an R. capsulatus population In some naturally competent bacterial species, such as B. subtilis, the competent state develops in only a subpopulation (10–20%) of the culture, all of which express 123  dprA (Berka et al., 2002, Smits et al., 2005). Similarly, the RcGTA structural genes are expressed in a subpopulation (<1%) of an R. capsulatus culture (Hynes et al., 2012, Fogg et al., 2012). To evaluate whether dprA shows a similar bistable expression pattern, I constructed a plasmid containing ∼ 315 bp 5′ of the dprA coding region fused in-frame to the mCherry fluorescent protein. The resultant plasmid pDprAmCherry was conjugated into the WT strain, and cells evaluated for fluorescence in the stationary phase by fluorescence microscopy. The vast majority of cells expressed dprA (Fig 3-32A), and this was supported by flow cytometry that showed a major positive peak (Fig 3-32B). Because CtrA is also essential for recipient capability, ctrA population level expression was also evaluated in single cells using mCherry fluorescence using the plasmid pCtrAmCherry, which contains ~450 bp 5‟ of the ctrA start codon fused to tmCherry. Cells were grown to stationary phase and imaged as described above. The results showed that ctrA is expressed in the vast majority of cells, similar to dprA (Fig 3-32C). Furthermore, a single postive peak was again visible when evaluated by flow cytometry (Fig 3-32D).   124   Figure 3-32. Expression of dprA::mCherry and ctrA::mCherry fusions in WT B10 cells in the stationary phase. A. Fluorescence image where WT(pDprA::mCherry) cells were excited by 561 nm light (fluorescence emission 610 nm) overlain on a light microscopy image of the same cells. B. Flow cytometry histogram of populations expressing drpA (blue) compared to a negative control lacking the plasmid (red). The y-axis stands for normalized cell number as percentage of maximum; whereas the x-axis represents arbitrary units for mCherry fluorescence. C. Fluorescence image where WT(pCtrA::mCherry) cells were excited by 561 nm light (fluorescence emission 610 nm) overlain on a light microscopy image of the same cells.. D. Flow cytometry histogram of populations expressing ctrA (blue) compared to a negative control lacking the plasmid (red). The y-axis stands for normalized cell number as percentage of maximum; whereas the x-axis represents arbitrary units for mCherry fluorescence.  3.3.9 Bioinformatic analysis of comEC, comF, and comM Because I found that recombination of RcGTA-borne DNA required DprA and RecA, I hypothesized that additional transformation-like genes down-regulated in the 125  ΔctrA mutant were involved in RcGTA recipient capability. The other genes I chose to study were comEC (rcc02362), comF (rcc00197), and comM (rcc00460).  To begin, I performed a bioinformatics analysis of each predicted protein. I first examined the putative comEC homologue, encoded by rcc02362. ComEC homologues are essential for DNA transport through the CM in all natural competence systems studied to date, including the Gram-positive S. pneumoniae and B. subtilis, and Gram-negative H. influenziae and V. cholerae (Johnston et al., 2014, Draskovic & Dubnau, 2005). The ComEC protein family members are predicted to be integral membrane proteins with six transmembrane segments (TMS), supported by in vitro studies of the B. subtilis homologue (Draskovic & Dubnau, 2005); a hydropathy analysis of R. capsulatus ComEC revealed it to have six predicted TMS, consistent with this property. Furthermore, ComEC is predicted to be present in the CM, and contains the two conserved domains ubiquitously present in ComEC proteins. Therefore I predict that R. capsulatus ComEC encodes a genuine ComEC homologue.  ComF homologues also appear to be involved in DNA transport through the CM because null comF mutants in other species have the same phenotype as null comEC mutants (Sinha et al., 2012, Seitz & Blokesch, 2013b). However, the mechanistic function of ComF proteins remains unknown. Hydropathy analysis showed that R. capsulatus ComF has one putative TMS near the C-terminus, and it is predicted to be cytoplasmic. It is thus possible that ComF is anchored to the CM by a TMS. Also of interest is that ComF contains two putative domains: a phosphoribosyltransferase domain often involved in nucleotide salvage pathways (Murray, 1971), and a double zinc ribbon domain often involved in DNA binding (Klug & Rhodes, 1987). Although the 126  overall function of ComF is difficult to infer, because comF deletions have the identical DNA import loss phenotype as comEC mutants, it is possible that ComF is involved in a DNA processing step during DNA import into the cell via ComEC. There is no known function for ComM proteins, although my bioinformatics analyses yielded some possible clues. R. capsulatus ComM is predicted to be cytoplasmic, and has no predicted TMS. Furthermore, several regions of the protein share homology with subunit I of Mg chelatase, which is an AAA+ ATPase that provides energy for the insertion of Mg2+ into protoporphyrin IX (Reid et al., 2003). ComM also contains domains with weak homology to RuvB, a Holliday junction DNA helicase (Yamada et al., 2002), a Rossman-like domain, and a sigma-54 interaction domain. Lastly, it is notable that ComM homologues are detectable only in organisms in which the DprA lacks a DD3 (data not shown). Based on these homologies, and its predicted cellular localization, I hypothesize that ComM is involved in a recombination step within the cytoplasm of recipient cells similar to DprA (Mortier-Barriere et al., 2007, Yadav et al., 2013), and that this is the case in natural transformation systems as well.  3.3.10 comEC, comF, and comM are required for RcGTA recipient capability To directly address their involvement in RcGTA recipient capability, I generated knockouts of the comEC (rcc02362), comF (rcc00197), and comM (rcc00460) homologues in R. capsulatus. Null mutation of comEC, comF, or comM all resulted in an absolute loss in RcGTA recipient capability (<10-6 of WT levels), and these mutations were complemented to WT levels by the native gene in trans (Fig 3-33A). In all three mutant strains RcGTA adsorption capability (Fig 3-33B), frequency of RecA-dependent integration of a suicide plasmid containing an insert homologous to a region on the 127  chromosome (Fig 3-33C), growth kinetics (3-33D), and UV sensitivity (Fig 3-33E) were found to be identical to the WT strain. Therefore the R. capsulatus comEC, comF and comM homologues are essential for RcGTA recipient capability, but these genes are not needed for RcGTA binding to cells, RecA-mediated homologous recombination, growth, nor UV-damaged DNA repair, indicating that the defect(s) in these mutants is specific to RcGTA recipient capability, at some step after particle adsorption to cells.  Because comEC and comF are essential for DNA transport through the cytoplasmic membrane (CM) in natural competence systems (Johnston et al., 2014, Sinha et al., 2012, Seitz & Blokesch, 2013b), I hypothesized that RcGTA-borne DNA entry into the recipient cell cytoplasm involves comEC/comF as well. A corollary of this hypothesis is that there would be a build-up of RcGTA-borne DNA in the periplasm of recipient cells lacking either ComEC or ComF, and that this build-up of DNA could be detected in biochemical experiments. 128   Figure 3-33. A. Relative RcGTA recipient capability of WT, ΔcomEC, ΔcomF and ΔcomM strains, and the trans complemented strains ΔcomEC(pComEC), ΔcomF(pComF) and ΔcomM(pComM). Error bars represent the standard deviation from the mean (n = 3). B. Relative RcGTA adsorption capability of WT, ΔcomEC, ΔcomF and ΔcomM strains. Error bars represent the standard deviation from the mean (n = 3). C. Relative homologous recombination frequency of the suicide plasmid pZDJ1081 into the chromosome of WT, ΔcomEC, ΔcomF, and ΔcomM strains, displayed as relative conjugation efficiency (%WT). Error bars represent the standard deviation from the mean (n = 3). D. Comparison of the growth rate of WT, ΔcomEC, ΔcomF, ΔcomM, ΔdprA, and ΔctrA mutant strains grown in RCV liquid medium aerobically with shaking at 200 rpm. Culture turbidity (OD650) was measured for each strain at the indicated time points, and plotted as a function of time. E. UV sensitivity of WT, ΔcomEC, ΔcomF, and ΔcomM strains.  129  3.3.11 RcGTA-borne DNA build-up in the periplasmic fraction of ΔcomEC and ΔcomF mutants To determine the relative amount of RcGTA-borne DNA in the periplasm of recipient cells, a modified RcGTA transduction assay was used to monitor incoming DNA entry into the cell. The RcGTA stock used for this set of experiments contained a gentamycin resistance cartridge not present in WT R. capsulatus. After exposure of WT cells to RcGTA for 3 hours, cells were washed extensively and separated into periplasmic and cytoplasmic fractions by addition of EDTA and centrifugation (see Methods for detailed description).   DNA was purified from each fraction, and total RcGTA-derived DNA quantified by a quantitative polymerase chain reaction (qPCR) using the gentamycin resistance cartridge as a target. Values obtained were normalized to the amounts of the puhA (photosynthetic reaction center) single-copy gene in the chromosomal fraction. I observed that the ΔcomEC and ΔcomF mutants contained 6.7-fold and 5.7-fold more incoming RcGTA DNA, respectively, in the periplasmic fraction than WT cells (Fig 3-34).    130   Figure 3-34. Relative residual RcGTA-borne DNA levels in the periplasm of WT, ΔcomEC, and ΔcomF strains, as measured by qPCR. Values shown are a ratio of periplasmic RcGTA-borne DNA to chromosomal puhA levels. Error bars represent the standard deviation from the mean (n = 3).   3.3.12 Prevalence of ComEC and ComF in GTA-containing organisms The RcGTA major structural gene cluster and close homologues appear be limited to and vertically inherited in the α-proteobacteria (Lang & Beatty, 2007, Lang et al., 2012). In addition to RcGTA, several other functional GTAs have been observed, such as in Ruegeria mobilis, Ruegeria pomeroyi, and Roseovarious nubinhibens (Biers et al., 2008, Lang et al., 2012, McDaniel et al., 2010). Furthermore, full RcGTA-like gene clusters, or partial/re-arranged clusters were present in most of the α-proteobacterial genomes (Lang & Beatty, 2007).  To determine whether ComEC and ComF homologues exist in previously identified GTA-gene containing genomes (Lang & Beatty, 2007), I performed BLASTP searches using the R. capsulatus homologues as a query against a number of α-131  proteobacterial genomes, as well as unrelated bacteria producing a functional GTA encoded by non-RcGTA-homologous genes. I observed that all organisms that contain a functional GTA (either homologous to RcGTA or not), and those that contain full or partial/re-arranged RcGTA-like gene clusters all contain a detectable ComEC homologue, and all except for Sphingomonas alaskensis, contain a detectable a ComF homologue (Table 3-6).   Table 3-6. Presence of detectable ComEC and ComF homologues in other bacterial species that contain functional or putative GTAs, or are naturally competent.  Species ComEC  ComF Verified functional gene transfer agent Putative gene transfer agent Naturally competent Rhodobacter capsulatus yes yes yes no no Synechocystics PC 6803 yes yes no no yes Helicobacter pylori yes yes no no yes Rhizobium elti yes yes no yes no Bartonella grahamii yes yes yes no no Brucella abortus yes yes no yes no Sphingomonas alaskensis yes no no yes no Caulobacter crescentus yes yes no yes no Rhodopseudomonas palustris yes yes no yes no Nitrobacter hamburgensis yes yes no yes no Rickettsia felis yes yes no yes no Ruegeria mobilis yes yes yes no no Paracoccus denitrificans yes yes no yes no Rhodobacter sphaeroides yes yes no yes no Ruegeria pomeroyi yes yes yes no no Roseovarious nubinhibens yes yes yes no no Wolbachia pipientis yes yes no yes no Haemophils influenzae yes yes no no yes Vibrio cholerae yes yes no no yes Desulfovibria desulfuricans yes yes yes no no Streptococcus pneumoniae yes yes no no yes Bacillis subtilis yes yes no no yes Neisseria meningitidis yes yes no no yes 132    3.3.13 Sensitivity of WT, ΔgtaI, ΔctrA, and com gene mutants to infection by two uncharacterized phages Because RcGTA particles are so similar to genuine bacteriophages, and the com-like genes in R. capsulatus for RcGTA recipient capability, it was possible that these genes were involved in genuine phage infection. I therefore performed preliminary tests of the phage sensitivity of WT, ΔctrA, ΔgtaI, ΔcomEC, ΔcomF, ΔcomM, and ΔdprA by plaque assays using two different phages. The first phage (called Phage 1) is an uncharacterized prophage that is carried by the R. capsulatus strain DE442 and forms plaques on the WT B10 strain (but probably is the same as the phage sequenced by A. Hynes and A. Lang, Rcap NL, GenBank accession # JQ066768). The second phage (called Phage 2) is an environmental phage ("RcTitan" that forms plaques on WT B10 cells; GenBank accession # KR935213 (A. Westbye, personal communication), isolated by students working with D. Bollivar (https://www.iwu.edu/biology/faculty/bollivar.html; see also http://dx.doi.org/10.7554/eLife.06416.001).   I first tested each strain's sensitivity to infection by Phage 1, and found that compared to WT, the ΔctrA mutant formed fewer plaques than WT cells (~40%), and further, the ΔcomEC mutant formed no visible plaques; all other strains had WT numbers of plaques (Appendix D1). To determine the magnitude of the infection defect in the ΔctrA and ΔcomEC mutants, phage spot assays was performed using serial dilutions of phage stock, with concentrations ranging from 100 to 10-6. The magnitude of the defect in phage infection of the ΔctrA mutant was similar to the plaque assay 133  results, with a marginal ~60% reduction in the number of plaques compared to WT at similar dilutions, whereas no plaques/clearing was observed at any concentration of phage stock with the ΔcomEC mutant, suggesting that this strain is completely resistant to Phage 1 (Appendix D2).   The sensitivity of all strains for infection by Phage 2 was then tested. I found that all strains were sensitive to infection by Phage 2 at a similar level with the exception of the ΔctrA mutant, which again formed marginally fewer plaques (~10% of WT) than WT (Appendix D1). Overall, these data indicate that the ΔctrA mutant is somewhat resistant to both bacteriophages, and that the ΔcomEC mutant is completely resistant to Phage 1 but not Phage 2. 134  Chapter 4: Discussion 4.1 Quorum-sensing regulation of RcGTA production Several prior studies showed that RcGTA production is dependent on growth phase of laboratory cultures, with RcGTA becoming detectable in the early stationary phase of growth (Solioz et al., 1975, Florizone, 2006). The control of production is at the level of transcription initiation (Lang & Beatty, 2000), typical of QS regulated behavior, and it was subsequently found that RcGTA transcription is indeed regulated by QS dependent on the gtaI gene (Schaefer et al., 2002). Schaefer et al. also noted that a luxR homologue and possible receptor for the C16 and C14 acyl-HSLs synthesized by GtaI was encoded directly upstream (5‟) of the gtaI gene (Schaefer et al., 2002), and possibly co-transcribed with gtaI (Leung, 2010); this ORF was subsequently given the name gtaR. A follow up study found that gtaI also regulated ctrA transcription (Leung et al., 2013). The gtaR ORF was subsequently mutated, and found to have no effect on ctrA transcription, however when the gtaR ORF was disrupted in the ΔgtaI strain, a WT level of ctrA transcription was restored, showing that the ΔgtaR mutation was dominant over the ΔgtaI mutation (Leung et al., 2013). In other words, these results indicated that GtaR was a negative regulator because in the absence of gtaI (and thus C16/C14-acyl-HSLs), transcription of ctrA decreased. Additionally, the same pattern of regulation was observed for the gtaR promoter (Leung et al., 2012). Lastly, Leung et al. showed that the GtaR protein could be purified in the absence of acyl-HSL, and bound to its own promoter at the predicted -10 hexamer, which is typical of negative regulators of the LuxR-family (Leung et al., 2012, Tsai & Winans, 2010). 135  4.1.1 Co-transcription of gtaR and gtaI One of the questions that remained unanswered in previous work was if gtaR and gtaI are co-transcribed; the possibility was raised because of the short intergenic spacer (49 bp) and the fact that the genes are in the same orientation. I showed that these two genes are indeed co-transcribed as an operon (Fig 3-1), which is important for several reasons. First, it shows that in addition to regulating its own transcription, GtaR also regulates gtaI transcription; prior to this discovery, no luxRI QS pairs had been found to be co-transcribed. Other luxR-type negative regulators are convergently transcribed with their cognate luxI-type gene (Tsai & Winans, 2010). Second, co-transcription is compatible with the concept of GtaR/I forming an autoinducing loop. At low cell densities, GtaR is presumably bound to its own promoter, repressing both gtaR and gtaI transcription. At higher cell densities, a lower proportion of GtaR would be bound to the gtaRI promoter due to inhibition via binding of C16/C14 acyl-HSLs, thus leading to increased transcription of this operon. As transcription increases, presumably more GtaR would be made in addition to GtaI, however the synthesis of C16/C14 acyl-HSLs would quickly out-compete GtaR-based transcriptional repression because GtaI could continuously synthesize multiple acyl-HSLs whereas each GtaR monomer can presumably bind only a single acyl-HSL molecule. Thus, with increased transcription of the gtaRI operon, an excess of C16/C14 acyl-HSL would eventually be present, effectively abolishing negative regulation by GtaR. Positive regulator LuxR-type proteins are activated by binding acyl-HSL, causing them to gain binding affinity for the promoter region of their cognate luxI gene, activating transcription (Waters & Bassler, 2005, Fuqua et al., 1994). Thus, these systems form a positive auto-inducing loop to amplify 136  acyl-HSL signals (Lazdunski et al., 2004). The GtaRI system would also amplify incoming acyl-HSL signal, however by de-repression rather than activation. 4.1.2 GtaR negatively regulates RcGTA production and responds to multiple long-chain acyl-homoserine lactones Previous work demonstrated that gtaR regulates ctrA and gtaR transcription (Leung et al., 2012, Leung et al., 2013), however RcGTA regulation was never investigated. I hypothesized that RcGTA regulation by GtaR would be similar to its own auto-regulation and the regulation of CtrA. Using the same mutants, I showed that GtaR does indeed negatively regulate transcription of the RcGTA primary structural gene cluster because mutation of the gtaR gene in addition to gtaI offset the gtaI mutant defect. Additionally, a plasmid harbouring the gtaR ORF complemented the double mutant back to the single gtaI mutant phenotype, supporting this conclusion (Fig 3-2).   A prior study found that the LuxR-type regulator LasR was relatively loose in its signal specificity, and could bind and be activated by acyl-HSLs of similar acyl-tail length and bond-substitution (Savka et al., 2011). In natural environments, bacteria rarely, if ever, exist in a mono-culture as in laboratory pure cultures. I thus hypothesized that R. capsulatus could respond to signals produced by other bacteria to stimulate RcGTA production. Using spent growth media from other related species, such as R. sphaeroides and P.denitrificans, I indeed found that RcGTA production in the ΔgtaI mutant was stimulated by something in the spent growth media from these other species (Fig 3-3). R. sphaeroides and P. denitrificans both produce long-chain acyl-HSLs (Puskas et al., 1997, Schaefer et al., 2002), and so I hypothesized that acyl-HSLs of similar structure could stimulate RcGTA production in a ΔgtaI mutant. I observed that, 137  as predicted, acyl-HSLs of similar structure to those produced by R. capsulatus stimulated RcGTA production (Fig 3-4), and that the stimulatory effect was correlated to acyl-tail length. Evidently, R. capsulatus responds to acyl-HSLs with acyl-tail lengths within 2 carbon units of those endogenously produced. Furthermore, the tail length rather than the structure appeared to be the key determinant of recognition, as both C16c-acyl-HSL and the R. sphaeroides 7,8-cis-N-tetradecenoyl homoserine lactone stimulated RcGTA production similarly to C16 and C14 acyl-HSL, and both contain double-bonds in the acyl-tail. This effect is presumably due to recognition by GtaR because no acyl-HSLs elicited a response in the gtaRI double mutant (Fig 3-5); however, despite many attempts, no direct interaction between GtaR and an acyl-HSL was observed biochemically. Different approaches included direct addition of C16-acyl-HSL to EMSA binding reactions, expression and purification of 6HisGtaR with C16-acyl-HSL present in the growth medium and in all purification buffers, and even polymerization into native PAGE gel used for EMSAs. Regardless, this type of looseness in specificity have been observed previously in some LuxR/I-type systems, and bio-reporters are available that function similarly (Savka et al., 2011, Zhu et al., 2003). Also of note is that cognate LuxR homologues which respond to long-chain acyl-HSLs, such as LasR and QscR in P. aeruginosa, have clearly co-evolved to bind the long hydrophobic acyl-tail of these HSLs because there is a conservation of hydrophobic residues in the acyl-tail-containing cavity of the ligand binding domain (Lintz et al., 2011, Bottomley et al., 2007). Lastly, it should be noted that an excess (2 µM) of acyl-HSL was used in all cases. In WT R. capsulatus cultures, up to 390 nM of C16 acyl-HSL is detectable in culture fluids (Schaefer et al., 2002), which is 138  approximately one fifth of what I added in my experiments. It is therefore possible that R. capsulatus shows a preference for specific acyl-HSLs at more limiting concentrations, and that my conditions simply saturated the response within this reporter system. Additional experiments would be required to directly address this possibility.   Also of interest was the observation that spent E. coli growth media weakly induced RcGTA production. I initially hypothesized that AI-2 might be responsible for this response, however after testing the growth media from WT E. coli and an isogenic ΔluxS mutant (Tavender et al., 2008), it appeared that this was not the case. In the course of following up on this hypothesis, I made further interesting observations. First, although R. capsulatus does not encode a detectable homologue of luxS (synthesizes AI-2) (Schauder et al., 2001), it does encode homologues of proteins that function in the import of and response to AI-2. These include homologues of the Lsr proteins (Xavier & Bassler, 2005) LsrR, LsrK, LsrA, LsrC, LsrD, and LsrB (encoded by rcc02883, rcc02884, rcc02880, rcc02879, rcc02878 and rcc02877, respectively) in the genome sequence, with a minimum of 39% amino acid identity to the proteins found in E. coli. A schematic depiction of ORFs and predicted functions of the putative lsr genes is shown in Fig 4-1. Although I did not find RcGTA production to be affected by AI-2 under the conditions tested, the presence of these genes suggests that R. capsulatus could respond to AI-2 even though it does not synthesize it. This has been observed in other bacteria, which contain the same or similar regulators that function to „spy‟ on communication by other bacteria, and allow them to modulate their own behavior (Xavier & Bassler, 2003, Pereira et al., 2008). This is further evidence that R. 139  capsulatus has evolved as a member of a mixed microbial community, although the relevance of RcGTA in this context remains to be determined.   Figure 4-1.Schematic depiction of Lsr autoinducer 2 import and regulatory system. LsrB is a periplasmic protein that binds AI2 and delivers it to the LsrC and LsrD ABC-transporter type importer proteins; LsrA is an ATPase that provies energy for AI2 importation by this transporter. Once Internalized, AI2 is phosphorylated by the LsrK kinase. Binding of phosphorylated AI2 by LsrR results in loss of DNA binding affinity for LsrR and subsequent de-repression of the lsrACDB genes. Figure adapted from (Xavier & Bassler, 2005)  4.1.3 Analysis of the orphan LuxR homologues rcc01088 and rcc01823 During the analysis of the GtaRI QS system, three putative LuxR homologues were detected in the R. capsulatus genome. GtaR (encoded by rcc00328) was found to function in the same system as GtaI, however the function of the other two LuxR homologues, encoded by rcc01088 and rcc01823 remains unclear because the mutant strains were not different from WT in any phenotypes which I tested. With the number of sequenced bacterial genomes now very large, there have been several independent observations that the number of predicted LuxR-type regulator genes in proteobacterial genomes is considerably higher than the number of LuxI-type autoinducer synthase 140  genes (Patankar & Gonzalez, 2009, Schaefer et al., 2013). Many of these LuxR homologues are not associated with a LuxI-type gene, and consequently are referred to as „orphan‟ luxR genes. Unlike most cognate luxR/I pairs, genes encoding orphan LuxR homologues do not directly regulate transcription of a luxI gene, although some interact with the acyl-HSL produced by the LuxI homologue in the same bacterium to modulate some type of behavior (Patankar & Gonzalez, 2009). For example, ExpR in Sinorhizobium meliloti regulates EPS production (Pellock et al., 2002), VirR in Erwinia sp stimulates production of plant cell wall-degrading enzymes (Barnard & Salmond, 2007), and CarR in Serratia sp regulates antibiotic production (Coulthurst et al., 2005), all in response an acyl-HSL produced by the LuxI homologue in that bacterium. With the identification of different classes of HSL-based QS, such a p-coumaryl-HSL in R. palustris that is derived from the plant compound p-coumaric acid (Schaefer et al., 2008), it has been speculated that some orphan LuxR‟s may respond to plant or other exogenous derived signals to regulate cellular behavior. One example is XccR in Xanthamonas campestris, which activates a virulence gene proline iminopeptidase (pip) in response to certain plant factors present in extracts, although the identity(ies) are unknown (Zhang et al., 2012). Of note, the pip gene locus was found to be directly downstream of the xccR gene. A recent survey of the Poplus deltoides microbiome found that this orphan luxR/pip locus was observed in at least five independent instances, indicating that this function may be widely conserved (Schaefer et al., 2013).    Knockouts of either rcc01088 or rcc01823 had no effect on RcGTA production, capsule production, or motility; furthermore, neither of the mutations offset the defects caused by the ΔgtaI mutation, as was observed for gtaR. Thus, the function of these 141  genes in R. capsulatus remains unclear. The genomic context of rcc01823 does not yield any clues as to potential functions. However, the rcc01088 ORF lies directly upstream of a predicted pip gene, as seen in X. campestris and members of the P. deltoids microbiome (see Fig 3-13 in Chapter 3) (Schaefer et al., 2013), and so I speculate that Rcc01088 regulates rcc01087; whether this is true, and whether this putative function is in a pathogenic, symbiotic, or some other role remains to be determined. Furthermore, I predict that Rcc01088 responds to a plant-derived signal as do R. palustris RpaR and X. campestris XccR (Schaefer et al., 2008, Zhang et al., 2012), as opposed to long-chain acyl-HSLs like GtaR. Further experimentation would be required to address these possibilities, although the mutants are now available for such work.  4.2 Quorum-sensing regulation of a capsular polysaccharide receptor for the gene transfer agent of R. capsulatus The finding that the CPS of R. capsulatus is a receptor for the RcGTA is the first report of a receptor for any GTA. The involvement of the capsule in initial binding to cells solves a potential issue of the capsule providing a thick polysaccharide barrier to the cell surface that could decrease accessibility to the cell envelope of RcGTA particles, thus preventing or reducing sucessful injection of RcGTA-borne DNA into recipient cells. Evolution of RcGTA to bind to this structure negates this problem, and additionally provides a much greater surface area for RcGTA to initially bind. It is important to note, however, that the capsule is not essential for RcGTA recipient capability (loss of capsule decreases the recipient capability to ~5-10% of the WT value; 142  Fig 3-17), and so there appears to be a yet unidentified receptor for the RcGTA that is essential for binding and injection of RcGTA-borne DNA into cells. The strain 37b4 lacks a capsule, and may additionally lack the hypothetical secondary receptor because the recipient capability of 37b4 is undetectable. However, it is not clear whether the 37b4 strain lacks a hypothetical secondary receptor or there is another obstacle (perhaps a restriction endonuclease) that blocks RcGTA-borne gene acquisition. 4.2.1 Growth phase and gtaRI regulation of RcGTA recipient capability and adsorption capability Because the concept of RcGTA recipient capability was unstudied, I decided to do an initial investigation to see if the pattern of recipient capability was similar to that of RcGTA production. The logic I used was that if a small percentage of R. capsulatus cells is induced to commit suicide by lysis and produce a burst of RcGTA, there could be similar regulatory systems to induce RcGTA recipient capability. I thus hypothesized that RcGTA recipient capability and RcGTA production could be co-regulated in terms of growth phase, and found this to be true (Section 3.2 and 3.3). I then discovered that the recipient capability loss in the ΔgtaI mutant was at least in part to the regulation of a CPS receptor involved in initial binding of RcGTA to cells. Because QS is often involved in growth phase regulated behavioral shifts (Schuster et al., 2013), I hypothesized that the GtaR/I system was also involved, and found this to be true in both recipient capability and regulation of a surface receptor. These results consistently showed that RcGTA production and regulation are tightly co-regulated, at least under the conditions I tested. Additionally, these data indicate a long and complex evolutionary history 143  between the RcGTA and R. capsulatus because production and recipient capability are linked.  4.2.2 GtaRI regulation of capsule biosynthesis QS regulation of extracellular polysaccharides is relatively common, and there are many examples of LuxR/I-like pairs that regulate this behavior. Examples include pel and psl biosynthesis in P. aeruginosa regulated by LasR/I (Wei & Ma, 2013), and extracellular polysaccharide biosynthesis regulation by EsaR in Pantoea stewartii (von Bodman et al., 1998). Interestingly, EsaR is also a LuxR-type negative regulator (Tsai & Winans, 2010). EPS is often a constituent of biofilms (Nadell et al., 2008, Wei & Ma, 2013) and has other functions in natural settings, and perhaps does for R. capsulatus as well. I speculate that GtaR/I and the capsular polysaccharide of R. capsulatus have a function in a biofilm context in natural environments, similar to homologous systems in other bacteria. I was unable to find conditions where R. capsulatus forms a biofilm, however I was not exhaustive in this search. Additionally, there have been no prior studies on the capability of R. capsulatus to form biofilms, and so there was no clear place to start. Several questions in this area are ripe for future study. These include: does R. capsulatus form biofilms? And if so, are gtaR/I and the capsular polysaccharide involved? There are other functions of capsules in bacteria, however most of them have been studied in the context of pathogenesis, and so when and why the free-living R. capsulatus species forms a capsule remains unclear.  4.2.3 Identification of capsule polysaccharide biosynthesis genes The rcc01081-1086 gene cluster resembles group 1 or 4 Wzy-dependent capsule biosynthesis genes, as well as group 1 LPS O-antigen clusters. Indeed, the machinery 144  used for CPS and LPS O-antigen biosynthesis is very similar and sometimes difficult to distinguish based on sequence analysis alone (Whitfield, 2006). One factor that I used to attempt to differentiate the two was genomic location. LPS O-antigen biosynthesis genes are generally located in close proximity to other genes involved in synthesis of the core oligosaccharide of LPS (Raetz & Whitfield, 2002, Whitfield, 2006), however homologues of these genes were not detectable in the proximity of rcc01081-1086 (in fact, as shown in Fig 3-13, rcc01081-86 are flanked by putative RcGTA attachment factors and an orphan LuxR homologue). For group 4 Wzy-dependent capsule biosynthesis systems, genes encoding the machinery that synthesizes the polysaccharide repeat unit are separate from other required genes, such as a polysaccharide chain initiation protein (e.g. WecA, which attaches GlcNAc to a polyisoprenyl phosphate on which the polysaccharide chain is built), and export proteins such as Wza, WzB, and Wzc. Furthermore, functions of these proteins may also overlap and be carried out by genes in other polysaccharide biosynthesis clusters, such as the ‟22 minute‟ locus in E. coli (Whitfield, 2006). A search of the R. capsulatus genome for other required machinery revealed clear homologues of a putative chain-initiator WecA (rcc01932), and export proteins Wza, Wzb, and Wzc (rcc01958-1960). Additionally, the pattern of regulation of these genes was similar to that of rcc01081-1086, with rcc01932 being notably quite down-regulated in the ΔgtaI mutant (9-fold). A full schematic of the putative CPS biosynthesis system is given in Fig 3-12.  The morphological phenotype of the Δ1081 mutant was initially surprising. I had predicted a loss in capsule biosynthesis, however cells were swollen and filamentous, and formed massive aggregates in liquid culture. The Δ1081 mutant did not produce a 145  capsule, and resembled the ΔgtaI and 37b4 strains in macroscopic tests of pelleting and CPS/EPS quantification (Fig 3-15 and 3-16), and so evidence suggested that at the very least, CPS biosynthesis was disrupted. A possible explanation for why cells were so malformed is that Rcc01081 is involved in synthesizing a polysaccharide repeat unit in the cytoplasm that is then flipped into the periplasm by Wzx, and polymerized into a longer repeat unit chain by Wzy. Without Rcc01081, an incomplete polymer would be formed that may no longer be recognized by the polysaccharide polymerase Wzy, or possibly the flippase Wzx. Thus, under capsule-induced biosynthesis conditions, cells may be burdened by a buildup of incomplete polysaccharide that cannot be exported, which causes other defects such as cell shape changes. Pleiotropic phenotypes for these types of mutants are not uncommon (Xayarath & Yother, 2007).   Evidence that supports this model is that under conditions where cells produce less capsule (and thus less precursor polysaccharide polymer), such as in YPS medium or in a ΔgtaI mutant background (Δ1081/ ΔgtaI), the cell morphology changes caused by the Δ1081 mutation are offset (Fig 3-16). These data also clearly showed that rcc01081 is regulated by GtaI. Additionally, I knocked out the putative Wzy homologue rcc01085, and found that Δ1085 had the same phenotype as the Δ1081 mutant, which is consistent with this hypothesis; a buildup of polysaccharide in the Δ1085 mutant would be present because although the correct polysaccharide repeat unit would be synthesized, there is no Wzy polymerase to synthesize the polysaccharide chain and deplete the pool of complete polysaccharide repeat units.  Mutagenesis of the wecA homologue rcc01932 showed that this gene is involved in the same pathway as rcc01081-1086 because the Δ1932 strain no longer produces a 146  capsule. A key difference between Δ1932 and the Δ1085 and Δ1081 mutants is that Δ1932 cells are morphologically similar to WT cells as opposed to the cell shape defects in the Δ1081 and Δ1085 strains (Fig 3-16). This phenotype fits with the model of rcc01932 encoding a polysaccharide chain initiator, because polysaccharide synthesis would not start in the Δ1932 mutant, preventing the buildup of unused polysaccharide repeat units.  If, as predicted, Rcc01932 initiates glycan synthesis that involves Rcc01081-1086, removing rcc01932 would offset the major phenotypic defects of the Δ1081 and Δ1085 strains because synthesis of a polysaccharide polymer would never initiate. To directly test this, I constructed a Δ1081/Δ1932 double mutant, and as predicted, the morphology of cells are identical to the Δ1932 single mutant (Fig 3-16). This result indicates that mutation of rcc01932 offset the phenotypic effect caused by the mutation of rcc01081, and that the two distant genes function in the same capsule biosynthesis system. Mutation of other genes in either CPS synthesis gene cluster is required to verify their role in CPS biosynthesis.   4.2.4 Identification of capsule as a receptor for the RcGTA Binding to the capsular polysaccharide of is a mechanism for several phage to adsorb to cells (Stirm & Freund-Molbert, 1971, Pickard et al., 2010). Furthermore, the CPS represents a thick coating that could present a barrier to access the surface of R. capsulatus cells, and so using the CPS as an initial binding receptor for RcGTA adsorption could negate this potential problem. A capsule acting as a barrier to phage penetration to cells has been observed in Staphylococcus aureus and other species (Wilkinson & Holmes, 1979). A number of genuine phages use capsular polysaccharide 147  as an initial binding receptor for adsorption to cells, and so it is not a great surprise that the RcGTA also functions this way. Examples of these are the coliphages K5a, and K1-5 (Stirm & Freund-Molbert, 1971, Choy et al., 1975), and the VI phages of Salmonella enterica. Interestingly, these phages also possess enzymes that degrade the CPS upon binding (Rakhuba et al., 2010, Pickard et al., 2010). Such a mechanism allows the phage to breach the capsule layer, which can span a relatively large distance (~0.5 µM). A specific mechanistic example is the KflA protein of coliphage K5a, which functions as a polysaccharide lyase that degrades K5 capsule polysaccharide, and is a tail-spike protein (Clarke et al., 2000). RcGTA may use a similar strategy to traverse the capsule layer, although there is no clear homologue of KflA in R. capsulatus. The RcGTA orfg15 has weak similarity to a putative rhamnosyltransferase, and rhamnose is a component of the R. capsulatus capsule, and so the orfg15 gene product may be an effector. The orf g14 was shown to have glycoside hydrolase activity, degrading peptidoglycan, and so is likely involved in passage of RcGTA-borne DNA through the periplasm (Fogg et al., 2012).  A prior study found that the capsular polysaccharide of R. capsulatus strain St. Louis was initially obtained as part of an SDS-insoluble complex (Bräutigam et al., 1988). This complex was found to contain peptidoglycan, protein, and polysaccharide, and the polysaccharide was liberated by addition of a protease. Furthermore, the same complex purified from the non-encapsulated 37b4 strain was found to lack the polysaccharide component attributed to the capsule, although the protein-peptidoglycan complex remained; the same complex purified from a phage-resistant strain of St Louis, RC1-, was also found to lack the polysaccharide (Bräutigam et al., 1988, Flammann & 148  Weckesser, 1984). These findings are of note for two reasons. First, the fact that polysaccharide attachment appears to involve a protein component may explain the  observation that proteinase K abolishes the loose pellet phenotype. Second, it is an interesting parallel that an R. capsulatus genuine phage also appears to utilize the capsule as a receptor in a fashion analogous to RcGTA.  As a final note, after I finished work on the CPS, a follow-up study was done in our lab looking at the putative attachment factors encoded by rcc01079 and rcc01080. Both of these proteins were found in a previous proteomics study to co-purify with RcGTA particles (Chen et al., 2009a), but are located far from the RcGTA primary gene cluster and instead are in proximity to the rcc01081-1086 CPS biosynthesis gene cluster (Lang et al., 2012). It has been found that a Δ1080 mutant still produces RcGTA at WT levels, however it is greatly reduced in its capability to infect recipient cells (Westbye et al. unpublished), and this is largely due to a reduction in adsorption of Δ1080-produced RcGTA to recipients. Based on this, and the proximity to rcc01081-1086, it was hypothesized that rcc01080 encoded an attachment factor that binds to the capsule of R. capsulatus. This has been found to be the case because RcGTA produced by a Δ1080 strain binds to Δ1081 and Δ1932 (capsule-lacking) cells similarly to WT RcGTA (Westbye et al., unpublished). The architecture of RcGTA structural genes being located so far from the primary gene cluster is an organization not seen in phages.  Overall, it appears that the capsular polysaccharide and its cognate attachment factors have evolved in concert with RcGTA. The driving force for this co-evolution and conservation may have been to increase transduction frequencies by gaining the 149  capability to bind the capsule, or a response to the possible HGT acquisition of capsule genes (and thus a capsule), indicated by the low G/C% and different codon usage of rcc01085 (encoding a Wzy homologue) compared to most other R. capsulatus genes. That is, acquisition of a capsule could have subsequently interfered with RcGTA binding to cells, and so over time RcGTA particles evolved the capability to bind the capsule (assuming a selective advantage from maintaining RcGTA-dependent HGT). There are many avenues of further research in this area, such as: what is the identity of the putative RcGTA secondary receptor? And what is the significance of the possible HGT acquisition of the Wzy homologue (rcc01085) within the rcc01081-1086 gene cluster?  There are many technical challenges to answer such questions, however the represent a very interesting area of research.  4.3 A natural transformation-like system essential for RcGTA recipient capability is regulated by CtrA and quorum-sensing The discovery of the absolute loss of RcGTA recipient capability in the ΔctrA mutant was probably my most important finding, because it led to discovery that an entire natural transformation-like pathway is required for import and recombination of RcGTA-borne DNA.  It is notable that R. capsulatus is not known to be naturally competent, and genetic transformation of R. capsulatus with naked DNA has not been observed to date, and so it is possible that these genes may be maintained to specifically function in the RcGTA system.  The subsequent discovery that gtaI in addition to ctrA also regulates several of these genes in addition to ctrA itself is interesting because it indicates in that multiple 150  levels of regulation of RcGTA recipient capability, in addition to CPS regulation. Furthermore, these results greatly strengthen the concept of co-evolution between RcGTA genes and the R. capsulatus genome, because they provide additional evidence that RcGTA is integrated into R. capsulatus biology. These data also show that the RcGTA HGT mechanism combines key aspects of natural transformation and gene transduction, which were previously thought to be unrelated.  4.3.1 CtrA induction of RcGTA recipient capability CtrA is a master regulator of the cell cycle in C. crescentus (Quon et al., 1996), and regulates motility in many α-proteobacteria (Greene et al., 2012). Transcriptome analyses of ΔctrA versus WT strains of C. crescentus and R. capsulatus showed that in both species > 200 genes are CtrA-regulated, indicating that CtrA probably controls as yet uncharacterized processes (Laub et al., 2000, Mercer et al., 2010). Because CtrA homologues have not previously been implicated in natural competence regulation, or GTA recipient capability, CtrA-dependent regulation of a GTA recipient capable state is novel. There are CtrA homologues in all α-proteobacteria examined to date that possess RcGTA-like genes, and so CtrA may be involved in GTA recipient capability in other species. I observed that the loss of RcGTA recipient capability in a ΔctrA mutant was partially rescued by the phosphomimetic CtrA protein D51E, and increased to ∼ 210% of WT by the non-phosphorylated mimetic D51A (Fig 3-20). There are several possible interpretations of these results. First, RcGTA recipient capability may be induced by both phosphorylated and non-phosphorylated CtrA, with induction by non-phosphorylated CtrA being much stronger. Second, non-phosphorylated CtrA may be the sole form that activates RcGTA recipient capability, and another form of regulation 151  may exist, such as the regulated proteolysis of non-phosphorylated CtrA, as seen in C. crescentus (Curtis & Brun, 2010). Third, others have observed that the C. crescentus D51A and D51E constructs do not precisely mimic the phosphorylated and non-phosphorylated states of CtrA (Curtis & Brun, 2010, Siam & Marczynski, 2003). It is possible that both CtrA and CtrA∼P exist in equilibrium between two conformations, a DNA non-binding state and a DNA-binding state. Thus phosphorylation shifts the equilibrium to a DNA binding conformation. The CtrA D51E mimics the phosphorylated state, presumably because the Glu side-chain is more bulky than that of Asp. The CtrA D51E mutation may not be as effective in shifting the equilibrium as true phosphorylation of Asp51, resulting in a weak induction of RcGTA recipient capability rather than the absence of induction. In contrast the CtrA D51A mutation may shift the equilibrium in the opposite direction even greater than than WT D51 residue, which would explain the stronger effect than the WT CtrA. 4.3.2 RecA involvement in RcGTA recipient capability The ubiquitous RecA protein is important for the repair of DNA lesions in bacteria, and necessary for homologous recombination of incoming DNA into the chromosome in natural transformation (Camerini-Otero & Hsieh, 1995, Yadav et al., 2013). RcGTA-mediated gene transfer in the R. capsulatus genome occurs at every locus that has been tested, either chromosomal or plasmid, as shown by many allele replacement experiments (Genthner & Wall, 1984, Scolnik & Marrs, 1987). My data confirm the requirement for RecA, and the need for the competence protein DprA additionally argues that RcGTA-carried DNA integrates into the genome via a host cell homologous recombination system, as opposed to a phage-like integration system. 152  4.3.3 Proposed functions of DprA and involvement in RcGTA recipient capability DprA proteins in B. subtilis, S. pneumoniae and H. pylori have been characterized, but their only known function is in natural transformation pathways (Mortier-Barriere et al., 2007, Yadav et al., 2013, Dwivedi et al., 2013, Mirouze et al., 2013). My findings extend the function of DprA proteins to the RcGTA recipient capability pathway in R. capsulatus, and possibly other GTA-producing organisms. Indeed, DprA homologues were detectable in all bacteria known to possess a functional GTA, and in my set of α-proteobacteria containing RcGTA-like genes. Based on the combination of knockout and expression studies reported here, dprA is clearly expressed and functional within R. capsulatus cells, although its‟ in vivo functions apart from RcGTA-mediated gene transfer are not clear. Nevertheless, my investigation into the structure and in vitro activities of RcDprA revealed several possibilities.  RcDprA contains a DD3 (see Section 3.3.5), and this domain resembles the DNA-binding motif of dsDNA-binding proteins. Full-length HpDprA also contains this domain and binds both ssDNA and dsDNA. However a truncated HpDprA protein lacking the DD3 retained the capability to bind ssDNA, indicating that the DD3 is not essential for ssDNA-binding (Wang et al., 2013). Furthermore, many DprA proteins contain a DD3, and the amino acid sequence indicates conservation of identity. Based on this analysis, and the dsDNA binding by RcDprA, I hypothesize that the DD3 domain confers the capability of DprA proteins to bind dsDNA in addition to ssDNA in EMSA assays. My attempts to purify a C-terminally truncated RcDprA lacking part or all of the DD3 were not successful, and so to date, direct biochemical evidence has not been obtained. The possibility exists that the DD3 confers additional activities to DprA 153  proteins, or that a probable dsDNA binding capability conferred by the DD3 is important for another activity, such as in strand invasion or strand annealing in homologous recombination. However it is difficult to predict a precise function(s) with the currently available data, and so an in-depth biochemical study is needed.  Other DprA proteins facilitate RecA polymerization onto ssDNA by breaching a SSB protein barrier, which inhibits RecA binding to ssDNA. Experiments on S. pneumoniae and B. subtilis DprA showed that these proteins interacted with E. coli RecA and modestly increased ATPase activity at sub stoichiometric concentrations in the presence of SSB (Mortier-Barriere et al., 2007, Yadav et al., 2013). R. capsulatus has two homologues of SSB proteins, rcc01805 and rcc00014, but neither has been studied and so I used a commercially available recombinant SSB protein from E. coli. I observed a similar effect of RcDprA on RecA ATPase activity, indicating that this may be a conserved feature of DprA proteins. The observed differences in RecA ATPase activity upon addition of RcDprA were not as great as those reported to have been seen with SpDprA and BsDprA (Mortier-Barriere et al., 2007, Yadav et al., 2013), which may be due to the phylogenetic distance between E. coli and R. capsulatus. E. coli RecA and R. capsulatus RecA share 62% identity, whereas E. coli and R. capsulatus DprA share only 31% identity, and so non-conserved interaction residues may be absent. 4.3.4 Comparison to other dprA genes, in terms of regulation and function The dprA genes of B. subtilis and S. pneumoniae are in competence-induced regulons (Karudapuram et al., 1995, Berka et al., 2002, Mortier-Barriere et al., 2007, Mirouze et al., 2013). In both S. pneumoniae and B. subtilis competence development is QS-regulated, as are the dprA genes (Mirouze et al., 2013, Grossman, 1995). As in 154  most Gram-positive bacteria, S. pneumoniae and B. subtilis use modified oligopeptides as QS autoinducers (Waters & Bassler, 2005); S. pneumoniae uses the competence-stimulating peptide (CSP), and B. subtilis uses the ComX pheromone.  In S. pneumoniae, the competent state develops quickly, and lasts only a short period of time before cells are no longer competent, with dprA expressed during only that short period of time. Interestingly, DprA is involved in the shut-off of this competent state through interaction with ComE (Mirouze et al., 2013). In B. subtilis, competence is induced in a sub-population of cells (Dubnau, 1991), and subsequently dprA is expressed highly within only this sub-population (Berka et al., 2002).  In R. capsulatus, dprA is expressed in the vast majority of cells, with an increased expression in the stationary phase (Fig 3-22 and 3-32), following a classical LuxR/I type of QS cascade, which differs from the QS regulation of dprA in other bacteria. The difference from S. pneumoniae regulation is that once R. capsulatus cells begin to express dprA, they continue to do so into the stationary phase. The QS regulation of dprA in R. capsulatus is different from that in B. subtilis in that dprA is expressed in essentially all cells in an R. capsulatus population rather than a sub-population. The Gram-negative H. pylori and Neisseria species are constitutively competent, although factors such as nutrient limitation and DNA damage alter overall competence levels (Seitz & Blokesch, 2013a). However the expression of dprA has not been studied in H. pylori or Neisseria. Competence in Pseudomonadaceae species appears to increase with culture density, and peak in the stationary phase (Seitz & Blokesch, 2013a), and so dprA expression may be similar to that in R. capsulatus. 155  Based on these observations, the mechanisms of dprA regulation vary across species, and this work represents the first report of LuxR/I-type QS regulation of a dprA gene. An additional point is that dprA expression in all cells for a prolonged period suggests that DprA may have some other function, as it would be energetically wasteful to continuously produce a protein at high levels for the sole purpose of RcGTA recipient capability. When RcDprA was queried for potential protein interaction partners with STRING 9.05, factoring in neighbourhood, gene fusion, co-occurrence, co-expression, and experimental data (Franceschini et al., 2013), the top three hits were topoisomerase I (encoded by topA), ComM, and RecA. Topoisomerase I is involved in removing DNA supercoils during transcription and DNA replication (Wang, 2002). Interestingly, R. capsulatus topA (rcc03100) is located very close to dprA, and this is a conserved feature in diverse bacteria (Mortier-Barriere et al., 2007). I have shown that RcDprA increases RecA ATPase activity in the presence of SSB, as for other DprAs (Mortier-Barriere et al., 2007, Yadav et al., 2013). The predicted interaction with ComM is intriguing; based on microarray values, the R. capsulatus predicted comM has qualitatively the same expression pattern as dprA (regulated by CtrA, GtaI, and growth phase; Table 3-4). Deletion of comM in H. influenzae results in decreased natural transformation efficiency, but its function is not known (Sinha et al., 2012). I generated a mutant of comM, and found that it also had an absolute loss of RcGTA recipient capability (Fig 3-33). This provides some initial genetic evidence that ComM may work in the same pathway as DprA, at least in RcGTA recipient capability, because inactivation of each gene generates the same phenotype. Unlike DprA, however, there is no indication of a function for ComM. Hydropthy analysis indicates 156  that it is probably cytoplasmic, however when I attempted to purify the protein, it was not soluble after cell lysis under standard conditions and I was unable to purify it as a native protein. Thus, I did not continue on to biochemical studies. The only clear motif in the ComM amino acid sequence is an ATPase domain similar to that of magnesium chelatase; however this only indicates that ComM probably hydrolyzes ATP to drive some process, because the rest of the protein does not have significant similarity to a domain of known function. Investigating the function of ComM is an area with much potential, and a mutant and protein expression system has been generated for future research. Additional functions of RcDprA, its interaction partners, and the role of other genes potentially involved in RcGTA recipient capability are other avenues ripe for future research. 4.3.5 RcGTA-borne DNA entry and recombination into the genome of recipient cells The genes identified in the R. capsulatus com-like pathway, specifically DprA, ComEC, and ComF, are defining proteins in natural transformation systems in other bacteria (Johnston et al., 2014). These proteins are thought to function in the import and recombination of transforming ssDNA, and my results indicating that all of three of these genes are required for RcGTA recipient capability are consistent with RcGTA-borne DNA being processed by the classical com pathway. However more in-depth biochemical analysis is required for verification. Naturally competent bacteria take up dsDNA via a pilus structure (Seitz & Blokesch, 2013a, Mell et al., 2012); R. capsulatus B10 cells are decorated with pili (Shelswell et al., 2005), but their possible involvement in RcGTA recipient capability remains to be determined. Furthermore, additional 157  periplasmic or cytoplasmic membrane-associated proteins are involved in natural transformation in other bacteria, such as the EndA nuclease in S. pneumoniae, which functions to degrade one strand  of dsDNA to generate ssDNA to be transported into the cytoplasm by ComEC/ComF (Midon et al., 2011), or ComEA in V. cholerae which binds periplasmic DNA (Seitz & Blokesch, 2013b). There are no detectable EndA or ComEA homologues in R. capsulatus, however. These kinds of additional required proteins are variable in natural genetic transformation systems, and are often carried out by different proteins in distantly related bacteria. Thus, there likely exist additional proteins involved in processing RcGTA-borne DNA in recipient cells, however identity(s) and putative role(s) cannot easily be inferred by sequence analysis.  I showed that comEC and comF natural competence-related genes are required for DNA carried within a phage-like RcGTA particle to enter the cytoplasm of recipient cells (Fig 3-33 and 3-34). Additionally, based on the finding that all organisms containing functional or putative GTAs contain ComEC and ComF homologues, I speculate that it is a general mechanism for internalization of GTA-borne DNA requires the comEC/comF system in other GTA-containing bacteria.   Although my data indicate that there is an accumulation of RcGTA-borne DNA in the periplasm of ΔcomEC and ΔcomF mutants, there are two possible interpretations of these data. Firstly, the ComEC DNA transporter could serve as an inner membrane receptor for a lengthening tail or a TMP, perhaps in a fashion analogous to ManY in the phage λ (Davidson et al., 2012, Williams et al., 1986, Boulanger et al., 2008). In these instances, the cellular function of the protein (such as in mannose transport, or in this case DNA transport) is not required for phage infection, and the proteins are simply co-158  opted for the phages‟ own purposes (Davidson et al., 2012). Secondly, the RcGTA may inject its DNA into the periplasm or possibly deliver it to the ComEC transporter in a co-ordinated fashion via injected proteins, which then transport the DNA through the CM as in natural transformation (Johnston et al., 2014).  Although my data do not definitively differentiate between these two possibilities, I favour the latter explanation for several reasons. Firstly, the predicted RcGTA TMP protein is only 219 amino acids in length, which is much shorter than typical TMPs (>600 amino acids) that are thought to bridge the periplasmic space of non-contractile tailed phages (Davidson et al., 2012). Secondly, the fact that both comEC and comF expression are controlled by CtrA as part of a set of natural transformation gene homologues which also includes the recombination mediator DprA, suggests that they are part of a regulated system of DNA uptake and recombination. This is in contrast to the use of ManY (which has an unrelated function to DNA transport) as observed in the λ phage (Davidson et al., 2012). A summary of both possible models is depicted in Figure 4-2.  159   Figure 4-2. Possible DNA entry modes of RcGTA-borne DNA into recipient cells. Shown on the left (A) is my proposed mode of DNA entry. RcGTA-borne DNA is injected into the periplasm of recipient cells after binding to the cell surface. DNA then passes through the peptidoglycan layer via the action of the lysozyme-like protein encoded by P14 (Fogg et al., 2012). The ComEC/ComF DNA system then transports a ssDNA molecule into the cytoplasm as in natural transformation, and recombination occurs via the DprA/RecA mechanism in a pathway that may involve ComM (Brimacombe et al., 2014). An alternative interpretation of our data is shown on the right (B), where dsDNA is transported through the periplasm via the tape measure protein, which requires ComEC for DNA entry into the cytoplasm in a fashion analogous to the ManY protein in phage λ (Berrier et al., 2000). 160  4.3.6 Population level regulation of ctrA and dprA The observation that ctrA is expressed in essentially all cells in the population of a stationary phase culture (Fig 3-32) is of particular interest for several reasons. First, the fact that ctrA is expressed in the majority of the population contrasts with RcGTA expression, which occurs in a sub-population of <1% of cells. Because CtrA tightly regulates RcGTA transcription, this finding indicates that there is some other level of regulation of RcGTA expression that restricts expression to this sub-population. It is possible that this involves another regulator that remains to be identified, or perhaps a post-translational modification of CtrA, such as proteolytic degradation by ClpX as in C. crescentus (Iniesta & Shapiro, 2008). To my knowledge, this is the first study of the population-level expression of ctrA; other studies have focused on phosphorylation state and the localization of CckA (Jacobs et al., 1999, Jacobs et al., 2003), however none addressed whether all cells actually expressed ctrA. I speculate that other bacteria that use CtrA for regulation have a similar pattern of expression. In the cases where CtrA is not essential for viability, there may be variations, however in species such as C. crescentus where CtrA is essential for viability, it is safe to assume that ctrA is expressed in all cells in the population because they otherwise die. Phosphorylation of CtrA does not specifically induce RcGTA expression because a non-phosphorylatable CtrA allele still induces RcGTA expression in a ΔctrA mutant, although such strains do not lyse and release RcGTA. The phosphomimetic complement pD51E, however, both induces RcGTA transcription and lytic release (Mercer et al., 2012). As a second overall point of interest, with CtrA also being a master regulator of RcGTA recipient capability that is expressed in the vast majority of 161  the population, a logical deduction is that the majority of the population can act as RcGTA recipients. The key piece of data that supports this interpretation and differentiates it from the RcGTA sub-population expression pattern is that dprA is also expressed in all cells in the population in a pattern like that of ctrA. Thus, induction of expression of dprA via CtrA must differ in at least one aspect from the one that leads to CtrA induction of RcGTA. The nature of this pathway, and the cell regulatory cues that push the cell in one direct or another (i.e. toward becoming an RcGTA producer or a recipient) remain to be elucidated; it is of note that there is no evidence to indicate that RcGTA producers do not also produce the Com proteins required to be recipients.  I also attempted to fuse the comEC, comF, and comM promoters to the mCherry fluorescent protein gene to evaluate their population level expression, but was unable to observe a fluorescent signal strong enough to generate an image or perform FACS analysis.  4.3.7 Involvement of ctrA and comEC in phage infection In an interesting preliminary set of experiments, I observed that the ΔctrA mutant is somewhat resistant infection to two phages I tested (Phage 1 and Phage 2), and that the ΔcomEC mutant is completely resistant to Phage 1 but not Phage 2. It is also notable that no other mutants tested had defects in phage infection, including the ΔdprA, ΔcomM, and ΔcomF mutants. Both Phage 1 and 2 are incompletely characterized, although the genomes have been sequenced (see Appendix D) and thus it is unknown what type of morphology (i.e., siphoviridae, myoviridae, or podoviridae) they posses, although they are double-stranded DNA phages.  162  The complete resistance of the ΔcomEC mutant to Phage 1 raises the possibility that Phage 1 could be a siphoviridae type of phage which uses ComEC as an inner membrane receptor. Furthermore, the reduction of infection levels of the ΔctrA mutant could be a result of the down-regulation of comEC. If Phage 1 uses ComEC as an inner membrane receptor, this represents an interesting overlap with RcGTA recipient capability; however it is important to remember that RcGTA recipient capability requires all of the com-like genes, the rest of which are dispensable for phage infection, and so infection by this phage is fundamentally different. The finding does raise the possibility that RcGTA may share a common ancestor with a phage that used ComEC as an inner membrane receptor, and that RcGTA subsequently evolved to use the entire com pathway for both DNA transport and recombination. Notably, another study in H. influenzae identified the comEC homologue (also called rec2) as being involved in phage recombination in addition to natural transformation, however the identity of the phage was unknown (Kupfer & McCarthy, 1992). Thus, it is possible that ComEC homologues are involved in infection by phages in other bacteria as well.  Lastly, it is important to note that the ΔcomEC mutant had a WT sensitivity to Phage 2, indicating that involvement of ComEC in R. capsulatus phage infection is not universal. The reduction in phage infection in the ΔctrA mutant was similar, however, and so a partial resistance of ΔctrA mutants to phage infection may be more common. Further characterization of these two phages, and genetic and biochemical study of their involvement with the com-like genes would be a very interesting avenue of further research, and may provide clues to the evolution of RcGTA.   163   4.3.8 Overall model of the RcGTA HGT process I propose the following description of the RcGTA-mediated gene transfer process. Upon cultures reaching the stationary phase of growth, a sub-population (<1%) is stimulated to differentiate into a donor cells that go on to lyse and release RcGTA particles (Solioz et al., 1975, Fogg et al., 2012, Hynes et al., 2012). Concurrently, the bulk of the population expresses competence genes, which renders these cells capable of acquiring RcGTA-borne genes. RcGTA packages random ~4-kb dsDNA fragments of the cell genome (Yen et al., 1979, Hynes et al., 2012), and undergoes a poorly understood maturation process that requires the hybrid histidine kinase CckA (Westbye et al., 2013). RcGTA particles are subsequently released from the sub-population by host-regulated cell lysis employing a holin/endolysin system (Hynes et al., 2012, Westbye et al., 2013, Fogg et al., 2012), into an environment containing recipient-capable cells. Because RcGTA recipient capability is regulated by the same proteins as RcGTA production, expression of these factors is also maximal in the stationary phase, but is at a high level in essentially all potential recipient cells. One recipient-capability factor is  the CPS receptor that is involved in the initial binding of RcGTA to cells, which appears to be recognized by the rcc01079 and rcc01080 predicted RcGTA attachment factors (Westbye and Beatty, unpublished (Lang et al., 2012)). RcGTA DNA then passes through the cell envelope into recipient cells in a process requiring the ComEC and ComF putative DNA import system as in a natural transformation pathway. If sequence homology is present, DNA undergoes homologous recombination into the genome facilitated by DprA and possibly ComM. All of these factors are regulated in the 164  same fashion (or co-regulated) by the same systems (CtrA and GtaI) as RcGTA production. Because the cost of producting RcGTA is high (i.e., death), having the surrounding cells primed as RcGTA recipients by transcription of the com genes would provide a selective advantage to such cells, because they could take up the DNA packaged by producing cells, perhaps facilitating spread of beneficial mutations, or in HR-mediated DNA repair during growth under mutation-prone conditions.   165  Chapter 5: Conclusions and Future Directions 5.1 Conclusions The results presented in this thesis represent the first studies of factors specifically affecting the capability of R. capsulatus cells to receive RcGTA-borne DNA, and have opened the door on a new aspect of RcGTA research: uptake. Furthermore, the discovery that the same proteins, CtrA and GtaI, regulate RcGTA production and recipient capability greatly facilitates study of this area, because whole genome transcription microarray analyses of these mutants are available for use in identifying additional factors that may affect RcGTA recipient capability. The co-regulation of production and recipient capability also highlights the level to which RcGTA is integrated into the R. capsulatus physiology, and it is becoming ever clearer that GTAs are very distinct from transducing phages. An additional level of novelty in RcGTA-mediated transduction is that key aspects of both phage-mediated transduction and natural transformation are combined into a single HGT mechanism, which was unprecedented. How this came to be is an interesting question to consider, and many possibilities exist.  Based on sequence homology, it is clear that RcGTA and dsDNA phages share a common ancestor (Lang & Beatty, 2000, Lang et al., 2012). It is possible that this common ancestor was a ‘proto-phage’, which led to two lines of descent: GTAs and phages. Thus, the RcGTA may be the descendent of this progenitor, and represents a living fossil that mirrors this ancestor.  166  Alternatively, the RcGTA could have decended from a genuine phage, with RcGTA coming about as the result of a defective phage infection. Over time, it co-evolved with α-proteobacterial genomes, and eventually acquired the capability to use the com system already present. Conversely, it is possible that com proteins were originally phage proteins used for DNA transport and recombination, which became integrated into the host genome and evolved to function for naked DNA uptake in transformation rather than the original phage functions. Overall, the involvement of the com system in RcGTA-mediated transduction highlights that there are additional HGT mechanisms aside from the „big three‟ of conjugation, transduction, and transformation that remain to be discovered.   Overall, several fundamental questions about RcGTA biology have been addressed in this thesis. Firstly, GtaR regulates RcGTA production, and gtaR and gtaI are co-transcribed as an operon. Secondly, the capsule of R. capsulatus is an RcGTA initial receptor that is also regulated by GtaI. Lastly, RcGTA DNA entry and recombination into the chromosome requires natural transformation machinery that is regulated by CtrA and GtaI. These findings strengthen the concept that RcGTA has a long evolutionary history with R. capsulatus, and is deeply integrated into its cellular physiology. Because RcGTA-like gene clusters are widespread in the α-proteobacteria, some of which have been shown to be functional, and α-proteobacteria constitute a large fraction of bacteria in both aquatic and terrestrial environments (Williams et al., 2007), gene-transfer agent mediated HGT probably is prevalent in the environment and is likely a driver of α-proteobacteria evolution.  167  5.2 Future Directions QS regulation in R. capsulatus presents many avenues of further research. GtaR appears to be the cognate LuxR homologue that responds to the long-chain acyl-HSLs synthesized by GtaI, however I was unable to show a direct interaction between the two. Furthermore, the multiple sites where where GtaR should directly bind in the genome sequence are unclear, and will require a ChiP-seq type of experiment to address. Transcriptional regulators often bind to inverted repeats that are at least somewhat conserved in sequence, although there are some that do not follow this pattern and GtaR appears to be one of them. Searches of the R. capsulatus genome with degenerate versions of the single identified GtaR binding site revealed no regions of homology (Leung et al., 2012), yet GtaR must bind other sites because it has such a large regulon (at least 151 genes are dysregulated in a GtaI mutant (Brimacombe et al., 2013). Another unanswered question is: what is the function of the orphan LuxR homologues Rcc01088 and Rcc01823 in R. capsulatus? I generated mutants, but they have no apparent phenotype, yet according to microarray studies, they are transcribed under laboratory conditions. The availability of these mutants will facilitate delineating their functions.   The involvement of the cellular polysaccharide capsule as an RcGTA receptor is also quite interesting with many avenues for future research. Several phages use CPS as an initial binding receptor (Choy et al., 1975, Scholl et al., 2001), and so it is not surprising that RcGTA does the same. Notably, when the putative capsule-binding attachment factors rcc01079-1080 are mutated, RcGTA infects cells very poorly (Westbye et al. unpublished). There are still interesting questions that remain in this 168  area, such as: what is the structure of the CPS polymer? What other systems regulate capsule production? Are the other putative CPS genes involved in capsule biosynthesis? Is rcc01081-1086 truly an operon? A particularly intriguing gene is rcc01085, the predicted Wzy polysaccharide polymerase that appears to have been horizontally acquired. Generally, if genes or operons are acquired by HGT, the whole coding region has an altered GC content and codon usage bias; rcc01085, however, represents a single, key biosynthetic gene in the middle of a putative operon, and the GC skew begins and ends almost precisely at the start and stop codons. How this came to be is an interesting question. One possibility is that rcc01081-1086 was horizontally acquired, and over many generations of selection, developed the same codon usage and GC content as the rest of the R. capsulatus genome, whereas the codon usage of rcc01085 was imperative for the proper level of expression and thus was unable to evolve.  The requirement for CtrA in RcGTA recipient capability is interesting because it establishes CtrA as a master regulator of the RcGTA gene transfer process as a whole, controlling both production and uptake. The stimulus that activates CtrA transcription of genes in R. capsulatus is still unclear. CtrA appears to activate genes in both the phosphorylated and non-phosphorylated state, with some of the regulated genes being different subsets of RcGTA production and recipient capability factors. RcGTA recipient capability is strongly activated by a non-phosphorylatable CtrA complement, which is unusual for response regulators. Conversely, RcGTA maturation and lysis appear to be activated by phosphorylated CtrA (Mercer et al., 2012),  (A.B. Westbye, personal communication).  169  In C. crescentus, the hybrid histidine kinase CckA phosphorylates the phosphotransfer protein ChpT, which subsequently phosphorylates CtrA, and consequently, mutants of each gene have similar or identical phenotypes. In R. capsulatus, this is not the case. CckA and ChpT mutants have a similar phenotype in terms of RcGTA production, but CtrA mutants are different. RcGTA is still produced in ΔcckA and ΔchpT strains however it is not released, which is due at least in part to the down-regulation of the holin/endolysin genes (Westbye et al., 2013), whereas in CtrA mutants the RcGTA structural gene cluster is not transcribed (Mercer et al., 2012, Lang & Beatty, 2000) in addition to down-regulation of the holin/endolysin genes (Westbye et al. unpublished). Because recipient capability was so strongly activated by non-phosphorylatable CtrA, I hypothesized that CckA was not involved in RcGTA recipient capability. I did preliminary experiments examining RcGTA recipient capability of a ΔcckA and ΔchpT strains, and found the ΔchpT mutant to have a WT phenotype, however the ΔcckA mutant had ~95% loss of recipient capability. This was surprising because in a strain lacking CckA, CtrA would theoretically not be phosphorylated, and so one would expect RcGTA recipient capability to either increase or remain the same. Possible explanations for this phenomenon are that CtrA is phosphorylated by another, parallel system, and CckA can act as a CtrA phosphatase in this context, increasing the amount of non-phosphorylated CtrA. Alternatively, CtrA may be phosphorylated by a different regulator other than CckA that is involved in recipient capability. Regardless, there remain many unanswered questions in this area, such as: what is the cause of the ~95% loss of RcGTA recipient capability in the ΔcckA mutant? Are all domains of CckA (Fig 1-5C) necessary for this phenotype? Is there a parallel system regulating CtrA 170  phosphorylation other than CckA and ChpT? A whole genome transcriptomic microarray of a ΔcckA mutant versus WT cells is available, and may be of use in answering these questions.  Another area with a number of unanswered questions is that of the com genes that are required for RcGTA recipient capability, dprA, comM, comEC, and comF. Of particular interest is the R. capsulatus DprA protein, especially the DD3 domain it contains at the C-terminus. I was able to show both ssDNA and dsDNA binding with the full length protein, but was never able to purify a soluble truncated protein lacking the C-terminal domain, which I hypothesized would continue to bind ssDNA but not dsDNA. Future efforts at generating a truncated protein may directly address this question. Furthermore, the true cellular function of the DD3 remains unclear, as well as that of RcDprA as a whole. Although I showed that the DD3 domain appears to endow RcDprA with the capability to protect dsDNA from endonuclease digestion, this could very easily be a by-product of RcDprA being a non-specific DNA binding protein – once DNA is coated with protein in vitro, nucleases can no longer access it. Whether RcDprA reaches sufficiently high concentrations in vivo is unclear.  In terms of DprA function another interesting possibility was raised by Dr. R. Redfield (UBC), who observed that a H. influenziae ΔdprA mutant is hypersensitive to hydroxyurea (unpublished), which de-stabilizes replication forks, indicating that in addition to transformation, HiDprA has some other function. I attempted the same experiment in R. capsulatus and E. coli ΔdprA mutants, and observed no difference from WT in hydroxyurea sensitivity, and so this is not a general property of ΔdprA mutants (data not shown).  The availability of the purified protein and a predicted 171  structure of RcDprA are excellent starting materials for an in-depth study of this class of DD3 containing DprA proteins.      172  Bibliography Adams, C. W., M. E. Forrest, S. N. Cohen & J. T. Beatty (1989) Structural and functional analysis of transcriptional control of the Rhodobacter capsulatus puf operon. J Bacteriol 171: 473-482. Anthony, E. E., Jr. (1931) A Note on Capsule Staining. Science 73: 319-320. Arnold, K., L. Bordoli, J. Kopp & T. Schwede (2006) The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22: 195-201. Barany, F. (1985) Single-stranded hexameric linkers: a system for in-phase insertion mutagenesis and protein engineering. Gene 37: 111-123. Barnard, A. M. & G. P. Salmond (2007) Quorum sensing in Erwinia species. Anal Bioanal Chem 387: 415-423. Beatty, J. T. & H. Gest (1981) Biosynthetic and bioenergetic functions of citric acid cycle reactions in Rhodopseudomonas capsulata. J Bacteriol 148: 584-593. Bekker, M., M. J. Teixeira de Mattos & K. J. Hellingwerf (2006) The role of two-component regulation systems in the physiology of the bacterial cell. Sci Prog 89: 213-242. Berka, R. M., J. Hahn, M. Albano, I. Draskovic, M. Persuh, X. Cui, A. Sloma, W. Widner & D. Dubnau (2002) Microarray analysis of the Bacillus subtilis K-state: genome-wide expression changes dependent on ComK. Mol Microbiol 43: 1331-1345. Berrier, C., M. Bonhivers, L. Letellier & A. Ghazi (2000) High-conductance channel induced by the interaction of phage lambda with its receptor maltoporin. FEBS Lett 476: 129-133. Biers, E. J., K. Wang, C. Pennington, R. Belas, F. Chen & M. A. Moran (2008) Occurrence and expression of gene transfer agent genes in marine bacterioplankton. Appl Environ Microbiol 74: 2933-2939. Biondi, E. G., S. J. Reisinger, J. M. Skerker, M. Arif, B. S. Perchuk, K. R. Ryan & M. T. Laub (2006) Regulation of the bacterial cell cycle by an integrated genetic circuit. Nature 444: 899-904. Bottomley, M. J., E. Muraglia, R. Bazzo & A. Carfi (2007) Molecular insights into quorum sensing in the human pathogen Pseudomonas aeruginosa from the structure of the virulence regulator LasR bound to its autoinducer. J Biol Chem 282: 13592-13600. Boulanger, P., P. Jacquot, L. Plancon, M. Chami, A. Engel, C. Parquet, C. Herbeuval & L. Letellier (2008) Phage T5 straight tail fiber is a multifunctional protein acting as a tape measure and carrying fusogenic and muralytic activities. J Biol Chem 283: 13556-13564. Bräutigam, E., F. Fiedler, D. Woitzik, H. T. Flammann & J. Weckesser (1988) Capsule polysaccharide-protein-peptidoglycan complex in the cell envelope of Rhodobacter capsulatus. Arch Microbiol 150: 567-573. Brimacombe, C. A., H. Ding & J. T. Beatty (2014) Rhodobacter capsulatus DprA is essential for RecA-mediated gene transfer agent (RcGTA) recipient capability regulated by quorum-sensing and the CtrA response regulator. Mol Microbiol 92: 1260-1278. 173  Brimacombe, C. A., A. Stevens, D. Jun, R. Mercer, A. S. Lang & J. T. Beatty (2013) Quorum-sensing regulation of a capsular polysaccharide receptor for the Rhodobacter capsulatus gene transfer agent (RcGTA). Mol Microbiol 87: 802-817. Burrus, V. & M. K. Waldor (2004) Shaping bacterial genomes with integrative and conjugative elements. Res Microbiol 155: 376-386. Bush, K., P. Courvalin, G. Dantas, J. Davies, B. Eisenstein, P. Huovinen, G. A. Jacoby, R. Kishony, B. N. Kreiswirth, E. Kutter, S. A. Lerner, S. Levy, K. Lewis, O. Lomovskaya, J. H. Miller, S. Mobashery, L. J. Piddock, S. Projan, C. M. Thomas, A. Tomasz, P. M. Tulkens, T. R. Walsh, J. D. Watson, J. Witkowski, W. Witte, G. Wright, P. Yeh & H. I. Zgurskaya (2011) Tackling antibiotic resistance. Nat Rev Microbiol 9: 894-896. Camerini-Otero, R. D. & P. Hsieh (1995) Homologous recombination proteins in prokaryotes and eukaryotes. Annu Rev Genet 29: 509-552. Capra, E. J. & M. T. Laub (2012) Evolution of two-component signal transduction systems. Annu Rev Microbiol 66: 325-347. Carter, S. G. & D. W. Karl (1982) Inorganic phosphate assay with malachite green: an improvement and evaluation. J Biochem Biophys Methods 7: 7-13. Casjens, S. R. & I. J. Molineux (2012) Short noncontractile tail machines: adsorption and DNA delivery by podoviruses. Adv Exp Med Biol 726: 143-179. Chen, F., A. Spano, B. E. Goodman, K. R. Blasier, A. Sabat, E. Jeffery, A. Norris, J. Shabanowitz, D. F. Hunt & N. Lebedev (2009a) Proteomic analysis and identification of the structural and regulatory proteins of the Rhodobacter capsulatus gene transfer agent. J Proteome Res 8: 967-973. Chen, G., L. R. Swem, D. L. Swem, D. L. Stauff, C. T. O'Loughlin, P. D. Jeffrey, B. L. Bassler & F. M. Hughson (2011a) A strategy for antagonizing quorum sensing. Mol Cell 42: 199-209. Chen, Y. E., C. Tropini, K. Jonas, C. G. Tsokos, K. C. Huang & M. T. Laub (2011b) Spatial gradient of protein phosphorylation underlies replicative asymmetry in a bacterium. Proc Natl Acad Sci USA 108: 1052-1057. Chen, Y. E., C. G. Tsokos, E. G. Biondi, B. S. Perchuk & M. T. Laub (2009b) Dynamics of two Phosphorelays controlling cell cycle progression in Caulobacter crescentus. J Bacteriol 191: 7417-7429. Choy, Y. M., F. Fehmel, N. Frank & S. Stirm (1975) Escherichia coli capsule bacteriophages. IV. Primary structure of the bacteriophage 29 receptor, the E. coli serotype 29 capsular polysaccharide. J Virol 16: 581-590. Clarke, B. R., F. Esumeh & I. S. Roberts (2000) Cloning, expression, and purification of the K5 capsular polysaccharide lyase (KflA) from coliphage K5A: evidence for two distinct K5 lyase enzymes. J Bacteriol 182: 3761-3766. Coulthurst, S. J., A. M. Barnard & G. P. Salmond (2005) Regulation and biosynthesis of carbapenem antibiotics in bacteria. Nat Rev Microbiol 3: 295-306. Curtis, P. D. & Y. V. Brun (2010) Getting in the loop: regulation of development in Caulobacter crescentus. Microbiol Mol Biol Rev 74: 13-41. Cuthbertson, L., I. L. Mainprize, J. H. Naismith & C. Whitfield (2009) Pivotal roles of the outer membrane polysaccharide export and polysaccharide copolymerase 174  protein families in export of extracellular polysaccharides in gram-negative bacteria. Microbiol Mol Biol Rev 73: 155-177. Davidson, A. R., L. Cardarelli, L. G. Pell, D. R. Radford & K. L. Maxwell (2012) Long noncontractile tail machines of bacteriophages. Adv Exp Med Biol 726: 115-142. Dereeper, A., S. Audic, J. M. Claverie & G. Blanc (2010) BLAST-EXPLORER helps you building datasets for phylogenetic analysis. BMC. Evol. Biol. 10: 8. Dereeper, A., V. Guignon, G. Blanc, S. Audic, S. Buffet, F. Chevenet, J. F. Dufayard, S. Guindon, V. Lefort, M. Lescot, J. M. Claverie & O. Gascuel (2008) Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res 36: W465-469. Ding, H., M. M. Moksa, M. Hirst & J. T. Beatty (2014) Draft Genome Sequences of Six Rhodobacter capsulatus Strains, YW1, YW2, B6, Y262, R121, and DE442. Genome Announc 2. Draskovic, I. & D. Dubnau (2005) Biogenesis of a putative channel protein, ComEC, required for DNA uptake: membrane topology, oligomerization and formation of disulphide bonds. Mol Microbiol 55: 881-896. Dubnau, D. (1991) The regulation of genetic competence in Bacillus subtilis. Mol Microbiol 5: 11-18. Dwivedi, G. R., E. Sharma & D. N. Rao (2013) Helicobacter pylori DprA alleviates restriction barrier for incoming DNA. Nucleic Acids Res 41: 3274-3288. Edgar, R. C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32: 1792-1797. Elliott, J. & W. Arber (1978) E. coli K-12 pel mutants, which block phage lambda DNA injection, coincide with ptsM, which determines a component of a sugar transport system. Mol Gen Genet 161: 1-8. Feucht, A., A. Schmid, R. Benz, H. Schwarz & K. J. Heller (1990) Pore formation associated with the tail-tip protein pb2 of bacteriophage T5. J Biol Chem 265: 18561-18567. Fioravanti, A., B. Clantin, F. Dewitte, Z. Lens, A. Verger, E. G. Biondi & V. Villeret (2012) Structural insights into ChpT, an essential dimeric histidine phosphotransferase regulating the cell cycle in Caulobacter crescentus. Acta Crystallogr Sect F Struct Biol Cryst Commun 68: 1025-1029. Flammann, H. T. & J. Weckesser (1984) Composition of the cell wall of the phage resistant mutant Rhodopseudomonas capsulata St. Louis RC1. Arch Microbiol 139: 33-37. Florizone, S. M., (2006) Studies on the Regulation of the Gene Transfer Agent (GTA) of Rhodobacter capsulatus. In: Microbiology and Immunology. Vancouver: University of British Columbia, pp. 78. Fogg, P. C. M., A. B. Westbye & J. T. Beatty (2012) One for All or All for One: Heterogeneous Expression and Host Cell Lysis Are Key to Gene Transfer Agent Activity in Rhodobacter capsulatus. PLoS One 7: e43772. Foussard, M., S. Cabantous, J. Pedelacq, V. Guillet, S. Tranier, L. Mourey, C. Birck & J. Samama (2001) The molecular puzzle of two-component signaling cascades. Microbes Infect 3: 417-424. 175  Franceschini, A., D. Szklarczyk, S. Frankild, M. Kuhn, M. Simonovic, A. Roth, J. Lin, P. Minguez, P. Bork, C. von Mering & L. J. Jensen (2013) STRING v9.1: protein-protein interaction networks, with increased coverage and integration. Nucleic Acids Res 41: D808-815. Fuqua, W. C., S. C. Winans & E. P. Greenberg (1994) Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators. J Bacteriol 176: 269-275. Gambello, M. J., S. Kaye & B. H. Iglewski (1993) LasR of Pseudomonas aeruginosa is a transcriptional activator of the alkaline protease gene (apr) and an enhancer of exotoxin A expression. Infect Immun 61: 1180-1184. Genthner, F. J. & J. D. Wall (1984) Isolation of a recombination-deficient mutant of Rhodopseudomonas capsulata. J Bacteriol 160: 971-975. Greene, S. E., M. Brilli, E. G. Biondi & A. Komeili (2012) Analysis of the CtrA pathway in Magnetospirillum reveals an ancestral role in motility in alphaproteobacteria. J Bacteriol 194: 2973-2986. Grossman, A. D. (1995) Genetic networks controlling the initiation of sporulation and the development of genetic competence in Bacillus subtilis. Annu Rev Genet 29: 477-508. Gruenig, M. C., N. Renzette, E. Long, S. Chitteni-Pattu, R. B. Inman, M. M. Cox & S. J. Sandler (2008) RecA-mediated SOS induction requires an extended filament conformation but no ATP hydrolysis. Mol Microbiol 69: 1165-1179. Ha, S. C., J. Choi, H. Y. Hwang, A. Rich, Y. G. Kim & K. K. Kim (2009) The structures of non-CG-repeat Z-DNAs co-crystallized with the Z-DNA-binding domain, hZ alpha(ADAR1). Nucleic Acids Res 37: 629-637. Hancock, R. E. (1984) Alterations in outer membrane permeability. Annu. Rev. Microbiol. 38: 237-264. Hasegawa, H. & L. Holm (2009) Advances and pitfalls of protein structural alignment. Curr Opin Struct Biol 19: 341-348. Heuer, H. & K. Smalla (2007) Horizontal gene transfer between bacteria. Environ Biosafety Res 6: 3-13. Hirakawa, H., Y. Oda, S. Phattarasukol, C. D. Armour, J. C. Castle, C. K. Raymond, C. R. Lappala, A. L. Schaefer, C. S. Harwood & E. P. Greenberg (2011) Activity of the Rhodopseudomonas palustris p-coumaroyl-homoserine lactone-responsive transcription factor RpaR. J Bacteriol 193: 2598-2607. Holm, L. & P. Rosenstrom (2010) Dali server: conservation mapping in 3D. Nucleic Acids Res 38: W545-549. Hu, B., W. Margolin, I. J. Molineux & J. Liu (2013) The bacteriophage t7 virion undergoes extensive structural remodeling during infection. Science 339: 576-579. Hynes, A. P., R. G. Mercer, D. E. Watton, C. B. Buckley & A. S. Lang (2012) DNA packaging bias and differential expression of gene transfer agent genes within a population during production and release of the Rhodobacter capsulatus gene transfer agent, RcGTA. Mol. Microbiol. 85: 314-325. Imhoff, J. F., (1995) Taxonomy and Physiology of Phototrophic Purple Bacteria and Green Sulfur Bacteria. In: Anoxygenic photosynthetic bacteria. R. E. 176  Blankenship, M. T. Madigan & C. E. Bauer (eds). Dordrecht, The Netherlands: Kluwer Academic Publishers, pp. 1-15. Ind, A. C., S. L. Porter, M. T. Brown, E. D. Byles, J. A. de Beyer, S. A. Godfrey & J. P. Armitage (2009) Inducible-expression plasmid for Rhodobacter sphaeroides and Paracoccus denitrificans. Appl Environ Microbiol 75: 6613-6615. Iniesta, A. A. & L. Shapiro (2008) A bacterial control circuit integrates polar localization and proteolysis of key regulatory proteins with a phospho-signaling cascade. Proc Natl Acad Sci USA 105: 16602-16607. Ionescu, M. & S. Belkin (2009) Simple quantification of bacterial envelope-associated extracellular materials. J Microbiol Methods 78: 302-306. Irizarry, R. A., B. Hobbs, F. Collin, Y. D. Beazer-Barclay, K. J. Antonellis, U. Scherf & T. P. Speed (2003) Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4: 249-264. Jacobs, C., N. Ausmees, S. J. Cordwell, L. Shapiro & M. T. Laub (2003) Functions of the CckA histidine kinase in Caulobacter cell cycle control. Mol Microbiol 47: 1279-1290. Jacobs, C., I. J. Domian, J. R. Maddock & L. Shapiro (1999) Cell cycle-dependent polar localization of an essential bacterial histidine kinase that controls DNA replication and cell division. Cell 97: 111-120. Johnsborg, O., V. Eldholm & L. S. Havarstein (2007) Natural genetic transformation: prevalence, mechanisms and function. Res Microbiol 158: 767-778. Johnston, C., B. Martin, G. Fichant, P. Polard & J. P. Claverys (2014) Bacterial transformation: distribution, shared mechanisms and divergent control. Nat Rev Microbiol 12: 181-196. Karudapuram, S., X. Zhao & G. J. Barcak (1995) DNA sequence and characterization of Haemophilus influenzae dprA+, a gene required for chromosomal but not plasmid DNA transformation. J Bacteriol 177: 3235-3240. Katzke, N., S. Arvani, R. Bergmann, F. Circolone, A. Markert, V. Svensson, K. E. Jaeger, A. Heck & T. Drepper (2010) A novel T7 RNA polymerase dependent expression system for high-level protein production in the phototrophic bacterium Rhodobacter capsulatus. Protein Expr Purif 69: 137-146. Keen, N. T., S. Tamaki, D. Kobayashi & D. Trollinger (1988) Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene 70: 191-197. Kiefer, F., K. Arnold, M. Kunzli, L. Bordoli & T. Schwede (2009) The SWISS-MODEL Repository and associated resources. Nucleic Acids Res 37: D387-392. Klug, A. & D. Rhodes (1987) Zinc fingers: a novel protein fold for nucleic acid recognition. Cold Spring Harb Symp Quant Biol 52: 473-482. Koch, B., T. Liljefors, T. Persson, J. Nielsen, S. Kjelleberg & M. Givskov (2005) The LuxR receptor: the sites of interaction with quorum-sensing signals and inhibitors. Microbiology 151: 3589-3602. Kolibachuk, D. & E. P. Greenberg (1993) The Vibrio fischeri luminescence gene activator LuxR is a membrane-associated protein. J Bacteriol 175: 7307-7312. Kupfer, D. M. & D. McCarthy (1992) rec-2-dependent phage recombination in Haemophilus influenzae. J Bacteriol 174: 4960-4966. 177  Lang, A. S., (2000) The Gene Transfer Agent (GTA) of Rhodobacter capsulatus. In: Microbiology and Immunology. Vancouver: University of British Columbia, pp. 106. Lang, A. S. & J. T. Beatty (2000) Genetic analysis of a bacterial genetic exchange element: the gene transfer agent of Rhodobacter capsulatus. Proc Natl Acad Sci USA 97: 859-864. Lang, A. S. & J. T. Beatty (2001) The gene transfer agent of Rhodobacter capsulatus and "constitutive transduction" in prokaryotes. Arch Microbiol 175: 241-249. Lang, A. S. & J. T. Beatty (2002) A bacterial signal transduction system controls genetic exchange and motility. J Bacteriol 184: 913-918. Lang, A. S. & J. T. Beatty (2007) Importance of widespread gene transfer agent genes in alpha-proteobacteria. Trends. Microbiol. 15: 54-62. Lang, A. S., O. Zhaxybayeva & J. T. Beatty (2012) Gene transfer agents: phage-like elements of genetic exchange. Nat Rev Microbiol 10: 472-482. Laub, M. T., S. L. Chen, L. Shapiro & H. H. McAdams (2002) Genes directly controlled by CtrA, a master regulator of the Caulobacter cell cycle. Proc Natl Acad Sci USA 99: 4632-4637. Laub, M. T. & M. Goulian (2007) Specificity in two-component signal transduction pathways. Annu Rev Genet 41: 121-145. Laub, M. T., H. H. McAdams, T. Feldblyum, C. M. Fraser & L. Shapiro (2000) Global analysis of the genetic network controlling a bacterial cell cycle. Science 290: 2144-2148. Lazdunski, A. M., I. Ventre & J. N. Sturgis (2004) Regulatory circuits and communication in Gram-negative bacteria. Nat Rev Microbiol 2: 581-592. Leiman, P. G. & M. M. Shneider (2012) Contractile tail machines of bacteriophages. Adv Exp Med Biol 726: 93-114. Leung, M. M.-L., (2010) CtrA and GtaR: two systems that regulate the Gene Transfer Agent of Rhodobacter Capsulatus. In: Microbiology and Immunology. Vancouver: University of British Columbia pp. 168. Leung, M. M., C. A. Brimacombe & J. T. Beatty (2013) Transcriptional regulation of the Rhodobacter capsulatus response regulator CtrA. Microbiology 159: 96-106. Leung, M. M., C. A. Brimacombe, G. B. Spiegelman & J. T. Beatty (2012) The GtaR protein negatively regulates transcription of the gtaRI operon and modulates gene transfer agent (RcGTA) expression in Rhodobacter capsulatus. Mol Microbiol 83: 759-774. Lintz, M. J., K. Oinuma, C. L. Wysoczynski, E. P. Greenberg & M. E. Churchill (2011) Crystal structure of QscR, a Pseudomonas aeruginosa quorum sensing signal receptor. Proc Natl Acad Sci USA 108: 15763-15768. Lisboa, J., J. Andreani, D. Sanchez, M. Boudes, B. Collinet, D. Liger, H. van Tilbeurgh, R. Guerois & S. Quevillon-Cheruel (2014) Molecular determinants of the DprA-RecA interaction for nucleation on ssDNA. Nucleic Acids Res 42: 7395-7408. Liu, D., P. T. S. Wong & B. J. Dutka (1973) Determination of carbohydrate in lake sediment by a modified phenol-sulfuric acid method. Water Research 7: 741-746. Lu, D., S. Fillet, C. Meng, Y. Alguel, P. Kloppsteck, J. Bergeron, T. Krell, M. T. Gallegos, J. Ramos & X. Zhang (2010) Crystal structure of TtgV in complex with its DNA 178  operator reveals a general model for cooperative DNA binding of tetrameric gene regulators. Genes Dev 24: 2556-2565. Marrs, B. (1974) Genetic recombination in Rhodopseudomonas capsulata. Proc Natl Acad Sci USA 71: 971-973. Marx, C. J. & M. E. Lidstrom (2001) Development of improved versatile broad-host-range vectors for use in methylotrophs and other Gram-negative bacteria. Microbiology 147: 2065-2075. Masepohl, B., T. Drepper, A. Paschen, S. Gross, A. Pawlowski, K. Raabe, K. U. Riedel & W. Klipp (2002) Regulation of nitrogen fixation in the phototrophic purple bacterium Rhodobacter capsulatus. J Mol Microbiol Biotechnol 4: 243-248. McDaniel, L. D., E. Young, J. Delaney, F. Ruhnau, K. B. Ritchie & J. H. Paul (2010) High frequency of horizontal gene transfer in the oceans. Science 330: 50. Mell, J. C., I. M. Hall & R. J. Redfield (2012) Defining the DNA uptake specificity of naturally competent Haemophilus influenzae cells. Nucleic Acids Res 40: 8536-8549. Mercer, R. G., S. J. Callister, M. S. Lipton, L. Pasa-Tolic, H. Strnad, V. Paces, J. T. Beatty & A. S. Lang (2010) Loss of the response regulator CtrA causes pleiotropic effects on gene expression but does not affect growth phase regulation in Rhodobacter capsulatus. J Bacteriol 192: 2701-2710. Mercer, R. G., M. Quinlan, A. R. Rose, S. Noll, J. T. Beatty & A. S. Lang (2012) Regulatory systems controlling motility and gene transfer agent production and release in Rhodobacter capsulatus. FEMS Microbiol Lett 331: 53-62. Midon, M., P. Schafer, A. Pingoud, M. Ghosh, A. F. Moon, M. J. Cuneo, R. E. London & G. Meiss (2011) Mutational and biochemical analysis of the DNA-entry nuclease EndA from Streptococcus pneumoniae. Nucleic Acids Res 39: 623-634. Miller, R. V. (2001) Environmental bacteriophage-host interactions: factors contribution to natural transduction. Antonie Van Leeuwenhoek 79: 141-147. Mirouze, N., M. A. Berge, A. L. Soulet, I. Mortier-Barriere, Y. Quentin, G. Fichant, C. Granadel, M. F. Noirot-Gros, P. Noirot, P. Polard, B. Martin & J. P. Claverys (2013) Direct involvement of DprA, the transformation-dedicated RecA loader, in the shut-off of pneumococcal competence. Proc Natl Acad Sci USA 110: E1035-1044. Mitrophanov, A. Y. & E. A. Groisman (2008) Signal integration in bacterial two-component regulatory systems. Genes Dev 22: 2601-2611. Moreno-Hagelsieb, G. & K. Latimer (2008) Choosing BLAST options for better detection of orthologs as reciprocal best hits. Bioinformatics 24: 319-324. Mortier-Barriere, I., M. Velten, P. Dupaigne, N. Mirouze, O. Pietrement, S. McGovern, G. Fichant, B. Martin, P. Noirot, E. Le Cam, P. Polard & J. P. Claverys (2007) A key presynaptic role in transformation for a widespread bacterial protein: DprA conveys incoming ssDNA to RecA. Cell 130: 824-836. Murray, A. W. (1971) The biological significance of purine salvage. Annu Rev Biochem 40: 811-826. Myllykallio, H., F. Drepper, P. Mathis & F. Daldal (2000) Electron-transfer supercomplexes in photosynthesis and respiration. Trends Microbiol 8: 493-494. 179  Nadell, C. D., J. B. Xavier, S. A. Levin & K. R. Foster (2008) The evolution of quorum sensing in bacterial biofilms. PLoS Biol 6: e14. Novick, R. P. & E. Geisinger (2008) Quorum sensing in staphylococci. Annu Rev Genet 42: 541-564. Omar, A. S., H. T. Flammann, J. R. Golecki & J. Weckesser (1983) Detection of capsule and slime polysaccharide layers in two strains of Rhodopseudomonas capsulata. Arch Microbiol 134: 114-117. Patankar, A. V. & J. E. Gonzalez (2009) Orphan LuxR regulators of quorum sensing. FEMS Microbiol Rev 33: 739-756. Pellock, B. J., M. Teplitski, R. P. Boinay, W. D. Bauer & G. C. Walker (2002) A LuxR homolog controls production of symbiotically active extracellular polysaccharide II by Sinorhizobium meliloti. J Bacteriol 184: 5067-5076. Pena-Castillo, L., R. G. Mercer, A. Gurinovich, S. J. Callister, A. T. Wright, A. B. Westbye, J. T. Beatty & A. S. Lang (2014) Gene co-expression network analysis in Rhodobacter capsulatus and application to comparative expression analysis of Rhodobacter sphaeroides. BMC Genomics 15: 730. Pereira, C. S., J. R. McAuley, M. E. Taga, K. B. Xavier & S. T. Miller (2008) Sinorhizobium meliloti, a bacterium lacking the autoinducer-2 (AI-2) synthase, responds to AI-2 supplied by other bacteria. Mol Microbiol 70: 1223-1235. Peterson, G. (1983) Determination of total protein. Meth. Enzymol. 91: 95-119. Pickard, D., A. L. Toribio, N. K. Petty, A. van Tonder, L. Yu, D. Goulding, B. Barrell, R. Rance, D. Harris, M. Wetter, J. Wain, J. Choudhary, N. Thomson & G. Dougan (2010) A conserved acetyl esterase domain targets diverse bacteriophages to the Vi capsular receptor of Salmonella enterica serovar Typhi. J Bacteriol 192: 5746-5754. Piper, K. R., S. Beck von Bodman & S. K. Farrand (1993) Conjugation factor of Agrobacterium tumefaciens regulates Ti plasmid transfer by autoinduction. Nature 362: 448-450. Puskas, A., E. P. Greenberg, S. Kaplan & A. L. Schaefer (1997) A quorum-sensing system in the free-living photosynthetic bacterium Rhodobacter sphaeroides. J Bacteriol 179: 7530-7537. Quevillon-Cheruel, S., N. Campo, N. Mirouze, I. Mortier-Barriere, M. A. Brooks, M. Boudes, D. Durand, A. L. Soulet, J. Lisboa, P. Noirot, B. Martin, H. van Tilbeurgh, M. F. Noirot-Gros, J. P. Claverys & P. Polard (2012) Structure-function analysis of pneumococcal DprA protein reveals that dimerization is crucial for loading RecA recombinase onto DNA during transformation. Proc Natl Acad Sci USA 109: E2466-2475. Quon, K. C., G. T. Marczynski & L. Shapiro (1996) Cell cycle control by an essential bacterial two-component signal transduction protein. Cell 84: 83-93. Quon, K. C., B. Yang, I. J. Domian, L. Shapiro & G. T. Marczynski (1998) Negative control of bacterial DNA replication by a cell cycle regulatory protein that binds at the chromosome origin. Proc Natl Acad Sci USA 95: 120-125. Raetz, C. R. & C. Whitfield (2002) Lipopolysaccharide endotoxins. Annu Rev Biochem 71: 635-700. 180  Rakhuba, D. V., E. I. Kolomiets, E. S. Dey & G. I. Novik (2010) Bacteriophage receptors, mechanisms of phage adsorption and penetration into host cell. Pol J Microbiol 59: 145-155. Rao, S. T. & M. G. Rossmann (1973) Comparison of super-secondary structures in proteins. J Mol Biol 76: 241-256. Rapp, B. J. & J. D. Wall (1987) Genetic transfer in Desulfovibrio desulfuricans. Proc Natl Acad Sci USA 84: 9128–9130. Reid, J. D., C. A. Siebert, P. A. Bullough & C. N. Hunter (2003) The ATPase activity of the ChlI subunit of magnesium chelatase and formation of a heptameric AAA+ ring. Biochemistry 42: 6912-6920. Reisenauer, A., K. Quon & L. Shapiro (1999) The CtrA response regulator mediates temporal control of gene expression during the Caulobacter cell cycle. J Bacteriol 181: 2430-2439. Roessner, C. A. & G. M. Ihler (1984) Proteinase sensitivity of bacteriophage lambda tail proteins gpJ and pH in complexes with the lambda receptor. J Bacteriol 157: 165-170. Rossmann, M. G., V. V. Mesyanzhinov, F. Arisaka & P. G. Leiman (2004) The bacteriophage T4 DNA injection machine. Curr Opin Struct Biol 14: 171-180. Roy, A. & S. Mitra (1970) Increased fragility of Escherichia coli after infection with bacteriophage M13. J Virol 6: 333-339. Sambrook, J., E. F. Fritsch & T. Maniatis, (1989) Molecular cloning : a laboratory manual New York : Cold Spring Harbor Laboratory Press, Plainview. Savka, M. A., P. T. Le & T. J. Burr (2011) LasR receptor for detection of long-chain quorum-sensing signals: identification of N-acyl-homoserine lactones encoded by the avsI locus of Agrobacterium vitis. Curr Microbiol 62: 101-110. Schaefer, A. L., E. P. Greenberg, C. M. Oliver, Y. Oda, J. J. Huang, G. Bittan-Banin, C. M. Peres, S. Schmidt, K. Juhaszova, J. R. Sufrin & C. S. Harwood (2008) A new class of homoserine lactone quorum-sensing signals. Nature 454: 595-599. Schaefer, A. L., C. R. Lappala, R. P. Morlen, D. A. Pelletier, T. Y. Lu, P. K. Lankford, C. S. Harwood & E. P. Greenberg (2013) LuxR- and luxI-type quorum-sensing circuits are prevalent in members of the Populus deltoides microbiome. Appl Environ Microbiol 79: 5745-5752. Schaefer, A. L., T. A. Taylor, J. T. Beatty & E. P. Greenberg (2002) Long-chain acyl-homoserine lactone quorum-sensing regulation of Rhodobacter capsulatus gene transfer agent production. J Bacteriol 184: 6515-6521. Schaller, G. E., S. H. Shiu & J. P. Armitage (2011) Two-component systems and their co-option for eukaryotic signal transduction. Curr Biol 21: R320-330. Schauder, S., K. Shokat, M. G. Surette & B. L. Bassler (2001) The LuxS family of bacterial autoinducers: biosynthesis of a novel quorum-sensing signal molecule. Mol Microbiol 41: 463-476. Scholl, D., S. Rogers, S. Adhya & C. R. Merril (2001) Bacteriophage K1-5 encodes two different tail fiber proteins, allowing it to infect and replicate on both K1 and K5 strains of Escherichia coli. J Virol 75: 2509-2515. 181  Schu, D. J., A. L. Carlier, K. P. Jamison, S. von Bodman & A. M. Stevens (2009) Structure/function analysis of the Pantoea stewartii quorum-sensing regulator EsaR as an activator of transcription. J Bacteriol 191: 7402-7409. Schuster, M., D. J. Sexton, S. P. Diggle & E. P. Greenberg (2013) Acyl-homoserine lactone quorum sensing: from evolution to application. Annu Rev Microbiol 67: 43-63. Schuster, M., M. L. Urbanowski & E. P. Greenberg (2004) Promoter specificity in Pseudomonas aeruginosa quorum sensing revealed by DNA binding of purified LasR. Proc Natl Acad Sci USA 101: 15833-15839. Sciochetti, S. A., T. Lane, N. Ohta & A. Newton (2002) Protein sequences and cellular factors required for polar localization of a histidine kinase in Caulobacter crescentus. J Bacteriol 184: 6037-6049. Scolnik, P. A. & B. L. Marrs (1987) Genetic research with photosynthetic bacteria. Annu Rev Microbiol 41: 703-726. Seitz, P. & M. Blokesch (2013a) Cues and regulatory pathways involved in natural competence and transformation in pathogenic and environmental Gram-negative bacteria. FEMS Microbiol Rev 37: 336-363. Seitz, P. & M. Blokesch (2013b) DNA-uptake machinery of naturally competent Vibrio cholerae. Proc Natl Acad Sci USA 110: 17987-17992. Shaner, N. C., R. E. Campbell, P. A. Steinbach, B. N. Giepmans, A. E. Palmer & R. Y. Tsien (2004) Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol 22: 1567-1572. Shelswell, K. J., T. A. Taylor & J. T. Beatty (2005) Photoresponsive flagellum-independent motility of the purple phototrophic bacterium Rhodobacter capsulatus. J Bacteriol 187: 5040-5043. Siam, R. & G. T. Marczynski (2003) Glutamate at the phosphorylation site of response regulator CtrA provides essential activities without increasing DNA binding. Nucleic Acids Res 31: 1775-1779. Simon, R., U. Priefer & A. Puhler (1983) A Broad Host Range Mobilization System for In Vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria. Nat Biotech 1: 784-791. Sinha, S., J. C. Mell & R. J. Redfield (2012) Seventeen Sxy-dependent cyclic AMP receptor protein site-regulated genes are needed for natural transformation in Haemophilus influenzae. J Bacteriol 194: 5245-5254. Smeets, L. C., S. C. Becker, G. J. Barcak, C. M. Vandenbroucke-Grauls, W. Bitter & N. Goosen (2006) Functional characterization of the competence protein DprA/Smf in Escherichia coli. FEMS Microbiol Lett 263: 223-228. Smits, W. K., C. C. Eschevins, K. A. Susanna, S. Bron, O. P. Kuipers & L. W. Hamoen (2005) Stripping Bacillus: ComK auto-stimulation is responsible for the bistable response in competence development. Mol Microbiol 56: 604-614. Solioz, M., (1975) The Gene Transfer Agent of Rhodopsuedomonas capsulata. St. Louis: Saint Louis University, pp. 112. Solioz, M., H. C. Yen & B. Marris (1975) Release and uptake of gene transfer agent by Rhodopseudomonas capsulata. J Bacteriol 123: 651-657. 182  Stirm, S. & E. Freund-Molbert (1971) Escherichia coli capsule bacteriophages. II. Morphology. J Virol 8: 330-342. Strnad, H., A. Lapidus, J. Paces, P. Ulbrich, C. Vlcek, V. Paces & R. Haselkorn (2010) Complete genome sequence of the photosynthetic purple nonsulfur bacterium Rhodobacter capsulatus SB 1003. J Bacteriol 192: 3545-3546. Sun, L., L. N. Young, X. Zhang, S. P. Boudko, A. Fokine, E. Zbornik, A. P. Roznowski, I. J. Molineux, M. G. Rossmann & B. A. Fane (2014) Icosahedral bacteriophage PhiX174 forms a tail for DNA transport during infection. Nature 505: 432-435. Surette, M. G., M. B. Miller & B. L. Bassler (1999) Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: a new family of genes responsible for autoinducer production. Proc Natl Acad Sci USA 96: 1639-1644. Swem, L. R., S. Elsen, T. H. Bird, D. L. Swem, H. G. Koch, H. Myllykallio, F. Daldal & C. E. Bauer (2001) The RegB/RegA two-component regulatory system controls synthesis of photosynthesis and respiratory electron transfer components in Rhodobacter capsulatus. J Mol Biol 309: 121-138. Tavender, T. J., N. M. Halliday, K. R. Hardie & K. Winzer (2008) LuxS-independent formation of AI-2 from ribulose-5-phosphate. BMC Microbiol 8: 98. Taylor, D. P., S. N. Cohen, W. G. Clark & B. L. Marrs (1983) Alignment of genetic and restriction maps of the photosynthesis region of the Rhodopseudomonas capsulata chromosome by a conjugation-mediated marker rescue technique. J Bacteriol 154: 580-590. Taylor, T. A., (2004) Evolution and Regulation of the Gene Transfer Agent (GTA) of Rhodobacter capsulatus. In: Microbiology and Immunology. Vancouver: University of British Columbia, pp. 66. Tsai, C. M. & C. E. Frasch (1982) A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal Biochem 119: 115-119. Tsai, C. S. & S. C. Winans (2010) LuxR-type quorum-sensing regulators that are detached from common scents. Mol Microbiol 77: 1072-1082. Tun-Garrido, C., P. Bustos, V. Gonzalez & S. Brom (2003) Conjugative transfer of p42a from Rhizobium etli CFN42, which is required for mobilization of the symbiotic plasmid, is regulated by quorum sensing. J Bacteriol 185: 1681-1692. von Bodman, S. B., D. R. Majerczak & D. L. Coplin (1998) A negative regulator mediates quorum-sensing control of exopolysaccharide production in Pantoea stewartii subsp. stewartii. Proc Natl Acad Sci USA 95: 7687-7692. Wall, J. D., P. F. Weaver & H. Gest (1975) Gene transfer agents, bacteriophages, and bacteriocins of Rhodopseudomonas capsulata. Arch Microbiol 105: 217-224. Wang, H., L. Ziesche, O. Frank, V. Michael, M. Martin, J. Petersen, S. Schulz, I. Wagner-Dobler & J. Tomasch (2014) The CtrA phosphorelay integrates differentiation and communication in the marine alphaproteobacterium Dinoroseobacter shibae. BMC Genomics 15: 130. Wang, J. C. (2002) Cellular roles of DNA topoisomerases: a molecular perspective. Nat Rev Mol Cell Biol 3: 430-440. Wang, W., J. Ding, Y. Zhang, Y. Hu & D. C. Wang (2013) Structural insights into the unique single-stranded DNA-binding mode of Helicobacter pylori DprA. Nucleic Acids Res. 183  Waters, C. M. & B. L. Bassler (2005) Quorum sensing: cell-to-cell communication in bacteria. Annu Rev Cell Dev Biol 21: 319-346. Weaver, P. F., J. D. Wall & H. Gest (1975) Characterization of Rhodopseudomonas capsulata. Arch Microbiol 105: 207-216. Weckesser, J., G. Drews & I. Fromme (1972) Chemical analysis of and degradation studies on the cell wall lipopolysaccharide of Rhodopseudomonas capsulata. J Bacteriol 109: 1106-1113. Wei, Q. & L. Z. Ma (2013) Biofilm matrix and its regulation in Pseudomonas aeruginosa. Int J Mol Sci 14: 20983-21005. Westbye, A. B., M. M. Leung, S. M. Florizone, T. A. Taylor, J. A. Johnson, P. C. Fogg & J. T. Beatty (2013) Phosphate concentration and the putative sensor kinase protein CckA modulate cell lysis and release of the Rhodobacter capsulatus gene transfer agent. J Bacteriol 195: 5025-5040. Whitfield, C. (2006) Biosynthesis and assembly of capsular polysaccharides in Escherichia coli. Annu Rev Biochem 75: 39-68. Wilkinson, B. J. & K. M. Holmes (1979) Staphylococcus aureus cell surface: capsule as a barrier to bacteriophage adsorption. Infect Immun 23: 549-552. Williams, K. P., B. W. Sobral & A. W. Dickerman (2007) A robust species tree for the alphaproteobacteria. J Bacteriol 189: 4578-4586. Williams, N., D. K. Fox, C. Shea & S. Roseman (1986) Pel, the protein that permits lambda DNA penetration of Escherichia coli, is encoded by a gene in ptsM and is required for mannose utilization by the phosphotransferase system. Proc Natl Acad Sci USA 83: 8934-8938. Wolska, K. I. (2003) Horizontal DNA transfer between bacteria in the environment. Acta Microbiol Pol 52: 233-243. Wozniak, R. A. & M. K. Waldor (2010) Integrative and conjugative elements: mosaic mobile genetic elements enabling dynamic lateral gene flow. Nat Rev Microbiol 8: 552-563. Wu, J., N. Ohta & A. Newton (1998) An essential, multicomponent signal transduction pathway required for cell cycle regulation in Caulobacter. Proc Natl Acad Sci USA 95: 1443-1448. Xavier, K. B. & B. L. Bassler (2003) LuxS quorum sensing: more than just a numbers game. Curr Opin Microbiol 6: 191-197. Xavier, K. B. & B. L. Bassler (2005) Regulation of uptake and processing of the quorum-sensing autoinducer AI-2 in Escherichia coli. J Bacteriol 187: 238-248. Xayarath, B. & J. Yother (2007) Mutations blocking side chain assembly, polymerization, or transport of a Wzy-dependent Streptococcus pneumoniae capsule are lethal in the absence of suppressor mutations and can affect polymer transfer to the cell wall. J Bacteriol 189: 3369-3381. Yadav, T., B. Carrasco, J. Hejna, Y. Suzuki, K. Takeyasu & J. C. Alonso (2013) Bacillus subtilis DprA recruits RecA onto single-stranded DNA and mediates annealing of complementary strands coated by SsbB and SsbA. J Biol Chem 288: 22437-22450. Yamada, K., T. Miyata, D. Tsuchiya, T. Oyama, Y. Fujiwara, T. Ohnishi, H. Iwasaki, H. Shinagawa, M. Ariyoshi, K. Mayanagi & K. Morikawa (2002) Crystal structure of 184  the RuvA-RuvB complex: a structural basis for the Holliday junction migrating motor machinery. Mol Cell 10: 671-681. Yen, H. C., N. T. Hu & B. L. Marrs (1979) Characterization of the gene transfer agent made by an overproducer mutant of Rhodopseudomonas capsulata. J Mol Biol 131: 157-168. Yen, H. C. & B. L. Marrs (1976) Maps of genes for carotenoid and bacteriochlorophyll biosynthesis in Rhodopseudomonas capsulata. J Bacteriol 126: 619-629. Young, C. S., R. C. Reyes & J. T. Beatty (1998) Genetic complementation and kinetic analyses of Rhodobacter capsulatus ORF1696 mutants indicate that the ORF1696 protein enhances assembly of the light-harvesting I complex. J Bacteriol 180: 1759-1765. Zhang, J., J. Kan, J. Zhang, P. Guo, X. Chen, R. Fang & Y. Jia (2012) Synergistic activation of the pathogenicity-related proline iminopeptidase gene in Xanthomonas campestris pv. campestris by HrpX and a LuxR homolog. Appl Environ Microbiol 78: 7069-7074. Zhang, R. G., T. Pappas, J. L. Brace, P. C. Miller, T. Oulmassov, J. M. Molyneaux, J. C. Anderson, J. K. Bashkin, S. C. Winans & A. Joachimiak (2002) Structure of a bacterial quorum-sensing transcription factor complexed with pheromone and DNA. Nature 417: 971-974. Zhaxybayeva, O. & W. F. Doolittle (2011) Lateral gene transfer. Curr Biol 21: R242-246. Zhu, J., Y. Chai, Z. Zhong, S. Li & S. C. Winans (2003) Agrobacterium bioassay strain for ultrasensitive detection of N-acylhomoserine lactone-type quorum-sensing molecules: detection of autoinducers in Mesorhizobium huakuii. Appl Environ Microbiol 69: 6949-6953.   185  Appendices Appendix A   One-way ANOVA results for comparison of measured values. Each assay, strains, and comparisons are indicated in each sub-appendix  A.1 One-way ANOVA results for growth-phase evaluation of RcGTA recipient capability recipient capability assays  number of XY pairs 7 Pearson r 0.9501 95% conf. interval 0.693-0.992 p-value 0.00104 correlation significant? (α=0.05) yes r squared 0.9028   adsorption assay  number of XY pairs 7 pearson r 0.9571 95% conf. interval 0.731-0.993 p-value 0.000715 correlation significant? (α=0.05) yes r squared 0.9162   186  A.2 One-way ANOVA results for mutant evaluation of RcGTA recipient capability Strain 1  Strain 2 p-value WT B10  ΔgtaI 0.0000558 WT B10 ΔgtaI + C16 0.9993916 WT B10 ΔgtaR 1 WT B10  ΔgtaRI 1 WT B10  Δ1081 0.0000936 WT B10  Δ1081[p1081] 0.0324655 WT B10  ΔgtaI/Δ1081 0.0001958 WT B10  ΔgtaI/Δ1081 + C16 0.0000894 WT B10  Δ1932 0.000061 WT B10  Δ1932[p1932] 0.4535225 WT B10  Δ1081/Δ1932 0.0000385 WT B10  37b4 0.0000333 Δ1081  Δ1081[p1081] 0.492496 WT ΔctrA 0 WT ΔctrA(pRRR) 0.0000028 WT WT(D51E) 0.84 WT WT(D51A) 0.14 WT ΔctrA(D51E) 0.002 WT ΔctrA(D51A) 0.0069 ΔctrA(D51A) ΔctrA(D51E) 0.000099 WT ΔdprA 0 WT ΔdprA(pDprA) 0.06 WT ΔdprA(pRhDprA) 0.000000024 ΔdprA(pRhDprA) ΔdprA 0 ΔdprA(pRhDprA) ΔctrA(pRhDprA) 0  A.3 One-way ANOVA results for mutant evaluation of RcGTA adsorption capability Strain 1 Strain 2  p-value No Cells WT B10 0 No Cells ΔgtaI 0.3630966 No Cells ΔgtaI + C16 0 No Cells ΔgtaR 0 187  Strain 1 Strain 2  p-value No Cells ΔgtaRI 0 No Cells Δ1081 0.0332213 No Cells Δ1081[p1081] 0 No Cells ΔgtaI/Δ1081 1.00E-07 No Cells ΔgtaI/Δ1081 + C16 0 No Cells Δ1932 0.9930653 No Cells Δ1932[p1932] 0 No Cells Δ1081/Δ1932 0.7869396 No Cells 37b4 0.9982706 Δ1081[p1081] Δ1081[p1081] 0.0000007 ΔgtaI ΔgtaI + C16 0.0000001 No cells ΔdprA 1.75E-09 No cells ΔrecA 1.92E-08 No cells ΔctrA 4.30E-09 No cells ΔcomEC 0.000000055 No cells ΔcomF 2.20E-08 No cells ΔcomM 6.30E-08  A.4 One-way ANOVA results for mutant evaluation of OM-associated carbohydrate quantification Strain 1 Strain 2 p-value WT B10 ΔgtaI 0 WT B10 ΔgtaI + C16 2.00E-07 WT B10 ΔgtaR 6.84E-05 WT B10 ΔgtaRI 0.165229 WT B10 Δ1081 0 WT B10 Δ1081[p1081] 0.005464 WT B10 ΔgtaI/Δ1081 0 WT B10 ΔgtaI/Δ1081 + C16 0 WT B10 Δ1932 0 WT B10 Δ1932[p1932] 0.00004 WT B10 Δ1081/Δ1932 0 WT B10 37b4 0 ΔgtaI ΔgtaI + C16 0 Δ1081 Δ1081[p1081] 0 Δ1932 Δ1932[p1932] 0 188   A.5 One-way ANOVA results for mutant evaluation of OM-associated polysaccharide RcGTA adsorption blocking assay Strain 1 Strain 2 p-value No Cells WT 0 WT WT extracts 1.30E-06 WT ΔgtaI extracts 0.881878 WT Δ1932 extracts 0.999761   A.6 One-way ANOVA results for RcGTA tracking assay qPCR data Strain 1 Strain 2 p-value WT ΔcomEC 0.02924 WT  ΔcomF 0.02077 ΔcomEC ΔcomF 0.656 no GTA WT 0.0019 no GTA ΔcomEC 0.02164 no GTA ΔcomF 0.01423  A.7 One-way ANOVA results for promoter::lacZ analyses Rcgta::lacZ   Strain 1 Strain2 p-value WT ΔgtaI 0.045 WT C16 0.9 WT ΔgtaR 0.754 WT ΔgtaRI 0.589 WT ΔgtaRI(R) 0.0485 ΔgtaI ΔgtaRI(R) 0.804 Rcgta::lacZ   Strain 1 Strain2 p-value WT ΔgtaI 0.0066 WT C4 0.0114 189  Strain 1 Strain2 p-value WT C6 0.027 WT C8 0.0327 WT C10 0.0448 WT C12 0.1904 WT C14 0.4315 WT C16 0.35 WT C16c 0.535 WT C18 0.2402 1081::lacZ   Strain 1 Strain2 p-value WT ΔgtaI 0.0042 WT C16 0.0662 WT ΔgtaR 0.18 WT ΔgtaRI 0.37 ΔgtaI C16 0.0026 dprA::lacZ   Strain 1 Strain2 p-value WT ΔctrA 1.27E-05 WT ΔgtaI 8.32E-05 WT ΔdprA 0.46 ΔgtaI C16 0.032  A.8 One-way ANOVA for RcGTA production experiments Strain 1 Strain2 p-value WT ΔgtaI 0.0064 WT C16 0.1674 WT ΔgtaR 0.1006 WT ΔgtaRI 0.5804 WT ΔgtaRI(R) 0.003 ΔgtaI ΔgtaRI(R) 0.1282    Strain 1 Strain2 p-value WT ΔgtaI 0.005 ΔgtaI +WT 0.0226 ΔgtaI +R.sph 0.0374 ΔgtaI +P.den 0.0326 190  Strain 1 Strain2 p-value ΔgtaI +R.pal 0.6094 ΔgtaI +E.col 0.0487 ΔgtaI +C16 0.0006 ΔgtaI +LB 0.9024    Strain 1 Strain2 p-value WT ΔgtaI 0.0064 WT C4 0.0084 WT C6 0.0082 WT C8 0.0072 WT C10 0.0124 WT C12 0.9351 WT C14 0.4526 WT C16 0.8432 WT C16c 0.8724 WT C18 0.81      191  Appendix B  Full size MUSCLE MSA of DprA amino acid sequences         192    193  194  Appendix C  Standard curves and raw data for RcGTA tracking assay qPCR assays C.1 Standard curves for Gm cassette and puhA qPCR primers   C.2 Raw data for RcGTA tracking assay qPCR analysis log10(DNA conc.) GmR cassette target Ct Calculated DNA conc. (ng) log10(DNA conc.) puhA target Ct Calculated DNA conc. (ng)   0 ng 37.02   0 ng 36.93   -1 0.1 ng 26.92  -1 0.1 ng 26.22   0 1 ng 24.97  0 1 ng 25.11   1 10 ng 21.79  1 10 ng 22.00   2 100 ng 19.46  2 100 ng 19.33           Ratio Gm/puhA (x100)  No GTA1 27.66 0.0612  No GTA1 15.81 2756.25 0.002223  WT1 20.10 55.75  WT1 14.57 9224.23 0.604468  ΔcomEC1 18.42 252.99  ΔcomEC1 15.12 5407.12 4.678850  ΔcomF1 18.07 347.78  ΔcomF1 14.34 11547.12 3.011910           GmR Ct Calculat log10(DNA puhA Ct Calculat Ratio 195  cassette target ed DNA conc. (ng) conc.) target ed DNA conc. (ng) Gm/puhA (x100)  No GTA2 29.72 0.0095  No GTA2 16.15 1997.92 0.000478  WT2 20.69 32.85  WT2 15.33 4391.08 0.74828  ΔcomEC2 16.98 925.67  ΔcomEC2 14.09 14676.18 6.30735  ΔcomF2 18.00 371.01  ΔcomF2 14.83 7138.49 5.19734           No GTA3 30.26 0.0058  No GTA3 17.13 771.90 0.000763  WT3 23.62 2.34  WT3 17.99 335.43 0.698033  ΔcomEC3 20.55 37.02  ΔcomEC3 16.60 1290.64 2.868773  ΔcomF3 21.63 14.02  ΔcomF3 17.79 408.17 3.436477                196  Appendix D  Evalulation of phage sensitivity of WT, ΔgtaI, ΔctrA, and com gene mutants D.1 Summary of sensitivity of all strains to two different phages, as measured by plaque assay. Phage 1 is an uncharacterized prophage present in the R. capsulatus strain DE442 (but probably is the same as the phage sequenced by A. Hynes and A. Lang, Rcap NL, GenBank accession # JQ066768). Phage 2 is an environmental phage isolated by students working with D. Bollivar which has been sequenced and submitted to GenBank with the accession # KR935213)   WT ΔgtaI ΔctrA ΔcomEC ΔcomF ΔcomM ΔdprA Phage 1 ++ ++ + - ++ ++ ++ Phage 2 ++ ++ + ++ ++ ++ ++ ++ indicates a WT level of sensitivity + indicates a reduced level of sensitivity -  indicates no detectable phage infection (not sensitivite)  D.2 Example of phage spot assay, using serial dilutions of Phage 1 stock on WT, and ΔctrA and ΔcomEC mutants.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0166531/manifest

Comment

Related Items