Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Structural and functional characterization of components of bacterial type III secretion systems Burkinshaw, Brianne J. 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2015_september_burkinshaw_brianne.pdf [ 19.94MB ]
Metadata
JSON: 24-1.0166442.json
JSON-LD: 24-1.0166442-ld.json
RDF/XML (Pretty): 24-1.0166442-rdf.xml
RDF/JSON: 24-1.0166442-rdf.json
Turtle: 24-1.0166442-turtle.txt
N-Triples: 24-1.0166442-rdf-ntriples.txt
Original Record: 24-1.0166442-source.json
Full Text
24-1.0166442-fulltext.txt
Citation
24-1.0166442.ris

Full Text

    STRUCTURAL AND FUNCTIONAL CHARACTERIZATION OF COMPONENTS OF BACTERIAL TYPE III SECRETION SYSTEMS   by  BRIANNE J. BURKINSHAW  B.Sc., The University of Northern British Columbia, 2008     A THESIS SUBMITTED FOR PARTIAL FULFILLMENT OF  THE REQUIREMENTS FOR THE DEGREE OF   DOCTOR OF PHILOSOPHY  in   THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES  (Biochemistry and Molecular Biology)     THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)          July 2015 © Brianne J. Burkinshaw, 2015 	   	   	   ii	  Abstract  Many Gram-negative pathogens use a type III secretion system (T3SS) to inject effector proteins into the host cytoplasm, where they manipulate host processes to the advantage of the bacterium. The T3SS is composed of a cytoplasmic export apparatus, a membrane-spanning basal body with a central channel formed by the inner rod, an extra-cellular needle filament and a translocon complex that inserts in the host membrane. In this thesis, proteins involved in T3SS assembly, as well as a T3SS effector protein were structurally and functionally characterized. The structure of EtgA, a T3SS-associated peptidoglycan (PG)-cleaving enzyme from enteropathogenic Escherichia coli (EPEC) was solved. The EtgA active site has features in common with lytic transglycosylases (LTs) and hen egg-white lysozyme (HEWL). EtgA contains an aspartate that aligns with lysozyme Asp52 (a residue critical for catalysis), a conservation not observed in LT families to which the conserved T3SS enzymes were presumed to belong.  Mutation of the EtgA catalytic glutamate conserved across LTs and HEWL, and this differentiating aspartate diminishes type III secretion in vivo, supporting its essential role in T3SS assembly. EtgA forms a complex with the T3SS inner rod component, which enhances PG-lytic activity of EtgA in vitro, providing localization and regulation of the lytic activity to prevent cell lysis. After assembly of the basal body and needle, the gatekeeper protein ensures the translocon assembles at the needle tip prior to secretion of effector proteins. The gatekeeper from EPEC (SepL) was crystallized and it was shown that it has three X-bundle domains, which likely mediate protein-protein interactions to control translocon and effector secretion.  Comparison of SepL to structurally characterized orthologs revealed several conserved residues, which may be required to regulate secretion of translocators or effectors.  Finally, SopB, a 	   	   	   iii	  Salmonella effector protein, in complex with host Cdc42, an Rho GTPase that regulates critical events in eukaryotic cytoskeleton organization and membrane trafficking was structurally characterized.  Structural and biochemical analysis of the SopB/ Cdc42 complex shows that SopB structurally and functionally mimics a host guanine nucleotide dissociation inhibitor (GDI) by contacting key residues in the regulatory switch regions of Cdc42 and slowing Cdc42 nucleotide exchange.     	   	   	   iv	  Preface   Part of Chapter 1 of this thesis was published as a review article  (Burkinshaw BJ, Strynadka NCJ. 2014.  Assembly and Structure of the T3SS, Biochimica et Biophysica Acta. 1843(8): 1649-63).  Chapter 1 was written by me and revised by my supervisor, Dr. Natalie Strynadka.  Chapter 2 was published as a research article (Burkinshaw BJ, Deng W, Lameignere E, Wasney GA, Zhu H, Worrall LJ, Finlay BB, Strynadka NC. 2015. Structural analysis of a specialized type III secretion system peptidoglycan-cleaving enzyme. J Biol Chem 16: 10406-17).  Cloning, protein expression and purification was done by me.  Structural characterization of EtgA was done by me, with assistance of Dr. Liam Worrall in data processing.  Analysis of EtgA/EscI complex by light scattering was done by Dr. Emilie Lameignere.  Scanning electron microscopy of Escherichia coli expressing EtgA was done by Dr. Haizhong Zhu.  EtgA activity assays were done by me, with the assistance of Greg Wasney.  Sequence alignments were done by me.  Type III secretion assays were done by Dr. Wanyin Deng.  Negative stain electron microscopy of purified inner rod protein was done by me.  Protein stability assays were done by Greg Wasney.  The figures were generated and the manuscript written by me, with revisions by Dr. Natalie Strynadka, Dr. Brett Finlay and Dr. Wanyin Deng.    Chapter 3 was written by me, and revised by Dr. Natalie Strynadka.  SepL was purified and structurally characterized by me.  Chapter 4 was published as a research article (Burkinshaw BJ, Prehna G, Worall LJ, and Strynadka NC. 2012.  Structure of Salmonella effector protein SopB N-terminal domain in complex with host RhoGTPase Cdc42.  J Biol Chem 16: 13348-13355). In this work, I 	   	   	   v	  purified and crystallized the SopB/Cdc42 complex and collected data.  Dr. Liam Worrall assisted in structure determination and model building of the complex.  Dr. Gerd Prehna provided insight on RhoGDI mimicry and helped to design the nucleotide exchange assays.  I performed the nucleotide exchange assays and isothermal titration calorimetry.  The manuscript was written by me, and revised by Dr. Natalie Strynadka.   Chapter 5 was written by me and revised by Dr. Natalie Strynadka. 	     	   	   	   vi	  Table of Contents  Abstract………......................................................................................................................................................ii Preface………........................................................................................................................................................iv Table of Contents………..................................................................................................................................vi List of Tables……….........................................................................................................................................viii List of Figures....................................................................................................................................................ix List of Abbreviations……….............................................................................................................................x Acknowledgments………..................................................................................................................................xi Dedication………................................................................................................................................................xii  1	   Introduction	  ................................................................................................................................	  1	  1.1	   Protein transport across Gram-negative bacterial cell walls	  .................................................	  1	  1.2	   The Type III Secretion System	  ......................................................................................................	  3	  1.3	   Assembly of the T3SS	  ......................................................................................................................	  4	  1.4	   Chaperones	  ......................................................................................................................................	  10	  1.4.1	   Class IA and IB chaperones	  ................................................................................................................	  11	  1.4.2	   Class II chaperones	  .................................................................................................................................	  13	  1.4.3	   Class III chaperones	  ...............................................................................................................................	  13	  1.5	   Architecture of the T3S apparatus	  .............................................................................................	  14	  1.5.1	   The export apparatus and ATPase	  .....................................................................................................	  14	  1.5.2	   The autoprotease	  .....................................................................................................................................	  15	  1.5.3	   The export gate	  ........................................................................................................................................	  16	  1.5.4	   The ATPase	  ...............................................................................................................................................	  17	  1.5.5	   The basal body	  .........................................................................................................................................	  17	  1.5.6	   The inner membrane rings	  ...................................................................................................................	  18	  1.5.7	   The outer membrane ring	  .....................................................................................................................	  19	  1.5.8	   The inner rod	  ............................................................................................................................................	  21	  1.5.9	   The needle	  .................................................................................................................................................	  22	  1.5.10	   The tip complex	  ....................................................................................................................................	  25	  1.5.11	   The translocon	  .......................................................................................................................................	  27	  1.6	   Transport of effectors through the T3SS	  ..................................................................................	  29	  1.7	   Structural overview of Salmonella effectors	  ............................................................................	  30	  1.7.1	   Modulation of RhoGTPases	  ................................................................................................................	  33	  1.7.2	   Targeting the host ubiquitin pathway	  ...............................................................................................	  34	  1.7.3	   Covalent modification of host targets	  ..............................................................................................	  35	  1.7.4	   Interaction with the host cytoskeleton	  .............................................................................................	  36	  1.8	   T3SS summary and perspectives	  ................................................................................................	  38	  1.9	   Overview of thesis objectives	  .......................................................................................................	  39	  2	   Structural analysis of a specialized type III secretion system peptidoglycan-cleaving enzyme	  .............................................................................................................................................	  40	  2.1	   Introduction	  ....................................................................................................................................	  40	  2.2	   Methods	  ............................................................................................................................................	  45	  2.2.1	   Cloning of genes into expression vectors for crystallography, protein expression and  purification	  ................................................................................................................................................	  45	  2.2.2	   Crystallization of EtgA	  .........................................................................................................................	  47	  2.2.3	   Data collection, structure determination and refinement	  ...........................................................	  47	  2.2.4	   Scanning Electron Microscopy of BL21 Escherichia coli expressing EtgA	  ......................	  48	  2.2.5	   Size Exclusion Chromatography-Multiangle Light Scattering (SEC-MALS)	  ...................	  48	  	   	   	   vii	  2.2.6	   Cloning, expression, purification and imaging of EHEC inner rod protein EprJ	  ..............	  49	  2.2.7	   Generation of Citrobacter rodentium and EPEC etgA deletion mutants for T3SS  secretion assay	  ..........................................................................................................................................	  49	  2.2.8	   Complementation constructs for EPEC and Citrobacter rodentium etgA deletion  mutants..	  .....................................................................................................................................................	  50	  2.2.9	   Type III secretion assay for EPEC and Citrobacter rodentium	  ...............................................	  51	  2.2.10	   Thermal stability assay	  .......................................................................................................................	  52	  2.2.11	   EtgA activity assay	  ...............................................................................................................................	  53	  2.3	   Results	  ..............................................................................................................................................	  53	  2.3.1	   Structural characterization of the catalytic core of EtgA	  ...........................................................	  53	  2.3.2	   EtgA requires a catalytic glutamate and aspartate for activity in vivo	  ..................................	  59	  2.3.3	   EtgA associates with the T3SS through interaction with the inner rod, EscI	  .....................	  61	  2.3.4	   Interaction with the inner rod EscI enhances the activity of EtgA in vitro	  ..........................	  64	  2.4	   Discussion	  ........................................................................................................................................	  65	  3	   Structural analysis of a T3SS gatekeeper protein from EPEC	  .....................................	  69	  3.1	   Introduction	  ....................................................................................................................................	  69	  3.2	   Methods	  ............................................................................................................................................	  73	  3.2.1	   Cloning, protein expression and purification	  .................................................................................	  73	  3.2.2	   Crystallization and data collection	  ....................................................................................................	  74	  3.3	   Results	  ..............................................................................................................................................	  75	  3.3.1	   Structural overview of SepL	  ................................................................................................................	  75	  3.3.2	   Comparison of SepL to gatekeeper orthologs	  ...............................................................................	  76	  3.4	   Discussion	  ........................................................................................................................................	  84	  4	   Structure of Salmonella effector protein SopB in complex with host Cdc42	  .............	  88	  4.1	   Introduction	  ....................................................................................................................................	  88	  4.2	   Methods	  ............................................................................................................................................	  90	  4.2.1	   Isothermal titration calorimetry	  ..........................................................................................................	  90	  4.2.2	   Static light scattering	  .............................................................................................................................	  91	  4.2.3	   Analysis of SopB and Cdc42 interaction by gel filtration	  .........................................................	  91	  4.2.4	   Cloning of genes into expression constructs, purification and crystallization	  ...................	  91	  4.2.5	   Data collection, structure determination and refinement	  ...........................................................	  92	  4.2.6	   Cdc42 nucleotide exchange assay	  .....................................................................................................	  93	  4.3	   Results	  ..............................................................................................................................................	  94	  4.3.1	   Biochemical analysis and crystallization of bacterial SopB and host Cdc42 complex	  ...	  94	  4.3.2	   SopB contacts host Cdc42 by mimicking a eukaryotic CRIB-like intermolecular β- sheet…	  ........................................................................................................................................................	  95	  4.3.3	   SopB contacts key Cdc42 regulatory switch residues to mimic a Rho GDI	  .......................	  99	  4.3.4	   SopB prevents Cdc42 nucleotide exchange in vitro	  ..................................................................	  102	  4.4	   Discussion	  .....................................................................................................................................	  103	  5	   Summary and future directions	  .........................................................................................	  107	  5.1	   EtgA	  ...............................................................................................................................................	  107	  5.2	   SepL	  ...............................................................................................................................................	  111	  5.3	   SopB	  ...............................................................................................................................................	  114	  5.4	   Closing summary	  ........................................................................................................................	  116	  References………………………………………………………………………………………………………..119	    	   	   	  viii	   List of Tables  Table 1.1 Nomenclature of T3SS components from selected animal-pathogenic bacteria	  ........	  6	  Table 1.2 Structures of T3SS components	  ..................................................................................................	  6	  Table 1.3 Structure of Salmonella effector proteins	  .............................................................................	  32	  Table 2.1 EtgA data collection and refinement statistics	  ....................................................................	  55	  Table 3.1 Nomenclature of the gatekeeper protein.	  ..............................................................................	  73	  Table 3.2 SepL Data collection and refinement statistics.	  ..................................................................	  77	  Table 3.3 Summary of DALI search results for SepL.	  .........................................................................	  79	  Table 4.1 SopB/Cdc42 data collection and refinement statistics.	  ....................................................	  96	     	   	   	   ix	   List of Figures  Figure 1.1 Overview of Gram-negative bacterial secretion systems.	  .................................................	  2	  Figure 1.2 Structural overview of the T3SS injectisome.	  ......................................................................	  5	  Figure 1.3 Overview of structurally characterized Salmonella effectors and their role in host cell pathways.	  ...........................................................................................................................................	  31	  Figure 2.1 Schematic overview of T3SS apparatus components and the role of EtgA during assembly.	  ...................................................................................................................................................	  42	  Figure 2.2 Structure of the catalytic core of EtgA.	  ................................................................................	  56	  Figure 2.3 Multiple sequence alignment of T3SS specialized PG-lytic enzyme EtgA with other macromolecular machine-associated PG-lytic enzymes, lytic transglycosylase Slt70 and C-lysozyme.	  ..........................................................................................................................	  58	  Figure 2.4 Comparison of EtgA active site with Slt70 and lysozyme active site bound to peptidoglycan-like fragments and flagellar PG-lytic enzyme FlgJ.	  .......................................	  60	  Figure 2.5 Analysis of EtgA activity in vivo and interaction with the inner rod.	  ........................	  63	  Figure 2.6 The inner rod enhances EtgA peptidoglycan cleaving activity.	  ..................................	  65	  Figure 3.1 Structural overview of SepL.	  ...................................................................................................	  77	  Figure 3.2 Comparison of SepL overall structure to orthologs.	  ........................................................	  80	  Figure 3.3 Surface charge of gatekeeper orthologs.	  ..............................................................................	  81	  Figure 3.4 Structural alignment of SepL domains 2 and 3 with gatekeeper orthologs.	  ............	  83	  Figure 4.1 Analysis of SopB (29-181) binding to Cdc42 by isothermal titration calorimetry and light scattering.	  ................................................................................................................................	  95	  Figure 4.2 Overview of Cdc42 (blue) structure and interaction with GTPase binding domain of SopB (orange).	  ....................................................................................................................................	  98	  Figure 4.3 SopB contacts Cdc42 through a CRIB-like motif that contains an Ile residue conserved with eukaryotic Cdc42 effector proteins.	  ...................................................................	  99	  Figure 4.4 When Cdc42 is bound to SopB the conformation of Cdc42 switch I residues aligns with the conformation of Cdc42 switch I residues when bound to human RhoGDI, and the GTP activity of Cdc42 is down-regulated.	  ...........................................................................	  101	  Figure 4.5 SopB leucine residues form van der Waals contacts with Cdc42 switch II residues Leu67 and Leu70.	  ................................................................................................................................	  102	      	   	   	   x	  List of Abbreviations  BME β-mercaptoethanol CRIB Cdc42 and Rac-interactive binding DTT dithiothreitol EDTA edetic acid EHEC enterohemorrhagic Escherichia coli EM electron microscopy EMBD electron microscopy data bank EPEC enteropathogenic Escherichia coli GAP GTP activating protein GDI guanine nucleotide dissociation inhibitor GEF guanine nucleotide exchange factor GlcNAc N-acteylglucosamine grlA global regulator of LEE activator grlR global regulator of LEE repressor HEWL IM hen egg-white lysozyme inner membrane IPTG isopropyl-β-D-thiogalactopyranoside ITC isothermal titration calorimetry LB Luria Bertoni media LEE locus of enterocyte effacement  MAD multi-wavelength anomalous dispersion Mant-GDP N-methanylanthraniloyl guanosine diphosphate MBP maltose binding protein MurNAc N-acetyl muramic acid OM outer membrane PDB protein data bank PG peptidoglycan SCV Salmonella containing vacuole SILAC stable isotope labelling of amino acids in cell culture SPI-1 Salmonella pathogenicity island 1 SPI-2 Salmonella pathogenicity island 2 ssNMR solid state nuclear magnetic resonance T3SS type III secretion system TCEP tris(2-carboxyethyl)phosphine TM target cell membrane    	   	   	   xi	  Acknowledgments  I would like to thank my parents for teaching me to value of education and encouraging me to follow my interests, as well as my brothers and extended family for their support.    I am grateful to my supervisor, Dr. Natalie Strynadka, for giving me the opportunity to pursue graduate studies on the bacterial type III secretion system in her laboratory. Under her guidance, I have learned how to design experiments, write manuscripts and present my data to colleagues.  Because of her support, I have been able to attend numerous workshops and conferences, and have had access to cutting-edge technology and a wonderful group of colleagues.     I would also like to thank my committee members, Dr. Lawrence McIntosh and Dr. Brett Finlay, for their critical feedback on my work and offering their expertise on NMR, protein structure and function, and bacterial pathogenesis.  I am fortunate to have collaborated with both of their laboratories.  I am thankful to Wanyin Deng for experimental collaboration and insightful discussions on type III secretion, as well as providing feedback on manuscripts.  Mark Okon taught me a great deal about how to use NMR to study protein samples and how to interpret my spectra.  Each morning during my studies, I was happy to arrive at the laboratory and begin experiments, largely due to my colleagues for their part in creating such a pleasant and stimulating environment to work in.  Our lab manager, Liza deCastro, maintained an efficient and organized work environment, and was always willing to provide technical advice for purification of troublesome proteins.  Marija Vuckovic taught me everything about cloning and provided insight on type III secretion projects.  Dr. Liam Worrall taught me about protein structure determination and refinement and patiently helped me to troubleshoot any problems I encountered as I was learning.  Dr. Julien Bergeron set aside a significant amount of time to teach me about NMR and electron microscopy.  I thank all the rest of the laboratory members for sharing their expertise and advice over the years.  I am fortunate to have received funding from NSERC, as well as the Centre for Blood Research, during the course of my studies.  I thank Dr. Alejandro Colman-Lerner, for giving me the opportunity to expand my horizons and work in his laboratory following my undergraduate degree. Finally, I would like to thank Dr. Stephen Rader, as his infectious enthusiasm for science motivated me to pursue a career in research.    	   	   	   xii	  Dedication  To Martin Matěj, for your support and encouragement.                           	   	   	   1	  1 Introduction 1.1 Protein transport across Gram-negative bacterial cell walls   Gram-negative bacteria are protected from their environment by a cell wall, which is composed of an outer membrane, peptidoglycan layer and inner membrane.  The cell wall helps maintain shape, pH and osmolarity and prevent undesirable diffusion of foreign molecules into the cell.  However, to interact with the surrounding environment, Gram-negative bacteria must transport protein and DNA across the cell wall.  To facilitate transport of proteins across the cell wall, Gram-negative bacteria encode at least six specialized secretion systems (Type I to VI; Figure 1.1), and perhaps more that are yet to be discovered.  There is an interesting evolutionary relationship among these Gram-negative secretion systems and with other membrane-spanning organelles.  Briefly, as an example, the Type III Secretion system is thought to have evolved through exaption from the flagella, accompanied by loss of flagella genes (although the protein secreting function remained) and recruitment of an outer membrane embedded secretin(1).  Recruitment of the secretin is thought to have occurred more than once, with some secretins sharing homology to secretins found in Type II secretion systems, while others have a secretin of a distinctly different origin(1).   Furthermore, the most recently discovered secretion system, the Type VI secretion system, shares a common evolutionary origin with the contractile tail of bacterial phages(2).  The ability to secrete protein or DNA into the extracellular milieu or neighbouring eukaryotic or bacterial cells no doubt provides a strong selective advantage, and has been co-opted for numerous processes including acquirement of nutrients, manipulation of host cells, symbiosis, and communication with or attack on neighbouring bacteria.  Current investigation of bacterial secretion systems aims to address a common set of questions: How 	   	   	   2	  is secretion regulated and energized?  How are proteins recognized and transported by the secretion system?  How is assembly of such a large multi-protein system regulated?  A detailed knowledge of how Gram-negative bacteria transport proteins across their cell wall is critical for understanding how they communicate and interact with other bacterial species, as well host cells during pathogenesis, information that will be pertinent for development of drugs and vaccines that target the T3SS and key virulence factors.  	  Figure 1.1 Overview of Gram-negative bacterial secretion systems.  Gram-negative bacteria assemble six known secretion systems (Type I-VI) for transport of protein and/or DNA across the bacterial membranes and into the extracellular milieu or target bacterial or eukaryotic cells.  Protein Data Bank (PDB) or electron microscopy databank (EMDB) codes are shown in parentheses.  	    	   	   	   3	  1.2 The Type III Secretion System   More than two decades ago, the observation that Yersinia “Yop” virulence, or effector proteins were translocated into host cells in a Sec-independent manner without cleavage of an N-terminal sequence(3) led to the proposed existence of an alternative secretion system, named the Type III Secretion System (T3SS)(3,4).  The presence of a specialized secretion system unique to only pathogenic strains of bacteria was also supported by the identification of the inv genetic locus contained within the Salmonella Pathogenicity Island I (SPI-1), a gene cluster in Salmonella required for invasion(5,6) and the observation of homology between InvG, a protein encoded in the inv operon, and the outer membrane secretin of the type II secretion system (T2SS) PulD (as well as additional inv proteins and flagella proteins) (7,8).  Additionally, a second gene cluster encoding a distinct T3SS was identified in Salmonella(9) (named SPI-2, for Salmonella Pathogenicity Island 2).  Clusters of genes that encode a T3SS have since been discovered in a number of animal and plant bacterial pathogens, as well as symbiotic bacteria, and have been classified into families based on sequence conservation.  The best-characterized mammalian pathogens can be classified into three families: Inv-Mxi-Spa family contains Salmonella spp. SPI-1, and Shigella flexneri; the Ysc family contains Yersinia spp. and Pseudomonas aeruginosa; and the Ssa-Esc family contains enteropathogenic Escherichia coli (EPEC), and Salmonella spp. SPI-2.   The first electron microscopy (EM) images of the Salmonella(10) and Shigella (11,12) T3SS revealed a remarkable syringe-like appearance: a wide base embedded in the membrane of the bacteria and a thin extracellular needle that protruded to the extracellular space.  Since these first images, the field has made appreciable progress in the structural and mechanistic characterization of the >20 components which comprise the conserved T3SS 	   	   	   4	  apparatus in a variety of bacterial pathogens, as well as that of the more diverse sets of species-specific virulence effector proteins that are delivered by the T3SS with aid of cognate bacterial chaperones.  T3SS assembly and structure, as well as a general overview of effector proteins will be discussed in detail in Sections 1.3-1.7.    1.3 Assembly of the T3SS   The T3SS is composed of more than 20 proteins (Figure 1.2A), many of which form oligomers and are membrane embedded. Unfortunately, nomenclature is not consistent between species (Table 1.1); the emphasis here will be to use the Salmonella SPI-1 naming. Structurally characterized components of the T3SS are listed in Table 1.2.  During infection, the bacteria receive an external cue from the host environment and begin to assemble the constituents of the secretion system, a process that must be coordinated in space and time.  Assembly can be categorized into discrete stages: 1) Assembly of the basal body rings and export apparatus, 2) Assembly of the inner rod and needle, 3) Assembly of the tip and translocon, and 4) Secretion of effectors.  The precise mechanism of T3SS assembly is still under investigation; however, several models have been proposed, and studies indicate that some facets of assembly may vary between species.    Assembly of the basal body and export apparatus has been described by an “inside-out” process in Salmonella(13) and an “outside-in” process in Yersinia(14,15).  In the Salmonella inside-out model, the export apparatus components SpaP and SpaR initiate assembly at the inner membrane and recruit the remaining export apparatus components SpaQ and SpaS.  The inner membrane ring components of the basal body, PrgH and PrgK, then assemble at the site of the export apparatus.    	   	   	   5	   Figure 1.2 Structural overview of the T3SS injectisome.  A) PDB or EMBD accession codes of solved structural components are shown, (adapted from (16)).  B) ssNMR analysis of the Salmonella needle filament.  Left- view through the needle channel looking from the top down.  Each PrgI subunit has a unique colour and the N-terminal domain (demarcated N) faces the extracellular space.  Right- lateral interface between needle subunit i (olive) and i+5 (purple), and  i+6 (orange) and axial interface between i and i+11 demonstrate intersubunit interactions that occur during formation of the needle filament.  C) Left- InvG (blue), PrgH (orange) and PrgK (purple) ring models.  Center- cut away of Salmonella needle complex EM structure with one subunit each of InvG, PrgK and PrgH to show relative localization of subunits within the basal body.  Right- subunit-subunit interactions occur via “ring-building” motifs.  The inset shows interactions between two PrgH periplasmic domains. D) Left-Top view of the nonameric MxiA export gate with each subunit coloured uniquely.  The pore diameter is ~50 Å.  Right- Side view of MxiA nonameric ring.  The ring has a depth of ~55 Å and a funnel-like shape with an external diameter of 110Å at the cytoplasmic facing end and an external diameter of 170 Å at the membrane facing end.     	   	   	   6	  Table 1.1 Nomenclature of T3SS components from selected animal-pathogenic bacteria Structure Component Species Salmonella typhimuruium (SPI-1) Shigella flexneri EPEC Yersinia spp. Pseudomonas aeruginosa Export Apparatus ATPase InvC Spa47 EscN YscN PscN Central Stalk InvI Spa13 Orf15 YscO PscO Peripheral Stalk OrgB MxiL EscL YscL PscL C-ring SpaO Spa33 SepQ YscQ PscQ (HcrQ) Gate InvA MxiA EscV YscV (LcrD) PcrD Gate-keeper InvE MxiC SepL/ SepD YopN/ TyeA PopN Autoprotease SpaS Spa40 EscU YscU PscU IM component SpaP Spa24 EscR YscR PscR IM component SpaR Spa29 EscT YscT PscT IM component SpaQ Spa9 EscS YscS PscS Basal Body IM Ring PrgH MxiG EscD YscD PscD IM Ring PrgK YscJ EscJ YscJ PscJ OM Ring InvG MxiD EscC YscC PscC Pilotin InvH MxiM N/A YscW ExsB Inner Rod PrgJ MxiI EscI YscI PscI Needle Filament PrgI MxiH EscF YscF PscF Tip Tip SipD IpaD EspA LcrV PcrV Translocon Minor subunit SipB IpaB EspD YopB PopB Major subunit SipC IpaC EspB YopD PopD Accessory Proteins Lytic transglycosylase IagB IpgF EtgA YsaH - Needle length regulator  InvJ Spa32 EscP YscP PscP  Table 1.2 Structures of T3SS components Component Protein Name Species Method (reference) PDB/EMDB Codes ATPase EscN EPEC x-ray(17)  2OBM C-Ring HcrQ Pseudomonas syringae x-ray(18)   1OY9  Gate InvA Salmonella x-ray(19,20)  2X49, 3LW9 MxiA Shigella x-ray(21)  4A5P Gate-keeper MxiC Shigella x-ray(22)  2VJ4 YopN/TyeA Yersinia x-ray(23)  1XL3 Autoprotease SpaS Salmonella x-ray(24) 3C01 Spa40 Shigella x-ray(25)  2VT1 EscU EPEC x-ray(24)  3BZL YscU Yersinia x-ray(26,27)  2JL1 Needle Complex PrgH, PrgK, InvG Salmonella EM(28)  1875 	   	   	   7	  Component Protein Name Species Method (reference) PDB/EMDB Codes MxiG, MxiJ, MxiD Shigella EM(29)  1617 Injectisome with trapped substrate Salmonella EM(30)  2481, 2482 In situ injectisome Shigella Cryo-ET(31)  - In situ injectisome Yersinia Cryo-ET(31)  - In situ injectisome Salmonella Cryo-ET(32)  - Basal Body IM Ring EscJ EPEC x-ray(33)  1YJ7 PrgH/PrgK Salmonella EM(28)  1874 PrgH (cytoplasmic) Salmonella x-ray(34)  4G2S PrgH (periplasmic) Salmonella x-ray(34,35)  3GR0, 4G1I MxiG Shigella NMR, x-ray(36,37)  2XXS, 4A4Y Pilotin MxiM Shigella x-ray(38)  1Y9L Pilotin-Secretin MxiM-MxiD Shigella NMR(39)  2JW1 Secretin InvG Salmonella EM(28)  1871 YscC Yersinia EM(40)  5720-5722 InvG (periplasmic) Salmonella x-ray(34)  4G08 Needle PrgI Salmonella x-ray(41)   2X9C NMR(41,42)  2KV7, 2JOW PrgI Salmonella ssNMR(43)  2LPZ MxiH  Shigella  x-ray(44)  2CA5 Negative stain EM(44)  1416 Cryo-EM(45) 5352 ssNMR, PrgI homology model(46)  - YscF/YscG/YscE Yersinia x-ray(47)  2P58 PscF/PscG/PscE Pseudomonas x-ray(48)  2UWJ BsaL Burkholderia NMR(49)  3G0U Tip  SipD Salmonella x-ray(50)  3NZZ SipD/PrgI Salmonella x-ray(51)  3ZQB IpaD Shigella x-ray(52) 3R9V LcrV Yersinia x-ray(53)  1R6F EspA/CesA EPEC x-ray(54)  1XOU BipD Burkholderia x-ray(55)  21XR Translocon PopB/PcrH Pseudomonas x-ray(56)  2XCB IpaB/IpgC Shigella x-ray(57)  3ZG1 	   	   	   8	  Component Protein Name Species Method (reference) PDB/EMDB Codes YopD/SycD Yersinia x-ray(58)  4AM9 IpaB Shigella x-ray(59)  3U0C SipB Salmonella x-ray (59) 3TUL   The secretin outer membrane protein InvG is transported via the Sec pathway and, with the aid of a lipidated chaperone known as a T3SS pilotin(60-62), forms an oligomer in the outer membrane.  This model is supported by the observations that the export apparatus can assemble in the absence of the needle complex(13), that the inner membrane ring can assemble in the absence of InvG(63) and that InvG ortholog in EPEC, EscC, requires the inner membrane ring for correct localization(64).  It has been shown that the basal body can assemble in the absence of the export apparatus; however, this structure lacks the inner socket and cup substructures and is a dead end for assembly(13).  In the Yersinia outside-in model, the secretin inserts first into the outer membrane, and then the inner membrane ring component YscD (PrgH ortholog) and the export apparatus assemble in parallel.  Assembly is completed by recruitment of the second inner membrane ring protein, YscJ (PrgK) and the cytoplasmic ATPase and C-ring.  The two models may reflect divergent assembly pathways between species.  The next stage of assembly, formation of the inner rod (the presumed inner channel of the basal body) and the contiguous hollowed needle that protrudes from the extracellular face of the basal body, requires ATPase activity(65), indicating that it proceeds after assembly of the functional basal body and export apparatus.  Needle length is constant within species, and is likely optimized for contact with the host cell(66); therefore, regulation of needle length is an important aspect of T3SS assembly.  Needle length regulation has been proposed to be controlled by Type 3 substrate specificity switch proteins, which may function as a 	   	   	   9	  “molecular ruler”(67), or conversely, needle length may be regulated by the inner rod(68).  These switch proteins share little sequence identity, but have a structurally conserved C-terminal domain(69).  In Yersinia and EPEC, the switch proteins YscP and EscP interact with the T3SS autoprotease proteins YscU and EscU, respectively, in the bacterial cytosol(70,71), and may play a role in regulating the substrate switching event associated with auto-cleavage of the autoprotease (see below), although the mechanistic details are not well understood.  The molecular ruler model was proposed from the observation that deletions in YscP resulted in shorter needles, whereas insertions resulted in longer needles (67).  In this model, the C-terminal globular domain of YscP is thought to be associated with the base of the T3SS, and the N-terminal region extends through the inner channel of the nascent needle until it is stretched to its limit; this in turn induces a conformational change at the base of the T3SS, terminating secretion of the needle.  Interestingly, expression in Yersinia of two constructs of YscP, one longer relative to the other, resulted in a population with two distinct needle lengths rather than an intermediate needle length, suggesting that only one molecule of YscP is required per secretion apparatus(72).  Additionally, the helical content of YscP may play a role in needle length regulation, as disruption of N-terminal helices by designed mutations also altered needle length(73).  YscP also regulates secretion of the inner rod, as the inner rod is hyper secreted in the absence of YscP, which in turn affects the length of the needle(74).  An alternative mechanism involving the inner rod-mediated control of needle length was proposed after the observation that deletion of the Salmonella switch protein InvJ resulted in needle complexes without inner rod but long labile needles(68).  The needle and the inner rod are exported, and after completion of the inner rod, a proposed conformational change occurs at the base of the secretion system, triggering a substrate-switching event.  In the absence of 	   	   	   10	  the rod, which requires InvJ for proper assembly, the needle is continuously exported, resulting in longer needles.    Secretion of effector proteins is controlled by an additional protein, InvE (Salmonella), YopN/TyeA (Yersinia), MxiC (Shigella) and SepD/SepL (EPEC), which is localized to the bacterial membrane(75) likely via interaction with components of the T3SS(76,77).  Structures of YopN/TyeA (as well as YopN with its chaperones SycN/YscB)(23) and MxiC(22) have been solved, revealing three conserved 4-helix X-bundle fold domains (described as four helices packed in a coil-coiled arrangement)  with the third domain of MxiC orthologous to TyeA(78).  This group of proteins has been proposed to act as a “gate-keeper” based on the observation that deletion of the protein results in decreased or abolished secretion of translocon proteins, and in some instances increased secretion of effectors(75,76,79-82).  MxiC, InvE and YopN/TyeA were all shown to interact with the inner rod, although the precise purpose of this interaction has yet to be discerned(77).   1.4 Chaperones   Within the bacterial cytoplasm, specialized chaperones bind T3SS substrates and deliver them to the ATPase anchored at the cytoplasmic face of the T3SS assembly. All evidence indicates these chaperones are released back to the cytoplasm with only the cognate effector substrate shuttled into the export apparatus(83) for secretion.   T3SS chaperones have been shown to prevent premature degradation and oligomerization of substrates, as well as undesirable interactions with bacterial proteins and the bacterial membrane(84), and may also help establish a secretion hierarchy of substrates(85).  Chaperones can be divided into several classes: class IA (or uni-effector) chaperones specifically bind one effector, class IB 	   	   	   11	  (or multicargo) chaperones associate with multiple effectors, class II chaperones bind translocon proteins, and class III chaperones associate with needle subunits.  A number of chaperones have been structurally characterized, both as homo- or heterodimers, as well as in complex with their cognate substrate(23,48,54,57,58,86-101).  Although there is diversity amongst the various species, chaperones are typically small, acidic proteins, and may function as homodimers or heterodimers. 1.4.1 Class IA and IB chaperones   Class IA and IB chaperones typically bind the N-terminal region of effectors, a region referred to as the chaperone binding domain, covering the first 50-100 amino acids of the effector.  Generally, the N-terminal region of the effectors adopts a non-globular conformation and wraps around the surface of the chaperone.  An intriguing similarity observed between co-crystal structures of both class IA and IB effector/chaperone pairs SptP/SicP(86), YopE/SycE(102), YopN/SycN-YscB(23), YscM2/SycH(89), SipA/InvB(88) and YopH/SycH(90) is the presence of a so-called “β-motif” within the chaperone binding domain of the effector, which forms an intermolecular β-sheet interaction with the chaperone, thus behaving as a conserved targeting motif(88).  While the N-terminal region of effectors interacts with the chaperone in a non-globular conformation, some effectors retain catalytic activity of their C-terminal domain when in complex with the chaperone, indicating that the C-terminal domain retains a globular fold (87).  The process of effector translocation through the needle has been described as “threading the needle”(103), implying that the N-terminal domain of the effector, maintained in an unfolded conformation by interaction with the chaperone, is first fed through the T3SS needle, and the subsequent unfolding of the globular 	   	   	   12	  C-terminal domain, concomitant with the ATP hydrolysis and consequent release of the chaperone, allows for passage of the effector in a partially unfolded state. Class IA chaperones bind a specific effector usually encoded in a gene adjacent to the chaperone gene, and translation of the chaperone has been shown to be coupled to expression of the effector(104).  Structurally characterized examples of class IA chaperones in Salmonella include SigE(87), which binds effector SopB, as well as SicP(86), which binds effector SptP.  Both SigE and SicP have a mixed α/β-fold and function as homodimers.  The N-terminal chaperone binding domain of SptP interacts with the SicP dimer in an extended conformation through hydrophobic patches on each chaperone monomer surface(86), an interaction that exemplifies complex formation between effectors and Class I chaperones.    Class IB chaperones are often encoded near genes for structural components of the T3SS and interact with multiple substrates(85).   Structures from various species indicate that, like their class IA counterparts, IB chaperones contact their effectors in an extended non-globular fashion via dispersed clusters of largely nonpolar interactions (for example, as seen in Yersinia YopE/SycE(102), and YscM2/SycH(89)). The Salmonella Class IB chaperone InvB is encoded between the genes encoding the T3SS export apparatus component InvA and the ATPase InvC within the invABC locus and binds effectors SipA(105), SopE/E2(106,107), and SopA(108).  A feature unique to the latter two of these effectors (as well as their orthologs which interact with the Shigella chaperone Spa15 (31% sequence identity to InvB) is the presence of a conserved sequence (LMIF)xxx(IV)5xx(IV)8x(N)10 which resides within the above mentioned β-motif(109) structural region of these proteins.  Interestingly, Spa15 and InvB can function 	   	   	   13	  interchangeably to bind and facilitate secretion of effectors containing this conserved sequence(109), suggesting that it acts as a conserved Class IB chaperone targeting motif.   1.4.2 Class II chaperones   Class II chaperones contain tetratricopeptide (TPR) repeats and are required for secretion of the two T3SS translocon proteins that form the pore-forming complex in the infected host cell membrane (these proteins are often termed major and minor based on their proposed prevalence in the complex).  Structures of Pseudomonas PcrH with a PopD(56) peptide, Yersinia SycD(94) with a YopD(58) peptide, and Shigella IpgC(92) with a IpaB(57,93) peptide reveal a conserved chaperone fold of TPR repeats with a  “cupped palm” surface which forms a binding groove for the minor or major translocon peptide.  Stoichiometry and dimerization interfaces of class II chaperones vary in the structures observed to date.  Structures of the full-length translocon/effector complex could help discern the ternary structure of the complex; however, the full-length translocon may interact with the chaperone in a molten globule conformation(110), impeding crystallization. 1.4.3 Class III chaperones   Class III chaperones form heterodimers and associate with needle subunits in a 1:1:1 ternary complex to prevent polymerization of the needle in the bacterial cytosol.  Structures of Pseudomonas PscG/PscE/PscF(48), Yersinia YscG/YscE/YscF(47) and Aeromonas AscG/AscE(111) complexes have been solved.  The PscG/YscG/AscG chaperone has a TPR fold that binds the C-terminal helix of the needle subunit (PscF/YscF) via hydrophobic residues of its concave surface.  The second chaperone, PscE/YscE/AscE, has two main α-helices and associates primarily with PscG/YscG/AscG, perhaps stabilizing the TPR chaperone.  It is interesting to note that the heterodimeric chaperoning system of the needle 	   	   	   14	  subunit diverges from the chaperone of the EPEC filament protein EspA (essentially an elongated extension of the needle component in that species), in which a single hairpin structured chaperone CesA bound to EspA in a 1:1 ratio is sufficient to impede polymerization of EspA(54). 1.5 Architecture of the T3S apparatus 1.5.1 The export apparatus and ATPase   The export apparatus is composed of five membrane proteins (SpaP, SpaQ, SpaR, SpaS and InvA in Salmonella), as well as a soluble ATPase complex.  The membrane components of the export apparatus localize to the inner membrane, initiating with assembly of SpaP, SpaQ and SpaR(13) (YscR, YscS, YscT in Yersinia)(15) and associate with the base of the needle complex, where they are required for assembly of the functional secretion system(13).  EM analysis of needle complexes with deletion of the export apparatus membrane proteins shows a loss of density located in the inner membrane rings of the basal body, which corresponds to the socket and cup region.  These are thought to function respectively as an anchor for the inner rod and an entry point for substrates(28,68) (see below), suggesting that the export apparatus contributes to its formation(13).  Recent in situ cryo-electron tomography studies of the T3SS injectisome revealed the organization of some export apparatus features (for instance the ATPase oligomer and export gate), which are absent in purified needle complexes(31,32). While little is known about the structure of the membrane components SpaP, SpaQ, SpaR, the cytoplasmic domains of SpaS and InvA (and orthologs), as well as the ATPase have been structurally characterized.  	   	   	   15	  1.5.2 The autoprotease   SpaS, sometimes referred to as a molecular switch for its potential role in controlling the chronology and specificity of substrate secretion, has an N-terminal trans-membrane domain connected by a well-conserved flexible linker to a globular C-terminal cytoplasmic autoprotease domain.  The autoprotease has a conserved NPTH sequence motif and self-cleavage occurs between the asparagine and proline residues via an intein-like mechanism involving asparagine cyclization(24,112).  The two subdomains produced by self-cleavage tightly associate and structures of SpaS(24) (Salmonella), EscU(24) (EPEC), Spa40(25) (Shigella), YscU(26,27) (Yersinia), and FlhB(113) (flagellar homolog) have been solved.  The conserved fold consists of a central β-sheet and four α-helices, with the cleavage motif situated on a short surface-exposed loop.  Self-cleavage alters the electrostatic surface of the auto-protease, which may function biologically as a switch mechanism, changing from export of “early substrates” (needle and rod) to “late substrates” (needle tip and translocon) as non-cleaving mutants have defective secretion profiles of late substrates and effectors(24,114,115).  Non-cleaving mutants also have aberrant localization of chaperone/effector complexes at the inner membrane, suggesting that cleavage may support targeted and specific docking of these complexes to the export apparatus(115).  Interestingly, a non-cleaving YscU mutant secreted tip protein when the N-terminal secretion signal of an effector was grafted onto the tip protein, also indicating a role in recognition of effectors(114). Additionally, in EPEC the autoprotease domain directly interacts with the inner rod(116), and associates with the “ruler” protein(71), although the significance of these interactions and how they contribute to substrate switching and assembly is not understood.  Unlike the export ring pore (see below), the autoprotease has only been observed as a 	   	   	   16	  monomer, although it is possible that multiple copies are present in the assembled export apparatus.   1.5.3 The export gate  The export apparatus component InvA (MxiA in Shigella, YscV in Yersinia) oligomerizes(15,21) to form a cytoplasmic export ring pore.  Structures of InvA cytoplasmic domain(19,20) (as well as the flagellar homolog FlhA)(117-119) captured a monomeric form of the protein; however, the cytoplasmic domain of MxiA crystallized in a closed, planar nonameric ring with an external diameter of 110-170 Å, a pore diameter of ~50 Å and a depth of ~55 Å (Figure 1.2 D)(21).  The monomer is composed of four conserved subdomains, the first of which is structurally similar to the E subunit from the peripheral stalk of the archael A0A1 ATP synthase(19-21).  The nonameric ring in the crystal structure is formed by interactions between subdomains 1 and 3, with subdomain two situated at the external edge of the ring, a conformation supported as biologically relevant for secretion by mutational analysis of key interacting residues(21). Electron cryo-tomography of flagella with a deletion of FlhA showed a loss of density in the toroidal region situated between the inner membrane rings of the base and the cytoplasmic ATPase, consistent with the size of the nonameric MxiA ring(21).  This data suggests a model in which T3SS substrates are unwound from their cognate chaperone at the site of the ATPase (see below) and funnelled into the export ring pore, which facilitates passage of the substrate to the mouth of the needle complex channel, a step that may be energetically enabled by proton motive force(21).  The role of the remaining membrane components of the export apparatus remains unknown and future structural work is required to construct a comprehensive model of how the export apparatus functions to deliver and regulate passage of substrates to the needle complex. 	   	   	   17	  1.5.4 The ATPase The T3SS has a dedicated ATPase that is structurally similar to the β-catalytic subunit of the F1 ATPase.  The structure of the T3SS ATPase in EPEC, EscN(17) has been solved, as well as the flagellar homolog FliI(120).   The ATPase has three domains: an N-terminal domain thought to facilitate oligomerization into a homohexamer(121,122), a central ATPase domain that binds ATP via a conserved Rossmann fold, and a C-terminal domain, which is the proposed binding site of the chaperone/effector complex(17,83).  The in silico model of the ATPase hexamer, based on interactions between the α- and β-subunits of the heterohexameric F1-ATPase, suggests a circular complex with an outer diameter of 105Å, and an inner pore diameter ranging from 30-50 Å, as well as 6 ATP binding sites located at the consecutive dimer interface of adjacent monomers(17).  The structure of the flagellar ATPase accessory protein, FlgJ, (as well as a Chlamydia trachomatis T3SS ortholog CT670(123)) were also solved and shown to be structurally similar to the F1F0-ATPase central stalk γ subunit; it is proposed these proteins facilitate hexamerization of the ATPase by binding in a 1:6 ratio, likely orientating the ATPase such that the C-terminal domain faces the membrane and export gate(124).  Thus far, little is known about how the ATPase coordinates with the so-named “sorting platform”(125), a complex localized to the cytoplasm and proposed to include SpaO, OrgB (homologous to the peripheral stalk protein of F-ATPase) and other export apparatus components (SpaP, SpaQ, SpaR, SpaS) to transport substrates in a regulated, hierarchical fashion.  1.5.5 The basal body   The portion of the needle complex embedded in the bacterial inner and outer membranes is called the basal body; remarkably, despite the 3.5 MDa size of the needle 	   	   	   18	  complex, the basal body is composed of three proteins (InvG, PrgH, and PrgK in Salmonella) that are ~60 kDa or smaller(10).  The needle complex has been studied by cryo-EM (Salmonella)(28,126) and negative stain EM (Shigella)(29), revealing a common overall architecture consisting of a series of stacked rings with a wide base and neck-like region.  Recently, in situ cryo-electron tomography was used to study Shigella, Salmonella and Yersinia injectisomes, the latter of which has never been purified(31,32).  The recent EM map of the Salmonella needle complex with improved resolution(28), along with new crystal structures of the periplasmic and cytoplasmic domains of PrgH, and the periplasmic domain of InvG in conjunction with customized Rosetta modelling algorithms(34) have led to the most rigorous model to date of the possible oligomerization interfaces within the major ring components of the T3SS basal body (Figure 1.2 C). 1.5.6 The inner membrane rings   The inner membrane portion of the basal body consists of two stacked rings, inner membrane ring 1 (IR1), located in the periplasm and inner membrane ring 2 (IR2) located in the cytoplasm.  The IM ring is composed of oligomers of PrgK and PrgH(63).   Nano-gold labelling and EM show that the C-terminal region of PrgH localizes to the periplasmic region, where it forms a 24-mer ring, which encompasses a smaller diameter 24-mer ring of the N-terminal domain of PrgK(28,63).  PrgK is predicted to be anchored to the inner membrane by its lipidated N-terminus(12), with the N-terminal domain positioned in the periplasm, followed by a transmembrane helix and small cytoplasmic domain.   Crystallization of the N-terminal domain of the EPEC PrgK ortholog EscJ produced a superhelical organization in the crystal lattice, with 24 subunits in a complete turn of the helix(33).  Flattening of the helix produced a ring structure composed of 24 subunits of EscJ 	   	   	   19	  with a diameter of 180 Å, similar to the diameter observed in EM maps of Salmonella IR rings(33).  PrgH contains a single transmembrane helix, which divides the protein into a cytoplasmic N-terminal domain and a periplasmic C-terminal domain(63).  The structures of the periplasmic(34,35) and cytoplasmic(34) domains of PrgH have been solved.  The PrgH periplasmic domain contains two ring-building motifs (a conserved fold consisting of two α-helices folded against a β-sheet)(35), whereas the cytoplasmic domain contains a fork head associated (FHA) domain, as observed in structures of orthologs in Shigella(36,37), Yersinia(127,128) and Chlamydia (PDB 3GQS).   While FHA domains commonly bind phosphorylated threonines, the FHA residues that bind phosphothreonines are poorly conserved among T3S orthologs(34).  Of note, deletion of the FHA domain in Salmonella leads to the formation of needle-less basal body, suggesting a role in T3SS assembly.  A definitive biological role for this domain has not been elucidated, although modelling predicts it faces the cytosol, rendering it available to mediate protein-protein interactions(34). 1.5.7 The outer membrane ring   The outer membrane ring (OM ring) and neck region of the basal body is composed of InvG(63), a protein belonging to the secretin family.  Secretins typically oligomerize in outer-membrane embedded complexes of 12-15 subunits, and are also core components of the T2SS and Type IV pili System(129).  Assembly and oligomerization of InvG in the outer membrane requires the assistance of a small lipoprotein, a pilotin called InvH(60,61).  The structures of the Shigella and Pseudomonas pilotins MxiM(38) and ExsB(130) show little structural homology. Although both contain anti-parallel β-sheets, MxiM contains an additional α-helix that interrupts the β-barrel like structure.  MxiM is proposed to function by first binding its own N-terminal lipid, which is then displaced by interaction with the C-	   	   	   20	  terminal domain of Shigella secretin MxiD, freeing the lipid moiety for recognition by the Lol sorting pathway and insertion into the outer membrane(38,39).  Atomic resolution data were previously only available for the periplasmic domain of the EPEC secretin EscC(35), but a crystal structure of the homologous domain of Salmonella InvG(34) is now available for modelling into the Salmonella T3SS EM map. Recent cryo-EM of InvG suggests the OM ring is composed of 15 subunits(28), which, although initially unexpected and still a matter under investigation in Salmonella and other species, was recently supported as the most favourable oligomeric assembly of the periplasmic domain of InvG modelled into the high resolution EM map by Rosetta(34).  Indeed, cryo-EM analysis of the Yersinia secretin YscC revealed that is composed of 12 subunits(40).  Both EscC and InvG secretins contain a conserved “ring building motif” consisting of two α-helices folded against a β-sheet, which is found at the InvG oligomer interface, supported by mutational analysis(34), suggesting that the fold may serve as an oligomerization scaffold(35).  The N-terminal periplasmic domain of InvG extends into the periplasm and contacts the C-terminal domain of PrgH, as shown by crosslinking of the needle complex and mass-spectrometry analysis(63,131).   Additionally, recent modelling suggests an electronegative face on the surface of the InvG ring opposite a complementary electropositive face of the PrgH ring, which may aid in ring assembly(34).  The overall assembly of the basal body has 3-fold symmetry, with 4-5 subunits of InvG corresponding to 8 subunits of IR-1(28). The recent EM structure of the basal body suggested that the interior cup (at the cytosolic side) and socket-like structures are composed of apparently individual subunits with the socket connecting directly to the inner rod(28).  Little is known about the protein composition and role of these observed features, but one hypothesis is that the socket serves as an anchor for the inner rod, and the cup region as an 	   	   	   21	  entry point for substrates.  After contact with the host cell, a signal transmitted through the needle and inner rod may trigger a conformational change in the cup region, allowing for subsequent export of substrate(28,126). 1.5.8 The inner rod   The inner rod of the T3SS is located within the base of the needle complex(126) and is proposed to form a channel through the periplasmic spanning region of the needle complex, physically anchoring the needle to the base of the secretion system(68).  Based on predicted coiled-coil regions within the primary sequence, the inner rod subunit is proposed to be paralogous to the extracellular needle subunit(78) and like the needle, believed capable of self-polymerization(116).  However, because the inner rod is localized within the concentric rings of the basal body, it likely requires such an environment to fold into its functional form, presumably hindering structural studies on the intact rod in its isolated form.    Indeed, analysis of recombinant, purified Salmonella inner rod subunit, PrgJ, and Shigella inner rod subunit, MxiI, by NMR spectroscopy and circular dichroism revealed that the inner rod behaves as a monomer, lacks tertiary structure, and is mostly unfolded, save for a short C-terminal α-helical region (residues 65-82 in PrgJ)(132), indicating that additional scaffolding components may be required for folding and polymerization.  Multiple binding partners within the T3SS have been implicated for the inner rod during assembly.  The inner rod from E. coli, EscI, has been shown to interact with the cytoplasmic domain of the autoprotease (EscU)(116,133), with a specialized T3SS associated lytic transglycosylase (EtgA)(133) proposed to selectively clear peptidoglycan to facilitate T3SS assembly, and the secretin component of the basal body(116).  Additionally, it has been shown to bind the gatekeeper protein (InvE/MxiC/YopN) in Salmonella, Shigella and 	   	   	   22	  Yersinia (see above)(77).  Recognition of the inner rod by the autoprotease may play a role in switching from “early” to “late” substrates during assembly(116).  Interaction with the lytic transglycosylase (IagB in Salmonella, IpgF in Shigella) is proposed to locally clear peptidoglycan for efficient assembly of the T3SS(134-136) and contribute to virulence of Citrobacter in mice(137).   1.5.9 The needle   A filament termed “the needle” forms an ~50 nm long channel with an 8 nm outer diameter and 2 nm inner diameter that extends from basal body to the host cell, and functions as a conduit for effectors proteins.  The needle is a polymeric assembly of more than 120 copies of a small molecular weight protomer called MxiH in Shigella(11) and PrgI in Salmonella(138,139).  Purified needle protomer can polymerize spontaneously to form long filaments of varying lengths, rendering atomic resolution models of the individual protomer inherently difficult to attain.  Fortuitously, deletion of the last five amino acids of the protomer prevents polymerization, and a crystal structure of monomeric MxiH∆C5(44) and NMR structures of monomeric BsaL∆C5(49) (Burkholderia) and PrgI∆C5(42) were obtained.  Structures of PscF (Pseudomonas)(48) and YscF(47) (Yersinia) were also obtained in complex with their respective heterodimeric chaperones (see Chaperones section).  MxiH, BsaL and PrgI consist of N-terminal α-helix (α1) and a C-terminal α-helix (α2), connected by conserved central region with a PxxP sequence motif (x = S, D or N).  The first 3, 8, and 19 N-terminal residues of PrgI, BsaL and MxiH, respectively, are disordered and have less sequence conservation than the central region and C-terminal helix(42,44,49).  While truncation of the five C-terminal residues of the needle protomer allowed elucidation of the monomeric structures, these mutants are non-functional, and thus further probing of the 	   	   	   23	  protein-protein interactions that permit needle polymerization requires models of the full-length monomer, as well as the intact needle filament.  A systematic mutagenesis study identified a soluble full-length PrgI and MxiH double valine to alanine mutant (V65A V67A in PrgI), referred to as PrgI* and MxiH* (41).  NMR and x-ray structures of PrgI* show that the last five residues extend the C-terminal α2 helix (41). PrgI* spontaneously polymerizes in vitro and Fourier-transform infrared spectra and Magic-angle Spinning solid state NMR spectroscopy identified a helical to beta-sheet conformational change in the C-terminal region of PrgI* upon conversion from monomer to polymer, suggesting that protomer refolding is required for assembly of the needle(41).    A hybrid approach using x-ray fibre diffraction, electron microscopy and docking of protomer structures to EM maps was used to address the question of how the needle protomer assembles to form a filament, and to characterize the helical architecture and dimensions of the filament.  The first model of the Shigella needle was solved to ~16 Å resolution and had 5.6 subunits/turn and a 24 Å helical pitch(140).  Docking of the MxiH crystal structure into the EM map lead to the first proposed model, in which MxiH was oriented such that the head group, or central region, decorated the surface of the needle, the N-terminal helix lined the central channel, and the C-terminal helix formed the outer shell of the needle(44).   A higher resolution cryo-EM structure solved to 7.7 Å allowed visualization of alpha and beta features of the Shigella needle(45).  Docking of MxiH into the EM map resulted in a model with the C-terminal region of MxiH exposed on the needle surface, and the N-terminal helix lining the needle channel.  β-hairpin structure identified on the needle surface  (contributed to residues 51-64 of MxiH) appeared to interact with the head group of the subunit below in the 11-start helix (45).  Electron microscopy was also used to generate an ~18 Å model of the Salmonella 	   	   	   24	  typhimurium needle with an average symmetry of 6.3 subunits per turn and a 26Å helical pitch(141).  The central region of the PrgI monomer was modeled into the density of the needle map, but the resolution of the filament structure and the structural plasticity of PrgI prevented modeling of the remainder of the monomer.  While the models described above have provided a wealth of information about the needle, they are limited by resolution, as inter- and intra- subunit contacts cannot be discerned at low or medium resolution.  A recent study combined solid-state NMR (ssNMR), electron microscopy and Rosetta modelling to deliver the first atomic model of the Salmonella typhimurium needle (Figure 1.2 B)(43).  Previous EM models were calculated from needles sheared from isolated basal body complexes, whereas this study used recombinantly produced needles obtained by in vitro polymerization. The resulting model had an 11-start helical configuration, with ~5.7 subunits per turn and an axial rise of 24Å. Within the context of the needle filament, the secondary structure of PrgI, as determined by conformation-dependent chemical shifts, consists of an extended N-terminal domain, an α-helix, loop, and C-terminal α-helix.  ssNMR spectra of [1-13C] glucose labeled, [2-13C] glucose labeled, and mixed [1/2-13C] glucose labeled needle preparations were compared to determine restraints for inter-subunit interactions and intra-subunit interactions(43).  Intra-subunit contacts form between the two α-helices, positioning the helices in a hair-pin structure.  The lateral interface between subunits forms between α1-α1 and α2-α2 packing of adjacent (i±5, i±6) subunits, and the axial interface includes contacts between the extended N-terminal domain and the central loop region of the i±11 subunit above/below it.  Rosetta modelling was used in combination with the ssNMR distance restraints and scanning transmission electron microscopy (STEM) data(141) to obtain an atomic resolution model of 	   	   	   25	  the needle. The N-terminal region of PrgI faces the outer surface of the needle, and the C-terminal helix, which has higher sequence conservation between species, lines the central channel of the needle, a topology supported by immuno-gold labelling studies.  Recently, ssNMR analysis of the Shigella needle found that MxiH had a similar secondary structure to PrgI in the polymerized needle, and a Rosetta homology model of MxiH generated using PrgI as template correlated well with the cutting-edge 7.7 Å Shigella EM map(45) and the ssNMR chemical shift data.  Like the Salmonella needle model, the N-terminal region of MxiH is surface exposed, and the C-terminal region lines the lumen of the needle, suggesting a conserved architecture.   1.5.10 The tip complex   The distal end of the needle culminates in a specialized tip complex, which plays a role in sensing contact with the host cell(142-144), regulates secretion of effector proteins(142,144-146), and facilitates insertion of the translocon into the host cell membrane(142,143,145,147-151) (for a comprehensive review of the tip complex(151)). The tip component varies in sequence and assembly between species and can be grouped accordingly: the Inv-Mxi-Spa family (IpaD in Shigella, SipD in Salmonella, and BipD in Burkholderia), the Ysc family (PcrV in Pseudomonas, LcrV in Yersinia) and Esc family (EspA in EPEC, Bsp22 in Bordetella).  The tip proteins of the Inv-Mxi-Spa family and the Ysc family have a similar overall fold, although differ in that tip proteins from the latter family have a specific chaperone and tip proteins from the former family have a self-chaperoning domain (see below).  Tip proteins from the Esc family have little structural similarity to other tip proteins, albeit the presence of a coiled-coil(54), and extend from the distal end of the needle, polymerizing into filamentous assemblies(152-156) which likely 	   	   	   26	  serve species-specific functions during pathogenesis.  The focus of this section will be limited to the Mxi-Inv-Spa family of tip proteins; for more information on the Ysc family, refer to structural studies of LcrV(53,157-159) and an in-depth review of PcrV(151).  Structural characterization of SipD(50,51), IpaD(52,55), and BipD(55,160,161) indicate a conserved fold, consisting of three domains with an overall dumbbell type appearance: an N-terminal α-helical hairpin packs against a central long coiled-coil domain, with a mixed α/β domain, located at the end of the central coiled-coil, lying opposite the N-terminal domain.  The N-terminal α-helical hairpin is proposed to act as a self-chaperoning domain, as its fold is similar to that of the needle subunit, and it may mimic interactions with the needle(55), preventing premature oligomerization of the tip protein in the bacterial cytoplasm(162).  The interface formed between the needle and tip has been probed in Shigella(163) as well as Salmonella(51,164).  In Shigella, an interaction occurs between the PSNP motif of MxiH and IpaD.  This interaction is not possible without a reorganization of the proposed self-chaperoning domain of IpaD.  A crystal structure of a PrgI-SipD fusion in combination with mutational analysis convincingly demonstrates that the self-chaperoning region of SipD must be deleted (in vitro) for interaction with PrgI to occur and that PrgI interacts with the concave face of the central coiled-coil with residues that make contacts with a helix of the N-terminal domain in the full-length PrgI structure(51).  This interaction face is consistent with NMR paramagnetic relaxation enhancement studies between PrgI and SipD(164). A model of the pentameric(165) Salmonella SipD tip complex atop the Shigella needle modelled by cryo-EM(44) with the concave face of the SipD central coiled coil assembling around the outer surface of the needle suggests an open conformation, with the inner channel of the needle accessible and SipD forming an outer diameter of 140Å(51); 	   	   	   27	  however, SipD/PrgI interaction has not yet been reworked in the context of the recent Salmonella ssNMR needle model(166).  High resolution structural studies of the tip complex in the context of the polymerized needle will be required to determine how the self-chaperoning domain refolds to allow tip assembly, and how the tip complex regulates secretion of effector proteins and insertion of the translocon into the host cell membrane.  Bile salts are present at high concentrations in the host duodenum, and interact with the tip proteins of infecting Shigella and Salmonella; however, binding of bile salts to tip protein have apparently contrary effects on the invasiveness of Shigella and Salmonella.  Interaction of IpaD with bile salts activates IpaD and stimulates recruitment of the translocon component IpaB(150,167), whereas bile salts repress invasiveness of Salmonella(168).  The bile salt deoxycholate interacts with IpaD α3 and α7 of the central coiled-coil, and induces a conformational change upon binding(52,169).  Three reports demonstrate binding of SipD to bile salts deoxycholate, taurodeoxycholate and chenodeoxycholate, although they describe different positions of the bile salt binding cleft(50,51,170). 1.5.11 The translocon   Upon contact with the host cell, the translocon components of the T3SS are secreted and form a pore in the host cell membrane(171-173), a step which is required for delivery of effector proteins to the host cell cytoplasm.  The translocon is assembled from three components: a hydrophilic translocator (or tip complex; see above), a major hydrophobic translocator and a minor hydrophobic translocator.   The so-termed major hydrophobic translocator contains two predicted transmembrane regions, while the minor translocator contains one membrane-associated region.  In Salmonella the translocon forms a pore with an inner diameter of approximately 3.5 nm(174).  Atomic force microscopy of the EPEC 	   	   	   28	  translocon suggests a complex of 6-8 subunits with an outer diameter of 55-65 nm and a height of 15-20 nm protruding above the membrane plane(175).   The hydrophobic components of the translocon have been recalcitrant to structural studies, perhaps owing to the transmembrane regions as well as the myriad of conformations and interactions they must likely form, for example: complex formation with cytoplasmic chaperone, export in a presumably partially unfolded state through the needle, subsequent interaction with needle tip and/or translocon partners, oligomerization to form a functional pore, insertion into the host cell membrane, interaction with host lipids, and finally interaction with host proteins within the host cytoplasm.  Current structures of the translocon proteins are restricted to peptides of the translocators in complex with their chaperone(56,57,93), as well as a protease-resistant N-terminal segment of the major translocator(59).  The structure of a peptide of the N-terminal chaperone binding domain of Shigella major translocator IpaB(57,93), a peptide of Pseudomonas minor translocator PopD(56), and a peptide of Yersinia minor translocator YopD(58) in complex with their respective chaperones IpgC, PcrH, and SycD were solved by x-ray crystallography.  Interestingly, the chaperone appears to bind both the major and minor translocator in the same cleft.  Despite low sequence identity (21%) the N-terminal region of IpaB and Salmonella SipB were found to both form a well conserved extended coiled-coil consisting of 3 anti-parallel helices(59).  Since the needle, tip and translocon all possess a coiled-coil motif, it appears this is an important structural motif in assembly of the functional secretion system. High resolution EM data and/or atomic level structural data will provide insight into how the pore regulates passage of effectors into the host cell, and help validate or disprove 	   	   	   29	  proposed models of assembly such as the “three-tiered ring model”(176) in which each hydrophobic component forms a homo-oligomer, with the major component embedded in the membrane and the minor component associated with the membrane and in contact with the tip complex, or another alternate assembly model in which the hydrophobic components form a hetero-oligomer that then associates with the tip complex(176). 1.6 Transport of effectors through the T3SS   Since the diameter of the T3SS needle filament (~20 Å) cannot accommodate passage of folded effector proteins, it has long been presumed that after release of the chaperone at the site of the export apparatus, effectors are fed through the secretion system needle in an unfolded form.   Recently, this concept was elegantly illustrated by cryo-EM and single particle analysis of “substrate-trapped” Salmonella injectisomes(30), as well as biochemical and functional analysis of Shigella substrate-trapped injectisomes(177).  The substrate, Salmonella effector protein SptP, or Shigella IpaB was effectively trapped during secretion through the injectisome by fusion of a stable protein to its C-terminus, which cannot be unfolded by the T3S apparatus, thus preventing efficacious secretion and subsequently blocking the secretion channel.   Negative stained EM analysis of substrate-trapped injectisomes showed a bulbous protrusion at the distal needle tip, indicating that effector refolding occurs spontaneously after secretion; additionally, immunogold labelling localized the C-terminal fusion to the base of the basal body, demarcating the substrate entry point.  Difference maps between the WT needle complex and substrate-trapped needle complex show additional density along the length of the inner rod and needle (corresponding to the unfolded substrate) and unexpectedly reveal a change in density along the circumference of the basal body IR-1(30).   To summarize, the unfolded substrate enters the secretion channel 	   	   	   30	  in a polarized fashion, leading with the N-terminus, and travels the length of the needle; upon exiting the needle channel, the substrate appears to spontaneously refold.  Due to the resemblance of the T3SS to a syringe, it has been intuitively thought that delivery of effectors to the host cell occurs via a one-step “microinjection” mechanism, by which the effector travels through the injectisome, bypassing the bacterial and host membranes, to reach the host cytoplasm.  However, recent work has led to the proposal of an alternate two-step method, in which T3SS effectors and translocators are secreted prior to host cell contact and localize to the bacterial surface; after contact with the host cell, the hydrophobic translocators are proposed to insert into the host cell membrane and facilitate entry of effectors, much like binary AB toxin delivery(178,179). Further work is required to definitively show whether the host membrane-embedded translocon forms a continuous channel with the tip and needle filament, and/or functions independently as a pore to allow transport of effectors localized at the bacterial surface. 1.7 Structural overview of Salmonella effectors   The overall structure of the T3S apparatus is remarkably well conserved between species; however, the number and activities of T3SS effector proteins that are passaged through the system vary extensively between species, as each species possesses a uniquely adapted set of effectors that promote survival and replication of the bacteria within the host.  Nonetheless, there are some common themes that are generally conserved amongst effectors from all species such as modularity, functional mimicry, and spatial and temporal regulation of effector activity(180).  Effector proteins provide a sophisticated mechanism for tampering with the host cell physiology to promote survival of the bacteria – unlike bacterial toxins, many effector-mediated modifications of host proteins are reversible; in fact, the activities of 	   	   	   31	  some effectors are antagonistic, which allows the bacteria fine-tuned control over host processes. In this section we will conduct a brief survey of Salmonella effectors that have been structurally characterized (see Figure 1.3, Table 1.3).   	  Figure 1.3 Overview of structurally characterized Salmonella effectors and their role in host cell pathways. Left panel, Salmonella SPI-1 effectors are shown in blue font and SPI-2 effectors are shown in green font. After entry into the host cell, Salmonella survives and replicates within the Salmonella containing vacuole. SPI-1 and SPI-2 effectors target many host pathways; here we highlight structurally characterized effectors that target RhoGTPase signalling, the ubiquitin pathway, cytoskeleton components, and also effectors that covalently modify host proteins. A) Effectors SopE (green), SopB (orange), and SptP (red) interact with switch regions (shown in cyan) of Cdc42 and/or Rac1 (blue). B) Hect-type E3 ligase SopA (purple) in complex with host E2 ubiquitin conjugating enzyme UbcH7 (gray) and NEL E3 ligase SspH2 (yellow). C) SifA (red) in complex with kinesin binding protein SKIP (gray), ADP ribosyltransferase SpvB (purple) and actin binding SipA (blue) all interact with and/or modify host cytoskeleton proteins. D) Many effectors covalently modify their host targets, such as phosphothreonine lyase SpvC (yellow), cysteine protease SseI (green) and the C-terminal tyrosine phosphatase domain of SptP (red). PDB codes of Salmonella effector structures used for this figure are listed in panels A–D. 	   	   	   32	   Table 1.3 Structure of Salmonella effector proteins T3SS  Effector Activity Host Interacting Partner Structure PDB code (reference) SPI-1 SipA Actin bundling F-actin (N)SipA/InvB 2FM8(88) (N)SipA  2FM9(88) (C)SipA  1Q5Z(181) SopA HECT3 Ubiquitin ligase Ubiquitin conjugating enzymes (E2) UbcH5a, UbcH5c, UbcH7 SopA/E2 UbcH7 3SY2(182) SopA 2QZA, 2QYU(183) SopB (N) GDI, (C) Phosphoinositide phosphatase Cdc42 (N)SopB/Cdc42 4DID(184) SopE GEF Cdc42, Rac1, Rab5 SopE/Cdc42 1GZS(185) SopE2 GEF Cdc42, Rac1 SopE2 1R9K(186) SptP (N)GAP, (C) Tyrosine phosphatase Cdc42, Rac1 (N)SptP/SicP 1JYO(86) SptP/Rac1 1G4U(187)  SptP 1G4W(187) PipB2  Kinesin light chain (N)PipB2  2LEZ SPI-2 SifA (N) SKIP interacting (C)GEF RhoA, SifA kinesin interacting protein (SKIP) (N)SifA/SKIP 3HW2(188) (N)SifA/SKIP 3CXB(189) SseI (C) Cysteine protease TRIP6, IQGAP1 SseI 4G29(190) SspH2 E3 ligase PKN1 SspH2 3G06(191) SpvB ADP-ribosyltransferase actin SpvB 2GWK(192) SpvC Phosphothreonine Lyase Dual-phosphorylated MAPKs Highest activity for phospho-p38 SpvC 2Q8Y(193) SpvC + phosphothreonine peptide 2Z8P(194) 	  	   	   	   33	  1.7.1 Modulation of RhoGTPases  Rho GTPase signalling is commonly targeted by bacterial effectors, perhaps due to its central role in regulation of host actin and cytoskeleton dynamics, as well as numerous signal transduction pathways.  Rho GTPases act as molecular switches, alternating between an inactive GDP bound state and an active GTP bound state.  In the active GTP bound state, Rho GTPases Cdc42, Rho, and Rac interact with more than 30 potential eukaryotic effector proteins, such as kinases, consequently activating down-stream signalling pathways(195).  Rho GTPases have a conserved small globular α/β fold with two flexible switch regions (switch I and switch II) and a conserved P-loop (phosphate binding loop) which coordinate the nucleotide and an Mg2+ ion, and undergo a conformational change after hydrolysis of GTP to GDP(196).  Hydrolysis of GTP is intrinsically slow, and activity of the Rho GTPase is regulated by guanine-nucleotide exchange factors (GEFs), GTP activating proteins (GAPs) and guanine nucleotide dissociation inhibitors (GDIs)(196).  Salmonella effectors SopE and SopE2 are bacterial GEFs that catalyze Cdc42 and Rac1 exchange of GDP for GTP(197-199), a function that could not be extrapolated from sequence analysis as the bacterial GEFs show no sequence or structural homology to eukaryotic GEFs(185,186).  Indeed, SopE has a V-shaped fold composed of two 3-helix bundles and a catalytic GAGA motif connecting the two sides of the ‘V’.  In the co-crystal structure, SopE contacts switch I and II of Cdc42, mimicking interactions of eukaryotic GEFs with key Cdc42 residues, to disrupt binding of the nucleotide and facilitate its dissociation(185).  SifA, a SPI-2 secreted Salmonella effector may contact Rho-GDP through a C-terminal domain which has similar fold to SopE(188,189); however, it belongs to the WxxxE family of bacterial effectors, named for the conserved Trp and Glu residues in the catalytic site, and GEF activity has not yet been 	   	   	   34	  demonstrated(200).  The N-terminal GAP domain of Salmonella effector SptP forms a four-helix bundle that inserts between switch I and II of the GTPase and contacts the β- phosphate of GTP with a catalytic arginine residue(187), mimicking the interaction made between eukaryotic GAPs and Cdc42, despite a lack of sequence and structure conservation.  The N-terminal domain of Salmonella effector SopB has GDI-like activity towards Cdc42, and contacts switch I and II of the GTPase via a helical bundle and mimics interactions of eukaryotic GDIs to prevent dissociation of GDP nucleotide(184).    The structures of Salmonella GTPase binding domains reveal that they contain a mostly helical fold and share little structural homology with their eukaryotic counterparts.  Salmonella has co-opted a complete set of GTPase regulators to finely tune host GTPase activity during infection. 1.7.2 Targeting the host ubiquitin pathway   The host ubiquitin pathway plays a pivotal role in numerous host processes such as protein degradation, DNA repair, cell cycle control, and protein trafficking (see reviews(201-203)), and bacterial effectors have evolved to commandeer various aspects of the ubiquitin pathway(204).  Three enzymes facilitate the covalent attachment of ubiquitin to specific lysine residues of a target protein either as a mono-ubiquitin or poly-ubiquitin chain: 1) Ubiquitin activating enzyme E1 recruits and binds ubiquitin via a covalent thioester bond 2) Ubiquitin conjugating enzyme E2 transfers ubiquitin from E1 and 3) ubiquitin ligase E3 interacts with E2 and transfers ubiquitin to the lysine of the target substrate(205).  Structurally characterized Salmonella effectors SopA and SspH2 are both ubiquitin E3 ligases, although SopA belongs to the HECT-type E3 ligase family(206) and SspH2 belongs to the NEL (Novel E3 Ligase) family(207).  SopA has little sequence conservation with eukaryotic HECT E3 ligases, except for a conserved motif in the active site, but is 	   	   	   35	  structurally similar in that it contains an L-shaped bilobal architecture with an N-lobe that binds E2 and a catalytic C-lobe with a conserved cysteine that can form a thioester bond with ubiquitin(182,183).  A co-crystal structure of SopA in complex with host E2 UbcH7 demonstrates that SopA binds the same face of UbcH7 as eukaryotic E3 ligases and comparison of the structure to that of an EHEC ortholog NleL in complex with UbcH7 shows the C-lobe can move 180o on a flexible hinge region, a motion that is important for ubiquitin transfer(182).  The SspH2 structure revealed two domains: an N-terminal leucine-rich repeat (LRR) which mediates protein-protein interactions and an all helical C-terminal E3 ligase domain with a catalytic cysteine(191).  The catalytic cysteine is partially buried by the LRRs, which may represent an auto-inhibited conformation, preventing pre-mature interaction with host proteins(191).  The known structures of Salmonella E3 ligases show that markedly different structures have evolved to transfer ubiquitin to a subset of host cell proteins, likely dictated by their specific protein-protein interaction domains. This process appears regulated in time as SopA is secreted by the SPI-1 T3SS and SspH2 is secreted by SPI-2 T3SS (another Salmonella E3 ligase SspH1 is secreted by both the SPI-1 and SPI-2 T3SSs).    1.7.3 Covalent modification of host targets   Another mechanism deployed by T3SS effectors is covalent modification of host cell proteins.  Recent structures of Salmonella phosphothreonine lyase SpvC(193,194), cysteine protease SseI(190), as well as the structure of the C-terminal tyrosine phosphatase domain of SptP(187) exemplify effectors that covalently modify host target proteins.  SpvC irreversibly inactivates host signalling protein MAPK by cleaving a phosphothreonine residue required for activity through a β-elimination mechanism, resulting in cleavage of the C-O bond and generation of a double bond product(193,194).  The N-terminus, although disordered in the 	   	   	   36	  crystal structure, has a conserved D motif for interaction with host MAPKs(193).  SpvC has an α/β fold and binds the pT-x-pY peptide of MAPK through a central twisted 5-stranded β-sheet and surface loops(193,194).  The phosphothreonine lyase activity of SpvC and related bacterial effectors represents a novel mechanism for irreversible inactivation of MAPKs that has not yet been observed in eukaryotic systems.  A recent structure of the C-terminal domain of another SPI-2 secreted effector, SseI, revealed a cysteine protease domain with a conserved Cys-His-Asp catalytic triad(190).  This domain of SseI has sequence and structural similarity to Pastuerella multocida toxin (PMT), which has glutamine deamidase activity towards the α-subunit of heterotrimeric GTPases.  The biological targets of SseI have yet to be identified, and catalytic activity was not observed in in vitro assays(190).  The Salmonella SPI-1 effector SptP, has a C-terminal tyrosine phosphatase domain with sequence conservation (15%) to eukaryotic tyrosine phosphatase PTP1B. Structural analysis reveals this domain of SptP adopts the canonical tyrosine phosphatase fold with a twisted β-strand fold at the core, and a cluster of 4 helices at one end and 2 helices at the other(187).  The active site contains a conserved P-loop with a catalytic cysteine(187).  These structures provide examples of Salmonella effectors that select host substrates for covalent modification to control signalling pathways in a reversible or irreversible manner.  1.7.4 Interaction with the host cytoskeleton   Multiple Salmonella effectors interact with components of the host cytoskeleton, such as actin and microtubule binding proteins.  While some effectors alter actin dynamics by regulating activity of small GTPases involved in signalling pathways controlling actin dynamics (see above), others directly bind or modify actin.  Crystal structures of Salmonella SipA and SpvB are examples of two such effectors.  SipA contains a C-terminal domain that 	   	   	   37	  directly binds actin(208) to stabilize F-actin, as well as promote polymerization of G-actin(209).  EM analysis demonstrates that SipA binds actin, linking subdomain 4 of actin monomer i to subdomain 1 of monomer i +3 of the adjacent actin filament(181,209).  The central region of the SipA actin binding domain has a globular fold with N-terminal and C-terminal extensions on either side that are proposed to behave as a molecular stapler, connecting and stabilizing actin filaments(181).  SpvB, another actin-modulating effector, ADP ribosylates actin to inhibit polymerization(210,211).  Structural studies of SpvB reveal 2 nearly perpendicular β-sheets forming a canonical ADP ribosyltransferase α/β fold and show binding of NAD in a manner similar to other characterized members of the family(192). SipA and SpvB exemplify the diverse, and sometimes antagonistic, mechanisms Salmonella effectors use to modulate host proteins.  Additionally, SP1-2 effector SifA (see above), contacts SifA Kinesin Interacting Protein (SKIP) via its N-terminal domain, an interaction that likely serves to localize SifA to microtubules through binding of SKIP to the motor protein kinesin(77,188,189,212,213).  Although the mechanism is not yet well understood, SifA is necessary for tubulation of the Salmonella phagosome and a ∆sifA mutant is attenuated for virulence in mice(212,213).  This section provides only a brief survey of Salmonella effectors that have been structurally characterized.  Elucidating the structures of these effectors is particularly valuable in the instances for which activity cannot be gleaned from the amino acid sequence.  Structural studies of bacterial effectors that do have sequence conservation to eukaryotic proteins provide information not only about the bacterial effector, but also of the class of host protein it emulates.   	   	   	   38	  1.8 T3SS summary and perspectives   Recent strides have been made in structural characterization of the T3SS.  An improved EM map of the needle complex provides new details of its symmetry and substructures(28).  New crystal structures of the periplasmic domain of OM ring component InvG and the cytoplasmic domain of IM ring component PrgH in combination with Rosetta modeling provide the most rigorous model of oligomeric interactions in the basal body complex(34).   Great advances have been made in determining the architecture of the Salmonella(43) and Shigella(46) needles by a combination of ssNMR, electron microscopy and Rosetta modeling.  These studies convincingly demonstrate that the conserved residues of the needle protomer line the channel of the needle, while the variable N-terminal region decorates the surface of the needle.  At the cytoplasmic side of the T3SS, a remarkable nonameric structure of the gate protein MxiA provides visualization of a major component of the export apparatus(21).  New structures have emerged of class II translocon chaperones(56-58,92-94), as well as class III heterodimeric needle chaperones(47,48,111) and more than eight Salmonella virulence effectors in the last five years(182-184,188-191,194).   However despite recent advances, much about the structure and assembly of the T3SS is yet to be discovered.  For example, little is known at the molecular level regarding the inner membrane components of the export apparatus, as well as the energetics behind translocation of substrates through the extensive path of the secretion system needle.  Less is known about the structure of the inner rod in the periplasm of the needle complex, and the membrane domains of the basal body components.  Paramount to our understanding of the T3SS mediated delivery of effectors into the host cell will be structural analysis of the translocon pore-forming complex. Collectively, a piecing together of these T3SS molecular 	   	   	   39	  events using a multidisciplinary approach of biophysical, biochemical and cellular microbiology are generating an evolving model of this essential process to the pathogenicity of the major Gram-negative bacterial pathogens. 1.9 Overview of thesis objectives 	  	   The goal of the research outlined in the following chapters of this thesis is to gain a better understanding of assembly and regulation of the T3SS, as well as to characterize the interaction between a type III secreted effector protein and its host target.    Since the discovery of the virulence-associated type III secretion system nearly two decades ago, the field has made great strides in piecing together the structure of this complex macromolecular machine.  However, many aspects of how the secretion system assembles remain poorly understood.  This thesis describes work on two T3SS proteins from EPEC that are required for assembly: a peptidoglycan-cleaving enzyme called EtgA that interacts with the inner rod EscI, which we show can polymerize into a filament, and a gatekeeper protein that regulates secretion hierarchy, called SepL.  EtgA has long been proposed to facilitate T3SS assembly by locally clearing peptidoglycan, which acts as a barrier for large protein complexes.  SepL belongs to a class of proteins that regulate the secretion switch from translocon components to effector proteins.  The final research chapter presents work on a Salmonella effector protein, called SopB.  SopB has a modular architecture, with a GTPase binding domain that interacts with host Cdc42, and a phosphoinositide phosphatase domain, both of which are critical for modulation the host cell.  Structural and functional characterization of these secretion system components and effector protein contributes towards improved understanding of multiple aspects of type III secretion.   	   	   	   	   40	  2 Structural analysis of a specialized type III secretion system peptidoglycan-cleaving enzyme  2.1 Introduction   Diarrhoeal diseases account for approximately 18% of deaths of children under the age of 5 years (214).  In 2011, one of the most prevalent diarrhoea inducing pathogens, enteropathogenic Escherichia coli (EPEC), caused an estimated 79,000 deaths in this age category of children (215).  Following ingestion, EPEC adheres intimately to the epithelial cells of the small intestine, and causes effacement of microvilli and formation of actin pedestals beneath the bacterium(216-219).  Once adhered to the intestinal epithelium, EPEC assembles a virulence-specific protein transport system (referred to as the type III secretion system or T3SS).  The syringe-like T3SS injects more than 20 different virulence proteins from the EPEC cytoplasm directly into the host cytoplasm.  Critical for pathogenesis, delivered effectors manipulate host cell processes such as cytoskeleton dynamics, inflammatory signalling pathways, cell cycle progression and apoptosis(220).  The T3SS machinery is also conserved among other Gram-negative pathogens such as Shigella, Salmonella, Yersinia and Pseudomonas, underscoring the importance of understanding such a key virulence factor at a molecular level.    The EPEC T3SS (as well as effector proteins and their chaperones) is encoded in a pathogenicity island called LEE (locus of enterocyte effacement) that is arranged in 5 polycistronic operons (LEE 1-5).  The T3SS is composed of more than twenty proteins that oligomerize in a highly regulated and hierarchical fashion to form a contiguous channel through both bacterial membranes and the host membrane.  The first components to assemble are the cytoplasmic export apparatus, inner-membrane basal body rings, and outer-membrane embedded secretin (Figure 2.1).  The export apparatus, which includes an ATPase, export 	   	   	   41	  gate and autoprotease, shuttles T3SS substrates from the bacterial cytoplasm into the secretion channel. The basal body, which spans the bacterial membranes, is formed by concentric inner membrane rings composed of EscJ and EscD, and an outer membrane-embedded secretin, EscC(33,35,221).  The inner rod component (EscI), which shares sequence identity with the well-characterized filamentous extracellular needle (EscF), is presumed to create a channel through the basal body inner and outer membrane rings(78,116), leading to the subsequent needle appendage that continues the channel through the extracellular space. In EPEC, the needle in turn is capped by a filamentous extension composed of EspA (54,152,153,155,222) that facilitates the span of the T3SS across the micro-villiated surface of the infected host gut epithelial cells.  In the final step of assembly, the translocon (EspB and EspD) assembles at the tip of the EspA filament and inserts into the host membrane to form a pore(175) for direct delivery of virulence effectors into the host cell.  Assembly of molecular transport systems (such as the T3SS) that span both bacterial membranes requires local re-arrangements in the peptidoglycan layer(135,223-225).  Peptidoglycan is composed of glycan strands of β-1,4 glycosidic linked N-acetylglucosamine (GlcNAc) and N-acetyl muramic acid (MurNAc) disaccharide, which are crosslinked by short 4-5 residue peptides to create a mesh-like layer with an average pore size between 2-7 nM (226,227).  Proteins smaller than ~50 kDa can diffuse freely through the peptidoglycan, but the peptidoglycan layer acts as a barrier to larger proteins and protein complexes (226).  The periplasmic region of the T3SS is ~ 17 nm in diameter at the widest point and most species encode a T3SS-specific “specialized” PG-lytic enzyme.    	   	   	   42	  	  Figure 2.1 Schematic overview of T3SS apparatus components and the role of EtgA during assembly. EtgA is transported to the periplasm by the Sec secretion system.  It interacts with the inner rod, EscI, in the bacterial periplasm, and locally clears peptidoglycan during assembly.  After assembly of the inner rod and needle, the EspA filament and translocon form.  Inset- peptidoglycan is composed of repeating MurNAc-GlcNAc disaccharide.  Both lytic transglycosylases and lysozymes cleave the β-1,4 glycosidic linkage, but lysozyme uses a hydrolysis mechanism to produce MurNAc and GlcNAc while lytic transglycosylases produce 1,6-anhydromuramoyl product along with GlcNAc.   PG-lytic enzymes such as lytic transglycosylases degrade peptidoglycan by cleaving the β-1,4 glycosidic linkage between GlcNAc and MurNAc disaccharide, releasing a 1,6-anhydromuramoyl product (see Figure 2.1 inset). The 1,6-anhydromuramoyl product released by lytic transglycosylases is recycled for production of new peptidoglycan(228).  Lysozymes have the same substrate specificity as lytic transglycosylases; however, the reaction catalyzed by lysozyme uses a water molecule to hydrolyze the glycosidic linkage between GlcNAc and MurNAc disaccharide, releasing GlcNAc and MurNAc products (Figure 2.1 inset).   	   	   	   43	   The EPEC LEE pathogenicity island encodes a T3SS-specialized PG-lytic enzyme, EtgA, located between the LEE1 operon and the grlR (global regulator of LEE repressor) and grlA (global regulator of LEE activator) operon(78). EtgA was classified as a putative Family 1A lytic transglycosylase due to the presence of conserved sequence motifs(78).  The N-terminus of EtgA has a signal peptide that targets it for transport to the periplasm by the Sec-dependent general secretory pathway(134). An early study that used a yeast two hybrid assay to survey interactions between LEE encoded proteins, suggested that EtgA binds the inner rod subunit, EscI (133). Peptidoglycan-degrading activity of EtgA, as well as T3SS PG-lytic enzyme orthologs from Salmonella and Shigella (IagB and IpgF, 41% and 35% sequence identity respectively) was shown by zymogram, and mutation of a conserved glutamate (E42 in EPEC) abrogates activity (134,136). Deletion of etgA from the EPEC ortholog Citrobacter rodentium, a mouse bacterial pathogen similar to EPEC, impedes T3S and attenuates virulence(137).  Accordingly, deletion of etgA from EPEC decreases T3S and reduces T3SS-dependent haemolysis of erythrocytes(134).  However, it has been reported that disruption of the Salmonella ipgF gene had no effect on HeLa cell invasion, although this may not be reflective of the situation in the naturally targeted epithelial cells(229).   Escherichia coli has at least seven known lytic transglycosylases (Slt70, MltA, MltB, MltC, MltD, MltE and MltF) that play a role in peptidoglycan remodelling during cell growth and division (230). EtgA shares sequence similarity with consensus motifs I, II and III of the catalytic domain of Family 1A lytic transglycosylase Slt70, which has been well characterized at the molecular level (231-233).  Despite low sequence similarity, the catalytic domain of Slt70 is structurally similar to goose-type lysozyme(231,232).  Both lytic transglycosylases (such as Slt70) and goose-type lysozyme lack the catalytic aspartate 	   	   	   44	  (Asp52) that is generally found in lysozymes, such as the prototypical hen egg-white lysozyme (HEWL).   In the proposed lytic transglycosylase mechanism, the catalytic Glu acts as a general acid to donate a proton to the glycosydic oxygen, resulting in bond cleavage and formation of an oxocarbenium ion transition state, stabilized by the formation of an oxozolinium intermediate.  The next step of the lytic transglycosylase mechanism involves an intramolecular nucleophilic attack by the C6 hydroxyl of the MurNAc  (probably aided by abstraction of a proton from the hydroxyl group by the oxyanionic form of the catalytic Glu) on the C1 carbon of the oxozolinium intermediate, resulting in formation of the 1,6 anhydro product(224,231-233). Since activity of PG-lytic enzymes can be fatal to the bacterium, their expression, localization, and activity must be tightly regulated.  Expression of EtgA in EHEC is negatively regulated by the presence of GrlA, an activator of T3SS gene expression (234).  Presumably, this allows for synthesis of T3SS components prior to transport of EtgA to the periplasm (234). Additionally, activity of specialized PG-lytic enzymes may be spatially regulated by physical interaction with other components of the molecular transport system.  For instance, VirB1, a PG-lytic enzyme associated with the type IV secretion system (involved in conjugation, DNA uptake and effector translocation), interacts with several apparatus components(235).  Likewise, the interaction of EtgA with the T3SS inner rod, EscI, may spatially restrict the activity of EtgA.  Interestingly, the flagellar secretion system, which is evolutionarily related to the T3SS, has a modular PG-lytic enzyme called FlgJ (Salmonella), that has PG-lytic activity in its C-terminal domain, while its N-terminal domain forms the rod-cap itself, ensuring that peptidoglycan is cleared as the rod assembles (236,237).  Furthermore, lytic transglycosylases involved in cell wall re-modelling during 	   	   	   45	  growth and division are lipoproteins that are spatially restricted by association with the periplasmic leaflet of the outer membrane (224,238).   In this study, we obtained the first known structure of a T3SS-specific PG-lytic enzyme (conserved with type II and type IV secretion system and type IV pili-associated PG-lytic enzymes), encompassing the catalytic core of EPEC EtgA.  Based on structural similarity to other lytic transglycosylases and lysozymes, we mutated putative catalytic residues in the EtgA active site and tested the effect of each mutant on type III secretion.  Additionally, we expressed and co-purified recombinant EtgA with its binding partner, the inner rod protein EscI, and determined the stoichiometry of the EscI/EtgA complex.  Finally, we show that EscI stabilizes EtgA and enhances its peptidoglycan degrading activity.  Secretion system associated PG-lytic enzymes such as EtgA are attractive drug targets, as they represent one of the few enzymatic components of the T3SS.  Drugs that target a component of the pathogen required for virulence, but not for replication per se, may lessen selective pressure and emergence of resistance factors (239).  Structural information for the specialized virulence-associated T3SS PG-lytic enzymes will be critical for developing drugs that specifically target these enzymes. 2.2 Methods 2.2.1 Cloning of genes into expression vectors for crystallography, protein expression and purification   The coding region of EtgA residues 19-152 was amplified from EPEC E2348/69 genomic DNA and cloned into pET-21a vector (un-tagged) as well as pET-28a vector with an N-terminal 10X histidine tag by restriction free cloning.  EtgA (19-152) corresponds to a deletion of the N-terminal Sec-secretion signal.  EtgA mutants were generated by quick change PCR.  The coding region of EscI residues 24-137 was amplified 	   	   	   46	  from EPEC genomic DNA and cloned by restriction free PCR into pET-28a vector with an N-terminal 10X histidine tag.  	  For protein production for crystallization trials EtgA (19-152) D60N-pET-21 was co-transformed with N-terminally his10 tagged EscI (24-137) –pET-28 in E. coli BL21 (DE3).  To produce selenomethionine labelled protein, cultures were grown in M9 media (supplemented with 1 mM MgSO4, 0.1 mM CaCl2, 0.01 mM FeCl3, 1 mg thiamine and 1% glucose) with 50 µg/ml kanamycin and 100 µg/ml ampicillin at 37 oC to an A600 of 0.7 and then 0.05 g of selenomethionine was added per litre of culture.  After 30 minutes of growth with selenomethionine, the culture was induced with 1 mM IPTG for 18 hours at 20oC.  Cells were harvested by centrifugation and cell pellets were re-suspended in lysis buffer containing 20 mM Hepes pH 7.5, 500 mM NaCl, 50 mM imidazole, 1 mM BME and one complete protease inhibitor cocktail tablet (Roche), and lysed by French press.  Cell lysate was centrifuged at 45,000 rpm for one hour at 4 oC.  The supernatant was loaded on a 1 ml Ni-NTA column, which was pre-equilibrated with wash buffer (20 mM Hepes pH 7.5, 500 mM NaCl and 50 mM imidazole, 1 mM BME).  EtgA (19-152) D60N and EscI (24-137) complex was eluted with elution buffer (20 mM Hepes pH 7.5, 500 mM NaCl, 500 mM imidazole, 1 mM BME).  Elution fractions were pooled and concentrated and loaded onto a Superdex 75 10/30 column equilibrated with buffer (Hepes pH 7.5, 500 mM NaCl, 5 mM BME).  EtgA (19-152) D60N and EscI (24-137) complex eluted as a single peak and protein-containing fractions were pooled and concentrated to 20 mg/ml for crystallization trials. To express EtgA/EscI complex for the in vitro activity assay, WT EtgA (19-152)-pET-21 (or the catalytic mutants E42A or D60N) was co-transformed with N-terminally his10 tagged EscI (24-137) –pET-28 in E. coli BL21 (DE3).  Cultures were grown in 2 L of LB 	   	   	   47	  media with 50 µg/mL kanamycin and 100 µg/mL ampicillin and induced with 1 mM IPTG at an A600 of 0.6 at 20 oC for 20 hours.  Cells were harvested, lysed and protein was purified as described above, but without BME.  To produce EtgA for activity assays, WT EtgA (19-152)-pET-28 (or the catalytic mutants E42A or D60N) was transformed into E. coli BL21 (DE3) and expressed as above.  Cells were harvested and lysed and EtgA was purified on a 1 mL Ni-NTA column, as described above.  EtgA was prepared fresh, immediately before the activity assay. 2.2.2 Crystallization of EtgA   EtgA (19-152) D60N/EscI (24-137) complex was set up extensively for crystallization, but was recalcitrant to crystallization.  Limited in situ proteolysis (240) of EtgA (19-152) D60N /EscI (24-137) complex using a 1:1000 molar ratio of chymotrypsin: EtgA (19-152) D60N/EscI (24-137) complex was set up in sitting drop vapour diffusion and produced crystals in multiple conditions containing 2-propanol as the precipitant.  Crystals typically appeared after 3 days in the optimized condition (0.1 M imidazole pH 7.3-7.5 with 20-23 % 2-propanol) at room temperature. Crystals were cryo-protected with a solution of mother liquor with 25% glycerol and flash frozen in liquid nitrogen. 2.2.3 Data collection, structure determination and refinement   Crystals were screened and MAD data were collected at the Lawrence Berkeley National Laboratory Advanced Light Source on beamline 8.2.1 at a peak wavelength of 0.9785 Å, an inflection wavelength of 0.9797 Å and a high energy remote wavelength of 0.9611 Å.  Data were processed with xia2 using XDS to index all frames, XSCALE to scale, and Aimless to merge (241).   Phases were obtained using autoSHARP, which located one selenomethionine (242).  The structure was built, refined and validated using autoSHARP, 	   	   	   48	  Coot, Refmac and PDB_REDO server(242-246).  Figures were made using the UCSF Chimera package(247). 2.2.4 Scanning Electron Microscopy of BL21 Escherichia coli expressing EtgA    BL21 (DE3) E. coli was transformed with WT EtgA (19-152)-pET-27, with a PelB signal sequence for export to the periplasm.  Cells were grown in LB-media until an OD600 of 0.6, and then induced with 0.1 mM IPTG.  Cells were imaged by scanning electron microscopy both with IPTG, one hour after induction, and without IPTG at the same time point.  Samples were prepared by filtering onto a 0.4um nucleopore filter in a Swinex holder, in fixative (4% EM grade formaldehyde/2.5% glutaraldehyde), followed by microwave processing. The samples were removed from the filter holder, processed in an inverted position through post-fixation in buffered osmium tetroxide (1%) washes, and alcohol dehydration prior to drying.  Following drying, the samples were mounted on aluminum SEM stubs using a conductive (silver) paste, dried, and sputter coated with gold.  Samples were imaged with a Hitachi S-4700 field emission scanning electron microscope. 2.2.5 Size Exclusion Chromatography-Multiangle Light Scattering (SEC-MALS)   Purified EtgA(19-152)/EscI(10-137) complex at a concentration of 2 mg/mL was injected over a Superdex 75 HR 10/30 column (GE Healthcare) pre-equilibrated in buffer (20mM Hepes pH 7.5, 500mM NaCl) and analyzed with a DAWN® HELEOS-II® 18-angles light-scattering detector and Optilab® T-rEX™ differential refractometer (Wyatt Technology).  All detectors were normalized using a 2 mg/mL monomeric bovine serum albumin standard. Data analysis was performed using ASTRA 6 software (Wyatt Technology). 	   	   	   49	  2.2.6 Cloning, expression, purification and imaging of EHEC inner rod protein EprJ   The coding region of EprJ was generated by PCR from EHEC O157:H7 genomic DNA and inserted into pMAL-c2x vector by restriction free cloning.  pMAL-c2X-EprJ plasmid was transformed into BL21 (DE3) cells and expressed as described above for EtgA.  Cells were resuspended in buffer (20 mM Hepes pH 7.5, 500 mM NaCl) and lysed by French press and centrifuged at 45,000 rpm for 45 minutes.  Lysate was passed over 3 mL of amylose resin and then resin was washed with 15 mL of wash buffer (20 mM Hepes pH 7.5, 500 mM NaCl).  MBP-EprJ fusion protein was eluted with 5 mL of elution buffer (20 mM Hepes pH 7.5, 500 mM NaCl, 250 mM maltose).  The MBP tag was cleaved overnight with Factor Xa protease.  EprJ was purified over a Superose 6 column in buffer (20 mM Hepes pH 7.5, 150 mM NaCl), and eluted in the void volume of the column. Purified EprJ (1 µl of 0.3 mg/mL) was applied to a glow-discharged carbon coated transmission electron microscopy grid (Ted Pella, Inc.).  After drying, the grid was stained with 1 µl of Nano-W® (methylamine tungstate, Nanoprobes) for 30 seconds.  Excess stain was removed by blotting with a Whatman paper.  Grids were imaged with a FEI Tecnai G2 200kV Transmission Electron Microscope. 2.2.7 Generation of Citrobacter rodentium and EPEC etgA deletion mutants for T3SS secretion assay  An in-frame deletion mutant of etgA, formerly known as rorf3, was generated in C. rodentium strain DBS100 and characterized as previously described (137). An etgA deletion mutant was also generated in the streptomycin-resistant derivative of EPEC O127:H6 strain E2348/69 using the sacB gene-based allelic exchange method and the suicide vector pCVD442 (248). A 4044 bp DNA fragment containing the EPEC etgA gene, as well as ~1.8 kb of flanking sequences on both sides, was amplified by PCR using primers EPescT-F 	   	   	   50	  (5’ATGAATGAGATAATGACGGTCATAGTATC3’) and EPcesD-1 (5’CTCAATGACCTTCATTCTTATGCC3’). The PCR product was cloned into pCRII-TOPO (Invitrogen), and the resultant plasmid was used as template for inverse PCR using primers EPetgA-RD (5’GCTAGCTCAGAAGGCAATACGCAATG3’, NheI) and EPetgA-DF (5’GCTAGCTGAAATGAGAATGATACTCAG3’, NheI) to create an internal deletion in the etgA gene. The inverse PCR product was digested with NheI, gel purified, treated with T4 DNA ligase, and transformed into E. coli strain DH10B. The DNA fragment containing the etgA gene with the internal deletion and its flanking regions was then subcloned as a SacI/XbaI fragment into the suicide vector pCVD442 to generate pCVD-∆EPetgA. The etgA gene in the suicide vector has an internal deletion from nucleotides 37 to 384 (~76% of the coding region) and an NheI site introduced at the deletion site. Plasmid pCVD-∆EPetgA was transformed into E. coli strain SM10λpir by electroporation, and introduced into EPEC strain E2348/69 by conjugation. After sucrose selection as previously described (248), EPEC colonies resistant to sucrose and streptomycin but sensitive to ampicillin, indicative of allelic exchange and loss of the suicide vector, were screened by colony PCR for deletion of etgA. The obtained EPEC etgA mutant was further verified by PCR. 2.2.8  Complementation constructs for EPEC and Citrobacter rodentium etgA deletion mutants   Constructs expressing EPEC or C. rodentium etgA in the plasmid pACYC184 (New England Biolabs), which has a moderate copy number of 30-50/cell in bacteria, were toxic to EPEC and C. rodentium when grown under type III secretion inducing conditions, and caused partial bacterial lysis, probably due to EtgA’s peptidoglycan-hydrolyzing activities. We next generated EtgA complementation constructs in the vector pZS*24MCS (EXPRESSYS; http://www.expressys.com/main_vectors.html), which has a much lower 	   	   	   51	  copy number of 3-5/cell than pACYC184. The coding region of EPEC etgA, as well as its 159-bp upstream promoter region, was amplified by PCR using primers EtgAcom-1 (5’GGATCCATTTGTTCTATCCATAAGC3’, BamHI) and EPetgAcom-2 (5’GTCGACGATTCGTATTGCGATAGACCTTG3’, SalI). Likewise, the C. rodentium etgA gene and its 149-bp promoter region were amplified using primers EtgAcom-1 (5’GGATCCATTTGTTCTATCCATAAGC3’, BamHI) and CRetgAcom-2 (5’GTCGACGATCCGTATTGCAATGGATATTG3’, SalI). These PCR products were digested with BamHI and SalI, gel-purified, and ligated into BamHI/SalI-treated pZS*24MCS to generate pZS*-EPetgA and pZS*-CRetgA, respectively. The constructs were confirmed by DNA sequencing, and transformed via electroporation into EPEC and/or C. rodentium etgA deletion mutants for complementation. The EPEC and Citrobacter ΔetgA mutants can be complemented by either pZS*-EPetgA or pZS*-CRetgA, indicating that EPEC etgA and Citrobacter etgA are functionally exchangeable. Based on this observation, we were able to test variants of EPEC etgA generated by site-directed mutagenesis in the Citrobacter ΔetgA mutant, which has a much more pronounced type III secretion defect than the EPEC ΔetgA mutant. 2.2.9 Type III secretion assay for EPEC and Citrobacter rodentium   EPEC and C. rodentium strains were grown overnight in LB broth containing appropriate antibiotics at 37oC in a shaker at 225 rpm. The cultures were then diluted 1:40 into 3 ml of pre-warmed Dulbecco’s modified Eagle’s medium (DMEM) (HyClone) supplemented with 4500 mg/L glucose, 4 mM L-glutamine and 110 mg/L sodium pyruvate without any antibiotics in a 6-well tissue culture plate (Corning Inc.) and grown statically at 37oC for 6 hours in a tissue culture incubator containing 5% CO2 (v/v) to induce type III 	   	   	   52	  secretion. The cultures were centrifuged at 16,100 g for 10 min to pellet the bacteria, and the bacterial pellet was re-suspended in SDS-PAGE sample buffer to generate whole cell lysates. The bacterial growth medium supernatant was collected and passed through a Millex-GV 0.22 µm filter unit (Millipore) to remove any remaining bacteria, and the proteins in the supernatant were precipitated with 10% (v/v) trichloroacetic acid (TCA). After centrifugation at 16,100 g for 30 min, the protein pellet was dried in air and dissolved in SDS-PAGE sample buffer, with the residual TCA neutralized with 0.5 µl of saturated Tris. The amount of the sample buffer used to re-suspend the bacterial pellet or dissolve the precipitated proteins was normalized according to the A600 values of the cultures to ensure equal loading of the samples. 2.2.10 Thermal stability assay  	   EtgA (19-152) or EtgA (19-152)/EscI (24-137) complex thermostability was measured as a function of its temperature dependent aggregation by differential static light scattering (StarGazer-2; Harbinger Biotechnology and Engineering Corporation) according to the method of Vedadi et al. (249). Briefly, 10 µl of 0.4 mg/ml protein in 100mM Hepes pH 7.5, 300 mM NaCl was heated from 25-85°C at a rate of 1°C/min in individual wells of a clear-bottom 384 well plate (Corning 3540, Rochester, NY). To test the importance of the EtgA disulphide bond for protein stability, 0.4 mg/mL EtgA (19-152)/EscI (24-137) complex (in 100mM Hepes pH 7.5, 300 mM NaCl) was incubated with a serial dilution of reducing agent (either DTT or TCEP) ranging in concentration from 1µM to 10mM.  Protein aggregation, as a measure of the intensity of scattered light, was scanned every 30 seconds with a CCD camera. The integrated intensities were plotted against temperature, where the inflection point of each fitted curve, using a Boltzmann regression, was defined as the 	   	   	   53	  aggregation temperature, Tagg. The Kagg for DTT and TCEP was determined by a four parameter logistic curve using SigmaPlot software (Systat Software Inc., USA). 2.2.11 EtgA activity assay  	   EtgA activity assays were performed using an Enzchek® Lysozyme Assay Kit.  In summary, 450 µg/mL of peptidoglycan labelled with fluorescein (Enzchek®) was serially diluted in half with 50 mM Hepes pH 7 buffer to create a series of 12 reaction mixtures.  A final concentration of 1 µM of protein (WT EtgA/EscI, EtgA E42A/EscI, EtgA D60N/EscI, WT EtgA, EtgA E42A, or EtgA D60N) was added to each reaction.  As a separate negative control, an equal volume of buffer was added in place of protein to a peptidoglycan dilution series.  All reactions were done in triplicate with a final reaction volume of 10 µl and transferred to a non-binding surface 384-well low volume plate (Corning® 3820).  Fluorescence was measured at 37 oC with an excitation/emission wavelength of 485/530nm using a Bio-Tek® Synergy H4 microplate reader.  Reactions were read every 30 seconds for one hour and data were analyzed using SigmaPlot software.  Lysozyme was initially used as a positive control.   2.3 Results 2.3.1 Structural characterization of the catalytic core of EtgA 	   To gain insight into the activity EtgA, we have solved the x-ray crystal structure of its catalytic core. Initially, a complex of the inner rod EscI (24-137) and EtgA (19-152) D60N (necessary for stabilization as in isolation EtgA is highly unstable and prone to rapid precipitation) was set up for crystallization trials, but was recalcitrant to crystallization.  In situ limited proteolysis of EscI (24-137)/EtgA (19-152) D60N complex with chymotrypsin produced crystals that diffracted to 2.0 Å resolution (Table 2.1).  The structure of the 	   	   	   54	  crystallized proteolytic product was solved using multi-wavelength anomalous dispersion (MAD) phasing of selenomethionine derivative crystals, and was revealed to encompass the catalytic core of EtgA, residues 19-105 (Table 1, Figure 2.2A).  The catalytic core of EtgA has a globular, mainly α-helical fold (helices denoted as α1-5) with a β-strand region (residues 47-67) closely resembling the catalytic domain of E. coli lytic transglycosylase Slt70 (PDB 1QTE; residues 451-618).  Accordingly, a DALI search revealed Slt70 (along with another E. coli Family 1 lytic transglycosylase, MltE) to be among the top structural orthologs, with a z-score of 11.2 and a root mean square deviation (r.m.s.d.) of 2.1 Å over 79 aligned Cα atoms.  C-lysozyme (2FBD) also had a high z-score (9.0) with an r.m.s.d. of 2.2 Å over 80 aligned Cα atoms.  Alignment of EtgA with the catalytic region of Slt70 (1QTE) and the top lysozyme DALI hit (PDB: 2FBD) revealed that the core helices of EtgA (α2 and α5) closely align with both lysozyme and Slt70, corresponding to a common “scaffold” present in many lytic transglycosylases and lysozymes (Figure 2.2B).  Interestingly, EtgA helices α1 and α5 are joined by a disulphide bond formed between Cys20 and Cys89, residues that are conserved in T3SS PG-lytic enzymes, as well as PG-lytic enzymes associated with the type IV pilus (T4P), bundle-forming pilus (Bfp) and the type II secretion system (T2SS) (Figure 2.2A, Figure 2.3).  This conserved disulphide bond stabilizes the fold of the protein, as incubation with increasing concentration of reducing agent (DTT or TCEP) causes a maximum change in aggregation temperature of 11.5oC (Figure 2.2C).  Notably, a disulphide is absent from the same region in lysozyme and Slt70 (Figure 2.2), suggesting the extra stabilization provided by the disulphide is only present in T3SS PG-lytic enzymes and their macromolecular complex associated orthologs.   	   	   	   55	   Strikingly, EtgA contains an extension of the second turn of its β-hairpin (residues 53-60), which aligns with the corresponding region in lysozyme, but is absent from Slt70 and other structurally characterized lytic transglycosylases (Figure 2.2B).  The presence of this region in EtgA is particularly interesting, as it contains an aspartate (Asp60) in the same position as the lysozyme catalytic Asp52 (in our structure this aspartate has been mutated to an asparagine as it conferred greater protein yields and stability for crystallography).   Table 2.1 EtgA data collection and refinement statistics  Selenomethionine EtgA Data Collection  Space group P3121 Cell dimensions  a,b,c (Å)a 31.4, 31.4, 149.52 α, β, γ (o) 90, 90, 120  Peak Inflection Remote Wavelength (Å) 0.9795 0.9797 0.9611 Resolution (Å) 29.9 – 2.0 (2.05-2.00) 29.9 – 2.01 (2.07-2.01) 29.9 – 2.03 (2.09-2.03) Completeness (%) 99.0(99.8) 99.1(99.3) 99.0(99.5) Unique reflections 6322(452) 6244(471) 6064(481) Redundancy  6.8(7.4) 6.8(7.4) 6.8(7.3) I/σ(I) 14.2(3.0) 14.5(3.3) 14.0(3.2) Rmerge 0.087(0.767) 0.086(0.672) 0.095(0.693) Refinement Statistics  bRwork / Rfree 20.8% / 24.4% Number of atoms      Protein 688     Ligand/ion 0     Water 17 r.m.s.d. bonds (Å) 0.012 r.m.s.d. angles (o) 1.47 B-factors (Å2)  Protein  40.6 Water 41.4 Ramachandran Statistics  Favored (%) 98.82 Additional (%) 1.18 	   	   	   56	  Disallowed (%) 0 aValues in parentheses represent the highest resolution shell bRwork = (ΣΙFobs-FcalcΙ) / ΣΙFobsΙ.  Rfree is calculated from 5% of randomly selected  reflections excluded during refinement.  	  Figure 2.2 Structure of the catalytic core of EtgA. A) The crystallized chymotrypsin proteolyzed fragment of EtgA corresponds to the catalytic core, encompassing residues 19 to 105, as shown in the bottom schematic (orange corresponds to the region in the crystal structure, blue corresponds to the Sec-secretion signal, and grey is the region of EtgA absent from the structure).  The catalytic glutamate (E42) as well as a conserved aspartate (D60N) are shown as sticks. B) EtgA active site shares similarity with both lysozyme (PDB 2FBD) and Slt70 (PDB 1QTE), as shown by alignment of EtgA (orange) with Slt70 (blue) and lysozyme (cyan).  The catalytic glutamate (E42) has a similar position in all three structures.  The lysozyme catalytic aspartate aligns with EtgA D60N.  Other active site residues present in lysozyme and EtgA, but absent from Slt70 includes residues N54, N56, Thr58, and N67, which form a hydrogen-bonding network with D60N (residues shown as sticks, hydrogen bonds shown as dashed lines). C) To test the importance of the EtgA disulphide bond for stability, differential static light scattering was 	   	   	   57	  measured to monitor aggregation of EtgA/EscI complex with increasing concentration of reducing agent (DTT or TCEP).   The change in aggregation temperature (Tagg) was plotted as a function of reducing agent concentration.  Experiments were done in triplicate and error bars represent standard deviation. 	  This residue (D60N) forms a hydrogen-bonding network with the side chains of Asn54, Asn56, Thr58, and Asn67 (Figure 2.2B).  This hydrogen-bonding network was first described in HEW lysozyme, and forms a platform against which the GlcNAc sugar packs in the D (-1) site(250). Indeed, this aspartate and the residues forming the hydrogen-bonding network are also conserved in Shigella and Salmonella EtgA orthologs, IpgF and IagB, as well as orthologs associated with Bfp, and T2SS assembly (Figure 2.3).   Based on observations using 2-fluorochitobiosyl, lysozyme Asp52 has been proposed to act as a nucleophile, generating the glycosyl-enzyme intermediate, followed by protonation of the leaving group oxygen (4-OH) of GlcNAc by the general/acid base Glu35 and attack by water (251). Earlier proposals had suggested alternatively, that lysozyme Asp 52, restrained by the conserved hydrogen-bonding network described above, would provide charge stabilization of the developed oxocarbenium in an Sn2 displacement reaction rather than act as a nucleophile per se.     Conversely, lytic transglycosylases studied to date lack a catalytic aspartate.  An overlay of EtgA with lysozyme bound to MurNAc-GlcNAc-MurNAc trisaccharide reveals that EtgA Asn54, Asp60 and Glu42 align with the corresponding lysozyme residues to contact substrate in the D (-1) site (Figure 2.4A).   Comparison of MltE in complex with chitopentaose (i.e. (GlcNAc)5) to EtgA reveals that several residues of MltE that make hydrogen bonds or van der Waals contacts with chitopentaose are conserved and overlay with EtgA residues (Figure 2.4B).  Of note, EtgA Gln65 and Ser51 align with the corresponding residues in MltE that contact chitopentaose in the E (+1) and D (-1) positions.  	   	   	   58	  	  Figure 2.3 Multiple sequence alignment of T3SS specialized PG-lytic enzyme EtgA with other macromolecular machine-associated PG-lytic enzymes, lytic transglycosylase Slt70 and C-lysozyme. Alignment of EtgA (Escherichia coli, C7BUG6), IagB (Salmonella enterica serovar Typhi, P43018), IpgF (Shigella flexneri, Q07568), and YsaH (Yersinia enterocolitica, Q9KKJ1) with type II secretion system PG-lytic enzyme OrfC (Burkholderia pseudomallei, Q9ZF87), bundle-forming pilus PG-lytic enzyme BfpH (Escherichia coli 0127:H6, Q47073), type IVB pilus PG-lytic enzyme PilT (Salmonella enterica serovar Typhi, Q9ZIU8), Slt70 lytic transglycosylase (Escherichia coli, POAGC3), and lysozyme (Musca domestica, Q7YT16).  The macromolecular machine associated PG-lytic enzymes contain the glutamate general acid (denoted by *) present in both Slt70 and lysozyme, as well as an aspartate (denoted by *), which is present and required for catalysis in lysozyme but absent from Slt70.  EtgA residues conserved with lysozyme that form a hydrogen-bonding network with the conserved Asp are boxed and labeled as “lysozyme-like residues”.  Cysteines that form a disulphide 	   	   	   59	  bond in EtgA and are conserved with other T3SS, type IV pili, bundle-forming pili and the type II secretion system PG-lytic enzymes are boxed and labeled.  A motif conserved between Slt70 and T3SS-associated PG-lytic enzymes is also boxed and labeled.  Sequence alignment was done using clustal omega and the image was generated using Chimera.  Swiss-Prot/TrEMBL accession numbers for each sequence are shown above in brackets.  Surprisingly, given the evolutionary relationship between the flagella and T3SS (1), structural comparison of the flagella PG-lytic enzyme, FlgJ, to EtgA reveals structural homology to the scaffold helices (α1, α2, and α5 in EtgA), but markedly different structure of the β-hairpin and α3 and α4 regions of EtgA (Figure 2.4C) (252).  These differences are reflected in a relatively weak (compared to lysozyme and Slt70) DALI z-score of 4.3 and r.m.s.d. of 3.4 Å over 70 aligned Cα atoms. Additionally, structure based sequence alignment of FlgJ (PDB 2ZYC) with EtgA reveals only 9% sequence identity.  The β-hairpin of FlgJ extends further (and is also partially disordered in this structure) than that of EtgA and protrudes from the globular fold of the structure.  While the EtgA general acid Glu42 aligns with FlgJ Glu185, FlgJ lacks a catalytic aspartate corresponding to EtgA Asp60. 2.3.2 EtgA requires a catalytic glutamate and aspartate for activity in vivo  	   Given the unexpected and unprecedented (for lytic transglycosylase enzymes) structural alignment of EtgA Asp60 and β-hairpin region with lysozyme catalytic Asp52 and β-hairpin, and their conservation in T3SS encoding species, we mutated the conserved residues and tested the effect on type III secretion.   The ΔetgA mutant of both Citrobacter rodentium and EPEC displayed a reduced type III secretion phenotype. The Citrobacter ΔetgA mutant exhibited a more than 90% reduction in type III secretion when compared to the wild-type strain (137), whereas the EPEC ΔetgA mutant only had 50% attenuation of type III secretion, possibly due to functional redundancy with a house-keeping PG-lytic enzyme (data not shown; (134)). 	   	   	   60	  	  Figure 2.4 Comparison of EtgA active site with Slt70 and lysozyme active site bound to peptidoglycan-like fragments and flagellar PG-lytic enzyme FlgJ. A)  Overlay of EtgA (orange) with HEW lysozyme (PDB 9LYZ (253), cyan) bound to MurNAc-GlcNAc-MurNAc trisaccharide (yellow sticks), centered on subsite D.  B)  Overlay of EtgA (orange) with Escherichia coli lytic transglycosylase MltE (PDB 4HJZ (254); blue) bound to chitopentaose (yellow sticks).  C)  Structural comparison of EtgA with the flagellar N-acetylglucosaminidase FlgJ reveals that the core scaffold of EtgA (α1, α2 and α5) aligns with the flagellar-associated peptidoglycan cleaving enzyme, FlgJ (PDB 2ZYC (252)); however, the β-turn and α3 and α4 of EtgA share little structural similarity to FlgJ.  EtgA is shown in orange, and labels refer to EtgA residues and helices.  FlgJ is shown in green. As a greater reduction in type III secretion was useful for testing the effect of EtgA catalytic mutants, the Citrobacter ΔetgA mutant was used for the following experiments.  Citrobacter ΔetgA could be complemented by both EPEC and Citrobacter etgA (91% sequence identity) 	   	   	   61	  expressed on a low-copy number plasmid (3-5 copies/cell).  The low-copy number plasmid was critical for successful complementation, as complementation of etgA with a moderate-copy number plasmid (30-50 copies/cell) was toxic to EPEC and Citrobacter when grown under type III secretion inducing conditions, and caused partial bacterial lysis (data not shown), probably due to EtgA’s peptidoglycan-hydrolyzing activities. As expected, mutation of the catalytic glutamate (E42A) abrogated type III secretion (Figure 2.5A).  Complementation with etgA N54A N56A (two asparagines located in the β-hairpin that are conserved in lysozyme and form a hydrogen-bonding network with Asp60) severely decreased type III secretion (Figure 2.5A).  Mutation of EtgA Asp60 (conserved with lysozyme catalytic Asp52) to alanine also caused a severe decrease in type III secretion, indicating an important role in peptidoglycan cleavage.  2.3.3 EtgA associates with the T3SS through interaction with the inner rod, EscI  	   T3SS associated PG-lytic enzymes may be spatially regulated through interaction with secretion system components to prevent undesired peptidoglycan cleavage and cell lysis.  Indeed, we show that expression of WT EtgA (19-152) fused to a PelB signal sequence for periplasmic localization in BL21 (DE3) E. coli (a non-pathogenic expression strain lacking a T3SS) caused severe cell lysis, as shown by scanning electron microscopy images comparing morphology of BL21 (DE3) E. coli without induction of EtgA expression (Figure 2.5B, top) and with induction of EtgA expression (Figure 2.5B, bottom).  Since unregulated expression and export of EtgA to the periplasm is autolytic, a targeting mechanism must be in place to ensure that periplasmic EtgA localizes to the nascent T3S apparatus to clear peptidoglycan.  To better understand the interaction between the inner rod and EtgA, and how it may serve as a tethering mechanism, we sought to co-express and co-purify the two 	   	   	   62	  proteins to characterize the interaction in vitro.  While full length EscI (residues 1-142) was insoluble, as was also observed for expression of the Salmonella ortholog PrgJ (132), several N- and C-terminally truncated polyhistidine-tagged constructs of EscI successfully co-expressed and co-purified with untagged EtgA (19-152).  The minimal region of EscI required for interaction with EtgA encompassed residues 50-137, whereas the longest EscI construct that could be co-expressed encompassed residues 10-137. Size exclusion chromatography multi-angle light scattering (SEC-MALS) was used to characterize the stoichiometry between EscI (10-137) and EtgA (19-152) and showed that the two proteins interact in a 1:1 ratio to form a complex of 31,400 Da ±0.4% (Figure 2.5D).  Based on sequence similarity to the T3SS needle component, EscI is predicted to polymerize into a filamentous rod like structure (78,116) that presumably lies within and connects the inner and outer membrane ring structures of the T3SS basal body. While we were unable to express and purify a soluble filamentous form of EscI, we could express and purify the EHEC ortholog (EprJ, 26% identity) by fusion to an N-terminal maltose binding protein (MBP) solubilization tag.  Following cleavage of the MBP tag, EprJ formed heterogenous, filamentous structures, as observed by negative stain electron microscopy (Figure 2.5C), showing directly for the first time that full-length EprJ is capable of filamentous polymerization. Although it is unknown precisely how EtgA would localize along a filamentous form of the inner rod our data nevertheless shows that in this interaction, each EscI component binds only one EtgA protein via residues encompassing the central region of EscI. 	   	   	   63	  	  Figure 2.5 Analysis of EtgA activity in vivo and interaction with the inner rod. A) Type III secretion assay of Citrobacter rodentium ΔetgA mutant complemented with EPEC etgA and its site-directed mutants.  Citrobacter rodentium DBS100 ΔetgA was complemented with EPEC etgA with mutations of key conserved active site residues. T3SS secreted proteins (translocon components EspB and EspD, as well as EspA filament) from Citrobacter rodentium grown in DMEM were analyzed by 16 % SDS-PAGE and stained by Coomassie G250.  B) Scanning electron microscopy images of BL21 (DE3) E. coli without expression of EtgA (top) and after induction of EtgA expression (bottom).  EtgA was fused to a pelB signal peptide for export to the periplasm.  C) Purification of MBP tagged EprJ (EscI ortholog in EHEC) by amylose affinity chromatography (left gel) followed by cleavage of the MBP tag and size exclusion chromatography (right gel).  Purified EprJ was imaged by negative stain electron microscopy.  The white scale bar corresponds to 100 nm. D) Stoichiometry of EtgA and inner rod (EscI) complex by SEC-MALS.  EscI (10-137) and EtgA (19-152) were co-purified, injected over a Superdex 75 10/300 column and analyzed by multi-angle light scattering. EscI (10-137)/EtgA (19-152) were shown to form a monodisperse complex of 31,400 Da (± 0.4%), corresponding to a 1:1 ratio.  	   	   	   64	  2.3.4 Interaction with the inner rod EscI enhances the activity of EtgA in vitro   To determine whether the inner rod affects the PG-lytic activity of EtgA, we compared activity of EtgA versus EtgA/EscI complex in vitro using a fluorescently labelled peptidoglycan substrate.  An initial buffer screen showed the optimal pH for EtgA activity is between 6 and 7.5, so subsequent activity assays were done at pH 7.  Of note, the EscI/EtgA complex was less active than the lysozyme control (data not shown).  EtgA had an apparent Vmax of 95±5 RFU/min, whereas EtgA/EscI complex had nearly an eight-fold higher apparent Vmax of 720 ± 15 RFU/min (Figure 2.6A, Table 2.2).  Both samples had a similar apparent Km, suggesting that the inner rod does not affect binding of peptidoglycan to EtgA (Table 2.2).  Mutation of the catalytic glutamate (E42A) and aspartate (D60N) rendered EtgA inactive (both alone and in complex with the inner rod), underscoring the importance of both residues for catalysis (Figure 2.6A).  The observation that EtgA catalytic mutants in complex with EscI were inactive shows that EscI does not have any peptidoglycan cleaving activity itself, but acts to enhance the activity of EtgA.   A thermal aggregation assay was used to compare the thermal stability of EtgA to the thermal stability EtgA in complex with EscI.   EtgA had an aggregation temperature (Tagg) of 40oC, whereas EtgA/EscI had a Tagg of 48oC (Figure 2.6B), suggesting that EscI stabilizes EtgA.  The stabilizing effect of the inner rod on EtgA may contribute towards the increase in EtgA activity observed in the presence of the inner rod.   Table 2.2 EtgA peptidoglycan cleavage parameters  Apparent Vmax (RFU/min/µM EtgA)* Apparent Km (µg/mL)* EtgA (19-152) WT 95 ± 5 80 ± 15 WT EtgA(19-152)/  EscI (24-137) 720 ± 15 80 ± 5   * Experiments were done in triplicate and error is a measure of standard deviation 	   	   	   65	  	  Figure 2.6 The inner rod enhances EtgA peptidoglycan cleaving activity. A) EtgA (19-152) and EtgA (19-152)/EscI (24-137) complex was incubated with fluorescein-labeled peptidoglycan and the activity was monitored by measuring fluorescence with an excitation/emission wavelength of 485/530nm over one hour.  Conserved EtgA active site residues E42 and D60 were also mutated and assayed for activity, both with and without the inner rod EscI. Experiments were repeated in triplicate and error bars represent standard error.  B) Thermal aggregation of EtgA (19-152) or EtgA (19-152)/EscI (24-137) complex was monitored over increasing temperature by differential static light scattering (aggregation intensity).   2.4 Discussion 	   Clusters of genes encoding type II, type III and type IV secretion systems (as well as type IV pili) often encode a PG-lytic enzyme.  Based on sequence similarity with Family 1A lytic transglycosylases, these specialized secretion system PG-lytic enzymes were presumed 	   	   	   66	  to function as a lytic transglycosylase with creation of N-acetyl glucosamine and 1,6-anhydromuramic acid products (135).  In our crystal structure of T3SS-specific PG-lytic enzyme EtgA, we see features that are conserved with both lytic transglycosylases and HEW lysozyme.  The most surprising feature of the EtgA structure is a β-hairpin loop and aspartate that aligns remarkably well with the lysozyme β-hairpin loop and catalytic aspartate.  This conserved aspartate previously went unnoticed in the literature, as sequence alignments were done with Slt70, which, like all other characterized lytic transglycosylases, lacks a catalytic aspartate.   Accordingly, we have shown mutation of the aligned aspartate decreased type III secretion and abrogated peptidoglycan cleaving activity, underscoring its importance for catalysis in these virulence systems.   Currently, little is known about the mechanistic details of how specialized PG-lytic enzymes facilitate assembly of macromolecular complexes.  Recently, a PG-lytic enzyme associated with the flagella, FlgJ, was shown to cleave peptidoglycan between GlcNAc and MurNAc saccharides, acting as an endo-specific N-acetylglucosaminidase(255).  Another study showed Helicobacter pylori and Salmonella typhimurium required activity of house-keeping lytic transglycosylases for functionality of the flagella (ie motility), but not flagella assembly (256).  This work proposed a model that the N-actelyglucosaminidase activity of FlgJ clears peptidoglycan to facilitate flagella assembly, and subsequently house-keeping (involved in cell growth and cell wall maintenance) lytic transglycosylases remodel the opening in the peptidoglycan, producing 1,6-anhydromuramoyl peptidoglycan ends that interact with MotB, the flagellar motor protein(255,256).  Does the difference in structure (and likely activity) between type III associated PG-lytic enzyme EtgA and the flagellar FlgJ somehow play a nuanced role in assembly of each system, or does it reflect a different 	   	   	   67	  evolutionary acquirement of a PG-lytic enzyme?  The cell-wall products produced by an N-acetylglucosaminidase, muramidase (lysozyme) and lytic transglycosylase would differ, creating a distinct chemical environment around the secretion system. Multiple components of the type III secretion apparatus interact with peptidoglycan(257), and may selectively bind particular peptidoglycan moieties.    Supporting the idea that PG-lytic enzymes are intricately involved in macromolecular complex assembly, the tomato plant pathogen Pseudomonas syringae pv tomato DC300 encodes three PG-lytic enzymes (HopP1, HrpH, HopAJ1) that are up-regulated during type III assembly (258).  HopP1 has homology to EtgA (26% sequence identity) and we observe that it contains both a conserved catalytic glutamate and aspartate, while HrpH and HopAJ1 do not share sequence similarity with EtgA and have only a catalytic glutamate.  A combination of deletions of HopP1, HprH and HopAJ1 causes a decrease in virulence and effector translocation, but not a decrease in effector secretion(258). Indeed, many type II, III and IV secretion system gene clusters encode a specific PG-lytic enzyme, yet the deletion phenotype is often only attenuated for virulence. The variability in deletion phenotype, as also observed in our analysis of C. rodentium and EPEC ΔetgA mutants here, can then perhaps be attributed to functional redundancy with other PG-lytic enzymes, or the ability of the secretion apparatus to insert in naturally occurring holes in the peptidoglycan sacculus.  It is possible that specialized PG-lytic enzymes play a multi-faceted role in assembly, modifying local peptidoglycan in such a way that it is a recruitment signal for peptidoglycan-interacting components of the secretion system.   Activities of PG-lytic enzymes are tightly regulated temporally and spatially to prevent erroneous peptidoglycan cleavage and autolysis.  Expression of EtgA is negatively 	   	   	   68	  regulated by GrlA (an activator of T3SS gene expression) presumably to allow expression of T3SS components before expression and export of EtgA to the periplasm(234).  Once in the periplasm, EtgA interacts with the T3SS inner rod component EscI, which likely polymerizes into a filament.  Our in vitro peptidoglycan cleavage assay shows that EtgA is nearly eight times more active in the presence of the inner rod, suggesting that the inner rod not only spatially restricts the activity of EtgA, but may also enhance its activity.  Once transported to the periplasm by the Sec-secretion system, EtgA would be marginally active until it binds EscI (which is secreted through the T3SS), preventing destructive uncontrolled cell lysis.  This may be a common theme for secretion system associated PG-lytic enzymes, as others such as VirB1 from the type IV secretion system have been shown to interact with components of the secretion apparatus(235).   In conclusion, the structure of EtgA reveals that, despite sequence similarity with Family 1A lytic transglycosylases, EtgA possesses a catalytic glutamate and aspartate, as well as β-hairpin region that are remarkably similar to lysozyme.  Although EtgA and lysozyme share a conserved sequence in this region, it was previously unnoticed, and EtgA (as well as other orthologs associated with the type II, type III and type IV secretion systems) was presumed to act as a lytic transglycosylase.  Additionally, we show that EtgA’s peptidoglycan cleaving activity is enhanced in the presence of the inner rod EscI.  The low level of activity detected for EtgA in the absence of EscI may serve as a mechanism to prevent uncontrolled lysis prior to interaction with EscI.   Future work will focus on characterization of EtgA’s mechanism and reaction products to definitively classify it as a lysozyme or lytic transglycosylase.   	   	   	   69	  3 Structural analysis of a T3SS gatekeeper protein from EPEC 3.1 Introduction   Many Gram-negative bacterial pathogens, including enteropathogenic Escherichia coli (EPEC), Salmonella, Chlamydia and Yersinia, use a type III secretion system (T3SS) to deliver effector proteins directly into the cytoplasm of target host cells.  The T3SS is composed of a cytoplasmic export apparatus, a membrane spanning basal body, extracellular needle filament and a tip complex (also called the translocon) that inserts into the target host cell membrane(16).  A substructure called the inner rod forms a channel through the basal body, which connects to the lumen of the needle, creating a conduit for effector proteins(126).  Effector proteins secreted by the T3SS manipulate a number of host cell processes, such as the ubiquitination pathway, cytoskeleton dynamics, and inflammatory signalling to the benefit of the bacterium(259).   Due to the complexity of the T3SS, assembly must be tightly regulated to ensure components are secreted with the correct hierarchy.  After the basal body and export apparatus assemble, the inner rod, needle, tip and translocon subunits are recognized by the export apparatus and secreted through the nascent basal body in an ATP-dependent manner(260).  The translocon proteins bind specialized chaperones in the bacterial cytoplasm, which are presumably required for recognition by the ATPase and subsequent secretion of the translocon protein(261). Needle length is tightly regulated and is suggested to be optimized for contact with the host cell (66).  An accessory protein called the type III specificity switch protein is proposed to regulate needle length by acting as a molecular ruler (67).  In Yersinia, extending the length of the ruler protein by insertion of additional amino acids corresponds to a linear increase in needle length.  After the needle reaches the correct length, subunits that form the translocon complex are secreted.  This step is regulated in part 	   	   	   70	  by a component of the export apparatus called the autoprotease, which has a conserved motif that undergoes self-cleavage via an intein-like mechanism(24).  Mutation this conserved motif to a non-cleaving mutant results in normal secretion of the needle subunits, but diminished translocon secretion (24).  Once the translocon has been correctly assembled at the needle tip, effectors can then be secreted.  The switch from secretion of translocon to effectors is controlled by a protein called the gatekeeper (for gatekeeper nomenclature across species discussed below refer to Table 3.1) (260).   The gatekeeper complex is a key regulatory component of type III secretion, as deletion of the gene encoding the gatekeeper has been shown to attenuate virulence(137).  A ΔsepL mutant of Citrobacter rodentium (an EPEC related mouse pathogen) fails to secrete translocon proteins, form pedestals that are characteristic of attaching/effacing (A/E) pathogens, and has attenuated virulence in mice (137).  SepL binds a protein called SepD, which is also required for regulation of type III secretion(75,79). Generally, deletion of sepL or sepD results in decreased secretion of tip and translocon proteins (EspA, EspB and EspD in EPEC), and increased secretion of effector proteins (75), a trend also observed in deletion of the Salmonella ortholog InvE, and the deletion of Shigella MxiC (although there are conflicting reports on whether translocator secretion is diminished in Shigella) (76,80,82).  In contrast, deletion of the Yersinia ortholog YopN results in constitutive secretion of effector and translocon proteins, suggesting some variability in phenotype between species(262,263).  The mechanism by which the gatekeeper regulates secretion of the translocon and effectors is not well understood; however, the recently characterized interaction between Chlamydia gatekeeper CopN and the translocon chaperone Scc3 have led to a model in which a complex formed by the gatekeeper, translocon chaperone, and translocon is required to form prior to 	   	   	   71	  secretion of the translocon (264).  In other species, such as EPEC, interaction between the gatekeeper and the translocon chaperones has not been observed, which may reflect a weaker affinity or perhaps a variation in mechanism.    Much like effector proteins, the gatekeeper interacts with a specialized chaperone, and in some species, the gatekeeper is secreted into the host cell.  A crystal structure of Yersinia YopN in complex with its heterodimeric chaperone SycN/YscB shows how the extended N-terminal region of YopN wraps around the chaperones(23). In addition to SepD, SepL interacts with a small acidic protein called CesL(265). CesL has limited sequence similarity with the SycN, and the genes encoding SepD and YscB have a conserved position, indicating that CesL and SepD may be orthologous to the heterodimeric chaperones of YopN(265).  While secretion of SepL has not been directly observed, there is evidence that orthologs in Shigella (76) and Chlamydia (266) are secreted.  In fact, the Chlamydia gatekeeper CopN acts as an effector in the host cell cytoplasm and binds directly to αβ-tubulin to prevent microtubule polymerization(267).  This effector-like activity of CopN has yet to be observed in other gatekeeper proteins, and may be a divergent function.   Despite low sequence conservation among orthologs, the overall structure of the gatekeeper is well conserved and may serve as a scaffold.  Crystal structures of the gatekeeper from Shigella (MxiC), Yersinia (YopN/TyeA; the gatekeeper is expressed as two polypeptides, with TyeA orthologous to gatekeeper domain 3), and Chlamydia (CopN) show a conserved architecture of three helical X-bundle domains (described as four helices packed in a coil-coiled arrangement, referred to in (22)(22,23,264,268).  The similarity between domains may indicate a gene duplication event, ultimately increasing the surface area accessible for mediating protein-protein interactions(22). In the structure of YopN in 	   	   	   72	  complex with chaperones SycN/YscB, YopN amino acids 32-75 wrap around the chaperones in an extended conformation, similar to the interaction between the N-terminus of effector proteins and their cognate chaperones(23,86).  In the structure of the CopN/Scc3 complex, Scc3 contacts CopN through two sites, which span the second and third domains of CopN(264).   The gatekeeper likely acts as a scaffold, and may interact with a number of other T3SS components.  Some evidence suggests that the inner rod (MxiI in Shigella) interacts with the second domain of MxiC(77).  The interaction between MxiC and the inner rod may form a physical plug to prevent secretion of effector proteins, disruption of the interaction deregulates effector secretion(77).  Additionally, the third domain of SepL is required for interaction with Tir, a type III secreted receptor required for intimate attachment of A/E pathogens to the host cell (269). The SepL-Tir interaction was shown to be important to delay release of effector proteins(269).  A complete understanding of how protein-protein interactions mediated by the gatekeeper regulate secretion hierarchy has yet to be reached. In this study, we present the crystal structure of a gatekeeper protein from EPEC, SepL.  Like its previously characterized orthologs, SepL consists of three helical X-bundle domains.  In our crystal structure, the linking regions between the SepL domains appear more flexible than the corresponding region in its orthologs, increasing wobble between domains.  This suggests that SepL has more flexibility between domains than its orthologs, or perhaps the linking regions between domains are flexible in all species and the other structurally characterized orthologs were captured in a more rigid conformation in the crystal lattice.  Comparison of SepL to structures of its orthologs allows for identification of conserved residues.  Future studies will be directed towards testing the role of these residues in secretion of translocon and effector proteins in EPEC.    	   	   	   73	  Table 3.1 Nomenclature of the gatekeeper protein. Species  Gatekeeper nomenclature enteropathogenic Escherichia coli, Citrobacter rodentium SepL Shigella MxiC Yersinia YopN/TyeA Salmonella InvE Chlamydia  CopN  3.2 Methods  3.2.1 Cloning, protein expression and purification   DNA encoding SepL residues 70-351 was cloned into pET-28a vector by restriction free cloning to create a construct encoding 10x His tagged SepL (70-351).  DNA encoding the same region of SepL was also cloned into pET-21a vector using restriction free methods to create a construct encoding untagged SepL (70-351).  DNA encoding SepD (6-151) was cloned into pET-28a and pET-21a vectors using restriction free methods to generate constructs expressing 10x His tagged SepD (6-151) and untagged SepD, respectively.    To express native SepL (70-351)/SepD (6-151) complex, pET-28a-SepL (70-351) and pET-21a-SepD(6-151) were co-transformed in BL21 (DE3) Escherichia coli.  Resulting colonies were inoculated into LB-media with 50 µg/mL kanamycin and 100 µg/mL ampicillin, and grown at 37 °C with 200 rpm shaking until an OD600 of 0.6.  Expression was induced with 1mM IPTG at 20 °C over 18 hrs.  Cells were harvested by centrifugation and resuspended in lysis buffer (20mM Hepes pH 7.5, 500 mM NaCl, and 50 mM imidazole, with complete protease inhibitor tablet).  Cells were lysed by French press, and lysates were clarified by centrifugation at 45,000 rpm for 45 minutes.  Lysate was injected over a 1 mL His-Trap column, washed with lysis buffer and eluted with a gradient of elution buffer (20 mM Hepes pH 7.5, 500 mM NaCl, and 500 mM imidazole).  Protein containing fractions 	   	   	   74	  were pooled and dialyzed overnight at 4 °C into buffer (20 mM Hepes pH 7.5, 350 mM NaCl) with added thrombin to remove the His tag.  As a second purification step, protein was injected over a Superdex 200 10/30 column pre-equilibrated in buffer (20 mM Hepes pH 7.5, 350 mM NaCl).  Fractions containing SepL (70-351)/SepD (6-151) were pooled and concentrated to 20 mg/mL.    To prepare selenomethionine protein, M9 media (supplemented with 1 mM MgSO4, 0.1 mM CaCl2, 0.01 mM FeCl3 1mg thiamine and 1% glucose) with 50 µg/mL kanamycin was inoculated with Bl21 (DE3) cells harbouring SepL (70-351)-pET-28, grown to an OD600 of 0.6 and 0.05 g selenomethionine was added per litre of culture.  After thirty minutes, cells were induced with 1mM IPTG and harvested as described above.  N-terminally histagged SepD (6-151) was expressed as described for unlabeled protein, and cells were combined with selenomethionine SepL (70-351) cells.  Both proteins were co-purified and concentrated as described above, including 10 mM TCEP throughout the purification.  3.2.2 Crystallization and data collection   Initially, crystallization conditions were screened by vapour diffusion method with 5mg/mL SepL (70-351)/SepD (6-151) complex and tiny needle-like crystals grew after one day in 3 M NaCl with 0.1 M Tris pH 8.5 buffer.  Optimization of this condition failed to produce diffraction-quality crystals.  Instead, this condition was used as an additive for further screening by microbatch crystallization under oil, using Al’s oil to cover the drop, and paraffin oil to cover the plate. Using ratios of 0.3 ul 20 mg/mL protein, 0.1 ul initial crystal condition (3M NaCl, Tris pH 8.5) and 0.2 ul PACT condition produced cube or thick plate-like crystals in over 30% of PACT conditions after 9-25 days at room temperature.  Crystals were cryo-protected in perfluoropolyether oil and flash frozen in liquid nitrogen.  Crystals 	   	   	   75	  were also grown using 3 M NaBr and 0.1 M Tris pH 8.5 as an additive for an additional phasing strategy.    Multi-wavelength anomalous diffraction data for selenomethionine derived crystals and crystals grown in the presence of NaBr was collected at the Advanced Light Source beamline 5.0.2 at Lawrence Berkeley National Laboratory.  Data sets for the NaBr and selenomethionine derived crystals were processed with xia2, using XDS to index all frames, XSCALE to scale and Aimless to merge (241).  AutoSHARP was used to obtain initial phases for the selenomethionine protein, using peak and inflection data sets, and located six selenomethiones(242). Automatic model building was done with ARP/wARP within autoSHARP. The resulting model was used as a search model for the NaBr derived data using Phenix-MR-SAD (270). Phenix MR-SAD located five bromides using this initial molecular replacement model as a partial solution.  Buccaneer (ccp4 suite) was used for model building(245).   The structure was refined using Coot, Refmac5 and Buster (244-246,271).  Figures were generated using Chimera (247).    3.3 Results  3.3.1 Structural overview of SepL   Originally, SepL (70-351) in complex with SepD (6-151) was set up for crystallization trials.  An initial hit condition produced small spherulite crystals and was then used as an additive for further screening, which produced diffracting cube shaped crystals in multiple conditions.  Data sets were collected on selenomethionine derived crystals and crystals grown in the presence of NaBr.  Starting phases were solved by multiwavelenth anomalous dispersion data from the selenomethionine derived crystal (space group P422) collected at peak and inflection wavelengths.  This model, which contained density for one 	   	   	   76	  copy of SepL in the asymmetric unit, was then used for molecular replacement singlewavelength anomalous dispersion (MR-SAD) phasing of data collected from the crystal grown in NaBr at the NaBr peak wavelength.   This crystal form (space group P43212) had two copies of SepL (chain A and chain B) in the asymmetric unit and has a resolution of 3.2Å.  This structure was refined and used for all other analysis.  Although crystal trials were done with SepL (80-351)/SepD (6-151) complex, the resulting crystals did not contain SepD.  Data collection and refinement statistics are listed in Table 3.2. The resulting model of SepL encompasses residues 80-348 and forms three X-bundle domains (Figure 3.1). Chain A has missing density for residues 196-200 and chain B has missing density for residues 194-199, a region which forms a loop between α-helices 6 and 7.  Chains A and B adopt a similar conformation with a root-mean-square-deviation (r.m.s.d) of 0.461 Å over 259 aligned C-α atoms. The first domain (residues 80-172) consists of five α-helices and an extended loop region encompassing residues 103-125 (Figure 3.1).  The second domain (residues 173-266) and third domain (residues 267-350) also consist of five α-helices.  Each domain is connected by a hinge-like loop (Figure 3.2).  The SepL domains do not align along the same axis, creating curvature in the overall shape of SepL (Figure 3.1). 3.3.2 Comparison of SepL to gatekeeper orthologs   	   Orthologs of SepL from Chlamydia, Shigella, and Yersinia have been structurally characterized, and a DALI search with SepL revealed these orthologs to be the top scoring structural homologs (Table 3.3).  Structurally characterized gatekeeper proteins all have three X-bundle domains with domains 2 and 3 connected by a long central helix (Figure 3.2).   	   	   	   77	  	  Figure 3.1 Structural overview of SepL. SepL X-bundle domains are coloured as blue (domain 1), orange (domain 2) and green (domain 3).  α-helices are labeled 1-15, and N- and C-termini are demarcated.  SepL surface is represented in grey.  The bottom structure is a 90o rotation around the horizontal axis of the SepL structure shown above.  Images were made using SepL chain A.    	  Table 3.2 SepL Data collection and refinement statistics.  NaBr SepL Selenomethionine SepL Data Collection   Space group P43212 P422 Cell dimensions   a, b, c (Å) 84.32, 84.32, 239 78.21, 78.21, 147 α, β, γ(°) 90, 90, 90 90, 90, 90  Peak Peak Inflection Wavelength (Å) 0.92023 0.97943 0.97961 aResolution (Å) 84.32- 3.20  (3.42-3.20) 73.47-3.65(4.00-3.65) 73.47-3.65 (4.00-3.65)  	   	   	   78	   NaBr SepL Selenomethionine SepL Completeness (%) 100.0 (100.0) 99.8 (99.7) 99.8 (99.7) Unique reflections 15064 (2654) 5504 (1266) 5505 (1267) Redundancy 18.5 (19.1) 17.8 (18.6) 17.8 (18.6) I/σ(I) 22.9 (4.6) 18.2 (6.9) 16.0 (4.7) Rmerge 0.116 (0.823) 0.132(0.478) 0.172(0.731) Rpim 0.038(0.270) 0.043(0.156) 0.057(0.240) CC 1/2 0.999(0.959) 0.999 (0.989) 0.999 (0.973) Refinement statistics   bRwork/Rfree 21.6/25.8 This structure was not refined. Number of atoms 4302 Protein 4289 Ligand/ion 5 Water 8 r.m.s.d bonds (Å) 0.015 r.m.s.d. angles (o) 1.94 B-factors (Å2)  Protein  96.28 Water 41.73 Ramachandran Statistics  Favored (%) 92 Allowed (%) 5.7 cOutliers (%) 2.7 aValues in parentheses represent the highest resolution shell bRwork = (ΣΙFobs-FcalcΙ) / ΣΙFobsΙ.  Rfree is calculated from 5% of randomly selected  reflections excluded during refinement. cOutlier residues are located in flexible loop regions with poor electron density  The central helix of SepL is broken into two helical segments, connected by a hinge, as seen also in the central helix region of YopN/TyeA (Figure 3.2). Conversely, the central helix of MxiC and CopN is rigid.  Domains 1 and 2 of SepL are connected by a hinge-like loop, whereas in YopN/TyeA, MxiC and CopN domains 1 and 2 are connected by a kinked helix (Figure 3.2).  The hinge-like regions that connect SepL domains result in wobble between domains, giving SepL a more curved appearance.  MxiC and CopN, appear to have a more rigid structure, and a linear overall shape (Figure 3.2).  The variation in curvature of the gatekeeper structure could represent species-specific differences, or the gatekeepers may 	   	   	   79	  be generally flexible between domains, and the differences seen between species represent “snapshots” of conformations captured during crystallization.  Indeed, the high B-factors of SepL loop regions may be indicative of flexibility in these regions. Table 3.3 Summary of DALI search results for SepL. Name (Species) PDB/Chain z-score r.m.s.d. (Å) Number of residues aligned  Number of residues % ID CopN (Chlamydia) 4P40/A 11.9 4.1 190 288 10 MxiC (Shigella) 2VIX/B 11.0 3.4 183 283 11 TyeA (Yersinia) 1XL3/D 10.9 1.6 79 85 20 YopN (Yersinia) 1XL3/B 7.6 4.8 119 206 13   The gatekeeper likely acts as a scaffold, providing multiple protein-protein interaction sites on each of its three X-bundle domains.  Residues or regions of the gatekeeper implicated in binding a component of the T3SS are noted in Figure 3.2.  SepL has been shown to interact with Tir through its C-terminal domain.  The translocon chaperone Scc3 was shown to interact with two regions of CopN, bridging domains 2 and 3.  MxiC residue F206 (shown in green) located on the surface of domain 2 is required for interaction with the inner rod, and a number of residues (E201, E276, E293 shown in red) form an electronegatively charged surface on domains 2 and 3 are required for regulation of translocon/effector secretion hierarchy in Shigella(77,142).  So far, domain 1 has not been implicated in interaction with any protein.  SepL, like all of the gatekeepers, has one surface more negatively charged than the opposite face, when rotated 180o (Figure 3.3).  It was previously noted that this charged surface may be involved in protein-protein interactions, and mutation of MxiC residues in this region cause premature secretion (22,142) 	   	   	   80	   	  Figure 3.2 Comparison of SepL overall structure to orthologs. Each of the gatekeeper structures consists of three X-bundle domains (schematic).  The helices of domains 2 and 3 on the nearest face of each gatekeeper are collared orange.  The central helix of SepL and YopN/TyeA is broken into two helices by a hinge.  SepL domains 1 and 2 are also connected by hinge, creating more curvature in the arrangement of domains.  The YopN chaperone-binding region is shown in blue.  Regions of the gatekeepers proposed to interact with T3SS components are marked and labeled.  PDB codes: YopN/TyeA, PDB 1XL3 (23), PDB 1XKP(23); MxiC, PDB 2VJ5 (22); CopN, PDB 4P40 (268).    	   	   	   81	   Figure 3.3 Surface charge of gatekeeper orthologs. Electrostatic surfaces of the gatekeeper orthologs were calculated using Chimera and displayed in a red-white-blue scale (red is negatively charged, blue is positively charged).  PDB codes: YopN/TyeA, PDB 1XL3 (23); MxiC, PDB 2VJ5 (22); CopN, PDB 4P40 (268).   While the gatekeeper proteins have a conserved X-bundle domain structure, they have low overall sequence identity (Table 3.3), with only three residues (out of ~280 SepL residues) absolutely conserved among the structurally characterized gatekeepers. Comparison of SepL domains 2 and 3 to the corresponding domains of CopN, YopN/TyeA and MxiC reveal three notable areas of sequence conservation (Figure 3.4).  One region corresponds to the binding site of the translocon chaperone (as identified in the CopN/Scc3 structure) located at the loop region connecting SepL α14 and α15 (Figure 3.4, top inset).  An absolutely conserved arginine (SepL Arg333), required for binding of CopN to Scc3, and the neighbouring Phe237 is within this region.  Domain 3 has an additional region of sequence 	   	   	   82	  conservation, located in the loop connecting α12 and α13, as well as the surface of α15.  Here a bulky hydrophobic residue (SepL Trp288) is surface exposed on the loop between α12 and α13.  Neighbouring conserved residues include a methionine (Met339), asparagine (Asn335), and two negatively charged residues (SepL Glu331, Thr290).  Domain 2 has one region of sequence conservation surrounding an absolutely conserved tyrosine (SepL Tyr188) on α7.  Interestingly, in MxiC, CopN, and YopN/TyeA, this region is located within a cleft formed between domains 1 and 2, whereas in SepL, due to the position of domain 1 relative to domain 2, this conserved tyrosine is more accessible.  Tyr188 is situated near a conserved aspartate and phenylalanine, both on the same side of α9.  A loop connecting α7 and α87 has two conserved negatively charged residues (Ser201 and Asp248) and α7 also has a conserved surface exposed glutamine (SepL Gln182).  Domain 1 has the least sequence conservation among all domains, and we failed to find any significant regions of conservation localizing to the protein surface.     	   	   	   83	  	  Figure 3.4 Structural alignment of SepL domains 2 and 3 with gatekeeper orthologs. Alignment of SepL (cyan) domain 3 with the corresponding region of MxiC (purple), CopN (orange) and TyeA (yellow) is shown in the top and middle panel.  Top inset- An absolutely conserved arginine required for interaction of CopN with the translocon chaperone and conserved surrounding residues are shown.  Labeled residues use SepL numbering.  Middle inset- conserved residues in domain 3 are shown as sticks. The bottom panel shows alignment of SepL with domain 2 of gatekeeper orthologs.  Bottom inset- An absolutely conserved tyrosine and surrounding conserved residues are shown as sticks.  PDB codes: YopN/TyeA, PDB 1XL3 (23); MxiC, PDB 2VJ5 (22); CopN, PDB 4P40 (268).   	   	   	   84	  3.4 Discussion   In this study, we have structurally characterized the T3SS gatekeeper protein from EPEC, called SepL.  Despite low sequence identity, SepL has an architecture similar to its structurally characterized orthologs with three helical X-bundle domains(22,23,264,268).  Additionally, like its orthologs, SepL has one surface that is electronegatively charged, a region proposed to be important for facilitating protein-protein interactions(22).  SepL domains are connected by flexible loops, creating a flexible hinge-connection between domains.  As a result, SepL has significant wobble between domains, giving the overall structure a curved appearance.  Domains of SepL orthologs are connected by rigid or kinked helices, resulting in a more linear or rigid alignment of domains.  These variations in flexibility between domains may reflect true species-specific differences.  Alternatively all gatekeeper proteins may have flexible connections between domains and variations seen in the crystal structures could represent different conformations trapped by crystallization conditions and crystal lattice contacts.  Structure based alignment of SepL to orthologs CopN, MxiC and YopN/TyeA reveal three regions of sequence conservation across domains 2 and 3.  One conserved region in domain 3, which includes an absolutely conserved arginine, has been shown to be required for interaction with the translocon chaperone Scc3 in Chlamydia(264).  While the interaction between the Chlamydial gatekeeper CopN and the translocon chaperone Scc3 has been structurally characterized, we have yet to observe an interaction between SepL and the corresponding translocon chaperone in EPEC.  An interaction between SepL and translocon-specific chaperones may not have been observed due to a weaker affinity, or perhaps additional proteins (such as the translocon proteins) are required for interaction to occur.  	   	   	   85	  Testing the effect of mutation of the conserved SepL Arg333 could provide evidence as to whether this chaperone-binding region of CopN is functionally conserved in SepL.  Another interesting region of sequence conservation in the third gatekeeper domain surrounds a conserved bulky hydrophobic residue (Trp288), which is located in a surface exposed loop between α12 and α13.  To our knowledge, mutation of this residue has not been tested in any SepL orthologs.  Due to the proximity to the translocon chaperone binding site on domain 3, this region may contact the translocon, when it is bound to its specific chaperone.  Finally, a conserved tyrosine is located in α7 of domain 2.  This tyrosine (SepL Tyr188) is surrounded by a conserved aspartate and alanine on the opposing α9.  Interacting partners of the gatekeeper domain 1 have not yet been identified.  The sequence, and also structure of domain 1 is much less well conserved than the other domains (78), which may indicate a divergence in binding partners between species.  SepD, which has been shown to interact with SepL and is critical for regulation of hierarchy translocator and effector secretion (75), likely interacts with domain 1 and/or 2 of SepL (269).  If SepD is indeed a chaperone, orthologous to the Yersinia gatekeeper chaperone YscB, it would be expected to interact with the extended N-terminal region of SepL.  However, this region of SepL (residues 1-69) is not required for interaction with SepD, suggesting that SepD binds SepL through a different interface.   In order to understand how the gatekeeper regulates secretion hierarchy of translocon proteins and effectors, a more detailed knowledge of how various components binds to the scaffolding domains of the gatekeeper will be required.  The challenge in characterizing these interactions is the seemingly weak affinity of the gatekeeper to binding partners.  In Chlamydia (but not in other species), interaction between the gatekeeper and translocon 	   	   	   86	  chaperone can be observed between purified proteins, perhaps due to an extended region of the translocon chaperone Scc3 that provides additional surface area for interaction that is not present in orthologs (264).  In Salmonella, the gatekeeper only binds chaperone/translocon complex, and not empty chaperone(82).  Likely, the interactions between the gatekeeper and its binding partners are weak and transient, as they must assemble and disassemble prior to secretion.  Alternatively, interaction may require multiple binding partners, such as the case in Salmonella(82).  It is likely that characterization of SepL binding interactions will require structure-based mutational analysis to test the effect on function, as identification of interactions between purified recombinant proteins have proven difficult, perhaps due to weak interactions or the requirement of additional unknown partners.   Deletion of the gatekeeper has varying phenotype between species.  In EPEC the phenotype for ∆sepL or ∆sepD mutants is very striking(75).  These EPEC mutants fail to secrete translocator proteins (EspA, EspB, and EspD) and have increased secretion of effector proteins(75).  In Shigella, there is conflicting data for the ∆mxiC phenotype.  One study found that ∆mxiC does not affect secretion of translocators, but does increase secretion of effectors(76), whereas another found that ∆mxiC did have diminished secretion of translocators(80).  In Yersinia, deletion of YopN or TyeA results in increased expression of effectors and translocators(262,263).  Because of the clear phenotype of the EPEC ∆sepL mutant, mutational analysis of SepL can provide information on whether the mutant affects translocon secretion, effector secretion or both.  Mutational analysis of SepL could potentially help determine which domains are required to prevent premature secretion of effectors, to facilitate translocon secretion, and to interact with SepD.  	   	   	   87	  In summary, the crystal structure of SepL, although quite similar to its structurally characterized orthologs, will be useful for structure-based mutational analysis.  The EPEC ∆sepL mutant has been well characterized, and can be efficiently complemented with SepL(75,137).  The clear phenotype of the ∆sepL mutant may be instrumental is assigning a particular function to each SepL domain.  Based on our structural comparison to CopN, MxiC and YopN/TyeA, future studies will focus on mutation of the conserved SepL residues Tyr188, Trp288 and Arg333 to test their function in translocator and effector secretion, as well as interaction with SepD.                       	   	   	   88	  4 Structure of Salmonella effector protein SopB in complex with host Cdc42  4.1 Introduction 	   Salmonella enterica is a Gram-negative bacterium that causes typhoid fever and gastroenteritis.  Typhoid fever resulted in ~22 million illnesses and 200,000 deaths during 2000(272), while Salmonella induced gastroenteritis results in an estimated 93.8 million illnesses and 155,000 deaths each year(273).  Such numbers emphasize the importance of understanding the molecular mechanisms of Salmonella pathogenesis.  Salmonella gains entry into human host phagocytic and intestinal epithelial cells by secreting virulence effector proteins into the host cytoplasm via a T3SS(274).  Inside the host cell, Salmonella delivers additional effector proteins via a second distinct T3SS and creates a replication niche termed the Salmonella containing vacuole (SCV). SopB (also known as SigD) is a T3SS secreted Salmonella effector protein that contains a GTPase binding domain (residues 117-168) and a phosphoinositide phosphatase domain (residues 357-561). Upon T3SS-mediated delivery of SopB into host cells, the phosphoinositide phosphatase domain promotes host membrane fission by hydrolysis of phosphatidylinositol- 4, 5-bisphosphate [PI(4, 5)P2], a process that facilitates bacterial entry (275).  Subsequently, SopB is multi mono-ubiquitinated and translocated to the SCV (276,277), where SopB phosphatase activity is proposed to help prevent lysosomal degradation of the bacteria by reducing the negative surface charge of the SCV(278).   The potential function of the SopB GTPase binding domain was suggested when phosphatase deficient SopB R468A expressed in yeast interfered with actin dynamics(279), cell cycle progression and MAP kinase signalling through direct interaction with yeast Cdc42 (280).  Cdc42 is an essential Rho GTPase that regulates cytoskeleton organization and membrane trafficking during cell motility, proliferation, and cytokinesis in eukaryotes 	   	   	   89	  (281,282).  Active Cdc42 (GTP bound) and inactive Cdc42 (GDP bound) differ in conformation in the flexible regulatory regions, switch I and II (Figure 4.2A)(195).  Downstream host effector proteins such as PAK serine threonine kinases(283)  and the Wiscott-Aldrich Syndrome protein (WASP)  (284)recognize and bind the switch regions of active Cdc42 and this interaction subsequently alters the signalling activity of the host effector (Figure 4.2B)(195).   The interaction of the Salmonella SopB virulence effector with Cdc42 was delineated by stable isotope labelling of amino acids in cell culture (SILAC) mass spectrometric analysis in mammalian cells with the resulting Cdc42 binding region (residues 117-168) shown to down-regulate Cdc42-dependent signalling(280,285).  SopB binds specifically to Cdc42 and no other related GTPases(285).  SopB binds both active and inactive Cdc42 and this interaction is important for translocation of SopB to the SCV(286).  Furthermore, disrupting interaction between SopB and Cdc42 during a Salmonella invasion assay reduces the efficiency of Salmonella replication within the SCV(286).     Cdc42 is also targeted by Salmonella effector proteins SopE (and its paralogue SopE2) and SptP.   SopE/E2 mimic eukaryotic guanine exchange factors (GEFs) to catalyze the exchange of GDP for GTP and activate Cdc42 and Rac1, a closely related Rho GTPase, to drive actin cytoskeleton assembly (Figure 4.2B)(198,287).  SptP inactivates Cdc42 and Rac1 by mimicking a GTPase activating protein (GAP) and catalyzing hydrolysis of GTP to GDP by Cdc42 and Rac1 (Figure 4.2B)(288).  The structures of SopE in complex with Cdc42 and SptP in complex with Rac1(185,187) have been solved, but a lack of structural information for SopB has impeded analysis and understanding of its interaction with and modulation of Cdc42. 	   	   	   90	  Here we present the crystal structure of the N-terminal GTPase-binding domain of SopB in complex with its host target, Cdc42.  This structure shows that SopB contacts Cdc42 by mimicking a eukaryotic CRIB (for Cdc42 and Rac-interactive binding)-like motif, which was previously unidentified due to a lack of sequence conservation.  This is the first time a bacterial effector protein has been shown to contact a Rho GTPase through a CRIB-like motif.  Furthermore, our structure shows that SopB mimics key interactions between Cdc42 and host guanine dissociation inhibitor (GDI), a regulatory protein that sequesters Cdc42 in the inactive state by preventing exchange of GDP for GTP.  In vitro nucleotide exchange assays confirm that the N-terminal domain of SopB slows intrinsic Cdc42 nucleotide exchange, as well as Cdc42 nucleotide exchange catalyzed by the Salmonella GEF, SopE.    4.2 Methods 4.2.1 Isothermal titration calorimetry 	   Isothermal titration calorimetry was done using an iTC200 (MicroCal GE Healthcare).  Cdc42 and SopB(29-181) were each expressed in E. coli BL21 (DE3) cells and purified from cell lysate by injection over a 1mL His-trap column (GE) and a Superdex 75 26/60 column (GE).  Protein samples were dialyzed into 20 mM Hepes pH 7.5 with 50mM NaCl.  The concentration of SopB(29-181) and Cdc42 were determined by Bradford assay. SopB(29-181) was concentrated to 774 µM and 19 aliquots of 1 µl were injected into the ITC cell containing 94.7 µM Cdc42.  Titration experiments were repeated in triplicate.  The dissociation constant was determined by fitting the raw data to a bi-molecular interaction model.    	   	   	   91	  4.2.2 Static light scattering 	  SopB(29-181)/Cdc42 complex was expressed and purified (described below) and concentrated to 2 mg/ml.  The protein complex (100 µl volume) was injected over a Superdex 75 10/300 GL column (GE) and analyzed by miniDAWN multiangle static light scattering device (Wyatt Technologies) and ASTRA program.   4.2.3 Analysis of SopB and Cdc42 interaction by gel filtration 	   SopB(29-181), SopB I49A(29-181) and Cdc42 were expressed and purified (as described below).  Protein was concentrated to 2mg/ml and injected over a Superdex 75 10/30 column (GE) for gel filtration analysis.  To determine the effect of the SopB I49A point mutation on interaction with Cdc42, WT SopB(29-181) and SopB I49A(29-181)  (2mg/ml) were incubated with Cdc42 (2mg/ml) on ice for 1 hr and then injected over a Superdex 75 10/30 column (GE) for gel filtration analysis. 4.2.4 Cloning of genes into expression constructs, purification and crystallization 	   Cdc42 with a deletion of seven C-terminal amino acids (Cdc42(1-183)) was amplified from Homo sapiens cDNA and cloned into pET 28 vector (Novagen) with restriction sites NdeI and SacI. Residues 29-181 of SopB were amplified from Salmonella typhimurium DNA and cloned into pET-21 vector (Novagen) with restriction sites NdeI and Sac1.  Expression constructs pET-28 with N-terminal 6x his-tagged Cdc42(1-183) and pET-21 SopB(29-181) were co-transformed into Escherichia coli BL21 (DE3) cells.  Cells were grown in LB medium with 50µg/ml kanamycin and 100µg/ml ampicillin to an O.D 600 of 0.6 and expression of Cdc42 and SopB(29-181) was induced with 1 mM IPTG for 20 hours at 20 oC.  Cells were harvested by centrifugation, re-suspended in buffer with 20 mM Hepes pH 7.5, 300 mM NaCl and 50 mM imidazole and lysed by French press.  The cell suspension was 	   	   	   92	  centrifuged at 45,000 rpm for 1 hour and supernatant was filtered and injected onto a 1ml His-trap column (GE Health Sciences).  The column was washed with buffer (20 mM Hepes pH 7.5, 300 mM NaCl, 50 mM imidazole) and his-tagged Cdc42 and bound SopB(29-181) were eluted with elution buffer (20 mM Hepes pH 7.5, 300 mM NaCl, 500 mM imidazole).  Fractions containing the protein complex were concentrated and further purified by gel filtration with a Superdex 75 26/60 column (GE Health Sciences) in 20 mM Hepes pH 7.5, 300 mM NaCl.  The final yield of protein was 100 mg of purified SopB(29-181) and Cdc42 complex for 2 L of bacterial culture.  Protein was concentrated to 12 mg/ml for crystallization trials.  The SopB(29-181) and Cdc42 complex was crystallized using the sitting drop vapour diffusion method by mixing 0.5 µl of 12 mg/ml protein solution with 0.5µl of well solution, 0.2M Sodium chloride, 0.1 M Phosphate-citrate pH 4.2, 20% (w/v) PEG 8000 (JCSG+ suite, Qiagen).  The crystals were diamond-shaped and appeared after 14 days at 4 oC. 4.2.5 Data collection, structure determination and refinement 	   Crystals were cryo-protected in a solution of mother liquor with 20% glycerol and flash frozen in liquid nitrogen.  Crystals were screened at the CMCF-2 of the Canadian Light Source and diffracted to 2.25 Å resolution.  The crystals were space group P43212 and had cell dimensions of 106.7 x 106.7 x 87.5 Å.  Data was reduced and scaled using MOSFLM (289) and SCALA(290).  The phases of the SopB(29-181)/Cdc42 complex were solved by molecular replacement using Phaser_MR (270), with the search model Cdc42-GDP (PDB 1AN0). COOT(291) was used to perform model building and the model was refined with REFMAC5(246) from the CCP4 suite and Phenix(292) .  Ligand and ion atoms were refined at an occupancy of one.  The structure was analyzed using Molprobity(293)  with 96.7%, 	   	   	   93	  3.3%, and 0% of residues in the favourable, allowed and disallowed regions of the Ramachandran plot. The SopB/Cdc42 structure was deposited in the Protein Data Bank (4DID). Figures were generated by PyMOL(294). 4.2.6 Cdc42 nucleotide exchange assay 	   Cdc42 nucleotide exchange assay was adapted from reference (295).  Cdc42 was pre-loaded with a fluorescent GDP analogue, N-methanylanthraniloyl (Mant) –GDP, by incubating 100 µM Cdc42 with 500 µM Mant-GDP in buffer (20 mM Tris pH 8.0, 150 mM NaCl, 5 mM EDTA, 1 mM DTT) at 37 oC for 30 minutes.  The reaction was transferred to ice and stopped by addition of 10 mM MgCl2.  A de-salting column (GE Healthcare) was used to remove free Mant-GDP and exchange the Mant-GDP loaded Cdc42 into reaction buffer (20 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgCl2). Mant-GDP loaded Cdc42 was diluted with reaction buffer at a final concentration of 2.5 µM.  To initiate nucleotide exchange, unlabelled GTP was added to Mant-GDP loaded Cdc42 at a final concentration of 500 µM.  The intrinsic exchange rate was measured by exciting Mant-GDP at 355 nm and monitoring emission at 448 nm.  The fluorescence intensity at 448 nm decreases as Mant-GDP is released from Cdc42 into solution. To determine the effect of SopB on nucleotide exchange rate, 2.5 µM mant-GDP loaded Cdc42 was incubated with a 1.5 M or 3 M excess of SopB(29-181) in buffer (20 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgCl2) for 10 minutes on ice.  The exchange reaction was initiated by addition of 500 µM GTP and measured as described above.   Each reaction was repeated in three independent experiments and the mean value of relative fluorescence was plotted versus time.  Standard deviation from the mean was calculated in Microsoft excel and is represented by error bars.   The SopE catalyzed nucleotide exchange reactions were prepared and measured as described above.   GTP was 	   	   	   94	  added to reaction mixture and measurements were recorded for thirty seconds.  The spectrophotometer as paused as SopE was added to the reaction at a final concentration of 25 nM and measurements resumed immediately after.        4.3 Results 4.3.1 Biochemical analysis and crystallization of bacterial SopB and host Cdc42 complex 	  To determine how the SopB N-terminal domain binds Cdc42 to down-regulate activity, SopB(29-181) in complex with Cdc42 bound to GDP (Kd of 6 µM ±  2µM as determined by ITC analysis; Figure 4.1A) was co-purified for crystallization.  SopB(29-181) and Cdc42 formed a 1:1 complex (as determined by static light scattering; Figure 4.1B) and yielded crystals that diffracted to 2.25 Å resolution (1 complex in the asymmetric unit; Table 4.1).   Density could be observed for residues 45-171 of SopB, and residues 1-179 of Cdc42 as well as its GDP ligand.  SopB consists of a β-strand (β1) that forms an intermolecular β-sheet with Cdc42 and five α-helices (α 1-5), three of which (α2, α 3,and α 4) contact Cdc42 switch I and II regions (Figure 4.2 C,D).  The interface of SopB and Cdc42 forms an area of ~1770 Å2 as calculated by PISA (296).     	   	   	   95	                  Figure 4.1 Analysis of SopB (29-181) binding to Cdc42 by isothermal titration calorimetry and light scattering. A) SopB(29-181) was concentrated to 774 µM and 1 µl aliquots were injected into 94.7 µM Cdc42.  The dissociation constant (Kd) 6 µM ±  2µM was calculated as the mean value of the Kd determined.  Experiments were repeated a minimum of three times and error is represented as standard deviation.  B) Purified SopB(29-181)/Cdc42 complex was analyzed by injection over a Superdex 75 10/300 GL column (GE) followed by static light scattering (Wyatt Technologies).  The complex eluted from the column in a mono-disperse peak and a molecular weight of ~42kDa, corresponding to a 1:1 binding stoichiometry.  4.3.2  SopB contacts host Cdc42 by mimicking a eukaryotic CRIB-like intermolecular β-sheet 	   SopB residues 48-52 and Cdc42 β2 form an intermolecular β-sheet that extends the three-stranded β-sheet of Cdc42 by an additional strand (Figure 4.2C).  SopB residues flanking the intermolecular β-strand interact with Cdc42 α5 and α1 (Figure 4.2C).  Specifically, SopB residue Arg46 side chain forms hydrogen bonds with side chains with Cdc42 α5 residues Asn167 and Glu171.  Additionally, hydrophobic interactions are formed between SopB residues Pro47 and Ile49 and Cdc42 residue Leu174 in α5.  SopB residue Arg53 forms a hydrogen bond with Cdc42 residue Tyr23 in α1.  Furthermore, SopB residues 58-62 form a short α-helix (α1) that packs against the intermolecular β-sheet such that SopB 	   	   	   96	  residues Thr58 and Tyr62 hydrogen bond with Cdc42 residues Ala41 and Thr43, respectively.       Table 4.1 SopB/Cdc42 data collection and refinement statistics. Data collection SopB/Cdc42 Space group P43212 Cell dimensions  a, b, c (Å) 107.00, 107.00, 87.75 α, β, γ (°) 90.0, 90.0, 90.0 Resolution (Å) 45.7-2.35 aCompleteness (%) 99.9 (100) Redundancy 14.5 (14.7) Rmerge 0.081 (0.578) I/σI 18.8 (4.7) Refinement statistics  Resolution (Å) 45.7-2.35 bRwork/Rfree 0.2133/0.2522 No. reflections 405,282 No. atoms  Protein 2,391 Ligand/ion 28/1 Water 116 B-factors (Å2)  Protein 45.0 Ligand/ion 35.5/29.8 Water 49.5 r.m.s. deviations  Bond lengths (Å) 0.0230 Bond angles (°) 1.9055 Ramachandran values  Favoured (%) 96.7 Allowed (%) 3.3 aValues in parentheses represent the highest resolution shell bRwork = (ΣΙFobs-FcalcΙ) / ΣΙFobsΙ.  Rfree is calculated from 5% of randomly selected  reflections excluded during refinement.  	   	   	   97	  Eukaryotic effector proteins such as p21-activated kinase (PAK), which couples activation of Cdc42 to cytoskeletal function, and cell migration (297) form an intermolecular β-sheet with Cdc42 β2 and contact Cdc42 α1 and α5 through a CRIB motif with the conserved sequence ISxP(x)2-4FxHxxHV  (Figure 4.3A) (283).  The SopB region (resides 46-53) that forms the intermolecular β-sheet contacts the same regions of Cdc42 (β2, α1 and α5) as the PAK CRIB motif. The canonical CRIB motif is not conserved in SopB except for residue Ile 49, which remarkably superimposes closely with the PAK residue Ile12 (Figure 4.3B).   In both the eukaryotic PAK and Salmonella SopB, this Ile residue contacts Cdc42 Ile46 and an additional Arg46 side chain forms hydrogen bonds with side chains of Cdc42 α5 residues Asn167 and hydrophobic residues contained within Cdc42 α5.  As such, SopB is the first example of a bacterial effector protein that mimics a host CRIB-like interaction to contact and modulate the action of a mammalian Rho GTPase, despite lacking the identifying CRIB sequence motif. This data indicates a key structural role of the Ile residue in the context of Cdc42 binding. This observation is supported by earlier site specific mutagenesis studies(298) of an I75N mutant within the eukaryotic αPAK CRIB that binds Cdc42 with ~3 fold less affinity as well as our gel filtration analysis of a I49A point mutant of SopB that disrupts interaction with Cdc42 (Figure 4.3C).  	   	   	   98	  	  Figure 4.2 Overview of Cdc42 (blue) structure and interaction with GTPase binding domain of SopB (orange). A) Ribbon structure of GDP bound Cdc42 (PDB 1AN0). The regulatory switch regions of Cdc42 (cyan) interact with host effector proteins. B) Cdc42 activity is regulated by GEFs, GAPs and GDIs.  Active GTP bound Cdc42 turns on numerous effector proteins to regulate cytoskeleton organization, cell cycle control, cellular trafficking and proliferation.  C) The amino-terminal strand of SopB (labelled as β1; orange) forms an intermolecular β-sheet with β2 of Cdc42 (blue) and contacts Cdc42 α1 and α5.  Bound GDP nucleotide (yellow) is shown in stick representation and magnesium is represented by a red star.  Interacting amino acids are shown as sticks in the insert below. D) SopB helices α2, α3, and α4 insert between switch 	   	   	   99	  I and II of Cdc42.  SopB residues and Cdc42 switch residues that interact are shown as sticks in the insert below.  A magnesium ion (red sphere) coordinates GDP nucleotide (yellow; shown in stick representation) and two water molecules (blue spheres). 	  Figure 4.3 SopB contacts Cdc42 through a CRIB-like motif that contains an Ile residue conserved with eukaryotic Cdc42 effector proteins. A) Eukaryotic Cdc42 effector proteins Par6 (PDB 1NF3 (299)), WASP (PDB 1CEE (284)) and PAK6 (PDB 2ODB) contain a CRIB domain that forms an intermolecular β-sheet with Cdc42 β2. B) SopB (orange) lacks a conserved CRIB motif except for residue Ile49, which superimposes with the CRIB Ile residue of eukaryotic effector proteins such as PAK6 Ile12 (green; PDB 2ODB) to contact Cdc42 (blue).  C) Gel filtration analysis of binding of SopB (residues 29-181) to Cdc42 after mutagenesis of a SopB Ile residue (I49A) that is conserved with the CRIB Ile of eukaryotic Cdc42-binding effector proteins.   SopB I49A with Cdc42 (purple) elutes later on the gel filtration profile than WT SopB with Cdc42 (green), indicating that Ile49 is important for interaction with Cdc42.  Corresponding elution fractions from WT SopB + Cdc42 (top) and SopB I49A + Cdc42 (bottom) are shown beside the gel filtration profile. 4.3.3 SopB contacts key Cdc42 regulatory switch residues to mimic a Rho GDI  	   SopB helices (α2, α3, and α4) insert between Cdc42 regulatory loop regions, switch I and II (residues 26-45 and 59-74, respectively) (Figure 4.2D).  When our structure of Cdc42 in complex with GDP and SopB is superimposed with that of Cdc42 in complex with GDP 	   	   	  100	  (PDB 1AN0), the overall structure of Cdc42 is similar (average r.m.s.d. of 1.5 Å on 179 Cα atoms).  However, our comparison shows there is a localized change in conformation of the Cdc42 switch I (r.m.s.d. of 2.5 Å on Cα atoms of residues 26-45) and that it is the SopB interaction with Cdc42 Val36 that is predominantly responsible (Figure 4.2D; Figure 4.4A). Significantly, our observed conformation of Cdc42 switch I in complex with GDP and Salmonella SopB is similar to that of Cdc42 switch I in complex with GDP and human Rho GDI, an inactivator of Cdc42 activity (Figure 4.1B).  At switch I, the main contacts between Cdc42 and SopB is a hydrogen bond between the hydroxyl group of SopB residue Ser100 and the main chain carbonyl of Cdc42 residue Val36 and van der Waals interactions between SopB residue Val97 and the side chain atoms of Cdc42 Thr35. In addition, the main chain carbonyl of Cdc42 switch I residue Thr35 and the terminal phosphate group of GDP are coordinated by magnesium.  Similarly, in the human Rho GDI, a serine residue contacts Cdc42 Val36, and the main chain carbonyl of Cdc42 Thr35 and the terminal phosphate group of GDP are coordinated by magnesium (300).  Additional observations from our data show that in the presence of SopB, Cdc42 switch I residue Phe37, which is solvent exposed in Cdc42-GDP, is reoriented to a hydrophobic pocket that Tyr40 occupies in the Cdc42-GDP structure (Figure 4.4A).  This flip of Phe37 also occurs when Rho GDI is bound to Cdc42 (Figure 4.4B) (300).  Collectively, our structure shows that Salmonella SopB mimics several contacts between host Rho GDI and Cdc42 to reposition Cdc42 switch I residues such that Thr35 forms a coordination network with magnesium and GDP, an interaction that prevents dissociation of bound nucleotide from Cdc42 (300,301).  	   	   	  101	  	  Figure 4.4 When Cdc42 is bound to SopB the conformation of Cdc42 switch I residues aligns with the conformation of Cdc42 switch I residues when bound to human RhoGDI, and the GTP activity of Cdc42 is down-regulated. A) Alignment of Cdc42 switch I (blue) when bound to SopB and Cdc42 switch I (grey) in the absence of SopB (PDB 1AN0).  Both Cdc42 structures contain GDP (yellow). B) Alignment of Cdc42 switch I (blue) when bound to SopB with Cdc42 switch I (grey) when bound to Rho GDI (PDB 1DOA (300)).  C) Intrinsic Cdc42 nucleotide exchange was monitored by measuring change in emitted fluorescence when mant-GTP is exchanged for unlabelled GTP.  SopB was added in excess to the nucleotide exchange assay and the change in fluorescence was measured.   SopE catalyzed Cdc42 nucleotide exchange was measured as for intrinsic Cdc42 nucleotide exchange.  The experiment was repeated with SopB I49A.  The arrow indicates the addition of SopE to the reaction mix.  Experiments were repeated in triplicate and error bars represent standard error. Our structural data also shows that SopB makes extensive contacts with Cdc42 switch II; however, the conformation of switch II in our structure is similar to that of Cdc42 in complex with GDP (r.m.s.d. of 0.6 Å on Cα atoms of residues 59-74), suggesting that SopB uses switch II as an anchoring point to further facilitate binding.  SopB α2, α3, and α4 form a helical bundle with a hydrophobic groove composed of several leucine residues (Leu84, 	   	   	  102	  Leu98, Leu127, Leu131, Leu134) that contact Cdc42 switch II residues Leu67 and Leu70 (Figure  4.5). SopB mutant L84P has previously been shown to disrupt SopB binding to Cdc42 (286). These interactions are complemented by additional polar interactions (Figure 4.2D).  Like host Rho GDI and the GDI domain of the Yersinia effector YpkA (301), two SopB residues, Arg138 and Asp95, hydrogen bond to the hydroxyl group of switch II residue Tyr64.  Two salt bridges are formed between SopB residues Lys111 and Arg138 and switch II residues Asp76 and Arg138, respectively.  SopB residue Gln104 contacts switch II residue Asp57, which is also coordinated in Rac1 by YpkA.  	  Figure 4.5 SopB leucine residues form van der Waals contacts with Cdc42 switch II residues Leu67 and Leu70. SopB leucine residues, Leu84, Leu98, Leu131, Leu134 (orange) form van der Waals contacts with Cdc42 switch II residues Leu67 and Leu70 (blue). A similar set of interactions is also observed when eukaryotic Rho GDI (PDB 1DOA) binds Cdc42. 4.3.4 SopB prevents Cdc42 nucleotide exchange in vitro 	   To support our observation that SopB structurally mimics Rho GDI, we used an in vitro nucleotide exchange assay to test whether SopB(29-181) can slow dissociation of bound 	   	   	  103	  GDP from Cdc42 and subsequent exchange for GTP (Figure 4.4C).  Our data show that SopB significantly decreases the rate of in vitro intrinsic Cdc42 nucleotide exchange in a dose dependent manner.  In addition, we tested whether SopB slows nucleotide exchange in the presence of the potent Salmonella GEF, SopE. As seen with the intrinsic nucleotide exchange reaction, SopB slows the rate of Cdc42 nucleotide exchange catalyzed by SopE (Figure 4.4C).  To test whether the SopB mutant I49A can still inhibit Cdc42 nucleotide exchange, we repeated the intrinsic and catalyzed Cdc42 exchange assay with SopB I49A.  SopB I49A could inhibit nucleotide exchange at levels similar to wild type SopB for the intrinsic exchange assay.  However, in the presence of the potent GEF SopE, the SopB I49A mutation significantly decreased the ability of SopB to inhibit nucleotide exchange.    4.4 Discussion 	   Rho GTPases regulate a multitude of cellular processes such as cytoskeleton organization, cell division and cell motility (302).  Members of the Rho GTPase family (for example Cdc42, Rac1 and RhoA) are low molecular weight proteins containing two flexible regulatory switch regions, termed switch I and II, that bind and hydrolyze GTP.  As the name implies, they function as molecular switches, which are active in the GTP-bound state and inactive in the GDP-bound state (302).  Cycling between the active and inactive state causes a change in conformation at the switch regions critical to function.  In the active state, Rho GTPases interact with effector proteins, such as kinases, lipases, and oxidases to alter their activity (195).  The activity of Rho GTPases is regulated by: GEFs, which catalyze exchange of GDP for GTP to activate the GTPase; GAPs, which catalyze hydrolysis of GTP to inactivate the GTPase; and GDIs, which prevent dissociation of bound nucleotide to prevent reactivation of the GTPase (302). 	   	   	  104	  Since Rho GTPases play a fundamental role in many cellular processes, they are common targets of bacterial effector proteins and toxins.  While bacterial toxins often inhibit or activate Rho GTPases by irreversible covalent modification (303), Salmonella uses a type III secretion system to deliver multiple effector proteins to the host cell that target specific Rho GTPases and modify their activity in a reversible and temporally regulated (304) manner.  This sophisticated mechanism of Rho GTPase regulation by Salmonella allows the bacterium to manipulate the activity of Rho GTPases at different times post infection and exploit the resulting cellular effect for efficient entry into the host cell (304).  While the interaction between Salmonella effectors SopE and SptP and Rho GTPases Cdc42 and Rac1 have been structurally characterized (185,187), there has been no structural information of the Salmonella effector SopB and its interaction with Cdc42.  Here we have presented the first structure of the Cdc42-binding domain of SopB in complex with Cdc42.  In this model, SopB contacts key Cdc42 switch I and II residues that are also contacted by host Rho GDI (300).  The most notable interaction in this region is a hydrogen bond between SopB Ser100 and the main chain carbonyl of Cdc42 Val36.  This hydrogen bond positions the main chain carbonyl of the neighbouring Cdc42 residue Thr35 to coordinate a magnesium ion, which is also coordinated by the terminal phosphate group of the bound GDP nucleotide.  This coordination network, which is similar to that seen in the complex between Rho GDI and Cdc42 (300), serves to stabilize the bound GDP nucleotide and prevent exchange for GTP.  In vitro nucleotide exchange assays confirm that the GTPase binding domain of SopB can slow intrinsic and SopE catalyzed Cdc42 nucleotide exchange.  The GDI-like activity of the GTPase binding domain of SopB is consistent with the 	   	   	  105	  observation that phosphatase deficient SopB can down-regulate Cdc42 signalling in a yeast model system (280).    Like Salmonella, Yersinia also encodes a T3SS effector protein, YpkA, which mimics a host GDI (301).  The C-terminal GDI domain of YpkA binds to Rac1 and RhoA, but not Cdc42 (286).  Although there is no sequence similarity between the GDI domains of SopB and YpkA, both interact with Rho GTPases by inserting alpha helices between switch I and II and specifically contacting switch I residues Val36 (SopB), and Thr35 (YpkA) so that the magnesium ion coordinates the main chain carbonyl of Thr35 and the terminal phosphate of GDP.   One unexpected feature of the SopB and Cdc42 interaction is the CRIB-like domain of SopB that forms an intermolecular beta sheet with Cdc42.  This region of the complex closely resembles interactions between Cdc42 and eukaryotic effector proteins that contain a CRIB motif, such as PAK (283) and WASP (284), but was not predicted because of a lack of sequence similarity between this region of SopB and the canonical CRIB motif.  However, SopB contains an isoleucine residue that superimposes with a conserved CRIB isoleucine of eukaryotic effector proteins.  This isoluecine is positioned within a hydrophobic pocket on the surface of Cdc42.  The SopB and Cdc42 CRIB-like interaction is not conserved with YpkA(301) as YpkA does not form an intermolecular β-sheet with β2 of Rac1 or RhoA.  This is the first known example of a bacterial effector protein that mimics a CRIB-like domain to contact Cdc42.  In conclusion, our structure shows that SopB contacts Cdc42 with a eukaryotic CRIB-like motif and slows in vitro Cdc42 nucleotide exchange by structurally mimicking key contacts made between human Rho GDI and Cdc42.  The discovery of the GDI-like function 	   	   	  106	  of SopB demonstrates that Salmonella uses a GEF (198,287), GAP (288) and GDI to contact Cdc42, resulting in sophisticated regulation of host Cdc42 signalling.   This is the first time that a pathogenic bacterium has been shown to mimic all three eukaryotic regulators of small GTPases.   	   	   	  107	  5 Summary and future directions  The goal of the research presented in this thesis was to gain a better understanding of assembly and regulation of the T3SS, as well as to characterize the interaction between a type III secreted effector protein and its host target.   We have presented the structure of a peptidoglycan-cleaving enzyme from EPEC and show that interaction with the inner rod component of the secretion system appears to enhance its activity in vitro.  Although EtgA is often referred to as a lytic transglycosylase in the literature, our structure shows that the EtgA active site is remarkably similar to lysozyme, including the presence of an aspartate that aligns with hen egg white lysozyme aspartate 52.  We have also presented the structure of a protein that regulates type III secretion hierarchy in EPEC, called SepL.  Finally, we solved the structure of a Salmonella effector protein, called SopB, in complex with host Rho GTPase Cdc42 and show that SopB mimicks host Rho GDIs to slow Cdc42 nucleotide exchange. 5.1 EtgA  Deletion of EtgA diminishes type III secretion, suggesting that the peptidoglycan-cleaving activity of EtgA is required for assembly(134).  Indeed, many other macromolecular complexes (such as type IV pili or the type II secretion system) that traverse the peptidoglycan layer of Gram-negative bacteria require a dedicated enzyme to clear peptidoglycan.  Activity of a peptidoglycan-cleaving enzyme such as EtgA must be tightly regulated in order to prevent cell lysis.  Some genes encoding macromolecular complex associated PG-cleaving enzymes are fused to genes encoding structural components of the complex, thus ensuring that peptidoglycan is only cleared in the immediate area.  In EPEC, EtgA is secreted by the general Sec-secretion system, and interacts with the inner rod 	   	   	  108	  component of the secretion system, presumably during early stages of assembly.  It remains to be discovered at which step in assembly EtgA interacts with the inner rod.  Does it bind prior to assembly with the secretin?  Or is it feasible for EtgA to interact with the inner rod after association with the secretin?  We show that in vitro, EtgA has marginal activity; however, its activity is greatly enhanced when in complex with the inner rod component EscI.  This way, the interaction with the inner rod may spatially restrict EtgA activity, preventing erroneous degradation of peptidoglycan.  Based on conserved sequence similarity, early literature had suggested that EtgA and its orthologs act as lytic transglycosylases and target the glycosidic linkage between N-acetylmuramic acid and N-acetylglucosamine producing a 1,6-anhydromuramic acid and N-acetyl glucosamine products.  However, comparison of our structure of EtgA to hen egg-white lysozyme reveals an area of the active site that is particularly well conserved with lysozyme.  Remarkably, the β-hairpin region has a conserved aspartate (critical for lysozyme catalysis) that forms a hydrogen-bonding network with a number of other conserved residues (in lysozyme this region forms a platform that packs against N-acetylglucosamine in the D site).  This region of conservation is absent from all characterized lytic transglycosylases.  Mutation of the catalytic glutamate, conserved in lysozymes and lytic transglycosylases, as well as the aspartate and hydrogen-bonding network residues diminishes type III secretion in vivo.  Lysozymes have the same substrate specificity as lytic transglycosylases, but use a hydrolysis mechanism to produce N-acetylglucosamine and N-acteylmuramic acid products.  Is the mechanism of EtgA peptidoglycan cleavage of importance to its role in secretion system assembly?  The evolutionarily related flagella associates with an N-acetylglucosaminidase (called FlgJ in Salmonella), which targets the neighbouring glycosidic linkage to clear peptidoglycan(255).  	   	   	  109	  Lysozymes, lytic transglycosylases and N-acetylglucosaminidases all function to cleave peptidoglycan, but each would leave a different product, and a different chemical environment around the associated macromolecular complex.  The cleaved peptidoglycan products could potentially act as a signal, or serve to recruit or bind secretion system proteins.  Conversely, the variation in activity between the flagellar and T3SS peptidoglycan-cleaving enzymes may simply reflect a different evolutionary acquisition of the enzyme. EtgA is a particularly interesting peptidoglycan-cleaving enzyme as it has conserved lysozyme-like features in its active site (such as the catalytically important aspartate and its surrounding hydrogen-bonding network), as well as a scaffolding region that is structurally similar to and shares sequence conservation with lytic transglycosylases such as Slt70.  Attractive objectives for future experiments include kinetic analysis of EtgA activity, as well as elucidation of EtgA’s mechanism to definitively classify it as a lysozyme or lytic transglycosylase.  However, one of the major challenges in studying activity of peptidoglycan-cleaving enzymes is the lack of a suitable homogeneous substrate.  Initially, in collaboration with the Withers group at the University of British Columbia, EtgA activity was tested using p-nitrophenyl-chitobiose as substrate.  Chitobiose is a dimer of β-1,4-linked glucosamine units and cleavage of the nitrophenyl group causes a colorimetric change that can be monitored over time.  We found that EtgA did not cleave p-nitrophenyl-chitobiose, perhaps because it may require the N-acetylmuramic acid unit of peptidoglycan for substrate recognition, suggesting that future kinetic analysis of EtgA will likely require a more biologically relevant substrate.  EtgA can be classified as a lytic transglycosylase or a lysozyme through identification of its reaction products, as lytic transglycosylases produce 1,6-anhydromuramic acid and lysozymes produce muramic acid.  After incubation of EtgA 	   	   	  110	  with heterogeneous peptidoglycan substrate, disaccharide products can be isolated and identified by high performance liquid chromatography (HPLC) coupled to electrospray ionization mass spectrometry/mass spectrometry (ESI-MS/MS) (255).  In the case that there is a low abundance of product, an alternative strategy to identify EtgA products involves incubating EtgA with peptidoglycan in [18O]H2O to directly label hydrolytic reaction products.  In this case, if EtgA uses a lysozyme-like mechanism, reaction products will contain 18O, which could be identified by mass spectrometry.  Investigating the EtgA reaction mechanism is critical for understanding how EtgA and its orthologs clear peptidoglycan and will also provide clues to the type of chemical environment created by cleaved peptidoglycan ends surrounding the secretion system apparatus.  These peptidoglycan ends could function as a signal or interact with peptidoglycan binding components of the secretion system.  Additionally, cleaved soluble peptidoglycan fragments may be released as a signalling molecule, stressing the importance of understanding EtgA’s mechanism. The initial goal of our work on EtgA was to co-crystallize EtgA with its binding partner, the inner rod subunit EscI, in order to determine how EtgA is tethered to the type III secretion apparatus.  In order to co-purify EtgA/EscI complex, dozens of EscI N- and C-terminal truncation constructs were cloned and expressed, as full length EscI is not soluble.  In fact, neither EtgA nor EscI are stable individually, so co-expression and co-purification seems the best strategy to obtain the complex.  Analysis of EscI/EtgA complex stability by thermal denaturation indicates that it is folded and stable in solution.  We tried a number of strategies to obtain crystals of the complex, such as setting up different protein constructs for crystallization, modifying protein by reductive methylation, as well as varying standard experimental parameters such as protein concentration, buffer conditions, additives, 	   	   	  111	  temperature, and crystallization conditions.  While these crystallization trials were unsuccessful, further screening and tweaking of experimental parameters may eventually allow for crystal growth.  NMR spectroscopy may be another means of obtaining the structure of the EscI/EtgA complex.  Possible limitations of this approach include size of the complex (~24 kDa for the shortest stable constructs), the instability of the individual proteins (which may complicate approaches that involve mixing labeled/unlabeled protein to form the complex), and the requirement of high salt (>0.5 M) for stability of the complex.  Initial HSQC experiments would provide a quick means of assessing the suitability of EtgA/EscI complex for NMR studies. Structural characterization of the inner rod will likely require interaction with another secretion system component, such as EtgA, as it appears at least partially unfolded in isolation(132).  Cryo-EM with a direct electron detector may allow for structural characterization of an EscI filament in complex with EtgA.  A structure of the EtgA/EscI complex would be very valuable, as the inner rod is one of the remaining uncharacterized components of the T3SS, and a structure of the complex would provide insight into how EtgA associates with the T3SS.        5.2 SepL  The EPEC gatekeeper protein SepL plays a critical role in T3SS assembly, as deletion of SepL (or its binding partner SepD) in the closely related mouse pathogen C. rodentium diminishes pedestal formation and virulence in mice(137).  The phenotype of the ΔsepL mutant is quite striking: secretion of translocon proteins (EspA, EspB and EspD) is abrogated, and secretion of effector proteins is increased(75).    This phenotype suggests that SepL promotes secretion of the translocon components, and delays secretion of effector proteins.  Very little is known about the mechanism of how SepL regulates secretion 	   	   	  112	  hierarchy, but our crystal structure of SepL shows that like its structurally characterized orthologs, it consists of three X-bundle domains, which may act as scaffolding domains to mediate protein-protein interactions.  The Chlamydia ortholog CopN has been shown to interact with the translocator chaperone Scc3 through domains 2 and 3, supporting the idea that the gatekeeper regulates secretion through physical interaction with translocator components(264).  So far, we have not been able to identify interactions between SepL and components of the translocon or their dedicated chaperones.  This may reflect a weak affinity (the CopN/Scc3 interface contains an extended region of Scc3 not conserved in other translocator chaperones) or the necessity of additional binding partners.  Sequence conservation between SepL and its orthologs is very low (between 10-13% sequence identity).  Indeed, only three amino acids are absolutely conserved between SepL and its structurally characterized orthologs CopN, MxiC (Shigella) and YopN/TyeA (Yersinia).  However, through structural comparison we were able to identify three SepL regions spanning domains 2 and 3 that are conserved with orthologs.  Structure-based identification of conserved SepL residues will allow mutational analysis in EPEC. Future work on SepL will focus on identification interaction partners in order to better understand how SepL regulates secretion of translocon proteins and effectors.  Mutational analysis of conserved SepL residues may indicate regions that are important for interaction with other T3SS components.  Likely, SepL must interact with translocon/chaperone complexes.  In Salmonella, the gatekeeper only interacts with the translocon when its specific chaperone is present(82).  To our knowledge, interaction between SepL and translocators (EspA, EspD, EspB) in complex with their specific chaperone has never been systematically tested in vitro with purified protein.  Both published(54) and unpublished work from our lab 	   	   	  113	  show that each of the translocators is soluble in complex with its chaperone, suggesting that screening of interactions between SepL and translocator/chaperone pairs is feasible.  A surface plasmon resonance system, such as the Octet system available in our laboratory, will allow fast analysis of interaction between SepL and translocator/chaperone complexes, and also requires little sample.  Identification of SepL interacting partners will provide new targets for structural studies. An objective worth revisiting, and the original goal of our structural studies with SepL, was to crystallize SepL in complex with its known interacting partner, SepD.  A ΔsepD mutant has an identical phenotype to that of ΔsepL, suggesting both proteins are critical for regulation of translocon and effector secretion.  SepD has topology and features typical of a chaperone(265); however, unlike the Yersinia gatekeeper heterodimeric chaperone pair, SepD does not require the unstructured N-terminus of SepL for interaction, suggesting a different mode of interaction. While we extensively screened conditions for crystallization of SepD/SepL (70-351), our initial hit condition only produced crystals of SepL.  Our structural data for SepL suggests that residues 70-79 are disordered in the crystal lattice and that the ideal construct to use for future crystallization studies encompasses SepL residues 80-351.  Using this shorter SepL construct in complex with SepD may improve likelihood of complex crystallization, as the disordered N-terminus of SepL may have prevented growth of other crystal forms.  Another approach for crystallization trials would be to set up SepL (full length) in complex with SepD and CesL (which requires SepL N-terminal 70 amino acids for interaction).  SepL/SepD/CesL were shown to form a complex with a 1:1:1 ratio, whereas SepL/SepD complex exhibits concentration dependent changes in stoichiometry(265). 	   	   	  114	  Structural studies of the SepL/SepD complex will hopefully shed light on the role of SepD, and whether it has a chaperone-like function.    5.3 SopB  The Salmonella effector protein SopB has an N-terminal GTPase binding domain and a C-terminal phosphoinositide phosphatase domain, both of which are required for its activity in the host cell.  The interacting partner of SopB GTPase binding domain was identified as host Cdc42 by stable isotope labelling of amino acids in cell culture (SILAC)(285).  Cdc42 is a small Rho GTPase that regulates many cellular processes such as cytoskeleton organization, membrane trafficking and cell cycle progression.  Two additional Salmonella effectors have been shown to target Cdc42: SopE, a guanine exchange factor (GEF) that activates Cdc42, and SptP, a RhoGTPase activating protein (GAP) that catalyzes hydrolysis of GTP to subsequently inactive Cdc42(185,187).  We solved the crystal structure of SopB GTPase domain in complex with host Cdc42.  SopB forms a helical bundle that inserts between Cdc42 switch I and II regions, which are important for GTPase function.  Comparison of SopB bound Cdc42 to the structure of Cdc42 in complex with host Rho guanine dissociation inhibitor (GDI) shows a conserved structure of Cdc42 switch regions.  Despite a lack of sequence conservation, SopB mimics key contacts made between host RhoGDI and Cdc42 regulatory switch regions, suggesting that SopB may function as a RhoGDI.  We used an in vitro fluorescent nucleotide exchange assay to show that SopB does slow Cdc42 nucleotide exchange, even in the presence of the GEF SopE.  Interestingly, SopB uses a CRIB-like motif to form an intermolecular β-sheet with Cdc42 β2, a mode of interaction also observed between eukaryotic effectors such as PAK and Cdc42(283).  The GDI-like activity of the SopB GTPase binding domain was difficult to predict based on 	   	   	  115	  sequence alone, underscoring the importance of structurally characterizing the SopB/Cdc42 complex.   A curious feature of SopB is its modular architecture: a GDI domain adjacent to a phosphoinositide phosphatase domain.  Modularity is a commonly observed in type III secreted effector proteins, and is proposed to have arisen from the process of terminal re-assortment.  Terminal re-assortment describes a process in which domains evolve independently of each other, and then combine to form a chimeric protein, which ultimately increases effector diversity (305).  It would be interesting to test whether the Cdc42-targeting GDI domain of SopB is required for functionality of its phosphoinositide phosphatase domain during infection.  A previous study concluded that mutation of SopB residues that impair interaction with Cdc42 did not affect the catalytic activity of the phosphatase domain in vivo, based on the observation that these mutants did not significantly alter the overall percentage of host cell PI(4,5)P2, as probed by a fluorescent marker(286).  However, the same study found that disruption of Cdc42/SopB interaction impaired localization of SopB to the Salmonella containing vacuole (SCV) and intracellular Salmonella replication, suggesting that the GDI domain of SopB is important at later stages of infection(286).  It is possible that interaction between Cdc42 and SopB is required for targeting SopB to the SCV, where the phosphoinositide phosphatase domain has been shown to regulate the membrane surface charge by targeting P1(4,5)P2 and phosphatidylserine(278).   Measurement of whole cell levels of PI(4,5)P2 after infection with a impaired Cdc42-interacting SopB mutant may have not been sensitive enough to detect relatively small localized changes of PI(4,5)P2 on the SCV.  In order to assess the effect of SopB/Cdc42 interaction on the phosphatase activity of SopB specifically at the SCV, we could measure co-localizaton of fluorescein labeled WT 	   	   	  116	  Salmonella or a SopB-Cdc42 interacting mutant with a fluorescent marker for PI(4,5)P2 or PS at a time point of 20 minutes post-infection, a method that was described previously(278).   If SopB interaction with Cdc42 is required for efficient functionality of its phosphoinositide phosphatase domain at later stages of infection, it may explain how fusion of the GDI domain to the phosphatase domain conveys an advantage to the bacterium over transporting each functional SopB domain as a single polypeptide.   5.4 Closing summary   The major goal of this thesis was to use a structural approach to improve our understanding of how the T3SS of Gram-negative pathogens assembles and contributes to virulence.  Structural characterization of components that are involved in secretion system assembly, such as the EPEC peptidoglycan-cleaving enzyme EtgA and the gatekeeper protein SepL, allow for structure-based mutation to test the biological importance of conserved residues.  Elucidation of the N-terminal region of the Salmonella effector protein SopB in complex with host RhoGTPase Cdc42 revealed the GDI function of SopB, an activity that could not be predicted from sequence alone, as this GDI domain shares no sequence similarity with eukaryotic GDIs.    The work presented here contributes to the rapidly growing body of research on type III secretion, but in our quest to understand the function and mechanism of this secretion apparatus and its associated effector proteins, new questions arise.  For example, the role of EtgA in assembly of the secretion system apparatus remains ill defined.  We have yet to understand at which stage of secretion system assembly it clears peptidoglycan, and whether its activity acts a signal to recruit peptidoglycan-binding components of the secretion system.  Furthermore, does it remain bound to the inner rod after assembly is complete?  Understanding how this enzyme facilitates assembly will be 	   	   	  117	  particularly valuable, as it has orthologs associated with other types of macromolecular complexes.  Likewise, the mechanism by how the gatekeeper SepL regulates secretion of translocon and effector proteins remains elusive.  Understanding the function of this protein will likely require identification and characterization of possibly weak and transient interactions made between SepL and its targets.  Identification of the GDI activity of SopB’s N-terminal domain underlines the complexity of type III secreted effector proteins, as many effectors possess multiple activities that may act synergistically during infection.  Understanding how a complete set of secreted effector proteins regulates host cell processes overtime will be crucial for delineation of bacterial pathogenesis mechanisms and also serves as a tool to understand biology of the host cell processes are that are targeted by the bacteria.      	   	   	  118	  References 1.	   Abby,	  S.	  S.,	  and	  Rocha,	  E.	  P.	  (2012)	  The	  non-­‐flagellar	  type	  III	  secretion	  system	  evolved	  from	  the	  bacterial	  flagellum	  and	  diversified	  into	  host-­‐cell	  adapted	  systems.	  PLoS	  Genet	  8,	  e1002983	  2.	   Leiman,	  P.	  G.,	  Basler,	  M.,	  Ramagopal,	  U.	  A.,	  Bonanno,	  J.	  B.,	  Sauder,	  J.	  M.,	  Pukatzki,	  S.,	  Burley,	  S.	  K.,	  Almo,	  S.	  C.,	  and	  Mekalanos,	  J.	  J.	  (2009)	  Type	  VI	  secretion	  apparatus	  and	  phage	  tail-­‐associated	  protein	  complexes	  share	  a	  common	  evolutionary	  origin.	  Proc	  Natl	  Acad	  Sci	  U	  S	  A	  106,	  4154-­‐4159	  3.	   Michiels,	  T.,	  Vanooteghem,	  J.	  C.,	  Lambert	  de	  Rouvroit,	  C.,	  China,	  B.,	  Gustin,	  A.,	  Boudry,	  P.,	  and	  Cornelis,	  G.	  R.	  (1991)	  Analysis	  of	  virC,	  an	  operon	  involved	  in	  the	  secretion	  of	  Yop	  proteins	  by	  Yersinia	  enterocolitica.	  Journal	  of	  Bacteriology	  173,	  4994-­‐5009	  4.	   Salmond,	  G.	  P.,	  and	  Reeves,	  P.	  J.	  (1993)	  Membrane	  traffic	  wardens	  and	  protein	  secretion	  in	  gram-­‐negative	  bacteria.	  Trends	  in	  biochemical	  sciences	  18,	  7-­‐12	  5.	   Galan,	  J.	  E.,	  and	  Curtiss,	  R.,	  3rd.	  (1989)	  Cloning	  and	  molecular	  characterization	  of	  genes	  whose	  products	  allow	  Salmonella	  typhimurium	  to	  penetrate	  tissue	  culture	  cells.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  86,	  6383-­‐6387	  6.	   Altmeyer,	  R.	  M.,	  McNern,	  J.	  K.,	  Bossio,	  J.	  C.,	  Rosenshine,	  I.,	  Finlay,	  B.	  B.,	  and	  Galan,	  J.	  E.	  (1993)	  Cloning	  and	  molecular	  characterization	  of	  a	  gene	  involved	  in	  Salmonella	  adherence	  and	  invasion	  of	  cultured	  epithelial	  cells.	  Molecular	  microbiology	  7,	  89-­‐98	  7.	   Galan,	  J.	  E.,	  Ginocchio,	  C.,	  and	  Costeas,	  P.	  (1992)	  Molecular	  and	  functional	  characterization	  of	  the	  Salmonella	  invasion	  gene	  invA:	  homology	  of	  InvA	  to	  members	  of	  a	  new	  protein	  family.	  Journal	  of	  Bacteriology	  174,	  4338-­‐4349	  8.	   Kaniga,	  K.,	  Bossio,	  J.	  C.,	  and	  Galan,	  J.	  E.	  (1994)	  The	  Salmonella	  typhimurium	  invasion	  genes	  invF	  and	  invG	  encode	  homologues	  of	  the	  AraC	  and	  PulD	  family	  of	  proteins.	  Molecular	  microbiology	  13,	  555-­‐568	  9.	   Shea,	  J.	  E.,	  Hensel,	  M.,	  Gleeson,	  C.,	  and	  Holden,	  D.	  W.	  (1996)	  Identification	  of	  a	  virulence	  locus	  encoding	  a	  second	  type	  III	  secretion	  system	  in	  Salmonella	  typhimurium.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  93,	  2593-­‐2597	  10.	   Kubori,	  T.,	  Matsushima,	  Y.,	  Nakamura,	  D.,	  Uralil,	  J.,	  Lara-­‐Tejero,	  M.,	  Sukhan,	  A.,	  Galan,	  J.	  E.,	  and	  Aizawa,	  S.	  I.	  (1998)	  Supramolecular	  structure	  of	  the	  Salmonella	  typhimurium	  type	  III	  protein	  secretion	  system.	  Science	  (New	  York,	  N.Y.)	  280,	  602-­‐605	  11.	   Tamano,	  K.,	  Aizawa,	  S.,	  Katayama,	  E.,	  Nonaka,	  T.,	  Imajoh-­‐Ohmi,	  S.,	  Kuwae,	  A.,	  Nagai,	  S.,	  and	  Sasakawa,	  C.	  (2000)	  Supramolecular	  structure	  of	  the	  Shigella	  type	  III	  secretion	  machinery:	  the	  needle	  part	  is	  changeable	  in	  length	  and	  essential	  for	  delivery	  of	  effectors.	  The	  EMBO	  journal	  19,	  3876-­‐3887	  12.	   Blocker,	  A.,	  Jouihri,	  N.,	  Larquet,	  E.,	  Gounon,	  P.,	  Ebel,	  F.,	  Parsot,	  C.,	  Sansonetti,	  P.,	  and	  Allaoui,	  A.	  (2001)	  Structure	  and	  composition	  of	  the	  Shigella	  flexneri	  "needle	  complex",	  a	  part	  of	  its	  type	  III	  secreton.	  Molecular	  microbiology	  39,	  652-­‐663	  	   	   	  119	  13.	   Wagner,	  S.,	  Konigsmaier,	  L.,	  Lara-­‐Tejero,	  M.,	  Lefebre,	  M.,	  Marlovits,	  T.	  C.,	  and	  Galan,	  J.	  E.	  (2010)	  Organization	  and	  coordinated	  assembly	  of	  the	  type	  III	  secretion	  export	  apparatus.	  Proc	  Natl	  Acad	  Sci	  U	  S	  A	  107,	  17745-­‐17750	  14.	   Diepold,	  A.,	  Amstutz,	  M.,	  Abel,	  S.,	  Sorg,	  I.,	  Jenal,	  U.,	  and	  Cornelis,	  G.	  R.	  (2010)	  Deciphering	  the	  assembly	  of	  the	  Yersinia	  type	  III	  secretion	  injectisome.	  EMBO	  J	  29,	  1928-­‐1940	  15.	   Diepold,	  A.,	  Wiesand,	  U.,	  and	  Cornelis,	  G.	  R.	  (2011)	  The	  assembly	  of	  the	  export	  apparatus	  (YscR,S,T,U,V)	  of	  the	  Yersinia	  type	  III	  secretion	  apparatus	  occurs	  independently	  of	  other	  structural	  components	  and	  involves	  the	  formation	  of	  an	  YscV	  oligomer.	  Mol	  Microbiol	  82,	  502-­‐514	  16.	   Worrall,	  L.	  J.,	  Lameignere,	  E.,	  and	  Strynadka,	  N.	  C.	  (2011)	  Structural	  overview	  of	  the	  bacterial	  injectisome.	  Current	  opinion	  in	  microbiology	  14,	  3-­‐8	  17.	   Zarivach,	  R.,	  Vuckovic,	  M.,	  Deng,	  W.,	  Finlay,	  B.	  B.,	  and	  Strynadka,	  N.	  C.	  (2007)	  Structural	  analysis	  of	  a	  prototypical	  ATPase	  from	  the	  type	  III	  secretion	  system.	  Nat	  Struct	  Mol	  Biol	  14,	  131-­‐137	  18.	   Fadouloglou,	  V.	  E.,	  Tampakaki,	  A.	  P.,	  Glykos,	  N.	  M.,	  Bastaki,	  M.	  N.,	  Hadden,	  J.	  M.,	  Phillips,	  S.	  E.,	  Panopoulos,	  N.	  J.,	  and	  Kokkinidis,	  M.	  (2004)	  Structure	  of	  HrcQB-­‐C,	  a	  conserved	  component	  of	  the	  bacterial	  type	  III	  secretion	  systems.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  101,	  70-­‐75	  19.	   Worrall,	  L.	  J.,	  Vuckovic,	  M.,	  and	  Strynadka,	  N.	  C.	  (2010)	  Crystal	  structure	  of	  the	  C-­‐terminal	  domain	  of	  the	  Salmonella	  type	  III	  secretion	  system	  export	  apparatus	  protein	  InvA.	  Protein	  Sci	  19,	  1091-­‐1096	  20.	   Lilic,	  M.,	  Quezada,	  C.	  M.,	  and	  Stebbins,	  C.	  E.	  (2010)	  A	  conserved	  domain	  in	  type	  III	  secretion	  links	  the	  cytoplasmic	  domain	  of	  InvA	  to	  elements	  of	  the	  basal	  body.	  Acta	  Crystallogr	  D	  Biol	  Crystallogr	  66,	  709-­‐713	  21.	   Abrusci,	  P.,	  Vergara-­‐Irigaray,	  M.,	  Johnson,	  S.,	  Beeby,	  M.	  D.,	  Hendrixson,	  D.	  R.,	  Roversi,	  P.,	  Friede,	  M.	  E.,	  Deane,	  J.	  E.,	  Jensen,	  G.	  J.,	  Tang,	  C.	  M.,	  and	  Lea,	  S.	  M.	  (2013)	  Architecture	  of	  the	  major	  component	  of	  the	  type	  III	  secretion	  system	  export	  apparatus.	  Nat	  Struct	  Mol	  Biol	  20,	  99-­‐104	  22.	   Deane,	  J.	  E.,	  Roversi,	  P.,	  King,	  C.,	  Johnson,	  S.,	  and	  Lea,	  S.	  M.	  (2008)	  Structures	  of	  the	  Shigella	  flexneri	  type	  3	  secretion	  system	  protein	  MxiC	  reveal	  conformational	  variability	  amongst	  homologues.	  Journal	  of	  Molecular	  Biology	  377,	  985-­‐992	  23.	   Schubot,	  F.	  D.,	  Jackson,	  M.	  W.,	  Penrose,	  K.	  J.,	  Cherry,	  S.,	  Tropea,	  J.	  E.,	  Plano,	  G.	  V.,	  and	  Waugh,	  D.	  S.	  (2005)	  Three-­‐dimensional	  structure	  of	  a	  macromolecular	  assembly	  that	  regulates	  type	  III	  secretion	  in	  Yersinia	  pestis.	  Journal	  of	  Molecular	  Biology	  346,	  1147-­‐1161	  24.	   Zarivach,	  R.,	  Deng,	  W.,	  Vuckovic,	  M.,	  Felise,	  H.	  B.,	  Nguyen,	  H.	  V.,	  Miller,	  S.	  I.,	  Finlay,	  B.	  B.,	  and	  Strynadka,	  N.	  C.	  (2008)	  Structural	  analysis	  of	  the	  essential	  self-­‐cleaving	  type	  III	  secretion	  proteins	  EscU	  and	  SpaS.	  Nature	  453,	  124-­‐127	  25.	   Deane,	  J.	  E.,	  Graham,	  S.	  C.,	  Mitchell,	  E.	  P.,	  Flot,	  D.,	  Johnson,	  S.,	  and	  Lea,	  S.	  M.	  (2008)	  Crystal	  structure	  of	  Spa40,	  the	  specificity	  switch	  for	  theShigella	  flexneritype	  III	  secretion	  system.	  Molecular	  microbiology	  69,	  267	  <last_page>	  276	  26.	   Lountos,	  G.	  T.,	  Austin,	  B.	  P.,	  Nallamsetty,	  S.,	  and	  Waugh,	  D.	  S.	  (2009)	  Atomic	  resolution	  structure	  of	  the	  cytoplasmic	  domain	  ofYersinia	  pestisYscU,	  a	  regulatory	  switch	  involved	  in	  type	  III	  secretion.	  Protein	  Science	  18,	  467	  <last_page>	  474	  	   	   	  120	  27.	   Wiesand,	  U.,	  Sorg,	  I.,	  Amstutz,	  M.,	  Wagner,	  S.,	  van	  den	  Heuvel,	  J.,	  Lührs,	  T.,	  Cornelis,	  G.	  R.,	  and	  Heinz,	  D.	  W.	  (2009)	  Structure	  of	  the	  Type	  III	  Secretion	  Recognition	  Protein	  YscU	  from	  Yersinia	  enterocolitica.	  Journal	  of	  Molecular	  Biology	  385,	  854	  <last_page>	  866	  28.	   Schraidt,	  O.,	  and	  Marlovits,	  T.	  C.	  (2011)	  Three-­‐dimensional	  model	  of	  Salmonella's	  needle	  complex	  at	  subnanometer	  resolution.	  Science	  (New	  York,	  N.Y.)	  331,	  1192-­‐1195	  29.	   Hodgkinson,	  J.	  L.,	  Horsley,	  A.,	  Stabat,	  D.,	  Simon,	  M.,	  Johnson,	  S.,	  da	  Fonseca,	  P.	  C.,	  Morris,	  E.	  P.,	  Wall,	  J.	  S.,	  Lea,	  S.	  M.,	  and	  Blocker,	  A.	  J.	  (2009)	  Three-­‐dimensional	  reconstruction	  of	  the	  Shigella	  T3SS	  transmembrane	  regions	  reveals	  12-­‐fold	  symmetry	  and	  novel	  features	  throughout.	  Nature	  structural	  &	  molecular	  biology	  16,	  477-­‐485	  30.	   Radics,	  J.,	  Konigsmaier,	  L.,	  and	  Marlovits,	  T.	  C.	  (2014)	  Structure	  of	  a	  pathogenic	  type	  3	  secretion	  system	  in	  action.	  Nature	  structural	  &	  molecular	  biology	  21,	  82-­‐87	  31.	   Kudryashev,	  M.,	  Stenta,	  M.,	  Schmelz,	  S.,	  Amstutz,	  M.,	  Wiesand,	  U.,	  Castano-­‐Diez,	  D.,	  Degiacomi,	  M.	  T.,	  Munnich,	  S.,	  Bleck,	  C.	  K.,	  Kowal,	  J.,	  Diepold,	  A.,	  Heinz,	  D.	  W.,	  Dal	  Peraro,	  M.,	  Cornelis,	  G.	  R.,	  and	  Stahlberg,	  H.	  (2013)	  In	  situ	  structural	  analysis	  of	  the	  Yersinia	  enterocolitica	  injectisome.	  eLife	  2,	  e00792	  32.	   Kawamoto,	  A.,	  Morimoto,	  Y.	  V.,	  Miyata,	  T.,	  Minamino,	  T.,	  Hughes,	  K.	  T.,	  Kato,	  T.,	  and	  Namba,	  K.	  (2013)	  Common	  and	  distinct	  structural	  features	  of	  Salmonella	  injectisome	  and	  flagellar	  basal	  body.	  Scientific	  reports	  3,	  3369	  33.	   Yip,	  C.	  K.,	  Kimbrough,	  T.	  G.,	  Felise,	  H.	  B.,	  Vuckovic,	  M.,	  Thomas,	  N.	  A.,	  Pfuetzner,	  R.	  A.,	  Frey,	  E.	  A.,	  Finlay,	  B.	  B.,	  Miller,	  S.	  I.,	  and	  Strynadka,	  N.	  C.	  (2005)	  Structural	  characterization	  of	  the	  molecular	  platform	  for	  type	  III	  secretion	  system	  assembly.	  Nature	  435,	  702-­‐707	  34.	   Bergeron,	  J.	  R.,	  Worrall,	  L.	  J.,	  Sgourakis,	  N.	  G.,	  DiMaio,	  F.,	  Pfuetzner,	  R.	  A.,	  Felise,	  H.	  B.,	  Vuckovic,	  M.,	  Yu,	  A.	  C.,	  Miller,	  S.	  I.,	  Baker,	  D.,	  and	  Strynadka,	  N.	  C.	  (2013)	  A	  refined	  model	  of	  the	  prototypical	  Salmonella	  SPI-­‐1	  T3SS	  basal	  body	  reveals	  the	  molecular	  basis	  for	  its	  assembly.	  PLoS	  pathogens	  9,	  e1003307	  35.	   Spreter,	  T.,	  Yip,	  C.	  K.,	  Sanowar,	  S.,	  Andre,	  I.,	  Kimbrough,	  T.	  G.,	  Vuckovic,	  M.,	  Pfuetzner,	  R.	  A.,	  Deng,	  W.,	  Yu,	  A.	  C.,	  Finlay,	  B.	  B.,	  Baker,	  D.,	  Miller,	  S.	  I.,	  and	  Strynadka,	  N.	  C.	  (2009)	  A	  conserved	  structural	  motif	  mediates	  formation	  of	  the	  periplasmic	  rings	  in	  the	  type	  III	  secretion	  system.	  Nat	  Struct	  Mol	  Biol	  16,	  468-­‐476	  36.	   McDowell,	  M.	  A.,	  Johnson,	  S.,	  Deane,	  J.	  E.,	  Cheung,	  M.,	  Roehrich,	  A.	  D.,	  Blocker,	  A.	  J.,	  McDonnell,	  J.	  M.,	  and	  Lea,	  S.	  M.	  (2011)	  Structural	  and	  functional	  studies	  on	  the	  N-­‐terminal	  domain	  of	  the	  Shigella	  type	  III	  secretion	  protein	  MxiG.	  The	  Journal	  of	  biological	  chemistry	  286,	  30606-­‐30614	  37.	   Barison,	  N.,	  Lambers,	  J.,	  Hurwitz,	  R.,	  and	  Kolbe,	  M.	  (2012)	  Interaction	  of	  MxiG	  with	  the	  cytosolic	  complex	  of	  the	  type	  III	  secretion	  system	  controls	  Shigella	  virulence.	  FASEB	  journal	  :	  official	  publication	  of	  the	  Federation	  of	  American	  Societies	  for	  Experimental	  Biology	  26,	  1717-­‐1726	  38.	   Lario,	  P.	  I.,	  Pfuetzner,	  R.	  A.,	  Frey,	  E.	  A.,	  Creagh,	  L.,	  Haynes,	  C.,	  Maurelli,	  A.	  T.,	  and	  Strynadka,	  N.	  C.	  (2005)	  Structure	  and	  biochemical	  analysis	  of	  a	  secretin	  pilot	  protein.	  The	  EMBO	  journal	  24,	  1111-­‐1121	  	   	   	  121	  39.	   Okon,	  M.,	  Moraes,	  T.	  F.,	  Lario,	  P.	  I.,	  Creagh,	  A.	  L.,	  Haynes,	  C.	  A.,	  Strynadka,	  N.	  C.,	  and	  McIntosh,	  L.	  P.	  (2008)	  Structural	  characterization	  of	  the	  type-­‐III	  pilot-­‐secretin	  complex	  from	  Shigella	  flexneri.	  Structure	  (London,	  England	  :	  1993)	  16,	  1544-­‐1554	  40.	   Kowal,	  J.,	  Chami,	  M.,	  Ringler,	  P.,	  Muller,	  S.	  A.,	  Kudryashev,	  M.,	  Castano-­‐Diez,	  D.,	  Amstutz,	  M.,	  Cornelis,	  G.	  R.,	  Stahlberg,	  H.,	  and	  Engel,	  A.	  (2013)	  Structure	  of	  the	  Dodecameric	  Yersinia	  enterocolitica	  Secretin	  YscC	  and	  Its	  Trypsin-­‐Resistant	  Core.	  Structure	  (London,	  England	  :	  1993)	  	  41.	   Poyraz,	  O.,	  Schmidt,	  H.,	  Seidel,	  K.,	  Delissen,	  F.,	  Ader,	  C.,	  Tenenboim,	  H.,	  Goosmann,	  C.,	  Laube,	  B.,	  Thunemann,	  A.	  F.,	  Zychlinsky,	  A.,	  Baldus,	  M.,	  Lange,	  A.,	  Griesinger,	  C.,	  and	  Kolbe,	  M.	  (2010)	  Protein	  refolding	  is	  required	  for	  assembly	  of	  the	  type	  three	  secretion	  needle.	  Nature	  structural	  &	  molecular	  biology	  	  42.	   Wang,	  Y.,	  Ouellette,	  A.	  N.,	  Egan,	  C.	  W.,	  Rathinavelan,	  T.,	  Im,	  W.,	  and	  De	  Guzman,	  R.	  N.	  (2007)	  Differences	  in	  the	  electrostatic	  surfaces	  of	  the	  type	  III	  secretion	  needle	  proteins	  PrgI,	  BsaL,	  and	  MxiH.	  Journal	  of	  Molecular	  Biology	  371,	  1304-­‐1314	  43.	   Loquet,	  A.,	  Sgourakis,	  N.	  G.,	  Gupta,	  R.,	  Giller,	  K.,	  Riedel,	  D.,	  Goosmann,	  C.,	  Griesinger,	  C.,	  Kolbe,	  M.,	  Baker,	  D.,	  Becker,	  S.,	  and	  Lange,	  A.	  (2012)	  Atomic	  model	  of	  the	  type	  III	  secretion	  system	  needle.	  Nature	  486,	  7402-­‐7279	  44.	   Deane,	  J.	  E.,	  Roversi,	  P.,	  Cordes,	  F.	  S.,	  Johnson,	  S.,	  Kenjale,	  R.,	  Daniell,	  S.,	  Booy,	  F.,	  Picking,	  W.	  D.,	  Picking,	  W.	  L.,	  Blocker,	  A.	  J.,	  and	  Lea,	  S.	  M.	  (2006)	  Molecular	  model	  of	  a	  type	  III	  secretion	  system	  needle:	  Implications	  for	  host-­‐cell	  sensing.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  103,	  12529-­‐12533	  45.	   Fujii,	  T.,	  Cheung,	  M.,	  Blanco,	  A.,	  Kato,	  T.,	  Blocker,	  A.	  J.,	  and	  Namba,	  K.	  (2012)	  Structure	  of	  a	  type	  III	  secretion	  needle	  at	  7-­‐A	  resolution	  provides	  insights	  into	  its	  assembly	  and	  signaling	  mechanisms	  [Biophysics	  and	  Computational	  Biology].	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  109,	  4461-­‐4466	  46.	   Demers,	  J.	  P.,	  Sgourakis,	  N.	  G.,	  Gupta,	  R.,	  Loquet,	  A.,	  Giller,	  K.,	  Riedel,	  D.,	  Laube,	  B.,	  Kolbe,	  M.,	  Baker,	  D.,	  Becker,	  S.,	  and	  Lange,	  A.	  (2013)	  The	  common	  structural	  architecture	  of	  Shigella	  flexneri	  and	  Salmonella	  typhimurium	  type	  three	  secretion	  needles.	  PLoS	  pathogens	  9,	  e1003245	  47.	   Sun,	  P.,	  Tropea,	  J.	  E.,	  Austin,	  B.	  P.,	  Cherry,	  S.,	  and	  Waugh,	  D.	  S.	  (2008)	  Structural	  characterization	  of	  the	  Yersinia	  pestis	  type	  III	  secretion	  system	  needle	  protein	  YscF	  in	  complex	  with	  its	  heterodimeric	  chaperone	  YscE/YscG.	  Journal	  of	  Molecular	  Biology	  377,	  819-­‐830	  48.	   Quinaud,	  M.,	  Ple,	  S.,	  Job,	  V.,	  Contreras-­‐Martel,	  C.,	  Simorre,	  J.	  P.,	  Attree,	  I.,	  and	  Dessen,	  A.	  (2007)	  Structure	  of	  the	  heterotrimeric	  complex	  that	  regulates	  type	  III	  secretion	  needle	  formation.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  104,	  7803-­‐7808	  49.	   Zhang,	  L.,	  Wang,	  Y.,	  Picking,	  W.	  L.,	  Picking,	  W.	  D.,	  and	  De	  Guzman,	  R.	  N.	  (2006)	  Solution	  structure	  of	  monomeric	  BsaL,	  the	  type	  III	  secretion	  needle	  protein	  of	  Burkholderia	  pseudomallei.	  Journal	  of	  Molecular	  Biology	  359,	  322-­‐330	  50.	   Chatterjee,	  S.,	  Zhong,	  D.,	  Nordhues,	  B.	  A.,	  Battaile,	  K.	  P.,	  Lovell,	  S.,	  and	  De	  Guzman,	  R.	  N.	  (2011)	  The	  crystal	  structures	  of	  the	  Salmonella	  type	  III	  secretion	  system	  tip	  protein	  SipD	  in	  complex	  with	  deoxycholate	  and	  chenodeoxycholate.	  Protein	  science	  :	  a	  publication	  of	  the	  Protein	  Society	  20,	  75-­‐86	  	   	   	  122	  51.	   Lunelli,	  M.,	  Hurwitz,	  R.,	  Lambers,	  J.,	  and	  Kolbe,	  M.	  (2011)	  Crystal	  Structure	  of	  PrgI-­‐SipD:	  Insight	  into	  a	  Secretion	  Competent	  State	  of	  the	  Type	  Three	  Secretion	  System	  Needle	  Tip	  and	  its	  Interaction	  with	  Host	  Ligands.	  PLoS	  pathogens	  7,	  e1002163	  52.	   Barta,	  M.	  L.,	  Guragain,	  M.,	  Adam,	  P.,	  Dickenson,	  N.	  E.,	  Patil,	  M.,	  Geisbrecht,	  B.	  V.,	  Picking,	  W.	  L.,	  and	  Picking,	  W.	  D.	  (2012)	  Identification	  of	  the	  bile	  salt	  binding	  site	  on	  IpaD	  from	  Shigella	  flexneri	  and	  the	  influence	  of	  ligand	  binding	  on	  IpaD	  structure.	  Proteins	  80,	  935-­‐945	  53.	   Derewenda,	  U.,	  Mateja,	  A.,	  Devedjiev,	  Y.,	  Routzahn,	  K.	  M.,	  Evdokimov,	  A.	  G.,	  Derewenda,	  Z.	  S.,	  and	  Waugh,	  D.	  S.	  (2004)	  The	  structure	  of	  Yersinia	  pestis	  V-­‐antigen,	  an	  essential	  virulence	  factor	  and	  mediator	  of	  immunity	  against	  plague.	  Structure	  (London,	  England	  :	  1993)	  12,	  301-­‐306	  54.	   Yip,	  C.	  K.,	  Finlay,	  B.	  B.,	  and	  Strynadka,	  N.	  C.	  (2005)	  Structural	  characterization	  of	  a	  type	  III	  secretion	  system	  filament	  protein	  in	  complex	  with	  its	  chaperone.	  Nat	  Struct	  Mol	  Biol	  12,	  75-­‐81	  55.	   Johnson,	  S.,	  Roversi,	  P.,	  Espina,	  M.,	  Olive,	  A.,	  Deane,	  J.	  E.,	  Birket,	  S.,	  Field,	  T.,	  Picking,	  W.	  D.,	  Blocker,	  A.	  J.,	  Galyov,	  E.	  E.,	  Picking,	  W.	  L.,	  and	  Lea,	  S.	  M.	  (2007)	  Self-­‐chaperoning	  of	  the	  type	  III	  secretion	  system	  needle	  tip	  proteins	  IpaD	  and	  BipD.	  The	  Journal	  of	  biological	  chemistry	  282,	  4035-­‐4044	  56.	   Job,	  V.,	  Mattei,	  P.	  J.,	  Lemaire,	  D.,	  Attree,	  I.,	  and	  Dessen,	  A.	  (2010)	  Structural	  basis	  of	  chaperone	  recognition	  of	  type	  III	  secretion	  system	  minor	  translocator	  proteins.	  The	  Journal	  of	  biological	  chemistry	  285,	  23224-­‐23232	  57.	   Lunelli,	  M.,	  Lokareddy,	  R.	  K.,	  Zychlinsky,	  A.,	  and	  Kolbe,	  M.	  (2009)	  IpaB-­‐IpgC	  interaction	  defines	  binding	  motif	  for	  type	  III	  secretion	  translocator.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  106,	  9661-­‐9666	  58.	   Schreiner,	  M.,	  and	  Niemann,	  H.	  H.	  (2012)	  Crystal	  structure	  of	  the	  Yersinia	  enterocolitica	  type	  III	  secretion	  chaperone	  SycD	  in	  complex	  with	  a	  peptide	  of	  the	  minor	  translocator	  YopD.	  BMC	  structural	  biology	  12,	  13-­‐6807-­‐6812-­‐6813	  59.	   Barta,	  M.	  L.,	  Dickenson,	  N.	  E.,	  Patil,	  M.,	  Keightley,	  A.,	  Wyckoff,	  G.	  J.,	  Picking,	  W.	  D.,	  Picking,	  W.	  L.,	  and	  Geisbrecht,	  B.	  V.	  (2012)	  The	  structures	  of	  coiled-­‐coil	  domains	  from	  type	  III	  secretion	  system	  translocators	  reveal	  homology	  to	  pore-­‐forming	  toxins.	  Journal	  of	  Molecular	  Biology	  417,	  395-­‐405	  60.	   Daefler,	  S.,	  and	  Russel,	  M.	  (1998)	  The	  Salmonella	  typhimurium	  InvH	  protein	  is	  an	  outer	  membrane	  lipoprotein	  required	  for	  the	  proper	  localization	  of	  InvG.	  Molecular	  microbiology	  28,	  1367-­‐1380	  61.	   Crago,	  A.	  M.,	  and	  Koronakis,	  V.	  (1998)	  Salmonella	  InvG	  forms	  a	  ring-­‐like	  multimer	  that	  requires	  the	  InvH	  lipoprotein	  for	  outer	  membrane	  localization.	  Molecular	  microbiology	  30,	  47-­‐56	  62.	   Schuch,	  R.,	  and	  Maurelli,	  A.	  T.	  (1999)	  The	  mxi-­‐Spa	  type	  III	  secretory	  pathway	  of	  Shigella	  flexneri	  requires	  an	  outer	  membrane	  lipoprotein,	  MxiM,	  for	  invasin	  translocation.	  Infection	  and	  immunity	  67,	  1982-­‐1991	  63.	   Schraidt,	  O.,	  Lefebre,	  M.	  D.,	  Brunner,	  M.	  J.,	  Schmied,	  W.	  H.,	  Schmidt,	  A.,	  Radics,	  J.,	  Mechtler,	  K.,	  Galan,	  J.	  E.,	  and	  Marlovits,	  T.	  C.	  (2010)	  Topology	  and	  organization	  of	  the	  Salmonella	  typhimurium	  type	  III	  secretion	  needle	  complex	  components.	  PLoS	  pathogens	  6,	  e1000824	  	   	   	  123	  64.	   Gauthier,	  A.,	  Puente,	  J.	  L.,	  and	  Finlay,	  B.	  B.	  (2003)	  Secretin	  of	  the	  enteropathogenic	  Escherichia	  coli	  type	  III	  secretion	  system	  requires	  components	  of	  the	  type	  III	  apparatus	  for	  assembly	  and	  localization.	  Infection	  and	  immunity	  71,	  3310-­‐3319	  65.	   Sukhan,	  A.,	  Kubori,	  T.,	  Wilson,	  J.,	  and	  Galan,	  J.	  E.	  (2001)	  Genetic	  analysis	  of	  assembly	  of	  the	  Salmonella	  enterica	  serovar	  Typhimurium	  type	  III	  secretion-­‐associated	  needle	  complex.	  J	  Bacteriol	  183,	  1159-­‐1167	  66.	   Mota,	  L.	  J.,	  Journet,	  L.,	  Sorg,	  I.,	  Agrain,	  C.,	  and	  Cornelis,	  G.	  R.	  (2005)	  Bacterial	  injectisomes:	  needle	  length	  does	  matter.	  Science	  (New	  York,	  N.Y.)	  307,	  1278	  67.	   Journet,	  L.,	  Agrain,	  C.,	  Broz,	  P.,	  and	  Cornelis,	  G.	  R.	  (2003)	  The	  needle	  length	  of	  bacterial	  injectisomes	  is	  determined	  by	  a	  molecular	  ruler.	  Science	  (New	  York,	  N.Y.)	  302,	  1757-­‐1760	  68.	   Marlovits,	  T.	  C.,	  Kubori,	  T.,	  Lara-­‐Tejero,	  M.,	  Thomas,	  D.,	  Unger,	  V.	  M.,	  and	  Galan,	  J.	  E.	  (2006)	  Assembly	  of	  the	  inner	  rod	  determines	  needle	  length	  in	  the	  type	  III	  secretion	  injectisome.	  Nature	  441,	  637-­‐640	  69.	   Agrain,	  C.,	  Callebaut,	  I.,	  Journet,	  L.,	  Sorg,	  I.,	  Paroz,	  C.,	  Mota,	  L.	  J.,	  and	  Cornelis,	  G.	  R.	  (2005)	  Characterization	  of	  a	  Type	  III	  secretion	  substrate	  specificity	  switch	  (T3S4)	  domain	  in	  YscP	  from	  Yersinia	  enterocolitica.	  Molecular	  microbiology	  56,	  54-­‐67	  70.	   Botteaux,	  A.,	  Sani,	  M.,	  Kayath,	  C.	  A.,	  Boekema,	  E.	  J.,	  and	  Allaoui,	  A.	  (2008)	  Spa32	  interaction	  with	  the	  inner-­‐membrane	  Spa40	  component	  of	  the	  type	  III	  secretion	  system	  of	  Shigella	  flexneri	  is	  required	  for	  the	  control	  of	  the	  needle	  length	  by	  a	  molecular	  tape	  measure	  mechanism.	  Molecular	  microbiology	  70,	  1515-­‐1528	  71.	   Monjaras	  Feria,	  J.,	  Garcia-­‐Gomez,	  E.,	  Espinosa,	  N.,	  Minamino,	  T.,	  Namba,	  K.,	  and	  Gonzalez-­‐Pedrajo,	  B.	  (2012)	  Role	  of	  EscP	  (Orf16)	  in	  injectisome	  biogenesis	  and	  regulation	  of	  type	  III	  protein	  secretion	  in	  enteropathogenic	  Escherichia	  coli.	  Journal	  of	  Bacteriology	  194,	  6029-­‐6045	  72.	   Wagner,	  S.,	  Stenta,	  M.,	  Metzger,	  L.	  C.,	  Dal	  Peraro,	  M.,	  and	  Cornelis,	  G.	  R.	  (2010)	  Length	  control	  of	  the	  injectisome	  needle	  requires	  only	  one	  molecule	  of	  Yop	  secretion	  protein	  P	  (YscP).	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  107,	  13860-­‐13865	  73.	   Wagner,	  S.,	  Sorg,	  I.,	  Degiacomi,	  M.,	  Journet,	  L.,	  Dal	  Peraro,	  M.,	  and	  Cornelis,	  G.	  R.	  (2009)	  The	  helical	  content	  of	  the	  YscP	  molecular	  ruler	  determines	  the	  length	  of	  the	  Yersinia	  injectisome.	  Molecular	  microbiology	  71,	  692-­‐701	  74.	   Wood,	  S.	  E.,	  Jin,	  J.,	  and	  Lloyd,	  S.	  A.	  (2008)	  YscP	  and	  YscU	  switch	  the	  substrate	  specificity	  of	  the	  Yersinia	  type	  III	  secretion	  system	  by	  regulating	  export	  of	  the	  inner	  rod	  protein	  YscI.	  Journal	  of	  Bacteriology	  190,	  4252-­‐4262	  75.	   Deng,	  W.,	  Li,	  Y.,	  Hardwidge,	  P.	  R.,	  Frey,	  E.	  A.,	  Pfuetzner,	  R.	  A.,	  Lee,	  S.,	  Gruenheid,	  S.,	  Strynakda,	  N.	  C.,	  Puente,	  J.	  L.,	  and	  Finlay,	  B.	  B.	  (2005)	  Regulation	  of	  type	  III	  secretion	  hierarchy	  of	  translocators	  and	  effectors	  in	  attaching	  and	  effacing	  bacterial	  pathogens.	  Infection	  and	  immunity	  73,	  2135-­‐2146	  76.	   Botteaux,	  A.,	  Sory,	  M.	  P.,	  Biskri,	  L.,	  Parsot,	  C.,	  and	  Allaoui,	  A.	  (2009)	  MxiC	  is	  secreted	  by	  and	  controls	  the	  substrate	  specificity	  of	  the	  Shigella	  flexneri	  type	  III	  secretion	  apparatus.	  Molecular	  microbiology	  71,	  449-­‐460	  77.	   Cherradi,	  Y.,	  Schiavolin,	  L.,	  Moussa,	  S.,	  Meghraoui,	  A.,	  Meksem,	  A.,	  Biskri,	  L.,	  Azarkan,	  M.,	  Allaoui,	  A.,	  and	  Botteaux,	  A.	  (2013)	  Interplay	  between	  predicted	  	   	   	  124	  inner-­‐rod	  and	  gatekeeper	  in	  controlling	  substrate	  specificity	  of	  the	  type	  III	  secretion	  system.	  Molecular	  microbiology	  87,	  1183-­‐1199	  78.	   Pallen,	  M.	  J.,	  Beatson,	  S.	  A.,	  and	  Bailey,	  C.	  M.	  (2005)	  Bioinformatics	  analysis	  of	  the	  locus	  for	  enterocyte	  effacement	  provides	  novel	  insights	  into	  type-­‐III	  secretion.	  BMC	  microbiology	  5,	  9	  79.	   O'Connell,	  C.	  B.,	  Creasey,	  E.	  A.,	  Knutton,	  S.,	  Elliott,	  S.,	  Crowther,	  L.	  J.,	  Luo,	  W.,	  Albert,	  M.	  J.,	  Kaper,	  J.	  B.,	  Frankel,	  G.,	  and	  Donnenberg,	  M.	  S.	  (2004)	  SepL,	  a	  protein	  required	  for	  enteropathogenic	  Escherichia	  coli	  type	  III	  translocation,	  interacts	  with	  secretion	  component	  SepD.	  Molecular	  microbiology	  52,	  1613-­‐1625	  80.	   Martinez-­‐Argudo,	  I.,	  and	  Blocker,	  A.	  J.	  (2010)	  The	  Shigella	  T3SS	  needle	  transmits	  a	  signal	  for	  MxiC	  release,	  which	  controls	  secretion	  of	  effectors.	  Molecular	  microbiology	  78,	  1365-­‐1378	  81.	   Kresse,	  A.	  U.,	  Beltrametti,	  F.,	  Muller,	  A.,	  Ebel,	  F.,	  and	  Guzman,	  C.	  A.	  (2000)	  Characterization	  of	  SepL	  of	  enterohemorrhagic	  Escherichia	  coli.	  Journal	  of	  Bacteriology	  182,	  6490-­‐6498	  82.	   Kubori,	  T.,	  and	  Galan,	  J.	  E.	  (2002)	  Salmonella	  type	  III	  secretion-­‐associated	  protein	  InvE	  controls	  translocation	  of	  effector	  proteins	  into	  host	  cells.	  Journal	  of	  Bacteriology	  184,	  4699-­‐4708	  83.	   Akeda,	  Y.,	  and	  Galan,	  J.	  E.	  (2005)	  Chaperone	  release	  and	  unfolding	  of	  substrates	  in	  type	  III	  secretion.	  Nature	  437,	  911-­‐915	  84.	   Letzelter,	  M.,	  Sorg,	  I.,	  Mota,	  L.	  J.,	  Meyer,	  S.,	  Stalder,	  J.,	  Feldman,	  M.,	  Kuhn,	  M.,	  Callebaut,	  I.,	  and	  Cornelis,	  G.	  R.	  (2006)	  The	  discovery	  of	  SycO	  highlights	  a	  new	  function	  for	  type	  III	  secretion	  effector	  chaperones.	  The	  EMBO	  journal	  25,	  3223-­‐3233	  85.	   Thomas,	  N.	  A.,	  Ma,	  I.,	  Prasad,	  M.	  E.,	  and	  Rafuse,	  C.	  (2012)	  Expanded	  roles	  for	  multicargo	  and	  class	  1B	  effector	  chaperones	  in	  type	  III	  secretion.	  Journal	  of	  Bacteriology	  194,	  3767-­‐3773	  86.	   Stebbins,	  C.	  E.,	  and	  Galan,	  J.	  E.	  (2001)	  Maintenance	  of	  an	  unfolded	  polypeptide	  by	  a	  cognate	  chaperone	  in	  bacterial	  type	  III	  secretion.	  Nature	  414,	  77-­‐81	  87.	   Luo,	  Y.,	  Bertero,	  M.	  G.,	  Frey,	  E.	  A.,	  Pfuetzner,	  R.	  A.,	  Wenk,	  M.	  R.,	  Creagh,	  L.,	  Marcus,	  S.	  L.,	  Lim,	  D.,	  Sicheri,	  F.,	  Kay,	  C.,	  Haynes,	  C.,	  Finlay,	  B.	  B.,	  and	  Strynadka,	  N.	  C.	  (2001)	  Structural	  and	  biochemical	  characterization	  of	  the	  type	  III	  secretion	  chaperones	  CesT	  and	  SigE.	  Nature	  structural	  biology	  8,	  1031-­‐1036	  88.	   Lilic,	  M.,	  Vujanac,	  M.,	  and	  Stebbins,	  C.	  E.	  (2006)	  A	  common	  structural	  motif	  in	  the	  binding	  of	  virulence	  factors	  to	  bacterial	  secretion	  chaperones.	  Molecular	  cell	  21,	  653-­‐664	  89.	   Phan,	  J.,	  Tropea,	  J.	  E.,	  and	  Waugh,	  D.	  S.	  (2004)	  Structure	  of	  the	  Yersinia	  pestis	  type	  III	  secretion	  chaperone	  SycH	  in	  complex	  with	  a	  stable	  fragment	  of	  YscM2.	  Acta	  crystallographica.Section	  D,	  Biological	  crystallography	  60,	  1591-­‐1599	  90.	   Vujanac,	  M.,	  and	  Stebbins,	  C.	  E.	  (2013)	  Context-­‐dependent	  protein	  folding	  of	  a	  virulence	  peptide	  in	  the	  bacterial	  and	  host	  environments:	  structure	  of	  an	  SycH-­‐YopH	  chaperone-­‐effector	  complex.	  Acta	  crystallographica.Section	  D,	  Biological	  crystallography	  69,	  546-­‐554	  91.	   Birtalan,	  S.,	  and	  Ghosh,	  P.	  (2001)	  Structure	  of	  the	  Yersinia	  type	  III	  secretory	  system	  chaperone	  SycE.	  Nature	  structural	  biology	  8,	  974-­‐978	  	   	   	  125	  92.	   Barta,	  M.	  L.,	  Zhang,	  L.,	  Picking,	  W.	  L.,	  and	  Geisbrecht,	  B.	  V.	  (2010)	  Evidence	  for	  alternative	  quaternary	  structure	  in	  a	  bacterial	  Type	  III	  secretion	  system	  chaperone.	  BMC	  structural	  biology	  10,	  21-­‐6807-­‐6810-­‐6821	  93.	   Lokareddy,	  R.	  K.,	  Lunelli,	  M.,	  Eilers,	  B.,	  Wolter,	  V.,	  and	  Kolbe,	  M.	  (2010)	  Combination	  of	  two	  separate	  binding	  domains	  defines	  stoichiometry	  between	  type	  III	  secretion	  system	  chaperone	  IpgC	  and	  translocator	  protein	  IpaB.	  The	  Journal	  of	  biological	  chemistry	  285,	  39965-­‐39975	  94.	   Buttner,	  C.	  R.,	  Sorg,	  I.,	  Cornelis,	  G.	  R.,	  Heinz,	  D.	  W.,	  and	  Niemann,	  H.	  H.	  (2008)	  Structure	  of	  the	  Yersinia	  enterocolitica	  type	  III	  secretion	  translocator	  chaperone	  SycD.	  Journal	  of	  Molecular	  Biology	  375,	  997-­‐1012	  95.	   van	  Eerde,	  A.,	  Hamiaux,	  C.,	  Perez,	  J.,	  Parsot,	  C.,	  and	  Dijkstra,	  B.	  W.	  (2004)	  Structure	  of	  Spa15,	  a	  type	  III	  secretion	  chaperone	  from	  Shigella	  flexneri	  with	  broad	  specificity.	  EMBO	  reports	  5,	  477-­‐483	  96.	   Evdokimov,	  A.	  G.,	  Tropea,	  J.	  E.,	  Routzahn,	  K.	  M.,	  and	  Waugh,	  D.	  S.	  (2002)	  Three-­‐dimensional	  structure	  of	  the	  type	  III	  secretion	  chaperone	  SycE	  from	  Yersinia	  pestis.	  Acta	  crystallographica.Section	  D,	  Biological	  crystallography	  58,	  398-­‐406	  97.	   Trame,	  C.	  B.,	  and	  McKay,	  D.	  B.	  (2003)	  Structure	  of	  the	  Yersinia	  enterocolitica	  molecular-­‐chaperone	  protein	  SycE.	  Acta	  crystallographica.Section	  D,	  Biological	  crystallography	  59,	  389-­‐392	  98.	   Buttner,	  C.	  R.,	  Cornelis,	  G.	  R.,	  Heinz,	  D.	  W.,	  and	  Niemann,	  H.	  H.	  (2005)	  Crystal	  structure	  of	  Yersinia	  enterocolitica	  type	  III	  secretion	  chaperone	  SycT.	  Protein	  science	  :	  a	  publication	  of	  the	  Protein	  Society	  14,	  1993-­‐2002	  99.	   Locher,	  M.,	  Lehnert,	  B.,	  Krauss,	  K.,	  Heesemann,	  J.,	  Groll,	  M.,	  and	  Wilharm,	  G.	  (2005)	  Crystal	  structure	  of	  the	  Yersinia	  enterocolitica	  type	  III	  secretion	  chaperone	  SycT.	  The	  Journal	  of	  biological	  chemistry	  280,	  31149-­‐31155	  100.	   Gendrin,	  C.,	  Contreras-­‐Martel,	  C.,	  Bouillot,	  S.,	  Elsen,	  S.,	  Lemaire,	  D.,	  Skoufias,	  D.	  A.,	  Huber,	  P.,	  Attree,	  I.,	  and	  Dessen,	  A.	  (2012)	  Structural	  basis	  of	  cytotoxicity	  mediated	  by	  the	  type	  III	  secretion	  toxin	  ExoU	  from	  Pseudomonas	  aeruginosa.	  PLoS	  pathogens	  8,	  e1002637	  101.	   Halavaty,	  A.	  S.,	  Borek,	  D.,	  Tyson,	  G.	  H.,	  Veesenmeyer,	  J.	  L.,	  Shuvalova,	  L.,	  Minasov,	  G.,	  Otwinowski,	  Z.,	  Hauser,	  A.	  R.,	  and	  Anderson,	  W.	  F.	  (2012)	  Structure	  of	  the	  type	  III	  secretion	  effector	  protein	  ExoU	  in	  complex	  with	  its	  chaperone	  SpcU.	  PloS	  one	  7,	  e49388	  102.	   Birtalan,	  S.	  C.,	  Phillips,	  R.	  M.,	  and	  Ghosh,	  P.	  (2002)	  Three-­‐dimensional	  secretion	  signals	  in	  chaperone-­‐effector	  complexes	  of	  bacterial	  pathogens.	  Molecular	  cell	  9,	  971-­‐980	  103.	   Smith,	  C.	  L.,	  and	  Hultgren,	  S.	  J.	  (2001)	  Bacteria	  thread	  the	  needle.	  Nature	  414,	  29,	  31	  104.	   Button,	  J.	  E.,	  and	  Galan,	  J.	  E.	  (2011)	  Regulation	  of	  chaperone/effector	  complex	  synthesis	  in	  a	  bacterial	  type	  III	  secretion	  system.	  Molecular	  microbiology	  81,	  1474-­‐1483	  105.	   Bronstein,	  P.	  A.,	  Miao,	  E.	  A.,	  and	  Miller,	  S.	  I.	  (2000)	  InvB	  is	  a	  type	  III	  secretion	  chaperone	  specific	  for	  SspA.	  Journal	  of	  Bacteriology	  182,	  6638-­‐6644	  106.	   Lee,	  S.	  H.,	  and	  Galan,	  J.	  E.	  (2003)	  InvB	  is	  a	  type	  III	  secretion-­‐associated	  chaperone	  for	  the	  Salmonella	  enterica	  effector	  protein	  SopE.	  Journal	  of	  Bacteriology	  185,	  7279-­‐7284	  	   	   	  126	  107.	   Ehrbar,	  K.,	  Friebel,	  A.,	  Miller,	  S.	  I.,	  and	  Hardt,	  W.	  D.	  (2003)	  Role	  of	  the	  Salmonella	  pathogenicity	  island	  1	  (SPI-­‐1)	  protein	  InvB	  in	  type	  III	  secretion	  of	  SopE	  and	  SopE2,	  two	  Salmonella	  effector	  proteins	  encoded	  outside	  of	  SPI-­‐1.	  Journal	  of	  Bacteriology	  185,	  6950-­‐6967	  108.	   Ehrbar,	  K.,	  Hapfelmeier,	  S.,	  Stecher,	  B.,	  and	  Hardt,	  W.	  D.	  (2004)	  InvB	  is	  required	  for	  type	  III-­‐dependent	  secretion	  of	  SopA	  in	  Salmonella	  enterica	  serovar	  Typhimurium.	  Journal	  of	  Bacteriology	  186,	  1215-­‐1219	  109.	   Costa,	  S.	  C.,	  Schmitz,	  A.	  M.,	  Jahufar,	  F.	  F.,	  Boyd,	  J.	  D.,	  Cho,	  M.	  Y.,	  Glicksman,	  M.	  A.,	  and	  Lesser,	  C.	  F.	  (2012)	  A	  new	  means	  to	  identify	  type	  3	  secreted	  effectors:	  functionally	  interchangeable	  class	  IB	  chaperones	  recognize	  a	  conserved	  sequence.	  mBio	  3,	  10.1128/mBio.00243-­‐00211.	  Print	  02012	  110.	   Faudry,	  E.,	  Job,	  V.,	  Dessen,	  A.,	  Attree,	  I.,	  and	  Forge,	  V.	  (2007)	  Type	  III	  secretion	  system	  translocator	  has	  a	  molten	  globule	  conformation	  both	  in	  its	  free	  and	  chaperone-­‐bound	  forms.	  The	  FEBS	  journal	  274,	  3601-­‐3610	  111.	   Chatterjee,	  C.,	  Kumar,	  S.,	  Chakraborty,	  S.,	  Tan,	  Y.	  W.,	  Leung,	  K.	  Y.,	  Sivaraman,	  J.,	  and	  Mok,	  Y.	  K.	  (2011)	  Crystal	  structure	  of	  the	  heteromolecular	  chaperone,	  AscE-­‐AscG,	  from	  the	  type	  III	  secretion	  system	  in	  Aeromonas	  hydrophila.	  PloS	  one	  6,	  e19208	  112.	   Ferris,	  H.	  U.,	  Furukawa,	  Y.,	  Minamino,	  T.,	  Kroetz,	  M.	  B.,	  Kihara,	  M.,	  Namba,	  K.,	  and	  Macnab,	  R.	  M.	  (2005)	  FlhB	  regulates	  ordered	  export	  of	  flagellar	  components	  via	  autocleavage	  mechanism.	  The	  Journal	  of	  biological	  chemistry	  280,	  41236-­‐41242	  113.	   Meshcheryakov,	  V.	  A.,	  Kitao,	  A.,	  Matsunami,	  H.,	  and	  Samatey,	  F.	  A.	  (2013)	  Inhibition	  of	  a	  type	  III	  secretion	  system	  by	  the	  deletion	  of	  a	  short	  loop	  in	  one	  of	  its	  membrane	  proteins.	  Acta	  crystallographica.Section	  D,	  Biological	  crystallography	  69,	  812-­‐820	  114.	   Sorg,	  I.,	  Wagner,	  S.,	  Amstutz,	  M.,	  Muller,	  S.	  A.,	  Broz,	  P.,	  Lussi,	  Y.,	  Engel,	  A.,	  and	  Cornelis,	  G.	  R.	  (2007)	  YscU	  recognizes	  translocators	  as	  export	  substrates	  of	  the	  Yersinia	  injectisome.	  The	  EMBO	  journal	  26,	  3015-­‐3024	  115.	   Thomassin,	  J.-­‐L.,	  He,	  X.,	  and	  Thomas,	  N.	  (2011)	  Role	  of	  EscU	  auto-­‐cleavage	  in	  promoting	  type	  III	  effector	  translocation	  into	  host	  cells	  by	  Enteropathogenic	  Escherichia	  coli.	  BMC	  Microbiology	  11,	  205	  116.	   Sal-­‐Man,	  N.,	  Deng,	  W.,	  and	  Finlay,	  B.	  B.	  (2012)	  EscI:	  a	  crucial	  component	  of	  the	  type	  III	  secretion	  system	  forms	  the	  inner	  rod	  structure	  in	  enteropathogenic	  Escherichia	  coli.	  Biochem	  J	  442,	  119-­‐125	  117.	   Moore,	  S.	  A.,	  and	  Jia,	  Y.	  (2010)	  Structure	  of	  the	  cytoplasmic	  domain	  of	  the	  flagellar	  secretion	  apparatus	  component	  FlhA	  from	  Helicobacter	  pylori.	  The	  Journal	  of	  biological	  chemistry	  285,	  21060-­‐21069	  118.	   Saijo-­‐Hamano,	  Y.,	  Imada,	  K.,	  Minamino,	  T.,	  Kihara,	  M.,	  Shimada,	  M.,	  Kitao,	  A.,	  and	  Namba,	  K.	  (2010)	  Structure	  of	  the	  cytoplasmic	  domain	  of	  FlhA	  and	  implication	  for	  flagellar	  type	  III	  protein	  export.	  Molecular	  microbiology	  76,	  260-­‐268	  119.	   Bange,	  G.,	  Kummerer,	  N.,	  Engel,	  C.,	  Bozkurt,	  G.,	  Wild,	  K.,	  and	  Sinning,	  I.	  (2010)	  FlhA	  provides	  the	  adaptor	  for	  coordinated	  delivery	  of	  late	  flagella	  building	  blocks	  to	  the	  type	  III	  secretion	  system.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  107,	  11295-­‐11300	  	   	   	  127	  120.	   Imada,	  K.,	  Minamino,	  T.,	  Tahara,	  A.,	  and	  Namba,	  K.	  (2007)	  Structural	  similarity	  between	  the	  flagellar	  type	  III	  ATPase	  FliI	  and	  F1-­‐ATPase	  subunits.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  104,	  485-­‐490	  121.	   Akeda,	  Y.,	  and	  Galan,	  J.	  E.	  (2004)	  Genetic	  analysis	  of	  the	  Salmonella	  enterica	  type	  III	  secretion-­‐associated	  ATPase	  InvC	  defines	  discrete	  functional	  domains.	  Journal	  of	  Bacteriology	  186,	  2402-­‐2412	  122.	   Pozidis,	  C.,	  Chalkiadaki,	  A.,	  Gomez-­‐Serrano,	  A.,	  Stahlberg,	  H.,	  Brown,	  I.,	  Tampakaki,	  A.	  P.,	  Lustig,	  A.,	  Sianidis,	  G.,	  Politou,	  A.	  S.,	  Engel,	  A.,	  Panopoulos,	  N.	  J.,	  Mansfield,	  J.,	  Pugsley,	  A.	  P.,	  Karamanou,	  S.,	  and	  Economou,	  A.	  (2003)	  Type	  III	  protein	  translocase:	  HrcN	  is	  a	  peripheral	  ATPase	  that	  is	  activated	  by	  oligomerization.	  The	  Journal	  of	  biological	  chemistry	  278,	  25816-­‐25824	  123.	   Lorenzini,	  E.,	  Singer,	  A.,	  Singh,	  B.,	  Lam,	  R.,	  Skarina,	  T.,	  Chirgadze,	  N.	  Y.,	  Savchenko,	  A.,	  and	  Gupta,	  R.	  S.	  (2010)	  Structure	  and	  protein-­‐protein	  interaction	  studies	  on	  Chlamydia	  trachomatis	  protein	  CT670	  (YscO	  Homolog).	  Journal	  of	  Bacteriology	  192,	  2746-­‐2756	  124.	   Ibuki,	  T.,	  Imada,	  K.,	  Minamino,	  T.,	  Kato,	  T.,	  Miyata,	  T.,	  and	  Namba,	  K.	  (2011)	  Common	  architecture	  of	  the	  flagellar	  type	  III	  protein	  export	  apparatus	  and	  F-­‐	  and	  V-­‐type	  ATPases.	  Nature	  structural	  &	  molecular	  biology	  18,	  277-­‐282	  125.	   Lara-­‐Tejero,	  M.,	  Kato,	  J.,	  Wagner,	  S.,	  Liu,	  X.,	  and	  Galan,	  J.	  E.	  (2011)	  A	  sorting	  platform	  determines	  the	  order	  of	  protein	  secretion	  in	  bacterial	  type	  III	  systems.	  Science	  (New	  York,	  N.Y.)	  331,	  1188-­‐1191	  126.	   Marlovits,	  T.	  C.,	  Kubori,	  T.,	  Sukhan,	  A.,	  Thomas,	  D.	  R.,	  Galan,	  J.	  E.,	  and	  Unger,	  V.	  M.	  (2004)	  Structural	  insights	  into	  the	  assembly	  of	  the	  type	  III	  secretion	  needle	  complex.	  Science	  (New	  York,	  N.Y.)	  306,	  1040-­‐1042	  127.	   Gamez,	  A.,	  Mukerjea,	  R.,	  Alayyoubi,	  M.,	  Ghassemian,	  M.,	  and	  Ghosh,	  P.	  (2012)	  Structure	  and	  interactions	  of	  the	  cytoplasmic	  domain	  of	  the	  Yersinia	  type	  III	  secretion	  protein	  YscD.	  Journal	  of	  Bacteriology	  194,	  5949-­‐5958	  128.	   Lountos,	  G.	  T.,	  Tropea,	  J.	  E.,	  and	  Waugh,	  D.	  S.	  (2012)	  Structure	  of	  the	  cytoplasmic	  domain	  of	  Yersinia	  pestis	  YscD,	  an	  essential	  component	  of	  the	  type	  III	  secretion	  system.	  Acta	  crystallographica.Section	  D,	  Biological	  crystallography	  68,	  201-­‐209	  129.	   Korotkov,	  K.	  V.,	  Gonen,	  T.,	  and	  Hol,	  W.	  G.	  (2011)	  Secretins:	  dynamic	  channels	  for	  protein	  transport	  across	  membranes.	  Trends	  in	  biochemical	  sciences	  36,	  433-­‐443	  130.	   Izore,	  T.,	  Perdu,	  C.,	  Job,	  V.,	  Attree,	  I.,	  Faudry,	  E.,	  and	  Dessen,	  A.	  (2011)	  Structural	  characterization	  and	  membrane	  localization	  of	  ExsB	  from	  the	  type	  III	  secretion	  system	  (T3SS)	  of	  Pseudomonas	  aeruginosa.	  Journal	  of	  Molecular	  Biology	  413,	  236-­‐246	  131.	   Sanowar,	  S.,	  Singh,	  P.,	  Pfuetzner,	  R.	  A.,	  Andre,	  I.,	  Zheng,	  H.,	  Spreter,	  T.,	  Strynadka,	  N.	  C.,	  Gonen,	  T.,	  Baker,	  D.,	  Goodlett,	  D.	  R.,	  and	  Miller,	  S.	  I.	  (2010)	  Interactions	  of	  the	  transmembrane	  polymeric	  rings	  of	  the	  Salmonella	  enterica	  serovar	  Typhimurium	  type	  III	  secretion	  system.	  mBio	  1,	  10.1128/mBio.00158-­‐00110	  132.	   Zhong,	  D.,	  Lefebre,	  M.,	  Kaur,	  K.,	  McDowell,	  M.	  A.,	  Gdowski,	  C.,	  Jo,	  S.,	  Wang,	  Y.,	  Benedict,	  S.	  H.,	  Lea,	  S.	  M.,	  Galan,	  J.	  E.,	  and	  De	  Guzman,	  R.	  N.	  (2012)	  The	  Salmonella	  type	  III	  secretion	  system	  inner	  rod	  protein	  PrgJ	  is	  partially	  folded.	  J	  Biol	  Chem	  287,	  25303-­‐25311	  	   	   	  128	  133.	   Creasey,	  E.	  A.,	  Delahay,	  R.	  M.,	  Daniell,	  S.	  J.,	  and	  Frankel,	  G.	  (2003)	  Yeast	  two-­‐hybrid	  system	  survey	  of	  interactions	  between	  LEE-­‐encoded	  proteins	  of	  enteropathogenic	  Escherichia	  coli.	  Microbiology	  149,	  2093-­‐2106	  134.	   Garcia-­‐Gomez,	  E.,	  Espinosa,	  N.,	  de	  la	  Mora,	  J.,	  Dreyfus,	  G.,	  and	  Gonzalez-­‐Pedrajo,	  B.	  (2011)	  The	  muramidase	  EtgA	  from	  enteropathogenic	  Escherichia	  coli	  is	  required	  for	  efficient	  type	  III	  secretion.	  Microbiology	  157,	  1145-­‐1160	  135.	   Koraimann,	  G.	  (2003)	  Lytic	  transglycosylases	  in	  macromolecular	  transport	  systems	  of	  Gram-­‐negative	  bacteria.	  Cell	  Mol	  Life	  Sci	  60,	  2371-­‐2388	  136.	   Zahrl,	  D.,	  Wagner,	  M.,	  Bischof,	  K.,	  Bayer,	  M.,	  Zavecz,	  B.,	  Beranek,	  A.,	  Ruckenstuhl,	  C.,	  Zarfel,	  G.	  E.,	  and	  Koraimann,	  G.	  (2005)	  Peptidoglycan	  degradation	  by	  specialized	  lytic	  transglycosylases	  associated	  with	  type	  III	  and	  type	  IV	  secretion	  systems.	  Microbiology	  151,	  3455-­‐3467	  137.	   Deng,	  W.,	  Puente,	  J.	  L.,	  Gruenheid,	  S.,	  Li,	  Y.,	  Vallance,	  B.	  A.,	  Vazquez,	  A.,	  Barba,	  J.,	  Ibarra,	  J.	  A.,	  O'Donnell,	  P.,	  Metalnikov,	  P.,	  Ashman,	  K.,	  Lee,	  S.,	  Goode,	  D.,	  Pawson,	  T.,	  and	  Finlay,	  B.	  B.	  (2004)	  Dissecting	  virulence:	  systematic	  and	  functional	  analyses	  of	  a	  pathogenicity	  island.	  Proc	  Natl	  Acad	  Sci	  U	  S	  A	  101,	  3597-­‐3602	  138.	   Kubori,	  T.,	  Sukhan,	  A.,	  Aizawa,	  S.	  I.,	  and	  Galan,	  J.	  E.	  (2000)	  Molecular	  characterization	  and	  assembly	  of	  the	  needle	  complex	  of	  the	  Salmonella	  typhimurium	  type	  III	  protein	  secretion	  system.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  97,	  10225-­‐10230	  139.	   Kimbrough,	  T.	  G.,	  and	  Miller,	  S.	  I.	  (2000)	  Contribution	  of	  Salmonella	  typhimurium	  type	  III	  secretion	  components	  to	  needle	  complex	  formation.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  97,	  11008-­‐11013	  140.	   Cordes,	  F.	  S.,	  Daniell,	  S.,	  Kenjale,	  R.,	  Saurya,	  S.,	  Picking,	  W.	  L.,	  Picking,	  W.	  D.,	  Booy,	  F.,	  Lea,	  S.	  M.,	  and	  Blocker,	  A.	  (2005)	  Helical	  packing	  of	  needles	  from	  functionally	  altered	  Shigella	  type	  III	  secretion	  systems.	  Journal	  of	  Molecular	  Biology	  354,	  206-­‐211	  141.	   Galkin,	  V.	  E.,	  Schmied,	  W.	  H.,	  Schraidt,	  O.,	  Marlovits,	  T.	  C.,	  and	  Egelman,	  E.	  H.	  (2010)	  The	  Structure	  of	  the	  Salmonella	  typhimurium	  Type	  III	  Secretion	  System	  Needle	  Shows	  Divergence	  from	  the	  Flagellar	  System.	  Journal	  of	  Molecular	  Biology	  	  142.	   Roehrich,	  A.	  D.,	  Guillossou,	  E.,	  Blocker,	  A.	  J.,	  and	  Martinez-­‐Argudo,	  I.	  (2013)	  Shigella	  IpaD	  has	  a	  dual	  role:	  signal	  transduction	  from	  the	  type	  III	  secretion	  system	  needle	  tip	  and	  intracellular	  secretion	  regulation.	  Molecular	  microbiology	  87,	  690-­‐706	  143.	   Veenendaal,	  A.	  K.,	  Hodgkinson,	  J.	  L.,	  Schwarzer,	  L.,	  Stabat,	  D.,	  Zenk,	  S.	  F.,	  and	  Blocker,	  A.	  J.	  (2007)	  The	  type	  III	  secretion	  system	  needle	  tip	  complex	  mediates	  host	  cell	  sensing	  and	  translocon	  insertion.	  Molecular	  microbiology	  63,	  1719-­‐1730	  144.	   Schiavolin,	  L.,	  Meghraoui,	  A.,	  Cherradi,	  Y.,	  Biskri,	  L.,	  Botteaux,	  A.,	  and	  Allaoui,	  A.	  (2013)	  Functional	  insights	  into	  the	  Shigella	  type	  III	  needle	  tip	  IpaD	  in	  secretion	  control	  and	  cell	  contact.	  Molecular	  microbiology	  88,	  268-­‐282	  145.	   Ligtenberg,	  K.	  G.,	  Miller,	  N.	  C.,	  Mitchell,	  A.,	  Plano,	  G.	  V.,	  and	  Schneewind,	  O.	  (2013)	  LcrV	  mutants	  that	  abolish	  Yersinia	  type	  III	  injectisome	  function.	  Journal	  of	  Bacteriology	  195,	  777-­‐787	  	   	   	  129	  146.	   Lee,	  P.	  C.,	  Stopford,	  C.	  M.,	  Svenson,	  A.	  G.,	  and	  Rietsch,	  A.	  (2010)	  Control	  of	  effector	  export	  by	  the	  Pseudomonas	  aeruginosa	  type	  III	  secretion	  proteins	  PcrG	  and	  PcrV.	  Molecular	  microbiology	  75,	  924-­‐941	  147.	   Costa,	  T.	  R.,	  Edqvist,	  P.	  J.,	  Broms,	  J.	  E.,	  Ahlund,	  M.	  K.,	  Forsberg,	  A.,	  and	  Francis,	  M.	  S.	  (2010)	  YopD	  self-­‐assembly	  and	  binding	  to	  LcrV	  facilitate	  type	  III	  secretion	  activity	  by	  Yersinia	  pseudotuberculosis.	  The	  Journal	  of	  biological	  chemistry	  285,	  25269-­‐25284	  148.	   Goure,	  J.,	  Pastor,	  A.,	  Faudry,	  E.,	  Chabert,	  J.,	  Dessen,	  A.,	  and	  Attree,	  I.	  (2004)	  The	  V	  antigen	  of	  Pseudomonas	  aeruginosa	  is	  required	  for	  assembly	  of	  the	  functional	  PopB/PopD	  translocation	  pore	  in	  host	  cell	  membranes.	  Infection	  and	  immunity	  72,	  4741-­‐4750	  149.	   Pettersson,	  J.,	  Holmstrom,	  A.,	  Hill,	  J.,	  Leary,	  S.,	  Frithz-­‐Lindsten,	  E.,	  von	  Euler-­‐Matell,	  A.,	  Carlsson,	  E.,	  Titball,	  R.,	  Forsberg,	  A.,	  and	  Wolf-­‐Watz,	  H.	  (1999)	  The	  V-­‐antigen	  of	  Yersinia	  is	  surface	  exposed	  before	  target	  cell	  contact	  and	  involved	  in	  virulence	  protein	  translocation.	  Molecular	  microbiology	  32,	  961-­‐976	  150.	   Stensrud,	  K.	  F.,	  Adam,	  P.	  R.,	  La	  Mar,	  C.	  D.,	  Olive,	  A.	  J.,	  Lushington,	  G.	  H.,	  Sudharsan,	  R.,	  Shelton,	  N.	  L.,	  Givens,	  R.	  S.,	  Picking,	  W.	  L.,	  and	  Picking,	  W.	  D.	  (2008)	  Deoxycholate	  interacts	  with	  IpaD	  of	  Shigella	  flexneri	  in	  inducing	  the	  recruitment	  of	  IpaB	  to	  the	  type	  III	  secretion	  apparatus	  needle	  tip.	  The	  Journal	  of	  biological	  chemistry	  283,	  18646-­‐18654	  151.	   Sato,	  H.,	  and	  Frank,	  D.	  W.	  (2011)	  Multi-­‐Functional	  Characteristics	  of	  the	  Pseudomonas	  aeruginosa	  Type	  III	  Needle-­‐Tip	  Protein,	  PcrV;	  Comparison	  to	  Orthologs	  in	  other	  Gram-­‐negative	  Bacteria.	  Frontiers	  in	  microbiology	  2,	  142	  152.	   Daniell,	  S.	  J.,	  Takahashi,	  N.,	  Wilson,	  R.,	  Friedberg,	  D.,	  Rosenshine,	  I.,	  Booy,	  F.	  P.,	  Shaw,	  R.	  K.,	  Knutton,	  S.,	  Frankel,	  G.,	  and	  Aizawa,	  S.	  (2001)	  The	  filamentous	  type	  III	  secretion	  translocon	  of	  enteropathogenic	  Escherichia	  coli.	  Cell	  Microbiol	  3,	  865-­‐871	  153.	   Sekiya,	  K.,	  Ohishi,	  M.,	  Ogino,	  T.,	  Tamano,	  K.,	  Sasakawa,	  C.,	  and	  Abe,	  A.	  (2001)	  Supermolecular	  structure	  of	  the	  enteropathogenic	  Escherichia	  coli	  type	  III	  secretion	  system	  and	  its	  direct	  interaction	  with	  the	  EspA-­‐sheath-­‐like	  structure.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  98,	  11638-­‐11643	  154.	   Daniell,	  S.	  J.,	  Kocsis,	  E.,	  Morris,	  E.,	  Knutton,	  S.,	  Booy,	  F.	  P.,	  and	  Frankel,	  G.	  (2003)	  3D	  structure	  of	  EspA	  filaments	  from	  enteropathogenic	  Escherichia	  coli.	  Molecular	  microbiology	  49,	  301-­‐308	  155.	   Wang,	  Y.	  A.,	  Yu,	  X.,	  Yip,	  C.,	  Strynadka,	  N.	  C.,	  and	  Egelman,	  E.	  H.	  (2006)	  Structural	  polymorphism	  in	  bacterial	  EspA	  filaments	  revealed	  by	  cryo-­‐EM	  and	  an	  improved	  approach	  to	  helical	  reconstruction.	  Structure	  14,	  1189-­‐1196	  156.	   Medhekar,	  B.,	  Shrivastava,	  R.,	  Mattoo,	  S.,	  Gingery,	  M.,	  and	  Miller,	  J.	  F.	  (2009)	  Bordetella	  Bsp22	  forms	  a	  filamentous	  type	  III	  secretion	  system	  tip	  complex	  and	  is	  immunoprotective	  in	  vitro	  and	  in	  vivo.	  Molecular	  microbiology	  71,	  492-­‐504	  157.	   Chaudhury,	  S.,	  Battaile,	  K.	  P.,	  Lovell,	  S.,	  Plano,	  G.	  V.,	  and	  De	  Guzman,	  R.	  N.	  (2013)	  Structure	  of	  the	  Yersinia	  pestis	  tip	  protein	  LcrV	  refined	  to	  1.65	  A	  resolution.	  Acta	  crystallographica.Section	  F,	  Structural	  biology	  and	  crystallization	  communications	  69,	  477-­‐481	  	   	   	  130	  158.	   Mueller,	  C.	  A.,	  Broz,	  P.,	  Muller,	  S.	  A.,	  Ringler,	  P.,	  Erne-­‐Brand,	  F.,	  Sorg,	  I.,	  Kuhn,	  M.,	  Engel,	  A.,	  and	  Cornelis,	  G.	  R.	  (2005)	  The	  V-­‐antigen	  of	  Yersinia	  forms	  a	  distinct	  structure	  at	  the	  tip	  of	  injectisome	  needles.	  Science	  (New	  York,	  N.Y.)	  310,	  674-­‐676	  159.	   Broz,	  P.,	  Mueller,	  C.	  A.,	  Muller,	  S.	  A.,	  Philippsen,	  A.,	  Sorg,	  I.,	  Engel,	  A.,	  and	  Cornelis,	  G.	  R.	  (2007)	  Function	  and	  molecular	  architecture	  of	  the	  Yersinia	  injectisome	  tip	  complex.	  Molecular	  microbiology	  65,	  1311-­‐1320	  160.	   Erskine,	  P.	  T.,	  Knight,	  M.	  J.,	  Ruaux,	  A.,	  Mikolajek,	  H.,	  Wong	  Fat	  Sang,	  N.,	  Withers,	  J.,	  Gill,	  R.,	  Wood,	  S.	  P.,	  Wood,	  M.,	  Fox,	  G.	  C.,	  and	  Cooper,	  J.	  B.	  (2006)	  High	  resolution	  structure	  of	  BipD:	  an	  invasion	  protein	  associated	  with	  the	  type	  III	  secretion	  system	  of	  Burkholderia	  pseudomallei.	  Journal	  of	  Molecular	  Biology	  363,	  125-­‐136	  161.	   Pal,	  M.,	  Erskine,	  P.	  T.,	  Gill,	  R.	  S.,	  Wood,	  S.	  P.,	  and	  Cooper,	  J.	  B.	  (2010)	  Near-­‐atomic	  resolution	  analysis	  of	  BipD,	  a	  component	  of	  the	  type	  III	  secretion	  system	  of	  Burkholderia	  pseudomallei.	  Acta	  crystallographica.Section	  F,	  Structural	  biology	  and	  crystallization	  communications	  66,	  990-­‐993	  162.	   Epler,	  C.	  R.,	  Dickenson,	  N.	  E.,	  Bullitt,	  E.,	  and	  Picking,	  W.	  L.	  (2012)	  Ultrastructural	  analysis	  of	  IpaD	  at	  the	  tip	  of	  the	  nascent	  MxiH	  type	  III	  secretion	  apparatus	  of	  Shigella	  flexneri.	  Journal	  of	  Molecular	  Biology	  420,	  29-­‐39	  163.	   Zhang,	  L.,	  Wang,	  Y.,	  Olive,	  A.	  J.,	  Smith,	  N.	  D.,	  Picking,	  W.	  D.,	  De	  Guzman,	  R.	  N.,	  and	  Picking,	  W.	  L.	  (2007)	  Identification	  of	  the	  MxiH	  needle	  protein	  residues	  responsible	  for	  anchoring	  invasion	  plasmid	  antigen	  D	  to	  the	  type	  III	  secretion	  needle	  tip.	  The	  Journal	  of	  biological	  chemistry	  282,	  32144-­‐32151	  164.	   Rathinavelan,	  T.,	  Tang,	  C.,	  and	  De	  Guzman,	  R.	  N.	  (2011)	  Characterization	  of	  the	  interaction	  between	  the	  Salmonella	  type	  III	  secretion	  system	  tip	  protein	  SipD	  and	  the	  needle	  protein	  PrgI	  by	  paramagnetic	  relaxation	  enhancement.	  The	  Journal	  of	  biological	  chemistry	  286,	  4922-­‐4930	  165.	   Sani,	  M.,	  Botteaux,	  A.,	  Parsot,	  C.,	  Sansonetti,	  P.,	  Boekema,	  E.	  J.,	  and	  Allaoui,	  A.	  (2007)	  IpaD	  is	  localized	  at	  the	  tip	  of	  the	  Shigella	  flexneri	  type	  III	  secretion	  apparatus.	  Biochimica	  et	  biophysica	  acta	  1770,	  307-­‐311	  166.	   Loquet,	  A.,	  Habenstein,	  B.,	  and	  Lange,	  A.	  (2013)	  Structural	  Investigations	  of	  Molecular	  Machines	  by	  Solid-­‐State	  NMR.	  Accounts	  of	  Chemical	  Research	  	  167.	   Olive,	  A.	  J.,	  Kenjale,	  R.,	  Espina,	  M.,	  Moore,	  D.	  S.,	  Picking,	  W.	  L.,	  and	  Picking,	  W.	  D.	  (2007)	  Bile	  salts	  stimulate	  recruitment	  of	  IpaB	  to	  the	  Shigella	  flexneri	  surface,	  where	  it	  colocalizes	  with	  IpaD	  at	  the	  tip	  of	  the	  type	  III	  secretion	  needle.	  Infection	  and	  immunity	  75,	  2626-­‐2629	  168.	   Prouty,	  A.	  M.,	  and	  Gunn,	  J.	  S.	  (2000)	  Salmonella	  enterica	  serovar	  typhimurium	  invasion	  is	  repressed	  in	  the	  presence	  of	  bile.	  Infection	  and	  immunity	  68,	  6763-­‐6769	  169.	   Dickenson,	  N.	  E.,	  Zhang,	  L.,	  Epler,	  C.	  R.,	  Adam,	  P.	  R.,	  Picking,	  W.	  L.,	  and	  Picking,	  W.	  D.	  (2011)	  Conformational	  changes	  in	  IpaD	  from	  Shigella	  flexneri	  upon	  binding	  bile	  salts	  provide	  insight	  into	  the	  second	  step	  of	  type	  III	  secretion.	  Biochemistry	  50,	  172-­‐180	  170.	   Wang,	  Y.,	  Nordhues,	  B.	  A.,	  Zhong,	  D.,	  and	  De	  Guzman,	  R.	  N.	  (2010)	  NMR	  characterization	  of	  the	  interaction	  of	  the	  Salmonella	  type	  III	  secretion	  system	  protein	  SipD	  and	  bile	  salts.	  Biochemistry	  49,	  4220-­‐4226	  	   	   	  131	  171.	   Schoehn,	  G.,	  Di	  Guilmi,	  A.	  M.,	  Lemaire,	  D.,	  Attree,	  I.,	  Weissenhorn,	  W.,	  and	  Dessen,	  A.	  (2003)	  Oligomerization	  of	  type	  III	  secretion	  proteins	  PopB	  and	  PopD	  precedes	  pore	  formation	  in	  Pseudomonas.	  The	  EMBO	  journal	  22,	  4957-­‐4967	  172.	   Blocker,	  A.,	  Gounon,	  P.,	  Larquet,	  E.,	  Niebuhr,	  K.,	  Cabiaux,	  V.,	  Parsot,	  C.,	  and	  Sansonetti,	  P.	  (1999)	  The	  tripartite	  type	  III	  secreton	  of	  Shigella	  flexneri	  inserts	  IpaB	  and	  IpaC	  into	  host	  membranes.	  The	  Journal	  of	  cell	  biology	  147,	  683-­‐693	  173.	   Hakansson,	  S.,	  Schesser,	  K.,	  Persson,	  C.,	  Galyov,	  E.	  E.,	  Rosqvist,	  R.,	  Homble,	  F.,	  and	  Wolf-­‐Watz,	  H.	  (1996)	  The	  YopB	  protein	  of	  Yersinia	  pseudotuberculosis	  is	  essential	  for	  the	  translocation	  of	  Yop	  effector	  proteins	  across	  the	  target	  cell	  plasma	  membrane	  and	  displays	  a	  contact-­‐dependent	  membrane	  disrupting	  activity.	  The	  EMBO	  journal	  15,	  5812-­‐5823	  174.	   Miki,	  T.,	  Okada,	  N.,	  Shimada,	  Y.,	  and	  Danbara,	  H.	  (2004)	  Characterization	  of	  Salmonella	  pathogenicity	  island	  1	  type	  III	  secretion-­‐dependent	  hemolytic	  activity	  in	  Salmonella	  enterica	  serovar	  Typhimurium.	  Microbial	  pathogenesis	  37,	  65-­‐72	  175.	   Ide,	  T.,	  Laarmann,	  S.,	  Greune,	  L.,	  Schillers,	  H.,	  Oberleithner,	  H.,	  and	  Schmidt,	  M.	  A.	  (2001)	  Characterization	  of	  translocation	  pores	  inserted	  into	  plasma	  membranes	  by	  type	  III-­‐secreted	  Esp	  proteins	  of	  enteropathogenic	  Escherichia	  coli.	  Cellular	  microbiology	  3,	  669-­‐679	  176.	   Mattei,	  P.	  J.,	  Faudry,	  E.,	  Job,	  V.,	  Izore,	  T.,	  Attree,	  I.,	  and	  Dessen,	  A.	  (2011)	  Membrane	  targeting	  and	  pore	  formation	  by	  the	  type	  III	  secretion	  system	  translocon.	  The	  FEBS	  journal	  278,	  414-­‐426	  177.	   Dohlich,	  K.,	  Zumsteg,	  A.	  B.,	  Goosmann,	  C.,	  and	  Kolbe,	  M.	  (2014)	  A	  Substrate-­‐Fusion	  Protein	  Is	  Trapped	  inside	  the	  Type	  III	  Secretion	  System	  Channel	  in	  Shigella	  flexneri.	  PLoS	  pathogens	  10,	  e1003881	  178.	   Akopyan,	  K.,	  Edgren,	  T.,	  Wang-­‐Edgren,	  H.,	  Rosqvist,	  R.,	  Fahlgren,	  A.,	  Wolf-­‐Watz,	  H.,	  and	  Fallman,	  M.	  (2011)	  Translocation	  of	  surface-­‐localized	  effectors	  in	  type	  III	  secretion.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  108,	  1639-­‐1644	  179.	   Edgren,	  T.,	  Forsberg,	  A.,	  Rosqvist,	  R.,	  and	  Wolf-­‐Watz,	  H.	  (2012)	  Type	  III	  secretion	  in	  Yersinia:	  injectisome	  or	  not?	  PLoS	  pathogens	  8,	  e1002669	  180.	   Galan,	  J.	  E.	  (2009)	  Common	  themes	  in	  the	  design	  and	  function	  of	  bacterial	  effectors.	  Cell	  host	  &	  microbe	  5,	  571-­‐579	  181.	   Lilic,	  M.,	  Galkin,	  V.	  E.,	  Orlova,	  A.,	  VanLoock,	  M.	  S.,	  Egelman,	  E.	  H.,	  and	  Stebbins,	  C.	  E.	  (2003)	  Salmonella	  SipA	  polymerizes	  actin	  by	  stapling	  filaments	  with	  nonglobular	  protein	  arms.	  Science	  (New	  York,	  N.Y.)	  301,	  1918-­‐1921	  182.	   Lin,	  D.	  Y.,	  Diao,	  J.,	  and	  Chen,	  J.	  (2012)	  Crystal	  structures	  of	  two	  bacterial	  HECT-­‐like	  E3	  ligases	  in	  complex	  with	  a	  human	  E2	  reveal	  atomic	  details	  of	  pathogen-­‐host	  interactions.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  109,	  1925-­‐1930	  183.	   Diao,	  J.,	  Zhang,	  Y.,	  Huibregtse,	  J.	  M.,	  Zhou,	  D.,	  and	  Chen,	  J.	  (2008)	  Crystal	  structure	  of	  SopA,	  a	  Salmonella	  effector	  protein	  mimicking	  a	  eukaryotic	  ubiquitin	  ligase.	  Nature	  structural	  &	  molecular	  biology	  15,	  65-­‐70	  184.	   Burkinshaw,	  B.	  J.,	  Prehna,	  G.,	  Worrall,	  L.	  J.,	  and	  Strynadka,	  N.	  C.	  (2012)	  Structure	  of	  Salmonella	  effector	  protein	  SopB	  N-­‐terminal	  domain	  in	  complex	  with	  host	  Rho	  GTPase	  Cdc42.	  J	  Biol	  Chem	  287,	  13348-­‐13355	  	   	   	  132	  185.	   Buchwald,	  G.,	  Friebel,	  A.,	  Galan,	  J.	  E.,	  Hardt,	  W.	  D.,	  Wittinghofer,	  A.,	  and	  Scheffzek,	  K.	  (2002)	  Structural	  basis	  for	  the	  reversible	  activation	  of	  a	  Rho	  protein	  by	  the	  bacterial	  toxin	  SopE.	  The	  EMBO	  journal	  21,	  3286-­‐3295	  186.	   Williams,	  C.,	  Galyov,	  E.	  E.,	  and	  Bagby,	  S.	  (2004)	  solution	  structure,	  backbone	  dynamics,	  and	  interaction	  with	  Cdc42	  of	  Salmonella	  guanine	  nucleotide	  exchange	  factor	  SopE2.	  Biochemistry	  43,	  11998-­‐12008	  187.	   Stebbins,	  C.	  E.,	  and	  Galan,	  J.	  E.	  (2000)	  Modulation	  of	  host	  signaling	  by	  a	  bacterial	  mimic:	  structure	  of	  the	  Salmonella	  effector	  SptP	  bound	  to	  Rac1.	  Molecular	  cell	  6,	  1449-­‐1460	  188.	   Diacovich,	  L.,	  Dumont,	  A.,	  Lafitte,	  D.,	  Soprano,	  E.,	  Guilhon,	  A.	  A.,	  Bignon,	  C.,	  Gorvel,	  J.	  P.,	  Bourne,	  Y.,	  and	  Meresse,	  S.	  (2009)	  Interaction	  between	  the	  SifA	  virulence	  factor	  and	  its	  host	  target	  SKIP	  is	  essential	  for	  Salmonella	  pathogenesis.	  The	  Journal	  of	  biological	  chemistry	  284,	  33151-­‐33160	  189.	   Ohlson,	  M.	  B.,	  Huang,	  Z.,	  Alto,	  N.	  M.,	  Blanc,	  M.	  P.,	  Dixon,	  J.	  E.,	  Chai,	  J.,	  and	  Miller,	  S.	  I.	  (2008)	  Structure	  and	  function	  of	  Salmonella	  SifA	  indicate	  that	  its	  interactions	  with	  SKIP,	  SseJ,	  and	  RhoA	  family	  GTPases	  induce	  endosomal	  tubulation.	  Cell	  host	  &	  microbe	  4,	  434-­‐446	  190.	   Bhaskaran,	  S.	  S.,	  and	  Stebbins,	  C.	  E.	  (2012)	  Structure	  of	  the	  catalytic	  domain	  of	  the	  Salmonella	  virulence	  factor	  SseI.	  Acta	  crystallographica.Section	  D,	  Biological	  crystallography	  68,	  1613-­‐1621	  191.	   Quezada,	  C.	  M.,	  Hicks,	  S.	  W.,	  Galan,	  J.	  E.,	  and	  Stebbins,	  C.	  E.	  (2009)	  A	  family	  of	  Salmonella	  virulence	  factors	  functions	  as	  a	  distinct	  class	  of	  autoregulated	  E3	  ubiquitin	  ligases.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  106,	  4864-­‐4869	  192.	   Margarit,	  S.	  M.,	  Davidson,	  W.,	  Frego,	  L.,	  and	  Stebbins,	  C.	  E.	  (2006)	  A	  steric	  antagonism	  of	  actin	  polymerization	  by	  a	  salmonella	  virulence	  protein.	  Structure	  (London,	  England	  :	  1993)	  14,	  1219-­‐1229	  193.	   Zhu,	  Y.,	  Li,	  H.,	  Long,	  C.,	  Hu,	  L.,	  Xu,	  H.,	  Liu,	  L.,	  Chen,	  S.,	  Wang,	  D.	  C.,	  and	  Shao,	  F.	  (2007)	  Structural	  insights	  into	  the	  enzymatic	  mechanism	  of	  the	  pathogenic	  MAPK	  phosphothreonine	  lyase.	  Molecular	  cell	  28,	  899-­‐913	  194.	   Chen,	  L.,	  Wang,	  H.,	  Zhang,	  J.,	  Gu,	  L.,	  Huang,	  N.,	  Zhou,	  J.	  M.,	  and	  Chai,	  J.	  (2008)	  Structural	  basis	  for	  the	  catalytic	  mechanism	  of	  phosphothreonine	  lyase.	  Nature	  structural	  &	  molecular	  biology	  15,	  101-­‐102	  195.	   Bishop,	  A.	  L.,	  and	  Hall,	  A.	  (2000)	  Rho	  GTPases	  and	  their	  effector	  proteins.	  The	  Biochemical	  journal	  348	  Pt	  2,	  241-­‐255	  196.	   Vetter,	  I.	  R.,	  and	  Wittinghofer,	  A.	  (2001)	  The	  guanine	  nucleotide-­‐binding	  switch	  in	  three	  dimensions.	  Science	  (New	  York,	  N.Y.)	  294,	  1299-­‐1304	  197.	   Hardt,	  W.	  D.,	  Chen,	  L.	  M.,	  Schuebel,	  K.	  E.,	  Bustelo,	  X.	  R.,	  and	  Galan,	  J.	  E.	  (1998)	  S.	  typhimurium	  encodes	  an	  activator	  of	  Rho	  GTPases	  that	  induces	  membrane	  ruffling	  and	  nuclear	  responses	  in	  host	  cells.	  Cell	  93,	  815-­‐826	  198.	   Stender,	  S.,	  Friebel,	  A.,	  Linder,	  S.,	  Rohde,	  M.,	  Mirold,	  S.,	  and	  Hardt,	  W.	  D.	  (2000)	  Identification	  of	  SopE2	  from	  Salmonella	  typhimurium,	  a	  conserved	  guanine	  nucleotide	  exchange	  factor	  for	  Cdc42	  of	  the	  host	  cell.	  Molecular	  microbiology	  36,	  1206-­‐1221	  199.	   Rudolph,	  M.	  G.,	  Weise,	  C.,	  Mirold,	  S.,	  Hillenbrand,	  B.,	  Bader,	  B.,	  Wittinghofer,	  A.,	  and	  Hardt,	  W.	  D.	  (1999)	  Biochemical	  analysis	  of	  SopE	  from	  Salmonella	  	   	   	  133	  typhimurium,	  a	  highly	  efficient	  guanosine	  nucleotide	  exchange	  factor	  for	  RhoGTPases.	  The	  Journal	  of	  biological	  chemistry	  274,	  30501-­‐30509	  200.	   Alto,	  N.	  M.,	  Shao,	  F.,	  Lazar,	  C.	  S.,	  Brost,	  R.	  L.,	  Chua,	  G.,	  Mattoo,	  S.,	  McMahon,	  S.	  A.,	  Ghosh,	  P.,	  Hughes,	  T.	  R.,	  Boone,	  C.,	  and	  Dixon,	  J.	  E.	  (2006)	  Identification	  of	  a	  bacterial	  type	  III	  effector	  family	  with	  G	  protein	  mimicry	  functions.	  Cell	  124,	  133-­‐145	  201.	   Jackson,	  S.	  P.,	  and	  Durocher,	  D.	  (2013)	  Regulation	  of	  DNA	  damage	  responses	  by	  ubiquitin	  and	  SUMO.	  Molecular	  cell	  49,	  795-­‐807	  202.	   Raiborg,	  C.,	  and	  Stenmark,	  H.	  (2009)	  The	  ESCRT	  machinery	  in	  endosomal	  sorting	  of	  ubiquitylated	  membrane	  proteins.	  Nature	  458,	  445-­‐452	  203.	   Mocciaro,	  A.,	  and	  Rape,	  M.	  (2012)	  Emerging	  regulatory	  mechanisms	  in	  ubiquitin-­‐dependent	  cell	  cycle	  control.	  Journal	  of	  cell	  science	  125,	  255-­‐263	  204.	   Hicks,	  S.	  W.,	  and	  Galan,	  J.	  E.	  (2010)	  Hijacking	  the	  host	  ubiquitin	  pathway:	  structural	  strategies	  of	  bacterial	  E3	  ubiquitin	  ligases.	  Current	  opinion	  in	  microbiology	  13,	  41-­‐46	  205.	   Capili,	  A.	  D.,	  and	  Lima,	  C.	  D.	  (2007)	  Taking	  it	  step	  by	  step:	  mechanistic	  insights	  from	  structural	  studies	  of	  ubiquitin/ubiquitin-­‐like	  protein	  modification	  pathways.	  Current	  opinion	  in	  structural	  biology	  17,	  726-­‐735	  206.	   Zhang,	  Y.,	  Higashide,	  W.	  M.,	  McCormick,	  B.	  A.,	  Chen,	  J.,	  and	  Zhou,	  D.	  (2006)	  The	  inflammation-­‐associated	  Salmonella	  SopA	  is	  a	  HECT-­‐like	  E3	  ubiquitin	  ligase.	  Molecular	  microbiology	  62,	  786-­‐793	  207.	   Rohde,	  J.	  R.,	  Breitkreutz,	  A.,	  Chenal,	  A.,	  Sansonetti,	  P.	  J.,	  and	  Parsot,	  C.	  (2007)	  Type	  III	  secretion	  effectors	  of	  the	  IpaH	  family	  are	  E3	  ubiquitin	  ligases.	  Cell	  host	  &	  microbe	  1,	  77-­‐83	  208.	   Zhou,	  D.,	  Mooseker,	  M.	  S.,	  and	  Galan,	  J.	  E.	  (1999)	  Role	  of	  the	  S.	  typhimurium	  actin-­‐binding	  protein	  SipA	  in	  bacterial	  internalization.	  Science	  (New	  York,	  N.Y.)	  283,	  2092-­‐2095	  209.	   Galkin,	  V.	  E.,	  Orlova,	  A.,	  VanLoock,	  M.	  S.,	  Zhou,	  D.,	  Galan,	  J.	  E.,	  and	  Egelman,	  E.	  H.	  (2002)	  The	  bacterial	  protein	  SipA	  polymerizes	  G-­‐actin	  and	  mimics	  muscle	  nebulin.	  Nature	  structural	  biology	  9,	  518-­‐521	  210.	   Lesnick,	  M.	  L.,	  Reiner,	  N.	  E.,	  Fierer,	  J.,	  and	  Guiney,	  D.	  G.	  (2001)	  The	  Salmonella	  spvB	  virulence	  gene	  encodes	  an	  enzyme	  that	  ADP-­‐ribosylates	  actin	  and	  destabilizes	  the	  cytoskeleton	  of	  eukaryotic	  cells.	  Molecular	  microbiology	  39,	  1464-­‐1470	  211.	   Tezcan-­‐Merdol,	  D.,	  Engstrand,	  L.,	  and	  Rhen,	  M.	  (2005)	  Salmonella	  enterica	  SpvB-­‐mediated	  ADP-­‐ribosylation	  as	  an	  activator	  for	  host	  cell	  actin	  degradation.	  International	  journal	  of	  medical	  microbiology	  :	  IJMM	  295,	  201-­‐212	  212.	   Stein,	  M.	  A.,	  Leung,	  K.	  Y.,	  Zwick,	  M.,	  Garcia-­‐del	  Portillo,	  F.,	  and	  Finlay,	  B.	  B.	  (1996)	  Identification	  of	  a	  Salmonella	  virulence	  gene	  required	  for	  formation	  of	  filamentous	  structures	  containing	  lysosomal	  membrane	  glycoproteins	  within	  epithelial	  cells.	  Molecular	  microbiology	  20,	  151-­‐164	  213.	   Brumell,	  J.	  H.,	  Goosney,	  D.	  L.,	  and	  Finlay,	  B.	  B.	  (2002)	  SifA,	  a	  type	  III	  secreted	  effector	  of	  Salmonella	  typhimurium,	  directs	  Salmonella-­‐induced	  filament	  (Sif)	  formation	  along	  microtubules.	  Traffic	  (Copenhagen,	  Denmark)	  3,	  407-­‐415	  214.	   Bryce,	  J.,	  Boschi-­‐Pinto,	  C.,	  Shibuya,	  K.,	  Black,	  R.	  E.,	  and	  Group,	  W.	  H.	  O.	  C.	  H.	  E.	  R.	  (2005)	  WHO	  estimates	  of	  the	  causes	  of	  death	  in	  children.	  Lancet	  365,	  1147-­‐1152	  	   	   	  134	  215.	   Lanata,	  C.	  F.,	  Fischer-­‐Walker,	  C.	  L.,	  Olascoaga,	  A.	  C.,	  Torres,	  C.	  X.,	  Aryee,	  M.	  J.,	  Black,	  R.	  E.,	  Child	  Health	  Epidemiology	  Reference	  Group	  of	  the	  World	  Health,	  O.,	  and	  Unicef.	  (2013)	  Global	  causes	  of	  diarrheal	  disease	  mortality	  in	  children	  <5	  years	  of	  age:	  a	  systematic	  review.	  PloS	  one	  8,	  e72788	  216.	   Jerse,	  A.	  E.,	  Yu,	  J.,	  Tall,	  B.	  D.,	  and	  Kaper,	  J.	  B.	  (1990)	  A	  genetic	  locus	  of	  enteropathogenic	  Escherichia	  coli	  necessary	  for	  the	  production	  of	  attaching	  and	  effacing	  lesions	  on	  tissue	  culture	  cells.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  87,	  7839-­‐7843	  217.	   Moon,	  H.	  W.,	  Whipp,	  S.	  C.,	  Argenzio,	  R.	  A.,	  Levine,	  M.	  M.,	  and	  Giannella,	  R.	  A.	  (1983)	  Attaching	  and	  effacing	  activities	  of	  rabbit	  and	  human	  enteropathogenic	  Escherichia	  coli	  in	  pig	  and	  rabbit	  intestines.	  Infection	  and	  immunity	  41,	  1340-­‐1351	  218.	   Rosenshine,	  I.,	  Ruschkowski,	  S.,	  Stein,	  M.,	  Reinscheid,	  D.	  J.,	  Mills,	  S.	  D.,	  and	  Finlay,	  B.	  B.	  (1996)	  A	  pathogenic	  bacterium	  triggers	  epithelial	  signals	  to	  form	  a	  functional	  bacterial	  receptor	  that	  mediates	  actin	  pseudopod	  formation.	  The	  EMBO	  journal	  15,	  2613-­‐2624	  219.	   Taylor,	  C.	  J.,	  Hart,	  A.,	  Batt,	  R.	  M.,	  McDougall,	  C.,	  and	  McLean,	  L.	  (1986)	  Ultrastructural	  and	  biochemical	  changes	  in	  human	  jejunal	  mucosa	  associated	  with	  enteropathogenic	  Escherichia	  coli	  (0111)	  infection.	  Journal	  of	  pediatric	  gastroenterology	  and	  nutrition	  5,	  70-­‐73	  220.	   Wong,	  A.	  R.,	  Pearson,	  J.	  S.,	  Bright,	  M.	  D.,	  Munera,	  D.,	  Robinson,	  K.	  S.,	  Lee,	  S.	  F.,	  Frankel,	  G.,	  and	  Hartland,	  E.	  L.	  (2011)	  Enteropathogenic	  and	  enterohaemorrhagic	  Escherichia	  coli:	  even	  more	  subversive	  elements.	  Mol	  Microbiol	  80,	  1420-­‐1438	  221.	   Schraidt,	  O.,	  and	  Marlovits,	  T.	  C.	  (2011)	  Three-­‐dimensional	  model	  of	  Salmonella's	  needle	  complex	  at	  subnanometer	  resolution.	  Science	  331,	  1192-­‐1195	  222.	   Knutton,	  S.,	  Rosenshine,	  I.,	  Pallen,	  M.	  J.,	  Nisan,	  I.,	  Neves,	  B.	  C.,	  Bain,	  C.,	  Wolff,	  C.,	  Dougan,	  G.,	  and	  Frankel,	  G.	  (1998)	  A	  novel	  EspA-­‐associated	  surface	  organelle	  of	  enteropathogenic	  Escherichia	  coli	  involved	  in	  protein	  translocation	  into	  epithelial	  cells.	  The	  EMBO	  journal	  17,	  2166-­‐2176	  223.	   Dijkstra,	  A.	  J.,	  and	  Keck,	  W.	  (1996)	  Peptidoglycan	  as	  a	  barrier	  to	  transenvelope	  transport.	  Journal	  of	  bacteriology	  178,	  5555-­‐5562	  224.	   Scheurwater,	  E.,	  Reid,	  C.	  W.,	  and	  Clarke,	  A.	  J.	  (2008)	  Lytic	  transglycosylases:	  bacterial	  space-­‐making	  autolysins.	  Int	  J	  Biochem	  Cell	  Biol	  40,	  586-­‐591	  225.	   Scheurwater,	  E.	  M.,	  and	  Burrows,	  L.	  L.	  (2011)	  Maintaining	  network	  security:	  how	  macromolecular	  structures	  cross	  the	  peptidoglycan	  layer.	  FEMS	  microbiology	  letters	  318,	  1-­‐9	  226.	   Demchick,	  P.,	  and	  Koch,	  A.	  L.	  (1996)	  The	  permeability	  of	  the	  wall	  fabric	  of	  Escherichia	  coli	  and	  Bacillus	  subtilis.	  J	  Bacteriol	  178,	  768-­‐773	  227.	   Meroueh,	  S.	  O.,	  Bencze,	  K.	  Z.,	  Hesek,	  D.,	  Lee,	  M.,	  Fisher,	  J.	  F.,	  Stemmler,	  T.	  L.,	  and	  Mobashery,	  S.	  (2006)	  Three-­‐dimensional	  structure	  of	  the	  bacterial	  cell	  wall	  peptidoglycan.	  Proc	  Natl	  Acad	  Sci	  U	  S	  A	  103,	  4404-­‐4409	  228.	   Uehara,	  T.,	  Suefuji,	  K.,	  Valbuena,	  N.,	  Meehan,	  B.,	  Donegan,	  M.,	  and	  Park,	  J.	  T.	  (2005)	  Recycling	  of	  the	  anhydro-­‐N-­‐acetylmuramic	  acid	  derived	  from	  cell	  wall	  murein	  involves	  a	  two-­‐step	  conversion	  to	  N-­‐acetylglucosamine-­‐phosphate.	  Journal	  of	  bacteriology	  187,	  3643-­‐3649	  	   	   	  135	  229.	   Allaoui,	  A.,	  Menard,	  R.,	  Sansonetti,	  P.	  J.,	  and	  Parsot,	  C.	  (1993)	  Characterization	  of	  the	  Shigella	  flexneri	  ipgD	  and	  ipgF	  genes,	  which	  are	  located	  in	  the	  proximal	  part	  of	  the	  mxi	  locus.	  Infect	  Immun	  61,	  1707-­‐1714	  230.	   Vollmer,	  W.,	  Joris,	  B.,	  Charlier,	  P.,	  and	  Foster,	  S.	  (2008)	  Bacterial	  peptidoglycan	  (murein)	  hydrolases.	  FEMS	  microbiology	  reviews	  32,	  259-­‐286	  231.	   Thunnissen,	  A.	  M.,	  Dijkstra,	  A.	  J.,	  Kalk,	  K.	  H.,	  Rozeboom,	  H.	  J.,	  Engel,	  H.,	  Keck,	  W.,	  and	  Dijkstra,	  B.	  W.	  (1994)	  Doughnut-­‐shaped	  structure	  of	  a	  bacterial	  muramidase	  revealed	  by	  X-­‐ray	  crystallography.	  Nature	  367,	  750-­‐753	  232.	   Thunnissen,	  A.	  M.,	  Rozeboom,	  H.	  J.,	  Kalk,	  K.	  H.,	  and	  Dijkstra,	  B.	  W.	  (1995)	  Structure	  of	  the	  70-­‐kDa	  soluble	  lytic	  transglycosylase	  complexed	  with	  bulgecin	  A.	  Implications	  for	  the	  enzymatic	  mechanism.	  Biochemistry	  34,	  12729-­‐12737	  233.	   van	  Asselt,	  E.	  J.,	  Thunnissen,	  A.	  M.,	  and	  Dijkstra,	  B.	  W.	  (1999)	  High	  resolution	  crystal	  structures	  of	  the	  Escherichia	  coli	  lytic	  transglycosylase	  Slt70	  and	  its	  complex	  with	  a	  peptidoglycan	  fragment.	  Journal	  of	  molecular	  biology	  291,	  877-­‐898	  234.	   Yu,	  Y.	  C.,	  Lin,	  C.	  N.,	  Wang,	  S.	  H.,	  Ng,	  S.	  C.,	  Hu,	  W.	  S.,	  and	  Syu,	  W.	  J.	  (2010)	  A	  putative	  lytic	  transglycosylase	  tightly	  regulated	  and	  critical	  for	  the	  EHEC	  type	  three	  secretion.	  J	  Biomed	  Sci	  17,	  52	  235.	   Hoppner,	  C.,	  Carle,	  A.,	  Sivanesan,	  D.,	  Hoeppner,	  S.,	  and	  Baron,	  C.	  (2005)	  The	  putative	  lytic	  transglycosylase	  VirB1	  from	  Brucella	  suis	  interacts	  with	  the	  type	  IV	  secretion	  system	  core	  components	  VirB8,	  VirB9	  and	  VirB11.	  Microbiology	  151,	  3469-­‐3482	  236.	   Hirano,	  T.,	  Minamino,	  T.,	  and	  Macnab,	  R.	  M.	  (2001)	  The	  role	  in	  flagellar	  rod	  assembly	  of	  the	  N-­‐terminal	  domain	  of	  Salmonella	  FlgJ,	  a	  flagellum-­‐specific	  muramidase.	  Journal	  of	  molecular	  biology	  312,	  359-­‐369	  237.	   .	  	  238.	   Blackburn,	  N.	  T.,	  and	  Clarke,	  A.	  J.	  (2002)	  Characterization	  of	  soluble	  and	  membrane-­‐bound	  family	  3	  lytic	  transglycosylases	  from	  Pseudomonas	  aeruginosa.	  Biochemistry	  41,	  1001-­‐1013	  239.	   Baron,	  C.,	  and	  Coombes,	  B.	  (2007)	  Targeting	  bacterial	  secretion	  systems:	  benefits	  of	  disarmament	  in	  the	  microcosm.	  Infectious	  disorders	  drug	  targets	  7,	  19-­‐27	  240.	   Dong,	  A.,	  Xu,	  X.,	  Edwards,	  A.	  M.,	  Chang,	  C.,	  Chruszcz,	  M.,	  Cuff,	  M.,	  Cymborowski,	  M.,	  Di	  Leo,	  R.,	  Egorova,	  O.,	  Evdokimova,	  E.,	  Filippova,	  E.,	  Gu,	  J.,	  Guthrie,	  J.,	  Ignatchenko,	  A.,	  Joachimiak,	  A.,	  Klostermann,	  N.,	  Kim,	  Y.,	  Korniyenko,	  Y.,	  Minor,	  W.,	  Que,	  Q.,	  Savchenko,	  A.,	  Skarina,	  T.,	  Tan,	  K.,	  Yakunin,	  A.,	  Yee,	  A.,	  Yim,	  V.,	  Zhang,	  R.,	  Zheng,	  H.,	  Akutsu,	  M.,	  Arrowsmith,	  C.,	  Avvakumov,	  G.	  V.,	  Bochkarev,	  A.,	  Dahlgren,	  L.	  G.,	  Dhe-­‐Paganon,	  S.,	  Dimov,	  S.,	  Dombrovski,	  L.,	  Finerty,	  P.,	  Flodin,	  S.,	  Flores,	  A.,	  Gräslund,	  S.,	  Hammerström,	  M.,	  Herman,	  M.	  D.,	  Hong,	  B.	  S.,	  Hui,	  R.,	  Johansson,	  I.,	  Liu,	  Y.,	  Nilsson,	  M.,	  Nedyalkova,	  L.,	  Nordlund,	  P.,	  Nyman,	  T.,	  Min,	  J.,	  Ouyang,	  H.,	  Park,	  H.	  W.,	  Qi,	  C.,	  Rabeh,	  W.,	  Shen,	  L.,	  Shen,	  Y.,	  Sukumard,	  D.,	  Tempel,	  W.,	  Tong,	  Y.,	  Tresagues,	  L.,	  Vedadi,	  M.,	  Walker,	  J.	  R.,	  Weigelt,	  J.,	  Welin,	  M.,	  Wu,	  H.,	  Xiao,	  T.,	  Zeng,	  H.,	  Zhu,	  H.,	  Genomics,	  M.	  C.	  f.	  S.,	  and	  Consortium,	  S.	  G.	  (2007)	  In	  situ	  proteolysis	  for	  protein	  crystallization	  and	  structure	  determination.	  Nat	  Methods	  4,	  1019-­‐1021	  241.	   Winter,	  G.,	  Lobley,	  C.	  M.,	  and	  Prince,	  S.	  M.	  (2013)	  Decision	  making	  in	  xia2.	  Acta	  Crystallogr	  D	  Biol	  Crystallogr	  69,	  1260-­‐1273	  	   	   	  136	  242.	   Vonrhein,	  C.,	  Blanc,	  E.,	  Roversi,	  P.,	  and	  Bricogne,	  G.	  (2007)	  Automated	  structure	  solution	  with	  autoSHARP.	  Methods	  Mol	  Biol	  364,	  215-­‐230	  243.	   Joosten,	  R.	  P.,	  Long,	  F.,	  Murshudov,	  G.	  N.,	  and	  Perrakis,	  A.	  (2014)	  The	  PDB_REDO	  server	  for	  macromolecular	  structure	  model	  optimization.	  IUCrJ	  1,	  213-­‐220	  244.	   Emsley,	  P.,	  Lohkamp,	  B.,	  Scott,	  W.	  G.,	  and	  Cowtan,	  K.	  (2010)	  Features	  and	  development	  of	  Coot.	  Acta	  Crystallogr	  D	  Biol	  Crystallogr	  66,	  486-­‐501	  245.	   Winn,	  M.	  D.,	  Ballard,	  C.	  C.,	  Cowtan,	  K.	  D.,	  Dodson,	  E.	  J.,	  Emsley,	  P.,	  Evans,	  P.	  R.,	  Keegan,	  R.	  M.,	  Krissinel,	  E.	  B.,	  Leslie,	  A.	  G.,	  McCoy,	  A.,	  McNicholas,	  S.	  J.,	  Murshudov,	  G.	  N.,	  Pannu,	  N.	  S.,	  Potterton,	  E.	  A.,	  Powell,	  H.	  R.,	  Read,	  R.	  J.,	  Vagin,	  A.,	  and	  Wilson,	  K.	  S.	  (2011)	  Overview	  of	  the	  CCP4	  suite	  and	  current	  developments.	  Acta	  Crystallogr	  D	  Biol	  Crystallogr	  67,	  235-­‐242	  246.	   Murshudov,	  G.	  N.,	  Vagin,	  A.	  A.,	  and	  Dodson,	  E.	  J.	  (1997)	  Refinement	  of	  macromolecular	  structures	  by	  the	  maximum-­‐likelihood	  method.	  Acta	  Crystallogr	  D	  Biol	  Crystallogr	  53,	  240-­‐255	  247.	   Pettersen,	  E.	  F.,	  Goddard,	  T.	  D.,	  Huang,	  C.	  C.,	  Couch,	  G.	  S.,	  Greenblatt,	  D.	  M.,	  Meng,	  E.	  C.,	  and	  Ferrin,	  T.	  E.	  (2004)	  UCSF	  Chimera-­‐-­‐a	  visualization	  system	  for	  exploratory	  research	  and	  analysis.	  J	  Comput	  Chem	  25,	  1605-­‐1612	  248.	   Donnenberg,	  M.	  S.,	  and	  Kaper,	  J.	  B.	  (1991)	  Construction	  of	  an	  eae	  deletion	  mutant	  of	  enteropathogenic	  Escherichia	  coli	  by	  using	  a	  positive-­‐selection	  suicide	  vector.	  Infect	  Immun	  59,	  4310-­‐4317	  249.	   Vedadi,	  M.,	  Niesen,	  F.	  H.,	  Allali-­‐Hassani,	  A.,	  Fedorov,	  O.	  Y.,	  Finerty,	  P.	  J.,	  Jr.,	  Wasney,	  G.	  A.,	  Yeung,	  R.,	  Arrowsmith,	  C.,	  Ball,	  L.	  J.,	  Berglund,	  H.,	  Hui,	  R.,	  Marsden,	  B.	  D.,	  Nordlund,	  P.,	  Sundstrom,	  M.,	  Weigelt,	  J.,	  and	  Edwards,	  A.	  M.	  (2006)	  Chemical	  screening	  methods	  to	  identify	  ligands	  that	  promote	  protein	  stability,	  protein	  crystallization,	  and	  structure	  determination.	  Proceedings	  of	  the	  National	  Academy	  of	  Sciences	  of	  the	  United	  States	  of	  America	  103,	  15835-­‐15840	  250.	   Strynadka,	  N.	  C.,	  and	  James,	  M.	  N.	  (1991)	  Lysozyme	  revisited:	  crystallographic	  evidence	  for	  distortion	  of	  an	  N-­‐acetylmuramic	  acid	  residue	  bound	  in	  site	  D.	  J	  Mol	  Biol	  220,	  401-­‐424	  251.	   Vocadlo,	  D.	  J.,	  Davies,	  G.	  J.,	  Laine,	  R.,	  and	  Withers,	  S.	  G.	  (2001)	  Catalysis	  by	  hen	  egg-­‐white	  lysozyme	  proceeds	  via	  a	  covalent	  intermediate.	  Nature	  412,	  835-­‐838	  252.	   Hashimoto,	  W.,	  Ochiai,	  A.,	  Momma,	  K.,	  Itoh,	  T.,	  Mikami,	  B.,	  Maruyama,	  Y.,	  and	  Murata,	  K.	  (2009)	  Crystal	  structure	  of	  the	  glycosidase	  family	  73	  peptidoglycan	  hydrolase	  FlgJ.	  Biochem	  Biophys	  Res	  Commun	  381,	  16-­‐21	  253.	   Kelly,	  J.	  A.,	  Sielecki,	  A.	  R.,	  Sykes,	  B.	  D.,	  James,	  M.	  N.,	  and	  Phillips,	  D.	  C.	  (1979)	  X-­‐ray	  crystallography	  of	  the	  binding	  of	  the	  bacterial	  cell	  wall	  trisaccharide	  NAM-­‐NAG-­‐NAM	  to	  lysozyme.	  Nature	  282,	  875-­‐878	  254.	   Fibriansah,	  G.,	  Gliubich,	  F.	  I.,	  and	  Thunnissen,	  A.	  M.	  (2012)	  On	  the	  mechanism	  of	  peptidoglycan	  binding	  and	  cleavage	  by	  the	  endo-­‐specific	  lytic	  transglycosylase	  MltE	  from	  Escherichia	  coli.	  Biochemistry	  51,	  9164-­‐9177	  255.	   Herlihey,	  F.	  A.,	  Moynihan,	  P.	  J.,	  and	  Clarke,	  A.	  J.	  (2014)	  The	  essential	  protein	  for	  bacterial	  flagella	  formation	  FlgJ	  functions	  as	  a	  β-­‐N-­‐acetylglucosaminidase.	  J	  Biol	  Chem	  	  256.	   Roure,	  S.,	  Bonis,	  M.,	  Chaput,	  C.,	  Ecobichon,	  C.,	  Mattox,	  A.,	  Barrière,	  C.,	  Geldmacher,	  N.,	  Guadagnini,	  S.,	  Schmitt,	  C.,	  Prévost,	  M.	  C.,	  Labigne,	  A.,	  Backert,	  S.,	  Ferrero,	  R.	  L.,	  	   	   	  137	  and	  Boneca,	  I.	  G.	  (2012)	  Peptidoglycan	  maturation	  enzymes	  affect	  flagellar	  functionality	  in	  bacteria.	  Mol	  Microbiol	  86,	  845-­‐856	  257.	   Pucciarelli,	  M.	  G.,	  and	  García-­‐del	  Portillo,	  F.	  (2003)	  Protein-­‐peptidoglycan	  interactions	  modulate	  the	  assembly	  of	  the	  needle	  complex	  in	  the	  Salmonella	  invasion-­‐associated	  type	  III	  secretion	  system.	  Mol	  Microbiol	  48,	  573-­‐585	  258.	   Oh,	  H.	  S.,	  Kvitko,	  B.	  H.,	  Morello,	  J.	  E.,	  and	  Collmer,	  A.	  (2007)	  Pseudomonas	  syringae	  lytic	  transglycosylases	  coregulated	  with	  the	  type	  III	  secretion	  system	  contribute	  to	  the	  translocation	  of	  effector	  proteins	  into	  plant	  cells.	  J	  Bacteriol	  189,	  8277-­‐8289	  259.	   Raymond,	  B.,	  Young,	  J.	  C.,	  Pallett,	  M.,	  Endres,	  R.	  G.,	  Clements,	  A.,	  and	  Frankel,	  G.	  (2013)	  Subversion	  of	  trafficking,	  apoptosis,	  and	  innate	  immunity	  by	  type	  III	  secretion	  system	  effectors.	  Trends	  Microbiol	  21,	  430-­‐441	  260.	   Diepold,	  A.,	  and	  Wagner,	  S.	  (2014)	  Assembly	  of	  the	  bacterial	  type	  III	  secretion	  machinery.	  FEMS	  Microbiol	  Rev	  38,	  802-­‐822	  261.	   Chatterjee,	  S.,	  Chaudhury,	  S.,	  McShan,	  A.	  C.,	  Kaur,	  K.,	  and	  De	  Guzman,	  R.	  N.	  (2013)	  Stucture	  and	  biophysics	  of	  Type	  III	  secretion	  in	  bacteria.	  Biochemistry	  	  262.	   Day,	  J.	  B.,	  Ferracci,	  F.,	  and	  Plano,	  G.	  V.	  (2003)	  Translocation	  of	  YopE	  and	  YopN	  into	  eukaryotic	  cells	  by	  Yersinia	  pestis	  yopN,	  tyeA,	  sycN,	  yscB	  and	  lcrG	  deletion	  mutants	  measured	  using	  a	  phosphorylatable	  peptide	  tag	  and	  phosphospecific	  antibodies.	  Mol	  Microbiol	  47,	  807-­‐823	  263.	   Ferracci,	  F.,	  Schubot,	  F.	  D.,	  Waugh,	  D.	  S.,	  and	  Plano,	  G.	  V.	  (2005)	  Selection	  and	  characterization	  of	  Yersinia	  pestis	  YopN	  mutants	  that	  constitutively	  block	  Yop	  secretion.	  Mol	  Microbiol	  57,	  970-­‐987	  264.	   Archuleta,	  T.	  L.,	  and	  Spiller,	  B.	  W.	  (2014)	  A	  gatekeeper	  chaperone	  complex	  directs	  translocator	  secretion	  during	  type	  three	  secretion.	  PLoS	  Pathog	  10,	  e1004498	  265.	   Younis,	  R.,	  Bingle,	  L.	  E.,	  Rollauer,	  S.,	  Munera,	  D.,	  Busby,	  S.	  J.,	  Johnson,	  S.,	  Deane,	  J.	  E.,	  Lea,	  S.	  M.,	  Frankel,	  G.,	  and	  Pallen,	  M.	  J.	  (2010)	  SepL	  resembles	  an	  aberrant	  effector	  in	  binding	  to	  a	  class	  1	  type	  III	  secretion	  chaperone	  and	  carrying	  an	  N-­‐terminal	  secretion	  signal.	  J	  Bacteriol	  192,	  6093-­‐6098	  266.	   Fields,	  K.	  A.,	  and	  Hackstadt,	  T.	  (2000)	  Evidence	  for	  the	  secretion	  of	  Chlamydia	  trachomatis	  CopN	  by	  a	  type	  III	  secretion	  mechanism.	  Mol	  Microbiol	  38,	  1048-­‐1060	  267.	   Archuleta,	  T.	  L.,	  Du,	  Y.,	  English,	  C.	  A.,	  Lory,	  S.,	  Lesser,	  C.,	  Ohi,	  M.	  D.,	  Ohi,	  R.,	  and	  Spiller,	  B.	  W.	  (2011)	  The	  Chlamydia	  effector	  chlamydial	  outer	  protein	  N	  (CopN)	  sequesters	  tubulin	  and	  prevents	  microtubule	  assembly.	  J	  Biol	  Chem	  286,	  33992-­‐33998	  268.	   Nawrotek,	  A.,	  Guimarães,	  B.	  G.,	  Velours,	  C.,	  Subtil,	  A.,	  Knossow,	  M.,	  and	  Gigant,	  B.	  (2014)	  Biochemical	  and	  structural	  insights	  into	  microtubule	  perturbation	  by	  CopN	  from	  Chlamydia	  pneumoniae.	  J	  Biol	  Chem	  289,	  25199-­‐25210	  269.	   Wang,	  D.,	  Roe,	  A.	  J.,	  McAteer,	  S.,	  Shipston,	  M.	  J.,	  and	  Gally,	  D.	  L.	  (2008)	  Hierarchal	  type	  III	  secretion	  of	  translocators	  and	  effectors	  from	  Escherichia	  coli	  O157:H7	  requires	  the	  carboxy	  terminus	  of	  SepL	  that	  binds	  to	  Tir.	  Mol	  Microbiol	  69,	  1499-­‐1512	  	   	   	  138	  270.	   McCoy,	  A.	  J.,	  Grosse-­‐Kunstleve,	  R.	  W.,	  Adams,	  P.	  D.,	  Winn,	  M.	  D.,	  Storoni,	  L.	  C.,	  and	  Read,	  R.	  J.	  (2007)	  Phaser	  crystallographic	  software.	  J	  Appl	  Crystallogr	  40,	  658-­‐674	  271.	   Bricogne	  G.,	  Blanc	  E.,	  Brandl	  M.,	  Flensburg	  C.,	  Keller	  P.,	  Paciorek	  W.,	  Roversi	  P,	  Sharff	  A.,	  Smart	  O.S.,	  Vonrhein	  C.,	  and	  T.O.,	  W.	  (2011)	  BUSTER	  version	  2.10.0.	  Cambridge,	  United	  Kingdom:	  Global	  Phasing	  Ltd.	  272.	   Crump,	  J.	  A.,	  Luby,	  S.	  P.,	  and	  Mintz,	  E.	  D.	  (2004)	  The	  global	  burden	  of	  typhoid	  fever.	  Bull	  World	  Health	  Organ	  82,	  346-­‐353	  273.	   Majowicz,	  S.	  E.,	  Musto,	  J.,	  Scallan,	  E.,	  Angulo,	  F.	  J.,	  Kirk,	  M.,	  O'Brien,	  S.	  J.,	  Jones,	  T.	  F.,	  Fazil,	  A.,	  Hoekstra,	  R.	  M.,	  and	  Studies,	  I.	  C.	  o.	  E.	  D.	  B.	  o.	  I.	  (2010)	  The	  global	  burden	  of	  nontyphoidal	  Salmonella	  gastroenteritis.	  Clin	  Infect	  Dis	  50,	  882-­‐889	  274.	   Ibarra,	  J.	  A.,	  and	  Steele-­‐Mortimer,	  O.	  (2009)	  Salmonella-­‐-­‐the	  ultimate	  insider.	  Salmonella	  virulence	  factors	  that	  modulate	  intracellular	  survival.	  Cell	  Microbiol	  11,	  1579-­‐1586	  275.	   Terebiznik,	  M.	  R.,	  Vieira,	  O.	  V.,	  Marcus,	  S.	  L.,	  Slade,	  A.,	  Yip,	  C.	  M.,	  Trimble,	  W.	  S.,	  Meyer,	  T.,	  Finlay,	  B.	  B.,	  and	  Grinstein,	  S.	  (2002)	  Elimination	  of	  host	  cell	  PtdIns(4,5)P(2)	  by	  bacterial	  SigD	  promotes	  membrane	  fission	  during	  invasion	  by	  Salmonella.	  Nat	  Cell	  Biol	  4,	  766-­‐773	  276.	   Patel,	  J.	  C.,	  Hueffer,	  K.,	  Lam,	  T.	  T.,	  and	  Galán,	  J.	  E.	  (2009)	  Diversification	  of	  a	  Salmonella	  virulence	  protein	  function	  by	  ubiquitin-­‐dependent	  differential	  localization.	  Cell	  137,	  283-­‐294	  277.	   .	  	  278.	   Bakowski,	  M.	  A.,	  Braun,	  V.,	  Lam,	  G.	  Y.,	  Yeung,	  T.,	  Heo,	  W.	  D.,	  Meyer,	  T.,	  Finlay,	  B.	  B.,	  Grinstein,	  S.,	  and	  Brumell,	  J.	  H.	  (2010)	  The	  phosphoinositide	  phosphatase	  SopB	  manipulates	  membrane	  surface	  charge	  and	  trafficking	  of	  the	  Salmonella-­‐containing	  vacuole.	  Cell	  Host	  Microbe	  7,	  453-­‐462	  279.	   Alemán,	  A.,	  Rodríguez-­‐Escudero,	  I.,	  Mallo,	  G.	  V.,	  Cid,	  V.	  J.,	  Molina,	  M.,	  and	  Rotger,	  R.	  (2005)	  The	  amino-­‐terminal	  non-­‐catalytic	  region	  of	  Salmonella	  typhimurium	  SigD	  affects	  actin	  organization	  in	  yeast	  and	  mammalian	  cells.	  Cell	  Microbiol	  7,	  1432-­‐1446	  280.	   Rodriguez-­‐Escudero,	  I.,	  Rotger,	  R.,	  Cid,	  V.	  J.,	  and	  Molina,	  M.	  (2006)	  Inhibition	  of	  Cdc42-­‐dependent	  signalling	  in	  Saccharomyces	  cerevisiae	  by	  phosphatase-­‐dead	  SigD/SopB	  from	  Salmonella	  typhimurium.	  Microbiology	  (Reading,	  England)	  152,	  3437-­‐3452	  281.	   Sinha,	  S.,	  and	  Yang,	  W.	  (2008)	  Cellular	  signaling	  for	  activation	  of	  Rho	  GTPase	  Cdc42.	  Cell	  Signal	  20,	  1927-­‐1934	  282.	   Hall,	  A.	  (1998)	  Rho	  GTPases	  and	  the	  actin	  cytoskeleton.	  Science	  279,	  509-­‐514	  283.	   Morreale,	  A.,	  Venkatesan,	  M.,	  Mott,	  H.	  R.,	  Owen,	  D.,	  Nietlispach,	  D.,	  Lowe,	  P.	  N.,	  and	  Laue,	  E.	  D.	  (2000)	  Structure	  of	  Cdc42	  bound	  to	  the	  GTPase	  binding	  domain	  of	  PAK.	  Nat	  Struct	  Biol	  7,	  384-­‐388	  284.	   Abdul-­‐Manan,	  N.,	  Aghazadeh,	  B.,	  Liu,	  G.	  A.,	  Majumdar,	  A.,	  Ouerfelli,	  O.,	  Siminovitch,	  K.	  A.,	  and	  Rosen,	  M.	  K.	  (1999)	  Structure	  of	  Cdc42	  in	  complex	  with	  the	  GTPase-­‐binding	  domain	  of	  the	  'Wiskott-­‐Aldrich	  syndrome'	  protein.	  Nature	  399,	  379-­‐383	  285.	   Rogers,	  L.	  D.,	  Kristensen,	  A.	  R.,	  Boyle,	  E.	  C.,	  Robinson,	  D.	  P.,	  Ly,	  R.	  T.,	  Finlay,	  B.	  B.,	  and	  Foster,	  L.	  J.	  (2008)	  Identification	  of	  cognate	  host	  targets	  and	  specific	  	   	   	  139	  ubiquitylation	  sites	  on	  the	  Salmonella	  SPI-­‐1	  effector	  SopB/SigD.	  J	  Proteomics	  71,	  97-­‐108	  286.	   Rodríguez-­‐Escudero,	  I.,	  Ferrer,	  N.	  L.,	  Rotger,	  R.,	  Cid,	  V.	  J.,	  and	  Molina,	  M.	  (2011)	  Interaction	  of	  the	  Salmonella	  Typhimurium	  effector	  protein	  SopB	  with	  host	  cell	  Cdc42	  is	  involved	  in	  intracellular	  replication.	  Mol	  Microbiol	  80,	  1220-­‐1240	  287.	   Hardt,	  W.	  D.,	  Chen,	  L.	  M.,	  Schuebel,	  K.	  E.,	  Bustelo,	  X.	  R.,	  and	  Galán,	  J.	  E.	  (1998)	  S.	  typhimurium	  encodes	  an	  activator	  of	  Rho	  GTPases	  that	  induces	  membrane	  ruffling	  and	  nuclear	  responses	  in	  host	  cells.	  Cell	  93,	  815-­‐826	  288.	   Fu,	  Y.,	  and	  Galán,	  J.	  E.	  (1999)	  A	  salmonella	  protein	  antagonizes	  Rac-­‐1	  and	  Cdc42	  to	  mediate	  host-­‐cell	  recovery	  after	  bacterial	  invasion.	  Nature	  401,	  293-­‐297	  289.	   W.,	  L.	  A.	  G.	  (1992)	  Joint	  CCP4	  +	  ESF-­‐EAMCB	  Newsletter	  on	  Protein	  Crystallography.	  	  	  290.	   Collaborative	  Computational	  Project,	  N.	  m.	  (1994)	  The	  CCP4	  suite:	  programs	  for	  protein	  crystallography.	  Acta	  Crystallogr	  D	  Biol	  Crystallogr	  50,	  760-­‐763	  291.	   Emsley,	  P.,	  and	  Cowtan,	  K.	  (2004)	  Coot:	  model-­‐building	  tools	  for	  molecular	  graphics.	  Acta	  Crystallogr	  D	  Biol	  Crystallogr	  60,	  2126-­‐2132	  292.	   Afonine	  P.	  V.,	  G.-­‐K.	  R.	  W.,	  Adams	  P.	  D.	  (2005).	  (2005)	  Collaborative	  Computational	  Project,	  Number	  4	  Newsletter	  42.	  	  	  293.	   Chen,	  V.	  B.,	  Arendall,	  W.	  B.,	  Headd,	  J.	  J.,	  Keedy,	  D.	  A.,	  Immormino,	  R.	  M.,	  Kapral,	  G.	  J.,	  Murray,	  L.	  W.,	  Richardson,	  J.	  S.,	  and	  Richardson,	  D.	  C.	  (2010)	  MolProbity:	  all-­‐atom	  structure	  validation	  for	  macromolecular	  crystallography.	  Acta	  Crystallogr	  D	  Biol	  Crystallogr	  66,	  12-­‐21	  294.	   L.,	  D.	  W.	  (2010)	  The	  PyMOL	  Molecular	  Graphics	  System,	  version	  1.3r1,Schrödinger,	  LLC,	  New	  York.	  	  	  295.	   Murata,	  T.,	  Delprato,	  A.,	  Ingmundson,	  A.,	  Toomre,	  D.	  K.,	  Lambright,	  D.	  G.,	  and	  Roy,	  C.	  R.	  (2006)	  The	  Legionella	  pneumophila	  effector	  protein	  DrrA	  is	  a	  Rab1	  guanine	  nucleotide-­‐exchange	  factor.	  Nat	  Cell	  Biol	  8,	  971-­‐977	  296.	   Krissinel,	  E.,	  and	  Henrick,	  K.	  (2007)	  Inference	  of	  macromolecular	  assemblies	  from	  crystalline	  state.	  J	  Mol	  Biol	  372,	  774-­‐797	  297.	   Eswaran,	  J.,	  Soundararajan,	  M.,	  Kumar,	  R.,	  and	  Knapp,	  S.	  (2008)	  UnPAKing	  the	  class	  differences	  among	  p21-­‐activated	  kinases.	  Trends	  Biochem	  Sci	  33,	  394-­‐403	  298.	   Zhao,	  Z.	  S.,	  Manser,	  E.,	  Chen,	  X.	  Q.,	  Chong,	  C.,	  Leung,	  T.,	  and	  Lim,	  L.	  (1998)	  A	  conserved	  negative	  regulatory	  region	  in	  alphaPAK:	  inhibition	  of	  PAK	  kinases	  reveals	  their	  morphological	  roles	  downstream	  of	  Cdc42	  and	  Rac1.	  Mol	  Cell	  Biol	  18,	  2153-­‐2163	  299.	   Garrard,	  S.	  M.,	  Capaldo,	  C.	  T.,	  Gao,	  L.,	  Rosen,	  M.	  K.,	  Macara,	  I.	  G.,	  and	  Tomchick,	  D.	  R.	  (2003)	  Structure	  of	  Cdc42	  in	  a	  complex	  with	  the	  GTPase-­‐binding	  domain	  of	  the	  cell	  polarity	  protein,	  Par6.	  EMBO	  J	  22,	  1125-­‐1133	  300.	   Hoffman,	  G.	  R.,	  Nassar,	  N.,	  and	  Cerione,	  R.	  A.	  (2000)	  Structure	  of	  the	  Rho	  family	  GTP-­‐binding	  protein	  Cdc42	  in	  complex	  with	  the	  multifunctional	  regulator	  RhoGDI.	  Cell	  100,	  345-­‐356	  301.	   Prehna,	  G.,	  Ivanov,	  M.	  I.,	  Bliska,	  J.	  B.,	  and	  Stebbins,	  C.	  E.	  (2006)	  Yersinia	  virulence	  depends	  on	  mimicry	  of	  host	  Rho-­‐family	  nucleotide	  dissociation	  inhibitors.	  Cell	  126,	  869-­‐880	  302.	   Jaffe,	  A.	  B.,	  and	  Hall,	  A.	  (2005)	  Rho	  GTPases:	  biochemistry	  and	  biology.	  Annu	  Rev	  Cell	  Dev	  Biol	  21,	  247-­‐269	  	   	   	  140	  303.	   Aktories,	  K.	  (2011)	  Bacterial	  protein	  toxins	  that	  modify	  host	  regulatory	  GTPases.	  Nat	  Rev	  Microbiol	  9,	  487-­‐498	  304.	   Kubori,	  T.,	  and	  Galán,	  J.	  E.	  (2003)	  Temporal	  regulation	  of	  salmonella	  virulence	  effector	  function	  by	  proteasome-­‐dependent	  protein	  degradation.	  Cell	  115,	  333-­‐342	  305.	   Stavrinides,	  J.,	  Ma,	  W.,	  and	  Guttman,	  D.	  S.	  (2006)	  Terminal	  reassortment	  drives	  the	  quantum	  evolution	  of	  type	  III	  effectors	  in	  bacterial	  pathogens.	  PLoS	  Pathog	  2,	  e104	   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0166442/manifest

Comment

Related Items