STRUCTURAL AND FUNCTIONAL CHARACTERIZATION OF COMPONENTS OF BACTERIAL TYPE III SECRETION SYSTEMS by BRIANNE J. BURKINSHAW B.Sc., The University of Northern British Columbia, 2008 A THESIS SUBMITTED FOR PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Biochemistry and Molecular Biology) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) July 2015 © Brianne J. Burkinshaw, 2015 ii Abstract Many Gram-negative pathogens use a type III secretion system (T3SS) to inject effector proteins into the host cytoplasm, where they manipulate host processes to the advantage of the bacterium. The T3SS is composed of a cytoplasmic export apparatus, a membrane-spanning basal body with a central channel formed by the inner rod, an extra-cellular needle filament and a translocon complex that inserts in the host membrane. In this thesis, proteins involved in T3SS assembly, as well as a T3SS effector protein were structurally and functionally characterized. The structure of EtgA, a T3SS-associated peptidoglycan (PG)-cleaving enzyme from enteropathogenic Escherichia coli (EPEC) was solved. The EtgA active site has features in common with lytic transglycosylases (LTs) and hen egg-white lysozyme (HEWL). EtgA contains an aspartate that aligns with lysozyme Asp52 (a residue critical for catalysis), a conservation not observed in LT families to which the conserved T3SS enzymes were presumed to belong. Mutation of the EtgA catalytic glutamate conserved across LTs and HEWL, and this differentiating aspartate diminishes type III secretion in vivo, supporting its essential role in T3SS assembly. EtgA forms a complex with the T3SS inner rod component, which enhances PG-lytic activity of EtgA in vitro, providing localization and regulation of the lytic activity to prevent cell lysis. After assembly of the basal body and needle, the gatekeeper protein ensures the translocon assembles at the needle tip prior to secretion of effector proteins. The gatekeeper from EPEC (SepL) was crystallized and it was shown that it has three X-bundle domains, which likely mediate protein-protein interactions to control translocon and effector secretion. Comparison of SepL to structurally characterized orthologs revealed several conserved residues, which may be required to regulate secretion of translocators or effectors. Finally, SopB, a iii Salmonella effector protein, in complex with host Cdc42, an Rho GTPase that regulates critical events in eukaryotic cytoskeleton organization and membrane trafficking was structurally characterized. Structural and biochemical analysis of the SopB/ Cdc42 complex shows that SopB structurally and functionally mimics a host guanine nucleotide dissociation inhibitor (GDI) by contacting key residues in the regulatory switch regions of Cdc42 and slowing Cdc42 nucleotide exchange. iv Preface Part of Chapter 1 of this thesis was published as a review article (Burkinshaw BJ, Strynadka NCJ. 2014. Assembly and Structure of the T3SS, Biochimica et Biophysica Acta. 1843(8): 1649-63). Chapter 1 was written by me and revised by my supervisor, Dr. Natalie Strynadka. Chapter 2 was published as a research article (Burkinshaw BJ, Deng W, Lameignere E, Wasney GA, Zhu H, Worrall LJ, Finlay BB, Strynadka NC. 2015. Structural analysis of a specialized type III secretion system peptidoglycan-cleaving enzyme. J Biol Chem 16: 10406-17). Cloning, protein expression and purification was done by me. Structural characterization of EtgA was done by me, with assistance of Dr. Liam Worrall in data processing. Analysis of EtgA/EscI complex by light scattering was done by Dr. Emilie Lameignere. Scanning electron microscopy of Escherichia coli expressing EtgA was done by Dr. Haizhong Zhu. EtgA activity assays were done by me, with the assistance of Greg Wasney. Sequence alignments were done by me. Type III secretion assays were done by Dr. Wanyin Deng. Negative stain electron microscopy of purified inner rod protein was done by me. Protein stability assays were done by Greg Wasney. The figures were generated and the manuscript written by me, with revisions by Dr. Natalie Strynadka, Dr. Brett Finlay and Dr. Wanyin Deng. Chapter 3 was written by me, and revised by Dr. Natalie Strynadka. SepL was purified and structurally characterized by me. Chapter 4 was published as a research article (Burkinshaw BJ, Prehna G, Worall LJ, and Strynadka NC. 2012. Structure of Salmonella effector protein SopB N-terminal domain in complex with host RhoGTPase Cdc42. J Biol Chem 16: 13348-13355). In this work, I v purified and crystallized the SopB/Cdc42 complex and collected data. Dr. Liam Worrall assisted in structure determination and model building of the complex. Dr. Gerd Prehna provided insight on RhoGDI mimicry and helped to design the nucleotide exchange assays. I performed the nucleotide exchange assays and isothermal titration calorimetry. The manuscript was written by me, and revised by Dr. Natalie Strynadka. Chapter 5 was written by me and revised by Dr. Natalie Strynadka. vi Table of Contents Abstract………......................................................................................................................................................ii Preface………........................................................................................................................................................iv Table of Contents………..................................................................................................................................vi List of Tables……….........................................................................................................................................viii List of Figures....................................................................................................................................................ix List of Abbreviations……….............................................................................................................................x Acknowledgments………..................................................................................................................................xi Dedication………................................................................................................................................................xii 1 Introduction ................................................................................................................................ 1 1.1 Protein transport across Gram-negative bacterial cell walls ................................................. 1 1.2 The Type III Secretion System ...................................................................................................... 3 1.3 Assembly of the T3SS ...................................................................................................................... 4 1.4 Chaperones ...................................................................................................................................... 10 1.4.1 Class IA and IB chaperones ................................................................................................................ 11 1.4.2 Class II chaperones ................................................................................................................................. 13 1.4.3 Class III chaperones ............................................................................................................................... 13 1.5 Architecture of the T3S apparatus ............................................................................................. 14 1.5.1 The export apparatus and ATPase ..................................................................................................... 14 1.5.2 The autoprotease ..................................................................................................................................... 15 1.5.3 The export gate ........................................................................................................................................ 16 1.5.4 The ATPase ............................................................................................................................................... 17 1.5.5 The basal body ......................................................................................................................................... 17 1.5.6 The inner membrane rings ................................................................................................................... 18 1.5.7 The outer membrane ring ..................................................................................................................... 19 1.5.8 The inner rod ............................................................................................................................................ 21 1.5.9 The needle ................................................................................................................................................. 22 1.5.10 The tip complex .................................................................................................................................... 25 1.5.11 The translocon ....................................................................................................................................... 27 1.6 Transport of effectors through the T3SS .................................................................................. 29 1.7 Structural overview of Salmonella effectors ............................................................................ 30 1.7.1 Modulation of RhoGTPases ................................................................................................................ 33 1.7.2 Targeting the host ubiquitin pathway ............................................................................................... 34 1.7.3 Covalent modification of host targets .............................................................................................. 35 1.7.4 Interaction with the host cytoskeleton ............................................................................................. 36 1.8 T3SS summary and perspectives ................................................................................................ 38 1.9 Overview of thesis objectives ....................................................................................................... 39 2 Structural analysis of a specialized type III secretion system peptidoglycan-cleaving enzyme ............................................................................................................................................. 40 2.1 Introduction .................................................................................................................................... 40 2.2 Methods ............................................................................................................................................ 45 2.2.1 Cloning of genes into expression vectors for crystallography, protein expression and purification ................................................................................................................................................ 45 2.2.2 Crystallization of EtgA ......................................................................................................................... 47 2.2.3 Data collection, structure determination and refinement ........................................................... 47 2.2.4 Scanning Electron Microscopy of BL21 Escherichia coli expressing EtgA ...................... 48 2.2.5 Size Exclusion Chromatography-Multiangle Light Scattering (SEC-MALS) ................... 48 vii 2.2.6 Cloning, expression, purification and imaging of EHEC inner rod protein EprJ .............. 49 2.2.7 Generation of Citrobacter rodentium and EPEC etgA deletion mutants for T3SS secretion assay .......................................................................................................................................... 49 2.2.8 Complementation constructs for EPEC and Citrobacter rodentium etgA deletion mutants.. ..................................................................................................................................................... 50 2.2.9 Type III secretion assay for EPEC and Citrobacter rodentium ............................................... 51 2.2.10 Thermal stability assay ....................................................................................................................... 52 2.2.11 EtgA activity assay ............................................................................................................................... 53 2.3 Results .............................................................................................................................................. 53 2.3.1 Structural characterization of the catalytic core of EtgA ........................................................... 53 2.3.2 EtgA requires a catalytic glutamate and aspartate for activity in vivo .................................. 59 2.3.3 EtgA associates with the T3SS through interaction with the inner rod, EscI ..................... 61 2.3.4 Interaction with the inner rod EscI enhances the activity of EtgA in vitro .......................... 64 2.4 Discussion ........................................................................................................................................ 65 3 Structural analysis of a T3SS gatekeeper protein from EPEC ..................................... 69 3.1 Introduction .................................................................................................................................... 69 3.2 Methods ............................................................................................................................................ 73 3.2.1 Cloning, protein expression and purification ................................................................................. 73 3.2.2 Crystallization and data collection .................................................................................................... 74 3.3 Results .............................................................................................................................................. 75 3.3.1 Structural overview of SepL ................................................................................................................ 75 3.3.2 Comparison of SepL to gatekeeper orthologs ............................................................................... 76 3.4 Discussion ........................................................................................................................................ 84 4 Structure of Salmonella effector protein SopB in complex with host Cdc42 ............. 88 4.1 Introduction .................................................................................................................................... 88 4.2 Methods ............................................................................................................................................ 90 4.2.1 Isothermal titration calorimetry .......................................................................................................... 90 4.2.2 Static light scattering ............................................................................................................................. 91 4.2.3 Analysis of SopB and Cdc42 interaction by gel filtration ......................................................... 91 4.2.4 Cloning of genes into expression constructs, purification and crystallization ................... 91 4.2.5 Data collection, structure determination and refinement ........................................................... 92 4.2.6 Cdc42 nucleotide exchange assay ..................................................................................................... 93 4.3 Results .............................................................................................................................................. 94 4.3.1 Biochemical analysis and crystallization of bacterial SopB and host Cdc42 complex ... 94 4.3.2 SopB contacts host Cdc42 by mimicking a eukaryotic CRIB-like intermolecular β- sheet… ........................................................................................................................................................ 95 4.3.3 SopB contacts key Cdc42 regulatory switch residues to mimic a Rho GDI ....................... 99 4.3.4 SopB prevents Cdc42 nucleotide exchange in vitro .................................................................. 102 4.4 Discussion ..................................................................................................................................... 103 5 Summary and future directions ......................................................................................... 107 5.1 EtgA ............................................................................................................................................... 107 5.2 SepL ............................................................................................................................................... 111 5.3 SopB ............................................................................................................................................... 114 5.4 Closing summary ........................................................................................................................ 116 References………………………………………………………………………………………………………..119 viii List of Tables Table 1.1 Nomenclature of T3SS components from selected animal-pathogenic bacteria ........ 6 Table 1.2 Structures of T3SS components .................................................................................................. 6 Table 1.3 Structure of Salmonella effector proteins ............................................................................. 32 Table 2.1 EtgA data collection and refinement statistics .................................................................... 55 Table 3.1 Nomenclature of the gatekeeper protein. .............................................................................. 73 Table 3.2 SepL Data collection and refinement statistics. .................................................................. 77 Table 3.3 Summary of DALI search results for SepL. ......................................................................... 79 Table 4.1 SopB/Cdc42 data collection and refinement statistics. .................................................... 96 ix List of Figures Figure 1.1 Overview of Gram-negative bacterial secretion systems. ................................................. 2 Figure 1.2 Structural overview of the T3SS injectisome. ...................................................................... 5 Figure 1.3 Overview of structurally characterized Salmonella effectors and their role in host cell pathways. ........................................................................................................................................... 31 Figure 2.1 Schematic overview of T3SS apparatus components and the role of EtgA during assembly. ................................................................................................................................................... 42 Figure 2.2 Structure of the catalytic core of EtgA. ................................................................................ 56 Figure 2.3 Multiple sequence alignment of T3SS specialized PG-lytic enzyme EtgA with other macromolecular machine-associated PG-lytic enzymes, lytic transglycosylase Slt70 and C-lysozyme. .......................................................................................................................... 58 Figure 2.4 Comparison of EtgA active site with Slt70 and lysozyme active site bound to peptidoglycan-like fragments and flagellar PG-lytic enzyme FlgJ. ....................................... 60 Figure 2.5 Analysis of EtgA activity in vivo and interaction with the inner rod. ........................ 63 Figure 2.6 The inner rod enhances EtgA peptidoglycan cleaving activity. .................................. 65 Figure 3.1 Structural overview of SepL. ................................................................................................... 77 Figure 3.2 Comparison of SepL overall structure to orthologs. ........................................................ 80 Figure 3.3 Surface charge of gatekeeper orthologs. .............................................................................. 81 Figure 3.4 Structural alignment of SepL domains 2 and 3 with gatekeeper orthologs. ............ 83 Figure 4.1 Analysis of SopB (29-181) binding to Cdc42 by isothermal titration calorimetry and light scattering. ................................................................................................................................ 95 Figure 4.2 Overview of Cdc42 (blue) structure and interaction with GTPase binding domain of SopB (orange). .................................................................................................................................... 98 Figure 4.3 SopB contacts Cdc42 through a CRIB-like motif that contains an Ile residue conserved with eukaryotic Cdc42 effector proteins. ................................................................... 99 Figure 4.4 When Cdc42 is bound to SopB the conformation of Cdc42 switch I residues aligns with the conformation of Cdc42 switch I residues when bound to human RhoGDI, and the GTP activity of Cdc42 is down-regulated. ........................................................................... 101 Figure 4.5 SopB leucine residues form van der Waals contacts with Cdc42 switch II residues Leu67 and Leu70. ................................................................................................................................ 102 x List of Abbreviations BME β-mercaptoethanol CRIB Cdc42 and Rac-interactive binding DTT dithiothreitol EDTA edetic acid EHEC enterohemorrhagic Escherichia coli EM electron microscopy EMBD electron microscopy data bank EPEC enteropathogenic Escherichia coli GAP GTP activating protein GDI guanine nucleotide dissociation inhibitor GEF guanine nucleotide exchange factor GlcNAc N-acteylglucosamine grlA global regulator of LEE activator grlR global regulator of LEE repressor HEWL IM hen egg-white lysozyme inner membrane IPTG isopropyl-β-D-thiogalactopyranoside ITC isothermal titration calorimetry LB Luria Bertoni media LEE locus of enterocyte effacement MAD multi-wavelength anomalous dispersion Mant-GDP N-methanylanthraniloyl guanosine diphosphate MBP maltose binding protein MurNAc N-acetyl muramic acid OM outer membrane PDB protein data bank PG peptidoglycan SCV Salmonella containing vacuole SILAC stable isotope labelling of amino acids in cell culture SPI-1 Salmonella pathogenicity island 1 SPI-2 Salmonella pathogenicity island 2 ssNMR solid state nuclear magnetic resonance T3SS type III secretion system TCEP tris(2-carboxyethyl)phosphine TM target cell membrane xi Acknowledgments I would like to thank my parents for teaching me to value of education and encouraging me to follow my interests, as well as my brothers and extended family for their support. I am grateful to my supervisor, Dr. Natalie Strynadka, for giving me the opportunity to pursue graduate studies on the bacterial type III secretion system in her laboratory. Under her guidance, I have learned how to design experiments, write manuscripts and present my data to colleagues. Because of her support, I have been able to attend numerous workshops and conferences, and have had access to cutting-edge technology and a wonderful group of colleagues. I would also like to thank my committee members, Dr. Lawrence McIntosh and Dr. Brett Finlay, for their critical feedback on my work and offering their expertise on NMR, protein structure and function, and bacterial pathogenesis. I am fortunate to have collaborated with both of their laboratories. I am thankful to Wanyin Deng for experimental collaboration and insightful discussions on type III secretion, as well as providing feedback on manuscripts. Mark Okon taught me a great deal about how to use NMR to study protein samples and how to interpret my spectra. Each morning during my studies, I was happy to arrive at the laboratory and begin experiments, largely due to my colleagues for their part in creating such a pleasant and stimulating environment to work in. Our lab manager, Liza deCastro, maintained an efficient and organized work environment, and was always willing to provide technical advice for purification of troublesome proteins. Marija Vuckovic taught me everything about cloning and provided insight on type III secretion projects. Dr. Liam Worrall taught me about protein structure determination and refinement and patiently helped me to troubleshoot any problems I encountered as I was learning. Dr. Julien Bergeron set aside a significant amount of time to teach me about NMR and electron microscopy. I thank all the rest of the laboratory members for sharing their expertise and advice over the years. I am fortunate to have received funding from NSERC, as well as the Centre for Blood Research, during the course of my studies. I thank Dr. Alejandro Colman-Lerner, for giving me the opportunity to expand my horizons and work in his laboratory following my undergraduate degree. Finally, I would like to thank Dr. Stephen Rader, as his infectious enthusiasm for science motivated me to pursue a career in research. xii Dedication To Martin Matěj, for your support and encouragement. 1 1 Introduction 1.1 Protein transport across Gram-negative bacterial cell walls Gram-negative bacteria are protected from their environment by a cell wall, which is composed of an outer membrane, peptidoglycan layer and inner membrane. The cell wall helps maintain shape, pH and osmolarity and prevent undesirable diffusion of foreign molecules into the cell. However, to interact with the surrounding environment, Gram-negative bacteria must transport protein and DNA across the cell wall. To facilitate transport of proteins across the cell wall, Gram-negative bacteria encode at least six specialized secretion systems (Type I to VI; Figure 1.1), and perhaps more that are yet to be discovered. There is an interesting evolutionary relationship among these Gram-negative secretion systems and with other membrane-spanning organelles. Briefly, as an example, the Type III Secretion system is thought to have evolved through exaption from the flagella, accompanied by loss of flagella genes (although the protein secreting function remained) and recruitment of an outer membrane embedded secretin(1). Recruitment of the secretin is thought to have occurred more than once, with some secretins sharing homology to secretins found in Type II secretion systems, while others have a secretin of a distinctly different origin(1). Furthermore, the most recently discovered secretion system, the Type VI secretion system, shares a common evolutionary origin with the contractile tail of bacterial phages(2). The ability to secrete protein or DNA into the extracellular milieu or neighbouring eukaryotic or bacterial cells no doubt provides a strong selective advantage, and has been co-opted for numerous processes including acquirement of nutrients, manipulation of host cells, symbiosis, and communication with or attack on neighbouring bacteria. Current investigation of bacterial secretion systems aims to address a common set of questions: How 2 is secretion regulated and energized? How are proteins recognized and transported by the secretion system? How is assembly of such a large multi-protein system regulated? A detailed knowledge of how Gram-negative bacteria transport proteins across their cell wall is critical for understanding how they communicate and interact with other bacterial species, as well host cells during pathogenesis, information that will be pertinent for development of drugs and vaccines that target the T3SS and key virulence factors. Figure 1.1 Overview of Gram-negative bacterial secretion systems. Gram-negative bacteria assemble six known secretion systems (Type I-VI) for transport of protein and/or DNA across the bacterial membranes and into the extracellular milieu or target bacterial or eukaryotic cells. Protein Data Bank (PDB) or electron microscopy databank (EMDB) codes are shown in parentheses. 3 1.2 The Type III Secretion System More than two decades ago, the observation that Yersinia “Yop” virulence, or effector proteins were translocated into host cells in a Sec-independent manner without cleavage of an N-terminal sequence(3) led to the proposed existence of an alternative secretion system, named the Type III Secretion System (T3SS)(3,4). The presence of a specialized secretion system unique to only pathogenic strains of bacteria was also supported by the identification of the inv genetic locus contained within the Salmonella Pathogenicity Island I (SPI-1), a gene cluster in Salmonella required for invasion(5,6) and the observation of homology between InvG, a protein encoded in the inv operon, and the outer membrane secretin of the type II secretion system (T2SS) PulD (as well as additional inv proteins and flagella proteins) (7,8). Additionally, a second gene cluster encoding a distinct T3SS was identified in Salmonella(9) (named SPI-2, for Salmonella Pathogenicity Island 2). Clusters of genes that encode a T3SS have since been discovered in a number of animal and plant bacterial pathogens, as well as symbiotic bacteria, and have been classified into families based on sequence conservation. The best-characterized mammalian pathogens can be classified into three families: Inv-Mxi-Spa family contains Salmonella spp. SPI-1, and Shigella flexneri; the Ysc family contains Yersinia spp. and Pseudomonas aeruginosa; and the Ssa-Esc family contains enteropathogenic Escherichia coli (EPEC), and Salmonella spp. SPI-2. The first electron microscopy (EM) images of the Salmonella(10) and Shigella (11,12) T3SS revealed a remarkable syringe-like appearance: a wide base embedded in the membrane of the bacteria and a thin extracellular needle that protruded to the extracellular space. Since these first images, the field has made appreciable progress in the structural and mechanistic characterization of the >20 components which comprise the conserved T3SS 4 apparatus in a variety of bacterial pathogens, as well as that of the more diverse sets of species-specific virulence effector proteins that are delivered by the T3SS with aid of cognate bacterial chaperones. T3SS assembly and structure, as well as a general overview of effector proteins will be discussed in detail in Sections 1.3-1.7. 1.3 Assembly of the T3SS The T3SS is composed of more than 20 proteins (Figure 1.2A), many of which form oligomers and are membrane embedded. Unfortunately, nomenclature is not consistent between species (Table 1.1); the emphasis here will be to use the Salmonella SPI-1 naming. Structurally characterized components of the T3SS are listed in Table 1.2. During infection, the bacteria receive an external cue from the host environment and begin to assemble the constituents of the secretion system, a process that must be coordinated in space and time. Assembly can be categorized into discrete stages: 1) Assembly of the basal body rings and export apparatus, 2) Assembly of the inner rod and needle, 3) Assembly of the tip and translocon, and 4) Secretion of effectors. The precise mechanism of T3SS assembly is still under investigation; however, several models have been proposed, and studies indicate that some facets of assembly may vary between species. Assembly of the basal body and export apparatus has been described by an “inside-out” process in Salmonella(13) and an “outside-in” process in Yersinia(14,15). In the Salmonella inside-out model, the export apparatus components SpaP and SpaR initiate assembly at the inner membrane and recruit the remaining export apparatus components SpaQ and SpaS. The inner membrane ring components of the basal body, PrgH and PrgK, then assemble at the site of the export apparatus. 5 Figure 1.2 Structural overview of the T3SS injectisome. A) PDB or EMBD accession codes of solved structural components are shown, (adapted from (16)). B) ssNMR analysis of the Salmonella needle filament. Left- view through the needle channel looking from the top down. Each PrgI subunit has a unique colour and the N-terminal domain (demarcated N) faces the extracellular space. Right- lateral interface between needle subunit i (olive) and i+5 (purple), and i+6 (orange) and axial interface between i and i+11 demonstrate intersubunit interactions that occur during formation of the needle filament. C) Left- InvG (blue), PrgH (orange) and PrgK (purple) ring models. Center- cut away of Salmonella needle complex EM structure with one subunit each of InvG, PrgK and PrgH to show relative localization of subunits within the basal body. Right- subunit-subunit interactions occur via “ring-building” motifs. The inset shows interactions between two PrgH periplasmic domains. D) Left-Top view of the nonameric MxiA export gate with each subunit coloured uniquely. The pore diameter is ~50 Å. Right- Side view of MxiA nonameric ring. The ring has a depth of ~55 Å and a funnel-like shape with an external diameter of 110Å at the cytoplasmic facing end and an external diameter of 170 Å at the membrane facing end. 6 Table 1.1 Nomenclature of T3SS components from selected animal-pathogenic bacteria Structure Component Species Salmonella typhimuruium (SPI-1) Shigella flexneri EPEC Yersinia spp. Pseudomonas aeruginosa Export Apparatus ATPase InvC Spa47 EscN YscN PscN Central Stalk InvI Spa13 Orf15 YscO PscO Peripheral Stalk OrgB MxiL EscL YscL PscL C-ring SpaO Spa33 SepQ YscQ PscQ (HcrQ) Gate InvA MxiA EscV YscV (LcrD) PcrD Gate-keeper InvE MxiC SepL/ SepD YopN/ TyeA PopN Autoprotease SpaS Spa40 EscU YscU PscU IM component SpaP Spa24 EscR YscR PscR IM component SpaR Spa29 EscT YscT PscT IM component SpaQ Spa9 EscS YscS PscS Basal Body IM Ring PrgH MxiG EscD YscD PscD IM Ring PrgK YscJ EscJ YscJ PscJ OM Ring InvG MxiD EscC YscC PscC Pilotin InvH MxiM N/A YscW ExsB Inner Rod PrgJ MxiI EscI YscI PscI Needle Filament PrgI MxiH EscF YscF PscF Tip Tip SipD IpaD EspA LcrV PcrV Translocon Minor subunit SipB IpaB EspD YopB PopB Major subunit SipC IpaC EspB YopD PopD Accessory Proteins Lytic transglycosylase IagB IpgF EtgA YsaH - Needle length regulator InvJ Spa32 EscP YscP PscP Table 1.2 Structures of T3SS components Component Protein Name Species Method (reference) PDB/EMDB Codes ATPase EscN EPEC x-ray(17) 2OBM C-Ring HcrQ Pseudomonas syringae x-ray(18) 1OY9 Gate InvA Salmonella x-ray(19,20) 2X49, 3LW9 MxiA Shigella x-ray(21) 4A5P Gate-keeper MxiC Shigella x-ray(22) 2VJ4 YopN/TyeA Yersinia x-ray(23) 1XL3 Autoprotease SpaS Salmonella x-ray(24) 3C01 Spa40 Shigella x-ray(25) 2VT1 EscU EPEC x-ray(24) 3BZL YscU Yersinia x-ray(26,27) 2JL1 Needle Complex PrgH, PrgK, InvG Salmonella EM(28) 1875 7 Component Protein Name Species Method (reference) PDB/EMDB Codes MxiG, MxiJ, MxiD Shigella EM(29) 1617 Injectisome with trapped substrate Salmonella EM(30) 2481, 2482 In situ injectisome Shigella Cryo-ET(31) - In situ injectisome Yersinia Cryo-ET(31) - In situ injectisome Salmonella Cryo-ET(32) - Basal Body IM Ring EscJ EPEC x-ray(33) 1YJ7 PrgH/PrgK Salmonella EM(28) 1874 PrgH (cytoplasmic) Salmonella x-ray(34) 4G2S PrgH (periplasmic) Salmonella x-ray(34,35) 3GR0, 4G1I MxiG Shigella NMR, x-ray(36,37) 2XXS, 4A4Y Pilotin MxiM Shigella x-ray(38) 1Y9L Pilotin-Secretin MxiM-MxiD Shigella NMR(39) 2JW1 Secretin InvG Salmonella EM(28) 1871 YscC Yersinia EM(40) 5720-5722 InvG (periplasmic) Salmonella x-ray(34) 4G08 Needle PrgI Salmonella x-ray(41) 2X9C NMR(41,42) 2KV7, 2JOW PrgI Salmonella ssNMR(43) 2LPZ MxiH Shigella x-ray(44) 2CA5 Negative stain EM(44) 1416 Cryo-EM(45) 5352 ssNMR, PrgI homology model(46) - YscF/YscG/YscE Yersinia x-ray(47) 2P58 PscF/PscG/PscE Pseudomonas x-ray(48) 2UWJ BsaL Burkholderia NMR(49) 3G0U Tip SipD Salmonella x-ray(50) 3NZZ SipD/PrgI Salmonella x-ray(51) 3ZQB IpaD Shigella x-ray(52) 3R9V LcrV Yersinia x-ray(53) 1R6F EspA/CesA EPEC x-ray(54) 1XOU BipD Burkholderia x-ray(55) 21XR Translocon PopB/PcrH Pseudomonas x-ray(56) 2XCB IpaB/IpgC Shigella x-ray(57) 3ZG1 8 Component Protein Name Species Method (reference) PDB/EMDB Codes YopD/SycD Yersinia x-ray(58) 4AM9 IpaB Shigella x-ray(59) 3U0C SipB Salmonella x-ray (59) 3TUL The secretin outer membrane protein InvG is transported via the Sec pathway and, with the aid of a lipidated chaperone known as a T3SS pilotin(60-62), forms an oligomer in the outer membrane. This model is supported by the observations that the export apparatus can assemble in the absence of the needle complex(13), that the inner membrane ring can assemble in the absence of InvG(63) and that InvG ortholog in EPEC, EscC, requires the inner membrane ring for correct localization(64). It has been shown that the basal body can assemble in the absence of the export apparatus; however, this structure lacks the inner socket and cup substructures and is a dead end for assembly(13). In the Yersinia outside-in model, the secretin inserts first into the outer membrane, and then the inner membrane ring component YscD (PrgH ortholog) and the export apparatus assemble in parallel. Assembly is completed by recruitment of the second inner membrane ring protein, YscJ (PrgK) and the cytoplasmic ATPase and C-ring. The two models may reflect divergent assembly pathways between species. The next stage of assembly, formation of the inner rod (the presumed inner channel of the basal body) and the contiguous hollowed needle that protrudes from the extracellular face of the basal body, requires ATPase activity(65), indicating that it proceeds after assembly of the functional basal body and export apparatus. Needle length is constant within species, and is likely optimized for contact with the host cell(66); therefore, regulation of needle length is an important aspect of T3SS assembly. Needle length regulation has been proposed to be controlled by Type 3 substrate specificity switch proteins, which may function as a 9 “molecular ruler”(67), or conversely, needle length may be regulated by the inner rod(68). These switch proteins share little sequence identity, but have a structurally conserved C-terminal domain(69). In Yersinia and EPEC, the switch proteins YscP and EscP interact with the T3SS autoprotease proteins YscU and EscU, respectively, in the bacterial cytosol(70,71), and may play a role in regulating the substrate switching event associated with auto-cleavage of the autoprotease (see below), although the mechanistic details are not well understood. The molecular ruler model was proposed from the observation that deletions in YscP resulted in shorter needles, whereas insertions resulted in longer needles (67). In this model, the C-terminal globular domain of YscP is thought to be associated with the base of the T3SS, and the N-terminal region extends through the inner channel of the nascent needle until it is stretched to its limit; this in turn induces a conformational change at the base of the T3SS, terminating secretion of the needle. Interestingly, expression in Yersinia of two constructs of YscP, one longer relative to the other, resulted in a population with two distinct needle lengths rather than an intermediate needle length, suggesting that only one molecule of YscP is required per secretion apparatus(72). Additionally, the helical content of YscP may play a role in needle length regulation, as disruption of N-terminal helices by designed mutations also altered needle length(73). YscP also regulates secretion of the inner rod, as the inner rod is hyper secreted in the absence of YscP, which in turn affects the length of the needle(74). An alternative mechanism involving the inner rod-mediated control of needle length was proposed after the observation that deletion of the Salmonella switch protein InvJ resulted in needle complexes without inner rod but long labile needles(68). The needle and the inner rod are exported, and after completion of the inner rod, a proposed conformational change occurs at the base of the secretion system, triggering a substrate-switching event. In the absence of 10 the rod, which requires InvJ for proper assembly, the needle is continuously exported, resulting in longer needles. Secretion of effector proteins is controlled by an additional protein, InvE (Salmonella), YopN/TyeA (Yersinia), MxiC (Shigella) and SepD/SepL (EPEC), which is localized to the bacterial membrane(75) likely via interaction with components of the T3SS(76,77). Structures of YopN/TyeA (as well as YopN with its chaperones SycN/YscB)(23) and MxiC(22) have been solved, revealing three conserved 4-helix X-bundle fold domains (described as four helices packed in a coil-coiled arrangement) with the third domain of MxiC orthologous to TyeA(78). This group of proteins has been proposed to act as a “gate-keeper” based on the observation that deletion of the protein results in decreased or abolished secretion of translocon proteins, and in some instances increased secretion of effectors(75,76,79-82). MxiC, InvE and YopN/TyeA were all shown to interact with the inner rod, although the precise purpose of this interaction has yet to be discerned(77). 1.4 Chaperones Within the bacterial cytoplasm, specialized chaperones bind T3SS substrates and deliver them to the ATPase anchored at the cytoplasmic face of the T3SS assembly. All evidence indicates these chaperones are released back to the cytoplasm with only the cognate effector substrate shuttled into the export apparatus(83) for secretion. T3SS chaperones have been shown to prevent premature degradation and oligomerization of substrates, as well as undesirable interactions with bacterial proteins and the bacterial membrane(84), and may also help establish a secretion hierarchy of substrates(85). Chaperones can be divided into several classes: class IA (or uni-effector) chaperones specifically bind one effector, class IB 11 (or multicargo) chaperones associate with multiple effectors, class II chaperones bind translocon proteins, and class III chaperones associate with needle subunits. A number of chaperones have been structurally characterized, both as homo- or heterodimers, as well as in complex with their cognate substrate(23,48,54,57,58,86-101). Although there is diversity amongst the various species, chaperones are typically small, acidic proteins, and may function as homodimers or heterodimers. 1.4.1 Class IA and IB chaperones Class IA and IB chaperones typically bind the N-terminal region of effectors, a region referred to as the chaperone binding domain, covering the first 50-100 amino acids of the effector. Generally, the N-terminal region of the effectors adopts a non-globular conformation and wraps around the surface of the chaperone. An intriguing similarity observed between co-crystal structures of both class IA and IB effector/chaperone pairs SptP/SicP(86), YopE/SycE(102), YopN/SycN-YscB(23), YscM2/SycH(89), SipA/InvB(88) and YopH/SycH(90) is the presence of a so-called “β-motif” within the chaperone binding domain of the effector, which forms an intermolecular β-sheet interaction with the chaperone, thus behaving as a conserved targeting motif(88). While the N-terminal region of effectors interacts with the chaperone in a non-globular conformation, some effectors retain catalytic activity of their C-terminal domain when in complex with the chaperone, indicating that the C-terminal domain retains a globular fold (87). The process of effector translocation through the needle has been described as “threading the needle”(103), implying that the N-terminal domain of the effector, maintained in an unfolded conformation by interaction with the chaperone, is first fed through the T3SS needle, and the subsequent unfolding of the globular 12 C-terminal domain, concomitant with the ATP hydrolysis and consequent release of the chaperone, allows for passage of the effector in a partially unfolded state. Class IA chaperones bind a specific effector usually encoded in a gene adjacent to the chaperone gene, and translation of the chaperone has been shown to be coupled to expression of the effector(104). Structurally characterized examples of class IA chaperones in Salmonella include SigE(87), which binds effector SopB, as well as SicP(86), which binds effector SptP. Both SigE and SicP have a mixed α/β-fold and function as homodimers. The N-terminal chaperone binding domain of SptP interacts with the SicP dimer in an extended conformation through hydrophobic patches on each chaperone monomer surface(86), an interaction that exemplifies complex formation between effectors and Class I chaperones. Class IB chaperones are often encoded near genes for structural components of the T3SS and interact with multiple substrates(85). Structures from various species indicate that, like their class IA counterparts, IB chaperones contact their effectors in an extended non-globular fashion via dispersed clusters of largely nonpolar interactions (for example, as seen in Yersinia YopE/SycE(102), and YscM2/SycH(89)). The Salmonella Class IB chaperone InvB is encoded between the genes encoding the T3SS export apparatus component InvA and the ATPase InvC within the invABC locus and binds effectors SipA(105), SopE/E2(106,107), and SopA(108). A feature unique to the latter two of these effectors (as well as their orthologs which interact with the Shigella chaperone Spa15 (31% sequence identity to InvB) is the presence of a conserved sequence (LMIF)xxx(IV)5xx(IV)8x(N)10 which resides within the above mentioned β-motif(109) structural region of these proteins. Interestingly, Spa15 and InvB can function 13 interchangeably to bind and facilitate secretion of effectors containing this conserved sequence(109), suggesting that it acts as a conserved Class IB chaperone targeting motif. 1.4.2 Class II chaperones Class II chaperones contain tetratricopeptide (TPR) repeats and are required for secretion of the two T3SS translocon proteins that form the pore-forming complex in the infected host cell membrane (these proteins are often termed major and minor based on their proposed prevalence in the complex). Structures of Pseudomonas PcrH with a PopD(56) peptide, Yersinia SycD(94) with a YopD(58) peptide, and Shigella IpgC(92) with a IpaB(57,93) peptide reveal a conserved chaperone fold of TPR repeats with a “cupped palm” surface which forms a binding groove for the minor or major translocon peptide. Stoichiometry and dimerization interfaces of class II chaperones vary in the structures observed to date. Structures of the full-length translocon/effector complex could help discern the ternary structure of the complex; however, the full-length translocon may interact with the chaperone in a molten globule conformation(110), impeding crystallization. 1.4.3 Class III chaperones Class III chaperones form heterodimers and associate with needle subunits in a 1:1:1 ternary complex to prevent polymerization of the needle in the bacterial cytosol. Structures of Pseudomonas PscG/PscE/PscF(48), Yersinia YscG/YscE/YscF(47) and Aeromonas AscG/AscE(111) complexes have been solved. The PscG/YscG/AscG chaperone has a TPR fold that binds the C-terminal helix of the needle subunit (PscF/YscF) via hydrophobic residues of its concave surface. The second chaperone, PscE/YscE/AscE, has two main α-helices and associates primarily with PscG/YscG/AscG, perhaps stabilizing the TPR chaperone. It is interesting to note that the heterodimeric chaperoning system of the needle 14 subunit diverges from the chaperone of the EPEC filament protein EspA (essentially an elongated extension of the needle component in that species), in which a single hairpin structured chaperone CesA bound to EspA in a 1:1 ratio is sufficient to impede polymerization of EspA(54). 1.5 Architecture of the T3S apparatus 1.5.1 The export apparatus and ATPase The export apparatus is composed of five membrane proteins (SpaP, SpaQ, SpaR, SpaS and InvA in Salmonella), as well as a soluble ATPase complex. The membrane components of the export apparatus localize to the inner membrane, initiating with assembly of SpaP, SpaQ and SpaR(13) (YscR, YscS, YscT in Yersinia)(15) and associate with the base of the needle complex, where they are required for assembly of the functional secretion system(13). EM analysis of needle complexes with deletion of the export apparatus membrane proteins shows a loss of density located in the inner membrane rings of the basal body, which corresponds to the socket and cup region. These are thought to function respectively as an anchor for the inner rod and an entry point for substrates(28,68) (see below), suggesting that the export apparatus contributes to its formation(13). Recent in situ cryo-electron tomography studies of the T3SS injectisome revealed the organization of some export apparatus features (for instance the ATPase oligomer and export gate), which are absent in purified needle complexes(31,32). While little is known about the structure of the membrane components SpaP, SpaQ, SpaR, the cytoplasmic domains of SpaS and InvA (and orthologs), as well as the ATPase have been structurally characterized. 15 1.5.2 The autoprotease SpaS, sometimes referred to as a molecular switch for its potential role in controlling the chronology and specificity of substrate secretion, has an N-terminal trans-membrane domain connected by a well-conserved flexible linker to a globular C-terminal cytoplasmic autoprotease domain. The autoprotease has a conserved NPTH sequence motif and self-cleavage occurs between the asparagine and proline residues via an intein-like mechanism involving asparagine cyclization(24,112). The two subdomains produced by self-cleavage tightly associate and structures of SpaS(24) (Salmonella), EscU(24) (EPEC), Spa40(25) (Shigella), YscU(26,27) (Yersinia), and FlhB(113) (flagellar homolog) have been solved. The conserved fold consists of a central β-sheet and four α-helices, with the cleavage motif situated on a short surface-exposed loop. Self-cleavage alters the electrostatic surface of the auto-protease, which may function biologically as a switch mechanism, changing from export of “early substrates” (needle and rod) to “late substrates” (needle tip and translocon) as non-cleaving mutants have defective secretion profiles of late substrates and effectors(24,114,115). Non-cleaving mutants also have aberrant localization of chaperone/effector complexes at the inner membrane, suggesting that cleavage may support targeted and specific docking of these complexes to the export apparatus(115). Interestingly, a non-cleaving YscU mutant secreted tip protein when the N-terminal secretion signal of an effector was grafted onto the tip protein, also indicating a role in recognition of effectors(114). Additionally, in EPEC the autoprotease domain directly interacts with the inner rod(116), and associates with the “ruler” protein(71), although the significance of these interactions and how they contribute to substrate switching and assembly is not understood. Unlike the export ring pore (see below), the autoprotease has only been observed as a 16 monomer, although it is possible that multiple copies are present in the assembled export apparatus. 1.5.3 The export gate The export apparatus component InvA (MxiA in Shigella, YscV in Yersinia) oligomerizes(15,21) to form a cytoplasmic export ring pore. Structures of InvA cytoplasmic domain(19,20) (as well as the flagellar homolog FlhA)(117-119) captured a monomeric form of the protein; however, the cytoplasmic domain of MxiA crystallized in a closed, planar nonameric ring with an external diameter of 110-170 Å, a pore diameter of ~50 Å and a depth of ~55 Å (Figure 1.2 D)(21). The monomer is composed of four conserved subdomains, the first of which is structurally similar to the E subunit from the peripheral stalk of the archael A0A1 ATP synthase(19-21). The nonameric ring in the crystal structure is formed by interactions between subdomains 1 and 3, with subdomain two situated at the external edge of the ring, a conformation supported as biologically relevant for secretion by mutational analysis of key interacting residues(21). Electron cryo-tomography of flagella with a deletion of FlhA showed a loss of density in the toroidal region situated between the inner membrane rings of the base and the cytoplasmic ATPase, consistent with the size of the nonameric MxiA ring(21). This data suggests a model in which T3SS substrates are unwound from their cognate chaperone at the site of the ATPase (see below) and funnelled into the export ring pore, which facilitates passage of the substrate to the mouth of the needle complex channel, a step that may be energetically enabled by proton motive force(21). The role of the remaining membrane components of the export apparatus remains unknown and future structural work is required to construct a comprehensive model of how the export apparatus functions to deliver and regulate passage of substrates to the needle complex. 17 1.5.4 The ATPase The T3SS has a dedicated ATPase that is structurally similar to the β-catalytic subunit of the F1 ATPase. The structure of the T3SS ATPase in EPEC, EscN(17) has been solved, as well as the flagellar homolog FliI(120). The ATPase has three domains: an N-terminal domain thought to facilitate oligomerization into a homohexamer(121,122), a central ATPase domain that binds ATP via a conserved Rossmann fold, and a C-terminal domain, which is the proposed binding site of the chaperone/effector complex(17,83). The in silico model of the ATPase hexamer, based on interactions between the α- and β-subunits of the heterohexameric F1-ATPase, suggests a circular complex with an outer diameter of 105Å, and an inner pore diameter ranging from 30-50 Å, as well as 6 ATP binding sites located at the consecutive dimer interface of adjacent monomers(17). The structure of the flagellar ATPase accessory protein, FlgJ, (as well as a Chlamydia trachomatis T3SS ortholog CT670(123)) were also solved and shown to be structurally similar to the F1F0-ATPase central stalk γ subunit; it is proposed these proteins facilitate hexamerization of the ATPase by binding in a 1:6 ratio, likely orientating the ATPase such that the C-terminal domain faces the membrane and export gate(124). Thus far, little is known about how the ATPase coordinates with the so-named “sorting platform”(125), a complex localized to the cytoplasm and proposed to include SpaO, OrgB (homologous to the peripheral stalk protein of F-ATPase) and other export apparatus components (SpaP, SpaQ, SpaR, SpaS) to transport substrates in a regulated, hierarchical fashion. 1.5.5 The basal body The portion of the needle complex embedded in the bacterial inner and outer membranes is called the basal body; remarkably, despite the 3.5 MDa size of the needle 18 complex, the basal body is composed of three proteins (InvG, PrgH, and PrgK in Salmonella) that are ~60 kDa or smaller(10). The needle complex has been studied by cryo-EM (Salmonella)(28,126) and negative stain EM (Shigella)(29), revealing a common overall architecture consisting of a series of stacked rings with a wide base and neck-like region. Recently, in situ cryo-electron tomography was used to study Shigella, Salmonella and Yersinia injectisomes, the latter of which has never been purified(31,32). The recent EM map of the Salmonella needle complex with improved resolution(28), along with new crystal structures of the periplasmic and cytoplasmic domains of PrgH, and the periplasmic domain of InvG in conjunction with customized Rosetta modelling algorithms(34) have led to the most rigorous model to date of the possible oligomerization interfaces within the major ring components of the T3SS basal body (Figure 1.2 C). 1.5.6 The inner membrane rings The inner membrane portion of the basal body consists of two stacked rings, inner membrane ring 1 (IR1), located in the periplasm and inner membrane ring 2 (IR2) located in the cytoplasm. The IM ring is composed of oligomers of PrgK and PrgH(63). Nano-gold labelling and EM show that the C-terminal region of PrgH localizes to the periplasmic region, where it forms a 24-mer ring, which encompasses a smaller diameter 24-mer ring of the N-terminal domain of PrgK(28,63). PrgK is predicted to be anchored to the inner membrane by its lipidated N-terminus(12), with the N-terminal domain positioned in the periplasm, followed by a transmembrane helix and small cytoplasmic domain. Crystallization of the N-terminal domain of the EPEC PrgK ortholog EscJ produced a superhelical organization in the crystal lattice, with 24 subunits in a complete turn of the helix(33). Flattening of the helix produced a ring structure composed of 24 subunits of EscJ 19 with a diameter of 180 Å, similar to the diameter observed in EM maps of Salmonella IR rings(33). PrgH contains a single transmembrane helix, which divides the protein into a cytoplasmic N-terminal domain and a periplasmic C-terminal domain(63). The structures of the periplasmic(34,35) and cytoplasmic(34) domains of PrgH have been solved. The PrgH periplasmic domain contains two ring-building motifs (a conserved fold consisting of two α-helices folded against a β-sheet)(35), whereas the cytoplasmic domain contains a fork head associated (FHA) domain, as observed in structures of orthologs in Shigella(36,37), Yersinia(127,128) and Chlamydia (PDB 3GQS). While FHA domains commonly bind phosphorylated threonines, the FHA residues that bind phosphothreonines are poorly conserved among T3S orthologs(34). Of note, deletion of the FHA domain in Salmonella leads to the formation of needle-less basal body, suggesting a role in T3SS assembly. A definitive biological role for this domain has not been elucidated, although modelling predicts it faces the cytosol, rendering it available to mediate protein-protein interactions(34). 1.5.7 The outer membrane ring The outer membrane ring (OM ring) and neck region of the basal body is composed of InvG(63), a protein belonging to the secretin family. Secretins typically oligomerize in outer-membrane embedded complexes of 12-15 subunits, and are also core components of the T2SS and Type IV pili System(129). Assembly and oligomerization of InvG in the outer membrane requires the assistance of a small lipoprotein, a pilotin called InvH(60,61). The structures of the Shigella and Pseudomonas pilotins MxiM(38) and ExsB(130) show little structural homology. Although both contain anti-parallel β-sheets, MxiM contains an additional α-helix that interrupts the β-barrel like structure. MxiM is proposed to function by first binding its own N-terminal lipid, which is then displaced by interaction with the C- 20 terminal domain of Shigella secretin MxiD, freeing the lipid moiety for recognition by the Lol sorting pathway and insertion into the outer membrane(38,39). Atomic resolution data were previously only available for the periplasmic domain of the EPEC secretin EscC(35), but a crystal structure of the homologous domain of Salmonella InvG(34) is now available for modelling into the Salmonella T3SS EM map. Recent cryo-EM of InvG suggests the OM ring is composed of 15 subunits(28), which, although initially unexpected and still a matter under investigation in Salmonella and other species, was recently supported as the most favourable oligomeric assembly of the periplasmic domain of InvG modelled into the high resolution EM map by Rosetta(34). Indeed, cryo-EM analysis of the Yersinia secretin YscC revealed that is composed of 12 subunits(40). Both EscC and InvG secretins contain a conserved “ring building motif” consisting of two α-helices folded against a β-sheet, which is found at the InvG oligomer interface, supported by mutational analysis(34), suggesting that the fold may serve as an oligomerization scaffold(35). The N-terminal periplasmic domain of InvG extends into the periplasm and contacts the C-terminal domain of PrgH, as shown by crosslinking of the needle complex and mass-spectrometry analysis(63,131). Additionally, recent modelling suggests an electronegative face on the surface of the InvG ring opposite a complementary electropositive face of the PrgH ring, which may aid in ring assembly(34). The overall assembly of the basal body has 3-fold symmetry, with 4-5 subunits of InvG corresponding to 8 subunits of IR-1(28). The recent EM structure of the basal body suggested that the interior cup (at the cytosolic side) and socket-like structures are composed of apparently individual subunits with the socket connecting directly to the inner rod(28). Little is known about the protein composition and role of these observed features, but one hypothesis is that the socket serves as an anchor for the inner rod, and the cup region as an 21 entry point for substrates. After contact with the host cell, a signal transmitted through the needle and inner rod may trigger a conformational change in the cup region, allowing for subsequent export of substrate(28,126). 1.5.8 The inner rod The inner rod of the T3SS is located within the base of the needle complex(126) and is proposed to form a channel through the periplasmic spanning region of the needle complex, physically anchoring the needle to the base of the secretion system(68). Based on predicted coiled-coil regions within the primary sequence, the inner rod subunit is proposed to be paralogous to the extracellular needle subunit(78) and like the needle, believed capable of self-polymerization(116). However, because the inner rod is localized within the concentric rings of the basal body, it likely requires such an environment to fold into its functional form, presumably hindering structural studies on the intact rod in its isolated form. Indeed, analysis of recombinant, purified Salmonella inner rod subunit, PrgJ, and Shigella inner rod subunit, MxiI, by NMR spectroscopy and circular dichroism revealed that the inner rod behaves as a monomer, lacks tertiary structure, and is mostly unfolded, save for a short C-terminal α-helical region (residues 65-82 in PrgJ)(132), indicating that additional scaffolding components may be required for folding and polymerization. Multiple binding partners within the T3SS have been implicated for the inner rod during assembly. The inner rod from E. coli, EscI, has been shown to interact with the cytoplasmic domain of the autoprotease (EscU)(116,133), with a specialized T3SS associated lytic transglycosylase (EtgA)(133) proposed to selectively clear peptidoglycan to facilitate T3SS assembly, and the secretin component of the basal body(116). Additionally, it has been shown to bind the gatekeeper protein (InvE/MxiC/YopN) in Salmonella, Shigella and 22 Yersinia (see above)(77). Recognition of the inner rod by the autoprotease may play a role in switching from “early” to “late” substrates during assembly(116). Interaction with the lytic transglycosylase (IagB in Salmonella, IpgF in Shigella) is proposed to locally clear peptidoglycan for efficient assembly of the T3SS(134-136) and contribute to virulence of Citrobacter in mice(137). 1.5.9 The needle A filament termed “the needle” forms an ~50 nm long channel with an 8 nm outer diameter and 2 nm inner diameter that extends from basal body to the host cell, and functions as a conduit for effectors proteins. The needle is a polymeric assembly of more than 120 copies of a small molecular weight protomer called MxiH in Shigella(11) and PrgI in Salmonella(138,139). Purified needle protomer can polymerize spontaneously to form long filaments of varying lengths, rendering atomic resolution models of the individual protomer inherently difficult to attain. Fortuitously, deletion of the last five amino acids of the protomer prevents polymerization, and a crystal structure of monomeric MxiH∆C5(44) and NMR structures of monomeric BsaL∆C5(49) (Burkholderia) and PrgI∆C5(42) were obtained. Structures of PscF (Pseudomonas)(48) and YscF(47) (Yersinia) were also obtained in complex with their respective heterodimeric chaperones (see Chaperones section). MxiH, BsaL and PrgI consist of N-terminal α-helix (α1) and a C-terminal α-helix (α2), connected by conserved central region with a PxxP sequence motif (x = S, D or N). The first 3, 8, and 19 N-terminal residues of PrgI, BsaL and MxiH, respectively, are disordered and have less sequence conservation than the central region and C-terminal helix(42,44,49). While truncation of the five C-terminal residues of the needle protomer allowed elucidation of the monomeric structures, these mutants are non-functional, and thus further probing of the 23 protein-protein interactions that permit needle polymerization requires models of the full-length monomer, as well as the intact needle filament. A systematic mutagenesis study identified a soluble full-length PrgI and MxiH double valine to alanine mutant (V65A V67A in PrgI), referred to as PrgI* and MxiH* (41). NMR and x-ray structures of PrgI* show that the last five residues extend the C-terminal α2 helix (41). PrgI* spontaneously polymerizes in vitro and Fourier-transform infrared spectra and Magic-angle Spinning solid state NMR spectroscopy identified a helical to beta-sheet conformational change in the C-terminal region of PrgI* upon conversion from monomer to polymer, suggesting that protomer refolding is required for assembly of the needle(41). A hybrid approach using x-ray fibre diffraction, electron microscopy and docking of protomer structures to EM maps was used to address the question of how the needle protomer assembles to form a filament, and to characterize the helical architecture and dimensions of the filament. The first model of the Shigella needle was solved to ~16 Å resolution and had 5.6 subunits/turn and a 24 Å helical pitch(140). Docking of the MxiH crystal structure into the EM map lead to the first proposed model, in which MxiH was oriented such that the head group, or central region, decorated the surface of the needle, the N-terminal helix lined the central channel, and the C-terminal helix formed the outer shell of the needle(44). A higher resolution cryo-EM structure solved to 7.7 Å allowed visualization of alpha and beta features of the Shigella needle(45). Docking of MxiH into the EM map resulted in a model with the C-terminal region of MxiH exposed on the needle surface, and the N-terminal helix lining the needle channel. β-hairpin structure identified on the needle surface (contributed to residues 51-64 of MxiH) appeared to interact with the head group of the subunit below in the 11-start helix (45). Electron microscopy was also used to generate an ~18 Å model of the Salmonella 24 typhimurium needle with an average symmetry of 6.3 subunits per turn and a 26Å helical pitch(141). The central region of the PrgI monomer was modeled into the density of the needle map, but the resolution of the filament structure and the structural plasticity of PrgI prevented modeling of the remainder of the monomer. While the models described above have provided a wealth of information about the needle, they are limited by resolution, as inter- and intra- subunit contacts cannot be discerned at low or medium resolution. A recent study combined solid-state NMR (ssNMR), electron microscopy and Rosetta modelling to deliver the first atomic model of the Salmonella typhimurium needle (Figure 1.2 B)(43). Previous EM models were calculated from needles sheared from isolated basal body complexes, whereas this study used recombinantly produced needles obtained by in vitro polymerization. The resulting model had an 11-start helical configuration, with ~5.7 subunits per turn and an axial rise of 24Å. Within the context of the needle filament, the secondary structure of PrgI, as determined by conformation-dependent chemical shifts, consists of an extended N-terminal domain, an α-helix, loop, and C-terminal α-helix. ssNMR spectra of [1-13C] glucose labeled, [2-13C] glucose labeled, and mixed [1/2-13C] glucose labeled needle preparations were compared to determine restraints for inter-subunit interactions and intra-subunit interactions(43). Intra-subunit contacts form between the two α-helices, positioning the helices in a hair-pin structure. The lateral interface between subunits forms between α1-α1 and α2-α2 packing of adjacent (i±5, i±6) subunits, and the axial interface includes contacts between the extended N-terminal domain and the central loop region of the i±11 subunit above/below it. Rosetta modelling was used in combination with the ssNMR distance restraints and scanning transmission electron microscopy (STEM) data(141) to obtain an atomic resolution model of 25 the needle. The N-terminal region of PrgI faces the outer surface of the needle, and the C-terminal helix, which has higher sequence conservation between species, lines the central channel of the needle, a topology supported by immuno-gold labelling studies. Recently, ssNMR analysis of the Shigella needle found that MxiH had a similar secondary structure to PrgI in the polymerized needle, and a Rosetta homology model of MxiH generated using PrgI as template correlated well with the cutting-edge 7.7 Å Shigella EM map(45) and the ssNMR chemical shift data. Like the Salmonella needle model, the N-terminal region of MxiH is surface exposed, and the C-terminal region lines the lumen of the needle, suggesting a conserved architecture. 1.5.10 The tip complex The distal end of the needle culminates in a specialized tip complex, which plays a role in sensing contact with the host cell(142-144), regulates secretion of effector proteins(142,144-146), and facilitates insertion of the translocon into the host cell membrane(142,143,145,147-151) (for a comprehensive review of the tip complex(151)). The tip component varies in sequence and assembly between species and can be grouped accordingly: the Inv-Mxi-Spa family (IpaD in Shigella, SipD in Salmonella, and BipD in Burkholderia), the Ysc family (PcrV in Pseudomonas, LcrV in Yersinia) and Esc family (EspA in EPEC, Bsp22 in Bordetella). The tip proteins of the Inv-Mxi-Spa family and the Ysc family have a similar overall fold, although differ in that tip proteins from the latter family have a specific chaperone and tip proteins from the former family have a self-chaperoning domain (see below). Tip proteins from the Esc family have little structural similarity to other tip proteins, albeit the presence of a coiled-coil(54), and extend from the distal end of the needle, polymerizing into filamentous assemblies(152-156) which likely 26 serve species-specific functions during pathogenesis. The focus of this section will be limited to the Mxi-Inv-Spa family of tip proteins; for more information on the Ysc family, refer to structural studies of LcrV(53,157-159) and an in-depth review of PcrV(151). Structural characterization of SipD(50,51), IpaD(52,55), and BipD(55,160,161) indicate a conserved fold, consisting of three domains with an overall dumbbell type appearance: an N-terminal α-helical hairpin packs against a central long coiled-coil domain, with a mixed α/β domain, located at the end of the central coiled-coil, lying opposite the N-terminal domain. The N-terminal α-helical hairpin is proposed to act as a self-chaperoning domain, as its fold is similar to that of the needle subunit, and it may mimic interactions with the needle(55), preventing premature oligomerization of the tip protein in the bacterial cytoplasm(162). The interface formed between the needle and tip has been probed in Shigella(163) as well as Salmonella(51,164). In Shigella, an interaction occurs between the PSNP motif of MxiH and IpaD. This interaction is not possible without a reorganization of the proposed self-chaperoning domain of IpaD. A crystal structure of a PrgI-SipD fusion in combination with mutational analysis convincingly demonstrates that the self-chaperoning region of SipD must be deleted (in vitro) for interaction with PrgI to occur and that PrgI interacts with the concave face of the central coiled-coil with residues that make contacts with a helix of the N-terminal domain in the full-length PrgI structure(51). This interaction face is consistent with NMR paramagnetic relaxation enhancement studies between PrgI and SipD(164). A model of the pentameric(165) Salmonella SipD tip complex atop the Shigella needle modelled by cryo-EM(44) with the concave face of the SipD central coiled coil assembling around the outer surface of the needle suggests an open conformation, with the inner channel of the needle accessible and SipD forming an outer diameter of 140Å(51); 27 however, SipD/PrgI interaction has not yet been reworked in the context of the recent Salmonella ssNMR needle model(166). High resolution structural studies of the tip complex in the context of the polymerized needle will be required to determine how the self-chaperoning domain refolds to allow tip assembly, and how the tip complex regulates secretion of effector proteins and insertion of the translocon into the host cell membrane. Bile salts are present at high concentrations in the host duodenum, and interact with the tip proteins of infecting Shigella and Salmonella; however, binding of bile salts to tip protein have apparently contrary effects on the invasiveness of Shigella and Salmonella. Interaction of IpaD with bile salts activates IpaD and stimulates recruitment of the translocon component IpaB(150,167), whereas bile salts repress invasiveness of Salmonella(168). The bile salt deoxycholate interacts with IpaD α3 and α7 of the central coiled-coil, and induces a conformational change upon binding(52,169). Three reports demonstrate binding of SipD to bile salts deoxycholate, taurodeoxycholate and chenodeoxycholate, although they describe different positions of the bile salt binding cleft(50,51,170). 1.5.11 The translocon Upon contact with the host cell, the translocon components of the T3SS are secreted and form a pore in the host cell membrane(171-173), a step which is required for delivery of effector proteins to the host cell cytoplasm. The translocon is assembled from three components: a hydrophilic translocator (or tip complex; see above), a major hydrophobic translocator and a minor hydrophobic translocator. The so-termed major hydrophobic translocator contains two predicted transmembrane regions, while the minor translocator contains one membrane-associated region. In Salmonella the translocon forms a pore with an inner diameter of approximately 3.5 nm(174). Atomic force microscopy of the EPEC 28 translocon suggests a complex of 6-8 subunits with an outer diameter of 55-65 nm and a height of 15-20 nm protruding above the membrane plane(175). The hydrophobic components of the translocon have been recalcitrant to structural studies, perhaps owing to the transmembrane regions as well as the myriad of conformations and interactions they must likely form, for example: complex formation with cytoplasmic chaperone, export in a presumably partially unfolded state through the needle, subsequent interaction with needle tip and/or translocon partners, oligomerization to form a functional pore, insertion into the host cell membrane, interaction with host lipids, and finally interaction with host proteins within the host cytoplasm. Current structures of the translocon proteins are restricted to peptides of the translocators in complex with their chaperone(56,57,93), as well as a protease-resistant N-terminal segment of the major translocator(59). The structure of a peptide of the N-terminal chaperone binding domain of Shigella major translocator IpaB(57,93), a peptide of Pseudomonas minor translocator PopD(56), and a peptide of Yersinia minor translocator YopD(58) in complex with their respective chaperones IpgC, PcrH, and SycD were solved by x-ray crystallography. Interestingly, the chaperone appears to bind both the major and minor translocator in the same cleft. Despite low sequence identity (21%) the N-terminal region of IpaB and Salmonella SipB were found to both form a well conserved extended coiled-coil consisting of 3 anti-parallel helices(59). Since the needle, tip and translocon all possess a coiled-coil motif, it appears this is an important structural motif in assembly of the functional secretion system. High resolution EM data and/or atomic level structural data will provide insight into how the pore regulates passage of effectors into the host cell, and help validate or disprove 29 proposed models of assembly such as the “three-tiered ring model”(176) in which each hydrophobic component forms a homo-oligomer, with the major component embedded in the membrane and the minor component associated with the membrane and in contact with the tip complex, or another alternate assembly model in which the hydrophobic components form a hetero-oligomer that then associates with the tip complex(176). 1.6 Transport of effectors through the T3SS Since the diameter of the T3SS needle filament (~20 Å) cannot accommodate passage of folded effector proteins, it has long been presumed that after release of the chaperone at the site of the export apparatus, effectors are fed through the secretion system needle in an unfolded form. Recently, this concept was elegantly illustrated by cryo-EM and single particle analysis of “substrate-trapped” Salmonella injectisomes(30), as well as biochemical and functional analysis of Shigella substrate-trapped injectisomes(177). The substrate, Salmonella effector protein SptP, or Shigella IpaB was effectively trapped during secretion through the injectisome by fusion of a stable protein to its C-terminus, which cannot be unfolded by the T3S apparatus, thus preventing efficacious secretion and subsequently blocking the secretion channel. Negative stained EM analysis of substrate-trapped injectisomes showed a bulbous protrusion at the distal needle tip, indicating that effector refolding occurs spontaneously after secretion; additionally, immunogold labelling localized the C-terminal fusion to the base of the basal body, demarcating the substrate entry point. Difference maps between the WT needle complex and substrate-trapped needle complex show additional density along the length of the inner rod and needle (corresponding to the unfolded substrate) and unexpectedly reveal a change in density along the circumference of the basal body IR-1(30). To summarize, the unfolded substrate enters the secretion channel 30 in a polarized fashion, leading with the N-terminus, and travels the length of the needle; upon exiting the needle channel, the substrate appears to spontaneously refold. Due to the resemblance of the T3SS to a syringe, it has been intuitively thought that delivery of effectors to the host cell occurs via a one-step “microinjection” mechanism, by which the effector travels through the injectisome, bypassing the bacterial and host membranes, to reach the host cytoplasm. However, recent work has led to the proposal of an alternate two-step method, in which T3SS effectors and translocators are secreted prior to host cell contact and localize to the bacterial surface; after contact with the host cell, the hydrophobic translocators are proposed to insert into the host cell membrane and facilitate entry of effectors, much like binary AB toxin delivery(178,179). Further work is required to definitively show whether the host membrane-embedded translocon forms a continuous channel with the tip and needle filament, and/or functions independently as a pore to allow transport of effectors localized at the bacterial surface. 1.7 Structural overview of Salmonella effectors The overall structure of the T3S apparatus is remarkably well conserved between species; however, the number and activities of T3SS effector proteins that are passaged through the system vary extensively between species, as each species possesses a uniquely adapted set of effectors that promote survival and replication of the bacteria within the host. Nonetheless, there are some common themes that are generally conserved amongst effectors from all species such as modularity, functional mimicry, and spatial and temporal regulation of effector activity(180). Effector proteins provide a sophisticated mechanism for tampering with the host cell physiology to promote survival of the bacteria – unlike bacterial toxins, many effector-mediated modifications of host proteins are reversible; in fact, the activities of 31 some effectors are antagonistic, which allows the bacteria fine-tuned control over host processes. In this section we will conduct a brief survey of Salmonella effectors that have been structurally characterized (see Figure 1.3, Table 1.3). Figure 1.3 Overview of structurally characterized Salmonella effectors and their role in host cell pathways. Left panel, Salmonella SPI-1 effectors are shown in blue font and SPI-2 effectors are shown in green font. After entry into the host cell, Salmonella survives and replicates within the Salmonella containing vacuole. SPI-1 and SPI-2 effectors target many host pathways; here we highlight structurally characterized effectors that target RhoGTPase signalling, the ubiquitin pathway, cytoskeleton components, and also effectors that covalently modify host proteins. A) Effectors SopE (green), SopB (orange), and SptP (red) interact with switch regions (shown in cyan) of Cdc42 and/or Rac1 (blue). B) Hect-type E3 ligase SopA (purple) in complex with host E2 ubiquitin conjugating enzyme UbcH7 (gray) and NEL E3 ligase SspH2 (yellow). C) SifA (red) in complex with kinesin binding protein SKIP (gray), ADP ribosyltransferase SpvB (purple) and actin binding SipA (blue) all interact with and/or modify host cytoskeleton proteins. D) Many effectors covalently modify their host targets, such as phosphothreonine lyase SpvC (yellow), cysteine protease SseI (green) and the C-terminal tyrosine phosphatase domain of SptP (red). PDB codes of Salmonella effector structures used for this figure are listed in panels A–D. 32 Table 1.3 Structure of Salmonella effector proteins T3SS Effector Activity Host Interacting Partner Structure PDB code (reference) SPI-1 SipA Actin bundling F-actin (N)SipA/InvB 2FM8(88) (N)SipA 2FM9(88) (C)SipA 1Q5Z(181) SopA HECT3 Ubiquitin ligase Ubiquitin conjugating enzymes (E2) UbcH5a, UbcH5c, UbcH7 SopA/E2 UbcH7 3SY2(182) SopA 2QZA, 2QYU(183) SopB (N) GDI, (C) Phosphoinositide phosphatase Cdc42 (N)SopB/Cdc42 4DID(184) SopE GEF Cdc42, Rac1, Rab5 SopE/Cdc42 1GZS(185) SopE2 GEF Cdc42, Rac1 SopE2 1R9K(186) SptP (N)GAP, (C) Tyrosine phosphatase Cdc42, Rac1 (N)SptP/SicP 1JYO(86) SptP/Rac1 1G4U(187) SptP 1G4W(187) PipB2 Kinesin light chain (N)PipB2 2LEZ SPI-2 SifA (N) SKIP interacting (C)GEF RhoA, SifA kinesin interacting protein (SKIP) (N)SifA/SKIP 3HW2(188) (N)SifA/SKIP 3CXB(189) SseI (C) Cysteine protease TRIP6, IQGAP1 SseI 4G29(190) SspH2 E3 ligase PKN1 SspH2 3G06(191) SpvB ADP-ribosyltransferase actin SpvB 2GWK(192) SpvC Phosphothreonine Lyase Dual-phosphorylated MAPKs Highest activity for phospho-p38 SpvC 2Q8Y(193) SpvC + phosphothreonine peptide 2Z8P(194) 33 1.7.1 Modulation of RhoGTPases Rho GTPase signalling is commonly targeted by bacterial effectors, perhaps due to its central role in regulation of host actin and cytoskeleton dynamics, as well as numerous signal transduction pathways. Rho GTPases act as molecular switches, alternating between an inactive GDP bound state and an active GTP bound state. In the active GTP bound state, Rho GTPases Cdc42, Rho, and Rac interact with more than 30 potential eukaryotic effector proteins, such as kinases, consequently activating down-stream signalling pathways(195). Rho GTPases have a conserved small globular α/β fold with two flexible switch regions (switch I and switch II) and a conserved P-loop (phosphate binding loop) which coordinate the nucleotide and an Mg2+ ion, and undergo a conformational change after hydrolysis of GTP to GDP(196). Hydrolysis of GTP is intrinsically slow, and activity of the Rho GTPase is regulated by guanine-nucleotide exchange factors (GEFs), GTP activating proteins (GAPs) and guanine nucleotide dissociation inhibitors (GDIs)(196). Salmonella effectors SopE and SopE2 are bacterial GEFs that catalyze Cdc42 and Rac1 exchange of GDP for GTP(197-199), a function that could not be extrapolated from sequence analysis as the bacterial GEFs show no sequence or structural homology to eukaryotic GEFs(185,186). Indeed, SopE has a V-shaped fold composed of two 3-helix bundles and a catalytic GAGA motif connecting the two sides of the ‘V’. In the co-crystal structure, SopE contacts switch I and II of Cdc42, mimicking interactions of eukaryotic GEFs with key Cdc42 residues, to disrupt binding of the nucleotide and facilitate its dissociation(185). SifA, a SPI-2 secreted Salmonella effector may contact Rho-GDP through a C-terminal domain which has similar fold to SopE(188,189); however, it belongs to the WxxxE family of bacterial effectors, named for the conserved Trp and Glu residues in the catalytic site, and GEF activity has not yet been 34 demonstrated(200). The N-terminal GAP domain of Salmonella effector SptP forms a four-helix bundle that inserts between switch I and II of the GTPase and contacts the β- phosphate of GTP with a catalytic arginine residue(187), mimicking the interaction made between eukaryotic GAPs and Cdc42, despite a lack of sequence and structure conservation. The N-terminal domain of Salmonella effector SopB has GDI-like activity towards Cdc42, and contacts switch I and II of the GTPase via a helical bundle and mimics interactions of eukaryotic GDIs to prevent dissociation of GDP nucleotide(184). The structures of Salmonella GTPase binding domains reveal that they contain a mostly helical fold and share little structural homology with their eukaryotic counterparts. Salmonella has co-opted a complete set of GTPase regulators to finely tune host GTPase activity during infection. 1.7.2 Targeting the host ubiquitin pathway The host ubiquitin pathway plays a pivotal role in numerous host processes such as protein degradation, DNA repair, cell cycle control, and protein trafficking (see reviews(201-203)), and bacterial effectors have evolved to commandeer various aspects of the ubiquitin pathway(204). Three enzymes facilitate the covalent attachment of ubiquitin to specific lysine residues of a target protein either as a mono-ubiquitin or poly-ubiquitin chain: 1) Ubiquitin activating enzyme E1 recruits and binds ubiquitin via a covalent thioester bond 2) Ubiquitin conjugating enzyme E2 transfers ubiquitin from E1 and 3) ubiquitin ligase E3 interacts with E2 and transfers ubiquitin to the lysine of the target substrate(205). Structurally characterized Salmonella effectors SopA and SspH2 are both ubiquitin E3 ligases, although SopA belongs to the HECT-type E3 ligase family(206) and SspH2 belongs to the NEL (Novel E3 Ligase) family(207). SopA has little sequence conservation with eukaryotic HECT E3 ligases, except for a conserved motif in the active site, but is 35 structurally similar in that it contains an L-shaped bilobal architecture with an N-lobe that binds E2 and a catalytic C-lobe with a conserved cysteine that can form a thioester bond with ubiquitin(182,183). A co-crystal structure of SopA in complex with host E2 UbcH7 demonstrates that SopA binds the same face of UbcH7 as eukaryotic E3 ligases and comparison of the structure to that of an EHEC ortholog NleL in complex with UbcH7 shows the C-lobe can move 180o on a flexible hinge region, a motion that is important for ubiquitin transfer(182). The SspH2 structure revealed two domains: an N-terminal leucine-rich repeat (LRR) which mediates protein-protein interactions and an all helical C-terminal E3 ligase domain with a catalytic cysteine(191). The catalytic cysteine is partially buried by the LRRs, which may represent an auto-inhibited conformation, preventing pre-mature interaction with host proteins(191). The known structures of Salmonella E3 ligases show that markedly different structures have evolved to transfer ubiquitin to a subset of host cell proteins, likely dictated by their specific protein-protein interaction domains. This process appears regulated in time as SopA is secreted by the SPI-1 T3SS and SspH2 is secreted by SPI-2 T3SS (another Salmonella E3 ligase SspH1 is secreted by both the SPI-1 and SPI-2 T3SSs). 1.7.3 Covalent modification of host targets Another mechanism deployed by T3SS effectors is covalent modification of host cell proteins. Recent structures of Salmonella phosphothreonine lyase SpvC(193,194), cysteine protease SseI(190), as well as the structure of the C-terminal tyrosine phosphatase domain of SptP(187) exemplify effectors that covalently modify host target proteins. SpvC irreversibly inactivates host signalling protein MAPK by cleaving a phosphothreonine residue required for activity through a β-elimination mechanism, resulting in cleavage of the C-O bond and generation of a double bond product(193,194). The N-terminus, although disordered in the 36 crystal structure, has a conserved D motif for interaction with host MAPKs(193). SpvC has an α/β fold and binds the pT-x-pY peptide of MAPK through a central twisted 5-stranded β-sheet and surface loops(193,194). The phosphothreonine lyase activity of SpvC and related bacterial effectors represents a novel mechanism for irreversible inactivation of MAPKs that has not yet been observed in eukaryotic systems. A recent structure of the C-terminal domain of another SPI-2 secreted effector, SseI, revealed a cysteine protease domain with a conserved Cys-His-Asp catalytic triad(190). This domain of SseI has sequence and structural similarity to Pastuerella multocida toxin (PMT), which has glutamine deamidase activity towards the α-subunit of heterotrimeric GTPases. The biological targets of SseI have yet to be identified, and catalytic activity was not observed in in vitro assays(190). The Salmonella SPI-1 effector SptP, has a C-terminal tyrosine phosphatase domain with sequence conservation (15%) to eukaryotic tyrosine phosphatase PTP1B. Structural analysis reveals this domain of SptP adopts the canonical tyrosine phosphatase fold with a twisted β-strand fold at the core, and a cluster of 4 helices at one end and 2 helices at the other(187). The active site contains a conserved P-loop with a catalytic cysteine(187). These structures provide examples of Salmonella effectors that select host substrates for covalent modification to control signalling pathways in a reversible or irreversible manner. 1.7.4 Interaction with the host cytoskeleton Multiple Salmonella effectors interact with components of the host cytoskeleton, such as actin and microtubule binding proteins. While some effectors alter actin dynamics by regulating activity of small GTPases involved in signalling pathways controlling actin dynamics (see above), others directly bind or modify actin. Crystal structures of Salmonella SipA and SpvB are examples of two such effectors. SipA contains a C-terminal domain that 37 directly binds actin(208) to stabilize F-actin, as well as promote polymerization of G-actin(209). EM analysis demonstrates that SipA binds actin, linking subdomain 4 of actin monomer i to subdomain 1 of monomer i +3 of the adjacent actin filament(181,209). The central region of the SipA actin binding domain has a globular fold with N-terminal and C-terminal extensions on either side that are proposed to behave as a molecular stapler, connecting and stabilizing actin filaments(181). SpvB, another actin-modulating effector, ADP ribosylates actin to inhibit polymerization(210,211). Structural studies of SpvB reveal 2 nearly perpendicular β-sheets forming a canonical ADP ribosyltransferase α/β fold and show binding of NAD in a manner similar to other characterized members of the family(192). SipA and SpvB exemplify the diverse, and sometimes antagonistic, mechanisms Salmonella effectors use to modulate host proteins. Additionally, SP1-2 effector SifA (see above), contacts SifA Kinesin Interacting Protein (SKIP) via its N-terminal domain, an interaction that likely serves to localize SifA to microtubules through binding of SKIP to the motor protein kinesin(77,188,189,212,213). Although the mechanism is not yet well understood, SifA is necessary for tubulation of the Salmonella phagosome and a ∆sifA mutant is attenuated for virulence in mice(212,213). This section provides only a brief survey of Salmonella effectors that have been structurally characterized. Elucidating the structures of these effectors is particularly valuable in the instances for which activity cannot be gleaned from the amino acid sequence. Structural studies of bacterial effectors that do have sequence conservation to eukaryotic proteins provide information not only about the bacterial effector, but also of the class of host protein it emulates. 38 1.8 T3SS summary and perspectives Recent strides have been made in structural characterization of the T3SS. An improved EM map of the needle complex provides new details of its symmetry and substructures(28). New crystal structures of the periplasmic domain of OM ring component InvG and the cytoplasmic domain of IM ring component PrgH in combination with Rosetta modeling provide the most rigorous model of oligomeric interactions in the basal body complex(34). Great advances have been made in determining the architecture of the Salmonella(43) and Shigella(46) needles by a combination of ssNMR, electron microscopy and Rosetta modeling. These studies convincingly demonstrate that the conserved residues of the needle protomer line the channel of the needle, while the variable N-terminal region decorates the surface of the needle. At the cytoplasmic side of the T3SS, a remarkable nonameric structure of the gate protein MxiA provides visualization of a major component of the export apparatus(21). New structures have emerged of class II translocon chaperones(56-58,92-94), as well as class III heterodimeric needle chaperones(47,48,111) and more than eight Salmonella virulence effectors in the last five years(182-184,188-191,194). However despite recent advances, much about the structure and assembly of the T3SS is yet to be discovered. For example, little is known at the molecular level regarding the inner membrane components of the export apparatus, as well as the energetics behind translocation of substrates through the extensive path of the secretion system needle. Less is known about the structure of the inner rod in the periplasm of the needle complex, and the membrane domains of the basal body components. Paramount to our understanding of the T3SS mediated delivery of effectors into the host cell will be structural analysis of the translocon pore-forming complex. Collectively, a piecing together of these T3SS molecular 39 events using a multidisciplinary approach of biophysical, biochemical and cellular microbiology are generating an evolving model of this essential process to the pathogenicity of the major Gram-negative bacterial pathogens. 1.9 Overview of thesis objectives The goal of the research outlined in the following chapters of this thesis is to gain a better understanding of assembly and regulation of the T3SS, as well as to characterize the interaction between a type III secreted effector protein and its host target. Since the discovery of the virulence-associated type III secretion system nearly two decades ago, the field has made great strides in piecing together the structure of this complex macromolecular machine. However, many aspects of how the secretion system assembles remain poorly understood. This thesis describes work on two T3SS proteins from EPEC that are required for assembly: a peptidoglycan-cleaving enzyme called EtgA that interacts with the inner rod EscI, which we show can polymerize into a filament, and a gatekeeper protein that regulates secretion hierarchy, called SepL. EtgA has long been proposed to facilitate T3SS assembly by locally clearing peptidoglycan, which acts as a barrier for large protein complexes. SepL belongs to a class of proteins that regulate the secretion switch from translocon components to effector proteins. The final research chapter presents work on a Salmonella effector protein, called SopB. SopB has a modular architecture, with a GTPase binding domain that interacts with host Cdc42, and a phosphoinositide phosphatase domain, both of which are critical for modulation the host cell. Structural and functional characterization of these secretion system components and effector protein contributes towards improved understanding of multiple aspects of type III secretion. 40 2 Structural analysis of a specialized type III secretion system peptidoglycan-cleaving enzyme 2.1 Introduction Diarrhoeal diseases account for approximately 18% of deaths of children under the age of 5 years (214). In 2011, one of the most prevalent diarrhoea inducing pathogens, enteropathogenic Escherichia coli (EPEC), caused an estimated 79,000 deaths in this age category of children (215). Following ingestion, EPEC adheres intimately to the epithelial cells of the small intestine, and causes effacement of microvilli and formation of actin pedestals beneath the bacterium(216-219). Once adhered to the intestinal epithelium, EPEC assembles a virulence-specific protein transport system (referred to as the type III secretion system or T3SS). The syringe-like T3SS injects more than 20 different virulence proteins from the EPEC cytoplasm directly into the host cytoplasm. Critical for pathogenesis, delivered effectors manipulate host cell processes such as cytoskeleton dynamics, inflammatory signalling pathways, cell cycle progression and apoptosis(220). The T3SS machinery is also conserved among other Gram-negative pathogens such as Shigella, Salmonella, Yersinia and Pseudomonas, underscoring the importance of understanding such a key virulence factor at a molecular level. The EPEC T3SS (as well as effector proteins and their chaperones) is encoded in a pathogenicity island called LEE (locus of enterocyte effacement) that is arranged in 5 polycistronic operons (LEE 1-5). The T3SS is composed of more than twenty proteins that oligomerize in a highly regulated and hierarchical fashion to form a contiguous channel through both bacterial membranes and the host membrane. The first components to assemble are the cytoplasmic export apparatus, inner-membrane basal body rings, and outer-membrane embedded secretin (Figure 2.1). The export apparatus, which includes an ATPase, export 41 gate and autoprotease, shuttles T3SS substrates from the bacterial cytoplasm into the secretion channel. The basal body, which spans the bacterial membranes, is formed by concentric inner membrane rings composed of EscJ and EscD, and an outer membrane-embedded secretin, EscC(33,35,221). The inner rod component (EscI), which shares sequence identity with the well-characterized filamentous extracellular needle (EscF), is presumed to create a channel through the basal body inner and outer membrane rings(78,116), leading to the subsequent needle appendage that continues the channel through the extracellular space. In EPEC, the needle in turn is capped by a filamentous extension composed of EspA (54,152,153,155,222) that facilitates the span of the T3SS across the micro-villiated surface of the infected host gut epithelial cells. In the final step of assembly, the translocon (EspB and EspD) assembles at the tip of the EspA filament and inserts into the host membrane to form a pore(175) for direct delivery of virulence effectors into the host cell. Assembly of molecular transport systems (such as the T3SS) that span both bacterial membranes requires local re-arrangements in the peptidoglycan layer(135,223-225). Peptidoglycan is composed of glycan strands of β-1,4 glycosidic linked N-acetylglucosamine (GlcNAc) and N-acetyl muramic acid (MurNAc) disaccharide, which are crosslinked by short 4-5 residue peptides to create a mesh-like layer with an average pore size between 2-7 nM (226,227). Proteins smaller than ~50 kDa can diffuse freely through the peptidoglycan, but the peptidoglycan layer acts as a barrier to larger proteins and protein complexes (226). The periplasmic region of the T3SS is ~ 17 nm in diameter at the widest point and most species encode a T3SS-specific “specialized” PG-lytic enzyme. 42 Figure 2.1 Schematic overview of T3SS apparatus components and the role of EtgA during assembly. EtgA is transported to the periplasm by the Sec secretion system. It interacts with the inner rod, EscI, in the bacterial periplasm, and locally clears peptidoglycan during assembly. After assembly of the inner rod and needle, the EspA filament and translocon form. Inset- peptidoglycan is composed of repeating MurNAc-GlcNAc disaccharide. Both lytic transglycosylases and lysozymes cleave the β-1,4 glycosidic linkage, but lysozyme uses a hydrolysis mechanism to produce MurNAc and GlcNAc while lytic transglycosylases produce 1,6-anhydromuramoyl product along with GlcNAc. PG-lytic enzymes such as lytic transglycosylases degrade peptidoglycan by cleaving the β-1,4 glycosidic linkage between GlcNAc and MurNAc disaccharide, releasing a 1,6-anhydromuramoyl product (see Figure 2.1 inset). The 1,6-anhydromuramoyl product released by lytic transglycosylases is recycled for production of new peptidoglycan(228). Lysozymes have the same substrate specificity as lytic transglycosylases; however, the reaction catalyzed by lysozyme uses a water molecule to hydrolyze the glycosidic linkage between GlcNAc and MurNAc disaccharide, releasing GlcNAc and MurNAc products (Figure 2.1 inset). 43 The EPEC LEE pathogenicity island encodes a T3SS-specialized PG-lytic enzyme, EtgA, located between the LEE1 operon and the grlR (global regulator of LEE repressor) and grlA (global regulator of LEE activator) operon(78). EtgA was classified as a putative Family 1A lytic transglycosylase due to the presence of conserved sequence motifs(78). The N-terminus of EtgA has a signal peptide that targets it for transport to the periplasm by the Sec-dependent general secretory pathway(134). An early study that used a yeast two hybrid assay to survey interactions between LEE encoded proteins, suggested that EtgA binds the inner rod subunit, EscI (133). Peptidoglycan-degrading activity of EtgA, as well as T3SS PG-lytic enzyme orthologs from Salmonella and Shigella (IagB and IpgF, 41% and 35% sequence identity respectively) was shown by zymogram, and mutation of a conserved glutamate (E42 in EPEC) abrogates activity (134,136). Deletion of etgA from the EPEC ortholog Citrobacter rodentium, a mouse bacterial pathogen similar to EPEC, impedes T3S and attenuates virulence(137). Accordingly, deletion of etgA from EPEC decreases T3S and reduces T3SS-dependent haemolysis of erythrocytes(134). However, it has been reported that disruption of the Salmonella ipgF gene had no effect on HeLa cell invasion, although this may not be reflective of the situation in the naturally targeted epithelial cells(229). Escherichia coli has at least seven known lytic transglycosylases (Slt70, MltA, MltB, MltC, MltD, MltE and MltF) that play a role in peptidoglycan remodelling during cell growth and division (230). EtgA shares sequence similarity with consensus motifs I, II and III of the catalytic domain of Family 1A lytic transglycosylase Slt70, which has been well characterized at the molecular level (231-233). Despite low sequence similarity, the catalytic domain of Slt70 is structurally similar to goose-type lysozyme(231,232). Both lytic transglycosylases (such as Slt70) and goose-type lysozyme lack the catalytic aspartate 44 (Asp52) that is generally found in lysozymes, such as the prototypical hen egg-white lysozyme (HEWL). In the proposed lytic transglycosylase mechanism, the catalytic Glu acts as a general acid to donate a proton to the glycosydic oxygen, resulting in bond cleavage and formation of an oxocarbenium ion transition state, stabilized by the formation of an oxozolinium intermediate. The next step of the lytic transglycosylase mechanism involves an intramolecular nucleophilic attack by the C6 hydroxyl of the MurNAc (probably aided by abstraction of a proton from the hydroxyl group by the oxyanionic form of the catalytic Glu) on the C1 carbon of the oxozolinium intermediate, resulting in formation of the 1,6 anhydro product(224,231-233). Since activity of PG-lytic enzymes can be fatal to the bacterium, their expression, localization, and activity must be tightly regulated. Expression of EtgA in EHEC is negatively regulated by the presence of GrlA, an activator of T3SS gene expression (234). Presumably, this allows for synthesis of T3SS components prior to transport of EtgA to the periplasm (234). Additionally, activity of specialized PG-lytic enzymes may be spatially regulated by physical interaction with other components of the molecular transport system. For instance, VirB1, a PG-lytic enzyme associated with the type IV secretion system (involved in conjugation, DNA uptake and effector translocation), interacts with several apparatus components(235). Likewise, the interaction of EtgA with the T3SS inner rod, EscI, may spatially restrict the activity of EtgA. Interestingly, the flagellar secretion system, which is evolutionarily related to the T3SS, has a modular PG-lytic enzyme called FlgJ (Salmonella), that has PG-lytic activity in its C-terminal domain, while its N-terminal domain forms the rod-cap itself, ensuring that peptidoglycan is cleared as the rod assembles (236,237). Furthermore, lytic transglycosylases involved in cell wall re-modelling during 45 growth and division are lipoproteins that are spatially restricted by association with the periplasmic leaflet of the outer membrane (224,238). In this study, we obtained the first known structure of a T3SS-specific PG-lytic enzyme (conserved with type II and type IV secretion system and type IV pili-associated PG-lytic enzymes), encompassing the catalytic core of EPEC EtgA. Based on structural similarity to other lytic transglycosylases and lysozymes, we mutated putative catalytic residues in the EtgA active site and tested the effect of each mutant on type III secretion. Additionally, we expressed and co-purified recombinant EtgA with its binding partner, the inner rod protein EscI, and determined the stoichiometry of the EscI/EtgA complex. Finally, we show that EscI stabilizes EtgA and enhances its peptidoglycan degrading activity. Secretion system associated PG-lytic enzymes such as EtgA are attractive drug targets, as they represent one of the few enzymatic components of the T3SS. Drugs that target a component of the pathogen required for virulence, but not for replication per se, may lessen selective pressure and emergence of resistance factors (239). Structural information for the specialized virulence-associated T3SS PG-lytic enzymes will be critical for developing drugs that specifically target these enzymes. 2.2 Methods 2.2.1 Cloning of genes into expression vectors for crystallography, protein expression and purification The coding region of EtgA residues 19-152 was amplified from EPEC E2348/69 genomic DNA and cloned into pET-21a vector (un-tagged) as well as pET-28a vector with an N-terminal 10X histidine tag by restriction free cloning. EtgA (19-152) corresponds to a deletion of the N-terminal Sec-secretion signal. EtgA mutants were generated by quick change PCR. The coding region of EscI residues 24-137 was amplified 46 from EPEC genomic DNA and cloned by restriction free PCR into pET-28a vector with an N-terminal 10X histidine tag. For protein production for crystallization trials EtgA (19-152) D60N-pET-21 was co-transformed with N-terminally his10 tagged EscI (24-137) –pET-28 in E. coli BL21 (DE3). To produce selenomethionine labelled protein, cultures were grown in M9 media (supplemented with 1 mM MgSO4, 0.1 mM CaCl2, 0.01 mM FeCl3, 1 mg thiamine and 1% glucose) with 50 µg/ml kanamycin and 100 µg/ml ampicillin at 37 oC to an A600 of 0.7 and then 0.05 g of selenomethionine was added per litre of culture. After 30 minutes of growth with selenomethionine, the culture was induced with 1 mM IPTG for 18 hours at 20oC. Cells were harvested by centrifugation and cell pellets were re-suspended in lysis buffer containing 20 mM Hepes pH 7.5, 500 mM NaCl, 50 mM imidazole, 1 mM BME and one complete protease inhibitor cocktail tablet (Roche), and lysed by French press. Cell lysate was centrifuged at 45,000 rpm for one hour at 4 oC. The supernatant was loaded on a 1 ml Ni-NTA column, which was pre-equilibrated with wash buffer (20 mM Hepes pH 7.5, 500 mM NaCl and 50 mM imidazole, 1 mM BME). EtgA (19-152) D60N and EscI (24-137) complex was eluted with elution buffer (20 mM Hepes pH 7.5, 500 mM NaCl, 500 mM imidazole, 1 mM BME). Elution fractions were pooled and concentrated and loaded onto a Superdex 75 10/30 column equilibrated with buffer (Hepes pH 7.5, 500 mM NaCl, 5 mM BME). EtgA (19-152) D60N and EscI (24-137) complex eluted as a single peak and protein-containing fractions were pooled and concentrated to 20 mg/ml for crystallization trials. To express EtgA/EscI complex for the in vitro activity assay, WT EtgA (19-152)-pET-21 (or the catalytic mutants E42A or D60N) was co-transformed with N-terminally his10 tagged EscI (24-137) –pET-28 in E. coli BL21 (DE3). Cultures were grown in 2 L of LB 47 media with 50 µg/mL kanamycin and 100 µg/mL ampicillin and induced with 1 mM IPTG at an A600 of 0.6 at 20 oC for 20 hours. Cells were harvested, lysed and protein was purified as described above, but without BME. To produce EtgA for activity assays, WT EtgA (19-152)-pET-28 (or the catalytic mutants E42A or D60N) was transformed into E. coli BL21 (DE3) and expressed as above. Cells were harvested and lysed and EtgA was purified on a 1 mL Ni-NTA column, as described above. EtgA was prepared fresh, immediately before the activity assay. 2.2.2 Crystallization of EtgA EtgA (19-152) D60N/EscI (24-137) complex was set up extensively for crystallization, but was recalcitrant to crystallization. Limited in situ proteolysis (240) of EtgA (19-152) D60N /EscI (24-137) complex using a 1:1000 molar ratio of chymotrypsin: EtgA (19-152) D60N/EscI (24-137) complex was set up in sitting drop vapour diffusion and produced crystals in multiple conditions containing 2-propanol as the precipitant. Crystals typically appeared after 3 days in the optimized condition (0.1 M imidazole pH 7.3-7.5 with 20-23 % 2-propanol) at room temperature. Crystals were cryo-protected with a solution of mother liquor with 25% glycerol and flash frozen in liquid nitrogen. 2.2.3 Data collection, structure determination and refinement Crystals were screened and MAD data were collected at the Lawrence Berkeley National Laboratory Advanced Light Source on beamline 8.2.1 at a peak wavelength of 0.9785 Å, an inflection wavelength of 0.9797 Å and a high energy remote wavelength of 0.9611 Å. Data were processed with xia2 using XDS to index all frames, XSCALE to scale, and Aimless to merge (241). Phases were obtained using autoSHARP, which located one selenomethionine (242). The structure was built, refined and validated using autoSHARP, 48 Coot, Refmac and PDB_REDO server(242-246). Figures were made using the UCSF Chimera package(247). 2.2.4 Scanning Electron Microscopy of BL21 Escherichia coli expressing EtgA BL21 (DE3) E. coli was transformed with WT EtgA (19-152)-pET-27, with a PelB signal sequence for export to the periplasm. Cells were grown in LB-media until an OD600 of 0.6, and then induced with 0.1 mM IPTG. Cells were imaged by scanning electron microscopy both with IPTG, one hour after induction, and without IPTG at the same time point. Samples were prepared by filtering onto a 0.4um nucleopore filter in a Swinex holder, in fixative (4% EM grade formaldehyde/2.5% glutaraldehyde), followed by microwave processing. The samples were removed from the filter holder, processed in an inverted position through post-fixation in buffered osmium tetroxide (1%) washes, and alcohol dehydration prior to drying. Following drying, the samples were mounted on aluminum SEM stubs using a conductive (silver) paste, dried, and sputter coated with gold. Samples were imaged with a Hitachi S-4700 field emission scanning electron microscope. 2.2.5 Size Exclusion Chromatography-Multiangle Light Scattering (SEC-MALS) Purified EtgA(19-152)/EscI(10-137) complex at a concentration of 2 mg/mL was injected over a Superdex 75 HR 10/30 column (GE Healthcare) pre-equilibrated in buffer (20mM Hepes pH 7.5, 500mM NaCl) and analyzed with a DAWN® HELEOS-II® 18-angles light-scattering detector and Optilab® T-rEX™ differential refractometer (Wyatt Technology). All detectors were normalized using a 2 mg/mL monomeric bovine serum albumin standard. Data analysis was performed using ASTRA 6 software (Wyatt Technology). 49 2.2.6 Cloning, expression, purification and imaging of EHEC inner rod protein EprJ The coding region of EprJ was generated by PCR from EHEC O157:H7 genomic DNA and inserted into pMAL-c2x vector by restriction free cloning. pMAL-c2X-EprJ plasmid was transformed into BL21 (DE3) cells and expressed as described above for EtgA. Cells were resuspended in buffer (20 mM Hepes pH 7.5, 500 mM NaCl) and lysed by French press and centrifuged at 45,000 rpm for 45 minutes. Lysate was passed over 3 mL of amylose resin and then resin was washed with 15 mL of wash buffer (20 mM Hepes pH 7.5, 500 mM NaCl). MBP-EprJ fusion protein was eluted with 5 mL of elution buffer (20 mM Hepes pH 7.5, 500 mM NaCl, 250 mM maltose). The MBP tag was cleaved overnight with Factor Xa protease. EprJ was purified over a Superose 6 column in buffer (20 mM Hepes pH 7.5, 150 mM NaCl), and eluted in the void volume of the column. Purified EprJ (1 µl of 0.3 mg/mL) was applied to a glow-discharged carbon coated transmission electron microscopy grid (Ted Pella, Inc.). After drying, the grid was stained with 1 µl of Nano-W® (methylamine tungstate, Nanoprobes) for 30 seconds. Excess stain was removed by blotting with a Whatman paper. Grids were imaged with a FEI Tecnai G2 200kV Transmission Electron Microscope. 2.2.7 Generation of Citrobacter rodentium and EPEC etgA deletion mutants for T3SS secretion assay An in-frame deletion mutant of etgA, formerly known as rorf3, was generated in C. rodentium strain DBS100 and characterized as previously described (137). An etgA deletion mutant was also generated in the streptomycin-resistant derivative of EPEC O127:H6 strain E2348/69 using the sacB gene-based allelic exchange method and the suicide vector pCVD442 (248). A 4044 bp DNA fragment containing the EPEC etgA gene, as well as ~1.8 kb of flanking sequences on both sides, was amplified by PCR using primers EPescT-F 50 (5’ATGAATGAGATAATGACGGTCATAGTATC3’) and EPcesD-1 (5’CTCAATGACCTTCATTCTTATGCC3’). The PCR product was cloned into pCRII-TOPO (Invitrogen), and the resultant plasmid was used as template for inverse PCR using primers EPetgA-RD (5’GCTAGCTCAGAAGGCAATACGCAATG3’, NheI) and EPetgA-DF (5’GCTAGCTGAAATGAGAATGATACTCAG3’, NheI) to create an internal deletion in the etgA gene. The inverse PCR product was digested with NheI, gel purified, treated with T4 DNA ligase, and transformed into E. coli strain DH10B. The DNA fragment containing the etgA gene with the internal deletion and its flanking regions was then subcloned as a SacI/XbaI fragment into the suicide vector pCVD442 to generate pCVD-∆EPetgA. The etgA gene in the suicide vector has an internal deletion from nucleotides 37 to 384 (~76% of the coding region) and an NheI site introduced at the deletion site. Plasmid pCVD-∆EPetgA was transformed into E. coli strain SM10λpir by electroporation, and introduced into EPEC strain E2348/69 by conjugation. After sucrose selection as previously described (248), EPEC colonies resistant to sucrose and streptomycin but sensitive to ampicillin, indicative of allelic exchange and loss of the suicide vector, were screened by colony PCR for deletion of etgA. The obtained EPEC etgA mutant was further verified by PCR. 2.2.8 Complementation constructs for EPEC and Citrobacter rodentium etgA deletion mutants Constructs expressing EPEC or C. rodentium etgA in the plasmid pACYC184 (New England Biolabs), which has a moderate copy number of 30-50/cell in bacteria, were toxic to EPEC and C. rodentium when grown under type III secretion inducing conditions, and caused partial bacterial lysis, probably due to EtgA’s peptidoglycan-hydrolyzing activities. We next generated EtgA complementation constructs in the vector pZS*24MCS (EXPRESSYS; http://www.expressys.com/main_vectors.html), which has a much lower 51 copy number of 3-5/cell than pACYC184. The coding region of EPEC etgA, as well as its 159-bp upstream promoter region, was amplified by PCR using primers EtgAcom-1 (5’GGATCCATTTGTTCTATCCATAAGC3’, BamHI) and EPetgAcom-2 (5’GTCGACGATTCGTATTGCGATAGACCTTG3’, SalI). Likewise, the C. rodentium etgA gene and its 149-bp promoter region were amplified using primers EtgAcom-1 (5’GGATCCATTTGTTCTATCCATAAGC3’, BamHI) and CRetgAcom-2 (5’GTCGACGATCCGTATTGCAATGGATATTG3’, SalI). These PCR products were digested with BamHI and SalI, gel-purified, and ligated into BamHI/SalI-treated pZS*24MCS to generate pZS*-EPetgA and pZS*-CRetgA, respectively. The constructs were confirmed by DNA sequencing, and transformed via electroporation into EPEC and/or C. rodentium etgA deletion mutants for complementation. The EPEC and Citrobacter ΔetgA mutants can be complemented by either pZS*-EPetgA or pZS*-CRetgA, indicating that EPEC etgA and Citrobacter etgA are functionally exchangeable. Based on this observation, we were able to test variants of EPEC etgA generated by site-directed mutagenesis in the Citrobacter ΔetgA mutant, which has a much more pronounced type III secretion defect than the EPEC ΔetgA mutant. 2.2.9 Type III secretion assay for EPEC and Citrobacter rodentium EPEC and C. rodentium strains were grown overnight in LB broth containing appropriate antibiotics at 37oC in a shaker at 225 rpm. The cultures were then diluted 1:40 into 3 ml of pre-warmed Dulbecco’s modified Eagle’s medium (DMEM) (HyClone) supplemented with 4500 mg/L glucose, 4 mM L-glutamine and 110 mg/L sodium pyruvate without any antibiotics in a 6-well tissue culture plate (Corning Inc.) and grown statically at 37oC for 6 hours in a tissue culture incubator containing 5% CO2 (v/v) to induce type III 52 secretion. The cultures were centrifuged at 16,100 g for 10 min to pellet the bacteria, and the bacterial pellet was re-suspended in SDS-PAGE sample buffer to generate whole cell lysates. The bacterial growth medium supernatant was collected and passed through a Millex-GV 0.22 µm filter unit (Millipore) to remove any remaining bacteria, and the proteins in the supernatant were precipitated with 10% (v/v) trichloroacetic acid (TCA). After centrifugation at 16,100 g for 30 min, the protein pellet was dried in air and dissolved in SDS-PAGE sample buffer, with the residual TCA neutralized with 0.5 µl of saturated Tris. The amount of the sample buffer used to re-suspend the bacterial pellet or dissolve the precipitated proteins was normalized according to the A600 values of the cultures to ensure equal loading of the samples. 2.2.10 Thermal stability assay EtgA (19-152) or EtgA (19-152)/EscI (24-137) complex thermostability was measured as a function of its temperature dependent aggregation by differential static light scattering (StarGazer-2; Harbinger Biotechnology and Engineering Corporation) according to the method of Vedadi et al. (249). Briefly, 10 µl of 0.4 mg/ml protein in 100mM Hepes pH 7.5, 300 mM NaCl was heated from 25-85°C at a rate of 1°C/min in individual wells of a clear-bottom 384 well plate (Corning 3540, Rochester, NY). To test the importance of the EtgA disulphide bond for protein stability, 0.4 mg/mL EtgA (19-152)/EscI (24-137) complex (in 100mM Hepes pH 7.5, 300 mM NaCl) was incubated with a serial dilution of reducing agent (either DTT or TCEP) ranging in concentration from 1µM to 10mM. Protein aggregation, as a measure of the intensity of scattered light, was scanned every 30 seconds with a CCD camera. The integrated intensities were plotted against temperature, where the inflection point of each fitted curve, using a Boltzmann regression, was defined as the 53 aggregation temperature, Tagg. The Kagg for DTT and TCEP was determined by a four parameter logistic curve using SigmaPlot software (Systat Software Inc., USA). 2.2.11 EtgA activity assay EtgA activity assays were performed using an Enzchek® Lysozyme Assay Kit. In summary, 450 µg/mL of peptidoglycan labelled with fluorescein (Enzchek®) was serially diluted in half with 50 mM Hepes pH 7 buffer to create a series of 12 reaction mixtures. A final concentration of 1 µM of protein (WT EtgA/EscI, EtgA E42A/EscI, EtgA D60N/EscI, WT EtgA, EtgA E42A, or EtgA D60N) was added to each reaction. As a separate negative control, an equal volume of buffer was added in place of protein to a peptidoglycan dilution series. All reactions were done in triplicate with a final reaction volume of 10 µl and transferred to a non-binding surface 384-well low volume plate (Corning® 3820). Fluorescence was measured at 37 oC with an excitation/emission wavelength of 485/530nm using a Bio-Tek® Synergy H4 microplate reader. Reactions were read every 30 seconds for one hour and data were analyzed using SigmaPlot software. Lysozyme was initially used as a positive control. 2.3 Results 2.3.1 Structural characterization of the catalytic core of EtgA To gain insight into the activity EtgA, we have solved the x-ray crystal structure of its catalytic core. Initially, a complex of the inner rod EscI (24-137) and EtgA (19-152) D60N (necessary for stabilization as in isolation EtgA is highly unstable and prone to rapid precipitation) was set up for crystallization trials, but was recalcitrant to crystallization. In situ limited proteolysis of EscI (24-137)/EtgA (19-152) D60N complex with chymotrypsin produced crystals that diffracted to 2.0 Å resolution (Table 2.1). The structure of the 54 crystallized proteolytic product was solved using multi-wavelength anomalous dispersion (MAD) phasing of selenomethionine derivative crystals, and was revealed to encompass the catalytic core of EtgA, residues 19-105 (Table 1, Figure 2.2A). The catalytic core of EtgA has a globular, mainly α-helical fold (helices denoted as α1-5) with a β-strand region (residues 47-67) closely resembling the catalytic domain of E. coli lytic transglycosylase Slt70 (PDB 1QTE; residues 451-618). Accordingly, a DALI search revealed Slt70 (along with another E. coli Family 1 lytic transglycosylase, MltE) to be among the top structural orthologs, with a z-score of 11.2 and a root mean square deviation (r.m.s.d.) of 2.1 Å over 79 aligned Cα atoms. C-lysozyme (2FBD) also had a high z-score (9.0) with an r.m.s.d. of 2.2 Å over 80 aligned Cα atoms. Alignment of EtgA with the catalytic region of Slt70 (1QTE) and the top lysozyme DALI hit (PDB: 2FBD) revealed that the core helices of EtgA (α2 and α5) closely align with both lysozyme and Slt70, corresponding to a common “scaffold” present in many lytic transglycosylases and lysozymes (Figure 2.2B). Interestingly, EtgA helices α1 and α5 are joined by a disulphide bond formed between Cys20 and Cys89, residues that are conserved in T3SS PG-lytic enzymes, as well as PG-lytic enzymes associated with the type IV pilus (T4P), bundle-forming pilus (Bfp) and the type II secretion system (T2SS) (Figure 2.2A, Figure 2.3). This conserved disulphide bond stabilizes the fold of the protein, as incubation with increasing concentration of reducing agent (DTT or TCEP) causes a maximum change in aggregation temperature of 11.5oC (Figure 2.2C). Notably, a disulphide is absent from the same region in lysozyme and Slt70 (Figure 2.2), suggesting the extra stabilization provided by the disulphide is only present in T3SS PG-lytic enzymes and their macromolecular complex associated orthologs. 55 Strikingly, EtgA contains an extension of the second turn of its β-hairpin (residues 53-60), which aligns with the corresponding region in lysozyme, but is absent from Slt70 and other structurally characterized lytic transglycosylases (Figure 2.2B). The presence of this region in EtgA is particularly interesting, as it contains an aspartate (Asp60) in the same position as the lysozyme catalytic Asp52 (in our structure this aspartate has been mutated to an asparagine as it conferred greater protein yields and stability for crystallography). Table 2.1 EtgA data collection and refinement statistics Selenomethionine EtgA Data Collection Space group P3121 Cell dimensions a,b,c (Å)a 31.4, 31.4, 149.52 α, β, γ (o) 90, 90, 120 Peak Inflection Remote Wavelength (Å) 0.9795 0.9797 0.9611 Resolution (Å) 29.9 – 2.0 (2.05-2.00) 29.9 – 2.01 (2.07-2.01) 29.9 – 2.03 (2.09-2.03) Completeness (%) 99.0(99.8) 99.1(99.3) 99.0(99.5) Unique reflections 6322(452) 6244(471) 6064(481) Redundancy 6.8(7.4) 6.8(7.4) 6.8(7.3) I/σ(I) 14.2(3.0) 14.5(3.3) 14.0(3.2) Rmerge 0.087(0.767) 0.086(0.672) 0.095(0.693) Refinement Statistics bRwork / Rfree 20.8% / 24.4% Number of atoms Protein 688 Ligand/ion 0 Water 17 r.m.s.d. bonds (Å) 0.012 r.m.s.d. angles (o) 1.47 B-factors (Å2) Protein 40.6 Water 41.4 Ramachandran Statistics Favored (%) 98.82 Additional (%) 1.18 56 Disallowed (%) 0 aValues in parentheses represent the highest resolution shell bRwork = (ΣΙFobs-FcalcΙ) / ΣΙFobsΙ. Rfree is calculated from 5% of randomly selected reflections excluded during refinement. Figure 2.2 Structure of the catalytic core of EtgA. A) The crystallized chymotrypsin proteolyzed fragment of EtgA corresponds to the catalytic core, encompassing residues 19 to 105, as shown in the bottom schematic (orange corresponds to the region in the crystal structure, blue corresponds to the Sec-secretion signal, and grey is the region of EtgA absent from the structure). The catalytic glutamate (E42) as well as a conserved aspartate (D60N) are shown as sticks. B) EtgA active site shares similarity with both lysozyme (PDB 2FBD) and Slt70 (PDB 1QTE), as shown by alignment of EtgA (orange) with Slt70 (blue) and lysozyme (cyan). The catalytic glutamate (E42) has a similar position in all three structures. The lysozyme catalytic aspartate aligns with EtgA D60N. Other active site residues present in lysozyme and EtgA, but absent from Slt70 includes residues N54, N56, Thr58, and N67, which form a hydrogen-bonding network with D60N (residues shown as sticks, hydrogen bonds shown as dashed lines). C) To test the importance of the EtgA disulphide bond for stability, differential static light scattering was 57 measured to monitor aggregation of EtgA/EscI complex with increasing concentration of reducing agent (DTT or TCEP). The change in aggregation temperature (Tagg) was plotted as a function of reducing agent concentration. Experiments were done in triplicate and error bars represent standard deviation. This residue (D60N) forms a hydrogen-bonding network with the side chains of Asn54, Asn56, Thr58, and Asn67 (Figure 2.2B). This hydrogen-bonding network was first described in HEW lysozyme, and forms a platform against which the GlcNAc sugar packs in the D (-1) site(250). Indeed, this aspartate and the residues forming the hydrogen-bonding network are also conserved in Shigella and Salmonella EtgA orthologs, IpgF and IagB, as well as orthologs associated with Bfp, and T2SS assembly (Figure 2.3). Based on observations using 2-fluorochitobiosyl, lysozyme Asp52 has been proposed to act as a nucleophile, generating the glycosyl-enzyme intermediate, followed by protonation of the leaving group oxygen (4-OH) of GlcNAc by the general/acid base Glu35 and attack by water (251). Earlier proposals had suggested alternatively, that lysozyme Asp 52, restrained by the conserved hydrogen-bonding network described above, would provide charge stabilization of the developed oxocarbenium in an Sn2 displacement reaction rather than act as a nucleophile per se. Conversely, lytic transglycosylases studied to date lack a catalytic aspartate. An overlay of EtgA with lysozyme bound to MurNAc-GlcNAc-MurNAc trisaccharide reveals that EtgA Asn54, Asp60 and Glu42 align with the corresponding lysozyme residues to contact substrate in the D (-1) site (Figure 2.4A). Comparison of MltE in complex with chitopentaose (i.e. (GlcNAc)5) to EtgA reveals that several residues of MltE that make hydrogen bonds or van der Waals contacts with chitopentaose are conserved and overlay with EtgA residues (Figure 2.4B). Of note, EtgA Gln65 and Ser51 align with the corresponding residues in MltE that contact chitopentaose in the E (+1) and D (-1) positions. 58 Figure 2.3 Multiple sequence alignment of T3SS specialized PG-lytic enzyme EtgA with other macromolecular machine-associated PG-lytic enzymes, lytic transglycosylase Slt70 and C-lysozyme. Alignment of EtgA (Escherichia coli, C7BUG6), IagB (Salmonella enterica serovar Typhi, P43018), IpgF (Shigella flexneri, Q07568), and YsaH (Yersinia enterocolitica, Q9KKJ1) with type II secretion system PG-lytic enzyme OrfC (Burkholderia pseudomallei, Q9ZF87), bundle-forming pilus PG-lytic enzyme BfpH (Escherichia coli 0127:H6, Q47073), type IVB pilus PG-lytic enzyme PilT (Salmonella enterica serovar Typhi, Q9ZIU8), Slt70 lytic transglycosylase (Escherichia coli, POAGC3), and lysozyme (Musca domestica, Q7YT16). The macromolecular machine associated PG-lytic enzymes contain the glutamate general acid (denoted by *) present in both Slt70 and lysozyme, as well as an aspartate (denoted by *), which is present and required for catalysis in lysozyme but absent from Slt70. EtgA residues conserved with lysozyme that form a hydrogen-bonding network with the conserved Asp are boxed and labeled as “lysozyme-like residues”. Cysteines that form a disulphide 59 bond in EtgA and are conserved with other T3SS, type IV pili, bundle-forming pili and the type II secretion system PG-lytic enzymes are boxed and labeled. A motif conserved between Slt70 and T3SS-associated PG-lytic enzymes is also boxed and labeled. Sequence alignment was done using clustal omega and the image was generated using Chimera. Swiss-Prot/TrEMBL accession numbers for each sequence are shown above in brackets. Surprisingly, given the evolutionary relationship between the flagella and T3SS (1), structural comparison of the flagella PG-lytic enzyme, FlgJ, to EtgA reveals structural homology to the scaffold helices (α1, α2, and α5 in EtgA), but markedly different structure of the β-hairpin and α3 and α4 regions of EtgA (Figure 2.4C) (252). These differences are reflected in a relatively weak (compared to lysozyme and Slt70) DALI z-score of 4.3 and r.m.s.d. of 3.4 Å over 70 aligned Cα atoms. Additionally, structure based sequence alignment of FlgJ (PDB 2ZYC) with EtgA reveals only 9% sequence identity. The β-hairpin of FlgJ extends further (and is also partially disordered in this structure) than that of EtgA and protrudes from the globular fold of the structure. While the EtgA general acid Glu42 aligns with FlgJ Glu185, FlgJ lacks a catalytic aspartate corresponding to EtgA Asp60. 2.3.2 EtgA requires a catalytic glutamate and aspartate for activity in vivo Given the unexpected and unprecedented (for lytic transglycosylase enzymes) structural alignment of EtgA Asp60 and β-hairpin region with lysozyme catalytic Asp52 and β-hairpin, and their conservation in T3SS encoding species, we mutated the conserved residues and tested the effect on type III secretion. The ΔetgA mutant of both Citrobacter rodentium and EPEC displayed a reduced type III secretion phenotype. The Citrobacter ΔetgA mutant exhibited a more than 90% reduction in type III secretion when compared to the wild-type strain (137), whereas the EPEC ΔetgA mutant only had 50% attenuation of type III secretion, possibly due to functional redundancy with a house-keeping PG-lytic enzyme (data not shown; (134)). 60 Figure 2.4 Comparison of EtgA active site with Slt70 and lysozyme active site bound to peptidoglycan-like fragments and flagellar PG-lytic enzyme FlgJ. A) Overlay of EtgA (orange) with HEW lysozyme (PDB 9LYZ (253), cyan) bound to MurNAc-GlcNAc-MurNAc trisaccharide (yellow sticks), centered on subsite D. B) Overlay of EtgA (orange) with Escherichia coli lytic transglycosylase MltE (PDB 4HJZ (254); blue) bound to chitopentaose (yellow sticks). C) Structural comparison of EtgA with the flagellar N-acetylglucosaminidase FlgJ reveals that the core scaffold of EtgA (α1, α2 and α5) aligns with the flagellar-associated peptidoglycan cleaving enzyme, FlgJ (PDB 2ZYC (252)); however, the β-turn and α3 and α4 of EtgA share little structural similarity to FlgJ. EtgA is shown in orange, and labels refer to EtgA residues and helices. FlgJ is shown in green. As a greater reduction in type III secretion was useful for testing the effect of EtgA catalytic mutants, the Citrobacter ΔetgA mutant was used for the following experiments. Citrobacter ΔetgA could be complemented by both EPEC and Citrobacter etgA (91% sequence identity) 61 expressed on a low-copy number plasmid (3-5 copies/cell). The low-copy number plasmid was critical for successful complementation, as complementation of etgA with a moderate-copy number plasmid (30-50 copies/cell) was toxic to EPEC and Citrobacter when grown under type III secretion inducing conditions, and caused partial bacterial lysis (data not shown), probably due to EtgA’s peptidoglycan-hydrolyzing activities. As expected, mutation of the catalytic glutamate (E42A) abrogated type III secretion (Figure 2.5A). Complementation with etgA N54A N56A (two asparagines located in the β-hairpin that are conserved in lysozyme and form a hydrogen-bonding network with Asp60) severely decreased type III secretion (Figure 2.5A). Mutation of EtgA Asp60 (conserved with lysozyme catalytic Asp52) to alanine also caused a severe decrease in type III secretion, indicating an important role in peptidoglycan cleavage. 2.3.3 EtgA associates with the T3SS through interaction with the inner rod, EscI T3SS associated PG-lytic enzymes may be spatially regulated through interaction with secretion system components to prevent undesired peptidoglycan cleavage and cell lysis. Indeed, we show that expression of WT EtgA (19-152) fused to a PelB signal sequence for periplasmic localization in BL21 (DE3) E. coli (a non-pathogenic expression strain lacking a T3SS) caused severe cell lysis, as shown by scanning electron microscopy images comparing morphology of BL21 (DE3) E. coli without induction of EtgA expression (Figure 2.5B, top) and with induction of EtgA expression (Figure 2.5B, bottom). Since unregulated expression and export of EtgA to the periplasm is autolytic, a targeting mechanism must be in place to ensure that periplasmic EtgA localizes to the nascent T3S apparatus to clear peptidoglycan. To better understand the interaction between the inner rod and EtgA, and how it may serve as a tethering mechanism, we sought to co-express and co-purify the two 62 proteins to characterize the interaction in vitro. While full length EscI (residues 1-142) was insoluble, as was also observed for expression of the Salmonella ortholog PrgJ (132), several N- and C-terminally truncated polyhistidine-tagged constructs of EscI successfully co-expressed and co-purified with untagged EtgA (19-152). The minimal region of EscI required for interaction with EtgA encompassed residues 50-137, whereas the longest EscI construct that could be co-expressed encompassed residues 10-137. Size exclusion chromatography multi-angle light scattering (SEC-MALS) was used to characterize the stoichiometry between EscI (10-137) and EtgA (19-152) and showed that the two proteins interact in a 1:1 ratio to form a complex of 31,400 Da ±0.4% (Figure 2.5D). Based on sequence similarity to the T3SS needle component, EscI is predicted to polymerize into a filamentous rod like structure (78,116) that presumably lies within and connects the inner and outer membrane ring structures of the T3SS basal body. While we were unable to express and purify a soluble filamentous form of EscI, we could express and purify the EHEC ortholog (EprJ, 26% identity) by fusion to an N-terminal maltose binding protein (MBP) solubilization tag. Following cleavage of the MBP tag, EprJ formed heterogenous, filamentous structures, as observed by negative stain electron microscopy (Figure 2.5C), showing directly for the first time that full-length EprJ is capable of filamentous polymerization. Although it is unknown precisely how EtgA would localize along a filamentous form of the inner rod our data nevertheless shows that in this interaction, each EscI component binds only one EtgA protein via residues encompassing the central region of EscI. 63 Figure 2.5 Analysis of EtgA activity in vivo and interaction with the inner rod. A) Type III secretion assay of Citrobacter rodentium ΔetgA mutant complemented with EPEC etgA and its site-directed mutants. Citrobacter rodentium DBS100 ΔetgA was complemented with EPEC etgA with mutations of key conserved active site residues. T3SS secreted proteins (translocon components EspB and EspD, as well as EspA filament) from Citrobacter rodentium grown in DMEM were analyzed by 16 % SDS-PAGE and stained by Coomassie G250. B) Scanning electron microscopy images of BL21 (DE3) E. coli without expression of EtgA (top) and after induction of EtgA expression (bottom). EtgA was fused to a pelB signal peptide for export to the periplasm. C) Purification of MBP tagged EprJ (EscI ortholog in EHEC) by amylose affinity chromatography (left gel) followed by cleavage of the MBP tag and size exclusion chromatography (right gel). Purified EprJ was imaged by negative stain electron microscopy. The white scale bar corresponds to 100 nm. D) Stoichiometry of EtgA and inner rod (EscI) complex by SEC-MALS. EscI (10-137) and EtgA (19-152) were co-purified, injected over a Superdex 75 10/300 column and analyzed by multi-angle light scattering. EscI (10-137)/EtgA (19-152) were shown to form a monodisperse complex of 31,400 Da (± 0.4%), corresponding to a 1:1 ratio. 64 2.3.4 Interaction with the inner rod EscI enhances the activity of EtgA in vitro To determine whether the inner rod affects the PG-lytic activity of EtgA, we compared activity of EtgA versus EtgA/EscI complex in vitro using a fluorescently labelled peptidoglycan substrate. An initial buffer screen showed the optimal pH for EtgA activity is between 6 and 7.5, so subsequent activity assays were done at pH 7. Of note, the EscI/EtgA complex was less active than the lysozyme control (data not shown). EtgA had an apparent Vmax of 95±5 RFU/min, whereas EtgA/EscI complex had nearly an eight-fold higher apparent Vmax of 720 ± 15 RFU/min (Figure 2.6A, Table 2.2). Both samples had a similar apparent Km, suggesting that the inner rod does not affect binding of peptidoglycan to EtgA (Table 2.2). Mutation of the catalytic glutamate (E42A) and aspartate (D60N) rendered EtgA inactive (both alone and in complex with the inner rod), underscoring the importance of both residues for catalysis (Figure 2.6A). The observation that EtgA catalytic mutants in complex with EscI were inactive shows that EscI does not have any peptidoglycan cleaving activity itself, but acts to enhance the activity of EtgA. A thermal aggregation assay was used to compare the thermal stability of EtgA to the thermal stability EtgA in complex with EscI. EtgA had an aggregation temperature (Tagg) of 40oC, whereas EtgA/EscI had a Tagg of 48oC (Figure 2.6B), suggesting that EscI stabilizes EtgA. The stabilizing effect of the inner rod on EtgA may contribute towards the increase in EtgA activity observed in the presence of the inner rod. Table 2.2 EtgA peptidoglycan cleavage parameters Apparent Vmax (RFU/min/µM EtgA)* Apparent Km (µg/mL)* EtgA (19-152) WT 95 ± 5 80 ± 15 WT EtgA(19-152)/ EscI (24-137) 720 ± 15 80 ± 5 * Experiments were done in triplicate and error is a measure of standard deviation 65 Figure 2.6 The inner rod enhances EtgA peptidoglycan cleaving activity. A) EtgA (19-152) and EtgA (19-152)/EscI (24-137) complex was incubated with fluorescein-labeled peptidoglycan and the activity was monitored by measuring fluorescence with an excitation/emission wavelength of 485/530nm over one hour. Conserved EtgA active site residues E42 and D60 were also mutated and assayed for activity, both with and without the inner rod EscI. Experiments were repeated in triplicate and error bars represent standard error. B) Thermal aggregation of EtgA (19-152) or EtgA (19-152)/EscI (24-137) complex was monitored over increasing temperature by differential static light scattering (aggregation intensity). 2.4 Discussion Clusters of genes encoding type II, type III and type IV secretion systems (as well as type IV pili) often encode a PG-lytic enzyme. Based on sequence similarity with Family 1A lytic transglycosylases, these specialized secretion system PG-lytic enzymes were presumed 66 to function as a lytic transglycosylase with creation of N-acetyl glucosamine and 1,6-anhydromuramic acid products (135). In our crystal structure of T3SS-specific PG-lytic enzyme EtgA, we see features that are conserved with both lytic transglycosylases and HEW lysozyme. The most surprising feature of the EtgA structure is a β-hairpin loop and aspartate that aligns remarkably well with the lysozyme β-hairpin loop and catalytic aspartate. This conserved aspartate previously went unnoticed in the literature, as sequence alignments were done with Slt70, which, like all other characterized lytic transglycosylases, lacks a catalytic aspartate. Accordingly, we have shown mutation of the aligned aspartate decreased type III secretion and abrogated peptidoglycan cleaving activity, underscoring its importance for catalysis in these virulence systems. Currently, little is known about the mechanistic details of how specialized PG-lytic enzymes facilitate assembly of macromolecular complexes. Recently, a PG-lytic enzyme associated with the flagella, FlgJ, was shown to cleave peptidoglycan between GlcNAc and MurNAc saccharides, acting as an endo-specific N-acetylglucosaminidase(255). Another study showed Helicobacter pylori and Salmonella typhimurium required activity of house-keeping lytic transglycosylases for functionality of the flagella (ie motility), but not flagella assembly (256). This work proposed a model that the N-actelyglucosaminidase activity of FlgJ clears peptidoglycan to facilitate flagella assembly, and subsequently house-keeping (involved in cell growth and cell wall maintenance) lytic transglycosylases remodel the opening in the peptidoglycan, producing 1,6-anhydromuramoyl peptidoglycan ends that interact with MotB, the flagellar motor protein(255,256). Does the difference in structure (and likely activity) between type III associated PG-lytic enzyme EtgA and the flagellar FlgJ somehow play a nuanced role in assembly of each system, or does it reflect a different 67 evolutionary acquirement of a PG-lytic enzyme? The cell-wall products produced by an N-acetylglucosaminidase, muramidase (lysozyme) and lytic transglycosylase would differ, creating a distinct chemical environment around the secretion system. Multiple components of the type III secretion apparatus interact with peptidoglycan(257), and may selectively bind particular peptidoglycan moieties. Supporting the idea that PG-lytic enzymes are intricately involved in macromolecular complex assembly, the tomato plant pathogen Pseudomonas syringae pv tomato DC300 encodes three PG-lytic enzymes (HopP1, HrpH, HopAJ1) that are up-regulated during type III assembly (258). HopP1 has homology to EtgA (26% sequence identity) and we observe that it contains both a conserved catalytic glutamate and aspartate, while HrpH and HopAJ1 do not share sequence similarity with EtgA and have only a catalytic glutamate. A combination of deletions of HopP1, HprH and HopAJ1 causes a decrease in virulence and effector translocation, but not a decrease in effector secretion(258). Indeed, many type II, III and IV secretion system gene clusters encode a specific PG-lytic enzyme, yet the deletion phenotype is often only attenuated for virulence. The variability in deletion phenotype, as also observed in our analysis of C. rodentium and EPEC ΔetgA mutants here, can then perhaps be attributed to functional redundancy with other PG-lytic enzymes, or the ability of the secretion apparatus to insert in naturally occurring holes in the peptidoglycan sacculus. It is possible that specialized PG-lytic enzymes play a multi-faceted role in assembly, modifying local peptidoglycan in such a way that it is a recruitment signal for peptidoglycan-interacting components of the secretion system. Activities of PG-lytic enzymes are tightly regulated temporally and spatially to prevent erroneous peptidoglycan cleavage and autolysis. Expression of EtgA is negatively 68 regulated by GrlA (an activator of T3SS gene expression) presumably to allow expression of T3SS components before expression and export of EtgA to the periplasm(234). Once in the periplasm, EtgA interacts with the T3SS inner rod component EscI, which likely polymerizes into a filament. Our in vitro peptidoglycan cleavage assay shows that EtgA is nearly eight times more active in the presence of the inner rod, suggesting that the inner rod not only spatially restricts the activity of EtgA, but may also enhance its activity. Once transported to the periplasm by the Sec-secretion system, EtgA would be marginally active until it binds EscI (which is secreted through the T3SS), preventing destructive uncontrolled cell lysis. This may be a common theme for secretion system associated PG-lytic enzymes, as others such as VirB1 from the type IV secretion system have been shown to interact with components of the secretion apparatus(235). In conclusion, the structure of EtgA reveals that, despite sequence similarity with Family 1A lytic transglycosylases, EtgA possesses a catalytic glutamate and aspartate, as well as β-hairpin region that are remarkably similar to lysozyme. Although EtgA and lysozyme share a conserved sequence in this region, it was previously unnoticed, and EtgA (as well as other orthologs associated with the type II, type III and type IV secretion systems) was presumed to act as a lytic transglycosylase. Additionally, we show that EtgA’s peptidoglycan cleaving activity is enhanced in the presence of the inner rod EscI. The low level of activity detected for EtgA in the absence of EscI may serve as a mechanism to prevent uncontrolled lysis prior to interaction with EscI. Future work will focus on characterization of EtgA’s mechanism and reaction products to definitively classify it as a lysozyme or lytic transglycosylase. 69 3 Structural analysis of a T3SS gatekeeper protein from EPEC 3.1 Introduction Many Gram-negative bacterial pathogens, including enteropathogenic Escherichia coli (EPEC), Salmonella, Chlamydia and Yersinia, use a type III secretion system (T3SS) to deliver effector proteins directly into the cytoplasm of target host cells. The T3SS is composed of a cytoplasmic export apparatus, a membrane spanning basal body, extracellular needle filament and a tip complex (also called the translocon) that inserts into the target host cell membrane(16). A substructure called the inner rod forms a channel through the basal body, which connects to the lumen of the needle, creating a conduit for effector proteins(126). Effector proteins secreted by the T3SS manipulate a number of host cell processes, such as the ubiquitination pathway, cytoskeleton dynamics, and inflammatory signalling to the benefit of the bacterium(259). Due to the complexity of the T3SS, assembly must be tightly regulated to ensure components are secreted with the correct hierarchy. After the basal body and export apparatus assemble, the inner rod, needle, tip and translocon subunits are recognized by the export apparatus and secreted through the nascent basal body in an ATP-dependent manner(260). The translocon proteins bind specialized chaperones in the bacterial cytoplasm, which are presumably required for recognition by the ATPase and subsequent secretion of the translocon protein(261). Needle length is tightly regulated and is suggested to be optimized for contact with the host cell (66). An accessory protein called the type III specificity switch protein is proposed to regulate needle length by acting as a molecular ruler (67). In Yersinia, extending the length of the ruler protein by insertion of additional amino acids corresponds to a linear increase in needle length. After the needle reaches the correct length, subunits that form the translocon complex are secreted. This step is regulated in part 70 by a component of the export apparatus called the autoprotease, which has a conserved motif that undergoes self-cleavage via an intein-like mechanism(24). Mutation this conserved motif to a non-cleaving mutant results in normal secretion of the needle subunits, but diminished translocon secretion (24). Once the translocon has been correctly assembled at the needle tip, effectors can then be secreted. The switch from secretion of translocon to effectors is controlled by a protein called the gatekeeper (for gatekeeper nomenclature across species discussed below refer to Table 3.1) (260). The gatekeeper complex is a key regulatory component of type III secretion, as deletion of the gene encoding the gatekeeper has been shown to attenuate virulence(137). A ΔsepL mutant of Citrobacter rodentium (an EPEC related mouse pathogen) fails to secrete translocon proteins, form pedestals that are characteristic of attaching/effacing (A/E) pathogens, and has attenuated virulence in mice (137). SepL binds a protein called SepD, which is also required for regulation of type III secretion(75,79). Generally, deletion of sepL or sepD results in decreased secretion of tip and translocon proteins (EspA, EspB and EspD in EPEC), and increased secretion of effector proteins (75), a trend also observed in deletion of the Salmonella ortholog InvE, and the deletion of Shigella MxiC (although there are conflicting reports on whether translocator secretion is diminished in Shigella) (76,80,82). In contrast, deletion of the Yersinia ortholog YopN results in constitutive secretion of effector and translocon proteins, suggesting some variability in phenotype between species(262,263). The mechanism by which the gatekeeper regulates secretion of the translocon and effectors is not well understood; however, the recently characterized interaction between Chlamydia gatekeeper CopN and the translocon chaperone Scc3 have led to a model in which a complex formed by the gatekeeper, translocon chaperone, and translocon is required to form prior to 71 secretion of the translocon (264). In other species, such as EPEC, interaction between the gatekeeper and the translocon chaperones has not been observed, which may reflect a weaker affinity or perhaps a variation in mechanism. Much like effector proteins, the gatekeeper interacts with a specialized chaperone, and in some species, the gatekeeper is secreted into the host cell. A crystal structure of Yersinia YopN in complex with its heterodimeric chaperone SycN/YscB shows how the extended N-terminal region of YopN wraps around the chaperones(23). In addition to SepD, SepL interacts with a small acidic protein called CesL(265). CesL has limited sequence similarity with the SycN, and the genes encoding SepD and YscB have a conserved position, indicating that CesL and SepD may be orthologous to the heterodimeric chaperones of YopN(265). While secretion of SepL has not been directly observed, there is evidence that orthologs in Shigella (76) and Chlamydia (266) are secreted. In fact, the Chlamydia gatekeeper CopN acts as an effector in the host cell cytoplasm and binds directly to αβ-tubulin to prevent microtubule polymerization(267). This effector-like activity of CopN has yet to be observed in other gatekeeper proteins, and may be a divergent function. Despite low sequence conservation among orthologs, the overall structure of the gatekeeper is well conserved and may serve as a scaffold. Crystal structures of the gatekeeper from Shigella (MxiC), Yersinia (YopN/TyeA; the gatekeeper is expressed as two polypeptides, with TyeA orthologous to gatekeeper domain 3), and Chlamydia (CopN) show a conserved architecture of three helical X-bundle domains (described as four helices packed in a coil-coiled arrangement, referred to in (22)(22,23,264,268). The similarity between domains may indicate a gene duplication event, ultimately increasing the surface area accessible for mediating protein-protein interactions(22). In the structure of YopN in 72 complex with chaperones SycN/YscB, YopN amino acids 32-75 wrap around the chaperones in an extended conformation, similar to the interaction between the N-terminus of effector proteins and their cognate chaperones(23,86). In the structure of the CopN/Scc3 complex, Scc3 contacts CopN through two sites, which span the second and third domains of CopN(264). The gatekeeper likely acts as a scaffold, and may interact with a number of other T3SS components. Some evidence suggests that the inner rod (MxiI in Shigella) interacts with the second domain of MxiC(77). The interaction between MxiC and the inner rod may form a physical plug to prevent secretion of effector proteins, disruption of the interaction deregulates effector secretion(77). Additionally, the third domain of SepL is required for interaction with Tir, a type III secreted receptor required for intimate attachment of A/E pathogens to the host cell (269). The SepL-Tir interaction was shown to be important to delay release of effector proteins(269). A complete understanding of how protein-protein interactions mediated by the gatekeeper regulate secretion hierarchy has yet to be reached. In this study, we present the crystal structure of a gatekeeper protein from EPEC, SepL. Like its previously characterized orthologs, SepL consists of three helical X-bundle domains. In our crystal structure, the linking regions between the SepL domains appear more flexible than the corresponding region in its orthologs, increasing wobble between domains. This suggests that SepL has more flexibility between domains than its orthologs, or perhaps the linking regions between domains are flexible in all species and the other structurally characterized orthologs were captured in a more rigid conformation in the crystal lattice. Comparison of SepL to structures of its orthologs allows for identification of conserved residues. Future studies will be directed towards testing the role of these residues in secretion of translocon and effector proteins in EPEC. 73 Table 3.1 Nomenclature of the gatekeeper protein. Species Gatekeeper nomenclature enteropathogenic Escherichia coli, Citrobacter rodentium SepL Shigella MxiC Yersinia YopN/TyeA Salmonella InvE Chlamydia CopN 3.2 Methods 3.2.1 Cloning, protein expression and purification DNA encoding SepL residues 70-351 was cloned into pET-28a vector by restriction free cloning to create a construct encoding 10x His tagged SepL (70-351). DNA encoding the same region of SepL was also cloned into pET-21a vector using restriction free methods to create a construct encoding untagged SepL (70-351). DNA encoding SepD (6-151) was cloned into pET-28a and pET-21a vectors using restriction free methods to generate constructs expressing 10x His tagged SepD (6-151) and untagged SepD, respectively. To express native SepL (70-351)/SepD (6-151) complex, pET-28a-SepL (70-351) and pET-21a-SepD(6-151) were co-transformed in BL21 (DE3) Escherichia coli. Resulting colonies were inoculated into LB-media with 50 µg/mL kanamycin and 100 µg/mL ampicillin, and grown at 37 °C with 200 rpm shaking until an OD600 of 0.6. Expression was induced with 1mM IPTG at 20 °C over 18 hrs. Cells were harvested by centrifugation and resuspended in lysis buffer (20mM Hepes pH 7.5, 500 mM NaCl, and 50 mM imidazole, with complete protease inhibitor tablet). Cells were lysed by French press, and lysates were clarified by centrifugation at 45,000 rpm for 45 minutes. Lysate was injected over a 1 mL His-Trap column, washed with lysis buffer and eluted with a gradient of elution buffer (20 mM Hepes pH 7.5, 500 mM NaCl, and 500 mM imidazole). Protein containing fractions 74 were pooled and dialyzed overnight at 4 °C into buffer (20 mM Hepes pH 7.5, 350 mM NaCl) with added thrombin to remove the His tag. As a second purification step, protein was injected over a Superdex 200 10/30 column pre-equilibrated in buffer (20 mM Hepes pH 7.5, 350 mM NaCl). Fractions containing SepL (70-351)/SepD (6-151) were pooled and concentrated to 20 mg/mL. To prepare selenomethionine protein, M9 media (supplemented with 1 mM MgSO4, 0.1 mM CaCl2, 0.01 mM FeCl3 1mg thiamine and 1% glucose) with 50 µg/mL kanamycin was inoculated with Bl21 (DE3) cells harbouring SepL (70-351)-pET-28, grown to an OD600 of 0.6 and 0.05 g selenomethionine was added per litre of culture. After thirty minutes, cells were induced with 1mM IPTG and harvested as described above. N-terminally histagged SepD (6-151) was expressed as described for unlabeled protein, and cells were combined with selenomethionine SepL (70-351) cells. Both proteins were co-purified and concentrated as described above, including 10 mM TCEP throughout the purification. 3.2.2 Crystallization and data collection Initially, crystallization conditions were screened by vapour diffusion method with 5mg/mL SepL (70-351)/SepD (6-151) complex and tiny needle-like crystals grew after one day in 3 M NaCl with 0.1 M Tris pH 8.5 buffer. Optimization of this condition failed to produce diffraction-quality crystals. Instead, this condition was used as an additive for further screening by microbatch crystallization under oil, using Al’s oil to cover the drop, and paraffin oil to cover the plate. Using ratios of 0.3 ul 20 mg/mL protein, 0.1 ul initial crystal condition (3M NaCl, Tris pH 8.5) and 0.2 ul PACT condition produced cube or thick plate-like crystals in over 30% of PACT conditions after 9-25 days at room temperature. Crystals were cryo-protected in perfluoropolyether oil and flash frozen in liquid nitrogen. Crystals 75 were also grown using 3 M NaBr and 0.1 M Tris pH 8.5 as an additive for an additional phasing strategy. Multi-wavelength anomalous diffraction data for selenomethionine derived crystals and crystals grown in the presence of NaBr was collected at the Advanced Light Source beamline 5.0.2 at Lawrence Berkeley National Laboratory. Data sets for the NaBr and selenomethionine derived crystals were processed with xia2, using XDS to index all frames, XSCALE to scale and Aimless to merge (241). AutoSHARP was used to obtain initial phases for the selenomethionine protein, using peak and inflection data sets, and located six selenomethiones(242). Automatic model building was done with ARP/wARP within autoSHARP. The resulting model was used as a search model for the NaBr derived data using Phenix-MR-SAD (270). Phenix MR-SAD located five bromides using this initial molecular replacement model as a partial solution. Buccaneer (ccp4 suite) was used for model building(245). The structure was refined using Coot, Refmac5 and Buster (244-246,271). Figures were generated using Chimera (247). 3.3 Results 3.3.1 Structural overview of SepL Originally, SepL (70-351) in complex with SepD (6-151) was set up for crystallization trials. An initial hit condition produced small spherulite crystals and was then used as an additive for further screening, which produced diffracting cube shaped crystals in multiple conditions. Data sets were collected on selenomethionine derived crystals and crystals grown in the presence of NaBr. Starting phases were solved by multiwavelenth anomalous dispersion data from the selenomethionine derived crystal (space group P422) collected at peak and inflection wavelengths. This model, which contained density for one 76 copy of SepL in the asymmetric unit, was then used for molecular replacement singlewavelength anomalous dispersion (MR-SAD) phasing of data collected from the crystal grown in NaBr at the NaBr peak wavelength. This crystal form (space group P43212) had two copies of SepL (chain A and chain B) in the asymmetric unit and has a resolution of 3.2Å. This structure was refined and used for all other analysis. Although crystal trials were done with SepL (80-351)/SepD (6-151) complex, the resulting crystals did not contain SepD. Data collection and refinement statistics are listed in Table 3.2. The resulting model of SepL encompasses residues 80-348 and forms three X-bundle domains (Figure 3.1). Chain A has missing density for residues 196-200 and chain B has missing density for residues 194-199, a region which forms a loop between α-helices 6 and 7. Chains A and B adopt a similar conformation with a root-mean-square-deviation (r.m.s.d) of 0.461 Å over 259 aligned C-α atoms. The first domain (residues 80-172) consists of five α-helices and an extended loop region encompassing residues 103-125 (Figure 3.1). The second domain (residues 173-266) and third domain (residues 267-350) also consist of five α-helices. Each domain is connected by a hinge-like loop (Figure 3.2). The SepL domains do not align along the same axis, creating curvature in the overall shape of SepL (Figure 3.1). 3.3.2 Comparison of SepL to gatekeeper orthologs Orthologs of SepL from Chlamydia, Shigella, and Yersinia have been structurally characterized, and a DALI search with SepL revealed these orthologs to be the top scoring structural homologs (Table 3.3). Structurally characterized gatekeeper proteins all have three X-bundle domains with domains 2 and 3 connected by a long central helix (Figure 3.2). 77 Figure 3.1 Structural overview of SepL. SepL X-bundle domains are coloured as blue (domain 1), orange (domain 2) and green (domain 3). α-helices are labeled 1-15, and N- and C-termini are demarcated. SepL surface is represented in grey. The bottom structure is a 90o rotation around the horizontal axis of the SepL structure shown above. Images were made using SepL chain A. Table 3.2 SepL Data collection and refinement statistics. NaBr SepL Selenomethionine SepL Data Collection Space group P43212 P422 Cell dimensions a, b, c (Å) 84.32, 84.32, 239 78.21, 78.21, 147 α, β, γ(°) 90, 90, 90 90, 90, 90 Peak Peak Inflection Wavelength (Å) 0.92023 0.97943 0.97961 aResolution (Å) 84.32- 3.20 (3.42-3.20) 73.47-3.65(4.00-3.65) 73.47-3.65 (4.00-3.65) 78 NaBr SepL Selenomethionine SepL Completeness (%) 100.0 (100.0) 99.8 (99.7) 99.8 (99.7) Unique reflections 15064 (2654) 5504 (1266) 5505 (1267) Redundancy 18.5 (19.1) 17.8 (18.6) 17.8 (18.6) I/σ(I) 22.9 (4.6) 18.2 (6.9) 16.0 (4.7) Rmerge 0.116 (0.823) 0.132(0.478) 0.172(0.731) Rpim 0.038(0.270) 0.043(0.156) 0.057(0.240) CC 1/2 0.999(0.959) 0.999 (0.989) 0.999 (0.973) Refinement statistics bRwork/Rfree 21.6/25.8 This structure was not refined. Number of atoms 4302 Protein 4289 Ligand/ion 5 Water 8 r.m.s.d bonds (Å) 0.015 r.m.s.d. angles (o) 1.94 B-factors (Å2) Protein 96.28 Water 41.73 Ramachandran Statistics Favored (%) 92 Allowed (%) 5.7 cOutliers (%) 2.7 aValues in parentheses represent the highest resolution shell bRwork = (ΣΙFobs-FcalcΙ) / ΣΙFobsΙ. Rfree is calculated from 5% of randomly selected reflections excluded during refinement. cOutlier residues are located in flexible loop regions with poor electron density The central helix of SepL is broken into two helical segments, connected by a hinge, as seen also in the central helix region of YopN/TyeA (Figure 3.2). Conversely, the central helix of MxiC and CopN is rigid. Domains 1 and 2 of SepL are connected by a hinge-like loop, whereas in YopN/TyeA, MxiC and CopN domains 1 and 2 are connected by a kinked helix (Figure 3.2). The hinge-like regions that connect SepL domains result in wobble between domains, giving SepL a more curved appearance. MxiC and CopN, appear to have a more rigid structure, and a linear overall shape (Figure 3.2). The variation in curvature of the gatekeeper structure could represent species-specific differences, or the gatekeepers may 79 be generally flexible between domains, and the differences seen between species represent “snapshots” of conformations captured during crystallization. Indeed, the high B-factors of SepL loop regions may be indicative of flexibility in these regions. Table 3.3 Summary of DALI search results for SepL. Name (Species) PDB/Chain z-score r.m.s.d. (Å) Number of residues aligned Number of residues % ID CopN (Chlamydia) 4P40/A 11.9 4.1 190 288 10 MxiC (Shigella) 2VIX/B 11.0 3.4 183 283 11 TyeA (Yersinia) 1XL3/D 10.9 1.6 79 85 20 YopN (Yersinia) 1XL3/B 7.6 4.8 119 206 13 The gatekeeper likely acts as a scaffold, providing multiple protein-protein interaction sites on each of its three X-bundle domains. Residues or regions of the gatekeeper implicated in binding a component of the T3SS are noted in Figure 3.2. SepL has been shown to interact with Tir through its C-terminal domain. The translocon chaperone Scc3 was shown to interact with two regions of CopN, bridging domains 2 and 3. MxiC residue F206 (shown in green) located on the surface of domain 2 is required for interaction with the inner rod, and a number of residues (E201, E276, E293 shown in red) form an electronegatively charged surface on domains 2 and 3 are required for regulation of translocon/effector secretion hierarchy in Shigella(77,142). So far, domain 1 has not been implicated in interaction with any protein. SepL, like all of the gatekeepers, has one surface more negatively charged than the opposite face, when rotated 180o (Figure 3.3). It was previously noted that this charged surface may be involved in protein-protein interactions, and mutation of MxiC residues in this region cause premature secretion (22,142) 80 Figure 3.2 Comparison of SepL overall structure to orthologs. Each of the gatekeeper structures consists of three X-bundle domains (schematic). The helices of domains 2 and 3 on the nearest face of each gatekeeper are collared orange. The central helix of SepL and YopN/TyeA is broken into two helices by a hinge. SepL domains 1 and 2 are also connected by hinge, creating more curvature in the arrangement of domains. The YopN chaperone-binding region is shown in blue. Regions of the gatekeepers proposed to interact with T3SS components are marked and labeled. PDB codes: YopN/TyeA, PDB 1XL3 (23), PDB 1XKP(23); MxiC, PDB 2VJ5 (22); CopN, PDB 4P40 (268). 81 Figure 3.3 Surface charge of gatekeeper orthologs. Electrostatic surfaces of the gatekeeper orthologs were calculated using Chimera and displayed in a red-white-blue scale (red is negatively charged, blue is positively charged). PDB codes: YopN/TyeA, PDB 1XL3 (23); MxiC, PDB 2VJ5 (22); CopN, PDB 4P40 (268). While the gatekeeper proteins have a conserved X-bundle domain structure, they have low overall sequence identity (Table 3.3), with only three residues (out of ~280 SepL residues) absolutely conserved among the structurally characterized gatekeepers. Comparison of SepL domains 2 and 3 to the corresponding domains of CopN, YopN/TyeA and MxiC reveal three notable areas of sequence conservation (Figure 3.4). One region corresponds to the binding site of the translocon chaperone (as identified in the CopN/Scc3 structure) located at the loop region connecting SepL α14 and α15 (Figure 3.4, top inset). An absolutely conserved arginine (SepL Arg333), required for binding of CopN to Scc3, and the neighbouring Phe237 is within this region. Domain 3 has an additional region of sequence 82 conservation, located in the loop connecting α12 and α13, as well as the surface of α15. Here a bulky hydrophobic residue (SepL Trp288) is surface exposed on the loop between α12 and α13. Neighbouring conserved residues include a methionine (Met339), asparagine (Asn335), and two negatively charged residues (SepL Glu331, Thr290). Domain 2 has one region of sequence conservation surrounding an absolutely conserved tyrosine (SepL Tyr188) on α7. Interestingly, in MxiC, CopN, and YopN/TyeA, this region is located within a cleft formed between domains 1 and 2, whereas in SepL, due to the position of domain 1 relative to domain 2, this conserved tyrosine is more accessible. Tyr188 is situated near a conserved aspartate and phenylalanine, both on the same side of α9. A loop connecting α7 and α87 has two conserved negatively charged residues (Ser201 and Asp248) and α7 also has a conserved surface exposed glutamine (SepL Gln182). Domain 1 has the least sequence conservation among all domains, and we failed to find any significant regions of conservation localizing to the protein surface. 83 Figure 3.4 Structural alignment of SepL domains 2 and 3 with gatekeeper orthologs. Alignment of SepL (cyan) domain 3 with the corresponding region of MxiC (purple), CopN (orange) and TyeA (yellow) is shown in the top and middle panel. Top inset- An absolutely conserved arginine required for interaction of CopN with the translocon chaperone and conserved surrounding residues are shown. Labeled residues use SepL numbering. Middle inset- conserved residues in domain 3 are shown as sticks. The bottom panel shows alignment of SepL with domain 2 of gatekeeper orthologs. Bottom inset- An absolutely conserved tyrosine and surrounding conserved residues are shown as sticks. PDB codes: YopN/TyeA, PDB 1XL3 (23); MxiC, PDB 2VJ5 (22); CopN, PDB 4P40 (268). 84 3.4 Discussion In this study, we have structurally characterized the T3SS gatekeeper protein from EPEC, called SepL. Despite low sequence identity, SepL has an architecture similar to its structurally characterized orthologs with three helical X-bundle domains(22,23,264,268). Additionally, like its orthologs, SepL has one surface that is electronegatively charged, a region proposed to be important for facilitating protein-protein interactions(22). SepL domains are connected by flexible loops, creating a flexible hinge-connection between domains. As a result, SepL has significant wobble between domains, giving the overall structure a curved appearance. Domains of SepL orthologs are connected by rigid or kinked helices, resulting in a more linear or rigid alignment of domains. These variations in flexibility between domains may reflect true species-specific differences. Alternatively all gatekeeper proteins may have flexible connections between domains and variations seen in the crystal structures could represent different conformations trapped by crystallization conditions and crystal lattice contacts. Structure based alignment of SepL to orthologs CopN, MxiC and YopN/TyeA reveal three regions of sequence conservation across domains 2 and 3. One conserved region in domain 3, which includes an absolutely conserved arginine, has been shown to be required for interaction with the translocon chaperone Scc3 in Chlamydia(264). While the interaction between the Chlamydial gatekeeper CopN and the translocon chaperone Scc3 has been structurally characterized, we have yet to observe an interaction between SepL and the corresponding translocon chaperone in EPEC. An interaction between SepL and translocon-specific chaperones may not have been observed due to a weaker affinity, or perhaps additional proteins (such as the translocon proteins) are required for interaction to occur. 85 Testing the effect of mutation of the conserved SepL Arg333 could provide evidence as to whether this chaperone-binding region of CopN is functionally conserved in SepL. Another interesting region of sequence conservation in the third gatekeeper domain surrounds a conserved bulky hydrophobic residue (Trp288), which is located in a surface exposed loop between α12 and α13. To our knowledge, mutation of this residue has not been tested in any SepL orthologs. Due to the proximity to the translocon chaperone binding site on domain 3, this region may contact the translocon, when it is bound to its specific chaperone. Finally, a conserved tyrosine is located in α7 of domain 2. This tyrosine (SepL Tyr188) is surrounded by a conserved aspartate and alanine on the opposing α9. Interacting partners of the gatekeeper domain 1 have not yet been identified. The sequence, and also structure of domain 1 is much less well conserved than the other domains (78), which may indicate a divergence in binding partners between species. SepD, which has been shown to interact with SepL and is critical for regulation of hierarchy translocator and effector secretion (75), likely interacts with domain 1 and/or 2 of SepL (269). If SepD is indeed a chaperone, orthologous to the Yersinia gatekeeper chaperone YscB, it would be expected to interact with the extended N-terminal region of SepL. However, this region of SepL (residues 1-69) is not required for interaction with SepD, suggesting that SepD binds SepL through a different interface. In order to understand how the gatekeeper regulates secretion hierarchy of translocon proteins and effectors, a more detailed knowledge of how various components binds to the scaffolding domains of the gatekeeper will be required. The challenge in characterizing these interactions is the seemingly weak affinity of the gatekeeper to binding partners. In Chlamydia (but not in other species), interaction between the gatekeeper and translocon 86 chaperone can be observed between purified proteins, perhaps due to an extended region of the translocon chaperone Scc3 that provides additional surface area for interaction that is not present in orthologs (264). In Salmonella, the gatekeeper only binds chaperone/translocon complex, and not empty chaperone(82). Likely, the interactions between the gatekeeper and its binding partners are weak and transient, as they must assemble and disassemble prior to secretion. Alternatively, interaction may require multiple binding partners, such as the case in Salmonella(82). It is likely that characterization of SepL binding interactions will require structure-based mutational analysis to test the effect on function, as identification of interactions between purified recombinant proteins have proven difficult, perhaps due to weak interactions or the requirement of additional unknown partners. Deletion of the gatekeeper has varying phenotype between species. In EPEC the phenotype for ∆sepL or ∆sepD mutants is very striking(75). These EPEC mutants fail to secrete translocator proteins (EspA, EspB, and EspD) and have increased secretion of effector proteins(75). In Shigella, there is conflicting data for the ∆mxiC phenotype. One study found that ∆mxiC does not affect secretion of translocators, but does increase secretion of effectors(76), whereas another found that ∆mxiC did have diminished secretion of translocators(80). In Yersinia, deletion of YopN or TyeA results in increased expression of effectors and translocators(262,263). Because of the clear phenotype of the EPEC ∆sepL mutant, mutational analysis of SepL can provide information on whether the mutant affects translocon secretion, effector secretion or both. Mutational analysis of SepL could potentially help determine which domains are required to prevent premature secretion of effectors, to facilitate translocon secretion, and to interact with SepD. 87 In summary, the crystal structure of SepL, although quite similar to its structurally characterized orthologs, will be useful for structure-based mutational analysis. The EPEC ∆sepL mutant has been well characterized, and can be efficiently complemented with SepL(75,137). The clear phenotype of the ∆sepL mutant may be instrumental is assigning a particular function to each SepL domain. Based on our structural comparison to CopN, MxiC and YopN/TyeA, future studies will focus on mutation of the conserved SepL residues Tyr188, Trp288 and Arg333 to test their function in translocator and effector secretion, as well as interaction with SepD. 88 4 Structure of Salmonella effector protein SopB in complex with host Cdc42 4.1 Introduction Salmonella enterica is a Gram-negative bacterium that causes typhoid fever and gastroenteritis. Typhoid fever resulted in ~22 million illnesses and 200,000 deaths during 2000(272), while Salmonella induced gastroenteritis results in an estimated 93.8 million illnesses and 155,000 deaths each year(273). Such numbers emphasize the importance of understanding the molecular mechanisms of Salmonella pathogenesis. Salmonella gains entry into human host phagocytic and intestinal epithelial cells by secreting virulence effector proteins into the host cytoplasm via a T3SS(274). Inside the host cell, Salmonella delivers additional effector proteins via a second distinct T3SS and creates a replication niche termed the Salmonella containing vacuole (SCV). SopB (also known as SigD) is a T3SS secreted Salmonella effector protein that contains a GTPase binding domain (residues 117-168) and a phosphoinositide phosphatase domain (residues 357-561). Upon T3SS-mediated delivery of SopB into host cells, the phosphoinositide phosphatase domain promotes host membrane fission by hydrolysis of phosphatidylinositol- 4, 5-bisphosphate [PI(4, 5)P2], a process that facilitates bacterial entry (275). Subsequently, SopB is multi mono-ubiquitinated and translocated to the SCV (276,277), where SopB phosphatase activity is proposed to help prevent lysosomal degradation of the bacteria by reducing the negative surface charge of the SCV(278). The potential function of the SopB GTPase binding domain was suggested when phosphatase deficient SopB R468A expressed in yeast interfered with actin dynamics(279), cell cycle progression and MAP kinase signalling through direct interaction with yeast Cdc42 (280). Cdc42 is an essential Rho GTPase that regulates cytoskeleton organization and membrane trafficking during cell motility, proliferation, and cytokinesis in eukaryotes 89 (281,282). Active Cdc42 (GTP bound) and inactive Cdc42 (GDP bound) differ in conformation in the flexible regulatory regions, switch I and II (Figure 4.2A)(195). Downstream host effector proteins such as PAK serine threonine kinases(283) and the Wiscott-Aldrich Syndrome protein (WASP) (284)recognize and bind the switch regions of active Cdc42 and this interaction subsequently alters the signalling activity of the host effector (Figure 4.2B)(195). The interaction of the Salmonella SopB virulence effector with Cdc42 was delineated by stable isotope labelling of amino acids in cell culture (SILAC) mass spectrometric analysis in mammalian cells with the resulting Cdc42 binding region (residues 117-168) shown to down-regulate Cdc42-dependent signalling(280,285). SopB binds specifically to Cdc42 and no other related GTPases(285). SopB binds both active and inactive Cdc42 and this interaction is important for translocation of SopB to the SCV(286). Furthermore, disrupting interaction between SopB and Cdc42 during a Salmonella invasion assay reduces the efficiency of Salmonella replication within the SCV(286). Cdc42 is also targeted by Salmonella effector proteins SopE (and its paralogue SopE2) and SptP. SopE/E2 mimic eukaryotic guanine exchange factors (GEFs) to catalyze the exchange of GDP for GTP and activate Cdc42 and Rac1, a closely related Rho GTPase, to drive actin cytoskeleton assembly (Figure 4.2B)(198,287). SptP inactivates Cdc42 and Rac1 by mimicking a GTPase activating protein (GAP) and catalyzing hydrolysis of GTP to GDP by Cdc42 and Rac1 (Figure 4.2B)(288). The structures of SopE in complex with Cdc42 and SptP in complex with Rac1(185,187) have been solved, but a lack of structural information for SopB has impeded analysis and understanding of its interaction with and modulation of Cdc42. 90 Here we present the crystal structure of the N-terminal GTPase-binding domain of SopB in complex with its host target, Cdc42. This structure shows that SopB contacts Cdc42 by mimicking a eukaryotic CRIB (for Cdc42 and Rac-interactive binding)-like motif, which was previously unidentified due to a lack of sequence conservation. This is the first time a bacterial effector protein has been shown to contact a Rho GTPase through a CRIB-like motif. Furthermore, our structure shows that SopB mimics key interactions between Cdc42 and host guanine dissociation inhibitor (GDI), a regulatory protein that sequesters Cdc42 in the inactive state by preventing exchange of GDP for GTP. In vitro nucleotide exchange assays confirm that the N-terminal domain of SopB slows intrinsic Cdc42 nucleotide exchange, as well as Cdc42 nucleotide exchange catalyzed by the Salmonella GEF, SopE. 4.2 Methods 4.2.1 Isothermal titration calorimetry Isothermal titration calorimetry was done using an iTC200 (MicroCal GE Healthcare). Cdc42 and SopB(29-181) were each expressed in E. coli BL21 (DE3) cells and purified from cell lysate by injection over a 1mL His-trap column (GE) and a Superdex 75 26/60 column (GE). Protein samples were dialyzed into 20 mM Hepes pH 7.5 with 50mM NaCl. The concentration of SopB(29-181) and Cdc42 were determined by Bradford assay. SopB(29-181) was concentrated to 774 µM and 19 aliquots of 1 µl were injected into the ITC cell containing 94.7 µM Cdc42. Titration experiments were repeated in triplicate. The dissociation constant was determined by fitting the raw data to a bi-molecular interaction model. 91 4.2.2 Static light scattering SopB(29-181)/Cdc42 complex was expressed and purified (described below) and concentrated to 2 mg/ml. The protein complex (100 µl volume) was injected over a Superdex 75 10/300 GL column (GE) and analyzed by miniDAWN multiangle static light scattering device (Wyatt Technologies) and ASTRA program. 4.2.3 Analysis of SopB and Cdc42 interaction by gel filtration SopB(29-181), SopB I49A(29-181) and Cdc42 were expressed and purified (as described below). Protein was concentrated to 2mg/ml and injected over a Superdex 75 10/30 column (GE) for gel filtration analysis. To determine the effect of the SopB I49A point mutation on interaction with Cdc42, WT SopB(29-181) and SopB I49A(29-181) (2mg/ml) were incubated with Cdc42 (2mg/ml) on ice for 1 hr and then injected over a Superdex 75 10/30 column (GE) for gel filtration analysis. 4.2.4 Cloning of genes into expression constructs, purification and crystallization Cdc42 with a deletion of seven C-terminal amino acids (Cdc42(1-183)) was amplified from Homo sapiens cDNA and cloned into pET 28 vector (Novagen) with restriction sites NdeI and SacI. Residues 29-181 of SopB were amplified from Salmonella typhimurium DNA and cloned into pET-21 vector (Novagen) with restriction sites NdeI and Sac1. Expression constructs pET-28 with N-terminal 6x his-tagged Cdc42(1-183) and pET-21 SopB(29-181) were co-transformed into Escherichia coli BL21 (DE3) cells. Cells were grown in LB medium with 50µg/ml kanamycin and 100µg/ml ampicillin to an O.D 600 of 0.6 and expression of Cdc42 and SopB(29-181) was induced with 1 mM IPTG for 20 hours at 20 oC. Cells were harvested by centrifugation, re-suspended in buffer with 20 mM Hepes pH 7.5, 300 mM NaCl and 50 mM imidazole and lysed by French press. The cell suspension was 92 centrifuged at 45,000 rpm for 1 hour and supernatant was filtered and injected onto a 1ml His-trap column (GE Health Sciences). The column was washed with buffer (20 mM Hepes pH 7.5, 300 mM NaCl, 50 mM imidazole) and his-tagged Cdc42 and bound SopB(29-181) were eluted with elution buffer (20 mM Hepes pH 7.5, 300 mM NaCl, 500 mM imidazole). Fractions containing the protein complex were concentrated and further purified by gel filtration with a Superdex 75 26/60 column (GE Health Sciences) in 20 mM Hepes pH 7.5, 300 mM NaCl. The final yield of protein was 100 mg of purified SopB(29-181) and Cdc42 complex for 2 L of bacterial culture. Protein was concentrated to 12 mg/ml for crystallization trials. The SopB(29-181) and Cdc42 complex was crystallized using the sitting drop vapour diffusion method by mixing 0.5 µl of 12 mg/ml protein solution with 0.5µl of well solution, 0.2M Sodium chloride, 0.1 M Phosphate-citrate pH 4.2, 20% (w/v) PEG 8000 (JCSG+ suite, Qiagen). The crystals were diamond-shaped and appeared after 14 days at 4 oC. 4.2.5 Data collection, structure determination and refinement Crystals were cryo-protected in a solution of mother liquor with 20% glycerol and flash frozen in liquid nitrogen. Crystals were screened at the CMCF-2 of the Canadian Light Source and diffracted to 2.25 Å resolution. The crystals were space group P43212 and had cell dimensions of 106.7 x 106.7 x 87.5 Å. Data was reduced and scaled using MOSFLM (289) and SCALA(290). The phases of the SopB(29-181)/Cdc42 complex were solved by molecular replacement using Phaser_MR (270), with the search model Cdc42-GDP (PDB 1AN0). COOT(291) was used to perform model building and the model was refined with REFMAC5(246) from the CCP4 suite and Phenix(292) . Ligand and ion atoms were refined at an occupancy of one. The structure was analyzed using Molprobity(293) with 96.7%, 93 3.3%, and 0% of residues in the favourable, allowed and disallowed regions of the Ramachandran plot. The SopB/Cdc42 structure was deposited in the Protein Data Bank (4DID). Figures were generated by PyMOL(294). 4.2.6 Cdc42 nucleotide exchange assay Cdc42 nucleotide exchange assay was adapted from reference (295). Cdc42 was pre-loaded with a fluorescent GDP analogue, N-methanylanthraniloyl (Mant) –GDP, by incubating 100 µM Cdc42 with 500 µM Mant-GDP in buffer (20 mM Tris pH 8.0, 150 mM NaCl, 5 mM EDTA, 1 mM DTT) at 37 oC for 30 minutes. The reaction was transferred to ice and stopped by addition of 10 mM MgCl2. A de-salting column (GE Healthcare) was used to remove free Mant-GDP and exchange the Mant-GDP loaded Cdc42 into reaction buffer (20 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgCl2). Mant-GDP loaded Cdc42 was diluted with reaction buffer at a final concentration of 2.5 µM. To initiate nucleotide exchange, unlabelled GTP was added to Mant-GDP loaded Cdc42 at a final concentration of 500 µM. The intrinsic exchange rate was measured by exciting Mant-GDP at 355 nm and monitoring emission at 448 nm. The fluorescence intensity at 448 nm decreases as Mant-GDP is released from Cdc42 into solution. To determine the effect of SopB on nucleotide exchange rate, 2.5 µM mant-GDP loaded Cdc42 was incubated with a 1.5 M or 3 M excess of SopB(29-181) in buffer (20 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgCl2) for 10 minutes on ice. The exchange reaction was initiated by addition of 500 µM GTP and measured as described above. Each reaction was repeated in three independent experiments and the mean value of relative fluorescence was plotted versus time. Standard deviation from the mean was calculated in Microsoft excel and is represented by error bars. The SopE catalyzed nucleotide exchange reactions were prepared and measured as described above. GTP was 94 added to reaction mixture and measurements were recorded for thirty seconds. The spectrophotometer as paused as SopE was added to the reaction at a final concentration of 25 nM and measurements resumed immediately after. 4.3 Results 4.3.1 Biochemical analysis and crystallization of bacterial SopB and host Cdc42 complex To determine how the SopB N-terminal domain binds Cdc42 to down-regulate activity, SopB(29-181) in complex with Cdc42 bound to GDP (Kd of 6 µM ± 2µM as determined by ITC analysis; Figure 4.1A) was co-purified for crystallization. SopB(29-181) and Cdc42 formed a 1:1 complex (as determined by static light scattering; Figure 4.1B) and yielded crystals that diffracted to 2.25 Å resolution (1 complex in the asymmetric unit; Table 4.1). Density could be observed for residues 45-171 of SopB, and residues 1-179 of Cdc42 as well as its GDP ligand. SopB consists of a β-strand (β1) that forms an intermolecular β-sheet with Cdc42 and five α-helices (α 1-5), three of which (α2, α 3,and α 4) contact Cdc42 switch I and II regions (Figure 4.2 C,D). The interface of SopB and Cdc42 forms an area of ~1770 Å2 as calculated by PISA (296). 95 Figure 4.1 Analysis of SopB (29-181) binding to Cdc42 by isothermal titration calorimetry and light scattering. A) SopB(29-181) was concentrated to 774 µM and 1 µl aliquots were injected into 94.7 µM Cdc42. The dissociation constant (Kd) 6 µM ± 2µM was calculated as the mean value of the Kd determined. Experiments were repeated a minimum of three times and error is represented as standard deviation. B) Purified SopB(29-181)/Cdc42 complex was analyzed by injection over a Superdex 75 10/300 GL column (GE) followed by static light scattering (Wyatt Technologies). The complex eluted from the column in a mono-disperse peak and a molecular weight of ~42kDa, corresponding to a 1:1 binding stoichiometry. 4.3.2 SopB contacts host Cdc42 by mimicking a eukaryotic CRIB-like intermolecular β-sheet SopB residues 48-52 and Cdc42 β2 form an intermolecular β-sheet that extends the three-stranded β-sheet of Cdc42 by an additional strand (Figure 4.2C). SopB residues flanking the intermolecular β-strand interact with Cdc42 α5 and α1 (Figure 4.2C). Specifically, SopB residue Arg46 side chain forms hydrogen bonds with side chains with Cdc42 α5 residues Asn167 and Glu171. Additionally, hydrophobic interactions are formed between SopB residues Pro47 and Ile49 and Cdc42 residue Leu174 in α5. SopB residue Arg53 forms a hydrogen bond with Cdc42 residue Tyr23 in α1. Furthermore, SopB residues 58-62 form a short α-helix (α1) that packs against the intermolecular β-sheet such that SopB 96 residues Thr58 and Tyr62 hydrogen bond with Cdc42 residues Ala41 and Thr43, respectively. Table 4.1 SopB/Cdc42 data collection and refinement statistics. Data collection SopB/Cdc42 Space group P43212 Cell dimensions a, b, c (Å) 107.00, 107.00, 87.75 α, β, γ (°) 90.0, 90.0, 90.0 Resolution (Å) 45.7-2.35 aCompleteness (%) 99.9 (100) Redundancy 14.5 (14.7) Rmerge 0.081 (0.578) I/σI 18.8 (4.7) Refinement statistics Resolution (Å) 45.7-2.35 bRwork/Rfree 0.2133/0.2522 No. reflections 405,282 No. atoms Protein 2,391 Ligand/ion 28/1 Water 116 B-factors (Å2) Protein 45.0 Ligand/ion 35.5/29.8 Water 49.5 r.m.s. deviations Bond lengths (Å) 0.0230 Bond angles (°) 1.9055 Ramachandran values Favoured (%) 96.7 Allowed (%) 3.3 aValues in parentheses represent the highest resolution shell bRwork = (ΣΙFobs-FcalcΙ) / ΣΙFobsΙ. Rfree is calculated from 5% of randomly selected reflections excluded during refinement. 97 Eukaryotic effector proteins such as p21-activated kinase (PAK), which couples activation of Cdc42 to cytoskeletal function, and cell migration (297) form an intermolecular β-sheet with Cdc42 β2 and contact Cdc42 α1 and α5 through a CRIB motif with the conserved sequence ISxP(x)2-4FxHxxHV (Figure 4.3A) (283). The SopB region (resides 46-53) that forms the intermolecular β-sheet contacts the same regions of Cdc42 (β2, α1 and α5) as the PAK CRIB motif. The canonical CRIB motif is not conserved in SopB except for residue Ile 49, which remarkably superimposes closely with the PAK residue Ile12 (Figure 4.3B). In both the eukaryotic PAK and Salmonella SopB, this Ile residue contacts Cdc42 Ile46 and an additional Arg46 side chain forms hydrogen bonds with side chains of Cdc42 α5 residues Asn167 and hydrophobic residues contained within Cdc42 α5. As such, SopB is the first example of a bacterial effector protein that mimics a host CRIB-like interaction to contact and modulate the action of a mammalian Rho GTPase, despite lacking the identifying CRIB sequence motif. This data indicates a key structural role of the Ile residue in the context of Cdc42 binding. This observation is supported by earlier site specific mutagenesis studies(298) of an I75N mutant within the eukaryotic αPAK CRIB that binds Cdc42 with ~3 fold less affinity as well as our gel filtration analysis of a I49A point mutant of SopB that disrupts interaction with Cdc42 (Figure 4.3C). 98 Figure 4.2 Overview of Cdc42 (blue) structure and interaction with GTPase binding domain of SopB (orange). A) Ribbon structure of GDP bound Cdc42 (PDB 1AN0). The regulatory switch regions of Cdc42 (cyan) interact with host effector proteins. B) Cdc42 activity is regulated by GEFs, GAPs and GDIs. Active GTP bound Cdc42 turns on numerous effector proteins to regulate cytoskeleton organization, cell cycle control, cellular trafficking and proliferation. C) The amino-terminal strand of SopB (labelled as β1; orange) forms an intermolecular β-sheet with β2 of Cdc42 (blue) and contacts Cdc42 α1 and α5. Bound GDP nucleotide (yellow) is shown in stick representation and magnesium is represented by a red star. Interacting amino acids are shown as sticks in the insert below. D) SopB helices α2, α3, and α4 insert between switch 99 I and II of Cdc42. SopB residues and Cdc42 switch residues that interact are shown as sticks in the insert below. A magnesium ion (red sphere) coordinates GDP nucleotide (yellow; shown in stick representation) and two water molecules (blue spheres). Figure 4.3 SopB contacts Cdc42 through a CRIB-like motif that contains an Ile residue conserved with eukaryotic Cdc42 effector proteins. A) Eukaryotic Cdc42 effector proteins Par6 (PDB 1NF3 (299)), WASP (PDB 1CEE (284)) and PAK6 (PDB 2ODB) contain a CRIB domain that forms an intermolecular β-sheet with Cdc42 β2. B) SopB (orange) lacks a conserved CRIB motif except for residue Ile49, which superimposes with the CRIB Ile residue of eukaryotic effector proteins such as PAK6 Ile12 (green; PDB 2ODB) to contact Cdc42 (blue). C) Gel filtration analysis of binding of SopB (residues 29-181) to Cdc42 after mutagenesis of a SopB Ile residue (I49A) that is conserved with the CRIB Ile of eukaryotic Cdc42-binding effector proteins. SopB I49A with Cdc42 (purple) elutes later on the gel filtration profile than WT SopB with Cdc42 (green), indicating that Ile49 is important for interaction with Cdc42. Corresponding elution fractions from WT SopB + Cdc42 (top) and SopB I49A + Cdc42 (bottom) are shown beside the gel filtration profile. 4.3.3 SopB contacts key Cdc42 regulatory switch residues to mimic a Rho GDI SopB helices (α2, α3, and α4) insert between Cdc42 regulatory loop regions, switch I and II (residues 26-45 and 59-74, respectively) (Figure 4.2D). When our structure of Cdc42 in complex with GDP and SopB is superimposed with that of Cdc42 in complex with GDP 100 (PDB 1AN0), the overall structure of Cdc42 is similar (average r.m.s.d. of 1.5 Å on 179 Cα atoms). However, our comparison shows there is a localized change in conformation of the Cdc42 switch I (r.m.s.d. of 2.5 Å on Cα atoms of residues 26-45) and that it is the SopB interaction with Cdc42 Val36 that is predominantly responsible (Figure 4.2D; Figure 4.4A). Significantly, our observed conformation of Cdc42 switch I in complex with GDP and Salmonella SopB is similar to that of Cdc42 switch I in complex with GDP and human Rho GDI, an inactivator of Cdc42 activity (Figure 4.1B). At switch I, the main contacts between Cdc42 and SopB is a hydrogen bond between the hydroxyl group of SopB residue Ser100 and the main chain carbonyl of Cdc42 residue Val36 and van der Waals interactions between SopB residue Val97 and the side chain atoms of Cdc42 Thr35. In addition, the main chain carbonyl of Cdc42 switch I residue Thr35 and the terminal phosphate group of GDP are coordinated by magnesium. Similarly, in the human Rho GDI, a serine residue contacts Cdc42 Val36, and the main chain carbonyl of Cdc42 Thr35 and the terminal phosphate group of GDP are coordinated by magnesium (300). Additional observations from our data show that in the presence of SopB, Cdc42 switch I residue Phe37, which is solvent exposed in Cdc42-GDP, is reoriented to a hydrophobic pocket that Tyr40 occupies in the Cdc42-GDP structure (Figure 4.4A). This flip of Phe37 also occurs when Rho GDI is bound to Cdc42 (Figure 4.4B) (300). Collectively, our structure shows that Salmonella SopB mimics several contacts between host Rho GDI and Cdc42 to reposition Cdc42 switch I residues such that Thr35 forms a coordination network with magnesium and GDP, an interaction that prevents dissociation of bound nucleotide from Cdc42 (300,301). 101 Figure 4.4 When Cdc42 is bound to SopB the conformation of Cdc42 switch I residues aligns with the conformation of Cdc42 switch I residues when bound to human RhoGDI, and the GTP activity of Cdc42 is down-regulated. A) Alignment of Cdc42 switch I (blue) when bound to SopB and Cdc42 switch I (grey) in the absence of SopB (PDB 1AN0). Both Cdc42 structures contain GDP (yellow). B) Alignment of Cdc42 switch I (blue) when bound to SopB with Cdc42 switch I (grey) when bound to Rho GDI (PDB 1DOA (300)). C) Intrinsic Cdc42 nucleotide exchange was monitored by measuring change in emitted fluorescence when mant-GTP is exchanged for unlabelled GTP. SopB was added in excess to the nucleotide exchange assay and the change in fluorescence was measured. SopE catalyzed Cdc42 nucleotide exchange was measured as for intrinsic Cdc42 nucleotide exchange. The experiment was repeated with SopB I49A. The arrow indicates the addition of SopE to the reaction mix. Experiments were repeated in triplicate and error bars represent standard error. Our structural data also shows that SopB makes extensive contacts with Cdc42 switch II; however, the conformation of switch II in our structure is similar to that of Cdc42 in complex with GDP (r.m.s.d. of 0.6 Å on Cα atoms of residues 59-74), suggesting that SopB uses switch II as an anchoring point to further facilitate binding. SopB α2, α3, and α4 form a helical bundle with a hydrophobic groove composed of several leucine residues (Leu84, 102 Leu98, Leu127, Leu131, Leu134) that contact Cdc42 switch II residues Leu67 and Leu70 (Figure 4.5). SopB mutant L84P has previously been shown to disrupt SopB binding to Cdc42 (286). These interactions are complemented by additional polar interactions (Figure 4.2D). Like host Rho GDI and the GDI domain of the Yersinia effector YpkA (301), two SopB residues, Arg138 and Asp95, hydrogen bond to the hydroxyl group of switch II residue Tyr64. Two salt bridges are formed between SopB residues Lys111 and Arg138 and switch II residues Asp76 and Arg138, respectively. SopB residue Gln104 contacts switch II residue Asp57, which is also coordinated in Rac1 by YpkA. Figure 4.5 SopB leucine residues form van der Waals contacts with Cdc42 switch II residues Leu67 and Leu70. SopB leucine residues, Leu84, Leu98, Leu131, Leu134 (orange) form van der Waals contacts with Cdc42 switch II residues Leu67 and Leu70 (blue). A similar set of interactions is also observed when eukaryotic Rho GDI (PDB 1DOA) binds Cdc42. 4.3.4 SopB prevents Cdc42 nucleotide exchange in vitro To support our observation that SopB structurally mimics Rho GDI, we used an in vitro nucleotide exchange assay to test whether SopB(29-181) can slow dissociation of bound 103 GDP from Cdc42 and subsequent exchange for GTP (Figure 4.4C). Our data show that SopB significantly decreases the rate of in vitro intrinsic Cdc42 nucleotide exchange in a dose dependent manner. In addition, we tested whether SopB slows nucleotide exchange in the presence of the potent Salmonella GEF, SopE. As seen with the intrinsic nucleotide exchange reaction, SopB slows the rate of Cdc42 nucleotide exchange catalyzed by SopE (Figure 4.4C). To test whether the SopB mutant I49A can still inhibit Cdc42 nucleotide exchange, we repeated the intrinsic and catalyzed Cdc42 exchange assay with SopB I49A. SopB I49A could inhibit nucleotide exchange at levels similar to wild type SopB for the intrinsic exchange assay. However, in the presence of the potent GEF SopE, the SopB I49A mutation significantly decreased the ability of SopB to inhibit nucleotide exchange. 4.4 Discussion Rho GTPases regulate a multitude of cellular processes such as cytoskeleton organization, cell division and cell motility (302). Members of the Rho GTPase family (for example Cdc42, Rac1 and RhoA) are low molecular weight proteins containing two flexible regulatory switch regions, termed switch I and II, that bind and hydrolyze GTP. As the name implies, they function as molecular switches, which are active in the GTP-bound state and inactive in the GDP-bound state (302). Cycling between the active and inactive state causes a change in conformation at the switch regions critical to function. In the active state, Rho GTPases interact with effector proteins, such as kinases, lipases, and oxidases to alter their activity (195). The activity of Rho GTPases is regulated by: GEFs, which catalyze exchange of GDP for GTP to activate the GTPase; GAPs, which catalyze hydrolysis of GTP to inactivate the GTPase; and GDIs, which prevent dissociation of bound nucleotide to prevent reactivation of the GTPase (302). 104 Since Rho GTPases play a fundamental role in many cellular processes, they are common targets of bacterial effector proteins and toxins. While bacterial toxins often inhibit or activate Rho GTPases by irreversible covalent modification (303), Salmonella uses a type III secretion system to deliver multiple effector proteins to the host cell that target specific Rho GTPases and modify their activity in a reversible and temporally regulated (304) manner. This sophisticated mechanism of Rho GTPase regulation by Salmonella allows the bacterium to manipulate the activity of Rho GTPases at different times post infection and exploit the resulting cellular effect for efficient entry into the host cell (304). While the interaction between Salmonella effectors SopE and SptP and Rho GTPases Cdc42 and Rac1 have been structurally characterized (185,187), there has been no structural information of the Salmonella effector SopB and its interaction with Cdc42. Here we have presented the first structure of the Cdc42-binding domain of SopB in complex with Cdc42. In this model, SopB contacts key Cdc42 switch I and II residues that are also contacted by host Rho GDI (300). The most notable interaction in this region is a hydrogen bond between SopB Ser100 and the main chain carbonyl of Cdc42 Val36. This hydrogen bond positions the main chain carbonyl of the neighbouring Cdc42 residue Thr35 to coordinate a magnesium ion, which is also coordinated by the terminal phosphate group of the bound GDP nucleotide. This coordination network, which is similar to that seen in the complex between Rho GDI and Cdc42 (300), serves to stabilize the bound GDP nucleotide and prevent exchange for GTP. In vitro nucleotide exchange assays confirm that the GTPase binding domain of SopB can slow intrinsic and SopE catalyzed Cdc42 nucleotide exchange. The GDI-like activity of the GTPase binding domain of SopB is consistent with the 105 observation that phosphatase deficient SopB can down-regulate Cdc42 signalling in a yeast model system (280). Like Salmonella, Yersinia also encodes a T3SS effector protein, YpkA, which mimics a host GDI (301). The C-terminal GDI domain of YpkA binds to Rac1 and RhoA, but not Cdc42 (286). Although there is no sequence similarity between the GDI domains of SopB and YpkA, both interact with Rho GTPases by inserting alpha helices between switch I and II and specifically contacting switch I residues Val36 (SopB), and Thr35 (YpkA) so that the magnesium ion coordinates the main chain carbonyl of Thr35 and the terminal phosphate of GDP. One unexpected feature of the SopB and Cdc42 interaction is the CRIB-like domain of SopB that forms an intermolecular beta sheet with Cdc42. This region of the complex closely resembles interactions between Cdc42 and eukaryotic effector proteins that contain a CRIB motif, such as PAK (283) and WASP (284), but was not predicted because of a lack of sequence similarity between this region of SopB and the canonical CRIB motif. However, SopB contains an isoleucine residue that superimposes with a conserved CRIB isoleucine of eukaryotic effector proteins. This isoluecine is positioned within a hydrophobic pocket on the surface of Cdc42. The SopB and Cdc42 CRIB-like interaction is not conserved with YpkA(301) as YpkA does not form an intermolecular β-sheet with β2 of Rac1 or RhoA. This is the first known example of a bacterial effector protein that mimics a CRIB-like domain to contact Cdc42. In conclusion, our structure shows that SopB contacts Cdc42 with a eukaryotic CRIB-like motif and slows in vitro Cdc42 nucleotide exchange by structurally mimicking key contacts made between human Rho GDI and Cdc42. The discovery of the GDI-like function 106 of SopB demonstrates that Salmonella uses a GEF (198,287), GAP (288) and GDI to contact Cdc42, resulting in sophisticated regulation of host Cdc42 signalling. This is the first time that a pathogenic bacterium has been shown to mimic all three eukaryotic regulators of small GTPases. 107 5 Summary and future directions The goal of the research presented in this thesis was to gain a better understanding of assembly and regulation of the T3SS, as well as to characterize the interaction between a type III secreted effector protein and its host target. We have presented the structure of a peptidoglycan-cleaving enzyme from EPEC and show that interaction with the inner rod component of the secretion system appears to enhance its activity in vitro. Although EtgA is often referred to as a lytic transglycosylase in the literature, our structure shows that the EtgA active site is remarkably similar to lysozyme, including the presence of an aspartate that aligns with hen egg white lysozyme aspartate 52. We have also presented the structure of a protein that regulates type III secretion hierarchy in EPEC, called SepL. Finally, we solved the structure of a Salmonella effector protein, called SopB, in complex with host Rho GTPase Cdc42 and show that SopB mimicks host Rho GDIs to slow Cdc42 nucleotide exchange. 5.1 EtgA Deletion of EtgA diminishes type III secretion, suggesting that the peptidoglycan-cleaving activity of EtgA is required for assembly(134). Indeed, many other macromolecular complexes (such as type IV pili or the type II secretion system) that traverse the peptidoglycan layer of Gram-negative bacteria require a dedicated enzyme to clear peptidoglycan. Activity of a peptidoglycan-cleaving enzyme such as EtgA must be tightly regulated in order to prevent cell lysis. Some genes encoding macromolecular complex associated PG-cleaving enzymes are fused to genes encoding structural components of the complex, thus ensuring that peptidoglycan is only cleared in the immediate area. In EPEC, EtgA is secreted by the general Sec-secretion system, and interacts with the inner rod 108 component of the secretion system, presumably during early stages of assembly. It remains to be discovered at which step in assembly EtgA interacts with the inner rod. Does it bind prior to assembly with the secretin? Or is it feasible for EtgA to interact with the inner rod after association with the secretin? We show that in vitro, EtgA has marginal activity; however, its activity is greatly enhanced when in complex with the inner rod component EscI. This way, the interaction with the inner rod may spatially restrict EtgA activity, preventing erroneous degradation of peptidoglycan. Based on conserved sequence similarity, early literature had suggested that EtgA and its orthologs act as lytic transglycosylases and target the glycosidic linkage between N-acetylmuramic acid and N-acetylglucosamine producing a 1,6-anhydromuramic acid and N-acetyl glucosamine products. However, comparison of our structure of EtgA to hen egg-white lysozyme reveals an area of the active site that is particularly well conserved with lysozyme. Remarkably, the β-hairpin region has a conserved aspartate (critical for lysozyme catalysis) that forms a hydrogen-bonding network with a number of other conserved residues (in lysozyme this region forms a platform that packs against N-acetylglucosamine in the D site). This region of conservation is absent from all characterized lytic transglycosylases. Mutation of the catalytic glutamate, conserved in lysozymes and lytic transglycosylases, as well as the aspartate and hydrogen-bonding network residues diminishes type III secretion in vivo. Lysozymes have the same substrate specificity as lytic transglycosylases, but use a hydrolysis mechanism to produce N-acetylglucosamine and N-acteylmuramic acid products. Is the mechanism of EtgA peptidoglycan cleavage of importance to its role in secretion system assembly? The evolutionarily related flagella associates with an N-acetylglucosaminidase (called FlgJ in Salmonella), which targets the neighbouring glycosidic linkage to clear peptidoglycan(255). 109 Lysozymes, lytic transglycosylases and N-acetylglucosaminidases all function to cleave peptidoglycan, but each would leave a different product, and a different chemical environment around the associated macromolecular complex. The cleaved peptidoglycan products could potentially act as a signal, or serve to recruit or bind secretion system proteins. Conversely, the variation in activity between the flagellar and T3SS peptidoglycan-cleaving enzymes may simply reflect a different evolutionary acquisition of the enzyme. EtgA is a particularly interesting peptidoglycan-cleaving enzyme as it has conserved lysozyme-like features in its active site (such as the catalytically important aspartate and its surrounding hydrogen-bonding network), as well as a scaffolding region that is structurally similar to and shares sequence conservation with lytic transglycosylases such as Slt70. Attractive objectives for future experiments include kinetic analysis of EtgA activity, as well as elucidation of EtgA’s mechanism to definitively classify it as a lysozyme or lytic transglycosylase. However, one of the major challenges in studying activity of peptidoglycan-cleaving enzymes is the lack of a suitable homogeneous substrate. Initially, in collaboration with the Withers group at the University of British Columbia, EtgA activity was tested using p-nitrophenyl-chitobiose as substrate. Chitobiose is a dimer of β-1,4-linked glucosamine units and cleavage of the nitrophenyl group causes a colorimetric change that can be monitored over time. We found that EtgA did not cleave p-nitrophenyl-chitobiose, perhaps because it may require the N-acetylmuramic acid unit of peptidoglycan for substrate recognition, suggesting that future kinetic analysis of EtgA will likely require a more biologically relevant substrate. EtgA can be classified as a lytic transglycosylase or a lysozyme through identification of its reaction products, as lytic transglycosylases produce 1,6-anhydromuramic acid and lysozymes produce muramic acid. After incubation of EtgA 110 with heterogeneous peptidoglycan substrate, disaccharide products can be isolated and identified by high performance liquid chromatography (HPLC) coupled to electrospray ionization mass spectrometry/mass spectrometry (ESI-MS/MS) (255). In the case that there is a low abundance of product, an alternative strategy to identify EtgA products involves incubating EtgA with peptidoglycan in [18O]H2O to directly label hydrolytic reaction products. In this case, if EtgA uses a lysozyme-like mechanism, reaction products will contain 18O, which could be identified by mass spectrometry. Investigating the EtgA reaction mechanism is critical for understanding how EtgA and its orthologs clear peptidoglycan and will also provide clues to the type of chemical environment created by cleaved peptidoglycan ends surrounding the secretion system apparatus. These peptidoglycan ends could function as a signal or interact with peptidoglycan binding components of the secretion system. Additionally, cleaved soluble peptidoglycan fragments may be released as a signalling molecule, stressing the importance of understanding EtgA’s mechanism. The initial goal of our work on EtgA was to co-crystallize EtgA with its binding partner, the inner rod subunit EscI, in order to determine how EtgA is tethered to the type III secretion apparatus. In order to co-purify EtgA/EscI complex, dozens of EscI N- and C-terminal truncation constructs were cloned and expressed, as full length EscI is not soluble. In fact, neither EtgA nor EscI are stable individually, so co-expression and co-purification seems the best strategy to obtain the complex. Analysis of EscI/EtgA complex stability by thermal denaturation indicates that it is folded and stable in solution. We tried a number of strategies to obtain crystals of the complex, such as setting up different protein constructs for crystallization, modifying protein by reductive methylation, as well as varying standard experimental parameters such as protein concentration, buffer conditions, additives, 111 temperature, and crystallization conditions. While these crystallization trials were unsuccessful, further screening and tweaking of experimental parameters may eventually allow for crystal growth. NMR spectroscopy may be another means of obtaining the structure of the EscI/EtgA complex. Possible limitations of this approach include size of the complex (~24 kDa for the shortest stable constructs), the instability of the individual proteins (which may complicate approaches that involve mixing labeled/unlabeled protein to form the complex), and the requirement of high salt (>0.5 M) for stability of the complex. Initial HSQC experiments would provide a quick means of assessing the suitability of EtgA/EscI complex for NMR studies. Structural characterization of the inner rod will likely require interaction with another secretion system component, such as EtgA, as it appears at least partially unfolded in isolation(132). Cryo-EM with a direct electron detector may allow for structural characterization of an EscI filament in complex with EtgA. A structure of the EtgA/EscI complex would be very valuable, as the inner rod is one of the remaining uncharacterized components of the T3SS, and a structure of the complex would provide insight into how EtgA associates with the T3SS. 5.2 SepL The EPEC gatekeeper protein SepL plays a critical role in T3SS assembly, as deletion of SepL (or its binding partner SepD) in the closely related mouse pathogen C. rodentium diminishes pedestal formation and virulence in mice(137). The phenotype of the ΔsepL mutant is quite striking: secretion of translocon proteins (EspA, EspB and EspD) is abrogated, and secretion of effector proteins is increased(75). This phenotype suggests that SepL promotes secretion of the translocon components, and delays secretion of effector proteins. Very little is known about the mechanism of how SepL regulates secretion 112 hierarchy, but our crystal structure of SepL shows that like its structurally characterized orthologs, it consists of three X-bundle domains, which may act as scaffolding domains to mediate protein-protein interactions. The Chlamydia ortholog CopN has been shown to interact with the translocator chaperone Scc3 through domains 2 and 3, supporting the idea that the gatekeeper regulates secretion through physical interaction with translocator components(264). So far, we have not been able to identify interactions between SepL and components of the translocon or their dedicated chaperones. This may reflect a weak affinity (the CopN/Scc3 interface contains an extended region of Scc3 not conserved in other translocator chaperones) or the necessity of additional binding partners. Sequence conservation between SepL and its orthologs is very low (between 10-13% sequence identity). Indeed, only three amino acids are absolutely conserved between SepL and its structurally characterized orthologs CopN, MxiC (Shigella) and YopN/TyeA (Yersinia). However, through structural comparison we were able to identify three SepL regions spanning domains 2 and 3 that are conserved with orthologs. Structure-based identification of conserved SepL residues will allow mutational analysis in EPEC. Future work on SepL will focus on identification interaction partners in order to better understand how SepL regulates secretion of translocon proteins and effectors. Mutational analysis of conserved SepL residues may indicate regions that are important for interaction with other T3SS components. Likely, SepL must interact with translocon/chaperone complexes. In Salmonella, the gatekeeper only interacts with the translocon when its specific chaperone is present(82). To our knowledge, interaction between SepL and translocators (EspA, EspD, EspB) in complex with their specific chaperone has never been systematically tested in vitro with purified protein. Both published(54) and unpublished work from our lab 113 show that each of the translocators is soluble in complex with its chaperone, suggesting that screening of interactions between SepL and translocator/chaperone pairs is feasible. A surface plasmon resonance system, such as the Octet system available in our laboratory, will allow fast analysis of interaction between SepL and translocator/chaperone complexes, and also requires little sample. Identification of SepL interacting partners will provide new targets for structural studies. An objective worth revisiting, and the original goal of our structural studies with SepL, was to crystallize SepL in complex with its known interacting partner, SepD. A ΔsepD mutant has an identical phenotype to that of ΔsepL, suggesting both proteins are critical for regulation of translocon and effector secretion. SepD has topology and features typical of a chaperone(265); however, unlike the Yersinia gatekeeper heterodimeric chaperone pair, SepD does not require the unstructured N-terminus of SepL for interaction, suggesting a different mode of interaction. While we extensively screened conditions for crystallization of SepD/SepL (70-351), our initial hit condition only produced crystals of SepL. Our structural data for SepL suggests that residues 70-79 are disordered in the crystal lattice and that the ideal construct to use for future crystallization studies encompasses SepL residues 80-351. Using this shorter SepL construct in complex with SepD may improve likelihood of complex crystallization, as the disordered N-terminus of SepL may have prevented growth of other crystal forms. Another approach for crystallization trials would be to set up SepL (full length) in complex with SepD and CesL (which requires SepL N-terminal 70 amino acids for interaction). SepL/SepD/CesL were shown to form a complex with a 1:1:1 ratio, whereas SepL/SepD complex exhibits concentration dependent changes in stoichiometry(265). 114 Structural studies of the SepL/SepD complex will hopefully shed light on the role of SepD, and whether it has a chaperone-like function. 5.3 SopB The Salmonella effector protein SopB has an N-terminal GTPase binding domain and a C-terminal phosphoinositide phosphatase domain, both of which are required for its activity in the host cell. The interacting partner of SopB GTPase binding domain was identified as host Cdc42 by stable isotope labelling of amino acids in cell culture (SILAC)(285). Cdc42 is a small Rho GTPase that regulates many cellular processes such as cytoskeleton organization, membrane trafficking and cell cycle progression. Two additional Salmonella effectors have been shown to target Cdc42: SopE, a guanine exchange factor (GEF) that activates Cdc42, and SptP, a RhoGTPase activating protein (GAP) that catalyzes hydrolysis of GTP to subsequently inactive Cdc42(185,187). We solved the crystal structure of SopB GTPase domain in complex with host Cdc42. SopB forms a helical bundle that inserts between Cdc42 switch I and II regions, which are important for GTPase function. Comparison of SopB bound Cdc42 to the structure of Cdc42 in complex with host Rho guanine dissociation inhibitor (GDI) shows a conserved structure of Cdc42 switch regions. Despite a lack of sequence conservation, SopB mimics key contacts made between host RhoGDI and Cdc42 regulatory switch regions, suggesting that SopB may function as a RhoGDI. We used an in vitro fluorescent nucleotide exchange assay to show that SopB does slow Cdc42 nucleotide exchange, even in the presence of the GEF SopE. Interestingly, SopB uses a CRIB-like motif to form an intermolecular β-sheet with Cdc42 β2, a mode of interaction also observed between eukaryotic effectors such as PAK and Cdc42(283). The GDI-like activity of the SopB GTPase binding domain was difficult to predict based on 115 sequence alone, underscoring the importance of structurally characterizing the SopB/Cdc42 complex. A curious feature of SopB is its modular architecture: a GDI domain adjacent to a phosphoinositide phosphatase domain. Modularity is a commonly observed in type III secreted effector proteins, and is proposed to have arisen from the process of terminal re-assortment. Terminal re-assortment describes a process in which domains evolve independently of each other, and then combine to form a chimeric protein, which ultimately increases effector diversity (305). It would be interesting to test whether the Cdc42-targeting GDI domain of SopB is required for functionality of its phosphoinositide phosphatase domain during infection. A previous study concluded that mutation of SopB residues that impair interaction with Cdc42 did not affect the catalytic activity of the phosphatase domain in vivo, based on the observation that these mutants did not significantly alter the overall percentage of host cell PI(4,5)P2, as probed by a fluorescent marker(286). However, the same study found that disruption of Cdc42/SopB interaction impaired localization of SopB to the Salmonella containing vacuole (SCV) and intracellular Salmonella replication, suggesting that the GDI domain of SopB is important at later stages of infection(286). It is possible that interaction between Cdc42 and SopB is required for targeting SopB to the SCV, where the phosphoinositide phosphatase domain has been shown to regulate the membrane surface charge by targeting P1(4,5)P2 and phosphatidylserine(278). Measurement of whole cell levels of PI(4,5)P2 after infection with a impaired Cdc42-interacting SopB mutant may have not been sensitive enough to detect relatively small localized changes of PI(4,5)P2 on the SCV. In order to assess the effect of SopB/Cdc42 interaction on the phosphatase activity of SopB specifically at the SCV, we could measure co-localizaton of fluorescein labeled WT 116 Salmonella or a SopB-Cdc42 interacting mutant with a fluorescent marker for PI(4,5)P2 or PS at a time point of 20 minutes post-infection, a method that was described previously(278). If SopB interaction with Cdc42 is required for efficient functionality of its phosphoinositide phosphatase domain at later stages of infection, it may explain how fusion of the GDI domain to the phosphatase domain conveys an advantage to the bacterium over transporting each functional SopB domain as a single polypeptide. 5.4 Closing summary The major goal of this thesis was to use a structural approach to improve our understanding of how the T3SS of Gram-negative pathogens assembles and contributes to virulence. Structural characterization of components that are involved in secretion system assembly, such as the EPEC peptidoglycan-cleaving enzyme EtgA and the gatekeeper protein SepL, allow for structure-based mutation to test the biological importance of conserved residues. Elucidation of the N-terminal region of the Salmonella effector protein SopB in complex with host RhoGTPase Cdc42 revealed the GDI function of SopB, an activity that could not be predicted from sequence alone, as this GDI domain shares no sequence similarity with eukaryotic GDIs. The work presented here contributes to the rapidly growing body of research on type III secretion, but in our quest to understand the function and mechanism of this secretion apparatus and its associated effector proteins, new questions arise. For example, the role of EtgA in assembly of the secretion system apparatus remains ill defined. We have yet to understand at which stage of secretion system assembly it clears peptidoglycan, and whether its activity acts a signal to recruit peptidoglycan-binding components of the secretion system. Furthermore, does it remain bound to the inner rod after assembly is complete? Understanding how this enzyme facilitates assembly will be 117 particularly valuable, as it has orthologs associated with other types of macromolecular complexes. Likewise, the mechanism by how the gatekeeper SepL regulates secretion of translocon and effector proteins remains elusive. Understanding the function of this protein will likely require identification and characterization of possibly weak and transient interactions made between SepL and its targets. Identification of the GDI activity of SopB’s N-terminal domain underlines the complexity of type III secreted effector proteins, as many effectors possess multiple activities that may act synergistically during infection. Understanding how a complete set of secreted effector proteins regulates host cell processes overtime will be crucial for delineation of bacterial pathogenesis mechanisms and also serves as a tool to understand biology of the host cell processes are that are targeted by the bacteria. 118 References 1. Abby, S. S., and Rocha, E. P. (2012) The non-‐flagellar type III secretion system evolved from the bacterial flagellum and diversified into host-‐cell adapted systems. PLoS Genet 8, e1002983 2. Leiman, P. G., Basler, M., Ramagopal, U. A., Bonanno, J. B., Sauder, J. M., Pukatzki, S., Burley, S. K., Almo, S. C., and Mekalanos, J. J. (2009) Type VI secretion apparatus and phage tail-‐associated protein complexes share a common evolutionary origin. Proc Natl Acad Sci U S A 106, 4154-‐4159 3. Michiels, T., Vanooteghem, J. C., Lambert de Rouvroit, C., China, B., Gustin, A., Boudry, P., and Cornelis, G. R. (1991) Analysis of virC, an operon involved in the secretion of Yop proteins by Yersinia enterocolitica. Journal of Bacteriology 173, 4994-‐5009 4. Salmond, G. P., and Reeves, P. J. (1993) Membrane traffic wardens and protein secretion in gram-‐negative bacteria. Trends in biochemical sciences 18, 7-‐12 5. Galan, J. E., and Curtiss, R., 3rd. (1989) Cloning and molecular characterization of genes whose products allow Salmonella typhimurium to penetrate tissue culture cells. Proceedings of the National Academy of Sciences of the United States of America 86, 6383-‐6387 6. Altmeyer, R. M., McNern, J. K., Bossio, J. C., Rosenshine, I., Finlay, B. B., and Galan, J. E. (1993) Cloning and molecular characterization of a gene involved in Salmonella adherence and invasion of cultured epithelial cells. Molecular microbiology 7, 89-‐98 7. Galan, J. E., Ginocchio, C., and Costeas, P. (1992) Molecular and functional characterization of the Salmonella invasion gene invA: homology of InvA to members of a new protein family. Journal of Bacteriology 174, 4338-‐4349 8. Kaniga, K., Bossio, J. C., and Galan, J. E. (1994) The Salmonella typhimurium invasion genes invF and invG encode homologues of the AraC and PulD family of proteins. Molecular microbiology 13, 555-‐568 9. Shea, J. E., Hensel, M., Gleeson, C., and Holden, D. W. (1996) Identification of a virulence locus encoding a second type III secretion system in Salmonella typhimurium. Proceedings of the National Academy of Sciences of the United States of America 93, 2593-‐2597 10. Kubori, T., Matsushima, Y., Nakamura, D., Uralil, J., Lara-‐Tejero, M., Sukhan, A., Galan, J. E., and Aizawa, S. I. (1998) Supramolecular structure of the Salmonella typhimurium type III protein secretion system. Science (New York, N.Y.) 280, 602-‐605 11. Tamano, K., Aizawa, S., Katayama, E., Nonaka, T., Imajoh-‐Ohmi, S., Kuwae, A., Nagai, S., and Sasakawa, C. (2000) Supramolecular structure of the Shigella type III secretion machinery: the needle part is changeable in length and essential for delivery of effectors. The EMBO journal 19, 3876-‐3887 12. Blocker, A., Jouihri, N., Larquet, E., Gounon, P., Ebel, F., Parsot, C., Sansonetti, P., and Allaoui, A. (2001) Structure and composition of the Shigella flexneri "needle complex", a part of its type III secreton. Molecular microbiology 39, 652-‐663 119 13. Wagner, S., Konigsmaier, L., Lara-‐Tejero, M., Lefebre, M., Marlovits, T. C., and Galan, J. E. (2010) Organization and coordinated assembly of the type III secretion export apparatus. Proc Natl Acad Sci U S A 107, 17745-‐17750 14. Diepold, A., Amstutz, M., Abel, S., Sorg, I., Jenal, U., and Cornelis, G. R. (2010) Deciphering the assembly of the Yersinia type III secretion injectisome. EMBO J 29, 1928-‐1940 15. Diepold, A., Wiesand, U., and Cornelis, G. R. (2011) The assembly of the export apparatus (YscR,S,T,U,V) of the Yersinia type III secretion apparatus occurs independently of other structural components and involves the formation of an YscV oligomer. Mol Microbiol 82, 502-‐514 16. Worrall, L. J., Lameignere, E., and Strynadka, N. C. (2011) Structural overview of the bacterial injectisome. Current opinion in microbiology 14, 3-‐8 17. Zarivach, R., Vuckovic, M., Deng, W., Finlay, B. B., and Strynadka, N. C. (2007) Structural analysis of a prototypical ATPase from the type III secretion system. Nat Struct Mol Biol 14, 131-‐137 18. Fadouloglou, V. E., Tampakaki, A. P., Glykos, N. M., Bastaki, M. N., Hadden, J. M., Phillips, S. E., Panopoulos, N. J., and Kokkinidis, M. (2004) Structure of HrcQB-‐C, a conserved component of the bacterial type III secretion systems. Proceedings of the National Academy of Sciences of the United States of America 101, 70-‐75 19. Worrall, L. J., Vuckovic, M., and Strynadka, N. C. (2010) Crystal structure of the C-‐terminal domain of the Salmonella type III secretion system export apparatus protein InvA. Protein Sci 19, 1091-‐1096 20. Lilic, M., Quezada, C. M., and Stebbins, C. E. (2010) A conserved domain in type III secretion links the cytoplasmic domain of InvA to elements of the basal body. Acta Crystallogr D Biol Crystallogr 66, 709-‐713 21. Abrusci, P., Vergara-‐Irigaray, M., Johnson, S., Beeby, M. D., Hendrixson, D. R., Roversi, P., Friede, M. E., Deane, J. E., Jensen, G. J., Tang, C. M., and Lea, S. M. (2013) Architecture of the major component of the type III secretion system export apparatus. Nat Struct Mol Biol 20, 99-‐104 22. Deane, J. E., Roversi, P., King, C., Johnson, S., and Lea, S. M. (2008) Structures of the Shigella flexneri type 3 secretion system protein MxiC reveal conformational variability amongst homologues. Journal of Molecular Biology 377, 985-‐992 23. Schubot, F. D., Jackson, M. W., Penrose, K. J., Cherry, S., Tropea, J. E., Plano, G. V., and Waugh, D. S. (2005) Three-‐dimensional structure of a macromolecular assembly that regulates type III secretion in Yersinia pestis. Journal of Molecular Biology 346, 1147-‐1161 24. Zarivach, R., Deng, W., Vuckovic, M., Felise, H. B., Nguyen, H. V., Miller, S. I., Finlay, B. B., and Strynadka, N. C. (2008) Structural analysis of the essential self-‐cleaving type III secretion proteins EscU and SpaS. Nature 453, 124-‐127 25. Deane, J. E., Graham, S. C., Mitchell, E. P., Flot, D., Johnson, S., and Lea, S. M. (2008) Crystal structure of Spa40, the specificity switch for theShigella flexneritype III secretion system. Molecular microbiology 69, 267 <last_page> 276 26. Lountos, G. T., Austin, B. P., Nallamsetty, S., and Waugh, D. S. (2009) Atomic resolution structure of the cytoplasmic domain ofYersinia pestisYscU, a regulatory switch involved in type III secretion. Protein Science 18, 467 <last_page> 474 120 27. Wiesand, U., Sorg, I., Amstutz, M., Wagner, S., van den Heuvel, J., Lührs, T., Cornelis, G. R., and Heinz, D. W. (2009) Structure of the Type III Secretion Recognition Protein YscU from Yersinia enterocolitica. Journal of Molecular Biology 385, 854 <last_page> 866 28. Schraidt, O., and Marlovits, T. C. (2011) Three-‐dimensional model of Salmonella's needle complex at subnanometer resolution. Science (New York, N.Y.) 331, 1192-‐1195 29. Hodgkinson, J. L., Horsley, A., Stabat, D., Simon, M., Johnson, S., da Fonseca, P. C., Morris, E. P., Wall, J. S., Lea, S. M., and Blocker, A. J. (2009) Three-‐dimensional reconstruction of the Shigella T3SS transmembrane regions reveals 12-‐fold symmetry and novel features throughout. Nature structural & molecular biology 16, 477-‐485 30. Radics, J., Konigsmaier, L., and Marlovits, T. C. (2014) Structure of a pathogenic type 3 secretion system in action. Nature structural & molecular biology 21, 82-‐87 31. Kudryashev, M., Stenta, M., Schmelz, S., Amstutz, M., Wiesand, U., Castano-‐Diez, D., Degiacomi, M. T., Munnich, S., Bleck, C. K., Kowal, J., Diepold, A., Heinz, D. W., Dal Peraro, M., Cornelis, G. R., and Stahlberg, H. (2013) In situ structural analysis of the Yersinia enterocolitica injectisome. eLife 2, e00792 32. Kawamoto, A., Morimoto, Y. V., Miyata, T., Minamino, T., Hughes, K. T., Kato, T., and Namba, K. (2013) Common and distinct structural features of Salmonella injectisome and flagellar basal body. Scientific reports 3, 3369 33. Yip, C. K., Kimbrough, T. G., Felise, H. B., Vuckovic, M., Thomas, N. A., Pfuetzner, R. A., Frey, E. A., Finlay, B. B., Miller, S. I., and Strynadka, N. C. (2005) Structural characterization of the molecular platform for type III secretion system assembly. Nature 435, 702-‐707 34. Bergeron, J. R., Worrall, L. J., Sgourakis, N. G., DiMaio, F., Pfuetzner, R. A., Felise, H. B., Vuckovic, M., Yu, A. C., Miller, S. I., Baker, D., and Strynadka, N. C. (2013) A refined model of the prototypical Salmonella SPI-‐1 T3SS basal body reveals the molecular basis for its assembly. PLoS pathogens 9, e1003307 35. Spreter, T., Yip, C. K., Sanowar, S., Andre, I., Kimbrough, T. G., Vuckovic, M., Pfuetzner, R. A., Deng, W., Yu, A. C., Finlay, B. B., Baker, D., Miller, S. I., and Strynadka, N. C. (2009) A conserved structural motif mediates formation of the periplasmic rings in the type III secretion system. Nat Struct Mol Biol 16, 468-‐476 36. McDowell, M. A., Johnson, S., Deane, J. E., Cheung, M., Roehrich, A. D., Blocker, A. J., McDonnell, J. M., and Lea, S. M. (2011) Structural and functional studies on the N-‐terminal domain of the Shigella type III secretion protein MxiG. The Journal of biological chemistry 286, 30606-‐30614 37. Barison, N., Lambers, J., Hurwitz, R., and Kolbe, M. (2012) Interaction of MxiG with the cytosolic complex of the type III secretion system controls Shigella virulence. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 26, 1717-‐1726 38. Lario, P. I., Pfuetzner, R. A., Frey, E. A., Creagh, L., Haynes, C., Maurelli, A. T., and Strynadka, N. C. (2005) Structure and biochemical analysis of a secretin pilot protein. The EMBO journal 24, 1111-‐1121 121 39. Okon, M., Moraes, T. F., Lario, P. I., Creagh, A. L., Haynes, C. A., Strynadka, N. C., and McIntosh, L. P. (2008) Structural characterization of the type-‐III pilot-‐secretin complex from Shigella flexneri. Structure (London, England : 1993) 16, 1544-‐1554 40. Kowal, J., Chami, M., Ringler, P., Muller, S. A., Kudryashev, M., Castano-‐Diez, D., Amstutz, M., Cornelis, G. R., Stahlberg, H., and Engel, A. (2013) Structure of the Dodecameric Yersinia enterocolitica Secretin YscC and Its Trypsin-‐Resistant Core. Structure (London, England : 1993) 41. Poyraz, O., Schmidt, H., Seidel, K., Delissen, F., Ader, C., Tenenboim, H., Goosmann, C., Laube, B., Thunemann, A. F., Zychlinsky, A., Baldus, M., Lange, A., Griesinger, C., and Kolbe, M. (2010) Protein refolding is required for assembly of the type three secretion needle. Nature structural & molecular biology 42. Wang, Y., Ouellette, A. N., Egan, C. W., Rathinavelan, T., Im, W., and De Guzman, R. N. (2007) Differences in the electrostatic surfaces of the type III secretion needle proteins PrgI, BsaL, and MxiH. Journal of Molecular Biology 371, 1304-‐1314 43. Loquet, A., Sgourakis, N. G., Gupta, R., Giller, K., Riedel, D., Goosmann, C., Griesinger, C., Kolbe, M., Baker, D., Becker, S., and Lange, A. (2012) Atomic model of the type III secretion system needle. Nature 486, 7402-‐7279 44. Deane, J. E., Roversi, P., Cordes, F. S., Johnson, S., Kenjale, R., Daniell, S., Booy, F., Picking, W. D., Picking, W. L., Blocker, A. J., and Lea, S. M. (2006) Molecular model of a type III secretion system needle: Implications for host-‐cell sensing. Proceedings of the National Academy of Sciences of the United States of America 103, 12529-‐12533 45. Fujii, T., Cheung, M., Blanco, A., Kato, T., Blocker, A. J., and Namba, K. (2012) Structure of a type III secretion needle at 7-‐A resolution provides insights into its assembly and signaling mechanisms [Biophysics and Computational Biology]. Proceedings of the National Academy of Sciences 109, 4461-‐4466 46. Demers, J. P., Sgourakis, N. G., Gupta, R., Loquet, A., Giller, K., Riedel, D., Laube, B., Kolbe, M., Baker, D., Becker, S., and Lange, A. (2013) The common structural architecture of Shigella flexneri and Salmonella typhimurium type three secretion needles. PLoS pathogens 9, e1003245 47. Sun, P., Tropea, J. E., Austin, B. P., Cherry, S., and Waugh, D. S. (2008) Structural characterization of the Yersinia pestis type III secretion system needle protein YscF in complex with its heterodimeric chaperone YscE/YscG. Journal of Molecular Biology 377, 819-‐830 48. Quinaud, M., Ple, S., Job, V., Contreras-‐Martel, C., Simorre, J. P., Attree, I., and Dessen, A. (2007) Structure of the heterotrimeric complex that regulates type III secretion needle formation. Proceedings of the National Academy of Sciences of the United States of America 104, 7803-‐7808 49. Zhang, L., Wang, Y., Picking, W. L., Picking, W. D., and De Guzman, R. N. (2006) Solution structure of monomeric BsaL, the type III secretion needle protein of Burkholderia pseudomallei. Journal of Molecular Biology 359, 322-‐330 50. Chatterjee, S., Zhong, D., Nordhues, B. A., Battaile, K. P., Lovell, S., and De Guzman, R. N. (2011) The crystal structures of the Salmonella type III secretion system tip protein SipD in complex with deoxycholate and chenodeoxycholate. Protein science : a publication of the Protein Society 20, 75-‐86 122 51. Lunelli, M., Hurwitz, R., Lambers, J., and Kolbe, M. (2011) Crystal Structure of PrgI-‐SipD: Insight into a Secretion Competent State of the Type Three Secretion System Needle Tip and its Interaction with Host Ligands. PLoS pathogens 7, e1002163 52. Barta, M. L., Guragain, M., Adam, P., Dickenson, N. E., Patil, M., Geisbrecht, B. V., Picking, W. L., and Picking, W. D. (2012) Identification of the bile salt binding site on IpaD from Shigella flexneri and the influence of ligand binding on IpaD structure. Proteins 80, 935-‐945 53. Derewenda, U., Mateja, A., Devedjiev, Y., Routzahn, K. M., Evdokimov, A. G., Derewenda, Z. S., and Waugh, D. S. (2004) The structure of Yersinia pestis V-‐antigen, an essential virulence factor and mediator of immunity against plague. Structure (London, England : 1993) 12, 301-‐306 54. Yip, C. K., Finlay, B. B., and Strynadka, N. C. (2005) Structural characterization of a type III secretion system filament protein in complex with its chaperone. Nat Struct Mol Biol 12, 75-‐81 55. Johnson, S., Roversi, P., Espina, M., Olive, A., Deane, J. E., Birket, S., Field, T., Picking, W. D., Blocker, A. J., Galyov, E. E., Picking, W. L., and Lea, S. M. (2007) Self-‐chaperoning of the type III secretion system needle tip proteins IpaD and BipD. The Journal of biological chemistry 282, 4035-‐4044 56. Job, V., Mattei, P. J., Lemaire, D., Attree, I., and Dessen, A. (2010) Structural basis of chaperone recognition of type III secretion system minor translocator proteins. The Journal of biological chemistry 285, 23224-‐23232 57. Lunelli, M., Lokareddy, R. K., Zychlinsky, A., and Kolbe, M. (2009) IpaB-‐IpgC interaction defines binding motif for type III secretion translocator. Proceedings of the National Academy of Sciences of the United States of America 106, 9661-‐9666 58. Schreiner, M., and Niemann, H. H. (2012) Crystal structure of the Yersinia enterocolitica type III secretion chaperone SycD in complex with a peptide of the minor translocator YopD. BMC structural biology 12, 13-‐6807-‐6812-‐6813 59. Barta, M. L., Dickenson, N. E., Patil, M., Keightley, A., Wyckoff, G. J., Picking, W. D., Picking, W. L., and Geisbrecht, B. V. (2012) The structures of coiled-‐coil domains from type III secretion system translocators reveal homology to pore-‐forming toxins. Journal of Molecular Biology 417, 395-‐405 60. Daefler, S., and Russel, M. (1998) The Salmonella typhimurium InvH protein is an outer membrane lipoprotein required for the proper localization of InvG. Molecular microbiology 28, 1367-‐1380 61. Crago, A. M., and Koronakis, V. (1998) Salmonella InvG forms a ring-‐like multimer that requires the InvH lipoprotein for outer membrane localization. Molecular microbiology 30, 47-‐56 62. Schuch, R., and Maurelli, A. T. (1999) The mxi-‐Spa type III secretory pathway of Shigella flexneri requires an outer membrane lipoprotein, MxiM, for invasin translocation. Infection and immunity 67, 1982-‐1991 63. Schraidt, O., Lefebre, M. D., Brunner, M. J., Schmied, W. H., Schmidt, A., Radics, J., Mechtler, K., Galan, J. E., and Marlovits, T. C. (2010) Topology and organization of the Salmonella typhimurium type III secretion needle complex components. PLoS pathogens 6, e1000824 123 64. Gauthier, A., Puente, J. L., and Finlay, B. B. (2003) Secretin of the enteropathogenic Escherichia coli type III secretion system requires components of the type III apparatus for assembly and localization. Infection and immunity 71, 3310-‐3319 65. Sukhan, A., Kubori, T., Wilson, J., and Galan, J. E. (2001) Genetic analysis of assembly of the Salmonella enterica serovar Typhimurium type III secretion-‐associated needle complex. J Bacteriol 183, 1159-‐1167 66. Mota, L. J., Journet, L., Sorg, I., Agrain, C., and Cornelis, G. R. (2005) Bacterial injectisomes: needle length does matter. Science (New York, N.Y.) 307, 1278 67. Journet, L., Agrain, C., Broz, P., and Cornelis, G. R. (2003) The needle length of bacterial injectisomes is determined by a molecular ruler. Science (New York, N.Y.) 302, 1757-‐1760 68. Marlovits, T. C., Kubori, T., Lara-‐Tejero, M., Thomas, D., Unger, V. M., and Galan, J. E. (2006) Assembly of the inner rod determines needle length in the type III secretion injectisome. Nature 441, 637-‐640 69. Agrain, C., Callebaut, I., Journet, L., Sorg, I., Paroz, C., Mota, L. J., and Cornelis, G. R. (2005) Characterization of a Type III secretion substrate specificity switch (T3S4) domain in YscP from Yersinia enterocolitica. Molecular microbiology 56, 54-‐67 70. Botteaux, A., Sani, M., Kayath, C. A., Boekema, E. J., and Allaoui, A. (2008) Spa32 interaction with the inner-‐membrane Spa40 component of the type III secretion system of Shigella flexneri is required for the control of the needle length by a molecular tape measure mechanism. Molecular microbiology 70, 1515-‐1528 71. Monjaras Feria, J., Garcia-‐Gomez, E., Espinosa, N., Minamino, T., Namba, K., and Gonzalez-‐Pedrajo, B. (2012) Role of EscP (Orf16) in injectisome biogenesis and regulation of type III protein secretion in enteropathogenic Escherichia coli. Journal of Bacteriology 194, 6029-‐6045 72. Wagner, S., Stenta, M., Metzger, L. C., Dal Peraro, M., and Cornelis, G. R. (2010) Length control of the injectisome needle requires only one molecule of Yop secretion protein P (YscP). Proceedings of the National Academy of Sciences of the United States of America 107, 13860-‐13865 73. Wagner, S., Sorg, I., Degiacomi, M., Journet, L., Dal Peraro, M., and Cornelis, G. R. (2009) The helical content of the YscP molecular ruler determines the length of the Yersinia injectisome. Molecular microbiology 71, 692-‐701 74. Wood, S. E., Jin, J., and Lloyd, S. A. (2008) YscP and YscU switch the substrate specificity of the Yersinia type III secretion system by regulating export of the inner rod protein YscI. Journal of Bacteriology 190, 4252-‐4262 75. Deng, W., Li, Y., Hardwidge, P. R., Frey, E. A., Pfuetzner, R. A., Lee, S., Gruenheid, S., Strynakda, N. C., Puente, J. L., and Finlay, B. B. (2005) Regulation of type III secretion hierarchy of translocators and effectors in attaching and effacing bacterial pathogens. Infection and immunity 73, 2135-‐2146 76. Botteaux, A., Sory, M. P., Biskri, L., Parsot, C., and Allaoui, A. (2009) MxiC is secreted by and controls the substrate specificity of the Shigella flexneri type III secretion apparatus. Molecular microbiology 71, 449-‐460 77. Cherradi, Y., Schiavolin, L., Moussa, S., Meghraoui, A., Meksem, A., Biskri, L., Azarkan, M., Allaoui, A., and Botteaux, A. (2013) Interplay between predicted 124 inner-‐rod and gatekeeper in controlling substrate specificity of the type III secretion system. Molecular microbiology 87, 1183-‐1199 78. Pallen, M. J., Beatson, S. A., and Bailey, C. M. (2005) Bioinformatics analysis of the locus for enterocyte effacement provides novel insights into type-‐III secretion. BMC microbiology 5, 9 79. O'Connell, C. B., Creasey, E. A., Knutton, S., Elliott, S., Crowther, L. J., Luo, W., Albert, M. J., Kaper, J. B., Frankel, G., and Donnenberg, M. S. (2004) SepL, a protein required for enteropathogenic Escherichia coli type III translocation, interacts with secretion component SepD. Molecular microbiology 52, 1613-‐1625 80. Martinez-‐Argudo, I., and Blocker, A. J. (2010) The Shigella T3SS needle transmits a signal for MxiC release, which controls secretion of effectors. Molecular microbiology 78, 1365-‐1378 81. Kresse, A. U., Beltrametti, F., Muller, A., Ebel, F., and Guzman, C. A. (2000) Characterization of SepL of enterohemorrhagic Escherichia coli. Journal of Bacteriology 182, 6490-‐6498 82. Kubori, T., and Galan, J. E. (2002) Salmonella type III secretion-‐associated protein InvE controls translocation of effector proteins into host cells. Journal of Bacteriology 184, 4699-‐4708 83. Akeda, Y., and Galan, J. E. (2005) Chaperone release and unfolding of substrates in type III secretion. Nature 437, 911-‐915 84. Letzelter, M., Sorg, I., Mota, L. J., Meyer, S., Stalder, J., Feldman, M., Kuhn, M., Callebaut, I., and Cornelis, G. R. (2006) The discovery of SycO highlights a new function for type III secretion effector chaperones. The EMBO journal 25, 3223-‐3233 85. Thomas, N. A., Ma, I., Prasad, M. E., and Rafuse, C. (2012) Expanded roles for multicargo and class 1B effector chaperones in type III secretion. Journal of Bacteriology 194, 3767-‐3773 86. Stebbins, C. E., and Galan, J. E. (2001) Maintenance of an unfolded polypeptide by a cognate chaperone in bacterial type III secretion. Nature 414, 77-‐81 87. Luo, Y., Bertero, M. G., Frey, E. A., Pfuetzner, R. A., Wenk, M. R., Creagh, L., Marcus, S. L., Lim, D., Sicheri, F., Kay, C., Haynes, C., Finlay, B. B., and Strynadka, N. C. (2001) Structural and biochemical characterization of the type III secretion chaperones CesT and SigE. Nature structural biology 8, 1031-‐1036 88. Lilic, M., Vujanac, M., and Stebbins, C. E. (2006) A common structural motif in the binding of virulence factors to bacterial secretion chaperones. Molecular cell 21, 653-‐664 89. Phan, J., Tropea, J. E., and Waugh, D. S. (2004) Structure of the Yersinia pestis type III secretion chaperone SycH in complex with a stable fragment of YscM2. Acta crystallographica.Section D, Biological crystallography 60, 1591-‐1599 90. Vujanac, M., and Stebbins, C. E. (2013) Context-‐dependent protein folding of a virulence peptide in the bacterial and host environments: structure of an SycH-‐YopH chaperone-‐effector complex. Acta crystallographica.Section D, Biological crystallography 69, 546-‐554 91. Birtalan, S., and Ghosh, P. (2001) Structure of the Yersinia type III secretory system chaperone SycE. Nature structural biology 8, 974-‐978 125 92. Barta, M. L., Zhang, L., Picking, W. L., and Geisbrecht, B. V. (2010) Evidence for alternative quaternary structure in a bacterial Type III secretion system chaperone. BMC structural biology 10, 21-‐6807-‐6810-‐6821 93. Lokareddy, R. K., Lunelli, M., Eilers, B., Wolter, V., and Kolbe, M. (2010) Combination of two separate binding domains defines stoichiometry between type III secretion system chaperone IpgC and translocator protein IpaB. The Journal of biological chemistry 285, 39965-‐39975 94. Buttner, C. R., Sorg, I., Cornelis, G. R., Heinz, D. W., and Niemann, H. H. (2008) Structure of the Yersinia enterocolitica type III secretion translocator chaperone SycD. Journal of Molecular Biology 375, 997-‐1012 95. van Eerde, A., Hamiaux, C., Perez, J., Parsot, C., and Dijkstra, B. W. (2004) Structure of Spa15, a type III secretion chaperone from Shigella flexneri with broad specificity. EMBO reports 5, 477-‐483 96. Evdokimov, A. G., Tropea, J. E., Routzahn, K. M., and Waugh, D. S. (2002) Three-‐dimensional structure of the type III secretion chaperone SycE from Yersinia pestis. Acta crystallographica.Section D, Biological crystallography 58, 398-‐406 97. Trame, C. B., and McKay, D. B. (2003) Structure of the Yersinia enterocolitica molecular-‐chaperone protein SycE. Acta crystallographica.Section D, Biological crystallography 59, 389-‐392 98. Buttner, C. R., Cornelis, G. R., Heinz, D. W., and Niemann, H. H. (2005) Crystal structure of Yersinia enterocolitica type III secretion chaperone SycT. Protein science : a publication of the Protein Society 14, 1993-‐2002 99. Locher, M., Lehnert, B., Krauss, K., Heesemann, J., Groll, M., and Wilharm, G. (2005) Crystal structure of the Yersinia enterocolitica type III secretion chaperone SycT. The Journal of biological chemistry 280, 31149-‐31155 100. Gendrin, C., Contreras-‐Martel, C., Bouillot, S., Elsen, S., Lemaire, D., Skoufias, D. A., Huber, P., Attree, I., and Dessen, A. (2012) Structural basis of cytotoxicity mediated by the type III secretion toxin ExoU from Pseudomonas aeruginosa. PLoS pathogens 8, e1002637 101. Halavaty, A. S., Borek, D., Tyson, G. H., Veesenmeyer, J. L., Shuvalova, L., Minasov, G., Otwinowski, Z., Hauser, A. R., and Anderson, W. F. (2012) Structure of the type III secretion effector protein ExoU in complex with its chaperone SpcU. PloS one 7, e49388 102. Birtalan, S. C., Phillips, R. M., and Ghosh, P. (2002) Three-‐dimensional secretion signals in chaperone-‐effector complexes of bacterial pathogens. Molecular cell 9, 971-‐980 103. Smith, C. L., and Hultgren, S. J. (2001) Bacteria thread the needle. Nature 414, 29, 31 104. Button, J. E., and Galan, J. E. (2011) Regulation of chaperone/effector complex synthesis in a bacterial type III secretion system. Molecular microbiology 81, 1474-‐1483 105. Bronstein, P. A., Miao, E. A., and Miller, S. I. (2000) InvB is a type III secretion chaperone specific for SspA. Journal of Bacteriology 182, 6638-‐6644 106. Lee, S. H., and Galan, J. E. (2003) InvB is a type III secretion-‐associated chaperone for the Salmonella enterica effector protein SopE. Journal of Bacteriology 185, 7279-‐7284 126 107. Ehrbar, K., Friebel, A., Miller, S. I., and Hardt, W. D. (2003) Role of the Salmonella pathogenicity island 1 (SPI-‐1) protein InvB in type III secretion of SopE and SopE2, two Salmonella effector proteins encoded outside of SPI-‐1. Journal of Bacteriology 185, 6950-‐6967 108. Ehrbar, K., Hapfelmeier, S., Stecher, B., and Hardt, W. D. (2004) InvB is required for type III-‐dependent secretion of SopA in Salmonella enterica serovar Typhimurium. Journal of Bacteriology 186, 1215-‐1219 109. Costa, S. C., Schmitz, A. M., Jahufar, F. F., Boyd, J. D., Cho, M. Y., Glicksman, M. A., and Lesser, C. F. (2012) A new means to identify type 3 secreted effectors: functionally interchangeable class IB chaperones recognize a conserved sequence. mBio 3, 10.1128/mBio.00243-‐00211. Print 02012 110. Faudry, E., Job, V., Dessen, A., Attree, I., and Forge, V. (2007) Type III secretion system translocator has a molten globule conformation both in its free and chaperone-‐bound forms. The FEBS journal 274, 3601-‐3610 111. Chatterjee, C., Kumar, S., Chakraborty, S., Tan, Y. W., Leung, K. Y., Sivaraman, J., and Mok, Y. K. (2011) Crystal structure of the heteromolecular chaperone, AscE-‐AscG, from the type III secretion system in Aeromonas hydrophila. PloS one 6, e19208 112. Ferris, H. U., Furukawa, Y., Minamino, T., Kroetz, M. B., Kihara, M., Namba, K., and Macnab, R. M. (2005) FlhB regulates ordered export of flagellar components via autocleavage mechanism. The Journal of biological chemistry 280, 41236-‐41242 113. Meshcheryakov, V. A., Kitao, A., Matsunami, H., and Samatey, F. A. (2013) Inhibition of a type III secretion system by the deletion of a short loop in one of its membrane proteins. Acta crystallographica.Section D, Biological crystallography 69, 812-‐820 114. Sorg, I., Wagner, S., Amstutz, M., Muller, S. A., Broz, P., Lussi, Y., Engel, A., and Cornelis, G. R. (2007) YscU recognizes translocators as export substrates of the Yersinia injectisome. The EMBO journal 26, 3015-‐3024 115. Thomassin, J.-‐L., He, X., and Thomas, N. (2011) Role of EscU auto-‐cleavage in promoting type III effector translocation into host cells by Enteropathogenic Escherichia coli. BMC Microbiology 11, 205 116. Sal-‐Man, N., Deng, W., and Finlay, B. B. (2012) EscI: a crucial component of the type III secretion system forms the inner rod structure in enteropathogenic Escherichia coli. Biochem J 442, 119-‐125 117. Moore, S. A., and Jia, Y. (2010) Structure of the cytoplasmic domain of the flagellar secretion apparatus component FlhA from Helicobacter pylori. The Journal of biological chemistry 285, 21060-‐21069 118. Saijo-‐Hamano, Y., Imada, K., Minamino, T., Kihara, M., Shimada, M., Kitao, A., and Namba, K. (2010) Structure of the cytoplasmic domain of FlhA and implication for flagellar type III protein export. Molecular microbiology 76, 260-‐268 119. Bange, G., Kummerer, N., Engel, C., Bozkurt, G., Wild, K., and Sinning, I. (2010) FlhA provides the adaptor for coordinated delivery of late flagella building blocks to the type III secretion system. Proceedings of the National Academy of Sciences of the United States of America 107, 11295-‐11300 127 120. Imada, K., Minamino, T., Tahara, A., and Namba, K. (2007) Structural similarity between the flagellar type III ATPase FliI and F1-‐ATPase subunits. Proceedings of the National Academy of Sciences of the United States of America 104, 485-‐490 121. Akeda, Y., and Galan, J. E. (2004) Genetic analysis of the Salmonella enterica type III secretion-‐associated ATPase InvC defines discrete functional domains. Journal of Bacteriology 186, 2402-‐2412 122. Pozidis, C., Chalkiadaki, A., Gomez-‐Serrano, A., Stahlberg, H., Brown, I., Tampakaki, A. P., Lustig, A., Sianidis, G., Politou, A. S., Engel, A., Panopoulos, N. J., Mansfield, J., Pugsley, A. P., Karamanou, S., and Economou, A. (2003) Type III protein translocase: HrcN is a peripheral ATPase that is activated by oligomerization. The Journal of biological chemistry 278, 25816-‐25824 123. Lorenzini, E., Singer, A., Singh, B., Lam, R., Skarina, T., Chirgadze, N. Y., Savchenko, A., and Gupta, R. S. (2010) Structure and protein-‐protein interaction studies on Chlamydia trachomatis protein CT670 (YscO Homolog). Journal of Bacteriology 192, 2746-‐2756 124. Ibuki, T., Imada, K., Minamino, T., Kato, T., Miyata, T., and Namba, K. (2011) Common architecture of the flagellar type III protein export apparatus and F-‐ and V-‐type ATPases. Nature structural & molecular biology 18, 277-‐282 125. Lara-‐Tejero, M., Kato, J., Wagner, S., Liu, X., and Galan, J. E. (2011) A sorting platform determines the order of protein secretion in bacterial type III systems. Science (New York, N.Y.) 331, 1188-‐1191 126. Marlovits, T. C., Kubori, T., Sukhan, A., Thomas, D. R., Galan, J. E., and Unger, V. M. (2004) Structural insights into the assembly of the type III secretion needle complex. Science (New York, N.Y.) 306, 1040-‐1042 127. Gamez, A., Mukerjea, R., Alayyoubi, M., Ghassemian, M., and Ghosh, P. (2012) Structure and interactions of the cytoplasmic domain of the Yersinia type III secretion protein YscD. Journal of Bacteriology 194, 5949-‐5958 128. Lountos, G. T., Tropea, J. E., and Waugh, D. S. (2012) Structure of the cytoplasmic domain of Yersinia pestis YscD, an essential component of the type III secretion system. Acta crystallographica.Section D, Biological crystallography 68, 201-‐209 129. Korotkov, K. V., Gonen, T., and Hol, W. G. (2011) Secretins: dynamic channels for protein transport across membranes. Trends in biochemical sciences 36, 433-‐443 130. Izore, T., Perdu, C., Job, V., Attree, I., Faudry, E., and Dessen, A. (2011) Structural characterization and membrane localization of ExsB from the type III secretion system (T3SS) of Pseudomonas aeruginosa. Journal of Molecular Biology 413, 236-‐246 131. Sanowar, S., Singh, P., Pfuetzner, R. A., Andre, I., Zheng, H., Spreter, T., Strynadka, N. C., Gonen, T., Baker, D., Goodlett, D. R., and Miller, S. I. (2010) Interactions of the transmembrane polymeric rings of the Salmonella enterica serovar Typhimurium type III secretion system. mBio 1, 10.1128/mBio.00158-‐00110 132. Zhong, D., Lefebre, M., Kaur, K., McDowell, M. A., Gdowski, C., Jo, S., Wang, Y., Benedict, S. H., Lea, S. M., Galan, J. E., and De Guzman, R. N. (2012) The Salmonella type III secretion system inner rod protein PrgJ is partially folded. J Biol Chem 287, 25303-‐25311 128 133. Creasey, E. A., Delahay, R. M., Daniell, S. J., and Frankel, G. (2003) Yeast two-‐hybrid system survey of interactions between LEE-‐encoded proteins of enteropathogenic Escherichia coli. Microbiology 149, 2093-‐2106 134. Garcia-‐Gomez, E., Espinosa, N., de la Mora, J., Dreyfus, G., and Gonzalez-‐Pedrajo, B. (2011) The muramidase EtgA from enteropathogenic Escherichia coli is required for efficient type III secretion. Microbiology 157, 1145-‐1160 135. Koraimann, G. (2003) Lytic transglycosylases in macromolecular transport systems of Gram-‐negative bacteria. Cell Mol Life Sci 60, 2371-‐2388 136. Zahrl, D., Wagner, M., Bischof, K., Bayer, M., Zavecz, B., Beranek, A., Ruckenstuhl, C., Zarfel, G. E., and Koraimann, G. (2005) Peptidoglycan degradation by specialized lytic transglycosylases associated with type III and type IV secretion systems. Microbiology 151, 3455-‐3467 137. Deng, W., Puente, J. L., Gruenheid, S., Li, Y., Vallance, B. A., Vazquez, A., Barba, J., Ibarra, J. A., O'Donnell, P., Metalnikov, P., Ashman, K., Lee, S., Goode, D., Pawson, T., and Finlay, B. B. (2004) Dissecting virulence: systematic and functional analyses of a pathogenicity island. Proc Natl Acad Sci U S A 101, 3597-‐3602 138. Kubori, T., Sukhan, A., Aizawa, S. I., and Galan, J. E. (2000) Molecular characterization and assembly of the needle complex of the Salmonella typhimurium type III protein secretion system. Proceedings of the National Academy of Sciences of the United States of America 97, 10225-‐10230 139. Kimbrough, T. G., and Miller, S. I. (2000) Contribution of Salmonella typhimurium type III secretion components to needle complex formation. Proceedings of the National Academy of Sciences of the United States of America 97, 11008-‐11013 140. Cordes, F. S., Daniell, S., Kenjale, R., Saurya, S., Picking, W. L., Picking, W. D., Booy, F., Lea, S. M., and Blocker, A. (2005) Helical packing of needles from functionally altered Shigella type III secretion systems. Journal of Molecular Biology 354, 206-‐211 141. Galkin, V. E., Schmied, W. H., Schraidt, O., Marlovits, T. C., and Egelman, E. H. (2010) The Structure of the Salmonella typhimurium Type III Secretion System Needle Shows Divergence from the Flagellar System. Journal of Molecular Biology 142. Roehrich, A. D., Guillossou, E., Blocker, A. J., and Martinez-‐Argudo, I. (2013) Shigella IpaD has a dual role: signal transduction from the type III secretion system needle tip and intracellular secretion regulation. Molecular microbiology 87, 690-‐706 143. Veenendaal, A. K., Hodgkinson, J. L., Schwarzer, L., Stabat, D., Zenk, S. F., and Blocker, A. J. (2007) The type III secretion system needle tip complex mediates host cell sensing and translocon insertion. Molecular microbiology 63, 1719-‐1730 144. Schiavolin, L., Meghraoui, A., Cherradi, Y., Biskri, L., Botteaux, A., and Allaoui, A. (2013) Functional insights into the Shigella type III needle tip IpaD in secretion control and cell contact. Molecular microbiology 88, 268-‐282 145. Ligtenberg, K. G., Miller, N. C., Mitchell, A., Plano, G. V., and Schneewind, O. (2013) LcrV mutants that abolish Yersinia type III injectisome function. Journal of Bacteriology 195, 777-‐787 129 146. Lee, P. C., Stopford, C. M., Svenson, A. G., and Rietsch, A. (2010) Control of effector export by the Pseudomonas aeruginosa type III secretion proteins PcrG and PcrV. Molecular microbiology 75, 924-‐941 147. Costa, T. R., Edqvist, P. J., Broms, J. E., Ahlund, M. K., Forsberg, A., and Francis, M. S. (2010) YopD self-‐assembly and binding to LcrV facilitate type III secretion activity by Yersinia pseudotuberculosis. The Journal of biological chemistry 285, 25269-‐25284 148. Goure, J., Pastor, A., Faudry, E., Chabert, J., Dessen, A., and Attree, I. (2004) The V antigen of Pseudomonas aeruginosa is required for assembly of the functional PopB/PopD translocation pore in host cell membranes. Infection and immunity 72, 4741-‐4750 149. Pettersson, J., Holmstrom, A., Hill, J., Leary, S., Frithz-‐Lindsten, E., von Euler-‐Matell, A., Carlsson, E., Titball, R., Forsberg, A., and Wolf-‐Watz, H. (1999) The V-‐antigen of Yersinia is surface exposed before target cell contact and involved in virulence protein translocation. Molecular microbiology 32, 961-‐976 150. Stensrud, K. F., Adam, P. R., La Mar, C. D., Olive, A. J., Lushington, G. H., Sudharsan, R., Shelton, N. L., Givens, R. S., Picking, W. L., and Picking, W. D. (2008) Deoxycholate interacts with IpaD of Shigella flexneri in inducing the recruitment of IpaB to the type III secretion apparatus needle tip. The Journal of biological chemistry 283, 18646-‐18654 151. Sato, H., and Frank, D. W. (2011) Multi-‐Functional Characteristics of the Pseudomonas aeruginosa Type III Needle-‐Tip Protein, PcrV; Comparison to Orthologs in other Gram-‐negative Bacteria. Frontiers in microbiology 2, 142 152. Daniell, S. J., Takahashi, N., Wilson, R., Friedberg, D., Rosenshine, I., Booy, F. P., Shaw, R. K., Knutton, S., Frankel, G., and Aizawa, S. (2001) The filamentous type III secretion translocon of enteropathogenic Escherichia coli. Cell Microbiol 3, 865-‐871 153. Sekiya, K., Ohishi, M., Ogino, T., Tamano, K., Sasakawa, C., and Abe, A. (2001) Supermolecular structure of the enteropathogenic Escherichia coli type III secretion system and its direct interaction with the EspA-‐sheath-‐like structure. Proceedings of the National Academy of Sciences of the United States of America 98, 11638-‐11643 154. Daniell, S. J., Kocsis, E., Morris, E., Knutton, S., Booy, F. P., and Frankel, G. (2003) 3D structure of EspA filaments from enteropathogenic Escherichia coli. Molecular microbiology 49, 301-‐308 155. Wang, Y. A., Yu, X., Yip, C., Strynadka, N. C., and Egelman, E. H. (2006) Structural polymorphism in bacterial EspA filaments revealed by cryo-‐EM and an improved approach to helical reconstruction. Structure 14, 1189-‐1196 156. Medhekar, B., Shrivastava, R., Mattoo, S., Gingery, M., and Miller, J. F. (2009) Bordetella Bsp22 forms a filamentous type III secretion system tip complex and is immunoprotective in vitro and in vivo. Molecular microbiology 71, 492-‐504 157. Chaudhury, S., Battaile, K. P., Lovell, S., Plano, G. V., and De Guzman, R. N. (2013) Structure of the Yersinia pestis tip protein LcrV refined to 1.65 A resolution. Acta crystallographica.Section F, Structural biology and crystallization communications 69, 477-‐481 130 158. Mueller, C. A., Broz, P., Muller, S. A., Ringler, P., Erne-‐Brand, F., Sorg, I., Kuhn, M., Engel, A., and Cornelis, G. R. (2005) The V-‐antigen of Yersinia forms a distinct structure at the tip of injectisome needles. Science (New York, N.Y.) 310, 674-‐676 159. Broz, P., Mueller, C. A., Muller, S. A., Philippsen, A., Sorg, I., Engel, A., and Cornelis, G. R. (2007) Function and molecular architecture of the Yersinia injectisome tip complex. Molecular microbiology 65, 1311-‐1320 160. Erskine, P. T., Knight, M. J., Ruaux, A., Mikolajek, H., Wong Fat Sang, N., Withers, J., Gill, R., Wood, S. P., Wood, M., Fox, G. C., and Cooper, J. B. (2006) High resolution structure of BipD: an invasion protein associated with the type III secretion system of Burkholderia pseudomallei. Journal of Molecular Biology 363, 125-‐136 161. Pal, M., Erskine, P. T., Gill, R. S., Wood, S. P., and Cooper, J. B. (2010) Near-‐atomic resolution analysis of BipD, a component of the type III secretion system of Burkholderia pseudomallei. Acta crystallographica.Section F, Structural biology and crystallization communications 66, 990-‐993 162. Epler, C. R., Dickenson, N. E., Bullitt, E., and Picking, W. L. (2012) Ultrastructural analysis of IpaD at the tip of the nascent MxiH type III secretion apparatus of Shigella flexneri. Journal of Molecular Biology 420, 29-‐39 163. Zhang, L., Wang, Y., Olive, A. J., Smith, N. D., Picking, W. D., De Guzman, R. N., and Picking, W. L. (2007) Identification of the MxiH needle protein residues responsible for anchoring invasion plasmid antigen D to the type III secretion needle tip. The Journal of biological chemistry 282, 32144-‐32151 164. Rathinavelan, T., Tang, C., and De Guzman, R. N. (2011) Characterization of the interaction between the Salmonella type III secretion system tip protein SipD and the needle protein PrgI by paramagnetic relaxation enhancement. The Journal of biological chemistry 286, 4922-‐4930 165. Sani, M., Botteaux, A., Parsot, C., Sansonetti, P., Boekema, E. J., and Allaoui, A. (2007) IpaD is localized at the tip of the Shigella flexneri type III secretion apparatus. Biochimica et biophysica acta 1770, 307-‐311 166. Loquet, A., Habenstein, B., and Lange, A. (2013) Structural Investigations of Molecular Machines by Solid-‐State NMR. Accounts of Chemical Research 167. Olive, A. J., Kenjale, R., Espina, M., Moore, D. S., Picking, W. L., and Picking, W. D. (2007) Bile salts stimulate recruitment of IpaB to the Shigella flexneri surface, where it colocalizes with IpaD at the tip of the type III secretion needle. Infection and immunity 75, 2626-‐2629 168. Prouty, A. M., and Gunn, J. S. (2000) Salmonella enterica serovar typhimurium invasion is repressed in the presence of bile. Infection and immunity 68, 6763-‐6769 169. Dickenson, N. E., Zhang, L., Epler, C. R., Adam, P. R., Picking, W. L., and Picking, W. D. (2011) Conformational changes in IpaD from Shigella flexneri upon binding bile salts provide insight into the second step of type III secretion. Biochemistry 50, 172-‐180 170. Wang, Y., Nordhues, B. A., Zhong, D., and De Guzman, R. N. (2010) NMR characterization of the interaction of the Salmonella type III secretion system protein SipD and bile salts. Biochemistry 49, 4220-‐4226 131 171. Schoehn, G., Di Guilmi, A. M., Lemaire, D., Attree, I., Weissenhorn, W., and Dessen, A. (2003) Oligomerization of type III secretion proteins PopB and PopD precedes pore formation in Pseudomonas. The EMBO journal 22, 4957-‐4967 172. Blocker, A., Gounon, P., Larquet, E., Niebuhr, K., Cabiaux, V., Parsot, C., and Sansonetti, P. (1999) The tripartite type III secreton of Shigella flexneri inserts IpaB and IpaC into host membranes. The Journal of cell biology 147, 683-‐693 173. Hakansson, S., Schesser, K., Persson, C., Galyov, E. E., Rosqvist, R., Homble, F., and Wolf-‐Watz, H. (1996) The YopB protein of Yersinia pseudotuberculosis is essential for the translocation of Yop effector proteins across the target cell plasma membrane and displays a contact-‐dependent membrane disrupting activity. The EMBO journal 15, 5812-‐5823 174. Miki, T., Okada, N., Shimada, Y., and Danbara, H. (2004) Characterization of Salmonella pathogenicity island 1 type III secretion-‐dependent hemolytic activity in Salmonella enterica serovar Typhimurium. Microbial pathogenesis 37, 65-‐72 175. Ide, T., Laarmann, S., Greune, L., Schillers, H., Oberleithner, H., and Schmidt, M. A. (2001) Characterization of translocation pores inserted into plasma membranes by type III-‐secreted Esp proteins of enteropathogenic Escherichia coli. Cellular microbiology 3, 669-‐679 176. Mattei, P. J., Faudry, E., Job, V., Izore, T., Attree, I., and Dessen, A. (2011) Membrane targeting and pore formation by the type III secretion system translocon. The FEBS journal 278, 414-‐426 177. Dohlich, K., Zumsteg, A. B., Goosmann, C., and Kolbe, M. (2014) A Substrate-‐Fusion Protein Is Trapped inside the Type III Secretion System Channel in Shigella flexneri. PLoS pathogens 10, e1003881 178. Akopyan, K., Edgren, T., Wang-‐Edgren, H., Rosqvist, R., Fahlgren, A., Wolf-‐Watz, H., and Fallman, M. (2011) Translocation of surface-‐localized effectors in type III secretion. Proceedings of the National Academy of Sciences of the United States of America 108, 1639-‐1644 179. Edgren, T., Forsberg, A., Rosqvist, R., and Wolf-‐Watz, H. (2012) Type III secretion in Yersinia: injectisome or not? PLoS pathogens 8, e1002669 180. Galan, J. E. (2009) Common themes in the design and function of bacterial effectors. Cell host & microbe 5, 571-‐579 181. Lilic, M., Galkin, V. E., Orlova, A., VanLoock, M. S., Egelman, E. H., and Stebbins, C. E. (2003) Salmonella SipA polymerizes actin by stapling filaments with nonglobular protein arms. Science (New York, N.Y.) 301, 1918-‐1921 182. Lin, D. Y., Diao, J., and Chen, J. (2012) Crystal structures of two bacterial HECT-‐like E3 ligases in complex with a human E2 reveal atomic details of pathogen-‐host interactions. Proceedings of the National Academy of Sciences of the United States of America 109, 1925-‐1930 183. Diao, J., Zhang, Y., Huibregtse, J. M., Zhou, D., and Chen, J. (2008) Crystal structure of SopA, a Salmonella effector protein mimicking a eukaryotic ubiquitin ligase. Nature structural & molecular biology 15, 65-‐70 184. Burkinshaw, B. J., Prehna, G., Worrall, L. J., and Strynadka, N. C. (2012) Structure of Salmonella effector protein SopB N-‐terminal domain in complex with host Rho GTPase Cdc42. J Biol Chem 287, 13348-‐13355 132 185. Buchwald, G., Friebel, A., Galan, J. E., Hardt, W. D., Wittinghofer, A., and Scheffzek, K. (2002) Structural basis for the reversible activation of a Rho protein by the bacterial toxin SopE. The EMBO journal 21, 3286-‐3295 186. Williams, C., Galyov, E. E., and Bagby, S. (2004) solution structure, backbone dynamics, and interaction with Cdc42 of Salmonella guanine nucleotide exchange factor SopE2. Biochemistry 43, 11998-‐12008 187. Stebbins, C. E., and Galan, J. E. (2000) Modulation of host signaling by a bacterial mimic: structure of the Salmonella effector SptP bound to Rac1. Molecular cell 6, 1449-‐1460 188. Diacovich, L., Dumont, A., Lafitte, D., Soprano, E., Guilhon, A. A., Bignon, C., Gorvel, J. P., Bourne, Y., and Meresse, S. (2009) Interaction between the SifA virulence factor and its host target SKIP is essential for Salmonella pathogenesis. The Journal of biological chemistry 284, 33151-‐33160 189. Ohlson, M. B., Huang, Z., Alto, N. M., Blanc, M. P., Dixon, J. E., Chai, J., and Miller, S. I. (2008) Structure and function of Salmonella SifA indicate that its interactions with SKIP, SseJ, and RhoA family GTPases induce endosomal tubulation. Cell host & microbe 4, 434-‐446 190. Bhaskaran, S. S., and Stebbins, C. E. (2012) Structure of the catalytic domain of the Salmonella virulence factor SseI. Acta crystallographica.Section D, Biological crystallography 68, 1613-‐1621 191. Quezada, C. M., Hicks, S. W., Galan, J. E., and Stebbins, C. E. (2009) A family of Salmonella virulence factors functions as a distinct class of autoregulated E3 ubiquitin ligases. Proceedings of the National Academy of Sciences of the United States of America 106, 4864-‐4869 192. Margarit, S. M., Davidson, W., Frego, L., and Stebbins, C. E. (2006) A steric antagonism of actin polymerization by a salmonella virulence protein. Structure (London, England : 1993) 14, 1219-‐1229 193. Zhu, Y., Li, H., Long, C., Hu, L., Xu, H., Liu, L., Chen, S., Wang, D. C., and Shao, F. (2007) Structural insights into the enzymatic mechanism of the pathogenic MAPK phosphothreonine lyase. Molecular cell 28, 899-‐913 194. Chen, L., Wang, H., Zhang, J., Gu, L., Huang, N., Zhou, J. M., and Chai, J. (2008) Structural basis for the catalytic mechanism of phosphothreonine lyase. Nature structural & molecular biology 15, 101-‐102 195. Bishop, A. L., and Hall, A. (2000) Rho GTPases and their effector proteins. The Biochemical journal 348 Pt 2, 241-‐255 196. Vetter, I. R., and Wittinghofer, A. (2001) The guanine nucleotide-‐binding switch in three dimensions. Science (New York, N.Y.) 294, 1299-‐1304 197. Hardt, W. D., Chen, L. M., Schuebel, K. E., Bustelo, X. R., and Galan, J. E. (1998) S. typhimurium encodes an activator of Rho GTPases that induces membrane ruffling and nuclear responses in host cells. Cell 93, 815-‐826 198. Stender, S., Friebel, A., Linder, S., Rohde, M., Mirold, S., and Hardt, W. D. (2000) Identification of SopE2 from Salmonella typhimurium, a conserved guanine nucleotide exchange factor for Cdc42 of the host cell. Molecular microbiology 36, 1206-‐1221 199. Rudolph, M. G., Weise, C., Mirold, S., Hillenbrand, B., Bader, B., Wittinghofer, A., and Hardt, W. D. (1999) Biochemical analysis of SopE from Salmonella 133 typhimurium, a highly efficient guanosine nucleotide exchange factor for RhoGTPases. The Journal of biological chemistry 274, 30501-‐30509 200. Alto, N. M., Shao, F., Lazar, C. S., Brost, R. L., Chua, G., Mattoo, S., McMahon, S. A., Ghosh, P., Hughes, T. R., Boone, C., and Dixon, J. E. (2006) Identification of a bacterial type III effector family with G protein mimicry functions. Cell 124, 133-‐145 201. Jackson, S. P., and Durocher, D. (2013) Regulation of DNA damage responses by ubiquitin and SUMO. Molecular cell 49, 795-‐807 202. Raiborg, C., and Stenmark, H. (2009) The ESCRT machinery in endosomal sorting of ubiquitylated membrane proteins. Nature 458, 445-‐452 203. Mocciaro, A., and Rape, M. (2012) Emerging regulatory mechanisms in ubiquitin-‐dependent cell cycle control. Journal of cell science 125, 255-‐263 204. Hicks, S. W., and Galan, J. E. (2010) Hijacking the host ubiquitin pathway: structural strategies of bacterial E3 ubiquitin ligases. Current opinion in microbiology 13, 41-‐46 205. Capili, A. D., and Lima, C. D. (2007) Taking it step by step: mechanistic insights from structural studies of ubiquitin/ubiquitin-‐like protein modification pathways. Current opinion in structural biology 17, 726-‐735 206. Zhang, Y., Higashide, W. M., McCormick, B. A., Chen, J., and Zhou, D. (2006) The inflammation-‐associated Salmonella SopA is a HECT-‐like E3 ubiquitin ligase. Molecular microbiology 62, 786-‐793 207. Rohde, J. R., Breitkreutz, A., Chenal, A., Sansonetti, P. J., and Parsot, C. (2007) Type III secretion effectors of the IpaH family are E3 ubiquitin ligases. Cell host & microbe 1, 77-‐83 208. Zhou, D., Mooseker, M. S., and Galan, J. E. (1999) Role of the S. typhimurium actin-‐binding protein SipA in bacterial internalization. Science (New York, N.Y.) 283, 2092-‐2095 209. Galkin, V. E., Orlova, A., VanLoock, M. S., Zhou, D., Galan, J. E., and Egelman, E. H. (2002) The bacterial protein SipA polymerizes G-‐actin and mimics muscle nebulin. Nature structural biology 9, 518-‐521 210. Lesnick, M. L., Reiner, N. E., Fierer, J., and Guiney, D. G. (2001) The Salmonella spvB virulence gene encodes an enzyme that ADP-‐ribosylates actin and destabilizes the cytoskeleton of eukaryotic cells. Molecular microbiology 39, 1464-‐1470 211. Tezcan-‐Merdol, D., Engstrand, L., and Rhen, M. (2005) Salmonella enterica SpvB-‐mediated ADP-‐ribosylation as an activator for host cell actin degradation. International journal of medical microbiology : IJMM 295, 201-‐212 212. Stein, M. A., Leung, K. Y., Zwick, M., Garcia-‐del Portillo, F., and Finlay, B. B. (1996) Identification of a Salmonella virulence gene required for formation of filamentous structures containing lysosomal membrane glycoproteins within epithelial cells. Molecular microbiology 20, 151-‐164 213. Brumell, J. H., Goosney, D. L., and Finlay, B. B. (2002) SifA, a type III secreted effector of Salmonella typhimurium, directs Salmonella-‐induced filament (Sif) formation along microtubules. Traffic (Copenhagen, Denmark) 3, 407-‐415 214. Bryce, J., Boschi-‐Pinto, C., Shibuya, K., Black, R. E., and Group, W. H. O. C. H. E. R. (2005) WHO estimates of the causes of death in children. Lancet 365, 1147-‐1152 134 215. Lanata, C. F., Fischer-‐Walker, C. L., Olascoaga, A. C., Torres, C. X., Aryee, M. J., Black, R. E., Child Health Epidemiology Reference Group of the World Health, O., and Unicef. (2013) Global causes of diarrheal disease mortality in children <5 years of age: a systematic review. PloS one 8, e72788 216. Jerse, A. E., Yu, J., Tall, B. D., and Kaper, J. B. (1990) A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proceedings of the National Academy of Sciences of the United States of America 87, 7839-‐7843 217. Moon, H. W., Whipp, S. C., Argenzio, R. A., Levine, M. M., and Giannella, R. A. (1983) Attaching and effacing activities of rabbit and human enteropathogenic Escherichia coli in pig and rabbit intestines. Infection and immunity 41, 1340-‐1351 218. Rosenshine, I., Ruschkowski, S., Stein, M., Reinscheid, D. J., Mills, S. D., and Finlay, B. B. (1996) A pathogenic bacterium triggers epithelial signals to form a functional bacterial receptor that mediates actin pseudopod formation. The EMBO journal 15, 2613-‐2624 219. Taylor, C. J., Hart, A., Batt, R. M., McDougall, C., and McLean, L. (1986) Ultrastructural and biochemical changes in human jejunal mucosa associated with enteropathogenic Escherichia coli (0111) infection. Journal of pediatric gastroenterology and nutrition 5, 70-‐73 220. Wong, A. R., Pearson, J. S., Bright, M. D., Munera, D., Robinson, K. S., Lee, S. F., Frankel, G., and Hartland, E. L. (2011) Enteropathogenic and enterohaemorrhagic Escherichia coli: even more subversive elements. Mol Microbiol 80, 1420-‐1438 221. Schraidt, O., and Marlovits, T. C. (2011) Three-‐dimensional model of Salmonella's needle complex at subnanometer resolution. Science 331, 1192-‐1195 222. Knutton, S., Rosenshine, I., Pallen, M. J., Nisan, I., Neves, B. C., Bain, C., Wolff, C., Dougan, G., and Frankel, G. (1998) A novel EspA-‐associated surface organelle of enteropathogenic Escherichia coli involved in protein translocation into epithelial cells. The EMBO journal 17, 2166-‐2176 223. Dijkstra, A. J., and Keck, W. (1996) Peptidoglycan as a barrier to transenvelope transport. Journal of bacteriology 178, 5555-‐5562 224. Scheurwater, E., Reid, C. W., and Clarke, A. J. (2008) Lytic transglycosylases: bacterial space-‐making autolysins. Int J Biochem Cell Biol 40, 586-‐591 225. Scheurwater, E. M., and Burrows, L. L. (2011) Maintaining network security: how macromolecular structures cross the peptidoglycan layer. FEMS microbiology letters 318, 1-‐9 226. Demchick, P., and Koch, A. L. (1996) The permeability of the wall fabric of Escherichia coli and Bacillus subtilis. J Bacteriol 178, 768-‐773 227. Meroueh, S. O., Bencze, K. Z., Hesek, D., Lee, M., Fisher, J. F., Stemmler, T. L., and Mobashery, S. (2006) Three-‐dimensional structure of the bacterial cell wall peptidoglycan. Proc Natl Acad Sci U S A 103, 4404-‐4409 228. Uehara, T., Suefuji, K., Valbuena, N., Meehan, B., Donegan, M., and Park, J. T. (2005) Recycling of the anhydro-‐N-‐acetylmuramic acid derived from cell wall murein involves a two-‐step conversion to N-‐acetylglucosamine-‐phosphate. Journal of bacteriology 187, 3643-‐3649 135 229. Allaoui, A., Menard, R., Sansonetti, P. J., and Parsot, C. (1993) Characterization of the Shigella flexneri ipgD and ipgF genes, which are located in the proximal part of the mxi locus. Infect Immun 61, 1707-‐1714 230. Vollmer, W., Joris, B., Charlier, P., and Foster, S. (2008) Bacterial peptidoglycan (murein) hydrolases. FEMS microbiology reviews 32, 259-‐286 231. Thunnissen, A. M., Dijkstra, A. J., Kalk, K. H., Rozeboom, H. J., Engel, H., Keck, W., and Dijkstra, B. W. (1994) Doughnut-‐shaped structure of a bacterial muramidase revealed by X-‐ray crystallography. Nature 367, 750-‐753 232. Thunnissen, A. M., Rozeboom, H. J., Kalk, K. H., and Dijkstra, B. W. (1995) Structure of the 70-‐kDa soluble lytic transglycosylase complexed with bulgecin A. Implications for the enzymatic mechanism. Biochemistry 34, 12729-‐12737 233. van Asselt, E. J., Thunnissen, A. M., and Dijkstra, B. W. (1999) High resolution crystal structures of the Escherichia coli lytic transglycosylase Slt70 and its complex with a peptidoglycan fragment. Journal of molecular biology 291, 877-‐898 234. Yu, Y. C., Lin, C. N., Wang, S. H., Ng, S. C., Hu, W. S., and Syu, W. J. (2010) A putative lytic transglycosylase tightly regulated and critical for the EHEC type three secretion. J Biomed Sci 17, 52 235. Hoppner, C., Carle, A., Sivanesan, D., Hoeppner, S., and Baron, C. (2005) The putative lytic transglycosylase VirB1 from Brucella suis interacts with the type IV secretion system core components VirB8, VirB9 and VirB11. Microbiology 151, 3469-‐3482 236. Hirano, T., Minamino, T., and Macnab, R. M. (2001) The role in flagellar rod assembly of the N-‐terminal domain of Salmonella FlgJ, a flagellum-‐specific muramidase. Journal of molecular biology 312, 359-‐369 237. . 238. Blackburn, N. T., and Clarke, A. J. (2002) Characterization of soluble and membrane-‐bound family 3 lytic transglycosylases from Pseudomonas aeruginosa. Biochemistry 41, 1001-‐1013 239. Baron, C., and Coombes, B. (2007) Targeting bacterial secretion systems: benefits of disarmament in the microcosm. Infectious disorders drug targets 7, 19-‐27 240. Dong, A., Xu, X., Edwards, A. M., Chang, C., Chruszcz, M., Cuff, M., Cymborowski, M., Di Leo, R., Egorova, O., Evdokimova, E., Filippova, E., Gu, J., Guthrie, J., Ignatchenko, A., Joachimiak, A., Klostermann, N., Kim, Y., Korniyenko, Y., Minor, W., Que, Q., Savchenko, A., Skarina, T., Tan, K., Yakunin, A., Yee, A., Yim, V., Zhang, R., Zheng, H., Akutsu, M., Arrowsmith, C., Avvakumov, G. V., Bochkarev, A., Dahlgren, L. G., Dhe-‐Paganon, S., Dimov, S., Dombrovski, L., Finerty, P., Flodin, S., Flores, A., Gräslund, S., Hammerström, M., Herman, M. D., Hong, B. S., Hui, R., Johansson, I., Liu, Y., Nilsson, M., Nedyalkova, L., Nordlund, P., Nyman, T., Min, J., Ouyang, H., Park, H. W., Qi, C., Rabeh, W., Shen, L., Shen, Y., Sukumard, D., Tempel, W., Tong, Y., Tresagues, L., Vedadi, M., Walker, J. R., Weigelt, J., Welin, M., Wu, H., Xiao, T., Zeng, H., Zhu, H., Genomics, M. C. f. S., and Consortium, S. G. (2007) In situ proteolysis for protein crystallization and structure determination. Nat Methods 4, 1019-‐1021 241. Winter, G., Lobley, C. M., and Prince, S. M. (2013) Decision making in xia2. Acta Crystallogr D Biol Crystallogr 69, 1260-‐1273 136 242. Vonrhein, C., Blanc, E., Roversi, P., and Bricogne, G. (2007) Automated structure solution with autoSHARP. Methods Mol Biol 364, 215-‐230 243. Joosten, R. P., Long, F., Murshudov, G. N., and Perrakis, A. (2014) The PDB_REDO server for macromolecular structure model optimization. IUCrJ 1, 213-‐220 244. Emsley, P., Lohkamp, B., Scott, W. G., and Cowtan, K. (2010) Features and development of Coot. Acta Crystallogr D Biol Crystallogr 66, 486-‐501 245. Winn, M. D., Ballard, C. C., Cowtan, K. D., Dodson, E. J., Emsley, P., Evans, P. R., Keegan, R. M., Krissinel, E. B., Leslie, A. G., McCoy, A., McNicholas, S. J., Murshudov, G. N., Pannu, N. S., Potterton, E. A., Powell, H. R., Read, R. J., Vagin, A., and Wilson, K. S. (2011) Overview of the CCP4 suite and current developments. Acta Crystallogr D Biol Crystallogr 67, 235-‐242 246. Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Refinement of macromolecular structures by the maximum-‐likelihood method. Acta Crystallogr D Biol Crystallogr 53, 240-‐255 247. Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M., Meng, E. C., and Ferrin, T. E. (2004) UCSF Chimera-‐-‐a visualization system for exploratory research and analysis. J Comput Chem 25, 1605-‐1612 248. Donnenberg, M. S., and Kaper, J. B. (1991) Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-‐selection suicide vector. Infect Immun 59, 4310-‐4317 249. Vedadi, M., Niesen, F. H., Allali-‐Hassani, A., Fedorov, O. Y., Finerty, P. J., Jr., Wasney, G. A., Yeung, R., Arrowsmith, C., Ball, L. J., Berglund, H., Hui, R., Marsden, B. D., Nordlund, P., Sundstrom, M., Weigelt, J., and Edwards, A. M. (2006) Chemical screening methods to identify ligands that promote protein stability, protein crystallization, and structure determination. Proceedings of the National Academy of Sciences of the United States of America 103, 15835-‐15840 250. Strynadka, N. C., and James, M. N. (1991) Lysozyme revisited: crystallographic evidence for distortion of an N-‐acetylmuramic acid residue bound in site D. J Mol Biol 220, 401-‐424 251. Vocadlo, D. J., Davies, G. J., Laine, R., and Withers, S. G. (2001) Catalysis by hen egg-‐white lysozyme proceeds via a covalent intermediate. Nature 412, 835-‐838 252. Hashimoto, W., Ochiai, A., Momma, K., Itoh, T., Mikami, B., Maruyama, Y., and Murata, K. (2009) Crystal structure of the glycosidase family 73 peptidoglycan hydrolase FlgJ. Biochem Biophys Res Commun 381, 16-‐21 253. Kelly, J. A., Sielecki, A. R., Sykes, B. D., James, M. N., and Phillips, D. C. (1979) X-‐ray crystallography of the binding of the bacterial cell wall trisaccharide NAM-‐NAG-‐NAM to lysozyme. Nature 282, 875-‐878 254. Fibriansah, G., Gliubich, F. I., and Thunnissen, A. M. (2012) On the mechanism of peptidoglycan binding and cleavage by the endo-‐specific lytic transglycosylase MltE from Escherichia coli. Biochemistry 51, 9164-‐9177 255. Herlihey, F. A., Moynihan, P. J., and Clarke, A. J. (2014) The essential protein for bacterial flagella formation FlgJ functions as a β-‐N-‐acetylglucosaminidase. J Biol Chem 256. Roure, S., Bonis, M., Chaput, C., Ecobichon, C., Mattox, A., Barrière, C., Geldmacher, N., Guadagnini, S., Schmitt, C., Prévost, M. C., Labigne, A., Backert, S., Ferrero, R. L., 137 and Boneca, I. G. (2012) Peptidoglycan maturation enzymes affect flagellar functionality in bacteria. Mol Microbiol 86, 845-‐856 257. Pucciarelli, M. G., and García-‐del Portillo, F. (2003) Protein-‐peptidoglycan interactions modulate the assembly of the needle complex in the Salmonella invasion-‐associated type III secretion system. Mol Microbiol 48, 573-‐585 258. Oh, H. S., Kvitko, B. H., Morello, J. E., and Collmer, A. (2007) Pseudomonas syringae lytic transglycosylases coregulated with the type III secretion system contribute to the translocation of effector proteins into plant cells. J Bacteriol 189, 8277-‐8289 259. Raymond, B., Young, J. C., Pallett, M., Endres, R. G., Clements, A., and Frankel, G. (2013) Subversion of trafficking, apoptosis, and innate immunity by type III secretion system effectors. Trends Microbiol 21, 430-‐441 260. Diepold, A., and Wagner, S. (2014) Assembly of the bacterial type III secretion machinery. FEMS Microbiol Rev 38, 802-‐822 261. Chatterjee, S., Chaudhury, S., McShan, A. C., Kaur, K., and De Guzman, R. N. (2013) Stucture and biophysics of Type III secretion in bacteria. Biochemistry 262. Day, J. B., Ferracci, F., and Plano, G. V. (2003) Translocation of YopE and YopN into eukaryotic cells by Yersinia pestis yopN, tyeA, sycN, yscB and lcrG deletion mutants measured using a phosphorylatable peptide tag and phosphospecific antibodies. Mol Microbiol 47, 807-‐823 263. Ferracci, F., Schubot, F. D., Waugh, D. S., and Plano, G. V. (2005) Selection and characterization of Yersinia pestis YopN mutants that constitutively block Yop secretion. Mol Microbiol 57, 970-‐987 264. Archuleta, T. L., and Spiller, B. W. (2014) A gatekeeper chaperone complex directs translocator secretion during type three secretion. PLoS Pathog 10, e1004498 265. Younis, R., Bingle, L. E., Rollauer, S., Munera, D., Busby, S. J., Johnson, S., Deane, J. E., Lea, S. M., Frankel, G., and Pallen, M. J. (2010) SepL resembles an aberrant effector in binding to a class 1 type III secretion chaperone and carrying an N-‐terminal secretion signal. J Bacteriol 192, 6093-‐6098 266. Fields, K. A., and Hackstadt, T. (2000) Evidence for the secretion of Chlamydia trachomatis CopN by a type III secretion mechanism. Mol Microbiol 38, 1048-‐1060 267. Archuleta, T. L., Du, Y., English, C. A., Lory, S., Lesser, C., Ohi, M. D., Ohi, R., and Spiller, B. W. (2011) The Chlamydia effector chlamydial outer protein N (CopN) sequesters tubulin and prevents microtubule assembly. J Biol Chem 286, 33992-‐33998 268. Nawrotek, A., Guimarães, B. G., Velours, C., Subtil, A., Knossow, M., and Gigant, B. (2014) Biochemical and structural insights into microtubule perturbation by CopN from Chlamydia pneumoniae. J Biol Chem 289, 25199-‐25210 269. Wang, D., Roe, A. J., McAteer, S., Shipston, M. J., and Gally, D. L. (2008) Hierarchal type III secretion of translocators and effectors from Escherichia coli O157:H7 requires the carboxy terminus of SepL that binds to Tir. Mol Microbiol 69, 1499-‐1512 138 270. McCoy, A. J., Grosse-‐Kunstleve, R. W., Adams, P. D., Winn, M. D., Storoni, L. C., and Read, R. J. (2007) Phaser crystallographic software. J Appl Crystallogr 40, 658-‐674 271. Bricogne G., Blanc E., Brandl M., Flensburg C., Keller P., Paciorek W., Roversi P, Sharff A., Smart O.S., Vonrhein C., and T.O., W. (2011) BUSTER version 2.10.0. Cambridge, United Kingdom: Global Phasing Ltd. 272. Crump, J. A., Luby, S. P., and Mintz, E. D. (2004) The global burden of typhoid fever. Bull World Health Organ 82, 346-‐353 273. Majowicz, S. E., Musto, J., Scallan, E., Angulo, F. J., Kirk, M., O'Brien, S. J., Jones, T. F., Fazil, A., Hoekstra, R. M., and Studies, I. C. o. E. D. B. o. I. (2010) The global burden of nontyphoidal Salmonella gastroenteritis. Clin Infect Dis 50, 882-‐889 274. Ibarra, J. A., and Steele-‐Mortimer, O. (2009) Salmonella-‐-‐the ultimate insider. Salmonella virulence factors that modulate intracellular survival. Cell Microbiol 11, 1579-‐1586 275. Terebiznik, M. R., Vieira, O. V., Marcus, S. L., Slade, A., Yip, C. M., Trimble, W. S., Meyer, T., Finlay, B. B., and Grinstein, S. (2002) Elimination of host cell PtdIns(4,5)P(2) by bacterial SigD promotes membrane fission during invasion by Salmonella. Nat Cell Biol 4, 766-‐773 276. Patel, J. C., Hueffer, K., Lam, T. T., and Galán, J. E. (2009) Diversification of a Salmonella virulence protein function by ubiquitin-‐dependent differential localization. Cell 137, 283-‐294 277. . 278. Bakowski, M. A., Braun, V., Lam, G. Y., Yeung, T., Heo, W. D., Meyer, T., Finlay, B. B., Grinstein, S., and Brumell, J. H. (2010) The phosphoinositide phosphatase SopB manipulates membrane surface charge and trafficking of the Salmonella-‐containing vacuole. Cell Host Microbe 7, 453-‐462 279. Alemán, A., Rodríguez-‐Escudero, I., Mallo, G. V., Cid, V. J., Molina, M., and Rotger, R. (2005) The amino-‐terminal non-‐catalytic region of Salmonella typhimurium SigD affects actin organization in yeast and mammalian cells. Cell Microbiol 7, 1432-‐1446 280. Rodriguez-‐Escudero, I., Rotger, R., Cid, V. J., and Molina, M. (2006) Inhibition of Cdc42-‐dependent signalling in Saccharomyces cerevisiae by phosphatase-‐dead SigD/SopB from Salmonella typhimurium. Microbiology (Reading, England) 152, 3437-‐3452 281. Sinha, S., and Yang, W. (2008) Cellular signaling for activation of Rho GTPase Cdc42. Cell Signal 20, 1927-‐1934 282. Hall, A. (1998) Rho GTPases and the actin cytoskeleton. Science 279, 509-‐514 283. Morreale, A., Venkatesan, M., Mott, H. R., Owen, D., Nietlispach, D., Lowe, P. N., and Laue, E. D. (2000) Structure of Cdc42 bound to the GTPase binding domain of PAK. Nat Struct Biol 7, 384-‐388 284. Abdul-‐Manan, N., Aghazadeh, B., Liu, G. A., Majumdar, A., Ouerfelli, O., Siminovitch, K. A., and Rosen, M. K. (1999) Structure of Cdc42 in complex with the GTPase-‐binding domain of the 'Wiskott-‐Aldrich syndrome' protein. Nature 399, 379-‐383 285. Rogers, L. D., Kristensen, A. R., Boyle, E. C., Robinson, D. P., Ly, R. T., Finlay, B. B., and Foster, L. J. (2008) Identification of cognate host targets and specific 139 ubiquitylation sites on the Salmonella SPI-‐1 effector SopB/SigD. J Proteomics 71, 97-‐108 286. Rodríguez-‐Escudero, I., Ferrer, N. L., Rotger, R., Cid, V. J., and Molina, M. (2011) Interaction of the Salmonella Typhimurium effector protein SopB with host cell Cdc42 is involved in intracellular replication. Mol Microbiol 80, 1220-‐1240 287. Hardt, W. D., Chen, L. M., Schuebel, K. E., Bustelo, X. R., and Galán, J. E. (1998) S. typhimurium encodes an activator of Rho GTPases that induces membrane ruffling and nuclear responses in host cells. Cell 93, 815-‐826 288. Fu, Y., and Galán, J. E. (1999) A salmonella protein antagonizes Rac-‐1 and Cdc42 to mediate host-‐cell recovery after bacterial invasion. Nature 401, 293-‐297 289. W., L. A. G. (1992) Joint CCP4 + ESF-‐EAMCB Newsletter on Protein Crystallography. 290. Collaborative Computational Project, N. m. (1994) The CCP4 suite: programs for protein crystallography. Acta Crystallogr D Biol Crystallogr 50, 760-‐763 291. Emsley, P., and Cowtan, K. (2004) Coot: model-‐building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr 60, 2126-‐2132 292. Afonine P. V., G.-‐K. R. W., Adams P. D. (2005). (2005) Collaborative Computational Project, Number 4 Newsletter 42. 293. Chen, V. B., Arendall, W. B., Headd, J. J., Keedy, D. A., Immormino, R. M., Kapral, G. J., Murray, L. W., Richardson, J. S., and Richardson, D. C. (2010) MolProbity: all-‐atom structure validation for macromolecular crystallography. Acta Crystallogr D Biol Crystallogr 66, 12-‐21 294. L., D. W. (2010) The PyMOL Molecular Graphics System, version 1.3r1,Schrödinger, LLC, New York. 295. Murata, T., Delprato, A., Ingmundson, A., Toomre, D. K., Lambright, D. G., and Roy, C. R. (2006) The Legionella pneumophila effector protein DrrA is a Rab1 guanine nucleotide-‐exchange factor. Nat Cell Biol 8, 971-‐977 296. Krissinel, E., and Henrick, K. (2007) Inference of macromolecular assemblies from crystalline state. J Mol Biol 372, 774-‐797 297. Eswaran, J., Soundararajan, M., Kumar, R., and Knapp, S. (2008) UnPAKing the class differences among p21-‐activated kinases. Trends Biochem Sci 33, 394-‐403 298. Zhao, Z. S., Manser, E., Chen, X. Q., Chong, C., Leung, T., and Lim, L. (1998) A conserved negative regulatory region in alphaPAK: inhibition of PAK kinases reveals their morphological roles downstream of Cdc42 and Rac1. Mol Cell Biol 18, 2153-‐2163 299. Garrard, S. M., Capaldo, C. T., Gao, L., Rosen, M. K., Macara, I. G., and Tomchick, D. R. (2003) Structure of Cdc42 in a complex with the GTPase-‐binding domain of the cell polarity protein, Par6. EMBO J 22, 1125-‐1133 300. Hoffman, G. R., Nassar, N., and Cerione, R. A. (2000) Structure of the Rho family GTP-‐binding protein Cdc42 in complex with the multifunctional regulator RhoGDI. Cell 100, 345-‐356 301. Prehna, G., Ivanov, M. I., Bliska, J. B., and Stebbins, C. E. (2006) Yersinia virulence depends on mimicry of host Rho-‐family nucleotide dissociation inhibitors. Cell 126, 869-‐880 302. Jaffe, A. B., and Hall, A. (2005) Rho GTPases: biochemistry and biology. Annu Rev Cell Dev Biol 21, 247-‐269 140 303. Aktories, K. (2011) Bacterial protein toxins that modify host regulatory GTPases. Nat Rev Microbiol 9, 487-‐498 304. Kubori, T., and Galán, J. E. (2003) Temporal regulation of salmonella virulence effector function by proteasome-‐dependent protein degradation. Cell 115, 333-‐342 305. Stavrinides, J., Ma, W., and Guttman, D. S. (2006) Terminal reassortment drives the quantum evolution of type III effectors in bacterial pathogens. PLoS Pathog 2, e104
Featured Collection
UBC Theses and Dissertations
Structural and functional characterization of components of bacterial type III secretion systems Burkinshaw, Brianne J. 2015
Item Metadata
Download
- Media
- 24-ubc_2015_september_burkinshaw_brianne.pdf [ 19.94MB ]
- Metadata
- JSON: 24-1.0166442.json
- JSON-LD: 24-1.0166442-ld.json
- RDF/XML (Pretty): 24-1.0166442-rdf.xml
- RDF/JSON: 24-1.0166442-rdf.json
- Turtle: 24-1.0166442-turtle.txt
- N-Triples: 24-1.0166442-rdf-ntriples.txt
- Original Record: 24-1.0166442-source.json
- Full Text
- 24-1.0166442-fulltext.txt
- Citation
- 24-1.0166442.ris
Full Text
Cite
Citation Scheme:
Usage Statistics
Share
Embed
Customize your widget with the following options, then copy and paste the code below into the HTML
of your page to embed this item in your website.
<div id="ubcOpenCollectionsWidgetDisplay">
<script id="ubcOpenCollectionsWidget"
src="{[{embed.src}]}"
data-item="{[{embed.item}]}"
data-collection="{[{embed.collection}]}"
data-metadata="{[{embed.showMetadata}]}"
data-width="{[{embed.width}]}"
async >
</script>
</div>
Our image viewer uses the IIIF 2.0 standard.
To load this item in other compatible viewers, use this url: https://iiif.library.ubc.ca/presentation/dsp.24.1-0166442/manifest