You may notice some images loading slow across the Open Collections website. Thank you for your patience as we rebuild the cache to make images load faster.

Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of the Lyn tyrosine kinase in innate immunity and intestinal inflammation Roberts, Morgan 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2015_september_roberts_morgan.pdf [ 33.5MB ]
Metadata
JSON: 24-1.0166382.json
JSON-LD: 24-1.0166382-ld.json
RDF/XML (Pretty): 24-1.0166382-rdf.xml
RDF/JSON: 24-1.0166382-rdf.json
Turtle: 24-1.0166382-turtle.txt
N-Triples: 24-1.0166382-rdf-ntriples.txt
Original Record: 24-1.0166382-source.json
Full Text
24-1.0166382-fulltext.txt
Citation
24-1.0166382.ris

Full Text

THE ROLE OF THE LYN TYROSINE KINASE IN INNATE IMMUNITY AND INTESTINAL INFLAMMATION  by Morgan Roberts  B.Sc., McGill University, 2008  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  July 2015  © Morgan Roberts, 2015   ii Abstract The immune system is critical for host survival by providing protection against infectious organisms. However, the immune system also plays a major pathological role in many human diseases through inappropriate inflammatory responses that can lead to tissue damage and death. Therefore, understanding the mechanisms that drive and regulate these responses has broad implications for the development of therapies for numerous diseases including inflammatory bowel disease and atherosclerosis. Through its involvement in key signalling pathways, the Lyn tyrosine kinase is an important regulator of immune cell development and function. Using models of chemically induced colitis and enteric infection, we show that Lyn plays a critical role in regulating gastro-intestinal inflammation and in protection from enteric pathogens, by regulating host responses to intestinal microbes. Lyn-/- mice were highly susceptible to dextran sulfate sodium-induced colitis, whereas Lyn gain-of-function (Lynup) mice exhibited attenuated colitis. Protection in Lynup mice was independent of the adaptive immune system and involved hypersensitivity to microbial products such as LPS, leading to enhanced production of protective factors including IL-22. Increased DSS susceptibility in Lyn-/- mice correlated with dysbiosis and altered T cell responses. This dysbiosis was characterized by an expansion of segmented filamentous bacteria, which was associated with altered production of IL-22 and IgA. Furthermore, increased Lyn activity in dendritic cells was sufficient to drive increased IL-22 production by innate lymphoid cells. This extended beyond the gut to the spleen, which added to previous findings by our lab and others, identifying Lyn as an important regulator of systemic mononuclear phagocytes and their inflammatory responses. Finally, we identified Lyn as a negative regulator of Ly6C-   iii patrolling monocytes (pMo). Lyn-/- mice displayed increased frequency and numbers of pMos whereas Lynup mice were skewed towards increased conventional monocytes (cMo). The increase in pMos in Lyn-/- mice was independent of the adaptive immune system and the autoimmune and myeloproliferative disorders that develop in these mice with age. Furthermore, these monocyte differences correlated with a pathological role for Lyn in a model of atherosclerosis. Together, these studies identify Lyn as an important regulator of innate immune responses involved in sterile and microbial-driven inflammatory diseases.     iv Preface  A version of chapter 3 has been published. JL Bishop*, ME Roberts*, JL Beer, M Huang, MK Chehal, X Fan, LA Fouser, HL Ma, JT Bacani, and KW Harder. Lyn activity protects mice from DSS colitis and regulates the production of IL-22 from innate lymphoid cells. Mucosal Immunology. March 2014;7(2):405-16. (*Indicates co-first authorship). Together with Dr. Jennifer L Bishop, I designed, executed and analyzed the majority of the experiments in this paper. I was also responsible for approximately 75% of the writing and 90% of the figure making for the manuscript while Dr. Bishop wrote the other 25%, generated approximately 10% of the figures, and helped edit the final version of the manuscript. Dr. Bishop performed the initial DSS experiments and data analysis for Figures 3.1, 3.2, 3.3 and 3.7 and I completed the repeats of these experiments together with Dr. Bishop. Dr. Bishop and I both provided data for Figure3.4A-C and I alone provided the data and analysis for Figure 3.4D-F. I alone provided the data for Figures 3.5, 3.7, 3.9, 3.10, 3.11, 3.12, and 3.13. Dr. Bishop and I, together, provided the data for Figure 3.8A, C, D, E, and G. I provided the data for Figure 3.8B, F, and Jennifer L. Beer took the histology pictures for Figures 3.1, 3.2, and 3.6 and helped organize the files for the figures.  Morris Huang isolated some of the RNA and did some of the RT-PCR for Figure 3.4B. He also isolated the fecal DNA in Figure 3.13B and provided technical support. Dr. Manreet K Chehal provided some serum samples for Figure 3.8E, provided technical support and helped edit the final manuscript. Xueling Fan provided technical support and helped weigh mice during the DSS experiments. Dr. LA Fouser and Dr. HL Ma provided the IL-22 neutralizing antibody used in Figure 3.4F and the anti-IL-22 antibody for flow cytometry used in Figure 3.8H and 3.9. Dr.   v JT Bacani performed the histopathological analysis of the colonic tumour sections for Figure 3.3. Her descriptions of the tumours are included in the results section of the text. Dr. Kenneth W Harder provided supervision as well as advice for experimental design and interpretation of the data. He also provided editorial input for the manuscript.  A version of chapter 4 has been published. ME Roberts*, JL Bishop*, X Fan, JL Beer, WWS Kum, DL Krebs, M Huang, N Gill, JJ Priatel, BB Finlay, and KW Harder. Lyn deficiency leads to increased microbiota-dependent intestinal inflammation and susceptibility to enteric pathogens. Journal of Immunology, November 2014;193(10):5249-63 (*Indicates co-first authorship). This manuscript can be accessed at http://www.jimmunol.org/content/193/10/5249.long.  Together with Dr. Jennifer L Bishop, I designed, executed and analyzed the majority of the experiments in this paper. I was responsible for approximately 90% of the writing and 90% of the figure making for the manuscript while Dr. Bishop wrote the other 10%, made about 10% of the figures, and helped edit the final version of the manuscript. Dr. Bishop performed the pathological analaysis in Figure 4.2C and performed the majority of the experiments for figure 4.12. Initial studies for the Salmonella infection model in Figure 4.12 were performed by Dr. WWS Kum. The experiments and data analysis for Figures 4.1A-C, 4.2A, C, D, I, J, K, 4.4A-E, 4.6B-E, and 4.7A were perfomed together by me and Dr. Bishop. I alone provided and analysed the data in Figures 4.1D, 4.3, 4.4F-J, 4.5B-H, 4.6A, 4.7B-F, 4.8, 4.9, 4.10, and 4.11. JL Beer acquired images and performed data analysis for Figure 4.2E-F and acquired images for Figure 4.12E. Dr. N Gill provided data for figure 4.5A. As part of her work investigating antigen-specific T cell responses, Xueling Fan provided the rationale to investigate IL-17 production by T cells (Figure 4.8 and 4.9). Morris Huang isolated some of   vi the RNA and did some of the RT-PCR for Figure 4.4E and 4.2K. He also isolated some of the fecal DNA in Figure 4.5A, 4.6A, and 4.11 and provided technical support. Dr. Danielle L Krebs provided technical support for Western blot analysis and RT-qPCR and editorial input for the manuscript. Dr. John J Priatel provided reagents and technical advice for analysis of IL-17 production by T cells and editorial input for the manuscript. Dr. B Brett Finlay provided reagents and technical advice for the enteric infection models and analysis of fecal bacterial communities. Dr. Kenneth W Harder provided supervision as well as advice for experimental design and interpretation of the data. He also provided editorial input for the manuscript.  The work in chapter 5 is unpublished and will likely be submitted for publication later this year. I designed, executed and analyzed the majority of the experiments in this chapter and was responsible for 100% of the writing and figure making. Under the supervision of Dr. Harder, David Hancock made the initial observation of increased patrolling monocytes in Lyn-/- mice. Alexander Sio performed some of the repeat experiments for Figures 5.1 and 5.2. Xueling Fan performed some of the repeats for Figure 5.4 and together with Daven Tai acquired images and performed analysis of aortic plaque area in Figure 5.13C-D. Together, Xueling Fan and I provided the data for Figure 5.13E-F. Under my supervision, Rachel Cederberg performed the experiments and data analysis for Figure 5.10 and provided technical support. Dr. Kenneth W Harder provided supervision as well as advice for experimental design and interpretation of the data.  Animal breeding and experimentation was performed according to U.B.C Animal Care Committee and the Canadian Council of Animal Care guidelines. Breeding of mice was performed under the following UBC Animal Care Committee ethics certificates: A10-0305   vii and A14-0349. Animal experimentation was performed under the following UBC Animal Care Committee ethics certificates: A08-0434, A13-0245, and A14-0341.   viii Table of Contents   Abstract ...................................................................................................................................ii	  Preface .................................................................................................................................... iv	  Table of Contents.................................................................................................................viii	  List of Tables ........................................................................................................................xiii	  List of Figures ......................................................................................................................xiv	  List of Abbreviations ..........................................................................................................xvii	  Acknowledgements ..............................................................................................................xxi	  Dedication...........................................................................................................................xxiii	  Chapter 1: Introduction......................................................................................................... 1	  1.1	   The innate immune system in health and disease........................................................ 2	  1.2	   The mononuclear phagocyte system............................................................................ 3	  1.2.1	   Monocytes ............................................................................................................ 6	  1.2.2	   Dendritic cells....................................................................................................... 7	  1.2.3	   Intestinal mononuclear phagocytes....................................................................... 8	  1.3	   Innate lymphoid cells................................................................................................. 10	  1.4	   Intestinal homeostasis and its breakdown in inflammatory bowel disease ............... 12	  1.5	   The importance of pattern recognition receptor signalling in intestinal homeostasis and inflammation ................................................................................................................ 13	  1.6	   Impact of the microbiota on the host immune system............................................... 15	    ix 1.7	   The intestinal mononuclear phagocyte system mediates intestinal inflammation and homeostasis......................................................................................................................... 17	  1.8	   Type 17 responses by CD4+ T cells and ILCs in intestinal homeostasis and inflammation....................................................................................................................... 19	  1.9	   Lyn tyrosine kinase.................................................................................................... 21	  1.9.1	   The role of Lyn in mononuclear phagocyte development .................................. 26	  1.9.2	   The role of Lyn in dendritic cells ....................................................................... 27	  1.9.3	   The role of Lyn in monocytes and macrophages................................................ 28	  1.10	   Research objectives and hypotheses......................................................................... 30	  Chapter 2: Materials and methods ..................................................................................... 32	  2.1	   Animals...................................................................................................................... 33	  2.2	   Animal rederivation, chimerism and cell depletions ................................................. 33	  2.3	   Experimental colitis and colitis-associated cancer DSS colitis ................................. 34	  2.4	   Bacterial infections .................................................................................................... 36	  2.5	   Intestinal histology .................................................................................................... 36	  2.6	   Quantitative analysis of murine gene expression ...................................................... 38	  2.7	   Bacterial quantitative PCR ........................................................................................ 39	  2.8	   IgA quantification...................................................................................................... 39	  2.9	   Colon explant culture and ELISA ............................................................................. 40	  2.10	   Intestinal permeability assay (FITC-dextran)........................................................... 40	  2.11	   In vivo cell depletions and IL-22 response to endotoxin.......................................... 40	  2.12	   Isolation of colonic lamina propria leukocytes ........................................................ 41	  2.13	   Isolation of blood cells, splenocytes and BM cells for flow cytometry ................... 41	    x 2.14	   Surface staining for flow cytometry ......................................................................... 42	  2.15	   Flow cytometric analysis of splenic and colonic IL-22 production ......................... 43	  2.16	   Analysis of Lyn expression by flow cytometry........................................................ 44	  2.17	   In vivo incorporation of BrdU .................................................................................. 44	  2.18	   Flow cytometric analysis of cell death ..................................................................... 45	  2.19	   Acquisition and analysis of flow cytometry data ..................................................... 45	  2.20	   Isolation of intestinal epithelial cells and Western blot analysis.............................. 45	  2.21	   Splenic cultures ........................................................................................................ 46	  2.22	   DC-ILC co-culture.................................................................................................... 47	  2.23	   In vitro BM-derived monocyte cultures ................................................................... 47	  2.24	   Experimental atherosclerosis.................................................................................... 48	  2.25	   Statistical analysis .................................................................................................... 48	  Chapter 3: Lyn activity protects mice from DSS colitis and regulates the production of IL-22 from innate lymphoid cells ........................................................................................ 49	  3.1	   Introduction ............................................................................................................... 50	  3.2	   Results ....................................................................................................................... 52	  3.2.1	   Lyn is protective against experimental colitis .................................................... 52	  3.2.2	   Increased Lyn activity is associated with an enhanced IL-22 response during experimental colitis......................................................................................................... 57	  3.2.3	   The adaptive immune system is dispensable for protection from acute colitis in Lynup mice....................................................................................................................... 61	  3.2.4	   Enhanced IL-22 production in Lynup mice occurs in response to LPS and requires DCs and ILCs ................................................................................................... 65	    xi 3.2.5	   Increased Lyn activity in DCs is sufficient to drive enhanced IL-22 production by ILCs ........................................................................................................................... 71	  3.2.6	   LPS hypersensitivity is sufficient to protect microbiota-depleted Lynup mice from DSS colitis ............................................................................................................. 73	  3.3	   Discussion.................................................................................................................. 75	  Chapter 4: Lyn deficiency leads to increased microbiota-dependent intestinal inflammation and susceptibility to enteric pathogens....................................................... 81	  4.1	   Introduction ............................................................................................................... 82	  4.2	   Results ....................................................................................................................... 84	  4.2.1	   Lyn deficiency results in increased susceptibility to experimental colitis ......... 84	  4.2.2	   Colonic changes at early time points during DSS challenge, and altered cytokine production correlate with increased susceptibility to disease in Lyn-/- mice .................. 85	  4.2.3	   The adaptive immune system is required for increased susceptibility of Lyn-/- mice to DSS. ................................................................................................................... 88	  4.2.4	   Increased susceptibility to DSS in Lyn-/- mice is dependent on the microbiota .94	  4.2.5	   Increased T cell production of IFNγ and IL-17 in Lyn-/- mice and the impact of the microbiota on colonic T cell accumulation............................................................. 100	  4.2.6	   Lyn deficient mice exhibit increased susceptibility to enteric pathogens and SFB expansion ...................................................................................................................... 105	  4.3	   Discussion................................................................................................................ 110	  Chapter 5: Lyn is a negative regulator of patrolling monocyte development and survival in response to CSF-1 ............................................................................................ 117	  5.1	   Introduction ............................................................................................................. 118	    xii 5.2	   Results ..................................................................................................................... 122	  5.2.1	   Lyn is a negative regulator of patrolling monocyte populations ...................... 122	  5.2.2	   Increased patrolling monocytes in Lyn-/- mice is independent of the adaptive immune system ............................................................................................................. 127	  5.2.3	   Increased Lyn kinase activity does not impair patrolling monocyte populations but supports a modest increase in conventional monocytes ......................................... 130	  5.2.4	   Lyn mediated regulation of patrolling monocytes is cell autonomous............. 132	  5.2.5	   Lyn is a negative regulator of CSF-1 induced monocyte development and survival in response to limited cytokine concentrations in vitro .................................. 138	  5.2.6	   Lyn regulates pMo population dynamics and expression of CSF-1R in vivo .. 140	  5.2.7	   Lyn promotes the development of atherosclerosis ........................................... 144	  5.3	   Discussion................................................................................................................ 148	  Chapter 6: Conclusion........................................................................................................ 155	  6.1	   Summary and contribution to the field .................................................................... 156	  6.2	   Future directions ...................................................................................................... 161	  6.2.1	   Understanding Lyn’s role intestinal homeostasis and inflammation................ 161	  6.2.2	   Understanding Lyn’s role in monocyte homeostasis and effector functions, and in atherosclerosis .......................................................................................................... 163	  6.3	   Concluding remarks................................................................................................. 164	  References............................................................................................................................ 166	     xiii List of Tables Table 2.1 DSS induced colitis score ....................................................................................... 35	  Table 2.2 Salmonella induced gastroenteritis score ............................................................... 36	  Table 2.3 C. rodentium induced pathology score ................................................................... 37	  Table 2.4 Murine qPCR primers............................................................................................. 38	  Table 2.5 Bacterial qPCR primers .......................................................................................... 39	     xiv List of Figures Figure 1.1 Development of the mononuclear phagocyte system.............................................. 5	  Figure 1.2 The innate lymphoid cell family. .......................................................................... 12	  Figure 1.3 Functional domains of Lyn. .................................................................................. 22	  Figure 1.4 Active and inactive structures of Lyn. .................................................................. 24	  Figure 1.5 Lyn is a positive and negative regulator of immune cell signalling...................... 25	  Figure 3.1 Lyn deficiency increases susceptibility to DSS colitis. ........................................ 54	  Figure 3.2 Increased Lyn activity attenuates acute DSS-induced colitis................................ 55	  Figure 3.3 Increased Lyn activity attenuates chronic DSS-induced colitis and colitis associated cancer. ................................................................................................................... 57	  Figure 3.4 Lynup/up mice produce increased levels of IL-22 during DSS colitis. .................... 59	  Figure 3.5 The intestinal immune compartment of Lynup/up mice........................................... 62	  Figure 3.6 Lyn activity in innate immune cells is sufficient to protect from DSS colitis. ..... 64	  Figure 3.7 The intestinal immune compartments of Rag-/-Lynup/up mice. ............................... 64	  Figure 3.8 DCs and ILCs are required for increased IL-22 production in Lynup/up mice in response to LPS ...................................................................................................................... 66	  Figure 3.9 Lyn regulates IL-22 production from ILCs, the major source of IL-22 in splenic cultures.................................................................................................................................... 67	  Figure 3.10 Systemic administration of monoclonal anti-CD90 antibodies or DT depletes CD90+ cells and DCs, respectively......................................................................................... 69	  Figure 3.11 Colonic expression of Lyn .................................................................................. 71	  Figure 3.12 Increased Lyn-activity in DCs drives enhanced IL-22 production by ILCs. ...... 72	    xv Figure 3.13 Hypersensitivity to LPS protects antibiotic treated Lyn+/up mice from DSS-induced weight-loss and death................................................................................................ 75	  Figure 4.1 Lyn deficiency increases susceptibility to DSS-induced colitis............................ 85	  Figure 4.2 Lyn deficiency leads to exacerbated DSS colitis, barrier permeability, crypt hyperplasia and distinct cytokine and transcription factor expression profiles. ..................... 87	  Figure 4.3 Lyn deficiency affects colonic DC composition. .................................................. 90	  Figure 4.4 The adaptive immune system is required for susceptibility to DSS colitis in Lyn-/- mice......................................................................................................................................... 92	  Figure 4.5 DSS susceptibility in Lyn-/- mice is associated with a distinct microbiota............ 96	  Figure 4.6 Lyn deficient BM radiation chimeric mice do not exhibit increased susceptibility to DSS..................................................................................................................................... 98	  Figure 4.7 Lyn-/- mice have altered IL-22 and IgA responses. ............................................... 99	  Figure 4.8 Accumulation of IL-17 and/or IFNγ producing colonic T cells correlates with DSS susceptibility and the presence of a distinct microbiota in Lyn-/- mice................................. 102	  Figure 4.9 Altered production of IFNg and IL-17 by splenic T cells in Lyn-/- mice varies in response to DSS and changes in the microbiota................................................................... 103	  Figure 4.10 The microbiota affects the susceptibility of Lyn-/- mice to DSS colitis............. 105	  Figure 4.11 Expansion of SFB differs in Lyn-/- compared to wt mice.................................. 106	  Figure 4.12 Lyn deficiency increases susceptibility to enteric infection-induced inflammation......................................................................................................................... 108	  Figure 5.1 Lyn-/- mice have increased frequency and number of patrolling monocytes....... 124	  Figure 5.2 Lyn is a negative regulator of splenic and BM patrolling monocyte numbers and splenic conventional monocytes. .......................................................................................... 126	    xvi Figure 5.3 Lyn-/- mice have increased numbers of splenic but not BM monocyte progenitor cells. ...................................................................................................................................... 127	  Figure 5.4 Increased patrolling monocytes in Lyn-/- mice is independent of the adaptive immune system. .................................................................................................................... 129	  Figure 5.5 Lyn does not regulate BM monocyte progenitor cells in Rag-/- mice. ................ 129	  Figure 5.6 Lyn gain-of-function mice have increased proportions of conventional monocytes............................................................................................................................................... 131	  Figure 5.7 Lyn is expressed in all monocyte lineage cells and regulates patrolling monocyte populations by a cell autonomous mechanism. .................................................................... 133	  Figure 5.8 Negative regulation of patrolling monocytes by Lyn is cell intrinsic. ................ 136	  Figure 5.9 Regulation of monocyte populations by Lyn is dependent on Lyn expression in hematopoietic cells. .............................................................................................................. 138	  Figure 5.10 Lyn negatively regulates monocyte development as well as survival in response to CSF-1 withdrawal in vitro. ............................................................................................... 140	  Figure 5.11 Lyn negatively regulates CD115 (CSF-1R) cell surface expression and turnover of patrolling monocytes in vivo. ........................................................................................... 141	  Figure 5.12 Analysis of cell viability in Lyn+/+ and Lyn-/- mice. .......................................... 144	  Figure 5.13 Lyn deficiency is associated with protection, and Lyn activation with susceptibility, to atherosclerosis in the Ldlr-/- high fat diet model of disease. ..................... 146	     xvii List of Abbreviations AHR: Aryl hydrocarbon receptor αLP: Alpha lymphoid progenitor AMP: Antimicrobial peptide AOM: Azoxymethane APC: Antigen presenting cell BAFF: B cell activating factor belonging to the TNF family Batf3: Basic leucine zipper transcription factor ATF-like 3 BM: Bone marrow BM-DC: Bone marrow derived dendritic cell BM-MΦ: Bone marrow derived macrophage BM-Mo: Bone marrow derived monocyte BrdU: Bromodeoxyuridine CAC: Colitis-associated cancer CD: Cluster of differentiation  CrD: Crohn's disease cDC: Conventional dendritic cell CDP: Common dendritic cell progenitor cLP: Colonic lamina propria cMo: Conventional monocyte cMoP: Common monocyte progenitor CSF-1R: Colony stimulating factor 1 receptor   xviii Csk: C-terminal Src kinase DC: Dendritic cell DSS: Dextran sulfate sodium DT: Diptheria toxin EDTA: Ethylenediaminetetraacetic acid Flt3: Fms-like tyrosine kinase 3 GATA3: GATA-binding protein 3 GI: Gastrointestinal GM-CSF: Granulocyte macrophage colony stimulating factor GMP: Granulocyte macrophage progenitor HI-ABS: Heat-inactivated adult bovine serum HI-FBS: Heat-inactivated fetal bovine serum i.p.: Intraperitoneal IBD: Inflammatory bowel disease Id2: Inhibitor of DNA binding 2 IFNγ: Interferon gamma Ig: Immunoglobulin IL: Interleukin ILC: Innate lymphoid cell ILC1: Group 1 innate lymphoid cell ILC2: Group 2 innate lymphoid cell ILC3: Group 3 innate lymphoid cell iNOS: Inducible nitric oxide synthase   xix IRF4: Interferon regulatory factor 4 ITAM: Immunoreceptor tyrosine-based activating motif ITIM: Immunoreceptor tyrosine-based inhibitory motif i.v.: Intravenous LCM: L cell conditioned medium LDL: Low-density lipoprotein LFA-1: Lymphocyte function-associated antigen 1 LN: Lymph node LP: Lamina propria LPS: Lipopolysaccharide LTA: Lipoteich acid LTi: Lymphoid tissue inducer mAb: Monoclonal antibody MAMP: Microbial associated molecular patterns MDP: Macrophage dendritic cell progenitor MHC: Major histocompatibility complex mLN: Mesenteric lymph node MPS: Mononuclear phagocyte system MTPBS: Mouse tonicity phosphate buffered saline MyD88: Myeloid differentiation primary response 88 NK: Natural killer NLR: NOD-like receptor pDC: Plasmacytoid dendritic cell   xx PIR-B: Paired Ig-like receptor B pMo: Patrolling monocyte pre-DC: Precursor dendritic cell PRR: Pattern recognition receptor RA: Retinoic acid RORγt: RAR-related orphan receptor gamma t SCFA: Short-chain fatty acids SFB: Segmented filamentous bacteria SFK: Src family of membrane associated tyrosine kinases SH: Src homology SHIP-1: Src homology 2 domain-containing inositol phosphatase 1 SHP: Src homology 2 domain-containing phosphatase SIRP-α: Signal regulatory protein alpha SR-A: Scavenger receptor A T-bet: T-box expressed in T cells TCR: T cell receptor TGF-β: Transforming growth factor beta Th: T helper TLR: Toll-like receptor TNFα: Tumour necrosis factor alpha Treg: Regulatory T TSLP: Thymic stromal lymphopoietin UC: Ulcerative colitis  xxi Acknowledgements  I would first like to thank my supervisor Dr. Kenneth Harder. Your guidance and support were instrumental in the successes I have had as a graduate student and allowed me to be a better scientist than I ever thought possible. I thank you for giving me the opportunity to work in your lab, for the freedom you gave me to explore some of the weird ideas I have had along the way, and for always being up for a good argument.  I would also like to thank my committee members Dr. Pauline Johnson, Dr. Bruce Vallance, and Dr. Colby Zaph. I really appreciate all the time you have spent reading my reports and attending my committee meetings. The advice you gave and each of your unique perpectives and expertises provided a valuable contribution to the progress and success of my project.  I would next like to thank my friends and labmates who made graduate school a fun (and in the worst of times tolerable) place to be. First and foremost I want to thank my awesome friend and mentor Dr. Jenna Bishop. I learned so much from you and had the most fun moments of my PhD working with you. Together we were able to accomplish so much…we really made the perfect super team! I also want to thank my past and current labmates, Manreet Chehal, Alex Sio, Betty Fan, Danielle Krebs, Israel Matos, Morris Huang and Rachel Cederberg. Each of you has helped me along the way and you have been great people to have around the lab. Our department has a lot of really great people/scientists who have helped me out in countless ways. In particular I want to thank members of the Johnson, Abraham, Perona-Wright, Horwitz and Gold labs, with a special thanks to Asanga, Sally,   xxii Adam, and Sonja. Steve and Nicolette you guys are awesome and were a bright spot in a really tough time in my PhD. If it wasn’t for you I might be an electrician right now. ☺  There have been so many people who have helped me during my PhD and I would like to give a special thanks to Darlene Birkenhead. You are an invaluable member of our department who has supported so many struggling students. I also want to thank the staff that provided technical support. This includes the flow core staff, Andy and Justin, and our animal technicians (especially Vesna, Alpa, Betty and Erin).   I have been extremely fortunate to have the love and support of a fantastic family and group of friends. I want to thank my Mom and Dad and my step-dad Don for their support, and my hilarious and brilliant brother Thomas. I also have the most brilliant and fantastic twin sister Ali who is too awesome to even describe. Thanks for being the best shrub a girl could ask for! Thanks also to all my friends, especiall Katelyn, Ross, Bayden, Cam, Dean, and Lisa, who made the last 6 years in Vancouver great.  Finally, I want to thank my wonderful husband and friend Mike. I could not have done any of this work without your endless support and caring. You always take the best care of me when I am completely overwhelmed with work, and have a superhuman amount of patients for all my mess, weird sleeping hours, and (slight) crankiness when I’m stressed out. You love me, feed me, clean up after me, do the groceries, take care of the house, fix my bike, drive me to work, etc., etc., etc. and do it without ever (hardly) complaining. Thanks for being your awesome self!     xxiii Dedication To my loving husband and awe-inspiring shrub.   1 Chapter 1: Introduction      2 1.1 The innate immune system in health and disease The innate immune system is critical for protection from infectious organisms and for the maintenance of tissue homeostasis in response to a variety of noxious stimuli. Innate immunity is mediated by coordinated interactions between a collection of barriers including the skin and mucosal epithelia, numerous plasma proteins, and an assortment of leukocytes including mononuclear phagocytes, innate lymphoid cells (ILC), and granulocytes such as neutrophils8. The major role of innate immunity is to mediate inflammation, and to facilitate tissue repair and a return to homeostasis subsequent to inflammation. When inflammation is triggered under normal conditions, innate immune mechanisms are activated in situ and additional innate immune cells are recruited to the site of infection or damage. The noxious stimuli are then cleared, tissue repair mechanisms are activated and inflammation resolves. However, if inflammatory stimuli or tissue dysfunction persist and/or inflammation is not resolved, chronic inflammation can occur, which can cause serious collateral damage to the host9. These types of inappropriate inflammatory responses are a common pathogenic mechanism involved in many human diseases10 including autoimmune diseases such as multiple sclerosis11 and rheumatoid arthritis12; cardiovascular disease such as atherosclerosis13; neurodegenerative diseases such as Alzheimer’s disease11 and amyotrophic lateral sclerosis14; metabolic diseases15 such as type 2 diabetes and obesity; and inflammatory bowel disease16 (IBD). Furthermore, chronic inflammation has also been associated with ageing17 and tumourigenesis8. Therefore, understanding the mechanisms that drive and regulate the innate immune system will not only build on our understanding of the immune system as a whole, but will also contribute to the understanding of fundamental pathological mechanisms of human disease.   3 1.2 The mononuclear phagocyte system   The mononuclear phagocyte system (MPS) is made up of monocytes, macrophages, and dendritic cells (DC) as well their committed progenitors18, 19. Together, the MPS plays an important role in the maintenance of tissue integrity and in the initiation of adaptive immunity. Although much heterogeneity exists within the MPS, the various cell types share the features of being phagocytic, being regulated in some way by colony stimulating factor 1 receptor (CSF-1R) signalling and being highly adaptable to changing environments5. Our understanding of the relationship between the various members of the MPS is constantly evolving, however it is now clear that at least three distinct lineages exist (Figure 1.1). One of these lineages is the tissue resident macrophages which include cells such as Kupffer cells in the liver, and microglia in the central nervous system. These cells arise during fetal development, are long-lived cells with self-renewal capacity, and are specialized in maintaining tissue integrity and in recruiting other immune cells in response to inflammatory stimuli20, 21, 22, 23, 24. The other two lineages, conventional DCs (cDC) and monocytes continue to develop postnatally from bone marrow (BM) derived precursors7, 25, 26, 27, 28. One major difference between cDCs and monocytes is that the later developmental stages of cDCs, but not monocytes, depends on fms-like tyrosine kinase 3 (Flt3) signalling29, 30, 31, 32. There is still a great deal of uncertainty about the relationship between the BM precursors of cDCs and monocytes5 however a commonly accepted model7, 33, 34 suggests that they share a common progenitor with granulocytes called the granulocyte macrophage progenitor (GMP). GMPs can then further differentiate into the now controversial32 macrophage DC progenitor (MDP), that acts as the last common step between DCs and monocytes. Further differentiation of the MDP generates the common DC progenitor (CDP), which can no   4 longer give rise to monocytes but can generate plasmacytoid DCs (pDC) or the precursor DC (pre-DC), which enters circulation and gives rise to cDCs. Alternatively, MDPs can differentiate into a common monocyte progenitor (cMoP), which can then develop into monocytes7 (Figure 1.1).   5    Figure 1.1 Development of the mononuclear phagocyte system. The MPS is composed of three distinct lineages of effector cells: tissue macrophages, monocytes, and dendritic cells, as well as their committed progenitors. Development of MPS cells occurs through step-wise differentiation of committed progenitor cells that become more lineage restricted as they differentiate. Monocyte and macrophage development and maintenance is dependent on CSF-1R signalling while DC development depends on Flt3-ligand. APC, antigen presenting cell; BM, bone marrow; cDC, conventional dendritic cell; CDP, committed dendritic cell progenitor; cMo, conventional monocyte; cMoP, committed monocyte progenitor cell; GMP, granulocyte-macrophage progenitor; HSC, hematopoietic stem cell; MDP, macrophage dendritic cell progenitor; Mo, monocyte; MΦ, macrophage; pDC, plasmacytoid dendritic cell; pre-DC, precursor DC; pMo, patrolling monocyte. Figure is an adaptation of figures from Jenkins SJ, et. al, 20145; Onai N, et. al, 20146; and Hettinger et. al, 20137.   ?AdultHSCGMPMDPCDPcMoPcMo pMocMopMoEffector MoMo-APCMo-M\TissueM\pre-DC pDCpre-DC pDCpDCcDCYolk sac/fetal liver-progenitorFlt3-ligand dependentCSF-1 dependentBMBloodTissue  6 1.2.1 Monocytes  Monocytes were initially thought to exist as a circulating intermediate between BM progenitors and tissue macrophages. However, it is now clear that monocytes play a limited role in the maintenance of tissue macrophages5 and are in fact effector cells in their own right34. Monocytes express numerous pattern recognition receptors (PRR) and scavenger receptors that allow them to recognize invading microbes, dying and stressed cells, as well as a number of lipids and lipoproteins. Triggering of these receptors induces the production of various effector molecules including cytokines and chemokines as well as inducible nitric oxide synthase (iNOS)34. This together with their circulating nature makes monocytes uniquely equipped to encounter, recognize, and respond to infections and deviations from tissue homeostasis.  In mice two major subsets of monocytes exist, termed Ly6C+ conventional monocytes (cMo) and Ly6C- patrolling monocytes (pMo). Human equivalents to murine cMos and pMos have also been identified and are distinguished based on the expression of cluster of differentiation 16 (CD16) and CD14, as CD14hiCD16- and CD14loCD16+, respectively35, 36. One notable difference between human and murine monocytes is that pMos make up almost half the circulating monocytes in mice whereas their human equivalents are much less abundant (5-15%)37, 38, 39. Circulating pMos have a relatively long half-life of ~2-5 days in circulation and are now thought to be terminally differentiated monocytes, at times referred to as blood-resident macrophages, arising from cMos as an intermediate23, 26, 38. The existence of pMos was only recently described and their development and function in vivo is still largely unclear37, 38. However, studies by the Geissmann group have demonstrated that, in the steady state, these cells adhere to and patrol the luminal side of the vascular   7 endothelium where they play an important role in maintaining vascular integrity40, 41. Other studies have also suggested potential protective roles for pMos in Alzheimer’s disease42 and atherosclerosis43, likely through their ability to scavenge and clear away pathogenic proteins and lipids that contribute to early stages of disease. Conversely, pMos play a pathogenic inflammatory role in a model of arthritis44.  In contrast to pMos, cMos are a short-lived (~19 hour circulating half-life)23, and express a variety of chemokine receptors that allow them to be quickly recruited to sites of infection or tissue damage38, 45. Depending on the context of their recruitment into tissue, cMos can differentiate into effector cells with at least three distinct functionalities34. In the context of infection cMos can contribute to protective inflammatory responses via the production of tumour necrosis factor alpha (TNFα) and iNOS and are often referred to as TipDCs46, although their classification as DCs is largely debated, and the term effector Mo has been suggested instead34. Alternatively, cMos can be recruited to contribute to the resolution of inflammation where they transiently contribute to the tissue macrophage pool47, 48, 49. This role for cMos has been described in a number of diseases including, atherosclerosis50 and spinal cord injuries51. Finally, cMos can also take up antigen in tissue and migrate to lymph nodes (LN) where they can act as antigen presenting cells (APC)52, 53. Overall, monocytes provide a plastic and fast acting pool of cells that are intimately involved in inflammation and the maintenance of tissue integrity. 1.2.2 Dendritic cells  DCs are a heterogeneous group of BM-derived cells found in blood, lymphoid tissue and nonlymphoid tissue. DCs have emerged as central controllers of both adaptive and innate immune responses. Through PRRs such as Toll-like receptors (TLR), DCs can recognize   8 foreign microorganisms as well as endogenous danger signals and can initiate appropriate immune responses. Furthermore, DCs are referred to as professional APCs due to their specialized ability to ingest and process antigens and present them in the context of major histocompatibility complex class II (MHC II) and MHC I to CD4+ and CD8+ T cells, respectively, while simultaneously providing additional signals such as cytokines that dictate the nature of the immune response. The heterogeneity of DCs was originally identified in the spleen54, which contains three distinct subsets of cDCs55, 56 plus a subset of cells called plasmacytoid DCs (pDC) that play an important role in viral infection57, 58. The cDC subsets include CD8+CD11b- (CD8+ cDCs) and two subsets of CD11b+CD8- DCs (CD11b+ DCs) that differ in their expression of CD4. Functional equivalents of CD8+ DCs and CD11b+ DCs (CD4+) are found in nonlymphoid tissues, and are distinguished based on the mutually exclusive expression of CD103 and CD11b, respectively59. An additional population of cDCs that are CD11b+CD103+ also exist in the intestinal lamina propria59, 60, 61 and will be discussed in greater detail in section 1.2.3. CD8+/CD103+ cDCs are considered to be particularly important in the host response to viral infection and anti-tumour responses due to their enhanced ability to cross-present antigens to CD8+ T cells62, 63, 64, 65. Conversely, CD11b+ cDCs are thought to play a greater role in initiating CD4+ T cell responses66, 67. 1.2.3 Intestinal mononuclear phagocytes  A complex network of mononuclear phagocytes exists within the intestinal lamina propria (LP) and the gut-associated lymphoid tissue. Although the classification of intestinal MPS subsets is constantly evolving as new studies emerge, it is generally accepted that there are at least three subsets of cDCs as well as a substantial population of tissue-resident   9 macrophages that all express CD11c and MHC II 68, 69, 70.  The two most well described intestinal cDC subsets express the integrin CD103 but differ in their expression of CD11b. As true cDCs, both subsets differentiate from circulating pre-DCs in a Flt3-dependent manner, however CD103+CD11b+ DCs also require granulocyte macrophage colony stimulating factor (GM-CSF, also known as CSF-2) for their development, while CD103+CD11b- DCs do not59, 60, 71, 72. Furthermore, CD103+CD11b+ DCs are found in the LP and their differentiation depends on the transcription factors interferon regulatory factor 4 (IRF4) and Notch260, 61, 73, 74, 75. In contrast, CD103+CD11b- DCs are thought to reside in isolated lymphoid follicles and Peyer’s patches, and depend on basic leucine zipper transcription factor ATF-like 3 (Batf3), IRF8 and inhibitor of DNA binding 2 (Id2) for their development59, 60, 64. While there is debate regarding the migratory potential of the various intestinal mononuclear phagocytes, CD103+ DCs are thought to migrate to the mesenteric LNs (mLN) where they can present antigen and initiate effector and regulatory T cell responses76, 77, 78, 79. The third subset of cDCs has been more recently identified. These Flt3 and IRF4-dependent cells are identified as CD103-CD11b+ and also express CX3CR1 but lack expression of the Fc receptor CD64 (FcγR1)75, 79, 80. These CD103-CD11b+ cDCs are thought to migrate to the mLN and play a role in T helper 17 (Th17) responses75, 79, 80.  The expression of CD64 has recently been identified as an important marker distinguishing macrophages from CD11b+ DCs in nonlymphoid tissues, including the gut81, 82, 83. Tissue-resident gut macrophages can be identified as CD103-CD11b+CD64+ and also express high levels of CX3CR160, 76, 83. Unlike other tissue-resident macrophages, intestinal macrophages are relatively short-lived, with a half-life of approximately three weeks, and are maintained by the influx of Ly6C+ cMos at the steady state60, 61, which acquire a robust anti-  10 inflammatory phenotype upon recruitment to the gut84, 85. The development and maintenance of intestinal macrophages is dependant on CSF-1R and, like other tissue macrophages, they are thought to play important roles in maintaining intestinal homeostasis60, 75.  1.3 Innate lymphoid cells  ILCs have recently emerged as important members of the innate immune system that integrate signals from hematopoietic and non-hematopoietic cells in order to contribute to protective immunity as well as tissue homeostasis and repair3, 86, 87. ILCs are enriched at barrier sites such as the gut and lung but can be found in numerous lymphoid and nonlymphoid tissues including the spleen. The founding members of the ILC family, natural killer (NK) and lymphoid tissue inducer (LTi) cells have been extensively studied over the last 4088 and 1889 years, respectively. However, within the last five years, three distinct groups of non-cytotoxic ILCs, analogous to T helper cell subsets, have been characterized3, 87 (Figure 1.2).   All ILCs are thought to develop from a common progenitor cell called the α-lymphoid precursor (αLP)90, 91, 92, 93. They also share the expression of CD25 (IL-2Rα) and CD127 (IL-7Rα) as well as a lack of lineage markers, but are distinguished based on their expression of transcriptions factors and the cytokines they produce3, 87 (Figure 1.2). Group 1 ILCs (ILC1) express the transcription factor T-box expressed in T cells (T-bet), and can produce interferon-γ (IFNγ) and TNF in response to interleukin 12 (IL-12), IL-15 or IL-1890, 94, 95. ILC1s therefore contribute to type 1 inflammatory responses and are thought to play a role in immunity against intracellular parasites and bacteria90, 96. NK cells were originally thought to be part of ILC1s however recent analysis of the ILC developmental pathway indicates that NK cells are a separate lineage90.  ILC2s express the transcription factor   11 GATA-binding protein 3 (GATA3)97, 98, 99 and the type-2 cytokines IL-4, IL-5, IL-9 and IL-13 as well as amphiregulin. These cells are activated by a variety of cytokines including IL-2, IL-4, IL-33 and thymic stromal lymphopoietin (TSLP), and play important roles in tissue repair responses and in type 2 inflammatory responses during helminth infection and allergy100, 101, 102, 103, 104, 105. The third group of ILCs, ILC3s, include LTi cells and are defined by the expression of the transcription factor RAR-related orphan receptor gamma t (RORγt)106, 107, 108 and the ability to produce IL-22107, 109, 110, 111. ILC3s also express CD90 (Thy1), as do ILC2s, but ILC2s can be distinguished from ILC3s based on the expression of ST2 (IL-33R) by ILC2s87. ILC3s can also produce IL-17A, IL-17F, GM-CSF, and TNF and are involved in maintaining barrier integrity and protection against enteric pathogens107, 109, 110, 111, 112. ILC3s are activated by the type 17 response cytokines IL-23 and IL-1β as well as aryl hydrocarbon receptor (AHR) ligands112, 113, 114, 115.  Although heterogeneity exists within each of the ILC groups, ILC3s have the most defined variety, with at least four distinct subsets, that can be divided into two groups based on CCR6 expression3. CCR6+ ILCs, include LTi cells and can be further subdivided based on CD4 expression116. The CCR6- ILCs can be differentiated into two subsets based on NKp46 expression96. The CCR6- ILCs can also produce IL-22 like their CCR6+ counterparts however they can also turn on expression of T-bet and produce IFNγ in response to IL-1296, 117. The plasticity of ILC3s has been demonstrated in a number of studies, which found that in certain inflammatory environments, ILC3s can respond to IL-12 or IL-18 by decreasing expression of RORγt while increasing T-bet expression. This change in transcription factor expression results in the loss of IL-22 and IL-17 production with a gain of IFNγ production96,   12 116. The adaptability and variety of the ILC3 effector responses make ILC3s invaluable members of the mucosal immune system.  1.4 Intestinal homeostasis and its breakdown in inflammatory bowel disease   The human intestinal tract houses more than 100 trillion microorganisms, collectively termed the gut microbiota, that are separated from the rest of the body by a single layer of intestinal epithelial cells118. These microbes provide many benefits to their host, including promoting the appropriate development of the immune system119, however the close proximity of potentially pathogenic microorganisms with the internal environment puts the host at risk for serious infections. The gut, like other mucosal sites, is therefore reinforced by an elaborate immune system charged with the unique task of tolerating microbial and food antigens while maintaining its ability to recognize and defend against invading pathogens. Complex networks of interactions involving the microbiota, the intestinal epithelium and the underlying immune system have therefore developed and are critical in the maintenance of intestinal homeostasis. Consequently, perturbations in these interactions can lead to  Figure 1.2 The innate lymphoid cell family. The ILC family is made up of NK cells and three groups of non-cytotoxic ILCs. Each group of ILCs can be distinguished based on the expression of transcriptions factors and the cytokines they produce. AHR, aryl hydrocarbon receptor; Areg, amphiregulin; GM-CSF, granulocyte macrophage colony-stimulating factor; IFNγ, interferon gamma; ILC, innate lymphoid cell; LTi, lymphoid tissue inducer; NCR, natural cytotoxicity receptor; NK, natural killer; TNF, tumour necrosis factor; TSLP, thymic stromal lymphopoietin. This figure was reproduced from the manuscript by Artis D, et. al3, with permission from Macmillan Publishers Limited3.     Cytotoxic ILCs Non-cytotoxic ILCsNK0-5фPerforin &granzyme  IL-12IL-15IL-18NK cells T-bet+ ILC1 GATA3+ ILC2 969ʺ[+ ILC3ILC1CD127- CD127+ LTi cells CCR6+ T-bet-ILC1IL-12IL-15IL-18IL-12IL-18ILC2 CD4+ CD4-IL-25IL-33TSLPTL1A03уIL-23AHRligandsCCR6- T-bet+NCR+NCR-03уIL-23AHRligands0-5ф0-5фTNFTNFTNF IL-22IL-17A GM-CSFIL-5IL-4 IL-9IL-13 Areg IL-220-5ф GM-CSF  13 infections or conversely, inflammatory disorders such as IBD in genetically susceptible individuals16.  IBD, which includes Crohn’s disease (CrD) and ulcerative colitis (UC), are chronic, relapsing inflammatory disorders that affect the gastrointestinal (GI) tract. Over 230,000 Canadians suffer from IBD and approximately 9,000 new cases are diagnosed each year120.  The symptoms of these diseases extend beyond the GI tract as IBD patients have a significantly increased risk of developing numerous extraintestinal diseases including psoriasis, arthritis and liver diseases121. They also have a much greater risk of developing colorectal cancer and it has been estimated that CrD patients have a significantly (approximately 47%) increased mortality risk from a variety of causes including cardiovascular disease, infections, cancer, and complications following surgeries120. The etiology of IBD is still largely unknown, however recent genome-wide association studies have highlighted the importance of the epithelial barrier and immune system, and their responses to environmental factors such as the microbiota and diet, in this disease122. There is currently no cure for IBD and many patients are non-responsive to conventional treatments. Therefore understanding the mechanisms that drive intestinal inflammation in order to identifying novel therapeutic targets is an important area of research. 1.5 The importance of pattern recognition receptor signalling in intestinal homeostasis and inflammation  Recognition of the microbiota by intestinal epithelial and immune cells via PRRs, including TLRs and NOD-like receptors (NLR), plays an important role in intestinal homeostasis and immunity. In the steady state, stimulation of PRRs supports intestinal epithelial barrier function123 and maintains the tolerogenic nature of the intestinal immune   14 system124. Indeed, numerous polymorphisms in PRRs16 such as nucleotide-binding oligomerization domain-containing 2 (NOD2), NLRP3 or TLR4, and downstream signalling molecules such as MAL125, have been associated with IBD. Loss of various PRR responses in transgenic mice can lead to the development of spontaneous colitis, as in the case of Tlr5-/- mice126, or can cause increased susceptibility to experimental models of colitis as seen in Tlr2-/-, Tlr4-/-, Myd88-/- 127, 128, or Nod22939iC mice129. Furthermore, >100-fold reduction of the microbiota by the administration of antibiotics increases the severity of colitis induced by the chemical irritant dextran sulfate sodium (DSS), which can be rescued by the reintroduction of the microbial products lipopolysaccharide (LPS) or lipoteich acid (LTA) in the drinking water127. However, the protective effects of PRRs can be lost if proper regulatory mechanisms are not in place.  Uncontrolled inflammatory responses downstream of PRR signalling contribute extensively to the pathogenesis of IBD and murine models of colitis130. Mice deficient in the immunoregulatory cytokine IL-10 develop severe intestinal inflammation131 that is dependent on the microbiota132, 133 and polymorphisms in the genes encoding immunosuppressive cytokines such as IL-10 have also been associated with CrD and UC16. Furthermore, the development of colitis in Rag-/- mice infected with Helicobacter hepaticus is also dependent on PRR-dependent inflammatory responses as loss of myeloid differentiation primary response 88 (MyD88) in the hematopoietic compartment prevents the development of colitis134. In humans, the use of antibiotics135 and fecal stream diversion136 has been shown to induce remission in patients with CD indicating a role for microbial stimuli in the maintenance of pathological inflammation in this disease.    15 1.6 Impact of the microbiota on the host immune system  The presence of the commensal microbiota is critical for the proper development and function of the intestinal and systemic immune systems137, 138, 139. The requirement for commensal microbes in the development and maintenance of the host immune system has been established through the use of germ-free and antibiotic treated mice. For example, germ-free mice exhibit numerous innate and adaptive immune deficiencies including altered development of lymphoid organs, reduced immune cell repertoires, decreased production of immunoglobulin (Ig) A, altered cytokine production profiles, and impaired production of antimicrobial peptides (AMP)137, 138, 139. Although intestinal homeostasis is thought to be maintained by a complex microbiota that works together to regulate the inflammatory tone of the intestinal and systemic immune systems, specific commensal constituents have been identified that can independently alter the steady state and inflammatory host immune responses.   In healthy individuals, the commensal microbiota can promote the development and maintenance of regulatory T (Treg) cells that play critical roles in maintaining intestinal immune tolerance. For example, Bacteroides fragilis as well as a mixture of numerous Clostridia species have recently been found to promote the induction of intestinal Foxp3+ Treg cells by various mechanisms140, 141, 142. B. fragilis is thought to induce Treg cells by promoting tolerogenic DC responses via the expression of polysaccharide A143, 144. Interestingly, B. fragilis may also help mediate intestinal immune responses by supporting Th1 responses145. Alternatively, the ability of the mix of Clostridia to promote Treg cells has been associated with their ability to produce short-chain fatty acids (SCFA) such as butyrate, as a metabolic by-product as well as the induction of increased active transforming growth   16 factor beta (TGF-β)141, 142, 146, 147. Regulation of intestinal immune responses by commensal-derived metabolic by-products such as SCFAs has recently emerged as an important mediator of host-microbial interactions137. One recently identified example of this, is the production of the tryptophan metabolite indole-3-aldehyde by a species of Lactobacillus in response to a tryptophan-enriched diet. This metabolite acts as an AHR ligand and induces the expression of IL-22 by ILC3s, which was found to provide protection against fungal infection148.  Another group of commensal bacteria termed segmented filamentous bacteria (SFB) that are present in numerous vertebrates including mice, chickens, and paediatric humans, have also been identified as important regulators of effector T and B cell responses149. SFB are well-established inducers of intestinal and systemic Th17 cells and can also promote Th1 responses and IgA production in mice150, 151, 152, 153. The presence of SFBs has been associated with protective immune responses against enteric infections such as Citrobacter rodentium151 however they have also been implicated in pathogenic proinflammatory T cell responses154 in diseases such as arthritis155 and experimental autoimmune encephalomyelitis156. The mechanisms of SFB-induced regulation of T cell responses is still unclear but may involve a number of pathways including the induction of serum amyloid A production151, their potential to produce SCFAs157, 158, 159, and/or the presentation of SFB-derived antigens by intestinal DCs to T cells150, 152, 160.  Together the commensal microbiota acts as an important regulator of host immune responses through a variety of mechanisms that include the production of metabolites such as SCFAs and AHR ligands, stimulation of immune cells via cell wall constituents such as polysaccharide A, as well as the provision of antigens that can be presented to T and B cells   17 by intestinal APCs137. Conversely changes in host immune responses can have profound impacts on the composition of the microbiota. This can result from alterations in innate mechanisms such as the production of antimicrobial peptides including RegIIIγ161, and ILC production of IL-22162, or changes in adaptive immune responses such as IgA production163, 164. The importance of the immune system in regulating pathogenic and commensal organisms will be discussed further in chapters 3 and 4.  1.7 The intestinal mononuclear phagocyte system mediates intestinal inflammation and homeostasis The intestinal MPS plays a central role in mediating the balance between tolerogenic and proinflammatory responses in the GI tract. In this way, MPS cells in the gut are central to maintaining homeostasis while simultaneously maintaining an ability to induce robust inflammatory responses when faced with infiltrating infectious microorganisms. The balance between tolerogenic and inflammatory responses is therefore critical to host health as its breakdown can lead to potentially lethal infections or conversely the development of destructive inflammatory responses that can lead to chronic diseases such as IBD. In IBD, DCs may contribute to inflammatory pathology by inappropriately responding to microbial products. DCs isolated from the intestinal mucosa of patients with IBD exhibited increased expression of TLR2 and TLR4 and produced more pro-inflammatory cytokines in response to LPS, compared to healthy controls165. A pro-inflammatory role for intestinal DCs has also been observed in animal models of intestinal inflammation. Intestinal DCs contribute to spontaneous T cell proliferation in lymphopenic hosts by producing IL-6. Production of IL-6 is MyD88-dependent and is required to drive pathogenic T cell responses that lead to T cell transfer colitis in Rag-/- mice166. DCs can also   18 contribute to inflammation in the DSS-model of colitis as depletion of DCs during the later stages (days 5-7) of acute colitis reduces the severity of inflammation167. Furthermore, the accumulation of Ly6C+ cMo-derived effector monocytes and macrophages during DSS-induced colitis has also been associated with the pathogenesis of this disease61.  These inflammatory attributes of DCs and macrophages seem to conflict with the anti-inflammatory or “tolerogenic” phenotype that has been associated with intestinal mononuclear phagocytes. This can be explained however by the existence of various intestinal mononuclear phagocyte subsets with different inflammatory properties, and by the changes observed in the MPS during inflammation. The tolerogenic/anti-inflammatory nature of the intestinal mucosa during the steady state is mediated at least in part by the induction of Treg cells by CD103+ DCs as well as by intestinal-resident macrophages112, 168, 169. These DCs can migrate from the LP to the mLN where, via the production of TGF-β and retinoic acid (RA), they induce Foxp3+ Treg cell development170, 171 and the expression of gut homing receptors78 such as CCR9 and α4β7 integrin, on T cells. Furthermore intestinal macrophages have also been implicated in restricting proinflammatory Th1 responses, and disruption of macrophage signalling via specific deletion of STAT3 within macrophages, resulted in the spontaneous development of chronic enterocolitis associated with increased Th1 responses172. In contrast, both CD11b+CD103+ DCs and CD11b+CD103- DCs have been associated with induction of Th17 responses79, 80, 168, 173. SIRPα+CD103- and CD70hiCD103- mononuclear phagocytes have also been associated with Th17 responses and are pathogenic in the TNBS174 and T cell transfer175 models of colitis, respectively. During inflammation, changes in the composition and phenotype of the DC and macrophage compartments may contribute to the inflammatory environment in the gut. A decrease of CD103+ DCs in the LP   19 is observed during inflammation176 and one study observed a shift towards an inflammatory phenotype in these DCs in the mLN177. Furthermore an increase of pro-inflammatory DCs such as E-cadherin+ DCs178, during inflammation also serves to heighten the inflammatory milieu of the intestine179. Finally, the phenotype of incoming Ly6C+ cMos is dramatically impacted by the inflammatory tone of the intestine. At steady state, cMos are imprinted, through a yet unknown mechanism, with a robust anti-inflammatory phenotype as they develop into gut-resident macrophages. These macrophages are thought to maintain their anti-inflammatory phenotype during inflammation however newly recruited cMos that become CX3CR1int macrophages, take on a pro-inflammatory phenotype and can contribute to intestinal inflammation84, 85, 180, 181. 1.8 Type 17 responses by CD4+ T cells and ILCs in intestinal homeostasis and inflammation  The intestine houses an extensive T cell compartment composed of CD4+ and CD8+ T cell receptor αβ+ (TCRαβ) T cells as well as γδ T cells, NKT cells and mucosal-associated invariant T cells182.  T cells can be found within organized lymphoid tissue such as the mLNs and Peyer’s Patches, which are the sites for induction of T cell responses, and within the LP and intestinal epithelium, which constitute the effector sites. Many of the T cells present in the LP are CD4+ T cells including Th1, Th2, Th17 and Treg cells182. The enrichment of Th17 cells and the induction of Treg cells at mucosal sites suggests an important role for these cells in mucosal immunity and homeostasis. The presence of increased IL-17 in the intestines of patients with CD and UC183, 184 and the association of IL-23R polymorphisms with IBD185 has sparked immense interest in the role of Th17 cells and their associated cytokines in intestinal inflammatory responses. As indicated above, DCs play a major role in the   20 induction of Th17 and Treg cells. In mice, the production of TGF-β supports the differentiation of both cell types however TGF-β plus RA induces Foxp3+ Tregs170 while TGF-β in the presence of IL-6186, 187, 188 or IL-21189, 190 drives Th17 differentiation. The inverse relationship between these two cell types is further driven by IL-23. IL-23 maintains Th17 populations191, 192 and has been reported to suppress induction of intestinal Foxp3+ CD4+ T cells193, 194.  Th17 cells are a heterogeneous group of cells that produce varied combinations of cytokines including IL-17A, IL-17F, IL-21, IL-22 and IFNγ192. These cytokines have been associated with both protective and destructive roles in the intestine. IL-17A and IL-22 support epithelial barrier function195, 196, 197 and the production of AMPs198, 199 and can limit disease severity in DSS-induced colitis200, 201, 202.  IL-22 also provides protection from T cell transfer-induced colitis202. Conversely, IL-17F and IL-21 drive inflammation in the DSS model of colitis201, 203 and IL-17A and IL-17F have redundant, pro-inflammatory effects in the T cell transfer model of colitis204. The inflammatory role of IL-17A and IL-17F is likely attributed to their ability to stimulate the production of pro-inflammatory cytokines and chemokines such as TNFα, IL-6 and CXCL1 by myeloid and endothelial cells205. Although IFNγ is generally considered a type 1 response cytokine, Th17 and ILC3 cells can be induced to express IFNγ together with IL-17. The expression of IFNγ by Th17 cells is often associated with pathological inflammation and autoimmune diseases such as CD206, 207, arthritis208, and multiple sclerosis209 in humans, as well as in mouse models of colitis194, 210, 211 and experimental autoimmune encephalomyelitis212, 213, 214.    21 In addition to Th17 cells, ILC3s can also produce IL-17, IL-22 and IFNγ in the gut86. Like Th17 cells, these cells express the IL-23 receptor and the transcription factor RORγt. NKp46+ 107, 215 and CD4+ ILC3s111, 216, 217 contribute to intestinal homeostasis and immunity via the production of IL-22, and by IL-17 production from CD4+ ILC3s216, 218.  ILC3s also contribute to intestinal homeostasis by supporting Treg induction via microbiota-dependent interactions with intestinal macrophages112, and by interacting directly with CD4+ T cells via MHC II to limit commensal antigen specific Th17 cell responses219. Conversely, CD4-NKp46- ILC3s have pro-inflammatory effects in the intestine through the production of IL-17 and IFNγ. The IL-23-induced production of IFNγ or IFNγ plus IL-17 drives intestinal inflammation in the anti-CD40 and Helicobater hepaticus induced models of colitis220. Both, DCs and PRRs are involved in ILC3 production of IL-22. For example, DCs are required for IL-22 production by ILC3s in response to flagellin216, 221, and TLR2 agonists induce IL-22 expression by ILCs222. The interactions that occur between DCs and ILC3s are still largely unknown however, stimulation of LTβR on DCs by lymphotoxin-expressing ILC3s was recently found to drive production of IL-22 by ILC3s, likely via DC-derived IL-23217. Together, ILC3s and Th17 cells are important mediators of intestinal homeostasis but also have the capacity to drive inflammatory responses that can be detrimental to the host. 1.9 Lyn tyrosine kinase  The Lyn tyrosine kinase is a member of the Src family of membrane associated tyrosine kinases (SFK) that is expressed throughout the hematopoietic system, with the exception of T cells and some ILCs1, 223, and in non-hematopoietic cells such as epithelial cells224, 225, 226. Lyn acts as an important signalling modulator by playing roles in activating and inhibitory signalling cascades downstream of a number of integrins and cell surface   22 receptors such as cytokine receptors, chemokine receptors, and immunoreceptors, resulting in the regulation of a number of biological processes including cell differentiation, proliferation, adhesion, and immune responses2, 227, 228. Lyn is structurally similar to other SFKs, including the presence of a unique N-terminal domain that contains a myristoylation and a palmitoylation site that are important for localization within the plasma membrane. Next to the unique domain are the Src homology 3 (SH3) and SH2 domains that mediate Lyn’s interactions with proteins containing proline rich motifs and phosphotyrosine residues, respectively. Following the SH2 domain is a linker domain and the kinase domain that accounts for the catalytic activity of Lyn (Figure 1.3)1.    Lyn is activated by ligand binding to cell surface receptors and its activity is modulated by its phosphorylation status and its interactions with other proteins through its SH2 and SH3 domains. In its inactive state, Lyn has a closed conformation in which its SH2 domain is bound to the phosphorylated C-terminal inhibitory tyrosine residue Y508, and its SH3 domain is bound to a proline rich motif in the linker domain (Figure 1.4)229. Activation  Figure 1.3 Functional domains of Lyn. Schematic of Lyn’s structural domains. N-terminal unique domain contains a myristoylation and a palmitoylation site that are important for localization to the plasma membrane. Next to the unique domain are the SH3 and SH2 domains followed by the linker domain that contains a proline rich region (P) and the kinase domain that contains the activating tyrosine Y397. The inhibitory tyrosine Y508 is located in the C-terminal. This figure was reproduced from the manuscript by Ingley E1 with permission from Biomed Central Limited as part of the open access agreement.    23 of Lyn occurs through a series of events that involve dephosphorylation of the inhibitory Y508 by phosphatases such as CD45 or Src-homology 2 domain-containing phosphatase 2 (SHP-2)230, 231, and interactions of its SH2 and SH3 domains with other proteins to allow for the release of the closed confirmation1. Finally Lyn’s kinase activity is maximized by the trans-autophosphorylation of the activating tyrosine residue Y397 in the activation loop of its kinase domain1, 232. Inactivation of Lyn can occur by dephosphorylation of Y397 by phoshatases such as SHP-1233, and by phosphorylation of Y508 by C-terminal Src kinase (Csk) resulting in reconfiguration to a closed structure234, 235. Lyn’s activity can also be regulated by its location within the cell. For example, interactions with certain adaptor molecules allows it to localize to lipid rafts within the plasma membrane, whereas interactions with caspase 3 or 7 can result in cleavage at the N-terminal resulting in its cytosolic localization where it can no longer mediate membrane signalling cascades236, 237, 238.    24   Unlike other SFKs, which primarily act as positive regulators of signalling pathways, Lyn has important roles in both activating and inhibitory signalling2. Lyn can mediate activating signalling via phosphorylation of immunoreceptor tyrosine-based activating motifs (ITAM) in membrane proteins such as CD19 and Igα/β within the B cell receptor, that recruit proteins such as Syk to enhance signalling. In contrast, Lyn can mediate inhibitory signalling by phosphorylating immunoreceptor tyrosine-based inhibitory motifs (ITIM) in inhibitory proteins such as signal regulatory protein alpha (SIRPα) and paired Ig-like receptor B (PIR-B) that can then recruit inhibitory molecules such as SHP-1, SHP-2 and SH2-containing inositol phosphatase 1 (SHIP-1) (Figure 1.5). Lyn can also regulate signalling pathways by directly phosphorylating signalling molecules such as SHIP-1 and the DOK family proteins2, 4, 227, 228.  Figure 1.4 Active and inactive structures of Lyn. Activation of Lyn occurs through a series of events that involve dephosphorylation of the inhibitory Y508 by phosphatases and interactions of its SH2 and SH3 domains with other proteins to allow for the release of the closed confirmation. Lyn’s kinase activity is maximized by the trans-autophosphorylation of the activating tyrosine residue Y397 in the activation loop of its kinase domain. Inactivation of Lyn can occur by dephosphorylation of Y397 and by phosphorylation of Y508 by Csk resulting in the reconfiguration to a closed structure. Figure is an adaptation of a figure from Hibbs M, and Harder KW, 20062.    25  Lyn is a critical regulator of pathways involved in leukocyte survival, proliferation, adhesion, and hematopoiesis4, 227. Consequently, loss of Lyn expression in Lyn-/- mice leads to severe perturbations in hematopoiesis resulting in age-dependent splenomegaly and myeloproliferative diseases239, 240, as well as atopy241 and autoimmune disease242. Conversely, the expression of a gain-of-function form of Lyn (LynY508F) in Lyn “knock-in”  Figure 1.5 Lyn is a positive and negative regulator of immune cell signalling. Schematic representation of the model of Lyn’s role in inhibitory and activating signalling pathways. Unlike other SFKs, Lyn plays important roles in positive and negative signalling downstream of cytokine receptors, integrins and inhibitory molecules such as PIR-B. Lyn acts as a positive regulator of signalling by phosphorylating tyrosine residues in receptors containing ITAMs which recruits kinases such as Syk. Conversely Lyn inhibits signalling by phosphorylating tyrosine residues ITIMs in proteins such as PIR-B, which leads to the recruitment of inhibitory phosphatases such as SHP-1 and SHIP-1. By regulating signalling thresholds, Lyn can modulate downstream responses such as cell development, survival, and activation. This figure was reproduced from a manuscript by Scapini P, et. al, with permission from John Wiley & Sons A/S4.    26 (Lynup) mice also leads to alterations in the development and function of the immune system, including the loss of a functional B cell compartment227. 1.9.1 The role of Lyn in mononuclear phagocyte development  Lyn is expressed throughout the MPS, from early myeloid progenitor cells to functionally mature and differentiated cells. Overall, Lyn has been established as an important negative regulator of signalling downstream of cellular receptors in myeloid cells involved in myelopoiesis as well as survival, proliferation, and adhesion of mature myeloid cells including mononuclear phagocytes4. The role of Lyn as a negative regulator of myelopoiesis was definitively identified using Lyn deficient mice. Lyn-/- mice exhibit age-dependent expansion of myeloid cells and their progenitors, which results in the development of myeloproliferative disease involving splenomegaly239, 240. This includes a significant age-dependent increase in myeloid cells in blood, spleen and BM, as well as an increase in cells with myeloid progenitor capacity in the spleens of Lyn-/- mice239, 240, 243. The complete mechanism of Lyn-mediated restriction of myelopoiesis remains to be elucidated however it is clear that Lyn is involved in multiple aspects of this process. BM progenitor cells from Lyn-/- mice are hypersensitive to CSF-1 and GM-CSF resulting in increased cellular output in BM-derived macrophage and DC cultures, respectively, compared to WT mice4, 240.  The age-dependent expansion of myeloid cells in Lyn-/- mice is independent of the adaptive immune system but depends on a feed-forward loop involving B cell activating factor belonging to the TNF family (BAFF) and IFNγ243. Interestingly, the myeloproliferative disease is dependent on MyD88 signalling, suggesting a role for TLR or IL-1 signalling244. Lyn, together with Hck, another SFK, are thought to inhibit myelopoiesis by recruiting the inhibitory phosphatase SHIP-1 to the plasma membrane. Mice deficient in Hck do not exhibit   27 any major alterations in their myeloid compartment, however Lyn-/-Hck-/- mice develop an exaggerated myeloproliferative disease compared to Lyn-/- mice, suggesting some functional redundancy between these two SFKs245. Furthermore, the myeloproliferative disease can be corrected in Lyn-/-Hck-/- mice by the expression of a constitutively membrane bound form of SHIP-1245. Consistent with this, Ship-1-/- mice exhibit similar myelopoietic defects as Lyn-/- mice239. Interestingly, unlike many other Lyn-mediated inhibitory signalling pathways, Lyn may mediate its inhibitory signalling through pathways independent of the major myeloid cell inhibitory receptors PIR-B and SIRPα, since loss of either of these molecules does not result in myeloproliferative diseases246, 247. 1.9.2 The role of Lyn in dendritic cells Aside from its role in the development of mononuclear phagocytes, Lyn is an important regulator of inhibitory and activating signalling downstream of numerous cytokine receptors, adhesion molecules, and PRRs in monocytes, macrophages and DCs2, 4. Lyn is a negative regulator of DC generation both in vitro and in vivo, and in cytokine withdrawal induced apoptosis. However, Lyn seems to play a positive role in DC maturation and responses to microbial associated molecular patterns (MAMP) such as LPS241, 248, 249. Primary and BM-derived Lyn-/- DCs exhibit a hypomature phenotype at steady state and in response to LPS, with decreased expression of MHC II and co-stimulatory markers such as CD80, whereas increased Lyn activity in Lynup DCs results in a hypermature phenotype 241, 248, 249. Lyn in DCs also regulates the tone and magnitude of response to MAMPs such as LPS. Lyn-/- DCs produce decreased IL-12 and increased IL-10 in response to LPS while Lynup DCs produce increased IL-12 and decreased IL-10, compared to WT DCs248, 249. These differences in DC maturation and activation result in their altered interactions with other   28 immune cells. For example, Lyn-/- DCs are impaired in their ability to induce antigen specific Th1 responses, and instead promote type 2 inflammatory responses that drive a model of allergic lung inflammation241. Furthermore, increased Lyn signalling results in a striking hypersensitivity to LPS in vivo that depends on DC-mediated activation of IFNγ production by NK cells249. Although the role of Lyn in TLR responses has been somewhat controversial, a number of studies have observed activation of Lyn in response to MAMPs such as LPS and CpG250, 251, 252, 253, 254 and the use of Lyn gain-of-function mutant mice has clearly indicated an in vivo role for Lyn in PRR responses249. 1.9.3 The role of Lyn in monocytes and macrophages  The role of Lyn in macrophages has been largely studied in the context of cytokine and integrin signalling and, as in DCs, Lyn is primarily involved in inhibitory signalling in these cells. The role of Lyn in monocytes is largely understudied however many of the studies involving Lyn in macrophages and DCs were performed with CSF-1 derived BM-macrophages (BM-MΦ) and GM-CSF derived BM-DCs, which are likely similar to monocyte-derived cells in vivo. Therefore, the lessons learned about Lyn in these cells may provide evidence for Lyn’s role in monocytes.   Lyn inhibits signalling downstream of both CSF-1 and GM-CSF receptors in macrophages4, 255. In response to GM-CSF, Lyn-/- BM-MΦ exhibit decreased phosphorylation of PIR-B, SIRPα, and Dok-1, suggesting Lyn is acting through these inhibitory proteins4. Lyn may also act through Dok-1 downstream of CSF-1R. Lyn was found to inhibit Akt activation downstream of CSF-1R signalling in macrophages via SH2-domain mediated interactions with SHIP-1 that led to stabilization of SHIP-1255. As in BM-DCs, Lyn was also found to negatively regulate cytokine withdrawal induced survival in macrophages240.   29  By recruiting SHP-1 through PIR-B and SIRPα ITIM phosphorylation, Lyn is also a negative regulator of integrin signalling in macrophages during adhesion-dependant activation, and Lyn-/- macrophages exhibit a hyper-adhesive phenotype256. Furthermore, Lyn was recently identified as a negative regulator of monocyte adhesion to endothelial cells via lymphocyte function-associated antigen 1 (LFA-1)257, which is an important mechanism of monocyte attachment to endothelial cells in vivo. Interestingly Lyn may also play a positive role in adhesion downstream of the scavenger receptor A (SR-A)258, highlighting the importance of Lyn as both an inhibitor and activator of signalling in mononuclear phagocytes. Lyn has also been implicated in chemokine signalling and myeloid cell migration however, migration assays utilizing Lyn deficient cells are difficult to interpret due to their hyper-adhesive phenotype. A recent study using Lyn-/-Hck-/-Fgr-/- triple knock-out mice found no alteration in myeloid cell recruitment to inflamed tissues in a variety of inflammation models including autoantibody-induced arthritis and a model of skin blistering disease259. This suggests that migration of these cells is not impaired in vivo, however a possible upregulation of Src activity in these mice could compensate for the loss of the other three SFKs. Finally, Lyn is also activated downstream of FcγRs260, 261 however its role in signalling is thought to be redundant with other SFKs and further studies will need to be performed to understand Lyn’s role in FcγR mediated phagocytosis4. Overall, Lyn is a critical regulator of mononuclear phagocyte development, survival, cytokine responsiveness, and responses to microbial products. Modulating Lyn activity in MPS cells therefore provides a useful and important tool to study in vivo homeostasis of the MPS and the function of these cells in the context of inflammatory and microbial stimuli.   30 1.10 Research objectives and hypotheses   The importance of Lyn in innate and adaptive immune homeostasis and its emerging role as a regulator of PRR responses suggests that Lyn may be an important mediator of intestinal homeostasis and inflammation. However Lyn’s role in this compartment had never been investigated. We therefore hypothesized that modulation of PRR responses by Lyn in innate immune cells alters host-microbial interactions that regulate intestinal homeostasis and inflammation. To investigate this hypothesis we first questioned whether altered Lyn activity in Lyn-/- and Lynup mice affected the outcome of an experimental model of colitis induced by DSS. These studies identified Lyn as a protective factor against DSS colitis. I therefore sought to understand how increased Lyn signalling provided protection from disease and conversely how Lyn deficiency resulted in susceptibility to intestinal inflammation, and whether Lyn mediated changes in host-microbial interactions were involved in these disease susceptibility phenotypes. The results from these studies are described in chapters three and four of my dissertation, respectively. Finally, given the importance of monocyte derived cells in intestinal homeostasis and inflammation, and the lack of understanding of Lyn’s role in monocytes, we sought to investigate the role of Lyn in systemic monocyte homeostasis, with an emphasis on distinguishing Lyn’s role in pMos compared to cMos. As a known regulator of the MPS and CSF-1R signalling, which plays critical but differing roles in cMos versus pMos, we hypothesized that Lyn may play distinct steady state roles in cMo and pMo homeostasis and that Lyn may regulate monocyte populations by regulating CSF-1R signalling. The results of these studies are described in chapter five of this dissertation. Overall, the body of work I performed during my PhD has provided a novel understanding of   31 Lyn’s role in intestinal homeostasis and inflammation, as well as in systemic monocyte homeostasis.     32 Chapter 2: Materials and methods   33 2.1 Animals  Lyn-/-, Lynup, Rag-/-, Rag-/-Lyn-/-, Rag-/-Lynup, CD11c-DTR/GFP, CD11c-DTR/GFP-Lynup mice were previously described240, 242, 249 and were on a C57BL/6 (>10 generation) background.  Some experiments were performed with Lyn+/up mice (indicated in figures), which exhibit an intermediate gain-of-function phenotype consistent with the dominant nature of the mutant allele240, 249. Mice were bred in house and housed in specific pathogen–free microisolator cages and fed autoclaved food and reverse-osmosis water. Animal experimentation was performed according to U.B.C Animal Care Committee and the Canadian Council of Animal Care guidelines.  All mice were age- and sex-matched in each experiment. 2.2 Animal rederivation, chimerism and cell depletions For rederivation (performed by the Centre for Disease Modeling Transgenic Core Facility, UBC), Lyn-/- embryos were harvested from pregnant females 2.5 days post-coitum and were surgically implanted in specific pathogen-free pseudo-pregnant CD1 foster mothers. Pups were born naturally and were kept with foster mothers until the time of weaning. For BM chimeric mice, B6.SJL-Ptprca Pepcb/BoyJ (BoyJ) recipient mice were subjected to lethal irradiation (650 rads, 2 doses, 4 hours apart) and one day later were injected with 5-8x106 C57BL/6 or Lyn-/- BM cells by intravenous (i.v.) injection. Mice were allowed to reconstitute for at least 8 weeks prior to analysis of systemic monocyte populations or 14 weeks for DSS treatments. For B cell depletion experiments, mice were treated with 100µg i.v. of anti-CD20 monoclonal antibodies (clone 5D2, isotype IgG2a, Genentech) or an isotype control (anti-human OKT3, IgG2a, Biomedical Research Centre Ablab) on days -4 and -2 prior to DSS treatment. B cell depletion was confirmed by flow   34 cytometry at the end of the experiment (day 7). Chimerism was verified by flow cytometry based on the chimeric marker CD45 (CD45.1 versus CD45.2). 2.3 Experimental colitis and colitis-associated cancer DSS colitis Unless otherwise indicated, mice were treated with 2.5% (w/v) of DSS (36,000-50,000 Da, MP Biomedicals, or 40,000-50,000 Da, Affymetrix, with both inducing similar disease) ad libidum in sterile drinking water for 7 days. Mice were supplied with fresh DSS every other day and body weight and rectal bleeding were recorded daily. For some experiments, mice received a cocktail of antibiotics262 containing 0.5g/L each of ampicillin trihydrate, metronidazole (Sigma-Aldrich), gentamicin sulfate, neomycin trisulfate and 0.25g/L vancomycin hydrochloride (Toku-E) plus 2.5% (w/v) sugar in their drinking water for a total of 5 weeks. At the beginning of the antibiotic treatment, if mice were not drinking sufficiently, the dose of metranidazole was lowered and gradually increased as mice adjusted to the taste. During the fourth week, the antibiotic cocktail was supplemented with 10µg/ml LPS (E. coli 0127:B8, Sigma-Aldrich) or nothing and 2.5% DSS (as above) was added during the fifth week. Mice were then given sterile drinking water for an additional 7 days. For co-housing experiments, female mice were co-housed for 4 weeks prior to DSS treatment. Mice were weighed and monitored for rectal bleeding twice per week during antibiotic treatment and daily during DSS treatment and recovery periods. Mice that lost greater than 20% initial weight or that became moribund were euthanized. Chronic inflammation and colitis-associated cancer (CAC) were induced using an adaptation of a previously described protocol263. On day 0, mice were administered a single intraperitoneal (i.p.) injection of 10mg/kg azoxymethane (AOM, Sigma-Aldrich) and were given 2.5% DSS ad libidum in sterile drinking water, followed by 14 days recovery on sterile water. Mice   35 were subjected to three cycles of DSS treatment and recovery with an experimental endpoint of day 63. Body weight, rectal bleeding and fecal occult blood were recorded daily during DSS cycles and every other day during recovery periods. At the experimental endpoint, colons were isolated, opened longitudinally and macroscopic tumors were counted and measured. Rectal bleeding for all DSS experiments was scored using the following system: 0=no blood, visible or occult, 1=diarrhea or occult blood detected, 2=mild rectal bleeding, 3=moderate rectal bleeding, 4=severe rectal bleeding. Intestinal pathology was scored as following: 1=mild mucosal, 2=mild multifocal, 3=moderate multifocal, 4=severe multifocal. See Table 2.1 for more information. For IL-22 neutralization experiment mice were given 2% DSS in sterile drinking water for 7 days followed by 7 days of recovery. Mice were treated with 250µg of anti-IL-22 monoclonal antibody (mIL-22-03, Pfizer) or isotype control (Biomedical Research Centre Ablab) by i.p. injection on days -4, -1, 2, and 5 of DSS treatment and mouse weight and health were assessed daily. Table 2.1 DSS induced colitis score Score Definition 1 Mild mucosal (well defined crypts, little to no epithelial damage, few mononuclear cells) 2 Mild multifocal (clearly defined crypts with minor separation from underlying muscle, minor epithelial sloughing, goblet cell depletion, mononuclear and polymorphonuclear cell infiltration) 3 Moderate multifocal (poorly defined crypt structure and crypt abscesses, epithelial destruction with ulceration, increased goblet cell depletion, increased mononuclear cell and polymorphonuclear cell infiltration in submucosa) 4 Severe multifocal (crypt destruction, elimination or complete detachment of epithelium, significant mononuclear cell and polymorphonuclear cell infiltration into mucosa and submucosa)    36 2.4 Bacterial infections Bacterial Preparation: S. Typhimurium strain SL1344 and C. rodentium strain DBS100 were grown overnight in 3 and 5 ml of Luria broth, respectively, at 37°C with shaking (200 rpm). Bacteria were then washed and resuspended in HEPES buffer for infection by oral gavage.  Salmonella-induced gastroenteritis: 24 hours prior to infection, mice were treated orally with 20mg streptomycin sulfate (Sigma-Aldrich) diluted in HEPES buffer followed by oral infection with 3x106 S. Typhimurium SL1344.  Typhoid model: Mice were infected orally with 1x106 S. Typhimurium strain SL1344. Citrobacter rodentium: Mice were infected orally with 1x108 C. rodentium DBS100. 2.5 Intestinal histology Colons were isolated and cross-sections of distal colon were fixed in 10% neutral buffered formalin, embedded in paraffin and stained with hematoxylin and eosin. All bright field microscopy images were captured using the Olympus BX61 microscope (Olympus), using 4X and 10X apochromatic objective lenses, and an Olympus colour CCD camera.  All images were obtained using Olympus CellSens Dimension software and processed using the software Picasa (Google). Distal colon sections from AOM/DSS treated mice were assessed by a trained pathologist to identify tumour type and characteristics. Pathological scores were determined for S. Typhimurium264 and C. rodentium265 induced pathology as outlined in Table 2.2 and Table 2.3. Table 2.2 Salmonella induced gastroenteritis score Score Type Description Total Score Luminal score + surface epithelial score + mucosal score + submucosal score   37 Score Type Description Luminal Score Sum of scores Empty 0 Necrotic epithelial cells 1 = scant, 2 = moderate, 3 = dense PMNs 1 = scant, 2 = moderate, 3 = dense Surface Epithelial Score Sum of scores No pathological change  0 Regenerative change 1 = mild, 2 = moderate, 3 = severe Desquamation 1 = patchy, 2 = diffuse PMNs in epithelium 1 Ulceration 1 Mucosal Score Sum of scores No pathological change  0 Crypt abscesses 1 = rare (15%), 2 = moderate (15-50%), 3 = abundant (>50%) Mucinous plugs 1 Granulation tissue 1 Submucosal Score Sum of scores No pathological change  0 Mononuclear cell infiltrate 0 = one small aggregate, 1 = more than one aggregate, 2 = large aggregates plus increased single cells PMN infiltrate 0 = none, 1 = single, 2 = aggregates Edema 0 = mild, 1 = moderate, 2 = severe  Table 2.3 C. rodentium induced pathology score Score Type Description Total Score Submucosal edema + goblet cell depletion + epithelial hyperplasia + epithelial integrity Submucosal edema 0 = no change, 1 = mild, 2 = moderate, 3 = profound Goblet cell depletion Number of goblet cells per high-power field averaged from five fields at 400x magnification where 0 = > 50, 1 = 25–50, 2 = 10–25, 3 = < 10 Epithelial hyperplasia Percentage above height of the control, where 0 = no change, 1 = 1–50%, 2 = 51–100%, 3 = ≥ 100% Epithelial integrity 0 = no change, 1 = < 10 epithelial cells shedding per lesion, 2 = 11–20 epithelial cells shedding per lesion, 3 = epithelial ulceration, 4 = epithelial ulceration with severe crypt destruction    38 2.6 Quantitative analysis of murine gene expression  At the experimental endpoint, 0.5cm of colon tissue was stored in 250ml RNAlater (Qiagen) and frozen at -80°C. Tissue was homogenized using a GentleMACS Tissue Dissociator (Miltenyi Biotec) in buffer RLT from the RNA Easy kit (Qiagen) and total RNA was isolated from homogenate according to manufacturer’s instructions with DNAse I digestion. Alternatively, RNA was isolated using Trizol Reagent (Sigma) followed by oligo (dT) purification of mRNA as previously described 266. Synthesis of cDNA was performed using iScript cDNA Synthesis Kit. Quantitative real-time PCR was done using iQ Syber Green Supermix or SsoFast EvaGreen Supermix (Bio-Rad) and the Bio-Rad CFX96 real-time system and the primers listed in Table 2.4. RegIIIg and RegIIIb expression was quantified using the MmReg3g1SG QuantiTect Primer Assay (Qiagen), primer sequence was not available from manufacturer. Gene expression of each target was calculated relative to the house-keeping genes Gapdh or Rps29. Table 2.4 Murine qPCR primers Primer Name Sequence GAPDH Fwd: ATTGTCAGCAATGCATCCTG Rev: ATGGACTGTGGTCATGAGCC RPS29 Fwd: ACGGTCTGATCCGCAAATAC Rev: CATGATCGGTTCCACTTGGT IFNγ Fwd: CACGGCACAGTCATTGAAAGCCTA Rev: TGCCAGTTCCTCCAGATATCCAAG IL-17A Fwd: GGACTCTCCACCGCAATGA Rev: GGCACTGAGCTTCCCAGATC IL-22 Fwd: GCTGGACTCCCTTGTGTGT Rev: CACATGGCCTCAGTCTCAA IL-23p19 Fwd: GCCCCGTATCCAGTGTGAAG Rev: CGGATCCTTTGCAAGCAGAA MUC1 Fwd: AGGAGGTTTCGGCAGGTAAT Rev: TCCTTCTGAGAGCCACCACT RORγt Fwd: CCGCTGAGAGGGCTTCAC Rev: TGCAGGAGTAGGCCACATTACA   39 2.7 Bacterial quantitative PCR Fecal pellets were isolated from mice, homogenized using a Mixer Mill (Retsch), and total DNA was isolated from fecal samples using the QIAamp DNA stool kit (Qiagen) according to manufacturer’s instructions. Quantitative PCR was performed on a 7500 Fast Real-Time System (Applied Biosystems) using Quantitec SYBR Green mastermix (Qiagen). Alternatively, fecal DNA was isolated by two sequential phenol-chloroform extractions and quantitative PCR was done using SsoFast EvaGreen Supermix and the Bio-Rad CFX96 real-time system with the primers listed in Table 2.5. In all figures, group-specific bacterial abundance was determined relative to Eubacteria and is expressed as a relative abundance.  Table 2.5 Bacterial qPCR primers Primer Name Sequence Eubacteria UniF340: ACTCCTACGGGAGGCAGCAGT  UniR514: ATTACCGCGGCTGCTGGC Lactobacillus/Lactococcus LabF362: AGCAGTAGGGAATCTTCCA LabR677: CACCGCTACACATGGAG SFB SFB736F: GACGCTGAGGCATGAGAGCAT SFB844R: GACGGCACGGATTGTTATTCA Clostridium coccoides cluster ClccF: ACTCCTACGGGAGGCAGC  ClccR: GCTTCTTAGTCAGGTACCGTCAT Helicobacter hepaticus B38: GCATTTGAAACTGTTACTCTG B39: CTGTTTTCAAGCTCCCC  2.8 IgA quantification IgA concentrations were measured in serum and feces by ELISA (Affymetrix eBioscience) according to the manufacturers instructions. Fecal protein suspensions were obtained by resuspending fecal pellets, previously frozen at -80oC, in 10µl/mg of feces of MTPBS + 0.1mg/ml soybean trypsin inhibitor (Type II-S, Sigma) + 1X protease inhibitor cocktail (Roche). Samples were then spun at 16 000 rcf for 15 minutes to remove debris.     40 2.9 Colon explant culture and ELISA  Colons were isolated from mice, opened longitudinally, washed thoroughly in mouse tonicity phosphate buffered saline (MTPBS) with 100U/ml penicillin G, 100µg/ml streptomycin (Gibco) and ~0.5-0.75cm sections were cultured in 250µl or 500µl RPMI supplemented with penicillin, streptomycin and 100µg/ml gentamicin (Sigma-Aldrich) for 24 hours at 37°C, 5% CO2. After 24 hours, supernatants were removed and cleared of debris by centrifugation and frozen at -80°C. Cytokine levels were assessed by ELISA (eBiosciences) or Luminex Protein Assay (Life Technologies) according to manufacturer’s instructions. 2.10 Intestinal permeability assay (FITC-dextran) Four hours prior to sacrifice, DSS treated mice were orally gavaged with 200µl of 400ng/ml FITC-dextran (Sigma; FD4) in mouse tonicity PBS (MTPBS). Mice were euthanized and blood was collected by cardiac puncture and immediately added to 50µl 3% acid-citrate dextrose (20 mM citric acid, 100 nM sodium citrate, 5 mM dextrose). Plasma was collected and fluorescence was quantified at excitation 485nm, emission 530nm for 0.1s (Wallac Victor, Perkin-Elmer Life Sciences).  2.11 In vivo cell depletions and IL-22 response to endotoxin  For DC depletion CD11c-DTR/GFP and CD11c-DTR/GFP-Lynup/up mice were given an i.p. injection of 5ng/g diphtheria toxin (DT, Sigma-Aldrich) 24 hours prior to i.p. injection with 5µg LPS (E. coli 0127:B8, Sigma-Aldrich) and sacrificed 2 hours post-injection. For CD90-depletion, mice were given 1mg anti-CD90.2 (TIB107, Biomedical Research Centre) mAb by i.p. injection two days prior to i.p. injection with 25µg LPS (E. coli 0111:B4, Sigma-Aldrich). Blood was collected via cardiac puncture and serum and colon explant   41 culture supernatants were collected and IL-22 production was assessed by ELISA (eBioscience).  2.12 Isolation of colonic lamina propria leukocytes Colons were isolated from mice, opened longitudinally, washed thoroughly in MTPBS containing 5% heat-inactivated (30 minutes in water-bath at 55oC) adult bovine serum (HI-ABS) and cut into 0.5cm pieces. Epithelial cells were stripped with three successive washes of 37°C MTPBS containing 5% HI-ABS and 2mM ethylenediaminetetraacetic acid (EDTA) with rocking. Tissue was washed, minced and digested in RPMI containing 5% HI-ABS, and 580U/ml collagenase type VIII (Sigma-Aldrich) or 400U/ml collagenase type IV (Worthington) for 30 minutes at 37°C with shaking. Supernatants were strained through a 70µm cell strainer and the remaining tissue was collected and digested a second time. Supernatant from the second digests were combined with first and cells were washed twice with RPMI containing 5% HI-ABS and analyzed by flow cytometry (see below).  2.13 Isolation of blood cells, splenocytes and BM cells for flow cytometry Blood was collected by cardiac puncture immediately following euthanasia and was quickly put into a tube containing 500µl 2mg/ml EDTA in MTPBS. Alternatively, for repeated blood collection from live mice, blood was collected from the saphenous vein into an EDTA coated tube by capillary action of the tube. Blood was added drop-wise into pre-warmed (37oC) RBC lysis buffer (0.144M NH4Cl plus 0.017M Tris, pH 7.2) (10-13ml for cardiac puncture, 3ml for saphenous vein bleeds) and was incubated at 37oC for 5 minutes. Cells were then washed once with FACS buffer and then analyzed by flow cytometry (see below). In some cases blood samples were analyzed using a VetABC blood counter (Scil   42 Vet). In this case an aliquot of blood was collected into an EDTA coated tube and was kept on ice before analysis as per the manufacturer’s instructions. Spleens were harvested from euthanized mice and placed in cold FACS buffer. Single cell suspensions were obtained by mincing the spleens and pushing the tissue pieces through a 70µm sieve. Cells were then washed once with FACS buffer and were then analyzed by flow cytometry (see below). Femurs were harvested from euthanized mice and BM was harvested by flushing both ends of the bones with FACS buffer using a 21 gauge needle. Cells were then washed once with FACS buffer and were then analyzed by flow cytometry (see below). 2.14 Surface staining for flow cytometry  Colon LP, blood, BM or spleen cells were resuspended in MTPBS containing 5% HI-ABS, 0.05% NaN3, and 2.5mM EDTA (FACS buffer), incubated with anti-FcγRII/RIII (2.4G2) and then stained with either direct fluorochrome conjugated or biotinylated antibodies against CD3 [2C11 or 17A2], CD4 [RM4-5 or GK.5], CD8a [53-6.7], CD11a (LFA-1) [M17/4], CD11b [M1/70], CD11c [N418], CD19 [1D3], CD25 [PC61.5], panCD45 [I3/2], CD45.1 [A20], CD45.2 [104], CD45R (B220) [RA3-6B2], CD49b (DX5) [DX5], CD62L [MEL-14], CD80 [16-10A1], CD86 [GL1], CD90.2 (Thy1.2) [53-2.1], CD103 [2E7], CD115 (M-CSFR) [AFS98], CD117 (cKit) [ACK2], CD127 (IL-7R) [A7R34], CD135 (Flt3) [A2F10], CD274 (PD-L1) [MIH5], F4/80 [BM8], Gr-1 (Ly6C/G) [RB6-8C5], Ly6A/E (Sca-1) [D7], Ly6C [AL-21], Ly6G [IA8], MHC II [M5/144.15.2], NK1.1 [PK136], TCRβ [Η57−597], or Ter119 [TER-11] (eBioscience, BD biosience, and Ablab Biomedical Research Centre), washed, and stained with streptavidin-fluorochrome secondary antibodies where appropriate. To exclude dead cells, cells were either stained with Fixable Viability   43 Dye (eBioscience) as per manufacturer’s instructions or were resuspended in FACS buffer containing 200ng/ml propidium iodide (Sigma) or 25µg/ml DAPI (Sigma) prior to flow cytometry analysis.  2.15 Flow cytometric analysis of splenic and colonic IL-22 production  To assess splenic IL-22 production by flow cytometry, splenocytes were stimulated for 8 hrs with 10µg/ml brefeldin A (Sigma-Aldrich) ± 10ng/ml murine recombinant IL-23 (R&D Systems) ± 10ng/ml LPS (Ultrapure E. coli 0111:B4, Invivogen). An adaptation of a previously published protocol267 was used to assay in vivo IL-22 production by colonic lamina propria cells in response to LPS. Briefly, mice were injected with 10µg LPS (E. coli 0111:B4, Sigma-Aldrich) and one hour later were given 250µg of brefeldin A (Sigma) by intravenous injection. Mice were sacrificed three hours post-brefeldin A injection and colonic lamina propria cells were isolated and cultured for 6 hours at 37oC in “complete medium” (RPMI 1640 (Invitrogen) supplemented with 10% (v/v) FBS (Invitrogen), 100U/ml penicillin G, 100ug/ml streptomycin, 2mM glutaMAX (Invitrogen), and 55µM 2-mercaptoethanol) supplemented with 1X non-essential amino acids, 20mM HEPES, 1mM sodium pyruvate, and 10µg/ml brefeldin A. Cells were then analyzed for IL-22 production by flow cytometry. Cells were stained for surface markers as indicated above and were then washed in MTPBS and stained with Fixable Viability Dye (eBioscience) prior to fixation with 2% paraformaldehyde in FACS buffer. The cells were then permeabilized with permeabilization buffer (FACS buffer plus 0.1% Saponin (VWR International) or 1X Permeabilization Buffer (eBioscience)) and stained with Alexa-647 conjugated anti-IL-22 (mIL-22-02, Pfizer). Cells were washed once with permeabilization buffer and once with   44 FACS buffer and were then either analyzed immediately or stored in the dark at 4oC for a maximum of three days prior to analysis. 2.16 Analysis of Lyn expression by flow cytometry Cells from naïve wt or Lyn-/- mice were stained for surface markers as indicated above and were then washed in MTPBS and stained with Fixable Viability Dye (eBioscience) prior to fixation with 2% paraformaldehyde in FACS buffer. The cells were then permeabilized with permeabilization buffer (FACS buffer plus 0.1% Saponin (VWR International) or 1X Permeabilization Buffer (eBioscience)) and stained with anti-Lyn antibody (made in house). Cells were then washed and stained with PE- or Alexa647-conjugated F(ab')2 Donkey α-rabbit IgG (Jackson ImmunoResearch Laboritories Inc.) diluted in permeabilization buffer. Cells were washed once with permeabilization buffer and once with FACS buffer and were then either analyzed immediately or stored in the dark at 4oC for a maximum of three days prior to analysis. 2.17 In vivo incorporation of BrdU Mice were given three doses of 2mg of Bromodeoxyuridine (BrdU) (Sigma) by i.p. injection, each injection separated by three hours. Blood was collected from live mice via the saphenous vein and cells were prepared and stained for surface stains and viability as above. Fixation and staining for BrdU was performed using the APC BrdU Flow Kit (BD Biosciences) as per the manufacturer’s instructions with the following adjustments: the first fixation with Cytofix/Cytoperm Solution was performed for 20 minutes at room temperature, 75µl of diluted DNAse per sample was used instead of 100µl, and cells were stained with anti-BrdU antibody diluted 1/75 (or the eBioscience anti-BrdU antibody [BU20A] diluted 1/10) for 30 minutes at room temperature instead of 1/50 for 20 minutes.    45 2.18 Flow cytometric analysis of cell death  Cells were stained for surface markers and with the Fixable Viability Dye (eBioscience) as above, and then washed once with Annexin V binding buffer (dH2O plus 10mM HEPES, 140mM NaCl, 2.5mM CaCl2, and 0.1% BSA). 3µl of Annexin V-PE (eBioscience) was then added to each tube in a total of 100µl of Annexin V binding buffer per sample and cells were incubated for 20 minutes on ice. 150µl of Annexin V binding buffer was then added to each tube and cells were analyzed immediately by flow cytometry.   2.19 Acquisition and analysis of flow cytometry data Flow cytometry data was acquired using an LSRII or FACSCanto flow cytometer with FACS Diva software (BD Biosciences) or a MACSQuant (Miltenyi Biotec) flow cytometer with the built in software. Flow cytometry data was analyzed using Flow Jo analysis software (Treestar). 2.20 Isolation of intestinal epithelial cells and Western blot analysis  0.75cm colon sections were harvested and homogenized in RIPA buffer plus 1mM sodium orthovanadate, 10mM sodium fluoride, and a complete protease inhibitor cocktail (Roche, Mississauga, Canada) using GentleMACS tissue dissociator. Insoluble material was removed by centrifugation, and protein concentrations were determined using a BCA assay (Pierce Biotechnology). Proteins were separated by SDS-PAGE, transferred to nitrocellulose membrane (Bio-Rad) and Western blotting was performed using antibodies against Lyn (made in house), phospho-Lyn (Y507), phospho-Src Family (Y418), or β-actin (Cell Signaling Technology). For analysis of epithelial cell proteins, colons were harvested from mice, opened longitudinally, washed thoroughly in MTPBS and cut into 0.5cm pieces. Epithelial cells were   46 stripped in 37°C Hank’s Balanced Salt Solution (Lonza) + 30mM EDTA for 10 minutes at 37°C with shaking. Supernatant was strained through a 70µm cell strainer, cells were collected by centrifugation and supernatant was removed. Cells were lysed in buffer containing 1% Triton-X-100, 0.1% SDS, 1% glycerol, 50mM Tris (pH 7.5), 150mM NaCl, 2mM EDTA, 1mM sodium orthovanadate, 10mM sodium fluoride, and a complete protease inhibitor cocktail (Roche).  Insoluble material was removed by centrifugation, and protein concentrations were determined using a BCA assay (Pierce Biotechnology). Proteins were separated by SDS-PAGE, transferred to nitrocellulose membrane (Bio-Rad) and Western blotting was performed using the following primary antibodies: β-actin, phospho-STAT3 Y705, phospho-STAT3 S727, and total STAT3 (Cell Signaling Technology). Detection of specific bands was performed using horseradish peroxidase-linked goat anti-rabbit or sheep anti-mouse antiserum together with the ECL detection system (Amersham). 2.21 Splenic cultures  Spleens were harvested from mice into RMPI 1640 containing 5% heat-inactivated fetal bovine serum (HI-FBS) (Invitrogen). Single cell suspensions were made by mincing spleens with razor blades and passing tissue through 70µm cell strainers. Cells were prepared for magnetic sorting by labeling with anti-CD90.2-PE (eBioscience) and anti-PE microbeads (Miltenyi Biotec). Cell separation was performed using the AutoMACS Pro (Miltenyi Biotec) and negative fractions were plated and stimulated similarly to total splenocytes. Efficiencies of cell depletions were confirmed by flow cytometry. For DC depleted cultures, DCs were depleted in vivo as indicated in the main text.  Spleens were harvest 24 hours post DC-depletion and splenocytes were isolated as above. For stimulations, 1-3 million cells were plated in 96 well round bottom plates in 250µl “complete medium” (RPMI 1640   47 (Invitrogen) supplemented with 10% (v/v) HI-FBS (Invitrogen), 100U/ml penicillin G, 100ug/ml streptomycin, 2mM glutaMAX (Invitrogen), and 10µm 2-mercaptoethanol) + 10ng/ml murine recombinant IL-23 (R&D Systems) + 10ng/ml LPS (Ultrapure E. coli 0111:B4, Invivogen) and were cultured for 24 hours at 37°C, 5% CO2. The presence of IL-22 in cell supernatants was assessed by ELISA (eBioscience). 2.22 DC-ILC co-culture  BM-DCs were derived from femoral cells isolated from naïve mice as previously described249. BM-DCs were grown in “complete medium” supplemented with GM-CSF (made in house). Splenocytes were harvested as above and were incubated with biotinylated anti-CD90.2 mAb (eBioscience) followed by anti-biotin microbeads (Miltenyi Biotec) prior to positive selection using the AutoMACS Pro (Miltenyi Biotec). BM-DCs were harvested on day 8 and 2.1 x 105 cells were plated in a 96 well plate in complete medium 1 hour before addition of 7 x 104 CD90+ splenocytes. 1 hour later cells were stimulated 0-100ng/ml LPS (E. coli 0111.B4, Sigma-Aldrich) in complete medium supplemented with GM-CSF. 20 hours later supernatants were collected and IL-22 was assayed by ELISA (eBioscience). 2.23 In vitro BM-derived monocyte cultures BM-Mo were derived under sterile conditions from femoral BM cells isolated from naïve mice, and were grown at 37oC with 5% CO2. 2 x 105 BM cells per well were plated in 1ml of “complete medium” supplemented with 20% L cell conditioned medium (LCM, a source of M-CSF) or varying doses of recombinant murine M-CSF (Peprotech) as indicated, in 24-well ultra-low attachment plates (Corning). Three to four days later, 1ml of fresh, pre-warmed, medium was added to each well. After the first feed, cells were fed every 2-3 days by carefully removing 1 ml of medium and replacing it with 1ml of fresh, pre-warmed,   48 medium. Plates were left to settle for 5-10 minutes before removal of medium to avoid removing cells.  2.24 Experimental atherosclerosis  Chimeric mice were generated as outline above, using Ldlr-/- mice as hosts. The donor BM contained a mix of 90% Rag-/-, Rag-/-Lyn-/-, or Rag-/-Lynup/up BM and 10% BoyJ BM. 6 weeks post bone marrow transplant, mice were put on a high fat “atherogenic” diet, ad libitum, containing 15.8% fat and 1.25% cholesterol (Harland Teklad diet# 94059) for 8-10 weeks to induce atherosclerosis. At the experimental endpoint, the animals were anesthetized and lethally exsanguinated prior to a perfusion of the vasculature system with MTPPBS. The heart with intact aortic root was harvested and placed in 10% formalin. Hearts were embedded in paraffin and histological sections were cross-sectioned and stained with Oil Red O (Wax-it Histology Services Inc.). Atherosclerotic plaque area was quantified using the Aperio ImageScope software (Aperio Technologies). Quantification was performed by manually outlining Oil Red O-positive areas. The average total plaque areas from 3-4 tissue sections were quantified and represent the aortic plaque area per animal.  2.25 Statistical analysis  Survival data from in vivo experiments was analyzed by a Log-rank test performed on curves generated by GraphPad Prism (MacKiev Software). For all other analysis, two-tailed, unpaired Student t tests with a 95% confidence interval performed on graphs generated in GraphPad Prism were used. Error bars represent the SEM. P values of <0.05, <0.01, and < 0.001 were used as cutoffs for statistical significance and are represented in the figures by one, two or three asterisks (or hashtags), respectively.   49 Chapter 3: Lyn activity protects mice from DSS colitis and regulates the production of IL-22 from innate lymphoid cells   50 3.1 Introduction The mammalian intestinal tract has evolved to house vast microbial communities, the microbiota, that exist in a largely symbiotic relationship with their host124. Recognition of these microbes by intestinal epithelial and immune cells via PRRs plays a critical role in intestinal homeostasis, inflammation, and immunity. In the steady state, PRR signalling supports intestinal homeostasis by promoting intestinal epithelial barrier function and an anti-inflammatory tone of the intestinal immune system123, 124. Consistent with this, polymorphisms in genes encoding PRRs such as NOD2 or TLR4, and downstream signaling molecules such as MAL, are associated with IBD16. Furthermore, loss of PRR-responses in mice can lead to spontaneous colitis, as in Tlr5-/-126 mice, or to increased susceptibility to colitis (Tlr2-/-, Tlr4-/-, Myd88-/-, or Nod22939iC mice)127, 129.  However, the protective effects of PRRs can be lost if proper regulatory mechanisms are not in place and as such, uncontrolled PRR-induced inflammatory responses contribute extensively to pathogenesis in IBD and murine models of colitis130. IBD is associated with production of pro-inflammatory mediators by innate and T cell subsets. Recently, the role of the Type-17 cytokines IL-17, IL-22 and often IFNγ, and the cells capable of producing them, including T cells and ILCs, have become a focus of scrutiny in IBD and mouse models of colitis. In IBD patients, levels of IL-22, IL-17 and IFNγ  are elevated183, 268, 269, as are populations of IFNγ and IL-17-producing ILCs270, 271. In contrast, IL-22, in particular IL-22 produced by ILCs, is a key effector molecule protecting the gut from inflammation in murine models of colitis and enteric infection111, 272. IL-22 targets cells in barrier organs, such as the intestinal epithelium, where it induces host defense, pro-survival and proliferation factors including β-defensins, RegIII   51 proteins and mucins272. Accordingly, in mouse models of colonic injury195 as well as in trinitrobenzene sulfonic acid273, T cell transfer202, and DSS-induced colitis196, 202, IL-22 antagonizes inflammation and promotes wound-healing. IL-22 is produced by T cell subsets including Th17 cells. However, multiple subsets of RORγt+ ILC3s, including LTi-like cells and NCR+ ILC3s are major sources of intestinal IL-22274, 275. Importantly, production of IL-22 is largely influenced by innate immune cell responses to TLR signals. For example, DCs are required for IL-22 production by ILCs in response to LPS and flagellin216, 221. These studies support the many reports indicating that appropriate activation of PRRs are required to attenuate inflammation induced by intestinal damage and to enhance barrier function and repair. Lyn is an SFK expressed in leukocytes except T cells and is activated by ligand binding to adhesion molecules, cytokine receptors, immunoreceptors and TLRs1. Depending on the cell microenvironment, developmental stage and type of stimulus, Lyn can restrict or amplify signal-transduction. The importance of Lyn in regulating TLR signal-transduction remains controversial, but has been explored using Lyn-/- and Lynup mice249, 276, 277, 278. Lynup mice contain a tyrosine to phenylalanine mutation in the endogenous lyn gene at the C-terminal negative-regulatory tyrosine phosphorylation site, leading to increased Lyn-activity240.  Our laboratory recently demonstrated that Lynup DCs exhibit enhanced maturation and distinct cytokine production profiles in response to TLR-stimuli, driving increased DC-dependent NK cell activation and IFNγ production, resulting in severely increased susceptibility to LPS249. Perturbations in immune cell function and responses to PRR signals are critical factors in the development of IBD and mouse models of colitis16, yet despite the regulation   52 of many immune cell responses by Lyn, there is no known link between Lyn and susceptibility to gastrointestinal inflammation. Herein, we provide evidence that Lyn activity is protective against DSS colitis. Conversely, Lyn deficiency significantly increases susceptibility to colitis. Protection from DSS induced inflammation in Lynup mice is associated with elevated levels of IL-22 and IL-22-responsive factors in the colon. We show that LPS hypersensitivity drives enhanced production of IL-22 in Lynup mice, which requires both DCs and innate CD90+ cells (ILCs), and that increased Lyn activity in DCs is sufficient to enhance IL-22 production by ILCs in vitro. Furthermore, augmented responses to LPS by Lynup mice protect these mice from DSS-induced wasting and morbidity following antibiotic treatment. These results reveal a novel role for Lyn in modulating IL-22 production and ILC function and underscore the importance of this enzyme in the control of intestinal inflammation. Our results also highlight how changes in signaling pathways regulating cellular responses to PRRs can profoundly alter the outcome of intestinal inflammation. 3.2 Results 3.2.1 Lyn is protective against experimental colitis  Our lab previously identified Lyn as an important regulator of systemic and DC-intrinsic PRR induced responses249, which are known to dictate the outcome of intestinal inflammation123. We therefore questioned how changes in Lyn activity, and associated enhanced innate responses to MAMPs, might alter intestinal homeostasis and susceptibility to inflammation. We challenged wildtype (wt), Lyn-/- and Lynup mice with DSS in their drinking water. Lyn-/- mice were highly susceptible to DSS compared to wt as assessed by body weight, colon length, rectal-bleeding and histopathology (Figure 3.1). By contrast, Lynup mice lost slightly less weight than wt counterparts, had significantly longer colons, and   53 significantly reduced rectal bleeding, indicating protection from DSS (Figure 3.2A-C). Furthermore, Lynup colons showed fewer areas of crypt-loss and less epithelial-sloughing and ulceration compared to wt mice, while changes in crypt length or epithelial cell proliferation were not observed (Figure 3.2D, data not shown).  Together, these data demonstrate a protective role for Lyn in acute DSS-induced colitis.  Our investigation of the mechanism(s) underlying susceptibility to gastrointestinal inflammation in Lyn-/- mice revealed a multifactorial role for Lyn involving multiple cell types, with susceptibility to DSS colitis dependent on the adaptive immune system and the development of a distinct microbiota. These findings are the subject of chapter four of this dissertation. Here we describe how increased Lyn activity protects mice from DSS-induced colitis, and the relationship between Lyn activity, PRR responses and ILC cytokine production.   54   Figure 3.1 Lyn deficiency increases susceptibility to DSS colitis. Lyn+/+ and Lyn-/- mice were challenged with 2.5% DSS and (A) body weight and (B) rectal bleeding were monitored for 7 days. Mice were sacrificed on day 7, (C) colon length was measured and (D) cross sections of distal colon were stained with hematoxylin and eosin. Representative data from more than three independent experiments are shown, n=4-9, error bars represent SEM. * = p < 0.05, ** = p < 0.01, *** = p < 0.005.  0 1 2 3 4 5 6 775859510534567890 1 2 3 4 5 6 70.00.51.01.5Weight (% Starting) Score Lyn+/+Time (days) A B 0 1 2 3 4 5 6 7 880859095Time (days) Length (cm) * Untreated DSS C Weight Change Rectal Bleeding Colon Length D DSS 4x 10x Untreated 4x 10x 500+m0 1 2 3 4 5 6 7 880859095100105* ** *** *** * *** *** Lyn-/-Lyn+/+Lyn-/- Lyn+/+Lyn-/-Lyn+/+Lyn-/-500+m200+m200+m500+m500+m200+m200+m  55  Given Lyn’s protective role in acute colitis, we investigated the outcome of chronic inflammation and Lynup mice. Wt and Lynup mice were treated with the carcinogen azoxymethane (AOM) followed by three cycles of DSS (Figure 3.3A). Lynup mice were resistant to DSS-induced attenuation of weight gain that became apparent following the second cycle and significant by the third (Figure 3.3B). This was associated with a trend towards reduced morbidity in Lynup mice compared to wt (100% survival of Lynup versus 67% of wt, p<0.07) (Figure 3.3C). Lynup mice also had significantly longer colons at the  Figure 3.2 Increased Lyn activity attenuates acute DSS-induced colitis. Lyn+/+ and Lynup/up mice were challenged with 2.5% DSS and (A) body weight and (B) rectal bleeding were monitored for 7 days. Mice were sacrificed on day 7, (C) colon length was measured and (D) cross sections of distal colon were stained with hematoxylin and eosin. Pooled data from two of three independent experiments are shown for A-C, n=8-10. Error bars represent SEM. * = p < 0.05, ** = p < 0.01, *** = p < 0.001.   34567890 1 2 3 4 5 6 70.000.250.500.751.001.250 1 2 3 4 5 6 7 88090100110D DSS 4x 10x Untreated 4x 10x 200 m 500+m 200+mWeight (% Starting) Score Time (days) A B 8085Time (days) Length (cm) Untreated DSS C Weight Change Rectal Bleeding Colon Length 8085** * * *** *** *** Lyn+/+Lynup/upLyn+/+Lynup/upLyn+/+Lynup/upLyn+/+Lynup/up500+m 200+m500+m 200+m500+m 200+m  56 experimental endpoint (Figure 3.3D), indicating a reduction in chronic inflammation 279. Consistent with this, Lynup mice exhibited a dramatic reduction in tumour number and load compared to controls (Figure 3.3E). Of note, upon histological examination of distal colon sections containing tumours, no overt differences were observed between the tumours from wt and Lynup mice, with the tumours confirmed to be adenomas containing low-grade epithelial dysplasia. A minority of the adenomas in each group exhibited characteristics of high-grade dysplasia and intramucosal adenocarcinoma without evidence of muscularis mucosa or submucosal invasion. Together, these data indicate that Lyn activity protects mice from acute and chronic DSS-induced intestinal inflammation and reduces the incidence of CAC.   57  3.2.2 Increased Lyn activity is associated with an enhanced IL-22 response during experimental colitis To investigate the contribution of cytokine responses in Lyn mediated protection from DSS colitis, we screened the colons of DSS treated wt and Lynup mice for inflammatory and immunoregulatory mediators. No consistent differences in mRNA or protein expression of TNFα, IL-6, IL-10 or IL-12 were observed (data not shown). By contrast, compared to wt mice, Lynup colon explants showed a significant 4-fold increase in IL-22 production consistent with a trend to an increase in colonic Il-22 mRNA expression following DSS  Figure 3.3 Increased Lyn activity attenuates chronic DSS-induced colitis and colitis associated cancer. Lyn+/+ and Lynup/up mice were challenged using the AOM/DSS model of chronic colitis and colitis-associated cancer. (A) Graphical depiction of experimental protocol. On day 0, Lyn+/+ and Lynup/up mice were injected with 10mg/kg azoxymethane (AOM) and 2.5% DSS was administered for 7 days, followed by 14 days of recovery. DSS and recovery cycles were repeated two more times for a total of 63 days. (B) Weight change at the end of each DSS and recovery periods are shown from a representative of two independent experiments, n=5/experiment. (C) Moribund mice that lost >20% body weight prior to day 63 were euthanized. (D-E) Mice were sacrificed on day 63 and (D) colon length was measured and (E) macroscopic tumours in colons were counted and diameters were measured. Tumour load indicates sum of tumour diameters per colon. Data pooled from two independent experiments is shown for colon length, mortality, tumour development and tumour load, n=10. Error bars represent SEM. * = p < 0.05, ** = p < 0.01, *** = p < 0.001.  0 10 20 30 40 50 60 7002550751008090100110120Cycle 1 Cycle 2 Cycle 38090100110120Cycle 1 Cycle 2 Cycle 3X3 2.5% DSS7 days H2O14 daysAOM i.p.day 0 (singleinjection) 051015012345634567 *** *** ** Survival (%) Time (days) Morbidity Colon Length Tumour Number Tumour Load Length (cm) Number Diameter Sum (mm) Weight (% Starting) Weight (% Starting) Weight After DSS Weight After Recovery A BC D E*** p=0.07 Lyn+/+Lynup/upLyn+/+Lynup/upLyn+/+Lynup/up  58 treatment (Figure 3.4A, B). Increased IL-22 production by Lynup mice was observed as early as 2 days post-DSS treatment, with a significant increase in the colons (~3-fold) and low levels in the serum (Figure 3.4C). IL-23 drives the production of IL-22 by RORγt+ subsets of T cells and ILCs218, 280, 281. Accordingly, there was a significant 13-fold increase in the production of IL-23 in the colons of Lynup mice after DSS treatment. This was associated with an increase in Il-23 mRNA and a significant increase in Rorc mRNA (Figure 3.4A-B). IFNγ and IL-17A can also be produced by IL-23-responsive T cell and ILC populations218, 281.  Colons of Lynup mice produced increased levels of Ifng mRNA and protein, however no consistent differences in Il-17a mRNA expression were observed (Figure 3.4A-B). Baseline production of these inflammatory mediators was low to undetectable in colons of untreated wt and Lynup mice with the exception of IFNγ, which was modestly elevated in Lynup mice compared to controls (data not shown).   59   Figure 3.4 Lynup/up mice produce increased levels of IL-22 during DSS colitis. Lyn+/+ and Lynup/up mice were treated with 2.5% DSS for 7 days or as indicated. (A) Colon tissue was cultured for 24 hours and cytokines were quantified by ELISA. Representative data is shown from 3 independent experiments n=4-5/experiment (B) RNA was extracted from colon sections and normalized (Gapdh) target gene expression (Norm. Exp.) was assessed by qPCR. Colon data pooled from two of three independent experiments is shown n=8. (C) IL-22 levels in blood and colon explant cultures were assayed by ELISA. (D) Colonic epithelial cells were isolated and protein expression was analyzed by Western blotting for total STAT3, and phospho-STAT3 (pS727 and pY705). β-actin was used as a loading control. Numbers represent band intensity as quantified by ImageJ software. Representative data is shown, n=3. (E) Colonic gene expression was assessed as in B. Representative data is shown, n=2-4 (F) Lynup/up mice were treated with 2% DSS for 7 days followed by a 7 day recovery period. Neutralizing anti-IL-22 mAb or isotype control Ab was administered prior to and throughout the course of DSS treatment and mice were weighed daily.  indicates a control mouse that reached humane endpoint, n=5. (A-F) Error bars represent SEM * = p < 0.05, ** = p < 0.01, *** = p < 0.001.   D Norm. Exp. RegIIIg0501001502002d 7d 0.00.51.01.52.02d 7d Muc1* Norm. Exp. E Norm. Exp. RegIIIbWeight (% Starting) Time (days) Weight Change 0 2 4 6 8 10 12 14758595105isotype anti-IL-22 95105F * 02550751001252d 7d Norm. Exp. Norm. Exp. Norm. Exp. Il-22 Il-23 IfngB 0510150255075100125150175020040060080010001200Norm. Exp. Norm. Exp. Il-17a Rorc0102030405005101520 *** pg/ml pg/ml pg/ml IL-22 IL-23 IFNaA C 05010015020025005010015020025030035040045005101520`-actin P-STAT3 pY705 pS727 2.2 1.0 1.0 3.1 STAT3 1.3 1.0 1.0 1.8 1.4 1.0 1.0 1.4 1.2 1.0 1.0 1.3 2 Days Untrt ** * 0255075100IL-22 – Colon (2 Days) pg/ml Colon Lyn+/+Lynup/up** Blood ND Lyn+/+Lynup/upLyn+/+Lynup/up  60 IL-22 mediates protection during intestinal inflammation via STAT3 activation in intestinal epithelial cells, promoting cell survival, proliferation, and the production of host-defense molecules195, 272. Colonic epithelial cells isolated from Lynup mice 2 days post-DSS exposure showed a small but consistent increase in STAT3 activation, indicated by phosphorylation of tyrosine 705 and serine 727 (Figure 3.4D). This was consistent with a significant increase in DSS induced colonic IL-22 (Figure 3.4C). Furthermore, increased levels of IL-22 observed 2 and 7 days post-DSS treatment correlated with elevated expression of the antimicrobial lectins RegIIIg and RegIIIb and mucin protein Muc1 mRNAs (Figure 3.4E), which are established STAT3 responsive genes induced by IL-22195, 199. No differences in these factors were observed between naïve wt and Lynup mice (data not shown). Loss of IL-22 responses impairs restitution following DSS treatment in wt mice196. Since the impact of increased Lyn activity was exaggerated in the chronic/relapsing model of colitis (Figure 3.3) we sought to determine whether recovery of Lynup mice following DSS treatment was dependent on the increased IL-22 observed in these mice. Anti-IL-22-neutralizing or isotype control antibodies were administered by i.p. injection to Lynup mice starting 4 days before DSS treatment and body weight was assessed throughout the experiment. No differences in weight change were observed during the acute phase of DSS treatment. However, IL-22 neutralization resulted in a significant delay in recovery of Lynup mice (Figure 3.4F). Together these results suggest that increased production of IL-22 in Lynup mice acts to enhance intestinal repair and may contribute to protection from DSS colitis.   61 3.2.3 The adaptive immune system is dispensable for protection from acute colitis in Lynup mice To investigate if changes in steady state or DSS-induced inflammatory cell populations were responsible for the diminished inflammation and altered cytokine production profiles in DSS treated Lynup mice, we examined the composition of immune cells in the colonic LP (cLP). Untreated, but not DSS treated, Lynup colons showed a small but reproducible increase in macrophage (CD11b+F4/80+) and neutrophil (CD11b+Gr-1hi) frequencies compared to their wt counterparts (Figure 3.5A). B cells were almost completely absent in Lynup colons, consistent with previous reports of a systemic decrease in B cell populations282. Before and after DSS treatment, CD4+ T cell (CD3+CD4+), and DC (CD11c+MHCIIhi) frequencies were increased in Lynup colons. Within the DC compartment however no major differences in DC composition or activation status were observed based on MHCII, CD80, CD86, CD11b, and CD103 expression (Figure 3.5A). Interestingly, no significant changes in total numbers of DCs, macrophages, or neutrophils were found between naïve wt and Lynup mice, although a small but consistent increase in CD4+ and CD8+ T cell numbers, and a 25-fold decrease in B cell numbers, was observed in Lynup mice (Figure 3.5B).    62   Figure 3.5 The intestinal immune compartment of Lynup/up mice. Lyn+/+ and Lynup/up mice were left untreated or were challenged with 2.5% DSS for 7 days. Colonic lamina propria cells were isolated and analyzed for flow cytometry. All cells were first gated on live (propidium iodide negative) CD45+ populations. (A) Representative plots from 3 independent experiments are shown. Numbers represent pooled mean frequency ± SEM, n=6. (B) Graphs indicate total numbers of indicated cell populations per colon. Data is pooled from 3 experiments, n=6, and error bars represent SEM.  010203050200350500650800950CD19 B220 0 102 103 104 105<PE-A>: CD40102103104105<PE-Cy7-A>: CD80 102 103 104 105<PE-A>: CD40102103104105<PE-Cy7-A>: CD80 102 103 104 105<FITC-A>: CD30102103104105<Pacific Blue-A>: CD450 102 103 104 105<FITC-A>: CD30102103104105<Pacific Blue-A>: CD45H2ODSS CD45+Lyn+/+A CD11b CD103 0 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 1050102103104105CD11c MHC II 30.2 ± 4.0 0 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 1050102103104105CD11b Gr-1 0 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 1050102103104105CD11b F4/80 32.5 ± 1.7 37.8 ± 3.1 16.0 ± 6.0 23.8 ± 7.2 <Pacific Blue-A>: CD45CD3 CD45 CD4 CD8 16.1 ± 2.2 35.2 ± 3.0 17.5 ± 3.3 29.4 ± 4.5 24.3 ± 2.5 0 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 105010210310410513.4 ± 2.7 1.0 ± 0.8 12.6 ± 1.9 0.7 ± 0.3 0 102 103 104 105<PE-A>: CD80020406080100% of Max0 102 103 104 105<FITC-A>: CD86020406080100% of MaxCD80 CD86 Lyn+/+Lynup/up0 102 103 104 105<PE-A>: CD80020406080100% of Max0 102 103 104 105<FITC-A>: CD86020406080100% of MaxB Number (x103)Total Numbers Lynup/up Lyn+/+ Lynup/upCD45+CD11c+MHCII+ CD45+CD11c+MHCII+CD45+ CD45+H2ODSS H2ODSS Lyn+/+ Lynup/upCD45+ CD45+ CD45+CD3+20.8 ± 2.4 15.4 ± 1.6 25.0 ± 2.0 44.9 ± 8.6 45.7 ± 10.0 4.7 ± 0.3 6.8 ± 0.3 44.8 ± 4.4 50.9 ± 5.0 7.8 ± 0.9 10.2 ± 1.3 26.8 ± 3.8 26.5 ± 1.4 36.1 ± 5.9 38.9 ± 7.3 0.2 ± 0.1 0.6 ± 0.1 7.4 ± 0.2 7.6 ± 1.2 21.9 ± 1.0 56.0 ± 3.6 62.3 ± 4.4 22.5 ± 5.7 26.5± 6.7 53.0 ± 4.6 54.2 ± 11.9 Lyn+/+Lynup/upTotal Leukocytes(CD45+) DC(CD11c+ MHCII+)Macrophages(CD11b+ F4/80+)Neutrophils(CD11b+ Gr-1hi )T Cells(CD3+ )CD4+ T Cells(CD4+ CD3+ )CD8+ T Cells(CD8+ CD3+ )B Cells(B220+CD19+ )  63 To assess the relative contributions of adaptive versus innate immune cells in limiting colitis in Lynup mice, we conducted DSS challenges in Rag-/- and Rag-/-Lynup mice. Protection from DSS in Lynup mice was exaggerated in the absence of an adaptive immune system, indicating that the changes observed in B and T cell populations were not responsible for attenuation of DSS colitis. Rag-/-Lynup mice showed significantly less weight loss and rectal bleeding, and had significantly longer and less inflamed colons than Rag-/- mice. In fact, Rag-/-Lynup mice, were almost completely resistant to DSS treatment, with minimal weight loss and rectal bleeding and an absence of significant shortening of the colon (Figure 3.6A-D). In addition, we found that the ceca of Rag-/- mice showed inflammation after DSS treatment, characterized by severe edema and crypt destruction as well as the presence of inflammatory cells in the submucosa and lumen, while Rag-/-Lynup mice had only slight epithelial sloughing (Figure 3.6D). Similar to Lynup mice, naïve Rag-/-Lynup mice had a small, but consistent, increase in neutrophil (CD11b+Gr-1hi) frequency (Figure 3.7). However, the frequencies of DCs and macrophages were indistinguishable between Rag-/- and Rag-/-Lynup mice. After DSS challenge, however, the frequency of these populations was moderately reduced in Rag-/-Lynup compared to Rag-/- animals (Figure 3.7). Together, these results suggest that enhanced Lyn activity in innate immune cells is sufficient to protect mice from DSS induced intestinal inflammation, and that protection from colitis is not associated with dramatic changes in cLP innate leukocyte populations.   64    Figure 3.6 Lyn activity in innate immune cells is sufficient to protect from DSS colitis. Rag-/- and Rag-/-Lynup/up mice were challenged with 2.5% DSS and (A) body weight and (B) rectal bleeding were monitored over 7 days. (C) Mice were sacrificed on day 7, and colon length was measured. Pooled data from two of three independent experiments is shown, n=7-9. Error bars represent SEM. * = p < 0.05, ** = p < 0.01, *** = p < 0.001. (D) Cecal cross sections and longitudinally sectioned colons from untreated and DSS treated mice (day 7) were stained with hematoxylin and eosin. Representative sections are shown. 34567890 1 2 3 4 5 6 77585951050 1 2 3 4 5 6 70.00.51.01.5Weight (% Starting) Score Time (days) Time (days) Length (cm) * Untreated DSS Weight Change Rectal Bleeding Colon Length 500+m 200+mDSS Colon 4x 10x Untrt. Colon4x 10x Untrt. Cecum4x 4x DSS Cecum Rag-/-Rag-/-Lynup/up*** *** *** *** ** * ** ** Rag-/-Rag-/-Lynup/upRag-/-Rag-/-Lynup/upA B CD500+m 200+m500+m 200+m500+m 200+m500+m 200+m500+m 200+m Figure 3.7 The intestinal immune compartments of Rag-/-Lynup/up mice. Rag-/- and Rag-/-Lynup/up mice were left untreated (H2O) or were challenged with 2.5% DSS for 7 days (DSS). Colonic lamina propria cells were isolated and analyzed for the presence of macrophages (CD11b+F4/80+), granulocytes (Gr-1+CD11b+), and DCs (CD11c+MHC II+). All cells were first gated on live (propidium iodide negative) CD45+ populations. Representative plots from 2-3 independent experiments are shown. Numbers represent pooled mean frequency ± SEM, n=4-6.   CD45+Rag-/-H2O DSS CD11c MHC II 0 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 105010210310410564.3 ± 2.3 61.6 ± 3.6 CD11b Gr-1 0 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041057.5 ± 0.8 0.6 ± 0.2 1.5 ± 0.1 5.2 ± 1.5 8.7 ± 2.8 CD11b F4/80 0 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 105010210310410552.0 ± 2.6 39.3 ± 7.8 55.6 ± 3.5 60.2 ± 2.3 Rag-/-Lynup/upCD45+ CD45+Rag-/- Rag-/-Lynup/up Rag-/- Rag-/-Lynup/up64.0 ± 0.7 58.7 ± 0.9 22.7 ± 0.910.0 ± 1.1 14.5 ± 1.7   65 3.2.4 Enhanced IL-22 production in Lynup mice occurs in response to LPS and requires DCs and ILCs To determine the cell types responsible for increased IL-22 production in Lynup mice, we stimulated total splenocytes or splenocytes depleted of specific cell populations, with IL-23 ± LPS. Lynup splenocytes produced more IL-22 than wt in response to IL-23 with or without LPS. Adaptive immune system cells were not required for enhanced IL-22 production by Lynup splenocytes, but IL-22 production was dependent on the presence of CD90+ cells (Figure 3.8A). Flow cytometric analysis revealed that ILCs (CD90+Lin-) were the major producers of IL-22 in the spleens of Rag-/- and Rag-/-Lynup mice (Figure 3.9). This is consistent with previous reports that identified CD90+ ILCs as a major source of IL-22216, 218, 221, 283. Interestingly a two-fold increase in frequency and a five-fold increase in ILC numbers were observed in Rag-/-Lynup compared to Rag-/- spleens (Figure 3.8B). IL-22 production was also slightly enhanced in Rag-/-Lynup ILCs, based on mean fluorescence-intensity of IL-22 staining (Figure 3.9). Increased IL-22 production by Lynup splenocytes also required the presence of DCs, as splenocytes from DT treated CD11cDTR-Lynup mice failed to produce enhanced IL-22 compared to DT treated CD11cDTR controls (Figure 3.8C). DCs were not however a source of IL-22 in splenic cultures, as IL-22 was undetectable in CD11c+ cells (data not shown), indicating that these cells were required as accessory cells to drive increased IL-22 by Lynup ILCs.    66   Figure 3.8 DCs and ILCs are required for increased IL-22 production in Lynup/up mice in response to LPS  0510152025ng/ml Blood IL-22(Rag-/-) ** *     0500100015002000250030003500Colon IL-22 (Rag-/-)pg/ml *     B E A 0500100015002000* Blood Colon IL-22 (C57BL/6) pg/ml 0 102 103 104 105<APC-A>: CD900102103104105<FITC-A>: Lin (CD3 CD11b CD11c Gr1 B220)0 102 103 104 105<APC-A>: CD900102103104105<FITC-A>: Lin (CD3 CD11b CD11c Gr1 B220)9.6 ± 2.2 6.6 ± 2.3 Colon Lineage CD90 02505007501000125015001750Total ILC (x 103) * 0102030Total ILC (x 103)0100200300050100150200250300350400450pg/ml **Blood IL-22(CD11cDTR)DT     DT     pg/ml *01002003004005006007000100200300400500600Spleen IL-22 (C57BL/6) IL-23  IL-23+LPS  ** *** ** * * pg/ml Lyn+/+Lynup/up_CD90 IL-23  IL-23+LPS  ** ***** ****ND ND Spleen IL-22 (Rag-/-)pg/ml 0255075100125150DT     * * * Spleen IL-22 (CD11cDTR) pg/ml H Spleen 0 102 103 104 10501021031041050 102 103 104 10501021031041051.9 ± 0.3 4.1 ± 1.3 Rag-/- Rag-/-Lynup/upLineage CD90 0 102 103 104 105<APC-A>: IL-220102103104105<PE-Cy7-A>: CD900 102 103 104 105<APC-A>: IL-220102103104105<PE-Cy7-A>: CD900 102 103 104 105<APC-A>: IL-220102103104105<PE-Cy7-A>: CD900 102 103 104 105<APC-A>: IL-220102103104105<PE-Cy7-A>: CD900 102 103 104 105<PE-Cy7-A>: CD900102103104105<APC-Cy7-A>: Lineage0 102 103 104 105<PE-Cy7-A>: CD900102103104105<APC-Cy7-A>: Lineage0 102 103 104 105<PE-Cy7-A>: CD900102103104105<APC-Cy7-A>: Lineage0 102 103 104 105<PE-Cy7-A>: CD900102103104105<APC-Cy7-A>: LineageCD90 Lineage CD90+IL-22+0.8 1.4 0.4 1.2 2.4 0.7 3.9 1.1 90.0 90.2 96.0 96.7 IL-22 CD90 (2531) (3382) 0 102 103 104 105<PerCP-Cy5-5-A>: Sca-10102103104105<FITC-A>: CD40 102 103 104 105<PerCP-Cy5-5-A>: Sca-10102103104105<FITC-A>: CD40 102 103 104 105<PerCP-Cy5-5-A>: Sca-10102103104105<FITC-A>: CD40 102 103 104 105<PerCP-Cy5-5-A>: Sca-10102103104105<FITC-A>: CD4IL-22+ ILCs (Lineage-CD90+)Sca-1 CD4 0.0 19.1 6.4 74.5 0.0 15.0 25.0 60.0 0.9 18.4 4.4 74.5 8.6 27.3 12.8 51.3 Control LPS D G C F _CD90 ***Rag-/- Rag-/-Lynup/upColon IL-22(CD11cDTR)_CD90 _CD90   67   Because Lynup mice are profoundly hypersensitive to LPS249 and LPS is known to drive IL-22 production in vivo216, 283, we questioned whether systemic administration of LPS would be sufficient to drive increased IL-22 production in Lynup mice. Lynup mice showed Figure 3.8 DCs and ILCs are required for increased IL-22 production by Lynup/up mice in response to LPS (A) Total splenocytes (αCD90 -) or splenocytes depleted of CD90+ cells (αCD90 +) from naïve Lyn+/+ and Lynup/up (left) or Rag-/- and Rag-/-Lynup/up (right) mice were stimulated with IL-23 ± LPS and IL-22 production was quantified. Representative data from three independent experiments is shown, n=2/experiment. (B) Splenic and (F) colonic ILCs (lineage[CD3, CD11b, CD11c, Gr-1, B220]-CD90+) from naïve Rag-/- and Rag-/-Lynup/up mice were analyzed by flow cytometry. Graphs and plots represent data pooled from 2 independent experiments, n=6. Numbers on plots represent mean frequency ± SEM. (C) CD11cDTR and CD11cDTR-Lynup/up mice were injected with PBS (DT-) or DT (DT+) and one day later splenocytes were isolated and stimulated with IL-23 + LPS. Representative data from 2 independent experiments are shown, n=2-4. (A,C) Unstimulated cells produced undetectable levels of IL-22 (data not shown). (D) Lyn+/+ and Lynup/up mice were treated with LPS and IL-22 in blood and colon explant cultures was assessed. Graphs represent data pooled from two independent experiments, n=8. (E) Rag-/- and Rag-/-Lynup/up or (G) CD11cDTR and CD11cDTR-Lynup/up mice were injected with PBS, (E) anti-CD90 mAb or (G) DT prior to LPS injection.  IL-22 in blood and colon explants was assessed. (E) Representative data from 2 independent experiments are shown, n=3/experiment. (G) Graphs represent data pooled from two independent experiments, n=4-6. (H) Rag-/- and Rag-/-Lynup/up mice were left untreated or were injected with LPS followed by brefeldin A and colonic lamina propria cells were isolated and cultured in the presence of brefeldin A. IL-22 production was analyzed by flow cytometry, n=3 and numbers indicate frequency or mean fluorescence intensity (in brackets) of the highlighted population.  (A-G) Error bars represent SEM, * = p < 0.05, ** = p < 0.01, *** = p < 0.001.   Figure 3.9 Lyn regulates IL-22 production from ILCs, the major source of IL-22 in splenic cultures. Splenocytes from naïve Rag-/- and Rag-/-Lynup/up mice were treated with brefeldin A alone (Unstim.) or brefeldin A and IL-23 ± LPS for 8 hours and IL-22 production was assessed by flow cytometry. Lineage cocktail included CD3, CD11b, CD11c, Gr-1 and B220. Plots represent data pooled from 2 independent experiments, n=4. Numbers on plots represent pooled mean frequency ± SEM or representative mean fluorescence intensities (MFI).  Unstim.  CD45+IL-22 CD90 0 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 1050102103104105MFI 493 0 102 103 104 105<PE-A>: IL-220102103104105<APC-A>: CD90MFI 620 59.2 ± 5.3 72.1 ± 6.6 0 102 103 104 1050102103104105MFI 1204 0 102 103 104 105<PE-A>: IL-220102103104105<APC-A>: CD90MFI 1713 85.3 ± 1.3 89.2 ± 1.8 CD90 Lineage CD25 CD4 0 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 1050102103104105MFI 1006 MFI 1349 82.4 ± 1.9 86.9 ± 1.7 IL-23Rag-/- Rag-/-Lynup/up Rag-/- Rag-/-Lynup/up Rag-/- Rag-/-Lynup/upCD45+IL-22+CD90+ CD45+IL-22+Lin-CD90+67.8 ± 7.9 69.1 ± 11.1 70.5 ± 1.5 70.0 ± 2.0 69.5 ± 1.6 68.7 ± 1.2 IL-23+ LPS  68 significantly increased levels of IL-22 in blood two hours after LPS i.p. injection and the systemic effects of LPS also resulted in increased IL-22 production in the colon (Figure 3.8D), suggesting that the increased IL-22 response in the colons and blood following DSS treatment may be a result of Lynup mouse TLR hyper-responsiveness. Enhanced IL-22 production in the blood and colon of Lynup mice was maintained in the absence of an adaptive immune system as Rag-/-Lynup mice also produced more IL-22 in response to LPS (Figure 3.8E). As CD90+ ILCs were required for enhanced-production of IL-22 by Lynup splenocytes, and are known to be a major source of IL-22 during systemic responses to TLR-ligands216, 218, 221, 283 we questioned whether the increased systemic IL-22 production in Lynup mice required CD90+ ILCs. Rag-/- and Rag-/-Lynup mice were treated with an anti-CD90 monoclonal antibody followed by an i.p. injection of LPS two days later. Depletion of CD90+ ILCs was assessed in the spleen, mLN and cLP by flow cytometry. Complete depletion of CD90+ cells was observed in spleen and mLN, however only partial depletion was achieved in the cLP (Figure 3.10A). Consistent with the spleen data, enhanced IL-22 production by Rag-/-Lynup mice following LPS injection required the presence of CD90+ cells. In Rag-/-Lynup mice, depletion of CD90+ cells resulted in a significant ten-fold reduction in serum IL-22 levels and a two-fold reduction in colon (Figure 3.8E). Interestingly, unlike in the spleen, increased colonic IL-22 production was not dependent on increased ILC numbers as no difference in ILC numbers was observed in the colons of Rag-/- and Rag-/-Lynup mice (Figure 3.8F).    69  DCs are required for IL-22 production in response to TLR stimulation and during enteric infection216, 217, 221 and we found that DCs were required for enhanced IL-22  Figure 3.10 Systemic administration of monoclonal anti-CD90 antibodies or DT depletes CD90+ cells and DCs, respectively. (A) Rag-/- and Rag-/-Lynup/up mice were mock injected (PBS) or treated with anti-CD90 mAb. Two days later mice were injected with LPS and presence of CD90+ cells in the spleen, mesenteric lymph nodes (MLN) and colonic lamina propria (cLP) was assessed by flow cytometry 2 hours post-LPS injection. (B) CD11cDTR mice were injected with PBS or diptheria toxin (DT) and the presence of DCs (CD11c+MHC II+) in the cLP and spleen was assessed by flow cytometry at the indicated time points post-DT injection. (C) CD11cDTR and CD11cDTR-Lynup/up mice were mock injected (PBS) or treated with DT 1 day prior to LPS injection and presence of DCs (CD11c+MHC II+) and ILCs (lineage-CD90+) cells in the spleen, MLN and cLP was assessed by flow cytometry. All cells were first gated on live (propidium iodide negative) CD45+ populations. Representative plots are shown and numbers represent frequency of highlighted population.  0 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 105<APC-A>: CD11c0102103104105<PE-A>: CL20 102 103 104 105<APC-A>: CD11c0102103104105<PE-A>: CL20 102 103 104 105<APC-A>: CD11c0102103104105<PE-A>: CL20 102 103 104 105<APC-A>: CD11c0102103104105<PE-A>: CL233.8 1.7 11.0 19.1 1.5 0.1 0.4 0.5 CD11c MHC II PBS 2 Days 3 Days 4 Days Spleen cLP B C 0 102 103 104 105<APC-A>: CD900102103104105<PE-A>: Lineage0 102 103 104 105<PE-Cy7-A>: CD11c0102103104105<APC-Cy7-A>: MHC II0 102 103 104 105<PE-Cy7-A>: CD11c0102103104105<APC-Cy7-A>: MHC II0 102 103 104 105<FITC-A>: CD11c-GFP0102103104105<APC-Cy7-A>: MHC II0 102 103 104 105<FITC-A>: CD11c-GFP0102103104105<APC-Cy7-A>: MHC II0 102 103 104 105<APC-A>: CD900102103104105<PE-A>: Lienage0 102 103 104 105<APC-A>: CD900102103104105<PE-A>: Lienage0 102 103 104 105<PE-Cy7-A>: CD11c0102103104105<APC-Cy7-A>: MHC II0 102 103 104 105<PE-Cy7-A>: CD11c0102103104105<APC-Cy7-A>: MHC II0 102 103 104 105<APC-A>: CD900102103104105<PE-A>: Lineage0 102 103 104 105<APC-A>: CD900102103104105<PE-A>: LineagePBS DT Spleen MLN cLP PBS DT PBS DT CD90 Lineage CD11c MHC II 1.2 0.1 0.3 0.4 1.6 0.1 0.3 1.6 8.2 1.3 2.2 2.8 CD90 Lineage 0 102 103 104 105R1-A: CD90 - APC-A0102103104105B1-A: Lineage - FITC-A0 102 103 104 105R1-A: CD90 - APC-A0102103104105B1-A: Lineage - FITC-A12.8 0.0 0 102 103 104 105R1-A: CD90 - APC-A0102103104105B1-A: Lineage - FITC-A0 102 103 104 105R1-A: CD90 - APC-A0102103104105B1-A: Lineage - FITC-A25.5 0.0 0 102 103 104 105R1-A: CD90 - APC-A0102103104105B1-A: Lineage - FITC-A0 102 103 104 105R1-A: CD90 - APC-A0102103104105B1-A: Lineage - FITC-A22.2 6.8 A PBS CD45+anti-CD90  Spleen MLN cLP PBS anti-CD90 PBS anti-CD90 CD45+CD45+  70 production by Lynup splenocytes (Figure 3.8C).  To investigate the contribution of DCs to increased IL-22 production in Lynup mice in vivo, we depleted DCs by DT treatment of CD11cDTR and CD11cDTR-Lynup mice and measured IL-22 levels in the blood and colon after LPS challenge. DC depletion was verified in the cLP, MLN and spleen by flow cytometry (Figure 3.10B-C). IL-22 levels were reduced up to five-fold in the blood and three-fold in the colons of LPS injected DC depleted CD11cDTR-Lynup and CD11cDTR mice (Figure 3.8G). Loss of IL-22 was not due to the depletion of IL-22 producing T cells or ILCs, as no changes were observed in these compartments after DT treatment (Figure 3.10B and data not shown).  Finally, we sought to identify the source of IL-22 in the cLP in vivo. To do this, Rag-/- and Rag-/-Lynup mice were left untreated or injected with LPS followed by an intravenous injection of brefeldin A. Mice were sacrificed 4 hours later and cLP cells were isolated, incubated for 6 hours with brefeldin A, and then analyzed by flow cytometry to assess cellular production of IL-22. As in the spleen, IL-22 was produced by ILCs but not DCs (Figure 3.8H, data not shown). Furthermore, Rag-/-Lynup mice had an increased frequency of IL-22-producing cells and produced more IL-22 on a per cell basis. As in the spleen, IL-22 was produced by a heterogeneous population of colonic ILCs, including both CD4+ and CD4- populations. Taken together, our results demonstrate that Lyn-activity enhances IL-22 production by ILCs in both the gastrointestinal tract and systemically in response to TLR-stimulation, and that this response is dependent on DCs.    71 3.2.5 Increased Lyn activity in DCs is sufficient to drive enhanced IL-22 production by ILCs   Although well characterized in the majority of the hematopoietic system, the expression of Lyn has, to the best of our knowledge, not been assessed in ILCs or in cLP leukocytes. We therefore isolated cLP cells from naïve wt and Lyn-/- mice and assessed Lyn expression in various cell types by flow cytometry. Lyn was expressed in macrophages, neutrophils and NK cells but not T cells, consistent with previous reports1. Interestingly, very low levels of Lyn were also observed in CD45- cells, which may include intestinal epithelial cells (Figure 3.11). Lyn expression was found to differ in ILC subsets. CD4-Sca-1+ ILCs expressed Lyn while CD4+Sca-1+ ILCs did not, which given the expression of IL-22 by both populations in spleen and colon suggests that changes in Lyn activity in other cell types drives enhanced IL-22 production by ILCs (Figure 3.12A). We also confirmed expression of Lyn in cLP DCs by flow cytometry and found that although all DCs expressed Lyn, expression varied between DC subsets, with CD11b+CD103- cells exhibiting the highest Lyn expression (Figure 3.12B).   Figure 3.11 Colonic expression of Lyn Colonic lamina propria cells were isolated from naïve Lyn+/+ (black open histograms) and Lyn-/- (grey filled histograms) mice and Lyn expression in conventional T cells (TCRβ+), macrophages (CD11b+F4/80hi), neutrophils (CD11b+Gr-1hi), NK cells (NK1.1+DX5+) and non-hematopoietic cells (CD45-) was assessed by flow cytometry. All cells were first gated on live CD45+ populations, with the exception of CD45- cells, which were gated on live CD45- cells. Representative histograms are shown.   100 101 102 103 104PE-A: Lyn PE-A020406080100% of Max100 101 102 103 104APC-A: Lyn APC-A020406080100% of Max100 101 102 103 104PE-A: Lyn PE-A020406080100% of Max100 101 102 103 104PE-A: Lyn PE-A020406080100% of MaxT Cells(TCR`+)Macrophages(CD11b+F4/80hi)Neutrophils(CD11c+Gr-1hi)NK Cells(NK1.1+DX5+)Lyn+/+Lyn-/-Lyn 100 101 102 103 104PE-A: Lyn PE-A020406080100% of Max(CD45-)  72  We have previously shown that Lyn activity in DCs regulates DC maturation, cytokine production and NK cell IFNγ production in response to LPS249. Here we identified DCs as necessary for increased IL-22 production in Lynup mice. We therefore questioned whether similar interactions were driving increased IL-22 production by CD90+ ILCs. Innate CD90+ cells (ILCs) were isolated from Rag-/- spleens and cultured with wt or Lynup bone marrow-derived DCs with or without LPS. In response to LPS, ILCs cultured with Lynup DCs  Figure 3.12 Increased Lyn-activity in DCs drives enhanced IL-22 production by ILCs. (A-B) Colonic lamina propria cells were isolated from naïve Lyn+/+ (black open histograms) and Lyn-/- (grey filled histograms) mice and Lyn expression in (A) ILCs (lineage-CD90+) and (B) DCs (CD11c+MHCII+) was assessed by flow cytometry. All cells were first gated on live CD45+ populations. Representative histograms are shown.  (C-D) Lyn+/+ or Lynup/up bone marrow-derived DCs were cultured alone or with CD90+ cells isolated from Rag-/- mice for 24 hours with (C) the indicated doses (ng/ml) or (D) 0ng/ml (-) or 100ng/ml (+) of LPS. (C) IL-22 and (D) IL-23 in culture supernatants were assessed by ELISA. Representative data from 3 independent experiments are shown. (E) Lyn+/+ or Lynup/up BM-DCs were stimulated with LPS for the indicated time points and IL-12p40 and IL-23p19 expression was assessed by qPCR (normalized to GAPDH). Error bars represent SEM, * = p < 0.05.    010020030040050060070080090010001100C Co-Culture IL-22pg/ml DC + ILC LPS ND DC ILC * ND ND Lyn+/+ Lynup/up 0 1 10 100 0 1 10 100 100 100 100 * 0100020003000400050006000D DC IL-23* ND ND LPS - + pg/ml DC IL-12p40 DC IL-23p19LPS 0.01.02.03.00.00.51.01.52.0Norm. Exp. Norm. Exp. ND ND 0 2 4 6 0 2 4 6 0 2 4 6 0 2 4 6 LPS E + - 100 101 102 103 104PerCP-Cy5-5-A: Sca1 PerCP-Cy5-5-A100101102103104PE-Cy7-A: CD4 PE-Cy7-A0 102 103 104 105<APC-A>: CD900102103104105<APC-Cy7-A>: Lineage100 101 102 103 104PE-A: Lyn PE-A020406080100% of Max100 101 102 103 104PE-A: Lyn PE-A020406080100% of Max100 101 102 103 104PE-A: Lyn PE-A020406080100% of Max100 101 102 103 104PE-A: Lyn PE-A020406080100% of Max100 101 102 103 104PE-A: Lyn PE-A020406080100% of MaxCD90 Lineage Sca-1 CD4 Lyn Lyn 1 2 4 3 1 2 4 3 100 101 102 103 104APC-A: Lyn APC-A020406080100% of Max100 101 102 103 104APC-A: Lyn APC-A020406080100% of Max100 101 102 103 104APC-A: Lyn APC-A020406080100% of Max100 101 102 103 104APC-A: Lyn APC-A020406080100% of Max100 101 102 103 104FITC-A: CD11b FITC-A100101102103104PE-A: CD103 PE-A100 101 102 103 104APC-A: Lyn APC-A020406080100% of Max0 102 103 104 105<PE-Cy7-A>: CD11c0102103104105<APC-Cy7-A>: MHCIICD11c MHC II CD11b CD103 Lyn Lyn 1 2 3 1 2 3 1 2 3 B (hours) (hours)Lyn-/-A Lyn+/+Lyn-/-Lyn+/+  73 produced more IL-22 than those cultured with wt DCs, indicating that enhanced Lyn activity in DCs is sufficient to drive increased IL-22 production by ILCs (Figure 3.12C). Neither ILCs nor DCs cultured alone produced IL-22 in response to LPS, confirming the necessity of both cell types for IL-22 production. Consistent with their ability to enhance ILC production of IL-22, Lynup DCs produced more IL-23 in response to LPS (Figure 3.12D). This increase in IL-23 production correlated with increased expression of Il-12p40 as Lynup DCs expressed more Il-12p40 mRNA compared to wt with no differences in Il-12p19 expression (Figure 3.12E). Collectively, these results highlight the importance of DC function in regulating ILC activity and suggest that increased Lyn activity in DCs regulates systemic responses to microbial products like LPS, leading to enhanced IL-22 production by ILCs. 3.2.6 LPS hypersensitivity is sufficient to protect microbiota-depleted Lynup mice from DSS colitis  Intestinal responses to microbial products are required to limit destructive inflammation resulting from DSS induced injury127, 129 and radiation-induced gastrointestinal damage284, 285. Given the systemic LPS hypersensitivity and increased IL-22 production by ILCs in response to LPS in Lynup mice, we hypothesized that intestinal hypersensitivity to LPS might play a protective role following DSS treatment. Wt and Lynup mice were treated with antibiotics to reduce their flora and received a low dose (10µg/ml) of LPS in their drinking water, which provides marginal protection to wt mice from DSS induced pathology127, prior to and during DSS treatment. Mice were then left to recover for 7 days (Figure 3.13A). The antibiotic regime was effective at significantly reducing bacterial-load in the gut as assessed by fecal DNA and bacterial 16S ribosomal RNA gene content (Figure 3.13B). Corresponding with the induction of IL-22 by LPS (Figure 3.8), the reduction in   74 intestinal flora resulted in a significant reduction in DSS induced IL-22 production in wt and Lynup mice (Figure 3.13C). In the absence of LPS, wt and Lynup mice exhibited similar DSS-induced weight loss, however wt mice exhibited profound sensitivity to DSS as 80% of mice became moribund by day 43, reaching 100% by day 44 (Figure 3.13D-E). Strikingly, microbiota reduced Lynup mice were protected from DSS with 75% of mice surviving the experiment. The presence of a low dose of LPS in the drinking water, mimicking TLR stimulation by intestinal flora, did not rescue wt mice from DSS induced weight-loss or morbidity. By contrast, LPS had a profound effect in Lynup mice, with 100% survival of the LPS treated Lynup mice and significantly reduced weight-loss observed (Figure 3.13D-E). Overall these data suggest that Lyn activity modulates intestinal responses to microbial products, which significantly impact the outcome of disease following intestinal damage.    75  3.3 Discussion  Perturbations in the immune system and its responses to PRR signals are critical factors in the development of IBD and experimental colitis16, however despite Lyn’s role in immune cell responses, the function of Lyn has never been explored in the context of gastrointestinal inflammation. There are however, various human malignancies associated with dysregulation of Lyn expression or activity1. Drugs targeting SFKs, such as Dasatinib used to inhibit SFKs in tumours may also affect Lyn and other SFKs systemically. Importantly, colitis can develop as a side effect of Dasatinib treatment286, 287, implicating a role for SFKs such as Lyn, or other targets of this tyrosine kinase inhibitor, in modulating gastrointestinal immune  Figure 3.13 Hypersensitivity to LPS protects antibiotic treated Lyn+/up mice from DSS-induced weight-loss and death. (A) Diagram depicting the experimental protocol. Lyn+/+ and Lyn+/up mice were given a cocktail of antibiotics (AB’c) in their drinking water for 5 weeks. LPS was added during the fourth week to half the group of mice and 2.5% DSS was added to all cages for the fifth week. All mice were then given sterile drinking water for an additional week. (B-C) Colon sections and fresh fecal pellets were harvested from Lyn+/+ and Lyn+/up mice four days post-DSS treatment. (B) Total concentration of DNA and relative abundance of 16S bacterial DNA is shown. (C) IL-22 in colon explant cultures was quantified by ELISA, n=4. (D, E) Lyn+/up and wt mice were treated as in A and (D) body weight and (E) animal health were assessed daily from day 35-49 and mice that became moribund were euthanized.  symbol indicates death of a mouse treated with (grey) or without (black) LPS. Representative data from two independent experiments is shown, n=4-6/experiment. Error bars represent SEM, * = p < 0.05, ** = p < 0.01, *** = p < 0.001.  0.00.10.20.30.40.50.6010203040506070809010035 37 39 41 43 45 47 49809010011010011035 37 39 41 43 45 47 498090100110Days050100150200250300350050100150200250300350Weight (% Starting) Weight (% Starting) Time (days) Time (days) Survival (%) Weight Change Weight Change Morbidity Time (days) Lyn+/+Lyn+/upLyn+/up  pg/ml AB’c     Colon IL-22 * ******Total DNA 16S DNA ng/+lRelative Abundance A B C D E AB’c H2OLPS +/- DSS Time (days) 14 28 35 42 49 7 AB’c     203040506070809010035 37 39 41 43 45 47 4989010110** ** **** * ** Lyn+/up+LPSLyn+/+Lyn+/++LPSLyn+/+Lyn+/++LPSLyn+/upLyn+/up+LPS  76 responses. Here we present evidence that Lyn plays a role in regulating intestinal inflammation and disease in acute and chronic models of DSS induced colitis. Moreover, we suggest a potential mechanism of protection from disease in Lynup mice, showing that hypersensitivity to TLR stimuli leads to increased protective responses during inflammatory insult. Chronic intestinal inflammation is linked with the development of colon cancer both in mice and in patients with IBD279, 288. Accordingly, increased Lyn activity in Lynup mice resulted not only in decreased chronic colitis, but also the development of fewer tumours following AOM/DSS treatment. Whether protection from CAC is afforded by enhanced Lyn activity within the hematopoietic system alone or other Lyn expressing compartments such as the epithelium still remains to be determined and would provide important mechanistic-insights into the role of Lyn in colon cancer. Nonetheless, the data presented here may have implications for IBD patients, as a recent study identified a protective-association between increased levels of Lyn mRNA in the rectal mucosa of UC patients and diminished development of CAC289. SFK inhibitors are being used and developed for the treatment of various cancers, including colon cancer290, however our results suggest that the use of these inhibitors be carefully monitored for gastrointestinal-complications.  Uncontrolled inflammatory responses downstream of PRR-signaling contribute extensively to pathogenesis in IBD and murine models of colitis130. However, these same signaling pathways are required to maintain intestinal homeostasis and limit inflammation16, 123, 124, 126, 127, 129. Given the DC dependent hypersensitivity of Lynup mice to LPS249, we questioned whether enhanced PRR responses by innate immune cells were responsible for the protection from DSS in Lynup mice. We found that the adaptive immune system was   77 dispensable for this phenotype and that LPS hypersensitivity in Lynup mice was sufficient to rescue antibiotic-treated mice from DSS induced disease and death. A previous study demonstrated that introduction of a high dose (50mg/ml) of LPS into drinking water of mice following antibiotic treatment was sufficient to protect mice from DSS-induced colitis and mortality, while a lower dose of LPS (10µg/ml) was less effective and rescued only ~30% of wt mice127. By contrast, we found that a low dose of LPS (10µg/ml) had little effect on DSS-induced weight-loss and mortality in wt mice, possibly due to differences in animal facilities, sources of LPS, microbiota and/or the antibiotic treatment regime used in our study. Nonetheless, heterozygosity for the Lyn gain-of-function allele (Lyn+/up) was sufficient to confer sensitivity to the low dose of LPS, rescuing all Lynup mice from DSS-induced weight loss and morbidity. Together these studies suggest that the hypersensitivity to PRR ligands, such as LPS, by innate immune cells is sufficient to provide protection from DSS induced disease. However, further studies using immunodeficient mice are currently ongoing to address this question directly, as it remains a possibility that increased innate responses to microbes in Lynup mice enhance protective adaptive immunity. Of note, in the absence of LPS treatment, Lynup mice exhibited increased survival compared to wt.  The antibiotic treatment regime used in our studies has been shown to significantly reduce the microbial-burden within the intestine, however, some bacteria persist following the treatment262. We therefore speculate that hypersensitivity to these remaining microbes in Lynup mice provides some protection from DSS insult. Interestingly, recent studies have highlighted the importance of IL-22 and antimicrobial responses in maintaining appropriate anatomical localization of intestinal microbes that have the potential to induce systemic inflammation291, 292. Whether Lyn-gain-of-function mice possess a distinct   78 microbiota, or a superior ability to control pathobionts that may emerge during the course of antibiotic treatment, remains to be determined.  IL-22 production is induced in vivo in response to TLR ligands including LPS or flagellin216, 221, 283. We therefore hypothesized that hypersensitivity to microbial products is involved in modulating IL-22 production in Lynup mice. Systemic administration of LPS alone was sufficient to induce increased amounts of IL-22 in Lynup mice compared to wt. Furthermore, antibiotic treatment profoundly decreased DSS-induced IL-22 production in both wt and Lynup mice. These data suggest that increased Lyn activity serves to enhance TLR-responses that modulate IL-22 production and does not drive IL-22 production through PRR-independent mechanisms. This is in agreement with previous studies indicating that increased Lyn activity in Lynup mice does not qualitatively affect immune cell signaling pathways, but instead serves to modulate signaling thresholds in Lyn regulated pathways240. To our knowledge, this is the first report demonstrating regulation of IL-22 production by Lyn or any other SFK. Although IL-22 levels increase early in Lynup mice during DSS treatment, neutralizing experiments suggested that IL-22 plays a more important role in restitution and repair. This is consistent with the exaggerated protection observed in Lynup mice during the course of the chronic DSS model compared to acute DSS.  However, we hypothesize that subtle increases in intestinal IL-22 throughout the lifetime of a Lynup mouse may result in the predisposition towards resistance to the initial DSS-induced epithelial damage, resulting in protection from acute intestinal damage. Further studies are needed to investigate this possibility. ILCs have emerged as the major source of IL-22 in response to systemic administration of TLR ligands216, 218, 221, 283. However, whether Lyn is expressed in ILCs, or   79 plays a role in ILC activation and function has not been studied. Interestingly, in the colon Lyn was only expressed by CD4-Sca-1+ ILCs but IL-22 was produced by numerous subsets of ILCs including CD4+ subsets. This suggests that ILC-intrinsic changes in Lyn activity are not solely responsible for the increased IL-22 production by ILCs in Lynup mice. It is now evident that DCs are required to respond to microbial products and convey signals to ILCs in order to drive IL-22 production216, 221. Furthermore, the importance of DC interactions with members of the ILC family has been extensively studied in the context of NK cells293. However, the pathways that mediate DC interactions with IL-22 producing ILC3s, including LTi-like cells and NCR+ ILC3s, are just beginning to be elucidated275. Our previous work highlighted the importance of DC-intrinsic Lyn signaling in DC regulation of NK cell activation and effector responses. LPS challenge of Lynup mice led to DC and NK cell dependent morbidity in Lynup mice249. The data presented here extend the importance of Lyn in modulating DC-interactions to other members of the ILC family. While DCs did not produce IL-22, both DCs and innate CD90+ cells (ILCs) were required to drive increased IL-22 production in vivo and in in vitro culture systems. Furthermore, hypersensitivity to LPS by increased Lyn activity in DCs drove increased IL-22 production by ILCs in vitro. Collectively, we show that modulation of Lyn signaling in DCs may be a common mechanism that regulates the activity of distinct ILC family members.  This study reveals a novel role for Lyn in regulating intestinal inflammation and IL-22 production by ILCs and demonstrates how changes in signaling pathways that regulate PRR-responses can have a profound impact on intestinal inflammation. This work should pave the way for future studies investigating the importance of Lyn and other SFKs in regulating the host-microbiota interactions during homeostasis and disease, the molecular   80 interactions that dictate the outcome of innate immune cell interactions, and the outcome of clinical studies utilizing Lyn and other SFK inhibitors that may lead to colitis.   81 Chapter 4: Lyn deficiency leads to increased microbiota-dependent intestinal inflammation and susceptibility to enteric pathogens    82 4.1 Introduction The human intestinal tract houses up to 100 trillion microorganisms that exist as complex communities collectively termed the commensal microbiota118. These microbes provide many benefits to their host, including aiding in digestion, protection from colonization by pathogens, as well as the appropriate development of the immune system119. However, the close proximity of potentially pathogenic microorganisms with the internal environment puts the host at risk for serious infection. The gut, like other mucosal sites, is therefore reinforced by an elaborate immune system charged with the unique task of containing and tolerating the microbiota while maintaining an ability to recognize and defend against enteric pathogens. This immune system is continuously exposed to microbial products from the luminal flora, which trigger innate responses via PRRs123, 124. These interactions play a major role in regulating the intestinal inflammatory environment, which in turn affects the composition of the microbiota294. This can have profound implications for the outcome of intestinal inflammation. For example, mice deficient in NLRP6, ASC, IL-18 or Caspase-1 possess distinct microbiotas associated with exacerbated colitis induced by the chemical irritant DSS295. The colitogenic effects of dysbiosis are transferable, as co-housing or cross-fostering of mutant mice with wt mice results in enhanced susceptibility of wt mice to DSS295. This phenomenon extends to susceptibility to infection by enteric pathogens such as Citrobacter rodentium, in that transfer of microbiota from resistant strains of mice into susceptible hosts can both increase resistance to infection as well as decrease inflammation-induced damage296, 297. The mechanisms that affect the dynamics between the host immune system and commensal microbiota are still largely unclear, as is the impact of perturbations of these interactions on the outcome of inflammation and susceptibility to enteric infection.   83 An important regulator of immune homeostasis and PRR-induced responses is the Lyn tyrosine kinase. Lyn is a member of the Src-family of non-receptor tyrosine kinases expressed throughout the hematopoietic system with the exception of T cells and some ILCs. The kinase is activated upon ligand binding to a wide variety of cell surface receptors that are essential for initiating or limiting immune responses1, 4. Studies of Lynup and Lyn-/- mice have shown that Lyn is an important regulator of B cell responses242, 282, 298, 299, proliferation and degranulation of mast cells300, 301, integrin signaling in neutrophils256, M2 macrophage polarization245, and that Lyn is a critical regulator of DC function and NK cell activation following TLR stimulation249, 302. Furthermore, data presented in chapter 3 of this thesis demonstrated that Lyn activation promotes IL-22 production and protects mice from DSS colitis, phenotypes associated with enhanced TLR-dependent DC activation of ILC3s223.   Here we show that Lyn deficiency results in increased susceptibility to intestinal damage-induced inflammation and enteric infection. Lyn-/- mice exhibited enhanced susceptibility to DSS-induced colitis, increased colonic pathology following C. rodentium infection, and were highly susceptible to bacterial colonization and inflammation in the gut during gastroenteritis and typhoid models of Salmonellosis. Susceptibility to DSS in Lyn-/- mice was associated with exaggerated production of IL-17 and IFNγ by colonic T cells and was dependent on the presence of the adaptive immune system excluding CD20+ B cells. The development of dysbiosis in Lyn-/- mice, which included the expansion of SFB, was associated with altered IL-22 and IgA production and susceptibility to DSS colitis that was transferable to wt mice via co-housing. Together, these results demonstrate that Lyn plays an important role in controlling intestinal inflammatory responses by regulating both the nature of the immune response and the composition of the microbiota.   84 4.2 Results 4.2.1 Lyn deficiency results in increased susceptibility to experimental colitis  We recently identified a protective role for Lyn in intestinal inflammation, showing that hypersensitivity to PRR ligands in Lyn gain-of-function mice led to increased protective responses during DSS treatment, a phenotype that was independent of the adaptive immune system223. Here, we used both enteric infection and intestinal damage models of disease to better understand the role of Lyn in regulating intestinal inflammation and the mucosal immune system. Lyn-/- and wt mice were challenged with increasing concentrations of DSS for 7 days followed by recovery, and morbidity (mice were euthanized after ≥20% body weight loss) was assessed throughout the experiment. At intermediate (2.5%) and high (5%) doses of DSS, survival was significantly reduced in Lyn-/- mice. A dose of 5% DSS caused 100% morbidity of both wt and Lyn-/- mice, with wt mice surviving a maximum of 8 days and Lyn-/- mice a maximum of 6 days. Decreasing the dose to 2.5% extended survival of wt mice to a maximum of 11 days, whereas Lyn-/- mice survived only until day 9. At a dose of 1.5% DSS, 100% of Lyn-/- and wt mice survived the entire treatment period (Figure 4.1A). Colon length was measured for each mouse at the experimental endpoint (≥20% weight loss or 14 days). Lyn-/- colons were shorter than wt after 1.5% DSS treatment and significantly shorter following 2.5% and 5% DSS treatment, and there was no significant difference in colon length of untreated mice (Figure 4.1B). Rectal bleeding scores in Lyn-/- mice also indicated increased susceptibility to disease and increased with DSS dose (Figure 4.1C).     85  4.2.2 Colonic changes at early time points during DSS challenge, and altered cytokine production correlate with increased susceptibility to disease in Lyn-/- mice To investigate changes in the colon throughout DSS treatment, we first sought to investigate whether SFKs, including Lyn, were activated during DSS treatment303, 304. Western blot analysis revealed an increase in active SFKs in the colons of DSS treated mice compared to untreated controls, based on an increase in the phosphorylation of the activating tyrosine residue (Y418 for Src and Y396 for Lyn). An increase in Lyn activity was supported by a modest decrease in the phosphorylation of the inhibitory tyrosine (Y507) (Figure 4.1D).   Figure 4.1 Lyn deficiency increases susceptibility to DSS-induced colitis. Increasing concentrations of DSS (1.5%, 2.5% and 5%) were administered to wt (Lyn+/+) and Lyn-/- mice for 7 days followed by a recovery period. (A) Animals were monitored daily for % body weight loss as an indicator of morbidity (experimental endpoint was equivalent to ≥20% loss of starting weight). (B) Once 20% weight loss was reached, or on day 14, mice were sacrificed and colon length was measured. (C) Rectal bleeding was scored daily throughout the treatment. Representative data of two independent experiments are shown, n=4-6. Error bars represent SEM, * = p < 0.05, ** = p < 0.01. (D) Colonic protein lysates from naïve (d0) and DSS treated (d3, d6) mice were analyzed by Western blotting for total Lyn, and phospho-Lyn (inhibitory, pY507) and phopho-Src family (activating, pY418). β-actin was used as a loading control. 0 2 4 6 8 10 12 1401234C Rectal Bleeding-1.5%Score Time (days) 0 1 2 3 4 5 6 701234Rectal Bleeding-5%Time (days) 0 1 2 3 4 5 6 7 8 9 10 11 12 130255075100A MorbidityTime (days) Survival (%) Lyn+/+ 5% DSSLyn-/- 5% DSSLyn-/- 2.5% DSSLyn-/- 1.5% DSSLyn+/+ 2.5% DSSLyn+/+ 1.5% DSS** * *0 1 2 3 4 5 6 7 8 9 100123Lyn+/+Lyn-/-0 1 2 3 4 5 6 7 8 9 1001234Rectal Bleeding-2.5%Time (days) *B Length (cm) 45678910Colon Length DSS * Lyn+/+Lyn-/-Untrt. 1.5% 2.5% 5% *LynpY507pY418`-actinLyn-/- Lyn+/+DSS d0 d0 d6 d3D  86 We then challenged wt and Lyn-/- mice with 2.5% DSS for 2, 4 or 7 days and monitored disease progression. Lyn-/- mice lost significantly more body weight than wt controls on days 4 and 7 of treatment (Figure 4.2A). In addition, as early as day 2 post-DSS treatment, Lyn-/- mice had significantly shorter colons than wt mice, with colon length in both strains decreasing progressively during treatment (Figure 4.2B). Shorter colons in Lyn-/- mice correlated with modestly elevated pathology scores at days 2 and 4, and significantly higher scores at day 7 of DSS treatment, compared to wt (Figure 4.2C). Assessment of epithelial integrity during DSS treatment by measuring FITC-dextran diffusion into the bloodstream showed that permeability of the intestinal epithelium was significantly greater in Lyn-/- mice at days 2 and 4 post-DSS treatment (Figure 4.2D). This increase in barrier permeability was associated with increased cellular proliferation in Lyn-/- colons. After 2 days of DSS treatment, Ki67+ cells were observed significantly further up the colonic crypts compared to wt controls (Figure 4.2E). Furthermore, there were significantly increased numbers of Ki67+ cells per crypt in Lyn-/- mice on day 7 post-DSS treatment (Figure 4.2F,H). Consistent with increased numbers of proliferating epithelial cells, crypt hyperplasia was a feature of Lyn-/- colons after DSS treatment, with the greatest differences in crypt length observed at day 7 (Figure 4.2G). Representative histological sections of colons taken at each time point are shown in Figure 4.2H and indicate increased pathology, including immune cell infiltration, epithelial injury, crypt hyperplasia and edema, in Lyn-/- mice by day 7 of DSS. Together, these data demonstrate an increase in kinetics and severity of intestinal damage in Lyn-/- mice following DSS exposure.    87   Figure 4.2 Lyn deficiency leads to exacerbated DSS colitis, barrier permeability, crypt hyperplasia and distinct cytokine and transcription factor expression profiles. ***Day 7 Day 4 Day 2 Day 7 Day 4 Day 2 7580859095100D H Scale bar = 100+mScale bar = 200+mE Ki67  A B C Body Weight Colon Length Colon Pathology 051015202530354045Gut Permeability ND F 051015202530354045Ki67  150200250300Crypt Length Length (+m) Length (cm) Score Weight (% Starting) Lyn+/+Lyn-/-*** ** 4.55.05.56.06.57.07.58.0 ** ** FITC (+g/ml) Ki67+  (% of crypt)* * Lyn+/+Lyn-/-Day 2 Untrt. Day 4 Day 7 Untrt. Day 7 G 0102030405060* 0123 * Day 2 Untrt. Day 4 Day 7 Day 2 Untrt. Day 4 Day 7 * Day 2 Untrt. Day 4 Day 7 Day 2 Untrt. Day 4 Day 7 Day 2 Untrt. Day 4 Day 7 050100150200250050100150200250010002000300040005000pg/mlJ IFNa IL-22 IL-17A/F RorcNorm. Exp. 2Day 4 70.02.55.07.510.012.515.017.520.022.5 *010020030001002003002Day 4 7 2Day 4 7020406080100120pg/mlDay 7Day 7Day 7Day 7TNF_IL-1` IL-6I KKi67+  (cells/crypt)  88  Cytokine production in explant cultures was assessed as the cytokine environment plays a major role in the development and outcome of intestinal inflammation. Although Lyn-/- mice had more severe inflammation and intestinal damage, we found no significant differences in the production of the pro-inflammatory cytokines IL-1β, TNFα, or IL-6 in DSS treated wt and Lyn-/- mice (Figure 4.2I). IL-17, IL-22, and IFNγ also play important roles in the pathogenesis of IBD and experimental models of colitis 16. Levels of IL-17A/F were variable but trended towards a slight increase in Lyn-/- mice which was consistent with a significant increase in the expression of Rorc (encoding RORγt), a transcription factor required for the generation of Th17 cells305 and IL-17 producing ILCs306. Increased IFNγ was also observed in Lyn-/- mice during DSS treatment, however IL-22 was not consistently different between genotypes (Figure 4.2J,K).  4.2.3 The adaptive immune system is required for increased susceptibility of Lyn-/- mice to DSS.  The innate immune system plays a critical role in dictating the nature and magnitude of intestinal immune responses and susceptibility to DSS colitis. We therefore analyzed the Figure 4.2 Lyn deficiency leads to exacerbated DSS colitis, barrier permeability, crypt hyperplasia and distinct cytokine and transcription factor expression profiles. Wt (Lyn+/+) and Lyn-/- mice were treated with 2.5% DSS and animals were sacrificed on days 2, 4 and 7 after the start of treatment. (A) Body weight was monitored daily. (B) Colon length was measured at the experimental endpoint. (C) Pathology scoring and (G) crypt length were assessed from (H) cross sections of distal colon stained with H&E or Ki67 (green) and DAPI (blue). (D) At the experimental endpoint, mice were administered 400ng/g FITC-dextran by oral gavage and sacrificed four hours later. Blood was collected for analysis of FITC serum levels as an indicator of intestinal permeability. Quantitation of Ki67 positive cells are expressed either as (E) % length of crypt containing Ki67+ cells or as (F) total numbers of Ki67+ cells per crypt. (I, J) At the experimental endpoint, colons were harvested and cytokines were measured in colon explant supernatants. (K) After 7 days of DSS, RNA was extracted from distal colon tissue and Rorc mRNA expression was assessed by qPCR. Target gene expression (Norm. Exp.) was normalized to Gapdh. Representative data from more than three independent experiments are shown for A, n=3. Pooled data from two to three independent experiments are shown in B-D, n=6-11, untreated n=3. For E-G, representative data of one to two independent experiments is shown for DSS treated mice, n=3-6. Representative data from three independent experiments is shown for I and K, n=4-6. Pooled data from three independent experiments is shown for cytokine production in J, n=6-9. Error bars represent SEM, ** = p < 0.01, *** = p < 0.001.     89 innate immune compartments in the colonic lamina propria of wt and Lyn-/- mice before and after DSS challenge. No consistent differences were found in the frequency of colonic macrophages (CD11b+F4/80+) or granulocytes/neutrophils (CD11b+Gr1hi) in untreated or DSS treated Lyn-/- and wt mice. However we observed a small but consistent increase in frequency in DCs (CD11c+MHCII+) in untreated Lyn-/- mice and this difference was significant after DSS treatment (Figure 4.3A). Further examination of the DC compartment revealed significantly decreased frequency of the immunoregulatory CD11b-CD103+ DCs in the colons of DSS-treated Lyn-/- mice (Figure 4.3B). No major differences were observed in MHCII, CD80 or CD86 expression in DCs from naïve mice, however after DSS treatment, Lyn-/- DCs expressed elevated levels of CD80 and CD86 (Figure 4.3B). Overall the observed changes in colonic DC populations, in Lyn-/- mice correlated with increased intestinal inflammation in these mice.    90   Figure 4.3 Lyn deficiency affects colonic DC composition. Wt (Lyn+/+) and Lyn-/- mice were left untreated (Untrt.) or were challenged with 2.5% DSS for 7 days (DSS). Colonic lamina propria cells were isolated and analyzed for the presence of (A) macrophages (CD11b+F4/80+), granulocytes (CD11b+Gr-1+), and DCs (CD11c+MHC II+); (B) DCs were further analyzed for the expression of CD103 and CD11b (gated on CD11c+MHCII+ cells) as well as for CD80, CD86 and MHCII expression (gated on CD11c+ cells). (Right) DCs are represented by open histograms and shaded histograms represent CD11c- cells.  All cells were first gated on live (propidium iodide negative) CD45+ populations. Representative plots and graphs pooled from 3 to 4 independent experiments are shown, n=6-8 total. Error bars represent SEM, * = p < 0.05. 0 102 103 104 105<FITC-A>: CD11b0102103104105<APC-A>: F4/800 102 103 104 105<FITC-A>: CD11b0102103104105<PE-Cy7-A>: Gr-10 102 103 104 105<FITC-A>: CD11b0102103104105<PE-Cy7-A>: Gr-10 102 103 104 105<FITC-A>: CD11b0102103104105<PE-Cy7-A>: Gr-10 102 103 104 105<FITC-A>: CD11b0102103104105<PE-Cy7-A>: Gr-10 102 103 104 105<PE-Cy7-A>: CD11c0102103104105<APC-A>: MHC II0 102 103 104 105<PE-Cy7-A>: CD11c0102103104105<APC-A>: MHC II0 102 103 104 105<PE-Cy7-A>: CD11c0102103104105<APC-A>: MHC II0 102 103 104 105<PE-Cy7-A>: CD11c0102103104105<APC-A>: MHC IICD45+Lyn+/+Untrt.  DSS A CD11c MHC II 22.7 26.8 15.1 23.5 CD11bGr-1 0.12 1.1 0.20 2.7 0 102 103 104 105<FITC-A>: CD11b0102103104105<APC-A>: F4/800 102 103 104 105<FITC-A>: CD11b0102103104105<APC-A>: F4/800 102 103 104 105<FITC-A>: CD11b0102103104105<APC-A>: F4/80CD11b F4/80 35.8 33.0 26.7 21.1 7.3 12.4 9.1 13.3 0 102 103 104 105<APC-A>: MHC II020406080100% of Max0 102 103 104 105<FITC-A>: CD86020406080100% of Max0 102 103 104 105<PE-A>: CD80020406080100% of Max0 102 103 104 105<FITC-A>: CD11b0102103104105<PE-A>: CD1030 102 103 104 105<FITC-A>: CD11b0102103104105<PE-A>: CD1030 102 103 104 105<FITC-A>: Cd11b0102103104105<PE-A>: CD1030 102 103 104 105<FITC-A>: Cd11b0102103104105<PE-A>: CD103CD11b CD103 47.8 41.0 28.1 34.8 4.3 6.9 CD80 0 102 103 104 105<PE-A>: CD80020406080100% of MaxCD86 0 102 103 104 105<FITC-A>: CD86020406080100% of MaxUntrt.  DSS B 0 102 103 104 105<APC-A>: MHC II020406080100% of MaxMHC II 31.1 23.6 32.3 38.7 9.3 8.9 010203005101520253035% of CD45+  CellsUntreatedCD11c+MHC II+CD11b+F4/80+CD11b+Gr-1loCD11b+Gr-1hiCD11c+MHC II+CD11b+F4/80+CD11b+Gr-1loCD11b+Gr-1hi% of CD45+  CellsDSS*01020304050600102030405060CD11b-CD103+CD11b+CD103+CD11b+CD103-% of DCsUntreatedCD11b-CD103+CD11b+CD103+CD11b+CD103-*% of DCsDSSLyn+/+Lyn-/-Lyn-/- Lyn+/+ Lyn-/- Lyn+/+ Lyn-/-CD45+ CD45+CD45+CD11c+MHCII+Lyn+/+ Lyn-/-CD45+CD11c+Lyn+/+Lyn-/-  91 To gain further insight into the mechanism of susceptibility to DSS in Lyn-/- mice, we questioned whether the adaptive immune system was required for disease severity. Lyn-/-, Rag-/- and Rag-/-Lyn-/- mice were treated with DSS for 7 days. Lyn-/- mice exhibited the greatest susceptibility to disease however Rag-/-Lyn-/- mice were modestly resistant to DSS colitis compared to their Rag-/- counterparts (Figure 4.4A). No major differences were observed in rectal bleeding between the groups however the Rag-/-Lyn-/- mice exhibited the least amount of rectal bleeding, particularly in the early part of the disease (Figure 4.4B). In addition, Lyn-/- mice had significantly shorter colons following DSS treatment than both immunodeficient groups, which did not differ from each other (Figure 4.4C).   92   Figure 4.4 The adaptive immune system is required for susceptibility to DSS colitis in Lyn-/- mice. 0 1 2 3 4 5 6 70123Days Days0 1 2 3 4 5 6 77585951050 1 2 3 4 5 6 701234345678IsoH Body Weight Weight (% Starting) Lyn+/+Lyn-/-_CD20 Iso _CD20***Lyn+/+ (Iso)Lyn+/+ (_CD20)Lyn-/- (Iso)Lyn-/- (_CD20)Rectal BleedingScoreColon LengthLength (cm)I J** ****** ***## ##### ### *** *******# ##345678A Weight (% Starting) DaysRectal BleedingScoreColon LengthLength (cm)B CDays****Lyn-/- Rag-/- Rag-/-Lyn-/-0 1 2 3 4 5 6758595105Body Weight Lyn-/-Rag-/-Rag-/-Lyn-/-7*** **####### ## **D E GB220CD3Lyn-/-Lyn+/+ Lyn-/-Lyn+/+Spleen ColonIsotype_CD2020.0 ± 3.352.8 ± 6.913.1 ± 5.428.9 ± 6.461.8± 3.44.4± 1.94.8± 0.815.3± 5.67.4 ± 1.99.9 ± 1.612.6 ± 1.617.6 ± 1.213.9± 5.74.1± 1.04.7± 0.74.9± 0.70100200300Untreated DSSNumber/colon (x103 )B CellsF*048120.00.51.01.5020406004080120pg/ml**Lyn-/- Rag-/- Rag-/-Lyn-/-IFNa*pg/mlLyn-/- Rag-/- Rag-/-Lyn-/-IL-17A IL-17A/Fpg/mlLyn-/- Rag-/- Rag-/-Lyn-/-RorcNorm. Exp.Lyn-/- Rag-/- Rag-/-Lyn-/-* ***  93  Consistent with increased inflammation, immunocompetent Lyn-/- mice exhibited significantly elevated IL-17 and IFNγ production and expression of Rorc compared to Rag-/-Lyn-/- mice. Lyn-/- mice also expressed significantly increased levels of Rorc mRNA and trended towards more IL-17 production compared to Rag-/- mice. Interestingly, in the absence of an adaptive immune system (Rag-/-), Lyn deficient (Rag-/-Lyn-/-) mice no longer exhibited increased IFNγ or Type 17 response markers (IL-17 and Rorc) compared to their Lyn wt (Rag-/-) counterparts (Figure 4.4D,E).  Lyn-/- mice are known to have an altered B cell compartment involving both defects in B cell development as well as hyperactivity of B cells that results in autoimmune disease in aged mice242, 282, 298, 299. Consistent with published reports on systemic B cell populations, naïve Lyn-/- mice had significantly fewer B cells in the colonic lamina propria than wt mice. Following DSS, this difference was diminished but still trended towards decreased B cells (Figure 4.4F).  We therefore questioned whether altered B cell responses, perhaps through differences in IL-10 or other immunoregulatory cytokines, were contributing to increased DSS colitis in Lyn-/- mice. However B cell depletion had no impact on the disease severity of Figure 4.4 The adaptive immune system is required for susceptibility to DSS colitis in Lyn-/- mice. (A-E) Lyn-/-, Rag-/- and Rag-/-Lyn-/- mice were treated with 2.5% DSS and (A) body weight and (B) rectal bleeding were monitored over 7 days. At the experimental endpoint (day 7), mice were sacrificed, and (C) colon length and was measured. (D) Cytokine production was measured in colon explant cultures. (E) RNA was extracted from distal colon and mRNA expression was assessed by qPCR. Target gene expression was normalized to Rps29. Representative data from three independent experiments for Rag-/- and Rag-/-Lyn-/- and an independent experiment including Lyn-/- is shown n=6-7. (F) Total B cell numbers (B220+ or CD19+) were assessed by flow cytometry in naïve and DSS treated wt (Lyn+/+) and Lyn-/- mice. Graph represents data pooled from 3-4 experiments, n=6-8. (G-J) Wt (Lyn+/+) and Lyn-/- mice were treated with anti-CD20 depleting mAb (aCD20) or isotype control antibodies (Iso) 4 and 2 days prior to treatment with 2.5% DSS for 7 days. (G) B cell (B220+CD3-) depletion in spleen and colonic lamina propria were assessed by flow cytometry. Representative plots are shown and numbers represent mean frequency per group ± SD. (H,I) Body weight and rectal bleeding were monitored daily throughout the DSS treatment. After 7 days of DSS treatment mice were sacrificed, (J) colon length was measured. Data from an independent experiment is shown, n=6-7. */# = p < 0.05, **/## = p < 0.01, ***/### = p < 0.001. (A-B) *s represent differences between Rag-/- vs. Rag-/-Lyn-/- and #s represent Lyn-/- vs. Rag-/-Lyn-/-. (H-J) *s indicate differences between Lyn+/+ (Iso) vs. Lyn-/- (Iso) and #s indicate differences between Lyn+/+ (αCD20) vs. Lyn-/- (αCD20).      94 wt or Lyn-/- mice, suggesting that these cells are not directly contributing to disease etiology in our mice (Figure 4.4H-J). Together, these data suggest that Lyn deficiency drives pathogenic adaptive immune responses, potentially involving exaggerated IL-17 and IFNγ producing T cells.  4.2.4 Increased susceptibility to DSS in Lyn-/- mice is dependent on the microbiota  The ability of the immune system to shape the composition of the microbiota has been highlighted in a number of recent studies.  For example, dysbiosis is a feature of Tbx21-/-Rag2-/-307, Pycard-/- (encodes ASC), and Nlrp6-/- mice295. Importantly, the dysbiosis that develops in these mutant mice is sufficient to drive spontaneous colitis307 or increased susceptibility to experimental colitis295. We therefore sought to determine whether Lyn is a direct negative regulator of intestinal inflammation, or alternatively, if Lyn deficiency might lead to the emergence of a distinct microbiota predisposing Lyn-/- mice to colitic disease. A basic examination of the microbiota revealed no significant difference in relative abundance of Clostridium coccoides or Lactobacillus/Lactococcus between wt and Lyn-/- mice; however Lyn-/- mice had a significantly elevated population of SFB (Figure 4.5A). Our mouse colonies had previously tested positive for colitogenic Helicobacter species including H. hepaticus, however, no difference in abundance was observed between wt and Lyn-/- mice (Figure 4.5A), and H. bilis was undetectable in our colony (data not shown). To determine whether differences in microbiota contributed to DSS susceptibility in Lyn-/- mice, wt and Lyn-/- mice were co-housed for 4 weeks prior to DSS treatment. Strikingly, changes in microbiota had a dramatic effect on DSS susceptibility. Co-housing of wt mice with Lyn-/- mice increased DSS-induced disease in wt mice and provided limited protection in Lyn-/- mice, as both genotypes displayed an intermediate DSS susceptibility phenotype based on weight loss and   95 colon length (Figure 4.5B,D). Following co-housing, the differences in weight loss between wt and Lyn-/- mice was greatly reduced and both genotypes were indistinguishable based on colon length and rectal bleeding assessments (Figure 4.5C,D). These changes in disease susceptibility correlated with changes in SFB abundance. Prior to co-housing, Lyn-/- mice had a significantly increased (~20-fold) abundance of SFB compared to wt mice, which had low to undetectable levels of SFB DNA. Co-housing resulted in an increase in SFB abundance in wt mice and a concurrent decrease in Lyn-/- mice, with similar levels of SFB DNA detected in fecal pellets of both genotypes following four weeks of co-housing (Figure 4.5E).   96   Figure 4.5 DSS susceptibility in Lyn-/- mice is associated with a distinct microbiota.  (A) Bacterial DNA was isolated from fecal pellets from naïve wt (Lyn+/+) and Lyn-/- mice and the relative abundance of SFB, Clostridium coccoides (Clost.), Lactobacillus/Lactococcus (Lacto.), and Helicobacter hepaticus (H. hep.) DNA was quantified by qPCR. Target bacterial DNA was normalized to total eubacterial DNA. Representative data from three independent experiments is shown, n=8. The Y-axis on the right represents the scale for abundance of H. hepaticus. (B-E) Wt and Lyn-/- mice were co-housed for 4 weeks prior to treatment with 2.5% DSS. (B) Body weight and (C) rectal bleeding were monitored daily during DSS treatment. (D) At the experimental endpoint (day 7), mice were sacrificed and colon length was measured. (E) Fresh feces was collected after 0, 2 and 4 weeks of co-housing and relative abundance of SFB DNA was assessed by qPCR using total eubacteria as a reference. (B-E) Representative data from two independent experiments is shown, n=4-5. (F-H) Wt and Lyn-/- mice were rederived by surgical implantation of embryos into CD1 female recipient mice. Rederived mice were treated with 3.5% DSS for 7 days and (F) Body weight and (G) rectal bleeding were monitored daily. (H) At the experimental endpoint (day 7), mice were sacrificed and colon length was measured. (F-H) Representative data from three independent experiments is shown, n=4. Error bars represent SEM, * = p < 0.05, ** = p < 0.01, *** = p < 0.001.   0 1 2 3 4 5 6 70.00.51.01.52.02.5345678C ** ** Rectal Bleeding Score Time (days) Colon Length Length (cm)  Control Co-housed D A Rel. Abundance MicrobiotaSFB  Clostr.  Lacto.  Rel. Abundance SFB 0.00.10.20.3***  *0 wks 2 wks 4 wksE ***  ##0 1 2 3 4 5 6 70.00.51.01.52.02.5Rectal Bleeding Time (days)Score  G **##0 1 2 3 4 5 6 7859095100105Weight Change Time (days)% Starting Weight B 456789Colon Length Length (cm)  Untrt. DSS H ** ** 0 1 2 3 4 5 6 780859095100105Weight Change Time (days) % Starting Weight *F 0 2 40.00.10.20.3 Lyn+/+Lyn-/-0.000.050.101.001.251.500.00.10.20.30.4Lyn+/+Lyn-/-H. hep.Lyn+/+ Lyn-/- Lyn+/+Lyn-/-} co-housed*** ***#  97  To further determine the role of the microbiota in Lyn-mediated protection from DSS, Lyn-/- mice were rederived into a higher barrier SPF facility by surgical implantation of embryos into CD1 mice (which provided the initial source of microbiota). Following rederivation, no SFB DNA could be detected in feces of either wt or Lyn-/- mice (data not shown). Consistent with the co-housing data, rederived Lyn-/- mice did not exhibit increased susceptibility to DSS. In fact, Lyn-/- mice exhibited slightly less weight loss than wt mice and no major differences were observed in rectal bleeding or colon length following DSS treatment (Figure 4.5F-H). The contribution of the microbiota to DSS susceptibility was further confirmed in radiation chimeric mice in which congenic (CD45.2-CD45.1+) BoyJ mice were reconstituted with either wt or Lyn-/- bone marrow (CD45.2+CD45.1-). The use of BoyJ hosts allowed for the normalization of the microbiota between recipients of wt or Lyn-/- BM. Chimerism was confirmed in the spleen and colonic lamina propria by flow cytometry and at least 95% of total CD45+ cells were of donor origin (CD45.2+CD45.1-) (data not shown). No differences were observed in the microbial communities assayed between the groups of chimeric mice, which were all negative for SFB and H. hepaticus (Figure 4.6A). Chimeric wt and Lyn-/- mice were treated with DSS for 7 days and were either euthanized following DSS treatment or were left to recover for an additional 7 days. Consistent with results of the rederived Lyn-/- mice, Lyn-/- chimeric mice did not show increased susceptibility to DSS compared to wt, based on weight loss, rectal bleeding, colon length and survival (Figure 4.6B-E). Interestingly, Lyn-/- chimeric mice trended towards a slight advantage during the recovery period in terms of weight loss and rectal bleeding (Figure 4.6B,C). This supports the role for an altered microbiota in driving increased susceptibility to DSS in Lyn-/- mice, although a potential contribution of Lyn expressing radio-resistant cells cannot be   98 excluded. Taken together, the results from these three sets of experiments suggest that Lyn-deficiency alters an intimate cross-talk between the microbiota and immune system, which regulates intestinal microbial composition and the nature of the inflammatory response to intestinal damage.  Finally, we sought to identify a potential mechanism through which Lyn might regulate the microbiota. Using Lyn gain-of-function mice, we recently showed that Lyn regulates systemic and intestinal production of IL-22 in response to microbial products such as LPS223.  Since IL-22 can regulate the intestinal microbiota including SFB148, 162, 308, 309, we questioned whether Lyn-deficiency would have a negative impact on IL-22 production. In  Figure 4.6 Lyn deficient BM radiation chimeric mice do not exhibit increased susceptibility to DSS. Wt (Lyn+/+) or Lyn-/- bone marrow (CD45.2+) was transplanted into lethally irradiated BoyJ mice (CD45.1+). Four months later mice were treated with DSS for 7 days followed by sterile drinking water for an additional 7 days. (A) Prior to DSS treatment, bacterial DNA was isolated from fecal pellets from naïve wt (Lyn+/+) and Lyn-/- mice and the relative abundance of segmented filamentous bacteria (SFB), Clostridium coccoides (Clost.), Lactobacillus/Lactococcus (Lacto.), and Helicobacter hepaticus (H. hep.) DNA was quantified by qPCR. Target bacterial DNA was normalized to total eubacterial DNA. Representative data is shown, n=4-5. (B) Body weight and (C) rectal bleeding were monitored over 14 days. (D) At the experimental endpoint (≥20% weight loss) mice were sacrificed. (E) Some mice were sacrificed on day 7 and colon length was measured. (B-E) Representative data from an independent 14 day and two independent 7 day experiments are shown, n=5-6. Error bars represent SEM.   0 2 4 6 8 10 12 14758595105Lyn+/+Lyn-/-Time (days) % Starting Weight Weight Change BTime (days) 0 2 4 6 8 10 12 140102030405060708090100Survival (%) Morbidity D Time (days) Score Rectal Bleeding C 0 2 4 6 8 10 12 140123Length (cm) 7 days DSS Colon Length 3456789E ARel. AbundanceMicrobiotaSFB Clostr. Lacto.  H. hep.Lyn+/+Lyn-/-0.00.51.0NDND NDND  99 response to IL-23, Lyn-/- splenocytes produced significantly less IL-22 than wt splenocytes (Figure 4.7A). In response to systemic administration of LPS, we observed decreased IL-22 production by Lyn-/- ileal explant cultures however no differences were observed in blood or colon explant cultures (Figure 4.7B). Diminished IL-22 production was not due to a lack of intestinal or splenic ILCs, which are major producers of IL-22 (Figure 4.7C-E).   IgA is another immune effector molecule known to impact the microbiota including SFB and a previous study identified altered IgA production in serum of Lyn-/- mice298.  Figure 4.7 Lyn-/- mice have altered IL-22 and IgA responses. (A) Total splenocytes from naïve Lyn+/+ and Lyn-/- mice were left untreated or were stimulated with IL-23, and IL-22 production was quantified by ELISA. Pooled data from 4 independent experiments is shown, n=4 untreated, n=8 +IL-23. (B) Lyn+/+ and Lyn-/- mice were treated with LPS and IL-22 in ileum, colon and blood was assessed. Data from 3 representative experiments is shown for blood and colon and an independent experiment for ileum n=6-8. (C) Splenic, (D) colonic and (E) mesenteric LN ILCs (lineage-CD90+) from naïve Lyn+/+ and Lyn-/- mice were analyzed by flow cytometry. Graphs and plots represent data pooled from 3 independent experiments, n=9. Numbers on plots represent mean frequency ± SEM. (F) Blood and fecal IgA concentrations in naïve Lyn+/+ and Lyn-/- mice from the original (Orig.) and rederived (Red.) colonies were assessed by ELISA, n=6-8. * = p < 0.05, ** = p < 0.01, *** = p < 0.001.   01020300510150100200300400500A Spleen IL-22 B Lyn+/+Lyn-/-**IL-22 (pg/ml)ND NDUntrt. IL-23051015Blood IL-22 IL-22 (ng/ml)02004006008001000Colon IL-22 IL-22 (pg/ml)0100020003000*Ileum IL-22 IL-22 (pg/ml)0100200300400500Total ILC (x 103)Spleen Lyn+/+ Lyn-/- *Total ILC (x 103)ColonLyn+/+ Lyn-/- Total ILC (x 103)mLN Lyn+/+ Lyn-/-0204060800500100015002000IgA (+g/ml)IgA (ng/ml)Blood IgA Fecal IgALineage CD90 *******0.05 ******C D E F0.23 ± 0.01 0.14 ± 0.00 3.03 ± 0.45 2.30 ± 0.61 0.16 ± 0.02 Lineage CD90 Lineage CD90 Orig. Red. Orig. Red.0.27 ± 0.02   100 Consistent with these studies, we observed increased IgA concentrations in the blood and feces of Lyn-/- mice (Figure 4.7F). Lyn-/- mice from both original (SFB+) and rederived (SFB-) colonies had significantly increased IgA in their blood. Fecal IgA concentrations were only significantly increased in the rederived (SFB-) Lyn-/- mice compared to their wt counterparts, however IgA concentrations were significantly higher in both original (SFB+) colonies compared to their rederived controls. Together these data suggest the possibility that Lyn may regulate the microbiota via diverse mechanisms including IL-22 and IgA production. 4.2.5 Increased T cell production of IFNγ  and IL-17 in Lyn-/- mice and the impact of the microbiota on colonic T cell accumulation Increased susceptibility of Lyn-/- mice to DSS colitis correlated with the presence of SFB as well as a moderate increase in colonic IFNγ and IL-17 production that was dependent on the adaptive immune system. We therefore questioned if these cytokines were T cell derived and whether the presence of SFB was driving the exaggerated cytokine production in Lyn-/- mice. Wt and Lyn-/- mice from the original (SFB+) and rederived (SFB-) colonies were left untreated or were treated with DSS for 7 days and IFNγ and IL-17 production by splenic and colonic lamina propria T cells were assessed by flow cytometry. Untreated Lyn-/- mice from the original (SFB+) but not the rederived (SFB-) colony had a 3-4 fold increase in colonic CD4+ and CD8+ T cells compared to their wt counterparts (Figure 4.8B), however, the same mice trended towards a decrease in splenic T cell populations (Figure 4.9). Furthermore, naïve Lyn-/- mice from both the original (SFB+) and rederived (SFB-) colonies had increased frequencies and numbers of colonic IFNγ+ and IL-17+ CD4+ T cells compared to their wt counterparts. However, only Lyn-/- mice from the original (SFB+) but not the rederived (SFB-) colony also had increased frequencies and numbers of IFNγ+ CD8+ T cells   101 and IFNγ+IL-17+ CD4+ T cells compared to wt mice. Correlating with susceptibility to DSS, SFB-containing Lyn-/-, and not the rederived (SFB-) mice, maintained their increased numbers of IFNγ and IL-17 producing colonic T cells following DSS (Figure 4.8A,B). In the spleen only the rederived (SFB-) Lyn-/- mice had an increase in IL-17+ CD4+ T cell numbers and this difference was observed in both naïve and DSS-treated mice. Furthermore, naïve Lyn-/- mice from both colonies had increased numbers of IFNγ+ T cells; however following DSS treatment this difference was lost in the original colonies (Figure 4.9). Of note, the increases in the number of cytokine producing colonic T cells in DSS compared to naïve mice is reflective of changes in the total numbers of T cells more than an increase proportion of cytokine-producing T cells. This suggests that the polarization of the inflammatory T cell response occurs at steady state and that the magnitude of inflammatory T cell responses as opposed to altered polarization are being regulated during DSS induced inflammation. Therefore, steady state regulation of the intestinal T cell populations, influenced by the commensal microbiota, may predispose Lyn-/- mice to susceptibility to inflammatory diseases that are driven by production of IL-17 and/or IFNγ.    102   Figure 4.8 Accumulation of IL-17 and/or IFNγ  producing colonic T cells correlates with DSS susceptibility and the presence of a distinct microbiota in Lyn-/- mice. Wt (Lyn+/+) and Lyn-/- mice from the original (Orig.) or rederived colonies (Red.) were left untreated or were treated with 2.5% DSS for 7 days. Colonic lamina propria cells were isolated and stimulated ex vivo with PMA, ionomycin and brefeldin A for 4 hours and IL-17A and IFNγ production in CD4+ and CD8+ T cells (CD3+) were assessed by intracellular flow cytometry. Cells were first gated on live CD45+ populations. (A) Representative plots are shown and numbers represent mean frequency. (B). Graphs represent total cell numbers per colon. Representative data from two independent experiments are shown, n = 3-4 per experiment. Error bars represent SEM, * = p < 0.05, ** = p < 0.01, *** = p < 0.001.   0510152025300123457.5910.5 *****0.07 CD4+ T Cells 0 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041050 102 103 104 10501021031041056.7 0.5 4.8 28.4 3.3 11.5 14.8 0.4 4.4 15.2 0.7 7.5 5.8 0.1 0.2 37.2 0.3 0.3 6.1 0.1 0.7 7.3 0.1 0.3 7.7 0.6 3.3 20.4 1.9 9.0 8.1 0.4 3.3 14.8 0.8 8.0 8.4 0.3 0.1 26.6 0.4 0.2 6.9 0.6 0.5 3.7 0.4 0.2 Untrt.DSS IFNaIL-17Lyn+/+ Lyn-/- Lyn+/+ Lyn-/- Lyn+/+ Lyn-/- Lyn+/+ Lyn-/-Original  Rederived  Original  Rederived  A 0.07**Untreated DSS DSS IL-17+ T Cells IL-17+IFNa+ T Cells#/colon (x 103) #/colon (x 103)0100200300400500* *0255075100125150***01002003004005000255075100125150 * *Untreated DSS Untreated DSS Total T Cells IFNa+ T Cells#/colon (x 103)#/colon (x 103) Orig. Red. Orig. Red. CD4+ CD8+Lyn+/+Lyn-/-B * * ********0.06* ** ****0.06Untreated 0123457.5910.5051015202530CD8+ T CellsOrig. Red. Orig. Red. CD4+ CD8+Orig. Red. Orig. Red. CD4+ CD8+Orig. Red. Orig. Red. CD4+ CD8+Orig. Red. Orig. Red. CD4+ CD8+Orig. Red. Orig. Red. CD4+ CD8+Orig. Red. Orig. Red. CD4+ CD8+Orig. Red. Orig. Red. CD4+ CD8+  103  Interestingly, total T cells as well as IFNγ and IL-17 producing T cell numbers were increased in the original (SFB+) compared to the rederived (SFB-) Lyn-/- mice, both at the steady state and following DSS treatment. We therefore sought to confirm whether this was a direct result of changes in the microbiota. Lyn-/- mice from the rederived (SFB-) colony were housed in cages supplemented twice weekly with dirty bedding from either rederived (SFB-) or original (SFB+) Lyn-/- mice for four weeks prior to DSS treatment. All the mice housed in  Figure 4.9 Altered production of IFNg and IL-17 by splenic T cells in Lyn-/- mice varies in response to DSS and changes in the microbiota. Wt (Lyn+/+) and Lyn-/- mice from the original (Orig.) or rederived colonies (Red.) were left untreated or were treated with 2.5% DSS for 7 days. Splenocytes were isolated and stimulated ex vivo with PMA, ionomycin and brefeldin A for 4 hours and IL-17A and IFNγ production in CD4+ and CD8+ T cells (CD3+) were assessed by intracellular flow cytometry. Cells were first gated on live CD45+ populations. Graphs represent total cell numbers per spleen. Data from an independent experiment for untreated mice and one of two independent experiments for DSS treated mice are shown, n = 3-4 per experiment. Error bars represent SEM, * = p < 0.05, ** = p < 0.01, *** = p < 0.001.   051015202530354045051015202530354045Untreated DSS Total T Cells #/spleen (x 106)Orig. Red. Orig. Red. CD4+ CD8+Orig. Red. Orig. Red. CD4+ CD8+Lyn+/+Lyn-/-* * ** 0246802468Untreated DSS IFNa+ T CellsOrig. Red. Orig. Red. CD4+ CD8+Orig. Red. Orig. Red. CD4+ CD8+* * 0.08 * * *** * 050100150200250050100150200250Untreated DSS IL-17+ T CellsOrig. Red. Orig. Red. CD4+ CD8+Orig. Red. Orig. Red. CD4+ CD8+* ** * ** #/spleen (x 106)#/spleen (x 103)  104 original Lyn-/- bedding, but none of the mice with the rederived bedding, became SFB+ (data not shown) and are referred to as SFB+ and SFB-, respectively. Following DSS treatment the production of IFNγ and IL-17 by T cells in the colonic lamina propria was assessed by flow cytometry. The introduction of microbes from the original Lyn-/- colony to the rederived Lyn-/- mice led to a significant increase in total and IFNγ+ CD4+ and CD8+ T cells as well as IL-17+ and IL-17+IFNγ+ CD4+ T cells (Figure 4.10D). This was also associated with a trend towards increased susceptibility to DSS based on rectal bleeding and colon length, although differences in weight loss were not observed (Figure 4.103A-C). Taken together, these data suggest that loss of Lyn is sufficient to induce increased IL-17 and IFNγ production by T cells irrespective of microbiota status; however in the presence of SFBs, both single- (IL-17+IFNγ-,  IL-17-IFNγ+) and double-positive (IL-17+IFNγ+) cytokine producing T cells were increased in the colons of Lyn-/- mice, correlating with DSS susceptibility.   105  4.2.6 Lyn deficient mice exhibit increased susceptibility to enteric pathogens and SFB expansion  Finally, we sought to investigate whether the dysbiosis in Lyn-/- mice resulted from an acute inability to control potentially pathogenic bacteria. Since the presence of increased SFB in Lyn-/- mice was associated with their susceptibility to DSS and sustained production of IFNγ and IL-17 by colonic T cells, we questioned whether Lyn-/- mice were impaired in their ability to control SFB. Wt and Lyn-/- mice from the rederived colonies (SFB-) were housed in cages supplemented twice weekly with dirty bedding from either their own colony (SFB-) or bedding from original Lyn-/- mice (SFB+). The presence of fecal SFB was assessed  Figure 4.10 The microbiota affects the susceptibility of Lyn-/- mice to DSS colitis. Lyn-/- mice from the rederived colony were housed in cages supplemented twice weekly with dirty bedding from either their own colony (SFB-) or bedding from original Lyn-/- mice (SFB+). After four weeks, mice were treated with 2.5% DSS for 7 days and (A) weight loss and (B) rectal bleeding were monitored daily. (C-D) On day 7, mice were euthanized and (C) colon length was measured and (D) colonic lamina propria cells were isolated and stimulated ex vivo with PMA, ionomycin and brefeldin A for 4 hours. IL-17 and IFNγ production in CD4+ and CD8+ T cells (CD3+) were then assessed by intracellular flow cytometry. Cells were first gated on live CD45+ populations. Graphs represent total cell numbers per colon. Data from an independent experiment is shown, n = 4. Error bars represent SEM, ** = p < 0.01, *** = p < 0.001.   0 1 2 3 4 5 6 70.00.51.01.52.02.50 1 2 3 4 5 6 78085909510010545678Weight Change Time (days)% Starting Weight SFB-  SFB+ SFB-SFB+Rectal Bleeding Time (days) Score Colon Length Length (cm) A B C 0.070100200300051015202501020300100200300400500600700#/colon (x103 )#/colon (x103 )#/colon (x103 )#/colonCD4+ CD8+ CD4+ CD8+ CD4+ CD8+ CD4+ CD8+****** ******SFB-SFB+Total T Cells IL-17+ T Cells IFNa+ T Cells IL-17+IFNa+ T CellsD *  106 weekly for three weeks. Indeed, throughout the course of the experiment, Lyn-/- mice trended towards increased fecal SFB abundance compared to wt mice suggesting an impaired ability to control intestinal SFB populations (Figure 4.11).  An inability to control colonization by intestinal microbes can leave the host susceptible to infection by enteric pathogens. We therefore questioned whether Lyn-deficient mice would exhibit a general susceptibility to enteric pathogens C. rodentium and S. Typhimurium. C. rodentium is a natural murine pathogen that attaches to colonic epithelium, effacing the barrier and causing inflammation. Infection persists for approximately one month in the colon, where the bacterial load increases to the height of infection at weeks 1-2 post-infection and then decreases until bacteria are eliminated by week four310. Bacteria can move to systemic sites but do not typically cause overt disease leading to morbidity. Monitoring of progression of C. rodentium infection in Lyn-/- and wt mice revealed a significant increase in colonic pathology at 6, 12, 21 and 28 days post infection in Lyn-/- mice (Figure 4.12A). This coincided with a significantly higher bacterial load in the colons of Lyn- Figure 4.11 Expansion of SFB differs in Lyn-/- compared to wt mice. Wt (Lyn+/+) and Lyn-/- mice from the rederived colony were housed for three weeks in cages supplemented twice weekly with dirty bedding from either their own colony (SFB-) or bedding from original Lyn-/- mice (SFB+). Fresh feces was collected after 1, 2 and 3 weeks and relative abundance of SFB DNA was assessed by qPCR using total eubacteria as a reference. Representative data from two independent experiments is shown, n=5. Error bars represent SEM.   0.00.10.20.30.40.50.60.70.80.9Lyn+/+Lyn-/-Bedding Time SFB- SFB+ SFB- SFB+ SFB- SFB+1 wk 2 wks 3 wks Donor SFB Relative Abundance NDND NDND NDND0.08  107 /- mice on day 21 post-infection (Figure 4.12B) but no significant differences in systemic bacterial number were found in spleen or liver at any time point (Figure 4.12C,D). Histological examination revealed increased colonic pathology, including hyperplasia, immune cell infiltration, edema and epithelial damage at each time point during infection in Lyn-/- mice (Figure 4.12A,E).    108   Figure 4.12 Lyn deficiency increases susceptibility to enteric infection-induced inflammation.  6 12 21 2801234501234567896 12 21 28011D Bacterial Load Liver CFU (log10)Time (days) C Bacterial Load Spleen CFU (log10)Time (days) A Colon Pathology E B Bacterial Load Colon CFU (log10)Time (days) Edema Goblet Cell Depletion Epithelial Destruction Hyperplasia * * ** ** Lyn +/+ -/- +/+ -/- +/+ -/- +/+ -/- +/+ -/- Uninf.Day 6Day 12Day 21Day 286 12 21 2801234*6 12 21 2801234Lyn+/+Lyn-/-6 12 21 280123421 28** Lumen Epithelium Mucosa Submucosa 0123456789101101234567891011Bacterial Load CFU (log10)* ** Cecum Spleen 10 11 12 130 1 2 3 4 5 6 7 8 9 10 11 12 130102030405060708090100Lyn+/+Lyn-/-Lyn+/+Lyn-/- *** Morbidity Survival (%) Time (days) Cecum PathologyScore Lyn+/+ Lyn-/-10x 4x 4x ABic ABic + SalmonellaLyn+/+Lyn-/-0 1 2 3 4 5 6 70102030405060708090100Morbidity Survival (%) Time (days) 0123456789* 5060708090100Bacterial Load CFU (log10)*** Colon Spleen LiverHF GI J K0515102012345789106ScoreLyn+/+Lyn-/-Day 6 Day 12 Day 21 Day 28 Scale bar = 200+m200+m500+m 500+m  109  S. Typhimurium is a human-adapted pathogen that causes gastroenteritis in mice pre-treated with a high dose of oral streptomycin, which perturbs the endogenous microbiota allowing efficient bacterial colonization of the colon. Susceptibility to disease can be monitored by bacterial enumeration and assessment of cecal pathology, as well as by assessing morbidity and systemic bacterial dissemination311. Lyn-/- mice were highly susceptible to S. Typhimurium, with all mice becoming moribund significantly earlier after infection (day 6) compared to wt mice (day 13) (Figure 4.12F). On day 4 post-infection, Lyn-/- mice had significantly higher bacterial loads in the cecum and spleen (G), correlating with significantly greater cecal pathology (Figure 4.12H). The ceca of Lyn-/- mice showed complete loss of crypt architecture, severe edema and more extensive luminal inflammatory infiltrates compared to wt mice (Figure 4.12I). Lyn-/- mice were also highly susceptible to systemic infection with S. Typhimurium. In this ‘typhoid-like’ model of disease, mice are not pre-treated with antibiotic, therefore rather than colonizing the gut, bacteria rapidly translocate through the intestinal epithelium, disseminating systemically and replicating to high numbers, leading to organ failure and morbidity311. Similar to our results in streptomycin treated mice, all Lyn-/- animals became moribund significantly earlier than wt Figure 4.12 Lyn deficiency increases susceptibility to enteric infection-induced inflammation. Wt (Lyn+/+) and Lyn-/- mice were infected C. rodentium and sacrificed at indicated days post-infection. (A) Histopathology was scored from H&E stained sections of distal colon. The remainder of the (B) colon, and the (C) spleen and (D) liver were homogenized and bacterial CFU per organ were determined. (E) Representative H&E sections from each time point are shown. Pooled data from two independent experiments is shown for A-D, n=6 (infected), n=3 (naïve). Representative sections from two independent experiments are shown for E, n=6. (F-I) Wt (Lyn+/+) and Lyn-/- mice were treated with streptomycin 24 hours prior to infection with S. Typhimurium.  (F) Mice were monitored daily for signs of disease and sacrificed when moribund. (G) Four days post-infection, mice were sacrificed and the cecum and spleen were homogenized for enumeration of bacterial CFU. (H-I) Ceca were stained with H&E and slides were scored to quantify levels of inflammation. Representative data from two independent experiments are shown for F-I, n=6-8. (J-K) Mice were infected with S. Typhimurium and were (J) monitored daily for signs of disease and sacrificed when moribund. (K) Four days post-infection, mice were sacrificed and the colon, spleen and liver were homogenized for enumeration of bacterial CFU. (J) Pooled and (K) representative data from two independent experiments are shown, n=6 and n=3, respectively. Error bars represent SEM, * = p < 0.05, ** = p < 0.01, *** = p < 0.001.    110 mice (day 5 versus day 7) following S. Typhimurium infection (Figure 4.12J), and this was associated with significantly higher bacterial loads in the colon, and a trend towards increased loads in the liver and spleen (Figure 4.12K). 4.3 Discussion The Lyn tyrosine kinase is a critical regulator of signal transduction pathways regulating the development and function of a number of different leukocyte populations involved in intestinal immune and inflammatory responses. Until recently, the only evidence implicating a role for Lyn in intestinal disease had been clinical studies showing colitis as a side-effect in cancer patients treated with the broad-spectrum tyrosine kinase inhibitor Dasatinib286, 287, 312, However, the work outlined in chapter 3 demonstrated that Lyn gain-of-function mutant mice were protected from DSS colitis, which was independent of the adaptive immune system and involved hypersensitivity to TLR ligands223. Understanding the biological role of Lyn is complicated by the opposing roles of Lyn in both activating and inhibitory cell-signalling pathways and by potential redundancy with other members of the SFK family. Our studies of Lyn gain-of-function mice allowed us to dissect the consequence of increased Lyn activity as well as the functions of Lyn that may be redundant with other SFKs.  In this study, we sought to understand how loss of Lyn leads to susceptibility to colitis, focusing on identifying non-redundant roles for Lyn using Lyn-/- mice. Our work clearly shows a protective role for Lyn, in limiting intestinal inflammation induced by intestinal epithelial damage as well as during enteric infection. Here, we investigated the requirement for Lyn in regulating inflammatory responses to infection by two enteric pathogens and investigated the mechanism of susceptibility to DSS in Lyn-/- mice. Importantly, the data presented here highlight how Lyn deficiency affects both innate and   111 adaptive immune responses, resulting in perturbations in the composition of the microbiota and the outcome of intestinal inflammation.  Intestinal homeostasis is mediated by a number of immune and environmental factors including the production of cytokines by innate and adaptive immune cells. Importantly, the microbiota has recently emerged as a critical factor in intestinal homeostasis and inflammation in both humans and mice16, 313, 314. Sequencing of 16s rRNA genes has identified differences in the microbiota of healthy controls compared to IBD patients, with a loss of diversity being a hallmark of disease315, 316, 317.  Inflammation in itself results in changes in bacterial composition318, which makes the interpretation of dysbiosis in IBD difficult to decipher. However, the effective use of antibiotics319, 320, 321, 322 and probiotics323 to control IBD along with the increased incidence of IBD observed in children previously treated with multiple courses of antibiotics324 suggest an important role for dysbiosis in IBD pathogenesis.   Lyn plays a critical role in immune homeostasis and PRR-induced responses, which are both involved in the maintenance of the microbiota. We therefore questioned whether the increased inflammation in Lyn-/- mice resulted indirectly from changes in the microbiota or directly through exaggerated inflammatory responses following barrier disruption. Co-housing experiments demonstrated that Lyn-/- mice foster a pro-inflammatory flora that was transferable to wt mice, resulting in their increased susceptibility to DSS colitis. Interestingly, the Lyn-/- phenotype was also partially rescued by co-housing with wt mice. Furthermore, rederivation of Lyn-/- mice completely rescued these mice from DSS susceptibility. Together this suggests that Lyn-/- mice may harbor a microbiota not only enriched for colitogenic microorganisms but may also lack tolerance-inducing species. Our   112 limited analysis of the microbiota identified an increased representation of SFB DNA in Lyn-/- feces. Interestingly, SFB abundance correlated with susceptibility to DSS of both wt and Lyn-/- mice following co-housing however further studies are needed to investigate the specific contribution of SFB to the exaggerated intestinal inflammation observed in Lyn-/- mice.  Changes in intestinal microbiota can have profound effects on the tone of T cell responses both locally at mucosal sites and systemically. For example, colonization by a defined group of Clostridium species promotes intestinal Treg development and function141, whereas the introduction of microbiota containing closely related SFB induce the differentiation of CD4+ T cells that express IL-17 and IFNγ151, 155. Furthermore, the presence of SFB is sufficient to drive increased pathology associated with increased Th17 responses in murine models of multiple sclerosis and arthritis155, 156. Alternatively, SFB have been associated with protection from diabetes in female mice325. Interestingly, we found increased IL-17 and IFNγ production by certain T cell populations in both rederived (SFB-) and original (SFB+) Lyn-/- mice; indicating a predisposition towards these T cell responses independent of the microbiome, possibly through increased BAFF or IL-6 production in Lyn-/- mice243, 299. However, disease severity was associated with an increase of these T cell populations as a result of altered microbiota characterized by the presences of SFB. Although early reports indicated a type-2 cytokine skewing in Lyn-/- mice241, the data presented here is consistent with more recent reports that also showed an increase in IFNγ production by CD4+ and CD8+ T cells in Lyn-/- mice 243.  IL-17 and IFNγ, as well as the cells that produce them play important roles in the etiology of IBD. For example, IL-17 and IFNγ producing Th17 cells are located in the lamina   113 propria and IL-17 levels are elevated in the colons and blood of patients with CrD or UC183, 326, 327. IFNγ is also elevated in CrD patients328. In addition, polymorphisms resulting in hyperactive IL-17 production are associated with IBD329. However, whether IL-17 promotes inflammation in murine models of colitis remains controversial. In DSS colitis the use of IL-17 neutralizing antibodies increases susceptibility to DSS, implicating a protective role for this cytokine in disease200. However, mounting evidence suggests that IL-17 indeed promotes inflammation in the colon. For example, IL-17A deficient mice have reduced epithelial damage and inflammation of the colon during DSS treatment330, and show a reduction in chronic inflammation and tumor development in a model of colitis-associated cancer331. Accordingly, when we investigated the role of adaptive immune responses in susceptibility to DSS in Lyn-/- mice, we found that unlike immunosufficient background mice, Rag-/-Lyn-/- mice were modestly protected from colitis. Furthermore, no differences were observed in IL-17 production or Rorc expression in Rag-/-Lyn-/- compared to Rag-/- mice, and IFNγ was even decreased in Rag-/-Lyn-/- mice correlating with decreased disease severity. Importantly, although Lyn is an important regulator of B cell development and function, B cells did not account for the adaptive immune component that was necessary to drive enhanced sensitivity to DSS colitis in Lyn-/- mice.  A number of recent studies have described the complex web of interactions between the microbiota and host immune system. However much of the work has focused on how commensal microorgansisms (including SFB) impact the immune system150, 152, 160 and less is understood about what immune mechanisms influence SFB colonization and maintenance. Nonetheless, an AHR/IL-22/antimicriobial peptide axis has emerged as a pathway that regulates the microbiota and SFB162, 332. We previously showed that increased Lyn activity   114 promotes IL-22 production. Here we found that Lyn deficiency resulted in a decreased capacity to produce IL-22 in the ileum of Lyn-/- mice. Given that the ileum is the primary site of SFB colonization, this suggests a possible mechanism to explain the dysbiosis and SFB expansion in Lyn-/- mice. Another possible mechanism through which Lyn may impact the microbiota is by affecting IgA production163. Interestingly this may be directly due to B cell intrinsic loss of Lyn, or may indirectly involve altered T cell populations as both Th17 and Treg cells have been implicated in intestinal T cell-dependent IgA production333, 334, 335.   In addition to alterations in DSS induced disease, changes in the microbiota in Lyn-/- mice, likely also dictate the outcome of infection with S. Typhimurium and C. rodentium. Access to the gut epithelium during enteric infection is limited by the microbiota, a phenomenon called colonization resistance. This is best exemplified in the S. Typhimurium gastroenteritis model of infection, where pre-treatment with streptomycin transiently reduces gut commensal number and diversity311, thereby opening a niche for S. Typhimurium to colonize the cecum and colon. Other studies have shown that low intestinal microbial complexity reduces colonization resistance during Salmonella infection336. Interestingly, we found that even in the typhoid model of Salmonella infection, bacterial burden in the colons of Lyn-/- mice after four days were significantly higher than those in wt mice, suggesting that Lyn deficiency may alter the microbiota in a way that reduces colonization resistance. Previous studies suggested that the presence of SFB correlated with protection from C. rodentium infection151. However, our data is consistent with a more recent study that showed that decreased IL-22 production, which is known to increase susceptibility to C. rodentium infection, results in the expansion of SFB162. Overall, these data suggest that Lyn deficiency   115 does indeed alter the composition of commensal communities in the gut that can impact enteric infections.  While the exploration of the mechanisms behind susceptibility to these pathogens was outside the scope of this work, there are a myriad of factors that determine the outcome of infection and may involve alterations in immune responses in Lyn-/- mice. For example, both T and B cell responses play roles in the clearance of S. Typhimurium337 and C. rodentium infections310. While the early (two days post-infection) pathology observed in Lyn-/- mice infected with S. Typhimurium suggests that Lyn-deficiency in innate cells contributes to colonization susceptibility and inflammation, the increased inflammation observed throughout the duration of C. rodentium infection in Lyn-/- mice could be mediated by both innate and adaptive mechanisms. Interestingly, while IL-17A/F-deficient mice are more susceptible to C. rodentium infection198, other studies have shown that colonic inflammation is associated with IL-17 and IFNγ production early after infection338. This response may be exaggerated in Lyn-/- mice leading to increased inflammation at day 6 post-infection.  In summary, we have identified Lyn as a critical regulator of the microbiota as well as intestinal inflammation in murine models of IBD and enteric infection. We speculate that increased abundance of SFB in Lyn-/- mice, together with a genetic predisposition to increased numbers of IFNγ and IL-17 producing T cells, contributes to exaggerated IFNγ and IL-17 production by colonic T cells and enhanced intestinal inflammation in Lyn-/- mice. Thus, as is the case in human IBD, complex interactions between host genotype and intestinal microbial composition is key to disease etiology. As drugs targeting Lyn are entering the clinic and are being actively pursued to treat neoplastic disease, this work   116 suggests that these agents be thoroughly investigated for untoward dysbiotic and gastrointestinal effects, as well as drug induced enteric pathogen susceptibility.     117 Chapter 5: Lyn is a negative regulator of patrolling monocyte development and survival in response to CSF-1   118 5.1 Introduction Monocytes are important members of the MPS that contribute to tissue homeostasis, inflammation and resolution of inflammatory responses. Although traditionally thought of as circulating intermediates between BM progenitors and tissue macrophages, monocytes are now known to be important immune effector cells that likely play a limited role in the maintenance of tissue macrophage populations5, 34. Monocytes are a heterogeneous population of cells but can identified as smaller and less granular than granulocytes, and as CD11b+ and CSF-1R+ (CD115). Monocytes are highly circulatory cells that make up approximately 10% of blood leukocytes and can also been found in BM and spleen23, 339, 340. Although there is substantial heterogeneity within monocyte populations, they can be divided into two major subsets in mice, termed Ly6C+ conventional monocytes (cMo) and Ly6C- patrolling monocytes (pMo). Aside from Ly6C expression, cMos can also be identified based on expression of CD62L and CCR2, where as pMos lack these markers and express CD11c and PD-L138, 39, 341, 342. Both subsets also express the adhesion molecule LFA-1 that allows them to adhere to ICAM-1 expressing endothelial cells, however pMos express higher levels than cMos38, 40, 257. Human equivalents to these murine monocyte subsets have also been identified and can be distinguished by differential expression of CD16 and CD14. Based on analysis of surface markers, gene expression, and functionality, human CD14hiCD16- and CD14loCD16+ monocytes, are thought to be the human counterparts to murine cMos and pMos, respectively35, 36.  All monocytes share a common developmental pathway and are derived from a recently identified BM progenitor cell termed the cMoP that lack expression of lineage markers, and are Flt3-CD117+CD115+Ly6C+7. Although there is currently considerable   119 debate regarding mononuclear phagocyte development and the existence of MDPs32, cMoPs develop from a progenitor with the capacity to differentiate into DCs and monocytes, which is thought to be the MDP5, 7, 23. MDPs differ from cMoPs by the expression of Flt3 and can be identified as lineage-Flt3+CD117+CD115+ 7, 23. The use of cell transfer, cell depletion and cell tracing experiments have identified cMos as a precursor to pMos, which are considered to be terminally differentiated cells that act primarily as blood resident macrophages23, 26. In contrast, cMos maintain the capacity to differentiate into pMos or intestinal macrophages at steady state and can extravasate into tissue during infection or inflammation where, depending on the environmental cues, they can differentiate into a variety of effector cells with inflammatory and antigen presentation capabilities34, 38, 46, 343, 344, 345, 346. Both monocyte subsets express a variety of PRRs and scavenger receptors that allow them to recognize invading microbes, dying and stressed cells, as well as particles such as low-density lipoprotein (LDL). Triggering of these receptors induces the production of various effector molecules including cytokines, chemokines and iNOS34. At the steady state pMos are thought to patrol the vasculature where they scavenge accumulating microparticles such as lipoproteins or protein aggregates, or necrotic debris, and survey and maintain endothelial integrity35, 40, 41, 42. In this way pMos are thought to help prevent the development of diseases such as atherosclerosis43, 347 and Alzheimer’s disease42. However, a pathogenic role for pMos has also been suggested in spinal cord injuries348, inflammatory arthritis44, and systemic lupus erythematosus349, 350.  The factors that regulate pMo development and homeostasis are largely unknown. The transcription factor Nur77 was recently identified as a master regulator of pMo, but not cMo, differentiation and survival43, and sphingosine-1-phosphate receptor signalling is   120 thought to be required for pMo egress from BM and spleen351, 352. Interestingly, the circulating lifespan of pMos is thought to be limited by CSF-1 availability and/or the presence of cMos that may act as a CSF-1 sink23, 353. Neutralization of CSF-1R for a prolonged period time leads to the loss of blood pMos, but not cMos, suggesting that signalling through this receptor regulates pMo survival or differentiation from cMos353. Furthermore, a recent study by Yona et. al calculated the steady state circulating half-life of pMos to be approximately 2.2 days. However depletion of CCR2+ cMos resulted in an extension of pMo circulating half-life to 11 days, which was partially reversed by neutralizing CSF-1R23. Although it is clear that pMos can dynamically adjust their circulating half-life, at least in part through CSF-1R signalling, the mechanisms that regulate this ability are still unclear. Lyn is expressed throughout the MPS including in progenitor cells as well as in functionally mature cells such as monocytes, where it acts as an important negative regulator of signalling downstream of cellular receptors involved in development, survival, proliferation, and adhesion4. Lyn deficiency results in an age-dependent expansion of myeloid cells that leads to the development of a myeloproliferative disease involving splenomegaly239, 240. This includes increased myeloid cells in blood, BM, and spleen, as well as an increase in myeloid progenitor cells in the spleens of aged Lyn-/- mice239, 240, 243. Lyn is thought to restrict myelopoiesis at least in part by acting as an inhibitor of CSF-1 and GM-CSF signalling in BM progenitor cells. Lyn-/- BM progenitor cells are hypersensitive to CSF-1 and GM-CSF resulting in increased production of BM-derived macrophages and DCs, respectively 4, 240. Lyn can also inhibit signalling downstream of these receptors in mature mononuclear phagocytes. In BM-derived macrophages, Lyn was found to inhibit Akt   121 activation downstream of CSF-1R signalling through SH2-domain mediated interactions with the inhibitory phosphatase SHIP-1255. Furthermore, Lyn can negatively regulate cytokine withdrawal induced survival in macrophages240. Lyn can also regulate mononuclear phagocyte function by inhibiting integrin signalling256. A recent study identified Lyn as a negative regulator of human monocyte adhesion to endothelial cells by regulating LFA-1 mediated adhesion257, which is required for monocyte attachment to endothelial cells and pMo patrolling of the vasculature in vivo. Alterations in monocyte homeostasis can have major implications in numerous inflammatory diseases as these cells are intimately involved throughout inflammatory processes including the initiation and propagation of inflammation, and resolution of inflammation and tissue repair following inflammatory damage. Monocytes have been found to be particularly important in the development and progression of atherosclerosis, which is now considered a chronic inflammatory disease that results from altered lipid metabolism and inappropriate immune responses354, 355. Activation of the endothelium at athero-prone sites within arteries leads to increased permeability and accumulation of lipoproteins in the intima of the arterial wall, as well as a recruitment of monocytes to these regions that develop into M1-type macrophages and foam cells that promote pathological inflammation354, 355. This process is amplified by the development of monocytosis in response to hypercholesterolemia, with a particular increase in cMos50, 356, 357. Although the role pMos in atherosclerosis is still poorly defined, they can take up oxidized lipoproteins358 and some studies using Nr4a-/- mice, which lack pMos have observed exacerbation of atherosclerosis in these mice43, 347 suggesting a possible protective role for these cells. Given the importance of monocytes in cardiovascular diseases including atherosclerosis,   122 understanding the factors that regulate their homeostasis can provide important information to support the development of novel preventative and therapeutic treatments for these diseases.  Although Lyn is known to be a critical regulator of mononuclear phagocyte development and function, its role in monocytes in vivo is still largely unclear. Furthermore, the function of Lyn in pMos has, to the best of our knowledge, never been examined. The data presented here identifies Lyn as a negative regulator of monocyte development and survival. Loss of Lyn results in an accumulation of pMos, which is independent of the age-related myeloproliferative disease as well as the adaptive immune system. Lyn’s ability to regulate pMo populations was cell intrinsic and did not result from the accumulation of BM progenitors, but did correlate with increased splenic cMoPs. Loss of Lyn resulted in increased BM-Mo survival even under limiting concentrations of CSF-1 and decreased turnover of pMo populations in vivo, suggesting an increased half-life.  Finally, Lyn activity promoted the development of atherosclerosis, which correlated with altered monocyte homeostasis. Overall, the data presented here suggests that Lyn acts downstream of CSF-1R to limit monocyte development and survival, which may impact the development of inflammatory diseases such as atherosclerosis. 5.2 Results 5.2.1 Lyn is a negative regulator of patrolling monocyte populations  Lyn has been previously established as a negative regulator of myelopoiesis and aged Lyn-/- mice have increased numbers of CD11b+F4/80+ cells in blood and spleen4, 240.  However Lyn’s role in monocyte homeostasis is still ill defined and has yet to be investigated specifically in the context of Ly6C+ cMos and Ly6C-/lo pMos. We therefore   123 questioned whether loss of Lyn would affect steady state monocyte populations in vivo. Given the age-dependent development of myeloproliferative disease in Lyn-/- mice4, 239, 240 we examined the monocyte compartments of young (8-10wk) and aged (26-30wk) wt and Lyn-/- mice. Blood, BM, and spleen were harvested from naïve mice and monocytes were assessed by flow cytometry. Monocytes were identified based on size (FSC) and granularity (SSC) and by expression of CD11b and CD115 (CSF-1R), and cMos and pMos were distinguished as Ly6C+CD62L+ and Ly6C-/loCD62L-, respectively. The distinction between cMos and pMos was further confirmed by CD11c expression by pMos but not cMos (Figure5.1A). 8-10 week and 26-30 week old Lyn-/- mice had a significantly increased frequency (~2-fold and 4-fold) and number (~1.5-fold and 3-fold) of blood monocytes compared to wt mice, which increased with age (Figure 5.1C,D). This phenotype was independent of overt myeloproliferative disease as it occurred prior to the development of splenomegaly in Lyn-/- mice (Figure 5.1B). Lyn-/- mice also exhibited an increased frequency of monocytes in BM and spleen and increased total number of monocytes in spleen that was significantly higher in aged Lyn-/- mice (Figure 5.1E,F, 5.2).    124   Figure 5.1 Lyn-/- mice have increased frequency and number of patrolling monocytes. 020406002040608005101520250204060020406080Spleen Weight050100150200250Weight (mg)8-10 wk 26-30 wk*******A BC Blood cMo02505007501000125015001750010203040Blood Monocytes% Total8-10 wk 26-30 wk********D Blood Monocytes*******Number/+l8-10 wk 26-30 wkE BM Monocytes% Total8-10 wk 26-30 wk02468***F Spleen Monocytes% Total8-10 wk 26-30 wk0.00.51.01.52.02.5*Blood pMo% of Monocytes8-10 wk 26-30 wk********Blood pMo020040060080010001200 ********Number/+l8-10 wk 26-30 wkBM pMo% of Monocytes8-10 wk 26-30 wk*** *Spleen pMo% of Monocytes8-10 wk 26-30 wk****020406080100*% of Monocytes8-10 wk 26-30 wk** ****Blood cMo0100200300400Number/+l8-10 wk 26-30 wkBM cMo% of Monocytes8-10 wk 26-30 wk** **Spleen cMo% of Monocytes8-10 wk 26-30 wk*** **FSCSSCCD11bCD115CD62LLy6CCD11c% MaxcMopMocMopMoMonocyteMonocyteLyn+/+Lyn-/-Lyn+/+Lyn-/-  125  Interestingly the composition of the monocyte compartment was skewed towards pMos in Lyn-/- mice in all tissues examined, with an increased frequency of pMos and decreased frequency of cMos within total monocytes (Figure 5.1C,E,F). Analysis of total numbers indicated that loss of Lyn did not result in decreased cMo populations, as no difference in cMo numbers were observed in Lyn-/- mice compared to wt with the exception of an increase in splenic cMos in aged Lyn-/- mice (Figure 5.1D, 5.2). Instead, Lyn-deficiency resulted in a significant expansion of pMos in blood, BM, and spleen that was observed in young and aged Lyn-/- mice. Together this data identifies Lyn as a negative regulator of pMo populations in vivo. Figure 5.1 Lyn-/- mice have increased frequency and number of patrolling monocytes. (A,C,D) Blood, (E) BM and (F) spleen were collected from young (8-10wk) and aged (26-30wk) naïve Lyn+/+ and Lyn-/- mice and monocyte populations were assessed by flow cytometry. (A) Representative plots from blood, detailing the gating scheme are shown. Monocytes are identified as CD11b+CD115+ and neutrophils are excluded based on size (FSC) and granularity (SSC). Conventional monocytes (cMo) are defined as Ly6C+CD62L+, and are confirmed to be CD11c-. Patrolling monocytes (pMo) are defined as Ly6C-/loCD62L-, and are confirmed to be CD11c+. Exclusion of neutrophils was confirmed by absence of expression of Ly6G (data not shown). (B) Spleens were weighed prior to processing for flow cytometry. (C, E, F) Frequency of total monocytes (left) as well as cMo (center) and pMo (right) within the total monocyte populations was quantified. (D) Number of total monocytes as well as cMo and pMo populations per µl of blood were quantified. Representative data from at least three independent experiments for each age group are shown, n=4-5/group. Error bars represent SEM, * = p < 0.05, ** = p < 0.01, *** = p < 0.001.   126   We next sought to further investigate monocyte differences in Lyn-/- mice by analyzing myeloid and monocyte progenitor cell populations.  We harvested BM from young (8-10 wk) and aged (26-30 wk) wt and Lyn-/- mice and quantified the numbers of MPs, MDPs, and cMoPs and found no significant differences between wt or Lyn-/- mice in either age group (Figure 5.3A-C). We also found no difference in CDPs, which are DC committed progenitors (Figure 5.3C). A previous study by Harder et. al, identified an increase in CSF-1 responsive progenitor cells in the spleens of Lyn-/- mice using in vitro colony forming assays240. Consistent with this, we observed a significant increase (~4-fold) in number of cMoPs in the spleens of Lyn-/- mice, which significantly increased with age (Figure 5.3D-E).  Figure 5.2 Lyn is a negative regulator of splenic and BM patrolling monocyte numbers and splenic conventional monocytes. (A) BM and (B) spleen were collected from young (8-10wk) and aged (26-30wk) naïve Lyn+/+ and Lyn-/- mice and monocyte populations were assessed by flow cytometry. Monocytes are identified as CD11b+CD115+ and neutrophils are excluded based on size (FSC) and granularity (SSC). Conventional monocytes (cMo) are defined as Ly6C+CD62L+, and are confirmed to be CD11c-. Patrolling monocytes (pMo) are defined as Ly6C-/loCD62L-, and are confirmed to be CD11c+. Exclusion of neutrophils was confirmed by absence of expression of Ly6G (data not shown). Numbers of total monocytes as well as cMo and pMo populations per (A) femur or (B) spleen were quantified. Representative data from at least three independent experiments for each age group are shown, n=4-5/group. Error bars represent SEM, * = p < 0.05, ** = p < 0.01, *** = p < 0.001.  *A BM Monocytes#/Femur (x 106)8-10 wk 26-30 wkBM pMo#/Femur (x 106)8-10 wk 26-30 wkBM cMo#/Femur (x 106)8-10 wk 26-30 wk0.00.51.01.52.02.53.00.00.51.01.52.02.50.00.10.20.30.40.50.6B Spleen Monocytes#/Spleen (x 106)8-10 wk 26-30 wkSpleen pMo#/Spleen (x 106)8-10 wk 26-30 wkSpleen cMo#/Spleen (x 106)8-10 wk 26-30 wk0123456 **0.00.51.01.5 **01234***Lyn+/+Lyn-/-  127 This suggests that an increase in extramedullary monopoiesis could contribute to the increase in pMo numbers observed in Lyn-/- mice.  5.2.2 Increased patrolling monocytes in Lyn-/- mice is independent of the adaptive immune system Lyn-/- mice have an altered B cell compartment that leads the production of autoantibodies, the accumulation of circulating immune complexes and the development of a lupus-like autoimmune disease that progresses with age242. We therefore questioned whether  Figure 5.3 Lyn-/- mice have increased numbers of splenic but not BM monocyte progenitor cells. (A-C) BM and (D-E) spleen were collected from young (8-10wk) and aged (26-30wk) naïve Lyn+/+ and Lyn-/- mice and progenitor cell populations were assessed by flow cytometry. (A,D,E) cMoPs were identified as lineage- (CD3, CD19, NK1.1, Ly6G) Flt3-CD115+CD117+CD11b-Ly6C+. (B,C) MDPs, CDPs, and MPs were identified as lineage- (CD3, CD19, NK1.1, Ly6G, CD11b, CD11c, MHC II, Ter119, CD127) Flt3+ and were distinguished as CD117+CD115+, CD117-CD115+, CD117+CD115-, respectively. (A,B,D) Representative plots are shown to demonstrate gating strategy. (C,E) Graphs represent total number of indicated progenitor cells per femur or spleen. (A-C) For MDPs, CDPs, and MPs data from a representative of at least three independent experiments is shown, n=4-5/group. For cMoPs, data from a representative of two independent experiments is shown, n=4-5/group. (D-E). Data from an independent experiment is shown, n=4-5/group. Error bars represent SEM, * = p < 0.05, ** = p < 0.01, *** = p < 0.001.  CD115CD117CD11bLy6CLin-Flt3-cMoPCD115CD117Lin-Flt3+MP MDPCDPAC050100150200250300350Lyn+/+Lyn-/-BM cMoP#/femur (x103 )0204060 BM MDP#/femur (x103 )8-10 wk 26-30 wk 8-10 wk 26-30 wkB051015 BM MP#/femur (x103 )8-10 wk 26-30 wk0204060 BM CDP#/femur (x103 )8-10 wk 26-30 wkCD115CD117CD11bLy6CLin-Flt3-CD115CD117CD11bLy6CLin-Flt3-Lyn+/+ Lyn-/-D E0204060Spleen cMoP8-10 wk 26-30 wk*******#/spleen (x103 )cMoP cMoP  128 the altered monocyte compartment in Lyn-/- mice resulted from the chronic inflammation occurring in these animals. To address this we analyzed the monocyte compartments of Rag-/- and Rag-/-Lyn-/- mice, which lack adaptive immune cells including B cells, and therefore do not develop autoimmune disease. Interestingly, Rag-/-Lyn-/- had similar alterations in their monocyte compartment as their immunocompetent counterparts. Rag-/-Lyn-/- mice had an increased frequency of total monocytes in blood and BM and an increased number of monocytes in blood and spleen, compared to Rag-/- mice. Furthermore, the monocytes were skewed towards pMos with an increase in frequency of pMos and a decreased frequency of cMos in blood, BM, and spleen of Rag-/-Lyn-/- mice compared to their Rag-/- controls (Figure 5.4C,E). Like in the immunocompentent mice, Lyn deficiency had no significant impact on the number of cMos in Rag-/- background mice but it did lead to an increase in pMo numbers in all tissues examined (Figure 5.4D,F). Finally, this difference in pMos was not due to an increase in BM progenitor cells as no differences in numbers of MPs, MDPs, or cMoPs were observed in Rag-/-Lyn-/- mice compared to Rag-/- controls (Figure 5.5). Overall this data shows that Lyn is an important negative regulator of steady state pMo populations and that the expansion of this monocyte subset does not depend on the presence of adaptive immune cells or autoimmune disease.    129    Figure 5.4 Increased patrolling monocytes in Lyn-/- mice is independent of the adaptive immune system. Blood, BM and spleen were collected from naïve Rag-/- and Rag-/-Lyn-/- mice and monocyte populations were assessed by flow cytometry. Monocytes were identified as CD11b+CD115+ and neutrophils are excluded based on size (FSC) and granularity (SSC) and lack of Ly6G. Conventional monocytes (cMo) were defined as Ly6C+CD62L+, and were confirmed to be CD11c-. Patrolling monocytes (pMo) were defined as Ly6C-/loCD62L-, and were confirmed to be CD11c+. Frequency of (A) total monocytes or (C) cMo and (E) pMo within total monocyte populations are shown. Total numbers of (B) monocytes, (D) cMo, or (F) pMo per organ or µl of blood are shown. Representative data from three independent experiments are shown, n=6/group. Error bars represent SEM, * = p < 0.05, ** = p < 0.01, *** = p < 0.001.  0.00.51.01.52.0% TotalA BRag-/-Lyn-/-Rag-/-010203040010020030040002004006008001000% Total% TotalBlood Total Mo BM Total Mo Spleen Total Mo Blood Total Mo BM Total Mo Spleen Total MoNumber/+lNumber/femur (106)0.00.51.01.5025050075010001250Number/spleen (103)01234567020406080020406002040608002040600204060801000510150100200300400500020040060001002003004005000.00.51.01.5050100150200Blood cMo BM cMo Spleen cMo Blood cMo BM cMo Spleen cMo% of Monocytes% of Monocytes% of MonocytesNumber/+lNumber/femur (106)Number/spleen (103)Blood pMo BM pMo Spleen pMo Blood pMo BM pMo Spleen pMo% of Monocytes% of Monocytes% of MonocytesNumber/+lNumber/femur (103)Number/spleen (103)*********************** **C DE F Figure 5.5 Lyn does not regulate BM monocyte progenitor cells in Rag-/- mice. BM was harvested from naïve Rag-/- and Rag-/-Lyn-/- mice and progenitor cell populations were assessed by flow cytometry. cMoPs were identified as lineage- (CD3, CD19, NK1.1, Ly6G, CD11b-, Ter119-)Flt3-CD115+CD117+Ly6C+. MDPs, CDPs, and MPs were identified as lineage- (CD3, CD19, NK1.1, Ly6G, CD11b, CD11c, MHC II, Ter119, CD127) Flt3+ and were distinguished as CD117+CD115+, CD117-CD115+, CD117+CD115-, respectively. Graphs represent total number of indicated progenitor cell population per femur. (A-C) Data from a representative experiment is shown, n=6/group. Error bars represent SEM.   0204060801000510152025BM cMoP BM MDP#/femur (x103 )#/femur (x103 )ARag-/-Rag-/-Lyn-/-0204060BM CDP#/femur (x103 )0510152025BM MP#/femur (x103 )  130 5.2.3 Increased Lyn kinase activity does not impair patrolling monocyte populations but supports a modest increase in conventional monocytes   The role of Lyn in monocytes may be multifactorial as Lyn can act as an important signalling molecule through its kinase activity and also as an adaptor molecule. Furthermore, SFKs often have functional redundancies therefore the use of Lyn-deficient mice allows for the investigation of non-redundant roles for Lyn while the use of a gain-of-function (Lynup) mutant mouse, can identify functions shared with other SFKs. We therefore questioned how increasing Lyn activity would affect monocytes in vivo. Blood, BM, and spleen were harvested from wt, Lyn-/-, and Lynup mice and monocytes were analyzed by flow cytometry as above. In blood, BM and spleen Lyn-/- mice had an increased frequency of monocytes, as previously observed, as did Lynup mice in spleen and BM but not in blood, compared to wt mice. However, the blood and BM of Lynup mice had significantly increased frequency of cMos and decreased frequency pMos within the total monocyte populations, while Lyn-/- mice had the reverse phenotype (Figure 5.6A). Although Lynup mice had increased proportions of cMos as indicated by an increased ratio of cMo/pMo in blood and BM (Figure 5.6B), this resulted from a modest decrease in pMo numbers in blood and a modest but significant increase in cMo in BM (Figure 5.6D). Lynup mice also had a trend towards increased splenic cMos (Figure 5.6C). Therefore although loss of Lyn resulted in increased pMo numbers in blood, BM, and spleen, increased Lyn kinase activity had only a modest effect on blood pMo and had no significant impact on splenic and BM reservoirs (Figure 5.6D). Instead, increased Lyn activity results in a modest increase in cMos in spleen and BM (Figure 5.6). Together this suggests that Lyn may act to limit pMos by a mechanism other   131 than its kinase activity, or that kinase mediated suppression of pMos is already maximal at steady state in wt mice.    Figure 5.6 Lyn gain-of-function mice have increased proportions of conventional monocytes.  0123Blood MonocytesRatio cMo/pMo ****ABCLyn+/+Lyn-/-LynupBlood BM SpleenCD11bCD115CD62LLy6C8.7 ± 0.821.3 ± 3.6**6.2 ± 1.146.5 ± 1.331.4 ± 0.5***60.7 ± 5.5*42.2 ± 1.430.0 ± 3.5**57.9 ± 0.9***CD11bCD115CD62LLy6C3.7 ± 0.15.3 ± 0.5**4.9 ± 0.5*77.6 ± 1.268.5 ± 3.6*86.3 ± 1.6**14.5 ± 1.024.3 ± 3.3*9.2 ± 1.1*CD11bCD115CD62LLy6C1.0 ± 0.11.8 ± 0.3*1.7 ± 0.2**36.4 ± 2.223.4 ± 1.6*41.7 ± 3.749.7 ± 1.961.4 ± 1.2**48.6 ± 4.0Lyn+/+ Lyn-/- Lynup/up0510150.00.51.01.5Ratio cMo/pMoRatio cMo/pMoBM Monocytes Spleen Monocytes0100200300400500020040060080010000500100015002000250002004006008000500100015000100020003000# cMo/+l# pMo/+lBlood cMoBlood pMoBM cMoBM pMoSpleen cMoSpleen pMo# cMo/femur (x103 )# pMo/femur (x103 )# cMo/spleen (x103 )# pMo/spleen (x103 )D****** ****  132  5.2.4 Lyn mediated regulation of patrolling monocytes is cell autonomous   We next sought to determine whether Lyn was regulating monocytes in a cell autonomous fashion, or whether altered Lyn activity or expression in other cells resulted in an environment that impacted monocyte homeostasis. To investigate this we first questioned whether Lyn was expressed in monocytes and their progenitor cells in vivo, reasoning that patterns of Lyn expression within given populations might provide clues as to the cells within which Lyn played a key physiological role. Blood and BM were harvested from naïve wt and Lyn-/- mice and expression of Lyn in pMos and cMos was assayed by intracellular flow cytometry, using Lyn-/- cells as a negative staining control. Lyn was expressed by pMos and cMos in blood and BM (Figure 5.7A). Furthermore, Lyn was also expressed by all monocyte progenitor cells analyzed, which included MPs, MDPs, and cMoPs, and by CDPs, which are a DC restricted progenitor (Figure 5.7B).  The expression of Lyn throughout the monocyte lineage suggested that Lyn could possibly regulate monocyte homeostasis in a cell-intrinsic manner at multiple steps throughout monocyte development. Figure 5.6 Lyn gain-of-function mice have increased proportions of conventional monocytes. Blood, BM and spleen were collected from naïve Lyn+/+, Lyn-/-, and Lynup/up mice and monocyte populations were assessed by flow cytometry. (A) Representative plots are shown and numbers indicate mean frequency plus or minus SEM of monocytes (CD11b+CD115+Ly6G- and gated based on FSC/SSC) within total live cells, or cMos (Ly6C+CD62L+) and pMos (Ly6C-/loCD62L-) within total monocytes. Asterisks indicate statistically significant difference between Lyn+/+ and Lyn-/- or Lynup/up for the indicated population. (B) Ratios of cMo/pMo are shown. Numbers of (C) cMos and (D) pMos per organ or µl of blood are shown. Representative data of two independent experiments are shown, n=3-5/group. Error bars represent SEM, * = p < 0.05, ** = p < 0.01, *** = p < 0.001.    133   Figure 5.7 Lyn is expressed in all monocyte lineage cells and regulates patrolling monocyte populations by a cell autonomous mechanism.   010020030040050060002004006000501001502000200400600010020030005010015001230246810120.00.51.01.52.02.5ACD11cLy6CBMMonocytesLynpMoLyncMoCD11cLy6CLynMonocytesLynpMo cMoBloodLyn+/+Lyn-/-Lin-Flt3- cMoPCD115CD117Lin-Flt3+CD115CD117CDP MDP MPBMBlood MonocytesRatio cMo/pMoBM MonocytesRatio cMo/pMoSpleen MonocytesRatio cMo/pMoBCLyn+/+Lyn-/-Lynup/up# cMo/+l# pMo/+lBlood cMoBlood pMo# cMo/femur (x103 )# pMo/femur (x103 )BM cMoBM pMo# cMo/spleen (x103 )# pMo/spleen (x103 )Spleen cMoSpleen pMoDELyn LynLynLyn****CD45.2+ CD45.2+ CD45.2+*******CD45.2+ CD45.2+ CD45.2+CD45.2+ CD45.2+ CD45.2+**** *  134   In order to assess the relative contribution of cell intrinsic and extrinsic regulation of monocyte populations by Lyn we performed a series of experiments utilizing BM transplantation into lethally irradiated mice. In the first set of experiments BoyJ mice, which express wt Lyn and the congenic marker CD45.1, were lethally irradiated and transplanted with a mix of 50% BoyJ (CD45.1) BM plus either 50% wt, Lyn-/-, or Lynup BM, which could be distinguished from the BoyJ cells by expression of CD45.2. Mice were then left to reconstitute for 8 weeks and monocyte populations were then analyzed in blood, BM, and spleen by flow cytometry as above. This resulted in chimeric mice that expressed wt Lyn in the non-hematopoietic cells but had a mix of wt or mutant Lyn expressing immune cells. In this setting any differences observed in CD45.2+ monocytes (Lyn mutant) but not CD45.1+ (Lyn+/+) could be attributed to a cell intrinsic role for Lyn whereas changes in CD45.1+ monocytes between the groups would be predicted to be as a result of cell extrinsic factors derived from altered Lyn activity in CD45.2+ hematopoietic cells. As a control to assess successful irradiation and reconstitution with donor BM, one group of mice received 100% CD45.2+ BM and monocytes were found to be >95% CD45.2+, confirming the successful ablation of host (CD45.1+) monocytes and their progenitors (data not shown).  Figure 5.7 Lyn is expressed in all monocyte lineage cells and regulates patrolling monocyte populations by a cell autonomous mechanism.  (A-B) Blood and BM were harvested form naïve Lyn+/+ and Lyn-/- mice and Lyn expression in (A) cMo (Ly6C+CD11c-) and pMo (Ly6C-/loCD11c+), and in (B) cMoPs, MDPs, CDPs, and MPs was assessed by intracellular flow cytometry. (A-E) Monocytes were identified as CD11b+CD115+Ly6G- and were gated based on FSC/SSC. (B) cMoPs were identified as lineage- (CD3, CD19, NK1.1, Ly6G, CD11b-)Flt3-CD115+CD117+. MDPs, CDPs, and MPs were identified as lineage- (CD3, CD19, NK1.1, Ly6G, CD11b, CD11c, MHC II, Ter119, CD127) Flt3+ and were distinguished as CD117+CD115+, CD117-CD115+, CD117+CD115-, respectively. (C-E) Lethally irradiated BoyJ (Lyn+/+, CD45.1+) mice were transplanted with 50% BoyJ (Lyn+/+, CD45.1+) BM and 50% Lyn+/+, Lyn-/- or Lynup/up (CD45.2+) BM. 8 weeks later blood, BM, and spleen were harvested and CD45.2+ (Lyn+/+, Lyn-/- or Lynup/up) monocyte (CD11b+CD115+Ly6G- and gated based on FSC/SSC) populations were assessed by flow cytometry. (C) Ratio of cMo/pMo and total number of (D) cMo and (E) pMo per organ or µl of blood are shown. (A-B) Representative data of two independent experiments are shown. (C-E) Representative data of two independent experiments for Lyn+/+ and Lyn-/- and an independent experiment for Lynup/up are shown, n=4-5/group. Error bars represent SEM, * = p < 0.05, *** = p < 0.001.    135 Analysis of monocyte populations in the mixed BM chimeric mice suggested that Lyn-mediated regulation of monocytes is cell autonomous. First, the reconstituted CD45.2+ monocytes, exhibited a similar phenotype to monocytes in naïve wt, Lyn-/- and Lynup mice which included an increased proportion of pMos within the Lyn-/- monocyte compartment as indicated by the decreased ratio of cMo/pMo in blood, BM, and spleen, as well as an increased proportion of Lynup cMos (Figure 5.7C). Importantly, mice transplanted with Lyn-/- BM had a significant increase in CD45.2+ pMos numbers in BM and spleen and a trend towards increased CD45.2+ pMos in blood, compared to mice transplanted with wt BM. No significant difference in pMo numbers was observed in the Lynup transplanted mice, however, as in naïve Lynup mice, there was a trend towards decreased CD45.2+ pMos in blood (Figure 5.7E). No major differences in CD45.2+ cMo numbers were observed in mice transplanted with Lyn-/- BM, however, there were more splenic CD45.2+ cMos in the Lynup group (Figure 5.7D). These data suggest that altered Lyn signalling within non-hematopoietic cells is not required to regulate systemic monocyte populations.   In order to further investigate whether Lyn's role in regulating monocyte subset development was cell intrinsic, we examined the CD45.1+ monocytes in the same chimeric mice. CD45.1+ monocytes all express wt Lyn however the groups differ in that they share their environment with wt, Lyn-/-, or Lynup immune cells. Interestingly, the presence of Lynup hematopoietic cells had no impact on the proportion or total numbers of cMos or pMos in any tissues analyzed. However, contrary to what was found in CD45.2+ cells and in naïve Lyn-/- mice, the presence of Lyn-/- hematopoietic cells resulted in a significant increase in proportion and number of wt cMos in blood and BM, with no significant differences in pMo populations (Figure 5.8). Together these data suggest that Lyn acts as a cell autonomous   136 negative regulator of pMos, which may be dominant over a potential to inhibit cMo populations by regulating the hematopoietic environment.   Although the experiments described above suggested that Lyn deficiency in non-hematopoietic cells is not required to drive increased pMos, we wanted to determine whether Lyn in non-hematopoietic cells could regulate monocytes in vivo. To do this we generated BM chimeric mice by lethally irradiating wt, Lyn-/-, and Lynup mice and transplanted them with 100% BoyJ (Lyn+/+) BM. Again mice were left to reconstitute for 8 weeks prior to  Figure 5.8 Negative regulation of patrolling monocytes by Lyn is cell intrinsic. Lethally irradiated BoyJ (Lyn+/+, CD45.1+) mice were transplanted with 50% BoyJ (Lyn+/+, CD45.1+) BM and 50% Lyn+/+, Lyn-/- or Lynup/up (CD45.2+) BM. 8 weeks later blood, BM, and spleen were harvested and CD45.1+ (Lyn+/+) monocyte (CD11b+CD115+Ly6G- and gated based on FSC/SSC) populations were assessed by flow cytometry. (A) Ratio of cMo/pMo and total number of (B) cMo and (C) pMo per organ or µl of blood are shown. Representative data of two independent experiments for Lyn+/+ and Lyn-/- and an independent experiment for Lynup/up are shown, n=4-5/group. Error bars represent SEM, * = p < 0.05.  Blood MonocytesRatio cMo/pMoBM MonocytesRatio cMo/pMoSpleen MonocytesRatio cMo/pMoA# cMo/+l# pMo/+lBlood cMoBlood pMo# cMo/femur (x103 )# pMo/femur (x103 )BM cMoBM pMo# cMo/spleen (x103 )# pMo/spleen (x103 )Spleen cMoSpleen pMoBC*CD45.1+ CD45.1+ CD45.1+CD45.1+ CD45.1+ CD45.1+CD45.1+ CD45.1+ CD45.1+0.00.51.01.5024680.00.51.01.5050100150010020030040050001002003000501001502002500501001500100200300400500600***Lyn+/+ (Lyn+/+) Lyn+/+ (Lyn-/-) Lyn+/+ (Lynup/up)  137 analysis of monocyte compartments in blood, BM, and spleen (Figure 5.9A). In these experiments all groups had wt hematopoietic compartments but their non-hematopoietic cells had different Lyn genotypes. Loss of Lyn, or expression of a gain-of-function Lyn mutant in the non-hematopoietic compartment, had no effect on blood, BM, or spleen monocyte composition as indicated by similar ratios of cMo/pMo observed in the various groups (Figure 5.9B). Furthermore, numbers of total monocytes, pMos, and cMos in blood were also similar (Figure 5.9C). This data suggests that Lyn activity in non-hematopoietic cells has no major impact on circulating monocyte populations. Overall we conclude that although Lyn is expressed in various cell types that could influence monocyte homeostasis, Lyn primarily regulates monocyte populations through cell autonomous mechanisms.   138  5.2.5 Lyn is a negative regulator of CSF-1 induced monocyte development and survival in response to limited cytokine concentrations in vitro  Given the cell autonomous role for Lyn in regulating pMos in vivo, the dependence of pMo homeostasis on CSF-123, and previous studies defining Lyn as a negative regulator of CSF-1R signalling in BM-derived macrophages255, we hypothesized that Lyn may regulate pMo populations by modulating CSF-1R receptor signalling. To begin to address this we developed an in vitro culture system to generate BM-derived monocytes (BM-Mo). BM cells  Figure 5.9 Regulation of monocyte populations by Lyn is dependent on Lyn expression in hematopoietic cells. Lethally irradiated Lyn+/+, Lyn-/- or Lyn+/up (CD45.2+) mice were transplanted with BoyJ (Lyn+/+, CD45.1+) BM and 8 weeks later blood, BM, and spleen were harvested. CD45.1+ (Lyn+/+) monocyte (CD11b+CD115+Ly6G- and gated based on FSC/SSC) populations were assessed by flow cytometry. cMo were identified as Ly6C+CD62L+ and pMo were identified as Ly6C-/loCD62L-. (A) Representative plots of blood cells indicating gating strategy are shown. (B) Ratio of cMo/pMo for blood BM and spleen and (C) number of total monocytes, cMo and pMo per µl of blood are shown. Representative data of two independent experiments for Lyn+/+ and Lyn+/up and an independent experiment for Lyn-/- are shown, n=4-6/group. Error bars represent SEM.  0.00.20.40.60.81.0AFSCCD45.1Blood MonocytesRatio cMo/pMoBFSCSSCCD11bCD115CD62LLy6C0.00.20.40.60.8Spleen MonocytesRatio cMo/pMo02468BM MonocytesRatio cMo/pMo05001000150020002500Blood MonocytesNumber/+l02004006008001000Blood cMoNumber/+l025050075010001250Blood pMoNumber/+lLyn-/-Lyn+/+ Lyn+/upC  139 were grown in culture for 7-9 days under non-adherent conditions with media supplemented with LCM as a source of CSF-1. Analysis of these cultures by flow cytometry indicated that these cells were phenotypically similar to pMos in vivo. Greater than 90% of the cells co-expressed CD11b and CD115 (CSF-1R) and ~95% of these cells expressed CD11c and PD-L1 and lacked expression of Ly6C and CD62L. (Figure 5.10A). Consistent with previous reports that demonstrated increased cellular output of Lyn-/- BM-macrophages grown in CSF-1 under adherent conditions4, 240, Lyn-/- BM cultures produced increased BM-Mo numbers compared to wt BM (Figure 5.10B). Given the similar number of monocyte progenitor cells in Lyn-/- BM compared to wt (Figure 5.3B), the increased cellular output from Lyn-/- BM-Mo cultures suggests that Lyn-/- progenitor cells can generate more monocytes than wt cells, or that the Lyn-/- BM-Mo survive longer and therefore accumulate to a greater degree. Since Lyn and SFKs have been identified as negative regulators of CSF-1R induced activation of Akt255, 359, which can contribute to cell survival, we questioned whether Lyn-/- BM-Mos had increased survival under limiting CSF-1 conditions. To investigate this we harvested wt and Lyn-/- BM-Mos after 7 days of culture and reseeded equal numbers of cells into wells containing different concentrations of CSF-1. We then assayed cell survival by counting remaining viable cells in each well after 2 and 5 days of culture. Lyn-/- BM-Mos exhibited significantly increased survival compared to their wt counterparts at both time points when cultured with 10ng/ml and 2ng/ml of CSF-1 and had a slight increase in remaining live cells at 0.4ng/ml at day 2 (Figure 5.10C). This data supports the hypothesis that Lyn-deficiency enhances BM-Mo survival in limiting concentrations of CSF-1.     140  5.2.6 Lyn regulates pMo population dynamics and expression of CSF-1R in vivo  CSF-1 plays an important role in mediating monocyte homeostasis and is thought to regulate the circulating half-life of pMos in vivo23. Furthermore, Lyn has been identified as a negative regulator of CSF-1R signalling by promoting the activation of the inhibitory phosphatase SHIP-1255 and SFK binding to the CSF-1R promotes downregulation of the CSF-1R via ligand-binding induced receptor internalization and degradation359. We therefore hypothesized that Lyn-/- monocytes may sustain increased CSF-1R signalling which could result in their increased survival in vivo. To address this we first analyzed the expression of CSF-1R (CD115) on wt and Lyn-/- monocytes in blood, BM, and spleen by flow cytometry. Lyn-/- pMos and cMos expressed significantly higher levels of CSF-1R in blood, BM, and  Figure 5.10 Lyn negatively regulates monocyte development as well as survival in response to CSF-1 withdrawal in vitro. BM-derived monocytes were grown in vitro by culturing BM cells under non-adherent conditions with L cell conditioned media (LCM) as a source of CSF-1. (A) After one week in culture surface expression of CD11b, CD115, CD11c, PD-L1, Ly6C and CD62L was assessed. Representative plots are shown and numbers indicate frequency of gated populations. (B) Lyn+/+ and Lyn-/- BM-Mo were grown in vitro and total numbers per well were assessed after one week in culture. (C) After 7 days in culture with LCM, Lyn+/+ and Lyn-/- BM-Mo were harvested and 4x105 cells were seeded into media containing the indicated doses of CSF-1. Number of remaining live cells per well was then assessed after 2 and 5 days of culture. (A-C) Representative data from at least three independent experiments are shown, (B) n=BM from 4 mice/group, (C) n= BM from 3 mice/group. Error bars represent SEM, * = p < 0.05, ** = p < 0.01.  0.42100501001502002500.4210050100150200250Lyn+/+ Lyn-/-0100200300400BM-MoNumber/well (x103)BM-Mo (2 days) BM-Mo (5 days)A*CNumber/well (x103)Number/well (x103)CSF-1 (ng/ml) CSF-1 (ng/ml)******Lyn+/+Lyn-/-92.494.5CD11b+CD115+ CD11b+CD115+4.21.7CD11bCD115PD-L1CD11cCD62LLy6CB  141 spleen, compared to wt monocytes (Figure 5.11A,B). Although under normal conditions, increased CSF-1R expression is suggestive of decreased signalling, the increased expression of CSF-1R on Lyn-/- monocytes may indicate impaired receptor internalization and degradation, which could result in sustained cell surface receptor expression. This increase in CSF-1R expression may promote increased sensitivity to CSF-1 by Lyn-/- monocytes in vivo, however further studies are required to investigate this possibility.    Figure 5.11 Lyn negatively regulates CD115 (CSF-1R) cell surface expression and turnover of patrolling monocytes in vivo. (A-B) Blood, BM and spleen were collected from naïve Lyn+/+ and Lyn-/- mice and expression of CD115 on (A) cMo (Ly6C+CD62L+) and (B) pMo (Ly6C-/loCD62L-) monocyte populations was assessed by flow cytometry. Graphs represent mean fluorescent intensity (MFI) of CD115. (C-D) Lyn+/+ and Lyn-/- mice were given three injections of 2mg of BrdU three hours apart by i.p. injection. Presence of BrdU+ blood monocyte populations was assessed by flow cytometry at the indicated time points post BrdU treatments. (C) Representative plots are shown for cMo (Ly6C+CD11c-) and pMo (Ly6C-/loCD11c+) and numbers indicate frequence of BrdU+ cells. (D) Graphs represent frequency of BrdU+ cMo and pMo over time. (A-B) Representative data from three independent experiments are shown, n=6/group. (C-D) Representative data from two independent experiments are shown, n=5-6/group. Error bars represent SEM, * = p < 0.05, ** = p < 0.01, *** = p < 0.001.  0200040006000010002000300040005000CD115 MFI0100020003000400002000400060000100020003000400001000200030004000CD115 MFICD115 MFICD115 MFICD115 MFICD115 MFIA BBlood cMo BM cMo Spleen cMo Blood pMo BM pMo Spleen pMo*** * ** ********BrdULy6CBrdULy6C 1.5 80.9 11.71.5 6.7 12.1CUntrt. Day 2 Day 4 Untrt. Day 2 Day 4cMo pMoD0 2 4 6 8 100204060801000 2 4 6 8 10051015Lyn-/-Lyn+/+cMo pMoLyn+/+Lyn-/-% BrdU+ of cMo% BrdU+ of pMo****Days Days  142  We next performed a series of experiments using BrdU incorporation into monocytes in wt and Lyn-/- mice in order to gain insight into the kinetics of population turnover of pMos and cMos in vivo. In these experiments mice were given three doses of 2mg of BrdU by i.p. injection, each separated by three hours. The presence of circulating BrdU+ monocytes was then monitored over time by flow cytometric analysis of blood monocytes collected via the saphenous vein. In these experiments BrdU is thought to be incorporated into the DNA of dividing progenitor cells, which is then inherited by the newly developed cMos, which then differentiate into pMos resulting in BrdU+ pMo. Consistent with a previous study by Yona et al.23, the majority of cMo populations were BrdU+ by 2 days post treatment and as a result of their short circulating half-life (less than one day), very few BrdU+ cMos remained 4 days post treatment, and no BrdU+ cMos were detectable at day 6. By contrast, pMos remained mostly BrdU- consistent with their significantly longer circulating half-life compared to cMos. However the frequency of BrdU+ pMos slowly increased over time in wt mice peaking at day 4 post-injection (at ~12% BrdU+) (Figure 5.11C-D). Interestingly, although no differences in BrdU incorporation kinetics were observed in cMo populations between wt and Lyn-/- mice, circulating Lyn-/- pMos exhibited a significant reduction in BrdU incorporation compared to wt, suggesting a slower rate of turnover of this population of cells (Figure 5.11D). Since pMo population numbers remain fairly stable at steady state within the time frame of these experiments (8-10 days), the decreased proportion of newly incorporated pMos in Lyn-/- mice suggests that these monocytes may have a longer circulating half-life and would therefore not need to be replaced as often. In order to assess the survival of Lyn-/- versus wt monocytes in vivo, we analyzed the frequency of apoptotic and dead monocytes in blood and BM of naïve mice, using a viability dye and annexin V staining. We did not detect   143 any significant differences in cell viability between wt and Lyn-/- monocytes, other than a slight increase in viability dye positive cMos in the BM of Lyn-/- mice (Figure 5.12). However since apoptotic and dead cells are effectively cleared at steady state, assessing the late stages of apoptosis by annexin V staining and viability dye uptake may not be an appropriate method to study survival of monocyte populations in vivo. Although further studies are needed to investigate the circulating half-life of Lyn-/- pMos and how changes in survival could result in increased pMo numbers in Lyn-/- mice, we hypothesize that Lyn acts as a negative regulator of CSF-1R signalling potentially by promoting receptor internalization and degradation, thereby limiting pMo survival and controlling pMo numbers and ultimately the ratio of cMos and pMos.   144  5.2.7 Lyn promotes the development of atherosclerosis  Monocytes play a central role in the development and progression of atherosclerosis354, 355 and recent studies have suggested that pMos may play a role in antagonizing atherosclerosis43, 347. Given Lyn’s ability to regulate monocyte homeostasis, we questioned whether Lyn might play a role in atherosclerosis. To investigate this possibility we utilized a model of atherosclerosis in which Ldlr-/- mice are fed a high fat diet, which results in an accumulation of circulating LDL and VLDL and leads to the development of  Figure 5.12 Analysis of cell viability in Lyn+/+ and Lyn-/- mice. Blood and BM were harvested from naïve Lyn+/+ and Lyn-/- mice, and cell viability (annexin V [AV], viability dye) of cMo (Ly6C+CD11c-) and pMo (Ly6C-/loCD11c+) was assessed by flow cytometry. (A) Representative plots from blood are shown. Numbers represent frequency of gate populations. (B-C) Graphs represent frequency of live (AV-Viability-), apoptotic (AV+Viability-), and dead (Viability+) cMo and pMo in blood and BM. Representative data from two independent experiments are shown, n=3-4/group. Error bars represent SEM, * = p < 0.05, ** = p < 0.01, *** = p < 0.001.  Live cMoAB% of cMo3.0 5.016.280.7 82.6 12.22.088.8 9.02.390.0 7.6Annexin VViabilityAnnexin VViabilityLyn+/+ Lyn-/- Lyn+/+ Lyn-/-cMo pMo020406080100Blood BM051015202502468Blood BM Blood BMApoptotic cMo Dead cMo% of cMo% of cMo***C020406080100Live pMo% of pMoBlood BM******0102030400246810Blood BM Blood BM*********Apoptotic pMo Dead pMo% of cMo% of cMoLyn-/-Lyn+/+  145 atherosclerosis354, 360. In order to assess the contribution of Lyn in the innate immune system to the development of atherosclerosis, we generated chimeric mice using Ldlr-/- mice (CD45.2+) as hosts transplanted with a mixture of 10% BoyJ (Lyn+/+, CD45.1+) BM and either 90% Rag-/-, Rag-/-Lyn-/-, or Rag-/-Lynup BM (CD45.2+). Mice were then left to reconstitute for 6 weeks and were then fed a high fat diet for an additional 8.5 weeks (Figure 5.13A). The resulting chimeric mice lacked the LDLR expression in non-hematopoietic cells and possessed wt adaptive immune cells derived from wt BM donors (BoyJ). By contrast, the majority (~90%) of the innate immune cells were derived from Rag-/- BM and therefore expressed either wt or mutant Lyn and could be distinguished from BoyJ derived innate immune cells (~10% of innate immune cells) by differential CD45.1/CD45.2 expression. Chimerism was assessed by flow cytometry and innate immune cells including pMos, cMos, DC, and neutrophils were found to be approximately 90% CD45.2+ (Figure 5.13B). Furthermore, the B cells were ~95% CD45.1+, indicating successful chimerism, and T cells were approximally 70% CD45.1+, which is consistent with the radioresistent nature of some T cells. Since Rag-/- BM cannot produce T or B cells, the CD45.1- adaptive immune cells are radiorestant cells from the Ldlr-/- host (Figure 5.13B).   146   Figure 5.13 Lyn deficiency is associated with protection, and Lyn activation with susceptibility, to atherosclerosis in the Ldlr-/- high fat diet model of disease.  Aortic PlaquesArea (+m2 x103)*ELyn+/+0200400600800Lyn-/- Lynup/upD*Lyn+/+ Lyn-/- Lynup/upF650 rads x2 BM90% Rag-/- (Lyn+/+/Lyn-/-/Lynup/up) [CD45.2+]10% BoyJ (Lyn+/+) [CD45.1+]24h 6wk 8.5wkHigh FatDietLdlr-/- Ldlr-/-Assess aortic plaque &hematpoietic reconstitution(blood, BM, spleen)0 5 10 15 20 25 30 35 40 45 50 55 6090100110120Weight Change% Starting WeightLyn+/+Lyn-/-Lynup/upDays* ** *CA01234505101501234Blood MonocytesRatio cMo/pMoRatio cMo/pMoRatio cMo/pMoBM Monocytes Spleen Monocytes************Lyn+/+Lyn-/-Lynup/upCD45.2+ CD45.2+ CD45.2+Blood MonocytesRatio cMo/pMoRatio cMo/pMoRatio cMo/pMoBM Monocytes Spleen MonocytesCD45.1+ CD45.1+ CD45.1+G012302468100.00.51.01.5B% of cellsCD45.2+CD45.1+cMopMoDCNeutro.T cellB cell020406080100Chimerism  147   Mice were weighed twice weekly while being fed a high fat diet, and after an initial plateau in weight in the Rag-/- and Rag-/-Lyn-/- group and a modest loss of weight in the Rag-/-Lynup group, all mice steadily gained weight (Figure 5.13C). After 8.5 weeks of high fat diet mice were euthanized, aortic roots were harvested and atherosclerotic plaque area was quantified using Oil Red O staining.  Analysis of aortic plaque area revealed that Lyn in innate immune cells promoted atherosclerosis as mice with Lyn-/- and Lynup innate immune systems had significantly decreased or increased plaque area compared to wt, respectively (Figure 5.13D,E).  The protection from atherosclerosis in Lyn-/- chimeric mice correlated with increased proportions of Lyn-/- pMos within the monocyte compartment compared to cMos as indicated by a significantly decreased ratio of cMo/pMo in blood and spleen compared to the wt group. Conversely, increased susceptibility to disease in the Lynup chimeric mice correlated with increased proportions of cMos compared to wt (Figure 5.13F). Furthermore, consistent with our results in Figure 5.8, Lyn mediated changes in monocyte populations was cell intrinsic as BoyJ (Lyn+/+) monocytes, identified by CD45.1 expression, in the same mice did not exhibit any differences in monocyte subset composition (Figure 5.13G). Overall, the data presented here identifies Lyn as a key regulator of the innate immune system and an important Figure 5.13 Lyn deficiency is associated with protection, and Lyn activation with susceptibility, to atherosclerosis in the Ldlr-/- high fat diet model of disease. Lethally irradiated Ldlr-/- mice were transplanted with 10% BoyJ (Lyn+/+, CD45.1+) BM and 90% Rag-/-, Rag-/-Lyn-/- or Rag-/-Lynup/up (CD45.2+) BM. 6 weeks later mice were given a high fat diet to induce atherosclerosis and 8.5 weeks later blood, BM, spleen and heart/aortic root were harvested. (A) A schematic representation of the experimental protocol. (B) Chimerism was confirmed in blood cells by flow cytometry. Graph represents frequency of CD45.1+ and CD45.2+ cells withing cMos (CD11b+CD115+Ly6C+CD62L+), pMos (CD11b+CD115+Ly6C-CD62L-), DCs (CD11chiMHCII+), neutrophils (CD11b+Gr1hi), T cells (CD3+CD19-), and B cells (CD19+CD3-). (C) Mice were weighed twice weekly during high fat diet treatment. (D-E) Aortic roots were cross-sectioned and stained with oil red O to visualizes atherosclerotic plaques. (D) Average plaque area from four cross sections per mouse was quantified. (F) CD45.2+ and (G) CD45.1+ cMo (Ly6C+) and pMo (Ly6C-/lo) in blood, BM, and spleen were assessed by flow cytometry. Graphs represent ratio of cMo/pMo. Data from an independent experiment is shown n=7. Error bars represent SEM, * = p < 0.05, *** = p < 0.001.     148 antagonist of atherosclerosis, a phenotype that is correlated with Lyn-mediated changes in monocyte homeostasis. However, further studies are needed to elucidate whether these changes in monocyte populations contribute to altered susceptibility to atherosclerosis. 5.3 Discussion The Lyn tyrosine kinase is well established as a negative regulator of myeloid cell development and function4, 239, 240, 243, 299, 361, however the role of Lyn in pMos had, to the best of our knowledge, never been examined. The data presented in this chapter identifies a novel role for Lyn as a negative regulator of pMo homeostasis and provides a critically important clarification regarding Lyn’s role in monocytes. Previous studies that identified increased monocyte numbers in Lyn-/- mice were performed prior to the discovery of pMos as a unique subset of monocytes with distinct functionality compared to cMos4, 240. Therefore, the increase in monocytes in Lyn-/- mice was assumed to be an increase in cMo numbers. However, the data presented here clearly show that, with the exception of increased splenic cMos in aged Lyn-/- mice, Lyn deficiency in monocytes does not lead to increased cMos but instead leads to a significant increase in pMos in blood, BM and spleen. Furthermore, this increase in pMos was independent of outright myeloproliferative disease and adaptive immune system dependent autoimmune disease, which suggests a truly steady state role for Lyn in regulating pMo population size. The differences in the physiological roles of pMos and cMos at steady state, and during infection and inflammation, make the clarification of Lyn deficiency induced increase in pMos as opposed to cMos, critically important in the elucidation of Lyn’s role in regulating health and disease.  Lyn-/- mice develop an age-dependent lupus-like autoimmune disease that is characterized by the production of autoantibodies, an accumulation of immune complexes   149 and the development of glomerulonephritis227, 242, 243, 299. Although much of the work aimed at understanding how Lyn deficiency results in autoimmune disease, has focused on Lyn’s role in B cells227, 302, 362, a recent study by Scapini et al., demonstrated that loss of Lyn in innate immune cells is sufficient to cause the autoimmunity and nephritis243. In this study they identified a feed forward inflammatory loop that required BAFF and IFNγ to induce autoimmunity243. They proposed a model in which hyperactive myeloid cells produce an excess of the cytokine BAFF, which promotes B cell survival and also activates T cells resulting in an increase in IFNγ production. This increased IFNγ then acts back on myeloid cells to further enhance their activation and production of BAFF243.  Our data identifying increased pMos in Lyn-/- mice provides further support for the idea that Lyn expression in monocytes may act to antagonize lupus-like autoimmune disease, since pMos have been implicated as pathological drivers of lupus. Patrolling monocytes express a vast array of Fc receptors and engagement of these receptors by immune complexes has been implicated in murine models of lupus40, 349, 350, 363. Lyn can be activated by Fc receptor engagement and can regulate downstream signalling4, 260, 261, 364. It is therefore reasonable to speculate that Lyn activity in pMos may suppress the development or progression of lupus-like diseases by not only regulating pMo numbers but also their immune complex mediated inflammatory responses. Further studies will be required to address this important research question.  Although various mouse models have been used to explore how Lyn activity modulates a number of inflammatory diseases including; lupus227, 242, 243, 299, asthma241, 365, 366, experimental autoimmune encephalomyelitis367, and most recently colitis223, 368, a role for Lyn in atherosclerosis has not been investigated. Here, we examined how loss of Lyn, or an increase in Lyn activity, affected the outcome of the Ldlr-/- high fat model of atherosclerosis.   150 In this model, activation of Lyn within innate immune cells acted to accelerate disease, as mice transplanted with Rag-/-Lynup BM had an increase in plaque development, whereas mice reconstituted with Rag-/-Lyn-/- BM exhibited diminished plaque development. These phenotypes correlated with Lyn’s role in monocyte development. Conventional monocytes are well-established drivers of atherosclerosis in humans and numerous experimental models of disease, and although somewhat controversial, pMos have been linked with protection from disease43, 347, 354, 355, 369. Interestingly, our data showed that at steady state, Lyn activation supported increased cMo numbers without affecting pMos, whereas loss of Lyn resulted in an accumulation of systemic pMos. This suggests that increased Lyn activity may drive atherosclerosis by supporting pathogenic cMo populations, as opposed to suppressing protective effects by pMos, while the opposite may be true in the Lyn-/- group. Alternatively, the degree to which atherosclerosis develops may depend on the relative ratios of the two monocyte populations as Lyn deficiency shifted the ratio of cMo/pMo, with an increase in the relative frequency of pMos observed in Lyn-/- BM Ldlr-/- radiation chimeric mice. By contrast in atherosclerosis-prone Lynup mice this ratio was reversed with cMos predominating. Further studies will be required to determine whether Lyn mediated changes in monocytes are solely responsible for these distinct atherosclerosis susceptibilities. As Lyn is expressed within other innate immune populations it is reasonable to assume that Lyn could regulate atherogenesis by multiple mechanisms including monocytes.  Interestingly, the studies that have linked pMos to protection from atherosclerosis used Nur77-deficient mice or BM chimeras, which have a severely impaired pMo compartment39, 43, 347. In both studies, one using the Ldrl-/- high fat diet model and the other using the Apoe-/- model, mice lacking Nur77 developed worse disease, which was linked to   151 an impaired M2 and enhanced M1 macrophage phenotype43, 347. Within sites of atherogenesis, M1 macrophage responses are thought to contribute to pathological inflammation, whereas M2 responses may be protective354, 370. Lyn-/- macrophages are M2 skewed245 (our unpublished observation) therefore, loss of Lyn in myeloid cells might inhibit atherosclerosis by not only facilitating the expansion of pMos, but by also influencing monocyte inflammatory phenotype. Further studies investigating the functional differences of Lyn-/- and Lynup monocytes and monocyte-derived macrophages in the context of atherogenic stimuli such as oxLDL, should provide further insight into the role of Lyn in monocytes in atherosclerosis. Furthermore, analysis of the myeloid cells present in healthy and atherosclerotic aortas of Lyn-/- and Lynup mice will also be necessary to provide a clearer understanding of the role of Lyn in this model of chronic inflammation. Although, our focus has been on Lyn's role in monocyte subset development, atherosclerosis is highly complex with numerous contributing mechanisms, including altered endothelial cell homeostasis, platelet function, and a recently identified role for dendritic cells and regulatory T cell responses in disease etiology. Given Lyn's reported roles in these cells and processes, and the fact that Lyn is expressed in other immune cells that may regulate atherosclerosis240, 354, 370, 371, 372, 373 careful examination of Lyn’s action in each of these compartments will be required to fully understand how Lyn activity impacts this disease.   The data presented here clearly identified Lyn as a regulator of monocyte homeostasis however a detailed mechanism of how loss of Lyn results in increased pMos and how increased Lyn activity results in increased cMos, remains to be elucidated. Our work identified a cell autonomous role for Lyn in monocytes in regulating pMo homeostasis, but since Lyn is expressed throughout monocyte development, it is still unclear at what stage(s)   152 in monocyte development Lyn might be acting to influence mature monocyte populations. We did not observe any difference in BM progenitor numbers, but Lyn-/- BM cells produced more BM-derived monocytes, in vitro, which resemble pMos based on expression of CD11b, CSF-1R, PD-L1, and CD11c, and lack of CD62L and Ly6C. This suggests increased output from BM progenitor cells could contribute to increased monocyte numbers in vivo. Furthermore, we identified an age-dependent increase in splenic cMoPs in Lyn-/- mice, consistent with previous studies that have identified increased splenic progenitors with myeloid differentiation capacity4, 240, 361. This suggests that increased extramedullary monopoiesis could be involved in the observed systemic pMo expansion in Lyn-/- mice. However, although we did observe increased splenic cMos in aged mice, cMos were mostly unaffected in younger mice and in blood and BM of Lyn-/- mice. Therefore the increased splenic cMoPs or potential increased output from BM progenitors did not result in a generalized increase in monocytes. Although cMos have been identified as an obligate precursor to pMo in blood, whether pMos can develop directly from cMoPs in spleen or BM has not been explored23, 34. Indeed,  previous studies found that BM pMos acquire BrdU before their blood counterparts which suggests a possible difference in their development23. An investigation of the role of splenic cMoPs in the development of pMos might provide valuable insight into pMo biology, and given the increase in extramedullary myelopoieis in Lyn-/- mice, these mice could be a useful model to study this process.  Lyn might also regulate pMo populations by limiting their survival. The circulating lifespan of pMos can vary dramatically, a process that has been shown to be at least partially dependent on CSF-1R signalling23. Lyn and SFKs have been implicated in CSF-1R signalling in at least two recent studies. A study by Baran et al., found that Lyn negatively   153 regulates CSF-1R signalling in BM-macrophages by promoting activity of the inhibitory phosphatase SHIP-1255. Another study by Rohde et al. found that inhibiting SFK binding to the juxtamembrane domain of CSF-1R by mutating Y559 resulted in decreased receptor internalization and degradation in response to ligand binding359. In both studies Lyn/SFK interactions with CSF-1R resulted in decreased Akt activation255, 359, which could be one of the ways CSF-1R signalling mediates survival in pMos. Consistent with a role for Lyn as negative regulator of monocyte survival downstream of CSF-1R signalling, Lyn-/- BM-derived monocytes had increased survival in culture even under limiting CSF-1 concentrations. We also observed increased expression of CSF-1R (CD115) on pMos and cMos in the blood, BM, and spleen of Lyn-/- mice compared to wt. This phenotype is consistent with SFK driven receptor internalization and degradation and could result in prolonged or increased CSF-1R signalling in Lyn-/- monocytes. Interestingly, although Lyn also regulated CSF-1R expression on cMos, no difference in BrdU labeling kinetics was observed in Lyn-/- cMos compared to wt, indicating similar population turnover. Therefore, although Lyn mediated regulation of CSF-1R signalling may alter pMo populations, it does not seem to have an effect on cMos. This is consistent with increased reliance on CSF-1R signalling in pMos versus cMos353. Although, cMos require CSF-1R signalling for their development, as evidenced by dramatic loss of monocytes in CSF-1 and CSF-1R deficient mice374, 375, prolonged neutralization of the receptor does not result in a loss of cMos while it dramatically affects pMos353. Therefore, if Lyn acts to inhibit CSF-1R signalling, it is not surprising that the phenotype manifests more dramatically in pMo numbers.   The mechanisms that regulate pMo development and survival are still largely unkown and Lyn may act to modulate these cells through CSF-1R-independent pathways. For   154 example, both Nur77 and CX3CR1 have been identified as important regulators of pMo survival but Lyn’s involvement in these pathways has not been investigated39, 376. Overall the data presented here identify a novel role for Lyn as a negative regulator of pMos and the development of atherosclerosis. These studies have laid the foundation for interesting new avenues of investigation aimed at understanding the role of Lyn in monocyte biology and cardiovascular disease.    155 Chapter 6: Conclusion    156 6.1 Summary and contribution to the field  Inappropriate inflammatory responses constitute a major pathological force that can initiate, exacerbate, and/or perpetuate the spectrum of human disease. Therefore, novel insight into the factors that regulate innate immune responses can have broad implications related to human health and disease. The work described in this dissertation provides a novel understanding of the critical importance of the Lyn tyrosine kinase in regulating innate immune responses, host-microbial interactions, and the outcome of microbial-driven and sterile inflammation.   Prior to this work, the role of Lyn or any SFK in intestinal homeostasis and inflammation was completely unknown. The only association between SFKs and gastrointestinal inflammation was the development of colitis in some patients treated with Dasatanib286, 287, a broad tyrosine kinase inhibitor. Our work definitively demonstrated that Lyn acts to inhibit pathogenic inflammatory responses through a variety of mechanisms that centre on host-microbial interactions. Increased Lyn activity resulted in a hypersensitivity to microbial products such as LPS, which was sufficient to protect mice from DSS-induced colitis. This work expanded on initial findings by our lab that identified a profound systemic hypersensitivity to LPS by Lynup mice, resulting in increased DC-induced IFNγ production by NK cells249. The dichotomy between Lynup mediated lethal responses to systemic LPS and the protective effect of the same stimulus in the context in the intestinal tract, further supports the recently established understanding that steady state PRR signalling in the intestinal tract supports a tolerogenic/anti-inflammatory environment while signalling through the same receptors systemically can lead to devastating inflammatory responses.    157  Our investigation into the mechanism of Lyn-mediated protection from DSS colitis led to a number of new discoveries regarding the role of Lyn in innate immunity. Prior to this work, no role for Lyn in regulating IL-22 production or non-cytotoxic ILC responses had ever been established. We identified Lyn as an important regulator of IL-22 production in response to intestinal damage and LPS, and demonstrated that LPS hyperresponsiveness by Lynup DCs was sufficient to drive increased IL-22 production from ILC3s. At the time that our work on Lyn in DC-ILC interactions was being performed, the discovery of the ILC family (other than NK and LTi cells), was just being established and very little was known about how DCs could interact with ILCs or how IL-22 production by ILCs was regulated. Our work, therefore contributed to a burgeoning field of ILC3 biology by identifying a new factor regulating DC-ILC interactions. Furthermore, this work expanded on previous studies by our lab showing that increased Lyn activity in DCs could drive IFNγ production by NK cells, the cytotoxic member of the ILC family. Therefore the discovery that Lyn could act in a similar manner to enhance IL-22 production by ILC3s, suggested that Lyn in DCs may act as a central regulator in various ILC responses, as opposed to simply regulating one small part of ILC effector function. However, whether this is true in DC-mediated ILC1 and ILC2 responses remains to be determined.   Our investigation into the role of Lyn in the intestinal immune system led to the characterization of Lyn expression at the protein level on a per cell basis within intestinal immune cells. Although, it was assumed that myeloid cells and NK cells expressed Lyn in vivo while T cells did not, flow cytometric analysis of Lyn expression in intestinal immune cells had never been reported. This was fundamentally important in our understanding of how Lyn regulates intestinal homeostasis and inflammation and led to the discovery of Lyn   158 expression by a distinct subset of ILCs (Sca1+CD4-). Lyn’s role in these cells however was not investigated; therefore future studies investigating the cell intrinsic role for Lyn in Sca1+CD4- ILCs may provide novel insight into ILC biology.   The increased susceptibility to DSS-induced colitis by Lyn-/- mice further supported the importance of Lyn in regulating intestinal inflammation. However, while investigating the mechanisms of Lyn-mediated protection from colitis, it became clear that the mechanisms mediating protection in Lynup mice were different than those mediating susceptibility in Lyn-/- mice.  While the innate immune system was sufficient to protect Lynup mice from DSS, the adaptive immune system was required to mediate increased disease in Lyn-/- animals. Interestingly, although Lyn is not expressed in T cells, susceptibility to DSS in Lyn-/- mice was associated with altered IFNγ and IL-17 production by T cells. Lyn had previously been associated with regulating IFNγ and IL-17 production by T cells243, 362, 377 however our findings provided important confirmation of this phenotype and established for the first time the influence of the microbiota on Lyn-regulated T cell responses.   While investigating the mechanism of Lyn mediated protection from experiment colitis, we identified a previously unknown role for Lyn in regulating the microbiota. Although we did not perform an in-depth analysis of the microbial communities in Lyn-/- compared to wt mice, we identified an expansion of SFB in Lyn-/- mice, which correlated with susceptibility to DSS as well as an enhancement in IFNγ and IL-17 production from Lyn-/- intestinal T cells. Although there has been a flurry of renewed interest in SFB due to their role in regulating intestinal and systemic inflammatory diseases, the majority of the work has focused on how SFB regulate immune responses as opposed to what immune factors regulate colonization and expansion of SFB150, 152, 160. Prior to our studies, two main   159 immunological pathways were known to negatively regulate SFB. These involved IL-22-induced production of the antimicrobial peptide RegΙΙΙγ by intestinal epithelial cells, and IgA production by plasma cells162, 163, 332.  Interestingly, Lyn is involved in both of these pathways and altered IgA responses and impaired ileal IL-22 production in Lyn-/- mice were associated with increased SFB burden in these animals.  The identification of Lyn’s role in regulating the microbiota provided the final piece in a framework of knowledge that allowed us to conceptualize Lyn’s complicated function in intestinal homeostasis an inflammation. Overall, our work suggests that Lyn-mediated regulation of host-microbial interactions lies at the heart of its importance in regulating intestinal inflammation. We propose that by regulating innate responses to microbial products, Lyn regulates the production of cytoprotective factors such as IL-22 that can directly modulate intestinal epithelial barrier function and limit intestinal inflammation, but can also impact the composition of the commensal microbiota which can then itself alter the outcome of intestinal inflammation. Furthermore our work links the abundance of knowledge regarding Lyn-mediated alterations of B cell responses with a potential to regulate the microbiota and intestinal inflammation through altered antibody responses. Finally, since Lyn-deficiency on its own does not induce increased susceptibility to DSS colitis, as was observed using the rederived colonies and radiation chimeric mice, Lyn mediated regulation of intestinal inflammation provides further evidence for the importance of interactions between host susceptibilities and environmental triggers in the outcome of intestinal inflammation. Lyn-/- mice may therefore, prove to be a useful tool in studying the combinatorial effects of genetic susceptibility plus various environmental factors in models of inflammatory bowel disease.    160  We next sought to expand our studies to investigate Lyn-mediated regulation of systemic innate immune responses. Given the importance of Lyn as a negative regulator of myeloid cell development and function4, 239, 240, 243, 299, 361, and the complete lack of knowledge regarding Lyn’s role in pMos, we questioned whether Lyn differentially regulates pMo and/or cMo populations in vivo. Interestingly, loss of Lyn expression and increased Lyn kinase activity affected distinct monocyte populations.  Lyn-/- mice had a profound increase in pMo numbers in all tissues examined, with little effect on cMo numbers, a phenotype that was independent of overt myeloproliferative disease and adaptive immune system driven autoimmune disease. This finding was completely novel and has important implications for our understanding of how Lyn deficiency results in a spontaneous lupus-like autoimmune disease. Increased Lyn kinase activity had no major impact on pMo populations but instead supported the expansion of cMo populations in BM and spleen. Our work also contributed to the small body of data suggesting that Lyn acts as a negative regulator of CSF-1R signalling, and demonstrated for the first time a role for Lyn in regulating CSF-1R expression on monocytes in vivo. The increased dependence of CSF-1R signalling for pMo population maintenance, compared to cMos23, 353, provides a rationale to hypothesize that although Lyn may act as an inhibitor of CSF-1R signalling in both cMos and pMos, this inhibition is particularly important in pMos, leading to specific expansion of pMos in Lyn-/- mice. Overall, our work provides a novel understanding of Lyn’s role in monocyte homeostasis, which has major implication for a number of inflammatory diseases, including lupus, atherosclerosis and Alzheimer’s disease.   Together, the work described in this dissertation identified novel roles for Lyn in regulating monocyte homeostasis, DC-ILC interactions, and host-microbial interactions,   161 which ultimately dictate the outcome of gastrointestinal inflammation and atherosclerosis. Interestingly, Lyn can act as both an inhibitor and protagonist of inflammatory disease depending on the disease context. In the gut Lyn acts to limit inflammatory damage but instead drives pathology in models of cardiovascular disease or sepsis. Lyn may therefore be a useful therapeutic target for inflammatory diseases however careful therapeutic design will be required to avoid detrimental off target effects. 6.2 Future directions 6.2.1 Understanding Lyn’s role intestinal homeostasis and inflammation  Our work investigating Lyn’s role in intestinal homeostasis and inflammation identified the importance of Lyn as a regulator of host-microbial interactions and demonstrated the significance of these interactions on the outcome of inflammation. However, a number of questions regarding the mechanisms of Lyn mediated protection from gastrointestinal inflammation and enteric infection remain. Although we were able to identify increased SFB in Lyn-/- mice through our limited analysis of intestinal bacterial communities, a more thorough analysis and comparison of the commensal microbiotas, including bacterial, viral and eukaryotic species, in wt, Lyn-/-, and Lynup/up mice is needed in order to understand Lyn’s role in this compartment. Our lab does not have the capacity to perform these types of analysis, however they could be performed via collaboration with microbiologists in our department. Further studies by our lab could be performed to elucidate the mechanisms of Lyn mediated changes in the microbiota. The use of compound mutant mice such as Rag-/-Lyn-/-, Lyn-/-µMT, or Lyn-/-Il-22-/- (or similar crosses with Lynup/up) mice or cell specific Lyn mutation could be used to identify specific cell types or cytokine responses responsible for Lyn’s role in the regulating the microbiota. This could then be related back to disease   162 susceptibility, not only for DSS mediated colitis but also enteric infection induced gastroenteritis and systemic inflammatory diseases such as the lupus-like disease in Lyn-/- mice or atherosclerosis.  Further investigation to analyse the detailed mechanisms of how Lyn mediates protection from experimental colitis could provide novel insight into colitis pathogenesis. Since Lyn affects a variety of signalling pathways, cell types, and inflammatory responses, its use as a drug target has the potential for deleterious off target effects. Therefore understanding the exact mechanisms of how Lyn protects from colitis would allow for a more specific therapeutic approach that would likely act downstream of Lyn or within a specific cell compartment. For example, although our studies demonstrated that hypersensitivity to LPS by Lyn+/up mice is sufficient to protect from DSS colitis, the specific cell types and molecules that mediate the protection are still unknown. Similarly, our work identified a requirement for Lyn deficiency together with a dysbiotic microbiota to induce increased susceptibility to DSS, a phenotype that was associated with SFB and increased IL-17 and IFNγ production from T cells. Whether SFB and/or T cells are actually driving disease in these mice remains to be determined. The use of cytokine neutralizing and/or cell depleting antibodies could be used to investigate the relative contributions of CD4 or CD8 T cells and the cytokines they produce. Furthermore, since the rederived Lyn-/- mice lack SFB and do not exhibit increased susceptibility to DSS, they could be used to investigate the impact of colonization of SFB on DSS colitis, by inoculating them with fecal material from SFB mono-colonized mice. Many questions remain regarding Lyn’s role in intestinal homeostasis and inflammation, however these questions could provide the initial framework for a research project for incoming graduate students in the Harder lab.   163 6.2.2 Understanding Lyn’s role in monocyte homeostasis and effector functions, and in atherosclerosis  We have identified an important role for Lyn in regulating pMo populations in vivo, however many questions remain regarding the mechanism through which Lyn regulates monocytes and how this impacts the development of inflammatory diseases such as lupus and atherosclerosis. The negative regulation of pMos was associated with altered responses to CSF-1R signalling by Lyn-/- cells. Our in vitro studies and in vivo BrdU incorporation assay suggests that Lyn regulates CSF-1R signalling to mediate increased survival and/or the circulation half-life of Lyn-/- pMos, which may contribute to the increased numbers of these cells. However, a detailed biochemical analysis of Lyn’s role in CSF-1R signalling in monocytes and how this affects pMo and cMo survival, development, and function is needed. The factors that regulate pMo and cMo homeostasis are still largely unknown and Lyn may regulate monocytes through still undefined CSF-1R-independent mechanisms. Therefore an investigation into how Lyn regulates pMos and cMos in vivo may provide not only mechanistic insight into Lyn-mediated control of monocytes but may also help to further understand monocyte biology. Furthermore, Nur77 is known to regulate pMo development and survival as well as monocyte-derived macrophage polarization, but a role for Lyn in Nur77 activity is unknown39, 43. Nur77 can however be regulated by post-translational modifications including phosphorylation by Akt378, 379, which suggests a possibility for Lyn’s involvement in this pathway. We also identified an accumulation of splenic cMoPs in Lyn-/- mice that correlated with a systemic increase in pMos. The importance of extramedullary monopoiesis in pMo homeostasis is currently unknown and an investigation into the   164 requirement for these splenic progenitors for the increased pMos in Lyn-/- mice could provide novel insight into pMo biology.   Finally, we identified a protective role for Lyn in innate immune cells in the development of atherosclerosis, which correlated to changes in monocyte populations, but we have yet to investigate the mechanism of this protection. A more detailed analysis of markers of atherosclerosis including circulating lipid concentrations and areas of necrosis within the atherosclerotic plaques is also needed to provide a more thorough description of Lyn’s role in this model. Additionally, flow cytometric analysis of the cells present within the aortas of naïve and atherosclerotic mice would provide valuable insight into understanding which cells are impacting atherogenesis in situ. Furthermore, analysis of functional differences of Lyn-/- and Lynup monocytes, such as uptake of and activation by oxLDL or other atherogenic mediators, as well as adhesion and migration differences, could help elucidate how Lyn in monocytes impacts atherosclerosis. Our identification of Lyn in innate immune cells as a regulator of atherosclerosis has opened up a completely new avenue of research for the lab and will be an interesting project for future lab members. 6.3 Concluding remarks  Overall the work described in this dissertation has provided numerous contributions to the field of immunology and to the understanding of how regulating signalling thresholds within immune cells impacts innate immunity and host-microbial interactions. Furthermore, it has laid the groundwork for exciting avenues of research for future members of the Harder laboratory. The continuation of the work described here will hopefully lead to important discoveries in the field of innate immunity and mucosal immunology that will allow for   165 translation of our basic research findings into novel therapeutics for the treatment of human inflammatory diseases.       166 References 1. Ingley E. Functions of the Lyn tyrosine kinase in health and disease. Cell Commun Signal 2012, 10(1): 21.  2. Hibbs ML, Harder KW. The duplicitous nature of the Lyn tyrosine kinase in growth factor signaling. Growth Factors 2006, 24(2): 137-149.  3. Artis D, Spits H. The biology of innate lymphoid cells. Nature 2015, 517(7534): 293-301.  4. Scapini P, Pereira S, Zhang H, Lowell CA. Multiple roles of Lyn kinase in myeloid cell signaling and function. Immunol Rev 2009, 228(1): 23-40.  5. Jenkins SJ, Hume DA. Homeostasis in the mononuclear phagocyte system. Trends Immunol 2014, 35(8): 358-367.  6. Onai N, Ohteki T. Bipotent or Oligopotent? A macrophage and DC progenitor revisited. Immunity 2014, 41(1): 5-7.  7. Hettinger J, Richards DM, Hansson J, Barra MM, Joschko AC, Krijgsveld J, Feuerer M. Origin of monocytes and macrophages in a committed progenitor. Nat Immunol 2013, 14(8): 821-830.  8. Nowarski R, Gagliani N, Huber S, Flavell RA. Innate immune cells in inflammation and cancer. Cancer immunology research 2013, 1(2): 77-84.  9. Nathan C, Ding A. Nonresolving inflammation. Cell 2010, 140(6): 871-882.  10. Scrivo R, Vasile M, Bartosiewicz I, Valesini G. Inflammation as "common soil" of the multifactorial diseases. Autoimmunity reviews 2011, 10(7): 369-374.  11. Zipp F, Aktas O. The brain as a target of inflammation: common pathways link inflammatory and neurodegenerative diseases. Trends in neurosciences 2006, 29(9): 518-527.  12. Weyand CM, Goronzy JJ. Pathogenesis of rheumatoid arthritis. The Medical clinics of North America 1997, 81(1): 29-55.  13. Sitia S, Tomasoni L, Atzeni F, Ambrosio G, Cordiano C, Catapano A, Tramontana S, Perticone F, Naccarato P, Camici P, Picano E, Cortigiani L, Bevilacqua M, Milazzo L, Cusi D, Barlassina C, Sarzi-Puttini P, Turiel M. From endothelial dysfunction to atherosclerosis. Autoimmunity reviews 2010, 9(12): 830-834.    167 14. Philips T, Robberecht W. Neuroinflammation in amyotrophic lateral sclerosis: role of glial activation in motor neuron disease. The Lancet Neurology 2011, 10(3): 253-263.  15. McNelis JC, Olefsky JM. Macrophages, immunity, and metabolic disease. Immunity 2014, 41(1): 36-48.  16. Kaser A, Zeissig S, Blumberg RS. Inflammatory bowel disease. Annu Rev Immunol 2010, 28: 573-621.  17. Feldman N, Rotter-Maskowitz A, Okun E. DAMPs as mediators of sterile inflammation in aging-related pathologies. Ageing research reviews 2015.  18. Geissmann F, Manz MG, Jung S, Sieweke MH, Merad M, Ley K. Development of monocytes, macrophages, and dendritic cells. Science 2010, 327(5966): 656-661.  19. van Furth R, Cohn ZA, Hirsch JG, Humphrey JH, Spector WG, Langevoort HL. [Mononuclear phagocytic system: new classification of macrophages, monocytes and of their cell line]. Bulletin of the World Health Organization 1972, 47(5): 651-658.  20. Alliot F, Godin I, Pessac B. Microglia derive from progenitors, originating from the yolk sac, and which proliferate in the brain. Brain research Developmental brain research 1999, 117(2): 145-152.  21. Ginhoux F, Greter M, Leboeuf M, Nandi S, See P, Gokhan S, Mehler MF, Conway SJ, Ng LG, Stanley ER, Samokhvalov IM, Merad M. Fate mapping analysis reveals that adult microglia derive from primitive macrophages. Science 2010, 330(6005): 841-845.  22. Schulz C, Gomez Perdiguero E, Chorro L, Szabo-Rogers H, Cagnard N, Kierdorf K, Prinz M, Wu B, Jacobsen SE, Pollard JW, Frampton J, Liu KJ, Geissmann F. A lineage of myeloid cells independent of Myb and hematopoietic stem cells. Science 2012, 336(6077): 86-90.  23. Yona S, Kim KW, Wolf Y, Mildner A, Varol D, Breker M, Strauss-Ayali D, Viukov S, Guilliams M, Misharin A, Hume DA, Perlman H, Malissen B, Zelzer E, Jung S. Fate mapping reveals origins and dynamics of monocytes and tissue macrophages under homeostasis. Immunity 2013, 38(1): 79-91.  24. Hashimoto D, Chow A, Noizat C, Teo P, Beasley MB, Leboeuf M, Becker CD, See P, Price J, Lucas D, Greter M, Mortha A, Boyer SW, Forsberg EC, Tanaka M, van Rooijen N, Garcia-Sastre A, Stanley ER, Ginhoux F, Frenette PS, Merad M. Tissue-resident macrophages self-maintain locally throughout adult life with minimal contribution from circulating monocytes. Immunity 2013, 38(4): 792-804.    168 25. Fogg DK, Sibon C, Miled C, Jung S, Aucouturier P, Littman DR, Cumano A, Geissmann F. A clonogenic bone marrow progenitor specific for macrophages and dendritic cells. Science 2006, 311(5757): 83-87.  26. Varol C, Landsman L, Fogg DK, Greenshtein L, Gildor B, Margalit R, Kalchenko V, Geissmann F, Jung S. Monocytes give rise to mucosal, but not splenic, conventional dendritic cells. J Exp Med 2007, 204(1): 171-180.  27. Auffray C, Fogg DK, Narni-Mancinelli E, Senechal B, Trouillet C, Saederup N, Leemput J, Bigot K, Campisi L, Abitbol M, Molina T, Charo I, Hume DA, Cumano A, Lauvau G, Geissmann F. CX3CR1+ CD115+ CD135+ common macrophage/DC precursors and the role of CX3CR1 in their response to inflammation. J Exp Med 2009, 206(3): 595-606.  28. Onai N, Obata-Onai A, Schmid MA, Ohteki T, Jarrossay D, Manz MG. Identification of clonogenic common Flt3+M-CSFR+ plasmacytoid and conventional dendritic cell progenitors in mouse bone marrow. Nat Immunol 2007, 8(11): 1207-1216.  29. Waskow C, Liu K, Darrasse-Jeze G, Guermonprez P, Ginhoux F, Merad M, Shengelia T, Yao K, Nussenzweig M. The receptor tyrosine kinase Flt3 is required for dendritic cell development in peripheral lymphoid tissues. Nat Immunol 2008, 9(6): 676-683.  30. Kingston D, Schmid MA, Onai N, Obata-Onai A, Baumjohann D, Manz MG. The concerted action of GM-CSF and Flt3-ligand on in vivo dendritic cell homeostasis. Blood 2009, 114(4): 835-843.  31. McKenna HJ, Stocking KL, Miller RE, Brasel K, De Smedt T, Maraskovsky E, Maliszewski CR, Lynch DH, Smith J, Pulendran B, Roux ER, Teepe M, Lyman SD, Peschon JJ. Mice lacking flt3 ligand have deficient hematopoiesis affecting hematopoietic progenitor cells, dendritic cells, and natural killer cells. Blood 2000, 95(11): 3489-3497.  32. Sathe P, Metcalf D, Vremec D, Naik SH, Langdon WY, Huntington ND, Wu L, Shortman K. Lymphoid tissue and plasmacytoid dendritic cells and macrophages do not share a common macrophage-dendritic cell-restricted progenitor. Immunity 2014, 41(1): 104-115.  33. Chow A, Brown BD, Merad M. Studying the mononuclear phagocyte system in the molecular age. Nat Rev Immunol 2011, 11(11): 788-798.  34. Mildner A, Yona S, Jung S. A close encounter of the third kind: monocyte-derived cells. Adv Immunol 2013, 120: 69-103.    169 35. Cros J, Cagnard N, Woollard K, Patey N, Zhang SY, Senechal B, Puel A, Biswas SK, Moshous D, Picard C, Jais JP, D'Cruz D, Casanova JL, Trouillet C, Geissmann F. Human CD14dim monocytes patrol and sense nucleic acids and viruses via TLR7 and TLR8 receptors. Immunity 2010, 33(3): 375-386.  36. Ingersoll MA, Spanbroek R, Lottaz C, Gautier EL, Frankenberger M, Hoffmann R, Lang R, Haniffa M, Collin M, Tacke F, Habenicht AJ, Ziegler-Heitbrock L, Randolph GJ. Comparison of gene expression profiles between human and mouse monocyte subsets. Blood 2010, 115(3): e10-19.  37. Passlick B, Flieger D, Ziegler-Heitbrock HW. Identification and characterization of a novel monocyte subpopulation in human peripheral blood. Blood 1989, 74(7): 2527-2534.  38. Geissmann F, Jung S, Littman DR. Blood monocytes consist of two principal subsets with distinct migratory properties. Immunity 2003, 19(1): 71-82.  39. Hanna RN, Carlin LM, Hubbeling HG, Nackiewicz D, Green AM, Punt JA, Geissmann F, Hedrick CC. The transcription factor NR4A1 (Nur77) controls bone marrow differentiation and the survival of Ly6C- monocytes. Nat Immunol 2011, 12(8): 778-785.  40. Auffray C, Fogg D, Garfa M, Elain G, Join-Lambert O, Kayal S, Sarnacki S, Cumano A, Lauvau G, Geissmann F. Monitoring of blood vessels and tissues by a population of monocytes with patrolling behavior. Science 2007, 317(5838): 666-670.  41. Carlin LM, Stamatiades EG, Auffray C, Hanna RN, Glover L, Vizcay-Barrena G, Hedrick CC, Cook HT, Diebold S, Geissmann F. Nr4a1-dependent Ly6C(low) monocytes monitor endothelial cells and orchestrate their disposal. Cell 2013, 153(2): 362-375.  42. Michaud JP, Bellavance MA, Prefontaine P, Rivest S. Real-time in vivo imaging reveals the ability of monocytes to clear vascular amyloid beta. Cell reports 2013, 5(3): 646-653.  43. Hanna RN, Shaked I, Hubbeling HG, Punt JA, Wu R, Herrley E, Zaugg C, Pei H, Geissmann F, Ley K, Hedrick CC. NR4A1 (Nur77) deletion polarizes macrophages toward an inflammatory phenotype and increases atherosclerosis. Circulation research 2012, 110(3): 416-427.  44. Misharin AV, Cuda CM, Saber R, Turner JD, Gierut AK, Haines GK, 3rd, Berdnikovs S, Filer A, Clark AR, Buckley CD, Mutlu GM, Budinger GR, Perlman H. Nonclassical Ly6C(-) monocytes drive the development of inflammatory arthritis in mice. Cell reports 2014, 9(2): 591-604.    170 45. Palframan RT, Jung S, Cheng G, Weninger W, Luo Y, Dorf M, Littman DR, Rollins BJ, Zweerink H, Rot A, von Andrian UH. Inflammatory chemokine transport and presentation in HEV: a remote control mechanism for monocyte recruitment to lymph nodes in inflamed tissues. J Exp Med 2001, 194(9): 1361-1373.  46. Serbina NV, Salazar-Mather TP, Biron CA, Kuziel WA, Pamer EG. TNF/iNOS-producing dendritic cells mediate innate immune defense against bacterial infection. Immunity 2003, 19(1): 59-70.  47. Stables MJ, Shah S, Camon EB, Lovering RC, Newson J, Bystrom J, Farrow S, Gilroy DW. Transcriptomic analyses of murine resolution-phase macrophages. Blood 2011, 118(26): e192-208.  48. Ramachandran P, Pellicoro A, Vernon MA, Boulter L, Aucott RL, Ali A, Hartland SN, Snowdon VK, Cappon A, Gordon-Walker TT, Williams MJ, Dunbar DR, Manning JR, van Rooijen N, Fallowfield JA, Forbes SJ, Iredale JP. Differential Ly-6C expression identifies the recruited macrophage phenotype, which orchestrates the regression of murine liver fibrosis. Proc Natl Acad Sci U S A 2012, 109(46): E3186-3195.  49. Davies LC, Rosas M, Jenkins SJ, Liao CT, Scurr MJ, Brombacher F, Fraser DJ, Allen JE, Jones SA, Taylor PR. Distinct bone marrow-derived and tissue-resident macrophage lineages proliferate at key stages during inflammation. Nature communications 2013, 4: 1886.  50. Tacke F, Alvarez D, Kaplan TJ, Jakubzick C, Spanbroek R, Llodra J, Garin A, Liu J, Mack M, van Rooijen N, Lira SA, Habenicht AJ, Randolph GJ. Monocyte subsets differentially employ CCR2, CCR5, and CX3CR1 to accumulate within atherosclerotic plaques. J Clin Invest 2007, 117(1): 185-194.  51. Shechter R, London A, Varol C, Raposo C, Cusimano M, Yovel G, Rolls A, Mack M, Pluchino S, Martino G, Jung S, Schwartz M. Infiltrating blood-derived macrophages are vital cells playing an anti-inflammatory role in recovery from spinal cord injury in mice. PLoS medicine 2009, 6(7): e1000113.  52. Jakubzick C, Gautier EL, Gibbings SL, Sojka DK, Schlitzer A, Johnson TE, Ivanov S, Duan Q, Bala S, Condon T, van Rooijen N, Grainger JR, Belkaid Y, Ma'ayan A, Riches DW, Yokoyama WM, Ginhoux F, Henson PM, Randolph GJ. Minimal differentiation of classical monocytes as they survey steady-state tissues and transport antigen to lymph nodes. Immunity 2013, 39(3): 599-610.  53. Cheong C, Matos I, Choi JH, Dandamudi DB, Shrestha E, Longhi MP, Jeffrey KL, Anthony RM, Kluger C, Nchinda G, Koh H, Rodriguez A, Idoyaga J, Pack M, Velinzon K, Park CG, Steinman RM. Microbial stimulation fully differentiates   171 monocytes to DC-SIGN/CD209(+) dendritic cells for immune T cell areas. Cell 2010, 143(3): 416-429.  54. Vremec D, Zorbas M, Scollay R, Saunders DJ, Ardavin CF, Wu L, Shortman K. The surface phenotype of dendritic cells purified from mouse thymus and spleen: investigation of the CD8 expression by a subpopulation of dendritic cells. J Exp Med 1992, 176(1): 47-58.  55. Vremec D, Shortman K. Dendritic cell subtypes in mouse lymphoid organs: cross-correlation of surface markers, changes with incubation, and differences among thymus, spleen, and lymph nodes. J Immunol 1997, 159(2): 565-573.  56. Vremec D, Pooley J, Hochrein H, Wu L, Shortman K. CD4 and CD8 expression by dendritic cell subtypes in mouse thymus and spleen. J Immunol 2000, 164(6): 2978-2986.  57. Asselin-Paturel C, Boonstra A, Dalod M, Durand I, Yessaad N, Dezutter-Dambuyant C, Vicari A, O'Garra A, Biron C, Briere F, Trinchieri G. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat Immunol 2001, 2(12): 1144-1150.  58. Nakano H, Yanagita M, Gunn MD. CD11c(+)B220(+)Gr-1(+) cells in mouse lymph nodes and spleen display characteristics of plasmacytoid dendritic cells. J Exp Med 2001, 194(8): 1171-1178.  59. Ginhoux F, Liu K, Helft J, Bogunovic M, Greter M, Hashimoto D, Price J, Yin N, Bromberg J, Lira SA, Stanley ER, Nussenzweig M, Merad M. The origin and development of nonlymphoid tissue CD103+ DCs. J Exp Med 2009, 206(13): 3115-3130.  60. Bogunovic M, Ginhoux F, Helft J, Shang L, Hashimoto D, Greter M, Liu K, Jakubzick C, Ingersoll MA, Leboeuf M, Stanley ER, Nussenzweig M, Lira SA, Randolph GJ, Merad M. Origin of the lamina propria dendritic cell network. Immunity 2009, 31(3): 513-525.  61. Varol C, Vallon-Eberhard A, Elinav E, Aychek T, Shapira Y, Luche H, Fehling HJ, Hardt WD, Shakhar G, Jung S. Intestinal lamina propria dendritic cell subsets have different origin and functions. Immunity 2009, 31(3): 502-512.  62. del Rio ML, Bernhardt G, Rodriguez-Barbosa JI, Forster R. Development and functional specialization of CD103+ dendritic cells. Immunol Rev 2010, 234(1): 268-281.    172 63. den Haan JM, Bevan MJ. Constitutive versus activation-dependent cross-presentation of immune complexes by CD8(+) and CD8(-) dendritic cells in vivo. J Exp Med 2002, 196(6): 817-827.  64. Edelson BT, Kc W, Juang R, Kohyama M, Benoit LA, Klekotka PA, Moon C, Albring JC, Ise W, Michael DG, Bhattacharya D, Stappenbeck TS, Holtzman MJ, Sung SS, Murphy TL, Hildner K, Murphy KM. Peripheral CD103+ dendritic cells form a unified subset developmentally related to CD8alpha+ conventional dendritic cells. J Exp Med 2010, 207(4): 823-836.  65. Pooley JL, Heath WR, Shortman K. Cutting edge: intravenous soluble antigen is presented to CD4 T cells by CD8- dendritic cells, but cross-presented to CD8 T cells by CD8+ dendritic cells. J Immunol 2001, 166(9): 5327-5330.  66. Kronin V, Fitzmaurice CJ, Caminschi I, Shortman K, Jackson DC, Brown LE. Differential effect of CD8(+) and CD8(-) dendritic cells in the stimulation of secondary CD4(+) T cells. Int Immunol 2001, 13(4): 465-473.  67. Dudziak D, Kamphorst AO, Heidkamp GF, Buchholz VR, Trumpfheller C, Yamazaki S, Cheong C, Liu K, Lee HW, Park CG, Steinman RM, Nussenzweig MC. Differential antigen processing by dendritic cell subsets in vivo. Science 2007, 315(5808): 107-111.  68. Grainger JR, Askenase MH, Guimont-Desrochers F, da Fonseca DM, Belkaid Y. Contextual functions of antigen-presenting cells in the gastrointestinal tract. Immunol Rev 2014, 259(1): 75-87.  69. Bekiaris V, Persson EK, Agace WW. Intestinal dendritic cells in the regulation of mucosal immunity. Immunol Rev 2014, 260(1): 86-101.  70. Haniffa M, Collin M, Ginhoux F. Ontogeny and functional specialization of dendritic cells in human and mouse. Adv Immunol 2013, 120: 1-49.  71. Karsunky H, Merad M, Cozzio A, Weissman IL, Manz MG. Flt3 ligand regulates dendritic cell development from Flt3+ lymphoid and myeloid-committed progenitors to Flt3+ dendritic cells in vivo. J Exp Med 2003, 198(2): 305-313.  72. Greter M, Helft J, Chow A, Hashimoto D, Mortha A, Agudo-Cantero J, Bogunovic M, Gautier EL, Miller J, Leboeuf M, Lu G, Aloman C, Brown BD, Pollard JW, Xiong H, Randolph GJ, Chipuk JE, Frenette PS, Merad M. GM-CSF controls nonlymphoid tissue dendritic cell homeostasis but is dispensable for the differentiation of inflammatory dendritic cells. Immunity 2012, 36(6): 1031-1046.  73. Lewis KL, Caton ML, Bogunovic M, Greter M, Grajkowska LT, Ng D, Klinakis A, Charo IF, Jung S, Gommerman JL, Ivanov, II, Liu K, Merad M, Reizis B. Notch2   173 receptor signaling controls functional differentiation of dendritic cells in the spleen and intestine. Immunity 2011, 35(5): 780-791.  74. Persson EK, Uronen-Hansson H, Semmrich M, Rivollier A, Hagerbrand K, Marsal J, Gudjonsson S, Hakansson U, Reizis B, Kotarsky K, Agace WW. IRF4 transcription-factor-dependent CD103(+)CD11b(+) dendritic cells drive mucosal T helper 17 cell differentiation. Immunity 2013, 38(5): 958-969.  75. Schlitzer A, McGovern N, Teo P, Zelante T, Atarashi K, Low D, Ho AW, See P, Shin A, Wasan PS, Hoeffel G, Malleret B, Heiseke A, Chew S, Jardine L, Purvis HA, Hilkens CM, Tam J, Poidinger M, Stanley ER, Krug AB, Renia L, Sivasankar B, Ng LG, Collin M, Ricciardi-Castagnoli P, Honda K, Haniffa M, Ginhoux F. IRF4 transcription factor-dependent CD11b+ dendritic cells in human and mouse control mucosal IL-17 cytokine responses. Immunity 2013, 38(5): 970-983.  76. Schulz O, Jaensson E, Persson EK, Liu X, Worbs T, Agace WW, Pabst O. Intestinal CD103+, but not CX3CR1+, antigen sampling cells migrate in lymph and serve classical dendritic cell functions. J Exp Med 2009, 206(13): 3101-3114.  77. Worbs T, Bode U, Yan S, Hoffmann MW, Hintzen G, Bernhardt G, Forster R, Pabst O. Oral tolerance originates in the intestinal immune system and relies on antigen carriage by dendritic cells. J Exp Med 2006, 203(3): 519-527.  78. Johansson-Lindbom B, Svensson M, Pabst O, Palmqvist C, Marquez G, Forster R, Agace WW. Functional specialization of gut CD103+ dendritic cells in the regulation of tissue-selective T cell homing. J Exp Med 2005, 202(8): 1063-1073.  79. Cerovic V, Houston SA, Scott CL, Aumeunier A, Yrlid U, Mowat AM, Milling SW. Intestinal CD103(-) dendritic cells migrate in lymph and prime effector T cells. Mucosal Immunol 2013, 6(1): 104-113.  80. Scott CL, Bain CC, Wright PB, Sichien D, Kotarsky K, Persson EK, Luda K, Guilliams M, Lambrecht BN, Agace WW, Milling SW, Mowat AM. CCR2(+)CD103(-) intestinal dendritic cells develop from DC-committed precursors and induce interleukin-17 production by T cells. Mucosal Immunol 2015, 8(2): 327-339.  81. Langlet C, Tamoutounour S, Henri S, Luche H, Ardouin L, Gregoire C, Malissen B, Guilliams M. CD64 expression distinguishes monocyte-derived and conventional dendritic cells and reveals their distinct role during intramuscular immunization. J Immunol 2012, 188(4): 1751-1760.  82. Plantinga M, Guilliams M, Vanheerswynghels M, Deswarte K, Branco-Madeira F, Toussaint W, Vanhoutte L, Neyt K, Killeen N, Malissen B, Hammad H, Lambrecht BN. Conventional and monocyte-derived CD11b(+) dendritic cells initiate and   174 maintain T helper 2 cell-mediated immunity to house dust mite allergen. Immunity 2013, 38(2): 322-335.  83. Tamoutounour S, Henri S, Lelouard H, de Bovis B, de Haar C, van der Woude CJ, Woltman AM, Reyal Y, Bonnet D, Sichien D, Bain CC, Mowat AM, Reis e Sousa C, Poulin LF, Malissen B, Guilliams M. CD64 distinguishes macrophages from dendritic cells in the gut and reveals the Th1-inducing role of mesenteric lymph node macrophages during colitis. Eur J Immunol 2012, 42(12): 3150-3166.  84. Rivollier A, He J, Kole A, Valatas V, Kelsall BL. Inflammation switches the differentiation program of Ly6Chi monocytes from antiinflammatory macrophages to inflammatory dendritic cells in the colon. J Exp Med 2012, 209(1): 139-155.  85. Zigmond E, Varol C, Farache J, Elmaliah E, Satpathy AT, Friedlander G, Mack M, Shpigel N, Boneca IG, Murphy KM, Shakhar G, Halpern Z, Jung S. Ly6C hi monocytes in the inflamed colon give rise to proinflammatory effector cells and migratory antigen-presenting cells. Immunity 2012, 37(6): 1076-1090.  86. Spits H, Di Santo JP. The expanding family of innate lymphoid cells: regulators and effectors of immunity and tissue remodeling. Nat Immunol 2011, 12(1): 21-27.  87. Spits H, Artis D, Colonna M, Diefenbach A, Di Santo JP, Eberl G, Koyasu S, Locksley RM, McKenzie AN, Mebius RE, Powrie F, Vivier E. Innate lymphoid cells--a proposal for uniform nomenclature. Nat Rev Immunol 2013, 13(2): 145-149.  88. Kiessling R, Klein E, Wigzell H. "Natural" killer cells in the mouse. I. Cytotoxic cells with specificity for mouse Moloney leukemia cells. Specificity and distribution according to genotype. Eur J Immunol 1975, 5(2): 112-117.  89. Mebius RE, Rennert P, Weissman IL. Developing lymph nodes collect CD4+CD3- LTbeta+ cells that can differentiate to APC, NK cells, and follicular cells but not T or B cells. Immunity 1997, 7(4): 493-504.  90. Klose CS, Flach M, Mohle L, Rogell L, Hoyler T, Ebert K, Fabiunke C, Pfeifer D, Sexl V, Fonseca-Pereira D, Domingues RG, Veiga-Fernandes H, Arnold SJ, Busslinger M, Dunay IR, Tanriver Y, Diefenbach A. Differentiation of type 1 ILCs from a common progenitor to all helper-like innate lymphoid cell lineages. Cell 2014, 157(2): 340-356.  91. Cherrier M, Sawa S, Eberl G. Notch, Id2, and RORgammat sequentially orchestrate the fetal development of lymphoid tissue inducer cells. J Exp Med 2012, 209(4): 729-740.    175 92. Possot C, Schmutz S, Chea S, Boucontet L, Louise A, Cumano A, Golub R. Notch signaling is necessary for adult, but not fetal, development of RORgammat(+) innate lymphoid cells. Nat Immunol 2011, 12(10): 949-958.  93. Constantinides MG, McDonald BD, Verhoef PA, Bendelac A. A committed precursor to innate lymphoid cells. Nature 2014, 508(7496): 397-401.  94. Fuchs A, Vermi W, Lee JS, Lonardi S, Gilfillan S, Newberry RD, Cella M, Colonna M. Intraepithelial type 1 innate lymphoid cells are a unique subset of IL-12- and IL-15-responsive IFN-gamma-producing cells. Immunity 2013, 38(4): 769-781.  95. Bernink JH, Peters CP, Munneke M, te Velde AA, Meijer SL, Weijer K, Hreggvidsdottir HS, Heinsbroek SE, Legrand N, Buskens CJ, Bemelman WA, Mjosberg JM, Spits H. Human type 1 innate lymphoid cells accumulate in inflamed mucosal tissues. Nat Immunol 2013, 14(3): 221-229.  96. Klose CS, Kiss EA, Schwierzeck V, Ebert K, Hoyler T, d'Hargues Y, Goppert N, Croxford AL, Waisman A, Tanriver Y, Diefenbach A. A T-bet gradient controls the fate and function of CCR6-RORgammat+ innate lymphoid cells. Nature 2013, 494(7436): 261-265.  97. Hoyler T, Klose CS, Souabni A, Turqueti-Neves A, Pfeifer D, Rawlins EL, Voehringer D, Busslinger M, Diefenbach A. The transcription factor GATA-3 controls cell fate and maintenance of type 2 innate lymphoid cells. Immunity 2012, 37(4): 634-648.  98. Klein Wolterink RG, Serafini N, van Nimwegen M, Vosshenrich CA, de Bruijn MJ, Fonseca Pereira D, Veiga Fernandes H, Hendriks RW, Di Santo JP. Essential, dose-dependent role for the transcription factor Gata3 in the development of IL-5+ and IL-13+ type 2 innate lymphoid cells. Proc Natl Acad Sci U S A 2013, 110(25): 10240-10245.  99. Mjosberg J, Bernink J, Golebski K, Karrich JJ, Peters CP, Blom B, te Velde AA, Fokkens WJ, van Drunen CM, Spits H. The transcription factor GATA3 is essential for the function of human type 2 innate lymphoid cells. Immunity 2012, 37(4): 649-659.  100. Moro K, Yamada T, Tanabe M, Takeuchi T, Ikawa T, Kawamoto H, Furusawa J, Ohtani M, Fujii H, Koyasu S. Innate production of T(H)2 cytokines by adipose tissue-associated c-Kit(+)Sca-1(+) lymphoid cells. Nature 2010, 463(7280): 540-544.  101. Neill DR, Wong SH, Bellosi A, Flynn RJ, Daly M, Langford TK, Bucks C, Kane CM, Fallon PG, Pannell R, Jolin HE, McKenzie AN. Nuocytes represent a new innate effector leukocyte that mediates type-2 immunity. Nature 2010, 464(7293): 1367-1370.   176  102. Price AE, Liang HE, Sullivan BM, Reinhardt RL, Eisley CJ, Erle DJ, Locksley RM. Systemically dispersed innate IL-13-expressing cells in type 2 immunity. Proc Natl Acad Sci U S A 2010, 107(25): 11489-11494.  103. Mjosberg JM, Trifari S, Crellin NK, Peters CP, van Drunen CM, Piet B, Fokkens WJ, Cupedo T, Spits H. Human IL-25- and IL-33-responsive type 2 innate lymphoid cells are defined by expression of CRTH2 and CD161. Nat Immunol 2011, 12(11): 1055-1062.  104. Monticelli LA, Sonnenberg GF, Abt MC, Alenghat T, Ziegler CG, Doering TA, Angelosanto JM, Laidlaw BJ, Yang CY, Sathaliyawala T, Kubota M, Turner D, Diamond JM, Goldrath AW, Farber DL, Collman RG, Wherry EJ, Artis D. Innate lymphoid cells promote lung-tissue homeostasis after infection with influenza virus. Nat Immunol 2011, 12(11): 1045-1054.  105. Wilhelm C, Hirota K, Stieglitz B, Van Snick J, Tolaini M, Lahl K, Sparwasser T, Helmby H, Stockinger B. An IL-9 fate reporter demonstrates the induction of an innate IL-9 response in lung inflammation. Nat Immunol 2011, 12(11): 1071-1077.  106. Sun Z, Unutmaz D, Zou YR, Sunshine MJ, Pierani A, Brenner-Morton S, Mebius RE, Littman DR. Requirement for RORgamma in thymocyte survival and lymphoid organ development. Science 2000, 288(5475): 2369-2373.  107. Satoh-Takayama N, Vosshenrich CA, Lesjean-Pottier S, Sawa S, Lochner M, Rattis F, Mention JJ, Thiam K, Cerf-Bensussan N, Mandelboim O, Eberl G, Di Santo JP. Microbial flora drives interleukin 22 production in intestinal NKp46+ cells that provide innate mucosal immune defense. Immunity 2008, 29(6): 958-970.  108. Eberl G, Marmon S, Sunshine MJ, Rennert PD, Choi Y, Littman DR. An essential function for the nuclear receptor RORgamma(t) in the generation of fetal lymphoid tissue inducer cells. Nat Immunol 2004, 5(1): 64-73.  109. Cella M, Fuchs A, Vermi W, Facchetti F, Otero K, Lennerz JK, Doherty JM, Mills JC, Colonna M. A human natural killer cell subset provides an innate source of IL-22 for mucosal immunity. Nature 2009, 457(7230): 722-725.  110. Cupedo T, Crellin NK, Papazian N, Rombouts EJ, Weijer K, Grogan JL, Fibbe WE, Cornelissen JJ, Spits H. Human fetal lymphoid tissue-inducer cells are interleukin 17-producing precursors to RORC+ CD127+ natural killer-like cells. Nat Immunol 2009, 10(1): 66-74.  111. Sonnenberg GF, Monticelli LA, Elloso MM, Fouser LA, Artis D. CD4(+) lymphoid tissue-inducer cells promote innate immunity in the gut. Immunity 2011, 34(1): 122-134.   177  112. Mortha A, Chudnovskiy A, Hashimoto D, Bogunovic M, Spencer SP, Belkaid Y, Merad M. Microbiota-dependent crosstalk between macrophages and ILC3 promotes intestinal homeostasis. Science 2014, 343(6178): 1249288.  113. Cella M, Otero K, Colonna M. Expansion of human NK-22 cells with IL-7, IL-2, and IL-1beta reveals intrinsic functional plasticity. Proc Natl Acad Sci U S A 2010, 107(24): 10961-10966.  114. Kiss EA, Vonarbourg C, Kopfmann S, Hobeika E, Finke D, Esser C, Diefenbach A. Natural aryl hydrocarbon receptor ligands control organogenesis of intestinal lymphoid follicles. Science 2011, 334(6062): 1561-1565.  115. Lee JS, Cella M, McDonald KG, Garlanda C, Kennedy GD, Nukaya M, Mantovani A, Kopan R, Bradfield CA, Newberry RD, Colonna M. AHR drives the development of gut ILC22 cells and postnatal lymphoid tissues via pathways dependent on and independent of Notch. Nat Immunol 2012, 13(2): 144-151.  116. Vonarbourg C, Mortha A, Bui VL, Hernandez PP, Kiss EA, Hoyler T, Flach M, Bengsch B, Thimme R, Holscher C, Honig M, Pannicke U, Schwarz K, Ware CF, Finke D, Diefenbach A. Regulated expression of nuclear receptor RORgammat confers distinct functional fates to NK cell receptor-expressing RORgammat(+) innate lymphocytes. Immunity 2010, 33(5): 736-751.  117. Rankin LC, Groom JR, Chopin M, Herold MJ, Walker JA, Mielke LA, McKenzie AN, Carotta S, Nutt SL, Belz GT. The transcription factor T-bet is essential for the development of NKp46+ innate lymphocytes via the Notch pathway. Nat Immunol 2013, 14(4): 389-395.  118. Artis D. Epithelial-cell recognition of commensal bacteria and maintenance of immune homeostasis in the gut. Nat Rev Immunol 2008, 8(6): 411-420.  119. Macpherson AJ, Harris NL. Interactions between commensal intestinal bacteria and the immune system. Nat Rev Immunol 2004, 4(6): 478-485.  120. The Impact of Inflammatory Bowel Disease (IBD) in Canada. Report by Crohn's and Colitis Foundation of Canada 2012.  121. Williams H, Walker D, Orchard TR. Extraintestinal manifestations of inflammatory bowel disease. Curr Gastroenterol Rep 2008, 10(6): 597-605.  122. Khor B, Gardet A, Xavier RJ. Genetics and pathogenesis of inflammatory bowel disease. Nature 2011, 474(7351): 307-317.    178 123. Abreu MT. Toll-like receptor signalling in the intestinal epithelium: how bacterial recognition shapes intestinal function. Nat Rev Immunol 2010, 10(2): 131-144.  124. Chow J, Lee SM, Shen Y, Khosravi A, Mazmanian SK. Host-bacterial symbiosis in health and disease. Adv Immunol 2010, 107: 243-274.  125. De Jager PL, Franchimont D, Waliszewska A, Bitton A, Cohen A, Langelier D, Belaiche J, Vermeire S, Farwell L, Goris A, Libioulle C, Jani N, Dassopoulos T, Bromfield GP, Dubois B, Cho JH, Brant SR, Duerr RH, Yang H, Rotter JI, Silverberg MS, Steinhart AH, Daly MJ, Podolsky DK, Louis E, Hafler DA, Rioux JD. The role of the Toll receptor pathway in susceptibility to inflammatory bowel diseases. Genes Immun 2007, 8(5): 387-397.  126. Vijay-Kumar M, Sanders CJ, Taylor RT, Kumar A, Aitken JD, Sitaraman SV, Neish AS, Uematsu S, Akira S, Williams IR, Gewirtz AT. Deletion of TLR5 results in spontaneous colitis in mice. J Clin Invest 2007, 117(12): 3909-3921.  127. Rakoff-Nahoum S, Paglino J, Eslami-Varzaneh F, Edberg S, Medzhitov R. Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell 2004, 118(2): 229-241.  128. Araki A, Kanai T, Ishikura T, Makita S, Uraushihara K, Iiyama R, Totsuka T, Takeda K, Akira S, Watanabe M. MyD88-deficient mice develop severe intestinal inflammation in dextran sodium sulfate colitis. J Gastroenterol 2005, 40(1): 16-23.  129. Maeda S, Hsu LC, Liu H, Bankston LA, Iimura M, Kagnoff MF, Eckmann L, Karin M. Nod2 mutation in Crohn's disease potentiates NF-kappaB activity and IL-1beta processing. Science 2005, 307(5710): 734-738.  130. Asquith M, Powrie F. An innately dangerous balancing act: intestinal homeostasis, inflammation, and colitis-associated cancer. J Exp Med 2010, 207(8): 1573-1577.  131. Kuhn R, Lohler J, Rennick D, Rajewsky K, Muller W. Interleukin-10-deficient mice develop chronic enterocolitis. Cell 1993, 75(2): 263-274.  132. Rakoff-Nahoum S, Hao L, Medzhitov R. Role of toll-like receptors in spontaneous commensal-dependent colitis. Immunity 2006, 25(2): 319-329.  133. Sellon RK, Tonkonogy S, Schultz M, Dieleman LA, Grenther W, Balish E, Rennick DM, Sartor RB. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun 1998, 66(11): 5224-5231.    179 134. Asquith MJ, Boulard O, Powrie F, Maloy KJ. Pathogenic and protective roles of MyD88 in leukocytes and epithelial cells in mouse models of inflammatory bowel disease. Gastroenterology 2010, 139(2): 519-529, 529 e511-512.  135. Perencevich M, Burakoff R. Use of antibiotics in the treatment of inflammatory bowel disease. Inflamm Bowel Dis 2006, 12(7): 651-664.  136. Rutgeerts P, Goboes K, Peeters M, Hiele M, Penninckx F, Aerts R, Kerremans R, Vantrappen G. Effect of faecal stream diversion on recurrence of Crohn's disease in the neoterminal ileum. Lancet 1991, 338(8770): 771-774.  137. Kabat AM, Srinivasan N, Maloy KJ. Modulation of immune development and function by intestinal microbiota. Trends Immunol 2014, 35(11): 507-517.  138. Round JL, Mazmanian SK. The gut microbiota shapes intestinal immune responses during health and disease. Nat Rev Immunol 2009, 9(5): 313-323.  139. Kamada N, Nunez G. Role of the gut microbiota in the development and function of lymphoid cells. J Immunol 2013, 190(4): 1389-1395.  140. Round JL, Mazmanian SK. Inducible Foxp3+ regulatory T-cell development by a commensal bacterium of the intestinal microbiota. Proc Natl Acad Sci U S A 2010, 107(27): 12204-12209.  141. Atarashi K, Tanoue T, Shima T, Imaoka A, Kuwahara T, Momose Y, Cheng G, Yamasaki S, Saito T, Ohba Y, Taniguchi T, Takeda K, Hori S, Ivanov, II, Umesaki Y, Itoh K, Honda K. Induction of colonic regulatory T cells by indigenous Clostridium species. Science 2011, 331(6015): 337-341.  142. Atarashi K, Tanoue T, Oshima K, Suda W, Nagano Y, Nishikawa H, Fukuda S, Saito T, Narushima S, Hase K, Kim S, Fritz JV, Wilmes P, Ueha S, Matsushima K, Ohno H, Olle B, Sakaguchi S, Taniguchi T, Morita H, Hattori M, Honda K. Treg induction by a rationally selected mixture of Clostridia strains from the human microbiota. Nature 2013, 500(7461): 232-236.  143. Shen Y, Giardino Torchia ML, Lawson GW, Karp CL, Ashwell JD, Mazmanian SK. Outer membrane vesicles of a human commensal mediate immune regulation and disease protection. Cell Host Microbe 2012, 12(4): 509-520.  144. Dasgupta S, Erturk-Hasdemir D, Ochoa-Reparaz J, Reinecker HC, Kasper DL. Plasmacytoid dendritic cells mediate anti-inflammatory responses to a gut commensal molecule via both innate and adaptive mechanisms. Cell Host Microbe 2014, 15(4): 413-423.    180 145. Mazmanian SK, Liu CH, Tzianabos AO, Kasper DL. An immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell 2005, 122(1): 107-118.  146. Furusawa Y, Obata Y, Fukuda S, Endo TA, Nakato G, Takahashi D, Nakanishi Y, Uetake C, Kato K, Kato T, Takahashi M, Fukuda NN, Murakami S, Miyauchi E, Hino S, Atarashi K, Onawa S, Fujimura Y, Lockett T, Clarke JM, Topping DL, Tomita M, Hori S, Ohara O, Morita T, Koseki H, Kikuchi J, Honda K, Hase K, Ohno H. Commensal microbe-derived butyrate induces the differentiation of colonic regulatory T cells. Nature 2013, 504(7480): 446-450.  147. Arpaia N, Campbell C, Fan X, Dikiy S, van der Veeken J, deRoos P, Liu H, Cross JR, Pfeffer K, Coffer PJ, Rudensky AY. Metabolites produced by commensal bacteria promote peripheral regulatory T-cell generation. Nature 2013, 504(7480): 451-455.  148. Zelante T, Iannitti RG, Cunha C, De Luca A, Giovannini G, Pieraccini G, Zecchi R, D'Angelo C, Massi-Benedetti C, Fallarino F, Carvalho A, Puccetti P, Romani L. Tryptophan catabolites from microbiota engage aryl hydrocarbon receptor and balance mucosal reactivity via interleukin-22. Immunity 2013, 39(2): 372-385.  149. Schnupf P, Gaboriau-Routhiau V, Cerf-Bensussan N. Host interactions with Segmented Filamentous Bacteria: an unusual trade-off that drives the post-natal maturation of the gut immune system. Semin Immunol 2013, 25(5): 342-351.  150. Lecuyer E, Rakotobe S, Lengline-Garnier H, Lebreton C, Picard M, Juste C, Fritzen R, Eberl G, McCoy KD, Macpherson AJ, Reynaud CA, Cerf-Bensussan N, Gaboriau-Routhiau V. Segmented filamentous bacterium uses secondary and tertiary lymphoid tissues to induce gut IgA and specific T helper 17 cell responses. Immunity 2014, 40(4): 608-620.  151. Ivanov, II, Atarashi K, Manel N, Brodie EL, Shima T, Karaoz U, Wei D, Goldfarb KC, Santee CA, Lynch SV, Tanoue T, Imaoka A, Itoh K, Takeda K, Umesaki Y, Honda K, Littman DR. Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 2009, 139(3): 485-498.  152. Goto Y, Panea C, Nakato G, Cebula A, Lee C, Diez MG, Laufer TM, Ignatowicz L, Ivanov, II. Segmented filamentous bacteria antigens presented by intestinal dendritic cells drive mucosal Th17 cell differentiation. Immunity 2014, 40(4): 594-607.  153. Ivanov, II, Frutos Rde L, Manel N, Yoshinaga K, Rifkin DB, Sartor RB, Finlay BB, Littman DR. Specific microbiota direct the differentiation of IL-17-producing T-helper cells in the mucosa of the small intestine. Cell Host Microbe 2008, 4(4): 337-349.    181 154. Pene J, Chevalier S, Preisser L, Venereau E, Guilleux MH, Ghannam S, Moles JP, Danger Y, Ravon E, Lesaux S, Yssel H, Gascan H. Chronically inflamed human tissues are infiltrated by highly differentiated Th17 lymphocytes. J Immunol 2008, 180(11): 7423-7430.  155. Wu HJ, Ivanov, II, Darce J, Hattori K, Shima T, Umesaki Y, Littman DR, Benoist C, Mathis D. Gut-residing segmented filamentous bacteria drive autoimmune arthritis via T helper 17 cells. Immunity 2010, 32(6): 815-827.  156. Lee YK, Menezes JS, Umesaki Y, Mazmanian SK. Proinflammatory T-cell responses to gut microbiota promote experimental autoimmune encephalomyelitis. Proc Natl Acad Sci U S A 2011, 108 Suppl 1: 4615-4622.  157. Kuwahara T, Ogura Y, Oshima K, Kurokawa K, Ooka T, Hirakawa H, Itoh T, Nakayama-Imaohji H, Ichimura M, Itoh K, Ishifune C, Maekawa Y, Yasutomo K, Hattori M, Hayashi T. The lifestyle of the segmented filamentous bacterium: a non-culturable gut-associated immunostimulating microbe inferred by whole-genome sequencing. DNA research : an international journal for rapid publication of reports on genes and genomes 2011, 18(4): 291-303.  158. Sczesnak A, Segata N, Qin X, Gevers D, Petrosino JF, Huttenhower C, Littman DR, Ivanov, II. The genome of th17 cell-inducing segmented filamentous bacteria reveals extensive auxotrophy and adaptations to the intestinal environment. Cell Host Microbe 2011, 10(3): 260-272.  159. Prakash T, Oshima K, Morita H, Fukuda S, Imaoka A, Kumar N, Sharma VK, Kim SW, Takahashi M, Saitou N, Taylor TD, Ohno H, Umesaki Y, Hattori M. Complete genome sequences of rat and mouse segmented filamentous bacteria, a potent inducer of th17 cell differentiation. Cell Host Microbe 2011, 10(3): 273-284.  160. Yang Y, Torchinsky MB, Gobert M, Xiong H, Xu M, Linehan JL, Alonzo F, Ng C, Chen A, Lin X, Sczesnak A, Liao JJ, Torres VJ, Jenkins MK, Lafaille JJ, Littman DR. Focused specificity of intestinal TH17 cells towards commensal bacterial antigens. Nature 2014, 510(7503): 152-156.  161. Vaishnava S, Behrendt CL, Ismail AS, Eckmann L, Hooper LV. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A 2008, 105(52): 20858-20863.  162. Qiu J, Guo X, Chen ZM, He L, Sonnenberg GF, Artis D, Fu YX, Zhou L. Group 3 innate lymphoid cells inhibit T-cell-mediated intestinal inflammation through aryl hydrocarbon receptor signaling and regulation of microflora. Immunity 2013, 39(2): 386-399.    182 163. Suzuki K, Meek B, Doi Y, Muramatsu M, Chiba T, Honjo T, Fagarasan S. Aberrant expansion of segmented filamentous bacteria in IgA-deficient gut. Proc Natl Acad Sci U S A 2004, 101(7): 1981-1986.  164. Kubinak JL, Petersen C, Stephens WZ, Soto R, Bake E, O'Connell RM, Round JL. MyD88 Signaling in T Cells Directs IgA-Mediated Control of the Microbiota to Promote Health. Cell Host Microbe 2015, 17(2): 153-163.  165. Baumgart DC, Thomas S, Przesdzing I, Metzke D, Bielecki C, Lehmann SM, Lehnardt S, Dorffel Y, Sturm A, Scheffold A, Schmitz J, Radbruch A. Exaggerated inflammatory response of primary human myeloid dendritic cells to lipopolysaccharide in patients with inflammatory bowel disease. Clin Exp Immunol 2009, 157(3): 423-436.  166. Feng T, Wang L, Schoeb TR, Elson CO, Cong Y. Microbiota innate stimulation is a prerequisite for T cell spontaneous proliferation and induction of experimental colitis. J Exp Med 2010, 207(6): 1321-1332.  167. Abe K, Nguyen KP, Fine SD, Mo JH, Shen C, Shenouda S, Corr M, Jung S, Lee J, Eckmann L, Raz E. Conventional dendritic cells regulate the outcome of colonic inflammation independently of T cells. Proc Natl Acad Sci U S A 2007, 104(43): 17022-17027.  168. Denning TL, Norris BA, Medina-Contreras O, Manicassamy S, Geem D, Madan R, Karp CL, Pulendran B. Functional specializations of intestinal dendritic cell and macrophage subsets that control Th17 and regulatory T cell responses are dependent on the T cell/APC ratio, source of mouse strain, and regional localization. J Immunol 2011, 187(2): 733-747.  169. Manicassamy S, Reizis B, Ravindran R, Nakaya H, Salazar-Gonzalez RM, Wang YC, Pulendran B. Activation of beta-catenin in dendritic cells regulates immunity versus tolerance in the intestine. Science 2010, 329(5993): 849-853.  170. Coombes JL, Siddiqui KR, Arancibia-Carcamo CV, Hall J, Sun CM, Belkaid Y, Powrie F. A functionally specialized population of mucosal CD103+ DCs induces Foxp3+ regulatory T cells via a TGF-beta and retinoic acid-dependent mechanism. J Exp Med 2007, 204(8): 1757-1764.  171. Jaensson E, Uronen-Hansson H, Pabst O, Eksteen B, Tian J, Coombes JL, Berg PL, Davidsson T, Powrie F, Johansson-Lindbom B, Agace WW. Small intestinal CD103+ dendritic cells display unique functional properties that are conserved between mice and humans. J Exp Med 2008, 205(9): 2139-2149.    183 172. Takeda K, Clausen BE, Kaisho T, Tsujimura T, Terada N, Forster I, Akira S. Enhanced Th1 activity and development of chronic enterocolitis in mice devoid of Stat3 in macrophages and neutrophils. Immunity 1999, 10(1): 39-49.  173. Denning TL, Wang YC, Patel SR, Williams IR, Pulendran B. Lamina propria macrophages and dendritic cells differentially induce regulatory and interleukin 17-producing T cell responses. Nat Immunol 2007, 8(10): 1086-1094.  174. Fortin G, Raymond M, Van VQ, Rubio M, Gautier P, Sarfati M, Franchimont D. A role for CD47 in the development of experimental colitis mediated by SIRPalpha+CD103- dendritic cells. J Exp Med 2009, 206(9): 1995-2011.  175. Atarashi K, Nishimura J, Shima T, Umesaki Y, Yamamoto M, Onoue M, Yagita H, Ishii N, Evans R, Honda K, Takeda K. ATP drives lamina propria T(H)17 cell differentiation. Nature 2008, 455(7214): 808-812.  176. Strauch UG, Grunwald N, Obermeier F, Gurster S, Rath HC. Loss of CD103+ intestinal dendritic cells during colonic inflammation. World J Gastroenterol 2011, 16(1): 21-29.  177. Laffont S, Siddiqui KR, Powrie F. Intestinal inflammation abrogates the tolerogenic properties of MLN CD103+ dendritic cells. Eur J Immunol 2010, 40(7): 1877-1883.  178. Siddiqui KR, Laffont S, Powrie F. E-cadherin marks a subset of inflammatory dendritic cells that promote T cell-mediated colitis. Immunity 2010, 32(4): 557-567.  179. Rutella S, Locatelli F. Intestinal dendritic cells in the pathogenesis of inflammatory bowel disease. World J Gastroenterol 2011, 17(33): 3761-3775.  180. Platt AM, Bain CC, Bordon Y, Sester DP, Mowat AM. An independent subset of TLR expressing CCR2-dependent macrophages promotes colonic inflammation. J Immunol 2010, 184(12): 6843-6854.  181. Weber B, Saurer L, Schenk M, Dickgreber N, Mueller C. CX3CR1 defines functionally distinct intestinal mononuclear phagocyte subsets which maintain their respective functions during homeostatic and inflammatory conditions. Eur J Immunol 2011, 41(3): 773-779.  182. van Wijk F, Cheroutre H. Intestinal T cells: facing the mucosal immune dilemma with synergy and diversity. Semin Immunol 2009, 21(3): 130-138.  183. Fujino S, Andoh A, Bamba S, Ogawa A, Hata K, Araki Y, Bamba T, Fujiyama Y. Increased expression of interleukin 17 in inflammatory bowel disease. Gut 2003, 52(1): 65-70.    184 184. Nielsen OH, Kirman I, Rudiger N, Hendel J, Vainer B. Upregulation of interleukin-12 and -17 in active inflammatory bowel disease. Scand J Gastroenterol 2003, 38(2): 180-185.  185. Duerr RH, Taylor KD, Brant SR, Rioux JD, Silverberg MS, Daly MJ, Steinhart AH, Abraham C, Regueiro M, Griffiths A, Dassopoulos T, Bitton A, Yang H, Targan S, Datta LW, Kistner EO, Schumm LP, Lee AT, Gregersen PK, Barmada MM, Rotter JI, Nicolae DL, Cho JH. A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science 2006, 314(5804): 1461-1463.  186. Ivanov, II, McKenzie BS, Zhou L, Tadokoro CE, Lepelley A, Lafaille JJ, Cua DJ, Littman DR. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell 2006, 126(6): 1121-1133.  187. Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, Stockinger B. TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity 2006, 24(2): 179-189.  188. Bettelli E, Carrier Y, Gao W, Korn T, Strom TB, Oukka M, Weiner HL, Kuchroo VK. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 2006, 441(7090): 235-238.  189. Korn T, Bettelli E, Gao W, Awasthi A, Jager A, Strom TB, Oukka M, Kuchroo VK. IL-21 initiates an alternative pathway to induce proinflammatory T(H)17 cells. Nature 2007, 448(7152): 484-487.  190. Nurieva R, Yang XO, Martinez G, Zhang Y, Panopoulos AD, Ma L, Schluns K, Tian Q, Watowich SS, Jetten AM, Dong C. Essential autocrine regulation by IL-21 in the generation of inflammatory T cells. Nature 2007, 448(7152): 480-483.  191. Langrish CL, Chen Y, Blumenschein WM, Mattson J, Basham B, Sedgwick JD, McClanahan T, Kastelein RA, Cua DJ. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med 2005, 201(2): 233-240.  192. Morrison PJ, Ballantyne SJ, Kullberg MC. Interleukin-23 and T helper 17-type responses in intestinal inflammation: from cytokines to T-cell plasticity. Immunology, 133(4): 397-408.  193. Izcue A, Hue S, Buonocore S, Arancibia-Carcamo CV, Ahern PP, Iwakura Y, Maloy KJ, Powrie F. Interleukin-23 restrains regulatory T cell activity to drive T cell-dependent colitis. Immunity 2008, 28(4): 559-570.  194. Ahern PP, Schiering C, Buonocore S, McGeachy MJ, Cua DJ, Maloy KJ, Powrie F. Interleukin-23 drives intestinal inflammation through direct activity on T cells. Immunity 2010, 33(2): 279-288.   185  195. Pickert G, Neufert C, Leppkes M, Zheng Y, Wittkopf N, Warntjen M, Lehr HA, Hirth S, Weigmann B, Wirtz S, Ouyang W, Neurath MF, Becker C. STAT3 links IL-22 signaling in intestinal epithelial cells to mucosal wound healing. J Exp Med 2009, 206(7): 1465-1472.  196. Sugimoto K, Ogawa A, Mizoguchi E, Shimomura Y, Andoh A, Bhan AK, Blumberg RS, Xavier RJ, Mizoguchi A. IL-22 ameliorates intestinal inflammation in a mouse model of ulcerative colitis. J Clin Invest 2008, 118(2): 534-544.  197. Kinugasa T, Sakaguchi T, Gu X, Reinecker HC. Claudins regulate the intestinal barrier in response to immune mediators. Gastroenterology 2000, 118(6): 1001-1011.  198. Ishigame H, Kakuta S, Nagai T, Kadoki M, Nambu A, Komiyama Y, Fujikado N, Tanahashi Y, Akitsu A, Kotaki H, Sudo K, Nakae S, Sasakawa C, Iwakura Y. Differential roles of interleukin-17A and -17F in host defense against mucoepithelial bacterial infection and allergic responses. Immunity 2009, 30(1): 108-119.  199. Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, Gong Q, Abbas AR, Modrusan Z, Ghilardi N, de Sauvage FJ, Ouyang W. Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med 2008, 14(3): 282-289.  200. Ogawa A, Andoh A, Araki Y, Bamba T, Fujiyama Y. Neutralization of interleukin-17 aggravates dextran sulfate sodium-induced colitis in mice. Clin Immunol 2004, 110(1): 55-62.  201. Yang XO, Chang SH, Park H, Nurieva R, Shah B, Acero L, Wang YH, Schluns KS, Broaddus RR, Zhu Z, Dong C. Regulation of inflammatory responses by IL-17F. J Exp Med 2008, 205(5): 1063-1075.  202. Zenewicz LA, Yancopoulos GD, Valenzuela DM, Murphy AJ, Stevens S, Flavell RA. Innate and adaptive interleukin-22 protects mice from inflammatory bowel disease. Immunity 2008, 29(6): 947-957.  203. Fina D, Sarra M, Fantini MC, Rizzo A, Caruso R, Caprioli F, Stolfi C, Cardolini I, Dottori M, Boirivant M, Pallone F, Macdonald TT, Monteleone G. Regulation of gut inflammation and th17 cell response by interleukin-21. Gastroenterology 2008, 134(4): 1038-1048.  204. Leppkes M, Becker C, Ivanov, II, Hirth S, Wirtz S, Neufert C, Pouly S, Murphy AJ, Valenzuela DM, Yancopoulos GD, Becher B, Littman DR, Neurath MF. RORgamma-expressing Th17 cells induce murine chronic intestinal inflammation via redundant effects of IL-17A and IL-17F. Gastroenterology 2009, 136(1): 257-267.    186 205. Iwakura Y, Ishigame H, Saijo S, Nakae S. Functional specialization of interleukin-17 family members. Immunity 2011, 34(2): 149-162.  206. Annunziato F, Cosmi L, Santarlasci V, Maggi L, Liotta F, Mazzinghi B, Parente E, Fili L, Ferri S, Frosali F, Giudici F, Romagnani P, Parronchi P, Tonelli F, Maggi E, Romagnani S. Phenotypic and functional features of human Th17 cells. J Exp Med 2007, 204(8): 1849-1861.  207. Kleinschek MA, Boniface K, Sadekova S, Grein J, Murphy EE, Turner SP, Raskin L, Desai B, Faubion WA, de Waal Malefyt R, Pierce RH, McClanahan T, Kastelein RA. Circulating and gut-resident human Th17 cells express CD161 and promote intestinal inflammation. J Exp Med 2009, 206(3): 525-534.  208. Nistala K, Adams S, Cambrook H, Ursu S, Olivito B, de Jager W, Evans JG, Cimaz R, Bajaj-Elliott M, Wedderburn LR. Th17 plasticity in human autoimmune arthritis is driven by the inflammatory environment. Proc Natl Acad Sci U S A 2010, 107(33): 14751-14756.  209. Kebir H, Ifergan I, Alvarez JI, Bernard M, Poirier J, Arbour N, Duquette P, Prat A. Preferential recruitment of interferon-gamma-expressing TH17 cells in multiple sclerosis. Annals of neurology 2009, 66(3): 390-402.  210. Morrison PJ, Bending D, Fouser LA, Wright JF, Stockinger B, Cooke A, Kullberg MC. Th17-cell plasticity in Helicobacter hepaticus-induced intestinal inflammation. Mucosal Immunol 2013, 6(6): 1143-1156.  211. Kullberg MC, Jankovic D, Feng CG, Hue S, Gorelick PL, McKenzie BS, Cua DJ, Powrie F, Cheever AW, Maloy KJ, Sher A. IL-23 plays a key role in Helicobacter hepaticus-induced T cell-dependent colitis. J Exp Med 2006, 203(11): 2485-2494.  212. Hirota K, Duarte JH, Veldhoen M, Hornsby E, Li Y, Cua DJ, Ahlfors H, Wilhelm C, Tolaini M, Menzel U, Garefalaki A, Potocnik AJ, Stockinger B. Fate mapping of IL-17-producing T cells in inflammatory responses. Nat Immunol 2011, 12(3): 255-263.  213. Wang Y, Godec J, Ben-Aissa K, Cui K, Zhao K, Pucsek AB, Lee YK, Weaver CT, Yagi R, Lazarevic V. The transcription factors T-bet and Runx are required for the ontogeny of pathogenic interferon-gamma-producing T helper 17 cells. Immunity 2014, 40(3): 355-366.  214. Duhen R, Glatigny S, Arbelaez CA, Blair TC, Oukka M, Bettelli E. Cutting edge: the pathogenicity of IFN-gamma-producing Th17 cells is independent of T-bet. J Immunol 2013, 190(9): 4478-4482.    187 215. Sanos SL, Bui VL, Mortha A, Oberle K, Heners C, Johner C, Diefenbach A. RORgammat and commensal microflora are required for the differentiation of mucosal interleukin 22-producing NKp46+ cells. Nat Immunol 2009, 10(1): 83-91.  216. Van Maele L, Carnoy C, Cayet D, Songhet P, Dumoutier L, Ferrero I, Janot L, Erard F, Bertout J, Leger H, Sebbane F, Benecke A, Renauld JC, Hardt WD, Ryffel B, Sirard JC. TLR5 signaling stimulates the innate production of IL-17 and IL-22 by CD3(neg)CD127+ immune cells in spleen and mucosa. J Immunol 2010, 185(2): 1177-1185.  217. Tumanov AV, Koroleva EP, Guo X, Wang Y, Kruglov A, Nedospasov S, Fu YX. Lymphotoxin controls the IL-22 protection pathway in gut innate lymphoid cells during mucosal pathogen challenge. Cell Host Microbe 2011, 10(1): 44-53.  218. Takatori H, Kanno Y, Watford WT, Tato CM, Weiss G, Ivanov, II, Littman DR, O'Shea JJ. Lymphoid tissue inducer-like cells are an innate source of IL-17 and IL-22. J Exp Med 2009, 206(1): 35-41.  219. Hepworth MR, Monticelli LA, Fung TC, Ziegler CG, Grunberg S, Sinha R, Mantegazza AR, Ma HL, Crawford A, Angelosanto JM, Wherry EJ, Koni PA, Bushman FD, Elson CO, Eberl G, Artis D, Sonnenberg GF. Innate lymphoid cells regulate CD4+ T-cell responses to intestinal commensal bacteria. Nature 2013, 498(7452): 113-117.  220. Buonocore S, Ahern PP, Uhlig HH, Ivanov, II, Littman DR, Maloy KJ, Powrie F. Innate lymphoid cells drive interleukin-23-dependent innate intestinal pathology. Nature 2010, 464(7293): 1371-1375.  221. Kinnebrew MA, Buffie CG, Diehl GE, Zenewicz LA, Leiner I, Hohl TM, Flavell RA, Littman DR, Pamer EG. Interleukin 23 production by intestinal CD103(+)CD11b(+) dendritic cells in response to bacterial flagellin enhances mucosal innate immune defense. Immunity 2012, 36(2): 276-287.  222. Crellin NK, Trifari S, Kaplan CD, Satoh-Takayama N, Di Santo JP, Spits H. Regulation of cytokine secretion in human CD127(+) LTi-like innate lymphoid cells by Toll-like receptor 2. Immunity 2010, 33(5): 752-764.  223. Bishop JL, Roberts ME, Beer JL, Huang M, Chehal MK, Fan X, Fouser LA, Ma HL, Bacani JT, Harder KW. Lyn activity protects mice from DSS colitis and regulates the production of IL-22 from innate lymphoid cells. Mucosal Immunol 2014, 7(2): 405-416.  224. Tsukita S, Oishi K, Akiyama T, Yamanashi Y, Yamamoto T. Specific proto-oncogenic tyrosine kinases of src family are enriched in cell-to-cell adherens   188 junctions where the level of tyrosine phosphorylation is elevated. J Cell Biol 1991, 113(4): 867-879.  225. Ikeda K, Nakayama Y, Togashi Y, Obata Y, Kuga T, Kasahara K, Fukumoto Y, Yamaguchi N. Nuclear localization of Lyn tyrosine kinase mediated by inhibition of its kinase activity. Exp Cell Res 2008, 314(18): 3392-3404.  226. Siyanova EY, Serfas MS, Mazo IA, Tyner AL. Tyrosine kinase gene expression in the mouse small intestine. Oncogene 1994, 9(7): 2053-2057.  227. Xu Y, Harder KW, Huntington ND, Hibbs ML, Tarlinton DM. Lyn tyrosine kinase: accentuating the positive and the negative. Immunity 2005, 22(1): 9-18.  228. Lowell CA. Src-family kinases: rheostats of immune cell signaling. Mol Immunol 2004, 41(6-7): 631-643.  229. Koch CA, Anderson D, Moran MF, Ellis C, Pawson T. SH2 and SH3 domains: elements that control interactions of cytoplasmic signaling proteins. Science 1991, 252(5006): 668-674.  230. Wang D, Esselman WJ, Cole PA. Substrate conformational restriction and CD45-catalyzed dephosphorylation of tail tyrosine-phosphorylated Src protein. J Biol Chem 2002, 277(43): 40428-40433.  231. Futami M, Zhu QS, Whichard ZL, Xia L, Ke Y, Neel BG, Feng GS, Corey SJ. G-CSF receptor activation of the Src kinase Lyn is mediated by Gab2 recruitment of the Shp2 phosphatase. Blood 2011, 118(4): 1077-1086.  232. Xu W, Doshi A, Lei M, Eck MJ, Harrison SC. Crystal structures of c-Src reveal features of its autoinhibitory mechanism. Molecular cell 1999, 3(5): 629-638.  233. Somani AK, Yuen K, Xu F, Zhang J, Branch DR, Siminovitch KA. The SH2 domain containing tyrosine phosphatase-1 down-regulates activation of Lyn and Lyn-induced tyrosine phosphorylation of the CD19 receptor in B cells. J Biol Chem 2001, 276(3): 1938-1944.  234. Okada M, Nada S, Yamanashi Y, Yamamoto T, Nakagawa H. CSK: a protein-tyrosine kinase involved in regulation of src family kinases. J Biol Chem 1991, 266(36): 24249-24252.  235. Ingley E. Src family kinases: regulation of their activities, levels and identification of new pathways. Biochimica et biophysica acta 2008, 1784(1): 56-65.    189 236. Luciano F, Herrant M, Jacquel A, Ricci JE, Auberger P. The p54 cleaved form of the tyrosine kinase Lyn generated by caspases during BCR-induced cell death in B lymphoma acts as a negative regulator of apoptosis. FASEB J 2003, 17(6): 711-713.  237. Marchetti S, Gamas P, Belhacene N, Grosso S, Pradelli LA, Colosetti P, Johansen C, Iversen L, Deckert M, Luciano F, Hofman P, Ortonne N, Khemis A, Mari B, Ortonne JP, Ricci JE, Auberger P. The caspase-cleaved form of LYN mediates a psoriasis-like inflammatory syndrome in mice. EMBO J 2009, 28(16): 2449-2460.  238. Luciano F, Ricci JE, Auberger P. Cleavage of Fyn and Lyn in their N-terminal unique regions during induction of apoptosis: a new mechanism for Src kinase regulation. Oncogene 2001, 20(36): 4935-4941.  239. Harder KW, Quilici C, Naik E, Inglese M, Kountouri N, Turner A, Zlatic K, Tarlinton DM, Hibbs ML. Perturbed myelo/erythropoiesis in Lyn-deficient mice is similar to that in mice lacking the inhibitory phosphatases SHP-1 and SHIP-1. Blood 2004, 104(13): 3901-3910.  240. Harder KW, Parsons LM, Armes J, Evans N, Kountouri N, Clark R, Quilici C, Grail D, Hodgson GS, Dunn AR, Hibbs ML. Gain- and loss-of-function Lyn mutant mice define a critical inhibitory role for Lyn in the myeloid lineage. Immunity 2001, 15(4): 603-615.  241. Beavitt SJ, Harder KW, Kemp JM, Jones J, Quilici C, Casagranda F, Lam E, Turner D, Brennan S, Sly PD, Tarlinton DM, Anderson GP, Hibbs ML. Lyn-deficient mice develop severe, persistent asthma: Lyn is a critical negative regulator of Th2 immunity. J Immunol 2005, 175(3): 1867-1875.  242. Hibbs ML, Tarlinton DM, Armes J, Grail D, Hodgson G, Maglitto R, Stacker SA, Dunn AR. Multiple defects in the immune system of Lyn-deficient mice, culminating in autoimmune disease. Cell 1995, 83(2): 301-311.  243. Scapini P, Hu Y, Chu CL, Migone TS, Defranco AL, Cassatella MA, Lowell CA. Myeloid cells, BAFF, and IFN-gamma establish an inflammatory loop that exacerbates autoimmunity in Lyn-deficient mice. J Exp Med 2010, 207(8): 1757-1773.  244. Silver KL, Crockford TL, Bouriez-Jones T, Milling S, Lambe T, Cornall RJ. MyD88-dependent autoimmune disease in Lyn-deficient mice. Eur J Immunol 2007, 37(10): 2734-2743.  245. Xiao W, Hong H, Kawakami Y, Lowell CA, Kawakami T. Regulation of myeloproliferation and M2 macrophage programming in mice by Lyn/Hck, SHIP, and Stat5. J Clin Invest 2008, 118(3): 924-934.    190 246. Yamao T, Noguchi T, Takeuchi O, Nishiyama U, Morita H, Hagiwara T, Akahori H, Kato T, Inagaki K, Okazawa H, Hayashi Y, Matozaki T, Takeda K, Akira S, Kasuga M. Negative regulation of platelet clearance and of the macrophage phagocytic response by the transmembrane glycoprotein SHPS-1. J Biol Chem 2002, 277(42): 39833-39839.  247. Ujike A, Takeda K, Nakamura A, Ebihara S, Akiyama K, Takai T. Impaired dendritic cell maturation and increased T(H)2 responses in PIR-B(-/-) mice. Nat Immunol 2002, 3(6): 542-548.  248. Chu CL, Lowell CA. The Lyn tyrosine kinase differentially regulates dendritic cell generation and maturation. J Immunol 2005, 175(5): 2880-2889.  249. Krebs DL, Chehal MK, Sio A, Huntington ND, Da ML, Ziltener P, Inglese M, Kountouri N, Priatel JJ, Jones J, Tarlinton DM, Anderson GP, Hibbs ML, Harder KW. Lyn-dependent signaling regulates the innate immune response by controlling dendritic cell activation of NK cells. J Immunol 2012, 188(10): 5094-5105.  250. Cross JL, Kott K, Miletic T, Johnson P. CD45 regulates TLR-induced proinflammatory cytokine and IFN-beta secretion in dendritic cells. J Immunol 2008, 180(12): 8020-8029.  251. Boulet I, Ralph S, Stanley E, Lock P, Dunn AR, Green SP, Phillips WA. Lipopolysaccharide- and interferon-gamma-induced expression of hck and lyn tyrosine kinases in murine bone marrow-derived macrophages. Oncogene 1992, 7(4): 703-710.  252. Sanjuan MA, Rao N, Lai KT, Gu Y, Sun S, Fuchs A, Fung-Leung WP, Colonna M, Karlsson L. CpG-induced tyrosine phosphorylation occurs via a TLR9-independent mechanism and is required for cytokine secretion. J Cell Biol 2006, 172(7): 1057-1068.  253. Herrera-Velit P, Reiner NE. Bacterial lipopolysaccharide induces the association and coordinate activation of p53/56lyn and phosphatidylinositol 3-kinase in human monocytes. J Immunol 1996, 156(3): 1157-1165.  254. Stefanova I, Corcoran ML, Horak EM, Wahl LM, Bolen JB, Horak ID. Lipopolysaccharide induces activation of CD14-associated protein tyrosine kinase p53/56lyn. J Biol Chem 1993, 268(28): 20725-20728.  255. Baran CP, Tridandapani S, Helgason CD, Humphries RK, Krystal G, Marsh CB. The inositol 5'-phosphatase SHIP-1 and the Src kinase Lyn negatively regulate macrophage colony-stimulating factor-induced Akt activity. J Biol Chem 2003, 278(40): 38628-38636.    191 256. Pereira S, Lowell C. The Lyn tyrosine kinase negatively regulates neutrophil integrin signaling. J Immunol 2003, 171(3): 1319-1327.  257. Malik M, Chen YY, Kienzle MF, Tomkowicz BE, Collman RG, Ptasznik A. Monocyte migration and LFA-1-mediated attachment to brain microvascular endothelia is regulated by SDF-1 alpha through Lyn kinase. J Immunol 2008, 181(7): 4632-4637.  258. Nikolic DM, Cholewa J, Gass C, Gong MC, Post SR. Class A scavenger receptor-mediated cell adhesion requires the sequential activation of Lyn and PI3-kinase. American journal of physiology Cell physiology 2007, 292(4): C1450-1458.  259. Kovacs M, Nemeth T, Jakus Z, Sitaru C, Simon E, Futosi K, Botz B, Helyes Z, Lowell CA, Mocsai A. The Src family kinases Hck, Fgr, and Lyn are critical for the generation of the in vivo inflammatory environment without a direct role in leukocyte recruitment. J Exp Med 2014, 211(10): 1993-2011.  260. Strzelecka-Kiliszek A, Kwiatkowska K, Sobota A. Lyn and Syk kinases are sequentially engaged in phagocytosis mediated by Fc gamma R. J Immunol 2002, 169(12): 6787-6794.  261. Fitzer-Attas CJ, Lowry M, Crowley MT, Finn AJ, Meng F, DeFranco AL, Lowell CA. Fcgamma receptor-mediated phagocytosis in macrophages lacking the Src family tyrosine kinases Hck, Fgr, and Lyn. J Exp Med 2000, 191(4): 669-682.  262. Hill DA, Siracusa MC, Abt MC, Kim BS, Kobuley D, Kubo M, Kambayashi T, Larosa DF, Renner ED, Orange JS, Bushman FD, Artis D. Commensal bacteria-derived signals regulate basophil hematopoiesis and allergic inflammation. Nat Med 2012, 18(4): 538-546.  263. Neufert C, Becker C, Neurath MF. An inducible mouse model of colon carcinogenesis for the analysis of sporadic and inflammation-driven tumor progression. Nat Protoc 2007, 2(8): 1998-2004.  264. Coburn B, Li Y, Owen D, Vallance BA, Finlay BB. Salmonella enterica serovar Typhimurium pathogenicity island 2 is necessary for complete virulence in a mouse model of infectious enterocolitis. Infect Immun 2005, 73(6): 3219-3227.  265. Gibson DL, Ma C, Bergstrom KS, Huang JT, Man C, Vallance BA. MyD88 signalling plays a critical role in host defence by controlling pathogen burden and promoting epithelial cell homeostasis during Citrobacter rodentium-induced colitis. Cell Microbiol 2008, 10(3): 618-631.  266. Kerr TA, Ciorba MA, Matsumoto H, Davis VR, Luo J, Kennedy S, Xie Y, Shaker A, Dieckgraefe BK, Davidson NO. Dextran sodium sulfate inhibition of real-time   192 polymerase chain reaction amplification: a poly-A purification solution. Inflamm Bowel Dis 2012, 18(2): 344-348.  267. Frausto RF, Crocker SJ, Eam B, Whitmire JK, Whitton JL. Myelin oligodendrocyte glycoprotein peptide-induced experimental allergic encephalomyelitis and T cell responses are unaffected by immunoproteasome deficiency. J Neuroimmunol 2007, 192(1-2): 124-133.  268. Olsen T, Rismo R, Cui G, Goll R, Christiansen I, Florholmen J. TH1 and TH17 interactions in untreated inflamed mucosa of inflammatory bowel disease, and their potential to mediate the inflammation. Cytokine 2011, 56(3): 633-640.  269. Schmechel S, Konrad A, Diegelmann J, Glas J, Wetzke M, Paschos E, Lohse P, Goke B, Brand S. Linking genetic susceptibility to Crohn's disease with Th17 cell function: IL-22 serum levels are increased in Crohn's disease and correlate with disease activity and IL23R genotype status. Inflamm Bowel Dis 2008, 14(2): 204-212.  270. Geremia A, Arancibia-Carcamo CV, Fleming MP, Rust N, Singh B, Mortensen NJ, Travis SP, Powrie F. IL-23-responsive innate lymphoid cells are increased in inflammatory bowel disease. J Exp Med 2011, 208(6): 1127-1133.  271. Takayama T, Kamada N, Chinen H, Okamoto S, Kitazume MT, Chang J, Matuzaki Y, Suzuki S, Sugita A, Koganei K, Hisamatsu T, Kanai T, Hibi T. Imbalance of NKp44(+)NKp46(-) and NKp44(-)NKp46(+) natural killer cells in the intestinal mucosa of patients with Crohn's disease. Gastroenterology 2010, 139(3): 882-892, 892 e881-883.  272. Zenewicz LA, Flavell RA. Recent advances in IL-22 biology. Int Immunol 2011, 23(3): 159-163.  273. Monteleone I, Rizzo A, Sarra M, Sica G, Sileri P, Biancone L, MacDonald TT, Pallone F, Monteleone G. Aryl hydrocarbon receptor-induced signals up-regulate IL-22 production and inhibit inflammation in the gastrointestinal tract. Gastroenterology 2011, 141(1): 237-248, 248 e231.  274. Walker JA, Barlow JL, McKenzie AN. Innate lymphoid cells--how did we miss them? Nat Rev Immunol 2013, 13(2): 75-87.  275. Pearson C, Uhlig HH, Powrie F. Lymphoid microenvironments and innate lymphoid cells in the gut. Trends Immunol 2012, 33(6): 289-296.  276. Keck S, Freudenberg M, Huber M. Activation of murine macrophages via TLR2 and TLR4 is negatively regulated by a Lyn/PI3K module and promoted by SHIP1. J Immunol 2010, 184(10): 5809-5818.    193 277. Lee JY, Lowell CA, Lemay DG, Youn HS, Rhee SH, Sohn KH, Jang B, Ye J, Chung JH, Hwang DH. The regulation of the expression of inducible nitric oxide synthase by Src-family tyrosine kinases mediated through MyD88-independent signaling pathways of Toll-like receptor 4. Biochem Pharmacol 2005, 70(8): 1231-1240.  278. Meng F, Lowell CA. Lipopolysaccharide (LPS)-induced macrophage activation and signal transduction in the absence of Src-family kinases Hck, Fgr, and Lyn. J Exp Med 1997, 185(9): 1661-1670.  279. Ullman TA, Itzkowitz SH. Intestinal inflammation and cancer. Gastroenterology 2011, 140(6): 1807-1816.  280. Zheng Y, Danilenko DM, Valdez P, Kasman I, Eastham-Anderson J, Wu J, Ouyang W. Interleukin-22, a T(H)17 cytokine, mediates IL-23-induced dermal inflammation and acanthosis. Nature 2007, 445(7128): 648-651.  281. Eberl G. Development and evolution of RORgammat+ cells in a microbe's world. Immunol Rev 2012, 245(1): 177-188.  282. Hibbs ML, Harder KW, Armes J, Kountouri N, Quilici C, Casagranda F, Dunn AR, Tarlinton DM. Sustained activation of Lyn tyrosine kinase in vivo leads to autoimmunity. J Exp Med 2002, 196(12): 1593-1604.  283. Dumoutier L, de Heusch M, Orabona C, Satoh-Takayama N, Eberl G, Sirard JC, Di Santo JP, Renauld JC. IL-22 is produced by gammaC-independent CD25+ CCR6+ innate murine spleen cells upon inflammatory stimuli and contributes to LPS-induced lethality. Eur J Immunol 2011, 41(4): 1075-1085.  284. Burdelya LG, Krivokrysenko VI, Tallant TC, Strom E, Gleiberman AS, Gupta D, Kurnasov OV, Fort FL, Osterman AL, Didonato JA, Feinstein E, Gudkov AV. An agonist of toll-like receptor 5 has radioprotective activity in mouse and primate models. Science 2008, 320(5873): 226-230.  285. Riehl T, Cohn S, Tessner T, Schloemann S, Stenson WF. Lipopolysaccharide is radioprotective in the mouse intestine through a prostaglandin-mediated mechanism. Gastroenterology 2000, 118(6): 1106-1116.  286. Mustjoki S, Ekblom M, Arstila TP, Dybedal I, Epling-Burnette PK, Guilhot F, Hjorth-Hansen H, Hoglund M, Kovanen P, Laurinolli T, Liesveld J, Paquette R, Pinilla-Ibarz J, Rauhala A, Shah N, Simonsson B, Sinisalo M, Steegmann JL, Stenke L, Porkka K. Clonal expansion of T/NK-cells during tyrosine kinase inhibitor dasatinib therapy. Leukemia 2009, 23(8): 1398-1405.  287. Shimokaze T, Mitsui T, Takeda H, Kawakami T, Arai T, Ito M, Iwaba A, Izumino H, Takahashi N, Kanno M, Sendo D, Hayasaka K. Severe hemorrhagic colitis caused by   194 dasatinib in Philadelphia chromosome-positive acute lymphoblastic leukemia. Pediatr Hematol Oncol 2009, 26(6): 448-453.  288. Feagins LA, Souza RF, Spechler SJ. Carcinogenesis in IBD: potential targets for the prevention of colorectal cancer. Nat Rev Gastroenterol Hepatol 2009, 6(5): 297-305.  289. Watanabe T, Kobunai T, Yamamoto Y, Ikeuchi H, Matsuda K, Ishihara S, Nozawa K, Iinuma H, Kanazawa T, Tanaka T, Yokoyama T, Konishi T, Eshima K, Ajioka Y, Hibi T, Watanabe M, Muto T, Nagawa H. Predicting ulcerative colitis-associated colorectal cancer using reverse-transcription polymerase chain reaction analysis. Clin Colorectal Cancer 2011, 10(2): 134-141.  290. Lieu C, Kopetz S. The SRC family of protein tyrosine kinases: a new and promising target for colorectal cancer therapy. Clin Colorectal Cancer 2010, 9(2): 89-94.  291. Sonnenberg GF, Monticelli LA, Alenghat T, Fung TC, Hutnick NA, Kunisawa J, Shibata N, Grunberg S, Sinha R, Zahm AM, Tardif MR, Sathaliyawala T, Kubota M, Farber DL, Collman RG, Shaked A, Fouser LA, Weiner DB, Tessier PA, Friedman JR, Kiyono H, Bushman FD, Chang KM, Artis D. Innate lymphoid cells promote anatomical containment of lymphoid-resident commensal bacteria. Science 2012, 336(6086): 1321-1325.  292. Ayres JS, Trinidad NJ, Vance RE. Lethal inflammasome activation by a multidrug-resistant pathobiont upon antibiotic disruption of the microbiota. Nat Med 2012, 18(5): 799-806.  293. Moretta L, Ferlazzo G, Bottino C, Vitale M, Pende D, Mingari MC, Moretta A. Effector and regulatory events during natural killer-dendritic cell interactions. Immunol Rev 2006, 214: 219-228.  294. Hooper LV, Littman DR, Macpherson AJ. Interactions between the microbiota and the immune system. Science 2012, 336(6086): 1268-1273.  295. Elinav E, Strowig T, Kau AL, Henao-Mejia J, Thaiss CA, Booth CJ, Peaper DR, Bertin J, Eisenbarth SC, Gordon JI, Flavell RA. NLRP6 inflammasome regulates colonic microbial ecology and risk for colitis. Cell 2011, 145(5): 745-757.  296. Ghosh S, Dai C, Brown K, Rajendiran E, Makarenko S, Baker J, Ma C, Halder S, Montero M, Ionescu VA, Klegeris A, Vallance BA, Gibson DL. Colonic microbiota alters host susceptibility to infectious colitis by modulating inflammation, redox status, and ion transporter gene expression. Am J Physiol Gastrointest Liver Physiol 2011, 301(1): G39-49.    195 297. Willing BP, Vacharaksa A, Croxen M, Thanachayanont T, Finlay BB. Altering host resistance to infections through microbial transplantation. PLoS One 2011, 6(10): e26988.  298. Nishizumi H, Taniuchi I, Yamanashi Y, Kitamura D, Ilic D, Mori S, Watanabe T, Yamamoto T. Impaired proliferation of peripheral B cells and indication of autoimmune disease in lyn-deficient mice. Immunity 1995, 3(5): 549-560.  299. Tsantikos E, Oracki SA, Quilici C, Anderson GP, Tarlinton DM, Hibbs ML. Autoimmune disease in Lyn-deficient mice is dependent on an inflammatory environment established by IL-6. J Immunol 2010, 184(3): 1348-1360.  300. Hernandez-Hansen V, Mackay GA, Lowell CA, Wilson BS, Oliver JM. The Src kinase Lyn is a negative regulator of mast cell proliferation. J Leukoc Biol 2004, 75(1): 143-151.  301. Leung WH, Bolland S. The inositol 5'-phosphatase SHIP-2 negatively regulates IgE-induced mast cell degranulation and cytokine production. J Immunol 2007, 179(1): 95-102.  302. Lamagna C, Scapini P, van Ziffle JA, Defranco AL, Lowell CA. Hyperactivated MyD88 signaling in dendritic cells, through specific deletion of Lyn kinase, causes severe autoimmunity and inflammation. Proc Natl Acad Sci U S A 2013, 110(35): E3311-3320.  303. Verhagen AM, Wallace ME, Goradia A, Jones SA, Croom HA, Metcalf D, Collinge JE, Maxwell MJ, Hibbs ML, Alexander WS, Hilton DJ, Kile BT, Starr R. A kinase-dead allele of Lyn attenuates autoimmune disease normally associated with Lyn deficiency. J Immunol 2009, 182(4): 2020-2029.  304. Barouch-Bentov R, Che J, Lee CC, Yang Y, Herman A, Jia Y, Velentza A, Watson J, Sternberg L, Kim S, Ziaee N, Miller A, Jackson C, Fujimoto M, Young M, Batalov S, Liu Y, Warmuth M, Wiltshire T, Cooke MP, Sauer K. A conserved salt bridge in the G loop of multiple protein kinases is important for catalysis and for in vivo Lyn function. Molecular cell 2009, 33(1): 43-52.  305. Yang XO, Pappu BP, Nurieva R, Akimzhanov A, Kang HS, Chung Y, Ma L, Shah B, Panopoulos AD, Schluns KS, Watowich SS, Tian Q, Jetten AM, Dong C. T helper 17 lineage differentiation is programmed by orphan nuclear receptors ROR alpha and ROR gamma. Immunity 2008, 28(1): 29-39.  306. Cherrier M, Ohnmacht C, Cording S, Eberl G. Development and function of intestinal innate lymphoid cells. Curr Opin Immunol 2012, 24(3): 277-283.    196 307. Garrett WS, Lord GM, Punit S, Lugo-Villarino G, Mazmanian SK, Ito S, Glickman JN, Glimcher LH. Communicable ulcerative colitis induced by T-bet deficiency in the innate immune system. Cell 2007, 131(1): 33-45.  308. Behnsen J, Jellbauer S, Wong CP, Edwards RA, George MD, Ouyang W, Raffatellu M. The cytokine IL-22 promotes pathogen colonization by suppressing related commensal bacteria. Immunity 2014, 40(2): 262-273.  309. Zenewicz LA, Yin X, Wang G, Elinav E, Hao L, Zhao L, Flavell RA. IL-22 deficiency alters colonic microbiota to be transmissible and colitogenic. J Immunol 2013, 190(10): 5306-5312.  310. Mundy R, MacDonald TT, Dougan G, Frankel G, Wiles S. Citrobacter rodentium of mice and man. Cell Microbiol 2005, 7(12): 1697-1706.  311. Kaiser P, Diard M, Stecher B, Hardt WD. The streptomycin mouse model for Salmonella diarrhea: functional analysis of the microbiota, the pathogen's virulence factors, and the host's mucosal immune response. Immunol Rev 2012, 245(1): 56-83.  312. Erkut M, Erkut N, Ersoz S, Arslan M, Sonmez M. A case of acute colitis with severe rectal bleeding in a patient with chronic myeloid leukemia after dasatinib use. Acta Haematol 2010, 123(4): 205-206.  313. Hill DA, Artis D. Intestinal bacteria and the regulation of immune cell homeostasis. Annu Rev Immunol 2010, 28: 623-667.  314. Damman CJ, Miller SI, Surawicz CM, Zisman TL. The microbiome and inflammatory bowel disease: is there a therapeutic role for fecal microbiota transplantation? Am J Gastroenterol 2012, 107(10): 1452-1459.  315. Nagalingam NA, Lynch SV. Role of the microbiota in inflammatory bowel diseases. Inflamm Bowel Dis 2012, 18(5): 968-984.  316. Sartor RB. Microbial influences in inflammatory bowel diseases. Gastroenterology 2008, 134(2): 577-594.  317. Frank DN, St Amand AL, Feldman RA, Boedeker EC, Harpaz N, Pace NR. Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proceedings of the National Academy of Sciences of the United States of America 2007, 104(34): 13780-13785.  318. Lupp C, Robertson ML, Wickham ME, Sekirov I, Champion OL, Gaynor EC, Finlay BB. Host-mediated inflammation disrupts the intestinal microbiota and promotes the overgrowth of Enterobacteriaceae. Cell Host Microbe 2007, 2(3): 204.    197 319. Guslandi M. Rifaximin in the treatment of inflammatory bowel disease. World J Gastroenterol 2011, 17(42): 4643-4646.  320. Ohkusa T, Kato K, Terao S, Chiba T, Mabe K, Murakami K, Mizokami Y, Sugiyama T, Yanaka A, Takeuchi Y, Yamato S, Yokoyama T, Okayasu I, Watanabe S, Tajiri H, Sato N. Newly developed antibiotic combination therapy for ulcerative colitis: a double-blind placebo-controlled multicenter trial. Am J Gastroenterol 2010, 105(8): 1820-1829.  321. Sartor RB. Therapeutic manipulation of the enteric microflora in inflammatory bowel diseases: antibiotics, probiotics, and prebiotics. Gastroenterology 2004, 126(6): 1620-1633.  322. Khan KJ, Ullman TA, Ford AC, Abreu MT, Abadir A, Marshall JK, Talley NJ, Moayyedi P. Antibiotic therapy in inflammatory bowel disease: a systematic review and meta-analysis. Am J Gastroenterol 2011, 106(4): 661-673.  323. Meijer BJ, Dieleman LA. Probiotics in the treatment of human inflammatory bowel diseases: update 2011. J Clin Gastroenterol 2011, 45 Suppl: S139-144.  324. Hviid A, Svanstrom H, Frisch M. Antibiotic use and inflammatory bowel diseases in childhood. Gut 2011, 60(1): 49-54.  325. Kriegel MA, Sefik E, Hill JA, Wu HJ, Benoist C, Mathis D. Naturally transmitted segmented filamentous bacteria segregate with diabetes protection in nonobese diabetic mice. Proc Natl Acad Sci U S A 2011, 108(28): 11548-11553.  326. Seiderer J, Elben I, Diegelmann J, Glas J, Stallhofer J, Tillack C, Pfennig S, Jurgens M, Schmechel S, Konrad A, Goke B, Ochsenkuhn T, Muller-Myhsok B, Lohse P, Brand S. Role of the novel Th17 cytokine IL-17F in inflammatory bowel disease (IBD): upregulated colonic IL-17F expression in active Crohn's disease and analysis of the IL17F p.His161Arg polymorphism in IBD. Inflamm Bowel Dis 2008, 14(4): 437-445.  327. Fonseca-Camarillo G, Mendivil-Rangel E, Furuzawa-Carballeda J, Yamamoto-Furusho JK. Interleukin 17 gene and protein expression are increased in patients with ulcerative colitis. Inflamm Bowel Dis 2011, 17(10): E135-136.  328. Fuss IJ, Neurath M, Boirivant M, Klein JS, de la Motte C, Strong SA, Fiocchi C, Strober W. Disparate CD4+ lamina propria (LP) lymphokine secretion profiles in inflammatory bowel disease. Crohn's disease LP cells manifest increased secretion of IFN-gamma, whereas ulcerative colitis LP cells manifest increased secretion of IL-5. J Immunol 1996, 157(3): 1261-1270.    198 329. Kim SW, Kim ES, Moon CM, Park JJ, Kim TI, Kim WH, Cheon JH. Genetic polymorphisms of IL-23R and IL-17A and novel insights into their associations with inflammatory bowel disease. Gut 2011, 60(11): 1527-1536.  330. Ito R, Kita M, Shin-Ya M, Kishida T, Urano A, Takada R, Sakagami J, Imanishi J, Iwakura Y, Okanoue T, Yoshikawa T, Kataoka K, Mazda O. Involvement of IL-17A in the pathogenesis of DSS-induced colitis in mice. Biochem Biophys Res Commun 2008, 377(1): 12-16.  331. Hyun YS, Han DS, Lee AR, Eun CS, Youn J, Kim HY. Role of IL-17A in the development of colitis-associated cancer. Carcinogenesis 2012, 33(4): 931-936.  332. Vaishnava S, Yamamoto M, Severson KM, Ruhn KA, Yu X, Koren O, Ley R, Wakeland EK, Hooper LV. The antibacterial lectin RegIIIgamma promotes the spatial segregation of microbiota and host in the intestine. Science 2011, 334(6053): 255-258.  333. Cao AT, Yao S, Gong B, Elson CO, Cong Y. Th17 cells upregulate polymeric Ig receptor and intestinal IgA and contribute to intestinal homeostasis. J Immunol 2012, 189(9): 4666-4673.  334. Tsuji M, Komatsu N, Kawamoto S, Suzuki K, Kanagawa O, Honjo T, Hori S, Fagarasan S. Preferential generation of follicular B helper T cells from Foxp3+ T cells in gut Peyer's patches. Science 2009, 323(5920): 1488-1492.  335. Cong Y, Feng T, Fujihashi K, Schoeb TR, Elson CO. A dominant, coordinated T regulatory cell-IgA response to the intestinal microbiota. Proc Natl Acad Sci U S A 2009, 106(46): 19256-19261.  336. Endt K, Stecher B, Chaffron S, Slack E, Tchitchek N, Benecke A, Van Maele L, Sirard JC, Mueller AJ, Heikenwalder M, Macpherson AJ, Strugnell R, von Mering C, Hardt WD. The microbiota mediates pathogen clearance from the gut lumen after non-typhoidal Salmonella diarrhea. PLoS Pathog 2010, 6(9): e1001097.  337. Mittrucker HW, Kaufmann SH. Immune response to infection with Salmonella typhimurium in mice. J Leukoc Biol 2000, 67(4): 457-463.  338. Kim YG, Kamada N, Shaw MH, Warner N, Chen GY, Franchi L, Nunez G. The Nod2 sensor promotes intestinal pathogen eradication via the chemokine CCL2-dependent recruitment of inflammatory monocytes. Immunity 2011, 34(5): 769-780.  339. Auffray C, Sieweke MH, Geissmann F. Blood monocytes: development, heterogeneity, and relationship with dendritic cells. Annu Rev Immunol 2009, 27: 669-692.    199 340. Swirski FK, Nahrendorf M, Etzrodt M, Wildgruber M, Cortez-Retamozo V, Panizzi P, Figueiredo JL, Kohler RH, Chudnovskiy A, Waterman P, Aikawa E, Mempel TR, Libby P, Weissleder R, Pittet MJ. Identification of splenic reservoir monocytes and their deployment to inflammatory sites. Science 2009, 325(5940): 612-616.  341. Ginhoux F, Jung S. Monocytes and macrophages: developmental pathways and tissue homeostasis. Nat Rev Immunol 2014, 14(6): 392-404.  342. Peng Y, Latchman Y, Elkon KB. Ly6C(low) monocytes differentiate into dendritic cells and cross-tolerize T cells through PDL-1. J Immunol 2009, 182(5): 2777-2785.  343. Narni-Mancinelli E, Soudja SM, Crozat K, Dalod M, Gounon P, Geissmann F, Lauvau G. Inflammatory monocytes and neutrophils are licensed to kill during memory responses in vivo. PLoS Pathog 2011, 7(12): e1002457.  344. Robben PM, LaRegina M, Kuziel WA, Sibley LD. Recruitment of Gr-1+ monocytes is essential for control of acute toxoplasmosis. J Exp Med 2005, 201(11): 1761-1769.  345. Serbina NV, Pamer EG. Monocyte emigration from bone marrow during bacterial infection requires signals mediated by chemokine receptor CCR2. Nat Immunol 2006, 7(3): 311-317.  346. Serbina NV, Kuziel W, Flavell R, Akira S, Rollins B, Pamer EG. Sequential MyD88-independent and -dependent activation of innate immune responses to intracellular bacterial infection. Immunity 2003, 19(6): 891-901.  347. Hamers AA, Vos M, Rassam F, Marinkovic G, Kurakula K, van Gorp PJ, de Winther MP, Gijbels MJ, de Waard V, de Vries CJ. Bone marrow-specific deficiency of nuclear receptor Nur77 enhances atherosclerosis. Circulation research 2012, 110(3): 428-438.  348. Donnelly DJ, Longbrake EE, Shawler TM, Kigerl KA, Lai W, Tovar CA, Ransohoff RM, Popovich PG. Deficient CX3CR1 signaling promotes recovery after mouse spinal cord injury by limiting the recruitment and activation of Ly6Clo/iNOS+ macrophages. The Journal of neuroscience : the official journal of the Society for Neuroscience 2011, 31(27): 9910-9922.  349. Amano H, Amano E, Santiago-Raber ML, Moll T, Martinez-Soria E, Fossati-Jimack L, Iwamoto M, Rozzo SJ, Kotzin BL, Izui S. Selective expansion of a monocyte subset expressing the CD11c dendritic cell marker in the Yaa model of systemic lupus erythematosus. Arthritis and rheumatism 2005, 52(9): 2790-2798.  350. Santiago-Raber ML, Amano H, Amano E, Baudino L, Otani M, Lin Q, Nimmerjahn F, Verbeek JS, Ravetch JV, Takasaki Y, Hirose S, Izui S. Fcgamma receptor-  200 dependent expansion of a hyperactive monocyte subset in lupus-prone mice. Arthritis and rheumatism 2009, 60(8): 2408-2417.  351. Debien E, Mayol K, Biajoux V, Daussy C, De Aguero MG, Taillardet M, Dagany N, Brinza L, Henry T, Dubois B, Kaiserlian D, Marvel J, Balabanian K, Walzer T. S1PR5 is pivotal for the homeostasis of patrolling monocytes. Eur J Immunol 2013, 43(6): 1667-1675.  352. Lewis ND, Haxhinasto SA, Anderson SM, Stefanopoulos DE, Fogal SE, Adusumalli P, Desai SN, Patnaude LA, Lukas SM, Ryan KR, Slavin AJ, Brown ML, Modis LK. Circulating monocytes are reduced by sphingosine-1-phosphate receptor modulators independently of S1P3. J Immunol 2013, 190(7): 3533-3540.  353. MacDonald KP, Palmer JS, Cronau S, Seppanen E, Olver S, Raffelt NC, Kuns R, Pettit AR, Clouston A, Wainwright B, Branstetter D, Smith J, Paxton RJ, Cerretti DP, Bonham L, Hill GR, Hume DA. An antibody against the colony-stimulating factor 1 receptor depletes the resident subset of monocytes and tissue- and tumor-associated macrophages but does not inhibit inflammation. Blood 2010, 116(19): 3955-3963.  354. Moore KJ, Sheedy FJ, Fisher EA. Macrophages in atherosclerosis: a dynamic balance. Nat Rev Immunol 2013, 13(10): 709-721.  355. Hilgendorf I, Swirski FK, Robbins CS. Monocyte fate in atherosclerosis. Arteriosclerosis, thrombosis, and vascular biology 2015, 35(2): 272-279.  356. Swirski FK, Pittet MJ, Kircher MF, Aikawa E, Jaffer FA, Libby P, Weissleder R. Monocyte accumulation in mouse atherogenesis is progressive and proportional to extent of disease. Proc Natl Acad Sci U S A 2006, 103(27): 10340-10345.  357. Swirski FK, Libby P, Aikawa E, Alcaide P, Luscinskas FW, Weissleder R, Pittet MJ. Ly-6Chi monocytes dominate hypercholesterolemia-associated monocytosis and give rise to macrophages in atheromata. J Clin Invest 2007, 117(1): 195-205.  358. Wu H, Perrard XD, Wang Q, Perrard JL, Polsani VR, Jones PH, Smith CW, Ballantyne CM. CD11c expression in adipose tissue and blood and its role in diet-induced obesity. Arteriosclerosis, thrombosis, and vascular biology 2010, 30(2): 186-192.  359. Rohde CM, Schrum J, Lee AW. A juxtamembrane tyrosine in the colony stimulating factor-1 receptor regulates ligand-induced Src association, receptor kinase function, and down-regulation. J Biol Chem 2004, 279(42): 43448-43461.  360. Ishibashi S, Brown MS, Goldstein JL, Gerard RD, Hammer RE, Herz J. Hypercholesterolemia in low density lipoprotein receptor knockout mice and its reversal by adenovirus-mediated gene delivery. J Clin Invest 1993, 92(2): 883-893.   201  361. Tsantikos E, Maxwell MJ, Putoczki T, Ernst M, Rose-John S, Tarlinton DM, Hibbs ML. Interleukin-6 trans-signaling exacerbates inflammation and renal pathology in lupus-prone mice. Arthritis and rheumatism 2013, 65(10): 2691-2702.  362. Hua Z, Gross AJ, Lamagna C, Ramos-Hernandez N, Scapini P, Ji M, Shao H, Lowell CA, Hou B, DeFranco AL. Requirement for MyD88 signaling in B cells and dendritic cells for germinal center anti-nuclear antibody production in Lyn-deficient mice. J Immunol 2014, 192(3): 875-885.  363. Biburger M, Aschermann S, Schwab I, Lux A, Albert H, Danzer H, Woigk M, Dudziak D, Nimmerjahn F. Monocyte subsets responsible for immunoglobulin G-dependent effector functions in vivo. Immunity 2011, 35(6): 932-944.  364. Boekhoudt GH, McGrath AG, Swisher JF, Feldman GM. Immune complexes suppress IFN-gamma-induced responses in monocytes by activating discrete members of the SRC kinase family. J Immunol 2015, 194(3): 983-989.  365. Li G, Fox J, 3rd, Liu Z, Liu J, Gao GF, Jin Y, Gao H, Wu M. Lyn mitigates mouse airway remodeling by downregulating the TGF-beta3 isoform in house dust mite models. J Immunol 2013, 191(11): 5359-5370.  366. Adachi T, Stafford S, Sur S, Alam R. A novel Lyn-binding peptide inhibitor blocks eosinophil differentiation, survival, and airway eosinophilic inflammation. J Immunol 1999, 163(2): 939-946.  367. Du C, Sriram S. Increased severity of experimental allergic encephalomyelitis in lyn-/- mice in the absence of elevated proinflammatory cytokine response in the central nervous system. J Immunol 2002, 168(6): 3105-3112.  368. Roberts ME, Bishop JL, Fan X, Beer JL, Kum WW, Krebs DL, Huang M, Gill N, Priatel JJ, Finlay BB, Harder KW. Lyn deficiency leads to increased microbiota-dependent intestinal inflammation and susceptibility to enteric pathogens. J Immunol 2014, 193(10): 5249-5263.  369. Anbazhagan K, Duroux-Richard I, Jorgensen C, Apparailly F. Transcriptomic network support distinct roles of classical and non-classical monocytes in human. International reviews of immunology 2014, 33(6): 470-489.  370. Ley K, Miller YI, Hedrick CC. Monocyte and macrophage dynamics during atherogenesis. Arteriosclerosis, thrombosis, and vascular biology 2011, 31(7): 1506-1516.    202 371. Han J, Zhang G, Welch EJ, Liang Y, Fu J, Vogel SM, Lowell CA, Du X, Cheresh DA, Malik AB, Li Z. A critical role for Lyn kinase in strengthening endothelial integrity and barrier function. Blood 2013, 122(25): 4140-4149.  372. Ming Z, Hu Y, Xiang J, Polewski P, Newman PJ, Newman DK. Lyn and PECAM-1 function as interdependent inhibitors of platelet aggregation. Blood 2011, 117(14): 3903-3906.  373. Senis YA, Mazharian A, Mori J. Src family kinases: at the forefront of platelet activation. Blood 2014, 124(13): 2013-2024.  374. Wiktor-Jedrzejczak W, Ratajczak MZ, Ptasznik A, Sell KW, Ahmed-Ansari A, Ostertag W. CSF-1 deficiency in the op/op mouse has differential effects on macrophage populations and differentiation stages. Experimental hematology 1992, 20(8): 1004-1010.  375. Dai XM, Ryan GR, Hapel AJ, Dominguez MG, Russell RG, Kapp S, Sylvestre V, Stanley ER. Targeted disruption of the mouse colony-stimulating factor 1 receptor gene results in osteopetrosis, mononuclear phagocyte deficiency, increased primitive progenitor cell frequencies, and reproductive defects. Blood 2002, 99(1): 111-120.  376. Landsman L, Bar-On L, Zernecke A, Kim KW, Krauthgamer R, Shagdarsuren E, Lira SA, Weissman IL, Weber C, Jung S. CX3CR1 is required for monocyte homeostasis and atherogenesis by promoting cell survival. Blood 2009, 113(4): 963-972.  377. Scapini P, Lamagna C, Hu Y, Lee K, Tang Q, DeFranco AL, Lowell CA. B cell-derived IL-10 suppresses inflammatory disease in Lyn-deficient mice. Proc Natl Acad Sci U S A 2011, 108(41): E823-832.  378. Masuyama N, Oishi K, Mori Y, Ueno T, Takahama Y, Gotoh Y. Akt inhibits the orphan nuclear receptor Nur77 and T-cell apoptosis. J Biol Chem 2001, 276(35): 32799-32805.  379. Pekarsky Y, Hallas C, Palamarchuk A, Koval A, Bullrich F, Hirata Y, Bichi R, Letofsky J, Croce CM. Akt phosphorylates and regulates the orphan nuclear receptor Nur77. Proc Natl Acad Sci U S A 2001, 98(7): 3690-3694.  	  	  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0166382/manifest

Comment

Related Items