Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Role of the KNAT7 transcription factor in diurnal regulation of lignin biosynthetic genes and resource… Das, Orpita 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2015_september_das_orpita.pdf [ 3.95MB ]
Metadata
JSON: 24-1.0166357.json
JSON-LD: 24-1.0166357-ld.json
RDF/XML (Pretty): 24-1.0166357-rdf.xml
RDF/JSON: 24-1.0166357-rdf.json
Turtle: 24-1.0166357-turtle.txt
N-Triples: 24-1.0166357-rdf-ntriples.txt
Original Record: 24-1.0166357-source.json
Full Text
24-1.0166357-fulltext.txt
Citation
24-1.0166357.ris

Full Text

ROLE OF THE KNAT7 TRANSCRIPTION FACTOR IN DIURNAL REGULATION OF LIGNIN BIOSYNTHETIC GENES AND RESOURCE ALLOCATION IN ARABIDOPSIS THALIANA by  Orpita Das  B.Tech., National Institute of Technology, Warangal, 2012  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  July 2015 © Orpita Das, 2015 ii  Abstract Lignified secondary cell walls in plants represent an irreversibly deposited final metabolic sink for global fixed carbon reserves and synthesis of these walls is an energetically expensive process for the plant; hence it follows that spatial-temporal control of secondary cell wall biosynthesis must be closely co-ordinated with carbon metabolism. The function of the KNOTTED ARABIDOPSIS THALIANA 7 (KNAT7) homeodomain protein, a repressor of transcription and part of the multi-level network of transcription factors regulating secondary cell wall biosynthesis and deposition, was studied to investigate its potential role in diurnal regulation of a set of lignin biosynthetic genes (LBGs) in Arabidopsis thaliana. I found that in young wild-type seedlings, transcript accumulation levels of LBGs grown in long day conditions vary diurnally but most do not show a change in temporal variation over a daily light-dark cycle in the knat7 mutant. Diurnal patterns of LBG transcript accumulation were less clear in mature wild-type inflorescence stem tissue, however diurnal expression at subjective 'dawn' was altered for some LBGs in knat7, providing evidence for a function for KNAT7 as a diurnal regulator of LBG expression in actively lignifying tissue. A diurnal regulatory function for KNAT7 is also supported by the presence of a hypocotyl elongation phenotype as well as by an altered timing to floral transition in KNAT7 mutants, phenotypes commonly displayed by mutants defective in clock regulation. Further, evidence for KNAT7 function as an activator of diurnal transcription of 3-DEOXY-D-ARABINO-HEPTULOSONATE 7-PHOSPHATE SYNTHASE 1 (DHS1) was observed in seedlings while in stems KNAT7 seemed to function as a repressor of LBGs. KNAT7 temporal expression variation itself shows minimal change in seedling and stem tissue grown in longday conditions, suggesting that post transcriptional mechanisms, such as protein-protein interactions, may be important for modulating KNAT7 functions diurnally. Overall, my data iii  provides support for the hypothesis that diurnal regulation of transcript abundance is a function of KNAT7 in seedlings and mature stem tissue, which may represent a means to fine-tune resource (sucrose and starch) allocation to secondary cell wall biosynthesis coordinated with diurnal fluctuations in availability.  iv  Preface This thesis is original, unpublished, independent work by the author, Orpita Das. v  Table of Contents Abstract .......................................................................................................................................... ii Preface ........................................................................................................................................... iv Table of Contents ...........................................................................................................................v List of Tables .............................................................................................................................. viii List of Figures ............................................................................................................................... ix List of Abbreviations .................................................................................................................. xii Acknowledgements .................................................................................................................... xiv Dedication .....................................................................................................................................xv  Introduction and literature review ................................................................................. 1 Chapter 1:1.1 Introduction to biological clocks .................................................................................1 1.1.1 Clock mechanism in plants ..................................................................................... 2 1.1.2 Tissue, organ and species specific clock regulation ............................................... 7 1.2 Plant cell walls .............................................................................................................8 1.2.1 Lignin composition and biosynthesis ..................................................................... 9 1.2.2 Lignified tissue in Arabidopsis ............................................................................. 11 1.2.3 Developmental regulation of secondary cell wall formation in stems .................. 13 1.2.4 The KNAT7 repressor complex ............................................................................ 15 1.3 Clock regulation of secondary metabolism ...............................................................18 1.4 Research questions and objectives .............................................................................20 1.5 Motivation for the research ........................................................................................20   vi   Materials and methods ................................................................................................ 22 Chapter 2:2.1 Plant material .............................................................................................................22 2.2 Growth conditions .....................................................................................................22 2.3 Genotyping mutants ...................................................................................................23 2.4 Sample collection for qRT-PCR ................................................................................23 2.5 RNA extraction and cDNA synthesis ........................................................................24 2.6 qRT-PCR ...................................................................................................................24 2.6.1 Reference gene selection ....................................................................................... 24 2.6.2 Plate Setup ............................................................................................................ 27 2.6.3 Expression calculation .......................................................................................... 27 2.7 Hypocotyl length measurement and bolting study ....................................................28  Diurnal patterns of expression of lignin biosynthetic genes in wild-type Arabidopsis Chapter 3:thaliana…………………………………………………………………………………………..30 3.1 Introduction ................................................................................................................30 3.2 Results ........................................................................................................................31 3.2.1 Temporal expression patterns of LHY and DHS1 genes in wild-type seedlings ... 31 3.2.2 Temporal expression patterns of lignin biosynthetic genes in wild-type seedlings ……………………………………………………………………………………32 3.2.3 Temporal expression patterns of LHY and DHS1 genes in wild-type inflorescence stems……………………………………………………………………………………...39 3.2.4 Temporal expression patterns of lignin biosynthetic genes in wild-type inflorescence stems ........................................................................................................... 39 3.3 Discussion ..................................................................................................................43 vii   Role for KNAT7 in diurnal regulation of lignin biosynthetic genes in seedlings and Chapter 4:stems……………………………………………………………………………………………..47 4.1 Introduction ................................................................................................................47 4.2 Results ........................................................................................................................48 4.2.1 Temporal expression patterns of the KNAT7 gene in wild-type seedlings and stems……………………………………………………………………………………...48 4.2.2 Temporal expression patterns of LHY and DHS1 genes in knat7 seedlings and stems……………………………………………………………………………………...50 4.2.3 Temporal expression patterns of lignin biosynthetic genes in knat7 seedlings and stems……………………………………………………………………………………...58 4.2.4 Temporal expression patterns of lignin biosynthetic genes in a second replicate set of knat7 stems ................................................................................................................... 59 4.2.5 Phenotypic analysis of KNAT7 mutants ................................................................ 63 4.3 Discussion ..................................................................................................................65  Conclusion and future directions ................................................................................ 72 Chapter 5:References .....................................................................................................................................79  viii  List of Tables  Table 2-1 Genes studied using qRT-PCR and primer pairs used. ................................................ 29 Table 4-1 Hypocotyl lengths in wild type knat7 and 4CL:KNAT7 seedlings (Replicate 1). ........ 64 Table 4-2 Hypocotyl lengths in wild type knat7 and 4CL:KNAT7 seedlings (Replicate 2). ........ 64 Table 4-3 Days to bolting in wild type knat7 and 4CL:KNAT7 plants. ........................................ 65  ix  List of Figures Figure 1-1 Interlocked transcription-translation feedback loops of transcription factor genes that make up the plant circadian clock. .................................................................................................. 4 Figure 1-2 Temporal expression profiles of Arabidopsis clock genes in wild-type plants. ........... 6 Figure 1-3 The Arabidopsis phenylpropanoid pathway................................................................ 11 Figure 1-4 An overview of the transcriptional network regulating secondary cell wall biosynthesis in Arabidopsis. ......................................................................................................... 14 Figure 2-1 Identification of a stable reference gene for normalization of qRT-PCR. .................. 26 Figure 3-1 Temporal expression patterns of LHY and DHS1 in wild-type seedlings grown in LD........................................................................................................................................................ 33 Figure 3-2 Temporal expression patterns of PAL1, C4H, 4CL1, F5H and COMT in wild-type seedlings grown in LD. ................................................................................................................. 35 Figure 3-3 Temporal expression patterns of PAL1, C4H, 4CL1, F5H and COMT in wild-type seedlings grown in CL. ................................................................................................................. 36 Figure 3-4 Temporal expression patterns of C3H, HCT, CCOMT, CCR1 and CAD1 in wild-type seedlings grown in LD. ................................................................................................................. 37 Figure 3-5 Temporal expression patterns of C3H, HCT, CCOMT, CCR1 and CAD1 in wild-type seedlings grown in CL. ................................................................................................................. 38 Figure 3-6 Temporal expression patterns of LHY and DHS1 in wild-type inflorescence stems grown in LD. ................................................................................................................................. 40 Figure 3-7 Temporal expression patterns of PAL1, C4H, 4CL1, F5H and COMT in wild-type inflorescence stems grown in LD. ................................................................................................ 41 x  Figure 3-8 Temporal expression patterns of C3H, HCT, CCOMT, CCR1 and CAD1 in wild-type inflorescence stems grown in LD. ................................................................................................ 42 Figure 4-1 Temporal expression patterns of KNAT7 in wild-type seedlings grown in LD and CL........................................................................................................................................................ 49 Figure 4-2 Temporal expression pattern of KNAT7 in wild-type inflorescence stems grown in LD. ................................................................................................................................................ 50 Figure 4-3 Temporal expression patterns of LHY and DHS1 in wild-type and knat7 seedlings grown in LD. ................................................................................................................................. 51 Figure 4-4 Temporal expression patterns of LHY and DHS1 in wild-type and knat7 inflorescence stems grown in LD. ....................................................................................................................... 52 Figure 4-5 Expression of DHS1, C3H and F5H in the day and night in wild-type and knat7 seedlings grown in LD. ................................................................................................................. 53 Figure 4-6 Temporal expression patterns of PAL1, C4H, 4CL1, F5H and COMT in wild-type and knat7 seedlings grown in LD. ....................................................................................................... 54 Figure 4-7 Temporal expression patterns of C3H, HCT, CCOMT, CCR1 and CAD1 in wild-type and knat7 seedlings grown in LD. ................................................................................................ 55 Figure 4-8 Temporal expression patterns of PAL1, C4H, 4CL1, F5H and COMT in wild-type and knat7 inflorescence stems grown in LD........................................................................................ 56 Figure 4-9 Temporal expression patterns of C3H, HCT, CCOMT, CCR1 and CAD1 in wild-type and knat7 inflorescence stems grown in LD. ................................................................................ 57 Figure 4-10 Spread of LBG expression data over 48 h in wild-type and knat7 inflorescence stems grown in LD. ................................................................................................................................. 60 xi  Figure 4-11 Expression of LHY, DHS1, C4H, C3H, HCT, CCOMT, F5H and COMT at dawn in a second stem collection set of wild-type and knat7 inflorescence stems grown in LD. ................ 62  xii  List of Abbreviations  cDNA complementary deoxyribonucleic acid CL continuous light  Col Columbia DNA deoxyribonucleic acid EDTA ethylenediaminetetraacetic acid GUS β-glucuronidase hy elongated hypocotyl irx irregular xylem L/D light / dark LD longday LBGs lignin biosynthetic genes mRNA messenger ribonucleic acid SDS sodium dodecyl sulphate T-DNA transfer DNA PAL phenylalanine ammonia lyase C4H cinnamate-4-hydroxylase 4CL 4-coumarate CoA ligase C3H p-coumaroyl shikimate 3-hydroxylase HCT hydroxycinnamoyl CoA:shikimate hydroxycinnamoyl transferase CCOMT caffeoyl CoA o-methyltransferase xiii  CCR cinnamoyl CoA reductase F5H ferulate 5-hydroxylase COMT caffeic acid o-methyltransferase CAD cinnamyl alcohol dehydrogenase qRT-PCR quantitative real  time polymerase chain reaction SDS sodium dodecyl sulphate  xiv  Acknowledgements  I would like to sincerely thank my supervisor Dr. Carl Douglas for his scientific counsel patience and enduring support. Dr. Douglas and my committee members Dr. Lacey Samuels and Dr. Brian Ellis believed in me and inspired me to persevere in my efforts to pursue the research that I have to come to love even more over the last few years. I am honoured to have been mentored by these extremely brilliant scientists and all the other passionate and dedicated researchers at the Botany Department of the University of British Columbia.  I am thankful for the time Dr. Santokh Singh, Plant Physiology lab instructor and Dr. Gary Bradfield, department advisor, set aside to advise me on scientific and non-scientific questions and for the support provided by the wonderful office staff of the Botany Department, like Veronica Oxtoby and Isabel Ferens.  The Working on Walls (WoW) group of students and researchers at the University of British Columbia played a tremendous role in shaping my scientific ideas and encouraging me to question more and really think. Financial and other support from WoW provided for overwhelming learning experiences, like attending my first scientific conference. I also want to thank the members of the Douglas lab for supporting me and helping me tackle my research problems. Finally I would like the acknowledge the loving support from my family in India and my friends in Vancouver; my flat-mate Nayantara Duttachoudhury, for putting up with my spells of anxiety and Sharan Vaswani, who proved that a computer scientist could in fact share stimulating and constructive scientific conversations with a biologist about science.  xv  Dedication    Dedicated to my parents Aparajita Das, Rabindranath Das and my brother Rohit Das.                          1   Introduction and literature review Chapter 1:1.1 Introduction to biological clocks  All eukaryotes have a circadian clock; an internal time-keeping mechanism consisting of transcription-translation feedback loops, to predictively synchronize internal biological processes with the earth‘s 24 hour rotation around the sun. Circadian rhythms, a subset of diurnal rhythms, are oscillations in metabolism, physiology and behaviour that have a period of ~24 h. Even in the absence of exogenous time cues these rhythms persist, indicating their generation by an endogenous circadian clock (Dunlap et. al., 2004). In trees important physiological processes like cold acclimation in winter, release from dormancy in spring and photoperiodic induction of flowering are controlled by the photoperiod sensing abilities provided by the circadian clock. Hypocotyl elongation, leaf movements and stomatal closure are all examples of daily clock controlled activities (Kinmonth-Schultz et. al., 2013). Primary metabolism is influenced by the clock. It ensures efficiency of the photosynthetic apparatus and nutrient utilization (Harmer et. al., 2000). Carbon allocation and utilization pathway response, to regular environmental changes affecting carbon availability as well as sudden carbon starvation, is clock-regulated (Stitt et. al., 2007). Dodd et. al., (2005) showed that when Arabidopsis thaliana (Arabidopsis) clock period matched that of the external environment the plants made more chlorophyll, had bigger rosettes, grew faster and survived better when competing for resources; hence clocks provide plants with an adaptive advantage. Circadian clocks, consisting of transcription-translation feedback loops, have in fact evolved independently in different lineages at least 4 times in the last 2 billion years (Edgar et. al., 2012).  An enrichment of clock-regulated genes in phytohormone response as well as stress-response pathways was identified by Covington et. al., (2008). Clock regulation determines  2  sensitivity to auxin responses in a time-of-day specific manner (Covington et. al.,2007), allows plants to anticipate likely pest attacks (Goodspeed et. al., 2012) and respond to wounding, cold stress (Pruneda-Paz et. al., 2010) and pathogen stress by induction of secondary metabolism gene expression (Nascimento and Fett-Nato, 2010). Temporal compartmentalization of maximum expression of the thousands of transcripts generated and metabolic processes performed by a cell over the day may also be a function of the clock (Harmer et. al., 2000).  Up to 35% of the Arabidopsis transcriptome shows clock regulation (Michael and McClung, 2003). More recently over half of the Arabidopsis expressed genes were shown to be diurnally regulated (Michael et. al., 2008) and/or nearly one-third of expressed genes were shown to be circadian regulated (Covington et, al., 2008). All of these data indicate the far-reaching consequences of clock regulation on co-ordination of plant gene expression, physiology, metabolism and growth.   1.1.1  Clock mechanism in plants The molecular mechanism of the plant circadian clock can be thought to consist of 3 major parts - a self-sustaining core biochemical oscillator consisting of transcription factors and associated genes, input pathways for environmental sensing and output pathways for co-ordination of cellular and physiological responses. In Arabidopsis more than 20 core clock genes have been identified to date. The complexity of transcriptional and post-translational feedback mechanisms making up the clock in higher plants makes it difficult to identify the roles of individual genes or molecular interactions. In the most recent mathematical model of the clock, transcriptional activation is primarily the responsibility of REVEILLE8 (REV8) while the rest of the clock genes are modelled as repressors to corroborate experimental evidence from the  3  literature (Fig. 1-1; Fogelmark and Troein, 2014). These core clock genes show peaks in mRNA and protein levels at distinct times of day (Fig. 1-2; Carre and Veflingstad, 2013; Fogelmark and Troein, 2014) and reciprocally regulate expression of other clock genes as well as downstream processes at the transcriptional and post-translational level.  LATE ELONGATED HYPOCOTYL (LHY) and a closely related MYB-like transcription factor CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) show high mRNA and protein levels in the morning and repress evening phased clock genes like TIMING OF CAB EXPRESSION 1 (TOC1), GIGANTEA (GI), LUX ARRHYTHMO (LUX), BROTHER OF LUX ARRHYTHMO (BOA, also known as NOX), EARLY FLOWERING 3 (ELF3) and ELF4 by binding to primarily the Evening Element (EE) motif. TOC1 in turn regulates CCA1 and LHY and was only recently identified as a repressor (Gendron et. al., 2012; Hsu and Harmer, 2014).  The PSEUDO RESPONSE REGULATOR (PRR) genes form a part of the second identified transcriptional feedback loop making up the core clock architecture. PRR5, PRR7 and PRR9 repress CCA1 and LHY in a partially redundant manner and enable progression of the clock by showing peaks in transcript level consecutively over the day. Several promoter motifs have been identified to mediate clock-regulated expression at specific times of the day, for example the Morning Element (ME), CCAl-Binding Site (CBS), EE and Midnight Module (PBX/TBX/SBX; Wang et. al., 1997; Harmer et. al., 2000; Harmer and Kay, 2005; Michael et. al., 2008).       4             Figure 1-1 Interlocked transcription-translation feedback loops of transcription factor genes that make up the plant circadian clock. Lightening and yellow circles indicate points at which light can provide input to the clock at the transcriptional and post-transcriptional level respectively. Solid lines indicate transcriptional regulation and dashed lines indicate protein–protein interactions, with arrows for activation and bars for repression or degradation. The green line indicates a hypothetical interaction, and the light grey line indicates an interaction that the model predicts to be extremely weak. Figure reproduced from Fogelmark & Troein, (2014)  5  Alternative splicing and phosphorylation of several clock genes is also observed. ZEITLUPE (ZTL), an F-box protein found exclusively in the cytoplasm, targets TOC1 and PRR5 for proteasomal degradation. GI stabilizes ZTL while CONSTITUTIVE PHOTOMORPHOGENIC 1 (COP1) targets GI for degradation. A splice variant of CCA1 lacking the MYB domain (CCA1β) can interfere with full length CCA1 (CCA1α) function (Hsu and Harmer, 2014). Cytosolic signalling molecules may also play a role in clock regulation of plant processes (Dodd et. al., 2007).  Self-sustained oscillations of mRNA or protein expression of the clock genes may be observed when plants are grown in continuous light or continuous darkness and steady temperature and environment conditions. ‗Zeitgebers‘ like light quality, photoperiod, light intensity and temperature fluctuations provide external cues that entrain oscillations of the clock to the external environment so as to regulate physiological processes most efficiently. Diurnal patterns of transcript and protein abundance characteristic to those particular environmental conditions can be observed which may be different from circadian expression patterns.  Light determines clock oscillation but the clock also functions in the ‗gating‘ of light input. A metaphorical gate prevents light from resetting the clock at inappropriate times of the day, allowing the circadian clock to restrict sensitivity to specific external stimuli at a particular time of the day (McWatters and Devlin, 2011). While sucrose and starch metabolism is clock regulated, rhythmic endogenous sugar signals too can provide metabolic feedback to the clock. Sucrose responsiveness of the clock is most pronounced at (is gated to) mid-day, through modulation of expression of the morning expressed gene PRR7 (Haydon et. al., 2013).   6   Figure 1-2 Temporal expression profiles of Arabidopsis clock genes in wild-type plants. Plants were grown under 12 h light/ 12 h dark cycles before transfer to constant light. (a), (b), (c) are reproduced from Carre and Veflingstad, (2013), data for their figure was obtained from the ‗DIURNAL‘ database (Mockler et. al., 2007). (d) is reproduced from Fogelmark and Troein, (2014). Shaded area indicates night. Open and hatched bars above the charts indicate subjective day and subjective night, respectively.     7  1.1.2 Tissue, organ and species specific clock regulation It was generally assumed that all plant cells contain identical, cell-autonomous multi-loop clocks. However, James et. al., (2008) discovered that several genes in root clocks display markedly different expression properties from those in the shoots. Of the 20 core clock genes only CCA1, LHY, PRR5 and PRR7 were capable of independent oscillations in Arabidopsis roots, while the rest were synchronized by a photosynthesis-related signal from the shoot. The author makes a valid observation, that metabolism is organ-specific, so clocks must be modified to support specific processes in different tissues and organs.  While roots have a simplified clock compared to the shoot, vascular-specific clocks in leaves require an additional clock gene for appropriate oscillation. PRR3 is expressed in a vasculature specific manner and increases stability of the TOC1 core oscillator protein without affecting its transcription (Para et. al., 2007). Endo et. al., (2014) showed that morning loop clock genes and outputs were more active in mesophyll tissue while evening loop clock genes were more active in leaf vasculature. Further they showed that circadian clocks in cells of vascular tissue signal to neighbouring cell clocks in leaves; disruption of the circadian clock in the vasculature, but not the disruption of mesophyll, epidermis, stem or root clocks, affects the most well-studied and prominent clock-regulated process - timing of flower production in Arabidopsis.  Circadian systems have been shown to be well conserved between Arabidopsis, poplar and rice species (Filichkin et. al., 2011). Orthologues of Arabidopsis clock genes have been identified in chestnut trees, teak (Ibanez et. al., 2008, Norlia et. al., 2008) and several other plant species. Wood-forming tissue in eucalyptus have a functional clock and 8% of genes expressed  8  during xylogenesis, including those involved in carbon allocation, hormone signalling, stress response and wood formation, show diurnal expression patterns (Solomon et. al., 2010). Mature Arabidopsis inflorescence stems, which serve as a model for angiosperm secondary cell wall and wood formation (Zhang et. al., 2011) have been little studied in terms of clock and output gene expression regulation. Elongation of the first internode of inflorescence stems shows circadian rhythmicity and is clock- regulated (Jouve et. al., 1998; Jouve et. al., 1999). Niinuma et. al., (2005) observed that stem circumnutation is clock regulated and for the first time performed a genetic analysis of the clock in 4-5cm tall inflorescence stem tissue, identifying the existence of a functional clock.  Secondary cell walls and woody biomass are major sinks for the photosynthetic resources of plants including trees, and it is of interest to further study the genetic mechanisms, like clock regulation, that may drive efficient resource allocation in its tissues.  1.2 Plant cell walls  Cell walls determine plant cell shape, functionality and collectively the plant form. All cells have a primary cell wall capable of growth and expansion, made up of cellulose and hemicellulose (predominantly xyloglucan in Arabidopsis) embedded within a matrix of pectin and proteins. When cells have ceased expansion, differentiation of certain special kinds of cells involves development of toughened secondary cell walls, made up of cellulose, hemicellulose (predominantly glucuronoxylan in Arabidopsis) and lignin. Cellulose is the major load-bearing component of cell walls while xyloglucan forms modifiable cross-links between the cellulose microfibrils, allowing for growth plasticity as well as mechanical strength. Several xylan deficient Arabidopsis mutants have weakened cell walls with collapsed xylem indicating the  9  structural role played by secondary cell wall hemicellulose. Pectin is essential for cell-adhesion and formation of the cell wall matrix. Lignin is a hydrophobic phenolic polymer that impregnates the secondary cell wall matrix, water-proofing it, providing structural support, and is in some cases associated with pathogen resistance. Lignification is considered as a signature for irreversible cell differentiation, since plant enzymes cannot degrade lignin once it has been deposited (Hao and Mohnen, 2014).   1.2.1 Lignin composition and biosynthesis Lignin is a polyphenolic polymer that is formed from the in muro oxidative polymerization of the monolignols p-coumaryl alcohol, coniferyl alcohol and sinapyl alcohol that make up the p-hydroxyphenyl (H), guaiacyl (G) and syringyl (S) lignin polymer units respectively. The intermonolignol bonds are carbon–carbon bonds, condensed bonds or ethers, and the β-O-4′ ether bond is the most common linkage (Boerjan et. al., 2003).   The monolignols that polymerize in the wall to form lignin are a product of the cytosolic phenylpropanoid pathway shown in Fig. 1-3. The phenylpropanoid pathway produces many secondary metabolites involved in plant defence, structural support, and survival. Light protective anthocyanins, flavonoids that determine flower colour and rhizobacterial nitrogen fixation, coumarins and lignans are also products of the same phenylpropanoid pathway (Fraser and Chapple, 2011). The lignin biosynthetic pathway can be divided into two parts – the general phenylpropanoid pathway consisting of genes encoding PHENYLALANINE AMMONIA LYASE (PAL), CINNAMATE-4-HYDROXYLASE (C4H), 4-COUMARATE:COA LIGASE (4CL), HYDROXYCINNAMOYL-COA SHIKIMATE/QUINATE HYDROXYCINNAMOYL TRANSFERASE (HCT), P-COUMAROYL SHIKIMATE/QUINATE 3-HYDROXYLASE (C3H),  10  CAFFEOYL SHIKIMATE ESTERASE (CSE) and CAFFEOYL COA O-METHYLTRANSFERASE (CCOMT). The monolignol specific pathway consists of FERULATE 5-HYDROXYLASE (F5H), CAFFEIC ACID O-METHYLTRANSFERASE (COMT), CINNAMOYL COA REDUCTASE (CCR) and CINNAMYL ALCOHOL DEHYDROGENASE (CAD) (Vanholme et. al., 2012). Many of these enzymes are encoded by gene families. Thirty-five genes from the above gene families can convert phenylalanine to the H, G or S monolignol subunits, but based on evolutionary analysis, promoter analysis and expression data the ‗lignin toolbox‘ genes, identified by Raes et. al., (2005), are thought to encode the 12 enzymes specifically responsible for developmental lignification. A subset of 10 of these genes has been studied in my thesis. Lignin biosynthesis takes place at least in part associated with the endoplasmic reticulum. Monolignol transport through the cytosol, across the plasma membrane, may take place through mechanisms like passive diffusion or ABCG transporter mediated active transport (Alejandro et. al., 2012). Monolignols then polymerise at the cell wall through oxidative radical coupling. One or more laccase or peroxidase enzyme may catalyse this process at the phenoxy radical of the growing lignin chain. Lignin is deposited within the carbohydrate matrix of the cell wall in the final stages of xylem cell differentiation. Lignification begins at the cell corners in the middle lamella; eventually spreading across the secondary wall towards the lumen. The process is regulated by the cell through the supply of available monomers, the chemical reactions involved, the radical-generating capacity and the conditions in the cell wall (Bonawitz and Chapple, 2010).    11   Figure 1-3 The Arabidopsis phenylpropanoid pathway. Enzymes catalysing each step are in bold next to arrows. Dotted arrows represent predicted pathways. Figure modified from Hao and Mohnen, (2014)  1.2.2 Lignified tissue in Arabidopsis Lignin, in the treachery elements and fibers of vascular tissue and its supportive tissue, make up a third of terrestrial woody biomass (Donaldson, 2001). Phloem fibers in stems of many dicot plants, extraxylary fibers beneath the epidermis in grass stems, sclereids in pear fruits, guard cells, root endodermis, trichomes, anther endothecium and dehiscent seed pods are some other examples of secondary cell wall containing tissues or organs (Zhong et. al., 2015). In young Arabidopsis seedlings, appropriate spatial and temporal control of plant cell cycle and cell expansion are required so that neighbouring cells grow in a co-ordinated manner.  12  Procambial meristematic initials give rise to primary xylem and phloem vascular tissue. Young protoxylem elements contain secondary lignified thickenings in a helical or annular arrangement parallel to the growing axis of the cell, to allow cell expansion.  The vascular cambium in mature stems gives rise to xylem vessels, xylary fibres and phloem, while the parenchymatous tissue between the vascular bundles in Arabidopsis stems (interfascicular parenchyma) differentiates to form supportive interfascicular fibre cells. Secondary wall thickenings are formed after cell expansion ceases and initially are largely composed of cellulose and xylan (Albersheim et. al., 2010). Lignin is laid down within the matrix of the thickenings and can account for more than 25% of the dry weight of the mature wall. After lignification, vessel elements undergo cell death resulting in a toughened hollow tube made of dead cell walls. The secondary wall thickening in treachery elements has reticulated, scalariform or pitted wall thickening. Fibers on the other hand have more uniformly thickened secondary walls, except for pits where secondary wall thickening is locally prevented (Schuetz et. al., 2013). The inflorescence stem of Arabidopsis displays a gradient of secondary cell wall development at increasing distances from the shoot apical meristem (Ehlting et. al., 2005). Closer to the top of the inflorescence stem, differentiated vessel elements have thickened secondary cell walls, while interfascicular fibers have not yet formed. Further down the stem, at the same radial distance, vessels are at a more advanced stage of development as compared to fibers. At the bottom of mature inflorescence stems, active lignification of fibers takes place, while most vessels are fully differentiated and metabolically inactive (Hall and Ellis, 2013).     13  1.2.3 Developmental regulation of secondary cell wall formation in stems A hierarchical network of NAC and MYB domain containing transcription factors is important for developmental regulation of secondary cell wall biosynthesis in Arabidopsis (Fig. 1-4). The NAC genes SECONDARY WALL-ASSOCIATED NAC DOMAIN 1 (SND1), NAC SECONDARY WALL THICKENING PROMOTING FACTOR 1 (NST1), NST2, VASCULAR-RELATED NAC-DOMAIN 6 (VND6) and VND7 serve as the master switches for fiber and vessel cell differentiation and have tissue type specific expression. They bind to several common targets and their transcriptional activity converges at the redundantly activating MYB genes MYB42 and MYB83 that have a secondary wall specific expression (Kubo et. al., 2005; Zhong et. al., 2007).  MYB58, MYB63 and MYB85 specifically activate lignin biosynthesis by binding to the AC element in the promoters of PAL, 4CL, C3H, HCT, CCOMT, CCR and CAD family of genes. F5H contains no AC elements and is directly regulated by SND1 (Zhong et. al., 2009). Several other MYB and NAC genes have been implicated in activating deposition of both cellulose and hemicellulose (Fig. 1-4; Schuetz et. al.,2013).  A few repressors in the network have been identified. MYB4 can repress expression of lignin pathway genes by altering expression of 4CL, C4H and possibly CAD family genes. Down-regulation MYB4 is thought to allow lignification in response to wounding (Jin et. al., 2000). MYB32 is also a repressor of lignin deposition and has high levels of expression in poorly lignified tissues like flowers (Preston et. al., 2004). The homeodomain transcription factor gene BREVIPEDICLLUS (BP) represses premature lignin deposition (Mele et. al., 2003). MYB7, MYB4 and MYB32 can repress their own expression as well as the expression of the upstream SND1 transcription factor gene (Wang et. al., 2011).    14     Figure 1-4 An overview of the transcriptional network regulating secondary cell wall biosynthesis in Arabidopsis.  Reproduced from Schuetz et. al., (2013)    15   KNOTTED ARABIDOPSIS THALIANA 7 (KNAT7) is another transcription factor in this regulatory network that represses secondary cell wall formation. KNAT7 is activated by SND1, related NAC genes as well as MYB46 and is strongly expressed in secondary wall containing tissues (Zhong et. al., 2008; Ko et. al., 2009). My thesis deals with exploring the physiological significance of this repressor transcription factor in seedling and mature stem secondary cell wall development.    1.2.4 The KNAT7 repressor complex KNAT7 is a KNOTTED-LIKE HOMEDOMAIN (KNOX) gene that belongs to a plant-specific three-amino acid loop extension (TALE) superclass of homeodomain transcription factors (Hake et. al., 2004). The homeodomain in the KNAT7 protein mediates specific DNA-binding interactions while the MEINOX domain allows interactions with other TALE proteins. Class I KNOX genes play important roles in meristem function, tissue proliferation, control of leaf shape and hormone homeostasis in flowering plants, while the Class II clade of KNOX genes, formed by gene duplication in an ancestor of land plants, is thought to act in an antagonistic biochemical manner to the Class I genes, at least with respect to KNAT3, KNAT4 and KNAT5 (Fururmizo et. al., 2015). KNAT7, which belongs to the Class II clade of KNOX proteins, represses target gene expression in a protoplast transient expression system (Li et. al., 2011; Liu et. al., 2014).  Much more is known about KNAT7 as compared to the other Class II KNOX genes. KNAT7 is strongly expressed, concurrently with secondary wall formation in Arabidopsis stems and young plant hypocotyls (Brown et. al., 2005; Persson et. al., 2005; Liu et al., 2014). KNAT7  16  shows increasing expression from the top to the base of the Arabidopsis inflorescence stem (Li et. al., 2012). Expression profiling and expression pattern filtering by Ehlting et. al., (2005) identified KNAT7 as a candidate involved in regulating secondary cell wall biosynthetic genes in fibers. KNAT7 expression is observed in developing xylem, phloem, interfascicular fibers, cortex close to interfascicular fibers as well as in the cambial region close to the xylem in mature Arabidopsis stems (Li et. al., 2012; Liu et. al., 2014). In seedlings, strong GUS activity driven by the KNAT7 promoter is observed in the vascular systems of roots, hypocotyl and cotyledons, and in the stele of young roots (Li et. al., 2012; Liu et. al., 2014). The knat7-1 knock-out allele (hence referred to as knat7) exhibits thickened interfascicular fiber cell walls in mature stem tissue relative to wild-type stems, while KNAT7 overexpression mutants show the opposite phenotype in the same tissue (Li et. al., 2012; Liu et. al., 2014). This thickened fiber phenotype depends on interaction with BELL1-LIKE HOMEODOMAIN 6 (BLH6) protein as the Pro35S:KNAT7 blh6 plants show wild-type like stem interfascicular fiber thickness. The xylem vessels in knat7 on the other hand show a mild irx phenotype (collapsed, irregular shaped vessels) that is enhanced in the blh6 knat7 background, suggesting that transcriptional regulation by KNAT7 may be complex. A dominant transcriptional repression variant of KNAT7 in transgenic Arabidopsis resulted in thinner interfascicular and xylary fiber cell walls, but no irx phenotype (Zhong et. al., 2008), which may be partly explained for by the fact that the KNAT7 protein is a repressor and a dominant repression mutant would show enhanced repression of KNAT7 targets.  KNAT7 forms a heterodimer with BLH6 to directly repress expression of REVOLUTA/INTERFASCICULAR FIBERLESS1 (REV/IFL1) in interfascicular fibers.  17  Interactions of KNAT7 with BLH6, as well as with  OVATE FAMILY PROTEIN 1 (OFP1) and OFP4 enhance KNAT7 repression activity in protoplast transactivation studies while an activator of anthocyanin biosynthesis, MYB75, shows repression activity when it interacts with KNAT7. MYB75 and KNAT7 transcription factors together also regulate secondary cell wall formation in interfascicular fibers and the seed coat. A decrease in adherence of mucilage to seed coat in knat7 however does not require interaction of the protein with MYB75 (Bhargava et. al., 2013). Expression profiling of secondary cell wall biosynthetic genes has been carried out in knat7 inflorescence stems (Liu et. al., 2014). Increased levels of the expression of two secondary cell wall cellulose synthase genes, CELLULOSE SYNTHASE A7 (CESA7) and CESA8 is observed, while primary wall CESA gene expression remains unchanged.  IRREGULAR XYLEM 7 (IRX7), IRX8, IRX9 and the majority of lignin biosynthesis genes also show increased expression in stem tissue and the total lignin content per gram dry weight is increased (Li et. al., 2012; Liu et. al., 2014). However the relative composition of cell wall sugars (reflecting cellulose and hemicellulose levels) does not show any difference in knat7 stems (Li et. al., 2012). Taken together, these characteristics of the knat7 support a role for KNAT7 as a repressor of secondary cell wall deposition in interfascicular fibers.  Based on the phenotypes of knat7, KNAT7 repressor activity of the protein in protoplast systems, and its position in the developmental transcriptional regulatory network,  Li et. al., (2012) suggested a role for it as part of a regulatory module for resource allocation to the secondary cell wall. KNAT7 is also the target of MYB61 – a resource allocation transcription factor that controls xylem quantity and quality, seed coat mucilage deposition, stomatal closure and lateral root formation (Romano et. al., 2012). The secondary cell wall transcriptional regulatory network consists of multiple feed-forward pathways that activate secondary cell wall  18  biosynthesis while also activating expression of a repressor. It is possible that the physiological significance of the repression activity of KNAT7 and its interaction partners is for resource allocation.   1.3 Clock regulation of secondary metabolism ~30% of a plant‘s photosynthetic resources are driven into the shikimate pathway, which produces the aromatic amino acids required for protein biosynthesis, namely L-tryptophan (Trp), L-phenylalanine (Phe), and L-tyrosine (Tyr) (Maeda and Dudareva, 2012). The shikimate pathway genes are light and clock regulated. The first and the fourth enzymes for biomolecular conversion in the shikimate pathway are regulated by the circadian clock through the EE motif and the CBS promoter elements while the second and fifth enzymes in the pathway are light regulated through the PHYTOCHROME-INTERACTING FACTOR (PIF) binding G-motif promoter element. Resistance to glyphosate, which is an inhibitor of the shikimate pathway enzyme 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase, is conferred by modulating light regulation of this pathway (Sharkhuu et. al., 2014).  Further, in a genome-wide analysis of Arabidopsis transcripts, twenty-three genes involved in phenylpropanoid secondary metabolism showed peaks in expression 20 h after dawn (Harmer et. al., 2000). Cytochrome P450 monooxygenases are likely to be rate-limiting in secondary metabolic pathways and Pan et. al., (2009) also confirmed circadian regulation of P450s in phenylpropanoid as well as carotenoid, oxylipin, glucosinolate and brassinosteroid biosynthesis pathways. Rogers et. al., (2005) used northern blots to show that lignin biosynthetic genes exhibit two different kinds of patterns of periodic transcript variation in 14-days old long day grown plants as compared to long day grown plants transferred to continuous light;  19  indicating evidence for light and clock regulation of lignification. They also showed that metabolizable sucrose levels play an important role in lignin biosynthetic gene regulation.  Donaldson (1992) studied seasonal variations in lignification during one growth season in radiata pine and found that the number of lignifying cells reached a maximum during the summer and was often incomplete at the onset of winter, while Grand et. al., (1979) found that light is necessary for incorporation of guaiacyl but not syringyl residues from radioactively labelled phenylalanine in poplar stems. These are some more lines of evidence for light and clock regulation of lignification in literature.  The goal of my Masters‘ thesis was to confirm diurnal trends in expression of selected lignin biosynthetic genes (LBGs) using quantitative measurements of transcript abundance and to test the hypothesis that KNAT7, a secondary wall specific transcription factor implicated in resource allocation (Li et. al., 2012), plays a role to modulate diurnal regulation of lignin biosynthesis.           20  1.4 Research questions and objectives Hypothesis – KNAT7 forms a negative regulatory loop for resource allocation to secondary cell wall biosynthesis over a 24 hour daily cycle.  Objective 1: Determine if expression of LBGs in wild-type Arabidopsis seedlings shows a free- running (circadian) and diurnal pattern of expression.  Objective 2: Determine if a diurnal pattern of expression of LBGs is observed in wild-type Arabidopsis inflorescence stems. Objective 3: Determine whether KNAT7 contributes to diurnal regulation of LBGs in long day conditions in seedlings and inflorescence stems. Objective 4: Determine if knat7 mutants show any additional phenotypes that may implicate the gene for a role of diurnal regulator.  1.5 Motivation for the research Diurnal light rhythms and a plant‘s internal circadian rhythm are important signals for resource allocation and plant cell walls represent a very large sink for global fixed carbon reserves. Almost 70% of the carbon dioxide fixed by land plants is deposited as secondary cell walls (Pauly and Keegstra, 2008). A highly coordinated gene network, consisting of multiple parallel feed forward pathways is responsible for developmental regulation of secondary cell walls (Schuetz et. al., 2013). However diurnal regulation of secondary cell wall formation has not been well-studied yet.  Laying down of secondary cell walls is an energetically expensive process for the plant and appropriate spatial-temporal control of deposition is essential for plant function (Boudet, 2000). Plants lack any mechanisms for degrading lignified secondary cell walls. Under these  21  circumstances, a negative regulatory loop in the secondary cell wall biosynthesis network would be very important, as it would help the plant sense circadian, diurnal and sucrose availability signals to repress resource allocation to growth and development in limiting conditions.  In order to observe a possible link between KNAT7 and resource allocation, I examined LBG transcript level variation over 48 h periods in Arabidopsis wild-type and knat7 plants by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). I was particularly interested in stem tissue, where largest amounts of secondary cell walls are deposited, KNAT7 has highest levels of expression and the knat7 secondary cell wall phenotypes are observed.  I also used 7-day seedling tissue, since it is the most commonly studied developmental stage for diurnal/circadian rhythm studies. I predicted that if the KNAT7 transcription factor is responsible for repression, based on resource allocation, characteristic diurnal variation in mRNA levels for LBGs (henceforth this refers to the 10 ‗lignin toolbox‘ genes selected to study) in knat7 would be diminished, since the mutants would have lost the ability to repress LBG expression at daily expression minima.  22   Materials and methods Chapter 2: 2.1 Plant material  The knat7-1 (knat7) and 4CL :KNAT7 Arabidopsis thaliana (Arabidopsis) mutants were obtained from Dr. Yuanyuan Liu and are previously described in Li et. al., (2012). Both mutants are in the Arabidopsis ecotype Columbia-0 (Col-0) background and this ecotype was used as the wild type throughout. The knat7 mutant (also named SALK_ 002098) has a T-DNA insertion in the fourth intron of the KNAT7 gene and is from the Arabidopsis Biological Resource Center (ABRC, Columbia, OH, USA, https://abrc.osu.edu/). In 4CL:KNAT7, a parsley 4CL1 promoter drives overexpression of KNAT7 specifically to cells with secondary wall thickening. The genotype of both mutants used in experiments was confirmed (see below).  2.2 Growth conditions Seeds were surface-sterilized with 75% ethanol and planted on Murashige and Skoog (MS) Basal Salts media with minimal organics (Sigma) and 1% (w/v) agar (Sigma).  Plants were grown vertically (agar surface perpendicular to the ground) in wooden supports to collect samples for qRT-PCR analysis. After 3 days of cold-treatment in the dark at 4℃, seedlings were transferred to a growth chamber set at 110µmol m-2s-1 light fluence, 21℃, 70% humidity and a photoperiod of 16 h light/ 8 h dark (long day, LD or16L/8D).  Seedlings for study in continuous light were transferred to 24 h light (continuous light, CL or 24L/0D) after 7 days in 16L/8D. Aluminium foil was wrapped around simultaneously grown long day plants at night to prevent unwanted light exposure. For experiments requiring mature plants, seedlings were transferred to 2×2 inch pots containing soil (Sunshine Mix #4,  23  from SunGro Horticulture Canada Ltd; http://www.sungro.com) and maintained in the same growth conditions described for seedlings, in long day conditions.   2.3 Genotyping mutants DNA was isolated from one to two young rosette leaves by grinding tissue in a 1.5 mL Eppendorf tube containing 500μl Shorty DNA extraction buffer (200mM Tris, 400mM LiCl, 25mM EDTA, 1% SDS). DNA was precipitated from the supernatant using 500μl isopropanol and the pellet was cleaned using 1ml of 70% ethanol. The pelleted DNA was suspended in 100μl distilled water. The presence of the T-DNA insert in knat7 was examined by semi-quantitative PCR using flanking gene specific primers (5‘-AAG TTT GGG CTT GGG CTT GAC-3‘ and 5‘-TTG CCT TGT CAT CTT CCT GTT CA-3‘) and T-DNA left border LBb1.3 (5‘-ATT TTG CCG ATT TCG GAA C-3‘) to select for homozygotes. Primers used to identify presence of a 4CL: KNAT7 construct were 5‘-CTA TAT ATT TGT GAG TTG GTA-3‘ and 5‘-TCC TCT TGC GTT GGT TAA TG-3‘.   2.4 Sample collection for qRT-PCR Five seedlings each were collected in a tube, flash-frozen in liquid nitrogen and stored at -80℃ until they were used. For stem samples, at 5 weeks of age, plants with inflorescence stems with a total height of 25     were identified. Stem sections 10 cm from the base of the inflorescence stems, from 3 plants, were collected in a tube, flash-frozen in liquid nitrogen and stored at -80℃ until they were used. Three biological replicate tubes were collected at 12 time  24  points, every four hours, over two consecutive days. The sample collected at ‗dawn‘ (when light switches on in growth chamber) was defined as the 0 h or 24 h sample.  2.5 RNA extraction and cDNA synthesis Total RNA was extracted using TRIzol® Reagent (Life Technologies, www.lifetechnologies.com) according to the manufacturer‘s instructions. The concentration of RNA was measured using the absorbance at 260 nm and the quality was assessed using the A260/A280 ratio. Single-strand cDNAs were synthesized via reverse transcription using QuaniTect® Reverse Transcriptase kit (Qiagen, www.qiagen.com) that included a genomic DNA elimination step, according to manufacturer‘s instructions.   2.6 qRT-PCR  2.6.1 Reference gene selection The RefGenes tool (Hruz et. al., 2011) was used to identify a set of genes that showed the least variation in expression in a set of all available light, diurnal and circadian microarray experiments in the database, as of October, 2013. The top 20 genes from this list were compared to a list of superior reference genes validated by Czechowski et. al., (2005) and Hong et. al., (2010). Based on the comparison and a survey of reference genes used by circadian biologists UBIQUITIN-CONJUGATING ENZYME 21(AT5G25760; UBC21), PP2A (AT1G13320) and FBOX (AT5G15710) were selected for further analysis of suitability. ACTIN 2 (AT3G18780, ACT2) a traditionally used ‗housekeeping‘ reference gene in qRT-PCR was also included for further testing.   25  A set of 6 wild-type cDNA samples and 6 knat7 cDNA samples was selected to perform qRT-PCR analysis of expression levels of each of the four genes described above. Such an analysis was performed individually for both stem and seedling samples. Fig. 2-1 indicates the threshold cycle (Ct) values for expression of these genes. The best internal reference gene would show the least amount of variation in expression levels in this set of uniformly prepared cDNA samples. Standard deviation was used as a parameter to indicate stability of expression of these genes. For stem samples, FBOX clearly showed the least variation in Ct value and lowest standard deviation as compared to other potential reference genes and was chosen as an internal reference for stem samples. LATE ELONGATED HYPOCOTYL (LHY), a gene that is reported to show robust diurnal cycling in expression (Schaffer et. al., 1998) showed clear variation in Ct values with a much larger standard deviation as compared to all the other potential reference genes. Subsequently, a similar analysis was performed for seedling samples which indicated that FBOX again showed the least variation in Ct value. However, PP2A showed a low standard deviation as well. I also was made aware of the geNorm algorithm (Vandesompele et. al., 2000; part of qbase+ software distributed by Biogazelle; www.biogazelle.com/qbaseplus) for identification of stable reference genes. Analysis using this algorithm showed PP2A to be the most stable reference gene. Several publications studying circadian phenomenon in plants have used PP2A as a reference gene hence I selected this for use for normalization of seedling qRT-PCR results.   26   Figure 2-1 Identification of a stable reference gene for normalization of qRT-PCR. Threshold cycle (Ct) value from qRT-PCR assessing expression of potential reference genes UBC21, FBOX, PP2A, ACT2 and known diurnally oscillating gene LHY in a set of wild-type and knat7 a)stem samples b)seedling samples. Threshold was assigned to a region where exponentially increasing amplification in qRT-PCR was observed. SD, standard deviation of the Ct for a given gene in the twelve samples assayed.  27  2.6.2 Plate Setup cDNA was diluted (1:3 for stem samples, 1:2 for seedling samples) and 1μl was used in each reaction in a 10μl q-RT-PCR reaction volume, using iQ™ SYBR® Green Supermix (Bio-Rad Laboratories Inc.; www.bio-rad.com) following manufacturer‘s instructions.  qRT-PCR amplification was performed with gene-specific primers (Table 2.1). Three technical replicates of qRT-PCR were performed for each primer-sample combination. Given the large number of qRT-PCR experiments to be performed, a strategy to minimize the number of experiments and to manage for inter-run shifts in SYBR Green fluorescence measurement was required. I ensured that reactions of a gene for all 12 time points, for one set of wild-type or knat7 biological replicates was on the same qRT-PCR plate – allowing measurement of accurate diurnal trends for that set of 12 samples. Normalization for inter-run variation was performed using an additional qRT-PCR experiment, where all biological replicates for wild-type and knat7, for the 0h samples were studied on the same plate.  2.6.3 Expression calculation  Fold-change of gene 1 relative to gene 2 = [2^(CT, gene 2 – CT, gene 1)] Actual fold-change of gene 1 relative to gene 2 = [Experimental fold-change for gene 1 relative to gene 2 * Normalization factor] Efficiency of primers used was tested using a dilution curve to ensure that it is within a 95% to 105% range. Specificity of primer binding was tested with a melt curve, at the end of every q-RT-PCR experiment. Error bars represent standard error (SE) of actual fold-changes for the three biological replicates. A student‘s t-test for samples with unequal variance was performed to determine statistically significant differences.  28   2.7 Hypocotyl length measurement and bolting study For hypocotyl length measurements, seeds were grown on petri plates in a similar manner to the ones used for qRT-PCR. Light intensities on different shelves of a growth chamber were modified to obtain fluences of ~3, 12 and 96 µmol m-2s-1, measured using a light meter. Aluminium foil wrapped around petri dishes was used to create dark conditions. At least two plates containing both wild-type and mutant plants were treated to each of these four light conditions for 7 days. On the 8th day individual hypocotyl lengths were measured using the application ImageJ (http://rsb.info.nih.gov/ij) from photographs of plates.  For flowering time analysis, plants were grown on soil at 110 µmol m-2s-1in long day photoperiod and monitored daily for bolting. When the inflorescence stem was greater than 1 cm in height, it was considered to have started ‗bolting‘. The number of days from transfer of seeds to conducive germination conditions, until the day of ‗bolting‘, was counted as ‗days to bolting‘.            29  Table 2-1 Genes studied using qRT-PCR and primer pairs used. GENE LOCUS GENE NAME PRIMER SEQUENCE (5’-3’) AT1G62990 KNAT7 KNAT7-F: AAATTGGTGGAGGAGACAGG KNAT7-R: TCCTCTTGCGTTGGTTAATG AT1G01060 LHY LHY-F: CCAACGAAACAGGTAAGTGG LHY-R: CTTGGGAACATCTTGAACCG AT4G39980 DHS1 DHS1-F: AATACTGGCTGAAGTCCGAG DHS1-R: ATTCTGTCACGTTCTGACCT AT2G37040 PAL1 PAL1-F: AAGATTGGAGCTTTCGAGGA PAL1-R: TCTGTTCCAAGCTCTTCCCT AT2G30490 C4H C4H-F: ACTGGCTTCAAGTCGGAGAT C4H-R: ACACGACGTTTCTCGTTCTG AT1G51680 4CL1 4CL1-F: TCAACCCGGTGAGATTTGTA 4CL1-R: TCGTCATCGATCAATCCAAT AT2G40890 C3H C3H-F: GTTGGACTTGACCGGATCTT C3H-R: ATTAGAGGCGTTGGAGGATG AT5G48930 HCT HCT-F: GCCTGCACCAAGTATGAAGA HCT-R: GACAGTGTTCCCATCCTCCT AT4G34050 CCOMT CCOMT-F: CTCAGGGAAGTGACAGCAAA CCOMT-R: GTGGCGAGAAGAGAGTAGCC AT1G15950 CCR1 CCR1-F: GTGCAAAGCAGATCTTCAGG CCR1-R: GCCGCAGCATTAATTACAAA AT4G36220 F5H F5H-F: CTTCAACGTAGCGGATTTCA F5H-R: AGATCATTACGGGCCTTCAC AT5G54160 COMT COMT-F: TTCCATTGCTGCTCTTTGTC COMT-R: CATGGTGATTGTGGAATGGT AT4G34230 CAD1 CAD1-F: TTGGCTGATTCGTTGGATTA CAD1-R: ATCACTTTCCTCCCAAGCAT AT1G13320 PP2A PP2A-F: TAACGTGGCCAAAATGATGC PP2A-R: GTTCTCCACAACCGCTTGGT AT5G15710 FBOX FBOX-F: TTTCGGCTGAGAGGTTCGAGT FBOX-R: GATTCCAAGACGTAAAGCAGATCAA AT5G08290 ACT2 ACT2-F: CCTGAAAGGAAGTACAGTG ACT2-R: CTGTGAACGATTCCTGGAC AT5G25760 UBC21 UBC-F: TTAGAGATGCAGGCATCAAGAGCGC UBC-R: CATATTTCTCCTGTCTTGAAATGAA    30   Diurnal patterns of expression of lignin biosynthetic genes in wild-type Chapter 3:Arabidopsis thaliana   3.1 Introduction Expression profiling experiments have suggested that up to one third of the genes in the Arabidopsis genome are regulated by the circadian clock (Harmer et. al., 2000; Covington et. al., 2008). Harmer et. al., (2000) identified rhythmic up- and down-regulation of expression of 23 phenylpropanoid biosynthetic genes in continuous light (CL) grown seedlings, with all having one peak in expression at 20 h after dawn. Rogers et. al., (2005) showed by northern blot analysis that 11 genes of the phenylpropanoid pathway involved in developmental lignification show rhythmic variation in diurnal expression, attributable to both light regulation and circadian clock regulation. Pan et. al., (2009) reported a circadian rhythm in expression of the rate-limiting cytochrome P450 genes (C3H, C4H and F5H) and some other genes of the monolignol branch of the phenylpropanoid pathway; a promoter analysis identified (CCA1-binding sites) CBS and morning element (ME) elements over-represented in these genes.  In this chapter my aim was to confirm diurnal and circadian rhythmicity in transcript abundance of selected lignin biosynthetic genes (LBGs) by studying LBG expression in seedlings in controlled longday (LD) and CL conditions. Temporal expression patterns identified with better accuracy and resolution in wild type (Col-0) Arabidopsis will serve as a baseline to observe any changes in LBG expression in mutant backgrounds. Further, characterisation of diurnal patterns of LBGs in tissue from mature Arabidopsis stems  would provide baseline data to investigate regulation of LBGs by KNAT7 in the tissue where prominent secondary wall defects have been observed due to loss-of-function of this transcription factor gene. I also chose  31  to observe diurnal and circadian patterns in conditions where seedlings were limited to their own photosynthetic capabilities (without added sucrose in the growth media), since evidence over the last few years has re-affirmed the importance of sucrose as an input as well as output to the plant circadian clock (Haydon et. al., 2013).   3.2 Results 3.2.1 Temporal expression patterns of LHY and DHS1 genes in wild-type seedlings LHY is a core clock gene responsible for maintenance of circadian oscillations in plants cells and DHS1 encodes the first enzyme in the shikimate pathway. DHS1 has been reported to be under circadian clock regulation by binding of clock genes to its promoter (Sharkhuu et. al., 2014). In order to validate my qRT-PCR setup, I first assayed the temporal variation in expression of these two genes from 7-8 day old seedlings grown in LD and CL conditions on agar medium without added sucrose. Steady state mRNA levels of LHY, assayed by qRT-PCR, showed a peak in expression at ‗dawn‘ (0 h and 24 h; defined as the time when light switches on in the growth chamber) in LD grown seedlings and a similar pattern was observed in CL grown seedlings (Fig. 3-1). These patterns are in agreement with published literature (Schaffer et. al., 1998) and confirmed the validity of the assay system including RNA extraction, qRT-PCR setup, and the reference genes used to normalize expression from different samples.  DHS1 transcripts showed increasing abundance from dawn to end of the day in LD conditions, confirming its diurnal regulation (Fig. 3-1b). However, a  largely arrhythmic pattern of expression was observed in CL for this gene (Fig. 3-1d), suggesting lack of strong circadian clock regulation in these growth conditions. This is in contrast to the findings of Sharkhuu et al., (2014), who identified a DHS1 expression peak 1 h after dawn and an expression trough at 16 h  32  for LD grown plants and a peak in the middle of the day for CL grown plants. It appears that differences in growth conditions influence diurnal and clock regulated expression of DHS1.   3.2.2 Temporal expression patterns of lignin biosynthetic genes in wild-type seedlings We do not yet fully understand light and the circadian clock regulation of secondary metabolism, hence it is essential to identify whether lignin biosynthetic genes show diurnal variation in expression levels in the experimental growth conditions of LD used in this study as well as test for persistence of any rhythmic expression variation in the CL growth conditions that were established in the previous section. I used qRT-PCR to assay the diurnal and circadian expression patterns of a set of 10 LBGs in 7-8 day old seedlings. One member of each of the gene families involved in developmental lignification, as described by Raes et. al., (2003), was studied.  LBGs showed consistent variations in transcript abundance over the two days expression was assayed, in both LD and CL (Figs. 3-2, 3-3, 3-4, 3-5). A peak at 4 h after dawn, drop in transcript abundance between 4-8 h after dawn and sharp drop in abundance at night (16-24 h after dawn) was observed for many LBGs in LD grown plants. PAL1, C4H and 4CL1 had distinctly different patterns of expression as compared to F5H and COMT in LD conditions. All five of these genes showed very clear and reproducible rhythmicity in temporal mRNA abundance as compared to the other LBGs. PAL1, C4H and 4CL1 however showed an additional up-regulation after the 8 h time point expression trough. An additional peak in expression at the end of day was observed for these three genes, not observed for F5H or COMT (Fig 3-2).    33    Figure 3-1 Temporal expression patterns of LHY and DHS1 in wild-type seedlings grown in LD. 7-8 day old Col-0 seedlings grown on agar plates were assayed. (a), (b), LD (16L/8D entrained seedlings. (c), (d), LD-grown seedlings transferred to CL (24L/OD) at (-)8 h. Shaded regions indicate night or ‗subjective‘ night. Maximum expression levels were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates.        34  When plants entrained in LD conditions were transferred to CL, an almost immediate change in the expression pattern of many LBGs was observed (Figs. 3-3, 3-5). This change was most striking for PAL1, C4H, 4CL1, F5H and COMT, as the sharp decreases in transcript abundance of these genes at night, observed in LD, were replaced by increased or plateauing expression in the subjective nights.  LBG expression in CL seemed to be more co-regulated as compared to their diurnal patterns in LD. A drop in abundance around subjective midday and peak at subjective night was observed.  No evidence of diurnal regulation of C3H transcript abundance was observed in both LD and CL conditions in these experimental conditions (Figs. 3-4, 3-5). In some cases high biological variability seemed to obscure apparent diurnal patterns in transcript abundance (e.g. CCOMT in LD; Fig. 3-4; F5H, COMT, CAD1 in CL; Fig. 3-2, 3-4). However, overall clear rhythmicity in transcript abundance was observed for most LBGs in LD and presence of rhythmic expression variation even in CL confirmed that expression of LBGs is controlled by a circadian clock in the experimental conditions used.    35   Figure 3-2 Temporal expression patterns of PAL1, C4H, 4CL1, F5H and COMT in wild-type seedlings grown in LD.  7-8 day old Col-0 seedlings grown on agar plates were assayed. Shaded regions indicate night. Maximum expression levels were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates.   36   Figure 3-3 Temporal expression patterns of PAL1, C4H, 4CL1, F5H and COMT in wild-type seedlings grown in CL.  7-8 day old Col-0 seedlings grown on agar plates were assayed. Shaded regions indicate ‗subjective‘ night. Maximum expression levels were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates. 37   Figure 3-4 Temporal expression patterns of C3H, HCT, CCOMT, CCR1 and CAD1 in wild-type seedlings grown in LD.  7-8 day old Col-0 seedlings grown on agar plates were assayed. Shaded regions indicate night. Maximum expression levels were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates.  38   Figure 3-5 Temporal expression patterns of C3H, HCT, CCOMT, CCR1 and CAD1 in wild-type seedlings grown in CL.  7-8 day old Col-0 seedlings grown on agar plates were assayed. Shaded regions indicate ‗subjective‘ night. Maximum expression levels were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates.   39  3.2.3 Temporal expression patterns of LHY and DHS1 genes in wild-type inflorescence stems While several studies have examined diurnal and circadian rhythms in gene expression in seedlings, no studies have focused on the mature inflorescence stems where secondary wall formation and lignin deposition represents a major metabolic sink. To investigate such rhythms, I used the lower 10 cm of inflorescence stems from 5-week old Arabidopsis plants grown under LD to assay gene expression levels over a 48 h time period. Steady state mRNA levels of LHY, quantified by qRT-PCR, showed a peak in expression at ‗dawn‘ while DHS1 showed increasing levels from dawn to the end of the day in mature stem tissue (Fig. 3-6). The pattern of diurnal expression of these genes in stems showed consistent rhythmicity over the two days of the study. They had expression peaks in the same phase as in seedlings. Thus the presence of temporally varying transcript abundance of these genes indicates that these stem samples are well suited to study diurnal regulation of LGBs in stems.   3.2.4 Temporal expression patterns of lignin biosynthetic genes in wild-type inflorescence stems I used the stem samples described above to assay expression levels of the 10 LGBs over a 48 h period. Although there were large biological variations in transcript abundance, at night LBG gene expression was generally lower by about 2-fold than expression levels over the day (Figs. 3-7, 3-8). However, it is difficult to discern consistent, rhythmic diurnal patterns in expression as seen for LHY in the same samples. F5H, one of the rate limiting genes in the monolignol specific branch of the phenylpropanoid pathway, showed the clearest diurnal pattern in expression with low levels of expression in the night and higher levels during the day.  40   Figure 3-6 Temporal expression patterns of LHY and DHS1 in wild-type inflorescence stems grown in LD.  Lower 10cm of inflorescence stems of 5 week old plants grown on soil were assayed. Shaded regions indicate night. Maximum expression levels were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates.   41   Figure 3-7 Temporal expression patterns of PAL1, C4H, 4CL1, F5H and COMT in wild-type inflorescence stems grown in LD.  Lower 10cm of inflorescence stems of 5 week old plants grown on soil were assayed. Maximum expression levels were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates.   42   Figure 3-8 Temporal expression patterns of C3H, HCT, CCOMT, CCR1 and CAD1 in wild-type inflorescence stems grown in LD.  Lower 10cm of inflorescence stems of 5 week old plants grown on soil were assayed. Shaded regions indicate night. Maximum expression levels were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates.    43  3.3 Discussion The presence of clear, reproducible variation in LHY expression in seedlings (Fig. 3-1) with a phase as reported in the literature, confirmed the validity of my experimental setup. Clear rhythmicity in expression in seedlings and stems indicated the presence of a functional circadian clock in the two wild-type developmental stages studied.  LHY is part of the first identified transcription- translation feedback loop of the endogenous circadian clock and has been well studied in Arabidopsis seedlings. All tissues and cell-types studied to date show cycling expression of this gene over a 24 h time period (Hsu and Harmer, 2014, Marti and Webb, 2014). Eucalyptus developing xylem has been observed to express LHY with a peak in transcript levels at dawn (Solomon et. al., 2010). A similar pattern in observed in the vascular tissue of leaves separated by microdissection from the rest of the leaf (Endo et. al., 2014). While LHY expression in secondary cell wall rich inflorescence stem bases has not been studied before it was expected that would also show similar diurnal rhythmicity.  Rhythmically expressed genes are so controlled by time-of-day specific binding of clock transcription factors at their promoter.  LHY and CCA1 are dawn phased repressors that function partially redundantly by binding to the EE and CBS (Michael et. al., 2008). DHS1 is an example of a gene regulated by the clock by binding to EE and CBS at its promoter. Rhythmic variation in expression of DHS1 was observed in seedling and stem samples in my experimental conditions (Figs. 3-1, 3-6), the phase of expression of DHS1 in LD was not as reported (Sharkhuu et. al., 2014). This may be because these authors used different growth conditions as the ones I used: a light intensity of 22±2 µmol m-2 s-1 was used in the previous study as compared to the 110 µmol m-2 s-1 used in my experiment. Seedlings in the previous study were also grown on 2% sucrose. Light and sucrose have been shown to affect the pace of clock  44  regulated genes like CHLOROPHYLL A/B-BINDING PROTEIN 2 (CAB2) and CAROTENOID AND CHLOROPLAST REGULATION 2 (CCR2) (Millar, 2004, Haydon et. al., 2013). I queried the ‗Diurnal‘ database, a web-based tool for accessing standard diurnal and circadian gene expression profiles from a collection of Arabidopsis microarray experiments (Mockler et. al., 2007) and found that in seedlings grown in conditions slightly different from my experiment, DHS1 shows peaks in expression between 8-12 h after dawn. Hence different phases in diurnal expression of DHS1 may be observed in different environmental conditions. It is not clear why DHS1 showed no circadian regulation in CL grown seedlings.  As expected, most LBGs showed clear and consistent changes in expression levels over the two days of our study when studied in 7-8 day old seedlings (Figs 3-2, 3-4). Robust oscillations of LBGs, studied in seedlings, have been reported several times in the literature (Harmer et. al., 2000; Rogers et. al., 2005, Pan et. al., 2009) I also confirmed that LBGs show rhythmic up- and down- regulation of transcript abundance even in that constant environment conditions of CL (Figs. 3-3 and 3-5), indicating that an independent oscillator like the circadian clock regulates expression of the LBGs. Most reported clock genes and clock regulated genes studied show one peak in expression over a daily cycle, so the existence of more than one peak in LBG expression is unusual but not unexpected as Rogers et. al., (2005) also found more than one peak in expression of LBGs grown in LD conditions. They observed a peak at 4 h after dawn, only in diurnal conditions, while a peak at 23 h was observed in diurnal as well as circadian conditions. I also observed a peak in LBG expression at 4 h after dawn under my experimental LD conditions, but did not include a time point corresponding to the second peak reported by Rogers et. al., (2005)  45  at 23 h after dawn. In my conditions a second peak at 16 h after dawn was observed for some genes in LD grown seedlings.  PAL1, C4H and 4CL1, as part of anthocyanin biosynthesis studies, have been shown to be light induced (Das et. al., 2012) which is consistent with the observation that they show a peak after dawn in my experimental conditions. Secondary wall network analysis by an enhanced Yeast-1-Hybrid assay showed that PAL1, C4H, and HCT promoters may be regulated by HY5, a protein related to the phytochrome light signalling pathway (Taylor-Teeples et. al., 2014). The presence of a dark period before dawn is required to observe this peak in LBGs. This is in agreement with results from Rogers et. al., (2005).  Further, I found that when plants entrained in LD are transferred to CL, a rapid response to light extension is observed clearly for genes like PAL1, C4H, 4CL1 and F5H. This too may be a response to an acute light regulatory pathway.  In constant CL conditions a drop in expression of LBGs at subjective midday and a peak in expression at subjective night is observed. It is curious that even in conditions of abundant light, a drop in LBG expression takes place in the middle of the subjective day. A drop in transcript levels of several core clock genes is essential to allow expression of other reciprocally repressed transcription-translation feedback loops (McClung, 2006). The drop in expression of LBGs at 8 h after dawn may reflect rhythmicity of the clock genes regulating their expression, for example expression of a daytime repressor, like the PRR genes. Or it may be that rhythmicity of LBGs is a knock-on effect or default pattern related to diurnal regulation of other branches of the phenylpropanoid pathway (for example light-protective and plant defence compound related pathways). Since lignification represents an irreversible differentiation step in secondary growth, these patterns may be linked to resource availability signals, but Rogers et. al., 2005 showed that  46  the sex1 mutant, that is deficient in starch turnover, shows an overall reduced level of expression of LBGs, but an unchanged diurnal pattern of expression.  We would expect that any diurnal processes regulating secondary wall formation in seedlings would be more active in inflorescence stem tissue, that deposit large amounts of carbon in its extensively lignified vascular and supportive tissue network. Yet in LD grown inflorescence stems diurnal variation in expression levels of LBGs were not clearly observed (Figs 3-7, 3-8). It is difficult to explain this result based on the current limited knowledge we have of diurnal regulation of LBGs. Developing xylem in Eucalyptus showed clear diurnal rhythmicity in expression of C4H, C3H, CCOMT, F5H and CAD2 (Solomon et. al., 2010). It is possible the number of independent stem samples was not large enough to observe diurnal trends above inherent biological variation. Efforts were made during stem sample collection to minimize developmental differences in stem growth, by ensuring that stems harvested were between a narrow range of total heights at the time of collection (25 cm ± 1cm). F5H is considered to be one of the rate-limiting enzymes of the lignin biosynthetic pathway and functions specifically in the phenylpropanoid pathway branch for monolignol biosynthesis (Fraser and Chapple, 2011). This gene did show a clearer diurnal variation in expression as compared to the other LBGs studied. In summary, I was able to confirm validity of my qRT-PCR methods as well as appropriateness of the tissue samples to study diurnal regulation of LBGs, laying the ground work for future studies. Clear diurnal and circadian regulated expression of LBGs was observed in seedlings and presence of an oscillating clock observed in mature Arabidopsis stems was identified based on rhythmicity of LHY and DHS1 expression in this tissue; however LBGs in stems showed negligible diurnal variation in expression level.  47   Role for KNAT7 in diurnal regulation of lignin biosynthetic genes in seedlings Chapter 4:and stems  4.1 Introduction KNAT7 is a transcriptional regulator and a part of the complex gene network that regulates secondary cell wall biosynthesis and deposition in land plants such as Arabidopsis and poplar. Multiple feed-forward pathways of NAC and MYB master regulators direct expression of KNAT7 as well as of genes encoding enzymes required for the biosynthesis of the cellulose, hemicellulose and lignin components of the cell wall (Schuetz, et. al., 2013). KNAT7 is expressed co-ordinately with genes involved in secondary wall biosynthesis in young Arabidopsis seedlings as well as in inflorescence stems, with maximum levels of its expression observed at the base of the inflorescence stem (Brown et. al., 2005, Persson et. al., 2005, Ehlting et. al., 2005). KNAT7 acts as a transcriptional repressor in transient protoplast transactivation assays (Li et. al., 2012; Liu et. al., 2014). Inflorescence stems in knat7 loss-of-function mutants show thicker interfascicular fiber cell walls while overexpression lines show thinner walls, and the amount of lignin at the bases of mature knat7 stems is increased (Li et. al., 2012; Liu et. al., 2014). These properties as well as the position of KNAT7 in the secondary wall regulatory network lead to the proposal that KNAT7 functions in a negative regulatory module to fine-tune resource allocation to secondary cell walls in the fiber cells of inflorescence stems (Li et. al., 2012; Liu et. al., 2014). Data presented in Chapter 3 and from the literature (Harmer et. al., 2000; Rogers et. al., 2005; Pan et. al., 2009) indicate that several lignin biosynthetic genes show diurnal variations in expression levels in response to factors such as light and an internal circadian oscillator. Massive  48  amounts of carbon derived from photosynthesis are deposited into the secondary cell walls over the course of development. During the day photosynthate is assimilated and transported as sucrose, while in the night starch reserves are utilized in a well-regulated manner so that enough reserves are available at the end of night, in accordance with day-length (Blasing et. al., 2005). Almost 30% of these photosynthetic resources are driven into the phenylpropanoid branch of the shikimate pathway which eventually leads to biosynthesis of the monolignols incorporated into lignin (Maeda and Dudareva, 2012). In this chapter, I tested the hypothesis that a role of the KNAT7 repressor transcription factor is the diurnal regulation of lignin biosynthetic genes in coordination with diurnally varying carbon availability over a 24 h light and dark cycle. If KNAT7 is involved in diurnal regulation, it was expected that transcript abundance of lignin genes in seedlings and stems of a knat7 loss-of-function mutant would show changes in diurnal expression variation as compared to wild-type expression patterns.   4.2 Results  4.2.1 Temporal expression patterns of the KNAT7 gene in wild-type seedlings and stems Core clock component genes in Arabidopsis show diagnostic peaks in expression once every 24 h cycle. Expression is entrained by environmental cues and persists in constant conditions such as continuous light (CL) exposure (Hsu and Harmer, 2014). I used qRT-PCR to determine if KNAT7 temporal expression showed any such trends in wild-type Arabidopsis seedlings. In long day (LD) grown seedlings, a relatively stable pattern of KNAT7 expression was observed over the 24 h cycle, no diagnostic peaks similar to other clock genes was observed. Transfer to CL however resulted in a peak in expression at 8 h after subjective dawn and a drop at 28 h (Fig. 4-1). Hence KNAT7 expression levels seem to be responsive to transfer to  49  continuous light conditions in seedlings, suggesting that photoperiod sensing may be relevant to KNAT7‘s physiological function. I carried out a similar experiment under LD conditions using the lower 10cm of mature wild-type stems. Any potential diurnal trends in expression were obscured by large biological variation between samples (Fig 4-2). However, tendency towards higher expression of KNAT7 in the day and lower expression in the nights seemed to be present consistently on both days of the experiment.    Figure 4-1 Temporal expression patterns of KNAT7 in wild-type seedlings grown in LD and CL. 7-8 day old Col-0 seedlings grown on agar plates were assayed. (a) LD (16L/8D entrained seedlings) (b) LD-grown seedlings transferred to CL (24L/OD) at (-)8 h. Dotted lines indicate expression levels from (a) for comparison. Shaded regions indicate night or ‗subjective‘ night. Maximum expression levels in LD samples were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates.   50   Figure 4-2 Temporal expression pattern of KNAT7 in wild-type inflorescence stems grown in LD. The lower 10cm of inflorescence stems of 5 week old plants grown on soil were assayed. Shaded regions indicate night. Maximum expression levels were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates  4.2.2 Temporal expression patterns of LHY and DHS1 genes in knat7 seedlings and stems  No change in LHY expression pattern was observed in knat7 seedlings (Fig. 4-3a) or inflorescence stem bases (Fig 4-4a) relative to wild type, as expected, since all previous reports implicate KNAT7 in the control of secondary cell wall biosynthesis, which would be downstream of clock regulation, controlled by LHY. In knat7 seedlings grown in LD conditions, DHS1, the evening phased, clock regulated, shikimate pathway gene, showed consistently lower expression levels during the day (4 h-16 h) on both days of study. In the night DHS1 levels were unchanged (Fig. 4-3b). However, variability between samples made it difficult to discern consistent statistically significant differences. To gain statistical power, I pooled expression data from light time points of the first and second 24 h periods (Day 1, 4 h, 8 h, 12 h, and 16 h time points; Day 2, -12 h, -8 h, 28 h and  51  32 h time points) and similarly pooled data from dark time points of the first and second 24 h periods (Night 1, Night 2). The results from this are shown in Fig. 4-5a and DHS1 consistently showed decreased expression in knat7 in the day but not in the night, while LHY expression was unchanged in knat7 after performing a similar analysis (data not shown). In knat7 stems, no change in DHS1 expression was observed relative to wild type levels at a p≤0.05 threshold of statistical significance (Fig 4-4b).    Figure 4-3 Temporal expression patterns of LHY and DHS1 in wild-type and knat7 seedlings grown in LD.  Blue line, wild-type seedlings (data from Chapter 3); yellow line, knat7 seedlings. 7-8 day old seedlings grown on agar plates were assayed. Shaded regions indicate night. Maximum expression levels in wild-type were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates. Asterisk indicates a significant difference at p≤0.05.   52   Figure 4-4 Temporal expression patterns of LHY and DHS1 in wild-type and knat7 inflorescence stems grown in LD.  Black lines, wild type (data from Chapter 3). Maroon lines, knat7. Lower 10cm of inflorescence stems of 5 week old plants grown on soil were assayed. Shaded regions indicate night. Maximum expression levels in wild-type were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates.   53   Figure 4-5 Expression of DHS1, C3H and F5H in the day and night in wild-type and knat7 seedlings grown in LD.  Day 1: Data from 4 h, 8 h, 12 h, and 16 h time points were pooled; Day 2: Data from -12 h, -8 h, 28 h, 32 h time points were pooled; Night 1: Data from -4 h, 0 h time-points were pooled; Night 2: Data from 20 h, 24 h time points were pooled. 7-8 day old seedlings grown on agar plates were assayed. Bars indicate SE of 3 biological replicates at each time point. Asterisk indicates a significant difference at p≤0.05.             54   Figure 4-6 Temporal expression patterns of PAL1, C4H, 4CL1, F5H and COMT in wild-type and knat7 seedlings grown in LD.  Blue lines, wild type (data from Chapter 3). Yellow lines, knat7. 7-8 day old Col-0 seedlings grown on agar plates were assayed. Shaded regions indicate night. Maximum expression levels in wild-type were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates. Asterisk indicates a significant difference at p≤0.05.    55   Figure 4-7 Temporal expression patterns of C3H, HCT, CCOMT, CCR1 and CAD1 in wild-type and knat7 seedlings grown in LD.  Blue lines, wild type (data from Chapter 3). Yellow lines, knat7. 7-8 day old Col-0 seedlings grown on agar plates were assayed. Shaded regions indicate night. Maximum expression levels in wild-type were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates. Asterisk indicates a significant difference at p≤0.05.    56    Figure 4-8 Temporal expression patterns of PAL1, C4H, 4CL1, F5H and COMT in wild-type and knat7 inflorescence stems grown in LD.  Black line, wild type (data from Chapter 3); Maroon line, knat7. The lower 10cm of inflorescence stems of 5 week old plants grown on soil were assayed. Maximum expression levels in wild-type were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates. Asterisks indicate a significant difference at p≤0.05.   57   Figure 4-9 Temporal expression patterns of C3H, HCT, CCOMT, CCR1 and CAD1 in wild-type and knat7 inflorescence stems grown in LD.  Black line, wild type (data from Chapter 3); Maroon line, knat7. The lower 10cm of inflorescence stems of 5 week old plants grown on soil were assayed. Maximum expression levels in wild-type were set to ‗1‘ and expression at all other time points are relative to this value. Bars indicate SE of 3 biological replicates. Asterisks indicate a significant difference at p≤0.05.  58  4.2.3 Temporal expression patterns of lignin biosynthetic genes in knat7 seedlings and stems Next I assayed LBG expression levels in LD grown knat7 seedlings to test for changes from the wild-type diurnal patterns previously described in Figs. 3-2 and 3-4.  For most LBGs, no consistent change in diurnal expression pattern, over the two days of the study, was observed in knat7 (Figs. 4-6, 4-7). However, F5H and C3H showed some evidence for decrease in gene expression over the diurnal cycle in knat7 relative to wild type.  The pooling of samples strategy described for DHS1 in the previous section was applied to LBGs. As shown in Fig. 4-5, F5H expression was significantly lower in knat7 than in wild type in all four of the data pools, while C3H expression was significantly lower in the Day 1 and Day 2 pools than in wild type. Thus KNAT7 does act to regulate overall expression levels of at least some LBGs in seedlings and may also play a role in diurnal regulation of expression of C3H in LD grown seedlings. Expression of F5H and C3H, two of the three rate-limiting cytochrome P450 genes, seems to be affected in knat7 seedlings grown in LD.  Next I assayed the diurnal expression patterns of LBGs in the lower 10cm of 5-week old knat7 inflorescence stems, where the knat7 secondary cell wall phenotype has been described (Li et. al., 2012; Liu et. al., 2014). Relative to wild type, in knat7, overall expression levels of many LBGs were increased (Figs. 4-8, 4-9) consistent with earlier reports from single time-point experiments (Li et. al., 2012; Liu et. al., 2014).  Unlike results from seedlings, it was observed that temporal expression patterns of LBGs in knat7 stems were not consistent on both days of the experiment, and variation in expression levels between biological replicate samples made it difficult to identify statistically significant diurnal changes in gene expression in knat7 stems.   59  Yet, I observed that some LBGs, especially those encoding enzymes for general phenylpropanoid metabolism at the start of the pathway (PAL1, C4H, 4CL1) and some enzymes required for G and S monolignol biosynthesis (C3H, HCT, CCOMT) showed larger variations in expression over the day as compared to the wild-type levels. To represent this, I pooled expression data from all time points, for a given gene, and prepared a box-plot representing the spread of the expression data over the two days of the experiment (Fig 4-10). Maximum expression of many LBGs over the two day period, represented by the top edge of the bar, and median expression value, represented by the centre of the box, was higher in knat7 stems. Further, the difference between maximum and minimum values, represented by the range between the bars, was also greater for many LBGs in the knat7 background, indicating that greater variation in expression of the LBGs, over the two days, occurred in the absence of KNAT7 function. CAD1, C3H, HCT and CCOMT showed the largest increase in the range of transcript abundance values of the respective genes in knat7 stems.   4.2.4 Temporal expression patterns of lignin biosynthetic genes in a second replicate set of knat7 stems In the experiments described in the previous chapter, LBG transcript levels in inflorescence stems of wild-type plants grown in LD conditions were generally at a minimum in the night, with low levels persisting at dawn. However in in knat7 stems, many LBGs showed a trend of increased transcript levels at dawn, relative to wild type (Figs. 4-8, 4-9). This trend was also observed on the second day of the experiment and was seen in all genes except for F5H and COMT.    60   Figure 4-10 Spread of LBG expression data over 48 h in wild-type and knat7 inflorescence stems grown in LD.  Grey, wild type; Maroon, knat7. The lower 10cm of inflorescence stems of 5 week old plants grown on soil were assayed. Expression data is the same as used in Fig 4.8, 4.9. Bars indicate maximum and minimum expression. Boxes represent upper quartile, median and lower quartile of all expression data at the 48 h time point for a given gene. Asterisk indicates a significant difference between average expression at p≤0.05 for a given gene.  61  Apparent biological variability made it difficult to draw definitive, statistically significant conclusions about this trend. Thus, I repeated the experiment with a second collection of stem samples and assayed expression of selected LBGs (the cytochrome P450 genes, HCT, CCOMT and COMT) as well as of LHY and DHS1, only at the crucial 0 h and 24 h dawn time points. The three biological replicates for each of these two time points were pooled to increase statistical power, and the average expression values in knat7 stems were compared to wild-type levels in a combined ―dawn‖ dataset for the two days.  Fig. 4-11 shows the results of this second experiment. Similar to the first stem collection, LHY and DHS1 did not show statistically significant differences in expression levels at the dawn time-point. However, significantly increased expression was observed for C3H, HCT, CCOMT and COMT confirming trends from the first stem experiment for C3H, HCT, and CCOMT. In the first experiment analysing expression in inflorescence stems, F5H and COMT did not show a trend of higher expression at dawn relative to wild-type stems. However in this second stem experiment F5H showed significantly decreased expression, while COMT showed increased expression (Fig.  4-11). Overall, these data support a role for KNAT7 in repressing the expression of certain LBGs during the night, suggesting that KNAT7 may be required to ensure physiologically appropriate reduced expression levels at the end of the night. KNAT7 does not regulate diurnal expression of all LBGs in the phenylpropanoid pathway in the same manner, a trend seen in knat7 stems and seedlings.     62   Figure 4-11 Expression of LHY, DHS1, C4H, C3H, HCT, CCOMT, F5H and COMT at dawn in a second stem collection set of wild-type and knat7 inflorescence stems grown in LD.  Gray bars, wild type; Maroon bars, knat7. The lower 10cm of inflorescence stems of 5 week old plants grown on soil were assayed. Expression data from two sets of samples, at the 0 h and 24 h time points (―dawn‖), were pooled. Expression levels of each gene in wild-type were set to ‗1‘ and expression in knat7 is relative to this value. Bars indicate SE of 6 biological replicates. Asterisks indicate a significant difference at p≤0.05.               63  4.2.5 Phenotypic analysis of KNAT7 mutants My data on LBG expression in inflorescence stems in the knat7 mutant suggest a connection between KNAT7 and diurnal/circadian regulation. Given this apparent connection, it was of interest to determine if any clock-related phenotypes are present in the knat7 mutant. Depending on the clock component altered, clock mutants develop either longer or shorter seedling hypocotyls relative to wild type, and exhibit either accelerated or delayed timing of floral transition, as assayed from bolting of the inflorescence stem (McClung, 2006).  To test for possible clock-related phenotypes in knat7, I measured hypocotyl lengths of wild-type, knat7 and KNAT7 overexpression (4CL:KNAT7) seedlings grown in the dark (0 µmol m-2s-1) and at low (3 µmol m-2s-1), medium (12 µmol m-2s-1) and high (96 µmoles m-2s-1) light fluences. These results are shown in Table 4.1. In the dark, hypocotyls of knat7 were significantly more elongated compared to wild-type, while the overexpression line 4CL:KNAT7 showed shorter hypocotyls. A similar result was observed at the low fluence light intensity. In medium fluence light only knat7 hypocotyls were significantly longer, and in high fluence light only 4CL:KNAT7 hypocotyls were significantly shorter than wild-type. Repetition of this experiment gave similar results (Table 4.2).  Since flowering time is also clock-controlled, I tested days to bolting (counted from the day seeds were transferred to light and temperature conducive to germination). Within the populations of plants tested, knat7 plants bolted later than wild-type plants while 4CL:KNAT7 bolted later than both wild-type and knat7 plants (Table 4.2).  Thus KNAT7 mutants show altered hypocotyl growth and bolting time; phenotypes that commonly accompany mutations in genes required for clock regulation.    64   Table 4-1 Hypocotyl lengths in wild type knat7 and 4CL:KNAT7 seedlings (Replicate 1).  Hypocotyl Length (cm) Genotype 0 µmol m-2s-1 3 µmol m-2s-1 12 µmol m-2s-1 96 µmol m-2s-1 Wild-type 0.856 ± 0.027 1 0.265 ± 0.015 0.148 ± 0.006 0.130 ± 0.005 knat7 1.002 ± 0.030* 2 0.332 ± 0.017* 0.169 ± 0.006* 0.123 ± 0.003 4CL:KNAT7  0.727 ± 0.028* 0.225 ± 0.012* 0.147 ± 0.006 0.108 ± 0.004* 1 ± Standard Error, n = 24 hypocotyls for each condition.  2 Asterisks indicate values significantly different from wild-type at p≤0.05.   Table 4-2 Hypocotyl lengths in wild type knat7 and 4CL:KNAT7 seedlings (Replicate 2).  Hypocotyl Length (cm) Genotype 0 µmol m-2s-1 3 µmol m-2s-1 12 µmol m-2s-1 96 µmol m-2s-1 Wild-type 1.055±0.081 1 0.373±0.041 0.173±0.023 0.121±0.011 knat7 1.169±0.095* 2 0.409±0.036* 0.212±0.042* 0.144±0.013* 4CL:KNAT7 1.026±0.095 0.318±0.049* 0.145±0.016* 0.112±0.010* 1 ± Standard Error, n = 16 hypocotyls for each condition.  2 Asterisks indicate values significantly different from wild-type at p≤0.05.     65  Table 4-3 Days to bolting in wild type knat7 and 4CL:KNAT7 plants. Genotype Days to bolting Wild-type 29.5±0.21 knat7 30.6 ± 0.3*2 2 4CL :KNAT7 30.9±0.5* 1  ± Standard Error, n = 56, 62 and 65 wild-type, knat7 and 4CL:KNAT7 plants respectively.  2 Asterisks indicate values significantly different from wild-type at p≤0.05.   4.3 Discussion In this chapter I tested the hypothesis that the transcriptional repression activity of KNAT7 modulates the rhythmic diurnal expression patterns of LBGs. My approach was to build on the results presented in Chapter 3 to test for changes in LBG expression patterns, especially changes that are consistently observed on the two days of the study, in the knat7 mutant background relative to wild-type. I found little evidence to support this hypothesis in seedlings. However, in inflorescence stems that have a greater commitment to lignin deposition, especially in interfascicular fibers, I uncovered a possible role for KNAT7 in repressing expression of certain LBGs in the night. Consistent with a role for KNAT7 in clock regulation, knat7 mutants showed hypocotyl elongation and time to bolting phenotypes that commonly accompany mutations in core clock genes.  In LD grown knat7 seedlings, transcript levels of LBGs did not show a significantly different value at any time point consistently on both days of the study. However many showed a trend of overall lower expression level throughout the day (Figs. 4-6, 4-7). This trend in LGB  66  expression, and the significant decreases in expression of C3H and F5H in the knat7 mutant (Fig. 4-5) is in contrast to the reported increase in expression of many of these genes in knat7 inflorescence stems relative to wild type (Liu et. al., 2014).  When I assayed LBG expression in knat7 inflorescence stems (Figs. 4-8, 4-9), however, expression levels were generally higher than wild type over the course of the diurnal cycles, consistent with the reported increases in gene expression levels in knat7 (Liu et. al., 2014). One explanation for these results is that inflorescence stems are enriched in fiber cells, whose secondary cell walls are thicker in the knat7 mutant (Li et. al., 2012; Liu et. al., 2014), while the vascular bundles of seedlings lack this cell type. Thus, the repression function of KNAT7 with respect to LBG expression may target LBGs in interfascicular fiber cells and not vessels, such that the repression function is not obvious in seedlings.  In LD grown knat7 stems, in the first stem collection, expression of many LBGs appeared to be changed in the 0 h and 24 h dawn sample, mostly genes in the general phenylpropanoid pathway and genes important for G monolignol biosynthesis (Figs. 4-8, 4-9). However because of large biological variation in the stem samples, diurnal pattern change trends were not statistically significant, even though the trend of increased expression at dawn in knat7 was observed on both days of the study. A second set of stem samples assayed at the dawn time point, with double the number of biological replicates gave more promising results. Out of the genes C4H, C3H, HCT, CCOMT, F5H, COMT that were assayed C3H, HCT, CCOMT and COMT showed significantly increased expression while F5H showed decreased expression. Hence it appears that KNAT7 regulates diurnal expression levels of several LBGs at the end of night in stems. Stored starch levels are depleted towards the end of night and it is possible that  67  KNAT7 plays a role in regulating LBG expression in co-ordination with this resource availability signal.  Another observation from assaying LBG expression in knat7 stems was that greater variation in expression levels over the day was observed as compared to the minimal variation in LBG expression in wild-type stems (Fig. 4-10). C3H shows the least diurnal variation in LD grown wild-type seedlings and shows minimal diurnal variation, like the other LBGs in wild-type stems (Figs.3-4, 3-8). However, in knat7 stems, the variation in expression values over the day was very large. In knat7 seedlings overall lower expression of C3H was observed and expression was lower in pooled daytime samples but was unchanged in pooled night-time samples on both days of the study (Fig. 4.5b). In both the first and second knat7 stem collection increased expression of C3H at dawn was observed. This suggests that KNAT7 may have a more important role to play in the regulation of this gene. F5H, another one of the rate-limiting cytochrome P450 monooxygenase genes, shows overall decreased expression in knat7 seedlings, overall unchanged expression in the first knat7 stem collection and decreased expression at dawn in the second knat7 stem collection. Clearly knockout of KNAT7 does not affect expression of all the phenylpropanoid genes in the same manner.  Further, in both knat7 seedlings and stems, I observed significantly different peaks in expression at 32 h and/or 36h after dawn, for some genes. Harmer et. al., 2000 showed that diurnally regulated sucrose transport and metabolism genes and starch metabolism genes show peaks in expression levels at discrete times in the day, as would be necessary for their function. Some of these genes peak at 8 h after subjective dawn in 12L/12D grown plants transferred to continuous light, while some genes peak at subjective night. The mid-day change in expression of LBGs, along with the changed expression at dawn, in LD grown knat7 plants, may be  68  physiologically relevant to indicate misregulation of sucrose metabolism signals. But since the mid-day expression change is not consistently observed on both days of the study, it is possible that this may be an experimental artifact caused by perhaps a factor like unwanted light exposure during sample collection on the second night of the study.  In the knat7 background, LHY expression in LD grown seedlings and stems was mostly unchanged in diurnal fluctuations in transcript abundance relative to wild-type samples grown in parallel. However an unexpected change in diurnal expression of DHS1 was observed in the knat7 seedling samples but not in the knat7 stem samples. The shikimate pathway gene DHS1 can be regulated by dawn-phased clock repressors like LHY and CCA1 hence was included in this study to confirm presence of a functional clock in plant samples. While a consistent change at any particular time point was not observed in DHS1 diurnal regulation in seedlings in knat7 relative to wild type, I observed a decrease in DHS1 expression in the day when data from light time points were pooled. This suggests that in seedlings, KNAT7 positively regulates DHS1 expression in the day.  DHS1 expression in wild-type plants is induced in response to wounding and pathogen stress (Keith et. al., 1991). DHS is the first enzyme in the shikimate pathway and is encoded by a gene family in Arabidopsis that includes DHS1, DHS2 and DHS3. Among the three DHS genes, clock regulation of only DHS1 has been studied. DHS3 expression is highest in the second internode of the inflorescence stem, while DHS1 has a more widespread expression with highest levels in the vegetative rosette (Arabidopsis eFP browser, Winter et. al., 2007). Based on expression profile, DHS3 may be more important in driving carbon flux into the lignin biosynthetic pathway and is more likely than DHS1 to be regulated by KNAT7 with respect to secondary cell wall related functions. If KNAT7 diurnal regulation functions extend to the  69  shikimate pathway this may explain why DHS1 does not show any clear changed diurnal regulation in knat7 stems (Fig. 4-4) even though greater diurnal effects on expression of the LBGs were observed in the stem tissue.  Vanholme et. al., 2012 found that shikimate and phenylpropanoid pathway genes are generally co-ordinately regulated at the metabolite level in mutants that result in lignin defects. Global expression profiling from top to bottom of the Arabidopsis inflorescence stem by Ehlting et. al., (2005) indicated that genes encoding enzymes of the shikimate pathway are up-regulated but that the parts of the pathway specific for other amino acids are not differentially expressed at the bottom of the stem. This provides another line of evidence to suggest that the shikimate and phenylpropanoid pathway genes may be regulated by common mechanisms. A thorough analysis of shikimate pathway genes in KNAT7 mutants may help to identify if KNAT7 plays a role in such a common regulatory mechanism.  The knat7 seedlings also showed a hy (elongated hypocotyl) phenotype when grown in the dark or at low fluence rates. Clock gene mutants such as cca1 and lhy show short hypocotyls while overexpressors of CCA1, LHY and rve8, elf3, prr7, prr9 show elongated hypocotyls (Nagel and Kay, 2012). In conjunction with traits such as mis-expression of CAB2 and CCR2 clock output genes, this phenotype is used to characterise clock mutants. Normal hypocotyl elongation is a complex process that requires co-ordinated regulation of cell wall biosynthetic enzymes as well as cell wall modifying enzymes by light, circadian and phytohormone signalling pathways. The presence of the hy phenotype in the dark or only at low fluence light intensities is similar to the trends observed for the RVE8 knock-out and overexpressor mutants (Rawat et. al., 2013). This phenotype is also similar to the trends shown by some mutants defective in phtochromeA mediated, low fluence light response (Yanovsky et. al., 2000). The role of KNAT7 in regulation  70  of cell wall components apart from lignin is not clear; hence it is not clear what causes the hy phenotype in knat7. However, these results are consistent with a link between KNAT7 and the clock. Another complex phenotype used to characterise clock mutants is flowering time. Time to bolting is delayed in both knat7 and the overexpressor mutant 4CL:KNAT7. Clock mutants like cca1, lhy, rve8, elf3 show early flowering while overexpressors of CCA1, LHY, prr7, prr9 and ztl show delayed flowering (Nagel and Kay, 2012). Arabidopsis is a facultative long day plant, flowering more rapidly in long days than in short days. Many clock mutants lack photoperiodic sensing and hence flower at the same time in long day and short day conditions. These results further suggest a link between KNAT7 and the clock, but bolting time phenotype of the knat7 mutant should be studied in additional photoperiods. If KNAT7 is a diurnal regulator, it is possible that the expression of KNAT7 itself may show diurnal rhythmicity. However, in LD-grown wild-type seedlings, stable expression of KNAT7 throughout the day was observed (Fig. 4-1a). Clock related genes such as LHY show large diurnal variations in transcript abundance that correlate with their biological activity in modulating clock-regulated target genes. Thus, an open question is how KNAT7 achieves its apparent function in diurnal regulation in the absence of diurnal variation in transcript abundance. The KNOX family genes that KNAT7 is a part of perform their functions by interacting with specific BLH family protein partners (Hake et. al., 2004). KNAT7 interacts with BLH6 to regulate secondary cell wall formation and requires BLH6 interactions to repress REV (Liu et. al., 2014). BLH6 turns up in a list of top 200 genes that are induced in response to light (Blasing et. al., 2005). OFP1, OFP4 and MYB75 also interact with KNAT7 (Li et. al., 2011,  71  Bhargava et. al., 2013). Interactions with any of these proteins may enable DHS1 and LBG diurnal regulation. In CL-grown wild-type seedlings I observed a change in the KNAT7 expression pattern as compared to the LD photoperiod grown seedlings (Fig. 4-1b). It is possible that in CL the level of KNAT7 expression as well as interactions with protein partners is important for regulating downstream processes. An analysis of DHS1 and LBG expression in CL-grown knat7 could shed light of the significance of KNAT7 expression levels in CL grown seedlings. In summary, based of differences in expression of some LBGs at dawn in knat7 stems relative to wild type, changed expression of DHS1 in knat7 seedlings, and hypocotyl and bolting time phenotypes of the knat7 mutant, a link between diurnal regulation and KNAT7 transcriptional activity can be drawn. KNAT7 may act as either an activator or repressor and selective interactions with other transcription factor proteins and a sucrose related regulatory signal may potentially enable KNAT7 to perform its diurnal regulation functions.   72   Conclusion and future directions Chapter 5:A hierarchical feed-forward network of several transcription factors is responsible for developmental regulation of lignin biosynthesis in secondary cell walls in Arabidopsis plants. Several LBGs have also been identified to be diurnally regulated by environmental signals like light perception and an endogenous circadian clock. The goal of my thesis was to identify whether KNAT7, a component of the developmental secondary wall regulatory network, may function in the diurnal regulation of the transcription of LBGs. In Chapter 3, I identified that a clear diurnal and circadian variation in transcript abundance of LBGs in observed in wild-type seedlings (Figs. 3-2, 3-3, 3-4, 3-5). In wild-type stems, very little diurnal variation in expression levels can be observed (Figs. 3-7, 3-8). Large inherent biological variations seem to be present in these samples; however genes like F5H show higher expression levels during the day as compared to in the night in the wild-type stem samples.  Rhythmic cycling of the LHY clock gene expression in LD grown wild-type seedlings (Fig. 3-1a), with a phase and waveform as expected from literature, validated my experimental setup; persistence of rhythmic cycling of LHY in CL (Fig. 3-1c) confirmed the presence of a functioning endogenous clock in seedlings. DHS1, a clock controlled gene, showed diurnal regulation in LD indicating that the seedling clock can modulate expression of downstream targets.  I identified robust oscillations in expression of PAL1, C4H, 4CL1, F5H and COMT in LD grown wild-type seedlings while diurnal variation in HCT, CCOMT, CCR1 and CAD1 was less prominent in my growth conditions. C3H showed the least variation in expression levels over the day. Previous reports of diurnal expression of LBGs typically identified them as co-regulated.  73  The greater accuracy of qRT-PCR over microarray and northern blot studies previously used (Harmer et. al., 2000; Rogers et. al., 2005) revealed finer details of the expression of the genes I analysed. For example, I identified groups of LBGs that showed similar trends in expression and these groups tended to correlate with their positions in the phenylpropanoid pathway  PAL1, C4H and 4CL1 show an additional peak in expression in LD conditions as compared to F5H and COMT. The differences in transcript abundance of the genes in the general phenylpropanoid pathway as compared to the genes specific to S monolignol synthesis may reflect the differing requirements of the many secondary metabolites that are produced by the phenylpropanoid pathway. Also, we cannot rule out that lignin biosynthetic enzyme abundance does not reflect transcript levels because of post-transcriptional processes. For example, the PAL family of enzymes in Arabidopsis was shown to be negatively regulated at the protein level via the ubiquitination–26S proteasome pathway (Zhang et. al., 2013). However the goal of my study was to characterise transcription level trends in wild-type to compare against knat7.  Most LBGs showed variation in transcript abundance even when transferred to CL, indicating regulation at the transcript level by an internal circadian clock, in my growth conditions, as would be expected based on earlier studies. A peak at 4 h after dawn, observed for most lignin genes in LD grown seedlings, may indicate light regulated expression based on the fact that it is not observed in CL grown wild-type seedlings and a trough in expression in the middle of the day may represent circadian regulation of expression since this peak was present in both LD and CL grown seedlings. Both these characteristics of LBG expression can be mildly observed in northern blots assay performed by Rogers et. al., (2005). The peak at 23 h after dawn observed by Rogers et. al., 2005 cannot be accounted for because of restrictions placed by my sampling frequency. In mature inflorescence stem bases, the presence of a functional circadian  74  clock in LD conditions was identified by observing diurnal variation in expression levels of LHY and DHS1 (Fig. 3-6), in spite of low variation in LBG levels observed in the same samples.  Next, in Chapter 4, I went on to study diurnal variation in LBG expression in knat7 seedlings and stems. I identified that in seedlings diurnal transcript abundance variations of most of the studied LBGs persisted unchanged in the knat7 mutant (Figs. 4-6, 4-7), suggesting that KNAT7 is not involved in diurnal regulation of LBGs in this developmental stage. Some LBGs, showed decreased levels of expression throughout the day in this developmental stage, suggesting an activation function for KNAT7 in the regulation of LBG expression in seedlings.  Although LBGs in knat7 seedlings did not show changed diurnal expression, decreased expression of DHS1 (Figs. 4-3b, 4-5a), a clock output gene, was observed in knat7 only in the daytime, providing an interesting new avenue to further investigate KNAT7‘s diurnal regulation functions and transcriptional activation functions. No evidence for involvement of KNAT7 with DHS gene expression regulation has been reported in the past. DHS1 is the first enzyme in the shikimate pathway and evidence from literature suggests that shikimate and phenylpropanoid metabolites are controlled by common regulatory pathways over development and in secondary cell wall mutants (Ehlting et. al., 2005; Vanholme et. al., 2012). It would be interesting to explore the possibilities that KNAT7 indirectly regulates lignin biosynthesis by modulating flux down the shikimate pathway or is part of the common feedback regulatory pathway that regulates both shikimate and phenylpropanoid metabolites.  Another line of evidence linking KNAT7 to clock regulation in seedlings is the elongated hypocotyl phenotype (Table 4.1). Light, clock and phytohormone signals control hypocotyl elongation during early photomorphogenesis by regulating expression of the PIF4 (PHYTOCHROME INTERACTING FACTOR 4) and PIF5 proteins (Niva et. al., 2007). Defects  75  in any of these three regulatory mechanisms of targets can cause hypocotyl elongation phenotypes.  Both knat7 and 4CL:KNAT7 also show a delay in bolting time (Table 4.2). Clock-defective mutants almost exclusively display an altered phenotype of early or late flowering time, implying a key role for the circadian clock in the photoperiodic control of flowering time (Imaizumi and Kay, 2006). A certain minimum concentration of sucrose at the shoot apical meristem of the vegetative rosette is also required to signal the transition from vegetative to reproductive growth and bolting in Arabidopsis plants (Gibson, 2005). Either of these mechanisms or a combination of the two may be disrupted in knat7 mutants. This clock phenotype is also milder in knat7 than in other clock mutants, perhaps double knock-out mutants disrupted in function of KNAT7 as well as other protein-protein interacting partners may show a more prominent phenotype, indicating involvement of the partner to facilitate KNAT7‘s diurnal functions.  Thus, knat7 shows two common clock related phenotypes, as well as altered diurnal regulation of DHS1, even before it reaches the developmental stage at which most secondary cell wall phenotypes have been previously reported in knat7.  Since LHY does not show changed expression in knat7 seedlings (Fig. 4-3a) as well as in knat7 stems (Fig. 4-4) it is also possible that KNAT7 acts downstream or parallel to the core clock mechanism that requires appropriate LHY expression, explaining milder clock related phenotypes observed.  Finally, in tissue collected from the base of the mature Arabidopsis inflorescence stem, I observed evidence of KNAT7’s diurnal regulation functions, acting on the LBGs, that are believed to be downstream targets of KNAT7 based on previous reports.   76  Altered diurnal regulation of several studied LBGs was observed at the ‗dawn‘ time point, as compared to wild-type expression levels, in two sets of independent experiments (Figs. 4-8, 4-9, 4-11). Large variations in expression between biological replicates from stem tissue made this trend difficult to identify, but pooling of time points to increase statistical power helped to observed statistically significant increased expression levels of several LBGs at dawn.  C3H, HCT and CCOMT showed the change in transcript levels at dawn, as well as overall higher expression levels over the day, as compared to the wild-type expression level. F5H showed either the same or decreased expression at the dawn time point.  Starch levels are depleted in the night in a precisely regulated manner, to ensure availability for metabolic activities even at the end of night (Stitt and Zeeman, 2012). Wild-type LBG expression levels, shows lower levels in the night as compared to daytime levels. Higher expression of LBGs at dawn in knat7 stems may indicate that night-time repression in coordination with decreasing starch availability does not take place.  In the sex1 mutant, that is defective in starch turnover, diurnal regulation of lignin genes is not affected, but overall levels are reduced (Rogers et al., 2005). Hence it appears that decreased starch levels at night do not regulate LBG diurnal abundance, but does affect its overall level. Based on this line of evidence, a proposal for KNAT7 function in the night is that it pre-emptively blocks activation of LBG expression in the night, to prevent a draw on limited resources at this time of day from secondary cell wall containing tissue that is an irreversibly deposited final metabolic sink in cell differentiation. A well-known function of the clock is to ‗gate‘ physiological processes so that they occur at the appropriate time of the day. The clock may regulate gating of physiologically inappropriate wall deposition through KNAT7.  77  In the absence of KNAT7 function, it may be that the plant draws on all available resources in the night. Just like knat7, the sex1 mutant shows increased expression of C3H in proportion to the changes in expression of other LBGs in the mutant. This suggests the possibility that knat7 plants sense low carbon availability, even when it is available, like the sex1 mutant. KNAT7 acts as a repressor of secondary cell wall deposition in the interfascicular fibers of Arabidopsis stems but there is no evidence to indicate that thicker walls in knat7 are a result of KNAT7‘s clock related functions. The thick interfascicular fiber walls have been studied in the past in relatively higher fluence lights. Analysis of the interfascicular fiber thickenings in sex1 knat7 double mutant and of knat7 plants grown in low light intensities as well as studying LBGs expression in the night in the mutant stems could provide an easy means to disprove or further pursue the ‗gating‘ theory as well as provide further evidence to investigate if thicker inflorescence cell walls are a result of disruption of diurnal regulation in knat7.  While there is evidence for KNAT7‘s diurnal transcription regulation functions, the KNAT7 transcript levels themselves do not show strong regulation in diurnal levels, in the wild-type (Figs. 4-1, 4-2). Given this finding, it is interesting to speculate how KNAT7 performs its diurnal functions. One of the few examples of clock components that do not show rhythmic expression is ZTL, a protein containing a blue-light receptor LOV domain, kelch repeats for protein-protein interactions and an F-box domain for dark-dependant targeting of TOC1 and PRR5 for proteasomal degradation (Somers et. al., 2000). Day-time activities of ZTL involve interacting with GI. Similarly for KNAT7, specific day-time and night-time protein interactions may help it perform its diurnal function.    78  In summary, I have established that inflorescence stems in Arabidopsis have a functional circadian clock based on variation in mRNA abundance of in this tissue. I have also shown that KNAT7 is involved in regulating diurnal expression of LBGs at the end of night in this developmental stage. In seedlings, the diurnal regulated variation in expression of LBGs is not as clearly affected in the knat7 mutant; however KNAT7 regulates diurnal expression of DHS1 in this tissue and activates overall F5H expression. Hypocotyl elongation phenotype and altered timing of floral transition in LD supports KNAT7‘s role as a diurnal regulator.   79  References Alabad  , D., Oyama, T., Yanovsky, M. J., Harmon, F. G., Mas, P.,   Kay, S. A. (2001). Reciprocal regulation between TOC1 and LHY/CCA1 within the Arabidopsis circadian clock. Science, 293(5531), 880-883. Albersheim, P., Darvill, A., Roberts, K., Sederoff, R., & Staehelin, A. (2010).Plant cell walls. Garland Science. Alejandro, S., Lee, Y., Tohge, T., Sudre, D., Osorio, S., Park, J., … Martinoia, E. (2012). AtABCG29 is a monolignol transporter involved in lignin biosynthesis. Current Biology: CB, 22(13), 1207–1212. http://doi.org/10.1016/j.cub.2012.04.064 Bhargava, A., Ahad, A., Wang, S., Mansfield, S. D., Haughn, G. W., Douglas, C. J., & Ellis, B. E. (2013). The interacting MYB75 and KNAT7 transcription factors modulate secondary cell wall deposition both in stems and seed coat in Arabidopsis. Planta, 237(5), 1199–1211.http://doi.org/10.1007/s00425-012-1821-9 Bläsing, O. E., Gibon, Y., Günther, M., Höhne, M., Morcuende, R., Osuna, D., ... & Stitt, M. (2005). Sugars and circadian regulation make major contributions to the global regulation of diurnal gene expression in Arabidopsis. The Plant Cell Online, 17(12), 3257-3281. Boerjan, W., Ralph, J., & Baucher, M. (2003). Lignin biosynthesis. Annual review of plant biology, 54(1), 519-546. Bonawitz, N. D., & Chapple, C. (2010). The Genetics of Lignin Biosynthesis: Connecting Genotype to Phenotype. Annual Review of Genetics, 44(1), 337–363. http://doi.org/10.1146/annurev-genet-102209-163508  80  Boudet, A. M. (2000). Lignins and lignification: selected issues. Plant Physiology and Biochemistry, 38(1), 81-96. Brown, D. M., Zeef, L. A. H., Ellis, J., Goodacre, R., & Turner, S. R. (2005). Identification of Novel Genes in Arabidopsis Involved in Secondary Cell Wall Formation Using Expression Profiling and Reverse Genetics. The Plant Cell Online, 17(8), 2281–2295. Carré, I., & Veflingstad, S. R. (2013, May). Emerging design principles in the Arabidopsis circadian clock. In Seminars in cell & developmental biology (Vol. 24, No. 5, p Covington, M. F., & Harmer, S. L. (2007). The Circadian Clock Regulates Auxin Signaling and Responses in Arabidopsis. PLoS Biol, 5(8), e222. http://doi.org/10.1371/journal.pbio.0050222 Covington, M. F., Maloof, J. N., Straume, M., Kay, S. A., & Harmer, S. L. (2008). Global transcriptome analysis reveals circadian regulation of key pathways in plant growth and development. Genome Biology, 9(8), R130. http://doi.org/10.1186/gb-2008-9-8-r130 Czechowski, T., Stitt, M., Altmann, T., Udvardi, M. K., & Scheible, W.-R. (2005). Genome-Wide Identification and Testing of Superior Reference Genes for Transcript Normalization in Arabidopsis. Plant Physiology, 139(1), 5–17. http://doi.org/10.1104/pp.105.063743 Das, P. K., Shin, D. H., Choi, S. B., & Park, Y. I. (2012). Sugar-hormone cross-talk in anthocyanin biosynthesis. Molecules and cells, 34(6), 501-507. Dowson-Day, M. J., & Millar, A. J. (1999). Circadian dysfunction causes aberrant hypocotyl elongation patterns in Arabidopsis. The Plant Journal, 17(1), 63–71. http://doi.org/10.1046/j.1365-313X.1999.00353.x Donaldson, L. A. (1992). Lignin distribution during latewood formation in Pinus radiata D. Don. IAWA Journal, 13(4), 381-387.  81  Dodd, A. N., Salathia, N., Hall, A., Kévei, E., Tóth, R., Nagy, F., … Webb, A. A. R. (2005). Plant Circadian Clocks Increase Photosynthesis, Growth, Survival, and Competitive Advantage. Science, 309(5734), 630–633. http://doi.org/10.1126/science.1115581 Dodd, A. N., Gardner, M. J., Hotta, C. T., Hubbard, K. E., Dalchau, N., Love, J., ... & Webb, A. A. (2007). The Arabidopsis circadian clock incorporates a cADPR-based feedback loop. Science, 318(5857), 1789-1792 Donaldson, L. A. (2001). Lignification and lignin topochemistry — an ultrastructural view. Phytochemistry, 57(6), 859–873. http://doi.org/10.1016/S0031-9422(01)00049-8 Dunlap, J. C., Loros, J. J., & DeCoursey, P. J. (2004). Chronobiology: biological timekeeping. Sinauer Associates. Edgar, R. S., Green, E. W., Zhao, Y., van Ooijen, G., Olmedo, M., Qin, X., ... & Reddy, A. B. (2012). Peroxiredoxins are conserved markers of circadian rhythms. Nature, 485(7399), 459-464. Ehlting, J., Mattheus, N., Aeschliman, D. S., Li, E., Hamberger, B., Cullis, I. F., … Douglas, C. J. (2005). Global transcript profiling of primary stems from Arabidopsis thaliana identifies candidate genes for missing links in lignin biosynthesis and transcriptional regulators of fiber differentiation. The Plant Journal, 42(5), 618–640. http://doi.org/10.1111/j.1365-313X.2005.02403.x Endo, M., Shimizu, H., Nohales, M. A., Araki, T., & Kay, S. A. (2014). Tissue-specific clocks in Arabidopsis show asymmetric coupling. Nature, 515(7527), 419–422. http://doi.org/10.1038/nature13919 Filichkin, S. A., Breton, G., Priest, H. D., Dharmawardhana, P., Jaiswal, P., Fox, S. E., ... & Mockler, T. C. (2011). Global profiling of rice and poplar transcriptomes highlights key conserved circadian-controlled pathways and cis-regulatory modules. PloS one, 6(6), e16907.  82  Fogelmark, K., & Troein, C. (2014). Rethinking Transcriptional Activation in the Arabidopsis Circadian Clock. PLoS Comput Biol, 10(7), e1003705. http://doi.org/10.1371/journal.pcbi.1003705 Fraser, C. M., & Chapple, C. (2011). The Phenylpropanoid Pathway in Arabidopsis. The Arabidopsis Book / American Society of Plant Biologists, 9. http://doi.org/10.1199/tab.0152 Furumizu, C., Alvarez, J. P., Sakakibara, K., & Bowman, J. L. (2015). Antagonistic Roles for KNOX1 and KNOX2 Genes in Patterning the Land Plant Body Plan Following an Ancient Gene Duplication. PLoS Genet, 11(2), e1004980. http://doi.org/10.1371/journal.pgen.1004980 Gendron, J. M., Pruneda-Paz, J. L., Doherty, C. J., Gross, A. M., Kang, S. E., & Kay, S. A. (2012). Arabidopsis circadian clock protein, TOC1, is a DNA-binding transcription factor. Proceedings of the National Academy of Sciences,109(8), 3167-3172. Gibson, S. I. (2005). Control of plant development and gene expression by sugar signaling. Current Opinion in Plant Biology, 8(1), 93–102. http://doi.org/10.1016/j.pbi.2004.11.003 Goodspeed, D., Chehab, E. W., Min-Venditti, A., Braam, J., & Covington, M. F. (2012). Arabidopsis synchronizes jasmonate-mediated defense with insect circadian behavior. Proceedings of the National Academy of Sciences, 109(12), 4674-4677. Grand, C., Ranjeva, R., Boudet, A. M., & Alibert, G. (1979). Photoregulation of the incorporation of guaiacyl units into lignins. Planta, 146(3), 281-286. Hake, S., Smith, H. M., Holtan, H., Magnani, E., Mele, G., & Ramirez, J. (2004). THE ROLE OF KNOX GENES IN PLANT DEVELOPMENT#. Annu. Rev. Cell Dev. Biol., 20, 125-151. Hall, H., & Ellis, B. (2013). Transcriptional programming during cell wall maturation in the expanding Arabidopsis stem. BMC Plant Biology, 13(1), 14. http://doi.org/10.1186/1471-2229-13-14  83  Hao, Z., & Mohnen, D. (2014). A review of xylan and lignin biosynthesis: Foundation for studying Arabidopsis irregular xylem mutants with pleiotropic phenotypes. Critical Reviews in Biochemistry and Molecular Biology. http://doi.org/10.3109/10409238.2014.889651 Harmer, S. L., Hogenesch, J. B., Straume, M., Chang, H. S., Han, B., Zhu, T., ... & Kay, S. A. (2000). Orchestrated transcription of key pathways in Arabidopsis by the circadian clock. Science, 290(5499), 2110-2113. Harmer, S. L., & Kay, S. A. (2005). Positive and negative factors confer phase-specific circadian regulation of transcription in Arabidopsis. The Plant Cell Online, 17(7), 1926-1940. Haydon, M. J., Mielczarek, O., Robertson, F. C., Hubbard, K. E., & Webb, A. A. R. (2013). Photosynthetic entrainment of the Arabidopsis thaliana circadian clock. Nature, 502(7473), 689–692. http://doi.org/10.1038/nature12603 Hong, S. M., Bahn, S. C., Lyu, A., Jung, H. S., & Ahn, J. H. (2010). Identification and testing of superior reference genes for a starting pool of transcript normalization in Arabidopsis. Plant & Cell Physiology, 51(10), 1694–1706. http://doi.org/10.1093/pcp/pcq128 Hruz, T., Wyss, M., Docquier, M., Pfaffl, M. W., Masanetz, S., Borghi, L., ... & Zimmermann, P. (2011). RefGenes: identification of reliable and condition specific reference genes for RT-qPCR data normalization. BMC genomics,12(1), 156. Hsu, P. Y., & Harmer, S. L. (2014). Wheels within wheels: the plant circadian system. Trends in plant science, 19(4), 240-249. Ibañez, C., Ramos, A., Acebo, P., Contreras, A., Casado, R., Allona, I., & Aragoncillo, C. (2008). Overall alteration of circadian clock gene expression in the chestnut cold response. PLoS One, 3(10), e3567.  84  Ishida, T., Kaneko, Y., Iwano, M., & Hashimoto, T. (2007). Helical microtubule arrays in a collection of twisting tubulin mutants of Arabidopsis thaliana.Proceedings of the National Academy of Sciences, 104(20), 8544-8549. James, A. B., Monreal, J. A., Nimmo, G. A., Kelly, C. L., Herzyk, P., Jenkins, G. I., & Nimmo, H. G. (2008). The Circadian Clock in Arabidopsis Roots Is a Simplified Slave Version of the Clock in Shoots. Science, 322(5909), 1832–1835. http://doi.org/10.1126/science.1161403 Jin, H., Cominelli, E., Bailey, P., Parr, A., Mehrtens, F., Jones, J., ... & Martin, C. (2000). Transcriptional repression by AtMYB4 controls production of UV‐protecting sunscreens in Arabidopsis. The EMBO journal, 19(22), 6150-6161. Jouve, L., Greppin, H., & Agosti, R. D. (1998). Arabidopsis thaliana floral stem elongation: Evidence for an endogenous circadian rhythm. Plant Physiology and Biochemistry, 36(6), 469–472. http://doi.org/10.1016/S0981-9428(98)80212-X Jouve, L., Greppin, H., & Agosti, R. D. (2000). Floral stem growth of Arabidopsis ecotypes. I. Differences during synchronized light regime and continuous light free run. Archives Des Sciences, 53(3), 207–214. Keith, B., Dong, X. N., Ausubel, F. M., & Fink, G. R. (1991). Differential induction of 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase genes in Arabidopsis thaliana by wounding and pathogenic attack. Proceedings of the National Academy of Sciences, 88(19), 8821-8825. Kinmonth-Schultz, H. A., Golembeski, G. S., & Imaizumi, T. (2013). Circadian clock-regulated physiological outputs: Dynamic responses in nature. Seminars in Cell & Developmental Biology, 24(5), 407–413. http://doi.org/10.1016/j.semcdb.2013.02.006  85  Ko, J.-H., Kim, W.-C., & Han, K.-H. (2009). Ectopic expression of MYB46 identifies transcriptional regulatory genes involved in secondary wall biosynthesis in Arabidopsis. The Plant Journal, 60(4), 649–665. http://doi.org/10.1111/j.1365-313X.2009.03989.x Kubo, M., Udagawa, M., Nishikubo, N., Horiguchi, G., Yamaguchi, M., Ito, J., ... & Demura, T. (2005). Transcription switches for protoxylem and metaxylem vessel formation. Genes & development, 19(16), 1855-1860. Li, E., Wang, S., Liu, Y., Chen, J.-G., & Douglas, C. J. (2011). OVATE FAMILY PROTEIN4 (OFP4) interaction with KNAT7 regulates secondary cell wall formation in Arabidopsis thaliana. The Plant Journal, 67(2), 328–341. http://doi.org/10.1111/j.1365-313X.2011.04595.x Li, E., Bhargava, A., Qiang, W., Friedmann, M. C., Forneris, N., Savidge, R. A., … Douglas, C. J. (2012). The Class II KNOX gene KNAT7 negatively regulates secondary wall formation in Arabidopsis and is functionally conserved in Populus. New Phytologist, 194(1), 102–115. http://doi.org/10.1111/j.1469-8137.2011.04016.x Liu, Y., You, S., Taylor-Teeples, M., Li, W. L., Schuetz, M., Brady, S. M., & Douglas, C. J. (2014). BEL1-LIKE HOMEODOMAIN6 and KNOTTED ARABIDOPSIS THALIANA7 Interact and Regulate Secondary Cell Wall Formation via Repression of REVOLUTA. The Plant Cell Online, 26(12), 4843–4861. http://doi.org/10.1105/tpc.114.128322 Maeda, H., & Dudareva, N. (2012). The Shikimate Pathway and Aromatic Amino Acid Biosynthesis in Plants. Annual Review of Plant Biology, 63(1), 73–105. http://doi.org/10.1146/annurev-arplant-042811-105439 McClung, C. R. (2006). Plant circadian rhythms. The Plant Cell Online, 18(4), 792-803. McWatters, H. G., & Devlin, P. F. (2011). Timing in plants – A rhythmic arrangement. FEBS Letters, 585(10), 1474–1484. http://doi.org/10.1016/j.febslet.2011.03.051  86  Mele, G., Ori, N., Sato, Y., & Hake, S. (2003). The knotted1-like homeobox gene BREVIPEDICELLUS regulates cell differentiation by modulating metabolic pathways. Genes & development, 17(17), 2088-2093. Michael, T. P., & McClung, C. R. (2003). Enhancer Trapping Reveals Widespread Circadian Clock Transcriptional Control in Arabidopsis. Plant Physiology, 132(2), 629–639. http://doi.org/10.1104/pp.021006 Michael, T. P., Breton, G., Hazen, S. P., Priest, H., Mockler, T. C., Kay, S. A., & Chory, J. (2008). A Morning-Specific Phytohormone Gene Expression Program underlying Rhythmic Plant Growth. PLoS Biol, 6(9), e225. http://doi.org/10.1371/journal.pbio.0060225 Millar, A. J. (2004). Input signals to the plant circadian clock. Journal of experimental botany, 55(395), 277-283. Mockler, T. C., Michael, T. P., Priest, H. D., Shen, R., Sullivan, C. M., Givan, S. A., … Chory, J. (2007). The Diurnal Project: Diurnal and Circadian Expression Profiling, Model-based Pattern Matching, and Promoter Analysis. Cold Spring Harbor Symposia on Quantitative Biology, 72, 353–363. http://doi.org/10.1101/sqb.2007.72.006 Nagel, D. H., & Kay, S. A. (2012). Complexity in the wiring and regulation of plant circadian networks. Current Biology, 22(16), R648-R657. Nascimento, N. C. do, & Fett-Neto, A. G. (2010). Plant secondary metabolism and challenges in modifying its operation: an overview. Methods in Molecular Biology (Clifton, N.J.), 643, 1–13. http://doi.org/10.1007/978-1-60761-723-5_1 Niinuma, K., Someya, N., Kimura, M., Yamaguchi, I., & Hamamoto, H. (2005). Circadian Rhythm of Circumnutation in Inflorescence Stems of Arabidopsis. Plant and Cell Physiology, 46(8), 1423–1427. http://doi.org/10.1093/pcp/pci127  87  Niwa, Y., Yamashino, T., & Mizuno, T. (2009). The Circadian Clock Regulates the Photoperiodic Response of Hypocotyl Elongation through a Coincidence Mechanism in Arabidopsis thaliana. Plant and Cell Physiology, 50(4), 838–854. http://doi.org/10.1093/pcp/pcp028 Norlia, B., Norwati, M., Norwati, A., Rosli, H. M., & Norihan, M. S. (2008). Isolation and characterization of LHY homolog gene expressed in flowering tissues of Tectona grandis (teak). African Journal of Biotechnology, 7(9). Pan, Y., Michael, T. P., Hudson, M. E., Kay, S. A., Chory, J., & Schuler, M. A. (2009). Cytochrome P450 Monooxygenases as Reporters for Circadian-Regulated Pathways. Plant Physiology, 150(2), 858–878. Para, A., Farré, E. M., Imaizumi, T., Pruneda-Paz, J. L., Harmon, F. G., & Kay, S. A. (2007). PRR3 Is a Vascular Regulator of TOC1 Stability in the Arabidopsis Circadian Clock. The Plant Cell, 19(11), 3462–3473. http://doi.org/10.1105/tpc.107.054775 Persson, S., Wei, H., Milne, J., Page, G. P., & Somerville, C. R. (2005). Identification of genes required for cellulose synthesis by regression analysis of public microarray data sets. Proceedings of the National Academy of Sciences of the United States of America, 102(24), 8633–8638. http://doi.org/10.1073/pnas.0503392102 Preston, J., Wheeler, J., Heazlewood, J., Li, S. F., & Parish, R. W. (2004). AtMYB32 is required for normal pollen development in Arabidopsis thaliana. The Plant Journal, 40(6), 979-995. Pruneda-Paz, J. L., & Kay, S. A. (2010). An expanding universe of circadian networks in higher plants. Trends in plant science, 15(5), 259-265.Raes, J., Rohde, A., Christensen, J. H., Van de Peer, Y., & Boerjan, W. (2003). Genome-wide characterization of the lignification toolbox in Arabidopsis.Plant Physiology, 133(3), 1051-1071.  88  Raes, J., Rohde, A., Christensen, J. H., Peer, Y. V. de, & Boerjan, W. (2003). Genome-Wide Characterization of the Lignification Toolbox in Arabidopsis. Plant Physiology, 133(3), 1051–1071. http://doi.org/10.1104/pp.103.026484 Rawat, R., Takahashi, N., Hsu, P. Y., Jones, M. A., Schwartz, J., Salemi, M. R., … Harmer, S. L. (2011). REVEILLE8 and PSEUDO-REPONSE REGULATOR5 Form a Negative Feedback Loop within the Arabidopsis Circadian Clock. PLoS Genet, 7(3), e1001350. http://doi.org/10.1371/journal.pgen.1001350 Rogers, L. A., Dubos, C., Cullis, I. F., Surman, C., Poole, M., Willment, J., … Campbell, M. M. (2005). Light, the circadian clock, and sugar perception in the control of lignin biosynthesis. Journal of Experimental Botany, 56(416), 1651–1663. http://doi.org/10.1093/jxb/eri162 Romano, J. M., Dubos, C., Prouse, M. B., Wilkins, O., Hong, H., Poole, M., … Campbell, M. M. (2012). AtMYB61, an R2R3-MYB transcription factor, functions as a pleiotropic regulator via a small gene network. New Phytologist, 195(4), 774–786. http://doi.org/10.1111/j.1469-8137.2012.04201.x Schaffer, R., Ramsay, N., Samach, A., Corden, S., Putterill, J., Carré, I. A., & Coupland, G. (1998). The late elongated hypocotyl Mutation of Arabidopsis Disrupts Circadian Rhythms and the Photoperiodic Control of Flowering. Cell, 93(7), 1219–1229. http://doi.org/10.1016/S0092-8674(00)81465-8 Schuetz, M., Smith, R., & Ellis, B. (2013). Xylem tissue specification, patterning, and differentiation mechanisms. Journal of Experimental Botany, 64(1), 11–31. http://doi.org/10.1093/jxb/ers287 Sharkhuu, A., Narasimhan, M. L., Merzaban, J. S., Bressan, R. A., Weller, S., & Gehring, C. (2014). A red and far-red light receptor mutation confers resistance to the herbicide glyphosate. The Plant Journal, 78(6), 916–926. http://doi.org/10.1111/tpj.12513  89  Smith, A. M., & Stitt, M. (2007). Coordination of carbon supply and plant growth. Plant, cell & environment, 30(9), 1126-1149Somers, D. E., Schultz, T. F., Milnamow, M., & Kay, S. A. (2000). ZEITLUPE Encodes a Novel Clock-Associated PAS Protein from Arabidopsis. Cell, 101(3), 319–329. http://doi.org/10.1016/S0092-8674(00)80841-7 Solomon, O. L., Berger, D. K., & Myburg, A. A. (2010). Diurnal and circadian patterns of gene expression in the developing xylem of Eucalyptus trees. South African Journal of Botany, 76(3), 425-439. Somers, D. E., Schultz, T. F., Milnamow, M., & Kay, S. A. (2000). ZEITLUPE Encodes a Novel Clock-Associated PAS Protein from Arabidopsis. Cell, 101(3), 319–329.  Stitt, M., & Zeeman, S. C. (2012). Starch turnover: pathways, regulation and role in growth. Current Opinion in Plant Biology, 15(3), 282–292. http://doi.org/10.1016/j.pbi.2012.03.016 Taylor-Teeples, M., Lin, L., de Lucas, M., Turco, G., Toal, T. W., Gaudinier, A., … Brady, S. M. (2015). An Arabidopsis gene regulatory network for secondary cell wall synthesis. Nature, 517(7536), 571–575. http://doi.org/10.1038/nature14099 Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., & Speleman, F. (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome biology, 3(7), research0034. Vanholme, R., Storme, V., Vanholme, B., Sundin, L., Christensen, J. H., Goeminne, G., … Boerjan, W. (2012). A Systems Biology View of Responses to Lignin Biosynthesis Perturbations in Arabidopsis. The Plant Cell Online, 24(9), 3506–3529. http://doi.org/10.1105/tpc.112.102574 Wang, Z. Y., Kenigsbuch, D., Sun, L., Harel, E., Ong, M. S., & Tobin, E. M. (1997). A Myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene. The Plant Cell Online, 9(4), 491-507.  90  Wang, H., Zhao, Q., Chen, F., Wang, M., & Dixon, R. A. (2011). NAC domain function and transcriptional control of a secondary cell wall master switch. The Plant Journal, 68(6), 1104-1114. Winter, D., Vinegar, B., Nahal, H., Ammar, R., Wilson, G. V., & Provart, N. J. (2007). An ―Electronic Fluorescent Pictograph‖ browser for exploring and analyzing large-scale biological data sets. PloS one, 2(8), e718. Yanovsky, M. J., Whitelam, G. C., & Casal, J. J. (2000). fhy3-1 retains inductive responses of phytochrome A. Plant physiology, 123(1), 235-242. Zhang, J., Elo, A., & Helariutta, Y. (2011). Arabidopsis as a model for wood formation. Current Opinion in Biotechnology, 22(2), 293-299. Zhang, X., Gou, M., & Liu, C.-J. (2013). Arabidopsis Kelch Repeat F-Box Proteins Regulate Phenylpropanoid Biosynthesis via Controlling the Turnover of Phenylalanine Ammonia-Lyase. The Plant Cell, 25(12), 4994–5010. http://doi.org/10.1105/tpc.113.119644 Zhong, R., & Ye, Z.-H. (2007). Regulation of cell wall biosynthesis. Current Opinion in Plant Biology, 10(6), 564–572. http://doi.org/10.1016/j.pbi.2007.09.001 Zhong, R., Lee, C., Zhou, J., McCarthy, R. L., & Ye, Z.-H. (2008). A Battery of Transcription Factors Involved in the Regulation of Secondary Cell Wall Biosynthesis in Arabidopsis. The Plant Cell, 20(10), 2763–2782. http://doi.org/10.1105/tpc.108.061325 Zhong, R., & Ye, Z. H. (2009). Transcriptional regulation of lignin biosynthesis.Plant signaling & behavior, 4(11), 1028-1034. Zhong, R., & Ye, Z.-H. (2015). Secondary Cell Walls: Biosynthesis, Patterned Deposition and Transcriptional Regulation. Plant and Cell Physiology, 56(2), 195–214. http://doi.org/10.1093/pcp/pcu140 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0166357/manifest

Comment

Related Items