UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The expression and invasion-suppressive function of HOXB4 in epithelial ovarian cancer Zhang, Xin 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2014_september_zhang_xin.pdf [ 5.31MB ]
Metadata
JSON: 24-1.0165920.json
JSON-LD: 24-1.0165920-ld.json
RDF/XML (Pretty): 24-1.0165920-rdf.xml
RDF/JSON: 24-1.0165920-rdf.json
Turtle: 24-1.0165920-turtle.txt
N-Triples: 24-1.0165920-rdf-ntriples.txt
Original Record: 24-1.0165920-source.json
Full Text
24-1.0165920-fulltext.txt
Citation
24-1.0165920.ris

Full Text

THE EXPRESSION AND INVASION-SUPPRESSIVE FUNCTION OF HOXB4  IN EPITHELIAL OVARIAN CANCER  by Xin Zhang  Bachelor of Medicine, Xi’an Jiaotong University, 2006 Master of Medicine, Xi’an Jiaotong University, 2008  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Reproductive and Developmental Sciences)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August 2014  © Xin Zhang, 2014 ii  Abstract  HOX genes are transcription factors which act as morphological regulators during development and in adult tissues. HOX paralogs often function cooperatively or synergistically in a specific tissue both in development and carcinogenesis. We have previously shown that HOXA4 enhances cell-cell adhesion and inhibits cell migration in epithelial ovarian cancer (EOC) cells. HOXB4, a close paralog of HOXA4, is more highly expressed in EOC cells than ovarian surface epithelium (OSE), a putative source of EOC. We therefore hypothesized that HOXB4 might have functions similar or complementary to those of HOXA4 in EOC.   In our present study, we found variable expression levels of HOXB4 in EOC cell lines. Treatment with a DNA hypo-methylation reagent (5-Aza-dC) significantly induced HOXB4 expression in EOC cells. Functionally, neither siRNA-mediated down-regulation nor retroviral overexpression of HOXB4 affected EOC cell proliferation, as assessed by MTT and cell counting assays. Down-regulation of endogenous HOXB4 significantly enhanced trans-well Matrigel invasion of EOC cells and immortalized fallopian tube epithelial cells (OE-E6/E7), whereas forced-expression of HOXB4 suppressed EOC cell invasiveness. Gene expression microarray analysis indicated that expression of the extracellular matrix receptor CD44 was positively regulated by HOXB4, and down-regulation of CD44 reversed the suppression of cell invasion in HOXB4 over-expressing EOC cells. Immunohistochemical analysis of HOXB4 expression was performed on two ovarian carcinoma tissue microarrays. Strong nuclear immuno-reactivity for HOXB4 was detected in the fimbrial epithelium of fallopian tube, a putative source of high-grade serous carcinoma (HGSC), whereas negative staining was observed in OSE, more iii  than 85% of HGSCs and all mucinous ovarian carcinomas in both arrays. Indeed, HOXB4 staining was significantly correlated with subtype (p<0.0001) in the Cheryl Brown Ovarian Cancer Outcomes Unit array (optimal representation of subtypes). Unexpectedly, we found borderline significant associations with FIGO stage (p=0.0685) and improved disease specific survival (p=0.0906) for HGSC in the Tumor Bank array (large HGSC cohort).    Taken together, our immunohistochemical and in vitro studies suggest that promoter methylation may promote the loss of HOXB4, which functions as an inhibitor of cell invasiveness partially via CD44, thereby contributing HGSC progression or metastasis.    iv  Preface  The research project presented in this dissertation was originally developed in Dr. Peter Leung's laboratory, and covered by the H98-70175-ovarian cancer- CIHR grant, which has been approved by the Children's and Women's Research Ethics Board in UBC.   I have participated in experimental design under Dr. Leung and Dr. Klausen's supervision and conducted all listed experiments except the gene expressing microarray and the analysis of gene expressing microarray and two tissue microarrays. I was also responsible for data collection and analysis, as well as preparation of manuscripts for peer-reviewed journal publication.  Presentations  American Association for Cancer Research special conference: Stem cells, development, and cancer. Vancouver, Canada. March, 2011. Poster presentation. Expression and invasion-suppressive function of HOXB4 in ovarian cancer cells. Xin Zhang , Peter C.K. Leung, and Christian Klausen.  14th Biennial meeting of the International Gynecologic Cancer Society. Vancouver, Canada. October, 2012. Poster presentation. Epigenetic silencing of invasion-suppressive HOXB4 in ovarian cancer. Xin Zhang, Mark S. Carey, C. Blake Gilks, Peter C.K. Leung, and Christian Klausen.  v  Table of Contents  Abstract .......................................................................................................................................... ii Preface ........................................................................................................................................... iv Table of Contents ...........................................................................................................................v List of Tables ................................................................................................................................ xi List of Figures .............................................................................................................................. xii List of Abbreviations ...................................................................................................................xv Acknowledgements ......................................................................................................................xx Dedication ................................................................................................................................... xxi Chapter  1: Introduction ...............................................................................................................1 1.1 Epithelial Ovarian Cancer ............................................................................................... 1 1.1.1 Overview ..................................................................................................................... 1 1.1.2 Common Subtypes of Ovarian Cancer ....................................................................... 2 1.1.2.1 High-Grade Serous Carcinoma ........................................................................... 2 1.1.2.2 Low-Grade Serous Carcinoma ............................................................................ 3 1.1.2.3 Clear Cell Carcinoma .......................................................................................... 3 1.1.2.4 Endometrioid Carcinoma .................................................................................... 4 1.1.2.5 Mucinous Carcinoma .......................................................................................... 4 1.1.3 Sources of Epithelial Ovarian Cancer ......................................................................... 4 1.1.4 Metastasis of Ovarian Cancer ..................................................................................... 6 1.2 HOX Genes ..................................................................................................................... 8 1.2.1 Overview ..................................................................................................................... 8 vi  1.2.2 Regulation of HOX Genes .......................................................................................... 9 1.2.2.1 Endocrine Regulation.......................................................................................... 9 1.2.2.1.1 Retinoic Acid................................................................................................. 9 1.2.2.1.2 Estrogen ....................................................................................................... 10 1.2.2.1.3 Vitamin D .................................................................................................... 11 1.2.2.2 Epigenetic Regulation ....................................................................................... 12 1.2.2.2.1 DNA Methylation ........................................................................................ 12 1.2.2.2.2 Histone Modifications ................................................................................. 17 1.2.2.2.3 Noncoding RNAs ........................................................................................ 18 1.2.3 HOX in Carcinogenesis ............................................................................................ 19 1.2.3.1 Leukemia........................................................................................................... 19 1.2.3.2 Other Types of Cancers .................................................................................... 20 1.2.4 HOX genes in Epithelial Ovarian Cancer ................................................................. 21 1.2.4.1 HOXA7 ............................................................................................................. 22 1.2.4.2 HOXB7 ............................................................................................................. 23 1.2.4.3 HOXA9, HOXA10 and HOXA11 .................................................................... 23 1.2.4.4 HOXB13 ........................................................................................................... 24 1.2.4.5 Group 4 HOX Paralogs ..................................................................................... 25 1.2.4.5.1 HOXA4 ....................................................................................................... 25 1.2.4.5.2 HOXB4........................................................................................................ 26 1.2.4.5.3 HOXC4........................................................................................................ 27 1.2.4.5.4 HOXD4 ....................................................................................................... 27 1.3 CD44 ............................................................................................................................. 28 vii  1.3.1 Overview ................................................................................................................... 28 1.3.2 The Function of CD44 .............................................................................................. 29 1.3.3 Regulation of CD44 .................................................................................................. 31 1.4 Rationale and Overall Hypothesis ................................................................................ 31 Chapter  2: Materials and Methods ...........................................................................................35 2.1 Cell Lines and Cell Culture........................................................................................... 35 2.2 Reverse Transcription and Polymerase Chain Reaction (PCR) .................................... 37 2.2.1 Reverse Transcription ............................................................................................... 37 2.2.2 Standard PCR ............................................................................................................ 37 2.2.3 Quantitative Real-Time PCR .................................................................................... 38 2.3 Western Blot Analysis .................................................................................................. 39 2.4 Small Interfering RNA (siRNA) Transfection .............................................................. 40 2.5 HOXB4 Retrovirus Production, Infection, and Selection ............................................. 41 2.6 MTT Proliferation Assays............................................................................................. 42 2.7 Trypan Blue Cell Viability Test .................................................................................... 42 2.8 Trans-Well Migration Assays ....................................................................................... 43 2.9 Matrigel Invasion Assay ............................................................................................... 43 2.10 Type I Collagen Coating Trans-Well Invasion ............................................................. 44 2.11 Gene Expression Microarray ........................................................................................ 44 2.12 5-Aza-2’-Deoxycytidine Treatment .............................................................................. 45 2.13 Tissue Microarray (TMA) ............................................................................................. 45 2.14 Immunohistochemistry ................................................................................................. 46 2.15 Statistical Analysis ........................................................................................................ 47 viii  Chapter  3: Expression and Function of HOXB4 in Ovarian Cancer Cells ...........................48 3.1 Rationale ....................................................................................................................... 48 3.2 Expression of HOXB4 in OSE, IOSE, Human Fallopian Tube Epithelial, and Ovarian Cancer Cells .............................................................................................................................. 49 3.3 HOXB4 Does Not Regulate Ovarian Cancer Cell Proliferation ................................... 50 3.4 HOXB4 Increases Trans-Well Migration in Ovarian Cancer Cells .............................. 52 3.5 HOXB4 Suppresses Trans-Well Matrigel Invasion in Ovarian Cancer Cells .............. 53 3.6 Matrix Metalloproteinase (MMP) Inhibitors Selectively Reverse HOXB4 siRNA-Induced Trans-Well Matrigel Invasion ..................................................................................... 54 3.7 HOXB4 Does Not Regulate Trans-Well Type I Collagen Invasion ............................. 55 3.8 HOXB4 Suppresses Trans-Well Matrigel Invasion in Fallopian Tube Epithelial Cells ........................................................................................................................................56 3.9 Discussion ..................................................................................................................... 56 Chapter  4: Mechanism Mediating the Suppressive Effects of HOXB4 on Ovarian Cancer Cell Invasion .................................................................................................................................77 4.1 Rationale ....................................................................................................................... 77 4.2 Gene Expression Microarray Analysis of HOXB4-Overexpressing OVCAR-5 Cells . 78 4.2.1 Differentially Expression Analysis of HOXB4 Targets ........................................... 78 4.2.2 Validation of Target Genes ....................................................................................... 80 4.3 Invasion-Suppressive Effect of HOXB4 Is Mediated by CD44 ................................... 81 4.3.1 Expression of CD44 Is Regulated by HOXB4 in OVCAR-5 and CaOV-3 Cells .... 81 4.3.2 Down-Regulation of CD44 Increases Trans-Well Matrigel Invasion in OVCAR-5 Cells.......................................................................................................................................82 ix  4.3.3 The Suppressive Effects of HOXB4 on Invasion Are Partially Mediated by CD44. 82 4.3.4 CD44 Is Not Expressed in A2780 Cells ................................................................... 83 4.4 Discussion ..................................................................................................................... 84 Chapter  5: Expression of HOXB4 in Putative Sources and Tissue Microarray (TMA) of Ovarian Carcinomas ....................................................................................................................96 5.1 Rationale ....................................................................................................................... 96 5.2 Antibody Validation by Immunocytochemistry of Ovarian Cancer Cell Lines ........... 97 5.3 Immunostaining of HOXB4 in Fimbrial Epithelium and OSE ..................................... 97 5.4 IHC for HOXB4 on TMA of Ovarian Carcinomas ...................................................... 98 5.4.1 Analysis of HOXB4 expression in the Tumor Bank Array ...................................... 99 5.4.2 Analysis of HOXB4 expression in CBOCOU Array .............................................. 101 5.5 Discussion ................................................................................................................... 103 Chapter  6: DNA Methylation Contributes to the Loss of HOXB4 Expression in Ovarian Cancer .........................................................................................................................................122 6.1 Rationale ..................................................................................................................... 122 6.2 HOXB4 Expression Is Restored by 5-Aza-dC Treatment .......................................... 123 6.3 Down-Regulation of DNMTs Does Not Restore HOXB4 Expression ........................ 123 6.4 Discussion ................................................................................................................... 124 Chapter  7: Conclusion and Future Directions .......................................................................134 7.1 Overview ..................................................................................................................... 134 7.2 The Expression of HOXB4 in Ovarian Cancer........................................................... 135 7.3 The Function of HOXB4 in Ovarian Cancer .............................................................. 136 7.4 The Epigenetic Regulation of HOXB4 in Ovarian Cancer ......................................... 139 x  7.5 Future Perspectives ..................................................................................................... 140 7.6 Conclusions ................................................................................................................. 141 References ...................................................................................................................................142 Appendices ..................................................................................................................................169 Appendix A Expression and Function of HOXC4 in Ovarian Cancer Cells .......................... 169 A.1 Rationale ................................................................................................................. 169 A.2 Expression of HOXC4 in Ovarian Cancer Cells ..................................................... 170 A.3 Down-Regulation of HOXC4 Does Not Affect Migration or Invasion of Ovarian Cancer Cells ........................................................................................................................ 171 A.4 Discussion ............................................................................................................... 172 Appendix B ............................................................................................................................. 179 B.1 HOXB4 PCR products sequencing result ............................................................... 179 B.2 HOXC4 PCR products sequencing result ............................................................... 180 B.3 Target sequences of the siRNA pool on HOXB4 ................................................... 180 B.4 Target sequences of the siRNA pool on HOXC4 ................................................... 180 B.5 Target sequences of the siRNA pool on CD44 ....................................................... 181 B.6 Target sequences of the siRNA pool on DNMT1 ................................................... 181 B.7 Target sequences of the siRNA pool on DNMT3A ................................................ 181 B.8 Target sequences of the siRNA pool on DNMT3B ................................................ 181 Appendix C Gene Expressing Microarray analysis of HOXB4 overexpressing cells shows target genes more than 1.5-fold change .................................................................................. 185   xi  List of Tables  Table 1.1 Overview of HOX genes involved in epithelial ovarian cancer.................................... 22 Table 2.1 Detailed information of ovarian cancer cell lines275 ..................................................... 36 Table 2.2 Antibodies for Western Blot analysis ........................................................................... 40 Table 4.1 Top 12 gene transcripts related to ovarian cancer ........................................................ 79 Table 4.2 Altered transcripts of metalloproteinase by overexpressing of HOXB4 ....................... 80 Table 5.1 HOXB4 staining in Tumor Bank Array of ovarian carcinomas ................................... 99 Table 5.2 Contingency analysis of HOXB4 by FIGO stage in HGSC (Tumor Bank Array) ..... 100 Table 5.3 Contingency analysis of HOXB4 by review grade in HGSC (Tumor Bank Array) ... 100 Table 5.4 Contingency analysis of HOXB4 by primary cell type in CBOCOU Array .............. 101 Table 5.5 Contingency analysis of HOXB4 by FIGO stage in CCC (CBOCOU Array) ........... 102 Table 5.6 Contingency analysis of HOXB4 by FIGO stage in EC (CBOCOU Array) .............. 102 Table 5.7 Contingency analysis of HOXB4 by FIGO stage in HGSC (CBOCOU Array) ........ 102 Table 5.8 Contingency analysis of HOXB4 by review grade in EC (CBOCOU Array) ............ 103 Table 5.9 Contingency analysis of HOXB4 by review grade in HGSC (CBOCOU Array) ...... 103  xii  List of Figures  Figure 1.1 Schematic structure of HOX clusters in human ........................................................... 33 Figure 1.2 The protein structure of CD44 isoforms ...................................................................... 34 Figure 3.1 HOXB4 expression in OE, OSE, IOSE, and ovarian cancer cells .............................. 64 Figure 3.2 siRNA mediated down-regulation of HOXB4 in ovarian cancer cell lines ................ 65 Figure 3.3 Down-regulation of HOXB4 does not alter ovarian cancer cell proliferation as assessed by MTT assay ................................................................................................................. 66 Figure 3.4 Down-regulation of HOXB4 does not alter ovarian cancer cell proliferation as assessed by trypan blue cell viability test ..................................................................................... 67 Figure 3.5 Overexpressing HOXB4 does not alter ovarian cancer cell proliferation as assessed by MTT assay and trypan blue cell viability test ............................................................................... 68 Figure 3.6 HOXB4 increases trans-well migration in A2780 cells .............................................. 69 Figure 3.7 HOXB4 does not regulate ovarian cancer cell migration ............................................ 70 Figure 3.8 HOXB4 suppresses trans-well Matrigel invasion in ovarian cancer cells .................. 71 Figure 3.9 Overexpressing HOXB4 suppresses ovarian cancer cell invasion .............................. 72 Figure 3.10 Reduced invasiveness of HOXB4-overexpressing cells are mediated by HOXB4 ... 73 Figure 3.11 GM6001, but not Marimastat, abolished siHOXB4 induced Matrigel trans-well invasion in CaOV-3 cells .............................................................................................................. 74 Figure 3.12 Overexpressing HOXB4 does not affect type I collagen invasion in ovarian cancer cells ............................................................................................................................................... 75 Figure 3.13 HOXB4 suppresses oviductal epithelial cell invasion ............................................... 76 xiii  Figure 4.1 Eight differentially-expressed gene transcripts were assessed by real-time PCR analysis in OVCAR-5 cells ........................................................................................................... 89 Figure 4.2 Eight differentially-expressed gene transcripts were tested by real-time PCR analysis in OVCAR-8 and CaOV-3 cells ................................................................................................... 90 Figure 4.3 HOXB4 regulates the expression of CD44 protein in ovarian cancer cells ................ 91 Figure 4.4 HOXB4 does not regulate the expression of CD44 in OE-E6/E7 cells ...................... 92 Figure 4.5 Down-regulation of CD44 expression increases cell invasion in OVCAR-5 cells ..... 93 Figure 4.6 HOXB4 suppressed invasion of ovarian cancer cells is reversed by siRNA mediated down-regulation of CD44 ............................................................................................................. 94 Figure 4.7 HOXB4 suppressed invasion of ovarian cancer cells is reversed by CD44 functional blocking antibody (clone 5F12) .................................................................................................... 95 Figure 5.1 Immunostaining of HOXB4 in ovarian cancer cell line OVCAR-8.......................... 110 Figure 5.2 Variable expression of HOXB4 in ovarian cancer cell lines ..................................... 111 Figure 5.3 Immunostaining of siRNA mediated down-regulated HOXB4 in OVCAR-8 cells . 112 Figure 5.4 HOXB4 expression in fallopian tube fimbria and ovarian cancer cells .................... 113 Figure 5.5 HOXB4 expression in fallopian tube fimbrial epithelium ........................................ 114 Figure 5.6 HOXB4 expression in normal ovarian tissue ............................................................ 115 Figure 5.7 Examples of the four intensities used for scoring HOXB4 staining in the tissue microarrays. ................................................................................................................................ 116 Figure 5.8 Disease specific survival of HOXB4 staining in high-grade serous carcinomas in Tumor Bank array ....................................................................................................................... 117 Figure 5.9 Survival curves of HOXB4 staining in CCC in the CBOCOU Array ....................... 118 Figure 5.10 Survival curves of HOXB4 staining in EC in the CBOCOU Array........................ 119 xiv  Figure 5.11 Survival curves of HOXB4 staining in HGSC in the CBOCOU Array .................. 120 Figure 5.12 Survival curves of HOXB4 staining in stage III HGSC in the CBOCOU Array .... 121 Figure 6.1 HOXB4 mRNA expression is induced by treatment with 5-Aza-dC in a concentration-dependent manner on ovarian cancer cells ................................................................................. 128 Figure 6.2 HOXB4 protein expression is induced by treatment with 5-Aza-dC in a concentration-dependent manner on ovarian cancer cells ................................................................................. 129 Figure 6.3 HOXB4 mRNA expression is induced by treatment with 5-Aza-dC in ovarian cancer cells ............................................................................................................................................. 130 Figure 6.4 HOXB4 protein expression is induced by treatment with 5-Aza-dC in ovarian cancer cells ............................................................................................................................................. 131 Figure 6.5 Down-regulation of DNMT1 does not induce HOXB4 mRNA levels in OVCAR-5 cells ............................................................................................................................................. 132 Figure 6.6 Down-regulation of DNMT3A and DNMT3B does not induce HOXB4 mRNA levels in OVCAR-5 cells ........................................................................................................................... 133 Figure A.1 HOXC4 expression in human fallopian tube epithelial cells, ovarian cancer cells, and immortalized OSE cell lines ....................................................................................................... 175 Figure A.2 siRNA mediated down-regulation of HOXC4 .......................................................... 176 Figure A.3 HOXC4 does not regulate ovarian cancer cell migration ......................................... 177 Figure A.4 HOXC4 does not regulate ovarian cancer cell invasion ........................................... 178  xv  List of Abbreviations  ABCB1 ADRB2 AML ANOVA  ARID1A  ATP-binding cassette, sub-family B (MDR/TAP), member 1 Adrenoceptor beta 2, surface Acute myeloid leukemia Analysis of variance AT-rich interactive domain 1A BRAF BRCA1/2 BM Murine sarcoma viral oncogene homolog B Breast cancer 1/2, early onset Basement membrane CCC CCND1 CDKN2A cDNA  COBL c-MYC CMML  Clear cell carcinoma Cyclin D1 Cyclin-dependent kinase inhibitor 2A Complementary deoxyribonucleic acid  Cordon-bleu WH2 repeat protein Avian myelocytomatosis viral oncogene homolog Chronic Myelomonocytic leukemia DAB DES DMEM DMSO DNA Mitogen-responsive phosphoprotein Desmin Dulbecco’s modified Eagle’s medium Dimethyl sulfoxide Deoxyribonucleic acid  xvi  DNMT DNA (cytosine-5-)-methyltransferase ECM EC EDTA  EGF EOC  EMT ER ERK ERM EZH2  Extracellular matrix  Endometrioid carcinoma Ethylenediamine tetra acetic acid Epidermal growth factor Epithelial ovarian cancer  Epithelial mesenchymal transition  Estrogen receptor Extracellular signal-regulated kinase Ezrin/Radixin/Moesin Enhancer of zeste homolog 2 FACS FBS  FIGO FOXM1 Fluorescence-activated cell sorting Fetal bovine serum International federation of gynecology and obstetrics Forkhead box M1 GAPDH GFP Glyceraldehyde-3-phosphate dehydrogenase Green fluorescent protein HER2 HGSC HNF-1β HOTAIR HOX Avian erythroblastic leukemia viral oncogene homolog 2 High-grade serous carcinoma Hepatocyte nuclear factor 1-beta HOX transcript antisense intergenic RNA Homeobox protein xvii  HSC HuR  Hematopoietic stem cell Hu-antigen R IHC IRES Immunohistochemistry internal ribosomal entry site kDa KRAS  Kilodalton Kirsten rat sarcoma viral oncogene homolog  LGSC LZTS1 Low-grade serous carcinoma leucine zipper, putative tumor suppressor 1 MAPK  MC MDS MEIS MGB MLL MMP mRNA MSCV  MTT Mitogen-activated protein kinase  Mucinous carcinoma Myelodysplastic syndrome Meis homeobox Minor groove binder Mixed lineage leukemia Matrix metalloprotease Messenger ribonucleic acid Murine stem cell virus 3-(4, 5- Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide NFQ NUP98 Non-fluorescent quencher Nucleoporin 98kDa OSE Ovarian surface epithelium PBS Phosphatase buffered saline xviii  PBX PcG PCR PI3KCA POU5F1 PTEN PVDF Pre-B-cell leukemia homeobox protein Polycomb group protein Polymerase chain reaction Phosphatidylinositol 3-kinase POU class 5 homeobox 1 protein Phosphatase and tensin homolog Polyvinylidene difluoride RA RAS RB1 RT-PCR  ROR1 RXR Retinoic acid  Rat sarcoma viral oncogene homolog Retinoblastoma 1 Reverse transcription polymerase chain reaction Receptor tyrosine kinase-like orphan receptor 1 Retinoid X receptor SAM SEM SDS-PAGE  S-adenosylmethionine Standard error of the mean Sodium dodecyl sulphate polyacrylamide gels for electrophoresis TALE TBS TET TCGA THSD1 TIC Three-amino-acid-loop-extension protein Tris-buffered saline Ten-eleven translocation protein The Cancer Genome Atlas Thrombospondin, type I, domain containing 1 Tubal intraepithelial carcinoma xix  TMA TrxG Tissue microarray Trithorax group protein VDR Vitamin D (1,25- dihydroxyvitamin D3) receptor WHO WNT WT1 World health organization Wingless-type MMTV integration site family Wilms tumor 1   xx  Acknowledgements  First of all, I would like to take this opportunity to express my heartfelt thanks to Dr. Peter C. K. Leung.  Moreover, I would like to thank Dr. Dan Rurak, Dr. Mark Carey, Dr. Anthony Cheung, and Dr. Christian Klausen, who are my thesis committee members.  Also, I would like to give my special thanks to Dr. Christian Klausen for his guidance and advice. I am also grateful to my friends and labmates in Dr. Leung’s laboratory. And many thanks to Mrs. Roshni Nair for her help in our department.  Finally, special thanks are owed to my parents and my husband, who have supported me throughout my years of education, both morally and financially.     xxi  Dedication      This is dedicated to the women and their families who are suffering from ovarian cancer.  1  Chapter  1: Introduction 1.1 Epithelial Ovarian Cancer 1.1.1 Overview              Epithelial ovarian cancer (EOC) is the fifth most common cause of death from cancers in women in Canada1. It kills more women than all other gynecologic malignancies together2. If ovarian cancer is diagnosed before spreading outside the ovaries, more than 90% of patients will survive 5 years. However, only approximately 19% of ovarian cancer is caught in the early stages2. About 75% of patients are diagnosed with ovarian cancer that has spread beyond the ovaries2. At that time, the rate of five-year survival drops to no more than 30%2. In cancer research, although we have made considerable progress, the mortality rate of ovarian cancer has changed little in the last several decades. The reason is primarily related to the low sensitivity of screening methods for early-stage disease diagnosis and the lack of good treatment outcomes at advanced stages. Therefore, it becomes more and more urgent that there will be increasing discovery of the molecular mechanisms underlying the regulation of motility and invasive behavior of ovarian cancer cells in terms of improving the outcomes for this lethal disease3.               A large number of complex genetic changes are involved in EOCs. In particular, a number of oncogenes and/or tumor suppressor genes are differentially expressed and/or mutated4. Morphological and molecular genetic analysis of EOCs has identified multiple subtypes, including low-grade serous carcinoma (LGSC), mucinous carcinomas (MCs), endometrioid carcinomas (ECs), clear cell carcinomas (CCCs), and malignant Brenner tumors. Each are associated with distinct molecular changes, such as murine sarcoma viral oncogene homolog B (BRAF), Kirsten rat sarcoma viral oncogene homolog (KRAS), β-catenin and phosphatase and tensin homolog (PTEN) mutations for LGSCs, MCs and CCCs, respectively, 2  and microsatellite instability in ECs5. In contrast, the most frequent molecular change in high grade serous carcinomas (HGSCs) is mutation of the tumor protein 53 (TP53)  gene, however germ line mutations or copy number variation of breast cancer 1, early onset (BRCA1) and breast cancer 2, early onset (BRCA2) also account for 5-10% of HGSCs6. 1.1.2 Common Subtypes of Ovarian Cancer               According to the histological classification of ovarian cancer, EOCs make up to 90% of ovarian cancers. EOCs are classified into subtypes based on the type of epithelial differentiation that is present in the tumor. These subtypes include HGSC and LGSC, together comprising approximately 80% of all EOCs, as well as ECs, MCs and CCCs7.  1.1.2.1 High-Grade Serous Carcinoma               HGSC accounts for most ovarian cancer deaths each year8. In the last two decades, surgery and combined platinum and taxane chemotherapy are the first line treatments for patients with HGSC7. The morphology of HGSC resembles the fallopian tubal epithelial structures and the tumor cells possess a very high mitotic rate9. Chromosomal instability is a feature of HGSC10,and might be related to the frequent mutation of TP53. A mutation study shows that there are TP53 mutations in 119 out of 123 cases of HGSC, with TP53 malfunction in all the cases11. Together with TP53 mutations, mutations or epigenetically silenced expression of other DNA repair proteins, such as BRCA1/2, are also found in HGSC12. Those genes are responsible for the chromosomal instabilities in HGSC. Besides these mutations and chromosomal instabilities, a TCGA (The Cancer Genome Atlas) research reports that the expression levels of some signaling molecules are altered in HGSC such as NOTCH, forkhead box M1 (FOXM1), retinoblastoma 1 (RB1)/cyclin D1 (CCND1)/ cyclin-dependent kinase inhibitor 2A (CDKN2A)/ E2F transcription factor 1 (E2F1), and phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic 3  subunit alpha (PI3KCA)/KRAS13. However, none of these molecules has a predictive association with the prognosis of HGSC. Even the TP53 mutation which predominantly presents in HGSC, does not have a predictive value11. Therefore, finding a predictive molecule for the prognosis of HGSC is required for ovarian cancer studies.  1.1.2.2 Low-Grade Serous Carcinoma               LGSC is a rare subtype of epithelial ovarian cancer, accounting for only 3.4% of a 1009 case review study14. LGSC is believed to be derived from serous borderline tumors15. Different from HGSC, LGSC is relatively chromosomally stable, has low mitotic rate, and is well differentiated histologically15. Most LGSCs express estrogen/progesterone receptors and TP53 and BRCA1/2 mutations are rare events in LGSC16. KRAS or BRAF are frequently mutated in two thirds of LGSC cases, and their mutation leads to the activation of the mitogen activated protein kinase (MAPK) pathway. Furthermore, these mutations have also been found in concurrent benign and borderline lesions, which indicates that mutations of KRAS or BRAF might be the initiating factors in LGSC tumorigenesis17.    1.1.2.3 Clear Cell Carcinoma               CCCs have an unfavorable prognosis compared to other low stage ovarian carcinomas18. CCC are characterized by clear cytoplasm, abundant cell membranes, hobnail cells, and eosinophilic hyaline stroma18. CCCs are believed to arise from endometriosis entrapped in the ovarian surface area18. Compared with HGSCs, most CCCs express high levels of hepatocyte nuclear factor (HNF)-1β, whereas they are negative for Wilms tumor 1 (WT1) and the estrogen receptor (ER)19. Yamamoto et al. demonstrated that the H1047R mutation of PIK3CA is present in almost half of all CCCs and their concurrent precursor lesions20. The mutations of AT-rich 4  interactive domain 1A (ARID1A) gene, encoding one of the chromatin remodeling complex proteins, have been observed in half of the CCCs21,22. 1.1.2.4 Endometrioid Carcinoma               ECs resemble the histological morphology of endometrial endometriosis4. Most ECs are diagnosed as low grade and low stage disease, and therefore have favorable survival4. ARID1A mutations can also be found in ECs21,22. In addition to ARID1A, β-catenin, PTEN, PIK3CA and KRAS mutations are observed in 10-30% of ECs4. Hereditary non-polyposis colorectal carcinoma is thought to be a predisposing factor for EC7. Moreover, EC has the most favorable prognosis of all EOC subtypes due to diagnosis at a lower grade and stage23. 1.1.2.5 Mucinous Carcinoma               MCs at early stage and low grade can be treated with oophorectomy without adjuvant chemotherapy and generally have good prognosis24. Almost three fourths of MCs present with mutations in KRAS25–28. Amplification of v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (HER2) has been found in 19% of MCs, allowing for HER2 targeted therapy29. Furthermore, it is also reported that KRAS mutations and HER2 overexpression or amplification are mutually exclusive in MCs29, providing for a stratified treatment approach for MCs. 1.1.3 Sources of Epithelial Ovarian Cancer               In human embryonic development, the mesodermal cell layer derived from the epiblast, which will ultimately form the female reproductive duct and ovarian surface epithelium (OSE) through the process of epithelial mesenchymal transition (EMT)30. Furthermore, the Müllerian duct will differentiate into most female reproductive organs such as the fallopian tube, endometrium, cervix and upper part of the vagina31. The celomic epithelium is thought to be the origin of OSE32. OSE, a layer of simple epithelium, which covers the ovarian surface or cortical 5  inclusion cysts33, is not a well differentiated epithelium in mature women32. There have been no known tissue-specific differentiation markers found in OSE32. OSE expresses keratins (keratin 7, 8, 18 and 19), mucin antigen MUC1, 17β-hydroxysteroid dehydrogenase, vimentin and N-cadherin, but does not express CA125 or E-cadherin32. Historically it has been believed that the OSE is the original tissue of EOC32. In adults, the OSE undergoes periodic ovulatory ruptures, and develops the mesenchymal features once trapped into the ovary stroma. However, some OSE still maintain the epithelial characteristics (epithelial inclusion cysts and clefts) and have the potential to undergo the neoplastic progression32,34. Although there is not enough evidence to show the differentiation pattern of OSE to Müllerian duct epithelium, the possibility that OSE is one of the sources of EOC cannot be ruled out34.                However, as the subtypes of EOCs now are considered to be a group of different diseases, there are other putative sources of EOC subtypes such as the fallopian tube fimbrial epithelium35 and endometriosis36. Indeed, Fallopian tube fimbria is now thought to be a bona fide source for HGSCs. Piek et al. proposed the mechanism that the neoplastic cells from the fimbrial end can be transmitted onto the surface of ovary during the ovulation and the reversing menstrual flow37. This hypothesis has been supported by the observation that serous tubal intraepithelial carcinomas (STICs) were more frequently found in the fallopian tubes than in the ovaries of the women with germline BRCA1/2 mutation undergoing prophylactic salpingo-oophorectomy38. Also, STICs were found in the fallopian tubes of sporadic HGSC patients and identical p53 mutations were found in five of five observed cases with STICs and serous ovarian cancer at the same time39. However, a study showed that STICs were found in approximately 60% of HGSCs40, suggesting the fallopian tube may not be the only source of HGSCs. It is also thought that CCCs and ECs arise from endometriosis, and that some MCs may be derived from 6  transitional cell nests in the tubal-peritoneal junction36. Moreover, based on the common embryonic origin and adjacent location of the Müllerian duct and OSE, Dr. Nelly Auersperg proposed a unifying hypothesis that ovarian cancer derives from both the OSE and the fallopian tube fimbrial epithelium, or a transition between the two41. 1.1.4 Metastasis of Ovarian Cancer               Metastasis is thought to be the end product of the process of carcinoma evolution. During this step, the epithelial cell sequentially accumulates genetic alterations which promote the transition of well-differentiated and immobile cells to highly proliferating and tissue-invasive cells. Thus, tumor cells might be transported away from the original sites by the body fluids in terms of blood, lymph, or the fluids of body cavities. It provides the opportunity for tumor cells to settle down and proliferate in a new tissue environment, and even invade further into nearby tissues at the metastatic sites, and this eventually leads to organ dysfunction and even death42. At the earliest stage (stage IA/IB), ovarian carcinoma is restricted to one or both ovaries with a complete overlying ovarian capsule43. As in the higher stages, the cancer cells disrupt the overlying capsule, directly extend and invade to the adjacent tissues such as the uterus, fallopian tubes, the peritoneum, and the broad ligament43. Differing from the classic patterns of metastasis of most tumors, ovarian carcinoma cells, particularly HGSC cells, detached from the original sites, are transported via the peritoneal fluid and implant on the peritoneum, the pelvic mesothelium or the serosa of abdominal organs, even prior to acquiring invasive potential43. Omentum, mesentery and diaphragm are the most common locations where aggregations of ovarian cancer cells are observed43. The degree of ascites usually correlates with intraperitoneal dissemination43. Tumor cells can be found in the lymphatics that collect the lymph fluid from ovaries draining into the pelvic lymph nodes or even in the para-aortic lymph nodes43. Clinically, 7  compared to other type of epithelial carcinomas, haematogenous dissemination is rarely seen43. In the progression of tumor cell metastasis, the neoplastic cells gain the ability to breach the surrounding extracellular matrix (ECM) and to interact with the stromal cells and substrates inducing a tissue-invasive and metastatic supportive microenvironment.                The ECM providing a physical barrier to tumor cell migration includes the basement membrane (BM) underlying the epithelial cells as well as the meshwork of interstitial ECM substrates44,45. BM is a sheet-like dense matrix secreted by the epithelial cells is the first ECM barrier of cancer cells. The meshwork of Laminin and type IV collagen, which are able to assemble themselves into polymers, are the predominant components of BMs46. This interlocking web forms a network with a pore size of approximately 50 nm, which restricts the migration of both cancer and normal cells through the layer44. Therefore, the epithelial-to-mesenchymal transition (EMT) and the proteolytic remodeling are required steps during BM transmigration. In the phase of embryonic gastrulation, the first BM degradation and invasion events occur during the formation of mesoderm by epithelial cells who must pass through the underlying BM47. This process is mainly controlled by the helix-loop-helix transcription factors together with zinc finger family members and microRNA networks47. Following BM perforation, cancer cells metastasize into the tissue interstitial matrix, which is a 3-dimensional network consisting mainly of a cross-linking fibrillar structure of fibrin, fibronectin and collagens48. This process requires tumor cells to adapt to a stromal microenvironment containing widely distributed type I collagen48. Although the composition of tumor-associated ECM varies among most cancer types, the family of matrix metalloproteinases (MMPs) and cell adhesion molecules facilitates neoplastic cell invasion together with ECM remodeling by stromal cells49. 8  Furthermore, the membrane-type MMPs are thought to be essential for cancer cell migration and invasion through both BM and interstitial ECMs44.   1.2 HOX Genes 1.2.1 Overview                HOX proteins are transcription factors that contain a conserved DNA-binding motif termed the homeodomain. The homeodomain is a 61-amino acid helix-turn-helix motif, which can insert certain recognition amino acids into the major groove and adjacent minor groove of DNA. In humans, the 39 HOX genes located at chromosomes 7p15, 17q21, 12q13, and 2q31, form 4 clusters (Figure 1.1). Based on homeobox sequence similarity and position within each cluster, HOX genes have been divided into 13 paralogous groups50. HOX genes together with their cofactors and the collaborators specify the DNA-binding site and regulate gene expression51. As cofactors, the TALE (three-amino-acid-loop-extension) proteins PBX and MEIS specify the function of HOX proteins by binding to amino acid sequences flanking the homeodomain51. PBX proteins mainly bind with 3’ HOX proteins, while MEIS proteins preferentially interact with 5’ HOX proteins52.                During embryonic development, HOX genes specify positional identity along the anterior-posterior axis. For instance, 3’ HOX genes (e.g.HOXA1) are expressed earlier and more anteriorly than 5’ HOX genes (e.g. HOXA13), generally referred to as spatial and temporal collinearity. Generally, more 5′ HOX genes in the cluster have a dominant phenotype compared to 3’ genes, which is described as posterior prevalence53. In mammals, although HOX genes act as individual proteins, they also function as part of a highly organized network with paralogous genes, or adjacent genes within the same cluster, or even nonparalogous genes in different linkage groups. Furthermore, they can interact with each other to specify morphological 9  regionalization during development30,54–57. Recently, a large amount of evidence has illustrated that HOX genes are also involved in oncogenesis in solid tumors and hematological malignancies58.  1.2.2 Regulation of HOX Genes               HOX genes are morphological regulators of tissue identity in both developing and adult tissues. Generally speaking, the regulation and the hierarchies of HOX genes are not clearly identified59. However, several hormones and their cognate receptors are reported to be regulators of HOX gene expression during embryonic development and differentiation60. Moreover, the epigenetic regulation of HOX genes is also involved in the development and functional differentiation of adult tissues in vertebrates59.  1.2.2.1 Endocrine Regulation               In both embryonic development and the physiology of adult tissues, endocrine regulation leads to regional expression patterns and functional differentiation of HOX genes59. Several endocrine factors have been shown to regulate HOX gene expression such as retinoic acid, estrogen ,vitamin D, progesterone, and testosterone59. 1.2.2.1.1 Retinoic Acid               During early embryonic development of the central nervous system in Xenopus, retinoic acid exerts a transformational effect on anterior neural tissue, inducing a posterior specification61. The well-defined regulatory function of retinoic acid in nervous system development is via its nuclear receptors, retinoic acid receptors (RAR) and retinoid x receptors (RXR) 62. The RAR and RXR can form homo- or heterodimers, these dimers can bind to the retinoic acid response element (RARE or RXRE) of the downstream target genes to regulate their expression62.   10                The expression of Hoxa1 and Hoxb1 are associated with the development of the midbrain and hindbrain of the mice embryo63. There are RAREs in the regulatory regions of murine Hoxa1, Hoxb1, and Hoxd4, suggesting that the expression of these Hox genes might be regulated by retinoic acid signaling64–66. Treatment with retinoic acid can up-regulate the anterior expression of murine Hoxb1 (Hox-2.9), Hoxb2 (Hox-2.8), Hoxb4 (Hox-2.6) and Hoxb5 (Hox-2.1), but not a 5’ gene Hoxb9 (Hox-2.5)67. Furthermore, targeted homozygous mutations of RARs and loss-of-function mutations of Hox genes results in similar phenotypes in mice models68. It has also been reported that a feedback circuit exists between the RAR subunits and Hox genes, and that the RARβ is the direct transcriptional regulator of Hoxb4 in mice69. However, this regulatory effect of retinoic acid in mice is only confined in the more anteriorly expressed Hox genes but not in the 5’ Hox genes60,67. Therefore, retinoic acid is an important regulatory factor of Hox genes in vertebrate development. 1.2.2.1.2 Estrogen               In mice embryonic development, estrogen is a sine qua non in the differentiation of the female reproductive tract70. In Erα(−/−) mice, uteri do not respond to estradiol resulting in sterility70. In Erβ-deficient mice, females can respond to estradiol, but still have subfertility71. In the development of the Müllerian tract, Hoxa9 is expressed in the developing fallopian tubes, Hoxa10 in the cranial part of the uterine anlage, Hoxa11 in the caudal part of developing uterus and cervix, and Hoxa13 in the upper vagina anlage72. However, treatment with diethylstilbestrol (DES) induces a caudally shifted expression pattern of Hoxa9, hoxa10, and hoxa11, while the expression of Hoxa13 is not changed73. This phenomenon cannot be observed in Erα(−/−) mice treated with DES, which indicates that DES might function via Erα74. However, this posterior 11  shifted expression cannot be induced by 17β estradiol, because the different ligand-receptor complexes recruit different cofactors facilitating different functions on target tissues75.               The regulation of HOX genes by estrogens occurs not only in organogenesis but also in adult tissues. In vitro, treatment with 17β estradiol at physiological concentrations leads to an increase of HOXA10 mRNA levels in a concentration-dependent manners in human primary cultured endometrial cells, as well as in an endometrial adenocarcinoma cell line (Ishikawa cells), while in vivo, the expression of Hoxa10 is consistent with the estradiol levels in mice76. Moreover, this 17β estradiol-mediated up-regulation of HOXA10 mRNA levels is ER dependent77, and cannot be blocked by pretreatment with cycloheximide, an inhibitor for new protein synthesis76. In ER positive breast cancer cells, treatments with either estradiol or tamoxifen increase the expression of HOXA10, which up-regulates the expression of TP53 and suppresses cancer cell invasion78. In conclusion, estrogen is a key regulator of HOX genes in both development and oncogenesis. 1.2.2.1.3 Vitamin D               The active form of vitamin D is 1, 25-dihydroxycholecalciferol. The receptor of vitamin D (VDR) is stimulated by vitamin D and binds to the vitamin D response element (VDRE) in the gene79. In vitro, vitamin D administration induces the expression of HOXA10 in primary human uterine stromal cells and a derived human endometrial stromal cell line80. Du et al. also report that there is a VDRE in the enhancer region –385 to −343 bp upstream of the HOXA10 transcription start site, which is directly regulated by 1, 25-dihydroxycholecalciferol80. Vitamin D also induces the differentiation of human hematopoietic cells and the mechanism of this effect also involves HOXA10. Overexpression of HOXA10 leads the human myelomonocyte cells (U-973) differentiating to a monocyte/macrophage stage, which is similar to the phenotype induced 12  by vitamin D treatment. Furthermore, the expression of HOXA10 can be increased by vitamin D treatment, and this effect cannot be blocked by pretreatment of cycloheximide81. Therefore, vitamin D is another important regulator of HOX genes in development. 1.2.2.2 Epigenetic Regulation               Epigenetics refers to heritable changes in gene expression not due to the alteration of the DNA sequence82. Epigenetic programming of HOX genes is a common control mechanism operating in both development and tumorogenesis58. Major epigenetic mechanisms include DNA methylation, histone modifications, and RNA interference83. 1.2.2.2.1 DNA Methylation               DNA methylation is a covalent modification resulting from addition of a methyl group from S-adenosylmethionine (SAM) to the fifth carbon of the cytosine in the CpG dinucleotides84. In mammals, DNA methylation plays important roles in genomic imprinting, chromatin modification and gene expression85. In particular, the hypermethylation of CpG islands in the promoter region of certain genes can down-regulate transcription by impairing the binding affinities of transcription factors to regulatory elements83. Therefore, in tumorigenesis, altered DNA methylation patterns attract more and more attention from researchers.                    This heritable mechanism of DNA methylation is catalyzed by a family of enzymes known as DNA methyltransferases (DNMTs)86. There are three distinct DNMT families in mammals, of which DNMT1 was the first eukaryotic methyltransferase to be studied87. It localizes to the DNA replication foci in S phase, and primarily transfers the methyl groups to hemi-methylated CpG sites to maintain the methylation patterns in cell division88. In this process, DNMT1 forms a complex with SAM and the unmethylated CpGs within duplex DNA, and leads a conformational change89. Furthermore, DNMT1 also maintains genome stability90 13  and activates de novo methylation in human cancer cells91. There are also two functional DNA methyltransferases in the DNMT3 family, DNMT3A and DNMT3B, and a regulatory factor, DNMT3L, which lacks cytosine methyltransferase activity88. DNMT3A and DNMT3B are the so-called de novo methyltransferases because they can transfer the methyl groups to unmethylated CpG sites to establish new patterns of DNA methylation92. Moreover, DNMT3A can even methylate CpA sites in embryonic development93. Therefore, both DNMT3 family members are actively expressed in early embryos, and are essential for development92. DNMT3A and DNMT3B are also expressed in adult tissues, though at much lower levels than DNMT192, however de novo CpG island methylation established by DNMT3A and DNMT3B is also extensively detected in human cancer cells91, and mutations of DNMT3 enzymes in adults are associated with carcinogenesis and poor progresssion94,95. Recently, Jones and Liang proposed a new model for the maintenance of DNA methylation: DNMT3A and DNMT3B specify the methylated DNA regions to facilitate DNMT1 recognizing the hemi-methylated DNA and keeping the DNA methylation status96. DNMT3L enhances de novo methylation by maintaining activity of DNMT3A and increasing the binding of SAM97. Another family of DNA methyltransferases is DNMT2. Although DNMT2 has the most conserved sequence and structural characteristics, and is widely distributed in eukaryotes88, neither duplex DNA in vitro nor genome methylation status in mouse ES cells can be altered by DNMT298. Goll et al. report that DNMT2 has a conserved function on specific methylation of cytosine 38 in the anticodon loop of aspartic acid transfer RNA (tRNAAsp) instead of the fifth cytosine in CpG sites of double stranded DNA99. Therefore, only the functions of DNMT1, DNMT3A and DNMT3B were considered in our studies.  14                The targeting mechanisms of DNMTs are at several levels. 1) DNMTs can recognize the DNA or chromatin by specific domains, the ADD domain of DNMT3 enzymes selectively bind to unmethylated lysine 4 of histone H3 (H3K4) to initiate de novo methylation100–102. 2) Chromatin-modifying enzymes interact with DNMTs to promote their binding to DNA103. 3) Small noncoding RNA might recruit DNMTs to silence gene transcription104. The regulation of DNMTs also includes post-transcriptional regulation by miRNAs105 and Hu-antigen R (HuR) proteins106, and a dynamic interplay of covalent post-translational modifications such as acetylation, methylation, phosphorylation, ubquitination103.               5-Aza-2’-Deoxycytidine (5-Aza-dC, Decitabine) is a cytosine analogue, and a potent demethylating drug that has been approved in 2006 by U.S. Food and Drug Administration to treat myelodysplastic syndrome (MDS) and chronic Myelomonocytic leukemia (CMML)107. The hypo-methylation effect of 5-Aza-dC results from inhibiting the activity of DNMTs108. In cells, 5-Aza-dC is phosphorylated by deoxycytidine kinase into 5-Aza-dC triphosphate, which is the active form of this drug109. Then it is incorporated into the newly synthesized DNA to replace the cytosine residues especially in the CpG islands during the S phase when cells are dividing110. This biological processing leads to an irreversible covalent trapping of DNMTs, which in turn results in a strong decrease of DNA methylation in the cell111. The mechanism involves the fact that the nitrogen in the 5-Aza-dC cannot accept the methyl group to release the covalently bonded DNMTs from the DNA adducts as the carbon in the same position of the regular deoxycytidine in the newly synthesized DNA112. Furthermore, the demethylation effect of 5-Aza-dC is not only through trapping DNMTs but also the proteasomal degradation of DNMTs113,114. Moreover, Nguyen et al. reports that 5-Aza-dC induces chromatin remodeling independently of covalent trapping of DNMTs in a bladder cancer cell line115. In this study, 15  treatment with 5-Aza-dC increased acetylation and H3K4 methylation at the unmethylated p14 promoter115. However, some side effects of 5-Aza-dC have been reported107,116. Also 5-Aza-dC has been reported to induce the C:G→G:C transversions via DNMTs117.                DNA methylation has essential roles in the regulation of HOX gene expression in both embryonic development and carcinogenesis. Branciamore et al. reported that the methylation of HOX gene CpG islands occurs not only in promoter regions but also in protein-coding exons118. In a study involving whole-genome comparative bisulfite sequencing analysis, HOX clusters were shown to have a differentiation-associated differential methylation pattern in human embryonic stem cells, neonatal fibroblasts, and adult mature peripheral blood monocytes; and this methylation of CpG sites was likely due to  de novo methylation by DNMT3s119. Hoxa5 and Hoxb5 have dynamic methylation patterns during mouse development120. In 18.5 days post coitum mouse fetuses, Hoxa5 and Hoxb5 are completely methylated in spleen, partially methylated in intestine, and unmethylated in sperm and testis; whereas after birth they acquire de novo methylation in spleen120. This methylation occured in the CpG islands of the promoter regions120. Another study shows that hypomethylation is maintained at the CpG sites of a 5’ Hoxc gene in Akt1 knockout mouse embryonic fibroblast cells121. In leukemia research, promoter hypermethylation of HOXA4, HOXA5 is associated with poor prognosis in both myeloid and lymphoid leukemia, silencing of HOXA4 also correlates with mutation of the immunoglobulin variable heavy chain in chronic lymphocytic leukemia122,123,124. In lung adenocarcinomas, de novo methylation of many CpG sites is found at the HOXA and HOXD loci125. Another genome-wide analysis with a microarray-based methylated CpG island recovery assay show that methylation of CpG island is found in 104 of 192 homeobox genes in a lung cancer cell line and that the CpG islands of HOXA7 and HOXA9 are frequently methylated in stage I primary 16  squamous cell carcinomas of the lung126. In breast cancer, the promoter region of HOXA5 is methylated in most TP53 negative tumors and this loss of expression of TP53 might due to the epigenetic silencing of HOXA5 expression127. Another study also demonstrates that aberrant DNA methylation is linked to loss of expression of the HOXA gene cluster in human breast cancer128. A recent discovery found that the ten-eleven translocation (TET) family proteins function as methylcytosine dioxygenases to demethylate DNA by converting 5-methyl- cytosine (5mC) into 5-hydroxymethylcytosine (5hmC)129. Inactivation of TET proteins contributes to the DNA hypermethylation in cancer129. In breast cancer, TET1 is found to demethylate the promoter regions of HOXA7 and HOXA9, and induce their expression130. Both TET1 and HOXA9 can suppress the growth and metastasis of breast cancer in a mouse model130. Analysis of an oligodendroglioma cell line demonstrated greater DNA methylation within the HOXA cluster131. Another study shows that higher methylation levels of HOXA7, HOXA9 and HOXA10 are found in stage II and III meningioma tumors than in stage I tumors132.                In ovarian cancer, Wu et al. reported that the promoter region of HOXA9 was hyper-methylated in 26 out of 51 samples of ovarian carcinomas133. Likewise, another study demonstrated that promoter hypermethylation of HOXA9 was observed in 95% of HGSC, while only one out of twelve OSE samples showed hypermethylated promoter of HOXA9134. Cheng et al. indicated that promoter hypomethylation of HOXA10 was significantly increased in ovarian cancers compared to normal ovaries135. The promoter region methylation of HOXA11 is strongly associated with a poor prognosis of ovarian cancer136. The hypermethylated CpG islands of BRCA1 are also found in ovarian cancer82. Hypermethylated CpG islands in the promoter region of HOXB4 are detected in extrahepatic cholangiocarcinoma, and treatment with 5-Aza-dC 17  restores the expression of HOXB4137. However, in ovarian cancer, the methylation profile of CpG islands in HOXB4 promoter region is still unknown.  1.2.2.2.2 Histone Modifications               The nucleosome is the basic structure of chromatin, it consists of 146 bp of DNA wrapped around histone octamers (H2A, H2B, H3, and H4)138. Covalent histone modifications, including arginine and lysine methylation, lysine acetylation, and serine phosphorylation, change the conformation of chromatin and regulate DNA accessibility for gene transcription, DNA repair and replication, and the organization of chromosomes139,140. In a histone protein, the addition of one, two or three methyl groups on specific lysine or arginine residues is defined as histone methylation139. Generally, the effect of histone methylation depends on the type of activated amino acids and their locations within the tail of the histone141.                The Polycomb group (PcG) proteins form repressive complexes which suppress gene expression by trimethylating histone H3 at lysine K27 (H3K27me3)142–145. The Trithorax group (TrxG) proteins work by antagonizing PcG silencing of gene transcription by trimethylating lysine 4 of histone H3 (H3K4me3)146–148. PcG proteins suppress the expression of Hox genes during embryonic development86. Mixed lineage leukemia (MLL) gene is a mammalian homologue of TrxG, and Bmi1 is a homologous PcG member. The expression of Hoxc8 can be altered in either Mll-deficient or Bmi1-deficient mice. These results demonstrate that HOX genes can be regulated by TrxG and PcG proteins, and this regulation is in an antagonistic manner147. Translocation and fusion of MLL gene in T-lineage and B-precursor acute leukemia lead to an increased expression levels of HOXA9, HOXA10, and HOXC6149.   18  1.2.2.2.3 Noncoding RNAs               A class of small non-coding RNA sequences, microRNA (miRNA), can complementarily bind to mRNA transcripts and lead to cleavage of this mRNA or interference of translational machinery150. Studies show that microRNAs (miRNAs) encoded in Hox clusters are conserved between drosophila and human151. Work by Yekta et al. finds that miR-196 encoded in HOX clusters is conserved in evolution and complementary to mRNA of HOXB8, HOXC8 and HOXD8152. Furthermore, they observed that miR-196 can directly cleave Hox8 mRNA in vivo152. In vitro studies, miR-196 decreases the expression of HOXB8, HOXC8, HOXD8 and HOXA7152. Another study shows that increased miR-196a induces cell invasiveness in gastrointestinal stromal tumors153. In the leukemia studies, miR-204 is confirmed to target HOXA10 and MEIS1 in the acute myeloid leukemia carrying nucleophosmin mutation154. In human breast cancer cells, miR-10a is reported to inhibit the expression of HOXD4155.                The HOX transcript antisense intergenic RNA (HOTAIR), located between HOXC11 and HOXC12 genes on chromosome 12 is co-expressed with HOXC genes. it controls expression of HOXD genes in trans156. HOTAIR can directly interact with the PcG proteins SUZ12 and EZH2 and activate the promoter methylation of the HOXD8-11156. It has been reported that the expression of HOTAIR is increased in primary and metastatic breast tumors, and strongly associated with metastasis and death157. The ability of noncoding RNAs to regulating the expression of HOX genes provides for novel avenues of investigation related to the regulation of HOX genes expression158.     19  1.2.3 HOX in Carcinogenesis               Deregulated HOX gene expression is widely reported in cancer research fields50,58. Generally, HOX genes that are highly expressed in adult tissues are decreased in carcinogenesis, whereas those that are highly expressed during development are increased in carcinogenesis159. Furthermore, decreased expression levels of HOX genes in cancers commonly have tissue specificity and are epigenetically regulated159.  1.2.3.1 Leukemia               In hematological malignancies, deregulated expression levels of HOX genes are frequently discovered in samples from leukemia patients, and are involved in the tumorigenic function of NUP98 and MLL fusion proteins53,160–163.               Elevated expression of HOX genes is observed in samples from patients diagnosed with acute myeloid leukemia (AML), which renders HOX genes as possible prognostic markers in AML164–166. Overexpression of HOXA9 correlates with the poor prognosis in AML and has been reported to be the worst gene among 6817 investigated genes167.  Consistent with this result, decreased expression of HOXA9 correlates with the best outcome and response to therapy168. Moreover, decreased expression of HOXA4 and MEIS1 has been shown to be associated with a favorable outcome in AML169. In acute lymphoid leukemia, HOXA3, HOXA5, HOXA7, HOXA9, HOXA10 and HOXC6 have been reported to be overexpressed especially in patients with fusion proteins, such as MLL-ENL and CALM-AF10149,170–173.                NUP98 belongs to the nuclear pore family, and selectively transports RNA and proteins into the nucleus or cytoplasm. NUP98 most frequently forms fusion proteins with HOX genes and develops AML over a long period up to one year in a bone marrow transplanted mouse model162. MLL fusion proteins are widely observed in leukemia, with up-regulated HOX gene 20  expression. In this scenario, the expression of HOX genes is not mandatory in leukemogenesis but plays a fine role in the formation of the specific phenotype174.                             Forced expression of HOXB3 in hematopoietic cells leads to a leukemic transformation of perturbed T and B cell progenitors and elevated myeloid pathways175. In a mouse model, overexpression of HOXA10 results in AML 19 to 50 weeks after transfection by significantly impairing the differentiation of myeloid and B-lymphoid pathways176. Retrovirally engineered HOXB6 expressing mice develop AML in seven months through inhibition of erythropoiesis and lymphoid precursors and promoting myeloidogenesis177. Co-overexpression of Hoxa9 and Meis1 that are transplanted into mice develops growth factor-dependent AML within three months178. However, overexpression of HOXB4 in mice mainly functions in the self-renewal of hematopoietic cells, and does not affect myeloid or lymphoid differentiation both in vitro and in vivo179. In contrast, transplantation of HOXB4 overexpressing cells into large animals results in a high incidence of leukemia180. These studies demonstrate that overexpression of HOX genes leads to leukemic transformation and results in leukemia in a short period with co-expression with MEIS1, which is a collaborator of HOX gene. Therefore, the deregulated expression of HOX genes is a main mechanism in leukemic transformation. 1.2.3.2 Other Types of Cancers               In breast carcinoma, loss of HOXA5 expression is observed in both breast cancer cell lines and in patient samples and HOXA5 down-regulates the expression of p53127.  Furthermore, Chen et al. show that this HOXA5-induced apoptosis is via caspase 2 and caspase 8181. They also demonstrated that retinoic acid can up-regulate HOXA5 expression in a RARβ-dependent manner, and inhibit the growth and induce apoptosis in breast cancer cells182. HOXA10 is reported to down-regulate TP53 expression in ER-positive primary breast cancer78. Moreover, 21  HOXD10, which is a paralog of HOXA10, has a migration-suppressive effect in breast cancer cells183.  Up-regulation of HOXB7 is observed in bone metastases of breast cancer184. In vitro studies show that HOXB7 induces invasion and vascularization of human breast cancer cells, and increase the expression of fibroblast growth factor 2184. Furthermore, forced expression of HOXB7 in breast cancer cells up-regulated the production of vascular endothelial growth factor, interleukin-8, melanoma growth-stimulatory activity/growth-related oncogene, and angiopoietin-2185. HOXB13 increases migration and invasion, and also represses ER expression in human breast cancer cells186. In cervical carcinoma, the expression levels of HOXC5 and HOXC8 are induced during the transition from normal cervical keratinocytes to squamous cell carcinoma187. Another study demonstrates that overexpression of HOXC10 up-regulates the invasiveness of cervical cancer cell lines both in vivo and in vitro188. Overexpression of HOXA10 in endometrial cancer inhibits invasion both in vivo and in vitro189. In prostate carcinoma, overexpression of HOXC8 is correlated with primary tumors, and increases cell growth independently from androgen receptor expression190. Overexpressed HOXD3 leads to a more motile and invasive phenotype in lung cancer191. Likewise, down-regulation of HOXD3 suppresses migration and invasion in melanoma cells192. The deregulated expression of HOX genes have also been found in other types of cancers and associated with primary tumors and the differentiation of cancer cells, such as oesophageal squamous cell carcinoma and neuroblastoma58.  1.2.4 HOX genes in Epithelial Ovarian Cancer               In ovarian cancer, numerous HOX genes have been reported to have the functional effects on cell growth, apoptosis, differentiation, adhesion, migration and invasion58,159,193. The expression, function and underlying mechanism are listed in Table 1.1.   22  Table 1.1 Overview of HOX genes involved in epithelial ovarian cancer HOX genes Expression in EOC  Function  Mechanisms  HOXA7194–197 Highly expressed in serous EOC and in sera of well-differentiated EOC patients Promoted Müllerian-like transformation of EOC in xenograft mice  HOXB730,198 Overexpressed in EOC; autologous antibody of EOC patients Increased invasion of EOC derived cell lines   HOXA9197,199–202 Overexpressed in EOC and associated with poor survival increased EOC cells proliferation and aggregation, whereas suppressed anoikis; induced serous-like xenograft EOC Promoted peritoneal fibroblasts,  mesenchymal stem cells and tumor-associated macrophages; transcriptionally up-regulated P-cadherin expression HOXA10197,203,204 Highly expressed and associated with poor prognosis in CCC;  Induced expression correlated with EC differentiation and progression; induced endometrioid-like xenograft EOC  HOXA11197  induced mucinous morphological xenograft EOC  HOXB1330,205 Overexpression in EOC lines and tumors Promoted cellular proliferation, colony formation and invasiveness  HOXA4196,206 Varying in EOC cell lines Suppressed migration, enhanced cell-cell adhesion Positively regulate integrin β1 protein levels HOXB430,207,208 Overexpressed in EOC cell lines   HOXC430,207,208 Lower or similar to normal ovary   HOXD430,207,208 Lower or similar to normal ovary   EC: endometrioid carcinoma; CCC: clear cell carcinoma. 1.2.4.1 HOXA7               Naora et al. found HOXA7 related immunogenicity in the sera of well-differentiated ovarian cancer patients195. The expression of HOXA7 was detected in the fallopian tube, endometrium, well-differentiated EOCs and the inclusion cysts of the ovary, but a very low or no expression level was found in OSEs195. A cDNA microarray study reported that HOXA7 was highly expressed in serous EOCs compared with benign serous tumors or low malignancy potential serous tumors194. Further, a tissue microarray containing 538 EOC specimens 23  conducted by the same group showed that positive nuclear expression of HOXA7 was associated with increased 5-year survival rates194. Furthermore, they also demonstrated that HOXA7 mRNA levels were higher in OVCAR-2, OVCAR-8, CaOV-3 and OVCAR-3 than in other human ovarian cancer cell lines196. Ectopic expression of HOXA7 led to a more differentiated phenotype by inducing E-cadherin expression and down-regulating vimentin in immortalized human OSE cells195. Moreover, Hoxa7 could promote a Müllerian-like transformation in a ovarian cancer xenografted mice model197.     1.2.4.2 HOXB7               The expression level of HOXB7 is much higher in EOCs than in normal OSE198,209,210. Also an autologous antibody against HOXB7 was found in patients with EOC198,209,210. Increased cellular proliferation was observed by ectopically expressing HOXB7 in immortalized human OSE cells198. Furthermore, forced expression of HOXB7 up-regulated the production of basic fibroblast growth factor (bFGF) in OSE cells198. Consistent with these studies, Yamashita, et al. observed higher HOXB7 mRNA levels in CaOV-3 cells than in normal ovary, and that antisense down-regulation of HOXB7 significantly reduced the number of invading ovarian cancer cells in vitro30.  1.2.4.3 HOXA9, HOXA10 and HOXA11               In human OSE, the expression level of HOXA9, HOXA10 and HOXA11 was not detectable199. However, in the adult, they are expressed sequentially along the Müllerian-duct-derived epithelia: HOXA9 is expressed in fallopian tube, endometrium and the upper vagina, HOXA10 is expressed in endometrium and endocervix, and HOXA11 is only expressed in the endocervix31. This expression mode also was detected in serous, endometrioid and mucinous EOCs, which resemble a similar morphologic differentiation as Müllerian duct epithelium, 24  respectively199. HOXA9 expression was associated with poor survival of ovarian cancer patients and mice. The pro-proliferation effects of HOXA9 in EOC involved the activation of transforming growth factor β receptor II, which increased chemokine (C-X-C motif) ligand 12 (CXCL12), interleukin 6 and vascular endothelial growth factor A expression in peritoneal fibroblasts and bone marrow–derived mesenchymal stem cells202. Further, transforming growth factor β2 and CXCL2 induced tumor-associated macrophages to instigate immune responses against ovarian cancer in a xenograft mouse model200. Furthermore, HOXA9 increased EOC cell aggregation and suppressed anoikis via up-regulating of P-cadherin by binding with the promoter of P-cadherin (cadherin 3, CDH3)201. In ovarian CCC, HOXA10 expression was high and associated with poor prognosis203. Induced HOXA10 expression was correlated with ovarian EC differentiation and progression204. Overexpression of HOXA10 stimulated OSE growth through epithelial-stromal interaction211. MiR-135a and WT1 repressed HOXA10 expression in ovarian cancers as tumor suppressors212,213. Hoxa9, Hoxa10 and Hoxa11 genes were overexpressed in OSE cells and xenografted intraperitoneally into nude mice197. This study showed that the OSE cells transduced with specific Hoxa genes underwent differentiated morphological transformation in the EOCs: overexpression of Hoxa9 shows similar cystic and papillary structure as serous EOC, overexpression of Hoxa10 formed endometrioid EOC-like tumors, and Hoxa11 induced mucinous morphological changes197.  1.2.4.4 HOXB13               The expression of HOXB13 is detected in multiple EOC lines and tumors205. What’s more, Depletion of HOXB13 in SKOV-3 and OVCAR-5 cells is associated with decreased cellular proliferation and colony formation205. Also, HOXB13 antisense treated SKOV-3 cells 25  showed impaired invasive capacity30. However, forced expression of HOXB13 induces tumor growth both in vitro and in vivo205.               Increasing evidence suggests that HOX genes may play important regulatory roles in ovarian carcinogenesis30. In particular, altered expression of HOX genes in ovarian cancer cells can affect ovarian cancer cell invasiveness30. However, the specific contributions of group 4 HOX paralogs are still not well characterized.  1.2.4.5 Group 4 HOX Paralogs               Although individual HOX genes have unique functions, knock-out studies in mice indicated that paralogous Hox genes may also have overlapping roles214. A study of double mutants of the group 3 Hox paralogs illustrated that the the combined effects of Hox paralogs are more powerful than those of any single gene56. In breast cancer, group 10 HOX paralogs function in a complementary fashion to suppress cell migration/invasion. In particular, overexpression of HOXA10 increases TP53 and inhibits Matrigel invasion78, and HOXD10  has migration-suppressive effects183. Additional studies suggest cooperative functions for group 4 Hox paralogs in specifying regional identity, and similar mechanisms might also be operating in other group 4 Hox-expressing tissues55,215. 1.2.4.5.1 HOXA4               A cDNA microarray study reported that HOXA4 was more highly expressed in serous EOCs compared with benign serous tumors or low malignant potential serous tumors194. In normal OSE, HOXA4 expression was related to the conditions of the cell culture media and treatment with epidermal growth factor (EGF)194. In cancer cells, the expression level of HOXA4 was associated with an epithelial morphology194. Endogenous HOXA4 did not affect cellular proliferation, whereas it suppressed the migratory activity196 of ovarian cancer cells by inhibiting 26  the formation of filopodia and enhancing cell-cell adhesion206, while overexpression of HOXA4 reversed these effects on ovarian cancer cells. The expression level of integrin β1 protein was attenuated by down regulation of HOXA4, but the mRNA level of integrin β1 was not affected206. 1.2.4.5.2 HOXB4               HOXB4 has a similar homeobox sequence and position within the cluster as HOXA4216. Overexpression of HOXB4 induced hematopoietic stem cell (HSC) expansion in vitro and in vivo53, however this effect was not observed in mature cells180. Moreover, ectopic expression of HOXB4 stimulated pluripotent progenitor cell proliferation and proliferation of HSC characteristics217. It has been reported that HOXB4 suppressed fibroblast growth is correlated with decreased c-MYC expression suggesting a directly regulatory role of HOXB4 in fibroblasts218. In ovarian cancer, a genome-wide association study identified a potential susceptibility locus (17q21) that contains, among other genes, HOXB4219. HOXB4 mRNA levels have been reported to be higher in ovarian cancer cells (SMOV2, ES-2, SKOV-3 and CaOV-3) than in normal ovary tissue30. Hong et al. examined the expression levels of 36 HOX genes in the EOCs cell lines and normal ovarian tissues and reported higher expression of HOXB4 mRNA and protein levels in TOV-21G, OV-90, SKOV-3 and SW626 ovarian cancer cells compared with normal ovaries, and found stronger anti-HOXB4 immunostaining in these four ovarian cancer lines and serous papillary ovarian carcinomas compared to normal ovarian samples (number of samples not specified)207. In contrast, Morgan et al. detected lower HOXB4 mRNA levels in SKOV-3 cells than in normal ovary, while the HOXB4 mRNA levels in OV-90 cells were similar to normal ovary208. However, putative functions and underlying mechanism of action of HOXB4 in ovarian cancer cells were not examined in these studies. In addition, 27  HOXB4 expression and localization in the fallopian tube fimbrial epithelium, which is believed to be a source of HGSC220, is completely unknown. 1.2.4.5.3 HOXC4               The expression of HOXC4 protein is observed in activated and/or proliferating T-lymphocytes, B-lymphocytes, or NK-cells221. Early expression and nuclear localization suggests that HOXC4 is involved in the regulation of lymphocyte activation and/or proliferation221. In keratinocytes of normal skin and in epithelial skin tumors, HOXC4 is expressed in differentiated keratinocytes, whereas a lack of differentiation (as in neoplastic cells) is accompanied by down-regulation of HOXC4 expression222. Furthermore, HOXC4 protein also mediated the activation of the enhancer of the immunoglobulin heavy chain in B cells223. In human cancer, HOXC4 is aberrantly expressed in LNCaP human prostate cancer cells which display a more malignant phenotype224. Morgan et al. found that HOXC4 mRNA levels were lower than (SKOV-3) or similar to (OV-90) normal ovary208. In contrast, Hong et al. showed similar intermediate HOXC4 mRNA expression within TOV-21G, OV-90, SKOV-3 and SW626 cells and mild to intermediate HOXC4 mRNA levels in four samples of normal ovaries207. Also, Yamashita et al. did not find any significant changes of HOXC4 mRNA levels in CaOV-3 cells compared with normal ovary, however the number of cancer cell lines studied may not be sufficient to look for linkages30. Importantly, none of the aforementioned studies investigated the functional role(s) of HOXC4 in ovarian cancer cells. 1.2.4.5.4 HOXD4               In breast cancers, HOXD4 expression level is high in MDA-MB-231cells but low in MCF-7 cells, and reduced HOXD4 expression might be due to microRNA-10a-induced transcriptional inhibition of HOXD4155. During embryogenesis in mice, Hoxd4 exerts a positive 28  regulatory function on neural development, and the expression of Hoxd4 is restricted along the anterior-posterior axis by PAX6225. Morgan et al. found that HOXD4 mRNA levels in SKOV-3 and OV-90 cells were similar to normal ovary208. Also, Yamashita et al. did not find any significant changes of HOXD4 mRNA levels in SKOV-3 cells compared with normal ovary30. However, Hong et al. showed lower HOXD4 mRNA levels in TOV-21G, OV-90, SKOV-3 and SW626 cells than in four samples of normal ovaries207. However, none of the aforementioned studies investigated the functional role(s) of HOXD4 in ovarian cancer cells. Based on these reports, we proposed that Group 4 HOX paralogs play important roles in regulating ovarian tumorigenesis and metastasis. 1.3 CD44 1.3.1 Overview               The CD44 protein family consists of a group of proteins (80-200 kDa in size), which are transcribed and translated from a single CD44 gene through alternative splicing and post-translational modifications226. The human CD44 gene is located at the chromosomal 11p13 locus and possesses 20 exons227. The standard form of CD44 (CD44s) is encoded from exons1-5 and 16-20, while the variant forms of CD44 (CD44v) include exons 1-5, 16-20 and alternative splicing of variable exons 6-15228. Theoretically, there could be more than one thousand CD44v variants produced by the alternative splicing mechanism229,230. CD44s and CD44v might have differential effects on cellular functions231. However, in our present study, we only focus on the combined expression of all the following seven CD44 transcripts: GenBank RefSeq #: NM_000610.3; NM_001001389.1; NM_001001390.1; NM_001001391.1; NM_001001392.1; NM_001202555.1; NM_001202556.1. CD44, as a type I transmembrane protein (Figure 1.2), contains one N-terminal domain which binds with hyaluronic acid, collagen, laminin and 29  fibronectin to increase matrix-dependent migration in vitro232,233. CD44 also contains one transmembrane domain and one C-terminal cytoplasmic domain which is believed to be phosphorylated and have signal transduction functions in migration and metastasis234,235. CD44 is widely expressed in mammalian cells except hepatocytes, pancreatic acinar cells, and renal tubular cells236,237. The expression of numerous types of CD44 isoforms have been found in neoplasia238.  1.3.2 The Function of CD44               The biological function of CD44 is complicated and depends on multiple factors. The major function of CD44 involves binding with extracellular matrix ligands such as hyaluronic acid (HA), collagens, laminin and fibronectin etc. The variants structures and the dynamic interactions with other factors such as MMPs, growth factors, and growth factor receptors also affect the function of CD44 in cells226,238,239.                In cancer pathogenesis, CD44 isoforms have significant roles in growth regulation, angiogenesis, lymphangiogenesis, adhesion, cell migration/invasion, and metastasis238,240,241. The relationship between the deregulated expression of CD44 isoforms and cancer prognosis has been intensively studied in the last 20 decades. The increased expression of CD44v has been found in metastatic cancer cells242, and is correlated with poor survival243, and regulated by the WNT pathway in early tumorigenesis of the colon244,245. In the contrast, in other cancers such as prostate cancer or neuroblastoma, decreased expression of CD44 isoforms is associated with unfavorable survival246,247, and the enforced expression of CD44 represses metastasis248. Therefore, the functions of CD44 in cancer progression are controversial.                Generally, the molecular mechanisms of CD44 in cancer can be summarized in three ways. 1) CD44, as a ligand-binding cell surface protein, can adhere to hyaluronic acid and other 30  ECM substrates to mediate cellular migration and invasion or cell-cell adhesion249. CD44 also can assemble enzymes and substrates in cancers. For instance, in breast cancer and melanoma, CD44 guides MMP9 to the cell surface to promote invasion by degrading type IV collagen in vitro250. 2) CD44 functions as co-receptor to mediate signaling transduction in carcinogenesis. For example, in ovarian cancer cell lines, CD44 interacts with HER2 through interchain disulfide bonds to induce the cancer cell growth by hyaluronan stimulation and this effect can be blocked by suppression of HER2251. 3) CD44 links the cell membrane to cytoskeleton. It has been widely reported that  Ezrin/Radixin/Moesin (ERM) proteins can directly bind to CD44 and link to they cytoskeleton by interaction with F-actin252,253.                In ovarian cancer, the correlation between CD44 and prognosis is controversial. Two previous studies demonstrated that a high expression of CD44 correlates with favorable prognosis in ovarian cancer patients254,255. In contrast, one study reports that the expression of CD44 is associated with a poor survival in ovarian cancer256. Other studies also showed no correlation between CD44 expression and the prognosis of ovarian cancer257,258. Functionally, most studies of CD44 have been focusing on its HA-dependent functions259. CD44 interacts with HER2 to induce ovarian cancer cell growth by HA stimulation251. CD44 has been shown to mediate ovarian cancer cell (CaOV-3 and SKOV-3) binding to HA secreting mesothelial cells260,261. Mechanically, CD44 interacts with c-Src and stimulates HA-dependent ovarian cancer cell migration262. Also, CD44-HA binding activates ovarian cancer cell migration by stimulating the Cdc42 and ERK pathways263, and by stimulating HER2 and the nuclear translocation of β-catenin264.  However, these pro-migratory mechanisms of CD44 interaction with HA cannot explain the clinical studies of CD44 associated with good prognosis. CD44 has also been demonstrated to mediate ovarian cancer cell adhesion with other ECM components 31  such as laminin, type IV collagen265, which are the major substrates in Matrigel. Therefore, there might be more roles of CD44 in ovarian cancer progression. 1.3.3 Regulation of CD44               The regulation of CD44 has not been defined very clearly. The alternative splicing of CD44 variants can be regulated by the RAS. Stimulation of the MAPK pathway can increase the expressions of CD44 variants266. Furthermore, the cleavage of CD44 can be induced by the ADAM-like proteins, MMPs, protein kinase C, calcium influx, and the Rho family of small G proteins267–269. This kind of soluble CD44 can inhibit the tumor behavior by blocking the binding with hyaluronan270. Also some studies show that HOXB4 exerts a regulatory effects on the expression of CD44. Overexpression of HOXB4 leads to a decreased in CD44 expression in human neonatal keratinocytes271. In another study, a mesenchymal stromal cell line differentiated from an enforced HOXB4-expressing cell line H9 (a human embryonic stem cell line) demonstrated the expression of CD44272. These results demonstrate that HOXB4 can regulate CD44 expression in a tissue dependent manner. 1.4 Rationale and Overall Hypothesis               Single and combined mutants of mouse paralogous Hox genes have suggested that Hox paralogs may have complementary, overlapping, or synergistic functions in a particular tissue54–57. HOXA4, the paralog of HOXB4, can regulate cell motility but cannot change the invasiveness of ovarian cancer cells196. Suppression of HOXA4 was shown previously to increase cell motility and spreading of ovarian cancer cells206. Furthermore, compound mutants for Hoxa4, Hoxb4, and Hoxd4 exhibited a dose-dependent increase in the number of vertebrae transformations, which suggests that similar mechanisms might also be operating in other group 4 Hox-expressing tissues55. Moreover, an expression profile of HOX genes between ovarian derived materials and 32  epithelial ovarian cancer cells showed overexpression of paralogs of HOX4 genes in cluster A and B30. There was no clear difference between the normal ovary and ovarian cancer cell lines in terms of the levels of expression of HOXC4 and HOXD4, however this may be due to the limited number of cell lines tested. Therefore, we hypothesize that the co-expression of group 4 HOX paralogs in invasive ovarian cancer cell lines act as regulators of ovarian cancer progression by suppressing ovarian cancer cell motility and invasiveness. To test this hypothesis, we examined and modulated of the expression levels of HOXB4 present in ovarian cancer cell lines and in ovarian cancer specimens. Furthermore, we investigated the functional roles of HOXB4, as well as the underlying mechanisms involved in ovarian cancer invasiveness by engineering the expression of HOXB4. After that, since the epigenetic regulation might be a common mechanism in altered expression of HOX genes58, we also explored the epigenetic regulatory factors for HOXB4. We also examined the expression of another group 4 HOX paralog, HOXC4 in ovarian cancer cell lines, and explored the function of HOXC4 by the siRNA mediated down-regulation.           33    Figure 1.1 Schematic structure of HOX clusters in human In humans, the 39 HOX genes are clustered on four different chromosomes. Each cluster contains 8–11 genes. Across different clusters, HOX genes can be aligned into paralogous groups (displayed in vertical columns and numbered) based on the homeobox sequence similarities and location regions. 3′ HOX genes (in pink color) are expressed more anteriorly and earlier than 5′ HOX genes (in green color), however 5′ HOX genes have a dominant phenotype compared with 3′ HOX genes.          34    Figure 1.2 The protein structure of CD44 isoforms    The protein structure of CD44s is compared with that of the largest variant isoform CD44v1–10. The amino acids (1-158) in green color in the amino-terminal domain are the hyaluronan-binding motifs, of which the disulfide links in this region are critical to the stability. The O-glycosylation, N-glycosylation and heparin sulphate sites in the variants (v1-10) are important for binding with other molecules. The cytoplasmic tail contains serine phosphorylation sites, which support functions in signaling transduction239.     35  Chapter  2: Materials and Methods 2.1 Cell Lines and Cell Culture               The protein lysates and cDNA of normal human ovarian surface epithelium (OSE) cells were kindly provided by Dr. Christian Klausen. Immortalized OSE cell lines IOSE-29, IOSE-80 and IOSE-397 were obtained by transfection with the immortalizing simian virus (SV) 40 large T antigen into normal OSE as previously described273.  SV 40 T antigen interferes with the function of retinoblastoma (Rb) and TP53273. The immortalized human oviduct epithelial cell line (OE-E6/E7) was a gift from Dr. William Yeung274. OE-E6/E7 cells were immortalized by HPV16 E6 and E7 antigens, which bind to Rb and TP53 proteins to stimulate cell growth274. Human ovarian carcinoma cell line IGROV-1 was kindly provided by Dr. Mark S. Carey at Vancouver General Hospital. Human ovarian cancer cell lines A2780, OVCAR-2, OVCAR-4, OVCAR-5, OVCAR-8, and OVCAR-10 were kindly provided by Dr. Nelly Auersperg. CaOV-3, OVCAR-3, SKOV-3 were obtained from the American Type Culture Collection (ATCC). Two clear cell ovarian carcinoma cell lines (TOV21G and JHOC-7) were kindly provided by Dr. Christian Klausen. Some detailed information one the ovarian cancer cell lines used is listed in Table 2.1. Phoenix cells (kindly provided by Dr. R Keith Humphries, Terry Fox Laboratory, British Columbia Cancer Agency, Vancouver, BC, Canada) were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Sigma-Aldrich, Oakville, Ontario, Canada) containing 10% fetal bovine serum (HyClone, Logan, Utah) and 1% penicillin/streptomycin (Invitrogen; Life Technologies, Grand Island, New York). The other cell lines were grown in a 1:1 mixture of M199/MCDB 105 medium (Sigma-Aldrich, Oakville, Ontario, Canada) supplemented with 5% fetal bovine serum (HyClone) and 1% penicillin/streptomycin (Invitrogen). All cells were cultured at 37 ℃ in a humidified incubator with 5% CO2 in air and subcultured using 0.06% 36  trypsin/0.01% ethylenediamine tetra acetic acid (trypsin/EDTA) (Invitrogen, Burlington, ON) in Ca2+, Mg2+-free Hanks’ balanced salt solution (Invitrogen). Table 2.1 Detailed information of ovarian cancer cell lines275 Cell lines Histotype Biomarkers expression DNA mutations IGROV-1 Mixed/EC p16, p53, VIM, HNF1B, DKK1 TP53, ARID1A, PTEN A2780 EC p53, VIM, DKK1 ARID1A, PTEN OVCAR-2 HGSC  N/A N/A OVCAR-4 HGSC VIM, DKK1, BAF250A TP53 OVCAR-5 HGSC ARID1A KRAS OVCAR-8 HGSC p53, VIM, DKK1, BAF250A TP53 OVCAR-10 HGSC  N/A N/A CaOV-3 HGSC p16, DKK1, BAF250A TP53 OVCAR-3 HGSC p16, p53, WT1, BAF250A TP53 SKOV-3 CCC/EC HNF1B, PR, DKK1, BAF250A PIK3CA, ARID1A TOV21G CCC p53, VIM, HNF1B, DKK1 KRAS, PTEN, PIK3CA, ARID1A JHOC-7 CCC p16, MDM2, p53, VIM, HNF1B, BAF250A  PIK3CA EC: endometrioid carcinoma; HGSC: high-grade serous carcinoma; CCC: clear cell carcinoma. p16: cyclin-dependent kinase inhibitor 2A; TP53: tumor protein p53; VIM: vimemtin; PR: progesterone receptor; MDM2: mouse double minute 2; HNF1B: hepatocyte nuclear factor 1-b; WT1: Wilms Tumor 1; DKK1: dickkopf homolog 1 (DKK1); ARID1A: AT-rich interactive domain 1A; BAF250A: ARID1A protein; KRAS: Kirsten rat sarcoma viral oncogene homolog; PTEN: phosphatase and tensin homolog; PIK3CA: phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha.  37  2.2 Reverse Transcription and Polymerase Chain Reaction (PCR) 2.2.1 Reverse Transcription               Total ribonucleic acid (RNA) was extracted from cultured cells with the RNeasy Plus kit (Qiagen Inc., Mississauga, ON). The concentration and purity of total RNA was measured by a NanoDrop-1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE). Complementary DNA (cDNA) synthesis was performed with the First Strand cDNA synthesis kit (Amersham Bioscience, Québec, Canada) using 1-2 µg total RNA to a final 15 µl mixture. 2.2.2 Standard PCR               Standard PCR for HOXB4 was performed with 1 µl of cDNA template. GAPDH was amplified as the reference gene in each reaction.  Primers for HOXB4:  5’ – TTCACGTGAGCACGGTAAAC – 3’ and                                     5’ – CGTGGCCCTCTATTGTCATT – 3’;                     GAPDH:  5’ – ATGTTCGTCATGGGTGTGAACCA – 3’ and                                     5’– TGGCAGGTTTTTCTAGACGGCAG – 3’. All primers were designed to span introns in order to detect specific mRNAs. The PCR product for HOXB4 was 513 bp (nucleotides GenBank NM_024015.4). The amplification reaction was carried out for 33 cycles. The thermal profile included 45 secs at 94℃ for denaturation, 30 secs at 60℃ for primer annealing, and 1 min at 72℃ for extension. Reactions without cDNA were used as PCR controls to ensure that cross-contamination of samples did not occur. PCR products were loaded on 1% agarose gels and stained with ethidium bromide. PCR products for HOXB4 were verified by sequencing analysis (DNA sequencing results are listed in Appendix B.1). 38  2.2.3 Quantitative Real-Time PCR               Quantitative real-time PCR (qPCR) was conducted using the ABI Prism 7300 Sequence Detector System (Applied Biosystems, Foster City, CA). The amplification signals were detected either by the SYBR green or the FAM dye detecting system. For the SYBR green detecting system, each 20 µl quantitative PCR reaction contained 1×SYBR Green PCR Master Mix (Applied Biosystems), 20 ng cDNA and 150nM of each specific primer.                For the SYBR green detecting system, the following nucleotides were used for amplification in triplicate on corresponding cDNA samples:  HOXB4, forward 5’ – TTCACGTGAGCACGGTAAAC – 3’           and reverse 5’ – ACGGCGCCTTGTCAGATAC – 3’;  HOXC4, forward 5’ – CACGGTGAACCCCAATTATA – 3’           and reverse 5’ – TGGGCGATCTCGATCCTTCT – 3’; DNMT1, forward 5’ –GAGCCACAGATGCTGACAAA– 3’           and reverse 5’ –TGCCATTAACACCACCTTCA– 3’; DNMT3A, forward 5’ –CAATGACCTCTCCATCGTCAAC– 3’           and reverse 5’ –CATGCAGGAGGCGGTAGAA– 3’; DNMT3B, forward 5’ –CCATGAAGGTTGGCGACAA– 3’           and reverse 5’ –TGGCATCAATCATCACTGGATT– 3’; GAPDH, forward 5’ – GAGTCAACGGATTTGGTCGT – 3’           and reverse 5’ – GACAAGCTTCCCGTTCTCAG – 3’. The reaction was conducted at 50℃ for 2 mins, 95℃ for 10 mins and followed by 40 cycles at 95℃ for 15 secs and 60℃ for 1 min. The amplification efficiencies were measured by calibration curves (plot of log input amount v.s. ΔCq) and the slope<0.1. Dissociation curve analysis, 39  agarose gel electrophoresis of PCR products and PCR product sequencing were used to validate specificity of each assay.                TaqMan Gene Expression Assays consisted of a pair of unlabeled PCR primers and a TaqMan probe with a FAM dye label on the 5’ end and the minor groove binder (MGB) and the nonfluorescent quencher (NFQ) on the 3’ end. To validation of the downstream target genes of HOXB4, TaqMan assays (Applied Biosystems: ADRB2: Hs00240532_s1; CD44: Hs01075861_m1; COBL: Hs00391205_m1; LZTS1: Hs00232762_m1; THSD1: Hs00938785_m1; POU5F1: Hs04260367_gH; ROR1: Hs00178178_m1; DAB2: Hs01120074_m1) were performed in triplicate on corresponding cDNA samples. Each 20 µl TaqMan reaction contained 20 ng cDNA, 1×TaqMan gene expression master mix (Applied Biosystems) and 1×TaqMan gene expression assay. The reaction was conducted at 50°C for 2 minutes, 95°C for 10 minutes, and 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. Three separate experiments were performed on different cultures, and each sample was assayed in triplicate. A mean value was used for the determination of mRNA levels by the comparative Cq (2−ΔΔCq) method with GAPDH as the reference gene. 2.3 Western Blot Analysis               Proteinase inhibitor cocktail (Sigma) was added fresh to ice-cold lysis buffer (Cell Signaling Technology) which was used to lyse cells that had been washed once with ice-cold PBS. The plate or culture dish was placed on ice for 5 min. Fimbrial tissue of fallopian tube was cut into 3×3 mm pieces on the ice. These tissue pieces were then washed 5 times with ice-cold PBS to remove blood. These tissue pieces and 500 µl of lysis buffer were placed into a grinder for 10 mins grinding on the ice. Syringe needles of progressively decreasing size were used several times to aspirate and homogenize the tissue protein lysate. The collected cell or tissue 40  lysates were then centrifuged at ≥ 13000Xg for 30 min at 4℃. A DC protein assay (Bio-Rad Laboratories, Richmond, CA) was used to measure protein concentration in both cell lysates and tissue lysates. The protein lysates were diluted to equal concentrations and boiled for 5 mins with loading buffer (2.5% w/v sodium dodecyl sulphate (SDS), 10% v/v glycerol, 50 mM HCl, pH 6.8, 0.5 M β-mercaptoethanol and 0.01% w/v bromophenol blue). 20 µg of protein separated by 8% or 10% SDS-polyacrylamide gel electrophoresis at 120V for 2 hours. Proteins were then transferred to polyvinylidene difluoride (PVDF) membranes at 100V for 2 hours. The membranes were blocked with 5% skim milk or 5% BSA (Bovine serum albumin) in 0.05% Tween-20 Tris-buffered saline (TBS: 10 mM Tris-HCl, pH7.4, 150 mM NaCl) for 1 hour at room temperature. All the primary antibodies are listed in Table 2.2. For the primary antibody incubation, the membranes were incubated overnight at 4 ℃. To visualize bound antibodies we used peroxidase-conjugated secondary antibodies (1:5000; Bio-Rad Lab), SuperSignal West Pico and Femto chemiluminescent substrates (Pierce, Nepean, ON), and X-ray film (Kodak). Table 2.2 Antibodies for Western Blot analysis Antigen Clone Supplier Dilution HOXB4 Polyclonal  Santa Cruz 1:800 HOXB4 EP1919Y Epitomics 1:1000 Actin Polyclonal  Santa Cruz 1:5000 CD44 Monoclonal  Cell Signaling 1:1000  2.4 Small Interfering RNA (siRNA) Transfection               ON-TARGET plus SMART pool human HOXB4 (50 nM), human HOXC4 (50 nM), human CD44 (50nM), human DNMT1 (50nM), human DNMT3A (50nM), human DNMT3B (50nM), and ON-TARGETplus siCONTROL non-targeting pool siRNAs (50 nM) were 41  purchased from Dharmacon, Inc. (Chicago, IL). Cells were plated at the density of 7.5×103/cm2, allowed to recover for 24 hours, and then transfected with Lipofectamine RNAiMAX (Invitrogen) and siRNA diluted in Opti-MEM (Invitrogen) according to the manufacturer’s guidelines. After 6 hrs, the culture medium in each well was replaced with 2 ml of culture medium containing 5% FBS. Transfection efficiency of Lipofectamine RNAiMAX was examined by an inverted fluorescent microscope (Zeiss) after transfection with  siGLO Green Transfection Indicator (Thermo Fisher Scientific, Inc. MA) for 24 hrs. Knockdown efficiency was assessed by RT-qPCR and Western blotting. 2.5 HOXB4 Retrovirus Production, Infection, and Selection               The control vector (MSCV IRES GFP) was the murine stem cell virus (MSCV) 2.1 retroviral vector modified with an internal ribosomal entry site (IRES) and enhanced green fluorescent protein (GFP) cassette, whereas the HOXB4 expressing vector contained a HOXB4-IRES-GFP cassette (MSCV HOXB4 IRES GFP) 276. These vectors were kindly provided by Dr. R. Keith Humphries (Terry Fox Laboratory, British Columbia Cancer Agency, Vancouver, BC, Canada).  Vectors were transfected into the amphotropic phoenix retroviral packaging cells using Lipofectamine 2000 (Invitrogen). After 24 hours of transfection, the culture medium was changed and 24 hours later we collected the virus-containing medium and filtered it through a 0.45 μm sterile filter. Filtered virus-containing medium was immediately added to OVCAR-5 cells at 70% confluence with polybrene (4µg/ml). Transduced cells were checked by an inverted fluorescent microscope (Zeiss) and GFP positive cells were collected by fluorescence-activated cell sorting (FACS). Propidium iodide (PI: 0.2 µg/ml) was used to control the cell viability in FACS. Pooled GFP positive cells were used for experiments and their purity was maintained by sorting cells every 4 weeks. 42  2.6 MTT Proliferation Assays               MTT (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide) assay is a colorimetric assay measuring the reduction of MTT by mitochondrial succinate dehydrogenase in metabolically active cells. Thus, the MTT assay actually measures cell viability, as an indirect measurement of cell proliferation. Cells were transfected with siRNA against HOXB4 for 24 hrs and seeded at the density of 2000 cells/well in M199/MCDB105 media supplemented with 0.5% FBS or 5% FBS on 96-well plates for 1 to 4 days. 10 µl of MTT was added to each well at a final concentration of 0.5 mg/ml. The plates were incubated at 37℃ in a humidified incubator with 5% CO2 in the air for 2 hours. Medium was removed, 200 µl of Dimethyl sulfoxide (DMSO) was added, and the plates were shaken and protected from light for 15 mins at room temperature. Absorbances were read at 490 nm using a microplate spectrophotometer (Dynex technologies, Sullyfield, VA). 2.7 Trypan Blue Cell Viability Test               Cells transfected with siRNA against HOXB4 for 24 hours or transduced with HOXB4 overexpressing vector were seeded at the density of 6.25×103 cells/cm2 in M199/MCDB105 media supplemented with 0.5% FBS or 5% FBS on the 12-well plates for 1 to 4 days. Then cells were trypsinized and diluted with serum-free culture media. The cell suspension was incubated with 0.4% trypan blue dye (GIBCO) at the ratio of 1:1 for 3 minutes at room temperature. In this test, live cells with intact cell membranes can exclude trypan blue dye. Therefore a dead cell will be stained blue. The test results were determined by counting the number of cells per well using a hematocytometer. 43  2.8 Trans-Well Migration Assays               Cells were transfected with either siHOXB4 or siHOXC4 for 48 hours and were seeded on the cell culture inserts (24-well, pore size 8 μm; BD Biosciences) with 75,000 cells in 250 μl of medium with 0.1% FBS. M199/MCDB105 medium with 10% FBS (750 μl) was added to the lower chamber and to serve as a chemotactic agent. Non-migrating cells were wiped from the upper side of the membrane with a swab and cells on the lower side were fixed in cold methanol (-20°C) for 20 mins and air dried. The cell nuclei were stained with Hoechst 33258 (Sigma-Aldrich), the membranes were removed from the insert by a blade, and were then mounted onto glass slides. The results were determined by counting the number of stained cells in five microscopic fields of triplicate membranes using a Zeiss Axiophot epifluorescent microscope equipped with a digital camera (QImaging, Surrey, BC). 2.9 Matrigel Invasion Assay               The invasion assay was performed in the same cell culture inserts (24-well, pore size 8 mm; BD Biosciences) as was used for the migration assay. The inserts were pre-coated with growth factor reduced Matrigel (40 µl, 1 mg/ml; BD Biosciences) and allowed to polymerize for 4 hours at 37 ℃ in a humidified incubator with 5% CO2 in the air. Cells were seeded with 75,000 cells in 250 µl of medium with 0.1% FBS. The medium with 10% FBS (750 µl) was added to the lower chamber to serve as a chemotactic agent. To study CD44 effects on HOXB4 overexpressing OVCAR-5 cells, 15 μg/ml anti-CD44 blocking antibodies (5F12 clone for human CD44, Thermo Fisher Scientific, Inc. MA) and isotype-matched IgG1 (Cell Signaling) were used in the Matrigel trans-well invasion assay. The cells were incubated with anti-CD44 or isotype-matched IgG1 for 1 hour before performing the invasion assay. To study the effects of matrix metalloproteinase (MMP) inhibitors on Matrigel invasion, cells were mixed with either 50 µM of 44  Insolution GM6001 (Calbiochem) or 20 µM of Marimastat (Tocris) before seeding in the invasion assay. Invading cells were fixed with cold methanol and stained with Hoechst 33258 (Sigma-Aldrich) and then counted using a Zeiss Axiophot epifluorescent microscope with a digital camera (QImaging, Surrey, BC).  Each individual experiment had triplicate inserts and five microscopic fields were counted per insert. 2.10 Type I Collagen Coating Trans-Well Invasion               Cells were seeded in trans-well inserts coated with acid-extracted Type I collagen prepared from rat tail tendons (BD Biosciences). We dissolved Type I collagen in 0.2% acetic acid to a final concentration of 200µg/ml. To induce gelling, collagen was mixed with 10×DMEM and 0.34 N NaOH at an 8:1:1 ratio at 4℃, and 50 µl of this mixture was added to the cell culture inserts (24-well, pore size 8 μm; BD Biosciences). After gelling was completed (1 hour at 37℃), 75,000 cells in 250 µl of medium with 0.1% FBS were seeded in the inserts for 24 hours. Medium with 10% FBS (750 µl) was added to the lower chamber to serve as a chemotactic agent. Non-invading cells were wiped from the upper side of the membrane and cells on the lower side were fixed in cold methanol (-20°C) and air dried. Cell nuclei were stained with Hoechst 33258 (Sigma-Aldrich) and counted using a Zeiss Axiophot epifluorescent microscope equipped with a digital camera (QImaging, Surrey, BC). Invasion was determined by counting the number of stained cells in five microscopic fields per insert. 2.11 Gene Expression Microarray               Total RNA was extracted from 3 biological replicates of green fluorescent protein (GFP, control) and HOXB4 overexpressing OVCAR-5 cells using the RNeasy Plus kit (Qiagen Inc., Mississauga, ON). The quality was assessed with the Agilent 2100 bioanalyzer prior to microarray analysis. Samples with a RIN value of greater than or equal to 8.0 were deemed to be 45  acceptable for microarray analysis. Samples were prepared following Agilent’s One-Color Microarray-Based Gene Expression Analysis Low Input Quick Amp Labeling v6.0. An input of 150ng of total RNA was used to generate Cyanine-3 labeled cRNA.  Samples were hybridized on SurePrint G3 Human GE 8×60K Microarrays (Design ID 028004). Arrays were scanned with the Agilent DNA Microarray Scanner at a 3um scan resolution and data was processed with Agilent Feature Extraction 10.10.  Processed signal was quantile normalized with Agilent GeneSpring 11.5.1. To find significantly regulated genes, fold changes between the compared groups and p-values gained from t-test between same groups were calculated. The t-tests were performed on normalized data that had been log transformed and the variances were not assumed to be equal between sample groups. Differentially expressed genes with a fold change cutoff of 1.5 and a p-value cutoff of 0.05 were further analyzed in Ingenuity Pathways Analysis software. 2.12 5-Aza-2’-Deoxycytidine Treatment               Cells were seeded in culture media at 40% confluence. OVCAR-5 cells were treated with 5-Aza-2’-deoxycytidine (5-Aza-dC) at different concentrations ranging from 0.1 µM to 0.8 µM for four days or at 0.625µM for one to four days in the media with 0.5% FBS. Similarly, IGROV-1 cells were treated with 5-Aza-dC at different concentrations ranging from 62.5 nM to 500 nM for five days or at 1µM for two to five days. Pooled results (mean ± SEM) were collected from at least three independent experiments. 2.13 Tissue Microarray (TMA)                  The Tumor Bank array comprises 445 cases from women with invasive ovarian cancer at Vancouver General Hospital between 2001 and 2008277. The Cheryl Brown Ovarian Cancer Outcomes Unit (CBOCOU) array comprises 612 cases from ovarian cancer patients in British Columbia in a period from 1984 to 200014. All the samples in the CBOCOU array are from 46  patients without macroscopic residual tumor after primary surgery and tumors in stage Ia or Ib and grade 1 are excluded in this array14.  Samples in these two arrays consisted of HGSCs, LGSCs, CCCs, ECs and MCs. Tumor cell types and grades (Silverberg) were assessed by pathologists. After review, tumor samples were fixed in formalin and embedded in paraffin for tissue microarray construction (Tumor Bank array and Cheryl Brown Ovarian Cancer Outcomes Unit array). A representative area of each tumor was selected, and a duplicate core TMA was constructed (Beecher Instruments, Silver Springs, MD, USA). Serial 4 μm sections were cut for immunohistochemical (IHC) analysis.   2.14 Immunohistochemistry                Normal ovary, fallopian tube fimbria and TMA slides were stained with anti-human HOXB4 mAb (Epitomics Inc. Burlingame, CA) by the heat-induced epitope retrieval immunohistochemistry technique using a DAKO kit. Briefly, the slides were deparaffinized, rehydrated, and incubated in 0.3% H2O2. After antigen retrieval for 30 min with modified Tris/EDTA buffer ph 9 Dako), slides were incubated in serum-free protein blocking agent. The slides were then incubated with anti-HOXB4 mAb overnight at 4℃. After washing with PBS containing 0.05% Tween-20 (PBS-T), samples are incubated with biotinylated anti-rabbit, anti-mouse and anti-goat immunoglobulin solution and washed again with PBS-T before incubation with streptavidin peroxidase solution (Universal LSAB+Kit, HRP, DAKO). The immunohistochemical reaction color is developed by treating the tissue sections with 3, 3-diaminobenzidine (DAB) substrate (DAB substrate kit, DAKO). The slides were washed, counterstained, dehydrated, and mounted with xylene-based mounting media. The analysis of histologic classification (WHO) and the grade (FIGO) of the specimens, and the intensity of immuno-reactivity of HOXB4 were determined by pathologists. 47  2.15 Statistical Analysis                  All values are expressed as mean ± SEM from at least three independent experiments. Data were analyzed by one-way ANOVA method followed by Tukey’s test. All the invasion data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. All the tests were done by GraphPad Prism 5 (GraphPad Software, San Diego, CA) and P <0.05 was considered statistically significant. For the TMA data, contingency tables and likelihood ratio tests were used to assess the relationships in the distribution of HOXB4 expression across different stages, grades and subtypes of ovarian carcinomas. Kaplan-Meier curves were generated to demonstrate the survival distributions for HOXB4 staining in different ovarian cancer subtypes. The Log-rank analysis was applied to test the survival differences between HOXB4 positive and negative staining groups. A P value of < 0.05 was considered statistically significant.        48  Chapter  3: Expression and Function of HOXB4 in Ovarian Cancer Cells 3.1 Rationale               Ovarian surface epithelium (OSE) is one of the putative sources of epithelial ovarian carcinomas (EOC)34. Aberrant expression of HOX genes in EOC is thought to be a contributor in ovarian tumor progression31.  Overexpression of HOXB7 in an immortalized human OSE line (IOSE-29) increases cell proliferation198, whereas ectopic expression of HOXA7 leads to a more differentiated phenotype195. Forced expression of Hoxa9, Hoxa10 and Hoxa11 promotes the transformation of tumorigenic OSE to Müllerian-like EOCs in mice199. Down-regulation of HOXB7 decreases invasion in SKOV-3 ovarian cancer cells30. Depletion of HOXB13 suppresses trans-well invasion and colony formation in ovarian cancer lines (SKOV-3 and OVCAR-5)30,205, whereas forced expression of HOXB13 induces tumor growth both in vitro and in vivo205. Gene expression microarray analysis suggests that the expression of HOXA4 is higher in serous ovarian adenocarcinomas compared with benign and low malignant potential serous ovarian tumors194. With a few exceptions (OVCAR-8), HOXA4 mRNA and protein levels are generally higher in OSE than in ovarian cancer cell lines (OVCAR-3, CaOV-3, SKOV-3, OVCAR-5, OVCAR-10 and A2780 cells)196,206. Down-regulation of HOXA4 increases the phosphorylation of epidermal growth factor (EGF) receptor and cell migration in EGF treated OSE cells and ovarian cancer cells196. Moreover, HOXA4 has been shown to suppress cell motility and spreading in ovarian cancer cells, and β1 integrin is possibly involved in this function206.                 It is widely thought that paralogous HOX genes (e.g. HOXA4, B4, C4 and D4) may function cooperatively or synergistically in a specific tissue both in development278 and carcinogenesis159. HOXB4 is a close paralog of HOXA4 whose mRNA levels have been reported to be higher in ovarian cancer cells (SMOV2, ES-2, SKOV-3 and CaOV-3) than in normal ovary 49  tissue30. Hong et al. reported higher expression of HOXB4 mRNA and protein levels in TOV-21G, OV-90, SKOV-3 and SW626 ovarian cancer cells compared with normal ovaries, and found stronger anti-HOXB4 immunostaining in these four ovarian cancer lines and serous papillary ovarian carcinomas compared to normal ovarian samples207. In contrast, Morgan et al. detected lower HOXB4 mRNA levels in SKOV-3 cells than in normal ovary, while the HOXB4 mRNA levels in OV-90 cells were similar to normal ovary208. However, none of the aforementioned studies investigated the functional roles of HOXB4 in ovarian cancer cells. In addition, HOXB4 expression and localization in the fallopian tube fimbrial epithelium, which is believed to be a source of high-grade serous ovarian carcinoma (HGSC) 220, is completely unknown. Therefore, to investigate the function of HOXB4 in ovarian cancer, we tested the expression of HOXB4 in cultured OSE, immortalized OSE (IOSE), immortalized human fallopian tube epithelial cells (OE-E6/E7), and several ovarian cancer cell lines. We also performed loss- and gain-of-function studies to investigate the biological functions of HOXB4 in ovarian cancer cells.  3.2 Expression of HOXB4 in OSE, IOSE, Human Fallopian Tube Epithelial, and Ovarian Cancer Cells               We first used RT-PCR to examine the mRNA expression levels of HOXB4 in an immortalized fallopian tube epithelial line (OE-E6/E7)274, a cultured OSE sample, three IOSE cell lines (IOSE80,29 and 397), and nine ovarian cancer cell lines (OVCAR-2, OVCAR-4, OVACAR-5, OVCAR-8, OVACAR-10, A2780, CaOV-3, OVCAR-3 and SKOV-3) (Figure 3.1A upper panel). To confirm the PCR results, we performed DNA sequencing of these PCR products (DNA sequencing results are listed in Appendix B.1). We also performed Western blot analysis with a polyclonal goat antibody against HOXB4 (N-18, Santa Cruz) to examine the 50  protein expression levels of HOXB4 in the same cells (Figure 3.1A lower panel). The results showed that HOXB4 levels in the immortalized OE, OSE and non-tumorigenic IOSE cells tended to be either similar to, or lower than, those of the cancer cell lines. The expression pattern of HOXB4 transcripts was similar to that of HOXB4 protein. Later HOXB4 protein levels in two clear cell ovarian cancer lines (TOV21G and JHOC-7) were tested by Western blotting using a monoclonal rabbit antibody against HOXB4 (#2096-1, Epitomics). JHOC-7 cells displayed a medium level of HOXB4 expression whereas TOV21G cells were HOXB4-negative (Figure 3.1B). Since we observed varied expression levels of HOXB4 in ovarian cancer cells, next we altered the expression of HOXB4 to explore the functional roles of HOXB4 in proliferation, migration, and invasion of ovarian cancer cells. 3.3 HOXB4 Does Not Regulate Ovarian Cancer Cell Proliferation               To explore the function of HOXB4 in ovarian cancer cells, we used an siRNA approach to down-regulate the expression of HOXB4 in two cell lines with high HOXB4 expression (OVCAR-8 and A2780) and one with moderate expression (CaOV-3). Preliminary studies assessing transfection efficiency were performed with Lipofectamine RNAiMAX (Invitrogen) and fluorescently labeled siRNA (siGLO Green, Thermo Scientific). Epifluorescence microscopy one day after transfection confirmed ≥80% transfection efficiency for each cell line (Appendix Figure B.1). Next, we treated cells with Lipofectamine RNAiMAX alone, control siRNA (ON-TARGET plus siCONTROL, Thermo scientific) or HOXB4-specific siRNA (ON-TARGET plus SMART pool, Thermo scientific; sequences of the 4 siHOXB4 duplexes are listed in Appendix B.3) at the concentration of 50 nM total. We observed that HOXB4 protein levels were down-regulated by 90% or more, and this level of knock-down could be maintained for up to five days after transfection (Figure 3.2). The siRNA studies were complemented by gain-of-51  function experiments in which we used a retroviral vector (kindly provided by Dr. Humphries, Vancouver, BC Cancer Agency) to ectopically express HOXB4 in a HOXB4-negative cell line (OVCAR-5). Co-expression of green fluorescent protein (GFP) from the same vector allowed for cell selection by fluorescence-activated cell sorting (FACS) to establish stably expressing cells.                HOXB4 has been shown to promote proliferation in a few cell types53,179,271,279. In cultured human neonatal keratinocytes, overexpression of HOXB4 protein enhances proliferation and colony formation and suppresses cell adhesion271. Forced expression of HOXB4 protein has pro-proliferative effects on hematopoietic stem cells (HSC)179, whereas proliferative defects have been identified in the HSCs of Hoxb4 knockout mice259. Moreover, forced HOXB4 protein expression promotes the erythropoietic differentiation of embryonic stem cells280. To determine whether HOXB4 has regulatory effects on proliferation in ovarian cancer cells, we measured the growth rates of three cell lines (OVCAR-8, A2780 and CaOV-3) following knockdown of HOXB4. Initially, we chose to use the MTT (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide) assay which is a colorimetric assay measuring the reduction of MTT by mitochondrial succinate dehydrogenase in metabolically active cells. Thus, the MTT assay actually measures cell viability, as an indirect measurement of cell proliferation. To complement these studies we also performed direct cell counting with Trypan blue to measure changes in the number of viable cells. Growth of each cell line in media with 0.5% FBS was evaluated by both assays at 2, 3, 4 and 5 days after transfection with Lipofectamine RNAiMAX alone, control siRNA or siRNA against HOXB4. Both MTT (Figure 3.3) and cell-counting assays (Figure 3.4) showed that there was no significant difference in siHOXB4-treated cultures compared with either vehicle control or control siRNA-treated cultures. Similar results were obtained with A2780 (Figure 3.3 and Figure 3.4) and CaOV-3 (Figure 3.3 and Figure 3.4) cells. 52  Consistent with our siRNA results, MTT assay and cell counting found no significant difference in proliferation between vector and HOXB4-expressing OVCAR-5 cells (Figure 3.5). Taken together, these data provide evidence that HOXB4 does not regulate the proliferation of ovarian cancer cells. 3.4 HOXB4 Increases Trans-Well Migration in Ovarian Cancer Cells               One of the functions of HOX genes is to regulate cancer cell migration and invasion30. Overexpressed HOXD3 leads to a more motile and invasive phenotype in lung cancer191. Likewise, down-regulation of HOXD3 suppresses migration and invasion in melanoma cells192. In cervical cancer, HOXC10 has been shown to mediate cell invasion188. Overexpression of HOXA10 in endometrial cancer represses invasion both in vivo and in vitro189. In breast cancer, group 10 HOX paralogs function complementarily in suppression of cell migration/invasion. Overexpression of HOXA10 increases p53 and inhibits Matrigel invasion78, and HOXD10 (a paralog of HOXA10) has a migration-suppressive effect in breast cancer cells183. HOXB7 mediates the epithelial-mesenchymal transition in breast cancer 184, and promotes invasion in ovarian cancer cells30. Inhibition of HOXB13 suppresses trans-well Matrigel invasion in ovarian cancer cells30. HOXA4 exerts suppressive effects on migration in ovarian cancer cells196,206. Therefore in the present study, we investigated whether HOXB4 influences cell motility and invasiveness using the siRNA and overexpression approaches previously described.                Uncoated trans-well inserts with media with 10%FBS in the lower chamber were used to assess chemotactic cell migration. A2780 cells were transfected with Lipofectamine RNAiMAX alone, control-siRNA or siRNA-targeting HOXB4 for two days, seeded in these trans-well inserts and cultured for an additional day. We observed a significant increase in the number of migrating cells in the siHOXB4 group compared with the control-siRNA and vehicle 53  control groups (Figure 3.6). Similarly, OVCAR-8 or CaOV-3 cells were treated with Lipofectamine RNAiMAX alone, control-siRNA or siRNA-targeting HOXB4 for two days, and trans-well migration assays were performed for one or two days. In contrast to A2780 cells, down-regulation of endogenous HOXB4 did not affect trans-well migration in these two cell lines (Figure 3.7). We also examined the one day trans-well migration of parental, vector control and HOXB4-expressing OVCAR-5 cells, and found no significant differences (Figure 3.7). Taken together, our chemotactic trans-well migration results suggest that although HOXB4 does not regulate cell migration in the majority of ovarian cancer cell lines studied here, it might exert pro-migratory effects in a subset of lines.  3.5 HOXB4 Suppresses Trans-Well Matrigel Invasion in Ovarian Cancer Cells               In addition to examining the influence of HOXB4 on trans-well ovarian cancer cell migration, we also investigated its effects on chemotactic trans-well invasion by adding media with 10% FBS to the lower chamber and seeding cells in inserts coated with ~1 mg/ml Matrigel. Matrigel is a solubilized extracellular matrix preparation, extracted from murine Engelbreth-Holm-Swarm sarcoma cells, which is widely used as a reconstituted basement membrane (BM) for a variety of in vitro assays. Its major component is laminin, followed by type IV collagen, heparan sulfate proteoglycans and entactin/nidogen281,282. For our studies, Matrigel was used to mimic the basement membrane (BM) which is a sheet-like dense matrix beneath the epithelial and endothelial cells, and separates the interstitial substrates from adjacent tissues44,45.               OVCAR-8 or CaOV-3 cells were transfected with Lipofectamine RNAiMAX alone, control-siRNA or siRNA-targeting HOXB4 for two days and seeded in trans-well inserts coated with Matrigel. Down-regulation of HOXB4 in OVCAR-8 or CaOV-3 cells significantly increased trans-well invasion (Figure 3.8 A and B). A2780 cells were also treated with Lipofectamine 54  RNAiMAX alone, control-siRNA or siRNA-targeting HOXB4 for two days, and then seeded in matrigel invasion assay and cultured for one more day. However, siRNA mediated down-regulation of HOXB4 did not alter the invasiveness of A2780 cells (Figure 3.8 C). These observations suggest that endogenous HOXB4 suppresses chemotactic trans-well Matrigel invasion in some ovarian cancer cells (OVCAR-8 and CaOV-3 cells). To confirm that HOXB4 suppresses the invasion of ovarian cancer cells, parental, vector control and HOXB4-expressing OVCAR-5 cells were seeded in the Matrigel invasion assay and incubated for one more day. HOXB4 overexpressing cells were significantly less invasive than vector control or parental OVCAR-5 cells (Figure 3.9). To fully confirm the invasion suppressive effects of ectopic HOXB4, siRNA was used to reverse the effects of HOXB4 overexpression on trans-well invasion in OVCAR-5 cells (Figure 3.10). Taken together, HOXB4 suppresses Matrigel invasion, but not trans-well migration, in many (OVCAR-8, CaOV-3 and OVCAR-5) but not all ovarian cancer cells.                3.6 Matrix Metalloproteinase (MMP) Inhibitors Selectively Reverse HOXB4 siRNA-Induced Trans-Well Matrigel Invasion                That HOXB4 suppresses Matrigel invasion in three out of four ovarian cancer cell lines tested (OVCAR-8, CaOV-3 and OVCAR-5) suggests that the suppressive effects of HOXB4 might be mediated through Matrigel-related proteases or receptors. Initially, we used Western blot analysis to examine the protein levels of several invasion related molecules (MMP2, MMP9, integrinα2, integrinα3, integrinαV, integrinβ1, integrinβ3, E-cad, pFAK, EGFR, pAkt, Akt, and pERK) following knockdown or overexpression of HOXB4 (Appendix Figure B.2). However, none of the proteins examined were affected by alterations in the expression level of HOXB4 in the four ovarian cancer lines (A2780, OVCAR-8, CaOV-3 and OVCAR-5).  55                MMPs are a group of at least 25 proteolytic enzymes which regulate cancer invasion/migration through degrading proteins including ECM substrates, ECM receptors and cell-cell adhesion molecules283. To screen for other members of MMPs involved in invasion suppressive effects of HOXB4, we used GM6001 (Galardin, Ilomastat) and Marimastat (BB-2516), both of which are potent, competitive and reversible peptidomimetic MMP inhibitors. Although they both act by mimicking the substrates of MMPs, some studies suggest that the spectrum of MMPs targeted by each compound is likely different284–292. Marimastat mainly targets MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-12, MMP-13, MMP-14, MMP-17 and TACE (tumor necrosis factor alpha convertase, ADAM17)284. In addition to these MMPs, GM6001 also inhibits the activities of MMP-15, MMP-16, MMP-26287,288, MMP-21292, ADAM19291,  anthrax lethal factor289, neprilysin, leucine aminopeptidase and dipeptidylpeptidase III293. Thus, we treated CaOV-3 cells with either siCtrl or siHOXB4 for two days, then incubated those cells with two different MMP inhibitors (GM6001 or Marimastat) for half an hour and performed the trans-well invasion assay for one more day. We found that GM6001, but not Marimastat, significantly blocked the siHOXB4 induced cellular invasiveness (Figure 3.11) suggesting that the activity of MMPs might be required for the enhanced invasiveness of HOXB4-depleted ovarian cancer cells.    3.7 HOXB4 Does Not Regulate Trans-Well Type I Collagen Invasion               Although the locations and components of type I collagen is different from Matrigel in vivo294, acid-extracted type I collagen polymerizes to form an intact cross-linked gel, which is strict in its requirements for collagenolytic activity of cancer cell invasion48. To determine whether MMP-mediated collagenolysis is involved in siHOXB4-induced invasion of ovarian cancer cells, reconstituted acid-extracted type I collagen gel (200µg/ml) and media with 56  10%FBS in the upper chamber were used to measure type I collagen invasion. Parental, vector control and HOXB4-expressing OVCAR-5 cells were seeded in the trans-well inserts coated with type I collagen and incubated for one more day. The results showed no significant changes between control and HOXB4 overexpressed cells (Figure 3.12), suggesting that neither the collagenolytic activity of MMPs nor the type I collagen receptors are involved in HOXB4 regulated ovarian cancer cell invasion. 3.8 HOXB4 Suppresses Trans-Well Matrigel Invasion in Fallopian Tube Epithelial Cells               Fallopian tube fimbrial secretory epithelial cells are considered to be a putative source of high-grade serous ovarian carcinoma41. We confirmed elevated expression of HOXB4 in an immortalized normal human fallopian tube epithelial cell line (OE-E6/E7) believed to be of secretory cell lineage274,295 (Figure 3.1 A). To test whether HOXB4 can affect the invasiveness of normal fallopian tube epithelial cells, we used siRNA to down-regulate HOXB4 in OE-E6/E7 cells and examined invasiveness using Matrigel-coated trans-well inserts. Invasiveness was significantly increased following HOXB4 knockdown (Figure 3.13), suggesting that endogenous HOXB4 likely exerts invasion-suppressive effects in normal fallopian tube fimbrial secretory epithelial cells as well as ovarian cancer cells. 3.9 Discussion                In embryonic development, abundant expression of HOXB4 has been reported in neurectoderm, mesoderm, lung and stomach, mesonephros, metanephros, and prevertebra in mice, as well as lung, kidney and testes in adult mice296. In human adult tissues, HOXB4 expression has been demonstrated in hematopoietic stem cells160,179, arm skin, psoriatic skin and basal cell carcinoma271. HOXB4 expression was also been found in endometrium especially glandular cells297. In our present study, we found varying expression levels of HOXB4 in high-57  grade serous and clear cell ovarian cancer lines. Although most cell lines were positive for HOXB4, OVCAR-5 and TOV21G cells are HOXB4-negative. Also we have identified another ovarian cancer cell line which does not express HOXB4 (IGROV-1, Chapter 6). Therefore it is not an uncommon phenomenon that there is no expression of HOXB4 in ovarian cancer cell lines. We also found mild to intermediate levels of HOXB4 expression in OSE and IOSE cells. Our results are consistent with the study of Morgan et al., in which they demonstrated higher HOXB4 mRNA levels in normal ovary compared with SKOV-3 cells208. However, it has been reported that HOXB4 mRNA is overexpressed in ovarian cancer cell lines whereas little or no HOXB4 mRNA and protein is detected in normal ovarian tissue30,207. This might result from the use of whole ovarian extracts in which the OSE only comprises a very small amount of the total tissue. Specifically, moderate HOXB4 expression in an extremely under represented cell type may be virtually undetectable in a whole extract. IOSE cells were immortalized by the simian virus 40 Tag/tag transfection273, which are DNA tumor viruses and act as oncoproteins to immortalize the normal cells through altering multiple pathways related to cell cycle (e.g. TP53 and pp2A). This or in vitro culture system elements may account for discrepancies between our findings with cultured cells and those of tissue extracts. Though we did not test the expression of HOXB4 in different culture conditions, previous studies have demonstrated that HOXA4 mRNA levels in OSE cells can be up-regulated by EGF treatment and low calcium concentrations196. Also, cells are surrounded by ECM in vivo, which is important for cells maintaining a differentiated state298. For instance, in the mammary gland once myoepithelial cells loose contact with the basement membrane, the normal structure of the tissue breaks down and the cells undergo neoplastic transformation299. In our culture system, OSE cells were directly seeded on the plastic culture dishes. Given the importance of HOX genes in the regulation of 58  differentiation, it is possible that altered cell-ECM interactions could modify the expression of HOXB4 in OSE cells.                              HOXB4 has multiple regulatory effects on cell proliferation and/or apoptosis both in development and adult tissues. The Drosophila homologue of HOXB4, Dfd, activates apoptotic pathways via regulating reaper in development300. In the notochord of Xenopus, Hoxb4 directly stimulates apoptosis via FLASH301. Furthermore, HOXB4 has pro-proliferative effects in hematopoietic stem cells (HSC)276,279,302,303 and keratinocytes271, and Jun-B, Fra-1 and c-Myc have been reported to be the down-stream targets of HOXB4 in self-renewal of HSC 304,305. Our study is the first to investigate the functional roles of HOXB4 in ovarian cancer. However, we found that HOXB4 did not affect proliferation in four different ovarian cancer cell lines. These results might reflect tissue specific effects of HOX genes, which function differentially in different tissue environments together with their cofactors or collaborators51. For instance, the HOX cofactor PBX1enhances Hoxb4 induced cellular proliferation in a rat embryo fibroblast cell line (Rat-1)306, whereas it limits the expansion of HOXB4-overexpressing HSCs in mice307. Therefore, that HOXB4 cannot regulate ovarian cancer cell growth is not unexpected. Indeed, cyclin D1 and p21 protein expression in HOXB4 down-regulated ovarian cancer cells showed no differences compared with controls (preliminary data not shown).               In our trans-well invasion system, the cells which are seeded in the insert have to attach to the Matrigel, and then break down the Matrigel or squeeze themselves to go through the Matrigel and the membrane44,45,308. Our research demonstrates that HOXB4 has invasion-suppressive effects on trans-well Matrigel invasion but not trans-well migration in three ovarian cancer cell lines (OVCAR-8, CaOV-3 and OVCAR-5). Also the invasion-suppressive effects of HOXB4 in ovarian cancer cells were confirmed by treating HOXB4-overexpressing OVCAR-5 59  cells with siHOXB4, which significantly blocked HOXB4-repressed invasion. Though siHOXB4 led to two-fold increase of invading cells in HOXB4-overexpressing compared with vector-overexpressing OVCAR-5 cells, it might be due the different characteristics of these two cell populations, which were the GFP expression cells selected by FACS. This suggests that the suppressive effects of HOXB4 on invasiveness could involve adhesion, proteolysis and motility in a Matrigel context but not on simple motility. Therefore, the invasion-suppressive effect of HOXB4 likely involves the regulation of Matrigel related enzymes or receptors. The major components of Matrigel are laminin, followed by type IV collagen, heparan sulfate proteoglycans, entactin/nidogen281,282. Therefore, adhesion to these substrates is the key step in trans-well Matrigel invasion, in which the integrin family play an important role by mediating adhesion to the substrates or/and neighboring cells and transducing signals from the cell surface to the interior309–311. The expression of HOX genes has been associated with integrins in several cancer types312,313. The negative regulation of β3 integrin by Hoxd10 has been reported in a malignant breast cancer cell line in a three-dimensional Matrigel model183. β1 integrin has been demonstrated to be a critical mediator for the peritoneal mesothelium adhesion of ovarian cancer261,314. A paralog of HOXB4, HOXA4, has been shown to have a migration- but not invasion- suppressive effects in ovarian cancer cells196,206. HOXA4 siRNA indirectly suppresses mature β1 integrin protein levels in OVCAR-8 and OVCAR-3 cells and this effect is abolished by a loss of cell-cell adhesion. Overexpression of HOXA4 has been shown to induce β1 integrin protein in CaOV-3 cells206. Hence, in our preliminary study, we tested the possibility that HOXB4 could regulate α2, α3, αV, β1 and β3 integrins that are subunits of laminin-, collagen- and vitronectin-binding integrins309, and we found that altered expression of HOXB4 did not affect these integrins. This is in agreement with our observation that HOXB4 did not change the 60  morphology of ovarian cancer cells (data not shown). However, HOXB4 has been demonstrated to have suppressive effects on cell adhesion to plastic, and the surface expression of integrin α2 in cultured keratinocytes271. This differential effect of HOXB4 might due to the tissue specificity of HOX genes. Also, we found that there were no conclusive changes in cell-cell and/or cell-substratum related molecules and pathways (E-cadherin, FAK, EGFR, ERK and AKT) regulated by HOXB4. However, these data cannot eliminate the possibility that the suppressive effect of HOXB4 on ovarian cancer cell invasion is not through cell-cell and/or cell-substratum adhesiveness. Indeed, further study is required to demonstrate the mechanism involved in HOXB4 regulated trans-well Matrigel invasion in ovarian cancer cells. Our study of the invasion-suppressive effect of HOXB4 together with previous studies of migration-suppressive effect of HOXA4 suggests complementary roles for these two group 4 HOX paralogs in the metastasis (migration/invasion) of ovarian cancer cells. Moreover, this functional synergistic effect has been reported in other types of cancers. For example, overexpression of HOXA10 increases TP53 and inhibits Matrigel invasion of breast cancer cells78, while HOXD10 has a migration-suppressive effect on breast cancer cells183.                Both protease-independent and protease-dependent invasion have been reported in Matrigel invasion48,315. Protease-independent invasion through Matrigel is thought to be facilitated a lack of covalent cross-links that are characteristic of intact basement membrane in vivo48. This kind of interlocking web forms a network with a pore size of approximately 50 nm, which restricts the migration of both cancer and normal cells44. During protease-dependent invasion, the family of matrix metalloproteinases (MMPs) are the most prominent proteases, which facilitate neoplastic cells invasion together with the stromal cells remodeling the ECM barrier44,49. HOXB7 has been reported to stimulate MMP9 expression in a breast cancer cell 61  line185. In our study we found that neither MMP2, nor MMP9 protein levels can be regulated by altering HOXB4 expression, and that Marimastat (a pan-spectrum MMP inhibitor) failed to block the siHOXB4-induced Matrigel invasion. However, we did find that another broad-range MMP inhibitor (GM6001) blocked the siHOXB4 induced Matrigel invasion in ovarian cancer cells suggesting that the repressive effects of HOXB4 in Matrigel invasion might be mediated by MMPs. The effective concentrations of GM6001in the in vitro invasion assay ranges from 1 to 35 µM in ovarian cancer cell lines316–322, thus one might argue that this effect is due to a side effect of GM6001 at a very high concentration. However, there has been no report about treating GM6001 in CaOV-3 cells, which we used in our study. Also GM6001 has been used at 50 µM in an in vitro trans-well invasion of fibromatosis323. Therefore, the high concentration (50 µM) is less likely to contribute to the blockade effect of GM6001. In addition, the concentration of Marimastat we used is 20 µM, which has been reported in several cancer studies324,325. In ovarian cancer though, marimastat concentrations of 2 or 20 µM has been used in CaOV-3 and IGROV cells326. In our study, even a high concentration of Marimastat (20 µM) did not have any effect on siHOXB4-induced invasion. The slightly differed spectrum of these two MMP inhibitors might contribute to our results. Both GM6001 and Marimastat have been reported to target MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-12, MMP-13, MMP-14, MMP-17 and TACE (tumor necrosis factor alpha convertase, ADAM17) 284–292. However, GM6001 also inhibits the activities of MMP-15, MMP-16, MMP-26287,288, MMP-21292, ADAM19291,  anthrax lethal factor289, neprilysin, leucine aminopeptidase and dipeptidylpeptidase III293. Nonetheless, compared to GM6001, Marimastat is a relatively new MMP inhibitor with fewer reports of its inhibitory spectrum. Thus, we could not eliminate the possibility that Marimastat has a broader spectrum, and that GM6001-specific targets are less than what we have listed. Taken together, 62  GM6001 blocked invasiveness induced by siHOXB4 in CaOV-3 cells suggests that the invasion-suppressive effect of HOXB4 on ovarian cancer cells might be protease-dependent, though the identification of the particular protease and the mechanisms involved need to be further studied.               Type I collagen is the major ECM component that ovarian cancer cells encounter during intraperitoneal metastatic dissemination319,321,327.  Since acid-extracted type I collagen gels oblige cancer cells to employ collagenolysis, it has also been used to test the invasiveness of ovarian cancer cells321. In our study type I collagen trans-well studies did not show any influence on cell invasion by altering HOXB4 expression, suggesting that the invasion suppressive effect of HOXB4 is not likely to involve type I collagen receptors or proteolytic enzymes. Indeed, in addition to the proteolytic effect on ECM substrates, metalloproteinases can also cleave growth factor receptors and/or the adhesive molecules on the cell surface in order to activate signaling pathways that regulate cell growth, adhesion and migration through ECM283,328–330. Together with our MMP inhibitor results, our study suggests that the activity of certain proteases facilitate invasion-suppressive effect of HOXB4 in Matrigel trans-well invasion, although the collagenolytic effect of those molecules is less likely to be involved.                  Interestingly, our findings suggest that HOXB4 enhances trans-well migration but not invasion in A2780 cells, which is completely different from what we observed in the other three lines (OVCAR-8, CaOV-3 and OVCAR-5). One possible reason for this difference might be that some consider the A2780 cell line to be derived from an endometrioid ovarian carcinoma, whereas the other three lines are thought to be of high-grade serous origin275. Since different subtypes of ovarian cancer are now widely considered to be different diseases, it is not surprising that HOXB4 might have different effects and underling mechanisms in different subtypes of ovarian cancer cell lines, which are thought to be derived from different precursors. However, 63  studies with additional endometrioid ovarian carcinoma lines would be required to confirm these effects and are needed to exclude a rare circumstance seen only in A2780 cells.                Since the fimbrial epithelium of Fallopian tube is believed to be a source of high-grade serous ovarian carcinoma, our study is the first to determine the HOXB4 expression in an immortalized human oviductal epithelial cell line (OE-E6/E7), and we found HOXB4 protein levels were higher in OE-E6/E7 cells than in six out of nine ovarian cancer lines (OVCAR-2, OVCAR-4, OVCAR-5, CaOV-3, OVCAR-3, and SKOV-3). In addition, the invasion-suppressive effect of HOXB4 in OE-E6/E7 suggests that the regulatory effect of HOXB4 is not only in the HGSC lines, but also in its putative source, the fimbrial epithelium of the fallopian tube. Therefore, HOXB4 might be a regulatory effector during HGSC progression, in particular as a putative tumor suppressor.                                       64   Figure 3.1 HOXB4 expression in OE, OSE, IOSE, and ovarian cancer cells A. RT-PCR analysis (upper panel) and Western blot analysis (lower panel) showed HOXB4 mRNA and protein levels (n=2) in immortalized fallopian tube epithelial cells (OE-E6/E7), cultured (OSE) and immortalized OSE cells (IOSE-80, -29, -397), and EOC-derived cell lines (OVCAR-2, -3, -4, -5, -8, -10, A2780, SKOV-3 and CaOV-3). β-actin was reprobed by anti-β-actin goat polyclonal antibody after stripping the HOXB4 antibody; B. Western blot showed the protein levels of HOXB4 in clear cell ovarian cancer cell lines (TOV21G and JHOC-7, n=1). Actin was probed by anti-actin goat polyclonal antibody after stripping the HOXB4 antibody.  65   Figure 3.2 siRNA mediated down-regulation of HOXB4 in ovarian cancer cell lines Cells were transfected and then cultured for 2-5 days with Lipofectamine alone (iMAX), control siRNA (siCon) or HOXB4 siRNA (siB4). Western blot analysis showed down-regulated HOXB4 protein levels in A2780, OVCAR-8 and CaOV-3 cells (n=2). Actin was probed by anti-actin goat polyclonal antibody after stripping the HOXB4 antibody.   66   Figure 3.3 Down-regulation of HOXB4 does not alter ovarian cancer cell proliferation as assessed by MTT assay Cells were transfected and then cultured for two to five days with Lipofectamine alone (iMAX), control siRNA (siCon), or HOXB4 siRNA (siB4) and cell viability was assessed by MTT assay in 0.5% FBS culture media. Data are presented as mean ± SEM of three independent experiments and one-way ANOVA method followed by Tukey’s test were used to test the differences of treatment groups in the same day. P<0.05 was considered as statistical significance. 67   Figure 3.4 Down-regulation of HOXB4 does not alter ovarian cancer cell proliferation as assessed by trypan blue cell viability test Cells were transfected and then cultured for two to five days with Lipofectamine alone (iMAX), control siRNA (siCon), or HOXB4 siRNA (siB4) and cell number was assessed by trypan blue cell viability test in 0.5% FBS culture media. Data are presented as mean ± SEM of three independent experiments and one-way ANOVA method followed by Tukey’s test were used to test the differences of treatment groups in the same day. P<0.05 was considered as statistical significance.  68   Figure 3.5 Overexpressing HOXB4 does not alter ovarian cancer cell proliferation as assessed by MTT assay and trypan blue cell viability test Parental, vector control (M) and HOXB4 (B4) overexpressing OVCAR-5 sublines were generated with retroviral vectors and GFP positive cells were sorted by flow cytometry. The cells were seeded and then cultured in the culture plates for one to five days, and cell numbers were assessed by MTT assay (A) and trypan blue cell viability test (B) in 0.5% FBS, respectively. Data are presented as mean ± SEM of three independent experiments and one-way ANOVA method followed by Tukey’s test were used to test the differences of treatment groups in the same day. P<0.05 was considered as statistical significance.  69   Figure 3.6 HOXB4 increases trans-well migration in A2780 cells A2780 cells were transfected and then cultured for two days with Lipofectamine alone (iMAX), control siRNA (siCon) or HOXB4 siRNA (siB4). Cells were trypsinized and seeded in trans-well inserts and then cultured for a further one day. Migrating cell nuclei were stained with Hoechst and counted using fluorescence microscopy. At least 5 random fields of the inserts were counted and 100 cells were included. A. Representative Fluorescence images of the migrating A2780 cells. Scale bar represents 100 µm; B. Histogram showed the migrating cells compared to siCon in A2780 cells. Results are presented as mean ± SEM from at least three independent experiments with triplicate inserts. Data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. Values that are statistically different from one another (P < 0.05) are indicated by different letters.   70   Figure 3.7 HOXB4 does not regulate ovarian cancer cell migration OVCAR-8 and CaOV-3 cells were transfected and then cultured for two days with Lipofectamine alone (iMAX), control siRNA (siCon) or HOXB4 siRNA (siB4). Cells were trypsinized and seeded in trans-well inserts and then cultured for a further one day (CaOV-3) or two days (OVCAR-8). Parental, vector control (vector) and HOXB4 (HOXB4) overexpressing OVCAR-5 cells were trypsinized, then seeded in trans-well inserts and cultured for a further one day. Migrating cell nuclei were stained with Hoechst and counted using fluorescence microscopy. At least 5 random fields of the inserts were counted and 100 cells were included. Histograms showed the migrating cells compared to siCon in OVCAR-8, CaOV-3 and OVCAR-5 cells. Results are presented as mean ± SEM from at least three independent experiments with triplicate inserts. Data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. 71   Figure 3.8 HOXB4 suppresses trans-well Matrigel invasion in ovarian cancer cells  OVCAR-8, CaOV-3 and A2780 cells were transfected and then cultured for two days with Lipofectamine alone (iMAX), control siRNA (siCon) or HOXB4 siRNA (siB4). Cells were trypsinized and seeded in Matrigel coated trans-well inserts and then cultured for a further one day (A2780) or two days (OVCAR-8 and CaOV-3). Invading cell nuclei were stained with Hoechst and counted using fluorescence microscopy. At least 5 random fields of the inserts were counted and 100 cells were included. A. Representative Fluorescence images of the invading OVCAR-8 and CaOV-3 cells. Scale bar represents 100 µm; B. Histograms showed the invading cells compared to siCon in OVCAR-8, CaOV-3 and A2780 cells. Results are presented as mean ± SEM from at least three independent experiments with triplicate inserts. Data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. 72   Figure 3.9 Overexpressing HOXB4 suppresses ovarian cancer cell invasion A. Western blot analysis showed HOXB4 protein levels in parental, control (Vector) and HOXB4 (HOXB4) overexpressing OVCAR-5 cells. These cells were trypsinized and seeded in Matrigel coated tran-swell inserts, and then cultured for a further one day. Invading cell nuclei were stained with Hoechst and counted using fluorescence microscopy. At least 5 random fields of the inserts were counted and 100 cells were included. B. Representative fluorescence images of invading cells. Scale bar: 100 μm. C. Histogram showed the invading cells compared to vector expressing OVCAR-5 cells. Results are presented as mean ± SEM from at least three independent experiments with triplicate inserts. Data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. Values that are statistically different from one another (P < 0.05) are indicated by different letters.   73   Figure 3.10 Reduced invasiveness of HOXB4-overexpressing cells are mediated by HOXB4 Control (Vector) and HOXB4 (HOXB4) expressing OVCAR-5 sublines were transfected and then cultured for two days with control siRNA (siCon), or HOXB4 siRNA (siB4). A. western blot analysis showed HOXB4 protein levels. Cells were trypsinized and seeded in trans-well inserts coated with Matrigel, and then cultured for a further one day. Invading cell nuclei were stained with Hoechst and counted using fluorescence microscopy. At least 5 random fields of the inserts were counted and 100 cells were included. B. Representative fluorescence images of invading cells. Scale bar: 100 µm. C. Histogram showed the invading cells compared to siCon treated vector expressing OVCAR-5 cells. Results are presented as mean ± SEM from at least three independent experiments with triplicate inserts. Data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. 74   Figure 3.11 GM6001, but not Marimastat, abolished siHOXB4 induced Matrigel trans-well invasion in CaOV-3 cells CaOV-3 cells were transfected and then cultured for two days with either control siRNA (siCon) or HOXB4 siRNA (siB4). Cells were trypsinized and mixed with DMSO (control), GM6001 (50 µM), or Marimastat (20 µM) for 30 mins, then cells were seeded in Matrigel coated trans-well inserts for a further two days. Invading cell nuclei were stained with Hoechst and counted using fluorescence microscopy. At least 5 random fields of the inserts were counted and 100 cells were included. Histogram showed the invading cells compared to siCon in CaOV-3 cells with each treatment. Results are presented as mean ± SEM from at least three independent experiments with triplicate inserts. Data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. Values that are statistically different from one another (P < 0.05) are indicated by different letters.     75    Figure 3.12 Overexpressing HOXB4 does not affect type I collagen invasion in ovarian cancer cells Parental, control (Vector) and HOXB4 (HOXB4) overexpressing OVCAR-5 sublines were generated with retroviral vectors and cells were sorted by flow cytometry. Cells were trypsinized and seeded in trans-well inserts coated with type I collagen, and then cell invasion was measured after one day. Invading cell nuclei were stained with Hoechst and counted using fluorescence microscopy. At least 5 random fields of the inserts were counted and 100 cells were included. Histogram showed the invading cells compared to siCon in A2780 (A) and OVCAR-10 (B) cells. Results are presented as mean ± SEM from at least three independent experiments with triplicate inserts. Data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. Values that are statistically different from one another (P < 0.05) are indicated by different letters.  76   Figure 3.13 HOXB4 suppresses oviductal epithelial cell invasion OE-E6/E7 cells were transfected and then cultured for two days with Lipofectamine alone (iMAX), control siRNA (siCon) or HOXB4 siRNA (siB4). A. Western blot analysis of HOXB4 protein levels. Cells were trypsinized and seeded in Matrigel coated trans-well inserts and then cultured for a further one day. Invading cell nuclei were stained with Hoechst and counted using fluorescence microscopy. At least 5 random fields of the inserts were counted and 100 cells were included. B. Representative Fluorescence images of the invading OE-E6/E7cells. Scale bar represents 100 µm; C. Histogram showed the invading cells compared to siCon in OE-E6/E7 cells. Results are presented as mean ± SEM from at least three independent experiments with triplicate inserts. Data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. Values that are statistically different from one another (P < 0.05) are indicated by different letters.  77  Chapter  4: Mechanism Mediating the Suppressive Effects of HOXB4 on Ovarian Cancer Cell Invasion 4.1 Rationale               Many HOX genes have been reported to exert regulatory effects on cancer cell migration and invasiveness50,58. Overexpression of HOXA10 in endometrial cancer represses invasion both in vivo and in vitro, and increases E-cadherin expression by decreasing Snail189. Also, overexpression of HOXA10 increases TP53 and inhibits Matrigel invasion of breast cancer cells78. In breast cancer, HOXB7 enhances migration and invasion, suppresses claudin 1, 4, 7 and E-cadherin, and increases vimentin and α-smooth muscle actin184. HOXD3 promotes migration and invasion in lung cancer, decreases E-cadherin and plakoglobin, increases integrin α3, β3, MMP2 and uPA, and induces N-cadherin and integrin α4 expression191. In melanoma cells, HOXD3 also enhances cell motility and invasiveness, and decreases CDC 42-interacting protein 4 and tropomyosin 1192. HOXD10 has a migration-suppressive effect in breast cancer cells by repressing integrin α3, MMP14, and uPAR183.                In ovarian cancer, HOXA4 has been shown to suppress cell migration, possibly via the regulation of integrin β1196,206.  HOXB7 and HOXB13 have pro-invasive effects on SKOV-3 cells30, and HOXB7 can increase production of vascular endothelial growth factor, interleukin-8, melanoma growth-stimulatory activity/growth-related oncogenene, and angiopoietin-2185.                In cultured keratinocytes, HOXB4 exerts suppressive effects on cell adhesion to plastic, and regulates the surface expression of integrin α2 and CD44271. In our study, we found that HOXB4 had suppressive effects on ovarian cancer cell invasion through Matrigel, and that this effect was blocked by GM6001. Therefore, in the present study, we performed a gene expression 78  microarray analysis in HOXB4 overexpressing OVCAR-5 cells to explore the molecules, which were regulated by HOXB4 in the invasion-suppressive phenotype of HOXB4. After validation of the microarray analysis, we also tested these target genes in two ovarian cancer cell lines which were treated with siHOXB4, as the expression of these target genes should be regulated by HOXB4 both in HOXB4 overexpressing and down-regulated cell lines. What’s more, these target genes should also fit in the invasion-suppressive phenotype of HOXB4 that we observed in ovarian cancer cells. We found that the effects of HOXB4 on cell invasiveness are mediated by CD44, a cell surface adhesion molecule which can bind to laminin and type IV collagen226,331 (the major components of Matrigel281,308) as well as hyaluronan and fibronectin.  4.2 Gene Expression Microarray Analysis of HOXB4-Overexpressing OVCAR-5 Cells 4.2.1 Differentially Expression Analysis of HOXB4 Targets               Total RNA was extracted from three biological replicates of green fluorescent protein (GFP)-positive OVCAR-5 cells transduced with either empty vector or HOXB4 using the RNeasy Plus kit (Qiagen Inc., Mississauga, ON). Samples were hybridized on SurePrint G3 Human GE 8×60K Microarrays (Design ID 028004). Differentially expressed genes with a fold change cutoff of 1.5 and a p-value cutoff of 0.05 were further analyzed in Ingenuity Pathways Analysis software. Our results showed that 345 genes passed a cutoff of 1.5-fold change (p<0.05) between GFP- and HOXB4-expressing OVCAR-5 cells (Appendix C). Then these genes were used as input for Ingenuity Pathways Analysis (IPA). 56 differentially expressed gene transcripts were involved in tissue development, 44 gene transcripts had functions on cellular movement, and 67 gene transcripts had functions related to tumorigenesis. At least 12 gene transcripts were involved in ovarian cancer from the Ingenuity Pathways Analysis software (Table 4.1). 79  Table 4.1 Top 12 gene transcripts related to ovarian cancer  Fold difference HOXB4/GFP  GenBank  Gene symbol  Gene title 4.12 NM_003480 MFAP5 Homo sapiens microfibrillar associated protein 5 3.4 NM_001442 FABP4 Homo sapiens fatty acid binding protein 4 3.24 NM_002019 FLT1 Homo sapiens fms-related tyrosine kinase 1, transcript variant 1 2.28 NM_153225 C8orf84 Homo sapiens chromosome 8 open reading frame 84 1.95 NM_007193 ANXA10 Homo sapiens annexin A10 1.72 NM_001134 AFP Homo sapiens alpha-fetoprotein 1.66 NM_005257 GATA6 Homo sapiens GATA binding protein 6  1.51 NM_001343 DAB2 Homo sapiens disabled homolog 2, mitogen-responsive phosphoprotein 1.5 NM_000610 CD44 Homo sapiens CD44 molecule (Indian blood group), transcript variant 1 -1.57 NM_002658 PLAU Homo sapiens plasminogen activator, urokinase, transcript variant 1 -1.58 NM_000758 CSF2 Homo sapiens colony stimulating factor 2 -1.72 NM_002256 KISS1 Homo sapiens KiSS-1 metastasis-suppressor  p-value cutoff is less than 0.05               We found that matrix metalloproteinase 12 (MMP12) and ADAM metallopeptidase with thrombospondin type 1 motif 14 (ADAMTS14) were significantly increased 2.7 fold and 1.9 fold by overexpressing HOXB4 in OVCAR-5 cells respectively (Table 4.2). Further, we observed that MMP13, ADAM33 and ADAMTSL4 were also altered by overexpressing HOXB4 in OVCAR-5 cells (Table 4.2).      80  Table 4.2 Altered transcripts of metalloproteinase by overexpressing of HOXB4  Fold difference HOXB4/GFP  GenBank  Gene symbol  Gene title 2.7 NM_002426 MMP12 Homo sapiens metrix metalloproteinase 12  1.94 NM_139155 ADAMTS14 Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 14 1.18 NM_153202 ADAM33 Homo sapiens ADAM metallopeptidase domain 33  1.69* NM_002427 MMP13 Homo sapiens matrix metallopeptidase 13  1.41** NM_019032 ADAMTSL4 Homo sapiens ADAMTS-like 4  *: p= 0.05447737; **: p= 0.06925775. 4.2.2 Validation of Target Genes               Based on our functional studies that HOXB4 suppressed ovarian cancer cell invasion, we focused our analysis on target molecules involved in cellular movement. We established criteria for the validation of target genes: 1) they have established expression in OVCAR-5, OVCAR-8, and CaOV-3 cells; 2) they are functionally related to invasion; 3) their up- or down-regulation along with their role in invasion corresponds to the reduced invasiveness associated with enhanced HOXB4 expression. Validated genes must be regulated by HOXB4 in all three cell lines with demonstrated effects on invasion (OVCAR-5, OVCAR-8 and CaOV-3 cells), and the direction of this regulation should be consistent with either HOXB4 overexpression (OVCAR-5) or knockdown (OVCAR-8 and CaOV-3).                Eight gene transcripts that were differentially expressed at least 1.5-fold in microarray analysis were chosen for validation as target genes of HOXB4 in ovarian cancer (ADRB2, POU5F1, COBL, LZTS1, CD44, DAB2, THSD1, and ROR1). TaqMan assays were used to measure target gene mRNA levels in HOXB4-overexpressing OVCAR-5 cells, as well as HOXB4 siRNA-treated CaOV-3 and OVCAR-8 cells. Six genes identified in the microarray analysis were successfully validated by TaqMan analysis in vector and HOXB4-overexpressing 81  OVCAR-5 cells (Figure 4.1). Next, in order to identify target genes influenced by HOXB4 in multiple cell lines, we tested these genes in OVCAR-8 and CaOV-3 cells treated with Lipofectamine RNAiMAX, control siRNA or siRNA targeting HOXB4 for two days. Of the target genes analyzed, CD44 was the only target to be successfully validated in OVCAR-8 and CaOV-3 cells (Figure 4.2). 4.3 Invasion-Suppressive Effect of HOXB4 Is Mediated by CD44 4.3.1 Expression of CD44 Is Regulated by HOXB4 in OVCAR-5 and CaOV-3 Cells               CD44 is a receptor for hyaluronic acid, laminin, type IV collagen and fibronectin, which are widely distributed in the extracellular matrix308. Considering the repertoire of extracellular matrices bound by CD44 in relation to the composition of Matrigel, it is likely that CD44 is an important adhesive molecule in trans-well Matrigel invasion assays308. Overexpression of HOXB4 has also been shown to induce CD44 expression in embryonic stem cells272, whereas it suppresses the cell surface expression of CD44 in keratinocytes271. Since our TaqMan assays results showed that CD44 mRNA was positively regulated by HOXB4 (Figure 4.1; Figure 4.2), we also tested the protein levels of CD44 in response to altered HOXB4 levels. In agreement with our mRNA findings, we found that CD44 protein was up-regulated by increased HOXB4 expression in OVCAR-5 cells and down-regulated by decreased HOXB4 expression in CaOV-3 cells (Figure 4.3). However, in OVCAR-8 cells, we were unable to properly separate CD44 proteins by SDS-PAGE (data not shown), which might be due to heavy post-translational modification (e.g. glycosylation) of CD44 in this cell line226. We also tested the mRNA levels of CD44 by TaqMan assay in OE-E6/E7 cells after treated with Lipofectamine RNAiMAX, control siRNA or siHOXB4 for two days, and we did not find changes of CD44 in siHOXB4 treated group compared with control groups (Figure 4.4).  82  4.3.2 Down-Regulation of CD44 Increases Trans-Well Matrigel Invasion in OVCAR-5 Cells               In ovarian cancer, previous clinical studies have generated controversial results regarding the relationship between CD44 protein levels and disease prognosis255–258. Functional studies suggest that CD44 can exert pro-migratory effects on ovarian cancer metastasis by interacting with β1 integrin261 or proteoglycan secreted by the cancer cells332. However, these results are at odds with clinical studies demonstrating that CD44 is associated with good prognosis. Therefore, there might be additional roles for CD44 in ovarian cancer progression.                Since we found that the expression of CD44 is up-regulated by HOXB4 that would suggest that CD44 could contribute to the suppressive effects of HOXB4 on ovarian cancer cell invasiveness. To confirm this, we used siRNA to investigate how OVCAR-5 cell invasiveness was influenced by CD44. OVCAR-5 cells were transfected with Lipofectamine RNAiMAX, control siRNA or siRNA targeting CD44 (sequences of CD44 siRNAs provided in Appendix B.5.) for two days and seeded in trans-well inserts coated with Matrigel. Our study showed that down-regulation of CD44 expression in OVCAR-5 cells significantly increased trans-well invasion (Figure 4.5), which was similar to what we had observed in down-regulation of HOXB4 in HOXB4 expressing ovarian cancer cell lines. These observations suggest that endogenous CD44 also suppresses chemotactic invasion in some ovarian cancer cells. 4.3.3 The Suppressive Effects of HOXB4 on Invasion Are Partially Mediated by CD44               To determine whether the invasion-suppressive effects of HOXB4 are mediated by CD44, vector or HOXB4 expressing OVCAR-5 cells were treated with control siRNA or siRNA targeting CD44 for two days, and seeded in the trans-well inserts coated with Matrigel for one more day. Media with 10%FBS was added in the lower chambers to serve as a chemotactic agent 83  in our in vitro trans-well chemotactic invasion assay. Our results showed that the ability of HOXB4 to suppress invasion in OVCAR-5 cells was reversed when CD44 was down-regulated by specific siRNA (Figure 4.6). Moreover, after down-regulation of CD44, the number of the invading cells significantly increased 1.5 fold or more in HOXB4 overexpressing OVCAR-5 cells compared with control vector expressing OVCAR-5 cells.                To confirm the siRNA findings and exclude potential off-target effects, we also examined whether a human CD44 function blocking antibody (clone 5F12) could antagonize the effects of HOXB4 on invasion. Vector or HOXB4 overexpressing OVCAR-5 cells were incubated with anti-CD44 or isotype-matched IgG1 for 1 hour, and then seeded in the trans-well inserts coated with Matrigel for one more day. We found that treatment with CD44 function blocking antibody significantly reversed the suppressive effects of HOXB4 overexpression on trans-well Matrigel invasion in OVCAR-5 cells (Figure 4.7). Overall, these two studies confirmed that the invasion-suppressive effects of HOXB4 are mediated by CD44 in ovarian cancer cells. 4.3.4 CD44 Is Not Expressed in A2780 Cells               Our previous results showed that down-regulation of HOXB4 in A2780 cells decreased trans-well migration but did not alter Matrigel invasion (Figure 3.15). These results were quite different from the invasion-suppressive effects of HOXB4 on OVCAR-8, CaOV-3 and OVCAR-5 cells. Having established the importance of CD44 in mediating the effects of HOXB4 in these cells, we hypothesized that the altered response of A2780 cells might result from a failure to regulate CD44. Thus, we examined CD44 mRNA levels in A2780 cells following treatment with Lipofectamine RNAiMAX, control siRNA or siRNA targeting CD44 for two days. In agreement with our hypothesis, the CD44 mRNA levels were undetectable by Taqman assay. Therefore, the 84  pro-migratory effects of HOXB4 in A2780 cells are likely mediated by an independent mechanism that does not involve CD44. Further studies will be required to elucidate the mechanism underlying the pro-migratory effects of HOXB4.  4.4 Discussion                Our gene expression analysis and phenotypic validation demonstrate that CD44 is a key mediator of the invasion-related effects of HOXB4 in ovarian cancer cells. The CD44 family is composed of a group of CD44 variants, which are all encoded by a single gene and generated by alternative splicing and post-translational modification231. In our study, the microarray probe and TaqMan assay used to examine CD44 expression were each able to detect all the CD44 variants listed in the Pubmed transcripts data base (RefSeq #: NM_000610.3; NM_001001389.1; NM_001001390.1; NM_001001391.1; NM_001001392.1; NM_001202555.1; NM_001202556.1). Additionally, the siRNA that we used to down-regulate CD44 expression targeted all the CD44 variants. Also, the antibody we used to detect the protein level of CD44 is immuno-active to all the CD44 variants. Therefore, future studies would be required to examine the specific roles of individual CD44 variants.                The many functions of CD44 include adhesion to hyaluronan and other components of ECM (e.g. laminin and collagen in Matrigel), co-receptor for receptor tyrosine kinases, and a linkage of the plasma membrane and actin cytoskeleton239. However, the relationship between the expression of CD44 protein family and the clinical survival of the ovarian cancer is controversial333.  Functionally, most studies of CD44 have focused on the HA-dependent functions259. CD44 has been shown to mediate ovarian cancer cell (CaOV-3 and SKOV-3) binding to HA secreting mesothelial cells260,261. Mechanistically, CD44 interacts with c-Src and stimulates HA-dependent ovarian cancer cell migration262. Also, CD44-HA binding activates 85  ovarian cancer cell migration by stimulating the Cdc42 and ERK pathways263, HER2 and nuclear translocation of β-catenin264.  However, these pro-migratory mechanisms of CD44 interaction with HA cannot explain the clinical studies of CD44 associated with good prognosis254,255. CD44 has also been demonstrated to mediate the ovarian cancer cell adhesion with other ECM components such as laminin, type IV collagen265,  which are major components of Matrigel and also essential for tumor cell metastasis. Therefore, there may be roles for CD44 interacting with laminin or type IV collagen in ovarian cancer progression.                In our study, we found down-regulation of CD44 induced Matrigel invasion, which is consistent with the invasion-suppressive function of HOXB4 we demonstrated in ovarian cancer cells (OVCAR-8, CaOV-3 and OVCAR-5). On the contrary, Muthukumaran et al. has demonstrated that overexpression of the CD44s variant increases trans-well Matrigel invasion in SKOV-3 cells, and down-regulation of CD44 by shRNA decreases trans-well Matrigel invasion in SKA cells334. However, in their studies, the pro-invasive effects were related to the CD44s variant, whereas the TaqMan assay, antibody and siRNA used in our studies targets both CD44s and CD44v, which could have contradictory effects on cellular functions231. These divergent findings could also be explained by differing concentrations of Matrigel, leading to altered adhesive characteristics, though Muthukumaran et al. did not report the concentration of Matrigel used in their studies334. Another possible explanation is that we only investigated the invasion-suppressive function of CD44 in OVCAR-5 cells. It is possible that there are different biological backgrounds, such as mutations and copy number changes, in these cell lines (i.e. OVCAR-5 vs. SKOV-3 and SKA).                In our present studies, we used force expression and knockdown techniques to show that HOXB4 is a positive regulator of CD44 expression in OVCAR-8, CaOV-3 and OVCAR-5 cells. 86  The importance of CD44 for HOXB4-regulated invasion was demonstrated using siRNA and a function blocking antibody targeting CD44, and is suggested by a lack of response in A2780 cells which lack CD44 expression. CD44 can be regulated in several ways. For example, alternative splicing of CD44 variants can be regulated by RAS266. Also, soluble CD44 can be generated via cleavage by ADAM-like proteins and MMPs267–269. Soluble CD44 has been shown to inhibit tumor behavior by blocking binding with hyaluronan270. Consistent with our findings, HOXB4 is a positive regulator of CD44 in a human embryonic stem cell line272. In contrast, enforced expression of HOXB4 in keratinocytes suppresses CD44 as well as cell-plastic adhesion271. Together, these studies suggest that CD44 is a common downstream target of HOXB4, but that tissue-specific collaborators and cofactors determine whether the influence of HOXB4 is positive or negative51. Future studies will be required to examine the precise molecular determinants of HOXB4-mediated regulation of CD44 in different cellular contexts.               Though we found that suppression of CD44 (by siRNA or a function-blocking antibody) can reverse the repression of Matrigel invasion by HOXB4, we also observed apparent pro-invasive effects of HOXB4 when CD44 function was ablated (Figures 4.6). These findings are similar to the pro-migratory effects observed in A2780 cells, in which there is no detectable CD44 mRNA, and suggest that CD44 might modify the function of HOXB4 in ovarian cancer cells. Future studies testing this hypothesis could examine whether CD44 overexpression would be sufficient to establish invasion suppressive functions for HOXB4 in A2780 cells.                The mechanism involved in the CD44-mediated suppression of Matrigel invasion remains unclear. Though we do know that hyaluronan, the classic ligand of CD44, is not a component of Matrigel281,282,308, CD44 still can bind with other ligands such as laminin and type IV collagen331,226. Therefore, the function of CD44 might be through adhesion to these 87  alternative ligands. Further, our gene expression microarray experiments in HOXB4 overexpressing OVCAR-5 cells demonstrated that the expression of several metalloproteinases were changed by HOXB4, though some of them were at borderline significance. Also, in Chapter 3, we demonstrated that the MMP inhibitor GM6001 also blocked siHOXB4-induced Matrigel invasion in ovarian cancer cells, suggesting that MMPs or other Matrigel degrading enzymes may contribute to the function of CD44 in ovarian cancer cells. Consistent with our findings, some studies have reported that MMPs can regulate CD44 function by cleaving the extracellular domain of CD44 protein335. Therefore our MMP inhibitor trans-well invasion and gene expression microarray experiments raise the possibilities that HOXB4 might regulate the activation, distribution or recycling of those ECM adhesive enzymes, which, in turn, contribute to the invasion-suppressive function of HOXB4 via interaction with CD44.                We demonstrated that HOXB4 is a positive regulator of CD44 expression in ovarian cancer cells in which we find the invasion-suppressive function of HOXB4 (OVCAR-8, CaOV-3 and OVCAR-5 cells). However, HOXB4 did not regulate the mRNA levels of CD44 in OE-E6/E7 cells, suggesting that the invasion-suppressive function of HOXB4 in this line is not mediated by CD44. This disparity could be related to differences in the transcriptional environment between normal and cancer cells, where a number of factors have been altered during carcinogenesis to acquire tumor-related properties. In that scenario, different collaborators and cofactors facilitate HOXB4 regulating its downstream targets in different tissues51. It is also in agreement with A2780 cells, where HOXB4 has a pro-migratory role and no CD44 expression.  88                Overall, our studies demonstrate that the invasion suppressive effect of HOXB4 is mediated, in part, by the adhesion molecule CD44. These effects of CD44 could require basal MMP activity, and CD44 itself may exert reciprocal effects on the functionality of HOXB4.                                     89   Figure 4.1 Eight differentially-expressed gene transcripts were assessed by real-time PCR analysis in OVCAR-5 cells Real-time PCR was performed using TaqMan assays specific for these gene transcripts. PCR results confirmed that six gene transcripts were indeed differentially expressed between vector- and HOXB4-expressing OVCAR-5 cells, as observed in our gene expression microarray. Results are presented as mean ± SEM from three independent experiments with triplicate PCR analyses the fold changes of mRNA levels relative to vector control. The comparative Cq(2−ΔΔCq) method with GAPDH as the reference gene was used in this study. One-way ANOVA method followed by Tukey’s test was used to test the differences between vector or HOXB4 overexpressing OVCAR-5 cells. *P < 0.05, **P< 0.01, ***P< 0.001        90   Figure 4.2 Eight differentially-expressed gene transcripts were tested by real-time PCR analysis in OVCAR-8 and CaOV-3 cells Real-time PCR was performed using TaqMan assays specific for these gene transcripts. A. PCR results showed that ADRB2 and CD44 were differentially expressed between siCtrl (control siRNA) and siHOXB4 treated OVCAR-8 cells. B. PCR results confirmed that CD44 mRNA levels were differentially expressed between siCtrl (control) and siHOXB4 treated CaOV-3 cells. Results are presented as mean ± SEM from three independent experiments with triplicates PCR analyses by the fold changes of mRNA levels relative to siCtrl. The comparative Cq(2−ΔΔCq) method with GAPDH as the reference gene was used in this study. One-way ANOVA method followed by Tukey’s test was used to test the differences between siCtrl (control siRNA) and siHOXB4 treated OVCAR-8 and CaOV-3 cells. *P < 0.05, **P< 0.01, ***P< 0.001        91   Figure 4.3 HOXB4 regulates the expression of CD44 protein in ovarian cancer cells CaOV-3 cells were transfected and then cultured for two days with Lipofectamine alone (iMAX), control siRNA (siCon) or HOXB4 siRNA (siB4). A. Representative blotting showed CD44 and HOXB4 protein examined by Western blot in CaOV-3 cells. B. Representative blotting showed CD44 and HOXB4 protein levels examined in Control (vector) and HOXB4 (HOXB4) overexpressing OVCAR-5 sublines. C and D. Quantitative analysis of Western blotting results are present as the fold change relative to siCon (mean ± SEM) from three independent experiments. One-way ANOVA followed by Tukey’s test was used to examine the different expression of CD44 protein. Values that are statistically different from one another (P < 0.05) are indicated by different letters.  92   Figure 4.4 HOXB4 does not regulate the expression of CD44 in OE-E6/E7 cells OE-E6/E7 cells were transfected and then cultured for two days with Lipofectamine alone (iMAX), control siRNA (siCon) or HOXB4 siRNA (siB4). Then HOXB4 mRNA (A) and CD44 mRNA (B) levels were analyzed by RT-qPCR in OE-E6/E7 cells. Results were present as the fold changes of mRNA levels relative to siCtrl (mean ± SEM) from three independent experiments with triplicate PCR analyses. The comparative Cq(2−ΔΔCq) method with GAPDH as the reference gene was used in this study. One-way ANOVA method followed by Tukey’s test was used to test the differences between siCtrl (control siRNA) and siHOXB4 treated OE-E6/E7 cells. Values that are statistically different from one another (P < 0.05) are indicated by different letters.       93   Figure 4.5 Down-regulation of CD44 expression increases cell invasion in OVCAR-5 cells OVCAR-5 cells were transfected and then cultured for two days with Lipofectamine alone (iMAX), control siRNA (siCon) or CD44 siRNA (siCD44). A. western blot analysis showed CD44 protein levels. Cells were trypsinized and seeded in Matrigel coated trans-well inserts and then cultured for a further one day. Invading cell nuclei were stained with Hoechst and counted using fluorescence microscopy. At least 5 random fields of the inserts were counted and 100 cells were included. B. Representative Fluorescence images of the invading OVCAR-5 cells. Scale bar represents 100 µm; C. Histogram showed the invading cells compared to siCon in OVCAR-5 cells. Results are presented as mean ± SEM from at least three independent experiments with triplicate inserts. Data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. 94   Figure 4.6 HOXB4 suppressed invasion of ovarian cancer cells is reversed by siRNA mediated down-regulation of CD44 Control (Vector) and HOXB4 (HOXB4) expressing OVCAR-5 sublines were transfected and then cultured for two days with control siRNA (siCon), or CD44 siRNA (siCD44). A. Western blot analysis showed CD44 and HOXB4 protein levels. Cells were trypsinized and seeded in trans-well inserts coated with Matrigel, and then cultured for a further one day. Invading cell nuclei were stained with Hoechst and counted using fluorescence microscopy. At least 5 random fields of the inserts were counted and 100 cells were included. B. Representative fluorescence images of invading cells. Scale bar: 100 µm. C. Histogram showed the invading cells compared to siCon treated vector expressing OVCAR-5 cells. Results are presented as mean ± SEM from at least three independent experiments with triplicate inserts. Data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. Values that are statistically different from one another (P < 0.05) are indicated by different letters. A. western blot analysis showed HOXB4 and CD44 protein levels.  95   Figure 4.7 HOXB4 suppressed invasion of ovarian cancer cells is reversed by CD44 functional blocking antibody (clone 5F12) HOXB4 (HOXB4) and control (Vector) expressing OVCAR-5 sublines were trypsinized, and then incubated for 30 mins with either control antibody (IgG1) or CD44 functional blocking antibody (CD44) at 15 µg/ml. Cells were seeded in trans-well inserts coated with Matrigel and invasion was measured after one day. A. Representative fluorescence images of invading cells. Scale bar: 100 µm. B. Histogram showed the invading cells compared to IgG1 treated vector expressing OVCAR-5 cells. Results are presented as mean ± SEM from at least three independent experiments with triplicate inserts. Data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. Values that are statistically different from one another (P < 0.05) are indicated by different letters.  96  Chapter  5: Expression of HOXB4 in Putative Sources and Tissue Microarray (TMA) of Ovarian Carcinomas 5.1 Rationale                HOXB4 mRNA levels are higher in SMOV2, ES-2, SKOV-3, and CaOV-3 cells than in normal ovary tissue30. Hong et al. also reported higher expression levels of HOXB4 mRNA and protein in SKOV-3, OV90, SW626 and TOV21G cells compared with normal ovaries, and showed strong expression of HOXB4 protein in serous ovarian carcinomas (number of samples not specified) compared to negative staining of normal ovary by IHC207. However, Morgan et al. showed that SKOV-3 cells have lower HOXB4 mRNA levels than normal ovary, while the HOXB4 mRNA levels in OV-90 cells were similar to normal ovary208. In addition, although Hong et al. report an absence of staining for HOXB4 in normal ovarian epithelium, the images presented appear to be of ovarian stroma and do not contain normal ovarian epithelium. Moreover, the serous papillary ovarian carcinoma samples used for IHC were not described in any way, including the number of samples analyzed207. Thus, to date, there are no publications examining the expression and clinical significance of HOXB4 in a large cohort of human ovarian carcinomas.                Having identified an invasion-suppressive function for HOXB4 in ovarian cancer cell lines, we next used TMA analysis to examine the clinical relevance of HOXB4 in ovarian cancer. For these IHC analysis we validated a monoclonal rabbit antibody against HOXB4 (#2096-1, Epitomics), the specificity of which was established in both HOXB4 knockdown and overexpressing cell lines. We used this antibody to stain OSE, fimbrial epithelium of fallopian tube, and two ovarian cancer cohorts, Tumor Bank Array and CBOCOU Array (moderate & high 97  risk; study number: CB-74) from Cheryl Brown Ovarian Cancer Outcomes Unit, which is an ovarian cancer database of the British Columbia Cancer Agency (BCCA).  5.2 Antibody Validation by Immunocytochemistry of Ovarian Cancer Cell Lines                To validate the monoclonal rabbit antibody against HOXB4 (#2096-1, Epitomics) for immunohistochemistry (IHC), we performed immunocytochemistry (ICC) with varying concentrations of this HOXB4 antibody in OVCAR-8 cells, which have high HOXB4 expression by both RT-PCR and Western blot. OVCAR-8 cells appeared nuclear intense immunostaining even at low antibody concentrations (Figure 5.1). This nuclear staining pattern was to be expected because HOX genes function as transcription factors in development and oncogenesis58. Consistent with the expression pattern in the ovarian cancer cells by Western blot analysis and RT-PCR, HOXB4 immunostaining was high in A2780 and OVCAR-8 cells, moderate in CaOV-3 cells and absent from OVCAR-5 cells (Figure 5.2).                Having previously demonstrated high efficiency knockdown of HOXB4 in OVCAR-8 cells (Figure 3.2), we used siHOXB4 treatment to further confirm the specificity of this monoclonal HOXB4 antibody. Following treatment with HOXB4 siRNA for two days, HOXB4 immunoreactivity was absent from virtually all cells. In addition to confirming the high efficiency knockdown of HOXB4 in OVCAR-8 cells, these attest to the specificity of the monoclonal rabbit HOXB4 antibody (Figure 5.3).  5.3 Immunostaining of HOXB4 in Fimbrial Epithelium and OSE               Fimbrial epithelium of fallopian tubes is believed to be a source of high-grade serous ovarian carcinomas35,41, however the expression of HOXB4 in this epithelium is unknown. We used Western blot analysis to examine the protein levels of HOXB4 in fallopian tube fimbria (FTF) and immortalized human fallopian tube epithelial cells (OE-E6/E7). We found FTF and 98  OE-E6/E7 lysates expressed high levels of HOXB4 protein when compared to three ovarian cancer cell lines with varying HOXB4 expression levels (OVCAR-8, high; CaOV-3, medium; OVCAR-5, negative) (Figure 5.4).               Having confirmed elevated HOXB4 levels in Fallopian tube fimbria and OE-E6/E7 cells, we next performed IHC on sections of three fallopian tube fimbria (case number: VOA-713, 725 and 610) to determine which cell types express HOXB4. In the fimbria, HOXB4 immunostaining was predominately expressed of the secretory cells, while weak positive staining was observed in ciliated cells. No cytoplasmic or stromal staining was observed (Figure 5.5).                 Because the ovarian surface epithelium (OSE) may also be a putative source of some forms of ovarian cancer32, we immunostained sections from one normal ovary as well. Surprisingly, there was no staining signal either in the OSE or in stromal cells (Figure 5.6).  5.4 IHC for HOXB4 on TMA of Ovarian Carcinomas               We used the monoclonal rabbit HOXB4 antibody to stain Tumor Bank array (445 cases) and Cheryl Brown Ovarian Cancer Outcomes Unit CBOCOU array (612 cases) slides containing malignant, borderline and benign ovarian tumors, using normal fallopian tube fimbrial tissues as a positive control. Almost half of the tumors did not stain, however samples with positive staining typically displayed nuclear staining in well-structured epithelial cells. In addition, this very clear nuclear staining had variable intensities between tumors, and the cytoplasm and stroma were rarely stained. Based on these nuclear staining patterns of HOXB4, we set up 4 levels of staining intensities in the nuclei, from no staining, mild, intermediate, to high staining (Figure 5.7). For the analysis, we counted more than or equal to 20% of cells staining intermediate or high as positive (1), and the remaining samples as negative (0).  99  5.4.1 Analysis of HOXB4 expression in the Tumor Bank Array               This TMA included 445 cases but, once the analysis was confined to ovarian carcinomas and samples without missing cores, the final results pertained to 263 cases. In this cohort, most cases were scored as 0 of HOXB4 staining; only 28 of 263 ovarian carcinomas were HOXB4 positive (i.e. more than 20% intermediate or high staining; Table 5.1). These included 1 of 24 (4.17%) clear cell, 2 of 25 (8%) endometrioid, 23 of 192 (11.98%) high-grade serous, 1 of 9 (11.11%) low-grade serous, and 1 of 7 (14.29%) undifferentiated ovarian carcinomas. None of the 6 mucinous ovarian carcinomas studied had positive HOXB4 staining. Table 5.1 HOXB4 staining in Tumor Bank Array of ovarian carcinomas Histological Subtype HOXB4 Positive/Total % Clear cell 1/24 4.17 Endometrioid 2/25 8 High-Grade Serous 23/192 11.98 Low-Grade Serous 1/9 11.11 Mucinous 0/6 0 Undifferentiated 1/7 14.29 Total 28/263 10.65               Because of the low sample numbers for clear cell, endometrioid, low-grade serous, mucinous, and undifferentiated carcinomas, the contingency and survival analyses were only performed with high-grade ovarian carcinomas. The contingency analysis of HOXB4 by FIGO stage (Table 5.2) in high-grade serous carcinomas showed borderline level of significance, suggesting that loss of HOXB4 might be associated with late stage (stage IV) disease, though the p value was not significant (Likelihood ratio, p=0.0685). However, there was no correlation 100  between HOXB4 staining and the grades of high-grade serous carcinoma in this array (Likelihood ratio, p=0.3361; Table 5.3).  Table 5.2 Contingency analysis of HOXB4 by FIGO stage in HGSC (Tumor Bank Array) FIGO Stage HOXB4 Positive/Total % I 1/9 11.11 II 2/17 11.76 III 20/139 14.39 IV 0/25 0 Total 23/190 12.11 Likelihood ratio, p=0.0685 Table 5.3 Contingency analysis of HOXB4 by review grade in HGSC (Tumor Bank Array) Grade HOXB4 Positive/Total % 2 7/44 15.91 3 15/144 10.42 Total 22/188 11.70 Likelihood ratio, p=0.3361               We performed Kaplan-Meier survival curve of stage I-IV HGSC patients (Figure 5.8 A) and we observed no significant differences between HOXB4 positive and negative expression samples (p=0.1073). Also because of the limited case numbers and better survival of stage I and II in high-grade serous ovarian carcinomas in this array, we excluded early stages (stage I and II) from the survival analysis. From our results, HOXB4 positive tumors appeared to have better survival, though Kaplan-Meier analysis showed the expression of HOXB4 in advanced stages (stage III and IV) of high-grade serous ovarian carcinomas did not correlate with the disease specific survival of patients (Figure 5.8 B), statistical significance was of borderline level (Log-rank, p=0.0906).  101  5.4.2 Analysis of HOXB4 expression in CBOCOU Array                This cohort contains 612 cases but, once the analysis was confined to ovarian carcinomas and samples without missing cores, the final results pertained to 497 cases.  Similar to the Tumor Bank Array, most cases in the CBOCOU Array stained negative for HOXB4 and only 58 of 497 samples were HOXB4 positive. These included 10 of 131 (7.63%) clear cell, 12 of 124 (9.68%) endometrioid, 29 of 199 (14.57%) high-grade serous, and 7 of 12 (58.33%) low-grade serous ovarian carcinomas. Contingency analysis of HOXB4 by revised tumor subtype was significant (Likelihood ratio, p<0.0001; Table5.4), suggesting that HOXB4 is differentially expressed among ovarian carcinoma subtypes. Most notably, all 31 cases of mucinous ovarian carcinomas displayed negative HOXB4 staining, which was consistent with negative staining in all 6 mucinous ovarian carcinomas in the Tumor Bank Array (Table 5.1).  Table 5.4 Contingency analysis of HOXB4 by primary cell type in CBOCOU Array Primary Cell Type HOXB4 Positive/Total % Clear Cell 10/131 7.63 Endometrioid 12/124 9.68 Mucinous  0/31 0 High-Grade Serous 29/199 14.57 Low-Grade Serous 7/12 58.33 Total  58/497 11.67 Likelihood ratio: p<0.0001                           We performed contingency analyses with clear cell, endometrioid, and high-grade serous ovarian carcinomas. Contingency analysis of HOXB4 by FIGO stage in clear cell carcinomas (Table5.5) showed no significant associations between HOXB4 staining and stage (Likelihood ratio, p=0.2838) in this array. Likewise, contingency analyses of HOXB4 by FIGO 102  stage in endometrioid (Table5.6) and high-grade serous carcinomas (Table5.7) did not show significant associations. Contingency analyses of HOXB4 by review grade in endometrioid (Table5.8) and high-grade serous carcinomas (Table5.9) did not show significant associations either. We did not perform contingency analysis for HOXB4 by review grade in clear cell carcinomas because all the clear cell carcinomas were considered as grade 3 tumors.    Table 5.5 Contingency analysis of HOXB4 by FIGO stage in CCC (CBOCOU Array) FIGO Stage HOXB4 Positive/Total % I 7/67 10.45 II 2/56 3.57 III 1/8 12.50 Total 10/131 7.63 Likelihood ratio, p=0.2838 Table 5.6 Contingency analysis of HOXB4 by FIGO stage in EC (CBOCOU Array) FIGO Stage HOXB4 Positive/Total % I 5/69 7.25 II 7/49 14.29 III 0/6 0 Total 12/124 9.68 Likelihood ratio, p=0.2489 Table 5.7 Contingency analysis of HOXB4 by FIGO stage in HGSC (CBOCOU Array) FIGO Stage HOXB4 Positive/Total % I 10/49 20.41 II 12/85 14.12 III 7/65 10.77 Total 29/199 14.57 Likelihood ratio, p=0.3588 103  Table 5.8 Contingency analysis of HOXB4 by review grade in EC (CBOCOU Array) Grade HOXB4 Positive/Total % 1 9/81 11.11 2 2/35 5.71 3 1/8 12.50 Total 12/124 9.68 Likelihood ratio, p=0.6136 Table 5.9 Contingency analysis of HOXB4 by review grade in HGSC (CBOCOU Array) Grade HOXB4 Positive/Total % 2 7/56 12.50 3 22/143 15.38 Total 29/199 14.57 Likelihood ratio, p=0.5993               We also performed overall and disease specific survival analyses in clear cell (Figure 5.9), endometrioid (Figure 5.10), and high-grade serous carcinomas (Figure 5.11). There were no significant correlations between HOXB4 staining and overall or disease specific survivals in clear cell, endometrioid or high-grade serous carcinomas. In order to avoid the low stages interfering with prognosis, we performed the overall and disease specific survival analyses with high stage (stage III, no IV in this array) high-grade serous carcinomas. However, neither of them showed significant associations between HOXB4 staining and patient survivals (Figure 5.12).   5.5 Discussion                HOX genes have been intensively studied in the progression of leukemogenesis. Intriguingly, HOXB4 increased the self-renewal of hematopoietic stem cells without disrupting normal lineage-specific differentiation compared with other leukemogenic HOX genes161. 104  Though studies in large animals suggest that forced expression of HOXB4 results in a high-incidence of leukemia180, clinical analyses of HOXB4 expression in acute myeloid leukemia demonstrated better overall survival and a lower multidrug resistance gene levels (ABCB1) in patients with elevated HOXB4 mRNA levels336.                In our present studies, normal human OSE stained negative for HOXB4. Previous studies by Yamashita et al. found little or no expression of HOXB4 mRNA in homogenized normal whole ovary by real-time PCR30. However, we cannot eliminate the possibility that the OSEs (small amount of whole ovary) might express HOXB4, but that expression is diluted by the whole ovary extract. Also, Hong et al. found there was no HOXB4 staining in normal ovarian tissue by IHC207, which agrees with our study, though we cannot tell which cells are the OSE in IHC images they provided and the specificity of the antibody they used for ICC and IHC is doubtful207. Although another study showed higher HOXB4 mRNA levels in normal ovary than SKOV-3 cells, which is inconsistent with our, Yamashita’s, or Hong’s studies, also they did not show the sequences of primers in RT-PCR208. Thus, from their results we cannot eliminate the possibility that the specificity of the primers is suspect. However, the limitation of our studies is that we only stained one ovary sample. Therefore, to get more ovary samples tested is one of our future studies.               Also, the absence of HOXB4 staining in OSE by IHC does not agree with our cultured cell results showing normal OSE and IOSE cells to express mild to intermediate levels of HOXB4 protein. This might be due to the in vitro culture system inducing the expression of HOXB4. First, the IOSE cells are immortalized by simian virus 40 large T/small t antigens273 through impairing the function of TP53 and Rb, while increasing pp2A337. The immortalization of these normal cell lines might contribute to the expression of HOXB4. However, our Western 105  blotting showed intermediate to high level of HOXB4 protein in non-immortalized OSE cells and fimbrial epithelium, in which there is wild type TP53 expression. In this situation, we cannot simply explain that HOXB4 is induced by cell immortalization. Such a discrepancy might also arise from factors in FBS such as the growth factors and/or calcium concentrations. Though we did not test the expression of HOXB4 in different culture conditions, the mRNA expression of HOXA4 in OSE can be up-regulated by EGF treatment and in a low calcium concentration196. Also the OSE cells we observed in our IHC study are on the surface of ovary, and we do not know whether the OSE in the inclusion cysts of the ovary shows negative staining of HOXB4, in which the OSE cells are thought to be in a growth factor rich environment32.                Another possibility might be that the cells were cultured in the plastic dishes in our in vitro culture system instead of being surrounded by their in vivo extracellular matrix (ECM), which can be important for cells to maintain their tissue-specific characteristics298,299. In our culture system, the cells might lose the contact with the ECM, which might induce the differentiation of cells. Since HOX genes are thought to be the key regulators in differentiation, it raises another possibility that loss of ECM could induce the expression of HOXB4 in our cultured cells. Considering that nine out of twelve ovarian cancer lines we tested showed positive HOXB4 protein expression (intermediate to high), whereas only ~11% of ovarian carcinoma samples exhibited positive HOXB4 staining in TMA studies, the in vitro culture system might also increase HOXB4 expression in the cancer lines. Nevertheless, the TMA does show that some tumors do have high HOXB4 expression. Therefore, we cannot eliminate the possibility that the patient samples used to set up these ovarian cancer cell lines might have high HOXB4 expression.  106                Fallopian tube fimbrial epithelium, especially the secretory cells, is thought to be one of the sources of high grade serous ovarian carcinomas6,7,15,35,41. We also observed high HOXB4 staining in the fallopian tube fimbrial epithelium, especially in the secretory cells. Though we only checked the protein expression level of one sample of fimbrial tissue lysate and stained three samples of fimbrial epithelium, the high HOXB4 protein levels are consistent with what we observed in OE-E6/E7 cells, which is considered to be derived from secretory cells of the fallopian tube fimbria. It would be of interest to determine whether the expression pattern of HOXB4 is altered in different menstrual phases.               Hong et al. found that there was primarily cytoplasmic staining of HOXB4, with some peri-nuclear staining, in ovarian cancer tissues as well as in four ovarian cancer cell lines207. However, in our present study, we found HOXB4 was mainly expressed in the nuclei of the carcinoma cells of patients and rarely expressed in the nuclei of stromal cells and cytoplasm of tumor cells. This is correlated with the function of HOXB4 as a transcription factor in cells, which should be mainly localized in the nuclei. However, we did find there were small amount of HOXB4 staining in the cytoplasm of CaOV-3 cells, and this was the only cytoplasmic staining we found by this rabbit monoclonal antibody (1:1600 dilution; #2096-1, Epitomics). We did a number of experiments to validate the specificity of this rabbit monoclonal antibody in Western blotting by either overexpression or siRNA knockdown approaches which we showed in Chapter 3. In addition, we also validated this antibody in several ovarian cancer lines with different HOXB4 protein levels and with down-regulated HOXB4 expression by ICC. The goat polyclonal antibody (N-18, Santa Cruz) Hong et al. used for study is the same one we used to test the HOXB4 protein levels in ovarian cancer lines and the specificity of this antibody for Western blotting has been validated by our study (Chapter 3). Though the major band is 107  siHOXB4 sensitive, we deemed it unsuitable due to low staining intensity and the presence of additional weaker bands. However, in Hong’s study, they also used this antibody for ICC and IHC , and they did not show any validation data for the specificity of this goat polyclonal anti-HOXB4 antibody for ICC or IHC207. Although they demonstrated that SW-626 expressed higher HOXB4 protein levels than OV-90 by Western blotting, which was similar to the HOXB4 mRNA levels in these two cancer lines207, SW-626 showed weaker HOXB4 staining than OV-90 in the ICC data207. However, this might be explained by differences in antibody binding with denatured linear protein in the Western blot vs. intact tissue after antigen-retrieval. Moreover, Hong et al. did not indicate the number of cases examined by IHC, nor did they specify whether those samples were high- grade or low-grade serous carcinomas.               Our study is the first to examine the HOXB4 expression patterns in two different tissue microarrays with a large number of ovarian cancers of different subtypes. Also, our study is the first to look at associations with clinical parameters (i.e. stage, grade, survival). In both arrays, we found less than twelve percent of ovarian carcinoma samples positively stained by HOXB4. Combined with the invasion-suppressive functional study we have shown in cancer lines, loss of HOXB4 expression from the fimbiral secretory cells (strong HOXB4 staining) to HGSC (loss than 15% positive HOXB4 staining) in both TMAs suggests that HOXB4 might exhibit suppression effects on ovarian cancer progression. Also, our studies showed that in the CBOCOU array, the expression of HOXB4 was differentially expressed in ovarian cancer subtypes and this observation was significant (p<0.0001). Though the contingency analysis of subtypes by HOXB4 in Tumor Bank array did not show any significance, this difference might because the small sample sizes of other subtypes (clear cell, endometrioid, mucinous, and low-grade serous carcinomas). Notably, none of the mucinous ovarian carcinomas had HOXB4 108  expression in both arrays. According to our results, HOXB4 might be a novel molecular marker to distinguish the different subtypes of ovarian carcinomas especially to exclude mucinous carcinomas. However, the limitation of our studies is small number of cases in mucinous carcinomas; therefore examination of the expression of HOXB4 in a larger number of mucinous carcinomas would be required to further studies.              In the Tumor bank array, which consists of 445 cases, most cases are high-grade serous carcinomas in the range from stage I to stage IV (FIGO) and mostly in stage III & IV. The contingency analysis of high-grade serous carcinomas by stages showed borderline statistical difference (p=0.0685), suggesting that the absence of HOXB4 staining might be related to higher stage, especially stage IV. Relatively low case numbers for stage I and stage II in the Tumor Bank Array might contribute to the lack of statistical significance. Moreover, while the CBOCOU array contained a sizeable cohort of stage I and II samples, it did not contain any stage IV samples.                We also performed disease specific survival analysis of HOXB4 in the Tumor Bank array. We found encouraging results (p=0.0906) consistent with the protective function of HOXB4 identified in our cell line functional studies, though they did not reach statistical significance. However, in the CBOCOU Array, the disease specific survival of patients with advanced stage (only stage III, no stage IV included in this array) high-grade serous ovarian carcinomas were not influenced by HOXB4 status. This might be due to the increased samples in stage I & II and a small number of samples with HOXB4 positive staining (only seven cases). In contrast, the Tumor Bank array analysis has a larger sample size for stage III & IV HGSC, even though the overall sample size of HGSC are similar in these two arrays. The prognosis of ovarian cancer is influenced by a number of factors such as neoadjuvant chemotherapy, tumor residua 109  after surgery, and the micro environment surrounding the tumors, etc23,338. The limitation of the Tumor Bank array study is that we did not exclude the patients with neoadjuvant chemotherapy because of small number of cases with positive HOXB4 staining. Although the CBOCOU array contains reasonable number of cases in each main subtype and the patients have the optimal debulking surgery without neoadjuvant chemotherapy, there are no stage IV tumors included especially in the HGSC. Therefore, considering the invasion-suppressive function of HOXB4 we have determined in the cancer lines, it might be premature to conclude that HOXB4 has no function in ovarian carcinoma. A further study of HGSC in a large case number in stage IV disease might be required to determine the relation between HOXB4 and patients prognosis.                        110     Figure 5.1 Immunostaining of HOXB4 in ovarian cancer cell line OVCAR-8 OVCAR-8 cells were seeded in the cell culture chamber slides and then cultured for one day. Cells were fixed and immunostained by an monoclonal HOXB4 antibody at serial dilutions from 1:100 (A), 1:200 (B), 1:400 (C), 1:800 (D), 1:1600 (E), to 1:3200 (F); G: (-) showed no primary antibody staining. Antibody staining is brown. (40×, scale bar: 25μm).    111          Figure 5.2 Variable expression of HOXB4 in ovarian cancer cell lines A2780 (A and E), OVCAR-8 (B and F), CaOV-3 (C and G), and OVCAR-5 (D and H) cells were seeded in the cell culture chamber slides and then cultured for one day. Cells were fixed and immunostained by either a monoclonal HOXB4 antibody at 1:800 dilutions or no primary antibody controls (-). Antibody staining is brown. (40×, scale bar: 25μm).  112      Figure 5.3 Immunostaining of siRNA mediated down-regulated HOXB4 in OVCAR-8 cells Following transfection for three days with Lipofectamine alone (iMAX), control siRNA (siCon) or HOXB4 siRNA (siB4), OVCAR-8 cells were seeded in the cell culture chamber slides and then cultured for a further one day. Cells were fixed and immunostained by a monoclonal HOXB4 antibody at 1:800 dilution. Antibody staining is brown. A: iMAX; B: siCon; C: siB4 showed protein levels of HOXB4 were efficiently down-regulated by siHOXB4; D: (-) showed no primary antibody staining (40×, scale bar: 25μm).  113     Figure 5.4 HOXB4 expression in fallopian tube fimbria and ovarian cancer cells Western blot analysis showed HOXB4 protein levels in ovarian cancer cell lines (OVCAR-8, OVCAR-3, and OVCAR-5), OE-E6/E7 cells and fallopian tube fimbria tissue lysate (FTF). Actin was probed by anti-actin goat polyclonal antibody after stripping the HOXB4 antibody. (n=1).           114      Figure 5.5 HOXB4 expression in fallopian tube fimbrial epithelium A. Section through normal human fallopian tube fimria stained without primary antibody was used as a negative control (No primary Ab). B. Sections through normal human fallopian tube fimria stained with HOXB4 antibody at 1:1600 dilutions: high staining in fimbrial epithelium, especially secretory cells (arrow); mild staining in the ciliated cells (arrowhead). (40×, scale bar: 25μm; insert 100×, scale bar: 10μm).        115   Figure 5.6 HOXB4 expression in normal ovarian tissue A. Section through normal human ovary stained without primary antibody was used as a negative control (No primary Ab). B. Sections through normal human ovary stained with HOXB4 antibody at 1:1600 dilutions: negative expression in both ovarian stromal tissue (S) and ovarian surface epithelium (arrow) (40×, scale bar: 25μm).           116   Figure 5.7 Examples of the four intensities used for scoring HOXB4 staining in the tissue microarrays. The staining showed intensity of HOXB4 in high-grade serous carcinomas of Tumor Bank array. The staining range is from no staining, mild, intermediate, to high staining of HOXB4 in the tumor cells. (40×, scale bar: 25μm)        117   Figure 5.8 Disease specific survival of HOXB4 staining in high-grade serous carcinomas in Tumor Bank array Kaplan-Meier disease specific survival curve showed HOXB4 staining in stage I-IV (A) and stage III and IV (B) high-grade serous ovarian carcinomas in the Tumor Bank array. Survival for patients having tumors with more than or equal to 20% of tumor cells showing intermediate to high staining of HOXB4 is depicted as HOXB4 positive, and survival for the remaining patients with tumors is shown as HOXB4 negative. Log-rank test was used to verify the significance of the difference in survival. p<0.05 was considered as statistical significance.          118   Figure 5.9 Survival curves of HOXB4 staining in CCC in the CBOCOU Array Kaplan-Meier overall (A) and disease specific (B) survival curves showed HOXB4 staining in clear cell ovarian carcinomas in the CBOCOU array. Survival for patients having tumors with more than or equal to 20% of tumor cells showing intermediate to high staining of HOXB4 is depicted as HOXB4 positive, and survival for the remaining patients with tumors is shown as HOXB4 negative. Log-rank test was used to verify the significance of the difference in survival. p<0.05 was considered as statistical significance.          119   Figure 5.10 Survival curves of HOXB4 staining in EC in the CBOCOU Array Kaplan-Meier overall (A) and disease specific (B) survival curves showed HOXB4 staining in endometrioid ovarian carcinomas in the CBOCOU array. Survival for patients having tumors with more than or equal to 20% of tumor cells showing intermediate to high staining of HOXB4 is depicted as HOXB4 positive, and survival for the remaining patients with tumors is shown as HOXB4 negative. Log-rank test was used to verify the significance of the difference in survival. p<0.05 was considered as statistical significance.          120   Figure 5.11 Survival curves of HOXB4 staining in HGSC in the CBOCOU Array Kaplan-Meier overall (A) and disease specific (B) survival curves showed HOXB4 staining in high-grade serous ovarian carcinomas in the CBOCOU array. Survival for patients having tumors with more than or equal to 20% of tumor cells showing intermediate to high staining of HOXB4 is depicted as HOXB4 positive, and survival for the remaining patients with tumors is shown as HOXB4 negative. Log-rank test was used to verify the significance of the difference in survival. p<0.05 was considered as statistical significance.          121   Figure 5.12 Survival curves of HOXB4 staining in stage III HGSC in the CBOCOU Array Kaplan-Meier overall (A) and disease specific (B) survival curves showed HOXB4 staining in stage III high-grade serous ovarian carcinomas in the CBOCOU Array. Survival for patients having tumors with more than or equal to 20% of tumor cells showing intermediate to high staining of HOXB4 is depicted as HOXB4 positive, and survival for the remaining patients with tumors is shown as HOXB4 negative. Log-rank test was used to verify the significance of the difference in survival. p<0.05 was considered as statistical significance.  122  Chapter  6: DNA Methylation Contributes to the Loss of HOXB4 Expression in Ovarian Cancer 6.1 Rationale                Epigenetic silencing of tumor suppressors is a common event in cancer development339. From our TMA studies, we found approximately fifty percent of high-grade serous ovarian carcinomas did not stain for HOXB4. In contrast, strong immunoreactivity for HOXB4 was observed in the fimbrial epithelium of fallopian tube, which is a putative source of high-grade serous ovarian carcinoma35,41. Moreover, we also demonstrated the invasion-suppressive function of HOXB4 in ovarian cancer cells. Therefore, we hypothesized that epigenetic silencing of invasion-suppressive HOXB4 might contribute to the loss of HOXB4 expression in ovarian cancers. DNA methylation is one of the most intensively studied epigenetic mechanisms in tumor biology85. DNA methyltransferases (DNMTs) can transfer a methyl group to the fifth carbon on a cytosine residue in CpG sites of newly synthesized DNA110. DNMT3A and DNMT3B are in charge of de novo DNA methylation92, while DNMT1 is responsible for the maintenance of DNA methylation340. 5-Aza-2’-Deoxycytidine (5-Aza-dC, Decitabine) is a cytosine analogue, which is incorporated into newly synthesized DNA in place of cytosine during the S phase of cell division110. Treatment of proliferating cells with 5-Aza-dC results in progressive demethylation of genomic DNA by preventing DNA methylation111. This occurs because, unlike the carbon in regular deoxycitidine, the nitrogen in 5-Aza-dC cannot accept a methyl group to release the covalently bonded DNMTs from DNA adducts112. Therefore, we treated ovarian cancer cells with 5-Aza-dC to investigate whether DNA methylation may contribute to the loss of HOXB4 expression in ovarian cancer.  123  6.2 HOXB4 Expression Is Restored by 5-Aza-dC Treatment                We treated OVCAR-5 cells for four days with varying concentrations of 5-Aza-dC (100, 200, 400 or 800nM) and measured HOXB4 mRNA levels by RT-qPCR. HOXB4 mRNA levels were significantly increased in a concentration-dependent manner after treatment with 5-Aza-dC (Figure 6.1 A). Also, we used another HOXB4 negative ovarian cancer line, IGROV-1 to confirm the finding we observed in OVCAR-5 cells. Similar to OVCAR-5 cells, treatment of IGROV-1 cells with 5-Aza-dC (62.5, 125, 250 or 500nM) for 5 days significantly increased HOXB4 mRNA levels (Figure 6.1 B). Consistent with the mRNA findings, HOXB4 protein levels were increased in a concentration-dependent manner in both OVCAR-5 and IGROV-1 cells following treatment with 5-Aza-dC (Figure 6.2).                Next, we treated OVCAR-5 cells for four days with 62.5nM 5-Aza-dC and examined HOXB4 mRNA levels each day. We found that HOXB4 mRNA levels were significantly increased, and that increases tended to be time-dependent (Figure 6.3 A). Similar results were observed when IGROV-1 cells were treated with 1µM 5-Aza-dC for 2, 3, 4 or 5 days (Figure 6.3 B). Furthermore, time-course studies in OVCAR-5 and IGROV-1 cells yielded 5-Aza-dC-induced increases in HOXB4 protein levels that had similar temporal patterns to those of HOXB4 mRNA (Figure 6.4).  6.3 Down-Regulation of DNMTs Does Not Restore HOXB4 Expression                Since HOXB4 expression in ovarian cancer cells was induced with treatment of 5-Aza-dC, which inhibits DNA methylation by trapping DNMTs in cells340, we hypothesize that down-regulation of DNMTs might also restore the expression of HOXB4. We used siDNMT1 (siRNAs sequences: Appendix B.6.) to decrease the expression levels of DNMT1 in OVCAR-5 cells for two to six days. However, despite substantial and sustained down-regulation of DNMT1 mRNA 124  levels, we did not observed any significant changes in HOXB4 mRNA levels at any time point (Figure 6.5).                   DNMT3A and DNMT3B play important roles in de novo methylation both in embryonic development and cancer83,92. Since 5-Aza-dC is not only an inhibitor of DNMT1 but also an inhibitor of DNMT3A and DNMT3B110,112,341, we manipulated the expression levels of DNMT3A/3B by treating OVCAR-5 cells with either siDNMT3A or siDNMT3B (sequences of siDNMT3A and siDNMT3B listed in Appendix B.7 and B.8) for 2-6 days. At the same time, to eliminate compensation between the two DNMT3s, we also treated OVCAR-5 cells with siDNMT3A and siDNMT3B together for 2-6 days. Although our preliminary experiments (n=1) showed 90% to 60% down-regulation of DNMT3A mRNA and 70% to 60% down-regulation of DNMT3B, none of the treatments could induce the expression of HOXB4 (Figure 6.6). Instead, HOXB4 mRNA levels appeared to decrease following knockdown of DNMT3A and/or DNMT3B. Also, we observed that DNMT3B mRNA levels were affected when we down-regulated DNMT3A mRNA levels alone, and vice versa.   6.4 Discussion                Epigenetic regulation of HOX genes is a common event in development and cancer formation144–146. HOXB4 expression can be induced in a human mesenchymal cell line by treatment with 5-Aza-dC and growth factors342. Also, HOXB4 has been shown to be a target of de novo methylation in a lung cancer cell line126. From Chapter 3 to Chapter 5, we have demonstrated the suppressive effect of HOXB4 on ovarian cancer cell invasion, the underlying mechanisms, and the loss-of-expression of HOXB4 from fallopian tube fimbria to the high-grade ovarian cancer samples. In our present study, we used 5-Aza-dC treatment to induce the expression of HOXB4 mRNA and protein in two HOXB4-negative cell lines (OVCAR-5 and 125  IGROV-1), and this regulation was both concentration- and time-dependent. Consistent with our findings, Shu et al. reported that expression of HOXB4 was inactivated by promoter hyper-methylation in extra hepatic cholangiocarcinoma, and this inactivation could be reversed by treatment with 5-Aza-dC137. Another study also demonstrated that the promoter region of HOXB4 was hypermethylated in primary thyroid cancers343. Therefore, hypermethylation of HOXB4 is not uncommon in carcinogenesis. However, the underlying mechanism of epigenetically deregulated HOXB4 is not clear. Indeed, either direct HOXB4 promoter hypermethylation or indirect effects on other hypermethylated genes could be involved in the restoration of HOXB4 expression following treatment with 5-Aza-dC. Future studies could include pyrosequencing to directly measure HOXB4 promoter methylation, both in cancer cell lines as well as clinical specimens.               5-Aza-dC treatment has been widely used to study DNA methylation in ovarian cancer cells and clinical studies83,344–347. The conventional dosing of 5-Aza-dC treatment in humans is ranging from 5-2000 mg/m2 and the estimated plasma concentration is 15-660 ng/ml (~0.06-2.64 µM)107,111,348. However, larger doses of 5-Aza-dC were associated with several side effects including arrested DNA synthesis and cytotoxicity107,110,116. Ovarian cancer cell lines have been treated with varying concentrations of 5-Aza-dC ranging from 0.5 to 10 µM in previous studies323–326. Staub et al. used 5-Aza-dC at 5 and 10 µM to treat SKOV3 cells, and 0.5-5 µM of 5-Aza-dC in OV207 cells; though OVCAR-5 cells were used in their studies, they did not show the exact concentration of 5-Aza-dC used in OVCAR-5 cells. In our studies, we treated OVCAR-5 cells with 5-Aza-dC at the concentration from 100 to 800 nM, which is likely to be smaller than Staub et al. used345. Also, Min et al. used 5 µM of 5-Aza-dC to successfully induce the expression of CD133 in IGROV-1 cells347. In our studies, we treated IGROV-1 cells with 5-Aza-126  dC at concentration from 62.5 to 500 nM, which is at least 10-fold lower than those used by Min et al. Therefore, from our studies, the induced expression of HOXB4 in ovarian cancer cells by 5-Aza-dC treatment is less likely due to a side effect of this drug at these very low concentrations. Indeed, induction of HOXB4 with treatment of 5-Aza-dC indicated that epigenetic regulation especially DNA methylation might be involved in HOXB4 regulation in ovarian cancer development.                Since 5-Aza-dC inhibits DNMTs by interfering  with the release of bonded DNMTs from DNA110,112,341, we tried to specify which DNMT is involved in maintaining the methylation of HOXB4 or HOXB4 regulatory factors.. In our present studies, siRNA-mediated down-regulation of DNMT1 in OVCAR-5 cells failed to restore HOXB4 expression.  However, we cannot exclude that DNMT1 is not involved in the silencing of HOXB4 in ovarian cancer cells. Because the knockdown efficiency of siRNA targeting DNMT1 in our study was roughly 70% even lower after transfection five or six days, which still leaves 30-40% DNMT1 expression. It is uncertain whether this amount of knockdown is sufficient to completely block the biological function of DNMT1. In addition, we only confirmed knockdown of DNMT1 at the mRNA level, thus we do not know its degree of knockdown at the protein level. Therefore, further studies need to be conducted to check the protein levels of DNMT1 after down regulation of DNMT1 by siRNA. Also, pyrosequnencing or methylation specific PCR is required to measure HOXB4 promoter methylation levels following down-regulation of DNMT1. Since Christman et al. provided the theoretical possibility that DNMT3A and DNMT3B can be inhibited by 5-Aza-dC110, we also performed preliminary experiments (one time) and observed decreased HOXB4 expression following siRNA-mediated down-regulation of DNMT3A and/or DNMT3B. These effects could be due to off-target effects of the DNMT3A and 127  DNMT3B siRNA, however future studies are required to confirm whether HOXB4 expression is suppressed by knockdown of DNMT3A and/or DNMT3B. As with siDNMT1, insufficient knockdown of DNMT3A/B and a lack of data for their protein levels may also explain these unusual findings. Another possible explanation for the inability of siDNMT1 or siDNMT3A/B to restore HOXB4 expression is compensation between DNMT1 and DNMT3A/B. In agreement with our studies, Han et al. reported that some miRNAs were regulated by double knockdown of DNMT1 and DNMT3b, but not by down-regulation of DNMT1 alone349. Future studies could examine whether combined knockdown of DNMT1 and DNMT3A/B is sufficient to induce HOXB4 expression in OVCAR-5 and IGROV-1 cells.               Taken together, our experiments demonstrate that 5-Aza-dC treatment induces HOXB4 expression in ovarian cancer cells in a concentration- and time- dependent manner. Methylation specific PCR or pyro-sequencing is needed to investigate the underlying mechanism (e.g. promoter methylation). Double or triple knockdown of DNMT1 and DNMT3s is needed to explore which DNMTs is involved in the methylation of HOXB4 in ovarian cancer cells.         128   Figure 6.1 HOXB4 mRNA expression is induced by treatment with 5-Aza-dC in a concentration-dependent manner on ovarian cancer cells OVCAR-5 and IGROV-1 cells were treated with 5-Aza-dC at different concentrations daily while being cultured for four days or five days respectively. Three separate experiments were performed on different cultures, and each sample was assayed in triplicate. A mean value (mean ± SEM) representing the fold change relative to Ctrl was used for the determination of HOXB4 mRNA levels in OVCAR-5 (A) and IGROV-1(B) cells. The comparative Cq(2−ΔΔCq) method with GAPDH as the reference gene was used in this study. One-way ANOVA method followed by Tukey’s test was used to test the differences among groups. Values that are statistically different from one another (P < 0.05) are indicated by different letters.  129   Figure 6.2 HOXB4 protein expression is induced by treatment with 5-Aza-dC in a concentration-dependent manner on ovarian cancer cells OVCAR-5 and IGROV-1 cells were treated with 5-Aza-dC at different concentrations while being cultured for four days or five days. A (OVCAR-5) and B (IGROV-1) show a representative Western blot of HOXB4 protein levels. C (OVCAR-5) and D (IGROV-1) show quantitative analysis of Western blotting results, which are presented as the fold change relative to Ctrl (mean ± SEM) from three independent experiments. One-way ANOVA followed by Tukey’s test was used to examine the different expression of HOXB4 protein. Values that are statistically different from one another (P < 0.05) are indicated by different letters.    130   Figure 6.3 HOXB4 mRNA expression is induced by treatment with 5-Aza-dC in ovarian cancer cells OVCAR-5 and IGROV-1 cells were treated with 5-Aza-dC at 0.625µM or 1µM daily while being cultured for four days or five days. Three separate experiments were performed on different cultures, and each sample was assayed in triplicate. A mean value (mean ± SEM) representing the fold change relative to DMSO at 1 day (OVCAR-5) or 2 days (IGROV-1) was used for the determination of HOXB4 mRNA levels in OVCAR-5 (A) and IGROV-1(B) cells. The comparative Cq(2−ΔΔCq) method with GAPDH as the reference gene was used in this study. One-way ANOVA method followed by Tukey’s test was used to test the differences among groups. Values that are statistically different from one another (P < 0.05) are indicated by different letters.      131   Figure 6.4 HOXB4 protein expression is induced by treatment with 5-Aza-dC in ovarian cancer cells OVCAR-5 and IGROV-1 cells were treated with 5-Aza-dC at 0.625µM or 1µM while being cultured for four days or five days. A. (OVCAR-5) and B (IGROV-1) show representative Western blots of HOXB4 protein levels. C (OVCAR-5) and D (IGROV-1) show quantitative analysis of Western blotting results (mean ± SEM), which are presented as the fold change relative to DMSO at 1 day (OVCAR-5) or 2 days (IGROV-1) from three independent experiments. One-way ANOVA followed by Tukey’s test was used to examine the different expression of HOXB4 protein. Values that are statistically different from one another (P < 0.05) are indicated by different letters.    132   Figure 6.5 Down-regulation of DNMT1 does not induce HOXB4 mRNA levels in OVCAR-5 cells OVCAR-5 cells were transfected with either control siRNA (siCon) or DNMT1 siRNA (siDNMT1) and then cultured for 2-6 days. The mRNA levels of DNMT1 (A) and HOXB4 (B) were quantified by RT-qPCR and are presented as fold changes relative to siCon (mean ± SEM). Three separate experiments were performed on different cultures, and each sample was assayed in triplicate. The comparative Cq(2−ΔΔCq) method with GAPDH as the reference gene was used in this study. One-way ANOVA method followed by Tukey’s test was used to test the differences among groups. Values that are statistically different from one another (P < 0.05) are indicated by different letters.     133   Figure 6.6 Down-regulation of DNMT3A and DNMT3B does not induce HOXB4 mRNA levels in OVCAR-5 cells OVCAR-5 cells were transfected for three, four, or six days with control siRNA (siCon), DNMT3A siRNA (siDNMT3A), DNMT3B siRNA (siDNMT3B), or DNMT3A and DNMT3B siRNAs together (si3A+si3B). RT-qPCR was used to measure the mRNA levels of DNMT3A (A), DNMT3B (B) and HOXB4 (C). Data from a single experiment with triplicate measurements is presented as fold changes (mean ± SEM) relative to siCon . The comparative Cq(2−ΔΔCq) method with GAPDH as the reference gene was used in this study. White bar: siCon; red bar: siDNMT3A; blue bar: siDNMT3B; grey bar: siDNMT3A+siDNMT3B.   134  Chapter  7: Conclusion and Future Directions 7.1 Overview               In epithelial ovarian cancer, deregulation of HOX genes plays critical roles in cancer development159. HOXA4 positively regulates motility and spreading of ovarian cancer cells but does not influence the invasiveness of ovarian cancer cells196,206. Studies of single and combined mutants of paralogous Hox genes have suggested that Hox paralogs can have complementary, overlapping, or synergistic functions in a particular tissue54–57. HOXB4, a paralog of HOXA4, has been shown to be expressed at higher levels in ovarian cancer cell lines and ovarian cancer tissue compared with normal ovary30,207. However, no publication has demonstrated the function of HOXB4 in ovarian cancer. Therefore, the studies described herein aimed to examine not only the expression of HOXB4 in normal tissues and ovarian cancer, but also to explore the functional roles of HOXB4 in ovarian cancer and identify potential molecular mechanisms.                First, we have demonstrated that HOXB4 does not influence ovarian cancer cell proliferation, but has suppressive effects on cell invasion and may influence cell migration. Second, we have demonstrated that CD44 is a down-stream target of HOXB4 that participates in the invasion-suppressive phenotype, and these effects may require basal MMP activity. Third, we found loss-of-expression of HOXB4 in a large number of HGSCs compared with normal fallopian tube fimbria, and demonstrated that hypermethylation might contribute to this loss-of-expression. Furthermore, histopathological analyses suggest that tumors that retain HOXB4 expression show a trend towards improved disease specific survival. Lastly, the expression and function of another group 4 HOX paralog, HOXC4, was examined in ovarian cancer cells; however, we did not did not find any effects on cell migration or invasion. 135  7.2 The Expression of HOXB4 in Ovarian Cancer               It has been previously reported That HOXB4 is differentially expressed in ovarian cancer cells compared with normal ovary30,207,208. Our study is the first to examine HOXB4 expression in an immortalized human fallopian tube epithelial cell line (OE-E6/E7), and we found HOXB4 protein levels were higher in OE-E6/E7 cells than in six out of nine ovarian cancer lines (OVCAR-2, OVCAR-4, OVCAR-5, CaOV-3, OVCAR-3, and SKOV-3). In Chapter 5, we found that HOXB4 has a strong nuclear staining pattern, suggesting its functional role as a transcription factor. Furthermore, we found high levels of HOXB4 in normal fallopian tube fimbrial tissue, whereas HOXB4 was absent from OSE in vivo. Both OSE and fallopian tube fimbria have been hypothesized to be putative sources of ovarian cancer41. In particular, the fimbrial epithelium of the Fallopian tube is believed to be a source of high-grade serous ovarian carcinoma25,35,220,350. Based on the expression of HOXB4 we observed in ovarian cancer cell lines, OSE and OE-E6/E7 cells, if one considers the OSE as the source of ovarian cancer and it is HOXB4 negative, then that implies the tumors have gained HOXB4 expression which would mean that HOXB4 might promote tumorigenesis. Alternatively, if one considers the fallopian tube fimbrial epithelium as the source of ovarian cancer it would suggest a tumor suppressive function for HOXB4. Indeed, the functional studies described in Chapter 3 provide strong support for a tumor suppressive role, which differs dramatically from the oncogenic role inferred by previous expression studies. Thus, our combined studies of HOXB4 expression and function have provided novel insights into the role of HOXB4 in ovarian cancer.               Our study is the first to examine the expression of HOXB4 in a large cohort of human ovarian carcinomas with survival data. We have found that ~50% of the ovarian carcinoma samples do not express HOXB4 and that HOXB4-positive high-grade serous carcinomas show a 136  trend towards better disease specific survival (Tumor bank Array). This result supports the invasion-suppressive role of HOXB4 in ovarian cancer cells. We have also found that HOXB4 might correlate with the stage of disease in high-grade serous carcinomas. Though it is of borderline significance, it suggests that HOXB4 expression might be associated with early stages, which is also in agreement with its suppressive effects on cell invasion. However, since stage is the most powerful prognostic indicator in ovarian carcinomas we must consider that a potential correlation with early stage disease could be driving the trend towards improved survival. Unfortunately, the absence of stage IV samples in the CBOCOU Array made it impossible to assess these relationships in the second cohort.               Furthermore, the CBOCOU Array results suggest that HOXB4 is differentially expressed in subtypes of ovarian carcinomas. However, we do not achieve significance in the Tumor Bank Array, likely due to the underrepresentation of non-serous subtypes in this array. In particular, none of 37 mucinous carcinomas in the two arrays shows HOXB4 staining, suggesting that HOXB4 might be a marker to distinguish the subtypes of ovarian cancers. 7.3 The Function of HOXB4 in Ovarian Cancer               Increasing evidence suggests that HOX genes exert regulatory roles in ovarian carcinogenesis30. Hoxa9, Hoxa10 and Hoxa11 can induce the differentiation of ovarian cancer in transgenic mice199. HOXB7 supports angiogenesis of ovarian neoplasms by up-regulating VEGF, IL-8 and other angiogenic factors185. Antisense down-regulation of either HOXB7 or HOXD13 significantly reduced the number of invading ovarian cancer cells30. Another study also reports that siHOXB13 treatment of human ovarian cancer cell lines is associated with decreased cellular proliferation205. Endogenous HOXA4 did not affect cellular proliferation, however it 137  suppressed the migratory activity196 of ovarian cancer cells by inhibiting the formation of filopodia and enhancing cell-cell adhesion206.               The results described in Chapter 3 show that HOXB4, a paralog of HOXA4, exerts suppressive effects on ovarian cancer cell invasion. Together with the migration-suppressive effects previously described for HOXA4, the present studies suggest that the group 4 HOX paralogs (HOXA4 and HOXB4) have complementary functional roles in regulating the metastatic capacity of ovarian cancer cells. These results support the notion that paralogous HOX genes can have complementary roles both in embryonic development and cancer progressions50,58,159. However, we found that another group 4 HOX paralog, HOXC4, does not affect either invasion or migration of ovarian cancer cells (Appendix A). This could be explained by functional redundancies or compensation by HOX genes in the same tissue50,58,159. However, it could also imply that the effects on migration/invasion don’t extend to all group 4 HOX paralogs. Furthermore, we discovered that this invasion-suppressive effect of HOXB4 in ovarian cancer is confined to Matrigel invasion, suggesting that these effects are related to Matrigel components (Laminin, type IV collagen, etc.) degrading enzymes and/or receptors. Interestingly, the invasion-suppressive effect of HOXB4 is blocked by GM6001 (MMP inhibitor), which suggests that MMPs might be required for the function of HOXB4 on ovarian cancer cells.                 In Chapter 4 we established CD44 as a downstream target of HOXB4 by a gene expression microarray analysis. The ability of HOXB4 to regulate CD44 is not uncommon. Consistent with our findings, HOXB4 is a positive regulator of CD44 in a human embryonic stem cell line272. Komuves et al. found that forced expression of HOXB4 down-regulated CD44 and β2 integrin in cultured keratinocytes, whereas CD44 was up-regulated in our system and there was no effect on β2 integrin271. This difference might be due to the tissue specificity of 138  HOX functions that different collaborators and cofactors facilitate HOXB4 regulating its downstream targets in different tissues51.               CD44 is a cell surface adhesion molecule whose biological function is complicated and depends on multiple factors. The major function of CD44 is through binding with extracellular matrix ligands such as hyaluronic acid, collagens, laminin and fibronectin226,238,239. The function of CD44 varies in ovarian cancer, with clinical studies showing inconsistent correlations between CD44 expression and patient prognosis230-232. Therefore, there are likely multiple roles for CD44 in ovarian cancer tumorigenesis. We have also found that CD44 has suppressive effects on ovarian cancer cell invasion, which is consistent with the effects of HOXB4. Furthermore, we have demonstrated that the ability of HOXB4 to suppress invasion can be reversed by down-regulation or functional antagonism of CD44. Mechanistically, studies show that the pro-migratory effects of CD44 in ovarian cancer involve interactions with β1 integrin261 or proteoglycan secreted by the cancer cells332. Though their results are all based on the interactions without Matrigel261, the interaction of β1 integrin and CD44 might be an explanation for the complementary effects of HOXA4 and HOXB4 in ovarian cancer cells, since the migration-suppressive effects of HOXA4 appear to involve β1 integrin206.                  Though down-regulation of HOXB4 increased invasion in OE-E6/E7 cells, CD44 was not down-regulated by siHOXB4 in these cells suggesting that there might be additional mechanisms in the regulatory effects of HOXB4. Moreover, perhaps certain oncogenic changes in the cancer cells are required before HOXB4 would be capable of regulating CD44. We also observed apparent pro-invasive effects of HOXB4 in CD44-negative A2780 cells suggesting that CD44 might exert regulatory effects on HOXB4 functions in some ovarian cancer cells.  139                Mechanistically, that siHOXB4-induced Matrigel invasion was blocked by an MMP inhibitor suggests that MMPs or other Matrigel degrading enzymes may contribute to the function of HOXB4, and possibly CD44, in ovarian cancer cells. Several studies demonstrate that some ECM degrading enzymes can regulate CD44 function by cleaving the extracellular domain of CD44 protein268,335,351. Also, CD44 can serve as an extracellular platform for some MMPs to exert their functiond in cell migration and/or invasion239. Therefore interactions between CD44 and activated MMPs might contribute to the invasion-suppressive effects of HOXB4 in ovarian cancer cells.  7.4 The Epigenetic Regulation of HOXB4 in Ovarian Cancer               Epigenetic regulation of HOX gene expression is extremely important in development86,143. Also, epigenetic silencing of tumor suppressors is a common event in cancer development339. Epigenetic programming of HOX gene expression is not uncommon in tumorigenesis, especially for those HOX genes that have tumor-suppressive effects58. DNA methylation is one of the most intensively studied epigenetic mechanisms in cancer biology85. HOXB4 expression can be induced in a human mesenchymal cell line by treatment with 5-Aza-dC342. Also, HOXB4 has been shown to be a target of de novo methylation in a lung cancer cell line126. The promoter region of HOXB4 was hypermethylated in primary thyroid cancers343 and in extra hepatic cholangiocarcinomas137. In Chapter 6, we demonstrated that the expression of HOXB4 could be induced by treatment with the demethylating agent 5-Aza-dC in two HOXB4-negative cell lines. These findings support the hypothesis that DNA methylation might contribute to the loss of HOXB4 expression from normal fallopian tube fimbrial epithelium to HGSC cells. Together with previous studies, hypermethylation and suppression of HOXB4 expression is not uncommon in carcinogenesis. However, the underlying mechanism of epigenetically deregulated 140  HOXB4 is not clear. Shu et al. studied 19 CpG sites located from 300 to 0 bp upstream of HOXB4 transcription starting site137. In the future, we could perform pyrosequencing to investigate whether HOXB4 promoter hypermethylation correlates with the loss of HOXB4 expression in ovarian carcer cell lines and tissues. Also, promoter demethylation might explain the re-expression of HOXB4 in cultured OSE cells relative to OSE in vivo. However, immunostaining of additional samples is required to confirm that the OSE does not express HOXB4 in vivo.   7.5 Future Perspectives               First, we have demonstrated that HOXB4 has invasion-suppressive effects on ovarian cancer cells. However, we found that HOXB4 has pro-migratory effects in A2780 cells. Moreover, the downstream target of HOXB4, CD44, is not expressed in this line. Therefore, further studies need to be conducted to confirm this phenotype and demonstrate the underlying mechanism. Next, we have described that the MMP inhibitor (GM6001) blocks siHOXB4 induced Matrigel invasion suggesting MMPs might be required in HOXB4 suppressed invasion. Therefore, future studies could focus on determining which MMP is involved. In our TMA studies, we have found that none of 37 mucinous carcinomas in two arrays shows HOXB4 staining suggesting that HOXB4 might be a marker to distinguish the subtypes. However, a larger sample size of mucinous carcinomas needs to be investigated. Also, there are also other epigenetic regulators (e.g. histone modification, chromatin remodeling and micro RNAs) which might be worthy to test to provide a more complete picture of the epigenetic regulation of HOXB4 in ovarian cancer cells. Furthermore, all of our functional studies have been conducted in vitro; therefore, to better demonstrate the suppressive effects of HOXB4 on ovarian cancer 141  invasion, xenograft mice might be a better model to illustrate the effect of HOXB4 in ovarian cancer. 7.6 Conclusions               The present study has demonstrated that HOXB4 has invasion-suppressive effects on ovarian cancer cells, and this effect is partially mediated by CD44. Furthermore, this study increases our understanding of the expression of HOXB4 in ovarian cancer samples as well as in the normal putative sources, and provides new method to differentiate the subtypes of ovarian cancer. Moreover, the loss-of-expression of HOXB4 from normal fallopian tube fimbria to high-grade serous ovarian cancers might be due to DNA methylation. 142  References 1. Moonsammy, S. H. et al. A pilot study of an exercise & cognitive behavioral therapy intervention for epithelial ovarian cancer patients. J. Ovarian Res. 6, 21 (2013). 2. Siegel, R., Naishadham, D. & Jemal, A. Cancer Statistics , 2013. CA A Cancer J. ofr Clin. 63, 11–30 (2013). 3. Goff, B. A., Mandel, L., Muntz, H. G. & Melancon, C. H. Results of a National Ovarian Cancer Survey. Cancer 89, 2068–2075 (2000). 4. Gurung, A., Hung, T., Morin, J. & Gilks, C. B. Molecular abnormalities in ovarian carcinoma: clinical, morphological and therapeutic correlates. Histopathology 62, 59–70 (2013). 5. Shih, I.-M. & Kurman, R. J. Ovarian tumorigenesis: a proposed model based on morphological and molecular genetic analysis. Am. J. Pathol. 164, 1511–1518 (2004). 6. Kurman, R. J. & Shih, I.-M. Pathogenesis of Ovarian Cancer. Lessons from Morphology and Molecular Biology and their Clinical Implications. Int. J. Gynecol. Pathol. 27, 151–160 (2009). 7. Gilks, C. B. & Prat, J. Ovarian carcinoma pathology and genetics: recent advances. Hum. Pathol. 40, 1213–23 (2009). 8. Güth, U. et al. Metastatic patterns at autopsy in patients with ovarian carcinoma. Cancer 110, 1272–80 (2007). 9. Malpica, A. et al. Grading ovarian serous carcinoma using a two-tier system. Am. J. Surg. Pathol. 28, 496–504 (2004). 10. Köbel, M., Huntsman, D. & Gilks, C. B. Critical molecular abnormalities in high-grade serous carcinoma of the ovary. Expert Rev. Mol. Med. 10, e22 (2008). 11. Ahmed, A. A. et al. Driver mutations in TP53 are ubiquitous in high grade serous carcinoma of the ovary. J. Pathol. 221, 49–56 (2010). 12. Press, J. Z. et al. Ovarian carcinomas with genetic and epigenetic BRCA1 loss have distinct molecular abnormalities. BMC Cancer 8, 17 (2008). 13. The Cancer Genome Atlas Research Network. Integrated genomic analyses of ovarian carcinoma. Nature 474, 609–15 (2011). 143  14. Köbel, M. et al. Differences in tumor type in low-stage versus high-stage ovarian carcinomas. Int. J. Gynecol. Pathol. 29, 203–11 (2010). 15. Kurman, R. J. & Shih, I.-M. The Origin and Pathogenesis of Epithelial Ovarian Cancer- a Proposed Unifying Theory. Am. J. Surg. Pathol. 34, 433–443 (2011). 16. Jones, S. et al. Low-grade serous carcinomas of the ovary contain very few point mutations. J. Pathol. 226, 413–20 (2012). 17. Vang, R., Shih, I.-M. & Kurman, R. J. Ovarian Low-grade and High-grade Serous Carcinoma: Pathogenesis, Clinicopathologic and Molecular Biologic Features, and Diagnostic Problems. Adv. Anat. Pathol. 16, 267–282 (2009). 18. McCluggage, W. G. My approach to and thoughts on the typing of ovarian carcinomas. J. Clin. Pathol. 61, 152–63 (2008). 19. Köbel, M. et al. A limited panel of immunomarkers can reliably distinguish between clear cell and high-grade serous carcinoma of the ovary. Am. J. Surg. Pathol. 33, 14–21 (2009). 20. Yamamoto, S. et al. PIK3CA mutation is an early event in the development of endometriosis-associated ovarian clear cell adenocarcinoma. J. Pathol. 225, 189–94 (2011). 21. Wiegand, K. C. et al. ARID1A mutations in endometriosis-associated ovarian carcinomas. N. Engl. J. Med. 363, 1532–43 (2010). 22. Jones, S. et al. Frequent mutations of chromatin remodeling gene ARID1A in ovarian clear cell carcinoma. Science (80-. ). 330, 228–31 (2010). 23. Gilks, C. B. et al. Tumor cell type can be reproducibly diagnosed and is of independent prognostic significance in patients with maximally debulked ovarian carcinoma. Hum. Pathol. 39, 1239–51 (2008). 24. Köbel, M. et al. Tumor type and substage predict survival in stage I and II ovarian carcinoma: insights and implications. Gynecol. Oncol. 116, 50–6 (2010). 25. Kurman, R. J. & Shih, I.-M. Molecular pathogenesis and extraovarian origin of epithelial ovarian cancer--shifting the paradigm. Hum. Pathol. 42, 918–31 (2011). 26. Cuatrecasas, M., Villanueva, a, Matias-Guiu, X. & Prat, J. K-ras mutations in mucinous ovarian tumors: a clinicopathologic and molecular study of 95 cases. Cancer 79, 1581–6 (1997). 27. Gemignani, M. L. et al. Role of KRAS and BRAF gene mutations in mucinous ovarian carcinoma. Gynecol. Oncol. 90, 378–381 (2003). 144  28. Mayr, D., Hirschmann, A., Löhrs, U. & Diebold, J. KRAS and BRAF mutations in ovarian tumors: a comprehensive study of invasive carcinomas, borderline tumors and extraovarian implants. Gynecol. Oncol. 103, 883–7 (2006). 29. Anglesio, M. S. et al. Molecular characterization of mucinous ovarian tumours supports a stratified treatment approach with HER2 targeting in 19% of carcinomas. J. Pathol. 229, 111–20 (2013). 30. Yamashita, T. et al. Suppression of invasive characteristics by antisense introduction of overexpressed HOX genes in ovarian cancer cells. Int. J. Oncol. 28, 931–8 (2006). 31. Naora, H. The heterogeneity of epithelial ovarian cancers: reconciling old and new paradigms. Expert Rev. Mol. Med. 9, 1–12 (2007). 32. Auersperg, N., Wong, A. S. T., Choi, K., Kang, S. K. & Leung, P. C. K. Ovarian Surface Epithelium : Biology , Endocrinology and Pathology. Endocr. Rev. 22, 255–288 (2001). 33. Feeley, K. M. & Wells, M. Precursor lesions of ovarian epithelial malignancy. Histopathology 38, 87–95 (2001). 34. Auersperg, N. Ovarian surface epithelium as a source of ovarian cancers: Unwarranted speculation or evidence-based hypothesis? Gynecol. Oncol. 130, 246–251 (2013). 35. Levanon K, Crum C, Drapkin, R. & Oncol, J. C. New insights into the pathogenesis of serous ovarian cancer and its clinical impact. J. Clin. Oncol. 26, 5284–5293 (2008). 36. Lim, D. & Oliva, E. Precursors and pathogenesis of ovarian carcinoma. Pathology 45, 229–42 (2013). 37. Piek, J. M. J., Kenemans, P. & Verheijen, R. H. M. Intraperitoneal serous adenocarcinoma: a critical appraisal of three hypotheses on its cause. Am. J. Obstet. Gynecol. 191, 718–32 (2004). 38. McCluggage, W. G. Morphological subtypes of ovarian carcinoma: a review with emphasis on new developments and pathogenesis. Pathology 43, 420–32 (2011). 39. Kindelberger, D. W. et al. Intraepithelial carcinoma of the fimbria and pelvic serous carcinoma: Evidence for a causal relationship. Am. J. Surg. Pathol. 31, 161–9 (2007). 40. Crum, C. P. Intercepting pelvic cancer in the distal fallopian tube: theories and realities. Mol. Oncol. 3, 165–70 (2009). 41. Auersperg, N. The origin of ovarian carcinomas: a unifying hypothesis. Int. J. Gynecol. Pathol. 30, 12–21 (2011). 145  42. Chiang, A. C. & Massague, J. Molecular basis of metastasis. N. Engl. J. Med. 359, 2814–23 (2008). 43. Naora, H. & Montell, D. J. Ovarian cancer metastasis: integrating insights from disparate model organisms. Nat. Rev. Cancer 5, 355–66 (2005). 44. Rowe, R. G. & Weiss, S. J. Navigating ECM barriers at the invasive front: the cancer cell-stroma interface. Annu. Rev. Cell Dev. Biol. 25, 567–95 (2009). 45. Rowe, R. G. & Weiss, S. J. Breaching the basement membrane: who, when and how? Trends Cell Biol. 18, 560–74 (2008). 46. Yurchenco, P. D., Amenta, P. S. & Patton, B. L. Basement membrane assembly, stability and activities observed through a developmental lens. Matrix Biol. 22, 521–38 (2004). 47. Yang, J. & Weinberg, R. a. Epithelial-mesenchymal transition: at the crossroads of development and tumor metastasis. Dev. Cell 14, 818–29 (2008). 48. Sabeh, F., Shimizu-Hirota, R. & Weiss, S. J. Protease-dependent versus -independent cancer cell invasion programs: three-dimensional amoeboid movement revisited. J. Cell Biol. 185, 11–9 (2009). 49. Sabeh, F. et al. Tumor cell traffic through the extracellular matrix is controlled by the membrane-anchored collagenase MT1-MMP. J. Cell Biol. 167, 769–81 (2004). 50. Grier, D. G. et al. The pathophysiology of HOX genes and their role in cancer. J. Pathol. 205, 154–71 (2005). 51. Mann, R. S., Lelli, K. M. & Joshi, R. Hox specificity unique roles for cofactors and collaborators. Curr. Top. Dev. Biol. 88, 63–101 (2009). 52. Crijns, A. P. G. et al. MEIS and PBX homeobox proteins in ovarian cancer. Eur. J. Cancer 43, 2495–2505 (2007). 53. Argiropoulos, B. & Humphries, R. K. Hox genes in hematopoiesis and leukemogenesis. Oncogene 26, 6766–76 (2007). 54. Chen, F. & Apecchi, Ma. R. Paralogous mouse Hox genes, Hoxa9, Hoxb9, and Hoxd9, function together to control development of the mammary gland in response to pregnancy. Proc. Natl. Acad. Sci. U. S. A. 96, 541–546 (1999). 55. Horan, G. S. et al. Compound mutants for the paralogous hoxa-4, hoxb-4, and hoxd-4 genes show more complete homeotic transformations and a dose-dependent increase in the number of vertebrae transformed. Genes Dev. 9, 1667–1677 (1995). 146  56. Manley, N. R. & Capecchi, M. R. Hox group 3 paralogous genes act synergistically in the formation of somitic and neural crest-derived structures. Dev. Biol. 192, 274–88 (1997). 57. Condie, B. G. & Capecchi, M. R. Mice with targeted disruptions in the paralogous genes hoxa-3 and hoxd-3 reveal synergistic interactions. Nature 370, 304–7 (1994). 58. Shah, N. & Sukumar, S. The Hox genes and their roles in oncogenesis. Nat. Rev. Cancer 10, 361–371 (2010). 59. Krumlauf, R. Hox Genes in Vertebrate Development. Cell 78, 191–201 (1994). 60. Daftary, G. S. & Taylor, H. S. Endocrine regulation of HOX genes. Endocr. Rev. 27, 331–335 (2006). 61. Durston, A. J. et al. Retinoic acid causes an anteroposterior transformation in the developing central nervous system. Nature 340, 140–144 (1989). 62. Bushue, N. & Wan, Y.-J. Y. Retinoid pathway and cancer therapeutics. Adv. Drug Deliv. Rev. 62, 1285–98 (2010). 63. Murphy, P. & Hill, R. E. Expression of the mouse labial-like homeobox-containing genes, Hox 2.9 and Hox 1.6, during segmentation of the hindbrain. Development 111, 61–74 (1991). 64. Langston, A. W. & Gudas, L. J. Identification of a retinoic acid responsive enhancer 3’ of the murine homeobox gene Hox-1.6. Mech. Dev. 38, 217–27 (1992). 65. Marshall, H. et al. A conserved retinoic acid response element required for early expression of the homeobox gene Hoxb-1. Nature 370, 567–71 (1994). 66. Pöpperl, H. & Featherstone, M. S. Identification of a retinoic acid response element upstream of the murine Hox-4.2 gene. Mol. Cell. Biol. 13, 257–65 (1993). 67. Conlon, R. A. & Rossant, J. Exogenous retinoic acid rapidly induces anterior ectopic expression of murine Hox-2 genes in vivo. Development 116, 357–68 (1992). 68. Lohnes, D. et al. Function of the retinoic acid receptors (RARs) during development (I). Craniofacial and skeletal abnormalities in RAR double mutants. Development 120, 2723–48 (1994). 69. Serpente, P. et al. Direct crossregulation between retinoic acid receptor {beta} and Hox genes during hindbrain segmentation. Development 132, 503–13 (2005). 70. Couse, J. F. & Korach, K. S. Estrogen receptor null mice: what have we learned and where will they lead us? Endocr. Rev. 20, 358–417 (1999). 147  71. Hewitt, S. C., Harrell, J. C. & Korach, K. S. Lessons in estrogen biology from knockout and transgenic animals. Annu. Rev. Physiol. 67, 285–308 (2005). 72. Taylor, H. S., Vanden Heuvel, G. B. & Igarashi, P. A conserved Hox axis in the mouse and human female reproductive system: late establishment and persistent adult expression of the Hoxa cluster genes. Biol. Reprod. 57, 1338–45 (1997). 73. Block, K., Kardana, A., Igarashi, P. & Taylor, H. S. In utero diethylstilbestrol (DES) exposure alters Hox gene expression in the developing müllerian system. FASEB J. 14, 1101–8 (2000). 74. Couse, J. F. et al. Estrogen receptor-alpha knockout mice exhibit resistance to the developmental effects of neonatal diethylstilbestrol exposure on the female reproductive tract. Dev. Biol. 238, 224–38 (2001). 75. Tanenbaum, D. M., Wang, Y., Williams, S. P. & Sigler, P. B. Crystallographic comparison of the estrogen and progesterone receptor ’ s ligand binding domains. Proc. Natl. Acad. Sci. U. S. A. 95, 5998–6003 (1998). 76. Taylor, H. S., Arici, a, Olive, D. & Igarashi, P. HOXA10 is expressed in response to sex steroids at the time of implantation in the human endometrium. J. Clin. Invest. 101, 1379–84 (1998). 77. Akbas, G. E., Song, J. & Taylor, H. S. A HOXA10 estrogen response element (ERE) is differentially regulated by 17 beta-estradiol and diethylstilbestrol (DES). J. Mol. Biol. 340, 1013–23 (2004). 78. Chu, M. C., Selam, F. B. & Taylor, hugh S. HOXA10 regulates p53 expression and matrigel invasion in human breast cancer cells. Cancer Biol. Ther. 3, 568–572 (2004). 79. Yoshizawa, T. et al. Mice lacking the vitamin D receptor exhibit impaired bone formation, uterine hypoplasia and growth retardation after weaning. Nat. Genet. 16, 391–6 (1997). 80. Du, H., Daftary, G. S., Lalwani, S. I. & Taylor, H. S. Direct regulation of HOXA10 by 1,25-(OH)2D3 in human myelomonocytic cells and human endometrial stromal cells. Mol. Endocrinol. 19, 2222–33 (2005). 81. Rots, N. Y., Liu, M., Anderson, E. C. & Freedman, L. P. A differential screen for ligand-regulated genes: identification of HoxA10 as a target of vitamin D3 induction in myeloid leukemic cells. Mol. Cell. Biol. 18, 1911–8 (1998). 82. Esteller, M. Epigenetics in cancer. N. Engl. J. Med. 358, 1148–59 (2008). 83. Maradeo, M. E. & Cairns, P. Translational application of epigenetic alterations: ovarian cancer as a model. FEBS Lett. 585, 2112–20 (2011). 148  84. Levenson, J. M. & Sweatt, J. D. Epigenetic mechanisms in memory formation. Nat. Rev. Neurosci. 6, 108–18 (2005). 85. Jones, P. a. Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nat. Rev. Genet. 13, 484–92 (2012). 86. Kiefer, J. C. Epigenetics in development. Dev. Dyn. 236, 1144–56 (2007). 87. Bestor, T., Laudano, a, Mattaliano, R. & Ingram, V. Cloning and sequencing of a cDNA encoding DNA methyltransferase of mouse cells. The carboxyl-terminal domain of the mammalian enzymes is related to bacterial restriction methyltransferases. J. Mol. Biol. 203, 971–83 (1988). 88. Goll, M. G. & Bestor, T. H. Eukaryotic cytosine methyltransferases. Annu. Rev. Biochem. 74, 481–514 (2005). 89. Song, C.-X. et al. Selective chemical labeling reveals the genome-wide distribution of 5-hydroxymethylcytosine. Nat. Biotechnol. 29, 68–72 (2011). 90. Chen, R. Z., Pettersson, U., Beard, C., Jackson-grusby, L. & Jaenisch, R. DNA hypomethylation leads to elevated mutation rates. Nature 395, 89–93 (1998). 91. Jair, K.-W. et al. De novo CpG island methylation in human cancer cells. Cancer Res. 66, 682–92 (2006). 92. Okano, M., Bell, D. W., Haber, D. a & Li, E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99, 247–57 (1999). 93. Ramsahoye, B. H. et al. Non-CpG methylation is prevalent in embryonic stem cells and may be mediated by DNA methyltransferase 3a. Proc. Natl. Acad. Sci. U. S. A. 97, 5237–42 (2000). 94. Ley, T. J. et al. DNMT3A Mutations in Acute Myeloid Leukemia. N. Engl. J. Med. 363, 2424–33 (2010). 95. Ribeiro, A. F. T. et al. Mutant DNMT3A: a marker of poor prognosis in acute myeloid leukemia. Blood 119, 5824–31 (2012). 96. Jones, P. a & Liang, G. Rethinking how DNA methylation patterns are maintained. Nat. Rev. Genet. 10, 805–11 (2009). 97. Jia, D., Jurkowska, R. Z., Zhang, X., Jeltsch, A. & Cheng, X. Structure of Dnmt3a bound to Dnmt3L suggests a model for de novo DNA methylation. Nature 449, 248–51 (2007). 149  98. Okano, M., Xie, S. & Li, E. Dnmt2 is not required for de novo and maintenance methylation of viral DNA in embryonic stem cells. Nucleic Acids Res. 26, 2536–40 (1998). 99. Goll, M. G. et al. Methylation of tRNAAsp by the DNA methyltransferase homolog Dnmt2. Science (80-. ). 311, 395–8 (2006). 100. Ooi, S. K. T. et al. DNMT3L connects unmethylated lysine 4 of histone H3 to de novo methylation of DNA. Nature 448, 714–7 (2007). 101. Otani, J. et al. Structural basis for recognition of H3K4 methylation status by the DNA methyltransferase 3A ATRX-DNMT3-DNMT3L domain. EMBO Rep. 10, 1235–41 (2009). 102. Zhang, Y. et al. Chromatin methylation activity of Dnmt3a and Dnmt3a/3L is guided by interaction of the ADD domain with the histone H3 tail. Nucleic Acids Res. 38, 4246–53 (2010). 103. Denis, H., Ndlovu, M. N. & Fuks, F. Regulation of mammalian DNA methyltransferases: a route to new mechanisms. EMBO Rep. 12, 647–56 (2011). 104. Aravin, A. a et al. A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. Mol. Cell 31, 785–99 (2008). 105. Takada, S., Berezikov, E., Choi, Y. L., Yamashita, Y. & Mano, H. Potential role of miR-29b in modulation of Dnmt3a and Dnmt3b expression in primordial germ cells of female mouse embryos. RNA 15, 1507–14 (2009). 106. López de Silanes, I. et al. The RNA-binding protein HuR regulates DNA methylation through stabilization of DNMT3b mRNA. Nucleic Acids Res. 37, 2658–71 (2009). 107. Jabbour, E., Issa, J.-P., Garcia-Manero, G. & Kantarjian, H. Evolution of decitabine development: accomplishments, ongoing investigations, and future strategies. Cancer 112, 2341–51 (2008). 108. Jüttermann, R., Li, E. & Jaenisch, R. Toxicity of 5-aza-2’-deoxycytidine to mammalian cells is mediated primarily by covalent trapping of DNA methyltransferase rather than DNA demethylation. Proc. Natl. Acad. Sci. U. S. A. 91, 11797–801 (1994). 109. Taylor, S. M. & Jones, P. a. Cellular differentiation, cytidine analogs and DNA methylation. Cell 20, 85–93 (1980). 110. Christman, J. K. 5-Azacytidine and 5-aza-2’-deoxycytidine as inhibitors of DNA methylation: mechanistic studies and their implications for cancer therapy. Oncogene 21, 5483–95 (2002). 150  111. Momparler, R. L. Epigenetic therapy of cancer with 5-aza-2’-deoxycytidine (decitabine). Semin. Oncol. 32, 443–51 (2005). 112. Gowher, H. & Jeltsch, A. Mechanism of Inhibition of DNA Methyltransferases by Cytidine Analogs in Cancer Therapy. Cancer Biol. Ther. 3, 1062–1068 (2004). 113. Ghoshal, K. et al. 5-Aza-Deoxycytidine Induces Selective Degradation of DNA Methyltransferase 1 by a Proteasomal Pathway That Requires the KEN Box , Bromo-Adjacent Homology Domain , and Nuclear Localization Signal. Mol. Cell. Biol. 25, 4727–4741 (2005). 114. Patel, K. et al. Targeting of 5-aza-2’-deoxycytidine residues by chromatin-associated DNMT1 induces proteasomal degradation of the free enzyme. Nucleic Acids Res. 38, 4313–24 (2010). 115. Nguyen, C. T. et al. Histone H3-Lysine 9 Methylation Is Associated with Aberrant Gene Silencing in Cancer Cells and Is Rapidly Reversed by 5-Aza-2’-deoxycytidine. Cancer Res. 62, 6456–6461 (2002). 116. Claus, R. & Lübbert, M. Epigenetic targets in hematopoietic malignancies. Oncogene 22, 6489–96 (2003). 117. Jackson-Grusby, L., Laird, P. W., Magge, S. N., Moeller, B. J. & Jaenisch, R. Mutagenicity of 5-aza-2’-deoxycytidine is mediated by the mammalian DNA methyltransferase. Proc. Natl. Acad. Sci. U. S. A. 94, 4681–5 (1997). 118. Branciamore, S., Chen, Z.-X., Riggs, A. D. & Rodin, S. N. CpG island clusters and pro-epigenetic selection for CpGs in protein-coding exons of HOX and other transcription factors. Proc. Natl. Acad. Sci. U. S. A. 107, 15485–90 (2010). 119. Laurent, L. et al. Dynamic changes in the human methylome during differentiation. Genome Res. 20, 320–31 (2010). 120. Hershko, A. Y., Kafri, T., Fainsod, A. & Razin, A. Methylation of HoxA5 and HoxB5 and its relevance to expression during mouse development. Gene 302, 65–72 (2003). 121. Kong, K.-A., Yoon, H. & Kim, M. H. Akt1 as a putative regulator of Hox genes. Gene 513, 287–91 (2013). 122. Strathdee, G., Sim, a, Parker, a, Oscier, D. & Brown, R. Promoter hypermethylation silences expression of the HoxA4 gene and correlates with IgVh mutational status in CLL. Leukemia 20, 1326–9 (2006). 151  123. Strathdee, G., Sim, A., Soutar, R., Holyoake, T. L. & Brown, R. HOXA5 is targeted by cell-type-specific CpG island methylation in normal cells and during the development of acute myeloid leukaemia. Carcinogenesis 28, 299–309 (2007). 124. Strathdee, G. et al. Inactivation of HOXA genes by hypermethylation in myeloid and lymphoid malignancy is frequent and associated with poor prognosis. Clin. cancer Res. 13, 5048–55 (2007). 125. Shiraishi, M., Sekiguchi, A., Oates, A. J., Terry, M. J. & Miyamoto, Y. HOX gene clusters are hotspots of de novo methylation in CpG islands of human lung adenocarcinomas. Oncogene 21, 3659–3662 (2002). 126. Rauch, T. et al. Homeobox gene methylation in lung cancer studied by genome-wide analysis with a microarray-based methylated CpG island recovery assay. Proc. Natl. Acad. Sci. U. S. A. 104, 5527–32 (2007). 127. Raman, V. et al. Compromised HOXA5 function can limit p53 expression in human breast tumours. Nature 405, 974–978 (2000). 128. Novak, P. et al. Epigenetic inactivation of the HOXA gene cluster in breast cancer. Cancer Res. 66, 10664–70 (2006). 129. Williams, K., Christensen, J. & Helin, K. DNA methylation: TET proteins-guardians of CpG islands? EMBO Rep. 13, 28–35 (2012). 130. Sun, M. et al. HMGA2/TET1/HOXA9 signaling pathway regulates breast cancer growth and metastasis. Proc. Natl. Acad. Sci. U. S. A. 110, 9920–5 (2013). 131. Ordway, J. M. et al. Comprehensive DNA methylation profiling in a human cancer genome identifies novel epigenetic targets. Carcinogenesis 27, 2409–23 (2006). 132. Di Vinci, A. et al. HOXA7, 9, and 10 are methylation targets associated with aggressive behavior in meningiomas. Transl. Res. 160, 355–62 (2012). 133. Wu, Q. et al. DNA methylation profiling of ovarian carcinomas and their in vitro models identifies HOXA9, HOXB5, SCGB3A1, and CRABP1 as novel targets. Mol. Cancer 6, 45 (2007). 134. Montavon, C. et al. Prognostic and diagnostic significance of DNA methylation patterns in high grade serous ovarian cancer. Gynecol. Oncol. 124, 582–8 (2012). 135. Cheng, W. et al. Identification of aberrant promoter hypomethylation of HOXA10 in ovarian cancer. J. Cancer Res. Clin. Oncol. 136, 1221–7 (2010). 152  136. Fiegl, H. et al. HOXA11 DNA methylation--a novel prognostic biomarker in ovarian cancer. Int. J. cancer 123, 725–9 (2008). 137. Shu, Y., Wang, B., Wang, J., Wang, J.-M. & Zou, S.-Q. Identification of methylation profile of HOX genes in extrahepatic cholangiocarcinoma. World J. Gastroenterol. 17, 3407–19 (2011). 138. Margueron, R., Trojer, P. & Reinberg, D. The key to development: interpreting the histone code? Curr. Opin. Genet. Dev. 15, 163–76 (2005). 139. Chi, P., Allis, C. D. & Wang, G. G. Covalent histone modifications--miswritten, misinterpreted and mis-erased in human cancers. Nat. Rev. Cancer 10, 457–69 (2010). 140. Strahl, B. D. & Allis, C. D. The language of covalent histone modifications. Nature 403, 41–45 (2000). 141. Bernstein, B. E., Meissner, A. & Lander, E. S. The mammalian epigenome. Cell 128, 669–81 (2007). 142. Lee, T. I. et al. Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125, 301–13 (2006). 143. Simon, J. a & Kingston, R. E. Mechanisms of polycomb gene silencing: knowns and unknowns. Nat. Rev. Mol. Cell Biol. 10, 697–708 (2009). 144. Bracken, A. P. & Helin, K. Polycomb group proteins: navigators of lineage pathways led astray in cancer. Nat. Rev. Cancer 9, 773–84 (2009). 145. Sauvageau, M. & Sauvageau, G. Polycomb group proteins: multi-faceted regulators of somatic stem cells and cancer. Cell Stem Cell 7, 299–313 (2010). 146. Mills, A. a. Throwing the cancer switch: reciprocal roles of polycomb and trithorax proteins. Nat. Rev. Cancer 10, 669–82 (2010). 147. Hanson, R. D. et al. Mammalian Trithorax and Polycomb-group homologues are antagonistic regulators of homeotic development. Proc. Natl. Acad. Sci. U. S. A. 96, 14372–14377 (1999). 148. Fanti, L. et al. The trithorax group and Pc group proteins are differentially involved in heterochromatin formation in Drosophila. Chromosoma 117, 25–39 (2008). 149. Ferrando, A. a et al. Gene expression signatures in MLL-rearranged T-lineage and B-precursor acute leukemias: dominance of HOX dysregulation. Blood 102, 262–8 (2003). 153  150. He, L. & Hannon, G. J. MicroRNAs: small RNAs with a big role in gene regulation. Nat. Rev. Genet. 5, 522–31 (2004). 151. Chopra, V. S. & Mishra, R. K. “Mir”acles in hox gene regulation. BioEssays 28, 445–448 (2006). 152. Yekta, S., Shih, I.-H. & Bartel, D. P. MicroRNA-directed cleavage of HOXB8 mRNA. Science (80-. ). 304, 594–6 (2004). 153. Niinuma, T. et al. Upregulation of miR-196a and HOTAIR drive malignant character in gastrointestinal stromal tumors. Cancer Res. 72, 1126–36 (2012). 154. Garzon, R. et al. Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proc. Natl. Acad. Sci. U. S. A. 105, 3945–50 (2008). 155. Tan, Y. et al. Transcriptional inhibiton of Hoxd4 expression by miRNA-10a in human breast cancer cells. BMC Mol. Biol. 10, 12 (2009). 156. Rinn, J. L. et al. Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs. Cell 129, 1311–23 (2007). 157. Gupta, R. a et al. Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature 464, 1071–6 (2010). 158. Brock, H. W., Hodgson, J. W., Petruk, S. & Mazo, A. Regulatory noncoding RNAs at Hox loci. Biochem. cell Biol. 87, 27–34 (2009). 159. Abate-Shen, C. Deregulated homeobox gene expression in cancer: cause or consequence? Nat. Rev. Cancer 2, 777–85 (2002). 160. Lawrence, H. J. & Largman, C. Homeobox genes in normal hematopoiesis and leukemia. Blood 80, 2445–53 (1992). 161. Abramovich, C., Pineault, N., Ohta, H. & Humphries, R. K. Hox genes: from leukemia to hematopoietic stem cell expansion. Ann. N. Y. Acad. Sci. 1044, 109–16 (2005). 162. Alharbi, R. a, Pettengell, R., Pandha, H. S. & Morgan, R. The role of HOX genes in normal hematopoiesis and acute leukemia. Leukemia 27, 1000–1008 (2012). 163. Eklund, E. The role of Hox proteins in leukemogenesis: insights into key regulatory events in hematopoiesis. Crit. Rev. Oncog. 16, 65–76 (2012). 164. Kawagoe, H., Humphries, R. K., Blair, a, Sutherland, H. J. & Hogge, D. E. Expression of HOX genes, HOX cofactors, and MLL in phenotypically and functionally defined 154  subpopulations of leukemic and normal human hematopoietic cells. Leukemia 13, 687–98 (1999). 165. Afonja, O. et al. MEIS1 and HOXA7 genes in human acute myeloid leukemia. Leuk. Res. 24, 849–55 (2000). 166. Drabkin, H. A. et al. Quantitative HOX expression in chromosomally defined subsets of acute myelogenous leukemia. Leukemia 16, 186–195 (2002). 167. Golub, T. R. et al. Molecular Classification of Cancer: Class Discovery and Class Prediction by Gene Expression Monitoring. Science (80-. ). 286, 531–537 (1999). 168. Andreeff, M. et al. HOX expression patterns identify a common signature for favorable AML. Leukemia 22, 2041–7 (2008). 169. Zangenberg, M. et al. The combined expression of HOXA4 and MEIS1 is an independent prognostic factor in patients with AML. Eur. J. Haematol. 83, 439–48 (2009). 170. Rozovskaia, T. et al. Upregulation of Meis1 and HoxA9 in acute lymphocytic leukemias with the t(4 : 11) abnormality. Oncogene 20, 874–8 (2001). 171. Krivtsov, A. V et al. H3K79 methylation profiles define murine and human MLL-AF4 leukemias. Cancer Cell 14, 355–68 (2008). 172. Zangrando, A., Dell’orto, M. C., Te Kronnie, G. & Basso, G. MLL rearrangements in pediatric acute lymphoblastic and myeloblastic leukemias: MLL specific and lineage specific signatures. BMC Med. Genomics 2, 1–12 (2009). 173. Dik, W. a et al. CALM-AF10+ T-ALL expression profiles are characterized by overexpression of HOXA and BMI1 oncogenes. Leukemia 19, 1948–57 (2005). 174. Kumar, A. R. et al. Hoxa9 influences the phenotype but not the incidence of Mll-AF9 fusion gene leukemia. Blood 103, 1823–8 (2004). 175. Sauvageau, G. et al. Overexpression of HOXB3 in hematopoietic cells causes defective lymphoid development and progressive myeloproliferation. Immunity 6, 13–22 (1997). 176. Thorsteinsdottir, U. et al. Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia. Mol. Cell. Biol. 17, 495–505 (1997). 177. Fischbach, N. a et al. HOXB6 overexpression in murine bone marrow immortalizes a myelomonocytic precursor in vitro and causes hematopoietic stem cell expansion and acute myeloid leukemia in vivo. Blood 105, 1456–66 (2005). 155  178. Kroon, E. et al. Hoxa9 transforms primary bone marrow cells through specific collaboration with Meis1a but not Pbx1b. EMBO J. 17, 3714–25 (1998). 179. Sauvageau, G. et al. Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo. Genes Dev. 9, 1753–1765 (1995). 180. Zhang, X. et al. High incidence of leukemia in large animals after stem cell gene therapy with a HOXB4-expressing retroviral vector. J. Clin. Invest. 118, (2008). 181. Chen, H., Chung, S. & Sukumar, S. HOXA5-Induced Apoptosis in Breast Cancer Cells Is Mediated by Caspases 2 and 8. Mol. Cell. Biol. 24, 924–935 (2004). 182. Chen, H. et al. HOXA5 acts directly downstream of retinoic acid receptor beta and contributes to retinoic acid-induced apoptosis and growth inhibition. Cancer Res. 67, 8007–13 (2007). 183. Carrio, M., Arderiu, G., Myers, C. & Boudreau, N. J. Homeobox D10 induces phenotypic reversion of breast tumor cells in a three-dimensional culture model. Cancer Res. 65, 7177–85 (2005). 184. Wu, X. et al. HOXB7, a homeodomain protein, is overexpressed in breast cancer and confers epithelial-mesenchymal transition. Cancer Res. 66, 9527–34 (2006). 185. Carè, A. et al. HOXB7 : A Key Factor for Tumor-associated Angiogenic Switch. Cancer Res. 61, 6532–6539 (2001). 186. Ma, X.-J. et al. A two-gene expression ratio predicts clinical outcome in breast cancer patients treated with tamoxifen. Cancer Cell 6, 445 (2004). 187. Alami, Y., Castronovo, V., Belotti, D., Flagiello, D. & Clausse, N. HOXC5 and HOXC8 Expression Are Selectively Turned on in Human Cervical Cancer Cells Compared to Normal Keratinocytes. Biochem. Biophys. Res. Commun. 745, 738–745 (1999). 188. Zhai, Y. et al. Gene expression analysis of preinvasive and invasive cervical squamous cell carcinomas identifies HOXC10 as a key mediator of invasion. Cancer Res. (2007). 189. Yoshida, H., Broaddus, R., Cheng, W., Xie, S. & Naora, H. Deregulation of the HOXA10 homeobox gene in endometrial carcinoma: role in epithelial-mesenchymal transition. Cancer Res. 66, 889–97 (2006). 190. Waltregny, D., Alami, Y., Clausse, N., Leval, J. De & Castronovo, V. Overexpression of the Homeobox Gene HOXC 8 in Human Prostate Cancer Correlates With Loss of umor Differentiation. Prostate 169, 162–169 (2002). 156  191. Hamada Ji et al. Overexpression of homeobox gene HOXD3 induces coordinate expression of metastasis-related genes in human lung cancer cells. Int. J. cancer 93, 516–25 (2001). 192. Okubo, Y. et al. Transduction of HOXD3-antisense into human melanoma cells results in decreased invasive and motile activities. Clin. Exp. Metastasis 19, 503–11 (2002). 193. Bhatlekar, S., Fields, J. Z. & Boman, B. M. HOX genes and their role in the development of human cancers. J. Mol. Med. (Berl). (2014). doi:10.1007/s00109-014-1181-y 194. Ota Takayo, Gilks, C. B., Longacre, T., Leung, P. C. K. & Auersperg, N. HOXA7 in epithelial ovarian cancer: interrelationships between differentiation and clinical features. Reprod. Sci. 14, 605–614 (2007). 195. Naora, H., Montz, F. J., Chai, C.-Y. & Roden, R. B. S. Aberrant expression of homeobox gene HOXA7 is associated with mullerian-like differentiation of epithelial ovarian tumors and the generation of a specific autologous antibody response. Proc. Natl. Acad. Sci. U. S. A. 98, 15290–15214 (2001). 196. Ota, T. et al. Expression and function of HOXA genes in normal and neoplastic ovarian epithelial cells. Differentiation 77, 162–71 (2009). 197. Cheng, W., Liu, J., Yoshida, H., Rosen, D. & Naora, H. Lineage infidelity of epithelial ovarian cancers is controlled by HOX genes that specify regional identity in the reproductive tract. Nat. Med. 11, 531–7 (2005). 198. Naora, H. et al. A serologically identified tumor antigen encoded by a homeobox gene promotes growth of ovarian epithelial cells. Proc. Natl. Acad. Sci. U. S. A. 98, 4060–4065 (2001). 199. Naora, H. Developmental Patterning in the Wrong Context The Paradox of Epithelial Ovarian Cancers. Cell Cycle 4, 1033–1035 (2005). 200. Ko, S. Y., Ladanyi, A., Lengyel, E. & Naora, H. Expression of the homeobox gene HOXA9 in ovarian cancer induces peritoneal macrophages to acquire an M2 tumor-promoting phenotype. Am. J. Pathol. 184, 271–81 (2014). 201. Ko, S. Y. & Naora, H. HOXA9 promotes homotypic and heterotypic cell interactions that facilitate ovarian cancer dissemination via its induction of P-cadherin. Mol. Cancer 13, 170 (2014). 202. Ko, S. Y. et al. HOXA9 promotes ovarian cancer growth by stimulating cancer-associated fibroblasts. 122, 3603–3617 (2012). 157  203. Li, B. et al. HOXA10 is overexpressed in human ovarian clear cell adenocarcinoma and correlates with poor survival. Int. J. Gynecol. Cancer 19, 1347–52 (2009). 204. Tanwar, P. S., Kaneko-Tarui, T., Lee, H.-J., Zhang, L. & Teixeira, J. M. PTEN loss and HOXA10 expression are associated with ovarian endometrioid adenocarcinoma differentiation and progression. Carcinogenesis 34, 893–901 (2013). 205. Miao, J. et al. HOXB13 promotes ovarian cancer progression. Proc. Natl. Acad. Sci. U. S. A. 104, 17093–8 (2007). 206. Klausen, C., Leung, P. C. K. & Auersperg, N. Cell motility and spreading are suppressed by HOXA4 in ovarian cancer cells: possible involvement of beta1 integrin. Mol. Cancer Res. 7, 1425–37 (2009). 207. Hong, J. H. et al. Expression pattern of the class I homeobox genes in ovarian carcinoma. J. Gynecol. Oncol. 21, 29–37 (2010). 208. Morgan, R., Plowright, L., Harrington, K. J., Michael, A. & Pandha, H. S. Targeting HOX and PBX transcription factors in ovarian cancer. BMC Cancer 10, 89 (2010). 209. Piura, B. & Piura, E. Autoantibodies to tumor-associated antigens in epithelial ovarian carcinoma. J. Oncol. 2009, 581939 (2009). 210. Erkanli, A. et al. Application of Bayesian modeling of autologous antibody responses against ovarian tumor-associated antigens to cancer detection. Cancer Res. 66, 1792–8 (2006). 211. Ko, S. Y., Lengyel, E. & Naora, H. The Müllerian HOXA10 gene promotes growth of ovarian surface epithelial cells by stimulating epithelial-stromal interactions. Mol. Cell. Endocrinol. 317, 112–9 (2010). 212. Tang, W. et al. MiR-135a functions as a tumor suppressor in epithelial ovarian cancer and regulates HOXA10 expression. Cell. Signal. 26, 1420–6 (2014). 213. Andikyan, V. & Taylor, H. S. WT1 represses HOX gene expression in the regulation of gynaecologic tumour histologic type. J. Cell. Mol. Med. 13, 4522–31 (2009). 214. Greer, J. M., Puetz, J., Thomas, K. R. & Capecchi, M. R. Maintenance of functional equivalence during paralogous Hox gene evolution. Nature 403, 661–5 (2000). 215. Iacovino, M. et al. A conserved role for Hox paralog group 4 in regulation of hematopoietic progenitors. Stem Cells Dev. 18, 783–792 (2009). 216. Morgan, R., Pettengell, R. & Sohal, J. The double life of HOXB4. FEBS Lett. 578, 1–4 (2004). 158  217. Schiedlmeier B et al. HOXB4’s road map to stem cell expansion. Proc. Natl. Acad. Sci. U. S. A. (2007). 218. Will, E. et al. HOXB4 Inhibits Cell Growth in a Dose-Dependent Manner and Sensitizes Cells Towards Extrinsic Cues. Cell cyle 5, 14–22 (2006). 219. Goode, E. et al. A genome-wide association study identifies susceptibility loci for ovarian cancer at 2q31 and 8q24. Nat. Genet. 42, 874–9 (2010). 220. Lee, Y. et al. A candidate precursor to serous carcinoma that originates in the distal fallopian tube. J. Pathol. 211, 26–35 (2007). 221. Meazza, B. R. et al. Expression of HOXC4 Homeoprotein in the Nucleus of Activated Human Lymphocytes. Blood 85, 2084–2090 (1995). 222. Rieger, E. et al. Expression of the homeobox gene HOXC4 in keratinocytes of normal skin and epithelial skin tumors is correlated with differentiation. J. Invest. Dermatol. 103, 341–6 (1994). 223. Kim, E. C., Edmonston, C. R., Wu, X., Schaffer, A. & Casali, P. The HoxC4 homeodomain protein mediates activation of the immunoglobulin heavy chain 3’ hs1,2 enhancer in human B cells. Relevance to class switch DNA recombination. J. Biol. Chem. 279, 42258–69 (2004). 224. Miller, G. J. et al. Aberrant HOXC Expression Accompanies the Malignant Phenotype in Human Prostate. Cancer Res. 63, 5879–5888 (2003). 225. Nolte, C. et al. Stereospecificity and PAX6 function direct Hoxd4 neural enhancer activity along the antero-posterior axis. Dev. Biol. 299, 582–93 (2006). 226. Goodison, S., Urquidi, V. & Tarin, D. CD44 cell adhesion molecules. Mol. Pathol. 52, 189–96 (1999). 227. Hofmann, M. et al. CD44 Splice Variants Confer Metastatic Behavior in Rats : Homologous Sequences Are Expressed in Human Tumor Cell Lines. Cancer Res. 51, 5292–5297 (1991). 228. Tölg, C., Hofmann, M., Herrlich, P. & Ponta, H. Splicing choice from ten variant exons establishes CD44 variability. Nucleic Acids Res. 21, 1225–9 (1993). 229. Screaton, G. R. et al. Genomic structure of DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 alternatively spliced exons. Proc. Natl. Acad. Sci. U. S. A. 89, 12160–4 (1992). 159  230. Ermak, G., Jennings, T., Boguniewicz, a & Figge, J. Novel CD44 messenger RNA isoforms in human thyroid and breast tissues feature unusual sequence rearrangements. Clin. Cancer Res. 2, 1251–4 (1996). 231. Naor, D., Wallach-Dayan, S. B., Zahalka, M. A. & Sionov, R. V. Involvement of CD44, a molecule with a thousand faces, in cancer dissemination. Semin. Cancer Biol. 18, 260–7 (2008). 232. Kohda, D. et al. Solution structure of the link module: a hyaluronan-binding domain involved in extracellular matrix stability and cell migration. Cell 86, 767–75 (1996). 233. Borland, G., Ross, J. a & Guy, K. Forms and functions of CD44. Immunology 93, 139–48 (1998). 234. Bourguignon, L. Y. W., Zhu, H., Shao, L., Zhu, D. & Chen, Y. Rho-Kinase ( ROK ) Promotes Cell Migration in Metastatic Breast Cancer Cells. Cell Motil. Cytoskeleton 287, 269–287 (1999). 235. Legg, J. W., Lewis, C. a, Parsons, M., Ng, T. & Isacke, C. M. A novel PKC-regulated mechanism controls CD44 ezrin association and directional cell motility. Nat. Cell Biol. 4, 399–407 (2002). 236. Terpe, J., Stark, H., Prehm, P. & Gfinthert, U. CD44 variant isoforms are preferentially expressed in basal epithelia of non-malignant human fetal and adult tissues. Histochemistry 101, 79–89 (1994). 237. Mackay, C. R. et al. Expression and modulation of CD44 variant isoforms in humans. J. Cell Biol. 124, 71–82 (1994). 238. Negi, L. M. et al. Role of CD44 in tumour progression and strategies for targeting. J. Drug Target. 20, 561–73 (2012). 239. Ponta, H., Sherman, L. & Herrlich, P. A. CD44: from adhesion molecules to signalling regulators. Nat. Rev. Mol. Cell Biol. 4, 33–45 (2003). 240. Jothy, S. CD44 and its partners in metastasis. Clin. Exp. Metastasis 20, 195–201 (2003). 241. Marhaba, R. & Zöller, M. CD44 in cancer progression: adhesion, migration and growth regulation. J. Mol. Histol. 35, 211–31 (2004). 242. Günthert, U. et al. A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell 65, 13–24 (1991). 160  243. Wielenga, V. J. M. et al. Expression of CD44 Variant Proteins in Human Colorectal Cancer Is Related to Tumor Progression Advances in Brief. Cancer Res. 53, 4754–4756 (1993). 244. Wielenga, V. J. et al. Expression of CD44 in Apc and Tcf mutant mice implies regulation by the WNT pathway. Am. J. Pathol. 154, 515–23 (1999). 245. Kim, H., Yang, X. L., Rosada, C., Hamilton, S. R. & August, J. T. CD44 expression in colorectal adenomas is an early event occurring prior to K-ras and p53 gene mutation. Arch. Biochem. Biophys. 310, 504–7 (1994). 246. De Marzo, a M., Bradshaw, C., Sauvageot, J., Epstein, J. I. & Miller, G. J. CD44 and CD44v6 downregulation in clinical prostatic carcinoma: relation to Gleason grade and cytoarchitecture. Prostate 34, 162–8 (1998). 247. Shtivelman, E. & Bishop, J. M. Expression of CD44 Is Repressed in Neuroblastoma Cells. Mol. Cell. Biol. 11, 5446–5453 (1991). 248. Gao, A. C., Lou, W., Dong, J. T. & Isaacs, J. T. CD44 is a metastasis suppressor gene for prostatic cancer located on human chromosome 11p13. Cancer Res. 57, 846–9 (1997). 249. Zohar, R. et al. Intracellular osteopontin is an integral component of the CD44-ERM complex involved in cell migration. J. Cell. Physiol. 184, 118–30 (2000). 250. Yu, Q. & Stamenkovic, I. Localization of matrix metalloproteinase 9 to the cell surface provides a mechanism for CD44-mediated tumor invasion. Genes Dev. 13, 35–48 (1999). 251. Bourguignon, L. Y. W. Interaction between the Adhesion Receptor, CD44, and the Oncogene Product, p185HER2, Promotes Human Ovarian Tumor Cell Activation. J. Biol. Chem. 272, 27913–27918 (1997). 252. Tsukita, S., Oishi, K., Sato, N., Sagara, J. & Kawai, a. ERM family members as molecular linkers between the cell surface glycoprotein CD44 and actin-based cytoskeletons. J. Cell Biol. 126, 391–401 (1994). 253. Yonemura, S. et al. Ezrin/radixin/moesin (ERM) proteins bind to a positively charged amino acid cluster in the juxta-membrane cytoplasmic domain of CD44, CD43, and ICAM-2. J. Cell Biol. 140, 885–95 (1998). 254. Sillanpää, S. et al. CD44 Expression Indicates Favorable Prognosis in Epithelial Ovarian Cancer CD44 Expression Indicates Favorable Prognosis in Epithelial Ovarian Cancer. Clin. Cancer Res. 9, 5318–5324 (2003). 255. Ross, J. S. et al. Decreased CD44 standard form expression correlates with prognostic variables in ovarian carcinomas. Am. J. Clin. Pathol. 116, 122–8 (2001). 161  256. Kayastha, S. et al. Expression of the Hyaluronan Receptor , CD44S , in Epithelial Ovarian Cancer Is an Independent Predictor of Survival. Clin. Cancer Res. 5, 1073–1076 (1999). 257. Berner, H. S. et al. Expression of CD44 in effusions of patients diagnosed with serous ovarian carcinoma--diagnostic and prognostic implications. Clin. Exp. Metastasis 18, 197–202 (2000). 258. Saegusa, M., Machida, D. & Okayasu, I. CD44 expression in benign, premalignant, and malignant ovarian neoplasms: relation to tumour development and progression. J. Pathol. 337, 326–337 (1999). 259. Ween, M. P., Oehler, M. K. & Ricciardelli, C. Role of Versican, Hyaluronan and CD44 in Ovarian Cancer Metastasis. Int. J. Mol. Sci. 12, 1009–29 (2011). 260. Cannistra, S. A., Kansas, G. S., Niloff, J., Defranzo, B. & Kim, Y. Binding of Ovarian Cancer Cells to Peritoneal Mesothelium in Vitro Is Partly Mediated by CD44H. Cancer Res. 53, 3830–3838 (1993). 261. Lessan, K., Aguiar, D. J., Oegema, T., Siebenson, L. & Skubitz, a P. CD44 and beta1 integrin mediate ovarian carcinoma cell adhesion to peritoneal mesothelial cells. Am. J. Pathol. 154, 1525–37 (1999). 262. Bourguignon, L. Y., Zhu, H., Shao, L. & Chen, Y. W. CD44 interaction with c-Src kinase promotes cortactin-mediated cytoskeleton function and hyaluronic acid-dependent ovarian tumor cell migration. J. Biol. Chem. 276, 7327–36 (2001). 263. Bourguignon, L. Y. W., Gilad, E., Rothman, K. & Peyrollier, K. Hyaluronan-CD44 interaction with IQGAP1 promotes Cdc42 and ERK signaling, leading to actin binding, Elk-1/estrogen receptor transcriptional activation, and ovarian cancer progression. J. Biol. Chem. 280, 11961–72 (2005). 264. Bourguignon, L. Y. et al. Hyaluronan promotes CD44v3-Vav2 interaction with Grb2-p185(HER2) and induces Rac1 and Ras signaling during ovarian tumor cell migration and growth. J. Biol. Chem. 276, 48679–92 (2001). 265. Casey, R. C. & Skubitz, a P. CD44 and beta1 integrins mediate ovarian carcinoma cell migration toward extracellular matrix proteins. Clin. Exp. Metastasis 18, 67–75 (2000). 266. Weg-Remers, S., Ponta, H., Herrlich, P. & König, H. Regulation of alternative pre-mRNA splicing by the ERK MAP-kinase pathway. EMBO J. 20, 4194–203 (2001). 267. Okamoto, I. et al. Regulated CD44 cleavage under the control of protein kinase C, calcium influx, and the Rho family of small G proteins. J. Biol. Chem. 274, 25525–34 (1999). 162  268. Nakamura, H. et al. Constitutive and induced CD44 shedding by ADAM-like proteases and membrane-type 1 matrix metalloproteinase. Cancer Res. 64, 876–82 (2004). 269. Okamoto, I. et al. CD44 cleavage induced by a membrane-associated metalloprotease plays a critical role in tumor cell migration. Oncogene 18, 1435–46 (1999). 270. Ahrens, T. et al. Soluble CD44 inhibits melanoma tumor growth by blocking cell surface CD44 binding to hyaluronic acid. Oncogene 20, 3399–408 (2001). 271. Komuves, L. G. et al. HOXB4 homeodomain protein is expressed in developing epidermis and skin disorders and modulates keratinocyte proliferation. Dev. Dyn. 224, 58–68 (2002). 272. Liu, Y.-P. & Hematti, P. Generation of mesenchymal stromal cells from a HOXB4-expressing human embryonic stem cells colony. Cytotherapy 11, 716–725 (2009). 273. Auersperg, N. et al. E-cadherin induces mesenchymal-to-epithelial transition in human ovarian surface epithelium. Proc. Natl. Acad. Sci. U. S. A. 96, 6249–54 (1999). 274. Lee, Y. L. et al. Establishment and characterization of an immortalized human oviductal cell line. Mol. Reprod. Dev. 59, 400–9 (2001). 275. Anglesio, M. S. et al. Type-specific cell line models for type-specific ovarian cancer research. PLoS One 8, e72162 (2013). 276. Antonchuk, J., Sauvageau, G. & Humphries, R. K. HOXB4 overexpression mediates very rapid stem cell regeneration and competitive hematopoietic repopulation. Exp. Hematol. 29, 1125–34 (2001). 277. Kalloger, S. E. et al. Calculator for ovarian carcinoma subtype prediction. Mod. Pathol. 24, 512–21 (2011). 278. Maconochie, M., Nonchev, S., Morrison, a & Krumlauf, R. Paralogous Hox genes: function and regulation. Annu. Rev. Genet. 30, 529–56 (1996). 279. Brun, A. C. M. et al. Hoxb4-deficient mice undergo normal hematopoietic development but exhibit a mild proliferation defect in hematopoietic stem cells. Blood 103, 4126–33 (2004). 280. Helgason, C. D., Sauvageau, G., Lawrence, H. J., Largman, C. & Humphries, R. K. Overexpression of HOXB4 enhances the hematopoietic potential of embryonic stem cells differentiated in vitro. Blood 87, 2740–9 (1996). 281. Kleinman, H. K. et al. Basement membrane complexes with biological activity. Biochemistry 25, 312–8 (1986). 163  282. Kleinman, H. K. et al. Isolation and characterization of type IV procollagen, laminin, and heparan sulfate proteoglycan from the EHS sarcoma. Biochemistry 21, 6188–93 (1982). 283. Egeblad, M. & Werb, Z. New functions for the matrix metalloproteinases in cancer progression. Nat. Rev. Cancer 2, 161–74 (2002). 284. Whittaker, M., Floyd, C. D., Brown, P. & Gearing, a J. Design and therapeutic application of matrix metalloproteinase inhibitors. Chem. Rev. 99, 2735–76 (1999). 285. Grobelny, D., Poncz, L. & Jj, R. E. G. Inhibition of human skin fibroblast collagenase, thermolysin, and Pseudomonas aeruginosa elastase by peptide hydroxamic acids. Biochemistry 31, 7152–7154 (1992). 286. Ledour, G. et al. Introduction of the 4-(4-bromophenyl)benzenesulfonyl group to hydrazide analogs of Ilomastat leads to potent gelatinase B (MMP-9) inhibitors with improved selectivity. Bioorg. Med. Chem. 16, 8745–59 (2008). 287. Ma, D. et al. Selective inhibition of matrix metalloproteinase isozymes and in vivo protection against emphysema by substituted gamma-keto carboxylic acids. J. Med. Chem. 49, 456–8 (2006). 288. Johnson, A. R. et al. Discovery and characterization of a novel inhibitor of matrix metalloprotease-13 that reduces cartilage damage in vivo without joint fibroplasia side effects. J. Biol. Chem. 282, 27781–91 (2007). 289. Turk, B. E. et al. The structural basis for substrate and inhibitor selectivity of the anthrax lethal factor. Nat. Struct. Mol. Biol. 11, 60–6 (2004). 290. Moss, M. L. & Rasmussen, F. H. Fluorescent substrates for the proteinases ADAM17, ADAM10, ADAM8, and ADAM12 useful for high-throughput inhibitor screening. Anal. Biochem. 366, 144–8 (2007). 291. Kang, T., Tschesche, H. & Amy Sang, Q.-X. Evidence for disulfide involvement in the regulation of intramolecular autolytic processing by human adamalysin19/ADAM19. Exp. Cell Res. 298, 285–95 (2004). 292. Marchenko, G. N., Marchenko, N. D. & Strongin, A. Y. The structure and regulation of the human and mouse matrix metalloproteinase-21 gene and protein. Biochem. J. 372, 503–15 (2003). 293. Saghatelian, A., Jessani, N., Joseph, A., Humphrey, M. & Cravatt, B. F. Activity-based probes for the proteomic profiling of metalloproteases. Proc. Natl. Acad. Sci. U. S. A. 101, 10000–5 (2004). 164  294. Hotary, K., Li, X.-Y., Allen, E., Stevens, S. L. & Weiss, S. J. A cancer cell metalloprotease triad regulates the basement membrane transmigration program. Genes Dev. 20, 2673–86 (2006). 295. Cheng, J.-C., Chang, H.-M. & Leung, P. C. K. Epidermal growth factor induces human oviductal epithelial cell invasion by down-regulating E-cadherin expression. J. Clin. Endocrinol. Metab. 97, E1380–9 (2012). 296. Gaunt, S. J., Krumlauf, R. & Duboule, D. Mouse homeo-genes within a subfamily, hox-1.4, -2.6 and -5.1, display similar anteroposterior domains of expression in the embryo , but show stage- and tissue-dependent differences in their regulation. Development 141, 131–141 (1989). 297. Gao, J., Mazella, J. & Tseng, L. Hox proteins activate the IGFBP-1 promoter and suppress the function of hPR in human endometrial cells. DNA Cell Biol. 21, 819–25 (2002). 298. Nelson, C. M. & Bissell, M. J. Of extracellular matrix, scaffolds, and signaling: tissue architecture regulates development, homeostasis, and cancer. Annu. Rev. Cell Dev. Biol. 22, 287–309 (2006). 299. Adriance, M. C., Inman, J. L., Petersen, O. W. & Bissell, M. J. Myoepithelial cells: good fences make good neighbors. Breast cancer Res. 7, 190–7 (2005). 300. Lohmann, I., Mcginnis, N., Bodmer, M. & Mcginnis, W. The Drosophila Hox Gene Deformed Sculpts Head Morphology via Direct Regulation of the Apoptosis Activator reaper. Cell 110, 457–466 (2002). 301. Morgan, R., Nalliah, A. & Morsi El-Kadi, A. S. FLASH, a component of the FAS–CAPSASE8 apoptotic pathway, is directly regulated by Hoxb4 in the notochord. Dev. Biol. 265, 105–112 (2004). 302. Amsellem, S. et al. Ex vivo expansion of human hematopoietic stem cells by direct delivery of the HOXB4 homeoprotein. Nat. Med. 9, 1423–7 (2003). 303. Antonchuk, J., Sauvageau, G. & Humphries, R. K. HOXB4-induced expansion of adult hematopoietic stem cells ex vivo. Cell 109, 39–45 (2002). 304. Krosl, J. & Sauvageau, G. AP-1 complex is effector of Hox-induced cellular proliferation and transformation. Oncogene 19, 5134–41 (2000). 305. Satoh, Y. et al. Roles for c-Myc in self-renewal of hematopoietic stem cells. J. Biol. Chem. 279, 24986–93 (2004). 306. Krosl, J. et al. Cellular proliferation and transformation induced by HOXB4 and HOXB3 proteins involves cooperation with PBX1. Oncogene 16, 3403–12 (1998). 165  307. Krosl, J., Beslu, N., Mayotte, N., Humphries, R. K. & Sauvageau, G. The competitive nature of HOXB4-transduced HSC is limited by PBX1: the generation of ultra-competitive stem cells retaining full differentiation potential. Immunity 18, 561–71 (2003). 308. Kleinman, H. K. & Martin, G. R. Matrigel: basement membrane matrix with biological activity. Semin. Cancer Biol. 15, 378–86 (2005). 309. Takada, Y., Ye, X. & Simon, S. The integrins. Genome Biol. 8, 215 (2007). 310. Hood, J. D. & Cheresh, D. a. Role of integrins in cell invasion and migration. Nat. Rev. Cancer 2, 91–100 (2002). 311. Guo, W. & Giancotti, F. G. Integrin signalling during tumour progression. Nat. Rev. Mol. Cell Biol. 5, 816–26 (2004). 312. Shim, C., Zhang, W., Rhee, C. H. & Lee, J. H. Profiling of differentially expressed genes in human primary cervical cancer by complementary DNA expression array. Clin. Cancer Res. 4, 3045–50 (1998). 313. Rossi Degl’Innocenti, D. et al. Quantitative expression of the homeobox and integrin genes in human gastric carcinoma. Int. J. Mol. Med. 20, 621–9 (2007). 314. Strobel, T. & Cannistra, S. a. Beta1-integrins partly mediate binding of ovarian cancer cells to peritoneal mesothelium in vitro. Gynecol. Oncol. 73, 362–7 (1999). 315. Wolf, K. & Friedl, P. Extracellular matrix determinants of proteolytic and non-proteolytic cell migration. Trends Cell Biol. 21, 736–44 (2011). 316. Griner, S. E., Joshi, J. P. & Nahta, R. Growth differentiation factor 15 stimulates rapamycin-sensitive ovarian cancer cell growth and invasion. Biochem. Pharmacol. 85, 46–58 (2013). 317. Wang, F.-Q., So, J., Reierstad, S. & Fishman, D. a. Matrilysin (MMP-7) promotes invasion of ovarian cancer cells by activation of progelatinase. Int. J. Cancer 114, 19–31 (2005). 318. Casey, R. C. et al. Establishment of an in vitro assay to measure the invasion of ovarian carcinoma cells through mesothelial cell monolayers. Clin. Exp. Metastasis 20, 343–56 (2003). 319. Burleson, K. M., Hansen, L. K. & Skubitz, A. P. N. Ovarian carcinoma spheroids disaggregate on type I collagen and invade live human mesothelial cell monolayers. Clin. Exp. Metastasis 21, 685–697 (2005). 166  320. Al-Alem, L. F., McCord, L. a, Southard, R. C., Kilgore, M. W. & Curry, T. E. Activation of the PKC pathway stimulates ovarian cancer cell proliferation, migration, and expression of MMP7 and MMP10. Biol. Reprod. 89, 73 (2013). 321. Sodek, K. L., Brown, T. J. & Ringuette, M. J. Collagen I but not Matrigel matrices provide an MMP-dependent barrier to ovarian cancer cell penetration. BMC Cancer 8, 223 (2008). 322. Kokenyesi, R., Murray, K. P., Benshushan, A., Huntley, E. D. & Kao, M.-S. Invasion of interstitial matrix by a novel cell line from primary peritoneal carcinosarcoma, and by established ovarian carcinoma cell lines: role of cell–matrix adhesion molecules, proteinases, and E-cadherin expression. Gynecol. Oncol. 89, 60–72 (2003). 323. Kong, Y. et al. Matrix metalloproteinase activity modulates tumor size, cell motility, and cell invasiveness in murine aggressive fibromatosis. Cancer Res. 64, 5795–803 (2004). 324. Monvoisin, A. et al. Involvement of matrix metalloproteinase type-3 in hepatocyte growth factor-induced invasion of human hepatocellular carcinoma cells. Int. J. Cancer 97, 157–62 (2002). 325. Lombard, M. A. et al. Synthetic Matrix Metalloproteinase Inhibitors and Tissue Inhibitor of Metalloproteinase ( TIMP ) -2 , but not TIMP-1 , Inhibit Shedding of Tumor Necrosis Factor- α Receptors in a Human Colon Adenocarcinoma ( Colo 205 ) Cell Line Synthetic Matrix Metallopr. (1998). 326. Scotton, C., Wilson, J., Scott, K. & Stamp, G. Multiple actions of the chemokine CXCL12 on epithelial tumor cells in human ovarian cancer. Cancer Res. 62, 5930–5938 (2002). 327. Moss, N. M. et al. Ovarian cancer cell detachment and multicellular aggregate formation are regulated by membrane type 1 matrix metalloproteinase: a potential role in I.p. metastatic dissemination. Cancer Res. 69, 7121–9 (2009). 328. Duffy, M. J., McKiernan, E., O’Donovan, N. & McGowan, P. M. Role of ADAMs in cancer formation and progression. Clin. Cancer Res. 15, 1140–1144 (2009). 329. Mochizuki S & Okada Y. ADAMs in cancer cell proliferation and progression. Cancer Sci. (2007). 330. Overall, C. M. & Kleifeld, O. Validating matrix metalloproteinases as drug targets and anti-targets for cancer therapy. Nat. Rev. Cancer 6, 227–239 (2006). 331. Ishii, S. et al. CD44 participates in the adhesion of human colorectal carcinoma cells to laminin and type IV collagen. Surg. Oncol. 2, 255–64 (1993). 167  332. Kokenyesi, R. Ovarian Carcinoma Cells Synthesize Both Chondroitin Sulfate and Heparan Sulfate Cell Surface Proteoglycans That Mediate Cell Adhesion to Interstitial Matrix. J. Cell. Biochem. 270, 259–270 (2001). 333. Ricciardelli, C. & Rodgers, R. J. Extracellular Matrix of Ovarian Tumors. Semin. Reprod. Med. 24, 270–82 (2006). 334. Neelakandan, M., Miletti-Gonzalez, K. E., Ravindranath, A. K. & Rodriguez-Rodriguez, L. Tumor necrosis factor-alpha differentially modulates CD44 expression in ovarian cancer cells. Mol. Cancer Res. 4, 511–520 (2006). 335. Nagano, O. et al. Cell-matrix interaction via CD44 is independently regulated by different metalloproteinases activated in response to extracellular Ca(2+) influx and PKC activation. J. Cell Biol. 165, 893–902 (2004). 336. Umeda, S. et al. Prognostic significance of HOXB4 in de novo acute myeloid leukemia. Hematology 17, 125–31 (2012). 337. Ahuja, D., Sáenz-Robles, M. T. & Pipas, J. M. SV40 large T antigen targets multiple cellular pathways to elicit cellular transformation. Oncogene 24, 7729–45 (2005). 338. Provenza, C., Young, R. H. & Prat, J. Anaplastic Carcinoma in Mucinous Ovarian Tumors of Stage on Prognosis , Their Histologic Spectrum , and Overlap. Am. J. Surg. Pathol. 32, 383–389 (2008). 339. Shen, H. & Laird, P. W. Interplay between the cancer genome and epigenome. Cell 153, 38–55 (2013). 340. Leonhardt, H., Page, A. W., Weier, H.-U. & Bestor, T. H. A targeting sequence directs DNA methyltransferase to sites of DNA replication in mammalian nuclei. Cell 71, 865–73 (1992). 341. Oka, M. et al. De novo DNA methyltransferases Dnmt3a and Dnmt3b primarily mediate the cytotoxic effect of 5-aza-2’-deoxycytidine. Oncogene 24, 3091–9 (2005). 342. Harris, D. M. et al. Transformation of human mesenchymal cells and skin fibroblasts into hematopoietic cells. PLoS One 6, e21250 (2011). 343. Rodríguez-Rodero, S. et al. DNA methylation signatures identify biologically distinct thyroid cancer subtypes. J. Clin. Endocrinol. Metab. 98, 2811–21 (2013). 344. Kikuchi, R. et al. Frequent inactivation of a putative tumor suppressor, angiopoietin-like protein 2, in ovarian cancer. Cancer Res. 68, 5067–75 (2008). 168  345. Staub, J. et al. Epigenetic silencing of HSulf-1 in ovarian cancer:implications in chemoresistance. Oncogene 26, 4969–78 (2007). 346. Shridhar, V. et al. Loss of Expression of a New Member of the DNAJ Protein Family Confers Resistance to Chemotherapeutic Agents Used in the Treatment of Ovarian Cancer. Cancer Res. 61, 4258–4265 (2001). 347. Min, K.-J., So, K. a, Ouh, Y.-T., Hong, J.-H. & Lee, J.-K. The effects of DNA methylation and epigenetic factors on the expression of CD133 in ovarian cancers. J. Ovarian Res. 5, 28 (2012). 348. Fang, F. et al. A phase 1 and pharmacodynamic study of decitabine in combination with carboplatin in patients with recurrent, platinum-resistant, epithelial ovarian cancer. Cancer 116, 4043–53 (2010). 349. Han, L., Witmer, P. D., Casey, E., Valle, D. & Sukumar, S. DNA methylation regulates MicroRNA expression. Cancer Biol. Ther. 6, 6–10 (2007). 350. Callahan, M. J. et al. Primary fallopian tube malignancies in BRCA-positive women undergoing surgery for ovarian cancer risk reduction. J. Clin. Oncol. 25, 3985–90 (2007). 351. Kajita, M. et al. Membrane-type 1 matrix metalloproteinase cleaves CD44 and promotes cell migration. J. Cell Biol. 153, 893–904 (2001). 352. Risk, M. C. et al. Differential gene expression in benign prostate epithelium of men with and without prostate cancer: evidence for a prostate cancer field effect. Clin. Cancer Res. 16, 5414–23 (2010). 353. Daga, a et al. The retroviral transduction of HOXC4 into human CD34(+) cells induces an in vitro expansion of clonogenic and early progenitors. Exp. Hematol. 28, 569–74 (2000). 354. Kim, D.-Y. et al. Upregulated hoxC4 induces CD14 expression during the differentiation of acute promyelocytic leukemia cells. Leuk. Lymphoma 46, 1061–6 (2005).      169  Appendices  Appendix A  Expression and Function of HOXC4 in Ovarian Cancer Cells A.1 Rationale               HOXC4 protein expression is observed in activated and/or proliferating T-lymphocytes, B-lymphocytes and NK-cells221. Early expression and nuclear localization was thought to suggest that HOXC4 may be involved in the regulation of lymphocyte activation and/or proliferation221. In keratinocytes of normal skin and in epithelial skin tumors, HOXC4 is expressed in differentiated keratinocytes and a lack of differentiation (as in neoplastic cells) is accompanied by down-regulation of HOXC4222. Also, HOXC4 has been shown to exert pro-proliferative and differentiation-suppressive effects on hematopoietic progenitor cells, which are similar to those of HOXB4215. In human cancers, HOXC4 is aberrantly expressed in human prostate cancer cells (LNCaP) displaying a malignant phenotype224. Moreover, studies suggest that HOXC4 is differentially expressed in the epithelium adjacent to prostate cancer and benign prostate352. In ovarian cancer, Morgan et al. found that HOXC4 mRNA levels were lower than (SKOV-3) or similar to (OV-90) normal ovary208. In contrast, Hong et al. showed similar intermediate HOXC4 mRNA expression within TOV-21G, OV-90, SKOV-3 and SW626 cells and mild to intermediate HOXC4 mRNA levels in four samples of normal ovaries207. Also, Yamashita et al. did not find any significant changes of HOXC4 mRNA levels in CaOV-3 cells compared with normal ovary30.                Although HOX genes likely have a number of unique functions, knock-out studies in mice indicate that paralogous HOX genes can have overlapping roles214. A study of group 3 Hox paralog double mutants  demonstrated that the sum of Hox paralogs was more powerful than any 170  single paralog56. Furthermore, demonstration of a cooperative function of group 4 Hox paralogs in specifying regional identity suggests that similar mechanisms might also be relevant to other group 4 Hox paralog-expressing tissues55,215. HOXA4 has been shown to suppress cell motility and spreading in ovarian cancer cells, and β1 integrin is possibly involved in this function206. The studies described in Chapter 3 have established that HOXB4 exerts invasion-suppressive effects in ovarian cancer cells. However, the expression and functional roles of HOXC4 in ovarian cancer are still unknown. Therefore, our hypothesis is that HOXC4 functions in a manner complementary to those of HOXA4 and HOXB4 in ovarian cancer cells. To test our hypothesis, we used real-time PCR to detect the mRNA levels of HOXC4 and the trans-well migration and Matrigel invasion assays to test the function of HOXC4 in ovarian cancer cells.   A.2 Expression of HOXC4 in Ovarian Cancer Cells               We first used RT-qPCR to examine HOXC4 mRNA levels in an immortalized fallopian tube epithelial line (OE-E6/E7)274, three IOSE cell lines (IOSE80,29 and 397), and nine ovarian cancer cell lines (OVCAR-2, OVCAR-4, OVACAR-5, OVCAR-8, OVACAR-10, A2780, CaOV-3, OVCAR-3 and SKOV-3) (Appendix Figure A.1). To confirm the PCR results, we performed DNA sequencing of these PCR products (DNA sequencing results are listed in Appendix B.2). We found the expression of HOXC4 was lowest in OE-E6/E7 cells, variable in ovarian cancer cell lines, and relatively high in IOSE cell lines. Two different antibodies were tested to detect HOXC4 protein levels in ovarian cancer cells, however siRNA knockdown studies demonstrated that neither of these antibodies was specific to HOXC4 (Appendix Figure B.3). Since we observed varied expression levels of HOXC4 in ovarian cancer cells, next we investigated the effects of HOXC4 in migration and invasion of ovarian cancer cells by manipulating the expression of HOXC4. 171  A.3 Down-Regulation of HOXC4 Does Not Affect Migration or Invasion of Ovarian Cancer Cells               The complementary effects of HOXA4 and HOXB4 on migration and invasion, respectively, suggest that HOXC4 might also exert regulatory effects on ovarian cancer cell migration and/or invasion. To explore these functions, we used an siRNA approach to down-regulate HOXC4 in two cell lines with high HOXC4 expression (A2780 and OVCAR-10). As we described in Chapter 3, preliminary studies assessing transfection efficiency were performed with Lipofectamine RNAiMAX (Invitrogen) and fluorescently labeled siRNA (siGLO Green, Thermo Scientific). Epifluorescence microscopy one day after transfection confirmed ≥80% transfection efficiency for each cell line (Appendix Figure B.1). Next, we treated cells with Lipofectamine RNAiMAX alone, control siRNA (ON-TARGET plus siCONTROL, Thermo scientific) or HOXC4-specific siRNA (ON-TARGET plus SMART pool, Thermo scientific; sequences of the 4 siHOXC4 duplexes are listed in Appendix B.4) at a concentration of 50 nM in each. We observed that HOXC4 mRNA levels were down-regulated by 60%-90%, and this level of knock-down could be maintained for up to five days after transfection (Appendix Figure A.2).                Uncoated or Matrigel coated (~1mg/ml) trans-well inserts with media with 10%FBS in the lower chamber were used to assess chemotactic cell migration and invasion. A2780 and OVCAR-10 cells were transfected with Lipofectamine RNAiMAX alone, control-siRNA or siRNA-targeting HOXC4 for two days, seeded in these trans-well inserts and cultured for an additional day. However, compared with control, siRNA-mediated down-regulation of HOXC4 showed no significant difference in either trans-well migration (Appendix Figure A.3) or Matrigel invasion (Appendix Figure A.4) in A2780 and OVCAR-10 cells. Taken together, our 172  results demonstrate that down-regulation of endogenous HOXC4 does not affect either trans-well migration or Matrigel invasion of ovarian cancer cells.  A.4 Discussion                HOXC4 is expressed in activated and/or proliferating T-lymphocytes, B-lymphocytes and NK-cells221. It is also expressed in differentiated keratinocytes, and appears to be down-regulated in neoplastic keratinocytes222. In contrast, HOXC4 is up-regulated in malignant prostate cell lines, lymph node metastases and primary prostate tumor epithelium224. HOXC4 was even differentially expressed in the benign epithelium adjacent prostate cancer and benign prostate352.                Our study is the first to test HOXC4 expression in such a large number of ovarian cancer cell lines as well as one human fallopian tube epithelial cell line and three immortalized OSE cell lines. We found varying HOXC4 mRNA levels in these ovarian cancer cell lines, very high expression in IOSE cells and low expression in OE cells. Yamashita et al. reported that HOXC13 was the only overexpressed HOXC gene mRNA in CaOV-3 cells compared with those in normal ovary30. However, they did not report decreased expression of HOXC4 gene in ovarian cancer cells compared with those in normal ovary, as they used normal ovary instead of pure ovarian surface epithelium30.  We observed that HOXC4 mRNA levels were much higher in three IOSE cell lines than in CaOV-3 cells, which might be in agreement with Yamashita’s studies in some degree.  Consistent with our findings, Morgan et al. also found that HOXC4 mRNA levels were lower in SKOV-3 cells than in normal ovary208. In contrast, Hong et al. showed higher HOXC4 mRNA expression in SKOV-3 cells than in four samples of normal ovaries207. 173                The function of HOXC4 has been reported in several tissues and cancers. Early expression and nuclear localization have been used to argue that HOXC4 may be involved in the regulation of lymphocyte activation and/or proliferation, however this has not been functionally verified221. Similarly, a role for HOXC4 in maintaining the differentiation of keratinocytes has been postulated based on the differential expression of HOXC4 between normal keratinocytes and undifferentiated epithelial skin tumors222. Indeed, HOXC4 exerts pro-proliferative and differentiation-suppressive effects on hematopoietic progenitor cells that are similar to those of HOXB4215,353. Moreover, forced expression of HOXC4 induces the differentiation of a human acute promyelocytic leukemia cell line in response to all-trans-retinoic acid treatment354. HOXC4 is also overexpressed in the malignant phenotype of human prostate cancer (LNCaP cells)224, and differentially expressed in the benign epithelium adjacent prostate cancer and normal prostate tissue352.                Previous studies have demonstrated that paralogous HOX genes might play overlapping or synergistic roles, and that the sum of HOX paralogs is more powerful than any single paralog55,56,214,215. Iacovino et al. showed that all group 4 Hox paralogs exert similar effects in promoting proliferation and suppressing differentiation in hematopoietic stem cells215. Likewise, Horan et al. reported that triple mutation of group 4 Hox genes led to a more complete transformation of cervical vertebrae55. In ovarian cancer, HOXA4 has been shown to suppress cell motility and spreading206, and our studies presented in Chapter 3 demonstrate that HOXB4 suppresses cell invasion. However, down-regulation of HOXC4 did not affect either the migration or invasion of ovarian cancer cells. Therefore, our findings suggest that the role of HOXC4 in ovarian cancer differs from that of other group 4 HOX paralogs (HOXA4 and HOXB4). Since other studies suggest that HOXC4 might regulate proliferation or differentiation 174  of lymphocytes221, hematopoietic stem cells215,353, leukemias354, skin tumors222 and prostate cancerc224,352, future studies exploring these processes in ovarian cancer cells will be of interest.                      175   Figure A.1 HOXC4 expression in human fallopian tube epithelial cells, ovarian cancer cells, and immortalized OSE cell lines Real-time PCR analyses of HOXC4 mRNA levels were represented as fold change relative to OE-E6/E7 (mean ± SEM). Two separate experiments were performed on different cultures, and each sample was assayed in triplicate. The comparative Cq(2−ΔΔCq) method with GAPDH as the reference gene was used in this study. OE-E6/E7: human fallopian tube epithelial cells; OVCAR-2, OVCAR-4, OVCAR-5, OVCAR-8, OVCAR-10, A2780, OVCAR-3, and SKOV-3 are ovarian cancer cell lines; IOSE80, IOSE29 and IOSE397 are immortalized ovarian surface epithelial cell lines.       176   Figure A.2 siRNA mediated down-regulation of HOXC4 Cells were transfected and then cultured for 2-5 days with Lipofectamine alone (iMAX), control siRNA (siCon) or HOXC4 siRNA (siC4). Real-time PCR analysis showed fold change relative to iMAX (mean ± SEM) of down-regulated HOXC4 mRNA in A2780 (A) and OVCAR-10 (B) cells. Two separate experiments were performed on different cultures, and each sample was assayed in triplicate. The comparative Cq(2−ΔΔCq) method with GAPDH as the reference gene was used in this study.          177   Figure A.3 HOXC4 does not regulate ovarian cancer cell migration A2780 and OVCAR-10 cells were transfected and then cultured for two days with Lipofectamine alone (iMAX), control siRNA (siCon) or HOXB4 siRNA (siB4). Cells were trypsinized and seeded in uncoated trans-well inserts and then cultured for a further one day. Migrating cell nuclei were stained with Hoechst and counted using fluorescence microscopy. At least 5 random fields of the inserts were counted and 100 cells were included. Histogram showed the migrating cells compared to siCon in A2780 (A) and OVCAR-10 (B) cells. Results are presented as mean ± SEM from at least three independent experiments with triplicate inserts. Data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. Values that are statistically different from one another (P < 0.05) are indicated by different letters.      178   Figure A.4 HOXC4 does not regulate ovarian cancer cell invasion A2780 and OVCAR-10 cells were transfected and then cultured for two days with Lipofectamine alone (iMAX), control siRNA (siCon) or HOXB4 siRNA (siB4). Cells were trypsinized and seeded in Matrigel coated trans-well inserts and then cultured for a further one day. Invading cell nuclei were stained with Hoechst and counted using fluorescence microscopy. At least 5 random fields of the inserts were counted and 100 cells were included. Histogram showed the invading cells compared to siCon in A2780 (A) and OVCAR-10 (B) cells. Results are presented as mean ± SEM from at least three independent experiments with triplicate inserts. Data were normalized by a log transformation to eliminate the variation of this experiment, and then analyzed by a one-way ANOVA followed by Tukey’s test. Values that are statistically different from one another (P < 0.05) are indicated by different letters.       179  Appendix B    B.1 HOXB4 PCR products sequencing result   180  B.2 HOXC4 PCR products sequencing result   B.3 Target sequences of the siRNA pool on HOXB4 J-012892-09 AGGAAUAUUCACAGAGCGA J-012892-10 GCGCAAAGUUCACGUGAGC J-012892-11 GCAAAGAGCCCGUCGUCUA J-012892-12 CGAAGAUGGAUCCACGUUU   B.4 Target sequences of the siRNA pool on HOXC4 J-013462-05 GGACAUUACCAGGUUAUUA J-013462-06 CGUAUUUGAUGGACUCUAA J-013462-07 CUGAACACAGUCCGGAAUA J-013462-08 CGAAGGAGAAGGAUCGAGA   181  B.5 Target sequences of the siRNA pool on CD44 J-009999-06 GAAUAUAACCUGCCGCUUU J-009999-07 CAAGUGGACUCAACGGAGA J-009999-08 CGAAGAAGGUGUGGGCAGA J-009999-09 GAUCAACAGUGGCAAUGGA  B.6 Target sequences of the siRNA pool on DNMT1 J-004605-06 GCACCUCAUUUGCCGAAUA  J-004605-07 AUAAAUGAAUGGUGGAUCA J-004605-08 CCUGAGCCCUACCGAAUUG J-004605-09 GGACGACCCUGACCUCAAA  B.7 Target sequences of the siRNA pool on DNMT3A J-006672-23 GCAUUCAGGUGGACCGCUA  J-006672-24 GCACUGAAAUGGAAAGGGU J-006672-25 CUCAGGCGCCUCAGAGCUA J-006672-26 GGGACUUGGAGAAGCGGAG  B.8 Target sequences of the siRNA pool on DNMT3B J-006395-07 ACGCACAGCUGACGACUCA  J-006395-08 UUUACCACCUGCUGAAUUA J-006395-09 CGAAUAACAACAGUGUCU J-006395-10 GCUCUUACCUUACCAUCGA 182    Figure B.1 Transfection of Lipofectamine RNAiMAX in ovarian cancer cells A2780, OVCAR-8, CaOV-3 and OVCAR-10 cells were placed in the cell culture dishes at the density of 7×103/cm2 for one day, then transfected with Lipofectamine RNAiMAX at the concentrations of (1.5, 2.5 and 3.5 µl/ml) containing siGLO Green transfection indicator (50nM) and cultured for one day. Fluorescence and phase images were taken after media changing. Merged images showed the cells in green color were the transfected cells. (40×, Scale bar represents 25 µm).  183    Figure B.2 Several invasion-relative proteins cannot be regulated by HOXB4 A2780, OVCAR-8 and CaOV-3 cells were transfected for two days with Lipofectamine alone (iMAX), control siRNA (siCon) or HOXB4 siRNA (siB4). OVCAR-5 cells were overexpressed with either control (Vector) or HOXB4 (HOXB4) vectors. Western blotting analysis showed the preliminary data of several invasion-relative proteins in A2780, CaOV-3, OVCAR-8 and OVCAR-5 cells (n=1).     184   Figure B.3 Optimization of HOXC4 antibodies Western blot analysis showed that LNCaP (positive control), IOSE397, OE-E6/E7 and OVCAR-4 cells were incubated with primary antibodies against HOXC4 (ab24710: A and B; sc N-20: C and D) diluted in 5% BSA at concentrations from 1:4000 to 1:8000 (ab24710) or from 1:400 to 1:800 (sc N-20). OVCAR-4 cells were transfected for two days with Lipofectamine alone (OV4 iMAX), control siRNA (OV4 siCtrl) or HOXC4 siRNA (OV4 siC4). Predicted band size for both antibodies is 30 kD. MW: molecular weight; kD: kilodalton. 185  Appendix C  Gene Expressing Microarray analysis of HOXB4 overexpressing cells shows target genes more than 1.5-fold change Fold change regulation GeneSymbol Description 2.945768 up LRRC4C Homo sapiens leucine rich repeat containing 4C (LRRC4C), mRNA [NM_020929] 2.53943 up  lincRNA:chr6:22144105-22144213 reverse strand 1.965334 up  lincRNA:chr12:1612439-1613590 forward strand 1.83768 up ANXA13 Homo sapiens annexin A13 (ANXA13), transcript variant 2, mRNA [NM_001003954] 1.582274 up  Visual system homeobox 1 (Transcription factor VSX1)(Retinal inner nuclear layer homeobox protein)(Homeodomain protein RINX) [Source:UniProtKB/Swiss-Prot;Acc:Q9NZR4] [ENST00000409285] 2.74434 up   1.653257 up APCDD1 Homo sapiens adenomatosis polyposis coli down-regulated 1 (APCDD1), mRNA [NM_153000] 4.485701 up RYR3 Homo sapiens ryanodine receptor 3 (RYR3), mRNA [NM_001036] 6.406531 up COX7A1 Homo sapiens cytochrome c oxidase subunit VIIa polypeptide 1 (muscle) (COX7A1), mRNA [NM_001864] 1.594943 up RGS2 Homo sapiens regulator of G-protein signaling 2, 24kDa (RGS2), mRNA [NM_002923] 2.59649 up OR8S1 Homo sapiens olfactory receptor, family 8, subfamily S, member 1 (OR8S1), mRNA [NM_001005203] 1.566947 up LOC100128591 Homo sapiens cDNA FLJ46872 fis, clone UTERU3013167. [AK128705] 7.102935 up COL3A1 Homo sapiens collagen, type III, alpha 1 (COL3A1), mRNA [NM_000090] 1.512202 up DAB2 Homo sapiens disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) (DAB2), mRNA [NM_001343] 1.545587 up SLCO2A1 Homo sapiens solute carrier organic anion transporter family, member 2A1 (SLCO2A1), mRNA [NM_005630] 1.647654 up KALRN Homo sapiens kalirin, RhoGEF kinase (KALRN), transcript variant 2, mRNA [NM_003947] 10.98373 up HSD17B2 Homo sapiens hydroxysteroid (17-beta) dehydrogenase 2 (HSD17B2), mRNA [NM_002153] 1.665385 up DCLK1 Homo sapiens doublecortin-like kinase 1 (DCLK1), mRNA [NM_004734] 3.20023 up LOC100271836 602363146F1 NIH_MGC_90 Homo sapiens cDNA clone IMAGE:4471450 5', mRNA sequence [BG250912] 2.344484 up  Fermitin family homolog 1 (Unc-112-related protein 1)(Kindlin-1) [ENST00000378844] 186  Fold change regulation GeneSymbol Description 1.774051 up DUOX1 Homo sapiens dual oxidase 1 (DUOX1), transcript variant 1, mRNA [NM_017434] 7.857379 up GC Homo sapiens group-specific component (vitamin D binding protein) (GC), mRNA [NM_000583] 1.550599 up DEFB103A Homo sapiens defensin, beta 103A (DEFB103A), mRNA [NM_018661] 1.951959 up ANXA10 Homo sapiens annexin A10 (ANXA10), mRNA [NM_007193] 1.633459 up  Parathyroid hormone/parathyroid hormone-related peptide receptor Precursor (Parathyroid hormone 1 receptor)(PTH1 receptor)(PTH/PTHrP type I receptor)(PTH/PTHr receptor) [Source:UniProtKB/Swiss-Prot;Acc:Q03431] [ENST00000313063] 1.682263 up TUBB2B Homo sapiens tubulin, beta 2B (TUBB2B), mRNA [NM_178012] 1.737274 up C6orf122 Homo sapiens chromosome 6 open reading frame 122 (C6orf122), non-coding RNA [NR_026781] 1.5067 up GAP43 Homo sapiens growth associated protein 43 (GAP43), transcript variant 2, mRNA [NM_002045] 1.64382 up LOC283403 Homo sapiens cDNA clone IMAGE:5268545 [BC038743] 2.050502 up  lincRNA:chr9:102564752-102567347 reverse strand 2.486157 up SPANXN5 Homo sapiens SPANX family, member N5 (SPANXN5), mRNA [NM_001009616] 2.526026 up TAGAP Homo sapiens T-cell activation RhoGTPase activating protein (TAGAP), transcript variant 3, mRNA [NM_138810] 2.92518 up hCG_1814486 full-length cDNA clone CS0DH003YA11 of T cells (Jurkat cell line) of Homo sapiens (human) [CR623603] 1.738363 up C1orf14 Homo sapiens chromosome 1 open reading frame 14 (C1orf14), mRNA [NM_030933] 2.0213 up ECM1 Homo sapiens extracellular matrix protein 1 (ECM1), transcript variant 1, mRNA [NM_004425] 8.07331 up HS3ST3B1 Heparan sulfate glucosamine 3-O-sulfotransferase 3B1 (EC 2.8.2.30)(Heparan sulfate D-glucosaminyl 3-O-sulfotransferase 3B1)(Heparan sulfate 3-O-sulfotransferase 3B1)(h3-OST-3B) [Source:UniProtKB/Swiss-Prot;Acc:Q9Y662] [ENST00000360954] 2.281557 up COLEC12 Homo sapiens collectin sub-family member 12 (COLEC12), mRNA [NM_130386] 4.026973 up PCK1 Homo sapiens phosphoenolpyruvate carboxykinase 1 (soluble) (PCK1), mRNA [NM_002591] 1.787736 up  lincRNA:chr15:79676505-79677063 forward strand 1.653979 up LOC100133654 PREDICTED: Homo sapiens hypothetical LOC100133654, mRNA [XM_001723539] 187  Fold change regulation GeneSymbol Description 3.242532 up FLT1 Homo sapiens fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) (FLT1), transcript variant 1, mRNA [NM_002019] 1.719073 up AFP Homo sapiens alpha-fetoprotein (AFP), mRNA [NM_001134] 1.806333 up  lincRNA:chr12:132852068-132854915 forward strand 1.610424 up  lincRNA:chr3:106830637-106959449 reverse strand 1.745884 up MYPN Homo sapiens myopalladin (MYPN), mRNA [NM_032578] 1.585805 up STAC Homo sapiens SH3 and cysteine rich domain (STAC), mRNA [NM_003149] 4.11934 up MFAP5 Homo sapiens microfibrillar associated protein 5 (MFAP5), mRNA [NM_003480] 2.781949 up CNN1 Homo sapiens calponin 1, basic, smooth muscle (CNN1), mRNA [NM_001299] 1.6155 up MRGPRF Homo sapiens MAS-related GPR, member F (MRGPRF), transcript variant 2, mRNA [NM_145015] 1.943535 up ADAMTS14 Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 14 (ADAMTS14), transcript variant 1, mRNA [NM_139155] 1.640664 up  lincRNA:chr6:53794843-53862463 forward strand 1.736129 up C10orf68 Homo sapiens chromosome 10 open reading frame 68 (C10orf68), mRNA [NM_024688] 1.692808 up LOC729860 PREDICTED: Homo sapiens hypothetical protein LOC729860 (LOC729860), miscRNA [XR_078773] 1.657494 up GATA6 Homo sapiens GATA binding protein 6 (GATA6), mRNA [NM_005257] 6.18873 up KCNIP1 Homo sapiens Kv channel interacting protein 1 (KCNIP1), transcript variant 1, mRNA [NM_001034837] 1.820798 up PPP2R2C Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform (PPP2R2C), transcript variant 1, mRNA [NM_020416] 1.751997 up OR2H1 Homo sapiens olfactory receptor, family 2, subfamily H, member 1 (OR2H1), mRNA [NM_030883] 2.071907 up  lincRNA:chr3:30157282-30517504 reverse strand 2.129298 up PTPN7 Homo sapiens protein tyrosine phosphatase, non-receptor type 7 (PTPN7), transcript variant 2, mRNA [NM_080588] 1.767048 up  V2-8 protein Fragment  [Source:UniProtKB/TrEMBL;Acc:Q5NV85] [ENST00000390313] 1.53981 up C20orf118 Homo sapiens chromosome 20 open reading frame 118 (C20orf118), mRNA [NM_080628] 188  Fold change regulation GeneSymbol Description 1.91424 up LGI2 Homo sapiens leucine-rich repeat LGI family, member 2 (LGI2), mRNA [NM_018176] 1.713418 up CSGALNACT1 Homo sapiens chondroitin sulfate N-acetylgalactosaminyltransferase 1 (CSGALNACT1), transcript variant 2, mRNA [NM_018371] 1.501265 up CD44 Homo sapiens CD44 molecule (Indian blood group) (CD44), transcript variant 1, mRNA [NM_000610] 1.836379 up  Putative uncharacterized protein ENSP00000340488 Fragment  [Source:UniProtKB/TrEMBL;Acc:A6NL95] [ENST00000338857] 1.673429 up C1orf138 PREDICTED: Homo sapiens chromosome 1 open reading frame 138 (C1orf138), miscRNA [XR_039834] 1.714552 up OR4A47 Homo sapiens olfactory receptor, family 4, subfamily A, member 47 (OR4A47), mRNA [NM_001005512] 1.667522 up LOC650392 Homo sapiens cDNA clone IMAGE:5264670 [BC036550] 1.904093 up BCO2 Homo sapiens beta-carotene oxygenase 2 (BCO2), transcript variant 1, mRNA [NM_031938] 2.327419 up  lincRNA:chr9:6652600-6659300 forward strand 2.046802 up  GB 50.40922 up FGB Homo sapiens fibrinogen beta chain (FGB), mRNA [NM_005141] 1.540479 up MYLK Homo sapiens myosin light chain kinase (MYLK), transcript variant 1, mRNA [NM_053025] 1.543595 up BHLHE41 Homo sapiens basic helix-loop-helix family, member e41 (BHLHE41), mRNA [NM_030762] 1.918266 up FILIP1 Homo sapiens filamin A interacting protein 1 (FILIP1), mRNA [NM_015687] 1.99233 up  lincRNA:chr1:173204502-173288452 reverse strand 2.428216 up C10orf122 Homo sapiens chromosome 10 open reading frame 122 (C10orf122), mRNA [NM_001128202] 1.930143 up CTRC Homo sapiens chymotrypsin C (caldecrin) (CTRC), mRNA [NM_007272] 1.679281 up  Uncharacterized protein C1orf167  [Source:UniProtKB/Swiss-Prot;Acc:Q5SNV9] [ENST00000444493] 1.849386 up DGCR9 Homo sapiens DiGeorge syndrome critical region gene 9 (DGCR9), non-coding RNA [NR_024159] 3.074898 up LOC388630 PREDICTED: Homo sapiens UPF0632 protein A (LOC388630), mRNA [XM_001132797] 1.715859 up  lincRNA:chr1:852245-854050 reverse strand 1.750562 up EPHA8 Homo sapiens EPH receptor A8 (EPHA8), transcript variant 1, mRNA [NM_020526] 2.278685 up C8orf84 Homo sapiens chromosome 8 open reading frame 84 (C8orf84), mRNA [NM_153225] 189  Fold change regulation GeneSymbol Description 2.024487 up   1.948149 up FLJ43585 Homo sapiens cDNA FLJ43585 fis, clone SKNMC2007502 [AK125573] 2.944835 up  lincRNA:chr10:112231435-112242285 forward strand 1.896316 up CXorf25 PREDICTED: Homo sapiens chromosome X open reading frame 25 (CXorf25), miscRNA [XR_078589] 3.399396 up FABP4 Homo sapiens fatty acid binding protein 4, adipocyte (FABP4), mRNA [NM_001442] 1.863663 up LOC440104 PREDICTED: Homo sapiens similar to RIKEN cDNA 1110012D08, transcript variant 1 (LOC440104), mRNA [XM_001721986] 1.966137 up RANBP17 Homo sapiens RAN binding protein 17 (RANBP17), mRNA [NM_022897] 1.812037 up TRPV1 Homo sapiens transient receptor potential cation channel, subfamily V, member 1 (TRPV1), transcript variant 3, mRNA [NM_080706] 2.406638 up HIF3A Homo sapiens hypoxia inducible factor 3, alpha subunit (HIF3A), transcript variant 2, mRNA [NM_022462] 2.004787 up SIGLEC12 Homo sapiens sialic acid binding Ig-like lectin 12 (SIGLEC12), transcript variant 1, mRNA [NM_053003] 2.493302 up CTNNA2 Homo sapiens catenin (cadherin-associated protein), alpha 2 (CTNNA2), transcript variant 1, mRNA [NM_004389] 2.974674 up C2orf40 Homo sapiens chromosome 2 open reading frame 40 (C2orf40), mRNA [NM_032411] 2.029018 up QRICH2 Homo sapiens glutamine rich 2 (QRICH2), mRNA [NM_032134] 1.501077 up MYT1L Homo sapiens myelin transcription factor 1-like (MYT1L), mRNA [NM_015025] 3.572901 up DAPL1 Homo sapiens death associated protein-like 1 (DAPL1), mRNA [NM_001017920] 3.645572 up DAPL1 Homo sapiens death associated protein-like 1 (DAPL1), mRNA [NM_001017920] 1.806824 up C6orf217 Homo sapiens chromosome 6 open reading frame 217 (C6orf217), non-coding RNA [NR_026805] 2.058972 up SOX8 Homo sapiens SRY (sex determining region Y)-box 8 (SOX8), mRNA [NM_014587] 2.95293 up C10orf140 Homo sapiens chromosome 10 open reading frame 140 (C10orf140), mRNA [NM_207371] 2.014696 up HKDC1 Homo sapiens hexokinase domain containing 1 (HKDC1), mRNA [NM_025130] 2.537165 up LOC100128496 Putative uncharacterized protein C20orf78  [Source:UniProtKB/Swiss-Prot;Acc:Q9BR46] [ENST00000278779] 1.619666 up KCNJ13 Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 13 (KCNJ13), mRNA [NM_002242] 190  Fold change regulation GeneSymbol Description 4.323891 up LOC100131726 Homo sapiens HCC-related HCC-C11_v3 (LOC100131726), non-coding RNA [NR_024479] 1.702712 up MYPN Homo sapiens myopalladin (MYPN), mRNA [NM_032578] 1.765212 up FAM71F2 Homo sapiens family with sequence similarity 71, member F2 (FAM71F2), transcript variant 2, mRNA [NM_001128926] 1.745782 up C11orf64 Homo sapiens chromosome 11 open reading frame 64 (C11orf64), non-coding RNA [NR_026946] 2.597354 up LZTS1 Homo sapiens leucine zipper, putative tumor suppressor 1 (LZTS1), mRNA [NM_021020] 4.238687 up CPA4 Homo sapiens carboxypeptidase A4 (CPA4), transcript variant 1, mRNA [NM_016352] 2.818101 up  lincRNA:chr12:48037808-48056882 reverse strand 1.607976 up DPYSL5 Homo sapiens dihydropyrimidinase-like 5 (DPYSL5), mRNA [NM_020134] 1.666246 up CSGALNACT1 Homo sapiens chondroitin sulfate N-acetylgalactosaminyltransferase 1 (CSGALNACT1), transcript variant 1, mRNA [NM_001130518] 1.669248 up ANKRD23 Homo sapiens ankyrin repeat domain 23 (ANKRD23), mRNA [NM_144994] 1.735223 up  lincRNA:chr14:66896649-66896875 reverse strand 2.311161 up  lincRNA:chr2:75153892-75163742 forward strand 2.152122 up DEFB103B Homo sapiens defensin, beta 103B (DEFB103B), mRNA [NM_001081551] 2.669418 up SLITRK4 Homo sapiens SLIT and NTRK-like family, member 4 (SLITRK4), mRNA [NM_173078] 1.738615 up WSCD1 Homo sapiens WSC domain containing 1 (WSCD1), mRNA [NM_015253] 1.831622 up  lincRNA:chr12:32597733-32653233 reverse strand 1.502306 up  lincRNA:chr3:106965972-106966557 forward strand 1.884836 up  lincRNA:chr3:187546031-187607831 forward strand 2.317364 up LOC100292680 Homo sapiens cDNA FLJ33297 fis, clone BNGH42001406 [AK090616] 1.575649 up TMEM133 Homo sapiens transmembrane protein 133 (TMEM133), mRNA [NM_032021] 1.970454 up  lincRNA:chr2:201626997-201633254 reverse strand 2.031886 up C1orf223 Homo sapiens chromosome 1 open reading frame 223 (C1orf223), mRNA [NM_001145474] 1.652636 up  lincRNA:chr22:25423157-25423764 forward strand 2.331806 up TESSP2 Homo sapiens testis serine protease 2 (TESSP2), mRNA [NM_182702] 2.089724 up  HCG2000720Hypothetical gene supported by AK054822 ;[ENST00000401499] 191  Fold change regulation GeneSymbol Description 2.223788 up PID1 Homo sapiens phosphotyrosine interaction domain containing 1 (PID1), transcript variant 1, mRNA [NM_017933] 1.912051 up DOCK11 Homo sapiens dedicator of cytokinesis 11 (DOCK11), mRNA [NM_144658] 1.570101 up NRP2 Homo sapiens neuropilin 2 (NRP2), transcript variant 6, mRNA [NM_201264] 8.318625 up MAP7D2 Homo sapiens MAP7 domain containing 2 (MAP7D2), mRNA [NM_152780] 2.506602 up  Seven transmembrane helix receptor  [Source:UniProtKB/TrEMBL;Acc:Q8NGL5] [ENST00000328673] 1.626849 up SPINT3 Homo sapiens serine peptidase inhibitor, Kunitz type, 3 (SPINT3), mRNA [NM_006652] 1.763414 up GBX2 Homo sapiens gastrulation brain homeobox 2 (GBX2), mRNA [NM_001485] 2.644615 up LOC100130778 Homo sapiens cDNA FLJ43949 fis, clone TESTI4015263. [AK125937] 2.159106 up  lincRNA:chr6:154718233-154725342 forward strand 2.707243 up MMP12 Homo sapiens matrix metallopeptidase 12 (macrophage elastase) (MMP12), mRNA [NM_002426] 2.060395 up ANO3 Homo sapiens anoctamin 3 (ANO3), mRNA [NM_031418] 2.907408 up LENEP Homo sapiens lens epithelial protein (LENEP), mRNA [NM_018655] 1.587422 up NRXN1 Homo sapiens neurexin 1 (NRXN1), transcript variant alpha2, mRNA [NM_001135659] 5.238341 up  lincRNA:chr7:77313177-77314625 forward strand 2.261642 up   1.607376 up KSR2 Homo sapiens kinase suppressor of ras 2 (KSR2), mRNA [NM_173598] 4.862629 up RELN Homo sapiens reelin (RELN), transcript variant 1, mRNA [NM_005045] 1.58865 up LOC645431 Homo sapiens hypothetical LOC645431 (LOC645431), non-coding RNA [NR_024334] 1.820175 up  DB300201 BRACE3 Homo sapiens cDNA clone BRACE3035472 3', mRNA sequence [DB300201] 1.51588 up LOC344887 PREDICTED: Homo sapiens similar to hCG2041270 (LOC344887), miscRNA [XR_017497] 2.186612 up LILRA5 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 (LILRA5), transcript variant 3, mRNA [NM_181879] 2.139624 up  lincRNA:chr15:39468955-39472228 reverse strand 3.856371 up  lincRNA:chr2:39745774-39826761 reverse strand 192  Fold change regulation GeneSymbol Description 2.43162 up LOC100132738 PREDICTED: Homo sapiens similar to hCG1817845 (LOC100132738), mRNA [XM_001714359] 1.818555 up  RUN and FYVE domain-containing protein 2 (Rab4-interacting protein related) [Source:UniProtKB/Swiss-Prot;Acc:Q8WXA3] [ENST00000342616] 2.614834 up FAM20A Homo sapiens family with sequence similarity 20, member A (FAM20A), transcript variant 1, mRNA [NM_017565] 4.036427 up LOC388630 PREDICTED: Homo sapiens UPF0632 protein A (LOC388630), mRNA [XM_371250] 1.782571 up CRLF1 Homo sapiens cytokine receptor-like factor 1 (CRLF1), mRNA [NM_004750] 2.06354 up   2.47567 up GIMAP6 Homo sapiens GTPase, IMAP family member 6 (GIMAP6), transcript variant 1, mRNA [NM_024711] 1.538319 up LOC344887 Homo sapiens mRNA; cDNA DKFZp686B14224 (from clone DKFZp686B14224) [BX640843] 1.796322 up C3orf36 Homo sapiens chromosome 3 open reading frame 36 (C3orf36), mRNA [NM_025041] 1.962093 up C12orf39 Spexin Precursor (NPQ) [Source:UniProtKB/Swiss-Prot;Acc:Q9BT56] [ENST00000256969] 0.500161 down TNP1 Homo sapiens transition protein 1 (during histone to protamine replacement) (TNP1), mRNA [NM_003284] 0.620824 down CXCL10 Homo sapiens chemokine (C-X-C motif) ligand 10 (CXCL10), mRNA [NM_001565] 0.627341 down XPNPEP2 Homo sapiens X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound (XPNPEP2), mRNA [NM_003399] 0.635593 down PLAU Homo sapiens plasminogen activator, urokinase (PLAU), transcript variant 1, mRNA [NM_002658] 0.470566 down HLA-DOA Homo sapiens major histocompatibility complex, class II, DO alpha (HLA-DOA), mRNA [NM_002119] 0.526473 down GATA1 Homo sapiens GATA binding protein 1 (globin transcription factor 1) (GATA1), mRNA [NM_002049] 0.487665 down HLA-DQA2 Homo sapiens major histocompatibility complex, class II, DQ alpha 2 (HLA-DQA2), mRNA [NM_020056] 0.482585 down RP11-403I13.9 PREDICTED: Homo sapiens phosphodiesterase 4D interacting protein-like (LOC645262), miscRNA [XR_079250] 0.578043 down  lincRNA:chr13:44760050-44767325 reverse strand 0.41916 down ODAM Homo sapiens odontogenic, ameloblast asssociated (ODAM), mRNA [NM_017855] 0.618409 down COBL Homo sapiens cordon-bleu homolog (mouse) (COBL), mRNA [NM_015198] 0.54983 down HTR4 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), transcript variant i, mRNA [NM_001040173] 193  Fold change regulation GeneSymbol Description 0.381524 down  lincRNA:chr6:57535316-57542016 forward strand 0.533816 down HLA-DRB1 Homo sapiens major histocompatibility complex, class II, DR beta 1 (HLA-DRB1), mRNA [NM_002124] 0.665361 down  lincRNA:chr3:193965436-193973087 forward strand 0.529779 down HLA-DRB3 Homo sapiens major histocompatibility complex, class II, DR beta 3 (HLA-DRB3), mRNA [NM_022555] 0.585162 down  lincRNA:chr7:20940525-20952850 forward strand 0.595987 down  Protein phosphatase Slingshot homolog 2 (EC 3.1.3.48)(EC 3.1.3.16)(SSH-2L)(hSSH-2L) [Source:UniProtKB/Swiss-Prot;Acc:Q76I76] [ENST00000394848] 0.560438 down  Leukocyte antigen CD37 (Tetraspanin-26)(Tspan-26)(CD37 antigen) [Source:UniProtKB/Swiss-Prot;Acc:P11049] [ENST00000391859] 0.609543 down LOC100129098 PREDICTED: Homo sapiens hypothetical LOC100129098 (LOC100129098), mRNA [XM_001714829] 0.128032 down MYL2 Homo sapiens myosin, light chain 2, regulatory, cardiac, slow (MYL2), mRNA [NM_000432] 0.589274 down ROBO4 Homo sapiens roundabout homolog 4, magic roundabout (Drosophila) (ROBO4), mRNA [NM_019055] 0.584586 down  lincRNA:chr14:23012123-23016533 forward strand 0.59504 down CIITA Homo sapiens class II, major histocompatibility complex, transactivator (CIITA), mRNA [NM_000246] 0.487628 down HLA-DQA1 Homo sapiens major histocompatibility complex, class II, DQ alpha 1 (HLA-DQA1), mRNA [NM_002122] 0.527804 down OR9A2 Homo sapiens olfactory receptor, family 9, subfamily A, member 2 (OR9A2), mRNA [NM_001001658] 0.580334 down KISS1 Homo sapiens KiSS-1 metastasis-suppressor (KISS1), mRNA [NM_002256] 0.371729 down  lincRNA:chr15:95807796-95868971 forward strand 0.401181 down  lincRNA:chr11:122051045-122238681 reverse strand 0.653315 down  lincRNA:chr7:155263689-155276039 reverse strand 0.625642 down LOC100131232 Homo sapiens cDNA FLJ33442 fis, clone BRACE2021936 [AK090761] 0.41222 down  lincRNA:chr9:34674175-34679375 forward strand 0.419724 down  Putative uncharacterized protein ENSP00000346720  [Source:UniProtKB/TrEMBL;Acc:A6NG04] [ENST00000398668] 0.369065 down FST Homo sapiens follistatin (FST), transcript variant FST344, mRNA [NM_013409] 0.418855 down POTEE Homo sapiens POTE ankyrin domain family, member E (POTEE), mRNA [NM_001083538] 0.581469 down LOC646034 PREDICTED: Homo sapiens, mRNA [XM_001724735] 194  Fold change regulation GeneSymbol Description 0.343816 down OR9G4 Homo sapiens olfactory receptor, family 9, subfamily G, member 4 (OR9G4), mRNA [NM_001005284] 0.430152 down AMPH Homo sapiens amphiphysin (AMPH), transcript variant 1, mRNA [NM_001635] 0.492773 down PADI3 Homo sapiens peptidyl arginine deiminase, type III (PADI3), mRNA [NM_016233] 0.596804 down COBL Homo sapiens cordon-bleu homolog (mouse) (COBL), mRNA [NM_015198] 0.505021 down HLA-DRB4 Homo sapiens major histocompatibility complex, class II, DR beta 4 (HLA-DRB4), mRNA [NM_021983] 0.353466 down  lincRNA:chr3:177832281-178039381 reverse strand 0.574162 down HLA-DRB6 Homo sapiens major histocompatibility complex, class II, DR beta 6 (pseudogene) (HLA-DRB6), non-coding RNA [NR_001298] 0.429147 down CCL28 Homo sapiens chemokine (C-C motif) ligand 28 (CCL28), mRNA [NM_148672] 0.506105 down LOC653707 PREDICTED: Homo sapiens similar to hCG2040277 (LOC653707), mRNA [XM_001720182] 0.19332 down POTEB Homo sapiens POTE ankyrin domain family, member B (POTEB), mRNA [NM_207355] 0.353594 down  lincRNA:chr8:55350297-55366022 forward strand 0.642738 down   0.519725 down LOC219731 Homo sapiens cDNA FLJ32141 fis, clone PLACE5000067 [AK056703] 0.470592 down  lincRNA:chr7:130630222-130792989 forward strand 0.515041 down  lincRNA:chr10:120432310-120438537 forward strand 0.622356 down NR2F1 Homo sapiens nuclear receptor subfamily 2, group F, member 1 (NR2F1), mRNA [NM_005654] 0.513924 down GGT5 Homo sapiens gamma-glutamyltransferase 5 (GGT5), transcript variant 1, mRNA [NM_001099781] 0.405309 down TRIM67 Homo sapiens tripartite motif-containing 67 (TRIM67), mRNA [NM_001004342] 0.37431 down LOC285972 Homo sapiens cDNA FLJ39839 fis, clone SPLEN2014136 [AK097158] 0.388152 down  lincRNA:chr5:152000064-152603103 reverse strand 0.339414 down SPAG16 Homo sapiens sperm associated antigen 16 (SPAG16), transcript variant 1, mRNA [NM_024532] 0.423373 down AOX1 Homo sapiens aldehyde oxidase 1 (AOX1), mRNA [NM_001159] 0.602662 down MUC5B Homo sapiens mucin 5B, oligomeric mucus/gel-forming (MUC5B), mRNA [NM_002458] 0.579858 down POU5F1 Homo sapiens POU class 5 homeobox 1 (POU5F1), transcript variant 1, mRNA [NM_002701] 0.628107 down CXCR6 Homo sapiens chemokine (C-X-C motif) receptor 6 195  Fold change regulation GeneSymbol Description 0.645625 down  lincRNA:chr4:53589204-53589578 forward strand 0.300735 down  Rheumatoid factor RF-ET13 Fragment  [Source:UniProtKB/TrEMBL;Acc:O43234] [ENST00000390611] 0.5209 down  Ig kappa chain C region  [Source:UniProtKB/Swiss-Prot;Acc:P01834] [ENST00000390237] 0.608503 down  Uromodulin-like 1 Precursor (Olfactorin) [Source:UniProtKB/Swiss-Prot;Acc:Q5DID0] [ENST00000380457] 0.518389 down CLEC1B Homo sapiens C-type lectin domain family 1, member B (CLEC1B), transcript variant 1, mRNA [NM_016509] 0.553811 down  lincRNA:chr1:22419913-22441088 forward strand 0.542971 down CD74 Homo sapiens CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 3, mRNA [NM_001025158] 0.09772 down IL13RA2 Homo sapiens interleukin 13 receptor, alpha 2 (IL13RA2), mRNA [NM_000640] 0.438568 down LOC100129376 PREDICTED: Homo sapiens hypothetical LOC100129376 (LOC100129376), mRNA [XM_001714605] 0.320477 down CST9 Homo sapiens cystatin 9 (testatin) (CST9), mRNA [NM_001008693] 0.634799 down   0.634626 down  HADV38S2 Fragment  [Source:UniProtKB/TrEMBL;Acc:A0JD32] [ENST00000390465] 0.626418 down LOC401180 PREDICTED: Homo sapiens similar to hCG1745223 (LOC401180), mRNA [XM_379325] 0.490422 down  lincRNA:chr1:192962627-192968077 reverse strand 0.446606 down  Putative uncharacterized protein ENSP00000384254  [Source:UniProtKB/TrEMBL;Acc:B5MC88] [ENST00000403226] 0.464419 down AOX1 Homo sapiens aldehyde oxidase 1 (AOX1), mRNA [NM_001159] 0.630852 down  Novel protein (FLJ40547)  [Source:UniProtKB/TrEMBL;Acc:Q5VZ43] [ENST00000317652] 0.542112 down GJB5 Homo sapiens gap junction protein, beta 5, 31.1kDa (GJB5), mRNA [NM_005268] 0.462442 down SUSD2 Homo sapiens sushi domain containing 2 (SUSD2), mRNA [NM_019601] 0.610956 down HLA-DQB1 Homo sapiens major histocompatibility complex, class II, DQ beta 1 (HLA-DQB1), mRNA [NM_002123] 0.424537 down  lincRNA:chrX:138924534-138934584 reverse strand 196  Fold change regulation GeneSymbol Description 0.469298 down HLA-DQA1 Homo sapiens major histocompatibility complex, class II, DQ alpha 1 (HLA-DQA1), mRNA [NM_002122] 0.296653 down CPLX2 Homo sapiens complexin 2 (CPLX2), transcript variant 1, mRNA [NM_006650] 0.556718 down  lincRNA:chr8:72443139-72504241 reverse strand 0.511909 down  V_segment translation product Fragment  [Source:UniProtKB/TrEMBL;Acc:A0A5B7] [ENST00000422143] 0.558861 down  lincRNA:chr11:9781624-9791949 reverse strand 0.358231 down  cDNA FLJ43696 fis, clone TBAES2007964  [Source:UniProtKB/TrEMBL;Acc:Q6ZUH9] [ENST00000372387] 0.561894 down SEMA5B Homo sapiens sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B (SEMA5B), transcript variant 1, mRNA [NM_001031702] 0.551515 down HLA-DPA1 Homo sapiens major histocompatibility complex, class II, DP alpha 1 (HLA-DPA1), mRNA [NM_033554] 0.561912 down  lincRNA:chr3:16006245-16179026 reverse strand 0.155134 down EDIL3 Homo sapiens EGF-like repeats and discoidin I-like domains 3 (EDIL3), mRNA [NM_005711] 0.19763 down MYL10 Homo sapiens myosin, light chain 10, regulatory (MYL10), mRNA [NM_138403] 0.528586 down  Homo sapiens cDNA FLJ37566 fis, clone BRCOC2002085 [AK094885] 0.391747 down   0.639614 down TMPRSS13 Homo sapiens transmembrane protease, serine 13 (TMPRSS13), mRNA [NM_001077263] 0.491903 down C1orf100 Homo sapiens chromosome 1 open reading frame 100 (C1orf100), mRNA [NM_001012970] 0.415863 down CT62 Homo sapiens cancer/testis antigen 62 (CT62), mRNA [NM_001102658] 0.358408 down  lincRNA:chr8:128351522-128404873 forward strand 0.644331 down  PDZ domain-containing protein MAGIX  [Source:UniProtKB/Swiss-Prot;Acc:Q9H6Y5] [ENST00000376339] 0.553047 down  lincRNA:chrX:64808260-64845760 forward strand 0.55078 down FGFBP1 Homo sapiens fibroblast growth factor binding protein 1 (FGFBP1), mRNA [NM_005130] 0.554275 down HLA-DPA1 Homo sapiens major histocompatibility complex, class II, DP alpha 1 (HLA-DPA1), mRNA [NM_033554] 0.63025 down AACSL Homo sapiens acetoacetyl-CoA synthetase-like (AACSL), non-coding RNA [NR_024035] 0.407138 down S100A12 Homo sapiens S100 calcium binding protein A12 197  Fold change regulation GeneSymbol Description 0.54106 down  lincRNA:chr8:96083967-96100152 reverse strand 0.624488 down  lincRNA:chr5:169624950-169625424 reverse strand 0.65648 down  lincRNA:chr14:85860222-85886416 forward strand 0.436607 down KCNK16 Homo sapiens potassium channel, subfamily K, member 16 (KCNK16), transcript variant 3, mRNA [NM_001135106] 0.621104 down  HLA class II histocompatibility antigen, DQ(1) beta chain Precursor (DC-3 beta chain) [Source:UniProtKB/Swiss-Prot;Acc:P01918] [ENST00000399670] 0.634763 down CSF2 Homo sapiens colony stimulating factor 2 (granulocyte-macrophage) (CSF2), mRNA [NM_000758] 0.430569 down FAM131B Homo sapiens family with sequence similarity 131, member B (FAM131B), transcript variant a, mRNA [NM_001031690] 0.512267 down HLA-DRB5 Homo sapiens major histocompatibility complex, class II, DR beta 5 (HLA-DRB5), mRNA [NM_002125] 0.597956 down GVIN1 Homo sapiens GTPase, very large interferon inducible 1 (GVIN1), non-coding RNA [NR_003945] 0.666625 down POU5F1 Homo sapiens POU class 5 homeobox 1 (POU5F1), transcript variant 1, mRNA [NM_002701] 0.488534 down GNG4 Homo sapiens guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 1, mRNA [NM_001098722] 0.4768 down  Protein FAM115C (Protein FAM139A) [Source:UniProtKB/Swiss-Prot;Acc:A6NFQ2] [ENST00000411935] 0.549583 down KAAG1 Homo sapiens kidney associated antigen 1 (KAAG1), mRNA [NM_181337] 0.654917 down  lincRNA:chr7:226042-232442 forward strand 0.452436 down   0.605908 down MAGEB5 Melanoma-associated antigen B5 (MAGE-B5 antigen)(Cancer/testis antigen 3.3)(CT3.3) [Source:UniProtKB/Swiss-Prot;Acc:Q9BZ81] [ENST00000379029] 0.358047 down LOC642350 PREDICTED: Homo sapiens similar to Coagulation factor V precursor (Activated protein C cofactor) (LOC642350), miscRNA [XR_041338] 0.19327 down OR4N4 Homo sapiens olfactory receptor, family 4, subfamily N, member 4 (OR4N4), mRNA [NM_001005241] 0.386754 down  Noelin Precursor (Neuronal olfactomedin-related ER localized protein)(Olfactomedin-1) [Source:UniProtKB/Swiss-Prot;Acc:Q99784] [ENST00000371799] 0.476751 down CES1 Homo sapiens carboxylesterase 1 (monocyte/macrophage serine esterase 1) (CES1), transcript variant 3, mRNA  198  Fold change regulation GeneSymbol Description 0.655655 down NPSR1 Homo sapiens neuropeptide S receptor 1 (NPSR1), transcript variant 2, mRNA [NM_207173] 0.634951 down  lincRNA:chr4:129437065-129440553 reverse strand 0.62425 down  lincRNA:chr15:38361681-38364103 forward strand 0.4761 down  lincRNA:chr15:21087660-21167566 reverse strand 0.539005 down OR5J2 Homo sapiens olfactory receptor, family 5, subfamily J, member 2 (OR5J2), mRNA [NM_001005492] 0.395652 down KCNK17 Homo sapiens potassium channel, subfamily K, member 17 (KCNK17), transcript variant 1, mRNA [NM_031460] 0.45579 down  lincRNA:chr2:216658337-216658674 forward strand 0.424967 down LOC645605 PREDICTED: Homo sapiens similar to hCG1790590 (LOC645605), mRNA [XM_001716708] 0.572847 down  Major histocompatibility complex, class II, DQ beta 1  [Source:UniProtKB/TrEMBL;Acc:B0S7Y6] [ENST00000424686] 0.484978 down  lincRNA:chr2:233436406-233452556 reverse strand 0.636887 down LAMC3 Homo sapiens laminin, gamma 3 (LAMC3), mRNA [NM_006059] 0.539618 down FLJ35816 PREDICTED: Homo sapiens FLJ35816 protein (FLJ35816), miscRNA [XR_079520] 0.470614 down CAPN6 Homo sapiens calpain 6 (CAPN6), mRNA [NM_014289] 0.643314 down LOC619207 Homo sapiens scavenger receptor protein family member (LOC619207), non-coding RNA [NR_002934] 0.522078 down  DB326574 OCBBF2 Homo sapiens cDNA clone OCBBF2030083 3', mRNA sequence [DB326574] 0.547897 down  lincRNA:chr5:36701011-36702056 reverse strand 0.584374 down NAG20 Homo sapiens NAG20 (NAG20) mRNA, partial cds [AF210649] 0.652128 down LOC100132240 PREDICTED: Homo sapiens similar to MIG7 (LOC100132240), miscRNA [XR_038313] 0.575951 down DEFB1 Homo sapiens defensin, beta 1 (DEFB1), mRNA [NM_005218] 0.532094 down HMX1 Homo sapiens H6 family homeobox 1 (HMX1), mRNA [NM_018942] 0.118229 down CT45A5 Homo sapiens cancer/testis antigen family 45, member A5 (CT45A5), mRNA [NM_001007551] 0.51236 down KRT83 Homo sapiens keratin 83 (KRT83), mRNA [NM_002282] 0.645702 down  lincRNA:chr5:8462735-8463209 forward strand 0.502627 down LOC728342 Homo sapiens cDNA clone IMAGE:5297581 [BC045192] 0.640367 down  full-length cDNA clone CS0DK002YL21 of HeLa cells Cot 25-normalized of Homo sapiens (human) [CR626610] 0.631268 down  lincRNA:chr1:95186012-95196686 reverse strand 0.437459 down  Putative TAF11-like protein ENSP00000332601   199  Fold change regulation GeneSymbol Description 0.651907 down CEP164 Homo sapiens centrosomal protein 164kDa (CEP164), mRNA [NM_014956] 0.643334 down HLA-DQB1 Homo sapiens major histocompatibility complex, class II, DQ beta 1 (HLA-DQB1), mRNA [NM_002123] 0.591972 down PRM3 Homo sapiens protamine 3 (PRM3), mRNA [NM_021247] 0.571291 down  lincRNA:chr2:162097179-162111204 reverse strand 0.097641 down CT45A1 Homo sapiens cancer/testis antigen family 45, member A1 (CT45A1), mRNA [NM_001017417] 0.41341 down ODF3B Homo sapiens outer dense fiber of sperm tails 3B (ODF3B), mRNA [NM_001014440] 0.589186 down OR10H4 Homo sapiens olfactory receptor, family 10, subfamily H, member 4 (OR10H4), mRNA [NM_001004465] 0.570203 down BARX2 Homo sapiens BARX homeobox 2 (BARX2), mRNA [NM_003658] 0.49488 down RPL31P11 Homo sapiens ribosomal protein L31 pseudogene 11 (RPL31P11), non-coding RNA [NR_002595] 0.458986 down LOC100127937 PREDICTED: Homo sapiens hypothetical LOC100127937 (LOC100127937), mRNA [XM_001721022] 0.31137 down   0.607119 down   0.630266 down UNQ9368 Homo sapiens RTFV9368 (SLED1), non-coding RNA [NR_003542] 0.309511 down  Putative olfactory receptor 10D3 (Olfactory receptor OR11-293)(HTPCRX09) [Source:UniProtKB/Swiss-Prot;Acc:Q8NH80] [ENST00000318666] 0.359759 down  Keratin-81-like protein  [Source:UniProtKB/Swiss-Prot;Acc:A6NCN2] [ENST00000257935]  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0165920/manifest

Comment

Related Items