UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Resistance to food processing sanitizers and heavy metals in Listeria monocytogenes from British Columbia,… Milillo, Michael Steven 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2015_november_milillo_michael.pdf [ 1.96MB ]
Metadata
JSON: 24-1.0165806.json
JSON-LD: 24-1.0165806-ld.json
RDF/XML (Pretty): 24-1.0165806-rdf.xml
RDF/JSON: 24-1.0165806-rdf.json
Turtle: 24-1.0165806-turtle.txt
N-Triples: 24-1.0165806-rdf-ntriples.txt
Original Record: 24-1.0165806-source.json
Full Text
24-1.0165806-fulltext.txt
Citation
24-1.0165806.ris

Full Text

     Resistance to food processing sanitizers and heavy metals in Listeria monocytogenes from British Columbia, Canada and antibiogram profiles of clinically relevant Listeria monocytogenes from British Columbia and Alberta, Canada by Michael Steven Milillo BSc, The Pennsylvania State University, 2011  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in The Faculty of Graduate and Postdoctoral Studies (Food Science) The University of British Columbia (Vancouver) September, 2015 © Michael Steven Milillo, 2015   ii  Abstract  Listeria monocytogenes (Lm), a foodborne pathogen, causes the rare but severe disease listeriosis in at-risk populations. Resistance that increases environmental fitness in Lm, including resistance to heavy metals and/or food processing sanitizers, is of concern as it may increase survival in natural and food processing environments that leads to increased potential for product contamination. Lm (n=46) from the British Columbia food chain were evaluated for resistance to food processing sanitizers and heavy metals. All isolates were found to be sensitive to triclosan (16 µg/ml) and peroxyacetic acid (150 ppm exposure for 60 seconds). Seventeen isolates were resistant to quaternary ammonium compounds (QUATs; 10 µg/ml), with all positive for one known resistance determinant (bcrABC, n=16; emrE, n=1). Resistance to cadmium (Cd) and arsenic was found in 89% and 24% of the isolates, respectively. Under sub-lethal concentrations of Cd, all Cd sensitive isolates showed reduced growth. Decreasing pH and increasing Cd resulted in a minimum inhibitory concentration for a representative Cd sensitive isolate at 1.5 µg/ml CdCl2 at pH 6 and 0.5 µg/ml CdCl2 at pH 5.5. All bcrABC positive isolates were Cd resistant, and two were capable of co-transferring QUAT and Cd resistance to L. monocytogenes 08-5578. When bcrABC and emrE were combined through conjugation, there was no observable increase in resistance to QUATs. While L. monocytogenes from British Columbia remain sensitive to common sanitizers, a sub-population is resistant to low QUAT concentrations and co-resistant to Cd. Further work is needed to explore if co-selection between heavy metal and sanitizer resistance is a concern in the food chain. As Lm continue to cause disease, surveillance of antibiotic resistance within the population of Lm is necessary to aid in effective early treatment. A collection of sequence type 120 Lm (n=21)   iii  were all found to be sensitive to the primary drugs of choice for treatment of listeriosis - ampicillin, gentamicin, and co-trimoxazole. Four isolates were resistant to an ampicillin alternative, linezolid. This data supports the continued use of the primary drugs of choice in treating listeriosis in Canada from sequence type 120 Lm, but suggests the possibility of decreased effectiveness of alternative antibiotics.     iv  Preface  All of the work presented henceforth was conducted in the Food, Nutrition, and Health Ulrich Freybe Food Safety Laboratory at the University of British Columbia, Vancouver campus. All chapters of this thesis, except for chapter 4 and any whole genome sequencing, are the original, unpublished, independent work of author, Michael Steven Milillo. Michael Steven Milillo was the lead investigator for the projects located in Chapter 4 where he was responsible for all major areas of concept formation and analysis. The data collection was carried out by Ellynn Casteyde under his guidance.  Dr. Chad Laing from Public Health Agency of Canada Laboratory for Foodborne Zoonosis contributed to the assembly and annotation of sequenced isolates and Dr. Jessica Chen aided in the collection and analysis of whole genome sequence data.          v  Table of contents Abstract ........................................................................................................................................... ii Preface............................................................................................................................................ iv Table of contents ............................................................................................................................. v List of tables ................................................................................................................................... ix List of figures ................................................................................................................................. xi Acknowledgments........................................................................................................................ xiii Dedication .................................................................................................................................... xiv Chapter 1: Literature review ........................................................................................................... 1 1.1 The genus Listeria..................................................................................................................... 1 1.2 Foodborne disease in North America ....................................................................................... 2 1.3 Listeriosis .................................................................................................................................. 3 1.4 Epidemiology of listeriosis outbreaks ....................................................................................... 5 1.5 Molecular epidemiology of Listeria monocytogenes ................................................................ 8 1.6 Mechanisms of Listeria monocytogenes pathogenesis ........................................................... 13 1.6.1 Mechanisms of invasion .............................................................................................. 13 1.6.2 Intracellular replication ................................................................................................ 14 1.6.3 Systemic spread and treatment..................................................................................... 17 1.7 L. monocytogenes ecology and transmission .......................................................................... 19 1.7.1 Reservoirs .................................................................................................................... 19 1.7.2 Cold adaptation and growth ......................................................................................... 20 1.7.3 Osmotolerance ............................................................................................................. 22 1.7.4 Acid tolerance .............................................................................................................. 23 1.7.5 Metal ion tolerance ...................................................................................................... 24 1.7.6 Sanitizer tolerance ........................................................................................................ 29 1.7.7 Regulation of stress response ....................................................................................... 33     1.7.8 Persistence.................................................................................................................... 35 1.8 Hypotheses and research objectives ........................................................................................ 36 Chapter 2: Resistance of Listeria monocytogenes from the British Columbia food chain to common food processing sanitizers ............................................................................................................. 39 2.1 Introduction ............................................................................................................................. 39   vi  2.2 Methods................................................................................................................................... 41 2.2.1 Isolate collection .......................................................................................................... 41 2.2.2 Sanitizers and reagents ................................................................................................. 44 2.2.3 Sanitizer resistance assay ............................................................................................. 44 2.2.4 Genetic screening ......................................................................................................... 45 2.2.5 Sanitizer exposure assay .............................................................................................. 46 2.2.6 Data analysis and statistics........................................................................................... 47 2.3 Results ..................................................................................................................................... 48 2.3.2 Susceptibility to the antimicrobial triclosan ................................................................ 48 2.3.4 Susceptibility to antimicrobial quaternary ammonium compounds ............................ 50 2.3.3 Susceptibility to the antimicrobial Perox-e .................................................................. 52 2.4 Discussion ............................................................................................................................... 53 2.4.1 L. monocytogenes from BC are sensitive to triclosan .................................................. 53 2.4.2 Resistance to QUATs can be found amongst L. monocytogenes from BC ................. 54 2.4.3 bcrABC is the most prominent resistance determinant to QUATs .............................. 55 2.4.4 L. monocytogenes from BC are sensitive to mixed peroxyacetic acid ........................ 57 2.4.5 Future studies and significance .................................................................................... 58 Chapter 3: Resistance of Listeria monocytogenes from the British Columbia food chain to heavy metals and co-resistance to quaternary ammonium compounds ................................................... 60 3.1 Introduction ............................................................................................................................. 60 3.2 Methods................................................................................................................................... 64 3.2.1 Isolate collection .......................................................................................................... 64 3.2.2 Heavy metal stocks and reagents ................................................................................. 64 3.2.3 Genetic screening ......................................................................................................... 64 3.2.4 Whole genome sequencing and subsequent analysis of plasmid content in L. monocytogenes ...................................................................................................................... 67 3.2.5 Resistance to heavy metals .......................................................................................... 68 3.2.6 Sub-lethal growth assays.............................................................................................. 68 3.2.7 Low pH and cadmium combination assay ................................................................... 69 3.2.8 Plasmid curing of resistant wild type isolates .............................................................. 70 3.2.9 Agar-based mating experiments .................................................................................. 70   vii  3.2.10 Sanitizer tolerance assay ............................................................................................ 71 3.2.11 RNA extractions......................................................................................................... 72 3.2.12 Evaluation of gene expression using quantitative reverse transcriptase PCR ........... 73 3.2.13 Data analysis and statistics ......................................................................................... 75 3.3 Results ..................................................................................................................................... 76 3.3.1 Cadmium and arsenic resistance in food chain derived L. monocytogenes ................. 76 3.3.2 Growth of cadmium sensitive isolates in the presence of sub-lethal cadmium ........... 82 3.3.3 Effect of cadmium and pH on the growth of cadmium sensitive and resistant L. monocytogenes ...................................................................................................................... 83 3.3.4 L. monocytogenes co-resistant to quaternary ammonium compounds and cadmium .. 85 3.3.5 Plasmid analysis of L. monocytogenes co-resistant to quaternary ammonium compounds and cadmium ......................................................................................................................... 86 3.3.6 Characterization of transconjugants ............................................................................. 94 3.3.7 Expression of quaternary ammonium compound resistance determinants in BAC exposed transconjugants ....................................................................................................... 96 3.4 Discussion ............................................................................................................................... 99 3.4.1 Heavy metal resistance detected in L. monocytogenes from the BC food chain ......... 99 3.4.2 Prevalence of cadmium resistance determinants in L. monocytogenes from the BC food chain .................................................................................................................................... 101 3.4.3 Decreased fitness for cadmium sensitive L. monocytogenes in the presence of sub-lethal cadmium .............................................................................................................................. 102 3.4.4 Additive effect of increasing cadmium and high acid environment on growth of L. monocytogenes .................................................................................................................... 103 3.4.5 Cadmium resistant L. monocytogenes co-resistant to quaternary ammonium compounds............................................................................................................................................. 105 3.4.6 Analysis from alignment of plasmids from cadmium and quaternary ammonium resistant L. monocytogenes ................................................................................................. 106 3.4.7 Conjugative transfer of cadmium and quaternary ammonium compound co-resistance among L. monocytogenes .................................................................................................... 107 3.4.8 Relative fitness of transconjugants ............................................................................ 108 3.4.9 Expression of quaternary ammonium compound resistance determinants in donor, recipient, and transconjugant isolates. ................................................................................ 111 3.4.10 Future studies and significance ................................................................................ 112   viii  Chapter 4: Antibiogram profiles of sequence type 120 Listeria monocytogenes from the food chain in British Columbia and Alberta, Canada ................................................................................... 113 4.1 Introduction ........................................................................................................................... 113 4.2 Methods................................................................................................................................. 116 4.2.1 Isolate collection ........................................................................................................ 116 4.2.2 Genetic screening ....................................................................................................... 117 4.2.3 Antimicrobial resistance as determined by the disk diffusion assay ......................... 117 4.2.4 Antibiotic resistance as determined by microbroth dilutions .................................... 120 4.2.5 Resistance determinant databases .............................................................................. 120 4.2.6 Data analysis and statistics......................................................................................... 121 4.3 Results ................................................................................................................................... 122 4.3.1 Antimicrobial resistance of ST120 L. monocytogenes according to disk diffusions assays .................................................................................................................................. 122 4.3.2 Minimum inhibitory concentration of ampicillin, rifampicin, and vancomycin in ST120 L. monocytogenes ................................................................................................................ 125 4.3.3 Analysis antibiotic resistance genes of sequence type 120 L. monocytogenes according to the Comprehensive Antibiotic Resistance Database ...................................................... 126 4.4 Discussion ............................................................................................................................. 129 4.4.1 Antibiotic resistance among ST120 L. monocytogenes from the Canadian food chain............................................................................................................................................. 129 4.4.2 ST120 L. monocytogenes from the Canadian food chain lack association with major antibiotic resistance genes................................................................................................... 132 4.5 Future studies and significance ..................................................................................... 135 Chapter 5: Conclusion................................................................................................................. 136 References ................................................................................................................................... 140 Appendix A ................................................................................................................................. 159 Supplemental figures .......................................................................................................... 159 Supplemental tables ............................................................................................................ 168   ix  List of tables Table 1: Outbreaks of listeriosis in Canada ................................................................................... 6 Table 2: Listeria monocytogenes isolates used in this study with available typing data. ............ 42 Table 3: All primers used during the detection of quaternary ammonium compound resistance determinants in Listeria monocytogenes from the British Columbia food chain. ........................ 46 Table 4: Sanitizer resistance of Listeria monocytogenes isolates (n=46). ................................... 48 Table 5: The breakdown of quaternary ammonium compound resistant Listeria monocytogenes (n=17) by lineage and serotype with detected resistance determinants. ....................................... 50 Table 6: Primers used during the evaluation of heavy metal resistance and co-resistance to quaternary ammonium compounds in Listeria monocytogenes from the British Columbia food chain. ............................................................................................................................................. 66 Table 7: Primers used for quantitative reverse transcriptase PCR during the evaluation of expression of quaternary ammonium compound resistance determinants in transconjugants. .... 74 Table 8: Prevalence of cadmium resistance determinants among L. monocytogenes isolates. ... 79 Table 9: The prevalence of cadmium resistance determinants in the different lineage and serotypes of Listeria monocytogenes in this collection. ............................................................................... 81 Table 10: Growth of cadmium sensitive strains in the presence of sub-lethal (1 µg/ml) cadmium chloride. ........................................................................................................................................ 83 Table 11: The effect of cadmium and low pH in combination on growth of cadmium resistant and sensitive L. monocytogenes. .......................................................................................................... 85 Table 12: Analysis of plasmid carriage and conjugation by cadmium and QUAT co-resistant isolates........................................................................................................................................... 89 Table 13: Summary of assembled plasmids. ................................................................................ 89 Table 14: Annotation of open reading frames from plasmid assemblies. .................................... 91   x  Table 15: Characterization of confirmed transconjugants for MIC of quaternary ammonium compounds and growth in the presence of sub-lethal cadmium. .................................................. 95 Table 16: Characterization of donor, recipient, and transconjugants used in RNA extractions for growth in the presence of sub-lethal (10 µg/ml) benzalkonium chloride. .................................... 95 Table 17: List of Listeria monocytogenes sequence type 120 isolates from food processing environments in Alberta and British Columbia. ......................................................................... 116 Table 18: Antibiotics used for disk diffusion susceptibility testing........................................... 119 Table 19: Antimicrobial resistance in sequence type 120 Listeria monocytogenes (n=21) as determined by disk diffusion assays. .......................................................................................... 124 Table 20: Minimum inhibitory (MIC) concentrations of ampicillin, rifampicin, and vancomycin for sequence type 120 Listeria monocytogenes. ......................................................................... 125 Table 21: Principal open reading frames from sequence type 120 Listeria monocytogenes (n=21) associated with antibiotic resistance. .......................................................................................... 127 Table 22: Homology to Listeria monocytogenes EGD-e of principal open reading frames identified by the Comprehensive Antibiotic Resistance Database for sequence type 120 L. monocytogenes. ........................................................................................................................... 128 Table S1: Antibiogram profiles for sequence type 120 Listeria monocytogenes isolated from the food chain in Canada .................................................................................................................. 168       xi  List of figures Figure 1: The generalized interrelationship between select typing methods for Listeria monocytogenes. ............................................................................................................................... 9 Figure 2: Relative representation of Lineages I and II in different environments and outcomes.10 Figure 3: Formation of peroxyacetic acid from hydrogen peroxide and acetic acid. .................. 30 Figure 4: Chemical structure of a quaternary ammonium compound. ........................................ 31 Figure 5:  Resistance of Listeria monocytogenes collected from the food chain in British Columbia (n=46) to industrial sanitizers. ...................................................................................................... 51 Figure 6: Identification of quaternary ammonium compound sensitive and resistant isolates by source of isolation from the British Columbia food chain. ........................................................... 52 Figure 7: Listeria monocytogenes (n=46) resistance to cadmium chloride  at 35 and 70 µg/ml and sodium arsenite  at 500 µg/ml. ...................................................................................................... 78 Figure 8: Prevalence of resistance to benzalkonium chloride, cadmium chloride, and sodium arsenite  among isolates of Listeria monocytogenes by serotype and lineage. ............................. 78 Figure 9: Phylogenetic grouping of plasmid replication initiation protein RepA from Listeria monocytogenes plasmids. .............................................................................................................. 90 Figure 10: Alignment of select assemled plasmid sequences with pLM80 and representative plasmids. ....................................................................................................................................... 92 Figure 11: Upstream and downstream regions of bcrABC in assembled plasmids. .................... 93 Figure 12: Upregulation of QUAT resistance determinants after 60 minute exposure to 10 µg/ml BAC with normalization to bglA. ................................................................................................. 97 Figure 13: Expression of QUAT resistance determinants after 60 minute exposure to 10 µg/ml BAC with normalization to bglA. ................................................................................................. 98   xii  Figure 14: Breakdown of susceptibility to relevant antibiotics in sequence type 120 Listeria monocytogenes. ........................................................................................................................... 123 Figure S1: Growth of cadmium sensitive and resistant Listeria monocytogenes in the presence of sub-lethal (1 μg/ml) cadmium chloride. ...................................................................................... 159 Figure S2: The three way interaction plot for the interaction between pH, cadmium concentration, and isolate and their effect on µmax. ............................................................................................ 160 Figure S3: The growth of cadmium resistant Listeria monocytogenes 08-5578 in the presence of cadmium (1 µg/ml) at 5.5, 6.0, 6.5 and 7.0 pH values. ............................................................... 161 Figure S4: The growth of Listeria monocytogenes 08-5578 CdS in the presence of cadmium             (1 µg/ml) at 5.5, 6.0, 6.5 and 7.0 pH values. .............................................................................. 162 Figure S5: The growth of cadmium resistant Listeria monocytogenes 08-5578 at pH 6.0 with 0.0, 0.5, 1.0, and 1.5 µg/ml cadmium concentrations. ....................................................................... 163 Figure S6: The growth of Listeria monocytogenes 08-5578 CdS at pH 6.0 with 0.0, 0.5, 1.0, and 1.5 µg/ml cadmium concentrations. ............................................................................................ 164 Figure S7: Confirmation of transconjugants using detection of bcrABC and emrE. ................. 165 Figure S8: Upregulation of QUAT resistance determinants after 60 minute exposure to 10 µg/ml BAC with normalization to 16S rRNA. ...................................................................................... 166 Figure S9: Expression of QUAT resistance determinants after 60 minute exposure to 10 µg/ml BAC with normalization to 16S rRNA. ...................................................................................... 167        xiii  Acknowledgments  I would like to acknowledge all those who have contributed to my program, my development along the way, and the end result that is my thesis. First, I would like to acknowledge Dr. Kevin Allen for allowing me to be a part of the Ulrich Freybe Food Safety Laboratory at the University of British Columbia. I would like to acknowledge Dr. Christine Scaman, my interim supervisor, for all assistance and guidance throughout my degree. I would like to acknowledge Dr. Jessica Chen, for whom without neither the lab or I ever would have made it through the previous two years. Additionally, I would like to acknowledge my remaining committee members, Dr. Kristie Keeney and Dr. Siyun Wang, for all of their insightful feedback along the way and revisions towards the end. Last but not least, I would like to acknowledge all of the members of the Allen lab (new and old) for being there through the “early” morning breakfasts, the late night dinners, and the trials and tribulations of research.   xiv  Dedication         To my parents, grandparents, and sister; I appreciate that you’ve put up with me, or the lack of me, throughout these years.  1  Chapter 1: Literature review 1.1 The genus Listeria   The genus Listeria consists of seventeen species to date, with all considered to be facultative, Gram-positive saprophytes (den Bakker et al., 2013, 2010; Weller et al., 2014).  Of these species, Listeria ivanovii and Listeria monocytogenes can be pathogenic but only L. monocytogenes is primarily associated with disease in humans. The incidence of disease associated with L. monocytogenes is currently 3.0 and 3.4 cases/million/year in Canada and the UK respectively, and the disease remains characterized by fatality rates of 10-40% (Clark et al., 2010; Gillespie et al., 2006). There are approximately 2,000 genes in the core genome of Listeria and 3,000-4,500 genes in the accessory genome (den Bakker et al., 2010). Many of the genes in the accessory genome are putatively involved in metabolism of carbon sources and supports the classification of Listeria as a saprophyte (den Bakker et al., 2010). In the 1960’s and 1970’s, it was originally reported that Listeria species could be readily isolated from 12.2% of cultivated fields, 44.0% of uncultivated fields, 9.9% of meadows and pastures, and 15.2% of forests (Weis and Seeliger, 1975). More recent work shows that frequencies of Listeria monocytogenes, specifically, are 24% in ruminant farms, 17% in field areas, and 3% in dairy farms(Locatelli et al., 2013a; Nightingale et al., 2004). Survival in diverse soils indicates the natural environment is a prominent reservoir for the genus Listeria.    2  1.2 Foodborne disease in North America  Despite continued research for improving food safety, foodborne illness has been and will continue to be a concern. Between Canada and the United States, it is estimated that there are 13.4 million cases of domestically acquired foodborne illness annually (Scallan et al., 2011; Thomas et al., 2013). Viruses are the leading foodborne illness causing agent, accounting for 59% of foodborne illness and 12% of the foodborne illness related deaths, in part due to increased detection and reporting (Scallan et al., 2011; Thomas et al., 2013). However, bacterial pathogens still remain responsible for 39% of the total foodborne illness and 64% of foodborne illness related deaths, which are estimated to be over 1,300 each year in the United States alone (Scallan et al., 2011). Of the estimated deaths, L. monocytogenes ranks as the third most deadly foodborne pathogen, behind Salmonella spp. and Toxoplasma gondii (Scallan et al., 2011).    3  1.3 Listeriosis   In 1929, L. monocytogenes was first discovered as a bacterial pathogen capable of infecting humans (Gray and Killinger, 1966). Since then, it has become known as a lethal foodborne pathogen that can result in high hospitalization and fatality rates in susceptible populations (Scallan et al., 2011). L. monocytogenes can cause self-limiting cases of gastroenteritis in healthy individuals, however it is better known for the less frequent, but more severe disease, listeriosis. Listeriosis primarily develops in those predisposed with a compromised immune system, pregnancy, or age extreme (Farber et al., 1996). The number of cases per million persons is highest in the <1 year old age group, followed closely by the 60 and over year old age group (Clark et al., 2010). Cases can be defined as an individual with symptoms compatible with the isolation of L. monocytogenes from an otherwise normally sterile site (Clark et al., 2010).  In adult listeriosis, significant clinical syndromes that lead to high hospitalization rates and often death are severe septicemia followed by meningitis and encephalitis (Clark et al., 2010). Neonatal listeriosis most frequently results in abortion during the third trimester, while the mother suffers from only mild flu-like symptoms (Becroft et al., 1971).   Invasive listeriosis is fatal without treatment, the only exception being pregnant women whose infection may be self-limited after delivery (Schlech, 2000). The preferred treatment for invasive listeriosis is a combined prescription of an aminoglycoside and ampicillin (Hof et al., 1997). Treatment of up to three weeks is often recommended, and in the case of severely immunocompromised individuals prolonged treatment may be necessary to prevent relapses. For perinatal infections, if L. monocytogenes infection can be reliably confirmed prior to birth, treatment of the mother with an antibiotic regime may allow the pregnancy to continue to term   4  (Evans et al., 1985). Even with antibiotic treatment, fatalities as a result of invasive listeriosis still remain some of the highest for foodborne pathogens (Farber et al., 1996; Mead et al., 1999; Scallan et al., 2011). For this reason emphasis should remain on disease prevention, rather than treatment, primarily through the control of the bacterial pathogen in the food chain.  L. monocytogenes can also cause self-limiting gastroenteritis. In 1997, the first significant outbreak of febrile gastroenteritis caused by L. monocytogenes was reported in which 292 people were hospitalized and an estimated 72% of those exposed experienced symptoms after consuming the implicated cafeteria food (Aureli et al., 2000). Additional incidences of gastroenteritis in otherwise immunocompetent adults further suggest that more typical foodborne illness discomforts (e.g., fever, watery diarrhea, malaise) can also be associated with L. monocytogenes infection (Ooi and Lorber, 2005). The median dose of L. monocytogenes found to induce febrile gastroenteritis is 105 colony forming units (CFU)/g, however the minimum required dose is not known (Ryser and Marth, 2007). Though febrile gastroenteritis is not considered the primary concern with L. monocytogenes in the Food and Drug Administration (FDA) risk assessments, the burden may be underestimated due to lack of routine testing for the pathogen in examined stool cultures (Aureli et al., 2000; FDA, 2003). This clinical outcome should not be regarded as having an insignificant economic impact.     5  1.4 Epidemiology of listeriosis outbreaks  Only two Listeria species, L. ivanovii and L. monocytogenes, are commonly known to cause disease. L. ivanovii has been implicated in disease in ruminants with only rare cases of infection in humans, while L. monocytogenes remains the most significant Listeria species of concern in humans (Cummins et al., 1994). It has been reported that 99% of listeriosis cases can be related to food (FDA, 2003; Mead et al., 1999). Due to L. monocytogenes’ heat labile nature and lack of toxin production, resulting disease can be attributed to the consumption of contaminated ready-to-eat (RTE) foods. In Canada there have been numerous outbreaks, including an outbreak in 1981 that implicated L. monocytogenes as a foodborne pathogen. This outbreak, caused by contaminated prepackaged coleslaw in the Maritime provinces of Canada became the first well-documented food-associated listeriosis outbreak (Schlech et al., 1983). The cabbage used in the coleslaw production was thought to have been contaminated when manure from a ruminant farm was applied as fertilizer.  From 1996 until 2008, there were seven outbreaks of invasive listeriosis that occurred as the result of RTE products (Table 1; Health Canada, 2011). Implicated food items consisted of coleslaw, imitation crab meat, whipping cream, raw and pasteurized milk cheeses, and RTE meats. In 2008, Canada suffered its most significant outbreak of L. monocytogenes to date (57 illnesses and 23 deaths) with the Maple Leaf Foods outbreak as a result of contaminated, prepackaged delicatessen meats (Health Canada, 2011).      6   Table 1: Outbreaks of listeriosis in Canada1   Year Invasive Number of cases (deaths) Foods 1981 Yes 41 (17) Coleslaw 1996 Yes 2 Imitation crab meat 2000 Yes 7 Whipping cream 2002 Yes 47 Cheeses 2002 Yes 17 Raw milk cheese 2002 No 86 Cheese made from pasteurized milk 2008 Yes 57 (23) RTE deli meats 2008 Yes 40 (2) Cheeses 1Adapted from the Health Canada (2011) Policy on Listeria monocytogenes in Read-to-eat foods. Over 85% of listeriosis cases in the United States are predicted to be the result of contaminated RTE meats, with 1,599 cases attributed to deli meats according to FoodNet data from 1997-2000 (FDA, 2003). More recently several significant outbreaks of L. monocytogenes have been linked to the consumption of fresh produce (CDC, 2015a, 2011). In 2011, an outbreak linked to contaminated cantaloupes infected 147 people around the United States and caused 34 deaths and is now the largest outbreak of listeriosis to date in the United States (CDC, 2011). Additional outbreaks in the United States have occurred with celery, sprouts, and apples implicated as the vehicle for infection (CDC, 2015a, 2015b; Gaul et al., 2013). While not associated with an outbreak, a significant recall was issued in 2014 for stone fruits coming from one processor in the United States due to L. monocytogenes contamination (FDA, 2014). In sporadic cases of listeriosis in the United States, melons from commercial establishments as well as homemade and commercial hummus have been implicated as vehicles (Varma et al., 2007). While Canada has not yet observed similar produce-related listeriosis cases, these reports mirror the trend that the largest proportion of foodborne illnesses are now related to fresh fruits and vegetables, and indicates that in the future, contamination of produce with L. monocytogenes may be more of a concern (CDC,   7  2015c). While in recent cases of L. monocytogenes contamination of produce, the organism could readily be found in the washing and packaging plants that distributed the produce, the role of the produce in reintroduction into the facilities should be explored (CDC, 2011; FDA, 2014). Due to the well-documented abilities of L. monocytogenes to persist in the natural environment, more research should be done to understand the factors effecting its growth and survival in environments that may lead to contamination of produce.       8  1.5 Molecular epidemiology of Listeria monocytogenes  Due to the ubiquitous nature of L. monocytogenes, the widespread distribution of RTE foods, and often delayed onset of clinical symptoms it has become increasingly important to understand the epidemiology of L. monocytogenes and the interaction of subtypes with various environments. Numerous methods have been proposed for the subtyping of L. monocytogenes (Figure 1). Among these methods are serotyping, lineage typing, pulse field gel electrophoresis, multi-locus sequence typing, and subtyping based on plasmid carriage as well as resistance to the heavy metals cadmium and arsenic. The initial method for subtyping L. monocytogenes was proposed by Paterson based on distinct somatic (O antigens) and flagellar (H antigen) serotype groups of L. monocytogenes (Paterson, 1940). Currently, there are thirteen serotypes in total: 1/2a, 1/2b, 1/2c, 3a, 3b, 3c, 4a, 4b, 4c, 4d, 4e, 4ab, and 7 (Graves and Swaminathan, 2007; Seeliger and Jones, 1986).  Serotypes 1/2a, 1/2b, and 4b are more commonly associated with clinical cases in humans (Orsi et al., 2011).    9   Figure 1: The generalized interrelationship between select typing methods for Listeria monocytogenes. The typing methods can be seen from left to right as the genotypic based, and most discriminatory, Sequence Typing (ST), followed by the serological based serotyping and phenotypically based lineage typing. STx represents a single or group of strains highly related based on muti-locus sequence typing. Due to the differences in genotyping and phenotyping methods there are possibilities for overlap between serotype and lineage type groups. The black boxes represent theoretical clonal complexes, or groupings of genetically related strains isolated from temporally and geographically different times or locations. In the event these strains were related to disease they could be referred to as epidemic clones rather than clonal complexes. This figure is not drawn to scale and was adapted from the figures of Orsi et al. (2011).   10  L. monocytogenes lineage types are phylogenetic groupings that better represent the phenotypic differences in the population. There have been four lineage types (I, II, III, and IV) that have been proposed for L. monocytogenes (Piffaretti et al., 1989; Rasmussen et al., 1995; Ward et al., 2008). Analysis of whole genome sequence data of L. monocytogenes of varying serotypes has revealed a high level of genetic similarity, and the greatest heterogeneity was found in genes encoding transport or surface proteins (Hain et al., 2007). These genetic differences correlated with the serotypes and could contribute to the phenotypic differences seen in the lineages. Orsi et al. (2011), reported in the USA that lineage I, consisting of serotypes 1/2b, 3b, 3c, and 4b, was highly represented amongst human clinical isolates, whereas lineage II, consisting of serotypes 1/2a, 1/2c, and 3a, dominated food, natural environment, and FPE isolates (Figure 2).  Figure 2: Relative representation of Lineages I and II in different environments and outcomes. The arrow thickness indicates a higher prevalence of this lineage type in the respective environment or outcome relative to the other lineage type. Broken arrows indicate the representation of lineage I and II in sporadic cases of listeriosis in Northern Europe, which has the opposite trend as the USA. Lineage types III and IV were not included in this figure due to their low occurrence in these environments and outcomes. This figure was reproduced from Orsi et al. (2011) with permission from the American Society of Microbiology.   11   Regional differences in L. monocytogenes distributions can been seen around the world, but little is known if these are due to differences in food processing controls, the food supply, or geographic separation. Contrary to the role of the 4b serotype in disease in the USA, the majority (54.8%) of  listeriosis cases in Canada over the previous two decades have been linked to the 1/2a serotype (Knabel et al., 2012). A similar trend has been seen in Switzerland from 2011-2013 with serotype 1/2a accounting for the majority of clinical cases;  in Italy from 2000-2010 this has also been the dominant serotype in disease (Althaus et al., 2014; Pontello et al., 2012). Additionally, in Finland from 1995-2004, serotype 1/2a was responsible for 60% of the human listeriosis cases (Lyytikainen et al., 2006). It remains to be seen if this is reflective of the frequent presence of 1/2a in food environments and thus increased opportunity for product contamination, or a result of invasion characteristics unique to this serotype.  The plurality of sporadic and outbreak cases of listeriosis in Canada have been caused by an identical clonal complex (CC), CC8 (Knabel et al., 2012). A CC is a group of genetically related isolates according to MLST patterns. A new epidemic clone (EC), or a “group of genetically-related isolates implicated in geographically and temporally unrelated outbreaks that are presumably of a common ancestor”, has been proposed (Knabel et al., 2012). These isolates were first noticed due to the high similarity in pulse field gel electrophoresis (PFGE) patterns. PFGE is a banding pattern methodology that compares isolates based on fragment sizes resulting from the restriction of the whole genome by the two infrequent cutting enzymes AscI and ApaI. Multilocus sequence typing (MLST), or the comparison of the genetic sequences from seven housekeeping genes in L. monocytogenes, was used to further subtype these L. monocytogenes into, or single locus variants of, sequence type (ST) 120 (Knabel et al., 2012; Ragon et al., 2008; Salcedo et al., 2003). CC8 has been implicated in disease causing outbreaks of L. monocytogenes in Canada since   12  1988 and includes the strain responsible for the delicatessen outbreak of 2008 that was Canada’s most deadly listeriosis outbreak (ca. 50% fatality) (Knabel et al., 2012).  Additional methods for subtyping L. monocytogenes are used and have been suggested in the past, including subtyping of strains based on sensitivity to cadmium and arsenic (McLauchlin et al., 1997).  McLauchlin et al. (1997) evaluated 565 unrelated strains from both clinical and food environments around the United Kingdom and internationally. Substantial portions of their collection were determined to be resistant to cadmium (58%) and arsenic (18%), and combined with plasmid profiling the authors suggested this may be a reliable, easily applied method for subtyping (McLauchlin et al., 1997). The authors did not suggest any associations between clinical and food isolates and heavy metal resistance, but they did report that 67% of serogroup 1/2 isolates were resistant to cadmium compared to only 45% of 4b isolates (McLauchlin et al., 1997). It is worth noting that over 60% of the serogroup 1/2 isolates were collected from food whereas only 29% of 4b isolates were from food (McLauchlin et al., 1997). Heavy metal resistance may contribute to fitness of these serogroup 1/2 isolates in the natural and food processing environment that leads to their contamination of products and significant representation in food samples. Lee et al. (2013) analyzed L. monocytogenes serotype 4b isolates responsible for sporadic illnesses for resistance to cadmium and arsenic. The authors found associations between specific genetic determinants for cadmium and arsenic resistance and certain epidemic clones of L. monocytogenes. They concluded that the acquisition of heavy metal resistance genes by these isolates responsible for illness may be one of the traits that has allowed them to better persist in a variety of environments and increase the likelihood of product contamination. Lee et al. (2013) highlighted the need for further studies to understand benefit of cadmium and arsenic resistance to L. monocytogenes.   13  1.6 Mechanisms of Listeria monocytogenes pathogenesis 1.6.1 Mechanisms of invasion   The infectious pathway of invasive listeriosis and febrile gastroenteritis begins in the gastrointestinal tract. In the biphasic challenge of gastric acidity followed by bile salts, clinically derived strains of L. monocytogenes survived better than food derived strains (Ramalheira et al., 2010), which is an indication of the importance of acid and salt tolerance to the virulence of L. monocytogenes. Bacteria that survive these stresses then move on to the intestinal tract to invade the epithelium. As the epithelium in the intestinal mucosa renews, internalin protein A allows L. monocytogenes to adhere to the exposed E-cadherin of enterocytes that is normally concealed within cell-cell junctions, facilitating transfer across the intestinal barrier (Lecuit et al., 2001). Intracellular transport of L. monocytogenes cells at this stage may contribute to febrile gastroenteritis, however transportation via the blood or lymphatic system to the liver and internal organs appears to happen rapidly and without intracellular replication of the bacteria in the intestinal epithelium (Ebe et al., 1999; Pron et al., 1998). The majority of cells end up in the liver, and if an insufficient immune response is mobilized, L. monocytogenes can overwhelm the host macrophages and survive to proliferate in the host cells.   Invasion in L. monocytogenes is mediated by the family of proteins called internalins, allowing L. monocytogenes entry into non-phagocytic cells. At least 28 members of the internalin (Inl) family have been identified in Listeria, however InlA and InlB, are the most well-studied. These proteins are encoded on the inlAB operon (Braun and Cossart, 2000; den Bakker et al., 2010; Jacquet et al., 2004). Both are surface anchored proteins that can facilitate internalization of the bacterial cell into the host cell without additional contributing factors (Braun et al., 1998; Lecuit et al., 1997). InlA mediates entry into host epithelial cells expressing E-cadherin, as described   14  earlier, and InlB facilities the entry into a more diverse range of cells possessing Met or qC1q-R receptors (Cossart, 2002; Lecuit et al., 2001). The loss of either of these two internalins can result in a loss of invasion of hepatocytes by 2-10 fold during in vitro assays, but the loss of the whole inlAB operon reduces invasion by 100 fold (Dramsi et al., 1995). From a food safety perspective, the loss of, or mutations in, InlA may be more significant due to its role in crossing the epithelial barrier. InlA mutants failed to cause mortality in Guinea pigs at doses that normally cause 100% mortality when administered orally (Lecuit et al., 2001). Further supporting the importance of InlA, L. monocytogenes strains with pre-mature stop codons in the inlA gene had reduced invasion in Caco-2 and HepG2 cell lines as well as in Guinea pigs that were orally infected (Nightingale et al., 2008). Interestingly, Nightingale et al. (2008) exposed Guinea pigs to L. monocytogenes with pre-mature stop codons in the inlA gene then subsequently orally infected them with L. monocytogenes with wild type inlA and reported a protective effect. This suggests the possibility of an attenuated vaccine, or a beneficial effect of avirulent L. monocytogenes that could be encountered in food. 1.6.2 Intracellular replication   Integral to the virulence of L. monocytogenes is the Listeria pathogenicity island 1 (LIPI-1) that contains the genes prfA, plcA, hly, mpl, actA, and plcB (Vázquez-Boland et al., 2001). Together, these six virulence factors provide the framework for L. monocytogenes as the intracellular pathogen. The first gene in LIPI-1 is prfA which encodes PrfA, the positive regulatory factor A. PrfA itself is positively regulated by indicators of invasion, such as exposure to 37°C as opposed to <30° via a RNA thermoswitch, and can be repressed by environmental sugars to limit metabolic waste when outside of the host (de las Heras et al., 2011; Freitag et al., 1993).  PrfA binds to PrfA-boxes that are 14 base pair palindromic repeats upstream of transcriptional start sites   15  for virulence associated genes (Scortti et al., 2007). PrfA boxes can be found within the LIPI-1 and upstream of prfA itself, creating a positive feedback loop for expression of virulence factors. Expression of each of the remaining genes in the LIPI-1 coincides with the crucial steps of L. monocytogenes pathogenesis. In order to be virulent, L. monocytogenes must be able to escape the compartmentalization within macrophages, the host’s primary innate immune defense. Lysis is mediated by the listeria lysin O protein and phospholipases (Beauregard et al., 1997; Marquis et al., 1995). Listeria lysin O (LLO) hemolysin protein is encoded by the hly gene (Vázquez-Boland et al., 2001). It is necessary for escape from the primary vacuole after phagocytosis by cells and also involved in the release of bacteria from the double membrane vacuoles formed during intracellular spread (Gedde et al., 2000). Aiding LLO are phospholipases, the two most prominent are encoded by plcA and plcB (Marquis et al., 1995). L. monocytogenes with knock-out mutants of both of these genes have a significantly reduced potential for disease due to their reduced ability to escape the phagosome. Also found on LIPI-1 is mpl, which encodes a zinc-metalloprotease that aids in invasion by processing PlcB into its active state (Marquis et al., 1995). The main stress that L. monocytogenes faces when phagocytosed by macrophages is acidification of the vacuole (Beauregard et al., 1997). Survival of L. monocytogenes is dependent on its tolerance to the low pH environment, another indication that acid tolerance is crucial for clinically successful strains. The acidic pH optimum of LLO limits the activity of LLO to the acidified vacuole, thus not prematurely rupturing the host cell within which the pathogen takes refuge (Portnoy et al., 2002). In the acidified vacuole, LLO functions to lyse the compartment through mechanisms not fully understand, but lytic activity is inhibited once it is released into the more neutral cytosol.   16   Between the combined actions of LLO and various phospholipases, L. monocytogenes can be released from the vacuoles and is free to replicate in the cytosol, which provides a much more conducive environment for proliferation. The virulence regulated hexose phosphate transporter that facilitates growth utilizing glucose-6-phosphate is required for optimal intracellular doubling times of L. monocytogenes (Chico-Calero et al., 2002; Gaillard et al., 1987). Additionally, the metabolic genes purH, purD, and pyrE, all involved in synthesis of purine or pyrimidine, as well as an arginine transporter, arpJ, are upregulated during cytosolic growth (Klarsfeld et al., 1994).  After replication, actin-based motility allows for movement through the cytosol and is crucial for intracellular spread. L. monocytogenes movement within the host cell is made possible by the propulsion generated from an actin tail. L. monocytogenes is remarkable in that only one protein, ActA, encoded by actA, is required for both the recruitment of host cell actin and the polymerization of the actin tail that allows for movement (Vázquez-Boland et al., 2001). As actin is recruited to ActA, actin filaments accumulate in the cytosol or up against a host cell structure. ActA functions as a nucleation point for actin filaments and as additional actin is recruited the tail becomes elongated at the bacterial surface, pushing the cell away from the immobilized actin filaments. ActA accumulates at only one pole of the bacterial cell, allowing for efficient unidirectional movement (Kocks et al., 1993). As the tail grows and L. monocytogenes is propelled to the membrane of the host cell, a protrusion forms budding into the neighboring cell (Tilney and Portnoy, 1989). L. monocytogenes then finds itself in a double membrane vacuole within a new host cell. If the host lacks a competent immune response to clear infected host cells, L. monocytogenes will again escape from the vacuole and continue to replicate and spread.      17  1.6.3 Systemic spread and treatment  After one week, an adequate immune system normally proves sufficient for eradicating a L. monocytogenes infection. If the infection is not cleared at this point however, it can spread to full bacteremia (Vázquez-Boland et al., 2001).  Bacteremia can involve proliferation in the blood stream (septicemia), infection of the central nervous system, or crossing the placental barrier in pregnant women (Vázquez-Boland et al., 2001). In non-pregnant individuals, L. monocytogenes is a significant cause of adult meningitis, but 73% of cases of listeriosis in Canada between 1995 and 2004 manifested themselves as septicemia (Clark et al., 2010). At this point treatment is necessary for recovery. Unfortunately, as a result of the 1-2 week delayed onset of spread and development of symptoms, the host’s susceptibility, and the intracellular nature of L. monocytogenes, treatment can be difficult (Posfay-Barbe and Wald, 2009).  Reports of antibiotic resistance in L. monocytogenes remain sparse, but they do exist (Lungu et al., 2011). Antibiotic resistance genes have been identified in L. monocytogenes for tetracycline and erythromycin, however resistance to the preferred antibiotics of treatment, ampicillin and gentamicin, is rare (Lungu et al., 2011; Swaminathan and Gerner-Smidt, 2007). An ABC transporter, AnrAB, is involved in the innate resistance of L. monocytogenes to nisin, bacitracin, and β-lactam antibiotics, however the level of resistance to β-lactams that it contributes to is well below clinical doses (MIC of 1 µg/ml) (Collins et al., 2010). Its presence, however, suggests the possibility of upregulation that may contribute to elevated levels of resistance. Despite the rare occurrence of resistance to clinical antibiotics there is always cause for concern with L. monocytogenes. L. monocytogenes  is ubiquitous in nature and can be frequently isolated from stool samples of otherwise healthy humans, implying that there is great opportunity for exchange   18  of genetic material with non-pathogenic species that may be reservoirs of resistance to common antimicrobials  (Allen et al., 2014; Lungu et al., 2011).     19  1.7 L. monocytogenes ecology and transmission  1.7.1 Reservoirs  Introduction of L. monocytogenes into the food processing environment (FPE) is a difficult issue to control in food safety. There are numerous factors that may contribute to more frequent contamination of the FPE. As stated above, the Listeria species are saprophytes. L. monocytogenes is well adapted to survival in the natural environment and has been reported to survive for more than 730 days in soil and up to 928 days in water (Sauders and Wiedmann, 2007).  In produce fields, 8.3 and 9% of soil samples were found to be positive for L. monocytogenes (Dowe et al., 1997; Strawn et al., 2013b). More varied prevalence was also found in ruminant farms with L. monocytogenes isolated from 3, 8.3, 24 and 27% of soil samples (Fox et al., 2009; Garcia et al., 1996; Locatelli et al., 2013a; Nightingale et al., 2004). Maintenance practices of agricultural fields, such as irrigation and soil cultivation, are associated with increased isolation of L. monocytogenes (Strawn et al., 2013b). L. monocytogenes populations will decline in livestock waste over time, but the continuous reapplication of manure to agriculture fields as fertilizer and the method in which it is applied can maintain a constant level of the viable pathogen (Hutchison et al., 2005; 2004).  In addition, sighting of wildlife in proximity to pastures has been associated with increased isolation of L. monocytogenes (Chapin et al., 2014). This exemplifies that L. monocytogenes is prevalent in farm environments where produce and livestock may be exposed to it. A contributing factor to the difficult control of L. monocytogenes introduction into the FPE are employees and equipment which can readily track in contaminated soils (Schuchat et al., 1991). Regardless of sufficient cleaning and sanitation practices in the FPE, repeated introduction of L. monocytogenes from raw ingredients and employees into the FPE can lead to increased risk of persistence in the plant, contamination of the final product, or both.   20  1.7.2 Cold adaptation and growth  L. monocytogenes’ ability to adapt to and grow at cold temperatures sets it apart from many other foodborne pathogens. Its cold adaptability may contribute to seasonal survival in the natural environment as L. monocytogenes has been reported to be isolated with greater frequency in cooler temperature months (Strawn et al., 2013a). Growth at refrigeration temperatures of 2-4°C means L. monocytogenes can proliferate in temperature controlled production areas and properly stored RTE foods to reach infectious concentrations in a matter of days (FDA, 2003). L. monocytogenes ability to adapt to and grow at cold temperatures hinges on three main response mechanisms: changes in membrane fluidity, the production of cold shock proteins, and the import of solutes that contribute to metabolic function at cold temperatures(Gandhi and Chikindas, 2007).  As the temperature decreases, so does the kinetic energy of all molecules. The cell membrane becomes more rigid as carbon-carbon interactions increase, which affects solute transport across the membrane and membrane-bound enzyme activity (Gandhi and Chikindas, 2007). To combat this, L. monocytogenes has been reported to increase the proportion of branched fatty acids in the membrane as well as shorten their length; both factors decrease the number of interactions between the carbon molecules (Annous et al., 1997). Several transposon-induced mutants have been created in L. monocytogenes that showed low temperature sensitivity in support of this.  Mutated bkdB and pgpH genes resulted in decrease branched chain fatty acids and cell membrane proteins that impact membrane fluidity (Liu et al., 2006; Zhu et al., 2005). However, bkdB was not induced at low temperatures and the expression of pgpH may contribute to cold adaptability of L. monocytogenes but there were no significant differences in expression of pgpH  found between slow, intermediate, and fast cold adapting strains (Arguedas-Villa et al., 2014, 2010; Zhu et al., 2005). Mutations in sigL have been suggested to effect the regulation of pgpH,   21  but these mutations were found in a variety of slow, intermediate, and fast cold adapters suggesting there are other yet unknown regulatory factors involved in adaptation to cold stress (Arguedas-Villa et al., 2014).  Several chaperone proteins have been identified in L. monocytogenes that are involved in the cold shock response (Gandhi and Chikindas, 2007). There is a family of small DNA and RNA chaperone proteins thought to facilitate regulation, transcription, and translation at cold temperature by maintaining proper nucleic acid folding (Ermolenko and Makhatadze, 2002). There are three cold shock family proteins (cspA, cspB, and cspD) in L. monocytogenes (Glaser et al., 2001). They are not necessary for growth under normal temperatures (37°C) or non-osmotic stress conditions, but are crucial for growth at refrigeration temperatures or defined minimal media with 2.2% NaCl (Schmid et al., 2009). Additionally, Liu et al. (2002) reported the increased expression of groEL, clpB, and clpP when L. monocytogenes 10403S was grown at 10°C compared to 37°C, all of which are putatively involved in facilitating protein folding or the degradation of aggregated or misfolded proteins due to the low temperature.  Glycine betaine and carnitine are low molecular weight, high solubility molecules that carry a neutral charge and do not interfere with general enzymatic function (Bayles and Wilkinson, 2000). Angelidis and Smith (2003), evaluated the benefit of glycine betaine and carnitine transporters in L. monocytogenes and Wemekamp-Kamphuis et al. (2004) confirmed their findings that the import of glycine betaine and carnitine support continued metabolic function at cold temperatures. While Liu and coworkers did not report the upregulation of any genes involved in the transport of low molecular weight solutes, knockout mutants of these genes have been shown to be involved in cold adaption (Liu et al., 2002). Mutants that lacked the necessary transporters,   22  BetL and Gbu for glycine betaine import and OpuC for carnitine import, showed reduced growth at cold temperatures (7°C) (Angelidis and Smith, 2003). 1.7.3 Osmotolerance   Osmotic pressure occurs when there is low water activity (aw) and can affect enzymatic activity and cell turgidity causing decreased metabolic activity or resulting in cell death. This has been shown to be a principal factor in soil survival, as the moisture of different soils is a significant variable in determining survival and presence of L. monocytogenes (Chapin et al., 2014; Welshimer, 1960). Low aw is a situation that is often induced in foods as a method of preservation through drying of the product or addition of salts. Bacteria in the FPE routinely experience cyclical periods of limited growth, physical cleaning and sanitation, followed by desiccation and starvation (Pan et al., 2006). Similar to their role in cold growth, glycine betaine and carnitine are also osmotically active solutes that do not interfere with cellular functions even at high concentrations  (Bayles and Wilkinson, 2000). In addition, both glycine betaine and carnitine form three to five hydrogen bonds with water molecules, helping to limit the continuous loss of water (Galinski et al., 1997). Upregulation of gbuA under high osmotic stress increases the import of glycine betaine (Duche et al., 2002). This helps explain how the addition of glycine betaine to the cell’s environment can increase the growth rate of L. monocytogenes under osmotic stress (Bayles and Wilkinson, 2000). Additionally, the upregulation of the protein chaperone, dnaK, maintains protein conformation under altered aw and salinity, by osmotically stressed L. monocytogenes (Duché et al., 2002).     23  1.7.4 Acid tolerance   High acidity is a common strategy for food preservation, and a stress frequently encountered in natural and food processing environments. L. monocytogenes benefits from being tolerant to high acid foods that are normally effective against other bacterial pathogens. Common sanitizers, such as mixed peroxyacetic acids, are well suited for use in clean-in-place systems (Kitis, 2004; Marriott and Gravani, 2006). Agricultural soils range from a pH of 4.5-6.5 and acidity is significantly related to L. monocytogenes survival in natural environments (BCMOA, 2001; Locatelli et al., 2013b). High acidity is also a significant stress during passage through the host.    Acid tolerance is beneficial for survival during both gastric passage and phagocytosis by macrophages (Conte et al., 2002; Cotter et al., 2001).  As L. monocytogenes is a facultative anaerobe, it has the capability to regulate intracellular pH using both the electron transport chain as well as anaerobic ATP hydrolysis to translocate H+ across the membrane (Shabala et al., 2002). In particular, the F0F1 – ATPase multisubunit enzyme system that is normally used for anaerobic respiration is involved in raising the intracellular pH by utilizing energy stored as ATP (Shabala et al., 2002). The glutamate decarboxylase (GAD)  system similarly raises the intracellular pH through the use of a glutamate/gamma-aminobutyrate (GABA) antiporter (Cotter et al., 2001). L. monocytogenes decarboxylates intracellular glutamate using up one H+ and then exports the glutamate as GABA while another glutamate is imported (Cotter et al., 2001). The addition of glutamate to simulated gastric systems increased the survival of L. monocytogenes and it has been suggested that glutamate rich foods may also contribute to survival in this way (Cotter et al., 2001; Gandhi and Chikindas, 2007). Combined, the F0F1 – ATPase and GAD systems make up crucial parts of the acid tolerance response (ATR).    24   Exposure to mild acid stress allows L. monocytogenes to then subsequently adapt to further high acid stress (O’Driscoll et al., 1996). This is referred to as the ATR, in which the role of aerobic and anaerobic respiration as well as the GAD system contribute to L. monocytogenes’ abilities to survive many acidic natural, food, and host environments. The ATR needs to be very rapid in order to survive quick drops in pH that may be encountered during food processing or upon entry into the digestive tract (Shabala et al., 2002). The ATR in L. monocytogenes relies on pre-constructed proteins for an immediate response while additional proteins, such as GroEL and ATP synthase, can be transcribed for further acid adaption (Phan‐Thanh and Mahouin, 1999). The production of these proteins allows for the chaperoning of misfolded proteins and additional ATP for bolstering the ATR in the event of additional acid stress. L. monocytogenes exposed to mild acid stress (pH 5.5) is able to induce the ATR and recover with increased survival under subsequent high acid challenge (pH 3.5) a feat that is very valuable to surviving the multiple hurdles of the FPE and gastric acid in the host (O’Driscoll et al., 1996). 1.7.5 Metal ion tolerance   The presence of metals in the environment, such as arsenic, copper, and cadmium, may be affecting the population of L. monocytogenes in the food chain in a variety of ways. Transition metals are required as micronutrients but both heavy metals and transition metals at even slightly elevated levels are deleterious. For example, at low concentrations, some are utilized as enzyme cofactors, but in excess, can be potent generators of reactive oxygen species (ROS) (Fones and Preston, 2013; Nies and Silver, 2007). Even at low concentrations of metals, pH can affect the bioavailability or solubility of trace metals that are present in the environment, potentially synergistically increasing their effect (BCMOA, 2001; Chuan et al., 1996; Domínguez et al., 2009). Whether they are intentionally used for the control of microorganisms or present as   25  contaminants of agriculture, heavy metals have affected and continue to affect the evolution of L. monocytogenes.   Arsenic containing compounds have been used extensively in the poultry industry to promote growth and for disease prevention (Fisher et al., 2015). The arsenical roxarsone in particular has been fed to 88% of the chickens raised for human consumption in the United States till 2010 (Nachman et al., 2013).  Roxarsone is excreted by poultry and subsequently shed into the environment directly or via barn litter spread in agricultural fields (Fisher et al., 2015). L. monocytogenes can be frequently found in poultry facilities as well as readily isolated from farm environments (Dan et al., 2015; Locatelli et al., 2013a; Sugiri et al., 2014). No association between arsenic resistant L. monocytogenes and arsenicals use in the farm environment has been made, but exposure to water soluble arsenic compounds could act as a significant selective pressure for arsenic resistant isolates of Listeria. Multiple arsenic resistance determinants have been found in L. monocytogenes, with 18-20% of the isolated populations resistant to arsenic (Lee et al., 2013; McLauchlin et al., 1997; Ratani et al., 2012). However, these determinants have all been chromosomally incorporated, limiting their horizontal spread, and have not been associated with any additional survival advantages in the host or natural environment. It remains to be determined if rising concern over arsenic compounds in certain types of produce, such as apples, or produce production has any implication for arsenic resistance in L. monocytogenes (Carrington et al., 2013). Copper resistance in L. monocytogenes is more multi-faceted than arsenic resistance, with benefits of resistance being seen in both the host and natural environment. The copA encoded copper efflux protein is necessary for limiting toxic accumulation of copper in the cytosol of L. monocytogenes at levels as low as 100 µM CuSO4 (Corbett et al., 2011). Resistance to copper is beneficial for intracellular pathogens as macrophages have been shown to use copper for   26  bactericidal activities in the phagosome (White et al., 2009). How the copper elicits an antibacterial effect in the macrophage is not quite known, but it may contribute to additional generation of hydrogen peroxide in the phagosome. The combined effect of copper and the already generated hydrogen peroxide from the macrophage respiratory burst has been shown to be lethal to other pathogens (Elzanowska et al., 1995). Export of copper may limit the generation of ROS within the cell and benefit the intracellular lifecycle of L. monocytogenes. L. monocytogenes isolated from the dairy farm environment were highly resistant to copper with over 90% of isolates having a MIC of 256 µg/ml CuSO4 (Margolles et al., 2001). This prevalence of copper resistance could be in part due to the extensive use of copper as an antimicrobial agent in agricultural systems where L. monocytogenes may be frequently exposed (Fones and Preston, 2013; Locatelli et al., 2013b). The use of copper in agriculture may provide an additional selective pressure for copper resistance, but the benefit to the intracellular lifecycle likely precedes the use of copper for antimicrobial treatment. Unlike copper and arsenic, there is no intended use of cadmium either by the host or in food or animal production that explains the widespread incidence of cadmium resistance seen in L. monocytogenes from environmental and clinical settings worldwide (Margolles et al., 2001; McLauchlin et al., 1997; Mullapudi et al., 2008; Xu et al., 2014). Several reports indicate that approximately 50% or more of tested isolates were resistant (McLauchlin et al., 1997; Mullapudi et al., 2008; Ratani et al., 2012). Margolles et al. (2001), on the other hand, reported that 90% of their isolates were susceptible to 64 µg/ml cadmium sulfate, although the minimum inhibitory concentration (MIC) varied. Four resistance determinants have been identified that contribute to cadmium resistance, however cadmium resistant isolates have been found that lack any of the known determinants suggesting that there are yet unidentified means of resistance (Lee et al.,   27  2013). The first determinant to be discovered in L. monocytogenes, cadA1, was found on the transposon Tn5422 and showed similarity to cadmium resistance determinants found in Staphyloccocus species (Lebrun et al., 1994b). A resistance determinant, cadA2, was reported on plasmid pLM80 in L. monocytogenes and a third, cadA3, was reported within an integrating and conjugative element in L. monocytogenes, EGDe (Elhanafi et al., 2010; Mullapudi et al., 2010). The fourth resistance determinant, cadA4, was discovered on the chromosome of L. monocytogenes ScottA (Lee et al., 2013). Monitoring of cadmium levels in Europe and Canada have revealed detectable concentrations of cadmium but these are generally within soil and fresh water regulatory limits (Health Canada, 1994; Pan et al., 2010). The highest concentrations of cadmium are closely associated with industrial mining processes, but there is also a strong correlation of cadmium presence in arable agriculture with the application of rock phosphate fertilizer (Health Canada, 1994; Pan et al., 2010). Phosphate fertilizers can be contaminated with cadmium during their production process and have been suggested as a vehicle for cadmium addition to agricultural soils (Grant and Sheppard, 2008; Grant, 2011). The cadmium is naturally present in the phosphate rock, as it forms precipitates with the phosphate compounds, and is carried on through the production of the fertilizer (Grant, 2011). The concentration of the cadmium in the fertilizer depends on the initial level of contamination in the phosphate rock, with rock phosphate containing anywhere from 2-100 mg/kg cadmium (Grant, 2011), Yearly accumulation of cadmium due to phosphate fertilizer application ranges from 0.1-3.1 g/hectare/year (Nziguheba and Smolders, 2008). Also contributing to the influx of cadmium to soils is the application of sewage sludge, or biosolids, to agricultural fields. While phosphate fertilizers may have higher concentrations of cadmium, compared to biosolids, average 43 mg/kg and 2.9 mg/kg dry weight respectively, the average influx   28  of cadmium in soils where biosolids are applied is higher than for soils with phosphate fertilizer use, 64 and 3.3 g/hector per application period respectively, across Canadian provinces (Sheppard et al., 2009) The accumulation of low levels of cadmium contamination in soils may be selecting for resistant L. monocytogenes. The association between plasmid carriage and cadmium resistance has been reported, which is not surprising considering three of the four cadmium resistance determinants (cadA1, cadA2, cadA3) are frequently plasmid borne (Kuenne et al., 2010; Lebrun et al., 1994a; McLauchlin et al., 1997; Mullapudi et al., 2010). Cadmium resistance and plasmid carriage has also been reported to be higher in recurrent isolates from food processors than sporadic isolates (Harvey and Gilmour, 2001). Aside from the putative selective pressure of environmental cadmium, little further work and few suggestions have been made as to why cadmium resistance is so prevalent (Lebrun et al., 1992; Margolles et al., 2001). However, determinants for both cadmium resistance and resistance to quaternary ammonium compounds (QUATs) have been found on a recently discovered plasmid (pLM80) in L. monocytogenes (Elhanafi et al., 2010).    Recent reports have made associations between resistance to cadmium and arsenic and disease causing L. monocytogenes (Lee et al., 2013). Lee et al. (2013) noted that resistance determinants for cadmium and arsenic were principally found amongst clonal groups that have been repeatedly responsible for foodborne outbreaks. The authors suggested that their propensity for heavy metal resistance may indicate their ability to horizontally acquire accessory genes that are beneficial for survival in various environments or invasion in the host. Margolles et al. (2001) concluded that cadmium resistance may be increasing in the L. monocytogenes population from dairy farm environments due to exposure to a moderate selective pressure of solubilized heavy metal salts, but no connection was made to disease causing strains. Overall, there is a lack of   29  consensus of the benefit of heavy metal resistance to L. monocytogenes and what influence heavy metals in the natural environment may have on growth characteristics of L. monocytogenes.  1.7.6 Sanitizer tolerance   Whether sporadic or persistent, the efficient eradication of L. monocytogenes is important for any food processing facility. More so than the raw product itself, the FPE is the most common source for post-processing but pre-packaging, contamination of RTE foods (Malley et al., 2015). An important part of all cleaning and sanitation schemes is the assurance that the appropriate sanitizers are chosen and applied in a suitable manner. The method of intended use often dictates the class of sanitizer chosen and for L. monocytogenes sanitization, both oxidative and quaternary ammonium compound based sanitizers are typically employed by the food industry (Pan et al., 2006).   Mixed peroxyacetic acids are common industrial sanitizers formed through the reaction of hydrogen peroxide and acetic acid (Figure 3) and have been shown to be effective at controlling planktonic L. monocytogenes (Pan et al., 2006). They are biocidal in their undissociated form at acidic pH, but have little difference in efficiency between pH 5 and 8 while significantly less effective at pH 9 and above (Kitis, 2004). Peroxyacetic acids can also be used to treat many classes of microorganisms, and are  less corrosive and affected by organic material than some other oxidative sanitizers (Marriott and Gravani, 2006). For these reasons they are frequently used in clean-in-place systems, and followed by a rinse due to their corrosive nature on metals. When utilized in a simulated food processing environment, however, survival of surface-adhered L. monocytogenes was found (Pan et al., 2006). Surviving sessile cells that were subsequently removed did not show any increase in resistance compared to non-treated L. monocytogenes.   30  Microscopic images of the treated colonies revealed that surface cells lacked distinct morphology and lytic debris may be responsible for protecting the underlying cells. CH3CO2H + H2O2  CH3CO3H + H2O where CH3CO2H = acetic acid CH3CO3H = peracetic acid H2O2 = hydrogen peroxide Figure 3: Formation of peracetic acid from hydrogen peroxide and acetic acid (Kitis, 2004).  Quaternary ammonium compound based sanitizers (QUAT) gain their name from the four alkyl chains covalently bound to a nitrogen atom (Figure 4) (Marriott and Gravani, 2006). These hydrophobic tails are thought to interact with the hydrophobic interior of bacterial cell membranes and disrupt the cell’s integrity (Gilbert and Al-Taae, 1985). Varying chain lengths have been found to have greater effects on different bacterial species as well as yeast and fungi (Gilbert and Al-Taae, 1985). The QUATs, including BAC, are commonly used in the food industry due to their stability, non-toxic nature, effectiveness against Listeria, and applicability as surfactants (Marriott and Gravani, 2006). As surfactants though, they can leave behind a residual antimicrobial film at concentrations well below the recommended use concentrations of 200 to 800 µg/ml (Marriott and Gravani, 2006).  Under these circumstances, increased tolerance in L. monocytogenes due to efflux pumps may contribute to facilitating survival in the FPE and its ability to persist over time.   31   Figure 4: Chemical structure of a quaternary ammonium compound. Side groups (represented by Rx) are alkyl chains of varying lengths. L. monocytogenes has been shown to possess genetic determinants for efflux mediated increased resistance to (QUATs). The first multidrug efflux pump found in L. monocytogenes, MdrL, was discovered in 2000 by Mata et al. (2000). The authors reported increased resistance to ethidium bromide, macrolides, cefotaxime, and heavy metals when mdrL was present in L. monocytogenes. The same year, Mereghetti et al., (2000) evaluated 97 L. monocytogenes isolates from food, FPEs, and clinical settings for resistance to QUATs.  They found that seven strains had increased resistance, with elevated minimum inhibitory concentrations (MICs) to 10 µg/ml benzalkonium chloride (BAC), whereas the majority were susceptible to 4 µg/ml. Suspecting the recently discovered mdrL gene as the cause of the increased MIC, the authors used polymerase chain reaction (PCR) amplification for genetic testing. They found all 97 isolates to be positive for mdrL, and concluded inherent resistance or perhaps over-expression of mdrL in the seven resistant strains may be the cause of the increased MIC (Mereghetti et al., 2000). It has been confirmed that overexpression of mdrL can cause an increase in resistance, however this effect was only made evident after the isolates had been selected for on media containing benzalkonium chloride (BAC) (Romanova et al., 2006).    32  Additional resistance determinants to QUATs have been identified that contribute to higher MICs than MdrL including bcrABC and qacH (Elhanafi et al., 2010; Müller et al., 2013). The first is a cassette of genes that encode two putative small multidrug resistance proteins (BcrB and BcrC) and one TetR family transcriptional regulator (BcrA) (Elhanafi et al., 2010). This resistance cassette was first found on the pLM80 plasmid with a cadmium resistance determinant, however isolates have been recovered with bcrABC incorporated into the chromosome (Dutta et al., 2013; Elhanafi et al., 2010). Regardless, for all isolates positive for bcrABC the MIC to BAC was 30-40 µg/ml (Dutta et al., 2013). This cassette was found in QUAT resistant L. monocytogenes isolated from a variety of sporadic and outbreak associated food, FPE, and clinical sources in North America (Dutta et al., 2013). An Austrian study published by Müller et al. (2013) found the majority of their strains with high MIC to BAC did not possess bcrABC, but found ten isolates with a novel small multidrug resistance protein, QacH. QacH is encoded by qacH and carried on the Tn6188 transposon in L. monocytogenes (Müller et al., 2013). Müller et al., identified QacH as being the responsible efflux pump for increased MIC to BAC in all of their isolated resistant strains. All qacH positive isolates had a MIC to BAC of 30 µg/ml, with the exception of one isolate that exhibited a MIC of only 15 µg/ml (Müller et al., 2013). This one isolate was found to have three non-synonymous mutations in the qacH gene, possibly explaining the lack of increase in MIC to BAC.  A final resistance determinant that has been identified in L. monocytogenes was first found on the Listeria Genomic Island 1 (LGI1) and putatively associated with increased resistance to QUATs (Gilmour et al., 2010). Encoded by emrE, this efflux mediated resistance has so far only been reported to be found within LGI1 and in ST120 strains of L. monocytogenes (Knabel et al., 2012). A ΔemrE mutant has confirmed that emrE plays a role in resistance to QUATs in L.   33  monocytogenes  (Kovacevic, 2014). It remains to be seen how widespread emrE may be in comparison to the other resistance determinants and/or if co-expression of any of these resistance determinants (e.g. bcrABC, qacH, emrE) may allow for a greater resistance to QUATs. 1.7.7 Regulation of stress response   Just as virulence regulation in L. monocytogenes has the central player PrfA, adaption to certain stressors revolves around the alternative sigma factor σB. Encoded by sigB, transcription is upregulated under high acid, low temperature, and high osmotic stress situations (Becker et al., 2000, 1998; Wiedmann et al., 1998). It has also been shown that σB regulates oxidative stress tolerance and facilitates survival in carbon starvation situations as well as playing a role in biofilm formation and disinfectant resistance; however it has little impact on ethanol and heat tolerance adaption (Ferreira et al., 2001; Van Der Veen and Abee, 2010). Transcriptomic approaches have been used to evaluate the upregulation of σB dependent genes across multiple lineages of L. monocytogenes. Oliver et al. (2010) identified a core regulon of 63 σB dependent genes in all four lineages, however the total number of σB dependent genes across all lineages approached 400. While many genes were differentially upregulated in the various lineages, among the core upregulated genes were hallmarks for stress survival in L. monocytogenes such as glycine betaine transporters as well as the glutamate decarboxylase system (Oliver et al., 2010).   As with ATR, exposure to sub-lethal stress can prime L. monocytogenes for subsequent challenges of the FPE. Due to the pervasive influence of σB-dependent genes in stress adaption, survival of one challenge can allow for bolstering of defenses for an entirely new stress. This is apparent where there are clear overlaps in defense mechanisms that are regulated by σB dependent genes. For instance, adaption of L. monocytogenes to cold temperatures (4°C) allowed for   34  increased growth when exposed to 3-10% NaCl as compared to cells grown at 37°C (Bergholz et al., 2010; Pittman et al., 2014). The ATR, which can facilitate survival under mild acidic conditions due to the activity of the GAD system and F1F0-ATPase indirectly induces the expression of OpuC through σB which can facilitate the influx of osmo- and cryo-protectants (Mujahid et al., 2013). Exposure to a pH of 4.5 also showed the accumulation of ClpP in the cytosol, a cold shock protein that allowed for increased survival of L. monocytogenes to subsequent freeze thaw cycles (Wemekamp-Kamphuis et al., 2004).  Sub-lethal stress can induce a more general stress response through σB dependent genes that mediate a restructuring of the cell membrane allowing for protection to such challenges as high hydrostatic pressure, surfactants, and cell envelope acting bacteriocins and antibiotics (Begley et al., 2006; Ryan et al., 2008; Wemekamp-Kamphuis et al., 2004).  The broad expanse of σB regulated genes even goes beyond that of the general stress response. σB is necessary for the early stages of virulence. The usefulness of the ATR to survival in the gastrointestinal tract is intuitive, but σB is also involved in the regulation of key virulence genes such as inlA (Oliver et al., 2010). In this way the low pH experienced by L. monocytogenes behaves as an indication that the cell is perhaps in close proximity to the host. Similarly, σB can also upregulate a bile salt hydrolase (bsh) and bilE, which are both involved in a bile tolerance and contributes to L. monocytogenes ability to survive the gastrointestinal tract (Garner et al., 2006; Sleator et al., 2005; Zhang et al., 2011). Finally, exposure to the low pH of the gastrointestinal tract initiates an ATR and upregulates σB dependent genes, including prfA (de las Heras et al., 2011). However, while σB has been reported to be involved in mediating invasion through the regulation of inlAB and prfA this effect is thought to be limited to the gastrointestinal tract and minimal once the bacteria are intracellular (Toledo-Arana et al., 2009).    35  1.7.8 Persistence   L. monocytogenes is a model intracellular pathogen. It has well-defined and well-studied mechanisms for evading host defenses. In addition, its reported ability to tolerate and even grow in the presence of common food chain stresses such as high acid foods, refrigeration temperatures, and osmotic pressure sets it apart from many foodborne pathogens. The continued isolation of unique strains of L. monocytogenes from the food chain has been extensively documented and reviewed (Carpentier and Cerf, 2011; Ferreira et al., 2014). Despite the abundance of recent literature, a clear understanding of the factors involved in the persistence of L. monocytogenes in the food chain is lacking. The difficulty of persistence meta-analysis is the inherent variability of industrial food processing facilities and inconsistencies in the definition of persistence between studies. In both the Ferreira and the Carpentier and Cerf reviews, the authors choose to defer to the definitions of persistence for each of the respective papers they cover. Definitions vary between research groups, and may include repeated isolation of identical pulse field gel electrophoresis (PFGE) patterns and serotypes for a given period of time or the use of statistical comparisons of ribotype patterns to public databases for the identification persistent strains (Lunden et al., 2003; Malley et al., 2013). The complication for all persistence definitions is the possibility of reintroduction when a strain is repeatedly reintroduced from an external reservoir, rather than continually subsisting within the confines of the monitored environment. Whether the L. monocytogenes isolated from RTE retail products is a persistent or sporadic strain, isolates should be evaluated for characteristics that may allow them to better survive and proliferate under adverse conditions, thereby potentially increasing their chances for final product contamination.     36  1.8 Hypotheses and research objectives  The hypotheses of this project and overall objectives of this research were conducted in three phases and can be broken down as follows:  Phase 1: Sanitizer resistance in L. monocytogenes Hypothesis 1: L. monocytogenes isolates from British Columbia FPEs show resistance to the common food processing sanitizers triclosan, peroxyacetic acid, and quaternary ammonium compounds.  Research objective: A total of 46 L. monocytogenes isolated from RTE foods and FPEs in British Columbia will be evaluated for resistance to the common food processing sanitizers triclosan, peroxyacetic acid, and quaternary ammonium compounds using agar resistance and exposure assays.  Phase 2: Association between heavy metal and QUAT resistance in L. monocytogenes  Hypothesis 2: Resistance to the heavy metals cadmium and arsenic can be found among L. monocytogenes isolated from British Columbia.  Research objective: A total of 46 L. monocytogenes isolated from RTE foods and FPEs in British Columbia will be evaluated for resistance to cadmium and arsenic using agar resistance assays.  Hypothesis 2: Resistance of L. monocytogenes to cadmium allows for increased growth rate and final cell density in the presence of sub-lethal cadmium concentrations when compared to non-resistant strains.   37  Research objective: Evaluation of the fitness benefit to L. monocytogenes of cadmium resistance in terms of environment fitness and survival in the FPE will be assessed using microtitre growth assays in the presence of sub-lethal cadmium. Hypothesis 3: Decreasing pH acts synergistically with increasing cadmium concentration on the exponential growth rate of L. monocytogenes. Research objective: A synergistic effect of high acid environments and sub-lethal cadmium on reducing the growth rate of L. monocytogenes will be explored using microtitre growth assays.  Hypothesis 4: Resistance determinants that contribute to cadmium and quaternary ammonium compound resistance can be co-transferred on mobile genetic elements in L. monocytogenes. Research objective: Isolates of L. monocytogenes co-resistant to quaternary ammonium compounds and cadmium will be used in agar based mating assays to evaluate the conjugative potential of mobile genetic elements that may carry the co-resistance.  Hypothesis 5: Possession of both bcrABC and emrE in L. monocytogenes allows for an elevated minimum inhibitory concentration of quaternary ammonium compounds.  Research objective: If transconjugants are produced from the mating of quaternary ammonium compound and cadmium co-resistant L.   38  monocytogenes with L. monocytogenes 08-5578 (emrE+), they will be evaluated for increased minimum inhibitory concentrations of quaternary ammonium compounds and for expression of known resistance determinants.  Phase 3: Antibiotic resistance in clinically relevant L. monocytogenes Hypothesis 6: Clinically relevant ST120 isolates of L. monocytogenes are resistant to antibiotics used in the treatment of listeriosis.   Research objective: L. monocytogenes ST120 strains originating from Albertan and British Columbian FPEs will be evaluated for antibiotic resistance using disk diffusion assays and in silico resistome analysis.         39  Chapter 2: Resistance of Listeria monocytogenes from the British Columbia food chain to common food processing sanitizers 2. 1 Introduction   Listeriosis is a severe foodborne disease that most often develops in the elderly, immunocompromised, and neonates. Outbreaks in North America have resulted in high fatality rates (30-40%), a characteristic of listeriosis that makes it one of the most deadly foodborne illnesses (CDC, 2015a, 2011; Jespersen and Huffman, 2014; Scallan et al., 2011). The etiological agent is Listeria monocytogenes, and in over 99% of infections, ready-to-eat (RTE) foods have been implicated as the vehicle of contamination (FDA, 2003; Mead et al., 1999). The characteristics (e.g. salt tolerance, cold growth, acid tolerance) that allow L. monocytogenes to survive the stresses of the food processing environment (FPE) and grow in common RTE products, combined with the high mortality rate of disease, has prompted government recommendations for strict environmental control and low tolerance of L. monocytogenes in final RTE products (Gandhi and Chikindas, 2007; Weatherill, 2009). In addition to routine surveillance, a better understanding of unique L. monocytogenes characteristics that may contribute to survival in the FPE is necessary.   Although it has been suggested that the FPE and the harborage sites it contains, play the most significant role in L. monocytogenes persistence, the need for continued surveillance for unique isolates that are well-adapted to persistence is also called for (Carpentier and Cerf, 2011; Ferreira et al., 2014). Niches in the FPE may provide some protection from cleaning agents and sanitizers, and when combined with bacterial tolerance to commonly used sanitizers, these areas may facilitate L. monocytogenes survival.  Increased survival of L. monocytogenes upon exposure to the oxidative sanitizer peroxyacetic acid has been reported, due to surface aggregation rather than inherent tolerance of the planktonic cells (Pan et al., 2006). Isolates of L. monocytogenes have   40  been discovered with well-characterized tolerance to quaternary ammonium compound based sanitizers (QUATs) (Mereghetti et al., 2000; Müller et al., 2013; Ratani et al., 2012; Xu et al., 2014). Notably, the efflux pumps encoded by bcrABC, qacH, and emrE have been associated with increased resistance to QUATs (Elhanafi et al., 2010; Gilmour et al., 2010; Müller et al., 2013). The use of broad spectrum phenolic compounds, such as triclosan, commonly found in antimicrobial soaps, has not produced any triclosan resistant isolates of L. monocytogenes as of yet; however, repeated exposure to triclosan did produce significant increases in resistance to the prescription antibiotic gentamicin (Kastbjerg et al., 2014).  Continued use of broad spectrum antimicrobials may select for indiscriminate efflux pumps allowing for cross-protection to other antimicrobials in L. monocytogenes (Allen et al., 2014; Kastbjerg et al., 2014).  A study was undertaken to evaluate a collection of L. monocytogenes sourced from provincially registered RTE meat, fish, and dairy food processing facilities in British Columbia (BC), Canada for resistance to common food processing sanitizers and for genetic determinants that may contribute to this resistance. L. monocytogenes from the FPE as well as the respective raw ingredients and RTE products, where applicable, were evaluated for resistance to the mixed peroxyacetic acid commercial product Perox-e, the QUATs benzalkonium chloride and commercial product E-SAN, as well as triclosan. This evaluation will allow for a better understanding of the sanitizer resistance of the L. monocytogenes population in BC that is subsiding in the food chain with potential for product contamination.   41  2.2 Methods 2.2.1 Isolate collection   All strains were generously donated by the British Columbia Center for Disease Control and were isolated from British Columbia RTE foods and RTE FPEs from 2008-2009 as reported by Kovacevic et al. (2012). In total, 46 isolates were chosen for characterization based on pulse field gel electrophoresis (PFGE) patterns, multi-locus sequence typing (MLST) results, and phenotypic data as reported. For a subset of isolates, draft whole genome assemblies were available from a sequencing project that used paired-end 100bp Illumina data. All strains were kept at -80°C in tryptic soy broth (TSB; Neogen, Corp., Lansing, MI) with 20% glycerol.  The isolates were collected from 15 different facilities from the British Columbia food chain representing six source types (dairy environments, RTE meat products, RTE fish processing environments, RTE fish products, and other retail delicatessen RTE foods FPEs). In total, this collection is comprised of the serotypes 1/2a, 1/2b, 1/2c, 3a, and 4b. A summary of the isolate characteristics can be found in Table 2.      42  Table 2: Listeria monocytogenes isolates used in this study with available typing data (Kovacevic, 2014).  Isolate Number (Lm) RTE Source Facility # Lineage Serotype PFGE Tenover Composite Designation MLST 1 Dairy environment 5 II 1/2a G2 7 4 Dairy environment 5 II 1/2a F1 11 10 Dairy environment 7 II 1/2a N1 155 11 Dairy environment 11 II 1/2a G1 7 14 Meat food 38 II 1/2c H2 9 15 Meat food 38 II 1/2a J1 662 17 Fish food 19 II 1/2c H1 9 20 Fish environment 19 II 1/2c H1 9 22 Fish environment 19 II 3a K5 321 23 Fish environment 19 II 3a K3 321 24 Fish environment 19 II 1/2c H1 9 26 Fish environment 19 II 3a K4 321 29 Fish environment 19 II 3a K2** (ApaI only) 321 30 Fish environment 19 II 1/2c H4 9 31 Fish environment 19 II 1/2c H4 9 32 Fish environment 20 II 1/2a L1 155 33 Fish environment 20 I 4b A1 194 35 Fish environment 20 I 4b A1 194 41 Fish food 20 I 4b M1 194 44 Fish environment 21 II 1/2a K9 321 47 Fish environment 21 II 1/2a K1 321 50 Fish food 21 I 4b A2 2 51 Fish food 21 II 1/2a K6 321 54 Fish food 20 I 4b A1 194 60 Fish food 20 I 4b A1 194 63 Fish environment 28 I 4b B1 1   43  Isolate Number (Lm) RTE Source Facility # Lineage Serotype PFGE Tenover Composite Designation MLST 69 Fish environment 28 I 4b B1 1 70 Fish environment 31 I 4b E1 6 73 Fish food 28 I 4b B1 1 76 Fish food 28 II 1/2a H3 9 77 Fish food 28 I 4b B1 1 78 Fish food 31 II 1/2a I2 91 79 Fish food 31 I 4b C1 6 81 Fish food 31 I 4b C1 6 87 Fish food 31 I 4b C2 6 88 Fish food 31 I 4b B1 1 90 Fish food 31 I 4b C1 6 93 Other food 44 II 1/2a H6 120 96 Other environment 46 II 1/2a G4 7 99 Other environment 49 II 1/2a K10 321 101 Other environment 49 II 1/2a F2 11 102 Other food 50 II 1/2a K7 321 105 Other food 50 II 1/2c H5 9 106 Other environment 49 I 1/2b D2 5 109 Other food R7 II 1/2a AscI: LMACI.0001, ApaI: LMAAI.0001 120 112 Other food R11 I 1/2b AscI: LMACI.0470, ApaI: LMAAI.0584 296   44  2.2.2 Sanitizers and reagents  All sanitizer stocks were prepared the day of the experiment. Benzalkonium chloride (alkylbenzyldimethylammonium chloride; Fluka Analytical/Sigma-Aldrich, Co., St. Louis, MO) and triclosan (irgisan; Sigma-Aldrich Co., St. Louis, MO) powders were weighed out, accounting for purity, then completely dissolved in distilled and deionized water and 70% ethanol, respectively. E-SAN (1:1 alkyldimethylbenzylammonium chloride and alkyldimethylethyl-benzylammonium chloride active ingredient; Epsilon Chemicals, Ltd., Edmonton, AB) was diluted according to manufacturer’s instructions and the concentration of active ingredients was confirmed with the Hydrion Quat test kit (Micro Essential Lab, Inc., Brooklyn, NY), then the stock was adjusted to appropriate working concentrations in distilled and deionized water. Perox-e (hydrogen peroxide and acetic acid with ≤5% peroxyacetic acid active ingredients; Epsilon Chemicals, Ltd., Edmonton, AB) was diluted according to manufacturer’s instructions and the concentration of active ingredients was confirmed with the Hydrion Peracetic acid test kit (Micro Essential Lab, Inc., Brooklyn, NY), then the stock was adjusted to appropriate working concentrations in distilled and deionized water. 2.2.3 Sanitizer resistance assay  All isolates were screened for sanitizer resistance using an agar based resistance assay (Mullapudi et al., 2008), adapted as follows. Isolates were streaked onto tryptic soy agar (TSA; Neogen, Corp., Lansing, MI) containing 5% defibrinated sheep blood (SB; Alere, Inc., Ottawa, ON) and incubated at 37°C overnight. Post-incubation, one isolated colony (ca. 1-2 mm) was suspended in 100 µl Mueller-Hinton broth (MHB; BD Diagnostics, Sparks, MD) and mixed by vortexing. In less than 30 minutes, 5 µl of each suspension was spotted onto MHB with 1.2% agar   45  containing the desired concentrations of sanitizer. For benzalkonium chloride and E-SAN all isolates were screened at 4, 8, and 10 µg/ml. Any isolates showing confluent growth at 10 µg/ml were termed resistant and the minimum inhibitory concentration was determined from spotting on 10, 15, 20, 25, 30 µg/ml. All isolates were tested at 2, 4, 8, 16, and 32 µg/ml of triclosan and isolates found to have confluent growth at 32 µg/ml were termed resistant. All benzalkonium chloride and E-SAN experiments were carried out with L. monocytogenes CDL 69 as a resistant control (Müller et al., 2013). L. monocytogenes ATCC 7646 was used as a susceptible control for benzalkonium chloride, E-SAN, and triclosan experiments. All isolates were tested with two technical replicates for each of three independent biological replicates. 2.2.4 Genetic screening   When possible, draft whole genome assemblies were screened in silico utilizing the basic local alignment search tool (BLAST) with accession numbers that correspond to the nucleotide sequences of known resistance determinants listed in Table 3. Polymerase chain reactions (PCRs) were carried out using a Bio-Rad, Inc. C1000 thermocycler with a reaction mixture of 0.75 Units AmpliTaq Gold 360 polymerase (Life Technologies, Inc., Foster City, CA), 1X AmpliTaq Gold 360 buffer (Life Technologies, Inc., Foster City, CA), 2.5 mM MgCl2, 200 µM dNTPs, and 200 µM of each forward and reverse primers sourced from Integrated DNA Technologies (Table 2). Thermocycling was carried out as recommended by the producer of the AmpliTaq Gold 360 polymerase with an appropriate annealing temperature and 35 cycles of amplification. Total DNA for PCR was acquired by a single colony lysis method with a lysis buffer of 50 mM NaCl, 50 M Tric-HCl, 0.5 mM EDTA, and 1% Triton-X, and a 15 minute 98°C heat treatment.    46  Table 3: All primers used during the detection of quaternary ammonium compound resistance determinants in Listeria monocytogenes from the British Columbia food chain.  2.2.5 Sanitizer exposure assay  An exposure assay adapted from Pan et al. (2006) was used to evaluate the resistance of all strains following a short exposure to the mixed peroxyacetic acid based sanitizer Perox-e (Epsilon Chemicals, Ltd, Edmonton, AB). Cultures were incubated on TSA containing 5% defibrinated sheep blood (Alere, Inc., Ottawa, ON) overnight at 37°C. Post-incubation, one isolated colony was grown in 5 ml of TSB for <18 hours at 37°C with 150 rpm shaking. Cultures were diluted to a concentration of 108-109 colony forming units (CFU) per ml in buffered peptone saline and 1 ml of cells was harvested at 7000 rpm for 2 minutes. All starting cultures were serially diluted and spot plated to confirm CFU concentrations. Pellets were resuspended in 0.85% saline solution. Exposure assays were prepared in 24-well tissue culture plates with 1 ml aqueous solutions of 0, 55, 150, and 1100 parts per million (ppm) Perox-e. Using a multichannel pipette, 5 µl of resuspended cells were inoculated into the Perox-e and mixed by repeat pipetting. At 30, 120, and Target Primer Sequence (5’3’) PCR product size (bp) GenBank Acession number Reference bcrABC p1 CAT TAG AAG CAG TCG CAA AG CA 1130 AADR01000010.1  (Elhanafi et al., 2010) p2 GTT TTC GTG TCA GCA GAT CTT TGA qacH qacH-KJ-F AGC ACT TGC AAT AGT GGG GG 249 HF565365 Johnston, 2015 qacH-KJ-R CCT GCA ATG CTA GCC ATG TT emrE LGI1-1862-F GAG CAA CAC CAC CTA AGT TC 330 CP001602.2 (Kovačević et al., 2012) LGI1-1862-R CAG TCG CTA TCG TAC TTG AA   47  180 seconds 5 µl of the cell-sanitizer mixture was transferred to Dey/Engley broth (DEB; Difco/BD Diagnostics, Sparks, MD) to neutralize the sanitizer. The DEB was incubated at 37°C for 48 hours and wells that turned yellow, as compared to the negative (purple) and positive (yellow) control wells, were termed resistant at that time point and concentration. All experiments were completed with two technical replicates, and two independent biological replicates. L. monocytogenes ATCC 7646 was used as a susceptible control. 2.2.6 Data analysis and statistics   Breakpoints for the sanitizer resistance data were established to best differentiate sensitive and resistant L. monocytogenes due to detectable genetic differences. For QUATs a breakpoint of 10 µg/ml was used, as suggested previously in the literature (Mullapudi et al., 2008). Triclosan resistance was determined using a breakpoint of 16 µg/ml determined from the results from other studies on triclosan resistance in L. monocytogenes (Christensen et al., 2011; Kastbjerg et al., 2014). Resistance to the commercial product Perox-e, as tested by the sanitizer exposure assay, was defined as resistance to any of the recommended appropriate use concentrations (55 µg/ml for 180 seconds, 150 µg/ml for 60 seconds, and 1100 µg/ml for 30 seconds) (E-Chem, 2008). The range of MICs was reported when the MIC varied across biological replicates. All statistical analysis was done using the Fisher’s exact test of independence (α = 0.05) in resistance according to subtyping group and computed using Minitab® 17 Statistical Software (Minitab, Inc., State College, PA).    48  2.3 Results 2.3.2 Susceptibility to the antimicrobial triclosan   All isolates were found to have a MIC to triclosan according to the agar-based sanitizer tolerance assay of 8-16 µg/ml after 24-48 hours of growth (Table 4). Due to the low variability of MICs within the collection and MICs to triclosan within the ranges previously reported, all L. monocytogenes were reported as susceptible (Christensen et al., 2011; Kastbjerg et al., 2014). Table 4: Sanitizer resistance of Listeria monocytogenes isolates (n=46).a Isolate Number (Lm) RTE Source Facility # Serotype Triclosan MIC (µg/ml)b BAC MIC (µg/ml)c E-SAN MIC (µg/ml)c 1 Dairy environment 5 1/2a 8 8 8 4 Dairy environment 5 1/2a 8 8 4-8 10 Dairy environment 7 1/2a 8 20-25* 20* 11 Dairy environment 11 1/2a 8-16 8 4-8 20 Fish environment 19 1/2c 8-16 20-25* 15-20* 22 Fish environment 19 3a 8 20* 15* 23 Fish environment 19 3a 8 20* 15* 24 Fish environment 19 1/2c 8-16 20-25* 15-20* 26 Fish environment 19 3a 8 20* 15-20* 29 Fish environment 19 3a 8 20-25* 15* 30 Fish environment 19 1/2c 8 20-25* 15-20* 31 Fish environment 19 1/2c 8 20-25* 15-20* 32 Fish environment 20 1/2a 8 8-10 4-8 33 Fish environment 20 4b 16 8-10 10 35 Fish environment 20 4b 16 8 4-8 44 Fish environment 21 1/2a 8 20-25* 15* 47 Fish environment 21 1/2a 8 20* 15* 63 Fish environment 28 4b 16 8 4-8 69 Fish environment 28 4b 16 4-8 4 70 Fish environment 31 4b 16 4-8 4 17 Fish food 19 1/2c 8-16 20-25* 15-20* 41 Fish food 20 4b 16 8 4-8 54 Fish food 20 4b 16 8 4-8 60 Fish food 20 4b 16 8 8 50 Fish food 21 4b 8 8 4-8   49  Isolate Number (Lm) RTE Source Facility # Serotype Triclosan MIC (µg/ml)b BAC MIC (µg/ml)c E-SAN MIC (µg/ml)c 51 Fish food 21 1/2a 8 20-25* 15* 76 Fish food 28 1/2a 8-16 8 4-8 73 Fish food 28 4b 16 4-8 4-8 77 Fish food 28 4b 16 8 4-8 78 Fish food 31 1/2a 8-16 8 8 79 Fish food 31 4b 16 8-10 4-8 81 Fish food 31 4b 16 8 4-8 87 Fish food 31 4b 16 8-10 4-8 88 Fish food 31 4b 16 8 4-8 90 Fish food 31 4b 16 8 4-8 15 Meat food 38 1/2a 8-16 8 4-8 14 Meat food 38 1/2c 8 8 4-8 93 Other food 44 1/2a 8 8 4-8 96 Other environment 46 1/2a 8-16 8-10 4-8 99 Other environment 49 1/2a 8-16 20* 15* 101 Other environment 49 1/2a 8-16 8 4-8 106 Other environment 49 1/2b 16 8 4-8 102 Other food 50 1/2a 8 20* 15-20* 105 Other food 50 1/2c 8-16 8 4-8 109 Other food R7 1/2a 8 20* 15* 112 Other food R11 1/2b 16 20-25* 15-20* aIsolates are grouped first by facility number they were collected from, then by serotype. All isolates were sensitive to Perox-e exposure at 150 ppm for 60 seconds. bAll isolates were sensitive to triclosan. cResistant isolates to the quaternary ammonium compounds (QUATs) benzalkonium chloride (BAC) and E-San are marked by an asterisk and had growth at 10 µg/ml.  50  2.3.4 Susceptibility to antimicrobial quaternary ammonium compounds   All isolates in this collection were screened for resistance to BAC and E-SAN at 4, 8, and 10 µg/ml. Of the 46 isolates, 17 were found to be resistant to both BAC and E-SAN at 10 µg/ml (Figure 1, Table 4). The MIC to both BAC and E-SAN was determined for all 17 resistant isolates and MICs were between 20-25 µg/ml and 15-20 µg/ml respectively. PCR assays or BLASTn screening of genome assemblies were used to evaluate all resistant isolates for known resistance determinants. Resistance in 16 of these isolates was associated with bcrABC, one was positive for emrE, and no isolates were positive for qacH (Table 5).  Table 5: The breakdown of quaternary ammonium compound resistant Listeria monocytogenes (n=17) by lineage and serotype with detected resistance determinants.a Lineageb Serotype Positive by PCR for bcrABC Positive by PCR for emrE I 1/2b (n=1) 1 0 II 1/2a (n=7) 6 1 1/2c (n=5) 5 0 3a (n=4) 4 0 aNo qacH positive isolates were detected. b There were significant (P=0.0004) differences found in resistance between Lineage I (1; 5.55%) and Lineage II (16; 57.14%).       51   Figure 5:  Resistance of Listeria monocytogenes collected from the food chain in British Columbia (n=46) to industrial sanitizers. Resistance to the quaternary ammonium compounds (QUATs) benzalkonium chloride (BAC) and E-San was tested by agar resistance assays at 10 µg/ml. Triclosan was tested at 16 µg/ml using the same method and Perox-e was tested using an exposure assay at 150 ppm for 60 seconds. Light grey bars and dark grey bars represent sensitive and resistant isolates, respectively.  Resistance of isolates to benzalkonium chloride and E-san was significantly different (P=0.0005) in Lineage I (5.55%, one isolate) and Lineage II (55.17%) isolates (Table 5). Additionally, the majority (58.8%) of resistant isolates were collected from the RTE fish FPE and the only emrE positive resistant isolate (Lm 109) was from a seafood RTE product collected at retail (Figure 6, Table 4). There were significant differences found in resistance between lineages I and II; lineage II was significantly more likely to have resistant Listeria than lineage I (Table 5; 05101520253035404550BAC E-San Triclosan Perox-eNumber of IsolatesSensitiveResistantSanitizer Treatment  52  P=0.0007). Within these resistant isolates, 41% were found to be serotype 1/2a. The MIC for these resistant isolates to BAC ranged from 20-25 µg/ml, and 15-20 µg/ml E-San for E-San (Table 4).   Figure 6: Identification of quaternary ammonium compound sensitive and resistant isolates by source of isolation from the British Columbia food chain. Resistant isolates were found in all sectors evaluated, with the majority (83%) coming from ready-to-eat (RTE) fish and fish food processing environments (PFE). From fish FPE, 63% of collected isolates were found to be resistant. The number of resistant strains in each groups were not significantly different (P=0.0716). Light grey bars and dark grey bars represent sensitive and resistant isolates, respectively. 2.3.3 Susceptibility to the antimicrobial Perox-e   Perox-e is a combined hydrogen peroxide, acetic acid and peroxyacetic acid based sanitizer produced by E-Chem (E-Chem, 2008). All L. monocytogenes in this collection survived Perox-e exposure for 30 seconds at 55 ppm, with only sporadic survival (<5%) at 150 ppm with no reproducibility across replicates at this level, and no survival to 1100 ppm (Table 3). At 120 and 180 seconds of exposure, no isolates survived at any concentration (Table 4). 1410231367024681012141618Dairy FPE RTE Fish Fish FPE Other RTEFoods/FPEsSensitiveResistantSource of IsolationNumber of Isolates  53  2.4 Discussion 2.4.1 L. monocytogenes from BC are sensitive to triclosan   All L. monocytogenes from this collection of food chain derived isolates are susceptible to triclosan at a concentration of 16 µg/ml according to the agar tolerance assay (Table 3). Previous reports have shown similar findings with MICs ranging from 4-16 µg/ml triclosan (Aarestrup et al., 2007; Christensen et al., 2011). Christensen et al. (2011) reported a median MIC of 8 µg/ml with the highest reported resistance having a MIC of 16 µg/ml in L. monocytogenes (n=8) from a variety of food processing, environmental, and human clinical sources. Aarestrup et al. (2007) found the majority of their isolates to have a MIC of 16 µg/ml in their comparatively larger study of 114 L. monocytogenes collected from retail food products in Denmark. This study supports the findings of the general susceptibility of the L. monocytogenes population to these concentrations of triclosan, well below that found in commercial products, that incorporate concentrations of  0.1-0.6% w/w triclosan, approximately 1000-6000 µg triclosan per gram of product (Fang et al., 2010).  L. monocytogenes may prove to be less susceptible to products with triclosan incorporated into their structures compared to other Gram positive pathogens (Camilloto et al., 2010; Møretrø et al., 2011). Though the L. monocytogenes in this collection do not have elevated resistance as compared to other studies on triclosan resistance in L. monocytogenes, resistance of other Gram-positive bacterial pathogens has been reported to be lower than in L. monocytogenes (Aarestrup et al., 2007). When testing the susceptibility of bacterial pathogens to cutting boards embedded with triclosan (a commercial product by Microban) and polyethylene and cellulose packaging, Listeria spp. have proven to be more resilient than Staphylococcus aureus (Camilloto et al., 2010; Møretrø et al., 2011). In fact, the addition of triclosan to cutting boards had no effect on L. monocytogenes, possibly because the desorption of triclosan from solid plastics (5% w/w) has been shown to occur   54  at levels below the MIC of currently studied bacteria (<1 µg triclosan per gram of cutting board per hour) (Junker and Hay, 2004; Møretrø et al., 2011). While there is a general high susceptibility to triclosan in L. monocytogenes, the efficacy of incorporating triclosan into food production equipment should be carefully evaluated for its role in controlling L. monocytogenes as it appears to be ineffective in this manner of use. Additionally, selection of L. monocytogenes on triclosan containing media can select for increased resistance to the clinically relevant antibiotic gentamicin (Christensen et al., 2011). The increased resistance to gentamicin remained stable even after the selective pressure of triclosan and gentamicin was removed. 2.4.2 Resistance to QUATs can be found amongst L. monocytogenes from BC   According to growth at a concentration of 10 µg/ml BAC and 10 µg/ml E-San, 17 of 47 (36%) L. monocytogenes collected from the BC food chain were determined to be resistant to these quaternary ammonium compounds (Figure 1). This percentage is comparable to other reports that populations of L. monocytogenes from a variety of environmental, food, and clinical samples in which 7-46% exhibit resistance to QUATs (Mereghetti et al., 2000; Mullapudi et al., 2008; Ratani et al., 2012; Xu et al., 2014). Higher prevalence of resistance in 1/2a isolates was also witnessed by Mullapudi et al. (2008) and Ratani et al. (2012), but in contrast Xu et al. (2014) found 4b isolates had significantly higher prevalence of resistance. Geographical differences may explain this as Xu et al. (2014) evaluated isolates collected from Northern China where as Mulapudi et al. (2008), Ratani et al. (2012), as well as this study, used isolate collections from North America. MICs for E-SAN were slightly, but consistently lower than for BAC (Table 3). E-San is mixture of quaternary ammonium compounds with different length alkyl side chains. This may allow for greater efficacy on a wider variety of isolates and contribute to the lower MIC in some   55  of the tested isolates. These MIC values are in the range that have previously been reported. Xu et al. (2014) reported resistant isolates with MIC values between 16 and 20 µg/ml BAC while both Mullapudi et al. (2008) and Ratani et al. (2012) found higher MIC values, between 30 and 40 µg/ml BAC.  Due to the wetting properties of QUATs, they are suited to penetrate into deep recesses and porous material (Marriott and Gravani, 2006). If they are rinsed inefficiently or when used in a ‘no rinse’ method of application, they may leave behind a residual antimicrobial film. In hard-to-reach places, the remaining antimicrobial combined with residual moisture or organic material may dilute the QUATs to low concentrations. Recommended concentrations for QUAT use (200-1000 µg/ml) remain sufficient for elimination of L. monocytogenes, but the resistance seen in this collection of L. monocytogenes may allow for increased survival at low concentrations of residual sanitizers. Resistance may contribute to better adhesion and survival when L. monocytogenes are first established in these niches with low QUATs concentrations, as has been shown with Pseudomonas aeruginosa (Machado et al., 2011). 2.4.3 bcrABC is the most prominent resistance determinant to QUATs   All but one of the QUAT resistant isolates in this collection were found to be positive for bcrABC and the remaining one was positive for emrE (Table 4). This is consistent with reports that bcrABC confers resistance to QUATs and is responsible for resistance in the majority of QUAT tolerant L. monocytogenes isolates found in North America (Dutta et al., 2013; Elhanafi et al., 2010). The alternative QUAT resistance determinant detected, emrE, has been putatively associated with resistance to QUATs in L. monocytogenes, but it has not been reported outside of its presence in clonal complex (CC) 8, of which many are also MLST sequence type (ST) 120,   56  isolates found across Canada (Gilmour et al., 2010; Knabel et al., 2012; Kovacevic, 2014). The emrE positive isolate (Lm 109) from this collection belongs to ST120 (Table 3).   Nine of the sixteen bcrABC positive isolates were collected from a single RTE fish processing facility (Table 3). These nine isolates are comprised of only two MLST STs (ST 9 and 321) and have PFGE patterns that only vary by 2-3 fragment patterns within a MLST ST indicating that they have high genetic similarity. This could contribute to the high presence of bcrABC in L. monocytogenes in this facility due to vertical transfer, the result of horizontal transfer from reservoir Listeria species, or a combination of the two (Katharios-Lanwermeyer et al., 2012). Regardless of how the spread of bcrABC has occurred in this facility, the close similarity and high number of isolates collected may be inflating the percentage of QUAT resistant L. monocytogenes found in this collection from the BC food chain.  Varying levels of resistance to QUATs have been reported among isolates positive for bcrABC. Mullapudi et al. (2008) and Ratani et al. (2012) found MICs to BAC to be between 30 and 40 µg/ml with differences being associated with sequence variations in the flanking region of bcrABC (Dutta et al., 2013). Isolates from this study that were positive for bcrABC had comparatively lower MICs to BAC (20-25 µg/ml) when using the same agar resistance assay for reasons that are unknown, but could be similarly due to regulation as a result of altered up and downstream regions. In an Austrian study of 91 reference, food, environmental, and clinical isolates of L. monocytogenes the resistance determinant qacH was found to confer resistance to BAC when using the agar resistance assay at 15-30 µg/ml depending on the isolate (Müller et al., 2013). However, they also reported qacH negative isolates to have MICs between 10-20 µg/ml BAC, including one bcrABC positive isolate that had an MIC of 10 µg/ml BAC. Xu et al. (2013) reported the presence of qacA and qacEΔ1-sul in four of their L. monocytogenes collected from   57  Northern China.  These resistant determinants are part of the small multi-drug resistance family and have been identified in Staphylococcus aureus and Acinetobacter baumannii . However, while 19 of 71 isolates from their collection were resistant to BAC, only four possessed one of the determinants they screened for. These had MICs from 10-18 µg/ml. They did not screen for the presence of bcrABC, emrE, or qacH.  2.4.4 L. monocytogenes from BC are sensitive to mixed peroxyacetic acid   At appropriate use concentrations (55 µg/ml for 180 seconds, 150 µg/ml for 60 seconds, and 1100 µg/ml for 30 seconds), L. monocytogenes from the BC food chain remain susceptible to the peroxyacetic acid based Perox-e sanitizer . Even below the producer’s recommended use concentrations and exposure times, all L. monocytogenes were found to be susceptible. Survival was detected for all isolates when cells were exposed to 55 ppm for 30 seconds, however only sporadic survival (<5%) of 150 ppm at 30 seconds. Beyond these concentrations, and for exposure periods longer than 30 seconds, no isolates were able to recover from the exposure. While this study tested only for survival after exposure (i.e. did not detect log reduction of CFU/ml), several other studies have reported the log reduction of L. monocytogenes after treatment with peroxyacetic acid solutions Pan et al. (2006) found that exposure for 60 seconds at a 50 ppm solution reduced the L. monocytogenes population by 1.8-2.2 logs for planktonic cells at 107-108 CFU/ml. The authors reported that sessile cells exhibited greater survival to the same treatment of peroxyacetic acid, but this was attributed to the protective effect of the surface layer of sessile cells. Similarly, Baert et al. (2009) found that a peroxyacetic acid concentration of 250 µg/ml was needed to reduce L. monocytogenes on lettuce compared to wash water alone.  Interestingly, when peroxyacetic acid was used, no L. monocytogenes could be detected in the rinse water unlike water without santizer. This could suggest a benefit of peroxyacetic acid for the purpose of limiting   58  cross-contamination. Lower concentrations of peroxyacetic acid (25-70 µg/ml) were used by Yu Neo et al. (2013) for eliminating L. monocytogenes on mung bean sprouts. For all concentrations at 90 and 180 second exposures, the test L. monocytogenes was reduced by 1-2 log CFU/ml. The authors highlighted an additional concern for food processing when they noted that acid adapted L. monocytogenes could exhibit better survival by over 1 log CFU/ml at the highest concentration (70 µg/ml) for 180 seconds.   These findings confirm the recent literature reports that low concentrations of peroxyacetic acid are effective at reducing planktonic L. monocytogenes. However, peroxyacetic acid is in constant equilibrium with acetic acid and hydrogen peroxide, with extended storage hydrogen peroxide decomposes and shifts the equilibrium. Due to this propensity of peroxyacetic acids to decrease in activity over time, especially at dilute concentrations, continued care should be taken to ensure proper concentrations of the sanitizer are administered for exposure (Kitis, 2004). Working solutions for sanitization should be mixed as needed and measured to confirm the appropriate concentrations of peroxyacetic acid are reached. 2.4.5 Future studies and significance   This study revealed that some L. monocytogenes in the BC food chain exhibit increased resistance to QUATs. The resistance and prevalence remains low and is comparable to other studies. All resistant L. monocytogenes were associated with one of the known resistance determinants to QUATs. No isolates possessed more than one of the known determinants, however they were not explored for as of yet unknown contributing resistance factors. All sanitizers tested in this study have been found to be effective at recommended use concentrations, but the ability of L. monocytogenes to tolerate low concentrations of residual antimicrobials should be further   59  evaluated. In particular, the attachment and survival of L. monocytogenes in niche environments where it may encounter both the endogenous microflora of the FPE and QUAT films that have built up over time should be explored. Here mixed species biofilms may facilitate horizontal transfer of resistance or survival to sanitizer exposure and resistance to QUATs may aid in increased attachment to low concentration residual antimicrobial films.     60  Chapter 3: Resistance of Listeria monocytogenes from the British Columbia food chain to heavy metals and co-resistance to quaternary ammonium compounds 3. 1 Introduction   L. monocytogenes is a prominent bacterial foodborne pathogen around the world, and is characterized by a high fatality rate (Scallan et al., 2011; Thomas et al., 2013). Though it is heat labile, L. monocytogenes is well adapted to survival in the food chain and an estimated >99% of infections occur as the result of contaminated food (FDA, 2003; Gandhi and Chikindas, 2007; Mead et al., 1999). All Listeria species are ubiquitous saprophytes in the natural environment, which increases the likelihood of contamination of raw ingredients and introduction into the food processing environment (FPE) (den Bakker et al., 2010; Vivant et al., 2013). The Listeria genus has a core genome that contains numerous genes for carbon sequestration allowing it to utilize a diverse nutrient base as well as a vast accessory genome that represents its ability to acquire a wide array of genes beneficial for adaption to harsh natural and food processing environments (den Bakker et al., 2010). Gene acquisition can occur through a variety of means and the accessory genome plays an important role in heavy metal and increased sanitizer resistance.   While only a small percentage (<7%) of the open reading frames in all Listeria genomes are predicted to have been recently introduced via horizontal gene transfer (HGT), there is evidence for new and old horizontal gene acquisition (den Bakker et al., 2010). Few functional prophages or transposons remain in the L. monocytogenes genome, but numerous plasmids have been reported as well as their transfer within the Listeria genus and between L. monocytogenes and the surrounding microbiota (den Bakker et al., 2010; Katharios-Lanwermeyer et al., 2012; Kuenne et al., 2010; Toomey et al., 2009). Toomey et al. (2009) witnessed the transfer of   61  antimicrobial resistance genes between lactic acid bacteria and L. monocytogenes in a simulated food matrix. Katharios-Lanwermeyer et al. (2012) were similarly successful in transferring a quaternary ammonium compound based sanitizer (QUAT) resistance gene (bcrABC) from non-pathogenic Listeria species to L. monocytogenes. As it stands, plasmid mediated bcrABC transfer is the only documented instance of horizontal transfer of QUAT resistance in the Listeria genus.  Other resistance determinants to QUATs (emrE and qacH),  however these have been reported to be chromosomally incorporated, rather than on plasmids, in L. monocytogenes (Gilmour et al., 2010; Kovacevic, 2014; Müller et al., 2013). A correlation between high efficiency transfer donors of the QUAT resistance and the presence of traG genes within putative plasmids was observed and there was high overall similarity to the pLM80 plasmid. Further, during the annotation of published Listeria plasmids, Kuenne et al. (2010) similarly found a putative partial type IV secretion systems (e.g. traG/D, traE) on plasmids such as pLM80. Based on replication initiation protein (RepA) sequences, Kuenne et al. (2010) identified two phylogenetic groupings of Listeria plasmids and showed the overall relatedness of these proteins to those of other Gram-positive species. pLM80 has been previously reported to fall into group two according to this method of grouping (Kuenne et al., 2010).  Aside from proteins involved in plasmid replication and a DNA-directed RNA polymerase, Kuenne et al. (2010) reported that the only conserved feature among all of the assembled plasmids were cadmium resistance genes. Katharios-Lanwermeyer et al. (2012) reported co-selection between QUAT tolerance and resistance to cadmium. Widespread cadmium, as well as arsenic resistance has been well documented in L. monocytogenes (Margolles et al., 2001; McLauchlin et al., 1997; Mullapudi et al., 2008; Xu et al., 2014). While Margolles et al. (2001) hypothesize that exposure to water-soluble heavy metals may be driving the increase in resistance to cadmium seen   62  in the dairy farm environment, the extent to which heavy metals in agriculture influence the ecology of L. monocytogenes is unknown. Heavy metals in agricultural soils must meet regulatory standards (1.4 µg/g cadmium and 12 µg/g arsenic), but the detection of low levels is still reported and could have an impact on soil microbiota population dynamics (BCMOE, 2005; CCME, 1999, 1997; Pan et al., 2010). Specifically, cadmium and arsenic can be found in British Columbia top soils in concentrations ranging from 0.1 to 3.4 µg/g and 0.9 to 15 µg/g, respectively (BCMOE, 2005). Environmental soil pH alone impacts the survival of L. monocytogenes, but decreasing pH has also been shown to increase the solubility of heavy metals (Domínguez et al., 2009; Locatelli et al., 2013b). The combined effect of soil pH and increased solubility of heavy metals may illicit a synergistic effect on heavy metal sensitive L. monocytogenes.  A high prevalence of cadmium resistance in L. monocytogenes and an apparent link with QUAT tolerance on mobile genetic elements suggests that environmental characteristics may select for L. monocytogenes more likely to have increased tolerance to QUATs. An indirect pressure, such as a heavy metal in the environment, which may perpetuate resistance determinants for sanitizers commonly used in the food processing industry is of concern. The following work evaluated L. monocytogenes isolated from the food chain in Canada for resistance to cadmium and arsenic. This work also examined these strains’ survival in sub-lethal concentrations more typically experienced in the natural environment in order to understand how these conditions may select for resistant isolates. Additionally, conjugative HGT of cadmium and QUAT resistance was examined from cadmium and QUAT (emrE-/bcrABC+) co-resistant L. monocytogenes to both QUAT-sensitive (emrE-/bcrABC-) and QUAT-resistant (emrE+/bcrABC-) L. monocytogenes. This work is significant as it evaluates the dissemination of QUAT resistance between pathogenic strains of Listeria that has never been reported before. Additionally, no L. monocytogenes isolate has yet   63  been documented to possess multiple resistance determinants to QUATs and the potential benefit of this to L. monocytogenes is unknown.   64  3.2 Methods 3.2.1 Isolate collection  The isolate collection used was described in section 2.2.1. The L. monocytogenes 08-5578 (QUAT resistant; emrE+) strain responsible for the 2008 delicatessen meat outbreak in Canada was used as a recipient for HGT studies (GenBank Accession: CP001602) (Gilmour et al., 2010; Kovacevic, 2014). L. monocytogenes 08-5578 ΔemrE, with a non-polar deletion mutant of the emrE gene, was also used as a recipient for HGT studies (Kovacevic, 2014). Streptomycin resistant derivatives were obtained by passaging on brain heart infusion broth (BHIB) with 1.5% agar (Thermo Fisher Scientific Inc., Ottawa, ON) and streptomycin (Sigma-Aldrich Co., Lansing, MI) progressively from 100, 200, and 350 µg/ml up to 500 µg/ml. Plasmid curing was carried out as described in section 3.2.8. All strains were kept at -80°C in tryptic soy broth (TSB; Neogen Corp., Lansing, MI) with 20% glycerol. 3.2.2 Heavy metal stocks and reagents  All heavy metal stocks were prepared the day of the experiment. Cadmium chloride (CdCl2; Sigma-Aldrich Co., Oakville, ON) and sodium (meta) arsenite (NaAsO2; Sigma-Aldrich Co., Oakville, ON) powders were weighed out, accounting for purity, then completely dissolved in distilled and deionized water. The stock was subsequently adjusted to appropriate working concentrations for each of the respective salts. 3.2.3 Genetic screening   When possible, draft whole genome assemblies of L. monocytogenes isolates were screened in silico utilizing the basic local alignment search tool (BLAST) using nucleotide   65  sequences of known resistance determinants listed in Table 5. PCRs were carried out using a Bio-Rad Inc. C1000 thermocycler with a reaction mixture of 0.75 Units AmpliTaq Gold 360 polymerase (Life Technologies Inc., Foster City, CA), 1X AmpliTaq Gold 360 buffer (Life Technologies Inc., Foster City, CA), 2.5 mM MgCl2, 200 µM dNTPs, and 200 µM of each forward and reverse primers sourced from Integrated DNA Technologies (Coralville, IA; Table 6). Total DNA for PCR was acquired by a single colony lysis method with a lysis buffer of 50 mM NaCl, 50 M Tric-HCl, 0.5 mM EDTA, and 1% Triton-X, and a 15 minute 98°C heat treatment.   66    Table 6: Primers used during the evaluation of heavy metal resistance and co-resistance to quaternary ammonium compounds in Listeria monocytogenes from the British Columbia food chain. Target Primer Sequence (5’3’) PCR product size (bp) GenBank Accession Reference bcrABC p1 CAT TAG AAG CAG TCG CAA AG CA 1130 AADR01000010.1 Elhanafi, 2010 p2 GTT TTC GTG TCA GCA GAT CTT TGA qacH qacH-KJ-F AGC ACT TGC AAT AGT GGG GG 249 HF565365.1 Johnston, 2015 qacH-KJ-R CCT GCA ATG CTA GCC ATG TT emrE LGI1-1862-F GAG CAA CAC CAC CTA AGT TC 330 CP001602.2 Kovacevic, 2012 LGI1-1862-R CAG TCG CTA TCG TAC TTG AA cadA1 cadA-Tn5422F CAGAGCACTTTACTGACCATCAATCGTT 594 L28104.1 Mullapudi et al., 2010 cadA-Tn5422R CTTCTTCATTTAACGTTCCAGCAAAAA cadA2 cadA-pLM80F ACAAGTTAGATCAAAAGAGTCTTTTATT 590 AADR01000058.1 Mullapudi et al., 2010 cadA-pLM80R ATCTTCTTCATTTAGTGTTCCTGCAAAT cadA-p74 cadA-p74F CCGGATAGAGAGCAAGTATG 508 CP001603.1 Kovacevic, 2012 cadA-p74R TGTACTGAAGGCTGAAGGTT cadA3 cadA3-F TCGCTCCAAAAGAGGCGTTA 741 NC_003210.1 Current study cadA3-R CTGAGGCAAGAGGGTGTTGT cadA4 cadA4-F ScottA GCATACGTACGAACCAGAAG 1135 AFGI01000005.1 Lee et al., 2013 cadA4-R ScottA CAGTGTTTCTGCTTTTGCTCC LGI1-1859 LGI1-1859F AAG AGC GCG AAG CTG AAA GAT A 77 CP001602.2 Kovacevic, 2014 LGI1-1859R CCT CAT CTT GGA ATC GTT CCA   67  3.2.4 Whole genome sequencing and subsequent analysis of plasmid content in L. monocytogenes    Genomic DNA was obtained from overnight cultures of L. monocytogenes using a PureLink Genomic DNA Kit (Life Technologies, Carlsbad, CA). Genomic DNA was subjected to library preparation using the TruSeq system (Illumina, San Diego, CA) and 100bp paired end sequencing on an Illumina Hi-seq. Reads were assembled using SPAdes to create a draft genome assembly. Plasmid sequences were identified in the draft assembly using methods adapted from Kuenne et al. (2010). Sequences were aligned to the closed genome of L. monocytogenes EDG-e (Accession: NC_003210.1) using the Mauve Contig Mover in Mauve version 2.3.1 (Darling et al., 2004). Contigs not aligning to the EDG-e chromosome were compared to L. monocytogenes published plasmids (Altschul et al., 1990; Kuenne et al., 2010) by BLAST. Contigs displaying no similarity to EDG-e or L. monocytogenes plasmids were reviewed for open reading frames that could be associated with plasmid DNA (e.g. Tra, Rep proteins, etc.).  They were excluded only if they displayed open readings frames associated with chromosomal DNA (e.g. rRNA, tRNA) and no  alignment to the Listeria associated plasmids pLM33, pLM1-2bUG1, pLM5578, pLM80, and pLI100 annotated by Kuenne et al. (2010). Identified plasmid sequences were concatenated into a single assembly with a spacer sequence “NNNNNCACACACTTAATTAATTAAGTGTGTGNNNNN” placed between all contigs to avoid gene prediction across contigs (Kuenne et al., 2010). Automated annotation was then carried out using RAST (Aziz et al., 2008). Mauve progressive aligner was used to carry out alignments of assembled plasmids from select isolates to representative plasmids from the phylogenetic groups outlined by Kuenne et al. (2010). Replication initiation protein (RepA) homologs (30% amino acid similarity over 70% of the coding sequence) were extracted and an alignment was   68  constructed using ClustalW with a BLOSUM scoring matrix, using MEGA version 6.06 (Tamura et al., 2013). Subsequently, a maximum likelihood phylogenetic tree was constructed using default parameters and 1000 bootstrap iterations. 3.2.5 Resistance to heavy metals  All isolates were screened for resistance using an agar-based resistance assay (McLauchlin et al., 1997; Mullapudi et al., 2008), adapted as follows. Isolates were streaked onto TSA containing 5% defibrinated sheep blood (Alere, Ottawa, ON) and incubated at 37°C overnight. Post incubation, one isolated colony (ca. 1-2 mm) was suspended in 100 µl TSB and mixed by vortexing for 5 seconds. From each suspension, 3 µl was spotted onto Iso-sensitest agar (ISA; Oxoid, Thermo Scientific Inc., Ottawa, ON) plates containing the desired concentrations of heavy metals. For CdCl2, all isolates were screened at 0, 35, and 75 µg/ml, and 0 and 500 µg/ml for NaAsO2. Any isolates showing confluent growth at 35 µg/ml for CdCl2 or 500 µg/ml of NaAsO2 were termed resistant for that metal. All experiments were completed with two technical replicates, and at least three independent biological replicates. Cadmium resistant and arsenic sensitive L. monocytogenes EDG-e (GenBank Accession: NC_003210) was used as a resistant control strain for cadmium (70 µg/ml CdCl2) and arsenic resistant and cadmium sensitive L. monocytogenes 10403S (GenBank Accession: NC_017544) was used as a resistant control strain for arsenic (500 µg/ml NaAsO2).  3.2.6 Sub-lethal growth assays  Fresh isolated colonies were inoculated into 10 ml of TSB and incubated for 16 hours at 30°C with 180 rpm shaking. An aliquot of 100 µl of overnight culture was diluted into 9.9 ml of TSB and 9.9 ml of TSB containing the desired metal or sanitizer. The final concentration of CdCl2   69  used for testing was 1 µg/ml, confirmed using the Invitrogen Measure-IT™ lead and cadmium fluorescent probe-based assay kit (Molecular Probes, Inc., Invitrogen Technologies, Eugene, OR). For growth in the presence of sub-lethal BAC, a 10 µg/ml concentration was used. A 200 µl aliquot of diluted overnight culture (approx. 107-108 CFU/ml) in TSB or TSB with respective metal or sanitizer was added to a 96-well plate (Costar, Fisher Scientific, Ottawa, ON) in duplicate and the OD600 was recorded at 30 minute intervals until all isolates reached stationary phase (15-24 hours) using a SpectraMax plate reader (Molecular Devices, Sunnyvale, CA). The starting culture was further serially diluted and plated to confirm the inoculum concentration. All experiments were completed with three independent biological replicates.  The OD600 data was log10 transformed and fit to growth curves using DMFit software version 2.1 (Computational Microbiology Research Group, Institute of Food Research, Colney, Norwich, UK; Baranyi and Roberts, 1994).  L. monocytogenes EDG-e and L. monocytogenes 08-5578 were used as cadmium resistant controls while cadmium sensitive and arsenic resistant L. monocytogenes 10403S and a plasmid cured L. monocytogenes 08-5578 Cds strain were used as cadmium sensitive controls.  3.2.7 Low pH and cadmium combination assay  Isolated colonies of CdR L. monocytogenes 08-5578 and plasmid cured CdS L. monocytogenes 08-5578 were inoculated into 10 ml of TSB and incubated for 16 hours at 30°C with 180 rpm shaking. Combinations of varied cadmium levels (0.0 0.5, 1.0, and 1.5 µg/ml) and pH values (5.5, 6.0, 6.5, and 7.0) were examined in TSB using a four by four factorial arrangement. Following a 1:1000 dilution of 16 hour culture, 200 µl was added to a 96-well plate (Costar) in duplicate and the OD600 was recorded at 30 minute intervals until all isolates reached stationary phase (22-24 hours) using a SpectraMax plate reader. The inoculum was serially diluted and plated to confirm the inoculum of 106 CFU/ml. All experiments were completed with two technical   70  replicates for each of three independent biological replicates and the OD600 data was log10 transformed then fitted to growth curves using DMFit software version 2.1.  3.2.8 Plasmid curing of resistant wild type isolates  High temperature passaging was used to obtain plasmid cured co-sensitive (BAC + Cd) strains. Adapted from Lebrun et al. (1992), a single colony was streaked onto BHI agar plates and incubated up to 48 hours at 45°C. Up to three colonies per streak were tested for loss of plasmids using PCR based assays for bcrABC as well as cadA1 or cadA2. Colonies were repeatedly passaged until a loss of plasmid was indicated by PCR, with a limit of 6 consecutive passages. Liquid passaging was also utilized when agar passaging was unsuccessful. In brief, a single colony was inoculated into 10 ml BHI and incubated for 24 hr at 42°C with shaking. After growth, 100 µl of culture was spread plated on BHI agar and incubated at 37°C overnight. Resulting colonies were again tested by PCR for loss of resistance determinants. Any colonies found to be negative for bcrABC and cadA1 or cadA2, respectively, were sub-cultured on BHI agar at 37°C overnight and confirmed using PCR. 3.2.9 Agar-based mating experiments    Mating experiments were adapted from Katharios-Lanwermeyer et al. (2012). All QUAT and cadmium co-resistant isolates were used as donors and the streptomycin resistant, cadmium sensitive and QUAT resistant L. monocytogenes 08-5578 as well as cadmium sensitive and QUAT sensitive L. monocytogenes 08-5578 ΔemrE, were used as the recipients. Single colonies of desired recipient and donor strains were individually inoculated into 10 ml of brain heart infusion (BHI) broth (Difco/BD Diagnostics, Sparks, MD) and incubated for <18 hours at 37°C with shaking. Inoculated BHI broth (100 µl) was transferred to 9.9 ml of fresh BHI broth   71  and incubated at 37°C with shaking. After 4 hours of incubation, benzalkonium chloride was added to a concentration of 4 µg/ml to all of the donor strains and allowed to further incubate for 1 hour. After 5 hours of incubation, all cultures were removed and 100 µl of donor culture was added to 900 µl of recipient culture. The cells were then harvested and resuspended in 100 µl of fresh BHI broth. A 50 µl aliquot of the donor-recipient strain mixture was spotted, in duplicate, onto BHI agar and incubated at 25°C for 24 hours. After incubation, any growth was transferred to a double selective BHI agar plate containing 10 µg/ml CdCl2 and 50 µg/ml streptomycin and incubated for up to 96 hours at 37°C.  Aliquots (50 µl) of the uncombined parent strains were also individually spotted onto double selective media as a control and carried through the selection process to ensure the viability of the cells during plating transfers. Potential transconjugants isolated on double selective media were confirmed using PCR to examine the presence of bcrABC and emrE, or LGI1-1859 in the case of the ΔemrE mutant. Successful transconjugants were characterized for the MIC of benzalkonium chloride tested at 5, 10, 15, 20, 25, and 30 µg/ml and for restored growth rate in the presence of sub-lethal CdCl2 at 1 µg/ml. One tranconjugant from each L. monocytogenes 08-5578 and L. monocytogenes 08-5578 ΔemrE recipient and the respective donor and recipient strains were selected for sub-lethal BAC growth assays outlined in section 3.2.6. 3.2.10 Sanitizer tolerance assay  All transconjugants were screened for QUAT resistance using an agar based resistance assay (Mullapudi et al., 2008), adapted as follows. Isolates were streaked onto tryptic soy agar (TSA; Neogen Corp., Lansing, MI) containing 5% defibrinated sheep blood (SB; Alere Inc., Ottawa, ON) and incubated at 37°C overnight. Post-incubation, one isolated colony (ca. 1-2 mm) was suspended in 100 µl Mueller-Hinton broth (MHB; BD Diagnostics, Sparks, MD) and mixed by vortexing. In less than 30 minutes, 5 µl of each suspension was spotted onto MHB with 1.2%   72  agar containing the desired concentrations of benzalkonium chloride and E-SAN. The minimum inhibitory concentration was determined from spotting on 0, 5, 10, 15, 20, 25, 30 µg/ml. All benzalkonium chloride and E-SAN experiments were carried out with L. monocytogenes CDL 69 as a resistant control (Müller et al., 2013). L. monocytogenes ATCC 7646 was used as a susceptible control for benzalkonium chloride, and E-SAN experiments. All isolates were tested with two technical replicates for each of three independent biological replicates. 3.2.11 RNA extractions   Two transconjugants from the high frequency donor isolate Lm 10 and the respective parent strains were chosen for RNA extraction and gene expression experiments. L. monocytogenes 08-5578 (bcrABC-/emrE+), Lm 10 (bcrABC+/emrE-), L. monocytogenes 08-5578-10B2 (bcrABC+/emrE+), and L. monocytogenes 08-5578ΔemrE-10A2 (bcrABC+/emrE-) were all inoculated individually into 15 ml of BHI from fresh isolated colonies and grown at 30°C with shaking. After the cultures were grown to stationary phase, 100 µl was transferred to 15 ml of fresh BHI and grown for 8 hours at 30°C. At 8 hours, 5 ml aliquots of culture were divided into two 15 ml centrifuge tubes. One tube remained untreated while the other was brought to a concentration of 10 µg/ml BAC and both tubes were further incubated for 1 hour at 30°C. After the 1 hour treatment period, 500 µl of 10% phenol:chloroform (Sigma-Aldrich Co., Oakville, ON) in 100% ethanol was added. Cultures were immediately vortexed for 5 seconds and centrifuged at 2500 g for 10 minutes. The supernatant was decanted and the pellet was suspended in lysis buffer (RNA PowerSoil Total RNA Isolation kit; Mo Bio Laboratories, Inc., Carlsbad, CA). RNA extraction was completed following the protocol of the PowerSoil kit. All samples were treated with the RTS DNase kit (Mo Bio Laboratories, Inc., Carlsbad, CA) for removal of genomic DNA. The Qiagen RNeasy kit with on-column DNase treatment (Qiagen, Hilden, GER) was used for   73  further purification of the extracted RNA. Extracted RNA was quantified with a Nanodrop spectrophotometer (Thermoscientific, Wilmington, DE), and evaluated for integrity using an Agilent BioAnalyzer (Agilent Technologies, Santa Clara, CA). Intact RNA was stored at -80°C.  3.2.12 Evaluation of gene expression using quantitative reverse transcriptase PCR   RNA was converted to cDNA using the QuantiTech Reverse Transcription Kit (Qiagen, Hilden, GER). All real-time primers were optimized for 90-100% efficiency at a 56°C annealing temperature and primer concentration ratios were confirmed to be the most efficient, or have less than a two-fold difference in amplification. Primers can be found in Table 7. No reverse transcriptase controls were tested for all cDNA preps and no template controls were run with every PCR to ensure lack of gDNA contamination. Real-time PCR (RT PCR) was carried out using the Bio-Rad SsoAdvanced SYBR Green Supermix and recommended cycling parameters (BioRad, Mississauga, ON). Expression of bcrABC and/or emrE was normalized to the house keeping genes 16S rRNA and bglA, which have been verified to be the most stable endogenous controls under common food processing stresses (Tasara and Stephan, 2007). Expression was evaluated relative to wild type, non-treated control strains and up-regulation for each isolate was reported relative to itself upon treatment. Results are from three independent biological replicates for extraction samples and RT PCR was conducted in triplicate (Ct value variation < 0.3 cycles) for each target gene. Expression data was log2 transformed and normalized results to both 16S rRNA and bglA were examined for normality and equal variances.    74  Table 7: Primers used for quantitative reverse transcriptase PCR during the evaluation of expression of quaternary ammonium compound resistance determinants in transconjugants. aPrimers had efficiencies between 90-100%.Target Primer Sequence (5’-3’)a PCR product size (bp) GenBank Accession Reference bcrABC bcrABC-F-MM2 GACTCGCGCCTTAATACATGC 125 AADR01000010.1 Current study bcrABC-R-MM2 ACTCGAAGTGGACGAGGATG emrE emrE-F-qJK GTT GCT ATA GCG GTG ATT GGA GT 102 CP001602.2 Kovacevic, 2015 emrE-R-qJK GTT CAG GCC TAC AAC CCC TG bglA bglA-F GCCTACTTTTTATGGGGTGGAG 417 AY158286.1 and AY158295.1 Tasara and Stephan, 2007 bglA-R CGATTAAATACGGTGCGGACATA 16S rRNA 16S-rRNA F TTA GCT AGT TGG TAG GGT 318 N/a Tasara and Stephan, 2007 16S-rRNA R AAT CCG GAC AAC GCT TGC   75  3.2.13 Data analysis and statistics   For the agar resistance assay all statistical analysis was done using the Fisher’s exact test for differences (α = 0.05) in heavy metal resistance according to subtype. For sub-lethal growth assays all differences between isolate growth factors (µmax, OD600, and generation time) were determined using ANOVA (α = 0.05) tests. The data set from each gene expression normalization gene was tested for normality and homogeneity of variance (α = 0.05) using probability plots and Levene’s test.  The normally distributed data set with less variance was selected for further analysis. ANOVA was used for evaluating significant differences (α = 0.05) in upregulation and expression between transconjugants and donor or recipient strains. Statistics were computed using Minitab® 17 Statistical Software (Minitab®, State College, PA).    76  3.3 Results 3.3.1 Cadmium and arsenic resistance in food chain derived L. monocytogenes   Of the L. monocytogenes obtained from the food chain in British Columbia, 41 (89%) displayed growth on 35 µg/ml CdCl2, and 29 (63%) grew on 70 µg/ml CdCl2, whereas only 11 (24%) grew in the presence of 500 µg/ml NaAsO4 (Figure 7). Using growth at either 35 µg/ml CdCl2 or 70 µg/ml, resistance to cadmium is significantly more prevalent than resistance to arsenic (P<0.01, P<0.01, Figure 7). All isolates from serotypes 1/2b (n=2), 1/2c (n=7), 3a (n=4), and 4b (n=16) were found to be resistant to cadmium, but only 71% (n=12) of 1/2a isolates were resistant to cadmium (Figure 8). Resistance to arsenic was much less frequent amongst the serotypes with 6% of 1/2a (n=1), 71% of 1/2c (n=5) and 38% of 4b (n=6) isolates exhibiting resistance while none of the resistant isolates were serotype 1/2b or 3a. There were no differences found in the prevalence of cadmium (P=0.14) or arsenic (P=0.49) resistance between lineages I and II (Figure 8). All isolates from the serotypes 1/2b (n=2), 1/2c (n=7), and 3a (n=4) were found to be resistant to cadmium, however due to the limited number of these isolates, no significant differences were found between these serotypes or with 1/2a and 4b (Figure 8). Between the two most prominent serotypes in the collection, 1/2a (n=17) and 4b (n=16), the prevalence of cadmium resistance was significantly higher in serotype 4b (P=0.04, Figure 8).    Thirty-eight isolates were positive for a previously reported cadmium resistance determinant (Lee et al., 2013), with no isolate testing positive for more than one. Three of the cadmium resistance isolates and all five of the cadmium sensitive isolates lacked all of the known resistance genes (Table 8). The cadmium resistance determinant cadA1 was detected in 37.5% of resistant isolates, cadA2 was found in 32.5% of resistant isolates, and cadA3 and cadA4 were only detected in 12.5% and 10% of resistant isolates, respectively (Table 9). Serotype 1/2a accounted   77  for 10 out of the 15 cadA1 positives and only one of the thirteen cadA2 positive isolates (Table 9). Serotypes 1/2c and 4b accounted for nine of the thirteen cadA2 positive isolates and only two of the cadA1 positive isolates. Serotype 4b accounted for all of the less frequently reported cadA3 and cadA4 resistance determinants.     78   Figure 7: Listeria monocytogenes (n=46) resistance to cadmium chloride (Cd) at 35 and 70 µg/ml and sodium arsenite (As) at 500 µg/ml. Light grey bars indicate sensitive isolates and dark grey bars indicate resistant isolates. Resistance to cadmium at 35 and 70 µg/ml is significantly more prevalent than resistance to arsenic (* P<0.01, ** P<0.01).  Figure 8: Prevalence of resistance to benzalkonium chloride (BAC), cadmium chloride (Cd), and sodium arsenite (As) among isolates of Listeria monocytogenes by serotype and lineage. White, dark grey, and slashed line bars indicate percent of isolates resistant to BAC, Cd, and As respectively. The prevalence of cadmium resistance was significantly higher in serotype 4b than 1/2a (* P=0.04).   ****,**05101520253035404550Cd (35 μg/ml) Cd (70 μg/ml) As (500 µg/ml)Number of IsolatesSensitiveHeavy Metal Treatment**01020304050607080901001/2a(n=17)1/2b(n=2)1/2c(n=7)3a(n=4)4b(n=16)Lineage I(n=18)LineageII (n=28)Percent of Isolates ResistantBAC (10 µg/ml) Cd (35 μg/ml) As (500 µg/ml)Serotype  79  Table 8: Prevalence of cadmium resistance determinants among L. monocytogenes isolates.a Isolate Number (Lm) Serotype Cadmium chloride (35 ug/ml) Cadmium chloride (70 ug/ml) Sodium arsenite (500 ug/ml) Facility MLST traG bcrABC Cassette LGI1/emrE cadA1 cadA2 cadA3 cadA4 1 1/2a    5 7        4 1/2a Resistant Resistant  5 11    +    10 1/2a Resistant Resistant  7 155 + +   +   11 1/2a    11 7        17 1/2c Resistant Resistant Resistant 19 9  +   +   20 1/2c Resistant Resistant Resistant 19 9  +   +   24 1/2c Resistant Resistant Resistant 19 9  +   +   30 1/2c Resistant Resistant Resistant 19 9  +   +   31 1/2c Resistant Resistant Resistant 19 9  +   +   22 3a Resistant   19 321  +  +    23 3a Resistant   19 321  +  +    26 3a Resistant   19 321  +   +   29 3a Resistant   19 321  +   +   32 1/2a Resistant Resistant  20 155        33 4b Resistant Resistant  20 194      +  35 4b Resistant Resistant  20 194      +  41 4b Resistant Resistant  20 194      +  54 4b Resistant Resistant  20 194      +  60 4b Resistant Resistant  20 194      +  44 1/2a Resistant Resistant  21 321  +  +    47 1/2a Resistant Resistant  21 321  +  +    51 1/2a Resistant Resistant  21 321  +  +    50 4b Resistant Resistant Resistant 21 2       + 76 1/2a Resistant   28 9    +    63 4b Resistant Resistant Resistant 28 1        69 4b Resistant Resistant Resistant 28 1       +   80  Isolate Number (Lm) Serotype Cadmium chloride (35 ug/ml) Cadmium chloride (70 ug/ml) Sodium arsenite (500 ug/ml) Facility MLST traG bcrABC Cassette LGI1/emrE cadA1 cadA2 cadA3 cadA4 73 4b Resistant Resistant Resistant 28 1       + 77 4b Resistant Resistant Resistant 28 1       + 78 1/2a    31 91        70 4b Resistant Resistant  31 6     +   79 4b Resistant Resistant  31 6     +   81 4b Resistant Resistant  31 6        87 4b Resistant Resistant  31 6     +   88 4b Resistant Resistant Resistant 31 1       + 90 4b Resistant Resistant  31 6     +   14 1/2c Resistant   38 9    +    15 1/2a Resistant   38 662    +    93 1/2a Resistant  Resistant 44 120    +    96 1/2a    46 7        99 1/2a Resistant   49 321  +  +    101 1/2a Resistant   49 11    +    106 1/2b Resistant Resistant  49 5    +    102 1/2a Resistant   50 321  +  +    105 1/2c Resistant   50 9    +    109 1/2a    R7 120   +     112 1/2b Resistant Resistant  R11 296 + +   +   a + denotes the positive detection of a gene by either PCR or in silico BLAST analysis. All empty cells represent susceptible / negative results.    81  Table 9: The prevalence of cadmium resistance determinants in the different lineage and serotypes of Listeria monocytogenes in this collection.  aThree cadmium resistant isolates lacked any known resistance determinants.    Lineage Serotype cadA1 cadA2 cadA3 cadA4 Totala I 1/2b 1 1 0 0 2 4b 0 4 5 4 13 II 1/2a 10 1 0 0 11 1/2c 2 5 0 0 7 3a 2 2 0 0 4 Total 15 13 5 4 37   82  3.3.2 Growth of cadmium sensitive isolates in the presence of sub-lethal cadmium   Cadmium sensitive isolates had significantly reduced exponential growth rates (µmax) (0.204+/-0.012 OD600/hr) and maximum cell densities (OD600) (0.460+/-0.023 OD600) as compared to the cadmium resistant control strains, L. monocytogenes EDG-e and L. monocytogenes 08-5578 (0.243+/-0.005 OD600/hr µmax and 0.580+/-0.042 max OD600), in the presence of sub-lethal cadmium (P<0.01 and P<0.01, respectively; Table 10; Figure S1 in Appendix A). These growth rates correspond to generation times (Gt) that are significantly longer for the cadmium sensitive isolates (7.85+/-0.46 hr vs. 6.59+/-0.14 hr) by an average of 1.26 hours under these conditions (P<0.01, Table 10). Similar differences were seen in CFU/ml cell counts that correspond to the changes observed from OD600 (Table 10).      83  Table 10: Growth of cadmium sensitive strains in the presence of sub-lethal (1 µg/ml) cadmium chloride. aCadmium sensitive isolates had a reduced µmax and max OD600, and increased generation time (Gt) compared to cadmium resistant isolates (P<0.01, P<0.01, P<0.01 respectively).  bLog10 transformations were used for µmax and Gt calculations.  cGt was calculated from average µmax. dPlating of representative isolates during growth experiments confirmed a difference between cadmium sensitive and resistant isolates in µmax and Max OD600 (P<0.01, P<0.01).   3.3.3 Effect of cadmium and pH on the growth of cadmium sensitive and resistant L. monocytogenes    The representative cadmium resistant L. monocytogenes 08-5578 and plasmid cured, cadmium sensitive L. monocytogenes 08-5578 derivative were evaluated for growth in the presence of increasing cadmium and decreasing pH. There was no significant difference in the average µmax (0.253+/-0.028 for cadmium resistant and 0.241+/-0.022 for cadmium sensitive) or average max OD600 (5.177+/-0.057 for cadmium resistant and 0.511+/-0.061 for cadmium sensitive) in the absence of cadmium between these isolates averaging across pH levels (P=0.53 and P=0.88, respectively; Table 11). There was, however, a significant interaction (P<0.01) between cadmium, pH, and the isolate (i.e. cadmium sensitive or resistant) involved in regards to Strain Cd Sensitivity AVG µmax in TSB with Cdab (OD600/hr) Gt in Cdabc (hr) Ratio of µmax in presence of Cd and w/o AVG Max OD600a Lm1 S 0.198±0.002 8.08 0.83 0.450±0.018 Lm11 S 0.219±0.002 7.29 0.92 0.463±0.013 Lm78 S 0.212±0.011 7.52 0.90 0.436±0.020 Lm96 S 0.211±0.004 7.57 0.88 0.467±0.017 Lm109 S 0.204±0.005 7.81 0.85 0.493±0.003 EGDe R 0.246±0.016 6.49 1.01 0.545±0.011 10403S S 0.200±0.010 7.99 0.86 0.45±0.001 08-5578 R 0.239±0.011 6.69 0.98 0.602±0.018 08-5578 CdS S 0.184±0.007 8.67 0.77 0.46±0.015 Results with CFU counts done in paralleld 08-5578 R 0.236±0.005 6.76 N/a 0.627±0.005 08-5578 CdS S 0.193±0.008 8.27 N/a 0.502±0.012   84  µmax (Figure S2 in Appendix A). As pH decreased, the cadmium resistant isolate showed a reduction in growth that was not significantly affected by the presence of cadmium (P=0.60; Table 11, Figure S3 in Appendix A). For the cadmium sensitive isolate there was a significant interaction between cadmium and pH on the µmax and max OD600, until the minimum inhibitory concentration of the cadmium was reached (P<0.01; Table 10, Figure S4 in Appendix A). As cadmium increased, at each respective pH, the µmax and max OD600 for the cadmium resistant isolate was unaffected, whereas the µmax and max OD600 decreased for the cadmium sensitive isolate (Figure S5 and S6 in Appendix A). At four combinations of pH and cadmium as seen in Table 11 (pH 6 and 1.5 µg/ml; pH 5.5 and 0.5, 1.0, 1.5 µg/ml) a change in OD600 of no more than 0.05 over the course of the growth assay and is considered an inhibitory concentration of growth (Brandt et al., 2010; Branen and Davidson, 2004). The inhibitory concentration was not reached for the cadmium resistant isolate (Table 11).    85  Table 11: The effect of cadmium and low pH in combination on growth of cadmium resistant and sensitive L. monocytogenes.a,b aThere was a significant interaction between cadmium and pH for the cadmium sensitive isolate (P<0.01), but not for the cadmium resistant isolate (P=0.60). b Cadmium chloride concentration is in µg/ml.  3.3.4 L. monocytogenes co-resistant to quaternary ammonium compounds and cadmium   Of the seventeen isolates resistant to QUATs, sixteen of them were also resistant to cadmium (Table 8). All sixteen that were positive for the QUAT resistance determinant bcrABC were positive for either cadA1 or cadA2 (Table 8). The remaining QUAT resistant isolate (Lm 109) tested sensitive to cadmium and was negative for all cadmium resistance determinants (Table 08-5578 µmax  (OD600/hr) 08-5578 Max OD600   CdCl2      pH 0 0.5 1 1.5   CdCl2      pH 0 0.5 1 1.5 7 0.276± 0.002 0.246±0.001 0.256±0.001 0.243±0.001 7 0.587±0.012 0.572±0.014 0.560±0.015 0.558±0.015 6.5 0.272±0.002 0.244±0.002 0.250±0.002 0.234±0.003 6.5 0.527±0.008 0.514±0.008 0.508±0.000 0.511±0.008 6 0.251±0.001 0.245±0.001 0.235±0.002 0.227±0.001 6 0.509±0.013 0.493±0.025 0.478±0.013 0.492±0.024 5.5 0.214±0.003 0.221±0.004 0.206±0.003 0.208±0.002 5.5 0.448±0.019 0.407±0.027 0.403±0.011 0.394±0.003 08-5578 CdS µmax (OD600/hr) 08-5578 CdS Max OD600   CdCl2      pH 0 0.5 1 1.5   CdCl2       pH 0 0.5 1 1.5 7 0.255±0.000 0.228±0.001 0.221±0.011 0.181±0.006 7 0.584±0.010 0.515±0.026 0.404±0.036 0.305±0.054 6.5 0.263±0.003 0.191±0.011 0.198±0.004 0.142±0.008 6.5 0.529±0.007 0.428±0.025 0.227±0.067 0.132±0.039 6 0.232±0.002 0.191±0.005 0.118±0.001 0.084±0.000 6 0.494±0.007 0.172±0.020 0.060±0.016 0.004±0.007 5.5 0.214±0.004 0.118±0.002 0.072±0.000 0.065±0.000 5.5 0.438±0.022 0.014±0.025 0.004±0.006 0.002±0.003   86  8). Lm 109 is MLST ST120, making it part of the proposed epidemic clone V causing listeriosis in Canada for the past twenty years, and is positive for the QUAT resistant determinant emrE, which can be found on LGI-1 (Table 8) (Gilmour et al., 2010; Knabel et al., 2012). 3.3.5 Plasmid analysis of L. monocytogenes co-resistant to quaternary ammonium compounds and cadmium   Co-resistant isolates were initially evaluated for the loss of mobile genetic elements by high heat passaging. Four of the sixteen isolates were confirmed to have lost both bcrABC and the respective cadmium resistance determinant after successive passaging while the remaining isolates were determined to be incurable by this method (Table 12). Where whole genome sequences were available, homologs of repA were identified and used to construct a phylogenetic tree, alongside sequences obtained from reference plasmids (Table 12, Figure 9). In all eight of the available sequences, this indicated the presence of plasmids carrying the bcrABC and cadmium resistance genes. They were assigned to the previously identified Listeria plasmid phylogenetic groups Group 1 and Group 2 (Kuenne et al., 2010). Of the four plasmids chosen for further bioinformatics analysis the plasmid of group 1 has the smallest assembled size of the four plasmids at 61,784 bp compared to the slightly larger assembled plasmids of group 2 (66,447; 81,644, and 89,889 bp) (Table 13; Figure 10).  According to RepA homology, the only cadmium and QUAT co-resistant isolate from this study that was associated with group 1 was Lm 20 (Figure 9). Within group 2, plasmids from Lm 10 and Lm 112 had 100% amino acid identity to pLM80 by RepA sequence and all other co-resistant isolates matched the RepA sequence from pLM5578 with 100% identity (Figure 10). Aside from replication initiation proteins, the only annotated open reading frames universal to all plasmids were those involved in cadmium efflux and mobile element proteins (Table 13). Mobile   87  element proteins, which includes any annotated mobile element protein, integrase, recombinase, resolvase, or transposase, varied from 5-11 open reading frames among the plasmids (Table 14). All plasmid assemblies except for pLM1-2c20 contained a DNA polymerase IV (Figure 10). In this region pLM1-2c20 has high homology to the other plasmids and the lack of the DNA polymerase IV may be the result of an artificially truncated protein at the end of the contig or poor sequencing coverage (Figure 10). Some form of stress response associated proteins (e.g. proteases, peroxidases, protein chaperones, thermonucleases, glycine betaine transport, etc.) was encoded on all of the plasmids (Table 14).  All assembled plasmids from this study that were chosen for analysis were associated with isolates phenotypically resistant to QUATs and showed homology to the bcrABC cassette found on pLM80 (Figure 10). Of those four plasmids, pLM1-2a10 and pLM1-2b112 from Lm 10 and Lm 112 showed high overall homology to pLM80 including putative type IV secretion systems (i.e. traG/D and traE) as well as homology for the invasion associated protein p60 involved in cell division (Elhanafi et al., 2010; Pilgrim et al., 2003). pLM1-2a99 and pLM5578 both also have partial type IV secretion systems, however the Mauve alignment analysis indicates they have low homology to the similar systems in pLM80, pLM1-2a10 and pLM1-2b112 (Figure 10). pLM1-2a99 and pLM1-2bUG1 both encode proteins involved in Death On Curing (DOC) and Prevent Host Death (PHD) which are associated with plasmid stability (Lehnherr et al., 1993). The region encoding bcrABC in all four of the co-resistant plasmids chosen for further analysis show high homology (Figure 11). For the plasmids from Lm 10, 20, and 112 the up and downstream regions also show high similarity to both each other as well as pLM80 (Figure 11). The up and downstream regions from the pLM1-2a99, however, are difficult to analyze due to the short contig on which bcrABC is found (Figure 11). Primer walking for the purpose of making a   88  more complete closed plasmid would reveal whether these flanking regions are divergent or not. Based on the overall dissimilarity of pLM1-2a99 it may be the case that this plasmid does indeed have more divergent up and downstream regions to bcrABC (Figure 11). The genetic organization for the up and downstream regions around bcrABC is similar in the other analyzed co-resistant plasmids. Upstream of bcrABC, pLM1-2a10, pLM1-2c20, and pLM1-2b112 as well as pLM80 all have a LtrC-like protein (Figure 11) (Elhanafi et al., 2010). In these assemblies, downstream of bcrABC, there are two small resolvase proteins, followed by a glyoxylase, two hypothetical proteins, and a MoxR-like ATPase (Figure 11).      89  Table 12: Analysis of plasmid carriage and conjugation by cadmium and QUAT co-resistant isolates.   aPhylogenetic grouping of plasmids and detection of traG were only carried out for isolates with available whole genome sequence data.  bPhylogenetic groupings were based on amino acid sequence of the RepA protein.  cSuccessful conjugation was determined as any isolate to produce a confirmed transconjugant from any of three independent biological replicates.  Table 13: Summary of assembled plasmids. aLength in base pairs as is indicated in the respective plasmid GenBank files.  bAll open reading frames were assigned by Mauve version 2.3.1 (Darling et al., 2004).  Strain Plasmid cured Phylogenetic Groupingab traGa Successful conjugationc Lm 10 + G2 + + Lm 20 + G1 - - Lm 22 - G2 - - Lm 23 - G2 - - Lm 24 - N/a N/a - Lm 26 - N/a N/a - Lm 29 - N/a N/a - Lm 30 + N/a N/a - Lm 31 - N/a N/a - Lm 44 - G2 - - Lm 47 - N/a N/a - Lm 51 - N/a N/a - Lm 99 - G2 - - Lm 102 - G2 - - Lm 112 + G2 + + Host Putative Plasmid Status Length (bp)a Open Reading Framesb Accession L. monocytogenes  08-5578 pLM5578 closed 77054 83 CP001603 L. monocytogenes H7858 pLM80 contigs (2) 82248 94 AADR01000010, AADR01000058 L. monocytogenes UG1 SLCC2755 pLM1-2bUG1 closed 57780 66 FR667692 L. monocytogenes  Lm 10 pLM1-2a10 contigs (4) 89889 100 This study L. monocytogenes  Lm 20 pLM1-2c20 contigs (5) 61784 72 This study L. monocytogenes  Lm 99 pLM1-2a99 contigs (3) 66447 74 This study L. monocytogenes  Lm 112 pLM1-2b112 contigs (1) 81644 92 This study   90   Figure 9: Phylogenetic grouping of plasmid replication initiation protein RepA from Listeria monocytogenes plasmids. A Maximum likelihood tree was constructed from RepA amino acid homology using MEGA version 6.06 with a ClustalW algorithm and BLOSUM scoring matrix.  Reference plasmid sequences were used for assigning phylogenetic groups 1 and 2 (Kuenne et al., 2010). RepA sequences demarcated by a yellow box indicate plasmids from isolates of this study. The red bracket identifies Lm 10 and Lm 112 which group with 100% amino acid sequence identity to RepA from pLM80. All other RepA sequences from this study in group 2 match pLM5578.   91  Table 14: Annotation of open reading frames from plasmid assembliesa. aAll annotations were done using RAST and whole sequence alignments were done using the Mauve progressive aligner, version 2.3.1 (Aziz et al., 2008; Darling et al., 2004). Each category contains the number of proteins that could be associated with the trait. bMobile element proteins include anything annotated as a mobile element protein, integrase, recombinase, resolvase, or transposase. cThe only antimicrobial resistance proteins were those within the bcrABC cassette. dOnly cadmium and copper resistance associated proteins were detected eStress adaption included proteins involved in glycine betaine transport, proteases, peroxidases, protein chaperones, thermonucleases,  and glyoxalases.    Host Strain  Putative Plasmid Open Reading Frames Mobile element proteinsb Antimicrobial resistancec Metal resistanced Stress adaptione Type IV secretion system 08-5578 pLM5578 83 9 0 6 4 2 H7858 pLM80 94 11 3 3 4 2 UG1 SLCC2755 pLM1-2bUG1 66 14 0 6 3 0 Lm 10 pLM1-2a10 100 11 3 4 7 2 Lm 20 pLM1-2c20 72 11 3 4 6 0 Lm 99 pLM1-2a99 74 5 3 2 2 2 Lm 112 pLM1-2b112 92 11 3 3 4 2   92   Figure 10: Alignment of identified plasmid sequences with pLM80 and representative plasmids. Alignment was constructed using the Mauve progressive aligner (Darling et al., 2004). Reference plasmids were selected from RepA phylogenetic groups 1 and 2  (Kuenne et al., 2010). Key sequences are outlined in colors as designated in the legend. The red arrow indicates the proposed region for DNA polymerase IV in pLM1-2c20. All sequences were aligned to the reference sequence of pLM80.     93    Figure 11: Upstream and downstream regions of bcrABC. Alignment of the putative plasmids from four bcrABC positive isolates was constructed using the Mauve progressive aligner (Darling et al., 2004).  Upstream and downstream regions of high homology were highlighted to illustrate the close relation in all but pLM1-2a99 between these annotations and previously published information by Elhanafi et al. (2010).   94  3.3.6 Characterization of transconjugants    Only matings of bcrABC+ Lm 10 and Lm 112 with a cadmium sensitive L. monocytogenes 08-5578 derivative or a cadmium and QUAT sensitive L. monocytogenes 08-5578 ΔemrE derivative produced confirmed transconjugants (Figure S7 in Appendix A). Tranconjugants from the QUAT sensitive L. monocytogenes 08-5578ΔemrE showed an increased MIC for BAC, but no additional increase in resistance was seen with transconjugants from the QUAT resistant emrE+ L. monocytogenes 08-5578  (Table 15). Transconjugants experienced maximum OD600 values greater than those of the cadmium-sensitive recipient isolates when grown in the presence of sub-lethal cadmium (P<0.01; Table 15). The µmax in the presence of cadmium was not higher for all transconjugants compared to the cadmium sensitive recipient isolates (Table 15). However, by normalizing the µmax of all of the isolates to their growth in the absence of cadmium allows us to see that the transconjugants did experience increased growth rates in the presence of cadmium compared to the cadmium sensitive isolates. The ratio of µmax in the presence of cadmium relative to the µmax without cadmium was higher in the transconjugants (0.98±0.01) than the cadmium sensitive isolates (0.84±0.05) (P<0.01; Table 15).   Representative transconjugants had reduced growth rates (0.181±0.003 OD600/hr compared to 0.251±0.013 OD600/hr) and final cell densities (0.588±0.006 OD600/hr compared to 0.651±0.000 OD600/hr) when grown in the presence of sub-lethal BAC (10 µg/ml) compared to the donor and recipient isolates from the conjugation (P<0.01; Table 16). However, for the µmax in the presence of BAC relative to the µmax in non-treated media there was no significant difference between the transconjugants and wild-type isolates when the growth rates were normalized (P=0.35; Table 16).    95  Table 15: Characterization of confirmed transconjugants for MIC of quaternary ammonium compounds and growth in the presence of sub-lethal cadmium. Isolate Conjugation Assay QUAT MIC (µg/ml) Cd µMaxa (OD600/hr) Cd Max OD600a Cd µMax Ratiob 08-5578-10A1 Transconjugant 25 0.193±0.000 0.542±0.010 0.94 08-5578-10B2 Transconjugant 25 0.173±0.001 0.553±0.001 0.98 08-5578-10B6 Transconjugant 25 0.209±0.001 0.587±0.007 1.02 08-5578-112B4 Transconjugant 25 0.196±0.001 0.527±0.008 0.98 08-5578-112B27 Transconjugant 25 0.196±0.004 0.529±0.001 0.98 08-5578  ΔemrE-10A2 Transconjugant 20-25 N/a N/a N/a Lm 10 Donor 20 N/a N/a N/a Lm 112 Donor 20-25 N/a N/a N/a 08-5578 CdS Recipient 20-25 0.181±0.006 0.470±0.006 0.78 08-5578 ΔemrE CdS Recipient 5 0.182±0.003 0.470±0.033 0.82 aThere was no significant difference in µmax (P=0.28) however there was a significant difference (P<0.01) in max OD600 between transconjugants and recipients for growth in sub-lethal cadmium.  bRelative to un-supplemented media there was a significantly higher µmax in cadmium of the transconjugants compared to cadmium sensitive recipients (P<0.01).   Table 16: Characterization of donor, recipient, and transconjugants used in RNA extractions for growth in the presence of sub-lethal (10 µg/ml) benzalkonium chloride (BAC). Isolate Conjugation Assay QUAT MIC (µg/ml) BAC µMax (OD600/hr) BAC Max OD600 BAC µMax Ratioa 08-5578-10B2 Trans-conjugant 25 0.183±0.029 0.584±0.018 0.99 08-5578  ΔemrE-10A2 Trans-conjugant 20-25 0.179±0.017 0.592±0.004 0.96 Lm 10 Donor 20 0.242±0.008 0.652±0.011 0.99 08-5578 CdS Recipient 20-25 0.261±0.033 0.651±0.012 1.07 aRelative to unsupplemented media there was no significant difference in µmax (P=0.35).     96  3.3.7 Expression of quaternary ammonium compound resistance determinants in BAC exposed transconjugants   Both normalization schemes resulted in data sets that were normally distributed, however lower variances were seen with bglA and thus it was used for the following results. Results from 16S normalization can be found in supplemental figures S8 and S9 in Appendix A. Expression of bcrABC and emrE was confirmed in transconjugants upon exposure to 10 µg/ml BAC for 60 minutes. When comparing fold-change values, there was no difference in the upregulation of either bcrABC or emrE between the transconjugants and wild-type isolates, but significantly lower upregulation of emrE was observed as compared to bcrABC (P<0.05; Figure 12). Relative to the bcrABC donor isolate, Lm 10, there was no difference in log2 expression for the transconjugants of bcrABC after treatment (Figure 13). Similarly, there was no difference in emrE expression between the emrE+ recipient and transconjugants (Figure 13).      97   Figure 12: Upregulation of QUAT resistance determinants after 60 minute exposure to 10 µg/ml BAC with normalization to bglA. Bars represent the average fold change from at least two biological replicates with the standard error of the mean. Light gray bars represent change in bcrABC expression and black bars represent chance in emrE expression. There were no significant differences seen in fold change within isolates expressing either bcrABC or emrE, but there was a significant difference between the fold change in expression of bcrABC and emrE (P<0.01). 01234567Lm 10 (bcrABC+) 08-5578 ΔemrE (bcrABC+)08-5578(bcrABC+/emrE+)08-5578 (emrE+) 08-5578(bcrABC+/emrE+)Fold change Log2Isolate  98   Figure 13: Expression of QUAT resistance determinants after 60 minute exposure to 10 µg/ml BAC with normalization to bglA. Bars represent the average expression from at least two biological replicates with the standard error of the mean relative to the non-treated donor or recipient. Light gray bars represent change in bcrABC expression and black bars represent chance in emrE expression. Lower expression of bcrABC was seen between treated Lm 10 and 08-5578 (bcrABC+/emrE+) however this was not found to be significant (P=0.19). A similar trend was seen for emrE expression, though it was also not found to be significant (P=0.09).   -2-101234567Non-treatedTreatedNon-treatedTreatedNon-treatedTreatedNon-treatedTreatedNon-treatedTreatedLm 10 (bcrABC+) 08-5578 ΔemrE (bcrABC+)08-5578(bcrABC+/emrE+)08-5578 (emrE+) 08-5578(bcrABC+/emrE+)Log2 Expression Isolate  99  3.4 Discussion 3.4.1 Heavy metal resistance detected in L. monocytogenes from the BC food chain   Resistance to cadmium was determined by growth at the more lenient 35 µg/ml cadmium chloride cutoff as suggested by Lee et al (2013).  For reference, cadmium sensitive L. monocytogenes that do not possess any cadmium resistance determinants frequently have MICs of 10 µg/ml CdCl2 (Lee et al., 2013).  The authors proposed the 35 µg/ml cutoff as opposed to 70 µg/ml due to the lower level resistance associated with cadA4 that allows for growth at 35 µg/ml but not at 70 µg/ml. This study observed the opposite effect, with all cadA4 positive isolates being resistant to 70 µg/ml cadmium chloride and only 33.3% and 85% of cadA1 and cadA2, respectively, isolates being resistant to both 35 and 70 µg/ml cadmium chloride (Table 7). Lee et al. (2013) suggested the divergent sequence of cadA4 compared to the other three cadmium resistance determinants may contribute to the lower MIC seen in the cadA4+ isolates. The reason for the deviation of these results from that of Lee et al. (2013) is unknown, however it suggests there is a contributing factor other than the divergent sequence of cadA4. Regulatory differences of cadA4, which is the only chromosomally associated cadmium resistance determinant, as well as differences in the upstream and downstream regions of the plasmids the other determinants may be encoded on could explain the difference in inhibitory concentrations observed.  The prevalence of resistance to cadmium in this study of 90% falls above the broad range (7-66%) of prevalence seen in previous published results;  however a more lenient cutoff of cadmium resistance (35 µg/ml as opposed to 70 µg/ml) was used  in the present study (Margolles et al., 2001; McLauchlin et al., 1997; Mullapudi et al., 2008; Ratani et al., 2012; Xu et al., 2014). According to the 70 µg/ml cutoff for cadmium resistance, the majority of isolates in this collection remains resistant to cadmium (n=29, 63%). In an early report, McLauchlin et al. (1997) observed   100  the widespread resistance to cadmium of L. monocytogenes in 58% (n=326) of their total clinical and food isolates. Margolles et al. (2001), observed much lower resistance to cadmium with only 7% (n=2) of the authors’ collection of L. monocytogenes from soft ripened cheeses in Spain being resistant at this concentration. However, the wide range of MIC of cadmium within their isolates, as well as high level resistance (MIC of 128 µg/ml) led the authors to suggest that cadmium resistance may be just emerging in that population. Other studies from China and North America reported 50% and 66%, respectively (Mullapudi et al., 2008; Xu et al., 2014). This high prevalence is still lower than the 90% of isolates in the BC food chain resistant to cadmium reported here, but the presence of several closely related isolates as determined by MLST collected from the same facility may be inflating these results (Table 8).   This study observed arsenic resistance that is slightly higher (n=11, 24%) than that reported by other studies (6-19%) (McLauchlin et al., 1997; Mullapudi et al., 2008). A high similarity among arsenic resistant isolates according to MLST patterns in this study may indicate close ancestral relation and account for the higher percentage of arsenic resistant isolates observed as compared to the previous two studies. In particular, five isolates collected from the same facility all have the same MLST pattern and were all found to be resistant to arsenic (Table 8). McLauchlin et al. (1997) observed 106 isolates to be resistant to arsenic, for which there was no association with plasmid carriage. The lack of plasmid associated arsenic resistance would limit the potential for horizontal transfer and could explain the lower prevalence relative to cadmium resistance, and supports the high similarity of arsenic resistance isolates found in this study. Interestingly, Mullapudi et al. (2008) reported the opposite in terms of plasmid carriage and arsenic resistance. All 23 of the authors’ arsenic resistant isolates were positive for a pLI100 plasmid associated arsA2 resistance determinant. Over half (13/23) of these isolates also possessed an integrated homologue   101  of arsA2, arsA1, that was never detected in the absence of arsA2. While Mullapudi et al. (2008) did not observe arsenic resistance in the absence of plasmid associated resistance determinants, they did show a majority of their arsenic resistant collection to have chromosomally integrated arsA1.  3.4.2 Prevalence of cadmium resistance determinants in L. monocytogenes from the BC food chain   Our findings are in agreement with the findings of Ratani et al. (2012) who reported higher prevalence of cadmium resistance among 4b isolates than 1/2a isolates, but in contrast with Mullapudi et al. (2008) and Xu et al. (2014) who found the opposite. While Mullapudi et al. (2008) collected isolates from North America, Xu et al. (2014) collected their L. monocytogenes from the provinces of China and comparison may be made difficult due to variations in serotype distributions in different geographic areas. Analysis has shown that the major clones of L. monocytogenes can be found worldwide, but more extensive sample sizes and discriminatory typing methods (such as MLST) are needed to further evaluate the geographic distribution of strain level L. monocytogenes (Chenal-Francisque et al., 2011).   The most frequently observed cadmium resistance determinant detected was cadA1, followed closely by cadA2 (Table 9). Of the known resistance determinants, cadA1 has previously been reported to be the most prevalent with over 50% of resistant isolates tested being positive (Mullapudi et al., 2010; Ratani et al., 2012; Xu et al., 2014). Both cadA3 and cadA4 have been associated with chromosomal integration whereas cadA1 and cadA2 have been associated with plasmid carriage (Elhanafi et al., 2010; Glaser et al., 2001; Lebrun et al., 1994a; Lee et al., 2013). Increased potential for horizontal transfer of cadA1 and cadA2 may explain the greater prevalence   102  of these resistance determinants, while chromosomal integration of cadA3 and cadA4 may contribute to the localization of these determinants to serotype 4b in this population. 3.4.3 Decreased fitness for cadmium sensitive L. monocytogenes in the presence of sub-lethal cadmium   Previous explanations for the widespread prevalence of cadmium resistance in L. monocytogenes encompass both exposure to water soluble environmental heavy metals as well as a benefit to invasion as selective pressures (Camejo et al., 2009; Margolles et al., 2001; Mullapudi et al., 2008). Due to the saprophytic nature of L. monocytogenes, environmental exposure to cadmium may be more likely to explain the pervasive existence of these resistance genes in the accessory genome (den Bakker et al., 2010). Additionally, the only conserved feature within 14 sequenced Listeria plasmids, aside from replication initiation proteins and DNA polymerase IV, was that of a cadmium resistance operon (Kuenne et al., 2010). These plasmids contain many other genes involved in metal resistance and oxidative stress response that may contribute to natural and food environment survival.   Cadmium sensitive L. monocytogenes experienced decreased exponential growth rates and final cell densities when grown in the presence of sub-lethal cadmium (Table 10). While resistance determination was set at 35 µg/ml, natural soil environments contain concentrations that are often 10-350 fold lower (Health Canada, 1994; Pan et al., 2010). In European countries, topsoil concentrations of cadmium ranged from <0.01 to 14.1 µg/g with an average and median of 0.284 µg/g  and 0.145 µg/g respectively (Pan et al., 2010). In BC, topsoil concentrations of cadmium range from 0.1 to 3.4 µg/g and average 0.8 µg/g with a median of 0.6 µg/g (BCMOE, 2005). In order to evaluate the fitness of L. monocytogenes isolates in comparable low concentration cadmium environments, broth based growth assays were used for rapid, reproducible analysis. A   103  1 µg/ml cadmium chloride concentration, which equates to 0.62 µg/ml of cadmium, was chosen. Though this concentration is higher than the reported median in topsoil for BC, it is below the 3 µg/g cadmium maximum limit allowed in agriculture and a better representation than the concentrations (35-70 µg/ml cadmium chloride) used in other studies for determining resistance (Health Canada, 1994). Broth based assays have inherent differences from soil systems (e.g. diffusion, interaction with organic matter), but reduced growth rate and final cell density of cadmium sensitive cultures indicates that cadmium resistance is beneficial even in sub-lethal cadmium levels that L. monocytogenes may be exposed to. A positive correlation was found between the application of rock phosphate fertilizers to agricultural fields and cadmium contamination, suggesting that this may be an area for future control if it influences the ecology of soil microorganisms significantly (Pan et al., 2010). Treated sewage sludge is also allowed for agriculture application in Canada and can have cadmium concentrations up to 5 µg/g dry weight (Acton and Gregorich, 1995). Follow up experiments in controlled soil environments with known cadmium concentrations are necessary to confirm differences in fitness of cadmium sensitive and resistant L. monocytogenes over both short and long term studies. 3.4.4 Additive effect of increasing cadmium and high acid environment on growth of L. monocytogenes    The natural environment contains many confounding variables that influence the survival of soil microorganisms, one of which is pH. Soil pH itself is an indicator of the survival of L. monocytogenes, but it also affects the solubility of soil nutrients (BCMOA, 2001; Domínguez et al., 2009; Locatelli et al., 2013b). A broad range of soil acidities can be found for optimal crop growth (pH 4.0-8.0), however many crops prefer a slightly acidic environment (pH 5.5-7.0) which contributes to the greater solubility or bioavailability of minerals (e.g. nitrogen, calcium,   104  magnesium, iron, potassium, etc.) in organic soils (BCMOA, 2001). The pH of soils has been reported to influence the bioavailability of heavy metals as well, and a decrease in adsorption of cadmium by crops was seen when the pH of sludge was raised (Alloway, 1995; Jackson and Alloway, 1992). However, the possibility remains that the adsorption mechanisms of the plants, as opposed to the solubility of the metals, was altered by the pH change and should not be overlooked. Dominguez et al. (2009) observed a significant negative correlation between pH and solubility of cadmium in the soil, but the regression equation had a poor fit (r2=0.62) and there was limited change in the soluble concentration of cadmium (<0.2 µg/g) between pH of 5 and pH of 8. The authors also found there was no significant correlation between organic matter in the soil and cadmium solubility (Domínguez et al., 2009).  The interaction between pH and cadmium and their effect on the growth of L. monocytogenes has not previously been explored. A synergy experiment in this study revealed that there is a significant interaction between pH, cadmium concentration, and the sensitivity to cadmium of this strain of L. monocytogenes with respect to µmax (Figure S2). These results suggest that sub-lethal cadmium concentrations in the environment, where acidic pH may be readily encountered, may have more profound effects on the ecology of L. monocytogenes than previously considered. The combined effect of pH and cadmium is additive rather than synergistic, however, as the decrease in µmax and maximum cell density is the sum of the decrease due to each of those factors independently. The lack of synergy between pH and cadmium may be the result of minimal increase in solubility of cadmium in this pH range (pH 5.5 to 7) (Domínguez et al., 2009). At a pH below 5.5 an increase in cadmium solubility may result in a synergistic effect, but further studies would be needed to verify this. The concentrations of environmental cadmium remain low, as reported by the British Columbia Ministry of the Environment (2005), but further studies should   105  evaluate to what extent low concentration heavy metals may influence L. monocytogenes in soil systems and not just liquid media.  3.4.5 Cadmium resistant L. monocytogenes co-resistant to quaternary ammonium compounds   All bcrABC positive, QUAT resistant L. monocytogenes isolates were resistant to cadmium and possessed either cadA1 or cadA2, an association that has been previously reported in Listeria (Dutta et al., 2013; Elhanafi et al., 2010). Dutta et al. (2013) only found one isolate of 70 bcrABC positive L. monocytogenes that was cadmium susceptible. The authors did notice a subset of bcrABC positive L. monocytogenes that possessed a plasmid borne cadmium resistance determinant, but showed evidence of chromosomal integration of the bcrABC gene. To evaluate the bcrABC positive isolates of this collection for mobile genetic elements that may carry co-resistance to both cadmium and QUATs, high heat passaging was utilized. Four isolates were successfully cured of both bcrABC and their respective cadmium resistance determinant, while carriage remained stable in the other twelve and no isolates selectively lost either bcrABC or the cadmium resistance determinant (Table 12). The loss of both determinants that contribute to resistance to QUATs and cadmium suggests a single mobile genetic element that may facilitate horizontal transfer of this co-resistance between L. monocytogenes, which has previously been shown to occur between non-pathogenic Listeria and L. monocytogenes (Katharios-Lanwermeyer et al., 2012).   When whole genome data was available, all bcrABC positive isolates were found to possess a RepA protein that is found on plasmids and is necessary for plasmid replication in Listeria, as suggested by Kuenne et al. (2010) (Table 12). A phylogeny based on repA amino acid sequences could differentiate the present plasmids into the two previously identified groups (Figure 9)   106  (Kuenne et al., 2010). Select plasmids from both groups were cured, as indicated by the loss of bcrABC and the cadmium resistance determinant, suggesting that no association between stability of the plasmids as a result of assembled size or phylogenetic grouping can be made, but further analysis would be necessary to confirm this. When considering the results of the previous section, natural environment exposure to sub-lethal cadmium, especially in low pH conditions, may provide a selective pressure to perpetuate these cadmium resistance-carrying plasmids, indirectly selecting for carriage of QUAT resistance in select L. monocytogenes.   3.4.6 Analysis from alignment of plasmids from cadmium and quaternary ammonium resistant L. monocytogenes    The annotation of these assembled plasmids revealed several coding regions which may be involved in cellular mechanisms of interest, however further work (i.e. gene knock-outs) is necessary to evaluate their true phenotypic effect. Coding regions that may have contributed to and can be associated with observed results of this study are the cadmium efflux systems, the bcrABC cassette, partial type IV secretion systems, and the DOC and PhD system (Figure 10). Both the cadmium efflux systems and the bcrABC cassette confirm the PCR and phenotype results for these isolates. It is interesting to note the presence of coding regions associated with type IV secretion systems, such as traG/D and traE, which can be found on the assembled plasmids from Lm 10 and Lm 112 as these were the only two co-resistant isolates to successfully produce transconjugants. This association between high efficiency transfer and traG/D has been made before by Katharios-Lanwermeyer et al. (2012), however as with the other coding regions annotated, further work is necessary to prove this involvement in facilitating conjugation. The DOC and PhD system found on the assembled plasmid from Lm 99 is putatively involved in plasmid stability, and Lm 99 is the only isolate of these four selected for plasmid analysis that   107  failed to have its plasmid cured upon high heat passaging. Again, the true involvement of DOC and PhD in plasmid stability in this case is unknown, but further work could be done to understand its role in plasmid curing as well as conjugation.  The region encoding bcrABC in all four of the assembled co-resistant plasmids chosen for further analysis show similarity based on annotations to what Elhanafi et al. (2010) reported. There are two small hypothetical proteins and resolvases annotated here as opposed to one of each by the Elhanafi et al. (2010). The annotation of pLM80 using RAST side by side with pLM1-2a10, pLM1-2c20, and pLM1-2b112 and alignment with Mauve revealed homology across this region suggesting the difference is an artifact of the annotation program that was not disclosed by Elhanafi et al. While Elhanafi et al. (2010) suggested that variations in the upstream and downstream coding regions may have a role in the regulation of bcrABC, this was not explored in this study and no associations are being made between these draft genome sequence annotations and potential resistance phenotypes to QUATS.   3.4.7 Conjugative transfer of cadmium and quaternary ammonium compound co-resistance among L. monocytogenes    Katharios-Lanwermeyer et al. (2012) first suggested that non-pathogenic Listeria may act as a reservoir of QUAT resistance determinants that can be horizontally transferred to L. monocytogenes. These results highlight the risk of horizontal transfer of resistance determinants for QUATs among L. monocytogenes, which has not previously been reported. While more studies are needed to evaluate the risk of transfer in FPE settings, this indicates that L. monocytogenes, in addition to non-pathogenic Listeria, can contribute to the spread of resistance to common food processing sanitizers through both horizontal and vertical transmission. However, in agreement with Katharios-Lanwermeyer et al. (2012), not all plasmid borne bcrABC is of equal risk for   108  horizontal transfer. Two (Lm 10 and Lm 112) of sixteen L. monocytogenes isolates co-resistant to QUATs and cadmium successfully produced transconjugants in this study (Table 12, Figure S7). Both of these isolates were confirmed to have the traG gene that is associated with high frequency transfer (Katharios-Lanwermeyer et al., 2012). Additionally, the RepA phylogeny revealed that the amino acid sequence for the replication initiation protein RepA present in Lm 10 and Lm 112 group with 100% identity to pLM80 (Figure 9).  pLM80 was the first characterized plasmid to carry bcrABC as well as resistance to cadmium, and all high frequency transfers of co-resistance documented by Katharios-Lanwermeyer et al. (2012) were associated with pLM80-like plasmids.   Contrary to the findings of Katharios-Lanwermeyer et al. (2012), not all co-resistant donor isolates in this study were capable of horizontal transfer to a L. monocytogenes recipient strain. Transfer efficiency was difficult to calculate as the recovery of transconjugants was very low, though consistent across the three biological replicates. Due to these restrictions, and the slow growth of transconjugants on the double selective media, successful conjugation was reported as positive or negative. Katharios-Lanwermeyer et al. (2012) similarly reported low efficiencies of transfer (<1.0x10-9 – 3.7x10-6), taken from one representative biological replicate. Further replicates, or alternative recipient strains, may have revealed that the other co-resistant isolates in this study were capable of conjugation but this was not detected in the current work.  3.4.8 Relative fitness of transconjugants   The transfer of co-resistance allowed for an increased MIC to QUATs (Table 15). However, when conjugations were carried out with L. monocytogenes 08-5578, which is emrE positive and QUAT resistant, no further increases in MICs to QUATs were seen when bcrABC and emrE were combined (Table 15). The phenotypic effect of harboring multiple resistance   109  determinants to QUATs has not been shown before, but the lack of further increased resistance suggests there is limited risk for increased survival due to further elevated QUAT resistance in the FPE. The increase in resistance seen in the L. monocytogenes 08-5578 ΔemrE-10A2 transconjugant does confirm that L. monocytogenes can horizontally transfer the resistance phenotype (Table 15). When grown in the presence of sub-lethal cadmium, the transconjugants did not show a significant difference in µmax, but they did grow to a higher maximum OD600 (Table 15). The representative transconjugants used for expression analysis of the QUAT resistance determinants, exhibited a lower growth rate and maximum OD600 than the recipient isolate when grown in the presence of 10 µg/ml BAC (Table 16). It is worth noting, however, that L. monocytogenes 08-5578 ΔemrE had a MIC to BAC of 5 µg/ml and only the transconjugant (L. monocytogenes 08-5578 ΔemrE-10A2) was able to grow at 10 µg/ml BAC in TSB regardless of its slightly decreased growth rate.  Relative to growth in non-treated media, all transconjugants showed restored ability to grow in the presence of sub-lethal cadmium and BAC (Table 15). It is necessary to normalize the growth rates for each respective isolate grown to that observed in non-treated media because of the overall decreased fitness of these transconjugants. There are several possibilities to explain this decreased fitness. The initial explanation would be that streptomycin-resistant derivatives have been shown to have decreased fitness due to mutations in the ribosome that contribute to  the resistance (Paulander et al., 2009). This may contribute to the decreased fitness, however, the streptomycin-resistant recipient isolate (L. monocytogenes 08-5578 Cds) did not show a similar decrease in fitness under non-selective conditions. A second obvious explanation would be the fitness cost of the transferred co-resistance. Under sub-lethal conditions, the fitness cost of carrying and expressing the co-resistance may not outweigh the growth benefits. However, as was seen in   110  the MIC to BAC for L. monocytogenes 08-5578 ΔemrE-10A2, this is a normally inhibitory situation (≥10 µg/ml BAC) in which the transferred co-resistance is of benefit (Table 15). The transferred co-resistance may be on a larger mobile genetic element than the wild type plasmid (ca. 82 kb for pLM80-like plasmids vs 77 kb) that was cured from the L. monocytogenes 08-5578 recipient (Kuenne et al., 2010). The difference in size of the transferred genetic elements may be an artifact of the plasmid assemblies from draft sequences, but could be contributed to by components of the type IV secretion system that are involved in the transfer of plasmids.  Kathrios-Lanwermeyer et al. (2012) made an association between traG and the high efficiency transfer of pLM80-like plasmids while Kuenne et al. (2010) reported only a partial type IV secretion system on the pLM5578 plasmid. Similarly to Kuenne et al. (2010), the annotation of pLM5578 in this instance did reveal components of a type IV secretion system (traE), but others such as traG were not annotated. Type IV secretion systems can be energy intensive and involve the formation of otherwise unnecessary cellular structures (e.g. the pilus, inner membrane recruitment proteins for DNA) (Fronzes et al., 2009). Together, all of these fitness costs, or some other mutation as a result of the stressful double-selective (10 µg/ml CdCl2, 50 µg/ml streptomycin) recovery of transconjugants, might contribute to the decreased fitness of the transconjugants. Alternative transconjugant recovery methods may resolve this issue. One such option would be to serially dilute all cells from the mating experiment and then test a subset using a multiplex real-time PCR. This would avoid the stressful selection process, but could prove to be less economical or lack sensitivity to detect transconjugants if the efficiency proved to be low, as was observed in this study.     111  3.4.9 Expression of quaternary ammonium compound resistance determinants in donor, recipient, and transconjugant isolates.  The up-regulation of QUAT resistance determinants in transconjugants was not significantly different than the recipient or donor isolates, but there was a downward trend of log2 expression of both bcrABC and emrE in the transconjugants relative to the donor or recipient isolates following BAC exposure (Figure 12). There was a significant difference in up-regulation of bcrABC and emE (Figure 12), which could be the result of a canonical promoter region for bcrABC versus a promoter for the alternative sigma factor, σ24, for emrE  (Elhanafi et al., 2010; Gilmour et al., 2010). The lower trend of total expression in the transconjugants with multiple resistance determinants may be the result of either limited cellular resources (e.g. polymerase, amino acids) or a fitness-cost benefit of over-expressing both resistance determinants. The antagonistic potential of multiple beneficial mutations (i.e. that allow for elevated protein production contributing to some sort of stress alleviation) on fitness cost has been explored in other bacteria and may provide some explanation why it is not necessary to over-express two small multi-drug resistance proteins when one is sufficient for survival to the given stress (Chou et al., 2014). Under high stress conditions (15-20 µ/ml BAC) it is possible that the benefit of expressing both resistance determinants may outweigh the fitness cost of two functional proteins, but further experiments would be necessary to evaluate this. A lack of increase in the MIC to QUATS in transconjugants however suggests that either the fitness cost of adequately expressing both bcrABC and emrE is too great, or there is a threshold at which this method of resistance is not sufficient to survive exposure to QUATs. The latter is probable as QUATs act by disrupting the cell membrane of bacteria through incorporating long alkyl side chains in between the   112  phospholipids (Gilbert and Al-Taae, 1985). How efflux pumps contribute to increased resistance to QUATs is not fully understood. 3.4.10 Future studies and significance   Of the L. monocytogenes isolated from the British Columbia food chain, 90% could be found to be resistant to cadmium and 24% were resistant to arsenic. Cadmium sensitive isolates showed reduced µmax and maximum OD600 values compared to cadmium resistant controls when grown in microbroth assays. The pH of the broth medium was found to have a significant effect on a representative cadmium sensitive isolate, but not on the representative cadmium resistant isolate. This is the first study to show decreased fitness of cadmium sensitive isolates in sub-lethal cadmium environments and suggest environmental factors, such as soil pH, could contribute to low levels of cadmium having significant impact on the ecology of L. monocytogenes in natural reservoirs over time. Further studies in soil systems are needed to confirm this effect on both short and long term survival. Cadmium resistant isolates were found that were also resistant to QUATs. Co-resistance was transferable to the cadmium sensitive L. monocytogenes 08-5578, but when multiple QUAT resistance determinants were combined via conjugation no further increase in inhibitory concentrations was seen. These results are the first to provide evidence for the horizontal transfer of cadmium and QUAT co-resistance between isolates of L. monocytogenes. The lack of elevated levels of resistance to QUATs when resistance determinants were combined suggests further resistance will not be seen in L. monocytogenes in the FPE due to this efflux mediated mechanism.       113  Chapter 4: Antibiogram profiles of sequence type 120 Listeria monocytogenes from the food chain in British Columbia and Alberta, Canada 4.1 Introduction  Listeria monocytogenes is a foodborne pathogen well suited to surviving a number of regular food chain stresses (Gandhi and Chikindas, 2007). Infection manifests as little more than a gastrointestinal illness in healthy individuals, but in the immunocompromised, elderly, and pregnant it can cause the invasive infection known as listeriosis (Vázquez-Boland et al., 2001). Upwards of 99% of these infections are estimated to be the result of consumption of ready-to-eat (RTE) foods contaminated with L. monocytogenes (FDA, 2003; Mead et al., 1999). Invasive L. monocytogenes has a propensity for causing adult meningitis and perinatal septicemia in susceptible hosts. In listeriosis cases, the disease is not self-limited and hospitalization and fatality rates are high. In North America during the early 2000’s, listeriosis was associated with a 6.5-15.9% fatality rate (Clark et al., 2010; Scallan et al., 2011). However, this is low compared to many reports and more recent outbreaks in the US and Canada have resulted in 30-40% fatality (CDC, 2015b, 2011; Gilmour et al., 2010). This highlights the importance of understanding differences in the L. monocytogenes populations that are capable of surviving in the food chain and possibly resisting both food processing environment (FPE) and clinical treatment strategies. With high fatality rates and considering the susceptible population most affected by listeriosis, it is critical to provide early antibiotic treatment that can be relied upon to be effective. Historically, lineage I strains of L. monocytogenes have been more frequently implicated in disease and less with isolation in foods and the FPE, while lineage II strains were the opposite (Orsi et al., 2011). Conversely, in Canada this has not proven to be the case. Over the past two   114  decades a predominant clone, clonal complex 8 (CC8) of which includes single locus variants of sequence type (ST) 120, of L. monocytogenes of lineage II,  1/2a serotype, has been the principle disease causing agent (Knabel et al., 2012). After the 2008 outbreak in Canada with prepackaged, RTE deli meats, whole genome sequencing of the responsible CC8, ST120, 1/2a serotype strain revealed a novel 50 kb Listeria genomic island (LGI-1) that contained such genes as emrE, which encodes a putative antimicrobial efflux pump (Gilmour et al., 2010). This putative antimicrobial efflux pump contributes to resistance to quaternary ammonium compounds (QUATs) and may facilitate persistence in the FPE (Kovacevic, 2014). It remains to be seen if emrE, or other uncharacterized determinants on LGI-1 may contribute to antibiotic resistance in clinical cases. The L. monocytogenes strains responsible for the 2008 Canadian delicatessen outbreak (L. monocytogenes 08-5578 and 08-5923) were found to have full length, wildtype inlA, which is involved in successfully invasion, but this has not been characterized for other CC8 isolates (Gilmour et al., 2010; Knabel et al., 2012; Nightingale et al., 2008).  Reports of antibiotic resistance in L. monocytogenes fortunately remain sparse, but they do exist (Lungu et al., 2011). Antibiotic resistance genes have been identified in L. monocytogenes, but resistance to the preferred antibiotics of treatment, ampicillin and gentamicin, has been rare (Lungu et al., 2011; Swaminathan and Gerner-Smidt, 2007). The anrAB operon encodes a multidrug transporter that contributes to the inherent low-level resistance of L. monocytogenes to ampicillin and is so far reported as ubiquitous, but the observed minimum inhibitory concentrations of ampicillin remain sensitive (0.25 to 1 µg/ml) (Collins et al., 2010; Hof et al., 1997; Troxler et al., 2000). Between 1926 and 2007 a small, but significant, increase in penicillin and ampicillin minimum inhibitory concentrations was seen in L. monocytogenes from clinical cases in France (Morvan et al., 2010). The role of anrAB in this increase is unknown, but the   115  increase in inherent resistance over time warrants continued surveillance.  Additionally, multiple resistance genes for other classes of antibiotics have been found in L. monocytogenes from rare clinical cases (Morvan et al., 2010). Two plasmids (37 and 39 kb) were isolated from L. monocytogenes with resistance genes to chloramphenicol, erythromycin, and tetracycline (Hadorn et al., 1993; Poyart-Salmeron et al., 1990). Both plasmids were found to be conjugative and transferable to other Gram positive bacteria. Of the sequenced plasmids available for the Listeria genus none carry any antibiotic resistance genes, though one plasmid encodes an efflux pump for resistance to quaternary ammonium compound food processing sanitizers (Elhanafi et al., 2010; Kuenne et al., 2010). Despite the rare occurrence of antibiotic resistant isolates, the ubiquitous nature of L. monocytogenes and frequency of isolation from otherwise healthy human stool samples, allows for extensive opportunity for intermingling and the exchange of genetic material with non-pathogenic species that may be reservoirs of resistance to common antimicrobials  (Allen et al., 2014; Lungu et al., 2011).  Considering the apparent relevance of CC8 and ST120 isolates of L. monocytogenes in Canada, the following work evaluated a collection of ST120 isolates collected from RTE foods in Canada for their resistance to commonly used antibiotics. It is unknown why ST120 isolates predominate in clinical cases in Canada and this could be a result of genetic factors that allow for increased invasion or survival in the food chain. Therefore, information regarding their susceptibility to antibiotics is important to the control and treatment of L. monocytogenes in Canada.   116  4.2 Methods 4.2.1 Isolate collection  Nineteen isolates were generously donated by Dr. Victor Gannon from the Laboratory of Foodborne Zoonosis, Pubic Health Agency of Canada and originated from RTE foods in Alberta, Canada. An additional two isolates were included from the collection listed in section 2.2.1. In total, 21 isolates were chosen for complete analysis based on in silico MLST results for ST120 (Table 17). All strains were kept at -80°C in tryptic soy broth (TSB; Neogen corp.) with 20% glycerol and routinely sub-cultured. Table 17: List of Listeria monocytogenes sequence type (ST) 120 isolates from food processing environments in Alberta and British Columbia.a Isolate Province of originb QUAT resistance determinants identified in genome assembliesa Lm 93 BC  Lm 109 BC emrE Lm 262 AB  Lm 264 AB emrE Lm 272 AB  Lm 273 AB  Lm 285 AB emrE Lm 289 AB emrE Lm 292 AB emrE Lm 297 AB emrE Lm 298 AB emrE Lm 299 AB emrE Lm 303 AB emrE Lm 304 AB emrE Lm 305 AB  Lm 307 AB  Lm 310 AB emrE Lm 319 AB emrE Lm 332 AB  Lm 351 AB emrE   117  Isolate Province of originb QUAT resistance determinants identified in genome assembliesa Lm 353 AB emrE aAll isolates are ST 120 L. monocytogenes with full length, wild-type inlA. Sequence type, and detection of inlA mutations and quaternary ammonium compound (QUAT) resistance determinants were determined from available draft sequence.  bCanadian province of origin; British Columbia (BC) or Alberta (AB). 4.2.2 Genetic screening   Draft whole genome assemblies were used to generate the MLST data using the Center for Genomic Epidemiology’s MultiLocus Sequence Typing version 1.8 tool (Larsen et al., 2012). The basic local alignment search tool (BLAST)  was used to screen for emrE sequences (Ragon et al., 2008).  The sequences for inlA were extracted and aligned to inlA from EDG-e using the Geneious® software (Biomatters Ltd., Auckland, NZ) to assign premature stop codons or wild-type status. 4.2.3 Antimicrobial resistance as determined by the disk diffusion assay   Kirby-Bauer disk diffusion assays were used for antibiotic susceptibility testing according to the method previously reported (Kovacevic et al., 2013). In brief, isolates were streaked onto tryptic soy agar with 0.6% yeast extract (TSA YE: Neogen Corp., Lansing, MI; Thermo Fisher Scientific, Fair Lawn, NJ) and incubated at 37°C overnight. After incubation a single isolated colony was used to inoculate 3 ml of TSB and was incubated with shaking (180 rpm) at 35°C for 16-18 hours. Overnight cultures were then thoroughly mixed and 70 µl was added to 7 ml of tempered (45°C) 0.75% agar. Tempered agar was mixed well and poured out onto cation ion adjusted Mueller Hinton agar (Becton and Dickinson and Company (BD), Sparks, MD). After the agar had solidified, no more than four 6 mm antibiotic disks were placed on each agar plate using   118  aseptic technique then incubated at 35°C for 24 hours. All 17 antibiotics (BD, Sparks, MD) listed in Table 3 were used and Escherichia coli K-12 MG1655 and Staphylococcus aureus ATCC 25923 were run alongside every replicate as controls. Results were recorded to the nearest millimeter and from and Clinical Laboratory Standards Institute (CLSI; Wayne, PA) breakpoints were used for L. monocytogenes when possible, and otherwise breakpoints for nalidixic acid and streptomycin were adapted from those established for Enterobacteriaceae and all other breakpoints were adapted from those established for Staphylococci. (Table 18) (CLSI, 2012b). Three independent biological replicates were completed.      119  Table 18: Antibiotics used for disk diffusion susceptibility testing.1 Antibiotic Abbreviation Amount (μg) E. coli K-12 MG1655 range (mm) S. aureus ATCC 25923 range (mm) L. monocytogenes Resistant (≤mm)2 L. monocytogenes Intermediate (mm)2 L. monocytogenes Sensitive (≥mm)2 Amikacin AMK 30 19-26 20-26 14 15-16 17 Ampicillin AMP 10 16-22 27-35 19 - 20 Cefoxitin FOX 30 23-29 23-29 14 15-17 18 Chloramphenicol CHL 30 21-27 19-26 12 13-17 18 Ciprofloxacin CIP 5 30-40 22-30 15 16-20 21 Clindamycin CLI 2 N/a 24-30 14 15-20 21 Erythromycin ERY 15 N/a 22-30 15 14-22 23 Gentamicin GEN 10 19-26 19-27 12 13-14 15 Imipenem IPM 10 26-32 N/a 13 14-15 16 Kanamycin KAN 30 17-25 19-26 13 14-17 18 Linezolid LZD 30 N/a 25-32 20 - 21 Nalidixic acid NAL 30 22-28 N/a 13 14-18 19 Rifampin RIF 5 8-10 26-34 16 17-19 20 Streptomycin STR 10 12-20 14-22 11 12-14 15 Co-trimoxazole SXT 23.75 23-29 24-32 10 11-15 16 Tetracycline TET 30 18-25 24-30 14 15-18 19 Trimethoprim TMP 5 21-28 19-26 10 11-15 16 Vancomycin3 VAN 5 N/a 17-21 14 - 15 1 All antibiotic disks were supplied by BD, Sparks, MD 2 The clinical breakpoint for ampicillin was established by CLSI for L. monocytogenes. Clinical breakpoints for nalidixic acid and streptomycin were adapted from those established for Enterobacteriaceae and all other breakpoints were adapted from those established for Staphylococci.  3Breakpoints for vancomycin were established using 30 µg disks as opposed to the 5 µg used in this study.   120  4.2.4 Antibiotic resistance as determined by microbroth dilutions   Microbroth dilutions assays were utilized to confirm results in isolates displaying variable sensitivity to select antibiotics, as described in the following. Cultures were streaked from -80°C stocks onto TSA YE and incubated at 37°C overnight. A single colony was then inoculated into 5 ml of TSB and incubated with shaking (180 rpm) for 18±2 hours. Ampicillin (AMP; Sigma-Aldrich, Oakville, ON), rifampicin (RIF; Sigma-Aldrich, Oakville, ON), and vancomycin (VAN; Sigma-Aldrich, Oakville, ON) stocks were made accounting for purity and kept at -20°C until use. Working dilutions were made in Mueller-Hinton broth (MHB; BD Diagnostics, Sparks, MD) at 0, 0.25, 0.5, 1.0, 2.0, and 4.0 µg/ml AMP on the day of testing. A 100 µl aliquot of the overnight broth culture was added to 10 ml of MHB and mixed thoroughly. All cultures were further serially diluted and plated to confirm a starting inoculum of 108 CFU/ml. A multichannel was then used to add 5 µl of diluted culture (105 CFU) to 195 µl of each respective working concentration of ampicillin in a microtitre 96-well plate (Costar, Fisher Scientific, Ottawa, ON). The process was repeated for two technical replicates for each of three independent biological replicates. Microbroth dilutions were incubated at 37°C with shaking for 24 hours. After incubation, the dilution with no visible growth was considered the minimum inhibitory concentration (MIC) (CLSI, 2012a) and technical replicates were averaged using the geometric mean.  4.2.5 Resistance determinant databases   Draft genome assemblies for ST120 L. monocytogenes isolates were uploaded to the Comprehensive Antibiotic Resistance Database (CARD) (McArthur et al., 2013). CARD provides an automated annotation of antibiotic resistance associated determinants and mutations. The output data was compiled and the annotation with the highest bit-score was prioritized when multiple   121  annotations were assigned to a single open reading frame. Any annotations with a percent identity by amino acid sequence of 30% or lower were omitted. The amino acid sequence from the remaining open reading frames were aligned to L. monocytogenes EGD-e (GenBank Accession: NC_003210) using a protein-protein BLAST and the highest similarity open reading frame was identified (Altschul et al., 1990).  4.2.6 Data analysis and statistics   Geometric means were used to best represent the central tendency across multiple independent biological replicates. Resistance was determined as a zone of inhibition below or equal to the breakpoint as outlined in Table 18. For microbroth dilution assays the MIC was defined as the lowest concentration for which no growth of the bacteria was visible. Geometric means were calculated for biological replicates.    122  4.3 Results 4.3.1 Antimicrobial resistance of ST120 L. monocytogenes according to disk diffusions assays     All ST120 (n=21) isolates examined in this study were all found to be sensitive to AMK, GEN, IMP, SXT, TET, and TMP according to the disk diffusion assay (Figure 14). All isolates were found to be sensitive to KAN and STR except for two that were found to have intermediate resistance (Figure 14). Substantial intermediate resistance was seen for chloramphenicol (CHL) and erythromycin (ERY) with nine of the isolates having intermediate resistance to these antibiotics, while all others were susceptible (Figure 14). All isolates had intermediate resistance to ciprofloxacin (CIP) (Figure 14). Four of the isolates were found to be resistant to linezolid (LZD) and one and two were found to be resistant to rifampin and vancomycin, respectively (Figure 14).  AMP resistance was seen in nine of the isolates, with twelve isolates testing sensitive under the given conditions and breakpoints (Figure 14). All isolates tested resistant to cefoxitin (FOX), clindamycin (CLI) and nalidixic acid (NAL) (Figure 14).  The mean and median of the range of zones of inhibition for the distributions of each antibiotic were 4.7 and 4 mm (Table 19). The largest range was found with RIF which had a range of 14 mm, followed by the next highest TMP and SXT which had 8 and 7 mm respectively (Table 19). The minimum range (0 mm) was found with NAL, for which all antibiotics were resistant and no zones of inhibition were detected. AMK, AMP, FOX, CHL, CIP, CLI, ERY, GEN, IMP, KAN, STR, TET, VAN, and LZD all had a range of zones of inhibition between 2 and 6 mm (Table 19). Both RIF and VAN had one observed outlier (Lm 304 and Lm 262, respectively) with smaller zones of inhibition that might indicate an alternative resistance phenotype (Table 19).     123    Figure 14: Breakdown of susceptibility to relevant antibiotics in sequence type 120 Listeria monocytogenes. All results were collected according to Clinical Laboratory Standards Institute guidelines with the appropriate controls used with each replicate (CLSI, 2011).  *AMP, RIF, and VAN sensitivity were determined from the microbroth dilution results.    02468101214161820AMK AMP* FOX CHL CIP CLI ERY GEN IMP KAN NAL RIF* STR SXT TET TMP VAN* LZDNumber of isolatesAntibiotic Sensitive Intermediate Resistant  124  Table 19: Antimicrobial resistance in sequence type 120 Listeria monocytogenes (n=21) as determined by disk diffusion assays.a,b   Number of isolates Avg. (mm)b Med. (mm)  Zone of inhib. (mm) 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 Antibiotic tested AMK            2 3 7 7 2            19 19 AMP             1 8 6 5 1           20 20 FOX   1 13 5 2                      9 9 CHL           1 8 11 1              18 18 CIP           3 8 7 2 1             18 17 CLI      1 4 13 3                   13 13 ERY                 9 10 1 1        23 23 GEN            5 6 3 3 4            19 18 IPM                     1  4 10 4 1 1 29 29 KAN            2 3 7 4 2 2 1          20 19 NAL 21                           6 6 RIF    1          2 7 9 1 1          20 21 STR         2 13 6                 15 15 SXT              1 5 3 4 4 3  1       22 22 TET                2 7 9 3         23 23 TMP                2 3 3 5 4 3   1    24 24 VAN      1   1 9 9 1                15 15 LZD               4 8 6 2 1         21 21 aSusceptibility was determined according to Clinical Laboratory Standards Institute guidelines using the disk diffusion assay and all measurements were taken to the nearest millimeter.  bSusceptibility breakpoints are based on those established by CLSI for L. monocytogenes when available and Staphylococcus or Enterococcus otherwise. A red line indicates a resistance breakpoint and a gray bar indicates intermediate resistance. cThe geometric mean was calculated for three independent biological replicates of each isolate, then rounded to the nearest one tenth millimeter and arithmetic mean was calculated for the sample population.   125  4.3.2 Minimum inhibitory concentration of ampicillin, rifampicin, and vancomycin in ST120 L. monocytogenes    All ST120 L. monocytogenes isolates in this collection reproducibly tested as sensitive to AMP, RIF, and VAN when using microbroth dilutions (Table 20). The collection had MIC values that ranged from ≤0.25 to 0.28 µg/ml AMP and there were no more than a two-fold difference between the MICs of the isolates (Table 20). All MICs for RIF were ≤0.06 µg/ml and MICs for VAN were between 1 to 2 µg/ml with no more than a two-fold difference between the MICs of the isolates (Table 20). These MICs were comparable to that of the L. monocytogenes ATCC 7646 strain, and the control strains (E. coli K-12 MG1655 and S. aureus ATCC 25923) were appropriately within acceptable ranges of sensitivity (Table 20).  Table 20: Minimum inhibitory (MIC) concentrations of ampicillin, rifampicin, and vancomycin for sequence type (ST) 120 Listeria monocytogenes.a Isolate Ampicillin MIC (µg/ml)cd Rifampicin MIC (µg/ml)cd Vancomycin MIC (µg/ml)cd ST120 L. monocytogenes collection <0.25-0.28 <0.06 1-2 L. monocytogenes ATCC 7646 <0.25 <0.06 1 Staphylococcus aureus ATCC 25923b <0.25 <0.06 2 Escherichia coli K-12 MG1566b 2 >1 8 aMICs were determined using microbroth dilution assays at 0, 0.25, 0.5, 1.0, 2.0, and 4.0 µg/ml ampicillin, 0, 0.06, 0.13, 0.25, 0.5, and 1 µg/ml for rifampicin, and 0, 0.5, 1.0, 2.0, 4.0, and 8.0 µg/ml for vancomycin. bControl strains used in disk diffusion assay. cThe geometric mean was used to average MICs across biological replicates and the range was reported for the collection. dAll isolates were considered sensitive to ampicillin, rifampicin, and vancomycin. Susceptibility is based on the Clinical Laboratory Standards International breakpoints for Staphylococci for dilution susceptibility testing (CLSI, 2012b).   126  4.3.3 Analysis antibiotic resistance genes of sequence type 120 L. monocytogenes according to the Comprehensive Antibiotic Resistance Database   All isolates had a hit with high percent identity (>99%) to a quinolone resistance protein NorB (Table 21). The next highest matches for all isolates consisted of DNA gyrases, DNA topoisomerases, and DNA directed RNA polymerases with percent identities ranging from 52.3-79.8% (Table 21). Of the remaining significant matches, multiple open reading frames (ORFs) were detected in the ST120 L. monocytogenes that matched multidrug transporters with similarity up to 58.6% (Table 21). In nineteen isolates a match was found to a rifampin phosphotransferase with a mean percent identity match of 52.1% (Table 21). Low percent identity matches, below 40%, were found for penicillin-binding proteins and tetracycline resistance proteins in 13 and 12 isolates, respectively (Table 21). All identified ORFs by the CARD were compared to L. monocytogenes EGD-e using protein-protein BLASTs and revealed high homology (100% identity with >98% gene coverage), except for the rifampin phosphotransferases which a high percent identity (99%) but over only 58% of the gene (Table 22).      127  Table 21: Principal open reading frames from sequence type 120 Listeria monocytogenes (n=21) associated with antibiotic         resistance.a aThe Comprehensive Antibiotic Resistance Database was used to upload draft whole genome sequences of sequence type 120 L. monocytogenes. bIdentified resistance associated proteins listed here were selected due to high relevance and percent identity. cTotal number of hits exceeds the number of isolate as some isolates returned multiple matches to multidrug transporters. dCalculations are based on the amino acid percent identity returned between the database entry and the homologous region in the uploaded L. monocytogenes. Hits that returned percent identities below 30% were omitted.        Identified resistance associated proteinb Quinolone resistance protein (NorB) DNA gyrases and topoisomerases, and DNA directed RNA polymerases Multidrug transporter Rifampin phosphotransferase Penicillin-binding protein Tetracycline resistance protein Total number of hitsc 21 57 26 19 13 12 Meand 99.6 72.3 57.1 52.1 36.9 36.1 Mediand 99.6 70.5 58.6 52.1 37.0 36.1 Minimumd 99.6 52.3 55.0 52.1 36.7 36.1 Maximumd 100 79.8 58.6 52.3 37.0 36.1   128  Table 22: Homology to Listeria monocytogenes EGD-e of principal open reading frames identified by the Comprehensive Antibiotic Resistance Database for sequence type 120 L. monocytogenes.  aResistance associated proteins were identified from draft sequences of sequence type 120 L. monocytogenes by the Comprehensive Antibiotic Resistance Database. bHomologous open reading frames in L. monocytogenes EGD-e (GenBank Accession: NC_003210) were identified using protein-protein BLASTs (Altschul et al., 1990).Identified resistance associated proteina Quinolone resistance protein (NorB) DNA gyrases  DNA topoisomerases DNA directed RNA polymerases Multidrug transporters Rifampin phosphotransferase Penicillin-binding protein 2’ Tetracycline resistance protein Location in L. monocytogenes EGD-e genomeb Lmo2818 Lmo0646 Lmo0655 Lmo1184 Lmo0919, Lmo0981, Lmo0990, Lmo1617, Lmo1695, Lmo2751, Lmo2752 Lmo0411 Lmo0441 Lmo0406 L. monocytogenes EGD-e annotationb MFS Transporter gyrB DNA gyrase subunit β parE DNA topoisomerase IV subunit β rpoB DNA directed RNA polymerase subunit β Multidrug tranporters and hypothetical proteins Phosphoenolpyruvate synthase D-alanyl-D-alanine carboxypeptidase Tetracycline resistance protein Percent coverageb 99 100 100 99 98-100 58 98 100 Percent identityb 100 100 100 100 100 99 100 100   129  4.4 Discussion 4.4.1 Antibiotic resistance among ST120 L. monocytogenes from the Canadian food chain Though emrE is a putative antimicrobial efflux pump, and contributes to QUAT resistance, no difference was seen in the antibiotic resistance profile of these isolates that could be associated with emrE.  All isolates do have a complete wild-type inlA sequence, as has been shown in the sequenced ST120 strains responsible for the 2008 delicatessen outbreak in Canada, suggesting they do have the capacity for inlA-mediated invasion. Invasion assays are needed to confirm this. The complete antibiogram profiles for this collection of ST120 L. monocytogenes can be found in Table S1.  The commonly prescribed antibiotics for listeriosis include GEN, AMP, and the AMP alternative SXT due to their effectiveness against L. monocytogenes intra- and extracellularly (Hof et al., 1997; Posfay-Barbe and Wald, 2009). While all isolates tested sensitive to GEN and SXT, the detection of any resistant isolates to AMP is concerning. This apparent high prevalence of resistance according to the disk diffusion assay may be misleading, however, as the mean zone of inhibition was 20 mm with a range from 18 to 22 mm and breakpoint for resistance of 19 mm (Table 19). This is a narrow range showing that all isolates have zones of inhibition that cluster close to the breakpoint. Differences in the agar depth (such as the use of an agar overlay) could be shifting the distribution towards more resistant due to decreased diffusion of the antibiotics (CLSI, 2012b). This suggest the results are better used for comparison within the isolates tested, rather than to the breakpoints established.  Microbroth dilution assays were used to further evaluate the MIC of AMP for the collection of ST120 L. monocytogenes. Due to the normal distribution of zones of inhibition for AMP and   130  the lack of significant outliers, MICs were chosen to verify the resistance phenotypes of the collection. Notably, the controls only had zones of inhibition that were smaller than the acceptable range as opposed to larger, suggesting false positives for resistance. The MIC results contradict the disk diffusion results in that all L. monocytogenes from this collection were found to be sensitive to AMP (Table S1). These results are comparable to previously reported AMP MICs (0.06-1.0 µg/ml AMP) for sensitive isolates of the genus Listeria, including L. monocytogenes (Collins et al., 2010; Hof et al., 1997; Troxler et al., 2000).     Resistance was seen for cefoxitin (FOX), clindamycin (CLI), and nalidixic acid (NAL) for all isolates (Figure 14, Table S1)). Both FOX and NAL resistance are not surprising as FOX resistance has been related to low-affinity penicillin binding proteins inherent in L. monocytogenes (Lmo0441) and NAL is commonly used for L. monocytogenes selection (Guinane et al., 2006; Troxler et al., 2000). CLI resistance has been reported to be prevalent among Listeria species and has been linked to the mdrL gene in L. monocytogenes as well as mutations in the ribosomal subunits (Chen et al., 2010; Kovacevic et al., 2013; Mata et al., 2000). Interestingly, both erythromycin and chloramphenicol showed high prevalence of intermediate sensitivity in this collection of L. monocytogenes and mutations in the ribosomal subunits have been shown to cause resistance (Figure 14) (Depardieu et al., 2007). Any cross resistance was not explored in this study however and remains for further evaluation.   LZD is a relevant new antibiotic as an alternative to AMP for meningitis resulting from L. monocytogenes infections (Morosi et al., 2006). Four isolates were found to be resistant to LZD in this study (Figure 14, Table S1). LZD resistance can be caused by mutations to its ribosomal binding site but so far resistance in L. monocytogenes has been rare and unexplored (Kovacevic et al., 2013; Long and Vester, 2012; Morosi et al., 2006). One isolate was found to be resistant to   131  rifampin (RIF) according to the disk diffusion assay (Table 18). Resistance to RIF can also result from mutations in ribosomal subunits, but whether or not this might be related to LZD resistance remains to be further explored. As with the AMP resistance, the inhibition zones for LZD clustered right around the breakpoint of 20 mm (range 20-24 mm) and further testing may be necessary to verify these results. There was one isolate (Lm 304) with resistance to RIF that was also found to be a significant outlier within the zone of inhibition distribution for this antibiotic. Interestingly, when MICs were used to confirm the resistance of this isolate no more than a two-fold difference in MIC was observed within the collection and all isolates were considered sensitive (Table 20, Table S1).  The MICs (<0.06 µg/ml RIF) are comparable to the natural sensitivity that has been previously reported for L. monocytogenes (0.04-0.25 µg/ml and 0.06-0.25 µg/ml RIF) (Hof et al., 1997; Troxler et al., 2000).  Additional resistance was seen for vancomycin (VAN) in two isolates (Figure 14). However, this resistance was determined using the breakpoint established by CLISI for 10 µg VAN disks (CLSI, 2011). Due to the unavailability of this concentration, 5 µg VAN disks were used for comparison of resistance within the collection. It is worth nothing that, even with the decreased amount of VAN, all but two of the tested isolates were sensitive (Table 19). Only one of the VAN resistant isolates (Lm 262) was observed to be an outlier to the distribution of the zones of inhibition for this antibiotic. Lm 262 had a MIC value within two-fold (1-2 µg/ml) of the rest of the collection for VAN and was considered sensitive (Table 20, Table S1)). MICs ranging from 1 to 2 µg/ml for VAN are comparable to the natural sensitivity of L. monocytogenes with reported MICs between 0.12-4 µg/ml (Hof et al., 1997; Troxler et al., 2000). Substantial (9-21 isolates) intermediate resistance was seen for CIP, CHL, and ERY (Figure 14, Table S1)). Notably, all isolates were observed to have intermediate resistance to CIP   132  (Figure 14, Table S1). Previous reports of AMR surveillance are similar with the majority of isolates having intermediate resistance to CIP in a study of L. monocytogenes from BC and inherent intermediate resistance reported for the L. monocytogenes (Kovacevic et al., 2013; Troxler et al., 2000). Resistance to CIP in L. monocytogenes has been related to the increased expression of the efflux pump lde that is widely present in the species (Godreuil et al., 2003; Lismond et al., 2008). Resistance or intermediate resistance to CHL and ERY on the other hand are less frequently reported (Charpentier and Courvalin, 1999; Kovacevic et al., 2013; Troxler et al., 2000). Interestingly, the isolates previously reported to be CHL and ERY resistant were multidrug resistant to CHL, ERY, and TET and carried a conjugative plasmid with genes that are (cat221, ermB, and tetM) associated with resistance to these antibiotics (Hadorn et al., 1993; Poyart-Salmeron et al., 1990). All of the isolates in this study clustered between the intermediate resistance and sensitive breakpoints for CHL and ERY (Table 19). Considering the small range of the zones of inhibition and no observed outliers for CHL and ERY, there is likely no difference in the resistance phenotype for these antibiotics in the isolates of this collection. All isolates were found to be sensitive to TET (Figure 14, Table S1). 4.4.2 ST120 L. monocytogenes from the Canadian food chain lack association with major antibiotic resistance genes  Comparison of the ST120 L. monocytogenes isolates to CARD revealed a pervasive efflux pump (assigned annotation of NorB) with 100% identity that is putatively associated with quinolone resistance. NorB has been characterized in Staphylococus aureus and over expression is associated with increased resistance to quinolones as well as dyes such as ethidium bromide (Truong-bolduc et al., 2005). The presence of related proteins in L. monocytogenes may contribute to resistance, both published and observed, to the first generation quinolone NAL in addition to   133  the intermediate resistance seen for CIP. Further research is necessary to explore this, but BLASTp searches revealed 100% homology over 99% of the sequence to L. monocytogenes EGD-e Lmo2818. Lmo2818 is annotated as a major facilitator superfamily transporter, but is otherwise uncharacterized. The next highest ranking hits for all isolates were matches to either DNA topoisomerases or gyrases and DNA directed RNA polymerases. These had high percent identities (60-70%) to resistance proteins within CARD, but could be due to conserved domains within these ubiquitous proteins. CARD identifies these sequences as mutations in other organisms have been related to antibiotic resistance, however the ORFs identified here appear to be homogeneous in this collection of ST120 L. monocytogenes as well as EGD-e (Table 22). Mutations in the amino acid sequence of topoisomerases and gyrases have been shown to contribute to quinolone resistance which could, alongside NorB, contribute to the inherent resistance of L. monocytogenes to select antibiotics of this class (Lampidis et al., 2002). Again, further research is necessary to explore this, but BLASTp searches revealed 100% homology over 100% of the sequence to published L. monocytogenes EGD-e gyrB and parE. While it is not known to what extent NorB and these possible mutations in either DNA topoisomerases or gyrases may contribute to quinolone resistance, the phenotypic results for this collection reveled all isolates were resistance to NAL and had intermediate resistance to CIP. The high homology between the open reading frames identified and those present in L. monocytogenes EGD-e indicates these sequences are not uncharacteristic for L. monocytogenes.   Of the remaining hits that met the minimum percent identity criteria (30%), the most relevant proteins identified were multidrug transporters, rifampin phosphotransferases, penicillin binding proteins, and tetracycline resistance proteins. For each of these categories the percent identity was highly similar between all isolates, suggesting that the database was identifying   134  similar or identical regions in all of the isolates (Table 21). The multidrug transporters had the highest percent identity (maximum 59%), and comparison to L. monocytogenes EGD-e showed 98-100% identity to a variety of uncharacterized multidrug transporters and hypothetical proteins (Table 21, 22). The involvement of these proteins in antibiotic resistance is, as of yet, unknown, but the high similarity to open reading frames in L. monocytogenes EGD-e suggest they are not unique to this collection.  Rifampicin phosphotransferases are associated with low level resistance to rifampicin, whereas high level resistance is associated with mutations in subunit β of DNA directed RNA polymerases (Goldstein, 2014). The rifampin phosphotransferases identified by CARD had a maximum percent identity of 52% and when compared to L. monocytogenes EGD-e were only 99% similar across 58% of the sequence for this protein (Table 21, 22). This is in contrast to the alignment of other identified resistance open reading frames to L. monocytogenes EGD-e due to the low coverage (58% vs ca 100%). However, a broadened BLASTp search of all Listeria monocytogenes available in GenBank releaved 100% identity over 100% of the sequence to phospholenolpyruvate synthase of L. monocytogenes strains other than EGD-e. Differences between the rifampicin phophotransferase identified by CARD and the phosphoenolpyruvate synthase in L. monocytogenes species were not explored in this study, but no association could be made between the detection of any of the rifampin phosphotransferases and phenotypic resistance to any of the antibiotics tested.  The penicillin binding protein and tetracycline resistance protein hits were only identified in 13 and 12 of the isolates respectively, with below 40% identify for both (Table 20). As discussed above, low affinity penicillin binding proteins can be found in L. monocytogenes. When compared to L. monocytogenes EGD-e, all identified penicillin binding proteins matched Lmo0441 with   135  100% identity over 98% of the sequence (Table 22). Lm0441 has been suggested to be involved in the inherent resistance of L. monocytogenes to β-lactams (Guinane et al., 2006). Insertional mutagenesis of this gene revealed a two-fold decrease in penicillin MIC and up sixteen-fold decrease in cephalosporin MICs compared to the wild-type EGD-e. The contribution of this penicillin binding protein to the observed MICs to AMP in this collection was not explored, but the isolates remain sensitive. Further research is necessary to understand the relevance of the tetracycline resistance protein hit, but the percent identity was low and phenotypic data did not reveal any TET resistant L. monocytogenes isolates (Figure 14). 4.5 Future studies and significance   This collection of ST120 L. monocytogenes from Canada are susceptible to the relevant clinical antibiotics (AMP, GEN, SXT) and the significant resistance and intermediate resistance that has been seen (NAL, CLI, FOX, CIP, LZD) is in line with previous reports. Intermediate resistance was observed for ERY and CHL that is not associated with any resistance determinants found in the Comprehensive Antibiotic Resistance Database and as of yet requires further research. While ST120 L. monocytogenes have been the pervasive sequence type responsible for listeriosis in Canada for the past two decades, these results indicate early antibiotic treatment should hopefully remain effective.       136  Chapter 5: Conclusion   With an aging population and increasing demand for minimally processed foods, the risk of L. monocytogenes remains a food safety concern. Though listeriosis has been most frequently associated with ready-to-eat meats and dairy products, recent significant outbreaks have occurred in North America caused by minimally processed produce that were contaminated with L. monocytogenes. The ubiquitous nature of L. monocytogenes in agricultural environments may contribute to the contamination of minimally processed foods. In the absence of a process kill step, L. monocytogenes characteristics that may contribute to survival in the agricultural or food processing environment are of interest to the food protection community. Resistance to sanitizers may increase persistence in the processing facility and resistance to heavy metals may allow for increased survival in agricultural environments. Additionally, while emphasis should always remain on prevention of disease rather than treatment, surveillance of L. monocytogenes for changes in antibiotic susceptibility allow for early awareness of decreased antibiotic effectiveness in the event of a listeriosis outbreak.  A collection of L. monocytogenes (n=46) isolated from the British Columbia food chain remain susceptible to recommended use concentrations of the food processing sanitizers triclosan, peroxyacetic acid, and quaternary ammonium compounds (QUATs). These chemicals are frequently used for limiting the survival and persistence of food borne pathogens on processing equipment that might be involved in washing or packaging of even minimally processed foods. The susceptibility of this collection of L. monocytogenes is encouraging for maintaining control through the appropriate use of these chemical agents. QUATs, however, have the potential to remain at low concentration in residues on hard-to-reach places when applied in a no-rinse method.   137  Seventeen of the L. monocytogenes isolates from British Columbia were resistant to QUATs from 15-20 µg/ml compared to the natural sensitivity of 2-5 µg/ml for the remaining isolates. Similar resistance has been noticed in previous publications and was associated with the characterized resistance determinants bcrABC and emrE. With a minimum inhibitory concentration (MIC) of no more than 25 µg/ml, this resistance is still 8-32 fold lower than the recommended use concentrations for QUATs. However, it does suggest there are strains of L. monocytogenes that may be able to better survive low concentration residual QUATs that may remain in processing facilities. This is the first report of bcrABC detected within L. monocytogenes from the food chain in Canada.  There is a high prevalence of cadmium (89%) and arsenic (24%) resistance in L. monocytogenes isolated from British Columbia. All of the bcrABC positive isolates that tested resistant to QUATs were also found to be resistant to cadmium. The high prevalence of L. monocytogenes resistant to these metals is in alignment with previous observations in the literature. While the prevalence of cadmium and arsenic resistance has been used for subtyping L. monocytogenes, no studies have examined the benefit to L. monocytogenes in terms of growth under comparable environmental exposure conditions. Due to the association between QUAT and cadmium resistance that has been previously published and similarly observed in this report, cadmium was focused on for the remaining studies. Cadmium sensitive isolates showed reduced growth rates and reduced maximum cell densities in the presence of sub-lethal cadmium chloride (1 µg/ml) compared to cadmium resistant isolates. An additive effect was seen between decreasing pH and increasing cadmium concentration that produced a MIC in a representative cadmium sensitive L. monocytogenes but not a representative cadmium resistant L. monocytogenes. Taken in the context of an average 0.8 µg/g of cadmium in British Columbia soils, cadmium may select   138  for increased prevalence of cadmium and the associated QUAT resistant L. monocytogenes over time. However, log phase growth of bacteria is rare in agriculture environments and further survival studies in soil systems should verify these results. Additionally, two of the sixteen QUAT and cadmium resistant L. monocytogenes were able to co-transfer this resistance to recipient L. monocytogenes, suggesting horizontal transmission may allow for increased spread of resistance to both QUATs and cadmium. When QUAT resistance (bcrABC+) was transferred to an already QUAT resistant (emrE+) L. monocytogenes, no further increase in MIC was observed. This suggests there is limited potential for elevated resistance to QUATs in L. monocytogenes that is mediated by these resistance transporters. The benefit of being positive for both emrE and bcrABC to L. monocytogenes in sub-lethal environments of QUATs in terms of increased growth rate or attachment to QUAT residue coated surfaces remains to be explored.   A collection of sequence type (ST) 120 L. monocytogenes (n=21) from British Columbia and Alberta, Canada remain sensitive to the commonly prescribed antimicrobials for the treatment of listeriosis. ST 120 L. monocytogenes are clinically relevant L. monocytogenes as they are part of the clonal complex 8 that has been responsible for the majority of listeriosis cases in Canada since the late 1980’s. While these ST 120 L. monocytogenes are not associated with any known cases of disease, they were isolated from the food chain. Characteristics of ST 120 L. monocytogenes that may contribute to their over representation in clinical cases within Canada are unknown, but surveillance of their antibiotic resistance in this study reveals similar antibiotic resistance patterns within ST 120 and to reported natural sensitivity of L. monocytogenes.   There are significant factors that influence L. monocytogenes all along the farm to fork continuum. This report has been the first to examine the survival of L. monocytogenes to environmentally comparable cadmium exposure, the conjugative co-transfer of cadmium and   139  QUAT resistance from L. monocytogenes to the L. monocytogenes 08-5578 recipient strain, the combined effect of multiple QUAT resistance determinants in L. monocytogenes, and the antibiotic sensitivity of the clinically relevant ST 120 L. monocytogenes. Further studies are needed to fully understand the impact of environmental exposure to heavy metals on the long term prevalence of L. monocytogenes, the benefit to persistence of QUAT resistance, and the clinical success of ST 120 L. monocytogenes. This work expands the scientific community’s understanding of a pathogen that is ubiquitous in the farm, persistent in food processing, and often fatal in disease.          140  References  Aarestrup, F., Knochel, S., Hasman, H., 2007. Antimicrobial susceptibility of Listeria monocytogenes from food products. Foodborne Pathog. Dis. 4, 216–221. Acton, D. and Gregorich, L., 1995. The health of our soils: towards sustainable agriculture in Canada. Centre for Land and Biological Resources Research, Research Branch, Agriculture and Agri-Food Canada. Ottawa, Ontario. Allen, K.J., Wałecka-Zacharska, E., Chen, J.C., Katarzyna, K.-P., Devlieghere, F., Van Meervenne, E., Osek, J., Wieczorek, K., Bania, J., 2014. Listeria monocytogenes – An examination of food chain factors potentially contributing to antimicrobial resistance. Food Microbiol.  Alloway, B., 1995. Heavy metals in soils, 2nd ed. Blackie Academic & Professional, London. 140-151. Althaus, D., Lehner, A., Brisse, S., Maury, M., Tasara, T., Stephan, R., 2014. Characterization of Listeria monocytogenes strains isolated during 2011–2013 from Human Infections in Switzerland. Foodborne Pathog. Dis. 11, 753–758.  Altschul, S., Gish, W., Miller, W., Myers, E., Lipman, D., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Angelidis, A.S., Smith, G.M., 2003. Role of the glycine betaine and carnitine transporters in adaptation of Listeria monocytogenes to chill stress in defined medium. Appl. Environ. Microbiol. 69, 7492–7498. Annous, B.A., Becker, L.A., Bayles, D.O., Labeda, D.P., Wilkinson, B.J., 1997. Critical role of anteiso-C15:0 fatty acid in the growth of Listeria monocytogenes at low temperatures. Appl. Environ. Microbiol. 63, 3887–3894. Arguedas-Villa, C., Kovacevic, J., Allen, K.J., Stephan, R., Tasara, T., 2014. Cold growth behaviour and genetic comparison of Canadian and Swiss Listeria monocytogenes strains associated with the food supply chain and human listeriosis cases. Food Microbiol. 40, 81–87.  Arguedas-Villa, C., Stephan, R., Tasara, T., 2010. Evaluation of cold growth and related gene transcription responses associated with Listeria monocytogenes strains of different origins. Food Microbiol. 27, 653–660.  Aureli, P., Fiorucci, G., Caroli, D., Marchiaro, G., Novara, O., Leone, L., Salmaso, S., 2000. An outbreak of febrile gastroenteritis associated with corn contaminated by Listeria monocytogenes. N. Engl. J. Med. 342, 1236–1241.   141  Aziz, R.K., Bartels, D., Best, A.A., DeJongh, M., Disz, T., Edwards, R.A., Formsma, K., Gerdes, S., Glass, E.M., Kubal, M., Meyer, F., Olsen, G.J., Olson, R., Osterman, A.L., Overbeek, R.A., McNeil, L.K., Paarmann, D., Paczian, T., Parrello, B., Pusch, G.D., Reich, C., Stevens, R., Vassieva, O., Vonstein, V., Wilke, A., Zagnitko, O., 2008. The RAST Server: rapid annotations using subsystems technology. BMC Genomics 9, 75.  Baranyi, J., Roberts, T., 1994. A dynamic approach to predicting bacterial growth in food. Int. J. Food Microbiol. 23, 277–294. Bayles, D.O., Wilkinson, B.J., 2000. Osmoprotectants and cryoprotectants for Listeria monocytogenes. Lett. Appl. Microbiol. 30, 23–27.  British Columbia Ministry of Agriculture, 2001. Soil factsheet; soil pH. http://www.agf.gov.bc.ca/ resmgmt/publist/600Series/637100-1.pdf British Columbia Ministry of the Environment, 2005. Technical guidance on contaminated sites; soil quality database. http://www.env.gov.bc.ca/epd/remediation/guidance/technical/pdf /tg17.pdf Beauregard, B.K.E., Lee, K., Collier, R.J., Swanson, J.A., 1997. Listeriolysin O from Listeria monocytogenes. October 186, 1159–1163. Becker, L.A., Cetin, M.S., Hutkins, R.W., Benson, A.K., 1998. Identification of the gene encoding the alternative sigma factor σB from Listeria monocytogenes and its role in osmotolerance. J. Bacteriol. 180, 4547–4554. Becker, L.A., Evans, S.N., Hutkins, R.W., Benson, A.K., 2000. Role of σB in adaptation of Listeria monocytogenes to growth at low temperature. J. Bacteriol. 182, 7083–7087.  Becroft, D.M., Farmer, K., Seddon, R.J., Sowden, R., Stewart, J.H., Vines, A., Wattie, D.A., 1971. Epidemic listeriosis in the newborn. Br. Med. J. 3, 747–751.  Begley, M., Hill, C., Ross, R.P., 2006. Tolerance of Listeria monocytogenes to cell envelope-acting antimicrobial agents is dependent on SigB. Appl. Environ. Microbiol. 72, 2231–2234. Bergholz, T.M., den Bakker, H.C., Fortes, E.D., Boor, K.J., Wiedmann, M., 2010. Salt stress phenotypes in Listeria monocytogenes vary by genetic lineage and temperature. Foodborne Pathog. Dis. 7, 1537–1549.  Brandt, A.L., Castillo, A., Harris, K.B., Keeton, J.T., Hardin, M.D., Taylor, T.M., 2010. Inhibition of Listeria monocytogenes by food antimicrobials applied singly and in combination. J. Food Sci. 75. Branen, J.K., Davidson, P.M., 2004. Enhancement of nisin, lysozyme, and monolaurin antimicrobial activities by ethylenediaminetetraacetic acid and lactoferrin. Int. J. Food Microbiol. 90, 63–74.   142  Braun, L., Cossart, P., 2000. Interactions between Listeria monocytogenes and host mammalian cells. Microbes Infect. 2, 803–811. Braun, L., Ohayon, H., Cossart, P., 1998. The InlB protein of Listeria monocytogenes is sufficient to promote entry into mammalian cells. Mol. Microbiol. 27, 1077–1087.  Camejo, A., Buchrieser, C., Couvé, E., Carvalho, F., Reis, O., Ferreira, P., Sousa, S., Cossart, P., Cabanes, D., 2009. In vivo transcriptional profiling of Listeria monocytogenes and mutagenesis identify new virulence factors involved in infection. PLoS Pathog. 5. e1000449.  Camilloto, G.P., Pires, A.C.S., Soares, N.D.F.F., Araújo, E.A.., Andrade, N.J., Ferreira, S.O., 2010. Effect of active packaging incorporated with triclosan on bacteria adhesion. J. Food Sci. 75. 557-564.  Carpentier, B., Cerf, O., 2011. Review - Persistence of Listeria monocytogenes in food industry equipment and premises. Int. J. Food Microbiol. 145, 1–8.  Carrington, C.D., Murray, C., Tao, S., 2013. A Quantitative Assessment of Inorganic Arsenic in Apple Juice. Center for Food Safety and Applied Nutrition, U.S. Food and Drug Administration. 32. http://www.fda.gov/downloads/Food/FoodScienceResearch/ RiskSafety Assessment/UCM360016.pdf  Canadian Council of Ministers of the Environment, 1999. Canadian Soil Quality Guidelines for the Protection of Environmental and Human Health - Cadmium. 9. http://ceqg-rcqe.ccme.ca/download/en/261 Canadian Council of Ministers of the Environment, 1997. Canadian soil quality guidelines for the protection of environmental and human health - Arsenic (inorganic) 7. http://ceqg-rcqe.ccme.ca/download/en/257 Centers for Disease Control and Prevention, 2015a. Multistate outbreak of listeriosis linked to commercially produced, prepackaged caramel apples made from Bidart Bros. Apples.  http://www.cdc.gov/listeria/outbreaks/caramel-apples-12-14/index.html Centers for Disease Control and Prevention, 2015b. Wholesome Soy Products , Inc. sprouts and investigation of human listeriosis cases. http://www.cdc.gov/listeria/outbreaks/bean-sprouts-11-14/index.html Centers for Disease Control and Prevention, 2015c. Overview of attribution of foodborne illness. http://www.cdc.gov/foodborneburden/attribution/overview.html Centers for Disease Control and Prevention, 2011. Multistate outbreak of listeriosis linked to whole cantaloupes from Jensen Farms, Colerado  http://www.cdc.gov/listeria/outbreaks/ cantaloupes-jensen-farms/index.html   143  Chapin, T.K., Nightingale, K.K., Worobo, R.W., Wiedmann, M., Strawn, L.K., 2014. Geographical and meteorological factors associated with isolation of Listeria species in New York State produce production and natural environments. J. Food Prot. 77, 1919–1928.  Charpentier, E., Courvalin, P., 1999. Antibiotic resistance in Listeria spp. Antimicrob. Agents Chemother. 43, 2103–2108. Chen, B.Y., Pyla, R., Kim, T.J., Silva, J.L., Jung, Y.S., 2010. Antibiotic resistance in Listeria species isolated from catfish fillets and processing environment. Lett. Appl. Microbiol. 50, 626–632.  Chenal-Francisque, V., Lopez, J., Cantinelli, T., Caro, V., Tran, C., Leclercq, A., Lecuit, M., Brisse, S., 2011. Worldwide distribution of major clones of Listeria monocytogenes. Emerg. Infect. Dis. 17, 1110–1112.  Chico-Calero, I., Suárez, M., González-Zorn, B., Scortti, M., Slaghuis, J., Goebel, W., Vázquez-Boland, J. a, 2002. Hpt, a bacterial homolog of the microsomal glucose- 6-phosphate translocase, mediates rapid intracellular proliferation in Listeria. Proc. Natl. Acad. Sci. U. S. A. 99, 431–436. Chou, H.H., Delaney, N.F., Draghi, J.A., Marx, C.J., 2014. Mapping the fitness landscape of gene expression uncovers the cause of antagonism and sign epistasis between adaptive mutations. PLoS Genet. 10. e1004149. Christensen, E.G., Gram, L., Kastbjerg, V.G., 2011. Sublethal triclosan exposure decreases susceptibility to gentamicin and other aminoglycosides in Listeria monocytogenes. Antimicrob. Agents Chemother. 55, 4064–4071. doi:10.1128/AAC.00460-11 Clark, C.G., Farber, J., Pagotto, F., Ciampa, N., Doré, K., Nadon, C., Bernard, K., Ng, L.K., 2010. Surveillance for Listeria monocytogenes and listeriosis, 1995-2004. Epidemiol. Infect. 138, 559–572. Clinical Laboratory Standards International, 2012a. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Ninth Edition (M07-A9). Wayne, PA. Clinical Laboratory Standards International, 2012b. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Second Informational Supplement (M100-S22). Wayne, PA. Collins, B., Curtis, N., Cotter, P.D., Hill, C., Ross, R.P., 2010. The ABC transporter AnrAB contributes to the innate resistance of Listeria monocytogenes to nisin, bacitracin, and various β-lactam antibiotics. Antimicrob. Agents Chemother. 54, 4416–4423.     144  Conte, M.P., Petrone, G., Maria, A., Biase, D., Longhi, C., Penta, M., Tinari, A., Fabozzi, G., Visca, P., Seganti, L., Superti, F., 2002. Effect of acid adaptation on the fate of Listeria monocytogenes in THP-1 human macrophages activated by gamma interferon 70, 4369–4378.  Corbett, D., Schuler, S., Glenn, S., Andrew, P.W., Cavet, J.S., Roberts, I.S., 2011. The combined actions of the copper-responsive repressor CsoR and copper-metallochaperone CopZ modulate CopA-mediated copper efflux in the intracellular pathogen Listeria monocytogenes. Mol. Microbiol. 81, 457–472.  Cossart, P., 2002. Molecular and cellular basis of the infection by Listeria monocytogenes: an overview. Int. J. Med. Microbiol. 291, 401–409. Cotter, P.D., Gahan, C.G.M., Hill, C., 2001. A glutamate decarboxylase system protects Listeria monocytogenes in gastric fluid. Mol. Microbiol. 40, 465–475.  Cummins, A., Fielding, A., McLauchlin, J., 1994. Listeria ivanovii infection in a patient with AIDS. J. Infect. 28, 89–91. Dan, S.D., Tabaran, A., Mihaiu, L., Mihaiu, M., 2015. Antibiotic susceptibility and prevalence of foodborne pathogens in poultry meat in Romania. J. Infect. Dev. Ctries. 9.  Darling, A.C.E., Mau, B., Blattner, F.R., Perna, N.T., 2004. Mauve : Multiple Alignment of Conserved Genomic Sequence With Rearrangements. Genome Res. 14. 1394–1403. De las Heras, A., Cain, R.J., Bielecka, M.K., Vázquez-Boland, J.A., 2011. Regulation of Listeria virulence: PrfA master and commander. Curr. Opin. Microbiol. 14, 118–127. Den Bakker, H.C., Cummings, C.A., Ferreira, V., Vatta, P., Orsi, R.H., Degoricija, L., Barker, M., Petrauskene, O., Furtado, M.R., Wiedmann, M., 2010. Comparative genomics of the bacterial genus Listeria: Genome evolution is characterized by limited gene acquisition and limited gene loss. BMC Genomics 11, 688.  Den Bakker, H.C., Manuel, C.S., Fortes, E.D., Wiedmann, M., Nightingale, K.K., 2013. Genome sequencing identifies Listeria fleischmannii subsp. coloradonensis subsp. nov., isolated from a ranch. Int. J. Sys. Evol. Microb. 63, 3257–3268. Depardieu, F., Podglajen, I., Leclercq, R., Collatz, E., Courvalin, P., 2007. Modes and modulations of antibiotic resistance gene expression. Clin. Microbiol. Rev. 20, 79–114.  Domínguez, M.T., Madrid, F., Marañón, T., Murillo, J.M., 2009. Cadmium availability in soil and retention in oak roots: Potential for phytostabilization. Chemosphere 76, 480–486.  Dowe, M., Jackson, E., Mori, J., Colin, B., 1997. Listeria monocytogenes survival in soil and incidence in agricultural soils. J. Food Prot. 10, 1158–1286.   145  Dramsi, S., Biswas, I., Maguin, E., Braun, L., Mastroeni, P., Cossart, P., 1995. Entry of Listeria monocytogenes into hepatocytes requires expression of Inlb, a surface protein of the internalin multigene family. Mol. Microbiol. 16, 251–261. Duché, O., Trémoulet, F., Glaser, P., Labadie, J., 2002. Salt stress proteins induced in Listeria monocytogenes. Appl. Environ. Microbiol. 68, 1491–1498.  Duché, O., Trémoulet, F., Namane, a, Labadie, J., 2002a. A proteomic analysis of the salt stress response of Listeria monocytogenes. FEMS Microbiol. Lett. 215, 183–188. Dutta, V., Elhanaf, D., Kathariou, S., 2013. Conservation and distribution of the benzalkonium chloride resistance cassette bcrABC in Listeria monocytogenes. Appl. Environ. Microbiol. 79, 6067–6074. Ebe, Y., Hasegawa, G., Takatsuka, H., Umezu, H., Mitsuyama, M., Arakawa, M., Mukaida, N., Naito, M., 1999. The role of Kupffer cells and regulation of neutrophil migration into the liver by macrophage inflammatory protein-2 in primary listeriosis in mice. Pathol. Int. 49, 519–532. Epsilon Chemicals Ltd., 2008. Perox-E Technical Data. Edmonton, Alberta. http://www.echem.ca/ Elhanafi, D., Dutta, V., Kathariou, S., 2010. Genetic characterization of plasmid-associated benzalkonium chloride resistance determinants in a Listeria monocytogenes strain from the 1998-1999 outbreak. Appl. Environ. Microbiol. 76, 8231–8238. Elzanowska, H., Wolcott, R.G., Hannum, D.M., Hurst, J.K., 1995. Bactericidal properties of hydrogen peroxide and copper or iron-containing complex ions in relation to leukocyte function. Free Radic. Biol. Med. 18, 437–449. Ermolenko, D.N., Makhatadze, G.I., 2002. Bacterial cold-shock proteins. Cell. Mol. Life Sci. 59, 1902–1913.  Evans, J., Allen, A., Stinson, D., Bortolussi, R., L, P., 1985. Perinatal listeriosis: report of an outbreak. Peditric Infect. Dis. 4, 237–241. Fang, J.L., Stingley, R.L., Beland, F.A., Harrouk, W., Lumpkins, D.L., Howard, P., 2010. Occurrence, efficacy, metabolism, and toxicity of triclosan. J. Environ. Sci. Health. 28, 147–171.  Farber, J.M., Ross, W.H., Harwig, J., 1996. Health risk assessment of Listeria monocytogenes in Canada. Int. J. Food Microbiol. 30, 145–156.  Food and Drug Administration, 2014. Wawona Packing Co. takes precautionary step of voluntarily recalling fresh, whole peaches, plums, nectarines, and pluots because of possible health risk. http://www.fda.gov/Safety/Recalls/ucm405943.htm   146  Food and Drug Administration, 2003. Quantitative assessment of relative risk to public health from foodborne Listeria monocytogenes among selected categories of ready-to-eat foods. http://www.fda.gov/downloads/Food/FoodScienceResearch/UCM197330.pdf Ferreira, A., Byrne, C.P.O., Boor, K.J., 2001. Role of σB in heat, ethanol, acid, and oxidative stress resistance and during carbon starvation in Listeria monocytogenes. Appl Env. Microbiol 67, 4454–57.  Ferreira, V., Wiedmann, M., Teixeira, P., Stasiewicz, M.J., 2014. Listeria monocytogenes persistence in food-associated environments: epidemiology, strain characteristics, and implications for public health. J. Food Prot. 77, 150–70.  Fisher, D.J., Yonkos, L.T., Staver, K.W., 2015. Environmental concerns of roxarsone in broiler poultry feed and litter in Maryland, USA. Environ. Sci. Technol. 49, 1999-2012. Fones, H., Preston, G.M., 2013. The impact of transition metals on bacterial plant disease. FEMS Microbiol. Rev. 37, 495–519.  Fox, E., O’Mahony, T., Clancy, M., Dempsey, R., O’Brien, M., Jordan, K., 2009. Listeria monocytogenes in the Irish dairy farm environment. J. Food Prot. 72, 1450–1456. Freitag, N.E., Rong, L., Portnoy, D.A., 1993. Regulation of the prfA transcriptional activator of Listeria monocytogenes: Multiple promoter elements contribute to intracellular growth and cell-to-cell spread. Infect. Immun. 61, 2537–2544. Fronzes, R., Christie, P.J., Waksman, G., 2009. The structural biology of type IV secretion systems. Nat. Rev. Microbiol. 7, 703–714.  Gaillard, J.L., Berche, P., Mounier, J., Richard, S., Sansonetti, P., 1987. In vitro model of penetration and intracellular growth of Listeria monocytogenes in the human enterocyte-like cell line Caco-2. Infect. Immun. 55, 2822–2829. Galinski, E. a., Stein, M., Amendt, B., Kinder, M., 1997. The kosmotropic (structure-forming) effect of compensatory solutes. Comp. Biochem. Physiol. 117, 357–365. Gandhi, M., Chikindas, M.L., 2007. Listeria: A foodborne pathogen that knows how to survive. Int. J. Food Microbiol. 113, 1–15.  Garcia, E., DePaz, M., Rodriquez, J., Gaya, P., Medina, M., Nunez, M., 1996. Exogenous sources of Listeria contamination in raw ewe’s milk. J. Food Prot. 59, 950–954. Garner, M.R., Njaa, B.L., Wiedmann, M., Boor, K.J., 2006. Sigma B contributes to Listeria monocytogenes gastrointestinal infection but not to systemic spread in the guinea pig infection model. Infect. Immun. 74, 876–886.   147  Gaul, L.K., Farag, N.H., Shim, T., Kingsley, M.A., Silk, B.J., Hyytia-Trees, E., 2013. Hospital-acquired listeriosis outbreak caused by contaminated diced celery - Texas, 2010. Clin. Infect. Dis. 56, 20–26.  Gedde, M.M., Higgins, D.E., Tilney, L.G., Portnoy, D.A., 2000. Role of listeriolysin O in cell-to-cell spread of Listeria monocytogenes. Infect. Immun. 68, 999–1003.  Gilbert, P., Al-Taae, A., 1985. Antimicrobial activity of some alkyltrimethylammonium bromides. Lett. Appl. Microbiol. 1, 101–104. Gillespie, I.A., McLauchlin, J., Grant, K.A., Little, C.L., Mithani, V., Penman, C., Lane, C., Regan, M., 2006. Changing pattern of human listeriosis, England and Wales, 2001-2004. Emerg. Infect. Dis. 12, 1361–1366. Gilmour, M.W., Graham, M., Van Domselaar, G., Tyler, S., Kent, H., Trout-Yakel, K.M., Larios, O., Allen, V., Lee, B., Nadon, C., 2010. High-throughput genome sequencing of two Listeria monocytogenes clinical isolates during a large foodborne outbreak. BMC Genomics 11.  Glaser, P., Frangeul, L., Buchrieser, C., Rusniok, C., Amend, A., Baquero, F., Berche, P., Bloecker, H., Brandt, P., Chakraborty, T., Charbit, A., Chetouani, F., Couvé, E., de Daruvar, A., Dehoux, P., Domann, E., Domínguez-Bernal, G., Duchaud, E., Durant, L., Dussurget, O., Entian, K.D., Fsihi, H., García-del Portillo, F., Garrido, P., Gautier, L., Goebel, W., Gómez-López, N., Hain, T., Hauf, J., Jackson, D., Jones, L.M., Kaerst, U., Kreft, J., Kuhn, M., Kunst, F., Kurapkat, G., Madueno, E., Maitournam, A., Vicente, J.M., Ng, E., Nedjari, H., Nordsiek, G., Novella, S., de Pablos, B., Pérez-Diaz, J.C., Purcell, R., Remmel, B., Rose, M., Schlueter, T., Simoes, N., Tierrez, A., Vázquez-Boland, J.A., Voss, H., Wehland, J., Cossart, P., 2001. Comparative genomics of Listeria species. Science 294, 849–852. Goldstein, B.P., 2014. Resistance to rifampicin: a review. J. Antibiot. 67, 625–630.  Grant, C.A., 2011. Influence of phosphate fertilizer on cadmium in agricultural soils and crops. Pedologist 54, 143–155. Grant, C.A., Sheppard, S.C., 2008. Fertilizer impacts on cadmium availability in agricultural soils and crops. Hum. Ecol. Risk Assess. Int. J. 14, 210–228.  Graves, L.M., Swaminathan, B., 2007. Chapter 9: Subtyping Listeria monocytogenes, in: Listeria, listeriosis, and food safety, Third. ed.  Gray, M.L., Killinger, A.H., 1966. Listeria monocytogenes and listeric infections. Bacteriol. Rev. 30, 309–382. Guinane, C.M., Cotter, P.D., Ross, R.P., Hill, C., 2006. Contribution of penicillin-binding protein homologs to antibiotic resistance, cell morphology, and virulence of Listeria monocytogenes EGD-e. Antimicrob. Agents Chemother. 50, 2824–2828.    148  Hadorn, K., Hachler, H., Schaffner, A., Kayser, F., 1993. Genetic characterization of plasmid-encoded multiple antibiotic resistance in a strain of Listeria monocytogenes causing endocarditis. Eur. J. Clin. Microbiol. Infect. Dis. 12, 928–937. Hain, T., Chatterjee, S.S., Ghai, R., Kuenne, C.T., Billion, A., Steinweg, C., Domann, E., Kärst, U., Jänsch, L., Wehland, J., Eisenreich, W., Bacher, A., Joseph, B., Schär, J., Kreft, J., Klumpp, J., Loessner, M.J., Dorscht, J., Neuhaus, K., Fuchs, T.M., Scherer, S., Doumith, M., Jacquet, C., Martin, P., Cossart, P., Rusniock, C., Glaser, P., Buchrieser, C., Goebel, W., Chakraborty, T., 2007. Pathogenomics of Listeria spp. Int. J. Med. Microbiol. 297, 541–557. Harvey, J. and Gilmour, A., 2001. Characterization of Recurrent and Sporadic Listeria monocytogenes Isolates from Raw Milk and Nondairy Foods by Pulsed-Field Gel Electrophoresis, Monocin Typing, Plasmid Profiling, and Cadmium and Antibiotic Resistance Determination. Appl. Enviro. Microbio. 67, 840–847. Health Canada, 2011. Policy on Listeria monocytogenes in Ready-to-Eat Foods. http://www.hc-sc.gc.ca/fn-an/alt_formats/pdf/legislation/pol/policy_listeria_monocytogenes_2011-eng.pdf Health Canada, 1994. Cadmium and its compounds, Canadian Environmental Protection Act: Priority substances list assessment report. http://www.hc-sc.gc.ca/ewh-semt/alt_formats/ hecs-sesc/pdf/pubs/contaminants/psl1-lsp1/cadmium_comp/cadmium_comp-eng.pdf Hof, H., Nichterlein, T., Kretschmar, M., 1997. Management of listeriosis. Clin. Microbiol. Rev. 10, 345–357. Hutchison, M.L., Walters, L.D., Moore, a, Crookes, K.M., Avery, S.M., 2004. Effect of Length of time before incorporation on survival of pathogenic bacteria present in livestock wastes applied to agricultural soil effect of length of time before incorporation on survival of pathogenic bacteria present in livestock wastes. Appl. Environ. Microbiol. 70, 5111–5118.  Hutchison, M.L., Walters, L.D., Moore, T., Thomas, D.J.I., Avery, S.M., 2005. Fate of pathogens present in livestock wastes spread onto fescue plots. Appl. Environ. Microbiol. 71, 691–696.  Jackson, A., Alloway, B., 1992. Transfer of cadmium from soils to the human food chain, in Adriano, D.C. Biogeochem. Trace Met. 109–158. Jacquet, C., Doumith, M., Gordon, J.I., Martin, P.M. V, Cossart, P., Lecuit, M., 2004. A molecular marker for evaluating the pathogenic potential of foodborne Listeria monocytogenes. J. Infect. Dis. 189, 2094–2100.  Jespersen, L., Huffman, R., 2014. Building food safety into the company culture: a look at Maple Leaf Foods. Perspect. Public Health. 134, 200–205.  Junker, L.M., Hay, A.G., 2004. Effects of triclosan incorporation into ABS plastic on biofilm communities. J. Antimicrob. Chemother. 53, 989–996.    149  Kastbjerg, V.G., Hein-Kristensen, L., Gram, L., 2014. Triclosan-induced aminoglycoside-tolerant Listeria monocytogenes isolates can appear as small-colony variants. Antimicrob. Agents Chemother. 58, 3124–3132.  Katharios-Lanwermeyer, S., Rakic-Martinez, M., Elhanafi, D., Ratani, S., Tiedje, J.M., Kathariou, S., 2012. Coselection of cadmium and benzalkonium chloride resistance in conjugative transfers from nonpathogenic Listeria spp. to other Listeriae. Appl. Environ. Microbiol. 78, 7549–7556.  Kitis, M., 2004. Disinfection of wastewater with peracetic acid: A review. Environ. Int. 30, 47–55.  Klarsfeld, A.D., Goossens, P.L., Cossart, P., 1994. Five Listeria monocytogenes genes preferentially expressed in infected mammalian cells: plcA, purH, purD, pyrE and an arginine ABC transporter gene, arpJ. Mol. Microbiol. 13, 585–597.  Knabel, S.J., Reimer, A., Verghese, B., Lok, M., Ziegler, J., Farber, J., Pagotto, F., Graham, M., Nadon, C. a., Gilmour, M.W., 2012. Sequence typing confirms that a predominant Listeria monocytogenes clone caused human listeriosis cases and outbreaks in Canada from 1988 to 2010. J. Clin. Microbiol. 50, 1748–1751.  Kocks, C., Hellio, R., Gounon, P., Ohayon, H., Cossart, P., 1993. Polarized distribution of Listeria monocytogenes surface protein ActA at the site of directional actin assembly. J. Cell Sci. 105, 699–710. Kovacevic, J., 2014. Characterization of food chain-derived Listeria monocytogenes and the role of Listeria genomic island (LGI1) in virulence, survival, and tolerance to food-related stress. Thesis: University of British Columbia. Kovacevic, J., McIntyre, L.F., Henderson, S.B., Kosatsky, T., 2012. Occurrence and distribution of Listeria species in facilities producing ready-to-eat foods in British Columbia, Canada. J. Food Prot. 75, 216–224.  Kovačević, J., Mesak, L.R., Allen, K.J., 2012. Occurrence and characterization of Listeria spp. in ready-to-eat retail foods from Vancouver, British Columbia. Food Microbiol. 30, 372–378.  Kovacevic, J., Sagert, J., Wozniak, A., Gilmour, M.W., Allen, K.J., 2013. Antimicrobial resistance and co-selection phenomenon in Listeria spp. recovered from food and food production environments. Food Microbiol. 34, 319–327.  Kuenne, C., Voget, S., Pischimarov, J., Oehm, S., Goesmann, A., Daniel, R., Hain, T., Chakraborty, T., 2010. Comparative analysis of plasmids in the genus Listeria. PLoS One. 5, e12511   150  Lampidis, R., Kostrewa, D., Hof, H., 2002. Molecular characterization of the genes encoding DNA gyrase and topoisomerase IV of Listeria monocytogenes. J. Antimicrob. Chemother. 49, 917–924.  Larsen, M. V., Cosentino, S., Rasmussen, S., Friis, C., Hasman, H., Marvig, R.L., Jelsbak, L., Sicheritz-Pontén, T., Ussery, D.W., Aarestrup, F.M., Lund, O., 2012. Multilocus sequence typing of total-genome-sequenced bacteria. J. Clin. Microbiol. 50, 1355–1361.  Lebrun, M., Audurier, A., Cossart, P., 1994a. Plasmid-borne cadmium resistance genes in Listeria monocytogenes are present on Tn5422, a novel transposon closely-related to Tn917. J. Bacteriol. 176, 3049–3061. Lebrun, M., Audurier, A, Cossart, P., 1994b. Plasmid-Borne cadmium resistance genes in Listeria monocytogenes are similar to cadA and cadC of Staphylococcus aureus and are induced by cadmium. J. Bacteriol. 176, 3040–3048. Lebrun, M., Loulergue, J., Chaslus-Dancla, E., Audurier, A., 1992. Plasmids in Listeria monocytogenes in relation to cadmium resistance. Appl. Environ. Microbiol. 58, 3183–3186. Lecuit, M., Ohayon, H., Braun, L., Mengaud, J., Cossart, P., 1997. Internalin of Listeria monocytogenes with an intact leucine-rich repeat region is sufficient to promote internalization. Infect. Immun. 65, 5309–5319. Lecuit, M., Vandormael-Pournin, S., Lefort, J., Huerre, M., Gounon, P., Dupuy, C., Babinet, C., Cossart, P., 2001. A transgenic model for listeriosis: role of internalin in crossing the intestinal barrier. Science 292, 1722–1725.  Lee, S., Rakic-Martinez, M., Graves, L.M., Ward, T.J., Siletzky, R.M., Kathariou, S., 2013. Genetic determinants for cadmium and arsenic resistance among Listeria monocytogenes serotype 4B isolates from sporadic human listeriosis patients. Appl. Environ. Microbiol. 79, 2471–2476.  Lehnherr, H., Maguin, E., Jafri, S., Yarmolinsky, M.B., 1993. Plasmid addiction genes of bacteriophage P1: doc, which causes cell death on curing of prophage, and phd, which prevents host death when prophage is retained. J. Mol. Biol.  Lismond, A., Tulkens, P.M., Mingeot-Leclercq, M.P., Courvalin, P., Van Bambeke, F., 2008. Cooperation between prokaryotic (Lde) and eukaryotic (MRP) efflux transporters in J774 macrophages infected with Listeria monocytogenes: Studies with ciprofloxacin and moxifloxacin. Antimicrob. Agents Chemother. 52, 3040–3046.  Liu, S., Bayles, D.O., Mason, T.M., Wilkinson, B.J., 2006. A cold-sensitive Listeria monocytogenes mutant has a transposon insertion in a gene encoding a putative membrane protein and shows altered (p)ppGpp levels. Appl. Environ. Microbiol. 72, 3955–3959.    151  Liu, S., Graham, J.E., Bigelow, L., Morse  II, P.D., Wilkinson, B.J., 2002. Identification of Listeria monocytogenes genes expressed in response to growth at low temperature. Appl. Environ. Microbiol. 68, 1697–1705.  Locatelli, A., Depret, G., Jolivet, C., Henry, S., Dequiedt, S., Piveteau, P., Hartmann, A., 2013a. Nation-wide study of the occurrence of Listeria monocytogenes in French soils using culture-based and molecular detection methods. J. Microbiol. Methods 93, 242–250.  Locatelli, A., Spor, A., Jolivet, C., Piveteau, P., Hartmann, A., 2013b. Biotic and abiotic soil properties influence survival of Listeria monocytogenes in soil. PLoS One 8, 1–8.  Long, K.S., Vester, B., 2012. Resistance to linezolid caused by modifications at its binding site on the ribosome. Antimicrob. Agents Chemother. 56, 603–612.  Lunden, J., Autio, T., Sjoberg, A., Korkeala, H., 2003. Persistent and nonpersistent Listeria monocytogenes contamination in meat and poultry processing plants. J. Food Prot. 11, 1964–2179. Lungu, B., O’Bryan, C.A., Muthaiyan, A., Milillo, S.R., Johnson, M.G., Crandall, P.G., Ricke, S.C., 2011. Listeria monocytogenes: antibiotic resistance in food production. Foodborne Pathog. Dis. 8, 569–578.  Lyytikainen, O., Nakari, U., Lukinmaa, S., Kela, E., Nguyen Tran Minh, N., Siitonen, A., 2006. Surveillance of human listeriosis in Finland during 1995-2004, Euro surveillance. 11, 82-85. Machado, I., Graça, J., Sousa, A.M., Lopes, S.P., Pereira, M.O., 2011. Effect of antimicrobial residues on early adhesion and biofilm formation by wild-type and benzalkonium chloride-adapted Pseudomonas aeruginosa. Biofouling 27, 1151–1159.  Malley, T.J. V, Stasiewicz, M.J., Gröhn, Y.T., Roof, S., Warchocki, S., Nightingale, K., Wiedmann, M., 2013. Implementation of statistical tools to support identification and management of persistent Listeria monocytogenes contamination in smoked fish processing plants. J. Food Prot. 76, 796–811. Malley, T.J. V., Butts, J., Wiedmann, M., 2015. Seek and destroy process: Listeria monocytogenes process controls in the ready-to-eat meat and poultry industry. J. Food Prot. 78, 436–445.  Margolles, A., Mayo, B., de los Reyes-Gavilán, C.G., 2001. Susceptibility of Listeria monocytogenes and Listeria innocua strains isolated from short-ripened cheeses to some antibiotics and heavy metal salts. Food Microbiol. 18, 67–73.  Marquis, H., Doshi, V., Portnoy, D. A., 1995. The broad-range phospholipase C and a metalloprotease mediate listeriolysin O-independent escape of Listeria monocytogenes from a primary vacuole in human epithelial cells. Infect. Immun. 63, 4531–4534.    152  Marriott, N., Gravani, R.B., 2006. Chapter 10: Sanitizers in: Principles of Food Sanitation: fifth edition. Springer Science&Business Media, New York, NY.  Mata, M.T., Baquero, F., Pérez-Díaz, J.C., 2000. A multidrug efflux transporter in Listeria monocytogenes. FEMS Microbiol. Lett. 187, 185–188.  McArthur, A.G., Waglechner, N., Nizam, F., Yan, A., Azad, M.A., Baylay, A.J., Bhullar, K., Canova, M.J., De Pascale, G., Ejim, L., Kalan, L., King, A.M., Koteva, K., Morar, M., Mulvey, M.R., O’Brien, J.S., Pawlowski, A.C., Piddock, L.J. V, Spanogiannopoulos, P., Sutherland, A.D., Tang, I., Taylor, P.L., Thaker, M., Wang, W., Yan, M., Yu, T., Wright, G.D., 2013. The comprehensive antibiotic resistance database. Antimicrob. Agents Chemother. 57, 3348–3357. McLauchlin, J., Hampton, M.D., Shah, S., Threlfall, E.J., Wieneke, A.A., Curtis, G.D., 1997. Subtyping of Listeria monocytogenes on the basis of plasmid profiles and arsenic and cadmium susceptibility. J. Appl. Microbiol. 83, 381–388. Mead, P.S., Slutsker, L., Dietz, V., McCaig, L.F., Bresee, J.S., Shapiro, C., Griffin, P.M., Tauxe, R. V., 1999. Food-related illness and death in the United States. Emerg. Infect. Dis. 5, 607–625. Mereghetti, L., Quentin, R., Mee, N.M. Der, Mee, N.M.D.E.R., 2000. Low sensitivity of Listeria monocytogenes to quaternary ammonium compounds. Appl. Environ. Microbiol. 66, 5083–5086.  Møretrø, T., Høiby-Pettersen, G.S., Habimana, O., Heir, E., Langsrud, S., 2011. Assessment of the antibacterial activity of a triclosan-containing cutting board. Int. J. Food Microbiol. 146, 157–162.  Morosi, S., Francisci, D., Baldelli, F., 2006. A case of rhombencephalitis caused by Listeria monocytogenes successfully treated with linezolid. J. Infect. 52, 73–75.  Morvan, A., Moubareck, C., Leclercq, A., Hervé-Bazin, M., Bremont, S., Lecuit, M., Courvalin, P., Le Monnier, A., 2010. Antimicrobial resistance of Listeria monocytogenes strains isolated from humans in France. Antimicrob. Agents Chemother. 54, 2728–2731.  Mujahid, S., Orsi, R.H., Vangay, P., Boor, K.J., Wiedmann, M., 2013. Refinement of the Listeria monocytogenes  σB regulon through quantitative proteomic analysis. Microbiology 159, 1109–1119.  Mullapudi, S., Siletzky, R.M., Kathariou, S., 2010. Diverse cadmium resistance determinants in Listeria monocytogenes isolates from the turkey processing plant environment. Appl. Environ. Microbiol. 76, 627–630.    153  Mullapudi, S., Siletzky, R.M., Kathariou, S., 2008. Heavy-metal and benzalkonium chloride resistance of Listeria monocytogenes isolates from the environment of turkey-processing plants. Appl. Environ. Microbiol. 74, 1464–1468. Müller, A., Rychli, K., Muhterem-Uyar, M., Zaiser, A., Stessl, B., Guinane, C.M., Cotter, P.D., Wagner, M., Schmitz-Esser, S., 2013. Tn6188 - A novel transposon in Listeria monocytogenes responsible for tolerance to benzalkonium chloride. PLoS One 8, e76835  Nachman, K.E., Baron, P. A., Raber, G., Francesconi, K. A., Navas-Acien, A., Love, D.C., 2013. Roxarsone, inorganic arsenic, and other arsenic species in chicken: A U.S.-based market basket sample. Environ. Health Perspect. 121, 818–824.  Nies, D.H., Silver, S., 2007. Molecular microbiology of heavy metals. Springer, New York. Nightingale, K.K., Ivy, R. A., Ho, A. J., Fortes, E.D., Njaa, B.L., Peters, R.M., Wiedmann, M., 2008. inlA premature stop codons are common among Listeria monocytogenes isolates from foods and yield virulence-attenuated strains that confer protection against fully virulent strains. Appl. Environ. Microbiol. 74, 6570–6583.  Nightingale, K.K., Schukken, Y.H., Nightingale, C.R., Fortes, E.D., Ho, A.J., Her, Z., Grohn, Y.T., Mcdonough, P.L., Wiedmann, M., 2004. Ecology and transmission of Listeria monocytogenes infecting ruminants and in the farm environment ecology and transmission of Listeria monocytogenes infecting ruminants and in the farm environment. Appl. Environ. Microbiol. 70, 4458–4467.  Nziguheba, G., Smolders, E., 2008. Inputs of trace elements in agricultural soils via phosphate fertilizers in European countries. Sci. Total Environ. 390, 53–57.  O’Driscoll, B., Gahan, C.G.M., Hill, C., 1996. Adaptive acid tolerance response in Listeria monocytogenes: Isolation of an acid-tolerant mutant which demonstrates increased virulence. Appl. Environ. Microbiol. 62, 1693–1698. Oliver, H.F., Orsi, R.H., Wiedmann, M., Boor, K.J., 2010. Listeria monocytogenes σB has a small core regulon and a conserved role in virulence but makes differential contributions to stress tolerance across a diverse collection of strains. Appl. Environ. Microbiol. 76, 4216–4232.  Ooi, S.T., Lorber, B., 2005. Gastroenteritis due to Listeria monocytogenes. Clin. Infect. Dis. 40, 1327–1332. Orsi, R.H., Bakker, H.C.D., Wiedmann, M., 2011. Listeria monocytogenes lineages: Genomics, evolution, ecology, and phenotypic characteristics. Int. J. Med. Microbiol. 301, 79–96.  Pan, J., Plant, J.A., Voulvoulis, N., Oates, C.J., Ihlenfeld, C., 2010. Cadmium levels in Europe: implications for human health. Environ. Geochem. Health 32, 1–12.    154  Pan, Y., Breidt, F., Kathariou, S., 2006. Resistance of Listeria monocytogenes biofilms to sanitizing agents in a simulated food processing environment. Appl. Environ. Microbiol. 72, 7711–7717.  Paterson, J., 1940. The antigenic structure of organisms of the genus Listerella. J. Pathol. Bacteriol. 51. Paulander, W., Maisnier-Patin, S., Andersson, D.I., 2009. The fitness cost of streptomycin resistance depends on rpsL mutation, carbon source and RpoS (σS). Genetics. 183, 539–546.  Phan‐Thanh, L., Mahouin, F., 1999. A proteomic approach to study the acid response in Listeria monocytogenes. Electrophoresis 20, 2214–2224. Piffaretti, J.C., Kressebuch, H., Aeschbacher, M., Bille, J., Bannerman, E., Musser, J.M., Selander, R.K., Rocourt, J., 1989. Genetic characterization of clones of the bacterium Listeria monocytogenes causing epidemic disease. Proc. Natl. Acad. Sci. U. S. A. 86, 3818–3822.  Pilgrim, S., Kolb-mäurer, A., Gentschev, I., Goebel, W., Kuhn, M., Kolb-ma, A., 2003. Deletion of the gene encoding p60 in Listeria monocytogenes leads to abnormal cell division and loss of actin-based motility. Infect. Immun. 71, 3473–3484.  Pittman, J.R., Buntyn, J.O., Posadas, G., Nanduri, B., Pendarvis, K., Donaldson, J.R., 2014. Proteomic analysis of cross protection provided between cold and osmotic stress in Listeria monocytogenes. J. Proteome Res. 13, 1896–1904.  Pontello, M., Guaita, A., Sala, G., Cipolla, M., Gattuso, A., Sonnessa, M., Gianfranceschi, M., 2012. Listeria monocytogenes serotypes in human infections (Italy, 2000-2010). Ann. Ist. Super. Sanita 48, 146–150.  Portnoy, D.A., Auerbuch, V., Glomski, I.J., 2002. The cell biology of Listeria monocytogenes infection: The intersection of bacterial pathogenesis and cell-mediated immunity. J. Cell Biol. 158, 409–414.  Posfay-Barbe, K.M., Wald, E.R., 2009. Listeriosis. Semin. Fetal Neonatal Med. 14, 228–233.  Poyart-Salmeron, C., Carlier, C., Trieu-Cuot, P., Courtieu, A., Courvalin, P., 1990. Transferable plasmid-mediated antibiotic resistance in Listeria monocytogenes. Lancet 335, 1422–1426. Pron, B., Boumaila, C., Jaubert, F., Sarnacki, S., Monnet, J.P., Berche, P., Gaillard, J.L., 1998. Comprehensive study of the intestinal stage of listeriosis in a rat ligated ileal loop system. Infect. Immun. 66, 747–755. Ragon, M., Wirth, T., Hollandt, F., Lavenir, R., Lecuit, M., Monnier, A. Le, Brisse, S., 2008. A new perspective on Listeria monocytogenes evolution. PLoS Pathog. 4.    155  Ramalheira, R., Almeida, M., Azeredo, J., Brandão, T., Almeida, G., Silva, J., Teixeira.P, 2010. Survival of clinical and food isolates of Listeria monocytogenes through simulated gastrointestinal tract conditions. Foodborne Pathog. Dis. 7, 121–128. Rasmussen, O.F., Skouboe, P., Dons, L., Rosen, L., Olsen, J.E., 1995. Listeria monocytogenes exists in at least three evolutionary lines: Evidence from flagellin, invasive associated protein and listeriolysin O genes. Microbiology 141, 2053–2061.  Ratani, S.S., Siletzky, R.M., Dutta, V., Yildirim, S., Osborne, J. a., Lin, W., Hitchins, A.D., Ward, T.J., Kathariou, S., 2012. Heavy metal and disinfectant resistance of Listeria monocytogenes from foods and food processing plants. Appl. Environ. Microbiol. 78, 6938–6945.  Romanova, N. a, Wolffs, P.F.G., Brovko, L.Y., Griffiths, M.W., 2006. Role of efflux pumps in adaptation and resistance of Listeria monocytogenes to benzalkonium chloride. Appl. Environ. Microbiol. 72, 3498–3503.  Ryan, E.M., Gahan, C.G.M., Hill, C., 2008. A significant role for Sigma B in the detergent stress response of Listeria monocytogenes. Lett. Appl. Microbiol. 46, 148–154.  Ryser, E., Marth, E., 2007. Chapter 12: Incidence and behavior of Listeria monocytogenes in cheese and other fermented dairy products, in: Ryser, E.T. (Ed.), Listeria, Listeriosis, and Food Safety, Third Edition. 405–501. Salcedo, C., Arreaza, L., Alcalá, B., Fuente, L. De, Alcala, B., 2003. Development of a Multilocus Sequence Typing Method for Analysis of Listeria monocytogenes Clones Development of a Multilocus. J. Clin. Microbiol. 41, 757–762.  Sauders, B., Wiedmann, M., 2007. Ecology of Listeria species and L. monocytogenes in the natural environment, in: Ryser, E., Marth, E. (Eds.), Listeria Listeriosis and Food Safety. 21–53. Scallan, E., Hoekstra, R.M., Angulo, F.J., Tauxe, R. V., Widdowson, M.A., Roy, S.L., Jones, J.L., Griffin, P.M., 2011. Foodborne illness acquired in the United States-Major pathogens. Emerg. Infect. Dis. 17, 7–15.  Schlech, W., 2000. Foodborne listeriosis. Clin. Infect. Dis. 31, 127. Schlech, W., Lavigne, P., Bortolussi, R., Allen, A., Haldane, E., Wort, J., Hightower, A., Johnson, S., King, S., Nicholls, E., Broome, C. V, 1983. Epidemic listeriosis — Evidence for transmission by food. N. Engl. J. Med. 308, 203–206.  Schmid, B., Klumpp, J., Raimann, E., Loessner, M.J., Stephan, R., Tasara, T., 2009. Role of cold shock proteins in growth of Listeria monocytogenes under cold and osmotic stress conditions. Appl. Environ. Microbiol. 75, 1621–1627.  Schuchat, A., Swaminathan, B., Broome, C. V, 1991. Epidemiology of human listeriosis. Clin. Microbiol. Rev. 4, 169–83.    156  Schweizer, H.P., 2001. Triclosan: A widely used biocide and its link to antibiotics. FEMS Microbiol. Lett. 202, 1–7.  Scortti, M., Monzó, H.J., Lacharme-Lora, L., Lewis, D.A., Vázquez-Boland, J.A., 2007. The PrfA virulence regulon. Microbes Infect. 9, 1196–1207. Seeliger, H., Jones, D., 1986. Bergey’s Manual of Systematic Bacteriology. Williams & Wilkins. Shabala, L., Shabala, L., Budde, B., Budde, B., Ross, T., Ross, T., Siegumfeldt, H., Siegumfeldt, H., Jakobsen, M., Jakobsen, M., Mcmeekin, T., Mcmeekin, T., 2002. Responses of Listeria monocytogenes of acid stress and glucose availability by a novel combination of fluorescence microscopy and microelectrode ion-selective techniques. Appl. Environ. Microbiol. 68, 1794–1802.  Sheppard, S.C., Grant, C.A., Sheppard, M.I., de Jong, R., Long, J., 2009. Risk indicator for agricultural inputs of trace elements to Canadian soils. J. Environ. Qual. 38, 919–932.  Sleator, R.D., Wemekamp-Kamphuis, H.H., Gahan, C.G.M., Abee, T., Hill, C., 2005. A PrfA-regulated bile exclusion system (BilE) is a novel virulence factor in Listeria monocytogenes. Mol. Microbiol. 55, 1183–1195.  Strawn, L.K., Fortes, E.D., Bihn, E.A., Nightingale, K.K., Gröhn, Y.T., Worobo, R.W., Wiedmann, M., Bergholz, P.W., 2013a. Landscape and meteorological factors affecting prevalence of three food-borne pathogens in fruit and vegetable farms. Appl. Environ. Microbiol. 79, 588–600.  Strawn, L.K., Gröhn, Y.T., Warchocki, S., Worobo, R.W., Bihn, E.A., Wiedmann, M., 2013b. Risk factors associated with Salmonella and Listeria monocytogenes contamination of produce fields. Appl. Environ. Microbiol. 79, 7618–7627.  Sugiri, Y.D., Gölz, G., Meeyam, T., Baumann, M.P.O., Kleer, J., Chaisowwong, W., Alter, T., 2014. Prevalence and antimicrobial susceptibility of Listeria monocytogenes on chicken carcasses in Bandung, Indonesia. J. Food Prot. 77, 1407–1410.  Swaminathan, B., Gerner-Smidt, P., 2007. The epidemiology of human listeriosis. Microbes Infect. 9, 1236–1243.  Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729.  Tasara, T., Stephan, R., 2007. Evaluation of housekeeping genes in Listeria monocytogenes as potential internal control references for normalizing mRNA expression levels in stress adaptation models using real-time PCR. FEMS Microbiol. Lett. 269, 265–272.    157  Thomas, M.K., Murray, R., Flockhart, L., Pintar, K., Pollari, F., Fazil, A., Nesbitt, A., Marshall, B., 2013. Estimates of the burden of foodborne illness in Canada for 30 specified pathogens and unspecified agents, circa 2006. Foodborne Pathog. Dis. 10, 639–48.  Tilney, L.G., Portnoy, D.A, 1989. Actin filaments and the growth, movement, and spread of the intacellular bacterial parsite, Listeria monocytogenes. J.Cell Biol. 109, 1597–1608. Toledo-Arana, A., Dussurget, O., Nikitas, G., Sesto, N., Guet-Revillet, H., Balestrino, D., Loh, E., Gripenland, J., Tiensuu, T., Vaitkevicius, K., Barthelemy, M., Vergassola, M., Nahori, M.-A., Soubigou, G., Régnault, B., Coppée, J.-Y., Lecuit, M., Johansson, J., Cossart, P., 2009. The Listeria transcriptional landscape from saprophytism to virulence. Nature 459, 950–956.  Toomey, N., Monaghan, A., Fanning, S., Bolton, D., 2009. Assessment of antimicrobial resistance transfer between lactic acid bacteria and potential foodborne pathogens using in vitro methods and mating in a food matrix. Foodborne Pathog. Dis. 6, 925-933. Troxler, R., von Graevenitz, A., Funke, G., Wiedemann, B., Stock, I., 2000. Natural antibiotic susceptibility of Listeria species: L. grayi, L. innocua, L. ivanovii, L. monocytogenes, L. seeligeri and L. welshimeri strains. Clin. Microbiol. Infect. 6, 525–535.  Truong-bolduc, Q., Dunman, P., Strahilevitz, J., Projan, S., Hooper, D., 2005. MgrA is a multiple regulator of two new efflux pumps in Staphylococcus aureus. J. Bacteriol. 187, 2395–2405.  Van Der Veen, S., Abee, T., 2010. Importance of SigB for Listeria monocytogenes static and continuous-flow biofilm formation and disinfectant resistance. Appl. Environ. Microbiol. 76, 7854–7860.  Varma, J.K., Samuel, M.C., Marcus, R., Hoekstra, R.M., Medus, C., Segler, S., Anderson, B.J., Jones, T.F., Shiferaw, B., Haubert, N., Megginson, M., McCarthy, P. V, Graves, L., Gilder, T. Van, Angulo, F.J., 2007. Listeria monocytogenes infection from foods prepared in a commercial establishment: a case-control study of potential sources of sporadic illness in the United States. Clin. Infect. Dis. 44, 521–528.  Vázquez-Boland, J.A, Kuhn, M., Berche, P., Chakraborty, T., Domi, G., González-zorn, B., Wehland, J., 2001. Listeria pathogenesis and molecular virulence determinants. Clin. Microbiol. Rev. 14, 584–640. Vivant, A.-L., Garmyn, D., Piveteau, P., 2013. Listeria monocytogenes, a down-to-earth pathogen. Front. Cell. Infect. Microbiol. 3, 1–10.  Ward, T.J., Ducey, T.F., Usgaard, T., Dunn, K.A., Bielawski, J.P., 2008. Multilocus genotyping assays for single nucleotide polymorphism-based subtyping of Listeria monocytogenes isolates. Appl. Environ. Microbiol. 74, 7629–7642.  Weatherill, S., 2009. Report of the independent investigator into the 2008 listeriosis outbreak. http://www.cpha.ca/uploads/history/achievements/09-lirs-rpt_e.pdf   158  Weis, J., Seeliger, H.P., 1975. Incidence of Listeria monocytogenes in nature. Appl. Microbiol. 30, 29–32. Weller, D., Andrus, A., Wiedmann, M., den Bakker, H.C., 2014. Listeria booriae sp. nov. and Listeria newyorkensis sp. nov., from food processing environments in the USA. Int. J. Syst. Evol. Microbiol. 65, 286–292. Welshimer, H.J., 1960. Survival of Listeria monocytogenes in soil. J. Bacteriol. 80, 316–320.  Wemekamp-Kamphuis, H.H., Wouters, J.A., Leeuw, P.P.L. a De, Hain, T., Chakraborty, T., Abee, T., 2004. Identification of sigma factor B - controlled genes and their impact on acid stress, high hydrostatic pressure, and freeze survival in Listeria monocytogenes EGD-e. Appl Env. Microbiol 70, 3457–3466.  White, C., Lee, J., Kambe, T., Fritsche, K., Petris, M.J., 2009. A role for the ATP7A copper-transporting ATPase in macrophage bactericidal activity. J. Biol. Chem. 284, 33949–33956.  Wiedmann, M., Arvik, T.J., Hurley, R.J., Boor, K.J., 1998. General stress transcription factor sigmaB and its role in acid tolerance and virulence of Listeria monocytogenes. J. Bacteriol. 180, 3650–3656. Xu, D., Li, Y., Shamim Hasan Zahid, M., Yamasaki, S., Shi, L., Li, J., Yan, H., 2014. Benzalkonium chloride and heavy-metal tolerance in Listeria monocytogenes from retail foods. Int. J. Food Microbiol. 190, 24–30.  Zhang, Q., Feng, Y., Deng, L., Feng, F., Wang, L., Zhou, Q., Luo, Q., 2011. SigB plays a major role in Listeria monocytogenes tolerance to bile stress. Int. J. Food Microbiol. 145, 238–243.  Zhu, K., Bayles, D.O., Xiong, A., Jayaswal, R.K., Wilkinson, B.J., 2005. Precursor and temperature modulation of fatty acid composition and growth of Listeria monocytogenes cold-sensitive mutants with transposon-interrupted branched-chain α-keto acid dehydrogenase. Microbiology 151, 615–623.     159  Appendix A Supplemental figures   Figure S1: Growth of cadmium sensitive and resistant Listeria monocytogenes in the presence of sub-lethal (1 μg/ml) cadmium chloride. Open circles represent cadmium sensitive isolates and closed triangles represent the representative cadmium resistant isolate L. monocytogenes 08-5578. Cadmium sensitive isolates had a reduced µmax and max OD600, and increased Gt compared to cadmium resistant isolates (P<0.01, P<0.01, P<0.01 respectively).   00.10.20.30.40.50.60.70 5 10 15 20 25Cell density (OD600)Hours of growth at 25°C in TSB  160   Figure S2: The three way interaction plot for the interaction between pH, cadmium concentration, and isolate and their effect on µmax. A significant interaction was found between all three factors (P<0.01).     161    Figure S3: The growth of cadmium resistant Listeria monocytogenes 08-5578 in the presence of cadmium (1 µg/ml) at 5.5, 6.0, 6.5 and 7.0 pH values. All dark grey lines represent growth of the cadmium resistance L. monocytogenes 08-5578 in the presence of 1 µg/ml cadmium. Error bars are bars are shown to represent the standard deviation from three biological replicates. 00.10.20.30.40.50.60.70 5 10 15 20Cell Density (OD600)Hours of growth in TSB at 25°CpH 7 pH 6.5 pH 6.0 pH 5.5  162   Figure S4: The growth of Listeria monocytogenes 08-5578 CdS in the presence of cadmium (1 µg/ml) at 5.5, 6.0, 6.5 and 7.0 pH values. All dark grey lines represent growth of the plasmid cured cadmium sensitive L. monocytogenes 08-5578 in the presence of 1 µg/ml cadmium. Error bars are bars are shown to represent the standard deviation from three biological replicates. 00.10.20.30.40.50.60 5 10 15 20Cell Density (OD600)Hours of growth at 25°CpH 7 pH 6.5 pH 6.0 pH 5.5  163   Figure S5: The growth of cadmium resistant Listeria monocytogenes 08-5578 at pH 6.0 with 0.0, 0.5, 1.0, and 1.5 µg/ml cadmium concentrations. All dark grey lines represent growth of the cadmium resistance L. monocytogenes 08-5578 at pH 6.0 with increasing cadmium concentrations. Error bars are bars are shown to represent the standard deviation from three biological replicates.  00.10.20.30.40.50.60 5 10 15 20Cell Density (OD600)Hours of growth at 25°C0 µg/ml CdCl2 0.5 µg/ml CdCl2 1 µg/ml CdCl2 1.5 µg/ml CdCl2  164   Figure S6: The growth of Listeria monocytogenes 08-5578 CdS at pH 6.0 with 0.0, 0.5, 1.0, and 1.5 µg/ml cadmium concentrations.  All dark grey lines represent growth of the plasmid cured cadmium sensitive L. monocytogenes 08-5578 at pH 6.0 with increasing cadmium concentrations. Error bars are bars are shown to represent the standard deviation from three biological replicates.    00.10.20.30.40.50.60 5 10 15 20Cell Density (OD600)Hours of growth at 25°C0 µg/ml CdCl2 0.5 µg/ml CdCl2 1 µg/ml CdCl2 1.5 µg/ml CdCl2  165   Figure S7: Confirmation of transconjugants using detection of bcrABC and emrE. A single colony was passaged on double selective agar to ensure purity of the culture then DNA was isolated from a single colony and tested for both bcrABC and emrE to confirm a positive transconjugant. Lanes 2-10 and 12-20 show the PCR product of the bcrABC and emrE reactions, respectively. The bright bands at 1130 bp represent the product of the bcrABC PCR and the bright bands at 330 bp represent the product of the emrE PCR. In this figure, transconjugants 10B2, 10B6, 112B4, and 112B27 are confirmed as indicated by bands for both bcrABC and emrE.      166   Figure S8: Upregulation of QUAT resistance determinants after 60 minute exposure to 10 µg/ml BAC with normalization to 16S rRNA. Bars represent the average fold change from at least two biological replicates with the standard error of the mean. Light gray bars represent change in bcrABC expression and black bars represent chance in emrE expression. There were no significant differences seen in fold change within isolates expressing either bcrABC or emrE, but there was a significant difference between the fold change in expression of bcrABC and emrE (P=0.04).   01234567Lm 10 (bcrABC+) 08-5578 ΔemrE (bcrABC+)08-5578(bcrABC+/emrE+)08-5578 (emrE+) 08-5578(bcrABC+/emrE+)Fold change Log2Isolate  167   Figure S9: Expression of QUAT resistance determinants after 60 minute exposure to 10 µg/ml BAC with normalization to 16S rRNA. Bars represent the average expression from at least two biological replicates with the standard error of the mean relative to the non-treated donor or recipient. Light gray bars represent change in bcrABC expression and black bars represent chance in emrE expression. Lower expression of bcrABC was seen between treated Lm 10 and 08-5578 (bcrABC+/emrE+) but was not found to be significant (P=0.38). No significant difference was seen for emrE expression (P=0.48).   -3-2-1012345Non-treatedTreatedNon-treatedTreatedNon-treatedTreatedNon-treatedTreatedNon-treatedTreatedLm 10 (bcrABC+) 08-5578 ΔemrE (bcrABC+)08-5578(bcrABC+/emrE+)08-5578 (emrE+) 08-5578(bcrABC+/emrE+)Log2 ExpressionIsolate  168  Supplemental tables Table S1: Antibiogram profiles for ST120 Listeria monocytogenes isolated from the food chain in Canada. Isolate Sensitive Intermediate Resistant Lm 93 AMK, AMP, ERY, GEN,  IMP, KAN, STR, STX, TET, TMP, VAN, LZD CHL, CIP FOX, CLI, NAL Lm 109 AMK, AMP, GEN,  IMP, KAN, RIF, STR, STX, TET, TMP, VAN, LZD CHL, CIP, ERY FOX, CLI, NAL Lm 262 AMK, AMP, CHL, GEN,  RIF, IMP, KAN, STR, STX, TET, TMP, VAN CIP, ERY FOX, CLI, NAL, LZD Lm 264 AMK, AMP, CHL, ERY, GEN, RIF, IMP, KAN, STR, STX, TET, TMP, VAN, LZD CIP FOX, CLI, NAL Lm 272 AMK, AMP, GEN,  IMP, KAN, RIF, STX, TET, TMP, VAN CHL, CIP, ERY, STR FOX, CLI, NAL, LZD Lm 273 AMK, AMP, CHL, GEN, IMP, KAN, RIF, STR, STX, TET, TMP, VAN, LZD CIP, ERY FOX, CLI, NAL Lm 285 AMK, AMP, GEN, IMP, RIF, STR, STX, TET, TMP, VAN, LZD CHL, CIP, ERY, KAN FOX, CLI, NAL Lm 289 AMK, AMP, CHL, GEN, IMP, KAN, RIF, STR, STX, TET, TMP, VAN, LZD CIP, ERY FOX, CLI, NAL Lm 292 AMK, AMP, ERY, GEN, IMP, KAN, RIF, STR, SXT, TET, TMP, VAN, LZD CHL, CIP FOX, CLI, NAL Lm 297 AMK, AMP, CHL, ERY, GEN, IMP, KAN,  RIF, STR, SXT, TET, TMP, VAN, LZD CIP FOX, CLI, NAL Lm 298 AMK, AMP, CHL, ERY, GEN, IMP, KAN, RIF, STR, STX, TET, TMP, VAN, LZD CIP FOX, CLI, NAL Lm 299 AMK, AMP, GEN, IMP, KAN, RIF, STR, SXT, TET, TMP, VAN CHL, CIP, ERY FOX, CLI, NAL, LZD Lm 303 AMK, AMP, CHL, ERY, GEN, IMP, KAN, RIF, STR, STX, TET, TMP, VAN, LZD CIP FOX, CLI, NAL Lm 304 AMK, AMP, CHL, ERY, GEN, IMP, KAN, RIF, STR, STX, TET, TMP, VAN, LZD CIP FOX, CLI, NAL Lm 305 AMK, AMP, ERY, GEN, IMP, KAN, RIF, STR, SXT, TET, TMP, VAN CHL, CIP FOX, CLI, NAL, LZD Lm 307 AMK, AMP, ERY, GEN, IMP, KAN, RIF, STR, SXT, TET, TMP, VAN CHL, CIP FOX, CLI, NAL Lm 310 AMK, AMP, CHL, ERY, GEN, IMP, KAN, RIF, STR, STX, TET, TMP, VAN, LZD CIP FOX, CLI, NAL Lm 319 AMK, AMP, GEN, IMP, KAN, RIF, STR, SXT, TET, TMP, VAN, LZD CHL, CIP, ERY FOX, CLI, NAL Lm 332 AMK, AMP, CHL, ERY, GEN, IMP, KAN, RIF, STR, STX, TET, TMP, VAN, LZD CIP FOX, CLI, NAL Lm 351 AMK, AMP, CHL, GEN, IMP, KAN, RIF, STR, STX, TET, TMP, VAN, LZD CIP, ERY FOX, CLI, NAL Lm 353 AMK, AMP, CHL, ERY, IMP, RIF,  SXT, TET, TMP, VAN, LZD CIP, KAN, STR FOX, CLI, NAL  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0165806/manifest

Comment

Related Items