Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Dissecting negative regulation of plant immunity through studying muse (mutant, snc1-enhancing) mutants Huang, Yan 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2014_spring_huang_yan.pdf [ 3.61MB ]
Metadata
JSON: 24-1.0165719.json
JSON-LD: 24-1.0165719-ld.json
RDF/XML (Pretty): 24-1.0165719-rdf.xml
RDF/JSON: 24-1.0165719-rdf.json
Turtle: 24-1.0165719-turtle.txt
N-Triples: 24-1.0165719-rdf-ntriples.txt
Original Record: 24-1.0165719-source.json
Full Text
24-1.0165719-fulltext.txt
Citation
24-1.0165719.ris

Full Text

DISSECTING NEGATIVE REGULATION of PLANT IMMUNITY THROUGH STUDYING muse (mutant, snc1-enhancing) MUTANTS   by   Yan Huang   M. Sc., Sichuan Agricultural University, 2009   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   DOCTOR OF PHILOSOPHY   in   The Faculty of Graduate and Postdoctoral Studies (Botany)   THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)   October 2013   ? Yan Huang, 2013  ii Abstract  Plants respond in various ways to defend themselves against pathogen infections. Resistance (R) protein-mediated defense is one of the most effective mechanisms, through which plants can detect the activity of secreted pathogen-derived molecules (effectors) that promote infection. In Arabidopsis, snc1 encodes a TIR-NB-LRR R-like protein that carries a unique gain-of-function mutation, leading to constitutive activation of defense. Mutant snc1 has been used as a successful tool to dissect R protein-mediated immunity. Over a dozen MOS (Modifier of SNC1) proteins have been identified as positive regulators of plant immunity, indicating a complicated signaling network involved in R protein activation. To study negative regulation of snc1-mediated resistance, genetic screens were performed in mos snc1 backgrounds. Mutants restoring snc1-mediated autoimmunity phenotypes were isolated and named as muse (mutants, snc1-enhancing) mutants. The sensitized mos snc1 background enables us to find mutants that may have subtle defense phenotypes by themselves. This PhD thesis reports the identification and characterization of two muse mutants, muse3 and muse5, both enhancing snc1-associated autoimmune phenotypes in the mos4 snc1 background. MUSE3 is an Arabidopsis ortholog of yeast E4 ubiquitin conjugating factor required for polyubiquitin chain assembly. From the genetic and biochemical data, we found that MUSE3 functions downstream of the E3 complex SCFCPR1 to facilitate the degradation of at least two R proteins, SNC1 and RPS2. My study is the first report on E4 function in plants and adds another key step in R protein turnover pathway. MUSE5 encodes an ortholog of yeast PAM16, part of the mitochondrial inner membrane protein import motor and therefore, is renamed AtPAM16. In yeast pam16 mutants, preprotein import into the matrix is defective. Knocking out AtPAM16 leads to elevated ROS production and enhanced PR gene expression, suggesting that a negative regulator of plant immunity may not be properly imported into mitochondria in Atpam16. This unknown negative regulator is probably involved in preventing ROS accumulation and autoimmunity in mitochondria. This study highlights the significance of negative regulation of plant immunity in mitochondria. In summary, my PhD research contributes to better understanding of the negative regulatory mechanisms plants utilize to defend themselves against pathogen attack.  iii Preface   The work described in this thesis is the culmination of research from January 2010 through November 2013. Below is a list of manuscripts (published or in press) that comprise this thesis, and the contribution made by the candidate.   Chapter 1 ? Literature Review ? Introduction, a portion of this chapter was modified from the manuscript:  Johnson K.C.M., Dong O.X., Huang Y. and Li X. (2012). A rolling stone gathers no moss, but resistant plants must gather their MOSes. Cold Spring Harb Symp Quant Biol. 77:259?268.  ? X. Li conceived and supervised the preparation of the manuscript. Johnson K.C.M., Dong X.O. and the candidate wrote the manuscript. The candidate wrote the sections of ?Introduction?, ?Regulators of SNC1 gene expression levels: MOS1 and MOS9? and ?Protein modifying enzymes: MOS5 and MOS8?.  Chapter 2 ? Dissecting Negative Regulators in Plant Immunity, a portion of this chapter was modified from the manuscript:  Huang Y., Chen X.J., Liu Y.N., Roth C., Copeland C., McFarlane H.E., Huang S., Lipka V., Wiermer M. and Li X. (2013). Mitochondrial AtPAM16 is required for plant survival and negative regulation of plant immunity. Nat Commun, 4, 2558.  ? The mutant, snc1-enhancing (MUSE) genetic screen was performed through collaboration of many students in the Li lab. Palma K. performed the initial mutagenesis on mos4 snc1 seeds and Li L. finished the MUSE primary screen together with Monaghan J. The MUSE secondary screen was carried out by Gannon P. and Li L. Gannon P. and the candidate did the backcross among the thirty-one putative muse mutants identified from the screen with the original line (mos4 snc1) to determine the dominance/recessiveness of muse mutants. Figure 2.1 and Figure 2.2 were taken by Gannon P. The candidate created Table 2.1. X. Li conceived and supervised the whole process of the MUSE screen.   iv Chapter 3 ? A E4 ligase facilitates polyubiquitination of plant immune receptor resistance proteins was modified from the manuscript:  Huang Y., Minaker S., Roth C., Hieter P., Lipka V., Wiermer M., and Li X. A E4 ligase facilitates polyubiquitination of plant immune receptor resistance proteins. Plant Cell, in press ? The muse3-1 mutant was identified from the MUSE screen described previously. The candidate performed most of the experiments under the supervision of Li X. The phylogenetic tree of MUSE3 and its homologs in multiple representative species was generated with the great help of Huang S. and confocal microscopy images of MUSE3-GFP (transgenic line generated by the candidate) were taken by Roth C., Lipka V. and Wiermer M. The yeast ufd2 knockout strain for yeast complementation test was generated by Minaker S.  Chapter 4 ? Mitochondrial AtPAM16 is required for plant survival and negative regulation of plant immunity was modified from the manuscript:  Huang Y., Chen X.J., Liu Y.N., Roth C., Copeland C., McFarlane H.E., Huang S., Lipka V., Wiermer M. and Li X. (2013). Mitochondrial AtPAM16 is required for plant survival and negative regulation of plant immunity. Nat Commun, 4, 2558.   ? The Atpam16-1 mutant was identified from the same MUSE screen as muse3-1. The candidate and Chen X.J. performed most of the experiments under the supervision of Li X. Roth C., Wiermer M., Roth C. and Lipka V. carried out confocal microscopy experiments and McFarlane H.E. designed and conducted the immune-gold labeled TEM using the AtPAM16-GFP transgenic line generated by the candidate; the library for whole-genome Illumina Sequencing was created by Liu Y.; the mutant alleles of BON1 and SIZ1 used in this study were identified by Huang S.           v Table of Contents   ABSTRACT ................................................................................................................................. ii PREFACE ................................................................................................................................... iii TABLE OF CONTENTS ........................................................................................................... v LIST OF TABLES ..................................................................................................................... ix LIST OF FIGURES .................................................................................................................... x LIST OF ABBREVIATIONS .................................................................................................. xii ACKNOWLEDGEMENTS ................................................................................................... xvii  CHAPTER 1: Literature Review ? Introduction ..................................................................... 1 1.1 Plant Disease Resistance ......................................................................................................... 1 1.1.1 NonHost Resistance ..................................................................................................... 1 1.1.2 Host Resistance ............................................................................................................ 2 1.1.2.1 PAMP-triggered Immunity ............................................................................. 2 1.1.2.2 Effector-triggered Immunity ........................................................................... 3 1.2 Plant Resistance Proteins ........................................................................................................ 5 1.2.1 NB-LRR R Proteins ...................................................................................................... 5 1.2.1.1 NB-LRR R Protein Regulation ....................................................................... 6 1.2.1.2 NB-LRR R Protein Downstream Signaling Components ............................... 7 1.2.2 SNC1?A TIR-NB-LRR R-like Protein .................................................................... 11 1.3 Finding Positive Regulators of R Protein-mediated Immunity ............................................. 12 1.3.1 Using snc1 As a Tool ................................................................................................. 12 1.3.2 The MOS Screen ........................................................................................................ 12 1.3.3 Modifier of snc1 (MOSes) ......................................................................................... 13  CHAPTER 2: Finding Negative Regulators of R Protein-mediated Immunity .................. 18 2.1 Summary ............................................................................................................................... 18 2.2 The MUSE Screen: A Modified snc1 Enhancer Screen ....................................................... 19 2.2.1 Using Modifier of snc1 As a Tool .............................................................................. 19 2.2.2 Primary Screen ........................................................................................................... 19  vi 2.2.3 Secondary Screen ....................................................................................................... 20 2.2.4 Dominance/Recessiveness .......................................................................................... 21 2.2.5 Complementation Test................................................................................................ 22 2.3 Cloning .................................................................................................................................. 24 2.3.1 Crude Mapping ........................................................................................................... 24 2.3.2 Fine Mapping ............................................................................................................. 24 2.3.3 Illumina Whole Genome Sequencing ......................................................................... 25 2.4 Identified MUSE Genes ........................................................................................................ 25 2.5 Thesis Objectives .................................................................................................................. 28  CHAPTER 3: A E4 Ligase Facilitates Polyubiquitination of Plant Immune  Receptor Resistance Proteins ........................................................................ 29 3.1 Summary .............................................................................................................................. 29 3.2 Introduction .......................................................................................................................... 29 3.3 Results .................................................................................................................................. 31 3.3.1 The muse3-1 Mutation Enhances snc1-mediated Autoimmunity in the  mos4 snc1 background ............................................................................................. 31 3.3.2 Positional Cloning of muse3-1 .................................................................................. 32 3.3.3 Confirmation that MUSE3 is AT5G15400 ................................................................. 39 3.3.4 Subcellular Localization of MUSE3 ......................................................................... 39 3.3.5 Arabidopsis MUSE3 Complements the Yeast ufd2 Phenotypes ............................... 40 3.3.6 muse3 Mutants Exhibit Enhanced Disease Resistant Phenotypes ............................. 44 3.3.7 Constitutive Defense Responses in muse3-2 are Partially Suppressed by  Knocking Out SNC1 ................................................................................................. 46 3.3.8 MUSE3 Facilitates the Degradation of SNC1 and RPS2 Mediated by CPR1 .......... 48 3.4 Discussion ............................................................................................................................ 55 3.5 Material and Methods .......................................................................................................... 57 3.5.1 Plant Growth Conditions and Mutant Screen ............................................................ 57 3.5.2 Gene Expression Analysis and Pathogen Infections ................................................. 58 3.5.3 Total Protein Extraction and Subcellular Fractionation ............................................ 58 3.5.4 Positional Cloning and Illumina Whole Genome Sequencing .................................. 59 3.5.5 Construction of Plasmids ........................................................................................... 60  vii 3.5.6 Transient Expression and Co-IP in N. benthamiana ................................................. 61 CHAPTER 4: Mitochondrial AtPAM16 is Required for Plant Survival and  Negative Regulation of Plant Immunity ...................................................... 63 4.1 Summary .............................................................................................................................. 63 4.2 Introduction .......................................................................................................................... 63 4.3 Results .................................................................................................................................. 65 4.3.1 Characterization of muse5-1 mos4 snc1 .................................................................... 65 4.3.2 Positional Cloning of muse5-1 .................................................................................. 67 4.3.3 Confirmation that MUSE5 is At3G59280 .................................................................. 70 4.3.4 At3G59280/TXR1/MUSE5 is an Ortholog of Yeast PAM16 ................................... 70 4.3.5 AtPAM16 Localizes to Mitochondrial Inner Membrane .......................................... 74 4.3.6 Analysis of Atpam16 Single Mutants ........................................................................ 79 4.3.7 Only Atpam16-1 and Atpam16-2 Enhance snc1-mediated Immunity ....................... 80 4.4 Discussion ............................................................................................................................ 84 4.4.1 AtPAM16 is Orthologous to the Yeast Mitochondrial Import Motor Subunit  PAM16 and Essential for Plant Survival .................................................................. 84 4.4.2 Thaxtomin A Toxin from Streptomyces scabies may be Targeting Mitochondria ... 85 4.4.3 AtPAM16 may be Involved in Importing a Nuclear Encoded Negative  Regulator of Plant Immunity into Mitochondria ...................................................... 86  4.5 Material and Methods ......................................................................................................... 88 4.5.1 Plant Growth Conditions and Mutant Screen ............................................................ 88 4.5.2 Gene Expression Analysis ......................................................................................... 88 4.5.3 Pathogen Infections ................................................................................................... 89 4.5.4 Positional Cloning of muse5-1 .................................................................................. 89 4.5.5 Transgenic Complementation .................................................................................... 89 4.5.6 Confocal Microscopy ................................................................................................ 90 4.5.7 Yeast Plasmids .......................................................................................................... 90 4.5.8 Mitochondrial Isolation and Proteinase K Digestion Assay ..................................... 91 4.5.9 Cryofixation Immune-gold Labelling for TEM ........................................................ 91 4.5.10 Creating Mutants ..................................................................................................... 92 4.5.11 DAB Staining .......................................................................................................... 92 4.5.12 Oxidative Burst Detection ....................................................................................... 93  viii CHAPTER 5: Discussion and Future Perspectives .............................................................. 95 5.1 The MUSE Screen and Its Significance ............................................................................... 96 5.2 Negative Regulators of SNC1 Identified from MUSE Screen ............................................. 97 5.3 Putative Ubiquitin Conjugating E4 Factor-MUSE3 ............................................................ 98 5.4 Protein Transporter-MUSE5 .............................................................................................. 100  REFERENCES ....................................................................................................................... 102   ix List of Tables   Table 2.1 mutant, snc1-enhancing (muse) mutants identified from mos snc1 backgrounds ..... 27  Table 3.1 List of primers used in gene expression analysis ....................................................... 62  Table 4.1 Mutations found in muse5 from Illumina sequencing reads between 20 Mb-22.7 Mb  on Chr. 3................................................................................................................... 68  Table 4.2 List of primers used in the study of AtPAM16 .......................................................... 94   x List of Figures  Figure 1.1 Signaling components downstream of CC -type and TIR -type NB-LRR   R proteins ............................................................................................................... 10  Figure 1.2 A model depicting the involvement of the MOS proteins in R protein-mediated defense signaling pathways in Arabidopsis, using SNC1 as an example of the  journey of TIR-NB-LRR proteins .......................................................................... 17  Figure 2.1 Morphology of putative muse mutants ..................................................................... 23  Figure 2.2 PR-2 expression and H.a. Noco2 resistance of putative muse mutants tested in secondary screen ..................................................................................................... 23  Figure 3.1 Characterizations of the muse3-1 mos4 snc1 triple mutant ...................................... 34  Figure 3.2 Positional cloning of muse3-1 .................................................................................. 35  Figure 3.3 Phylogenetic relationship between MUSE3 and its homologs ................................. 36  Figure 3.4 Multiple alignments between MUSE3, yeast UFD2 and human UBE4 ................... 37  Figure 3.5 MUSE3 complements the molecular lesion in muse3-1 mos4 snc1 and muse3-1  is allelic to muse3-2 ................................................................................................ 41  Figure 3.6 MUSE3-GFP complements the molecular lesion in muse3-1 and localizes to  both nuclei and cytoplasm ...................................................................................... 42  Figure 3.7 MUSE3 complements the S. cerevisiae ufd2 knockout phenotypes ......................... 43  Figure 3.8 Characterization of two single mutant alleles of muse3 .......................................... .45  Figure 3.9 SNC1 loss-of-function allele snc1-r1 partially suppresses the constitutive defense phenotypes of muse3-2 ........................................................................................... 47  Figure 3.10 MUSE3 facilitates CPR1-mediated degradation of SNC1 and RPS2 .................... 50  Figure 3.11 MUSE3 facilitates CPR1-mediated degradation of RPS2 ...................................... 51  Figure 3.12 MG132 treatment enhances SNC1 accumulation, although no polyubiquitinated form of SNC1 was detected .................................................................................. 51  Figure 3.13 MUSE3 associates with SNC1, but not with RPS2 and CPR1 directly ................. 52    xi Figure 3.14 MUSE3 associates with SNC1, but not with RPS2 and CPR1 directly. These are reciprocal Co-IP experiments for Figure 3.13 ...................................................... 53  Figure 3.15 The sequential model of how MUSE3 facilitates CPR1-mediated SNC1 and  RPS2 degradation................................................................................................... 54  Figure 4.1 Characterizations of the muse5-1 mos4 snc1 triple mutant ..................................... 66  Figure 4.2 Positional cloning of muse5-1 ................................................................................. 69  Figure 4.3 Confirmation that MUSE5 is At3g59280 ................................................................. 72  Figure 4.4 AtPAM16 and yeast PAM16 can complement each other across kingdoms ............ 73  Figure 4.5 AtPAM16-GFP localizes to the mitochondrial membrane ...................................... 76  Figure 4.6 AtPAM16-GFP localizes to the mitochondrial inner membrane ............................ 78  Figure 4.7 Single mutant analysis of Atpam16-1, Atpam16-2 and Atpam16l ........................... 81  Figure 4.8 Analysis of Atpam16 snc1 double mutants.............................................................. 83  Figure 4.9 Model of AtPAM16 as a subunit of mitochondria inner membrane import  motor for negative regulation of plant immunity ................................................... 87              xii List of Abbreviations  35S a very strong constitutive promoter found in Cauliflower mosaic virus (CaMV); the coefficient of sedimentation of viral transcript whose expression is naturally driven by this promoter is 35S ABRC Arabidopsis Biological Resource Center ACD Accelerated Cell Death ACT1 Actin 1 ADP Adenosine Di-Phosphate ATP  Adenosine Tri-Phosphate Avr Avirulent or Avirulence AvrB Avirulence protein B; an avirulence effector from Pseudomonas syringae pv. glycinea AvrL Avirulence protein L; an avirulence effector from the flax rust fungus Melampsora lini Avr-Pita  Avirulence protein Pita; an avirulence effector from Magnaporthe grisea AvrPto Avirulence protein Pto; an avirulence protein from Pseudomonas syringae AvrRpm1 Avirulence protein Rpm1; an avirulence protein isolated from Pseudomonas syringae pv. maculicola strain M2 AvrRps4 Avirulence protein Rps4; an avirulence protein isolated from Pseudomonas syringae pv. pisi AvrRpt2 Avirulence protein Rpt2; an avirulence protein isolated from Pseudomonas syringae pv. tomato Ax21 Activator of Xa21-mediated immunity bak1 brassinosteroid associated kinase 1  bap1 bon1 associated protein 1 bir1 bak1 interacting receptor-like kinase 1 BLAST  Basic Local Alignment Search Tool bon1 bonzai 1 BTH benzo (1, 2, 3) thiadiazole-7-carbothioic acid S-methyl ester bZIP basic leucine zipper CC coiled-coil cfu colony forming unit CIM constitutive immunity CIP29 cytokine-induced protein 29 CLSM confocal laser scanning microscopy Col  an Arabidopsis ecotype; it is also referred as wild type in this thesis work   xiii CPR1/CPR30 Constitutive Expresser of PR Genes 1; also known as Constitutive Expresser of PR Genes 30 C terminal carboxyl terminal Cul1 Cullin 1 DAB diaminobenzidine DND1 Defense no Death 1 DND2 Defense no Death 2 ERA1 Enhanced Response to Abscisic Acid 1 E1 ubiquitin-activating enzyme E2 ubiquitin-conjugating enzyme E3 ubiquitin ligase EDS1  Enhanced Disease Susceptibility 1 EDS5 Enhanced Disease Susceptibility 5 EFR EF-Tu receptor  EF-Tu bacterial Elongation Factor Tu elf18/26 an N-acetylated peptide comprising the first 18/26 amino acids of bacterial elongation factor Tu EMS Ethyl methanesulfonate; a chemical mutagen ETI effector-triggered immunity FLAG  an epitope protein tag compose of a single or repeated DYKDDDDK sequence flg22 flagellin conserved domain 22 FLS2  FLAGELLIN-SENSITIVE 2 GFP  green fluorescent protein G-patch  glycine-rich nucleic acid binding domain GPKOW/T54 human MOS2 homolog GUS  beta-glucuronidase; a reporter gene system used in this thesis H.a. Hyaloperonospora arabidopsidis  HA hemagglutinin; an epitope protein tag compose of a single or repeated YPYDVPDYA sequence HR hypersensitive response HSP90  HEAT SHOCK PROTEIN 90 INA 2,6-dichloro-isonicotinic acid; an SA analog InDel insertion/deletion IP Immunoprecipitation  KOW  Kyprides, Ouzounis, Woese Ler Landsberg erecta; an Arabidopsis ecotype L flax NBS-LRR protein with specific recognition of AvrL from the flax rust fungus Melampsora lini LRR leucine-rich repeat LSD lesions simulating disease resistance  xiv MAC MOS4-Associated Complex MAMP microbe-associated molecular pattern MAP Mitogen-activated protein MATE multidrug and toxin extrusion MG132 a proteasome inhibitor Mge1 also referred to as GrpEp, a GrpE-related protein MKP1 MAP Kinase Phosphatase 1 MOS Modifier of snc1 MOS1 Modifier of snc1, 1; a BAT2 domain containing protein MOS2 Modifier of snc1, 2; a G-patch and KOW domains containing protein MOS3 Modifier of snc1, 3; also known as AtNup96 or SAR3 MOS4 Modifier of snc1, 4; a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2) MOS5 Modifier of snc1, 5; also known as UBIQUITIN-ACTIVATING ENZYME 1 (UBA1), one of the two Arabidopsis Ubiquitin-activating enzymes MOS6 Modifier of snc1, 6; also known as  IMPORTIN ALPHA 3 (IMPA-3) MOS7 Modifier of snc1, 7; homologous to human and Drosophila Nup88 MOS8 Modifier of snc1, 8; also known as ENHANCED RESPONSE TO ABA 1 (ERA1) MOS9 Modifier of snc1, 9 MOS10 Modifier of snc1, 10; also known as Topless-Related 1 (TPR1) MOS11 Modifier of snc1, 11;  homologous to the human RNA binding protein CIP29 MOS12 Modifier of snc1, 12; an Arabidopsis cyclin L homolog  MOS14 Modifier of snc1, 14; a nuclear importer of serine-arginine rich (SR) proteins mROS mitochondrial reactive oxygen species MUSE Mutant, snc1-enhancing Screen mRNP messenger ribonucleoprotein  MS medium Murashige and Skoog medium; a plant growth medium N Nicotiana NahG SA-degrading salicylate hydroxylase gene NB-LRR  nucleotide binding-leucine rich repeat NDR1  Non-Race Specific Disease Resistance 1 NES nuclear export signal NLR Nod-like Receptor or nucleotide binding and leucine-rich repeat-containing R protein NLS nuclear localization signal or sequence NOD Nucleotide oligomerization domain  xv NPR1 NONEXPRESSER OF PR GENES 1 N terminal amino terminal Nup107-160  nuclear pore subcomplex contributes to proper kinetochore functions Nup88 nucleoporin 88kDa that functions in CRM1-Dependent Nuclear Protein Export OD optical density PAD4  Phytoalexin Deficient 4 SDS-PAGE  sodium dodecyl sulfate polyacrylamide gel electrophoresis PAM pre-sequence translocase-associated protein import motor PAMP pathogen-associated molecular pattern PCD programmed cell death PEPC Phosphoenolpyruvate carboxylase Pita rice NBS-LRR protein confers resistance to Magnaporthe grisea that express Ave-Pita  PM Plasma membrane PopP2 an avirulence effector from Ralstonia solanacearum PR  pathogenesis-related Prf Pseudomonas resistance and fenthion sensitivity PRR pattern recognition receptor Psm ES4326 Pseudomonas syringae pv. maculicola  strain ES4326 PTI  PAMP-triggered immunity PTM post-translational modification Pto tomato R protein confers resistance to races of Pseudomonas syringae pv. tomato that carry the AvrPto pv  Pathovar qRT-PCR  Quantitative reverse transcriptase PCR R Resistance RAR1 REQUIRED FOR MLA12 RESISTANCE 1 RIN4 RPM1-interacting protein 4 RING Really Interesting New Gene RLK receptor-like kinase ROS reactive oxygen species RPM1 RESISTANCE TO P. SYRINGAE PV MACULICOLA 1 RPP4 RECOGNITION OF PERONOSPORA PARASITICA 4 RPS2 RESISTANT TO P. SYRINGAE 2 RPS4 RESISTANT TO P. SYRINGAE 4 RPS5 RESISTANT TO P. SYRINGAE 5 RRS1  RESISTANT TO RALSTONIA SOLANACEARUM 1; also known as AtWRKY52 or SENSITIVE TO LOW HUMIDITY 1 (SLH1) RT-PCR  reverse transcriptase PCR SA Salicylic acid  xvi SAR systemic acquired resistance SCF Skp1-Cullin-F-box SGT1  Suppressor of G2 Allele of SKP1 SID2 SA Induction Deficient 2 SKP1 Suppressor of Kinetochore Protein 1 SNC1 suppressor of npr1, constitutive, 1 snc1-r1 the revertant mutant of snc1 that has 10 nucleotides deleted in the first exon of SNC1 SNI suppressor of npr1, inducible SR protein serine-arginine rich proteins SRFR1  suppressor of rps4-RLD 1 SSI suppressor of SA insensitivity T-DNA transfer DNA TEM transmission electron microscopy TIM translocase in the inner membrane TIR Toll/interleukin-1 receptor TOM translocase in the outer membrane TPL TOPLESS TPR1 TOPLESS-RELATED 1 TRN-SR Transportin-SR  Ub ubiquitin UBE4A/UBE4B Ubiquitin factor E4A/E4B UFD2 Ubiquitin Fusion Degradation 2 WT wild type Xa21  A rice resistance locus that confers disease resistance to Xanthomonas oryzae pv. Oryzae Xoo Xanthomonas oryzae pv. oryzae                  xvii   Acknowledgements  This project would not have been accomplished without the assistance of many amazing people. First and foremost, I would like to sincerely thank my supervisor Dr. Xin Li for providing me with the precious chance to pursue my PhD degree in her lab. I am extremely thankful for her patience, guidance, encouragement and expertise throughout my graduate studies at UBC. The continuous training, support and advice that Xin offered me over the years have been indispensable for my scientific development. Xin is not only an outstanding supervisor, but also a good friend in my life. I would also like to thank my committee members, Dr. Ljerka Kunst and Dr. Carl Douglas for their challenging and helpful suggestions during committee meetings.  Thanks to all the current and past members of the Li lab. With their help and support, I would be able to fulfil my projects smoothly and have a happy life in Vancouver. Special thanks to Yuti Cheng for providing me with excellent advice, encouragement and for being so patient and helpful over the past 4 years not only in my studies but also in my life. I would also like to thank Fang Xu for teaching me many aspects of molecular biology. A big thank-you goes to Kaeli Johnson for careful reading and revising my writing, such as PhD proposal and manuscripts. Many helps I obtained from my colleagues cannot all be listed here, but will keep in my heart forever. I believe they will be the important friends in my life and collaborators in the future.   I would also like to take this opportunity to thank our collaborators around the globe for their help and materials, without them, my projects would not be so smooth. For my MUSE3 project, I would like to thank Dr. Brian Staskawitz (UC Berkeley) for seeds of RPS2-HA transgenic line. For my MUSE5 project, I would like to thank Dr. Peter Rehling (University of G?ttingen) for kindly giving us the pam16-1 yeast strain, Dr. Wolf-R?diger Scheible (MPI Golm/Potsdam) for providing seeds of txr1-1, and Arabidopsis Biological Resource Centre (ABRC) for Atpam16l T-DNA insertion mutant. Dr. A. Lacey Samuels is acknowledged for her insightful discussions and suggestions on the mitochondrial co-localization and cryo-immunoTEM experiments.   xviii I would like to thank for the financial support for both of my projects from Natural Sciences and Engineering Research Council (NSERC) of Canada and the William Cooper Endowment Fund from UBC and I am partly supported by PhD scholarships from Chinese Scholarship Council (CSC).   Last but not least, I would like to thank my dear friends and family members in China for their trust, support and encouragement. They have been always by my side. Without them, everything is impossible.  1 1 Literature Review ? Introduction1   1.1  Plant Disease Resistance   Plant disease resistance protects plants from pathogen infections in two ways: the pre-formed mechanisms and infection-induced responses. The resistance responses in plants are generally classified into either nonhost and host resistance.    1.1.1 Nonhost Resistance   Plants have several means of defending themselves against microbial pathogens, including bacteria, fungi and viruses. They possess a variety of physical barriers, such as cuticle and rigid cell walls, or chemical barriers, for example, the phytoanticipins, which prevent or stop pathogens from initiating infections (Heath, 2000). These defense mechanisms largely constitute nonhost resistance.  Resistance of an entire plant species against all the isolates of a pathogen that is able to infect other plants is a phenomenon known as nonhost resistance. Nonhost resistance, as the most durable form of plant protecting mechanism, confers protection against the majority of microbial pathogens. Here, disease is an exception. In addition to pre-formed defense barriers, inducible reactions, such as callose deposition and reactive oxygen species (ROS) production, contribute to another layer of plant nonhost resistance (Bestwick et al., 1995; Bestwick et al., 1997; Tao et al., 2003; Rojas et al., 2012). Since nonhost defense provides robust protection to the entire plant species to all isolates of a pathogenic microbial species, understanding molecular mechanisms                                                  1 A portion of this chapter has been published. Johnson KC, Dong OX, Huang Y and Li X. (2012) Cold Spring Harb Symp Quant Biol. 77: 259?268   2 underlying this nonhost immunity is important to develop broad-spectrum disease-resistant plants (N?rnberger and Lipka, 2005; Hardham et al., 2007; Senthil-Kumar and Mysore, 2013).   1.1.2 Host Resistance   $SODQWLVFRQVLGHUHGD?KRVW?LILWFDQEHFRORQL]HGE\DJLYHQSDWKRJHQUpon pathogen detection, multi-layered defense responses known as host resistance are triggered in the plant to hinder the infection process (Dangl and Jones, 2001). These active defense responses have been conceptually separated into PAMP-triggered immunity and effector-triggered immunity according to different types of receptors that initiate the defense cascades.    1.1.2.1 PAMP-triggered Immunity   The first layer of host resistance, termed PAMP-triggered immunity (PTI), is initiated by the recognition of conserved microbial features known as either pathogen- or microbial-associated molecular patterns (PAMPs or MAMPs) by plant pattern recognition receptors (PRRs) that reside on the plasma membrane of plant cells (Boller and Felix, 2009). PAMP perception by PRRs is common to all multicellular organisms and leads to a chain of downstream signaling events, broadly referred to as part of general defense responses in plants (Nicaise et al., 2009). Many of PRRs are receptor-like kinases (RLKs). The best-studied PRRs in plant immunity are FLS2, EFR and XA21 that belong to the subfamily XII of leucine rich repeats (LRR)-containing RLKs (Shiu and Bleecker, 2003), possessing extracellular LRR domain, a single transmembrane domain and an intracellular kinase domain. The LRR extracellular domain of FLS2 recognizes a 22 amino acid (aa) synthetic peptide (flg22) corresponding to the conserved N-terminus of flagellin (the building component of flagellum, an important structure for bacterial movement), and activates downstream defense responses (G?mez-G?mez et al., 2001; Dunning et al., 2007). FLS2, thus far, has been identified in Arabidopsis, tomato,  3 Nicotiana benthamiana and rice (Boller and Felix, 2009). EFR, the receptor of elf18 and elf26 peptides in the acetylated N-terminus of bacterial elongation factor Tu (EF-Tu; the most abundant protein with function in protein translation), however, was only found in Brassicaceae species (e.g. Arabidopsis) but not in other tested plant families (Kunze et al., 2004), which causes the EF-Tu perception to be restricted to the Brassicaceae (Zipfel et al., 2006). XA21, cloned eighteen years ago, confers immunity to most strains of Xanthomonas oryzeae pv. Oryzae (Xoo) in rice (Song et al., 1995) through recognition of its matching ligand, derived from the N-terminal region of Ax21 (activator of Xa21-mediated immunity, a quorum sensing factor) has been identified only recently (Lee et al., 2009; Han et al., 2011). However, it is still conceivable that Ax21may not be the ligand for XA21, or there exists an extra sulfated ligand (Ronald, unpublished data present in Keystone Symposia Plant Immunity Meeting in April, 2013). Studies on PRR/PAMP perception demonstrate that PTI plays a major role in disease resistance and is achieved by an array of common downstream events, such as ion fluxes, oxidative burst, signal transduction via MAP (Mitogen-activated protein) kinase cascade, defense related gene activation, and callose deposition (G?mez-G?mez et al., 1999; Asai et al., 2002; Nishimura et al., 2003; M?sz?ros et al., 2006; Torres et al., 2006; Takabatake et al., 2007; Colcombet and Hirt, 2008; Clay et al., 2009; Pandey and Somssich, 2009; Wang et al., 2009). The genome sequence analysis reveals that a large number of RLKs are present in tested plant species; more than 600 and 1131 genes encoding RLKs are found in Arabidopsis and rice genomes, respectively (Shiu et al., 2004). However, only a few PRRs and their corresponding PAMPs have been identified and studied so far, and the detailed molecular mechanisms underlying PTI remain mostly unknown.   1.1.2.2 Effector-triggered Immunity   Although PTI is a fast response against pathogen infection, the resistance achieved by plants is relatively weak; PTI can be interfered with or suppressed by effector molecules from pathogens resulting in successful infection, and thus disease. In the long evolution of an ?arms race? between plants and pathogens, plants have evolved a stronger and more rapidly elicited second  4 layer of defense mediated by resistance (R) proteins. R proteins serve as intracellular immune receptors that recognize specific effector molecules; the recognized effector molecules are now called avirulence (Avr) factors, as the presence of such lead to pathogen recognition and plant defense activation. The recognition of pathogen Avr factors by plant R proteins can be direct or indirect (Chisholm et al., 2006; Jones and Dangl, 2006). Direct R-Avr interactions have been demonstrated for the following cases: rice Pi-ta, Arabidopsis RRS1-R, flax (Linum usitatissimum) L and their cognate Avr proteins Avr-Pita, PopP2, and AvrL, respectively (Jia et al., 2000; Deslandes et al., 2003; Dodds et al., 2006). However, the ?guard hypothesis? model describing the interaction between R proteins and Avr factors suggests that this interaction is indirect and may need a mediator. It proposes that R protein monitors the status of host proteins targeted by pathogen effectors (Jones and Dangl, 2006). This model is exemplified by Arabidopsis RIN4. Phosphorylation of RIN4 by AvrRpm1 or AvrB, and cleavage of RIN4 by AvrRpt2 can be detected by the host R proteins RPM1 and RPS2, respectively, and activate robust downstream defense responses (Mackey et al., 2002; Axtell and Staskawicz, 2003; Mackey et al., 2003). Thus, RIN4, as a host target protein of these three Avr proteins, is guarded by at least two R proteins. Studies on tomato Pto also provide experimental evidence to support WKH ?JXDUG model?hypothesis (Frederick et al., 1998; Oldroyd and Staskawicz, 1998; Van der Biezen and Jones, 1998; Dangl and Jones, 2001). Pto, a host protein, is guarded by the R protein Prf through recognition of its interdiction by AvrPto. This type of immunity, which is activated upon recognition of pathogenic effectors, is also termed effector-triggered immunity (ETI). ETI is characterized by two major events: 1) robust defense responses at the site of infection that usually cumulate in hypersensitive response (HR), a type of programmed cell death at the infection site to prevent the spread of pathogens, and 2) systemic acquired resistance (SAR), which confers long-lasting broad range enhanced resistance against future infections (Durrant and Dong, 2004).  SAR often follows after ETI-mediated HR. It is characterized by the accumulation of defense signal molecule salicylic acid (SA) throughout the plants and the induction of Pathogenesis-Related (PR) gene expression at distant sites (Malamy et al., 1990; Yalpani et al., 1991). The onset of SAR can also be achieved by exogenous application of SA or SA-analogs, such as 2, 6-dichloroisonicotinic acid (INA) or benzo (1, 2, 3) thiadiazole-7-carbothioic acid S-methyl ester (BTH) (Malamy et al., 1990; G?rlach et al., 1996). Previous study on SAR  5 demonstrated that SA functions as a necessary and sufficient signal to induce the SAR responses (Gaffney et al., 1993). Even though the mode of action of SA involved in defense responses is not yet fully uncovered, it is believed that SA may affect cellular redox state and modulate the oxidative burst, which triggers subsequent responses (Ryals et al., 1996; Mou et al., 2003). As a result of SAR induction, the whole plant becomes more resistant to secondary infections (Durrant and Dong, 2004).    1.2  Plant Resistance Proteins   Plant R proteins control a broad set of defense responses, and their induction through recognition of specific Avr factors is often sufficiently rapid and strong to prevent pathogens from further growth or spread (Jones and Dangl, 2006). Genetic analysis has shown that if either the R or the Avr gene is absent, the host plant will be unable to recognize the pathogen and disease will ensue (Flor, 1971). However, when both R and its corresponding Avr are present, the specific recognition initiates downstream complex signaling events leading to defense responses, termed R protein-mediated immunity (also known as ETI).   1.2.1 NB-LRR R Proteins   Many R genes have been cloned during the past twenty years, the majority of which encode proteins containing a central nucleotide-binding (NB) domain and C-terminal leucine-rich repeats (LRR) (Ellis et al., 2000), and are therefore referred to as NB-LRR R proteins. Genome-wide analysis revealed that there are 149 NB-LRR-encoding genes in the Arabidopsis genome (Meyers et al., 2003). These NB-LRR R proteins can be divided into two subclasses based on whether their N terminus contains a coiled-coil domain (CC) or a domain with homology to the Toll/Interleukin-1-receptor (TIR). The variable amino-terminal domains presented in NB-LRR R proteins are thought to be involved in protein-protein interactions and  6 activating various signaling pathways (Belkhadir et al., 2004; Inohara et al., 2005). The NB domain exhibits function of specific binding and hydrolysis of ATP, resulting in conformational changes that regulate downstream signaling which is required for R protein activation (Jiang and Wang, 2000; Tameling et al., 2002). The LRRs are repeats of 20 to 30 amino acid long motifs that are rich in leucine residues; LRRs are found in a number of proteins in organisms from viruses to eukaryotes, which function in providing a structural framework for achieving protein-protein interactions and pathogen recognition specificity (Kobe and Kajava, 2001; Rairdan and Moffett, 2006; Takken et al., 2006).   1.2.1.1 NB-LRR R Protein Regulation   Constitutive activation or over-accumulation of NB-LRR R proteins renders plants autoimmunity where defense responses are constitutively activated without pathogens, which also results in altered morphological development such as dwarfism (Li et al., 2001; Shirano et al., 2002). In order to balance plant immunity with proper growth and developmental requirements, NB-LRR R protein activity and stability must be tightly regulated. Ideally, they should be present at low levels and remain inactive without pathogen attack, but be activated rapidly upon infection. Despite the importance of protein level control of NB-LRR R proteins, the molecular mechanisms by which their turnover is regulated is poorly understood. Increasing evidence suggests that NB-LRR R proteins undergo multiple layers of negative regulation (McHale et al., 2006). Since the ?guard hypothesis? postulates that NB-LRR R proteins recognize the status of host proteins manipulated by pathogen effectors (Dangl and Jones, 2001), RIN4 belongs to one regulatory layer where its AvrRpt2-dependent disappearance is required for RPS2 activation, and triggers downstream defense responses (Kim et al., 2005).  Other negative regulation mechanisms can be achieved by intramolecular interactions between the different domains of NB-LRR R proteins (Hwang and Williamson, 2003; Takken and Tameling, 2009; Du et al., 2012). In the absence of a pathogen, the LRRs serve as negative regulators by stabilizing NB-LRR R proteins in an autoinhibited, ADP-bound ?OFF? state. Upon infection, a series of conformational changes triggered by effector perception and ADP/ATP  7 exchange through the LRR and NB domains, respectively, results in NB-LRR R protein activation. In addition to the autoinhibitional regulation of the NB-LRR R proteins, these immune receptors must be properly folded and stabilized in a recognition-competent state to function as a sensor through regulation by chaperone-assisted proteins (Shirasu, 2009). Three proteins, RAR1 (Required for Mla12 Resistance 1), SGT1 (Suppressor of the G2 allele of SKP1) and HSP90 (Heat Shock Protein 90) as core members in a protein complex, are required for regulating proper NB-LRR R protein folding. (Austin et al., 2002; Azevedo et al., 2002; T?r et al., 2002; Takahashi et al., 2003; Zhang et al., 2010). In addition to its function as a chaperone-assisted protein in positively regulating NB-LRR R protein folding, SGT1 has been shown to be involved in the negative regulation of NB-LRR R protein stability (Azevedo et al., 2006; Li et al., 2010b). Together with the finding that the yeast SGT1 associated with SCF (SKP1-CULLIN1-F-box protein)-type E3 ubiquitin ligase complex to target proteins for degradation (Kitagawa et al., 1999), these data indicate the potential role of the ubiquitin-dependent protein degradation pathway in NB-LRR R protein regulation. Recent studies provided strong experimental evidence that the F-box protein CPR1, a subunit of an SCF E3 ubiquitin ligase complex, targets multiple NB-LRR R proteins, such as SNC1 and RPS2, for ubiquitination and further protein degradation (Cheng et al., 2011; Gou et al., 2012). Therefore, ubiquitin/proteasome-mediated degradation also plays a negative role in plant immunity through regulating NB-LRR R protein turnover.   1.2.1.2 NB-LRR R Protein Downstream Signaling Components   Several components have been identified to be involved in signal transduction downstream of NB-LRR R protein activation. Resistance mediated by TIR-NB-LRR R proteins tends to signal through the EDS1/PAD4 complex (Enhanced Disease Susceptibility 1; Phytoalexin Deficient 4), whereas CC-NB-LRR R proteins usually activate resistance through the membrane-bound protein NDR1 (Non-race specific Disease Resistance 1) (Century et al., 1997; Aarts et al., 1998; Feys et al., 2005; Knepper et al., 2011) (Figure 1.1).   8 EDS1 encodes a protein with homology to eukaryotic lipases, which is proposed to function upstream of SA induced PR-1 expression (Falk et al., 1999). PAD4, a gene identified in a screen searching for phytoalexin deficiency in response to pathogen attack, encodes another lipase-like protein similar to EDS1 with an important function in SA signaling (Jirage et al., 1999). In fact, eds1 and pad4 mutants display similar enhanced disease susceptibility (EDS) phenotypes (Jirage et al., 1999). Yeast two-hybrid analysis combined with co-immunoprecipitation using stable Arabidopsis transgenic plants suggest that EDS1 directly interacts with PAD4 and their interaction seems to play an important role in a positive feedback loop of SA accumulation (Feys et al., 2001; Wiermer et al., 2005).  NDR1 was originally identified as a locus that is resistant in a race-specific manner to the bacterial pathogen Pseudomonas syringae pv. tomato strain  (P.s.t) DC3000 carrying any one of the examined Avr genes (e.g. AvrRpt2, AvrRpm1) and is also essential for the resistance against the fungal pathogen Peronospora parasitica (Century et al., 1995), representing a conserved signal transduction element required for Avr gene-specific disease resistance. NDR1 encodes a protein that may be associated with a membrane (Century et al., 1997). Despite with elusive biochemical and cellular function, NDR1 is a pathogen-induced component that is required for disease resistance mediated by several CC-NB-LRR R proteins, including RPS2, RPMl, and RPS5 (Century et al., 1997; Knepper et al., 2011). Mutations in EDS5 and SID2 (SA induction deficient 2) resulting in the reduction of SA accumulation, suggests a role of these genes in SA biosynthesis. Moreover, compared to eds1 and pad4 mutants, eds5 and sid2 mutants with similarly low level of SA, exhibits a lesser extent of enhanced susceptibility to bacterial and oomycete pathogens, as well as reduction of PR-gene expression, suggesting an existence of distinct SA-independent compensation pathways in those SA-deficient plants (Nawrath and M?traux, 1999). EDS5 is as a member of the MATE (multidrug and toxin extrusion) transporter gene family and is strongly induced after infection, suggesting a potential role in the mobilization of SA-precursors from intracellular storage (Nawrath et al., 2002). SID2 encodes an isochorismate synthase, an enzyme involved in SA synthesis from isochorismate in bacteria (Wildermuth et al., 2001).  Genetic analysis of Arabidopsis mutants with deficiencies in SA-induced PR gene expression led to the identification and cloning of NPR1 (Non-Expressor of PR Genes 1), which is a positive regulator of SAR thought to function downstream of SA accumulation triggered by  9 R protein activation (Cao et al., 1997).  A yeast two-hybrid screen revealed that NPR1 strongly interacts with members of the TGA subclass of basic leucine zipper (bZIP) transcription factors that bind sequences required for induction of the PR-1 promoter in response to SA accumulation  (Zhang et al., 1999; Zhou et al., 2000). Subsequent study uncovered that NPR1 activation requires changes in the cellular redox state induced by SA accumulation, which leads to NPR1 monomerization and nuclear translocation to induce PR gene expression (Mou et al., 2003). Although NPR1 is clearly important for transducing the SA signal to activate resistance, there is growing evidence suggesting the existence of an SA-dependent, NPR1-independent signaling pathway (Reuber et al., 1998; Uquillas et al., 2004).                         10                           Figure 1.1: Signaling components downstream of CC-type and TIR-type NB-LRR R proteins.      11 1.2.2 SNC1: A TIR-NB-LRR R-like Protein   A genetic screen undertaken to identify suppressors of npr1 led to the isolation of a unique gain-of-function mutant, snc1 (suppressor of npr1-1, constitutive 1). SNC1 encodes an R protein with a typical TIR-NB-LRR structure (Li et al., 2001).  However, SNC1 is currently also referred to as a TIR-NB-LRR R-like protein, since its cognate Avr protein(s) have not yet been discovered. SNC1 resides in the Resistance to Peronospora parasitica 4 (RPP4) R gene cluster on chromosome IV in Arabidopsis Columbia (Col) ecotype, exhibiting high homology to RPP4 and RPP5, with over 70% similarity at the amino acid level. In snc1, a glutamic acid to lysine substitution in the linker region between the NB and LRR domains results in constitutive activation of defense, without pathogen perception. The autoimmune phenotypes of homozygous snc1 plants include morphologically dwarfed stature, increased level of SA, constitutive expression of PR genes, and increased resistance against virulent pathogens such as the bacterial pathogen Pseudomonas syringae pv. maculicola (P.s.m) ES4326 and the oomycete pathogen Hyaloperonospora arabidopsidis (H.a.) Noco2 (Zhang et al., 2003). However, SNC1/snc1 heterozygous plant exhibits intermediate defense phenotypes but wild-type morphology compared with WT and homozygous snc1, suggesting that snc1 is a semi-dominant mutant. Epistasis analyses conducted between snc1 and other known NB-LRR R downstream signaling components discussed previously demonstrated that snc1 signals through the common signaling pathways shared by other TIR-NB-LRR R proteins (Zhang et al., 2003).           12 1.3  Finding Positive Regulators of R Protein-mediated Immunity    1.3.1 Using snc1 As a Tool   As the snc1 mutation functions upstream of defense and constitutively activates defense responses, this unique autoimmune mutant is a useful tool for dissecting downstream events required for TIR-NB-LRR R-mediated immunity.  1.3.2  The MOS Screen   To identify defense signaling components downstream of snc1, multiple mutagenesis strategies have been employed in snc1 suppressor screens, yielding a number of modifier of snc1 (mos) mutants that suppress or block snc1 autoimmune phenotypes. The original hypothesis was that the activated snc1 R protein requires downstream signaling components such as EDS1 and PAD4 WRWUDQVGXFHWKH?GDQJHUDODUP?LQRUGHUWRinduce defense outputs. The suppressor screens should yield mostly positive regulators of the signaling pathway. In the primary screen, the M2 generation of ethyl methanesulfonate (EMS), T-DNA, or fast-neutron mutagenized snc1 mutant populations were screened for loss of snc1 dwarfism and restoration of wild type-like morphology.  To confirm that putative mutants isolated from the primary screen are indeed snc1 suppressors and are involved in plant immunity, defense related phenotypes including PR gene expression, endogenous SA levels and resistance to P.s.m. ES4326 and H.a. Noco2 were assessed in the M3 populations as part of the secondary screen. Consistent with the prediction, the mos snc1 mutants exhibit wild type-like morphology and have decreased levels of all examined defense outputs when compared to snc1 single mutant background.  In total, fifteen mos mutants exhibiting varying degrees of suppression of the snc1 autoimmune phenotypes were identified from these screens. As expected, several mutant alleles of PAD4 were identified.  13 1.3.3  Modifiers of snc1 (MOSes)   These MOS genes encode proteins involved in a) epigenetic control of gene expression; b) RNA processing; c) mRNA export; d) nucleocytoplasmic protein trafficking; e) transcriptional regulation  and f) protein modification. The diverse functions of MOS proteins identified from the snc1 suppressor screens suggest that the activation of R protein-mediated resistance is complex and requires fine tuning (Palma et al., 2005; Zhang et al., 2005; Zhang and Li, 2005; Goritschnig et al., 2007; Palma et al., 2007; Wiermer et al., 2007; Goritschnig et al., 2008; Cheng et al., 2009; Germain et al., 2010; Li et al., 2010a; Xu et al., 2011; Xu et al., 2012) (Figure 1.2). The snc1 mutant displays morphological dwarfism together with constitutive defense activation, suggesting that maintaining R protein-mediated defense requires sacrifices to plant fitness. Accordingly, R gene expression must be tightly controlled under normal conditions. However, the mechanisms of R gene transcriptional control are largely unknown. MOS1 and MOS9 are found to regulate SNC1 transcription level through chromatin modification (Li et al., 2010a; Xia et al., 2013), providing insights into the regulatory mechanisms of TIR-NB-LRR R gene expression.  Following transcription, nascent pre-messenger RNA (pre-mRNA) transcripts undergo SURFHVVLQJVWHSVLQFOXGLQJ?FDSSLQJ?SRO\DGHQ\ODWLRQDQGVSOLFLQJ, prior to nuclear export into cytoplasm and translation. MOS2, MOS4 and MOS12 were identified as important proteins that may be involved in RNA processing. Mutations in MOS2 only partially suppress snc1-associated phenotypes and have defects in both basal and CC/TIR-NB-LRR R protein-mediated resistance (Zhang et al., 2005), suggesting that MOS2 may function as a convergent point for multiple defense pathways. MOS2 encodes a nuclear protein with a conserved G-patch (glycine-rich nucleic acid binding domain) and two KOW (Kyprides, Ouzounis, Woese) domains, which have been shown to regulate RNA-protein and protein-protein interactions, respectively (Aravind and Koonin, 1999; Steiner et al., 2002). Recent studies on the human MOS2 homolog GPKOW/T54 and yeast SPP2 homolog revealed that T54 contains RNA binding activity in a manner dependent on its interacting protein PROTEIN KINASE A (PKA) (Aksaas et al., 2011), and that SPP2 plays a essential role in pre-mRNA splicing through its association with an RNA-dependent ATPase (Silverman et al., 2004). Those results indicate that MOS2 may also be  14 involved in the same process. MOS4 is a small nuclear protein. Similar to MOS2, mutations in MOS4 compromise both basal and CC/TIR-NB-LRR R protein-mediated defense responses (Palma et al., 2007). MOS4 is predicted to be engaged in protein-protein interactions via its C-terminal amphipathic D-helix. From previous yeast 2-hybrid and co-immunoprecipitation experiments, MOS4 is known to form a complex (MOS4-associated complex; MAC) with at least twenty other proteins (Palma et al., 2007; Monaghan et al., 2009). Orthologous MAC complexes in yeast and human have been shown to function in spliceosome assembly and pre-mRNA splicing (Tarn et al., 1993; Ohi et al., 2002; Chan and Cheng, 2005; Deckert et al., 2006; Palma et al., 2007). Both mos4 and other MAC gene single mutants examined are viable but display developmental defects. However, all combinations of MAC double mutants are lethal, driving a hypothesis that MAC as a complex may be crucial for an essential biological process, such as mRNA splicing (N?meth et al., 1998; Palma et al., 2007; Monaghan et al., 2009; Monaghan et al., 2010). MOS4 and other MAC components tested have been found to be required for the proper splicing of two TIR-NB-LRR R genes, including SNC1 and RPS4,  but not for several house-keeping genes (Palma et al., 2007; Xu et al., 2012). These results further suggest that the roles of MAC, including MOS4 in splicing regulation may be specific to defense related genes. However, the precise mechanism of either MOS2 or MOS4 in RNA processing, particularly within plant immunity, remains unclear. The third gene with RNA splicing function identified in the MOS screen is MOS12, which encodes a protein with two conserved cyclin domains (Xu et al., 2012). Cyclin L, the human MOS12 homolog, is required for pre-mRNA splicing (Loyer et al., 2008). Experimental evidence demonstrates that the splicing patterns of SNC1 and RPS4 are altered in the mos12 mutant, resulting in suppression of snc1- and RPS4-mediated resistance. Interestingly, MOS12 associates with MAC in planta, further supporting its function in mRNA splicing. Once the pre-mRNA is processed to mature mRNA, it needs to be delivered through the nuclear pore complex from the nucleus to the cytoplasm, where it will be translated. MOS3, a member of the Nup107-160 nuclear pore sub-complex, and MOS11, a homolog of human RNA binding protein CIP29 are required for mRNA export from the nucleus (Zhang and Li, 2005; Parry et al., 2006; Germain et al., 2010). The identification and functional studies on MOS3 and MOS11 highlight the important role of mRNA export in regulation of defense related genes.  15 Like RNAs, proteins also travel between the nucleus and the cytoplasm by translocation through nuclear pore complexes in the nuclear envelope (Stochaj and Rother, 1999). MOS6 encodes an importin ?3, one of eight importin ?KRPRORJVLQ$UDELGRSVLV, which recognizes and imports proteins bearing nuclear localization signal (NLS) from the cytoplasm to the nucleus (Palma et al., 2005; Lange et al., 2007). MOS7 is a protein homologous to human and Drosophila Nup88, which regulates nuclear protein export (Cheng et al., 2009). MOS14, as a nuclear protein with high homology to Transportin-SR (TRN-SR) proteins in animals, has been shown to be involved in serine-arginine rich (SR) protein nuclear import (Reed and Cheng, 2005; Xu et al., 2011). The identification and studies of essential components of the nuclear import and export machinery through the snc1 suppressor screen have revealed that the important regulatory role of nucleocytoplasmic protein trafficking in plant immunity is achieved by fine-turning defense related protein translocation. MOS10, identified as a unique MOS gene sharing high sequence similarity to TOPLESS (TPL), was renamed as TOPLESS RELATED 1 (TPR1) (Zhu et al., 2010). Similar to TPL with function in transcriptional repression of auxin-related genes during embryogenesis (Szemenyei et al., 2008), TPR1 associates with SNC1 and represses the expression of Defense no Death 1 (DND1) and Defense no Death 2 (DND2) which encode negative regulators of immunity (Zhu et al., 2010). The discovery of TPRL, with a novel regulatory function suggests that events downstream of R protein activation may require repression of negative immune regulators.  In most eukaryotes, post-translational modifications (PTMs) modulate protein function by influencing their activity, stability and localization. PTMs are needed to regulate a diverse range of cellular functions. Increasing evidence indicates that PTMs, such as ubiquitination and phosphorylation, play an important role in plant defense signaling. The identification of MOS5 and MOS8 indicates that PTMs are crucial in regulating R protein activation. MOS5 encodes one of two ubiquitin-activating (E1) enzymes in Arabidopsis (Goritschnig et al., 2007). The loss of MOS5 function partially suppresses snc1 phenotypes and leads to both impaired basal and R protein mediated defense activity. The enhanced susceptibility phenotypes observed in the mos5 mutant may result from the increased stability of negative defense regulators, the degradation of which might be essential in snc1-mediated defense resistance. Alternatively, the mos5 mutation may disrupt the function of positive defense regulators, which may require mono-ubiquitination for activation. mos8 is an allele of ERA1 (ENHANCED RESPONSE TO ABSCISIC ACID1),  16 ZKLFK HQFRGHV WKH ?-subunit of farnesyltransferase (Goritschnig et al., 2008). Protein farnesylation involves the covalent binding of hydrophobic farnesyl- or geranylgeranyl-diphosphate moieties to the target proteins, likely facilitating their binding to cellular membranes (Galichet and Gruissem, 2003). Like other era1 alleles, mos8 displays enhanced susceptibility to P.s.m. ES4326, H.a. Noco2 and exhibits impaired defense responses mediated by several R proteins. These results imply a role of farnesylation in basal immunity and the Avr-specific signaling pathways.                                      17                          Figure 1.2: A model depicting the involvement of the MOS proteins in R protein-mediated defense signaling pathways in Arabidopsis, using SNC1 as an example of the journey of TIR-NB-LRR proteins.  1. MOS1, ATXR7 and MOS9 up-regulate the transcription of SNC1 through chromatin remodeling. 2. MOS2, MOS4, and MOS12 are required for the proper splicing of the transcripts of SNC1. 3. The Nup107-160 complex and MOS11 play key roles in the export of total mRNA (including mature mRNA of SNC1), which is required for effective defense. 4. MOS5 is an E1 ubiquitin-activating enzyme, an essential component of the ubiquitination cascade, required for the regulation of defense signaling components. As an example, the SCFCPR1 E3 ubiquitin ligase complex targets SNC1 for degradation, which prevents autoimmunity caused by over-accumulation of R proteins. MOS8 positively regulates plant defense, possibly through prenylation that affects the targeting of defense regulators. 5. MOS6 and MOS7 are involved in the nucleocytoplasmic shuttling of defense signaling molecules such as SNC1, EDS1, and NPR1. Like with RPS4, EDS1 is probably required for the nuclear localization and activation of SNC1 upon the recognition of its corresponding effector (Bhattacharjee et al., 2011; Heidrich et al., 2011). MOS14 is required for the nuclear import of splicing factors that may affect defense regulator RNA processing. 6. MOS10 activates the SNC1-mediated defense through transcriptional repression of negative regulators of defense such as DND1 and DND2 (adapted from (Johnson et al., 2012)).  18 2  Finding Negative Regulators of R Protein-mediated  Immunity2   2.1  Summary    In the sophisticated signaling network of plant innate immunity, negative regulators are equally important for the regulation of defense responses since over-activation of plant defense would be detrimental for plant growth and development. During the past two decades, many genetic screens have been targeting toward finding negative regulators of plant immunity. For example, early screens aiming at the isolation of mutants showing accelerated cell death (ACD) and lesions simulating disease resistance (LSD) identified components that are responsible for cell death or HR suppression (Greenberg et al., 1994; Jabs et al., 1996). Additional mutations in negative regulators were identified from defense marker-assisted screens, such as the constitutive expression of PR genes (CPR) screen using pPR-2::GUS and the constitutive immunity (CIM) screen based on the pPR-1::luciferase reporter activity (Bowling et al., 1994; Maleck et al., 2002). Suppressor screens with different npr1 mutant alleles were independently carried out in suppressor of npr1, inducible (SNI), suppressor of npr1, constitutive (SNC), and suppressor of SA insensitivity (SSI) screens, which identified a number of negative regulators dependent or independent of NPR1 (Li et al., 1999; Shah et al., 1999; Li et al., 2001; Gao et al., 2008). Although these screens have been exhaustive in generating mutants that exhibit extreme constitutive immune responses, such as lesion mimic or extremely dwarfed plants, negative regulators that do not exhibit severe morphological defects when mutated have not been targeted using a genetic approach. This is partly due to technical difficulties in identifying the mutation with traditional map-based cloning approaches.                                                     2 A portion of this section has been published. Yan Huang, Xuejin Chen, Yanan Liu, Charlotte Roth, Charles Copeland, Heather E. McFarlane, Shuai Huang, Volker Lipka, Marcel Wiermer and Xin Li. (2013) Nat Commun, 4, 2558.   19 2.2  The MUSE Screen: A Modified snc1 Enhancer Screen   2.2.1 Using Modifier of snc1 As a Tool   The mutant, snc1-enhancing (MUSE) genetic screen, intends to identify negative regulators that do not necessarily show dramatic autoimmunity defects when mutated. This screen is a modified version of a snc1 enhancer screen in which we are particularly interested in mutants that show minor phenotypes by themselves, but are able to drastically enhance snc1-mediated autoimmunity. These mutants may reveal a large number of previously unidentified negative regulators in plant immune regulatory pathways. The usage of the unique snc1 mutant not only provides us with a sensitized background to reveal mild enhanced resistance phenotypes of the muse mutants, it also enables convenient phenotyping during further genetic mapping. In order to avoid possible lethality of the snc1 muse double mutants due to enhanced autoimmunity, we utilized plants with mos2 or mos4 in the snc1 background that grow to wild-type size and morphology despite the snc1 mutation (Zhang et al., 2005; Palma et al., 2007). As the muse mutants studied in this thesis are in the mos4 snc1 background, details on the snc1 enhancer screen using mos4 snc1 as starting material will be introduced.   2.2.2 Primary Screen   Approximately 10,000 mos4 snc1 seeds were treated with ethyl methanesulfonate (EMS). Roughly 2,500 M1 plants were allowed to self-fertilize and harvested into 100 pools with 25 plants per pool.  The primary screen was carried out using 500 M2 plants per pool to screen mutants displaying dwarf morphology similar to that of snc1.  In total, 113 putative snc1 enhancers were isolated from the primary screen.  To check heritability, seeds from each putative enhancer were planted and the mos4 locus of these plants was checked to exclude the possibility  20 that these selected putative enhancers were just snc1-like contaminants. Then, lines homozygous for mos4 which displayed a heritable dwarf phenotype were collected for the secondary screen.   2.2.3 Secondary Screen   Among the 113 M2 mutant lines that were identified based on the dwarf morphology from the primary screen, 52 carry heritable mutations that were passed on to the M3 generation and further analyzed in the secondary screen. To confirm that mutants isolated from the primary screen are indeed involved in immunity, defense related phenotypes including snc1-like morphology, PR gene expression, snc1 gene expression and resistance to H.a. Noco2 were assessed.   For morphology, plants that display a typical type of dwarfism, such as curly or twisted leaves, bushy siliques are thought to be the putative enhancers as previous data suggest that mutants with constitutively activated defenses show these specific phenotypes. Detailed notes on leaf shapes (e.g. round, arrow-like, serrated), leaf color relative to WT, silique features (e.g. length, bushy) were collected and photographs were taken for each mutant to document the morphology.   For PR gene expression, the putative enhancers were predicted to show increased levels of PR gene expression compared to the original mutant background, mos4 snc1. As mos4 snc1 has a pPR-2::GUS construct in its genetic background and PR-2 is a well-established defense marker gene, the PR-2 expression in these mutants was assessed by simply using a GUS staining method.  The mutant seedlings (~14 days old, grown on MS plates) were collected and stained to check E-glucuronidase (GUS) activity. This pPR-2::GUS reporter gene system provides a straightforward way to check if defense signaling is affected in the mutants. snc1 gene expression is up-regulated in the snc1 single mutant and is suppressed in the mos4 snc1 double mutant, suggesting that mutations causing the up-regulation of snc1 gene expression would also be the enhancers of snc1. To identify these mutants, total RNA was extracted and snc1 gene expression was quantified by using either RT-PCR or quantitative RT-PCR (qRT-PCR).  21 Moreover, infection experiments provide stronger and more direct evidence on the involvement of enhancers in defense responses. In the secondary screen, the virulent oomycete pathogen H.a. Noco2 was used to test the resistance of the mutants compared with mos4 snc1 (as susceptible control) and snc1 (as resistant control). The mutant plantlets (~14 days old, soil-grown) were sprayed with a conidiospore solution of H.a. Noco2 and maintained under high humidity. Scoring was performed one week post inoculation following a protocol described in Li et al. (2001) by assessing the appearance of conidiospores on the leaves of the seedlings. The data reveal that these enhancers act differently upon exposure to H.a. Noco2, some showed enhanced resistance and some did not, indicating that these enhancers likely have different roles, if all of them are indeed involved in defense immunity.  Based on the secondary screen data, 31 out of these 52 heritable mutant lines exhibited auto-activated defense phenotypes, which were therefore defined as true snc1 enhancers and were thus termed muse (mutant, snc1-enhancing) mutants. All of these 31 putative muse mos4 snc1 mutants show severe dwarfism (Figure 2.1), and most of them have elevated PR-2 defense marker gene expression or enhanced resistance to H.a. Noco2 relative to the parental line (Figure 2.2). The other 21 heritable mutant lines without defense phenotypes or having seeds production problem were discarded.    2.2.4 Dominance/Recessiveness   To determine the genetic relationship of the mutant alleles to wild type, backcrosses were performed.  This backcross was done with the original line (mos4 snc1), as we expect that the morphological phenotypes of these mutants are likely dependent on snc1. Therefore, when backcrossed to mos4 snc1, the F1 plants will be homozygous for snc1 and mos4 and heterozygous for the muse mutation. Wild type morphology was observed in the F1 progeny for recessive mutations, while dwarf morphology was observed for dominant mutations. Among these 31 putative muse mos4 snc1 mutants, only one mutant was caused by a dominant mutation. The F1 plants were allowed to self-fertilize. As snc1 and mos4 would not segregate in the F2 progeny, a 3:1 ratio would be anticipated in the F2 population if the mutant phenotype is caused  22 by a single nuclear gene mutation. This genetic analysis concluded that all 31 mutants carry single nuclear gene mutations.   2.2.5 Complementation Test   Allelism tests are usually conducted between putative mutant lines to identify the independent complementation groups of mutants. If F1 plants of an allelism test cross fail to complement by showing mutant phenotypes, the data would suggest that the tested mutants contain mutations in the same gene. However, if F1 plants exhibit WT-like phenotypes, they complement each other and thus would have mutations in different genes. For the MUSE screen, such complementation tests were not performed before cloning. Instead, crude mapping was carried out and only when mutations were mapped to the same genomic region, these mutant lines were then tested through complementation test.                         23                   Figure 2.1: Morphology of putative muse mutants.  Plants were grown on soil at 28?C and 70% relative humidity for three weeks before the picture was taken (Figure was taken by Patrick Gannon).                    Figure 2.2: PR-2 expression and H.a. Noco2 resistance of putative muse mutants tested in secondary screen.  The intensity of blue GUS staining is a reporter for PR-2 expression and the number of H.a. Noco2 spores on each mutant is reported (Figure was taken by Patrick Gannon).  24 2.3 Cloning   Combination of positional cloning and next-generation sequencing was conducted to identify the molecular lesion in muse mutants.   2.3.1 Crude Mapping   Positional cloning is based on utilizing polymorphisms between two ecotypes. As the mutants are in Columbia (Col) background, to map the mutations, crosses between the original triple mutants (muse mos4 snc1) and Landsberg erecta (Ler) (another Arabidopsis ecotype) were generated. The F1 plants were allowed to self-fertilize and 24 plants with the same morphology as the original mutant in F2 were selected as a crude mapping population. For positional cloning, most markers are derived from insertion/deletion (In/Del) polymorphisms between Col and Ler ecotypes which were identified by data-mining the available genomic sequences of both ecotypes (Col genomic sequence is publicly available, while Ler sequence is provided by Monsanto to registered users at http://www.arabidopsis.org/Cereon/) (Jander et al., 2002). Firstly, In/Del markers throughout the five chromosomes of Arabidopsis were used to search for a bias towards the Col genotype as our mutants are in Columbia background and the plants selected for crude mapping all showed obvious mutant phenotypes. Then, more markers were used to flank the mutation after a linkage was found.  Once the mutation has been flanked between two markers, chromosome walking will be used to map the gene to the region as small as possible.   2.3.2 Fine Mapping   Fine mapping is used to further narrow down the position of the mutation to a smaller region (less than 100 kb) on the chromosome identified in crude mapping by using a much larger  25 population, as fine mapping requires recombination events close to the mutation of interest (Jander et al., 2002). To create such a large fine mapping population, several F2 lines are required which are heterozygous for the mutation (i.e. heterozygous at both flanking markers) and are homozygous at the SNC1 locus (snc1) and MOS4 locus (either WT MOS4 or mos4) to avoid interference of the segregation from the other two loci. The F2 lines selected were allowed to self-fertilize to obtain the F3 seeds. Because mapping of these mutants requires absolute certainty of phenotypes, only the F2 lines with clear segregation of dwarf and wild type phenotypes (1:3 for recessive mutations, 3:1 for dominant mutations) in the F3 were chosen to generate a fine mapping population. In the F3, the phenotype for all recombinant plants were recorded by assessing the segregation of the F4 plants on soil.    2.3.3 Illumina Whole Genome Sequencing  Alternative to use a large mapping population for fine mapping, next generation sequencing was utilized once the mutation had been narrowed down to a region of about 1Mb. The genomic DNA of plants homozygous for muse mutation from the mapping population was sequenced using Illumina?V next-generation sequencing platform. After comparison with wild type genomic sequence, the mutations within the flanking area were further analyzed.   2.4  Identified MUSE Genes   As a proof of concept, we identified several mutant alleles of three well-known negative regulators of plant immunity, BON1, CPR1 and SIZ1 (Table 2.1) by both complementation test and direct Sanger sequencing approach. We also identified a rare gain-of-function chs3-3d allele (Bi et al., 2011) and several intragenic second-site gain-of-function mutations of snc1 using the same strategies. Both BON1 and CPR1 are genetically dependent on SNC1 (Yang and Hua, 2004; Cheng et al., 2011; Gou et al., 2012). BON1 regulates SNC1 transcription through unknown mechanisms, while SCFCPR1 directly targets SNC1 and other NB-LRR proteins for degradation  26 (Cheng et al., 2011; Gou et al., 2012). The SUMO E3 ligase SIZ1 is involved in the regulation of many biological processes, one of which is the negative regulation of defense hormone SA accumulation (Miura et al., 2010; Miura and Ohta, 2010). However, the exact role of SIZ1 in the regulation of SA signaling is unclear.  Aside from these known negative regulators of plant immunity, most of the muse mutants identified so far carry mutations in novel genes as they do not map to regions containing any known negative regulators of plant disease resistance. Future cloning and detailed biochemical studies of these MUSE genes and their encoded proteins will enable us to better understand negative regulatory mechanisms that help fine-tune plant immunity.                           27   Table 2.1:  mutant, snc1-enhancing (muse) mutants identified from mos snc1 backgrounds                                            muse # Lab code Genetic background Mutation 1 31-1 mos4 snc1  9-1 mos4 snc1  37-1 mos4 snc1  15-2 mos4 snc1  98-1 mos4 snc1  2 81-1 mos4 snc1  3 48-1 mos4 snc1  4 3-1 mos4 snc1  5 57-1 mos4 snc1  6 39-1 mos4 snc1  7 92-1 mos4 snc1  LK83 mos2 snc1 npr1  8 471 mos2 snc1 npr1  9 10-2 mos4 snc1  10 LK70 mos2 snc1 npr1  11 LK185 mos2 snc1 npr1  12 LK98 mos2 snc1 npr1  13 LK24 mos2 snc1 npr1  14 806 mos2 snc1 npr1  15 LK149 mos2 snc1 npr1  bon1 60B-1 mos4 snc1 W100 to Stop 170 mos2 snc1 npr1 G397 to R LK40 mos2 snc1 npr1 Mutation in intron cpr1 47-1 mos4 snc1 E174 to K LK14 mos2 snc1 npr1 D264 to N siz1 68 mos4 snc1 R114 to Stop LK76 mos2 snc1 npr1 W511 to Stop chs3-3d 17-1 mos4 snc1 M1017 to V (Bi et al., 2011)  28 2.5 Thesis Objectives   Through the snc1 enhancer screen, we have identified a number of novel genes which likely play multiple negative roles involved in plant immunity. The overall objective of the thesis research is to enhance our understanding of the negative regulatory mechanisms that plants utilize to fine-tune defense outcomes to achieve immunity and, at the same time, to avoid detrimental effects from auto- or prolonged immunity. Special goals of my research are: a) Identification of novel MUSE genes that play a role as negative regulators in disease resistance through the snc1 enhancer screen using mos4 snc1 as starting material; b) Functional studies on novel MUSE proteins to illustrate their biological roles related to defense responses; c) Establishing signal transduction networks involved in defense pathways. Objective c) is a long-term project and will require contributions from the whole snc1 enhancer screen team. muse3 and muse5 were identified from the same mutagenized mos4 snc1 population generated using EMS. By detailed functional studies on MUSE3 and MUSE5, we discovered the functions of new negative components involved in R protein activation and also contributed to uncovering the negative regulatory mechanisms involved in R protein mediated defense signaling.           29 3 A E4 Ligase Facilitates Polyubiquitination of Plant Immune Receptor Resistance Proteins   3.1 Summary   Proteins with nucleotide binding and leucine-rich repeat domains (NB-LRRs) serve as immune receptors in animals and plants to recognize pathogens and activate downstream defense responses. As high accumulation of NB-LRRs can result in unwarranted autoimmune responses, their cellular concentrations must be tightly regulated. However, the molecular mechanisms of this regulatory process are scarcely detailed. F-box protein Constitutive expressor of PR genes 1 (CPR1) was previously identified as part of an Skp1, Cullin1, F-box protein (SCF) complex that targets NB-LRRs, including Suppressor of NPR1, Constitutive 1 (SNC1) and Resistance to Pseudomonas syringe 2 (RPS2), for ubiquitination and further protein degradation.. From a forward genetic screen, we identified Mutant, snc1-enhancing 3 (MUSE3), a E4 ubiquitin ligase involved in polyubiquitination of its protein targets. Knocking out MUSE3 in Arabidopsis results in increased protein levels of NB-LRRs including SNC1 and RPS2, while over-expression of MUSE3 together with CPR1 in N. benthamiana enhances polyubiquitination and protein degradation of these immune receptors. This first report on the functional role of a E4 ligase in plants provides insight into the poorly understood NB-LRR degradation pathway.    3.2 Introduction   Plants have evolved complex immune systems to fight against invading microbial pathogens that threaten their normal growth and development. Resistance (R) protein-mediated defense is an effective mechanism used to sense the molecular activities of secreted pathogen effector  30 molecules through their direct or indirect recognition (Staskawicz et al., 1995; Bent and Mackey, 2007). Most R proteins share homology with animal nucleotide-binding oligomerization domain (NOD-like) receptors, with common structural features including a central nucleotide-binding (NB) domain and C-terminal leucine-rich repeats (LRRs) (Maekawa et al., 2011). Plant NB-LRR R proteins can be further divided into two subclasses based on their N-terminal coiled-coil (CC) or Toll/Interleukin-1-receptor (TIR) domains (Aarts et al., 1998). Upon effector recognition, NB-LRR R proteins activate diverse downstream responses that usually culminate in a hypersensitive response (HR) to effectively restrict further pathogen spread (Jones and Dangl, 2006). NB-LRR R protein levels have to be delicately controlled to enable appropriate defense output and to avoid autoimmunity caused by R protein over-accumulation.  Autoimmune mutants where NB-LRR R protein activity or stability is enhanced, such as snc1 (suppressor of npr1-1, constitutive 1) and ssi4 (suppressor of salicylic acid insensitivity of npr1-5, 4), exhibit constitutive defense phenotypes including elevated defense marker gene expression, accumulation of the defense hormone salicylic acid (SA), and enhanced pathogen resistance, all of which contribute to reduced plant growth (Li et al., 2001; Shirano et al., 2002). In order to balance plant immunity with proper growth and development, NB-LRR R protein activity and turnover need to be tightly controlled (Shirasu, 2009). However, the regulatory mechanism by which NB-LRR R protein levels are controlled is unclear. There is growing evidence suggesting that ubiquitination plays an important role in NB-LRR R protein-mediated immunity (Liu et al., 2002; Zeng et al., 2004; Trujillo and Shirasu, 2010; Cheng and Li, 2012). Recent research revealed that the F-box protein CPR1 (Constitutive expresser of PR genes 1), a subunit of the E3 ubiquitin ligase complex SCF (SKP1-CULLIN1-F-box), targets the R proteins SNC1 and RPS2 for degradation to prevent R protein over-accumulation and resultant autoimmunity (Cheng et al., 2011; Gou et al., 2012). Thus ubiquitin/proteasome-mediated degradation may function as a crucial mechanism for regulating the turnover of plant R proteins. In eukaryotes, degradation of selective target proteins such as transcription factors, cell cycle regulators, signal transducers, and misfolded proteins often occurs through the ubiquitin-proteasome pathway (Hershko and Ciechanover, 1998). Ubiquitination is achieved by a series of well-characterized reactions catalyzed by enzymes including ubiquitin-activating enzyme E1, ubiquitin-conjugating enzyme E2 and ubiquitin ligase E3, which add ubiquitins to their substrates and most often mark them for subsequent degradation (Hochstrasser, 1996; Pickart,  31 2001). In vitro ubiquitin assays have demonstrated that the combined activities of E1, E2 and E3 enzymes are required and sufficient for the recognition and ubiquitination of many target substrates. Although polyubiquitinated proteins are the more preferred targets of the 26S proteasome, only a few ubiquitin moieties can be efficiently added to the substrate by E1, E2 and E3 enzymes alone. Efficient polyubiquitination beyond two or three ubiquitins often relies on E4 ligase activity (Koegl et al., 1999). In yeast, ubiquitin-conjugating E4 factor UFD2 (Ubiquitin Fusion Degradation Protein 2) facilitates polyubiquitin chain assembly in conjunction with E1, E2, and E3s. The current model for E4 function in animals and yeast suggests that it may form E3-E4 or E4-substrate complexes to coordinate the transfer of Ubiquitin (Ub) from E2 to the substrate or sequentially add Ub to the substrate after E3 initially ubiquitinates the target (Koegl et al., 1999; Hoppe et al., 2004). Yeast E4 Ufd2 is an evolutionarily conserved protein with a C-terminal U-box domain. A number of E4 orthologs have been functionally studied so far: the yeast Ufd2, the human or mouse UBE4A/UBE4B (Ubiquitin factor E4A/E4B), the C. elegans UFD-2, and NOSA from Dictyostelium (Johnson et al., 1995; Pukatzki et al., 1998; Koegl et al., 1999; Hoppe et al., 2004; Matsumoto et al., 2004). Here, we report the isolation, characterization, positional cloning and functional analysis of Arabidopsis MUSE3, which encodes an ubiquitin-conjugating E4 factor in Arabidopsis. Our study reveals that MUSE3 functions as an E4 factor and works downstream of the E3 ligase SCFCPR1 to facilitate the polyubiquitination and degradation of R proteins including SNC1 and RPS2.   3.3 Results   3.3.1 The muse3-1 Mutation Enhances snc1-mediated Autoimmunity in the mos4 snc1  Background   In Arabidopsis, the dominant mutant snc1 exhibits constitutive activation of plant defense responses including elevated defense marker gene expression and enhanced resistance against  32 both bacterial and oomycete pathogens (Li et al., 2001; Zhang et al., 2003). The mutant mos4 allele (modifier of snc1, 4), which was originally identified as a genetic suppressor of snc1, reverts snc1 to wild type (WT)-like phenotypes in the snc1 background (Palma et al., 2007). The triple mutant muse3-1 mos4 snc1 was isolated from the previously described muse (mutant, snc1-enhancing) forward genetic screen in the mos4 snc1 background designed to isolate negative regulators of R protein-mediated immunity (in Chapter 2). When backcrossed to mos4 snc1, WT-like morphology was observed in all F1 progeny, suggesting that the muse3-1 mutation is recessive. As shown in Figure 3.1A, this triple mutant reverts to snc1-like morphology despite the presence of the mos4 allele, exhibiting more severe dwarfism than snc1. To confirm that other defense-related phenotypes are enhanced in the muse3-1 mos4 snc1 mutant, the expression levels of PR-1 and PR-2 were examined by RT-PCR. As shown in Figure 3.1B, both PR-1 and PR-2 expressions were increased to snc1-like levels. Consistently, the snc1-like enhanced resistance against the virulent pathogen Hyaloperonospora arabidopsidis (H.a.) Noco2 was restored in the muse3-1 mos4 snc1 seedlings (Figure 3.1C). As snc1 exhibits higher SNC1 protein accumulation compared to WT (Cheng et al., 2011), which can be partially suppressed by mos4, SNC1 level was also examined in the triple mutant. As shown in Figure 3.1D, SNC1 protein level in the triple mutant is similar to that in snc1. Taken together, muse3-1 enhances all snc1-associated defense phenotypes in the mos4 snc1 background.   3.3.2 Positional Cloning of muse3-1   To identify muse3-1, a positional cloning approach was utilized. Triple mutant muse3-1 mos4 snc1 (in Columbia (Col) background) was crossed with Landsberg erecta (Ler). F1 plants were allowed to self-fertilize to generate the segregating F2 population. Using 24 F2 plants with snc1-enhancing morphology as a crude mapping population, the muse3-1 mutation was mapped to the top of chromosome 5 through linkage analysis. The mutation was further flanked between markers T31P16 and MPI7 using an additional 96 snc1-enhancing F2 plants (Figure 3.2A). To confirm the initial mapping and further narrow down the mutation region, a larger fine mapping population was generated using progeny from several F2 lines that are heterozygous for the  33 muse3-1 mutation but homozygous at both SNC1 (snc1) and MOS4 (mos4) loci,  aiming to avoid interference from those two. With 549 F3 plants from the fine mapping population, 69 recombinants were found between T31P16 and MPI7. As shown in Figure 3.2A, the muse3-1 mutation was eventually flanked between markers T9L3 and MQK4, which was located on BAC clone T20K14.  To identify potential molecular lesions in muse3-1, Illumina whole genome sequencing was carried out on nuclear DNA isolated from muse3-1 mos4 snc1 plants. After comparison between mutant sequence and the Arabidopsis WT reference genome sequence, several candidate genes with mutations were identified. Some of mutations could be excluded as being candidates after further analysis, since they were either false positive or silent mutations that did not cause amino acid changes. Direct Sanger sequencing confirmed the most likely candidate gene mutation using genomic DNA from muse3-1 mos4 snc1. A C to T transition occurred in At5g15400 in the 10th exon (Figure 3.2B and 3.2C), changing Q789 to an earlier stop codon and truncating the predicted U-box domain of the protein (Figure 3.2D).  BLAST analysis revealed that MUSE3 is a single-copy gene encoding a putative ubiquitin conjugating E4 factor with a conserved central ubiquitin elongating factor core domain (also called UFP2p core domain) and a C-terminal U-box domain (Figure 3.2D). Phylogenetic analysis of MUSE3 and its homologs showed that MUSE3 is a highly conserved protein in all sequenced eukaryotes (Figure 3.3). The best studied MUSE3 homolog is the yeast E4 ubiquitin ligase UFD2, which promotes ubiquitin chain elongation of various target substrates (Hoppe, 2005). MUSE3 share 35% and 30% protein similarity with UFD2 and UBE4, respectively. Protein alignment of the predicted UFP2p core domains and the U-boxes between MUSE3 and UFD2 further confirmed that these domains share high sequence homology and are highly conserved (Figure 3.4).          34                           Figure 3.1: Characterizations of the muse3-1 mos4 snc1 triple mutant.  A. Morphology of three-week-old soil-grown plants of wild type (WT), snc1, mos4 snc1 and muse3-1 mos4 snc1.  B. PR-1 and PR-2 expression in the indicated genotypes as determined by semi-quantitative RT-PCR. Total RNA was extracted from two-week-old plants grown on 1/2 MS medium and reverse transcribed to cDNA. PR-1, PR-2 and Actin1 were amplified by 28 cycles of PCR using equal amounts of total cDNA, and the products were analyzed by agarose gel electrophoresis.   C. Quantification of H.a. Noco2 sporulation on WT, snc1, mos4 snc1 and muse3-1 mos4 snc1. Two-week-old seedlings were inoculated with H.a. Noco2 at a concentration of 105 spores per ml of water. The spores were quantified seven days after inoculation. Bars represent means of four replicates ? SD.  D. SNC1 protein levels in the indicated genotypes. Total protein was extracted from leaves of four-week-old soil-grown plants. SNC1 protein was examined by western blot analysis with anti-SNC1 antibody (Li et al., 2010b). Rubisco levels from Ponceau S staining serve as internal loading control.     B A C D  35                              Figure 3.2: Positional cloning of muse3-1.  A. Map position of muse3-1 on chromosome 5. BAC clones and number of recombinants from the mapping population (in brackets) are indicated.  B. Gene structure of MUSE3 (At5g15400). There is only one splice form of MUSE3 according to the annotation on TAIR (http://www.arabidopsis.org). Boxes indicate exons and lines indicate introns. Grey regions show the UTRs. The star * indicates where the C to T mutation in muse3-1 occurred. The position of the T-DNA insertion site in muse3-2 is indicated with an arrow.  C. Genomic DNA sequence comparison between MUSE3 and muse3-1. In muse3-1, a C to T point mutation occurs in the 10th exon, which is indicated as a small letter.  D. The predicated protein domains of MUSE3. One Ufd2p_core (Ubiquitin elongating factor core) domain is indicated as a black rectangle. The short rectangle represents the U-box domain. The star * indicates where the protein truncation occurs due to the mutation in muse3-1.     A B C D  36                               Figure 3.3: Phylogenetic relationship between MUSE3 and its homologs.  MUSE3 and its homologs in multiple representative species were chosen to generate the phylogenetic tree. The homologs are represented by the species names. The phylogenetic tree was generated using Mega 5.0. Briefly, the full-length amino acid sequences of these homologs were aligned using Muscle and a maximum likelihood (ML) tree was constructed using the alignment sequence with bootstrap value= 500.             37          38       Figure 3.4:  Multiple alignments between MUSE3, yeast UFD2 and human UBE4.  Amino acid sequence alignments of predicted E4 factors are generated for Arabidopsis thaliana, Saccharomyces cerevisiae and Homo sapiens using ClustaIW software. Positions of Ufd2p_core (Ubiquitin elongating factor core) and the predict U-box domains are indicated under black and dotted lines, respectively. Black boxes indicate regions in which at least three of four residues are identical and gray boxes indicate conserved residues.       39 3.3.3 Confirmation that MUSE3 is AT5G15400   To confirm that the mutation found in At5g15400 is responsible for the muse3 mutant phenotypes and to better understand the function of MUSE3, full-length genomic clones of At5g15400 under the control of its native promoter with or without a C-terminal Green Fluorescent Protein (GFP) gene were transformed into muse3-1 mos4 snc1 plants. Nine independent T1 transgenic lines all displayed mos4 snc1-like morphology (Figure 3.5A), indicating At5g15400 is able to complement the morphological phenotypes of muse3-1 mos4 snc1. Furthermore, these transgenic plants restored susceptibility as mos4 snc1 (Figure 3.5B) suggesting that the mutation in At5g15400 causes the snc1-enhancing phenotypes in the mos4 snc1 background. In addition, the SAIL_713_A12 T-DNA insertion allele of muse3, re-named muse3-2, was obtained from the Arabidopsis Biological Resource Center (ABRC). muse3-2 carries a T-DNA insertion in the 11th exon of At5g15400 (Figure 3.2B). To test whether muse3-2 is allelic to muse3-1, a homozygous muse3-2 plant was crossed with homozygous muse3-1 mos4 snc1. In the F1 generation, all the plants exhibit a similar dwarfism as muse3-1 mos4 snc1 (Figure 3.5C), indicating that muse3-2 fails to complement muse3-1 and that they are allelic to each other. These data suggest that MUSE3 is At5g15400.   3.3.4 Subcellular Localization of MUSE3    To better understand the function of MUSE3, transgenic plants expressing genomic MUSE3 with a C-terminal Green Fluorescent Protein (GFP) gene under the control of its native promoter in the muse3-1 mos4 snc1 triple mutant background were generated to investigate its subcellular localization. As shown in Figure 3.6A and B, the fusion gene is able to complement the morphological phenotype and enhanced resistance against virulent H.a. Noco2 of muse3-1 mos4 snc1, suggesting that the MUSE3-GFP fusion protein is fully functional and localizes to the correct subcellular compartments. To assess the subcellular localization of MUSE3-GFP, these  40 transgenic plants were examined by two independent approaches: confocal fluorescence microscopy and subcellular fractionation followed by western bolt analysis. MUSE3-GFP green fluorescence was observed in both nuclei and cytoplasm of examined leaf epidermal and root cells (Figure 3.6C). Fractionation further confirmed that MUSE3-GFP is indeed present in both the nuclei-depleted and nuclei-enriched fractions (Figure 3.6D). Thus MUSE3 seems to have both a nuclear and cytoplasmic localization.   3.3.5 Arabidopsis MUSE3 Complements the Yeast ufd2 Mutant Phenotypes   Previously, the yeast knockout strain ufd2' was shown to exhibit growth defects including sensitivity to ethanol or hydroxyurea at 37?C (Koegl et al., 1999). Since UFD2 is a close homolog of MUSE3, we tested whether MUSE3 is orthologous to UFD2 through a yeast complementation experiment.  As shown in Figure 3.7, the ufd2' mutant strain exhibits no growth defect on SD-LEU plate. However, compared to the WT strain, ufd2' cells did not grow well and showed obvious sensitivity to either 10% ethanol or 100mM hydroxyurea. In contrast, ufd2' cells expressing MUSE3 grew much better than the ufd2' strain, although not as well as WT cells, on plates containing 10% ethanol. Furthermore, ufd2' strains expressing MUSE3 grew as well as WT on 100mM hydroxyurea plates. These yeast complementation data show that Arabidopsis MUSE3 is able to complement the ufd2 knockout phenotypes, and suggest that MUSE3 is a functional ortholog of the yeast UFD2 E4 ligase that is involved in ubiquitin chain elongation.          41                                Figure 3.5: MUSE3 complements the molecular lesion in muse3-1 mos4 snc1 and muse3-1 is allelic to muse3-2.  A. Morphology of four-week-old soil-grown plants of WT, snc1, mos4 snc1, muse3-1 mos4 snc1 and two representative transgenic lines expressing MUSE3 under its native promoter in muse3-1 mos4 snc1 triple mutant. B. Quantification of H.a. Noco2 sporulation on the indicated genotypes. The experiment was carried out as in Figure 1C. C. Morphology of three-week-old plants of WT, muse3-2, muse3-1 mos4 snc1 and F1 of muse3-2 crossed with muse3-1 mos4 snc1 are shown. The genotype of F1 plants were confirmed by PCR using mutation-specific primers. Since snc1 morphology is semi-dominant and mos4 is recessive, severely dwarfed F1 plants suggest failed complementation between muse3-1 and muse3-2, both of which are recessive.   A B C  42                            Figure 3.6: MUSE3-GFP complements the molecular lesion in muse3-1 and localizes to both nuclei and cytoplasm.  A. Morphology of wild type (WT), snc1, mos4 snc1, muse3-1 mos4 snc1 and two representative transgenic lines expressing MUSE3-GFP under the control of its native promoter in the muse3-1 mos4 snc1 triple mutant. B. Quantification of H.a. Noco2 sporulation on the indicated genotypes.  C. Confocal images of MUSE3-GFP fluorescence in leaf epidermis and root cells of soil-grown muse3-1 mos4 snc1 transgenic plants expressing MUSE3-GFP. Cell walls were stained with propidium iodide to visualize the cell outlines.  Scale bars are 10 ?m. D. Western blot analysis of MUSE3-GFP expressed in muse3-1 mos4 snc1 background under its native promoter in nuclei-depleted (-N) and nuclear (N) protein extracts of two-week-old plate-grown plants. Anti-PEPC and anti-H3 were used as markers for cytosolic and nuclear fractions, respectively. The loading amount of nuclear protein extracts (N) were 10? concentrated compared with nuclei-depleted fractions (-N). The experiment was repeated twice with similar results.    A B D C  43                               Figure 3.7: MUSE3 complements the S. cerevisiae ufd2 knockout phenotypes.  The following yeast strains were grown to early log phase and serially diluted and spotted on the indicated media: 1: WT yeast strain expressing p425-GPD empty vector; 2: yeast ufd2 knockout strain expressing p425-GPD empty vector; 3: ufd2 knockout strain expressing p425-GPD-MUSE3. The plates containing the following media were incubated at 37 ?C for 3 days unless indicated otherwise: SD-Leu + ETOH, with 10% ethanol, incubated for 6 days; SD-Leu + HU, with 100mM hydroxyl urea. The top SD-Leu plates were used as equal inoculum controls.         A B  44 3.3.6 muse3 Mutants Exhibit Enhanced Disease Resistant Phenotypes   Our study of the muse3-1 mos4 snc1 triple mutant indicates that MUSE3 functions as a negative regulator of snc1-mediated immunity. To determine its general role in plant immunity, we generated the muse3-1 single mutant by crossing muse3-1 mos4 snc1 with WT plants, followed by allele-specific genotyping in the F2 generation. We also utilized the muse3-2 allele for single mutant analyses. As shown in Figure 3.8A, both muse3-1 and muse3-2 plants are WT-like, with slightly smaller size as quantified by fresh weight analysis of aerial tissues (Figure 3.8B). The relative expression levels of PR-1 and PR-2 were increased in both mutant alleles (Figure 3.8C). To determine whether muse3 also altered resistance against virulent pathogens, muse3-1, muse3-2 and WT control plants were challenged with the virulent oomycete H.a. Noco2 or the bacterial pathogen Pseudomonas syringae pv. maculicola (P.s.m.) ES4326. As shown in Figure 3.8D and E, resistance against both pathogens was enhanced by both muse3 mutations. As SNC1 accumulates in the muse3-1 mos4 snc1 triple mutant, SNC1 level was also examined in muse3 single mutants. As shown in Figure 3.8F, both muse3-1 and muse3-2 exhibited higher SNC1 protein levels, although WT-like SNC1 transcription levels were detected (Figure 3.8C).  These data show that mutations in MUSE3 cause enhanced disease resistance and stabilize SNC1.                    45                             Figure 3.8: Characterization of two muse3 single mutant alleles.  A. Morphology of four-week-old soil-grown plants of WT, muse3-1 and muse3-2. B. Fresh weight (FW) of three-week-old plants of the indicated genotypes. Bars represent means ? SD (n=12). The experiments were repeated three times with similar results. C. Relative expression of PR-1, PR-2 and SNC1 in WT, muse3-1, and muse3-2 as determined by real time RT-PCR. Total RNA was extracted from 2-week-old plants grown on MS plate and reverse transcribed to cDNA. The PR-1, PR-2 and SNC1 expression levels were normalized by ACTIN1.   D. Quantification of H.a. Noco2 sporulation on WT, muse3-1 and muse3-2 seedlings.  E. Bacterial growth of P.s.m. ES4326 on WT, muse3-1 and muse3-2 plants. Leaves of 4-week-old plants were infiltrated with a bacterial suspension at OD600=0.0005. Leaf discs within the infected area were taken at day 0 and day 3 to quantify bacterial colony forming units (cfu). Bars represent means of five replicates ?SD. One way analysis of variance was used to calculate statistical significance between genotypes as indicated by different letters (p<0.0005). F. SNC1 protein level in WT, muse3-1 and muse3-2. Bands from a non-specific protein (NSP) serve as internal loading control.  A B C D E F  46 3.3.7 Constitutive Defense Responses in muse3-2 are Partially Suppressed by Knocking Out  SNC1   To test whether the enhanced resistance responses in the muse3 mutants are due to increased accumulation of SNC1 protein, we introduced snc1-r1, a loss-of-function deletion allele of SNC1 (Zhang et al., 2003), into muse3-2. Analysis of PR gene expression showed that constitutive expression of both PR-1 and PR-2 was only partially reduced in muse3-2 snc1-r1 (Figure 3.9A). In addition, enhanced resistance against the virulent pathogen H.a. Noco2 in muse3-2 was partially suppressed by the snc1-r1 mutation (Figure 3.9B). However, knocking out SNC1 did not significantly affect the muse3-2 associated resistant against P.s.m. ES4326 (Figure 3.9C). These data suggest that over-accumulation of SNC1 in muse3-2 contributes only partially to the enhanced resistance phenotypes of muse3, indicating that MUSE3 may target additional NB-LRRs other than SNC1 for degradation.  To test whether MUSE3 affects the stability of the CC-type NB-LRR R protein RPS2, we crossed the previously reported RPS2-HA transgene into the muse3-2 background (Axtell and Staskawicz, 2003). As shown in Figure 3.9D, RPS2-HA accumulates more in the muse3-2, indicating that MUSE3 also contributes to the turnover of RPS2. Without MUSE3, RPS2 becomes more stable.  47                             Figure 3.9: SNC1 loss-of-function allele snc1-r1 partially suppresses the constitutive defense phenotypes of muse3-2.  A. Relative expression of PR-1 and PR-2 in WT, muse3-2, and muse3-2 snc1-r1 as determined by real time RT-PCR. Total RNA was extracted from three-week-old soil-grown plants and reverse transcribed to cDNA. The PR-1, PR-2 and SNC1 transcript levels were normalized by ACTIN1. B. Growth of H.a. Noco2 sporulation on WT, muse3-2, and muse3-2 snc1-r1 seedlings. One way analysis of variance was used to calculate statistical significance between genotypes as indicated by different letters (p<0.05). C. Bacterial growth of P.s.m. ES4326 on WT, muse3-2, and muse3-2 snc1-r1. One way analysis of variance was used to calculate statistical significance between genotypes as indicated by different letters (p<0.05). D. Western blot analysis of RPS2-HA protein levels in muse3-2. The RPS2-HA transgene was crossed into muse3-2. Data from two independent lines were shown. NSP signals serve as internal loading control.   A B C D  48 3.3.8 MUSE3 Facilitates the Degradation of SNC1 and RPS2 Mediated by CPR1    The phenotypic analysis of muse3 mutants suggests that MUSE3 may negatively regulate the stability of SNC1 and RPS2. As CPR1, a component of the SCF E3 complex, has been shown to target SNC1 and RPS2 for degradation (Cheng et al., 2011), we hypothesized that MUSE3 may function together with CPR1 to regulate SNC1 and RPS2 degradation through the ubiquitin/proteasome pathway. To test this hypothesis, we employed a transient expression system in Nicotiana benthamiana by co-expressing SNC1-FLAG or RPS2-FLAG with either CPR1-FLAG or MUSE3-HA alone or CPR1-FLAG and MUSE3-HA together to reveal their biochemical relationships (Gou et al., 2012). As shown in Figure 3.10A and 3.10B, when co-expressed with CPR1, SNC1 and RPS2 exhibit decreased accumulation compared to expressing SNC1 or RPS2 alone, which is consistent with CPR1 degrading SNC1 and RPS2 (Cheng et al., 2011; Gou et al., 2012). When co-expressed with MUSE3, both SNC1 and RPS2 expression levels were unaffected, indicating that unlike CPR1, MUSE3 does not function as an E3 by itself that directly targets these substrates for degradation. However, when co-expressed with both CPR1 and MUSE3, the protein levels of SNC1 and RPS2 were much lower than when co-expressed with CPR1 alone, demonstrating that MUSE3 facilitates the degradation of SNC1 and RPS2 mediated by the E3 SCFCPR1. A similar trend in SNC1 levels was observed in snc1 over-expressing both CPR1 and MUSE3-GFP in Arabidopsis. Over-expression of CPR1 reduces the level of SNC1 and suppresses snc1-mediated dwarfism (Figure 3.10C and 3.10D), while over-expression of MUSE3-GFP alone did not alter the SNC1 level or the morphological phenotypes of snc1. However, SNC1 level is further reduced when MUSE3-GFP was expressed together with CPR1 (Figure 3.10C and 3.10D). Interestingly, we sometimes were able to detect polyubiquitinated RPS2 when it is co-expressed with both CPR1 and MUSE3 in N. benthamiana, supporting the role of MUSE3 as a E4 in polyubiquitination (Figures 3.11). However, we never observed polyubiquitinated form of SNC1, even from proteasome inhibitor MG132-pretreated leaf samples (Figure 3.12), possibly due to transience or instability of the polyubiquitinated forms of the substrate protein. The genetic and biochemical associations between MUSE3 and SNC1, RPS2, and CPR1 prompted us to test whether MUSE3 interacts with SNC1, RPS2 or CPR1 in planta. Co- 49 immunoprecipitation (IP) using co-expressed MUSE3-HA with either SNC1-FLAG, RPS2-FLAG, or CPR1-FLAG fusion proteins in N. benthamiana with anti-FLAG agarose beads revealed that MUSE3-HA only co-IPed with SNC1, but not with RPS2 or CPR1 in the elution fractions (Figure 3.13A-C). These results were further confirmed by reciprocal IP experiments using anti-HA agarose beads (Figure 3.14A-C). Taken together, MUSE3 seems to function downstream of CPR1 to facilitate the polyubiquitination and degradation of SNC1 and RPS2. MUSE3 appears to function with SNC1 through direct protein-protein interaction, while its activity with RPS2 seems indirect (Figure 3.15).                         50                               Figure 3.10: MUSE3 facilitates CPR1-mediated degradation of SNC1 and RPS2.  A. SNC1-FLAG levels in N. benthamiana leaves expressing the indicated proteins. NSP signals serve as internal loading control. B. RPS2-FLAG levels in N. benthamiana leaves expressing the indicated proteins. NSP signals serve as internal loading control. C. Morphology of four-week-old soil-grown plants of the indicated genotypes. #1 and #2 are two independent F3 lines homozygous for snc1, 35S::CPR1 and pMUSE3::MUSE3-GFP, which were identified from a cross between 35S::CPR1 in snc1 (T1-5,(Cheng et al., 2011) and pMUSE3::MUSE3-GFP  in snc1 (T1-10). D. Western blot analysis of SNC1 protein levels in the indicated genotypes. Total protein was extracted from four-week-old soil-grown plants. Rubisco levels serve as internal loading control. A B C D  51               Figure 3.11: MUSE3 facilitates CPR1-mediated degradation of RPS2.  Western blot detects RPS2-FLAG accumulation in N. benthamiana expressing the indicated constructs. Arrow indicates the predicted size of RPS-FLAG and stars * indicate the assumed polyubiquitinated forms of RPS2-FLAG. Bands from a non-specific protein (NSP) serve as internal loading control.                Figure 3.12: MG132 treatment enhances SNC1 accumulation, although no polyubiquitinated form of SNC1 was detected.  Transgenic snc1 over-expressing CPR1 and MUSE3-GFP were used to detect polyubiquitinated form of SNC1. Four-week-old soil-grown plants were infiltrated with either DMSO or DMSO VXSSOHPHQWHGZLWK?00*D6SURWHDVRPHLQKLELWRU. Total protein was extracted four hours after DMSO or MG132 treatment and examined by immunobloting using anti-SNC1 and anti-GFP antibodies. Rubisco levels serve as loading control. #1 and #2 are two independent F3 lines homozygous for snc1, 35S::CPR1 and pMUSE3:MUSE3-GFP, which were identified from a cross between 35S::CPR1 in snc1 (T1-5, Cheng et al., 2011) and pMUSE3:MUSE3-GFP in snc1 (T1-10, Figure 3.10C of current study).  52                                Figure 3.13: MUSE3 associates with SNC1, but not with RPS2 and CPR1 directly.  A. In planta co-IP of MUSE3-HA by SNC1-FLAG. B. In planta co-IP of MUSE3-HA by RPS2-FLAG. The polyubiquitinated forms of RPS2 detected in beads fraction as indicated with stars * were confirmed when the same samples were probed with anti-Ub antibody in western blot analysis. C. In planta co-IP of MUSE3-HA by CPR1-FLAG. From A to C, N. benthamiana leaves were infiltrated with the Agrobacterium containing the constructs expressing the indicated proteins. Total protein extracts were subjected to immunoprecipitation with anti-FLAG agarose beads. Input, Elute and Beads fractions were detected with anti-FLAG or anti-HA antibodies in western blot analysis.     A B C  53                                Figure 3.14: MUSE3 associates with SNC1, but not with RPS2 and CPR1 directly. These are reciprocal Co-IP experiments for Figure 3.13.  A. In planta co-IP of SNC1-FLAG by MUSE3-HA. B. In planta co-IP of RPS2-FLAG by MUSE3-HA.  C. In planta co-IP of CPR1-FLAG by MUSE3-HA. From A to C, N. benthamiana leaves were infiltrated with the Agrobacterium containing the constructs expressing the indicated proteins. Total protein extracts were subjected to immunoprecipitation with either empty agarose beads or anti-HA agarose beads. Input and Beads fractions were detected with anti-HA or anti-FLAG antibodies in western blot analysis.      A B C  54                                    Figure 3.15: The sequential model of how MUSE3 facilitates CPR1-mediated SNC1 and RPS2 degradation.  Firstly, SCFCPR1 complex mediates the transfer of Ub from E2 to the substrates (SNC1 and RPS2) through direct interactions. Subsequently, the ubiquitinated substrates dissociate with SCFCPR1 complex and MUSE3 takes over to transfer additional Ub from E2 to substrates through either direct interaction (SNC1) or unknown component (RPS2). Finally, the polyubiquitinated substrates will become efficient substrates for proteasome degradation.     55 3.4 Discussion   In eukaryotes, selective protein degradation by the ubiquitin-proteasome system primarily requires E1, E2 and E3 enzymes. However, E4 activity is often needed for polyubiquitination of many target proteins to ensure efficient downstream degradation (Koegl et al., 1999; Hoppe, 2005). E4 factors often catalyse polyubiquitin chain assembly in conjunction with E1, E2 and E3 enzymes. The first and best studied example of E4 function is UFD2 encoded by a single copy gene in yeast. In the work of Koegl et al. (1999), UFD2 efficiently facilitates the polyubiquitination of Ub-ProtA, a model UFD substrate, only together with E1, E2 and E3, but not with just E1 and E2, suggesting the requirement of E3 for E4 function on certain substrates (Koegl et al., 1999). Subsequent studies demonstrated that Ufd2p can also act as an E3 ligase as it is able to bind to E2 and its U-box domain is structurally similar to the E3 RING domains (Tu et al., 2007). The two proposed possible working models of Ufd2p and its corresponding E3 Ufd4p are: 1) a sequential model where Ufd2p functions downstream of Ufd4p to add further Ubs to the substrate; 2) a cooperative model in which Ufd2p works in conjunction with E3 Ufd4p for polyubiquitin chain assembly (Tu et al., 2007). Although Ufd2p is an evolutionarily conserved protein present in all eukaryotes, it biological function in plants has never been investigated. From this current study, the putative Arabidopsis E4 factor MUSE3 can complement the yeast ufd2 knockout strain phenotypes (Figure 3.7), suggesting that MUSE3 has E4 activity and is an ortholog of Ufd2p. Since muse3 mutant plants exhibit enhanced disease resistance and elevated levels of NB-LRR R proteins including SNC1 and RPS2 (Figure 3.8 and 3.9D), MUSE3 seems to play negative roles in plant immunity and turnover control of NB-LRR receptors. Since the enhanced resistance in muse3 is only partly due to increased SNC1 accumulation (Figure 3.9), we speculate that MUSE3 probably has multiple targets. Previously it was shown that CPR1, a component of an E3 complex, targets SNC1 for degradation (Cheng et al., 2011; Gou et al., 2012). However, over-expression of MUSE3 in the snc1 background did not affect SNC1 stability and snc1-mediated autoimmunity (data not shown), suggesting that MUSE3 alone cannot alter the stability of SNC1. In support of this, transient co-expression of SNC1 with MUSE3 in N. benthamiana demonstrated that MUSE3 alone is not sufficient to affect SNC1 or  56 RPS2 accumulation (Figure 3.10A and B). However, when expressed with CPR1, MUSE3 can enhance SNC1 and RPS2 degradation in N. benthamiana (Figure 3.10A and B). These biochemical data thus support the sequential model where MUSE3 seems to act downstream of CPR1 to facilitate SNC1 and RPS2 degradation (Figure 3.15). It is likely that Ub is firstly transferred via the E3 SCFCPR1 complex to substrates including SNC1 and RPS2. After adding 1-3 Ub moieties the SCFCPR1 E3 complex may become inactive and dissociate from the substrates. The ubiquitinated substrates may recruit MUSE3 and a E2 in order to transfer additional Ubs from the E2 to the substrates. The polyubiquitinated substrates thus become efficient substrates for proteasome degradation. This sequential model is further supported by our co-IP data showing that MUSE3 associates with SNC1 but not with CPR1 (Figure 3.13A, 3.13C and 3.14A, 3.14C). Although both SNC1 and RPS2 seem to be substrates of MUSE3, we believe that the modes of action of MUSE3 on these targets may be different. SNC1 appears to directly interact with MUSE3 (Figure 3.13 and 3.14) whereas the MUSE3-RPS2 interaction may require an unknown adaptor or facilitator protein. Unlike with SNC1 where polyubiquitinated forms of the protein was never observed on western blots, in half of our co-expression experiments with RPS2 in N. benthamiana, we are able to detect laddering signals that are presumed polyubiquitinated forms of RPS2 (Figure 3.11). The polyubiquitinated RPS2 signals appear to be slightly stronger when co-expressing CPR1 and MUSE3 compared to expressing CPR1 alone (Figure 3.11), suggesting that MUSE3 has E4 activity that is involved in efficient polyubiquitin chain assembly. We are not sure why laddering was not observed consistently in all experiments. It may be due to subtle differences in tissue collection and growth conditions. In addition, higher molecular weight signals above RPS2-FLAG were detected in the beads fraction of our co-IP experiment, which were confirmed to correspond to polyubiquitinated forms of RPS2 by immunobloting with anti-Ub antibody (Figure 3.13B). These polyubiquitinated laddering pattern was never observed for SNC1 samples, indicating that the turnover rate of polyubiquitinated RPS2 and SNC1 is probably different. Even with the application of the proteasome inhibitor MG132, we only observed higher SNC1 accumulation, but never polyubiquitinated forms of the protein (Figure 3.12), indicating that they may be too transient or unstable to be detected.     57 An important avenue of further investigation will be to identify other NB-LRRs being targeted by MUSE3. We do not expect all R proteins to be targeted by MUSE3, since the enhanced immunity of muse3 mutants is not severe (Figure 3.8). How MUSE3 achieves its substrate specificity will be an interesting question to address in future studies  We are also intrigued by the very mild growth defects observed in the muse3 mutants. Although MUSE3/UFD2 family genes are highly conserved in eukaryotes, the phenotypes of the mutants suggest that it is not needed for most other biological processes including general plant growth and development. In yeast and human, UFD2 was found to target many substrates involved in different processes, thus it is unlikely that MUSE3 is solely dedicated to immune response regulation in the plant kingdom. In Arabidopsis genome, there are two E1s, more than 37 E2s and over 1300 potential E3s (Hatfield et al., 1997; Bachmair et al., 2001; Vierstra, 2003). As the most numerous and diverse components of ubiquitination pathways, these E3s determine the specificity of substrates in various biological processes (Smalle and Vierstra, 2004; Liu et al., 2012). MUSE3, as the only E4 identified in Arabidopsis, most likely is helping a variety of E3 ligases for efficient degradation of their substrates. Therefore, it will be important in the future to perform a variety of detailed phenotypic analyses of muse3 mutants in the plant research community in order to reveal other important E3 partners and protein targets of MUSE3 in additional biological processes other than immunity.     3.5 Material and Methods   3.5.1 Plant Growth Conditions and Mutant Screen   All plants were grown in climate-controlled chambers at 22?C under a 16-hour light/8-hour dark cycle. The muse screen using ethyl methane sulfonate (EMS) was carried out as described previously in Chapter 2. muse3-1 was identified from the screen in the mos4-1 snc1 background.    58 3.5.2 Gene Expression Analysis and Pathogen Infections   About 70 mg total plant tissue was collected from either two-week-old seedlings grown on 1/2 MS medium or four-week-old soil-grown plants. RNA was extracted using the Totally RNA kit (Ambion, now part of Invitrogen). Superscript II reverse transcriptase (Invitrogen) was used to UHYHUVHWUDQVFULEH?Jtotal RNA to obtain cDNA. cDNA samples were initially normalized with ACTIN1 by real-time PCR using the QuantiFAST SYBR Green PCR kit (Qiagen). The cDNA was subsequently amplified by PCR. Gene-specific primers for RT-PCR analyses used in this study are listed in Table 3.1.  Infection experiments with the oomycete H. a. Noco2 and P.s.m. ES4326 were performed as described (Li et al., 2001). Briefly, H.a. Noco2 infection was performed on two-week-old seedlings by spraying H.a. Noco2 spore suspension at a concentration indicated in figure legends. Plants were maintained at 18?C under 12-hour light/12-hour dark cycle with 80% humidity, and the infection was quantified seven days after inoculation by counting the number of conidiospores per gram of tissue using a haemocytometer.    3.5.3 Total Protein Extraction and Subcellular Fractionation   50 mg leaf tissue from four-week-old soil-grown plants was harvested and ground into powder using liquid nitrogen. The samples were homogenized in extraction buffer (100mM Tris-HCl pH8, 0.1% SDS, 2% ?-mercaptoethanol). After centrifuging for 5 min at 13200 rpm, the supernatant of each sample was transferred to a new microtube with 4x SDS loading buffer and boiled for 5 min at 95?C. The sample was diluted to 1x loading buffer in final concentration. Western blot analysis was performed afterwards to analyze samples using specific antibodies.  Subcellular fractionation of MUSE3-GFP was carried out as previously described (Cheng et al., 2009). In brief, two-week-old plate-grown seedlings (1g) were harvested and ground to a fine powder in liquid nitrogen and mixed with 2 mL cold lysis buffer (20 mM Tris-HCl, pH 7.4, 25% glycerol, 20 mM KCl, 2 mM EDTA, 2.5 mM MgCl2, 250 mM sucrose, and 1mM  PMSF) .  59 The homogenate was filtered through a 95- and 40- Pm nylon mesh sequentially. The flow-through was spun at 1500g for 10 min, and the supernatant consisting of the cytosolic fraction was collected and mixed with 4? Laemmli loading buffer and heated at 95?C for 5 min. The pellet was washed four times with 3 mL of nuclear resuspension buffer NRBT consisting of 20 mM Tris-HCl, pH 7.4, 25% glycerol, 2.5 mM MgCl2, and 0.2% Triton X-100. The final pellet was mixed with 50 PL of 1? Laemmli loading buffer and heated at 95?C for 5 min. Then, two fractions were loaded on a 10% SDS-PAGE gel for protein separation. Antibodies used for western bolt analyses were as described: anti-Histone H3 (Feys et al., 2005), anti-GFP (Wirthmueller et al., 2007), and anti-PEPC (No?l et al., 2007).    3.5.4 Positional Cloning and Illumina Whole Genome Sequencing   Positional cloning of muse3-1 was performed using a previously described strategy as shown in Chapter 2. The markers used for mapping were designed according to the insertion/deletion or single nucleotide polymorphisms between the genomic sequences of Col and Ler ecotypes that are available on TAIR (http://www.arabidopsis.org). Once the mutation was narrowed down to a small region of about 1Mb, the genomic DNA of mutant seedlings from the mapping population were sequenced with Illumina whole-genome sequencing following the NEB Instruction Manual of ?NEB Next DNA Library Prep Master Mix Set for Illumina?. Briefly, the purified genomic DNA was sonicated into fragments around 300 bp which were set to end-repair, dA-Tailing and adaptor ligation. After removal of unligated adapters, the ligated DNA was enriched by PCR to create genomic DNA library. Then the genomic DNA library was sequenced using an Illumina Genome Analyzer. After comparison with WT genomic sequence, the mutations within the flanking area were shown up for further analysis. The sequences of primers for PCR are shown below:  P1, 5?- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA-3?;  P2, 5?- CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT-3?.    60 3.5.5 Construction of Plasmids   The MUSE3 genomic sequence plus 1.5kb region both upstream the start codon and downstream the stop codon was amplified by primers 5? CGCGGATCCGAAGATCTTAGGTACATTACCG 3? and 5? ACGCGTCGACTTACGATATGGACTGGTCATGC 3? from WT genomic DNA. The amplified fragment was then digested with BamHI and SalI and cloned into the modified pCAMBIA1305-GFP to generate pCAMBIA1305-pMUSE3::MUSE3. For the construction of pCAMBIA1305-pMUSE3::MUSE3-GFP, the fragment containing 1.5kb sequence upstream the start codon of MUSE3 and the MUSE3 genomic sequence without the stop codon was amplified by 5?CGCGGATCCGAAGATCTTAGGTACATTACCG 3? and 5? GTCGACATCAATTAACA 7$7?$IWHU BamHI and SalI digestion, the fragment was ligated into pCAMBIA1305-GFP. These constructs were electroporated into Agrobacterium and subsequently transformed into muse3-1 mos4 snc1 by floral dipping method (Clough and Bent, 1998). For transient expression experiments in N. benthamiana, the coding sequence of MUSE3 was PCR amplified from WT F'1$ XVLQJ SULPHUV ? &****7$&&$7**&*$&*$*&$$$&&7&$ ? DQG ?&*&**$7&&$7&$$77$$&$7$7&$&7*777*7$*?7KHDPSOLILHGIUDJPHQWZDVWKHQdigested with KpnI and BamHI and cloned into pCAMBIA1300-35S-3?HA to generate pCAMBIA1300-35S::MUSE3-3?HA. The plasmid was electroporated into Agrobacterium and used for transient expression and co-immunoprecipitation in N. benthamiana.  For yeast complementation in ufd2, full length MUSE3 cDNA was PCR-cloned into yeast expression vector p425-GPD by primers ? CGCGGATCCATGGCGACGAGCAAACCTCA ? and ? ACGCGTCGACTTAATCAATTAACATATCACTGTTTGTAG ?, using BamHI and SalI digestion sites for inserting MUSE3 behind the GPD promoter. The yeast ufd2 mutant strain was obtained from the yeast deletion collection (Open Biosystems). MUSE3 and empty vector control plasmids were introduced into ufd2 and wild type yeast strains using standard PEG/lithium acetate yeast transformation. Yeast transformants were grown overnight, serially diluted and plated onto the appropriate media to assay for growth.       61 3.5.6 Transient Expression and Co-IP in N. benthamiana   Transient expression in N. benthamiana was performed as described previously (Van den Ackerveken et al., 1996). The IP experiment was carried out following the protocol from Moffett et al. (Moffett et al., 2002), with minor modifications. Agrobacterium strains expressing the target genes with specific tags under 35S promoter were first inoculated in LB media with kanamycin selection and let grown at 28 ?C for 16-18 hours. Then, the bacterial cells were transferred into the new culture media (10.5g/L K2HPO4, 4.5g/L KH2PO4, 1.0g/L (NH4)2SO4, 0.5 g/L Sodium Citrate, 1mM MgSO4, 0.2% glucose, 0.5% glycerol, 50 ?M acetosyringone, and 10 mM N-morpholino-ethanesulfonic acid (MES) (pH 5.6), 50?g/mL Kanamycin) by 1:50 dilution and incubated for 8-12 hours. The bacteria were then pelleted at 4,000 rpms for 10 minutes and resuspended in MS buffer (4.4g/L MS, 10 mM MES, 150 ?M acetosyringone) and two strains were mixed to a final concentration of OD600=0.3 for infiltration on four-week-old N. benthamiana leaves. For protein immunoprecipitation, a 4 g of N. benthamiana tissue was harvested 38 hours after infiltration and ground into fine powder in liquid nitrogen. 2 ml extraction buffer per gram tissue (10% glycerol, 25mM Tris pH 7.5, 1mM EDTA, 150mM NaCl, 10 mM DTT, 2% w/v PVPP, 1% protease inhibitor cocktail) were added to the powder and homogenized by further grinding. The sample was spun at 15,000 g for 10 minutes at 4?C. 90 ?L of the supernatant was saved as input. Then, 30 ?l pre-washed protein A or protein G beads were added into the rest of the supernatant containing 0.15% NP40 (Nonidet P-40 Substitute). After 30 min incubation at 4?C, the mixture was spun at 4,000 rpm for 1 min to remove the beads. The supernatant was transferred to a tube with 30 ?l anti-FLAG M2 beads and incubated with agitation for 3 hours at 4?C. The beads were then spun down at 8,000 rpm for 1 minute at 4?C and washed with 1 ml of extraction buffer containing 0.15% NP40 for 8 times before immunoprecipitated proteins were eluted with 100?l 250?g/ml 3xFLAG peptides. SDS loading buffer was added to each samples and boiled for 5 minutes before running on SDS-PAGE gel for further western blot analysis.     62   Table 3.1: List of primers used in gene expression analysis              Primer name Primer Sequence (5'-->3') PR-1 F GTAGGTGCTCTTGTTCTTCCC R CACATAATTCCCACGAGGATC PR-2 F GCTTCCTTCTTCAACCACACAGC R CGTTGATGTACCGGAATCTGAC SNC1 F GGTAGCGACAATGGAAGACCACG R TTCAGATGTCCCCGATGTCATCCG Actin1 F CGATGAAGCTCAATCCAAACGA R CAGAGTCGAGCACAATACCG  63 4 Mitochondrial AtPAM16 is Required for Plant Survival and Negative Regulation of Plant Immunity2   4.1 Summary   Proteins containing nucleotide binding and leucine-rich repeat domains (NB-LRRs) serve as immune receptors in plants and animals. Negative regulation of immunity mediated by NB-LRR proteins is crucial, as their over-activation often leads to autoimmunity. From the same MUSE forward genetic screen targeting unknown negative regulators of NB-LRR-mediated resistance in Arabidopsis, we identified MUSE5, which is renamed AtPAM16 since it encodes the ortholog of yeast PAM16, part of the mitochondrial inner membrane protein import motor. Consistently, AtPAM16-GFP localizes to mitochondrial inner membrane. AtPAM16L is a paralog of AtPAM16. Double mutant Atpam16-1 Atpam16l is lethal, indicating that AtPAM16 function is essential. Single mutant Atpam16 plants exhibit smaller size and enhanced resistance against virulent pathogens. They also display elevated reactive oxygen species (ROS) accumulation. Thus AtPAM16 seems to be involved in importing a negative regulator of plant immunity into mitochondria, thus protecting plants from over-accumulation of ROS and preventing autoimmunity.    4.2 Introduction   Higher plants depend on their sophisticated immune systems to survive in nature. Two major types of immune receptors are responsible for microbial pathogen recognition and activation of                                                  2 A portion of this section has been published. Yan Huang, Xuejin Chen, Yanan Liu, Charlotte Roth, Charles Copeland, Heather E. McFarlane, Shuai Huang, Volker Lipka, Marcel Wiermer and Xin Li. (2013) Nature Communications, in press.   64 downstream defense responses (Dangl and Jones, 2001; Chisholm et al., 2006). PAMPs (pathogen-associated molecular patterns; also termed MAMPs, microbe-associated molecular patterns) are recognized by plasma membrane-residing pattern recognition receptors (PRRs) to activate PAMP-triggered immunity (PTI). Successful pathogens are able to deliver specialized effectors (also termed Avirulence (Avr) proteins) into the host cell, which often perturb PTI to promote pathogen infection. On the other hand, plants have evolved resistance (R) genes to thwart pathogen infestation. These intracellular immune receptors recognize effectors to trigger a robust response termed effector-triggered immunity (ETI) (Dangl and Jones, 2001; Chisholm et al., 2006),  which often includes the accumulation of the plant hormone salicylic acid (SA), induction of PATHOGENESIS-RELATED (PR) genes, production of reactive oxygen species (ROS) and a localized cell death referred to as the hypersensitive response (HR). Since ETI is often a much stronger response compared with PTI, R protein-mediated plant immunity plays a central role in defeating adapted pathogen invasion. The majority of R proteins belong to the nucleotide-binding and leucine-rich repeat (NB-LRR) class (Dangl and Jones, 2001), which can be further divided into two subclasses, based on the presence of a Toll/Interleukin-1-receptor-like (TIR) or a coiled-coil (CC) domain at the N terminus (Maekawa et al., 2011). Although many NB-LRR-encoding genes have been cloned in different plant species, it remains unclear how R proteins are activated.  Arabidopsis SNC1 (SUPPRESSOR OF NPR1-1, CONSTITUTIVE 1) encodes a TIR-type NB-LRR protein (Li et al., 2001; Zhang et al., 2003).  In the gain-of-function mutant allele snc1, a point mutation in the linker region between the NB and LRR results in a Glu to Lys change, which leads to constitutive activation of defense responses without pathogen interaction. This mutant provides us with an ideal tool to study R protein-mediated immunity. To identify positive regulators of ETI, forward genetic suppressor screens were carried out to identify mutants that can suppress the autoimmune phenotypes of snc1. From these screens, we identified over ten mos (modifier of snc1) mutations, which revealed that RNA processing, protein modification, epigenetic control of gene expression, and nucleocytoplasmic trafficking are important molecular events in R protein-mediated immunity (Johnson et al., 2012). Both MOS4 and MOS2 were identified as important positive regulators from the screens. MOS4 is a component of the nuclear spliceosome-associated MOS4-associated complex (MAC), which functions in regulating the proper splicing of R genes (Palma et al., 2007; Xu et al., 2012). MOS2 contains one G-patch  65 domain and two KOW motifs and is predicted to be involved in RNA processing pathways to regulate plant immunity (Zhang et al., 2005). The success of the MOS screen exemplifies the power of the unique snc1 autoimmune model system to help dissect molecular events in ETI.  Here we report the identification and characterization of MUSE5, which encodes the ortholog of the Saccharomyces cerevisiae pre-sequence translocase-associated protein import motor (PAM) subunit PAM16 of the inner mitochondrial membrane. Although mitochondria have traditionally been believed to contribute positively to plant immunity through ROS JHQHUDWLRQRXUVWXG\UHYHDOHGDQXQH[SHFWHGQHJDWLYHUHJXODWLRQRQPLWRFKRQGULD?VSRVLWLYHroles in plant defense. This regulation is probably achieved by a nuclear encoded negative regulator of ROS generation, whose import into the mitochondrial matrix relies on AtPAM16.   4.3 Results   4.3.1 Characterization of muse5-1 mos4 snc1   The triple mutant muse5-1 mos4 snc1 was isolated from the mutagenized mos4 snc1 population same as muse3-1. This triple mutant reverts from the wild type (WT)-like phenotype of mos4 snc1 to a dwarf morphology similar to snc1 (Figure 4.1A). When the triple mutant was backcrossed with mos4 snc1, the F1 plants were all WT-like, indicating that muse5-1 is recessive. To determine the defense phenotype of muse5-1 in the mos4 snc1 background, the expression of PR-1 and PR-2 was examined by RT-PCR. As shown in Figure 4.1B, the expression of PR-1 and PR-2 was increased by muse5-1 in mos4 snc1 but not as strongly as in snc1. Consistently, the muse5-1 mos4 snc1 plants showed much stronger pPR-2::GUS staining than mos4 snc1 (Figure 4.1C). To test whether muse5-1 alters resistance against a virulent pathogen, muse5-1 mos4 snc1 seedlings were challenged with the oomycete H.a. Noco2. As shown in Figure 4.1D, the enhanced resistance response of snc1 was restored in the triple mutant. Taken together, these results show that muse5-1 enhances all aspects of snc1-mediated autoimmunity in the mos4 snc1 background.  66                          Figure 4.1: Characterization of the muse5-1 mos4 snc1 triple mutant.  A. Morphology of three-week-old soil-grown plants of wild type (WT), snc1, mos4 snc1 and muse5-1 mos4 snc1. Scale bar represents 1 centimeter (cm).  B. PR-1 and PR-2 expression in WT, snc1, mos4 snc1 and muse5-1 mos4 snc1 as determined by RT-PCR. Total RNA was extracted from two-week-old plants grown on 1/2 MS medium and reverse transcribed to cDNA. PR-1, PR-2 and Actin-1 were amplified by 28 cycles of PCR using equal amounts of total cDNA, and the products were analyzed by agarose gel electrophoresis followed by ethidium bromide staining.  C. GUS staining of two-week-old plate-grown seedlings of WT, snc1, mos4 snc1 and muse5-1 mos4 snc1. All plants carry the pPR-2::GUS reporter gene.  D. Quantification of H.a. Noco2 sporulation on the indicated genotypes. Two-week-old plants were inoculated with H.a. Noco2 at a concentration of 105 spores per ml of water. The spores were quantified with a hemocytometer seven days after infection. Bars represent means ? SD (n=4 with 5 plants each). Similar results were obtained in three independent experiments.       A B C D  67 4.3.2 Positional Cloning of muse5-1   To identify muse5-1, a positional cloning approach was utilized. As muse5-1 mos4 snc1 is in Columbia (Col) background, the mapping cross was carried out with the original triple mutant and Landsberg erecta (Ler). The F1 plants were allowed to self-fertilize and 24 F2 plants with similar morphology as muse5-1 mos4 snc1 were selected as a crude mapping population. The muse5-1 mutation was mapped to the bottom of chromosome 3 by linkage analysis and was further flanked between markers F24B22 and F2A19 using an additional 72 triple mutant-like F2 plants (Figure 4.2A). To create a larger fine mapping population, progeny from several F2 lines heterozygous for the muse5-1 mutation and homozygous at the SNC1 locus (snc1) and MOS4 locus (either WT MOS4 or mos4) were used to avoid interference from these two loci. Out of 383 plants from the F3 fine mapping population, 35 recombinants were collected and further analyzed using markers between F24B22 and F2A19. The muse5-1 mutation was eventually mapped between markers F17J16 and T16L24, a distance of 170 kb, which was located on BAC clone F25L23 (Figure 4.2A). To find the muse5-1 mutation, genomic DNA of plants with the muse5-1 mos4 snc1 genotypes from the mapping population was extracted and sequenced with Illumina whole genome sequencing. After sequence comparison between the muse5-1 mutant DNA and the Arabidopsis reference genome, only one candidate mutation was found in the mapped region (Table 4.1). Direct Sanger sequencing of the candidate gene using muse5-1 mos4 snc1 mutant genomic DNA confirmed the G to A transition in At3g59280, which occurred at an intron-exon splice junction site (Figure 4.2B). To test whether this mutation affects the splicing pattern of At3g59280, the cDNA of At3g59280 was amplified by RT-PCR using RNA extracted from both muse5-1 mos4 snc1 and WT plants. Comparison of the cDNA sequences of muse5-1 and the WT confirmed an aberrant splicing pattern of At3g59280 in muse5-1, resulting in a G nucleotide deletion after the start codon (Figure 4.2C). As a consequence of the reading frame shift, the MUSE5 protein product is no longer produced.  MUSE5 is a small conserved protein which belongs to the DnaJ chaperon superfamily (Figure 4.2D). There is one predicted paralog of MUSE5 (At5g61880, named MUSE5L) in Arabidopsis. MUSE5 shares 35% amino acid sequence identity to the S. cerevisiae Pre-sequence translocase-associated protein import motor (PAM) subunit PAM16. Alignment of MUSE5,  68 MUSE5L and PAM16 displays the highly conserved PAM16 domain of the proteins (Figure 4.2E). Within the PAM16 domain, there is a region of about 85 residues that is denoted as J-like domain (Figure 4.2E), which has been shown to be responsible for dimerization with the J-domain of PAM18 (Frazier et al., 2004; D'Silva et al., 2005).    Table 4.1: Mutations found from Illumina sequencing reads between 20 Mb- 22.7 Mb on Chr. 3.                 Accession code Position on Chr.3 Mutation Reads Region Description AT3G56720 21013218 C to T 2/2 exon unknown protein AT3G57300 21206294 C to T 2/2 exon INO80 ortholog AT3G57670 21373095 G to A 2/2 exon C2H2-type zinc finger family protein AT3G58120 21522842 G to A 7/7 exon Basic-leucine zipper (bZIP) transcription factor family protein AT3G59280 21909971 C to T 8/8 intron Protein Transporter, Pam16 AT3G60330 22301755 G to A 2/4 exon H(+)-ATPase 7  69                          Figure 4.2: Positional cloning of muse5-1.  A. Map position of muse5-1 on chromosome 3. BAC clones are indicated.  B. Gene structure of MUSE5 (At3g59280). Boxes indicate exons and lines indicate introns. Grey regions show the UTRs. The two arrows indicate the start and stop codon, respectively. The asterisk indicates where the G to A mutation in muse5-1 occurred.  C. cDNA sequence comparison between MUSE5 and muse5-1. In muse5-1, one nucleotide of the third exon was spliced out due to the G to A mutation at the intron-exon splice junction that FUHDWHVDQHZ?VSOLFHVLWHFDXVLQJDUHDGLQJIUDPHVKLIW  D. Phylogenetic relationship between PAM16 and its orthologs. The orthologs are represented by the species names. Phylogenetic analysis was carried out using software MEGA v5.05. All amino acid sequences were compiled in FASTA format and used to generate alignment first. Maximum likelihood (ML) tree was implemented assessing with 1000 bootstrap replications.  E. Full length amino acid sequence alignments of MUSE5, MUSE5L and PAM16 proteins from S. cerevisiae (Sc) and S. pombe (Sp). The conserved PAM16 domain and degenerate J domain (J-like domain) are underlined by solid and dotted lines, respectively. Black boxes indicate regions in which at least two of three residues are identical and gray boxes indicate conserved residues.    A B C D E  70 4.3.3 Confirmation that MUSE5 is At3g59280   Transgenic complementation was carried out to confirm whether the mutation found in At3g59280 (Figure 4.2B) is responsible for enhancing the snc1 mutant phenotype. Full-length At3g59280 genomic DNA containing 1067 bp sequence before the start codon was PCR-amplified from WT plants and cloned into a binary vector, which was then transformed into the muse5-1 mos4 snc1 triple mutant. Six independent transgenic lines all displayed mos4 snc1-like morphology. Two representative plants from line #1 and #2 are shown in Figure 4.3A. These transgenic plants are slightly smaller than mos4 snc1 as quantified by whole-plant fresh weight analysis (Figure 4.3B). When inoculated with H.a. Noco2, these transgenic plants displayed elevated susceptibility as compared to muse5-1 mos4 snc1 (Figure 4.3C). The intermediate phenotypes of these transgenic plants demonstrate that wild type At3g59280 can mostly, but not fully complement the muse5-1 defects. This could be due to the missing unknown regulatory elements that were not included in the genomic construct of At3g59280. Previously, At3g59280 was named ThaXtomin Resistant 1 (TXR1) since mutants of this gene exhibit insensitivity to the cellulose synthesis inhibitor thaxtomin (Scheible et al., 2003). When we crossed txr1-1 with muse5-1 mos4 snc1, heterozygous F1 plants exhibited snc1-like phenotype (Figure 4.3D), indicating that muse5-1 failed to complement txr1-1. Taken together, our data suggest that MUSE5 is At3g59280/TXR1.   4.3.4 At3g59280/TXR1/MUSE5 is an Ortholog of Yeast PAM16   TXR1/MUSE5 shares 35% amino acid sequence identity to the S. cerevisiae PAM16 (Figure 4.2E), which is a small protein of the inner mitochondrial membrane that is conserved in all fully sequenced eukaryotic genomes. There are two predicted PAM16 paralogs in Arabidopsis, At3g59280/MUSE5/TXR1 and At5g61880. Previously, PAM16, the fifth identified subunit of the PAM, was found to be essential in driving preprotein import into the mitochondrial matrix in S. cerevisiae (Frazier et al., 2004). Thus a yeast complementation experiment was carried out to  71 determine whether MUSE5 is orthologous to PAM16. The pam16-1 allele is a temperature-conditional partial loss-of-function yeast strain generated by error-prone PCR, which grows like the wild-type strain at 30?C, but does not grow at 37?C. At 37?C, only WT and pam16-1 cells expressing TXR1/MUSE5 can grow (Figure 4.4A), suggesting that TXR1/MUSE5 can fully complement the yeast pam16-1 mutant phenotype. To test whether the yeast PAM16 is also able to complement muse5, we cloned yeast PAM16 and stably expressed it under the control of 35S promoter in muse5-1 mos4 snc1 triple mutant. As shown in Figure 4.4B, the representative transgenic plants revert from muse5-1 mos4 snc1 to mos4 snc1-like morphology. This complementing phenotype indicates that the yeast PAM16 and MUSE5 are indeed orthologous. Since TXR1/MUSE5 is an ortholog of yeast PAM16, we renamed At3g59280 as AtPAM16 and At5g61880 as AtPAM16L. The muse5-1 allele is renamed Atpam16-1, and txr1-1 is renamed Atpam16-2.                           72                           Figure 4.3: Confirmation that MUSE5 is At3g59280.  A. Plant morphology of WT, mos4 snc1, muse5-1 mos4 snc1 and muse5-1 mos4 snc1 transformed with a genomic clone of At3g59280. Two representative homozygous T3 plants from independent transgenic events are shown. Scale bar is 1 cm.  B. Fresh weight (FW) of plants of the indicated genotypes when they are three-week-old. Bars represent means ? SD (n=12). The experiments were repeated three times with similar results.  C. Quantification of H.a. Noco2 sporulation on the same genotypes as (A). Ten-day-old plants were sprayed with H.a. Noco2 at a concentration of 105 spores per ml of water. The oomycete spores on the surface of leaves were quantified seven days after inoculation. Bars represent means ? SD (n=4 with 5 plants each). Three independent experiments were carried out and similar results were obtained.  D. Morphology of plants from the allelism test between txr1-1 and muse5-1. F1 was generated from the cross between txr1-1 single mutant and muse5-1 mos4 snc1 triple mutant. Scale bar is 1 cm.      A B C D  73                                Figure 4.4: AtPAM16 and yeast PAM16 can complement each other across kingdoms.  A. Serial 1/10 dilutions of the following yeast strains containing the same number of cells were plated on SD-Leu medium: Left lane, the wild-type (WT) strain expressing empty vector (ev); Middle lane, pam16-1 knockout strain expressing empty vector; Right lane, pam16-1 knockout strain expressing AtPAM16. Yeast plates were incubated for 3 days at the indicated temperatures before the picture was taken.  B. Morphology of WT, mos4 snc1, muse5-1 mos4 snc1 and two representative transgenic T1 plants of muse5-1 mos4 snc1 transformed with 35S-PAM16. The plants were four weeks old when the picture was taken. Scale bar represents 1 cm.      A B  74 4.3.5  AtPAM16 Localizes to Mitochondrial Inner Membrane   To identify the subcellular localization of AtPAM16, a construct containing full-length genomic AtPAM16 DNA, fused with GFP at its C-terminus and driven by its endogenous promoter containing 1067 bp sequence before the start codon, was transformed into the Atpam16-1 mos4 snc1 triple mutant.  Similar to expressing AtPAM16::AtPAM16 in the triple background (Figure 4.3), expressing AtPAM16::AtPAM16-GFP in all 12 transgenic lines also mostly complemented the defects of the triple mutant, suggesting that AtPAM16-GFP is functional, although the plants are slightly smaller than mos4 snc1 (Figure 4.5A and B). These transgenic plants displayed similar susceptibility to H.a. Noco2 as compared with mos4 snc1 (Figure 4.5C). To investigate the subcellular localization of AtPAM16-GFP in vivo, we analyzed leaf and root tissues of the transgenic plants by confocal laser scanning microscopy (CLSM). GFP fluorescence in both leaf and root cells was observed in punctate structures (Figure 4.5D). According to the size and dynamic movement of the AtPAM16-GFP signals within the cells, they are likely to be mitochondria. To confirm mitochondrial localization of AtPAM16, we crossed the transgenic AtPAM16-GFP lines with an established mitochondrial marker line stably expressing CFP fused to a mitochondrial targeting sequence (the first 29 amino acids of S. cerevisiae cytochrome c oxidase IV; mt-ck CS16262) (Nelson et al., 2007). AtPAM16-GFP fluorescence was found to co-localize with mitochondria-targeted CFP (mt-CFP in Figure 4.5E) when root cells of F1 plants were examined by CLSM (Figure 4.5E). Interestingly, at this higher magnification increased fluorescence was observed at the rim of mitochondria, indicating membrane localization (Figure 4.5E). To test whether AtPAM16-GFP localizes to the inner mitochondrial membrane as does yeast PAM16, we utilized two independent strategies, a biochemical proteinase K digestion assay and a transmission electron microscopy (TEM) immuno-gold labeling approach using seedlings expressing the native promoter driven AtPAM16-GFP. As shown in Figure 4.6A, when isolated intact mitochondria were treated with proteinase K, AtPAM16-GFP was resistant to digestion. However, when the same mitochondria were disrupted by sonication, AtPAM16-GFP could be readily degraded upon proteinase K treatment, as could the mitochondrial inner membrane protein cytochrome c. This suggests that AtPAM16-GFP is protected from proteinase  75 K digestion because it is localized inside the mitochondria. In addition, when the same transgenic plants were cryofixed, freeze-substituted, and immunolabeled for TEM, quantification of AtPAM16-GPF signal, as detected by a gold-conjugated anti-GFP antibody, revealed significantly more label on mitochondria (mean ? standard error = 0.00969?0.00064 gold/?m2) as compared to other cellular components (cytoplasm, other organelles, cell wall = 0.00253?0.00016 gold/?m2) in AtPAM16-GPF expressing seedlings, or compared to background signal detected in WT samples not expressing the AtPAM16-GFP transgene (ANOVA, p<0.0001, n=81 measurements for AtPAM16-GFP, 94 measurements for WT; Figure 4.6B and C).  This mitochondrial signal was not detected in WT seedlings without the AtPAM16-GFP transgene (Figure 4.6D), or in AtPAM16-GFP seedlings treated without the primary antibody as a control (Figure 4.6E). All our data suggest that AtPAM16 localizes to the inner membrane of mitochondria like its yeast ortholog PAM16.                    76                                     A B C D E   77   Figure 4.5: AtPAM16-GFP localizes to the mitochondrial membrane.  A. Morphology of  WT, mos4 snc1, Atpam16-1 mos4 snc1 and Atpam16-1 mos4 snc1 transformed with AtPAM16-GFP. Two representative homozygous T3 plants from independent transgenic lines are shown. Scale bar is 1 cm.  B. Fresh weight (FW) of three-week-old plants of the indicated genotypes Bars represent means ? SD (n=12). The experiments were repeated three times with similar results.  C. Quantification of H.a. Noco2 sporulation on the same genotypes as Figure 5A. Ten-day-old seedlings were inoculated with a conidiospore suspension of 105 spores per ml of water. Spores were counted one week after inoculation. Bars represent means ? SD (n=4 with 5 plants each). Three independent experiments were carried out with similar results.  D. Confocal images of AtPAM16-GFP fluorescence in leaf pavement and root cells of soil-grown Atpam16-1 mos4 snc1 transgenic plants expressing AtPAM16-GFP under control of the native AtPAM16 promoter. Cell walls were stained with propidium iodide to visualize the outlines of cells. Scale bars are 20?m.  E. AtPAM16-GFP co-localizes with CFP fused to a mitochondrial targeting sequence. Confocal fluorescence microscopy images of root cells of soil-grown F1 plants grown from a cross between a transgenic plant expressing AtPAM16-GFP under its native promoter in the Atpam16-1 mos4 snc1 background and a transgenic marker line expressing CFP fused to a 29 amino acids mitochondrial (mt) targeting sequence of S. cerevisiae cytochrome c oxidase IV (Nelson et al., 2007). Cell walls were stained with propidium iodide to visualize the outlines of cells. Scale bars are 10?m. At this higher magnification, the image is a bit blurry due to fast movements of the mitochondria.                     78                              Figure 4.6: AtPAM16-GFP localizes to mitochondria inner membrane.  A. Immunodetection of AtPAM16-GFP from isolated mitochondria treated with proteinase K. Intact mitochondria (top panel) or sonication-ruptured mitochondria (lower panel) were treated with 10 mg/ml proteinase K (PK). Cytochrome c, a known mitochondria inner membrane protein, was used as positive control.  B. Immuno-TEM using a gold-conjugated anti-GFP antibody to detect AtPAM16-GFP. Arrowhead points to mitochondria, circles highlight gold particles, scale bar represents 200 nm. C. Quantification of mitochondrial signal relative to background signal in cytoplasm, other organelles, and the cell wall revealed significantly more gold per ?m2 in mitochondria (ANOVA, p<0.0001, n=81 AtPAM16-GFP, n=94 wild type) * indicates a statistically significant difference, error bars represent standard error.  D. Col-0 seedlings without the AtPAM16-GFP transgene treated with anti-GFP. Arrowheads point to mitochondria, circles highlight gold particles, and scale bars represent 200 nm.  E. The AtPAM16-GFP inner mitochondrial membrane signal was not detected in AtPAM16-GFP seedlings treated without a primary antibody. Arrowhead points to mitochondria, circles highlight gold particles, and scale bars represent 200 nm. A B C D E  79 4.3.6 Analysis of Atpam16 Single Mutants   From the snc1-enhancing phenotypes of Atpam16-1, we deduced that AtPAM16 probably serves as a negative regulator of snc1-mediated immunity. To determine its function in the absence of the snc1 mutation, we analyzed the phenotypes of Atpam16-1 (muse5-1), Atpam16-2 (txr1-1) and Atpam16l (At5g61880) single mutants. The Atpam16-1 single mutant was obtained from the F2 generation of a cross between Atpam16-1 mos4 snc1 and WT. We also obtained a T-DNA insertion mutant allele of AtPAM16L, which is homologous to AtPAM16 with 73% similarity (Figure 4.2E). This T-DNA mutant (SALK_061634C) contains an insertion in the second exon of AtPAM16L, likely leading to truncation of the encoded protein. Compared with WT, Atpam16-1 and Atpam16-2 displayed smaller size whereas Atpam16l exhibit no obvious morphological defects (Figure 4.7A). Atpam16-2 plants are consistently slightly smaller than Atpam16-1 plants, suggesting that Atpam16-2 is a stronger allele than Atpam16-1. Single mutant Atpam16-1, Atpam16-2 and Atpam16l plants were slightly more resistant to H.a. Noco2 compared with WT (Figure 4.7B). In addition, when challenged with virulent bacterial pathogen Pseudomonas syringae pv. maculicola (P.s.m.) ES4326, both Atpam16-1 and Atpam16-2 exhibit enhanced resistance compared with WT, while the susceptibility of Atpam16l is similar to WT (Figure 4.7C). The relative expression levels of PR-1 and PR-2 in these three single mutants were constitutively higher than those in WT (Figure 4.7D), with Atpam16-2 showing the highest expression of these defense marker genes. These results indicate that mutations in AtPAM16 cause enhanced disease resistance.  Mitochondria are sites of ROS production which is believed to contribute to R protein-mediated immune responses. Since AtPAM16 is part of the import motor of mitochondria, we examined ROS levels in the Atpam16 mutants via luminol-based chemiluminescence assay and DAB staining. As shown in Figure 4.7E, upon flg22 PAMP peptide treatment, both alleles of Atpam16 exhibited higher ROS levels compared with WT and Atpam16l, with Atpam16-2 showing the highest ROS production. A similar trend was observed with DAB staining. Mutant bir1-1 seedlings were used as positive control, as the mutant accumulates very high levels of hydrogen peroxide resulting in strong DAB staining (Gao et al., 2009). Obvious darker brown staining was observed on Atpam16-2 seedlings compared with WT (Figure 4.7F). The staining is  80 weaker in Atpam16-1, consistent with it being a weaker mutant allele of AtPAM16. Atpam16l displayed much fainter staining that is comparable to that of WT.  We tried to create an Atpam16-1 Atpam16l double mutant. Although 200 F2 plants from the cross between Atpam16-1 and Atpam16l were genotyped to screen for the double mutant, no Atpam16-1 Atpam16l double mutant could be identified. In the F3 generation obtained from 12 F2 plants heterozygous for Atpam16-1 and homozygous for Atpam16l, we still could not obtain the double mutant, indicating that the double mutant is lethal. Since PAM16 is part of the mitochondrial protein import motor, these data suggest that mitochondria protein import is essential for regular plant development and survival. The lethality of the double mutant also indicates that AtPAM16 and AtPAM16L function redundantly, with AtPAM16 playing a more dominant role in plant immunity as compared to its paralog AtPAM16L.    4.3.7 Only Atpam16-1 and Atpam16-2 Enhance snc1-mediated Immunity   To further test the enhancing impact of AtPAM16 mutations on snc1-mediated immune responses, Atpam16-1 snc1, Atpam16-2 snc1 and Atpam16l snc1 double mutants were generated. Both Atpam16-1 snc1 and Atpam16-2 snc1 exhibited snc1-enhancing stunted growth compared with snc1, whereas Atpam16l snc1 is indistinguishable from snc1 (Figure 4.8A). All three double mutants were more resistant to the oomycete pathogen H.a. Noco2 compared with wild type (Figure 4.8B). Thus, snc1-mediated immune response can only be enhanced by Atpam16-1 and Atpam16-2, but not by Atpam16l.     81                                A B C D E F  82   Figure 4.7: Single mutant analysis of Atpam16-1, Atpam16-2 and Atpam16l.  A. Morphology of WT, Atpam16-1, Atpam16-2 and Atpam16l single mutants. The picture was taken from soil-grown plants when they were three-week-old. Scale bar represents 1 cm.  B. Quantification of H.a. Noco2 sporulation in wild type, Atpam16-1, Atpam16-2 and Atpam16l seedlings. Two-week-old plants were inoculated with H.a. Noco2 at a concentration of 105 spores per ml of water. The oomycete spores on the surface of leaves were counted seven days after inoculation. Bars represent means ? SD (n=4 with 5 plants each). The experiment was repeated three times and similar results were observed. Asterisks indicate significant differences of Atpam16-1, Atpam16-2 and Atpam16l compared with WT EDVHGRQ6WXGHQW?Vt test, P < 0.05 (*).  C. Bacterial growth of P.s.m. ES4326 in WT, Atpam16-1, Atpam16-2 and Atpam16l. Leaves of four-week-old plants were infiltrated with a bacterial suspension at OD600 = 0.0005. Leaf discs within the infected area were taken at day 0 and day 3 to quantify colony-forming units (cfu). Bars represent means ? SD (n=5). Asterisks indicate significant differences of Atpam16-1, Atpam16-2 and Atpam16l compared with wild type EDVHGRQ6WXGHQW?V t test, P < 0.05 (*).  D. Relative expression of PR-1 and PR-2 in WT, Atpam16-1, Atpam16-2 and Atpam16l as determined by real time RT-PCR. Total RNA was extracted from four-week-old plants grown on soil and reverse transcribed to cDNA. Both PR-1 and PR-2 expression levels were normalized by Actin-1. Bars represent means ? SD (n=3). The experiment was repeated three times with similar results.  E. Oxidative burst in response to flg22 in WT, Atpam16-1, Atpam16-2 and Atpam16l. Under 12h light/12h dark cycle growth condition, leaf slices of four-week-old plants were treated with 1000 nM flg22 as elicitor. Oxidative burst was indirectly measured as relative light units (RLU) using a luminol-based chemiluminescence assay (Keppler et al., 1989). Three independent experiments (n = 10) were performed with similar results.  F. DAB staining of two-week-old 1/2 MS plate-grown plants of WT, Atpam16-1, Atpam16-2 and Atpam16l. The whole plants and representative leaves are shown. Mutant bir1-1 was used as positive control.   83                                 Figure 4.8: Analysis of Atpam16 snc1 double mutants.  A. Plant morphology of WT, snc1, Atpam16-1 snc1, Atpam16-2 snc1 and Atpam16l snc1. The picture was taken of soil-grown plants when they were three-week-old. Scale bar is 1 cm.  B. Quantification of H.a. Noco2 sporulation in WT, snc1, Atpam16-1 snc1, Atpam16-2 snc1 and Atpam16l snc1 seedlings. Two-week-old seedlings were sprayed with H.a. Noco2 at a concentration of 105 spores per ml of water. The spores were quantified one week after infection. Bars represent means ? SD (n=4 with 5 plants each). Similar results were observed in three independent experiments.       A B  84 4.4 Discussion   4.4.1 AtPAM16 is Orthologous to the Yeast Mitochondrial Import Motor Subunit PAM16 and Essential for Plant Survival   Much of the mitochondrial protein import mechanism has been uncovered from studies using yeast. In eukaryotes, over 98% of mitochondrial proteins are nuclear encoded and about 10-15% of nuclear genes encode mitochondrial proteins that need to be either incorporated into the organelle membrane or imported into the matrix. Proteins targeted to the mitochondrial matrix need to be transported by two distinct transport machineries. The TOM complex transfers proteins across the mitochondrial outer membrane, while the TIM23 complex transports the protein through the inner membrane (Neupert and Herrmann, 2007; van der Laan et al., 2010). PAM16 is part of the import motor of the TIM23 complex that facilitates the import of preproteins together with the mtHSP70 proteins and the co-chaperones Mge1, Tim44 and Pam18. It forms a stable heterodimer with PAM18 and resides on the matrix-side of the mitochondrial inner membrane (Pais et al., 2011). In yeast pam16 mutants, preprotein import into the matrix is defective (Frazier et al., 2004). The analogous and vital preprotein import function of PAM16 in Arabidopsis is supported by our data that Atpam16 Atpam16l double mutant plants are lethal. The conservation of the mitochondrial protein import machinery is also reflected by the fact that most of the TOM and TIM23 complex member-encoding genes can be found in Arabidopsis and other higher eukaryotes.  Using a combination of traditional mapping and next-generation sequencing, we identified MUSE5 as AtPAM16. Several lines of evidence indicate that AtPAM16 is an ortholog of the yeast mitochondrial inner membrane protein import motor PAM16. First, AtPAM16 is able to fully complement a yeast temperature-conditional pam16 allele (Figure 4.4A), while the yeast PAM16 is able to complement Atpam16 defects (Figure 4.4B).  These complementation data indicate that PAM16 is functionally highly conserved among eukaryotes, agreeing with the sequence analysis of PAM16-encoding genes in different organisms (Figure 4.2D). Additionally, in Arabidopsis, expression of the AtPAM16-GFP fusion gene construct complements the  85 Atpam16 defects, suggesting that the fusion protein localizes to the proper subcellular compartment. Indeed, confocal fluorescence microscopy confirmed that AtPAM16-GFP localizes to mitochondrial rims (Figures 4.5D and E), supporting its predicted function as part of the mitochondrial inner membrane protein import motor. In addition, our cryo-TEM and proteinase K digestion assay suggest that AtPAM16 indeed localizes to the inner membrane of mitochondria (Figure 4.6A-C).    4.4.2 Thaxtomin A Toxin from Streptomyces scabies may be Targeting Mitochondria   Previously, an Atpam16-2 mutant allele (named txr1-1) was identified from a forward genetic screen searching for thaxtomin A-resistant mutants (Scheible et al., 2003). Thaxtomin A is a phytotoxin from Streptomyces species, in particular Streptomyces scabies, the causal agent of potato scab. Application of thaxtomin A at a concentration as low as 50 nM causes Arabidopsis seedlings exhibit severe growth retardation as a consequence of cellulose synthesis inhibition (Scheible et al., 2003). The strong effect of thaxtomin A on cellulose synthesis is intriguing (Scheible et al., 2003; Bischoff et al., 2009). One interesting observation Bischoff et al. made is that application of thaxtomin enhances PR gene expression (Figure 2 from Bischoff et al., 2009), which is in agreement with the heightened PR gene expression of Atpam16 mutants (Figure 4.7D). Since our analysis revealed that TXR1 is actually AtPAM16, an alternative model of thaxtoPLQ$?VPRGHRIDFWLRQLVSURSRVHGIt is possible that the cellulose synthesis defects are downstream of its primary toxicity on mitochondria. Thaxtomin A may be targeting a mitochondrial matrix protein that relies on AtPAM16 for import, or it could be directly targeting AtPAM16 itself. Such targeting may serve as a virulence strategy to release a death signal from PLWRFKRQGULDDQGDVVLVWVWKHNLOOLQJRIKRVWFHOOVVRWKDWWKHSDWKRJHQFDQFRQVXPHWKHSODQW?Vphotosynthates. The thaxtomin-resistant phenotype of Atpam16 mutant plants is in agreement with this hypothesis. In Atpam16 mutant plants, this thaxtomin target may no longer be effectively imported into the matrix, thus exhibiting a thaxtomin-resistant phenotype. Future analysis on the effect of the phytotoxin to mitochondria will reveal more accurate relationships between the two.   86 4.4.3 AtPAM16 may be Involved in Importing a Nuclear Encoded Negative Regulator of Plant Immunity into Mitochondria   How does AtPAM16 as part of the mitochondrial inner membrane import motor regulate plant immunity? Mitochondria have long been connected with the hypersensitive response (HR), a programmed cell death (PCD) event that is associated with R protein-mediated immunity. It has been shown that mitochondria release the death signal cytochrome c to the cytosol, leading to the initiation of cell death and subsequent release of molecules such as reactive oxygen species (ROS) that drive the destruction of the cell (Krause and Durner, 2004). Multiple sources and types of ROS are involved in HR development, and it is generally believed that these are directed against pathogens (Mehdy, 1994). Mitochondria are among the multiple organelles that contribute to ROS production. Mutants defective in mitochondrial ROS (mROS) generation exhibit enhanced disease susceptibility to specific fungal and bacterial pathogens (Gleason et al., 2011).  All these studies point to a positive regulatory role of mitochondria during immune responses through ROS generation.  Intriguingly, our mutant analysis of Atpam16 alleles suggests that the positive role of mitochondria in ROS production is negatively regulated. Mutations in Atpam16-1 and Atpam16-2 enhance snc1-mediated autoimmunity (Figure 4.1 and 4.8). Single mutants Atpam16-1, Atpam16-2 and Atpam16l display an enhanced disease resistant phenotype and higher level of PR-1 and PR-2 expression (Figure 4.7B-D). Atpam16 single mutants also exhibit elevated ROS level (Figure 4.7E and F). These observations suggest that AtPAM16 functions in negative regulation of plant immunity through repressing mROS production. Since AtPAM16 is part of the mitochondrial protein import motor, this regulatory role is probably not direct. We propose that AtPAM16 is involved in the import of a nuclear encoded negative regulator of plant immunity into the mitochondrial matrix, along with other protein targets. This negative regulator is responsible for repressing processes such as excessive mROS production, which may lead to autoimmunity or unwanted cell death that would be detrimental to the plant (Figure 4.9A). Mutations in AtPAM16 may therefore attenuate the import of this negative regulator, leading to enhanced immunity (Figure 4.7 and 4.9B).   87 In summary, the plant mitochondria inner membrane import motor AtPAM16 was identified as an important contributor to R protein-mediated immunity, as well as an essential protein in plant survival. This work highlights the significance of negative regulation of mitochondrial activity in plant immunity. Future identification of the AtPAM16 targets will reveal further mechanistic details of how this negative regulation is achieved.                  Figure 4.9: Model of AtPAM16 as a subunit of mitochondria inner membrane import motor for negative regulation of plant immunity.  A. AtPAM16 normally facilitates import of an unknown negative regulator (?) into mitochondria during an immune response. This inhibition helps to prevent autoimmunity due to uncontrolled immune response, such as over-production of ROS.  B. With a mutation in AtPAM16, this negative regulator cannot be fully imported into mitochondria, thus leading to autoimmunity and ROS accumulation due to insufficient repression. Partial import of this negative regulator can still be achieved through AtPAM16L.     A B  88 4.5 Material and Methods   4.5.1 Plant Growth Conditions and Mutant Screen   All plants were grown in climate-controlled chambers under long day conditions (16h light/8h dark cycle) at 22?C. Approximately 10,000 mos4 snc1 mutant seeds were treated with 20mM Ethyl methanesulfonate (EMS) for 18 hours. Roughly 50,000 M2 plants representing around 2,500 M1 families were grown on soil and screened for snc1-like morphology. Seeds of putative mutants were plated on 1/2 MS medium and tested for constitutive pPR-2-GUS reporter gene expression by GUS staining. Mutants with constitutive GUS staining were further analyzed by H. a. Noco2 infection.   4.5.2 Gene Expression Analysis   About 0.07 g tissue was collected from two-week-old seedlings grown on 1/2 MS medium and RNA was extracted using the Totally RNA kit (Ambion, now part of Invitrogen, http://www.invitrogen.com/site/us/en/home/brands/ambion.html). Superscript II reverse transcriptase (Invitrogen) was used to reverse transcribe ?Jtotal RNA to generate cDNA. cDNA samples were initially normalized with ACTIN by real-time PCR using the QuantiFAST SYBR Green PCR kit. The cDNA was subsequently amplified by PCR using 94?C for 2 min and cycles of 94?C for 20 sec, 58?C for 30 sec and 68?C for 1 min. The sequences of primers used are listed in Table 3.1.       89 4.5.3 Pathogen Infections   Infection of H.a. Noco2 was performed on two-week-old soil-grown seedlings sprayed with a concentration of 105 spores/ml water. The inoculated seedlings were subsequently kept in a growth chamber with high humidity (~80%) at 18?C under 12h light/12h dark cycle for seven days before the growth of H. a. Noco2 was quantified by counting spores. For infections with P.s.m. ES4326, five-week-old soil-grown plants were infiltrated with bacterial suspension (OD600 = 0.0005) in 10 mM MgCl2. Leaf punches were taken at day 0 and day 3. Colony-forming units (CFU) were determined after serial dilution and bacterial incubation at 28?C on LB plates (Zhang et al., 2003).   4.5.4 Positional Cloning of muse5-1   Triple mutant muse5-1 mos4 snc1 plants were crossed with wild-type Landsberg erecta. Crude mapping was performed on F2 plants homozygous for muse5-1, and fine mapping was performed on F3 plants derived from F2 plants heterozygous for muse5-1 and homozygous for mos4 and snc1. Both the phenotype and genotype of the recombinants were confirmed in the next generation. The markers used to map muse5-1 were designed according to the insertion and deletion polymorphisms between the genomic sequences of Col and Ler ecotypes, provided by Monsanto on TAIR (http://www.arabidopsis.org).  4.5.5 Transgenic Complementation   A transgenic complementation experiment was conducted to confirm that the mutation identified in At3g59280/TXR1 is muse5-1. Full-length At3g59280/TXR1/AtPAM16 genomic DNA including 1067bp of native promoter sequence was amplified by PCR, cloned into the pCAMBIA1305 vector and transformed into muse5-1 mos4 snc1 plants by the floral dipping  90 method (Clough and Bent, 1998). Transgenic plants from the T2 generation were selected on 1/2 MS plates containing 50 mg/mL of hygromycin to identify homozygous lines. The construct used for TXR1/MUSE5/AtPAM16-GFP analysis was created in the same way but with a vector containing a GFP tag. Seeds of txr1-1 were generously provided by Dr. Wolf-R?diger Scheible. For allelism test between txr1-1 and muse5-1, txr1-1 was crossed with muse5-1 mos4 snc1 to generate F1. Morphologic phenotypes of F1 plants were examined. The sequences of primers used for construction of plasmids and mutant allele genotyping are listed in Table 4.2.   4.5.6 Confocal Microscopy   Confocal images of AtPAM16-GFP and mt-CFP transgenic seedlings were obtained with a Leica SP5 confocal microscope (Leica GmbH, Wetzlar, Germany) at 488 nm excitation for GFP (500-540 nm emission, HyD3 detector), at 548 nm excitation for CFP (465-485 nm emission) and at 561 nm excitation for detection of propidium iodide (600-640 nm emission), which was used at a concentration of 0.05% in H2O for staining cell walls.    4.5.7 Yeast Plasmids   Wild type TXR1/MUSE5 cDNA was PCR-cloned into yeast expression vector p425-GPD, using BamHI and SalI restriction sites for inserting TXR1/MUSE5 behind the GPD promoter. Primers used for cloning are listed in Table 4.2. The previously created pam16-1 mutant was kindly provided by Dr. Peter Rehling (Frazier et al., 2004).       91 4.5.8 Mitochondria Isolation and Proteinase K Digestion Assay   Mitochondria from AtPAM16-GFP transgenic plants were isolated according to a previously established procedure (http://www.edvotek.com/Plants). Briefly, two-week-old plate-grown seedlings (5g) were harvested and ground to a fine powder in liquid nitrogen and mixed with 10 mL cold lysis buffer (20 mM Tris-HCl, pH 7.4, 25% glycerol, 20 mM KCl, 2 mM EDTA, 2.5 mM MgCl2, 250 mM sucrose, and 1mM  PMSF) . The homogenate was filtered through a 95 ?m and 40 ?m nylon mesh sequentially. The flow-through was spun at 4?C, 700g for 10 min to pellet the nuclei and cell debris. The supernatant was transferred and centrifuge at 4?C at 10000g for 10 min. The pellet at the bottom is enriched with intact mitochondria. The pellet was further washed using suc washing buffer (0.3 M sucrose, 10mM Tris, 0.2% BSA) and centrifuged at 4?C at 10000g for 10 min to obtain relatively pure mitochondria. The isolated mitochondria were resuspended in 100 ?l of 0.4 M Suc, 50mM Tris, 3mM EDTA, 0.1 % (W/V) BSA, pH 7.5. The mitochondria suspension was further subjected to 10 mg/ml proteinase K digestion. Samples were incubated on ice for 10, 20, 30 and 40 min individually before adding 35 ?l 4? Laemmli loading buffer and heated at 95?C for 5 min. Sonication-disrupted mitochondria solution was used as control for proteinase K digestion.    4.5.9 Cryofixation Immune-gold Labelling for TEM   AtPAM16-GFP transgenic plants were used in cryo-TEM for subcellular localization. Seven-day old seedlings were high-pressure frozen in 1-hexadecene in B-type sample holders (Ted Pella) using a Leica HPM-100. Samples were freeze-substituted in 0.1% uranyl acetate, 0.25% glutaraldehyde, and 8% dimethoxypropane in acetone for five days, then brought to room temperature and infiltrated with LR white resin (London Resin Company) over four days.  Immunolabeling was performed (McFarlane et al., 2008) using 1/100 anti-GFP (Invitrogen A6455) and 1/100 goat-anti-rabbit conjugated to 10 nm gold (Ted Pella).  Samples were viewed using a Hitachi 7600 TEM at 80 kV accelerating voltage with an AMT Advantage CCD camera  92 (Hamamatsu ORCA).  AtPAM16-GFP signal was quantified relative to background by counting the number of gold particles per ?m2 of mitochondria relative to the gold per ?m2 of other cellular contents (cytoplasm, other organelles, and cell wall) using ImageJ.  Mean gold per ?m2 was compared between mitochondria and the rest of the cell in AtPAM16-GFP and WT without the transgene using ANOVA, n=81 measurements from 8 independent seedlings from two independent transgenic AtPAM16-GFP lines, and 94 measurements from WT.   4.5.10 Creating Mutants   To identify the Atpam16-1 single mutant, Atpam16-1 mos4 snc1 was crossed with WT containing pPR-2-GUS. F2 plants were genotyped for the Atpam16-1, mos4 and snc1 loci by genotype-specific PCR using primers listed in Table 4.2. Lines homozygous for Atpam16-1 without mos4 and snc1 mutations were regarded as Atpam16-1 single mutants. Lines homozygous for Atpam16-1 and snc1 with no mos4 mutation were kept as Atpam16-1 snc1 double mutants. T-DNA insertion mutant Atpam16l was obtained from the Arabidopsis Biological Resource Centre (ABRC). Plants homozygous for the T-DNA insertions were identified by PCR (Table 4.2). To create the Atpam16-1 Atpam16l double mutant, Atpam16-1 single mutant was crossed with Atpam16l. In the F2 generation, ~200 plants were genotyped by PCR. The Atpam16-2 snc1 and Atpam16l snc1 double mutants were obtained by crossing Atpam16-2 or Atpam16l to snc1 and the double mutants were identified in F2 by genotyping.   4.5.11 DAB Staining   DAB staining was performed on two-week-old seedlings grown on 1/2 MS medium, following a previously described procedure (Bindschedler et al., 2006). Briefly, the seedlings were soaked with 2 ml DAB solutions (1 mg/ ml DAB, 0.05% v/v Tween 20 and 10 mM Sodium Phosphate  93 buffer pH 7.0) in a 24-well tissue culture plate and vacuumed for two minutes before incubating on an orbital shaker. After one hour incubation, the staining solution was removed and the samples were destained with 95% ethanol and examined by microscopy for brown deposition.   4.5.12 Oxidative Burst Detection   ROS production from leaves was measured with a previously reported luminol-based assay (Keppler et al., 1989). In brief, plants were grown in climate-controlled chambers under 12h light/12h dark cycles at 22?C. Leaves of 4-week-old soil grown plants were sliced into approximately 1mm segments and floated in wells overnight on H2O under light. H2O was replaced with reagent containing luminol, peroxidase and flg22. ROS released by leaf tissue was detected by luminescence of luminol.                   94   Table 4.2: List of primers used in this study  a) Primers used to genotype Atpam16-1, Atpam16-2 and Atpam16l mutations  Primer name Primer Sequence (5'-->3') Atpam16-1 Common-F GGTTTCCTCCTCCTCTCTTC Wt-R TTTGCAAGTAGTCTCCCAGCC Mutant-R TTTGCAAGTAGTCTCCCAcCt Atpam16-2 Common-F tgagctggcttgaatttggac Wt-R TCTAGACATTCTTTGGCTCG        Atpam16l SALK_061634-LP TTGCTTCTCCATGACCTTGG   SALK_061634-RP TTTATTGCTTGTTCATGCGC   b) Primers used to plasmid construction  Primer name Primer Sequence (5'-->3') Restriction enzyme used  AtPAM16-BamHI-F CGCGGATCCctagagacgattcaaagcag BamHI  SalI AtPAM16- SalI-R(with GFP):     ACGCGTCGACACTAGGTGTACCGTTGCCTT AtPAM16- BamHI-F CGCGGATCCctagagacgattcaaagcag AtPAM16- SalI-R(without GFP) ACGCGTCGACaaagaaaccggattcagagg AtPAM16-CDS-BamHI-F CGCGGATCCATGGCTGGGAGACTACTTG AtPAM16-CDS-SalI-R ACGCGTCGACTTAACTAGGTGTACCGTTGC                      95 5 Discussion and Future Perspectives   Plants respond in a variety ways to microbial pathogens that cause great agricultural losses, both in quantity and quality. Better understanding of the plant immune system will greatly help us to develop sustainable strategies for disease control. As sessile organisms, plants depend on the innate immune system, which has evolved multiple layers of defense mechanisms to tackle invading pathogens. Among plant host-pathogen interactions, R protein-mediated defense is the most effective defense mechanism, and can be activated by either direct detection of secreted pathogen-derived Avr factors or detection of their activities (Chisholm et al., 2006; Jones and Dangl, 2006). The majority of R proteins contain an intracellular nucleotide binding (NB) and leucine-rich repeats (LRRs) (DeYoung and Innes, 2006), termed as NB-LRR R proteins. The NB-LRR R activation has been shown to signal through either downstream EDS1/PAD4 complex or NDR1 and usually culminates in localized programmed cell death known as HR, in order to restrict pathogen growth (N?rnberger and Scheel, 2001; Greenberg and Yao, 2004; Wiermer et al., 2005). In Arabidopsis, the gain-of-function mutant snc1 (suppressor of npr1-1, constitutive1), carries a unique mutation in a NB-LRR R protein, and displays constitutively activated defense marker genes and increased resistance against both bacterial and oomycete pathogens (Li et al., 2001; Zhang et al., 2003). More importantly, unlike other gain-of-function R protein mutants which result in global cell death or even lethality (Bendahmane et al., 2002; Shirano et al., 2002; Palma et al., 2010), snc1 does not show any macroscopic or microscopic cell death (Li et al., 2001). Consistent with other autoimmune mutants, however, the snc1 mutant also exhibits a typical type of dwarfism, such as stunted growth and curled leaves.  Since snc1 functions upstream of defense signaling, and it is constitutively activated without HR lesions, it is a useful tool to dissect downstream defense-related components including both positive and negative regulators that are involved in R protein activation. To search for positive signaling components, snc1 suppressor screens were performed using multiple mutagenesis strategies, which are collectively referred to as the Modifier of snc1 (MOS) screen. Fifteen MOS genes have been identified from the screen, which encode proteins that have been characterized to function in epigenetic regulation (Li et al., 2010a; Xia et al., 2013), RNA  96 processing (Zhang et al., 2005; Palma et al., 2007; Xu et al., 2012), nucleocytoplasmic trafficking (Palma et al., 2005; Zhang and Li, 2005; Cheng et al., 2009; Germain et al., 2010), transcriptional repression (Zhu et al., 2010) and protein modifications (Goritschnig et al., 2007; Goritschnig et al., 2008). The diverse functions of MOSes suggest that the activation of R protein-mediated resistance requires precise regulation at various levels.    5.1 The MUSE Screen and Its Significance   Both the positive and negative regulatory machinery, which form the sophisticated signaling pathways of plant innate immunity, should be under finely tuned control to achieve their proper purpose. Since mutant phenotypes with autoimmunity are mostly associated with dwarfism, negative regulators seem especially important for the regulation of plant resistance in term of plant growth and development. To identify such negative regulators, a modified snc1 enhancer screen was conducted. The reasons for utilizing mos snc1 but not snc1 as background for mutagenesis are: a) It may be very difficult to identify mutants with stronger enhanced disease resistance (edr) phenotypes than snc1 due to the pronounced autoimmunity of snc1; b) The mutants may be too small to survive; c) It makes it possible to isolate mutants that only exhibit minor phenotypes by themselves, but are able to significantly enhance snc1-associated autoimmune phenotypes; d) Keeping the unique snc1 mutation provides both a sensitized background to measure mild edr and convenient morphological phenotype during positional cloning.  As discussed previously, MOS2, MOS4 and MOS4-associated complex (MAC) have been implicated in plant immunity through functioning in RNA processing, but the precise mechanisms remain elusive (Zhang et al., 2005; Palma et al., 2007). In order to further investigate their functions in detail, the mutant, snc1-enhancing (MUSE) genetic screen originally aimed to search for negative regulators which may act in either MOS2/MOS4-dependent or independent signaling pathways. So far, it seems that almost all the muse mutants  97 identified function independent of MOS2 or MOS4. Several well-studied negative regulators were identified from muse screen (Table 1.1), supporting the validity of screen concept. Moreover, most of the MUSE genes seem novel and encode negative regulators that have not yet been well studied in plant immune regulatory pathways.  Overall, the MUSE genetic screen, performed subsequent to the MOS screen and aimed at detecting negative regulators in plant immunity, has also been shown to be another successful screen.    5.2 Negative Regulators of SNC1 Identified from MUSE Screen   Under normal circumstances, the cellular accumulation of NB-LRR R proteins must be under tight negative control to prevent unwarranted autoimmunity. However, the mechanisms by which these NB-LRR R proteins are negatively regulated are still unclear. The identification and characterization of the diverse functions associated with MOS genes suggest that snc1-mediated immunity is regulated by various cellular processes and pathways. Recently, studies of a number of SNC1-dependent autoimmune mutants, including bon1 (bonzai 1), bap1 (bon1-associated protein 1), bak1 ( brassinosteroid-associated kinase 1 ), bir1 (bak1 interacting receptor-like kinase 1), mkp1 (map kinase phosphatase 1), cpr1 (constitutive expressor of PR genes 1) and srfr1 (suppressor of rps4-RLD), reveal that SNC1 might be under a complex negative regulation from transcriptional to post-translational level by molecules with diverse functions and subcellular localizations (Yang and Hua, 2004; Yang et al., 2006; Li et al., 2010b; Cheng et al., 2011; Wang et al., 2011; Gou and Hua, 2012). Among them, BON1 and CPR1 mutant alleles were also identified from the MUSE screen, demonstrating that MUSE screen is successful. Similar to snc1, loss-of-function mutations in BON1 constitutively activate defense responses. The autoimmune phenotypes of bon1 can be largely suppressed by knocking out SNC1. Also, the SNC1 transcript level was found to be greatly increased in bon1 mutant compared to wild type (Yang and Hua, 2004). All these data indicate that the enhanced disease resistance in bon1 is mainly dependent on SNC1 and BON1 negatively regulates SNC1 at transcriptional level. However, this regulation may not be direct. Firstly, BON1 is a plasma  98 membrane localized protein, whereas SNC1 localizes in both cytoplasm and nucleus (Hua et al., 2001; Cheng et al., 2009). Secondly, a positive feedback regulation of SNC1 exists, in which the accumulation of SA due to defense activation will in turn up-regulate defense gene expression, including SNC1. Further study shows that the elevation of SNC1 transcript in bon1 can be inhibited by introducing either pad4 or nahG to block the feedback loop, indicating that negative regulation of SNC1 transcripts by BON1 is accomplished indirectly. CPR1, an F-box protein in SCF (Skp1-cullin-F-box) E3 complex was identified as a negative regulator of at least two NB-LRR R proteins including SNC1 (Cheng et al., 2011; Gou et al., 2012). Like bon1 and other autoimmune mutants, cpr1 also displays constitutive defense responses. The loss of SNC1 function suppresses the autoimmunity of cpr1, while over-expression of CPR1 in the same way suppresses snc1 mutant phenotypes. In cpr1 mutant, SNC1 protein accumulates to high level but with similar wild type SNC1 transcripts after introducing pad4 mutation to block the positive feedback loop. All these results suggest that CPR1 negatively regulates SNC1 accumulation. CPR1 functions as a component of an SCF E3 complex?it is most likely that CPR1 targets SNC1 for degradation. Further studies found that CPR1 interacts with SNC1 in vivo and inhibition of SNC1 accumulation by CPR1 is 26S proteasome-dependent as a protease inhibitor MG132 rescues the reduction of SNC1 by CPR1. The functional studies on CPR1 highlight that the ubiquitin/proteasome pathway is involved in plant immunity through negative regulation of plant NB-LRR R proteins, which prevents autoimmunity. It is likely other unknown SNC1 regulators could be found in MUSE screen. Future studies on the growing number of identified negative regulators of SNC1 will contribute together to reveal the regulatory network of NB-LRR R proteins in plant immunity.   5.3 Putative Ubiquitin Conjugating E4 Factor ? MUSE3   muse3-1, identified from the MUSE screen in the mutagenized mos4 snc1 population using EMS, enhances snc1-mediated autoimmunity in the mos4 snc1 background (Figure 3.1). Positional cloning combined with Illumina whole genome sequencing identified a C to T substitution  99 occurred in the tenth exon of At5g15400, converting Q789 to an early stop codon and truncating the predicted U-box domain (Figure 3.2). The predicted MUSE3 protein is a putative ubiquitin conjugating E4 factor and shows amino acid sequence homology to yeast UFD2 and human UBE4A/4B (Figure 3.4). Yeast UFD2 is the best studied E4 ubiquitin ligase, which was found to promote ubiquitin chain elongation of various target substrates (Hoppe, 2005). Previously, the yeast knockout strain ufd2' was shown to exhibit growth defects including sensitivity to ethanol or hydroxyurea at 37?C (Koegl et al., 1999). Consistent with its homology with yeast UFD2, MUSE3 is able to complement the ufd2 knockout phenotypes (Figure 3.7), suggesting that MUSE3 is orthologous to yeast E4 ligase UFD2 and may be also involved in ubiquitin chain elongation. Supporting the MUSE screen concept, single mutant analysis showed that muse3 mutants are WT-like, with slightly smaller size compared to WT plants, but exhibit enhanced disease resistant phenotypes (Figure 3.8). Similar to cpr1 mutant, SNC1 accumulates more in muse3 at translational level. Knocking out SNC1 only partially suppresses the constitutive defense responses in muse3-2 (a T-DNA allele) and RPS2-HA level in muse3-2 was also found to be increased (Figure 3.9). These data suggest that MUSE3 may negatively regulate the stability of SNC1 and RPS2. However, over-expression of MUSE3 in the snc1 background has no effect on snc1 stability, suggesting that MUSE3 may only have an assistant instead of dominate role in terms of SNC1 degradation. Further experiments demonstrated that MUSE3 facilitates the degradation of SNC1 and RPS2 downstream of CPR1 through different mechanisms; co-immunoprecipitation (IP) revealed that MUSE3 interacts with SNC1 but not with RPS2 or CPR1 (Figure 3.10). This study is the first report on E4 functions in plants and adds another key step in NB-LRR R protein turnover mediated by ubiquitin/proteasome pathway. Future investigation will be focused on searching for both MUSE3 corresponding E3 ubiquitin ligases and their targets. Like UFD2, studies on CPR1 and MUSE3 provide evidence to support the sequential model, in which MUSE3 functions downstream of CPR1 to facilitate the degradation of ubiquitinated substrates (SNC1 and RPS2) through either direct interaction (in the case of SNC1) or via unknown components (in the case of RPS2) (Figure 3.12). As MUSE3 is the only E4 encoding gene in the Arabidopsis genome, it is very likely that other E3 ubiquitin ligases which require MUSE3 function to degrade certain substrates may exist. How the specificity of E3-MUSE3-substrate  100 interactions is attained will be an interesting question to address. Other potential MUSE3 substrates are as discussed below? a) Immunity-related NB-LRR R proteins. Since muse3 mutants only exhibit mild enhanced disease resistance, it is reasonable to hypothesize that not all NB-LRR R proteins are targeted by MUSE3. Identification of NB-LRR R proteins that are targets of MUSE3 and comparison of which to those that are not regulated by MUSE3 may contribute to uncover how substrate specificity is achieved and the correlation of MUSE3 with plant immunity.  b) Immunity-unrelated proteins. Knocking out MUSE3 does not cause plant lethality, suggesting that MUSE3 E4 function is not essential for plant survival. While the MUSE3 homologs in yeast and human have been shown to have targets with diverse functions, MUSE3 may also have substrates involved in different biological processes. Identification and characterization of those proteins which are specifically targeted by MUSE3 will provide insight into the nearly blank E4-mediated regulation in plant kingdom.   5.4 Protein Transporter? MUSE5   muse5-1 was identified from the same MUSE screen as muse3-1. Like muse3, mutation of MUSE5 also enhances snc1-associated morphological and defense phenotypes in mos4 snc1 background (Figure 4.1). The same cloning strategy used to identify muse3-1 was utilized and identified a G to A transition within an intron-exon splice junction site in At3g59280, resulting in a reading frame shift (Figure 4.2). MUSE5 encodes a conserved protein with homology to the S. cerevisiae PAM subunit PAM16, which is a small protein localized in the mitochondrial inner membrane. MUSE5 has a predicted paralog in Arabidopsis. Previous study showed that PAM16, the fifth identified subunit of the PAM, is essential in driving preprotein import into the mitochondrial matrix in S. cerevisiae (Frazier et al., 2004). muse5-1 is allelic to txr1-1 which was identified as a mutant resistant to the cellulose synthesis inhibitor thaxtomin (Scheible et al., 2003) (Figure 4.3). Complementation tests demonstrated that TXR1/MUSE5 and yeast PAM16 can fully complement the yeast pam16-1 and Arabidopsis muse5-1 mos4 snc1 mutant phenotypes, respectively (Figure 4.4); this indicates that they are orthologous. Consistently, AtPAM16 also  101 localizes to the inner membrane of mitochondria (Figure 4.5 and 4.6). Similar to muse3, Atpam16 mutants are WT-like with smaller size whereas Atpam16l exhibit identical WT-like morphology (Figure 4.7A). In infection experiments, Atpam16 displays a stronger enhanced disease resistance phenotype than Atpam16l, and Atpam16-2 is a stronger mutant allele of AtPAM16 (Figure 4.7). The lethality of Atpam16-1 Atpam16l double mutant indicates the two genes function redundantly and their function is essential for regular plant development and survival. Double mutant analysis suggests that the snc1-mediated immune response can only be enhanced by Atpam16, but not by Atpam16l (Figure 4.8), suggesting that AtPAM16 plays a more dominant role in plant immunity compared to AtPAM16L.  Mitochondria have been shown to have a positive regulatory role during defense responses through ROS production (Mehdy, 1994; Krause and Durner, 2004; Gleason et al., 2011). The identification and mutant analysis of Atpam16 indicate that the positive regulation of mitochondria in ROS generation is negatively regulated. In yeast pam16 mutants, preprotein import into the matrix is defective (Frazier et al., 2004). Since AtPAM16 is orthologous to the yeast PAM16, Atpam16 could also have defects in importing preprotein into the mitochondrial matrix. Accordingly, a possible working model of AtPAM16 as a subunit of mitochondria inner membrane import motor is proposed, in which AtPAM16 playing a dominant role together with AtPAM16L to import unknown negative regulator(s) into mitochondria, which may suppress over-accumulation of mitochondrial ROS (mROS), and thus negatively regulates immune responses. Comparing proteomic profiling of mitochondria between WT and Atpam16 would potentially lead to the identification of the proposed AtPAM16 targets. Alternatively, AtPAM16 targets can be isolated through either yeast two-hybrid screen or co-IP experiments with AtPAM16 as bait. Studies on those targets will further reveal the details of the molecular mechanism through which negative regulation of mitochondrial activity in plant immunity is accomplished. Overall, my Ph.D. thesis identified two new negative regulators involved in plant immunity. Functional characterizations of MUSE3 and AtPAM16 highlight a key step in NB-LRR R protein stability through ubiquitin/proteasome pathway and the significance of negative regulation of plant immunity in mitochondria, respectively. My thesis work contributes to uncover the sophisticated negative regulatory network in plant immune system.    102 References   Aarts, N., Metz, M., Holub, E., Staskawicz, B.J., Daniels, M.J., and Parker, J.E. (1998). Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis. Proc Natl Acad Sci U S A 95, 10306-10311. Aksaas, A.K., Larsen, A.C., Rogne, M., Rosendal, K., Kvissel, A.K., and Sk?lhegg, B.S. (2011). G-patch domain and KOW motifs-containing protein, GPKOW; a nuclear RNA-binding protein regulated by protein kinase A. J Mol Signal 6, 10. Aravind, L., and Koonin, E.V. (1999). G-patch: a new conserved domain in eukaryotic RNA-processing proteins and type D retroviral polyproteins. Trends Biochem Sci 24, 342-344. Asai, T., Tena, G., Plotnikova, J., Willmann, M.R., Chiu, W.L., Gomez-Gomez, L., Boller, T., Ausubel, F.M., and Sheen, J. (2002). MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415, 977-983. Austin, M.J., Muskett, P., Kahn, K., Feys, B.J., Jones, J.D., and Parker, J.E. (2002). Regulatory role of SGT1 in early R gene-mediated plant defenses. Science 295, 2077-2080. Axtell, M.J., and Staskawicz, B.J. (2003). Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112, 369-377. Azevedo, C., Sadanandom, A., Kitagawa, K., Freialdenhoven, A., Shirasu, K., and Schulze-Lefert, P. (2002). The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science 295, 2073-2076. Azevedo, C., Betsuyaku, S., Peart, J., Takahashi, A., No?l, L., Sadanandom, A., Casais, C., Parker, J., and Shirasu, K. (2006). Role of SGT1 in resistance protein accumulation in plant immunity. EMBO J 25, 2007-2016. Bachmair, A., Novatchkova, M., Potuschak, T., and Eisenhaber, F. (2001). Ubiquitylation in plants: a post-genomic look at a post-translational modification. Trends Plant Sci 6, 463-470. Belkhadir, Y., Subramaniam, R., and Dangl, J.L. (2004). Plant disease resistance protein signaling: NBS-LRR proteins and their partners. Curr Opin Plant Biol 7, 391-399. Bendahmane, A., Farnham, G., Moffett, P., and Baulcombe, D.C. (2002). Constitutive gain-of-function mutants in a nucleotide binding site-leucine rich repeat protein encoded at the Rx locus of potato. Plant J 32, 195-204. Bent, A.F., and Mackey, D. (2007). Elicitors, effectors, and R genes: the new paradigm and a lifetime supply of questions. Annu Rev Phytopathol 45, 399-436.  103 Bestwick, C.S., Bennett, M.H., and Mansfield, J.W. (1995). Hrp Mutant of Pseudomonas syringae pv phaseolicola Induces Cell Wall Alterations but Not Membrane Damage Leading to the Hypersensitive Reaction in Lettuce. Plant Physiol 108, 503-516. Bestwick, C.S., Brown, I.R., Bennett, M.H., and Mansfield, J.W. (1997). Localization of hydrogen peroxide accumulation during the hypersensitive reaction of lettuce cells to Pseudomonas syringae pv phaseolicola. Plant Cell 9, 209-221. Bhattacharjee, S., Halane, M.K., Kim, S.H., and Gassmann, W. (2011). Pathogen effectors target Arabidopsis EDS1 and alter its interactions with immune regulators. Science 334, 1405-1408. Bi, D., Johnson, K.C., Zhu, Z., Huang, Y., Chen, F., Zhang, Y., and Li, X. (2011). Mutations in an aypical TIR-NB-LRR-LIM resistance protein confer autoimmunity. Front Plant Sci 2, 71. Bindschedler, L.V., Dewdney, J., Blee, K.A., Stone, J.M., Asai, T., Plotnikov, J., Denoux, C., Hayes, T., Gerrish, C., Davies, D.R., Ausubel, F.M., and Bolwell, G.P. (2006). Peroxidase-dependent apoplastic oxidative burst in Arabidopsis required for pathogen resistance. Plant J 47, 851-863. Bischoff, V., Cookson, S.J., Wu, S., and Scheible, W.R. (2009). Thaxtomin A affects CESA-complex density, expression of cell wall genes, cell wall composition, and causes ectopic lignification in Arabidopsis thaliana seedlings. J Exp Bot 60, 955-965. Boller, T., and Felix, G. (2009). A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu Rev Plant Biol 60, 379-406. Bowling, S.A., Guo, A., Cao, H., Gordon, A.S., Klessig, D.F., and Dong, X. (1994). A mutation in Arabidopsis that leads to constitutive expression of systemic acquired resistance. Plant Cell 6, 1845-1857. Cao, H., Glazebrook, J., Clarke, J.D., Volko, S., and Dong, X. (1997). The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88, 57-63. Century, K.S., Holub, E.B., and Staskawicz, B.J. (1995). NDR1, a locus of Arabidopsis thaliana that is required for disease resistance to both a bacterial and a fungal pathogen. Proc Natl Acad Sci U S A 92, 6597-6601. Century, K.S., Shapiro, A.D., Repetti, P.P., Dahlbeck, D., Holub, E., and Staskawicz, B.J. (1997). NDR1, a pathogen-induced component required for Arabidopsis disease resistance. Science 278, 1963-1965. Chan, S.P., and Cheng, S.C. (2005). The Prp19-associated complex is required for specifying interactions of U5 and U6 with pre-mRNA during spliceosome activation. J Biol Chem 280, 31190-31199.  104 Cheng, Y.T., and Li, X. (2012). Ubiquitination in NB-LRR-mediated immunity. Curr Opin Plant Biol 15, 392-399. Cheng, Y.T., Li, Y., Huang, S., Huang, Y., Dong, X., Zhang, Y., and Li, X. (2011). Stability of plant immune-receptor resistance proteins is controlled by SKP1-CULLIN1-F-box (SCF)-mediated protein degradation. Proc Natl Acad Sci U S A 108, 14694-14699. Cheng, Y.T., Germain, H., Wiermer, M., Bi, D., Xu, F., Garc?a, A.V., Wirthmueller, L., Despr?s, C., Parker, J.E., Zhang, Y., and Li, X. (2009). Nuclear pore complex component MOS7/Nup88 is required for innate immunity and nuclear accumulation of defense regulators in Arabidopsis. Plant Cell 21, 2503-2516. Chisholm, S.T., Coaker, G., Day, B., and Staskawicz, B.J. (2006). Host-microbe interactions: shaping the evolution of the plant immune response. Cell 124, 803-814. Clay, N.K., Adio, A.M., Denoux, C., Jander, G., and Ausubel, F.M. (2009). Glucosinolate metabolites required for an Arabidopsis innate immune response. Science 323, 95-101. Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16, 735-743. Colcombet, J., and Hirt, H. (2008). Arabidopsis MAPKs: a complex signalling network involved in multiple biological processes. Biochem J 413, 217-226. D'Silva, P.R., Schilke, B., Walter, W., and Craig, E.A. (2005). Role of Pam16's degenerate J domain in protein import across the mitochondrial inner membrane. Proc Natl Acad Sci U S A 102, 12419-12424. Dangl, J.L., and Jones, J.D. (2001). Plant pathogens and integrated defence responses to infection. Nature 411, 826-833. Deckert, J., Hartmuth, K., Boehringer, D., Behzadnia, N., Will, C.L., Kastner, B., Stark, H., Urlaub, H., and L?hrmann, R. (2006). Protein composition and electron microscopy structure of affinity-purified human spliceosomal B complexes isolated under physiological conditions. Mol Cell Biol 26, 5528-5543. Deslandes, L., Olivier, J., Peeters, N., Feng, D.X., Khounlotham, M., Boucher, C., Somssich, I., Genin, S., and Marco, Y. (2003). Physical interaction between RRS1-R, a protein conferring resistance to bacterial wilt, and PopP2, a type III effector targeted to the plant nucleus. Proc Natl Acad Sci U S A 100, 8024-8029. DeYoung, B.J., and Innes, R.W. (2006). Plant NBS-LRR proteins in pathogen sensing and host defense. Nat Immunol 7, 1243-1249. Dodds, P.N., Lawrence, G.J., Catanzariti, A.M., Teh, T., Wang, C.I., Ayliffe, M.A., Kobe, B., and Ellis, J.G. (2006). Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes. Proc Natl Acad Sci U S A 103, 8888-8893.  105 Du, X., Miao, M., Ma, X., Liu, Y., Kuhl, J.C., Martin, G.B., and Xiao, F. (2012). Plant programmed cell death caused by an autoactive form of Prf is suppressed by co-expression of the Prf LRR domain. Mol Plant 5, 1058-1067. Dunning, F.M., Sun, W., Jansen, K.L., Helft, L., and Bent, A.F. (2007). Identification and mutational analysis of Arabidopsis FLS2 leucine-rich repeat domain residues that contribute to flagellin perception. Plant Cell 19, 3297-3313. Durrant, W.E., and Dong, X. (2004). Systemic acquired resistance. Annu Rev Phytopathol 42, 185-209. Ellis, J., Dodds, P., and Pryor, T. (2000). Structure, function and evolution of plant disease resistance genes. Curr Opin Plant Biol 3, 278-284. Falk, A., Feys, B.J., Frost, L.N., Jones, J.D., Daniels, M.J., and Parker, J.E. (1999). EDS1, an essential component of R gene-mediated disease resistance in Arabidopsis has homology to eukaryotic lipases. Proc Natl Acad Sci U S A 96, 3292-3297. Feys, B.J., Moisan, L.J., Newman, M.A., and Parker, J.E. (2001). Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. EMBO J 20, 5400-5411. Feys, B.J., Wiermer, M., Bhat, R.A., Moisan, L.J., Medina-Escobar, N., Neu, C., Cabral, A., and Parker, J.E. (2005). Arabidopsis senescence-associated gene101 stabilizes and signals within an enhanced disease susceptibility1 complex in plant innate immunity. Plant Cell 17, 2601-2613. Frazier, A.E., Dudek, J., Guiard, B., Voos, W., Li, Y., Lind, M., Meisinger, C., Geissler, A., Sickmann, A., Meyer, H.E., Bilanchone, V., Cumsky, M.G., Truscott, K.N., Pfanner, N., and Rehling, P. (2004). Pam16 has an essential role in the mitochondrial protein import motor. Nat Struct Mol Biol 11, 226-233. Frederick, R.D., Thilmony, R.L., Sessa, G., and Martin, G.B. (1998). Recognition specificity for the bacterial avirulence protein AvrPto is determined by Thr-204 in the activation loop of the tomato Pto kinase. Mol Cell 2, 241-245. Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G., Uknes, S., Ward, E., Kessmann, H., and Ryals, J. (1993). Requirement of salicylic Acid for the induction of systemic acquired resistance. Science 261, 754-756. Galichet, A., and Gruissem, W. (2003). Protein farnesylation in plants--conserved mechanisms but different targets. Curr Opin Plant Biol 6, 530-535. Gao, M., Liu, J., Bi, D., Zhang, Z., Cheng, F., Chen, S., and Zhang, Y. (2008). MEKK1, MKK1/MKK2 and MPK4 function together in a mitogen-activated protein kinase cascade to regulate innate immunity in plants. Cell Res 18, 1190-1198.  106 Gao, M., Wang, X., Wang, D., Xu, F., Ding, X., Zhang, Z., Bi, D., Cheng, Y.T., Chen, S., Li, X., and Zhang, Y. (2009). Regulation of cell death and innate immunity by two receptor-like kinases in Arabidopsis. Cell Host Microbe 6, 34-44. Germain, H., Qu, N., Cheng, Y.T., Lee, E., Huang, Y., Dong, O.X., Gannon, P., Huang, S., Ding, P., Li, Y., Sack, F., Zhang, Y., and Li, X. (2010). MOS11: a new component in the mRNA export pathway. PLoS Genet 6, e1001250. Gleason, C., Huang, S., Thatcher, L.F., Foley, R.C., Anderson, C.R., Carroll, A.J., Millar, A.H., and Singh, K.B. (2011). Mitochondrial complex II has a key role in mitochondrial-derived reactive oxygen species influence on plant stress gene regulation and defense. Proc Natl Acad Sci U S A 108, 10768-10773. Goritschnig, S., Zhang, Y., and Li, X. (2007). The ubiquitin pathway is required for innate immunity in Arabidopsis. Plant J 49, 540-551. Goritschnig, S., Weihmann, T., Zhang, Y., Fobert, P., McCourt, P., and Li, X. (2008). A novel role for protein farnesylation in plant innate immunity. Plant Physiol 148, 348-357. Gou, M., and Hua, J. (2012). Complex regulation of an R gene SNC1 revealed by auto-immune mutants. Plant Signal Behav 7, 213-216. Gou, M., Shi, Z., Zhu, Y., Bao, Z., Wang, G., and Hua, J. (2012). The F-box protein CPR1/CPR30 negatively regulates R protein SNC1 accumulation. Plant J 69, 411-420. Greenberg, J.T., and Yao, N. (2004). The role and regulation of programmed cell death in plant-pathogen interactions. Cell Microbiol 6, 201-211. Greenberg, J.T., Guo, A., Klessig, D.F., and Ausubel, F.M. (1994). Programmed cell death in plants: a pathogen-triggered response activated coordinately with multiple defense functions. Cell 77, 551-563. G?mez-G?mez, L., Felix, G., and Boller, T. (1999). A single locus determines sensitivity to bacterial flagellin in Arabidopsis thaliana. Plant J 18, 277-284. G?mez-G?mez, L., Bauer, Z., and Boller, T. (2001). Both the extracellular leucine-rich repeat domain and the kinase activity of FSL2 are required for flagellin binding and signaling in Arabidopsis. Plant Cell 13, 1155-1163. G?rlach, J., Volrath, S., Knauf-Beiter, G., Hengy, G., Beckhove, U., Kogel, K.H., Oostendorp, M., Staub, T., Ward, E., Kessmann, H., and Ryals, J. (1996). Benzothiadiazole, a novel class of inducers of systemic acquired resistance, activates gene expression and disease resistance in wheat. Plant Cell 8, 629-643. Han, S.W., Sriariyanun, M., Lee, S.W., Sharma, M., Bahar, O., Bower, Z., and Ronald, P.C. (2011). Small protein-mediated quorum sensing in a Gram-negative bacterium. PLoS One 6, e29192.  107 Hardham, A.R., Jones, D.A., and Takemoto, D. (2007). Cytoskeleton and cell wall function in penetration resistance. Curr Opin Plant Biol 10, 342-348. Hatfield, P.M., Gosink, M.M., Carpenter, T.B., and Vierstra, R.D. (1997). The ubiquitin-activating enzyme (E1) gene family in Arabidopsis thaliana. Plant J 11, 213-226. Heath, M.C. (2000). Nonhost resistance and nonspecific plant defenses. Curr Opin Plant Biol 3, 315-319. Heidrich, K., Wirthmueller, L., Tasset, C., Pouzet, C., Deslandes, L., and Parker, J.E. (2011). Arabidopsis EDS1 connects pathogen effector recognition to cell compartment-specific immune responses. Science 334, 1401-1404. Hershko, A., and Ciechanover, A. (1998). The ubiquitin system. Annu Rev Biochem 67, 425-479. Hochstrasser, M. (1996). Ubiquitin-dependent protein degradation. Annu Rev Genet 30, 405-439. Hoppe, T. (2005). Multiubiquitylation by E4 enzymes: 'one size' doesn't fit all. Trends Biochem Sci 30, 183-187. Hoppe, T., Cassata, G., Barral, J.M., Springer, W., Hutagalung, A.H., Epstein, H.F., and Baumeister, R. (2004). Regulation of the myosin-directed chaperone UNC-45 by a novel E3/E4-multiubiquitylation complex in C. elegans. Cell 118, 337-349. Hua, J., Grisafi, P., Cheng, S.H., and Fink, G.R. (2001). Plant growth homeostasis is controlled by the Arabidopsis BON1 and BAP1 genes. Genes Dev 15, 2263-2272. Hwang, C.F., and Williamson, V.M. (2003). Leucine-rich repeat-mediated intramolecular interactions in nematode recognition and cell death signaling by the tomato resistance protein Mi. Plant J 34, 585-593. Inohara, Chamaillard, McDonald, C., and Nu?ez, G. (2005). NOD-LRR proteins: role in host-microbial interactions and inflammatory disease. Annu Rev Biochem 74, 355-383. Jabs, T., Dietrich, R.A., and Dangl, J.L. (1996). Initiation of runaway cell death in an Arabidopsis mutant by extracellular superoxide. Science 273, 1853-1856. Jander, G., Norris, S.R., Rounsley, S.D., Bush, D.F., Levin, I.M., and Last, R.L. (2002). Arabidopsis map-based cloning in the post-genome era. Plant Physiol 129, 440-450. Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P., and Valent, B. (2000). Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. EMBO J 19, 4004-4014. Jiang, X., and Wang, X. (2000). Cytochrome c promotes caspase-9 activation by inducing nucleotide binding to Apaf-1. J Biol Chem 275, 31199-31203.  108 Jirage, D., Tootle, T.L., Reuber, T.L., Frost, L.N., Feys, B.J., Parker, J.E., Ausubel, F.M., and Glazebrook, J. (1999). Arabidopsis thaliana PAD4 encodes a lipase-like gene that is important for salicylic acid signaling. Proc Natl Acad Sci U S A 96, 13583-13588. Johnson, E.S., Ma, P.C., Ota, I.M., and Varshavsky, A. (1995). A proteolytic pathway that recognizes ubiquitin as a degradation signal. J Biol Chem 270, 17442-17456. Johnson, K.C., Dong, O.X., Huang, Y., and Li, X. (2012). A Rolling Stone Gathers No Moss, but Resistant Plants Must Gather Their MOSes. Cold Spring Harb Symp Quant Biol 77, 259-268. Jones, J.D., and Dangl, J.L. (2006). The plant immune system. Nature 444, 323-329. Kim, H.S., Desveaux, D., Singer, A.U., Patel, P., Sondek, J., and Dangl, J.L. (2005). The Pseudomonas syringae effector AvrRpt2 cleaves its C-terminally acylated target, RIN4, from Arabidopsis membranes to block RPM1 activation. Proc Natl Acad Sci U S A 102, 6496-6501. Kitagawa, K., Skowyra, D., Elledge, S.J., Harper, J.W., and Hieter, P. (1999). SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell 4, 21-33. Knepper, C., Savory, E.A., and Day, B. (2011). Arabidopsis NDR1 is an integrin-like protein with a role in fluid loss and plasma membrane-cell wall adhesion. Plant Physiol 156, 286-300. Kobe, B., and Kajava, A.V. (2001). The leucine-rich repeat as a protein recognition motif. Curr Opin Struct Biol 11, 725-732. Koegl, M., Hoppe, T., Schlenker, S., Ulrich, H.D., Mayer, T.U., and Jentsch, S. (1999). A novel ubiquitination factor, E4, is involved in multiubiquitin chain assembly. Cell 96, 635-644. Krause, M., and Durner, J. (2004). Harpin inactivates mitochondria in Arabidopsis suspension cells. Mol Plant Microbe Interact 17, 131-139. Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T., and Felix, G. (2004). The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants. Plant Cell 16, 3496-3507. Lange, A., Mills, R.E., Lange, C.J., Stewart, M., Devine, S.E., and Corbett, A.H. (2007). Classical nuclear localization signals: definition, function, and interaction with importin alpha. J Biol Chem 282, 5101-5105. Lee, S.W., Han, S.W., Sririyanum, M., Park, C.J., Seo, Y.S., and Ronald, P.C. (2009). A type I-secreted, sulfated peptide triggers XA21-mediated innate immunity. Science 326, 850-853. Li, X., Clarke, J.D., Zhang, Y., and Dong, X. (2001). Activation of an EDS1-mediated R-gene pathway in the snc1 mutant leads to constitutive, NPR1-independent pathogen resistance. Mol Plant Microbe Interact 14, 1131-1139.  109 Li, X., Zhang, Y., Clarke, J.D., Li, Y., and Dong, X. (1999). Identification and cloning of a negative regulator of systemic acquired resistance, SNI1, through a screen for suppressors of npr1-1. Cell 98, 329-339. Li, Y., Tessaro, M.J., Li, X., and Zhang, Y. (2010a). Regulation of the expression of plant resistance gene SNC1 by a protein with a conserved BAT2 domain. Plant Physiol 153, 1425-1434. Li, Y., Li, S., Bi, D., Cheng, Y.T., Li, X., and Zhang, Y. (2010b). SRFR1 negatively regulates plant NB-LRR resistance protein accumulation to prevent autoimmunity. PLoS Pathog 6, e1001111. Liu, J., Li, W., Ning, Y., Shirsekar, G., Cai, Y., Wang, X., Dai, L., Wang, Z., Liu, W., and Wang, G.L. (2012). The U-Box E3 ligase SPL11/PUB13 is a convergence point of defense and flowering signaling in plants. Plant Physiol 160, 28-37. Liu, Y., Schiff, M., Serino, G., Deng, X.W., and Dinesh-Kumar, S.P. (2002). Role of SCF ubiquitin-ligase and the COP9 signalosome in the N gene-mediated resistance response to Tobacco mosaic virus. Plant Cell 14, 1483-1496. Loyer, P., Trembley, J.H., Grenet, J.A., Busson, A., Corlu, A., Zhao, W., Kocak, M., Kidd, V.J., and Lahti, J.M. (2008). Characterization of cyclin L1 and L2 interactions with CDK11 and splicing factors: influence of cyclin L isoforms on splice site selection. J Biol Chem 283, 7721-7732. Mackey, D., Holt, B.F., Wiig, A., and Dangl, J.L. (2002). RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 108, 743-754. Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R., and Dangl, J.L. (2003). Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Cell 112, 379-389. Maekawa, T., Kufer, T.A., and Schulze-Lefert, P. (2011). NLR functions in plant and animal immune systems: so far and yet so close. Nat Immunol 12, 817-826. Malamy, J., Carr, J.P., Klessig, D.F., and Raskin, I. (1990). Salicylic Acid: a likely endogenous signal in the resistance response of tobacco to viral infection. Science 250, 1002-1004. Maleck, K., Neuenschwander, U., Cade, R.M., Dietrich, R.A., Dangl, J.L., and Ryals, J.A. (2002). Isolation and characterization of broad-spectrum disease-resistant Arabidopsis mutants. Genetics 160, 1661-1671. Matsumoto, M., Yada, M., Hatakeyama, S., Ishimoto, H., Tanimura, T., Tsuji, S., Kakizuka, A., Kitagawa, M., and Nakayama, K.I. (2004). Molecular clearance of ataxin-3 is regulated by a mammalian E4. EMBO J 23, 659-669.  110 McFarlane, H.E., Young, R.E., Wasteneys, G.O., and Samuels, A.L. (2008). Cortical microtubules mark the mucilage secretion domain of the plasma membrane in Arabidopsis seed coat cells. Planta 227, 1363-1375. McHale, L., Tan, X., Koehl, P., and Michelmore, R.W. (2006). Plant NBS-LRR proteins: adaptable guards. Genome Biol 7, 212. Mehdy, M.C. (1994). Active Oxygen Species in Plant Defense against Pathogens. Plant Physiol 105, 467-472. Meyers, B.C., Kozik, A., Griego, A., Kuang, H., and Michelmore, R.W. (2003). Genome-wide analysis of NBS-LRR-encoding genes in Arabidopsis. Plant Cell 15, 809-834. Miura, K., and Ohta, M. (2010). SIZ1, a small ubiquitin-related modifier ligase, controls cold signaling through regulation of salicylic acid accumulation. J Plant Physiol 167, 555-560. Miura, K., Lee, J., Miura, T., and Hasegawa, P.M. (2010). SIZ1 controls cell growth and plant development in Arabidopsis through salicylic acid. Plant Cell Physiol 51, 103-113. Moffett, P., Farnham, G., Peart, J., and Baulcombe, D.C. (2002). Interaction between domains of a plant NBS-LRR protein in disease resistance-related cell death. Embo j 21, 4511-4519. Monaghan, J., Xu, F., Xu, S., Zhang, Y., and Li, X. (2010). Two putative RNA-binding proteins function with unequal genetic redundancy in the MOS4-associated complex. Plant Physiol 154, 1783-1793. Monaghan, J., Xu, F., Gao, M., Zhao, Q., Palma, K., Long, C., Chen, S., Zhang, Y., and Li, X. (2009). Two Prp19-like U-box proteins in the MOS4-associated complex play redundant roles in plant innate immunity. PLoS Pathog 5, e1000526. Mou, Z., Fan, W., and Dong, X. (2003). Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113, 935-944. M?sz?ros, T., Helfer, A., Hatzimasoura, E., Magyar, Z., Serazetdinova, L., Rios, G., Bard?czy, V., Teige, M., Koncz, C., Peck, S., and B?gre, L. (2006). The Arabidopsis MAP kinase kinase MKK1 participates in defence responses to the bacterial elicitor flagellin. Plant J 48, 485-498. Nawrath, C., and M?traux, J.P. (1999). Salicylic acid induction-deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. Plant Cell 11, 1393-1404. Nawrath, C., Heck, S., Parinthawong, N., and M?traux, J.P. (2002). EDS5, an essential component of salicylic acid-dependent signaling for disease resistance in Arabidopsis, is a member of the MATE transporter family. Plant Cell 14, 275-286.  111 Nelson, B.K., Cai, X., and Nebenfuhr, A. (2007). A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants. Plant J 51, 1126-1136. Neupert, W., and Herrmann, J.M. (2007). Translocation of proteins into mitochondria. Annu Rev Biochem 76, 723-749. Nicaise, V., Roux, M., and Zipfel, C. (2009). Recent advances in PAMP-triggered immunity against bacteria: pattern recognition receptors watch over and raise the alarm. Plant Physiol 150, 1638-1647. Nishimura, M.T., Stein, M., Hou, B.H., Vogel, J.P., Edwards, H., and Somerville, S.C. (2003). Loss of a callose synthase results in salicylic acid-dependent disease resistance. Science 301, 969-972. No?l, L.D., Cagna, G., Stuttmann, J., Wirthm?ller, L., Betsuyaku, S., Witte, C.P., Bhat, R., Pochon, N., Colby, T., and Parker, J.E. (2007). Interaction between SGT1 and cytosolic/nuclear HSC70 chaperones regulates Arabidopsis immune responses. Plant Cell 19, 4061-4076. N?meth, K., Salchert, K., Putnoky, P., Bhalerao, R., Koncz-K?lm?n, Z., Stankovic-Stangeland, B., Bak?, L., Mathur, J., Okr?sz, L., Stabel, S., Geigenberger, P., Stitt, M., R?dei, G.P., Schell, J., and Koncz, C. (1998). Pleiotropic control of glucose and hormone responses by PRL1, a nuclear WD protein, in Arabidopsis. Genes Dev 12, 3059-3073. N?rnberger, T., and Scheel, D. (2001). Signal transmission in the plant immune response. Trends Plant Sci 6, 372-379. N?rnberger, T., and Lipka, V. (2005). Non-host resistance in plants: new insights into an old phenomenon. Mol Plant Pathol 6, 335-345. Ohi, M.D., Link, A.J., Ren, L., Jennings, J.L., McDonald, W.H., and Gould, K.L. (2002). Proteomics analysis reveals stable multiprotein complexes in both fission and budding yeasts containing Myb-related Cdc5p/Cef1p, novel pre-mRNA splicing factors, and snRNAs. Mol Cell Biol 22, 2011-2024. Oldroyd, G.E., and Staskawicz, B.J. (1998). Genetically engineered broad-spectrum disease resistance in tomato. Proc Natl Acad Sci U S A 95, 10300-10305. Pais, J.E., Schilke, B., and Craig, E.A. (2011). Reevaluation of the role of the Pam18:Pam16 interaction in translocation of proteins by the mitochondrial Hsp70-based import motor. Mol Biol Cell 22, 4740-4749. Palma, K., Zhang, Y., and Li, X. (2005). An importin alpha homolog, MOS6, plays an important role in plant innate immunity. Curr Biol 15, 1129-1135. Palma, K., Zhao, Q., Cheng, Y.T., Bi, D., Monaghan, J., Cheng, W., Zhang, Y., and Li, X. (2007). Regulation of plant innate immunity by three proteins in a complex conserved across the plant and animal kingdoms. Genes Dev 21, 1484-1493.  112 Palma, K., Thorgrimsen, S., Malinovsky, F.G., Fiil, B.K., Nielsen, H.B., Brodersen, P., Hofius, D., Petersen, M., and Mundy, J. (2010). Autoimmunity in Arabidopsis acd11 is mediated by epigenetic regulation of an immune receptor. PLoS Pathog 6, e1001137. Pandey, S.P., and Somssich, I.E. (2009). The role of WRKY transcription factors in plant immunity. Plant Physiol 150, 1648-1655. Parry, G., Ward, S., Cernac, A., Dharmasiri, S., and Estelle, M. (2006). The Arabidopsis SUPPRESSOR OF AUXIN RESISTANCE proteins are nucleoporins with an important role in hormone signaling and development. Plant Cell 18, 1590-1603. Pickart, C.M. (2001). Mechanisms underlying ubiquitination. Annu Rev Biochem 70, 503-533. Pukatzki, S., Tordilla, N., Franke, J., and Kessin, R.H. (1998). A novel component involved in ubiquitination is required for development of Dictyostelium discoideum. J Biol Chem 273, 24131-24138. Rairdan, G.J., and Moffett, P. (2006). Distinct domains in the ARC region of the potato resistance protein Rx mediate LRR binding and inhibition of activation. Plant Cell 18, 2082-2093. Reed, R., and Cheng, H. (2005). TREX, SR proteins and export of mRNA. Curr Opin Cell Biol 17, 269-273. Reuber, T.L., Plotnikova, J.M., Dewdney, J., Rogers, E.E., Wood, W., and Ausubel, F.M. (1998). Correlation of defense gene induction defects with powdery mildew susceptibility in Arabidopsis enhanced disease susceptibility mutants. Plant J 16, 473-485. Rojas, C.M., Senthil-Kumar, M., Wang, K., Ryu, C.M., Kaundal, A., and Mysore, K.S. (2012). Glycolate oxidase modulates reactive oxygen species-mediated signal transduction during nonhost resistance in Nicotiana benthamiana and Arabidopsis. Plant Cell 24, 336-352. Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A., Steiner, H.Y., and Hunt, M.D. (1996). Systemic Acquired Resistance. Plant Cell 8, 1809-1819. Scheible, W.R., Fry, B., Kochevenko, A., Schindelasch, D., Zimmerli, L., Somerville, S., Loria, R., and Somerville, C.R. (2003). An Arabidopsis mutant resistant to thaxtomin A, a cellulose synthesis inhibitor from Streptomyces species. Plant Cell 15, 1781-1794. Senthil-Kumar, M., and Mysore, K.S. (2013). Nonhost resistance against bacterial pathogens: retrospectives and prospects. Annu Rev Phytopathol 51, 407-427. Shah, J., Kachroo, P., and Klessig, D.F. (1999). The Arabidopsis ssi1 mutation restores pathogenesis-related gene expression in npr1 plants and renders defensin gene expression salicylic acid dependent. Plant Cell 11, 191-206.  113 Shirano, Y., Kachroo, P., Shah, J., and Klessig, D.F. (2002). A gain-of-function mutation in an Arabidopsis Toll Interleukin1 receptor-nucleotide binding site-leucine-rich repeat type R gene triggers defense responses and results in enhanced disease resistance. Plant Cell 14, 3149-3162. Shirasu, K. (2009). The HSP90-SGT1 chaperone complex for NLR immune sensors. Annu Rev Plant Biol 60, 139-164. Shiu, S.H., and Bleecker, A.B. (2003). Expansion of the receptor-like kinase/Pelle gene family and receptor-like proteins in Arabidopsis. Plant Physiol 132, 530-543. Shiu, S.H., Karlowski, W.M., Pan, R., Tzeng, Y.H., Mayer, K.F., and Li, W.H. (2004). Comparative analysis of the receptor-like kinase family in Arabidopsis and rice. Plant Cell 16, 1220-1234. Silverman, E.J., Maeda, A., Wei, J., Smith, P., Beggs, J.D., and Lin, R.J. (2004). Interaction between a G-patch protein and a spliceosomal DEXD/H-box ATPase that is critical for splicing. Mol Cell Biol 24, 10101-10110. Smalle, J., and Vierstra, R.D. (2004). The ubiquitin 26S proteasome proteolytic pathway. Annu Rev Plant Biol 55, 555-590. Song, W.Y., Wang, G.L., Chen, L.L., Kim, H.S., Pi, L.Y., Holsten, T., Gardner, J., Wang, B., Zhai, W.X., Zhu, L.H., Fauquet, C., and Ronald, P. (1995). A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21. Science 270, 1804-1806. Staskawicz, B.J., Ausubel, F.M., Baker, B.J., Ellis, J.G., and Jones, J.D. (1995). Molecular genetics of plant disease resistance. Science 268, 661-667. Steiner, T., Kaiser, J.T., Marinkovi?, S., Huber, R., and Wahl, M.C. (2002). Crystal structures of transcription factor NusG in light of its nucleic acid- and protein-binding activities. EMBO J 21, 4641-4653. Szemenyei, H., Hannon, M., and Long, J.A. (2008). TOPLESS mediates auxin-dependent transcriptional repression during Arabidopsis embryogenesis. Science 319, 1384-1386. Takabatake, R., Karita, E., Seo, S., Mitsuhara, I., Kuchitsu, K., and Ohashi, Y. (2007). Pathogen-induced calmodulin isoforms in basal resistance against bacterial and fungal pathogens in tobacco. Plant Cell Physiol 48, 414-423. Takahashi, A., Casais, C., Ichimura, K., and Shirasu, K. (2003). HSP90 interacts with RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc Natl Acad Sci U S A 100, 11777-11782. Takken, F.L., and Tameling, W.I. (2009). To nibble at plant resistance proteins. Science 324, 744-746. Takken, F.L., Albrecht, M., and Tameling, W.I. (2006). Resistance proteins: molecular switches of plant defence. Curr Opin Plant Biol 9, 383-390.  114 Tameling, W.I., Elzinga, S.D., Darmin, P.S., Vossen, J.H., Takken, F.L., Haring, M.A., and Cornelissen, B.J. (2002). The tomato R gene products I-2 and MI-1 are functional ATP binding proteins with ATPase activity. Plant Cell 14, 2929-2939. Tao, Y., Xie, Z., Chen, W., Glazebrook, J., Chang, H.S., Han, B., Zhu, T., Zou, G., and Katagiri, F. (2003). Quantitative nature of Arabidopsis responses during compatible and incompatible interactions with the bacterial pathogen Pseudomonas syringae. Plant Cell 15, 317-330. Tarn, W.Y., Lee, K.R., and Cheng, S.C. (1993). The yeast PRP19 protein is not tightly associated with small nuclear RNAs, but appears to associate with the spliceosome after binding of U2 to the pre-mRNA and prior to formation of the functional spliceosome. Mol Cell Biol 13, 1883-1891. Torres, M.A., Jones, J.D., and Dangl, J.L. (2006). Reactive oxygen species signaling in response to pathogens. Plant Physiol 141, 373-378. Trujillo, M., and Shirasu, K. (2010). Ubiquitination in plant immunity. Curr Opin Plant Biol 13, 402-408. Tu, D., Li, W., Ye, Y., and Brunger, A.T. (2007). Structure and function of the yeast U-box-containing ubiquitin ligase Ufd2p. Proc Natl Acad Sci U S A 104, 15599-15606. T?r, M., Gordon, P., Cuzick, A., Eulgem, T., Sinapidou, E., Mert-T?rk, F., Can, C., Dangl, J.L., and Holub, E.B. (2002). Arabidopsis SGT1b is required for defense signaling conferred by several downy mildew resistance genes. Plant Cell 14, 993-1003. Uquillas, C., Letelier, I., Blanco, F., Jordana, X., and Holuigue, L. (2004). NPR1-independent activation of immediate early salicylic acid-responsive genes in Arabidopsis. Mol Plant Microbe Interact 17, 34-42. Van den Ackerveken, G., Marois, E., and Bonas, U. (1996). Recognition of the bacterial avirulence protein AvrBs3 occurs inside the host plant cell. Cell 87, 1307-1316. Van der Biezen, E.A., and Jones, J.D. (1998). Plant disease-resistance proteins and the gene-for-gene concept. Trends Biochem Sci 23, 454-456. van der Laan, M., Hutu, D.P., and Rehling, P. (2010). On the mechanism of preprotein import by the mitochondrial presequence translocase. Biochim Biophys Acta 1803, 732-739. Vierstra, R.D. (2003). The ubiquitin/26S proteasome pathway, the complex last chapter in the life of many plant proteins. Trends Plant Sci 8, 135-142. Wang, L., Tsuda, K., Sato, M., Cohen, J.D., Katagiri, F., and Glazebrook, J. (2009). Arabidopsis CaM binding protein CBP60g contributes to MAMP-induced SA accumulation and is involved in disease resistance against Pseudomonas syringae. PLoS Pathog 5, e1000301.  115 Wang, Z., Meng, P., Zhang, X., Ren, D., and Yang, S. (2011). BON1 interacts with the protein kinases BIR1 and BAK1 in modulation of temperature-dependent plant growth and cell death in Arabidopsis. Plant J 67, 1081-1093. Wiermer, M., Feys, B.J., and Parker, J.E. (2005). Plant immunity: the EDS1 regulatory node. Curr Opin Plant Biol 8, 383-389. Wiermer, M., Palma, K., Zhang, Y., and Li, X. (2007). Should I stay or should I go? Nucleocytoplasmic trafficking in plant innate immunity. Cell Microbiol 9, 1880-1890. Wildermuth, M.C., Dewdney, J., Wu, G., and Ausubel, F.M. (2001). Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414, 562-565. Wirthmueller, L., Zhang, Y., Jones, J.D., and Parker, J.E. (2007). Nuclear accumulation of the Arabidopsis immune receptor RPS4 is necessary for triggering EDS1-dependent defense. Curr Biol 17, 2023-2029. Xia, S., Cheng, Y.T., Huang, S., Win, J., Soards, A., Jinn, T.L., Jones, J.D., Kamoun, S., Chen, S., Zhang, Y., and Li, X. (2013). Regulation of transcription of nucleotide-binding leucine-rich repeat-encoding genes SNC1 and RPP4 via H3K4 trimethylation. Plant Physiol 162, 1694-1705. Xu, F., Xu, S., Wiermer, M., Zhang, Y., and Li, X. (2012). The cyclin L homolog MOS12 and the MOS4-associated complex are required for the proper splicing of plant resistance genes. Plant J 70, 916-928. Xu, S., Zhang, Z., Jing, B., Gannon, P., Ding, J., Xu, F., Li, X., and Zhang, Y. (2011). Transportin-SR is required for proper splicing of resistance genes and plant immunity. PLoS Genet 7, e1002159. Yalpani, N., Silverman, P., Wilson, T.M., Kleier, D.A., and Raskin, I. (1991). Salicylic acid is a systemic signal and an inducer of pathogenesis-related proteins in virus-infected tobacco. Plant Cell 3, 809-818. Yang, H., Li, Y., and Hua, J. (2006). The C2 domain protein BAP1 negatively regulates defense responses in Arabidopsis. Plant J 48, 238-248. Yang, S., and Hua, J. (2004). A haplotype-specific Resistance gene regulated by BONZAI1 mediates temperature-dependent growth control in Arabidopsis. Plant Cell 16, 1060-1071. Zeng, L.R., Qu, S., Bordeos, A., Yang, C., Baraoidan, M., Yan, H., Xie, Q., Nahm, B.H., Leung, H., and Wang, G.L. (2004). Spotted leaf11, a negative regulator of plant cell death and defense, encodes a U-box/armadillo repeat protein endowed with E3 ubiquitin ligase activity. Plant Cell 16, 2795-2808. Zhang, M., Kadota, Y., Prodromou, C., Shirasu, K., and Pearl, L.H. (2010). Structural basis for assembly of Hsp90-Sgt1-CHORD protein complexes: implications for chaperoning of NLR innate immunity receptors. Mol Cell 39, 269-281.  116 Zhang, Y., and Li, X. (2005). A putative nucleoporin 96 Is required for both basal defense and constitutive resistance responses mediated by suppressor of npr1-1,constitutive 1. Plant Cell 17, 1306-1316. Zhang, Y., Goritschnig, S., Dong, X., and Li, X. (2003). A gain-of-function mutation in a plant disease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1-1, constitutive 1. Plant Cell 15, 2636-2646. Zhang, Y., Fan, W., Kinkema, M., Li, X., and Dong, X. (1999). Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene. Proc Natl Acad Sci U S A 96, 6523-6528. Zhang, Y., Cheng, Y.T., Bi, D., Palma, K., and Li, X. (2005). MOS2, a protein containing G-patch and KOW motifs, is essential for innate immunity in Arabidopsis thaliana. Curr Biol 15, 1936-1942. Zhou, J.M., Trifa, Y., Silva, H., Pontier, D., Lam, E., Shah, J., and Klessig, D.F. (2000). NPR1 differentially interacts with members of the TGA/OBF family of transcription factors that bind an element of the PR-1 gene required for induction by salicylic acid. Mol Plant Microbe Interact 13, 191-202. Zhu, Z., Xu, F., Zhang, Y., Cheng, Y.T., Wiermer, M., and Li, X. (2010). Arabidopsis resistance protein SNC1 activates immune responses through association with a transcriptional corepressor. Proc Natl Acad Sci U S A 107, 13960-13965. Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D., Boller, T., and Felix, G. (2006). Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell 125, 749-760.    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0165719/manifest

Comment

Related Items