UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cellular and molecular mechanisms of action of NR2E1 in eye development Corso-Díaz, Ximena 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2014_spring_corsodiaz_ximena.pdf [ 4.51MB ]
Metadata
JSON: 24-1.0165718.json
JSON-LD: 24-1.0165718-ld.json
RDF/XML (Pretty): 24-1.0165718-rdf.xml
RDF/JSON: 24-1.0165718-rdf.json
Turtle: 24-1.0165718-turtle.txt
N-Triples: 24-1.0165718-rdf-ntriples.txt
Original Record: 24-1.0165718-source.json
Full Text
24-1.0165718-fulltext.txt
Citation
24-1.0165718.ris

Full Text

  CELLULAR AND MOLECULAR MECHANISMS OF ACTION OF NR2E1 IN EYE DEVELOPMENT  by Ximena Corso-D?az  B.Sc., Universidad de los Andes, 2004 M.Sc., University of Alberta, 2008   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2013  ? Ximena Corso-D?az, 2013ii  Abstract NR2E1 is a highly conserved orphan nuclear receptor crucial for neural stem cell proliferation and maintenance during development and adulthood. Nr2e1-null mice have brain and eye malformations, display cognitive deficits, are aggressive, and blind. NR2E1 regulatory variants have been found in bipolar disorder and cortical malformations in humans. Complete understanding of NR2E1 action requires identification of genes regulated by NR2E1, protein partners including co-regulators that interact with NR2E1, and characterization of the loci where these interactions take place. Importantly, the mechanisms of action and regulation of NR2E1, and its role in human pathology remain poorly understood. In this thesis, I studied the role of NR2E1 in three different systems. First, I explored the potential role of NR2E1 mutations in patients with aniridia and other congenital ocular disorders. I found that mutations in NR2E1 do not play a role in aniridia and provided further evidence on the high genetic conservation of NR2E1 in the human population. Second, I studied the cell-autonomous and non-cell-autonomous roles of Nr2e1 in retinal development using Nr2e1-null mice, and chimeric mice comprised of both wild-type and Nr2e1-null cells. I found that Nr2e1 regulates the development of specific retinal cell types and the organization of the neurites of inner nuclear neurons. Third, I studied NR2E1 at the protein level by screening for NR2E1 co-regulators using a peptide array and affinity purification tools. I found that the ligand binding domain of NR2E1 interacts with 19 putative novel co-regulators in vitro, and that most of these interactions are lost with the NR2E1 variant R274G, which I showed, does not affect gross retinal development in vivo. Overall, this study furthers our knowledge on the roles and mechanisms of action of NR2E1 during eye development by ruling out its role in a human eye disorder, demonstrating its role in mouse iii  retinal cell development and lamination, and unraveling some of its potential co-regulatory partners. Future studies are necessary to better characterize the role of NR2E1 in cell development and neurite organization as well as its interaction with the co-regulators herein discovered during retinal and brain development.                    iv  Preface Chapter 2: This Chapter has been published as: Corso-D?az X, Borrie AE, Bonaguro R, Schuetz JM, Rosenberg T, Jensen H, Brooks BP, Macdonald IM, Pasutto F, Walter MA, Gr?nskov K, Brooks-Wilson A, Simpson EM. Absence of NR2E1 mutations in patients with aniridia. Mol Vis. 2012;18:2770-82. Pubmed ID: 23213277. Minor typographical and grammatical changes were made as part of the incorporation into the thesis. Note that Molecular Vision authors retain the copyright of published articles. Furthermore, Molecular Vision specifically gives authors the right to use a research article as part of a thesis without obtaining explicit permission. This project was conceived and initiated by Dr. Elizabeth M. Simpson at the Centre for Molecular Medicine and Therapeutics (CMMT), University of British Columbia (UBC).  Adrienne Borrie was a Master student in the Simpson Laboratory, who did all the sequencing for NR2E1. Russell Bonaguro was a technician who designed sequencing primers to amplify NR2E1 sequences. Julia Schuetz, a graduate student, and Dr. Angela Brooks-Wilson trained and helped Adrienne to sequence NR2E1 and contributed to the sequencing analysis. Dr. Brian Brooks, Dr. Ian Macdonald, Dr. Michael Walter and Dr. Karen Gr?nskov contributed patient samples for this study. Dr. Karen Gr?nskov also sequenced CYP1B1, PITX2, FOXC1, and FOXE3. I proposed to sequence and sequenced the gene B3GALTL. I also analyzed the sequencing data obtained. I created all the figures and Dr. Elizabeth M. Simpson and I wrote the paper.  v  Chapter 3:  This project was conceived by Dr. Elizabeth M. Simpson. Both Dr. Simpson and I contributed to experimental design.  I performed all the experiments and data analysis, wrote the paper, and created all of the figures for this manuscript and will see it through to publication: Corso-D?az X, Simpson EM. Nr2e1 regulates cellular development and lamination during retinogenesis. In preparation.  Chapter 4:  This project was conceived by Dr. Elizabeth M. Simpson and me. Both Dr. Simpson and I contributed to experimental design.  Vivian Alonso, a volunteer, performed some of the GST-NR2E1 pull-downs, Charles de Leeuw, a graduate student, made NR2E1 cDNA. Rene Houtman, Senior Scientist at PamGene International (Netherlands), performed the peptide array MARCoNI at his company.  I performed all the remaining experiments and data analysis, wrote the paper, and created all of the figures for this manuscript and will see it through to publication: Corso-D?az X, Alonso V, de Leeuw C, Houtman R, Simpson EM. Novel Co-regulator Interactions for the Orphan Nuclear Receptor NR2E1 Revealed by a Peptide Array. In preparation. Ethics Approval Approval for the study in the second chapter involving human subjects was obtained from the Clinical Research Ethics Board of the University of British Columbia (Certificate of Approval #C99-0524). The research followed Canada?s Tri-Council Statement on ?Ethical Conduct for Research Involving Humans?.  vi  The studies described in this thesis that involved mouse work have been approved by the Animal Care Committee at the University of British Columbia. All mice were handled according to institutional guidelines. Approval certificates numbers include: A07-0435, A11-0370, and A11-0081.    vii  Table of Contents Abstract .................................................................................................................................................. ii Preface ................................................................................................................................................... iv Table of Contents ................................................................................................................................. vii List of Tables .......................................................................................................................................... xi List of Figures ........................................................................................................................................ xii List of Abbreviations .............................................................................................................................xiii Acknowledgements .............................................................................................................................. xv Dedication ............................................................................................................................................ xvi Chapter 1 : General introduction ........................................................................................................... 1 1.1 The vertebrate eye ................................................................................................................... 1 1.1.1 General anatomy ............................................................................................................... 1 1.1.2 Overview of eye development .......................................................................................... 1 1.2 The vertebrate retina ............................................................................................................... 5 1.2.1 General organization of the retina .................................................................................... 5 1.2.2 Development of the retina ................................................................................................ 7 1.2.3 Cellular and molecular mechanisms of retinal development ........................................... 7 1.3 Congenital human eye disorders ............................................................................................ 11 1.3.1 Peter?s anomaly, Peters-Plus syndrome and aniridia ...................................................... 12 1.4 Nuclear receptor 2E1 (NR2E1) ................................................................................................ 13 1.4.1 Nuclear receptors ............................................................................................................ 13 1.4.1.1 Molecular mechanisms involved in nuclear receptor function ................................ 14 1.4.2 Overview of NR2E1 .......................................................................................................... 15 1.4.3 Expression pattern of NR2E1 ........................................................................................... 16 1.4.4 Role of NR2E1 in brain development .............................................................................. 17 1.4.4.1 Role of NR2E1 in human brain disorders ................................................................. 17 1.4.5 Role of NR2E1 in eye development ................................................................................. 18 1.4.6 Cellular mechanisms of action of NR2E1 ......................................................................... 19 1.4.6.1 NR2E1 regulates neural stem cell behavior ............................................................. 19 1.4.6.2   2E1 regulates the develo ment of astrocytes and  ller glia ............................ 21 1.4.7 Molecular mechanisms involved in NR2E1 function ....................................................... 22 viii  1.4.7.1 Protein partners of NR2E1 ........................................................................................ 22 1.4.7.2 Gene targets of NR2E1 ............................................................................................. 23 1.4.8 Regulation of NR2E1 expression ..................................................................................... 26 1.5 Thesis objectives ..................................................................................................................... 26 1.5.1 Role of NR2E1 in aniridia ................................................................................................. 26 1.5.2 Cell-autonomous and non-cell-autonomous roles of Nr2e1 during mouse retinogenesis .................................................................................................................................................. 27 1.5.3 In search of novel co-regulators for NR2E1 ..................................................................... 27 Chapter 2 : Absence of NR2E1 mutations in patients with aniridia ..................................................... 29 2.1 Abstract .................................................................................................................................. 29 2.2 Introduction ............................................................................................................................ 30 2.3 Materials and methods .......................................................................................................... 33 2.3.1 Patients and control individuals ...................................................................................... 33 2.3.2 NR2E1 sequencing analysis ............................................................................................. 35 2.3.3 Database search and In silico analysis of variants ........................................................... 36 2.3.4 Clinical assessment of patient 2100 ................................................................................ 38 2.4 Results .................................................................................................................................... 38 2.4.1 Clinical Characteristics of patient 21000 ......................................................................... 40 2.4.2 Genetic assessment of patient 21000 ............................................................................. 41 2.5 Discussion ............................................................................................................................... 44 2.6 Acknowledgments .................................................................................................................. 46 Chapter 3 : Nr2e1 regulates cellular development and lamination during mouse retinogenesis ....... 47 3.1 Abstract .................................................................................................................................. 47 3.2 Introduction ............................................................................................................................ 48 3.3 Materials and methods .......................................................................................................... 50 3.3.1 Mouse strains husbandry and breeding .......................................................................... 50 3.3.2 Generation of embryonic stem cells (ESCs) ..................................................................... 50 3.3.3 Generation of chimeras ................................................................................................... 51 3.3.4 Assessment of chimerism ................................................................................................ 51 3.3.5 Histology .......................................................................................................................... 52 3.3.6 Antibodies ........................................................................................................................ 52 3.3.7 Imaging and cell counting ................................................................................................ 53 ix  3.3.8 Funduscopy...................................................................................................................... 54 3.3.9 Image Processing ............................................................................................................. 54 3.3.10 Statistical Analyses ........................................................................................................ 54 3.4 Results .................................................................................................................................... 54 3.4.1 Expression of EGFP and ?-galactosidase in mouse chimeras .......................................... 54 3.4.2 Nr2e1frc/frc reduced retinal thickness and blood vessel numbers are rescued by wild-type cells in Wt?frc chimeras ........................................................................................................ 57 3.4.3 Nr2e1frc/frc   ller glia mise  ression of    P and retinal structural defects are corrected in Wt?frc chimeras ................................................................................................ 60 3.4.4 Nr2e1frc/frc retinas have altered cell-type proportions, with only the ganglion cell layer defects being rescued by wild-ty e cells in Wt?frc chimeric retinas .................................... 61 3.4.5 Nr2e1frc/frc retinas display an ectopic plexiform layer and a disorganized inner plexiform layer, which are not rescued by wild-ty e cells in Wt?frc retinas ........................................ 71 3.4.6 Nr2e1frc/frc   ller glia cells are a errantly  ositioned in the inner nuclear layer and cell-autonomously misexpress Brn3a ............................................................................................. 74 3.5 Discussion ............................................................................................................................... 78 3.5.1 Cell-autonomous and non-cell autonomous roles of Nr2e1 in regulating retinal morphology .............................................................................................................................. 78 3.5.2 Roles of Nr2e1 in regulating retinal cell number and development ............................... 79 3.5.3  r2e1 cell-autonomously regulates  ller glia maturation and soma  ositioning ....... 83 3.5.4 Role of Nr2e1 in retinal lamination ................................................................................. 84 3.5.5 Concluding remarks ......................................................................................................... 86 Chapter 4 : Novel co-regulator interactions for the orphan nuclear receptor NR2E1 revealed by a peptide array ........................................................................................................................................ 88 4.1 Abstract .................................................................................................................................. 88 4.2 Introduction ............................................................................................................................ 89 4.3 Materials and methods .......................................................................................................... 90 4.3.1 Microarray assay for real-time analysis of co-regulator?nuclear receptor interaction (MARCoNI) ................................................................................................................................ 90 4.3.2 Plasmid constructs and site-directed mutagenesis ......................................................... 92 4.3.3 Protein expression and protein lysates preparation ....................................................... 93 4.3.4 Pull-down experiments ................................................................................................... 94 4.3.5 Western blot .................................................................................................................... 94 x  4.3.6 Mouse strains husbandry and breeding .......................................................................... 95 4.3.7 Histology .......................................................................................................................... 96 4.3.8 Imaging and assessment of retinal thickness .................................................................. 96 4.3.9 Statistical analysis ............................................................................................................ 96 4.4 Results .................................................................................................................................... 97 4.5 Discussion ............................................................................................................................. 107 Chapter 5 : General discussion ........................................................................................................... 111 5.1 Testing the role of NR2E1 candidate mutations in human eye disease ............................... 112 5.1.1 Screening for candidate NR2E1 mutations in patients with optic nerve disorders and hyperplastic primary vitreous................................................................................................. 113 5.2 Understanding the role of Nr2e1 in mouse eye development ............................................ 114 5.2.1  nderstanding the role of  r2e1 in  ller glia ............................................................ 116 5.2.2 Testing the role of Nr2e1 in repressing the glial fate in ganglion cells ......................... 117 5.2.3 Clarifying the role of Nr2e1 in apoptosis during retinal development ......................... 118 5.2.4 Testing the role of Nr2e1 in amacrine development .................................................... 119 5.2.5 Identification of differentially expressed neurite guiding cues in Nr2e1frc/frc retinas .... 120 5.2.6 Studying cell adhesion and guidance molecules in Nr2e1-null mouse brain ................ 120 5.2.7 Coupling planar cell polarity with neurite inhibition through Nr2e1 and atrophin1 .... 121 5.3 Unraveling novel molecular mechanisms of action of NR2E1.............................................. 122 5.3.1 Detail characterization of R274G in the eye .................................................................. 122 5.3.2 Confirming the in vitro binding of NR2E1 to targets in the array that are important for neural stem cell behavior ....................................................................................................... 123 5.3.3 Testing the functional and biological significance of targets in the array ..................... 124 5.3.4 The peptide array as a tool to screen for drugs that modulate NR2E1 ......................... 125 5.4 Conclusion ............................................................................................................................ 126 References .......................................................................................................................................... 127     xi    List of Tables Table 1.1. Protein interactors for vertebrate NR2E1. .......................................................................... 22 Table 2.1. Demographics of patients with ASD, microphthalmia, and optic nerve malformation. ..... 34 Table 2.2. PCR primers designed for mutational analysis of  CYP1B1, PITX2, FOXC1, FOXE3 AND B3GALTL ................................................................................................................................................ 37 Table 2.3. Sequence variation identified in NR2E1. ............................................................................. 39 Table 2.4. Variants found in B3GALTL, CYP1B1, FOXC1 and FOXE3 ..................................................... 42 Table 3.1. Characteristics of the chimeras generated. ......................................................................... 59 Table 4.1. Peptides used in the MARCoNI assay. ................................................................................. 91                  xii  List of Figures Figure 1.1. Schematic representation of vertebrate eye development. ................................................ 2 Figure 1.2. Development and organization of the vertebrate retina. .................................................... 6 Figure 2.1. Patient and his mother are heterozygous for a novel rare protein variant of NR2E1. ...... 44 Figure 3.1. Labeling of blastocyst-derived and ESC-derived cells is mutually exclusive in chimeras. .. 56 Figure 3.2. The reduced retinal thickness and blood vessel numbers characteristic of Nr2e1frc/frc retinas are rescued by wild-ty e cells in Wt?frc chimeras. .............................................................. 58 Figure 3.3.  Nr2e1frc/frc   ller glia mise  ression of    P and retinal structural defects are corrected in Wt?frc chimeras. ........................................................................................................................... 61 Figure 3.4. Nr2e1frc/frc P7 retinas have lower numbers of rods and bipolar cells and this phenotype is not rescued by wild-ty e cells in Wt?frc chimeras. .......................................................................... 63 Figure 3.5. Nr2e1frc/frc P7 retinas have lower numbers of ganglion cells and this phenotype is rescued by wild-ty e cells in Wt?frc chimeras. .............................................................................................. 65 Figure 3.6. Nr2e1frc/frc P7 retinas have increased numbers of amacrine cells and this phenotype is not rescued by wild-type cells in the inner nuclear layer of Wt?frc chimeras. ....................................... 68  igure 3.7. Hori ontal, cones and  ller glial num ers are normal in P7 and P21 Nr2e1frc/frc  retinas. .............................................................................................................................................................. 69 Figure 3.8. S-cones are overre resented in wt?frc chimeras. .......................................................... 70 Figure 3.9. Nr2e1frc/frc P7 retina displays an ectopic plexiform layer that is not rescued by wild-type cells in a Wt?frc chimera. .................................................................................................................. 73 Figure 3.10. Nr2e1frc/frc P7 retina dis lays increased levels of activated ?-catenin. ............................. 74 Figure 3.11. Nr2e1 is e  ressed in  ller glia throughout  ostnatal develo ment. .......................... 75 Figure 3.12. Nr2e1frc/frc    ller glia cells are a errantly  ositioned in the I   and cell-autonomously misexpress Brn3a. ................................................................................................................................ 77 Figure 3.13. Model depicting the cellular composition and organization of Nr2e1frc/frc clones. .......... 87 Figure 4.1. NR2E1 binds to the ATRO box in MARCoNI. ....................................................................... 98 Figure 4.2. NR2E1 binds to 26 peptides representing co-regulator interacting sequences in MARCoNI. ............................................................................................................................................................ 100 Figure 4.3. Conservation of arginine 274 and 276 in NR2E1, and the equivalent residue in NR2E3 and NR2F2. ................................................................................................................................................ 102 Figure 4.4. NR2E1 interacts with P300 and Androgen receptor. ....................................................... 103 Figure 4.5. NR2E1 variant R274G exhibits decreased binding to atrophin1. ..................................... 104 Figure 4.6. Nr2e1frc/frc, R274G mice display normal retinal blood vessel numbers and thickness. .... 106      xiii  List of Abbreviations 129  129S1/SvImJ CoRNR  Co-repressor nuclear receptor box  AAV  Adeno-Associated Virus AF-1  Activation function 1 AF-2  Activation function 2 ASD  Anterior segment dysgenesis  B6  C57BL/6J BAC  Bacterial Artificial Chromosome bHLH  helix-loop-helix  BrdU  Bromodeoxyuridine CNF  Ciliary Neurotrophic Factor  DBD  DNA-binding Domain DG  Dentate Gyrus DNA E(#)  Deoxyribonucleic acid Embryonic Day # EFTFs  Eye field transcription factors  EGF  Epidermal growth factor  EPL  Ectopic plexiform layer ESC  Embryonic Stem Cell FGF  Fibroblast growth factor  FGF8  Fibroblast growth factor 8  FRC  Fierce allele GCL  Ganglion Cell Layer INL  Inner Nuclear Layer IPL  Inner Plexiform Layer IPL  Inner plexiform layer ISH  In Situ Hybridization LBD  Ligand-binding Domain NBL  Neuroblastic layer Nr2e1  Nuclear receptor subfamily 2, group E, member 1 ? Mouse Gene Nr2e1  Nuclear receptor subfamily 2, group E, member 1 ? Mouse Protein NR2E1  Nuclear receptor subfamily 2, group E, member 1 ? Human or vertebrate Gene  NR2E1  Nuclear receptor subfamily 2, group E, member 1 ? Human or vertebrate Protein NR-box  Nuclear receptor box NSC  Neural Stem Cell NSC  Neural Stem Cell ONL  Outer Nuclear Layer OPL  Outer Plexiform Layer OPL  Outer plexiform layer OV  Optic vesicle P(#)  Post-natal Day # xiv  PA  Peters? anomaly  PCR  Polymerase Chain Reaction qRT-PCR  Quantitative RT-PCR RGC  Retinal Ganglion Cell RGC  Retinal ganglion cells  RPCs  Retinal precursor cells RPE  Retinal pigment epithelium  RT-PCR  Reverse Transcriptase PCR SGZ  Subgranular Zone SIFT  Sorting intolerant from tolerant  SNP  Single Nucleotide Polymorphism SVZ  Subventricular Zone TUNNEL  Terminal deoxynucleotidyl transferase dUTP nick end labeling Wt  Wild-type             xv  Acknowledgements Thank you to my PhD supervisory committee for all their support and advice during these years: Drs. Elizabeth M. Simpson, Dan Goldowitz, Keith Humphries and Blair Leavitt. Beth, thank you for giving me this incredible opportunity to challenge myself in the genetics field and for all the knowledge you have shared with me.  I am very grateful to all of my collaborators, who have contributed enormously not only to the successful developing of the projects but to my growth as a scientist. I want to thank Tammy Philippo, Katrina Bepple and Marina Campbell for providing administrative support, proofread various documents, and helping me keep organized.  I am forever grateful to Dr. Bibiana Wong,  Dr. Charles de Leeuw, Dr. Jean-Fran?ois  Schmouth, Adrienne Borrie  and Jack Hickmott for all your support during my PhD. Thank you for being such good friends and mentors. I would like to thank the Simpson lab in general for all the support both moral and scientific during these years. Thank you for making my life in the lab enjoyable. Thank you to my family for always believing in me and encouraging me to pursue my dreams.           xvi  Dedication     To my child,      May you be born in a world in which the pursuit of knowledge always favors the harmonious equilibrium of nature   1  Chapter 1 : General introduction  1.1 The vertebrate eye  1.1.1 General anatomy The eye is an organ specialized in detecting and converting light into electrical stimuli that are transported via the optic nerve to the brain. The eye can be divided into anterior and posterior segments. The anterior segment comprises the cornea, iris, ciliary body and lens. The posterior segment comprises the vitreous, choroid, retina, retinal pigmented epithelium and optic nerve (Richard, 2002). Of interest to this work are the cornea, lens and retina that are frequently affected in human eye disorders. The cornea is a non-vascularized five-layered structure. It consists of keratinocytes and endothelial cells and is rich in collagen. The lens, which functions to change the focal distance of the eye, is comprised of a lens capsule, epithelium, and lens fibers (Lang, 2004). The retina is the final light sensing tissue and will be described in detail below. 1.1.2 Overview of eye development The vertebrate eye is formed from multiple embryonic tissues through coordinated interactions between the neuroectoderm, surface ectoderm, and extraocular mesenchyme. By embryonic day 8 (E8), before there is any morphological evidence of eye formation, the anterior neural plate sets the molecular signature necessary for eye development: the eye field. Studies in Xenopus have demonstrated that a group of conserved eye field transcription factors (EFTFs) consisting of rax, pax6, six3, lhx2, nr2e1 (also known as tailless, tll) and six6 are important for eye field specification (Zuber et al, 2003). The main events leading to eye development are summarized in figure 1.1. After the presumptive eye tissue is formed, optic vesicle (OV) formation initiates at E8 as a lateral evagination from the 2  newly formed forebrain and grows gradually toward the surface ectoderm. Between day E9 and E10, the OV makes contact with the surface ectoderm and remains connected to the forebrain by the optic stalk. When contact with the surface ectoderm is established, both tissues undergo structural changes which begin with thickening of the two layers in contact. The thickening of the surface ectoderm forms the lens placode which invaginates to form the lens vesicle. The neuroectodermal thickening of the optic vesicle invaginates to form the optic cup with two neuroepithelial layers (Richard, 2002).  Figure 1.1. Schematic representation of vertebrate eye development. The optic vesicle forms as an evagination from the diencephalon that contacts the surface ectoderm. The optic vesicle invaginates to form the optic cup and differentiates into RPE, neural retina and optic stalk. The surface ectoderm invaginates to form the lens vesicle. Abbreviations: C: Cornea; L: lens; LP: lens placode; LV: lens vesicle; MS: mesenchyme; NR: neural retina; ON: optic nerve; OS: optic stalk; OV: optic vesicle; RPE: retinal pigment epithelium; S: sclera; SE: surface ectoderm. Adapted from Adler et al., 2007 (Adler & Canto-Soler, 2007).  Between E10 and E15, major differentiation events occur. The cornea, lens, retina and optic nerve begin to form. Importantly, the two neuroepithelial layers of the optic cup display differential 3  growth rates where the inner layer proliferates rapidly to form the neural retina and the outer layer proliferates slower and forms the retinal pigment epithelium (RPE). The specification of the neural retina and RPE is regulated by inductive signals that originate in the surface ectoderm and mesenchyme, respectively (Adler & Canto-Soler, 2007). By E11, the optic vesicle narrows inferiorly forming the choroid fissure, which closes completely during development. Axons from ganglion cells exit the eye through the choroid fissure forming the optic nerve (Chow & Lang, 2001).  From E14 until birth, lens and corneal tissue continue to mature and the iris and ciliary body differentiate from the anterior surface of the optic cup. The retina consists of two neuroblastic layers (NBL) with different cell types but the retinal ganglion cells (RGCs) are not fully mature yet. At postnatal day 21 (P21) eye development is almost complete with the exception of the outflow pathways, ora serrata and vascular system which reach full maturity by P56 (Richard, 2002). Several extrinsic and intrinsic signals orchestrate eye development. As mentioned above, early in development, the anterior neural plate is subdivided into molecular domains that express specific subsets of ETFs. A model in Xenopus has been proposed in which inhibition of otx2 initiates a cascade of EFTFs expression lead by rax and followed by pax6, six3 and lhx2. nr2e1 expresses at the end of this cascade and provides feedback to regulate the expression of six3 and lhx2 (Zuber et al, 2003).  Pax6 is of particular interest to this work and is a very important determinant of eye morphogenesis. Pax6 is a highly conserved transcription factor, which contains two DNA binding domains, a paired domain and a paired-typed homeodomain (Osumi et al, 2008). Importantly, Pax6-null mice (Small eye (Sey) allele) fail to form optic cups (Hill et al, 1991). Pax6 was the first causative gene to be identified in human anophthalmia and is frequently mutated in patients suffering from 4  the eye disorders aniridia and Peters? anomaly (Glaser et al, 1994). Heterozygous hypomorphic Sey mice also display eye abnormalities that involve all ocular tissues including retina, iris, lens and cornea (Collinson et al, 2001; Philips et al, 2005). Pax6 dosage is also very important during eye development as evidenced by the Pax6 overexpressor mice which display microphthalmia with no major brain defects (Schedl et al, 1996). Pax6 is crucial for the development of many other tissues including brain, nose, pancreas and pituitary gland (Osumi et al, 2008). Expression of Pax6, Rax, Hes1, Otx2, Lhx2, Six3, Six6 and Nr2e1 partially overlap within the early optic vesicle (Chow & Lang, 2001; Zuber et al, 2003). Later on, expression becomes more restricted as different eye structures are formed as well as new transcription factors begin to be expressed. For example, Pax2 and Vax2 are expressed in the optic stalk and ventral optic cup (Adler & Canto-Soler, 2007). Pax6, Rax, Lhx2, Vsx2 and Nr2e1 are expressed in the prospective neural retina and Pax6, Otx2 and Mitf in the prospective RPE (Adler & Canto-Soler, 2007; Hollemann et al, 1998; Martinez-Morales et al, 2004).  Extracellular signaling also plays a role in eye development where different tissues are able to affect the development of others. For example, Bone morphogenetic proteins (BMPs) are involved in signaling events between the surface ectoderm and the optic vesicle and mice lacking Bmp7, expressed only in the surface ectoderm, are often eyeless (Dudley & Robertson, 1997). Members of the fibroblast growth factor (FGF) family are also crucial for the formation of the neural retina when secreted by the surface ectoderm and prospective neural retina itself (Zhao et al, 2001). Signaling from fibroblast growth factor 8 (FGF8) in the optic stalk is fundamental for the initiation of retinal differentiation (Esteve & Bovolenta, 2006). Retinoic acid also plays a very important role during eye 5  development by regulating the morphogenic movements that form the optic cup, ventral retina and cornea (Duester, 2009).  1.2 The vertebrate retina 1.2.1 General organization of the retina The retina is the most complex structure of the eye and due to its accessibility, clear lamination, limited number of cell classes and basic circuitry, has represented an excellent model to study the nervous system including processes such as neurogenesis. The retina can be divided into the RPE and the neural retina. The former is a highly polarized and specialized epithelium containing cells that produce melanin. It participates in the outer blood-retinal barrier, maintains electrolytic flow, protects against oxidative stress, controls retinoid metabolism, and phagocytises apoptotic photoreceptors (Martinez-Morales et al, 2004). The neural retina is a light-sensitive tissue that can be divided into 5 layers: the outer nuclear layer (ONL) containing the photoreceptors; the outer plexiform layer (OPL) containing synapses between photoreceptors and interneurons; the inner nuclear layer (INL) which is composed of nuclei from bipolar, horizontal, amacrine and M?ller glia cells; the inner plexiform layer (IPL) which contains the synapses between ganglion, bipolar and amacrine cells; and the ganglion cell layer (GCL), which contains retinal ganglion cells (RGCs) whose axons leave the eye as the optic nerve, and displaced amacrine cells (Richard, 2002). The organization of the retina is summarized in figure 1.1. 6   Figure 1.2. Development and organization of the vertebrate retina. (a) Histological image overlaid with schematic diagram of the mature vertebrate neural retina structure, using the mouse retina as an example. The photoreceptor outer segments associate with the retinal pigmented epithelium (RPE), whereas their cell bodies reside in the outer nuclear layer (ONL). The inner nuclear layer (INL) contains the cell bodies of horizontal, bipolar, and amacrine cells, as well as  ller glia. The ganglion cell layer (GCL) contains the cell bodies of both ganglion and displaced amacrine cells. Connections between the photoreceptor, bipolar, and horizontal cells are found in the outer plexiform layer (OPL), whereas synapses between bipolar, ganglion, and amacrine cells occur in the inner plexiform layer (IPL). The ganglion cell (GC) axons make up the nerve fiber layer. (b) Chronological order and transcriptional regulation of retinal cell birth. GCs are generated first and  ller glia are generated last. Various transcription factors (left) direct the specification of each cell type and subtype. Abbreviation: OS, photoreceptor outer segments. Adapted from Bassett et al, 2012 (Bassett & Wallace, 2012).  7  1.2.2 Development of the retina During retinogenesis six types of neurons and one type of glia differentiate in overlapping waves but in a stereotyped and conserved fashion (Cepko et al, 1996) (Figure 1.1). Retinal differentiation begins at around E10.5 in mouse and lasts until P12 progressing in a medial to lateral gradient (Young, 1985). In the prenatal phase RGCs are the first cell type to differentiate followed by horizontal, cones and amacrine cells. In mice this phase peaks at E15.5 and continues until P2. In the postnatal phase rods, bipolar cells and  ller glia are generated with the peak of differentiation at P0 (Cepko et al, 1996).  During development, most retinal progenitors undergo interkinetic nuclear migration and mitotic divisions occur at the apical surface of the retina (Del Bene et al, 2008). Therefore, most cells have to migrate radially after they have acquired their identity to their final positions in the retina. Tangential migration is also important for cones, amacrine, ganglion and horizontal cells, which position themselves at regular intervals forming arrays that allow a complete sampling of the visual field (Reese & Galli-Resta, 2002). 1.2.3 Cellular and molecular mechanisms of retinal development A main question in developmental neuroscience is how progenitors coordinate proliferation and differentiation so appropriate numbers of each neural type are generated. Several intrinsic and extrinsic factors have been shown to modulate whether a retinal progenitor cell decides to stay in the cell cycle and proliferate or exit the cell cycle and differentiate. Therefore, the interplay between transcriptional regulation, extracellular and intracellular signaling, and cell cycle control has to be tightly regulated. 8  Retinal precursor cells (RPCs) divide symmetrically early during development to increase the pool of progenitors in the early optic cup. Pax6 (Hill et al, 1991), Chx10 (Burmeister et al, 1996) and Sox2 (Taranova et al, 2006) are crucial transcription factors that maintain proliferation in RPC and mutations in these genes result in small or absent eyes. Extrinsic signals such as sonic hedgehog (SHH) (Wallace, 2008), FGF, epidermal growth factor (EGF),  and transforming growth factor alpha (T  ?) also influence RPCs proliferation (Anchan et al, 1991; Lillien & Cepko, 1992).  Retinal fate specification is carried out by many families of transcription factors including basic helix-loop-helix (bHLH), homeodomain and forkhead. Some transcription factors can have an instructive role such as Nrl (Mears et al, 2001) or a permissive role such as Math5 (Brzezinski et al, 2012; Feng et al, 2010) towards a specific lineage. The final commitment to a cell type is also controlled by negative regulatory programs after early commitment to a particular fate. For example, brn3b is expressed in ganglion cell precursors and is important to suppress the amacrine, horizontal and late-born ganglion cell phenotypes (Qiu et al, 2008). In addition to the aforementioned signaling pathways that promote RPC proliferation, other signaling pathways also influence retinal fate. Some of these pathways include signaling from Notch (Perron & Harris, 2000), T  ? (Lillien & Cepko, 1992) and Ciliary Neurotrophic Factor (CNTF) (Goureau et al, 2004) which promote gliogenesis. Transforming growth factor  eta II (T  ?II) is also important to inhibit amacrine differentiation (Ma et al, 2007).  In the retina cell fate choice is also linked to the timing of cell cycle exit. Cells that exit the cell cycle early adopt early fates and cells that exit the cell cycle later adopt later fates. Cell cycle length increases as retinogenesis progresses (Alexiades & Cepko, 1996), and shortening the cell cycle artificially  induces early cell cycle exit and early neural fates. The opposite happens when cell cycle 9  exit is lengthened (Dyer et al, 2003; Ohnuma et al, 2002). It is becoming increasingly evident that factors that regulate the cell cycle influence factors that regulate lineage determination and vice versa, and that a single factor can have dual roles in these processes. For example, in Xenopus, Cyclin-dependent kinase inhibitor 1B (p27) not only is an enzyme inhibitor but also promotes the   ller glial fate, doing so through a distinct protein domain (Ohnuma et al, 1999). Cyclin-dependent kinase inhibitor 1C (p57) regulates the proliferation of retinal precursor cells (RPC) cells and also the development of a subpopulation of amacrine cells (Dyer & Cepko, 2000). Some transcription factors have also dual roles in proliferation and cell fate specification. For example, Prox1 promotes both cell cycle exit and horizontal cell specification in the retina (Dyer et al, 2003). A competence model of histogenesis was proposed by Livesey and Cepko wherein RPC pass through a series of competent states characterized by the successive expression of a set of temporally-coordinated transcription factors giving rise to a limited number of cell-types (Livesey & Cepko, 2001). Other studies have shown that parallel sublineages can occur simultaneously to give rise to all retinal cell types at the same time (Vitorino et al, 2009). Time-lapse studies following RPC clones from perinatal rats in vitro showed that the mode of division of a progenitor follows mostly a stochastic pattern where the decision to divide or differentiate is taken by fixed probabilities that correspond to the abundance of each cell type in the mature retina (Gomes et al, 2011). A recent study extends on this idea and suggests that the retina can emerge by a combination of stochastic and programmatic decisions taken by equipotent RPC in the retina. Specifically, they suggest that initially RPC divide symmetrically to generate two RPCs, and later on, three modes of divisions coexist: symmetrical to generate two RPC, asymmetrical to generate one RPC and one differentiated cell and symmetrical to generate two differentiated cells. The later predominates in a final phase of divisions. In the stage where the three modes of divisions coexist, each precursor has 10  then a probability of mode of division that does not depend on what mode of division was undertaken before. In this way, there is not a strict order of successive competence within a clone and the final numbers of cell types achieved in the mature retina originate from fixed probabilities of cell-type specification and random choices for the mode of division undertaken (He et al, 2012). An important finding that explains the complexity of RPC behavior at different developmental time-points is that they are highly heterogeneous. Gene expression profiling of individual RPC revealed a high level of heterogeneity among progenitors coexisting at the same developmental stage (Trimarchi et al, 2008). In addition to differential expression of transcription factors, RPCs also express different cyclin kinase inhibitors and cyclins as development progresses and in different regions of the retina. For example, p57 and p27 regulate proliferation in distinct populations of RPC in the mouse retina (Dyer & Cepko, 2001). Similarly, cyclin D1 is expressed in a subpopulation of early  PC and cyclin  3 is e  ressed in  ostnatal  PC and  ller glia (Das et al, 2012).  Cell death also plays an important role during retinogenesis. Apoptosis occurs at both embryonic and postnatal periods allowing appropriate numbers of each retinal cell type to be present in the mature retina. Studies in rat show that throughout development apoptosis occurs in 5% of cells in the ONL, 50% of cells in the INL and 50% of cells in the GCL (Voyvodic et al, 1995). Finally, despite the vast knowledge gained in the past years on factors that influence RPC multipotency, cell fate and cell cycle control, the interplay among factors involved in these processes is largely unknown and will require extensive research as we attempt to understand how retinal stem cells are directed to the appropriate lineages and how to control this process for therapeutic purposes.  11  1.3 Congenital human eye disorders  Eye malformations can occur due to failure in major eye developmental processes such as formation of the optic vesicle, lens induction, organization of the early retina or fusion of the optic fissure.  In the human population, whole eye disorders such as anophthalmia (no eyes) and microphthalmia (small eye) have a combined birth incidence of 1/5,000 (Fitzpatrick & van Heyningen, 2005). Other congenital disorders can affect primarily the retina or the anterior segment of the eye. The latter group of disorders is known as anterior segment dysgenesis (ASD).  Some of the main manifestations of congenital retinal disorders are retinitis pigmentosa where rod photoreceptors degenerate (Ayuso & Millan, 2010), inherited macular degeneration characterized by gradual loss of visual acuity, color vision and contrast sensitivity (Chen et al, 2010), and Leber congenital amaurosis, the most severe of retinal dystrophies characterized by blindness and variable retinal pathology (Koenekoop, 2004). Some of the ASD relevant to this work are Peters? anomaly (PA) and aniridia which will be explained in the following section. In recent years, many of the genetic mutations causing inherited eye disorders have been identified. Mutations in genes participating in anterior segment development such as PITX2, PITX3, FOXC1, FOXE3, PAX6, and MAF have been implicated in ASD (Cvekl & Tamm, 2004; Wurm et al, 2008).  In the retina, genes involved in phototransduction, the visual cycle or retinal precursor proliferation/differentiation have also been identified (Phelan & Bok 2000, Rattner et al 1999). Rhodopsin mutations are the most numerous, with more than 100 mutations reported (Daiger, 2004). Other common genes with mutations in retinal disorders are RDS, RP1, RPE65, and IMPDH1(RP1O) (Daiger, 2004).   12  1.3.1 Peter?s anomaly, Peters-Plus syndrome and aniridia Peters? anomaly (PA) (OMIM 604229) is a subtype of ASD caused by incomplete or delayed detachment of the lens vesicle from the surface ectoderm. Patients present with corneal clouding and variable iridolenticular corneal adhesions. It can be inherited as an autosomal dominant or recessive trait (MacDonald et al, 2004). Mutations in PAX6 (Hanson et al, 1994), FOXC1 (Honkanen et al, 2003), CYP1B1 (Vincent et al, 2001) and PITX2 (Doward et al, 1999) have been reported as causative in the disease. Peters-Plus syndrome (PP) (OMIM 261540) is a rare autosomal recessive disorder characterized by ocular disorders resembling PA. PP is also characterized by other systemic abnormalities that are always present such as growth delay, dysmorphic facial features, and short broad hands with fifth finger clinodactyly. Other abnormalities that are often present include short stature, cleft-lip and/or cleft-palate, hearing loss, abnormal ears, heart defects, genitourinary anomalies, variable degrees of mental retardation, and central nervous system abnormalities, including hydrocephalus. Mutations in B3GALTL are found in all patients diagnosed with PP (Faletra et al, 2011; Reis et al, 2008).  Aniridia (OMIM 106210) is a rare panocular disorder with a prevalence of 1:40,000 to 1:100,000 occurring with the same frequency in women as men. It primarily affects the iris, retina, optic nerve, lens and cornea. The main diagnostic feature is congenital absence or hypoplasia of the iris. The retina abnormalities include foveal hypoplasia, macular hypopigmentation and vascularization in the avascular fovea (Hingorani et al, 2012). Optic nerve hypoplasia and coloboma also occur in some cases (Hingorani et al, 2009; Morrison et al, 2002). Aniridia patients may also present with systemic abnormalities including brain malformations, hearing problems and WAGR syndrome 13  (Wilms tumor, aniridia, genitourinary anomalies, mental retardation syndrome) (Hingorani et al, 2012). In most cases, aniridia is caused by a dominant mutation on the PAX6 gene. Various PAX6 mutations involving intragenic regions or chromosomal rearrangement have been reported. The genetic cause of remaining cases is unknown (Hingorani et al, 2012).  1.4 Nuclear receptor 2E1 (NR2E1) 1.4.1 Nuclear receptors Nuclear receptors (NRs) are one of the main classes of transcriptional regulators in animals and are in charge of regulating many developmental and homeostatic processes. NRs can function as repressors or activators of gene transcription and are modulated by ligand-binding.  NRs share a similar structure having a DNA binding domain (DBD) in the center of the polypeptide and a ligand binding domain (LBD) at the C-terminus. The N-terminal region is highly variable and can contain an activation function (AF-1) that confers transcriptional activation independently of the LBD interaction with a ligand. The DBD and LBD are connected by a hinge region that is highly variable. The  B  normally contains 12 ? helices with helices 3, 7, and 10  roviding amino acid residues that form a hydrophobic pocket for ligand binding (Huang et al, 2010). It also contains a second activation function (AF-2) that is regulated by ligand binding. The DBD contains a conserved sequence with a short motif (P-box) responsible for DNA-binding specificity on sequences typically containing the AGGTCA sequence (Huang et al, 2010). The nuclear receptor superfamily is divided into 6 main subfamilies: 1) Thyroid Hormone Receptor-like, 2) Retinoid X Receptor-like, 3) Estrogen Receptor-like, 4) Nerve Growth Factor IB-like, 5) Steroidogenic Factor-like, and 6) Germ Cell Nuclear Factor-like. These subfamilies include receptors for steroid hormones, receptors for non-steroid ligands, receptors that bind diverse products of 14  lipid metabolism and orphan receptors with no known physiologically relevant ligand (Mangelsdorf et al, 1995). Around half of the 48 human nuclear receptors are still considered orphans (Burris et al, 2012).  1.4.1.1 Molecular mechanisms involved in nuclear receptor function NRs can exert transcriptional regulation in a genomic (by binding to specific response elements) and non-genomic way (by non-transcriptional regulation of signal transduction). The former can involve gene activation, gene derepression, gene repression or gene transrepression (Nettles & Greene, 2005).  NRs function by recruiting positive and negative regulatory proteins; namely co-activators-needed to activate gene transcription, and co-represssors needed to repress it. Co-regulators can induce histone modification, chromatin remodeling or participate in the assembly of the co-regulatory complex. The complexity of gene regulation is mediated not only by a vast number of co-regulators each able to interact with many different proteins but also by the regulation that each co-regulator is subjected to. Co-regulators are modulated by protein levels, covalent modifications and competitive binding (Perissi & Rosenfeld, 2005). Co-repressor protein levels can be regulated by the ubiquitylation machinery and proteasome-dependent degradation (Perissi et al, 2004).   In the classical model of NR function, agonist binding to a NR induces a conformational change in the ligand-binding domain, which, in turn, results in reduced affinity for co-repressors and enhanced affinity for co-activators.  In this model, the co-repressor nuclear receptor (CoRNR) box motif (I/LxxII) in the co-repressor interacts with a hydrophobic groove on the receptor (Perissi et al, 1999). After ligand binding, the co-activator can interact with the receptor through the nuclear receptor box (NR-box) motif (LxxLL) in the same region as the CoRNR box. The repositioning of helix 15  12 upon ligand binding in the receptor reduces the hydrophobic groove making it available for NR-box binding but inaccessible to the CoRNR box (Glass & Rosenfeld, 2000). A later model has proposed that a continuous exchange between co-repressor and co-activator complexes is required for transcriptional activation. In this model, not only a ligand-induced conformational change in the NR is necessary for co-regulator exchange but also an active removal of co-repressors by means of phosphorylation or degradation (Metivier et al, 2003). Although most co-repressors bind to unliganded NRs, some bind in response to ligand binding through a NR-box. Examples of these are Nuclear Receptor Interacting Protein 1 (NIRIP1) (Zschiedrich et al, 2008) and Transcription Intermediary  actor 1 ? (TI 1?) (Rambaud et al, 2009). Other co-regulators can function both as co-activators and co-repressors such as Proline, Glutamate and Leucine Rich Protein 1 (PELP1) (Vadlamudi et al, 2001) and Nuclear Receptor Binding SET Domain Protein 1 (NSD1) (Kurotaki et al, 2001).  1.4.2 Overview of NR2E1 The Tailless (Tll) gene was first identified in Drosophila where it was shown to function as a transcriptional repressor necessary for the establishment of terminal domains in the Drosophila embryo (Pignoni et al, 1990; Steingrimsson et al, 1991). The chick and mouse homolog of Tll gene (NR2E1) were subsequently cloned after a cDNA library screening using RXR? or Tll as a probe, respectively (Monaghan et al, 1995; Yu et al, 1994).  As a member of the nuclear receptor superfamily, NR2E1 has an N-terminal DBD and a C-terminal LBD connected by a hinge region. NR2E1 is highly conserved among vertebrates having 100% amino acid identity in its DBD and 99.6% identity in its LBD between mouse and humans. Drosophila Tll 16  and vertebrate NR2E1 share 81% identity in the DBD and 41% identity in the LBD. The LBD of NR2E1 shares 42% amino acid identity with the orphan nuclear receptor NR2F2 (Monaghan et al, 1995). 1.4.3 Expression pattern of NR2E1 In Drosophila, Tll  is first detected at both embryonic termini but later it becomes localized to the developing brain (Pignoni et al, 1990). A detailed expression pattern of the Nr2e1 protein in mice has been limited due to the unavailability of a reliable commercial antibody. Most of our knowledge of Nr2e1 expression pattern comes from studies by the Sch?tz group, who first characterized the distribution of Nr2e1 mRNA throughout mouse development by in situ hybridization (Monaghan et al, 1995). Expression of mouse Nr2e1 is first detected on embryonic day 8 (E8) in the 5-somite embryo. This expression is restricted to a few cells of the neural epithelium. From 6 to 13-somite stages expression is evident in prosencephalon, diencephalon and in structures that evaginate from the diencephalon such as the optic and nasal processes. Nr2e1 expression peaks at E12.5 and declines from E13.5 to birth after which it increases again with high levels detected in the ventricular zone of the telencephalon and diencephalon, developing olfactory epithelium, the optic tract and the retina (Monaghan et al, 1995).  Of interest to this work is the expression of Nr2e1 in the eye. At E9 Nr2e1 is expressed throughout the neural epithelium of the optic evaginations while they approach the surface ectoderm. When the optic stalk contacts the surface ectoderm, Nr2e1 transcripts are not detected in neural epithelium adjacent to the surface ectoderm but they are still present in the inner and outer layers of the optic cup as it invaginates. Nr2e1 is not detected in the lateral tips of the optic cup that give rise to the cilliary body and iris (Monaghan et al, 1995). By insertion of the lacZ gene at the Nr2e1 locus, Miyawaki et al. resolved the expression pattern of Nr2e1 in the developing retina (Miyawaki 17  et al, 2004). This study shows expression of Nr2e1 at E11.5 in the central developing retina which later extends to the periphery. From E13.5 onwards, ?-gal expression localized to the RPCs in the entire neuroblastic layer (NBL). At E17.5, ?-gal expression is detected within the optic nerve. At early postnatal periods ?-gal expression is localized to the INL in M?ller cells and remains in these cells in adulthood (Miyawaki et al, 2004). 1.4.4 Role of NR2E1 in brain development Loss-of-function experiments have given tremendous insight into the biological function of NR2E1. In Drosophila, loss-of-function alleles of Tailless (Tll) result in abnormalities of the anterior and posterior poles (Pignoni et al, 1990). In mice, various models of Nr2e1 inactivation have been studied. These include deletions in exons two and three (Monaghan et al, 1997), and exons three, four and five (Yu et al, 2000); and a spontaneous deletion recovered in mice by our laboratory. This deletion is referred to as the fierce (frc) allele, which is a deletion of the proximal promoter and all nine exons of Nr2e1 (Kumar et al, 2004). In Nr2e1-null mice, there is considerable brain hypoplasia observed in adults due to a reduction of the cerebral hemispheres and associated structures (Land & Monaghan, 2003; Roy et al, 2004; Roy et al, 2002; Stenman et al, 2003; Young et al, 2002). Nr2e1-null mice fail to correctly establish the telencephalic pallio-subpallial boundary as evidenced by altered gene expression at this boundary and abnormal formation of the radial glial pallisade (Stenman et al, 2003). 1.4.4.1 Role of NR2E1 in human brain disorders Due to the cortical hypoplasia and socially abnormal behaviours of Nr2e1-null mice along with the equivalency of mouse and human NR2E1 in gene regulation and protein function (Abrahams et al, 18  2005), the role of NR2E1 in human brain development and behavior is of great interest and has been studied by the Simpson Laboratory.   An initial study aimed at screening for possible variation in NR2E1 in patients with cortical malformations was undertaken by the Simpson Laboratory. NR2E1 was sequenced in its entire coding region, untranslated, splice sites, proximal promoter and evolutionarily conserved non-coding regions in 56 unrelated patients with cortical disorders. Seven novel candidate regulatory mutations that were absent from control subjects were identified suggesting a role of NR2E1 expression levels in cortical malformations (Kumar et al, 2007b). Candidate mutations for NR2E1 were also screened for in 126 humans with bipolar disorder, schizophrenia, or aggressive disorders. Eight novel candidate mutations that were absent in 325 controls were identified. Genetic association analysis was performed in 394 patients with bipolar disorder, 396 with schizophrenia, and 479 controls using six common markers and haplotypes. An association with bipolar disorder I was found suggesting a role of NR2E1 in psychiatric disorders (Kumar et al, 2008). 1.4.5 Role of NR2E1 in eye development A role for NR2E1 in regulating eye development has been observed in both Drosophila and vertebrates. In Drosophila embryos, Tll controls cell fate specification in the optic lobe (Daniel et al, 1999). In Xenopus, a fusion protein containing the Nr2e1 DBD and the engrailed repressor domain (Xtll-ZF-EnR) interferes with the evagination of the eye vesicle and subsequent eye formation (Hollemann et al, 1998). In contrast, Nr2e1-null mice exhibit no obvious optic cup abnormalities but display retinal and optic nerve dystrophy (Miyawaki et al, 2004; Yu et al, 2000). 19  Progressive postnatal retinal cell loss and increased apoptosis were detected in Nr2e1-null mice with a reduction of cell numbers in all retinal layers by P21 (Miyawaki et al, 2004). Retinal blood vessels are also affected in Nr2e1-null mice where there are fewer numbers and disorganized growth of blood vessels as opposed to the radial symmetry observed in wild-type mice. Nr2e1-null mice also retain the hyaloid vasculature which is normally lost in the postnatal eye (Uemura et al, 2006). Together, these abnormalities probably cause Nr2e1-null mice blindness (Young et al, 2002; Yu et al, 2000).  1.4.6 Cellular mechanisms of action of NR2E1 1.4.6.1 NR2E1 regulates neural stem cell behavior Studies over the past 15 years have clearly demonstrated a role of NR2E1 in regulating neural stem cell (NSC) cycle in vertebrates and Drosophila at various stages of development. In Drosophila embryos, Tll was shown to be required for proliferation and maintenance of Mushroom body neuroblasts, the equivalent of vertebrate neural stem cells (Kurusu et al, 2009). Roy and collaborators initially found that Nr2e1 regulates the timing of cortical neurogenesis in mice (Roy et al, 2004). Nr2e1-null mice showed an increase in the rate of proliferation of neural precursors and premature neurogenesis during the first neurogenic divisions occurring in the ventricular zone from E9.5 to E12.5. In late neurogenesis (from E16.5 onwards), there was a depletion of the precursor pool with longer cell cycle times, which demonstrated that Nr2e1 plays a crucial role in the control of neural precursor cell cycle (Roy et al, 2004).  Another study confirmed the role of Nr2e1 in neural stem cell (NSC) cell-cycle progression by showing that Nr2e1 is specifically expressed in neural precursor cells that are Nestin-positive in the germinal zones of embryonic brains, and that absence of Nr2e1 lengthened their cell-cycle. It was 20  also observed that a smaller fraction of cells reentering the cell-cycle in E14.5 Nr2e1-null NSCs caused a reduction in total NSC numbers (Li et al, 2008).  Nr2e1 also regulates the proliferation and differentiation of adult NSCs of the subventricular zone (SVZ) of the lateral ventricle and the subgranular zone (SGZ) of the dentate gyrus (DG), the main germinal zones of sustained neurogenesis during adulthood in the mammalian brain (Gage, 2000). Nr2e1 is expressed exclusively in astrocyte-like type B cells in mice, which are the NSCs in the SVZ (Doetsch et al, 1999) and is essential for maintaining their self-renewal in the adult SVZ. Nr2e1 was also shown to be required for the formation of astrocyte-like type B cells from radial glia during the early postnatal period (Liu et al, 2008). In the DG, inactivation of Nr2e1 by inducible recombination in adult mice leads to a reduction in NSC proliferation and impaired spatial learning (Zhang et al, 2008a). A recent study also showed that Nr2e1-null brains still contain NSCs in the adult DG but they are mispositioned in the granular layer and inactive. Interestingly, overexpressing Nr2e1 in these cells reactivated their ability to proliferate (Niu et al, 2011). This suggests that Nr2e1 in the adult brain is not completely required for the formation of adult NSC or the prevention of their differentiation in the adult DG. In agreement with a role for Nr2e1 in neural stem cell behaviour at various stages of development, overexpression of Nr2e1 has been found to promote excessive proliferation of NSCs leading to tumor formation. Overexpression of Nr2e1 in a glioma cell line induced cell proliferation and tumor formation in in vivo transplantation assays (Park et al, 2010). Overexpression of Nr2e1 in mice also caused the development of glioma-like lesions and gliomas which was exacerbated by the loss of the tumor suppressor p53 (Park et al, 2010). Importantly, increased Nr2e1 expression was also 21  observed in various glioma stem cell lines (Park et al, 2010) as well as in human primary glioblastomas (Liu et al, 2010). A recent study showed that Nr2e1 is also essential for the proliferation of stem cells harboring deletions in p21, p53, or Pten. In agreement with this role, Nr2e1-null mice prevented gliomagenesis within the adult neurogenic niches of mice harboring those deletions (Zou et al, 2012). Overall, these studies strongly suggest that NR2E1 could be of therapeutic or diagnostic use for glioblastomas and underscores its importance in NSC behavior. Nr2e1 has also shown to be important in retinal precursor cells (RPCs), where it also regulates cell cycle progression. A 70% reduction in BrdU incorporation was shown in E16.5 mouse retinal cells suggesting a reduction in the proportion of RPCs undergoing mitosis (Miyawaki et al, 2004). At P0 cells had prolonged cell cycle and there was an increase of cells that have exited the cell cycle compared to wild-type.  Increased expression of Pou4f1 (brn3a) and Pou4f3 (brn3c) was detected in Nr2e1 mutant retinas at both E14.5 and P0 suggesting premature neurogenesis as these factors are expressed in ganglion cells, the first cell types to be differentiated in the retina, and are sufficient for their differentiation (Zhang et al, 2006). As opposed to forebrain development, an increase in apoptosis has been observed in Nr2e1-null mice compared to wild-type (Miyawaki et al, 2004; Zhang et al, 2006). In agreement with this, a progressive cellular loss is seen in postnatal retinas. However, it seems that all retinal cell-types are affected in a similar way (Miyawaki et al, 2004). 1.4.6.2 NR2E1 regulates the development of astro ytes an   ller  l a  In addition to its expression in neural stem cells, Nr2e1 is also expressed in immature astrocytes and  ller glia in the retina (Miyawaki et al, 2004). Nr2e1 has shown to be important for the maturation of astrocytes. An impaired astrocytic network formation was shown to cause a decrease 22  of retinal vasculogenesis in Nr2e1-null mice (Miyawaki et al, 2004). Nr2e1 was also shown to be expressed specifically in proangiogenic astrocytes and its expression controlled by oxygen concentration (Uemura et al, 2006).     otential role of  r2e1 in  ller glia maturation was also suggested  y iyawa i and collaborators based on the persistent expression of Nr2e1 in these cells, and the ectopic expression of GFAP and reduced cell process thickness in Nr2e1-null  ller glia (Miyawaki et al, 2004). 1.4.7 Molecular mechanisms involved in NR2E1 function 1.4.7.1 Protein partners of NR2E1 To date, the molecular mechanism by which NR2E1 functions to regulate cell cycle and overall brain and retinal development are poorly understood. As a transcription factor, NR2E1 likely interacts with co-regulators (co-activators and/or co-repressors), other transcription factors and molecular chaperones.   Interestingly, only a handful of interactor proteins have been identified for vertebrate NR2E1 (Table 1.1). Furthermore, although evidence on the role of mouse Nr2e1 in activating gene transcription is increasing, no co-activator partners for Nr2e1 have been reported yet.  Table 1.1. Protein interactors for vertebrate NR2E1.   Protein Function Binding Species Reference 1 Atrophin 1  Co-repressor Direct Yeast-2-hybrid (Zhang et al, 2006) 2 BCL11A Co-repressor Direct Human HEK293 cells (Estruch et al, 2012) 3 LSD1 Co-repressor Direct Human retinoblastoma Y79 cells (Yokoyama et al, 2008) 4 HDAC 3, 5, 7 Co-repressor Unknown Cultured mouse forebrain progenitors (Sun et al, 2007) 5 pVHL Stabilization of HIF-2a Unknown Human neuroblastoma cell line (Zeng et al, 2012) 6 Sp1 TF, activation of Mash1 Unknown Human COS1 cells (Elmi et al, 2010)  TF, transcription factor 23  In Drosophila, Tll physically interacts with the co-repressor Atro to repress the segmentation gene even-skipped (Wang et al, 2006). The interaction of Nr2e1 and Atro homologs, Atrophin1 and Atrophin2, has also been reported in the mouse retina (Zhang et al, 2006) although its functional significance has not been assessed. Nr2e1 recruits histone deacetylases (HDAC) 3, 5, 7, (Sun et al, 2007) and lysine-specific demethylase 1 (LSD1) (Yokoyama et al, 2008) to chromatin to repress the promoters of p21 and Pten, respectively.  Furthermore, the oncoprotein and zinc finger transcription factor BCL11A was also shown to interact with NR2E1 and function as a co-repressor for NR2E1 on the promoter of p21 in HEK293 cells (Estruch et al, 2012). NR2E1 also interacts with proteins that have not been characterized as co-regulators. One of these proteins is von Hippel-Lindau protein (pVHL). In the presence of oxygen, hydroxylated hypoxia-inducible factor alpha (HIF-?)  inds  VH  which facilitates its degradation. However,   2E1  competes with HIF-? for  inding to  VH , which contri utes to the sta ili ation of HI -2? in neuroblastoma during normoxia (Zeng et al, 2012). Nr2e1 also cooperates with the transcription factor Specificity Protein 1 (Sp1) to directly target and activate the MASH1 promoter (Elmi et al, 2010). 1.4.7.2 Gene targets of NR2E1 As a transcription factor NR2E1 directly binds to the promoter of target genes to regulate their transcription. To date, a small number of target genes have been identified that help us understand the role of NR2E1 at the cellular level. Nr2e1 directly binds to the promoters of the transcription factors Pax2 (Yu et al, 2000) to repress its transcription. Pax2 is expressed in the ventral half of the optic vesicle during early eye morphogenesis and it later becomes confined to the optic stalk. Pax2 mutants show agenesis of the 24  optic chiasma, expansion of the retinal pigmented epithelium into the optic stalk and failure of the optic fissure to close resulting in coloboma (Torres et al, 1996). Importantly, overexpression of NR2E1 reproduces some of these phenotypes in chick (Yu et al, 2000). Nr2e1 also directly binds to the promoter of the transcription factor Mash1 to activate its transcription (Elmi et al, 2010). Mash1 is a member of the basic helix-loop-helix (bHLH) family of transcription factors and it plays a role in the specification of the neuronal lineage from neural precursor cells (NPCs) including retinal progenitors (Tomita et al, 1996). Overexpression of NR2E1 in primary hippocampal progenitors induced transient proliferation and later differentiation into neurons as well as an increase in Mash1 expression (Elmi et al, 2010).  Direct binding of Nr2e1 to the promoter of phospholipase C epsilon (Plce1) may also mediate its effects on neuronal differentiation (Zhang et al, 2006). Nr2e1 also directly binds and activates the promoters of the protein deacetylase Sirt1 (Iwahara et al, 2009) and the secreted ligand Wingless-Type MMTV Integration Site Family, Member 7A (Wnt7a) (Qu et al, 2010). Sirt1 is a histone deacetylase that has been recently shown to suppress proliferation of NPCs and favor their differentiation towards the astroglial lineage at the expense of the neuronal lineage (Prozorovski et al, 2008). The functional significance of NR2E1 transcriptional activation of Sirt1 awaits further characterization. Wnt7 is a signaling molecule that has been implicated in neural development and synaptic plasticity (Cerpa et al, 2008). Qu and collaborators showed that Wnt7a and its downstream target, active beta-catenin, also promote neural stem cell self-renewal and that both molecules rescued the defects in cell proliferation induced by Nr2e1 siRNA in adult mouse NSCs. They suggested that NR2E1 acts through the Wnt/beta-catenin pathway to regulate neural stem cell proliferation and self-renewal (Qu et al, 2010). 25  Nr2e1 also directly binds to the promoters of aquaporin 4 (Aqp4), Glial fibrillary acidic protein (Gfap) and S100 Calcium Binding Protein B (S100?) (Shi et al, 2004). As all of these genes are glial-specific (Eng, 1985; Jacque et al, 1978; Nagelhus et al, 2004), Nr2e1 may have a role in suppressing the glial lineage in progenitors through their repression. As evidence of this, Aqp4, Gfap, and S100? become upregulated in cultured Nr2e1-null progenitors (Shi et al, 2004). Intriguingly,  r2e1 is also e  ressed in  ller glia and immature astrocytes  ut the functional role of Nr2e1 in relation to these genes in astrocytes and  ller glial cells remains unexplored.   Nr2e1 also directly binds to the promoters of the tumor suppressors p21 and Pten (Zhang et al, 2006). Although the interaction of Nr2e1 with these factors has not been studied in detail, it is presumed that the repression of their expression is part of the mechanism by which Nr2e1 keeps NPCs in the cell cycle and prevents differentiation. Importantly, upregulation of p21 and pTen has been observed in both the retina and the brain of Nr2e1-null mice (Li et al, 2008; Zhang et al, 2008a; Zhang et al, 2006). Nr2e1 also indirectly regulates the retinoic acid rece tor  eta (   ?)  y acting as a cell type-specific regulator of its activity. Nr2e1 interacts with a yet unidentified protein that binds to a cis element within    ?  romoter, which confers  r2e1- and retinoic acid-dependent transactivation (Kobayashi et al, 2000). Interestingly, Nr2e1 represses various microRNA molecules involved in neural stem cell proliferation. Nr2e1 acts with the co-repressor LSD1 to repress miR-137 by directly binding to its promoter thus preventing differentiation of NSCs (Sun et al, 2011a). LSD1, in turn, is repressed by miR-137. In this way, a feedback regulatory loop is formed between miR-137, Nr2e1 and LSD1 necessary to control NSC proliferation and differentiation. Similarly, Nr2e1 represses miR-9 which, 26  in turn, suppresses Nr2e1 expression to promote neural differentiation and negatively regulate NSC proliferation (Zhao et al, 2009). 1.4.8 Regulation of NR2E1 expression Despite of the well characterized role of NR2E1 in neural stem cell maintenance, very little is known regarding its upstream regulators. As explained above, both miR-137 and miR-9 are capable of repressing murine Nr2e1 (Sun et al, 2011a; Zhao et al, 2009). In addition to these microRNAs, let-7b and let-7d also repress Nr2e1 in NSCs (Zhao et al, 2010; Zhao et al, 2013). In addition to microRNAs, Nr2e1 also binds to its own promoter to repress its expression (Shimozaki et al, 2012). Furthermore,  the transcription factor Sox2 binds to the promoter of Nr2e1 and positively regulates its expression in luciferase reporter assays (Shimozaki et al, 2012). 1.5 Thesis objectives 1.5.1 Role of NR2E1 in aniridia The eye phenotype of Nr2e1-null mice that includes blindness, retinal dystrophy and blood vessel defects, along with the high conservation of the NR2E1 gene, suggest that eye defects would result from mutations in NR2E1 in humans. Adding to this hypothesis, Nr2e1 genetically interacts with Pax6 in mice, a master eye regulator implicated in many eye disorders including most cases of aniridia. Strikingly, the role of NR2E1 in human eye disorders has not been explored. To test the hypothesis that aniridia patients with absence of PAX6 mutations may harbor coding or regulatory mutations in NR2E1, we screened NR2E1 for candidate mutations in patients with aniridia and also included other related congenital ocular malformations (anterior segment dysgenesis (ASD), congenital optic nerve malformation, and microphthalmia). The NR2E1 coding region, 5? and 3? untranslated regions (UTR), exon flanking regions including consensus splice sites and six 27  evolutionarily conserved non-coding candidate regulatory regions were analyzed by sequencing in 42 probands negative for PAX6 mutations and  19  probands with ASD, 1 proband with optic nerve malformation, and 2 probands with microphthalmia. We also sequenced a control population comprised of 376 healthy individuals.  1.5.2 Cell-autonomous and non-cell-autonomous roles of Nr2e1 during mouse retinogenesis Nr2e1-null mice have a complex eye phenotype involving premature retinal neurogenesis, retinal dystrophy, and impaired retinal blood vessel formation. The effects of Nr2e1 on different retinal populations, and its cell-autonomous and non-cell autonomous roles during eye development remain unknown. To undertake such study, we investigated the retinas of Nr2e1frc/frc mice and Nr2e1+/+ ? Nr2e1frc/frc chimeras at various postnatal time-points. We hypothesized that Nr2e1frc/frc retinas have an overrepresentation of cells born early (ganglion, amacrines) and underrepresentation of cells born later (bi olars and  ller glia) as has been shown to occur with premature neurogenesis. We also hypothesized that Nr2e1 has both cell-autonomous and non-cell autonomous roles in retinal development because it directly regulates both cell cycle genes and the secreted Wnt7a molecule, which participates in neurogenesis. 1.5.3 In search of novel co-regulators for NR2E1 NR2E1 functions as a repressor and activator of gene transcription but so far only a handful of co-repressors and no co-activators that interact with NR2E1 have been identified. In order to find potential co-regulators for NR2E1, we used an array containing peptides representing nuclear receptor co-regulators most of which harbored co-activator motif sequences. We also used NR2E1 single-point variants to test the specificity of the array and pull down experiments to confirm the 28  results obtained from it. In addition, we tested the effects of the NR2E1 variant R274G in retinal development.   29  Chapter 2 : Absence of NR2E1 mutations in patients with aniridia  2.1 Abstract Nuclear receptor 2E1 (NR2E1) is a transcription factor with many roles during eye development and thus may be responsible for the occurrence of certain congenital eye disorders in humans. To test this hypothesis we screened NR2E1 for candidate mutations in patients with aniridia and other congenital ocular malformations (anterior segment dysgenesis (ASD), congenital optic nerve malformation, and microphthalmia). The NR2E1 coding region, 5? and 3? untranslated regions (UTR), exon flanking regions including consensus splice sites and six evolutionarily conserved non-coding candidate regulatory regions were analyzed by sequencing 58 probands with aniridia of which 42 were negative for PAX6 mutations. Nineteen probands with ASD, 1 proband with optic nerve malformation, and 2 probands with microphthalmia were also sequenced. The control population was comprised of 376 healthy individuals. All sequences were analyzed against the GenBank sequence AL078596.8 for NR2E1. In addition, the coding region and flanking intronic sequences of FOXE3, FOXC1, PITX2, CYP1B1, PAX6 and B3GALTL were sequenced in one patient and his relatives. Sequencing analysis showed 17 NR2E1 variants including two novel rare non-coding variants (g.-1507G>A, g.14258C>T), and one novel rare coding variant (p.Arg274Gly). The latter, was present in a male diagnosed with Peters? anomaly (P ) who su sequently was found to have a  nown causative mutation for Peter-plus syndrome (PP) in B3GALTL (c.660+1G>A). In addition, the NR2E1 novel rare coding variant Arg274Gly was present in the unaffected mother of the patient but absent in 746 control chromosomes. We eliminated a major role for NR2E1 regulatory and coding mutations in aniridia and found a novel rare coding variant in NR2E1. In addition, we found no coding region variation in the control population for NR2E1, which further supports its previously reported high level of conservation and low genetic diversity. Future NR2E1 studies in ocular 30  disease groups such as those involving retinal and optic nerve abnormalities should be undertaken to determine whether NR2E1 plays a role in these conditions.  2.2 Introduction Congenital ocular malformations contribute to 17% of blindness cases in children worldwide (Ferretti P, 2006). Aniridia is a severe form of congenital ocular malformation that is characterized by iris hypoplasia or complete/partial absence of the iris and is usually accompanied by a range of other ocular disorders such as macular and optic nerve hypoplasia, glaucoma, and cataract (Kokotas & Petersen, 2010). Aniridia can be found combined with interhemispheric brain abnormalities (Abouzeid et al, 2009; Bamiou et al, 2004; Netland et al, 2011; Sisodiya et al, 2001; Thompson et al, 2004), obesity (Netland et al, 2011), and as part of a the WAGR syndrome, which includes Wilms tumor, genitourinary anomalies, and mental retardation (Fischbach et al, 2005). Anterior segment dysgenesis (ASD) is a genetically diverse group of congenital ocular malformations that affect the cornea, iris, lens and/or ciliary body. The clinical manifestations of ASD vary greatly between individuals. ASD can be classified as infantile glaucoma, Axenfeld- ieger Syndrome and Peters? anomaly (PA) among others (Idrees et al, 2006). The molecular mechanisms underlying congenital eye disorders involve mutations in genes that control the specification of the eye field, optic vesicle morphogenesis, growth patterning and closure of the optic cup, development of the retina and optic nerve, anterior segment morphogenesis and lens development. Among those genes, PAX6 is the most prominent, being the only known causative gene in classic aniridia and accounting for approximately 80% of these patients (Traboulsi et al, 2008). Other genes found to be mutated in ASD include B3GALTL, CYP1B1, FOXC1, FOXE3 and PITX2 (Arikawa et al, 2010; Ciralsky & Colby, 2007; Iseri et al, 2009; Kaur et al, 2009; Reis et al, 2008; Sun et al, 2011b; Zhang et al, 2011). Nevertheless, despite substantial efforts to identify causative mutations (Berker et al, 2009; 31  Chavarria-Soley et al, 2006; Dansault et al, 2007; Edward et al, 2004; Reis & Semina, 2011; Traboulsi et al, 2008; Vincent et al, 2006), the pathogenesis of many congenital ocular malformations remains unknown. The nuclear receptor 2E1 (NR2E1, also known as TLX) is involved in the control of proliferation of neural stem cells during brain and eye development. The role of NR2E1 in human disease is starting to be recognized as its genomic variation has been associated with bipolar disorder, and its overexpression in gliomas correlates with a decreased survival of brain tumor patients (Kumar et al, 2008; Park et al, 2010). NR2E1 is expressed very early during eye morphogenesis in the eye field together with Pax6 (Zuber et al, 2003), as well as in the optic cup and optic stalk (Monaghan et al, 1995; Yu et al, 2000). Mice lacking Nr2e1 display brain and eye defects resulting from abnormal neural stem cell proliferation and depletion of the neural stem cell pool (Liu et al, 2008; Zhang et al, 2006). At the molecular level there are different ways in which NR2E1 affects pathways involved in eye development. In mice, Nr2e1 represses Pax2 expression (Yu et al, 2000), which is required for optic cup and optic nerve development (Sehgal et al, 2008). Pax2 and Pax6 mutually inhibit each other to define the retina and optic stalk boundaries (Schwarz et al, 2000) and dysregulation of this process negatively affects optic nerve development (Azuma et al, 2003). Thus, Nr2e1 may indirectly influence the expression of Pax6, which is a master regulator of eye development and causes a variety of eye developmental disorders when mutated (Hanson, 2003). Evidence for such an interaction comes from Xenopus studies where Nr2e1 positively affects Pax6 levels (Zuber et al, 2003). Interestingly, the genetic interaction between Nr2e1 and Pax6 regulates the establishment of the dorsal-ventral cortical boundary in the mouse telencephalon (Stenman et al, 2003). In addition, Nr2e1 is involved in the retinoic acid pathway by potentiating the retinoic-acid-mediated induction of the retinoic acid rece tor  eta 2 (   ?2)  romoter (Kobayashi et al, 2000), which is 32  involved in retinal and anterior chamber morphogenesis (McFadden et al, 2004; McFadden et al, 2006; Troilo et al, 2006). Nr2e1 also has a non-cell autonomous role in activating the Wnt signaling pathway to promote neural stem cell proliferation and self-renewal (Qu et al, 2010). This pathway has many roles during eye development including patterning of the ocular surface ectoderm (Miller et al, 2006). Finally, NR2E3, the closest relative to NR2E1 in the human genome, causes enhanced S-cone syndrome and retinitis pigmentosa in humans (Escher et al, 2009; Hayashi et al, 2005; Schorderet & Escher, 2009). Thus, due to the important role that NR2E1 plays during eye development, we hypothesize that NR2E1 may be involved in human eye disorders impacting a wide range of eye structures whose development depend on NR2E1 genetic interactors such as PAX2 and PAX6.  Overall, the NR2E1 locus is unusually highly conserved, reminiscent of the HOX cluster, and displays low genetic diversity amongst humans (Abrahams et al, 2002; Kumar et al, 2008). We have previously screened for NR2E1 mutations in patients with severe brain malformations and bipolar disorder (Kumar et al, 2007a; Kumar et al, 2007b; Kumar et al, 2008) but did not find any amino acid variations. However, 14 non-synonymous variants have now been reported in the public databases; dbSNP, 1000 genomes, and the NHLBI Exome Sequencing Project (ESP). Among these variants 6 are predicted to confer amino acid substitutions that would affect protein function by Sorting Intolerant From Tolerant (SIFT) and Polymorphism Phenotyping (PolyPhen) scores; 2 of these were found in cancerous tissues in the heterozygous state, 3 were found in European-descendent ESP cohorts (comprising heart, lung and blood diseases) in the heterozygous state and 1 of unknown zygosity was found in European-descendent cohorts with atherosclerotic heart disease from the ClinSeq project (Biesecker et al, 2009).  33  Surprisingly, no cohort group comprised of individuals with a specific eye disorder has been screened for variation in NR2E1. To initiate such studies, we focused on sequencing NR2E1 in patients with aniridia but also included patients with ASD, microphthalmia and optic nerve malformations known not to harbour PAX6 mutations. We chose aniridia since we hypothesized that NR2E1 could alter PAX6 expression or functioning and ultimately lead to a phenotype resembling PAX6 haploinsufficiency. In this study, we identified several NR2E1 polymorphisms as well as a new amino acid variant in a  atient diagnosed with Peters? anomaly (P ) whom we subsequently found harbours a known causative mutation in B3GALTL. Sequencing of B3GALTL, CYP1B1, FOXC1, FOXE3 and PITX2 in the patient and his close relatives also revealed new variants in a subset of these genes. In conclusion, we did not find any causative mutation in NR2E1 that could explain aniridia.   2.3 Materials and methods 2.3.1 Patients and control individuals This study followed Canada?s Tri-Council Statement on ?Ethical Conduct for  esearch Involving Humans? and was a  roved  y The  niversity of British Colum ia (Certificate of    roval #C99-0524). Informed consent was obtained for all patients. Clinical and demographic data for all subjects are reported in Table 2.1. The study group consisted of 80 probands, 376 controls and 22 unaffected relatives.   Fifty-eight probands were diagnosed with aniridia, one proband had Axenfeld-Rieger syndrome, one proband had coloboma with congenital cataract, 12 probands had PA, five probands had Rieger syndrome, two probands had microphthalmia and one proband had optic nerve malformation (Table 2.1). Just over 70% of the samples collected were previously examined for PAX6 pathogenic 34  mutations and found to be negative using chromosomal analysis (11 aniridia samples (11 probands), 1 PA sample), and dideoxyfingerprinting or sequencing (33 aniridia samples (31 probands) and 21 samples of ASD, microphthalmia and other disorders) (Table 2.1). Thirty six patients were contacted and DNA samples collected during the 2007 Aniridia International Medical Conference (Memphis, TN, 2007). Some DNA samples were obtained from collections belonging to the research groups of Dr. Brian Brooks (1 sample) (National Eye Institute, National Institutes of Health, Department of Health and Human Services, Bethesda, Maryland, United States of America), Dr. Thomas Rosenberg and Dr. Karen Gronskov (17 samples) (Kennedy Center, Glostrup, Denmark), Dr. Francesca Pasutto (14 samples) (Institute of Human Genetics, Friedrich-Alexander University of Erlangen-Nuremberg, Erlangen, Germany),  Table 2.1. Demographics of patients with ASD, microphthalmia, and optic nerve malformation.  The demographic features of 89 patients with congenital ocular malformations, 376 controls and 22 unaffected relatives are shown. Numbers indicate the number of patients participating in this study. The majority of patients were tested for PAX6 mutations and chosen to participate in this study after they were found negative. Thirty-one probands with aniridia were negative for PAX6 after sequencing and 11 probands with aniridia were negative for PAX6 after chromosomal analysis. N/A, not applicable. PathologyMale Female Unknown Caucasian UnknownPAX6 Tested TotalAniridia 17 28 22 8 59 44 67SDAxenfeld-Rieger syndrome 0 0 1 0 1 1 1C loboma/congenit l cataract 0 1 0 1 0 1 1Pete s' omaly 3 1 8 4 8 12 12Rieger syndro e 1 1 3 2 3 5 5OtherMicrophthalmia 2 0 0 2 0 2 2Optic nerve malformation 1 0 0 1 0 1 1Control 0 0 376 376 0 N/A 376Unaffected relatives 7 14 1 0 22 N/A 22Gender Ethnicity 35  Dr. Michael Walter (7 samples) (Department of Medical Genetics, University of Alberta, Edmonton, Canada) and Dr. Veronica Van Heyningen (14 samples) (Medical Research Council (MRC), Human Genetics Unit, Edinburgh, Scotland, UK). The control group consisted of 282 individuals of Caucasian descent obtained from the Coriell Cell Repository (http://coriell.umdnj.edu/), 188 of which were used in a previous study including 94 sam les from individuals considered ?neurologically normal? (Kumar et al, 2008). Ninety-four Caucasian patients diagnosed with Gilbert syndrome, a bilirubin disorder, also used in a previous study were included in this study as controls (Kumar et al, 2008). In addition, 22 unaffected relatives were included in the study to better assess the potential pathogenicity of the variants found. Eighteen were relatives of patients with aniridia and 4 were relatives of patients with PA.  2.3.2 NR2E1 sequencing analysis Oragene?     self-collection kits (DNA Genotek, Gaithersburg, MD) were used to collect saliva from patients and relatives during the 2007 Aniridia International Medical Conference (2007,  em his, T ,  S ).  enomic     was e tracted using oleStri s?     Blood Kit ( ysa er,  orway) according to the manufacturer?s instructions. Patient  lood-purified DNA sent by collaborators was shipped and stored at 4?C. Sequence analysis included bi-directional sequencing of the coding region, 5' and 3' untranslated regions (UTR), exon flanking regions including consensus splice sites, and six evolutionarily conserved candidate regulatory non-coding regions using 20 polymerase chain reaction (PCR) amplicons as previously described (Kumar et al, 2007b). Human genomic NR2E1 (GenBank AL078596.8) sequence was used as the reference sequence. The numbering of NR2E1 variants was based on Antonarakis and the Nomenclature Working Group 36  (Antonarakis, 1998). Every human NR2E1 variant found was confirmed by repeating the PCR and sequencing process. DNA samples from a subset of patients displaying NR2E1 variants g.14121C>G and g.14258C>T with unknown PAX6 genotype were subjected to targeted array CGH analysis with exon-level resolution to identify deletions or duplications of one or more exons of PAX6 (Redeker et al, 2008) by GeneDx (Gaithersburg, MD, USA). In addition, these samples were analyzed for mutations by bi-directional sequencing of exonic regions of PAX6 (exons 1-13, the alternatively spliced exon 5a, and splice junctions) by GeneDx. B3GALTL, CYP1B1, FOXC1, FOXE3 and PITX2 were analyzed in patient 21000 and his family for sequence variations by bi-directional sequencing of exons and at least 10 bp of flanking intron sequence. Sanger sequencing was performed using BigDye terminator kit version 3.1 and capillary electrophoresis on an ABI3130XL (Applied Biosystems). Subsequent data analysis was performed using SeqScape (Carlsbad, CA, USA). Primers for B3GALTL were previously described (Reis et al, 2008) and novel primers are depicted in Table 2.2. Forward primers had ACCCACTGCTTACTGGCTTATC and reverse primers GAGGGGCAAACAACAGATGGC added for sequencing of the PCR product (underlined, Table 2.2). 2.3.3 Database search and In silico analysis of variants dbSNP database was searched at http://www.ncbi.nlm.nih.gov/projects/SNP/ (accessed July, 2012). 1000 genomes database was searched at http://browser.1000genomes.org/index.html (accessed July, 2012). NHLBI Exome Sequencing Project (ESP) was searched at Exome Variant Server, NHLBI Exome Sequencing Project (ESP), Seattle, WA (URL: http://evs.gs.washington.edu/EVS/ ) (accessed July, 2012). SIFT scores (Ng & Henikoff, 2003) were calculated using the online resource http://sift.jcvi.org/www/SIFT_seq_submit2.html (accessed May, 2011). PolyPhen scores (Adzhubei et al, 2010) were calculated using the online resource http://genetics.bwh.harvard.edu/pph2/ (accessed July, 2012). 37  Table 2.2. PCR primers designed for mutational analysis of  CYP1B1, PITX2, FOXC1, FOXE3 AND B3GALTL  Underlined, sequences used for sequencing primers. Gene Name SequenceB3GALTL oEMS4859 GAATGAAATCAGAAAAAAGTCAGCGoEMS4860 TATGTCCCATAAACATAGTATTTCCYP1B1 CYP1B1-2.1-2FH ACCCACTGCTTACTGGCTTATCTCCGACCTCTCCACCCAACCYP1B1-2.1-2RH GAGGGGCAAACAACAGATGGCCAGTGCTCCGAGTAGTGGCCCYP1B1-2-FH2 ACCCACTGCTTACTGGCTTATCGCAGCTCCGGTCCGCCYP1B1-2-2RH2 GAGGGGCAAACAACAGATGGCCAGCTCACGGAACTCGGGCYP1B1-2.3-2FH ACCCACTGCTTACTGGCTTATCTTCCGTGTGGTGTCCGGCYP1B1-2.3-2RH GAGGGGCAAACAACAGATGGCCGCCTTCTTTTCCGCAGAGCYP1B1-2-4FH ACCCACTGCTTACTGGCTTATCACAACGAAGAGTTCGGGCGCYP1B1-2-4RH GAGGGGCAAACAACAGATGGCGAAACCCCAAACCCGGGCYP1B1-3-1FH ACCCACTGCTTACTGGCTTATCCTAGATAGCCTATTTAAGAAAAAGTGGAATTACYP1B1-3-1RH GAGGGGCAAACAACAGATGGCGTGAGCCAGGATGGAGATGAAGCYP1B1-3-2FH ACCCACTGCTTACTGGCTTATCGTTTTTGTCAACCAGTGGTCTGTGCYP1B1-3-2RH2 GAGGGGCAAACAACAGATGGCCTACTCATGAAGAACCGCTGGGFOXC1 FOXC1-1FH2 ACCCACTGCTTACTGGCTTATCCAGCGCAGCCGGACGCACAGFOXC1-1RH2 GAGGGGCAAACAACAGATGGCGCCAGCCCTGCTTGTTGTCCCGFOXC1-2FH ACCCACTGCTTACTGGCTTATCAGCTACATCGCGCTCATCACCAFOXC1-2RH GAGGGGCAAACAACAGATGGCTGCTGTCGGGGCTCTCGATCTTFOXC1-3FH ACCCACTGCTTACTGGCTTATCCCGTGCGCATCCAGGACATCAAFOXC1-3RH GAGGGGCAAACAACAGATGGCATGGCTTGCAGGTTGCAGTGGTFOXC1-4FH ACCCACTGCTTACTGGCTTATCCTACTCGCCCGGCCAGAGCTCCFOXC1-4RH3 GAGGGGCAAACAACAGATGGCTTTCGATTTTGCCTTGATGGFOXE3 FOXE3-1FH ACCCACTGCTTACTGGCTTATCAGGAGGGGTGGAAAGGGAAGGGGAFOXE3-1RH GAGGGGCAAACAACAGATGGCCGGTAGATGGCGGCCAGCGTGAGFOXE3-2FH ACCCACTGCTTACTGGCTTATCCGAGCCAGGGCGGGAGCCAGFOXE3-2RH GAGGGGCAAACAACAGATGGCAAGGCTGCGGCTGCGGCGTCFOXE3-3FH ACCCACTGCTTACTGGCTTATCCGCCCGCGCGTCTGTTCAGCFOXE3-3RH GAGGGGCAAACAACAGATGGCGAGTCCAGGAGGCCACGACGAGAPITX2 PITX2-2FH ACCCACTGCTTACTGGCTTATCAGTCTCATCTGAGCCCTGCTCACPITX2-2RH GAGGGGCAAACAACAGATGGCGCGATTTGGTTCTGATTTCCTPITX2-3FH ACCCACTGCTTACTGGCTTATCGTCTTTGCTCTTTGTCCCTCTTTCPITX2-3RH GAGGGGCAAACAACAGATGGCAATTTGGGGAAAGGAATTAACGTCPITX2-4AFH ACCCACTGCTTACTGGCTTATCGCCCGCCTCTGGTTTTAAGATGPITX2-4ARH GAGGGGCAAACAACAGATGGCTCCGGAAGGCTCAAGCGAAAAAPITX2-4BFH ACCCACTGCTTACTGGCTTATCGGGAGGGAGAGAAGAAGGGGGTPITX2-4BRH GAGGGGCAAACAACAGATGGCGAGCCAGGCGAACGACCACTPITX2-5FH ACCCACTGCTTACTGGCTTATCCCAGCTCTTCCACGGCTTCTGCPITX2-5RH GAGGGGCAAACAACAGATGGCTCGGAGAGGGAACTGTAATCTCGCPITX2-6FH ACCCACTGCTTACTGGCTTATCTGAGTGCGCTAGCGTGTGTGTCPITX2-6RH GAGGGGCAAACAACAGATGGCTCCCTTTCTTTAGTGCCCACGACC38  2.3.4 Clinical assessment of patient 2100  During infancy a pediatric ophthalmological consultant performed bed-side inspections including assessment of visual acuity with large objects and preferential looking techniques. Examination of the exterior eye and eye movements was performed with a pencil light. Anterior segments were studied with a hand-held slit lamp, and visualization of the posterior segments by indirect ophthalmoscopy. Examinations under general anesthesia were performed with an operating microscope. Intraocular tension was assessed with applanation tonometry and Schi?tz tonometer. Retinal inspections were performed with a binocular indirect ophthalmoscope, and eye dimensions were measured with ultrasound. 2.4 Results Studying a proband group made up primarily of aniridia (72.5% (58/80)) and ASD (23.75% (19/80)) and enriched for cases with no evidence of PAX6 mutation (82.5% (66/80)), we identified 17 NR2E1 variants (Table 2.3). Only 1 variant was located in the coding region. Among the non-coding region variants, 5 were in the 5'-UTR, 7 within intronic regions, and 4 within upstream conserved candidate regulatory elements. To explore whether the variants found represented polymorphisms, rare variants or, candidate mutations in NR2E1, we sequenced a control group of 376 unaffected individuals (752 normal chromosomes). Not all the amplicons were successfully sequenced for every control and thus the exact numbers of control chromosomes are depicted in Table 2.3.  Although most of our aniridia patients were negative for PAX6 mutations, a fraction of the probands (11/58) only had analysis of chromosomal aberrations at the PAX6 locus done, so point mutations and small deletion/insertions were not detected. Similarly, some patients sequenced for PAX6 exons may have intronic or upstream deletions that were not detected by the method used. In this 39  way, our aniridia PAX6 negative group might have been overall smaller than 42 probands, thus reducing the power of our study. The rare variant g.-1507G>A was located in a conserved element and was not previously reported but was also found in an unaffected relative of the patient with aniridia and thus was not a strong candidate for a causative mutation. However, two rare variants were not previously reported and  Table 2.3. Sequence variation identified in NR2E1.  Allele frequencies of sequence variations within NR2E1 in patients with congenital ocular malformations and controls. The number of unaffected family members (UFM) who have the same variation as their affected relatives is shown. aNumbering based on Antonarakis and the Nomenclature Working Group (Antonarakis SE, 1998), where A of the initiator Met codon in exon 1 is denoted nucleotide +1 in human genomic NR2E1 sequence: GenBank AL078596.8. bCE, evolutionary conserved element within NR2E1 locus (Abrahams et al., 2002). cRare variants representing <1% of the population. N/A, not applicable; ND, not determined; UFM = Unaffected family members.  g.-2945A>G N/A CE11A (Upstream) 2/160 1 0/3242/484 (0.41)cKumar et al., 2007TCAGAACTGTATTGTGATTTAg.-1507G>A N/A CE12A (Upstream) 1/160 1 0/3701/530 (0.19)cThis studyAATGGGGAGGGGGTAGGGGATg.-1492G>A N/A CE12A (Upstream) 8/160 1 0/370 8/530 (1.51) Kumar et al., 2007GGGGATGAGGGCCTCTCTTCAg.-1453C>G N/A CE12A (Upstream) 1/160 0 1/3702/530 (0.38)cKumar et al., 2007AGCGGGAGCCCGCAACGCCCGg.-555C>T N/A 5'UTR 1/160 0 2/3703/530 (0.57)cKumar et al., 2007ATCTAGTTTTCCCACTCTGCGg.-364C>A N/A 5'UTR 1/160 0 ND1/160 (0.63)cdbSNPCGTAGGAAGGCCATTTTCGTGg.-200G>C N/A 5'UTR 8/160 1 ND 8/160 (5.00) Kumar et al., 2007AGAAACTTAAGGATGCTTAAAg.-93A>G N/A 5'UTR 117/160 15 ND 117/160 (73.125) Kumar et al., 2007GCTGGAGGGCAGCTGGAGAGCg.-34C>T N/A 5'UTR 7/160 1 ND 7/160 (4.38) Kumar et al., 2007ACTCGGGCAGCGCCCACCAACg.2040G>A N/A CE17B (Intron 1) 74/160 11 ND 74/160 (46.25) dbSNPCGCCTTGCCCGGCTTCTCGCGg.3026C>G N/A CE19B (Intron 1) 1/160 1 ND1/160 (0.63)cKumar et al., 2007GAGGGGGGCGCCGAGCCGGTGg.3154C>T N/A CE19B (Intron 1) 12/160 0 44/370 56/530 (10.57) dbSNPGTTGTAATTACCCGGCCGAGCg. 4601-4602delTC N/A Intron 1 15/160 1 ND 15/160 (9.38) Kumar et al., 2007TTGCTTAGCATCTCTCTCTCCg.10049-10050delTG N/A Intron 4 80/160 12 ND 80/160 (50.00) dbSNPCTGAGCTGTGTGATTGGGGTCg.14121C>G p.Arg274Gly Exon 7 1/160 1 0/7461/906 (0.11)cThis studyGGTGGTGGCTCGATTTAGACAg.14258C>T N/A Intron 7 1/160 0 0/7461/906 (0.11)cThis studyTCAGCCACCTCGAAGTCTGAAg.14672C>A N/A Intron 7 8/160 0 ND 8/160 (5.00) dbSNPAAGTGATCCGCCTGCCTCGGCNucleotide Changea Amino-acid ChangeLocationbProbandAlleleFreq.ControlAlleleFreq.TotalAllele Freq.Previously reported Flanking sequenceUFM 40  were not found in the control population (Table 2.3); variant g.14258C>T was in intron 7 in a patient with aniridia and variant g.14121C>G (Arg274Gly) was located in Exon 7 in a patient diagnosed with PA. We further sequenced PAX6 in these patients and found a known causal mutation (Baum et al, 1999; Singh et al, 2001) co-occurring with the variant g.14258C>T, which suggested that there was no functional significance for this NR2E1 variant. However, we did not find any PAX6 mutation in the male patient 21000 harboring the variant g.14121C>G (Arg274Gly). In summary, we did not find any candidate mutations in NR2E1 in patients with aniridia but found one candidate mutation in a patient diagnosed with PA who we further characterized as described below.  2.4.1 Clinical Characteristics of patient 21000 The patient, a boy, was the third child of a 40-year-old female after six pregnancies, three of which were terminated by spontaneous abortion.  The child was delivered by spontaneous birth in gestational week 38 with a low birth-weight 1,775 g (<1st percentile) and birth length 40 cm (<1st percentile). Placenta was small with one third infarction. No neonatal asphyxia was noted. Immediately after birth a large head circumference and corneal clouding was observed. Intracranial ultrasound showed intraventricular hemorrhage grade 3 with dilation of the ventricular system. A ventriculo-peritoneal shunt was necessary to control his head circumference. Pediatric follow-up showed pronounced growth retardation. At three years of age the bone age was retarded by two years. A laparoscopic examination established right testicular agenesia at six years of age. At twelve years the beginning of puberty was noted and his height had reached 126 cm (<3rd percentile). Puberty-suppressing treatment and growth hormone treatment was initiated despite normal hormone values to improve his final height. At 15 years his height was 149 cm (<3rd percentile), and his weight 52.8 kg (20th-50th percentile). He had normal proportions between upper and lower trunk as well as extremities with normal hands and feet. He showed normal facial characteristics, had 41  normal teeth and normal umbilicus. Fine and gross motor skills were appropriate for age.  Psycho-motor development was described as normal by several examinations, the last one at the age of 5. No renal failure was suspected and no ultrasound exam of the kidneys was done. The patient had a normal karyotype, and no sign of inborn metabolic diseases in blood and urine.  At four days old a corneal opacity on both eyes was noted by an ophthalmic examination and a tentative diagnosis of Peters? anomaly was made. He was visually alert and had no nystagmus.  t the age of six weeks examination under general anesthesia disclosed a corneal lenticular contact with thread-like structures from the pupillary margin to the posterior lens surface. At 14 months a binocular visual acuity of 20/200 was assessed by preferential looking. Re-examination under general anesthesia showed corneal diameters (right/left) of 11/11 mm, axial lengths of 19.8/20.8 mm, and intraocular tension of 11/11 mm Hg. Gonioscopy showed dysgenesis of the irido-corneal angle with a fine membrane covering the peripheral part of the iris root, and drag on the peripheral iris. The lenses were clear and indirect ophthalmoscopy showed normal optic nerve-heads, normal retinal vessels and pigmentation, and no sign of persistent hyaloid vessels. Both eyes had normal diameters, large central corneal opacities with central thinning, and clear peripheries. Therapy-resistant glaucoma developed in both eyes and was complicated by keratopathy, nearly collapsed anterior chambers, and dense cataracts. At age 13 he was virtually blind and used logtext and Braille in school.   2.4.2 Genetic assessment of patient 21000 To comprehensively study patient 21000, we sequenced additional candidate genes. This patient was originally diagnosed with PA but careful review of clinical information revealed short stature and developmental delay resembling Peters-plus syndrome (PP). Thus, we screened the patient for 42  additional genes known to be involved in the development of PA: CYP1B1, PITX2, FOXC1 and FOXE3, and also PP: B3GALTL. During this work, we identified a known homozygous pathogenic variation c.660+1G>A in B3GALTL (Reis et al, 2008) indicative of PP (Table 2.4). In addition, we found 3 novel non-pathological variants and 9 known variants in B3GALTL, FOXC1 and FOXE3 (Table 2.4). Subsequently, we sequenced B3GALTL in  atient 21000?s mother, father, and sister, and found the B3GALTL c.660+1G>A variation in the heterozygous state in all of them. Table 2.4. Variants found in B3GALTL, CYP1B1, FOXC1 and FOXE3   Gene Nucleotide Changea Amino Acid Change Location    First observation B3GALTL c.597-23delA N/A Intron 7 dbSNP  c.781-34_31dup N/A Intron 9 This study  c.1065-142T>C N/A Intron 12 dbSNP  c.348T>C p.(=) Exon 6 dbSNP  c.660+1G>Ab N/A Intron 8 Oberstein et al., 2006      CYP1B1 c.142C>G p.Arg48Gly Exon 2 dbSNP  c.1294G>C p.Val432Leu Exon 3 dbSNP  c.1347T>C p.(=) Exon 3 dbSNP  c.1358A>G p.Asn453Ser Exon 3 dbSNP      FOXE3 c.587G>C p.Gly196Ala  Exon 1 This study  c.510C>T p.(=) Exon 1 dbSNP      FOXC1 c.1267G>T  p.Ala423Ser Exon1 This study  Sequence variations within B3GALTL, CYP1B1, FOXE3 and FOXC1 found in patient 21000 and/or his mother, father and sister. Human genomic sequences (GenBank): B3GALTL: NM_194318.3; CYP1B1: NM_000104.3; FOXC1: NM_001453.2; FOXE3: NM_012186.2. aNumbering based on Antonarakis and the Nomenclature Working Group (Antonarakis SE, 1998), where A of the initiator Met codon in exon 1 is denoted nucleotide +1 in the coding region. bPathological mutation found in patient 21000. p.(=), no amino acid change.  We then explored the possibility that the phenotype of patient 21000 might be the result of a combination of mutations in B3GALTL and NR2E1 by further characterizing the NR2E1 rare variant 43  g.14121C>G (Arg274Gly). The sequence trace of this variant showed a double C/G peak, indicative of heterozygosity and thus the presence of a Wt arginine (Arg) and a variant glycine (Gly) in NR2E1 at amino acid 274 (Figure 2.1). To better understand the biochemical and possible biological consequences of the amino acid change we considered the SIFT score, which was 0.01, suggestive of no tolerance for this amino acid substitution. In addition, homology-BLAST analysis depicts a high (>90%) NR2E1-protein conservation among vertebrates and 100% identity at Arg274. NR2E3 protein is also highly (>70%) conserved and has 100% identity at Arg309, which aligns with NR2E1 Arg274. Furthermore, a database search for NR2E1 coding variants revealed the Arg274Gln variant (dbSNP, rs148906882), found in a melanoma sample and thus of potential biological significance (Wei et al, 2011).  We also screened for the Arg274Gly variant in the relatives of patient 21000, including the mother, father, and sister (Figure 2.1) and found that the mother was positive for variant Arg274Gly but presented with no phenotypic eye abnormalities even after detailed re-examination. These results suggested that variant Arg274Gly did not contribute to the phenotype in patient 21000.  44   Figure 2.1. Patient and his mother are heterozygous for a novel rare protein variant of NR2E1.  (A) Patient 21000 chromatogram shows the base pair change C?>G and the normal allele. (B) Pedigree depicting the family of patient 21000. (C) Protein domain representation of NR2E1 depicting the location of amino-acid change from Arg to Gly (arrow). DBD, DNA Binding Domain; LBD, Ligand Binding Domain; numbers represent amino-acids.  2.5 Discussion NR2E1 is a candidate for human congenital ocular malformation based on its role in mouse eye development, and interaction with key eye developmental genes such as Pax2 and Pax6 as well as prominent signalling pathways that regulate eye morphogenesis such as Wnt and retinoic acid. Based on this data, we undertook the first screening for NR2E1 mutations focused on human eye disorders. A patient population with congenital eye disorders enriched for lack of mutations in PAX6 was screened for sequence variation in functional regions of NR2E1 including candidate regulatory 45  and coding regions. We extended the characterization of several known polymorphisms, and identified one novel rare variant in a conserved element (g.-1507G>A). In addition, we found one novel rare intronic variant (g. 14258C>T) and one novel rare coding variant (g.14121C>G; p. Arg274Gly), not present in the control group. The latter, represents one of the few amino-acid changes found in NR2E1, all with unknown functional consequences, despite past substantial efforts to identify coding variants by sequencing-based mutation screening (Kumar et al, 2007a; Kumar et al, 2007b; Kumar et al, 2008); thus, we focused our further studies on this variant.  The novel rare NR2E1 coding variant was found hetero ygous in a  atient diagnosed with Peters? anomaly; it results in a substitution from Arg to Gly in amino acid 274 (Arg274Gly). There is substantial evidence suggesting that this amino acid change would alter NR2E1 protein functioning: 1) the high conservation of Arg274 not only in NR2E1 but also in NR2E3 (Arg309) and the association of the NR2E3 variant, Arg309Gly, with eye disease (Haider et al, 2000); 2) the low SIFT score indicating the substitution would not be tolerated; and 3) the possible clinical relevance of the Arg274Gln variant found in melanoma tissue (Wei et al, 2011) which, interestingly, has a SIFT score of only 0.04. However, patient 21000 also harboured a known causative homozygous mutation in B3GALTL and his phenotypically normal mother was heterozygous for the NR2E1 Arg274Gly variant. Although the patient does not seem to have typical PP due to its lack of facial dysmorphic features (Faletra et al, 2011), it is unlikely that the NR2E1 variant would have a role  in improving this condition. Thus, we conclude that the Arg274Gly variant does not cause disease in the heterozygous state, which is in accordance with studies in mice where homozygous loss-of-function of Nr2e1 is required for brain phenotypes (Land & Monaghan, 2003). However, the potential remains that this variant could be found in a future patient contributing to the phenotype in a homozygous or compound heterozygous state. 46  In conclusion, we have eliminated a major role for NR2E1 regulatory and coding mutations in aniridia. In addition, the lack of coding region variation we have found in the control population for NR2E1 further supports the high level of conservation and low genetic diversity known for this gene (Abrahams et al, 2002; Kumar et al, 2008). These genomic characteristics also argue that most changes in the coding region would have important biological consequences. Thus, future studies in other ocular disease groups are well justified and we propose that diseases involving retinal defects or optic nerve malformations should constitute the next research focus. 2.6 Acknowledgments The authors thank Dr. Veronica Van Heyningen (Human Genet. Unit, Med. Res. Council, Edinburgh, United Kingdom) for providing DNA samples, and Dr. Valerie Anne Wallace (Faculty of Medicine, University of Ottawa, ON, Canada) for providing training to AB. Importantly, the authors also thank the patients and their families for the kind donation of their time and DNA. This work was funded by a Sharon Stewart Aniridia Research Award to EMS. The authors indicate no financial conflict of interest.   47  Chapter 3 : Nr2e1 regulates cellular development and lamination during mouse retinogenesis 3.1 Abstract During retinal development multipotent retinal progenitors generate six types of neurons and one type of glia in a sequential order. After exiting the cell cycle, cells migrate to form the appropriate retinal layers and extend processes that are constrained within two plexiform strata. The emergence of different retinal cell types and their laminar organization is orchestrated by multiple extrinsic and intrinsic factors. Nr2e1 is a nuclear receptor expressed in neural stem cells. In the retina, Nr2e1 prevents premature neurogenesis and dystrophy, and is important for blood vessel formation. However, the role of Nr2e1 on different retinal populations, and its cell-autonomous and non-cell autonomous function during eye development remain unknown. Here, we studied the retinas of Nr2e1frc/frc mice and Nr2e1+/+ ? Nr2e1frc/frc chimeras. We hypothesized that Nr2e1frc/frc retinas would have an overrepresentation of cells born early (ganglion, amacrines) and underrepresentation of cells born later (bi olars and  ller glia) as has  een shown when premature neurogenesis occurs. We found that lack of Nr2e1 resulted in increased numbers of glycinergic amacrine cells; and decreased num ers of ganglion, rods and  i olar cells at P7.  o change in hori ontal, cones and  ller glia was evident at P7 and P21. Nr2e1frc/frc retinas also displayed increased activated ?-catenin, and lamination defects including an ectopic plexiform layer. In chimeras containing both Nr2e1frc/frc and Nr2e1+/+ cells, the numbers of cells in the ganglion cell layer were the only ones rescued by wild-type cells while lamination defects and the proportions of bipolar, rods and inner nuclear layer (INL) amacrine cells were not restored. Furthermore, Nr2e1frc/frc    ller glia were a errantly  ositioned in the I   and mise  ressed Brn3a 48  cell-autonomously. Together, these results revealed that Nr2e1 has multiple roles beyond preventing premature cell cycle exit during retinogenesis, including the regulation of retinal lamination as well as  ller glia and amacrine cell develo ment. 3.2 Introduction During retinal development six neuronal cell-types and one type of glia are generated in a conserved histogenic order and in overlapping waves (Livesey & Cepko, 2001).  anglion neurons are the first cells to  e generated followed  y amacrine, hori ontal, cones and rods during the em ryonic  eriod and  i olar, and  ller glia during the  ostnatal  eriod (Livesey & Cepko, 2001). These cell classes are organized into three nuclear layers and generate two plexiform layers where most of the synapses are confined. Although substantial experimental evidence suggests that retinal precursor cell (RPC) proliferation and fate choice are mainly determined by cell-autonomous mechanisms (Cayouette et al, 2003; He et al, 2012; Watanabe & Raff, 1990), extracellular signaling from differentiated cells has also been shown to play a role. For example, sonic hedgehog and vascular endothelial growth factor (VEGF) produced by retinal ganglion cells regulate the proliferation of RPCs and differentiation of other cells types (Hashimoto et al, 2006; Yu et al, 2006). Similarly, transforming growth factor ?II (T  ?II), regulated by Zac1, is produced by amacrine cells and acts as a negative feedback signal to lower amacrine production (Ma et al, 2007). The cell cycle also plays an important role during retinogenesis. The cell cycle length of vertebrate neural progenitors increases over time (Alexiades & Cepko, 1996) suggesting that the timing of cell cycle exit is highly linked to retinal fate. In fact, in various vertebrates including mice, premature cell cycle exit in the retina increases the numbers of cells that are born early and decreases the number of cells born towards the end of retinal histogenesis (Casarosa et al, 2003; Dyer & Cepko, 2001; 49  Ohnuma et al, 2002). Adding to this complexity, RPCs are heterogeneous (Trimarchi et al, 2008) and express many transcription factors and cell cycle regulators that play dual roles in controlling RPC cell cycle and fate (Dyer & Cepko, 2000; Dyer et al, 2003; Le et al, 2006). The intrinsic and extrinsic mechanisms that regulate RPCs proliferation and fate, as well as the exquisite retinal organization, are not completely understood. Nr2e1 is a highly conserved orphan nuclear receptor that regulates neural stem cell proliferation (Li et al, 2008). Nr2e1-null mice have smaller brain and retinas, are blind, and highly aggressive (Young et al, 2002). Nr2e1 is mostly a repressor that operates in a cell-autonomous fashion. However, recent evidence suggests that Nr2e1 also activates gene transcription (Elmi et al, 2010; Qu et al, 2010) and regulates the Wnt signaling pathway (Qu et al, 2010). Lack of Nr2e1 results in premature cell cycle exit during corticogenesis and reduced thickness of the last born layers of the cortex due to a depletion of the neural stem cell pool (Li et al, 2008). Nr2e1 also plays a role in the generation and maintenance of adult neural stem cells (Liu et al, 2008). Lack of Nr2e1 in the retina results in precocious neurogenesis, progressive dystrophy (Miyawaki et al, 2004; Zhang et al, 2006), and impaired blood vessel development (Uemura et al, 2006). However, the effect of Nr2e1 on different retinal populations, and its cell-autonomous and non-cell autonomous functions during eye development are unknown. To achieve insight into the roles of Nr2e1 in neural development, we studied the cellular composition and morphology of Nr2e1frc/frc and Nr2e1+/+?Nr2e1frc/frc chimeric mouse retinas. We found that Nr2e1 has many roles beyond preventing premature neurogenesis in the retina by regulating the differentiation of glycinergic amacrine cells, the maturation and cell numbers of M?ller glia, and the organization of neurites of the inner nuclear layer.   50  3.3 Materials and methods   3.3.1 Mouse strains husbandry and breeding Nr2e1frc/frc mice (Young et al, 2002) were generated by crossing heterozygote females on the C57BL/6J (B6) (JAX stock # 000664) background to heterozygote males on the 129S1/SvImJ (129) (JAX stock # 002448) background, thus generating control and mutant littermates on the hybrid B6129F1 background (Silva et al, 1997). B6.129P2(Cg)-Hprttm73(Ple142-lacZ)Ems (NR2E1-lacZ) (Schmouth et al, 2012a) (JAX stock # 012659) was used to study NR2E1 expression in the postnatal retina. Mice were kept in a pathogen-free animal facility at the Centre for Molecular Medicine and Therapeutics, University of British Columbia (Vancouver, BC, Canada) on an 6 am to 8 pm light cycle with, 20 ? 2?C, 50% ? 5% relative humidity, and food and water ad libitum. All procedures involving animals were in accordance with the Canadian Council on Animal Care (CCAC) and UBC Animal Care Committee (ACC) (Protocol numbers A11-0370 and A11-0081). 3.3.2 Generation of embryonic stem cells (ESCs) To obtain ESCs that contain both the EGFP transgene as a marker and the Nr2e1 frc allele, several crosses were performed.  First, B6-EGFP/+ mice were crossed to B6-Nr2e1+/frc mice to obtain B6-Nr2e1+/frc EGFP/+ females. These females were, in turn, crossed to 129-Nr2e1+/frc males (N>10) to obtain B6129F1-Nr2e1frc/frc EGFP/+ blastocysts for ESC generation. ESC lines were derived as previously described (Yang et al, 2009). Briefly, blastocysts at 3.5 days post fertilization (dpf) were cultured in KSOM+AA media under oil at 37?C for 3-5 h. One blast was then transferred to each single 96-well containing mitomycin-C-inactivated mouse embryonic fibroblasts (MEFs) and cultured in KSR-ESC media. Once a large enough clump of cells was visible with a well-defined inner cell mass, it was trypsinized and transferred to 1 x 24-well. Cells were replated 1:1 if necessary. 51  When cells reached confluence, they were split into 3 x 24-wells in 100% ESC media. All 3 wells were combined at confluence and frozen in 3 separate vials until needed.  3.3.3 Generation of chimeras  Chimeras were derived by microinjection of ESC into host blastocysts as previously described (Yang et al, 2009). Either B6129-Nr2e1+/+ EGFP/+ or B6129-Nr2e1frc/frc EGFP/+ ESCs were microinjected into B6-lacZ/+ host blastocysts. The generated chimeras were thus comprised of blastocyst-derived cells that were wild-type for Nr2e1 and harbored the lacZ transgene and ESC-derived cells that were either wild-type or mutant for Nr2e1, and harbored the EGFP transgene. The genotype of the chimeras is here defined by the genotype of blastocyst-derived cells and ESC-derived cells ( lastocyst?ESC): (Nr2e1+/+, lacZ/+) ?  (Nr2e1+/+, EGFP/+) and  (Nr2e1+/+, lacZ/+) ? (Nr2e1frc/frc, EGFP/+); and a  reviated as Wt?+/+ and Wt?frc/frc, respectively.  Two Nr2e1+/+ (mEMS4919 and mEMS4926) and two Nr2e1frc/frc (mEMS4914 and mEMS4922) ESC lines were used to generate chimeras. After injection, blastocysts were implanted into the uterine horns of B6 2.5 days pseudopregnant females. Four Wt?+/+ and four Wt?frc/frc P7 chimeric eyes were included in the study. Nine Wt?+/+ and ten Wt?frc/frc P21 chimeric eyes were also included. 3.3.4 Assessment of chimerism Chimerism was initially assessed by coat color. In the retina, chimerism was evaluated by EGFP expression in the outer nuclear layer (ONL) and inner nuclear layer (INL) by assessing the percentage of green fluorescence signal in an area containing the ONL and INL using the software ImageJ (Schneider et al, 2012).  52  3.3.5 Histology  Eyes were fixed by intracardial perfusions performed on avertin-anesthetized mice with 4% paraformaldehyde (PFA) in Phosphate buffered saline (PBS).  Eyes were then post-fixed in 4% PFA for 30 min prior to cryoprotection in 25% sucrose-PBS overnight. Subsequently, eyes were embedded in Optimal Cutting Temperature (OCT) medium, cryosectioned at 12 ?m and mounted on SuperFrost Plus slides (Thermo Fisher Scientific, Waltham, MA, USA). For lacZ immunohistochemistry, staining was performed using the X-gal substrate for 18 h at 37?C. To evaluate retinal thickness, retinal sections were subjected to hematoxylin and eosin staining. Briefly, tissue was incubated in hematoxylin for 5 min, washed in tap water and incubated in 1% lithium carbonate solution for 30 sec. After washing in tap water again, the tissue was incubated in acid alcohol (1%) for 5 s followed by another tap water wash and incubation in eosin Y solution for 5 min. After a final tap water wash, tissue was dehydrated in a gradient of ethanol, and xylene before mounting for microscopy. For immunofluorescence, retinal sections were incubated in blocking solution (5% bovine serum albumin (BSA), 0.3% Triton X-100 in PBS) for one hour. Subsequently, sections were incubated in primary antibody/blocking solution at 4?C overnight. After three washes of 10 min in PBS, sections were incubated in secondary antibody/blocking solution with the DNA dye Hoechst-33342 for one hour. Sections were washed 3 times in PBS and mounted in ProLong? Gold Antifade Reagent (Life Technologies Inc., Carlsbad, CA, USA). 3.3.6 Antibodies The following primary antibodies were used: mouse anti-Brn3a 14A6 from Santa Cruz Biotechnology, Inc (Dallas, TX, USA); mouse anti-Pax6, anti-ISL1/2, anti-N-Cadherin (MNCD2-c) and anti-PY489 ?-catenin from Developmental Studies Hybridoma Bank (Iowa, IA, USA); rabbit anti-Pax6 from Coavance (Princeton, NJ, USA); mouse anti-calbindin and anti-syntaxin from Sigma-Aldrich (St. 53  Louis, MO, USA); mouse anti-Rhodhamine (ID4) from Dr. R.S. Molday, University of British Columbia (Vancouver, BC, Canada); sheep anti-Chx10 from Exalpha Biologicals, Inc. (Shirley, MA, USA); rabbit anti-cone-arrestin, anti-Sox9, anti-S-opsin and anti-mGluR1, goat anti-calretinin, chicken anti-vimentin and guinea pig anti-GABA from Millipore (Billerica, MA, USA); mouse anti-PKCalpha, chicken anti-?-galactosidase and rabbit anti-Sox2 and anti-GlyT1 from Abcam (Cambridge, England); and mouse anti-GFAP from New England Biolabs (Ipswich, MA, USA). 3.3.7 Imaging and cell counting  For dual visualization of X-gal blue precipitate and EGFP fluorescence in chimeras, images were taken with the Olympus BX61 motorized microscope using both DP Controller and In Vivo software (Olympus Corporation of the Americas, Center Valley, PA, USA). All remaining fluorescent images were taken with a Leica TCS SP5 II confocal microscope (Leica Microsystems, Wetzlar, Germany). To assess the numbers of each cell type in the retina, 20X pictures were taken throughout a 12 ?M retinal section and tiled. At least five sections containing the entire retina were imaged. One eye from three different mice of each genotype was included. Labeled cells were manually counted using the Cell Counter tool of ImageJ (Schneider et al, 2012). To count cells in chimeric retinas, EGFP+/marker+ double-labeled or marker+ singled-labeled cells were counted throughout a central retinal section. The EGFP+ area was assessed by measuring the fluorescence intensity of the EGFP signal in the INL + ONL using ImageJ. The EGFP- area was assessed by subtracting the EGFP+ area from the total INL + ONL area. Cells density was expressed by the number of double-labeled cells over the EGFP+ area or single-labeled cells over the EGFP- area. One eye from three different chimeras representing each ESC genotype was included.   54  3.3.8 Funduscopy To assess the number of retinal blood vessels, funduscopy was performed as previously described (Abrahams et al, 2005; Schmouth et al, 2012a). Eyes were dilated with 1% atropine/PBS and photographed after 30 minutes. Animals were manually restrained without sedation. 3.3.9 Image Processing Images were processed using ImageJ and Adobe Photoshop. Brightness, contrast and scaling adjustments were performed as necessary.  3.3.10 Statistical Analyses Statistical analyses were performed using Microsoft Excel and XLSTAT. One-way ANOVA was used to compare cell numbers. Results were considered significance with a P-value ? 0.05.  The standard error of the mean (SEM) was indicated with error bars. Z-score was calculated as (retinal thickness or blood vessel number of Wt?frc chimeras) ? (mean of Wt?Wt chimeras)/standard deviation of Wt?Wt chimeras. 3.4 Results 3.4.1 Expression of EGFP and ?-galactosidase in mouse chimeras   To better understand the cell-autonomous and non-cell autonomous roles of Nr2e1 during retinogenesis, we made chimeric mice comprised of Nr2e1+/+ and Nr2e1frc/frc cells, herein referred as wt?frc chimeras. Chimeric mice were made by blastocyst injection of Nr2e1+/+ or Nr2e1frc/frc embryonic stem cells (ESCs) harboring an ubiquitous-expressing EGFP transgene (Fig.3.1A). Host  lastocyst contained, in turn, the ?-galactosidase enzyme expressed from the ROSA26 locus (Fig. 3.1B). In this way ESC-derived cells could be identified by the green fluorescence of EGFP and blastocyst-derived cells by the enzymatic product of ?-galactosidase. 55  We used two different cell lines per genotype to control for possible spontaneous mutations that could affect the phenotype of the mice. Four Wt?Wt and four Wt?frc chimeras were studied at P7. Nine Wt?Wt and ten Wt?frc chimeras were studied at P21. Eyes from these chimeras were collected and subjected to cryosectioning and funduscopy. First, we determined that the EGFP and ?-gal markers were expressed correctly in the chimeras. We used different antibodies against beta-galactosidase but could not detect it by immunofluorescence, thus we assessed the expression of beta-galactosidase by its enzymatic activity. We could clearly observe the blue precipitate formed by the hydrolysis of X-gal in perinuclear regions (Fig 3.1C). Importantly, this enzymatic reaction did not interfere with the EGFP fluorescence (Fig. 3.1C). Both markers were expressed in mutually exclusive regions of the chimeric retina (Fig. 3.1D) . In P21 retinas, faint EGFP signal was observed in the GCL and faint X-gal signal in the ONL. Therefore, we used P7 retinas for the majority of the experiments. We assessed the percentage of chimerism by measuring the area showing EGFP fluorescence 56   Figure 3.1. Labeling of blastocyst-derived and ESC-derived cells is mutually exclusive in chimeras.  (A) To generate embryonic stem cell (ESC) lines carrying the wild-type and mutant Nr2e1 alleles and the EGFP transgene, crosses between Nr2e1frc/+ mice to B6-Tg(CAG-EGFP)1Osb/J/+ (B6-EGFP/+) 57  mice, which contain multiple copies of EGFP, were carried out. (B) ESCs were injected into B6-Gt(ROSA)26Sor/J/+ (B6-R26lacZ/+) E3.5 blastocyst containing the ubiquitously expressed lacZ gene, which encodes the en yme ?-galactosidase (?-gal). The resulting chimeras [Wt?Wt and Wt?frc] contained wild-type (Wt) blastocyst-derived cells e  ressing ?-gal and ESC-derived cells expressing EGFP. The latter cells, were either wild-type or mutant (frc) for Nr2e1. (C) Retinal sections from B6-R26lacZ/+ and B6-EGFP/0 control mice at P7 and P21 were incubated with X-gal. The distribution of EGFP fluorescence signal (green) and blue X-gal product is shown. The EGFP signal was not affected by the X-gal reaction. (D) Wt?Wt and Wt?frc chimeric retinal sections from P7 and P21 mice were treated as in C. Note that the labeling of blastocyst-derived (?-gal+, blue) and ESC-derived (EGFP+, green) cells was mutually exclusive.  in the ONL and INL of each retina and comparing it to the total area. We excluded the IPL and GCL to decrease the interfering signal recovered from neural process. Thus, we were able to use these two markers reliably as indicators of the origin, host or ESC, of the differentiated cell types. 3.4.2 Nr2e1frc/frc reduced retinal thickness and blood vessel numbers are rescued by wild-type cells in Wt?frc chimeras Next, we assessed whether the reduced retinal thickness and blood vessel numbers of Nr2e1frc/frc retinas could be rescued by wild-type cells and how many wild-type cells would be needed to achieve rescue. We cryosectioned the eyes and measured the retinal thickness in a central section containing the optic nerve and two other adjacent sections 60 ?m away in both directions. We found that while the percentage of chimerism did not affect the retinal thickness of Wt?Wt chimeras, the thickness of Wt?frc chimera retinas decreased with the increase in number of Nr2e1frc/frc cells (Fig. 3.2A). We also found that only the two highest percentage chimeras (67% and 86%) had retinal thickness with a Z-score lower than -3 (127.5 ? 7.5 and 108.33 ? 4.81 ?m, respectively), suggesting that these retinas were not rescued by wild-type cells. However, a 66% chimera had a thickness value with Z-score >-3 (146.33 ? 5.78 ?m) suggesting that at least 34% of wild-type cells are needed to start seeing rescue of retinal thickness (Fig. 3.2A). 58  We also took fundus images of the chimeric eyes and manually counted the numbers of blood vessels in each chimera. Contrary to what we observed for the retinal thickness, we found no correlation  etween the num ers of  lood vessels and the  ercentage of chimerism in wt?frc eyes (Fig. 3.2B). Interestingly, only two chimeric eyes with lower percentage of chimerism (39% and 45%) had blood vessel numbers with a Z-score higher than -3 (10 and 9 blood vessels, respectively), suggesting that a contribution of more than 55% wild-type cells is necessary to make normal blood vessel numbers (Fig. 3.2B). Detailed information for each chimera is given in Table 3.1.   Figure 3.2. The reduced retinal thickness and blood vessel numbers characteristic of Nr2e1frc/frc retinas are rescued by wild-type cells in Wt?frc chimeras. (A) The retinal thickness in each chimera was measured in 3 sections; a central section containing the optic nerve and two sections 60 ?m away in both directions. Scatter plot shows normal retinal thickness in chimeras containing up to 66% of Nr2e1frc/frc cells. n = 8 for Wt?Wt, n = 9 for Wt?frc. (B) The blood vessel number of each chimera was assessed by funduscopy. Scatter plot shows normal blood vessel numbers in chimeras containing up to 45% of Nr2e1frc/frc cells. n = 9 for Wt?Wt and Wt?frc; *, Z-score ?-3; error bars represent the standard error of the mean.    59  Table 3.1. Characteristics of the chimeras generated. ID Age Chimerism % ESC line Genotype Blood vessel # Retinal thickness (?M) 7586 P7 48 mEMS4922 Nr2e1frc/frc na 213.63  ? 9.36 7585 P7 58 mEMS4922 Nr2e1frc/frc na 234.90  ? 13.84 7577 P7 62 mEMS4914 Nr2e1frc/frc na 205.67  ? 10.09 7584 P7 70 mEMS4922 Nr2e1frc/frc na 376.15  ? 38.77 7582 P28 39 mEMS4914 Nr2e1frc/frc 10 183.67  ? 2.33 7588 P28 42 mEMS4914 Nr2e1frc/frc 4 197.67  ? 5.61 7599 P28 45 mEMS4922 Nr2e1frc/frc 9 146.33  ? 5.78 7597 P28 54 mEMS4922 Nr2e1frc/frc ni 160.00  ? 0.00 7587 P28 61 mEMS4914 Nr2e1frc/frc 7 170.00  ? 7.64 7583 P28 64 mEMS4914 Nr2e1frc/frc 1 160.00  ? 5.77 7600 P28 66 mEMS4922 Nr2e1frc/frc 5 149.33  ? 4.70 7604 P28 67 mEMS4922 Nr2e1frc/frc 5 127.50  ? 7.50 7589 P28 77 mEMS4914 Nr2e1frc/frc 1 Irregular morphology 7598 P28 86 mEMS4922 Nr2e1frc/frc 7 108.33  ? 4.81 7578 P7 29 mEMS4919 Nr2e1+/+ na 204.43 ? 18.80 7580 P7 46 mEMS4919 Nr2e1+/+ na 259.95  ? 42.37 7579 P7 51 mEMS4919 Nr2e1+/+ na 196.42 ? 4.99 7581 P7 71 mEMS4919 Nr2e1+/+ na 180.5  ? 8.59 7612 P28 0.3 mEMS4926 Nr2e1+/+ 11 185.00  ? 4.93 7611 P28 10 mEMS4926 Nr2e1+/+ 11 190.33  ? 14.90 7610 P28 11 mEMS4926 Nr2e1+/+ 11 159.33  ? 6.33 7593 P28 18 mEMS4919 Nr2e1+/+ 11 178.00  ?  8.00 7592 P28 45 mEMS4919 Nr2e1+/+ 10 193.67  ? 5.84 7595 P28 50 mEMS4919 Nr2e1+/+ 13 172.67  ? 11.85 7591 P28 54 mEMS4919 Nr2e1+/+ 11 Irregular morphology 7594 P28 58 mEMS4919 Nr2e1+/+ 10 190  ? 0.00 7590 P28 92 mEMS4919 Nr2e1+/+ 9 204.33 ? 7.17 na = not applicable; ni = not identified    60  3.4.3 Nr2e1frc/frc   ller  l a m se  ress on o     P and retinal structural defects are corrected in Wt?frc chimeras   As previously reported by Miyawaki and collaborators (Miyawaki et al, 2004), we found that central   ller glia of Nr2e1frc/frc retinas express GFAP (Fig. 3.3A), a neurofilament that is only normally expressed in astrocytes and reactive  ller glia (Ekstrom et al, 1988). We also observed that, in addition to its thinner size, Nr2e1frc/frc retinas present structural defects that are difficult to explain solely on the basis of cell loss (Fig. 3.3B). We found that chimeric retinas with a very high contribution of Nr2e1frc/frc cells do not express GFAP in the central  ller glia suggesting that wild-type cells rescue this defect (Fig. 3.3C). We also observed that the retina of these chimeras was still very thin but did not have intrusion of INL cells into the ONL or migration of ONL cells into the subretinal space as seen in Nr2e1frc/frc retinas (Fig. 3.3C). This indicates that these defects emerge non-cell autonomously in Nr2e1frc/frc retinas.     61  Figure 3.3.  Nr2e1frc/frc   ller  l a m se  ress on o     P and retinal structural defects are corrected in Wt?frc chimeras. Confocal images of transverse retinal sections from P21 mice stained against    P. ( )    P is o served in the  C  of wild-ty e retinas and also in the  rocesses of  ller glia in Nr2e1frc/frc retinas (arrow). (B) Nr2e1frc/frc retinas present INL intrusions into the ONL (asterisk). (C) An 86% Wt?frc chimera showing absence of GFAP expression in  ller cells and a sence of INL intrusions into the ONL. INL = inner nuclear layer; ONL = outer nuclear layer; GCL = ganglion cell layer.  3.4.4 Nr2e1frc/frc retinas have altered cell-type proportions, with only the ganglion cell layer defects being rescued by wild-type cells in Wt?frc chimeric retinas  Although the role of Nr2e1 in regulating retinal thickness has been assessed, the numbers of different retinal classes in Nr2e1-null retinas has not yet been studied. Similarly, the presence of each retinal cell-type has previously only been assessed in adult eyes after apoptosis had already severely altered the structure and composition of the retina (Miyawaki et al, 2004; Zhang et al, 2006). To gain better insight into the cell numbers generated in Nr2e1frc/frc mice retinas, we studied the retina at P7 when most cell types have already been born but have not been exposed to daily visual activity and are less prone to apoptosis (Zhang et al, 2006). To label ganglion cells, we stained the retinas for Brn3a which is expressed in approximately 80% of ganglion cells (Badea et al, 2009). For amacrines we used antibodies for the pan-amacrine marker syntaxin, and Pax6, which labels amacrine cells and horizontal cells in the inner nuclear layer (INL) and amacrine and ganglion cells in the ganglion cell layer (GCL) (de Melo et al, 2003). To visualize horizontal cells we stained for calbindin which is expressed in horizontal cells and a subpopulation of amacrine cells (Li et al, 2004). For cones we used antibodies for cone-arrestin. For rods we used rhodhamine. For bipolar cells we used Chx10 (de Melo et al, 2003) and for  ller glia So 9 (Poche et al, 2008). To quantitatively assess the differences in cell numbers, we manually counted the numbers of all cell types in the retinas of wild-type and Nr2e1frc/frc mice at P7. Five sections through the eyes were analyzed.  62  To better understand the interplay between wild-type and Nr2e1frc/frc cells during the development of chimeric retinas, we looked at the density of different retinal cell types belonging to each genotype in the Wt?frc chimeras at P7. The number of each EGFP+ or EGFP- cell type was divided over the EGFP+ or EGFP- area, respectively. We first observed that the outer nuclear layer (ONL) of Nr2e1frc/frc retina, containing the photoreceptors, was severely reduced in size as previously reported (Miyawaki et al, 2004) (Fig 3.4A). Quantification of rod numbers in Nr2e1frc/frc retinas, revealed a reduction of 33% compared to wild type (Fig 3.4C). Similarly, bipolar cells were reduced in numbers in Nr2e1frc/frc retinas (Fig 3.4B) with a reduction of 27% when compared to wild type (Fig 3.4C).  In Wt?frc chimeras, we observed that the distribution of the EGFP cells differed from that of the wt?wt chimeras suggesting that the  ro ortion of cells generated  y Nr2e1frc/frc clones was not the same as the wild type. During retinogenesis RPCs give rise to clones of cells that migrate radially and a few cells that migrate laterally, thus giving rise to columns of cells spanning the entire retinal thickness (Reese et al, 1995). While EGFP+ cells in Wt?Wt chimeras typically form straight columns, EGFP+ cells in Wt?frc chimeras (Nr2e1frc/frc cells) usually distribute in asymmetrical columns with EGFP+ cells appearing underrepresented in the ONL (Fig. 3.4D).  In Wt?frc chimeras, the density of Nr2e1frc/frc rods (Fig. 3.4D and F) and bipolar cells (Fig 3.4E and G) was lower compared to the density of wild-type rods and bipolar cells. This suggests that wild-type cells did not rescue the numbers of Nr2e1frc/frc rods and bipolar cells generated in the chimeric retinas.  63   Figure 3.4. Nr2e1frc/frc P7 retinas have lower numbers of rods and bipolar cells and this phenotype is not rescued by wild-type cells in Wt?frc chimeras. Retinal sections from P7 Nr2e1frc/frc, Nr2e1+/+ and chimeric mice were subjected to immunofluorescence against (A) rhodopsin+  (rods) and (B) Chx10+ (bipolars). (C) Each retinal cell type was counted through five sections across the retina of P7 Nr2e1+/+ and Nr2e1frc/frc mice. Numbers were normalized to retinal length and expressed as percentages of Nr2e1+/+ cell numbers. Reduced numbers of both rods and bipolar cells were observed in mutant retinas compared to wild type. (D) In Wt?frc chimeras, EGFP positive cells were less abundant in the ONL labeled with rhodopsin compared to the rest of the retina. (E) Lower density of Nr2e1frc/frc bipolar cells was also 64  observed in Wt?frc chimeras compared to wild-type bipolar cells. The arrow shows a region comprised mostly of wild-type cells with a higher density of CHX10 positive cells. The density of rod and bipolar cells that were either Nr2e1 mutant or wild type in chimeras was assessed by counting double-labeled cells (marker positive/EGFP positive) or single-labeled cells (marker positive/EGFP negative) and dividing them by the EGFP positive or EGFP negative retinal area (ONL + INL), respectively. The density of Nr2e1frc/frc rods (F) and bipolar (G) cells was lower compared to the one of wild-type rods and bipolar cells in Wt?frc chimeras. n = 3. * P ? 0.05; ns = not significant; error bars represent the standard error of the mean. INL = inner nuclear layer; ONL = outer nuclear layer; GCL = ganglion cell layer; size bar = 50 ?m.   We observed less cell bodies labeled with Brn3a in the GCL of Nr2e1frc/frc retinas (Fig. 3.5A). Unexpectedly, we found ectopic expression of Brn3a in the INL of Nr2e1frc/frc retinas, which was only evident in ventral regions (Fig. 3.5A). Quantification of cell numbers revealed that Nr2e1frc/frc retinas have less than 38% of ganglion cells compared to wild type (Fig 3.5B). Contrary to Nr2e1frc/frc retinas, we found many Nr2e1frc/frc Brn3a+ cells in wt?frc chimeras in proportions similar to wild type (Fig. 3.5C and D). Interestingly, many wild-type and Nr2e1frc/frc Brn3a+ cells were mislocalized to the INL, suggesting a non-cell-autonomous migration defect of ganglion cells in the chimeras (Fig. 3.5C, asterisk).    65   Figure 3.5. Nr2e1frc/frc P7 retinas have lower numbers of ganglion cells and this phenotype is rescued by wild-type cells in Wt?frc chimeras. Retinal sections from P7 Nr2e1frc/frc, Nr2e1+/+ and chimeric mice were subjected to immunofluorescence against Brn3a. (A) Nr2e1frc/frc retinas had less Brn3a positive cells in the GCL and misexpressed Brn3a in the ventral INL. (B) Ganglion cells were counted through five sections across the retina of P7 Nr2e1+/+ and Nr2e1frc/frc mice using the marker Brn3a. Numbers were normalized to retinal length and expressed as percentages of Nr2e1+/+ cell numbers. Nr2e1frc/frc retinas had lower numbers of ganglion cells (37% of wild-type). (C) In Wt?frc chimeras many Nr2e1frc/frc ganglion cells (GFP positive/Brn3a positive) were observed (arrow). Note the aberrant position of Brn3a positive cells in Wt?frc retinas (open arrows), some of them wild-type (EGFP negative) (asterisk). (D) The density of ganglion cells that were either Nr2e1 mutant or wild type in chimeras was assessed by  counting double-labeled Brn3a positive/EGFP positive cells or single-labeled Brn3a/EGFP negative positive cells and dividing them by the EGFP positive or EGFP negative retinal area (ONL + INL), respectively. The density of Nr2e1frc/frc Brn3a positive ganglion cells was similar to the wild-type in Wt?frc retinas. n = 3. * P ? 0.05; ns = not significant; error  ars 66  represent the standard error of the mean. INL = inner nuclear layer; ONL = outer nuclear layer; GCL = ganglion cell layer; size bar = 50 ?m.  In contrast to the reduction in rods, bipolar and ganglion cells, Pax6+/syntaxin+ amacrine cells were highly increased in numbers in the INL of Nr2e1frc/frc retinas, representing the majority of cells in this layer (Fig. 3.6A and B). To better characterize these amacrine cells, we stained the retina for markers known to be expressed in the major amacrine subpopulations. Interestingly, the excess Pax6+/syntaxin+ cells were negative for GABA, calbindin and ISL1/2 but positive for the glycine transporter 1 (GlyT1), a marker of glycinergic amacrines (Fig. 3.6A). This suggests that Nr2e1frc/frc retinas generate an excess of glycinergic amacrine cells.  In wt?frc chimeric retinas, Nr2e1frc/frc amacrine cells were more abundant than wild-type amacrine cells (Fig. 3.6D-F). In contrast, the numbers of amacrine cells in the GCL of wt?frc chimeric retinas (assessed as Pax6+ minus Brn3a+) were comparable to wild type (Fig 3.6G), suggesting that wild-type cells prevented amacrine migration to the GCL or the survival of excess amacrine cells in this layer. 67     68   Figure 3.6. Nr2e1frc/frc P7 retinas have increased numbers of amacrine cells and this phenotype is not rescued by wild-type cells in the inner nuclear layer of Wt?frc chimeras. Retinal sections from P7 Nr2e1frc/frc, Nr2e1+/+ and chimeric mice were subjected to immunofluorescence. Amacrine cells were stained with the pan-amacrine marker syntaxin-1A, Pax-6, and the subclass markers Islet-1/2, GABA, calretinin or glycine transporter 1 (GlyT1). (A) Pax-6 and syntaxin-1A staining showing the distribution of amacrine cells in Nr2e1 wild-type and mutant retinas. ISL1/2, GABA and calretinin, markers of GABAergic cells, were not increased in the Nr2e1frc/frc  retina. Note the increased numbers of GlyT1 positive cells in Nr2e1frc/frc  retinas.  (B) Magnification of a region of Nr2e1frc/frc retina (rectangle) showing co-localization of Pax6 and syntaxin-1A. (C) amacrine cells were counted in the INL through five sections across the retina of P7 Nr2e1+/+ and Nr2e1frc/frc mice using the marker Pax6. Numbers were normalized to retinal length and expressed as percentages of Nr2e1+/+ cell numbers. Amacrine cells were increased by 45% in Nr2e1frc/frc retinas compared to wild type. In Wt?frc chimeras, Nr2e1frc/frc syntaxin+ (D) and Pax6+ (E) cells appear more abundant compared to wild type. The arrow in C shows a region with low numbers of mutant cells and amacrine cells. The arrow in E shows a region with high numbers of mutant cells and amacrine cells. The density of amacrine cells that were either mutant or wild type in chimeras was assessed by counting double-labeled Pax6+/EGFP+ cells or single-labeled Pax6+  cells and dividing them by the EGFP positive or EGFP negative retinal area (ONL + INL), respectively. Amacrine numbers in the GCL were obtained by subtracting Brn3a+ cells from the total Pax6+ cells in this layer. The density of Nr2e1frc/frc Pax6+ amacrine cells was increased compared to wild type in the INL (F) and was similar to wild type in the GCL (G).  n = 3. * P ? 0.05; ns = not significant; error bars represent the standard error of the mean. INL = inner nuclear layer; GCL = ganglion cell layer. Size bar = 50 ?m in all images except for B were it represents 12.5 ?m.  In P7 Nr2e1frc/frc retinas, the numbers of horizontal, cones and  ller glial cells were similar to wild-type retinas (Fig. 3.7A-D). Interestingly, these numbers also appeared normal at P21 (Fig. 3.7E) suggesting that horizontal, cones and  ller glial cells were s ared from the e cessive a optosis that occurs during the postnatal period in Nr2e1frc/frc retinas (Zhang et al, 2006).  69   Figure 3.7.  or  ontal,  ones an   ller  l al n m ers are normal  n P  an  P 1 Nr2e1frc/frc  retinas. Transverse retinal sections from P7 and P21 Nr2e1frc/frc and Nr2e1+/+ mice were su  ected to immunofluorescence against retinal neural mar ers. Hori ontal cells were identified with cal indin 70  in cells ad acent to the O  , cones with arrestin, and  ller glia with So 9. Images from P7 retinal sections showing the distribution of calbindin(A), arrestin-C (B) and SOX-9 (C) in Nr2e1 mutant and wild-type retinas. Each retinal cell type was counted through five sections across the retina of P7 (D) and p21 (E) Nr2e1+/+ and Nr2e1frc/frc mice using the markers mentioned above. Numbers were normalized to retinal length and expressed as percentages of Nr2e1+/+ cell num ers.  ote no difference in the num ers of hori ontal, cones and  ller glia at  oth P7 and P21  etween mutant and wild-type retinas. n = 3. * P ? 0.05; ns = not significant; error bars represent the standard error of the mean. INL = inner nuclear layer; ONL = outer nuclear layer; GCL = ganglion cell layer; size bar = 50 ?m. .  As shown above, we did not observed a difference in the numbers of cones generated in Nr2e1frc/frc retinas (Fig. 3.7). However, in Wt?frc chimeras the density of Nr2e1frc/frc S-cones cells labeled with S-opsin was higher than that of wild-type S-cones (Fig. 3.8A and B). We quantified the numbers of S-cones in Nr2e1frc/frc and Nr2e1+/+ retinas and observed no differences at P7 (Fig. 3.8C) suggesting that Nr2e1frc/frc S-cones in Wt?frc retinas are influenced by extrinsic signals from wild-type cells.  Figure 3.8. S-cones are overre resente   n wt? r  chimeras. Retinal sections from P7 Nr2e1frc/frc, Nr2e1+/+ and chimeras were subjected to immunofluorescence against S opsin. (A) The density of Nr2e1frc/frc S opsin positive cells appeared higher in mutant regions compared to wild-type regions. The arrow shows a region with mutant cells and a high 71  density of S-cones. (B) The density of S-cone cells that were either Nr2e1 mutant or wild type in chimeras was assessed by counting double-labeled S opsin positive/EGFP positive  cells or single-labeled S opsin positive/EGFP negative cells and dividing them by the EGFP positive or EGFP negative retinal area (ONL + INL), respectively.  Nr2e1frc/frc cells were overrepresented in Wt?frc chimeras. (C) S opsin positive cells were counted through five sections across the retina of P7 Nr2e1+/+ and Nr2e1frc/frc mice. Numbers were normalized to retinal length and expressed as percentages of Nr2e1+/+ cell numbers. There was no significant difference between the numbers of S opsin positive of wild-type and mutant retinas. n = 3. * P ? 0.05; ns = not significant; error  ars represent the standard error of the mean. INL = inner nuclear layer; ONL = outer nuclear layer; GCL = ganglion cell layer; size bar = 50 ?m.   In summary, P7 Nr2e1frc/frc retinas have a marked reduction of ganglion, bipolar and rod cells, increased numbers of glycinergic amacrine cells, and normal numbers of cones, horizontal and   ller glial cells.  In Wt?frc P7 chimeric retinas, Nr2e1 mutant cell numbers were rescued only in the ganglion cell layer. Wild-type cells were unable to rescue the numbers of bipolar, rods and INL amacrine cells generated from Nr2e1frc/frc progenitors. Interestingly, we observed an unexpected effect of wild-type cells on Nr2e1frc/frc S-cone numbers suggesting a role of Nr2e1 in controlling their development or survival non-cell-autonomously. 3.4.5 Nr2e1frc/frc retinas display an ectopic plexiform layer and a disorganized inner plexiform layer, which are not rescued by wild-type cells in Wt?frc retinas We observed that Nr2e1frc/frc retinas display an ectopic plexiform layer (EPL) in the inner nuclear layer (INL) evident at P7 (Fig. 3.9A). To better characterize this layer, we stained the retinas with antibodies that normally recognize the inner plexiform layer (IPL) and found that calbindin, calretinin and mGluR1 can be occasionally but not always found in this ectopic layer (Fig. 3.9B, C, D). In contrast, syntaxin and GlyT1 were always present throughout this layer (Fig.3.6A). Ectopic somas of calbindin and mGluR1 positive cells were also observed occasionally in proximity to this EPL (Fig. 72  3.9B and D, asterisks). To evaluate whether bipolar cells that normally establish synaptic connections with retinal ganglion cells (RGCs) and amacrine cells in the inner plexiform layer (IPL) (Dubin, 1970) also had terminals in the EPL, we stained retinas with PKCalpha expressed in ON   73  Figure 3.9. Nr2e1frc/frc P7 retina displays an ectopic plexiform layer that is not rescued by wild-type cells in a Wt?frc chimera. Transverse retinal sections from P7 Nr2e1+/+, Nr2e1frc/frc, Wt?Wt and Wt?frc chimeric retinas were subjected to immunofluorescence against proteins expressed in the IPL. (A) Hoechst-stained nuclei showing the presence of a region devoid of cell bodies where an ectopic plexiform layer (EPL) in Nr2e1frc/frc retinas forms (arrow). (B) Calbindin stains the IPL in Nr2e1+/+ and Nr2e1frc/frc retinas and the EPL in Nr2e1frc/frc retinas (arrow) with occasional calbindin+ cell bodies extending processes in it (arrow). (C) Calretinin also labels this ectopic layer (arrow). Note loss of organization of calretinin sublaminae in Nr2e1frc/frc retinas. (D) mGluR1 labels the ectopic INL in Nr2e1frc/frc retinas (arrow) and occasional cell bodies that co-label with Pax6 and extend processes in this layer (asterisks). Note cells bodies located between IPL sublamina (arrow head). (E) PKCalpha+ bipolar cells also extend processes and branch in this ectopic layer (arrow). (F) calretinin is also present in the ectopic layer of Wt?frc chimeras (arrow). Note the increased thickness and disorganization of the Wt?frc IPL. (G) Syntaxin is also present in the ectopic layer of Wt?frc chimeras but is absent in regions of wild-type cells (arrow). INL = inner nuclear layer; ONL = outer nuclear layer; GCL = ganglion cell layer .Size bar in A = 50 ?m; size bar in zoomed area = 22 ?m.  bipolars. We found that PKCalpha had mislocalized axon branchings in the EPL (Fig. 3.9E, arrow). We then asked if this EPL could be rescued by extracellular signals from the wild-type cells in the Wt?frc chimeras. We found that the EPL was present in all four P7 chimeras and that regions of wild-type cells failed to form this layer (Fig. 3.9F and G). These results suggest a role of Nr2e1 in a pathway that constrains the neurites of many inner retinal neurons to the IPL. We also observed that the IPL of Nr2e1frc/frc retinas is itself very disorganized with less defined calbindin and calretinin sublaminae (Fig. 3.9B and C) and the presence of Pax6+ cell bodies between mGluR1 sublaminae (Fig. 3.9D, arrowhead). In addition, the IPL of Wt?frc chimeras was thicker and less defined than that of Wt?Wt chimeras (Fig. 3.9F and G) showing that not only do wild-type cells fail to rescue the Nr2e1frc/frc IPL organization, but also disorganize their own dendritic arbors in the presence of Nr2e1frc/frc cells.  Various attractive and repulsive cues guide neurites to the correct partners and sublaminae in the retina (Deans et al, 2011; Masai et al, 2003; Matsuoka et al, 2011; Yamagata & Sanes, 2012). Lack of 74  the cell adhesion molecule, N-cadherin, or its protein binding partner, ?-catenin, results in severe disorganization of the IPL (Fu et al, 2006; Masai et al, 2003). We observed increased levels of the  hos horylated form (tyrosine 489) of ?-catenin in Nr2e1frc/frc retinas (Fig. 3.10). Phosphorylation of ?-catenin at this site disrupts its association with N-cadherin and leads to N-cadherin loss of function (Rhee et al, 2007). This defect suggest that dysregulation of ?-catenin could be partially responsible for the lamination defects of Nr2e1frc/frc retinas.  Figure 3.10. Nr2e1frc/frc P7 retina displays increased levels of a t vate  ?-catenin. Transverse retinal sections from P7 Nr2e1+/+ and Nr2e1frc/frc retinas were subjected to immunofluorescence against PY489 ?-catenin. Increased PY489 ?-catenin staining was observed in Nr2e1frc/frc retinas compared to wild type. n = 3. INL = inner nuclear layer; ONL = outer nuclear layer; GCL = ganglion cell layer.  3.4.6 Nr2e1frc/frc   ller  l a  ells are a errantly  os t oned in the inner nuclear layer and cell-autonomously misexpress Brn3a  r2e1 is e  ressed in the  ller glia of adult mice (Schmouth et al, 2012a). To  etter characteri e the e  ression of  r2e1 in  ller glia during  ostnatal develo ment, we stained P3, P7, P14 and P21 retinas with anti odies against ?-gal and Sox2 in mice expressing beta-galactosidase under the control of the human NR2E1 promoter (NR2E1-lacZ) (Schmouth et al, 2012a). We made use of this 75  mouse strain due to the lack of a reliable commercial antibody for Nr2e1. At P3, Sox2 antibodies label  rogenitors and  ller glia and, at P7,  ller glia and a subpopulation of amacrine cells (Lin et al, 2009). We observed co-localization of So 2 and ?-gal at all time-points (Fig. 3.11A) and the presence of Sox2+ cells in Nr2e1frc/frc retinas (Fig. 3.11B).   Figure 3.11. Nr2e1  s e  resse   n  ller  l a t ro   o t  ostnatal  evelo ment. Confocal images of transverse retinal sections from P3, P7, P14 and P21 retinas. (A) NR2E1-lacZ retinas showing co-localization of the retinal  recursor and  ller glia mar er So 2 with  eta-galactosidase. (B) Staining of So 2 shows the  resence of  ller glia in Nr2e1frc/frc retinas. n = 3. INL = inner nuclear layer; ONL = outer nuclear layer; GCL = ganglion cell layer.  76  Several defects in the  ller glia of Nr2e1frc/frc retinas were noticed.  or e am le, while wild-ty e   ller glia cells are  ositioned in the middle of the I    elow  i olar cells, Nr2e1frc/frc M?ller glial somas are located adjacent to the ONL intermingled with bipolar cells (Figs. 3.11 and 3.12A and B).  In addition, Nr2e1frc/frc  ller glia mise  ress the transcription factor Brn3a, which is only expressed in sensory neurons including ganglion cells (Fig. 3.12C and D). Interestingly, misexpression of this marker was only present in the ventral retina (Fig. 3.5A) and mislocalized to the cell soma (Fig. 3.12D,F and H). To further confirm that the mise  ression of Brn3a occurs in  ller glia we also stained retinas for the  ller glia mar er vimentin and observed its co-localization with Brn3a at both P7 and P21 (Fig. 3.12E-H). To ascertain whether these defects could be rescued by wild-type cells, we stained chimeras for Sox2 and Brn3a. We found that, in wt?frc chimeras, the soma of Nr2e1frc/frc  ller glia was still mislocali ed whereas wild-type  ller glia localized correctly within the INL (Fig. 3.12I-K). Similarly, the misexpression of Brn3a in  ller glia was only evident in Nr2e1frc/frc cells (Fig. 3.12L). These results suggest that  r2e1 cell-autonomously regulates the maturation of  ller glia.        77   Figure 3.12. Nr2e1frc/frc    ller  l a  ells are a errantly  os t one   n t e     an   ell-autonomously misexpress Brn3a. Confocal images of transverse retinal sections from P7 retinas. (A) Staining for Sox2 shows the Confocal images of transverse retinal sections from Nr2e1 mutant and wild-type P7 retinas. (A) Staining for SOX-2 shows the locali ation of  ller glia somas between cholinergic amacrines in the lower INL and ON bipolars in the upper INL, both labeled with Islet-1/2. Nr2e1+/+ SOX-2 positive somas are organized within a limited area comprising 1-2 cell bodies (bracket). (B) Nr2e1frc/frc retinas show disorganized SOX-2 positive somas occupying a bigger area in the retina than its wild-type counterparts (bracket). SOX-2 positive somas also were intermingling with ON bipolars with cells localizing adjacent to the OPL (arrows). (C) Ganglion cells (Brn3a positive) are present in the GCL of wild-type retinas and represent a different population from SOX-2 positive cells. (D) In Nr2e1frc/frc retinas, Brn3a is expressed in SOX-2 positive cells in the INL, which represent M?ller glia. (E) Brn3a does not co-localize with vimentin in P7 (E) or P21 (G) Nr2e1+/+ retinas. Nr2e1frc/frc  ller glia of P7 (F) and P21 (H) retinas show expression of 78  Brn3a in vimentin positive cells representing  ller glia. A process showing co-localization is shown with the arrow and magnified in inset boxes.  Wt?frc chimeras show that the mis ositioning of  ller glia soma (I) and the misexpression of Brn3a (L) is seen only in mutant cells.  INL = inner nuclear layer; GCL = ganglion cell layer; size bar = 50 ?m..  3.5 Discussion In this study we have discovered cell-autonomous and non-cell autonomous roles of Nr2e1 during retinal morphogenesis. We have also uncovered novel roles of Nr2e1 during retinogenesis. Our results demonstrate that Nr2e1 regulates the numbers and maturation of specific retinal cell-types and also influences retinal lamination.  3.5.1 Cell-autonomous and non-cell autonomous roles of Nr2e1 in regulating retinal morphology The Nr2e1frc/frc eye phenotype is very complex involving various cell types, thus making it difficult to identify the primary function of Nr2e1 during eye development. In this study, we used chimeras comprised of both Nr2e1 mutant and wild-type cells to better understand the non-cell-autonomous and cell-autonomous roles of Nr2e1. We first studied abnormal phenotypes previously reported to be present in Nr2e1frc/frc retinas such as reduced retinal thickness, disrupted layering, gliosis and reduced blood vessel numbers.  We observed that the reduced Nr2e1frc/frc retinal thickness could be rescued by a small number of wild-type cells (>34%) while the reduced blood vessel numbers were rescued by more than 55% wild-type cells. We also observed a correlation between chimerism and retinal thickness suggesting that the more wild-type cells in the chimeric retina, the better the improvement in retinal thickness. However, blood vessel number was not correlated with chimerism, which may be explained by the inherent variability of blood vessel numbers in Nr2e1frc/frc mice. This also suggests that blood vessel numbers and retinal thickness are not dependent on each other. 79   The low number of wild-type cells able to rescue the retinal thickness may indicate non-cell-autonomous roles of Nr2e1 in cell differentiation and/or survival. Cell num ers in wt?frc chimeras were studied in detail and are discussed below. The high number of cells needed to rescue the blood vessel defect may indicate that this defect is not improved by rescuing the mutant cells and is likely cell-autonomous. Nr2e1 is expressed in proangiogenic murine astrocytes that make the extracellular matrix where endothelial cells grow (Uemura et al, 2006) and thus it may act cell-autonomously in these cells to regulate blood vessel development in the retina.  uring retinogenesis,  ller glia e tend  rocesses  asally and a ically su  orting the integrity of the retina (Dubois-Dauphin et al, 2000) and helping to establish a correct retinal lamination (Willbold et al, 2000). Since Nr2e1frc/frc   ller glia have thin  rocesses (Miyawaki et al, 2004) and aberrant soma positioning (this study), it is possible that some of the structural defects seen in Nr2e1frc/frc retinas are the consequence of defects in the integrity of  ller glia itself. In Nr2e1frc/frc retinas, some cells in the INL protrude into the ONL and IPL, and cells in the ONL migrate into the subretinal space (Zhang et al, 2006). The latter has also  een shown to occur with targeted  ller glia cell-death (Rich et al, 1995). In Wt?frc chimeras, these structural defects are no longer seen even with 86% of Nr2e1frc/frc cells, suggesting that these defects are not regulated cell-autonomously by Nr2e1 in  ller glia. Interestingly, the mise  ression of    P in  ller glia, typical of gliosis, shown  y others and in this study was a sent in the chimeric eyes, suggesting that the reactive  ller  henoty e is secondary to other defects in Nr2e1frc/frc retinas. 3.5.2 Roles of Nr2e1 in regulating retinal cell number and development In the retina, Nr2e1 is not thought to be required for cell-type specification but instead to regulate cell numbers through shortening cell cycle length and thus delaying neurogenesis (Zhang et al, 80  2006). Since premature neurogenesis leads to the overproduction of cell-types born early during the embryonic period and underrepresentation of late-born cell types (Ohnuma et al, 2002), we were e  ecting an increased num er of ganglion and amacrine cells and a greatly reduced num er of  i olar and  ller glial cells in Nr2e1frc/frc retinas. However, we found that at P7, the numbers of different cell-types in Nr2e1frc/frc retinas do not correspond to the proportions expected from premature cell-cycle exit. We observed that instead of increased numbers, Nr2e1frc/frc had very few ganglion cells. It is possible that this reduction is due to excessive cell-death as increased apoptosis in the GCL was reported in Nr2e1frc/frc mice as early as P0 (Miyawaki et al, 2004). However, we cannot rule out that some precursors committed to generate ganglion cells undergo lineage conversion to produce other cell types that are overrepresented in Nr2e1frc/frc retinas such as amacrine cells as seen in Math5-/- mice (Wang et al, 2001) or  ller glia. We observed that while the reduction in rods and bipolar cell numbers could be explained  y the  remature neurogenesis model, the unaffected  ller glia cell numbers could not.  ller glia is the last cell type to be generated in the mouse retina (Livesey & Cepko, 2001). Therefore, the fact that it is not decreased in numbers in Nr2e1frc/frc mice suggests a  ias towards  ller glia differentiation in the absence of Nr2e1 regulation. Interestingly, we found that Nr2e1frc/frc  ller glia ecto ically expresses Brn3a, a transcription factor expressed only in ganglion cell precursors and mature ganglion cells (Badea et al, 2012). Considering this, it is an attractive hypothesis that most of the vebtral  ller glia in Nr2e1frc/frc mice could have originated from precursors initially committed to the ganglion lineage. To support this idea, Nr2e1 represses glial differentiation and activates the neuronal lineage commitment in adult rat hippocampus-derived progenitors (AHPs) through direct 81  activation of Mash1 (Elmi et al, 2010). Nr2e1 also directly binds to the promoter of glial-specific genes such as GFAP, aquaporin 4 (AQP4) and S100? which suggests that it regulates glial differentiation (Shi et al, 2004). Together this evidence suggests a role of  r2e1 in re ressing the   ller glia lineage during mouse retinal development. Intriguingly, even though amacrine cell overproduction in Nr2e1frc/frc retinas is likely due to precocious neurogenesis, the excess of amacrine cells generated adopted a glycinergic phenotype. There are approximately 30 subtypes of amacrine cells that are mainly subdivided in two groups: GABAergic and glycinergic (Voinescu et al, 2009). Our results suggest that Nr2e1 may also have a role in regulating amacrine subtype specification in mouse retinas. During retinogenesis, there are several extracellular pathways known to influence cell fate and proliferation of RPCs (Hashimoto et al, 2006; Murali et al, 2005; Perron & Harris, 2000; Wang et al, 2001; Wang et al, 2005). For example, sonic hedgehog (SHH) signals derived from ganglion cells, suppress the generation of additional RGCs (Wang et al, 2005) and activate RPC proliferation (Agathocleous et al, 2007). Similarly, vascular endothelial growth factor (VEGF) secreted by postmitotic neurons acts through the FLK1 receptor to increase RPC proliferation and decrease retinal ganglion cell genesis (Hashimoto et al, 2006). In addition, T  ?II acts as a negative feedback signal to lower amacrine production (Ma et al, 2007). As there is a reduced number of ganglion cells and an increased number of amacrine cells in Nr2e1frc/frc retinas, a defect in any of these pathways could contribute to the complexity of the Nr2e1-null retinal phenotype.  In support of this idea, sustained VEGF expression causing failure of the hyaloid vessels to regress is observed in Nr2e1frc/frc retinas (Uemura et al, 2006). In order to assess how Nr2e1 regulates extrinsic and intrinsic signals to 82  affect RPC proliferation and fate in vivo, we evaluated the interplay between wild-type and Nr2e1frc/frc cells in wt?frc chimeras. Intriguingly, the numbers of Nr2e1frc/frc INL amacrine cells, rods, and bipolar cells were not rescued by the presence of wild-type cells in Wt?frc chimeras, suggesting that in these chimeras cellular clones are independent and extrinsic signals do not affect the commitment to the amacrine, bipolar or rod lineages nor their survival. Contrary to the environmental independence observed with most retinal cell-types, ganglion cell numbers were restored in Wt?frc chimeras, suggesting a role of a trophic factor crucial for their survival or that prevents their trans-differentiation in cells lacking Nr2e1. Similarly, we observed that the number of amacrine cells in the GCL was rescued by wild-type cells in Wt?frc chimeras. Since Nr2e1frc/frc RPCs generate an excess of amacrine cells even in the presence of wild-type cells, as explained above, it is possible that their migration to the GCL or their survival, specifically in this layer, was influenced by wild-type cells. These results suggest that the cellular composition of the GCL, but not the INL or ONL, can be rescued by extra-cellular signals. Unexpectedly, Nr2e1frc/frc S-cone numbers were increased in Wt?frc chimeras. Since we did not observe changes in total cone or S-cone numbers in Nr2e1frc/frc retinas, it is possible that S-cones were generated in abundance in Nr2e1frc/frc retinas and survived in chimeras while normally dying before P7 in Nr2e1frc/frc retinas. To support this idea, a previous study reported increased mRNA levels of S-opsin in Nr2e1-null retinas although did not evaluate S-cone cell numbers (Zhang et al, 2006).  Interestingly, the numbers of horizontal, cones and  ller glial cells remained comparable to wild type from P7 through P21 when retinogenesis has long been completed, suggesting that they are spared from the excessive cell-death seen in Nr2e1frc/frc retinas during this period. This also suggests 83  that most of the cell death observed between P7 and P21 in Nr2e1frc/frc retinas may be due to the loss of amacrine cells that make most of the INL at P7. Intriguingly, chimeric retinas containing 34% of Nr2e1+/+ cells had a thickness comparable to wild-type retinas suggesting that wild-type cells may prevent cell-death of Nr2e1frc/frc cells instead of changing the proportions of the cell-types generated. Together, these results show that in addition to regulating retinal cell numbers by preventing premature neurogenesis, Nr2e1 is also a regulator of retinal gliogenesis and amacrine subtype specification. Strikingly, with the exception of cells in the GCL, Nr2e1+/+ and Nr2e1frc/frc cells in chimeras harbored different numbers of rods, bipolar and amacrine cells suggesting a cell-autonomous role of Nr2e1 in RPCs to control their generation. 3.5.3 r e1  ell-a tonomo sly re  lates  ller  l a mat rat on an  soma  os t on n     r2e1 is e  ressed in  ller glia and regulates its ultrastructure (Miyawaki et al, 2004). We o served that  r2e1 is e  ressed in  ller glia throughout  ostnatal develo ment and that Nr2e1frc/frc   ller glia mise  ress Brn3a and position its soma ectopically in the upper INL. Importantly, Brn3a misexpression is only seen in the ventral retina suggesting Nr2e1 may have a role in dorsoventral patterning of the retina. Supporting this idea, lack of Nr2e1 has been shown to result in loss of region-specific gene expression in the ventral-most pallial region of the telencephalon (Stenman et al, 2003). Im ortantly,  oth the Brn3a mise  ression and ecto ic soma  ositioning of  ller glia phenotypes were present only in Nr2e1frc/frc cells of Wt?frc chimeras. The fact that  ller glia e  resses  r2e1 and that wild-ty e  ller glia are unaffected  y Nr2e1frc/frc cells suggest this is a cell-autonomous function of  r2e1.  r2e1 may then have a role in the maturation of  ller glia  y regulating its transcri tional  rofile and  lanar cell  olarity.  84  3.5.4 Role of Nr2e1 in retinal lamination  We observed that Nr2e1frc/frc retinas have a disorganized IPL and an ectopic plexiform layer (EPL) within the INL suggesting that Nr2e1 regulates processes that organize and constrain the neurites of inner retinal neurons to the IPL. Interestingly, this ectopic layer can attract normal pre-synaptic partners as bipolar cells arborized within it.  The regulation of laminar targeting specificity in the retina depends on repulsive and attractive interactions mediated by different short-range molecules (Deans et al, 2011; Masai et al, 2003; Matsuoka et al, 2011; Yamagata & Sanes, 2012). Our finding, that in Wt?frc chimeras this ectopic layer is only formed in Nr2e1frc/frc regions, also suggests that long-range extracellular signals are not involved. It is possible that wild-type cells lack the ability to form this layer; however we cannot rule out that wild-type amacrine cells that could migrate tangentially into Nr2e1frc/frc columns also extend processes into this layer. On the other hand, we observed that IPL disorganization was evident in the entirety of the Wt?frc chimeras, including areas containing wild-type cells, suggesting that wild-type cells are also misdirected by the aberrant neurite organization of mutant cells. These chimeras also demonstrate that the lack of ganglion cells per se is not the cause of IPL disorganization since ganglion cell numbers are normal in Wt?frc chimeras.  It is possible that the EPL is the consequence of defects either in amacrine cells themselves or in cues coming from other cells.  ller glia are good candidates for the source of such a signal since they e  resse  r2e1. However, a recent study showed that a normal IP  forms in the a sence of   ller glia (Randlett et al, 2013) and another study showed that Fat3-/- amacrine cells can form an ectopic plexiform layer similar to the one we observed (Deans et al, 2011). Therefore, it is more likely that a defect inherent to amacrine cells is the cause of the EPL. Amacrine overproduction itself 85  could lead to the generation of an ectopic layer. However, other mouse models with increased amacrine cells do not form ectopic synapses. For example, Math5-/- mice have reduced ganglion and increased amacrine cells without lamination defects (Randlett et al, 2013). Conversely, Pten-/- mice have reduced numbers of amacrine cells but do form ectopic synaptic clusters into the INL accompanied by defects in cell migration (Cantrup et al, 2012). It is then an attractive idea that Nr2e1 regulates molecules involved in cell adhesion or repulsion pathways controlling neurite outgrowth of amacrine cells. In support of this idea, we have previously shown dendritic branching defects in granule cells of the Nr2e1frc/frc dentate gyrus (Christie et al, 2006).  Interestingly, we found increase  hos horylation of ?-catenin on tyrosine 489 which normally leads to its dissociation from N-cadherin (Rhee et al, 2007). The formation of stable cell-cell adhesions by N-cadherin requires its association with ?-catenin (Lilien et al, 2002). In zebrafish pac mutants lacking N-cadherin, the IPL forms in ectopic locations and amacrine processes are over-elaborated and mispositioned (Masai et al, 2003). This indicates that the N-cadherin/?-catenin pathway may be dysregulated in Nr2e1frc/frc mice and could thus provide a partial mechanism by which Nr2e1 affects lamination.   A disrupted patterning of the IPL and unorganized amacrine branching has been shown in Dscam-/- and Pten-/- mice (Cantrup et al, 2012; Fuerst et al, 2012). However, an organized single ectopic layer has been shown in few mouse models such as those lacking the transmembrane repellents Sema5A and Sema5B (Matsuoka et al, 2011) and the atypical cadherin Fat3 (Deans et al, 2011). Fat3-/- amacrine cells elaborate a second dendritic tree that projects away from the IPL and forms an additional synaptic layer in the INL (Deans et al, 2011). Fat3-/- mice have ectopic cells in proximity to the EP  that are ?tra  ed? a ove this layer. Interestingly, we also o served ecto ic cal indin+ and 86  Pax6+/mGluR1+ cells that align in a different plane in the INL and branch into an ectopic plexiform layer. It is possible that the mispositioning of amacrine cells that we see is not due to defects in cell migration but rather to a physical barrier formed by the EPL as seen in Fat3-/-. Intriguingly, we also observed that some wild-type Brn3a+ ganglion cells are misplaced in the IPL and INL of Wt?frc chimeras, suggesting that they can also be misdirected non-cell autonomously. It would be interesting to assess whether the expression of semaphorins or Fat3 is affected in Nr2e1frc/frc retinas. 3.5.5 Concluding remarks In summary, in this study we found that  r2e1 has numerous roles  eyond  reventing  remature cell cycle e it in  PC during retinal develo ment. S ecifically, our results suggest that  r2e1 has a role in  ller glia differentiation and maturation, in regulating amacrine subtype specification, and in organizing the neurites of inner retinal neurons to the IPL. Moreover, we have demonstrated that Nr2e1 regulates ganglion cell numbers and retinal structural integrity non-cell autonomously. A model showing the defects in cell numbers and lamination of the P7 Nr2e1frc/frc retina is depicted in Fig. 3.13. Nr2e1 is necessary to maintain neural stem cells in the developing and adult brain and so it has been implicated in physiological and pathological processes such as learning and memory (Zhang et al, 2008a), and gliomagenesis (Zou et al, 2012). However, the cellular and molecular mechanisms of action of Nr2e1 are largely unknown. Master eye regulatory genes, such as Pax6, regulate multiple developmental processes including progenitor cell proliferation and differentiation, cell-adhesion, migration, maturation and secretion of extra cellular molecules in different tissues (Canto-Soler & Adler, 2006; Simpson & Price, 2002; Xu et al, 2007). We are only beginning to understand how the 87  interplay between various factors influences the intricacies of neural development. Here we have not only shown that Nr2e1 has additional roles to preventing cell cycle exit during retinogenesis but also characterized them in terms of cell-autonomy and environmental context. We hope this work will stimulate further research addressing some of these roles during brain development and adult neurogenesis.  Figure 3.13. Model depicting the cellular composition and organization of Nr2e1frc/frc clones. (A) Wild-type retina with 3 nuclear layers and 2 plexiform layers. (B) Nr2e1frc/frc retinas contain reduced numbers of ganglion, bipolar and rod cells and increased numbers of glycinergic amacrine cells. Disorganization of the IPL is evident as well as the presence of an ectopic plexiform layer (EP ) in the I  .  ller glia somas are localized closer to the OPL and can be interspersed with bipolar cells. (C) An Nr2e1frc/frc clone in a Wt?frc chimera has reduced numbers of bipolar and rods and increased number of amacrine cells. Ganglion cell numbers are restored to wild ty e. There is also an increase in S-cone num ers.  isorgani ation of the IP  and an EP  are still evident as well as   ller glia soma mis ositioning. Some ganglion cells are ecto ically  ositioned in the IP  and I  . GCL = ganglion cell layer; INL = inner nuclear layer; ONL = outer nuclear layer; IPL = inner plexiform layer; EPL = ectopic plexiform layer; OPL = outer plexiform layer. 88  Chapter 4 : Novel co-regulator interactions for the orphan nuclear receptor NR2E1 revealed by a peptide array 4.1 Abstract NR2E1 (Tlx) is an orphan nuclear receptor that regulates neural stem cell maintenance and self-renewal. In the retina, Nr2e1-null mice exhibit pronounced dystrophy, abnormal blood vessels and laminar defects. NR2E1 functions mainly as a repressor of gene transcription in association with the co-repressors atrophin1, LSD1, HDAC and BCL11A. Recent evidence suggests that NR2E1 also acts as an activator of gene transcription. However, co-activator complexes that interact with NR2E1 have not yet been identified. In order to identify potential novel co-regulators for NR2E1, we used an array that contains peptides representing interaction motifs from co-regulatory proteins, including known co-activator nuclear receptor box sequences (LxxLL motif). We found 19 candidate NR2E1 partners, two of which, p300 and androgen receptor (AR), were further validated by reciprocal pull-down assays. The specificity of binding of NR2E1 to peptides in the array was evaluated using two single-point variants, R274G and R276Q, that disrupted the majority of the binding interactions observed with wild-type NR2E1 in the array. The decreased affinity of these variants to co-regulators was further validated by pull-down assays using atrophin1 as a bait protein. Despite the high conservation of arginine 274 in vertebrates, these reduced interactions were not significant in vivo as single-copy mice carrying the variant R274G did not generate an obvious retinal phenotype. In summary, we identified through a peptide array 19 novel putative interactors for NR2E1 and confirmed two of them, AR and p300, by affinity purification. P300 is a known co-activator of gene transcription and could be the first identified mediator of NR2E1 transcriptional activation function.  89  4.2 Introduction NR2E1 (Tlx) is an orphan nuclear receptor that regulates neural stem cell maintenance and self-renewal (Qu et al, 2010; Sun et al, 2007). NR2E1 is crucial for adult stem cell proliferation (Niu et al, 2011) and plays an important role in spatial learning through hippocampal neurogenesis (Miyawaki et al, 2004). Nr2e1-null mice are highly aggressive and have reduced cortical thickness and limbic structures (Roy et al, 2002). NR2E1 also regulates the development and survival of specific retinal cell-types and the lamination of inner nuclear layer neurons (Corso-D?az & Simpson, 2013; Miyawaki et al, 2004). Nr2e1-null retinas are extremely hypomorphic and have reduced number of blood vessels (Miyawaki et al, 2004; Young et al, 2002). However, in spite of the increasing knowledge that we gained over the past years regarding NR2E1 biological function, its precise molecular mechanism of action remains poorly understood. Nuclear receptors interact with multi-protein co-activator or co-repressor complexes to activate or repress transcription, respectively. These co-regulator complexes have histone modification and chromatin remodeling functions that elicit transcriptional control. Many co-regulators interact with the hydrophobic grove of nuclear receptors through specific motifs. Co-repressors use the consensus amino acid sequence LxxxIxxxL or co-repressor nuclear receptor (CoRNR) box motif (Hu & Lazar, 1999) and co-activators an LxxLL binding motif, also called the nuclear receptor box (Heery et al, 1997).  NR2E1 functions mainly as a repressor of gene transcription and interacts with the co-repressors atrophin1 (Zhang et al, 2006), the histone demethylase 1  (LSD1) (Yokoyama et al, 2008), various histone deacetylases (HDACs) (Sun et al, 2007)  and the oncoprotein BCL11A (Estruch et al, 2012). However, the composition and dynamics of the co-repressor complexes formed by NR2E1 are not 90  well understood. Similarly, recent studies show that NR2E1 is also an activator of gene transcription by binding to the promoters of Wnt7a (Qu et al, 2010), and Mash1 (Elmi et al, 2010). However, no co-activator proteins have been found to interact with NR2E1.  In order to identify novel potential co-regulators including co-activators that interact with NR2E1, we used an array containing peptides representing co-regulator interacting sequences where the LxxLL motif was highly represented. We found 19 interactions, two of which, p300 and AR, were further validated in pull-down assays. We confirmed the specificity of binding of NR2E1 to peptides in the array by using two single-point variants in the ligand binding domain of NR2E1: R274G and R276Q, which disrupted the binding of NR2E1 to the array. However, we also observed that R274G did not have an overt effect on retinal development and generated a normal retina, as assessed by funduscopy and histology, in a mouse model carrying this variant as a single copy insertion. Together, our results revealed many novel peptide-based interactors for NR2E1 that could play important biological roles in vivo, and suggest that amino acid changes in the ligand binding domain of NR2E1 reduce binding to regulators in vitro but, at least with respect to the variant R274G in the retina, are still tolerable in vivo despite the high level of conservation at this position. 4.3 Materials and methods 4.3.1 Microarray assay for real-time analysis of co-regulator?nuclear receptor interaction (MARCoNI) The peptide array was performed on Nuclear Receptor PamChip Arrays (PamGene International B.V., Hertogenbosch, The Netherlands) harboring immobilized peptides with coregulator-derived sequences (Table 4.1) as described before (Koppen et al, 2009). We added a peptide from atrophin1, called the ATRO box (PYADTPALRQLSEYARPHVAFS) as a positive control and a mutant  91  Table 4.1. Peptides used in the MARCoNI assay. No. Peptide ID No. Peptide ID No. Peptide ID No. Peptide ID 1 ANDR_10_32 41 MAPE_300_322 81 NELFB_428_450 121 PPRC1_1159_1181 2 ATRO box 42 MAPE_356_378 82 NELFB_80_102 122 PPRC1_151_173 3 ATRO box mut 43 MAPE_382_404_C388S 83 NR0B1_1_23 123 PR285_1062_1084 4 BL1S1_1_11 44 MAPE_454_476_C472S 84 NR0B1_136_159 124 PR285_1105_1127 5 BRD8_254_276 45 MAPE_91_113 85 NR0B1_68_90_C69S 125 PR285_1160_1182_C1163S 6 CBP_2055_2077 46 MED1_591_614 86 NR0B2_106_128 126 PR285_2216_2238_C2219S 7 CBP_345_367_C367S 47 MED1_632_655 87 NR0B2_201_223_C207S 127 PR285_432_454_C453S/C454S 8 CBP_345_368 48 MEN1_255_277 88 NR0B2_237_257 128 PRDM2_948_970 9 CBP_345_368_C367S 49 MGMT_86_108 89 NR0B2_9_31_C9S/C11S 129 PRGC1_130_155 10 CBP_57_80 50 MLL2_4175_4197 90 NRBF2_128_150 130 PRGC1_134_154 11 CCND1_243_264_C243S/C247S 51 MLL2_4702_4724 91 NRIP1_1055_1077 131 PRGC2_146_166 12 CENPR_1_18 52 MTA1S_388_410_C393S/C396S 92 NRIP1_120_142 132 PRGC2_338_358 13 CENPR_159_177 53 NCOA1_1421_1441 93 NRIP1_121_143_P124R 133 PRGR_102_124 14 CHD9_1023_1045 54 NCOA1_620_643 94 NRIP1_173_195 134 PRGR_42_64_C64S 15 CHD9_2018_2040 55 NCOA1_677_700 95 NRIP1_173_195_C177S 135 PROX1_57_79 16 CHD9_855_877 56 NCOA1_737_759 96 NRIP1_253_275_C263S 136 RAD9A_348_370 17 CNOT1_140_162 57 NCOA2_628_651 97 NRIP1_368_390 137 RBL2_875_897_C879S/C894S 18 CNOT1_1626_1648 58 NCOA2_677_700 98 NRIP1_488_510 138 TF65_437_459 19 CNOT1_1929_1951_C1932S 59 NCOA2_733_755 99 NRIP1_700_722 139 TGFI1_325_347_C334S/C346S 20 CNOT1_2083_2105 60 NCOA2_866_888 100 NRIP1_701_723 140 TGFI1_443_461_C452S/C455S 21 CNOT1_2086_2108 61 NCOA3_104_123_N-KKK 101 NRIP1_8_30 141 TIF1A_373_395_C394S 22 CNOT1_557_579 62 NCOA3_609_631 102 NRIP1_805_831 142 TIF1A_747_769 23 DDX5_133_155 63 NCOA3_609_631_C627S 103 NRIP1_924_946 143 TIP60_476_498 24 DHX30_241_262 64 NCOA3_673_695 104 NRIP1f_924_946_C945S 144 TREF1_168_190 25 DHX30_49_70 65 NCOA3_725_747 105 NSD1_894_916 145 TREF1_850_872 26 EP300_2039_2061 66 NCOA3_MOUSE_1029_1051 106 NSD1_982_1004 146 TRIP4_149_171_C171S 27 EP300_69_91 67 NCOA4_315_337 107 PAK6_248_270 147 TRRAP_3535_3557_C3535S/C3555S 28 GELS_376_398 68 NCOA4_79_101_C101S 108 PCAF_178_200 148 TRRAP_770_792 29 GNAQ_21_43 69 NCOA6_1479_1501 109 PELP1_142_164 149 TRRAP_971_993 30 HAIR_553_575_C567S 70 NCOA6_875_897 110 PELP1_168_190 150 TRXR1_132_154 31 HAIR_745_767_C755S/C759S 71 NCOR1_1925_1946 111 PELP1_20_42 151 UBE3A_396_418 32 IKBB_244_266 72 NCOR1_2039_2061 112 PELP1_251_273 152 UBE3A_649_671 33 IKBB_277_299 73 NCOR1_2039_2061_C2056S 113 PELP1_258_280 153 WIPI1_119_141 34 IKBB_62_84 74 NCOR1_2251_2273 114 PELP1_446_468 154 WIPI1_313_335_C318S 35 ILK_131_153 75 NCOR1_2376_2398 115 PELP1_496_518_C496S 155 ZNHI3_89_111 36 JHD2C_2054_2076 76 NCOR1_662_684_C662S 116 PELP1_56_78_C71S 156 ZNT9_449_471 37 KIF11_832_854_C854S 77 NCOR2_2123_2145 117 PELP1_571_593_C575S/C581S   38 L3R2A_12_34 78 NCOR2_2330_2352 118 PIAS2_6_28   39 LCOR_40_62 79 NCOR2_649_671_C649S 119 PNRC1_306_327   40 MAPE_249_271 80 NELFB_328_350 120 PNRC2_118_139                                           List of co-regulator-derived sequences used in the MARCoNI assay. Peptide ID: [coregulator (UniProt ID)]_[aa start]_[aa end of peptide]. The wild-type and mutant ATRO box were used as positive and negative control, respectively (red).  92  ATRO box as a negative control were two leucines were substituted with alanines (PYADTPAARQASEYARPHVAFS). Briefly, lysates were prepared from HEK293 cells transfected with the wild-type NR2E1 ligand binding domain FLAG-tagged at the N-terminus (FLAG-NR2E1LBD), and the variants R274G or R276Q as described below. The concentration of FLAG-NR2E1LBD in the lysates was assessed by western blot and the quantities of each sample were adjusted such that equal amounts of NR2E1 proteins were added to the array. Sample IDs were randomly assigned to allow for a blinded experiment. Alexa 488?conjugated anti-FLAG (4 mg/mL) antibody (LakePharma, Inc., Belmont, CA) was added to the lysates to detect the overexpressed proteins. The arrays were incubated with 25 ?L blocking buffer [TBS with 1% BSA, 0.01%, Tween-20, and 0.3% skimmed milk (Oxoid)] for 20 cycles. Subsequently, each array was incubated with 7-10 ?L of assay mix for 80 cycles and washed with 25 ?L TBS. At cycle 102, a TIFF (Tagged Image File Format) image was captured by the CCD camera. Image analysis was performed by automated spot finding and quantification using BioNavigator software (PamGene International BV) as described before (Koppen et al, 2009).  4.3.2 Plasmid constructs and site-directed mutagenesis Site directed mutagenesis was performed with the Quik-Change? Lightning Site-Directed Mutagenesis Kit (Stratagene, CA, USA) on wild-type FLAG-NR2E1LBD according to manufacturer?s instructions. Primers used were forward 5?-GAGGTGGTGGCTCGATTTCAACAACTCCGGTTAGATGC-3? and reverse 5?-GCATCTAACCGGAGTTGTTGAAATCGAGCCACCACCTC-3? for  274 ; and forward 5?-GCTTTACAAGAGGTGGTGGCTGGATTTAGACAACTCC-3? and reverse 5?-GGAGTTGTCTAAATCCAGCCACCACCACTTGTAAAGC-3? for  276Q. The   2E1 ligand  inding domain (LBD) was cloned into the pEGFP-N1 vector (Clontech, CA, USA) using EcoRI and NotI enzymes 93  (Invitrogen, CA, USA). The EGFP coding region was replaced with NR2E1 LBD, which was amplified using the  rimers: forward 5?-ATATGAATTCACCATG GACTACAAGGATGACGATGACAAGGGAGGAGGAGGAGGAGGAGTGTCCACCACTCCAGAGCGGC-3? and reverse 5?-ATATGGATCCTTAGATATCACTGGATTTGTAC-3?. The forward  rimer also contained the FLAG-tag coding sequence. GST-NR2E1 was generated by cloning full-length NR2E1 into pGEX-2T vector (Clontech, CA, USA) using BamHI and EcoRI enzymes (Invitrogen, CA, USA). NR2E1 cDNA was amplified using the following  rimers: forward 5?-ATATGGATCCGGAGGAGGAGGAGGAGGAATGAGCAAGCCAGCC-3? and reverse 5?-ATATGAATTCTTAGATATCACTGGATTTGTAC-3?.  pEGFP-C1-AR (Plasmid #28235) and  C V?-p300-myc (Plasmid #30489) were purchased from Addgene (Cambridge, MA, USA). The GST-ATRO1 construct was kindly donated by Dr. Chih-Cheng Tsai (Baylor College of Medicine, Houston, TX, USA). 4.3.3 Protein expression and protein lysates preparation One Shot? B 21 Star? ( E3) Chemically Competent E. coli (Life Technologies, Carlsbad, CA, USA) were transformed with GST-ATRO1 or GST-NR2E1 constructs. Subsequently, a bacterial colony was grown in 10 mL of LB media containing 100 ?g/mL Ampicillin overnight. Five ?L of the overnight culture were added to 100 mL of LB (1:50 dilution) containing 100 ?g/mL Ampicillin and grown to reach an OD600 of 0.5 (mid-log). Bacteria were induced with 0.1 mM IPTG for 4 hours at 37 ?C. Bacteria were pelleted at 7,000x g for 7 minutes, washed with STE buffer (10 mM Tris pH8.0, 150 mM NaCl and 1 mM EDTA) and resuspended in STE buffer containing protease inhibitors (Roche) and 100 ?g/mL of lysozyme. Cells were incubated 15 minutes on ice and DTT was added to a final concentration of 5 mM.  Subsequently, Sarkosyl was added to a final concentration of 0.2%, and 94  cells were vortex and sonicated on iced twice for 15 s. Cells were centrifuged at 20,000x g for 15 min. Supernatant were collected and used in subsequent experiments. HEK293 cells were grown in T-75 flasks and transfected with the different constructs. Forty-eight hours after transfection, cells were washed with PBS and lysed in ice-cold solubilization buffer (20mM Tris HCl, pH8.0, 1% NP40, 10% glycerol, and 137 mM NaCl) with protease inhibitor cocktail (Roche) and 1 mM phenylmethylsulfonyl fluoride (PMSF). Cells were sonicated for 10 s and centrifuged at 20,000x g for 10 min.  4.3.4 Pull-down experiments Bacterial lysates were incubated with glutathione MagBeads (GenScript, Piscataway, NJ, USA) for one hour. Beads were then washed twice with PBS and incubated in 1% BSA/PBS for one more hour. HEK293 lysates were adjusted to 0.1% BSA and incubated with the beads for two hours at 4?C.  Beads were washed 3 times for 30 minutes before adding 50 ?L of loading buffer. An SDS-Polyacrylamide gel electrophoresis was performed with the final sample from the beads and 3% of recovered input. 4.3.5 Western blot Sam les containing 1  loading  uffer were incu ated at 75 C for 10 min and loaded into  uP  E? Novex Bis-Tris Gels (Invitrogen, Carlsbad, CA, USA). Gels were run for 30-45 min at 150 V. Subsequently transfer into polyvinylidene difluoride (PVDF) membranes was performed for 90 min at 30 V. After transfer, membranes were washed and incubated in blocking solution (5% milk in Tween-TBS) for one hour. Subsequently, mem ranes were incu ated with  rimary anti odies in  loc ing solution overnight at 4 C.  nti odies against E  P (rabbit, 1:5000) (Invitrogen, Carlsbad, CA, USA) or His (mouse, 1:1000) (Applied Biological Materials Inc., Richmond, BC, Canada) were used. 95  After three washes of 10 min each, membranes were incubated with peroxidase-conjugated secondary antibodies. After three subsequent washes, the membrane was incubated with Novex? ECL Chemiluminescent Substrate (Invitrogen, Carlsbad, CA, USA) and exposed to Fuji Rx film. 4.3.6 Mouse strains husbandry and breeding B6.129P2(Cg)-Hprttm330(NR2E1,bEMS112)Ems mice were generated from embryonic stem cell (ESC) clone mEMS4738 harboring the bacterial artificial chromosome (BAC) bEMS112 (containing variant R274G) knock-in allele at the mouse Hprt locus, as previously described (Schmouth et al, 2012a; Schmouth et al, 2012b). Only male mice were studied to avoid variability due to random X inactivation of the knock-in allele at Hprt. Experimental animals for studying the NR2E1 BAC (bEMS112) were generated through a breeding strategy described before (Schmouth et al, 2012a). Briefly, B6 (C57BL/6J) females heterozygous for the BAC insert and for the fierce deletion (B6.Cg-Hprttm85(NR2E1,bEMS112)Ems/X, Nr2efrc/+), were crossed to 129 (129S1/SvImJ) males heterozygous for the fierce mutation (129S1/SvImJ.Cg-Nr2efrc/+). This produced first-generation hybrid offspring (B6129F1), abbreviated here as Nr2e1+/+; Nr2efrc/+; Nr2e1frc/frc; Nr2e1+/+/NR2E1; Nr2efrc/+/NR2E1; Nr2e1frc/frc/NR2E1; Nr2e1+/+/R274G; Nr2efrc/+/R274G; and Nr2e1frc/frc/R274G. Mice were kept in a pathogen-free animal facility at the Centre for Molecular Medicine and Therapeutics (Vancouver, BC, Canada) on an 6 am to 8 pm light cycle with, 20 ? 2?C, 50% ? 5% relative humidity, and food and water ad libitum. All procedures involving animals were in accordance with the Canadian Council on Animal Care (CCAC) and UBC Animal Care Committee (ACC) (Protocol numbers A07-0435 and A11-0370). 96  4.3.7 Histology Eyes were dissected, washed once in PBS and incu ated overnight in  avidson?s fi ative. Eyes were then stored in 70% ethanol until  araffin em edment. Eyes were sectioned at 5 ?m and mounted on SuperFrost Plus slides. To evaluate retinal thickness, eyes were subjected to hematoxylin and eosin staining. Briefly, tissue was incubated in hematoxylin for 5 min, washed in tap water and incubated in 1% lithium carbonate solution for 30 s. After washing in tap water again, the tissue was incubated in acid alcohol (1%) for 5 s followed by another tap water wash and incubation in eosin Y solution for 5 min. After a final tap water wash, tissue was dehydrated in a gradient of ethanol and xylene before mounting for microscopy. 4.3.8 Imaging and assessment of retinal thickness To assess the number of retinal blood vessels, funduscopy was performed as previously described (Abrahams et al, 2005; Schmouth et al, 2012a). In short, eyes were dilated with 1% atropine/PBS and photographed after 30 minutes. Animals were manually restrained without sedation. Retinal sections were imaged with the Olympus BX61 motorized microscope using the software DP Controller. Retinal sections were chosen such that they contained the optic nerve and retinal thickness was measured 600 ?m away from the optic nerve using the software ImageJ (Schneider et al, 2012). One section per eye and two eyes per animal were studied.  4.3.9 Statistical analysis Statistical analysis was performed using the software XLSTAT. Two-way ANOVA was used to calculate differences between groups. Q-values were calculated with Q-VALUE software (http://genomics.princeton.edu/storeylab/qvalue/).  A comparison between signal intensities in the western blot was performed by one-way ANOVA.  97  4.4 Results In order to find novel transcriptional co-regulators that interact with NR2E1, we incubated the N-terminal FLAG-tagged ligand-binding domain (FLAG-NR2E1LBD) with peptides of a microarray assay for real-time analysis of coregulator?nuclear receptor interaction (MARCoNI) (PamGene International). This array contained 154 peptides from 64 co-regulator proteins. Many of these peptides harbored the LxxLL motif. Since the array did not contain any previously known direct interactors for NR2E1, we added a peptide from atrophin1 as a positive control. This peptide is referred as the ATRO box and is comprised of 16 amino acids that are highly conserved among atrophins and found to be necessary for the interaction between NR2E1 and atrophin1 (Wang et al, 2006). Two additional amino acids on each side were included for stability in the array (PYADTPALRQLSEYARPHVAFS). Mutations in the two leucines of the ATRO box to alanines (PYADTPAARQASEYARPHVAFS) abolish the interaction between Drosophila Atro and NR2E1 in yeast-two-hybrid assays (Wang et al, 2006). Therefore, we included an ATRO box containing those two leucine to alanine substitutions as a negative control.  We found that FLAG-NR2E1LBD interacted very strongly with the ATRO box peptide in the array but bound very poorly to the mutant ATRO box (Fig. 4.1). This suggested that the array binding conditions were appropriate for identifying novel interactions between NR2E1 and co-regulators.  98   Figure 4.1. NR2E1 binds to the ATRO box in MARCoNI. The MARCoNI array contained a wild-type and mutant ATRO box (a peptide from atrophin1) as positive and negative controls, respectively. NR2E1 bound to the wild-type ATRO box and with greatly reduced affinity to the mutant ATRO box. The variants R274G and R276Q did not bind to any of the ATRO peptides. *, significantly different to wild-type (q >0.02).  FLAG-NR2E1LBD also showed binding to 26 peptides belonging to 19 proteins after applying False Discovery Rate correction for array size (q < 0.05) and eliminating negative fluorescence values (Fig. 4.2). These interactions were; however, weaker than the interaction with atrophin1 (Fig. 4.1 and 4.2). Importantly, none of these proteins have previously been shown to directly or indirectly bind to NR2E1. Some of the peptides that interacted with NR2E1 in the array are cofactors known to be primarily present in co-activator complexes. These include the SRC family members NCOA1 (SRC-1), NCOA2 (SRC-2) and NCOA3 (SRC-3) (Leo & Chen, 2000); the ATP-dependent chromatin remodeling protein, Chromodomain Helicase DNA Binding Protein 9 (CHD9) (Surapureddi et al, 2006); Proline-Rich Nuclear Receptor Coactivator (PNRC1) (Zhou et al, 2000); Peroxisome Proliferator-Activated Receptor Gamma, Coactivator-Related (PPRC1) (Andersson & Scarpulla, 2001); the scaffold 99  Transformation/Transcription Domain-Associated Protein (TRRAP) (McMahon et al, 1998) and the histone acetyltransferase P300 (Goodman & Smolik, 2000) (Fig. 4.2). Other proteins that showed significant binding to NR2E1 in the array are known to be primarily part of co-repressor complexes. These include the cell-cycle checkpoint protein human homolog of RAD9 (Bessho & Sancar, 2000); the NR2E3 co-repressor and RNA helicase DHX30 (RetCOR) (Takezawa et al, 2007); the HDAC-associated protein NCOR2 (SMRT) (Chen & Evans, 1995); and Nuclear Receptor Interacting Protein 1 (NRIP1; RIP140) (Cavailles et al, 1995). Interestingly, we found that six out of 14 NRIP1 peptides in the array showed significant interaction with NR2E1 (Fig.4.2).100   Figure 4.2. NR2E1 binds to 26 peptides representing co-regulator interacting sequences in MARCoNI. MARCoNI PamChip Array containing 154 peptides from 64 co-regulator proteins was used to assess the binding of NR2E1 to different co-regulators. NR2E1 showed significant binding to 26 co-regulators (q<0.05) depicted in the histogram. Two point variants in the ligand-binding domain of NR2E1 (R274G and R274Q) abolished the majority of binding interactions observed with wild-type NR2E1. Dark triangles indicate peptides that interacted equally with R274G and NR2E1 (q<0.05). Open triangles indicate peptides that interacted equally with R276Q and NR2E1 (q<0.05). AU = arbitrary units. 101  We also observed that other co-regulators that can act as co-activators and co-repressors are also targets in the array. These proteins are Proline, Glutamate And Leucine Rich Protein 1 (PELP1) (Vadlamudi et al, 2001); the Histone methyltransferase Nuclear Receptor Binding SET Domain Protein 1 (NSD1) (Kurotaki et al, 2001), and Tripartite Motif Containing 24 (IFI1a) (Kikuchi et al, 2009). In addition, transcription factors such as Prospero Homeobox 1 (PROX1) and androgen receptor (AR) also significantly interacted with NR2E1.  Other proteins that directly regulate transcription factors were also candidate partners for NR2E1. These include P21 Protein (Cdc42/Rac)-Activated Kinase 6 (PAK6) that phosphorylates AR and inhibits its transcriptional activity (Liu et al, 2013); and Nuclear Factor of Kappa Light Polypeptide Gene Enhancer in B-Cells (IKBB), that inhibits NF-kappa-B by sequestering it in the cytoplasm (Mercurio et al, 1997). To further assess the specificity of the array, we developed two NR2E1 variants, harboring a single-point variant in the LBD of NR2E1: an arginine to glycine substitution in codon 274 (R274G) and an arginine to glutamine substitution in codon 276 (R276Q). The LBD of NR2E1 is highly conserved in vertebrates (Fig. 4.3), so we hypothesized that amino-acid changes in the LBD will affect the ability of NR2E1 to interact with its protein partners. We previously found an amino-acid change in arginine 274 to glycine in the human population (mother and son) in the heterozygous state (Corso-Diaz et al, 2012). This arginine is highly conserved not only within NR2E1 but also within its close relative NR2E3. Furthermore, amino-acid similarity is also found in other nuclear receptors of the same family such as NR2F2 where there is a lysine instead of an arginine in aligned regions of the ligand binding domain corresponding to NR2E1 codon 274 (Fig. 4.3). This conservation suggests that an amino-acid with a positive charged side chain in this region is important for normal protein 102  function.  Furthermore, arginine 274 aligns with arginine 309 in NR2E3 and its substitution to glutamine in NR2E3 can be found in patients suffering from enhanced-S-cone syndrome (Galantuomo M.S & M, 2008; Haider et al, 2000). Interestingly, we observed that both variants caused a reduction in the binding of NR2E1 to the ATRO box and the majority of the novel co-regulator interactions found in the array. The exceptions were PELP1, IKBB, CDH9 and NRIP1 which did not show a significant reduction in interaction with R274G and R276Q.  Also, PAK6 and NCOA3 showed a comparable binding to R276Q and NR2E1 (Fig. 4.2).  Figure 4.3. Conservation of arginine 274 and 276 in NR2E1, and the equivalent residue in NR2E3 and NR2F2. UCSC genome browser image depicting the conservation of arginine 274 and 276 (red rectangle) from humans to Zebrafish in NR2E1 and NR2E3. A lysine, instead of arginine, is similarly conserved in NR2F2 suggesting an amino acid with positive charge is biologically important in this position.  We chose two proteins, AR and P300, from the array for further analysis. AR is a nuclear hormone receptor of the NR3C class. In addition to its well-known role in regulation of male development and reproductive function, AR also has a role in neurogenesis (Brannvall et al, 2005; Okamoto et al, 103  2012; Zhang et al, 2008b). The array included the FxxLF motif of AR, located in its NH2-terminal region. This motif interacts with AR itself to stabilize the ligand-bound AR complex by interacting with different regions of the AR ligand binding domain (He et al, 2000). The FxxLF motif also mediates AR interaction with co-regulators such as Melanoma Antigen Gene Protein-A11 (MAGE-11) (Askew et al, 2009). P300 is an acetyltransferase that acetylates histones and other proteins. P300 also acts as a scaffold for transcription factors and other components of the basal transcription machinery to facilitate chromatin remodeling and gene transcription (Goodman & Smolik, 2000). P300 has well established roles regulating neural stem cell differentiation (Kamiya et al, 2011; Nakashima et al, 1999). Importantly, by performing pull-down experiments we showed that NR2E1 binds to both AR and P300 in the array (Fig.4.4).    Figure 4.4. NR2E1 interacts with P300 and Androgen receptor. The ligand binding domain (LBD) of NR2E1 fused to GST was produced in E. coli and incubated with HEK293 lysates containing over-expressed P300-His (A) or over-expressed androgen receptor (AR)-EGFP (B). After incubation with glutathione/sepharose beads, purified complexes were resolved by SDS-PAGE followed by western blot using anti-His and anti-EGFP antibodies. Three independent experiments were conducted. Note the absence of binding of P300 or AR to the GST control and positive binding to NR2E1-GST. n = 3  104  We further studied the ability of R274G or R276Q to interact with atrophin1 by affinity purification assays. We used bacterially expressed atrophin1-GST (846-1191) containing the ATRO box as a bait and incubated it with HEK293 lysates containing the wild-type and variant FLAG-NR2E1LBD proteins used in the peptide array. In agreement to what we observed in the array, there was a decreased binding of both R274G and R276Q to atrophin1 suggesting that these amino acid changes alter the conformation of NR2E1 and its capacity to interact with its protein partners (Fig. 4.5).  Figure 4.5. NR2E1 variant R274G exhibits decreased binding to atrophin1. GST-ATRO (846-1191) containing the ATRO BOX was over-expressed in E.coli and incubated with either the wild-type, R274G or R276Q amino acid variants of the ligand-binding domain (LBD) of NR2E1 generated via overexpression in HEK293 cells; all NR2E1 LBD truncations contained an N-terminal FLAG tag. (A) Note the decreased binding of the R274G and R276Q variants to GST-ATRO (846-1191). (B) Western blot quantification of three independent experiments; the signal intensity detected with anti-FLAG antibody for each pull down was normalized to the input signal. Note that wild-type NR2E1 binds 8 times more to atrophin1 compared to R274G. n = 3  105  Since the NR2E1 variants used in this study have a dramatic effect on the ability of NR2E1 to interact with its partners, we studied the effects of R274G during retinogenesis in vivo. We analyzed the retinal blood vessel numbers and thickness of a transgenic mouse harboring the R274G mutation as a single copy on the X-Chromosome (Schmouth et al, 2012b). We compared littermates that were wild-type, Nr2e1+/frc or Nr2e1frc/frc, and that also harbor or not the R274G variant. In this way, we could study possible gain of function, dominant negative or loss of function behavior of R274G. Strikingly, we found that although the blood vessel radial symmetry was lost in Nr2e1frc/frc mice and the blood vessels numbers were reduced, the variant R274G did not affect blood vessel development (Fig. 4.6A and B). Similarly, the reduced retinal thickness of Nr2e1frc/frc mice was not observed in mice harboring the R274G variant on any of the Nr2e1 backgrounds studied (Fig. 4.6C and D). In conclusion, R274G does not generate an overt retinal phenotype suggesting that there are compensatory mechanisms involved or that these variants do not affect the interaction of NR2E1 with relevant co-factors in the retina.  106   Figure 4.6. Nr2e1frc/frc, R274G mice display normal retinal blood vessel numbers and thickness. (A) Fundus pictures of P28 Nr2e1+/+ and Nr2e1frc/frc controls and Nr2e1frc/frc mice harboring a human NR2E1 or R274G BAC single-copy knock-in at the Hprt locus. (B) Retinal blood vessel numbers in mice harboring a human NR2E1 or R274G BAC insertion in three different endogenous Nr2e1 backgrounds: NR2E1+/+, Nr2e1+/frc or Nr2e1frc/frc. Blood vessels are disorganized and greatly reduced in number in Nr2e1frc/frc retinas compared to wild-type, but are normal in both Nr2e1frc/frc/NR2E1 and Nr2e1frc/frc/R274G mice. (C) Paraffin-embedded eyes from P28 mice were sectioned at 5 ?m thickness. Central sections containing the optic nerve were stained with H and E. Representative retinal pictures from mice with genotypes described in A are shown. (D) The retinal thickness from mice with genotypes described in B was measured. Retinal thickness is highly reduced in Nr2e1frc/frc retinas compared to wild-type but it is normal in both Nr2e1frc/frc/NR2E1 and Nr2e1frc/frc/R274G mice. N = 6 (12 eyes); ns, no significant; *, P < 0.001. Error bars represent the standard error of the means. GCL = ganglion cell layer; INL = inner nuclear layer; ONL = outer nuclear layer; ON = optic nerve.   107  4.5 Discussion In this study, we used a peptide array to find novel interactors for NR2E1. We found that NR2E1 interacted with 19 proteins and we confirmed the androgen receptor and p300 interactions by affinity purification. We also found two point variants in NR2E1 that disrupted its binding to most co-regulators without overt physiological significance in the retina. Our results greatly increase our knowledge on the pool of putative co-regulators that can interact with NR2E1. Proteins interact through domains, many of which bind to short peptide sequences (Castagnoli et al, 2004). We used peptides in the array that represent some of these short sequences in a linear context. These sequences lack the context of the full protein and thus may result in non-specific interactions. To evaluate the specificity of the array and the appropriateness of this approach, we used as a positive control the ATRO box, and as a negative internal control the mutated ATRO box. We also used the NR2E1 point variants R274G and R276Q as experimental negative controls. We observed strong binding of NR2E1 to the wild-type ATRO box and decreased binding to the mutated ATRO box. Furthermore, we observed that R274G and R276Q failed to interact with most of NR2E1 putative interactors in the array suggesting that these variants generated a conformational change in NR2E1 that prevented its binding to other proteins. This hypothesis was further strengthened in pull-down assays using atrophin1 as bait where both NR2E1 variants interacted with atrophin1 with much less affinity than wild-type. Together, these data suggest that the binding of NR2E1 to the interactors in the array was highly specific.  Importantly, we noted that although specific, the binding of NR2E1 to other peptides in the array was weaker than observed for atrophin1, a known direct NR2E1 interactor. This could be due to the fact that the interaction of NR2E1 to the other peptides in the array is more transient or indirect.  108  Our results also suggest that there are many other proteins that could interact directly or indirectly with NR2E1, especially those with a known role in neural precursor behavior. For example, mouse Prox1, an interactor of NR2E1 in the array, has a role in controlling the balance between NPC self-renewal and neuronal differentiation by inhibiting Notch1 expression (Kaltezioti et al, 2010). Interestingly, the expression of the Prox1 homolog in Drosophila, prospero, is regulated by the homolog of NR2E1, Tlx (Kurusu et al, 2009), suggesting a role for NR2E1 in controlling PROX1 biological output.  It is then possible that a regulation of PROX1 by NR2E1 can also be achieved by their interaction in the same complex as suggested by our array results. Another interactor in the array that is also a neural precursor-related protein is DHX30 (RetCoR), and it is important for mediating NR2E3 repressor function in retinal progenitor cells (Takezawa et al, 2007). Also an interesting co-repressor target is NRIP1 that had 14 motifs in the array, of which 6 interacted with NR2E1. NRIP1 is expressed in the brain including the neurogenic region of the dentate gyrus (Duclot et al, 2012), but its role in neurogenesis, if any, is unknown and worth exploring. Importantly, some proteins that function in co-activator complexes also showed interaction with NR2E1 in the array. Interestingly, three co-activators members of the SRC family (SRC-1, SRC-2 and SRC-3) were found to interact with NR2E1 in the array. However, whether they have a role in neural stem cell behavior is not clear although there is some evidence that SRC-1 could be involved in neurogenesis as it is upregulated during neuronal differentiation in vitro (Nishihara et al, 2007).   Two important scaffolds of multi-protein co-activator complexes, TRRAP and P300, also interacted with NR2E1 in the array. TRRAP is found mutated in patients with schizophrenia (Xu et al, 2012) and controls the tumourigenicity of brain tumor initiating cells that are highly similar to neural stem 109  cells (Wurdak et al, 2010). In the brain, P300 mediates the induction of the astrocyte lineage (Nakashima et al, 1999) and works with the transcription factor Zfp521 to directly activate early neural genes (Kamiya et al, 2011). Understanding the biological importance of the interaction of these adaptor proteins with NR2E1 would greatly advance our knowledge of NR2E1 mechanisms of action. Many nuclear receptors have been shown to cooperate to regulate gene transcription. It is then an interesting possibility that AR and NR2E1 could function in a complex to cooperatively regulate adult neurogenesis, as suggested by their interaction in the array. Supporting this idea, AR is expressed in cultured embryonic and adult neural stem cells from rat brain and negatively influences their proliferation in response to 19-nortestosterone  (Brannvall et al, 2005). Moreover, Dihydrotestosterone acts in the hippocampus to mediate mouse neurogenesis through AR (Okamoto et al, 2012). Importantly, we successfully affinity purified both P300 and AR by pull-down experiments, thus reproducing by an orthogonal experiment the results from the array. These results strongly suggest that the array is a reliable tool to identify novel nuclear receptor interactors. Intriguingly, the variant R274G did not have an effect on retinal development in vivo.  Since we observed decreased binding of R274G to atrophin1 in two orthogonal approaches, we suggest that NR2E1 protein conformation was indeed compromised by this arginine to glycine substitution. It is possible that in vivo there was a compensatory mechanism such as upregulation of NR2E1 or other co-regulators to compensate the lower affinity of NR2E1 towards its protein partners. In support of this idea, we observed that the R274G and R276Q amino acid changes did not completely abolish binding of NR2E1 to co-regulators in the array as seen in the pull-down experiments with atrophin1. 110  Alternatively, R274G could negatively affect the interaction of NR2E1 with some but not all co-regulators sparing those interactions important for retinal development. In addition, we used only the ligand binding domain of NR2E1 in the array but the mouse expresses the full length protein. It is then possible that NR2E1-coregulator complexes are more stable in the full length conformation. Similarly, some co-regulators could bind to NR2E1 through both its LBD and DBD as is the case of LSD1 (Yokoyama et al, 2008). In summary, by using a highly specific peptide array, we uncovered novel putative interactors for NR2E1 including the co-activator P300 and the nuclear receptor AR. Future experiments are needed to confirm and understand the biological significance of the novel interactions discovered herein.   111  Chapter 5 : General discussion The development of the nervous system depends on a highly complex interplay of extrinsic and intrinsic factors that we are only beginning to understand.  In order to design therapies for central nervous system diseases, especially those aimed at regeneration and repair of nervous tissues, we need to understand what factors and mechanisms play a role in the generation of neural cells and their integration into active functional circuits. NR2E1 is an orphan nuclear receptor that is crucial for the proliferation and maintenance of neural stem cells at different stages of development including neurogenic regions of the adult brain. Therefore, understanding NR2E1 cellular and molecular mechanisms of action would greatly contribute to our knowledge of neural stem cell behavior.  Eye development has been extensively studied due to its accessibility, involvement in human disease and the therapeutic promise that cellular and gene therapies offer for eye disorders. The retina, in particular, has proven to be an excellent model to study neural stem cell behavior, cellular fate determination and differentiation. A better understanding of the role of NR2E1 in eye development will certainly not only advance our knowledge of the principles that govern neural stem cell behavior but also contribute to the knowledge of potential therapeutic targets for ocular disorders. Specific knowledge on NR2E1 molecular mechanism of action could allow for pharmacological manipulation of neural stem cell behavior by directly regulating NR2E1 or its partners. In this thesis, I studied NR2E1 at the genetic, cellular and molecular levels in humans, mice and in vitro. I discovered novel roles of NR2E1 during retinal development and propose novel protein 112  partners for NR2E1. In my discussion, I will summarize the main findings of my thesis highlighting the strengths and weaknesses of the research presented, and propose future directions.  5.1 Testing the role of NR2E1 candidate mutations in human eye disease In the second chapter of this thesis I presented the results from a sequencing project where a screening for NR2E1 candidate mutations in a human population, consisting of patients with aniridia and other congenital ocular disorders, was carried out. This research was the first attempt to screen for NR2E1 candidate mutations in congenital eye disorders. We hypothesized that due to the important role that NR2E1 plays during eye development, and its genetic interaction with causative genes of eye pathology such as PAX2 (Yu et al, 2000) and PAX6 (Stenman et al, 2003), NR2E1 mutations could be involved in human eye disorders. Our results showed absence of mutations in NR2E1 in patients with aniridia. Furthermore, only one amino acid variation in a mother and son was identified which furthers our knowledge on the high genetic conservation of NR2E1. Although the number of patients with aniridia that were negative for PAX6 mutations used in this study was considerable, only a few cases of patients with other ocular disorders were included. This prevented us from concluding on the role of NR2E1 mutations in Peters' anomaly, Axenfeld-Rieger syndrome, Rieger syndrome, coloboma/congenital cataract, microphthalmia, and optic nerve malformation. Clearly, a bigger sample size is needed to study the role of NR2E1 mutations in these disorders. This study focused on patients with aniridia due to the role that PAX6 mutations play in this disorder. However, human eye disorders that present severe retinal dystrophy resembling the Nr2e1-null mouse eye phenotype would perhaps be more likely to have an underlying NR2E1 mutation than disorders involving mainly the anterior segment of the eye. I propose to study some of these disorders below. 113  5.1.1 Screening for candidate NR2E1 mutations in patients with optic nerve disorders and hyperplastic primary vitreous There is not a single human disorder that recapitulates very closely the Nr2e1-null phenotype in mice. However, NR2E1 could have a role in human disorders that affect both the retina and the brain in a similar way they do in mice. As tools for brain imaging become more accessible, we are seeing an increase in eye disorders that co-occur with brain abnormalities. Conversely, more than 30% of congenital disorders have an eye phenotype (Swaroop & Sieving, 2013). I propose that optic nerve malformations are candidate diseases where NR2E1 mutations may play a role. Optic malformations are diseases that present with excavation of the optic disc or optic nerve hypoplasia (Dutton, 2004). Nr2e1 is expressed very early in the optic stalk of mice and Nr2e1-null mice have hypoplastic optic nerves (Yu et al, 2000). Interestingly, optic nerve malformations can be caused by PAX6 mutations that impair PAX6-mediated transcriptional repression of the PAX2 promoter (Azuma et al, 2003), a downstream target of NR2E1 (Yu et al, 2000). Patients with optic coloboma, for example, have a reduction of the optic nerve thickness and may have brain malformations such as  gyration abnormalities and lateral ventricular dilatation (Denis et al, 2013). Decrease cortical thickness and enlarged ventricular area are features of Nr2e1-null mice (Young et al, 2002). The development of optic nerve coloboma is associated with impaired astrocyte differentiation in humans (Chu et al, 2001), which is also a feature of Nr2e1-null mice (Miyawaki et al, 2004).  Impaired regression of hyaloid vessels is another abnormality in Nr2e1-null mice (Uemura et al, 2006; Young et al, 2002). This feature is one of the main characteristics of persistent hyperplastic primary vitreous disorder. This disorder can also present with neurologic abnormalities including ataxia and microcephaly (Marshman et al, 1999) making it a good candidate disease for NR2E1 causative mutations. NR2E1 has been shown to be expressed in the cerebellum of humans so 114  cerebellar defects could also be explained by NR2E1 mutations in this disorder. Mutations in the transcription factor ATHO7 (Math5) have been found to cause hyperplastic primary vitreous (Prasov et al, 2012). Math5 has an important role in regulating proliferation of retinal precursors and the differentiation of ganglion cells. Math5-/- mice have persistent primary vitreous as a consequence of ganglion cell defects (Edwards et al, 2012). I showed in chapter 3 that ganglion cells in Nr2e1frc/frc retinas are highly reduced in numbers already at P7 suggesting that Nr2e1 could affect the eye vasculature partly through ganglion cells as happens in Math5-/- mice. Thus, the role of Nr2e1 in regulating mouse ganglion cell numbers, astrocyte differentiation and retinal vasculature suggest a possible role of NR2E1 mutations in human persistent primary vitreous disorders. 5.2 Understanding the role of Nr2e1 in mouse eye development Nr2e1-null mice have a complex eye phenotype involving many cell-types and progressive dystrophy which makes the identification of the primary function of Nr2e1 very challenging. In my third chapter I characterized the retinas of Nr2e1-null mice in their cellular composition at an early developmental time-point where the eye is neither fully differentiated nor subjected to the excessive apoptosis typical of Nr2e1-null phenotype. I also looked for cell-autonomous and non-cell-autonomous roles of Nr2e1 in wt?frc chimeric retinas. I hypothesized that ganglion and amacrine cells would  e overre resented and  i olar and   ller glia cells underrepresented in Nr2e1-null retinas due to the premature neurogenesis observed in Nr2e1-null mice (Zhang et al, 2006). I also hypothesized that signaling from wild-type cells could rescue some of the Nr2e1-null eye phenotypes in wt?frc chimeras based on the role that extracellular signaling plays during eye development, the complex nature of Nr2e1-null phenotypes and the known non-cell-autonomous role of Nr2e1 in regulating NSC proliferation through the signaling molecule Wnt7a (Qu et al, 2010).  115  I found that the proportions of many retinal cell types at P7 greatly differed from the one expected revealing important roles of Nr2e1 in regulating cell development or differentiation. Of great importance are the Nr2e1-null   ller glia cell numbers, which were comparable to those of wild-type  ller glia cells instead of  eing reduced. This strongly suggested a role of Nr2e1 in preventing   ller glia differentiation.  I also observed roles of Nr2e1 that appear independent from its role in premature neurogenesis. First, I noted a role of Nr2e1 in the maturation of  ller glia and specification of a subpopulation of amacrine cells; and second, I observed a role of Nr2e1 in the regulation of synaptic strata formation by inner nuclear neurons. Furthermore, by looking at the chimeras, previously known phenotypes of the Nr2e1-null mice were found to be non-cell-autonomous while new phenotypes described in Chapter 3 were found to be cell-autonomous or mediated by short-range mechanism within cells derived from the same clone. For example, a reduction in bipolar and rod numbers was still evident in Nr2e1-null clones in wt?frc chimeras suggesting that the proliferative capabilities of RPC during development were not rescued by signaling molecules from wild-type cells.  The significance of this research lies on newly discovered roles of Nr2e1 in cell maturation and lamination of the retina along with a better characterization of the cell-autonomous and non-cell-autonomous roles of Nr2e1 involved in retinal development. An important caveat of this research is the lack of more representative chimeric animals with a low contribution of mutant cells. These chimeras would help us to better distinguish individual clones of mutant cells and thus better assess their composition and variability in a wild-type environment.  In addition, lack of information on the expression pattern of Nr2e1 in different subpopulation of retinal precursors and mature cells prevented us from having a better mechanistic interpretation of our results. Cell-specific 116  overexpression or underexpression of Nr2e1 in the retina would certainly help to clarify the cell-autonomous roles of Nr2e1 in the retina.  5.2.1 Understanding the role of Nr2e1  n  ller  l a  Although we and others have observed expression of Nr2e1 in mouse   ller glia by in situ hybridization (ISH) and promoter-driven LacZ expression (Miyawaki et al, 2004; Schmouth et al, 2012a), it is possible that Nr2e1 is not being translated. Furthermore, Nr2e1 may not have a role in   ller glia of the uninjured retina and remain silenced by microRNAs. This is especially important in light of many studies that have shown the importance of microRNAs during retinal development (Decembrini et al, 2009).   on retinal in ury,   ller glia can  ecome retinal  rogenitors by a process known as dedifferentiation. An interesting study in fish has shown that microRNA let-7 represses e  ression of genes involved in  ller glia dedifferentiation such as, ascl1a, hs d1, lin-28, oct4, pax6b and c-myc. These genes exhibit basal expression in the uninjured retina and let-7 can inhibit their expression preventing premature M?ller glia dedifferentiation (Ramachandran et al, 2010). As a cell cycle regulator of NSCs, Nr2e1 could potentially participate in the process of dedifferentiation of   ller glia. Interestingly, Nr2e1 is also regulated by microRNA let-7d in adult mouse NSC and the regulation seen in fish could also happen in mouse   ller glia. Thus, an assessment of Nr2e1 protein expression is thus necessary. In my third chapter I showed that Nr2e1frc/frc   ller glia misexpress the transcription factor Brn3a and have a defect in planar cell polarity. I suggested this is a cell-autonomous effect of Nr2e1 in mature   ller glia. However, an effect exerted by other cell-types on   ller glia cannot  e completely ruled out. In addition, we do not know if Nr2e1 has only a developmental role in 117  immature   ller glia or  lays an active role in adult   ller glia.     etter characteri ation of the role of  r2e1 in  ller glia is then necessary.  One way we can  egin to understand the role of   2E1 in  ller glia is  y its downregulation or overexpression in these cells using a cell-type-specific promoter. This can be achieved by using an inducible Cre line to remove or overexpress Nr2e1. Alternatively, we can use a promoter that is activated e clusively in  ller glia and deliver Nr2e1 cDNA or a SiRNA via virus infection. The Simpson Laboratory has recently designed a MiniPromoter of NR2E1 that drives expression of EGFP exclusively in  ller glial cells  y   V9 infection. This system could be very helpful to elucidate the role of Nr2e1 s ecifically in  ller glial cells.  5.2.2 Testing the role of Nr2e1 in repressing the glial fate in ganglion cells Nr2e1-null   ller glia misexpress Brn3a, a transcription factor expressed only in sensory neurons including ganglion cells of the retina (Jain et al, 2012). Nr2e1-null retinas also have higher num ers of   ller glia than e  ected from premature neurogenesis. This implies that Nr2e1 may be important to prevent the   ller glia fate-switch of ganglion cell precursors. Various studies have shown that the terminal differentiation of retinal cells is an active process requiring negative regulation that stabilizes fate specification. Interestingly, genes involved in the maturation of ganglion cells have been shown to be particularly important to maintain the ganglion cell identity. For example, Dlx1/Dlx2 null mice have reduced numbers of late-born ganglion cells, increase apoptosis of ganglion cells and ectopic expression of the transcription factor Crx, important for photoreceptor development in cells of the ganglion cell layer and inner nuclear layer. These results suggest that Dlx1 and Dlx2 are important for the final commitment to the ganglion phenotype and that their absence causes an aberrant cell fate switch of RGC progenitors to the photoreceptor 118  lineage (de Melo et al, 2005). Similarly, in Brn3b-null mice ganglion precursors switch fate to the amacrine and bipolar lineage (Qiu et al, 2008).  Interestingly, Dlx2 is downregulated in the absence of Nr2e1 in postnatal mouse brain (Obernier et al, 2011) suggesting that Nr2e1 could regulate the final commitment of ganglion cells partly to Dlx2. To test the hy othesis that ganglion  recursors switch fate to the   ller glia  henoty e, first it is necessary to establish whether   ller glia are born at the time where ganglion cells are normally specified. Ganglion cells are specified at early embryonic time-points beginning at E11 and peaking at E15 (Gan et al, 1996). Bromodeoxyuridine (BrdU) administration to pregnant females at E15 could be useful to this purpose since BrdU incorporates into newly synthesized DNA and can be detected if the cell does not further divide. Analysis of BrdU incorporation in  ller glia at P7 would allow determining whether   ller glia e ited the cell cycle at the same time as ganglion cells. In addition, studying the expression of Nr2e1 in ganglion precursors would be useful. This can be done by using the NR2E1-lacZ mouse strain we studied in chapter 3. Furthermore, overexpressing Nr2e1 specifically in ganglion cell precursors of the Nr2e1-null retinas would be useful to establish if Nr2e1 acts in those cells to prevent their differentiation to  ller glia. This can be achieved by looking at the expression of Brn3a in postnatal  ller glia of na?ve and transduced retinas of Nr2e1-null mice.    5.2.3 Clarifying the role of Nr2e1 in apoptosis during retinal development In chapter 3, I showed that adult chimeras have thicker retinas when more than 34% of wild-type cells are present. This suggests that wild-type cells could be restoring the proliferative behavior of RPC or the survival of retinal cells. Since we observed that RPC generated less bipolar and rods cells in chimeras, it is possible that the restoration of retinal thickness exerted by wild-type cells is due to a rescue of cell death and not to changes in proliferation and cell-fate decisions of RPCs. Apoptosis 119  is highly pronounced in Nr2e1-null retinas (Zhang et al, 2006). Looking at levels of apoptosis in the chimeras by Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assays will be a way of clarifying whether there is less apoptosis in Nr2e1frc/frc cells in wt?frc chimeras. In addition, counting amacrine cells in adult chimeric retinas will help to determine if these cells survive better in the chimeric environment. 5.2.4 Testing the role of Nr2e1 in amacrine development We observed that not only the population of amacrine cells was expanded but also that the excess of amacrine cells expressed the glycine transporter 1, a marker of glycinergic amacrines.  Interestingly,  amacrine subclass identity and soma positioning are determined at their time of birth with glycinergic amacrines developing after GABAergic amacrines (Voinescu et al, 2009). It is then possible that in Nr2e1frc/frc retinas more amacrine precursors exited the cell-cycle at the time when glycinergic amacrine cells are normally specified and thus generated an excess of these cells. In order to further understand if Nr2e1 has a role in regulating the timing of amacrine cell birth, BrdU experiments can be performed whereby injections of BrdU are given to pregnant females at various time points. BrdU injections can also be given at postnatal time-points before P7 thus covering most of the differentiation window. Co-staining of BrdU and syntaxin, a pan amacrine marker, in P7 retinas would provide information regarding when amacrines are specified in Nr2e1frc/frc retinas.  It would also be interesting to study whether Nr2e1 overexpression causes a reduction in the glycinergic amacrine subpopulation. The Simpson Laboratory has generated various NR2E1-overexpressor mouse strains that could be used to undertake these studies. 120  5.2.5 Identification of differentially expressed neurite guiding cues in Nr2e1frc/frc retinas  An exciting finding from chapter 3 is that Nr2e1 may have a role in constraining the neurites of inner nuclear neurons of the retina to the inner plexiform layer. Cell-adhesion and guidance molecules have a crucial role in neurite growth from neurons (Kiryushko et al, 2004). Thus, Nr2e1 may regulate the expression of some of these signaling cues during development. In order to study if the expression of some of these molecules is deregulated in Nr2e1frc/frc retinas, quantitative polymerase chain reaction (qPCR) and western blot for candidate cell adhesion molecules and guidance molecules can be performed in Nr2e1frc/frc retinas.  In chapter 3 we showed increased levels of activated beta-catenin in Nr2e1frc/frc retinas that suggest a defect in the N-cadherin/beta-catenin pathway which controls cell-adhesion (Masai et al, 2003). However, while N-cadherin null-mice have retinal lamination defects, they do not have a clear ectopic plexiform layer such as the one observed in Nr2e1frc/frc retinas. This suggests that additional mechanisms involved in neurite organization are dysregulated in Nr2e1frc/frc retinas. There are two strong candidate molecules that could be dysregulated in Nr2e1frc/frc retinas. Both, Fat3- and Sema5b-null mice show an ectopic layer in the INL (Deans et al, 2011; Matsuoka et al, 2011). In addition, R-cadherin has been shown to be upregulated in Nr2e1frc/frc retinas (Zhang et al, 2006). A screening for all these molecules should be then carried out in Nr2e1frc/frc retinas. 5.2.6 Studying cell adhesion and guidance molecules in Nr2e1-null mouse brain Although the lamination defect that we observed in Nr2e1-null retinas could be specific to retinal tissue, we cannot rule out that Nr2e1 has a direct role in regulating a signaling cue molecule expressed in the brain. As shown in chapter 3, we observed that Nr2e1-null retinas have increased levels of activated ?-catenin, which binds to cadherins to regulate cell adhesion (Hierholzer & 121  Kemler, 2010). It is  ossi le that the activation of ?-catenin seen in Nr2e1-mutant retinas is a consequence of defects in cadherin expression. It would be interesting to study the expression of N-cadherin and other cell-adhesion molecules that could be deregulated in Nr2e1-null mice in the brain. This could be done by qPCR and western blot as stated in the previous section. In support of this idea, cell-adhesion molecules have been shown to be important for neural stem cell behavior and knockdown of N-cadherin in mouse cortical progenitors causes premature neuronal differentiation (Zhang et al, 2010), a phenotype seen in Nr2e1-null mice. 5.2.7 Coupling planar cell polarity with neurite inhibition through Nr2e1 and atrophin1 There are two phenotypes in the Nr2e1-null mice, described in Chapter 3, that lead to retinal disorgani ation. One is the mislocali ation of   ller glia and the other one is the formation of an ectopic synaptic layer. Interestingly, these two events could be coupled through a molecule that regulates both planar cell polarity and synapse formation. Fat3-null mice form an ectopic synaptic layer similar to the one I described here (Deans et al, 2011). Interestingly, the Fat family of proteins has been shown to be involved in planar cell polarity (Saburi et al, 2012) through atrophin1, a known binding partner of Nr2e1 (Wang et al, 2006). Fat proteins bind to atrophin to control cell polarity (Saburi et al, 2012). It would be interesting to test whether Nr2e1 regulates this complex in   ller glia and amacrine precursors to regulate cell polarity and lamination, respectively. It is possible that Nr2e1 is necessary to stabilize the Fat3/Atrophin1 complex through its interaction with atrophin1 in these cells. Pull-down experiments with GST-NR2E1 similar to the ones shown in Chapter 4 could be performed with retinal lysates of postnatal retinas to observe if Fat3 and atrophin1 are pulled down with NR2E1.  122  5.3 Unraveling novel molecular mechanisms of action of NR2E1  In my fourth chapter I presented results of a screening for candidate binding partners of NR2E1. My hypothesis was that NR2E1 interacts with more co-regulators than the ones so far identified.  In this study, I found that the ligand binding domain (LBD) of NR2E1 interacts with 18 novel co-regulators in a peptide array. I also confirmed the binding of NR2E1 to two targets, androgen receptor and P300, by pull down experiments. Furthermore, two single NR2E1 point variants, R274G and R276Q, showed decreased binding to the co-regulators in the array although R274G did not affect gross retinal development in vivo. This study contributes to the understanding of the molecular mechanisms of action of NR2E1 since many of the co-regulators, including co-activators, found here to interact with NR2E1 play important roles in neural stem cell biology. In order to validate the array, additional targets have to be studied by orthogonal approaches such as pull-down experiments. More importantly, the targets have to be validated at the functional level to confirm that the binding between NR2E1 and a specific co-regulator happens within the cell environment and is capable of modulating the function of either protein involved. This validation is especially important in light of the lack of gross retinal phenotype observed in mice carrying the R274G variant that disrupts the majority of binding to co-regulators in the protein array. 5.3.1 Detail characterization of R274G in the eye In this study we observed that the NR2E1 variant protein R274G decreased the binding of NR2E1 to co-regulators in the array. We further confirmed this by pull down experiments between R274G and atrophin1. Thus, it was very surprising that this variant did not generate a phenotype in mice carrying this variant as a single copy. There are two main explanations for these phenomena: 1) a compensation mechanism that increased the expression of NR2E1 or a co-regulator, and 2) a difference in stability of the NR2E1/co-regulator complex between the array and the mouse.  123  In support of the first idea, heterozygous mice for Nr2e1 do not display an overt brain and eye phenotype but do have defects in neural stem cell (NSC) behavior that are detected at the cellular level only at early time points. Heterozygous mice have premature neurogenesis, and intermediate numbers of neurons ranging between wild-type and mutant mice. However, this was not observed after E11.5 and does not affect final brain size (Roy et al, 2004). Heterozygous adult neural stem cells also have decrease proliferation (Liu et al, 2008). Thus R274G can be sufficient to generate a normal retina but cause other defects that are more subtle.  A better characterization of the retina could make use of the specific phenotypes found in chapter 3.  or e am le, loo  for amacrine cell num er,  ller glia mislocalization and ectopic synaptic layer in the inner retina. Alternatively, RPC proliferation could be assessed. Although, it would also be interesting to study the brain in mice carrying the R274G variant, these mice do not express NR2E1 appropriately in various brain regions making them not suitable for this kind of study (Schmouth et al, 2012a). 5.3.2 Confirming the in vitro binding of NR2E1 to targets in the array that are important for neural stem cell behavior Many of the putative co-regulators found in the array play an important function in NSC proliferation or cell fate specification. These co-regulators should be studied further in other in vitro assays using the full length proteins to determine a real binding. We already confirmed binding of P300 and androgen receptor in the array by pull-down experiments. Other proteins of interest as mentioned in chapter 4 are Prox1, RetCoR, NIRIP1 and TRRAP. Prox1 and RetCoR are the most exciting targets due to their known role in NSC differentiation and strong evidence of their possible interaction with NR2E1.  124  Ectopic expression of Prox1 induces premature differentiation of NSC. Prox1 is also  important for the generation of new neurons in the dentate gyrus (Lavado et al, 2010). In Drosophila tailless directly represses prospero promoter (homolog of human PROX1) (Kurusu et al, 2009). Interestingly, NR2F2 that shares 42% amino acid identity with NR2E1 (Monaghan et al, 1995), forms heterodimers with PROX1 to regulate endothelial cell identity (Aranguren et al, 2013). Thus, it is likely that there is a biological significance for the interaction of NR2E1 and PROX1. RetCoR is essential for NR2E3 transcriptional repression function in retinal precursor cells. The fact that NR2E3 is the closest nuclear receptor to NR2E1 makes the interaction between NR2E1 and RetCoR more likely. 5.3.3 Testing the functional and biological significance of targets in the array The interaction observed between NR2E1 and co-regulators in the array and pull-down experiments should be followed by a functional assay to test the ability of different co-repressors to affect the function of NR2E1. A relatively simple and straightforward approach is to use a luciferase reporter assay whereby a promoter or a minimal response element for NR2E1 drives luciferase. Co-transfection in vitro of NR2E1 and the co-regulator being tested in a commonly used cell line such as HEK293 could reveal if the co-regulator enhances or decreases the activity of NR2E1. In the case of transcription factors such as androgen receptor and Prox1, a promoter or response element specific for them could be used since NR2E1 could, in this case, affect their activity. Once the functional significance has been identified, a biological significance can be studied. To do this, neural stem cells that are wild-type or null for NR2E1 can be transfected with the co-regulator and changes in transcription of a downstream gene of NR2E1 can be assessed. To further confirm that the difference between the cell lines seen is due to NR2E1, transient transfection of NR2E1 can 125  be performed along with the co-regulator in Nr2e1-null cells. These experiments could be performed in neural stem cells obtained from embryonic stem cell (ESC) differentiation in vitro.  I have established such an in vitro neural differentiation assay using mouse ESC and observed that neural stem cells express Nr2e1 in this system. The experiments mentioned above could be performed using this assay and the Nr2e1 wild-type and null ESC that I developed for Chapter 3. 5.3.4 The peptide array as a tool to screen for drugs that modulate NR2E1 Nuclear receptors have attracted a lot of scientific interest due to their potential as pharmacological targets. A small molecule that fits in the hydrophobic pocket of the LBD could modify the nuclear receptor conformation and change its function. This characteristic has been exploited extensively in steroid hormone receptors such as Estrogen receptor (Cirillo et al, 2013). Furthermore, small molecules can work as modulators where they enhance some functions of the receptor but inhibit others (Cirillo et al, 2013). In only a few years many ligands for previously believed orphan nuclear receptors have been found (Burris et al, 2012). NR2E1 has a ligand binding domain most similar to NR2F2. Interestingly, not until 5 years ago NR2F2 was also considered an orphan nuclear receptor. In 2008, Kruse and collaborators reported that above physiological concentrations of retinoic acids are able to promote NR2F2 to recruit co-activators and activate an NR2F2 reporter construct (Kruse et al, 2008). Thus it is possible that NR2E1 could also respond to natural or synthetic ligands.  Manipulating NR2E1 function through a small molecule could be of great scientific and clinical importance to regulate neural stem cell behaviour. The peptide array represents a great tool for screening for a ligand for NR2E1 as we have seen that NR2E1 can bind co-regulators in this array. Atrophin has been already shown to be a partner of NR2E1 by other groups and there is a possibility that other co-regulators in the array could be physiological interactors as well.  Based on the idea 126  that a ligand would induce a conformational change in NR2E1 and affect its ability to bind to different co-regulators, a chemical library could be added to NR2E1 lysates in the array to screen for differences in binding. Furthermore, if the crystal structure of NR2E1 is resolved, a synthetic ligand could be designed in the future that fits in the ligand binding pocket of NR2E1. 5.4 Conclusion The results presented in this thesis suggest novel cellular mechanisms by which NR2E1 can affect retinogenesis. This work also identified novel putative protein partners for NR2E1 which could function with NR2E1 to regulate gene transcription and may be important in neural stem cells and retinal progenitors. This study thus furthers our understanding on the roles of NR2E1 in human and mouse eye development and uncovers novel roles of NR2E1 that can be pursued in the future.   127  References  Abouzeid H, Youssef MA, ElShakankiri N, Hauser P, Munier FL, Schorderet DF (2009) PAX6 aniridia and interhemispheric brain anomalies. Molecular vision 15: 2074-2083  Abrahams BS, Kwok MC, Trinh E, Budaghzadeh S, Hossain SM, Simpson EM (2005) Pathological aggression in "fierce" mice corrected by human nuclear receptor 2E1. J Neurosci 25: 6263-6270  Abrahams BS, Mak GM, Berry ML, Palmquist DL, Saionz JR, Tay A, Tan YH, Brenner S, Simpson EM, Venkatesh B (2002) Novel vertebrate genes and putative regulatory elements identified at kidney disease and NR2E1/fierce loci. Genomics 80: 45-53  Adler R, Canto-Soler MV (2007) Molecular mechanisms of optic vesicle development: complexities, ambiguities and controversies. Developmental biology 305: 1-13  Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS, Sunyaev SR (2010) A method and server for predicting damaging missense mutations. Nat Methods 7: 248-249  Agathocleous M, Locker M, Harris WA, Perron M (2007) A general role of hedgehog in the regulation of proliferation. Cell Cycle 6: 156-159  Alexiades MR, Cepko C (1996) Quantitative analysis of proliferation and cell cycle length during development of the rat retina. Dev Dyn 205: 293-307  Anchan RM, Reh TA, Angello J, Balliet A, Walker M (1991) EGF and TGF-alpha stimulate retinal neuroepithelial cell proliferation in vitro. Neuron 6: 923-936  Andersson U, Scarpulla RC (2001) Pgc-1-related coactivator, a novel, serum-inducible coactivator of nuclear respiratory factor 1-dependent transcription in mammalian cells. Mol Cell Biol 21: 3738-3749  Antonarakis SE (1998) Recommendations for a nomenclature system for human gene mutations. Nomenclature Working Group. Hum Mutat 11: 1-3  Aranguren XL, Beerens M, Coppiello G, Wiese C, Vandersmissen I, Lo Nigro A, Verfaillie CM, Gessler M, Luttun A (2013) COUP-TFII orchestrates venous and lymphatic endothelial identity by homo- or hetero-dimerisation with PROX1. J Cell Sci 126: 1164-1175  128  Arikawa A, Yoshida S, Yoshikawa H, Ishikawa K, Yamaji Y, Arita RI, Ueno A, Ishibashi T (2010) Case of novel PITX2 gene mutation associated with Peters' anomaly and persistent hyperplastic primary vitreous. Eye (Lond) 24: 391-393  Askew EB, Bai S, Hnat AT, Minges JT, Wilson EM (2009) Melanoma antigen gene protein-A11 (MAGE-11) F-box links the androgen receptor NH2-terminal transactivation domain to p160 coactivators. J Biol Chem 284: 34793-34808  Ayuso C, Millan JM (2010) Retinitis pigmentosa and allied conditions today: a paradigm of translational research. Genome Med 2: 34  Azuma N, Yamaguchi Y, Handa H, Tadokoro K, Asaka A, Kawase E, Yamada M (2003) Mutations of the PAX6 gene detected in patients with a variety of optic-nerve malformations. Am J Hum Genet 72: 1565-1570  Badea TC, Cahill H, Ecker J, Hattar S, Nathans J (2009) Distinct roles of transcription factors brn3a and brn3b in controlling the development, morphology, and function of retinal ganglion cells. Neuron 61: 852-864  Badea TC, Williams J, Smallwood P, Shi M, Motajo O, Nathans J (2012) Combinatorial expression of Brn3 transcription factors in somatosensory neurons: genetic and morphologic analysis. J Neurosci 32: 995-1007  Bamiou DE, Musiek FE, Sisodiya SM, Free SL, Davies RA, Moore A, van Heyningen V, Luxon LM (2004) Deficient auditory interhemispheric transfer in patients with PAX6 mutations. Ann Neurol 56: 503-509  Bassett EA, Wallace VA (2012) Cell fate determination in the vertebrate retina. Trends Neurosci 35: 565-573  Baum L, Pang CP, Fan DS, Poon PM, Leung YF, Chua JK, Lam DS (1999) Run-on mutation and three novel nonsense mutations identified in the PAX6 gene in patients with aniridia. Hum Mutat 14: 272-273  Berker N, Alanay Y, Elgin U, Volkan-Salanci B, Simsek T, Akarsu N, Alikasifoglu M (2009) A new autosomal dominant Peters' anomaly phenotype expanding the anterior segment dysgenesis spectrum. Acta Ophthalmol 87: 52-57  Bessho T, Sancar A (2000) Human DNA damage checkpoint protein hRAD9 is a 3' to 5' exonuclease. J Biol Chem 275: 7451-7454  129  Biesecker LG, Mullikin JC, Facio FM, Turner C, Cherukuri PF, Blakesley RW, Bouffard GG, Chines PS, Cruz P, Hansen NF, Teer JK, Maskeri B, Young AC, Manolio TA, Wilson AF, Finkel T, Hwang P, Arai A, Remaley AT, Sachdev V, Shamburek R, Cannon RO, Green ED (2009) The ClinSeq Project: piloting large-scale genome sequencing for research in genomic medicine. Genome Res 19: 1665-1674  Brannvall K, Bogdanovic N, Korhonen L, Lindholm D (2005) 19-Nortestosterone influences neural stem cell proliferation and neurogenesis in the rat brain. Eur J Neurosci 21: 871-878  Brzezinski JAt, Prasov L, Glaser T (2012) Math5 defines the ganglion cell competence state in a subpopulation of retinal progenitor cells exiting the cell cycle. Dev Biol 365: 395-413  Burmeister M, Novak J, Liang MY, Basu S, Ploder L, Hawes NL, Vidgen D, Hoover F, Goldman D, Kalnins VI, Roderick TH, Taylor BA, Hankin MH, McInnes RR (1996) Ocular retardation mouse caused by Chx10 homeobox null allele: impaired retinal progenitor proliferation and bipolar cell differentiation. Nat Genet 12: 376-384  Burris TP, Busby SA, Griffin PR (2012) Targeting orphan nuclear receptors for treatment of metabolic diseases and autoimmunity. Chem Biol 19: 51-59  Canto-Soler MV, Adler R (2006) Optic cup and lens development requires Pax6 expression in the early optic vesicle during a narrow time window. Dev Biol 294: 119-132  Cantrup R, Dixit R, Palmesino E, Bonfield S, Shaker T, Tachibana N, Zinyk D, Dalesman S, Yamakawa K, Stell WK, Wong RO, Reese BE, Kania A, Sauve Y, Schuurmans C (2012) Cell-type specific roles for PTEN in establishing a functional retinal architecture. PLoS One 7: e32795  Casarosa S, Amato MA, Andreazzoli M, Gestri G, Barsacchi G, Cremisi F (2003) Xrx1 controls proliferation and multipotency of retinal progenitors. Mol Cell Neurosci 22: 25-36  Castagnoli L, Costantini A, Dall'Armi C, Gonfloni S, Montecchi-Palazzi L, Panni S, Paoluzi S, Santonico E, Cesareni G (2004) Selectivity and promiscuity in the interaction network mediated by protein recognition modules. FEBS Lett 567: 74-79  Cavailles V, Dauvois S, L'Horset F, Lopez G, Hoare S, Kushner PJ, Parker MG (1995) Nuclear factor RIP140 modulates transcriptional activation by the estrogen receptor. EMBO J 14: 3741-3751  Cayouette M, Barres BA, Raff M (2003) Importance of intrinsic mechanisms in cell fate decisions in the developing rat retina. Neuron 40: 897-904  130  Cepko CL, Austin CP, Yang X, Alexiades M, Ezzeddine D (1996) Cell fate determination in the vertebrate retina. Proc Natl Acad Sci U S A 93: 589-595  Cerpa W, Godoy JA, Alfaro I, Farias GG, Metcalfe MJ, Fuentealba R, Bonansco C, Inestrosa NC (2008) Wnt-7a modulates the synaptic vesicle cycle and synaptic transmission in hippocampal neurons. J Biol Chem 283: 5918-5927  Chavarria-Soley G, Michels-Rautenstrauss K, Caliebe A, Kautza M, Mardin C, Rautenstrauss B (2006) Novel CYP1B1 and known PAX6 mutations in anterior segment dysgenesis (ASD). J Glaucoma 15: 499-504  Chen JD, Evans RM (1995) A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377: 454-457  Chen Y, Bedell M, Zhang K (2010) Age-related macular degeneration: genetic and environmental factors of disease. Mol Interv 10: 271-281  Chow RL, Lang RA (2001) Early eye development in vertebrates. Annual review of cell and developmental biology 17: 255-296  Christie BR, Li AM, Redila VA, Booth H, Wong BK, Eadie BD, Ernst C, Simpson EM (2006) Deletion of the nuclear receptor Nr2e1 impairs synaptic plasticity and dendritic structure in the mouse dentate gyrus. Neuroscience 137: 1031-1037  Chu Y, Hughes S, Chan-Ling T (2001) Differentiation and migration of astrocyte precursor cells and astrocytes in human fetal retina: relevance to optic nerve coloboma. FASEB J 15: 2013-2015  Ciralsky J, Colby K (2007) Congenital corneal opacities: a review with a focus on genetics. Semin Ophthalmol 22: 241-246  Cirillo F, Nassa G, Tarallo R, Stellato C, De Filippo MR, Ambrosino C, Baumann M, Nyman TA, Weisz A (2013) Molecular mechanisms of selective estrogen receptor modulator activity in human breast cancer cells: identification of novel nuclear cofactors of antiestrogen-ERalpha complexes by interaction proteomics. J Proteome Res 12: 421-431  Collinson JM, Quinn JC, Buchanan MA, Kaufman MH, Wedden SE, West JD, Hill RE (2001) Primary defects in the lens underlie complex anterior segment abnormalities of the Pax6 heterozygous eye. Proc Natl Acad Sci U S A 98: 9688-9693  131  Corso-Diaz X, Borrie AE, Bonaguro R, Schuetz JM, Rosenberg T, Jensen H, Brooks BP, Macdonald IM, Pasutto F, Walter MA, Gronskov K, Brooks-Wilson A, Simpson EM (2012) Absence of NR2E1 mutations in patients with aniridia. Mol Vis 18: 2770-2782  Corso-D?az X, Simpson E (2013) Nr2e1 regulates cellular development and lamination during retinogenesis. In preparation  Cvekl A, Tamm ER (2004) Anterior eye development and ocular mesenchyme: new insights from mouse models and human diseases. Bioessays 26: 374-386  Daiger SP (2004) Identifying retinal disease genes: how far have we come, how far do we have to go? Novartis Found Symp 255: 17-27; discussion 27-36, 177-178  Daniel A, Dumstrei K, Lengyel JA, Hartenstein V (1999) The control of cell fate in the embryonic visual system by atonal, tailless and EGFR signaling. Development 126: 2945-2954  Dansault A, David G, Schwartz C, Jaliffa C, Vieira V, de la Houssaye G, Bigot K, Catin F, Tattu L, Chopin C, Halimi P, Roche O, Van Regemorter N, Munier F, Schorderet D, Dufier JL, Marsac C, Ricquier D, Menasche M, Penfornis A, Abitbol M (2007) Three new PAX6 mutations including one causing an unusual ophthalmic phenotype associated with neurodevelopmental abnormalities. Molecular vision 13: 511-523  Das G, Clark AM, Levine EM (2012) Cyclin D1 inactivation extends proliferation and alters histogenesis in the postnatal mouse retina. Dev Dyn 241: 941-952  de Melo J, Du G, Fonseca M, Gillespie LA, Turk WJ, Rubenstein JL, Eisenstat DD (2005) Dlx1 and Dlx2 function is necessary for terminal differentiation and survival of late-born retinal ganglion cells in the developing mouse retina. Development 132: 311-322  de Melo J, Qiu X, Du G, Cristante L, Eisenstat DD (2003) Dlx1, Dlx2, Pax6, Brn3b, and Chx10 homeobox gene expression defines the retinal ganglion and inner nuclear layers of the developing and adult mouse retina. J Comp Neurol 461: 187-204  Deans MR, Krol A, Abraira VE, Copley CO, Tucker AF, Goodrich LV (2011) Control of neuronal morphology by the atypical cadherin Fat3. Neuron 71: 820-832  Decembrini S, Bressan D, Vignali R, Pitto L, Mariotti S, Rainaldi G, Wang X, Evangelista M, Barsacchi G, Cremisi F (2009) MicroRNAs couple cell fate and developmental timing in retina. Proc Natl Acad Sci U S A 106: 21179-21184  132  Del Bene F, Wehman AM, Link BA, Baier H (2008) Regulation of neurogenesis by interkinetic nuclear migration through an apical-basal notch gradient. Cell 134: 1055-1065  Denis D, Girard N, Levy-Mozziconacci A, Berbis J, Matonti F (2013) [Ocular coloboma and results of brain MRI: preliminary results]. J Fr Ophtalmol 36: 210-220  Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A (1999) Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97: 703-716  Doward W, Perveen R, Lloyd IC, Ridgway AE, Wilson L, Black GC (1999) A mutation in the RIEG1 gene associated with Peters' anomaly. J Med Genet 36: 152-155  Dubin MW (1970) The inner plexiform layer of the vertebrate retina: a quantitative and comparative electron microscopic analysis. J Comp Neurol 140: 479-505  Dubois-Dauphin M, Poitry-Yamate C, de Bilbao F, Julliard AK, Jourdan F, Donati G (2000) Early postnatal Muller cell death leads to retinal but not optic nerve degeneration in NSE-Hu-Bcl-2 transgenic mice. Neuroscience 95: 9-21  Duclot F, Lapierre M, Fritsch S, White R, Parker MG, Maurice T, Cavailles V (2012) Cognitive impairments in adult mice with constitutive inactivation of RIP140 gene expression. Genes Brain Behav 11: 69-78  Dudley AT, Robertson EJ (1997) Overlapping expression domains of bone morphogenetic protein family members potentially account for limited tissue defects in BMP7 deficient embryos. Dev Dyn 208: 349-362  Duester G (2009) Keeping an eye on retinoic acid signaling during eye development. Chemico-biological interactions 178: 178-181  Dutton GN (2004) Congenital disorders of the optic nerve: excavations and hypoplasia. Eye (Lond) 18: 1038-1048  Dyer MA, Cepko CL (2000) p57(Kip2) regulates progenitor cell proliferation and amacrine interneuron development in the mouse retina. Development 127: 3593-3605  Dyer MA, Cepko CL (2001) p27Kip1 and p57Kip2 regulate proliferation in distinct retinal progenitor cell populations. J Neurosci 21: 4259-4271  133  Dyer MA, Livesey FJ, Cepko CL, Oliver G (2003) Prox1 function controls progenitor cell proliferation and horizontal cell genesis in the mammalian retina. Nat Genet 34: 53-58  Edward D, Al Rajhi A, Lewis RA, Curry S, Wang Z, Bejjani B (2004) Molecular basis of Peters anomaly in Saudi Arabia. Ophthalmic Genet 25: 257-270  Edwards MM, McLeod DS, Li R, Grebe R, Bhutto I, Mu X, Lutty GA (2012) The deletion of Math5 disrupts retinal blood vessel and glial development in mice. Experimental eye research 96: 147-156  Ekstrom P, Sanyal S, Narfstrom K, Chader GJ, van Veen T (1988) Accumulation of glial fibrillary acidic protein in Muller radial glia during retinal degeneration. Invest Ophthalmol Vis Sci 29: 1363-1371  Elmi M, Matsumoto Y, Zeng ZJ, Lakshminarasimhan P, Yang W, Uemura A, Nishikawa S, Moshiri A, Tajima N, Agren H, Funa K (2010) TLX activates MASH1 for induction of neuronal lineage commitment of adult hippocampal neuroprogenitors. Mol Cell Neurosci 45: 121-131  Eng LF (1985) Glial fibrillary acidic protein (GFAP): the major protein of glial intermediate filaments in differentiated astrocytes. J Neuroimmunol 8: 203-214  Escher P, Gouras P, Roduit R, Tiab L, Bolay S, Delarive T, Chen S, Tsai CC, Hayashi M, Zernant J, Merriam JE, Mermod N, Allikmets R, Munier FL, Schorderet DF (2009) Mutations in NR2E3 can cause dominant or recessive retinal degenerations in the same family. Hum Mutat 30: 342-351  Esteve P, Bovolenta P (2006) Secreted inducers in vertebrate eye development: more functions for old morphogens. Current opinion in neurobiology 16: 13-19  Estruch SB, Buzon V, Carbo LR, Schorova L, Luders J, Estebanez-Perpina E (2012) The oncoprotein BCL11A binds to orphan nuclear receptor TLX and potentiates its transrepressive function. PLoS One 7: e37963  Faletra F, Athanasakis E, Minen F, Fornasier F, Marchetti F, Gasparini P (2011) Vertebral defects in patients with Peters plus syndrome and mutations in B3GALTL. Ophthalmic Genet 32: 256-258  Feng L, Xie ZH, Ding Q, Xie X, Libby RT, Gan L (2010) MATH5 controls the acquisition of multiple retinal cell fates. Mol Brain 3: 36  Ferretti P CA, Tickle C, Moore G (ed) (2006) Embryos, Genes and Birth Defects. Chichester: John Wiley & Sons Ltd  134  Fischbach BV, Trout KL, Lewis J, Luis CA, Sika M (2005) WAGR syndrome: a clinical review of 54 cases. Pediatrics 116: 984-988  Fitzpatrick DR, van Heyningen V (2005) Developmental eye disorders. Current opinion in genetics & development 15: 348-353  Fu X, Sun H, Klein WH, Mu X (2006) Beta-catenin is essential for lamination but not neurogenesis in mouse retinal development. Dev Biol 299: 424-437  Fuerst PG, Bruce F, Rounds RP, Erskine L, Burgess RW (2012) Cell autonomy of DSCAM function in retinal development. Dev Biol 361: 326-337  Gage FH (2000) Mammalian neural stem cells. Science 287: 1433-1438  Galantuomo M.S ZI, Banfi S,   Ziviello C, Carboni G,  Forma  G,   Titi  Y,  , M F (2008) A NR2E3 Mutation (R309G) Associated With a Mild Form of Enhanced S-Cone Syndrome. Invest Ophthalmol Vis Sci 49  Gan L, Xiang M, Zhou L, Wagner DS, Klein WH, Nathans J (1996) POU domain factor Brn-3b is required for the development of a large set of retinal ganglion cells. Proc Natl Acad Sci U S A 93: 3920-3925  Glaser T, Jepeal L, Edwards JG, Young SR, Favor J, Maas RL (1994) PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nature genetics 7: 463-471  Glass CK, Rosenfeld MG (2000) The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev 14: 121-141  Gomes FL, Zhang G, Carbonell F, Correa JA, Harris WA, Simons BD, Cayouette M (2011) Reconstruction of rat retinal progenitor cell lineages in vitro reveals a surprising degree of stochasticity in cell fate decisions. Development 138: 227-235  Goodman RH, Smolik S (2000) CBP/p300 in cell growth, transformation, and development. Genes Dev 14: 1553-1577  Goureau O, Rhee KD, Yang XJ (2004) Ciliary neurotrophic factor promotes muller glia differentiation from the postnatal retinal progenitor pool. Dev Neurosci 26: 359-370  135  Haider NB, Jacobson SG, Cideciyan AV, Swiderski R, Streb LM, Searby C, Beck G, Hockey R, Hanna DB, Gorman S, Duhl D, Carmi R, Bennett J, Weleber RG, Fishman GA, Wright AF, Stone EM, Sheffield VC (2000) Mutation of a nuclear receptor gene, NR2E3, causes enhanced S cone syndrome, a disorder of retinal cell fate. Nature genetics 24: 127-131  Hanson IM (2003) PAX6 and congenital eye malformations. Pediatric research 54: 791-796  Hanson IM, Fletcher JM, Jordan T, Brown A, Taylor D, Adams RJ, Punnett HH, van Heyningen V (1994) Mutations at the PAX6 locus are found in heterogeneous anterior segment malformations including Peters' anomaly. Nat Genet 6: 168-173  Hashimoto T, Zhang XM, Chen BY, Yang XJ (2006) VEGF activates divergent intracellular signaling components to regulate retinal progenitor cell proliferation and neuronal differentiation. Development 133: 2201-2210  Hayashi T, Gekka T, Goto-Omoto S, Takeuchi T, Kubo A, Kitahara K (2005) Novel NR2E3 mutations (R104Q, R334G) associated with a mild form of enhanced S-cone syndrome demonstrate compound heterozygosity. Ophthalmology 112: 2115  He B, Kemppainen JA, Wilson EM (2000) FXXLF and WXXLF sequences mediate the NH2-terminal interaction with the ligand binding domain of the androgen receptor. J Biol Chem 275: 22986-22994  He J, Zhang G, Almeida AD, Cayouette M, Simons BD, Harris WA (2012) How variable clones build an invariant retina. Neuron 75: 786-798  Heery DM, Kalkhoven E, Hoare S, Parker MG (1997) A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387: 733-736  Hierholzer A, Kemler R (2010) Beta-catenin-mediated signaling and cell adhesion in postgastrulation mouse embryos. Dev Dyn 239: 191-199  Hill RE, Favor J, Hogan BL, Ton CC, Saunders GF, Hanson IM, Prosser J, Jordan T, Hastie ND, van Heyningen V (1991) Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature 354: 522-525  Hingorani M, Hanson I, van Heyningen V (2012) Aniridia. Eur J Hum Genet 20: 1011-1017  Hingorani M, Williamson KA, Moore AT, van Heyningen V (2009) Detailed ophthalmologic evaluation of 43 individuals with PAX6 mutations. Invest Ophthalmol Vis Sci 50: 2581-2590 136   Hollemann T, Bellefroid E, Pieler T (1998) The Xenopus homologue of the Drosophila gene tailless has a function in early eye development. Development 125: 2425-2432  Honkanen RA, Nishimura DY, Swiderski RE, Bennett SR, Hong S, Kwon YH, Stone EM, Sheffield VC, Alward WL (2003) A family with Axenfeld-Rieger syndrome and Peters Anomaly caused by a point mutation (Phe112Ser) in the FOXC1 gene. Am J Ophthalmol 135: 368-375  Hu X, Lazar MA (1999) The CoRNR motif controls the recruitment of corepressors by nuclear hormone receptors. Nature 402: 93-96  Huang P, Chandra V, Rastinejad F (2010) Structural overview of the nuclear receptor superfamily: insights into physiology and therapeutics. Annu Rev Physiol 72: 247-272  Idrees F, Vaideanu D, Fraser SG, Sowden JC, Khaw PT (2006) A review of anterior segment dysgeneses. Surv Ophthalmol 51: 213-231  Iseri SU, Osborne RJ, Farrall M, Wyatt AW, Mirza G, Nurnberg G, Kluck C, Herbert H, Martin A, Hussain MS, Collin JR, Lathrop M, Nurnberg P, Ragoussis J, Ragge NK (2009) Seeing clearly: the dominant and recessive nature of FOXE3 in eye developmental anomalies. Hum Mutat 30: 1378-1386  Iwahara N, Hisahara S, Hayashi T, Horio Y (2009) Transcriptional activation of NAD+-dependent protein deacetylase SIRT1 by nuclear receptor TLX. Biochem Biophys Res Commun 386: 671-675  Jacque CM, Vinner C, Kujas M, Raoul M, Racadot J, Baumann NA (1978) Determination of glial fibrillary acidic protein (GFAP) in human brain tumors. J Neurol Sci 35: 147-155  Jain V, Ravindran E, Dhingra NK (2012) Differential expression of Brn3 transcription factors in intrinsically photosensitive retinal ganglion cells in mouse. J Comp Neurol 520: 742-755  Kaltezioti V, Kouroupi G, Oikonomaki M, Mantouvalou E, Stergiopoulos A, Charonis A, Rohrer H, Matsas R, Politis PK (2010) Prox1 regulates the notch1-mediated inhibition of neurogenesis. PLoS Biol 8: e1000565  Kamiya D, Banno S, Sasai N, Ohgushi M, Inomata H, Watanabe K, Kawada M, Yakura R, Kiyonari H, Nakao K, Jakt LM, Nishikawa S, Sasai Y (2011) Intrinsic transition of embryonic stem-cell differentiation into neural progenitors. Nature 470: 503-509  Kaur K, Ragge NK, Ragoussis J (2009) Molecular analysis of FOXC1 in subjects presenting with severe developmental eye anomalies. Molecular vision 15: 1366-1373 137   Kikuchi M, Okumura F, Tsukiyama T, Watanabe M, Miyajima N, Tanaka J, Imamura M, Hatakeyama S (2009) TRIM24 mediates ligand-dependent activation of androgen receptor and is repressed by a bromodomain-containing protein, BRD7, in prostate cancer cells. Biochim Biophys Acta 1793: 1828-1836  Kiryushko D, Berezin V, Bock E (2004) Regulators of neurite outgrowth: role of cell adhesion molecules. Ann N Y Acad Sci 1014: 140-154  Kobayashi M, Yu RT, Yasuda K, Umesono K (2000) Cell-type-specific regulation of the retinoic acid receptor mediated by the orphan nuclear receptor TLX. Mol Cell Biol 20: 8731-8739  Koenekoop RK (2004) An overview of Leber congenital amaurosis: a model to understand human retinal development. Survey of ophthalmology 49: 379-398  Kokotas H, Petersen MB (2010) Clinical and molecular aspects of aniridia. Clin Genet 77: 409-420  Koppen A, Houtman R, Pijnenburg D, Jeninga EH, Ruijtenbeek R, Kalkhoven E (2009) Nuclear receptor-coregulator interaction profiling identifies TRIP3 as a novel peroxisome proliferator-activated receptor gamma cofactor. Mol Cell Proteomics 8: 2212-2226  Kruse SW, Suino-Powell K, Zhou XE, Kretschman JE, Reynolds R, Vonrhein C, Xu Y, Wang L, Tsai SY, Tsai MJ, Xu HE (2008) Identification of COUP-TFII orphan nuclear receptor as a retinoic acid-activated receptor. PLoS Biol 6: e227  Kumar RA, Chan KL, Wong AH, Little KQ, Rajcan-Separovic E, Abrahams BS, Simpson EM (2004) Unexpected embryonic stem (ES) cell mutations represent a concern in gene targeting: lessons from "fierce" mice. Genesis 38: 51-57  Kumar RA, Everman DB, Morgan CT, Slavotinek A, Schwartz CE, Simpson EM (2007a) Absence of mutations in NR2E1 and SNX3 in five patients with MMEP (microcephaly, microphthalmia, ectrodactyly, and prognathism) and related phenotypes. BMC Med Genet 8: 48  Kumar RA, Leach S, Bonaguro R, Chen J, Yokom DW, Abrahams BS, Seaver L, Schwartz CE, Dobyns W, Brooks-Wilson A, Simpson EM (2007b) Mutation and evolutionary analyses identify NR2E1-candidate-regulatory mutations in humans with severe cortical malformations. Genes Brain Behav 6: 503-516  Kumar RA, McGhee KA, Leach S, Bonaguro R, Maclean A, Aguirre-Hernandez R, Abrahams BS, Coccaro EF, Hodgins S, Turecki G, Condon A, Muir WJ, Brooks-Wilson AR, Blackwood DH, Simpson EM (2008) Initial association of NR2E1 with bipolar disorder and identification of candidate mutations in bipolar 138  disorder, schizophrenia, and aggression through resequencing. Am J Med Genet B Neuropsychiatr Genet 147B: 880-889  Kurotaki N, Harada N, Yoshiura K, Sugano S, Niikawa N, Matsumoto N (2001) Molecular characterization of NSD1, a human homologue of the mouse Nsd1 gene. Gene 279: 197-204  Kurusu M, Maruyama Y, Adachi Y, Okabe M, Suzuki E, Furukubo-Tokunaga K (2009) A conserved nuclear receptor, Tailless, is required for efficient proliferation and prolonged maintenance of mushroom body progenitors in the Drosophila brain. Developmental biology 326: 224-236  Land PW, Monaghan AP (2003) Expression of the transcription factor, tailless, is required for formation of superficial cortical layers. Cereb Cortex 13: 921-931  Lang RA (2004) Pathways regulating lens induction in the mouse. The International journal of developmental biology 48: 783-791  Lavado A, Lagutin OV, Chow LM, Baker SJ, Oliver G (2010) Prox1 is required for granule cell maturation and intermediate progenitor maintenance during brain neurogenesis. PLoS Biol 8  Le TT, Wroblewski E, Patel S, Riesenberg AN, Brown NL (2006) Math5 is required for both early retinal neuron differentiation and cell cycle progression. Dev Biol 295: 764-778  Leo C, Chen JD (2000) The SRC family of nuclear receptor coactivators. Gene 245: 1-11  Li S, Mo Z, Yang X, Price SM, Shen MM, Xiang M (2004) Foxn4 controls the genesis of amacrine and horizontal cells by retinal progenitors. Neuron 43: 795-807  Li W, Sun G, Yang S, Qu Q, Nakashima K, Shi Y (2008) Nuclear receptor TLX regulates cell cycle progression in neural stem cells of the developing brain. Mol Endocrinol 22: 56-64  Lilien J, Balsamo J, Arregui C, Xu G (2002) Turn-off, drop-out: functional state switching of cadherins. Dev Dyn 224: 18-29  Lillien L, Cepko C (1992) Control of proliferation in the retina: temporal changes in responsiveness to FGF and TGF alpha. Development 115: 253-266  Lin YP, Ouchi Y, Satoh S, Watanabe S (2009) Sox2 plays a role in the induction of amacrine and Muller glial cells in mouse retinal progenitor cells. Invest Ophthalmol Vis Sci 50: 68-74 139   Liu HK, Belz T, Bock D, Takacs A, Wu H, Lichter P, Chai M, Schutz G (2008) The nuclear receptor tailless is required for neurogenesis in the adult subventricular zone. Genes Dev 22: 2473-2478  Liu HK, Wang Y, Belz T, Bock D, Takacs A, Radlwimmer B, Barbus S, Reifenberger G, Lichter P, Schutz G (2010) The nuclear receptor tailless induces long-term neural stem cell expansion and brain tumor initiation. Genes Dev 24: 683-695  Liu T, Li Y, Gu H, Zhu G, Li J, Cao L, Li F (2013) p21-Activated kinase 6 (PAK6) inhibits prostate cancer growth via phosphorylation of androgen receptor and tumorigenic E3 ligase murine double minute-2 (Mdm2). J Biol Chem 288: 3359-3369  Livesey FJ, Cepko CL (2001) Vertebrate neural cell-fate determination: lessons from the retina. Nat Rev Neurosci 2: 109-118  Ma L, Cantrup R, Varrault A, Colak D, Klenin N, Gotz M, McFarlane S, Journot L, Schuurmans C (2007) Zac1 functions through TGFbetaII to negatively regulate cell number in the developing retina. Neural Dev 2: 11  MacDonald IM, Tran M, Musarella MA (2004) Ocular genetics: current understanding. Surv Ophthalmol 49: 159-196  Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM (1995) The nuclear receptor superfamily: the second decade. Cell 83: 835-839  Marshman WE, Jan JE, Lyons CJ (1999) Neurologic abnormalities associated with persistent hyperplastic primary vitreous. Can J Ophthalmol 34: 17-22  Martinez-Morales JR, Rodrigo I, Bovolenta P (2004) Eye development: a view from the retina pigmented epithelium. Bioessays 26: 766-777  Masai I, Lele Z, Yamaguchi M, Komori A, Nakata A, Nishiwaki Y, Wada H, Tanaka H, Nojima Y, Hammerschmidt M, Wilson SW, Okamoto H (2003) N-cadherin mediates retinal lamination, maintenance of forebrain compartments and patterning of retinal neurites. Development 130: 2479-2494  Matsuoka RL, Chivatakarn O, Badea TC, Samuels IS, Cahill H, Katayama K, Kumar SR, Suto F, Chedotal A, Peachey NS, Nathans J, Yoshida Y, Giger RJ, Kolodkin AL (2011) Class 5 transmembrane semaphorins control selective Mammalian retinal lamination and function. Neuron 71: 460-473  140  McFadden SA, Howlett MH, Mertz JR (2004) Retinoic acid signals the direction of ocular elongation in the guinea pig eye. Vision Res 44: 643-653  McFadden SA, Howlett MH, Mertz JR, Wallman J (2006) Acute effects of dietary retinoic acid on ocular components in the growing chick. Experimental eye research 83: 949-961  McMahon SB, Van Buskirk HA, Dugan KA, Copeland TD, Cole MD (1998) The novel ATM-related protein TRRAP is an essential cofactor for the c-Myc and E2F oncoproteins. Cell 94: 363-374  Mears AJ, Kondo M, Swain PK, Takada Y, Bush RA, Saunders TL, Sieving PA, Swaroop A (2001) Nrl is required for rod photoreceptor development. Nat Genet 29: 447-452  Mercurio F, Zhu H, Murray BW, Shevchenko A, Bennett BL, Li J, Young DB, Barbosa M, Mann M, Manning A, Rao A (1997) IKK-1 and IKK-2: cytokine-activated IkappaB kinases essential for NF-kappaB activation. Science 278: 860-866  Metivier R, Penot G, Hubner MR, Reid G, Brand H, Kos M, Gannon F (2003) Estrogen receptor-alpha directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115: 751-763  Miller LA, Smith AN, Taketo MM, Lang RA (2006) Optic cup and facial patterning defects in ocular ectoderm beta-catenin gain-of-function mice. BMC developmental biology 6: 14  Miyawaki T, Uemura A, Dezawa M, Yu RT, Ide C, Nishikawa S, Honda Y, Tanabe Y, Tanabe T (2004) Tlx, an orphan nuclear receptor, regulates cell numbers and astrocyte development in the developing retina. The Journal of neuroscience : the official journal of the Society for Neuroscience 24: 8124-8134  Monaghan AP, Bock D, Gass P, Schwager A, Wolfer DP, Lipp HP, Schutz G (1997) Defective limbic system in mice lacking the tailless gene. Nature 390: 515-517  Monaghan AP, Grau E, Bock D, Schutz G (1995) The mouse homolog of the orphan nuclear receptor tailless is expressed in the developing forebrain. Development 121: 839-853  Morrison D, FitzPatrick D, Hanson I, Williamson K, van Heyningen V, Fleck B, Jones I, Chalmers J, Campbell H (2002) National study of microphthalmia, anophthalmia, and coloboma (MAC) in Scotland: investigation of genetic aetiology. J Med Genet 39: 16-22  Murali D, Yoshikawa S, Corrigan RR, Plas DJ, Crair MC, Oliver G, Lyons KM, Mishina Y, Furuta Y (2005) Distinct developmental programs require different levels of Bmp signaling during mouse retinal development. Development 132: 913-923 141   Nagelhus EA, Mathiisen TM, Ottersen OP (2004) Aquaporin-4 in the central nervous system: cellular and subcellular distribution and coexpression with KIR4.1. Neuroscience 129: 905-913  Nakashima K, Yanagisawa M, Arakawa H, Kimura N, Hisatsune T, Kawabata M, Miyazono K, Taga T (1999) Synergistic signaling in fetal brain by STAT3-Smad1 complex bridged by p300. Science 284: 479-482  Netland PA, Scott ML, Boyle JWt, Lauderdale JD (2011) Ocular and systemic findings in a survey of aniridia subjects. J Aapos 15: 562-566  Nettles KW, Greene GL (2005) Ligand control of coregulator recruitment to nuclear receptors. Annu Rev Physiol 67: 309-333  Ng PC, Henikoff S (2003) SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Res 31: 3812-3814  Nishihara E, Moriya T, Shinohara K (2007) Expression of steroid receptor coactivator-1 is elevated during neuronal differentiation of murine neural stem cells. Brain Res 1135: 22-30  Niu W, Zou Y, Shen C, Zhang CL (2011) Activation of postnatal neural stem cells requires nuclear receptor TLX. J Neurosci 31: 13816-13828  Obernier K, Simeonova I, Fila T, Mandl C, Holzl-Wenig G, Monaghan-Nichols P, Ciccolini F (2011) Expression of Tlx in both stem cells and transit amplifying progenitors regulates stem cell activation and differentiation in the neonatal lateral subependymal zone. Stem Cells 29: 1415-1426  Ohnuma S, Hopper S, Wang KC, Philpott A, Harris WA (2002) Co-ordinating retinal histogenesis: early cell cycle exit enhances early cell fate determination in the Xenopus retina. Development 129: 2435-2446  Ohnuma S, Philpott A, Wang K, Holt CE, Harris WA (1999) p27Xic1, a Cdk inhibitor, promotes the determination of glial cells in Xenopus retina. Cell 99: 499-510  Okamoto M, Hojo Y, Inoue K, Matsui T, Kawato S, McEwen BS, Soya H (2012) Mild exercise increases dihydrotestosterone in hippocampus providing evidence for androgenic mediation of neurogenesis. Proc Natl Acad Sci U S A 109: 13100-13105  Osumi N, Shinohara H, Numayama-Tsuruta K, Maekawa M (2008) Concise review: Pax6 transcription factor contributes to both embryonic and adult neurogenesis as a multifunctional regulator. Stem cells (Dayton, Ohio) 26: 1663-1672 142   Park HJ, Kim JK, Jeon HM, Oh SY, Kim SH, Nam DH, Kim H (2010) The neural stem cell fate determinant TLX promotes tumorigenesis and genesis of cells resembling glioma stem cells. Mol Cells 30: 403-408  Perissi V, Aggarwal A, Glass CK, Rose DW, Rosenfeld MG (2004) A corepressor/coactivator exchange complex required for transcriptional activation by nuclear receptors and other regulated transcription factors. Cell 116: 511-526  Perissi V, Rosenfeld MG (2005) Controlling nuclear receptors: the circular logic of cofactor cycles. Nat Rev Mol Cell Biol 6: 542-554  Perissi V, Staszewski LM, McInerney EM, Kurokawa R, Krones A, Rose DW, Lambert MH, Milburn MV, Glass CK, Rosenfeld MG (1999) Molecular determinants of nuclear receptor-corepressor interaction. Genes Dev 13: 3198-3208  Perron M, Harris WA (2000) Determination of vertebrate retinal progenitor cell fate by the Notch pathway and basic helix-loop-helix transcription factors. Cell Mol Life Sci 57: 215-223  Philips GT, Stair CN, Young Lee H, Wroblewski E, Berberoglu MA, Brown NL, Mastick GS (2005) Precocious retinal neurons: Pax6 controls timing of differentiation and determination of cell type. Dev Biol 279: 308-321  Pignoni F, Baldarelli RM, Steingrimsson E, Diaz RJ, Patapoutian A, Merriam JR, Lengyel JA (1990) The Drosophila gene tailless is expressed at the embryonic termini and is a member of the steroid receptor superfamily. Cell 62: 151-163  Poche RA, Furuta Y, Chaboissier MC, Schedl A, Behringer RR (2008) Sox9 is expressed in mouse multipotent retinal progenitor cells and functions in Muller glial cell development. J Comp Neurol 510: 237-250  Prasov L, Masud T, Khaliq S, Mehdi SQ, Abid A, Oliver ER, Silva ED, Lewanda A, Brodsky MC, Borchert M, Kelberman D, Sowden JC, Dattani MT, Glaser T (2012) ATOH7 mutations cause autosomal recessive persistent hyperplasia of the primary vitreous. Hum Mol Genet 21: 3681-3694  Prozorovski T, Schulze-Topphoff U, Glumm R, Baumgart J, Schroter F, Ninnemann O, Siegert E, Bendix I, Brustle O, Nitsch R, Zipp F, Aktas O (2008) Sirt1 contributes critically to the redox-dependent fate of neural progenitors. Nat Cell Biol 10: 385-394  Qiu F, Jiang H, Xiang M (2008) A comprehensive negative regulatory program controlled by Brn3b to ensure ganglion cell specification from multipotential retinal precursors. J Neurosci 28: 3392-3403 143   Qu Q, Sun G, Li W, Yang S, Ye P, Zhao C, Yu RT, Gage FH, Evans RM, Shi Y (2010) Orphan nuclear receptor TLX activates Wnt/beta-catenin signalling to stimulate neural stem cell proliferation and self-renewal. Nat Cell Biol 12: 31-40; sup pp 31-39  Ramachandran R, Fausett BV, Goldman D (2010) Ascl1a regulates Muller glia dedifferentiation and retinal regeneration through a Lin-28-dependent, let-7 microRNA signalling pathway. Nat Cell Biol 12: 1101-1107  Rambaud J, Desroches J, Balsalobre A, Drouin J (2009) TIF1beta/KAP-1 is a coactivator of the orphan nuclear receptor NGFI-B/Nur77. J Biol Chem 284: 14147-14156  Randlett O, MacDonald RB, Yoshimatsu T, Almeida AD, Suzuki SC, Wong RO, Harris WA (2013) Cellular requirements for building a retinal neuropil. Cell Rep 3: 282-290  Redeker EJ, de Visser AS, Bergen AA, Mannens MM (2008) Multiplex ligation-dependent probe amplification (MLPA) enhances the molecular diagnosis of aniridia and related disorders. Molecular vision 14: 836-840  Reese BE, Galli-Resta L (2002) The role of tangential dispersion in retinal mosaic formation. Prog Retin Eye Res 21: 153-168  Reese BE, Harvey AR, Tan SS (1995) Radial and tangential dispersion patterns in the mouse retina are cell-class specific. Proc Natl Acad Sci U S A 92: 2494-2498  Reis LM, Semina EV (2011) Genetics of anterior segment dysgenesis disorders. Curr Opin Ophthalmol 22: 314-324  Reis LM, Tyler RC, Abdul-Rahman O, Trapane P, Wallerstein R, Broome D, Hoffman J, Khan A, Paradiso C, Ron N, Bergner A, Semina EV (2008) Mutation analysis of B3GALTL in Peters Plus syndrome. American journal of medical genetics Part A 146A: 2603-2610  Rhee J, Buchan T, Zukerberg L, Lilien J, Balsamo J (2007) Cables links Robo-bound Abl kinase to N-cadherin-bound beta-catenin to mediate Slit-induced modulation of adhesion and transcription. Nat Cell Biol 9: 883-892  Rich KA, Figueroa SL, Zhan Y, Blanks JC (1995) Effects of Muller cell disruption on mouse photoreceptor cell development. Exp Eye Res 61: 235-248  Richard SS (2002) Systematic Evaluation of the Mouse Eye,  New York: CRC Press. 144   Roy K, Kuznicki K, Wu Q, Sun Z, Bock D, Schutz G, Vranich N, Monaghan AP (2004) The Tlx gene regulates the timing of neurogenesis in the cortex. J Neurosci 24: 8333-8345  Roy K, Thiels E, Monaghan AP (2002) Loss of the tailless gene affects forebrain development and emotional behavior. Physiol Behav 77: 595-600  Saburi S, Hester I, Goodrich L, McNeill H (2012) Functional interactions between Fat family cadherins in tissue morphogenesis and planar polarity. Development 139: 1806-1820  Schedl A, Ross A, Lee M, Engelkamp D, Rashbass P, van Heyningen V, Hastie ND (1996) Influence of PAX6 gene dosage on development: overexpression causes severe eye abnormalities. Cell 86: 71-82  Schmouth JF, Banks KG, Mathelier A, Gregory-Evans CY, Castellarin M, Holt RA, Gregory-Evans K, Wasserman WW, Simpson EM (2012a) Retina restored and brain abnormalities ameliorated by single-copy knock-in of human NR2E1 in null mice. Mol Cell Biol 32: 1296-1311  Schmouth JF, Bonaguro RJ, Corso-Diaz X, Simpson EM (2012b) Modelling human regulatory variation in mouse: finding the function in genome-wide association studies and whole-genome sequencing. PLoS Genet 8: e1002544  Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9: 671-675  Schorderet DF, Escher P (2009) NR2E3 mutations in enhanced S-cone sensitivity syndrome (ESCS), Goldmann-Favre syndrome (GFS), clumped pigmentary retinal degeneration (CPRD), and retinitis pigmentosa (RP). Hum Mutat 30: 1475-1485  Schwarz M, Cecconi F, Bernier G, Andrejewski N, Kammandel B, Wagner M, Gruss P (2000) Spatial specification of mammalian eye territories by reciprocal transcriptional repression of Pax2 and Pax6. Development 127: 4325-4334  Sehgal R, Karcavich R, Carlson S, Belecky-Adams TL (2008) Ectopic Pax2 expression in chick ventral optic cup phenocopies loss of Pax2 expression. Developmental biology 319: 23-33  Shi Y, Chichung Lie D, Taupin P, Nakashima K, Ray J, Yu RT, Gage FH, Evans RM (2004) Expression and function of orphan nuclear receptor TLX in adult neural stem cells. Nature 427: 78-83  145  Shimozaki K, Zhang CL, Suh H, Denli AM, Evans RM, Gage FH (2012) SRY-box-containing gene 2 regulation of nuclear receptor tailless (Tlx) transcription in adult neural stem cells. J Biol Chem 287: 5969-5978  Silva AJ, Simpson EM, al. e, Wolfer DP (1997) Mutant mice and neuroscience: recommendations concerning genetic background. Banbury Conference on genetic background in mice. Neuron 19: 755-759  Simpson TI, Price DJ (2002) Pax6; a pleiotropic player in development. Bioessays 24: 1041-1051  Singh S, Chao LY, Mishra R, Davies J, Saunders GF (2001) Missense mutation at the C-terminus of PAX6 negatively modulates homeodomain function. Hum Mol Genet 10: 911-918  Sisodiya SM, Free SL, Williamson KA, Mitchell TN, Willis C, Stevens JM, Kendall BE, Shorvon SD, Hanson IM, Moore AT, van Heyningen V (2001) PAX6 haploinsufficiency causes cerebral malformation and olfactory dysfunction in humans. Nature genetics 28: 214-216  Steingrimsson E, Pignoni F, Liaw GJ, Lengyel JA (1991) Dual role of the Drosophila pattern gene tailless in embryonic termini. Science 254: 418-421  Stenman J, Yu RT, Evans RM, Campbell K (2003) Tlx and Pax6 co-operate genetically to establish the pallio-subpallial boundary in the embryonic mouse telencephalon. Development 130: 1113-1122  Sun G, Ye P, Murai K, Lang MF, Li S, Zhang H, Li W, Fu C, Yin J, Wang A, Ma X, Shi Y (2011a) miR-137 forms a regulatory loop with nuclear receptor TLX and LSD1 in neural stem cells. Nat Commun 2: 529  Sun G, Yu RT, Evans RM, Shi Y (2007) Orphan nuclear receptor TLX recruits histone deacetylases to repress transcription and regulate neural stem cell proliferation. Proc Natl Acad Sci U S A 104: 15282-15287  Sun W, Xiao X, Li S, Guo X, Zhang Q (2011b) Mutation analysis of 12 genes in Chinese families with congenital cataracts. Molecular vision 17: 2197-2206  Surapureddi S, Viswakarma N, Yu S, Guo D, Rao MS, Reddy JK (2006) PRIC320, a transcription coactivator, isolated from peroxisome proliferator-binding protein complex. Biochem Biophys Res Commun 343: 535-543  Swaroop A, Sieving PA (2013) The golden era of ocular disease gene discovery: Race to the finish. Clin Genet 84: 99-101 146   Takezawa S, Yokoyama A, Okada M, Fujiki R, Iriyama A, Yanagi Y, Ito H, Takada I, Kishimoto M, Miyajima A, Takeyama K, Umesono K, Kitagawa H, Kato S (2007) A cell cycle-dependent co-repressor mediates photoreceptor cell-specific nuclear receptor function. EMBO J 26: 764-774  Taranova OV, Magness ST, Fagan BM, Wu Y, Surzenko N, Hutton SR, Pevny LH (2006) SOX2 is a dose-dependent regulator of retinal neural progenitor competence. Genes Dev 20: 1187-1202  Thompson PJ, Mitchell TN, Free SL, Williamson KA, Hanson IM, van Heyningen V, Moore AT, Sisodiya SM (2004) Cognitive functioning in humans with mutations of the PAX6 gene. Neurology 62: 1216-1218  Tomita K, Nakanishi S, Guillemot F, Kageyama R (1996) Mash1 promotes neuronal differentiation in the retina. Genes Cells 1: 765-774  Torres M, Gomez-Pardo E, Gruss P (1996) Pax2 contributes to inner ear patterning and optic nerve trajectory. Development 122: 3381-3391  Traboulsi EI, Ellison J, Sears J, Maumenee IH, Avallone J, Mohney BG (2008) Aniridia with preserved visual function: a report of four cases with no mutations in PAX6. Am J Ophthalmol 145: 760-764  Trimarchi JM, Stadler MB, Cepko CL (2008) Individual retinal progenitor cells display extensive heterogeneity of gene expression. PLoS One 3: e1588  Troilo D, Nickla DL, Mertz JR, Summers Rada JA (2006) Change in the synthesis rates of ocular retinoic acid and scleral glycosaminoglycan during experimentally altered eye growth in marmosets. Invest Ophthalmol Vis Sci 47: 1768-1777  Uemura A, Kusuhara S, Wiegand SJ, Yu RT, Nishikawa S (2006) Tlx acts as a proangiogenic switch by regulating extracellular assembly of fibronectin matrices in retinal astrocytes. The Journal of clinical investigation 116: 369-377  Vadlamudi RK, Wang RA, Mazumdar A, Kim Y, Shin J, Sahin A, Kumar R (2001) Molecular cloning and characterization of PELP1, a novel human coregulator of estrogen receptor alpha. J Biol Chem 276: 38272-38279  Vincent A, Billingsley G, Priston M, Glaser T, Oliver E, Walter M, Ritch R, Levin A, Heon E (2006) Further support of the role of CYP1B1 in patients with Peters anomaly. Molecular vision 12: 506-510  147  Vincent A, Billingsley G, Priston M, Williams-Lyn D, Sutherland J, Glaser T, Oliver E, Walter MA, Heathcote G, Levin A, Heon E (2001) Phenotypic heterogeneity of CYP1B1: mutations in a patient with Peters' anomaly. J Med Genet 38: 324-326  Vitorino M, Jusuf PR, Maurus D, Kimura Y, Higashijima S, Harris WA (2009) Vsx2 in the zebrafish retina: restricted lineages through derepression. Neural Dev 4: 14  Voinescu PE, Kay JN, Sanes JR (2009) Birthdays of retinal amacrine cell subtypes are systematically related to their molecular identity and soma position. J Comp Neurol 517: 737-750  Voyvodic JT, Burne JF, Raff MC (1995) Quantification of normal cell death in the rat retina: implications for clone composition in cell lineage analysis. Eur J Neurosci 7: 2469-2478  Wallace VA (2008) Proliferative and cell fate effects of Hedgehog signaling in the vertebrate retina. Brain Res 1192: 61-75  Wang L, Rajan H, Pitman JL, McKeown M, Tsai CC (2006) Histone deacetylase-associating Atrophin proteins are nuclear receptor corepressors. Genes & development 20: 525-530  Wang SW, Kim BS, Ding K, Wang H, Sun D, Johnson RL, Klein WH, Gan L (2001) Requirement for math5 in the development of retinal ganglion cells. Genes Dev 15: 24-29  Wang Y, Dakubo GD, Thurig S, Mazerolle CJ, Wallace VA (2005) Retinal ganglion cell-derived sonic hedgehog locally controls proliferation and the timing of RGC development in the embryonic mouse retina. Development 132: 5103-5113  Watanabe T, Raff MC (1990) Rod photoreceptor development in vitro: intrinsic properties of proliferating neuroepithelial cells change as development proceeds in the rat retina. Neuron 4: 461-467  Wei X, Walia V, Lin JC, Teer JK, Prickett TD, Gartner J, Davis S, Stemke-Hale K, Davies MA, Gershenwald JE, Robinson W, Robinson S, Rosenberg SA, Samuels Y (2011) Exome sequencing identifies GRIN2A as frequently mutated in melanoma. Nature genetics 43: 442-446  Willbold E, Rothermel A, Tomlinson S, Layer PG (2000) Muller glia cells reorganize reaggregating chicken retinal cells into correctly laminated in vitro retinae. Glia 29: 45-57  Wurdak H, Zhu S, Romero A, Lorger M, Watson J, Chiang CY, Zhang J, Natu VS, Lairson LL, Walker JR, Trussell CM, Harsh GR, Vogel H, Felding-Habermann B, Orth AP, Miraglia LJ, Rines DR, Skirboll SL, Schultz PG (2010) An RNAi screen identifies TRRAP as a regulator of brain tumor-initiating cell differentiation. Cell Stem Cell 6: 37-47 148   Wurm A, Sock E, Fuchshofer R, Wegner M, Tamm ER (2008) Anterior segment dysgenesis in the eyes of mice deficient for the high-mobility-group transcription factor Sox11. Experimental eye research 86: 895-907  Xu B, Ionita-Laza I, Roos JL, Boone B, Woodrick S, Sun Y, Levy S, Gogos JA, Karayiorgou M (2012) De novo gene mutations highlight patterns of genetic and neural complexity in schizophrenia. Nat Genet 44: 1365-1369  Xu S, Sunderland ME, Coles BL, Kam A, Holowacz T, Ashery-Padan R, Marquardt T, McInnes RR, van der Kooy D (2007) The proliferation and expansion of retinal stem cells require functional Pax6. Dev Biol 304: 713-721  Yamagata M, Sanes JR (2012) Expanding the Ig superfamily code for laminar specificity in retina: expression and role of contactins. J Neurosci 32: 14402-14414  Yang GS, Banks KG, Bonaguro RJ, Wilson G, Dreolini L, de Leeuw CN, Liu L, Swanson DJ, Goldowitz D, Holt RA, Simpson EM (2009) Next generation tools for high-throughput promoter and expression analysis employing single-copy knock-ins at the Hprt1 locus. Genomics 93: 196-204  Yokoyama A, Takezawa S, Schule R, Kitagawa H, Kato S (2008) Transrepressive function of TLX requires the histone demethylase LSD1. Mol Cell Biol 28: 3995-4003  Young KA, Berry ML, Mahaffey CL, Saionz JR, Hawes NL, Chang B, Zheng QY, Smith RS, Bronson RT, Nelson RJ, Simpson EM (2002) Fierce: a new mouse deletion of Nr2e1; violent behaviour and ocular abnormalities are background-dependent. Behav Brain Res 132: 145-158  Young RW (1985) Cell differentiation in the retina of the mouse. Anat Rec 212: 199-205  Yu C, Mazerolle CJ, Thurig S, Wang Y, Pacal M, Bremner R, Wallace VA (2006) Direct and indirect effects of hedgehog pathway activation in the mammalian retina. Mol Cell Neurosci 32: 274-282  Yu RT, Chiang MY, Tanabe T, Kobayashi M, Yasuda K, Evans RM, Umesono K (2000) The orphan nuclear receptor Tlx regulates Pax2 and is essential for vision. Proceedings of the National Academy of Sciences of the United States of America 97: 2621-2625  Yu RT, McKeown M, Evans RM, Umesono K (1994) Relationship between Drosophila gap gene tailless and a vertebrate nuclear receptor Tlx. Nature 370: 375-379  149  Zeng ZJ, Johansson E, Hayashi A, Chavali PL, Akrap N, Yoshida T, Kohno K, Izumi H, Funa K (2012) TLX controls angiogenesis through interaction with the von Hippel-Lindau protein. Biol Open 1: 527-535  Zhang CL, Zou Y, He W, Gage FH, Evans RM (2008a) A role for adult TLX-positive neural stem cells in learning and behaviour. Nature 451: 1004-1007  Zhang CL, Zou Y, Yu RT, Gage FH, Evans RM (2006) Nuclear receptor TLX prevents retinal dystrophy and recruits the corepressor atrophin1. Genes Dev 20: 1308-1320  Zhang J, Woodhead GJ, Swaminathan SK, Noles SR, McQuinn ER, Pisarek AJ, Stocker AM, Mutch CA, Funatsu N, Chenn A (2010) Cortical neural precursors inhibit their own differentiation via N-cadherin maintenance of beta-catenin signaling. Dev Cell 18: 472-479  Zhang JM, Konkle AT, Zup SL, McCarthy MM (2008b) Impact of sex and hormones on new cells in the developing rat hippocampus: a novel source of sex dimorphism? Eur J Neurosci 27: 791-800  Zhang X, Wang P, Li S, Xiao X, Guo X, Zhang Q (2011) Mutation spectrum of PAX6 in Chinese patients with aniridia. Molecular vision 17: 2139-2147  Zhao C, Sun G, Li S, Lang MF, Yang S, Li W, Shi Y (2010) MicroRNA let-7b regulates neural stem cell proliferation and differentiation by targeting nuclear receptor TLX signaling. Proc Natl Acad Sci U S A 107: 1876-1881  Zhao C, Sun G, Li S, Shi Y (2009) A feedback regulatory loop involving microRNA-9 and nuclear receptor TLX in neural stem cell fate determination. Nat Struct Mol Biol 16: 365-371  Zhao C, Sun G, Ye P, Li S, Shi Y (2013) MicroRNA let-7d regulates the TLX/microRNA-9 cascade to control neural cell fate and neurogenesis. Sci Rep 3: 1329  Zhao S, Hung FC, Colvin JS, White A, Dai W, Lovicu FJ, Ornitz DM, Overbeek PA (2001) Patterning the optic neuroepithelium by FGF signaling and Ras activation. Development 128: 5051-5060  Zhou D, Quach KM, Yang C, Lee SY, Pohajdak B, Chen S (2000) PNRC: a proline-rich nuclear receptor coregulatory protein that modulates transcriptional activation of multiple nuclear receptors including orphan receptors SF1 (steroidogenic factor 1) and ERRalpha1 (estrogen related receptor alpha-1). Mol Endocrinol 14: 986-998  Zou Y, Niu W, Qin S, Downes M, Burns DK, Zhang CL (2012) The nuclear receptor TLX is required for gliomagenesis within the adult neurogenic niche. Mol Cell Biol 32: 4811-4820 150   Zschiedrich I, Hardeland U, Krones-Herzig A, Berriel Diaz M, Vegiopoulos A, Muggenburg J, Sombroek D, Hofmann TG, Zawatzky R, Yu X, Gretz N, Christian M, White R, Parker MG, Herzig S (2008) Coactivator function of RIP140 for NFkappaB/RelA-dependent cytokine gene expression. Blood 112: 264-276  Zuber ME, Gestri G, Viczian AS, Barsacchi G, Harris WA (2003) Specification of the vertebrate eye by a network of eye field transcription factors. Development 130: 5155-5167    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0165718/manifest

Comment

Related Items