Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of alpha v beta 6 integrin in enamel biomineralization Mohazab, Leila 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2013_fall_mohazab_leila.pdf [ 7.11MB ]
Metadata
JSON: 24-1.0165616.json
JSON-LD: 24-1.0165616-ld.json
RDF/XML (Pretty): 24-1.0165616-rdf.xml
RDF/JSON: 24-1.0165616-rdf.json
Turtle: 24-1.0165616-turtle.txt
N-Triples: 24-1.0165616-rdf-ntriples.txt
Original Record: 24-1.0165616-source.json
Full Text
24-1.0165616-fulltext.txt
Citation
24-1.0165616.ris

Full Text

The Role of Alpha v Beta 6 Integrin inEnamel BiomineralizationbyLeila MohazabA THESIS SUBMITTED IN PARTIAL FULFILLMENT OFTHE REQUIREMENTS FOR THE DEGREE OFMASTERS OF SCIENCEinThe Faculty of Graduate and Postdoctoral Studies(Craniofacial Science)THE UNIVERSITY OF BRITISH COLUMBIA(Vancouver)October 2013c? Leila Mohazab 2013AbstractTooth enamel has the highest degree of biomineralization of all vertebratehard tissues. During the secretory stage of enamel formation, ameloblastsdeposit an extracellular matrix that is in direct contact with ameloblastplasma membrane. Although it is known that integrins mediate cell-matrixadhesion and regulate cell signaling in most cell types, the receptors that reg-ulate ameloblast adhesion and matrix production are not well characterized.Thus, we hypothesized that ?v?6 integrin is expressed in ameloblasts whereit regulates biomineralization of enamel. Human and mouse ameloblastswere found to express both ?6 integrin mRNA and protein. The maxil-lary incisors of Itgb6-/- mice lacked yellow pigment and their mandibularincisors appeared chalky and rounded. Molars of Itgb6-/- mice showed signsof reduced mineralization and severe attrition. The mineral-to-protein ra-tio in the incisors was significantly reduced in Itgb6-/- enamel, mimickinghypomineralized amelogenesis imperfecta. Interestingly, amelogenin-rich ex-tracellular matrix abnormally accumulated between the ameloblast layer ofItgb6-/- mouse incisors and the forming enamel surface, and also betweenameloblasts. This accumulation was related to increased synthesis of amel-ogenin, rather than to reduced removal of the matrix proteins. This wasconfirmed in cultured ameloblast-like cells, which did not use ?v?6 integrinas an endocytosis receptor for amelogenins, although it participated in celladhesion on this matrix indirectly via endogenously produced matrix pro-teins. In summary, integrin ?v?6 is expressed by ameloblasts and it playsa crucial role in regulating amelogenin deposition/turnover and subsequentenamel biomineralization.iiPrefaceA version of chapter 2 has been published. Mohazab L, Koivisto L, JiangG, Kyto?ma?ki L, Haapasalo M, Owen GR, Wiebe C, Xie Y, HeikinheimoK, Yoshida T, Smith CE, Heino J, Ha?kkinen L, McKee MD, and LarjavaH. Critical role for ?v?6 integrin in enamel biomineralization. Journal ofCell Science. 2013; 126: 732-744. The research question of chapter 2 wasidentified and project was designed by Dr. Hannu Larjava. Leila Mohazabcollected and analysed most of the data under the guidance of Dr. HannuLarjava, and participated in writing the manuscript. L. Koivisto assisted inwestern blotting and cell spreading experiments and manuscript writing; G.Jiang performed real-time PCR analyses; L. Kyto?ma?ki performed and an-alyzed the gene arrays; M. Haapasalo and C. Wiebe. assisted in collectingsamples for immunohistochemistry; G.R. Owen assisted in endocytosis ex-periments; Y. Xie assisted in immunolocalization studies; K.H. Heikinheimoprovided samples and assisted in manuscript writing; T. Yoshida performedin situ hybridization experiments; C.E. Smith analyzed the mineral and pro-tein contents of enamel; J. Heino assisted in gene profiling and manuscriptwriting; L. Ha?kkinen participated in experiment planning and manuscriptwriting; M.D. McKee performed hard tissue sectioning and electron mi-croscopy studies and assisted in manuscript writing; H. Larjava supervisedall experiments and participated in manuscript writing.iiiTable of ContentsAbstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . iiPreface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . iiiTable of Contents . . . . . . . . . . . . . . . . . . . . . . . . . . . . ivList of Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . viiList of Figures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . viiiAcronyms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . viiiAcknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . xiDedication . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xii1 Review of the literature . . . . . . . . . . . . . . . . . . . . . . 11.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.2 Tooth development . . . . . . . . . . . . . . . . . . . . . . . 21.3 Amelogenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . 61.4 Enamel proteins . . . . . . . . . . . . . . . . . . . . . . . . . 101.5 Amelogenesis imperfecta . . . . . . . . . . . . . . . . . . . . 121.5.1 Overview of amelogenesis imperfecta . . . . . . . . . 121.5.2 Mutations in the amelogenin gene (AMELX) . . . . . 131.5.3 Mutations in the enamelin gene (ENAM) . . . . . . . 171.5.4 Mutations in the enamelysin gene (MMP20) . . . . . 211.5.5 Mutations in the kallikrein-4 gene (KLK4) . . . . . . 221.5.6 Mutations in the family with sequence similarity 83,member H gene (FAM83H) . . . . . . . . . . . . . . . 231.5.7 Mutations in the family with sequence similarity 20,member A gene (FAM20A) . . . . . . . . . . . . . . . 231.5.8 Mutations in the WD repeat-containing protein 72gene (WDR72) . . . . . . . . . . . . . . . . . . . . . . 24ivTable of Contents1.5.9 Mutations in the distal-less homeobox 3 gene (DLX3) 241.6 Dental management of patients with AI . . . . . . . . . . . . 251.7 Other mutations in mice that affect the enamel formation . . 281.8 Structure and function of integrins . . . . . . . . . . . . . . . 321.9 ?v?6 integrin . . . . . . . . . . . . . . . . . . . . . . . . . . 331.10 TGF-? activation . . . . . . . . . . . . . . . . . . . . . . . . 342 The role of ?v?6 integrin in enamel biomineralization . . 362.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 362.2 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 372.2.1 Teeth of Itgb6-/- mice have severe attrition and ab-normal enamel surface . . . . . . . . . . . . . . . . . 372.2.2 Enamel prism structure and mineralization are severelyaffected in Itgb6-/- . . . . . . . . . . . . . . . . . . . 382.2.3 Integrin ?6 mRNA and protein are expressed by ameloblastsin mouse and human teeth . . . . . . . . . . . . . . . 412.2.4 Expression of amelogenin and enamelin is significantlyincreased in the Itgb6-/- ameloblast layer . . . . . . . 432.2.5 Accumulation of amelogenin protein in the ameloblastlayer and enamel of Itgb6-/- mice . . . . . . . . . . . 462.2.6 Integrin ?v?6 participates indirectly in the adhesionof ameloblast-like cells on amelogenin-rich matrix butnot in amelogenin endocytosis . . . . . . . . . . . . . 482.3 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . 512.4 Materials and methods . . . . . . . . . . . . . . . . . . . . . 552.4.1 Animals . . . . . . . . . . . . . . . . . . . . . . . . . 552.4.2 Western blotting . . . . . . . . . . . . . . . . . . . . . 552.4.3 Gene expression profiling by microarray . . . . . . . . 552.4.4 RNA analysis by PCR . . . . . . . . . . . . . . . . . 562.4.5 Attrition rate . . . . . . . . . . . . . . . . . . . . . . 572.4.6 Scanning electron microscopy (SEM) . . . . . . . . . 572.4.7 Immunohistochemistry . . . . . . . . . . . . . . . . . 572.4.8 Mineral analysis of incisors . . . . . . . . . . . . . . . 582.4.9 In situ hybridization . . . . . . . . . . . . . . . . . . . 582.4.10 Undecalcified histology, transmission electron microscopyand immunogold labeling . . . . . . . . . . . . . . . . 582.4.11 Micro-computed tomography . . . . . . . . . . . . . . 592.4.12 Establishment of ameloblast cell lines . . . . . . . . . 592.4.13 Cell spreading assays . . . . . . . . . . . . . . . . . . 592.4.14 Amelogenin endocytosis by ameloblast-like cells . . . 60vTable of Contents2.4.15 Statistical analysis . . . . . . . . . . . . . . . . . . . . 603 Conclusion and future studies . . . . . . . . . . . . . . . . . . 61Bibliography . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64viList of Tables1.1 AMELX mutations. . . . . . . . . . . . . . . . . . . . . . . . 161.2 ENAM mutations . . . . . . . . . . . . . . . . . . . . . . . . . 201.3 Mutations in transgenic mice that cause enamel defects . . . 31viiList of Figures1.1 Tooth formation stages . . . . . . . . . . . . . . . . . . . . . . 31.2 Mouse hemi-mandible . . . . . . . . . . . . . . . . . . . . . . 61.3 Ameloblasts? morphological changes during amelogenesis . . . 72.1 Teeth from 6-month-old Itgb6-/- mice show severe attritoin . 392.2 Enamel prism structure and mineralization are severely af-fected in Itgb6-/- . . . . . . . . . . . . . . . . . . . . . . . . . 402.3 Integrin ?6 mRNA and protein are expressed by ameloblastsin developing mouse and human teeth. . . . . . . . . . . . . . 422.4 Gene expression profiling of enamel organs from 6-month-oldWT and Itgb6-/- mice. . . . . . . . . . . . . . . . . . . . . . . 442.5 Relative gene expression of selected enamel genes in 6-month-old WT and Itgb6-/- mice based on gene profiling . . . . . . . 452.6 Amelogenin protein is overexpressed in Itgb6-/- enamel organs. 472.7 Accumulation of amorphous matrix material between the ameloblastlayer and the forming enamel, and between ameloblasts, inItgb6-/- mice. . . . . . . . . . . . . . . . . . . . . . . . . . . . 492.8 Spreading, but not endocytosis, of ameloblast-like cells is reg-ulated by ?v?6 integrin on amelogenin-rich enamel matrix. . 50viiiAcronyms?v?6 alpha-v-beta-6.AI Amelogenesis imperfecta.AMBN Ameloblastin.AMELX Amelogenin gene on chromosome X.AMELY Amelogenin gene on chromosome Y.ANK Ankylosis gene.DEJ Dentinoenamel junction.DLX3 Distal-less homeobox 3.ECM Extracellular matrix.EMD Emdogain.ENAM Enamelin.ERM Epithelial cells rests of Malassez.FAM20A Family with sequence similarity 20, member A.FAM20B Family with sequence similarity 20, member B.FAM20C Family with sequence similarity 20, member C.FAM83H Family with sequence similarity 83, member H.H&E Hematoxylin and eosin.HERS Hertwigs epithelial root sheath.ixAcronymsIgG Immunoglobulin G.IRC Indirect resin crown.Itgb4 ?4 integrin.Itgb6 ?6 integrin.Itgb6-/- ?6 integrin knockout.KLK4 Kallikrein-4.LAP Latency associated peptide.LLC Large latent complex.LTBP Latent TGF-? binding protein.MMP20 Matrix metallopeptidase20 (enamelysin).ODAM Odontogenic ameloblast-associated.RGD Argenine-glycine-aspartic acid.SDS-PAGE Sodium dodecyl sulfate polyacrylamide gels.SLC Small latent complex.SSC Stainless steel crown.TGF?RI TGF-? type I receptor.TGF?RII TGF-? type II receptor.TGF-? Transforming growth factor- ?.TGF-?1 Transforming growth factor- ?1.TPA Tetradecanoylphorbol-13-acetate.WDR72 WD repeat-containing protein 72.WT Wild-type.xAcknowledgementsIt is my pleasure to acknowledge a number of people who helped and sup-ported me throughout this journey. First and foremost I would like toexpress my sincere gratitude to my supervisor, Dr. Hannu Larjava for hisunwavering support and encouragement. His continuous guidance, patienceand kindness are invaluable to me and motivated me to finish my Mastersdegree. He has been the quintessential supervisor and an insightful mentorat every step.Besides my supervisor, I would like to thank the rest of my thesis commit-tee, Dr. Lari Ha?kkinen and Dr. Dorin Ruse, for their patience and insightfulcomments. I sincerely thank Dr. Ha?kkinen for his immense support in myresearch and manuscript writing, as well as his willingness to answer all myquestions. I am grateful to Dr. Ruse for always being available to talk andfor lending me personal support and advice.A special thanks to Mr. Cristian Sperantia for his technical support, at-tention to detail, and kind assistance. I have always enjoyed our stimulatingconversations.I would also like to thank Dr. Gethin Owen, Dr. Leeni Koivisto, andDr. Gouqiao Jiang for all their help and instructions during the laboratorywork, assistance in experiments and manuscript writing, and for sharingtheir thoughts and knowledge with me.I thank Dr. McKee, Dr. Heino, Dr. Smith, Dr. Haapasalo, Dr. Xie,Dr. Yoshida, Dr. Wiebe, Dr. Heikinheimo, and Dr. Kyto?ma?ki for theircontribution in performing the experiments and analyzing the data for themanuscript.Most of all I am very grateful to my brother, Dr. Ali Reza Mohazab, forhis tremendous technical help in various steps.To my family, thank you for your constant love and support, and forbelieving in me.Supported by a grant from CIHR.xiDedicationThis work is dedicated to my loving family and in particular to my brother,Dr. Ali Reza Mohazab. Thank you for your endless support and encourage-ment.xiiChapter 1Review of the literature1.1 IntroductionEnamel is the hardest mineralized tissue in the body and the only calcifiedtissue that is produced by epithelial-derived cells, called ameloblasts. It cov-ers the crowns of teeth and protects them from functional wear and decay.Amelogenesis, or enamel development, consists of secretory, transition andmaturation stages. During the secretory stage, ameloblasts actively secreteenamel proteins such as amelogenin (the most abundant enamel matrix pro-tein) (Eastoe 1979), ameloblastin (Krebsbach et al. 1996), and enamelin (Huet al. 1997) into the enamel matrix. This extracellular matrix undergoesenzymatic modification by enamelysin (MMP20) and kallikrein-4 (KLK4)in the transition and maturation stages. This results in the formation of amature enamel that is mainly composed of hydroxyapatite crystallites anda minor amount of proteins (Bartlett et al. 1996; Nanci and Smith 2000).Several hereditary conditions affecting enamel have been described. In cer-tain cases, such as amelogenesis imperfecta, in which enamel formation andmineralization is affected, the enamel defects are caused by mutations inamelogenin, enamelin, MMP20, or KLK4 (Hu et al. 2007). The defectiveenamel mineralizations leads to extensive wear and decay in both the pri-mary and permanent dentition. As a result, these patients may lose theirteeth at a young age or require extensive restorative procedures to preventfurther decay and/or attrition (Crawford et al. 2007).Not all cases of defective enamel biomineralization can be explained bythe above gene defects, suggesting that also other mechanisms are involved.During amelogenesis, ameloblast plasma membrane has direct contact withthe matrix and the developing enamel crystals (Nanci and Smith 2000). Thereceptors of ameloblasts that mediate ameloblast-matrix adhesion, matrixorganization, and signaling are not well characterized, but may play animportant role in enamel biomineralization. Integrins mediate cell-matrixadhesion and signaling in most cell types (Hynes 2004). The secretome of ratincisor enamel organ has been reported to include the ?6 integrin transcript,but nothing is known about ?v?6 integrin in enamel formation (Moffatt et11.2. Tooth developmental. 2006). In the present study, we have investigated the expression andfunction of ?v?6 integrin during mouse enamel formation. The aims of ourstudy were? To characterize enamel defects in detail in ?6 integrin-null animals? To uncover the molecular mechanisms by which ?6 integrin deficiencyaffects enamel biomineralizationOur hypotheses were? ?v?6 integrin is expressed in a specific developmental stage in ameloblastsand that lack of its expression severely disturbs enamel mineralization.? ?v?6 integrin causes cell signaling via endogenous TGF-?1 activationwhich regulates the enamel matrix production and processing requiredfor biomineralization.1.2 Tooth developmentTeeth develop from oral ectoderm and mesenchyme, and this interactionbetween the epithelial tissue and its underlying mesenchymal tissue is un-der strict genetic control (Thesleff and Hurmerinta 1981; Thesleff 2006).Morphogenesis and cell differentiation in the tooth germ are regulated byepithelial-mesenchymal signaling, which consists of a chain of sequentialand reciprocal events (Thesleff et al. 1995; Thesleff 2003). Experimentshave shown that in the very early stages of tooth formation, the epithe-lium induces the mesenchyme to acquire odontogenic potential (Thesleff etal. 1995). In the later stages however, signals from the ectomesenchymecan elicit tooth formation from a variety of epithelia, even non-dental ep-ithelium. (Thesleff et al. 1995). During tooth development, the ectomes-enchymal cells, which originate from neural crest cells, and the epithelialcells slowly acquire higher levels of differentiation and become odontoblastsand ameloblasts respectively (Thesleff and Hurmerinta 1981). The epithelialderived ameloblast cells are responsible for the formation of highly mineral-ized, acellular enamel, while the odontoblasts make the more resilient, vitaldentin. In fact, other than the enamel (and some cementum), the rest ofthe tooth tissues as well as its supporting tissue are all derived directly fromneural crest cells.Tooth development has been divided into three overlapping periods ofinitiation, morphogenesis, and cell differentiation (Figure 1.1.; Kollar 1978;21.2. Tooth developmentThesleff and Hurmerinta 1981). During this process, a complex cascade ofgene expression takes place and results in oral ectoderm thickening, budding,growth, folding, and formation of tooth crown (Thesleff 2003).Figure 1.1: Tooth formation stages. Schematic representation shows thedifferent stages of tooth formation. There is a constant reciprocal interactionbetween the epithelial and mesenchymal tissue during tooth formation.During initiation, the primary epithelial band forms as a continuousthick band of epithelium in both the maxilla and mandible, from which thedental lamina and vestibular lamina are formed (Thesleff and Hurmerinta1981). The cells forming the vestibular lamina initially enlarge, but thendegenerate in order to form a cleft that becomes the future vestibule. Thedental lamina is formed from epithelial outgrowths into the underlying mes-enchyme and corresponds to the position of future teeth row (Kollar 1978).Furthermore, localized thickenings within the primary epithelial band givesrise to placodes, which bud into the underlying mesenchymal cells and func-tion as one of the first signalling centres of the tooth (Pispa and Thesleff2003). It is hypothesized that one entire tooth family (incisor, canine, or mo-lar) is formed from one dental placode (Thesleff 2003). Signaling moleculessuch as FGFs (fibroblast growth factor), BMPs (bone morphogenic proteins,belonging to the TGF-? superfamily) and Wnts regulate the formation ofplacodes (Thesleff 2003). Placodal signals in turn, regulate the budding ofepithelium and the mesenchymal condensation (Thesleff 2003).The morphogenesis phase encompasses the bud, cap, and bell stages oftooth formation, where the size and shape of the tooth is established by mor-phogenic movements of the tissue (Thesleff and Hurmerinta 1981). Duringthe bud stage, there is an epithelium incursion into the mesenchyme, whichis accompanied by the condensation of the mesenchymal cells surroundingthe budding epithelium (Thesleff et al. 1995). This ball of condensed ec-tomesenchymal cells gives rise to two clusters of cells: the dental papilla andthe dental follicle (Thesleff 2003). The dental papilla will form the dentinand the pulp, while the dental follicle gives rise to the cementoblasts andthe periodontal tissue (Tummers and Thesleff 2008). At this stage, the den-tal epithelium also has two distinct cell lineages which consist of peripheral31.2. Tooth developmentbasal cells and the centrally located stellate reticulum cells (Tummers andThesleff 2008).During the cap and bell stages, there is further morphogenesis of theepithelium and the crown morphology becomes apparent as the epitheliumgrows and surrounds the dental papilla (Thesleff et al. 1995). It is duringthe transition from bud to cap stage that morphologic differences betweentooth germs gives rise to different types of teeth. At the cap stage, theepithelial bud continues to proliferate into the mesenchyme, and surroundsthe dental papilla (Thesleff 2003). During transition to this stage, clustersof non-dividing epithelial cells give rise to the enamel knot, which expressesgenes for many signaling molecules, such as Shh (sonic hedgehog) BMPs,FGFs, and Wnts (Jernvall and Thesleff 2000; Thesleff 2003). Each toothhas a single primary enamel knot at the cap stage. Signals from the enamelknots regulate growth and cuspal morphogenesis by controlling the initia-tion of secondary enamel knots (Jernvall and Thesleff 2000; Thesleff 2003).Secondary enamel knots express most of the same signaling molecules andappear at the sites of epithelial foldings, corresponding to the tips of thefuture cups in the molar teeth (Jernvall and Thesleff 2000). While signalsfrom the enamel knot affect the epithelial and mesenchymal tissues, the re-ciprocal interaction between the epithelium and mesenchyme are needed tomaintain the enamel knot (Thesleff 2003).The final shape of the crown is established at the bell stage. Duringthis stage, cell differentiation and mineralization takes place as the epithe-lial and mesenchymal cells differentiate into ameloblasts and odontoblastsrespectively, and these cells start to deposit the enamel and dentin matrices(Thesleff 2003).Moreover, it is during the cap and bell stages that an epithelial out-growth on top of the ectomesenchyme forms the enamel organ. The cellsat the periphery of enamel organ, facing the dental follicle, form the outerenamel epithelium, and the cells that border the dental papilla form theinner enamel epithelium (Tummers and Thesleff 2003). The inner enamelepithelium is responsible for the formation of the enamel. The outer andinner enamel epithelia are continuous, and the region where they meet iscalled the cervical loop (Tummers and Thesleff 2003). Stratum reticulumcells and a layer of stratum intermedium cells facing the inner enamel epithe-lium occupy the core of the loop (Tummers and Thesleff 2003). The cervicalloop is responsible for the continuous cell division, until the crown reachesits full size, after which, the cells give rise to the epithelial component ofroot formation. While the cervical loop is maintained in continuously grow-ing teeth such as the rodent incisor, in humans it undergoes a structural41.2. Tooth developmentmodification upon root formation (Tummers and Thesleff 2003).After crown formation is completed, the stellate reticulum and stratumintermedium cells are lost, leaving only a double layer of basal epitheliumknown as Hertwig?s epithelial root sheath (HERS) (Tummers and Thesleff2003; Tummers and Thesleff 2008). The sheath grows down and encom-passes all, but the basal portion of dental pulp. It directs root growth andshape, and results in dentin formation in the root by initiating the differen-tiation of odontoblasts from the ectomesenchymal cells in the outer dentalpapilla (Tummers and Thesleff 2003; Tummers and Thesleff 2008). Cemen-togenesis in the root occurs when HERS degrades and gives rise to epithelialcells covering the root, known as the epithelial cells rests of Malassez (ERM)(Tummers and Thesleff 2008). Through the network lining of ERM, dentalfolliclular cells migrate and contact the newly formed dentin (Tummers andThesleff 2008). This results in the dental follicle cells to differentiate intocementoblasts depositing the cementum (Tummers and Thesleff 2008).The mouse incisor grows continuously and is functionally and morpho-logically subdivided into two domains: the labial crown analog and thelingual root analog (Figure 1.2; Tummers and Thesleff 2008). The labialside is covered by enamel produced by ameloblasts, and the lingual side iscovered by dentin and cementum deposited by odontoblasts and cemento-blsats (Tummers and Thesleff 2008). The cervical loop with a core of stellatereticulum cells resides in the base of the incisor, and thus both the crownand root analog are generated continuously by the apical end of the incisor(Harada et al. 2002; Tummers and Thesleff 2008). It has been suggestedthat the progeny of dividing stem cells from the core of the loop integrateinto the basal layer of epithelium, proliferate to form transit amplifying cellsaround the loop, and then differentiate into ameloblasts or root epitheliumdepending on their regulatory environment (Tummers and Thesleff 2008).Signaling molecules from the mesenchyme, such as FGF-3, FGF-10, BMP-4 and Activin were found to modulate and regulate the proliferation andmaintenance of the epithelial stem cell progeny (Harada et al. 2002; Wanget al. 2007). Lastly, Follistatin, which is a TGF-? antagonist, has beenidentified as the key signaling molecule that inhibits ameloblast differenti-ation and enamel deposition on the lingual side of the incisor (Wang et al.2007).51.3. AmelogenesisFigure 1.2: Mouse hemi-mandible. The mouse incisor grows continuouslyand is covered by enamel only on its labial side. The different stages ofamelogenesis can be found along the labial length of the incisor.1.3 AmelogenesisEnamel is the most highly mineralized tissue in the body. It is uniquefrom other mineralized tissues because it is noncollagenous and derivedfrom ameloblast cells, which are of epithelial origin (Fincham Moradian-Oldak and Simmer 1999). At the time of tooth eruption ameloblast cellsare lost, and therefore, mature enamel is acellular. Due to this absence ofameloblasts, mature enamel cannot renew itself and does not undergo re-modeling. (Fincham Moradian-Oldak and Simmer 1999). Mature enamel isapproximately ninety-five percent mineral, four percent water, and one per-cent organic matter (Deakins and Volker 1941; LeFevre and Manly 1932).The inorganic portion of enamel is long, thin closely packed crystals, com-posed of calcium hydroxyapatite Ca10(PO4)6(OH)2 (Simmer and Hu 2001;Elliott Holcomb and Young 1985; Young 1974). The hydroxyapatites grouptogether to form the fundamental organizational units of enamel: enamelrods and interrods. The crystals in the rods are parallel to the long axisof the rod, while the crystals in the interrods run in different directions(Simmer and Fincham 1995). The cylindrical enamel rods are surroundedby interrod enamel, and run from the dentinoenamel junction (DEJ) tothe tooth surface. The narrow space that forms the boundary between therod and interrod enamel contains organic material and is known as the rodsheath. The proteins ameloblastin and amelogenin are major componentsof the rod sheath (Hu et al. 2007). Rodents do not have a well defined rodsheath in their enamel (Uchida et al. 1998).61.3. AmelogenesisFigure 1.3: Ameloblasts? morphological changes during amelogenesis. Atfirst the cells of the inner enamel epithelium rest on the basement membrane(1). These ameloblasts then elongate and differentiate into pre-secretoryameloblasts (2). The pre-secretory ameloblasts degenerate the basementmembrane, as they start secreting the enamel proteins (3). The secretoryameloblasts form Tomes? processes, which are projections along the face ofthe ameloblast that organizes the enamel crystals (4). Once the enamelachieves its full thickness, the secretory stage ends and the ameloblasts losetheir Tomes? process (5). In the transition stage, the ameloblasts decreasetheir height, a new basement membrane is deposited, and the cells start toproduce enzymes to degrade the accumulated protein matrix (6). Duringthe maturation stage, the ameloblasts alter between the ruffle-ended (7)and smooth-ended phases (8). This modulation between the two phases isessential for the mineralization of the enamel.Amelogenesis or enamel formation is a highly specialized, multi-stageprocess that takes place in a unique extracellular matrix produced by ameloblastcells. Amelogenesis occurs in three stages: presecretory, secretory and mat-uration. During these stages, an organic matrix is secreted, the crystals arenucleated and elongated, the organic material and water and subsequentlylost, and the enamel crystals mature (Reith 1970). Throughout this process,ameloblast cells go through progressive morphological changes (Figure 1.3;Pindborg and Weinmann 1959).Following the initiation of dentinogenesis in the developing tooth, cellsof the inner enamel epithelium resting on a basement membrane (basal lam-ina), differentiate into pre-secretory ameloblasts. These ameloblast cellselongate, become polarized, prepare for protein synthesis, and lose the abil-ity to undergo mitosis (Simmer and Fincham 1995). The preameloblastsbegin secreting enamel proteins followed by degeneration of the basementmembrane (Simmer and Hu 2001). Degradation of the basement membrane,which originally serves to separate preameloblasts from preodontoblasts, is71.3. Amelogenesisrequired for enamel formation to occur (Hu et al. 2007). In addition, loss ofthis basement membrane marks the initiation of dentin mineralization (Hu etal. 2007). As the basal lamina disintegrates, the presecretory ameloblastssend cytoplasmic processes trough the gaps and continue the secretion ofenamel proteins on the irregular mineralizing surface of the dentin (Hu etal. 2007; Ronnholm 1962a; Ronnholm 1962b). The secreted enamel matrixmineralizes into a smooth thin layer of aprismatic, rodless enamel, and isperforated by odontoblast processes (Ronnholm 1962b). Thus, the dentinand enamel are linked and the dentinoenamel enamel junction is established.During the secretory stage, the ameloblasts migrate away from the DEJ.As they do this, they continue to produce and lay down enamel proteins intothe space that was previously the basal lamina, on top of the existing enamelcrystallites (Hu et al. 2007). The secretory ameloblasts are tall polarizedcolumnar cells (Lacruz et al 2010). They are linked by cell-cell junctionsand also further develop secretory structures called the Tomes? processes(Kallenbach 1973; Reith and Boyde 1978; Ronnholm 1962a; Ronnholm1962b). Tomes? processes are cytoplasmic extensions that extend in thenewly formed enamel, and organize the enamel crystals into rod and inter-rod enamel (Risnes 1998). Secretions from the proximal part of the Tomes?process, which contacts the adjacent ameloblast, form the interrod enamel,while secretions from the distal portion of the processes, which interdigitatesinto the enamel, form the rod enamel. During this stage, the ameloblastssecrete proteins at a mineralization front and the enamel crystals begin toelongate (Hu et al. 2007). The newly laid down enamel matrix is immedi-ately, but very lightly, mineralized and the mineralization front retreats withthe Tomes? process as the enamel crystals grow in length (Hu et al. 2007).Each enamel rod is synthesized by the Tomes? process of one ameloblastcell (Hu et al. 2007). The enamel crystals elongate in increments, witheach increment representing the amount of crystal growth in one day (Huet al. 2007; Simmer and Hu 2001). The amount of enamel deposition perday varies depending on the systemic factors (Simmer and Hu 2001). Atthe end of the secretory stage, the enamel is partially mineralized, and thecrystallites achieve their full length, corresponding to the final thickness ofthe enamel (Hu et al. 2007; Simmer and Fincham 1995).In the maturation stage, the principal function of ameloblasts is to re-move water and organic material from the enamel matrix, and supply itwith calcium and phosphate ions (Simmer and Fincham 1995). During thisstage, the enamel crystallites grow in width and thickness and the enamelhardens (Simmer and Hu 2001). In order for the mineralization of enamelto occur, the ameloblasts must undergo a transition that involves a reduc-81.3. Amelogenesistion in their secretory activity. These ameloblasts decreases in height andlose their Tomes? processes (Smith 1979). In addition, they begin secret-ing kallikrein-4 (KLK4), a protease that degrades the accumulated proteins(Hu et al. 2007). During the maturation stage, ameloblasts modulatebetween ruffle and smooth-ended morphologies (Josephsen and Fejerskov1977). Ruffle-ended ameloblasts are bounded by tight junctions and haveconsiderable endocytotic activity (Lacruz et al. 2010; Simmer and Fincham1995; Takano 1995). They participate in the active transport of calciumand phosphate into the enamel matrix (Lacruz et al. 2010; Simmer andFincham 1995; Takano 1995). As the enamel proteins are degraded andremoved, the sides of the enamel crystals are exposed, and active incorpo-ration of mineral ions into crystal takes place by ruffle ended ameloblasts(Hu et al. 2007). Furthermore, the ruffle-ended ameloblasts produce bicar-bonate ions, which alkalinizes the matrix and prevents demineralization ofthe crystals (Lacruz et al. 2010; Simmer and Fincham 1995; Smith 1998).In contrast, smooth ended ameloblasts have no endocytotic activity, and donot have distal tight junctions (Simmer 1995, Lacruz 2010). A lack of thetight junctions in these cells permits the exit of large molecules and proteinfragment to the enamel surface, from between the cells (Lacruz et al 2010;Simmer and Fincham 1995). The alteration between the ruffle-ended andsmooth-ended ameloblasts in the maturation stage is therefore essential inenamel formation. Ultimately, these cells function to create and maintainan environment where the pH is tightly regulated, and the removal of or-ganic matrix and deposition of mineral content can take place (Lacruz et al.2010).Moreover, during the maturation stage, the ameloblasts also deposit aunique basal lamina, to which they are attached via hemidesmosomes (DosSantos Neves et al. 2012). This basal lamina is highly glycosylated andcontains laminin-5 (Dos Santos Neves et al. 2012). This basal lamina isresponsible for the attachment of ameloblasts to the enamel, regulating themovement of material into and out of the enamel matrix, and relaying in-formation about the status of enamel formation to the ameloblast cells (DosSantos Neves et al. 2012). Amelotin and odontogenic ameloblast-associated(ODAM) are components of the basal lamina, which are secreted by thematuration stage ameloblasts (Dos Santos Neves et al. 2012; Moffatt et al.2006).In continuously erupting rodent incisors, the different stages of ameloge-nesis are found in series along the length of a single tooth. Enamel formationoccurs sequentially from the apical end to the incisal end of the incisor, anddistinct zones of secreting, maturing, and mature enamel are found on the91.4. Enamel proteinstooth (Smith and Nanci 1989).1.4 Enamel proteinsDuring amelogenesis, ameloblasts secrete a variety of enamel proteins andproteinases that are involved in enamel formation. Amelogenenin, ameloblastin,enamelin are the major structural proteins, while enamelysin (MMP20) andkallikrein-4 (KLK4) are the major proteinases.Amelogenin is secreted during the secretory stage of amelogenesis andplays a role in the regulation of enamel crystal pattern and thickness (Gib-son et al. 2001). It is the most abundant enamel protein, comprisingabout eighty to ninety percent of total enamel proteins (Deutsch 1989; Fin-cham Moradian-Oldak and Simmer 1999; Hu et al. 2007). Ninety per-cent of the human amelogenin protein is expressed from genes located onthe X-chromosome (AMELX), and ten percent are expressed from the Y-chromosome (AMELY) (Lau et al. 1989; Nakahori Takenaka and Nakagome1991; Salido et al. 1992). Amelogenin is secreted in a variety of isoforms, butthe major isoform has a molecular weight of approximately 25 kDa (Hu etal. 2007; Simmer and Hu 2001). The alternative splicing of the amelogenintranscript, as well as post-translational modifications such as proteolysis,result in a range of protein weights for amelogenin, as seen on a sodiumdodecyl sulfate polyacrylamide gels (SDS-PAGE) analysis (Fincham et al.1991; Gibson et al. 1991; Salido et al. 1992). Amelogenin is critical for nor-mal development of enamel, due to its role in the inhibition of lateral growthof hydroxyapatite crystals. The different amelogenin isoforms self-assembleinto structures known as nanospheres (Fincham et al. 1994). Nanospheresare responsible for regulating crystal spacing, and thus determine the widthand thickness of the of enamel crystals (Fincham et al. 1995). Furthermore,amelogenin contains histidine, which causes the absorption of hydrogen ions,and therefore functions to regulate the pH of the enamel matrix (Simmerand Hu 2001).Ameloblastin (AMBN), also known as amelin and sheathlin, is mainlysecreted during the secretory stage of enamel formation. It comprises aboutfive to ten percent of enamel proteins, and has a molecular weight of 65 to 70kDa (Yamakoshi et al. 2001). Its gene loci are located on chromosome 4q inhumans (MacDougall et al. 1997) and on chromosome 5 in mice (Krebsbachet al. 1996). Two ameloblastin isoforms are secreted due to alternativesplicing of mRNA transcript (Hu et al. 1997), and the protein is prote-olytically cleaved at its N-terminal soon after its secretion. The N-terminal101.4. Enamel proteinscleavage product is accumulated in the enamel sheath space, separating rodand interrod enamel (Uchida et al. 1995). Amelobastin is a critical celladhesion molecule which aids in the adherence of ameloblasts to the enamelsurface (Fukumoto et al. 2004; Fukumoto et al 2005). Ameloblastin alsoplays a crucial role in maintaining ameloblast differentiation, which makesit essential for normal enamel formation (Fukumoto et al. 2004; Fukumotoet al. 2005). It binds to the ameloblast cell, inhibits its proliferation, andmaintains the differentiated phenotype of secretory ameloblasts (Fukumotoet al. 2004; Fukumoto et al. 2005).Enamelin (ENAM) is the largest and least abundant of the enamel ma-trix proteins. It has a molecular mass of roughly 200 kDa (Hu et al 1997;Hu et al. 2000) and comprises about three to five percent of the structuralproteins in developing enamel. Enamelin gene is located on chromosome 4q,near the ameloblastin gene (Hu et al. 2000). Enamelin is secreted during thesecretory stage, and is rapidly cleaved by proteinases upon its release. Itsfunction is to promote crystal nucleation and elongation (Hu and Yamakoshi2003).Proteolysis, carried out by metalloproteinases and serine proteinases, isessential for enamel biomineralization (Hart et al. 2004; Kim et al. 2005).These proteases are expressed at different times and have different functions.Proteolytic activities cleave enamel proteins and produce stable cleavageproducts by changing the structure and properties of the protein. Moreover,proteolysis results in degradation of the extracellular organic matrix in thematuration stage, and thus allows crystal growth and mineralization (Lu etal. 2008; Smith 1998).MMP20 is a metalloproteinase that is predominantly expressed duringthe secretory and early maturation stages of amelogenesis (Bartlett et al.1996; Hu et al. 2002). It is located on chromosome 11 (Llano et al. 1997)and migrates as a double band at 40 and 45 kDa on SDS-PAGE (Fukae etal. 1998; Smith et al. 1996). MMP20 selectively cleaves enamel proteinsand slowly degrades them, and thus allows crystallites to grow in width andthickness (Lu et al. 2008). It predominantly cleaves amelogenin (Nagano etal. 2009) and ameloblastin (Chun et al. 2010) during the secretory stage.Uncleaved enamel proteins and cleaved products of proteins segregate intodifferent compartments within the enamel layer, which suggests that theymight have different functions (Simmer and Hu 2002).KLK4 is a serine protease that shows up as two bands at 31 and 34kDa on SDS-PAGE (Tanabe 1984). The gene is located on chromosome 19(DuPont et al. 1999; Hu et al. 2000) and the protein is secreted during thematuration stage of amelogenesis. KLK4 aggressively removes the remaining111.5. Amelogenesis imperfectaextracellular organic matrix, following the termination of enamel proteinsecretion, and makes way for hardening of the enamel. Residual amelogeninin the developing enamel comprises the main substrate for the KLK4 enzyme(Ryu et al. 2002). It also degrades glycosylated enamelin cleavage productthat is not digested by MMP20 (Yamakoshi et al. 2006). Interestingly,KLK4 does not degrade the enamel proteins that take part in making thebasal lamina during the maturation stage (Takano 1979).1.5 Amelogenesis imperfecta1.5.1 Overview of amelogenesis imperfectaAmelogenesis imperfecta (AI) represents a collection of genetic disordersthat affects enamel formation in primary as well as permanent dentition inthe absence of systemic manifestations (Aldred and Crawford 1995; Witkop1988). Clinically, teeth may present as being discolored and sensitive withrough texture, pits, or grooves (Crawford et al. 2007). Moreover, thesepatients are prone to periodontal conditions, predominantly gingivitis, andmay show dental anomalies such as reduced crown size and taurodontism(Poulsen et al. 2008). Patients with AI lose their teeth at a young ageor require extensive restorative procedures to prevent further decay and/orattrition. Furthermore, it has profound psychological effects such as poorself-esteem (Hu et al. 2007).The clinical manifestation is enamel that is either hypoplastic, hypoma-ture/ hypomineralized, hypocalcified or a combination of these, dependingon the timing of the enamel formation defect (Stephanopoulos et al. 2005;Witkop and Sauk 1976; Wright et al. 2009). Hypoplastic AI results inenamel that is pathologically thin and rough textured with a yellowish-browncolor; it forms if the defects occur in the secretory stage of amelogenesis andresults in crystal elongation being disrupted; (Hu and Yamakoshi 2003).On the other hand, hypomineralized/hypomature AI results in enamel thatis pathologically soft, opaque and brownish colored; it forms if the defectoccurs in the maturation stage of amelogenesis and affects the removal oforganic matrix (Hu and Yamakoshi 2003). In this case, it is important tonote that the teeth are normal in size (Hu and Yamakoshi 2003). Lastly,hypocalcified AI results from the defects occurring during the mineraliza-tion process and contains enamel that is very soft with a rough texture andwears away quickly (Hu and Yamakoshi 2003).The disorder?s mode of inheritance is either autosomal-dominant, autosomal-recessive, or X-linked (Aldred et al. 2003; Backman 1997; Crawford et al.121.5. Amelogenesis imperfecta2007). This is a genetically heterogeneous disorder and to date, mutations inthe following candidate genes have been found to cause different types of AI:amelogenin (AMELX), enamelin (ENAM), enamelysin (MMP20), kallikrein-4 (KLK4), family with sequence similarity 83, member H (FAM83H), Familywith sequence similarity 20, member A (FAM20A), WD repeat-containingprotein 72 (WDR72), and distal-less homeobox 3 (DLX3) (Crawford et al.2007; Wright et al. 2011; Lee et al. 2011). Interestingly, mutations in thegenes that encode the enamel extra-cellular matrix proteins and proteasesaccount for only one quarter of all AI cases, and nearly half of the AI causesare of an unknown etiology (Hart et al. 2003b; Kim et al. 2006; Lee etal. 2011). The prevalence of AI ranges from 1 in 700 in Sweden (Backmanand Holm 1986) to 1 in 14000 in the USA (Witkop 1957). AI has beenclassified into 14 clinical subtypes based on mode of inheritence and enamelphenotype (Witkop 1988; Aldred and Crawford 1995).Numerous mouse models have been generated that have one or a combi-nation of the candidate genes altered and/or knocked-out, and thus providetools for understanding AI pathogenesis (discussed below).1.5.2 Mutations in the amelogenin gene (AMELX)Amelogenin is the most abundant enamel matrix protein and its functionis thought to be the regulation of crystal growth and the organization ofenamel rods during amelogenesis (Gibson et al. 2001). The amelogeningene resides on the sex chromosomes and consists of seven exons and sixintrons (Brookes et al. 1995; Lau et al 1989). Although in humans theamelogenin gene is located on both the X chromosome (AMELX) and theY chromosome (AMELY), only 10% of the amelogenin mRNA expression isfrom AMELY (Lau et al. 1989; Nakahori et al. 1991; Salido et al. 1992).X-linked AI is a phenotypically and genotypically diverse disorder, whichresults from mutations in the Xp22.1-p22.3 chromosome of AMELX (Hartet al. 2000; Lagerstrom et al. 1991; Lagerstrom-fermer et al. 1995; Wrightet al. 2003). To date, there are 18 known AMELX mutations (Hu et al.2012) that result in distinct and variable enamel phenotypes depending onthe type and location of the mutation in the gene (Stephanopoulos et al.2005; Wright et al. 2003). In humans, the phenotypical appearance rangesfrom hypomineralized/hypomature enamel to hypoplastic enamel (Hart etal. 2000). Moreover, X-linked AI affects males and females quite differ-ently. Males have a single copy of the X chromosome therefore the enamelis severely affected because all alleles are affected if there is a mutation,whereas females are less severely affected by a single mutation because they131.5. Amelogenesis imperfectahave two X chromosomes. (Crawford and Aldred 1992). Affected femaleshave a distinctive phenotype that consists of alternating vertical ridges ofnormal and defective enamel, which results from alternative inactivation ofeither one of the X chromosomes, be it the normal or the mutated, in dif-ferent cohorts of enamel-forming cells (Hu et al. 2007). This is known as?lyonization? (Hu et al. 2007).In general, AMELX mutations consist of signal peptide, and mutationsthat causes a total loss of amelogenin protein, missense mutations affectingthe N-terminal region specifically, and mutations affecting the C-terminalregion in specific (Crawford et al 2007).Five AMELX signal peptide mutations have been reported that all resultin the formation of very thin, hypoplastic enamel (Kida et al. 2007; Kimet al. 2004; Lagerstrom-fermer et al. 1995; Sekiguchi et al. 2001b). Theseinclude a deletion of nine nucleotides in exon 2 that replace amino acids 5through 8 with threonine (g.14 22del) (Lagerstrom-fermer et al. 1995), asingle base substitution in exon 2 (g.11G>A) that introduces a prematurestop codon (Sekiguchi et al. 2001b), two missense mutations in exon 2(g.2T>C and g.11G>C) that affect the translation initiation codon and/orthe secretion of amelogenin (Kim et al. 2004), and lastly a missense pointmutation in exon 5 (g.3458C>G) (Kida et al. 2007). With the g.3458C>Gmutation lyonization is observed as the affected females show only verticalridges on normal-sized teeth, whereas the males have a generalized thin,discolored enamel (Kida et al. 2007).There are four mutations that affect the N-terminus of AMELX (Wrightet al. 2003). One involves a single nucleotide substitution in exon 5 (g.3458delC),and a subsequent introduction of a premature stop codon, which results ina hypomineralized/hypomature enamel accompanied with some degrees ofhypoplasia (Aldred et al. 1992; Lench et al. 1994). The other three mu-tations in the N-terminus are single nucleotide substitutions that result insingle amino acid changes leading to formation of a brown discolored enamel(Collier et al. 1997; Hart et al. 2002; Lench and Winter 1995; Ravassipouret al. 2000). While one involves exon 5 (g.3455C>T) and results in hy-pomineralized/hypomature enamel (Lench and Winter 1995), the other twomutations occur in exon 6 (g.3781C>A and g.3803A>T) and produce a hy-pomature enamel (Collier et al. 1997; Hart et al. 2002; Ravassipour et al.2000).There are six mutations that affect the C-terminus of AMELX by intro-ducing a premature stop codon in exon 6 and clinically present as smooth hy-poplastic enamel (g.4046delC, g.4114delC, g.3993delC, g.3958delC, g.4144G>T,and g.4090delC) (Greene et al. 2002; Hart et al. 2002; Kindelan et al. 2000;141.5. Amelogenesis imperfectaLench and Winter 1995; Sekiguchi et al. 2001a; Lee et al. 2011). Five ofthese mutations involve single deletions, while the fifth mutation involves asingle nucleotide change (Stephanopoulos et al. 2005; Lee et al. 2011).Another form of X-linked AI results from a 5 Kb deletion from exon3 to exon 7 that knocks out the AMELX gene (g.1148-54del) and causesa combined phenotype of hypomineralization and hypomaturation of theenamel (Lagerstrom et al. 1991).Lastly, a partial deletion of protein ARHGAP6 that causes the removalof all AMELX, has also been shown to cause X-linked AI (Hu et al. 2012).ARHGAP6 is a GTPase-activating protein of the Rho-GAP family, which isexpressed in different tissues at low levels and regulates actin polymerization(Prakash et al. 2000). The AMELX gene is situated within the first intron ofARHGAP6 (Crampton et al. 2006). Partial deletions of ARHGAP6 whichcause the removal of all AMELX gene results in hypoplastic AI, in whichthe enamel is thin and rough (Hu et al. 2012).Table 1.1 summarizes the different AMELX mutations and their respec-tive genotypes and phenotypes.In summary, signal peptide mutations and mutations in the C-terminusof the protein result in hypoplastic forms of X-linked AI, while mutations inthe N-terminus are associated with hypomineralized/hypomature X-linkedAI (Kang et al. 2009; Lee et al. 2011). Despite the number of mutationsthat have been identified, only 5% of families with AI show an X-linkedpattern (Backman and Holmgren 1988).Amelogenin knockout mice display thin hypoplastic enamel, which is dis-organized due to a total loss of prism structure (Gibson et al. 2001). More-over, their incisors and molars fracture frequently, and there is a markedchalky-white discoloration of the incisors (Gibson et al. 2001). This amelo-genin null phenotype indicates that amelogenins are indeed responsible forthe organization of crystal pattern and play a role in the regulation of enamelthickness (Gibson et al. 2001).151.5.AmelogenesisimperfectaTable 1.1: AMELX mutations.Location Protein Gene Inheritance Phenotype ReferencesIntron 1 ARHGAP6 g.302534 398773del96240 X-linked Hypoplastic Hu et al. (2012)Exon 2 ARHGAP6 g.363924416577del52654insAX-linked Hypoplastic Hu et al. (2012)Exon 2 p.I5 A8delinsT g.14 22del X-linked Hypoplastic Lagerstrom-Fermeret al. (1995)Exon 2 p.W4X g.11G>A X-linked Hypoplastic Sekiguchi et al.(2001)Exon 2 p.M1T g.2T>C X-linked Hypoplastic Kim et al. (2004)Exon 2 p.W4S g.11G>C X-linked Hypoplastic Kim et al. (2004)Exon 5 p.52R g.3458C>G X-linked Hypoplastic Kida et al. (2007)Exon 5 p.P52fsX53 g.3458delC X-linked Hypomineralized/HypomatureAldred et al. (1992)Lench et al. (1994)Exon 5 p.T51I g.3455C>T X-linked Hypomineralized/HypomatureLench and Winter(1995)Exon 6 p.70T g.3781C>A X-linked Hypomature Collier et al. (1997)Hart et al. (2000)Ravassipour et al.(2000)Exon 6 p.77L g.3803A>T X-linked Hypomature Hart et al. (2002)Exon 6 p.P158HfsX187 g.4046delC X-linked Smooth hypoplas-ticLench and Winter(1995)Exon 6 p.L181CfsX187 g.4114delC X-linked Smooth hypoplas-ticKindelan et al.(2000) Hart et al.(2002)Exon 6 p.Y147fsX187 g.3993delC X-linked Smooth hypoplas-ticGreene et al.(2002)Exon 6 p.H129fsX187 g.3958delC X-linked Smooth hypoplas-ticSekiguchi et al.(2001)Exon 6 p.E191X g.4144G>T X-linked Smooth hypoplas-ticLench and Winter(1995)Exon 6 p.P173LfsX16 g.4090delC X-linked Hypoplastic Lee et al. (2011)Exon 3-Exon 7p.18del g.1148 54del X-linked Hypomineralized/HypomatureLagerstrom et al.(1991)161.5. Amelogenesis imperfecta1.5.3 Mutations in the enamelin gene (ENAM)Enamelin, the largest and the least abundant enamel protein, plays a rolein enamel mineralization and crystal elongation (Chan et al. 2010; Hu etal. 2000; Hu et al. 2007). Human enamelin is localized on chromosome4 (4q11-q21) and consists of nine exons and eight introns (Crawford et al.2007; Dong et al. 2000; Hu et al. 2000; Hu et al 2001; Rajpar et al. 2001).There are 12 known ENAM mutations and the associated phenotype rangesfrom minor localized hypoplastic enamel to severe hypoplastic enamel (Chanet al. 2010; Simmer et al. 2012).Most ENAM mutations cause an autosomal-dominant hypoplastic formof AI. The first ENAM mutation identified consists of a G to A transition inintron 8 (g.6395G>A), which causes a deletion of exon 8 and a subsequentformation of a severe form of autosomal-dominant smooth hypoplastic AI(Rajpar et al. 2001). A clinical manifestation of small, yellow teeth withlittle or no enamel layer is observed (Rajpar et al. 2001). An upstream trans-lation termination codon in exon 5 (g.2382A>T) and a splice accepter sitemutation in intron 6 (g.4806A>C) both result in formation of autosomal-dominant local hypoplastic AI (a milder form of AI), in which, patientshave sensitive teeth and show localized enamel pits and horizontal grooves(Kim et al. 2005a; Kim et al. 2006; Mardh et al 2002). A missense mu-tation in exon 10 (g.12663C>A), which introduces a premature stop codonand truncates the enamelin protein after 246 amino acids, also results information of autosomal-dominant localized enamel hypoplasia (Ozdemir etal. 2005a). A splice donor site mutation of a single-G deletion at the endof exon 9 and the beginning of intron 9 (g.8344delG) results in autosomal-dominant smooth hypoplastic AI (Hart et al. 2003a; Kida et al 2002; Kimet al. 2005a; Pavlic et al. 2007). These patients have yellow colored teeththat are hypersensitive to cold stimuli and a thin enamel layer with a sur-face texture that varies from smooth to rough with or without horizontalgrooves (Hart et al. 2003a; Kida et al 2002; Kim et al. 2005a; Pavlic etal. 2007). A substitution of guanine with thymine in exon 9 (c.G817T)also results in autosomal-dominant hypoplastic AI with a manifestation ofsevere generalized hypoplastic enamel (Gutierrez et al. 2007). Lastly, anovel heterozygous in exon 4 of ENAM has recently been identified, whichcauses a frameshift in the coding region of the signal peptide and results inhypoplastic AI (Simmer et al. 2013).Other ENAM mutations result in dose-dependent associated phenotypes(Chan et al. 2010; Hart et al. 2003; Ozdemir et al. 2005a; Pavlic etal 2007). A 2bp (AG) insertion mutation in exon 10 of ENAM 4q13.3171.5. Amelogenesis imperfecta(g.13185/6insAG) introduces a premature termination codon and resultsin the formation of hypoplastic enamel (Chan et al. 2010; Hart et al. 2003;Kang et al. 2009; Ozdemir et al. 2005a; Pavlic et al. 2007). While se-vere generalized hypoplastic defects with an anterior open bite is inher-ited in an autosomal recessive pattern in the homozygous individuals, lo-calized hypoplastic enamel pittings (with or without open bite) with achalky white colored enamel is inherited in an autosomal dominant pat-tern in the heterozygous members (Chan et al. 2010; Hart et al. 2003;Ozdemir et al. 2005a; Pavlic et al. 2007). In fact, some heterozygousmembers of this mutation show no detectable enamel defect at all (Kang etal. 2009). Compound heterozygotes for the mentioned mutation (the AGinsertion in exon 10) and a novel insertion mutation of seven amino acids(g.12946 12947insAGTCAGTACCAGTACTGTGTC) also display a severegeneralized hypoplastic autosomal-recessive AI (Ozdemir et al. 2005a). Asingle T deletion in exon 10 (g.14917delT) results in a premature termi-nation codon and the subsequent formation of hypoplastic enamel in anautosomal-dominant pattern (Kang et al. 2009). The heterozygote indi-viduals for this mutation also display a dose-dependent phenotype rangingfrom chalky white enamel with mild localized pitting to prominent horizontalgrooves and hypoplasia (Kang et al. 2009). Lastly a missense ENAM muta-tion (g.12573C>T) that replaces leucine for a phosphorylated serine resultsin the formation mildly hypoplastic enamel and only localized pitting in het-erozygotes, but severe hypoplasia and enamel malformations are observedin homozygote individuals (Chan et al. 2010). These findings indicate thatENAM mutations may result in dose-dependent enamel phenotypes; gener-alized hypoplastic AI segregating as a recessive trait and localized enamelpitting segregating as a dominant trait (Chan et al. 2010; Ozdemir et al.2005a). Table 1.2 summarizes the different ENAM mutations and their re-spective genotypes and phenotypes.Similar to the AI cases in humans, enamelin defects in mice is also dose-dependent and thus heterozygous enamelin knockout (Enam+/-) and ho-mozygous enamelin knockout (Enam-/-) mice possess very different pheno-types (Hu et al. 2008). The Enam+/- mice have relatively mild defects ingeneral and have maxillary incisors that phenotypically range from havinga smooth, brownish yellow colored enamel to a chalky white colored enamel(Hu et al. 2008). While the maxillary incisors are somewhat similar to thewild-type mice, the mandibular incisors are rough, and blunt, with a chalkywhite colored enamel that has lost its translucency (Hu et al. 2008). Al-though some enamel abrasion is evident in the molar cusps, the molars inthese mice are normal for the most part (Hu et al. 2008).181.5. Amelogenesis imperfectaOn the other hand, enamel abnormalities are evident on all the teeth inthe Enam-/- mice. In these animals, both the maxillary and the mandibularincisors show rough and broken surfaces with a white opaque appearance,while the molar cusps display severe coronal wear (Hu et al. 2008). Further-more, the less the amount of enamelin present, the less mineralization thattakes place. As such, enamel proteins are accumulated in the extracellu-lar space of ameloblasts in Enam-/- mice without any mineralization takingplace (Hu et al. 2008). In fact, these mice lack true enamel altogether, andtheir teeth are rather covered by a thin layer of mineral that is formed by acompletely different mechanism (Hu et al. 2008).Mice that have a mutated enamelin gene display similar defects thanthose observed in the ENAM knockout mice. The homozygous mutatedmice show a complete loss of enamel on the incisors and molars, while theheterozygous mice had rough and cracked enamel surfaces (Masuya et al.2005; Seedorf et al. 2004; Seedorf et al. 2007). Overall, enamelin mutatedmice have a similar phenotype as the hypoplastic forms of AI (Masuya etal. 2005; Seedorf et al. 2004; Seedorf et al. 2007). The defects displayed byenamelin mutated mice and knockout mice emphasize the critical role thatenamelin plays in enamel crystal elongation and mineralization.191.5.AmelogenesisimperfectaTable 1.2: ENAM mutationsLocation Protein Gene Inheritance Phenotype ReferencesExon 4 p.Asn36Ilefs56 g.2979delA AD Local Hypoplastic Simmer et al.(2013)Exon 5 p.K53X g:2382A>T AD Local hypoplastic Mardh et al. (2002)Kim et al. (2006)Intron 6 p.M71 Q157del g.4806A>C AD Local Hypoplastic Kim et al. (2005)Intron 8 p.A158 Q178del g.6395G>A AD Smooth hypoplas-ticRajpar et al.(2001)Exon 9 p.R179M c.G817T AD Hypoplastic Gutierrez et al.(2007)Intron 9 p.N197fsX277 g.8344delG AD Smooth hypoplas-ticKida et al. (2002)Hart et al. (2003)Kim et al. (2005)Pavlic et al. (2007)Exon 10 p.S216L g.12573C>T AR; AD-localizedenamelpittingGeneralized hy-poplastic (recessivetrait); Localizedenamel pittings(dominant trait)Chan et al. (2010)Exon 10 p.S246X g.12663C>A AD Local hypoplastic Ozdemir et al.(2005)Exon 10 p.V340-M341insSQYQYCVg.12946 12947insAGTCAGTACCAGTACTGTGTCAR;AD-localizedenamelpittingGeneralized hy-poplastic (recessivetrait); Localizedenamel pittings(dominant trait)Ozdemir et al.(2005)Exon 10 p.P422fsX448 g.13185/6insAG AR;AD-localizedenamelpittingGeneralized hy-poplastic (recessivetrait); Localizedenamel pittings(dominant trait)Hart et al. (2003)Ozdemir et al.(2005) Pavlic et al.(2007) Kang et al.(2009) Chan et al.(2010)Exon 10 p.P998fsX1062 g.14917delT AD Hypoplastic Kang et al. (2009)Not men-tioned inthe studyp.R179-N196del g.9045A>G AD Hypoplastic Wright et al.(2011)201.5. Amelogenesis imperfecta1.5.4 Mutations in the enamelysin gene (MMP20)MMP20 is a tooth specific gene that is located on chromosome 11 (11q22.3-q23) (Llano et al. 1997) and is comprised of ten exons and nine introns(Caterina et al. 2002). This proteinase is expressed by ameloblasts duringthe secretory and early maturation stages of amelogenesis and plays a rolein removing enamel matrix proteins (Hu et al. 2002). To date, three muta-tions have been identified in the enamelysin gene, all of which result in anautosomal recessive form of hypomatured AI (Kim et al. 2005b; Ozdemir etal. 2005b; Papagerakis et al. 2008). The first is a point mutation in intron6 (g.IVS6S-2A>T) that destroys the splice acceptor and results in the for-mation of a hypomature enamel (Kim et al. 2005b). The second MMP20mutation involves a single base mutation in exon 5 (g.16250T>A) that altersthe amino acid histidine to glutamine (Ozdemir et al. 2005b). Individualshomozygous for these two types of MMP20 mutations have an anterior openbite with discolored, pigmented, opaque teeth; the teeth have a rough sur-face and are very brittle, even though they are of normal thickness (Kimet al. 2005b; Ozdemir et al. 2005b). This is typically the phenotype thatis associated with autosomal recessive pigmented hypomaturation AI (Kimet al. 2005b; Ozdemir et al. 2005b). The third point mutation takes placein exon 1 of MMP20 (g.102G>A) and introduces a premature stop codonwhich causes autosomal recessive hypoplastic-hypomature AI (Papagerakiset al. 2008). These individuals have very thin, hypomineralized enamel thathas yellowish pigmentation and chips away easily (Papagerakis et al. 2008).MMP20 null mice display a severe AI phenotype (Caterina et al. 2002).These mice do not process amelogenin properly, have an altered enamelmatrix and rod pattern, display severe attrition of the molars, and havehypoplastic enamel that does not adhere properly to dentin (Caterina etal. 2002). Furthermore, unlike the wild-type and heterozygous animals,the enamel matrix in the MMP20 null mice is not removed nor processedin the secretory stage of enamel development; in fact the enamel matrixpersists even in the late maturation stage of amelogenesis (Caterina et al.2002). Lastly, the enamel mineral in the MMP20 null mice is reduced by50% and its hardness is decreased significantly compared to the wild-typemice (Bartlett et al. 2004). This mouse model indicates that MMP20 isessential for processing and removal of the enamel matrix proteins, espe-cially amelogenins, in the secretory and maturation stages of amelogenesis;overall, a lack of this proteinase has profound effects on enamel development(Bartlett et al 2004; Caterina et al. 2002). Similar to heterozygous humans,heterozygous mice have a normal phenotype, thus suggesting that one func-211.5. Amelogenesis imperfectational MMP20 allele is sufficient for normal enamel formation (Caterina etal. 2002; Ozdemir et al. 2005b).1.5.5 Mutations in the kallikrein-4 gene (KLK4)KLK4 gene is on chromosome 19 (19q13.3-13.4) and consists of six exons andfive introns (DuPont et al. 1999; Hu et al. 2000). Its expression starts duringthe transition and maturation stages of enamel formation and continuesthrough tooth eruption where it is responsible for further degradation ofamelogenin cleavage products (Hu et al. 2002). Although the expression ofKLK4 and MMP20 are temporally different, mutation in KLK4 also causesautosomal recessive pigmented hypomaturation AI with a similar phenotypeas the AI caused by a mutated MMP20 gene (Hart et al. 2004; Wright etal. 2006). KLK4 mutation occurs in exon 4 (G.2142G>A) and results ina truncated KLK4 that lacks S207 of the catalytic triad, which is essentialfor the protein?s proteolytic activity (Hart et al. 2004). Similar to the firsttwo types of MMP20 mutations mentioned, KLK4 mutation result in anenamel with a normal thickness and prismatic architecture (Hart et al 2004;Wright et al. 2006). However, the enamel formed is discolored, incompletelymineralized, and has an increased protein content (Hart et al. 2004; Wrightet al. 2006).As for the KLK4 knockout mice, heterozygous and homozygous micedevelop quite different phenotypes. While the tooth shape, size and color ofheterozygous mice are very similar to the wild-type, the homozygous miceposses chalky white enamel that easily chips away and is abraded followingweaning (Simmer et al. 2009). Although the enamel crystallites of KLK4null mice do not fully mature, the enamel layer achieves normal thicknessand width (Simmer et al. 2009). Furthermore, lack of KLK4 results in ahigh retention of enamel proteins which act as a physical barrier and blockthe expansion and maturation of crystals (Simmer et al. 2009). In this case,individual enamel crystallites fail to grow together and interlock (Simmeret al. 2009). The observations from human cases and mouse experimentsshow that KLK4 is critical for removal of enamel proteins, crystallite growthand enamel mineralization; however, it does not play a major role in enamelthickness (Hart et al 2004; Simmer et al. 2009; Wright et al. 2006).221.5. Amelogenesis imperfecta1.5.6 Mutations in the family with sequence similarity 83,member H gene (FAM83H)FAM83H is located on chromosome 8q24.3 and while its function is not wellknown yet, the protein appears to be associated with intracellular vesiclesand trans Golgi organelle (Ding et al. 2009). Interestingly, the FAM83His one of the two genes (other one being WDR72) that plays a role in theetiology of AI which does not encode for a secreted protein (Ding et al.2009). Although FAM83H is expressed in developing teeth, its expression isnot confined to teeth and its role in amelogenesis is unknown (Kweon et al.2013; Lee et al. 2009). Furthermore, even though the protein is expressedin many other tissues throughout the body, no defects in these tissues havebeen identifies in the AI patients (Kweon et al. 2013).Mutations in FAM83H are the only known cause of autosomal dominanthypocalcified AI, and account for the highest percentage and most severecases of AI than any other gene mutations (Lee et al. 2011). All of the AI-causing mutations in FAM83H thus far have been either frameshift or non-sense mutations in the last coding exon (exon5), which results in a truncatedprotein (Kim et al. 2008; Lee et al. 2008; Hart et al. 2009; Wright et al.2009; El-Sayed et al. 2010; Lee et al. 2011). While most of the mutationsresult in a hypocalcified enamel covering the whole crown, the more down-stream mutations result in a localized phenotype confined to the cervicalhalf of the crown only (Wright et al. 2009). To date, 16 novel mutationshave been identified, all of which cause premature translation terminationbetween the amino acids Ser287 and Glu694 (Lee et al. 2011).Mice that overexpress FAM83H gene have shown to not have any enameldefects (Kweon et al. 2013). Further animal research is needed to shed lighton the role of this gene in amelogenesis.1.5.7 Mutations in the family with sequence similarity 20,member A gene (FAM20A)Mutations in the family with sequence similarity 20, member A gene isyet another novel mutation that plays a role in the etiology of AI. Familywith sequence 20 (FAM20) has three members: FAM20A, FAM20B, andFAM20C (Nalbant et al. 2005). FAM20 protein family plays different rolesin mineralized tissue. FAM20B is a kinase implicated in phosphorylationand control of proteoglycans, and it is expressed during the maturationstage of amelogenesis (Koike et al. 2009; O?Sullivan et al. 2011). FAM20Chas been shown to be an essential gene for normal bone development (Hao231.5. Amelogenesis imperfectaet al. 2007; Simpson et al. 2007; Wang et al. 2010; Ishikawa et al. 2012).Although the exact function of FAM20A is yet to be determined, the geneis located on chromosome 17q24.2 and it is expressed in the enamel organand the gingiva (Cho et al. 2012; O?Sullivan et al. 2011). Mutations in theFAM20A gene causes hypoplastic AI and gingival overgrowth (Cho et al.2012, O?Sullivan et al. 2011). Furthermore, prolonged retention of primaryteeth, intrapulpal calcificaition and delayed eruption of permanent teeth aresome other features that are found in these AI patient (O?Sullivan et al.2011).1.5.8 Mutations in the WD repeat-containing protein 72gene (WDR72)Recently, novel mutations in the WDR72 gene have been identified as asignificant cause of autosomal recessive hypomaturation AI (El-Sayed et al.2009; El-Sayed et al. 2011). WDR72 is an intracellular protein with a ?propeller structure, and plays a role in protein-protein interactions; however,its exact function is unknown for the most part (El-Sayed et al. 2009; El-Sayed et al. 2011). A point mutation in exon 15 of WDR72 (c.2348C>G)results in a premature stop codon, causing hypomaturation AI (El-Sayedet al. 2009; El-Sayed et al. 2011). Although the mechanism by which thismutation results in hypomaturation AI is not known, it is suggested that thelate stage of enamel maturation is affected (El-Sayed et al. 2009; El-Sayed etal 2011). More research and animal experiments are needed to understandthe role of WDR72 in amelogenesis.1.5.9 Mutations in the distal-less homeobox 3 gene (DLX3)The DLX3 gene is a homeodomain transcriptional factor that is expressed indental epithelium and mesenchyme, as well as in other locations such as dif-ferentiating epidermal cells, neural crest, hair follicles, and placenta (Beananand Sargent 2000). This factor behaves as a transcriptional activator andis located on chromosome 17 (q21 ? q22) (Dong et al. 2005). A two basepair deletion in this gene results in a frameshift alteration and introduces apremature stop codon that truncates the protein by 88 amino acids (Donget al. 2005). This results in the formation of a unique kind of syndromic AIknown as AI hypomaturation-hypoplasia type with taurodontism (AIHHT)(Dong et al. 2005). This is inherited in an autosomal dominant patternand manifests as thin, hard enamel with an enlarged pulp chamber (Donget al. 2005). Diagnosis of AIHHT should not be confused with tricho-dento-241.6. Dental management of patients with AIosseous (TDO) syndrome, which is also an autosomal dominant syndrome.TDO syndrome is caused by a four base pair deletion in DLX3 and manifestsas kinky, curly hair at birth, enlarged pulp chambers, enamel defects, andusually is accompanied by craniofacial abnormalities (Beanan and Sargent2000; Price et al. 1998).In mouse development, DLX3 is essential for embryonic survival and assuch the early lethality of the DLX3 knockout mice makes it very difficultto study the enamel formation later in development of these mice (Beananand Sargent 2000).1.6 Dental management of patients with AIDental management of AI patients is very complex in both the functional andesthetic aspects. In the past, patients with AI were treated with extractionsand the construction of complete removable dentures (Gokce et al. 2007).Recently however, bonded porcelain inlays, stainless steel crowns, metal-ceramic crowns, and adhesive plastic restorations are used more commonlyas means of treatment. The treatment plan for an AI patient must takeinto consideration many factors such as the patient?s age and socioeconomicstatus, the type of AI and the severity of the disorder, and the patient?sintraoral condition (Akin et al. 2007).Pediatric dentists play a crucial role in the early diagnosis and man-agement of AI. The goal is to maintain the health of the primary teeth asmuch as possible, and to closely monitor the development of the permanentteeth (Ng and Messer 2009). When the patient has mixed dentition, thetreatment?s aim is to improve esthetics, reduce dental hypersensitivity andattrition, maintain the vertical dimension, and restore the masticatory func-tion (Pires dos Santos et al. 2008). As such, the treatment of AI starts inchildhood and is based on early prevention and intervention (Crawford etal. 2007), which includes meticulous oral hygiene and protection of teethwith different types of crowns.Maintaining good oral hygiene and reducing the risk of getting dentalcaries are very important, as poor dental and gingival health further compli-cate the restorative management of the teeth (Sapir and Shapira 2007). Thechild?s diet should be modified to minimize taking cariogenic foods, whichcontain a high amount of sugar, stick to the tooth, and are erosive. Oral hy-giene instructions should include proper toothbrush and brushing method,and the use desensitizing toothpaste (Sapir and Shapira 2007). Further-more, topical use of fluoride, and daily use of sodium fluoride rinse, and251.6. Dental management of patients with AIcasein phosphopeptide-amorphous calcium phosphate must be implementedearly (Ng and Messer 2009). Together, these help to resist demineralization,decrease tooth sensitivity, reduce caries risk, and enhance enamel remineral-ization (Ng and Messer, 2009; Sapir and Shapira 2007). Lastly, the patientshould regularly receive professional tooth cleaning and calculus removal toimprove periodontal health (Ng and Messer 2009).Full coverage restorations are considered to be one of the most effec-tive ways of managing tooth sensitivity and poor esthetics in children (Ngand Messer 2009). Stainless steel crowns (SSC) are often used to coverthe primary and permanent molars, as early as possible (Ng and Messer2009; Pires dos Santos et al. 2008; Sapir and Shapira 2007). SSCs main-tain the vertical dimension of occlusion, conserve tooth vitality, integrityand prevent posteruptive breakdown, manage tooth sensitivity, and estab-lish correct interproximal and occlusal relationship (Ng and Messer 2009;Sapir and Shapira 2007). SSCs are also quick and easy to place, which isan advantage particularly when managing children (Ng and Messer 2009),and are not as costly or technique sensitive as cast restorations (Sapir andShapira 2007). However, SSCs require quite a bit of tooth preparation andneed to be replaced with cast restorations later on (Ng and Messer 2009).As for the anterior primary teeth, crown restoration with resin compositeor laminate veneers may be used (Ng and Messer 2009). Indirect resin crown(IRC) is suggested by some authors as an optimal intermediary treatmentoption for AI patients with mixed dentition (Quinonez et al. 2000). IRCs arevery cost effective and provide very good esthetics for children (Quinonez etal. 2000). Moreover, with the continued tooth eruption, IRCs can be easilymodified at the gingival margin by adding composite resin to the exposedmargin (Quinonez et al. 2000).Treating the permanent dentition in an AI patient is more complex andrequires a multidisciplinary approach which includes periodontic, orthodon-tics, endodnotic, and prosthodontic treatments (Ng and Messer 2009). Or-thodontic treatment can help to close spaces between teeth and fix the mal-occlusion, or to separate teeth before crown placement in order to conservetooth material in permanent teeth (Sapir and Shapira 2007). However,retention of orthodontic brackets to teeth may be a problem in some AIpatients (Sapir and Shapira 2007). In some cases, a headgear is fabricatedto be worn at night time in order to fix the occlusion (Sapir and Shapira2007).Simple microabrasions (mostly in cases of hypomaturation AI), gold orstainless steel crowns, all ceramic crowns, metal-ceramic crowns, porcelainlaminate veneers, porcelain onlays, direct resin composite restorations, indi-261.6. Dental management of patients with AIrect resin composite laminate veneers, and indirect resin composite partial orfull crowns are some of the treatment options that may be used to improveesthetics and/or restore teeth with posteruptive breakdown (Yamaguti etal. 2006). Gold based alloys are considered a good choice because they arequite wear resistant and also cause minimal wear of the opposing enamel (Ngand Messer 2009; Yamaguti et al. 2006). However, they have an unnaturalappearance and should be used for the posterior teeth mostly (Yamagutiet al. 2006). Metal-ceramic crowns on the other hand provide a more ap-pealing esthetics, but they are abrasive to the opposing tooth enamel andas such, this limits their use in AI patients who have a fragile enamel tobegin with (Yamaguti et al. 2006). All ceramic crowns are not as strong asmetal crowns, have a brittle characteristic, and also wear down the oppos-ing enamel (Yamaguti et al. 2006). However, they provide great estheticsand therefore they may be used as an anterior teeth restoration (Ng andMesser 2009). Porcelain laminate veneers are also a popular choice for thetreatment of anterior teeth. Unlike complete crown restoration that is aninvasive procedure with a substantial amount of tooth removal, veneers pro-vide the same optimal esthetics with a very conservative tooth preparation(Yamaguti et al. 2006). Veneers are however not a good choice if the patientsuffers from tooth sensitivity (Ng and Messer 2009).Recently, the use resin composite restoration associated with glass ionomercements has increased (Sabatini and Guzman-Armstrong 2009; Yamagutiet al. 2006). Resin composite restorations provide excellent esthetics andtooth preservation; however, bonding resin composite to AI-affected enamelcould be an issue. The bond strength between the resin composite and hy-pomineralized enamel is severely compromised compared to normal enamel(Sapir and Shapira 2007). The bond between the enamel and the restorationgreatly depends on the enamel surface changes after acid etching, and somestudies have shown that phosphoric acid that is commonly used to etch theenamel may cause more enamel loss than the self-etching primers (Seow andAmaratunge 1998; Sapir and Shapira 2007). Therefore, self-etching primersmay be used as an alternate means of preparing the tooth for the resincomposite bond (Sapir and Shapira 2007; Sabatini and Guzman-Armstrong2009). Self-etching primers are also recommended to use in AI patients be-cause they are simple to use, require few steps and less time, and cause lesspostoperative sensitivity (Sapir and Shapira 2007). Furthermore, some self-etching primers have fluoride releasing properties and an antibacterial com-ponent, both of which are advantageous to AI patients (Sapir and Shapira2007). The overall literature however, does suggest that typical etch pat-terns are produced in most variants of the AI, except in smooth hypoplastic271.7. Other mutations in mice that affect the enamel formationAI (Seow and Amaratunge 1998), and therefore bonding of resin compositeshould be feasible in most of the AI patients. Moreover, some authors sug-gest that pre-treating the enamel with 5% sodium hypochlorite removes theexcess non-mineralized acid insoluble proteins from teeth, and significantlyenhances the bond strength (Seow and Amaratunge 1998; Ng and Messer2009). It is also essential to remove all clinically defective, soft enamel inorder to obtain a stronger resin bond to the potentially underlying normalenamel (Sabatini and Guzman-Armstrong 2009). The disadvantage of com-posite resins is its undesirable properties such as microleakage, staining, lowabrasion resistance, and plaque accumulation (Saha and Saha 2011).In conclusion, the dental management of AI patients is very complexand case specific. It starts with proper diagnosis and early intervention inchildhood. The treatment includes many disciplines and modalities, andrequires follow-up and maintenance to achieve long-term success. Moreover,these patients require substantial emotional support, especially in the casesof children and adolescents.1.7 Other mutations in mice that affect theenamel formationAside from the discussed genes that play a role in the etiology of AI inhumans, there are a number of other genes that play pivotal roles in amelo-genesis, and their mutations cause various enamel defects in transgenic mice.Table 1.3 which is adapted from a review paper shows a list of enamel de-fects that are caused by different mutations in transgenic mice (Bei 2009).These different genes are responsible for cell-signalling, cell-cell adhesion,and transcription factors which affect the amelogenesis process. Below, afew examples of the selected genes that result in formation of a defectiveenamel are discussed.Cell signalling molecules are essential endogenous factors that play arole in ameloblast cell differentiation (Bei 2009). TGF-?1 is a cell signallingmolecule which is a member of the TGF-? super-family. It is expressed dur-ing early development in different tissues and cells, including the ameloblastcell (Chai et al. 1994; Chai et al. 1999; Pelton et al. 1991). TGF-? and itsreceptors have numerous functions such as regulating the immune response,cell proliferation and differentiation (Taipale Saharinen and Keski-Oja 1998;Haruyama et al. 2006). There are also important in regulating tooth devel-opment during the early stages (Chai et al. 1994; Chai et al. 1999; Peltonet al. 1991). Overexpression of TGF-?1 under the dentin sialoprotein pro-281.7. Other mutations in mice that affect the enamel formationmoter in teeth has shown to result in a pitted and hypoplastic enamel in mice(Haruyama et al. 2006). The observed phenotype is due to an early andabnormal detachment of the ameloblast cells from the underlying dentin,and formation of cysts that contain hypomineralized matrices near the DEJ(Haruyama et al. 2006).Smad3 is a member of Smad proteins, which are intracellular signalingmolecules that mediate the signals from activin and TGF-? super familyreceptors to the nucleus (Yokozeki et al. 2003). Mice that lack the Smad 3gene have severely hypomineralized enamel in their molars and incisors, dueto defective protein removal at the maturation stage (Yokozeki et al. 2003).The defective enamel has a normal thickness and rod and interred structure,which indicate that the secretory stage of amelogenesis is not affected inthese transgenic mice (Yokozeki et al. 2003). The Smad3 null mice also havea decreased inflammatory response and accelerated wound healing (Yokozekiet al. 2003). From the observed results it can be hypothesized that Smad3is critical for enamel biomineralization, and that the activin and TGF-?signaling may be essential for this process to take place normally (Yokozekiet al. 2003).Cell adhesion molecules such as laminins and integrins are strongly ex-pressed by secretory ameloblasts and play a role in regulating ameloblastcytodifferentiation (Bei 2009). Laminins are a family of extra-cellular ma-trix proteins that play a role in cell differentiation, migration, and adhesion(Yoshiba et al. 1998). Laminin-5 (Laminin-332), in specific, regulates ep-ithelial cells adhesion and mobility via integrins ?6?4 and ?3?1, and itsisoforms are expressed in the basement membrane of secretory ameloblasts(Yoshiba et al. 1998; Ryan et al. 1999). Laminin-5 plays a role in thelate stage differentiation of ameloblast cells and thus, when it is mutated,the ameloblast terminal differentiation is affected and hypoplastic enamel isformed (Ryan et al. 1999). The seceretory amloblasts of mice with a mu-tated laminin 5 alpha 3 produce very little enamel matrix (Ryan et al. 1999,Bei 2009). It is postulated that the laminin-5 interactions with the integrin?4 is critical in stabilizing the ameloblast cells structure and architecture(Ryan et al. 1999, Bei 2009). The absence of laminin 5 alpha 3 chain altersthe ameloblast adhesion and subsequently its structure and function, whichleads to a formation of defective and reduced enamel (Ryan et al. 1999).Transcription factors have also been shown to be critical for amelogen-esis. The homeobox gene Msx2 is part of the Msx homeobox gene familyand is expressed at numerous tissues including the eyes, hair follicles, andteeth (Satokata et al. 2000; Bei et al. 2004; Bei 2009). Mutations in Msx2gene affect the development of dentition in several different ways (Satokata291.7. Other mutations in mice that affect the enamel formationet al. 2000). Mice lacking the homeobox gene Msx2 exhibit defects in cuspmorphpogenesis, and have severely misshaped teeth (Bei et al. 2004). Fur-thermore, in the Msx2 knockout mice, the secretory ameloblasts produce aseverely hypoplastic enamel (Bei et al. 2004). The ameloblast cells of thesemice lose their cell-cell adhesion, and exhibit a poorly formed hemidesmo-somes, indicating the critical role of Msx2 in cell adhesion (Bei et al. 2004).Moreover, Msx2 controls the expression of laminin 5 alpha 3 chain in se-cretory ameloblasts (Bei et al. 2004). Interestingly, the mutations in Msx2and laminin 5 alpha 3 chain both result in reduced enamel deposition and avery similar phenotype, supporting the hypothesis that these genes functionwithin the same genetic pathway (Bei et al. 2004; Bei 2009).301.7.OthermutationsinmicethataffecttheenamelformationTable 1.3: Mutations in transgenic mice that cause enamel defectsGene Mutation Enamel phenotype ReferencesSp3 Knockout Hypoplastic Bouwman et al. (2000)Sp6 Knockout Hypoplastic Nakamura et al. (2008), Ruspita et al. (2008)Msx2 Knockout Hypoplastic Satokata et al. (2000), Bei et al. (2004)Smoothened K14 conditionalknockoutHypoplastic Gritli-Linde et al. (2002)Lama3 Knockout Hypoplastic Ryan et al. (1999)TGF?1 Overexpression(DSPP conditionalknockout)Hypoplastic Haruyama et al. (2006)Eda Overexpression(under K14 pro-moter)No enamel Mustonen et al. (2004)Wnt3 Overexpression(under K14 pro-moter)No enamel Millar et al. (2003)Follistatin Overexpression(under K14 pro-moter)No enamel Wang et al. (2004)Follistatin Knockout Ectopic enamel Wang et al. (2004)Gdnf Knockout No enamel de Vicente et al. (2002)Periostin Knockout Enamel defect Rios et al. (2005); Ma et al. (2011)Ameloblastin Knockout No enamel Fukumoto el al. (2005)Smad 3 Knockout Hypomineralized Yokozeki et al. (2003)Connexin 43 Dominant negative Hypoplastic Dobrowolski et al. (2008)311.8. Structure and function of integrins1.8 Structure and function of integrinsIntegrins comprise a large family of heterodimeric cell surface protein recep-tors, found to be critical for embryogenesis (Campbell and Humphries 2011;Giancotti 1997; Hynes 2004). They mediate cell-to-cell or cell-to-matrixadhesion and signaling in most cell types (Campbell and Humphries 2011;Giancotti and Ruoslahti 1999; Hynes 2004). Integrins are composed of twonon-covalently associated transmembrane subunits, ? and ?, which typicallyhave a long extracellular domain and a short intracellular domain (Hynes1992). The integrin ?6?4 is an exception in this regard, as it possesses along cytoplasmic tail (Suzuki and Naitoh 1990; Tamura et al. 1990). Thereare 18 ? and 8 ? subunits in vertebrates that dimerize to form 24 differentintegrins, each with a different tissue distribution, binding specificity, andsignalling properties (Barczyk Carracedo and Gullberg 2010; Hynes 2002;Hynes 2002).In order for integrins to get activated, intracellular cell signals need to in-teract with the cytoplasmic domain of integrins leading to a conformationalchange in the extracellular portion of the integrin (Larjava et al. 2011). Theinactive bent integrin changes into its activated extended form, which ex-poses the ligand binding site (Larjava et al. 2011). This process is referredto as inside-out activation (Larjava et al. 2011).Upon activation, integrins bind to a number of different ligands, manyof which are shared targets amongst the family members (Bouvard et al.2001; Hynes 1992). In addition to binding to extracellular matrix (ECM)ligands, integrins may also serve as receptors for many viruses and bacteria(Hynes 2002).The cytoplasmic tails of the integrins function in the binding and reorga-nization the actin cytoskeleton of a cell, which initiates a positive feedbacksystem in which more integrins cluster and further organization of the actinfilaments takes place. In the case of ?6?4 integrin, it binds to intermedi-ated filaments rather than actin filaments due its large intracellular domain(Hynes 2002; Giancotti and Ruoslahti 1999; Tarone et al. 2000). This re-sults in the formation of aggregates known as ?focal adhesions?, composedof extracellular matrix proteins, integrins, and intra- and extracellular com-ponents of the cytoskeleton (Burridge and Chrzanowska-Wodnicka 1996).The focal adhesions are tightly controlled and allow for cell migration andadhesion to occur.Besides their role in organization of the cytoskeleton and their integrationwith the ECM, integrins play a pivotal role in transducing signals throughthe cell membrane, in either direction (Giancotti and Ruoslahti 1999). These321.9. ?v?6 integrinsignals have been found to regulate cell survival, proliferation, and cycle(Giancotti 1997; Hynes 1992).The critical role that integrins play in biological processes is clearlydemonstrated in integrin deficient and transgenic animals. Ablation of in-tegrin genes results in various functional deficiencies such as defects in thekidneys, lungs and skin, to embryonic inviability, to name a few examples(Bouvard et al. 2001).Research regarding integrin expression during tooth development hasshown that tooth epithelium express ?6, ?v, ?1, ?4, and ?5 integrin subunits(Salmivirta et al. 1996). Furthermore, the secretome of rat incisor enamelorgan has been reported to include the ?6 integrin transcript, but not muchis known about ?v?6 integrin in enamel formation (Moffatt et al. 2006).1.9 ?v?6 integrin?v?6 integrin is exclusively an epithelial receptor which binds to its lig-ands through the arginine-glycine-aspartic acid (RGD) motif (Breuss et al.1993; Breuss et al. 1995; Thomas Nystrom and Marshall 2006). ?v?6 inte-grin?s RGD containing ligands include fibronectin (Busk Pytela and Shep-pard 1992), vitronectin (Huang et al. 1998), tenascin (Prieto Edelman andCrossin 1993), and fibrillin-1 (Jovanovic et al. 2007). The integrin alsobinds to RGD on latency associated peptides (LAP) of transforming growthfactor- ?1 (TGF-?1) (Munger et al. 1999) and TGF-?3 (Annes Rifkin andMunger 2002), viral capsids of foot-and-mouth disease virus (FMDV) (Milleret al. 2001), coxsackievirus A9 (CAV9) (Williams et al. 2004), and humanparechovirus 1 (HPEV 1) (Seitsonen et al. 2010).While the ?v subunit can pair with multiple ? subunits, the ?6 subunitbinds exclusively with the ?v unit to form the ?v?6 integrin (Hynes 2002).The ?6 integrin has a 788 amino acid sequence, and is distinct from otherrelated beta subunits due to its unique eleven amino acid carboxyl-terminalextension (Sheppard et al. 1990).The ?v?6 integrin is normally expressed at low levels in adult tissues,but it is upregulated during development, wound healing, and inflammation,(Breuss et al. 1995; Clark et al. 1996; Haapasalmi et al. 1996; Hahm etal. 2007; Hakkinen et al. 2000; Larjava et al. 1993) as well as in moresevere pathologies such as chronic skin wounds (Hakkinen et al. 2004) andin a variety of cancers (Hamidi et al 2000; Thomas Nystrom and Marshall2006). It is also constitutively expressed in junctional epithelium of teeth(Ghannad et al. 2008; Larjava et al. 2011), and the hair follicles of normal331.10. TGF-? activationadult tissue (Xie et al. 2009).Activation of TGF-?1 is considered to be one of the main functions of?v?6 integrin in vivo. TGF-?1 has a role in immunoregulation, where it canact as either a pro-inflammatory cytokine, or an anti-inflammatory cytokine,depending on the cell type (Li Sanjabi and Flavell 2006; Wahl et al. 2004).Mice deficient in the ?6 integrin develop mild inflammation in their skin andlungs, due to increased infiltration of macrophages and lymphocytes (Huanget al. 1996). Furthermore, the macrophages of these mice are deficient inclearing the phospholipids in their lungs (Koth et al. 2007). In addition, ?6knockout mice develop periodontal disease, in which chronic inflammation,pocket formation, and bone loss are observed (Ghannad et al. 2008; Lar-java et al. 2011). These results are attributed to reduced ?v?6 mediatedTGF-?1 activation, and suggest that ?v?6 integrin functions to modulateinflammatory response in the epithelial cells (Ghannad et al. 2008; Huang etal. 1996; Koth et al. 2007; Larjava et al. 2011). Moreover, ?6 knockout miceshow protection from pulmonary fibrosis (Munger et al. 1999; Puthawala etal. 2008), renal fibrosis (Hahm et al. 2007; Ma et al. 2003), liver fibrosis(Patsenker et al. 2008; Wang et al. 2007), and TGF-?-mediated pulmonaryedema (Pittet et al. 2001), which is due to reduced TGF-? activity.1.10 TGF-? activationTGF-? is a multifunctional cytokine that regulates cell growth, inflamma-tion, immune function, matrix synthesis, and apoptosis (Taipale Saharinenand Keski-Oja 1998). It functions by binding to its receptor and activatingan intracellular signalling cascade that results in alteration of gene expres-sion. There are three isoforms of TGF-? (TGF-?1, -2, and -3), which are allsecreted as inactive complexes. As such, TGF-? first needs to be activatedin order to be able to bind to its receptor and exert its effect. The ?v?6integrin binds and activates latent TGF-?1 and TGF-?3 (Annes Rifkin andMunger 2002; Annes et al. 2004).TGF-? is synthesized as a homodimeric pro-TGF-? that is covalentlylinked to another propeptide termed latency associated peptide (LAP) (Mas-sague Blain and Lo 2000; Worthington Klementowicz and Travis 2011).Even though LAP is cleaved from mature TGF-? in the Golgi, the TGF-?remains non-covalently attached to LAP upon its secretion (Dubois et al.1995).This associated LAP prevents signalling by blocking the TGF-? re-ceptor, and together with TGF-? it forms the small latent complex (SLC)(Lawrence et al. 1984). In most of the cases however, TGF-? is secreted as341.10. TGF-? activationpart of the large latent complex (LLC) (Dallas et al. 1994; Miyazono et al.1991; Taipale Saharinen and Keski-Oja 1998). LLC is formed when the SLC(LAP- TGF?) is covalently associated with latent TGF-?-binding protein(LTBP) (Saharinen and Keski-Oja 2000). LTBP binds to proteins in ECM,and therefore anchors the latent TGF-? to the ECM (Hyytiainen Pentti-nen and Keski-Oja 2004). The LAP needs to be dissociated from TGF-? inorder for TGF-? to get activated. This dissociation is a highly regulated pro-cess, and is termed latent TGF-? activation (Annes et al. 2004). Althougha number of different processes such as proteases that degrade LAP (Ko-jima Nara and Rifkin 1993; Yu and Stamenkovic 2000), thrombospondin-1(Crawford et al. 1998), and reactive oxygen species (Jobling et al. 2006)can activate latent TGF-?, integrins have been recognized as the key acti-vators (Aluwihare et al. 2009; Nishimura 2009; Worthington Klementowiczand Travis 2011; Yang et al. 2007). The ?v?6 mediated TGF-?1 activa-tion is a protease independent mechanism during which an induction of aconformational change in the LAP occurs (Annes et al 2004).?v?6 integrin recognizes and binds to the RGD motif in the LAP of thelatent complex (Annes et al. 2004). This leads to a conformational changeof the LLC and allows activated TGF-?1 to access its receptors (Annes et al.2004; Fontana et al. 2005; Wipff et al. 2007; Wipff and Hinz 2008; Worthing-ton Klementowicz and Travis 2011). Activation of TGF-?1 through thismechanism is dependent on integrin ability to bind to the actin cytoskeletonof the cell, which generates a retractile force and results in a conformationalchange in LLC. TGF-?s bind to type I and type II receptors (TGF-?RIand TGF-?RII), which in turn phosphorylate (activate) Smad2 and Smad3(Moustakas and Heldin 2008). Phosphorylated Smad2 and Smad3 then forma complex with Smad4, which translocates to the nucleus to regulate genetranscription (Kang Liu and Derynck 2009). In addition to the Smad sig-naling pathway, TGF-? receptors can signal via alternative pathways suchas mitogen-activated protein kinase (MAPK), phosphatidylinositol-3-kinase(PI3K), and Rho-like GTPase pathway (Zhang 2009). TGF-?1 knockoutanimals die a few weeks after birth from multifocal inflammatory disease,due to massive infiltrations of macrophages and lymphocytes in differentorgans (Shull et al. 1992).Although no enamel defects have been reported with TGF-?1 knockoutanimals, mice that lack Smad3 gene have phenotypes that mimic hypomin-eralized amelogenesis imperfecta (Yokozeki et al. 2003).35Chapter 2The role of ?v?6 integrin inenamel biomineralization2.1 IntroductionEnamel is the hardest mineralized tissue in the body and the only calci-fied tissue that is produced by epithelium-derived cells, namely ameloblasts.Amelogenesis consists of secretory, transition and maturation stages (Sim-mer et al. 2010). During the secretory stage, ameloblasts secrete enamelproteins such as amelogenin (the most abundant enamel matrix protein;Eastoe, 1979), ameloblastin (Krebsbach et al. 1996) and enamelin (Hu etal. 1997) into the enamel matrix. This extracellular matrix undergoes en-zymatic modification by enamelysin (MMP20) and kallikrein 4 (KLK4) inthe transition and maturation stages, which results in the formation of amature enamel that is mainly composed of hydroxyapatite crystallites anda minor amount of residual proteins (Bartlett et al., 1996; Nanci and Smith,2000). Mutations in amelogenin, enamelin, MMP20 and KLK4 genes allcause human hereditary amelogenesis imperfecta (AI), in which both enamelformation and its mineralization are affected (Hu et al. 2007). This leadsto extensive wear and decay in both the primary and permanent dentition,which may result in tooth loss at a young age or require extensive restorativeprocedures to prevent further decay and/or attrition (Crawford et al. 2007).During amelogenesis, the apical ameloblast plasma membrane directlyabuts against the matrix and the developing enamel crystals (Nanci andSmith, 2000). Although integrins mediate cell-matrix adhesion and signalingin most cell types (Hynes 2004), the receptors of ameloblasts that mediateameloblast-matrix adhesion, matrix organization, and signaling are not wellcharacterized. The rat incisor enamel organ has been reported to expressthe ?6 integrin transcript, but its role in enamel formation is not known(Moffatt et al. 2006). Integrin ?v?6 is an epithelial cell-specific integrinthat binds to the arginine-glycine-aspartic acid (RGD) amino acid motif inits ligands (Breuss et al. 1993), which include fibronectin, tenascin-C, vit-362.2. Resultsronectin and the latency-associated peptide (LAP) of transforming growthfactor-?1 (TGF-?1) and TGF-?3. Its binding to the LAP of latent TGF-?1activates the cytokine (Munger et al. 1999). This integrin-mediated activa-tion plays an important anti-inflammatory role in vivo (Yang et al. 2007),as it regulates experimental TGF-?1-dependent fibrosis in various organs(Hahm et al. 2007; Horan et al. 2008; Patsenker et al. 2008). Further-more, ?v?6 integrin is expressed in junctional epithelial cells that mediategingival soft tissue adhesion to tooth enamel (Ghannad et al. 2008). In-terestingly, loss of ?6 integrin in mice is associated with characteristics ofhuman periodontal disease, suggesting that ?v?6 integrin plays a role inprotecting periodontal tissues from inflammatory changes leading to peri-odontal disease (Ghannad et al. 2008). Junctional epithelium is derivedfrom cells arising from the reduced enamel epithelium during tooth erup-tion (Schroeder and Listgarten 1977). In the present study, therefore, wehypothesized that ?v?6 integrin is also expressed in ameloblasts and thatlack of its expression is associated with enamel defects. We show that micedeficient in ?v?6 integrin have hypomineralized enamel and show excessiveaccumulation of amelogenin in the mineralizing enamel matrix.2.2 Results2.2.1 Teeth of Itgb6-/- mice have severe attrition andabnormal enamel surfaceCompared to wild-type (WT) mice, Itgb6-/- mice had no obvious differencesin tooth development or eruption, and there was no malocclusion. However,when incisors of Itgb6-/- mice were examined more closely, it became ob-vious that they differed from those of WT mice. The maxillary incisors ofWT mice had a smooth and yellowish surface, whereas Itgb6-/- mouse max-illary incisors lacked the yellow pigmentation and were abnormally white.In addition, mandibular incisors of Itgb6-/- mice appeared chalky and thetips were noticeably more rounded than those of their WT counterparts(Figure 2.1A,B).Examination of defleshed mandibles from 12-month-old mice using a dis-secting microscope or after taking high-resolution radiographs showed thatwhereas WT mouse molars had prominent and pointed cusps on all threemolars (Figure 2.1C,E,G), the molar cusps of the Itgb6-/- mice had exten-sive wear at their occlusal surfaces (Figure 2.1D,F,H) similar to their bluntedincisors. This severe attrition of molar cusps was highly evident in the scan-ning electron micrographs, displaying flattened and heavily worn Itgb6-/-372.2. Resultsmouse molar cusps (Figure 2.1H). While the WT enamel was smooth, theenamel of Itgb6-/- mice showed extensive pit formation and roughness onthe sides of the molars (Figure 2.1I,J). The rate and amount of attritionin the molar teeth was further investigated in different age groups. As ex-pected, as the mice aged the attrition rate increased in both the WT andItgb6-/- mice; however, the rate of attrition was much faster in the Itgb6-/-group (Figure 2.1K). The degree of attrition in the Itgb6-/- mice reached themaximum level already by 6 months when the cusps were almost completelyworn down (Figure 2.1K).Next, we investigated whether the enamel phenotype in the Itgb6-/- micecould be rescued by re-expressing ?6 integrin. For this purpose, the Itgb6-/-mice were bred with mice over-expressing human ?6 integrin under the cy-tokeratin 14 (K14) promoter in addition to their own endogenous mouse ?6integrin (Ha?kkinen et al. 2004). Offspring carrying only human ?6 integrinon the knockout background were selected to represent the ?6 integrin res-cue mice (Figure 2.1L; integrin expression in the ameloblast layer of theseanimals is presented in Figure 2.6A) The incisors of the ?over-expressing? andthe ?rescue? mice appeared macroscopically normal (data not shown). Theaverage attrition rate of 6-month-old Itgb6-/- mice was significantly higherwhen compared to the ?rescue? and ?over-expressing? mice of the same age,indicating that the enamel attrition is effectively rescued by human ?6 inte-grin gene in the Itgb6-/- mice (Figure 2.1M). Moreover, over-expression of?6 integrin did not seem to affect enamel formation.2.2.2 Enamel prism structure and mineralization areseverely affected in Itgb6-/-To determine the specific nature of the enamel defects in Itgb6-/- mice,we first observed enamel microstructure. Electron micrographs of surfaceacid-etched incisors demonstrated a significant difference in prism structureand organization between the WT and Itgb6-/- enamel (Figure 2.2A,B). InWT mouse incisors, a parallel and well-organized enamel prism structurein alternating rows was present (Figure 2.2A). Interestingly, in the Itgb6-/- incisors, the enamel prism organization was completely lost; the enamelwas somewhat layered but showed no regular repeating pattern of prismstructure (Figure 2.2B).Next, we compared enamel mineral density in WT and Itgb6-/- mice.Micro-CT images were taken from 14-day-old Itgb6-/- andWTmouse mandibu-lar molars. While the mutant mice teeth appeared generally anatomicallynormal, the X-ray density of the enamel was greatly reduced in both the 1st382.2. ResultsFigure 2.1: Teeth from 6-month-old Itgb6-/- mice show severe attrition. (A,B) Incisors of the Itgb6-/- (?6-/-) mice show considerable wear at their tips, a chalkyappearance and an absence of yellow pigmentation as compared to WT incisors. (C, D)Severe attrition is also observed in the Itgb6-/- mandibular molars. (E-H) High-definitionradiographs and backscattered electron SEM images of defleshed mandibles demonstrateocclusal wear to the level of dentin in the Itgb6-/- molars. (I, J) In secondary electronSEM images, lateral enamel surfaces in Itgb6-/- mouse molars appear rough and pittedas compared to those in WT mice. (K) In WT mice, the attrition rate increases with agereaching a score (see Methods) of one in about twelve months. However, attrition in Itgb6-/- (?6-/-) mice reaches the maximum score of two in six months. (L) PCR genotypingshows that WT mice express the murine ?6 integrin while there is no expression in Itgb6-/- animals (?6-/-). K14?6 mice demonstrate the presence of both human and murine?6 integrin. Integrin ?6-deficient mice were cross-bred with K14?6 mice to create a ?6integrin rescue line (?6 rescue) carrying only the human ?6 integrin gene. The knockoutconstruct was identified by primers for neoF-5? and Km?R-5?. (M) Significant clinicalattrition observed in the Itgb6-/- (?6/-) mice compared to WT mice can be rescued byhuman ?6 integrin. WT, N= 167; ?6-/-, N=124; rescue, N=60; overexpressing, N=99.392.2. ResultsFigure 2.2: Enamel prism structure and mineralization are severely affectedin Itgb6-/-. (A) Enamel in WT mice shows a well-organized and regular prism structure.(B) In Itgb6-/-(?6-/-) enamel, the prism structure is completely lost and irregular. D,dentin, En, enamel. Micro-CT images of mandibular specimens from 14-day-old WT(C) and Itgb6-/- (D) mice show that the general development, relationship with alveolarbone, and eruption of both molars and the incisor appear normal in Itgb6-/- mice. Inlongitudinal sections of both the 1st and 2nd molars, the mineral density of enamel appearsgreatly reduced (less black/dark grey) in Itgb6-/- mice (arrows). Mineral-to-protein ratiosin the maxillary (E) and mandibular (F) incisors of 7-week-old WT and Itgb6-/-(?6-/-)mice (n=10) derived from 1-mm strips of developing enamel cut from the apical loop ofthe incisors and processed for protein and mineral measurements. Strips 1-2 representsecretory stage enamel, strips 3-4 maturation stage enamel and strips 5-11 mature hardenamel. 402.2. Resultsand 2nd molars of the Itgb6-/- mice compared to the WT (Figure 2.2C,D).To quantify the difference in mineralization during various stages of enamelformation, we measured the mineral-to-protein ratio of the maxillary andmandibular incisors in both mouse lines by an ashing method. Near theapical loop of the incisors, corresponding to the secretory stage, the mineral-to-protein ratio was similar in WT and Itgb6-/- mice (Figure 2.2E,F). How-ever, as the distance from the apical loop increased (maturation stage startsabout 3 mm from the apex), the mineral-to-protein ratio of Itgb6-/- mouseincisors became drastically decreased compared to that of the WT mice. Infact, from the regions that corresponded to the maturation stage and on-wards, the WT incisors were so highly mineralized that it was not possibleto cut away incisor enamel strips for sampling, whereas the Itgb6-/- incisorenamel strips were easily removed along the entire length of the incisors(strip 9 on maxilla and strip 11 on the mandible). In additional mineralanalyses using energy-dispersive X-ray spectroscopy, we studied a numberof molar teeth (areas of no wear on the buccal surface) where there was nostatistical difference in Ca/P ratios between Itgb6-/- and WT molars withthe ratios obtained being typical for hydroxyapatite (data not shown).2.2.3 Integrin ?6 mRNA and protein are expressed byameloblasts in mouse and human teethTo demonstrate that the ?6 integrin mRNA and protein are expressed inmouse teeth, in situ hybridization and immunohistochemical studies wereperformed. In situ hybridization of ?6 integrin mRNA with the anti-senseand sense probes was performed in the secretory stage of an upper incisorfrom a 10-day-old WT mouse. The anti-sense probe demonstrated a strongspecific signal that was localized only to the cytoplasm of ameloblasts (Fig-ure 2.3A), whereas no signal was detected with the control sense probe(Figure 2.3B).Next, we performed immunostaining of ?6 integrin protein in frozensections from the secretory stage of an upper incisor as well as from devel-oping upper molar cusps from 3-day-old WT mice. In both the incisor andmolar teeth, prominent ?6 integrin immunoreactivity was localized to theameloblast layer (Figure 2.3C,D). Hematoxylin- and eosin-stained sectionsconfirmed that the ?6 integrin immunoreactivity was indeed localized to theameloblast cell layer (Figure 2.3E,F).In order to investigate whether expression of ?6 integrin in ameloblastsis similar in humans, we immunostained maturation-stage ameloblasts fromsurgically removed, unerupted human wisdom teeth. Ameloblasts were iden-412.2. ResultsFigure 2.3: Integrin?6 mRNA and protein are expressed byameloblasts in developing mouse and human teeth. In situ hybridiza-tion of ?6 integrin with anti-sense (A) and sense (B) probes in the secretorystage of a maxillary incisor from a 10-day-old WT mouse. Localization of ?6integrin protein by immunostaining in undecalcified frozen sections from thesecretory stage maxillary incisor (C) and a developing maxillary molar cusp(D) from a 3-day-old WT mouse. (E, F) Parallel sections to C and D, re-spectively, stained with H&E. (G) Ameloblasts are present on extracted de-veloping human third molars (HE staining), and they show positive stainingfor K14 (H), amelogenin (I) and ?6 integrin (J) by immunohistochemistry.Abl/Ambl, ameloblast layer; P, pulp tissue; Obl, odontoblast layer; En/E,forming enamel; D, forming dentin; SR, stellate reticulum; CT, connectivetissue; B, bone.422.2. Resultstified in decalcified sections by morphology as well as by a positive signal forK14 and amelogenin (Figure 2.3G-I). The ameloblast layer was strongly la-beled with the ?6 integrin antibody (Figure 2.3J), indicating that expressionof ?v?6 integrin is conserved in human ameloblasts.2.2.4 Expression of amelogenin and enamelin issignificantly increased in the Itgb6-/- ameloblast layerIn order to identify the gene expression profile associated with the disturbedmineralization of Itgb6-/- enamel, we removed incisor enamel organs of adultItgb6-/- and WT mice from both the secretory and maturation stages. Aheat map of the differentially expressed genes was generated (Figure 2.4A).These data demonstrated significant differences in gene expression profiles inenamel organs between the WT and Itgb6-/- mice. Using the GOrilla GeneOntology analysis tool, two of the biological processes that show significantdifferences were identified as ?regulation of biomineralization? and ?osteoblastdifferentiation? (Figure 2.4B). The microarray gene expression results for?cellular components? and ?biological processes? were further analyzed usingDAVID (Database for Annotation, Visualization And Integrated Discovery).In both categories, those genes with significant differences in their expres-sion, including genes relevant to biomineralization, were graphed in a piechart (Figure 2.4C,D, respectively). The rest of the genes were grouped inthe ?other? category. For the ?cellular component? category, differentiallyregulated genes included genes associated with extracellular matrix or cellsurface. For the ?biological process? category, gene expression for defence,immune response, wounding, cell-cell signaling, endocytosis, tissue morpho-genesis and biomineralization differed significantly between the WT andItgb6-/- mice enamel organs.The gene profiling analysis showed that 67 genes were down-regulatedand 171 genes up-regulated in Itgb6-/- enamel organs compared to WTenamel organs (absolute fold change >1.6; data not shown). Interestingly,the two most up-regulated genes in Itgb6-/- enamel organs were amelogenin(Amelx ; 21-fold) and enamelin (Enam; 7.6-fold; Figure 2.5A). Other highlyupregulated genes were progressive ankylosis gene (Ank ; 5-fold) and RNAmotif binding proteins (RBMs; data not shown). Expression of Klk4 was alsoincreased, whereas ameloblastin (Ambn), MMP20 (Mmp20 ) and amelotin(Amtn) remained unchanged (Figure 2.5A and data not shown). The ex-pression of ?1 and ?4 integrin genes was not changed, suggesting that therewas no compensatory change in other integrins in the absence of ?6 integrin(Figure 2.5A). Also, the level of ameloblast marker gene K14 was unchanged.432.2. ResultsFigure 2.4: Gene expression profiling of enamel organs from 6-month-old WT andItgb6-/- mice. (A) Heat map of the differentiallyexpressed genes from pooled enamel organs (the groups consisted 4-6 miceeach and were designated as FVB 1-3 for WT and ?6 1-3 for the Itgb6-/-mice). (B) Differentially regulated biological processes in enamel organsbetween WT and Itgb6-/- mice analyzed using the GOrilla gene ontologyanalysis tool (p>10-3 for the white circles and p=10-3-10-5 for the yellowcircles); Differentially regulated cellular components (C) and processes (D)between WT and Itgb6-/- mice analyzed by the DAVID system.442.2. ResultsFigure 2.5: Relative gene expression of selected enamel genes in 6-month-old WT andItgb6-/- mice based on gene profiling (A) andconfirmation with real-time RT-PCR (B). Expression of amelogenin,enamelin and KLK4 genes are significantly upregulated in Itgb6-/-(?6-/-)enamel organs compared to WT enamel organs. Expression of ameloblastin,MMP20, ?1 or ?4 integrin and ameloblast marker K14 genes are not sig-nificantly altered. Truncated ?6 integrin mRNA expressed in the Itgb6-/-organs was recognized by the gene array probes (A) but was not amplifiedby the PCR primers specifically designated to detect the translated mRNA(B).Among the genes that showed the strongest down-regulation in the Itgb6-/-enamel organ, were arrestin domain containing 3 protein (Arrdc3; 8fold),photocadherin-21 (Pcdh21 ; -5.9-fold) and Fam20B (family with sequencehomology 20, member B; -2.9-fold; data not shown). Regulation of thesegenes in the Itgb6-/- enamel organ may contribute to the hypomineralizedenamel phenotype in these animals but their role needs to be further inves-tigated.Next, we verified the expression levels of amelogenin, enamelin and otherkey molecules associated with enamel mineralization using quantitative RT-PCR (Figure 2.5B). Among the tested mRNAs, only the expression ofAmelx, Enam and Klk4 showed significant increases both in gene arraysand in RT-PCR (Figure 2.5A,B).We then verified the integrin expression profiles of the incisor enamelorgans of 3-6-month-old WT, Itgb6-/- and ?6 integrin rescue mice by West-ern blotting. As expected, Itgb6-/- incisors were negative for ?6 integrin,whereas it was expressed in the WT animals (Figure 2.6A). In ?rescue? and452.2. Results?overexpressing? mice, ?6 integrin expression was elevated due to the con-stitutive K14 promoter activity in the enamel organs. Confirming the qRT-PCR results, the expression of ?1 integrin was similar in all mouse lines.However, the amount of ?v integrin protein, which partners with ?6 inte-grin and others, was reduced in the Itgb6-/- enamel (-2.5-fold; Figure 2.6A)likely because of intracellular degradation due to lack of receptor dimeriza-tion.2.2.5 Accumulation of amelogenin protein in theameloblast layer and enamel of Itgb6-/- miceAnalysis of protein expression in incisor enamel organs of 3-6-month-oldWT and Itgb6-/- mice by Western blotting revealed strong abnormal accu-mulation of amelogenin in the incisors of Itgb6-/- mice (on average 10-fold;Figure 2.6A,C). The main amelogenin bands were between 20-25 kDa, whichis consistent with major cleaved amelogenins. Consistent with the molar at-trition data, the amelogenin accumulation in the incisors of the Itgb6-/- micewas rescued by human ?6 integrin expression (Figure 2.6A), showing thatthe accumulation of amelogenin was specifically attributable to ?6 integrindeficiency. The expression of MMP20 and KLK4 was also slightly increasedin the Itgb6-/- mice (Figure 2.6B,D). The protein levels of enamelin werenot tested because of the lack of availability of a specific antibody for mouseenamelin.Because one of the main functions of ?v?6 integrin is to activate TGF-?1, we compared the phosphorylation and expression levels of Smad3, adownstream target of TGF-?1, in enamel organs. While TGF-?1 effec-tively induced pSmad3 phosphorylation in cultured ameloblast-like cells (notshown), there was no significant difference in the expression or phosphory-lation of Smad3 between the WT and Itgb6-/- enamel organs (Figure 2.6B),suggesting that the mineralization defect and accumulation of amelogeninin the Itgb6-/- enamel is not attributable to impaired TGF-?1 signaling.To visualize the organization of the ameloblast layer, undecalcified his-tological sections from the late secretory stage and early maturation stageincisors of 14-day-old Itgb6-/- and WT mice were compared. In WT mice,the ameloblast layer was well organized against mineralizing enamel (Fig-ure 2.7A,C). In the Itgb6-/- mice, the ameloblast layer was similarly or-ganized but showed abnormal accumulation of amorphous unmineralizedmatrix between the cells as well as between the ameloblasts and the form-ing enamel surface (Figure 2.7B,D). In order to identify this material, weperformed transmission electron microscopy (TEM) and immunogold la-462.2. ResultsFigure 2.6: Amelogenin protein is overexpressed in Itgb6-/- enamelorgans. (A) Western blots of ?1, ?6 and ?v integrin as well as amelogeninin WT, Itgb6-/- (?6-/-), ?6 rescue (F1) and ?6 overexpressing (K14) enamelorgans of 3-6-month-old mice. (B) Expression and phosphorylation of pS-mad3 and MMP20 and KLK4 expression in WT, Itgb6-/- (?6-/-) enamelorgans. (C) Normalized amelogenin expression relative to ?-actin. (D)Quantification of KLK4 and MMP20 Western blots relative to ?-actin. (C,D) n = 3-4 pooled samples representing 4-6 mice each; mean + s.d. is shown.472.2. Resultsbeling for amelogenin localization. Ameloblasts in the WT mouse showedtypical organization and secretion of enamel matrix (Figure 2.7E) that sub-sequently became highly mineralized in the maturation stage (Figure 2.7I).In the Itgb6-/- ameloblast layer, amorphous protein pools appeared in cyst-like structures between ameloblasts and towards the enamel surface (Fig-ure 2.7F,G). By immunolabeling, this material was shown to contain abun-dant amelogenin (Figure 2.7H). Abnormal accumulation of amelogenin wasobserved both between the cells and within the cells. Electron micrographsof the surface of WT mouse molar enamel revealed a smooth, well organized,and parallel crystal structure at the enamel-ameloblast border (Figure 2.7I)in the early maturation stage, whereas corresponding regions in the Itgb6-/-mouse showed an enamel surface that was irregular and layered (Fig 2.7J).2.2.6 Integrin ?v?6 participates indirectly in the adhesionof ameloblast-like cells on amelogenin-rich matrix butnot in amelogenin endocytosisTo determine whether ameloblasts use ?v?6 integrin as a cell adhesion re-ceptor for the enamel matrix, we seeded WT mouse ameloblasts in wellscoated with a porcine enamel matrix extract (EMD; over 90% amelogenin).Ameloblasts spread on EMD only in the absence of the protein synthesisblocker cycloheximide (Figure 2.8A), suggesting that their adhesion on EMDwas dependent on endogenous protein synthesis. Stimulating the cells with200 nM 12O-tetradecanoylphorbol-13-acetate (TPA), an integrin activator,further increased their adhesion and spreading by about 50% (Figure 2.8A).To determine whether this adhesion was mediated by ?v?6 integrin, cellspreading was analyzed in the presence of function-blocking anti-?v?6 in-tegrin antibodies. Three different antibodies blocked 35-50% of the cellspreading in a statistically significant manner (Figure 2.8B), indicating thatameloblasts deposit endogenous, amelogenin-binding extracellular matrixproteins, some of which are ?v?6 integrin ligands. As expected, these anti-bodies did not affect the spreading of Itgb6-/- ameloblasts (data not shown).We next tested whether ?v?6 integrin is involved in the regulationof amelogenin endocytosis in mouse ameloblasts. Amelogenin endocytosisoccurred in a similar fashion in both WT and Itgb6-/- ameloblasts (Fig-ure 2.8C-H), suggesting that ?v?6 integrin does not play a significant rolein this internalization process.482.2. ResultsFigure 2.7: Accumulation of amorphous matrix material betweenthe ameloblast layer and the forming enamel, and betweenameloblasts, in Itgb6-/- mice. Undecalcified tissue sections from in-cisors of 14-day-old WT (A, C) and Itgb6-/- mice (B, D) stained with vonKossa reagent for mineral followed by counterstaining with toluidine blue.Compared to WT incisors, Itgb6-/- mice show accumulation of unminer-alized extracellullar matrix (arrows) between the ameloblast layer and theforming enamel surface, and between individual ameloblasts. En, enamel;Abl, ameloblast layer; D, dentin; Obl, odontoblast layer; SR, stellate retic-ulum; B, bone; CT, connective tissue; P, pulp tissue. Transmission elec-tron micrographs of enamel organ of WT (E, I) and Itgb6-/- mice (F-H, J)showing secretory ameloblasts and enamel at the level of the second molar.Ameloblasts (Am) of the WT mouse (E) show typical organization and se-cretion of the enamel matrix (En) that subsequently becomes mineralized.In the Itgb6-/- ameloblast layer (F), amorphous protein pools appear in cyst-like structures between ameloblasts (asterisks) and near the enamel surface.Immunogold labeling for amelogenin of Itgb6-/- enamel organ shows abnor-mal amelogenin accumulation both between the cells and inside the cells(asterisks in G and H). The enamel (En) ameloblast (Am) interface in theWT maturation stage molar tooth is smooth and well mineralized and showsorganized, parallel crystal structure at this boundary (I, arrow). In a cor-responding molar crown region from an Itgb6-/- mouse, the enamel surfaceis less organized and irregularly mineralized with a layered appearance (J,arrow and arrowheads).492.2. ResultsFigure 2.8: Spreading, but not endocytosis, of ameloblast-like cells is regulatedby ?v?6 integrin on amelogenin-rich enamel matrix. (A) Ameloblast cell spreadingon plates coated with 10 mg/ml of EMD in the presence or absence of 50 ?M cycloheximideand 200 nM TPA. (B) WT ameloblasts were allowed to spread on EMD in the presence200 nM TPA and three different anti-?v?6 integrin antibodies (10D5, 50 ?g/ml; 6.8G6, 10?g/ml; 6.3G9, 10 ?g/ml) and in the absence of cycloheximide. Control cells (C) were leftuntreated. Combined results of four experiments (mean ? s.e.m.) are shown. **, p<0.01;***, p<0.001. Amelogenin endocytosis by WT (C, E, G) and Itgb6-/- ameloblasts (D,F, H). Both WT (C) and Itgb6-/- ameloblasts (D) show a very low level of endogenousamelogenin expression by immunostaining of the protein (green, arrows). Cell nucleiwere counterstained with DAPI (blue). When incubated with 100 ?g/ml EMD for 24h, accumulation of amelogenin was distinct within the cells (E, F). The accumulationwas seen in clusters on the cell edges (arrows) and in cytoplasmic regions (asterisk) forboth cell types. In the presence of both EMD and 20 ?M E64d (G, H), the staining ofamelogenin became more punctate and diffuse (arrow). There was no difference in thepattern of endocytosis between Itgb6-/- and WT cell lines, indicating that ?6 deficiencydoes not affect amelogenin endocytosis. 502.3. Discussion2.3 DiscussionEpithelial-cell integrins regulate a variety of cell functions during develop-ment and tissue repair (Larjava et al. 2011). However, little informationis available regarding integrin function in ameloblasts during enamel forma-tion. In the present report, we show that ?v?6 integrin plays a crucial rolein enamel biomineralization via regulation of amelogenin and enamelin geneexpression.Integrins likely play key roles in tooth development since several inte-grins, including ?6, ?v, ?1, ?4 and ?5 integrin subunits, are expressed in thedental epithelium (Salmivirta et al. 1996). Integrin ?v?5 may regulate toothmorphogenesis, as its expression oscillates between dental mesenchyme andepithelium (Yamada et al. 1994). Ameloblasts express ?2?1 integrin whenthey assume their columnar shape (Wu and Santoro, 1994), but no toothphenotype was observed in ?2 integrin knockout mice (unpublished datafrom our laboratory). Loss-of-function mutations in either ?6 or ?4 inte-grin cause human junctional epidermolysis bullosa, in which the epitheliumdetaches from the basement membrane causing skin or mucosal blistering(Wright 2010). In these patients, ameloblast adhesion to developing enamelis also reduced, leading to hypoplastic enamel (Wright 2010).Only a few potential integrin-binding ligands have been identified in theenamel matrix. Amelogenin (Snead et al. 1983) and amelotin (Iwasaki et al.2005; Moffatt et al. 2006) do not possess RGDmotifs or other known integrinrecognition sequences. The RGD motif in enamelin is not evolutionarilyconserved (Hu et al. 1997; Nawfal et al. 2007). Ameloblastin containsbinding sites for the RGD motif-binding integrins (Cern et al. 1996), andit has been shown to bind to ameloblasts, but the receptor has not yetbeen identified (Fukumoto et al. 2004). Ameloblasts also express bonesialoprotein that has binding sites for both hydroxyapatite and RGD-bindingintegrins (Ganss et al. 1999; Harris et al. 2000; Stubbs et al. 1997).Dentin sialoprotein, which also contains the RGD motif, is only transientlyexpressed in presecretory ameloblasts and may contribute to formation ofthe dentino-enamel junction rather than to enamel maturation (Bgue-Kirnet al. 1998; Paine et al. 2005).EMD enhances the adhesion, proliferation and matrix production offibroblast-like but not epithelial cells (Cattaneo et al. 2003; Gestrelius etal. 1997; Haase and Bartold, 2001; Hoang et al. 2000; Kawase et al. 2000).Attachment of human periodontal ligament cells to EMD is possibly medi-ated by bone sialoprotein as it can be inhibited by RGD-containing peptidesor with an anti-?v?3 integrin antibody (Suzuki et al. 2001). Also ?1 inte-512.3. Discussiongrins seem important to cell adhesion to EMD (van der Pauw et al. 2002).More recently, it was demonstrated that both ?1 and ?v integrins mediateperiodontal ligament fibroblast adhesion to EMD (Narani et al. 2007). Be-cause amelogenins do not contain any known recognition sites for integrins,it is possible that self-aggregation of amelogenins exposes cryptic integrinrecognition sites. Consistently with this hypothesis, amelogenins promotebinding of fibroblasts and endothelial cells via multiple integrins, including?v?3, ?v?5 and ?v?1 (Almqvist et al. 2010; Almqvist et al. 2011). Inthe present study, ameloblast ?v?6 integrin did not directly bind to EMDbut the cells attached via endogenously deposited matrix. Some of thesematrix molecules appeared to be ?v?6 integrin ligands, such as fibronectinthat readily binds to amelogenin (Narani et al. 2007). However, also Itgb6-/- ameloblasts were able to attach and spread on this matrix, suggestingcollaboration by other integrin receptors in ameloblast adhesion. It appearsunlikely that ?v?6 integrin is essential for ameloblast cell adhesion in vivoeither, as the ameloblasts retained their columnar shape and adhesion tothe developing enamel in the Itgb6-/- mice.Amelogenin or its fragments are endocytosed by ameloblasts via a receptor-mediated mechanism involving LAMP1 and CD63 proteins (Shapiro et al.2007). This uptake may serve as a feedback loop to upregulate amelogeninexpression through stabilization of its mRNA in the cytoplasm (Xu et al.2006). We did not find evidence for the direct involvement of ?v?6 integrinin amelogenin endocytosis. However, we found that expression of severalRBMs (Rbm26, Rbm45, Rbm8a) was increased (4.2-5-fold) in the enamel or-gans of Itgb6-/- mice compared to WT. RBMs have been shown to criticallyregulate post-transcriptional RNA metabolism (Janga and Mittal, 2011).Therefore, these proteins could regulate amelogenin and enamelin mRNAstability. It is possible that the lack of ?v?6 integrin signaling in the Itgb6-/- ameloblasts may disrupt the feedback system for amelogenin expressionand lead to its dysregulated accumulation in the tooth enamel by an as yetunknown mechanism.The best-known function of ?v?6 integrin is in the activation of latentTGF-?1 (Yang et al. 2007). TGF-? and its receptors are important reg-ulators of early tooth development (Chai et al. 1994; Chai et al. 1999;Pelton et al. 1991). In addition, TGF-?1 is expressed in ameloblasts of de-veloping enamel (Gao et al. 2009). Interestingly, the tooth development inTGF-?1 mutant mice is unaffected, which could be partially due to rescueby maternal TGF-?1 (D?Souza and Litz 1995). TGF-?s binding to typeI and II TGF-? receptors (TGF?RI and TGF?RII) induces activation ofSmad2/3 (Moustakas and Heldin 2008). Human mutations in TGF-?RI522.3. Discussionand II cause Loeys-Dietz syndrome due to abnormal receptor signaling, butno enamel phenotypes have been reported for these patients (Loeys et al.,2005). However, there is evidence that dysregulated TGF-?1 signaling maybe detrimental to amelogenesis. Ameloblasts in mice overexpressing TGF-?1 under the dentin sialoprotein promoter show enamel defects, includingameloblast detachment with a pitted and hypoplastic enamel (Haruyama etal. 2006). In K14-Smad2 -overexpressing mice, the ameloblast layer is dis-organized and amelogenin-containing matrix is found between ameloblasts(Ito et al. 2001). No tooth abnormalities have been reported in Smad7-/-(an inhibitor of TGF-? signaling) mice. Mice overexpressing Smad7 underthe K5 promoter, however, show suppressed Smad3-mediated signaling anda failure to produce proper enamel (Helder et al. 1998; Klopcic et al. 2007).In the present study, we did not find evidence for the enamel defects inItgb6-/- micebeing caused by altered TGF-?1 activation. Neither phospho-rylation nor the expression level of Smad3 was altered in the Itgb6-/- enamelorgan. We also compared histology of enamel from Smad3 -/- mice to that ofItgb6-/-, and they lacked similarity (unpublished results). Previous studieshave also shown that ameloblast morphology remains unaltered in Smad3 -/-mice although the enamel is poorly mineralized, this being likely attributableto defective protein removal at the maturation stage (Yokozeki et al. 2003).Recently, it was reported that Smad3 and FoxO1 (transcriptional co-factor for Smads) collaboratively regulate genes involved in enamel forma-tion (Poche et al. 2012). Interestingly, in both Smad3 and FoxO1 mutantteeth, the expression of Ambn, Amelx, Enam, Mmp20 and Klk4 were all sig-nificantly downregulated. The fact that Amelx and Enam are highly upreg-ulated in ?6 integrin mutant teeth also strongly suggests that the observedenamel phenotype is not caused by defective TGF-?1 activation. Clearly,TGF-? signaling regulates enamel formation but significant involvement of?v?6 integrin in the activation of ameloblast TGF-?s seems unlikely.We explored the gene expression profiles in the WT and Itgb6-/- mouseenamel organs to identify additional changes that could contribute to dis-turbed mineralization of Itgb6-/- mouse enamel. Interestingly, expression ofAnk was increased in the Itgb6-/- enamel organ. ANK functions in trans-porting inorganic pyrophosphate to the extracellular space, where pyrophos-phate serves as a potent inhibitor of extracellular matrix mineralization incalcified tissues (Harmey et al. 2004; Wang et al. 2005; Zaka and Williams2006). Future studies should therefore investigate whether inorganic py-rophosphate levels are increased in Itgb6-/- enamel organs, thereby con-tributing to the mineralization defect.Other significant changes in gene expression observed in the Itgb6-/-532.3. Discussionenamel organ included reduced expression of arrestin Arrdc3, photocadherinPcdh21 and Fam20B. ARRDC3 functions in cell signalling and moleculartrafficking (Rajagopal et al. 2010). It remains to be shown whether is in-volved in the regulation of Amelx expression. Mutations in PCDH21 causeautosomal recessive cone-rod dystrophy in the eye (Ostergaard et al. 2010),which is associated with AI in some patients, thus demonstrating possiblelinks between retinal functions and enamel mineralization (Parry et al. 2009;Polok et al. 2009). Since cell-cell adhesion of ameloblasts via cadherins hasbeen demonstrated to be critical for enamel mineralization (Bartlett et al.2010), it is possible that down-regulation of Pcdh21 contributes to weakenedameloblast cell-cell adhesion and subsequent accumulation of amelogeninsbetween the cells. FAM20B is a kinase implicated in phosphorylation andcontrol of proteoglycans (Koike et al. 2009). It and other members of theFAM20 protein family have multiple roles in mineralized tissues. Mutationsin FAM20A cause hypoplastic AI and gingival overgrowth (Cho et al. 2011;O?Sullivan et al. 2011), whereas FAM20C that is expressed in mineral-ized tissues, including enamel and dentin phosphorylates secreted mineral-binding proteins and is essential for normal bone development (Hao et al.2007; Simpson et al. 2007; Wang et al. 2010; Ishikawa et al. 2012). FAM20Bis expressed during the maturation stage of amelogenesis (O?Sullivan et al.2011), but its function in enamel remains unknown.Amelogenesis imperfecta represents a collection of genetic disorders thataffect enamel formation both in the primary and permanent dentition in theabsence of systemic manifestations (Hu et al. 2007). Mutations in severalgenes are associated with human AI (Hu et al. 2007; Stephanopoulos et al.2005). In general, mutations that affect enamel matrix production (AMELX,AMBN, ENAM ) tend to result in hypoplastic enamel while those that affectmatrix removal (MMP20, KLK4 ) tend to result in hypomaturation of theenamel (Hu et al. 2007). Interestingly, previous studies with overexpressionof normal amelogenin or its various fragments have not shown major alter-ations in enamel structure (Chen et al. 2003; Gibson et al. 2007; Paine etal. 2004). However, the present study clearly demonstrates that the enameldefect resulting from ?v?6 integrin deficiency and the subsequent overex-pression of amelogenin and enamelin is detrimental to enamel formation andleads to a condition that mimics the hypomaturation type of AI. Therefore,ITGB6 should be considered a candidate gene for human AI with normalthickness but altered prism structure and reduced mineralization. As dis-cussed above, there are several putative mechanisms for how ?v?6 integrinregulates enamel biomineralization that need to be explored further.542.4. Materials and methods2.4 Materials and methods2.4.1 AnimalsThe Animal Care Committee of the University of British Columbia approvedall animal procedures used in this study. The mouse lines used were: WT(FVB background), Itgb6-/- (a generous gift from Dr. Dean Sheppard, Uni-versity of California, San Francisco, CA, USA), K14?6 that overexpresseshuman ?6 integrin under the K14 promoter (Ha?kkinen et al. 2004) and ?6rescue mice representing Itgb6-/- mice that have been bred with the K14?6mice (F1; also from Dr. Sheppard). The mice were maintained in a con-ventional animal care facility and had free access to standard mouse chow(Purina 5001) and water. Animals were sacrificed by CO2 inhalation.2.4.2 Western blottingThe incisors of the maxillas and mandibles of 3-9-month-old mice (threeanimals, 8-10 incisors per group) were removed, and their enamel organsscraped off with a microsurgical blade and pooled for Western blotting.The antibodies used were: ameloblastin (ab72776; Abcam, Cambridge, MA,USA), amelogenin (pc-062; Kamiya Biomedical Company, Seattle, WA,USA), KLK4 (ab3636; Abcam), MMP20 (ab76109; Abcam), Smad3 (ab28379;Abcam), pSmad3 ab52903; Abcam), ?6 integrin (AF2389; R&D Systems,Inc., Minneapolis, MN, USA), ?v integrin (sc-6618, Santa Cruz Biotech-nology, Santa Cruz, CA, USA), ?1 integrin (4080; Larjava et al. 1990),?-actin (ab8227; Abcam) and ?-tubulin (mAb3408, Millipore, Temencula,CA, USA). Appropriate peroxidase-conjugated IgGs (Santa Cruz) were usedas secondary antibodies. After washing, the protein bands were detected us-ing ECL Western Blotting Detection Kit (GE Healthcare, Baie d?Urfe, QC,Canada), and the digitized images were quantified using the ImageJ soft-ware (available at http://rsb.info.nih.gov/ij; developed by Wayne Rasband,National Institutes of Health, Bethesda, MD, USA). Alternatively, IRDye-conjugated secondary antibodies (LI-COR Biosciences, Lincoln, NE, USA)were used and the blots analyzed and quantitated with Odyssey infraredreader (LI-COR).2.4.3 Gene expression profiling by microarrayThe enamel organs were collected from the incisors of 6-month-old WT andItgb6-/- mice, pooled (three animals, 8-10 incisors per group), placed intoRNAlater (Ambion, Life Technologies, Inc., Burlington, ON, Canada) and552.4. Materials and methodsstored at -80?C. Total RNA was extracted using either NucleoSpin RNA IIor XS kit (Macherey-Nagel, Bethlehem, PA, USA) and treated with DNa-seI digestion. RNA samples were analyzed using Illumina Mouse WG-6v.2.0 Expression BeadChip at the Finnish Microarray and Sequencing Cen-tre (Turku Centre for Biotechnology, Turku, Finland) followed by data anal-ysis with R (R Development Core Team 2008) and Bioconductor (Gentlemanet al. 2004) softwares. The data were quantile normalized, and statisticalanalysis for detecting the global differences in gene expression between thegroups was carried out using Bioconductor?s Limma package. The chosenthresholds used in filtering the differentially expressed genes were FDR p-value<0.05 and absolute fold change >1.6 as the comparison cutoff.2.4.4 RNA analysis by PCRTotal RNA (0.5 ?g) was reverse-transcribed with SuperScript VILO cDNASynthesis Kit (Invitrogen, Life Technologies). Real-time PCR amplificationwas performed on the MiniOpticon Real-Time System (Bio-Rad, Missis-sauga, ON, Canada) using 5 ?l of RT products (diluted to a concentrationwhere the CT values were well within the range of the standard curve)mixed with 10 ?l of 2x iQ SYBR Green I Supermix (Bio-Rad) and 5 pmolesof primers, in a final volume of 20 ?l. An amplification reaction was con-ducted for target genes with Actb, Gapdh and Hprt1 as reference genesand replicated 9 times for each sample. The data were analyzed basedon the comparative CT program of Gene Expression Analysis for iCycleriQ Real-Time PCR Detection System (Bio-Rad). Primer sequences (5?-3?)were: Actb (CTTCCTTCTTGGGTATGGAATC, TAGAGGTCTTTACG-GATGTCAAC), Ambn (CTTCCTTCTTGGGTATGGAATC, TAGAGGTCTT-TACGGATGTCAAC),Amelx (GCTTTTGCTATGCCCCTA, CTCATAGCT-TAAGTTGATATAACCA), Itgb6 (AATCACCAACCCTTGCAGTAG, AAT-GTGCTTGAATCCAAATGTAG), Enam (TCTCTGCTGCCATGCCATTC,TTGATTATATCGCATCATCTCTTCAC), Klk4 (CATCCCTGTGGCTAC-CCAA, GGGCAGTTTCCCATTCTTTA), Mmp20 (TGCTGTGGAACT-GAATGGCTA, ACACTAACCACGTCTTCCTTC), Hprt1 (TGTTGGATTTGAAATTCCA-GACAAG, CTTTTCCAGTTTCACTAATGACACAA), Krt14 (ATCCTCT-CAATTCTCCTCTGGCTC, ACCTTGCCATCGTGCACATC), Itgb1 (GCTG-GTTCTATTTCACCTATTCA, CAACCACGCCTGCTACAA), Itgb4 (CCAGCT-GAGACCAATGGCGA, GAGCACCTTCTTCATAGGTCCA, Gapdh (CTTTGT-CAAGCTCATTTCCTGGTA, GGCCATGAGGTCCACCA).562.4. Materials and methods2.4.5 Attrition rateMaxillas and mandibles of 3-24-month-old WT and Itgb6-/- mice were de-fleshed mechanically and with 2% KOH (EM Science, Merck, Darmstadt,Germany). Attrition of the molars was scored based on cusp heights where0= <10% attrition of the cusps, 1= attrition reaching up to 50% of the cuspheight, and 2= more than 50% attrition. In a cross-sectional study, we alsocompared the attrition rate of molars in 6-month-old WT, Itgb6-/-, K14-?6and rescue mice.2.4.6 Scanning electron microscopy (SEM)Calcium-to-phosphorus ratioWT and Itgb6-/- mice (11-14-month-old) were sacrificed, decapitated andtheir heads were fixed in 4% formaldehyde in phosphate-buffered saline(PBS, pH 7.2). The mandibles were dissected and further fixed in 2.5% glu-taraldehyde for 1 h at 4?C. The samples were post-fixed with 1 M OsO4 for1 h at RT. After three rinses, the specimens were dehydrated, critical-pointdried, gold-coated and viewed by SEM. Three standardized areas (mesial,middle and distal) on the mid-lingual surface of the third molar were usedto measure calcium-to-phosphorus ratios using energy dispersive X-ray spec-troscopy (Hitachi S-3000N SEM with light element EDX).Visualization of prism structuresDefleshed and dried incisors from WT and Itgb6-/- mice were frozen byimmersion in liquid nitrogen and then fractured (along the line from root tocrown) with a pre-cooled scalpel blade. The fractured portion of the incisorwas treated at RT in 35% phosphoric acid for 30 s, rinsed and air-dried(Snchez-Quevedo et al. 2006). The incisors were then mounted and coatedwith a 10 nm layer of gold/palladium. Each sample was imaged by SEMwith identical imaging conditions at 4 kV.2.4.7 ImmunohistochemistryImmunostaining of ?6 integrin was performed on frozen sections (6 ?m) ofthe secretory stage of an upper incisor and a developing upper molar from a3-day-old WT mouse using the ?6 integrin antibody ?6B1 (a generous giftfrom Dr. Dean Sheppard).Impacted human third molars containing the dental follicle were col-lected anonymously from patients requiring extractions of these teeth as a572.4. Materials and methodspart of their treatment (approved by the Clinical Research Ethics Board,University of British Columbia). Teeth with soft tissue remaining were fixedwith 2% formaldehyde in PBS and then decalcified in the same fixative con-taining 0.4 M EDTA. Frozen sections (6 ?m) containing patches of cellsresembling ameloblasts were identified and used for immunolocalization ofK14 (MCA890; AbD Serotec, Oxford, UK), amelogenin and ?6 integrinas described above using a fluorescently-labeled secondary antibody (Alexa488; Invitrogen).2.4.8 Mineral analysis of incisorsHemi-maxillas and -mandibles from 7-week-old male and female WT andItgb6-/- mice were removed and cleaned of adhering soft tissues. Proce-dures employed for isolating and removing sequential 1-mm-long strips ofdeveloping enamel from maxillary and mandibular incisors have been de-scribed in detail previously (Smith et al. 2005; Smith et al. 2009; Smith etal. 2011). Directly measured ?before? and ?after? heating weights were usedto calculate various parameters including mineral-to-volatiles ratio, whichrepresents the after-heating weight (mineral content of sample) divided bythe difference between the initial dry weight minus the after-heating weight(amount of volatiles in sample; mostly protein). Weight data for enamelstrips were collected from a minimum of 9 maxillary and 9 mandibular sam-ples per genotype.2.4.9 In situ hybridizationIn situ hybridization using digoxigenin-UTP labeled riboprobes was carriedout as previously described (Yoshida et al. 2010). A plasmid for integrin?6 integrin riboprobe was generated by inserting PCR products from mousecDNA into pCRII-TOPO vector (Invitrogen). Primers used for the PCRwere aggggtgactgctattgtgg and ggcaccaatgctttacact.2.4.10 Undecalcified histology, transmission electronmicroscopy and immunogold labelingWT and Itgb6-/- mouse mandibles were immersion-fixed overnight in sodiumcacodylate-buffered aldehyde solution and cut into segments containing themolars, underlying incisor and surrounding alveolar bone. The samples weredehydrated through a graded ethanol series and infiltrated in acrylic resin(LR White; London Resin Company, Berkshire, UK) followed by polymer-ization of at 55? C for two days. 1-?m sections of hemi-mandibles were582.4. Materials and methodscut with a diamond knife using an ultramicrotome, and glass slide-mountedsections were stained with 1% toluidine blue and von Kossa reagent formineral. Immunoglod-labeling for amelogenin coupled with TEM was per-formed as described previously (McKee and Nanci 1995; McKee et al. 1996)using an anti-amelogenin antibody kindly provided by Dr. Takashi Uchidaof Hiroshima University, Japan (Uchida et al. 1991).2.4.11 Micro-computed tomographyMicro-computed tomography (Micro-CT, model 1072; Skyscan, Kontich,Belgium) of undecalcified hemi-mandibles was performed at the level of thefirst molar from three samples of each genotype. The X-ray source was op-erated at maximum power (80 KeV) and at 100 ?A. Images were capturedusing a 12-bit, cooled, charge-coupled device camera (1024?1024 pixels)coupled by a fiber optic taper to the scintillator. Using a rotation stepof 0.9, total scanning time was 35 min for each sample with a scan res-olution of 5 ?m, after which ?300 sections (slice-to-slice distance of 16.5?m) were reconstructed using Skyscan tomography software. Appropriateimaging planes were selected to show three-dimensional longitudinal andcross-sectional ?sections? (segments) of the first molar and underlying in-cisor.2.4.12 Establishment of ameloblast cell linesMaxillary and mandibular incisors of 5-6-month-old WT and Itgb6-/- micewere prepared under aseptic conditions and placed in cell culture wells pre-coated with bovine fibronectin (10 ?g/ml; Millipore) and collagen (30 ?g/ml;PureCol R?; Advanced BioMatrix, Inc., San Diego, CA, USA) in keratinocytegrowth medium (KCM; Ha?kkinen et al. 2001). The cells growing out fromthe explants were differentially trypsinized to selectively remove the moreeasily released fibroblastic cells. The remaining epitheloid cells were con-firmed to express ameloblast marker K14 as well as to be positive (WT) ornegative (Itgb6-/-) for ?6 integrin expression by PCR. The ameloblasts wereroutinely grown in KCM.2.4.13 Cell spreading assaysFor cell spreading assays, WT ameloblasts were seeded in plates coated withEMD (10,000 ?g/ml in 10 mM acetic acid; Emdogain R? Straumann, Basel,Switzerland) in triplicates in the presence or absence of 50 ?M cycloheximide592.4. Materials and methods(a protein synthesis blocker) and 200 nM TPA (an integrin activator). Cellspreading was quantified as described previously (Narani et al., 2007).To explore the role of ?v?6 integrin in cell spreading on EMD, WTor Itgb6-/- ameloblasts were pre-incubated on ice with anti-integrin anti-bodies and then allowed to spread on EMD in the presence of TPA andin the absence of cycloheximide. The anti-?v?6 integrin antibodies usedwere: MAB2077Z (50 ?g/ml; Millipore), 6.8G6 (10 ?g/ml; Biogen Idec,Cambridge, MA, USA; Weinreb et al. 2004) and 6.3G9 (10 ?g/ml; Biogen).2.4.14 Amelogenin endocytosis by ameloblast-like cellsWT and Itgb6-/- ameloblasts were seeded onto glass coverslips (10,000 cellsper ml) for 24 h in KCM. The cells were treated with KCM only, with 100?g/ml of EMD or pre-treated for 10 min with 20 ?M E64d [(2S,3S)-trans-epoxysuccinyl-L-leucylamido-3-methylbutane ethyl ester; inhibits lysosomaldegradation of endocytosed proteins; McGowan et al. 1989)], followed byaddition of 100 ?g/ml of EMD. The cells were then incubated for 24 h andprocessed for immunofluorescence staining with anti-amelogenin antibody(PC-062).2.4.15 Statistical analysisThe experiments were repeated at least three times. The difference betweenWT and Itgb6-/- mice was calculated using unpaired, two-tailed Student?st-test using GraphPad InStat 3 software. Multiple comparison tests wereperformed using one-way ANOVA with Tukey?s post-test. Statistical signif-icance was set at p<0.05.60Chapter 3Conclusion and futurestudiesIn this paper, we demonstrate for the first time that ameloblast cell surface?v?6 integrin receptor critically regulates enamel biomineralization via reg-ulation of amelogenin and enamelin gene expression. In addition, we showthat ?6 integrin deficiency leads to amelogenesis imperfecta-like phenotypein mouse dentition. These mice show severe enamel defects including re-duced biomineralization of enamel and altered surface structure. Previously,it was reported that the secretome of rat incisor enamel organ contains ?6integrin transcript, but its function in enamel formation has not been pre-viously elucidated (Moffatt et al. 2006).Integrin ?v?6 is an exclusively epithelial adhesion protein that is absentfrom most parts of normal healthy epidermis and oral mucosa (Breuss et al.1993). However, recent studies indicate that ?v?6 integrin is constitutivelyexpressed in the junctional epithelium and oral epithelium of the gingivalpapilla (Csiszar et al. 2007; Ghannad et al. 2008). In vitro, ?v?6 integrinbinds to Arg-Gly-Asp (RGD) sequence containing extracellular matrix lig-ands. Amelogenin and most of the enamel matrix proteins (except bone anddentin sialoproteins) do not posses RGD motifs (Snead et al. 1983; Hu et al.1997; Stubbs et al. 1997; Chen et al. 1998; Bgue-Kirn et al. 1998; Ganss etal. 1999; Harris et al. 2000; Paine et al. 2005; Iwasaki et al. 2005; Moffattet al. 2006; Nawfal et al. 2007), making it unlikely that the ameloblast?v?6 integrins would directly interact with these molecules. However, thereis the possibility that there are cryptic sites within the matrix proteins thatcould unveil a ligand binding region which can interact with the ?v?6 re-ceptor. This could lead to binding of enamel matrix protein to the ?v?6receptor. There is also the possibility of bridging molecules that can act as aliason to allow matrix proteins to bind to the ?v?6 integrin. There may bebridging molecules that contain the RGD motif as well as a binding regionthat allows interaction of the matrix proteins with the ?v?6 integrin in anindirect manner, such as fibronectin (Narani et al. 2007).Our data indicate that ?6 integrin deficiency leads to accumulation of61Chapter 3. Conclusion and future studiesamelogenins in the enamel matrix leading to the mineralization defect andsubsequent enamel attrition. Moreover, there is an increased expressionof amelogenins and enamelin in their enamel organ. We also showed thatthis accumulation is likely due to excess production rather than reduceddegradation of amelogenin.Future studies should determine the relation between presence of thisintegrin and gene expression of enamel matrix proteins such as amelogenin.First, cell lines that have an increased amelogenin expression should be iden-tified. ?v?6 integrin should be blocked using either antibodies or SiRNA.Then signaling pathways and transcription factors should be studied.Amelogenin or its fragments are endocytosed by ameloblasts (Shapiro etal. 2007). This uptake may serve as a mechanism to regulate the amelogeninexpression (Xu et al. 2006). It is therefore possible that ?v?6 integrin isinvolved in the regulation of endocytosis of peptides from enamel protein,and lack of the integrin may lead to dysregulated accumulation and ex-pression of amelogenins in the enamel. When we seeded the WT and ?6integrin knockout ameloblasts in EMD coated (amelogenin rich) wells, therewas no difference in the pattern of endocytosis between the two cell lines.However, in vivo, amelogenin is surrounded by degradative enzymes suchas MMP20 and Klk4 which break down amelogenin into smaller fragments,and most likely it is these breakdown products that are actually endocytosedby the ameloblasts. A future study would be needed that includes seedingthe ameloblast cells (WT and ?6 integrin knockout) on a matrix that ismore representative of the in vivo matrix found surrounding ameloblasts.The matrix should include amelogenin along with the various degradativeenzymes, which cause in the formation of the amelogenin fragments, andthe uptake of these fragments can be compared between the two cell lines.This type of study may show that ?v?6 integrin does in fact disrupt theendocytosis and the feedback system for amelogenin expression.Our cell-spreading experiment results further indicated that the ?v?6 in-tegrin has an indirect role in the adhesion of ameloblast cells to amelogenin-rich matrix, and that the cells attached via an endogenously deposited ma-trix. It thus seems that the ?v?6 integrin is not essential for the ameloblastcell adhesion as the ?v?6 integrin knockout cells were also able to attachto the matrix in vitro, and the ameloblast cells remained attached to thedeveloping enamel in the knockout mice in vivo.Ameloblasts express TGF-?1, which contains the RGD site in the latentmolecule (Gao et al. 2009). TGF-?1 is a cell-signaling molecule that hasan important role in regulating tooth development during the early stages(Chai et al. 1994; Chai et al. 1999; Pelton et al. 1991). Binding of ?v?662Chapter 3. Conclusion and future studiesintegrin to the RGD site in the latent TGF-?1 causes activation of thispotent cytokine (Munger et al. 1999; Annes et al. 2004). Activated TGF-?1 in turn phosphorylates Smad2 and Smad3 which mediate the signals tothe nucleus (Yokozeki et al. 2003). The results of our study indicate thatenamel defects in the knockout mice is unlikely to be caused by alteredTGF-?1 activation, as no change was detected in the phosphorylation andexpression level of Smad2/3 in the ?6-/- mice enamel organ. Interestinglyhowever, smad3-/- mice share similarities in enamel defects with the ?6-/-mice (Yokozeki et al. 2003; Brown et al., 2007). It is clear that the TGF-?signaling regulates the amelogenesis process, but the role of ?v?6 integrin inactivation of TGF-?s in the ameloblast does not seem to be significant. Theexact mechanism and intracellular signaling leading to the enamel defectsin the ?6-/- mice remain to be further investigated.Lastly, there were other significant changes in the gene expression of?6-/- mice enamel organ that included an increased expression of Ank, andreduced expression of arrestin domain containing 3 protein (Arrdc2), pho-tocadherin21 (Pdch21), and family with sequence homology 20, member B(Fam20B). These genes have different roles in cell-adhesion and mineral-ization, and regulation of these genes in the ?6-/- mice enamel organ maycontribute to the hypomineralized enamel phenotype. Future studies shouldinvestigate the role of these genes in the enamel formation process. Futuresstudies should also further focus on investigating the mechanisms throughwhich the deficiency of this integrin leads to the observed abnormalities andclarify whether mutations in the ?6 integrin gene is associated with eitherhuman genetic (amelogenesis imperfecta) or acquired conditions that affectenamel formation.63Bibliography[1] J. T. Stubbs 3rd, K. P. Mintz, E. D. Eanes, D. A. Torchia, and L. W.Fisher. Characterization of native and recombinant bone sialopro-tein: delineation of the mineral-binding and cell adhesion domains andstructural analysis of the rgd domain. Journal of bone and mineralresearch, 12(8):1210?1222, 1997.[2] H. Akin, S. Tasveren, and D. Y. Yeler. Interdisciplinary approachto treating a patient with amelogenesis imperfecta: a clinical report.Journal of esthetic and restorative dentistry, 19(3):131?5; discussion136, 2007.[3] M. J. Aldred and P. J. Crawford. Amelogenesis imperfecta?towards anew classification. Oral diseases, 1(1):2?5, 1995.[4] M. J. Aldred, P. J. Crawford, E. Roberts, and N. S. Thomas. Identi-fication of a nonsense mutation in the amelogenin gene (amelx) in afamily with x-linked amelogenesis imperfecta (aih1). Human genetics,90(4):413?416, 1992.[5] M. J. Aldred, R. Savarirayan, and P. J. Crawford. Amelogenesis im-perfecta: a classification and catalogue for the 21st century. Oraldiseases, 9(1):19?23, 2003.[6] S. Almqvist, M. Werthen, A. Johansson, M. S. Agren, P. Thom-sen, and S. P. Lyngstadaas. Amelogenin is phagocytized and induceschanges in integrin configuration, gene expression and proliferationof cultured normal human dermal fibroblasts. Journal of materialsscience.Materials in medicine, 21(3):947?954, 2010.[7] S. Almqvist, M. Werthen, S. P. Lyngstadaas, C. Gretzer, and P. Thom-sen. Amelogenins promote an alternatively activated macrophage phe-notype in vitro. International Journal of Nano and Biomaterials,3:282?298, 2011.64Bibliography[8] P. Aluwihare, Z. Mu, Z. Zhao, D. Yu, P. H. Weinreb, G. S. Horan, S. M.Violette, and J. S. Munger. Mice that lack activity of alphavbeta6-and alphavbeta8-integrins reproduce the abnormalities of tgfb1- andtgfb3-null mice. Journal of cell science, 122(Pt 2):227?232, 2009.[9] J. P. Annes, Y. Chen, J. S. Munger, and D. B. Rifkin. Integrinalphavbeta6-mediated activation of latent tgf-beta requires the latenttgf-beta binding protein-1. The Journal of cell biology, 165(5):723?734,2004.[10] J. P. Annes, D. B. Rifkin, and J. S. Munger. The integrin alphavbeta6binds and activates latent tgfbeta3. FEBS letters, 511(1-3):65?68,2002.[11] B. Backman. Inherited enamel defects. Ciba Foundation symposium,205:175?82; discussion 183?6, 1997.[12] B. Backman and A. K. Holm. Amelogenesis imperfecta: prevalenceand incidence in a northern swedish county. Community dentistry andoral epidemiology, 14(1):43?47, 1986.[13] B. Backman and G. Holmgren. Amelogenesis imperfecta: a geneticstudy. Human heredity, 38(4):189?206, 1988.[14] M. Barczyk, S. Carracedo, and D. Gullberg. Integrins. Cell and tissueresearch, 339(1):269?280, 2010.[15] J. D. Bartlett, E. Beniash, D. H. Lee, and C. E. Smith. Decreasedmineral content in mmp-20 null mouse enamel is prominent during thematuration stage. Journal of dental research, 83(12):909?913, 2004.[16] J. D. Bartlett, J. M. Dobeck, C. E. Tye, M. Perez-Moreno, N. Stokes,A. B. Reynolds, E. Fuchs, and Z. Skobe. Targeted p120-catenin ab-lation disrupts dental enamel development. PloS one, 5(9):e12703,2010.[17] J. D. Bartlett, J. P. Simmer, J. Xue, H. C. Margolis, and E. C.Moreno. Molecular cloning and mrna tissue distribution of a novelmatrix metalloproteinase isolated from porcine enamel organ. Gene,183(1-2):123?128, 1996.[18] M. J. Beanan and T. D. Sargent. Regulation and function of dlx3 invertebrate development. Developmental Dynamics, 218:545?553, 2000.65Bibliography[19] C. Begue-Kirn, P. H. Krebsbach, J. D. Bartlett, and W. T. But-ler. Dentin sialoprotein, dentin phosphoprotein, enamelysin andameloblastin: tooth-specific molecules that are distinctively expressedduring murine dental differentiation. European journal of oral sciences,106(5):963?970, 1998.[20] M. Bei. Molecular genetics of ameloblast cell lineage. Journal ofexperimental zoology.Part B, Molecular and developmental evolution,312B(5):437?444, 2009.[21] M. Bei, S. Stowell, and R. Maas. Msx2 controls ameloblast terminaldifferentiation. Developmental dynamics , 231(4):758?765, 2004.[22] D. Bouvard, C. Brakebusch, E. Gustafsson, A. Aszodi, T. Bengtsson,A. Berna, and R. Fassler. Functional consequences of integrin genemutations in mice. Circulation research, 89(3):211?223, 2001.[23] P. Bouwman, H. Gollner, H. P. Elsasser, G. Eckhoff, A. Karis,F. Grosveld, S. Philipsen, and G. Suske. Transcription factor sp3is essential for post-natal survival and late tooth development. TheEMBO journal, 19(4):655?661, 2000.[24] J. M. Breuss, J. Gallo, H. M. DeLisser, I. V. Klimanskaya, H. G.Folkesson, J. F. Pittet, S. L. Nishimura, K. Aldape, D. V. Landers,and W. Carpenter. Expression of the beta 6 integrin subunit in de-velopment, neoplasia and tissue repair suggests a role in epithelial re-modeling. Journal of cell science, 108 ( Pt 6)(Pt 6):2241?2251, 1995.[25] J. M. Breuss, N. Gillett, L. Lu, D. Sheppard, and R. Pytela. Restricteddistribution of integrin beta 6 mrna in primate epithelial tissues. Thejournal of histochemistry and cytochemistry, 41(10):1521?1527, 1993.[26] J. M. Breuss, N. Gillett, L. Lu, D. Sheppard, and R. Pytela. Restricteddistribution of integrin ?6 mrna in primate epithelial tissues. 41:1521?1527, 1993.[27] S. J. Brookes, C. Robinson, J. Kirkham, and W. A. Bonass. Bio-chemistry and molecular biology of amelogenin proteins of developingdental enamel. Archives of Oral Biology, 40(1):1?14, 1995.[28] K. A. Brown, J. A. Pietenpol, and H. L. Moses. A tale of two pro-teins: differential roles and regulation of smad2 and smad3 in tgf-betasignaling. Journal of cellular biochemistry, 101(1):9?33, 2007.66Bibliography[29] K. Burridge and M. Chrzanowska-Wodnicka. Focal adhesions, con-tractility, and signaling. Annual Review of Cell and DevelopmentalBiology, 12:463?518, 1996.[30] M. Busk, R. Pytela, and D. Sheppard. Characterization of the inte-grin alpha v beta 6 as a fibronectin-binding protein. The Journal ofbiological chemistry, 267(9):5790?5796, 1992.[31] I. D. Campbell and M. J. Humphries. Integrin structure, activa-tion, and interactions. Cold Spring Harbor perspectives in biology,3(3):10.1101/cshperspect.a004994, 2011.[32] J. J. Caterina, Z. Skobe, J. Shi, Y. Ding, J. P. Simmer, H. Birkedal-Hansen, and J. D. Bartlett. Enamelysin (matrix metalloproteinase20)-deficient mice display an amelogenesis imperfecta phenotype. TheJournal of biological chemistry, 277(51):49598?49604, 20 2002.[33] V. Cattaneo, C. Rota, M. Silvestri, C. Piacentini, A. Forlino, A. Gal-lanti, G. Rasperini, and G. Cetta. Effect of enamel matrix derivativeon human periodontal fibroblasts: proliferation, morphology and rootsurface colonization. an in vitro study. Journal of periodontal research,38(6):568?574, 2003.[34] R. Cerny, I. Slaby, L. Hammarstrom, and T. Wurtz. A novel geneexpressed in rat ameloblasts codes for proteins with cell binding do-mains. Journal of bone and mineral research, 11(7):883?891, 1996.[35] Y. Chai, A. Mah, C. Crohin, S. Groff, P. Bringas Jr, T. Le, V. Santos,and H. C. Slavkin. Specific transforming growth factor-beta subtypesregulate embryonic mouse meckel?s cartilage and tooth development.Developmental biology, 162(1):85?103, 1994.[36] Y. Chai, J. Zhao, A. Mogharei, B. Xu, P. Bringas Jr, C. Shuler, andD. Warburton. Inhibition of transforming growth factor-beta type iireceptor signaling accelerates tooth formation in mouse first branchialarch explants. Mechanisms of development, 86(1-2):63?74, 1999.[37] H-C Chan, L. Mai, A. Oikonomopoulou, H. L. Chan, A. S. Richardson,S-K Wang, J. P. Simmer, and J. C-C Hu. Altered enamelin phosphory-lation site causes amelogenesis imperfecta. J.Dent.Res., 89(7):695?699,2010.67Bibliography[38] E. Chen, Z. A. Yuan, J. T. Wright, S. P. Hong, Y. Li, P. M. Collier,B. Hall, M. D?Angelo, S. Decker, R. Piddington, W. R. Abrams, A. B.Kulkarni, and C. W. Gibson. The small bovine amelogenin lrap fails torescue the amelogenin null phenotype. Calcified tissue international,73(5):487?495, 2003.[39] J. Chen, K. Sasaguri, J. Sodek, T. B. Aufdemorte, H. Jiang, andH. F. Thomas. Enamel epithelium expresses bone sialoprotein (bsp).European journal of oral sciences, 106 Suppl 1:331?336, 1998.[40] S. H. Cho, F. Seymen, K. E. Lee, S. K. Lee, Y. S. Kweon, K. J.Kim, S. E. Jung, S. J. Song, M. Yildirim, M. Bayram, E. B. Tuna,K. Gencay, and J. W. Kim. Novel fam20a mutations in hypoplasticamelogenesis imperfecta. Human mutation, 33(1):91?94, 2012.[41] Y. H. Chun, Y. Yamakoshi, F. Yamakoshi, M. Fukae, J. C. Hu, J. D.Bartlett, and J. P. Simmer. Cleavage site specificity of mmp-20 forsecretory-stage ameloblastin. Journal of dental research, 89(8):785?790, 2010.[42] R. A. Clark, G. S. Ashcroft, M. J. Spencer, H. Larjava, and M. W.Ferguson. Re-epithelialization of normal human excisional woundsis associated with a switch from alpha v beta 5 to alpha v beta 6integrins. The British journal of dermatology, 135(1):46?51, 1996.[43] P. M. Collier, J. J. Sauk, S. J. Rosenbloom, Z. A. Yuan, and C. W. Gib-son. An amelogenin gene defect associated with human x-linked amel-ogenesis imperfecta. Archives of Oral Biology, 42(3):235?242, 1997.[44] N. Crampton, N. H. Thomson, J. Kirkham, C. W. Gibson, and W. A.Bonass. Imaging rna polymerase-amelogenin gene complexes with sin-gle molecule resolution using atomic force microscopy. European jour-nal of oral sciences, 114 Suppl 1:133?8; discussion 164?5, 380?1, 2006.[45] P. J. Crawford, M. Aldred, and A. Bloch-Zupan. Amelogenesis imper-fecta. Orphanet journal of rare diseases, 2:17, 2007.[46] P. J. Crawford and M. J. Aldred. X-linked amelogenesis imperfecta.presentation of two kindreds and a review of the literature. Oralsurgery, oral medicine, and oral pathology, 73(4):449?455, 1992.[47] S. E. Crawford, V. Stellmach, J. E. Murphy-Ullrich, S. M. Ribeiro,J. Lawler, R. O. Hynes, G. P. Boivin, and N. Bouck. Thrombospondin-1 is a major activator of tgf-beta1 in vivo. Cell, 93:1159?1170, 1998.68Bibliography[48] A. Csiszar, C. Wiebe, H. Larjava, and L. Hakkinen. Distinctive molec-ular composition of human gingival interdental papilla. Journal ofperiodontology, 78(2):304?314, 2007.[49] S. L. Dallas, S. Park-Synder, K. Miyazono, D. Twardzik, G. R. Mundy,and L. F. Bonewald. Characterization and autoregulation of latenttransforming growth factor beta (tgf beta) complexes in osteoblast-like cell lines. production of a latent complex lacking the latent tgfbeta-binding protein. J.Biol.Chem., 269:6815?6821, 1994.[50] J. C. de Vicente, R. Cabo, E. Ciriaco, R. Laura, F. J. Naves, I. Silos-Santiago, and J. A. Vega. Impaired dental cytodifferentiation inglial cell-line derived growth factor (gdnf) deficient mice. Annals ofAnatomy = Anatomischer Anzeiger, 184(1):85?92, 2002.[51] M. Deakins and J. F. Volker. Amount of organic matter in enamelfrom several types of human teeth. J.Dent.Res., 20:117?121, 1941.[52] D. Deutsch. Structure and function of enamel gene products. TheAnatomical Record, 224(2):189?210, 1989.[53] Y. Ding, M. R. Estrella, Y. Y. Hu, H. L. Chan, H. D. Zhang, J. W.Kim, J. P. Simmer, and J. C. Hu. Fam83h is associated with intracel-lular vesicles and adhcai. Journal of dental research, 88(11):991?996,2009.[54] R. Dobrowolski, P. Sasse, J. W. Schrickel, M. Watkins, J. S. Kim,M. Rackauskas, C. Troatz, A. Ghanem, K. Tiemann, J. Degen, F. F.Bukauskas, R. Civitelli, T. Lewalter, B. K. Fleischmann, and K. Wil-lecke. The conditional connexin43g138r mouse mutant represents anew model of hereditary oculodentodigital dysplasia in humans. Hu-man molecular genetics, 17(4):539?554, 2008.[55] J. Dong, D. Amor, M. J. Aldred, T. Gu, M. Escamilla, and M. Mac-Dougall. Dlx3 mutation associated with autosomal dominant amelo-genesis imperfecta with taurodontism. American journal of medicalgenetics.Part A, 133A(2):138?141, 1 2005.[56] J. Dong, T. T. Gu, D. Simmons, and M. MacDougall. Enamelin mapsto human chromosome 4q21 within the autosomal dominant ameloge-nesis imperfecta locus. European journal of oral sciences, 108(5):353?358, 2000.69Bibliography[57] K. M. Draheim, H. B. Chen, Q. Tao, N. Moore, M. Roche, and S. Lyle.Arrdc3 suppresses breast cancer progression by negatively regulatingintegrin beta4. Oncogene, 29(36):5032?5047, 2010.[58] R. N. D?Souza and M. Litz. Analysis of tooth development in micebearing a tgf-beta 1 null mutation. Connective tissue research, 32(1-4):41?46, 1995.[59] C. M. Dubois, M. H. Laprise, F. Blanchette, L. E. Gentry, andR. Leduc. Processing of transforming growth factor beta 1 precur-sor by human furin convertase. The Journal of biological chemistry,270(18):10618?10624, 1995.[60] B. R. DuPont, C. C. Hu, X. Reveles, and J. P. Simmer. Assignmentof serine protease 17 (prss17) to human chromosome bands 19q13.3??q13.4 by in situ hybridization. Cytogenetics and cell genetics, 86(3-4):212?213, 1999.[61] B. F. Eames, Y. L. Yan, M. E. Swartz, D. S. Levic, E. W. Knapik, J. H.Postlethwait, and C. B. Kimmel. Mutations in fam20b and xylt1 re-veal that cartilage matrix controls timing of endochondral ossificationby inhibiting chondrocyte maturation. PLoS genetics, 7(8):e1002246,2011.[62] J. E. Eastoe. Enamel protein chemistry?past, present and future.Journal of dental research, 58(Spec Issue B):753?764, 1979.[63] W. El-Sayed, D. A. Parry, R. C. Shore, M. Ahmed, H. Jafri, Y. Rashid,S. Al-Bahlani, S. Al Harasi, J. Kirkham, C. F. Inglehearn, and A. J.Mighell. Mutations in the beta propeller wdr72 cause autosomal-recessive hypomaturation amelogenesis imperfecta. American Journalof Human Genetics, 85(5):699?705, 2009.[64] W. El-Sayed, R. C. Shore, D. A. Parry, C. F. Inglehearn, andA. J. Mighell. Ultrastructural analyses of deciduous teeth affectedby hypocalcified amelogenesis imperfecta from a family with a novely458x fam83h nonsense mutation. Cells, tissues, organs, 191(3):235?239, 2010.[65] W. El-Sayed, R. C. Shore, D. A. Parry, C. F. Inglehearn, and A. J.Mighell. Hypomaturation amelogenesis imperfecta due to wdr72 mu-tations: a novel mutation and ultrastructural analyses of deciduousteeth. Cells, tissues, organs, 194(1):60?66, 2011.70Bibliography[66] J. C. Elliott, D. W. Holcomb, and R. A. Young. Infrared determinationof the degree of substitution of hydroxyl by carbonate ions in humandental enamel. Calcified tissue international, 37(4):372?375, 1985.[67] A. G. Fincham, Y. Hu, E. C. Lau, H. C. Slavkin, and M. L. Snead.Amelogenin post-secretory processing during biomineralization in thepostnatal mouse molar tooth. Archives of Oral Biology, 36(4):305?317,1991.[68] A. G. Fincham, J. Moradian-Oldak, T. G. Diekwisch, D. M. Lyaruu,J. T. Wright, P. Bringas Jr, and H. C. Slavkin. Evidence for amel-ogenin ?nanospheres? as functional components of secretory-stageenamel matrix. Journal of structural biology, 115(1):50?59, 1995.[69] A. G. Fincham, J. Moradian-Oldak, and J. P. Simmer. The structuralbiology of the developing dental enamel matrix. Journal of structuralbiology, 126(3):270?299, 1999.[70] A. G. Fincham, J. Moradian-Oldak, J. P. Simmer, P. Sarte, E. C.Lau, T. Diekwisch, and H. C. Slavkin. Self-assembly of a recombinantamelogenin protein generates supramolecular structures. Journal ofstructural biology, 112(2):103?109, 1994.[71] L. Fontana, Y. Chen, P. Prijatelj, T. Sakai, R. Fassler, L. Y. Sakai,and D. B. Rifkin. Fibronectin is required for integrin alphavbeta6-mediated activation of latent tgf-beta complexes containing ltbp-1.FASEB journal , 19(13):1798?1808, 2005.[72] M. Fukae, T. Tanabe, T. Uchida, S. K. Lee, O. H. Ryu, C. Murakami,K. Wakida, J. P. Simmer, Y. Yamada, and J. D. Bartlett. Enamelysin(matrix metalloproteinase-20): localization in the developing toothand effects of ph and calcium on amelogenin hydrolysis. Journal ofdental research, 77(8):1580?1588, 1998.[73] S. Fukumoto, T. Kiba, B. Hall, N. Iehara, T. Nakamura, G. Lon-genecker, P. H. Krebsbach, A. Nanci, A. B. Kulkarni, and Y. Ya-mada. Ameloblastin is a cell adhesion molecule required for maintain-ing the differentiation state of ameloblasts. The Journal of cell biology,167(5):973?983, 2004.[74] S. Fukumoto, A. Yamada, K. Nonaka, and Y. Yamada. Essential rolesof ameloblastin in maintaining ameloblast differentiation and enamelformation. Cells, tissues, organs, 181(3-4):189?195, 2005.71Bibliography[75] B. Ganss, R. H. Kim, and J. Sodek. Bone sialoprotein. Critical reviewsin oral biology and medicine, 10(1):79?98, 1999.[76] S. Gao, C. Alarcon, G. Sapkota, S. Rahman, P. Y. Chen, N. Goerner,M. J. Macias, H. Erdjument-Bromage, P. Tempst, and J. Massague.Ubiquitin ligase nedd4l targets activated smad2/3 to limit tgf-betasignaling. Molecular cell, 36(3):457?468, 2009.[77] Y. Gao, D. Li, T. Han, Y. Sun, and J. Zhang. Tgf-beta1 and tgfbr1 areexpressed in ameloblasts and promote mmp20 expression. Anatomicalrecord (Hoboken, N.J.: 2007), 292(6):885?890, 2009.[78] R. C. Gentleman, V. J. Carey, D. M. Bates, B. Bolstad, M. Det-tling, S. Dudoit, B. Ellis, L. Gautier, Y. Ge, J. Gentry, K. Hornik,T. Hothorn, W. Huber, S. Iacus, R. Irizarry, F. Leisch, C. Li,M. Maechler, A. J. Rossini, G. Sawitzki, C. Smith, G. Smyth, L. Tier-ney, J. Y. Yang, and J. Zhang. Bioconductor: open software develop-ment for computational biology and bioinformatics. Genome biology,5(10):R80, 2004.[79] S. Gestrelius, C. Andersson, D. Lidstrom, L. Hammarstrom, andM. Somerman. In vitro studies on periodontal ligament cells andenamel matrix derivative. Journal of clinical periodontology, 24(9 Pt2):685?692, 1997.[80] F. Ghannad, D. Nica, M. I. Fulle, D. Grenier, E. E. Putnins, S. John-ston, A. Eslami, L. Koivisto, G. Jiang, M. D. McKee, L. Hakkinen,and H. Larjava. Absence of alphavbeta6 integrin is linked to initia-tion and progression of periodontal disease. The American journal ofpathology, 172(5):1271?1286, 2008.[81] F. G. Giancotti. Integrin signaling: specificity and control of cellsurvival and cell cycle progression. Current opinion in cell biology,9(5):691?700, 1997.[82] F. G. Giancotti and E. Ruoslahti. Integrin signaling. Science (NewYork, N.Y.), 285(5430):1028?1032, 1999.[83] C. W. Gibson, E. Golub, W. D. Ding, H. Shimokawa, M. Young,J. Termine, and J. Rosenbloom. Identification of the leucine-rich amel-ogenin peptide (lrap) as the translation product of an alternativelyspliced transcript. Biochemical and biophysical research communica-tions, 174(3):1306?1312, 1991.72Bibliography[84] C. W. Gibson, Z. A. Yuan, B. Hall, G. Longenecker, E. Chen, T. Thya-garajan, T. Sreenath, J. T. Wright, S. Decker, R. Piddington, G. Har-rison, and A. B. Kulkarni. Amelogenin-deficient mice display an amel-ogenesis imperfecta phenotype. The Journal of biological chemistry,276(34):31871?31875, 2001.[85] C. W. Gibson, Z. A. Yuan, Y. Li, B. Daly, C. Suggs, M. A. Aragon,F. Alawi, A. B. Kulkarni, and J. T. Wright. Transgenic mice thatexpress normal and mutated amelogenins. Journal of dental research,86(4):331?335, 2007.[86] K. Gokce, C. Canpolat, and E. Ozel. Restoring function and estheticsin a patient with amelogenesis imperfecta: a case report. The journalof contemporary dental practice, 8(4):95?101, 2007.[87] M. Goldberg, D. Septier, O. Rapoport, R. V. Iozzo, M. F. Young, andL. G. Ameye. Targeted disruption of two small leucine-rich proteogly-cans, biglycan and decorin, excerpts divergent effects on enamel anddentin formation. Calcified tissue international, 77(5):297?310, 2005.[88] S. R. Greene, Z. A. Yuan, J. T. Wright, H. Amjad, W. R. Abrams, J. A.Buchanan, D. I. Trachtenberg, and C. W. Gibson. A new frameshiftmutation encoding a truncated amelogenin leads to x-linked ameloge-nesis imperfecta. Archives of Oral Biology, 47(3):211?217, 2002.[89] A. Gritli-Linde, M. Bei, R. Maas, X. M. Zhang, A. Linde, and A. P.McMahon. Shh signaling within the dental epithelium is necessary forcell proliferation, growth and polarization. Development (Cambridge,England), 129(23):5323?5337, 2002.[90] S. J. Gutierrez, M. Chaves, D. M. Torres, and I. Briceno. Identi-fication of a novel mutation in the enamalin gene in a family withautosomal-dominant amelogenesis imperfecta. Archives of Oral Biol-ogy, 52(5):503?506, 2007.[91] K. Haapasalmi, K. Zhang, M. Tonnesen, J. Olerud, D. Sheppard,T. Salo, R. Kramer, R. A. Clark, V. J. Uitto, and H. Larjava. Ker-atinocytes in human wounds express alpha v beta 6 integrin. TheJournal of investigative dermatology, 106(1):42?48, 1996.[92] H. R. Haase and P. M. Bartold. Enamel matrix derivative induces ma-trix synthesis by cultured human periodontal fibroblast cells. Journalof periodontology, 72(3):341?348, 2001.73Bibliography[93] K. Hahm, M. E. Lukashev, Y. Luo, W. J. Yang, B. M. Dolinski, P. H.Weinreb, K. J. Simon, L. Chun Wang, D. R. Leone, R. R. Lobb, D. J.McCrann, N. E. Allaire, G. S. Horan, A. Fogo, R. Kalluri, C. F. Shield3rd, D. Sheppard, H. A. Gardner, and S. M. Violette. Alphav beta6integrin regulates renal fibrosis and inflammation in alport mouse. TheAmerican journal of pathology, 170(1):110?125, 2007.[94] L. Hakkinen, H. C. Hildebrand, A. Berndt, H. Kosmehl, and H. Lar-java. Immunolocalization of tenascin-c, alpha9 integrin subunit, andalphavbeta6 integrin during wound healing in human oral mucosa. Thejournal of histochemistry and cytochemistry, 48(7):985?998, 2000.[95] L. Hakkinen, L. Koivisto, H. Gardner, U. Saarialho-Kere, J. M. Car-roll, M. Lakso, H. Rauvala, M. Laato, J. Heino, and H. Larjava. In-creased expression of beta6-integrin in skin leads to spontaneous de-velopment of chronic wounds. The American journal of pathology,164(1):229?242, 2004.[96] L. Hakkinen, L. Koivisto, and H. Larjava. An improved method forculture of epidermal keratinocytes from newborn mouse skin. Methodsin cell science , 23(4):189?196, 2001.[97] S. Hamidi, T. Salo, T. Kainulainen, J. Epstein, K. Lerner, and H. Lar-java. Expression of alpha(v)beta6 integrin in oral leukoplakia. Britishjournal of cancer, 82(8):1433?1440, 2000.[98] J. Hao, K. Narayanan, T. Muni, A. Ramachandran, and A. George.Dentin matrix protein 4, a novel secretory calcium-binding proteinthat modulates odontoblast differentiation. The Journal of biologicalchemistry, 282(21):15357?15365, 2007.[99] H. Harada, T. Toyono, K. Toyoshima, M. Yamasaki, N. Itoh, S. Kato,K. Sekine, and H. Ohuchi. Fgf10 maintains stem cell compartmentin developing mouse incisors. Development (Cambridge, England),129(6):1533?1541, 2002.[100] D. Harmey, L. Hessle, S. Narisawa, K. A. Johnson, R. Terkeltaub,and J. L. Millan. Concerted regulation of inorganic pyrophosphateand osteopontin by akp2, enpp1, and ank: an integrated model ofthe pathogenesis of mineralization disorders. The American journalof pathology, 164(4):1199?1209, 2004.74Bibliography[101] N. L. Harris, K. R. Rattray, C. E. Tye, T. M. Underhill, M. J. Somer-man, J. A. D?Errico, A. F. Chambers, G. K. Hunter, and H. A. Gold-berg. Functional analysis of bone sialoprotein: identification of thehydroxyapatite-nucleating and cell-binding domains by recombinantpeptide expression and site-directed mutagenesis. Bone, 27(6):795?802, 2000.[102] P. S. Hart, M. J. Aldred, P. J. Crawford, N. J. Wright, T. C. Hart, andJ. T. Wright. Amelogenesis imperfecta phenotype-genotype correla-tions with two amelogenin gene mutations. Archives of Oral Biology,47(4):261?265, 2002.[103] P. S. Hart, S. Becerik, D. Cogulu, G. Emingil, D. Ozdemir-Ozenen,S. T. Han, P. P. Sulima, E. Firatli, and T. C. Hart. Novel fam83hmutations in turkish families with autosomal dominant hypocalcifiedamelogenesis imperfecta. Clinical genetics, 75(4):401?404, 2009.[104] P. S. Hart, T. C. Hart, M. D. Michalec, O. H. Ryu, D. Simmons,S. Hong, and J. T. Wright. Mutation in kallikrein 4 causes autosomalrecessive hypomaturation amelogenesis imperfecta. Journal of medicalgenetics, 41(7):545?549, 2004.[105] P. S. Hart, M. Michalec, W. Seow, T. Hart, and J. Wright. Identi-fication of a novel enamelin mutation (g.8344delg) in a family withamelogenesis imperfecta. Arch.Oral Biol., 48:589?591, 2003.[106] P. S. Hart, J. T. Wright, M. Savage, G. Kang, J. T. Bensen, M. C.Gorry, and T. C. Hart. Exclusion of candidate genes in two fami-lies with autosomal dominant hypocalcified amelogenesis imperfecta.European journal of oral sciences, 111(4):326?331, 2003.[107] S. Hart, T. Hart, C. Gibson, and J. T. Wright. Mutational analysisof x-linked amelogenesis imperfecta in multiple families. Archives ofOral Biology, 45(1):79?86, 2000.[108] T. C. Hart, P. S. Hart, M. C. Gorry, M. D. Michalec, O. H. Ryu,C. Uygur, D. Ozdemir, S. Firatli, G. Aren, and E. Firatli. Novel enammutation responsible for autosomal recessive amelogenesis imperfectaand localised enamel defects. Journal of medical genetics, 40(12):900?906, 2003.[109] N. Haruyama, T. Thyagarajan, Z. Skobe, J. T. Wright, D. Septier,T. L. Sreenath, M. Goldberg, and A. B. Kulkarni. Overexpression75Bibliographyof transforming growth factor-beta1 in teeth results in detachment ofameloblasts and enamel defects. European journal of oral sciences,114 Suppl 1:30?4; discussion 39?41, 379, 2006.[110] M. N. Helder, H. Karg, T. J. Bervoets, S. Vukicevic, E. H. Burger,R. N. D?Souza, J. H. Woltgens, G. Karsenty, and A. L. Bronckers.Bone morphogenetic protein-7 (osteogenic protein-1, op-1) and toothdevelopment. Journal of dental research, 77(4):545?554, 1998.[111] R. Heymann, S. Kallenbach, S. Alonso, P. Carroll, and T. A. Mitsiadis.Dynamic expression patterns of the new protocadherin families cnrsand pcdh-gamma during mouse odontogenesis: comparison with reelinexpression. Mechanisms of development, 106(1-2):181?184, 2001.[112] A. M. Hoang, T. W. Oates, and D. L. Cochran. In vitro wound heal-ing responses to enamel matrix derivative. Journal of periodontology,71(8):1270?1277, 2000.[113] G. S. Horan, S. Wood, V. Ona, D. J. Li, M. E. Lukashev, P. H. Wein-reb, K. J. Simon, K. Hahm, N. E. Allaire, N. J. Rinaldi, J. Goyal,C. A. Feghali-Bostwick, E. L. Matteson, C. O?Hara, R. Lafyatis, G. S.Davis, X. Huang, D. Sheppard, and S. M. Violette. Partial inhibitionof integrin alpha(v)beta6 prevents pulmonary fibrosis without exac-erbating inflammation. American journal of respiratory and criticalcare medicine, 177(1):56?65, 2008.[114] C. C. Hu, M. Fukae, T. Uchida, Q. Qian, C. H. Zhang, O. H. Ryu,T. Tanabe, Y. Yamakoshi, C. Murakami, N. Dohi, M. Shimizu, andJ. P. Simmer. Cloning and characterization of porcine enamelin mrnas.Journal of dental research, 76(11):1720?1729, 1997.[115] C. C. Hu, M. Fukae, T. Uchida, Q. Qian, C. H. Zhang, O. H. Ryu,T. Tanabe, Y. Yamakoshi, C. Murakami, N. Dohi, M. Shimizu, andJ. P. Simmer. Sheathlin: cloning, cdna/polypeptide sequences, and im-munolocalization of porcine enamel sheath proteins. Journal of dentalresearch, 76(2):648?657, 1997.[116] C. C. Hu, T. C. Hart, B. R. Dupont, J. J. Chen, X. Sun, Q. Qian,C. H. Zhang, H. Jiang, V. L. Mattern, J. T. Wright, and J. P. Simmer.Cloning human enamelin cdna, chromosomal localization, and analysisof expression during tooth development. Journal of dental research,79(4):912?919, 2000.76Bibliography[117] J. C. Hu, H. C. Chan, S. G. Simmer, F. Seymen, A. S. Richardson,Y. Hu, R. N. Milkovich, N. M. Estrella, M. Yildirim, M. Bayram, C. F.Chen, and J. P. Simmer. Amelogenesis imperfecta in two families withdefined amelx deletions in arhgap6. PloS one, 7(12):e52052, 2012.[118] J. C. Hu, Y. H. Chun, T. Al Hazzazzi, and J. P. Simmer. Enamel for-mation and amelogenesis imperfecta. Cells, tissues, organs, 186(1):78?85, 2007.[119] J. C. Hu, Y. Hu, C. E. Smith, M. D. McKee, J. T. Wright, Y. Ya-makoshi, P. Papagerakis, G. K. Hunter, J. Q. Feng, F. Yamakoshi,and J. P. Simmer. Enamel defects and ameloblast-specific expres-sion in enam knock-out/lacz knock-in mice. The Journal of biologicalchemistry, 283(16):10858?10871, 2008.[120] J. C. Hu, X. Sun, C. Zhang, S. Liu, J. D. Bartlett, and J. P. Simmer.Enamelysin and kallikrein-4 mrna expression in developing mouse mo-lars. European journal of oral sciences, 110(4):307?315, 2002.[121] J. C. Hu and Y. Yamakoshi. Enamelin and autosomal-dominant amel-ogenesis imperfecta. Critical reviews in oral biology and medicine,14(6):387?398, 2003.[122] J. C. Hu, C. Zhang, X. Sun, Y. Yang, X. Cao, O. Ryu, and J. P.Simmer. Characterization of the mouse and human prss17 genes, theirrelationship to other serine proteases, and the expression of prss17 indeveloping mouse incisors. Gene, 251(1):1?8, 2000.[123] J. C. Hu, C. H. Zhang, Y. Yang, C. Karrman-Mardh, K. Forsman-Semb, and J. P. Simmer. Cloning and characterization of the mouseand human enamelin genes. Journal of dental research, 80(3):898?902,2001.[124] X. Huang, J. Wu, S. Spong, and D. Sheppard. The integrin alphav-beta6 is critical for keratinocyte migration on both its known ligand,fibronectin, and on vitronectin. Journal of cell science, 111 ( Pt 15)(Pt15):2189?2195, 1998.[125] X. Huang, J. Wu, W. Zhu, R. Pytela, and D. Sheppard. Expres-sion of the human integrin beta6 subunit in alveolar type ii cells andbronchiolar epithelial cells reverses lung inflammation in beta6 knock-out mice. American journal of respiratory cell and molecular biology,19(4):636?642, 1998.77Bibliography[126] X. Z. Huang, J. F. Wu, D. Cass, D. J. Erle, D. Corry, S. G. Young,R. V. Farese Jr, and D. Sheppard. Inactivation of the integrin beta 6subunit gene reveals a role of epithelial integrins in regulating inflam-mation in the lung and skin. The Journal of cell biology, 133(4):921?928, 1996.[127] R. O. Hynes. Integrins: versatility, modulation, and signaling in celladhesion. Cell, 69(1):11?25, 1992.[128] R. O. Hynes. Integrins: bidirectional, allosteric signaling machines.Cell, 110(6):673?687, 2002.[129] R. O. Hynes. The emergence of integrins: a personal and historicalperspective. Matrix biology : journal of the International Society forMatrix Biology, 23(6):333?340, 2004.[130] M. Hyytiainen, C. Penttinen, and J. Keski-Oja. Latent tgf-beta bind-ing proteins: extracellular matrix association and roles in tgf-beta ac-tivation. Critical reviews in clinical laboratory sciences, 41(3):233?264,2004.[131] H. O. Ishikawa, A. Xu, E. Ogura, G. Manning, and K. D. Irvine. Theraine syndrome protein fam20c is a golgi kinase that phosphorylatesbio-mineralization proteins. PloS one, 7(8):e42988, 2012.[132] Y. Ito, P. Sarkar, Q. Mi, N. Wu, P. Bringas Jr, Y. Liu, S. Reddy,R. Maxson, C. Deng, and Y. Chai. Overexpression of smad2 revealsits concerted action with smad4 in regulating tgf-beta-mediated epi-dermal homeostasis. Developmental biology, 236(1):181?194, 2001.[133] K. Iwasaki, E. Bajenova, E. Somogyi-Ganss, M. Miller, V. Nguyen,H. Nourkeyhani, Y. Gao, M. Wendel, and B. Ganss. Amelotin?anovel secreted, ameloblast-specific protein. Journal of dental research,84(12):1127?1132, 2005.[134] T. Jackson, D. Sheppard, M. Denyer, W. Blakemore, and A. M. King.The epithelial integrin alphavbeta6 is a receptor for foot-and-mouthdisease virus. Journal of virology, 74(11):4949?4956, 2000.[135] S. C. Janga and N. Mittal. Construction, structure and dynamics ofpost-transcriptional regulatory network directed by rna-binding pro-teins. Advances in Experimental Medicine and Biology, 722:103?117,2011.78Bibliography[136] J. Jernvall and I. Thesleff. Reiterative signaling and patterning dur-ing mammalian tooth morphogenesis. Mechanisms of development,92(1):19?29, 2000.[137] M. F. Jobling, J. D. Mott, M. T. Finnegan, V. Jurukovski, A. C.Erickson, P. J. Walian, S. E. Taylor, S. Ledbetter, C. M. Lawrence,D. B. Rifkin, and M. H. Barcellos-Hoff. Isoform-specific activation oflatent transforming growth factor beta (ltgf-beta) by reactive oxygenspecies. Radiation research, 166(6):839?848, 2006.[138] K. Josephsen and O. Fejerskov. Ameloblast modulation in the matu-ration zone of the rat incisor enamel organ. a light and electron mi-croscopic study. Journal of anatomy, 124(Pt 1):45?70, 1977.[139] J. Jovanovic, J. Takagi, L. Choulier, N. G. Abrescia, D. I. Stuart, P. A.van der Merwe, H. J. Mardon, and P. A. Handford. alphavbeta6 isa novel receptor for human fibrillin-1. comparative studies of molecu-lar determinants underlying integrin-rgd affinity and specificity. TheJournal of biological chemistry, 282(9):6743?6751, 2007.[140] M. Jussila and I. Thesleff. Signaling networks regulating tooth organo-genesis and regeneration, and the specification of dental mesenchymaland epithelial cell lineages. Cold Spring Harbor perspectives in biology,4(4):a008425, 2012.[141] E. Kallenbach. The fine structure of tomes? process of rat incisorameloblasts and its relationship to the elaboration of enamel. Tissue& cell, 5(3):501?524, 1973.[142] H. Y. Kang, F. Seymen, S. K. Lee, M. Yildirim, E. B. Tuna, A. Patir,K. E. Lee, and J. W. Kim. Candidate gene strategy reveals enammutations. Journal of dental research, 88(3):266?269, 2009.[143] J. S. Kang, C. Liu, and R. Derynck. New regulatory mechanisms oftgf-beta receptor function. Trends in cell biology, 19(8):385?394, 2009.[144] T. Kawase, K. Okuda, H. Yoshie, and D. M. Burns. Cytostatic ac-tion of enamel matrix derivative (emdogain) on human oral squamouscell carcinoma-derived scc25 epithelial cells. Journal of periodontalresearch, 35(5):291?300, 2000.[145] M. Kida, T. Ariga, T. Shirakawa, H. Oguchi, and Y. Sakiyama.Autosomal-dominant hypoplastic form of amelogenesis imperfecta79Bibliographycaused by an enamelin gene mutation at the exon-intron boundary.Journal of dental research, 81(11):738?742, 2002.[146] M. Kida, Y. Sakiyama, A. Matsuda, S. Takabayashi, H. Ochi,H. Sekiguchi, S. Minamitake, and T. Ariga. A novel missense mutation(p.p52r) in amelogenin gene causing x-linked amelogenesis imperfecta.Journal of dental research, 86(1):69?72, 2007.[147] J. W. Kim, S. K. Lee, Z. H. Lee, J. C. Park, K. E. Lee, M. H. Lee,J. T. Park, B. M. Seo, J. C. Hu, and J. P. Simmer. Fam83h mutationsin families with autosomal-dominant hypocalcified amelogenesis im-perfecta. American Journal of Human Genetics, 82(2):489?494, 2008.[148] J. W. Kim, F. Seymen, B. P. Lin, B. Kiziltan, K. Gencay, J. P. Simmer,and J. C. Hu. Enam mutations in autosomal-dominant amelogenesisimperfecta. Journal of dental research, 84(3):278?282, 2005.[149] J. W. Kim, J. P. Simmer, T. C. Hart, P. S. Hart, M. D. Ramaswami,J. D. Bartlett, and J. C. Hu. Mmp-20 mutation in autosomal reces-sive pigmented hypomaturation amelogenesis imperfecta. Journal ofmedical genetics, 42(3):271?275, 2005.[150] J. W. Kim, J. P. Simmer, Y. Y. Hu, B. P. Lin, C. Boyd, J. T. Wright,C. J. Yamada, S. K. Rayes, R. J. Feigal, and J. C. Hu. Amelogeninp.m1t and p.w4s mutations underlying hypoplastic x-linked ameloge-nesis imperfecta. Journal of dental research, 83(5):378?383, 2004.[151] J. W. Kim, J. P. Simmer, B. P. Lin, F. Seymen, J. D. Bartlett, andJ. C. Hu. Mutational analysis of candidate genes in 24 amelogenesisimperfecta families. European journal of oral sciences, 114 Suppl 1:3?12; discussion 39?41, 379, 2006.[152] S. A. Kindelan, A. H. Brook, L. Gangemi, N. Lench, F. S. Wong,J. Fearne, Z. Jackson, G. Foster, and B. M. Stringer. Detection of anovel mutation in x-linked amelogenesis imperfecta. Journal of dentalresearch, 79(12):1978?1982, 2000.[153] B. Klopcic, T. Maass, E. Meyer, H. A. Lehr, D. Metzger, P. Chambon,A. Mann, and M. Blessing. Tgf-beta superfamily signaling is essentialfor tooth and hair morphogenesis and differentiation. European journalof cell biology, 86(11-12):781?799, 2007.80Bibliography[154] T. Koike, T. Izumikawa, J. Tamura, and H. Kitagawa. Fam20b isa kinase that phosphorylates xylose in the glycosaminoglycan-proteinlinkage region. The Biochemical journal, 421(2):157?162, 2009.[155] S. Kojima, K. Nara, and D. B. Rifkin. Requirement for transglutam-inase in the activation of latent transforming growth factor-beta inbovine endothelial cells. The Journal of cell biology, 121(2):439?448,1993.[156] L. L. Koth, B. Alex, S. Hawgood, M. A. Nead, D. Sheppard, D. J. Erle,and D. G. Morris. Integrin beta6 mediates phospholipid and collectinhomeostasis by activation of latent tgf-beta1. American journal ofrespiratory cell and molecular biology, 37(6):651?659, 2007.[157] P. H. Krebsbach, S. K. Lee, Y. Matsuki, C. A. Kozak, K. M. Yamada,and Y. Yamada. Full-length sequence, localization, and chromosomalmapping of ameloblastin. a novel tooth-specific gene. The Journal ofbiological chemistry, 271(8):4431?4435, 1996.[158] Y. S. Kweon, K. E. Lee, J. Ko, J. C. Hu, J. P. Simmer, and J. W. Kim.Effects of fam83h overexpression on enamel and dentine formation.Archives of Oral Biology, 58(9):1148?1154, 2013.[159] R. S. Lacruz, A. Nanci, I. Kurtz, J. T. Wright, and M. L. Paine.Regulation of ph during amelogenesis. Calcified tissue international,86(2):91?103, 2010.[160] M. Lagerstrom, N. Dahl, Y. Nakahori, Y. Nakagome, B. Backman,U. Landegren, and U. Pettersson. A deletion in the amelogenin gene(amg) causes x-linked amelogenesis imperfecta (aih1). Genomics,10(4):971?975, 1991.[161] M. Lagerstrom-fermer, M. Nilsson, B. Bckman, E. C. Salido,C. Shapiro, U. Petterson, and U. Landegren. Amelogenin signal pep-tide mutation: correlation mutations in the amelogenin gene (amgx)and manifestation of amelogenin imperfecta. Genomics, 26:159?162,1995.[162] H. Larjava, L. Koivisto, L. Hakkinen, and J. Heino. Epithelial integrinswith special reference to oral epithelia. Journal of dental research,90(12):1367?1376, 2011.81Bibliography[163] H. Larjava, J. Peltonen, S. K. Akiyama, S. S. Yamada, H. R. Gral-nick, J. Uitto, and K. M. Yamada. Novel function for beta 1 inte-grins in keratinocyte cell-cell interactions. The Journal of cell biology,110(3):803?815, 1990.[164] H. Larjava, T. Salo, K. Haapasalmi, R. H. Kramer, and J. Heino. Ex-pression of integrins and basement membrane components by woundkeratinocytes. The Journal of clinical investigation, 92(3):1425?1435,1993.[165] E. C. Lau, T. K. Mohandas, L. J. Shapiro, H. C. Slavkin, and M. L.Snead. Human and mouse amelogenin gene loci are on the sex chro-mosomes. Genomics, 4(2):162?168, 1989.[166] D. A. Lawrence, R. Pircher, C. Kryceve-Martinerie, and F. Jullien.Normal embryo fibroblasts release transforming growth factors in alatent form. Journal of Cellular Physiology, 121:184?188, 1984.[167] K. E. Lee, S. K. Lee, S. E. Jung, S. J. Song, S. H. Cho, Z. H. Lee, andJ. W. Kim. A novel mutation in the amelx gene and multiple crownresorptions. European journal of oral sciences, 119 Suppl 1:324?328,2011.[168] M. J. Lee, S. K. Lee, K. E. Lee, H. Y. Kang, H. S. Jung, and J. W.Kim. Expression patterns of the fam83h gene during murine toothdevelopment. Archives of Oral Biology, 54(9):846?850, 2009.[169] S. K. Lee, J. C. Hu, J. D. Bartlett, K. E. Lee, B. P. Lin, J. P. Sim-mer, and J. W. Kim. Mutational spectrum of fam83h: the c-terminalportion is required for tooth enamel calcification. Human mutation,29(8):E95?9, 2008.[170] M. L. LeFevre and R. S. Manly. Moisture, inorganic and organiccontents of enamel and dentin from carious teeth. Journal of AmericanDental Association, 24:233?242, 1932.[171] N. J. Lench, A. H. Brook, and G. B. Winter. Sscp detection of anonsense mutation in exon 5 of the amelogenin gene (amgx) causingx-linked amelogenesis imperfecta (aih1). Human molecular genetics,3(5):827?828, 1994.[172] N. J. Lench and G. B. Winter. Characterisation of molecular defects inx-linked amelogenesis imperfecta (aih1). Human mutation, 5(3):251?259, 1995.82Bibliography[173] M. O. Li, S. Sanjabi, and R. A. Flavell. Transforming growth factor-?controls development, homeostasis, and tolerance of t cells by reg-ulatory t cell-dependent and -independent mechanisms. Immunity,25:455?471, 2006.[174] H. Limeback and A. Simic. Biochemical characterization of stable highmolecular-weight aggregates of amelogenins formed during porcineenamel development. Archives of Oral Biology, 35(6):459?468, 1990.[175] E. Llano, A. M. Pendas, V. Knauper, T. Sorsa, T. Salo, E. Salido,G. Murphy, J. P. Simmer, J. D. Bartlett, and C. Lopez-Otin. Identifi-cation and structural and functional characterization of human enam-elysin (mmp-20). Biochemistry, 36(49):15101?15108, 1997.[176] B. L. Loeys, J. Chen, E. R. Neptune, D. P. Judge, M. Podowski,T. Holm, J. Meyers, C. C. Leitch, N. Katsanis, N. Sharifi, F. L. Xu,L. A. Myers, P. J. Spevak, D. E. Cameron, J. De Backer, J. Hellemans,Y. Chen, E. C. Davis, C. L. Webb, W. Kress, P. Coucke, D. B. Rifkin,A. M. De Paepe, and H. C. Dietz. A syndrome of altered cardiovas-cular, craniofacial, neurocognitive and skeletal development caused bymutations in tgfbr1 or tgfbr2. Nature genetics, 37:275?281, 2005.[177] Y. Lu, P. Papagerakis, Y. Yamakoshi, J. C. Hu, J. D. Bartlett, andJ. P. Simmer. Functions of klk4 and mmp-20 in dental enamel forma-tion. Biological chemistry, 389(6):695?700, 2008.[178] D. Ma, R. Zhang, Y. Sun, H. F. Rios, N. Haruyama, X. Han, A. B.Kulkarni, C. Qin, and J. Q. Feng. A novel role of periostin in post-natal tooth formation and mineralization. The Journal of biologicalchemistry, 286(6):4302?4309, 2011.[179] L. J. Ma, H. Yang, A. Gaspert, G. Carlesso, M. M. Barty, J. M.Davidson, D. Sheppard, and A. B. Fogo. Transforming growth factor-beta-dependent and -independent pathways of induction of tubuloint-erstitial fibrosis in beta6(-/-) mice. The American journal of pathology,163(4):1261?1273, 2003.[180] M. MacDougall, B. R. DuPont, D. Simmons, B. Reus, P. Krebsbach,C. Karrman, G. Holmgren, R. J. Leach, and K. Forsman. Ameloblastingene (ambn) maps within the critical region for autosomal dominantamelogenesis imperfecta at chromosome 4q21. Genomics, 41(1):115?118, 1997.83Bibliography[181] C. K. Mardh, B. Backman, G. Holmgren, J. C. Hu, J. P. Simmer, andK. Forsman-Semb. A nonsense mutation in the enamelin gene causeslocal hypoplastic autosomal dominant amelogenesis imperfecta (aih2).Human molecular genetics, 11(9):1069?1074, 2002.[182] J. Massague, S. W. Blain, and R. S. Lo. Tgfbeta signaling in growthcontrol, cancer, and heritable disorders. Cell, 103(2):295?309, 2000.[183] H. Masuya, K. Shimizu, H. Sezutsu, Y. Sakuraba, J. Nagano,A. Shimizu, N. Fujimoto, A. Kawai, I. Miura, H. Kaneda,K. Kobayashi, J. Ishijima, T. Maeda, Y. Gondo, T. Noda, S. Wakana,and T. Shiroishi. Enamelin (enam) is essential for amelogenesis:Enu-induced mouse mutants as models for different clinical subtypesof human amelogenesis imperfecta (ai). Human molecular genetics,14(5):575?583, 2005.[184] E. B. McGowan, E. Becker, and T. C. Detwiler. Inhibition of calpainin intact platelets by the thiol protease inhibitor e-64d. Biochemicaland biophysical research communications, 158(2):432?435, 1989.[185] M. D. McKee and A. Nanci. Osteopontin and the bone remodelingsequence. colloidal-gold immunocytochemistry of an interfacial extra-cellular matrix protein. Annals of the New York Academy of Sciences,760:177?189, 1995.[186] M. D. McKee, S. Zalzal, and A. Nanci. Extracellular matrix in toothcementum and mantle dentin: localization of osteopontin and othernoncollagenous proteins, plasma proteins, and glycoconjugates by elec-tron microscopy. The Anatomical Record, 245(2):293?312, 1996.[187] F. Michon, M. Tummers, M. Kyyronen, M. J. Frilander, andI. Thesleff. Tooth morphogenesis and ameloblast differentiation areregulated by micro-rnas. Developmental biology, 340(2):355?368, 2010.[188] S. E. Millar, E. Koyama, S. T. Reddy, T. Andl, T. Gaddapara, R. Pid-dington, and C. W. Gibson. Over- and ectopic expression of wnt3causes progressive loss of ameloblasts in postnatal mouse incisor teeth.Connective tissue research, 44 Suppl 1:124?129, 2003.[189] L. C. Miller, W. Blakemore, D. Sheppard, A. Atakilit, A. M. King,and T. Jackson. Role of the cytoplasmic domain of the beta-subunitof integrin alpha(v)beta6 in infection by foot-and-mouth disease virus.Journal of virology, 75(9):4158?4164, 2001.84Bibliography[190] K. Miyazono, A. Olofsson, P. Colosetti, and C. H. Heldin. A role ofthe latent tgf-beta 1-binding protein in the assembly and secretion oftgf-beta 1. The EMBO journal, 10(5):1091?1101, 1991.[191] P. Moffatt, C. E. Smith, R. Sooknanan, R. St-Arnaud, and A. Nanci.Identification of secreted and membrane proteins in the rat incisorenamel organ using a signal-trap screening approach. European journalof oral sciences, 114 Suppl 1:139?46; discussion 164?5, 380?1, 2006.[192] P. Moffatt, C. E. Smith, R. St-Arnaud, D. Simmons, J. T. Wright,and A. Nanci. Cloning of rat amelotin and localization of the proteinto the basal lamina of maturation stage ameloblasts and junctionalepithelium. The Biochemical journal, 399(1):37?46, 2006.[193] L. Mohazab, L. Koivisto, G. Jiang, L. Kyto?ma?ki, M. Haapasalo, G. R.Owen, C. Wiebe, Y. Xie, K. Heikinheimo, T. Yoshida, et al. Criticalrole for ?v?6 integrin in enamel biomineralization. Journal of cellscience, 126(3):732?744, 2013.[194] H. Morishita and T. Yagi. Protocadherin family: diversity, structure,and function. Current opinion in cell biology, 19(5):584?592, 2007.[195] A. Moustakas and C. H. Heldin. Dynamic control of tgf-beta signalingand its links to the cytoskeleton. FEBS letters, 582(14):2051?2065,2008.[196] J. S. Munger, X. Huang, H. Kawakatsu, M. J. Griffiths, S. L. Dalton,J. Wu, J. F. Pittet, N. Kaminski, C. Garat, M. A. Matthay, D. B.Rifkin, and D. Sheppard. The integrin alpha v beta 6 binds andactivates latent tgf beta 1: a mechanism for regulating pulmonaryinflammation and fibrosis. Cell, 96(3):319?328, 1999.[197] T. Mustonen, M. Ilmonen, M. Pummila, A. T. Kangas, J. Laurikkala,R. Jaatinen, J. Pispa, O. Gaide, P. Schneider, I. Thesleff, and M. L.Mikkola. Ectodysplasin a1 promotes placodal cell fate during earlymorphogenesis of ectodermal appendages. Development (Cambridge,England), 131(20):4907?4919, 2004.[198] T. Nagano, A. Kakegawa, Y. Yamakoshi, S. Tsuchiya, J. C. Hu,K. Gomi, T. Arai, J. D. Bartlett, and J. P. Simmer. Mmp-20 andklk4 cleavage site preferences for amelogenin sequences. Journal ofdental research, 88(9):823?828, 2009.85Bibliography[199] T. Nagano, S. Oida, H. Ando, K. Gomi, T. Arai, and M. Fukae. Rela-tive levels of mrna encoding enamel proteins in enamel organ epitheliaand odontoblasts. Journal of dental research, 82(12):982?986, 2003.[200] Y. Nakahori, O. Takenaka, and Y. Nakagome. A human x-y homolo-gous region encodes ?amelogenin?. Genomics, 9(2):264?269, 1991.[201] T. Nakamura, S. de Vega, S. Fukumoto, L. Jimenez, F. Unda, andY. Yamada. Transcription factor epiprofin is essential for tooth mor-phogenesis by regulating epithelial cell fate and tooth number. TheJournal of biological chemistry, 283(8):4825?4833, 2008.[202] D. Nalbant, H. Youn, S. I. Nalbant, S. Sharma, E. Cobos, E. G. Beale,Y. Du, and S. C. Williams. Fam20: an evolutionarily conserved familyof secreted proteins expressed in hematopoietic cells. BMC genomics,6:11, 2005.[203] A. Nanci and C. E. Smith. Matrix-mediated mineralization in enameland the collagen-based hard tissues, chapter 35, pages 217?224. Chem-istry and Biology of Mineralized Tissues. Rosemont, 2000.[204] N. Narani, G. R. Owen, L. Hakkinen, E. Putnins, and H. Larjava.Enamel matrix proteins bind to wound matrix proteins and regu-late their cell-adhesive properties. European journal of oral sciences,115(4):288?295, 2007.[205] A. H. Nawfal, D. Sidney, and J-Y Sire. Mammalian enamelins: iden-tification of conserved regions, evolution mode and made use of forvalidation of mutations leading to amelogenesis imperfecta. EuropeanCells and Materials Journal, 14:67, 2007.[206] J. Dos Santos Neves, R. M. Wazen, S. Kuroda, S. Francis Zalzal,P. Moffatt, and A. Nanci. Odontogenic ameloblast-associated andamelotin are novel basal lamina components. Histochemistry and cellbiology, 137(3):329?338, 2012.[207] F. K. Ng and L. B. Messer. Dental management of amelogenesis imper-fecta patients: a primer on genotype-phenotype correlations. Pediatricdentistry, 31(1):20?30, 2009.[208] S. L. Nishimura. Integrin-mediated transforming growth factor-betaactivation, a potential therapeutic target in fibrogenic disorders. TheAmerican journal of pathology, 175(4):1362?1370, 2009.86Bibliography[209] E. Ostergaard, M. Batbayli, M. Duno, K. Vilhelmsen, and T. Rosen-berg. Mutations in pcdh21 cause autosomal recessive cone-rod dys-trophy. Journal of medical genetics, 47(10):665?669, 2010.[210] J. O?Sullivan, C. C. Bitu, S. B. Daly, J. E. Urquhart, M. J. Barron,S. S. Bhaskar, H. Martelli-Junior, P. E. dos Santos Neto, M. A. Man-silla, J. C. Murray, R. D. Coletta, G. C. Black, and M. J. Dixon.Whole-exome sequencing identifies fam20a mutations as a cause ofamelogenesis imperfecta and gingival hyperplasia syndrome. Ameri-can Journal of Human Genetics, 88(5):616?620, 13 2011.[211] D. Ozdemir, P. S. Hart, E. Firatli, G. Aren, O. H. Ryu, and T. C.Hart. Phenotype of enam mutations is dosage-dependent. Journal ofdental research, 84(11):1036?1041, 2005.[212] D. Ozdemir, P. S. Hart, O. H. Ryu, S. J. Choi, M. Ozdemir-Karatas,E. Firatli, N. Piesco, and T. C. Hart. Mmp20 active-site mutation inhypomaturation amelogenesis imperfecta. Journal of dental research,84(11):1031?1035, 2005.[213] M. L. Paine, W. Luo, H. J. Wang, P. Bringas Jr, A. Y. Ngan, V. G.Miklus, D. H. Zhu, M. MacDougall, S. N. White, and M. L. Snead.Dentin sialoprotein and dentin phosphoprotein overexpression duringamelogenesis. The Journal of biological chemistry, 280(36):31991?31998, 2005.[214] M. L. Paine, D. H. Zhu, W. Luo, and M. L. Snead. Overexpressionof trap in the enamel matrix does not alter the enamel structuralhierarchy. Cells, tissues, organs, 176(1-3):7?16, 2004.[215] P. Papagerakis, H. K. Lin, K. Y. Lee, Y. Hu, J. P. Simmer, J. D.Bartlett, and J. C. Hu. Premature stop codon in mmp20 causing amel-ogenesis imperfecta. Journal of dental research, 87(1):56?59, 2008.[216] D. A. Parry, A. J. Mighell, W. El-Sayed, R. C. Shore, I. K. Jalili,H. Dollfus, A. Bloch-Zupan, R. Carlos, I. M. Carr, L. M. Downey,K. M. Blain, D. C. Mansfield, M. Shahrabi, M. Heidari, P. Aref, M. Ab-basi, M. Michaelides, A. T. Moore, J. Kirkham, and C. F. Inglehearn.Mutations in cnnm4 cause jalili syndrome, consisting of autosomal-recessive cone-rod dystrophy and amelogenesis imperfecta. AmericanJournal of Human Genetics, 84(2):266?273, 2009.87Bibliography[217] E. Patsenker, Y. Popov, F. Stickel, A. Jonczyk, S. L. Goodman, andD. Schuppan. Inhibition of integrin alphavbeta6 on cholangiocytesblocks transforming growth factor-beta activation and retards biliaryfibrosis progression. Gastroenterology, 135(2):660?670, 2008.[218] A. Pavlic, M. Petelin, and T. Battelino. Phenotype and enamelultrastructure characteristics in patients with enam gene mutationsg.13185-13186insag and 8344delg. Archives of Oral Biology, 52(3):209?217, 2007.[219] R. W. Pelton, B. Saxena, M. Jones, H. L. Moses, and L. I. Gold. Im-munohistochemical localization of tgf beta 1, tgf beta 2, and tgf beta 3in the mouse embryo: expression patterns suggest multiple roles duringembryonic development. The Journal of cell biology, 115(4):1091?1105,1991.[220] J. J. Pindborg and J. P. Weinmann. Morphologic and functional cor-relations in the enamel organ of the rat incisor during amelogenesis.Acta Anatomica, 36(4):367?381, 1959.[221] J. F. Pittet, M. J. Griffiths, T. Geiser, N. Kaminski, S. L. Dalton,X. Huang, L. A. Brown, P. J. Gotwals, V. E. Koteliansky, M. A.Matthay, and D. Sheppard. Tgf-? is a critical mediator of acute lunginjury. The Journal of clinical investigation, 107:1537?1544, 2001.[222] R. A. Poche, R. Sharma, M. D. Garcia, A. M. Wada, M. J. Nolte, R. S.Udan, J. H. Paik, R. A. DePinho, J. D. Bartlett, and M. E. Dickinson.Transcription factor foxo1 is essential for enamel biomineralization.PloS one, 7(1):e30357, 2012.[223] B. Polok, P. Escher, A. Ambresin, E. Chouery, S. Bolay, I. Meunier,F. Nan, C. Hamel, F. L. Munier, B. Thilo, A. Megarbane, and D. F.Schorderet. Mutations in cnnm4 cause recessive cone-rod dystrophywith amelogenesis imperfecta. American Journal of Human Genetics,84(2):259?265, 2009.[224] S. Poulsen, H. Gjorup, D. Haubek, G. Haukali, H. Hintze, H. Lovschall,and M. Errboe. Amelogenesis imperfecta - a systematic literature re-view of associated dental and oro-facial abnormalities and their impacton patients. Acta Odontologica Scandinavica, 66(4):193?199, 2008.[225] S. K. Prakash, R. Paylor, S. Jenna, N. Lache-Vane, D. L. Armstrong,B. Xu, M. A. Mancini, and H. Y. Zoghbi. Functional analysis of88Bibliographyarhgap6, a novel gtpase-activating protein for rhoa. Human moleculargenetics, 9(4):477?488, 2000.[226] J. A. Price, D. W. Bowden, J. T. Wright, M. J. Pettenati, and T. C.Hart. Identification of a mutation in dlx3 associated with tricho-dento-osseous (tdo) syndrome. Human molecular genetics, 7(3):563?569,1998.[227] A. L. Prieto, G. M. Edelman, and K. L. Crossin. Multiple inte-grins mediate cell attachment to cytotactin/tenascin. Proceedings ofthe National Academy of Sciences of the United States of America,90(21):10154?10158, 1993.[228] K. Puthawala, N. Hadjiangelis, S. C. Jacoby, E. Bayongan, Z. Zhao,Z. Yang, M. L. Devitt, G. S. Horan, P. H. Weinreb, M. E. Lukashev,S. M. Violette, K. S. Grant, C. Colarossi, S. C. Formenti, and J. S.Munger. Inhibition of integrin alpha(v)beta6, an activator of latenttransforming growth factor-beta, prevents radiation-induced lung fi-brosis. American journal of respiratory and critical care medicine,177(1):82?90, 2008.[229] R. Quinonez, R. Hoover, and J. T. Wright. Transitional anterior es-thetic restorations for patients with enamel defects. Pediatric den-tistry, 22(1):65?67, 2000.[230] S. Rajagopal, K. Rajagopal, and R. J. Lefkowitz. Teaching old re-ceptors new tricks: biasing seven-transmembrane receptors. Naturereviews.Drug discovery, 9(5):373?386, 2010.[231] M. H. Rajpar, K. Harley, C. Laing, R. M. Davies, and M. J. Dixon.Mutation of the gene encoding the enamel-specific protein, enamelin,causes autosomal-dominant amelogenesis imperfecta. Human molecu-lar genetics, 10(16):1673?1677, 2001.[232] D. B. Ravassipour, P. S. Hart, T. C. Hart, A. V. Ritter, M. Yamauchi,C. Gibson, and J. T. Wright. Unique enamel phenotype associatedwith amelogenin gene (amelx) codon 41 point mutation. Journal ofdental research, 79(7):1476?1481, 2000.[233] E. J. Reith. The stages of amelogenesis as observed in molar teeth ofyoung rats. Journal of Ultrastructure Research, 30:111?151, 1970.89Bibliography[234] E. J. Reith and A. Boyde. Histochemical and electron probe analysisof secretory ameloblasts of developing rat molar teeth. Histochemistry,55(1):17?26, 1978.[235] H. Rios, S. V. Koushik, H. Wang, J. Wang, H. M. Zhou, A. Lindsley,R. Rogers, Z. Chen, M. Maeda, A. Kruzynska-Frejtag, J. Q. Feng, andS. J. Conway. Periostin null mice exhibit dwarfism, incisor enamel de-fects, and an early-onset periodontal disease-like phenotype. Molecularand cellular biology, 25(24):11131?11144, 2005.[236] S. Risnes. Growth tracks in dental enamel. Journal of human evolu-tion, 35(4-5):331?350, 1998.[237] E. Ronnholm. The amelogenesis of human teeth as revealedby electron microscopy. i: The fine structure of the ameloblasts.J.Ultrastruct.Res., 6:229?248, 1962.[238] E. Ronnholm. The amelogenesis of human teeth as revealed by electronmicroscopy. ii. the development of the enamel crystallites. Journal ofultrastructure research, 6:249?303, 1962.[239] I. Ruspita, K. Miyoshi, T. Muto, K. Abe, T. Horiguchi, and T. Noma.Sp6 downregulation of follistatin gene expression in ameloblasts. Thejournal of medical investigation : JMI, 55(1-2):87?98, 2008.[240] M. C. Ryan, K. Lee, Y. Miyashita, and W. G. Carter. Targeted dis-ruption of the lama3 gene in mice reveals abnormalities in survivaland late stage differentiation of epithelial cells. The Journal of cellbiology, 145(6):1309?1323, 1999.[241] O. Ryu, J. C. Hu, Y. Yamakoshi, J. L. Villemain, X. Cao, C. Zhang,J. D. Bartlett, and J. P. Simmer. Porcine kallikrein-4 activation, glyco-sylation, activity, and expression in prokaryotic and eukaryotic hosts.European journal of oral sciences, 110(5):358?365, 2002.[242] C. Sabatini and S. Guzman-Armstrong. A conservative treatment foramelogenesis imperfecta with direct resin composite restorations: acase report. Journal of esthetic and restorative dentistry, 21(3):161?9;discussion 170, 2009.[243] M. K. Saha and S. G. Saha. Restoration of anterior teeth with directcomposite veneers in amelogenesis imperfecta. International Journalof Dental Clinics, 3(2):99?100, 2011.90Bibliography[244] J. Saharinen and J. Keski-Oja. Specific sequence motif of 8-cys repeatsof tgf-beta binding proteins, ltbps, creates a hydrophobic interactionsurface for binding of small latent tgf-beta. Molecular biology of thecell, 11(8):2691?2704, 2000.[245] E. C. Salido, P. H. Yen, K. Koprivnikar, L. C. Yu, and L. J. Shapiro.The human enamel protein gene amelogenin is expressed from boththe x and the y chromosomes. American Journal of Human Genetics,50(2):303?316, 1992.[246] K. Salmivirta, D. Gullberg, E. Hirsch, F. Altruda, and P. Ekblom. In-tegrin subunit expression associated with epithelial-mesenchymal in-teractions during murine tooth development. Developmental dynamics, 205(2):104?113, 1996.[247] C. Sanchez-Quevedo, G. Ceballos, I. A. Rodriguez, J. M. Garcia, andM. Alaminos. Acid-etching effects in hypomineralized amelogenesisimperfecta. a microscopic and microanalytical study. Medicina oral,patologia oral y cirugia bucal, 11(1):E40?3, 2006.[248] A. R. Espirito Santo, J. D. Bartlett, C. W. Gibson, Y. Li, A. B. Kulka-rni, and S. R. Line. Amelogenin- and enamelysin (mmp-20)-deficientmice display altered birefringence in the secretory-stage enamel or-ganic extracellular matrix. Connective tissue research, 48(1):39?45,2007.[249] A. P. Pires Dos Santos, C. M. Cabral, L. F. Moliterno, and B. H.Oliveira. Amelogenesis imperfecta: report of a successful transitionaltreatment in the mixed dentition. Journal of dentistry for children(Chicago, Ill.), 75(2):201?206, 2008.[250] S. Sapir and J. Shapira. Clinical solutions for developmental defectsof enamel and dentin in children. Pediatric dentistry, 29(4):330?336,2007.[251] I. Satokata, L. Ma, H. Ohshima, M. Bei, I. Woo, K. Nishizawa,T. Maeda, Y. Takano, M. Uchiyama, S. Heaney, H. Peters, Z. Tang,R. Maxson, and R. Maas. Msx2 deficiency in mice causes pleiotropicdefects in bone growth and ectodermal organ formation. Nature ge-netics, 24(4):391?395, 2000.91Bibliography[252] H. E. Schroeder and M. A. Listgarten. Fine structure of the developingepithelial attachment of human teeth. Monographs in developmentalbiology, 2:1?134, 1971.[253] H. Seedorf, M. Klaften, F. Eke, H. Fuchs, U. Seedorf, and M. Hrabede Angelis. A mutation in the enamelin gene in a mouse model. Journalof dental research, 86(8):764?768, 2007.[254] H. Seedorf, I. N. Springer, E. Grundner-Culemann, H. K. Albers,A. Reis, H. Fuchs, M. Hrabe de Angelis, and Y. Acil. Amelogene-sis imperfecta in a new animal model?a mutation in chromosome 5(human 4q21). Journal of dental research, 83(8):608?612, 2004.[255] J. Seitsonen, P. Susi, O. Heikkila, R. S. Sinkovits, P. Laurinmaki,T. Hyypia, and S. J. Butcher. Interaction of alphavbeta3 and al-phavbeta6 integrins with human parechovirus 1. Journal of virology,84(17):8509?8519, 2010.[256] H. Sekiguchi, S. Alaluusua, K. Minaguchi, and M. Yakushiji. A newmutation in the amelogenin gene causes x-linked amelogenesis imper-fecta. J.Dent.Res., 80:617, 2001.[257] H. Sekiguchi, M. Kiyoshi, and M. Yakushiji. Dna diagnosis of x-linkedamelogenesis imperfecta using pcr detection method of the humanamelogenin gene. Dent. Jpn., 37:109?112, 2001.[258] W. K. Seow and A. Amaratunge. The effects of acid-etching on enamelfrom different clinical variants of amelogenesis imperfecta: an semstudy. Pediatric dentistry, 20(1):37?42, 1998.[259] J. L. Shapiro, X. Wen, C. T. Okamoto, H. J. Wang, S. P. Lyngstadaas,M. Goldberg, M. L. Snead, and M. L. Paine. Cellular uptake of amel-ogenin, and its localization to cd63, and lamp1-positive vesicles. Cel-lular and molecular life sciences : CMLS, 64(2):244?256, 2007.[260] D. Sheppard, C. Rozzo, L. Starr, V. Quaranta, D. J. Erle, andR. Pytela. Complete amino acid sequence of a novel integrin beta sub-unit (beta 6) identified in epithelial cells using the polymerase chainreaction. The Journal of biological chemistry, 265(20):11502?11507,15 1990.[261] M. M. Shull, I. Ormsby, A. B. Kier, S. Pawlowski, R. J. Diebold,M. Yin, R. Allen, C. Sidman, G. Proetzel, and D. Calvin. Targeted92Bibliographydisruption of the mouse transforming growth factor-beta 1 gene resultsin multifocal inflammatory disease. Nature, 359(6397):693?699, 1992.[262] J. P. Simmer and A. G. Fincham. Molecular mechanisms of dentalenamel formation. Crit.Rev.Oral Biol.Med., 6(2):84?108, 1995.[263] J. P. Simmer and J. C. Hu. Dental enamel formation and its impacton clinical dentistry. Journal of dental education, 65(9):896?905, 2001.[264] J. P. Simmer and J. C. Hu. Expression, structure, and function ofenamel proteinases. Connective tissue research, 43(2-3):441?449, 2002.[265] J. P. Simmer, Y. Hu, R. Lertlam, Y. Yamakoshi, and J. C. Hu. Hypo-maturation enamel defects in klk4 knockout/lacz knockin mice. TheJournal of biological chemistry, 284(28):19110?19121, 2009.[266] J. P. Simmer, P. Papagerakis, C. E. Smith, D. C. Fisher, A. N. Roun-trey, L. Zheng, and J. C. Hu. Regulation of dental enamel shape andhardness. Journal of dental research, 89(10):1024?1038, 2010.[267] S. G. Simmer, N. M. Estrella, R. N. Milkovich, and J. C. Hu.Autosomal dominant amelogenesis imperfecta associated with enamframeshift mutation p.asn36ilefs56. Clinical genetics, 83(2):195?197,2013.[268] M. A. Simpson, R. Hsu, L. S. Keir, J. Hao, G. Sivapalan, L. M. Ernst,E. H. Zackai, L. I. Al-Gazali, G. Hulskamp, H. M. Kingston, T. E.Prescott, A. Ion, M. A. Patton, V. Murday, A. George, and A. H.Crosby. Mutations in fam20c are associated with lethal osteoscleroticbone dysplasia (raine syndrome), highlighting a crucial molecule inbone development. American Journal of Human Genetics, 81(5):906?912, 2007.[269] C. E. Smith. Ameloblasts: secretory and resorptive functions. Journalof dental research, 58(Spec Issue B):695?707, 1979.[270] C. E. Smith. Cellular and chemical events during enamel maturation.Critical reviews in oral biology and medicine, 9(2):128?161, 1998.[271] C. E. Smith, D. L. Chong, J. D. Bartlett, and H. C. Margolis. Mineralacquisition rates in developing enamel on maxillary and mandibularincisors of rats and mice: implications to extracellular acid loadingas apatite crystals mature. Journal of bone and mineral research,20(2):240?249, 2005.93Bibliography[272] C. E. Smith, M. Issid, H. C. Margolis, and E. C. Moreno. Developmen-tal changes in the ph of enamel fluid and its effects on matrix-residentproteinases. Advances in Dental Research, 10:159?169, 1996.[273] C. E. Smith and A. Nanci. A method for sampling the stages ofamelogenesis on mandibular rat incisors using the molars as a referencefor dissection. The Anatomical Record, 225(3):257?266, 1989.[274] C. E. Smith, A. S. Richardson, Y. Hu, J. D. Bartlett, J. C. Hu, andJ. P. Simmer. Effect of kallikrein 4 loss on enamel mineralization: com-parison with mice lacking matrix metalloproteinase 20. The Journalof biological chemistry, 286(20):18149?18160, 2011.[275] C. E. Smith, R. Wazen, Y. Hu, S. F. Zalzal, A. Nanci, J. P. Simmer,and J. C. Hu. Consequences for enamel development and mineral-ization resulting from loss of function of ameloblastin or enamelin.European journal of oral sciences, 117(5):485?497, 2009.[276] M. L. Snead, M. Zeichner-David, T. Chandra, K. J. Robson, S. L.Woo, and H. C. Slavkin. Construction and identification of mouseamelogenin cdna clones. Proceedings of the National Academy of Sci-ences of the United States of America, 80(23):7254?7258, 1983.[277] G. Stephanopoulos, M. E. Garefalaki, and K. Lyroudia. Genes andrelated proteins involved in amelogenesis imperfecta. Journal of dentalresearch, 84(12):1117?1126, 2005.[278] N. Suzuki, M. Ohyama, M. Maeno, K. Ito, and K. Otsuka. Attachmentof human periodontal ligament cells to enamel matrix-derived proteinis mediated via interaction between bsp-like molecules and integrinalpha(v)beta3. Journal of periodontology, 72(11):1520?1526, 2001.[279] S. Suzuki and Y. Naitoh. Amino acid sequence of a novel integrin beta4 subunit and primary expression of the mrna in epithelial cells. TheEMBO journal, 9(3):757?763, 1990.[280] J. Taipale, J. Saharinen, and J. Keski-Oja. Extracellular matrix-associated transforming growth factor-beta: role in cancer cell growthand invasion. Advances in Cancer Research, 75:87?134, 1998.[281] Y. Takano. Cytochemical studies of ameloblasts and the surface layerof enamel of the rat incisor at the maturation stage. Archivum histo-logicum Japonicum = Nihon soshikigaku kiroku, 42(1):11?32, 1979.94Bibliography[282] Y. Takano. Enamel mineralization and the role of ameloblasts in cal-cium transport. Connective tissue research, 33(1-3):127?137, 1995.[283] R. N. Tamura, C. Rozzo, L. Starr, J. Chambers, L. F. Reichardt,H. M. Cooper, and V. Quaranta. Epithelial integrin ?6?4: completeprimary structure of ?6 variant forms of ?4. The Journal of cell biol-ogy, 111:1593?1604, 1990.[284] T. Tanabe. Purification and characterization of proteolytic enzymesin porcine immature enamel. Tsurumi shigaku.Tsurumi Universitydental journal, 10(3):443?452, 1984.[285] G. Tarone, E. Hirsch, M. Brancaccio, M. De Acetis, L. Barberis,F. Balzac, S. F. Retta, C. Botta, F. Altruda, and L. Silengo. Integrinfunction and regulation in development. The International journal ofdevelopmental biology, 44(6):725?731, 2000.[286] R Development Core Team. R: A Language and Environment forStatistical Computing. R Foundation for Statistical Computing, 2008.[287] I. Thesleff. Epithelial-mesenchymal signalling regulating tooth mor-phogenesis. Journal of cell science, 116(Pt 9):1647?1648, 2003.[288] I. Thesleff. The genetic basis of tooth development and dental de-fects. American journal of medical genetics.Part A, 140(23):2530?2535, 2006.[289] I. Thesleff and K. Hurmerinta. Tissue interactions in tooth develop-ment. Differentiation, 18:75?88, 1981.[290] I. Thesleff, A. Vaahtokari, P. Kettunen, and T. Aberg. Epithelial-mesenchymal signaling during tooth development. Connective tissueresearch, 32:9?15, 1995.[291] G. J. Thomas, M. L. Nystrom, and J. F. Marshall. Alphavbeta6 in-tegrin in wound healing and cancer of the oral cavity. Journal of oralpathology & medicine, 35(1):1?10, 2006.[292] M. Tummers and I. Thesleff. Root or crown: a developmental choiceorchestrated by the differential regulation of the epithelial stem cellniche in the tooth of two rodent species. Development (Cambridge,England), 130(6):1049?1057, 2003.95Bibliography[293] M. Tummers and I. Thesleff. Observations on continuously growingroots of the sloth and the k14-eda transgenic mice indicate that epithe-lial stem cells can give rise to both the ameloblast and root epitheliumcell lineage creating distinct tooth patterns. Evolution & development,10(2):187?195, 2008.[294] M. Tummers and I. Thesleff. The importance of signal pathway mod-ulation in all aspects of tooth development. Journal of experimentalzoology.Part B, Molecular and developmental evolution, 312B(4):309?319, 2009.[295] T. Uchida, M. Fukae, T. Tanabe, Y. Yamakoshi, T. Satoda, C. Mu-rakami, O. Takahashi, and M. Shimizu. Immunochemical and immuno-cytochemical study of a 15 kda non-amelogenin and related proteinsin the porcine immature enamel: Proposal of a new group of enamelproteins sheath proteins. Biomed Res, 16:131?140, 1995.[296] T. Uchida, C. Murakami, K. Wakida, N. Dohi, Y. Iwai, J. P. Simmer,M. Fukae, T. Satoda, and O. Takahashi. Sheath proteins: synthesis,secretion, degradation and fate in forming enamel. European journalof oral sciences, 106 Suppl 1:308?314, 1998.[297] T. Uchida, T. Tanabe, M. Fukae, M. Shimizu, M. Yamada, K. Miake,and S. Kobayashi. Immunochemical and immunohistochemical stud-ies, using antisera against porcine 25 kda amelogenin, 89 kda enamelinand the 13-17 kda nonamelogenins, on immature enamel of the pig andrat. Histochemistry, 96(2):129?138, 1991.[298] M. T. van der Pauw, V. Everts, and W. Beertsen. Expression of inte-grins by human periodontal ligament and gingival fibroblasts and theirinvolvement in fibroblast adhesion to enamel matrix-derived proteins.Journal of periodontal research, 37(5):317?323, 2002.[299] S. M. Wahl, J. Swisher, N. McCartney-Francis, and W. Chen. Tgf-beta: the perpetrator of immune suppression by regulatory t cells andsuicidal t cells. Journal of leukocyte biology, 76(1):15?24, 2004.[300] B. Wang, B. M. Dolinski, N. Kikuchi, D. R. Leone, M. G. Peters,P. H. Weinreb, S. M. Violette, and D. M. Bissell. Role of alphav-beta6 integrin in acute biliary fibrosis. Hepatology (Baltimore, Md.),46(5):1404?1412, 2007.96Bibliography[301] W. Wang, J. Xu, B. Du, and T. Kirsch. Role of the progressive anky-losis gene (ank) in cartilage mineralization. Molecular and cellularbiology, 25(1):312?323, 2005.[302] X. Wang, J. Hao, Y. Xie, Y. Sun, B. Hernandez, A. K. Yamoah,M. Prasad, Q. Zhu, J. Q. Feng, and C. Qin. Expression of fam20cin the osteogenesis and odontogenesis of mouse. The journal of histo-chemistry and cytochemistry, 58(11):957?967, 2010.[303] X. Wang, J. Hao, Y. Xie, Y. Sun, B. Hernandez, A. K. Yamoah,M. Prasad, Q. Zhu, J. Q. Feng, and C. Qin. Expression of fam20cin the osteogenesis and odontogenesis of mouse. The journal of histo-chemistry and cytochemistry, 58(11):957?967, 2010.[304] X. P. Wang, M. Suomalainen, S. Felszeghy, L. C. Zelarayan, M. T.Alonso, M. V. Plikus, R. L. Maas, C. M. Chuong, T. Schimmang, andI. Thesleff. An integrated gene regulatory network controls stem cellproliferation in teeth. PLoS biology, 5(6):e159, 2007.[305] X. P. Wang, M. Suomalainen, C. J. Jorgez, M. M. Matzuk, S. Werner,and I. Thesleff. Follistatin regulates enamel patterning in mouse in-cisors by asymmetrically inhibiting bmp signaling and ameloblast dif-ferentiation. Developmental cell, 7(5):719?730, 2004.[306] P. H. Weinreb, K. J. Simon, P. Rayhorn, W. J. Yang, D. R. Leone,B. M. Dolinski, B. R. Pearse, Y. Yokota, H. Kawakatsu, A. Atakilit,D. Sheppard, and S. M. Violette. Function-blocking integrin alphav-beta6 monoclonal antibodies: distinct ligand-mimetic and nonligand-mimetic classes. The Journal of biological chemistry, 279(17):17875?17887, 2004.[307] C. H. Williams, T. Kajander, T. Hyypia, T. Jackson, D. Sheppard,and G. Stanway. Integrin alpha v beta 6 is an rgd-dependent receptorfor coxsackievirus a9. Journal of virology, 78(13):6967?6973, 2004.[308] P. J. Wipff and B. Hinz. Integrins and the activation of latent trans-forming growth factor beta1 - an intimate relationship. European jour-nal of cell biology, 87(8-9):601?615, 2008.[309] P. J. Wipff, D. B. Rifkin, J. J. Meister, and B. Hinz. Myofibroblastcontraction activates latent tgf-beta1 from the extracellular matrix.The Journal of cell biology, 179(6):1311?1323, 2007.97Bibliography[310] C. J. Witkop. Hereditary defects in enamel and dentin. Acta Geneticaet Statistica Medica, 7(1):236?239, 1957.[311] C. J. Witkop. Amelogenesis imperfecta, dentinogenesis imperfecta anddentin dysplasia revisited: problems in classification. Journal of oralpathology, 17(9-10):547?553, 1988.[312] C. J. Witkop and J. J. Sauk. Heritable defects of enamel. Oral FacialGenetics, pages 151?226, 1976.[313] J. J. Worthington, J. E. Klementowicz, and M. A. Travis. Tgfbeta:a sleeping giant awoken by integrins. Trends in biochemical sciences,36(1):47?54, 2011.[314] J. T. Wright. Oral manifestations in the epidermolysis bullosa spec-trum. Dermatologic clinics, 28(1):159?164, 2010.[315] J. T. Wright, B. Daly, D. Simmons, S. Hong, S. P. Hart, T. C. Hart,P. Atsawasuwan, and M. Yamauchi. Human enamel phenotype as-sociated with amelogenesis imperfecta and a kallikrein-4 (g.2142g?a)proteinase mutation. European journal of oral sciences, 114 Suppl1:13?7; discussion 39?41, 379, 2006.[316] J. T. Wright, P. S. Hart, M. J. Aldred, K. Seow, P. J. Crawford,S. P. Hong, C. W. Gibson, and T. C. Hart. Relationship of phenotypeand genotype in x-linked amelogenesis imperfecta. Connective tissueresearch, 44 Suppl 1:72?78, 2003.[317] J. T. Wright, T. C. Hart, P. S. Hart, D. Simmons, C. Suggs, B. Daley,J. Simmer, J. Hu, J. D. Bartlett, Y. Li, Z. A. Yuan, W. K. Seow, andC. W. Gibson. Human and mouse enamel phenotypes resulting frommutation or altered expression of amel, enam, mmp20 and klk4. Cells,tissues, organs, 189(1-4):224?229, 2009.[318] J. T. Wright, M. Torain, K. Long, K. Seow, P. Crawford, M. J. Al-dred, P. S. Hart, and T. C. Hart. Amelogenesis imperfecta: genotype-phenotype studies in 71 families. Cells, tissues, organs, 194(2-4):279?283, 2011.[319] J. E. Wu and S. A. Santoro. Complex patterns of expression suggestextensive roles for the alpha 2 beta 1 integrin in murine development.Developmental dynamics, 199(4):292?314, 1994.98Bibliography[320] Y. Xie, K. Gao, L. Hakkinen, and H. S. Larjava. Mice lackingbeta6 integrin in skin show accelerated wound repair in dexametha-sone impaired wound healing model. Wound repair and regeneration,17(3):326?339, 2009.[321] L. Xu, H. Harada, T. Yokohama-Tamaki, S. Matsumoto, J. Tanaka,and A. Taniguchi. Reuptake of extracellular amelogenin by dental ep-ithelial cells results in increased levels of amelogenin mrna throughenhanced mrna stabilization. The Journal of biological chemistry,281(4):2257?2262, 27 2006.[322] S. Yamada, K. M. Yamada, and K. E. Brown. Integrin regulatoryswitching in development: oscillation of beta 5 integrin mrna expres-sion during epithelial-mesenchymal interactions in tooth development.The International journal of developmental biology, 38(3):553?556,1994.[323] P. M. Yamaguti, A. C. Acevedo, and L. M. de Paula. Rehabilitationof an adolescent with autosomal dominant amelogenesis imperfecta:case report. Operative dentistry, 31(2):266?272, 2006.[324] Y. Yamakoshi, J. C. Hu, M. Fukae, F. Yamakoshi, and J. P. Simmer.How do enamelysin and kallikrein 4 process the 32-kda enamelin? Eu-ropean journal of oral sciences, 114 Suppl 1:45?51; discussion 93?5,379?80, 2006.[325] Y. Yamakoshi, T. Tanabe, S. Oida, C. C. Hu, J. P. Simmer, andM. Fukae. Calcium binding of enamel proteins and their derivativeswith emphasis on the calcium-binding domain of porcine sheathlin.Archives of Oral Biology, 46(11):1005?1014, 2001.[326] Z. Yang, Z. Mu, B. Dabovic, V. Jurukovski, D. Yu, J. Sung, X. Xiong,and J. S. Munger. Absence of integrin-mediated tgfbeta1 activation invivo recapitulates the phenotype of tgfbeta1-null mice. The Journalof cell biology, 176(6):787?793, 2007.[327] M. Yokozeki, E. Afanador, M. Nishi, K. Kaneko, H. Shimokawa,K. Yokote, C. Deng, K. Tsuchida, H. Sugino, and K. Moriyama. Smad3is required for enamel biomineralization. Biochemical and biophysicalresearch communications, 305(3):684?690, 2003.[328] K. Yoshiba, N. Yoshiba, D. Aberdam, G. Meneguzzi, F. Perrin-Schmitt, C. Stoetzel, J. V. Ruch, and H. Lesot. Expression and99Bibliographylocalization of laminin-5 subunits during mouse tooth development.Developmental dynamics, 211(2):164?176, 1998.[329] T. Yoshida, J. Miyoshi, Y. Takai, and I. Thesleff. Cooperation ofnectin-1 and nectin-3 is required for normal ameloblast function andcrown shape development in mouse teeth. Developmental dynamics,239(10):2558?2569, 2010.[330] R. A. Young. Implications in atomic substitutions and other structuraldetails in apatites. J.Dent.Res., 53:193?203, 1974.[331] Q. Yu and I. Stamenkovic. Cell surface-localized matrixmetalloproteinase-9 proteolytically activates tgf-beta and promotes tu-mor invasion and angiogenesis. Genes & development, 14(2):163?176,2000.[332] R. Zaka and C. J. Williams. Role of the progressive ankylosis gene incartilage mineralization. Current opinion in rheumatology, 18(2):181?186, 2006.[333] Y. E. Zhang. Non-smad pathways in tgf-beta signaling. Cell research,19(1):128?139, 2009.100

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0165616/manifest

Comment

Related Items