Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

ECERIFERUM7 subunit of the exosome, SUPERKILLER complex and small RNA species regulate cuticular wax… Zhao, Lifang 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2015_may_zhao_lifang.pdf [ 9.93MB ]
Metadata
JSON: 24-1.0135698.json
JSON-LD: 24-1.0135698-ld.json
RDF/XML (Pretty): 24-1.0135698-rdf.xml
RDF/JSON: 24-1.0135698-rdf.json
Turtle: 24-1.0135698-turtle.txt
N-Triples: 24-1.0135698-rdf-ntriples.txt
Original Record: 24-1.0135698-source.json
Full Text
24-1.0135698-fulltext.txt
Citation
24-1.0135698.ris

Full Text

ECERIFERUM7 SUBUNIT OF THE EXOSOME, SUPERKILLER COMPLEX AND SMALL RNA SPECIES REGULATE CUTICULAR WAX BIOSYNTHESIS IN ARABIDOPSIS THALIANA STEMS  by LIFANG ZHAO B.Sc., Nankai University, 2006 M.Sc., The University of British Columbia, 2009  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate and Postdoctoral Studies (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2015 ©  Lifang Zhao, 2015 ii  ABSTRACT The primary aerial surfaces of higher plants are covered by a continuous hydrophobic lipid layer called the cuticle, which is synthesized by the epidermal cells and provides protection against desiccation and environmental stresses. The cuticle is mainly composed of the cutin polyester matrix and cuticular waxes. Although the biosynthetic pathways of cuticular waxes are relatively well documented, how wax biosynthesis is regulated is not completely understood. The major goal of my thesis was to investigate the ECERIFERUM7 (CER7)-mediated mechanism of regulation of cuticular wax biosynthesis in stems of Arabidopsis thaliana. In particular, I was interested in investigating that how the Arabidopsis CER7 protein, a core component of the exosome complex that determines cellular RNA levels, was involved in this process. CER7 was proposed to degrade an mRNA encoding a repressor of wax biosynthetic gene CER3 to activate CER3 transcription required for stem wax biosynthesis. To identify the CER3 repressor and additional components of CER7 regulatory pathway, I carried out a cer7 suppressor screen and isolated mutants capable of restoring wild-type stem wax loads in the absence of CER7 activity. Characterization of these suppressor mutants and cloning of the affected genes resulted in a series of discoveries. First, cloning of RNA DEPENDENT RNA POLYMERASE 1 and SUPPRESSOR OF GENE SILENCING 3 from the suppressors demonstrated that small interfering RNAs (siRNAs) participate in CER7-mediated regulation of wax formation (Chapter 2). Second, forward genetics and reverse genetics, combined with small RNA sequencing confirmed that trans-acting siRNAs (tasiRNAs) are direct regulators of CER3 gene in CER7-controlled wax biosynthetic pathway (Chapter 3). Third, CER7 and tasiRNA-mediated regulation of CER3 during stem wax deposition requires the SUPERKILLER complex, which is known to be involved in cytoplasmic activities of the exosome in yeast and metazoan (Chapter 4).   iii  PREFACE Chapter 2 has been published as: Lam, P., Zhao, L., McFarlane, H.E., Aiga, M., Lam, V., Hooker, T.S., and Kunst, L. (2012) RDR1 and SGS3, components of RNA-mediated gene silencing, are required for the regulation of cuticular wax biosynthesis in developing inflorescence stems of Arabidopsis. Plant Physiol. 159: 1385-1395 © Copyright American Society of Plant Biologists, 2012 (www.plantphysiol.org). The text and figures were reproduced with permission. Prof. Ljerka Kunst and Dr. Tanya Hooker designed the research. Lifang Zhao and Dr. Patricia Lam performed the cer7 suppressor screen (Figure 2.2) and analyzed the suppressors (Figure 2.3). Undergraduate students Vivian Lam and Mytyl Aiga provided technical assistance to suppressor analysis. Lifang Zhao performed the map-based cloning of SGS3 gene (Figure 2.4C-D; Table 2.2), GUS staining assays (Figure 2.6), and generated the transgenic plants for the localization of SGS3 (Figure 2.7). Lifang Zhao was also involved in writing the manuscript. Dr. Heather McFarlane assisted in taking the images in Figure 2.7. Chapter 3 has been published as: Lam, P., Zhao, L., Eveleigh, N., Yu, Y., Chen, X., and Kunst, L. (2015) The exosome and trans-acting small interfering RNAs regulate cuticular wax biosynthesis during Arabidopsis inflorescence stem development. Plant Physiol. 167: 323-336 © Copyright American Society of Plant Biologists, 2015 (www.plantphysiol.org). The text and figures were reproduced with permission. Prof. Ljerka Kunst, Dr. Patricia Lam, and Lifang Zhao designed the research. Lifang Zhao performed the map-based cloning of the SDE5 and RDR6 genes (Figure 3.1 and 3.2; Table 3.1 and 3.2), reverse genetic experiments on DCL4 and DRB4 (Figure 3.3 and 3.6; Table 3.3), and siRNA detection (Figure 3.10). Lifang Zhao also wrote part of the manuscript. Dr. Patricia Lam identified AGO1 and HEN1 with the assistance of the undergraduate student Nathan Eveleigh. Dr. Patricia Lam prepared the RNA samples for RNA-seq, which was carried out by our collaborators Dr. Yu Yu and Prof. Xuemei Chen at the University of California, Riverside. Prof. Ljerka Kunst and Dr. Patricia Lam iv  analyzed the RNA-seq data. For Chapter 4, Prof. Ljerka Kunst and Lifang Zhao designed the research. Lifang Zhao performed the experiments, analyzed the data and wrote the first draft of the manuscript.                         v  TABLE OF CONTENTS ABSTRACT ....................................................................................................................... ii PREFACE ......................................................................................................................... iii TABLE OF CONTENTS .................................................................................................. v LIST OF TABLES ............................................................................................................ ix LIST OF FIGURES .......................................................................................................... x LIST OF ABBREVIATIONS ......................................................................................... xii ACKNOWLEDGEMENTS ........................................................................................... xv CHAPTER 1: INTRODUCTION .................................................................................... 1 1.1 The plant cuticle ....................................................................................................... 1 1.2 Cuticular wax biosynthesis ..................................................................................... 1 1.2.1 Biosynthesis of very long chain fatty acids ........................................................ 2 1.2.2 Alcohol-forming pathway ................................................................................... 7 1.2.3 Alkane-forming pathway .................................................................................... 7 1.3 Export of cuticular waxes ....................................................................................... 8 1.4 Regulation of wax biosynthesis and transport ..................................................... 11 1.4.1 Transcriptional regulation of wax biosynthesis .................................................11 1.4.2 Posttranscriptional and posttranslational regulation of wax biosynthesis ........ 13 1.5 The exosome ........................................................................................................... 14 1.6 Research objectives ................................................................................................ 17 CHAPTER 2: RDR1 AND SGS3, COMPONENTS OF RNA-MEDIATED GENE SILENCING, ARE REQUIRED FOR THE REGULATION OF CUTICULAR WAX BIOSYNTHESIS IN DEVELOPING INFLORESCENCE STEMS OF ARABIDOPSIS ............................................................................................................... 20 2.1 Introduction ........................................................................................................... 20 2.2 Results ..................................................................................................................... 23 vi  2.2.1 ProCER6:CER3 transgene complements the cer7-3 wax deficiency ............... 23 2.2.2 war mutants suppress the wax-deficiency of cer7 ............................................ 24 2.2.3 WAR3 encodes RNA DEPENDENT RNA POLYMERASE 1 ......................... 27 2.2.4 war4 contains a mutation in SUPPRESSOR OF GENE SILENCING 3 ........... 30 2.2.5 RDR1 and SGS3 are expressed throughout the plant ........................................ 33 2.2.6 RDR1 and SGS3 are involved in regulation of CER3 expression in developing inflorescence stems .................................................................................................... 35 2.3 Discussion ............................................................................................................... 36 2.4 Methods .................................................................................................................. 41 2.4.1 Plant material and growth conditions ............................................................... 41 2.4.2 Molecular complementation of cer7 with the CER3 transgene ........................ 41 2.4.3 Mutagenesis of cer7-1sti and suppressor screen ............................................... 42 2.4.4 Genotyping ........................................................................................................ 42 2.4.5 Cuticular wax extraction and analysis .............................................................. 42 2.4.6 Quantitative RT-PCR ........................................................................................ 43 2.4.7 Positional cloning of suppressor mutations ...................................................... 44 2.4.8 Molecular complementation of suppressor lines and subcellular localization of RDR1 and SGS3 ........................................................................................................ 44 2.4.9 RDR1 and SGS3 promoter:GUS fusions and GUS Activity Assay ................... 45 CHAPTER 3: THE EXOSOME AND TRANS-ACTING SMALL INTERFERING RNAS REGULATE CUTICULAR WAX BIOSYNTHESIS DURING ARABIDOPSIS INFLORESCENCE STEM DEVELOPMENT ............................... 47 3.1 Introduction ........................................................................................................... 47 3.2 Results ..................................................................................................................... 50 3.2.1 Identification of additional factors required for CER7-mediated CER3 silencing.................................................................................................................................... 50 3.2.2 DCL4, AGO1 and HEN1 proteins are also required for regulation of CER3 expression during stem wax deposition ..................................................................... 56 3.2.3 Is DRB4 required for CER3 silencing? ............................................................. 65 3.2.4 CER7 disruption causes the accumulation of small RNAs and the repression of their target genes, including CER3 ............................................................................ 66 3.3 Discussion ............................................................................................................... 73 3.3.1 TasiRNAs regulate cuticular wax biosynthesis in developing inflorescence stems .......................................................................................................................... 73 3.3.2 CER3 silencing by tasiRNAs is direct .............................................................. 75 vii  3.3.3 How do CER7 and tasiRNAs mediate stem wax deposition? .......................... 76 3.4 Materials and methods .......................................................................................... 77 3.4.1 Plant material and growth conditions ............................................................... 77 3.4.2 Positional cloning of suppressor mutations ...................................................... 77 3.4.3 Genotyping ........................................................................................................ 78 3.4.4 Cuticular wax extraction and analysis .............................................................. 80 3.4.5 Quantitative RT-PCR ........................................................................................ 81 3.4.6 Isolation of RNA for RNA-seq ......................................................................... 81 3.4.7 Small RNA extraction and library construction ................................................ 82 3.4.8 Bioinformatic analysis of small RNAs ............................................................. 82 CHAPTER 4: THE SUPERKILLER COMPLEX IS REQUIRED FOR CER7-DEPENDENT EXOSOME ACTIVITY IN CONTROLLING CUTICULAR WAX BIOSYNTHESIS IN ARABIDOPSIS ................................................................. 84 4.1 Introduction ........................................................................................................... 84 4.2 Results ..................................................................................................................... 86 4.2.1 Identification of AtSKI3 as a regulator of wax biosynthesis ............................ 86 4.2.2 Identification of WAR7 as AtSKI2, the second component of the SKI complex.................................................................................................................................... 91 4.2.3 AtSKI8, the third component of the SKI complex, is also necessary for stem wax deposition in Arabidopsis ................................................................................... 94 4.2.4 AtSKI3 is localized to the cytoplasm and granular cytoplasmic foci ............... 97 4.2.5 AtSKI3 cannot rescue yeast ski3xrn1; ScSKI3 cannot complement war1-3cer7-1.............................................................................................................. 97 4.2.6 AtSKI complex is required for the tasiRNAs to degrade CER3 mRNA........... 98 4.3 Discussion ............................................................................................................. 100 4.3.1 All components of the AtSKI complex participate the CER7-dependent regulation of wax biosynthesis................................................................................. 101 4.3.2 Regulation of both tasiRNAs and CER3 transcript levels requires participation of the AtSKI proteins ............................................................................................... 103 4.4 Conclusion ............................................................................................................ 104 4.5 Materials and methods ........................................................................................ 105 4.5.1 Plant materials and growth conditions ............................................................ 105 4.5.2 Mapping of suppressor mutations ................................................................... 105 4.5.3 Genotyping ...................................................................................................... 105 viii  4.5.4 Cuticular wax extraction and analysis ............................................................ 107 4.5.5 RT-PCR and quantitative RT-PCR .................................................................. 108 4.5.6 Plasmid construction and yeast and plant transformation............................... 108 CHAPTER 5: CONCLUSIONS AND FUTURE DIRECTIONS .............................. 111 5.1 Conclusions ........................................................................................................... 111 5.1.1 Gene silencing is involved in regulating wax biosynthesis .............................112 5.1.2 TasiRNAs are direct effectors of CER3 expression .........................................113 5.1.3 Yeast SKI-like complex is a cofactor of the exosome required for tasiRNAs-mediated wax biosynthesis.......................................................................114 5.2 Future directions ................................................................................................... 115 5.2.1 Cloning and characterization of other components that are involved in CER7-mediated regulation of wax biosynthesis .......................................................115 5.2.2 Additional mechanisms of regulation of CER3 expression .............................115 5.2.3 Additional biological functions of CER7 .........................................................116 5.2.4 Contributions of associated exoribonucleases and cofactors to the functions of the exosome in Arabidopsis ......................................................................................117 REFERENCES ............................................................................................................... 119            ix  LIST OF TABLES Table 2.1: Nomenclature and description of the rdr1 alleles ............................................ 31 Table 2.2: Nomenclature and description of the sgs3 alleles ............................................ 32 Table 2.3: Primers used in this study ................................................................................ 46 Table 3.1: Nomenclature and description of the sde5 alleles ............................................ 53 Table 3.2: Nomenclature and description of the rdr6 alleles ............................................ 57 Table 3.3: Nomenclature and description of the dcl4 alleles ............................................ 59 Table 3.4: Nomenclature and description of the ago alleles ............................................. 62 Table 3.5: Top 100 differentially expressed small RNAs in cer7 and wild type .............. 70 Table 3.6: Primers used in this study ................................................................................ 78 Table 4.1: Nomenclature and description of the ski3 alleles............................................. 90 Table 4.2: Nomenclature and description of the ski2 alleles............................................. 91 Table 4.3: Nomenclature and description of the ski8 alleles............................................. 96 Table 4.4: Primers used in this study .............................................................................. 106              x  LIST OF FIGURES Figure 1.1: Very long chain fatty acid elongation in the ER in Arabidopsis ...................... 5 Figure 1.2: Simplified pathways for wax biosynthesis in Arabidopsis stems..................... 6 Figure 1.3: A model of wax export from an epidermal cell to the cuticle .......................... 9 Figure 1.4: A model illustrating CER7-mediated regulation of wax biosynthesis ........... 13 Figure 1.5: A schematic model of the Arabidopsis exosome ............................................ 15 Figure 2.1: Complementation of cer7-3 with CER3 driven by the CER6 promoter......... 24 Figure 2.2: Summary of the suppressor screen ................................................................. 25 Figure 2.3: Analysis of war mutants. ................................................................................ 26 Figure 2.4: Positional cloning of war3 and war4, and RDR1 and SGS3 gene structures . 28 Figure 2.5: Expression analysis of RDR1 and SGS3 in different organs and tissues of Arabidopsis ................................................................................................................ 33 Figure 2.6: Tissue-specific expression of ProRDR1:GUS and ProSGS3:GUS in Arabidopsis stems ...................................................................................................... 34 Figure 2.7: Localization of SGS3 by confocal microscopy .............................................. 35 Figure 2.8: CER3 expression levels in the top 3 cm and the bottom 3 cm of a 10 cm stem as measured by quantitative RT-PCR ......................................................................... 36 Figure 2.9: A model illustrating the role of RDR1 and SGS3, components of RNA silencing, in regulating cuticular wax biosynthesis at the top of the stem ................. 39 Figure 2.10: Quantitative RT-PCR of CER7 expression levels in the top 3 cm and the bottom 3 cm of a 10 cm stem, as well as the epidermis. ............................................ 40 Figure 3.1: Identification of SDE5 and RDR6 as additional factors required for CER7-mediated CER3 silencing ................................................................................ 54 Figure 3.2: RDR1, RDR6 and DCL4 are all required for CER7-mediated CER3 silencing.................................................................................................................................... 58 Figure 3.3: DCL4 is required for CER7-mediated CER3 silencing .................................. 60 Figure 3.4: Wild-type-like stem wax phenotypes of ago1-11cer7-1 and hen1-1cer7-1 double mutants ........................................................................................................... 61 Figure 3.5: Wax deficient phenotypes of the hen1-8cer7-3 double mutant ...................... 64 Figure 3.6: DRB4 is required for CER7-mediated CER3 silencing ................................. 66 Figure 3.7: Small RNA profiles of all the mutant lines .................................................... 67 Figure 3.8: Analysis of small RNA-seq ............................................................................ 68 Figure 3.9: Transcript levels of genes found to be differentially expressed in cer7 by RNA-seq analysis....................................................................................................... 69 Figure 3.10: Detection of siRNAs by quantitative RT-PCR ............................................. 72 Figure 4.1: Stem phenotypes of mutants, map-based cloning of WAR1, AtSKI3 gene structure, and transcript levels of AtSKI3 gene in war1 and ski3 mutants ................. 89 Figure 4.2: Analyses of wax loads and CER3 transcript levels of war1cer7-1 and ski3cer7-3 mutants ..................................................................................................... 90 Figure 4.3: Map-based cloning of WAR7, AtSKI2 gene structure, and AtSKI2 transcript xi  levels in war7 and ski2 mutants ................................................................................. 92 Figure 4.4: Analyses of stem wax phenotypes, wax loads and CER3 transcript levels of war7cer7-1 and ski2cer7-3 mutants........................................................................... 93 Figure 4.5: Comparison of structures of SKI proteins in yeast and Arabidopsis .............. 94 Figure 4.6: Gene structure and transcript levels of AtSKI8 in ski8 mutants ..................... 95 Figure 4.7: Analyses of mutant phenotypes, wax loads and CER3 transcript levels of ski8cer7-3 mutants ..................................................................................................... 96 Figure 4.8: Localization of AtSKI3 by confocal microscopy ........................................... 97 Figure 4.9: Complementation tests between yeast SKI3 and Arabidopsis SKI3 .............. 99 Figure 4.10: Accumulation of tasiRNAs and CER3 transcripts ...................................... 100                 xii  LIST OF ABBREVIATIONS ABA  abscisic acid  ABC  ATP-binding cassette  ABCG ATP-binding cassette transporter, subfamily G ABRC  Arabidopsis biological resource center  ACCase Acetyl-CoA Carboxylase ACP acyl carrier protein AGO  ARGONAUTE  ARF  auxin response factor  Arabidopsis Arabidopsis thaliana BDG  BODYGUARD  BSTFA  N,O-bis(trimethylsilyl) trifluoroacetamide  cDNA complimentary DNA CER  ECERIFERUM  CFL  CURLY FLAG LEAF  Chr chromosome CoA Coenzyme A Col-0  Columbia-0  DCL  DICER-LIKE DEWAX DECREASE WAX BIOSYNTHESIS DGAT  diacylglycerol acyltransferase  DNA  deoxyribonucleic acid  dsRNA  double-stranded RNA  ECR  enoyl-CoA reductase  EDTA  ethylenediaminetetraacetic acid  EMS  ethyl methanesulphonate  ER  endoplasmic reticulum  xiii  FAE  fatty acid elongase  FAR  fatty acyl-CoA reductase  FAS  fatty acid synthase  FAT  fatty acyl-ACP thioesterase  GC  gas chromatography  GC-FID  gas chromatography with flame ionization detection  GFP  green fluorescent protein  GUS  β-glucuronidase  HCD  β-hydroxyacyl-CoA dehydratase  HDG1 Homeodomain glabrous 1 HD-ZIP  homeodomain-leucine zipper  HEN  HUA ENHANCER  HR  hypersensitive response  KCR  β-ketoacyl-CoA reductase  KCS  β-ketoacyl-CoA synthase  LACS  long-chain acyl-CoA synthetase  LB  lysogeny broth  Ler  Landsberg erecta  LTP  lipid transfer protein  MAH  mid-chain alkane hydroxylase  miRNA  micro-RNA  mRNA  messenger RNA  MYB  myeloblastosis  PAS  PASTICCINO  PCR  polymerase chain reaction  PM  plasma membrane  PTGS  posttranscriptional gene silencing  xiv  RDR  RNA-dependent RNA polymerase  RISC  RNA-induced silencing complex  RNA  ribonucleic acid  RNAi  RNA interference  RNase  ribonuclease  SGS  SUPPRESSOR OF GENE SILENCING  SHN  SHINE  siRNA  small interfering RNA  SKI SUPERKILLER smRNA  small RNA  snoRNA  small nucleolar RNA  SNP  small nucleotide polymorphisms  snRNA  small nuclear RNA  SSLP  simple sequence length polymorphism  ssRNA  single-stranded RNA  STI  STICHEL  T-DNA  transfer-DNA  TAG  triacylglycerol  ta-siRNA  trans-acting small interfering RNA  VLCFA  very long chain fatty acid  WAR  WAX RESTORER  WIN  WAX INDUCER  WS  wax synthase  WS/DGAT  wax synthase/diacylglycerol acyltransferase  YFP  yellow fluorescent protein YRE  YORE-YORE   xv  ACKNOWLEDGEMENTS My first and foremost thanks go to my supervisor, Dr. Ljerka Kunst. I cannot express enough my gratitude for her patient guidance, encouragement and advice throughout my graduate study. I have been extremely lucky to have Dr. Ljerka Kunst as my supervisor who cared so much not only about the research but also motivated my thinking in a large scope, and provided a variety of opportunities for career development. I would like to thank my supervisory committee members, Drs. George Haughn, Xin Li, and Carl Douglas, for their critical feedbacks and valuable suggestions for this research project. My supervisory committee members broadened my view of scientific research from different angles. I would like to thank all the members of the Kunst and Haughn labs: those present at the moment and those that have witnessed only a portion of this incredible experience. You all have contributed somehow to my PhD and I can associate many unforgettable memories to each and every one of you. I would like to thank the University of British Columbia for providing the Four Year Fellowship to support my doctoral training financially. I must express my gratitude to my parents and to my husband. Their unconditional love, continued support, encouragement, and patience made the strong foundation for the long journey of my graduate study. I am especially grateful to my mother in law who gave up her comfortable retired life and shared the burden of taking care of my daughter. I also feel lucky to have my daughter, Gabriela, who always gives me warmest kisses and tightest hugs to express her purest love and greatest encouragement.     1  CHAPTER 1: INTRODUCTION 1.1 The plant cuticle About 450 million years ago, plants started to develop a hydrophobic exterior layer on the surfaces of aerial organs, called the cuticle, which allows them to survive in the terrestrial environment (Riederer and Schreiber, 2001). This protective coating helps the plant fight biotic and abiotic environmental stresses (Reicosky and Hanover, 1978; Eigenbrode and Espelie, 1995; Barthlott and Neinhuis, 1997; Yeats and Rose, 2013), and plays critical roles in plant development by regulating the epidermal cell morphology (Lolle et al., 1998; Sieber et al., 2000) and plant physiology by mediating osmotic stress signaling and tolerance (Wang et al., 2011). The major components of the plant cuticle are cutin polyester matrix and cuticular waxes, but it also contains variable amounts of other constituents including cutan, triterpenoids and phenolics (Jetter et al., 2006). Cutin is an insoluble biopolymer of hydroxy and epoxy 16 and 18 carbon (C16 and C18)-long fatty acids and glycerol that provides structural strength to the cuticle (Graca et al., 2002; Beisson et al., 2012). Cuticular waxes surround and cover the cutin matrix and are composed of very long chain fatty acids (VLCFAs; C20-C34) and their derivatives that can be easily extracted with organic solvents (Samuels et al., 2008). Intracuticular waxes are embedded within the cutin matrix, and have distinct chemical composition from epicuticular waxes, which cover the outer face of the cutin framework (Jeffree, 2006). Epicuticular waxes plays critical functions in the communications of the plant with insects, pathogens, and are important for removal of water droplets and pollutants from plant surfaces (Samuels et al., 2008).   1.2 Cuticular wax biosynthesis The composition of cuticular waxes can vary dramatically among species, organs, developmental stages or environmental growth conditions (Rashotte et al., 1997; 2  Shepherd and Wynne Griffiths, 2006; Buschhaus and Jetter, 2011). Generally, the major compounds comprising the cuticular wax are generated from VLCFAs. Alkanes, aldehydes, secondary alcohols and ketones are generated via the alkane pathway (also known as the decarbonylation pathway), whereas primary alcohols and alkyl esters are generated by the primary alcohol pathway (also called the acyl reduction pathway). Arabidopsis has been used as an excellent experimental tool for studying wax biosynthesis in the past several decades. Characterization of the wax deficient mutants exhibiting a glossy stem phenotype, together with molecular cloning of mutated genes have resulted in a thorough understanding of pathways and enzymes that catalyze wax biosynthesis.  1.2.1 Biosynthesis of very long chain fatty acids The very long chain fatty acid precursors for wax biosynthesis are formed in the endoplasmic reticulum (ER) by elongation of C16 and C18 fatty acids synthesized in the plastids of epidermal cells. During C16 and C18 production, an acetyl-CoA and a C2 moiety from malonyl-acyl carrier protein (ACP), which is also generated from acetyl-CoA, are condensed to form  -ketoacyl-ACP. The  -ketoacyl-ACP is reduced to  -hydroxyacyl-ACP and dehydrated to trans- 2-enoyl-ACP, which undergoes an additional reduction to yield an acyl-ACP product that is two carbons longer than the original acetyl molecule. Six to seven elongation cycles are carried out to yield C16 and C18 fatty acids, respectively (Ohlrogge and Browse, 1995). These reactions are catalyzed by a complex of four soluble and dissociable enzymes called the fatty acid synthases (FASs). Two or three different forms of FAS complexes are needed to synthesize a C16 or C18 fatty acid, each containing a ketoacyl-ACP synthase (KAS) with unique chain length specificity. KASIII is responsible for the elongation of C2 to C4, KASI performs the extension from C4 to C16, whereas KASII catalyzed C16 to C18 chain elongation (Shimakata and Stumpf, 1982; Clough et al., 1992). The two reductases and the 3  dehydratase, which do not display chain length specificities, are common in all three kinds of plastidial FAS complexes (Shimakata and Stumpf, 1984). It has been proposed that activities and specificities of several different enzymes, including the KASII, acyl-ACP acyltransferases, thioesterases, the C18:0 acid desaturase in the plastid, as well as the fatty acid elongase (FAE) in the ER control the partitioning of C16 and C18 fatty acids between cuticular lipid forming pathways and membrane glycerolipid generating pathways in the epidermal cells (Samuels et al., 2008). In order to be exported out of the plastid and transferred to the ER for further elongation required for wax production, C16 and C18 acyl chains are first released from the ACP by a fatty acyl-ACP thioesterase (FAT) and then re-esterified to CoA by a long-chain acyl-CoA synthetase (LACS). Although the mechanism of fatty acyl transfer between FAT and LACS has not been established, some types of diffusion of the fatty acyl groups from one enzyme to the other was proposed to occur (Koo et al., 2004). Two classes of FATs, FATAs and FATBs, have been well studied (Voelker et al., 1997). In vitro assays showed that the FATA group has high activity with 18:1-ACP and low activity with saturated acyl-ACP. FATB class exhibits higher affinity for saturated acyl groups and low affinity for unsaturated acyl-ACPs (Voelker et al., 1997; Salas and Ohlrogge, 2002). Null fatb mutants of Arabidopsis displayed a 50% and 20% decrease of wax loads on stems and leaves, respectively, demonstrating that FATB is critical for providing saturated fatty acids to synthesize wax compounds (Bonaventure et al., 2003). The Arabidopsis genome has nine annotated LACS genes. To date, only LACS1, LACS2, and LACS4 were shown to play a role in cuticular wax production. LACS1 gene, allelic to ECERIFERUM8 (CER8), is required for the production of components of the alkane-forming pathway. A reduced wax amount, characterized by a decrease of C29 alkanes and derivatives was detected in several loss-of-function lacs1 mutants (Lu et al., 2009). In VLC-alkane producing yeast heterogonous systems, biosynthesis of C29 alkane was significantly enhanced by co-expression of LACS1 with CER1 and CER3 (Bernard et 4  al., 2012). Although the lacs2 mutants only show a deficiency in cutin biosynthesis, but not in wax production, the double lacs1lacs2 mutant exhibits a more severe wax phenotype than a single lacs1 mutant, suggesting that LACS1 and LACS2 may have partially overlapping functions in producing wax constituents (Weng et al., 2010). Furthermore, the double lacs1lacs2 mutant displayed a reduction in cutin amount in comparison to each single mutant. Thus, LACS1 and LACS2 play redundant roles in the biosynthesis of both cutin and cuticular wax (Lu et al., 2009; Weng et al., 2010). Analyses on lacs4 and lacs1 single mutants revealed that they retained 73% and 35% of wild type (WT) wax compounds, respectively. A redundancy between LACS1 and LACS4 in the process of wax production was indicated by the lacslacs4 double mutant, which only contained 23% of the wild-type wax load on stems. In addition, overlapping functions in the formation of tryphine of the pollen grains were also implied by comparing the amounts of the VLC-lipids in the double lacs1lacs4 mutants and each single mutants (Jessen et al., 2011). A recent study showed that an ABC transporter in Arabidopsis, referred to as AtABCA9, regulates the transport of fatty acids from plastids to the ER network (Kim et al., 2013). AtABCA9 protein localizes to the ER network and the expression of this gene was detected in the middle and late stages of developing seeds. The atabca9 null mutant has 65% of triacylglycerol (TAG) content in the seed compared with WT and overexpression of AtABCA9 increased TAG production by 40%. Taken together, AtABCA9 was proposed to provide fatty acid precursors for TAG formation in the ER during seed maturation (Kim et al., 2013). The contribution of this protein to the transport of fatty acids used for wax biosynthesis has not been determined. The multi-enzymatic fatty acid elongase (FAE) complexes carry out the elongation of the C16 and C18 fatty acyl groups into VLCFAs in the ER (Figure 1.1). Disruptions in genes encoding each of the individual FAE constituents lead to a significant reduction in all wax components (Zheng et al., 2005; Bach et al., 2008; Joubes et al., 2008; Beaudoin 5  et al., 2009). Every FAE cycle involves four consecutive reactions to yield an acyl-chain two carbons longer, which is similar to de novo fatty acid biosynthesis. However, instead of using malonyl-ACP as carbon donor, FAE receives 2 carbon-units from malonyl-CoA, generated by an acetyl-CoA carboxylase (ACCase). In Arabidopsis AtACC1 is essential for supplying malony-CoA for VLCFAs biosynthesis (Baud et al., 2003, 2004). Cuticular waxes are comprised of VLCFAs with a wide range of chain lengths, produced by sequential and parallel reactions performed by multiple elongase complexes. The specificity of each FAE complex is determined by the condensing enzyme  -ketoacyl-CoA synthase (KCS) (Lassner et al., 1996; Millar and Kunst, 1997; Trenkamp et al., 2004; Blacklock and Jaworski, 2006; Paul et al., 2006). The Arabidopsis genome has twenty one annotated KCSs (Joubes et al., 2008). Microarray-based transcriptional profiling indicated that eight KCSs were up-regulated in Arabidopsis stem epidermis during stem elongation, suggesting that they function in wax-related VLCFA biosynthesis (Suh et al., 2005). To date, only CER6 was shown to be a wax-specific KCS. It is expressed exclusively in epidermal cells and cer6 null mutants or transgenic sense suppressed plants retain only 6% of the wild-type stem wax load (Millar et al., 1999; Fiebig et al., 2000; Hooker et al., 2002).  Figure 1.1: Very long chain fatty acid elongation in the ER in Arabidopsis Reproduced with permission from Kunst and Samuels, 2009; Copyright © 2009, Elsevier. 6  Expression of CER6 gene alone in yeast was shown to generate fatty acids up to C28 (O. Rowland and L. Kunst, unpublished data). Further elongation of acyl chains to C30, requires participation of CER2 and CER2-LIKE1, related proteins of unknown function in addition to CER6 and other core FAE components (Haslam et al., 2012; Pascal et al., 2013). The core FAE components in Arabidopsis, in addition to a KCS, include a  -keto acyl reductase KCR1 (Beaudoin et al., 2009), a  -hydroxy acyl-CoA dehydratase PAS2 (Bach et al., 2008), and an enoyl-CoA reductase CER10 (Zheng et al., 2005). These components of the elongase complex are capable of interacting with each other and with an immunophillin-like protein, PAS1, which may serve as a molecular scaffold for FAE complex in the ER (Roudier et al., 2010). Following elongation, production of waxes entails modification of VLCFAs by one of the two pathways: an alcohol-forming pathway that yields primary alcohols and wax esters, and the alkane-forming pathway that makes alkanes, aldehydes, secondary alcohols, and ketones (Kunst and Samuels, 2009; Figure 1.2).  Figure 1.2: Simplified pathways for wax biosynthesis in Arabidopsis stems Reproduced with permission from Samuels et al., 2008; Copyright © 2008, Annual Reviews Inc. 7  1.2.2 Alcohol-forming pathway Although the production of alcohols from the corresponding fatty acids proceeds via aldehydes, several studies including biochemical studies on jojoba seeds (Pollard et al., 1979) and pea leaves (Vioque and Kolattukudy, 1997), as well as functional expression of genes encoding alcohol-generating fatty acyl reductases (FARs) in heterologous systems (Metz et al., 2000; Moto et al., 2003; Cheng and Russell, 2004) demonstrated that a single enzyme is capable of catalyzing a 2-step reduction from VLCFAs to alcohols without release of aldehydes. The Arabidopsis genome has eight putative FARs (Rowland et al., 2006). Analysis of the loss-of-function mutant cer4 which exhibits a drastic decrease in the content of primary alcohols and esters (Hannoufa et al., 1993; McNevin et al., 1993; Jenks et al., 1995), cloning of the CER4 gene and its heterologous expression in yeast demonstrated that CER4 has FAR activity and catalyzes the production of VLC-primary alcohols (Rowland et al., 2006). Further studies on the chain-length of wax esters from stems of Arabidopsis cer mutants demonstrated that CER4 produces the alcohols that are used for the production of wax esters and that the ester yield is determined by the levels of alcohols (Lai et al., 2007). Wax ester biosynthesis is catalyzed by WSD1, one of the eleven bi-functional WS/Diacylglycerol acyltransferases (DGATs) homologs in Arabidopsis (Li et al., 2008).  1.2.3 Alkane-forming pathway Alkanes are the final products of the alkane pathway in the leaves of Arabidopsis, while these central intermediates are further processed to secondary alcohols and ketones in stems (Jenks et al., 1995). Although the second part of the pathway, the formation of secondary alcohols and ketones is well understood, the biochemical reactions involved in alkane biosynthesis remain uncertain (Samuels et al., 2008). Characterization of cer1 and cer3, severe wax-deficient mutants that exhibit a dramatic reduction in alkane pathway components (Aarts et al., 1995; Chen et al., 2003; 8  Kurata et al., 2003; Rowland et al., 2007; Bourdenx et al., 2011; Sakuradani et al., 2013) and heterologous expression of CER1 and CER3 in yeast revealed that both of these proteins are required for alkane biosynthesis. Furthermore, co-expression of a cytochrome B5 oxidase with CER1 and CER3 increased alkane yield (Bernard et al., 2012). These data suggest that alkane formation is a redox-dependent reaction and not a hydrolytic reaction, as previously hypothesized (Cheesbrough and Kolattukudy, 1984; Schneider-Belhaddad and Kolattukudy, 2000). However, the exact nature of this reaction and the biochemical role of each protein remain elusive. MIDCHAIN ALKANE HYDROXYLASE1 (MAH1), encoding a cytochrome P450 monooxygenase, was shown to be responsible for producing secondary alcohols and ketones in Arabidopsis stem (Greer et al., 2007). MAH1 introduces a hydroxyl moiety on the central -CH2- group of alkanes in the first step, and then oxidizes the resulting secondary alcohols to ketones in the second step (Greer et al., 2007).  1.3 Export of cuticular waxes It is well established that the components of the VLCFA elongation complexes and enzymes participating in the wax biosynthesis all localize to the ER compartment (Millar et al., 1999; Rowland et al., 2006; Greer et al., 2007; Li et al., 2008; Kamigaki et al., 2009). Thus, all wax components must be transported from the ER to the cuticle on the plant surface. The detailed mechanism of wax export has not been fully elucidated, but several proteins required for this process have been identified in Arabidopsis (Figure 1.3). A number of hypotheses have been put forward to explain intracellular trafficking of wax constituents from the ER to the PM. First, soluble acyl carrier proteins, including fatty acid binding proteins, acyl-CoA binding proteins, and lipid transfer proteins (LTPs), could carry wax molecules through the cytoplasm to the PM. Second, oleosine-like vesicles with accumulated wax products may bud out of the ER and carry waxes to the PM. Third, vesicular trafficking involving Golgi apparatus may play a role in transport of 9  waxes. Fourth, waxes could be passed from the ER to the PM at membrane contact sites. So far, there is no direct evidence to support the first two hypotheses. Similarly, non-vesicular lipid-trafficking, via ER-plasma membrane contact sites has not been demonstrated to date (Pulsifer et al., 2012). In contrast, recent studies on vesicle-trafficking mutants gnom like1-1 (gnl1-1) and echidna (ech) have demonstrated the involvement of the Golgi and trans-Golgi network in wax transport to the PM (McFarlane et al., 2014).   Figure 1.3: A model of wax export from an epidermal cell to the cuticle Reproduced with permission from Samuels et al., 2008; Copyright © 2008, Annual Reviews Inc.  Members of the ATP-binding cassette (ABC) transporter family are responsible for the export of wax components from the PM to the extracellular matrix. CER5/ ATP-binding cassette transporter, subfamily G 12 (ABCG12) was the first ABC transporter shown to be involved in wax transport (Pighin et al., 2004). Mutations in CER5 caused 50% and 15% reductions in wax loads on stems and leaves, respectively, 10  and formation of large lipidic inclusions within the epidermal cells (Pighin et al., 2004; Rashotte et al., 2004). Co-expression analysis of ABCG-type genes with CER5/ABCG12 resulted in the identification of ABCG11 (Bird et al., 2007), which was also shown to participate in wax export. In addition, distinct from CER5, ABCG11 is also required for cutin monomers export to the cuticle (Bird et al., 2007; Panikashvili et al., 2007; Ukitsu et al., 2007). The CER5/ABCG12 and ABCG11 are half transporters and need to dimerize with other half transporters of the ABCG sub-family to form functional transporters. Using biomolecular fluorescence complementation in protoplasts, CER5/ABCG12 and ABCG11 were shown to heterodimerize and ABCG11 to homodimerize (McFarlane et al., 2010). Heterodimerization was proposed to be required for wax transport across the PM, whereas ABCG11 homodimers were hypothesized to be involved in the transport of cutin (McFarlane et al., 2010). Interestingly, abcg11, cer5/abcg12 and abcg11abcg12 double mutants all display 50% reductions in their stem wax loads, suggesting that other ABC-transporters or a different mechanism of wax transport across the PM may be involved (Bird et al., 2007). Following export across the PM, wax molecules must still cross the cell wall to reach the cuticle. For a long time, LTPs have been proposed to play a role in this process (Kader, 1996; Kunst and Samuels, 2003; Yeats and Rose, 2008). Nevertheless, experimental data supporting this hypothesis had not been presented until the discovery of LTPG1 (Debono et al., 2009). Analysis of the ltpg1 mutant revealed a 25% reduction in C29 alkane amount in stems and siliques, and less than a 5% change in leaves (Debono et al., 2009; Lee et al., 2009). These data, together with an in vitro assay showing that LTPG is capable of binding lipids led to a conclusion that LTPG1 contributes to the cuticular wax export (Debono et al., 2009; Lee et al., 2009). A mutation in LTPG2 results in a less severe wax deficiency compared to ltpg1, but disruption of both LTPG1 and LTPG2 leads to a more pronounced reduction in wax load, indicating that both these proteins function in wax delivery to the cuticle (Kim et al., 2012). 11  1.4 Regulation of wax biosynthesis and transport Wax biosynthesis is tightly regulated throughout development. In addition, environmental stresses such as cold, drought, humidity, as well as loss of structural integrity of the cuticle, trigger feedback regulation of wax production. This complex process is mediated by hormones, transcriptional regulators, and post-transcriptional factors.  1.4.1 Transcriptional regulation of wax biosynthesis Changing environmental conditions result in the transcription of diverse wax-related genes. The transcription of CER6 gene is up-regulated by light and osmotic stresses (Hooker et al., 2002), while the transcription of several KCSs, CER10 and KCR1 was shown to be down-regulated by cold and darkness (Joubes et al., 2008). In addition, these genes could be induced with sodium chloride, water deficit, and mannitol treatments (Joubes et al., 2008). Water stress was suggested to contribute to wax accumulation by affecting the expression of CER1 and ABCG11 (Panikashvili et al., 2010; Bourdenx et al., 2011). Transcriptional regulation of Arabidopsis wax biosynthetic genes that leads to wax buildup also occurs under drought, osmotic stress and ABA treatments (Kosma et al., 2009) and upon bacterial pathogen attack (Raffaele et al., 2008).  The AP2 domain-containing transcription factor, WAX INDUCER1/SHINE1 (WIN1/SHN1) was first identified to function in the regulation of wax production (Aharoni et al., 2004; Broun et al., 2004). Overexpressing this gene resulted in glossy leaves due to greatly increased wax accumulation (Aharoni et al., 2004). Later studies showed that the induction of wax biosynthetic genes occurred later than the up-regulation of genes involved in cutin biosynthesis in WIN1/SHN1-overexpressing plants, suggesting that WIN1/SHN1 may regulate wax biosynthesis indirectly or that the wax-associated genes are up-regulated by WIN1/SHN1 in a different manner (Kannangara et al., 2007; Shi et al., 2011). 12  Regulation of genes involved in the biosynthesis of cuticular lipids is also controlled by two MYB family transcription factors, MYB106 and MYB16 (Oshima and Mitsuda, 2013; Oshima et al., 2013). Similar to WIN1/SHN1, both cutin and wax biosynthetic genes can be directly activated by MYB106 and MYB16 (Oshima et al., 2013). Several additional members of the MYB family control expression of wax-related genes in response to environmental stress: MYB30, MYB96, MYB41 and MYB94. When MYB30 is induced by bacterial pathogen infection (Vailleau et al., 2002), it up-regulates VLCFA elongase genes, as well as CER2 and CER3 (Raffaele et al., 2008). MYB96 has been shown to control wax synthesis under drought conditions, which is ABA-dependent, by directly activating the promoters of wax-associated genes, including KCS1, KCS2, CER6, KCR1, CER3 and WSD1 (Seo et al., 2011). The expression of MYB41 can be induced by drought, ABA, light, sodium chloride and low temperature and its overexpression leads to lower expression of cutin and wax biosynthetic genes, indicating that MYB41 is a negative regulator of cuticle formation under environmental stress conditions (Cominelli et al., 2008). A R2R3-type MYB94 transcription factor activates Arabidopsis cuticular wax biosynthesis by binding directly to the promoters of WSD1, KCS2, CER2, FAR3, and ECR genes (Lee and Suh, 2014). MYB94 was found to be highly induced in response to drought, ABA, sodium chloride, and mannitol (Lee and Suh, 2014). An AP2/ERF-type transcription factor, DECREASE WAX BIOSYNTHESIS (DEWAX), was recently shown to negatively regulate cuticular wax formation during daily dark and light cycles. This transcription factor can repress the expression of genes of the alkane-forming pathway including LACS2, CER1, ATP CITRATE LYASE A2, and ECR, possibly through direct promoter binding (Go et al., 2014; Suh and Go, 2014). Similarly, an overexpression of the CURLY FLAG LEAF1 (CFL1) gene in Arabidopsis causes organ fusion phenotypes, as well as reduced amount of epicuticular waxes and defective cuticles (Wu et al., 2011).  13  1.4.2 Posttranscriptional and posttranslational regulation of wax biosynthesis In parallel to transcriptional regulation of wax biosynthesis, analyses of wax-deficient Arabidopsis mutants uncovered unsuspected posttranscriptional mechanisms that play important roles in controlling cuticular wax accumulation. Characterization of the Arabidopsis cer9 mutant and cloning of the CER9 gene showed that it encodes a protein with homology to yeast Doa10, an E3 ubiquitin ligase involved in ER-associated degradation of mis-folded proteins (Lu et al., 2012). CER9 was demonstrated to act in the early steps of both wax and cutin synthesis (Lu et al., 2012). The cer9 mutant phenotypes, including enhanced drought tolerance, elevated water use efficiency, as well as increased sensitivity to ABA treatment, indicate that CER9 acts as a negative regulator of cuticle lipid synthesis and ABA signaling pathway (Lu et al., 2012; Zhao et al., 2014).  Figure 1.4: A model illustrating CER7-mediated regulation of wax biosynthesis In the presence of CER7, mRNA encoding a hypothetical wax repressor is degraded, thus allowing the transcription of CER3 and wax production by the alkane-forming pathway. In the absence of CER7, the repressor protein inhibits CER3 transcription and wax production.  (Model prepared by Patricia Lam) Studies of the cer7 mutant and the identification of the CER7 gene revealed another posttranscriptional mechanism involved in regulation of wax biosynthesis. CER7 encodes RRP45 core component of an exosome that is responsible for RNA processing and RNA 14  degradation in a 3’ to 5’ direction (Hooker et al., 2007). CER7 positively regulates the transcript levels of CER3, a major wax biosynthetic gene (Hooker et al., 2007; Rowland et al., 2007) that was shown to interact with CER1 during alkane production (Bernard et al., 2012). Because CER7 is predicted to function as an exosomal ribonuclease, it was hypothesized that it regulates wax production indirectly by degrading an mRNA encoding a repressor of the CER3 gene (Hooker et al., 2007; Figure 1.4).  1.5 The exosome The exosome is a multiprotein complex first identified in yeast that carries out degradation of RNAs in the 3’ to 5’ direction (Mitchell et al., 1997). The exosome complex in yeast cells is comprised of ten subunits (Mitchell et al., 1997). Nine of these subunits are inactive proteins (Liu et al., 2006; Dziembowski et al., 2007) that form a conserved channel which threads single-stranded RNA (ssRNA) substrates to RRP44, the processive exoribonuclease subunit in the complex (Bonneau et al., 2009; Wasmuth and Lima, 2012; Makino et al., 2013). In both the cytoplasm and the nucleus, all the ten subunits are essential and form a stable assembly in yeast (Mitchell et al., 1997; Allmang et al., 1999). The nuclear form of the exosome is responsible for processing of the 5.8S rRNA precursor (Allmang et al., 1999) and complete degradation of the externally transcribed rRNA spacer (Allmang et al., 2000), aberrant pre-rRNAs, pre-mRNAs, pre-tRNAs (Bousquet-Antonelli et al., 2000; Libri et al., 2002; Torchet et al., 2002; Kadaba et al., 2004; Kadaba et al., 2006), and the mRNAs trapped in the nucleus (Das et al., 2003). In these processing and degradation functions the nuclear exosome is assisted by several auxiliary factors including RRP6 (Liu et al., 2006), the putative RNA-binding protein RRP47/C1D/LRP1 (Mitchell et al., 2003; Peng et al., 2003), and the TRF4/5-AIR1/2-MTR4-Polyadenylation (TRAMP) complex (LaCava et al., 2005; Vanacova et al., 2005; Wyers et al., 2005). 15  Most of the cytoplasmic exosome activities, including mRNA turnover (Anderson and Parker, 1998; van Hoof et al., 2000), degradation of the mRNA fragments derived from endonucleolytic cleavage by RNA Induced Silencing Complex (Orban and Izaurralde, 2005) or from no-go decay (Doma and Parker, 2006; Tollervey, 2006), nonsense-mediated decay (Lejeune et al., 2003; Mitchell and Tollervey, 2003; Takahashi et al., 2003), and non-stop decay (Frischmeyer et al., 2002; van Hoof et al., 2002) also require cofactors, including the SUPERKILLER2 (SKI2)/SKI3/SKI8 complex and the SKI7 protein (Houseley et al., 2006). Homologues of nine core exosomal proteins found in yeast are also present in Arabidopsis (Figure 1.5), with RNase PH-like subunits AtRRP41, AtRRP42, AtRRP43, CER7/AtRRP45, AtRRP46 and AtMTR3 arranged in three heterodimers to form a ring-like structure. Three S1 binding domain subunits AtRRP4, AtRRP40, and AtCSL4 are bound to the ring-like structure (Chekanova et al., 2007; Lange and Gagliardi, 2010). Two homologues of AtRRP45 (AtRRP45A and AtRRP45B), as well as of AtRRP40 (AtRRP40A and AtRRP40B) are present in Arabidopsis (Lange and Gagliardi, 2010). Surprisingly, no homologue of RRP44, which confers 3’-5’ exoribonucleolytic activity of the yeast exosome (Lebreton et al., 2008; Schaeffer et al., 2009; Schneider et al., 2009), has been functionally characterized to date in Arabidopsis.  Figure 1.5: A schematic model of the Arabidopsis exosome (Model prepared by Patricia Lam) In contrast to the exosome in yeast, flies and animals, where nine subunits of the core complex do not have catalytic activities (Liu et al., 2006; Dziembowski et al., 2007; 16  Liu et al., 2007), AtRRP41 protein has an in vitro phosphorolytic activity similar to archaeal exosomes (Chekanova et al., 2000). Therefore, whereas the yeast nuclear-exosome activity requires the exoribonuclease RRP6, the exosome core itself might degrade substrates in plant nuclei (Allmang et al., 1999). Furthermore, unlike in yeast where all nine exosomal subunits are essential (Mitchell et al., 1997; Allmang et al., 1999; van Hoof and Parker, 1999), disruption of Arabidopsis exosome subunits does not always result in lethality, but leads to diverse defects in plants, suggesting that individual subunits contribute unequally to integrity and function of the complex. For example, no obvious defects were detected in the Atcsl4 mutant (Chekanova et al., 2007), cer7/ Atrrp45b mutant exhibits a wax-deficient phenotype, whereas Atrrp45a does not show any visible phenotypic changes, although simultaneous disruption of both AtRRP45A and AtRRP45B proteins is lethal. In addition, expression of AtRRP45A under the control of the CER7/AtRRP45B promoter is able to complement wax-deficient phenotype of cer7/Atrrp45b (Hooker et al., 2007), implying that AtRRP45A and CER7/AtRRP45B are partially redundant and can both contribute to the regulation of wax production (Hooker et al., 2007). AtRRP41 is required for female gamete development, as a 1:1 ratio of viable seeds and aborted ovules were produced in heterozygous AtRRP41Atrrp41 mutant (Chekanova et al., 2007). Loss of AtRRP4 severely impairs post-zygotic processes, because Atrrp4 mutant seeds arrest in an early stage of embryo development with most seeds containing two-cell embryos and non-cellularized endosperm (Chekanova et al., 2007). Although Arabidopsis contains most of the genes encoding exosome cofactors, none of these genes/proteins have been characterized to date. A protein that stably associates with the nuclear exosome in yeast, RRP6, has three homologous genes in Arabidopsis (Chekanova et al., 2007; Lange et al., 2008). Whether any of the three RRP6-like proteins can bind to the core exosome complex in Arabidopsis has not been determined. Moreover, there are a large number of helicase encoding genes in Arabidopsis, four of which are 17  highly homologous to MTR4 and SKI2 in yeast (Kobayashi et al., 2007). One such helicase is INCREASED SIZE EXCLUSION LIMIT2 (ISE2), required for normal embryo development (Kobayashi et al., 2007).  HUA ENHANCER2 (HEN2), a second candidate, is involved in determining flower organ boundaries (Western et al., 2002). Whether ISE2 or HEN2 binds a SKI-like or TRAMP-like complex during exosome-related RNA degradation process in Arabidopsis remains to be investigated. The evolutionarily conserved yeast SKI complex is comprised of SKI2, SKI3, and SKI8 forming a tetramer with 1:1:2 stoichiometry. A single enzymatic activity is embedded in the helicase core of SKI2 (Halbach et al., 2013). SKI3 and SKI8 contain tetratricopeptide repeats (TPRs) and WD40 repeats, respectively, which typically mediate protein-protein interactions (Stirnimann et al., 2010). The SKI3 C-terminal arm and the two SKI8 subunits position the helicase core of the SKI2 centrally within the complex. The N-terminal arm of SKI3 and the SKI2 insertion domain modulate the ATPase and helicase activities of the complex. The SKI complex can thread RNAs directly to the exosome in yeast (Halbch et al., 2013). Allelic to VERNALIZATION INDEPENDENT 3, Arabidopsis SKI8 homolog was shown to be required for normal plant development and proper flowering time, presumably as part of the RNA polymerase II-associated factor 1 complex or the SKI complex, respectively (Dorcey et al., 2012; Takagi and Ueguchi, 2012). The ski2 mutant displays a dwarf phenotype that is similar to the ski8 mutant, but exhibits no defects in flower development (Dorcey et al., 2012). Arabidopsis SKI3 homologue has not been characterized yet.  1.6 Research objectives The CER7-dependent exosome activity is required for the expression of CER3, a major wax biosynthetic gene involved in the formation of waxes via the alkane pathway. The transcript level of CER3 is severely reduced in the cer7 mutant, indicating that CER7 is a positive regulator of CER3 expression. As a core subunit of the exosome, CER7 18  functions in RNA degradation, including mRNA turnover. Therefore, it was proposed that CER7 may mediate wax production by controlling levels of mRNA that encodes a repressor of the CER3 gene. I investigated the mechanism of regulation of wax biosynthesis in Arabidopsis inflorescence stems by identifying the putative CER3 repressor. The specific objectives of my research were: (1) to screen for suppressors of the wax-deficient cer7 mutant to identify downstream target(s) of the CER7 exosomal protein and (2) to characterize the isolated suppressor mutants and identify genes disrupted in these mutant lines. In chapter 2, I describe a screen for suppressors of cer7-1 that resulted in the isolation of 99 mutant lines with restored wax loads and re-established wild-type transcript levels of the CER3 gene. We initially focused on 32 suppressor lines, which fell into four complementation groups, named wax restorer1 (war1) to war4. Cloning of WAR3 and WAR4 showed that they encode components of the RNA-silencing machinery, RNA-DEPENDENT RNA POLYMERASE1 (RDR1) and SUPPRESSOR OF GENE SILENCING3 (SGS3), implicating post-transcriptional gene silencing (PTGS) in the control of cuticular wax deposition during inflorescence stem development in Arabidopsis. In chapter 3, I describe characterization of war5 and war6 suppressor mutants and identification of WAR5 and WAR6 genes that encode proteins SILENCING DEFECTIVE5 (SDE5) and RDR6, additional components required for the biosynthesis of trans-acting small interfering RNA (tasiRNA). Reverse genetics demonstrated that DICER-LIKE4 (DCL4),  DOUBLE-STRANDED-RNA-BINDING PROTEIN4 (DRB4), ARGONAUTE1 (AGO1) and HUA ENHANCER1 (HEN1) proteins are also required for regulation of CER3 expression during stem wax deposition. Next generation sequencing (RNA-seq) of small RNA species from wild type, cer7, cer7rdr1 and cer7sgs3 demonstrated that the tasiRNA species that are highly abundant in cer7 directly target 19  CER3 gene during PTGS. In chapter 4, I show that WAR1 and WAR7 encode SKI3 and SKI2 in Arabidopsis, respectively, two well-studied components of the evolutionarily conserved SKI complex, which functions as an exosome cofactor. Reverse genetic experiements demonstrated that SKI8, the third subunit of the SKI complex, is also required for the regulation of wax biosynthesis. My results indicate that all components of the SKI complex are necessary for the CER7-dependent exosomal degradation of the CER3 transcript, as well as controlling the CER3-specific tasiRNA levels. In the concluding chapter of this thesis, Chapter 5, I summarize key results and conclusions of my work and discuss their significance in a broader context. I also highlight some of the questions that arose from my research that could be addressed in the future.             20  CHAPTER 2: RDR1 AND SGS3, COMPONENTS OF RNA-MEDIATED GENE SILENCING, ARE REQUIRED FOR THE REGULATION OF CUTICULAR WAX BIOSYNTHESIS IN DEVELOPING INFLORESCENCE STEMS OF ARABIDOPSIS 2.1 Introduction The acquisition of the cuticle, a hydrophobic structure that covers the surface of primary aerial plant tissues, represents one of the key evolutionary adaptations that allowed plants to successfully colonize land. The cuticle is synthesized by the epidermal cells and it protects the plant from non-stomatal water loss (Riederer and Schreiber, 2001), ultraviolet radiation (Reicosky and Hanover, 1978), pathogen invasion (Barthlott and Neinhuis, 1997), insect attack (Eigenbrode and Espelie, 1995), and other environmental stresses (Riederer and Muller, 2006). Additionally, the cuticle has been reported to mediate osmotic stress signalling (Wang et al., 2011), and to have a role in preventing organ fusions during development by limiting the contact of neighbouring epidermal cells (Sieber et al., 2000; Wang et al., 2011). The cuticle is composed of two types of lipids: cutin, a plant-specific polyester of 16- and 18-carbon-long (C16 and C18) hydroxy and epoxy fatty acids and glycerol (Nawrath, 2006; Pollard et al., 2008), and wax, a mixture of very-long-chain fatty acids (VLCFAs) and their derivatives and variable amounts of triterpenoids and phenylpropanoids (Nawrath, 2006; Jetter et al., 2006). Wax compounds that are embedded within the cutin matrix are referred to as intracuticular waxes, whereas those that coat the surface of the cutin framework are referred to as epicuticular waxes (Jeffree, 2006). Cuticular wax biosynthesis takes place in several cellular compartments and involves pathways for the synthesis of VLCFA wax precursors and their subsequent modification to diverse wax constituents. C16 and C18 fatty acids are made in the plastid of epidermal cells and are then exported to the endoplasmic reticulum (ER), where they are elongated 21  to C24 to C36 VLCFAs that serve as the precursors for wax compounds. This elongation process is catalyzed by the fatty acid elongase complex composed of four enzymes: a β-ketoacyl-CoA synthase, a β-ketoacyl-CoA reductase, a β-hydroxyacyl-CoA dehydratase, and an enoyl-CoA reductase (Millar et al., 1999; Beaudoin et al., 2009; Bach et al., 2008; Zheng et al., 2005). Following elongation, VLCFAs are processed by the enzymes of the acyl-reduction pathway, which yields primary alcohols and alkyl esters, and the decarbonylation pathway, which produces aldehydes, alkanes, secondary alcohols and ketones (Samuels et al., 2008). The enzymes of the acyl-reduction pathway have been identified and include a fatty acyl reductase ECERIFERUM 4 (CER4) that converts VLCFA-CoAs to primary alcohols (Rowland et al., 2006), and a bifunctional wax synthase/diacylglycerol acyltransferase, WSD1 (Li et al., 2008), that generates wax esters. In contrast to the well-characterized acyl-reduction pathway, the only enzyme of the decarbonylation pathway with a known function is a cytochrome P450, designated MID-CHAIN ALKANE HYDROXYLASE 1 (MAH1), responsible for the oxidation of alkanes to secondary alcohols and ketones (Greer et al., 2007). Like the VLCFA elongation enzymes, all the characterized wax modification enzymes reside in the ER (Samuels et al., 2008). Even though a number of key wax biosynthetic enzymes and their cellular compartmentations have been established, little is known about the regulation of wax biosynthesis. The regulation of wax production is affected by both developmental and environmental cues, but only a small number of genes involved in this process have been identified to date. Recently, Wu et al. (2011) reported the isolation of the CURLY FLAG LEAF1 (CFL1) gene and demonstrated that it encodes a WW domain protein involved in cuticle development in Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa). They provided biochemical evidence that AtCFL1 interacts with HOMEODOMAIN GLABROUS 1, a class IV homeodomain-leucine zipper transcription factor, which regulates two cuticle development-related genes, BODYGUARD and FIDDLEHEAD. 22  Other transcription factors known to regulate cuticle formation are WAX INDUCER1/SHINE1 and its homologs, which primarily control cutin and indirectly wax accumulation (Broun et al., 2004; Aharoni et al., 2004; Kannangara et al., 2007). The MYB96 transcription factor was shown to promote cuticular wax biosynthesis under drought conditions by binding directly to the conserved sequences in the promoters of wax biosynthetic genes and activating their transcription (Seo et al., 2011). As well, MYB30 was shown to activate the expression of wax biosynthetic genes in response to pathogen attack, but it remains to be determined to what extent this transcription factor participates in wax biosynthesis under normal conditions (Raffaele et al., 2008). Besides direct activation of wax biosynthetic genes by transcription factors, Dr. Tanya Hooker (a former postdoctorate fellow in our lab)’s work on the wax-deficient cer7 mutant revealed that wax production in Arabidopsis stems is also controlled by the CER7 RNase, a core subunit of the exosome that is responsible for the 3’ to 5’ degradation of RNA (Hooker et al., 2007). Functional characterization of the CER7 enzyme demonstrated that it positively regulates mRNA levels of CER3, a wax biosynthetic gene whose protein product is required for wax formation via the decarbonylation pathway (Hooker et al., 2007; Rowland et al., 2007). Based on analysis of cer3 mutants, CER3 is predicted to function at the start of the decarbonylation pathway, but the reaction that it catalyzes is still unknown (Rowland et al., 2007). Because CER7 is an RNase, it is proposed that it acts indirectly by degrading the mRNA specifying a repressor of CER3 transcription. A prediction of the model is that inactivation of this putative repressor would bypass the requirement of CER7 in wax biosynthesis. Therefore, I and Patricia Lam (another fellow graduate in our lab) carried out a genetic screen for mutations that suppress the stem wax deficiency of cer7 in an attempt to identify the putative repressor, as well as additional regulatory components downstream of CER7. The screen resulted in the isolation of a series of wax restorer (war) mutants with mutations in genes distinct from CER7. Here, we describe the cloning and characterization of the war3 and war4 23  suppressors of cer7. Surprisingly, WAR3 and WAR4 encode components of the RNA-silencing machinery, implicating RNA silencing in the control of cuticular wax deposition during inflorescence stem development in Arabidopsis.  2.2 Results 2.2.1 ProCER6:CER3 transgene complements the cer7-3 wax deficiency A key assumption in finding the target of the CER7 exosomal RNase is that it acts on an mRNA encoding a repressor that binds the promoter of the CER3 gene to control its transcription during development. Presumably, the mRNA of this putative repressor is not degraded in the cer7 mutant, and the presence of the repressor inhibits CER3 transcription. Consequently, the CER3 protein and all the wax components downstream of CER3 in the wax biosynthetic pathway are not synthesized. To test our proposed model, we attempted to rescue the cer7 phenotype by expressing the CER3 coding region behind the epidermis-specific CER6 promoter (Millar et al., 1999) to which the putative repressor should not bind. As expected, the transformants that received the ProCER6:CER3 transgene were waxy (Figure 2.1A) and had restored CER3 transcript levels, as detected by quantitative real time PCR (Figure 2.1B). As a negative control, we also introduced the ProCER3 (with 5’UTR and first exon included):CER3 transgene into cer7-3, but this construct failed to complement the cer7-3 phenotype and increased CER3 transcript was not detected (Figure 2.1B). These data provide direct evidence that the cer7 phenotype is related to reduced CER3 transcription and that the CER3 promoter sequence is relevant to CER7-mediated control of CER3 transcript levels. 24   Figure 2.1: Complementation of cer7-3 with CER3 driven by the CER6 promoter (A) Stems from 5-week-old wild-type (Columbia 0), cer7-3, and cer7-3 transformed with the ProCER6:CER3 transgene showing restored wax in the transgenic plant. (B) Quantitative RT-PCR showing that CER3 expression levels are restored to wild-type levels in plants carrying the ProCER6:CER3 transgene. ACTIN2 was used as an internal control and control samples were normalized to 1. Values represent means ± SD (n=4). Statistically significant differences between samples (p<0.05) are indicated by a * using Student t test. (Data contributed by Patricia Lam)  2.2.2 war mutants suppress the wax-deficiency of cer7 To search for the putative CER3 repressor and identify additional components involved in CER7-mediated regulation of cuticular wax biosynthesis, we performed a genetic screen for extragenic mutations that suppress the cer7 glossy wax-deficient stem phenotype (Figure 2.2). For the initial screen, approximately 12,000 cer7sti double mutant seeds were mutagenized with Ethyl Methanesulphonate (M1 population). The stichel (sti) mutation, which resulted in a single-pronged trichome (Ilgenfritz et al., 2003), was introduced into the cer7 background to rule out possible wild-type seed contamination. The M1 population was grown to maturity for bulk harvest of the M2 seeds. Visual inspection of the M2 population resulted in the identification of 824 putative cer7 suppressors with waxy inflorescence stems. These suppressors were named war 25  mutants.  Figure 2.2: Summary of the suppressor screen Lifang Zhao performed the genotyping and wax analysis on M3 mutants and Patricia Lam carried out the real-time PCR on M3 mutants. Lifang Zhao completed almost all the complementation crosses between 32 suppressors (M4) and rough mapped more than 70 suppressors (M4).  The M3 progeny of all the putative suppressors were then subjected to more rigorous analyses to confirm the sti trichome phenotype and the presence of the original cer7-1 mutation and to determine the wax load, wax composition, and CER3 transcript levels of each mutant. Ninety-nine of the putative suppressor lines displayed the sti trichomes, and a diagnostic PCR-based Cleaved-amplified polymorphic sequence assay showed that they also carried the original cer-7-1 mutant allele. Thus the restored stem wax loads in these lines were due to mutations at sites distinct from the original cer7-1 mutation. The 99 lines retained after the secondary screen fell into two general groups: group 1, including plants with completely waxy, wild-type-looking stems; and group 2, including plants with waxy stem bases but glossy tops. We decided to focus on suppressor lines from group 1 and selected 32 war lines with the highest wax loads for further analysis. Allelism tests and rough genetic mapping revealed that they fall into at least four complementation 26  groups, war1 through war4 (Figure 2.3).  Figure 2.3: Analysis of war mutants. 27  (A) Stems of 6-week-old wild-type (Ler), cer7-1 and the 4 war mutants showing the suppression of the cer7-1 wax-deficient phenotype in the war mutants as indicated by glaucous stems. (B) Stem wax loads of war1 to war4 compared to wild-type and cer7-1. Error bars represent means ± SD (n=3). Statistically significant differences between samples (p<0.05) are indicated by a * using Student t test. (C) Stem wax composition of war1 to war4 compared to wild-type and cer7-1. Wax compositions for all war mutants are restored to near wild-type-like ratios of major wax components. (D) Quantitative RT-PCR showing that CER3 transcript levels are restored to wild-type levels in the war mutants. ACTIN2 was used as an internal control and control samples were normalized to 1. Values represent means ± SD (n=4).  Statistically significant differences between samples (p<0.05) are indicated by a * using Student t test. (Data contributed by Patricia Lam)  Stem wax analyses showed that all four war mutants have considerably higher wax loads than the cer7-1 mutant (Figure 2.3B). war1, war2 and war4 have 67%, 71% and 90% of wild-type wax levels, respectively, whereas war3 accumulates 10% greater than wild-type wax levels (Figure 2.3B). Furthermore, the cer7-1 wax composition, characterized by decreases in aldehyde, alkane, secondary alcohol and ketone levels, was restored to near wild-type compositions in the war lines (Figure 2.3C). All the war mutants were also analyzed for the expression of CER3. Quantitative real-time PCR measurements demonstrated that CER3 transcript accumulation was mostly or completely restored to wild-type levels and paralleled the restoration of wax loads in each suppressor line (Figure 2.3D). Here, we report the cloning and characterization of genes disrupted in war3 and war4 mutants.  2.2.3 WAR3 encodes RNA DEPENDENT RNA POLYMERASE 1 Genetic analysis of the F2 progeny from a backcross of the war3-1cer7-1 suppressor line to cer7-1 showed an approximately 3:1 segregation ratio of the glossy mutant to the waxy wild-type (620:232; χ2 = 2.26; p>0.1), indicating that wax restoration was due to a recessive mutation in a single nuclear gene. To map the war3-1 mutation, war3-1cer7-1 28  in the Landsberg erecta (Ler) background was crossed to cer7-3 in the Columbia ecotype to create a mapping population. Thirty-five F2 plants exhibiting a waxy phenotype were used to establish the linkage of war3-1 to markers F3F19 and F20D23 on chromosome 1 (Figure 2.4A).  Figure 2.4: Positional cloning of war3 and war4, and RDR1 and SGS3 gene structures (A) Schematic representation of the chromosomal location of war3 as determined by fine mapping. The markers used for mapping and number of recombinants are indicated. (B) Schematic representation of the RDR1 gene structure. 5’ and 3’ UTRs are indicated as gray boxes, exons as white boxes and introns as black lines. The translational start site 29  is represented by the bent arrow. The position and types of the mutations in rdr1 mutant alleles are also shown. (C) Schematic representation of the chromosomal location of war4 as determined by fine mapping. The markers used for mapping and the number of recombinants are indicated. (D) Schematic representation of the SGS3 gene structure and the position and types of mutations in sgs3 alleles. 5’ and 3’ UTRs are indicated as gray boxes, exons as white boxes and introns as black lines. The translational start site is represented by the bent arrow. (Data contributed by Patricia Lam)  The map position of war3-1 was further delineated to a 150 kb genomic region between markers T5E21 and F10B6I-5 using a population of 232 waxy individuals (Figure 2.4A). Sequencing of several candidate genes in this region revealed a point mutation in the third exon of At1g14790 at position 3171 (G to A transition), which is predicted to cause a premature stop codon in the war3-1 mutant. At1g14790 was also sequenced in war3-2 and war3-3, two additional alleles of war3 found in the suppressor screen, and in both cases missense mutations were detected (Figure 2.4B), confirming that WAR3 is indeed At1g14790. At1g14790 encodes RNA DEPENDENT RNA POLYMERASE 1 (RDR1; Yu et al., 2003). RDRs convert single-stranded RNA to double-stranded (ds) RNA that serves as the substrate for DICER. In Arabidopsis, there are 6 known RDRs. While RDR2 and RDR6 have been shown to be involved in the silencing of endogenous transcripts during development, RDR1 has not yet been demonstrated to play a role in this process (Dalmay et al., 2000; Mourrain et al., 2000; Xie et al., 2004). Instead, RDR1 has been reported to be involved in antiviral defense and shown to promote the turnover of viral RNAs in infected plants (Yu et al., 2003). Four additional alleles of war3 were identified from the T-DNA insertional mutant collection (Alonso et al., 2003): SALK_109922, SALK_112300, SALK_125022, and SALK_007638 (Figure 2.4B). Single homozygous war3 mutants do not have a visible wax phenotype. However, when homozygous war3 T-DNA mutants were crossed into the cer7-3 background, double mutants showed wild-type wax accumulation on inflorescence 30  stems, indicating that these war3 alleles were also able to suppress the cer7-related wax deficiency. No other morphological phenotypes were detected in the war3cer7 double mutants. To verify that the mutation identified in war3 is responsible for the wax restoration of cer7-1, the genomic and promoter region encompassing At1g14790 was transformed into the war3-1cer7-1 double mutant. Resulting transformants had wax-deficient glossy stems, confirming that WAR3 is RDR1. Therefore, the war3 alleles described here will be subsequently referred to as rdr1 (Table 2.1).  2.2.4 war4 contains a mutation in SUPPRESSOR OF GENE SILENCING 3 The unexpected finding that RDR1 is involved in the regulation of stem wax deposition downstream of the CER7 exoribonuclease prompted us to proceed with positional cloning of additional war suppressors to obtain more leads about the pathway involved. Genetic analysis of the F2 progeny from a backcross of war4-1cer7-1 (Ler ecotype) suppressor line to cer7-1 showed an approximately 3:1 segregation ratio of the glossy mutant to the waxy wild type (1951:641;  χ2 = 0.101, p>0.7), indicating that wax restoration was due to a recessive mutation in a single nuclear gene. The approximate map position of war4 was determined using 22 F2 progeny from a war4-1cer7-1 cross to cer 7-3 (Col-0 ecotype) which localized the war4-1 mutation between markers CIW8 and NGA139 on chromosome 5 (Figure 2.4C). Fine-mapping was carried out using 641 F2 plants and allowed us to narrow down the war4-1 mutation to a 100 kb region flanked by the markers K19M13 and MQM1, which contained 22 genes. Sequencing of candidate genes in this region revealed a C-to-T point mutation at position 454 in the first exon of At5g23570, predicted to cause a premature stop codon. Mutations in At5g23570 were also detected in four additional war4 alleles (Figure 2.4D). At5g23570 encodes SUPPRESSOR OF GENE SILENCING 3 (SGS3), an RNA-binding protein that is required for post-transcriptional gene silencing (PTGS) (Mourrain et al., 2000) and trans-acting siRNA (tasiRNA) production (Mourrain et al., 2000; Peragine et al., 2004). 31  SGS3 is thought to bind and protect RNA from degradation before its conversion to dsRNA by an RDR (Yoshikawa et al., 2005). We obtained two T-DNA insertional war4 mutants from the T-DNA insertional mutant collection (Alonso et al., 2003), sgs3-13 (SALK_039005) and sgs3-14 (SALK_001394), which contain T-DNA insertions in the second intron and the first exon of At5g23570, respectively. The single sgs3 mutants do not exhibit stem wax deficiency, but as described previously for several other sgs3 alleles, sgs3-13 and sgs3-14 have slightly downward-curled leaf margins (Peragine et al., 2004). To test the ability of sgs3-13 to suppress the cer7-caused stem wax deficiency like the war4-1 allele, we crossed it into the cer7-3 background. The resulting double mutant showed a waxy wild-type stem phenotype and downward- curled leaf margins, further demonstrating that At5g23570 is WAR4. In addition, we introduced the SGS3 coding region under the control of the cauliflower mosaic virus 35S promoter into the war4-1cer7-1 double mutant and obtained glossy cer7-like T1 progeny, indicative of successful complementation. Thus, WAR4 is SGS3, and we renamed all the war4 alleles described here sgs3 (Figure 2.4D; Table 2.2).  Table 2.1: Nomenclature and description of the rdr1 alleles rdr1 allele Alternate name Ecotype Mutagen Description of mutation Reference rdr1-1 CS66077 Col T-DNA Insertion in first exon Xie et al. 2004 rdr1-2 war3-1 Ler EMS Nonsense, Trp to stop at amino acid 1057 This study rdr1-3 war3-2 Ler EMS Missense, Arg to His at amino acid 369 This study rdr1-4 war3-3 Ler EMS Missense, Ala to Val at amino acid 856 This study rdr1-5 SALK_109922 Col T-DNA Insertion in promoter This study rdr1-6 SALK_112300 Col T-DNA Insertion in first exon This study rdr1-7 SALK_125022 Col T-DNA Insertion in third exon This study rdr1-8 SALK_007638 Col T-DNA Insertion in third exon This study (Data contributed by Patricia Lam)  32  Table 2.2: Nomenclature and description of the sgs3 alleles sgs3 allele Alternate name Ecotype Mutagen Description of mutation Reference sgs3-1  Col EMS Nonsense, Trp to STOP at amino acid 44 (Mourrain et al., 2000) sgs3-2  Col EMS Nonsense, Gln to STOP at amino acid 349 (Mourrain et al., 2000) sgs3-3  Col EMS Missense, Glu to Lys at amino acid 500 (Mourrain et al., 2000) sgs3-4  Col EMS Nonsense, Trp to STOP at amino acid 139 (Mourrain et al., 2000) sgs3-5  Col EMS Nonsense, Gln to STOP at amino acid 152 (Mourrain et al., 2000) sgs3-6  Col EMS Single nucleotide substitution at Met 501 (Boutet et al., 2003) sgs3-7 (same as sgs3-1) Col Fast neutron Nonsense, Trp to STOP at amino acid 44 (Adenot et al., 2006) sgs3-8  Col Fast neutron Rearrangement within the promoter region (Adenot et al., 2006) sgs3-9 (same as sgs3-3) Col Fast neutron Missense, Glu to Lys at amino acid 500 (Adenot et al., 2006) sgs3-10  Col EMS Nonsense, Gln to STOP at amino acid 531 (Elmayan et al., 2009) sgs3-11  Col EMS Change in intron/exon splice junction (Peragine et al., 2004) sgs3-12  Col EMS Nonsense, Trp to stop at amino acid 240 (Peragine et al., 2004) sgs3-13 SALK_039005 Col T-DNA Insertion in second intron (Peragine et al., 2004; Kumakura et al., 2009) sgs3-14 SALK_001394 Col T-DNA Insertion in first exon (Peragine et al., 2004; Kumakura et al., 2009) sgs3-15 war4-1 (same as sgs3-5) Ler EMS Nonsense, Gln to stop at amino acid 152 This study sgs3-16 war4-2 Ler EMS Missense, Pro to Leu at amino acid 229 This study sgs3-17 war4-3 Ler EMS Missense, Ala to Val at amino acid 393 This study 33  2.2.5 RDR1 and SGS3 are expressed throughout the plant  Quantitative reverse transcription (RT)-PCR was used to assess the expression levels of RDR1 and SGS3 in various organs. Aerial tissues were harvested from 4- to 6-week-old plants, whereas seedling and roots were collected from 14-d-old plants. RDR1 and SGS3 expression was detected in all tissues (Figure 2.5), but at varying levels. Expression patterns for RDR1 and SGS3 were very similar, with high transcript levels found in seedlings, cauline leaves, rosette leaves, and flowers. Low levels of RDR1 and SGS3 transcript were detected in roots and siliques.  To determine cell-type specific expression patterns of RDR1 and SGS3, we examined GUS activity in transgenic plants transformed with constructs in which the promoter region of RDR1 or SGS3 was fused to the GUS reporter gene (ProRDR1:GUS or ProSGS3:GUS, respectively). Cross-sections of the top of the stem show that both ProRDR1:GUS and ProSGS3:GUS are expressed in all stem tissues (Figure 2.6).   Figure 2.5: Expression analysis of RDR1 and SGS3 in different organs and tissues of Arabidopsis (Data contributed by Patricia Lam) 34   Figure 2.6: Tissue-specific expression of ProRDR1:GUS and ProSGS3:GUS in Arabidopsis stems A stem of a 4-week-old transgenic plant expressing (A) ProRDR1:GUS or (B) ProSGS3:GUS was stained for GUS activity. A cross-section from the top 3cm of the stem is shown. Scale bar = 0.1mm.  In order to establish the subcellular localization of SGS3, an SGS3:yellow fluorescent protein fusion under the control of the 35S promoter was created (Pro35:SGS3:YFP) and expressed in transgenic sgs3-15cer7-1 plants. The SGS3:YFP transgene was able to complement the waxy phenotype of sgs3-15cer7-1, indicating that the SGS3:YFP fusion protein was functional. In developing stems, SGS3 was found to be localized to a reticulate structure typical of the ER (Figure 2.7A). When leaves were examined, in addition to localization to the ER, SGS3 was also found to be present in the cytoplasm and in punctate structures, also termed cytoplasmic foci or granules, in agreement with previous reports (Figure 2.7B) (Glick et al., 2008; Kumakura et al., 2009; Elmayan et al., 2009). The punctae observed were not motile, suggesting that they are not Golgi bodies and did not colocalize with the hexyl rhodamine B stain, suggesting that they are not mitochondria. Because RDR6 was shown to interact with SGS3 and co-localize with SGS3 in similar puncta (Kumakura et al., 2009), we attempted to also determine the subcellular localization of RDR1. We expressed the RDR1:GFP transgene under the control of the native promoter, and transgenic rdr1-2cer7-1 plants carrying ProRDR1:RDR1:GFP were wax-deficient like the cer7-1 mutant, indicating that the RDR1:GFP fusion protein was functional. However, we were unable to detect strong fluorescent signal by confocal microscopy in any of the complemented lines. Low RDR1:GFP expression levels may be due to the weak RDR1 promoter. 35   Figure 2.7: Localization of SGS3 by confocal microscopy In stems (A), SGS3:YFP is localized to the ER. In leaves (B), SGS3:YFP is localized to the cytoplasm and to puncta. Z-projections of confocal stacks. Scale bar = 10 µm (Data contributed by Patricia Lam and Heather McFarlane)  2.2.6 RDR1 and SGS3 are involved in the regulation of CER3 expression in developing inflorescence stems Our suppressor screen resulted in the identification of several alleles of RDR1 and SGS3, suggesting that an RNA-based regulatory mechanism, possibly involving small RNAs, controls CER3 expression during cuticular wax deposition in developing inflorescence stems. During development, cuticular wax is synthesized predominantly at the top of the stem, where the stem is actively elongating, and waxes are deposited evenly along the stem (Suh et al., 2005). This requires higher expression of wax biosynthetic genes, including CER3, at the top of the stem than at the stem base. To determine if CER3 transcription is developmentally regulated in Arabidopsis inflorescence stems, and to investigate whether RNA silencing is involved in modulating CER3 expression, we monitored CER3 transcript levels in elongating stems by real-time PCR. As expected, CER3 transcript levels were considerably greater at the stem top than at the base of wild-type stems (Figure 2.8; 2.10). As shown previously, cer7-1 mutant plants displayed reduced CER3 transcript accumulation (Hooker et al., 2007) that did not significantly differ between the stem top and stem base. By contrast, introduction of 36  rdr1-2 or sgs3-15 mutation in the cer7-1 background resulted in a major surge in CER3 transcript accumulation, with the CER3 transcript reaching several fold greater levels than those detected in the wild-type stem top and stem base (Figure 2.8). These data indicate that RDR1 and SGS3, implicated in small RNA biogenesis, are necessary for the down-regulation of CER3 during the development of Arabidopsis inflorescence stems.   Figure 2.8: CER3 expression levels in the top 3cm and the bottom 3cm of a 10cm stem as measured by quantitative RT-PCR ACTIN2 was used as an internal control and control samples were normalized to 1.  Values represent means ± SD (n=4) and statistically significant differences (p<0.05) are indicated by a * using Student t test. (Data contributed by Patricia Lam)  2.3 Discussion We previously proposed a novel mechanism of regulating cuticular wax biosynthesis in developing Arabidopsis inflorescence stems, which involves the CER7 exosomal RNase (Hooker et al., 2007). We hypothesized that CER7 controls the transcription of CER3, a key wax biosynthetic gene, via degradation of an mRNA encoding a negative regulator of CER3. To test this model, we expressed the CER3 transgene in the cer7-3 mutant using the epidermis-specific CER6 promoter, which is not affected by the same negative regulator as CER3, and successfully complemented the cer7-3 stem wax 37  phenotype. To identify the proposed negative regulator and other factors required for CER7-mediated control of CER3 expression, we performed a screen for suppressors of cer7-1, which restore cer7-related stem wax deficiency to wild-type wax levels. We isolated four classes of suppressors designated war1 to war4. In this study, we characterized war3 and war4 and the genes disrupted by these mutations. WAR3 encodes RDR1, one of the six RDR proteins described in Arabidopsis. RDR proteins have been found in diverse eukaryotes and are considered to be core members of the RNA-silencing machinery. They catalyze the conversion of a single-stranded RNA template into dsRNA, which serves as a substrate for DICER-LIKE enzymes in the production of a type of small RNAs termed siRNAs. It is well documented that RDR2 and RDR6 participate in siRNA mediated gene silencing in Arabidopsis (Peragine et al., 2004; Vazquez et al., 2004; Xie and Qi, 2008), but evidence for such a role for RDR1 is currently lacking, as it has only been reported to be involved in antiviral defense by promoting turnover of viral RNAs in infected plants (Yu et al., 2003). Moreover, Yu et al. (2003) reported that RDR1 expression in leaves is only induced upon viral infection; however, we observed that RDR1 was constitutively expressed in most tissues at varying levels, consistent with expression patterns from the At-TAX tiling microarray experiments (Laubinger et al., 2008). Map-based cloning of WAR4 revealed that it encodes SGS3, a plant-specific protein suggested to bind and stabilize RNA template to initiate RDR-catalyzed dsRNA synthesis. SGS3 is essential for the synthesis of dsRNA in transgene silencing, virus silencing, and the synthesis of trans-acting siRNAs involved in the regulation of gene expression during normal plant development (Peragine et al., 2004), and it has been shown to directly interact with RDR6 in cytoplasmic punctae (Kumakura et al., 2009). The identification of RDR1 and SGS3 in our screen for the cer7-1 suppressors demonstrates that, in addition to RDR6, RDR1 function also requires the participation of 38  SGS3. Furthermore, even though RDR1 has not been reported to be involved in endogenous gene silencing, based on our results it seems reasonable to speculate that RDR1 and SGS3 are involved in the production of an as yet uncharacterized small RNA species that directly or indirectly mediates transcriptional gene silencing of CER3 to control wax deposition over the length of the stem. At the top of the stem where the stem is actively growing, wax biosynthetic genes are highly expressed (Suh et al., 2005). Conversely, at the base of the stem where growth has terminated, the expression of wax biosynthetic genes is reduced. As expected, in the wild type we found higher levels of the CER3 transcript in the stem top compared with the stem base. In the cer7-1 mutant, CER3 expression is significantly decreased, with CER3 transcript levels being similarly low in both the top and bottom of the stem, which results in the wax-deficient phenotype. In contrast to the cer7-1 mutant, CER3 transcript levels in rdr1-2cer7-1 and sgs3-15cer7-1 double mutants are considerably higher in both the top and the stem base than CER3 levels detected in the wild type (Figure 2.8), resulting in the restoration of stem wax loads. The simplest model that integrates all our findings is presented in Figure 2.9. Small RNA precursors are known targets of the exosomal RNA ribonucleases (Chekanova et al., 2007). We hypothesize that in the wild-type stem tops, where the CER7 is highly expressed (Figure 2.10) and the CER7 activity is presumably high, this exosomal RNase degrades a precursor of a small RNA species that acts as a repressor of CER3 expression. This results in enhanced CER3 transcription and wax production via the decarbonylation pathway. CER7 expression progressively decreases from the top towards the base of the stem (Figure 2.10), causing a gradual increase in small RNA accumulation. This is associated with the down-regulation of CER3 expression in the epidermal cells and the cessation of wax production at the stem base. In the cer7 mutant, where the CER7 exosomal subunit is not functional, the build-up of small RNAs cause CER3 silencing and stem wax deficiency. The biogenesis of small RNA precursors involved in the 39  silencing of CER3 requires RDR1 and SGS3 activities. In the absence of RDR1 or SGS3 in the rdr1cer7 or sgs3cer7 double mutant, respectively, the small RNA species responsible for CER3 repression will not be generated, abolishing the need for CER7 in wax biosynthesis.  Figure 2.9: A model illustrating the role of RDR1 and SGS3, components of RNA silencing, in regulating cuticular wax biosynthesis at the top of the stem (A) In the wild-type, the precursor of the smRNA that regulates expression of CER3 is degraded by CER7, therefore CER3 is expressed and wax production ensues. (B) In the cer7 mutant, the smRNA precursor is not degraded and is used for the production of a smRNA species by a pathway which involves RDR1 and SGS3. The smRNA functions to silence CER3, leading to decreased wax biosynthesis. (C) In either rdr1 or sgs3 suppressor of cer7, the smRNA species responsible for CER3 silencing will not be synthesized, resulting in CER3 expression and wax production in the absence of CER7 activity. (Model prepared by Patricia Lam) 40   Figure 2.10: Quantitative RT-PCR of CER7 expression levels in the top 3 cm and the bottom 3 cm of a 10 cm stem, as well as the epidermis. ACTIN2 was used as an internal control and control samples were normalized to 1.  Error bars represent ± SD (n=4). (Data contributed by Patricia Lam)  In an attempt to verify this model and identify the potential small RNA species that represses CER3 expression, we identified 33 small RNAs that map to the region upstream of CER3 (Arabidopsis Small RNA Project 2010; http://asrp.cgrb.oregonstate.edu/). However, none of these RNAs map to the fragment of the CER3 promoter that was used in our previous experiments to demonstrate that CER7 is required for transcription of the CER3 gene during stem wax deposition (Hooker et al., 2007). This suggests that the regulation of CER3 expression by small RNAs may be indirect and could involve another component, perhaps a positive regulator of CER3 transcription, which is controlled by PTGS. In this scenario, in wild type stem tops, the precursor of the small RNA repressor may be degraded by CER7, allowing the putative positive regulator to activate CER3 transcription. At the bottom of the stem, where the CER7 activity is lower, the small RNA repressor may silence the positive regulator of CER3, causing the down-regulation of CER3 expression. In the cer7 mutant, there may be a large accumulation of the small RNA repressor throughout the stem, silencing a positive regulator of CER3 and resulting in very low levels of CER3 transcription. In the rdr1cer7 and sgs3cer7 double mutants that lack the small RNA repressor, the putative positive regulator of CER3 would be continuously expressed, causing high levels of CER3 transcription and wax biosynthesis. 41  In conclusion, we have uncovered a novel mechanism of regulating cuticular wax biosynthesis during stem elongation, which involves the exosome and RNA mediated gene silencing. Such an intricate system of regulation may be utilized by the plant to control metabolism during cuticle development as a great amount of energy is expended by epidermal cells to generate cuticular lipids. RNA silencing of CER3 expression requires SGS3 and RDR1, providing evidence that RDR1 plays a role in gene regulation in addition to its role in antiviral defense. Identifying other components involved in this process, the RNA species responsible, and its target are important objectives for future research.  2.4 Methods 2.4.1 Plant material and growth conditions T-DNA insertion lines rdr1-1, rdr1-5 (SALK_109922), rdr1-6 (SALK_112300), rdr1-7 (SALK_125022), rdr1-8 (SALK_007638), sgs3-13 (SALK_039005) and sgs3-14 (SALK_001394) were obtained from the ABRC (www.arabidopsis.org). Seeds were germinated on AT-agar plates (Somerville and Ogren, 1982) and grown for 7-10 days before being transplanted to soil (Sunshine Mix 4, SunGro). All plants were grown at 20°C under continuous light (90-110 µE m-2 s-1 of photosynthetically active radiation) in an environmental chamber.  2.4.2 Molecular complementation of cer7 with the CER3 transgene The 1,899bp CER3 coding region was excised from the plasmid pESC-TRP:ProGAL1:CER3 (P. Lam unpublished results) using BamHI and NheI. This fragment was cloned into the plasmid pBluescriptII:ProCER6 (P. Lam, unpublished results) into the corresponding restriction enzyme sites to generate pBluescriptII:ProCER6:CER3. The ProCER6-CER3 fragment was then released using XhoI and SstI and cloned into pRD400 (Datla et al., 1992) that was digested with 42  enzymes SalI and SstI (SalI and XhoI form compatible ends). The resulting plasmid, pRD400:ProCER6:CER3 was transformed into Agrobacterium tumefaciens strain GV3101, pMP90 (Koncz and Schell, 1986) via electroporation. The cer7-3 plants were transformed using the floral dip method (Clough and Bent, 1998).  2.4.3 Mutagenesis of cer7-1sti and suppressor screen Approximately 12,000 cer7-1sti seeds were soaked inwater for 2 hours and then in 0.3% solution of Ethyl Methanesulphonate for 16 h. After mutagenesis, the seeds were washed four times with distilled water for 15 min per wash before being planted directly in soil in 64 pots. The M1 plants were grown until maturity and M2 seeds were harvested collectively from each pot, yielding 64 batches. In the primary screen, M2 seeds from each of the 64 batches were grown up and scored for a waxy stem phenotype. Plants that did not have a waxy phenotype were discarded. Those M2 plants that were waxy were grown to maturity and seeds were harvested individually and their progeny (M3) were then subjected to a secondary screen to confirm that they do have a waxy stem, the sti trichome phenotype and that the original cer7-1 mutation was still present.  2.4.4 Genotyping DNA was extracted according to Berendzen et al. (2005). To genotype cer7-1, dCAPS primers cer7-1_AflII-F and cer7-1_AflII-R (Table 2.3) were used to amplify a 210 bp fragment. The PCR product was then digested with AflII and run on a 1.5% agarose gel. The mutation in cer7-1 allows for the cleavage of the PCR product after AflII digestion resulting in a 185 bp and a 25 bp product. T-DNA insertion lines were genotyped using gene specific primers and LBb1.3 left T-DNA border primer.  2.4.5 Cuticular wax extraction and analysis Cuticular waxes were extracted from 4-6 week old Arabidopsis stems. Stems were 43  immersed for 30 sec in chloroform containing 10 µg n-tetracosane (C24 alkane), which was used as an internal standard. After extraction, samples were blown down under a stream of nitrogen and redissolved in 10 µL N, O-bis (trimethylsilyl) trifluoroacetamide (Sigma) and 10 µL pyridine (Fluka). Samples were derivatized for 90 minutes at 80 °C. After derivatization, excess BSTFA and pyridine were removed by blowing down under nitrogen and samples were dissolved in 30 µL of chloroform. Wax analyses were performed on a Hewlett-Packed 7890 series gas chromatograph equipped with a flame ionization detector and an HP-1 column with helium as the carrier gas. Gas chromatography was carried out with temperature-programmed on-column injection and oven temperature set at 50 °C for 2 min, and then raised by 40 °C min–1 to 200 °C, held for 2 min at 200 °C, raised by 3 °C min–1 to 320 °C, and held for 30 min at 320 °C. Quantification of wax components was carried out by comparing their flame ionization detector peak areas to that of the internal standard. Stem surface area was calculated by photographing stems prior to wax extraction, measuring the number of pixels, converting the values to cm2, and multiplying by π.  2.4.6 Quantitative RT-PCR RNA was extracted from plant tissue using TRIzol (Invitrogen) as per manufacturer’s protocol. RNA quantification was performed using a NanoDrop 8000 (Thermo Scientific). 500 ng of total RNA was treated with DNaseI (Fermentas) and then used for first strand cDNA synthesis using iScript RT supermix (Bio-Rad). RT-PCR was performed using gene-specific primer sets from Table 2.3. PCR cycles were optimized for each gene to identify the linear amplification range. Quantitative RT-PCR was performed in 20 µL reactions using iQ SYBR green supermix (Bio-Rad) and run on the iQ5 real-time PCR detection system (Bio-Rad). Data were analyzed using the Pfaffl method (Pfaffl, 2001), and control samples were normalized to 1.  44  2.4.7 Positional cloning of suppressor mutations To map the position of suppressor mutations, each suppressor line (Ler ecotype) was crossed to cer7-3 (Col-0 ecotype) and genomic DNA from leaves of 30-40 F2 plants with the wild-type waxy stem phenotype (plants homozygous for the suppressor mutation) was collected on FTA cards (Whatman) and subjected to PCR using simple sequence length polymorphism (SSLP) markers to determine linkage. To further pinpoint the location of each suppressor mutation, over 1,000 plants were screened with SSLP markers until a narrow interval was found.  2.4.8 Molecular complementation of suppressor lines and subcellular localization of RDR1 and SGS3 A 5,252 bp DNA fragment containing 1,754 bp of the upstream region of RDR1 (At1g14790) and the coding region minus the STOP codon was amplified from WT Col plants with primers RDR1p-attB1 and RDR1-attB2_noSTOP (Table 2.3) using Phusion polymerase (Finnzymes). Gateway adapters were added using the adapter protocol (Invitrogen). This 5252 bp fragment was cloned into pDONR221 using BP Clonase II (Invitrogen) to create pDONR221:ProRDR1:RDR1ΔSTOP and was sequenced to confirm that no mutations were introduced during PCR. The fragment was then recombined into the destination vector pGWB4 (Nakagawa et al., 2007) using LR Clonase II (Invitrogen) to generate pGWB4:ProRDR1:RDR1:GFP.  To generate SGS3:YFP fusions for sub-cellular localization analysis, the coding sequence of SGS3 (At5g23570) was obtained from leaf cDNA using primers SGS3-attB1 and SGS3-attB2_noSTOP (Table 2.3) with Phusion polymerase (Finnzymes). The PCR product was introduced into the pDONR207 entry vector using BP Clonase II (Invitrogen). Sequencing was performed to confirm error free inserts which were then transferred to the binary vectors pEarleyGate104 (Earley et al., 2006) using LR Clonase II (Invitrogen).  These constructs were introduced into rdr1-2cer7-1 and sgs3-15cer7-1 plants via 45  Agrobacterium-mediated transformation as described above.  Spinning disk confocal microscopy was performed on a Perkin Elmer Ultraview VoX Spinning Disk Confocal mounted on a Leica DMI6000 inverted microscope. GFP and YFP were detected using a 488 nm laser and 528/38-nm emission filters. Acquired images were processed using Volocity (Improvision) and Image J.  2.4.9 RDR1 and SGS3 promoter:GUS fusions and GUS Activity Assay To generate ProRDR1:GUS, a 1,754 bp region upstream of the RDR1 initiation codon was amplified from genomic DNA using the primers RDR1pro_EcoRI-F and RDR1_XbaI-R (Table 2.3) with Phusion polymerase (Finnzymes). The PCR product was digested with EcoRI and XbaI and cloned into the corresponding restriction enzyme sites of pBluescriptIISK(+) (Stratagene). After sequencing to confirm that no errors were induced from PCR, the ProRDR1 region was excised using SalI and BamHI and cloned into the corresponding sites of pBI101 (Clontech) to generate pBI101:ProRDR1:GUS. To generate ProSGS3:GUS, a 2,177-bp long region containing 2,141 bps immediately upstream of the SGS3 translation start site and 36 bps downstream of the SGS3 translation start site was amplified from genomic DNA using gene specific primers SGS3pro-attB1 and SGS3pro-attB2 with Phusion polymerase (Finnzymes). The obtained fragment was introduced to pDONR207 entry vector and sequencing confirmed that there was no error in the SGS3 promoter, which was then transferred into the pMDC163 destination vector.  Stems from transgenic plants containing the ProRDR1:GUS and ProSGS3:GUS constructs were removed and immersed in GUS staining buffer containing 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide, 100 mM Na2HPO4, 100 mM NaH2PO4, 0.2% Triton-X-100, and 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-Gluc) for 1-2 h at 37 °C. Stems were then cleared of chlorophyll by overnight incubation in 75% ethanol. Stained and cleared samples were examined under compound light microscopy.  46  Table 2.3: Primers used in this study Primer Sequence LBb1.3 5’-ATTTTGCCGATTTCGGAAC-3’ cer7-1_AflII-F 5’-CTGCACTGTAGGAGGAGAGAATGCT-3’ cer7-1_AflII-R 5’-CAAACGTGAAGGCTATTGGG-3’ SALK_109922-LP 5’-CAACAGGGCAGTGACTGAAA-3’ SALK_109922-RP 5’-GTTCCCTCAGTTTCCGATGA-3’ SALK_112300-LP 5’-CGTGGAGCAAGTACCAACCT-3’ SALK_112300-RP 5’-ATGGGTCACTAAACGCCTTG-3’ SALK_125022-LP 5’-GCTTGATGTGGCCTCAAAGT-3’ SALK_125022-RP 5’-GATTGGCCCATTCAGAGAAA-3’ SALK_007638-LP 5’-GCTTGATGTGGCCTCAAAGT-3’ SALK_007638-RP 5’-GATTGGCCCATTCAGAGAAA-3’ SALK_039005-LP 5’-AAGGCCATGCTTGTACATGAG-3’ SALK_039005-RP 5’-TATGAGGCTCTTAGAGCACGC-3’ SALK_001394-LP 5’-AAATTTGGAGTCCAGAATCGG-3’ SALK_001394-RP 5’-CAAAGCATCGGAATCATTCTC-3’ RDR1pro_EcoRI-F 5’-CGCGAATTCTTTCAGAGTGTGTAATATTTTC-3’ RDR1_XbaI-R 5’-AGATCTAGATCAACCGAAACGCAGAACATGG-3’ RDR1p-attB1 5′-AAAAAGCAGGCTTTTCAGAGTGTGTAATATTTT-3’ RDR1-attB2_noSTOP 5’-AGAAAGCTGGGTAACCGAAACGCAGAACATGGTCTA- 3’ SGS3attB1 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGAGTTCTAGGGCTGGTCC-3’ SGS3attB2_noSTOP 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCATCATCTTCATTGTGAAGG-3’ SGS3pro-attB1: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCTCTGTAAGTCCTCTTTCTGT-3’ SGS3pro-attB2: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCCTTTTCCTTAGACATTGGACC-3’ CER3-qPCR-F 5’-CTCATCTCCTGTTCCACATCC-3’ CER3-qPCR-R 5’-TCAATGGAACACCAGCTACG-3’ RDR1-RT-F 5’-TATGGTGGACTGCGTTGTGT-3’ RDR1-RT-R 5’-TTCGCGATGATCCCTAAACT-3’ SGS3-RT-F 5’-TGCAGCATGAACAGAACAGG-3’ SGS3-RT-R 5’-GCATCTCCCTCTCTTCCACA-3’ ACTIN2-F 5’-TCCCTCAGCACATTCCAGCAGAT-3’ ACTIN2-R 5’-AACGATTCCTGGACCTGCCTCATC-3’  47  CHAPTER 3: THE EXOSOME AND TRANS-ACTING SMALL INTERDERING RNAS REGULATE CUTICULAR WAX BIOSYNTHESIS DURING ARABIDOPSIS INFLORESCENCE STEM DEVELOPMENT 3.1 Introduction Cell walls of the primary surface tissues of land plants are coated with a cuticle, a lipid structure that plays a critical role in plant protection from desiccation, serves as a barrier against pathogen and insect attack (Kunst and Samuels, 2003), and prevents organ fusions during development (Sieber et al., 2000). The cuticle is synthesized by epidermal cells and is composed of cutin and cuticular waxes. Cutin is a polyester rich in oxygenated fatty acids with chain lengths of 16 or 18 carbons and glycerol (Pollard et al., 2008), whereas waxes include predominantly aliphatic very-long-chain fatty acid (VLCFA)-derived components, together with variable amounts of secondary metabolites such as flavonoids and triterpenoids (Jetter et al., 2006; Pollard et al., 2008). Forward genetic approaches using Arabidopsis thaliana eceriferum (cer) mutants and reverse genetic approaches have been instrumental in the identification of genes involved in cuticular wax biosynthesis and regulation as well as isolation of genes encoding plasma membrane-localized proteins that are required for wax export (Kunst and Samuels, 2009; von Wettstein-Knowles, 2012). Despite significant advances in our knowledge of wax biosynthetic and transport machinery, the regulation of wax deposition is still not well understood, and a relatively small number of genes involved in this process have been identified to date. The first transcription factors reported to regulate wax accumulation during cuticle formation were WAX INDUCER1/SHINE1 (WIN1/SHN1) and its homologs SHN2/3 and WXP1 (Aharoni et al., 2004; Broun et al., 2004; Zhang et al., 2005). Subsequent work demonstrated that the WIN1/SHN1 transcription factor activates cutin biosynthetic 48  genes, and only indirectly affects wax accumulation (Kannangara et al., 2007). Other transcription factors that control wax biosynthesis include MYB96 and MYB30, which activate cuticular wax biosynthesis under drought stress and in response to pathogen attack, respectively (Raffaele et al., 2008; Seo et al., 2011). Both of these transcription factors have been shown to bind the conserved sequences in the promoters of wax biosynthetic genes. Furthermore, DECREASE WAX BIOSYNTHESIS (DEWAX), an AP2/ERF type transcriptional repressor controls wax deposition during diurnal light/dark cycles via direct interaction with promoters of wax-related genes. DEWAX also plays an important role in determining the total organ-specific wax load on Arabidopsis shoots (Go et al., 2014). In addition to transcription factors, our work on the wax-deficient cer7 mutant resulted in a surprising discovery that CER7, a core subunit of the exosome, also controls wax biosynthesis in developing Arabidopsis inflorescence stems (Hooker et al., 2007). Inflorescence stems emerge at the transition from vegetative to reproductive development, and grow rapidly with most cell elongation occurring in the top 3 cm of stem below the apical meristem. Even though cell elongation in the stem decreases progressively from top to bottom, and eventually stops completely, cuticular wax load and composition remain remarkably constant throughout stem development (Suh et al., 2005). A comparison of transcriptomes of rapidly expanding and nonexpanding stem cells revealed that wax-related genes are preferentially or exclusively expressed in rapidly elongating stem segments (Suh et al., 2005), but how their expression is temporally regulated in a polar top-to-bottom fashion in developing stems was not known. Characterization of the cer7 mutant revealed that CER7 affects wax deposition in developing stems by positively regulating transcript levels of CER3, a key wax biosynthetic gene (Hooker et al., 2007). As expected of major genes required for wax production, CER3 transcript levels in wild-type stems are high at the stem apex and gradually decrease towards the stem base, concomitant with progressive reduction in 49  CER7 expression levels (Lam and Zhao et al., 2012). Conversely, in the stem wax-deficient cer7 mutant, CER3 expression is equally low at both the top and bottom of the stem (Lam and Zhao et al., 2012). To dissect the process of CER7-mediated regulation of CER3 expression we performed a screen for second-site suppressors of cer7 and identified a series of wax restorer (war) mutants. Cloning of genes disrupted in the war3 and war4 suppressors demonstrated that they encode SUPPRESSOR OF GENE SILENCING 3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE 1 (RDR1), proteins involved in post-transcriptional gene silencing (PTGS; Lam and Zhao et al., 2012). PTGS by mRNA degradation or translational inhibition in plants is controlled by microRNAs (miRNAs) and trans-acting small interfering RNAs (tasiRNAs). TasiRNAs are 21-nucleotide long, plant-specific class of endogenous small RNAs generated by cleavage of the TAS gene-derived transcripts. TasiRNA biogenesis is initiated by a miRNA-loaded RNA-induced silencing complex (RISC) (Allen et al, 2005; Xie et al., 2005; Yoshikawa et al., 2005) that makes the first cut in the TAS transcript at a specific target site, followed by the conversion of one of the two cleavage products into a double stranded RNA (dsRNA) by SUPPRESSOR OF GENE SILENCING 3 (SGS3) and RNA-DEPENDENT POLYMERASE 6 (RDR6) (Peragine et al, 2004; Vazquez et al, 2004; Allen et al, 2005). The resulting dsRNA is then processed into 21-nucleotide tasiRNA duplexes by RNAseIII DICER-LIKE4 (DCL4) (Dunoyer et al., 2005; Gasciolli et al., 2005; Hiraguri et al., 2005; Xie et al., 2005; Yoshikawa et al., 2005) and methylated by the RNA methyltransferase HUA ENHANCER 1 (HEN1) that protects them from degradation and 3′-end uridylation (Li et al., 2005; Yu et al., 2005). Finally, only the guide strands of the tasiRNA duplexes associate with ARGONAUTE1 (AGO1) (Baumberger and Baulcombe, 2005) to carry out PTGS of complementary target RNAs. SGS3 is a well-established component of the tasiRNA biogenesis pathway (Peragine et al., 2004, Yoshikawa et al., 2005), but RDR1 had not been previously reported to be 50  involved in tasiRNA biogenesis, or to be involved in silencing of endogenous genes. RDR1 has only been implicated in antiviral defense for siRNA synthesis targeted against viral RNAs (Yu et al., 2003; Garcia-Ruiz et al., 2010). Thus, upon the identification of RDR1 in our screen for suppressors of the cer7 wax deficiency, it was not clear whether tasiRNAs, or another type of non-coding RNAs, control CER3 expression to influence wax deposition. The goal of the present work was to establish the molecular identity of the effector non-coding RNA species and to determine whether these effector RNAs control CER3 transcript levels directly, or indirectly by PTGS of a positive regulator of CER3. To accomplish this, we isolated additional components of the CER3 silencing machinery, and performed next generation sequencing (RNA-seq) of small RNA populations that differentially accumulate in the cer7 mutant in comparison to wild-type and the cer7rdr1 and cer7sgs3 suppressor lines. Small RNAs that uniquely accumulated in the cer7 mutant, but not in the wild-type or the suppressors, were then used to find their cognate gene targets by sequence complementarity. Our results show that tasiRNAs are involved in CER3 silencing during stem wax deposition in the course of Arabidopsis inflorescence stem development and provide evidence that silencing of CER3 by tasiRNAs is direct.  3.2 Results 3.2.1 Identification of additional factors required for CER7-mediated CER3 silencing To identify proteins involved in the biogenesis of non-coding RNA effectors that control the expression of the CER3 gene during stem wax deposition and are negatively regulated by CER7, we carried out a genetic screen for mutations that abolish the cer7 wax-deficient phenotype. As previously reported, 99 lines were isolated from this suppressor screen. 77 lines were classified as group 1 wax restorer (war) mutants with completely recovered wax loads on their inflorescence stems (Lam and Zhao et al., 2012). These mutants fall into six complementation groups named war1 to war6. The 51  identification of WAR3/RDR1 and WAR4/SDS3 encouraged us to proceed with cloning and characterization of additional WAR genes, WAR5 and WAR6, to determine their role in CER3 silencing.  To identify WAR5, the war5-1cer7-1 (Ler ecotype) mutant was crossed to cer7-3 (Col-0 ecotype) to generate a mapping population. Genetic analysis of the F2 progeny demonstrated a roughly 3:1 segregation ratio of the wax-deficient mutant to the waxy wild-type (1590:516; χ2 = 0.279, p > 0.5), implying that wax recovery was caused by a single recessive mutation. The war5-1 mutation was mapped to a 110-kb region on chromosome 3 bordered by the markers K7L4 and MDQ17 (Figure 3.1A). Sequencing of several candidate genes in this area uncovered a G to A nucleotide change at the last position of the 5th intron (junction of the 5th intron and 6th exon) of At3g15390, expected to cause splicing defects during mRNA processing in the war5-1 mutant. Sequencing of the war5-2 allele, which was isolated from the same suppressor screen, revealed a C to T point mutation in At3g15390 at position 2619 (from ATG of the genomic DNA), leading to a premature stop codon (Figure 1B). At3g15390 encodes SILENCING DEFECTIVE5 (SDE5), a putative RNA trafficking protein reported to be required for sense transgene PTGS and the production of tasiRNAs (Hernandez-Pinzon et al., 2007; Jauvion et al., 2010). Two T-DNA insertional alleles obtained from the T-DNA mutant collection (Alonso et al., 2003), sde5-5 (SALK_114489) and sde5-6 (SALK_115496) (Figure 3.1B, Table 3.1), do not show signs of stem wax deficiency, but exhibit slightly downward-curled leaf edges, as observed in previously reported null sde5 mutants (Jauvion et al., 2010). However, similar to the original war5 alleles isolated in our suppressor screen, when sde5-5 and sde5-6 were crossed into the cer7-3 background, the double mutants showed wild-type like wax accumulation on stems (Figure 3.1C). Gas chromatography/flame ionization detection (GC/FID) analysis of the stem wax of war5cer7-1 alleles and sde5cer7-3 double mutants confirmed wild-type wax loads (Figure 3.1D). Wax composition profiles and CER3 expression levels in all war5cer7-1 52  and sde5cer7-3 double mutants were also similar to wild-type (Figure 3.1E-F). Taken together, these data indicate that SDE5 is WAR5. Therefore, the war5-1 and war5-2 were renamed sde5-7 and sde5-8 (Table 3.1). The WAR6 gene was mapped to chromosome 3 between markers T6H20 and F18B3 using 20 waxy individuals from the F2 population of a war6-4cer7-1 (Ler background) x cer7-3 (Col-0 background) cross (Figure 3.1G). Instead of continuing with fine mapping, we examined the genes in the region of interest for candidates that are involved in RNA silencing, as all the previously identified WAR genes encode proteins required for siRNA biogenesis (Lam and Zhao et al., 2012). One of the candidate genes in this region is At3g49500, which encodes RNA-DEPENDENT RNA POLYMERASE6 (RDR6), one of the six RNA-dependent RNA polymerases in the Arabidopsis genome. RDR6 was shown to co-localize with SGS3 in cytoplasmic SGS3/RDR6-granules (Kumakura et al., 2009), and functions together with SGS3 to convert single-stranded RNA (ssRNA) into double-stranded RNA (dsRNA) during tasiRNA formation (Peragine et al., 2004, Vazquez et al., 2004, Yoshikawa et al., 2005). Sequencing of the RDR6 genomic region in the war6-4 mutant revealed a G to A mutation that introduced a stop codon in second exon of RDR6. Four additional war6 alleles from our suppressor screen were also sequenced and all contained missense mutations in RDR6 (Figure 3.1H), confirming that WAR6 is RDR6. We obtained two additional war6 alleles, rdr6-11 and rdr6-12, which contain a C to T nonsense mutation at nucleotide 805 and a 7 bp deletion between nucleotide 997 to 1003 of RDR6, respectively (Peragine et al., 2004). Single homozygous rdr6 mutants do not show a visible wax phenotype but, as reported previously, rdr6-11 and rdr6-12 exhibit strong downward-curled leaf margins (Peragine et al., 2004). When these two mutants were crossed into the cer7-3 background double mutants exhibited near wild-type stem wax loads and composition (Figure 3.1I-K), confirming that these rdr6 alleles were also able to suppress the cer7 wax deficiency. As expected, real time PCR demonstrated substantially increased CER3 transcript levels in all war6cer7-1 53  alleles and rdr6cer7-3 double mutants (Figure 3.1L). Therefore, we renamed all war6 alleles rdr6 (Table 3.2). The fact that the WAR5 and WAR6 encode two additional tasiRNA biosynthetic proteins suggests that tasiRNAs are the non-coding effector RNA molecules involved in CER3 silencing. Surprisingly, mutations in either RDR1 or RDR6 can suppress cer7 wax deficiency, suggesting that they have non-redundant roles in the conversion of ssRNA to dsRNA during tasiRNA formation. To determine whether this is indeed the case, rdr1-7cer7-3 was crossed with rdr6-12cer7-3 to create the rdr1-7rdr6-12cer7-3 triple mutant. If RDR1 and RDR6 functioned redundantly, we would expect to detect increased CER3 transcript accumulation, leading to higher wax load on the stems of the triple mutant. Visual inspection and GC/FID analysis of rdr1-7rdr6-12cer7-3 stem wax demonstrated that wax load and composition (Figure 3.2A-C) in triple mutants were comparable to that of the double mutants. CER3 transcript levels were also unchanged in the triple mutant (Figure 3.2D). Thus, RDR1 and RDR6 act non-redundantly in the production of tasiRNAs that control wax accumulation on Arabidopsis stems.  Table 3.1: Nomenclature and description of the sde5 alleles sde5 allele Alternate name Eco-type Muta- gen Description of mutation Reference sde5-1  C24 Fast neutron A 3 kb inversion Hernandez-Pinzon et al. 2007 sde5-2 SALK_020726 Col T-DNA Insertion in sixth exon Hernandez-Pinzon et al., 2007 sde5-3 WISC-429G09 Col T-DNA Insertion in eighth exon Jauvion et al., 2010 sde5-4 sgs7 Col  EMS Change at the acceptor site of the second intron Jauvion et al., 2010 sde5-5 SALK_114489 Col T-DNA Insertion in fourth exon This study sde5-6 SALK_115496 Col T-DNA Insertion in seventh intron This study sde5-7 war5-1 Ler EMS Change at intron/exon junction This study sde5-8 war5-2 Ler EMS Nonsense, Arg to STOP at amino acid 450 This study 54   Figure 3.1: Identification of SDE5 and RDR6 as additional factors required for CER7-mediated CER3 silencing 55  (A) Schematic representation of the chromosomal location of war5 as determined by fine mapping. The markers used for mapping and the number of recombinants are indicated. (B) Schematic representation of the SDE5 gene structure. The 5’ and 3’ untranslated regions are indicated as gray boxes, exons as white boxes, and introns as black lines. The translational start site is represented by the bent arrow. The positions and types of the mutations in sde5 mutant alleles are also shown. (C) Stems of 6-week-old Landsberg erecta (Ler) wild-type (WT), cer7-1, two war5cer7-1 mutants, Columbia-0 (Col-0) WT, cer7-3, and two sde5cer7-3 double mutant plants showing the suppression of the cer7 wax-deficient phenotype in the double mutants as indicated by whitish stems. (D) Stem wax loads of war5cer7-1, sde5cer7-3 double mutants compared with their corresponding WT and cer7 mutant. Values represent means ± SD (n=3). Statistically significant differences between samples are indicated by different letters at P<0.01 using a one-way ANOVA and Tukey test. (E) Stem wax composition of war5-1cer7-1, sde5-5cer7-3 double mutants compared with their corresponding WT and cer7 mutant. Wax compositions for all double mutants are restored to WT-like ratios of major wax components. (F) Quantitative RT-PCR showing that CER3 transcript levels are recovered to 40~60% of WT levels in the double mutants. ACTIN2 was used as an internal control, and control samples were normalized to 1. Values represent means ± SD (n=3). (G) Schematic representation of the chromosomal location of war6 as determined by rough mapping. The markers used for mapping and the number of recombinants are indicated. (H) Schematic representation of the RDR6 gene structure. The 5’ and 3’ untranslated regions are indicated as gray boxes, exons as white boxes, and introns as black lines. The translational start site is represented by the bent arrow. The positions and types of the mutations in rdr6 mutant alleles are also shown. (I) Stems of 6-week-old Ler WT, cer7-1, five war6cer7-1 mutants, Col-0 WT, cer7-3, and two rdr6cer7-3 double mutant plants showing the suppression of the cer7 wax-deficient phenotype in the double mutants as indicated by whitish stems. (J) Stem wax loads of war6cer7-1, rdr6cer7-3 double mutants compared with their corresponding WT and cer7 mutants. Values represent means ± SD (n=3). Statistically significant differences between samples are indicated by different letters at P<0.01 using a one-way ANOVA and Tukey test. (K) Stem wax composition of war6-1cer7-1, rdr6-11cer7-3 double mutants compared with their corresponding WT and cer7 mutants. Wax compositions for all double mutants are restored to WT-like ratios of major wax components. (L) Quantitative RT-PCR showing that CER3 transcript levels are recovered to 40~100% of WT levels in the double mutants. ACTIN2 was used as an internal control, and control samples were normalized to 1. Values represent means ± SD (n=3). 56  3.2.2 DCL4, AGO1 and HEN1 proteins are also required for regulation of CER3 expression during stem wax deposition In addition to RDRs which generate double stranded RNAs, all small RNA biosynthetic pathways require DICER-LIKE (DCL) endonucleases that slice dsRNAs into 20-25-nucleotide RNA duplexes, ARGONAUTE (AGO) proteins which bind small RNAs and are responsible for small RNA-guided cleavage of target mRNAs, and the HUA ENHANCER 1 (HEN1) protein, an RNA methyltransferase which introduces a methyl group on DCL-generated small RNAs to protect them from degradation and uridylation (Chen et al., 2002; Boutet et al., 2003; Yu et al., 2005; Li et al., 2005). We employed a reverse genetic approach to pinpoint the DCL and AGO protein family members that are involved in the production of tasiRNAs controlling CER3 transcript levels during stem wax deposition. We reasoned that secondary mutations in the tasiRNA biogenesis pathway downstream of cer7 that abolish tasiRNA production should produce near wild-type CER3 transcript accumulation and stem wax restoration, as observed in rdr1cer7 and sgs3cer7 double mutants. We generated double mutants of dcl1cer7 through dcl4cer7 to determine which of the four DCL family members can rescue the cer7 stem wax deficiency. Of the four double mutants, dcl4-2cer7-3 alone displayed glaucous, waxy wild-type looking stems (Figure 3.2E, Table 3.3). GC/FID analysis confirmed that the wild-type stem wax load and composition were restored in the dcl4-2cer7-3 double mutant (Figure 3.2F-G), and real time PCR data demonstrated wild-type CER3 transcript accumulation (Figure 3.2H). Thus, DCL4 is necessary and sufficient for the cleavage of dsRNA into tasiRNAs involved in regulating wax production. Intriguingly, when we constructed this double mutant using another dcl4 allele, dcl4-10, which carries a T-DNA insertion in the 23rd exon of the DCL4 gene (Figure 3.3A, Table 3.3), the dcl4-10cer7-3 double mutant could not complete the development of true leaves, but died at the cotyledon stage (Fig. 3.3B). This might be due to the fact that the T-DNA insertion in dcl4-10 completely abolished DCL4 activity, whereas EMS-generated dcl4-2 is a weak 57  allele of DCL4 gene. If this is the case, a complete disruption of both CER7 and DCL4 genes compromises the ability of the plant to complete development. To investigate which of the 10 AGO(s) in Arabidopsis is involved in regulating CER3 expression, we obtained T-DNA insertional mutants for all AGO genes, except for AGO1, for which we acquired an EMS-generated mutant, ago1-11 (Table 3.4) (Alonso et al., 2003; Kidner and Martienssen, 2005). Double mutants were generated by crossing homozygous ago mutants with the cer7-1 allele, and their stem wax accumulation was evaluated by visual inspection, followed by GC analysis. The only double mutant that had waxy stems and near wild-type wax load and composition was the ago1-11cer7-1 (Figure 3.4A-D). Quantitative RT-PCR analysis confirmed that CER3 transcript levels were also restored to wild-type in the ago1-11cer7-1 mutant (Figure 3.4F). These results demonstrate that AGO1 is the ARGONAUTE protein required for the production of tasiRNAs involved in regulation of CER3 expression during stem wax deposition.  Table 3.2: Nomenclature and description of the rdr6 alleles rdr6 allele Alternate name Ecotype Mutagen Description of mutation Reference rdr6-11 CS24285 Col T-DNA Nonsense, Arg to STOP at amino acid 267 Peragine et al., 2004 rdr6-12 CS24286 Col Fast neutron 7 bp deletion (997-1003), frameshift Peragine et al., 2004 rdr6-13 CS24287 Col EMS Missense, Gly to Glu at amino acid 866 Peragine et al., 2004 rdr6-14 CS24288 Col EMS Nonsense, Trp to STOP at amino acid 1039 Peragine et al., 2004 rdr6-15 SAIL_617_H07 CS66481 Col T-DNA Insertion in first exon Allen et al., 2004 rdr6-16 war6-1 Ler EMS Missense, Ala to Thr at amino acid 772 This study rdr6-17 war6-2 Ler EMS Missense, Gly to Asp at amino acid 921 This study rdr6-18 war6-3 Ler EMS Missense, Ser to Asn at amino acid 862  This study rdr6-19 war6-4 Ler EMS Nonsense, Trp to STOP at amino acid 391 This study 58   Figure 3.2: RDR1, RDR6 and DCL4 are all required for CER7-mediated CER3 silencing 59  (A) Stems of 6-week-old Col-0 WT, cer7-3, rdr1-7cer7-3, rdr6-12cer7-3 and rdr1-7rdr6-12cer7-3 triple mutant plants showing the suppression of the cer7-3 wax-deficient phenotype in both the double and triple mutants as indicated by whitish stems. (B) Stem wax loads of rdr1-7cer7-3, rdr6-12cer7-3 double and rdr1-7rdr6-12cer7-3 triple mutants compared with WT and cer7-3 mutant. Values represent means ± SD (n=3). Statistically significant differences between samples are indicated by different letters at P<0.01 using a one-way ANOVA and Tukey test. (C) Stem wax composition of rdr1-7rdr6-12cer7-3 triple mutants compared with WT and cer7-3 mutant. Wax composition for triple mutants is restored to WT-like ratios of major wax components. (D) Quantitative real time PCR showing that CER3 transcript levels are recovered to 80% of WT levels in the double and triple mutants. ACTIN2 was used as an internal control, and control samples were normalized to 1. Values represent means ± SD (n=3). (E) Stems of 6-week-old Col-0 WT, cer7-3, and dcl4-2cer7-3 double mutant plants showing the suppression of the cer7-3 wax-deficient phenotype in the double mutant as indicated by whitish stem. (F) Stem wax loads of dcl4-2cer7-3 double mutant compared with WT and cer7-3 mutant. Values represent means ± SD (n=3). Statistically significant differences between samples are indicated by different letters at P<0.01 using a one-way ANOVA and Tukey test. (G) Stem wax composition of dcl4-2cer7-3 double mutant compared with WT and cer7-3 mutant. Wax composition is restored to WT-like ratios of major wax components. (H) Quantitative real time PCR showing that CER3 transcript level is recovered to 100% of WT level in the dcl4-2cer7-3 double mutant. ACTIN2 was used as an internal control, and control samples were normalized to 1. Values represent means ± SD (n=3).    Table 3.3: Nomenclature and description of the dcl4 alleles dcl4 allele Alternate name Eco-type Muta- gen Description of mutation Reference dcl4-1  WS T-DNA Insertion in tenth intron Gasciolli et al. 2005 dcl4-2 CS6954; dcl4-2e C24 EMS Missense, Glu to Lys at amino acid 560 Dunoyer et al., 2005 dcl4-3  C24 EMS Missense, Pro to Leu at amino acid 1038 Dunoyer et al., 2005 dcl4-4  C24 EMS Nonsense, Gln to STOP at amino acid 186 Dunoyer et al., 2005 dcl4-5  C24 EMS Change at intron 4/exon 5 junction Dunoyer et al., 2005 60  Table 3.3: Nomenclature and description of the dcl4 alleles (continued) dcl4 allele Alternate name Eco- type Muta- gen Description of mutation Reference dcl4-6  C24 EMS Missense, Arg to Gln in PAZ domain Dunoyer et al., 2005 dcl4-7  C24 EMS Nonsense, Gln to STOP at amino acid 374 Dunoyer et al., 2007 dcl4-8  C24 EMS Missense, Gly to Asp at amino acid 610 Dunoyer et al., 2007 dcl4-9  C24 EMS Change at exon 19/intron 19 junction Dunoyer et al., 2007 dcl4-10 CS66075;  dcl4-2t Col 0 T-DNA Insertion between nucleotide 9005 and 9046 Xie et al., 2005    Figure 3.3: DCL4 is required for CER7-mediated CER3 silencing (A) Schematic representation of the DCL4 gene structure. The 5’ and 3’ untranslated regions are indicated as gray boxes, exons as white boxes, and introns as black lines. The translational start site is represented by the bent arrow. The positions of the mutations are also shown. (B) Progeny of dcl4-10(-/-)cer7-3(+/-). Double mutants (circled in red and confirmed by genotyping) do not develop true leaves and die.  61   Figure 3.4: Wild-type-like stem wax phenotypes of ago1-11cer7-1 and hen1-1cer7-1 double mutants (A) Morphology of the cer7-1 mutant (left) compared to the ago1-11cer7-1 double mutant (right). (B) Close-up of ago1-11cer7-1 double mutant. The double mutant is dwarf and sterile with short broad leaves like the ago1-11 single mutant and has a waxy stem. (C) Stems of 6-week-old cer7-1 (top) and ago1-11cer7-1 (bottom) stems showing that the ago1-11cer7-1 double mutant has a restored stem wax phenotype. (D) Wax analysis of stems of wild-type, cer7-1 and the ago1-11cer7-1 double mutant shows that wax levels are restored to that of the wild-type. Values represent means ± SE (n=4). Statistically significant differences between samples are indicated by different letters at P<0.01 using a one-way ANOVA and Tukey test. (E) The levels of all wax components are restored back to wild-type levels in the 62  ago1-11cer7-1 double mutant. (F) Quantitative real time PCR showing expression levels of CER3 in the hen1-1cer7-1 and the ago1-11cer7-1 double mutant. Even though wax loads are restored to that of the wild-type in these double mutants, CER3 transcript levels are only partially restored. ACTIN2 was used as an internal control, and control samples were normalized to 1. Values represent means ± SD (n = 4). (G, H) hen1-1 mutants are characterized by delayed flowering, reduced organ size, and curly pointed leaves compared to the wild-type. These phenotypes are also apparent in the hen1-1cer7-1 double mutant. (I) Wax analysis of hen1-1cer7-1 show that wax levels are that of the wild-type, indicating that hen1-1 can suppress the cer7-1 wax deficient phenotype. Values represent means ± SE (n=4). Statistically significant differences between samples are indicated by different letters at P<0.01 using a one-way ANOVA and Tukey test. (J) Wax composition of the hen1-1cer7-1 double mutant is similar to that of wild-type and cer7-1. Even though the overall wax loads are that of wild-type, the hen1-1cer7-1 mutant has increased levels of primary alcohols and esters and decreased levels of aldehydes like the cer7-1 mutant, but similar levels of alkanes, secondary alcohols and ketones to the wild-type. (Data contributed by Patricia Lam)  Table 3.4: Nomenclature and description of the ago alleles ARGONAUTE name Mutant allele Type of mutation AGO1 - AT1G48410 ago1-11 EMS  ago1-36 - SALK_087076 T-DNA SALK_039910 T-DNA SALK_14149 T-DNA AGO2 - AT1G31280 ago2-1 – SALK_003380 T-DNA SALK_037548 T-DNA SALK_026811 T-DNA AGO3 - AT1G31290 ago3-1 – SM_3_31520 T-DNA ago3-2 – SALK_005335 T-DNA SALK_001761 T-DNA AGO4 - AT2G27040 SALK_007523 T-DNA SALK_071772 T-DNA SAIL_248_E07 T-DNA SALK_027933C T-DNA AGO5 - AT2G27880 ago5-1 – SALK_063806 T-DNA ago5-2 – SALK_118422 T-DNA SAIL_100_C09 T-DNA  63  Table 3.4: Nomenclature and description of the ago alleles (continued) ARGONAUTE name Mutant allele Type of mutation AGO6 - AT2G32940 ago6-2 – SALK_031553C T-DNA ago6-3 – SALK_106607 T-DNA SALK_106605 T-DNA SAIL_678_D07 T-DNA AGO7 - AT1G69440 ago7-1 – SALK_037458  T-DNA SAIL_618_D07 T-DNA SALK_095997 T-DNA SALK_080533 T-DNA SAIL_182_E11 T-DNA AGO8 - AT5G21030 ago8-1 – SALK_139894 T-DNA SALK_029708C T-DNA SALK_060402C T-DNA SALK_010058 T-DNA AGO9 - AT5G21150 ago9-1 – SALK_127358 T-DNA ago9-2 –SALK_112059 T-DNA SALK_116786 T-DNA AGO10 - AT5G43810 ago10-1 – SALK_000457 T-DNA ago10-2 – SALK_047336 T-DNA SALK_076299 T-DNA SALK_117555 T-DNA (Data contributed by Patricia Lam and Nathan Eveleigh)  If HEN1 is also required for the formation of the tasiRNAs involved in CER3 silencing in Arabidopsis inflorescence stems, as we suspected, then a hen1cer7 double mutant should have a waxy stem phenotype. To test this, the viable, weak hen1-8 allele of HEN1 (Yu et al., 2010) was initially crossed with cer7-3, and hen1-8cer7-3 double mutants were identified by PCR-genotyping. Besides the delayed flowering and morphological defects characteristic of hen1 mutants, hen1-8cer7-3 double mutants were visibly wax-deficient (Figure 3.5A-B). However, GC-FID measurements of hen1-8cer7-3 stem wax accumulation demonstrated that stem wax load was partially restored and was more than two-fold greater than that of the cer7-3 mutant (Figure 3.5C). We suspect that only partial restoration was observed due to the weak nature of the hen1-8 allele used in this experiment. We therefore obtained a strong hen1 allele, hen1-1, and crossed it with 64  cer7-1 to generate the hen1-1cer7-1 double mutant. hen1-1cer7-1 double mutant exhibited stunted and delayed growth phenotypes of the hen1-1 mutant and produced very short inflorescence stems compared to the wild-type (Figure 3.4G-H). Wax analysis revealed that the wax load was restored wild-type levels in the hen1-1cer7-1 (Figure 3.4I). Although total wax levels were restored in the double mutant, stem wax composition was intermediate between wild-type and the cer7-1, with higher primary alcohol and wax ester levels and lower than wild-type levels of alkanes, secondary alcohols and ketones compared to wild-type (Figure 3.4J).  Figure 3.5: Wax deficient phenotypes of the hen1-8cer7-3 double mutant (A) The hen1-8cer7-3 double mutant has the phenotypes of both hen1 and cer7, 65  including smaller organs, delayed flowering and a shiny wax-deficient stem. (B) Close-up of 6-week-old stems of Col-0 WT, cer7-3, hen1-8 and hen1-8cer7-3 showing that hen1-8cer7-3 does not suppress the cer7-3 wax-deficient phenotype. (C) Total wax load of wild type, cer7-3, hen1-8 and cer7-3hen1-8 double mutants. Values represent means ± SE (n=4). Statistically significant differences between samples are indicated by different letters at P<0.01 using a one-way ANOVA and Tukey test. (D) Similar to the hen1-1cer7-1 double mutant, the hen1-8cer7-3 double mutant has increased levels of primary alcohols and decreased levels of aldehydes compared to wild type, but the levels are alkanes, secondary alcohols and ketones are higher than in cer7. (Data contributed by Patricia Lam)  Full restoration of the wild-type wax load by hen1-1 in the cer7-1 background and partial rescue of the cer7-3 wax deficiency by the introduction of the hen1-8 mutation is consistent with HEN1 being a conserved component of the tasiRNAs biogenesis pathway required for CER3 gene silencing.  3.2.3 Is DRB4 required for CER3 silencing? TasiRNA production also involves dsRNA-BINDING DOMAIN 4 (DRB4) protein that interacts with DCL4 in vivo, and was shown to be required in vitro for DCL4 cleaving activity (Nakazawa et al., 2007; Fukudome et al., 2011). To determine if DRB4 is essential for DCL4 function in CER3 silencing, we generated a drb4-1cer7-3 double mutant using a previously characterized drb4-1 allele (SALK_000736) that carries a T-DNA insert between the start of transcription and the first ATG of the DRB4 gene, and lacks detectable DRB4 mRNA (Adenot et al., 2006; Nakazawa et al., 2007). drb4-1cer7-3 homozygous plants germinated and developed up to cotyledon stage, but their development was arrested and they eventually died without forming true leaves (Figure 3.6), similar to the dcl4-10cer7-3 double mutant (Figure 3.3B). The inability of both double mutants to develop past the cotyledon stage supports the hypothesis that in the absence of CER7, inactivation of either DCL4 or DRB4 activity cannot be substituted by other members of the DCL or DRB families, resulting in a block in the tasiRNA biosynthetic pathway and seedling lethality. 66   Figure 3.6: DRB4 is required for CER7-mediated CER3 silencing Progeny of drb4-1(-/-)cer7-3(+/-). Double mutants (circled in red and confirmed by genotyping) have small true leaves, and eventually die.  3.2.4 CER7 disruption causes accumulation of small RNAs and repression of their target genes, including CER3 The identification of genes mutated in the war5 and war6 suppressors of cer7 as SDE5 and RDR6, respectively, and verification that mutations in DCL4, AGO1 and HEN1 genes can rescue the cer7 wax deficiency, demonstrate that a functional tasiRNA pathway is required for CER3 silencing during stem wax deposition in the course of Arabidopsis inflorescence stem development. To provide further evidence for the involvement of tasiRNA in CER3 silencing, and to determine whether these effector RNAs influence CER3 expression directly, or indirectly via PTGS of a positive regulator of CER3, small RNA populations were prepared from wild-type, cer7, cer7rdr1 and cer7sgs3 stems and subjected to next generation sequencing (RNA-seq). Our rationale was that if the silencing of a gene by small RNAs were direct, then the absence of the CER7 exosomal subunit in the cer7 mutant would result in an overabundance of the effector small RNAs and consequent down-regulation of their targets, including CER3. 67   Figure 3.7: Small RNA profiles of all the mutant lines There is no change in the relative proportion of the different sizes of small RNAs in the mutants. 21 and 24 nucleotide (nt) long small RNAs represent the most abundant size of small RNA in all genotypes. (Data contributed by Patricia Lam)  As expected, the predominant small RNA species detected in all genotypes were 21 nt and 24 nt in length, and no major changes in the relative proportion of these different classes of small RNAs were detected, an indication that mutations in cer7, cer7rdr1 or cer7sgs3 do not affect the overall biogenesis of small RNAs (Figure 3.7). Because the high degree of complementarity between the tasiRNAs and their mRNA targets allows confident predictions of tasiRNA target genes, we then used the small RNA sequences that uniquely accumulated to high levels in the cer7 mutant in comparison to wild-type, cer7rdr1 and cer7sgs3 suppressors, to detect their cognate targets by complementarity searches. Using this strategy, we initially identified 100 targets (Table 3.5), and then focused on the 20 targets that exhibited homology with the most highly abundant small RNAs in the cer7 mutant relative to the wild-type and suppressor lines. This analysis revealed that small RNAs that accumulate to the highest levels in cer7 background correspond to six genes, including CER3 (At5g57800; Figure 3.8A). 68   Figure 3.8: Analysis of small RNA-seq (A) Heat map showing the top 20 differentially expressed genes. (B) Amongst the small RNA reads in the cer7 libraries a significant proportion of the total reads align to the CER3 gene compared to the wild-type libraries (3 replicates are performed.). (C) Line graph representing the relative density of all the reads that align to CER3 and locations along the CER3 gene where the reads align; the cer7 libraries are shown in solid lines and the wild-type libraries in dashed lines (Position (bp) starts from ATG of CER3 gene.). (Data contributed by Patricia Lam)  To validate this result, we carried out quantitative real-time PCR analysis and confirmed that the expression of all six genes, identified as targets of the highest accumulating small RNAs, was dramatically reduced in the cer7 mutant (Figure 3.9). 69  Finally, using qPCR, we sought to confirm that the small RNAs found to be abundant through RNA-seq were indeed accumulating in the cer7 mutant background. We selected and determined the abundance of 2 small tasiRNA species that targeted CER3 gene: siRNA-1 (5’-UGACAUGUAACAGAUCAGGCU-3’) and siRNA-2 (5’-AACAGAUUGAUCACGAAUGGC-3’). Stem-loop RT-PCR (Varkonyi-Gasic et al., 2007) confirmed that expression of both siRNAs are dramatically increased in cer7 (Figure 3.10). Collectively, these data demonstrate that small RNAs that accumulate in the cer7 mutant in the absence of CER7 are indeed effector molecules involved in direct silencing of the identified genes, and that the expression of CER3 and the other five identified genes is controlled by both CER7 and tasiRNAs.  Figure 3.9: Transcript levels of genes found to be differentially expressed in cer7 by RNA-seq analysis. Quantitative real time PCR confirmed that expression of these six genes is down-regulated in cer7. ACTIN2 was used as an internal control, and control samples were normalized to 1. Values represent means ± SD (n = 4). (Data contributed by Patricia Lam) 70  Table 3.5: Top 100 differentially expressed small RNAs in cer7 and wild type    71  Table 3.5: Top 100 differentially expressed small RNAs in cer7 and wild type (continued)  (Data contributed by Patricia Lam) 72   Figure 3.10: Detection of siRNAs by quantitative RT-PCR Two siRNAs that were found to be accumulating in the cer7 background by RNA-seq were also detected by qPCR. (A) Levels of siRNA-1 (UGACAUGUAACAGAUCAGGCU) in different backgrounds (B) Levels of siRNA-2 (AACAGAUUGAUCACGAAUGGC) in different backgrounds. Expression of these siRNAs was found to be relatively unchanged in double mutants. Values are relative to the wild-type and represent means ±SD ( =3).  Amongst the small RNA reads from the cer7 genotype, a considerably higher proportion of the total reads aligned to the CER3 gene than observed in the wild-type (~20% vs. ~1%; Figure 3.8B). Since CER3 expression was found to be controlled by small RNAs, we were interested in determining the areas of complementarity between the small RNAs and their CER3 target. All the reads that mapped to the CER3 gene from the cer7 and the wild-type were therefore aligned with CER3 and the density of reads at each 73  position of the gene was plotted (Figure 3.8C). In the cer7 mutant background most reads show complementarity to the first 1000 base pairs in 3 distinct regions, as indicated by the peaks in the line graph, in addition to two other areas around 1200 base pairs and 2200 base pairs. In the wild-type, the plotted densities show a single peak at around 500 base pairs that corresponds to the first peak in cer7. The additional small RNAs that exhibit sequence identity with CER3 and were exclusively found in the cer7 background are likely the substrates of the exosome and are degraded in the wild-type to allow for expression of CER3.   3.3 Discussion The transition from vegetative to reproductive growth in Arabidopsis is marked by the initiation and rapid elongation of inflorescence stems. During stem growth, the maximal rate of cell elongation occurs in the top segment near the apical meristem and decreases sharply towards the base, with no elongation detected below 7 cm from the top (Suh et al. 2005). Quantitative analysis of cuticular lipid deposition demonstrated that in the course of stem elongation and after the elongation has ceased, stem wax load and composition remain constant. Thus, the biosynthesis and deposition of wax constituents on the surface of expanding epidermal cells is closely matched to surface area expansion. Our work on the cer7 mutant and cer7 suppressors provide evidence that CER7, a core subunit of the exosome, and tasiRNAs govern wax deposition on the surface of elongating Arabidopsis stems by controlling the expression of the wax biosynthetic gene CER3.  3.3.1 TasiRNAs regulate cuticular wax biosynthesis in developing inflorescence stems  We have previously shown that CER7 subunit of the exosome controls wax biosynthesis in the epidermis of developing Arabidopsis stems by positively regulating transcript levels of the wax biosynthetic gene CER3 (Hooker et al., 2007). To characterize 74  the mechanism of CER7-mediated regulation of wax production and determine the target of the CER7, we performed a screen for suppressors of the cer7 mutant, which resulted in the identification of PTGS proteins, SGS3 and RDR1. Based on this information, we hypothesized that small RNAs, most likely tasiRNAs, mediate wax deposition in elongating stems, and that levels of these small RNAs are determined by CER7 activity (Lam and Zhao et al., 2012). While SGS3 is an established component of the tasiRNA biosynthetic pathway, RDR1 has not been reported to be involved in the silencing of endogenous genes. To provide additional evidence for the involvement of tasiRNAs in regulating stem wax deposition, we investigated cer7 suppressors war5 and war6. We demonstrate that WAR5 and WAR6 genes encode SDE5 and RDR6, additional components of the tasiRNA biogenesis pathway. Based on sequence similarity with a mammalian mRNA transport protein, SDE5 has been proposed to be involved in RNA nucleo-cytoplasmic trafficking required for tasiRNA formation (Hernandez-Pinzon et al., 2007; Jauvion et al., 2010), but the exact role of the SDE5 protein has not been determined. RDR6, on the other hand, is one of the six RNA-dependent RNA polymerases in Arabidopsis, and it is well documented that RDR6 is required for the production of double stranded RNA during biogenesis of tasiRNAs involved in silencing of endogenous gene transcripts (Peragine et al., 2004; Vazquez et al., 2004; Xie and Qi, 2008).   Surprisingly, our cer7 suppressor screen resulted in the identification of two RDR proteins, RDR1 and RDR6, mutations in which rescue cer7 wax deficient phenotype. Construction of the rdr1rdr6cer7 triple mutant and quantitative analysis of its stem wax load revealed that the wax load on the surface of the triple mutant is similar to that measured on stems of the rdr1cer7 and rdr6cer7 double mutants. These results support two conclusions: (1) RDR1 functions not only in PTGS of virus-derived RNAs as previously demonstrated (Yu et al., 2003; Garcia-Ruiz et al., 2010), but also in the production of tasiRNA involved in endogenous gene regulation in plants, and (2) RDR1 75  and RDR6 play non-redundant roles in tasiRNA biosynthesis. Why two different RDR enzymes are required for this process, and how their respective roles in the formation of dsRNA differ remains to be determined.  We further investigated which of the AGO and DCL isoforms are responsible for CER3 silencing, and whether HEN1 activity is also required. The results of our reverse genetic experiments showing that hallmark players of tasiRNA formation, AGO1 and DCL4, as well as HEN1, participate in the regulation of CER3 expression, are consistent with the conclusion that tasiRNAs are the small RNA class controlling this process.  3.3.2 CER3 silencing by tasiRNAs is direct  We previously proposed that small RNA buildup in the stem epidermis in the absence of CER7-dependent exosomal activity might abolish CER3 expression directly, or indirectly by PTGS of a positive transcriptional regulator of CER3. We reasoned that if CER3 silencing is direct, then a large proportion of the tasiRNAs that accumulate in the cer7 mutant relative to the wild-type would show complementarity to CER3. RNAseq of small RNA populations from developing Arabidopsis stems revealed that this is indeed the case. This experiment identified five other genes with sequence identity to highly abundant tasiRNAs, whose expression was dramatically down-regulated in the cer7 mutant, similar to CER3. Expression of these genes is also positively regulated by CER7 and negatively regulated by tasiRNAs, as shown by quantitative real-time PCR analysis. Two of the highly repressed genes identified in cer7 encode proteins of unknown function, whereas SUI1 (At5g54940) codes for a translation initiation factor, AUX1 (At2g38120) for a well-studied auxin influx transporter, and ERD14 (At1g76180) for a dehydrin protein that accumulates in response to dehydration, cold, salt stress and ABA. AUX1 is known to play a role in root gravitropic response, root hair development, and leaf phyllotaxy (Péret et al., 2012). AUX1 function in developing stems has not been investigated, even though the AUX1 gene is highly expressed in the stem. Similarly, 76  ERD14 transcripts were detected in stems, cauline leaves, roots, and flowers, but the biochemical function and physiological roles of ERD14 and other dehydrin family members are not fully understood (Kiyosue et al., 1994).  3.3.3 How do CER7 and tasiRNAs mediate stem wax deposition?  Endogenous small RNAs have been implicated in PTGS of genes controlling diverse aspects of plant development, but in most reported cases the effector molecules are miRNAs, not tasiRNAs (Baulcombe, 2005). To date, tasiRNAs have been shown to affect the expression of only a small number of genes, including those encoding pentatricopeptide (PPR)-repeat proteins, putative MYB transcription factors, proteins of unknown function, and members of the ARF family of auxin-related transcription factors. Furthermore, the only tasiRNA with a well-defined biological role is tasi-ARF which targets ARF3 and ARF4 genes to establish leaf polarity in Arabidopsis, and controls the juvenile-to-adult transition in leaves (Paragine et al., 2004, Vazquez et al., 2004, Yoshikawa et al., 2005, Allen et al., 2005, Williams et al., 2005, Adenot et al., 2006; Hunter et al., 2006). Thus, our discovery that CER3 expression required for wax biosynthesis in developing inflorescence stems is regulated by tasiRNA is intriguing. Even though additional examples of tasiRNA regulated genes and processes are likely to emerge over time, it is clear that tasiRNAs are used infrequently in endogenous gene regulation in comparison with miRNAs. Moreover, since both types of small RNAs can function in PTGS, and tasiRNAs have more complex biogenesis than miRNAs, it is not obvious why tasiRNAs would ever be used for specific processes over miRNAs to control gene expression. Because the major difference between these two types of small RNAs is that tasiRNAs appear to have longer-range movement than miRNAs (Dunoyer et al., 2010), it has been suggested that processes that require the formation of target gene expression gradients across organs will use tasiRNAs. For example, such gradients have been demonstrated to be responsible for the dorso-ventral leaf patterning in Arabidopsis 77  and maize (Schwab et al., 2009; Chitwood et al., 2009; Nogueira et al., 2009).  We currently have no evidence that this difference in mobility between tasiRNAs and miRNAs is relevant to stem cuticular wax deposition. Our results show that rapid wax deposition in the apical region with progressive attenuation towards the stem base that results in a constant wax load along the elongating inflorescence stem does involve a gradient of CER3 expression. We propose that this CER3 expression gradient is established by the gradual basipetal decrease of CER7-dependent exosomal activity, which in turn results in increased CER3 silencing by tasiRNAs. Indeed, we have detected a basipetal decline in CER7 transcript accumulation in developing Arabidopsis stems (Lam and Zhao et al., 2012). However, how this temporal change in CER7 expression impacts CER3-specific tasiRNA abundance remains to be investigated.  3.4 Materials and methods 3.4.1 Plant material and growth conditions Arabidopsis thaliana mutant lines cer7-1 sti and hen1-1 are in the Landsberg erecta genetic background and cer7-3 and hen1-8 are in the Columbia-0 genetic background. T-DNA insertion lines sde5-5 (SALK_114489), sde5-6 (SALK_115496), rdr6-11 (CS24285), rdr6-12 (CS24286), dcl2-1, dcl3-1, dcl4-2 (CS6954), dcl4-10 (CS66075), drb4-1 (SALK_000736) and all ago mutants listed in Supplemental Table 4 are in Columbia-0 genetic background, whereas dcl1-9 is in Wassilewskija genetic background. All the T-DNA lines were obtained from the Arabidopsis Biological Resource Centre (www.arabidopsis.org). Seeds were germinated on AT-agar plates (Somerville and Ogren, 1982) and grown in soil (Sunshine Mix 4; SunGro) at 20 °C under continuous light (90 to 120 µE m-2 s-1 photosynthetically active radiation).  3.4.2 Positional cloning of suppressor mutations To map the mutated genes in suppressor lines, each suppressor line (Ler ecotype) was 78  crossed to cer7-3 (Col-0 ecotype) and genomic DNA from leaves of 40 to 50 F2 plants with the wild-type waxy stem phenotype (plants homozygous for the suppressor mutation) was collected on FTA cards (Whatman) and used to determine the linkage to simple sequence length polymorphism (SSLP) markers via PCR amplification. To further identify the location of each suppressor mutation, over 1000 plants were screened with SSLP markers until a narrow interval was obtained.  3.4.3 Genotyping DNA was extracted according to Berendzen et al. (2005). To genotype hen1-8, primers hen1-2_F and hen1-2_R were used to amplify a 585 bp PCR product. The mutation in hen1-8 allows for the cleavage of the PCR product after HpaI digestion. To genotype ago1-11, primers ago1-11_F and ago1-11_R were used to amplify a 385 bp fragment. The PCR product was then subjected to BsrI digestion, which yields an extra band for the mutant allele. T-DNA insertion lines were genotyped using LBb1.3 and gene specific primers listed in Table 3.6.  Table 3.6: Primers used in this study Primer Sequence (5’ to 3’) LBb1.3 ATTTTGCCGATTTCGGAAC LB1_SAIL GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC Spm TACGAATAAGAGCGTCCATTTTAGAGTGA SALK_114489 LP  TGTGAAGAAGGTAACCCGATG SALK_114489 RP ATTGGACGATTGTTTCACAGC SALK_115496C LP TCAATCTCATCAACCCGAATC SALK_115496C RP AGAAAGGAGACCTGGAGTTGC SALK_000736 LP AGGCGATTCTCTTCGAATTTC SALK_000736 RP TTGTAGGCAACATCAATTCCC rdr6-11(CS24285) LP  ATATTTACGATACTGTCCCTG rdr6-11(CS24285) RP  CGCGGAGATATGAGCAATC rdr6-12 (CS24286) LP CTTCTGCATTCATCACAAGG rdr6-12 (CS24286) RP CTCAGTCAACTGAAACTGGT cer7-3_LP2 CTGGCTGTTCTGGTTGGAGT 79  Table 3.6: Primers used in this study (continued) Primer Sequence (5’ to 3’) cer7-3_RP2 CATTTCCAGAGCCGTTCATT hen1-2_F GAATGGAGGCGGCTTTTT hen1-2_R ACGTTGCAAGCTTCCTTGTT ago1-11_F TAGGCAGGAGCTCATTCAGG ago1-11_R CGGATGGCATCAAGTTCATA ACTIN2-F TCCCTCAGCACATTCCAGCAGAT ACTIN2-R AACGATTCCTGGACCTGCCTCATC CER3-qPCR-F CTCATCTCCTGTTCCACATCC CER3-qPCR-R TCAATGGAACACCAGCTACG SALK_106607 LP  AGGCTGCGAAAATGCTTAAA SALK_106607 RP  GAAATAGTGATGCCCGGAAA SALK_000457 LP CTGGTAAACGGGCAGATTGT SALK_000457 RP GTCCCTCGACAATTTTGCAT SALK_087076 LP AATCAGGTATATTCCGGTGGG SALK_087076 RP CAATGAGGCTTTATCACCAGC   SALK_003380 LP TGTGGAAGAGGAATTGATTGG   SALK_003380 RP AGCACCAATGAACATGACCTC   SM_3_31520 LP GGAACCTTACGACAAAGGGAG SM_3_31520 RP TGGTTTGCTTGTACCTATCGC SALK_005335 LP CGATAGTCCCGACTGACTCTG SALK_005335 RP AAACAGAGAGACAGTGGACGC SALK_007523 LP TTTTGGTTCCAATTGCATCTG SALK_007523 RP CCCACAAAATCAAAGTGAAGAAG SALK_071772 LP TGGTTGGTTTGCTTTGATTTC SALK_071772 RP CAAGTGATTTCTGCGGAGAAG SAIL_248_E07 LP GTGCATCTGTCTTTAGCCACC SAIL_248_E07 RP AAAAGCACACTCACAAGACCC SALK_027933C LP TGGCTTGGCTAACTACGTACG SALK_027933C RP CACAAAAAGTCACAAACCCAG SALK_063806 LP GGATTGTCTCTCAGTGTTGCC SALK_063806 RP TGAGCATTTGCAACTGATCAG SALK_118422 LP CCTCGATTGAAGCTCGTGTAC SALK_118422 RP TTCAAGGCAACATTTTCCATG SALK_031553C LP GTCTGGGAAACCCAAAGAGAC SALK_031553C RP ACCGGAAGAACTACCACCATC SALK_037458 LP  GTATTCTGGAGGCAGAGGAGC  80  Table 3.6: Primers used in this study (continued) Primer Sequence (5’ to 3’) SALK_037458 RP CTCCTCCTTTTCTTTTGCACC SALK_139894 LP TCCCTGTTTTGGTTCCTTTTC SALK_139894 RP TCCTGTTCCTGTTTCCATGAC SALK_127358 LP ATGAGTGGCCATTGTCTTGAG SALK_127358 RP TTTCCTTTTTGCTTGTGGATG SALK_112059 LP CAAGTTCTTGGAGGTCGTCTG SALK_112059 RP TGGAAATCGTAGGTTGTGAGC SALK_047336 LP AGAGAACGGGGAAGAGTCAAG SALK_047336 RP TTTCGTCATATTTGCGGGTAC siRNA1-RT GTCGATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCCTG siRNA1-F GCGGCGGTGACATGTAACAGAT siRNA2-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCCATT siRNA2-F GCGGCGGAACAGATTGATCACG stemloop-R GTGCAGGGTCCGAGGT  3.4.4 Cuticular wax extraction and analysis Cuticular waxes were extracted from 4- to 6-week-old Arabidopsis stems. Stems were immersed for 30 s in chloroform containing 10 µg of n-tetracosane (C24 alkane), which was used as an internal standard. After extraction, samples were blown down under nitrogen and re-dissolved in 10 µL N, O-bis (trimethylsilyl) trifluoroacetamide (Sigma) and 10 µL pyridine (Fluka). Samples were derivatized for 1 h at 80 °C. After derivatization, excess N, O-bis (trimethylsilyl) trifluoroacetamide and pyridine were removed by blowing down under nitrogen, and samples were dissolved in 50 µL of chloroform. Wax analyses were performed on an Agilent 7890 A gas chromatograph equipped with a flame ionization detector and an HP-1 methyl siloxane column. Gas chromatography was carried out with oven temperature set at 50 °C for 2 min, and then raised by 40 °C min–1 to 200 °C, held for 1 min at 200 °C, raised by 3 °C min–1 to 320 °C, and held for 15 min. 1 μL of each sample was injected and analyzed using a 2.7:1 split. 81  Quantification of wax components was carried out by comparing their flame ionization detector peak areas to that of the internal standard. Stem surface area was calculated by photographing stems prior to wax extraction, measuring the number of pixels, converting the values to cm2 and multiplying by π.  3.4.5 Quantitative RT-PCR RNA was extracted from plant tissue using TRIzol (Invitrogen) as per the manufacturer’s protocol. RNA quantification was performed using a NanoDrop 8000 (Thermo Scientific). 1 µg of total RNA was treated with DNaseI (Fermentas) and then used for first strand cDNA synthesis using iScript RT supermix (Bio-Rad). Quantitative RT-PCR was performed in 20 µL reactions using iQ SYBR green supermix (Bio-Rad) and run on the iQ5 real-time PCR detection system (Bio-Rad). Data were analyzed using the Pfaffl method (Pfaffl, 2001), and control samples were normalized to 1.  3.4.6 Isolation of RNA for RNA-seq 300 mg of tissue from the top 3 cm of Arabidopsis WT Col-0, cer7-3, rdr1-7cer7-3, sgs3-13cer7-3 stem was collected and frozen in liquid nitrogen. Tissues were ground to a fine powder with a pestle. 5 mL of TRIzol (Invitrogen) was added to each sample and incubated at room temperature for 5 min. 1 mL of chloroform was added and samples were mixed by shaking and incubated at room temperature for 2-3 min. Samples were centrifuged at 3,220 g at 4 °C for 30 min. After centrifugation, 3.5 mL of the top phase was transferred to a fresh tube containing 5 mL isopropanol. RNA was precipitated at room temperature for 10 min before centrifugation at 3,220 g at 4 °C for 30 min. The pellet was washed with 75% ethanol and centrifuged at 3,220 g at 4 °C for 15 min. The pellet was dried at room temperature for 10 min and the RNA was suspended in 50 µL of water. To help dissolve the pellet, RNA was placed at 60 °C for 10 min. Concentration and purity of RNA was determined using a NanoDrop 8000 (Thermo Scientific). 82  3.4.7 Small RNA extraction and library construction 20-25 µg of purified total RNA was denatured in 2X small RNA loading dye (80% formamide, 0.1% xylene, 0.1% bromophenol blue) at 70 °C for 10 min. RNA was then separated on a 15% polyacrylamide gel run in 0.5X Tris/Borate/EDTA (TBE) buffer.  Small RNAs approximately 15-40 nt in length were excised from the gel using a clean razor blade. RNA was recovered by breaking the gel fragments in 0.4 M NaCl and incubating overnight at 4°C, then precipitating with 1 µL glycogen, 1/10 volume 3 M NaOAc (pH5.2) and two volumes of ethanol at -20 °C for 6 hrs. The RNA was centrifuged at 12000 g at 4 °C for 15 min, washed with 70% ethanol and t air-dried.  The pellet was dissolved in 6 µL DEPC-treated water. Small RNA library construction was done using the Illumina Tru-Seq Small RNA Sample Prep Kit as per the manufacturer’s protocol.  3.4.8 Bioinformatic analysis of small RNAs The quality of the libraries was initially assessed using FastQC; all samples had high overall quality. Sequence data (in fastq format) was processed as follows using a combination of publicly available tools and custom UNIX scripts. The Illumina adapters were removed from the raw sequences using the "fastx_clipper" tool from the FASTX-Toolkit (version 0.0.13) (Blankenberg et al. 2010), and reads with length shorter than 5 nt were discarded. Sequence alignment was carried out using the BOWTIE aligner (version 0.12.8) (Langmead et al. 2009) against the latest Arabidopsis thaliana reference genome (TAIR10), using the default parameters of the n-alignment mode. All ten libraries reported alignment in > 98% of all reads. After using a custom perl script to convert the TAIR10 genome annotations from GFF to GTF format, counts of alignments to genome features were determined using the "htseq-count" tool from the HTSeq package (version 0.5.3p9) (Anders and Huber, 2010), under the "intersection-nonempty" mode. The number of single-mapping reads that overlap each annotated genome feature from the 83  TAIR10 annotations release (Lamesch et al. 2011) was counted and used as input for statistical analysis of differential expression.  Differential expression analysis of RNA-seq read alignment counts was performed using the software package EdgeR (Robinson et al., 2009, McCarthy et al., 2012) from the Bioconductor project (Gentleman et al., 2004). A general linear model (GLM) approach was used to locate features that differed between any of the four groups with the following criteria: FC > 2 between at least two groups, P < 0.01, and FDR < 0.001.  To include reads that did not map to previously annotated features, an analysis of differential expression was also carried out on counts of unique sequence reads, taken from all ten libraries combined. This was done using a combination of the "fastx_collapser" tool from the FASTX-Toolkit, and a custom perl script to output a file of unique sequences and counts for each library. Analysis of differential expression was carried out as above; it was found that all top DE sequences mapped to the top DE genes, with the majority aligning to the CER3 gene. The reads from the WT and cer7 libraries were aligned to the CER3 gene using megablast (Zhang et al., 2000), and the density of reads at each position of the gene was plotted using R (CRAN).            84  CHAPTER 4: THE SUPERKILLER COMPLEX IS REQUIRED FOR CER7-DEPENDENT EXOSOME ACTIVITY IN CONTROLLING CUTICULAR WAX BIOSYNTHESIS IN ARABIDOPSIS 4.1 Introduction The cuticle is an extracellular hydrophobic structure coating aerial surfaces of all land plants that serves as a primary barrier in restricting transpirational water loss, and provides protection from environmental stresses (Kunst and Samuels, 2003). It also plays an important role in drought stress signaling (Wang et al., 2011) and prevents organ fusions during plant development (Sieber et al., 2000). The two major cuticle constituents are cutin, an aliphatic polyester that functions as a structural scaffold, and cuticular waxes, deposited on the surface or embedded in the cutin matrix. Cuticular waxes are mixtures of very-long-chain fatty acids and their derivatives, including primary alcohols and wax esters that are produced by the acyl reduction pathway, as well as aldehydes, alkanes, ketones and secondary alcohols that are generated through the decarbonylation pathway (Samuels et al., 2008). They also usually contain small amounts of cyclic components such as triterpenoids and sterols (Jetter et al., 2006). Formation of wax components has been well-studied and enzymes catalyzing wax biosynthetic reactions have been identified and characterized (Bernard and Joubes, 2013). Transport of cuticular waxes to the cuticle requires ATP-binding cassette transporters and lipid transfer proteins (Pighin et al., 2004; Bird et al., 2007; Debono et al., 2009; Kim et al., 2012), but in contrast to wax biosynthesis, an understanding of this process is incomplete. Similarly, relatively little is known about the regulation of wax production. Wax biosynthesis can be induced by environmental stress and hormone treatment (Kosma et al., 2009), and several transcriptional regulators have been shown to affect wax accumulation. These include an APETALA2 (AP2) domain-containing transcription factor WAX INDUCER1/SHINE1, whose over-expression results in glossy leaves with an 85  increased wax load (Aharoni et al., 2004; Kannangara et al., 2007); MYB30, expressed in response to bacterial pathogen attack, which promotes the transcription of the fatty acid elongase complex genes (Raffaele et al., 2008); MYB96, which directly activates the promoters of several wax biosynthetic genes upon abscisic acid treatment or drought stress (Seo et al., 2011); and an AP2/Ethylene Responsive Factor type transcriptional repressor, DECREASE WAX BIOSYNTHESIS (DEWAX), which regulates wax accumulation during diurnal light/dark cycles and is involved in the organ-specific regulation of total wax loads on plant surfaces (Go et al., 2014; Suh and Go, 2014). A R2R3-type MYB94 transcription factor activates Arabidopsis cuticular wax biosynthesis by binding directly to the promoters of WSD1, KCS2, CER2, FAR3, and ECR genes (Lee and Suh, 2014). MYB94 was found to be highly induced in response to drought, ABA, sodium chloride, and mannitol (Lee and Suh, 2014). Besides transcription factors, cuticular wax accumulation is also controlled by two additional proteins: an E3 ubiquitin ligase encoded by the CER9 gene that acts as a negative regulator of both wax and cutin monomers (Lu et al., 2012), and CER7/RRP45B core subunit of the exosome that regulates wax production during inflorescence stem development (Hooker et al., 2007). The exosome is an evolutionarily conserved multi-protein complex that mediates cellular RNA processing and degradation in the 3’ to 5’ direction in both the nucleus and the cytoplasm (Houseley et al., 2006). Extensive studies of the yeast and human exosome complex indicated that all nine subunits were required for its integrity and function (Almang et al., 1999a,b; Liu et al., 2006). In light of this view of the eukaryotic exosome complex, the discovery that a core subunit of the exosome participates in a specialized plant process was surprising. It suggested that the plant exosome might have a unique organization with individual subunits performing distinct functions (Hooker et al., 2007). This idea was further investigated by detailed transcriptome analyses of the plant exosome core subunit mutants of Arabidopsis, which demonstrated that two additional subunits exhibited functional specialization. Specifically, 86  the RRP41 subunit was essential for the development of the female gametophyte, whereas the RRP4 subunit was required for embryogenesis (Chekanova et al., 2007). This work also demonstrated that, unlike in yeast and metazoa where the intactness of the exosome complex is essential for function, the loss of the CSL4 subunit is not detrimental to plant growth and development (Chekanova et al., 2007). In rapidly elongating inflorescence stems, wax load and composition remain fairly constant (Suh et al., 2005), indicating that the biosynthesis of wax constituents is closely coordinated with surface area expansion. Previously, we have shown that wax deposition is positively regulated by CER7 and negatively regulated by tasiRNAs that affect transcript levels of the wax biosynthetic gene CER3 (Lam et al., 2012, 2015). Over-accumulation of CER3-related tasiRNAs in the cer7 mutant demonstrated that CER7 controls tasiRNA levels. However, how CER7 activity impacts CER3-specific tasiRNA abundance and whether or not CER3 expression is regulated by additional factors besides tasiRNAs remains to be determined. In an attempt to address these questions, we characterized two further cer7 suppressor mutants, war1 and war7, both of which can restore the decreased CER3 transcript levels and the associated wax deficiency observed in the cer7 mutant to wild type. Positional cloning of WAR1 and WAR7 genes revealed that they encode components of the SUPERKILLER (SKI) complex, known to be required for the cytoplasmic activities of the exosome in yeast (Houseley et al., 2006, Halbach et al., 2013). Our results indicate that the SKI complex also plays a role in the CER7-mediated control of wax deposition on developing Arabidopsis stems.  4.2 Results 4.2.1 Identification of AtSKI3 as a regulator of wax biosynthesis To gain a better understanding about the specific role of CER7 in controlling CER3 transcript levels and to identify factors that participate in this process alongside tasiRNAs (Lam et al., 2012, 2015), we characterized two additional war mutants, war1 and war7, 87  that almost completely suppressed the stem wax deficiency of the cer7 mutant (Figure 4.1A). To pinpoint the mutation in war1-3 that restores cer7-1 stem wax load to wild- type, war1-3cer7-1 suppressor line was first backcrossed to cer7-1. The approximately 3:1 segregation ratio of the glossy mutant to the waxy wild type (631:205;  2=0.26, P > 0.5) in the F2 population suggested that wax restoration was caused by a recessive mutation in a single gene. An outcross of war1-3cer7-1 in the Lansbery erecta (Ler) background to the Arabidopsis Columbia-0 (Col-0) cer7-3 mutant was performed to create a mapping population for the identification of WAR1 gene. Rough mapping using 17 F2 plants that displayed a waxy stem phenotype indicated that the mutation in the war1-3 lies on chromosome 1 between the markers of T4O12 and F18B13 (Figure 4.1B). An enlarged F2 population containing 714 waxy plants was then used for fine mapping that narrowed down the war1-3 mutation to a 120-kb region flanked by the markers F14G6 and F7O12, which contains 29 annotated genes. DNA sequencing of this region revealed a C-to-T single nucleotide mutation at position 491 in the second exon of At1g76630, predicted to result in a premature stop codon (Figure 4.1C). Mutations in the At1g76630 gene were also detected in another two war1 alleles, uncovered from the same suppressor screen. The war1-2 mutant contains a single bp (C) deletion at position 1952 in the 9th exon, leading to a frame shift and an early stop codon at position 1957. The war1-1 mutant has a G-to-A mutation at position 148 of the first intron, which may affect the mRNA processing. These data indicate that WAR1 is At1g76630 (Figure 4.1C). The At1g76630 gene encodes a predicted polypeptide of 1,168 amino acids. Sequence analysis with the protein domain prediction tool SMART (http://smart.embl-heidelberg.de/) revealed that the WAR1 protein has six tetratricopeptide repeat (TPR) domains clustered at the N terminus and exhibits 23% identity and 40% similarity with the Saccharomyces cerevisiae SUPERKILLER3 (SKI3) C-terminal arm (Figure 4.5A). To confirm that mutations in AtSKI3 could restore wax 88  deficiency of the cer7, we obtained two T-DNA insertion alleles, GB-140B07 and Salk_099525, which we designated ski3-4 and ski3-5. T-DNA insertion sites in the 11th intron of AtSKI3 in the ski3-4 and in the 19th exon in the ski3-5, respectively, were established by DNA sequencing (Figure 4.1C). Semi-quantitative reverse transcription (RT)-PCR using total RNA extracts of the whole stems demonstrated that the overall abundance of the AtSKI3 mRNA in ski3-4 was similar to wild-type, whereas ski3-5 only retained trace amount of mRNA, implying that the gene disruption in ski3-5 is more severe (Figure 4.1D). In contrast, all three original war1 suppressor mutants, war1-1cer7-1, war1-2cer7-1 and war1-3cer7-1 have only slightly lower AtSKI3 mRNA levels than the wild type. Homozygous ski3-4 and ski3-5 single mutants do not exhibit any growth defects. However, when crossed into the cer7-3 background, both ski3-4 and ski3-5 can rescue the stem wax phenotype of the cer7 mutant like other war1/ski3 alleles (Figure 4.1A). Stem wax analyses by gas chromatography (GC) demonstrated that all war1cer7-1 suppressors and ski3cer7-3 double mutants contain considerably higher wax loads than the cer7 single mutants (Figure 4.2A). Additionally, in these lines, the cer7 wax composition with dramatic reduction in alkane pathway components was also restored to wild-type. The CER3 transcript accumulation, examined by real time PCR, was also mostly or partially re-established to wild-type levels (Figure 4.2B). To further corroborate the conclusion that the mutation in AtSKI3 is responsible for the recovered waxy phenotype in the suppressors, a transgene complementation of the war1-3cer7-1 suppressor line with the genomic DNA fragment containing AtSKI3 with its native promoter and fused with GFP was carried out. As expected, the introduction of the AtSKI3::GFP converted wild-type waxy stems of war1-3cer7-1 to glossy bright green cer7-like stems, indicative of successful complementation. Taken together all these data demonstrate that WAR1 is AtSKI3. The war1 mutants were therefore renamed ski3 (Table 4.1). 89    Figure 4.1: Stem phenotypes of mutants, map-based cloning of WAR1, AtSKI3 gene structure, and transcript levels of AtSKI3 gene in war1 and ski3 mutants (A) Stems of 6-week-old Landsberg erecta (Ler) wild-type (WT), cer7-1, war1cer7-1, Columbia (Col) 0 WT, cer7-3, and ski3cer7-3 mutant plants showing the suppression of the cer7 wax-deficient phenotype in the war1cer7-1 and ski3cer7-3 mutants as indicated by glaucous stems. (B) Schematic representation of the chromosomal location of war1 as determined by fine-mapping. The markers used for mapping and the number of recombinants are indicated. (C) Schematic representation of the AtSKI3 gene structure. The exons are indicated as white boxes and introns as black lines. The translational start site is represented by the bent arrow. The positions and types of the mutations in ski3 alleles are also shown. (D) RT-PCR analysis of AtSKI3 transcript levels in stems of war1 and ski3 mutants compared with the corresponding wild type.   90  Table 4.1: Nomenclature and description of the ski3 alleles ski3 allele Alternate name Eco- type Muta- gen Description of mutation Reference ski3-1 war1-1 Ler EMS G->A mutation in first intron at nucleotide 148 from ATG This work ski3-2 war1-2 Ler EMS C deletion in 9th exon at nucleotide 1952, causing Ser to Phe at amino acid 410 and Leu to STOP at amino acid 411 This work ski3-3 war1-3 Ler EMS Nonsense, Gln to STOP at amino acid 131 This work ski3-4 GK140B07 Col  T-DNA Insertion in 11th intron This work ski3-5 SALK_099525 Col T-DNA Insertion in 19th exon This work   Figure 4.2: Analyses of wax loads and CER3 transcript levels of war1cer7-1 and ski3cer7-3 mutants (A) Stem wax loads of war1cer7-1 and ski3cer7-3 double mutants compared with their corresponding WT and cer7 single mutant. Values represent means ± SD ( =3). (B) CER3 transcript levels of war1cer7-1 and ski3cer7-3 double mutants compared with their corresponding WT and cer7 single mutant. ACTIN2 was used as an internal control, and control samples were normalized to 1. Values represent means ± SD ( =3). 91  4.2.2 Identification of WAR7 as AtSKI2, the second component of the SKI complex Another mutation that rescues the cer7-related stem wax deficiency, war7, was mapped to Chromosome 3 in the vicinity of marker T6H20 (Figure 4.3A). Since AtSKI2, which encodes another component of the SKI complex is located in this region (Jolivet et al., 2006; Dorcey et al., 2012), and the SKI complex is conserved across many uni- and multi-cellular organisms, including yeast, Drosophila, Arabidopsis and humans, we suspected that mutations in AtSKI2 (At3g46960), just like those in AtSKI3, might be able to restore the wax phenotype of the cer7 mutant. We therefore sequenced AtSKI2 in the war7-1cer7-1 and war7-3cer7-1 suppressors. Comparisons with the wild-type sequence revealed nonsense C to T mutations at nucleotide 6909 of AtSKI2 in war7-1 and at nucleotide 2493 in war7-3. Both these mutations produce a premature stop codon that would truncate the protein and likely inactivate it (Figure 4.3B). In contrast, war7-2 contains a G to A substitution at position 1 of the 8th intron of the AtSKI2 gene, which might lead to mRNA splicing and protein translation defects. Hence, the war7 alleles will be hereafter referred to as ski2 (Table 4.2).  Table 4.2: Nomenclature and description of the ski2 alleles ski2 allele Alternate name Ecotype Mutagen Description of mutation Reference ski2-1 SALK_118579 Col T-DNA Insertion in 9th exon (Dorcey et al., 2012) ski2-2 war7-1 Ler EMS Nonsense, Arg to STOP at amino acid 1297 This work ski2-3 war7-2 Ler EMS g->a change at 8th exon/8th intron junction This work ski2-4 war7-3 Ler EMS Nonsense, Gln to STOP at amino acid 418 This work ski2-5 SALK_141579 Col T-DNA Insertion in 3rd intron This work ski2-6 SALK_122393 Col T-DNA Insertion in 23rd exon This work ski2-7 SALK_063541 Col T-DNA Insertion in 23rd exon This work  We identified three additional alleles of AtSKI2 in the T-DNA insertional mutant 92  collections: ski2-5 (SALK_141579), ski2-6 (SALK_122393) and ski2-7 (SALK_063541). The T-DNA insertion was within the third intron in the ski2-5 allele, and in the last exon in both ski2-6 and ski2-7. RT-PCR analysis using stem RNA demonstrated that AtSKI2 mRNA levels in war7-2 and ski2-5 were similar to the wild type, reduced in war7-1, war7-3 and ski2-7, and undetectable in ski2-6 (Figure 4.3C). All of the homozygous ski2 T-DNA mutants were indistinguishable from the wild type with respect to their stem wax loads. However, when they were crossed into the cer7-3 background, they could restore the cer7-3 stem wax phenotype to wild type (Figure 4.4A). Wax accumulation and composition was verified by GC analysis that confirmed that all war7cer7-1 suppressors and ski2cer7-3 double mutants displayed wild-type-like wax profiles (Figure 4.4B). Real time PCR also demonstrated wild-type CER3 transcript levels in these suppressor and double mutants (Figure 4.4C). These data indicate that WAR7 is AtSKI2.   Figure 4.3: Map-based cloning of WAR7, AtSKI2 gene structure, and AtSKI2 transcript levels in war7 and ski2 mutants (A) Schematic representation of the chromosomal location of war7 as determined by rough-mapping. The markers used for mapping and the number of recombinants are indicated. (B) Schematic representation of the AtSKI2 gene structure. The exons are indicated as while boxes and introns as black lines. The translational start site is represented by the bent arrow. The positions and types of the mutations in ski2 alleles are also shown. (C) RT-PCR analysis of AtSKI2 transcript levels in stems of war7 and ski2 mutants compared with the corresponding wild type. 93   Figure 4.4: Analyses of stem wax phenotypes, wax loads and CER3 transcript levels of war7cer7-1 and ski2cer7-3 mutants (A) Stems of 6-week-old Ler WT, cer7-1, war7cer7-1, Col 0 WT, cer7-3, and ski2cer7-3 mutant plants showing the suppression of the cer7 wax-deficient phenotype in the war7cer7-1 and ski2cer7-3 mutants as indicated by glaucous stems. (B) Stem wax loads of war7cer7-1 and ski2cer7-3 double mutants compared with their corresponding WT and cer7 single mutant. Values represent means ± SD ( =3). (C) CER3 transcript levels of war7cer7-1 and ski2cer7-3 double mutants compared with their corresponding WT and cer7 single mutant. ACTIN2 was used as an internal control, and control samples were normalized to 1. Values represent means ± SD ( =3).  Sequence alignment showed that AtSKI2 and yeast SKI2 share 43% identity and 59% similarity over 1000 amino acids at the C terminus (Figure 4.5B), mainly covering the 94  whole helicase region that is essential for RNA binding and ATP hydrolysis (Halbach et al., 2013). However, the N-terminus of the yeast SKI2 containing four SKI3-interacting segments that are necessary and sufficient for the interactions with SKI3 and SKI8 in yeast, does not exhibit significant homology with the Arabidopsis AtSKI2. ScSKI21347128711Helicase regionN-terminal regionScSKI8 39732111ScSKI31168143211C-terminal ArmN-terminal ArmABCAtSKI2AtSKI3AtSKI8InsertionInsertion Figure 4.5: Comparison of structures of SKI proteins in yeast and Arabidopsis (A) Domain structure of the subunit SKI3 in yeast and Arabidopsis. Individual TPR motifs are indicated as blue boxes. (B) Domain structure of the subunit SKI2 in yeast and Arabidopsis. The N-terminal region if shown in red, the helicase region in orange and the insertion domain in yellow. (C) Domain structure of the subunit SKI8 in yeast and Arabidopsis. WD40 motifs are indicated in green rectangles.  4.2.3 AtSKI8, the third component of the SKI complex, is also necessary for stem wax deposition in Arabidopsis In yeast and metazoan cells, a third component of the SKI complex named SKI8 is indispensible for the cytoplasmic functions of the exosome (Brown et al., 2000; Orban and Izaurralde, 2005; Zhu et al., 2005; Dorcey et al., 2012). In addition, distinct from SKI2 and SKI3, SKI8 also plays an important role in meiotic DNA recombination in 95  yeast (Arora et al., 2004) and functions as a component of the nuclear RNA polymerase II-associated factor 1 complex in both humans (Zhu et al., 2005) and Arabidopsis (Dorcey et al., 2012) in setting histone marks during transcription. To determine whether AtSKI8 works together with AtSKI2 and AtSKI3 to regulate stem wax biosynthesis in Arabidopsis, we obtained two T-DNA insertional mutants in the AtSKI8 gene from the Arabidopsis Biological Resource Center and employed them for reverse genetic studies. The T-DNA insertion in the ski8-6 (SALK_060207) is in the 5’ UTR, while the ski8-7 (SALK_139885) harbours an insertion in the second exon that strongly affects AtSKI8 mRNA level (Figure 4.6A-B; Table 4.3). Both ski8-7 and to a lesser extent ski8-6, display dwarf and bushy phenotypes (Figure 4.7A-B), and the ski8-7 mutation also results in flower defects (Dorcey et al., 2012) that are absent from the ski8-6. When ski8-6 and ski8-7 were crossed into the cer7-3 background, the resulting double mutants showed dramatically improved wax accumulation on inflorescence stems compared to cer7-3, and substantially restored CER3 transcript levels (Figures 4.7C-E). Based on these data, we conclude that in addition to AtSKI3 and AtSKI2, AtSKI8 also participates in the CER7-mediated regulation of stem wax biosynthesis, perhaps by interacting in a complex with AtSKI2 and AtSKI3.  Figure 4.6: Gene structure and transcript levels of AtSKI8 in ski8 mutants (A) Schematic representation of the AtSKI8 gene structure. The 5’ and 3’ untranslated regions are indicated as gray boxes, exons as while boxes, and intron as black line. The translational start site is represented by the bent arrow. The positions of the T-DNA insertion in ski8 alleles are also shown. (B) RT-PCR analysis of AtSKI8 transcript levels in stems of ski8 mutants compared with wild type. 96  Table 4.3: Nomenclature and description of the ski8 alleles ski8 allele Alternate name Eco- type Muta- gen Description of mutation Reference ski8-1 vip3-1 Ler T-DNA Insertion in second exon (Zhang et al., 2003) ski8-2 vip3-2 SALK_083364 Col T-DNA Insertion in first exon (Jolivet et al., 2006) ski8-3 vip3-3 SALK_117732 Col T-DNA Insertion in second exon (Jolivet et al., 2006) ski8-4 vip3zwg Sav-0 Natural genetic variation Deletion of nucleotides 861-867 of the ORF (Dorcey et al., 2012) ski8-5 boq-1 Col EMS Nonsense, Gly to Glu at amino acid 219 (Takagi and Ueguchi, 2012) ski8-6 SALK_060207 Col T-DNA Insertion in first exon This work ski8-7 SALK_139885 Col T-DNA Insertion in second exon This work   Figure 4.7: Analyses of mutant phenotypes, wax loads and CER3 transcript levels of ski8cer7-3 mutants (A) 6-week-old Col 0 WT, cer7-3, ski8-6 and ski8-7cer7-3 mutants. (B) 6-week-old Col 0 WT, cer7-3, ski8-7, and ski8-7cer7-3 mutants (C) Stems of 6-week-old Col 0 WT, cer7-3, and ski8cer7-3 mutant plants showing the suppression of the cer7 wax-deficient phenotype ski8cer7-3 mutants as indicated by 97  glaucous stems. (D) Stem wax loads of ski8cer7-3 double mutants compared with Col 0 WT and cer7 single mutant. Values represent means ± SD ( =3). (E) CER3 transcript levels of ski8cer7-3 double mutants compared with Col 0 WT and cer7 single mutant. ACTIN2 was used as an internal control, and control samples were normalized to 1. Values represent means ± SD ( =3).  4.2.4 AtSKI3 is localized to the cytoplasm and granular cytoplasmic foci To investigate if AtSKI3 functions as a component of the SKI complex in the cytoplasm, similar to ScSKI3, I generated an AtSKI3-GFP fusion and expressed it under control of the putative 5’ AtSKI3 native promoter. The introduction of this transgene into the war1-3cer7-1 mutant results in the conversion of its waxy stem into a wax-deficient stem, indicative of restored AtSKI3 function and correct cellular localization of the AtSKI3-GFP protein. Green fluorescence signal was detected in the cytoplasm in the root tissues (Figure 4.8A), as well as in cytoplasmic granules of unknown function (Figure 4.8B).   Figure 4.8: Localization of AtSKI3 by confocal microscopy (A) AtSKI3:GFP is localized to the cytoplasm (bar = 10  m) (B) AtSKI3:GFP is also localized to the cytoplasmic granules  4.2.5 AtSKI3 cannot rescue yeast ski3xrn1; ScSKI3 cannot complement war1-3cer7-1 Sequence alignments showed that the 500 amino acids at the AtSKI3 N-terminus are 98  homologous to the 14-21 TPR motifs of ScSKI3 C-terminal arm (Figure 4.5A). Conversely, the TPRs 28-33 of ScSKI3, whose deletion causes lethality in a yeast strain lacking XRN1 due to the loss of its ability to interact with ScSKI2 and ScSKI8, were not identified in AtSKI3 (Wang et al., 2005). This difference between yeast and Arabidopsis SKI3 proteins may lead to distinct organizations of their respective SKI complexes. To explore whether AtSKI3 can substitute for the ScSKI3 by interacting with the ScSKI2 and ScSKI8 in yeast cells, I generated a construct containing the AtSKI3 genomic region driven by the ScSKI3 promoter and introduced it into the yeast ski3xrn1 mutant (Johnson and Kolodner, 1995). The AtSKI3 failed to rescue the yeast ski3xrn1 double mutant (Figure 4.9A), indicating that AtSKI3 cannot replace ScSKI3 function in yeast. As a positive control, the ScSKI3 successfully complemented the yeast ski3xrn1 double mutant, allowing growth and formation of colonies. I also wanted to test whether ScSKI3 can replace AtSKI3 in regulating stem wax deposition, possibly through cooperation with AtSKI2 and AtSKI8. I thus cloned the ScSKI3 open reading frame and expressed it under the control of the native AtSKI3 promoter, which was previously used to drive the AtSKI3 gene to complement the war1-3cer7-1 mutant. The transgene was transformed into the war1-3cer7-3 line and stem wax loads of transformants were compared with the wild type and the cer7 mutant. I found that transgenic lines grew the same as war1-3cer7-3 and their stems were still glaucous and produced wild-type amount of wax, implying that ScSKI3 failed to substitute for AtSKI3 in controlling wax biosynthesis on Arabidopsis inflorescence stems (Figure 4.9B-C).  4.2.6 AtSKI complex is required for the tasiRNAs to degrade CER3 mRNA In yeast and metazoan cells, SKI complex functions together with exosome in 3'-5' RNA degradation. To investigate if the SKI complex components participate alongside CER7 in the exosome-controlled destruction of tasiRNAs that trigger CER3 mRNA turnover during stem wax deposition, I examined the abundance of two small RNA species, siRNA-1 (5’-UGACAUGUAACAGAUCAGGCU-3’) and siRNA-2 99  (5’-AACAGAUUGAUCACGAAUGGC-3’) that accumulate to high levels in the cer7 mutant (Lam et al., 2015), and down-regulate CER3 expression and stem wax biosynthesis, but are virtually undetectable in the wild type.   Figure 4.9: Complementation tests between yeast SKI3 and Arabidopsis SKI3 (A) AtSKI3 cannot complement yeast ski3 mutant. (B) ScSKI3 cannot complement war1cer7-1 mutant. T1-1: transgenic line 1-1.  In comparison with the cer7 mutant lacking exosomal ribonuclease activity that contained very high levels of the two tasiRNA species of interest, the levels of these two tasiRNAs were considerably lower in the ski3cer7-3, ski2cer7-3 and ski8cer7-3 double mutants (Figure 4.10A-B), as well as in ski3, ski2 and ski8 single mutants. As a result, the CER3 transcript abundance was greater in these mutant lines compared to the wax deficient cer7, but due to the presence of these small silencing RNAs, the CER3 transcript accumulation in most cases did not reach wild-type levels (Figure 4.10C). These results demonstrate that in the absence of the SKI complex components, tasiRNA effector molecules involved in silencing of CER3 are not efficiently degraded by the exosome, which results in reduced CER3 expression and consequently lower than wild 100  type wax loads. Furthermore, the finding that the abundance of the CER3 transcript in both the ski mutants and the skicer7 double mutants was intermediate between the wild type and the mutant, with the exception of ski3-5, suggests that in the absence of a functional SKI complex CER3 transcript degradation is also compromised.  Figure 4.10: Accumulation of tasiRNAs and CER3 transcripts (A) Detection of tasiRNA-1 in Col 0 WT, cer7-3, ski and skicer7-3 mutants by quantitative RT-PCR (B) Detection of tasiRNA-2 in Col 0 WT, cer7-3, ski and skicer7-3 mutants by quantitative RT-PCR  (C) Detection of CER3 transcript levels in Col 0 WT, cer7-3, ski and skicer7-3 mutants by quantitative RT-PCR ACTIN2 was used as an internal control, and control samples were normalized to 1. Values represent means ± SD ( =3).  4.3 Discussion We previously demonstrated that CER7-dependent exosome activity plays an important role in regulation of wax biosynthesis in elongating Arabidopsis stems by controlling the expression of wax biosynthetic gene CER3 (Hooker et al., 2007). To 101  elucidate the mechanism of CER7-mediated control of wax production, we performed a cer7 suppressor screen, which resulted in the discovery of tasiRNAs as direct effectors of CER3 gene expression (Lam et al., 2012, 2015). Based on our results we hypothesized that CER7-dependent exosomal degradation of the tasiRNAs (or their precursors) involved in PTGS of the CER3 gene is required to promote wax production in the wild type stem. To further investigate this unique regulatory process and determine if it involves other players in addition to CER7 and tasiRNAs, I characterized two novel cer7-suppressors, war1 and war7, and cloned the genes disrupted in these mutant lines. Identification of the WAR1 and WAR7 revealed that they encode SKI3 and SKI2 proteins, respectively, components of a well established evolutionarily conserved SKI complex known to work in close association with the exosome in yeast and metazoa (Brown et al., 2000; Orban and Izaurralde, 2005). My results demonstrate that efficient regulation of CER3 expression by tasiRNAs requires participation of SKI proteins, and implicate the SKI complex in CER7-mediated regulation of wax deposition.  4.3.1 All components of the AtSKI complex participate in the CER7-dependent regulation of wax biosynthesis Our work on Arabidopsis wax-deficient cer7 mutant revealed that CER7/AtRRP45B core subunit of the exosome complex, in addition to its functions within the complex, also moonlights in a uniquely plant process: the regulation of wax biosynthesis (Hooker et al., 2007). Whether the CER7 carries out this function as part of the intact exosome, or in a different context, is not known. In an attempt to identify additional factors involved in CER7-dependent regulation of stem wax biosynthesis, we carried out a cer7 suppressor screen that resulted in the identification of two SKI proteins, SKI3 and SKI2. Reverse genetic experiments showed that SKI8, the third known component of the AtSKI complex also participates in the regulation of CER3 expression in Arabidopsis. In yeast and metazoan cells, the activity of the exosome is regulated by auxiliary 102  factors, including helicases that are localized either to the cytoplasm or the nucleus. Cytoplasmic functions of the exosome, including 3’ to 5’ mRNA turnover, require participation of the SKI2 helicase, which together with SKI3 and SKI8 proteins forms the SKI complex. The well-studied SKI complex of Saccharomyces cerevisiae was shown to function as a tetramer of SKI3, SKI2 and SKI8 subunits that assemble with 1:1:2 stoichiometry and proposed to directly channel RNAs for degradation by the exosome (Halbach et al., 2013). The only protein with enzymatic activity in yeast is the SKI2 RNA helicase, whereas SKI3 and SKI8 subunits have structural roles and modulate the activity of SKI2 (Halbach et al., 2013). An additional protein, SKI7, links the SKI complex with the exosome in yeast (Araki et al., 2001). The organization and function of the plant SKI complex in exosomal activities is not well established. The existence of the SKI complex in Arabidopsis was first demonstrated by Dorcey et al., (2012), who successfully co-immunoprecipitated AtSKI3 and AtSKI2 with GFP-ATSKI8. This study also revealed that, similar to yeast, the AtSKI complex is involved in exosome-mediated 3’ to 5’ RNA turnover (Dorcey et al., 2012). However, genetic support for the conclusion that AtSKI2, AtSKI3, and AtSKI8 act in a complex during exosomal 3’ to 5’ RNA degradation by analyses of the phenotypes caused by mutations in each individual component was not obtained, due to unavailability of loss-of-function Atski3 mutants. My analyses of the ski mutants described here show that all components of Arabidopsis SKI complex play a role in the regulation of wax biosynthesis, because mutations in AtSKI3, AtSKI2, and AtSKI8 can all rescue the wax-deficient phenotype of the cer7 mutant. This supports the conclusion that SKI proteins function in the same pathway, or as a complex in Arabidopsis. Subcellular localization of a functional AtSKI3-GFP fusion protein capable of rescuing the ski3 mutant phenotype is consistent with the AtSKI3 role as an exosome auxiliary factor required for exosomal activities in the cytoplasm. However, the AtSKI3-GFP signal in cytoplasmic granules suggests a possibility that one or more 103  activities of the AtSKI complex and the exosome, or the activities of AtSKI3 and the exosome might be carried out in specialized organelles, such as processing bodies (P bodies), cytoplasmic protein complexes known to be involved in degradation and translational arrest of mRNA (Maldonado-Bonilla, 2014). Further localization studies, including co-localization work of AtSKI proteins with confirmed P body components are needed to address this hypothesis. Sequence analyses revealed significant differences between the SKI proteins in yeast and Arabidopsis (Figure 4.5), suggesting structural differences in the SKI complex organization between yeast and Arabidopsis. Surprisingly, an introduction of ScSKI8 into the Arabidopsis ski8 mutant was reported to successfully rescue ski8 pleiotropic phenotypes (Dorcey et al., 2012). To determine whether AtSKI3 homolog also shares functional similarity with its yeast counterpart, I attempted to complement the Arabidopsis ski3 mutant with the Scski3 homolog, as well as the yeast ski3 mutant with the Arabidopsis AtSKI3 gene. Both experiments were unsuccessful in that the ScSKI3 failed to complement Arabidopsis ski3 mutant, and vice versa. At present, it is not possible to deduce why this is the case, since the essential interacting domains that are required for tethering SKI2 and SKI8 to SKI3 in yeast have not been identified for the Arabidopsis SKI complex components.  4.3.2 Regulation of both tasiRNAs and CER3 transcript levels requires participation of the AtSKI proteins The finding that mutations in the components of the SKI complex result in restoration of wax deficiency caused by the loss-of function of the CER7/AtRRP45B core subunit of the exosome was unexpected. To test whether AtSKI proteins play a role in determining the tasiRNA levels that control CER3 expression during wax biosynthesis, like all the other WAR proteins identified in our suppressor screen, I examined the accumulation of two CER3-specific tasiRNAs in the ski mutants and the skicer7 double 104  mutant. My data show that in the absence of functional SKI proteins not only in ski single mutants, but also in skicer7 double mutants, tasiRNAs are produced. However, their abundance is lower than in the cer7 mutant and considerably higher than in the wild type. Relatively high levels of tasiRNAs in both single and double mutants in turn result in lower CER3 transcript accumulation in comparison to the wild type. Additionally, because ski single mutations and skicer7 double mutations affect CER3 transcript levels in a similar manner, it seems likely that SKI proteins function in a complex, and that the SKI complex and the CER7-dependent exosome act together in degrading not only tasiRNA, but also CER3 mRNAs in the cytoplasm of epidermal cells during stem wax biosynthesis.  4.4 Conclusion Based on evidence from this study, I propose the following model for regulation of wax biosynthesis in developing Arabidopsis inflorescence stems. In the wild type stem apex, degradation of tasiRNAs (or their precursors) by the CER7-dependent exosome activity, with the help of the SKI complex, results in expression of CER3 and production of wax components via the alkane biosynthetic pathway. In the cer7 mutant, buildup of CER3-related tasiRNAs, due to a lesion in the CER7 protein, causes PTGS of CER3. Degradation of CER3 mRNA in the absence of a functional exosomal CER7/AtRRP45B subunit, may involve a closely related protein AtRRP45A, and the SKI complex, resulting in low CER3 transcript levels and reduced stem wax load compared to the wild type. Loss-of-function ski mutations cause a moderate accumulation of tasiRNAs, because they cannot be efficiently degraded by the exosome without a contribution from the SKI complex. However, the presence of these tasiRNAs does not result in a complete CER3 mRNA turnover, due to SKI complex inactivity. Consequently, ski mutants accumulate considerably high levels of the CER3 transcript which results in the synthesis of alkanes and its derivatives in the stem epidermis. 105  4.5 Materials and methods 4.5.1 Plant materials and growth conditions Arabidopsis thaliana mutant lines cer7-1sti (Ler background) (Koornneef et al., 1989), cer7-3 (Col 0 background; SAIL-747-B08), ski3-5 (SALK_099525), ski2-5 (SALK_141579), ski2-6 (SALK_122393), ski2-7 (SALK_063541), ski8-6 (SALK_060207) and ski8-7 (SALK_139885) were obtained from the Arabidopsis Biological Resource Center (http://www.arabidopsis.org) and ski3-4 (GABI_140B07) was ordered from GABI_Kat (Max Planck Institute for Plant Breeding Research). Wild type and mutant seeds were stratified for 2-3 d at 4 °C, and germinated on AT-agar plates (Somerville and Ogren, 1982) for 7-10 d and transplanted to soil (Sunshine Mix 4; SunGro). All plants were grown at 20 °C under continuous light (90-110  Em-2s-1 photosynthetically active radiaton) in an environmental chamber.  4.5.2 Mapping of suppressor mutations To identify the mutated genes in suppressor lines, each suppressor line in Ler background was crossed to cer7-3 in Col-0 ecotype and grown to produce the F2 generation. Leaf genomic DNA from 16-17 individual plants with the wild-type waxy stem phenotype was extracted on FTA cards (Whatman). These DNA samples were subjected to PCR using simple sequence length polymorphism (SSLP) markers to determine linkage of the mutated gene. To further narrow the mapping interval of the war1 locus, over 2,000 plants were screened with SSLP markers until a small region was determined.  4.5.3 Genotyping Genomic DNA was extracted as described in Berendzen et al. (2005) and used for PCR. T-DNA insertion lines were genotyped using LBb1.3 (except GABI_140B07, for which primer o8409 was used) and gene-specific primers (http://signal.salk.edu/tdnaprimers.2.html) as listed in Table 4.4. 106  Table 4.4: Primers used in this study Primer Sequence (5’ to 3’) LBb1.3 ATTTTGCCGATTTCGGAAC GABI_140B07 LP CATTTTGTCTTTCTGGCTTCG GABI_140B07 RP CATCAAGCAAACCTTTTGGAG SALK_099525 LP  CTCCGACAAGAAGGATCAGTG SALK_099525 RP CACGTGAGCAGAGATTTCCTC SALK_141579 LP ATTTTGATTGGTTTTCCAGGG SALK_141579 RP GACTTCATTGCTTATGCTCGC SALK_122393 LP TTTCTCATTTGAACGTACCCG SALK_122393 RP CGCCAAGCTTTTTGTAGTCTC SALK_063541 LP  TTTCGGTGTTGAAGAGTCGTC SALK_063541 RP  TCGATCACTCTCTGTCCCTTC SALK_060207 LP GAACAGCTTCAACGCAAGTTC SALK_060207 RP AAGGAGGAGCTTCCAAAACAG SALK_139885 LP GACTGCAAGTACCACTTTCGC SALK_139885 RP TAATGGGAAACGACTTGCTTG o8409 ATATTGACCATCATACTCATTGC AtSKI3RT-F GTTCAAGCGAGTTCATTGTTTC AtSKI3RT-R GTCTTGCGAGTATATGCATCTG AtSKI2RT-F GGTGAACTTCAAGCTCAGTAC AtSKI2RT-R CAATCTCACAATGGTTCGAACT AtSKI8RT-F TCGATTGATAGCTTTGTCCGTG AtSKI8RT-R ATCTCCAGCTTGCAGTGTCC ACTIN2-F TCCCTCAGCACATTCCAGCAGAT ACTIN2-R AACGATTCCTGGACCTGCCTCATC CER3-qPCR-F CTCATCTCCTGTTCCACATCC CER3-qPCR-R TCAATGGAACACCAGCTACG AtSKI3p-attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCTGATGCAAGGAAAATTGCTG AtSKI3-attB2-noSTOP GGGGACCACTTTGTACAAGAAAGCTGGGTCGCTCATGGGATGTTGAACA ScSKI3-attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGTCGGATATTAAACAGCTATTGA ScSKI3-attB2 GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGAAACATTCGTTTAGCGCCTT AtSKI3p-attB4 GGGGCAACTTTGTATAGAAAAGTTGGATGCAAGGAAAATTGCTG AtSKI3p-attB1R GGGGCTGCTTTTTTGTACAAACTTGCTGAATATAACCCAATCTACAAAATG 107  Table 4.4: Primers used in this study (continued) Primer Sequence (5’ to 3’) AtSKI3-F AAACACGAAGACCAGAGGAAATATGGAATTAGAGCAGCTTAAGAA AtSKI3-R GCTCTAGATCAGCTCATGGGATGTTGAAC ScSKI3p-F TCCCCCGGGAAGCTTACACCTTCTTCTCCAA ScSKI3p-R TTCTTAAGCTGCTCTAATTCCATATTTCCTCTGCTCTTCGTGTTT ScSKI3t-F GCTCTAGAAAATTTGGATTCAGAATAGTCAAT ScSKI3t-R CCCAAGCTTGATCCCGGCGCTACCTGC siRNA1-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATAC GACAGCCTG siRNA1-F GCGGCGGTGACATGTAACAGAT siRNA2-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATAC GACGCCATT siRNA2-F GCGGCGGAACAGATTGATCACG stemloop-R GTGCAGGGTCCGAGGT  4.5.4 Cuticular wax extraction and analysis Cuticular waxes were extracted from 4- to 6-week-old Arabidopsis stems. Stems were immersed in chloroform containing 10  g of n-tetracosane (internal standard) for 30 s. Samples were blown down under a stream of nitrogen and re-dissolved in 10  L of N, O-bis (trimethylsilyl) trifluoroacetamide (Sigma) and 10  L of pyridine (Fluka). Derivatization of the samples was performed at 80 °C for 1 h. After that, excess N, O-bis (trimethylsilyl) trifluoroacetamide and pyridine were removed by blowing down under nitrogen, and samples were dissolved in 30  L of chloroform. Gas-liquid chromatography was performed using an HP7890 A series gas chromatograph equipped with flame ionization detection and a 30 m HP-1 column. Gas chromatography was carried out with temperature-programmed on-column injection and oven temperature set at 50 °C for 2 min, raised by 40 °C min-1 to 200 °C, held for 2 min at 200 °C, raised by 3 °C min-1 to 320 °C and held for 30 min at 320 °C. Quantification of wax deposition was carried out by comparing the flame ionization detector peak areas with the internal standard. Stem surface area was calculated by 108  photographing stems prior to wax extraction, measuring the number of pixels, converting them to cm2, and multiplying by  .  4.5.5 RT-PCR and quantitative RT-PCR RT-PCR was used to analyze the expression levels of AtSKI genes in different ski allelic mutants and their corresponding wild-type ecotypes. Total RNA was extracted from 4- to 5-week-old stems using TRIzol reagent (Invitrogen) according to manufacturer’s protocol. RNA quantification was carried out using a Nano-Drop 8000 (Thermo Scientific). One microgram of total RNA was treated with DNaseI (Fermentas) and then used for first-strand cDNA synthesis using iScript RT supermix (Bio-Rad). For RT-PCR, the cycle number and amount of template were optimized for all fragments to generate products in the linear range of the reaction. The actin gene ACTIN2 (At3g18780) was used as a constitutive control with primers ACTIN2-F and ACTIN2-R. Gene specific primers are listed in Table 4.4. Quantitative RT-PCR was performed using gene-specific primer sets from Table 4.4 in a 20  L volume with iQ SYBR Green supermix (Bio-Rad). The reactions were performed in triplicates and run on the iQ5 real time PCR detection system (Bio-Rad). Data were analyzed using the method of Pfaffl (2001), and control samples were normalized to 1. Small RNA detection was designed and performed according to the protocol provided by Varkonyi-Gasic et al., 2007.  4.5.6 Plasmid construction and yeast and plant transformation A 6,037-bp DNA genomic fragment containing 696 bp of the upstream region of AtSKI3 minus the stop codon was amplified from wild-type Col-0 plants with primers AtSKI3p-attB1 and AtSKI3-attB2-noSTOP shown in Table 4.4 using Phusion DNA polymerase (New England Biolabs). Gateway adapters were added using the adapter protocol (Invitrogen). This 6,037-bp fragment was cloned into pDONR207 using BP 109  Clonase II (Invitrogen), and was sequenced to confirm that no mutations were introduced by PCR. The fragment was then recombined into the destination vector pGWB4 (Nakagawa et al., 2007) using LR Clonase II (Invitrogen) to generate pGWB4:ProAtSKI3:AtSKI3:GFP. To generate a construct of ScSKI3 that can be expressed in Arabidopsis, yeast SKI3 was amplified from pAJ264 (SKI3 subclone in YEp351) (Johnson and Kolodner, 1995) using primers ScSKI3-attB1 and ScSKI3-attB2, and cloned into pDONR207 using BP Clonase II (Invitrogen). The 696-bp promoter of AtSKI3 was amplified from pGWB4:ProAtSKI3:AtSKI3:GFP with primers AtSKI3p-attB4 and AtSKI3p-attB1R, and inserted to pDONRGP4-P1R (Nakagawa et al., 2008) using BP Clonase II (Invitrogen). Both fragments were then recombined into the destination vector R4PGWB4_SRDX_HSP (Oshima et al., 2011) using LR Clonase II (Invitrogen) to generate R4PGWB4:ProAtSKI3:ScSKI3:SRDX. These constructs were sequenced to confirm that no errors were present, and then transformed into Agrobacterium tumefaciens strain GV3101, pMP90 (Koncz and Schell, 1986). The war1-3cer7-3 mutants were transformed using the floral dip method (Clough and Bent, 1998). The GFP fluorescence was examined with a Zeiss Pascal Excite laser scanning confocal microscope (Carl Zeiss MicroImaging GmbH, Jena, Germany). A 488 nm excitation wavelength with the emission filter set at 500-530 nm were used for GFP. All confocal images obtained were processed with Adobe Photoshop 5.0 (Mountain View, CA) software. For expression in yeast, AtSKI3 coding regions, amplified from Arabidpsis cDNA with primers AtSKI3-F and AtSKI3-R, were fused to ScSKI3 promoter, amplified by PCR from pAJ264 (SKI3 subclone in YEp351; Johnson and Kolodner, 1995), and inserted to sites of SmaI and XbaI in YEp351. Then the ScSKI3 terminator was amplified with primers ScSKI3t-F and ScSKI3t-R from pAJ264 and inserted to the sites of XbaI and 110  HindIII in YEp351 to produce YEp351:ScSKI3p:AtSKI3:ScSKI3t. The construct was sequenced and transformed into yeast (Saccharomyces cerevisiae) strain AJY107 (RDKY2060 with pRDK297; Johnson and Kolodner, 1995) using the method described by Gietz and Woods (2002). Transformed cells were grown on Leu- plates for 4 d. Individual transformed colonies were streaked on Leu- plates containing 5-fluoroorotic acid.                      111  CHAPTER 5: CONCLUSIONS AND FUTURE DIRECTIONS 5.1 Conclusions The major goal of my Ph.D project was to investigate how wax biosynthesis is regulated along the developing stems of Arabidopsis to keep constant wax loads and compositional profiles. The rate of surface area expansion is maximal at the top 3cm of the stem and decreases sharply toward the base of the stem. Accordingly, the expression of wax biosynthetic genes was demonstrated to be high at the shoot apex, but turned off at the bottom of the stem (Suh et al., 2005). Previously, Hooker et al. (2007) showed that the regulation of wax biosynthesis along the inflorescence stem involves CER7, a core subunit (AtRRP45B) of the RNA processing and degrading complex called the exosome. Furthermore, the CER7 was demonstrated to act as a positive regulator of CER3 (Hooker et al., 2007). As proposed in the model by Hooker et al. (2007), the CER7 target is an mRNA species encoding a repressor of CER3 expression. In the presence of CER7, the repressor transcript is degraded by the exosome, which results in CER3 expression and cuticular wax biosynthesis through the alkane-forming pathway. To decipher the mechanisms of CER7-mediated activation of CER3 expression and how this contributes to the regulatory network of wax biosynthesis along the developing Arabidopsis stem, I sought to identify the putative repressor of CER3 by performing a genetic screen for cer7 suppressors, which would exhibit wild-type cuticular wax load and composition, as well as wild-type levels of CER3 transcript. The screen resulted in the isolation of 99 second-site suppressors, 77 of which displayed almost completely restored wax loads and wild-type wax compositional profiles, as well as almost fully restored CER3 transcript levels. These suppressors fell into eight complementation groups, designated war1 to war8. Cloning and characterization of these WAR genes have generated a series of discoveries described below.  112  5.1.1 Gene silencing is involved in regulating wax biosynthesis Characterization of the war3 mutant and map-based cloning of WAR3 by another Ph.D student in the Kunst lab, Patricia Lam, and my analysis of war4 and identification of the WAR4 revealed that WAR3 encodes RDR1 and WAR4 encodes SGS3, components of the small RNA biosynthetic pathway (Chapter 2). RDR1 is one of the six RDR proteins annotated in the Arabidopsis genome that catalyze the conversion of ssRNA molecules into dsRNAs, substrates for DCL enzymes in the biogenesis of siRNAs. However, whereas RDR2 and RDR6 have previously been shown to participate in siRNA-mediated gene silencing in Arabidopsis (Peragine et al., 2004; Vazquez et al., 2004; Xie and Qi, 2008), RDR1 has only been reported to be involved in antiviral defense (Yu et al., 2003). SGS3 is a plant-specific protein with no demonstrated biochemical function, suggested to stabilize ssRNA template before it is used for dsRNA synthesis. SGS3 was reported to be essential for the siRNA biogenesis, possibly via direct interaction with RDR6 in cytoplasmic punctae (Kumakura et al., 2009). SGS3 requirement has been reported for siRNA biogenesis for transgene silencing, virus silencing, as well as tasiRNA formation for the regulation of gene expression during plant development (Peragine et al., 2004). The identification of RDR1 and SGS3 in our screen for the cer7 suppressors revealed that, in addition to RDR6, RDR1 activity also needs the participation of SGS3. Moreover, even though RDR1 has not been implicated in endogenous gene silencing thus far, it is reasonable to suggest that RDR1 and SGS3 are involved in the production of an as yet uncharacterized small RNA species that directly or indirectly involved in regulating the expression of CER3 to control wax deposition over the length of the developing stem. Based on these results, we proposed that small RNA species function as repressors of CER3. In the wild type plant, the CER7-dependent exosome degrades a precursor of these small RNAs, activating the expression of CER3, and the formation of waxes by the 113  alkane pathway. In the cer7 mutant, the precursor of the small RNA repressors is not degraded by the exosome, and is used for the production of small RNAs by a pathway that requires RDR1 and SGS3. The resulting small RNAs are involved in post-transcriptional silencing of CER3, causing the wax-deficient stem phenotype observed in cer7 mutant.  5.1.2 TasiRNAs are direct effectors of CER3 expression In chapter 3, investigation of cer7 suppressors war5 and war6, which were demonstrated to contain mutations in SDE5 and RDR6, respectively, provided additional evidence for the participation of tasiRNAs in regulating stem wax production. SDE5 had been suggested to play a role in RNA nucleo-cytoplasmic trafficking essential for tasiRNA biogenesis based on sequence similarity analysis (Hernandez-Pinzon et al., 2007; Jauvion et al., 2010), but the exact function of SDE5 protein is still uncertain. RDR6, on the other hand, is one of the six RDRs encoded in Arabidopsis, with well established roles in the formation of dsRNA molecules during biogenesis of tasiRNAs involved in silencing of endogenous gene transcripts (Peragine et al., 2004; Vazquez et al., 2004; Xie and Qi, 2008). Surprisingly, our suppressor screen led to the identification of two proteins from the RDR family, RDR1 and RDR6, which are involved in CER7-mediated control of stem wax deposition. Construction and analysis of the rdr1rdr6cer7 triple mutant led to two conclusions: (1) RDR1 plays an essential role in both PTGS of virus-derived RNAs and production of tasiRNAs associated with endogenous gene silencing, and (2) RDR1 and RDR6 are not redundant in tasiRNA biosynthesis. The reason for the requirement of two different RDR proteins in regulating wax deposition and the respective roles of these two RDRs in forming dsRNAs need further investigation. A reverse genetic approach led to the identification of AGO1, and HEN1 by Patricia Lam, as well as DCL4 and DRB4 by myself as additional components required for the 114  regulation of CER3 expression. This further supports the conclusion that tasiRNAs are the small RNA species mediating wax deposition on Arabidopsis stems. RNA sequencing of small RNA populations from developing stems carried out by our collaborators Yu Yu and Xuemei Chen (University of California, Riverside) revealed that a large proportion of the tasiRNAs that accumulate in the cer7 mutant relative to the wild type show complementarities to the CER3 gene (as well as five other genes), suggesting that CER3 silencing by tasiRNAs is direct.  5.1.3 Yeast SKI-like complex is a cofactor of the exosome required for tasiRNAs-mediated wax biosynthesis In chapter 4, cloning of another two genes disrupted in the war suppressor mutants resulted in the identification of WAR1 as AtSKI3 and WAR7 as AtSKI2. These data, as well as reverse genetic experiments on AtSKI8 demonstrated the involvement of the SKI-like complex in the control of wax biosynthesis mediated by CER7 and tasiRNAs during inflorescence stem development in Arabidopsis. TasiRNAs that are direct regulators of CER3 gene expression are produced in the ski mutants, although at a much lower level in comparison to the cer7 line. My data suggest that the AtSKI complex is required for the tasiRNAs to recognize and efficiently silence their downstream target, the CER3 gene. This adds to the previously proposed model in which the CER7 (or the CER7-dependent exosome activity) degrades tasiRNAs (or their precursors) that are direct effectors of CER3 gene. Based on this new information, we hypothesize that both CER7-dependent exosome activity and the AtSKI complex as a cofactor, are necessary for degradation of the CER3 mRNA and the tasiRNA effectors of the CER3 gene to regulate wax biosynthesis in the inflorescence stems of Arabidopsis.     115  5.2 Future directions 5.2.1 Cloning and characterization of other components that are involved in CER7-mediated regulation of wax biosynthesis Our results show that rapid wax deposition in the apical region of the stem with progressive attenuation toward the stem base that results in a constant wax load and composition along the bolting inflorescence stem involves a gradient of CER3 expression. We also detected a basipetal decrease in CER7 transcript accumulation in developing Arabidopsis stems. These data suggest that the CER3 expression gradient may be established by the gradual basipetal decline of CER7 activity, which in turn results in increased CER3 silencing by tasiRNAs. However, how this temporal change in CER7 expression impacts CER3-specific tasiRNA abundance remains to be investigated. Furthermore, whether or not CER3 expression is controlled by additional factors other than the tasiRNAs during CER7-mediated regulation of wax production remains open. To address these questions, cloning and characterizing of additional cer7 suppressors (war2 and war8) may provide valuable information.  In addition to the 77 suppressors with fully rescued wax loads and CER3 expression, the cer7 suppressor screen also identified candidates with partially restored wax loads and CER3 transcript abundance, mainly waxy at the base and wax-deficient at the top of the stem. Characterization of these mutants may also be informative and provide new insights about wax deposition during stem elongation. More interestingly, some putative cer7 suppressor lines displayed restored wax levels, but not CER3 transcript levels, suggesting that an alternative CER3-independent pathway for wax production might exist.  5.2.2 Additional mechanisms of regulation of CER3 expression  CER7 was demonstrated to positively regulate CER3 expression, as reduced CER3 transcript levels leading to decreased wax loads on the developing inflorescence stems 116  were detected in the cer7 mutant (Hooker et al., 2007). However, steady-state transcript levels of CER3 in the cer7 mutant were approximately 25% of wild type. Thus, there must be other ways of controlling CER3 gene expression, possibly via transcription factors that interact with the CER3 promoter (Hooker et al., 2007). Such transcription factors can be identified by performing a yeast one-hybrid assay, or a pull down assay with CNBr-activated sepharose using the putative CER3 promoter as bait. So far, MYB30 and MYB96, two members of the MYB transcription factor family, have been confirmed to participate in regulating CER3 expression (Raffaele et al., 2008; Seo et al., 2011). Interestingly, MYB30 seems to be regulated by PTGS pathway involving small RNAs, as increased MYB30 expression was observed in dcl1, dcl2dcl3dcl4, rdr2, rdr6 and hen1 mutant (Froidure et al., 2010). Since RNA sequencing showed that small RNA populations that accumulated in the cer7 mutant did not map to MYB30, the identification of effector molecules that control MYB30 transcript levels needs further investigation.  5.2.3 Additional biological functions of CER7 In Arabidopsis, down-regulation of individual core subunits of the exosome results in distinct developmental defects. This suggests that each of the core subunits contributes unequally to the in vivo activities of the exosome complex (Chekanova et al., 2007; Lange and Gagliardi, 2010). The CER7/AtRRP45B subunit participates in regulation of wax biosynthesis and is partially redundant with its homologue AtRRP45A as an essential component of the exosome. Results of my Ph.D research indicate that in addition to affecting the expression of CER3, CER7/AtRRP45B also controls transcript levels of several other genes including ERD14, SUI1, AUX1, and two genes of unknown functions. To get a more complete understanding of the biological roles of the CER7/AtRRP45B and its targets, one could use high-resolution tiling arrays covering the entire Arabidopsis genome to identify the RNA species that accumulate in the cer7 mutant. Such a study 117  would also help differentiate whether tasiRNA species or their precursors are the direct targets of CER7-mediated degradation. If the precursors of tasiRNAs are direct targets of CER7-dependent exosome, we would see a buildup of these precursors. If the transcripts of TAS loci-derived tasiRNA precursors do not accumulate to a higher level compared with the wild type, then we would propose that it is tasiRNAs and not their precursors that are degraded by CER7-mediated exosomal activity.  5.2.4 Contributions of associated exoribonucleases and cofactors to the functions of the exosome in Arabidopsis Exosome preparations from yeast, flies, trypanosomes and humans have been shown to be associated with RNA binding proteins and RNA helicases, such as proteins of the SKI-complex in the cytoplasm and the RRP47/C1D/LRP1 and MPP6 in the nucleus (Brown et al., 2000; van Hoof et al., 2000; Estevez et al., 2003; Mitchell et al., 2003; Schilders et al., 2005; Cristodero and Clayton, 2007; Schilders et al., 2007; Milligan et al., 2008). Some cofactors, like the yeast TRAMP complex may not bind directly and/or stably to the core exosome complex, but still plays an essential role in regulating some of the activities of the exosome, including the oligo-adenylation of nuclear exosome substrates (LaCava et al., 2005; Vanacova et al., 2005; Wyers et al., 2005). My Ph.D work demonstrated the existence of a SKI-like complex in Arabidopsis and its involvement in CER7/AtRRP45B-related regulation of wax biosynthesis. However, the type and scope of functions carried out by the SKI complex in plants needs to be explored further. For example, how the subunits of the SKI complex interact and associate into a stable assembly in Arabidopsis? As the essential interacting domain of ScSKI3 is missing in AtSKI3, is another as yet unidentified protein component required for tethering AtSKI2 and AtSKI8? Arabidopsis also does not contain SKI7, known to be involved in the interaction between the SKI complex and the exosome in yeast. Whether another protein has this role in Arabidopsis remains to be investigated. Finally, work on candidates for 118  other exosomal cofactors needs to be carried out. To accomplish this, homologues of these cofactors can be identified based on sequence similarity and the corresponding mutants could be examined.                         119  REFERENCES Aarts MG, Keijzer CJ, Stiekema WJ, Pereira A (1995) Molecular characterization of the CER1 gene of arabidopsis involved in epicuticular wax biosynthesis and pollen fertility. Plant Cell 7: 2115-2127 Adenot X, Elmayan T, Lauressergues D, Boutet S, Bouché N, Gasciolli V, Vaucheret H (2006) DRB4-dependent TAS3 trans-acting siRNAs control leaf morphology through AGO7. Curr Biol 16: 927–932 Aharoni A, Dixit S, Jetter R, Thoenes E, van Arkel G, Pereira A (2004) The SHINE clade of AP2 domain transcription factors activates wax biosynthesis, alters cuticle properties, and confers drought tolerance when overexpressed in Arabidopsis. Plant Cell 16: 2463-2480 Allen E, Xie Z, Gustafson AM, Carrington JC (2005) MicroRNA-directed phasing during trans-acting siRNA biogenesis in plants. Cell 121: 207–221 Allmang C, Kufel J, Chanfreau G, Mitchell P, Petfalski E, Tollervey D (1999) Functions of the exosome in rRNA, snoRNA and snRNA synthesis. EMBO J 18: 5399-5410 Allmang C, Mitchell P, Petfalski E, Tollervey D (2000) Degradation of ribosomal RNA precursors by the exosome. Nucleic Acids Res 28: 1684-1691 Allmang C, Petfalski E, Podtelejnikov A, Mann M, Tollervey D, Mitchell P (1999) The yeast exosome and human PM-Scl are related complexes of 3 '-> 5 ' exonucleases. Genes & Development 13: 2148-2158 Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653 –657 Anders S, Huber W (2010) Differential expression analysis for sequence count data. Genome Biol 11: R106 Anderson JS, Parker RP (1998) The 3' to 5' degradation of yeast mRNAs is a general mechanism for mRNA turnover that requires the SKI2 DEVH box protein and 3' to 5' exonucleases of the exosome complex. EMBO J 17: 1497-1506 Arora C, Kee K, Maleki S, Keeney S (2004) Antiviral protein Ski8 is a direct partner of Spo11 in meiotic DNA break formation, independent of its cytoplasmic role in RNA metabolism. Mol Cell 13: 549-559 Bach L, Michaelson LV, Haslam R, Bellec Y, Gissot L, Marion J, Da Costa M, Boutin JP, Miquel M, Tellier F, Domergue F, Markham JE, Beaudoin F, Napier JA, Faure JD (2008) The very-long-chain hydroxy fatty acyl-CoA dehydratase PASTICCINO2 is essential and limiting for plant development. Proc Natl Acad Sci U S A 105: 14727-14731 Barthlott W, Neinhuis C (1997) Purity of the sacred lotus, or escape from contamination in biological surfaces. Planta 202: 1-8 Baud S, Bellec Y, Miquel M, Bellini C, Caboche M, Lepiniec L, Faure JD, Rochat C 120  (2004) gurke and pasticcino3 mutants affected in embryo development are impaired in acetyl-CoA carboxylase. EMBO Rep 5: 515-520 Baud S, Guyon V, Kronenberger J, Wuilleme S, Miquel M, Caboche M, Lepiniec L, Rochat C (2003) Multifunctional acetyl-CoA carboxylase 1 is essential for very long chain fatty acid elongation and embryo development in Arabidopsis. Plant J 33: 75-86 Baulcombe D (2005) RNA silencing. Trends Biochem Sci 30: 290–293 Baumberger N, Baulcombe DC (2005) Arabidopsis ARGONAUTE1 is an RNA Slicer that selectively recruits microRNAs and short interfering RNAs. Proc Natl Acad Sci USA 102: 11928–11933 Beaudoin F, Wu X, Li F, Haslam RP, Markham JE, Zheng H, Napier JA, Kunst L (2009) Functional characterization of the Arabidopsis beta-ketoacyl-coenzyme A reductase candidates of the fatty acid elongase. Plant Physiol 150: 1174-1191 Beisson F, Li-Beisson Y, Pollard M (2012) Solving the puzzles of cutin and suberin polymer biosynthesis. Curr Opin Plant Biol 15: 329-337 Belostotsky D (2008) Transcriptome targets of the exosome complex in plants. Methods Enzymol 448: 429-443 Berendzen K, Searle I, Ravenscroft D, Koncz C, Batschauer A, Coupland G, Somssich IE, Ulker B (2005) A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta. Plant Methods 1: 4 Bernard A, Domergue F, Pascal S, Jetter R, Renne C, Faure JD, Haslam RP, Napier JA, Lessire R, Joubes J (2012) Reconstitution of plant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis complex. Plant Cell 24: 3106-3118 Bernard A, Joubes J (2013) Arabidopsis cuticular waxes: advances in synthesis, export and regulation. Prog Lipid Res 52: 110-129 Bird D, Beisson F, Brigham A, Shin J, Greer S, Jetter R, Kunst L, Wu X, Yephremov A, Samuels L (2007) Characterization of Arabidopsis ABCG11/WBC11, an ATP binding cassette (ABC) transporter that is required for cuticular lipid secretion. Plant J 52: 485-498 Blacklock BJ, Jaworski JG (2006) Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases. Biochem Biophys Res Commun 346: 583-590 Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A (2010) Manipulation of FASTQ data with Galaxy. Bioinformatics 26: 1783–1785 Bonaventure G, Salas JJ, Pollard MR, Ohlrogge JB (2003) Disruption of the FATB gene in Arabidopsis demonstrates an essential role of saturated fatty acids in plant growth. Plant Cell 15: 1020-1033 Bonneau F, Basquin J, Ebert J, Lorentzen E, Conti E (2009) The yeast exosome 121  functions as a macromolecular cage to channel RNA substrates for degradation. Cell 139: 547-559 Bourdenx B, Bernard A, Domergue F, Pascal S, Leger A, Roby D, Pervent M, Vile D, Haslam RP, Napier JA, Lessire R, Joubes J (2011) Overexpression of Arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences plant response to biotic and abiotic stresses. Plant Physiol 156: 29-45 Bousquet-Antonelli C, Presutti C, Tollervey D (2000) Identification of a regulated pathway for nuclear pre-mRNA turnover. Cell 102: 765-775 Boutet S, Vazquez F, Liu J, Béclin C, Fagard M, Gratias A, Morel JB, Crété P, Chen X, Vaucheret H (2003) Arabidopsis HEN1: a genetic link between endogenous miRNA controlling development and siRNA controlling transgene silencing and virus resistance. Curr Biol 13: 843–848 Broun P, Poindexter P, Osborne E, Jiang CZ, Riechmann JL (2004) WIN1, a transcriptional activator of epidermal wax accumulation in Arabidopsis. Proc Natl Acad Sci USA 101: 4706-4711 Brown JT, Bai X, Johnson AW (2000) The yeast antiviral proteins Ski2p, Ski3p, and Ski8p exist as a complex in vivo. RNA 6: 449-457 Buschhaus C, Jetter R (2011) Composition differences between epicuticular and intracuticular wax substructures: how do plants seal their epidermal surfaces? J Exp Bot 62: 841-853 Chekanova JA, Gregory BD, Reverdatto SV, Chen H, Kumar R, Hooker T, Yazaki J, Li P, Skiba N, Peng Q, Alonso J, Brukhin V, Grossniklaus U, Ecker JR, Belostotsky DA (2007) Genome-wide high-resolution mapping of exosome substrates reveals hidden features in the Arabidopsis transcriptome. Cell 131: 1340-1353 Chekanova JA, Gregory BD, Reverdatto SV, Chen H, Kumar R, Hooker T, Yazaki J, Li P, Skiba N, Peng Q, Alonso J, Brukhin V, Grossniklaus U, Ecker JR, Belostotsky DA (2007) Genome-wide high-resolution mapping of exosome substrates reveals hidden features in the Arabidopsis transcriptome. Cell 131: 1340-1353 Chekanova JA, Shaw RJ, Wills MA, Belostotsky DA (2000) Poly(A) tail-dependent exonuclease AtRrp41p from Arabidopsis thaliana rescues 5.8 S rRNA processing and mRNA decay defects of the yeast ski6 mutant and is found in an exosome-sized complex in plant and yeast cells. Journal of Biological Chemistry 275: 33158-33166 Chen X, Goodwin SM, Boroff VL, Liu X, Jenks MA (2003) Cloning and characterization of the WAX2 gene of Arabidopsis involved in cuticle membrane and wax production. Plant Cell 15: 1170-1185 Cheng JB, Russell DW (2004) Mammalian wax biosynthesis. I. Identification of two fatty acyl-Coenzyme A reductases with different substrate specificities and tissue 122  distributions. J Biol Chem 279: 37789-37797 Chitwood DH, Nogueira FT, Howell MD, Montgomery TA, Carrington JC, Timmermans MC (2009) Pattern formation via small RNA mobility. Genes Dev 23: 549–554 Clough RC, Matthis AL, Barnum SR, Jaworski JG (1992) Purification and characterization of 3-ketoacyl-acyl carrier protein synthase III from spinach. A condensing enzyme utilizing acetyl-coenzyme A to initiate fatty acid synthesis. J Biol Chem 267: 20992-20998 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743 Cominelli E, Sala T, Calvi D, Gusmaroli G, Tonelli C (2008) Over-expression of the Arabidopsis AtMYB41 gene alters cell expansion and leaf surface permeability. Plant J 53: 53-64 Cristodero M, Clayton CE (2007) Trypanosome MTR4 is involved in rRNA processing. Nucleic Acids Res 35: 7023-7030 Dalmay T, Hamilton A, Rudd S, Angell S, Baulcombe DC (2000) An RNA-dependent RNA polymerase gene in Arabidopsis is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell 101: 543–553 Daniel X, Lacomme C, Morel JB, Roby D (1999) A novel myb oncogene homologue in Arabidopsis thaliana related to hypersensitive cell death. Plant J 20: 57-66 Das B, Butler JS, Sherman F (2003) Degradation of normal mRNA in the nucleus of Saccharomyces cerevisiae. Mol Cell Biol 23: 5502-5515 Datla RSS, Hammerlindl JK, Panchuk B, Pelcher LE, Keller W (1992) Modified binary plant transformation vectors with the wild-type gene encoding NPTII. Gene 122: 383–384 Debono A, Yeats TH, Rose JK, Bird D, Jetter R, Kunst L, Samuels L (2009) Arabidopsis LTPG is a glycosylphosphatidylinositol-anchored lipid transfer protein required for export of lipids to the plant surface. Plant Cell 21: 1230-1238 Doma MK, Parker R (2006) Endonucleolytic cleavage of eukaryotic mRNAs with stalls in translation elongation. Nature 440: 561-564 Dorcey E, Rodriguez-Villalon A, Salinas P, Santuari L, Pradervand S, Harshman K, Hardtke CS (2012) Context-dependent dual role of SKI8 homologs in Mrna synthesis and turnover. PloS Genet 8: e1002652 Dunoyer P, Himber C, Voinnet O (2005) DICER-LIKE 4 is required for RNA interference and produces the 21-nucleotide small interfering RNA component of the plant cell-to-cell silencing signal. Nat Genet 37: 1356–1360 Dunoyer P, Schott G, Himber C, Meyer D, Takeda A, Carrington JC, Voinnet O (2010) Small RNA duplexes function as mobile silencing signals between plant cells. Science 328: 912–916 Dziembowski A, Lorentzen E, Conti E, Seraphin B (2007) A single subunit, Dis3, is essentially responsible for yeast exosome core activity. Nature Structural & 123  Molecular Biology 14: 15-22 Dziembowski A, Lorentzen E, Conti E, Seraphin B (2007) A single subunit, Dis3, is essentially responsible for yeast exosome core activity. Nat Struct Mol Biol 14: 15-22 Earley KW, Haag JR, Pontes O, Opper K, Juehne T, Song K, Pikaard CS (2006) Gateway‐compatible vectors for plant functional genomics and proteomics. Plant J 45: 616–629 Eigenbrode SD, Espelie KE (1995) Effects of Plant Epicuticular Lipids on Insect Herbivores. Annual Review of Entomology 40: 171-194 Elmayan T, Adenot X, Gissot L, Lauressergues D, Gy I, Vaucheret H (2009) A neomorphic sgs3 allele stabilizing miRNA cleavage products reveals that SGS3 acts as a homodimer. FEBS J 276: 835–844 Estevez AM, Lehner B, Sanderson CM, Ruppert T, Clayton C (2003) The roles of intersubunit interactions in exosome stability. J Biol Chem 278: 34943-34951 Fiebig A, Mayfield JA, Miley NL, Chau S, Fischer RL, Preuss D (2000) Alterations in CER6, a gene identical to CUT1, differentially affect long-chain lipid content on the surface of pollen and stems. Plant Cell 12: 2001-2008 Frischmeyer PA, van Hoof A, O'Donnell K, Guerrerio AL, Parker R, Dietz HC (2002) An mRNA surveillance mechanism that eliminates transcripts lacking termination codons. Science 295: 2258-2261 Froidure S, Roby D, Rivas S (2010) Expression of the Arabidopsis transcription factor AtMYB30 is post-transcriptionally regulated. Plant Physiol Biochem 48: 735-739 Fukudome A, Kanaya A, Egami M, Nakazawa Y, Hiraguri A, Moriyama H, Fukuhara T (2011) Specific requirement of DRB4, a dsRNA-binding protein, for the in vitro dsRNA-cleaving activity of Arabidopsis Dicer like 4. RNA 17: 750–760 Garcia-Ruiz H, Takeda A, Chapman EJ, Sullivan CM, Fahlgren N, Brempelis KJ, Carrington JC (2010) Arabidopsis RNA-dependent RNA polymerases and Dicer-Like proteins in antiviral defense and small interfering RNA biogenesis during Turnip mosaic virus infection. Plant Cell 22: 481–496 Gasciolli V, Mallory AC, Bartel DP, Vaucheret H (2005) Partially redundant functions of Arabidopsis DICER-like enzymes and a role for DCL4 in producing trans-acting siRNAs. Curr Biol 15: 1494–1500 Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B, Gautier L, Ge Y, Gentry J, et al (2004) Bioconductor: open software development for computational biology and bioinformatics. Genome Biol 5: R80 Gietz RD, Woods RA (2002) Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Guide to Yeast Genetics and Molecular and Cell Biology, Pt B 350: 87-96 Glick E, Zrachya A, Levy Y, Mett A, Gidoni D, Belausov E, Citovsky V, Gafni Y (2008) Interaction with host SGS3 is required for suppression of RNA silencing 124  by tomato yellow leaf curl virus V2 protein. Proc Natl Acad Sci USA 105: 157–161 Go YS, Kim H, Kim HJ, Suh MC (2014) Arabidopsis Cuticular Wax Biosynthesis Is Negatively Regulated by the DEWAX Gene Encoding an AP2/ERF-Type Transcription Factor. Plant Cell 26: 1666-1680 Graca J, Schreiber L, Rodrigues J, Pereira H (2002) Glycerol and glyceryl esters of omega-hydroxyacids in cutins. Phytochemistry 61: 205-215 Greer S, Wen M, Bird D, Wu X, Samuels L, Kunst L, Jetter R (2007) The cytochrome P450 enzyme CYP96A15 is the midchain alkane hydroxylase responsible for formation of secondary alcohols and ketones in stem cuticular wax of Arabidopsis. Plant Physiol 145: 653-667 Halbach F, Reichelt P, Rode M, Conti E (2013) The yeast Ski complex: crystal structure and RNA channeling to the exosome complex. Cell 154: 814-826 Hannoufa A, Mcnevin J, Lemieux B (1993) Epicuticular Waxes of Eceriferum Mutants of Arabidopsis-Thaliana. Phytochemistry 33: 851-855 Haslam TM, Manas-Fernandez A, Zhao L, Kunst L (2012) Arabidopsis ECERIFERUM2 is a component of the fatty acid elongation machinery required for fatty acid extension to exceptional lengths. Plant Physiol 160: 1164-1174 Hernandez-Pinzon I, Yelina NE, Schwach F, Studholme DJ, Baulcombe D, Dalmay T (2007) SDE5, the putative homologue of a human Mrna export factor, is required for transgene silencing and accumulation of trans-acting endogenous siRNA. Plant J 50: 140–148 Hernandez-Pinzon I, Yelina NE, Schwach F, Studholme DJ, Baulcombe D, Dalmay T (2007) SDE5, the putative homologue of a human mRNA export factor, is required for transgene silencing and accumulation of trans-acting endogenous siRNA. Plant J 50: 140-148 Hiraguri A, Itoh R, Kondo N, Nomura Y, Aizawa D, Murai Y, Koiwa H, Seki M, Shinozaki K, Fukuhara T (2005) Specific interactions between Dicer-like proteins and HYL1/DRB-family dsRNA-binding proteins in Arabidopsis thaliana. Plant Mol Biol 57: 173–188 Hooker TS, Lam P, Zheng H, Kunst L (2007) A core subunit of the RNA-processing/degrading exosome specifically influences cuticular wax biosynthesis in Arabidopsis. Plant Cell 19: 904-913 Hooker TS, Millar AA, Kunst L (2002) Significance of the expression of the CER6 condensing enzyme for cuticular wax production in Arabidopsis. Plant Physiol 129: 1568-1580 Houseley J, LaCava J, Tollervey D (2006) RNA-quality control by the exosome. Nat Rev Mol Cell Biol 7: 529-539 Hunter C, Willmann MR, Wu G, Yoshikawa M, de la Luz Gutiérrez-Nava M, Poethig SR (2006) Trans-acting siRNA-mediated repression of ETTIN and ARF4 regulates heteroblasty in Arabidopsis. Development 133: 2973–2981 125  Ilgenfritz H, Bouyer D, Schnittger A, Mathur J, Kirik V, Schwab B, Chua N, Jurgens G, Hulskamp M (2003) The Arabidopsis STICHEL gene is a regulator of trichome branch number and encodes a novel protein. Plant physiol. 131: 643-655 Jauvion V, Elmayan T, Vaucheret H (2010) The conserved RNA trafficking proteins HPR1 and TEX1 are involved in the production of endogenous and exogenous small interfering RNA in Arabidopsis. Plant Cell 22: 2697-2709 Jeffee CE (2006) The fine structure of the plant cuticle. In M Riederer, C Muller, eds, Biology of the Plant Cuticle. Blackwell, Oxford, pp 11-125 Jenks MA, Tuttle HA, Eigenbrode SD, Feldmann KA (1995) Leaf Epicuticular Waxes of the Eceriferum Mutants in Arabidopsis. Plant Physiology 108: 369-377 Jessen D, Olbrich A, Knufer J, Kruger A, Hoppert M, Polle A, Fulda M (2011) Combined activity of LACS1 and LACS4 is required for proper pollen coat formation in Arabidopsis. Plant J 68: 715-726 Jetter R, Kunst L, Samuels L (2006) Composition of plant cuticular waxes. In Biology of the plant cuticle (Blackwell Publishing Ltd) Joubes J, Raffaele S, Bourdenx B, Garcia C, Laroche-Traineau J, Moreau P, Domergue F, Lessire R (2008) The VLCFA elongase gene family in Arabidopsis thaliana: phylogenetic analysis, 3D modelling and expression profiling. Plant Mol Biol 67: 547-566 Johnson AW, Kolodner RD (1995) Synthetic Lethality of Sep1 (Xrn1) Ski2 and Sep1 (Xrn1) Ski3 Mutants of Saccharomyces-Cerevisiae Is Independent of Killer Virus and Suggests a General Role for These Genes in Translation Control. Molecular and Cellular Biology 15: 2719-2727 Johnson AW, Kolodner RD (1995) Synthetic lethality of sep1 (xrn1) ski2 and sep1 (xrn1) ski3 mutants of Saccharomyces cerevisiae is independent of killer virus and suggests a general role for these genes in translation control. Mol Cell Biol 15: 2719-2727 Jolivet S, Vezon D, Froger N, Mercier R (2006) Non conservation of the meiotic function of the Ski8/Rec103 homolog in Arabidopsis. Genes Cells 11: 615-622 Kadaba S, Krueger A, Trice T, Krecic AM, Hinnebusch AG, Anderson J (2004) Nuclear surveillance and degradation of hypomodified initiator tRNAMet in S. cerevisiae. Genes Dev 18: 1227-1240 Kadaba S, Wang X, Anderson JT (2006) Nuclear RNA surveillance in Saccharomyces cerevisiae: Trf4p-dependent polyadenylation of nascent hypomethylated tRNA and an aberrant form of 5S rRNA. RNA 12: 508-521 Kader JC (1996) Lipid-Transfer Proteins in Plants. Annu Rev Plant Physiol Plant Mol Biol 47: 627-654 Kamigaki A, Kondo M, Mano S, Hayashi M, Nishimura M (2009) Suppression of peroxisome biogenesis factor 10 reduces cuticular wax accumulation by disrupting the ER network in Arabidopsis thaliana. Plant Cell Physiol 50: 126  2034-2046 Kannangara R, Branigan C, Liu Y, Penfield T, Rao V, Mouille G, Hofte H, Pauly M, Riechmann JL, Broun P (2007) The transcription factor WIN1/SHN1 regulates Cutin biosynthesis in Arabidopsis thaliana. Plant Cell 19: 1278-1294 Kidner CA, Martienssen RA (2005) The role of ARGONAUTE1 (AGO1) in meristem formation and identity. Dev Biol 280: 504–517 Kim H, Lee SB, Kim HJ, Min MK, Hwang I, Suh MC (2012) Characterization of glycosylphosphatidylinositol-anchored lipid transfer protein 2 (LTPG2) and overlapping function between LTPG/LTPG1 and LTPG2 in cuticular wax export or accumulation in Arabidopsis thaliana. Plant Cell Physiol 53: 1391-1403 Kim S, Yamaoka Y, Ono H, Kim H, Shim D, Maeshima M, Martinoia E, Cahoon EB, Nishida I, Lee Y (2013) AtABCA9 transporter supplies fatty acids for lipid synthesis to the endoplasmic reticulum. Proc Natl Acad Sci U S A 110: 773-778 Kiyosue T, Yamaguchi-Shinozaki K, Shinozaki K (1994) Characterization of two cDNAs (ERD10 and ERD14) corresponding to genes that respond rapidly to dehydration stress in Arabidopsis thaliana. Plant Cell Physiol 35: 225–231 Kobayashi K, Otegui MS, Krishnakumar S, Mindrinos M, Zambryski P (2007) INCREASED SIZE EXCLUSION LIMIT2 encodes a putative DEVH box RNA helicase involved in plasmodesmata function during Arabidopsis embryogenesis. Plant Cell 19: 1885-1897 Koncz C, Schell J (1986) The promoter of TL-DNA gene 5 controls the tissue-specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector. Mol. Gen. Genet. 204: 383–396 Koo AJ, Ohlrogge JB, Pollard M (2004) On the export of fatty acids from the chloroplast. J Biol Chem 279: 16101-16110 Koornneef M, Hanhart CJ, Thiel F (1989) A Genetic and Phenotypic Description of Eceriferum (Cer) Mutants in Arabidopsis-Thaliana. Journal of Heredity 80: 118-122 Kosma DK, Bourdenx B, Bernard A, Parsons EP, Lu S, Joubes J, Jenks MA (2009) The impact of water deficiency on leaf cuticle lipids of Arabidopsis. Plant Physiol 151: 1918-1929 Kumakura N, Takeda A, Fujioka Y, Motose H, Takano R, Watanabe Y (2009) SGS3 and RDR6 interact and colocalize in cytoplasmic SGS3/RDR6-bodies. FEBS Lett 583: 1261-1266 Kunst L, Samuels AL (2003) Biosynthesis and secretion of plant cuticular wax. Prog Lipid Res 42: 51-80 Kunst L, Samuels L (2009) Plant cuticles shine: advances in wax biosynthesis and export. Curr Opin Plant Biol 12: 721–727 Kurata T, Kawabata-Awai C, Sakuradani E, Shimizu S, Okada K, Wada T (2003) The YORE-YORE gene regulates multiple aspects of epidermal cell differentiation in Arabidopsis. Plant J 36: 55-66 127  LaCava J, Houseley J, Saveanu C, Petfalski E, Thompson E, Jacquier A, Tollervey D (2005) RNA degradation by the exosome is promoted by a nuclear polyadenylation complex. Cell 121: 713-724 Lai C, Kunst L, Jetter R (2007) Composition of alkyl esters in the cuticular wax on inflorescence stems of Arabidopsis thaliana cer mutants. Plant J 50: 189-196 Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, components of RNA-mediated gene silencing, are required for the regulation of cuticular wax biosynthesis in developing inflorescence stems of Arabidopsis. Plant Physiol 159: 1385–1395 Lam P, Zhao L, Eveleigh N, Yu Y, Chen X, Kunst L (2015) The exosome and trans-acting small interfering RNAs regulate cuticular wax biosynthesis during Arabidopsis inflorescence stem development. Plant Physiol 167: 323-336 Lamesch P, Berardini TZ, Li D, Swarbreck D, Wilks C, Sasidharan R, Muller R, Dreher K, Alexander DL, Garcia-Hernandez M, et al (2012) The Arabidopsis Information Resource (TAIR): improved gene annotation and new tools. Nucleic Acids Res 40: D1202–D1210 Lange H, Gagliardi D (2010) The exosome and 3'-5' RNA degradation in plants. Adv Exp Med Biol 702: 50-62 Lange H, Holec S, Cognat V, Pieuchot L, Le Ret M, Canaday J, Gagliardi D (2008) Degradation of a polyadenylated rRNA maturation by-product involves one of the three RRP6-Like proteins in Arabidopsis thaliana. Molecular and Cellular Biology 28: 3038-3044 Langmead B, Trapnell C, Pop M, Salzberg SL (2009) Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10: R25 Lassner MW, Lardizabal K, Metz JG (1996) A jojoba beta-Ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants. Plant Cell 8: 281-292 Laubinger S, Zeller G, Henz SR, Sachsenberg T, Widmer CK, Naouar N, Vuylsteke M, Scholkopf B, Ratsch G, Weigel D (2008) At-TAX: a whole genome tiling array resource for developmental expression analysis and transcript identification in Arabidopsis thaliana. Genome Biol 9: R112 Lebreton A, Tomecki R, Dziembowski A, Seraphin B (2008) Endonucleolytic RNA cleavage by a eukaryotic exosome. Nature 456: 993-U987 Lee SB, Go YS, Bae HJ, Park JH, Cho SH, Cho HJ, Lee DS, Park OK, Hwang I, Suh MC (2009) Disruption of glycosylphosphatidylinositol-anchored lipid transfer protein gene altered cuticular lipid composition, increased plastoglobules, and enhanced susceptibility to infection by the fungal pathogen Alternaria brassicicola. Plant Physiol 150: 42-54 Lee SB, Suh MC (2014) Cuticular Wax Biosynthesis is Up-Regulated by the MYB94 Transcription Factor in Arabidopsis. Plant Cell Physiol  Lejeune F, Li X, Maquat LE (2003) Nonsense-mediated mRNA decay in mammalian 128  cells involves decapping, deadenylating, and exonucleolytic activities. Mol Cell 12: 675-687 Li F, Wu X, Lam P, Bird D, Zheng H, Samuels L, Jetter R, Kunst L (2008) Identification of the wax ester synthase/acyl-coenzyme A: diacylglycerol acyltransferase WSD1 required for stem wax ester biosynthesis in Arabidopsis. Plant Physiol 148: 97-107 Li J, Yang Z, Yu B, Liu J, Chen X (2005) Methylation protects miRNAs and siRNAs from a 39-end uridylation activity in Arabidopsis. Curr Biol 15: 1501–1507 Libri D, Dower K, Boulay J, Thomsen R, Rosbash M, Jensen TH (2002) Interactions between mRNA export commitment, 3'-end quality control, and nuclear degradation. Mol Cell Biol 22: 8254-8266 Liu Q, Greimann JC, Lima CD (2006) Reconstitution, activities, and structure of the eukaryotic RNA exosome. Cell 127: 1223-1237 Liu QS, Greimann JC, Lima CD (2007) Reconstitution, activities, and structure of the eukaryotic RNA exosome (vol 127, pg 1223, 2006). Cell 131: 188-189 Lolle SJ, Hsu W, Pruitt RE (1998) Genetic analysis of organ fusion in Arabidopsis thaliana. Genetics 149: 607-619 Lu S, Song T, Kosma DK, Parsons EP, Rowland O, Jenks MA (2009) Arabidopsis CER8 encodes LONG-CHAIN ACYL-COA SYNTHETASE 1 (LACS1) that has overlapping functions with LACS2 in plant wax and cutin synthesis. Plant J 59: 553-564 Lu S, Zhao H, Des Marais DL, Parsons EP, Wen X, Xu X, Bangarusamy DK, Wang G, Rowland O, Juenger T, Bressan RA, Jenks MA (2012) Arabidopsis ECERIFERUM9 involvement in cuticle formation and maintenance of plant water status. Plant Physiol 159: 930-944 Makino DL, Baumgartner M, Conti E (2013) Crystal structure of an RNA-bound 11-subunit eukaryotic exosome complex. Nature 495: 70-75 Maldonado-Bonilla LM (2013) Composition and function of P bodies in Arabidopsis thaliana. Front. Plant Sci. 5:201. doi: 10.3389/fpls.2014.00201 McCarthyDJ, Chen Y, SmythGK (2012) Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids Res 40: 4288–4297 McFarlane HE, Shin JJ, Bird DA, Samuels AL (2010) Arabidopsis ABCG transporters, which are required for export of diverse cuticular lipids, dimerize in different combinations. Plant Cell 22: 3066-3075 McFarlane HE, Watanabe Y, Yang W, Huang Y, Ohlrogge J, Samuels AL (2014) Golgi- and trans-Golgi network-mediated vesicle trafficking is required for wax secretion from epidermal cells. Plant Physiol 164: 1250-1260 Mcnevin JP, Woodward W, Hannoufa A, Feldmann KA, Lemieux B (1993) Isolation and Characterization of Eceriferum (Cer) Mutants Induced by T-DNA Insertions in Arabidopsis-Thaliana. Genome 36: 610-618 129  Metz JG, Pollard MR, Anderson L, Hayes TR, Lassner MW (2000) Purification of a jojoba embryo fatty acyl-coenzyme A reductase and expression of its cDNA in high erucic acid rapeseed. Plant Physiol 122: 635-644 Millar AA, Clemens S, Zachgo S, Giblin EM, Taylor DC, Kunst L (1999) CUT1, an Arabidopsis gene required for cuticular wax biosynthesis and pollen fertility, encodes a very-long-chain fatty acid condensing enzyme. Plant Cell 11: 825-838 Millar AA, Kunst L (1997) Very-long-chain fatty acid biosynthesis is controlled through the expression and specificity of the condensing enzyme. Plant J 12: 121-131 Milligan L, Decourty L, Saveanu C, Rappsilber J, Ceulemans H, Jacquier A, Tollervey D (2008) A yeast exosome cofactor, Mpp6, functions in RNA surveillance and in the degradation of noncoding RNA transcripts. Mol Cell Biol 28: 5446-5457 Mitchell P, Petfalski E, Houalla R, Podtelejnikov A, Mann M, Tollervey D (2003) Rrp47p is an exosome-associated protein required for the 3' processing of stable RNAs. Mol Cell Biol 23: 6982-6992 Mitchell P, Petfalski E, Shevchenko A, Mann M, Tollervey D (1997) The exosome: A conserved eukaryotic RNA processing complex containing multiple 3'->5' exoribonucleases. Cell 91: 457-466 Mitchell P, Tollervey D (2003) An NMD pathway in yeast involving accelerated deadenylation and exosome-mediated 3'-->5' degradation. Mol Cell 11: 1405-1413 Moto K, Yoshiga T, Yamamoto M, Takahashi S, Okano K, Ando T, Nakata T, Matsumoto S (2003) Pheromone gland-specific fatty-acyl reductase of the silkmoth, Bombyx mori. Proc Natl Acad Sci U S A 100: 9156-9161 Mourrain P, Béclin C, Elmayan T, Feuerbach F, Godon C, Morel J-B, Jouette D, Lacombe A-M, Nikic S, Picault N (2000) Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell 101: 533–542 Nakagawa T, Kurose T, Hino T, Tanaka K, Kawamukai M, Niwa Y, Toyooka K, Matsuoka K, Jinbo T, Kimura T (2007) Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. J Biosci Bioeng 104: 34–41 Nakagawa T, Nakamura S, Tanaka K, Kawamukai M, Suzuki T, Nakamura K, Kimura T, Ishiguro S (2008) Development of R4 gateway binary vectors (R4pGWB) enabling high-throughput promoter swapping for plant research. Biosci Biotechnol Biochem 72: 624-629 Nawrath C (2006) Unraveling the complex network of cuticular structure and function. Curr Opin Plant Biol 9: 281–287 Nogueira FT, Chitwood DH, Madi S, Ohtsu K, Schnable PS, Scanlon MJ, Timmermans MC (2009) Regulation of small RNA accumulation in the maize shoot apex. PLoS Genet 5: e1000320 130  Ohlrogge J, Browse J (1995) Lipid biosynthesis. Plant Cell 7: 957-970 Orban TI, Izaurralde E (2005) Decay of mRNAs targeted by RISC requires XRN1, the Ski complex, and the exosome. RNA 11: 459-469 Oshima Y, Mitsuda N (2013) The MIXTA-like transcription factor MYB16 is a major regulator of cuticle formation in vegetative organs. Plant Signal Behav 8: e26826 Oshima Y, Mitsuda N, Nakata M, Nakagawa T, Nagaya S, Kato K, Ohme-Takagi M (2011) Novel vector systems to accelerate functional analysis of transcription factors using chimeric repressor gene-silencing technology (CRES-T). Plant Biotechnology 28: 201-210 Oshima Y, Shikata M, Koyama T, Ohtsubo N, Mitsuda N, Ohme-Takagi M (2013) MIXTA-like transcription factors and WAX INDUCER1/SHINE1 coordinately regulate cuticle development in Arabidopsis and Torenia fournieri. Plant Cell 25: 1609-1624 Panikashvili D, Savaldi-Goldstein S, Mandel T, Yifhar T, Franke RB, Hofer R, Schreiber L, Chory J, Aharoni A (2007) The Arabidopsis DESPERADO/AtWBC11 transporter is required for cutin and wax secretion. Plant Physiol 145: 1345-1360 Panikashvili D, Shi JX, Bocobza S, Franke RB, Schreiber L, Aharoni A (2010) The Arabidopsis DSO/ABCG11 transporter affects cutin metabolism in reproductive organs and suberin in roots. Mol Plant 3: 563-575 Pascal S, Bernard A, Sorel M, Pervent M, Vile D, Haslam RP, Napier JA, Lessire R, Domergue F, Joubes J (2013) The Arabidopsis cer26 mutant, like the cer2 mutant, is specifically affected in the very long chain fatty acid elongation process. Plant J 73: 733-746 Paul S, Gable K, Beaudoin F, Cahoon E, Jaworski J, Napier JA, Dunn TM (2006) Members of the Arabidopsis FAE1-like 3-ketoacyl-CoA synthase gene family substitute for the Elop proteins of Saccharomyces cerevisiae. J Biol Chem 281: 9018-9029 Peng WT, Robinson MD, Mnaimneh S, Krogan NJ, Cagney G, Morris Q, Davierwala AP, Grigull J, Yang X, Zhang W, Mitsakakis N, Ryan OW, Datta N, Jojic V, Pal C, Canadien V, Richards D, Beattie B, Wu LF, Altschuler SJ, Roweis S, Frey BJ, Emili A, Greenblatt JF, Hughes TR (2003) A panoramic view of yeast noncoding RNA processing. Cell 113: 919-933 Peragine A, Yoshikawa M, Wu G, Albrecht HL, Poethig RS (2004) SGS3 and SGS2/SDE1/RDR6 are required for juvenile development and the production of trans-acting siRNAs in Arabidopsis. Genes Dev 18: 2368-2379 Péret B, Swarup K, Ferguson A, Seth M, Yang Y, Dhondt S, James N, Casimiro I, Perry P, Syed A, et al (2012) AUX/LAX genes encode a family of auxin influx transporters that perform distinct functions during Arabidopsis development. Plant Cell 24: 2874–2885 Pfaffl MW (2001) A new mathematical model for relative quantification in real-time 131  RT–PCR. Nucleic Acids Res 29: e45 Pighin JA, Zheng H, Balakshin LJ, Goodman IP, Western TL, Jetter R, Kunst L, Samuels AL (2004) Plant cuticular lipid export requires an ABC transporter. Science 306: 702-704 Pollard M, Beisson F, Li Y, Ohlrogge JB (2008) Building lipid barriers: biosynthesis of cutin and suberin. Trends Plant Sci 13: 236–246 Pollard MR, Mckeon T, Gupta LM, Stumpf PK (1979) Studies on Biosynthesis of Waxes by Developing Jojoba Seed .2. Demonstration of Wax Biosynthesis by Cell-Free Homogenates. Lipids 14: 651-662 Pulsifer IP, Kluge S, Rowland O (2012) Arabidopsis long-chain acyl-CoA synthetase 1 (LACS1), LACS2, and LACS3 facilitate fatty acid uptake in yeast. Plant Physiol Biochem 51: 31-39 Raffaele S, Vailleau F, Leger A, Joubes J, Miersch O, Huard C, Blee E, Mongrand S, Domergue F, Roby D (2008) A MYB transcription factor regulates very-long-chain fatty acid biosynthesis for activation of the hypersensitive cell death response in Arabidopsis. Plant Cell 20: 752-767 Rashotte AM, Jenks MA, Nguyen TD, Feldmann KA (1997) Epicuticular wax variation in ecotypes of Arabidopsis thaliana. Phytochemistry 45: 251-255 Rashotte AM, Jenks MA, Ross AS, Feldmann KA (2004) Novel eceriferum mutants in Arabidopsis thaliana. Planta 219: 5-13 Reicosky DA, Hanover JW (1978) Physiological Effects of Surface Waxes: I. Light Reflectance for Glaucous and Nonglaucous Picea pungens. Plant Physiol 62: 101-104 Riederer M, Muller C (2006) Biology of the plant cuticle (Blackwell Publishing Ltd: Oxford, UK) Riederer M, Schreiber L (2001) Protecting against water loss: analysis of the barrier properties of plant cuticles. J Exp Bot 52: 2023-2032 Robinson MD, McCarthy DJ, Smyth GK (2010) edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26: 139–140 Roudier F, Gissot L, Beaudoin F, Haslam R, Michaelson L, Marion J, Molino D, Lima A, Bach L, Morin H, Tellier F, Palauqui JC, Bellec Y, Renne C, Miquel M, Dacosta M, Vignard J, Rochat C, Markham JE, Moreau P, Napier J, Faure JD (2010) Very-long-chain fatty acids are involved in polar auxin transport and developmental patterning in Arabidopsis. Plant Cell 22: 364-375 Rowland O, Lee R, Franke R, Schreiber L, Kunst L (2007) The CER3 wax biosynthetic gene from Arabidopsis thaliana is allelic to WAX2/YRE/FLP1. FEBS Lett 581: 3538-3544 Rowland O, Zheng H, Hepworth SR, Lam P, Jetter R, Kunst L (2006) CER4 encodes an alcohol-forming fatty acyl-coenzyme A reductase involved in cuticular wax production in Arabidopsis. Plant Physiol 142: 866-877 132  Rowland O, Zheng HQ, Hepworth SR, Lam P, Jetter R, Kunst L (2006) CER4 encodes an alcohol-forming fatty acyl-coenzyme A reductase involved in cuticular wax production in Arabidopsis. Plant Physiology 142: 866-877 Sakuradani E, Zhao L, Haslam TM, Kunst L (2013) The CER22 gene required for the synthesis of cuticular wax alkanes in Arabidopsis thaliana is allelic to CER1. Planta 237: 731-738 Salas JJ, Ohlrogge JB (2002) Characterization of substrate specificity of plant FatA and FatB acyl-ACP thioesterases. Arch Biochem Biophys 403: 25-34 Samuels L, Kunst L, Jetter R (2008) Sealing plant surfaces: cuticular wax formation by epidermal cells. Annu Rev Plant Biol 59: 683-707 Schaeffer D, Tsanova B, Barbas A, Reis FP, Dastidar EG, Sanchez-Rotunno M, Arraiano CM, van Hoof A (2009) The exosome contains domains with specific endoribonuclease, exoribonuclease and cytoplasmic mRNA decay activities. Febs Journal 276: 218-219 Schilders G, Raijmakers R, Raats JM, Pruijn GJ (2005) MPP6 is an exosome-associated RNA-binding protein involved in 5.8S rRNA maturation. Nucleic Acids Res 33: 6795-6804 Schilders G, van Dijk E, Pruijn GJ (2007) C1D and hMtr4p associate with the human exosome subunit PM/Scl-100 and are involved in pre-rRNA processing. Nucleic Acids Res 35: 2564-2572 Schneider C, Leung E, Brown J, Tollervey D (2009) The N-terminal PIN domain of the exosome subunit Rrp44 harbors endonuclease activity and tethers Rrp44 to the yeast core exosome. Nucleic Acids Research 37: 1127-1140 Schwab R, Maizel A, Ruiz-Ferrer V, Garcia D, Bayer M, Crespi M, Voinnet O, Martienssen RA (2009) Endogenous tasiRNAs mediate noncell autonomous effects on gene regulation in Arabidopsis thaliana. PLoS ONE 4: e5980 Seo PJ, Lee SB, Suh MC, Park MJ, Go YS, Park CM (2011) The MYB96 transcription factor regulates cuticular wax biosynthesis under drought conditions in Arabidopsis. Plant Cell 23: 1138-1152 Shepherd T, Wynne Griffiths D (2006) The effects of stress on plant cuticular waxes. New Phytol 171: 469-499 Shi JX, Malitsky S, De Oliveira S, Branigan C, Franke RB, Schreiber L, Aharoni A (2011) SHINE transcription factors act redundantly to pattern the archetypal surface of Arabidopsis flower organs. PLoS Genet 7: e1001388 Shimakata T, Stumpf PK (1982) Isolation and function of spinach leaf beta-ketoacyl-[acyl-carrier-protein] synthases. Proc Natl Acad Sci U S A 79: 5808-5812 Shimakata T, Stumpf PK (1984) [Fatty acid synthetase of higher plants]. Tanpakushitsu Kakusan Koso 29: 249-265 Sieber P, Schorderet M, Ryser U, Buchala A, Kolattukudy P, Metraux JP, Nawrath C (2000) Transgenic Arabidopsis plants expressing a fungal cutinase show 133  alterations in the structure and properties of the cuticle and postgenital organ fusions. Plant Cell 12: 721-738 Somerville CR, Ogren WL (1982) Isolation of photorespiratory mutants of Arabidopsis. In Methods in chloroplast molecular biology Elsevier, New York, pp 129–139 Stirnimann CU, Petsalaki E, Russell RB, Muller CW (2010) WD40 proteins propel cellular net works. Trends Biochem. Sci. 35: 565-574 Suh MC, Go YS (2014) DEWAX-mediated transcriptional repression of cuticular wax biosynthesis in Arabidopsis thaliana. Plant Signal Behav 9 Suh MC, Samuels AL, Jetter R, Kunst L, Pollard M, Ohlrogge J, Beisson F (2005) Cuticular lipid composition, surface structure, and gene expression in Arabidopsis stem epidermis. Plant Physiol 139: 1649-1665 Takagi N, Ueguchi C (2012) Enhancement of meristem formation by bouquet-1, a mis-sense allele of the VERNALIZATION INDEPENDENCE 3 gene encoding a WD40 repeat protein in Arabidopsis thaliana. Genes to Cells 17: 982-993 Takahashi S, Araki Y, Sakuno T, Katada T (2003) Interaction between Ski7p and Upf1p is required for nonsense-mediated 3'-to-5' mRNA decay in yeast. EMBO J 22: 3951-3959 Tollervey D (2006) Molecular biology: RNA lost in translation. Nature 440: 425-426 Torchet C, Bousquet-Antonelli C, Milligan L, Thompson E, Kufel J, Tollervey D (2002) Processing of 3'-extended read-through transcripts by the exosome can generate functional mRNAs. Mol Cell 9: 1285-1296 Trenkamp S, Martin W, Tietjen K (2004) Specific and differential inhibition of very-long-chain fatty acid elongases from Arabidopsis thaliana by different herbicides. Proc Natl Acad Sci U S A 101: 11903-11908 Ukitsu H, Kuromori T, Toyooka K, Goto Y, Matsuoka K, Sakuradani E, Shimizu S, Kamiya A, Imura Y, Yuguchi M, Wada T, Hirayama T, Shinozaki K (2007) Cytological and biochemical analysis of COF1, an Arabidopsis mutant of an ABC transporter gene. Plant Cell Physiol 48: 1524-1533 Vailleau F, Daniel X, Tronchet M, Montillet JL, Triantaphylides C, Roby D (2002) A R2R3-MYB gene, AtMYB30, acts as a positive regulator of the hypersensitive cell death program in plants in response to pathogen attack. Proc Natl Acad Sci U S A 99: 10179-10184 van Hoof A, Frischmeyer PA, Dietz HC, Parker R (2002) Exosome-mediated recognition and degradation of mRNAs lacking a termination codon. Science 295: 2262-2264 van Hoof A, Parker R (1999) The exosome: A proteasome for RNA? Cell 99: 347-350 van Hoof A, Staples RR, Baker RE, Parker R (2000) Function of the ski4p (Csl4p) and Ski7p proteins in 3'-to-5' degradation of mRNA. Mol Cell Biol 20: 8230-8243 Vanacova S, Wolf J, Martin G, Blank D, Dettwiler S, Friedlein A, Langen H, Keith G, Keller W (2005) A new yeast poly(A) polymerase complex involved in RNA quality control. PLoS Biol 3: e189 134  Varkonyi-Gasic E, Wu R, Wood M, Walton EF, Hellens RP (2007) Protocol: a highly sensitive RT-PCR method for detection and quantification of microRNAs. Plant Methods 3: 12 Vazquez F, Vaucheret H, Rajagopalan R, Lepers C, Gasciolli V, Mallory AC, Hilbert JL, Bartel DP, Crete P (2004) Endogenous trans-acting siRNAs regulate the accumulation of Arabidopsis mRNAs. Mol Cell 16: 69-79 Vioque J, Kolattukudy PE (1997) Resolution and purification of an aldehyde-generating and an alcohol-generating fatty acyl-CoA reductase from pea leaves (Pisum sativum L.). Arch Biochem Biophys 340: 64-72 Voelker TA, Jones A, Cranmer AM, Davies HM, Knutzon DS (1997) Broad-range and binary-range acyl-acyl-carrier protein thioesterases suggest an alternative mechanism for medium-chain production in seeds. Plant Physiol 114: 669-677 von Wettstein-Knowles P (2012) Plant waxes. In eLS. John Wiley & Sons, Chichester, UK, 10.1002/9780470015902.a0001919.pub2 ( July 2014) Wang L, Lewis MS, Johnson AW (2005) Domain interactions within the Ski2/3/8 complex and between the Ski complex and Ski7p. RNA 11: 1291-1302 Wang ZY, Xiong L, Li W, Zhu JK, Zhu J (2011) The plant cuticle is required for osmotic stress regulation of abscisic acid biosynthesis and osmotic stress tolerance in Arabidopsis. Plant Cell 23: 1971-1984 Wasmuth EV, Lima CD (2012) Exo- and endoribonucleolytic activities of yeast cytoplasmic and nuclear RNA exosomes are dependent on the noncatalytic core and central channel. Mol Cell 48: 133-144 Weng H, Molina I, Shockey J, Browse J (2010) Organ fusion and defective cuticle function in a lacs1 lacs2 double mutant of Arabidopsis. Planta 231: 1089-1100 Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, Waterhouse PM (2001) Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J 27: 581-590 Western TL, Cheng YL, Liu J, Chen XM (2002) HUA ENHANCER2, a putative DExM-box RNA helicase, maintains homeotic B and C gene expression in Arabidopsis. Development 129: 1569-1581 Williams L, Carles CC, Osmont KS, Fletcher JC (2005) A database analysis method identifies an endogenous trans-acting short-interfering RNA that targets the Arabidopsis ARF2, ARF3, and ARF4 genes. Proc Natl Acad Sci USA 102: 9703–9708 Wu R, Li S, He S, Wassmann F, Yu C, Qin G, Schreiber L, Qu LJ, Gu H (2011) CFL1, a WW domain protein, regulates cuticle development by modulating the function of HDG1, a class IV homeodomain transcription factor, in rice and Arabidopsis. Plant Cell 23: 3392-3411 Wyers F, Rougemaille M, Badis G, Rousselle JC, Dufour ME, Boulay J, Regnault B, Devaux F, Namane A, Seraphin B, Libri D, Jacquier A (2005) Cryptic pol II 135  transcripts are degraded by a nuclear quality control pathway involving a new poly(A) polymerase. Cell 121: 725-737 Xie Z, Johansen LK, Gustafson AM, Kasschau KD, Lellis AD, Zilberman D, Jacobsen SE, Carrington JC (2004) Genetic and functional diversification of small RNA pathways in plants. PLoS Biol 2: e104 Xie Z, Qi X (2008) Diverse small RNA-directed silencing pathways in plants. Biochim Biophys Acta 1779: 720-724 Yeats TH, Rose JK (2008) The biochemistry and biology of extracellular plant lipid-transfer proteins (LTPs). Protein Sci 17: 191-198 Yeats TH, Rose JK (2013) The formation and function of plant cuticles. Plant Physiol 163: 5-20 Yoshikawa M, Peragine A, Park MY, Poethig RS (2005) A pathway for the biogenesis of trans-acting siRNAs in Arabidopsis. Gene Dev 19: 2164 –2175 Yu B, Bi L, Zhai J, Agarwal M, Li S, Wu Q, Ding SW, Meyers BC, Vaucheret H, Chen X (2010) siRNAs compete with miRNAs for methylation by HEN1 in Arabidopsis. Nucleic Acids Res 38: 5844–5850 Yu B, Yang Z, Li J, Minakhina S, Yang M, Padgett RW, Steward R, Chen X (2005) Methylation as a crucial step in plant microRNA biogenesis. Science 307: 932–935 Yu D, Fan B, MacFarlane SA, Chen Z (2003) Analysis of the involvement of an inducible Arabidopsis RNA-dependent RNA polymerase in antiviral defense. Mol Plant Microbe Interact 16: 206-216 Zhang JY, Broeckling CD, Blancaflor EB, Sledge MK, Sumner LW, Wang ZY (2005) Overexpression of WXP1, a putative Medicago truncatula AP2 domain-containing transcription factor gene, increases cuticular wax accumulation and enhances drought tolerance in transgenic alfalfa (Medicago sativa). Plant J 42: 689–707 Zhang Z, Schwartz S, Wagner L, Miller W (2000). A greedy algorithm for aligning DNA sequences. J Comput Biol 7: 203–214 Zhao H, Zhang H, Cui P, Ding F, Wang G, Li R, Jenks MA, Lu S, Xiong L (2014) The Putative E3 Ubiquitin Ligase ECERIFERUM9 Regulates Abscisic Acid Biosynthesis and Response during Seed Germination and Postgermination Growth in Arabidopsis. Plant Physiol 165: 1255-1268 Zheng H, Rowland O, Kunst L (2005) Disruptions of the Arabidopsis Enoyl-CoA reductase gene reveal an essential role for very-long-chain fatty acid synthesis in cell expansion during plant morphogenesis. Plant Cell 17: 1467-1481 Zhu B, Mandal SS, Pham AD, Zheng Y, Erdjument-Bromage H, Batra SK, Tempst P, Reinberg D (2005) The human PAF complex coordinates transcription with events downstream of RNA synthesis. Genes Dev 19: 1668-1673 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0135698/manifest

Comment

Related Items