Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Mechanisms of survival against desiccation and associated stresses of the soil-residing actinomycete… LeBlanc, Justin Christian 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2015_february_leblanc_justin.pdf [ 3.35MB ]
Metadata
JSON: 24-1.0135656.json
JSON-LD: 24-1.0135656-ld.json
RDF/XML (Pretty): 24-1.0135656-rdf.xml
RDF/JSON: 24-1.0135656-rdf.json
Turtle: 24-1.0135656-turtle.txt
N-Triples: 24-1.0135656-rdf-ntriples.txt
Original Record: 24-1.0135656-source.json
Full Text
24-1.0135656-fulltext.txt
Citation
24-1.0135656.ris

Full Text

MECHANISMS OF SURVIVAL AGAINST DESICCATION AND ASSOCIATED STRESSES OF THE SOIL-RESIDING ACTINOMYCETE RHODOCOCCUS JOSTII STRAIN RHA1  by Justin Christian LeBlanc  B.Sc.H., Queen’s University, 2004   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2014  © Justin Christian LeBlanc, 2014   ii Abstract  Actinomycetes are an abundant bacterial group in soil, with a critical role in the decomposition of organic matter.  Rhodococcus jostii strain RHA1 is of particular interest to the field of bioremediation because it can degrade a broad range of organic compounds, both natural and xenobiotic.  Understanding the factors contributing to the desiccation resistance of RHA1 will enrich our basic knowledge of this common soil stress and may help advance bioremediation technologies for contaminated soils subject to droughts. Here I report the first transcriptomic analysis of a Gram-positive bacterium during desiccation.  Filtered RHA1 cells incubated at either low relative humidity, as an air-drying treatment, or high relative humidity, as a control, were transcriptionally profiled over a comprehensive time series.  Also, the morphology of RHA1 cells was characterized by cryofixation scanning electron microscopy during each treatment.  Desiccation resulted in a transcriptional response of 819 differentially regulated genes, 8-times more than in the control.  Included among the highly up-regulated desiccation-specific genes was dps1 (induced 33-fold), encoding an oxidative stress protection protein which has not previously been directly associated with desiccation, as well as sigF3 (induced 58-fold), encoding a sigma factor possibly involved in the regulatory response to desiccation. RHA1 mutants with dps1 or both of its dps homologs deleted were challenged with oxidative stressors under a variety of assay conditions.  The mutants were also exposed to physiological stresses that generate reactive oxygen species intracellularly, including desiccation.  In all cases, the dps− mutants did not have impaired oxidative stress resistance – a novel finding with respect to bacterial dps-null strains.  Additionally, the RHA1 dps-null mutant did not have substantially lower survival compared to the wild type when challenged with metal toxicity or DNA-damaging agents or when they were cocultured through multiple cycles of starvation.  Nevertheless, expression of RHA1 dps1 in an Escherichia coli dps– mutant restored its hydrogen peroxide resistance.  Purified RHA1 Dps1 was shown to have ferroxidase activity and thereby to protect DNA from oxidative damage.  The general insensitivity of the RHA1 dps-null mutant may be representative of a large group of Actinobacteria for which robust oxidative stress tolerance is an important adaptation.    iii Preface  The course of my thesis research was planned in consultation with William W. Mohn. Material from a published paper (J. C. LeBlanc, E. R. Gonçalves, and W. W. Mohn, Appl. Environ. Microbiol. 74:2627–2636, 2008) has been adapted and incorporated into this thesis, mostly in Chapter 2 but also in the Abstract and section 1.3.  With respect to this work, Edmilson R. Gonçalves was the major contributor in designing the microarray experiments, of which he performed half.  He produced the data related to the desiccation transcriptome of RHA1, and likewise, I produced those related to the control transcriptome.  All other experiments from this paper were designed and performed by me, including those to validate the microarray results and to look for morphological adaptations.  I was responsible for data analysis and writing the paper. The rest of the work presented in this thesis was designed, conducted, and written by me, save for the purification of the RHA1 Dps proteins.  Somalinga Vijayakumar successfully purified RHA1 Dps1 in its native form, and he attempted to isolate Dps2.  He also drafted the corresponding methods, which I edited for subsection 4.2.4.   iv Table of Contents  Abstract .......................................................................................................................................... ii Preface ........................................................................................................................................... iii Table of Contents ......................................................................................................................... iv List of Tables .............................................................................................................................. viii List of Figures ............................................................................................................................... ix List of Abbreviations .....................................................................................................................x List of Abbreviations .....................................................................................................................x Acknowledgements ...................................................................................................................... xi Dedication .................................................................................................................................... xii Chapter 1:  Introduction ...............................................................................................................1 1.1. Use of microbial bioremediation in environmental cleanup ................................................1 1.2. Rhodococcus jostii strain RHA1 as a model organism for microbial bioremediation .........4 1.3. Bacterial desiccation resistance mechanisms .......................................................................8 1.4. Adaptations to environmental stresses by Rhodococcus and related actinomycetes .........10 1.4.1. Developmental responses to starvation ......................................................................10 1.4.2. Global regulation of responses to stress .....................................................................12 1.4.3. Mechanisms for combatting oxidative stress ..............................................................15 1.5. The myriad roles of Dps proteins in bacterial stress responses .........................................17 1.6. Thesis objectives and approach .........................................................................................21 Chapter 2:  Global Response of RHA1 to Desiccation Stress ..................................................22 2.1. Rationale ............................................................................................................................22 2.2. Materials and methods .......................................................................................................22 2.2.1. Growth conditions ......................................................................................................22 2.2.2. Desiccation stress treatments ......................................................................................22 2.2.3. Cryofixation SEM .......................................................................................................23 2.2.4. Transcriptomic analysis ..............................................................................................24 2.2.5. Microarray data ...........................................................................................................25 2.2.6. Reverse transcription–quantitative PCR .....................................................................25    v 2.3. Results ................................................................................................................................27 2.3.1. Drying rates and cell survival at low and high relative humidity ...............................27 2.3.2. Morphological adaptations .........................................................................................27 2.3.3. Desiccation-specific transcriptome .............................................................................30 2.3.4. Desiccation-specific genes up-regulated at 12 h ........................................................34 2.3.5. Congruency between microarray and RT-qPCR results .............................................35 2.3.6. Genes up-regulated early in response to common starvation stress ...........................37 2.4. Discussion ..........................................................................................................................38 2.4.1. Veritable desiccation resistance ..................................................................................38 2.4.2. Mechanisms of protection from desiccation-induced damage ...................................39 2.4.3. Comparison of bacterial desiccation responses ..........................................................41 Chapter 3:  Wild-Type-Like Stress Resistance of RHA1 dps Mutants..................................43 3.1. Rationale ............................................................................................................................43 3.2. Materials and methods .......................................................................................................43 3.2.1. Growth conditions ......................................................................................................43 3.2.2. General genetic methods .............................................................................................44 3.2.3. Construction of knockout mutants ..............................................................................45 3.2.4. Cell length measurement ............................................................................................46 3.2.5. H2O2 stress assay ........................................................................................................46 3.2.6. Desiccation resistance assay .......................................................................................47 3.2.7. Growth inhibition assay by diffusion of chemical stressors from paper disks ...........47 3.2.8. Metal toxicity assays ...................................................................................................48 3.2.9. UV radiation resistance assay .....................................................................................48 3.2.10. Quantification of strain abundance within mixed cultures of the dps-null mutant and wild-type RHA1 ...................................................................................................48 3.2.11. Statistics ......................................................................................................................49 3.3. Results ................................................................................................................................50 3.3.1. Creation of RHA1 dps1 and dps-null mutants ..........................................................50 3.3.2. General growth characterization of the dps mutants .................................................50 3.3.3. Insensitivity of dps1 mutant to oxidative and desiccative stresses ...........................52 3.3.4. Insensitivity of dps-null mutant to oxidative stresses .................................................52  vi 3.3.5. Insensitivity of dps-null mutant to physiological stresses associated with increased oxidative stress ...........................................................................................55 3.3.6. Minor sensitivity of dps-null mutant to iron overload but not other metal stresses ...56 3.3.7. Insensitivity of dps-null mutant to DNA-damaging agents ........................................58 3.3.8. Direct competition between the dps-null mutant and wild-type RHA1 over multiple cycles of starvation .......................................................................................58 3.4. Discussion ..........................................................................................................................59 3.4.1. Bacterial dps mutants are sensitive to oxidative stress, except for those of the Actinobacteria .............................................................................................................59 3.4.2. Excellent stress resistance of wild-type RHA1 ..........................................................62 3.4.3. Potential contributions of RHA1’s dps homologs to its oxidative stress resistance...63 Chapter 4:  Conserved Ferroxidase Activity of RHA1 Dps1 ...................................................65 4.1. Rationale ............................................................................................................................65 4.2. Materials and methods .......................................................................................................65 4.2.1. Multiple alignment of Dps protein sequences ............................................................65 4.2.2. General molecular biological methods .......................................................................65 4.2.3. Heterologous expression of RHA1 dps homologs......................................................66 4.2.4. Purification of RHA1 Dps proteins ............................................................................67 4.2.5. Dynamic light scattering .............................................................................................69 4.2.6. Functional characterization of RHA1 Dps1 ...............................................................69 4.2.6.1.  Staining for iron-binding proteins run by nondenaturing PAGE ........................ 69 4.2.6.2.  Ferroxidase activity assay ................................................................................... 69 4.3. Results ................................................................................................................................70 4.3.1. Functional predictions for the RHA1 Dps proteins from multiple sequence alignment ....................................................................................................................70 4.3.2. Heterologous expression of RHA1 Dps1 restored the oxidative stress resistance of an E. coli dps mutant .............................................................................................73 4.3.3. Iron-binding and ferroxidase activities of RHA1 Dps1 ..............................................74 4.3.4. In vitro DNA protection by RHA1 Dps1 ....................................................................77 4.4. Discussion ..........................................................................................................................78 Chapter 5:  Conclusion ................................................................................................................81 Afterword......................................................................................................................................85  vii References .....................................................................................................................................86 Appendices ..................................................................................................................................110 Appendix 1. Differentially regulated genes from the desiccation and control transcriptomes .....................................................................................................110 Appendix 2. Protocol for isolation of fosmid DNA from E. coli ............................................150 Appendix 3. Protocol for isolation of nucleic acids from Gram-positive bacteria ..................151   viii List of Tables  TABLE 1.1.  Pollutants degraded by RHA1................................................................................... 7 TABLE 2.1.  Quantitative PCR primer and probe sequences ....................................................... 26 TABLE 2.2.  Functional classification of desiccation-specific up-regulated genes ..................... 33 TABLE 2.3.  Microarray and RT-qPCR expression ratios at 12 h compared to time zero .......... 35 TABLE 2.4.  Genes from desiccation-specific transcriptome discussed in text ........................... 36 TABLE 3.1.  PCR primer sequences used in the creation and screening of deletion mutants ..... 45 TABLE 4.1.  PCR primer sequences used in the creation of plasmids for the expression of the RHA1 dps homologs ............................................................................................... 67 TABLE 4.2.  Functions and sequence characteristics of Dps proteins ......................................... 71 TABLE A.1.  Expression ratios of differentially regulated genes during the desiccation and control experiments .............................................................................................. 110    ix List of Figures  FIGURE 1.1.  Positive and negative transcriptional regulation at a model promoter. ................. 13 FIGURE 1.2.  Structural representations of the E. coli Dps monomer and dodecamer ............... 18 FIGURE 1.3.  Model of DNA binding by Dps ............................................................................. 20 FIGURE 2.1.  Drying rates and cell survival at low and high relative humidity.......................... 28 FIGURE 2.2.  Cell morphology of RHA1 during the desiccation and control experiments ........ 29 FIGURE 2.3.  Number of differentially regulated genes during the desiccation and control experiments ........................................................................................................... 30 FIGURE 2.4.  Clustering of expression patterns of genes differentially regulated during the desiccation experiment only .................................................................................. 32 FIGURE 3.1.  Genotype verification of the RHA1 dps1 and dps-null mutant strains by colony PCR ............................................................................................................ 51 FIGURE 3.2.  Growth of dps1 mutant and wild-type RHA1 cultures in minimal medium plus 20-mM sodium benzoate ............................................................................... 51 FIGURE 3.3.  Resistance of the dps1 mutant and wild-type RHA1 to oxidative and desiccative stresses ................................................................................................ 53 FIGURE 3.4.  Oxidative stress resistance of the dps-null mutant and wild-type RHA1 .............. 54 FIGURE 3.5.  Resistance of the dps-null mutant and wild-type RHA1 to the physiological stresses of long-term carbon starvation and desiccation ....................................... 56 FIGURE 3.6.  Metal stress resistance of the dps-null mutant and wild-type RHA1 .................... 57 FIGURE 3.7.  Resistance of the dps-null mutant and wild-type RHA1 to DNA-damaging agents ..................................................................................................................... 58 FIGURE 3.8.  Culture proportions of the dps-null mutant and wild-type RHA1 strains in the initial mixtures through nine passages of stationary phase ................................... 59 FIGURE 4.1.  H2O2 resistance of the E. coli dps mutant containing plasmids for expression of the RHA1 dps homologs ................................................................................... 73 FIGURE 4.2.  Nondenaturing PAGE of apo- and iron-bound RHA1 Dps1, stained for proteins and iron .................................................................................................... 75 FIGURE 4.3.  Ferroxidase assay on RHA1 Dps1 ......................................................................... 76 FIGURE 4.4.  DNA protection by RHA1 Dps1 from iron-dependent hydroxyl radical formation ............................................................................................................... 77  x List of Abbreviations  6FAM 6-carboxyfluorescein A305 absorbance at a λ of 305 nm BSA bovine serum albumin C carboxyl CDS coding DNA sequence CT cycle threshold cumene-OOH cumene hydroperoxide DDT dichlorodiphenyltrichloroethane CT comparative CT EPS extracellular polymeric substances H2O2 hydrogen peroxide MMS methyl methanesulfonate MOPS 3-(N-morpholino)propanesulfonic acid N amino NaCl sodium chloride NDMA N-nitrosodimethylamine NEM N-ethylmaleimide O2 molecular oxygen OD600 optical density at a λ of 600 nm PAGE polyacrylamide gel electrophoresis PBDE polybrominated diphenyl ether PCB polychlorinated biphenyl (p)ppGpp guanosine tetraphosphate (or pentaphosphate) RT-qPCR reverse transcription–quantitative PCR SDS sodium dodecyl sulfate SEM scanning electron microscopy TAMRA 6-carboxytetramethylrhodamine t-butyl-OOH tert-butyl hydroperoxide TSS transformation and storage solution   xi Acknowledgements  I would like to acknowledge colleagues involved with my thesis research:  Héctor M. Alvarez, for consultations regarding the design of the desiccation stress experiment; Hirofumi Hara, for mentorship during the transcriptomic experiments; Derrick Horne, for technical expertise with cryofixation microscopy; Jie Liu, for valuable guidance on creating knockout mutants of RHA1; and Jason C. Grigg, for instruction regarding dynamic light scattering.  Two undergraduate students worked with me on experiments presented in this thesis:  Philip Hou and Andy J. Kim helped characterize the stress resistance of the RHA1 dps1− and dps-null mutants, respectively. I would also like to thank many of the past and present members of William W. Mohn’s laboratory, as well as those of our neighbors, particularly the laboratories of Lindsay D. Eltis and Julian E. Davies, for so graciously sharing equipment, reagents, and knowledge with me over the years.  Besides those who contributed to my thesis work from a scientific standpoint, I want to sincerely thank everyone who treated me with respect as I progressed through graduate school.  Lastly, I want to acknowledge the Canadian public, who financially supported my academic development and thesis research through grants and scholarships.   xii Dedication       To those who will come after    1 Chapter 1:  Introduction  1.1. Use of microbial bioremediation in environmental cleanup The industrial activities of modern civilizations contaminate the biosphere, the very thin zone of habitable land, water, and atmosphere forming a living skin over our planet (281).  The materials extracted from the Earth’s crust by the mining and petroleum industries come from remote regions of the biosphere, inhabited only by microbial life-forms.  Although these resources are natural, many are unnatural and toxic in the ecosystems upon which we depend.  Similarly, products from synthetic chemical manufacturers, such as pesticides for agricultural practices, accumulate and pollute these ecosystems. One hardly needs to make a case for why the introduction of acutely or chronically toxic chemicals in our environment is of concern.  The publics of industrialized countries have been aware of these issues for over four decades, ever since many nations banned the insecticide known as dichlorodiphenyltrichloroethane (DDT) (85).  Years of spraying this insecticide over agricultural lands, going back to the 1940s, culminated in findings of dangerous concentrations of lipophilic DDT isomers and their partially degraded residues within the tissues of organisms high in the food chain (85).  Ultimately, populations of predatory birds, like the bald eagle, plummeted due to reproductive problems caused by the accumulation of DDT-derived toxicants in their shell glands (37).  Later in the 1970s, production of polychlorinated biphenyls (PCBs) was outlawed in the United States because of their widespread contamination of aquatic and terrestrial systems and detectable bioaccumulation in wildlife and humans (228).  The chemical stability of PCBs that is responsible for their environmental persistence is also one of the properties that had originally made them desirable for numerous applications, from electrical insulators and coolants of transformers to plasticizers and flame retardants (131).  PCB congeners that are highly substituted with chlorine (> 50 % of the mass) promote cancer in rodents, and are suspected carcinogens in humans (228).  The scientific community was generally unaware of the broader consequences these xenobiotics could have on human health or the health of natural ecosystems.  As late as 1969, Lichtenstein et al. (162) investigated whether PCBs could improve the efficacy of DDT formulations; granted, after concluding that PCBs increase the pesticide’s toxicity, the authors did caution that “potential effects on biological systems … should not be disregarded.”  2 Of course, the rise of the environmental movement has not extinguished all problems concerning environmental contamination.  Solutions for certain issues have been effectively put in place but new issues, with generally larger scopes, have also emerged.  As an example, the frequency and severity of accidental spills from oil tankers has steadily decreased since the 1970s, a time when these events were commonplace (138).  Credit for this progress goes to advancements made under several categories:  in technologies related to tanker navigation, especially global positioning systems; in the regulation of tanker traffic through narrow waterways; and in safer tanker designs, by transitioning from single to double hulls and by segmenting the petroleum cargo (139).  Despite these successes, ecological damage from oil spills continues as we consume more and more of this nonrenewable resource each year.  Now, leakages come increasingly from ageing or ambushed pipelines in regions of the world where the damages are often neither reported nor cleaned up (138).  Furthermore, in the summer of 2010, the largest accidental release of oil in history spewed into the Gulf of Mexico from the blown-out Deepwater Horizon rig (150) at a depth of 1.5 km below sea level (139).  As the Earth’s accessible petroleum reserves deplete, we have started to scrounge for oil by venturing into deeper and more remote waters (138) and by extracting bitumen enveloping grains of sand (173).  History teaches us that the methods to exploit a resource are developed before those that protect us from it. Conventionally, the cleanup of polluted environments requires resource-intensive physical and chemical treatments that convert the contamination into a more tenable form but that do not entirely eliminate it (120).  The three main methods used to decontaminate terrestrial sites are incineration, thermal desorption, and solidification (209).  The end result of the first two treatments, after the site is dug up and the offending contaminant is subjected to combustion or volatilization, respectively, is that the collected hazardous waste (e.g., ash) must still be disposed of.  Solidification of a contaminated site with cement contains the problem, but not indefinitely.  The potential benefits of microbial bioremediation as an alternative to these invasive remediation strategies are that its implementation is relatively inexpensive, it should not result in additional environmental impacts, and the contaminant is often permanently eliminated (209, 260). Microbial bioremediation harnesses the natural degradative abilities of microorganisms in order to lower contamination to safe levels or otherwise detoxify the site.  The application of microbial bioremediation, however, has been hampered by its general ineffectiveness in the field compared to laboratory trials (260).  The isolation of a strain or microbial consortium with the  3 catabolic pathway(s) needed to detoxify a target pollutant does not equate to an all-purpose solution for its bioremediation.  Many such products have entered the market; none can guarantee positive results (260).  While different sites may be afflicted by the same type of contaminant, many other factors influence whether biodegradation will be facilitated by the native or augmented microbial communities.  In contrast to the idealized conditions of laboratory cultures, the microorganisms responsible for bioremediation in situ can face fluctuating or suboptimal temperature, pH, water activity, and nutrient sources as well as potential interactions with antagonistic molecules and competing microbes (90).  Therefore, selecting strains that are specially adapted to each contaminated environment is just as much of a prerequisite for successful bioremediation as the relevant catabolic abilities. Bioaugmentation and biostimulation are two common approaches used, sometimes in combination, to enhance the biodegradation of unwanted contaminants (75).  Bioaugmentation involves applying pregrown microbial strains to contaminated sites believed to lack the natural capacity to degrade the contaminants (90).  However, unless the inoculated strains have the adaptive mechanisms to survive the stresses encountered at a particular site, they will quickly succumb and bioremediation will fail.  Thus far bioaugmentation has worked best within the controlled environment of a bioreactor, where key parameters can be regulated to promote survival and activity of the inoculated strains (75).  The rationale behind the strategy of biostimulation is that, given the tremendous microbial diversity in soils (170), microorganisms that possess the enzymatic pathways required to detoxify the contaminants are likely already present within the ecosystem and adapted to it.  As such, biostimulation is facilitated by understanding the microbial ecology of the site in order to manipulate conditions to favor mineralization of the contaminants by the native microbial community (260).  The first case in which biostimulation was employed to help remedy an environmental disaster happened in the spring of 1989 when crude oil infiltrated the beaches of Prince William Sound, Alaska from the wrecked Exxon Valdez tanker (139).  Biodegradation of this excess source of petroleum hydrocarbons soon became limited by the availability of major nutrients, principally nitrogen (213).  Enrichment of the hydrocarbon-degrading bacteria was achieved by spraying an oleophilic fertilizer over the oiled beaches, leading to a modest 2-fold increase in the rate of petroleum degradation compared to the untreated areas (213).  In other examples of remediation efforts utilizing biostimulation, electron donors were injected into subsurface sediments to induce bioreduction, for the dehalogenation of organic pollutants like chloroethenes (158) and  4 for the immobilization of uranium(VI) radioisotopes (285).  Effective microbial bioremediation solutions are thus tailored to each situation, informed by knowledge of how different ecological factors will affect pollutant degradation at a particular site.  1.2. Rhodococcus jostii strain RHA1 as a model organism for microbial bioremediation Many of the recalcitrant compounds of concern to the field of microbial bioremediation have been found to be degraded by bacteria belonging primarily to the Proteobacteria and Actinobacteria phyla (260).  These bacterial isolates possess and express the enzymatic machinery required for degradation of the contaminants; they are also able to withstand any accompanying toxicity.  The taxonomic division Actinobacteria represents a very large, diverse group of Gram-positive bacteria with genomes of high G+C content (168).  The species of Actinobacteria most associated with the ability to metabolize complex hydrocarbons are saprophytes from the genera Rhodococcus and Mycobacterium (260), both of the order Actinomycetales.  While many actinomycetes are adapted to niches in soil, the great diversity within this phylogenetic group precludes accurate blanketing statements.  For example, some actinomycetes are pathogens in humans and other animals (143, 231), most notably Mycobacterium tuberculosis, a causative agent of tuberculosis.  One general characteristic that appears to be shared by most actinomycetes is pleomorphy, although the degree of morphological differentiation varies considerably among the genera.  Species of Rhodococcus, Nocardia, and Mycobacterium exhibit “nocardioform” morphology (154), in that they can form cocci, rods, and simple branched filaments.  Other actinomycetes, like Streptomyces and Frankia, can grow into extensive mycelial networks (168).  These developmental adaptations, which lead to the generation of spores or resistant morphotypes (105), contribute to the persistence of actinomycetes under the stresses of soil habitats.  For some actinomycetes, protection from external perturbations is also achieved through the synthesis of unique lipids called mycolic acids, which create a thick, hydrophobic barrier as the outermost layer of their cell walls (105).  Rhodococci, mycobacteria, and other mycolic acid–containing relatives are referred to collectively as the mycolata taxon (53).  The hydrophobicity of rhodococcal cells allows them easier access to hydrophobic pollutants (13).  Rhodococci are thus suited for bioremediation applications because of their tolerance to common stresses (272) and their capacity to metabolize a broad range of organic compounds (84).  5 Rhodococcus jostii strain RHA1 (formerly an unclassified strain of Rhodococcus [140]) was isolated in the mid-1990s from soil contaminated with an insecticide, -hexachlorocyclohex-ane (235), commonly known as lindane.1  Because the researchers were looking for novel microbial degraders of PCB congeners, they enriched for strains that could use biphenyl as the sole carbon source.  Out of this screen, they discovered RHA1, a strain that can cometabolize highly chlorinated PCBs (235).  RHA1 outperformed other strong PCB degraders, in terms of both the variety of positions and total number of chlorine substituents on the biphenyl rings that it can detoxify (235).  While many aerobic, Gram-negative PCB degraders cannot transform PCBs substituted with more than five chlorines, RHA1 can transform several heptachlorobiphenyls (235).  This superior ability of RHA1 is believed to be due to its induction of multiple isozymes of the biphenyl catabolic pathway, which cooperatively recognize broader ranges of substrates (95). RHA1 is particularly adept at catabolizing aromatic compounds (117), a trait shared by rhodococci in general (151, 272).  Polybrominated diphenyl ethers (PBDEs) are halogenated, persistent aromatic pollutants whose history of usage, chemistry, and toxicity parallel those of PCBs (129).  Our exposure to PBDEs is unavoidable, however, due to their continued, although increasingly regulated (66), incorporation into all sorts of household items as flame retardants (129).  RHA1 is one of the best aerobic degraders of PBDEs known, as it is for PCBs (224).  RHA1 effectively debrominates diphenyl ethers with as many as five bromine substituents, which includes the major PBDE congener found to contaminate human breast milk (2,2′,4,4′-tetraBDE) (182, 224).  While RHA1 detoxifies PCBs and PBDEs through cometabolism, it can directly catabolize numerous other aromatic compounds that pose environmental problems.  The list includes chemicals used in the manufacturing of plastics, like the monomers of styrene (192, 205), phthalate (204), phthalate esters (114), and terephthalate (113).  RHA1 can also grow on each of four aromatic pollutants typically found at gasoline-contaminated sites:  benzene, toluene, ethylbenzene, and o-xylene (95, 236), but not the m- or p-xylene isomers (unpublished data).  Aliphatic hydrocarbons are the most biodegradable components of petroleum (267), so not surprisingly, rhodococci commonly can metabolize them (84, 272).  Although growth of RHA1 on n-alkanes has not been extensively surveyed, RHA1 likely can use a variety of n-alkanes as growth substrates because it has the catabolic pathways needed for growth on at least                                                  1 No published report has indicated whether strain RHA1 can degrade lindane.  6 one short-chain and one long-chain alkane, propane (237) and n-hexadecane (unpublished data).  The propane monooxygenase enzyme that allows RHA1 to grow on propane also enables this strain to cometabolize N-nitrosodimethylamine (NDMA) (237), a toxic groundwater contaminant (186).  The main sources of NDMA pollution are industrial, notably through rocket fuel production and chloramination and chlorination treatments of water and wastewater (186).  Another group of pollutants that RHA1 has been shown to degrade are aliphatic and aromatic nitriles (197).  Outside of their natural occurrences, these nitrogen-containing compounds are primarily produced by the chemical industry (10).  A summary of the types of pollutants that RHA1 is known to degrade is presented in Table 1.1, along with the toxicological and environmental threats they pose. An important step in helping to explain the impressive catabolic versatility of RHA1 was sequencing its genome.  At 9.7 Mbp, the genome size of RHA1 is in the top percentile of all sequenced bacterial genomes (NCBI Genome database [www.ncbi.nlm.nih.gov/ genome/browse]).  It consists of a linear chromosome (7.8 Mbp in size) and three linear plasmids, pRHL1 (1.1 Mbp), pRHL2 (0.44 Mbp), and pRHL3 (0.33 Mbp) (179).  Of the 9,145 proteins predicted to be encoded in the genome, > 1 in 9 are annotated as oxidoreductases, and of those, 203 oxygenases are identified (179).  The RHA1 genome is disproportionately rich in these types of enzymes in comparison to the genomes of related actinomycetes or other saprophytic soil bacteria (179).  The multiplicity of paralogous enzymes encoded in the large RHA1 genome seems to be a common feature of rhodococcal soil heterotrophs (263, 276) and may allow them to metabolize the diverse growth substrates needed for their persistence in these environments (272). The catabolic pathways responsible for the degradation of pollutants by RHA1 have largely been elucidated, as summarized in Table 1.1.  Now the challenge has shifted to understanding how RHA1 and related actinobacteria, which may be indigenous to the polluted sites, survive within their environmental niches so that in situ microbial bioremediation may be realized.  One of the factors that can impact bioremediation of contaminated soils is the resistance of the bacterial inhabitants to the stresses of water limitation, since periodic droughts commonly afflict microbial communities in the soils of many biomes.  Like most terrestrial ecosystems, the world’s arid regions are not spared from environmental damage.  These climates are home to some of the largest oil-producing nations as well as to roughly one tenth of all densely populated (> 100 persons/km2) human settlements (76).  Strategies to improve  7  TABLE 1.1.  Pollutants degraded by RHA1  Pollutant Toxicological and environmental concern(s) Reference(s) Catabolic gene(s) or operon(s) Reference(s)       PCBs  Poisonous Carcinogenic 228, 261 bph etb 95, 135       PBDEs  Carcinogenic Endocrine-disrupting Neurodevelop-mentally toxic 129 bph etb 225      Plastic monomers          Styrene  Poisonous  Possibly carcinogenic 261 bph 205       Phthalate esters  Endocrine-disrupting 110 pat pad 114      Petrochemicals          Benzene  Mutagenic Carcinogenic Haemotoxic Neurotoxic 68, 69, 261 bph etb 205       Toluene  Neurotoxic 68, 261 bph etb 205       Ethylbenzene  Poisonous 261 bph etb 205       o-Xylene  Neurotoxic 68, 261 bph etb 205       n-Alkanes (e.g., n-hexadecane)   Ecologically damaging, via hypothermia  and suffocation of sea life 139 alkB rubAB Unpublished      NDMA N N O Carcinogenic 261 prm 237       Nitriles NR  Poisonous 210 nth anh 197, 198         O Brm Brn OR1 O OR2 O Clm Cln  8 bioremediation of desiccated soils may develop from a thorough understanding of the important adaptations conferring desiccation tolerance to bacterial model organisms such as RHA1.  1.3. Bacterial desiccation resistance mechanisms Fluctuation in water availability is a fundamental stress challenging soil-residing microorganisms, since the structural integrity and proper functioning of most proteins and other cellular macromolecules depend upon interactions with water molecules.  Desiccation tolerance is therefore a key adaptation of many soil bacteria.  The physiological mechanisms by which bacteria survive water limitation have been best studied in cyanobacteria. Many cyanobacteria are well adapted to extremely dry environments (67).  Being photoautotrophic, some cyanobacteria live in desert soils (67) or anchor themselves to rock surfaces (167) or intertidal marine mats (207) where light is plentiful but water may be intermittent at best.  Certain Nostoc specimens have survived more than a century of desiccation (32) in a physiological state that has been found to contain ~ 10-times less water than in bacterial spores (212).  Although many of the reactions that produce oxidative radicals require water (212), desiccation leads to an overall increase in free radicals as electron transport chain proteins, lacking bound water, denature and malfunction (19).  Upon prolonged desiccation, anhydrobiotic cells have < 0.1 g of water / g of dry matter (20) – insufficient to form even a monolayer of water around intracellular macromolecules – and thus are metabolically inactive.  Bacteria not adapted to desiccation stress die at water contents of 0.3 g of water / g of dry matter (212).  Desiccation-resistant cyanobacteria employ mechanisms to slow the rate of water loss and to provide suitable water replacements. Many cyanobacteria mitigate water loss by synthesizing extracellular polymeric substances (EPS) to create a barrier between themselves and their dry environment (208).  One of the functions of this protective barrier, whether it forms a sheath, capsule, or slime, is to retain moisture, much like a sponge.  For example, the EPS of filamentous cyanobacteria populations enable them to survive in desert microbial crusts where the only source of water, for months at a time, is the occasional morning dew (176).  The EPS continue to protect the desiccated cells by slowing rehydration, once rain finally falls.  Dried membrane vesicles without EPS fuse together after wetting; however, damage from membrane fusion was prevented in experiments where the vesicles were supplemented with EPS from a Nostoc commune strain (124).  9 Another mechanism of desiccation-resistant cyanobacteria for retaining as much water as possible during air-drying is to increase their intracellular solute concentrations to equilibrate them with their increasingly hypertonic surroundings (275).  The molecules either imported or synthesized for this purpose are referred to as compatible solutes because, even at high concentrations, they permit cellular machinery to function (279).  Common compatible solutes used by bacteria include choline, betaine, proline, glutamate, glutamine, glucosylglycerol, ectoine, and potassium ion (275).  Two disaccharides, trehalose and sucrose, are the compatible solutes found in N. commune (125).  The hydroxyl groups of these disaccharides are able to replace the interactions water normally has with enzymes and the cell membrane, thereby maintaining their native conformations (60).  Considering membrane stability without water replacement by a compatible solute, the hydrophilic head groups of the membrane phospholipids condense and gel due to the increased phase transition temperature of the dry membrane (61).  Trehalose has been shown to maintain the phase transition temperature of dehydrated lipids and avoid leakage associated with rehydration of gel-phase membranes (61).  The importance of compatible solutes to desiccation survival has also been demonstrated by the improved desiccation tolerance of a recombinant Escherichia coli strain that expressed a cyanobacterial gene encoding a sucrose-6-phosphate synthase (21). In a microarray study of a desiccated cyanobacterial species, Anabaena sp. strain PCC7120, various mechanisms by which it copes with low water activity were revealed (141).  Osmotic stress responses such as potassium ion–transporting systems and trehalose metabolism genes were up-regulated to achieve ionic balance and stabilize cellular components with compatible solute, respectively.  Other, concurrent responses included the up-regulation of genes associated with protein stabilization (heat shock and chaperone proteins) and with countering oxidative threats (a probable manganese catalase), the latter being consistent with findings of increased reactive oxygen species in desiccated cells (62, 175).  Genes associated with photosynthesis, carbon dioxide fixation, nitrogen transporters, and transcription and translation were down-regulated within 3 h of air-drying (141).  Thus, in Anabaena sp. PCC7120, dwindling resources are directed towards key desiccation stress responses while the majority of cellular processes are shut down. Besides cyanobacteria, actinomycetes are also known to have high desiccation tolerance (67).  Studies in which spores of a Kineosporia sp. (218) or a Streptomyces sp. (280) were air-dried noted that long-term survival improved when the spores were subjected to low relative  10 humidity (of < 50 %) in comparison to moderate desiccation (65–95 %).  A high rate of drying had a similar effect upon the survival of the actinomycete Arthrobacter crystallopoietes (23) as well as on strains of a gammaproteobacterium, Pseudomonas fluorescens (65).  The lesson learnt here is that a certain intensity of drying should be applied in order to induce, and thus experimentally elucidate, desiccation resistance mechanisms.  As for many cyanobacteria, trehalose content promotes desiccation resistance in several actinomycetes, including Frankia hyphae (30) and the spores of Streptomyces griseus (178) and Streptomyces albidoflavus (157).  Additionally, asporogenous actinomycetes such as Rhodococcus spp. have good tolerance to desiccation stress (215).  The morphological and physiological changes induced by desiccation stress have been observed for Rhodococcus opacus PD630 (6), a species that is closely related to RHA1 (105).  Alvarez and coworkers (6) assayed for a range of known desiccation responses and found that PD630 produced an EPS slime and three osmolytes – trehalose, ectoine, and hydroxyectoine.  Since the air-dried cells were also starving, respiratory activity was greatly reduced and the cells utilized fatty acid reserves for energy and biosynthetic precursors (6).  Other proposed survival adaptations of this strain included observations of cell wall modifications, reductive cell division, and cell aggregation (6).  A remaining difficulty in studying bacterial adaptations to desiccation is discriminating between the responses that are a direct consequence of reduced water availability and those induced by stresses associated with desiccation, such as starvation.  1.4. Adaptations to environmental stresses by Rhodococcus and related actinomycetes  1.4.1. Developmental responses to starvation Starvation is one of the adverse consequences that can accompany desiccation, as the diffusion of nutrients to soil bacteria becomes restricted (34, 115, 177).  If a nutrient is limiting, cell growth will slow, ultimately to a state where no net increase in biomass is possible.  The inability of a bacterium to grow due to starvation – referred to generally as the stationary phase – represents a spectrum of cellular physiologies that differ depending on the type and severity of the nutrient privation (196). In response to sensing nutrient-poor conditions, several genera of actinomycetes enter developmental processes leading to the generation and dispersal of spores (44, 47).  Starved colonies of Streptomyces coelicolor, the archetype of actinomycete sporulation, develop white  11 aerial mycelia from which multinucleated apical hyphae subdivide into spores (45).  The gray-pigmented and rounded mature spores have thickened cell walls and are better adapted than the vegetative mycelium to withstand stresses likely to be encountered in soil, particularly desiccation and ingestion by soil invertebrates (47). Nocardioform actinomycetes are said to not differentiate (44), but their progression of resistance through stationary phase has notable similarities with the more elaborate development of their sporulating relatives.  Like the apical syncytia of streptomycetes, long rods of asporogenous actinomycetes reductively divide into cocci after growth has ceased (119, 168, 206, 239, 243).  Reductive cell division is thought to improve survival over periods of stress:  firstly, because the chance that one of multiple cells will avoid destruction should be better than that of a single multinucleated cell (188); and secondly, because the cells’ surface-to-volume ratios increase, meaning that each cell has a greater area of cell wall material per unit of cytoplasm, which may help the starving bacteria utilize dilute nutrient sources (188).  Also like spores, the cell walls of stationary-phase cocci of Arthrobacter crystallopoietes become thicker (271).  The cell envelope of R. opacus does not thicken, however, after a week of desiccation with concomitant starvation (6).  Not enough studies have detailed the morphological changes of asporogenous actinomycetes entering stationary phase to know whether the adaptation of thickened cell walls is common.  One possibility, consistent with the limited evidence available, is that rhodococci and other species of the mycolata taxon, of which Streptomyces and Arthrobacter do not belong (77, 105), may be sufficiently protected as is and do not need cell wall reinforcement.  Interestingly, the structural properties of mycolata cell walls seem to be specially adapted for surviving stresses like starvation, since many Gram-negative bacteria modify their cell walls to achieve similar benefits in response to nutrient privation.  The peptidoglycan of mycobacteria is highly cross-linked compared to that of Gram-negative bacteria (217, 278), which increase the cross-linking of their peptidoglycan during stationary phase (122, 174).  Researchers have not yet adequately explored how the peptidoglycan of mycolata taxon members may be restructured during stationary phase.  Also, mycolata have hydrophobic cell surfaces (15), whereas Gram-negative bacteria actively increase their cell surface hydrophobicity upon starvation (149).  A study that investigated whether the cell surface hydrophobicity of this group of actinomycetes changes over different growth phases of batch cultures found no consistent trend among the several species tested (246).  12 Another similarity between the development of nocardioform and sporulating actinomycetes during starvation is their use of storage compounds for subsistence.  Inclusions of triacylglycerols serve as a major source of endogenous carbon and energy in actinomycetes (3), one of the few bacterial groups that synthesize them for this purpose (5).  In Rhodococcus species, triacylglycerol reserves are mobilized when carbon substrates become limited (4); likewise, granules of glycogen, visible by electron microscopy in the prespores of streptomycetes (46), are depleted in mature spores (26).   The parallels described above between the survival strategies that have evolved in different lineages of actinomycetes seem to reveal a continuum of development.  In recent years, a few research groups have claimed to observe sporelike cells in aged cultures of mycobacteria (92, 153).  These reports have rekindled questioning of the doctrine that nocardioform actinomycetes such as mycobacteria do not differentiate (256).  While ambiguity remains about how closely the resistance programs of nocardioform actinomycetes may approximate those of the spore-forming genera, the suggestion that any of them could produce endospores, as do many species of Firmicutes, has attracted substantiated criticism (256).  1.4.2. Global regulation of responses to stress As yet, little research on Rhodococcus species has explored beyond basic descriptions of their effectiveness at tolerating various stresses; the detailed mechanistic explanations for many of these adaptations, and especially their coordination, remain largely unknown (81).  This level of knowledge has been sought from other actinomycetes, of course mostly from certain Mycobacterium and Streptomyces species with important pathological or medicinal implications for us.  In order to learn about saprophytic rhodococci, the best extrapolations will likely be made from discoveries about mycobacteria of a similar ecological niche. Given the frequent and varied environmental stresses that soil heterotrophs face, proper regulation of their genetic circuits must integrate information from multiple signals to coordinate an appropriate response.  These bacteria therefore have complex and hierarchical regulatory networks that are dependent upon numerous regulatory devices to direct gene expression.  Transcriptional activity at a promoter is regulated by the sigma factor that occupies the RNA polymerase holoenzyme as well as by other transcription factors that may activate or repress transcription (Figure 1.1).   13    OperatorActivatorsitePolycistronicmRNAPromoterA B CRepressorOffOnNegative regulation:Positive regulation:ActivatormRNARNA polymeraseholoenzymes70 FIGURE 1.1.  Positive and negative transcriptional regulation at a model promoter. FIGURE 1.1.  Positive and negative transcriptional regulation at a model promoter.  For genes A–C to be transcribed, the sigma factor occupying the RNA polymerase holoenzyme must recognize their promoter.  A transcriptional activator may also aid in initiating transcription, upon binding to a specific nucleotide sequence usually located upstream of the promoter (56).  Alternatively, expression of the operon may be prevented by the binding of a transcriptional repressor to its operator, which is usually located within or downstream of the promoter (56).  This figure was taken from Snyder and Champness (242) and adapted, with permission from the copyright holder.  All of the sigma factors in actinomycetes belong to the protein family homologous with the housekeeping sigma factor of 70 kDa from E. coli, σ70 (165); the other known family of sigma factors, related to σ54 from E. coli (183), are not found in these bacteria (88, 248).  The development of multicellular differentiation in the mycelia of S. coelicolor relies in part on its repertoire of 66 sigma factors (108, 269).  Simpler saprophytic actinomycetes like Mycobacterium smegmatis and R. jostii have a large number of these regulatory proteins too, with 26 and 34 sigma factors encoded in their genomes, respectively (179, 269).  Members of the σ70 family can be subdivided into four main groups according to their divergence in sequence and function from the full-length, essential housekeeping sigma factors, classified as the primary  14 group (200).  Group 2 sigma factors retain the three globular protein domains of the group 1 members (200) but serve as alternative sigma factors, meaning that the bacterial host can live in their absence (101).  The protein architectures of the next two σ70 subdivisions deviate successively more from that of the primary sigma factors, with group 4 members losing one of the globular domains altogether (200).  The expansion of σ70 homologs in the actinomycetes mentioned above is largely due to additional group 4 members, which are often accompanied by antagonistic regulatory proteins called antisigma factors (33).  Alternative sigma factors provide efficient regulatory mechanisms for these bacteria to specifically shift their transcriptomes in response to their dynamic microenvironments. Of RHA1’s 34 sigma factors, 28 are classified as group 4 members, three belong to group 3, one to group 2, and, interestingly, two appear to be primary sigma factors (unpublished data).  Similarly, M. smegmatis has just one representative from each of the first three groups of the σ70 family, while 23 of its 26 sigma factors fall into the fourth subdivision (deduced from reference 269).  The breadth of functional responsibilities controlled by these sigma factors narrows as they get more distantly related to the group 1 sigma factors.  The primary sigma factor in M. smegmatis, SigA, directs transcription of all genes needed for growth and for maintaining cellular homeostasis (94).  The group 2 sigma factor, SigB, is a key regulator in the transition to stationary phase (189).  Also important in this regard is the sigma factor from group 3, SigF, as it coordinates responses to a range of stresses that harm cells during stationary phase (130).  The roles played in M. smegmatis by members of the different sigma factor groups are typical of their bacterial orthologs.  Indeed, from what is known about the group 4 sigma factors in M. smegmatis, the environmental and physiological conditions that stimulate their activity and the regulons they then promote qualify them as more specialized regulators than the aforementioned sigma factors.  The only two sigma factors from this group that have been studied relatively thoroughly, SigE and SigH, both regulate genes that improve the resistance of M. smegmatis to oxidative assaults, among other stresses (83, 284).  In a review authored by Gruber and Gross (101), the recurrent links between oxidative stress and the group 4 sigma factors of S. coelicolor was also noted, indicating that reactive oxygen species may be a pervasive threat to the well-being of these aerobes (70). The interconnectedness of the global regulators in M. smegmatis can be illustrated by examples involving SigE or SigH.  For instance, SigE activates the stringent response, through promoting rel expression (250).  The stringent response, mediated by a small-molecule product  15 of Rel, guanosine tetraphosphate (ppGpp), helps adjust the overall physiology of bacteria in response to growth arrest (25).  Reductive cell division does not occur in a M. smegmatis disruption mutant of rel (64).  As a second example, a promoter of sigH3, one of eight sigH paralogs (269), appears to be recognized by the SigF–RNA polymerase complex (130).  This finding exemplifies how these sigma factors are arranged in a regulatory cascade, and it may also help explain why SigF is an integral piece of this bacterium’s defense against oxidative stress (130).  1.4.3. Mechanisms for combatting oxidative stress Aerobic organisms require continual maintenance to cope with the hazards of an oxygen-rich atmosphere.  For nonpathogenic bacteria, which specifically do not get bombarded with oxidative radicals by a host defense system, oxidative damage to their cellular components comes in times of hardship, when their protective mechanisms are overwhelmed or disabled by stresses.  Bacteria succumb to starvation primarily due to the resultant oxidative stress (196), which occurs during limitation for a carbon substrate because of, presumably, the diminished reducing power of the cell.  E. coli cultures starved under aerobic conditions for 2 days accumulate at least 4-times more oxidative damage than they had after growth, as measured by levels of protein carbonylation; after 10 days of starvation, only 2 % of the cells survive (72).  At the same time points, anaerobically starved cultures do not show increased protein oxidation nor do they lose any viability.  In a library of M. smegmatis mutants sensitive to carbon starvation (144), almost every mutant had a similar survival rate as the wild type after a lengthy stationary phase induced by oxygen limitation (145).  The body of evidence indicates that exposure to oxygen is required for the detrimental effects of stationary phase (196). Besides sigma factors, the development of oxidative resistance is regulated by other transcription factors that activate or repress gene expression in response to the redox environment of the cell.  Many of these regulatory proteins are not confined to actinomycetes, as the original buildup of oxygen in Earth’s atmosphere (35) predates the evolution of this taxon (77).  Homologs of OxyR, acting predominantly as transcriptional activators, are widespread among actinomycetes (107).  OxyR activity is stimulated through oxidation of one of its conserved cysteine residues by increases in the intracellular concentration of the reactive oxygen species hydrogen peroxide (H2O2) (70).  Certain members of the Fur family of transcriptional regulators, named after ferric uptake regulation (78), also sense peroxides within actinomycetes.   16 Since metal ions can exacerbate peroxide toxicity by reacting to form highly destructive hydroxyl radicals (223, 245), such Fur-type repressors as FurA in M. smegmatis (293) and CatR in S. coelicolor (106) provide important regulatory links between metal homeostasis and oxidative stress defenses (1).  These Fur-type repressors that respond to intracellular redox flux are believed to function like the related peroxide regulon repressor (PerR) from Bacillus subtilis (28, 187).  Their regulatory metal ions, which typically are needed by Fur proteins for operator binding, are coordinated by ligands that are labile to oxidation (156).  Loss of the metal ion effectors from regulators of the PerR subfamily results in derepression of their regulons, which include oxidative resistance genes (156). The enzymes and antioxidants produced by actinomycetes in order to detoxify reactive oxygen species are generally conserved across diverse bacterial phyla.  Superoxide dismutases catalyze the disproportionation of the superoxide radical (11), and in doing so produce H2O2, which then can be neutralized by catalases (133).  Peroxidases function in a manner distinct from catalases in that the former use endogenous reductants to destroy an assortment of peroxides (133).  Even in the presence of these superoxide and peroxide scavengers, the low steady-state levels of residual reactive oxygen species are still potent enough to degrade the cell (133).  The thiol functional groups of cysteines situated within the active sites of cytosolic enzymes are common targets of oxidation (127), resulting in disulfide stress (70).  As such, thioredoxin and thioredoxin reductase repair systems for these disulfides are ubiquitous in life (70).  The one clear example of an antioxidant mechanism that is unique to actinomycetes is the small molecule they synthesize to help reduce disulfides:  mycothiol, a disaccharide derivative, instead of glutathione, a tripeptide derivative (193).  Consequently, actinomycetes also produce an enzyme to regenerate oxidized mycothiol, mycothiol disulfide reductase (194), which functions analogously to glutathione reductases of other organisms (203).  In addition to the detoxification of reactive oxygen species and the repair of oxidative damage, another universal adaptation for surviving the hazards of an aerobic metabolism is to prevent reactive oxygen species formation.  Of the transition metals that partially reduce oxygen to generate more reactive species, iron is the chief culprit that must be sequestered from the cytosol (111, 245).  The ferritinlike protein superfamily, including the Dps family, plays a lead role in this process.  Hence, Dps proteins are commonly integrated as vital stress responses in bacteria.    17 1.5. The myriad roles of Dps proteins in bacterial stress responses The shared biological function of the ferritin, bacterioferritin, and Dps families is to safely oxidize ferrous ions (i.e., without generating hydroxyl radicals) and sequester the resultant hydrous ferric oxides within their hollow protein spheres.  Ferritins are found in organisms throughout the tree of life (7), whereas Dps homologs have been identified only in bacteria and archaea (109).  Bacterial ferritins and (heme-binding) bacterioferritins are composed of 24 subunits, usually forming homopolymers, and are able to store up to a few thousand iron atoms (7, 116).  Dps proteins are also referred to as miniferritins or dodecameric ferritins because they assemble from 12 Dps monomers and can accommodate a smaller core of approximately 500 iron atoms (109).  Although no significant similarity exists between the amino acid sequences of Dps proteins and other members of the ferritinlike superfamily, their homology is evident from the high similarity of their monomers’ structural folds (98). Dps monomers are small, compact proteins (109), of roughly 19 kDa, that consist of four conserved α-helices (98) flanked by amino (N) and carboxyl (C) termini of variable lengths.  Figure 1.2 depicts the structure of Dps from E. coli, the first discovered member of this protein family, characterized by Almirón and her colleagues in 1992 (2).  The quaternary structure of Dps dodecamers has both twofold and threefold axes of symmetry, described as 23-point-group or tetrahedral symmetry (98, 132).  The ferroxidase active site is located at the interface within the dimers of the Dps dodecamer (41, 244).  The subunits of each dimer are themselves related by a twofold axis of symmetry such that together they provide the necessary iron-coordinating ligands for two ferroxidase active sites (41, 244).  Each site has the carboxylate-bridged di-iron architecture common to ferritinlike proteins (59).  Thus, the dodecamer of a prototypic Dps contains a dozen dinuclear active sites, which can bind 24 Fe2+ in total (221).  Ferrous ions are guided toward the active sites by acidic residues that line four pores in the protein shell (14, 132).  These main entry routes into the dodecamer are formed at one end of the threefold symmetry axes, by portions of the subunit trimers folded near their N termini (Figure 1.2B) (14).  The pores on the opposite side of the dodecamer, at the C-terminal ends of trimers, are smaller and hindered by hydrophobic residues (109, 148).  The function of these four pores is unclear, but they may serve as auxiliary channels for reduced iron to exit the protein (109, 148). The physiological role of the conserved enzymatic activity of Dps proteins has diverged from that of their distant ferritinlike homologs.  Dps family members have evolved to more efficiently oxidize iron with H2O2 compared to molecular oxygen (O2) (49), the main oxidant  18 A B FIGURE 1.2.  Structural representations of the E. coli Dps monomer and dodecamer FIGURE 1.2.  Structural representations of the E. coli Dps (A) monomer and (B) dodecamer, along one of latter’s threefold axes of symmetry.  The conserved α-helices within the monomer are lettered (A–D), as are its N and C termini.  One of the pores of the cagelike dodecamer, surrounded by the N-terminal regions of a trimer of subunits, is emphasized with color.  These figures were taken from Haikarainen and Papageorgiou (109), with permission from the copyright holder.  used by their ferritin relatives (296).  Whereas ferritins and bacterioferritins deposit iron into their larger cores for the purpose of maintaining iron homeostasis, Dps proteins detoxify Fe2+ and H2O2 simultaneously in order to protect cells from oxidative stress (49).  The oxidized iron is stabilized as hydrous ferric oxides (FeOOH) in the Dps core.2  The overall mineralization reaction that occurs within Dps proteins is:  2 Fe2+ + H2O2 + 2 H2O → 2 FeOOH + 4 H+ (109).  The di-iron active site of Dps proteins promotes the oxidation of 2 Fe2+ for every H2O2 molecule reduced and thus avoids the partial reduction of H2O2 by lone electrons (249).  In the absence of                                                     2 Inorganic phosphate is also found in this core (38, 142).  19 this ferroxidase activity, destructive hydroxyl radicals would be produced as a result of the odd-electron Fenton reaction (111):  Fe2+ + H2O2 → Fe3+ + •OH + OH− (270).  Dps proteins are generally under strong selective pressure to fulfill the important job of limiting Fenton chemistry within cells by way of their ferroxidase and mineralization abilities. A novel function that has been acquired by some members of the Dps family, and not by any other ferritinlike group, is the ability to bind DNA.  In fact, Almirón et al. (2) named Dps, which they discovered in abundance in starved E. coli, to stand for DNA-binding protein from starved cells, because of the ordered complexes it forms with DNA.  For Dps homologs which bind DNA, protein–DNA interactions ordinarily occur between positive residues from either of the terminal tails protruding out of the surface of the Dps dodecamer and the negative phosphate groups of the DNA backbone (49).  So DNA-binding Dps proteins generally need to be in their native (dodecameric) form to associate with DNA (100), and, since binding is independent of nucleotide sequence (240), they protect the entirety of the cell’s genome.  In stationary-phase E. coli, Dps is one of the proteins responsible for condensation of its nucleoid (147).  Double-stranded DNA fits along the channels created between planar layers of Dps dodecamers, due to the gaps that remain when these spherical molecules pack together (Figure 1.3) (86).  In addition to the benefit of targeting this antioxidant defense to the cell’s genetic material, DNA binding by Dps proteins may also protect by physically shielding DNA from damaging agents.  In vitro assays have shown that Dps proteins from bacteria as diverse as E. coli, Deinococcus radiodurans, and the cyanobacterium Trichodesmium erythraeum can sequester double-stranded DNA compactly enough to inhibit its digestion by DNase I (38, 43, 87, 100, 202).  Dps1 from M. smegmatis can bind DNA too, but not so strongly that it leads to DNA condensation nor protection from nuclease action (42). The functions of the Dps protein family detailed above are necessary for many bacteria to survive various types of physiological stress.  Consequently, dps homologs are prevalent in bacterial genomes (Genomes Online Database [www.genomesonline.org]; 226).  Over the past two decades researchers have inactivated the dps genes of species from seven bacterial phyla and a range of habitats in order to investigate their respective contributions to stress resistance.  The recurring phenotype of dps− mutants is a significant sensitivity to oxidative stress, which can be  20 AB FIGURE 1.3.  Model of DNA binding by Dps FIGURE 1.3.  Model of DNA binding by Dps.  Double-stranded DNA binds in the channels between layers of Dps dodecamers, as depicted from above a single planar layer (A) or from the side of multiple (differently colored) layers (B).  DNA can bend around the dodecamers such that it is condensed within the Dps matrix (not illustrated).  The dodecamers are shown with iron ions (small orange circles) bound in their dinuclear ferroxidase active sites.  This figure was taken from Ren et al. (221), with permission from the copyright holder.  revealed in a large majority of these mutants by challenging them with H2O2, usually in stationary phase.  In the case of the facultative anaerobe Streptococcus mutans (whose dps homolog is named dpr, for dps-like peroxide resistance), its dpr− mutant is simply intolerant of exposure to air (287).  The dps− mutants of Burkholderia pseudomallei (166) and Borrelia burgdorferi (161) are exceptions in that they have wild-type resistance to H2O2, but they are still impaired in other aspects of their antioxidant defenses.  The B. pseudomallei dpsA− mutant is  21 sensitive to an organic hydroperoxide, tert-butyl hydroperoxide (t-butyl-OOH) (166).  The dps− mutant of the pathogen B. burgdorferi is attenuated, because of its poor survival within tick nymphs (161), the carriers of Lyme disease (29).  The reason why the B. burgdorferi dps− mutant fails to persist in vivo was suggested to be due to the associated oxidative stress – despite the mutant’s insensitivity to hydroperoxide treatments in vitro (161).  The advantage provided by Dps to the virulence of B. burgdorferi is an example where the relative contributions of potential ferroxidase and DNA-binding activities of a Dps homolog are not yet resolved.  Similar questions remain with respect to how Dps proteins from even the most thoroughly studied model organisms afford protection from stresses with complex physiological effects.  Considering just the E. coli dps− mutants, survival is compromised under all of the following conditions:  long-term starvation, but only when cocultured with the wild-type strain (190); acid and base extremes (51, 190); heat shock, but not cold shock (190); UV and γ irradiation (190); ultrahigh pressure (169); exposure to a toxic electrophile, N-ethylmaleimide (82); metal toxicity, specifically from iron, copper, and zinc (190, 255); and, of course, oxidative stress from H2O2 (2, 171, 190).  Some of these sensitivities have also been found in other dps− mutants, in addition to new discoveries of phenotypes for which the E. coli dps− mutants have not been tested.  1.6. Thesis objectives and approach The overall objective of this thesis is to identify mechanisms that enable RHA1 to persist during desiccation stress.  I examined the transcriptomic and morphological changes of RHA1 in response to air-drying.  This global approach revealed several genes with expression profiles and putative functions that made them promising candidates for contributing to the excellent desiccation resistance observed for RHA1.  All subsequent experiments presented in this thesis focus on two homologs of the dps family of antioxidant genes that were specifically up-regulated during desiccation.  I hypothesized that dps1 would be necessary for the full desiccation resistance of RHA1, a finding that would add a new stress condition to the list that Dps proteins have been shown to protect against.  The possible functional roles of the RHA1 dps homologs were explored:  (i) by testing deletion mutants of these genes for inferior resistance to a multitude of stresses in addition to desiccation; (ii) by expressing them in an E. coli dps mutant to see if either will complement its sensitivity to oxidative stress; and (iii) by directly assaying for activities of the purified RHA1 Dps1 protein.   22 Chapter 2:  Global Response of RHA1 to Desiccation Stress  2.1. Rationale Researchers have begun to discover the various adaptations that enable actinomycetes to survive desiccation, as discussed in section 1.3.  However, the genetic basis for the observed responses is unexplored in actinomycetes, as such studies have thus far been limited to Gram-negative bacteria (63, 141).  Using custom microarrays, I completed transcriptomic analyses of air-dried RHA1 along with an appropriate control experiment to specifically identify its desiccation responses.  This unbiased, genome-wide approach enabled me to identify genes that may be crucial for combatting desiccation stress, as well as those that may be important for responding to common stresses, like starvation, experienced by both the desiccated and control cells.  The microarray expression ratios for some of the highly up-regulated desiccation-specific genes were verified by reverse transcription–quantitative PCR (RT-qPCR).  To gain fuller understanding of how RHA1 copes with desiccation stress, changes in cell viability and morphology were monitored during each treatment, via CFU counts and cryofixation scanning electron microscopy (SEM), respectively.  2.2. Materials and methods  2.2.1. Growth conditions RHA1 cultures were grown at 30 °C in Erlenmeyer baffled flasks shaken at 200 rpm in W minimal medium (172) supplemented with 20-mM sodium benzoate, a very good growth substrate for this bacterium.  Liquid precultures of 50 ml in 125-ml baffled flasks were seeded with RHA1 colonies from W medium plates (1.5-% agar) grown on biphenyl vapors at 30 °C.  Biphenyl was used as a carbon source to ensure retention of the plasmids in this strain.  Experimental cultures of 330 ml in 1-liter baffled flasks were inoculated at 1 % (vol/vol) with a preculture in exponential growth phase at an optical density at a λ of 600 nm (OD600) of ~ 2, where the light path of the cuvette was 1 cm.  2.2.2. Desiccation stress treatments The following desiccation and control experiments were each conducted using three independent (not concurrent) biological replicates.  Exponential-growth-phase RHA1 cultures,  23 harvested at an OD600 of 2, were vacuum filtered onto sterilized 0.45-μm cellulose nitrate membranes (47-mm diameter; Whatman), using 20 ml of culture per membrane, and these were placed in preweighed polystyrene petri dishes.  Some membranes were cut into quarter segments for future cell viability assays.  The membranes were then placed in an air-tight cabinet maintained at 30 °C and an approximate relative humidity of either 20 % or 100 % for the desiccation or control experiments, respectively.  This point marked time zero of each experiment.  Low- and high-humidity conditions were achieved by putting trays of silica gel and water, respectively, below the petri dishes, and the relative humidity was monitored using a digital hygrometer. Directly after filtration and at nine subsequent time points (30 min, 1 h, 3 h, 6 h, 12 h, 24 h, 48 h, 1 wk, and 2 wk), the water content of the cells and the associated water were measured gravimetrically and cell viability was determined by CFU counts.  The rate at which the cells dried was determined by subtracting the mass of the dry nitrocellulose membrane from the masses of the membranes plus cells.  For the cell viability assay, a quarter membrane with cells was soaked in 10 ml of W medium for ~ 5 min and then vortexed at maximum speed for 1 min.  The cell suspension was serially diluted in 0.8-% sodium chloride (NaCl) solution, in duplicate as technical replicates, and these dilutions were grown on W medium plus 20-mM sodium benzoate plates (1.5-% agar) at 30 °C for ~ 8 days.  Cells from a whole membrane were harvested to extract RNA for transcriptomic analysis.  The membrane was placed in 10 ml of W medium and vortexed at maximum speed for 30 s.  An equal volume of “stop solution”, 5-% phenol (pH of 5) in ethanol, was added (17).  The cells were collected by centrifugation at 4,900 g for 10 min at 4 °C, suspended in 1.0 ml of the supernatant plus 2.0 ml of RNAprotect (Qiagen), and incubated for 5 min at room temperature.  The cells were then centrifuged at 13,000 g for 2 min at room temperature.  The pellet was frozen on dry ice and stored at –80 °C.  2.2.3. Cryofixation SEM Cells were viewed in a frozen state in order to observe any morphological adaptations of desiccated or control cells at various water contents.  The advantage of cryofixation SEM is that the appearance of the fully or partially hydrated cells, as well as any extracellular material present, was unaltered because the chemical fixation and alcohol dehydration steps of conventional SEM were not employed (266).  The samples were not coated with metal, thus eliminating this source of potential artifacts.  24 At selected time points during three independent desiccation and control experiments, small segments of the membrane plus cells were mounted onto microscope platform stubs using Tissue-Tek optimal-cutting-temperature compound and then plunged into liquid nitrogen for storage.  Ice from the surface of the samples was sublimated at –90 °C for approximately 40 min in a Hitachi S-4700 field emission scanning electron microscope.  Micrographs were taken at an accelerating voltage of 1.0 kV, at a working distance of 12.0 mm, and with no tilt of the cryostage.  The lengths of at least ten fully visible cells from each time point were measured, except where individual cells could not be delimited due to excessive extracellular material; as a result, reliable cell length data could not be obtained for some of the samples from the control experiments.  2.2.4. Transcriptomic analysis RNA was extracted from desiccated and control cells originally harvested from 20 ml of culture by adapting previous methods (95).  Briefly, total RNA isolation involved vortexing with glass beads and hot phenol plus sodium dodecyl sulfate (SDS; final concentrations of 14.3 % and 0.9 % [vol/vol], respectively); removal of debris with acetate and phenol plus chloroform (4.0 ml of phenol-chloroform [1:1, vol/vol]); precipitation of nucleic acids with acetate plus isopropanol; and a single DNase I treatment (15 U; Invitrogen) with incubation at 37 °C for 1 h in the presence of RNaseOUT (20 U; Invitrogen).  The RNA was purified by phenol-chloroform extraction (500 μl of phenol-chloroform [1:1, vol/vol]), precipitation, and the use of an RNeasy Mini Kit (Qiagen). cDNA synthesis, indirect Cy-labeling, and microarray hybridizations were performed as described previously (95), with the following modifications.  The cDNA synthesis mixture included 1.5 μg of random hexamer primers (Invitrogen) per 6.0 μg of RNA, which was brought to 15.3 μl with diethyl pyrocarbonate-treated water.  After RNA denaturation for 10 min at 70 °C followed by cooling for 5 min on ice, cDNA synthesis components were added to final concentrations of 0.46 mM each of dATP, dCTP, and dGTP; 0.19-mM dTTP; 0.28-mM aminoallyl-dUTP (Ambion); 0.01-M dithiothreitol; 0.3-U/μl RNaseOUT, and other ingredients as indicated before (95).  Equal amounts of differentially-labeled cDNA – 50 million pixels as measured by ImageQuant 5.2 (Molecular Dynamics) – from treated cells versus untreated time-zero cells were hybridized at 42 °C for 17 h.  After the automated washes, the slides were dipped in 0.2- SSC (1- SSC is 150-mM NaCl plus 15-mM sodium citrate [229]) and dried by  25 centrifugation at 225 g for 5 min at room temperature.  For one of the three hybridizations from each experiment, the Cy3 and Cy5 dyes were reversed (i.e., time-zero cDNA was labeled with Cy5 rather than Cy3) to account for dye bias (257).  The microarray contained duplicate spots of 70-mer oligonucleotide probes for 8,213 RHA1 genes, representing 89 % of the predicted genes (179).  The probes were designed and synthesized by Operon Biotechnologies, Inc. The microarray spot intensities were quantified using ImaGene 6.0 software (BioDiscovery, Inc.).  The average normalized expression ratios were calculated using GeneSpring 7.2 software (Silicon Genetics) by the intensity-dependent Lowess method, with 20 % of the data used for smoothing.  Differentially expressed genes were defined as those that were significantly up- or down-regulated by > 2-fold (P < 0.05) in at least three of seven time points compared to time zero.  K-means clustering of differentially expressed genes during the desiccation experiment was performed with GeneSpring 7.2 software using a Pearson correlation similarity measure.  2.2.5. Microarray data Details of the microarray design, transcriptomic experimental design, and transcriptomic data have been deposited in the NCBI Gene Expression Omnibus (GEO; www.ncbi.nlm.nih.gov/ geo) and are accessible through GEO Series accession number GSE10378.  2.2.6. Reverse transcription–quantitative PCR The expression ratios of selected genes were determined relative to those of a housekeeping gene encoding a probable DNA polymerase IV (gene identifier ro01702).  The expression of this housekeeping gene is steady under a variety of growth conditions (95), including the desiccation stress experiments reported here.  The primers and TaqMan probes (Applied Biosystems) used for qPCR (Table 2.1) were designed using the default settings of Primer Express software (version 2.0; Applied Biosystems). The samples used for the RT-qPCR and microarray analyses were the same.  Contaminating genomic DNA, which would not have affected microarray signal intensities, was greatly reduced from certain RNA samples needed for RT-qPCR by one or two DNase treatments, as described above, except that the amount of DNase I was increased to 86 U.  For cDNA synthesis, the manufacturer’s instructions for the Thermoscript RT-PCR System (Invitrogen Life Technologies) were followed, using random hexamer primers and 1.0 μg of   26 TABLE 2.1.  Quantitative PCR primer and probe sequences  Gene name or identifier Oligonucleotide Function Sequencea (5′–3′)    dps1   Sense primer CGAGTCGCCGACATACTTCA Antisense primer GCGTCAGATGCAGATCGTTGT Probe (6FAM)AAGCGGCTCAGCGC(NFQ)    dps2   Sense primer TGAGCCTGATCGCCAAACA Antisense primer GTGGACCGCCAGGAAGTG Probe (6FAM)CTGGAATGTCATCGGAC(NFQ)    sigF1   Sense primer TGCTGATGTTGCGGTTCTTC Antisense primer ACGCGCTGGGCGATT Probe (6FAM)ATCGATGACCCAGACGG(NFQ)    sigF2   Sense primer TTGGCCGGACGAGTATCAG Antisense primer CGAGGGCTGCCATCTGTT Probe (6FAM)TCACAGCACTCTTC(NFQ)    sigF3   Sense primer AATCACTTCCCGACCTCGAA Antisense primer GGGTCATGTTGCCGAAGAA Probe (6FAM)CACCGTGCTGGTCC(TAMRA)    ectA   Sense primer CGAGATACGGCGATCAACAA Antisense primer TGTCCATCGGGAAAATCGTT Probe (6FAM)CAAGAACTGTTCTCCC(NFQ)    ro01702   Sense primer GACAACAAGTTACGAGCCAAGATC Antisense primer CCTCCGTCAGCCGGTAGAT Probe (VIC)CGACGGACTTCGGCA(NFQ)     a Probes had a 5' 6-carboxyfluorescein (6FAM) or VIC fluorophore and a 3' nonfluorescent (NFQ) or 6-carboxytetramethylrhodamine (TAMRA) quencher.  purified RNA but only 10 U of RNaseOUT.  Each qPCR reaction mixture consisted of 1.0 μl of the 20 μl of cDNA produced, 200 nM of a TaqMan probe, 200 nM of each primer (except that 400 nM was used for the sigF1 assay), and 10 μl of 2- TaqMan Universal PCR Master Mix (Applied Biosystems) in a total volume of 20 μl.  Duplicate singleplex reactions for the gene of interest or the housekeeping gene were run in a Stratagene Mx3000P real-time PCR system for 2 min at 50 °C, 10 min at 95 °C, and then 40–45 cycles of 15 s at 95 °C and 1 min at 60 °C.  The qPCR cycle threshold (CT) results were analyzed by the comparative CT (ΔΔCT) method followed by Student’s one-sample t test to evaluate whether the gene targets were differentially regulated (22).  Expression ratios were calculated using the formula )( TCE  , where E is the  27 average amplification efficiency derived from the standard curves for the target and housekeeping genes (22).  2.3. Results  2.3.1. Drying rates and cell survival at low and high relative humidity Exponential-growth-phase RHA1 cells were filtered onto membranes and allowed to air-dry at a low relative humidity (~ 20 %) for up to 2 weeks.  Since the cells were subjected to concurrent stresses other than desiccation – most notably starvation – a control experiment was performed at high relative humidity (~ 100 %) such that the cells experienced significantly less desiccation stress.  The rate of drying during each treatment was determined gravimetrically (Figure 2.1A).  The desiccated cells reached a basal minimum mass by 12 h, whereas, over that same period, the control cells dried at a rate approximately 5-times slower, reducing their initial mass by half by 48 h.  After 2 weeks, the control cells still had a significantly greater mass, indicating that they had retained some intracellular water compared to the desiccated cells, whose mass did not differ significantly from dry-matter measurements (data not shown). Cell viability during the desiccation and control experiments was determined by CFU counts of the cell suspensions from vortexed membranes (Figure 2.1B).  The viability of the desiccated cells gradually decreased over time to a minimum of ~ 20 % after 2 weeks.  Conversely, the number of viable control cells more than doubled by 12 h, accompanied by increased variability among replicates.  In each control experiment, the cells started adhering to the membrane by 24 h, presumably due to their production of a sticky extracellular substance, which prohibited CFU counts for all subsequent time points.  Considering that very little growth substrate would have been available to the filtered cells, I hypothesized that the increase in cell number during the control experiment was due to reductive division and not increased biomass.  Desiccated cells were also microscopically examined to decipher whether the overall trend of decreasing CFU counts resulted solely from cell death or from the net contributions of an increase in cell number from reductive division coincident with a greater rate of cell death.  2.3.2. Morphological adaptations To observe any morphological adaptations of RHA1 to low or high relative humidity conditions, cryofixation SEM was used to view frozen samples with differing water contents   28 1 wk 2 wkB0.00.51.01.52.02.53.03.50 10 20 30 40 50T ime (h)109CFUsper20mlA0.000.050.100.150.200.250.30Cellpluswatermass(g) FIGURE 2.1.  (A) Loss of water from desiccated (●) or control (○) cells over time.  (B) CFU counts of desiccated (●) or control (○) cells over time.  The control experiment CFU counts from 24 h and on were confounded by cells adhering to the membrane.  The error bars represent standard deviations of the results from three independent cultures. FIGURE 2.1.  Drying rates and cell survival at low and high relative humidity  over the experimental time courses.  Just after filtration, the cells looked like healthy rods with a smooth cell surface (Figure 2.2A).  The appearance of the cells after 24 h and 1 week of desiccation did not change (Figures 2.2B and C).  Also, the average cell length remained constant at 7.5  0.3 μm (mean ± standard error) during desiccation.  Thus, reductive division did not occur and the steady decline in CFU as shown in Figure 2.1B corresponds to cell death.  In two of three independent control experiments, the cells were clearly embedded in an extracellular substance by 24 h (Figures 2.2D and E), consistent with the cells sticking to the membranes at this time during cell viability assays (cf. Figure 2.1B).  Although the average length of these embedded cells did not appear to differ from desiccated cells, the number of prominent septa within the embedded cells did increase, suggesting that cell division occurred without separation.  The vortexing step of the cell viability assay may have been forceful enough to break these    29    T = 0A24 hBDDesiccation(~ 20-% RH)1 wkCControl(~ 100-% RH)E FIGURE 2.2.  Cell morphology of RHA1 during the desiccation and control experiments FIGURE 2.2.  Cell morphology of RHA1 on membranes over 1 week of desiccation at ~ 20-% relative humidity (RH) versus incubation at ~ 100-% relative humidity.  Micrographs were captured by cryofixation SEM.  Scale bars are 10 μm for low-magnification images and 5 μm for high-magnification insets. 30 daughter cells apart, possibly accounting for the observed increase in CFU during the control experiment (cf. Figure 2.1B).  2.3.3. Desiccation-specific transcriptome Custom microarrays with probes for 89 % of the predicted RHA1 genes were used to profile the transcriptional response of RHA1 during the first 2 days of the desiccation and control experiments.  The main objective was to identify genes that were differentially expressed due to the higher rate of drying of the desiccation treatment.  The number of genes whose expression changed during desiccation was close to 8-times greater than that in the control experiment (Figure 2.3).  This disparity in genetic response indicates the severity of the stresses that the desiccated cells experienced, requiring large-scale alterations of their transcriptome.  The gene expression variability for the control cells was 45-% greater than that for their desiccated counterparts, which partially explains why they had fewer significantly up- and down-regulated genes; however, if only expression level–change criteria were considered, such as expression ratios up- or down-regulated by > 4-fold at three of seven time points, the response from the desiccated cells still exceeded that of the control cells by nearly a factor of 4.  Desiccation(~ 20-% RH)Control(~ 100-% RH)81910644 28 26 8 406 379  FIGURE 2.3.  Number of differentially regulated genes during the desiccation and control experiments FIGURE 2.3.  Number of differentially regulated genes during the desiccation and control experiments.  A differentially regulated gene was defined as up- or down-regulated (shown by arrows) by > 2-fold (P < 0.05) for at least three of seven time points relative to time zero.  RH, relative humidity.  The number of desiccation-specific responses, found to be differentially regulated in the desiccation treatment and not in the control, comprised a total of 406 up-regulated and 379 down-regulated genes (Figure 2.3; Appendix 1).  The expression profiles of these up-regulated  31 genes clustered into three general patterns.  Expression of the largest cluster under desiccating conditions steadily increased up to 12 h and then remained high (Figure 2.4A).  In general, the expression ratios of the same genes under the control conditions displayed no substantial up-regulation over 2 days.  The marked increase in expression of this group of genes at 12 h of desiccation coincided with the time point at which the desiccated cells reached minimal water content (cf. Figure 2.1A).  Therefore, the genes of this cluster appear to be up-regulated specifically in response to desiccation and are promising candidates for elucidating the mechanisms by which RHA1 survives its dried state.  The other two clusters of desiccation-specific up-regulated genes reached their peak expression levels quickly, within a few hours of treatment, with maximum expression ratios generally lower than those of the previous cluster.  One cluster was up-regulated early (around 3 h) and stayed up-regulated (Figure 2.4B) whereas the smallest gene cluster was up-regulated early (around 1 h) but only transiently (Figure 2.4C).  For these latter two groups of genes, the medial expression profiles during the control experiment followed similar trends as in the desiccated cells, but the expression ratios were attenuated in the control cells such that the genes did not pass the significance and expression level–change cutoffs.  This concordance in expression trends under both conditions, with maximum expression ratios occurring while the cells were still relatively well hydrated, suggests that the genes whose expression profiles are shown in Figures 2.4B and C are likely responding to common stresses in both treatments, only with heightened urgency in the desiccating cells.  Classifying many of these genes as adaptations to common stresses would augment the otherwise small number of genes that satisfied criteria for up-regulation in both experiments (Figure 2.3) and may provide a more accurate understanding of RHA1’s starvation response. For the 379 desiccation-specific down-regulated genes, the medial expression pattern exhibited an early, sustained decline by 3 h of desiccation compared to a slight decrease in expression of the same genes during the control experiment (Figure 2.4D).  Again, these genes could be clustered into three down-regulation patterns that reached their minimum expression ratios at 12 h (163 genes), at 3 h (114 genes), or, transiently, at 1 h (102 genes) of desiccation; however, in all three cases, these genes showed generally no differential regulation during the control experiment.  Thus, desiccation resulted in prompt down-regulation of many cellular processes not shut down to the same degree in the less stressed control cells. I focussed further analysis on the up-regulated genes of the desiccation-specific transcriptome in pursuit of the responses directly responsible for desiccation resistance in RHA1.    32 0.11101000 10 20 30 40 500.11101000 10 20 30 40 500.11101000 10 20 30 40 500.11101000 10 20 30 40 500.11101000 10 20 30 40 500.11101000 10 20 30 40 500.010.11100 10 20 30 40 500.010.11100 10 20 30 40 50Desiccation(~ 20-% RH)Control(~ 100-% RH)Normalized expression ratioTime (h)ABCDNormalized expression ratioperiment only FIGURE 2.4.  Clustering of expression patterns of genes differentially regulated during the desiccation experiment only.  Gray lines are the gene expression profiles of the same sets of genes during the desiccation and control experiments.  Thick black lines represent the median expression ratios of genes from the respective cluster.  The desiccation-specific up-regulated genes clustered into three groups:  (A) those up-regulated at 12 h (232 genes, including dps1 [○] and ectA [Δ]); (B) those up-regulated early (125 genes, including groL1 [□]); and (C) those up-regulated early but transiently (49 genes).  (D) Expression profiles for the 379 desiccation-specific down-regulated genes.  RH, relative humidity. FIGURE 2.4.  Clustering of expression patterns of genes differentially regulated during the desiccation experiment only  33 When these genes were categorized according to predicted functional roles, several groups warranted interest (Table 2.2).  z-score statistics were calculated (when possible) to gauge whether functional groups were over- or underrepresented in RHA1’s desiccation response in comparison to the number of that gene type present in the genome (71).  Functional categories with absolute z-score values of > 2 were considered to have deviated significantly from the number of differentially regulated genes expected for those groups (71).  In the desiccation-specific transcriptome, transcriptional regulator genes were far more prevalent than expected by chance.  Conversely, genes involved in transport were significantly less abundant than expected.  The proportion of up-regulated genes encoding transposases or hypothetical proteins was similar to that expected based on their genomic frequencies.  The desiccation-specific transcriptome also had several genes associated with cellular processes such as cell division, DNA recombination and repair, and lipid metabolism and cell envelope modification (Table 2.2).  Induction of genes involved in each of these functions may reflect adaptations to prevent and survive desiccation-induced damage.  Furthermore, with regard to the cell division group, six of the eight genes were up-regulated early in the desiccation treatment (i.e., the expression profiles are clustered in Figure 2.4B or C), suggesting that the desiccated cells may have taken initial steps towards cell division but never reductively divided.  TABLE 2.2.  Functional classification of desiccation-specific up-regulated genes  Functional category No. (%) of genes z scorec Desiccation-specifica In genomeb     Cell division 8 (2.0) NAf NA DNA recombination and repair 7 (1.7) NA NA Lipid metabolism and          cell envelope modification 23 (5.7) NA NA Transcriptional regulatorsd 71 (17.5) 705 (7.6) 7.6 Transportersd 20 (4.9) 890 (9.6) −3.3 Transposasese 6 (1.5) 199 (2.2) −1.0 Hypothetical gene productsd 138 (34.0) 3,509 (38.0) −1.7      a Total desiccation-specific up-regulated transcriptome contains 406 genes. b Total genome contains 9,225 genes. c z scores calculated as described by Doniger et al. (71), except genomic figures were used to approximate the proportion of genes in each functional category measured by the microarray. d Number in genome taken from McLeod et al. (179). e Number in genome determined by keyword search of gene annotations. f NA, not available.    34 2.3.4. Desiccation-specific genes up-regulated at 12 h Cluster analysis of the desiccation-specific transcriptome identified a group of genes that were increasingly expressed with drying.  One of the most highly up-regulated desiccation-specific genes was dps1, encoding a DNA protection during starvation protein.  The expression of dps1 resembled the typical expression pattern for genes up-regulated at 12 h of desiccation (Figure 2.4A).  Two conserved hypothetical genes (ro00102 and ro00103) contiguous with dps1 as well as two nearby but divergently transcribed genes encoding a sigma factor, SigF1, and an antisigma factor (ro00098 and ro00099) were all up-regulated during desiccation, with expression profiles correlated by > 99 % with that of dps1.  Other groups of genes also shared this pattern of regulation with at least 95-% correlation, including genes encoding another sigma factor, SigF3, and a probable transcriptional regulator of the MerR family (ro04728 and ro04729); a possible oxidoreductase, a dehydrogenase, and a possible cation transport regulator (ro05505–ro05507); a possible (p)ppGpp synthetase (ro08290), situated in between genes for a possible transcriptional regulator and a conserved hypothetical protein (ro08289 and ro08291); and, also of interest, a catalase (ro04309).  The simultaneous responses of these desiccation-specific genes suggest a common regulatory network.  The two alternative sigma factors, SigF1 and SigF3 (members of the group 3 subdivision of the σ70 family), are likely involved in the regulation of this network, but the signal(s) to which each responds and the genes that each transcribes cannot yet be deduced.  A third gene encoding a highly similar sigma factor of this subdivision, sigF2 (ro02118), did not have a microarray probe, so its expression was determined by RT-qPCR (Table 2.3).  Unlike its other two paralogs in RHA1, sigF2 was not differentially expressed at 12 h during either experiment (Table 2.3), suggesting that SigF2 has a different physiological role than the other two sigma factors. Two genes encoding enzymes in the biosynthetic pathway for the compatible solute ectoine, ectA and ectC (ro01305 and ro01307), were also part of the desiccation-specific cluster of genes up-regulated at 12 h (ectA expression is displayed in Figure 2.4A).  The third gene of ectoine biosynthesis, ectB (ro01306), had no probe in the microarray.  Both the desiccated and control cells would have experienced osmotic stress during their incubations out of liquid culture; however, the reduced severity of this stress in the control experiment is evident by the similar but attenuated expression profile of ectA during that treatment (Figure 2.4A).  The only other response associated with compatible solute production was up-regulation of an α,α-trehalose-phosphate synthase gene (ro00090), just one of six trehalose metabolism genes   35 TABLE 2.3.  Microarray and RT-qPCR expression ratios at 12 h compared to time zero  Gene identifier Gene name Expression ratioa in: Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) Microarray RT-qPCR  Microarray RT-qPCR        ro00101 dps1 31b 33b  2.2 1.3 ro08251 dps2 2.8b 3.5b  1.3 1.6b ro00098 sigF1 6.9b 7.7b  1.7 4.3b ro02118 sigF2 NAc 1.6  NA 1.3 ro04728 sigF3 31b 58b  1.1 1.3 ro01305 ectA 8.3b 10.7b  2.8 2.2         a Average normalized expression ratios (n = 3).  Negative expression ratios indicate down-regulation. b Significant change in expression between 12 h of treatment and time zero (P < 0.05). c NA, not available.  annotated in the RHA1 genome.  Two genes adjacent to this trehalose metabolism gene, encoding a conserved hypothetical protein and a hypothetical protein (ro00088 and ro00089), had expression trends similar to it during desiccation (Table 2.4).  2.3.5. Congruency between microarray and RT-qPCR results The expression ratios determined by microarray and RT-qPCR analyses at the 12-h time point of the desiccation and control experiments agreed well (Table 2.3).  In separate studies, our custom RHA1 microarray slides were validated by RT-qPCR for nine other genes, with reference to the same housekeeping gene used in the present study (95, 237, 265).  As a result, I have confidence in the validity of the microarray expression ratios.  RT-qPCR verified the significant up-regulation of genes believed to play important roles specific to desiccation tolerance, including dps1, sigF3, and ectA.  In the case of sigF1, its desiccation-specific microarray expression profiles and RT-qPCR expression ratios were not in complete agreement.  RT-qPCR showed significant up-regulation of sigF1 in both experiments, although its up-regulation was still 1.8-times greater during desiccation.  Expression of dps2 (ro08251), encoding a homolog of Dps1 with 37-% amino acid identity, was also confirmed by RT-qPCR to be up-regulated during desiccation but to a much lesser extent than dps1 – only ~ 3-fold as opposed to > 30-fold, respectively.  If this large difference in gene expression is indicative of protein abundance, then Dps2 is likely to contribute less than Dps1 to desiccation resistance, assuming also that these proteins function similarly.    36 TABLE 2.4.  Genes from desiccation-specific transcriptome discussed in text  Gene identifier Gene name Description of gene product Maximum expression ratioa Cluster patternb      ro00088  Conserved hypothetical protein 2.7 A ro00089  Hypothetical protein 11 A ro00090  α,α-Trehalose-phosphate synthase (UDP-forming) 4.9 A      ro00098 sigF1 σ70 type, group 3 subdivision 8.9 A ro00099  Antisigma factor, possible RsbW 3.4 A      ro00101 dps1 DNA protection during starvation protein 35 A ro00102  Conserved hypothetical protein 20 A ro00103/ro08731c  Conserved hypothetical protein / possible transglycosylase 12 A      ro00441 prmA Propane monooxygenase hydroxylase large subunit 348 B ro00442 prmB Propane monooxygenase reductase No probe  ro00443 prmC Propane monooxygenase hydroxylase small subunit 40 B ro00444 prmD Propane monooxygenase coupling protein 55 B ro00445  Conserved hypothetical protein 167 B ro00446  Conserved hypothetical protein 60 B ro00447 prmE Alcohol dehydrogenase 97 B ro00448 groL1 60-kDa chaperonin GroEL 52 B      ro00914  Probable AMP-dependent acyl–coenzyme A synthetase 4.3 B ro00915  Conserved hypothetical protein 5.5 B ro00916  Short-chain dehydrogenase 6.6 B      ro01305 ectA Probable acetyltransferase 10 A ro01306 ectB Probable diaminobutyrate–pyruvate aminotransferase No probe  ro01307 ectC L-Ectoine synthase 3.5 A      ro02122  Isocitrate lyase 8.2 C      ro04049  Conserved hypothetical protein 5.5 B ro04050  Conserved hypothetical protein 4.6 B ro04051  Probable stage II sporulation protein 2.8 B      ro04309  Catalase 4.3 A      ro04728 sigF3 σ70 type, group 3 subdivision 33 A ro04729  Probable transcriptional regulator, MerR family 20 A      ro05275 katG Catalase 6.7 B      ro05505  Possible oxidoreductase 6.0 A ro05506  Dehydrogenase 4.6 A ro05507  Possible cation transport regulator 9.1 A      ro05911  Probable NADH dehydrogenase subunit C 2.5 C      ro05915  Probable NADH dehydrogenase subunit G 4.3 C      ro05917  Probable NADH dehydrogenase subunit I 2.9 C ro05918  Probable NADH dehydrogenase subunit J 4.0 C ro05919  Probable NADH dehydrogenase subunit K 3.7 C ro05920  Probable NADH dehydrogenase subunit L 26 C ro05921  Probable NADH dehydrogenase subunit M 9.0 C      ro07195  Probable transcriptional regulator 16 A ro07196 sufB FeS assembly protein 18 A ro07197 sufD FeS assembly protein 8.7 A ro07198 sufC FeS assembly ATPase 9.0 A ro07199 sufS Selenocysteine lyase 4.5 A ro07200  Probable FeS assembly protein 3.6 B  37 Gene identifier Gene name Description of gene product Maximum expression ratioa Cluster patternb ro07201  Possible metal–sulfur cluster protein 3.2 B      ro08251 dps2 DNA protection during starvation protein 4.3 A      ro08289  Possible transcriptional regulator 9.7 A ro08290  Possible (p)ppGpp synthetase 21 A ro08291  Conserved hypothetical protein 15 A       a Maximum average normalized expression ratio (n = 3) attained during the desiccation time course. b Cluster pattern expression profiles are shown in Figure 2.4. c Probe cross-hybridizes with two genes.  2.3.6. Genes up-regulated early in response to common starvation stress Of the genes clustered in groups up-regulated early in desiccation, some of the most highly up-regulated responses belonged to two large putative operons.  Seven genes from each putative operon were significantly up-regulated in only the desiccation treatment but followed similar, attenuated expression patterns in the control.  Each set of genes was likely cotranscribed since the expression profiles of at least six of the seven members correlated by > 90 % during both treatments. Genes in the first of these putative operons (ro00441–ro00448), with members that encode a propane monooxygenase enzyme (prmABCD), all clustered in the up-regulated-early pattern (Table 2.4).  This large operon – including prmB (ro00442), for which the microarray lacked a probe – is induced in propane-grown RHA1 (237).  In addition to the functional role of these genes in propane catabolism, their expression was also greatly increased when RHA1 was grown on 5-mM phenol (unpublished data), an organic solvent stress.  The expression of this operon during organic solvent stress and during the starvation stress in both treatments of the present study (groL1 expression is displayed in Figure 2.4B) suggests that it may be part of a general stress response.  How the propane monooxygenase would contribute to such a stress response is unclear, but the GroEL chaperonin protein and, perhaps, the conserved hypothetical proteins encoded at the end of this operon may have important functions under a range of cellular stresses where macromolecular stability is jeopardized. The second putative operon consists of genes annotated as probable NADH dehydrogenase subunits (ro05909–ro05922); their expression profiles clustered in the pattern of early but transient up-regulation (Table 2.4).  This strong response of half of the 14 contiguous probable NADH dehydrogenase subunit genes likely represents an important adjustment of aerobic respiration in the starved cells from both treatments.  Transient up-regulation of these  38 genes has also been observed in early stationary phase of carbon-starved RHA1 batch cultures but not in nitrogen-starved ones (unpublished data). Other putative operons and highly expressed genes with expression trends during both experiments that indicate that they may have responded to common stresses include genes encoding a probable AMP-dependent acyl–coenzyme A synthetase, a conserved hypothetical protein, and a short-chain dehydrogenase (ro00914–ro00916); an isocitrate lyase (ro02122); a probable stage II sporulation protein downstream of two conserved hypothetical proteins (ro04049–ro04051); a KatG catalase (ro05275); and an FeS assembly pathway (ro07195–ro07201).  2.4. Discussion  2.4.1. Veritable desiccation resistance I have presented the first genome-wide study of the transcriptional response of a Gram-positive bacterium to desiccation.  In studies that have compared survival of Gram-positive and Gram-negative bacteria during air-drying, the Gram-positive species have consistently proven themselves better adapted to dry conditions (136, 280, 286).  In particular, actinomycetes have long been considered dry-soil specialists since their proportion within a bacterial community increases in arid regions (181).  Here we found that one fifth of RHA1 cells survived 2 weeks of desiccation at 30 °C and a relative humidity of ~ 20 %.  The cyanobacterium and alphaproteobacterium species for which the two other desiccation transcriptomes have been determined are less tolerant than RHA1 to their (less harsh) air-drying treatments:  fewer than 1 % of Anabaena sp. PCC7120 cells survive after only 22 h at 30-% relative humidity (141) and ~ 1–2 % of Bradyrhizobium japonicum cells survive after 3 days at 27-% relative humidity (when the initial cell count is conservatively estimated at 108 CFU/ml) (63).  RHA1, as a member of a truly desiccation-tolerant phylum, may be protected from air-drying by features inherent to Gram-positive cell walls in addition to the presumably beneficial genetic responses to desiccation stress identified in this study. Electron microscopy of RHA1 suggested that the integrity of its cell membrane was not breached over 1 week of desiccation.  Whether this reflects a special adaptation is difficult to ascertain since the only published micrographs of dried bacteria are of ones considered to be relatively desiccation-tolerant.  One would expect that desiccation-sensitive bacteria – such as E.  39 coli, which largely succumbs to desiccation in less than a day (126) – would leave visibly damaged cells as they are dried.  This idea is supported by the instability and folding of cell membranes observed in dehydrated E. coli K-12 cells subjected to hyperosmotic shock (185).  Like RHA1, a close relative, R. opacus PD630, maintains a healthy ultrastructure during desiccation (6).  After 60 days at 20-% relative humidity, the proportion of coccoidal PD630 cells increases, although the majority are still filamentous, and the cells become embedded in an EPS-like matrix (6).  I found possible evidence for reductive cell division and EPS production by RHA1 in only the control treatment.  Perhaps the intense and sudden stresses endured by the desiccated cells hindered these seemingly advantageous adaptations to air-drying that were possible in the more gradually dried control cells. Multiple observations in this study indicate that the desiccated cells experienced greater stress than the cells incubated at high relative humidity.  Relative to the control cells, the desiccated cells (i) dried significantly faster, (ii) failed to increase in cell number, (iii) had a greater number of differentially regulated genes, (iv) had greater changes in levels of gene expression, and (v) exhibited clearer, less variable trends with respect to cell viability, morphology, and gene expression.  The greater variability of the control cells suggests that the milder stresses they experienced neared a threshold for induction of certain desiccation responses such that only some were expressed, and most of those were weakly expressed.  These observations support conclusions based on the premise that the differences in responses between the treatments reflect adaptations to desiccation stress.  2.4.2. Mechanisms of protection from desiccation-induced damage High up-regulation of dps1 upon drying was one of the most notable responses of RHA1.  Since the discovery of Dps in starved E. coli (2), orthologs of this protein have been studied from species throughout the bacterial domain and a few archaea as well.  The closest biochemically characterized ortholog of Dps1 from RHA1 is from M. smegmatis (42).  Dps1 from M. smegmatis and most other purified Dps proteins have ferroxidase activity and can bind and sequester iron in their dodecameric form (109), preventing the production of hydroxyl radicals through Fenton chemistry (297).  Accordingly, the protection from oxidative stress imparted by this protein is well documented (2, 8, 128, 171, 199).  Some Dps homologs, including M. smegmatis Dps1, can also bind nonspecifically to double-stranded DNA (42).  In starved E. coli, Dps–DNA complexes biocrystallize (282), thereby sequestering DNA.  Thus, Dps may  40 additionally act as a protective shield for DNA against damaging agents such as nucleases and oxidative radicals (103, 190). The importance of dps genes for surviving a variety of physiological stresses has been observed for diverse bacterial species.  Even though one of the consequences of desiccation stress is known to be increased reactive oxygen species (62, 175), no previous study has demonstrated that Dps might help desiccation tolerance.  However, the dps gene of D. radiodurans is significantly up-regulated in response to γ irradiation, presumably conferring protection from the resulting oxidative radicals (252).  In fact, the remarkable resistance of D. radiodurans to ionizing radiation is believed to be a consequence of its adaptation to dry environments (175).  Dps in E. coli was also found to protect stationary-phase cells from UV and γ irradiation (190).  The association of oxidative stress with the cellular assaults imposed by both γ radiation and desiccation strengthens the prospect that Dps is a critical desiccation survival mechanism in RHA1. The sigma factor genes correlated with dps1 expression during desiccation in RHA1 are related to genes known to regulate expression of dps orthologs in two other Gram-positive bacteria, B. subtilis and a fellow actinomycete S. coelicolor.  Expression of dps is dependent upon SigB in response to several stresses in B. subtilis, including starvation, salt, heat, and ethanol treatments (8), and to salt stress in S. coelicolor (155).  Previous studies have never directly associated Dps with desiccation resistance, but such a function is consistent with a report by Völker et al. that a sigB− mutant of B. subtilis is 10-times more sensitive to lyophilization than the wild type (268).  In RHA1, the three SigF proteins have the highest sequence identities to the SigB proteins from B. subtilis and S. coelicolor.  Furthermore, in addition to being up-regulated during desiccation stress, dps1 and sigF3 of RHA1 were also up-regulated following heat and salt stresses, according to the results of separate microarray experiments (unpublished data).  These results suggest that SigF3 may regulate genes involved in resistance to a broader range of stresses than SigF1, although either or both could be responsible for the large transcriptional response after 12 h of desiccation.  The simultaneous up-regulation of sigF3 and dps1 during desiccation, osmotic, and heat stresses, as well as the potential conservation in RHA1 of the regulatory relationship seen in B. subtilis and S. coelicolor, all suggest a role for SigF3 in dps1 expression. To cope with the osmotic stress inherent to water evaporating off of drying cells, RHA1 up-regulated expression of genes needed to synthesize ectoine and, to a lesser degree, trehalose.   41 These two organic solutes are listed as predominant osmoprotectants found in actinomycetes (275) and they may be particularly prevalent in rhodococci since they accumulate in desiccated R. opacus PD630 cells grown on different carbon sources than used in our study (6).  Ectoine is likely the primary compatible solute in RHA1 because its biosynthetic pathway is a common response in both the osmotic and desiccative stress transcriptomes (74).  These studies on RHA1 used benzoate as the growth substrate, so whether other compatible solutes would be preferentially synthesized on other growth substrates is unknown.  Nevertheless, the ability to synthesize ectoine appears to be an important contributor to the desiccation resistance of RHA1.  In general, this compatible solute is restricted to halophilic and marine bacteria that thrive in salty environments, and so it may confer exceptional osmotolerance (36).  2.4.3. Comparison of bacterial desiccation responses Prior to the present study on an actinomycete, whole-genome transcriptional analyses had been conducted on two other desiccated bacterial species:  the cyanobacterium Anabaena sp. PCC7120 (microarray probes were not gene-specific, however) (141) and the alphaproteobacterium B. japonicum (63).  Important responses found in all three studies include genes for the synthesis of compatible solutes, protection from oxidative damage, cell envelope modification, and transcriptional regulation.  Results from the Anabaena sp. PCC7120 and B. japonicum transcriptomes both support previous findings that trehalose is a major compatible solute in these bacteria when desiccated (123, 247).  By contrast, RHA1 induced its ectoine biosynthetic pathway.  To neutralize reactive oxygen species, Anabaena sp. PCC7120 up-regulates a catalase (141) and B. japonicum up-regulates peroxidases and superoxide dismutases (63).  RHA1 did induce two catalases (Table 2.4), but its predominant antioxidant response was induction of dps1.  Knockout mutagenesis of these unique genetic responses will be needed to establish their contributions to RHA1’s fitness during desiccation.  Other commonalities between the desiccation responses of RHA1 and B. japonicum are genes involved in DNA modification, repair, and transposition (63).  Furthermore, both of these desiccated bacteria up-regulate a gene encoding isocitrate lyase, part of the glyoxylate shunt.  Since this gene is characterized as a response to common stresses in the present study, we propose that it was up-regulated to utilize acetate produced through catabolism of endogenous triacylglyceride storage compounds and lipids from the cell wall.  Lastly, Anabaena sp. PCC7120 and B. japonicum both induce heat shock and chaperonin proteins in response to desiccation (63, 141).  RHA1 also up-regulated  42 general stress genes during desiccation, including a chaperonin, encoded by groL1, and a possible (p)ppGpp synthetase, which would help control levels of the alarmones (p)ppGpp (251).  Additionally, two general stress genes of RHA1 encoding a chaperonin and a heat shock protein (ro08345 and ro08348) were induced during both the desiccation and control experiments (Appendix 1). The genetic mechanisms induced by RHA1 during desiccation stress represent our most detailed insight thus far of how desiccation-resistant bacteria are able to persist under conditions of low water activity.  And, with regard to the special bioremediation capabilities of RHA1, understanding the key mechanisms involved in its desiccation resistance may enable effective decontamination of polluted soils in arid and semiarid regions.   43 Chapter 3:  Wild-Type-Like Stress Resistance of RHA1 dps Mutants  3.1. Rationale I hypothesized that dps1 improves the fitness of RHA1 during desiccation by providing protection from oxidative stress, a logical extension of the known role of Dps proteins.  This hypothesis was supported by strong evidence for the up-regulation of dps1 specifically during desiccation stress.  To recapitulate, dps1 was one of the most highly up-regulated genes of those with expression profiles that were maximally expressed upon complete drying of the cells.  The expression trend of dps1 during desiccation stress was corroborated by several desiccation-specific genes located immediately downstream or just upstream of it that shared the same expression profile.  Furthermore, dps1 expression deduced from the microarray experiments was verified by RT-qPCR. After deleting dps1 from the RHA1 genome, I tested the mutant for sensitivity to oxidative stressors, to which the majority of bacterial dps mutants are sensitive.  I then tested the mutant for sensitivity to the complex physiological stress of desiccation.  When the dps1 mutant proved to be resistant to these stresses, I constructed a dps-null mutant of RHA1 (i.e., a dps1 dps2 double mutant) and thoroughly investigated its stress resistance.  3.2. Materials and methods  3.2.1. Growth conditions RHA1 and derivative strains were grown in a defined minimal medium consisting of the following nutrients, in the specified amounts per liter:  potassium hydrogen phosphate, 12.5 g; potassium dihydrogen phosphate, 2.32 g; ammonium sulfate, 1.00 g; magnesium sulfate, 316 mg; magnesium chloride hexahydrate, 28.6 mg; ferrous sulfate heptahydrate, 11.9 mg; calcium chloride, 11.1 mg; calcium carbonate, 2.50 mg; zinc sulfate heptahydrate, 1.80 mg; manganese sulfate monohydrate, 1.06 mg; thiamine hydrochloride, 337 μg; cupric sulfate pentahydrate, 313 μg; cobalt chloride hexahydrate, 300 μg; and boric acid, 75.0 μg.  Concentrated hydrochloric acid was added during preparation of the stock solution containing trace metals to solubilize these components.  Lastly, a carbon source of sodium benzoate was added to a final concentration of 20 mM.  The more complete set of nutrients provided in this medium led to improved reproducibility of RHA1 growth, compared to that on W minimal medium.  For certain  44 experiments, as indicated, cultures were grown in the complex medium of LB Broth, Lennox (Difco).  In all cases however, precultures of RHA1 strains were seeded with colonies from W medium plates (1.5-% agar) grown on biphenyl vapors at 30 °C.  Cultures of 50 or 100 ml in 250-ml Erlenmeyer flasks, closed with tin foil, were inoculated at 1 % (vol/vol) with a preculture in exponential growth phase and incubated at 30 °C with shaking at 200 rpm.  Cells in exponential growth phase were harvested near the half-maximal OD600 of the (pre)culture, and those in stationary phase were harvested 2.9–3.5 or 2.3 days after inoculation in minimal or LB medium, respectively.  Three replicate cultures per strain were used for experimentation, unless indicated otherwise.  Samples taken from cultures for CFU counts were serially diluted in 0.8-% NaCl solution, in duplicate as technical replicates, and then grown on LB plates (1.25-% agar) at 30 °C for ~ 2 days. E. coli was cultured in LB medium at 37 °C with shaking at 200 rpm.  3.2.2. General genetic methods Fundamental cloning techniques were performed following standard guidelines (229), such as those for PCR, agarose gel electrophoresis, electroporation, and chemical transformation using calcium chloride.  Primary cloning steps were conducted in E. coli strain DH5α (99).  PCR primers were designed using Gene Runner software (version 3.05; Hastings Software).  To prepare PCR template from RHA1 colonies, 1-ml LB cultures were seeded with individual colonies and harvested after 1 day of growth.  Washed cells were resuspended in 40 μl of sterile water and then subjected to two or three cycles of freezing (10 min at −20 °C) and heating (15 min in boiling water).  The genomic material released from the fractured cells was collected from the supernatant after centrifugation at 16,000 g for 5 min.  For PCRs using DNA template from RHA1 (i.e., of high G+C content), dimethylsulfoxide was added as a cosolvent to a concentration of 2 % (vol/vol).  DNA products from PCR reactions or agarose gels were purified using GFX columns (GE Healthcare), according to the instructions of the commercial kits.  Plasmid or fosmid DNA was isolated from E. coli hosts using a commercial kit from Qiagen or Bio-Rad Laboratories or using a standard procedure of alkaline cell lysis with SDS (Appendix 2), respectively.  Nucleic acid concentrations were measured using a NanoDrop spectrophotometer (ND-1000 version 3.3; NanoDrop Technologies, Inc.).    45 3.2.3. Construction of knockout mutants Unmarked gene deletion mutants were created in RHA1 using the same general strategy developed for another rhodococcal species (264).  Mutagenic plasmids were constructed from the upstream and downstream flanking sequences of each gene target, ligated together in the multiple cloning site of the plasmid pK18mobsacB (232).  The flanking sequences were each designed to be ~ 1 kbp in size and to overlap with the target protein-coding DNA sequence (CDS) by ~ 50 bp.  They were amplified from fosmid templates of the RHA1 genome library (273) using a high-fidelity, thermostable DNA polymerase and the primers listed in Table 3.1.  The dps1 and dps2 loci are found on fosmids from clones RF00111N05 and RF00120D15, respectively.  The ligation reactions consisted of the appropriately digested and dephosphorylated pK18mobsacB vector and the digested upstream and downstream flanking sequences, each provided at a high insert-to-vector molar ratio of between 4 and 5.  The total DNA concentrations of the reactions were ~ 14 ng/μl in volumes of ~ 16 μl.  TABLE 3.1.  PCR primer sequences used in the creation and screening of deletion mutants  Deletion target Primer Function and directionality Sequencea (5′–3′) Restriction site     dps1    Upstream fragment   Sense CGGTCTAGAAAGTGCGAGCGCGTGCCGAATG XbaI Antisense GCGAAGCTTGCCCTGATCGTCGGAAAGACCTGGC HindIII Downstream fragment   Sense CGGAAGCTTGCGGCAGCCTCTCGAACAACGG HindIII Antisense GCTGCATGCTGGAACGGCAACGTCAACAGGAAGC SphI Screening   Sense GAACTTCGGCGATCGAGTCAGGAAC  Antisense CTTGCCCTCGCGGGTGAGATC      dps2    Upstream fragment   Sense CGCGAATTCAGACGTGTTGCGGGCCGGACAAAC EcoRI Antisense CGGTCTAGAGGCGTCGAGGGCGGTGGTGATG XbaI Downstream fragment   Sense CGGTCTAGATCTGCCCAGCGCCGTCGACTC XbaI Antisense GCGAAGCTTGCCGAACGGGTACCGCAGGCTG HindIII Screening   Sense GGGAGGAAACGCCGGTTCAGTGCTC  Antisense GATTCTCGGCGAGGCACAAAGCGTG       a Restriction sites in the 5′ extensions of the primers are underlined.  Because the host range of pK18mobsacB is limited to close relatives of E. coli (232), the mutagenic derivatives described here could only be retained in RHA1 cells through integration  46 with the genome, via homologous recombination adjacent to the targeted gene.  Transformants of E. coli S17-1, a strain designed for the conjugative transfer of plasmids (238), served as donors of the mutagenic plasmids to the desired RHA1 parent strains.  S17-1 competent cells were transformed using a version of the transformation and storage solution (TSS) method developed by Chung et al. (54).  Notable deviations from the recommended procedure were as follows:  the TSS contained 200-mM Mg2+; S17-1 cells were concentrated 100-fold in unchilled TSS; and roughly 1 μg of the mutagenic plasmid was added to the competent cells, which were then put on ice for 1 h followed by a heat shock at 37 °C for 5 min.  The protocols for conjugation and the selection of potential mutants were performed basically as described previously (264), save that 50 μg/ml of kanamycin was employed as the selective concentration for RHA1 transconjugants.  Kanamycin-sensitive, sucrose-resistant colonies were screened by colony PCR, using primers external to the intended deletions (Table 3.1), to identify mutants.  3.2.4. Cell length measurement Cell length was measured to gauge the size of RHA1 cells, which grow as rods with a uniform width of ~ 1 μm.  The lengths of ten cells per culture were measured (to the nearest 0.5 μm) with the micrometer scale on a phase contrast microscope.  To control for human bias, the first ten cells that passed through the center of the field of view were measured, from areas of the slide not densely packed with cells.  The median cell lengths of culture samples were estimated from ln-transformed data.  3.2.5. H2O2 stress assay Cells harvested at the desired growth phase were spun down at 6,500 g for 3 min, washed in either unsupplemented minimal medium (i.e., without sodium benzoate) or in 0.8-% NaCl solution, and then resuspended in the same solution at the culture’s original cell density, unless indicated otherwise.  The cells were treated with H2O2 and incubated at 30 °C with shaking at 200 rpm.  Cell survival was determined from CFU counts of samples taken before and after the H2O2 treatment.  The stability of the stock H2O2 solution was verified using colormetric test strips for peroxide (EMD Chemicals Inc.).  Preliminary experiments to this and the following stress assays were performed to determine the degree of stress required to partially kill wild-type RHA1 cultures and thus to appropriately challenge the dps− mutants.   47 3.2.6. Desiccation resistance assay Culture samples at the desired growth phase were diluted to a cell density of ~ 20 CFUs/ml in unsupplemented minimal medium.  Cells from this diluted suspension were vacuum filtered, 5 ml at a time, onto sterilized 0.65-μm cellulose acetate membranes (47-mm diameter; Sartorius), depositing ~ 100 CFUs per membrane.  To prevent curling of the membranes during sterilization, the best practice was to autoclave them in wet conditions.  Also note that in one experiment, as indicated, sterilized 2.5-μm cellulose filters (grade 42; Whatman) were substituted for the membranes.  The wet membranes plus cells were desiccated in an air-tight cabinet maintained at 30 °C and a relative humidity of ~ 20 % using trays of silica gel and a digital hygrometer.  At various time points, the membranes were placed onto LB agar plates and incubated at 30 °C for ~ 2.5 days.  The desiccation resistance of the cells was determined by comparing the resultant CFU counts to those of filtered cells that had not undergone desiccation.  3.2.7. Growth inhibition assay by diffusion of chemical stressors from paper disks Cell suspensions were prepared from colony biomass (from LB agar plates, supplemented with antibiotics where appropriate) mixed in 0.8-% NaCl solution.  For each experiment, the turbidities of the cell suspensions of different strains were equalized at an OD600 between 2.0 and 2.6.  Uniform cell lawns were created by adding 100 μl of a cell suspension to 5 ml of liquid 0.7-% agar, warmed at 45 °C, and then pouring this layer on LB agar plates, prewarmed at 30 °C.  Once the agar had solidified, small disks (7-mm diameter) of filter paper (grade 1; Whatman) were placed on the cell lawns and a chemical stressor in a volume of 5 μl was allowed to infiltrate the disks.  Note that for the experiment involving the stressor H2O2, the cell suspensions were directly spread over LB agar plates instead of being applied in top layers of agar.  For the stressor methyl methanesulfonate (MMS), which was dissolved in ethanol, experiments showed that 5 μl of ethanol did not inhibit RHA1 growth.  To improve reproducibility of the results for volatile stressors, air flow through the glass plates was limited by sealing them with Parafilm M (Bemis Company, Inc.).  In all experiments, three to six replicate plates per strain were incubated at 30 °C for ~ 2 days.  The average diameter of the zone of growth inhibition bisecting the disk on each plate was measured.     48 3.2.8. Metal toxicity assays Stationary-phase culture samples of 1 ml were exposed to metal stresses of 50 and 500 mM, by the addition of a 1-M solution of FeSO4, CuSO4, or ZnCl2, and then incubated for 2 h at 30 °C with shaking at 200 rpm.  The solution of 1-M FeSO4 was prepared in deoxygenated water just prior to performing the assay.  Cell survival was determined from CFU counts of samples taken before and after the metal stress treatments. The effect of iron stress on cell growth was tested using cell suspensions prepared from colony biomass (from LB agar plates) mixed in 0.8-% NaCl solution and adjusted to an OD600 of 1.  Serial dilutions of the cell suspensions were pipetted as 10-μl droplets, in duplicate as technical replicates, onto LB agar plates supplemented with freshly prepared FeSO4 at concentrations of 0–10 mM.  Resistance to the iron treatments was evaluated after the plates were incubated for 2 days at 30 °C.  3.2.9. UV radiation resistance assay Stationary-phase culture samples of 10 ml were irradiated in open petri dishes (90-mm diameter) with UV light (254-nm λ) at a intensity of ~ 0.48 mW/cm2 for 2 min.  Survival of the irradiated cells was determined from CFU counts compared to those from nonirradiated controls.  3.2.10. Quantification of strain abundance within mixed cultures of the dps-null mutant and wild-type RHA1 Pure cultures of the dps-null mutant and wild-type RHA1 in minimal medium supplemented with sodium benzoate were seeded at 1 % (vol/vol) with cell suspensions adjusted to at an OD600 of 2.  The cell suspensions were prepared from colony biomass (grown on biphenyl vapors and W medium agar plates) mixed in 0.8-% NaCl solution.  Equal volumes of the pure cultures grown to stationary phase were blended and used to inoculate the first cocultures of these strains at 1 % (vol/vol).  Upon reaching stationary phase, these mixed cultures were passaged in fresh minimal medium supplemented with sodium benzoate, for a total of nine cycles.  Note that the stationary phases experienced by the mixed cultures were shorter for the first four passages compared to the last five.  Samples of 10 ml were harvested from the initial mixtures and the stationary-phase mixed cultures.  The cells were spun down at 5,400 g for 10 min at 4 °C, washed in 1 ml of 0.8-% NaCl solution, and stored as pellets at −80 °C.   49 Nucleic acids were isolated from these samples by a method involving cell lysis with lysozyme, protein removal with SDS and proteinase K, and extraction with organic solvents (Appendix 3). The proportions of each strain in the initial mixtures were determined by CFU counts from the pure cultures.  Changes in the relative abundance of the cocultured strains over the course of the experiment were monitored by qPCR using probe sets specific for each strain.  To quantify the wild-type strain, the primers and probe for the dps1 gene (Table 2.1) were reused since they target a region of this gene that is deleted in the dps-null mutant.  To quantify the dps-null mutant, a TaqMan probe was designed to anneal specifically to the mutant version of the dps1 gene, at the HindIII deletion junction sequence.  The probe sequence is 5′CGCAAGCTTG CCC3′, with a 5′ 6-carboxyfluorescein (6FAM) fluorophore and a 3′ nonfluorescent quencher, and the sense and antisense primer sequences are 5′CGCGCCGTTGTTCGA3′ and 5′AAGTTCA CCGTGCCAGGTCTT3′, respectively.  Each qPCR reaction mixture consisted of 50 ng of nucleic acid template, 200 nM of probe and each primer, and 10 μl of 2- TaqMan Universal PCR Master Mix in a total volume of 20 μl.  Duplicate singleplex reactions targeting each strain were run in a Stratagene Mx3000P real-time PCR system for 2 min at 50 °C, 10 min at 95 °C, and then 40 cycles of 15 s at 95 °C and 1 min at 60 °C.  The differences in CT values between the mutant and wild-type strains from the stationary-phase mixed cultures were normalized to those of the initial mixtures by the CT method.  Changes in the relative abundance of the strains were calculated using the formula )( TCE  , where E is the average amplification efficiency of the probe sets, derived from standard curves in which templates from the respective pure cultures were used.  The results were expressed as the proportions of each strain in the stationary-phase mixed cultures by combining the data from the CFU counts of the initial mixtures with the changes in strain abundance determined by qPCR.  The specificities of the probe sets were verified:  0.00 % of the DNA from the wild-type pure cultures was found to be of mutant origin, and vice versa.  3.2.11. Statistics Results in the text and figures are expressed as means with their standard errors.  Unless otherwise noted, statistical comparisons of test groups were computed by two-tailed, two-sample Student’s t tests assuming equal variances (93).  Resultant P values < 0.05 were considered statistically significant.   50 3.3. Results  3.3.1. Creation of RHA1 dps1 and dps-null mutants The two dps homologs in the RHA1 genome were deleted sequentially, via homologous recombination with mutagenic plasmids constructed in part from the flanking sequences of each gene.  The antibiotic resistance marker and the sacB counterselection marker in the plasmid were utilized, respectively, to detect plasmid integration at the target locus followed by a second recombination event in the transconjugants, from which the desired mutants were obtained.  Most of each gene’s CDS was deleted, leaving only 19 and 14 % of the original dps1 and dps2 CDSs, respectively.  In the case of the dps1 mutant, the deletion introduced a frameshift mutation in the remaining 3′ end of the gene, dislocating its stop codon 34 bp downstream from the native site but 5 bp before the start codon of the following, (likely) cotranscribed gene (ro00102).  These mutations were designed to disrupt all normal functionalities of the targeted dps genes without unduly increasing the chances of polar effects.  PCR amplification of the regions encompassing the deleted genes yielded the correct genotypes for the dps1 and dps-null strains:  at the dps1 and dps2 loci, respectively, the wild-type bands of 894 and 1,004 bp were replaced by the truncated bands of 464 and 566 bp (Figure 3.1).  The genotypic stability of these unmarked deletions was verified at least two additional times per mutant over the course of the phenotypic tests.  3.3.2. General growth characterization of the dps mutants Growth of the dps1 mutant in minimal medium was similar to that of wild-type RHA1, as measured by both optical density and colony counts (Figure 3.2), in terms of the lag phase before exponential growth and the turbidity reached at the transition into stationary phase.  The growth rates of the dps1 mutant and wild type during exponential growth phase were not significantly different, with doubling times of 4.8  0.1 h and 4.9  0.1 h, respectively, based on the OD600 data.  In stationary phase, the dps1 mutant consistently reached optical and cell densities that were not significantly different from wild type, as determined from additional cultures grown for stress assays.  Thus, the dps1 mutant was not impaired during any growth phase relative to wild type, unlike certain other dps mutants that have slower growth rates (8, 55) or poorer survival in stationary phase (199, 258, 287).   51 1,650 bp1,000 bp850 bp650 bp500 bp400 bp300 bp200 bp2,000 bpDNA ladderdps1 regionWild type #1Wild type #2dps1#1dps1#2dps-null#1dps-null#2NTCWild type #1Wild type #2dps1#1dps1#2dps-null#1dps-null#2NTCdps2 regionDNA ladderWild type #1Wild type #2dps1#1dps1#2dps-null#1dps-null#2NTCWild type #1Wild type #2dps1#1dps1#2dps-null#1dps-null#2NTC FIGURE 3.1.  Genotype verification of the RHA1 dps1 and dps-null mutant strains by colony PCR  FIGURE 3.1.  Colony PCR amplification of the regions encompassing the dps1 and dps2 loci to verify the genotypes of wild-type RHA1 and the dps1 and dps-null mutant strains.  The PCR products from two colonies of each strain and a no-template control (NTC) were electrophoresed on a single agarose gel.   0.010.11100 12 24 36 48 60 72Time (h)OD600567891011  log (CFU/ml) d FIGURE 3.2.  Growth of dps1 mutant (open symbols) and wild-type RHA1 (closed symbols) cultures in minimal medium plus 20-mM sodium benzoate, as measured by OD600 (circular symbols) and CFUs (triangular symbols). FIGURE 3.2.  Growth of dps1 mutant and wild-type RHA1 cultures in minimal medium plus 20-mM sodium benzoate  52 Just as for the single dps1 mutant, growth of the dps-null mutant was not reproducibly different from that of wild type, whether grown in minimal or rich medium.  The lengths of dps-null and wild-type cells in exponential and stationary growth phases were also examined because Dps proteins could potentially impact cell division through their roles in nucleoid organization (147) and in regulation of DNA replication initiation (50).  Cell size was not significantly different between the strains, with median cell lengths of ~ 6 μm in exponential growth phase and ~ 2 μm in stationary phase.  Thus, reductive division of the dps-null mutant was not defective as the cell lengths of both strains decreased by two thirds.  3.3.3. Insensitivity of dps1 mutant to oxidative and desiccative stresses The resistance of the dps1 mutant to oxidative stress from H2O2 was determined for cultures harvested during exponential growth and stationary phase.  I found that the resistance of exponential-growth-phase cells to H2O2 depended on the turbidity at which the cultures were harvested.  Therefore, only cultures harvested at similar turbidities (OD600 of 2.0  0.2) were selected to compare the oxidative resistance of the strains.  The survival results for cells from both growth phases (Figures 3.3A and B) show that killing occurred within 10 min of H2O2 addition, whereafter cell viability stabilized.  Survival of the dps1 mutant was not significantly different from wild type during either growth phase, except for at the last time point for the exponential-growth-phase cells when the mutant had significantly better survival. To test the desiccation resistance of the dps1 mutant, cultures in exponential or stationary growth phase were diluted and filtered onto membranes that were air-dried at a low relative humidity (~ 20 %) for up to 2 days.  Survival was quantified by placing the membranes on agar medium and counting the resulting colonies.  Consistent with the above results, the dps1 mutant was not sensitive to desiccation when stressed at either growth phase (Figures 3.3C and D).  For this stress, however, the cells from stationary phase had greatly improved survival compared to the cells harvested during exponential growth, indicating that resistance mechanisms had been induced as the cultures transitioned into stationary phase.  3.3.4. Insensitivity of dps-null mutant to oxidative stresses The oxidative resistance of the dps-null mutant was not significantly impaired during exponential nor stationary growth phase when challenged with H2O2 (Figures 3.4A and B, respectively).  Even though all the exponential-growth-phase cultures were harvested at similar  53 0204060801001201400 12 24 36 48 60Time (h)024681010 20 30Time (min)BD02468100 6 12 18 24 30Time (h)Survival (%)C02040608010012014010 20 30Time (min)Survival (%)*ASurvival (%)Survival (%) FIGURE 3.3.  Resistance of the dps1 mutant (open symbols) and wild-type RHA1 (closed symbols) to oxidative and desiccative stresses. (A) Survival of exponential-growth-phase cells challenged with 280-mM H2O2.  The data from this experiment were obtained from five mutant and six wild-type cultures.  The asterisk denotes a statistically significant difference between the strains.  (B) Survival of stationary-phase cells challenged with 380-mM H2O2. (C) Survival of exponential-growth-phase cells after air-drying at ~ 20-% relative humidity, on membranes of Whatman filter paper.  The data from this experiment were obtained from three mutant and two wild-type cultures.  (D) Survival of stationary-phase cells after air-drying at ~ 20-% relative humidity. FIGURE 3.3.  Resistance of the dps1 mutant and wild-type RHA1 to oxidative and desiccative stresses  turbidities, one of the wild-type biological replicates survived the stress much better than the other wild-type and mutant replicates, resulting in large standard errors for the wild-type data.  The variability in the oxidative resistance of these cultures at the midpoint of reaching their maximum turbidity suggests that antioxidative mechanisms were already starting to be induced as part of the transition to stationary phase. The above oxidative resistance assays were conducted at the original cell densities of the harvested cultures and required high H2O2 concentrations to kill some of the cells – 280- and 380-mM H2O2 for exponential-growth-phase and stationary-phase cells, respectively.  To make   54 010203040506002040608010012030 min02040608010012030 min 60 min02040608010012030 min 60 minSurvival (%)A B CGrowth inhibition diameter (mm)DH2O2(1.0 μmol)t-Butyl-OOH(4.5 μmol)Cumene-OOH(0.5 μmol)Paraquat(15 μmol)Survival (%)Growth inhibition diameter (mm) FIGURE 3.4.  Oxidative stress resistance of the dps-null mutant and wild-type RHA1 FIGURE 3.4.  Oxidative stress resistance of the dps-null mutant (white bars) and wild-type RHA1 (gray bars).  Survival of (A) exponential-growth-phase cells challenged with 280-mM H2O2 and (B) stationary-phase cells challenged with 380-mM H2O2.  (C) Survival of stationary-phase cells grown in LB medium, diluted to a low cell density (OD600 of ~ 0.21) and challenged with 20-mM H2O2.  (D) Sizes of the zones of growth inhibition caused by disks wetted with oxidative stressors.  sure that the lack of a phenotype for the dps-null mutant to oxidative stress was not due to the strains being tested in a state of high H2O2 resistance, the assay was repeated on stationary-phase cells diluted to a low cell density.  Additionally for this experiment, the cultures were grown in rich medium instead of in minimal medium supplemented with a carbon source of benzoate, which is also a common preservative used in acidic foods (12, 279).  Although 20-mM benzoate (a concentration 3-times higher than that permitted in food) supports robust and relatively fast RHA1 growth, I wanted to eliminate the possibility that the culturing conditions somehow offered cross-protection from H2O2 stress.  Under these altered assay conditions, the strains were sensitive to 20-mM H2O2 but the dps-null mutant was not more so than wild type (Figure 3.4C).   55 Trial experiments indicated that only a reduced cell density, and not a different growth medium, was needed for the observed decrease in H2O2 tolerance. The dps-null mutant was tested for sensitivity to oxidative stressors besides just H2O2 by growth inhibition assays where the applied stressor diffused into solid growth medium from a paper disk.  Other bacterial dps mutants have been found to be sensitive to organic hydroperoxides (128, 166), including the B. pseudomallei dpsA mutant, which is sensitive to t-butyl-OOH but not H2O2.  Wild-type RHA1 and the dps-null mutant were not significantly different in their abilities to grow up in the presence of H2O2 stress (Figure 3.4D), a result consistent with their similar resistances to H2O2 during exponential and stationary growth phases.  The zones of growth inhibition for wild type and the dps-null mutant were also not significantly different in size when the strains were exposed to the organic hydroperoxides of t-butyl-OOH or cumene-OOH (Figure 3.4D).  These hydroperoxide stressors yield hydroxyl radicals when reduced by unsequestered ferrous ions.  Superoxide results in an increase of both Fenton reactants:  H2O2, upon its reduction, and Fe2+, through its destabilization of protein iron–sulfur clusters (146, 164).  Nonetheless, the zones of growth inhibition caused by a superoxide-generating compound, paraquat, were not significantly different in size for the dps-null mutant compared to wild type (Figure 3.4D).  3.3.5. Insensitivity of dps-null mutant to physiological stresses associated with increased oxidative stress Wild-type RHA1 and the dps-null mutant had similar sensitivities to exogenous oxidative stressors.  Since Dps1 and Dps2 from RHA1 are predicted cytosolic proteins, other antioxidative enzymes may have detoxified the applied stressors before they crossed the cell membrane or the cell wall may have acted as an effective shield or impermeable barrier against them.  To account for these possibilities, and to better emulate the stressful conditions that RHA1 would experience in soil, the dps-null mutant was subjected to the physiological stresses of carbon starvation and desiccation, both of which lead to increased intracellular reactive oxygen species.  Results from the aforementioned growth curves and oxidative stress assays had established that survival of the dps-null mutant was not impaired for at least the first few days of stationary phase.  Viable cell counts from dps-null and wild-type cultures aerated (by shaking) for 3 months showed that the mutant withstood the accumulation of oxidative assaults as well as wild type over an extended period of carbon starvation (Figure 3.5A); close to 40 % of the cells from both strains survived,   56 0.00.10.20.30.40.53 moViable cells (109 CFU/ml)02040608010012024 h 48 h 1 wkSurvival (%)BAViable cells (109 CFU/ml)Survival (%) FIGURE 3.5.  Survival of the dps-null mutant (white bars) and wild-type RHA1 (gray bars) to the physiological stresses of (A) long-term carbon starvation in minimal medium and (B) desiccation at ~ 20-% relative humidity. FIGURE 3.5.  Resistance of the dps-null mutant and wild-type RHA1 to the physiological stresses of long-term carbon starvation and desiccation based on an approximate peak cell density for these cultures of 1  109 CFU/ml.  The dps-null mutant also survived up to 1 week of desiccation as well as wild type (Figure 3.5B), with about two thirds of cells growing up after enduring not only desiccation stress but also starvation on the air-dried membranes.  3.3.6. Minor sensitivity of dps-null mutant to iron overload but not other metal stresses All the previous assays had been testing whether RHA1 is protected from oxidative stress by sequestering oxidized iron via the ferroxidase activity of its Dps proteins.  In growth medium with optimal concentrations of trace elements, the dps-null mutant was not at a significant disadvantage compared to wild type during any of the oxidative stresses.  Dps proteins have been shown to improve bacterial resistance to excess metal ions, particularly when cultures are exposed to iron, copper, or zinc during stationary phase or the transition thereto (190, 258).  Hence, stationary-phase cultures of the RHA1 dps-null mutant were treated with each of these three metals to see if RHA1’s Dps proteins play a key role in metal detoxification.  The metals were added to final concentrations of 50 and 500 mM, with the former stress being on par with those leading to reported sensitivities among dps mutants (190, 258).  Monitoring survival for 2 h following metal addition was sufficient as all substantial killing occurred within the first hour.  In general, survival of the dps-null mutant to the iron and copper stresses was modestly lower than that of wild type, but the difference was statistically significant for only the 2-h time point from the 500-mM iron treatment (Figures 3.6A and B).  The dps-null mutant did not differ significantly from wild type in its resistance to zinc stress (Figure 3.6C).  57 0204060801001201 2Time (h)0204060801001201 2Time (h)0204060801001201 2Time (h)Survival (%)BA C*D10010-110-210-310-410-5Wild typedps-null0 mMDilution factorFe2+addedWild typedps-null2 mMWild typedps-null4 mMWild typedps-null6 mMWild typedps-null8 mMSurvival (%)Dilution factor FIGURE 3.6.  Metal stress resistance of the dps-null mutant and wild-type RHA1 FIGURE 3.6.  Metal stress resistance of the dps-null mutant (open symbols) and wild-type RHA1 (closed symbols) in stationary phase to 50-mM (small symbols) or 500-mM (large symbols) (A) FeSO4, (B) CuSO4, or (C) ZnCl2.  The asterisk denotes a statistically significant difference between the strains.  (D) Iron stress resistance of the dps-null mutant and wild-type RHA1 growing up on LB agar medium supplemented with FeSO4.  Results are representative of the technical and biological replicates from three experiments.  To investigate whether the weak sensitivity of the dps-null mutant to iron stress in stationary phase could be exacerbated by growing it up in iron-enriched conditions, serial dilutions of mutant and wild-type cell suspensions of equal turbidity were plated on LB agar supplemented with FeSO4.  Growth of the strains was indistinguishable at each of the iron stresses applied, including 8-mM FeSO4, which inhibited growth entirely (Figure 3.6D).     58 3.3.7. Insensitivity of dps-null mutant to DNA-damaging agents Physical protection of DNA through nonspecific binding is another function that has been acquired by some Dps proteins (109).  Studies of the Dps–DNA interactions in E. coli have further shown that its dps mutant has increased vulnerability to DNA-damaging agents such as the toxic electrophile N-ethylmaleimide (NEM) (82) and ionizing radiation from UV and γ sources (190).  The RHA1 dps-null mutant was not more sensitive to NEM nor MMS, a DNA methylator, compared to wild type when challenged in growth inhibition assays (Figure 3.7A).  Survival of stationary-phase cultures of the dps-null mutant was also not significantly reduced relative to wild type following exposure to germicidal UV light (Figure 3.7B).  0510152025302 minSurvival (%)0102030405060AGrowth inhibition diameter (mm)BNEM(1.5 μmol)MMS(30 μmol)Survival (%)Growth inhibition diameter (mm) FIGURE 3.7.  Resistance of the dps-null mutant and wild-type RHA1 to DNA-damaging agents FIGURE 3.7.  Resistance of the dps-null mutant (white bars) and wild-type RHA1 (gray bars) to DNA-damaging agents.  (A) Sizes of the zones of growth inhibition caused by disks wetted with NEM or MMS.  (B) Survival after UV irradiation.  3.3.8. Direct competition between the dps-null mutant and wild-type RHA1 over multiple cycles of starvation The dps-null mutant did not present a clear phenotypic difference from wild type when the strains were subjected to stressful conditions as separate pure cultures.  For such deletion mutants that do not show a conditional phenotypic difference, direct competition versus their parental strains over multiple generations can often reveal even slight reductions in fitness (253).  Therefore, to investigate if the dps genes impart a selective advantage to wild-type RHA1, mixed cultures of mutant plus wild-type cells, initially inoculated with approximately equal proportions of each strain, were grown to stationary phase and then passaged into fresh medium for a total of  59 nine cycles.  This experimental design tested whether the dps-null mutant could compete with the growth rate of wild type after enduring the oxidative stresses associated with carbon starvation.  The relative abundance of the strains in the stationary-phase mixed cultures was determined by quantitative PCR using probe sets specific for each strain.  After nine cycles of starvation – and ~ 60 generations, since each mixed culture was inoculated at 1 % (vol/vol) – the proportion of the dps-null mutant in the cultures was not significantly different from that in the initial mixtures (Figure 3.8).  The dps-null mutant survived and propagated at least as well as wild type under the competitive scenario examined here, since its proportions after the third and fifth passages had actually significantly increased compared to the initial mixtures.  0.00.10.20.30.40.50.60.70.80.91.0Initial mix P1 P2 P3 P4 P5 P6 P7 P8 P9Culture proportion  d**Initial mixturesCulture proportion  d FIGURE 3.8.  Culture proportions of the dps-null mutant (white bars) and wild-type RHA1 (gray bars) strains in the initial mixtures through nine passages (P1–P9) of stationary phase.  The asterisks denote a statistically significant difference in the strain proportions compared to the initial mix (P < 0.05 from a two-tailed, paired Student’s t test). FIGURE 3.8.  Culture proportions of the dps-null mutant and wild-type RHA1 strains in the initial mixtures through nine passages of stationary phase  3.4. Discussion  3.4.1. Bacterial dps mutants are sensitive to oxidative stress, except for those of the Actinobacteria Mutants from 23 bacterial species have been described in the literature for which at least one dps gene has been knocked out (2, 8, 31, 48, 51, 55, 58, 73, 80, 82, 91, 96, 112, 128, 134, 137, 147, 152, 160, 161, 166, 169, 190, 195, 199, 201, 216, 230, 234, 254, 255, 258, 259, 262, 283, 287, 289–292, 298).  The Dps proteins from several archaeal species have been isolated (118, 219, 220, 277, 295) but as yet no dps mutants have been characterized from this domain.   60 Every published study of a dps mutant uncovered at least one condition in which the mutant’s phenotype differs significantly from that of the respective wild-type strain.  For all but two of those species – M. smegmatis and S. coelicolor being the exceptions – a dps mutant was shown to have inferior resistance to some form of oxidative stress, usually to H2O2; furthermore, although several of these species have two dps homologs in their genomes, such as B. subtilis (8, 48), D. radiodurans (195, 289), and Edwardsiella tarda (298), construction of the dps-null mutant was not necessary because every assayed single dps mutant was sensitive to oxidative stress.  With regard to B. subtilis, both single mutants of its dps homologs fail to develop resistance to oxidative stress during starvation conditions (8, 48).  The differing regulation of the B. subtilis dps homologs may explain why they do not complement each other’s mutant phenotype:  one homolog responds to general stresses, as part of the σB regulon (8), and the other responds to metal ion limitation and to oxidative challenge from H2O2 (48).  Our research group’s transcriptomic experiments on RHA1 under various physiological stresses have shown that dps1 and dps2 are also regulated differently but that their expression is not mutually exclusive (unpublished data).  Both of RHA1’s dps homologs are up-regulated during osmotic (74) and desiccative stresses, although in each case dps1 is the dominant response.  Nevertheless, the single dps1 mutant of RHA1 survives oxidative stress from H2O2 and desiccation at least as well as the wild type. The RHA1 dps-null mutant was challenged with every relevant type of stress to which another bacterial dps mutant is reported to be sensitive.  This approach tested whether the dps-null mutant was deficient in any of the known functions of Dps proteins:  ferroxidase activity was assayed in response to a comprehensive set of chemical and physiological oxidative stresses; metal binding and storage was assayed in response to iron, copper, and zinc toxicity; and physical protection of DNA was assayed in response to DNA-damaging agents.  The dps-null mutant’s insensitivity to the more targeted genomic attacks is not surprising because had either of the RHA1 Dps proteins been important contributors to the compaction and physical shielding of DNA during prior phenotypic tests, I would have already found the mutant to have had increased susceptibility to oxidative radicals.  Survival of the RHA1 dps-null mutant was not significantly lower than that of wild type to any of the stresses, regardless of the growth phase at which they were applied, with the exception of extreme iron overload.  After two hours in 500-mM iron – a treatment of questionable environmental relevance – 16-% fewer dps-null mutant cells survived relative to wild type.  In contrast, the dps mutants of E. coli and Streptococcus  61 pyogenes are at least 10-fold more sensitive to metal toxicity compared to their parental strains at metal concentrations roughly 10-fold less than those endured by the RHA1 dps-null mutant (190, 258).  Thus, while the advantage provided by the RHA1 dps homologs was relatively weak, the test statistic for this severe iron stress surpassed the significance threshold, when considered in isolation. The statistical problem of multiple testing in this study must be taken into account though.  A total of 46 t tests were performed comparing either the dps1 or dps-null mutant to wild type in search of a conditional phenotype for these mutants.  At the α value of 0.05, a minimum of two of these statistical tests would be expected to conclude falsely that the mutant and wild-type strains had significantly different stress resistances under the conditions assayed.  In actuality, four of the t tests yielded significant P values, although none were highly significant (i.e., P < 0.01), and in three of these “significant results” the mutant had better stress resistance than wild-type RHA1.  Alternatively, the 46 phenotypic tests could have been grouped according to experimental relatedness and then separately analyzed using a multiple-comparison procedure such as Holm’s t test (93).  If the experiments were divided into 16 groups, as delineated in Figures 3.3–3.8 (excluding 3.6D), only one experiment would have yielded a significant difference between the strains – specifically, the improved survival of the dps1 mutant after 30 min of H2O2 stress during exponential growth phase.  But this result would still be questionable because of multiple testing, having a true error rate of finding a false positive of not 5 % but ~ 80 %, due to the 16 groupings (93).  Overall, the resounding conclusion is that deletion of the dps genes does not adversely affect the ability of RHA1 to cope with a multitude of environmental stresses to the degree that dps mutants from six of seven bacterial phyla are affected. All available evidence about dps mutants from the Actinobacteria phylum suggests that these genes do not confer a selective advantage in these species under standard oxidative stress assays.  More precisely, only actinomycete dps mutants have been investigated thus far, which, in addition to those of the present study, includes three single and three double dps mutants, but not a dps-null triple mutant, of S. coelicolor (80) and one of two potential single dps mutants of M. smegmatis (91).  Facey and coworkers (80) found that none of the S. coelicolor dps mutants have increased sensitivity to oxidative stress from H2O2.  They did observe, however, that the mutant strains have irregular nucleoid compaction during the sporulation stage of their developmental cycle, although this phenotypic difference did not translate into a demonstrable survival deficiency.  Since RHA1 cells do not sporulate like those of streptomycetes, I did not  62 directly look at the nucleoid structures of the RHA1 dps mutants.  The closest analog in rhodococcal cells to the prespore compartments that arise from apical syncytia in streptomycetes might be the cocci that form during nutrient starvation.  Cell length measurements during exponential and stationary growth phases indicated that the RHA1 dps-null mutant underwent reductive cell division to the same extent as the wild type.  Also, the dps-null mutant competed at least as well as the wild type over multiple cycles of reductive division and proliferation, suggesting that the inherited copies of genomic DNA were partitioned appropriately into daughter cells in an undamaged, functional state.  As with S. coelicolor, the M. smegmatis dps2 mutant has altered nucleoid morphology compared to that of the wild-type strain (91).  No conditions were reported in which the dps2 mutant has compromised fitness though.  Given that the Dps proteins from M. smegmatis have been studied for over a decade (104), the absence of well-characterized mutants for these proteins may be telling.  The RHA1 dps-null mutant described here is the first complete dps mutant shown to not have impaired oxidative resistance, a characteristic that appears to be representative of the Actinomycetales taxonomic order.  3.4.2. Excellent stress resistance of wild-type RHA1 The purpose of challenging wild-type RHA1 with various stresses was to find the benchmark resistance to which the dps mutants would be compared.  Not only did I find little phenotypic difference between the dps mutants and wild type, I also noticed for certain treatments that the severity required to reduce survival of wild-type RHA1 was substantially greater than that needed for the parental strains of many other bacterial dps mutants.  As previously discussed, RHA1 had superior resistance to metal toxicity and to desiccation, including the concomitant starvation stress.  RHA1 did not exhibit extraordinary resistance to all external perturbations however.  In particular, RHA1 had average resistance to chemical oxidants, with inhibitory concentrations that were in the same order of magnitude as those needed for various proteobacterial species (128, 134, 166).  The stresses for which RHA1 is well adapted are presumably like those it would have encountered in its original, contaminated soil habitat.  The relative hardiness of RHA1 cells stressed during different phases of growth showed that these special resistance mechanisms were not an innate feature of its thick cell wall but rather were employed upon entrance into stationary phase.  For instance, I observed that growing RHA1 cells could not tolerate 8 mM of metal ions whereas a substantial proportion of stationary-phase cells survived concentrations over 60-times higher.  Likewise, the desiccation resistance of  63 cells stressed during exponential growth plummeted compared to their stationary-phase counterparts.  Of course much of the improved resistance of RHA1 cells as they transformed from a state of growth to one of persistence can likely be attributed to shoring up of their cell walls to form more isolated bodies, through modifications including reductive cell division.  3.4.3. Potential contributions of RHA1’s dps homologs to its oxidative stress resistance The body of work presented here leads me to conclude that the dps genes of RHA1 are nonessential for it to survive oxidative stresses.  Save for the actinobacterial species most closely related to RHA1, all other bacteria studied so far require Dps proteins for their full resistance to varied sources of reactive oxygen species.  Given that RHA1 has robust stress resistance, I propose that the numerous antioxidant mechanisms encoded in its large genome are responsible for the lack of a conditional phenotype of the dps-null mutant.  Besides its two dps homologs, the RHA1 genome encodes two superoxide dismutases, eight catalases, nine peroxidases, two ferritins, and one bacterioferritin.  Like RHA1, S. coelicolor and M. smegmatis are nonpathogenic, environmentally derived bacteria (16, 143) with large genomes, of ≥ 7 Mbp (NCBI Genome database [www.ncbi.nlm.nih.gov/genome/browse]).  The conservation of multiple dps homologs in each of these soil-residing actinomycetes indicates that these genes do provide a selective advantage, albeit not readily apparent. One possibility is that the RHA1 dps genes contributed to just a minor fitness advantage under the assayed oxidative stresses, as one part of a large repertoire of antioxidant mechanisms.  Since most of the phenotypic tests I conducted used only three biological replicates, they were not designed to detect small survival deficiencies between the mutant and wild-type strains.  Perhaps the limited statistical power of these assays is the reason that I was unable to conclude with confidence that the dps-null mutant had impaired stress resistance, as already discussed.  Interestingly, the stresses for which the mean survival of the dps-null mutant was lower than that of wild type – although generally not significantly lower – were the same stresses to which wild type had the most impressive resistance, namely the physiological stresses of long-term starvation and desiccation (Figure 3.5) as well as the metal toxicities of iron and copper (Figures 3.6A and B).  To address the hypothesis that the dps genes may provide a “marginal benefit” to RHA1, the dps-null mutant and wild type were cocultured to see if one strain had a competitive edge over the other.  Following the relative proportions of mutant and wild-type strains over ~ 60 generations should have enabled detection of a decrease in fitness as small as ~ 5 %, based on  64 the results of similar competition experiments conducted on yeast mutants (253).  With respect to dps mutants, only the E. coli mutant has been pitted against its parental strain (190).  The E. coli dps mutant did not have a growth defect when cultured separately from wild type, but when cultured together the number of mutant cells fell below the level of detection after a single foray into stationary phase.  In contrast, the RHA1 dps-null mutant displayed no survival deficiency relative to wild type after nine rounds of carbon starvation (Figure 3.8). Another possible explanation for the observed absence of phenotypic differences between the dps− mutants and wild-type RHA1 could simply be that these strains were not challenged under conditions in which Dps proteins are essential for this bacterium’s survival.  Most of the stress assays conducted on the RHA1 dps− mutants were selected from those known to reveal sensitivities of other bacterial dps− mutants.  Thus, while the sum of negative results for the RHA1 dps− mutants is unique and noteworthy on its own, proving an absolute lack of distinguishing phenotypes for these mutants is clearly unfeasible.   65 Chapter 4:  Conserved Ferroxidase Activity of RHA1 Dps1  4.1. Rationale The RHA1 dps mutants did not display survival deficiencies in comparison to the wild type, consistent with published findings from other actinomycete dps mutants.  One assumption underlying the interpretation of these data is that the RHA1 dps genes encode functional proteins despite the lack of any veritable impairment of the deletion mutants.  Retention of the core Dps protein family functions by the RHA1 Dps homologs is supported by their high sequence similarities to the biochemically characterized Dps orthologs of M. smegmatis:  alignments of the Dps1 protein sequences from RHA1 and M. smegmatis are 72-% identical and, likewise, alignments of the Dps2 proteins are 38-% identical (BLASTP 2.2.26+ online tool from the NCBI website [blast.ncbi.nlm.nih.gov/Blast.cgi]).  Experiments on the M. smegmatis Dps proteins have shown that Dps1 has ferroxidase and iron-binding abilities (102), while Dps2 is predicted to have those functions (226), and that both Dps1 and Dps2 bind DNA (42, 102, 226).  We decided to express and purify the RHA1 Dps proteins and then elucidate their functionalities with respect to alleviating oxidative stress and protecting DNA, in part to discount the possibility that either or both of these genes have undergone enough decay to render them pseudogenes.  4.2. Materials and methods  4.2.1. Multiple alignment of Dps protein sequences ClustalW2 (version 2.0.12), an online tool from the European Bioinformatics Institute (www.ebi.ac.uk/Tools/msa/clustalw2), was used to align multiple Dps protein sequences.  The initial multiple alignment was performed with only the proteins that contained all of the conserved ferroxidase center residues identified by Roy et al. (226).  The five Dps homologs that did not satisfy this criterion were added individually to the group of conserved Dps proteins for realignment and then positioned in the final multiple alignment accordingly.  4.2.2. General molecular biological methods The basic cloning techniques employed are described in subsection 3.2.2.  DNA sequencing reactions were performed using the BigDye Terminator Cycle Sequencing Kit (version 3.1; Applied Biosystems), generally according to the manufacturer’s instructions except  66 that each 10-μl reaction contained 5.0 pmol of the sequencing primer; also, betaine was added as a cosolvent to a concentration of 1 M for certain DNA templates from RHA1.  The purified sequencing products were analyzed by the Nucleic Acid Protein Service Unit at the University of British Columbia. Fundamental protein methods were performed following standard guidelines (229), such as those for SDS polyacrylamide gel electrophoresis (PAGE) with Coomassie Brilliant Blue R-250 staining.  For nondenaturing PAGE, SDS was simply omitted from the gels and buffers.  The acrylamide component of the polyacrylamide gels consisted of 30-% acrylamide and 0.8-% N,N′-methylenebisacrylamide.  Protein preparations were quantified using a modified protocol of the bicinchoninic acid protein assay (241).  Micro BCA Reagents A and B (Thermo Scientific) were mixed with 4-% cupric sulfate pentahydrate in proportions of 101:97:2, respectively, as the working reagent.  To each 50-μl protein sample or standard, 1 ml of working reagent was added.  The reactions were allowed to develop in a 55-°C water bath for 1 h and then cooled to room temperature before their absorbances at 562 nm were measured.  For all protein assays, bovine serum albumin (BSA) served as the standard or control.  4.2.3. Heterologous expression of RHA1 dps homologs Complementation plasmids were constructed to express each of the RHA1 dps homologs in an E. coli dps mutant.  For this purpose, three E. coli strains were kindly provided by the laboratory of Roberto Kolter:  ZK1058, the dps mutant (190); ZK126, the parental wild type (57); and ZK1110, ZK126 harboring pJE106, a pBR322-derived complementation plasmid carrying the E. coli dps gene (180, 274).  The upstream regulatory region of dps from E. coli and the dps1 and dps2 CDSs from RHA1 were amplified from templates of the plasmid pJE106 and the RHA1 fosmids RF00111N05 and RF00120D15, respectively, using a high-fidelity, thermostable DNA polymerase and primers listed in Table 4.1.  The PCR products were sequenced to ensure their accuracy.  They were then appropriately digested and ligated into the 2,965-bp HindIII–AvaI fragment of the pBR322 cloning vector, each provided at a high insert-to-vector molar ratio of between 4 and 6.  The total DNA concentrations of the ligation reactions ranged between 8 and 14 ng/μl in volumes of 10–15 μl.  The finished complementation plasmids were designed to mimic the E. coli dps gene:  only two nucleotides of the regulatory region were changed, in creating an AseI restriction site immediately before the start codons of the RHA1 dps   67 TABLE 4.1.  PCR primer sequences used in the creation of plasmids for the expression of the RHA1 dps homologs  Primer Sequencea (5′–3′) Restriction site    For complementation plasmids:      E. coli dps regulatory region   Sense CGCATTAATTCATATCCTCTTGATGTTATGTCC AseI Antisense CGTCCCGAGTAACCATGCAGAATTTCTCGC AvaI RHA1 dps1 CDS   Sense CGGAAGCTTACCTTTCGTTGTGGACGGGAGATC HindIII Antisense CGGATTAATGTCGAAGTTCACCGTGCCAGG AseI RHA1 dps2 CDS   Sense CGGAAGCTTGCCTCCTCTTTTGCTCACCGTCTG HindIII Antisense CGGATTAATGACCCCTACCCCCATCACCAC AseI    For control plasmid:      E. coli dps regulatory region   Sense CGGAAGCTTTAATTCATATCCTCTTGATGTTATGTCC HindIII Antisense CGTCCCGAGTAACCATGCAGAATTTCTCGC AvaI    For expression plasmids:      RHA1 dps1 CDS   Sense GGAATTCCATATGTCGAAGTTCACCGTGCCAGG NdeI Antisense CCCAAGCTTACCTTTCGTTGTGGACGGGAGATC HindIII RHA1 dps2 CDS   Sense CGGAATTCCATGACCCCTACCCCCATCACCAC EcoRI Antisense CCCAAGCTTGCCTCCTCTTTTGCTCACCGTCTG HindIII     a Restriction sites in the primers are underlined.  CDSs, while the spacing and A+T richness of this region were preserved as in the native E. coli dps gene. The E. coli dps mutant was transformed with either of the complementation plasmids or the control plasmid and grown on agar medium supplemented with kanamycin (25 μg/ml) and ampicillin (50 μg/ml) to select for the mutant and plasmids, respectively.  Growth inhibition assays were performed on these strains by the method described in subsection 3.2.7.  4.2.4. Purification of RHA1 Dps proteins The dps1 and dps2 CDSs from RHA1 were cloned in plasmids pET-28a(+) and pET-47b(+) (Novagen), respectively, using PCR products obtained with primers listed in Table 4.1.  These expression plasmids were transformed separately into the E. coli Rosetta(DE3) strain (Novagen).  For overexpression of the recombinant Dps1 protein, 900 ml of LB medium containing kanamycin (30 μg/ml) and chloramphenicol (34 μg/ml) were inoculated at 1 % (vol/vol) with a preculture, grown overnight, and incubated at 37 °C with shaking at 200 rpm.  When the culture reached an OD600 of 0.6, protein expression was induced with 0.15-mM  68 isopropyl-β-D-1-thiogalactopyranoside followed by incubation overnight at 30 °C with shaking.  The cells were pelleted at 18,500 g for 20 min and then resuspended in 15 ml of a buffer composed of 5-mM imidazole, 20-mM 3-(N-morpholino)propanesulfonic acid (MOPS) (pH 7.0), and 0.5-M NaCl.  The cells underwent treatment with lysozyme (150 μg/ml) for 10 min on ice followed by mechanical disruption using a Microson XL2007 ultrasonic processor (Misonix, Inc.) set at an intensity of 4 for ten rounds of 10 s interspersed by 1-min breaks on ice.  Cell debris was removed by centrifugation at 13,000 g for 30 min at 4 °C and then filtration of the supernatant through a 0.22-μm mixed cellulose esters syringe filter.  The filtered supernatant was loaded onto a 1-ml His GraviTrap immobilized-Ni2+ affinity chromatography column (GE Healthcare), which had been equilibrated with 5 column volumes of the aforementioned MOPS-based buffer.  The column was washed with 10 volumes of this buffer and then 5 volumes of the same buffer except with an increased imidazole concentration of 60 mM.  Proteins were eluted from the column using 1 volume of buffer for each of five rising imidazole concentrations from 0.2 to 1 M.  The eluted fractions from buffers with 0.2- and 1-M imidazole yielded the purest recombinant Dps1, as determined by SDS PAGE.  These two fractions were pooled and then dialyzed overnight, in tubing with a 15-kDa threshold (Spectrum Laboratories, Inc.), at 4 °C in 4 liters of buffer composed of 20-mM MOPS (pH 7.0) and 50-mM NaCl.  During dialysis, human α-thrombin (Haematological Technologies Inc.) was provided at a molar ratio of 1 for every 200 recombinant Dps1 monomers.  Three residues (specifically, GSH) were left on Dps1 as an N-terminal scar after cleavage of its hexahistidine tag.  Lastly, α-thrombin was removed from the Dps1 protein preparation using Benzamidine Sepharose 6B resin (GE Healthcare).  Analysis of the protein band intensities of SDS polyacrylamide gels using AlphaEaseFC software (version 3.2.1; Alpha Innotech Corporation) indicated that the Dps1 preparation was 96-% pure.  The purified Dps1 preparation was concentrated using an Amicon Ultra centrifugal filter (30-kDa threshold; Millipore).  For enzymatic assays, the Dps1 preparation retained its activity when used either directly or thawed from storage at −80 °C, having been flash-frozen in liquid nitrogen.  To acquire iron-free Dps1 (apo-Dps1), the protein solution was dialyzed overnight at 4 °C in 500 volumes of a buffer composed of 20-mM MOPS (pH 7.0), 50-mM NaCl, 1-mM 3-(2-pyridyl)-5,6-bis(2-[5-furyl sulfonic acid])-1,2,4-triazine disodium salt (Ferene S; Sigma-Aldrich), and 0.3-% sodium dithionite; dialysis was then repeated in the same buffer lacking the latter two ingredients.  69 Attempts to overexpress recombinant Dps2 in E. coli BL21(DE3) (Stratagene) and Rosetta(DE3) strains yielded insoluble protein.  4.2.5. Dynamic light scattering Dynamic light scattering data of purified Dps1 solutions were collected at 22 °C using a DynaPro Plate Reader and Dynamics version 7.0.0 software (Wyatt Technology Corporation).  The results from three replicates per sample were analyzed by the regularization method.  The average particle size of the Dps1 preparations was stable in buffers composed of 20-mM MOPS (pH 7.0) with salt concentrations of 50- or 150-mM NaCl.  4.2.6. Functional characterization of RHA1 Dps1 The assays on purified Dps1 preparations whose results are presented here were conducted in a buffer of 50-mM MOPS (pH 7.0) and 50-mM NaCl.  Proteins were given a few minutes to interact after every addition of iron or H2O2 to the reactions.  Iron solutions were deoxygenated by purging with nitrogen gas.  4.2.6.1.  Staining for iron-binding proteins run by nondenaturing PAGE In order to test if Dps1 binds iron, 10-μM apo-Dps1 was allowed to interact with five iterative additions of 240-μM (deoxygenated) ammonium ferrous sulfate followed by 120-μM H2O2.  Glycerol was added to the completed reactions to a concentration of 10 %, to aid loading of the polyacrylamide gel.  After resolution by nondenaturing PAGE, the entire polyacrylamide gel – with the 5-% stacking gel still attached to the 6-% separating gel – was stained for iron with potassium ferricyanide, as described previously (159).  This method stained iron-binding proteins specifically, unlike staining with Ferene S (159), which led to results similar to protein staining with Coomassie.  The gel was imaged with a digital scanner before and after protein staining.  4.2.6.2.  Ferroxidase activity assay Iron oxidation by Dps1 was measured from changes in the reaction’s absorbance at a λ of 305 nm (A305) using a Cary 5000 spectrophotometer and Cary WinUV Kinetics version 3.00 software (Varian).  Once the solution of 1-μM Dps1 had equilibrated at 25 °C in a quartz cuvette (with a light path of 1 cm), its absorbance was zeroed.  The cuvette was briefly removed from the  70 instrument to add the reactants of 24-μM (deoxygenated) ammonium ferrous sulfate and, later, 12-μM H2O2.  4.3. Results  4.3.1. Functional predictions for the RHA1 Dps proteins from multiple sequence alignment Multiple sequence alignment of the Dps proteins with solved structures has led to the identification of a conserved set of residues that form the ferroxidase sites of this enzyme (226).  The consensus sequence, of L(X)17HW(X)3G(X)6H(X)14D(X)3ER(X)59–61D(X)18W/H, published by Roy et al. (226) and called the “Dps signature motif”, spans about three quarters of the total primary structure of a typical Dps protein, leaving just the N- and C-terminal tails of variable lengths.  Also, recently, the functions of many studied Dps proteins have been summarized (109).  In that review, Haikarainen and Papageorgiou catalogued whether or not each Dps protein has ferroxidase and DNA-binding activities, the main functions of this protein family (109). In Table 4.2, the functional and sequence information of studied Dps proteins were combined in order to help predict what activities the RHA1 Dps proteins possess.  Of the 21 Dps proteins assayed for ferroxidase activity, 18 were found to have it.  Every bacterial Dps protein with this activity also retained the conserved ferroxidase center residues; conversely, the only three found not to have ferroxidase activity did not conform to the consensus sequence.  The lack of ferroxidase activity by the Dps homologs from Lactococcus lactis is not surprising since their protein sequences have deviated greatly from the consensus.  In the case of B. burgdorferi Dps, one substitution of the conserved glycine residue to an anionic aspartate residue appears to have been enough to abolish its ferroxidase activity.  Since the sequences of the RHA1 Dps1 and Dps2 proteins conform exactly with the Dps signature motif, I hypothesized with confidence that they would show ferroxidase activity as well. According to the multiple alignment in Table 4.2, the C-terminal end of the consensus sequence for bacterial Dps ferroxidase centers should be corrected slightly to L(X)17HW(X)3G (X)6H(X)14D(X)3ER(X)57–61D(X)18W (modifications are underlined).  The two Dps proteins from archaeal species, Sulfolobus solfataricus and Pyrococcus furiosus, displayed ferroxidase activity (219, 277) even though they retained just five of the ten conserved bacterial Dps residues.     71 TABLE 4.2.  Functions and sequence characteristics of Dps proteins  Known functionsb d Protein sequence attributes Dps homologa Ferroxidase activity DNA binding Reference dd N-terminusc Dps signature motifd C-terminusc         R. jostii Dps1        M. smegmatis Dps1 Yes Yes 109     S. coelicolor DpsA  Yes 80     E. coli Dps Yes Yes 109     S. enterica Dps Yes  109     A. tumefaciens Dps Yes No 109     R. jostii Dps2        S. coelicolor DpsB  Yes 80     M. smegmatis Dps2  Yes 226     B. anthracis Dlp1 Yes No 109     B. anthracis Dlp2 Yes No 109     B. brevis Dps Yes Yes 109     S. mutans Dpr Yes No 109     S. pyogenes Dpr Yes No 109     S. suis Dpr Yes No 109     L. innocua Dps Yes No 109     C. jejuni Dps Yes No 109     H. pylori NapA Yes Yes 109     P. gingivalis Dps Yes  109     B. burgdorferi Dps No  109     D. radiodurans Dps2 Yes Yes 289     D. radiodurans Dps1 Yes Yes 109     S. coelicolor DpsC  Yes 80     S. solfataricus Dps Yes  109     P. furiosus Dps Yes  109     L. lactis DpsA No Yes 109     L. lactis DpsB No Yes 109             L (X)17HW (X)3G (X)6H (X)3ER (X)57D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)57D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)59D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)60D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)59D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)59D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)59D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)59D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)59D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)61D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)61D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)61D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)61D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)60D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)60D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)59D (X)18W(X)14DL (X)17HW (X)3D (X)6H (X)3ER (X)61D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)60D (X)18W(X)14DL (X)17RM (X)3G (X)6K (X)3(X)61D (X)19W(X)14E RQL (X)17RN (X)3G (X)6K (X)3(X)60D (X)19W(X)14E RPL (X)17GL (X)3S (X)4– (X)3(X)62K (X)18P(X)14Y QEL (X)17GI (X)3S (X)3C (X)3(X)62K (X)18R(X)14F DLL (X)17HW (X)3G (X)6H (X)3ER (X)59D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)59D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)59D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)59D (X)18W(X)14DL (X)17HW (X)3G (X)6H (X)3ER (X)60D (X)19W(X)14D+++++++++++++++++++++++++++ +++ +++++++++++++++++ +++++++++++++++++++++++++++++ +++++++++ a The order of the Dps homologs is preserved from the multiple sequence alignment obtained using ClustalW2. b A blank indicates that the function of the Dps homolog was unknown prior to the present study. c The relative lengths of the N- and C-terminal tails of each protein are depicted.  The approximate positions of positively charged residues (lysine and arginine) therein are marked with + symbols. d Shaded residues correspond to the conserved ferroxidase center identified by Roy et al. (226).  X represents any nonconserved residue. 72 However, three or four of the substitutions were conservative, which may explain why these distant archaeal and bacterial Dps homologs still have the same function. Unlike ferroxidase activity, DNA binding cannot be easily predicted from the primary structure of Dps proteins.  Of the 20 Dps proteins tested for interactions with DNA, 12 of them bound DNA in vitro or contributed to the condensation of the cell’s nucleoid (Table 4.2).  For those Dps molecules that do bind DNA, this ability does not consistently correlate with specific protein sequence attributes.  For some, positively charged residues in the protein tails interact with the DNA backbone:  the N-terminal tails of E. coli Dps (39) and D. radiodurans Dps1 (18) and both tails of M. smegmatis Dps1 (227) are essential for DNA binding, as truncated forms of these proteins lose this ability.  Based on its crystal structure, the DNA binding of M. smegmatis Dps2 has been attributed to two arginine residues in its N terminus, which is positioned on the dodecamer surface (226).  However, the Dps homologs from Streptococcus suis and Agrobacterium tumefaciens do not bind DNA even though the N-terminal tail of each of these proteins has multiple positive charges and is at least as long as that of M. smegmatis Dps1 or Dps2 (Table 4.2).  With regard to the N terminus of A. tumefaciens Dps, its electrostatic interactions with acidic residues on the dodecamer surface preclude potential interactions with the DNA backbone (41).  The unpredictability of what Dps molecules will bind DNA continues with the case of DpsA from L. lactis, which, as for others, requires its N terminus for DNA binding, but substitution of the terminal lysine residues to glutamate does not affect this activity (244).  DNA binding by L. lactis DpsA, thus, does not involve these positively charged terminal residues, but rather is suggested to involve divalent cations to bridge the interactions within the DpsA–DNA complexes (244).  Further, the Dps homolog from Helicobacter pylori, NapA (58, 294), binds DNA despite its lack of an N- or C-terminal tail extending beyond the bundle of four α-helices that make up the protein’s monomer (Table 4.2).  Instead of positively charged termini forming bonds with the DNA backbone, other basic residues exposed at the surface of the H. pylori NapA dodecamer serve this same role (43).   Both Dps1 and Dps2 from RHA1 have extended terminal tails carrying net-positive charges, resembling their closest homologs, from M. smegmatis and S. coelicolor, all of which are known to bind DNA (Table 4.2).  Though as evidenced above, other structural features of Dps dodecamers can impede the interactions between the DNA backbone and these long, positively charged termini, and DNA binding can also occur via different mechanisms altogether.   73 For these reasons, I cautiously hypothesized that RHA1 Dps1 and Dps2 would be able to bind and condense DNA.  4.3.2. Heterologous expression of RHA1 Dps1 restored the oxidative stress resistance of an E. coli dps mutant Complementation plasmids were constructed to test whether expression of either of the RHA1 dps homologs could rescue an E. coli dps mutant from its sensitivity to oxidative stress.  The plasmids were modelled after the one used for the original complementation of the E. coli dps mutant (2), except, of course, that an RHA1 dps CDS would be expressed instead of the E. coli dps CDS.  The constructs consisted of a 273-bp upstream regulatory region from the E. coli dps gene ligated in front of an RHA1 dps CDS, and cloned into the pBR322 vector.  A control plasmid for this complementation experiment was also created, made up of just the E. coli dps regulatory region within pBR322.  Using these complementation plasmids, expression of the RHA1 dps CDSs in the E. coli dps mutant should be regulated like that of the native E. coli dps gene. The relative sensitivities to oxidative stress of the complementation strains for the E. coli dps mutant were determined by observing growth inhibition on LB agar plates around disks of filter paper wetted with 1.5 μmol of H2O2 (Figure 4.1).  Wild-type E. coli grew right to the edge of the disk, although its growth was somewhat less dense than on the surrounding lawn, while the E. coli dps mutant had a clear zone of growth inhibition.  The E. coli dps mutant expressing RHA1 dps1 was protected from H2O2 toxicity to the same degree as wild-type E. coli.  The control plasmid for the complementation experiment did not improve the H2O2 resistance of the   E. coli dps+ RHA1 dps1 complementation plasmidE. coli dps+ RHA1 dps2complementation plasmidE. coli E. coli dpsE. coli dps+ control plasmid FIGURE 4.1.  H2O2 resistance of the E. coli dps mutant containing plasmids for expression of the RHA1 dps homologs FIGURE 4.1.  H2O2 resistance of the E. coli dps mutant containing plasmids for expression of the RHA1 dps homologs.  Growth of the E. coli strains on LB agar plates was challenged with 1.5 μmol of H2O2, applied to the paper disks.  The zones of growth inhibition are representative of those obtained from three replicate experiments.  74 E. coli dps mutant, as expected.  The E. coli dps mutant containing the complementation plasmid for RHA1 dps2 remained sensitive to H2O2, and on average had a larger zone of growth inhibition (14.6 ± 0.4 mm [mean diameter ± standard error]) than the mutant itself (12.9 ± 0.3 mm) or the mutant containing the control plasmid (13.4 ± 0.2 mm).  The extra metabolic load and, perhaps, the formation of inclusion bodies from producing nonfunctional, insoluble RHA1 Dps2 are the likely explanations for the apparent deleterious effect of this complementation plasmid to the fitness of the E. coli dps mutant.  During attempts to purify the RHA1 Dps proteins through overexpression in E. coli, only Dps1 partitioned into the soluble cellular fraction.  RHA1 Dps2 was repeatedly found to be insoluble in E. coli expression hosts (BL21[DE3] and Rosetta[DE3] strains), suggesting that the inability of RHA1 dps2 to complement the E. coli dps mutant does not indicate that this protein is defective when properly assembled. The finding that RHA1 dps1 rescued the E. coli dps mutant from H2O2 toxicity proves that Dps1 can protect cells from oxidative stress.  I cannot, however, make any new conclusions about the functionality of Dps2.  Although the protection from oxidative stress afforded by Dps proteins can almost always be attributed to their ferroxidase activity, the Dps proteins from L. lactis can maintain DNA integrity in the presence of reaction oxygen species solely through the physical shielding of their DNA binding (244).  In order to resolve how RHA1 Dps1 contributes to cellular resistance from oxidative stress, we purified this protein and tested it for iron-binding, ferroxidase, and DNA-binding activities.  4.3.3. Iron-binding and ferroxidase activities of RHA1 Dps1 For the purpose of testing whether RHA1 Dps1 binds iron, apo-Dps1 was prepared by reducing any ferric ions already bound within native Dps1 with sodium dithionite (0.3 %) and chelating the ferrous ions with Ferene S (1 mM).  The oligomeric states of the native and apo-Dps1 preparations were analyzed using dynamic light scattering.  Both protein preparations contained Dps1 molecules of a single oligomeric form, as deduced from the polydispersity values of < 20 %.  For both, the average particle radius was 5 nm, a size typical of Dps dodecamers (288). Apo-Dps1 was loaded with iron through five sequential additions of 24 Fe2+ per dodecamer, each followed by a half-molar equivalent of H2O2.  The reaction mixtures were then run on a nondenaturing polyacrylamide gel (Figure 4.2).  The Coomassie-stained gel shows that   75 Dps1 Dps1A BBSA +        +BSA +        +Fe2+& H2O2: FIGURE 4.2.  Nondenaturing PAGE of apo- and iron-bound RHA1 Dps1, stained for proteins and iron FIGURE 4.2.  Nondenaturing PAGE of apo- and iron-bound RHA1 Dps1.  Dps1 (15 μg per lane) reacted with a total of 120 Fe2+ ions per Dps1 dodecamer and a half-molar equivalent of H2O2, over five stepwise additions.  The gel was stained with (A) Coomassie, for proteins, and (B) potassium ferricyanide, for iron.  BSA, under identical reaction conditions, served as the negative control.  The gel images are representative of the results from two experiments.  apo-Dps1 ran as two doublet bands, corresponding to higher and lower oligomeric forms (Figure 4.2A).  The control protein of BSA (molecular mass of 66 kDa) had similar electrophoretic mobility as the lower doublet band of apo-Dps1 (19 kDa), likely in its trimeric or dimeric form.  The majority of the apo-Dps1 remained in the higher oligomeric form, which presumably corresponds to the same dodecameric assemblies detected by the dynamic light scattering analysis.  Perhaps the change in buffer properties – from 20-mM MOPS (pH 7.0), 150-mM NaCl buffer during dynamic light scattering to 25-mM Tris (pH ~ 8.3), 192-mM glycine buffer in the electrophoresis reservoir – caused the observed partial dissociation of the Dps1 dodecamers.  Further, the doublet protein band of each RHA1 apo-Dps1 oligomer may be due to instability of the monomer’s C-terminal tail since the M. smegmatis Dps1 ortholog spontaneously loses the final 16 residues of its C terminus in vitro (227).  If the RHA1 and M. smegmatis Dps1 proteins degrade at the same position in their pairwise sequence alignment, then the RHA1 Dps1 monomers in the lower band of the doublet would be 12 residues, or 7-%, shorter.  All of the  76 RHA1 apo-Dps1 oligomeric forms bound iron, nevertheless.  The Dps1 protein loaded with positively charged iron species did not enter the polyacrylamide gel during electrophoresis and, for the most part, formed a single band at the bottom of the well that the sample was loaded into (Figure 4.2A).  This protein band is the only one that was visible after the gel was soaked in the iron-specific potassium ferricyanide stain (Figure 4.2B).  BSA was used as a negative control protein for iron binding, although it does bind to various hydrophobic and hydrophilic substrates, including several cations (233).  Unlike RHA1 Dps1, BSA did not bind iron, as its electrophoretic mobility did not appreciably change upon Fe2+ addition (Figure 4.2A) nor did it stain after exposure to potassium ferricyanide solution (Figure 4.2B). RHA1 Dps1 was assayed for ferroxidase activity by allowing the purified, native protein (1 μM) to react with Fe2+ (24 μM) and H2O2 (12 μM) while monitoring A305, indicative of Fe3+ formation (102).  Iron-bound Dps1 under aerobic conditions did not result in detectable iron oxidation, just as for the BSA control protein premixed with Fe2+ (Figure 4.3).  However, at every time point after the addition of H2O2, the total increase in A305 was significantly higher for the Dps1-catalyzed reaction compared to the control reaction (P < 0.01 from two-tailed, two-sample Student’s t tests assuming equal variances).  In addition to greater Fe3+ formation, the ferroxidase activity of Dps1 also resulted in faster iron oxidation relative to the uncatalyzed   -0.01.000.010.020.030.040.050 2 4 6 8Time (min)A305Fe2+H2O2A305 FIGURE 4.3.  Ferroxidase assay on native RHA1 Dps1 (●) and on the BSA negative control (○).   Dps1 dodecamers (1 μM), or an equal amount of BSA, were mixed with Fe2+ (24 μM), and then H2O2 (12 μM), at the times indicated.  The mean results and their standard errors from five replicate assays are displayed. FIGURE 4.3.  Ferroxidase assay on RHA1 Dps1   77 Fenton reaction that occurred in the control cuvette.  Apo-Dps1 showed at least as much ferroxidase activity as native Dps1 preparations (data not shown).  4.3.4. In vitro DNA protection by RHA1 Dps1 Dps proteins protect cells from oxidative stress by oxidizing ferrous ions, without hydroxyl radical by-products, and mineralizing the resultant ferric ions in their hollow cores.  To show that the ferroxidase activity of RHA1 Dps1 prevents iron-dependent hydroxyl radical formation, the degradation of plasmid DNA in the presence of the Fenton reactants and Dps1 was monitored (Figure 4.4).  The undamaged 5.7-kbp plasmid (pK18mobsacB) ran mostly in a supercoiled topology, with a minor proportion in a nicked, relaxed form that migrated slower through a 1-% agarose gel.  Incubation of the plasmid with 120-μM Fe2+ and an excess of H2O2 caused almost complete plasmid disintegration.  As hypothesized, apo-Dps1 prevented much of this degradation.  Given that the ferroxidase centers of each Dps1 dodecamer can bind 24 Fe2+, 1.2-μg/μl (5.0-μM) apo-Dps1 would have been just enough protein to coordinate the added Fe2+, although certainly some Fe2+ would still have been in solution, free to generate hydroxyl   Fe2+& H2O2:Apo-Dps1BSAApo-Dps1BSAFereneSDNA ladder1.2 μg/μl 1.7 μg/μl +       +      +       +      +        + Apo-Dps1BSAApo-Dps1BSAFereneSDNA ladder FIGURE 4.4.  DNA protection by RHA1 Dps1 from iron-dependent hydroxyl radical formation FIGURE 4.4.  DNA protection by RHA1 Dps1 from iron-dependent hydroxyl radical formation.  Where indicated, 120-μM Fe2+ and 1-mM H2O2 were added, sequentially, to plasmid DNA in the absence or presence of 1.2-μg/μl (5.0-μM) or 1.7-μg/μl (7.5-μM) apo-Dps1, or equivalent amounts of BSA as negative control reactions.  An iron chelator, Ferene S (600 μM), was added as a positive control reaction.  The gel image is representative of the results from two experiments.  78 radicals.  Increasing the apo-Dps1 concentration to 1.7 μg/μl (7.5 μM) led to better protection of the plasmid, similar to that achieved by 600-μM Ferene S.  Much of the plasmid from both of these treatments remained supercoiled and the bands from the nicked plasmid were just marginally brighter than that from the gel lane of the undamaged plasmid.  Considering that Ferene S chelates Fe2+ in a 3:1 ratio (121), 600-μM Ferene S and 1.7-μg/μl (7.5-μM) apo-Dps1 represent roughly equal capacities for iron binding of 200 and 180 Fe2+, respectively.  The negative control reactions involving 1.2- or 1.7-μg/μl BSA did not inhibit oxidative damage like the equivalent apo-Dps1 treatments did, since the band of supercoiled plasmid was completely degraded in the presence of BSA.  By mass, these reactions contained 58- to 86-times more protein in them than DNA.  Therefore, a plausible reason why BSA prevented complete degradation of the nicked plasmid is that it could have served as a competing target for hydroxyl radicals in the reaction – those that hit protein residues could not then attack the plasmid. The DNA-protection assays presented here, in addition to other DNA-binding assays conducted (data not shown), did not yield any evidence to suggest that RHA1 Dps1 binds DNA.  At a concentration of up to ~ 660 Dps1 dodecamers per plasmid, this amount should have been high enough to affect DNA migration through the agarose gel (42).  Nevertheless, neither native Dps1 nor apo-Dps1 retarded the electrophoretic mobility of the plasmid DNA, in the reaction and electrophoresis buffer systems that were tried.  4.4. Discussion RHA1 mutant strains devoid of dps1 or both dps homologs did not have a significant, increased sensitivity to a variety of stresses mediated by reactive oxygen species.  Notwithstanding, functional characterization of RHA1 Dps1 showed that it is an effective protective mechanism against oxidative stress. Heterologous expression of RHA1 Dps1 in an E. coli dps mutant completely restored its resistance to H2O2, proving that Dps1 is a functional homolog, and not just one by sequence, of the Dps protein family.  Single knockout mutants of genes instrumental to the oxidative stress resistance of E. coli – such as dps or ahpC, encoding an alkyl hydroperoxide reductase – have served as useful genetic backgrounds on which to demonstrate the functions of dps orthologs from bacteria with more complex oxidative stress responses.  For B. pseudomallei, its dpsA mutant is sensitive to organic hydroperoxides but not H2O2, relative to the wild type (166).  Complementation of the E. coli ahpC mutant by DpsA from B. pseudomallei confirmed that  79 DpsA provides protection from organic hydroperoxides, although by a mechanism different from that of an alkyl hydroperoxide reductase (166).  For the lactic acid bacterium Oenococcus oeni, expression of its dps homolog complements the H2O2 sensitivity of the E. coli dps mutant (9).  The experimental strategy used in the O. oeni study was like mine, although necessitated out of different circumstances:  they created a complementation plasmid for the E. coli dps mutant because of technical difficulties in generating deletion mutants in O. oeni (9), whereas I did the same because deletion of the dps homologs from RHA1 did not result in any considerable fitness deficiency. Dps1 isolated from RHA1 bound iron and exhibited ferroxidase catalytic activity.  Such findings strengthen the causal relationship between the signature motif of bacterial Dps proteins and these conserved functions.  Studies that have compared the ferroxidation rates of Dps proteins using the oxidant H2O2 versus O2 have found that reactions supplied with H2O2 proceed roughly 100-times faster (49).  In the presence of O2 from air, many Dps family members have ferroxidase activities that are noticeably above background autoxidation rates (24, 40, 41, 100), such that the use of H2O2 as an alternate oxidant was often not explored.  E. coli Dps and M. smegmatis Dps1, however, oxidize iron particularly slowly under aerobic conditions (40, 297).  Likewise, for RHA1 Dps1, minutes passed under aerobic reaction conditions without detectable Fe3+ formation.  Of the Dps proteins for which ferroxidase activity has been tested, RHA1 Dps1 was most similar to E. coli Dps and M. smegmatis Dps1 in terms of not only this function but also sequence alignment (Table 4.2).  Thus, the evolution of this clade of Dps proteins to effectively use only H2O2 for iron oxidation may highlight their role in detoxifying both Fe2+ and H2O2, in contrast to the main role of ferritins in iron homeostasis (49). A comparison of the stoichiometry of Fe2+ oxidation by H2O2 catalyzed by Dps versus proceeding by the Fenton reaction indicates that Dps ferroxidase activity yields twice as many Fe3+ per H2O2 molecule but no hydroxyl radicals (cf. section 1.5).  Indeed, the reactions catalyzed by RHA1 Dps1 using H2O2 led to quicker formation of more Fe3+ and to less damage to plasmid DNA than did the control reactions containing BSA.  The kinetics of iron oxidation by RHA1 Dps1 match well with those of Listeria innocua Dps in that the control reactions progress slower (40).  Clearly, Dps enzymes must outcompete the destructive combination of Fe2+ and H2O2 in order to prevent oxidative damage.  The reported data are consistent with this premise; however, a seeming oversight in several studies that examined the ferroxidase activity  80 of Dps proteins in the presence of H2O2 is that they did not show results from control reactions without their proteins of interest (219, 249, 277, 297). The ferroxidase and iron-binding abilities of RHA1 Dps1 sufficed to inhibit iron-dependent hydroxyl radical formation, and thereby largely preserved the integrity of vulnerable plasmid DNA.  In contradiction to my hypothesis, RHA1 Dps1 did not bind to plasmid DNA under the same experimental conditions that allow M. smegmatis Dps1 to interact with DNA, namely a buffer at a pH of 7.0 plus 50-mM NaCl (42).  Crystallizing RHA1 Dps1 in order to solve its quaternary structure may clarify the preliminary evidence pointing to its inability to bind DNA in vitro.  Are the positively charged termini of RHA1 Dps1 rigidly affixed to its dodecamer surface, making them unavailable to interact with the DNA backbone?  Recall that these regions of the protein are responsible for DNA binding by M. smegmatis Dps1 (227), but that this function could be abolished by restricting the flexibility of these tails, as illustrated in the example of A. tumefaciens Dps (41).  For RHA1 Dps2, questions about the possibility of it binding DNA, and others concerning details of its putative ferroxidase activity, remain to be explored experimentally.  Although Dps2 did not fold correctly in E. coli, it can be overexpressed in a soluble form in RHA1 itself (unpublished data) to pursue these objectives. In summary, RHA1 Dps1 was shown to retain the conserved functions of the Dps protein family despite its seeming inconsequential contribution to the fitness of this bacterium under a plethora of oxidative assaults.  On its own, RHA1 Dps1 protected E. coli cells from the same type of oxidative stress that had no measurable effect on RHA1’s survival in the absence of this protein.  The unanswered question, therefore, is whether a selective condition exists where an RHA1 dps homolog plays a pivotal role, or that, due to genetic redundancy, these genes form part of a robust catalogue of oxidative resistance mechanisms critical for this bacterium’s ecological niche.    81 Chapter 5:  Conclusion  In this thesis I described how RHA1 responds to air-drying and I identified genes whose expression profiles implicate them in this bacterium’s excellent desiccation resistance.  From the transcriptomic analysis, the finding of significant and specific up-regulation of both of RHA1’s dps genes during the desiccation treatment suggested that they are important for coping with the increased exposure to oxidative radicals from this stress, consistent with the main role of Dps family members as antioxidant proteins.  Nevertheless, the RHA1 dps-null mutant did not have impaired resistance to desiccation even though the Dps1 protein was shown to be capable of inhibiting oxidative damage by way of its ferroxidase activity.  RHA1 Dps2 also putatively has this function, based on the key conserved residues in its protein sequence.  Given these results and that much of my thesis work centered on characterizing the dps− mutants and Dps1 protein of RHA1, we are left with no conclusive answers accounting for the extraordinary desiccation resistance of such bacteria.  However, the original objective of this research could be realized by investigations targeting other desiccation-specific responses highlighted in the transcriptomic analysis. The biosynthetic operon for the compatible solute ectoine is one promising candidate that may contribute to RHA1’s survival during osmotic and desiccative stresses.  Preliminary experiments on benzoate-grown RHA1 cultures that were osmotically shocked by salt addition indicated that hydroxyectoine accumulates in the cells (unpublished data).  A reasonable course of inquiry would be to extract the water-soluble osmolytes from such cultures in order to determine if ectoine and its derivatives are indeed the principal compatible solutes synthesized.  If so, an RHA1 mutant lacking ectoine production should be created by knocking out the putative diaminobutyrate acetyltransferase gene, ectA, for which no homologs exist in the genome.  Further, any changes in the relative concentrations of various compatible solutes within hyperosmotically stressed cells could be surveyed in cultures supplied with different carbon substrates, such as glucose or a soil extract.  Results from these analyses would inform whether constructing deletion mutants for other biosynthetic pathways of compatible solutes is likely to lead to demonstrable deficiencies in their resistances to osmotic and dessicative stresses. Another prime result from the transcriptomic analysis of desiccated RHA1 pertains to the potential regulation of this stress response by two of its three sigF paralogs.  Since the completion of these experiments on RHA1, other research groups have functionally  82 characterized the lone SigF ortholog of M. smegmatis.  These studies found that M. smegmatis sigF− mutants are sensitive to acidic pH, heat shock, and oxidative stress from H2O2, but not to shifts in osmolarity (89, 214).  Transcriptomic comparisons of a sigF− mutant to the wild type during exponential growth and stationary phase revealed ~ 200 members of the SigF regulon of M. smegmatis (130).  Among the genes dependent upon SigF for expression in M. smegmatis were those known, or believed, to be involved with the biosynthesis and uptake of osmoprotectants and with oxidative stress resistance.  Of the three RHA1 sigF paralogs, sigF3 appears to fulfill a physiological role most similar to that of sigF of M. smegmatis, both in terms of the functions of the genes correlated with its expression and the varied stresses that cause its induction.  Support for my hypothesis that SigF3 directly regulates dps1 expression in RHA1 has been strengthened by findings from in vitro transcription assays on dps1 from M. smegmatis using sigma factors purified from M. tuberculosis:  the core RNA polymerase from M. smegmatis initiated transcription from the dps1 promoter when it was reconstituted with σF or σH, but not with the primary sigma factor, σA (52).  To elucidate the regulons of RHA1 SigF1 or SigF3, and thereby discover how much of the desiccation-specific response each may coordinate, controlled overexpression experiments of these sigma factors may be a safer strategy compared to characterizing their knockout mutants.  With a total of 34 sigma factors encoded in the RHA1 genome, overlap between the promoters they recognize seems almost unavoidable.  Thus, attempts to find a phenotype for one of these sigma factor deletion mutants that differentiates it from wild-type RHA1 may not be fruitful. While I caution against pursuing research directions that may not lead to positive results, I do not belittle the body of work presented here showing a lack of phenotypic differences between the RHA1 dps− mutants and wild type when challenged under a comprehensive series of stresses.  To my knowledge, the dps-null mutant of RHA1 is the first one known to be insensitive to oxidative stresses, where the mutant was derived from a bacterium whose Dps proteins have the conserved ferroxidase center residues.  I speculate that RHA1’s dps genes are part of a robust suite of protective mechanisms for countering the reactive oxygen species that are inevitably produced in this bacterium, as it struggles to survive in its soil environment with a metabolism that is highly dependent upon O2 (179).  An interesting question that remains is whether complete dps− mutants of other soil-residing actinobacteria, like M. smegmatis or S. coelicolor, would similarly reveal cryptic roles for their dps homologs in their defenses against oxidative  83 stresses.  The limited evidence available on actinobacterial dps− mutants is consistent with my findings on the RHA1 dps− mutants, as already discussed.   Testing the desiccation resistance of dps− mutants of other species may result in sensitive phenotypes, however, since the rationale behind my initial hypothesis still seems sound – that Dps proteins could protect cells from the oxidative stress that accompanies desiccation.  The ideal candidate for this experiment would be a dps− mutant that is (i) sensitive to oxidative stress and (ii) derived from a species with natural tolerance towards desiccation.  Of the existing dps− mutants, those of B. subtilis (8, 48) and D. radiodurans (289) appear to best fit this description (175, 211).  In contrast, the desiccation-tolerant dps− mutants of RHA1 did not satisfy the first criterion.  And the E. coli dps− mutant, the only other such mutant to have been challenged by this stress, did not satisfy the second criterion; hence, I found that its desiccation resistance did not differ significantly from the wild type (unpublished data).  Lending further support to a potential role of Dps proteins in desiccation resistance is evidence for their involvement in response to hyperosmotic shock, a stress that is inextricably linked to dehydration.  After salt addition to growing cultures, the expression of dps homologs is up-regulated in five diverse bacterial species (8, 80, 155, 166, 184), including R. jostii.  To date, the dps− mutants of only two species, S. coelicolor and Legionella pneumophila, have undergone osmotic stress assays (80, 292).  None of the mutants exhibited a sensitive phenotype to excess salt, but the results are as expected considering the mutants’ origins – an actinomycete and an intracellular pathogen.  Conversely, the alphaproteobacterium Methylobacterium extorquens is adapted to the unstable and relatively harsh conditions of the phyllosphere (97, 163).  In concord with my hypothesis above, a knockout mutant of PhyR, a positive regulator of the dps homolog in M. extorquens, has impaired resistance to both osmotic and desiccative stresses (97).  Generating a dps− mutant of M. extorquens and testing its stress tolerance could potentially reveal new environmental disturbances to which a Dps family member provides protection. Many phenotypic tests were conducted on the RHA1 dps-null mutant in order to have confidence that, indeed, in an RHA1 background, these genes do not fulfill an essential role in oxidative stress resistance like that served by dps orthologs in many other bacteria.  For this reason, I also demonstrated that RHA1 Dps1 conforms to the established primary function of the Dps protein family – that it can inhibit reactive oxygen species formation in the cytosol via its ferroxidase activity.  But this necessary focus on systematically testing for known roles of Dps proteins did stifle efforts towards exploring novel ways that they may contribute to RHA1’s  84 fitness.  An intriguing possibility is that Dps proteins may not be restricted to functions localized only within cells.  Dps has been identified in the outer membrane of E. coli cells by three separate research groups, in studies concerning bacteriophage tolerance (152), adaptations to pH stress (283), growth on different glucose concentrations (291), and attachment to abiotic surfaces (96).  Additionally, this last study found that the dps− mutants of three E. coli strains have altered surface adherence compared to their wild-type counterparts (96).  The Dps homolog of H. pylori, named NapA because it is a neutrophil-activating protein (79), is also detected on the cell surface (191).  In comparison with wild-type H. pylori, the biofilm formed by a napA− mutant has a loose structure with reduced cell aggregation (290).  Even more extraordinary, the major subunit of fine tangled pili from Haemophilus ducreyi, FtpA, was identified as a member of the Dps family (27).  These discoveries indicate that, for at least some proteobacteria, a portion of the cellular Dps pool is localized extracellularly, where it appears to be involved with interactions with other cells and surfaces.  Outside of the Proteobacteria, Dps2 from D. radiodurans is predicted to contain a signal peptide in its unusually long N terminus (cf. Table 4.2), targeting this protein to an, as yet, undetermined noncytosolic destination (222).  In my opinion, examining the relative ability of the RHA1 dps-null mutant to form biofilms should near the top of the list of phenotypic tests for future consideration. The goal of my thesis research was to further our understanding of the physiological mechanisms that enable RHA1, and related actinobacteria, to survive the stresses associated with desiccation.  Basic research on such organisms, which are representative of hydrocarbon degraders in soils, should ultimately inform site-specific strategies designed to promote decontamination of polluted environments with minimal additional disturbance.  One challenge to the realization of this vision may be in translating knowledge obtained in the laboratory to the complexities of soil ecosystems.  Thus, intermediate steps towards more closely mimicking natural conditions in our experimental setups may be advisable.  As an example, attempts to reproduce results from in vitro experiments could be made in artificial soils composed of sterilized sand with humic acid.  While I support the development of bioremediation technologies, these efforts cannot replace sound policies to direct our attention and resources to the prevention of environmental calamities in the first place.  Such policies would encourage transitioning away from toxic substances to cleaner alternatives and would better ensure the safety of products before they enter the marketplace.   85 Afterword  An important research principle not evident from the results presented in this thesis is my efforts to reduce the environmental impacts of my research.  As examples, in the lab and office, this ethos translated to careful planning and execution of experiments to reduce waste, often employing more laborious methods; reusing reagents from the benches and freezers of ex-labmates; avoiding disposable items whenever possible; turning off equipment at night; realizing that expiry dates are often marketing tools; and not printing off papers when computers need to be on all day anyway.  While some of these actions have more influence than others, I feel strongly that everyone should be conscious of the net benefits and consequences of their research activities.  I find that the scientific community excels at scrutinizing the conclusions that are drawn from results, but we may not always do as good of a job as we should in criticizing the motives behind our research and its conduct.   86 References  1. Ahn, B.-E., J. Cha, E.-J. Lee, A.-R. Han, C. J. Thompson, and J.-H. Roe. 2006. Nur, a nickel-responsive regulator of the Fur family, regulates superoxide dismutases and nickel transport in Streptomyces coelicolor. Mol. Microbiol. 59:1848–1858.  2. Almirón, M., A. J. Link, D. Furlong, and R. Kolter. 1992. A novel DNA-binding protein with regulatory and protective roles in starved Escherichia coli. Genes Dev. 6:2646–2654.  3. Alvarez, A. F., H. M. Alvarez, R. Kalscheuer, M. Wältermann, and A. Steinbüchel. 2008. Cloning and characterization of a gene involved in triacylglycerol biosynthesis and identification of additional homologous genes in the oleaginous bacterium Rhodococcus opacus PD630. Microbiology 154:2327–2335.  4. Alvarez, H. M., R. Kalscheuer, and A. Steinbüchel. 2000. Accumulation and mobilization of storage lipids by Rhodococcus opacus PD630 and Rhodococcus ruber NCIMB 40126. Appl. Microbiol. Biotechnol. 54:218–223.  5. Alvarez, H. M., F. Mayer, D. Fabritius, and A. Steinbüchel. 1996. Formation of intracytoplasmic lipid inclusions by Rhodococcus opacus strain PD630. Arch. Microbiol. 165:377–386.  6. Alvarez, H. M., R. A. Silva, A. C. Cesari, A. L. Zamit, S. R. Peressutti, R. Reichelt, U. Keller, U. Malkus, C. Rasch, T. Maskow, F. Mayer, and A. Steinbüchel. 2004. Physiological and morphological responses of the soil bacterium Rhodococcus opacus strain PD630 to water stress. FEMS Microbiol. Ecol. 50:75–86.  7. Andrews, S. C. 1998. Iron storage in bacteria. Adv. Microb. Physiol. 40:281–351.  8. Antelmann, H., S. Engelmann, R. Schmid, A. Sorokin, A. Lapidus, and M. Hecker. 1997. Expression of a stress- and starvation-induced dps/pexB-homologous gene is controlled by the alternative sigma factor σB in Bacillus subtilis. J. Bacteriol. 179:7251–7256.  9. Athané, A., E. Bilhère, E. Bon, G. Morel, P. Lucas, A. Lonvaud, and C. Le Marrec. 2008. Characterization of an acquired dps-containing gene island in the lactic acid bacterium Oenococcus oeni. J. Appl. Microbiol. 105:1866–1875.  10. Banerjee, A., R. Sharma, and U. C. Banerjee. 2002. The nitrile-degrading enzymes: current status and future prospects. Appl. Microbiol. Biotechnol. 60:33–44.  11. Bannister, J. V., W. H. Bannister, and G. Rotilio. 1987. Aspects of the structure, function, and applications of superoxide dismutase. CRC Crit. Rev. Biochem. 22:111–180.  12. Bauman, R. W. 2004. Microbiology. Pearson Benjamin Cummings, San Francisco, CA.  87 13. Bell, K. S., J. C. Philp, D. W. J. Aw, and N. Christofi. 1998. The genus Rhodococcus. J. Appl. Microbiol. 85:195–210.  14. Bellapadrona, G., S. Stefanini, C. Zamparelli, E. C. Theil, and E. Chiancone. 2009. Iron translocation into and out of Listeria innocua Dps and size distribution of the protein-enclosed nanomineral are modulated by the electrostatic gradient at the 3-fold “ferritin-like” pores. J. Biol. Chem. 284:19101–19109.  15. Bendinger, B., H. H. M. Rijnaarts, K. Altendorf, and A. J. B. Zehnder. 1993. Physicochemical cell surface and adhesive properties of coryneform bacteria related to the presence and chain length of mycolic acids. Appl. Environ. Microbiol. 59:3973–3977.  16. Bentley, S. D., K. F. Chater, A. M. Cerdeño-Tárraga, G. L. Challis, N. R. Thomson, K. D. James, D. E. Harris, M. A. Quail, H. Kieser, D. Harper, A. Bateman, S. Brown, G. Chandra, C. W. Chen, M. Collins, A. Cronin, A. Fraser, A. Goble, J. Hidalgo, T. Hornsby, S. Howarth, C. H. Huang, T. Kieser, L. Larke, L. Murphy, K. Oliver, S. O'Neil, E. Rabbinowitsch, M. A. Rajandream, K. Rutherford, S. Rutter, K. Seeger, D. Saunders, S. Sharp, R. Squares, S. Squares, K. Taylor, T. Warren, A. Wietzorrek, J. Woodward, B. G. Barrell, J. Parkhill, and D. A. Hopwood. 2002. Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417:141–147.  17. Bernstein, J. A., A. B. Khodursky, P.-H. Lin, S. Lin-Chao, and S. N. Cohen. 2002. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc. Natl. Acad. Sci. USA 99:9697–9702.  18. Bhattacharyya, G., and A. Grove. 2007. The N-terminal extensions of Deinococcus radiodurans Dps-1 mediate DNA major groove interactions as well as assembly of the dodecamer. J. Biol. Chem. 282:11921–11930.  19. Billi, D., and M. Potts. 2002. Life and death of dried prokaryotes. Res. Microbiol. 153:7–12.  20. Billi, D., and M. Potts. 2000. Life without water: responses of prokaryotes to desiccation, p. 181–192. In K. B. Storey and J. M. Storey (ed.), Environmental stressors and gene responses. Elsevier, Amsterdam, Netherlands.  21. Billi, D., D. J. Wright, R. F. Helm, T. Prickett, M. Potts, and J. H. Crowe. 2000. Engineering desiccation tolerance in Escherichia coli. Appl. Environ. Microbiol. 66:1680–1684.  22. Bio-Rad. 2005. Real-time PCR applications guide. Bio-Rad Laboratories, Inc., Hercules, CA.  23. Boylen, C. W. 1973. Survival of Arthrobacter crystallopoietes during prolonged periods of extreme desiccation. J. Bacteriol. 113:33–37.  88 24. Bozzi, M., G. Mignogna, S. Stefanini, D. Barra, C. Longhi, P. Valenti, and E. Chiancone. 1997. A novel non-heme iron-binding ferritin related to the DNA-binding proteins of the Dps family in Listeria innocua. J. Biol. Chem. 272:3259–3265.  25. Braeken, K., M. Moris, R. Daniels, J. Vanderleyden, and J. Michiels. 2006. New horizons for (p)ppGpp in bacterial and plant physiology. Trends Microbiol. 14:45–54.  26. Braña, A. F., C. Méndez, L. A. Díaz, M. B. Manzanal, and C. Hardisson. 1986. Glycogen and trehalose accumulation during colony development in Streptomyces antibioticus. J. Gen. Microbiol. 132:1319–1326.  27. Brentjens, R. J., M. Ketterer, M. A. Apicella, and S. M. Spinola. 1996. Fine tangled pili expressed by Haemophilus ducreyi are a novel class of pili. J. Bacteriol. 178:808–816.  28. Bsat, N., L. Chen, and J. D. Helmann. 1996. Mutation of the Bacillus subtilis alkyl hydroperoxide reductase (ahpCF) operon reveals compensatory interactions among hydrogen peroxide stress genes. J. Bacteriol. 178:6579–6586.  29. Burgdorfer, W., A. G. Barbour, S. F. Hayes, J. L. Benach, E. Grunwaldt, and J. P. Davis. 1982. Lyme disease—a tick-borne spirochetosis? Science 216:1317–1319.  30. Burleigh, S. H., and J. O. Dawson. 1994. Desiccation tolerance and trehalose production in Frankia hyphae. Soil Biol. Biochem. 26:593–598.  31. Calhoun, L. N., and Y. M. Kwon. 2011. The ferritin-like protein Dps protects Salmonella enterica serotype Enteritidis from the Fenton-mediated killing mechanism of bactericidal antibiotics. Int. J. Antimicrob. Agents 37:261–265.  32. Cameron, R. E. 1962. Species of Nostoc Vaucher occurring in the Sonoran Desert in Arizona. Trans. Am. Microsc. Soc. 81:379–384.  33. Campbell, E. A., R. Greenwell, J. R. Anthony, S. Wang, L. Lim, K. Das, H. J. Sofia, T. J. Donohue, and S. A. Darst. 2007. A conserved structural module regulates transcriptional responses to diverse stress signals in bacteria. Mol. Cell 27:793–805.  34. Campbell, G. S. 1977. An introduction to environmental biophysics. Springer-Verlag, New York, NY.  35. Canfield, D. E. 2005. The early history of atmospheric oxygen: homage to Robert M. Garrels. Annu. Rev. Earth Planet. Sci. 33:1–36.  36. Cánovas, D., C. Vargas, F. Iglesias-Guerra, L. N. Csonka, D. Rhodes, A. Ventosa, and J. J. Nieto. 1997. Isolation and characterization of salt-sensitive mutants of the moderate halophile Halomonas elongata and cloning of the ectoine synthesis genes. J. Biol. Chem. 272:25794–25801.  37. Carson, R. 1962. Silent spring. Houghton Mifflin, Boston, MA.  89 38. Castruita, M., M. Saito, P. C. Schottel, L. A. Elmegreen, S. Myneni, E. I. Stiefel, and F. M. M. Morel. 2006. Overexpression and characterization of an iron storage and DNA-binding Dps protein from Trichodesmium erythraeum. Appl. Environ. Microbiol. 72:2918–2924.  39. Ceci, P., S. Cellai, E. Falvo, C. Rivetti, G. L. Rossi, and E. Chiancone. 2004. DNA condensation and self-aggregation of Escherichia coli Dps are coupled phenomena related to the properties of the N-terminus. Nucleic Acids Res. 32:5935–5944.  40. Ceci, P., G. Di Cecca, M. Falconi, F. Oteri, C. Zamparelli, and E. Chiancone. 2011. Effect of the charge distribution along the “ferritin-like” pores of the proteins from the Dps family on the iron incorporation process. J. Biol. Inorg. Chem. 16:869–880.  41. Ceci, P., A. Ilari, E. Falvo, and E. Chiancone. 2003. The Dps protein of Agrobacterium tumefaciens does not bind to DNA but protects it toward oxidative cleavage: x-ray crystal structure, iron binding, and hydroxyl-radical scavenging properties. J. Biol. Chem. 278:20319–20326.  42. Ceci, P., A. Ilari, E. Falvo, L. Giangiacomo, and E. Chiancone. 2005. Reassessment of protein stability, DNA binding, and protection of Mycobacterium smegmatis Dps. J. Biol. Chem. 280:34776–34785.  43. Ceci, P., L. Mangiarotti, C. Rivetti, and E. Chiancone. 2007. The neutrophil-activating Dps protein of Helicobacter pylori, HP-NAP, adopts a mechanism different from Escherichia coli Dps to bind and condense DNA. Nucleic Acids Res. 35:2247–2256.  44. Champness, W. 2000. Actinomycete development, antibiotic production, and phylogeny: questions and challenges, p. 11–31. In Y. V. Brun and L. J. Shimkets (ed.), Prokaryotic development. AMS Press, Washington, DC.  45. Chater, K. F. 2001. Regulation of sporulation in Streptomyces coelicolor A3(2): a checkpoint multiplex? Curr. Opin. Microbiol. 4:667–673.  46. Chater, K. F. 1998. Taking a genetic scalpel to the Streptomyces colony. Microbiology 144:1465–1478.  47. Chater, K. F., and G. Chandra. 2006. The evolution of development in Streptomyces analysed by genome comparisons. FEMS Microbiol. Rev. 30:651–672.  48. Chen, L., and J. D. Helmann. 1995. Bacillus subtilis MrgA is a Dps(PexB) homologue: evidence for metalloregulation of an oxidative-stress gene. Mol. Microbiol. 18:295–300.  49. Chiancone, E., and P. Ceci. 2010. The multifaceted capacity of Dps proteins to combat bacterial stress conditions: Detoxification of iron and hydrogen peroxide and DNA binding. Biochim. Biophys. Acta 1800:798–805.   90 50. Chodavarapu, S., R. Gomez, M. Vicente, and J. M. Kaguni. 2008. Escherichia coli Dps interacts with DnaA protein to impede initiation: a model of adaptive mutation. Mol. Microbiol. 67:1331–1346.  51. Choi, S. H., D. J. Baumler, and C. W. Kaspar. 2000. Contribution of dps to acid stress tolerance and oxidative stress tolerance in Escherichia coli O157:H7. Appl. Environ. Microbiol. 66:3911–3916.  52. Chowdhury, R. P., S. Gupta, and D. Chatterji. 2007. Identification and characterization of the dps promoter of Mycobacterium smegmatis: promoter recognition by stress-specific extracytoplasmic function sigma factors σH and σF. J. Bacteriol. 189:8973–8981.  53. Chun, J., S.-O. Kang, Y. C. Hah, and M. Goodfellow. 1996. Phylogeny of mycolic acid-containing actinomycetes. J. Ind. Microbiol. 17:205–213.  54. Chung, C. T., S. L. Niemela, and R. H. Miller. 1989. One-step preparation of competent Escherichia coli: Transformation and storage of bacterial cells in the same solution. Proc. Natl. Acad. Sci. USA 86:2172–2175.  55. Colburn-Clifford, J. M., J. M. Scherf, and C. Allen. 2010. Ralstonia solanacearum Dps contributes to oxidative stress tolerance and to colonization of and virulence on tomato plants. Appl. Environ. Microbiol. 76:7392–7399.  56. Collado-Vides, J., B. Magasanik, and J. D. Gralla. 1991. Control site location and transcriptional regulation in Escherichia coli. Microbiol. Rev. 55:371–394.  57. Connell, N., Z. Han, F. Moreno, and R. Kolter. 1987. An E. coli promoter induced by the cessation of growth. Mol. Microbiol. 1:195–201.  58. Cooksley, C., P. J. Jenks, A. Green, A. Cockayne, R. P. H. Logan, and K. R. Hardie. 2003. NapA protects Helicobacter pylori from oxidative stress damage, and its production is influenced by the ferric uptake regulator. J. Med. Microbiol. 52:461–469.  59. Crichton, R. R., and J.-P. Declercq. 2010. X-ray structures of ferritins and related proteins. Biochim. Biophys. Acta 1800:706–718.  60. Crowe, J. H., L. M. Crowe, and D. Chapman. 1984. Preservation of membranes in anhydrobiotic organisms: the role of trehalose. Science 223:701–703.  61. Crowe, J. H., F. A. Hoekstra, and L. M. Crowe. 1992. Anhydrobiosis. Annu. Rev. Physiol. 54:579–599.  62. Crowe, L. M., and J. H. Crowe. 1992. Anhydrobiosis: a strategy for survival. Adv. Space Res. 12:239–247.  63. Cytryn, E. J., D. P. Sangurdekar, J. G. Streeter, W. L. Franck, W.-s. Chang, G. Stacey, D. W. Emerich, T. Joshi, D. Xu, and M. J. Sadowsky. 2007. Transcriptional  91 and physiological responses of Bradyrhizobium japonicum to desiccation-induced stress. J. Bacteriol. 189:6751–6762.  64. Dahl, J. L., K. Arora, H. I. Boshoff, D. C. Whiteford, S. A. Pacheco, O. J. Walsh, D. Lau-Bonilla, W. B. Davis, and A. G. Garza. 2005. The relA homolog of Mycobacterium smegmatis affects cell appearance, viability, and gene expression. J. Bacteriol. 187:2439–2447.  65. Dandurand, L. M., M. J. Morra, M. H. Chaverra, and C. S. Orser. 1994. Survival of Pseudomonas spp in air-dried mineral powders. Soil Biol. Biochem. 26:1423–1430.  66. Daso, A. P., O. S. Fatoki, J. P. Odendaal, and J. O. Okonkwo. 2010. A review on sources of brominated flame retardants and routes of human exposure with emphasis on polybrominated diphenyl ethers. Environ. Rev. 18:239–254.  67. Davet, P. 2004. Microbial ecology of the soil and plant growth. Science Publishers, Inc., Enfield, NH.  68. Dean, B. J. 1978. Genetic toxicology of benzene, toluene, xylenes and phenols. Mutat. Res. 47:75–97.  69. Dean, B. J. 1985. Recent findings on the genetic toxicology of benzene, toluene, xylenes and phenols. Mutat. Res. 154:153–181.  70. den Hengst, C. D., and M. J. Buttner. 2008. Redox control in actinobacteria. Biochim. Biophys. Acta 1780:1201–1216.  71. Doniger, S., N. Salomonis, K. Dahlquist, K. Vranizan, S. Lawlor, and B. Conklin. 2003. MAPPFinder: using Gene Ontology and GenMAPP to create a global gene-expression profile from microarray data. Genome Biol. 4:R7.  72. Dukan, S., and T. Nyström. 1999. Oxidative stress defense and deterioration of growth-arrested Escherichia coli cells. J. Biol. Chem. 274:26027–26032.  73. Dwivedi, K., A. Sen, and G. S. Bullerjahn. 1997. Expression and mutagenesis of the dpsA gene of Synechococcus sp. PCC7942, encoding a DNA-binding protein involved in oxidative stress protection. FEMS Microbiol. Lett. 155:85–91.  74. Ekpanyaskun, P. 2006. Transcriptomic analysis of Rhodococcus sp. RHA1 responses to heat shock and osmotic stress. M.Sc. thesis. University of British Columbia, Vancouver, Canada.  75. El Fantroussi, S., and S. N. Agathos. 2005. Is bioaugmentation a feasible strategy for pollutant removal and site remediation? Curr. Opin. Microbiol. 8:268–275.  76. Ellis, E. C., and N. Ramankutty. 2008. Putting people in the map: anthropogenic biomes of the world. Front. Ecol. Environ. 6:439–447.   92 77. Embley, T. M., and E. Stackebrandt. 1994. The molecular phylogency and systematics of the actinomycetes. Annu. Rev. Microbiol. 48:257–289.  78. Escolar, L., J. Pérez-Martín, and V. de Lorenzo. 1999. Opening the iron box: transcriptional metalloregulation by the Fur protein. J. Bacteriol. 181:6223–6229.  79. Evans, D. J., Jr., D. G. Evans, T. Takemura, H. Nakano, H. C. Lampert, D. Y. Graham, D. N. Granger, and P. R. Kvietys. 1995. Characterization of a Helicobacter pylori neutrophil-activating protein. Infect. Immun. 63:2213–2220.  80. Facey, P. D., M. D. Hitchings, P. Saavedra-Garcia, L. Fernandez-Martinez, P. J. Dyson, and R. Del Sol. 2009. Streptomyces coelicolor Dps-like proteins: differential dual roles in response to stress during vegetative growth and in nucleoid condensation during reproductive cell division. Mol. Microbiol. 73:1186–1202.  81. Fanget, N., and S. Foley. 2011. Starvation/stationary-phase survival of Rhodococcus erythropolis SQ1: a physiological and genetic analysis. Arch. Microbiol. 193:1–13.  82. Ferguson, G. P., R. I. Creighton, Y. Nikolaev, and I. R. Booth. 1998. Importance of RpoS and Dps in survival of exposure of both exponential- and stationary-phase Escherichia coli cells to the electrophile N-ethylmaleimide. J. Bacteriol. 180:1030–1036.  83. Fernandes, N. D., Q.-l. Wu, D. Kong, X. Puyang, S. Garg, and R. N. Husson. 1999. A mycobacterial extracytoplasmic sigma factor involved in survival following heat shock and oxidative stress. J. Bacteriol. 181:4266–4274.  84. Finnerty, W. R. 1992. The biology and genetics of the genus Rhodococcus. Annu. Rev. Microbiol. 46:193–218.  85. Foght, J., T. April, K. Biggar, and J. Aislabie. 2001. Bioremediation of DDT-contaminated soils: a review. Biorem. J. 5:225–246.  86. Frenkiel-Krispin, D., I. Ben-Avraham, J. Englander, E. Shimoni, S. G. Wolf, and A. Minsky. 2004. Nucleoid restructuring in stationary-state bacteria. Mol. Microbiol. 51:395–405.  87. Frenkiel-Krispin, D., S. Levin-Zaidman, E. Shimoni, S. G. Wolf, E. J. Wachtel, T. Arad, S. E. Finkel, R. Kolter, and A. Minsky. 2001. Regulated phase transitions of bacterial chromatin: a non-enzymatic pathway for generic DNA protection. EMBO J. 20:1184–1191.  88. Furuya, T., S. Hirose, H. Semba, and K. Kino. 2011. Identification of the regulator gene responsible for the acetone-responsive expression of the binuclear iron monooxygenase gene cluster in mycobacteria. J. Bacteriol. 193:5817–5823.  89. Gebhard, S., A. Hümpel, A. D. McLellan, and G. M. Cook. 2008. The alternative sigma factor SigF of Mycobacterium smegmatis is required for survival of heat shock, acidic pH and oxidative stress. Microbiology 154:2786–2795.  93 90. Gentry, T. J., C. Rensing, and I. L. Pepper. 2004. New approaches for bioaugmentation as a remediation technology. Crit. Rev. Env. Sci. Technol. 34:447–494.  91. Ghatak, P., K. Karmakar, S. Kasetty, and D. Chatterji. 2011. Unveiling the role of Dps in the organization of mycobacterial nucleoid. PLoS One 6:e16019.  92. Ghosh, J., P. Larsson, B. Singh, B. M. F. Pettersson, N. M. Islam, S. N. Sarkar, S. Dasgupta, and L. A. Kirsebom. 2009. Sporulation in mycobacteria. Proc. Natl. Acad. Sci. USA 106:10781–10786.  93. Glantz, S. A. 2002. Primer of biostatistics, 5th ed. McGraw-Hill, New York, NY.  94. Gomez, M., L. Doukhan, G. Nair, and I. Smith. 1998. sigA is an essential gene in Mycobacterium smegmatis. Mol. Microbiol. 29:617–628.  95. Gonçalves, E. R., H. Hara, D. Miyazawa, J. E. Davies, L. D. Eltis, and W. W. Mohn. 2006. Transcriptomic assessment of isozymes in the biphenyl pathway of Rhodococcus sp. strain RHA1. Appl. Environ. Microbiol. 72:6183–6193.  96. Goulter-Thorsen, R. M., I. R. Gentle, K. S. Gobius, and G. A. Dykes. 2011. The DNA protection during starvation protein (Dps) influences attachment of Escherichia coli to abiotic surfaces. Foodborne Pathog. Dis. 8:939–941.  97. Gourion, B., A. Francez-Charlot, and J. A. Vorholt. 2008. PhyR is involved in the general stress response of Methylobacterium extorquens AM1. J. Bacteriol. 190:1027–1035.  98. Grant, R. A., D. J. Filman, S. E. Finkel, R. Kolter, and J. M. Hogle. 1998. The crystal structure of Dps, a ferritin homolog that binds and protects DNA. Nat. Struct. Biol. 5:294–303.  99. Grant, S. G. N., J. Jessee, F. R. Bloom, and D. Hanahan. 1990. Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proc. Natl. Acad. Sci. USA 87:4645–4649.  100. Grove, A., and S. P. Wilkinson. 2005. Differential DNA binding and protection by dimeric and dodecameric forms of the ferritin homolog Dps from Deinococcus radiodurans. J. Mol. Biol. 347:495–508.  101. Gruber, T. M., and C. A. Gross. 2003. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu. Rev. Microbiol. 57:441–466.  102. Gupta, S., and D. Chatterji. 2003. Bimodal protection of DNA by Mycobacterium smegmatis DNA-binding protein from stationary phase cells. J. Biol. Chem. 278:5235–5241.  103. Gupta, S., and D. Chatterji. 2005. Stress responses in mycobacteria. IUBMB Life 57:149–159.  94 104. Gupta, S., S. B. Pandit, N. Srinivasan, and D. Chatterji. 2002. Proteomics analysis of carbon-starved Mycobacterium smegmatis: induction of Dps-like protein. Protein Eng. 15:503–511.  105. Gürtler, V., B. C. Mayall, and R. Seviour. 2004. Can whole genome analysis refine the taxonomy of the genus Rhodococcus? FEMS Microbiol. Rev. 28:377–403.  106. Hahn, J.-S., S.-Y. Oh, K. F. Chater, Y.-H. Cho, and J.-H. Roe. 2000. H2O2-sensitive Fur-like repressor CatR regulating the major catalase gene in Streptomyces coelicolor. J. Biol. Chem. 275:38254–38260.  107. Hahn, J.-S., S.-Y. Oh, and J.-H. Roe. 2002. Role of OxyR as a peroxide-sensing positive regulator in Streptomyces coelicolor A3(2). J. Bacteriol. 184:5214–5222.  108. Hahn, M.-Y., J.-B. Bae, J.-H. Park, and J.-H. Roe. 2003. Isolation and characterization of Streptomyces coelicolor RNA polymerase, its sigma, and antisigma factors. Methods Enzymol. 370:73–82.  109. Haikarainen, T., and A. C. Papageorgiou. 2010. Dps-like proteins: structural and functional insights into a versatile protein family. Cell. Mol. Life Sci. 67:341–351.  110. Halden, R. U. 2010. Plastics and health risks. Annu. Rev. Public Health 31:179–194.  111. Halliwell, B., and J. M. C. Gutteridge. 1984. Oxygen toxicity, oxygen radicals, transition metals and disease. Biochem. J. 219:1–14.  112. Halsey, T. A., A. Vazquez-Torres, D. J. Gravdahl, F. C. Fang, and S. J. Libby. 2004. The ferritin-like Dps protein is required for Salmonella enterica serovar Typhimurium oxidative stress resistance and virulence. Infect. Immun. 72:1155–1158.  113. Hara, H., L. D. Eltis, J. E. Davies, and W. W. Mohn. 2007. Transcriptomic analysis reveals a bifurcated terephthalate degradation pathway in Rhodococcus sp. strain RHA1. J. Bacteriol. 189:1641–1647.  114. Hara, H., G. R. Stewart, and W. W. Mohn. 2010. Involvement of a novel ABC transporter and monoalkyl phthalate ester hydrolase in phthalate ester catabolism by Rhodococcus jostii RHA1. Appl. Environ. Microbiol. 76:1516–1523.  115. Harris, R. F. 1981. Effect of water potential on microbial growth and activity, p. 23–97. In J. F. Parr, W. R. Gardner, and L. F. Elliott (ed.), Water potential relations in soil microbiology. Soil Science Society of America, Madison, WI.  116. Harrison, P. M., and P. Arosio. 1996. The ferritins: molecular properties, iron storage function and cellular regulation. Biochim. Biophys. Acta 1275:161–203.  117. Hatta, T., T. Shimada, T. Yoshihara, A. Yamada, E. Masai, M. Fukuda, and H. Kiyohara. 1998. Meta-fission product hydrolases from a strong PCB degrader Rhodococcus sp. RHA1. J. Ferment. Bioeng. 85:174–179.  95 118. Hayden, J., and M. Hendrich. 2010. EPR spectroscopy and catalase activity of manganese-bound DNA-binding protein from nutrient starved cells. J. Biol. Inorg. Chem. 15:729–736.  119. Heinzen, R. J., and J. C. Ensign. 1975. Effect of growth substrates on morphology of Nocardia corallina. Arch. Microbiol. 103:209–217.  120. Heitzer, A., and G. S. Sayler. 1993. Monitoring the efficacy of bioremediation. Trends Biotechnol. 11:334–343.  121. Hennessy, D. J., G. R. Reid, F. E. Smith, and S. L. Thompson. 1984. Ferene ― a new spectrophotometric reagent for iron. Can. J. Chem. 62:721–724.  122. Hett, E. C., and E. J. Rubin. 2008. Bacterial growth and cell division: a mycobacterial perspective. Microbiol. Mol. Biol. Rev. 72:126–156.  123. Higo, A., H. Katoh, K. Ohmori, M. Ikeuchi, and M. Ohmori. 2006. The role of a gene cluster for trehalose metabolism in dehydration tolerance of the filamentous cyanobacterium Anabaena sp. PCC 7120. Microbiology 152:979–987.  124. Hill, D. R., T. W. Keenan, R. F. Helm, M. Potts, L. M. Crowe, and J. H. Crowe. 1997. Extracellular polysaccharide of Nostoc commune (Cyanobacteria) inhibits fusion of membrane vesicles during desiccation. J. Appl. Phycol. 9:237–248.  125. Hill, D. R., A. Peat, and M. Potts. 1994. Biochemistry and structure of the glycan secreted by desiccation-tolerant Nostoc commune (Cyanobacteria). Protoplasma 182:126–148.  126. Hiramatsu, R., M. Matsumoto, K. Sakae, and Y. Miyazaki. 2005. Ability of Shiga toxin-producing Escherichia coli and Salmonella spp. to survive in a desiccation model system and in dry foods. Appl. Environ. Microbiol. 71:6657–6663.  127. Hochgräfe, F., J. Mostertz, D. Albrecht, and M. Hecker. 2005. Fluorescence thiol modification assay: oxidatively modified proteins in Bacillus subtilis. Mol. Microbiol. 58:409–425.  128. Hong, Y., G. Wang, and R. J. Maier. 2006. Helicobacter hepaticus Dps protein plays an important role in protecting DNA from oxidative damage. Free Radic. Res. 40:597–605.  129. Hooper, K., and T. A. McDonald. 2000. The PBDEs: an emerging environmental challenge and another reason for breast-milk monitoring programs. Environ. Health Perspect. 108:387–392.  130. Hümpel, A., S. Gebhard, G. M. Cook, and M. Berney. 2010. The SigF regulon in Mycobacterium smegmatis reveals roles in adaptation to stationary phase, heat, and oxidative stress. J. Bacteriol. 192:2491–2502.   96 131. Hutzinger, O., S. Safe, and V. Zitko. 1974. The chemistry of PCB's. CRC Press, Cleveland, OH.  132. Ilari, A., S. Stefanini, E. Chiancone, and D. Tsernoglou. 2000. The dodecameric ferritin from Listeria innocua contains a novel intersubunit iron-binding site. Nat. Struct. Biol. 7:38–43.  133. Imlay, J. A. 2008. Cellular defenses against superoxide and hydrogen peroxide. Annu. Rev. Biochem. 77:755–776.  134. Ishikawa, T., Y. Mizunoe, S.-i. Kawabata, A. Takade, M. Harada, S. N. Wai, and S.-i. Yoshida. 2003. The iron-binding protein Dps confers hydrogen peroxide stress resistance to Campylobacter jejuni. J. Bacteriol. 185:1010–1017.  135. Iwasaki, T., K. Miyauchi, E. Masai, and M. Fukuda. 2006. Multiple-subunit genes of the aromatic-ring-hydroxylating dioxygenase play an active role in biphenyl and polychlorinated biphenyl degradation in Rhodococcus sp. strain RHA1. Appl. Environ. Microbiol. 72:5396–5402.  136. Janning, B., P. H. In't Veld, S. Notermans, and J. Krämer. 1994. Resistance of bacterial strains to dry conditions: use of anhydrous silica gel in a desiccation model system. J. Appl. Bacteriol. 77:319–324.  137. Jeong, K. C., K. F. Hung, D. J. Baumler, J. J. Byrd, and C. W. Kaspar. 2008. Acid stress damage of DNA is prevented by Dps binding in Escherichia coli O157:H7. BMC Microbiol. 8:181.  138. Jernelöv, A. 2010. How to defend against future oil spills. Nature 466:182–183.  139. Jernelöv, A. 2010. The threats from oil spills: now, then, and in the future. Ambio 39:353–366.  140. Jones, A. L., J. Davies, M. Fukuda, R. Brown, J. Lim, and M. Goodfellow. 2013. Rhodococcus jostii: a home for Rhodococcus strain RHA1. Antonie Van Leeuwenhoek 104:435–440.  141. Katoh, H., R. K. Asthana, and M. Ohmori. 2004. Gene expression in the cyanobacterium Anabaena sp PCC7120 under desiccation. Microb. Ecol. 47:164–174.  142. Kauko, A., A. T. Pulliainen, S. Haataja, W. Meyer-Klaucke, J. Finne, and A. C. Papageorgiou. 2006. Iron incorporation in Streptococcus suis Dps-like peroxide resistance protein Dpr requires mobility in the ferroxidase center and leads to the formation of a ferrihydrite-like core. J. Mol. Biol. 364:97–109.  143. Kazda, J. 2000. The ecology of mycobacteria. Kluwer Academic Publishers, Norwell, MA.   97 144. Keer, J., M. J. Smeulders, K. M. Gray, and H. D. Williams. 2000. Mutants of Mycobacterium smegmatis impaired in stationary-phase survival. Microbiology 146:2209–2217.  145. Keer, J., M. J. Smeulders, and H. D. Williams. 2001. A purF mutant of Mycobacterium smegmatis has impaired survival during oxygen-starved stationary phase. Microbiology 147:473–481.  146. Keyer, K., and J. A. Imlay. 1996. Superoxide accelerates DNA damage by elevating free-iron levels. Proc. Natl. Acad. Sci. USA 93:13635–13640.  147. Kim, J., S. H. Yoshimura, K. Hizume, R. L. Ohniwa, A. Ishihama, and K. Takeyasu. 2004. Fundamental structural units of the Escherichia coli nucleoid revealed by atomic force microscopy. Nucleic Acids Res. 32:1982–1992.  148. Kim, S.-G., G. Bhattacharyya, A. Grove, and Y.-H. Lee. 2006. Crystal structure of Dps-1, a functionally distinct Dps protein from Deinococcus radiodurans. J. Mol. Biol. 361:105–114.  149. Kjelleberg, S., M. Hermansson, P. Mårdén, and G. W. Jones. 1987. The transient phase between growth and nongrowth of heterotrophic bacteria, with emphasis on the marine environment. Annu. Rev. Microbiol. 41:25–49.  150. Kostka, J. E., O. Prakash, W. A. Overholt, S. J. Green, G. Freyer, A. Canion, J. Delgardio, N. Norton, T. C. Hazen, and M. Huettel. 2011. Hydrocarbon-degrading bacteria and the bacterial community response in Gulf of Mexico beach sands impacted by the Deepwater Horizon oil spill. Appl. Environ. Microbiol. 77:7962–7974.  151. Kulakov, L. A., and M. J. Larkin. 2002. Genetic organization of Rhodococcus, p. 15–46. In A. Danchin (ed.), Genomics of GC-rich Gram-positive bacteria. Caister Academic Press, Wymondham, United Kingdom.  152. Lacqua, A., O. Wanner, T. Colangelo, M. G. Martinotti, and P. Landini. 2006. Emergence of biofilm-forming subpopulations upon exposure of Escherichia coli to environmental bacteriophages. Appl. Environ. Microbiol. 72:956–959.  153. Lamont, E. A., J. P. Bannantine, A. Armién, D. S. Ariyakumar, and S. Sreevatsan. 2012. Identification and characterization of a spore-like morphotype in chronically starved Mycobacterium avium subsp. paratuberculosis cultures. PLoS One 7:e30648.  154. Lechevalier, H. A. 1989. Nocardioform actionomycetes, p. 2348–2350. In S. T. Williams, M. E. Sharpe, and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 4. Williams and Wilkins, Baltimore, MD.  155. Lee, E.-J., N. Karoonuthaisiri, H.-S. Kim, J.-H. Park, C.-J. Cha, C. M. Kao, and J.-H. Roe. 2005. A master regulator σB governs osmotic and oxidative response as well as differentiation via a network of sigma factors in Streptomyces coelicolor. Mol. Microbiol. 57:1252–1264.  98 156. Lee, J.-W., and J. D. Helmann. 2007. Functional specialization within the Fur family of metalloregulators. Biometals 20:485–499.  157. Lee, K. J., and Y. T. Rho. 1993. Characteristics of spores formed by surface and submerged cultures of Streptomyces albidoflavus SMF301. J. Gen. Microbiol. 139:3131–3137.  158. Lendvay, J. M., F. E. Löffler, M. Dollhopf, M. R. Aiello, G. Daniels, B. Z. Fathepure, M. Gebhard, R. Heine, R. Helton, J. Shi, R. Krajmalnik-Brown, C. L. Major, M. J. Barcelona, E. Petrovskis, R. Hickey, J. M. Tiedje, and P. Adriaens. 2003. Bioreactive barriers: a comparison of bioaugmentation and biostimulation for chlorinated solvent remediation. Environ. Sci. Technol. 37:1422–1431.  159. Leong, L. M., B. H. Tan, and K. K. Ho. 1992. A specific stain for the detection of nonheme iron proteins in polyacrylamide gels. Anal. Biochem. 207:317–320.  160. Li, H., A. K. Singh, L. M. McIntyre, and L. A. Sherman. 2004. Differential gene expression in response to hydrogen peroxide and the putative PerR regulon of Synechocystis sp. strain PCC 6803. J. Bacteriol. 186:3331–3345.  161. Li, X., U. Pal, N. Ramamoorthi, X. Liu, D. C. Desrosiers, C. H. Eggers, J. F. Anderson, J. D. Radolf, and E. Fikrig. 2007. The Lyme disease agent Borrelia burgdorferi requires BB0690, a Dps homologue, to persist within ticks. Mol. Microbiol. 63:694–710.  162. Lichtenstein, E. P., K. R. Schulz, T. W. Fuhremann, and T. T. Liang. 1969. Biological interaction between plasticizers and insecticides. J. Econ. Entomol. 62:761–765.  163. Lindow, S. E., and M. T. Brandl. 2003. Microbiology of the phyllosphere. Appl. Environ. Microbiol. 69:1875–1883.  164. Liochev, S. I., and I. Fridovich. 1994. The role of O2• – in the production of HO: in vitro and in vivo. Free Radic. Biol. Med. 16:29–33.  165. Lonetto, M., M. Gribskov, and C. A. Gross. 1992. The σ70 family: sequence conservation and evolutionary relationships. J. Bacteriol. 174:3843–3849.  166. Loprasert, S., W. Whangsuk, R. Sallabhan, and S. Mongkolsuk. 2004. DpsA protects the human pathogen Burkholderia pseudomallei against organic hydroperoxide. Arch. Microbiol. 182:96–101.  167. Lüttge, U. 1997. Cyanobacterial tintenstrich communities and their ecology. Naturwissenschaften 84:526–534.  168. Madigan, M. T., and J. M. Martinko. 2006. Brock biology of microorganisms, 11th ed. Pearson Prentice Hall, Upper Saddle River, NJ.   99 169. Malone, A. S., Y.-K. Chung, and A. E. Yousef. 2006. Genes of Escherichia coli O157:H7 that are involved in high-pressure resistance. Appl. Environ. Microbiol. 72:2661–2671.  170. Maron, P.-A., C. Mougel, and L. Ranjard. 2011. Soil microbial diversity: methodological strategy, spatial overview and functional interest. C. R. Biol. 334:403–411.  171. Martinez, A., and R. Kolter. 1997. Protection of DNA during oxidative stress by the nonspecific DNA-binding protein Dps. J. Bacteriol. 179:5188–5194.  172. Masai, E., A. Yamada, J. M. Healy, T. Hatta, K. Kimbara, M. Fukuda, and K. Yano. 1995. Characterization of biphenyl catabolic genes of gram-positive polychlorinated biphenyl degrader Rhodococcus sp. strain RHA1. Appl. Environ. Microbiol. 61:2079–2085.  173. Masliyah, J., Z. J. Zhou, Z. Xu, J. Czarnecki, and H. Hamza. 2004. Understanding water-based bitumen extraction from Athabasca oil sands. Can. J. Chem. Eng. 82:628–654.  174. Mason, A. C., and T. Egli. 1993. Dynamics of microbial growth in the decelerating and stationary phase of batch culture, p. 81–102. In S. Kjelleberg (ed.), Starvation in bacteria. Plenum Press, New York, NY.  175. Mattimore, V., and J. R. Battista. 1996. Radioresistance of Deinococcus radiodurans: functions necessary to survive ionizing radiation are also necessary to survive prolonged desiccation. J. Bacteriol. 178:633–637.  176. Mazor, G., G. J. Kidron, A. Vonshak, and A. Abeliovich. 1996. The role of cyanobacterial exopolysaccharides in structuring desert microbial crusts. FEMS Microbiol. Ecol. 21:121–130.  177. McAneney, K. J., R. F. Harris, and W. R. Gardner. 1982. Bacterial water relations using polyethylene glycol 4000. Soil Sci. Soc. Am. J. 46:542–547.  178. McBride, M. J., and J. C. Ensign. 1987. Effects of intracellular trehalose content on Streptomyces griseus spores. J. Bacteriol. 169:4995–5001.  179. McLeod, M. P., R. L. Warren, W. W. L. Hsiao, N. Araki, M. Myhre, C. Fernandes, D. Miyazawa, W. Wong, A. L. Lillquist, D. Wang, M. Dosanjh, H. Hara, A. Petrescu, R. D. Morin, G. Yang, J. M. Stott, J. E. Schein, H. Shin, D. Smailus, A. S. Siddiqui, M. A. Marra, S. J. M. Jones, R. Holt, F. S. L. Brinkman, K. Miyauchi, M. Fukuda, J. E. Davies, W. W. Mohn, and L. D. Eltis. 2006. The complete genome of Rhodococcus sp. RHA1 provides insights into a catabolic powerhouse. Proc. Natl. Acad. Sci. USA 103:15582–15587.  180. Mecsas, J., R. Welch, J. W. Erickson, and C. A. Gross. 1995. Identification and characterization of an outer membrane protein, OmpX, in Escherichia coli that is  100 homologous to a family of outer membrane proteins including Ail of Yersinia enterocolitica. J. Bacteriol. 177:799–804.  181. Meiklejohn, J. 1957. Numbers of bacteria and actinomycetes in a Kenya soil. Eur. J. Soil Sci. 8:240–247.  182. Meironyté, D., K. Norén, and Å. Bergman. 1999. Analysis of polybrominated diphenyl ethers in Swedish human milk. A time-related trend study, 1972–1997. J. Toxicol. Environ. Health Part A 58:329–341.  183. Merrick, M. J. 1993. In a class of its own — the RNA polymerase sigma factor σ54 (σN). Mol. Microbiol. 10:903–909.  184. Michán, C., M. Manchado, G. Dorado, and C. Pueyo. 1999. In vivo transcription of the Escherichia coli oxyR regulon as a function of growth phase and in response to oxidative stress. J. Bacteriol. 181:2759–2764.  185. Mille, Y., L. Beney, and P. Gervais. 2003. Magnitude and kinetics of rehydration influence the viability of dehydrated E. coli K-12. Biotechnol. Bioeng. 83:578–582.  186. Mitch, W. A., J. O. Sharp, R. R. Trussell, R. L. Valentine, L. Alvarez-Cohen, and D. L. Sedlak. 2003. N-Nitrosodimethylamine (NDMA) as a drinking water contaminant: a review. Environ. Eng. Sci. 20:389–404.  187. Mongkolsuk, S., and J. D. Helmann. 2002. Regulation of inducible peroxide stress responses. Mol. Microbiol. 45:9–15.  188. Morita, R. Y. 1986. Autecological studies and marine ecosystems, p. 147–181. In R. L. Tate III (ed.), Microbial autecology: a method for environmental studies. John Wiley & Sons, New York, NY.  189. Mukherjee, R., and D. Chatterji. 2005. Evaluation of the role of sigma B in Mycobacterium smegmatis. Biochem. Biophys. Res. Commun. 338:964–972.  190. Nair, S., and S. E. Finkel. 2004. Dps protects cells against multiple stresses during stationary phase. J. Bacteriol. 186:4192–4198.  191. Namavar, F., M. Sparrius, E. C. I. Veerman, B. J. Appelmelk, and C. M. J. E. Vandenbroucke-Grauls. 1998. Neutrophil-activating protein mediates adhesion of Helicobacter pylori to sulfated carbohydrates on high-molecular-weight salivary mucin. Infect. Immun. 66:444–447.  192. Navarro-Llorens, J. M., M. A. Patrauchan, G. R. Stewart, J. E. Davies, L. D. Eltis, and W. W. Mohn. 2005. Phenylacetate catabolism in Rhodococcus sp. strain RHA1: a central pathway for degradation of aromatic compounds. J. Bacteriol. 187:4497–4504.  193. Newton, G. L., K. Arnold, M. S. Price, C. Sherrill, S. B. Delcardayre, Y. Aharonowitz, G. Cohen, J. Davies, R. C. Fahey, and C. Davis. 1996. Distribution of  101 thiols in microorganisms: mycothiol is a major thiol in most actinomycetes. J. Bacteriol. 178:1990–1995.  194. Newton, G. L., and R. C. Fahey. 2002. Mycothiol biochemistry. Arch. Microbiol. 178:388–394.  195. Nguyen, H. H., C. B. de la Tour, M. Toueille, F. Vannier, S. Sommer, and P. Servant. 2009. The essential histone-like protein HU plays a major role in Deinococcus radiodurans nucleoid compaction. Mol. Microbiol. 73:240–252.  196. Nyström, T. 2004. Stationary-phase physiology. Annu. Rev. Microbiol. 58:161–181.  197. Okamoto, S. 2010. Characterization of a novel cobaltoenzyme and its metallochaperone in Rhodococcus. Ph.D. thesis. University of British Columbia, Vancouver, Canada.  198. Okamoto, S., and L. D. Eltis. 2007. Purification and characterization of a novel nitrile hydratase from Rhodococcus sp. RHA1. Mol. Microbiol. 65:828–838.  199. Olsen, K. N., M. H. Larsen, C. G. M. Gahan, B. Kallipolitis, X. A. Wolf, R. Rea, C. Hill, and H. Ingmer. 2005. The Dps-like protein Fri of Listeria monocytogenes promotes stress tolerance and intracellular multiplication in macrophage-like cells. Microbiology 151:925–933.  200. Österberg, S., T. d. Peso-Santos, and V. Shingler. 2011. Regulation of alternative sigma factor use. Annu. Rev. Microbiol. 65:37–55.  201. Pacello, F., P. Ceci, S. Ammendola, P. Pasquali, E. Chiancone, and A. Battistoni. 2008. Periplasmic Cu,Zn superoxide dismutase and cytoplasmic Dps concur in protecting Salmonella enterica serovar Typhimurium from extracellular reactive oxygen species. Biochim. Biophys. Acta 1780:226–232.  202. Park, M., S. T. Yun, S.-Y. Hwang, C.-I. Chun, and T. I. Ahn. 2006. The dps gene of symbiotic “Candidatus Legionella jeonii” in Amoeba proteus responds to hydrogen peroxide and phagocytosis. J. Bacteriol. 188:7572–7580.  203. Patel, M. P., and J. S. Blanchard. 1999. Expression, purification, and characterization of Mycobacterium tuberculosis mycothione reductase. Biochemistry 38:11827–11833.  204. Patrauchan, M. A., C. Florizone, M. Dosanjh, W. W. Mohn, J. Davies, and L. D. Eltis. 2005. Catabolism of benzoate and phthalate in Rhodococcus sp. strain RHA1: redundancies and convergence. J. Bacteriol. 187:4050–4063.  205. Patrauchan, M. A., C. Florizone, S. Eapen, L. Gómez-Gil, B. Sethuraman, M. Fukuda, J. Davies, W. W. Mohn, and L. D. Eltis. 2008. Roles of ring-hydroxylating dioxygenases in styrene and benzene catabolism in Rhodococcus jostii RHA1. J. Bacteriol. 190:37–47.   102 206. Patrauchan, M. A., D. Miyazawa, J. C. LeBlanc, C. Aiga, C. Florizone, M. Dosanjh, J. Davies, L. D. Eltis, and W. W. Mohn. 2012. Proteomic analysis of survival of Rhodococcus jostii RHA1 during carbon starvation. Appl. Environ. Microbiol. 78:6714–6725.  207. Pentecost, A. 1985. Relationships between light, temperature and photosynthesis in a temperate Microcoleus (cyanobacterium) mat. Microbios 43:141–148.  208. Philippis, R., and M. Vincenzini. 1998. Exocellular polysaccharides from cyanobacteria and their possible applications. FEMS Microbiol. Rev. 22:151–175.  209. Philp, J. C., S. M. Bamforth, I. Singleton, and R. M. Atlas. 2005. Environmental pollution and restoration: a role for bioremediation. In R. M. Atlas and J. C. Philp (ed.), Bioremediation: applied microbial solutions for real-world environmental cleanup. ASM Press, Washington, DC.  210. Pollak, P., G. Romeder, F. Hagedorn, and H.-P. Gelbke. 2000. Nitriles. doi:10.1002/14356007.a17_363. In F. Ullmann (ed.), Ullmann's encyclopedia of industrial chemistry. Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, Germany.  211. Potts, M. 1994. Desiccation tolerance of prokaryotes. Microbiol. Rev. 58:755–805.  212. Potts, M. 1999. Mechanisms of desiccation tolerance in cyanobacteria. Eur. J. Phycol. 34:319–328.  213. Pritchard, P. H., J. G. Mueller, J. C. Rogers, F. V. Kremer, and J. A. Glaser. 1992. Oil spill bioremediation: experiences, lessons and results from the Exxon Valdez oil spill in Alaska. Biodegradation 3:315–335.  214. Provvedi, R., D. Kocíncová, V. Donà, D. Euphrasie, M. Daffé, G. Etienne, R. Manganelli, and J.-M. Reyrat. 2008. SigF controls carotenoid pigment production and affects transformation efficiency and hydrogen peroxide sensitivity in Mycobacterium smegmatis. J. Bacteriol. 190:7859–7863.  215. Pucci, O. H., M. A. Bak, S. R. Peressutti, I. Klein, C. Härtig, H. M. Alvarez, and L. Wünsche. 2000. Influence of crude oil contamination on the bacterial community of semiarid soils of Patagonia (Argentina). Acta Biotechnol. 20:129–146.  216. Pulliainen, A. T., S. Haataja, S. Kähkönen, and J. Finne. 2003. Molecular basis of H2O2 resistance mediated by streptococcal Dpr: demonstration of the functional involvement of the putative ferroxidase center by site-directed mutagenesis in Streptococcus suis. J. Biol. Chem. 278:7996–8005.  217. Quintela, J. C., M. Caparrós, and M. A. de Pedro. 1995. Variability of peptidoglycan structural parameters in Gram-negative bacteria. FEMS Microbiol. Lett. 125:95–100.   103 218. Radajewski, S., and T. Duxbury. 2001. Motility responses and desiccation survival of zoospores from the actinomycete Kineosporia sp. strain SR11. Microb. Ecol. 41:233–244.  219. Ramsay, B., B. Wiedenheft, M. Allen, G. H. Gauss, C. Martin Lawrence, M. Young, and T. Douglas. 2006. Dps-like protein from the hyperthermophilic archaeon Pyrococcus furiosus. J. Inorg. Biochem. 100:1061–1068.  220. Reindel, S., S. Anemüller, A. Sawaryn, and B. F. Matzanke. 2002. The DpsA-homologue of the archaeon Halobacterium salinarum is a ferritin. Biochim. Biophys. Acta 1598:140–146.  221. Ren, B., G. Tibbelin, T. Kajino, O. Asami, and R. Ladenstein. 2003. The multi-layered structure of Dps with a novel di-nuclear ferroxidase center. J. Mol. Biol. 329:467–477.  222. Reon, B. J., K. H. Nguyen, G. Bhattacharyya, and A. Grove. 2012. Functional comparison of Deinococcus radiodurans Dps proteins suggests distinct in vivo roles. Biochem. J. 447:381–391.  223. Riley, P. A. 1994. Free radicals in biology: oxidative stress and the effects of ionizing radiation. Int. J. Radiat. Biol. 65:27–33.  224. Robrock, K. R., M. Coelhan, D. L. Sedlak, and L. Alvarez-Cohen. 2009. Aerobic biotransformation of polybrominated diphenyl ethers (PBDEs) by bacterial isolates. Environ. Sci. Technol. 43:5705–5711.  225. Robrock, K. R., W. W. Mohn, L. D. Eltis, and L. Alvarez-Cohen. 2011. Biphenyl and ethylbenzene dioxygenases of Rhodococcus jostii RHA1 transform PBDEs. Biotechnol. Bioeng. 108:313–321.  226. Roy, S., R. Saraswathi, D. Chatterji, and M. Vijayan. 2008. Structural studies on the second Mycobacterium smegmatis Dps: invariant and variable features of structure, assembly and function. J. Mol. Biol. 375:948–959.  227. Roy, S., R. Saraswathi, S. Gupta, K. Sekar, D. Chatterji, and M. Vijayan. 2007. Role of N and C-terminal tails in DNA binding and assembly in Dps: structural studies of Mycobacterium smegmatis Dps deletion mutants. J. Mol. Biol. 370:752–767.  228. Safe, S. 1989. Polychlorinated biphenyls (PCBs): mutagenicity and carcinogenicity. Mutat. Res. 220:31–47.  229. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.  230. Saumaa, S., A. Tover, M. Tark, R. Tegova, and M. Kivisaar. 2007. Oxidative DNA damage defense systems in avoidance of stationary-phase mutagenesis in Pseudomonas putida. J. Bacteriol. 189:5504–5514.  104 231. Schaal, K. P. 1983. Laboratory diagnosis of actinomycete diseases, p. 425–456. In M. Goodfellow, M. Mordarski, and S. T. Williams (ed.), The biology of the actinomycetes. Academic Press, Inc., London, England.  232. Schäfer, A., A. Tauch, W. Jäger, J. Kalinowski, G. Thierbach, and A. Pühler. 1994. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145:69–73.  233. Scott, T., and M. Eagleson. 1988. Concise encyclopedia: biochemistry, 2nd ed. Walter de Gruyter, New York, NY.  234. Sen, A., K. Dwivedi, K. A. Rice, and G. S. Bullerjahn. 2000. Growth phase and metal-dependent regulation of the dpsA gene in Synechococcus sp. strain PCC 7942. Arch. Microbiol. 173:352–357.  235. Seto, M., K. Kimbara, M. Shimura, T. Hatta, M. Fukuda, and K. Yano. 1995. A novel transformation of polychlorinated biphenyls by Rhodococcus sp. strain RHA1. Appl. Environ. Microbiol. 61:3353–3358.  236. Seto, M., E. Masai, M. Ida, T. Hatta, K. Kimbara, M. Fukuda, and K. Yano. 1995. Multiple polychlorinated biphenyl transformation systems in the gram-positive bacterium Rhodococcus sp. strain RHA1. Appl. Environ. Microbiol. 61:4510–4513.  237. Sharp, J. O., C. M. Sales, J. C. LeBlanc, J. Liu, T. K. Wood, L. D. Eltis, W. W. Mohn, and L. Alvarez-Cohen. 2007. An inducible propane monooxygenase is responsible for N-nitrosodimethylamine degradation by Rhodococcus sp. RHA1. Appl. Environ. Microbiol. 73:6930–6938.  238. Simon, R., U. Priefer, and A. Pühler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Bio/technology 1:784–791.  239. Smeulders, M. J., J. Keer, R. A. Speight, and H. D. Williams. 1999. Adaptation of Mycobacterium smegmatis to stationary phase. J. Bacteriol. 181:270–283.  240. Smith, J. L. 2004. The physiological role of ferritin-like compounds in bacteria. Crit. Rev. Microbiol. 30:173–185.  241. Smith, P. K., R. I. Krohn, G. T. Hermanson, A. K. Mallia, F. H. Gartner, M. D. Provenzano, E. K. Fujimoto, N. M. Goeke, B. J. Olson, and D. C. Klenk. 1985. Measurement of protein using bicinchoninic acid. Anal. Biochem. 150:76–85.  242. Snyder, L., and W. Champness. 2007. Molecular genetics of bacteria, 3rd ed. ASM Press, Washington, DC.  243. St. John, A. C., and J. C. Ensign. 1976. Macromolecular synthesis and cell division during morphogenesis of Arthrobacter crystallopoietes. Arch. Microbiol. 111:51–58.  105 244. Stillman, T. J., M. Upadhyay, V. A. Norte, S. E. Sedelnikova, M. Carradus, S. Tzokov, P. A. Bullough, C. A. Shearman, M. J. Gasson, C. H. Williams, P. J. Artymiuk, and J. Green. 2005. The crystal structures of Lactococcus lactis MG1363 Dps proteins reveal the presence of an N-terminal helix that is required for DNA binding. Mol. Microbiol. 57:1101–1112.  245. Stohs, S. J., and D. Bagchi. 1995. Oxidative mechanisms in the toxicity of metal ions. Free Radic. Biol. Med. 18:321–336.  246. Stratton, H. M., R. J. Seviour, and J. A. Soddell. 1993. Effect of culture conditions on cell surface hydrophobicity of nocardioforms. Actinomycetes 4:41–46.  247. Streeter, J. G. 2003. Effect of trehalose on survival of Bradyrhizobium japonicum during desiccation. J. Appl. Microbiol. 95:484–491.  248. Studholme, D. J., and R. Dixon. 2003. Domain architectures of σ54-dependent transcriptional activators. J. Bacteriol. 185:1757–1767.  249. Su, M., S. Cavallo, S. Stefanini, E. Chiancone, and N. D. Chasteen. 2005. The so-called Listeria innocua ferritin is a Dps protein. Iron incorporation, detoxification, and DNA protection properties. Biochemistry 44:5572–5578.  250. Sureka, K., S. Dey, P. Datta, A. K. Singh, A. Dasgupta, S. Rodrigue, J. Basu, and M. Kundu. 2007. Polyphosphate kinase is involved in stress-induced mprAB-sigE-rel signalling in mycobacteria. Mol. Microbiol. 65:261-276.  251. Sze, C. C., and V. Shingler. 1999. The alarmone (p)ppGpp mediates physiological-responsive control at the σ54-dependent Po promoter. Mol. Microbiol. 31:1217–1228.  252. Tanaka, M., A. M. Earl, H. A. Howell, M.-J. Park, J. A. Eisen, S. N. Peterson, and J. R. Battista. 2004. Analysis of Deinococcus radiodurans's transcriptional response to ionizing radiation and desiccation reveals novel proteins that contribute to extreme radioresistance. Genetics 168:21–33.  253. Thatcher, J. W., J. M. Shaw, and W. J. Dickinson. 1998. Marginal fitness contributions of nonessential genes in yeast. Proc. Natl. Acad. Sci. USA 95:253–257.  254. Theoret, J. R., K. K. Cooper, R. D. Glock, and L. A. Joens. 2011. A Campylobacter jejuni Dps homolog has a role in intracellular survival and in the development of campylobacterosis in neonate piglets. Foodborne Pathog. Dis. 8:1263–1268.  255. Thieme, D., and G. Grass. 2010. The Dps protein of Escherichia coli is involved in copper homeostasis. Microbiol. Res. 165:108–115.  256. Traag, B. A., A. Driks, P. Stragier, W. Bitter, G. Broussard, G. Hatfull, F. Chu, K. N. Adams, L. Ramakrishnan, and R. Losick. 2010. Do mycobacteria produce endospores? Proc. Natl. Acad. Sci. USA 107:878–881.   106 257. Tseng, G. C., M.-K. Oh, L. Rohlin, J. C. Liao, and W. H. Wong. 2001. Issues in cDNA microarray analysis: quality filtering, channel normalization, models of variations and assessment of gene effects. Nucl. Acids Res. 29:2549–2557.  258. Tsou, C.-C., C. Chiang-Ni, Y.-S. Lin, W.-J. Chuang, M.-T. Lin, C.-C. Liu, and J.-J. Wu. 2008. An iron-binding protein, Dpr, decreases hydrogen peroxide stress and protects Streptococcus pyogenes against multiple stresses. Infect. Immun. 76:4038–4045.  259. Tu, W. Y., S. Pohl, K. Gizynski, and C. R. Harwood. 2012. The iron-binding protein Dps2 confers peroxide stress resistance on Bacillus anthracis. J. Bacteriol. 194:925–931.  260. Tyagi, M., M. da Fonseca, and C. de Carvalho. 2011. Bioaugmentation and biostimulation strategies to improve the effectiveness of bioremediation processes. Biodegradation 22:231–241.  261. U.S. Environmental Protection Agency. 2012. 2012 edition of the drinking water standards and health advisories. U.S. Environmental Protection Agency, Washington, DC. EPA 822-S-12-001.  262. Ueshima, J., M. Shoji, D. B. Ratnayake, K. Abe, S. Yoshida, K. Yamamoto, and K. Nakayama. 2003. Purification, gene cloning, gene expression, and mutants of Dps from the obligate anaerobe Porphyromonas gingivalis. Infect. Immun. 71:1170–1178.  263. van der Geize, R., and L. Dijkhuizen. 2004. Harnessing the catabolic diversity of rhodococci for environmental and biotechnological applications. Curr. Opin. Microbiol. 7:255–261.  264. van der Geize, R., G. I. Hessels, R. van Gerwen, P. van der Meijden, and L. Dijkhuizen. 2001. Unmarked gene deletion mutagenesis of kstD, encoding 3-ketosteroid Δ1-dehydrogenase, in Rhodococcus erythropolis SQ1 using sacB as counter-selectable marker. FEMS Microbiol. Lett. 205:197–202.  265. van der Geize, R., K. Yam, T. Heuser, M. H. Wilbrink, H. Hara, M. C. Anderton, E. Sim, L. Dijkhuizen, J. E. Davies, W. W. Mohn, and L. D. Eltis. 2007. A gene cluster encoding cholesterol catabolism in a soil actinomycete provides insight into Mycobacterium tuberculosis survival in macrophages. Proc. Natl. Acad. Sci. USA 104:1947–1952.  266. van Doorn, W. G., F. Thiel, and A. Boekestein. 1990. Cryoscanning electron microscopy of a layer of extracellular polysaccharides produced by bacterial colonies. Scanning 12:297–299.  267. Van Hamme, J. D., A. Singh, and O. P. Ward. 2003. Recent advances in petroleum microbiology. Microbiol. Mol. Biol. Rev. 67:503–549.  268. Völker, U., B. Maul, and M. Hecker. 1999. Expression of the σB-dependent general stress regulon confers multiple stress resistance in Bacillus subtilis. J. Bacteriol. 181:3942–3948.  107 269. Waagmeester, A., J. Thompson, and J.-M. Reyrat. 2005. Identifying sigma factors in Mycobacterium smegmatis by comparative genomic analysis. Trends Microbiol. 13:505–509.  270. Walling, C. 1982. The nature of the primary oxidants in oxidations mediated by metal ions, p. 85–97. In T. E. King, H. S. Mason, and M. Morrison (ed.), Oxidases and related redox systems. Pergamon Press Canada Ltd., Willowdale, Canada.  271. Ward, C. M., Jr., and G. W. Claus. 1973. Gram characteristics and wall ultrastructure of Arthrobacter crystallopoietes during coccus-rod morphogenesis. J. Bacteriol. 114:378–389.  272. Warhurst, A. M., and C. A. Fewson. 1994. Biotransformations catalyzed by the genus Rhodococcus. Crit. Rev. Biotechnol. 14:29–73.  273. Warren, R., W. W. L. Hsiao, H. Kudo, M. Myhre, M. Dosanjh, A. Petrescu, H. Kobayashi, S. Shimizu, K. Miyauchi, E. Masai, G. Yang, J. M. Stott, J. E. Schein, H. Shin, J. Khattra, D. Smailus, Y. S. Butterfield, A. Siddiqui, R. Holt, M. A. Marra, S. J. M. Jones, W. W. Mohn, F. S. L. Brinkman, M. Fukuda, J. Davies, and L. D. Eltis. 2004. Functional characterization of a catabolic plasmid from polychlorinated-biphenyl-degrading Rhodococcus sp. strain RHA1. J. Bacteriol. 186:7783–7795.  274. Watson, N. 1988. A new revision of the sequence of plasmid pBR322. Gene 70:399–403.  275. Welsh, D. T. 2000. Ecological significance of compatible solute accumulation by micro-organisms: from single cells to global climate. FEMS Microbiol. Rev. 24:263–290.  276. Whyte, L. G., T. H. M. Smits, D. Labbé, B. Witholt, C. W. Greer, and J. B. van Beilen. 2002. Gene cloning and characterization of multiple alkane hydroxylase systems in Rhodococcus strains Q15 and NRRL B-16531. Appl. Environ. Microbiol. 68:5933–5942.  277. Wiedenheft, B., J. Mosolf, D. Willits, M. Yeager, K. A. Dryden, M. Young, and T. Douglas. 2005. An archaeal antioxidant: characterization of a Dps-like protein from Sulfolobus solfataricus. Proc. Natl. Acad. Sci. USA 102:10551–10556.  278. Wietzerbin, J., B. C. Das, J.-F. Petit, E. Lederer, M. Leyh-Bouille, and J.-M. Ghuysen. 1974. Occurrence of D-alanyl-(D)-meso-diaminopimelic acid and meso-diaminopimelyl-meso-diaminopimelic acid interpeptide linkages in the peptidoglycan of Mycobacteria. Biochemistry 13:3471–3476.  279. Willey, J. M., L. M. Sherwood, and C. J. Woolverton. 2008. Prescott, Harley, and Klein's microbiology, 7th ed. McGraw-Hill, New York, NY.  280. Williams, S. T., M. Shameemullah, E. T. Watson, and C. I. Mayfield. 1972. Studies of the ecology of actinomycetes in soil―VI. The influence of moisture tension on growth and survival. Soil Biol. Biochem. 4:215–225.  108 281. Wilson, E. O. 2002. The future of life. Random House of Canada Limited, Toronto, Canada.  282. Wolf, S. G., D. Frenkiel, T. Arad, S. E. Finkel, R. Kolter, and A. Minsky. 1999. DNA protection by stress-induced biocrystallization. Nature 400:83–85.  283. Wu, L., X.-m. Lin, and X.-x. Peng. 2009. From proteome to genome for functional characterization of pH-dependent outer membrane proteins in Escherichia coli. J. Proteome Res. 8:1059–1070.  284. Wu, Q.-l., D. Kong, K. Lam, and R. N. Husson. 1997. A mycobacterial extracytoplasmic function sigma factor involved in survival following stress. J. Bacteriol. 179:2922–2929.  285. Wu, W.-M., J. Carley, J. Luo, M. A. Ginder-Vogel, E. Cardenas, M. B. Leigh, C. Hwang, S. D. Kelly, C. Ruan, L. Wu, J. Van Nostrand, T. Gentry, K. Lowe, S. Carroll, W. Luo, M. W. Fields, B. Gu, D. Watson, K. M. Kemner, T. Marsh, J. Tiedje, J. Zhou, S. Fendorf, P. K. Kitanidis, P. M. Jardine, and C. S. Criddle. 2007. In situ bioreduction of uranium (VI) to submicromolar levels and reoxidation by dissolved oxygen. Environ. Sci. Technol. 41:5716–5723.  286. Xie, X., Y. Li, T. Zhang, and H. H. P. Fang. 2006. Bacterial survival in evaporating deposited droplets on a teflon-coated surface. Appl. Microbiol. Biotechnol. 73:703–712.  287. Yamamoto, Y., M. Higuchi, L. B. Poole, and Y. Kamio. 2000. Role of the dpr product in oxygen tolerance in Streptococcus mutans. J. Bacteriol. 182:3740–3747.  288. Yamamoto, Y., L. B. Poole, R. R. Hantgan, and Y. Kamio. 2002. An iron-binding protein, Dpr, from Streptococcus mutans prevents iron-dependent hydroxyl radical formation in vitro. J. Bacteriol. 184:2931–2939.  289. Yan, Z. Y., Z. J. Xu, G. Z. Xu, B. Tian, and Y. J. Hua. 2007. [Construction of a dps mutant and its functional analysis in Deinococcus radiodurans]. Wei Sheng Wu Xue Bao 47:610–615.  290. Yang, F.-L., A. M. Hassanbhai, H.-Y. Chen, Z.-Y. Huang, T.-L. Lin, S.-H. Wu, and B. Ho. 2011. Proteomannans in biofilm of Helicobacter pylori ATCC 43504. Helicobacter 16:89–98.  291. Yang, J.-N., C. Wang, C. Guo, X.-X. Peng, and H. Li. 2011. Outer membrane proteome and its regulation networks in response to glucose concentration changes in Escherichia coli. Mol. Biosyst. 7:3087–3093.  292. Yu, M.-j., J. Ren, Y.-l. Zeng, S.-n. Zhou, and Y.-j. Lu. 2009. The Legionella pneumophila Dps homolog is regulated by iron and involved in multiple stress tolerance. J. Basic Microbiol. 49:S79–S86.   109 293. Zahrt, T. C., J. Song, J. Siple, and V. Deretic. 2001. Mycobacterial FurA is a negative regulator of catalase–peroxidase gene katG. Mol. Microbiol. 39:1174–1185.  294. Zanotti, G., E. Papinutto, W. G. Dundon, R. Battistutta, M. Seveso, G. D. Giudice, R. Rappuoli, and C. Montecucco. 2002. Structure of the neutrophil-activating protein from Helicobacter pylori. J. Mol. Biol. 323:125–130.  295. Zeth, K., S. Offermann, L.-O. Essen, and D. Oesterhelt. 2004. Iron-oxo clusters biomineralizing on protein surfaces: structural analysis of Halobacterium salinarum DpsA in its low- and high-iron states. Proc. Natl. Acad. Sci. USA 101:13780–13785.  296. Zhao, G., F. Bou-Abdallah, P. Arosio, S. Levi, C. Janus-Chandler, and N. D. Chasteen. 2003. Multiple pathways for mineral core formation in mammalian apoferritin. The role of hydrogen peroxide. Biochemistry 42:3142–3150.  297. Zhao, G., P. Ceci, A. Ilari, L. Giangiacomo, T. M. Laue, E. Chiancone, and N. D. Chasteen. 2002. Iron and hydrogen peroxide detoxification properties of DNA-binding protein from starved cells: a ferritin-like DNA-binding protein of Escherichia coli. J. Biol. Chem. 277:27689–27696.  298. Zheng, W.-j., Y.-h. Hu, and L. Sun. 2011. The two Dps of Edwardsiella tarda are involved in resistance against oxidative stress and host infection. Fish Shellfish Immunol. 31:985–992.    110 Appendices  Appendix 1.  Differentially regulated genes from the desiccation and control transcriptomes  TABLE A.1.  Expression ratios of differentially regulated genes during the desiccation and control experiments  Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h                     Up-regulated genes during desiccation experiment only                     ro00013  Transposase 1.2 1.7 2.0 1.0 3.7 4.9 3.1  1.1 1.0 0.5 1.0 1.1 1.7 1.9 A X ro00088  Conserved hypothetical protein 1.0 0.9 1.6 1.6 2.4 2.5 2.7  1.2 1.0 1.1 1.1 1.2 1.5 1.5 A H ro00089  Hypothetical protein 0.6 1.6 2.1 2.6 8.2 11.2 8.8  0.9 1.5 1.9 3.1 2.4 2.5 2.3 A H ro00090  α,α-Trehalose-phosphate synthase (UDP-forming) 1.1 1.2 1.4 1.8 4.2 4.9 4.1  1.0 1.0 1.1 1.3 1.1 1.1 1.1 A  ro00098 sigF1 σ70 type, group 3 subdivision 1.3 2.0 2.9 3.4 6.9 6.8 8.9  1.7 1.8 2.0 2.0 1.7 1.7 1.9 A R ro00099  Antisigma factor, possible RsbW 1.2 1.6 1.5 1.5 3.4 2.9 3.3  2.3 1.8 1.4 1.5 1.3 1.1 1.3 A R ro00101 dps1 DNA protection during starvation protein 1.6 3.0 4.6 3.9 31.0 21.0 34.9  5.6 3.3 3.8 2.6 2.2 1.6 1.8 A  ro00102  Conserved hypothetical protein 1.5 1.9 5.0 4.1 19.5 15.0 16.9  3.6 2.9 3.9 3.1 2.8 1.7 1.7 A H ro00103 | ro08731  Conserved hypothetical protein | possible transglycosylase 1.4 2.1 3.2 3.2 9.1 11.0 11.8  2.6 1.9 2.2 1.9 1.7 1.4 1.7 A H ro00105  Conserved hypothetical protein 2.0 2.4 2.7 1.9 31.6 25.4 31.3  7.8 3.2 2.6 2.3 1.4 1.1 1.2 A H ro00141  Nonribosomal peptide synthetase 1.3 1.3 2.2 2.5 2.4 2.6 3.4  1.2 1.0 1.3 1.7 1.9 1.3 1.0 B  ro00143  Conserved hypothetical protein 1.2 2.1 3.1 2.5 5.1 3.9 4.2  1.6 2.4 2.7 2.5 2.5 1.7 1.6 A H ro00167  Conserved hypothetical protein 1.2 1.7 2.5 2.5 4.1 3.8 6.6  1.2 1.0 1.5 1.9 1.2 1.8 1.9 A H ro00180  Conserved hypothetical protein 1.5 2.3 1.5 2.4 3.8 4.0 4.2  1.7 1.8 1.8 1.6 2.3 2.2 1.9 A H ro00238  Conserved hypothetical protein 1.1 0.9 1.1 1.0 12.7 11.5 12.3  1.6 1.5 1.5 1.3 1.3 1.6 1.7 A H ro00242  Possible 3-oxoacyl-(acyl carrier protein) reductase 1.3 4.7 1.9 2.2 2.7 3.8 2.8  1.7 1.3 2.3 1.7 1.9 1.0 2.1 A  ro00267  Conserved hypothetical protein 1.0 1.7 3.4 14.5 18.7 25.0 26.1  1.2 1.0 1.1 6.3 27.7 31.0 37.5 A H ro00279  Protein kinase 1.3 1.5 1.8 3.3 2.8 3.1 3.3  1.0 1.3 1.2 1.2 1.4 1.7 1.3 B  ro00325 adh1 Alcohol dehydrogenase 0.9 1.2 1.7 2.3 3.5 3.5 4.4  1.2 1.1 1.2 1.6 2.0 2.9 2.4 A   111 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro00354  Conserved hypothetical protein 1.0 1.1 0.9 0.9 2.3 2.5 2.5  1.1 1.2 0.9 1.2 1.3 1.5 1.3 A H ro00358  Phenylacetaldoxime dehydratase 1.1 1.8 2.0 2.5 2.0 1.9 2.3  0.7 0.7 0.8 1.2 1.2 1.4 1.3 B  ro00365 | ro00371  Possible hydrolase | probable hydrolase 1.2 3.3 3.1 2.3 6.0 7.6 5.7  0.7 1.1 0.9 0.8 0.8 1.6 1.5 A  ro00413  Probable formate dehydrogenase 1.5 2.1 1.8 2.1 6.5 7.2 5.8  1.2 1.0 1.1 1.0 1.1 1.2 2.2 A  ro00419  Possible enoyl-CoA hydratase 0.7 1.7 0.7 4.2 7.5 12.0 9.5  1.8 1.2 1.2 1.4 3.4 3.0 7.6 A L ro00420  Ring-hydroxylating dioxygenase α subunit 1.0 0.9 1.1 3.3 7.2 6.1 6.1  0.9 0.8 1.0 0.9 1.3 2.7 2.6 A  ro00422  Possible transcriptional regulator, TetR family 1.1 2.4 3.8 3.5 2.7 3.0 2.6  1.3 1.6 2.4 3.6 2.6 1.7 1.4 B R ro00441 prmA Propane monooxygenase hydroxylase large subunit 1.2 3.3 42.6 347.9 186.8 219.8 259.7  1.2 1.0 46.0 8.4 81.2 88.2 58.6 B  ro00443 prmC Monooxygenase hydroxylase 1.0 1.1 4.3 39.6 6.2 7.2 9.8  0.9 1.1 2.8 1.0 2.2 2.0 2.1 B  ro00444 prmD Possible monooxygenase component 0.7 0.7 4.0 54.8 8.4 12.0 15.4  1.3 1.0 7.7 0.7 3.2 4.1 4.3 B  ro00445  Conserved hypothetical protein 1.0 3.0 13.9 167.2 28.5 28.5 51.2  0.9 0.9 12.7 0.5 6.4 10.6 9.5 B H ro00446  Conserved hypothetical protein 1.2 1.6 3.8 60.3 8.9 5.5 17.3  0.9 1.0 3.6 0.6 1.3 3.1 4.1 B H ro00447 prmE Alcohol dehydrogenase 0.8 1.3 8.9 97.1 30.0 44.7 34.5  0.6 0.2 12.5 1.3 5.7 3.0 5.5 B  ro00448 groL1 60-kDa chaperonin GroEL 0.6 0.8 6.0 52.0 17.2 25.0 37.2  0.9 0.8 6.9 0.9 4.9 7.9 5.9 B  ro00452  Possible transcriptional regulator 1.8 2.9 7.2 13.1 5.3 4.6 5.7  0.7 1.1 4.4 1.4 3.2 4.4 3.0 B R ro00453  Hypothetical protein 1.5 0.7 6.5 33.9 13.7 12.4 18.3  1.6 0.7 4.8 2.5 5.1 15.5 17.0 B H ro00455  Conserved hypothetical protein 1.5 1.8 1.6 4.4 2.7 3.9 2.4  1.0 1.2 1.8 1.4 2.4 4.2 6.6 B H ro00560  Conserved hypothetical protein 1.4 1.7 1.3 2.4 7.7 5.6 7.7  2.6 1.5 1.8 1.5 2.8 2.9 2.8 A H ro00673 | ro06911 | ro08109 xerD Tyrosine recombinase | possible integrase/recombinase | probable integrase/recombinase 1.7 1.8 1.4 1.5 2.3 2.5 2.7  1.9 1.5 1.3 1.0 1.1 0.7 1.1 A  ro00806  Conserved hypothetical protein 0.9 2.6 1.5 2.5 8.6 23.8 19.9  1.1 1.0 1.0 0.9 1.2 1.9 2.8 A H ro00807  Probable transcriptional regulator, LysR family 0.8 0.7 0.7 0.9 3.0 3.4 3.9  0.9 0.9 0.9 0.9 0.8 1.0 1.4 A R ro00808  Probable 2-nitropropane dioxygenase 0.7 7.5 2.4 7.0 107.7 105.8 305.7  1.1 0.9 1.5 2.0 3.0 6.4 8.6 A  ro00841  Conserved hypothetical protein 1.3 2.0 2.0 1.9 1.8 1.4 2.1  1.0 0.9 1.0 1.1 1.0 0.5 0.5 C H  112 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro00847  Conserved hypothetical protein 1.1 1.7 1.9 2.9 2.5 2.1 3.0  1.2 1.6 1.7 1.2 1.3 1.2 1.0 B H ro00869  Possible transcriptional regulator 0.9 1.4 2.0 2.1 2.0 2.1 2.0  0.9 0.8 1.1 1.1 1.3 1.3 1.2 B R ro00887  Conserved hypothetical protein 1.2 0.9 0.8 1.0 2.9 2.8 2.9  1.6 1.2 1.0 1.3 1.2 0.8 0.9 A H ro00903  Possible transcriptional regulator, MerR family 0.9 1.6 3.8 5.6 4.2 3.7 3.8  0.3 0.8 2.0 2.5 4.0 1.8 0.9 B R ro00905  Possible transcriptional regulator 1.2 2.1 3.3 3.3 5.7 5.0 5.3  0.6 1.0 1.5 1.7 1.7 1.3 1.0 A R ro00906  Conserved hypothetical protein 0.9 1.8 2.5 2.5 4.6 4.1 5.0  0.6 0.7 1.0 1.0 0.5 1.0 0.9 A H ro00914  Probable AMP-dependent acyl-CoA synthetase 1.1 2.5 4.3 3.7 2.2 2.6 2.1  1.7 1.9 2.9 2.8 2.3 1.9 2.4 B L ro00915  Conserved hypothetical protein 2.1 2.3 5.5 4.9 3.2 3.4 3.3  1.6 3.5 7.2 5.5 3.5 2.8 3.1 B H ro00916  Short-chain dehydrogenase 2.4 3.5 4.9 6.5 6.4 6.6 5.2  1.4 1.0 3.1 2.0 1.0 1.0 1.5 B L ro00925  Pseudouridylate synthase ribosomal large subunit 1.2 1.1 1.3 1.4 3.1 2.7 3.1  1.1 1.6 1.0 1.1 1.2 1.2 1.3 A  ro00931  CTP synthase 1.2 1.8 2.9 1.8 1.9 2.3 2.1  0.4 0.6 1.0 1.3 1.5 0.8 0.7 B  ro00933  Conserved hypothetical protein 1.5 1.5 1.6 2.1 2.2 1.8 2.9  1.5 1.1 1.3 1.6 1.6 0.6 0.3 A H ro00944  ABC transporter, ATP-binding component 1.3 1.1 0.9 1.5 2.8 5.6 2.9  0.9 0.6 0.8 0.8 1.2 0.7 0.6 A T ro00945  ABC transporter, permease component 0.9 1.7 1.3 2.1 2.7 5.6 3.0  0.7 0.9 1.1 1.5 1.4 1.1 0.7 A T ro00961 rplT 50S ribosomal protein L20 0.9 0.8 1.2 1.7 3.9 3.9 4.3  0.5 0.5 0.9 1.5 2.0 1.6 1.2 A  ro00963 infC Translation initiation factor IF-3 0.7 0.7 1.6 3.3 5.7 4.8 5.6  0.6 0.8 1.9 2.8 5.1 4.1 2.7 A  ro00988  Transcriptional regulator, AraC family 1.0 1.3 1.3 1.7 3.5 4.6 3.3  1.0 1.0 1.1 1.1 1.3 1.2 1.4 A R ro00989  Thioredoxin 1.4 1.8 1.8 2.1 5.5 4.9 6.3  1.6 1.4 1.4 1.7 2.4 2.0 1.4 A  ro01022 hisF Imidazole glycerol phosphate synthase subunit 1.1 2.1 2.2 2.8 2.3 1.7 2.4  0.6 1.2 1.3 1.2 1.0 0.9 0.8 B  ro01031 hisD1 Histidinol dehydrogenase 1.0 2.8 2.0 2.2 2.8 2.9 2.6  0.7 0.9 1.4 1.1 1.5 1.1 1.1 B  ro01048 sdhB1 Succinate dehydrogenase FeS protein 1.5 2.5 3.3 3.2 2.4 2.2 2.8  1.6 2.8 3.3 4.1 3.1 1.1 0.7 B  ro01050  Possible succinate dehydrogenase 1.1 1.6 2.2 2.6 1.7 1.4 2.0  1.0 1.5 1.8 2.1 2.0 0.7 0.4 B  ro01051  Conserved hypothetical protein 1.1 1.7 2.0 2.3 3.0 2.6 3.4  1.0 1.2 2.0 2.0 2.1 1.0 0.6 A H ro01091  Phospho-N-acetylmuramoyl-pentapeptide-transferase 1.6 2.6 2.9 2.8 1.8 1.6 1.9  0.8 0.9 1.0 1.0 0.8 0.7 0.9 C L  113 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro01096 mraW S-Adenosyl-methyltransferase 1.1 2.2 3.7 4.7 0.8 0.7 0.7  0.7 1.0 1.8 2.2 2.1 0.9 0.5 C L ro01098  Conserved hypothetical protein 1.2 1.8 2.5 2.4 2.8 3.4 3.6  1.6 1.2 1.8 2.2 4.2 3.4 2.5 B H ro01111  Protein kinase 1.1 2.1 2.1 2.3 1.8 1.9 2.1  1.0 1.0 1.2 1.1 1.3 1.5 1.5 B  ro01140  Conserved hypothetical protein, HesB family 1.2 2.1 3.0 2.4 4.2 4.0 4.0  1.1 1.5 2.2 2.5 2.5 1.3 1.2 A H ro01155  Conserved hypothetical protein 1.3 2.2 2.3 2.1 1.7 1.7 2.3  0.8 0.9 1.0 0.9 0.9 0.7 0.8 C H ro01163  Probable ABC quaternary amine transporter, permease component 1.4 2.2 2.3 2.1 1.2 1.3 1.5  2.1 2.1 2.0 2.3 2.3 1.2 0.7 C T ro01172  Probable ribonuclease R 1.1 1.6 1.9 2.8 2.8 2.5 3.1  1.0 0.8 1.2 1.3 1.2 1.0 1.0 B  ro01247 hrcA Heat-inducible transcription repressor HrcA 1.1 1.4 1.5 2.3 2.9 3.2 3.6  0.8 1.0 1.3 1.6 1.7 1.4 1.9 A R ro01252 cysH Phosphoadenylyl-sulfate reductase (thioredoxin) 1.2 2.5 2.3 2.1 4.2 3.7 5.8  0.6 1.1 1.1 0.9 0.7 0.5 1.2 A  ro01258  Conserved hypothetical protein 1.0 0.9 1.2 1.2 3.0 3.7 3.0  0.8 1.0 1.0 1.1 1.0 0.9 1.5 A H ro01290  Probable 5,10-methylene-tetrahydromethanopterin reductase 3.1 5.2 5.0 2.9 3.5 3.8 3.5  5.8 2.2 2.1 2.7 2.1 1.7 1.0 C  ro01305 ectA Probable acetyltransferase 1.1 1.1 1.1 1.4 8.3 10.4 8.7  0.7 0.7 1.2 2.3 2.8 2.9 3.1 A  ro01307 ectC L-Ectoine synthase 1.1 1.0 0.9 0.9 3.5 2.9 3.2  0.3 0.3 0.3 0.4 0.5 0.5 0.5 A  ro01325  Conserved hypothetical protein 1.1 1.8 2.3 2.0 2.3 2.1 2.6  0.7 1.6 2.1 1.6 1.6 0.6 0.7 B H ro01349  Transcriptional regulator, GntR family 2.3 4.5 1.0 1.0 2.2 2.3 3.2  3.4 3.3 1.9 1.5 1.7 1.2 1.9 A R ro01350  Probable fructokinase 2.2 5.4 0.7 0.9 2.6 2.6 3.1  2.1 2.8 1.0 1.7 1.1 1.0 1.3 A  ro01376  Conserved hypothetical protein 1.0 1.7 3.1 2.9 2.3 2.4 2.4  0.9 1.2 1.7 1.7 1.4 1.6 2.0 B H ro01380  Conserved hypothetical protein 1.0 2.0 2.5 2.3 1.2 1.6 2.3  0.6 1.3 1.3 1.2 1.1 0.8 0.6 C H ro01404  Conserved hypothetical protein 1.2 1.6 1.7 1.2 2.1 2.4 2.4  1.1 1.2 1.3 1.1 1.1 0.9 0.9 A H ro01484 rpmE1 50S ribosomal protein L31 type B 0.9 1.1 1.6 2.3 5.1 6.5 4.7  0.7 0.7 1.0 1.6 2.1 1.6 1.2 A  ro01643  Conserved hypothetical protein 1.0 3.2 3.2 5.8 2.8 4.5 6.0  1.1 1.0 1.8 1.6 1.3 1.6 1.4 B H ro01698  Possible transcriptional regulator, TetR family 0.9 1.4 1.3 1.8 3.7 2.7 4.1  0.8 1.0 1.1 1.3 1.2 1.8 1.6 A R ro01699  Probable transcriptional regulator, CarD family 0.9 1.5 3.0 4.3 17.8 12.7 22.1  1.0 1.4 2.0 2.0 2.8 3.0 2.8 A R ro01714 | ro01715  Hypothetical protein | hypothetical protein 1.4 1.5 2.3 3.6 2.4 2.5 2.9  1.5 1.7 1.1 1.5 4.4 8.1 5.2 B H  114 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro01745  Conserved hypothetical protein 1.4 2.4 2.9 4.5 4.4 4.0 4.2  1.3 0.7 1.6 2.3 2.3 1.5 1.4 B H ro01746  Methionyl aminopeptidase 0.6 0.8 4.0 2.5 3.1 0.5 4.1  1.0 3.5 1.1 1.0 2.2 1.9 0.6 B  ro01787  Transcriptional regulator, LysR family 1.4 2.0 3.1 2.9 10.6 9.0 10.0  2.2 1.6 1.9 1.8 1.7 1.3 1.4 A R ro01814  Transcriptional regulator 1.1 2.6 2.1 2.7 4.3 4.1 4.0  0.9 1.0 1.3 1.7 1.2 1.5 1.7 A R ro01941  Hypothetical protein 1.2 1.1 1.4 2.4 3.0 2.6 3.5  1.5 0.9 0.7 1.2 1.2 1.3 1.0 A H ro01971  Possible Mce family protein 1.2 2.3 2.2 2.4 1.1 0.6 1.2  1.3 1.9 1.7 1.8 1.3 0.7 0.5 C  ro01973  Possible ABC transport system, permease component 1.5 2.8 2.8 3.1 1.2 0.8 1.5  1.1 1.6 1.6 1.9 1.6 0.8 0.5 C T ro01974 | ro02744  Probable bifunctional ABC transport system | ABC superfamily, ATP-binding component 1.2 1.7 1.9 2.2 2.4 2.1 2.6  1.2 1.6 1.8 1.6 1.5 0.7 0.5 B T ro02040  4-Hydroxyphenylpyruvate dioxygenase 2.2 2.4 2.4 3.7 4.8 5.7 6.1  1.2 1.2 1.7 2.2 2.6 2.0 2.0 A  ro02041  Probable transcriptional regulator, AsnC family 1.6 1.5 0.8 1.1 2.6 2.7 2.7  2.0 1.2 1.3 1.4 1.8 0.6 0.9 A R ro02053  Glutamyl-tRNA reductase 1.0 1.7 1.7 2.3 2.1 2.3 2.1  1.2 0.8 1.2 2.5 1.5 1.4 1.4 B  ro02054  Possible redox-sensing transcriptional repressor 1.1 1.2 2.1 3.1 2.3 2.2 2.5  1.0 0.7 1.6 1.8 2.2 2.1 1.9 B R ro02065  Probable exopolyphosphatase 1.5 2.4 3.5 2.7 1.2 1.4 1.4  1.7 1.9 2.2 2.4 2.5 1.5 1.1 C  ro02102  Probable transcriptional regulator, MerR family 0.9 0.8 0.8 0.8 2.7 2.3 2.0  1.0 0.9 1.1 1.0 0.8 1.1 1.0 A R ro02109  Probable monooxygenase 0.9 0.9 1.1 1.1 3.0 2.9 3.2  1.1 1.1 0.8 0.9 0.8 1.3 1.1 A  ro02113  Conserved hypothetical protein 1.2 1.4 1.5 1.7 5.9 5.8 6.8  2.3 1.5 1.0 1.3 1.3 1.8 2.1 A H ro02114  Probable glycosyltransferase 1.7 1.7 2.3 3.6 6.3 6.1 6.8  1.9 1.3 1.2 1.5 2.8 3.6 3.3 A L ro02115  Antisigma factor antagonist 0.8 2.0 3.2 4.0 3.5 2.9 3.4  1.2 1.7 2.1 2.8 4.5 3.8 2.7 B R ro02121 hbd1 3-Hydroxybutyryl-CoA dehydrogenase 3.1 12.8 4.0 1.8 2.4 1.7 2.2  5.5 33.3 4.2 1.9 1.1 0.9 0.6 C L ro02122  Isocitrate lyase 3.0 8.2 2.8 1.9 3.2 2.4 2.7  2.5 9.4 2.7 1.3 1.3 0.8 0.6 C  ro02138  Possible transcriptional regulator 1.5 1.6 2.2 1.9 7.4 8.6 8.0  1.0 0.9 1.5 1.3 2.5 1.1 1.1 A R ro02153  Possible hydrolase 1.1 1.0 1.6 1.2 3.5 2.8 3.3  1.1 1.1 0.2 0.9 1.1 1.7 1.9 A  ro02178  Probable DNA-(apurinic or apyrimidinic site) lyase 1.1 1.4 1.6 2.0 2.1 2.2 2.5  0.8 0.8 0.8 0.8 0.8 0.9 0.9 A D  115 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro02187  Probable ABC multidrug-resistance transporter, ATP-binding component 0.7 1.3 1.3 2.5 2.2 2.2 3.1  0.4 0.6 1.1 1.4 1.1 0.8 0.6 B T ro02282  Hypothetical protein 1.2 1.0 2.0 3.8 2.9 2.2 2.6  1.9 1.3 3.2 6.9 7.8 2.6 0.9 B H ro02381 benR Transcriptional regulator, AraC family 1.5 1.7 2.4 1.9 2.3 1.8 2.4  0.6 0.6 0.6 0.8 0.8 1.1 0.9 B R ro02398  Possible membrane protein 1.4 2.3 2.3 2.4 1.8 1.7 2.2  0.9 0.9 1.0 1.1 1.0 1.0 1.0 C  ro02439  Conserved hypothetical protein 1.9 2.3 1.9 2.4 3.4 3.2 3.8  1.9 1.8 1.8 1.6 2.0 1.7 1.5 A H ro02441  Possible Te resistance protein 0.7 0.7 1.0 2.1 2.2 1.8 2.8  1.2 1.3 1.2 1.2 1.1 1.1 0.6 B  ro02443  Conserved hypothetical protein 0.9 1.0 2.0 2.8 2.2 2.4 2.3  1.3 1.1 1.2 1.5 2.5 1.8 1.6 B H ro02580  Transcriptional regulator, IclR family 1.2 1.3 1.3 1.3 3.3 3.0 3.2  1.2 1.6 1.0 0.8 0.6 0.7 0.6 A R ro02595  Sulfatase 1.3 0.1 4.6 4.9 5.8 10.8 8.5  1.0 1.2 0.9 2.7 8.3 4.6 1.8 B  ro02632  Hypothetical protein 1.5 1.5 1.4 1.1 2.3 3.2 2.2  1.3 1.4 0.9 1.4 0.5 1.4 1.6 A H ro02712  Probable transcriptional regulator, TetR family 1.0 1.0 2.4 1.9 6.1 4.7 6.8  1.1 1.1 1.7 2.1 2.9 2.3 2.3 A R ro02733  Probable transcriptional regulator 1.2 1.3 1.4 3.7 3.6 3.0 3.1  1.2 1.2 1.4 1.5 1.6 1.3 1.3 B R ro02770  Hypothetical protein 2.1 6.0 2.3 5.6 1.7 2.0 1.7  0.5 0.9 0.7 0.8 0.7 0.5 0.5 C H ro02821  Possible sarcosine oxidase β subunit 0.7 0.9 1.6 1.6 5.2 7.2 6.1  0.8 0.9 0.9 0.8 0.9 0.8 0.8 A  ro02829  Possible transcriptional regulator 0.8 2.0 3.2 3.9 8.3 13.2 9.3  0.6 1.0 1.3 2.0 2.1 2.6 2.0 A R ro03021  Multidrug-resistance transporter, MFS superfamily 1.1 2.5 2.6 2.4 1.6 2.7 2.1  0.7 0.9 1.0 1.0 0.6 0.5 0.3 B T ro03042  Probable transcriptional regulator, AsnC family 1.5 3.0 1.5 1.8 2.9 3.0 3.1  0.8 0.9 0.8 0.8 0.7 0.9 0.8 A R ro03049 shiA2 Shikimate transporter, MFS family 1.0 1.3 1.4 1.9 6.2 5.7 8.0  0.9 1.1 1.1 1.1 1.1 1.1 1.5 A T ro03073  Possible chromate resistance protein 1.1 1.1 1.3 1.7 3.0 2.4 2.9  0.8 0.9 0.9 1.0 1.2 1.2 1.2 A  ro03099  Probable esterase/lipase 0.9 1.4 1.7 2.3 2.2 2.2 2.7  1.1 1.1 0.9 1.2 1.5 1.1 1.0 B L ro03135 | ro08554  Conserved hypothetical protein | conserved hypothetical protein 3.3 6.2 5.9 1.5 0.5 0.1 0.5  2.2 2.5 1.8 1.3 1.3 1.0 2.1 C H ro03198  Conserved hypothetical protein 1.4 1.8 3.0 3.0 9.5 7.9 9.2  1.7 1.7 2.4 3.0 4.8 2.6 2.3 A H  116 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro03199  Possible resolvase, N-terminal 1.5 1.4 1.4 1.7 2.3 2.1 2.1  1.4 1.2 1.1 1.1 1.1 0.9 1.1 A D ro03243  Possible enoyl-CoA hydratase 1.4 2.2 1.5 1.4 3.0 2.7 2.7  0.9 1.1 0.9 0.9 0.9 1.6 1.4 A L ro03257  Conserved hypothetical protein 1.4 2.5 4.0 4.5 19.5 21.8 22.0  2.8 1.6 1.7 1.8 1.3 1.8 2.9 A H ro03286  Probable transcriptional regulator, AraC family 1.0 1.1 1.2 1.8 2.2 2.2 2.5  0.9 0.9 1.2 1.2 1.1 1.3 1.4 A R ro03287  Hypothetical protein 1.3 2.9 4.6 3.4 2.5 2.7 3.0  0.6 1.3 1.5 1.7 2.6 1.8 1.6 B H ro03360  Possible aldehyde dehydrogenase, C-terminal 1.6 2.6 3.1 2.8 2.5 2.4 2.3  0.8 1.3 1.3 1.0 1.2 1.4 1.6 B  ro03366  Amino acid transporter, APC family 1.1 1.6 2.1 2.9 2.2 2.4 2.6  1.0 1.0 1.4 1.7 1.3 1.6 1.4 B T ro03367  Probable transcriptional regulator, ArsR family 1.0 1.1 2.5 2.3 3.0 3.1 2.8  1.6 1.1 1.8 1.3 1.5 3.1 4.6 B R ro03373  Protein kinase/transcriptional regulator, LuxR family 1.6 0.6 2.2 2.5 2.9 2.4 3.9  1.1 1.0 1.4 2.0 1.8 1.2 1.2 B R ro03387  FAD-binding oxidoreductase 0.9 1.2 1.4 5.5 2.4 2.3 2.8  0.6 0.8 1.2 0.8 0.7 1.2 1.2 B  ro03401  Hypothetical protein 1.0 0.8 1.1 1.1 3.1 2.7 2.7  0.5 0.6 0.6 0.7 0.8 0.7 0.8 A H ro03412 | ro00705  Conserved hypothetical protein | conserved hypothetical protein 1.2 1.9 2.0 2.5 1.8 1.7 2.1  1.7 1.5 1.9 2.0 2.1 1.0 0.6 B H ro03421  Conserved hypothetical protein 0.8 1.8 3.3 2.7 4.9 5.7 5.7  1.3 1.7 1.7 1.4 1.7 1.8 2.1 A H ro03532 | ro04505 | ro04070 | ro04245 | ro03991 | ro04959 | ro00876  Possible transposase | possible transposase | conserved hypothetical protein | possible transposase | possible transposase | conserved hypothetical protein | conserved hypothetical protein 1.8 2.0 2.2 2.3 1.0 0.9 1.3  1.6 1.5 1.6 1.5 1.7 0.8 0.7 C X ro03653  Conserved hypothetical protein 1.2 1.6 2.2 2.7 2.6 2.1 2.9  0.6 0.7 0.9 0.9 0.8 1.1 1.3 B H ro03655 parA Chromosome partitioning protein ParA 1.4 2.2 2.1 2.4 1.9 1.5 1.9  0.8 0.9 1.3 1.0 1.1 0.7 0.6 C C ro03656 gidB Methyltransferase protein GidB (glucose-inhibited division protein B) 1.1 2.1 2.1 3.1 3.2 3.1 3.5  0.9 1.0 1.2 1.1 1.3 0.8 0.6 B C ro03680 gyrA DNA topoisomerase subunit A 1.2 1.8 3.7 3.9 3.1 3.0 3.3  0.3 0.9 1.3 1.1 1.0 0.6 0.4 B D ro03686  Transcriptional regulator, AraC family 1.0 1.3 1.4 1.4 2.5 2.5 2.4  1.1 1.1 1.0 1.6 1.3 1.0 1.1 A T  117 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro03703  Conserved hypothetical protein 1.1 2.0 2.6 2.2 2.0 1.8 2.5  0.9 1.4 1.9 1.6 2.1 1.4 1.3 B H ro03744 | ro08919 | ro06292 | pccB2 | Propionyl-CoA carboxylase β subunit | propionyl-CoA carboxylase β subunit | acetyl/propionyl-CoA carboxylase β subunit 0.9 1.2 1.3 1.2 2.3 2.1 2.5  0.5 0.6 0.6 0.5 0.6 0.6 0.7 A  ro03778 | ro04491 phaC1 | Poly(3-hydroxyalkanoate) synthetase | poly(3-hydroxyalkanoic acid) synthase 1.0 1.0 1.0 2.5 2.8 2.2 3.2  1.1 1.1 1.1 1.8 2.5 4.0 3.3 A  ro03844  Transketolase, C-terminal subunit 1.0 1.6 2.7 3.2 2.3 1.9 2.0  0.8 1.7 1.4 1.3 1.4 1.0 0.8 B  ro03845  Probable transcriptional regulator, GntR family 1.0 1.9 3.1 3.4 3.5 0.5 3.4  0.8 1.0 1.1 1.2 1.3 1.4 1.5 C R ro03888  Possible universal stress protein 1.6 2.9 0.9 0.9 2.6 2.7 3.6  1.0 1.1 0.8 0.7 0.7 0.8 1.0 A  ro03889  Sugar transporter, MFS superfamily 1.4 3.2 0.5 0.7 2.5 3.1 3.7  1.2 1.2 0.7 0.6 0.6 0.8 1.0 A T ro04007  Conserved hypothetical protein 0.5 1.3 1.1 1.4 2.4 4.1 3.0  1.0 0.9 1.2 1.6 1.4 1.3 1.3 A H ro04017  Possible cyclase 2.0 1.6 1.2 1.7 2.3 2.3 2.3  0.7 4.0 1.0 0.8 1.7 1.1 2.0 A  ro04026  Probable ferritin 1.0 0.9 3.3 2.6 7.0 7.1 5.3  0.7 0.4 1.0 0.7 1.0 0.7 0.6 A  ro04049  Conserved hypothetical protein 1.3 1.5 2.0 5.5 2.8 2.7 3.2  1.1 1.0 1.4 1.0 1.2 1.1 1.3 B H ro04050  Conserved hypothetical protein 1.3 2.3 3.5 4.2 4.6 3.5 4.1  0.8 1.4 1.7 2.3 2.1 0.9 0.4 B H ro04051  Probable stage II sporulation protein 0.8 2.3 2.3 2.5 2.0 2.4 2.8  1.1 1.2 1.8 2.4 1.8 0.9 0.6 B C ro04115  ABC O-antigen transporter, permease component 1.4 1.9 1.7 2.1 2.0 1.9 2.5  1.0 0.8 0.9 0.9 1.0 1.0 1.0 B T ro04122  Possible antigen protein 1.7 1.7 2.0 2.2 2.8 3.4 3.1  1.5 1.1 1.7 1.9 2.1 1.7 1.4 A  ro04124  Possible transcriptional regulator, ArsR family 1.4 1.2 2.1 2.7 2.0 1.8 1.9  1.7 1.1 1.8 2.6 3.9 2.4 2.4 B R ro04132  Possible lactoylglutathione lyase 1.1 1.0 1.4 1.7 2.3 2.9 2.6  1.0 0.9 1.6 1.3 1.8 1.6 1.3 A  ro04155  Conserved hypothetical protein 1.1 1.5 3.2 2.5 7.4 6.1 8.2  1.8 1.9 2.6 2.3 2.7 2.1 1.5 A H ro04194  Conserved hypothetical protein 1.3 1.9 2.5 3.0 13.2 10.7 16.7  1.9 1.5 1.1 1.0 1.1 2.1 1.7 A H ro04221  Conserved hypothetical protein 1.2 1.8 1.9 5.8 9.5 10.5 13.5  1.2 0.9 1.4 5.1 17.8 4.2 1.9 A H ro04242  Conserved hypothetical protein 1.2 2.0 2.5 2.0 3.5 4.6 2.5  1.6 1.4 1.2 1.7 2.5 2.5 2.3 A H ro04285  Conserved hypothetical protein 0.8 1.3 1.0 2.4 3.3 2.2 3.8  1.0 0.7 0.8 2.5 1.6 1.6 0.9 A H  118 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro04286  Conserved hypothetical protein 1.2 1.1 0.8 2.1 3.8 5.0 5.2  1.3 1.2 1.3 3.8 12.8 3.5 1.8 A H ro04297  Possible dipeptidase 2.0 1.5 1.8 2.2 3.8 3.2 3.9  1.2 1.1 2.1 1.3 1.3 1.4 2.6 A  ro04298  Probable hydrolase 1.8 1.0 1.2 1.6 3.4 4.5 4.1  1.2 1.0 0.7 0.8 0.9 1.5 0.7 A  ro04299  Probable transcriptional regulator, GntR family 1.9 1.3 1.5 1.6 2.8 2.4 2.8  1.2 1.0 1.2 1.1 1.1 1.2 1.4 A R ro04309  Catalase 1.1 1.2 1.5 2.2 4.2 4.1 4.3  1.1 1.1 1.4 1.1 1.1 1.3 1.3 A  ro04313  Conserved hypothetical protein 1.0 1.3 1.9 2.1 3.1 2.6 2.9  1.0 1.1 1.0 1.0 1.4 1.0 1.1 A H ro04321  Transcriptional regulator 1.0 1.7 2.5 2.7 2.5 2.3 2.1  1.0 1.2 2.0 2.3 2.3 1.2 0.9 B R ro04338  Conserved hypothetical protein 1.3 2.2 2.6 2.6 2.1 1.7 2.1  0.8 0.9 1.0 1.3 0.9 0.8 0.9 C H ro04392  Probable flavin oxidoreductase 1.3 2.3 2.7 2.3 1.1 1.1 1.1  0.6 1.1 1.5 1.3 1.3 1.3 1.0 C  ro04395  Possible transcriptional regulator, TetR family 0.8 1.7 1.5 1.8 3.0 5.3 2.9  1.3 0.7 0.9 0.9 1.2 1.1 1.0 A R ro04402  Conserved hypothetical protein 0.7 0.6 3.8 2.1 1.3 2.6 2.5  1.1 0.6 1.4 0.7 0.7 0.5 0.7 B H ro04432  Possible dithiol-disulfide isomerase 1.0 1.4 1.2 1.5 2.0 2.1 2.1  0.7 0.8 1.0 0.8 1.0 1.3 1.3 A  ro04433  Hypothetical protein 1.2 1.7 1.5 1.5 3.2 2.5 3.7  0.8 0.8 0.8 0.7 0.8 0.9 1.0 A H ro04453 aspA2 Aspartate ammonia-lyase 0.8 0.2 0.6 1.0 3.6 4.5 3.8  0.9 1.0 0.7 0.8 1.0 0.9 1.3 A  ro04454  Transcriptional regulator, GntR family 1.4 0.9 0.3 0.5 2.3 2.3 2.6  1.1 0.6 0.5 0.5 0.6 0.9 1.0 A R ro04459  Probable transcriptional regulator, CarD family 0.8 1.0 2.2 2.8 7.2 4.4 8.0  0.8 0.8 1.5 2.3 3.1 2.0 1.1 A R ro04460  Probable 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase 1.0 0.9 1.2 1.3 2.6 2.9 2.4  0.8 0.7 1.0 1.3 1.1 0.8 0.8 A L ro04496  ABC transporter, ATP-binding component 1.5 3.8 2.2 3.0 3.4 3.6 4.2  1.4 1.5 1.4 1.8 1.4 1.2 0.6 A T ro04543 gabD3 Succinate-semialdehyde dehydrogenase (NAD[P]+) 1.8 2.5 4.0 3.0 5.2 5.6 6.7  1.2 1.4 2.2 1.9 2.8 1.6 1.8 A  ro04546  Possible phenazine biosynthesis protein, PhzF family 1.7 2.6 2.0 3.0 4.5 18.9 3.9  1.1 1.1 1.7 1.9 2.3 1.9 2.4 A  ro04576  Possible phosphoglycerate dehydrogenase 1.4 2.3 2.8 3.0 5.1 4.5 5.1  1.3 1.2 1.9 1.9 2.5 1.8 3.2 A  ro04577  Probable arylmalonate decarboxylase 2.1 2.6 7.5 3.5 5.6 10.2 5.9  2.7 2.7 2.2 1.6 2.6 4.4 4.4 A  ro04601  Hydrogenase Ni incorporation protein HypA 1.3 1.4 1.2 2.2 2.3 2.8 2.7  2.0 1.8 1.5 2.7 3.4 2.7 2.5 A   119 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro04604  Ni-dependent hydrogenase large subunit 1.2 1.6 1.2 2.8 15.2 30.0 15.5  2.1 1.6 2.8 8.4 17.5 42.9 32.1 A  ro04631  Probable transcriptional regulator, TetR family 0.9 1.4 3.8 6.7 5.9 6.5 7.6  0.9 1.6 1.9 2.2 2.4 1.1 0.8 B R ro04643  Permease for cytosine/purines, uracil, thiamine, allantoin 1.2 3.0 2.0 2.1 1.9 1.8 2.2  0.9 1.0 1.1 1.2 1.3 1.7 2.3 C T ro04658  Conserved hypothetical protein 1.0 1.0 1.2 1.1 2.5 2.5 2.6  1.1 0.8 0.9 0.8 0.8 0.9 0.9 A H ro04728 sigF3 σ70 type, group 3 subdivision 3.9 3.1 3.3 4.5 31.0 21.3 33.0  2.6 1.7 1.4 1.2 1.1 0.8 0.9 A R ro04729  Probable transcriptional regulator, MerR family 2.2 2.6 3.2 4.2 17.5 15.0 20.3  2.1 1.2 1.4 1.6 2.0 1.8 1.9 A R ro04731  Probable transcriptional regulator, MerR family 3.1 3.1 4.0 3.7 34.4 31.0 33.1  3.8 1.9 2.9 1.5 1.3 0.7 1.1 A R ro04751  Probable thiolase 1.5 1.2 1.1 1.1 3.3 3.0 3.1  1.0 1.1 1.0 0.9 0.9 0.7 0.8 A L ro04783  Conserved hypothetical protein 5.3 1.9 2.1 2.2 3.2 6.7 3.4  2.3 1.7 2.6 2.1 2.9 1.1 1.9 A H ro04810  Conserved hypothetical protein 1.1 2.1 2.1 3.3 1.1 1.4 1.2  1.3 1.4 1.3 1.5 1.2 0.6 0.7 C H ro04843  Conserved hypothetical protein 0.9 1.0 1.6 4.0 3.0 2.7 3.6  2.2 2.4 4.8 3.8 3.8 2.1 1.6 B H ro04852  Conserved hypothetical protein 2.2 2.9 2.3 2.9 1.4 1.6 1.7  0.7 0.7 0.9 1.2 1.1 1.1 0.9 C H ro04857  Conserved hypothetical protein 1.3 4.6 2.1 2.2 4.2 4.3 5.4  0.3 0.7 0.5 0.4 0.4 0.5 0.6 A H ro04881  Conserved hypothetical protein 1.1 1.3 3.2 2.7 7.6 9.5 8.7  0.9 0.8 1.8 1.9 1.8 1.5 1.6 A H ro04882  Possible transcriptional regulator, TetR family 0.9 1.8 1.8 1.5 2.3 2.4 2.3  1.1 1.1 1.2 1.3 1.1 1.1 1.3 A R ro04890  Conserved hypothetical protein 1.5 1.9 1.9 2.2 2.9 2.6 2.3  1.7 1.1 1.1 1.1 1.7 2.0 2.4 A H ro04904  Conserved hypothetical protein 0.8 0.7 0.6 0.9 5.2 6.5 5.6  0.6 0.7 0.7 0.8 0.7 1.0 1.3 A H ro04919  Conserved hypothetical protein 0.9 1.1 1.7 2.1 3.7 4.8 3.3  1.2 0.9 1.6 4.3 4.0 1.7 2.6 A H ro04932  Conserved hypothetical protein 1.4 1.7 2.4 2.9 3.6 2.6 2.4  0.8 0.7 1.0 0.5 0.6 0.9 1.0 B H ro04934  Possible hydroxylase 1.5 1.5 1.5 1.8 8.3 7.7 8.8  1.8 1.3 1.6 1.3 2.1 1.5 1.6 A  ro04937  Conserved hypothetical protein 1.0 0.9 1.4 2.2 2.9 2.3 3.0  1.3 1.1 1.2 1.3 1.2 1.1 1.0 A H ro04966  Conserved hypothetical protein 1.3 2.2 2.2 2.2 2.1 2.1 2.5  1.1 0.9 0.9 0.8 0.9 0.7 0.8 B H ro04984  Conserved hypothetical protein 1.0 1.8 3.4 4.6 2.1 1.9 2.7  0.7 0.9 1.4 1.7 1.5 0.4 0.2 B H ro05005  Transcriptional regulator, TetR family 0.9 1.7 1.1 1.4 2.8 6.0 2.9  1.3 0.8 1.5 1.2 1.5 1.2 0.7 A R ro05024  Reductase 0.9 1.4 2.0 2.2 3.3 3.1 3.7  1.2 1.3 1.0 0.9 1.0 0.9 0.9 A  ro05054  Conserved hypothetical protein 1.0 1.5 1.6 1.8 4.4 4.0 4.5  0.9 1.0 1.0 1.0 1.4 1.5 1.3 A H ro05081  Conserved hypothetical protein 1.5 1.0 1.8 1.1 4.4 6.8 4.9  1.4 1.7 1.6 1.4 1.2 0.8 0.7 A H ro05083  Possible transcriptional regulator, TetR family 1.4 1.2 1.7 1.4 2.1 2.2 2.5  1.0 0.7 1.0 0.8 1.1 1.1 1.1 A R  120 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro05090  Possible alkylglycerone-phosphate synthase 1.7 1.2 1.8 2.2 5.7 12.3 5.4  0.7 0.9 0.7 0.8 0.8 0.5 0.8 A  ro05103 | ro02207  Nonribosomal peptide synthetase | nonribosomal peptide synthetase 1.2 2.1 2.2 2.3 1.9 2.6 2.4  1.0 1.1 1.4 1.3 1.5 1.7 1.4 B  ro05135  Conserved hypothetical protein 0.9 0.9 1.4 1.1 5.5 7.1 5.6  1.5 2.0 3.4 2.3 2.6 1.4 1.1 A H ro05175  Conserved hypothetical protein 1.3 2.1 2.7 2.5 2.7 2.9 3.4  0.9 1.0 1.5 1.7 1.5 1.0 0.9 B H ro05181  Hypothetical protein 1.5 1.8 3.2 2.9 2.9 3.2 2.9  0.8 1.0 1.7 1.5 1.3 0.4 0.3 B H ro05194  Isochorismate synthase 1.2 1.4 1.9 2.3 3.6 5.9 4.2  1.4 1.5 1.4 2.0 1.8 1.1 1.1 A  ro05197  Probable transcriptional regulator 1.2 5.2 2.4 3.2 3.4 3.1 3.6  1.0 1.5 1.5 1.9 1.5 1.4 1.2 B R ro05227  Conserved hypothetical protein 1.8 2.4 1.3 2.1 5.9 7.7 7.2  1.8 1.5 1.4 1.6 1.8 2.0 1.4 A H ro05233  Conserved hypothetical protein 1.0 1.9 2.2 2.2 1.8 2.1 2.1  1.1 1.2 2.5 2.0 1.8 3.9 4.1 B H ro05270  Possible transposase 2.8 2.3 2.7 2.1 3.3 2.8 3.4  1.7 1.4 1.4 1.4 1.0 0.4 0.7 A X ro05271  Sensor kinase, two-component system 1.5 2.5 2.4 2.3 2.4 3.1 2.3  1.4 1.1 1.2 1.1 1.0 0.6 1.0 B  ro05274  Fe3+ uptake regulator 1.3 2.9 5.3 4.9 2.5 2.3 2.7  0.5 0.8 1.4 1.5 1.0 0.6 0.5 C R ro05275 katG Catalase 1.1 3.3 6.7 4.9 3.2 3.1 3.6  0.2 0.6 0.8 0.7 0.5 0.3 0.2 B  ro05281  Conserved hypothetical protein 1.5 1.4 1.6 1.4 3.3 3.5 3.0  1.6 1.1 1.1 1.7 0.8 2.2 5.5 A H ro05292  Conserved hypothetical protein 0.9 1.4 1.0 1.4 5.1 7.3 2.8  1.1 1.2 0.8 1.9 0.8 1.4 1.0 A H ro05293  Transcriptional regulator 1.3 1.3 1.3 1.2 3.8 3.5 5.1  0.8 0.9 1.3 1.0 1.1 1.2 1.2 A R ro05298  Conserved hypothetical protein 1.2 2.9 2.9 2.8 2.1 2.2 2.3  1.0 1.2 1.7 1.3 1.1 1.2 1.0 C H ro05372  Conserved hypothetical protein 1.1 0.9 1.3 1.4 4.0 3.0 3.7  1.4 1.1 1.0 1.0 1.4 1.3 1.2 A H ro05407  Ligase 1.0 1.0 0.9 1.1 2.4 3.3 2.1  0.8 0.7 0.7 0.9 0.9 0.9 1.0 A L ro05505  Possible oxidoreductase 1.3 1.9 1.9 2.3 5.0 6.0 6.0  1.2 1.1 1.1 1.1 1.4 1.6 1.4 A  ro05506  Dehydrogenase 1.1 1.8 1.7 1.7 3.4 3.6 4.6  1.0 1.3 1.0 0.9 1.1 1.3 1.6 A  ro05507  Possible cation transport regulator 1.4 1.6 2.3 2.1 7.5 7.9 9.1  2.0 1.3 1.1 0.9 1.1 2.3 2.4 A R ro05535  Conserved hypothetical protein 1.2 2.0 2.8 2.8 3.0 2.6 3.3  0.8 1.0 1.2 1.1 1.0 0.7 0.7 B H ro05540  Hypothetical protein 1.6 2.5 2.5 2.0 13.0 10.4 13.0  1.4 0.9 0.6 0.5 0.6 0.8 0.6 A H ro05551 purA1 Adenylosuccinate synthetase 0.9 1.1 1.5 1.5 3.7 3.3 3.9  0.6 0.7 0.7 0.9 0.8 0.7 0.6 A  ro05553  Methylated-DNA(protein)-cysteine S-methyltransferase 2.0 3.4 2.4 2.1 0.9 1.0 0.8  0.9 0.9 1.3 1.1 0.9 0.8 0.9 C D ro05572  Conserved hypothetical protein 1.2 1.8 2.0 3.8 5.8 7.3 5.0  1.2 0.9 1.5 1.2 1.0 0.6 0.5 A H ro05576  Possible 34 kDa antigenic protein 1.1 2.1 2.6 2.1 2.2 2.1 2.5  1.0 1.1 1.2 0.8 0.8 0.5 0.5 B   121 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro05580  Hypothetical protein 0.5 0.8 0.5 0.5 3.1 3.1 3.2  0.4 0.5 0.5 0.5 0.7 0.7 0.7 A H ro05603  Conserved hypothetical protein 1.5 2.4 2.8 1.6 3.0 2.3 2.7  1.4 1.5 1.9 1.4 1.4 1.4 1.5 A H ro05612  Hypothetical protein 1.2 1.5 2.2 3.3 2.6 2.9 3.5  1.0 0.9 1.2 1.3 1.2 0.8 0.9 B H ro05613  Conserved hypothetical protein 1.3 1.4 5.0 5.8 5.0 4.1 5.6  1.5 1.2 2.5 2.2 1.5 0.6 0.5 B H ro05635  Conserved hypothetical protein 1.0 1.7 2.2 2.7 2.7 1.4 2.6  0.7 0.8 1.1 1.2 1.5 0.7 0.5 B H ro05671  Probable rRNA dimethyladenosine transferase 1.3 2.7 2.3 2.1 3.1 0.6 5.1  1.0 0.9 1.2 0.9 0.8 1.2 1.2 C  ro05677 dctA3 C4-dicarboxylate transporter, DAACS family 1.4 2.2 2.7 2.7 7.0 9.8 8.6  1.5 1.6 1.5 1.4 1.4 1.2 1.1 A T ro05735  Possible protein-tyrosine kinase, C-terminal 1.0 3.6 2.9 3.4 5.5 14.4 16.5  1.2 1.6 1.7 1.6 1.6 2.3 3.0 A  ro05740  Probable glycosyltransferase 1.0 2.2 1.8 2.0 2.3 2.7 2.5  1.3 1.3 1.2 1.3 1.6 2.4 1.8 B L ro05778  Conserved hypothetical protein 0.8 2.0 2.2 2.3 1.6 2.5 2.1  0.8 0.9 1.0 1.0 0.9 0.9 0.8 B H ro05840  Conserved hypothetical protein 1.5 2.3 3.4 2.3 2.2 1.9 2.4  0.8 1.2 1.3 1.0 1.2 0.7 0.6 C H ro05867  Probable exodeoxyribonuclease VII small subunit 1.4 1.5 1.6 2.1 2.6 2.3 2.3  0.8 0.9 0.8 0.8 0.8 0.9 0.8 A D ro05870  4-Hydroxy-3-methylbut-2-enyl diphosphate reductase 1.2 2.1 2.7 3.1 3.4 3.4 4.4  1.3 1.3 1.7 1.4 1.7 1.6 1.4 B L ro05872  Possible DNA recombination protein, RmuC family 0.9 0.8 0.9 1.4 2.5 2.4 2.8  0.8 1.1 0.7 0.8 0.9 1.1 0.8 A D ro05875  Conserved hypothetical protein 1.2 1.8 1.8 2.2 2.9 2.5 3.5  1.3 1.3 1.4 1.3 1.3 1.2 1.1 A H ro05900  Possible protease 1.0 1.1 2.1 3.0 2.8 3.2 2.4  1.1 1.2 1.2 1.9 2.4 1.7 1.9 B  ro05907  Possible beta-lactamase precursor 2.0 1.7 2.5 2.4 4.1 3.5 3.9  1.2 1.2 1.6 1.7 1.8 2.0 2.7 A  ro05911  Probable NADH dehydrogenase subunit C 1.3 2.2 2.5 2.3 1.0 0.7 1.1  2.8 3.2 4.2 3.0 1.5 0.5 0.5 C  ro05915  Probable NADH dehydrogenase subunit G 2.4 4.3 4.3 3.3 2.2 2.2 2.3  2.8 2.3 3.4 2.9 1.5 0.7 0.5 C  ro05917  Probable NADH dehydrogenase subunit I 2.1 2.9 2.7 2.4 1.6 1.4 1.5  1.5 2.1 2.0 1.6 0.8 0.3 0.3 C  ro05918  Probable NADH dehydrogenase subunit J 2.4 3.8 4.0 3.8 2.3 2.4 2.4  1.4 1.5 1.6 1.6 1.0 0.5 0.5 C  ro05919  Probable NADH dehydrogenase subunit K 2.3 3.7 3.6 3.4 2.1 2.8 2.3  1.3 1.6 1.9 1.6 0.9 0.7 0.6 C  ro05920  Probable NADH dehydrogenase subunit L 3.3 25.7 9.3 7.9 4.0 5.2 4.9  1.5 1.7 2.6 2.0 1.1 0.5 0.7 C   122 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro05921  Probable NADH dehydrogenase subunit M 2.9 6.6 8.6 9.0 4.1 4.2 4.3  1.2 2.4 2.9 3.0 1.3 0.6 0.4 C  ro05936  Conserved hypothetical protein 1.4 2.2 3.0 3.3 8.9 8.4 8.8  1.4 1.7 2.1 1.9 2.1 1.4 1.8 A H ro05940  Conserved hypothetical protein 1.3 1.3 1.6 1.5 3.9 3.5 3.9  0.8 0.7 0.9 0.8 0.8 0.9 1.0 A H ro05968  Dihydropteroate synthase 1.5 1.8 2.1 2.5 2.4 2.7 2.7  0.7 0.7 0.9 0.9 0.8 0.8 0.9 B  ro05972  Conserved hypothetical protein 1.0 1.8 2.2 2.5 1.8 2.1 2.2  1.0 0.9 1.4 1.6 1.3 1.3 1.1 B H ro05977  σ70 type, group 4 subdivision (ECF) 2.6 3.5 4.8 2.5 1.0 1.0 1.2  5.1 5.2 6.5 4.7 4.4 2.5 2.1 C R ro05992  Probable multidrug transporter, MFS superfamily 0.8 1.0 1.3 1.5 3.4 2.8 3.6  0.9 0.7 1.0 0.9 0.9 1.0 1.1 A T ro06007  Short-chain dehydrogenase 0.7 0.8 0.9 1.1 2.6 3.2 2.3  1.2 1.1 1.1 1.3 1.0 1.0 1.0 A L ro06008  Monooxygenase 0.9 0.9 0.8 1.3 3.9 4.0 3.9  0.9 1.4 1.5 1.7 1.4 1.3 1.3 A  ro06012 odhA 2-Oxoglutarate dehydrogenase, E1 and E2 components 1.5 2.2 1.3 1.6 2.5 3.0 3.1  0.4 0.4 0.4 0.4 0.6 0.5 0.6 A  ro06022  Possible transcriptional regulator 1.1 2.9 1.7 3.2 8.3 14.6 9.3  0.5 1.8 1.8 2.0 2.0 1.4 1.3 A R ro06028  Possible amidase 1.2 1.4 1.8 2.0 8.1 8.2 7.1  1.2 1.3 1.3 1.2 1.4 1.0 1.0 A  ro06033  Possible lysophospholipase 1.1 1.3 1.2 1.7 2.8 3.7 4.2  0.8 0.8 0.9 0.9 1.1 1.2 1.3 A L ro06034  Long-chain-fatty-acidCoA ligase 1.4 2.4 3.1 2.3 1.0 1.0 1.2  0.9 1.4 1.8 1.1 0.9 0.4 0.3 C L ro06068  Conserved hypothetical protein 1.5 2.1 2.3 2.1 1.4 1.2 1.4  1.2 1.3 1.9 1.3 1.0 1.1 1.3 C H ro06080  Conserved hypothetical protein 0.9 1.7 1.6 4.2 2.2 5.1 2.7  0.5 1.0 1.1 1.0 1.1 1.0 0.9 B H ro06095  Fatty-acidCoA carboxylase B subunit 1.1 2.5 3.6 3.5 1.7 1.5 1.9  0.6 1.4 1.0 1.0 1.3 1.2 1.4 C L ro06099  Citrate (pro-3S)-lyase 0.9 3.0 1.2 7.2 2.7 2.1 3.1  0.6 1.1 1.2 0.9 1.0 1.0 1.0 B  ro06108  Possible lipase 1.0 1.7 2.5 3.2 4.7 4.3 4.8  1.0 1.1 1.9 2.1 2.6 1.0 0.7 A L ro06190  Chaperone protein 0.9 1.3 1.8 2.3 2.3 2.4 2.3  1.1 1.1 1.3 1.5 1.6 1.1 0.9 B  ro06196  σ70 type, group 4 subdivision (ECF) 0.8 1.0 1.6 2.1 2.2 1.9 2.2  0.9 1.0 1.5 2.2 2.4 2.1 1.6 B R ro06198  Conserved hypothetical protein 1.2 1.6 2.6 2.7 2.1 1.9 2.4  0.7 1.1 1.5 1.3 1.3 0.9 0.7 B H ro06212  Conserved hypothetical protein 1.9 2.5 2.5 2.3 1.6 1.4 1.8  0.9 1.0 1.0 0.8 0.8 1.0 1.3 C H ro06222  Possible membrane protein 2.4 4.3 4.6 1.7 0.9 0.9 1.0  0.9 0.8 0.8 0.8 1.1 1.1 1.2 C  ro06313  Possible transcriptional regulator 1.6 1.2 1.4 1.9 3.4 2.7 2.9  2.4 1.4 1.9 3.0 4.2 1.8 1.1 A R ro06315  Conserved hypothetical protein 1.2 1.9 2.6 3.4 5.1 4.6 4.7  1.0 1.2 1.4 1.6 1.6 0.7 0.6 A H  123 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro06345  Possible transcriptional regulator, WhiB family 0.9 1.0 1.2 1.4 2.2 2.1 2.6  1.3 0.8 1.3 1.7 2.4 1.3 1.3 A R ro06359  Transcriptional regulator, TetR family 1.0 1.3 2.0 2.3 3.3 2.8 3.9  0.9 0.8 1.3 1.6 1.3 0.9 0.7 A R ro06360  Conserved hypothetical protein 1.0 3.8 2.2 2.7 2.5 3.1 2.9  0.7 1.0 1.2 1.2 1.1 0.9 0.6 B H ro06361  Molybdopterin biosynthesis protein 1.0 1.9 1.1 1.4 2.1 2.0 2.3  0.8 0.9 1.0 0.9 0.9 1.1 1.2 A  ro06533  Signal recognition particle protein 1.0 1.4 2.3 2.8 1.9 1.9 2.0  0.6 1.0 1.5 1.3 1.2 0.8 0.7 B  ro06586  Conserved hypothetical protein 1.0 2.8 2.5 3.4 2.5 2.4 3.0  1.3 1.4 1.4 1.9 2.0 1.2 1.0 B H ro06635  Transcriptional regulator, TetR family 1.0 1.1 1.9 2.2 4.0 9.2 5.1  0.9 2.0 1.4 1.2 1.7 1.7 1.1 A R ro06654 rplO2 30S ribosomal protein S15 1.1 1.0 1.8 3.2 3.3 2.6 2.7  0.8 0.7 1.1 1.2 1.5 1.3 1.4 B  ro06706  Conserved hypothetical protein 1.4 1.4 2.5 2.1 5.1 5.9 5.2  3.6 1.6 2.3 2.3 3.4 2.3 2.3 A H ro06724  Conserved hypothetical protein 2.6 2.0 3.2 2.6 1.6 3.3 3.0  1.4 1.0 1.4 1.3 1.2 1.3 1.2 B H ro06749  Conserved hypothetical protein 1.3 2.4 3.4 1.4 2.1 2.1 2.0  0.9 1.2 1.8 1.2 0.8 0.6 0.8 C H ro06750  DNA translocase FtsK 1.1 1.4 1.8 2.1 3.0 2.9 3.5  1.0 1.1 1.4 1.6 1.5 0.8 0.4 A C ro06771  Conserved hypothetical protein 1.0 1.3 2.4 1.8 1.8 2.1 2.1  0.7 0.9 1.2 1.0 1.1 0.8 0.9 B H ro06788  Repressor LexA 1.1 1.2 1.7 2.0 2.7 2.5 2.8  1.0 1.1 1.3 1.2 0.9 0.6 0.5 A R ro06790  Conserved hypothetical protein 1.4 2.5 2.1 2.0 1.6 1.8 2.1  1.1 1.4 1.2 1.2 1.3 0.7 0.8 C H ro06793  Possible hydrolase 1.7 1.5 1.2 1.8 2.1 2.9 2.1  1.2 1.0 1.0 1.4 1.2 1.0 1.2 A  ro06796 bioA2 Adenosylmethionine-8-amino-7-oxononanoate transaminase 1.3 1.5 1.2 1.9 2.1 2.1 2.3  1.7 1.3 1.2 1.5 1.6 0.8 1.0 A  ro06810  Fe2+-dependent transcriptional regulator 1.2 1.5 2.2 2.0 2.5 2.0 2.5  0.9 0.9 1.2 1.3 1.3 1.1 1.2 B R ro06813 sigB σ70 type, group 2 subdivsion (proven nonessential) 2.3 4.6 4.3 1.8 1.7 1.8 2.3  4.7 5.7 6.2 3.0 2.6 1.5 2.1 C R ro06817  Conserved hypothetical protein 1.4 2.1 2.4 3.7 3.3 3.8 3.3  0.7 1.0 1.1 1.7 1.9 1.3 0.8 B H ro06829  dUTP diphosphatase 1.0 2.1 2.6 3.1 2.0 2.2 2.1  0.9 1.1 1.6 2.0 2.2 1.7 1.5 B  ro06869  Possible 2-isopropylmalate synthase 0.9 1.0 0.8 0.9 3.4 3.1 3.0  0.3 0.3 0.3 0.4 0.4 0.5 0.5 A  ro06891  Conserved hypothetical protein 1.1 1.8 3.9 4.9 5.5 4.6 5.1  0.9 1.3 2.4 3.4 3.3 1.5 0.9 B H ro06953  Transcriptional regulator 1.4 1.6 1.8 2.0 6.3 6.2 7.0  1.2 1.1 1.3 1.2 1.3 1.0 0.7 A R ro06965  Conserved hypothetical protein 2.2 1.5 0.9 1.3 2.2 2.2 3.2  2.3 1.2 1.2 1.5 1.7 1.4 1.1 A H ro07012  Conserved hypothetical protein 1.1 0.9 1.3 1.7 4.0 5.6 4.7  2.6 1.4 1.3 1.3 1.2 1.6 1.7 A H  124 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro07016 | ro10078 | ro01609 | ro08590 | ro08602 | ro08494 | ro08320  Possible transposase | transposase, IS630 family | probable transposase | probable transposase | transposase | probable transposase | probable transposase 1.5 2.0 2.6 2.1 1.9 1.8 2.2  1.2 1.8 1.9 1.5 1.9 1.5 1.5 C X ro07195  Probable transcriptional regulator 1.2 1.4 2.1 2.8 9.5 15.1 15.5  1.4 2.1 2.5 2.9 4.4 2.9 2.4 A R ro07196 sufB FeS assembly protein 1.2 1.7 5.0 6.2 16.4 14.2 18.4  0.8 1.3 3.1 2.9 3.2 2.0 1.4 A  ro07197 sufD FeS assembly protein 1.3 1.8 3.1 4.7 7.9 7.0 8.7  0.6 1.4 2.5 1.7 1.9 1.2 1.0 A  ro07198 sufC FeS assembly ATPase 0.8 1.6 3.0 3.8 6.8 6.7 9.0  0.5 0.8 1.4 1.5 1.6 1.1 0.9 A  ro07199 sufS Selenocysteine lyase 1.0 1.0 1.7 2.2 3.9 4.5 3.8  0.8 0.9 1.1 1.5 1.4 1.1 1.1 A  ro07200  Probable FeS assembly protein 0.9 1.6 2.5 3.0 3.3 3.3 3.6  0.6 0.7 1.1 1.6 2.0 1.4 1.2 B  ro07201  Possible metal-sulfur cluster protein 0.8 1.9 2.1 2.3 3.2 2.5 3.1  0.6 0.8 1.6 1.5 1.6 1.1 0.9 B  ro07210  Probable transcriptional regulator, MoxR family 1.0 1.3 2.0 2.5 2.1 2.0 2.1  0.7 0.9 1.3 1.6 1.5 1.1 1.0 B R ro07242  Possible membrane protein 1.1 2.1 2.2 3.4 3.4 3.2 3.6  0.9 1.0 1.6 1.7 1.8 1.1 1.1 B  ro07249  Possible transcriptional regulator 1.3 1.4 2.2 1.8 3.2 3.2 3.0  1.4 1.5 2.4 2.3 1.7 1.3 1.3 A R ro07269  Possible ABC Mn2+/Zn2+ transporter, permease component 0.9 1.5 1.9 2.9 2.2 2.4 2.5  0.4 0.5 1.5 3.7 3.4 3.1 2.2 B T ro07271  ABC metal ion transporter, substrate-binding protein 0.9 1.3 1.5 2.7 3.5 3.4 4.3  1.0 1.8 3.3 7.7 10.9 9.8 3.7 A T ro08002 | ro10457  Conserved hypothetical protein | conserved hypothetical protein 1.7 2.4 4.3 3.7 26.1 16.7 27.0  5.0 3.0 3.2 2.5 2.2 1.5 1.6 A H ro08004  Conserved hypothetical protein 0.8 2.7 2.1 1.6 1.5 2.1 1.8  1.1 2.2 1.3 1.5 1.7 1.0 0.8 C H ro08053  Hypothetical protein 1.1 1.6 5.1 9.2 12.9 12.9 12.5  0.7 1.3 7.5 6.8 6.0 5.5 3.6 B H ro08054 bphB1 cis-2,3-Dihydrobiphenyl-2,3-diol dehydrogenase 0.5 0.3 1.6 5.4 13.6 13.4 42.9  1.1 1.8 7.1 7.7 7.5 5.9 3.3 A  ro08055 bphC1 2,3-Dihydroxybiphenyl 1,2-dioxygenase 0.2 0.2 1.1 4.9 18.0 13.1 19.8  1.1 1.9 7.1 10.2 9.6 4.0 3.8 A  ro08057 bphAd Biphenyl 2,3-dioxygenase, reductase 0.6 1.0 0.9 2.8 9.2 10.4 9.7  1.2 1.2 3.0 4.0 4.3 3.4 1.5 A   125 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro08058 bphAc Biphenyl 2,3-dioxygenase, ferredoxin component 0.2 0.7 1.5 5.0 33.3 23.0 21.9  1.5 2.3 9.5 10.0 12.6 6.2 7.3 A  ro08059 bphAb Biphenyl 2,3-dioxygenase β subunit 0.8 0.8 1.3 6.4 23.0 32.1 27.1  1.2 2.1 11.2 9.9 14.9 5.3 4.6 A  ro08060 bphAa Biphenyl 2,3-dioxygenase α subunit 0.8 1.0 2.1 10.2 38.4 33.5 36.5  1.4 2.3 9.2 7.6 10.2 8.1 5.8 A  ro08215  Conserved hypothetical protein 1.3 1.7 2.8 2.7 2.8 2.4 3.3  1.0 1.1 1.6 1.8 1.6 1.4 1.3 B H ro08251 dps2 Starvation-response DNA binding protein 1.5 2.7 2.5 1.4 2.8 4.3 2.5  0.7 1.3 1.4 1.0 1.3 1.4 1.4 A  ro08264  Conserved hypothetical protein 1.2 1.6 2.2 2.7 2.8 2.7 3.4  1.5 1.3 1.7 2.4 2.6 2.4 1.8 B H ro08289  Possible transcriptional regulator 1.1 1.4 2.1 1.6 8.4 9.7 9.1  1.0 0.9 1.4 1.0 1.1 1.3 1.4 A R ro08290  Possible (p)ppGpp synthetase 1.1 2.5 2.7 2.2 13.4 14.9 20.9  1.3 1.6 1.6 1.5 1.8 1.5 1.3 A  ro08291  Conserved hypothetical protein 0.9 1.4 3.9 1.8 7.8 13.2 15.3  1.0 1.2 1.1 1.1 1.4 1.1 1.2 A H ro08341  Probable transcriptional regulator 2.2 2.4 1.8 1.9 3.4 5.0 4.4  1.3 1.4 0.8 0.8 1.1 1.2 1.8 A R ro08409 | ro09134 | ro08121  Possible glycosyl hydrolase | possible metallopeptidase | possible peptidase/glycoside hydrolase 2.1 4.5 2.1 2.9 3.6 11.6 3.9  0.9 2.0 1.0 1.5 3.9 6.9 8.3 A  ro08507  ABC ribose transporter, ATP-binding component 0.9 1.6 2.4 2.1 3.7 4.3 4.3  1.2 2.1 1.6 1.4 1.9 1.6 1.8 A T ro08513  Conserved hypothetical protein 1.1 1.2 1.4 1.3 2.0 2.3 2.5  1.1 1.0 1.0 1.1 1.0 0.9 1.2 A H ro08519 | ro08383  Conserved hypothetical protein | conserved hypothetical protein 1.2 2.1 3.0 4.0 3.8 10.3 3.6  1.1 1.4 1.5 3.0 4.8 2.6 3.9 A H ro08590 | ro08494 | ro08320 | ro08602 | ro07017 | ro01609 | ro10078  Probable transposase | probable transposase | probable transposase | transposase | possible transposase | probable transposase | transposase, IS630 family 2.0 2.7 3.2 2.7 3.8 3.8 4.4  1.5 1.4 2.1 1.9 2.0 1.8 2.1 A X ro08599  Possible plasmid-partitioning protein, ParB family 1.7 4.8 8.5 14.0 13.0 20.4 13.0  0.8 1.7 3.6 4.3 3.8 1.3 0.8 B C  126 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro08600  Probable chromosome-partitioning protein, ParA family 0.8 1.1 2.8 3.9 3.7 4.9 5.5  1.1 2.0 1.9 2.2 2.4 1.5 0.6 B C ro08605  Possible ATPase involved in chromosome partitioning 1.1 6.0 3.8 5.4 24.7 20.5 29.2  0.9 2.0 1.1 1.2 1.4 0.8 0.5 A C ro08659  Conserved hypothetical protein 0.9 1.7 1.6 3.1 2.1 2.5 3.0  0.7 1.4 1.2 2.2 2.1 2.2 2.0 B H ro08667  Conserved hypothetical protein 1.4 1.5 1.8 2.4 12.5 9.5 15.5  0.9 0.9 1.0 1.3 1.9 1.9 1.6 A H ro08668  Conserved hypothetical protein 1.3 2.9 1.7 1.9 7.8 8.8 7.2  0.9 0.8 1.0 1.7 1.4 1.6 1.8 A H ro08723 | ro00631  Hypothetical protein | rhodococcal conserved hypothetical protein 0.9 1.6 1.5 1.4 2.2 2.3 3.4  1.7 1.0 1.5 1.3 1.4 1.5 1.3 A H ro08763  Hypothetical protein 1.8 1.7 2.2 5.8 2.1 3.2 2.0  1.0 1.1 1.4 0.9 1.4 0.9 1.1 B H ro08791  Probable transcriptional regulator, GntR family 1.8 2.6 2.4 2.8 10.3 14.0 13.3  1.2 1.9 1.5 1.8 2.8 1.6 2.3 A R ro08847  Probable galactarate dehydratase 0.8 0.7 1.4 1.5 4.1 4.0 3.6  0.8 1.3 1.6 1.4 1.9 1.7 0.7 A  ro08855  Permease 1.1 2.7 3.7 4.2 3.2 2.8 3.4  1.0 2.0 1.5 1.4 1.7 0.8 0.7 B T ro08904  Transcriptional regulator, TetR family 1.2 1.1 1.8 2.7 3.0 2.8 3.8  1.9 1.3 1.6 2.7 3.0 1.8 1.3 B R ro08907  Transcriptional regulator, IclR family 0.9 1.2 2.1 3.1 3.0 1.9 3.0  1.1 0.9 1.8 2.1 2.5 2.7 2.2 B R ro08944  Probable enoyl-CoA hydratase 1.4 1.2 1.0 1.1 4.8 4.1 5.1  2.7 1.6 0.8 1.4 1.2 1.7 0.7 A L ro08945  Probable long-chain-fatty-acidCoA ligase 1.0 1.2 1.1 1.1 2.3 2.5 2.4  1.1 1.2 0.9 0.9 0.8 1.0 0.7 A L ro08947  Conserved hypothetical protein 1.2 2.8 1.7 1.6 3.3 5.8 10.0  1.3 1.6 0.9 1.4 1.7 1.8 1.2 A H ro08957  Probable short-chain dehydrogenase 0.9 1.0 2.7 3.0 4.7 5.6 5.2  1.4 1.1 2.3 1.9 2.1 1.5 0.7 A L ro10065  Possible exonuclease 1.2 1.1 1.3 1.6 2.3 2.6 2.5  1.5 0.9 1.0 0.8 0.6 0.7 0.9 A D ro10066  Conserved hypothetical protein 1.3 1.7 3.2 3.9 8.0 5.8 8.7  1.1 1.3 2.2 1.7 3.3 2.5 2.8 A H ro10114 | ro10094 | ro08611 | ro10351  Possible transposase, C-terminal | possible transposase | probable transposase | possible transposase 2.1 3.5 2.4 2.7 1.8 1.9 2.2  1.3 1.2 2.2 2.1 1.7 1.4 1.3 C X ro10119 | ro08049  Probable enoyl-CoA hydratase | enoyl-CoA hydratase 1.1 1.0 1.1 2.3 2.5 2.0 2.4  1.5 2.0 3.4 2.6 2.6 1.9 1.4 A L  127 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro10126 bphB2 cis-3-Phenylcyclohexa-3,5-diene-1,2-diol dehydrogenase 1.3 0.8 2.8 5.4 4.4 4.3 5.9  1.7 2.3 7.5 4.4 4.8 2.8 1.6 B  ro10135 etbC 2,3-Dihydroxybiphenyl 1,2-dioxygenase 1.1 1.0 2.3 8.2 15.7 15.4 17.0  1.0 1.5 5.3 8.0 6.2 4.1 2.5 A  ro10136 bphD1 2-Hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase 1.1 1.1 1.4 2.0 5.8 6.8 5.3  1.4 1.3 2.2 2.5 2.4 2.9 3.6 A  ro10139  Possible ketosteroid-isomerase-related protein 0.9 0.9 0.8 1.0 2.4 2.5 2.2  1.0 1.1 2.4 2.0 1.7 1.4 1.2 A  ro10143 | ro10133 etbAa2 | etbAa1 Ethylbenzene dioxygenase α subunit | ethylbenzene dioxygenase α subunit 0.6 0.7 1.5 6.3 16.6 14.4 14.8  2.7 3.4 8.3 8.9 6.5 5.5 3.5 A  ro10144 | ro10134 etbAb2 | etbAb1 Ethylbenzene dioxygenase β subunit | ethylbenzene dioxygenase β subunit 0.6 0.5 1.5 3.3 12.2 12.0 12.2  2.7 4.2 9.3 10.5 9.3 5.4 4.1 A  ro10163  Transcriptional regulator 0.9 1.6 1.7 2.0 2.7 2.2 2.3  0.8 0.8 1.0 1.2 1.2 1.4 1.6 B R ro10169 amiE Amidase 1.0 1.0 1.2 2.5 6.3 9.7 16.0  1.0 1.1 0.9 1.1 1.6 1.5 1.9 A  ro10374  Conserved hypothetical protein 1.4 1.8 1.5 1.6 4.0 4.0 4.2  1.1 1.1 1.0 1.1 1.3 2.8 3.1 A H ro10389  Protein kinase/transcriptional regulator, LuxR family 1.5 2.4 2.6 2.9 1.7 1.5 1.9  1.5 1.3 1.6 1.5 1.6 3.4 3.1 C R ro10403  Conserved hypothetical protein 0.5 0.8 2.1 2.3 3.3 5.8 3.9  0.8 1.0 1.2 1.7 2.4 1.8 1.3 A H ro11054  Probable transcriptional regulator 0.8 1.1 1.5 4.6 6.9 6.4 7.1  1.4 0.9 1.3 1.3 3.5 5.9 5.0 A R ro11098  ABC transporter, ATP-binding component 0.9 0.9 1.0 1.4 3.3 2.9 2.9  1.2 1.0 1.1 1.0 1.1 1.4 1.3 A T ro11154  Conserved hypothetical protein 1.6 1.2 0.8 1.0 3.0 2.5 3.4  2.0 1.1 1.2 1.2 1.3 1.3 0.9 A H ro11170 adhB Alcohol dehydrogenase 1.1 1.5 1.7 1.7 9.6 8.6 9.5  1.5 1.0 1.2 1.6 2.1 1.7 1.6 A  ro11227 | ro11226  Conserved hypothetical protein | probable polysulfide reductase 1.1 2.1 2.0 2.3 1.8 2.2 2.7  1.2 1.4 1.5 1.3 1.6 1.4 1.8 B H ro11237  Possible sulfurtransferase, rhodanese-related 1.2 1.9 1.8 2.3 2.2 2.0 2.5  0.9 0.9 1.1 1.0 1.1 1.2 1.3 B  ro11263  Possible ATPase, ParA type 1.0 1.9 2.9 3.0 2.2 2.0 2.4  0.9 1.3 1.4 1.1 1.0 0.8 0.9 B C ro11309 macA Maleylacetate reductase 0.9 1.1 1.4 1.1 2.6 2.7 2.8  1.0 0.8 0.9 0.9 0.8 0.9 0.9 A  ro11310  Hydroxyquinol 1,2-dioxygenase 1.9 4.4 4.0 2.6 1.1 1.3 1.0  1.6 1.8 2.8 1.8 1.6 1.7 0.9 C   128 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro11314  Possible transcriptional regulator, AraC family 1.4 1.8 2.5 2.2 2.6 2.4 2.9  0.8 1.6 2.0 1.4 1.7 1.1 2.7 B R                     Up-regulated genes during control experiment only                     ro00159  Conserved hypothetical protein 1.1 1.4 2.5 2.1 0.6 0.6 0.7  1.5 1.9 3.5 2.7 2.9 2.3 3.3   ro00247  Rod-shaping protein, MreB 3.3 2.6 0.9 1.2 0.8 0.9 0.9  4.0 1.7 1.3 2.5 3.1 2.9 1.8   ro00248  Cell-division protein 3.7 3.1 3.6 3.2 0.9 1.9 1.2  1.8 1.3 2.2 3.2 3.4 1.9 2.2   ro00565  Transcriptional regulator, TetR family 0.7 0.6 0.4 0.7 1.4 1.3 1.5  2.6 1.5 2.3 4.2 5.3 3.6 2.3   ro00722  Conserved hypothetical protein 1.7 2.3 4.0 4.8 8.6 15.9 10.6  4.7 4.3 2.6 2.6 3.2 10.3 7.2   ro00899 | ro02564 glcB Malate synthase G | malate synthase G 0.8 1.5 1.3 1.2 1.2 1.3 1.4  2.5 3.0 2.1 1.8 1.4 0.9 1.0   ro01049 sdhA1 Succinate dehydrogenase flavoprotein subunit 1.0 1.2 1.8 2.3 1.2 1.1 1.2  1.4 1.5 2.3 2.6 2.1 1.4 1.0   ro01170  Conserved hypothetical protein 1.2 1.9 1.0 0.6 0.7 0.5 0.7  2.2 3.2 2.5 1.9 1.5 1.2 1.6   ro01346  ABC sugar transporter, permease component 2.2 8.0 0.9 1.6 4.1 3.4 6.4  4.3 5.8 1.8 4.2 3.1 3.5 3.1   ro02509  Probable cytochrome P450 ferredoxinNAD+ reductase 1.1 1.1 1.7 3.8 0.6 0.8 0.6  1.4 1.1 2.2 6.7 6.9 3.7 1.7   ro02606  Possible amidohydrolase 1.5 3.2 2.0 2.6 1.1 1.0 1.5  2.2 1.5 1.8 2.6 2.3 1.1 0.9   ro03039  Formate dehydrogenase 2.1 1.6 1.4 1.4 1.2 0.2 1.3  3.5 2.2 2.1 1.8 1.3 1.1 1.0   ro03901 | ro05120  Conserved hypothetical protein | conserved hypothetical protein 1.0 1.1 1.0 0.7 0.4 0.4 0.6  4.6 4.9 2.6 3.6 5.2 1.7 1.2   ro04165  Possible vanillate monooxygenase oxygenase subunit 4.4 3.1 2.8 5.1 6.5 4.8 6.6  12.8 5.1 4.9 5.4 7.5 7.9 5.5   ro04428  Probable thiocyanate hydrolase γ subunit 1.2 1.4 2.1 2.2 0.8 0.6 0.8  4.5 3.9 5.3 7.0 13.0 7.5 6.5   ro04429  Probable thiocyanate hydrolase α subunit 1.2 1.3 1.6 1.9 0.8 0.7 0.7  3.0 2.6 3.7 6.1 7.8 5.7 3.6   ro04967  Conserved hypothetical protein 1.0 1.2 0.9 0.7 0.7 0.5 0.6  2.2 4.2 2.3 2.1 1.4 1.0 1.2   ro04975  Carbon monoxide dehydrogenase medium subunit 1.4 1.2 1.0 1.0 0.5 0.2 0.6  4.3 2.3 2.1 2.6 2.3 1.5 1.2    129 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro05112  Possible ferredoxinNADP+ reductase, C-terminal 1.6 1.6 1.7 2.2 1.6 1.3 1.8  2.7 2.0 2.9 3.0 3.1 2.1 2.0   ro05203  Butyryl-CoA dehydrogenase 1.1 2.2 1.3 0.8 1.0 0.9 1.1  5.0 7.7 4.4 3.1 2.3 1.0 1.0   ro05647  Probable phosphoserine phosphatase (Psp)/probable 1-acylglycerol-3-phosphate O-acyltransferase (PlsC) 1.8 2.2 1.6 2.7 1.2 1.6 1.5  2.9 3.1 2.6 3.6 4.0 1.8 0.9   ro05701  Sulfatase-modifying factor 1.7 1.7 2.1 1.6 0.8 0.6 0.7  3.8 2.6 2.6 1.8 1.1 0.8 0.8   ro05912  Probable NADH dehydrogenase subunit D 1.9 1.8 2.0 1.5 0.8 0.7 0.9  6.3 7.2 6.7 4.7 2.2 0.6 0.5   ro05938  Catalase 1.9 2.6 4.7 3.6 17.6 10.0 18.3  12.9 6.7 4.1 2.9 3.7 5.1 3.8   ro06191  Conserved hypothetical protein 0.9 0.7 0.8 0.7 0.6 0.8 0.6  1.6 2.1 2.1 1.9 2.4 1.3 0.9   ro06201 choD Cholesterol oxidase 1.0 1.7 1.3 0.9 0.8 0.6 0.9  2.6 4.1 4.1 2.4 1.7 1.3 1.0   ro06625  Conserved hypothetical protein 1.2 1.0 0.9 0.9 0.4 0.1 0.4  3.1 2.6 2.6 2.4 2.4 1.3 1.8   ro06679  Cyclohexanone monooxygenase 0.9 0.2 0.0 0.9 0.6 1.4 0.1  2.0 2.2 1.3 7.6 4.1 2.7 3.6   ro06689  Conserved hypothetical protein 0.8 0.5 0.4 0.7 1.6 1.3 1.4  2.7 1.3 2.9 4.5 5.4 3.4 2.7   ro06691  Possible transcriptional regulator 0.7 0.7 0.9 2.2 3.1 2.8 3.2  1.3 1.2 1.8 2.8 3.9 3.4 2.4   ro06927  Conserved hypothetical protein 1.2 1.5 1.1 2.0 1.0 1.1 1.1  2.2 2.0 2.0 2.3 2.3 2.8 1.7   ro06972  Conserved hypothetical protein 1.3 1.3 0.9 1.9 0.6 1.0 0.7  2.6 2.0 2.7 3.2 5.9 3.2 1.4   ro07061  Conserved hypothetical protein 1.5 1.0 0.7 1.0 1.0 1.0 1.0  3.5 1.4 1.6 2.2 2.4 4.1 3.9   ro08129 | ro09141 | ro08417  Conserved hypothetical protein | conserved hypothetical protein | conserved hypothetical protein 1.3 1.1 1.0 1.8 1.2 1.3 1.5  2.2 1.7 2.0 2.6 2.8 0.9 0.8   ro08138  Long-chain-acyl-CoA dehydrogenase 0.7 0.3 2.2 1.2 1.9 0.4 1.8  3.1 1.6 2.1 2.9 3.7 3.8 5.7   ro08142  Probable 5-valerolactone hydrolase 0.6 0.4 0.4 0.8 1.6 0.4 1.3  1.5 1.0 1.4 3.0 2.9 3.3 7.2   ro08148  Possible transposase 1.8 2.2 1.2 1.6 1.0 0.8 1.0  3.3 3.0 2.0 2.3 2.5 1.4 1.3   ro08579  Conserved hypothetical protein 2.1 4.1 16.4 8.3 7.9 14.9 14.3  3.9 2.2 2.7 2.5 3.2 4.6 8.9   ro08650  Possible nonribosomal peptide synthetase 1.5 1.7 1.9 1.5 0.9 0.8 0.9  3.8 2.7 3.1 2.8 1.4 1.1 1.0   ro10116 bphG4 Ccetaldehyde dehydrogenase 0.9 0.6 0.9 2.5 2.0 4.4 2.8  1.7 2.3 4.4 3.6 3.5 1.3 1.1    130 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro10127 chnE 6-Oxohexanoate dehydrogenase 0.9 1.4 1.2 2.2 2.2 3.5 2.6  1.2 1.4 2.4 2.7 3.0 2.1 1.2   ro11127  Conserved hypothetical protein 1.4 2.4 2.3 2.1 2.0 0.3 1.3  1.0 0.7 2.2 3.2 1.9 2.7 4.9   ro11317  Possible transcriptional regulator, AraC family 1.4 1.5 1.6 1.3 0.9 0.8 0.8  3.5 2.0 3.3 2.4 1.2 1.0 1.1   ro11331  Probable transcriptional regulator, LuxR family 1.1 1.3 0.8 0.6 0.7 0.6 0.7  2.0 3.0 2.1 1.6 1.3 1.1 1.1                       Up-regulated genes during both experiments                     ro00327  Probable transcriptional regulator, MarR family 1.5 4.4 12.1 13.7 9.2 7.8 8.9  1.2 2.3 5.5 4.0 5.2 3.2 2.9   ro01355  Oxidoreductase 1.7 8.8 1.0 1.1 2.3 2.7 2.2  1.3 3.4 2.6 2.3 2.2 1.7 1.9   ro03258 | ro03083 | ro08112  Possible transcriptional regulator, MerR family | possible transcriptional regulator, MerR family | possible transcriptional regulator, MerR family 1.4 2.8 4.2 8.8 13.2 14.0 12.7  1.6 1.9 4.3 7.3 15.3 8.6 9.9   ro03750  Possible membrane protein 2.5 1.8 1.0 1.5 2.3 2.6 3.2  2.8 2.1 1.4 1.8 2.1 1.1 1.4   ro04619  Hydrogenase expression/formation protein 1.5 1.9 1.8 2.7 2.1 2.4 2.3  1.6 1.0 1.3 2.0 3.0 2.7 2.0   ro04732  Hypothetical protein 1.7 2.2 3.5 2.5 28.9 23.7 38.4  5.0 2.6 2.4 2.0 2.3 1.6 1.8   ro05134  Conserved hypothetical protein 1.5 1.8 2.4 2.8 16.9 12.9 19.8  4.5 3.2 2.3 3.6 6.8 7.1 4.9   ro05230  Dehydrogenase 0.9 1.4 2.1 1.8 2.1 1.9 2.2  1.5 1.4 3.1 2.0 3.0 3.5 3.0   ro05232  Possible carbon monoxide dehydrogenase 1.0 2.1 4.0 3.1 2.1 2.0 2.3  3.5 5.0 8.3 6.7 8.0 10.0 17.2   ro05624  Possible serine protease, C-terminal 2.2 3.4 4.8 1.6 1.0 0.9 1.0  2.3 3.2 3.9 2.2 2.4 1.6 1.5   ro05625  Probable Mo-cofactor-biosynthesis protein 1.9 3.6 5.5 2.0 1.2 1.1 1.2  2.7 4.0 4.3 2.5 2.4 1.6 1.7   ro05882  Conserved hypothetical protein 2.7 3.9 5.0 2.0 0.8 0.9 0.8  3.0 2.3 3.3 2.2 2.1 1.7 2.0   ro05978  Conserved hypothetical protein 2.0 2.5 3.5 3.6 1.7 1.3 2.2  2.1 2.3 2.8 2.0 2.6 1.8 1.8   ro07270  ABC metal transporter, ATP-binding component 1.0 1.4 1.5 2.5 2.5 2.4 2.9  0.5 0.9 2.8 6.8 7.3 5.4 3.4   ro08050 | ro10120  Medium-chain acyl-CoA ligase | medium-chain acyl-CoA ligase 1.4 2.3 1.7 2.6 3.4 5.2 4.1  1.8 2.9 3.1 3.4 2.6 1.7 1.8    131 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro08345 dnaJ4 Chaperone protein 2.3 4.1 4.1 6.3 5.1 4.5 5.4  3.2 1.9 6.4 6.4 6.2 3.5 9.5   ro08347 | ro03567  Hypothetical protein | hypothetical protein 3.0 3.2 4.7 7.0 7.1 5.0 6.6  7.2 3.7 4.8 5.2 7.1 6.9 5.4   ro08348  Heat shock protein (18-kDa antigen-like protein) 2.6 2.1 1.9 2.8 3.8 3.6 3.5  3.3 2.1 2.0 2.1 2.7 2.5 2.1   ro08418 | ro09142 | ro08130  Possible secreted protein | possible secreted protein | possible secreted protein 2.2 2.1 2.3 4.2 1.2 1.1 1.2  3.3 3.0 4.2 5.5 5.9 1.7 1.0   ro08747  Possible transposase 2.7 2.7 1.2 2.2 1.2 1.5 1.5  9.2 3.8 3.3 4.4 3.6 1.7 0.9   ro08853  Transcriptional regulator, GntR family 1.3 2.3 4.7 5.2 5.2 7.5 5.9  1.6 1.4 3.1 2.8 3.5 2.4 2.5   ro08977  Probable carveol dehydrogenase 1.1 1.9 2.2 4.0 3.2 2.7 4.0  1.4 1.3 2.2 2.1 2.7 1.7 1.3   ro10122 | ro08052 bphS2 | bphS1 Sensor kinase, two-component system | sensor kinase, two-component system 0.9 2.0 4.9 3.2 2.6 2.2 2.6  1.1 1.7 4.7 3.2 2.7 1.5 1.4   ro10135 etbC 2,3-Dihydroxybiphenyl 1,2-dioxygenase 1.0 1.5 2.3 4.0 8.8 11.4 9.1  2.2 3.7 9.6 9.5 8.5 3.5 3.7   ro10286  Probable dioxygenase 1.0 1.0 4.8 9.4 18.3 10.6 20.8  1.9 1.8 5.4 9.6 35.5 40.1 27.1   ro10375  Conserved hypothetical protein 0.9 0.7 1.6 2.8 2.4 1.8 2.2  1.3 1.1 2.9 4.9 4.9 5.0 3.3                       Down-regulated genes during desiccation experiment only                     ro00034  Hydrogenase 2.1 1.9 0.3 0.3 0.3 0.2 0.4  2.1 1.6 0.5 0.5 0.6 0.5 0.8   ro00048  Response regulator, two-component system 0.7 0.3 0.4 0.3 0.4 0.5 0.3  0.9 0.8 0.9 1.2 1.1 1.1 1.0   ro00055  Conserved hypothetical protein 0.9 0.5 0.6 0.4 0.4 0.3 0.3  0.8 1.0 1.0 0.9 0.9 0.9 1.0   ro00085  Enoyl-CoA hydratase 1.2 1.4 1.5 0.7 0.4 0.3 0.3  1.0 1.4 1.0 0.9 0.8 0.9 0.9   ro00097  Hypothetical protein 0.9 0.4 0.6 0.6 0.5 0.6 0.5  1.1 1.1 0.9 0.9 0.7 0.8 0.9   ro00108  Conserved hypothetical protein 0.7 0.4 0.5 0.3 0.3 0.2 0.2  0.8 1.0 0.9 0.9 0.9 0.8 0.9   ro00118  Conserved hypothetical protein 0.9 0.5 0.4 0.3 0.2 0.2 0.2  1.3 1.4 0.8 0.5 0.5 0.4 0.3   ro00119  Hypothetical protein 1.2 0.7 0.6 0.5 0.3 0.2 0.3  1.9 1.3 1.1 1.0 0.7 0.7 0.6   ro00131  Probable glycosyltransferase 0.5 0.2 0.3 0.3 0.4 0.5 0.3  0.9 1.1 1.1 1.7 1.1 0.8 0.7   ro00140  Possible lipase 1.0 1.1 0.8 0.7 0.4 0.3 0.3  1.5 1.3 1.1 1.5 1.5 0.8 0.8   ro00182  Hypothetical protein 0.9 0.4 0.4 0.3 0.2 0.3 0.2  1.1 0.9 0.9 0.9 0.6 0.5 0.7   ro00191  Conserved hypothetical protein 1.0 0.8 0.5 0.4 0.3 0.6 0.5  1.3 0.8 0.7 0.7 0.7 1.0 1.2   ro00256  Uracil phosphoribosyltransferase 1.5 1.1 0.6 0.4 0.3 0.2 0.3  2.1 1.2 1.0 1.0 0.9 0.9 0.9    132 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro00269  Possible redox protein 0.7 0.5 0.5 0.4 0.4 0.4 0.4  0.9 1.1 1.0 1.1 0.9 0.9 1.0   ro00322 leuB1 3-Isopropylmalate dehydrogenase 0.7 0.6 0.4 0.5 0.5 0.5 0.5  0.8 1.0 0.8 0.8 0.9 1.0 1.1   ro00340  Aldehyde dehydrogenase (NAD+) 0.8 0.4 0.5 0.4 0.5 0.4 0.4  0.9 0.9 0.9 1.0 0.8 0.9 1.1   ro00407  Bifunctional 3-hydroxyacyl-CoA dehydrogenase/3-hydroxybutyryl-CoA epimerase 0.6 0.3 0.2 0.5 0.6 0.8 0.5  1.1 1.0 1.3 1.7 1.1 1.2 1.1   ro00492  Malate dehydrogenase (oxaloacetate-decarboxylating) 1.0 0.7 0.5 0.4 0.5 0.4 0.5  1.2 1.2 0.9 0.9 0.9 1.0 1.4   ro00497  Conserved hypothetical protein 1.0 0.5 0.4 0.4 0.2 0.1 0.2  2.0 1.2 0.7 0.7 0.8 0.5 0.6   ro00506  Hypothetical protein 0.8 0.4 0.4 0.4 0.3 0.3 0.2  1.0 0.9 0.9 1.0 0.7 0.8 0.6   ro00514  Possible short-chain dehydrogenase 1.1 0.6 0.5 0.3 0.5 0.2 0.4  1.3 1.2 0.9 0.8 0.5 0.3 0.8   ro00539  Acetoacetate-CoA ligase 0.9 1.0 0.4 0.4 0.4 0.1 0.3  0.8 1.1 0.7 0.7 0.9 1.1 1.4   ro00542  Pyruvate dehydrogenase E1 component 0.7 0.4 0.6 0.7 0.3 0.5 0.3  1.3 1.0 1.4 1.6 1.3 1.3 1.0   ro00546  Pseudogene of acetolactate synthase 0.8 0.4 0.3 0.3 0.5 0.5 0.4  1.1 1.1 0.9 1.0 0.8 1.0 1.1   ro00561  Possible DNA-binding protein 0.7 0.4 0.3 0.4 0.3 0.7 0.3  1.2 1.1 0.9 0.9 0.8 1.0 1.2   ro00598  Probable amino acid transporter 0.6 0.4 0.4 0.6 0.6 0.7 0.5  0.9 0.8 1.3 1.7 1.1 1.2 0.9   ro00615  Hypothetical protein 1.1 0.9 0.8 0.4 0.2 0.1 0.1  1.7 1.6 1.5 1.1 0.7 0.6 0.6   ro00618  Isocitrate dehydrogenase (NADP+) 0.5 0.5 0.6 0.4 0.4 0.2 0.3  0.8 0.8 0.6 0.6 0.7 0.5 0.5   ro00635 | ro00552 | ro03424  Hypothetical protein | hypothetical protein | hypothetical protein 1.5 0.7 0.4 0.3 0.3 0.1 0.3  1.3 1.4 1.0 1.0 1.1 1.4 1.6   ro00636 | ro00553  Conserved hypothetical protein | conserved hypothetical protein 0.7 0.3 0.3 0.2 0.3 0.2 0.2  1.3 1.2 1.2 1.2 1.1 1.4 1.8   ro00640  Hypothetical protein 0.8 0.5 0.4 0.5 0.4 0.4 0.3  0.8 1.0 0.8 0.8 0.9 0.9 1.0   ro00676  Conserved hypothetical protein 2.5 3.1 1.0 0.6 0.4 0.3 0.4  0.9 1.0 0.5 0.5 0.5 0.5 0.4   ro00677  Possible extracellular protein 1.9 1.8 0.6 0.4 0.1 0.0 0.2  1.9 1.6 0.6 0.3 0.2 0.1 0.1    133 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro00724 | ro01629  Indolepyruvate ferredoxin oxidoreductase α and β subunit | probable indolepyruvate ferredoxin oxidoreductase 2.8 1.9 0.1 0.1 0.1 0.1 0.1  13.9 8.2 0.9 0.9 1.1 1.1 1.1   ro00743  Transposase 0.8 0.7 0.7 0.6 0.4 0.4 0.4  1.1 1.1 1.4 1.0 1.0 1.1 1.1   ro00798  Short-chain dehydrogenase/reductase 0.9 0.5 0.3 0.6 0.4 0.3 0.4  1.2 1.3 1.0 0.8 0.9 0.9 1.3   ro00814  Possible transketolase, C-terminal subunit 0.7 0.5 0.5 0.5 0.5 0.7 0.5  1.0 1.1 1.0 1.0 1.3 1.3 1.3   ro00819  ABC ribose transporter, substrate-binding component 0.6 0.3 0.4 0.4 0.2 0.1 0.3  0.7 0.9 0.9 1.0 0.9 1.0 1.0   ro00824  Probable flavin-containing monooxygenase 0.9 0.6 0.5 0.5 0.4 0.3 0.3  1.6 1.3 0.9 1.1 0.9 0.8 0.8   ro00900  Conserved hypothetical protein 1.2 0.8 0.2 0.3 0.2 0.2 0.2  0.9 1.7 2.5 1.5 1.5 1.1 0.9   ro00981  ABC amino acid transporter, ATP-binding component 1.1 1.5 2.0 1.4 0.4 0.4 0.4  0.7 0.9 1.4 1.2 0.8 0.4 0.3   ro00995  Probable branched-chain amino acid ABC transporter binding protein 1.4 1.5 0.8 0.3 0.1 0.1 0.1  1.6 1.7 1.3 0.7 0.4 0.1 0.1   ro01001  Probable sigma factor, includes region 2 0.9 0.6 0.5 0.4 0.3 0.4 0.4  1.2 0.9 1.0 0.9 0.6 0.7 0.8   ro01005  Conserved hypothetical protein 0.7 0.6 0.8 0.7 0.4 0.5 0.5  1.0 0.8 0.8 0.9 0.8 1.3 1.0   ro01085  Cell division protein, FtsZ 0.6 0.9 1.0 0.7 0.2 0.2 0.2  0.6 0.9 0.9 0.9 0.9 0.3 0.2   ro01190  Hypothetical protein 0.8 0.5 0.4 0.4 0.2 0.2 0.2  2.9 1.6 1.0 1.0 0.8 0.5 0.5   ro01283  Conserved hypothetical protein 0.7 0.6 0.5 0.4 0.4 0.5 0.4  1.0 1.1 1.2 1.3 0.9 1.3 1.1   ro01372  ATP-dependent protease proteolytic subunit 1.3 1.5 0.7 0.4 0.3 0.2 0.3  1.6 1.8 0.6 0.4 0.4 0.3 0.2   ro01387  Possible endonuclease 1.0 1.0 1.3 1.2 0.4 0.3 0.4  1.5 1.3 1.7 1.5 1.5 0.6 0.4   ro01418  Oligoribonuclease 0.8 0.8 0.6 0.5 0.5 0.4 0.4  0.7 0.9 0.7 0.7 0.8 0.7 0.9   ro01506  Short-chain dehydrogenase 0.7 0.5 0.4 0.3 0.2 0.1 0.1  1.4 0.9 0.7 1.0 0.7 0.4 0.7   ro01511  Metabolite transporter, MFS superfamily 0.6 0.4 0.2 0.2 0.3 0.5 0.2  1.5 1.0 0.8 0.7 0.8 1.2 1.2   ro01514  Probable phosphotriesterase 0.7 0.3 0.3 0.3 0.3 0.1 0.2  0.8 0.7 0.5 0.4 0.6 0.6 0.5   ro01526  Endopeptidase Clp subunit 1.2 1.3 0.5 0.4 0.4 0.3 0.4  1.3 1.2 0.6 0.6 0.6 0.5 0.5   ro01531  Conserved hypothetical protein 0.5 0.2 0.3 0.3 0.3 0.4 0.2  0.8 1.2 1.2 1.7 1.3 0.6 0.7    134 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro01547  Glucosamine-6-phosphate deaminase 0.7 0.7 0.5 0.6 0.5 0.2 0.4  0.7 1.0 0.7 0.8 0.8 1.2 0.7   ro01550  Protein-N(pi)-phosphohistidinesugar phosphotransferase 0.6 0.6 0.5 0.6 0.5 0.5 0.5  0.6 0.7 0.6 0.5 0.7 0.8 0.6   ro01551  Protein-N(pi)-phosphohistidinesugar phosphotransferase 0.7 0.5 0.4 0.4 0.3 0.3 0.3  0.8 0.7 0.6 0.8 0.7 0.8 0.8   ro01552  Protein-N(pi)-phosphohistidinesugar phosphotransferase 0.5 0.3 0.3 0.5 0.4 0.4 0.3  1.1 1.0 1.2 1.4 1.1 1.0 0.7   ro01553  Transcriptional regulator, GntR family 0.6 0.2 0.4 0.4 0.4 0.5 0.3  1.5 1.8 1.7 2.4 1.4 0.9 0.6   ro01571  Conserved hypothetical protein 0.7 0.5 0.5 0.4 0.5 0.4 0.4  0.7 0.9 0.8 0.8 0.7 0.9 1.0   ro01576 pdhA1 Pyruvate dehydrogenase E1 component α subunit 2.6 2.5 0.3 0.3 0.4 0.3 0.4  7.1 8.4 0.7 0.8 1.2 1.4 1.9   ro01580  Possible phenoxazinone synthase 0.5 0.3 0.4 0.4 0.4 0.4 0.3  1.2 1.2 1.0 2.2 1.1 0.9 0.8   ro01585  AMP-dependent synthetase 1.7 1.6 0.5 0.4 0.3 0.2 0.2  4.0 2.5 1.0 0.8 0.5 0.7 0.6   ro01587  Possible peptidase 1.5 1.0 0.4 0.4 0.4 0.3 0.3  2.3 1.6 1.1 1.3 1.1 1.2 1.1   ro01602  Probable esterase 1.4 1.1 0.8 0.6 0.3 0.2 0.3  2.3 1.6 1.3 1.6 1.3 0.9 1.1   ro01628  Leucine dehydrogenase/ phenylalanine dehydrogenase 3.9 3.0 0.2 0.1 0.1 0.1 0.1  7.4 6.8 0.9 1.0 1.4 1.3 1.5   ro01630  Transcriptional regulator, AsnC family 2.7 1.3 0.3 0.2 0.2 0.1 0.2  7.0 3.5 1.3 1.3 1.2 0.6 0.5   ro01703  Hypothetical protein 1.1 0.9 0.3 0.3 0.2 0.0 0.2  1.4 1.0 0.5 0.6 0.6 0.5 0.6   ro01786  Possible enhanced intracellular survival protein 0.8 0.6 0.5 0.4 0.3 0.2 0.2  1.4 1.0 0.7 0.7 0.6 0.5 0.4   ro01795  Conserved hypothetical protein 1.1 1.0 0.9 0.6 0.3 0.4 0.2  1.2 0.9 0.8 0.7 0.7 0.8 0.7   ro01833  Conserved hypothetical protein 1.2 1.2 0.3 0.1 0.1 0.0 0.1  1.0 0.9 0.3 0.3 0.2 0.2 0.2   ro01837  Exodeoxyribonuclease V β subunit 1.0 0.7 0.7 0.7 0.5 0.4 0.4  0.9 0.9 0.9 0.8 0.8 0.9 0.9   ro01880  Aryl-alcohol dehydrogenase (NADP+) 0.7 0.5 0.6 0.5 0.5 0.4 0.5  0.7 1.0 0.9 0.9 1.1 1.5 1.5    135 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro01893  ABC amino acid transporter, periplasmic binding protein 1.0 0.8 0.5 0.4 0.3 0.1 0.2  1.5 1.4 0.7 0.7 0.6 0.4 0.4   ro01895  ABC amino acid transporter, ATP-binding component 1.1 1.6 1.2 0.8 0.4 0.3 0.5  1.0 1.2 1.0 0.9 0.8 0.6 0.6   ro01903  Conserved hypothetical protein 0.9 0.8 0.6 0.5 0.2 0.2 0.3  1.6 1.2 0.8 0.7 0.6 0.4 0.3   ro01942  Probable adenylate cyclase 0.8 0.5 0.6 0.6 0.4 0.3 0.4  0.9 1.0 1.1 1.0 1.0 1.1 1.1   ro01979 rplK 50S ribosomal protein L11 1.1 0.5 0.2 0.2 0.2 0.2 0.2  1.2 1.2 0.9 0.9 1.0 1.3 1.2   ro02002  Conserved hypothetical protein 0.9 0.5 0.5 0.3 0.4 0.4 0.3  0.8 0.8 0.7 0.8 0.6 0.7 0.8   ro02006  Possible glyoxylase 1.1 1.3 1.0 0.9 0.5 0.4 0.5  1.1 1.0 0.9 0.7 0.8 0.7 0.5   ro02033  Possible cytochrome c-biogenesis membrane protein 0.8 0.5 0.4 0.3 0.4 0.3 0.3  0.7 0.8 0.7 0.7 0.8 0.7 0.9   ro02046  Hypothetical protein 0.9 0.7 0.4 0.3 0.4 0.2 0.4  1.3 1.0 0.6 0.4 0.3 0.3 0.3   ro02076  Possible LMBE-related protein 1.0 1.2 0.9 0.8 0.5 0.5 0.4  1.1 1.0 0.8 0.9 0.7 0.8 0.9   ro02095  Probable ubiquinone/menaquinone biosynthesis methyltransferase 1.4 1.2 0.7 0.7 0.4 0.3 0.4  1.3 1.1 0.6 0.6 0.5 0.5 0.5   ro02096  Probable formyltetrahydrofolate deformylase 0.8 0.8 0.6 0.6 0.4 0.4 0.3  0.9 1.1 1.1 0.9 0.7 0.9 1.0   ro02133  Conserved hypothetical protein 1.3 3.1 2.1 1.0 0.3 0.3 0.3  1.1 1.6 1.4 0.9 0.6 0.4 0.4   ro02185  Probable aminopeptidase 1.1 1.0 0.9 0.9 0.4 0.4 0.4  1.4 1.0 0.9 0.8 0.8 0.5 0.4   ro02231  ABC amino acid transporter, permease component 0.9 0.5 0.4 0.4 0.5 0.5 0.3  0.9 0.8 0.7 0.8 0.7 0.6 0.7   ro02239  Conserved hypothetical protein 0.8 0.4 0.5 0.3 0.3 0.3 0.3  0.9 0.9 0.8 0.9 0.9 0.9 1.0   ro02269  D-Serine/D-alanine/glycine transporter, APC family 0.7 0.5 0.4 0.3 0.4 0.2 0.3  0.8 0.9 0.7 0.6 0.5 0.6 0.6   ro02277  Conserved hypothetical protein 0.6 0.4 0.5 0.5 0.5 0.7 0.4  0.9 0.9 0.9 1.5 0.7 0.8 0.7   ro02301  Response regulator, two-component system 0.7 0.3 0.2 0.2 0.2 0.2 0.2  1.0 1.0 0.8 0.9 1.0 0.8 0.9   ro02306  Possible long-chain-fatty-acidCoA ligase 0.9 1.2 0.5 0.3 0.4 0.4 0.3  0.9 1.0 0.8 0.7 0.6 0.9 1.1   ro02307  Conserved hypothetical protein 0.5 0.2 0.3 0.3 0.3 0.4 0.3  0.9 1.0 1.2 1.6 1.0 0.8 0.6   ro02312  Probable transcriptional regulator, MarR family 0.8 0.5 0.6 0.5 0.5 0.6 0.4  1.0 0.8 1.1 1.0 0.7 1.0 1.1   ro02322  Probable isochorismatase 0.8 0.4 0.3 0.4 0.4 0.6 0.4  1.3 0.9 0.8 0.9 0.8 0.8 1.0    136 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro02328  Alkylated-DNA repair protein 0.6 0.3 0.4 0.3 0.4 0.2 0.3  0.8 1.1 0.9 1.0 1.1 1.5 1.9   ro02361  Probable lipase 1.1 0.8 0.8 0.5 0.3 0.2 0.3  6.5 5.3 2.7 1.7 0.9 0.5 0.4   ro02396 gpdA1 Glycerol-3-phosphate dehydrogenase (NAD[P]+) 1.2 1.0 0.8 0.9 0.4 0.4 0.4  1.6 1.4 1.1 1.3 1.1 0.8 0.5   ro02407  Conserved hypothetical protein 1.1 0.7 0.5 0.5 0.6 0.4 0.5  1.0 1.0 0.8 1.0 1.0 1.1 0.9   ro02428  Possible membrane protein 1.4 0.8 0.4 0.3 0.3 0.2 0.3  1.9 1.1 0.8 0.8 0.7 0.8 0.6   ro02461  Probable N-acyl-D-amino-acid deacylase 0.5 0.3 0.3 0.3 0.3 0.4 0.3  1.0 1.0 1.1 1.7 1.0 0.8 0.8   ro02468  Possible glucose dehydrogenase 0.5 0.2 0.3 0.3 0.4 0.3 0.2  1.2 1.4 1.2 2.0 1.4 0.8 0.5   ro02481  Carveol dehydrogenase 1.2 0.5 0.4 0.3 0.3 0.4 0.3  0.9 0.8 0.8 0.7 0.7 0.7 0.7   ro02490  Probable dioxygenase Rieske FeS component 1.3 1.1 0.6 0.5 0.2 0.1 0.3  0.8 1.3 0.7 0.6 0.7 1.0 0.9   ro02504  Conserved hypothetical protein 1.3 0.8 0.5 0.4 0.3 0.3 0.3  1.5 0.9 0.6 0.7 0.6 0.4 0.4   ro02523  Conserved hypothetical protein 0.6 0.4 0.2 0.3 0.4 0.4 0.3  0.7 0.7 0.6 0.8 0.6 0.7 0.6   ro02553  Possible epimerase 0.7 0.6 0.6 0.5 0.4 0.4 0.4  0.7 1.0 0.8 0.8 0.8 0.9 1.1   ro02570  Probable allantoinase 0.8 0.3 0.5 0.4 0.6 0.7 0.4  1.1 1.1 1.3 1.5 1.2 1.0 1.1   ro02581  Protein kinase 0.7 0.3 0.4 0.4 0.4 0.6 0.3  1.3 1.3 1.4 1.8 1.1 1.3 1.4   ro02594  Probable lactone hydrolase 0.6 0.5 0.4 0.4 0.5 0.1 0.4  1.1 0.8 0.8 0.7 0.9 1.0 0.9   ro02598  Probable serine-type D-Ala-D-Ala carboxypeptidase 1.1 1.6 0.6 1.0 0.4 0.3 0.4  1.1 1.1 1.6 1.5 1.4 0.9 0.7   ro02605  Possisble haloalkane dehalogenase 0.7 0.4 0.4 0.5 0.5 0.4 0.4  0.7 0.8 0.8 0.8 1.2 0.8 0.9   ro02621  Probable response regulator, two-component system 0.7 0.5 0.4 0.8 0.5 0.8 0.3  0.6 0.6 0.7 0.7 0.6 0.9 0.7   ro02647  Aldehyde dehydrogenase 0.7 0.4 0.4 0.5 0.7 0.7 0.6  1.1 1.1 1.4 1.3 1.0 1.0 0.9   ro02696  Acyl-CoA dehydrogenase 0.3 0.2 0.4 0.5 0.3 0.8 0.2  1.2 1.2 1.0 1.1 0.8 1.1 1.2   ro02752  Hypothetical protein 0.7 0.4 0.5 0.5 0.5 0.9 0.5  1.0 1.2 1.4 1.3 1.3 1.1 1.6   ro02847 hpaC Reductase, monooxygenase component 0.7 0.4 0.5 0.5 0.5 0.6 0.5  0.8 0.9 1.2 1.0 0.8 1.2 1.1   ro02889  Possible amine oxidase 1.1 1.0 0.6 0.5 0.4 0.3 0.3  0.7 0.7 0.6 0.6 0.6 0.7 0.8   ro02892  Aldehyde dehydrogenase 0.6 0.4 0.3 0.3 0.4 0.4 0.5  0.7 0.7 0.5 0.5 0.9 0.5 0.6   ro02894  Hypothetical protein 1.2 1.0 1.1 0.7 0.4 0.4 0.4  1.6 1.4 1.1 0.9 0.7 0.4 0.3   ro02903 serA1 Phosphoglycerate dehydrogenase 0.6 0.3 0.4 0.3 0.4 0.3 0.4  1.0 1.1 2.1 1.4 1.1 0.7 0.6   ro02905  Probable short-chain dehydrogenase 0.4 0.1 0.1 0.1 0.3 0.1 0.3  1.0 0.8 0.8 0.9 0.8 1.0 0.9    137 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro02906  ABC sugar transporter, permease component 0.2 0.1 0.2 0.2 0.3 0.2 0.4  0.8 0.9 0.8 1.1 0.9 1.0 1.1   ro02909  Transcriptional regulator, GntR family 0.4 0.2 0.1 0.3 0.8 0.7 0.9  1.3 0.9 0.7 0.7 0.8 0.7 0.7   ro02940  Probable AidB protein 0.7 0.4 0.5 0.4 0.7 0.7 0.5  1.5 1.5 1.8 1.9 1.2 0.9 0.9   ro02953  Possible transcriptional regulator, IclR family 0.8 0.7 0.6 0.6 0.5 0.5 0.4  1.0 1.1 1.1 1.3 0.8 1.1 1.1   ro02958  Hypothetical protein 1.2 0.9 0.5 0.5 0.2 0.2 0.1  2.2 1.2 0.9 1.1 0.9 0.6 0.6   ro02972  Conserved hypothetical protein 0.5 0.2 0.3 0.3 0.3 0.3 0.2  1.4 1.8 1.3 2.1 1.1 0.8 0.6   ro02974  Probable muconate cycloisomerase 0.7 0.3 0.3 0.3 0.3 0.1 0.2  0.7 1.4 0.7 0.6 1.2 0.5 0.5   ro02998  Sugar transporter, MFS superfamily 0.7 0.5 0.5 0.5 0.8 1.2 0.8  0.9 0.6 0.9 0.8 0.9 1.4 1.3   ro03019  Protein kinase/transcriptional regulator, LuxR family 0.7 0.4 0.6 0.5 0.7 0.6 0.5  1.2 1.4 1.3 1.6 1.3 1.1 1.3   ro03025  Acyl-CoA dehydrogenase 0.5 0.2 0.3 0.2 0.4 0.6 0.2  1.4 1.6 1.3 2.0 1.2 1.0 0.8   ro03076 | ro05210  Cytochrome P450 CYP136 | cytochrome P450 CYP136 1.0 0.6 0.4 0.4 0.4 0.3 0.4  1.4 1.1 0.8 0.7 0.8 0.8 0.8   ro03084  Possible cytochrome P450 0.5 0.2 0.3 0.3 0.4 0.4 0.2  1.1 1.1 1.0 1.1 0.8 1.1 1.1   ro03104  Possible oxidoreductase 1.0 0.4 0.2 0.3 0.3 0.3 0.2  3.4 3.1 1.3 1.2 0.9 1.0 1.1   ro03118  Possible tyrosine recombinase 0.8 0.4 0.4 0.4 0.4 0.5 0.4  1.3 1.3 1.3 1.5 1.0 1.1 0.9   ro03127  Possible MspA porin 1.5 1.9 0.7 0.2 0.2 0.1 0.2  1.6 1.7 1.2 1.0 0.7 0.3 0.5   ro03133 | ro08556  Conserved hypothetical protein | conserved hypothetical protein 0.6 0.3 0.3 0.2 0.2 0.2 0.2  1.0 1.3 0.9 0.9 1.1 1.2 1.3   ro03156  Conserved hypothetical protein 0.7 0.4 0.4 0.4 0.4 0.4 0.3  1.1 1.0 0.9 1.0 0.7 0.7 0.7   ro03191  Possible forkhead-associated domain 0.8 0.5 0.5 0.4 0.4 0.5 0.3  0.9 0.9 1.0 1.0 0.8 0.9 1.1   ro03193  Hypothetical protein 1.3 0.8 0.3 0.3 0.2 0.4 0.2  3.2 2.0 1.1 1.2 1.1 1.5 1.4   ro03216  Hypothetical protein 0.6 0.5 0.5 0.5 0.4 0.1 0.4  0.6 0.8 0.8 0.8 1.0 1.0 1.0   ro03237 | ro00788  Probable transcriptional regulator, LuxR family | possible protein kinase/transcriptional regulator, LuxR family 0.4 0.2 0.3 0.3 0.2 0.4 0.2  1.3 1.4 1.2 2.1 1.4 1.0 0.7   ro03316  Possible lyase, glyoxalase family protein 1.2 0.6 0.4 0.3 0.2 0.2 0.2  3.3 3.5 0.9 1.1 1.0 1.1 1.2    138 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro03337  Probable leucine-responsive regulator 0.8 0.5 0.4 0.3 0.4 0.4 0.4  1.2 1.2 0.9 1.0 1.0 1.2 1.1   ro03340  Conserved hypothetical protein 1.3 1.2 0.5 0.4 0.3 0.3 0.3  3.6 2.8 1.0 0.9 0.9 0.4 0.3   ro03346  Fatty acid desaturase 0.6 0.4 0.4 0.4 0.6 0.4 0.4  0.7 0.5 0.6 0.7 0.8 0.9 0.9   ro03350  Probable hydrolase 0.8 0.5 0.5 0.4 0.4 0.4 0.4  0.8 0.9 0.8 0.7 0.6 0.7 0.9   ro03365  Possible hydrolase 1.0 1.0 0.8 0.5 0.4 0.1 0.3  1.1 0.9 0.7 0.7 1.1 1.3 1.1   ro03370  Protein kinase/transcriptional regulator, LuxR family 0.8 0.3 0.5 0.5 0.8 0.7 0.5  1.3 1.6 1.5 2.0 1.9 0.8 0.6   ro03381  Possible transcriptional regulator, AsnC family 1.9 0.8 0.2 0.2 0.2 0.1 0.2  4.5 2.2 0.9 0.8 0.6 0.5 0.4   ro03390  Possible butyryl-CoA dehydrogenase 1.4 0.8 0.3 0.3 0.3 0.2 0.3  1.0 1.1 1.3 1.0 0.8 0.5 0.7   ro03438  Probable transcriptional regulator, LuxR family 0.7 0.7 0.5 0.4 0.4 0.4 0.3  1.1 0.9 0.7 0.7 0.8 0.5 0.7   ro03445  Conserved hypothetical protein 0.7 0.6 0.5 0.5 0.4 0.2 0.4  0.8 0.9 0.9 1.0 0.9 0.9 1.1   ro03538  Conserved hypothetical protein 0.8 0.5 0.5 0.5 0.6 0.6 0.5  0.9 1.2 1.0 1.1 1.0 1.0 0.9   ro03565  Transcriptional regulator, MerR family 1.1 0.7 0.4 0.4 0.4 0.3 0.3  0.7 1.2 0.7 0.8 0.9 0.9 1.1   ro03585  Cobaltochelatase, CobT 1.7 0.8 0.1 0.1 0.1 0.1 0.2  2.2 1.6 0.9 0.9 1.2 1.2 1.3   ro03628  Conserved hypothetical protein 0.7 0.4 0.3 0.4 0.4 0.4 0.3  0.8 0.9 0.8 0.7 0.8 0.9 1.0   ro03691  Possible rhomboid family protein 0.6 0.3 0.4 0.3 0.5 0.5 0.4  1.3 1.3 1.4 1.9 1.3 0.7 0.6   ro03709  Possible mitomycin C resistance protein 1.1 0.8 0.5 0.6 0.5 0.3 0.4  1.9 1.3 0.8 1.1 0.8 0.8 0.6   ro03767  Probable ATP-dependent transcriptional regulator 0.7 0.3 0.3 0.3 0.4 0.4 0.3  1.0 1.0 0.9 0.8 0.7 0.8 0.9   ro03768  Probable Na+/H+ antiporter, CPA1 family 0.8 0.3 0.5 0.5 0.5 0.6 0.4  0.9 0.6 1.0 1.3 1.9 2.6 2.8   ro03773  Flavin-binding monooxygenase 0.8 0.6 0.5 0.5 0.5 0.4 0.4  1.2 1.0 0.9 0.9 0.8 0.8 1.0   ro03820  Conserved hypothetical protein 0.7 0.5 0.4 0.4 0.4 0.7 0.5  1.2 0.9 0.7 0.7 0.5 0.7 0.7   ro03836  Possible β-lactamase 0.6 0.5 0.5 0.5 0.5 0.4 0.5  0.8 1.0 0.9 1.0 0.8 0.7 0.7   ro03839  Possible DGPF protein 1.0 0.7 0.5 0.4 0.4 0.3 0.4  1.2 1.0 0.7 0.8 0.7 0.6 0.6   ro03892  Acetyl-CoA C-acetyltransferase 0.8 0.5 0.5 0.4 0.6 0.7 0.4  0.9 0.8 1.2 1.6 0.8 1.1 1.0   ro03901  Conserved hypothetical protein 0.9 0.4 0.4 0.3 0.5 0.2 0.4  0.8 0.9 0.8 0.8 0.7 0.8 1.1   ro03908  Aromatic acid/H+ symporter, MFS superfamily 0.8 0.5 0.3 0.5 0.4 0.9 0.4  1.0 1.1 0.9 0.9 0.9 1.2 1.1    139 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro03909  Possible fumarylacetoacetate hydrolase 0.5 0.3 0.3 0.3 0.4 0.3 0.3  1.0 1.1 1.4 2.2 1.2 0.8 0.6   ro03960  Conserved hypothetical protein 1.0 0.7 0.5 0.4 0.3 0.2 0.3  2.2 1.2 0.7 0.7 0.7 0.5 0.4   ro03967  Metabolite transporter, MFS superfamily 1.9 4.3 0.6 0.6 0.4 0.4 0.4  1.3 3.1 0.6 0.6 0.8 0.7 0.7   ro03974  Probable NAD-dependent aldehyde dehydrogenase 0.5 0.3 0.3 0.2 0.2 0.2 0.2  0.7 0.7 0.5 0.5 0.6 0.4 0.4   ro03980  Probable acetolactate synthase large subunit, TPP family 0.8 0.4 0.3 0.2 0.3 0.4 0.3  2.5 2.4 0.9 0.9 1.0 1.0 1.2   ro03990  Probable Zn-binding oxidoreductase 1.6 1.5 1.0 0.7 0.3 0.2 0.3  2.0 1.2 0.8 0.8 0.7 0.6 0.6   ro04030  Possible membrane protein 0.6 0.3 0.4 0.4 0.5 0.6 0.4  0.9 0.8 0.7 0.7 0.7 0.8 0.8   ro04045  Conserved hypothetical protein 0.5 0.4 0.4 0.4 0.4 0.5 0.3  0.9 0.9 0.9 1.1 0.7 0.9 0.8   ro04074  Possible porin protein 1.3 1.4 0.6 0.5 0.1 0.1 0.1  1.9 1.7 1.1 0.7 0.6 0.1 0.1   ro04080  Conserved hypothetical protein 1.1 1.2 0.8 0.6 0.4 0.3 0.4  1.6 1.5 1.3 1.3 1.1 0.7 0.8   ro04083  Conserved hypothetical protein 1.3 0.9 0.5 0.5 0.2 0.2 0.2  2.8 1.9 1.1 1.0 0.9 0.7 0.5   ro04095  Conserved hypothetical protein 1.2 0.9 0.4 0.4 0.3 0.1 0.3  1.5 1.0 0.6 0.6 0.7 0.5 0.6   ro04112  Probable GTPase 0.5 0.2 0.4 0.4 0.6 0.8 0.6  1.4 1.1 1.4 1.8 1.3 1.3 1.1   ro04128 hisC3 Histidinol-phosphate transaminase 0.8 0.8 0.6 0.5 0.5 0.4 0.3  0.9 1.3 0.9 1.0 1.0 1.0 1.1   ro04143  Probable penicillin-binding protein 0.9 1.2 0.6 0.5 0.1 0.1 0.1  1.4 1.4 0.7 0.5 0.4 0.3 0.2   ro04145  Conserved hypothetical protein 1.2 1.3 0.8 0.8 0.5 0.5 0.4  1.7 1.5 1.0 0.9 0.8 0.5 0.6   ro04165  Possible vanillate monooxygenase, oxygenase subunit 1.0 0.4 0.1 0.2 0.1 0.1 0.1  1.0 2.8 1.1 0.7 1.4 1.0 4.8   ro04183  Possible transcriptional regulator, TetR family 0.6 0.4 0.3 0.3 0.3 0.3 0.3  1.0 1.2 1.0 1.0 1.4 1.5 1.4   ro04198  Ammonium transporter 0.9 0.6 0.5 0.5 0.3 0.3 0.5  0.6 0.7 0.6 0.5 0.6 0.5 0.5   ro04227  Conserved hypothetical protein 0.9 0.8 0.5 0.5 0.5 0.5 0.5  0.8 0.6 0.6 0.6 0.5 0.7 0.4   ro04278  Glucokinase 0.5 0.3 0.4 0.3 0.3 0.4 0.2  1.1 1.1 0.9 1.2 0.9 1.0 0.8   ro04282  Transcriptional regulator 0.7 0.5 0.6 0.5 0.4 0.5 0.4  1.4 1.2 2.2 1.8 1.2 1.0 0.8   ro04293  Conserved hypothetical protein 0.7 0.4 0.6 0.6 0.4 0.6 0.3  1.1 1.1 1.0 1.5 0.9 1.2 0.7   ro04324  Possible thioredoxin 0.6 0.3 0.3 0.4 0.4 0.6 0.4  0.9 0.9 1.3 1.6 0.9 1.0 0.9   ro04333  ABC oligopeptide transporter, substrate-binding component 0.9 1.6 1.3 0.9 0.3 0.3 0.3  1.0 1.5 1.4 1.5 1.1 0.6 0.5   ro04393  Conserved hypothetical protein 1.4 1.3 1.5 0.9 0.3 0.4 0.3  1.4 1.3 1.1 1.0 0.9 0.6 0.6    140 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro04504  Probable MutT protein 0.8 0.3 0.4 0.4 0.6 0.8 0.4  1.2 1.3 1.3 2.0 1.2 0.8 0.7   ro04520  Conserved hypothetical protein 1.0 1.4 1.4 1.0 0.5 0.5 0.4  1.0 0.9 0.9 0.9 0.7 0.9 0.8   ro04548  Possible methylmalonate-semialdehyde dehydrogenase (acylating), N-terminal 1.7 0.6 0.4 0.2 0.1 0.0 0.1  1.0 0.8 1.2 0.9 0.7 0.6 1.1   ro04588  Cytochrome P450 CYP142 0.8 0.5 0.4 0.4 0.4 0.1 0.4  0.8 0.8 0.9 0.8 0.8 0.8 0.8   ro04616  Conserved hypothetical protein 1.2 1.3 1.4 1.1 0.4 0.4 0.4  2.4 2.1 2.1 1.9 1.6 0.6 0.3   ro04647  Conserved hypothetical protein 0.7 0.3 0.4 0.4 0.4 0.5 0.3  0.8 1.1 1.0 0.9 0.9 1.0 0.9   ro04741 phoP Response regulator, two-component system 0.9 1.3 1.0 0.3 0.2 0.1 0.3  1.2 1.1 0.7 0.5 0.5 0.3 0.4   ro04760  Conserved hypothetical protein 0.9 0.4 0.5 0.4 0.3 0.2 0.3  0.9 0.9 0.9 0.9 0.8 0.7 0.8   ro04793  2,3-Dihydroxybenzoate-AMP ligase/S-dihydroxybenzoyltransferase 0.7 0.6 0.6 0.5 0.4 0.3 0.3  0.6 0.7 0.8 0.7 0.7 0.8 0.8   ro04898  Probable organic hydroperoxide resistance protein 0.9 0.5 0.3 0.6 0.5 0.3 0.4  2.3 1.8 1.5 1.4 1.3 1.0 1.3   ro04952  Conserved hypothetical protein 1.2 0.8 0.4 0.4 0.1 0.0 0.2  1.9 1.2 0.6 0.5 0.5 0.3 0.3   ro04958  Bifunctional ABC multidrug transporter 0.6 0.6 0.5 0.4 0.4 0.4 0.4  0.8 1.0 0.6 0.7 0.7 0.8 0.9   ro04977  Carbon monoxide dehydrogenase small subunit (ferredoxin) 1.0 0.9 0.6 0.6 0.4 0.3 0.3  1.5 1.1 0.8 0.9 0.8 0.8 0.7   ro05007  Possible antigen 85 A precursor 1.0 1.3 1.2 1.0 0.4 0.4 0.3  0.7 0.9 0.8 1.0 0.9 0.6 0.5   ro05041  Response regulator, two-component system 1.0 0.6 0.8 0.6 0.3 0.3 0.3  1.0 0.9 0.9 0.8 0.7 0.6 0.6   ro05044  Conserved hypothetical protein 0.6 0.5 0.7 0.4 0.4 0.3 0.2  0.6 0.7 0.6 0.6 0.5 0.4 0.4   ro05056  ABC transporter, ATP-binding component 1.2 0.6 0.2 0.2 0.2 0.1 0.2  4.6 4.4 0.8 0.9 1.2 1.3 1.6   ro05079  Possible dicarboxylate carrier protein 0.7 0.5 0.4 0.3 0.5 0.5 0.4  1.3 1.5 1.3 2.0 1.4 0.9 0.5   ro05086  Conserved hypothetical protein 1.0 1.0 1.0 1.2 0.4 0.4 0.5  1.2 1.2 1.1 1.4 1.6 0.7 0.6   ro05095  Conserved hypothetical protein 0.8 1.0 0.8 0.7 0.2 0.1 0.2  1.6 1.4 1.3 1.1 1.0 0.5 0.4   ro05100  Acyl-CoA dehydrogenase 1.4 2.9 0.4 0.3 0.3 0.1 0.4  2.5 4.1 0.9 0.7 0.8 0.8 0.7   ro05106  Conserved hypothetical protein 0.6 0.3 0.4 0.4 0.5 0.5 0.4  1.2 1.1 1.5 2.3 1.8 0.8 0.5   ro05108  Possible DNA ligase (ATP), N-terminal 0.5 0.2 0.3 0.3 0.5 0.5 0.3  0.9 1.3 1.3 1.7 1.5 0.9 0.5    141 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro05118  Probable neprilysin 1.1 1.2 0.7 0.5 0.4 0.1 0.4  1.4 1.1 0.8 0.7 0.6 0.6 0.6   ro05148  Probable transcriptional regulator, MerR family 0.7 0.3 0.4 0.5 0.6 0.6 0.4  1.4 1.5 1.6 1.9 1.5 0.9 0.7   ro05158  Di/tripeptide permease 0.9 0.7 0.5 0.5 0.3 0.2 0.3  1.3 0.9 0.7 0.7 0.6 0.3 0.2   ro05179  Conserved hypothetical protein 0.9 0.9 0.7 0.5 0.5 0.4 0.4  0.9 0.8 0.8 0.7 0.6 0.7 0.8   ro05256  Synthetase 1.3 0.8 0.4 0.3 0.6 0.6 0.5  1.5 1.1 0.9 1.0 1.1 1.1 1.0   ro05261  Conserved hypothetical protein 0.8 0.6 0.6 0.5 0.4 0.2 0.4  0.9 0.9 0.9 1.0 0.9 1.0 1.5   ro05287  Amino acid transporter, APC superfamily 0.8 0.6 0.4 0.4 0.4 0.2 0.3  0.9 1.2 0.8 0.8 0.8 0.9 1.3   ro05294  Reductase 0.6 0.4 0.4 0.4 0.6 0.8 0.5  1.3 1.2 1.4 1.4 1.0 1.0 0.8   ro05340  Conserved hypothetical protein 0.8 0.5 0.4 0.4 0.4 0.3 0.4  0.9 0.9 0.8 0.7 1.1 1.0 0.9   ro05341  Possible transcriptional regulator 1.1 0.7 0.7 0.9 0.5 0.4 0.5  1.0 1.0 0.8 0.8 0.8 0.7 0.7   ro05356  Conserved hypothetical protein 1.0 0.8 0.6 0.4 0.3 0.2 0.3  0.6 0.6 0.5 0.4 0.3 0.3 0.3   ro05388  Amino acid transporter, APC family 0.6 0.3 0.3 0.2 0.1 0.3 0.1  1.0 0.9 1.1 0.9 1.0 1.2 1.2   ro05402  Possible enoyl-CoA hydratase 1.0 1.4 0.6 0.5 0.4 0.3 0.4  0.7 0.9 0.7 0.8 0.7 0.9 0.9   ro05405  Possible monooxygenase 0.7 0.6 0.5 0.4 0.4 0.5 0.3  0.9 0.9 0.8 0.8 0.6 0.6 0.6   ro05446  UDP-glucose 6-dehydrogenase 1.5 2.9 0.7 0.3 0.4 0.4 0.3  7.4 14.0 5.8 3.0 3.1 1.8 1.8   ro05452  Nonribosomal peptide synthetase 0.9 0.7 0.5 0.5 0.5 0.4 0.4  1.0 0.9 0.8 0.8 0.7 0.8 0.8   ro05453  Probable protein-tyrosine kinase 0.6 0.3 0.1 0.1 0.2 0.0 0.1  0.5 0.4 0.3 0.4 0.3 0.3 0.2   ro05493  Conserved hypothetical protein 1.2 0.9 0.5 0.4 0.3 0.3 0.3  2.2 1.7 0.7 0.8 0.5 0.5 0.5   ro05517  Dehydrogenase 0.7 0.4 0.4 0.3 0.4 0.4 0.3  0.9 1.0 1.0 1.1 0.9 1.0 0.8   ro05537  Conserved hypothetical protein 0.9 0.7 0.6 0.5 0.2 0.2 0.2  1.5 1.1 0.9 0.7 0.6 0.5 0.4   ro05554  Probable alkaline phosphatase 1.4 1.2 0.7 0.4 0.4 2.1 0.3  1.2 1.0 0.6 0.5 0.7 0.3 0.6   ro05616 rpmG2 50S ribosomal protein L33 type 1 0.6 0.3 0.4 0.3 0.3 0.3 0.3  1.0 1.1 1.2 1.3 1.3 1.0 1.0   ro05632 galU2 UTPglucose-1-phosphate uridylyltransferase 0.7 0.6 0.4 0.4 0.5 0.4 0.5  1.0 1.1 0.8 0.9 0.9 0.7 0.8   ro05687  Conserved hypothetical protein 1.3 1.0 0.6 0.4 0.2 0.2 0.2  2.4 1.2 0.7 0.6 0.8 0.6 0.4   ro05705  Conserved hypothetical protein 0.9 0.8 0.7 0.5 0.3 0.2 0.3  0.7 0.8 0.6 0.6 0.5 0.5 0.5   ro05718  Possible transcriptional regulator 0.8 0.4 0.4 0.4 0.4 0.3 0.3  1.2 1.6 1.1 1.3 1.3 1.4 1.3   ro05757  Conserved hypothetical protein 0.6 0.5 0.5 0.4 0.4 0.5 0.4  0.6 0.9 0.7 0.7 0.6 0.7 0.9    142 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro05765  Conserved hypothetical protein 0.6 0.3 0.3 0.3 0.4 0.5 0.3  0.7 0.6 0.5 0.6 0.6 0.8 0.9   ro05805  Conserved hypothetical protein 0.8 0.5 0.5 0.5 0.5 0.3 0.3  0.8 0.9 0.8 0.8 0.8 0.9 1.1   ro05809  Probable 3-oxoacyl-(acyl carrier protein) reductase 0.7 0.5 0.5 0.4 0.4 0.4 0.4  0.9 1.0 0.9 0.9 0.9 1.1 1.2   ro05819  Probable (+)-trans-carveol dehydrogenase 0.7 0.3 0.4 0.5 0.6 0.7 0.4  1.2 1.3 1.4 1.7 1.0 1.2 1.1   ro05880  Probable multidrug-resistance transporter, MFS superfamily 0.6 0.4 0.5 0.4 0.5 0.4 0.4  1.0 1.7 1.1 1.2 1.2 1.3 1.3   ro05958  Possible arylsulfatase, N-terminal 1.1 0.9 0.5 0.7 0.5 0.4 0.6  2.5 1.6 1.2 1.5 2.1 1.9 1.9   ro06070  Transcriptional regulator, AcrR family 1.0 1.0 0.8 0.7 0.4 0.4 0.4  1.1 1.0 1.2 1.0 0.7 0.7 0.7   ro06073  Probable FMN-dependent (S)-2-hydroxy-acid oxidase 0.9 1.2 0.5 0.3 0.3 0.2 0.3  0.8 1.0 0.3 0.3 0.2 0.2 0.2   ro06081  Dehydrogenase 0.9 0.5 0.3 0.3 0.3 0.2 0.4  0.6 0.7 0.5 0.6 1.3 0.3 0.2   ro06084 eutB Ethanolamine ammonia-lyase heavy chain 0.6 0.5 0.4 0.3 0.3 0.4 0.3  0.7 0.8 0.6 0.6 0.5 0.4 0.5   ro06085 eutC Ethanolamine ammonia-lyase light chain 0.8 0.4 0.4 0.4 0.4 0.3 0.3  0.9 1.1 0.6 0.7 0.7 0.6 0.6   ro06087  Metabolite transporter, MFS superfamily 1.5 1.4 0.4 0.3 0.1 0.1 0.1  1.0 1.3 0.5 0.7 0.6 0.5 0.5   ro06093  Conserved hypothetical protein 1.4 1.2 0.6 0.5 0.3 0.3 0.3  2.6 1.7 1.0 1.2 1.6 1.0 0.7   ro06111  Aldehyde dehydrogenase 0.9 0.8 0.4 0.3 0.4 0.3 0.3  1.6 1.3 0.7 0.7 0.7 0.8 0.9   ro06112  Conserved hypothetical protein 1.1 0.7 0.3 0.3 0.3 0.1 0.3  3.2 2.6 1.3 0.8 1.0 0.8 0.9   ro06165  Conserved hypothetical protein 0.7 0.3 0.5 0.4 0.4 0.2 0.3  1.0 1.1 1.0 1.0 1.1 1.2 1.4   ro06209  Hypothetical protein 0.7 0.3 0.4 0.4 0.5 0.6 0.4  1.6 1.6 1.7 2.4 1.7 0.9 0.7   ro06307  Mannose-1-phosphate guanylyltransferase 0.9 0.7 0.6 0.4 0.2 0.2 0.2  3.2 2.7 1.3 1.2 0.7 0.6 0.7   ro06336  Possible fatty acid desaturase 0.7 0.4 0.3 0.3 0.5 0.3 0.5  0.6 0.3 0.2 0.2 0.3 0.2 0.2   ro06372  Probable triacylglycerol lipase 1.5 2.1 1.5 1.0 0.5 0.4 0.4  1.3 1.9 1.7 1.6 1.4 0.6 0.7   ro06398  Probable O-succinylbenzoateCoA ligase 0.9 1.1 1.0 0.6 0.2 0.1 0.2  1.2 1.4 0.9 0.8 0.6 0.3 0.3   ro06444  ABC Fe3+ transporter, substrate-binding component 0.7 0.5 0.5 0.5 0.6 0.5 0.4  0.6 0.8 0.8 0.9 0.9 1.0 1.2    143 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro06477  Sensor kinase, two-component system 0.7 0.5 0.6 0.4 0.5 0.2 0.4  1.1 1.0 1.2 1.0 0.8 0.7 0.9   ro06503 ppk Polyphosphate kinase 1.2 0.9 1.1 0.8 0.5 0.3 0.4  0.7 0.7 0.8 0.8 0.7 0.5 0.5   ro06523  DNA-formamidopyrimidine glycosylase 0.8 0.4 0.4 0.4 0.5 0.6 0.5  0.9 0.7 0.7 0.7 0.8 0.7 0.7   ro06598  Probable acetate-CoA ligase 0.7 0.5 0.6 0.7 0.5 0.4 0.5  0.7 0.8 0.8 0.8 0.8 0.9 0.9   ro06619  Possible lyase 1.3 0.8 0.6 0.4 0.2 0.2 0.2  4.2 2.6 1.4 1.0 0.7 0.4 0.3   ro06626  Possible stress protein 1.0 0.9 0.8 0.7 0.4 0.4 0.5  1.1 1.3 1.0 1.2 1.2 1.1 1.1   ro06664  Nonribosomal peptide synthetase 0.6 0.6 0.6 0.6 0.5 0.3 0.4  0.8 1.0 0.7 0.9 1.3 1.5 1.6   ro06668  Possible helicase 0.6 0.4 0.4 0.5 0.7 0.7 0.7  0.9 1.1 1.1 1.4 1.4 1.3 1.3   ro06695  Probable enoyl-CoA hydratase 0.8 0.6 0.4 0.5 0.5 0.5 0.5  1.0 0.9 0.9 1.1 1.1 1.4 1.1   ro06727  Probable transcriptional regulator, DeoR family 0.7 0.2 0.5 0.4 0.6 0.7 0.4  1.5 1.3 1.3 1.5 1.4 1.1 0.7   ro06736  Conserved hypothetical protein 1.2 0.9 0.6 0.3 0.4 0.2 0.4  1.0 0.7 0.9 0.8 0.5 0.6 0.5   ro06776  tRNA/rRNA methyltransferase 0.6 0.3 0.5 0.5 0.6 0.6 0.4  1.5 1.0 1.4 1.4 0.9 1.0 0.7   ro06777 dapF Diaminopimelate epimerase 0.5 0.5 0.5 0.5 0.5 0.5 0.5  0.9 1.0 1.0 1.0 0.9 0.7 0.7   ro06781  Phosphotransferase system, histidine-containing phosphocarrier protein 1.2 1.1 0.6 0.6 0.4 0.3 0.5  1.6 1.2 1.0 1.0 1.1 0.8 0.7   ro06782  Phosphotransferase system, fructose-specific 1.0 0.8 0.4 0.4 0.4 0.1 0.4  3.2 1.7 4.5 1.2 1.2 0.8 0.8   ro06783  1-Phosphofructokinase 0.8 0.5 0.5 0.5 0.5 0.4 0.4  0.7 0.8 0.9 1.1 0.8 0.8 0.9   ro06784  Transcriptional regulator, DeoR family 1.1 0.5 0.3 0.3 0.4 0.3 0.3  1.1 0.7 0.6 0.8 0.6 0.6 0.7   ro06787  Long-chain-acylCoA dehydrogenase 0.8 1.0 0.7 0.5 0.3 0.2 0.3  2.0 1.6 1.1 1.2 1.1 0.9 0.6   ro06842  probable glutaminase 1.1 0.7 0.5 0.4 0.3 0.2 0.3  1.3 0.9 0.8 0.8 0.5 0.3 0.4   ro06848  ABC transporter, substrate-binding component 0.6 0.5 0.5 0.4 0.5 1.2 0.5  0.8 0.9 1.0 0.9 0.7 0.6 1.1   ro06877  Conserved hypothetical protein 0.7 0.3 0.5 0.5 0.7 0.7 0.6  1.3 1.5 1.5 1.9 1.3 0.9 0.7   ro06920  Conserved hypothetical protein 0.8 0.5 0.4 0.4 0.6 0.5 0.5  0.8 1.0 1.0 1.0 1.1 1.0 1.9   ro06925  Probable transcriptional regulator, ArsR family 1.2 1.3 0.7 0.8 0.3 0.1 0.2  0.9 0.9 0.9 0.7 0.6 0.3 0.4   ro06929  Serine-type D-Ala-D-Ala carboxypeptidase 1.3 1.1 0.9 0.7 0.2 0.3 0.3  1.8 1.3 0.8 1.0 0.8 0.6 0.5    144 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro07052  Conserved hypothetical protein 0.9 0.5 0.6 0.5 0.5 0.7 0.4  1.5 1.5 1.5 1.6 0.8 0.9 0.9   ro07055  Possible sensory histidine kinase 0.7 0.4 0.4 0.4 0.3 0.2 0.3  1.0 0.9 0.7 1.0 0.8 0.8 0.8   ro07071  Probable enoyl-CoA hydratase 0.9 0.5 0.3 0.3 0.6 0.4 0.3  1.1 1.1 0.6 0.7 0.6 0.8 1.0   ro07096  Conserved hypothetical protein 0.8 0.5 0.4 0.4 0.5 0.5 0.5  0.8 0.9 0.8 0.7 1.0 0.9 1.0   ro07233 mutA Methylmalonyl-CoA mutase small subunit 0.6 0.5 0.4 0.4 0.5 0.5 0.4  1.2 1.1 0.8 0.9 0.8 1.0 1.1   ro08019  Aldehyde dehydrogenase 0.7 1.8 1.0 0.7 0.3 0.3 0.3  0.9 1.5 1.4 1.0 0.7 0.3 0.5   ro08030  Possible transposase 0.6 0.3 0.3 0.3 0.3 0.4 0.3  1.1 0.9 0.9 1.1 0.8 0.9 1.0   ro08043  Conserved hypothetical protein 0.6 0.2 0.4 0.3 0.5 0.6 0.3  1.0 1.2 1.4 2.5 1.3 0.9 0.6   ro08085 bphE3 2-Oxopent-4-enoate hydratase 0.9 0.7 0.7 0.6 0.4 0.3 0.3  1.5 1.1 1.1 1.1 0.9 0.7 0.7   ro08161 | ro10214 padC1 | padC2 3,4-Dihydroxyphthalate decarboxylase | 3,4-dihydroxyphthalate decarboxylase 2.4 7.6 0.2 0.2 0.3 0.2 0.3  5.2 4.1 0.6 0.5 0.7 1.0 0.9   ro08167 | ro10208 padAa1 | padAa2 Phthalate 3,4-dioxygenase α subunit | phthalate 3,4-dioxygenase α subunit 1.4 2.4 0.0 0.0 0.0 0.0 0.0  5.0 1.8 0.2 0.2 0.2 0.2 0.2   ro08169 | ro10206 | patE Phthalate ester hydrolase (isochorismatase hydrolase) | phthalate ester hydrolase (isochorismatase hydrolase) 1.6 2.7 0.1 0.1 0.1 0.0 0.2  4.6 2.8 0.6 0.7 0.8 0.7 0.7   ro08170 | ro10205  ABC transporter, permease component | ABC transporter, permease component 1.8 2.8 0.1 0.1 0.1 0.1 0.1  13.6 5.8 0.5 0.4 0.5 1.0 1.1   ro08171 | ro10204  Probable ABC taurine transporter, permease component | probable ABC taurine transporter, permease component 1.4 2.5 0.2 0.2 0.3 0.3 0.2  4.6 2.8 0.9 0.9 0.9 1.0 1.1   ro08173 | ro10202  Probable ABC transporter, substrate-binding component | ABC transporter, substrate-binding protein 1.9 3.7 0.3 0.2 0.2 0.1 0.2  1.6 1.0 0.6 0.7 0.7 0.6 0.6    145 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro08185 | ro10187  Monooxygenase | cyclohexanone monooxygenase 0.6 0.2 0.1 0.1 0.1 0.0 0.1  0.8 1.0 1.2 1.0 1.4 0.8 5.3   ro08190 | ro10182  Transcriptional regulator | σ54-dependent transcriptional regulator 0.4 0.3 0.4 0.5 0.6 0.5 0.5  1.1 0.9 1.3 1.3 1.2 1.1 0.8   ro08200 | ro01679  Te resistance protein | probable Te resistance protein 0.8 1.0 0.7 0.5 0.3 0.2 0.3  0.7 0.8 0.8 0.7 0.6 0.6 0.6   ro08202  Possible Te resistance protein 0.8 0.6 0.4 0.5 0.5 0.4 0.4  1.0 1.2 0.7 0.8 0.7 0.8 0.9   ro08203  Hypothetical protein 0.8 0.4 0.5 0.5 0.5 0.8 0.5  0.8 0.8 0.8 1.0 0.9 0.9 1.0   ro08249  Conserved hypothetical protein 1.3 1.1 1.0 0.6 0.3 0.1 0.3  1.6 1.2 1.2 1.1 0.7 0.5 0.4   ro08366 grpE4 Heat shock protein GrpE 0.6 0.3 0.5 0.4 0.4 0.3 0.3  0.6 0.7 0.7 0.7 0.7 0.9 1.1   ro08368  Hypothetical protein 1.7 3.3 0.1 0.3 0.2 0.1 0.3  2.4 1.7 0.7 0.5 0.8 1.4 0.5   ro08390  Possible methyltransferase 0.8 0.8 0.8 0.7 0.4 0.4 0.4  1.2 1.4 1.5 1.3 1.2 1.3 1.2   ro08428  Conserved hypothetical protein 0.8 0.5 0.4 0.5 0.6 0.8 0.6  0.8 1.0 0.9 1.0 0.9 0.3 1.4   ro08482  Hypothetical protein 0.9 0.6 0.5 0.6 0.4 0.3 0.4  0.8 0.9 0.6 0.7 0.8 0.8 1.0   ro08517  Conserved hypothetical protein 0.6 0.4 0.4 0.4 0.5 0.4 0.4  0.8 0.9 0.9 0.9 1.0 1.1 1.3   ro08561  Possible porin protein MspA 2.3 5.9 1.6 0.6 0.3 0.2 0.4  2.3 3.4 1.1 1.0 0.8 0.7 0.9   ro08569  Conserved hypothetical protein 1.1 0.6 0.7 0.4 0.2 0.1 0.2  1.1 1.0 0.9 0.8 0.5 0.5 0.3   ro08585  Probable exoribonuclease II 1.4 1.7 1.3 0.9 0.2 0.2 0.2  3.0 3.3 2.2 1.4 0.9 0.4 0.3   ro08597  Hypothetical protein 0.8 0.4 0.2 0.5 0.4 0.6 0.5  1.5 1.1 1.3 1.0 1.0 1.2 1.1   ro08613  Probable exoribonuclease II 1.6 1.3 0.5 0.4 0.2 0.4 0.3  4.7 2.1 0.9 0.9 0.6 0.3 0.3   ro08621 argE Acetylornithine deacetylase 0.9 0.8 0.4 0.5 0.4 0.4 0.4  1.3 1.0 0.7 1.0 0.9 0.7 0.7   ro08624  Probable acetoin dehydrogenase β subunit 1.0 1.0 0.4 0.4 0.5 0.4 0.5  1.2 1.1 0.7 0.7 0.8 0.9 1.0   ro08625  Conserved hypothetical protein 0.9 0.4 0.4 0.4 0.3 0.1 0.4  0.9 1.0 1.1 1.0 1.0 1.1 1.5   ro08626  Proline/betaine transporter, MFS family 0.7 0.5 0.5 0.5 0.7 0.7 0.6  1.0 1.2 1.3 1.3 1.1 1.1 1.0   ro08695  Conserved hypothetical protein 0.6 0.5 0.5 0.5 0.4 0.4 0.3  0.8 0.8 1.2 1.0 1.2 1.0 1.3   ro08773  Exoribonuclease R 1.1 1.3 1.0 0.7 0.5 0.4 0.4  1.0 1.3 1.0 0.9 1.0 0.9 1.0   ro08778  Conserved hypothetical protein 0.6 0.4 0.5 0.4 0.9 0.8 0.7  0.8 0.8 0.8 0.9 0.9 0.9 1.0   ro08805  Conserved hypothetical protein 1.0 0.8 0.5 0.3 0.2 0.2 0.2  1.4 0.9 0.8 0.7 0.8 0.7 0.6   ro08812 citA4 Citrate (si)-synthase 1.2 0.8 0.5 0.4 0.3 0.3 0.3  2.9 1.7 1.1 0.9 0.7 0.8 1.0   ro08813  Hypothetical protein 0.8 0.5 0.3 0.4 0.4 0.6 0.6  1.3 1.1 0.8 1.1 0.9 0.9 0.8   ro08814  Hypothetical protein 0.9 0.7 0.6 0.3 0.2 0.2 0.2  4.9 3.9 1.8 1.5 0.7 0.5 0.5   ro08815  Ferredoxin subunit 1.0 0.7 0.8 0.5 0.3 0.2 0.2  7.4 5.9 3.2 2.2 1.0 0.5 0.5    146 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro08887  Transcriptional regulator, AsnC family 0.8 0.6 0.3 0.5 0.5 0.4 0.5  0.7 0.8 0.8 0.8 0.8 1.0 1.3   ro08911 | ro08938  Possible sulfide-quinone reductase | possible sulfide-quinone reductase 0.8 0.4 0.1 0.1 0.1 0.1 0.1  13.2 1.6 0.8 0.6 0.9 0.9 1.4   ro09019 bphF1 4-Hydroxy-2-oxovalerate aldolase 0.7 0.5 0.4 0.5 0.5 0.5 0.5  0.6 0.6 0.6 0.7 0.8 0.9 1.0   ro09070  Hypothetical protein 0.7 0.3 0.2 0.4 0.5 0.5 0.4  0.9 0.9 0.9 0.9 1.3 0.9 1.2   ro10039  Rhodococcal conserved hypothetical protein 0.6 0.3 0.4 0.3 0.4 0.4 0.4  1.2 1.1 1.3 1.1 1.0 1.0 0.9   ro10051  Conserved hypothetical protein 0.7 0.6 0.8 0.6 0.5 0.3 0.4  0.8 0.9 1.1 1.1 1.2 1.1 1.2   ro10052  Conserved hypothetical protein 0.5 0.4 0.6 0.5 0.5 0.4 0.4  1.1 1.1 1.1 1.1 1.2 0.9 0.9   ro10053  Conserved hypothetical protein 0.6 0.3 0.5 0.5 0.5 0.3 0.3  1.3 0.6 1.1 1.2 0.9 0.8 0.7   ro10056  Conserved hypothetical protein 1.3 1.0 1.0 0.5 0.2 0.1 0.2  1.5 1.1 1.0 1.0 0.7 0.5 0.4   ro10060  Conserved hypothetical protein 1.4 1.0 0.6 0.5 0.2 0.1 0.2  2.4 1.7 1.1 1.0 0.8 0.6 0.6   ro10061  Conserved hypothetical protein 1.1 0.6 0.3 0.2 0.1 0.1 0.1  1.9 1.2 0.8 0.8 0.8 0.8 0.9   ro10070  Rhodococcal conserved hypothetical protein 0.7 0.6 0.3 0.5 0.6 0.8 0.4  0.9 0.9 0.9 1.0 0.8 0.9 1.0   ro10095  Rhodococcal conserved hypothetical protein 0.9 0.5 0.5 0.4 0.5 0.5 0.4  0.8 0.8 0.8 0.9 0.8 0.8 0.9   ro10162  Possible acetone carboxylase β subunit 1.3 0.8 0.5 0.5 0.4 0.6 0.4  1.8 1.0 1.0 0.8 0.8 0.8 0.8   ro10250  Conserved hypothetical protein 0.8 0.5 0.4 0.4 0.5 0.4 0.3  2.4 1.9 1.6 1.6 2.1 1.9 1.6   ro10259  Possible transposase 0.5 0.2 0.3 0.3 0.3 0.3 0.2  1.0 1.1 1.0 1.4 0.9 0.9 0.7   ro10265  Probable short-chain dehydrogenase 0.7 0.2 0.3 0.4 0.2 0.6 0.4  1.3 1.7 1.7 1.7 1.1 1.7 1.2   ro10280  Conserved hypothetical protein 0.8 0.7 0.7 0.6 0.5 0.4 0.4  0.5 0.8 0.7 0.6 0.9 0.8 0.9   ro10284  Probable 2-dehydro-3-deoxyglucarate aldolase 0.6 0.4 0.5 0.4 0.3 0.3 0.3  0.7 0.7 0.7 0.7 0.6 0.8 1.0   ro10302  Possible aldehyde dehydrogenase 0.6 0.4 0.3 0.5 0.3 0.3 0.4  0.7 0.7 0.7 0.8 1.1 1.1 1.2   ro10313  Probable 2,4-dichlorophenol 6-monooxygenase 1.0 0.7 0.6 0.6 0.2 0.2 0.2  3.6 1.8 2.2 2.4 2.4 0.6 0.4   ro10383 | ro11083  Hypothetical protein | hypothetical protein 1.3 1.3 1.1 0.8 0.5 0.4 0.4  0.9 0.8 0.7 0.5 0.6 0.6 0.7   ro10393  Conserved hypothetical protein 0.4 0.4 0.5 0.5 0.5 0.7 0.6  0.8 0.9 1.0 0.8 0.8 0.5 0.9   ro10398  Possible permease 0.8 0.6 0.7 0.4 0.3 0.6 0.3  1.2 1.1 1.0 1.0 0.9 0.8 0.9    147 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro10421 | ro10415  Conserved hypothetical protein | conserved hypothetical protein 0.6 0.3 0.4 0.3 0.3 0.3 0.2  1.1 1.3 1.0 1.6 1.0 0.9 0.7   ro10435  Probable proline/betaine transporter, MFS superfamily 0.4 0.3 0.2 0.3 0.4 0.4 0.4  0.9 0.7 0.8 0.7 0.7 0.7 0.5   ro10436  Probable cysteine synthase 0.4 0.4 0.2 0.2 0.2 0.1 0.2  1.6 1.1 0.6 0.6 0.8 1.3 1.0   ro10439  Possible integrase/ recombinase, XerD and XerC family 0.6 0.3 0.4 0.5 0.5 0.7 0.4  1.0 1.0 0.9 0.7 1.0 1.1 2.2   ro10450  Hypothetical protein 0.9 0.7 0.7 0.5 0.4 0.5 0.4  1.1 1.2 0.9 0.9 0.9 0.8 1.0   ro10452  Hypothetical protein 1.1 0.8 0.4 0.4 0.1 0.2 0.1  1.5 1.2 0.8 0.7 0.6 0.4 0.4   ro11070 | ro11010  Hypothetical protein | rhodococcal conserved hypothetical protein 0.6 0.3 0.4 0.4 0.6 0.7 0.4  1.3 1.5 1.5 2.3 1.6 0.7 0.6   ro11106  Hypothetical protein 0.7 0.5 0.5 0.4 0.4 0.6 0.4  0.8 1.0 0.7 0.9 0.8 0.9 1.0   ro11202  Conserved hypothetical protein 0.5 0.4 0.4 0.4 0.6 0.6 0.8  0.9 1.0 0.8 0.9 1.1 1.3 1.3   ro11214  Conserved hypothetical protein 0.6 0.3 0.4 0.5 0.6 0.7 0.5  1.3 1.3 1.4 2.4 1.5 0.7 0.6   ro11226  Probable polysulfide reductase 0.5 0.1 0.2 0.1 0.1 0.1 0.1  0.9 0.9 0.6 0.6 0.6 0.6 0.8   ro11266  Rhodococcal conserved hypothetical protein 1.3 1.2 0.5 0.4 0.5 0.5 0.4  2.3 1.3 0.7 0.9 0.8 0.6 0.4   ro11280  Conserved hypothetical protein 1.1 0.6 0.4 0.3 0.2 0.2 0.2  1.8 1.5 1.1 1.0 0.9 0.9 0.9   ro11281  Conserved hypothetical protein 0.7 0.5 0.4 0.3 0.3 0.5 0.4  1.0 1.0 1.0 1.0 1.0 0.9 0.9   ro11297  Conserved hypothetical protein 1.3 0.6 0.5 0.5 0.4 0.5 0.4  0.9 1.1 0.9 0.7 1.1 1.3 1.8   ro11312  Probable flavin reductase-like domain 0.7 0.4 0.6 0.4 0.5 0.6 0.5  1.2 1.3 1.2 1.6 1.2 1.2 1.1   ro11318  Hypothetical protein 0.7 0.4 0.5 0.5 0.5 0.5 0.4  0.6 0.6 0.7 0.7 0.7 0.7 1.0   ro11324  Rhodococcal conserved hypothetical protein 1.9 1.0 0.3 0.2 0.2 0.1 0.1  1.7 1.4 0.9 0.9 1.4 1.1 1.4                       Down-regulated genes during control experiment only                     ro00777  Possible CoA transferase 0.8 0.5 0.5 0.6 0.5 0.3 0.4  0.4 0.4 0.5 0.5 0.4 0.6 0.7   ro00820  ABC ribose transporter, ATP-binding component 0.9 0.8 0.7 0.7 0.9 1.1 0.8  0.3 0.4 0.4 0.5 0.3 0.5 0.5   ro00934 recN DNA repair protein RecN 0.8 0.4 0.5 0.5 0.9 0.7 0.8  0.4 0.4 0.4 0.5 0.5 0.5 0.6   ro01332  Probable formate dehydrogenase 0.8 0.8 1.1 0.7 0.4 0.5 0.5  0.4 0.5 0.5 0.5 0.5 0.6 0.7    148 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro01624  Possible transcriptional regulator, TetR family 1.0 0.8 0.9 1.0 1.3 1.2 1.2  0.4 0.4 0.4 0.5 0.6 0.6 0.6   ro01868  Probable aromatic acid transporter, MFS superfamily 8.0 0.1 1.9 4.0 7.4 7.1 1.4  0.4 0.4 0.3 0.2 0.3 0.4 0.4   ro02167  Probable multisubunit Na+/H+ antiporter MnhD subunit 0.6 0.7 1.0 0.9 1.1 1.2 0.5  0.4 0.5 0.5 0.5 0.6 0.8 0.7   ro02228  Possible acetyltransferase 0.7 0.9 0.9 0.7 0.6 1.3 0.7  0.4 0.5 0.4 0.4 0.5 0.4 0.5   ro02257  Conserved hypothetical protein 0.9 0.8 1.0 1.2 1.3 0.8 1.5  0.1 0.1 0.1 0.1 0.2 0.2 0.1   ro02387 benD cis-1,6-Dihydroxycyclohexa-3,5-diene-1-carboxylate dehydrogenase 1.0 0.8 0.7 0.9 1.3 1.4 1.1  0.2 0.2 0.2 0.2 0.2 0.2 0.2   ro02514 | ro08077 pheA1 Phenol hydroxylase, oxygenase component | phenyl hydroxylase, oxygenase component 0.7 0.7 1.0 1.7 1.8 2.4 2.4  0.4 0.4 0.4 0.5 0.4 0.4 0.4   ro02543  Conserved hypothetical protein 1.2 0.9 0.5 0.5 0.5 0.4 0.6  0.3 0.2 0.2 0.2 0.3 0.2 0.2   ro02858 paaH Phenylacetic acid-degradation ring-hydroxlyating complex protein 2 0.9 2.3 0.9 1.0 1.2 1.0 1.0  0.3 0.3 0.4 0.4 0.5 0.6 0.7   ro03578  Na+/solute symporter, SSF family 0.6 0.4 0.4 0.6 0.8 1.2 0.8  0.2 0.4 0.3 0.3 0.3 0.4 0.4   ro03623  Conserved membrane protein 1.0 1.3 0.9 0.9 1.3 1.5 1.4  0.5 0.5 0.4 0.5 0.6 0.8 0.9   ro05064  Possible nonspecific lipid-transfer protein 0.7 0.5 0.5 0.4 0.3 0.5 0.4  0.7 0.6 0.5 0.4 0.5 0.4 0.7   ro05361  σ70 type, group 4 subdivision (ECF) 1.2 1.2 1.2 1.1 0.9 0.7 0.7  0.5 0.5 0.4 0.5 0.5 0.4 0.5   ro05440  Possible serine O-acetyltransferase 0.5 0.5 0.5 0.4 0.2 0.2 0.9  0.4 0.5 0.4 0.5 0.4 0.5 0.6   ro05527  Conserved hypothetical protein 1.9 2.8 2.2 0.9 0.8 0.3 1.2  0.7 0.7 0.6 0.5 0.5 0.4 0.6   ro06352  Probable NAD(P)H dehydrogenase (quinone) 1.1 1.4 1.0 0.9 1.5 0.4 0.9  0.5 0.5 0.5 0.4 0.4 0.3 0.6   ro06353  Transcriptional regulator, AraC family 1.0 1.0 0.7 0.9 1.0 1.1 1.0  0.3 0.4 0.4 0.4 0.5 0.6 0.7   ro06869  Possible 2-isopropylmalate synthase 0.9 1.0 0.8 0.9 3.4 3.1 3.0  0.3 0.3 0.3 0.4 0.4 0.5 0.5   ro08960  Probable aldolase class II 1.0 1.2 1.0 0.7 0.7 0.5 0.7  0.8 0.6 0.4 0.4 0.4 0.4 0.4    149 Gene identifiera Gene name Description of gene product Expression ratiob in: Cluster patternc Functional categoryd Desiccation expt (~ 20-% relative humidity)  Control expt (~ 100-% relative humidity) 0.5 h 1 h 3 h 6 h 12 h 24 h 48 h  0.5 h 1 h 3 h 6 h 12 h 24 h 48 h ro09067  Probable glucose dehydrogenase 0.7 0.6 0.7 0.7 0.8 1.1 0.9  0.4 0.5 0.5 0.5 0.6 0.6 0.7   ro10046  Conserved hypothetical protein 0.5 0.5 1.2 0.9 0.7 0.4 0.6  0.2 0.2 0.6 0.6 0.4 0.2 0.2   ro10047  Conserved hypothetical protein 0.6 0.5 1.3 1.0 0.7 0.4 0.6  0.3 0.3 0.8 0.7 0.6 0.4 0.3   ro10048  Rhodococcal conserved hypothetical protein 0.5 0.3 1.0 0.7 0.5 0.3 0.4  0.4 0.4 0.9 1.2 0.9 0.4 0.5   ro11209  Conserved hypothetical protein 0.4 0.2 0.2 0.2 0.5 0.6 0.8  0.5 0.3 0.2 0.3 0.5 0.3 0.4                       Down-regulated genes during both experiments                     ro03003  Conserved hypothetical protein 0.6 0.4 0.4 0.3 0.3 0.3 0.3  0.5 0.5 0.5 0.5 0.4 0.5 0.5   ro03496  Probable glutamyl-tRNAGln amidotransferase subunit A 0.4 0.2 0.1 0.1 0.1 0.0 0.2  1.2 0.8 0.5 0.4 0.3 0.3 0.3   ro03801  Possible flavin-binding monooxygenase 0.7 0.4 0.4 0.5 0.8 0.8 0.8  0.4 0.3 0.3 0.4 0.4 0.4 0.4   ro04000  Short-chain dehydrogenase 1.1 0.8 0.5 0.5 0.5 0.2 0.4  0.4 0.5 0.3 0.3 0.4 0.4 0.4   ro04739 | ro04740  Hypothetical protein | hypothetical protein 1.1 0.8 0.5 0.1 0.1 0.1 0.1  1.5 1.3 0.6 0.3 0.1 0.1 0.1   ro06083  Probable ethanolamine permease, APC superfamily 0.6 0.4 0.2 0.2 0.2 0.2 0.3  0.5 0.6 0.4 0.3 0.3 0.2 0.2   ro06185  Probable metal-dependant glycoprotease 0.7 0.4 0.3 0.4 0.5 0.6 0.5  0.4 0.5 0.4 0.5 0.4 0.5 0.6   ro08172 | ro10203   Probable ABC taurine transporter, ATP-binding component | ABC transporter, ATP-binding component 1.3 2.3 0.0 0.0 0.0 0.0 0.0   4.4 2.4 0.4 0.3 0.3 0.4 0.4                          a Multiple gene identities indicate that the microarray probe could not distinguish between the (very similar) genes. b Bold expression ratios indicate significant (P < 0.05) differential regulation by > 2-fold. c Cluster pattern expression profiles are shown in Figure 2.4. d Functional classification of genes from Table 2.2.  C, cell division; D, DNA recombination and repair; L, lipid metabolism and cell envelope modification; R, transcriptional regulators; T, transporters; X, transposases; H, hypothetical gene products.    150 Appendix 2.  Protocol for isolation of fosmid DNA from E. coli Fosmid DNA harbored in an E. coli host was isolated by the following procedure, which is similar to a method published by Sambrook and Russell (229) for the preparation of bacterial artificial chromosomes by alkaline cell lysis with SDS: 1. The desired clone was grown overnight in LB medium plus the appropriate antibiotic, 25 μg/ml chloramphenicol in this case. 2. Cells from 2 ml of the culture were pelleted at 13,000 g for 5 min. 3. The pellet was resuspended in 500 μl of an ice-cold solution of 50-mM glucose, 25-mM Tris (pH 8.0), and 10-mM EDTA, and RNase A was added to this cell suspension to a final concentration of 50 μg/ml and allowed to sit for 5–10 min at room temperature. 4. After adding 500 μl of a freshly prepared solution of 0.2-M NaOH and 1-% SDS, the sample was incubated for another 10 min at room temperature. 5. Upon adding 700 μl of an ice-cold solution of 3-M potassium and 5-M acetate (composed of potassium acetate and glacial acetic acid), the sample was immediately mixed and centrifuged at 16,000 g for 20 min at 4 °C. 6. The supernatant was divided into two microcentrifuge tubes and 900 μl of isopropanol was added to each. 7. The samples were incubated at −20 °C for at least 15 min and then centrifuged at 16,000 g for 15 min at 4 °C. 8. The pellets were each resuspended in 500 μl of an ice-cold solution of 70-% ethanol and then centrifuged at 16,000 g for 10 min at room temperature. 9. The pellets were allowed to air-dry, and then they were pooled together in 30 μl of water.    151 Appendix 3.  Protocol for isolation of nucleic acids from Gram-positive bacteria Nucleic acids from cell pellets, obtained from 10 ml of cultures of rhodococci, were isolated according to the following procedure: 1. Thawed cell pellets were resuspended in 750 μl of a solution of 50-mM glucose, 25-mM Tris (pH 8.0), and 10-mM EDTA. 2. Lysozyme was added to the cell suspensions at a final concentration of 5 mg/ml, which were then incubated at 37 °C for 30 min with shaking at 200 rpm. 3. After adding 96 μl of 10-% SDS and 96 μl of 10-mg/ml proteinase K, the samples were placed in a 55-°C water bath for 1 h. 4. The samples were extracted with 750 μl of a mixture of phenol, chloroform, and isoamyl alcohol (25:24:1) saturated with 10-mM Tris (pH 8.0) and 1-mM EDTA. 5. The samples were centrifuged at 12,000 g for 5 min at room temperature, and the upper (aqueous) phase was transferred to a clean microcentrifuge tube. 6. The extraction steps 4 and 5 were repeated twice more. 7. To 650 μl of the aqueous phase, 32.5 μl of 5-M NaCl and 1.3 ml of ice-cold 100-% ethanol were added to precipitate the nucleic acids. 8. After mixing, the samples were centrifuged at 18,000 g for 15 min at 4 °C and the surface of the pellets were washed twice with 300 μl of ice-cold 70-% ethanol. 9. The nucleic acid pellets were dried under vacuum and then dissolved in a buffer of 1-mM Tris (pH 8.0) and 0.1-mM EDTA.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0135656/manifest

Comment

Related Items