UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Novel function of coagulation factor Xa : conversion into a clot-dissolving cofactor Vanden Hoek, Amanda Lynne 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_fall_vanden hoek_amanda.pdf [ 2.45MB ]
Metadata
JSON: 24-1.0105146.json
JSON-LD: 24-1.0105146-ld.json
RDF/XML (Pretty): 24-1.0105146-rdf.xml
RDF/JSON: 24-1.0105146-rdf.json
Turtle: 24-1.0105146-turtle.txt
N-Triples: 24-1.0105146-rdf-ntriples.txt
Original Record: 24-1.0105146-source.json
Full Text
24-1.0105146-fulltext.txt
Citation
24-1.0105146.ris

Full Text

NOVEL FUNCTION OF COAGULATION FACTOR Xa: CONVERSION INTO A CLOT-DISSOLVING COFACTOR by Amanda Lynne Vanden Hoek B.Sc., The University of British Columbia, 2005  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Pathology and Laboratory Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) August 2011 © Amanda Lynne Vanden Hoek, 2011  ii  Abstract Plasmin-mediated conversion of FXa into a clot-dissolving cofactor Factor Xa (FXa) is an essential blood clotting enzyme. A previously identified FXa derivative, Xa33/13, is generated by two distinct cleavages by the clot-dissolving (fibrinolytic) enzyme, plasmin. FXa is first converted to FXaβ by excision of a small C-terminal peptide and then proteolyzed at Lys330 in the autolysis loop to yield Xa33/13, which cannot participate in clotting. Instead, these cleavages confer novel fibrinolytic function to Xa33/13 as a tissue plasminogen activator (tPA) cofactor, thereby accelerating plasmin generation. To understand the importance of each cleavage and the role of individual residues in this functional conversion of FXa, five mutants were generated by mutation of basic residues to glutamine: Lys330 and four residues in the β-peptide region. Mutation at Lys330 prevented autolysis loop cleavage, and this mutant dissolved purified fibrin clots faster than plasma-derived FXa derivatives. Additionally, no basic residue within the β-peptide was uniquely targeted by plasmin and no single-point mutation in this region prevented subsequent autolysis loop cleavage. FX-deficient patient Factor X (FX) can be activated by two separate protein complexes, known as the initiating (extrinsic) and amplifying (intrinsic) tenases, which are assembled during coagulation. I describe a FX-deficient patient with a novel compound heterozygous mutation associated with differential clotting pathway function. Quantification of plasma FX antigen revealed 15 % of normal, which was consistent with extrinsic pathway activity. Intrinsic pathway activity was reduced to 5 % of normal, suggesting an activatable specific activity 3-fold lower than expected for this branch of the clotting pathway. DNA sequence analysis identified two heterozygous mutations: (1) a previously reported mutation that disrupts the splice site between exons I and II; (2) a novel  iii mutation resulting in an Arg386Cys substitution in the protease domain. I propose that alternate disulfide bond formation and protein folding may reduce circulating FX antigen levels. Additionally, Arg386 may be involved in substrate recognition by the intrinsic tenase complex, providing a possible explanation for the differential effect on the two branches of the coagulation cascade. Recombinant FX mutant studies confirmed our findings in patient plasma and provided further support for these hypotheses.  iv  Preface The FX-deficient patient study component of this dissertation (Chapter 5) was conducted as part of the “Blood Coagulation Biochemistry” project approved by the UBC Clinical Research Ethics Board under Ethics Certificate #H07-00621.  v  Table of Contents Abstract ........................................................................................................................................... ii Preface............................................................................................................................................ iv Table of Contents............................................................................................................................ v List of Tables ............................................................................................................................... viii List of Figures ................................................................................................................................ ix List of Symbols and Abbreviations................................................................................................ xi Acknowledgements....................................................................................................................... xv 1 INTRODUCTION.................................................................................................................... 1 1.1 Haemostasis........................................................................................................................... 1 1.2 Blood coagulation ................................................................................................................. 2 1.2.1 Initiation by the extrinsic pathway ................................................................................. 2 1.2.2 Propagation by the intrinsic pathway ............................................................................. 2 1.2.3 Prothrombinase complex ................................................................................................ 3 1.2.4 Established role of factor X ............................................................................................ 8 1.3 Fibrinolysis.......................................................................................................................... 18 1.3.1 Current fibrinolytic paradigm ....................................................................................... 18 1.3.2 Thrombolytic/fibrinolytic therapy ................................................................................ 27 1.3.3 Novel role of factor X in fibrinolysis ........................................................................... 29 1.4 Factor X deficiency ............................................................................................................. 35 1.5 Overall thesis outline and rationale..................................................................................... 37 1.6 Hypothesis........................................................................................................................... 38 2 MATERIALS AND METHODS............................................................................................... 39 2.1 Materials.............................................................................................................................. 39 2.2 Proteins................................................................................................................................ 40 2.3 Molecular biology of factor X............................................................................................. 41 2.3.1 Site-directed mutagenesis ............................................................................................. 41 2.3.2 Stable expression of recombinant factor X................................................................... 43 2.3.3 Clone selection ............................................................................................................. 44 2.4 Purification of recombinant factor X .................................................................................. 45  vi 2.5 Assessment of procoagulant function ................................................................................. 47 2.5.1 Activation by RVV-X................................................................................................... 47 2.5.2 Factor Xa clotting activity ............................................................................................ 48 2.6 Assessment of fibrinolytic function .................................................................................... 48 2.6.1 Plasmin-mediated fragmentation of FXa...................................................................... 48 2.6.2 tPA-mediated plasmin generation ................................................................................ 50 2.6.3 Purified fibrin clot lysis ................................................................................................ 50 2.6.4 Plasma clot lysis ........................................................................................................... 51 2.7 Factor X-deficient patient study.......................................................................................... 51 2.7.1 Blood sample preparation ............................................................................................. 51 2.7.2 Isolation of DNA .......................................................................................................... 51 2.7.3 Factor X antigen quantification .................................................................................... 52 2.7.4 Assessment of extrinsic function.................................................................................. 52 2.7.5 Assessment of intrinsic function................................................................................... 53 2.7.6 DNA sequencing........................................................................................................... 53 2.7.7 Arg386 mutation........................................................................................................... 55 3 ROLE OF Lys330 IN CONVERSION OF FXa INTO A FIBRINOLYTIC COFACTOR ...... 56 3.1 Overview and specific goals ............................................................................................... 56 3.2 Results ................................................................................................................................. 57 3.2.1 Mutagenesis and production of recombinant factor X ................................................. 57 3.2.3 Assessment of procoagulant function........................................................................... 63 3.2.4 Assessment of fibrinolytic function.............................................................................. 65 3.3 Discussion ........................................................................................................................... 76 4 PRELIMINARY STUDIES OF A ROLE FOR THE β-PEPTIDE IN CONVERSION OF FXa INTO A FIBRINOLYTIC COFACTOR ...................................................................................... 89 4.1 Overview and specific goals ............................................................................................... 89 4.2 Results ................................................................................................................................. 90 4.2.1 Mutagenesis and production of recombinant factor X ................................................. 90 4.2.2 Assessment of procoagulant function........................................................................... 90 4.2.3 Assessment of fibrinolytic function.............................................................................. 94 4.3 Discussion ........................................................................................................................... 96  vii 5 FACTOR X-DEFICIENT PATIENT STUDY........................................................................ 101 5.1 Overview and specific goals ............................................................................................. 101 5.2 Results ............................................................................................................................... 101 5.2.1 Assessment of plasma factor X antigen levels ........................................................... 101 5.2.2 Determination of factor X extrinsic pathway function............................................... 103 5.2.3 Determination of factor X intrinsic pathway function................................................ 103 5.2.4 DNA sequence analysis .............................................................................................. 106 5.2.5 Arg386 mutation......................................................................................................... 106 5.3 Discussion ......................................................................................................................... 109 6 SUMMARY............................................................................................................................. 121 6.1 Role of Lys330 in conversion of FXa into a clot-dissolving cofactor .............................. 121 6.2 Role of β-peptide in functional conversion of FXa........................................................... 122 6.3 Factor X-deficient patient.................................................................................................. 123 7 FUTURE STUDIES................................................................................................................. 126 7.1 Fibrin, antithrombin, and the stabilization of Xa33/13 ..................................................... 126 7.2 Role of the β-peptide in fibrinolysis.................................................................................. 127 7.3 Effect of Arg386Cys mutation on FX translation and secretion....................................... 129 BIBLIOGRAPHY....................................................................................................................... 131  viii  List of Tables Table 1: Primers used for mutagenesis of F10 gene..................................................................... 42 Table 2: Primers used for determining the DNA sequence of the F10 gene of FX-deficient patient and normal control DNA................................................................................................... 54 Table 3: Effect of VKOR on wildtype and Lys330Gln FX antigen expression ........................... 61 Table 4: Comparison of FX antigen expression levels from wildtype (wtFX)-, Arg386Cys (R386C)-, and Arg386Ala (R386A)-expressing cells ................................................................ 111 Table 5: Clinical measurements of coagulation factors in FX-deficient patient plasma ............ 114  ix  List of Figures Figure 1: Overview of the coagulation cascade.............................................................................. 4 Figure 2: Structure of prothrombin and activation to thrombin by FXa......................................... 7 Figure 3: Structure of factor V and activation to FVa by thrombin................................................ 9 Figure 4: Structure of F10 gene and activation of FX to FXa by the Xase complexes ................ 12 Figure 5: FXa crystal structures highlighting potential plasminogen binding sites following cleavage by plasmin...................................................................................................................... 14 Figure 6: Accepted two-phase model of fibrinolysis.................................................................... 19 Figure 7: Structure of fibrinogen and location of thrombin and plasmin cleavage sites .............. 21 Figure 8: Structure of plasminogen and activation to plasmin ..................................................... 23 Figure 9: Structure and activation of tPA ..................................................................................... 26 Figure 10: FXa fragmentation by plasmin .................................................................................... 30 Figure 11: Auxiliary cofactor model of fibrinolysis ..................................................................... 34 Figure 12: Detectable levels of functional recombinant FX were secreted by HEK 293 cells stably transfected with wtFX DNA............................................................................................... 58 Figure 13: Detectable levels of functional recombinant FX were secreted by HEK 293 cells stably transfected with K330Q mutant FX DNA.......................................................................... 59 Figure 14: Separation of rFX based on extent of γ-glutamyl carboxylation................................. 62 Figure 15: Wildtype FX (with VKOR) is not completely activated by RVV-X while Lys330Gln FX (with VKOR) shows normal activation to FXa ...................................................................... 64 Figure 16: Lys330Gln mutation prevents Xa33/13 generation, but does not prevent plasminogen binding to FXaβ ............................................................................................................................ 66 Figure 17: FXaβ produced from recombinant K330Q mutant FX participates in tPA-mediated plasmin generation to a similar extent as plasma-derived FXa and Xa33/13............................... 68 Figure 18: Plasma-derived normal FX is more rapidly degraded than other cofactors during the tPA-mediated plasmin generation chromogenic assay ................................................................. 69 Figure 19: FXaβ generated from recombinant Lys330Gln mutant FX accelerates purified clot lysis faster than plasma-derived FX, FXa or Xa33/13.................................................................. 71 Figure 20: Western blots of timecourse samples of purified fibrin clot lysis assay fail to provide a comprehensive explanation for the effects of auxiliary cofactors on fibrinolysis rates ............... 72 Figure 21: FX zymogens, both plasma-derived and recombinant Lys330Gln, accelerate plasma clot lysis faster than the FXa derivatives ...................................................................................... 74  x Figure 22: The fate of FX and FXa derivatives during plasma clot lysis ..................................... 75 Figure 23: Auxiliary cofactor model of fibrinolysis with both aPL and fibrin as reaction surfaces promoting the plasmin-mediated conversion of FXa into a tPA cofactor .................................... 80 Figure 24: Detectable levels of functional β-peptide FX mutants were secreted by stably transfected HEK 293 cells ............................................................................................................ 91 Figure 25: Lys435Gln, Lys427Gln, and the triple-point rFX mutant are poorly activated by RVV-X.......................................................................................................................................... 93 Figure 26: Under conditions facilitating anionic phospholipid-binding, β-peptide mutation impairs FXaβ production .............................................................................................................. 95 Figure 27: The triple-point mutant shows drastically reduced conversion of FXaα to FXaβ, although it is unclear if FXaβ and Xa33 generated from this mutant bind plasminogen ............. 97 Figure 28: Factor X antigen levels in patient plasma are reduced to 15 % compared to normal plasma, but FX activation through the extrinsic pathway is normal........................................... 102 Figure 29: Patient plasma has 15 % extrinsic clotting activity compared to normal plasma ..... 104 Figure 30: Patient plasma factor X activation through the intrinsic pathway is impaired.......... 105 Figure 31: Patient plasma has 5 % intrinsic clotting activity compared to normal plasma ........ 107 Figure 32: Identification of two single-point mutations of the F10 gene from FX-deficient patient DNA sample................................................................................................................................ 108 Figure 33: Stable expression of recombinant wildtype FX (wtFX), Arg386Ala (R386A), and Arg386Cys (R386C) FX mutants in HEK 293 cells................................................................... 110 Figure 34: Arg386Ala FX mutation results in normal extrinsic and reduced intrinsic clotting function compared to plasma-derived FX................................................................................... 112 Figure 35: Arg386Cys mutation may impair FX folding by disrupting proper disulfide bond formation..................................................................................................................................... 116 Figure 36: Arg386 may participate in binding FVIIIa and/or FIXa in the intrinsic FX activating complex....................................................................................................................................... 117  xi  List of Symbols and Abbreviations 4G3: Monoclonal calcium-dependent conformation-specific antibody for FX (recognizes the Gla domain) APC: Activated protein C aPL: Anionic phospholipid aPTT: Activated partial thromboplastin time AT: Antithrombin BCA: Bicinchoninic acid BSA: Bovine serum albumin CaCl2: Calcium chloride CNBr: Cyanogen bromide CO2: carbon dioxide CRM: Cross-reacting material CVD: Cardiovascular disease DMEM/F-12: Dulbecco’s modified Eagle’s medium supplemented with F-12 nutrient mixture DMSO: Dimethyl sulfoxide EDTA: Ethylenediamine tetraacetic acid EGF: Epidermal growth factor FBS: Fetal bovine serum FDA: Food and Drug Administration (US) FIX: Factor IX FIXa: Activated factor IX FV: Factor V  xii FVa: Activated factor V FVII: Factor VII FVIIa: Activated factor VII FVIII: Factor VIII FVIIIa: Activated FVIII FX: Factor X FXa: Activated FX FXaβ: Activated FX with a short C-terminal peptide removed FXI: Factor XI FXIa: Activated factor XI FXIII: Factor XIII FXIIIa: Activated factor XIII G418: Geneticin; a selection reagent Gla: γ-carboxylated glutamic acid residue; aPL binding domain HBS: HEPES-buffered saline HBSP: HBS with 0.01% PEG 8000 HEK: Human embryonic kidney HEPES: 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid HK: High molecular weight kininogen HRP: Horseradish peroxidase II: Prothrombin ITS: Insulin-transferrin-selenium supplement IVS: Intervening (intronic) sequence K330: Lys330; residue in autolysis loop of FX  xiii K330Q: Lys330 mutated to Gln KK: Kallikrein LB: Luria-Bertani LMV: Large multilamellar vesicles (phospholipids) Na2HPO4: Sodium phosphate, dibasic NaH2PO4: Sodium phosphate, monobasic Opti-MEM: Modified Eagle’s minimum essential medium (reduced serum) PAI-1: Plasminogen activator inhibitor 1 PAR: Protease activated receptor PC: Phosphatidylcholine PCR: Polymerase chain reaction PEG: Polyethylene glycol PT: Prothrombin time PVDF: Polyvinylidine difluoride PZ: Protein Z R386: Arg386 amino acid residue in FX protease domain R386A: Arg386 mutated to Ala R386C: Arg386 mutated to Cys rpm: Revolutions per minute RVV-X: Russell’s viper venom FX activator S-2251: Chromogenic substrate for plasmin S-2765: Chromogenic substrate for FXa SDS-PAGE: Sodium dodecyl sulphate polyacrylamide gel electrophoresis Serpin: Serine protease inhibitor  xiv SUV: Small unilamellar vesicles (phospholipids) TBS: Tris-buffered saline TBST: TBS with 0.1% Tween-20 TF: Tissue factor TFPI: Tissue factor pathway inhibitor tPA: Tissue-type plasminogen activator VKOR: Vitamin K epoxide reductase wtFX: Wildtype FX (recombinant) X47/13: FX proteolytic derivative containing a 47 kDa fragment non-covalently linked to a 13 kDa fragment Xa33/13: FXa derivative containing a 33 kDa fragment non-covalently linked to a 13 kDa fragment; similar to X47/13 but with the activation peptide removed Xa40: 40 kDa FXa derivative lacking the Gla domain Xase: FX-activating complex (extrinsic or intrinsic) ZPI: Protein Z-dependent protease inhibitor αXHC: Monoclonal antibody against the heavy chain of human FX(a) εACA: Epsilon aminocaproic acid; C-terminal lysine analogue  xv  Acknowledgements First and foremost, I would like to thank my supervisor, Dr. Ed Pryzdial who has supported me throughout this process with his seemingly inexhaustible knowledge, steadfast encouragement, and heroic patience whilst allowing me to find my own way. This dissertation would not have been possible without his continued guidance, unwavering support, and endless supply of martinis. In addition, I would like to thank my supervisory committee members Drs. Ross MacGillivray, Kelly McNagny, John Hill, and Paul Rennie for generously sharing their valuable insights and dedicating their time and efforts to helping me achieve my academic goals. To Isis Carter, Dr. Michael Sutherland, Scott Meixner, Kimberley Talbot, Kathleen DeAsis, Edwin Gershom, Dr. Ayo Yila Simon, Dr. Jina Song, Val Smith, Dr. Ann Wong, and many other members of the Centre for Blood Research: your unfailing camaraderie has made the trials and tribulations of graduate school worth every second. Finally, I am immeasurably grateful for the encouragement from my family and friends throughout this rollercoaster ride; your collective support helped me stay on track even when I could not see around the next bend. Thank you all!  1  1 INTRODUCTION 1.1 Haemostasis Haemostasis is the physiological control of bleeding. In response to vascular damage, the haemostatic process is responsible for rapidly and effectively sealing the site of injury to stem blood loss until the structural integrity of the vessel wall can be re-established through endothelial layer repair (reviewed in [1]). This tightly regulated sequence of events culminating in the formation of a fibrin blood clot is mediated by complex interactions between the cells lining the blood vessel, platelets, and circulating proteins known as coagulation factors [2]. Once vessel repair is initiated and the clot is no longer needed, the clot is broken down to restore normal blood flow to the area. Maintaining a delicate balance between clot formation (coagulation) and clot dissolution (fibrinolysis) ensures that blood clots form only where and when they are needed. Dysregulation of these processes at any stage can result in serious and potentially fatal health problems including thrombosis and haemorrhage (reviewed in [3]). Haemostasis is comprised of four interconnected and highly regulated processes: primary haemostasis, blood coagulation, fibrinolysis, and anti-coagulation [3]. Primary haemostasis involves temporary blood vessel constriction through smooth muscle contractions to slow the blood flow surrounding the site of injury. This reduction in flow rate allows circulating platelets to adhere to the damaged region, creating an unstable platelet plug that temporarily blocks the break in the vessel wall to stem blood loss. The platelet plug is stabilized and reinforced through the initiation of the coagulation cascade, a series of enzymatic activations that ultimately result in the formation of a stable fibrin blood clot at the site of injury (reviewed in [4]). Once vascular repair is underway, the third phase of haemostasis, fibrinolysis degrades the fibrin clot to restore normal blood flow to the area (reviewed in [5]). The fourth phase of haemostasis, anti-  2 coagulation, involves both circulating and membrane-bound proteins, which prevent the formation of blood clots in normal, healthy (undamaged) blood vessels [3].  1.2 Blood coagulation 1.2.1 Initiation by the extrinsic pathway The coagulation cascade involves the sequential activation of a series of inactive enzyme precursors (zymogens) and non-enzymatic cofactor precursors (procofactors) to ultimately generate a stable fibrin clot at the site of vascular injury (Figure 1) [4]. Because healthy, intact blood vessel endothelium is devoid of anionic phospholipid (aPL) and the membrane-bound coagulation protein tissue factor (TF), these components are said to be “extrinsic” to blood [3]. Endothelial damage exposes both subendothelial TF and aPL to platelets and coagulation proteins circulating in blood to initiate clot formation through this extrinsic pathway. TF acts as a receptor for the serine protease factor VIIa (FVIIa) and the TF-FVIIa complex then activates the circulating zymogen factor X (FX) to the serine protease factor Xa (FXa) [4]. FXa is responsible for the proteolytic activation of another zymogen, prothrombin to its active form, thrombin. Thrombin converts circulating fibrinogen monomers to fibrin, which then polymerizes to form a clot that is further stabilized by the cross-linking enzyme factor XIIIa [3]. 1.2.2 Propagation by the intrinsic pathway Another activating complex comprised of factors VIIIa (FVIIIa) and IXa (FIXa), which are part of the intrinsic coagulation pathway, can also activate FX (Figure 1). The zymogen FIX can be activated either by the TF-FVIIa complex or by factor XIa (FXIa), which is activated by the initial burst of thrombin generated through the extrinsic pathway [6]. Similarly, the procofactor FVIII is converted to FVIIIa by minute quantities of thrombin or TF-FVIIIa [7]. This amplification of FX activation and subsequent thrombin generation is critical for sustained formation of a stable fibrin blood clot as evidenced by the effects of haemophilia A (FVIII  3 deficiency) and B (FIX deficiency), which combined affect approximately 1 in 5,000 males worldwide [3]. Alternatively, upstream of the intrinsic pathway is the contact pathway, which is initiated when factor XIIa (FXIIa), kallikrein (KK), and high molecular weight kininogen (HK) bind to kaolin, glass, or another artificial surface to form a FXI-activating complex (Figure 1) [3]. FXIa then converts FIX to FIXa to activate the intrinsic pathway. While patients with deficiencies in FXII, prekallikrein, or high molecular weight kininogen do not bleed, suggesting that these are not vital components of the physiological haemostatic response to vascular damage, FXIdeficient patients often display mild bleeding diatheses, indicating that FXI is important [8]. 1.2.3 Prothrombinase complex Newly generated FXa comprises the enzymatic component of the prothrombinase complex, which also includes calcium and the cofactor Va (FVa) on an aPL membrane surface [9,10]. This complex is responsible for the conversion of prothrombin to thrombin at the site of vascular injury. Both prothrombin and FXa bind aPL in a calcium-dependent manner while the FVa:aPL interaction does not require calcium [11-13]. While FXa can cleave prothrombin in the absence of FVa, aPL and calcium, within the context of the prothrombinase complex, FXamediated activation of prothrombin is accelerated approximately 300,000-fold [14-16]. 1.2.3.1 Prothrombin/thrombin Thrombin is the central enzyme in haemostasis, interacting with a multitude of substrates, cofactors and inhibitors to participate in both procoagulant and anticoagulant pathways. Its zymogen, prothrombin, is a 72 kDa vitamin K-dependent glycoprotein produced in the liver, which circulates as a single chain molecule in human plasma at a concentration of approximately 1.4 µM [17]. Prothrombin contains a single Gla domain in which ten glutamic acid residues are converted to γ-carboxyglutamic acid (Gla) by the vitamin K-dependent enzyme  4  Figure 1: Overview of the coagulation cascade Tissue damage exposes anionic phospholipid and tissue factor (TF) to circulating coagulation factors, thereby initiating the coagulation cascade through the extrinsic pathway. Factor X is activated by the extrinsic Xase complex, which is comprised of TF and factor VIIa. Factor Xa then forms the prothrombinase complex with factor Va, anionic phospholipid and calcium. The initial burst of thrombin (IIa) generated by the prothrombinase complex feeds back into the cascade to activate factor XI, which then activates factor IX. Alternatively, factor XI can be activated by factor XIIa, kallikrein (KK) and high molecular weight kininogen (HK). The intrinsic Xase complex, comprised of factors VIIIa and IXa activates factor X, which then amplifies prothrombin (II) activation and ultimately results in the formation of a stable fibrin blood clot.  5  Tissue Damage  XI  Extrinsic Pathway  XI HK KK XIIa  IIa  TFPI  Intrinsic (contact) Pathway  X  TF  XIa  IXa X VII  VIIa  VIIIa X  X  TF  IXa  Xa  II  II  Va Xa  IIa II a  Fibrinogen  Fibrin Clot  IX  6 γ-glutamyl carboxylase, two Kringle domains, and a protease domain (Figure 2) (reviewed in [18]). The Gla domain is required for anionic phospholipid binding, which serves to co-localize prothrombin and its activation complex, prothrombinase to the site of vascular injury. The serine protease domain contains the active site and a number of cryptic surface regions that are exposed upon prothrombin activation. The primary haemostatic role of thrombin is the generation of fibrin. At the site of vascular injury, a series of proenzymes and procofactors are activated to facilitate the thrombin-mediated proteolytic conversion of fibrinogen into fibrin that ultimately results in the formation of a stabilized fibrin blood clot [3]. Initial small quantities of thrombin generated through the extrinsic pathway participate in a positive feedback mechanism to amplify the coagulation response by activating coagulation factors V (FV), VIII, XI, and XIII [3]. Thrombin also contributes to the generation of a stable clot by interacting with a variety of platelet receptors including protease-activated receptors (PARs) and glycoprotein Ibα to induce platelet activation and aggregation [19,20]. 1.2.3.2 Factor V/Va Factor V, the single-chain inactive procofactor form of FVa, is a 330 kDa protein that circulates in human plasma at a concentration of 20 nM [21,22]. FV contains three A domains, a single B domain and two C domains and is subject to extensive post-translation modifications including glycosylation, phosphorylation, and sulfation (Figure 3) [23]. FV is activated by thrombin-mediated proteolytic excision of the large B domain through a series of specific cleavages at Arg709, Arg1018, and Arg1545 (Figure 3) [24]. This results in the formation of FVa, the active cofactor, containing a heavy chain and a light chain that remain non-covalently associated through subunit interactions mediated by calcium and copper [25-27].  7  Prothrombin Gla  Kringle 1  S-S  Kringle 2  B (Protease)  A  FXa  Meizothrombin Gla  Kringle 1  S-S  Kringle 2  A  B (Protease)  Arg320 FXa  Thrombin Gla  Kringle 1  S-S  Kringle 2  Fragment 1.2  A  B (Protease)  Arg271  Figure 2: Structure of prothrombin and activation to thrombin by FXa Prothrombin contains a Gla domain, two Kringle domains and a serine protease domain. During prothrombin activation, FXa in the presence of FVa first cleaves after Arg320 to generate meizothrombin and then at Arg271 to release the Gla and two Kringle domains, known collectively as fragment 1.2. This yields mature thrombin, which contains the heavy (B) chain linked by a single disulfide bond to a short A chain.  8 FVa is localized to the site of vascular injury through calcium-independent interaction of the FVa light chain with anionic phospholipid exposed by damage to the vascular endothelial layer. FVa acts as a non-enzymatic cofactor in the prothrombinase complex, facilitating the generation of thrombin during clot formation. The presence of FVa has a dual effect on FXamediated prothrombin activation: 1) FVa increases the affinity of FXa for the aPL membrane surface by 100-fold [10,28,29]; and 2) FVa increases the enzymatic rate of FXa by 1000-fold [28]. These contributions of FVa to the prothrombinase complex result in the necessary enhancement of thrombin generation compared to FXa-catalyzed activity alone required to exceed the basal anticoagulant threshold of plasma [16]. 1.2.4 Established role of factor X 1.2.4.1 Primary structure The 27 kb human F10 gene is located on chromosome 13q34, adjacent to the F7 gene and contains 8 exons and 7 introns [30,31]. Exon I codes for the signal peptide; exon II encodes the propeptide sequence and the Gla domain; exon III codes for a short aromatic stack; exons IV and V encode epidermal growth factor-like (EGF) domains 1 and 2, respectively; exon VI codes for the activation peptide; and exons VII and VIII encode the serine protease domain (Figure 4a) [30,32]. Not only is the FX amino acid sequence largely conserved across a diverse range of organisms from chickens to mice to humans, but FX also shares structural and/or organizational homology with a number of other coagulation proteases including FVII, FIX, and protein C [30,33]. FX is synthesized in the liver as a single-chain 59 kDa precursor and circulates in the bloodstream as a two-chain zymogen at a concentration of approximately 170 nM [34,35]. The conversion of single-chain to two-chain FX is the result of intracellular excision of an Arg-Lys-  9  Factor V A1  A2  B  A3  C1  C2  IIa  A1  A2  A3  C1  Arg709  A1  C2  IIa  A3  A2  C1  Arg1018  C2  IIa  Factor Va A1  A2  A3  C1  C2  Arg1545 Figure 3: Structure of factor V and activation to FVa by thrombin Factor V contains three A domains, a large B domain, and two C domains. During activation, thrombin (IIa) first cleaves after Arg709, a short distance into the B domain. The B domain is then cleaved at Arg1018 and finally at Arg1545 to release the B domain, yielding the mature cofactor. The resulting heavy chain (A1-A2) and light chain (A3-C1-C2) remain non-covalently associated through divalent metal interactions.  10 Arg tripeptide between the second EGF domain and the activation peptide [34,36]. The heavy chain of mature FX is 303 residues in length and contains the activation peptide and the serine protease domain (Figure 4b). The light chain (139 residues) is connected to the heavy chain by a single disulfide link at Cys132-Cys302 and contains the Gla domain, the aromatic stack and both EGF domains [34,35]. FX is subjected to extensive post-translational modifications including glycosylation, γglutamyl carboxylation and β-hydroxylation [34,37,38]. During processing, the activation peptide undergoes glycosylation at Thr159 (O-linked), Thr171 (O-linked), Asn181 (N-linked), and Asn191 (N-linked) [39,40]. Also, the 11 glutamic acid residues in the N-terminal Gla domain are modified to γ-carboxyl glutamic acids by the vitamin K-dependent enzyme γglutamyl carboxylase [41,42]. This modification is crucial for proper enzymatic function as the Gla domain is responsible for calcium-dependent aPL binding [43]. Vitamin K acts as a cofactor in this reaction and the resulting vitamin K epoxide must be recycled to reduced vitamin K by the enzyme vitamin K epoxide reductase (VKOR) in a rate-limiting step before it can be used again by γ-glutamyl carboxylase [44-47]. Following γ-glutamyl carboxylation, Asp63 in the first EGF domain is β-hydroxylated, a modification which may be important for calcium binding in the EGF domain [48]. 1.2.4.2 Tertiary structure The first crystal structure of human FXa was published in 1993 [49], describing a Gladomainless form of FXa (Figure 5). In agreement with previous experimental and modeling studies, the overall arrangement of domains in the FXa crystal structure was relatively linear, suggesting that the molecule projects nearly perpendicular from the phospholipid membrane surface in the prothrombinase complex. The first EGF domain was found to be flexibly disordered while the second EGF domain was positioned to make a number of contacts with  11 residues on the surface of the catalytic domain. The structure of the active site of FXa was nearly identical to other serine proteases with the exposed catalytic triad oriented to project away from the (expected) membrane surface. It should be noted that during the production of FXa crystals for this study, the authors observed heterogeneous cleavage of a basic surfaceexposed region known as the autolysis loop within the catalytic domain. This loop spans Arg326-Arg336, contains four basic residues, is susceptible to both proteolytic and autoproteolytic cleavage [50], and plays a crucial role in inhibitor recognition and interaction [51-54]. Furthermore, the described crystals appeared to be missing a short C-terminal region of the heavy chain known as the β-peptide, suggesting (auto)proteolysis also occurred during crystal growth [49]. In 2002, another group reported a model of human FX based on a combination of computational modeling and previous crystal structures of FXa [55]. This model included the Gla and first EGF domains as well as the activation peptide, generating a more complete picture of FX(a) structure and providing insight into some of the key conformational changes that occur upon zymogen activation. As with the structure described by Padmanabhan and colleagues [49], the FXa crystal structure used for modeling in this study was Gla-domainless and was also missing the β-peptide [56] (Figure 5). The autoloysis loop however was intact. Mutational studies have also contributed significantly to our understanding of the structurefunction relationship of FX(a). These studies have confirmed many of the interactions predicted by models and observed in crystals, and reveal that a number of surface regions, particularly in the catalytic domain, appear to be important for proper FXa function [53,54,57-81]. Of particular relevance for this report, mutation of the basic residues in the autolysis loop indicated that Arg332 in particular plays an important role in interaction of FXa and antithrombin,  12  A  F10  SP PP Gla I  B  II  EGF 1  EGF 2  AP  IV  V  VI  III  Factor X Gla  EGF 1  Protease VII  VIII  S-S  EGF 2  AP  Protease  Arg195 Xase  Factor Xa Gla  EGF 1  Light Chain  S-S  EGF 2  Protease  Heavy Chain  Figure 4: Structure of F10 gene and activation of FX to FXa by the Xase complexes A) F10 gene. Exon I codes for the signal peptide (SP); exon II encodes the propeptide (PP) and the Gla domain; exon III codes for a short aromatic stack; exons IV and V encode epidermal growth factor-like (EGF) domains 1 and 2, respectively; exon VI codes for the activation peptide (AP); and exons VII and VIII encode the serine protease domain. B) FX structure and activation. Factor X circulates as a two-chain disulfide-linked zymogen. During activation, either the extrinsic or intrinsic Xase complex cleaves after Arg195 to release the activation peptide from the N-terminus of the heavy chain.  13 especially in the presence of heparin [53]. Conversely, Lys330 has a mild inhibitory effect on interaction with antithrombin that is overcome by heparin-mediated conformational rearrangements known to occur in both FXa and antithrombin [53]. Additionally, a number of surface regions on FX(a) are involved in protein-protein interactions with components of the Xase and prothrombinase complexes. Both the acidic “34-40” loop, comprised of residues Ile213-Gly219, and a large adjacent cluster of negatively charged residues (Asp250-Glu260) play a role in prothrombin activation by the prothrombinase complex and intrinsic pathwaymediated activation of FX [63,78,82]. On the opposite side of FXa lies a basic region known to be involved in FVa binding [60,61,69]. This same region has also been implicated in TF-FVIIamediated activation of FX [82] and may constitute a recognition site for FVIII as well (reviewed in [83]). Furthermore, the first EGF domain has also been proposed as a site of interaction between FX and FVIIa in the extrinsic Xase complex [55,84]. 1.2.4.3 Activation In response to vascular injury, the zymogen FX can be activated through both branches of the coagulation cascade. During initiation of coagulation, newly exposed membrane-bound TF interacts with FVII(a) in the presence of calcium to form the extrinsic Xase complex. FVIIa acts as the enzymatic component of this complex, cleaving a single Arg195-Ile196 peptide bond in the heavy chain of FX to release the 12 kDa N-terminal activation peptide and generate the serine protease FXaα (Figure 4b) (reviewed in [32]). This activated enzyme is a heterodimer consisting of a 16 kDa light chain covalently linked to the 30 kDa heavy chain comprising residues Ile196-Lys448. Prior to activation, the zymogen takes on an extended conformation, due in large part to both the attractive and repulsive interactions between the activation peptide and portions of the second EGF domain [55]. Following cleavage and release of the activation peptide, the  14  A  B  Figure 5: FXa crystal structures highlighting potential plasminogen binding sites following cleavage by plasmin Two different crystal structures of FXa (A: Protein Database (PDB) accession code 1XKA [56]; B: PDB accession code 1HCG [49]) highlighting the autolysis loop and β-peptide. The FXa heavy chain (blue) and a portion of the light chain (green) are shown. The autolysis loop, comprised of residues 326-336, is coloured white with basic residues displayed as sticks. The βpeptide basic residues are coloured yellow. The catalytic triad is highlighted in orange. Two different FXa crystals are shown here to demonstrate the heterogeneity in protein proteolysis during the crystallization process, particularly within the autolysis loop and the β-peptide region. All crystal structures are visualized using Rasmol 2 software (http://rasmol.org).  15 repulsion caused by the activation peptide is lost and the FXa molecule contracts by approximately 10-15 Å [55]. The newly exposed heavy chain N-terminal residue Ile196 reorients into the interior of the serine protease domain of FXa where it forms a critical salt bridge with Asp378 [55]. This results in a conformational rearrangement of a number of neighbouring residues including the active site Ser379 and residues forming the S1 specificity pocket, a binding region that largely determines the functional activity of FXa [55]. Thus, release of the activation peptide triggers the formation of the mature, catalytically competent active site of FXa containing the catalytic triad residues His236, Asp282 and Ser379. The initial burst of FXa generally yields enough thrombin to induce local aggregation of platelets and activate other clotting factors, including those involved in the intrinsic pathway [3]. During amplification of the procoagulant response, exposed anionic phospholipids on either damaged endothelial cells or localized platelets bind FIXa along with its cofactor FVIIIa in the presence of calcium [85]. This intrinsic Xase complex cleaves the same Arg195-Ile196 peptide bond as the extrinsic Xase complex with the same resulting conformational rearrangement, yielding a robust burst of FXa and thrombin sufficient for stable clot formation. A common in vitro activator of FX is the snake venom-derived metalloenzyme Russell’s viper venom FX activator (RVV-X). RVV-X cleaves the same single peptide bond as the extrinsic and intrinsic Xases but, unlike these physiological complexes, it does not require a membrane surface to do so [86]. 1.2.4.4 Interaction with anionic phospholipid In quiescent cells, anionic phospholipids are exclusively located on the cytosolic side of the plasma  membrane  bilayer  and  the  exposure  of  anionic  phospholipids,  primarily  phosphatidylserine (PS), is restricted to sites of vascular damage [87]. A number of phospholipid translocase proteins regulate this asymmetrical distribution of phospholipids  16 within the plasma membrane. An energy-dependent lipid transporter known as flippase selectively translocates anionic phospholipids from the outer leaflet to the cytosolic side of the plasma membrane (reviewed in [88]). In cells with elevated cytosolic calcium levels, including activated platelets, scramblase rapidly transports phospholipids bi-directionally across the membrane in a calcium-dependent manner to randomize phospholipid distribution, creating a membrane surface suitable for binding circulating coagulation factors [87-90]. Like other vitamin K-dependent coagulation factors, FX contains a Gla domain that is responsible for the anionic phospholipid membrane-binding properties of the protein and contributes to the localization of the coagulation response to sites of vascular injury. The Nterminal portion of the Gla domain forms the ω-loop due to binding of calcium ions within the core of the Gla domain [55]. This conformation forces a number of hydrophobic side chains comprising the ω-loop to protrude outwards from the protein with multiple studies suggesting that these form a foot-like structure that inserts into the membrane surface to avoid energetically unfavourable solvent exposure [55,91]. The specific requirement for negatively charged phosphatidylserine is thought to be a result of interactions between the serine head groups and both the calcium ion-Gla residue network and the only highly conserved cationic residue among Gla domains, Arg16 [92]. Estimates of the dissociation constant for the interaction between FX(a) and aPL range from 30-60 nM [93-95]. Thus, being lower than the circulating concentration of FX (170 nM), membrane accumulation and localization of FX is predicted once aPL becomes available as a result of endothelial damage or platelet activation. 1.2.4.5 Enzymatic function in prothrombinase complex The most critical role of FXa in coagulation is its activation of prothrombin to thrombin in the prothrombinase complex with FVa, calcium and aPL. FXa first cleaves prothrombin at Arg320, which separates the A and B chains, generating the intermediate known as  17 meizothrombin (Figure 2) [96]. A second FXa-mediated cleavage then occurs at Arg271 to release the Gla domain and two Kringle domains, collectively known as fragment 1.2, from the N-terminus of the A chain to yield the mature thrombin enzyme [97,98]. Unlike FXa, which remains tethered to aPL because of its intact Gla domain, the loss of this domain during prothrombin activation allows thrombin to be released from the membrane surface and circulate at the site of injury, thereby propagating the coagulation response. 1.2.4.6 Regulation of FXa activity Due to its central position in coagulation at the junction where the extrinsic and intrinsic pathways converge, tight regulation of FXa activity is critical for maintaining the delicate haemostatic balance. The three direct plasma inhibitors of FXa are tissue factor pathway inhibitor (TFPI), protein Z-dependent protease inhibitor (ZPI), and antithrombin (AT). Other inhibitors in plasma such as α2-macroglobulin and α1-proteinase inhibitor are also known to target FXa. TFPI circulates in plasma at a concentration of approximately 8 nM. Its role in the downregulation of the extrinsic pathway is two-fold. First, TFPI inhibits the initial stages of coagulation by binding to newly generated free FXa in a reversible and calcium-independent manner. Second, the TFPI-FXa complex can then form a tight quaternary inhibitory complex with TF-FVIIa in a calcium-dependent manner, preventing further FX and FIX activation [99103]. FXa in the prothrombinase complex is protected from TFPI-mediated inhibition [104,105]. Another plasma inhibitor of FXa is ZPI, a serine protease inhibitor (serpin) which circulates in plasma as a tight complex with its cofactor, protein Z (PZ) [106]. ZPI:PZ binds to phospholipid membrane-bound FXa, at which time PZ dissociates from the newly formed ZPI:FXa complex [106]. While most serpins form stable inhibitory complexes with their target proteases, the ZPI:FXa complex is reversible [54]. Unlike inhibition by TFPI, incorporation of  18 FXa into the prothrombinase complex does not appear to protect the enzyme from ZPI-mediated inhibition [107]. The third physiological FXa inhibitor, antithrombin, is also a serpin and circulates at a relatively high plasma concentration of 2.3 µM [108]. Antithrombin forms an irreversible inhibitory complex with FXa, an interaction that is enhanced approximately 1000-fold in the presence of heparin [109]. There is extensive evidence that incorporation of FXa into the prothrombinase complex protects FXa from inhibition by antithrombin both in the presence and absence of heparin [110-120]. This protection is at least partially due to the effective competition between prothrombin and antithrombin for FXa active site binding [110]. In addition, the FVa and prothrombin binding sites overlap with the heparin-binding site on FXa such that heparin is unable to enhance the antithrombin-mediated inhibition of FXa within the prothrombinase complex [110].  1.3 Fibrinolysis 1.3.1 Current fibrinolytic paradigm Following clot formation and initiation of endothelial repair, the fibrin blood clot must be broken down to re-establish normal blood flow to the area. According to the prevailing model of fibrinolysis, in the first phase fibrin acts as a cofactor for the enzyme tissue-type plasminogen activator (tPA) by co-localizing small amounts of tPA and its substrate, plasminogen, to the clot surface through weak interactions with intact fibrin (Figure 6) (reviewed in [121]). Small quantities of plasminogen are converted by tPA to the enzyme plasmin, which proteolytically primes the fibrin clot by exposing C-terminal lysine residues. In the second phase of fibrinolyis, these exposed lysine residues on “primed" fibrin act as additional receptors for both tPA and plasminogen, thereby amplifying plasmin production to generate fibrin degradation products and ultimately dissolve the clot [5,122].  19  Pg, tPA  Pg  Pg  tPA  K  tPA  Pg, tPA  Pg tPA  K  Pg tPA  Primed Fibrin  Intact Fibrin Pn  Pn  Degraded Fibrin  Figure 6: Accepted two-phase model of fibrinolysis Initial generation of low levels of plasmin (Pn) is facilitated by weak binding of plasminogen (Pg) and tPA to intact fibrin. Plasmin then primes the fibrin clot for further dissolution by proteolytically exposing C-terminal lysine (K) residues, which act as additional binding sites for tPA and plasminogen, thus amplifying plasmin generation and fibrinolysis. Modified from [123].  20 1.3.1.1 Fibrinogen/fibrin Fibrinogen is the circulating 340 kDa glycoprotein precursor to fibrin, consisting of a heterodimer of disulfide-linked Aα-, Bβ-, and γ-polypeptide chains (Figure 7) (reviewed in [124]). Each fibrinogen macromolecule is dumbbell-shaped with two outer D regions each linked by a coiled-coil segment to a central E region. The C-terminal segments of the Aα-chains form the αC domains, which extend away from the D region, interacting with the E region in fibrinogen and intermolecularly with each other in polymerized fibrin [124]. Chemically, fibrin monomers differ from fibrinogen only by the thrombin-mediated cleavage of short N-terminal fibrinopeptides “A” and “B” from the Aα- and Bβ-chains, respectively [124]. Structurally, however, the release of fibrinopeptides A and B results in significant conformational changes in fibrin leading to the exposure of a number of polymerization sites that are cryptic in fibrinogen. These exposed polymerization sites are known as “A” and “B” knobs and form non-covalent interactions with pre-existing complementary “a” and “b” holes in the D regions of adjacent fibrin molecules [124]. The resulting intermolecular A:a and B:b interactions produce halfstaggered fibrin oligomers which aggregate laterally to form an elaborate, branched threedimensional fibrin clot. The structural rearrangement of fibrin during activation and polymerization also exposes both tPA and plasminogen binding sites that are cryptic in fibrinogen, allowing fibrin to facilitate its own degradation. Fibrin contains both lysine-dependent and lysine-independent binding sites for tPA and plasminogen [124,125]. It has been proposed that C-terminal lysineindependent binding of tPA and plasminogen to fibrin occurs during the initial stages of fibrinolysis [125-127]. Previous studies have identified a segment of the D region of fibrin containing the γ312-324 sequence, which binds the finger domain of tPA [121,126,128,129].  21  Figure 7: Structure of fibrinogen and location of thrombin and plasmin cleavage sites A) Schematic of fibrinogen structure. Fibrinogen consists of two sets of disulfide linked Aα-, Bβ-, and γ chains, which are arranged into a central E domain and two outer D domains. Note that the flexible αC domains, which normally fold over the N-terminal portions of the Aα and Bβ chains in the central E region in fibrinogen, have been drawn to extend away from the D region for simplicity’s sake. B) Thrombin cleavage of fibrinopeptides A and B. Thrombin (IIa) excises the N-terminal fibrinopeptides A and B from the Aα- and Bβ- chains, respectively. This cleavage facilitates rearrangement of the fibrin monomers to promote polymerization of fibrin. C) Plasmin cleavage of fibrin during fibrinolysis. Plasmin (Pn) cleaves at a number of locations in polymerized fibrin (a single fibrin molecule is shown here) including in the C-terminal region of the Aα-chain and through all chains between the D and E domains.  22 The fibrin D region can also interact with plasminogen aminohexyl sites, which bind intact lysine residues rather than C-terminal lysines [127]. This initial formation of ternary fibrin-tPAplasminogen complexes in the absence of C-terminal lysines serves to generate small quantities of plasmin, which permits limited proteolysis of the fibrin clot at basic residues. Newly exposed C-terminal lysine residues then facilitate further tPA and plasminogen binding to the clot, enhancing plasmin generation and accelerating fibrinolysis. The D region of polymerized fibrin also contains an exposed Aα154-159 sequence that can bind either tPA (via the Kringle 2 domain) or plasminogen (via Kringles 1-3) in a lysine-dependent manner, but due to the vast excess of plasminogen over tPA in the blood, this site binds only plasminogen under physiological conditions [121]. The αC domain of polymerized fibrin binds both tPA and plasminogen through non-competing sites in a lysine-dependent manner [130]. 1.3.1.2 Plasminogen/plasmin Plasminogen, the precursor to the fibrinolytic enzyme plasmin, is a 90 kDa single-chain glycoprotein that circulates in plasma at a concentration of approximately 2 µM (reviewed in [131]). The protein is organized into several structural domains including a pre-activation peptide, five kringle domains, and a serine protease domain (Figure 8) (reviewed in [131]). Plasminogen circulates as a prozymogen commonly known as Glu-plasminogen, which can be converted to the zymogen Lys-plasminogen by plasmin-mediated release of a short N-terminal peptide (Figure 8) [132]. Lys-plasminogen displays enhanced fibrin affinity [133-135] and is more readily activated to plasmin than is Glu-plasminogen [135,136]. The current model of fibrinolysis proposes that fibrin clot formation facilitates tPA-mediated activation of small amounts of Glu-plasminogen and the resulting plasmin converts Glu-plasminogen to Lysplasminogen to enhance clot dissolution [121,122].  23 S-S S-S  Glu-Plasminogen  S-S  AP  K1  K2  K3  K4  K5  Protease  Pn S-S S-S S-S  Lys-Plasminogen  S-S  AP  K1  K2  K3  K4  K5  Protease  Lys78 tPA S-S S-S  Plasmin AP  K1  S-S S-S  K2  K3  K4  K5  Protease  Arg561 Figure 8: Structure of plasminogen and activation to plasmin Plasminogen circulates as a single chain 791-amino acid zymogen. It contains an N-terminal 77amino acid activation peptide followed by five Kringle (K) domains and a C-terminal serine protease domain. The activation peptide is released by cleavage by plasmin at Lys78 to yield Lys-plasminogen (or Lys-plasmin if activation peptide removal occurs after tPA-mediated activation). tPA activates plasminogen by cleavage at Arg561 to yield a two-chain disulfidelinked enzyme. Two interchain disulfide bonds are formed between Cys547 and Cys565, and Cys557 and Cys665.  24 Plasminogen is localized to sites of vascular injury through lysine-binding sites located within its Kringle domains, which recognize either internal or C-terminal exposed lysine residues, allowing plasminogen to interact with both intact and partially degraded fibrin [121]. Within the context of a fibrin clot, plasminogen is cleaved at Arg561-Val562 by tPA to generate the trypsin-like protease plasmin, which is comprised of two disulfide-linked chains, one containing the Kringle domains and the other containing the enzymatic domain (Figure 8) [131]. Plasmin cleaves after basic residues, either arginine or lysine, in target substrates. While plasmin has relatively broad substrate specificity including FV, FVIII, FIX, FX, and matrix metalloproteins, and participates in a variety of normal and pathological processes including cell migration, inflammation and tissue remodelling, the primary haemostatic role of plasmin is the proteolytic degradation of polymerized fibrin [137,138]. The initial plasmin-mediated cleavages occur in the surface-oriented αC-domains and between the D and E regions of polymerized fibrin [121]. These cleavages generate fibrin degradation products and expose C-terminal lysine residues that allow fibrin to act as a tPA cofactor, facilitating further plasminogen and tPA binding to fibrin and plasmin generation to enhance clot lysis [121]. This amplification of the fibrinolytic process is tempered by the presence of the primary physiological inhibitor of plasmin, α2-antiplasmin [139,140]. This circulating serine protease inhibitor not only binds to free plasmin to irreversibly inhibit its fibrinolytic activity, it also binds circulating plasminogen to prevent interaction with fibrin, and consequently delays the initiation of fibrinolysis [141,142]. Like FXa, which is protected from inhibition by antithrombin when bound to aPL in the context of the prothrombinase complex, fibrin-bound plasmin is also resistant to inhibition by α2-antiplasmin [143].  25 1.3.1.3 Tissue-type plasminogen activator As the name implies, tissue-type plasminogen activator (tPA) is the primary physiological activator of plasminogen at the site of a fibrin clot. tPA is synthesized by vascular endothelial cells and secreted into the bloodstream at a concentration of approximately 10 ng/mL as a single-chain 72 kDa glycoprotein containing a finger-like domain, an EGF domain, two Kringles, and a serine protease domain (Figure 9) (reviewed in [131]). Plasmin-mediated cleavage of tPA at the Arg275-Ile276 peptide bond generates a two-chain disulfide-linked molecule, which exhibits higher activity towards plasminogen circulating in blood than does single-chain tPA (Figure 9) [144]. However, both single-chain and two-chain tPA displayenhanced and approximately equivalent activity levels when bound to fibrin [5,144]. The half-life of circulating tPA is exceedingly short at approximately six minutes and this rapid clearance is mediated by the finger and EGF domains and carbohydrate moieties therein, as well as by the physiological inhibitor plasminogen activator inhibitor 1 (PAI-1) (reviewed in [145,146]). PAI-1 circulates in four-fold excess over tPA in blood to prevent systemic fibrinolysis and like α2-antiplasmin inhibition of fibrin-bound plasmin, fibrin-bound tPA is susceptible to inhibition by PAI-1 [131]. Like antithrombin, PAI-1 is a serpin that forms a stable covalent complex with tPA by trapping the enzyme’s active site with an uncleavable Arg-Met “bait” sequence (reviewed in [147]). Another physiological activator of plasminogen is urokinase (uPA). However, uPA does not specifically bind fibrin and, when initially developed as a thrombolytic agent, led to systemic plasminogen activation and depletion of coagulation factors (reviewed in [148]). While tPA is widely accepted as the main plasminogen activator within the context of haemostasis, the exact role, if any, of uPA in vascular fibrinolysis is less clear (reviewed in [149]). Instead, uPA is predominantly involved in cell migration and tissue remodeling through extravascular activation  26  tPA (single chain) S-S  F  EGF  K1  Protease  K2  Pn  tPA (two chain) S-S  F  EGF  K1  K2  Protease  Arg275 Figure 9: Structure and activation of tPA tPA circulates as a single chain 527-amino acid active enzyme. It contains an N-terminal fingerlike (F) domain followed by an epidermal growth factor-like (EGF) domain, two Kringle (K) domains, and a C-terminal serine protease domain. tPA can be cleaved by plasmin at Arg275 two yield a two-chain enzyme. A single disulfide bond between Cys264 and Cys395 link the heavy and light chains.  27 of plasminogen, and appears to play an important role in both inflammation and cancer metastasis (reviewed in [150]). 1.3.2 Thrombolytic/fibrinolytic therapy Heart disease and stroke are two of the leading causes of mortality in Canada [151]. Combined, the various forms of cardiovascular disease (CVD) account for 30 % of all deaths in Canada [151]. According to a report published by the Public Health Agency of Canada in 2000, CVD cost more than 22 billion dollars in physician and hospital services, lost wages, and decreased workforce productivity [152,153]. While the mortality rate from CVD has been steadily decreasing in Canada and other industrialized nations over the past 50 years, a sharp rise in the incidence of CVD in developing nations has health researchers predicting that by the year 2020, CVD will be the leading cause of death and disability globally [154]. Common treatments for acute myocardial infarction and ischemic stroke include: 1) a mechanical intervention known as angioplasty in which a balloon is surgically inserted into a blocked blood vessel and inflated to open the vessel and re-establish normal blood flow; 2) the administration of anticoagulant or antiplatelet drugs to prevent further thrombosis formation; and 3) the use of thrombolytic or fibrinolytic therapeutic agents which dissolve blood clots. A number of thrombolytic agents based on physiological activators of plasminogen (eg. streptokinase, tPA) are currently available for the pharmacological treatment of a variety of thrombosis-related conditions. Streptokinase activates plasminogen in a fibrin-independent manner, making it a very effective but non-specific fibrinolytic agent. Furthermore, the rapid activation of large pools of plasminogen results in the accumulation of fibrin degradation products, depletion of circulating plasminogen and broad plasmin-mediated proteolysis of a number of coagulation factors including FV, FVIII, FX, and prothrombin. Consequently, there is a significant risk of life-threatening systemic bleeding associated with streptokinase treatment,  28 especially in elderly patients (reviewed in [155]). Recombinant tPA (generic name: Alteplase) represents a significant improvement over treatment with streptokinase primarily due to its fibrin specificity. This restriction of the majority of plasmin generation to the surface of the clot reduces but does not completely eliminate the occurrence of serious haemorrhage. Attempts to improve both the safety and efficacy of tPA have produced a number of variant recombinant tPA preparations, including Reteplase, Tenecteplase, and Lanoteplase (reviewed in [156]). Despite showing potential in in vitro, animal, and pre-clinical studies, numerous tPA variants have failed to yield significant improvements in benefit-to-risk ratios over alteplase at the clinical level [156]. Besides the risk of serious haemorrhage associated with tPA and all other available thrombolytic agents, there are at least two additional drawbacks that make healthcare providers reluctant to prescribe these drugs on a broader scale. First, up to half of all clots are resistant to tPA treatment and the exact mechanism(s) behind this apparent therapeutic failure is currently unclear [157]. Systemic activation of plasminogen modulates coagulation cofactors [50,158162], leading to a seemingly paradoxical procoagulant effect [157]. As a result, clots may fail to lyse entirely, lysis may be delayed, or thrombotic reocclusion may occur [157]. Additionally, in the longterm, retracted clots typically associated with peripheral arterial occlusion and deep vein thrombosis, local plasminogen deficiency may limit the effectiveness of therapeutic plasminogen activators [138]. A second reason for this hesitation on the part of physicians is that the narrow administration window for tPA therapy significantly limits the number of patients eligible for treatment. Currently, the American Heart Association, the American Stroke Association, and the Canadian Stroke Strategy guidelines recommend the administration of tPA for treatment of ischemic stroke within three hours of symptom onset for most patients. Recent guideline  29 changes now permit administration of tPA up to 4.5 hours after symptom onset for a smaller subset of patients for whom this expanded window resulted in improved outcomes without compromising safety [163-166]. Despite this expansion of the administration timeframe for some individuals, many patients who may benefit from tPA therapy still fail to qualify for this treatment and only 3-5 % of all eligible ischemic stroke patients receive tPA [167]. It is estimated that upwards of 40 % of all stroke patients could potentially receive the drug, representing an additional 400,000 patients annually in the United States alone who could benefit from thrombolytic therapy [168]. Thus, the demand for thrombolytic treatment is predicted to continue to climb as safer and more effective therapeutic agents are identified and approved for use. Innovative approaches to this problem under investigation by a variety of research groups include identification of novel fibrinolytic animal-derived proteins, further modifications to recombinant tPA to improve fibrin selectively and half-life, and development of direct plasmin-based thrombolytic agents that do not rely on local supply of plasminogen (reviewed in [156] and [138]). The goal of the current work is to improve co-localization of tPA and plasminogen to the clot surface not through modification of the active enzyme, but rather through incorporation of an improved tPA cofactor at the site of a fibrin clot. 1.3.3 Novel role of factor X in fibrinolysis 1.3.3.1 Plasmin-mediated fragmentation of factor X and Xa In addition to fibrin, plasmin has relatively broad proteolytic substrate specificity. Of central relevance to the current work, plasmin cleaves FXa and the fragmentation profile is dependent on whether or not FXa is bound to a phospholipid membrane surface (Figure 10) [50]. Under anionic phospholipid-binding conditions, FXaα is converted to FXaβ through excision of a 4 kDa C-terminal peptide from the heavy chain known as the β-peptide. There are  30  FXaα Protease  β  Gla  Plasmin, aPL, Ca2+  Plasmin, no aPL  FXaβ  FXaβ β  Protease Gla  Protease  K427, K433, K435 Gla  Plasmin, aPL, Ca2+  R429  Plasmin, no aPL  Xa33/13  Xa40 33  Gla  β  13 K330  Protease  β  β  Gla  K43  Figure 10: FXa fragmentation by plasmin When bound to aPL, FXaα is proteolysed first to FXaβ by excision of the β-domain and then to Xa33/13 through cleavage at Lys330 (K330) in the autolysis loop. When binding to aPL is inhibited, plasmin-mediated cleavage of FXa yields Xa40 through cleavage in the β-peptide region at Arg429 (R429) and then at Lys43 (K43) to release the Gla domain.  31 five basic residues clustered in this region that could account for this excision as followed by SDS-PAGE and while the exact basic residue(s) targeted by plasmin is currently unknown, previous preliminary work suggests that Lys435 and to a lesser extent Lys433 are the likely candidates cleaved by plasmin to release the β-peptide [169]. A second plasmin-mediated cleavage then occurs in the autolysis loop, yielding a FXa derivative known as Xa33/13 [50]. The 33 kDa fragment contains the N-terminal portion of the heavy chain covalently linked by a single disulfide bond to the light chain. This fragment remains noncovalently associated to the 13 kDa C-terminal segment of the heavy chain by stabilization mediated by 22 inter-fragment hydrogen bonds, which are localized to the newly generated C-terminus and N-terminus of the 33 kDa and 13 kDa fragments, respectively [49,170]. While the crystal structure of a similarly autolysis loop-cleaved FXa molecule suggests that the overall structural integrity of the enzyme’s active site is maintained [49] and our own data indicates that Xa33/13 is able to incorporate a chloromethylketone into its active site, Xa33/13 does not possess significant clotting activity [50,170]. Furthermore, unpublished work from our laboratory has demonstrated the appearance of Xa33 antigen in clotting plasma, raising the possibility that it plays a role in haemostasis. In the absence of phospholipid binding, the plasmin-mediated cleavage pattern of FXa is altered (Figure 10) [50]. The β-peptide is still removed first to generate FXaβ, although again, the exact cleavage site is unknown but likely differs from that under aPL-binding conditions [50]. The second cleavage occurs not within the autolysis loop, but rather at Lys43 near the Nterminus of the light chain, thereby releasing the Gla domain [50]. This yields a 40 kDa FXa derivative (Xa40) with a functional active site (unlike Xa33/13), which is no longer tethered to a membrane surface due to the loss of its Gla domain. This molecule is similar to thrombin, the latter being a potent signalling molecule that also lacks a Gla domain, suggesting that Xa40 may  32 have cell signalling capabilities. Not surprisingly, Xa40 does not participate in clotting, likely due to its inability to bind anionic phospholipid membranes [50]. The zymogen FX can also be cleaved by plasmin to generate FX derivatives with altered function [159]. Non-membrane-bound FX is proteolysed by plasmin with a cleavage pattern similar to that of free FXa, first releasing the β-peptide likely through cleavage at Arg429 followed by loss of the Gla domain through cleavage at Lys43 to yield a 53 kDa derivative. A third cleavage then occurs at an unknown location to generate a 47 kDa species. The procoagulant potential of these FX derivatives is lost, likely due to disruption of anionic phospholipid binding. Membrane-bound FX also undergoes proteolysis similar to that of FXa with β-peptide excision followed by cleavage at Lys330 to generate a FX47/13 derivative [159]. The apparent molecular weight difference between FX47/13 and Xa33/13 is due to the presence of the activation peptide in the cleaved zymogen. A third cleavage occurs at Arg295 in the heavy chain to yield a 28 kDa FX derivative. Like its counterparts in FXa, plasmin-modulated FX can no longer participate in clotting, but may acquire novel function. 1.3.3.2 The auxiliary cofactor model of fibrinolysis: Factor X(a) derivatives as tPA cofactors In the current fibrinolytic paradigm, fibrin is the only accepted tPA accelerator in part due to its elevated local concentration at the site of vascular injury [121]. Previous studies, however, have demonstrated that plasmin-mediated cleavages of FX and FXa yield derivatives that can act as tPA cofactors [50,123,159,170-172]. Both FXaβ and Xa33/13 contain C-terminal lysine residues allowing these derivatives, but not FXaα, to act as plasminogen receptors and tPA cofactors. Previous studies have demonstrated that FXaβ contains one predicted C-terminal lysine residue while Xa33/13 contains two such residues [50,170]. The crystal structure of  33 autolysis loop-cleaved FXa suggests that the two C-terminal lysine residues present in Xa33/13 are located on opposite sides of the molecule and are oriented away from the phospholipid membrane surface [49], permitting the formation of either a 2:1 plasminogen:Xa33/13 or a 1:1:1 tPA:Xa33/13:plasminogen complex. This is consistent with binding studies that indicate a 2:1 plasminogen:Xa33/13 stoichiometry [170]. Both FXa and Xa33/13 enhance tPA-mediated plasmin generation and accelerate the dissolution of purified fibrin clots, even at concentrations as low as 10 nM, well below the circulating concentration of FX [123]. Interestingly, FXa accelerates purified fibrin lysis to a greater extent than does Xa33/13, despite the apparently greater plasminogen binding ability of the latter molecule based on ligand blotting experiments [50]. It is possible that Xa33/13 is a short-lived intermediate in the proteolytic modulation pathway of FXa and that FXaβ is a more stable fibrinolytic cofactor when additional plasminmediated fragmentation can occur [123]. While the exact mechanism remains to be determined, it is clear that coagulation factors localized to the clot surface, in particular FX(a), can act as tPA cofactors to enhance the dissolution of blood clots even in the presence of excess fibrin. The reason in the case of FXa is that fibrin is cleaved by plasmin to expose C-terminal lysine nearly 2-orders of magnitude more slowly [123]. This suggests that the current two-phase model of fibrinolysis, with fibrin as the only tPA cofactor, is incomplete and needs revision. We propose the auxiliary cofactor model of fibrinolysis in which FXa (or another localized auxiliary cofactor) present during clot formation is converted to a tPA cofactor by low levels of plasmin generated as a result of the initial weak tPA:fibrin:plasminogen interactions (Figure 11). This auxiliary cofactor enhances plasmin generation within the clot, resulting in increased proteolytic exposure of fibrin C-terminal lysine residues. The concentration of this primed fibrin eventually overwhelms the effect of the  34  Pg  Pg, tPA  Pg  tPA  K  tPA  Pg, tPA  Pg tPA  Pg  tPA K  Primed Fibrin  Intact Fibrin Pn  IIa  Pn Pg  Va  II Xa  tPA  K  Xa der.  K  Xa der Pg, tPA  Prothrombinase  Auxiliary Cofactor  Degraded Fibrin  Figure 11: Auxiliary cofactor model of fibrinolysis Initial low levels of plasmin (Pn) generate auxiliary tPA cofactors derived from FXa (FXa der) bound to the clot. These cofactors act as additional plasminogen (Pg) and tPA binding sites, increasing plasmin production and enhancing the clot priming phase of fibrinolysis. Image modified from [123].  35 plasmin-modulated FXa, and primed fibrin ultimately becomes the predominant cofactor toward its own dissolution. Based on this auxiliary cofactor model of fibrinolysis, we envision a novel approach to the design of therapeutic thrombolytic agents. As discussed above, there are a number of negative side effects associated with the administration of tPA to treat heart attack and stroke, in particular systemic bleeding and neurotoxicity (reviewed in [156]). Many of these problems are thought to be at least partially a result of the large doses of tPA that are required to effectively lyse clots due to incomplete localization of the drug to the site of a fibrin clot [156]. Additionally, a significant proportion of clots are resistant to lysis following administration of tPA [157]. While most research groups have focused their efforts on engineering a safer and more effective tPA molecule, the auxiliary cofactor model of fibrinolysis suggests that incorporation of therapeutic tPA cofactors other than fibrin into a clot may facilitate tPA and plasminogen binding and enhance thrombolysis. Thus, auxiliary cofactors may reduce (or eliminate) the negative side effects associated with tPA as we would expect co-administration of these cofactors to decrease the dosage of tPA required to effectively dissolve pathologic clots. In addition, because auxiliary cofactors provide the initial C-terminal lysine residues that facilitate plasmin generation during the preliminary stages of fibrinolysis, they may also prove effective in the dissolution of clots that are otherwise resistant to therapeutic tPA by circumventing the need for C-terminal lysine exposure on fibrin itself to yield sufficient accumulation of plasmin to degrade the clot.  1.4 Factor X deficiency Congenital factor X deficiency is an exceedingly rare autosomal recessive coagulation disorder that occurs at a rate of approximately 1:1,000,000 in the general population (reviewed in [173]). In mice, true congenital FX deficiency results in partial embryonic lethality and post-  36 neonatal fatal bleeding [174]. This highlights the biological importance of FX and suggests that complete absence of FX is incompatible with life, a hypothesis that is supported by the rarity of severe FX deficiencies in humans. Approximately 100 human FX defects have been reported in the literature and while missense mutations are the most frequent cause of congenital FX deficiency, a few nonsense, small deletion, larger gene deletion, and chromosomal abnormalities have been reported (reviewed in [175]). However, all of the severe FX deficiencies described to date retain at least some partially functional protein, providing further evidence that FX is essential for survival. FX deficiency is characterized by considerable heterogeneity at the clinical level. Homozygous and doubly heterozygous patients are often identified at an early age and tend to present with moderate or severe bleeding diatheses while heterozygous patients are either asymptomatic or report mild bleeding [176]. The most commonly reported symptoms are umbilical-stump bleeding, haemarthrosis (joint bleeding), post-operative or trauma-related haemorrhage, epistaxis (nosebleeds), menorrhagia, and easy bruising [173]. FX deficiency is usually treated with fresh frozen plasma or prothrombin complex concentrates to normalize clotting times. Traditionally, congenital FX deficiency has been categorized as either type I (cross-reacting material (CRM)-negative: decreased circulating FX antigen levels) or type II (CRM-positive: normal or near-normal antigen levels with decreased activity levels indicating inert protein). There has been some debate in recent years about the validity of this classification system as the number of identified and characterized FX defects increases and the established system is less able to accurately classify these new defects [176-178]. Of particular relevance to this report, it has been suggested that an additional category (type III) be added to the current classification system, which would include FX defects that are CRM-positive but yield abnormal or variable  37 activity levels. This category would include defects that only or predominantly affect either the extrinsic or the intrinsic pathways - defects that were previously classified as type II FX deficiency. Currently, fourteen cases of FX deficient patients with differential FX activity levels have been reported in the literature: ten defects primarily affecting the extrinsic pathway and only four cases of abnormal FX activity in the intrinsic pathway with normal or near-normal extrinsic activity have been documented (reviewed in [178]).  1.5 Overall thesis outline and rationale Factor Xa (FXa) is an essential blood clotting enzyme. We have previously identified a proteolytic derivative of FXa, Xa33/13, which is generated by two cleavages of phospholipidbound FXa by the enzyme plasmin, whose normal function is to dissolve clots. Xa33/13 can no longer participate in clotting and simultaneously confers clot-dissolving (fibrinolytic) function by acting as a tissue plasminogen activator (tPA) cofactor to accelerate plasmin generation. Currently, tPA is the only drug approved by the FDA for administration to myocardial infarction or stroke patients to dissolve thromboses. However, in a significant number of patients, tPA causes severe bleeding that can be fatal [179]. The development of a therapeutic tPA cofactor that can act only in a fibrinolytic capacity without affecting physiologic clotting would reduce the occurrence of severe bleeding and make tPA a safer and more effective drug for patients with blood clots. This project aimed to identify the molecular mechanisms of FXa conversion from a clotting enzyme to a fibrinolytic cofactor. This was achieved using recombinant FX (rFX) mutated at critical plasmin cleavages sites: a cluster of basic residues in the C-terminal β-peptide (Lys427, Arg429, Lys433, and Lys435) and Lys330 in the protease domain. These mutants provide vital tools to identify the FXa derivative(s) responsible for accelerating fibrinolysis and may ultimately allow us to design a recombinant hyperfunctional FXa to be used as a therapeutic  38 agent for the treatment of heart attack and ischemic stroke. Secondarily, the FX biochemistry and molecular biology that I have learned for the fibrinolysis project has been applied to understanding the molecular basis of disease in a patient diagnosed with FX deficiency. This person required significant transfused plasma to stabilize bleeding following minor surgery, but was otherwise relatively asymptomatic. I postulated that FX mutations might be identified at known plasmin cleavage sites, thereby enabling clot stabilization to protect the patient during normal haemostatic situations.  1.6 Hypothesis The overarching hypothesis of this work is that plasmin-mediated cleavage of FXa in the βpeptide region and at Lys330 is required for FXa to optimally acquire fibrinolytic function while cleavage at Lys330 also renders FXa more susceptible to proteolytic degradation and loss of this novel function.  39  2 MATERIALS AND METHODS 2.1 Materials The pCMV4-ss-pro-II-FX and pcDNA3.1 plasmids were generous gifts from Dr. Rodney Camire. The VKOR-pIRES plasmid was donated by Dr. Darryl Stafford. HEK 293 cells were obtained from American Type Culture Collection (Virginia, USA). The Stratagene Quikchange II XL site-directed mutagenesis kit was from Agilent Technologies (California, USA) and all primers were prepared by Integrated DNA Technologies (Iowa, USA). Ampicillin, Opti-Mem, DMEM/F-12, fetal bovine serum (FBS), L-glutamine, penicillin/streptomycin, trypsin, geneticin, and sodium chloride (NaCl) were purchased from Gibco (Invitrogen; California, USA). QIAprep spin miniprep kit and DNeasy blood and tissue kit were from Qiagen (Ontario, Canada). Lipofectamine 2000 was purchased from Invitrogen (California, USA). Glycerol, ethylenediaminetetraacetic acid (EDTA), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), puromycin, dimethyl sulphoxide (DMSO), epsilon-aminocaproic acid (εACA), benzamidine, polyethylene glycol 8000 (PEG 8000), sodium phosphate (dibasic; Na2HPO4), sodium phosphate (monobasic; NaH2PO4), bovine serum albumin (BSA), phosphatidylserine (PS), and phosphatidylcholine (PC) were all purchased from Sigma-Aldrich (Missouri, USA). Vitamin K1 was obtained from Baxter (Ontario, Canada). Cell culture flasks were purchased from both Corning (Massachusetts, USA) and Nalge Nunc International (New York, USA). Insulin-transferrin-sodium (ITS) was obtained from Roche (Indiana, USA). Polyvinylidene fluoride (PVDF) membranes, Amicon and Microcon centrifugal filtration devices, and regenerated cellulose ultrafiltration membranes were purchased from Millipore (Massachusetts, USA). The ECL-Plus detection kit, Q Sepharose fast flow, and cyanogen bromide (CNBR)activated Sepharose 4B were obtained from GE Healthcare (New Jersey, USA). Bicinchoninic  40 acid assay kit was purchased from Pierce (Illinois, USA). Innovin and aPTT reagent were obtained from Siemens Healthcare (Marburg, Germany) and Organon Teknika (North Carolina, USA), respectively. The PageBlue PVDF stain was from Fermentas (Ontario, Canada). Single chain tissue-type plasminogen activator (tPA) was obtained from Genentech (California, USA). Fibrinogen and Lys-plasminogen were obtained from Enzyme Research Laboratories (Indiana, USA). Guanidinoethylmercaptosuccinic acid (GEMSA) was purchased from CalbiochemBehring (California, USA). Pooled normal human plasma was from Affinity Biologicals Inc. (Ontario, Canada) and George King Bio-medical, Inc. (Kansas, USA). FX-immunodepleted plasma was obtained from Biopool International (California, USA). Chromogenic substrates S2765 and S-2251 were purchased from Diapharma Group Inc (Ohio, USA). Small unilamellar vesicles (SUV) and large multilamellar vesicles (LMV) consisting of 75:25 PC:PS were prepared and quantified as previously described [180].  2.2 Proteins Human plasma-derived proteins including FX, FXa, thrombin, plasmin, and antithrombin III as well as the Russell’s viper venom-derived FX activator (RVV-X) were purchased from Haematologic Technologies Inc. (Vermont, USA). Aprotinin was from Calbiochem. The monoclonal antibody specific for human FX(a) heavy chain was purchased from Green Mountain Antibodies (Vermont, USA). The 4G3 calcium-dependent antibody was a generous gift from Dr. Rodney Camire. Peroxidase-conjugated goat anti-mouse IgG used for detection of FX(a) and derivatives by western blot was purchased from Jackson ImmunoResearch Laboratories (Pennsylvania, USA) and used in combination with the chemiluminescent ECLPlus detection system.  41  2.3 Molecular biology of factor X 2.3.1 Site-directed mutagenesis All mutations described here were inserted into a previously generated F10-containing plasmid, pCMV4-ss-pro-II-FX in which the signal sequence and propeptide of FX have been substituted with those of prothrombin to increase expression of functional recombinant protein [181]. Lys330, Lys427, Arg429, Lys433, and Lys435 were individually mutated to glutamine and a triple-point Lys427Gln/Lys433Gln/Lys435Gln mutant was also generated using the Quikchange site-directed mutagenesis kit according to the manufacturer’s protocol. Basic residues were mutated to glutamine rather than the more traditional alanine to preserve the general size of the side chain while neutralizing the positive charge. Complementary primers containing the desired mutation(s) were designed using the software Oligo and generated by Integrated DNA Technologies (Table 1). Briefly, following PCR amplification of the pCMV4ss-pro-II-FX (wtFX) plasmid using the mutant primers, each PCR product was digested with the restriction enzyme Dpn I (10 U) to digest parental DNA, transformed into XL10-Gold ultracompetent cells in the presence of β-mercaptoethanol and plated onto ampicillin (10 µg/mL)-containing Luria-Bertani (LB) agar plates. Six colonies per mutant were then selected and grown in LB media supplemented with ampicillin (10 µg/mL). DNA was extracted using a mini-prep kit (Qiagen), quantified and fully sequenced to confirm both successful mutation and the fidelity of the entire F10 gene. Aliquots of cells in LB-ampicillin media were also stored in 15 % glycerol at -80 °C for future use. For the five single-point mutations, all initial DNA work was conducted by Dr. Mitra Panahi, a former postdoctoral fellow in our laboratory.  42  Mutant 330Gln Lys427Gln Arg429Gln Lys433Gln Lys435Gln  Forward Primer (5’-3’)  Reverse Primer (5’-3’)  CGCACCCACGAGCAAGGCC GGCAGTCC CGACAGGTCCATGCAAACC AGGGGC GGATCGACAGGTCCATGAA AACCCAGGGCTTGCCC GGCTTGCCCCAGGCCAAGA GCCATGCC GGCTTGCCCAAGGCCCAGA GCCATGCC AGGTCCATGCAAACCAGGG GATTGCCCCAGGCCCAGAG CCATGCC  GGACTGCCGGCCTTGCTCGTG GGTGCG GCCCCTGGTTTGCATGGACCT GTCG CGGCAAGCCCTGGGTTTTCAT GGACCTGTCGATCC GGCATGGCTCTTGGCCTGGG GCAAGCC GGCATGGCTCTGGGCCTTGG GCAAGCC GGCATGGCTGGCCTGGGGCA ATCCCCTGGTTGCATGGACCT  Lys427Gln/ Lys433Gln/ Lys435Gln Arg386Ala CCCGCACGTCACCGCCTTC AAGGAC Arg386Cys CCCGCACGTCACCTGCTTC AAGGACA  GGTGTCCTTGAAGGCGGTGA CGTGC GGTGTCCTTGAAGCAGGTGA CGTGC  Table 1: Primers used for mutagenesis of F10 gene Forward and reverse primers were designed using Oligo software and generated by IDT. Mutations are highlighted in the forward primer sequence (red). Note that a silent mutation (Gly: GGC GGA) was included in the triple point mutant to minimize primer loop formation.  43 2.3.2 Stable expression of recombinant factor X  F10-containing plasmids were co-transfected with the selectable marker plasmid pcDNA3.1 into HEK293 cells using Lipofectamine 2000 according to the manufacturer’s protocol. Briefly, both plasmids and the transfection reagent were combined in Opti-MEM medium and incubated for 20 min. at room temperature. This mixture was then used to transfect HEK293 cells (at approximately 85 % confluency) in 6-well plates. After 6-8 hours, Opti-MEM was replaced with DMEM-F/12 supplemented with 5 % fetal bovine serum (FBS), 1 % L-glutamine, and 1 % penicillin/streptomycin and cells were allowed to grow overnight at 37 °C, 5 % carbon dioxide (CO2). The following day, adherent cells were trypsinized (0.25 % trypsin, 1 mM EDTA) and a range of cell dilutions were cultured in 6-well plates containing selection media (DMEM-F/12 as described above further supplemented with 6 µg/mL vitamin K and 450 µg/mL geneticin). After 14-21 days, colonies were selected for expansion into T150 flasks (Corning CellBIND) which were allowed to reach approximately 90 % confluency prior to serum deprivation and removal of small aliquots of conditioned media to be assayed for FX production by both western blot and clotting assay. To increase production of functional recombinant FX, the vitamin K epoxide reductase (VKOR) gene-containing plasmid VKOR-pIRES was stably transfected into recombinant wtFX and Lys330Gln mutant FX-expressing HEK293 cells as described above and previously [45,182,183]. Selection media for these doubly transfected cells was supplemented with both geneticin and 1.75 µg/mL puromycin, the selection reagent for the VKOR-pIRES plasmid. At least 2-3 vials of cells from each clone were frozen in selection media containing 5 % DMSO and stored in liquid nitrogen for large-scale growth after clone selection (see below). Selected clones were thawed and expanded into triple flasks (Nunclon) and after reaching 80-90 % confluency, selection media was replaced with expression media (DMEM-F/12  44 supplemented with insulin-transferrin-selenium (ITS), 1 % L-glutamine, 1 % penicillin/ streptomycin, 1.75 µg/mL puromycin, 450 µg/mL G418, and 6 µg/mL vitamin K). Conditioned media was collected daily for 5-14 days and stored at -80 °C in the presence of the protease inhibitor benzamidine (10 mM). Small aliquots of uninhibited conditioned media were also stored at -80 °C for use in western blots and activity assays. 2.3.3 Clone selection 2.3.3.1 Factor Xa activity estimation  Small aliquots of uninhibited conditioned media from each clone were thawed at 37 °C and assayed for FXa activity using the prothrombin time (PT) clotting assay. Samples (50 µL) were diluted in HEPES-buffered saline (HBS; 20 mM HEPES, 150 mM NaCl, pH 7.4) and incubated for 1 min. at 37 °C with 50 µL of commercially available FX-immunodepleted plasma (BioPool). At 1 min., pre-warmed Innovin (100 µL) was added to the mixture to initiate clotting and clot formation was monitored electro-mechanically at 37 °C using an ST4 coagulation analyzer (Diagnostica Stago). A standard curve using plasma-derived normal FX diluted in FXdeficient plasma was generated for comparison purposes. 2.3.3.2 Factor X antigen quantification  Small aliquots of uninhibited conditioned media were thawed at 37 °C and analysed by western blot to determine how much FX antigen was expressed by each clone. Samples were diluted in Laemmli sample buffer (63 mM Tris-HCl, 10 % glycerol, 2 % SDS, 0.01 % Bromophenol blue) and heated at 95 °C for 5 minutes. They were then subjected to sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) on 10 % acrylamide gels and transferred to polyvinylidine difluoride (PVDF) membranes prior to blocking in 5 % skim milk in Tris-buffered saline with Tween (TBST; 50 mM Tris-HCl, 150 mM NaCl, 0.05 % Tween-20) at room temperature for 60 minutes. Blocked PVDF membranes were incubated with 20 ng/mL  45 mouse anti-human FX heavy chain (αXHC) monoclonal antibody in 5 % skim milk (in TBST) for 60 min. at room temperature. Membranes were then washed extensively in TBST and incubated in horseradish peroxidise (HRP)-conjugated goat anti-mouse antibody (20 ng/mL) in TBST for 60 min. at room temperature. Membranes were washed again prior to detection with ECL-Plus  chemiluminescent  substrate  using  the  ChemiGenius  imaging  equipment  (PerkinElmer). A range of purified plasma-derived normal FX samples of known amount were also run on each western blot, allowing rFX samples to be quantified using the densitometric analysis software GeneTools (PerkinElmer). 2.3.3.3 Determination of specific activity  To determine the amount of functional protein being produced by the various rFX clones, specific activity was calculated. The clotting times of the rFX clones were compared to those of the standard PT curve generated using plasma-derived normal FX with a known specific activity (units/mg) where one unit was defined as the amount of FXa activity in one millilitre of normal plasma. Calculated activity values (units/mL) based on the clotting assay were then divided by FX antigen levels (from western blot analysis) to obtain specific activity for each clone. The clones with the highest specific activity and cleanest expression profiles were selected for largescale production, purification, and further experimentation.  2.4 Purification of recombinant factor X Conditioned media from large-scale protein expression (10-20 L) was thawed at 37 °C then immediately stored at 4 °C or on ice for the duration of the purification process (except when bound to columns at room temperature). The conditioned media was centrifuged at 15,000 rpm for 30 min. to remove cell debris and then concentrated in a stirred cell concentrator under nitrogen using a regenerated cellulose ultrafiltration membrane with a 10 kDa molecular weight  46 cut-off limit (Millipore). The concentrated media was then dialyzed overnight against loading buffer (20 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, pH 7.2) and then loaded onto a QSepharose fast flow column equilibrated with loading buffer at a flow rate of 2 mL/min. The column was then washed with five column volumes of loading buffer prior to linear gradient elution with NaCl (150-750 mM). Fraction volumes ranged from 10 mL (during sample loading) to 1 mL (during elution). Collected fractions were assayed for FX activity by chromogenic assay using a tripeptidebased substrate designed for FXa recognition, S-2765. Small samples of each fraction were incubated for 20 min. at room temperature with Russell’s viper venom FX activator (RVV-X, 125 nM) and CaCl2 (2 mM) in a 96-well microplate to generate FXa. S-2765 was diluted in HBS/EDTA (20 mM) to a final concentration of 200 µM. Diluted substrate (150 µL) was added to each reaction well and FXa activity was monitored kinetically at 405 nm using a Spectramax190 microplate reader (Molecular Devices). FX-containing fractions were pooled and dialysed overnight against loading buffer (8 mM Tris-HCl, 60 mM NaCl, pH 7.4). The second purification step involved a monoclonal conformation-specific FX antibody (4G3) linked to cyanogen bromide (CNBr)-activated Sepharose 4B according to the resin manufacturer’s protocol (GE Healthcare). The use of this antibody to separate partially γglutamyl carboxylated FX from the fully modified protein has been previously described [58,181]. Because the ability of the 4G3 antibody to bind FX is calcium-dependent, the column was equilibrated immediately prior to sample application with loading buffer containing 2.5 mM CaCl2. The dialysate was also spiked with CaCl2 (2.5 mM) and loaded as before. After binding, the column was washed with loading buffer and then eluted with a linear gradient of EDTA (0-8 mM). Fraction volumes were collected as described above. Fractions were assayed for FXa activity as before except higher concentrations of CaCl2 (up to 25 mM) were required for  47 EDTA-containing fractions. Some initial fractions collected during sample loading on the 4G3Sepharose column (“flow-through”) were also found to contain FX. These fractions were pooled and, after the column was re-equilibrated with loading buffer and calcium, were loaded onto the column and eluted with EDTA again. This process was repeated until the flow-through contained insignificant amounts of FX as determined by chromogenic assay. All FX-containing fractions were then pooled and dialysed overnight against the third loading buffer (1 mM Na2HPO4/NaH2PO4, pH 6.8). The final pooled and dialysed protein sample from the 4G3-Sepharose column was loaded onto the third and final column, hydroxyapatite pre-equilibrated with loading buffer. FX was eluted from the column using a linear gradient of Na2HPO4/NaH2PO4 (1-400 mM) with 0.5 mL fractions. FX-containing fractions (as assessed by chromogenic assay, described above) were pooled and concentrated at 13,000 rpm in Microcon centrifugal filter devices with a 10 kDa molecular weight cut off. Buffer exchange to HBS was also carried out in these microtubes. Purified recombinant FX was stored in 50 % glycerol at -20 °C. Protein concentrations were determined by BCA assay against BSA standards and protein concentrations were confirmed by SDS-PAGE (10 % acrylamide gels) and Coomassie staining with plasma-derived commercially available human FX as a standard.  2.5 Assessment of procoagulant function 2.5.1 Activation by RVV-X  Plasma-derived and purified recombinant FX (10 µM) were activated at room temperature with RVV-X (125 nM) and CaCl2 (2 mM) for up to 20 minutes. At the indicated time points, samples were removed from the main reaction and quenched with Laemmli sample buffer. Samples were then heated at 95 °C for 5 min., resolved using SDS-PAGE (10 % acrylamide) and visualized by Coomassie blue staining. Unpurified recombinant FX was activated as  48 described (though at significantly lower FX concentrations dependent on FX concentration in conditioned media samples) and then diluted to appropriate concentrations for FX western blot analysis. 2.5.2 Factor Xa clotting activity  To confirm that recombinant FX displays normal procoagulant function, plasma-derived and recombinant FX were assayed for FXa activity by clotting assay. Samples (50 µL) were diluted in HBS and incubated for 1 min. at 37 °C with commercially available FX-immunodepleted plasma. At 1 min., pre-warmed Innovin (100 µL) was added to the mixture to initiate clotting and clot formation was monitored electro-mechanically at 37 °C using an ST4 analyzer (Diagnostica Stago). An estimation of FXa activity was obtained by comparing the clotting times to a standard curve generated using plasma-derived normal FX.  2.6 Assessment of fibrinolytic function 2.6.1 Plasmin-mediated fragmentation of FXa  To follow proteolysis of FXa by plasmin, plasma-derived or purified recombinant FX (5 µM) was first activated with RVV-X (125 nM) and CaCl2 (5 mM) for 20 min. at room temperature to produce FXa. Following activation, RVV-X was removed by addition of LMV (1.5 mM) and centrifugation at 13,000 rpm at 4 °C. The supernatant containing RVV-X was removed and the FXa-containing phospholipid pellet was resuspended in HBS/CaCl2 (5 mM). Xa33/13 and Xaβ were generated from phospholipid-bound plasma-derived and recombinant FXa (Lys330Gln mutant), respectively, by incubation with plasmin (0.1 µM) for up to 60 min. at room temperature. Samples were removed from the main reaction during the timecourse and quenched with sample buffer. Samples were heated at 95 °C for 5 min. and subjected to SDSPAGE (10 % acrylamide) and Coomassie staining for protein visualization.  49 To determine which FX(a) derivatives could bind plasminogen, ligand blots similar to the western blots described above were conducted, using HRP-conjugated plasminogen as the probe. Timecourse samples were subjected to SDS-PAGE, transferred to PVDF membrane, blocked with bovine serum albumin (10 mg/mL) in Tris-buffered saline (TBS; 50 mM Tris-HCl, 150 mM NaCl), then probed with plasminogen-HRP (23 nM) overnight at room temperature. Membranes were washed extensively in TBS prior to detection with ECL-Plus chemiluminescent substrate using the ChemiGenius imaging equipment (PerkinElmer). Unpurified recombinant FX β-peptide mutants were similarly activated with RVV-X and digested with plasmin (though at significantly lower FX concentrations dependent on FX concentration in conditioned media samples). Timecourse samples were then diluted to appropriate concentrations for both FX western and plasminogen ligand blot analysis as previously described. For large-scale preparation of FXa derivatives, plasma-derived or purified recombinant FX (10 µM) was activated with RVV-X (125 nM) in the presence of calcium (5 mM) and the resulting FXa was purified as described above. Xa33/13 and FXaβ were generated from phospholipid-bound plasma-derived and recombinant FXa (Lys330Gln mutant), respectively, by incubation with plasmin (0.2 µM) for 10 min. at room temperature. Two additional amounts of plasmin (0.1 µM, 5 min.) were added to ensure maximal conversion to FXa derivatives. Plasmin was then inhibited with aprotinin (1.5 µM) and loss of C-terminal lysines was prevented by simultaneous incubation with εACA (8 mM) for 5 min. The mixture was then centrifuged for 5 min. at 13,000 rpm (4 °C) and the resulting pellet was washed twice with CaCl2 (2 mM) in HBS/GEMSA (50 nM). FXa derivatives were released from phospholipid membranes by repeated room temperature incubations (15 min.) with HBS/EDTA (10 mM), centrifugation and separation of the FXa derivative-containing supernatant. Supernatants were then re-calcified (20  50 mM CaCl2), assayed for protein concentration by BCA assay (as described above) and stored at -80 °C. 2.6.2 tPA-mediated plasmin generation  The ability of plasma-derived and purified recombinant FX, FXa, and FXa derivatives to enhance tPA-mediated plasminogen activation was measured by chromogenic assay as previously described [123]. Briefly, plasminogen (0.5 µM), SUV (50 µM), CaCl2 (5 mM), GEMSA (50 nM), and the indicated cofactors (100 nM) were combined in a 96-well flat bottom microplate at room temperature. The reaction was initiated by addition of tPA (10 nM) and plasmin generation was monitored over 45 min. Samples (10 µL) were removed periodically throughout the timecourse, combined with chromogenic substrate S-2251 (0.16 mM, 190 µL) diluted with HBS containing 0.01 % PEG-8000 (HBSP) and EDTA (20 mM), and plasmin activity was measured kinetically (every 10 second for 2 minutes) at 405 nm using a Spectramax190 microplate reader (Molecular Devices). In some experiments, concurrent samples were prepared and diluted with sample buffer for FX western blot analysis. 2.6.3 Purified fibrin clot lysis  The ability of plasma-derived and recombinant human FX, FXa, and FXa derivatives to act as tPA cofactors and accelerate fibrinolysis using purified proteins was assessed by combining fibrinogen (3 µM), plasminogen (0.6 µM), SUV (50 µM), CaCl2 (5 mM), tPA (1 pM), and various cofactors (0.1 µM) in HBSP as previously described [123]. Clot formation was initiated by addition of thrombin (3 nM). Assays were carried out at room temperature in triplicate in 96well microplates, which were sealed with an adhesive plastic lid to prevent evaporation. Clot turbidity was monitored at 405 nm using a kinetic plate reader (Spectramax190, Molecular Devices). Graphpad Prism 4 software was used to determine the time at which, based on maximal (clot plateau) and minimal (full lysis) sample turbidity readings, 50 % of the generated  51 clot had dissolved (“half-lysis time”). Identical samples were prepared for western blot analysis of FX by adding sample buffer to individually prepared clots to quench the reaction at various times. Samples were then heated for 5 minutes at 95 °C and subsequently diluted to an appropriate cofactor concentration for western blot analysis (as previously described). 2.6.4 Plasma clot lysis  The ability of plasma-derived and recombinant human FX, FXa, and FXa derivatives to enhance fibrinolysis in plasma was assayed by combining normal pooled plasma diluted to 30 % in HBS, CaCl2 (20 mM), tPA (50 pM), and various cofactors (1 µM). Clot formation was initiated by addition of thrombin (3 nM). Assays were conducted as described above except that the reaction temperature was 37 °C. In some experiments, concurrent samples were also subjected to SDS-PAGE and western blot analysis.  2.7 Factor X-deficient patient study 2.7.1 Blood sample preparation  Prior to blood sample collection, a UBC Research Ethics Board approved informed donor consent form was signed by all participants. Whole blood was collected from the patient in 2.7 mL sodium citrate tubes and subjected to centrifugation at 140 g for 15 min. at 22 °C. The resulting platelet-poor plasma was removed, centrifuged again and then stored at -80 °C for future use. This work was carried out by Kimberley Talbot (Centre for Blood Research, UBC). 2.7.2 Isolation of DNA  DNA was isolated from collected patient whole blood using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol and stored at -80 °C. This work was carried out by Kimberley Talbot (Centre for Blood Research, UBC).  52 2.7.3 Factor X antigen quantification  Patient plasma was subjected to western blot analysis to confirm the clinical diagnosis of FX deficiency resulting from reduced antigen levels. Sample buffer was added to both normal pooled plasma diluted to 15 % in HBS and patient plasma and samples were heated at 95 °C from 5 min. prior to SDS-PAGE on 10 % acrylamide gels. Samples were then transferred to polyvinylidine difluoride (PVDF) membranes and blocked for 60 min. in 5 % skim milk in TBST at room temperature. PVDF membranes were then incubated with 20 ng/mL αXHC antibody in 5 % skim milk (in TBST) for 60 min. at room temperature. Membranes were then washed in TBST and incubated in HRP-conjugated goat anti-mouse antibody for 60 min. at room temperature. Membranes were washed again prior to detection with ECL-Plus chemiluminescent substrate and ChemiGenius imaging equipment (PerkinElmer). 2.7.4 Assessment of extrinsic function 2.7.4.1 Factor X activation  To determine if patient FX activated normally through the extrinsic pathway, 1 µL of patient plasma or normal pooled plasma diluted to 15 % (found to be consistent with amount of patient antigen) in FX-immunodepleted plasma was incubated with Innovin (0.8 µL) at 37 °C for up to 30 minutes. Sample buffer was added to individual reaction mixtures that were then heated at 95 °C for 5 min. and subjected to western blot analysis to follow the fate of FX(a) antigen during activation. 2.7.4.2 Prothrombin time clotting assay  To determine the activity level of patient FX in the extrinsic coagulation pathway, 50 µL of patient plasma or normal reference plasma diluted in FX-immunodepleted plasma was preincubated with FX-immunodepleted plasma (50 µL) for 1 min. at 37 °C. Pre-warmed Innovin  53 (100 µL) was then added to initiate clotting and clot formation was monitored electromechanically using an ST4 analyzer (Diagnostica Stago). Assays were conducted in duplicate. 2.7.5 Assessment of intrinsic function 2.7.5.1 Factor X activation  To determine if patient FX activated normally through the intrinsic pathway, 1 µL of patient plasma or normal pooled plasma diluted to 15 % in FX-immunodepleted plasma was incubated with aPTT reagent (0.8 µL) and 25 mM CaCl2 (0.8 µL) at 37 °C for up to 30 minutes. Sample buffer was added to individual timecourse samples, which were then heated at 95 °C for 5 minutes and subjected to western blot analysis as previously described except that the membrane blocking, washing and antibody incubation steps were carried out using the SNAP i.d. protein detection system (Millipore) according to the manufacturer’s protocol. 2.7.5.2 Activated partial thromboplastin time clotting assay  The ability of patient plasma to clot normally through the intrinsic pathway was monitored by pre-incubating patient plasma or normal reference plasma with commercially available FXimmunodepleted plasma (50 µL total plasma volume) and aPTT reagent (50 µL) for 3 minutes at 37 °C. At 3 minutes, pre-warmed CaCl2 (25 mM; 50 µL) was added to initiate clotting and clot formation was monitored electro-mechanically using an ST4 analyzer (Diagnostica Stago). Assays were conducted in duplicate according to clinical laboratory practice. 2.7.6 DNA sequencing  Primers for the eight exons and flanking intronic sequences of the F10 gene were designed using the Oligo software and generated by IDT (Table 2). PCR amplification products were purified and subjected to automatic DNA sequencing. Returned sequences were compared to BLAST search results for the human F10 gene to identify mutations.  54  Table 2: Primers used for determining the DNA sequence of the F10 gene of FX-deficient patient and normal control DNA  A combination of previously described [184] and newly designed primers were used to sequence the F10 gene. New primers were designed using Oligo software such that the flanking intronic sequences would also be amplified. Due to the large size of exon VIII, internal primers were required to obtain sequence coverage of the entire exon and flanking intronic sequences.  55 2.7.7 Arg386 mutation 2.7.7.1 Site-directed mutagenesis  Generation of both Arg386Cys and Arg386Ala mutants was carried out as described above. Briefly, complementary primers were designed for both Arg386Cys and Arg386Ala mutations using Oligo software (Table 1) and Quikchange mutagenesis was carried out according to the manufacturer’s protocol (Stratagene) using the pCMV4-ss-pro-II-FX plasmid as a template. As before, each mutation was confirmed by DNA sequence analysis. 2.7.7.2 Expression of recombinant factor X  Mutant plasmids were transfected in HEK 293 cells using Lipofectamine 2000 as described above. In order to understand the effect of the Arg386Cys mutation on FX expression levels, the VKOR-pIRES plasmid was not co-transfected with the pCMV4-ss-pro-II-FX plasmids containing either the Arg386Cys or Arg386Ala mutation. Multiple clones were selected for each mutant and expanded to T150 flasks for conditioned media collection and storage at -80 °C. All subsequent experiments using Arg386Cys and Arg386Ala recombinant FX were conducted using unpurified protein in serum-free culture media without added inhibitors. 2.7.7.3 Recombinant factor X clotting activity  To confirm that mutation at Arg386 disrupts the intrinsic but not extrinsic pathway, plasmaderived normal FX and the Arg386Ala mutant were subjected to PT and aPTT clotting assays as described above. In both assays, standard curves were generated using normal reference plasma and one unit of activity was defined as the amount of FXa activity in 50 µL of undiluted normal plasma. Specific activity calculations were carried out as described above.  56  3 ROLE OF Lys330 IN CONVERSION OF FXa INTO A FIBRINOLYTIC COFACTOR 3.1 Overview and specific goals In the auxiliary cofactor model of fibrinolysis, coagulation proteins within an intact fibrin clot are proteolytically modulated by low levels of plasmin to act as plasminogen binding sites during the initial stages of fibrinolysis. These auxiliary cofactors enhance tPA-mediated plasmin generation, resulting in more extensive priming and rapid dissolution of the clot. A clearer understanding of the mechanism behind this conversion of critical coagulation proteins into fibrinolytic cofactors may lead to the development of safer and more effective thrombolytic therapies. The autolysis loop of FXa, and Lys330 in particular, has been previously identified as one of at least two sites of plasmin-mediated proteolysis during the conversion of FXa from a clotting enzyme into a fibrinolytic tPA cofactor [50,123,159,170-172]. To understand the importance of autolysis loop cleavage in the acquisition of this novel function, the role of Lys330 was investigated. It was hypothesized that plasmin-mediated cleavage of FXa at Lys330 is required for FXa to optimally acquire fibrinolytic function while cleavage at Lys330 also renders FXa more susceptible to proteolytic degradation. To address this hypothesis, the specific goals were: 1. To generate and purify recombinant FX mutated to glutamine at Lys330; 2. To determine the effect of this mutation on activation of FX; 3. To establish the effect of this mutation on procoagulant function of FX(a); 4. To determine the effect of this mutation on the conversion of FXa into a functional fibrinolytic tPA cofactor.  57  3.2 Results 3.2.1 Mutagenesis and production of recombinant factor X  To study the role of the autolysis loop residue Lys330 in conversion of FXa into a fibrinolytic cofactor, a recombinant Lys330Gln FX mutant was generated by site-directed mutagenesis. Wildtype and mutant vectors were stably expressed in HEK 293 cells, and recombinant FX was secreted into serum-free culture media and collected over the course of 410 days. FX antigen levels in culture media from each set of rFX clones were analyzed by western blot (Figures 12a, 13a). Typical expression levels were in the low nanomolar range, similar to levels reported by others [45,181,185], indicating that mutation of Lys330 did not have a significant effect on FX expression and secretion. This observation is in agreement with a previous FX autolysis loop mutagenesis study that included a Lys330Ala mutant [53]. It should be noted, however, that a number of clones in the current study displayed partial activation of FX during cell culture (Figures 12a, 13a). Given the extensive post-translational modifications required to generate fully functional FX, successful recombinant protein expression and purification can be challenging. In particular, previous studies have found that incomplete γ-glutamyl carboxylation in the Gla domain of vitamin K-dependent proteins often results in the expression of non-functional protein, likely because the various mammalian cell systems used for recombinant protein production simply do not have sufficient post-translational modification machinery to keep up with large-scale protein expression. Co-transfection with the VKOR gene, which codes for a critical enzyme in the vitamin K-dependent γ-glutamyl carboxylation cycle, has been found to yield increased ratios of fully γ-glutamyl carboxylated, functional FX [45]. In the current study, VKOR was stably co-expressed with both wildtype and Lys330Gln FX, and secreted FX antigen levels were then quantified by western blot. Addition of VKOR resulted in 1.4- and 2.9-fold  pCMV4  wtFX/V 5  wtFX/V 4  wtFX/V 3  wtFX/V 2  wtFX/V 1  wtFX 3  wtFX 2  wtFX 1  A  nFX  58  75 kDa  FX  50 kDa  FXa 250 FX Specific Activity (units/mg)  B  200 150 100 50 0 nFX  wtFX 2  wt/v 1  wt/v 2  wt/v 3  wt/v 4  wt/v 5  Figure 12: Detectable levels of functional recombinant FX were secreted by HEK 293 cells stably transfected with wtFX DNA  A) Recombinant wtFX clones in culture media were subjected to western blot analysis using a mouse antibody against human FX(a) to determine the antigenic FX content. The wtFX clone #2 was then stably transfected with the VKOR gene and unpurified culture media from five resulting clones was similarly analyzed by western blot. B) Samples were also analysed for FXa activity by Innovin-initiated clotting assay (prothrombin time assay). Samples were run in at least duplicate. Unpurified culture media was incubated with 50 µL FX-deficient plasma and clotting time was measured at 37 °C upon addition of 100 µL of Innovin. Specific activity of recombinant FX was calculated based on the known specific activity of the control (plasmaderived FX). One unit is equal to the FX activity (as assessed by clotting assay) in 1 mL of normal plasma. Error bars indicate standard deviation. (nFX: plasma-derived FX, wtFX: wildtype FX, wt/v: wtFX co-expression with VKOR, pCMV4: empty vector).  pCMV4  K330Q/V 6  K330Q/V 5  K330Q/V 4  K330Q/V 3  K330Q/V 2  K330Q/V 1  nFX  A  K330Q  59  75 kDa  FX  50 kDa  FXa 250  B FX Specific Activity (units/mg)  200 150 100 50 0 nFX K330Q 330/v 1 330/v 2 330/v 3 330/v 4 330/v 5 330/v 6  Figure 13: Detectable levels of functional recombinant FX were secreted by HEK 293 cells stably transfected with K330Q mutant FX DNA  A) Recombinant K330Q FX in culture media from a previously selected clone was subjected to western blot analysis to determine the antigenic FX content. The K330Q clone was then stably transfected with the VKOR gene and unpurified culture media from six resulting clones was similarly analyzed by western blot. B) Samples were also analysed for FXa activity by Innovininitiated clotting assay (prothrombin time assay). Unpurified culture media was incubated with 50 µL FX-deficient plasma and clotting time was measured at 37 °C upon addition of 100 µL of Innovin. Samples were run in at least duplicate. Specific activity of recombinant FX was calculated based on the known specific activity of the control (plasma-derived normal FX). One unit is equal to the FX activity (as assessed by clotting assay) in 1 mL of normal plasma. Error bars indicate standard deviation. (nFX: plasma-derived FX, K330Q/v: K330Q co-expression with VKOR, pCMV4: empty vector).  60 enhancements of average FX antigen levels for Lys330Gln and wildtype FX, respectively, although some clones showed no change or even slight reductions in FX antigen levels (Table 3). To assess the corresponding FXa activity levels and determine if addition of VKOR resulted in a higher ratio of functional protein expression, clotting assays were conducted on culture media collected from each clone. All rFX clones facilitated clot formation, however, due to the variability in FX antigen expression levels, specific activity values were calculated to identify the most functional clones. While wildtype FX displayed lower specific activity than plasma-derived normal FX, this reduction of activatable FX was at least partially corrected upon co-expression with VKOR, particularly in the wtFX/VKOR #2 clone (Figure 12b). Similarly, the Lys330Gln FX variant showed significantly reduced specific activity values compared to plasma-derived normal FX. Again, expression of functional protein was fully restored upon coexpression with VKOR in the Lys330Gln/VKOR #1 clone (Figure 13b). Based on their superior specific activity values, the wtFX/VKOR #2 and Lys330Gln FX/VKOR #1 clones were selected for large-scale expression and purification. The monoclonal calcium-dependent FX antibody used in this study has been previously shown to separate non-γglutamyl carboxylated FX from the fully modified protein [45,181]. As expected, purification resulted in two separate pooled fractions of rFX, one containing functional protein and the other containing FX with reduced activity towards a chromogenic substrate (Figure 14). Only the functional, fully modified rFX was used for further studies. SDS-PAGE and Coomassie blue staining demonstrated that the purified rFX had approximately the same molecular weight as plasma-derived normal FX although a second, slightly smaller FX species was identified in the Lys330Gln recombinant protein, which may be the result of heterogeneous glycosylation  61  wtFX wtFX +VKOR K330Q K330Q +VKOR  Average FX Antigen Expression (ng/µL) 15 11  FX Antigen Expression Range (ng/µL) 0.2-45 7-18  Average FX Specific Activity (units/mg) 37 115  FX Specific Activity Range (units/mg) N/A 84-176  7  4-13  12.9  5-21  20.5 89  N/A 55-144  Table 3: Effect of VKOR on wildtype and Lys330Gln FX antigen expression  62  B FXa Activity (mOD/min)  A  800 600 400 200 0  A  B  Figure 14: Separation of rFX based on extent of γ-glutamyl carboxylation Recombinant FX was purified using a three-step chromatographic purification technique as described. Culture media was loaded onto a Q-sepharose column and eluted with a sodium chloride gradient. Fractions containing rFX were then dialyzed and bound to a calciumdependent conformation specific monoclonal antibody against the Gla domain and eluted from this column with EDTA. Finally, the collected rFX sample was loaded onto a hydroxyapatite column and eluted with Na2HPO4/NaH2PO4, resulting in the separation of two pools of rFX. The inset shows FXa activity of the two peaks based on their ability to cleave the chromogenic substrate, S-2765. The first peak (A) has little FXa activity and thus is likely improperly modified rFX while the second peak contains functional FX indicating that it has been properly γ-glutamyl carboxylated.  63 (Figure 15). Alternatively, it may be a degradation fragment of FX, possibly FXβ, generated either autoproteolytically or through the action of an unknown protease during cell culture. 3.2.3 Assessment of procoagulant function 3.2.3.1 FXa activity  To confirm that mutation at Lys330 does not affect procoagulant activity of FX, FXa activity of the purified mutant was compared to normal plasma-derived FX using the prothrombin time clotting assay. The specific activity of the purified Lys330Gln recombinant FX/VKOR (clone #1) and plasma-derived normal FX were 153 ± 15 units/mg and 133 ± 13 units/mg, respectively, confirming that the purified mutant has normal procoagulant function in the extrinsic pathway. Similarly, purified wildtype FX/VKOR (clone #2) had a specific activity of 125 ± 9 units/mg. 3.2.3.2 Activation by RVV-X  To further confirm that recombinant FX activates normally, both purified wildtype FX (with VKOR) and Lys330Gln FX (with VKOR) as well as plasma-derived FX were activated with the Russell’s viper venom FX activator (RVV-X). Lys330Gln FX displayed normal and complete activation compared to plasma-derived FX (Figure 15). Surprisingly, wildtype FX demonstrated limited activation by RVV-X, with 40 % of FX remaining in zymogen form after 20 minutes (Figure 15). Because of this failure to activate properly, purified wtFX (with VKOR) was not used in further studies. From this point forward, all comparison of FX mutants was made to either plasma-derived FX (nFX) since specific activities by PT were statistically indistinguishable or, where indicated, unpurified wtFX (without VKOR) in culture media. In addition, rFX purified from the Lys330Gln/VKOR #1 clone, which was used for all further experiments, will be referred to simply as Lys330Gln rFX for the remainder of this report.  64  nFX  wtFX/VKOR  Lys330Gln/ VKOR 75 kDa  FX FXβ  50 kDa  FXaα FXaβ Xa40  0  20  0  20  0  20  Activation with RVV-X (minutes) Figure 15: Wildtype FX (with VKOR) is not completely activated by RVV-X while Lys330Gln FX (with VKOR) shows normal activation to FXa  10 µM plasma-derived FX (nFX), purified wildtype FX (with VKOR; wtFX/VKOR), or Lys330Gln FX (with VKOR; Lys330Gln/VKOR) was incubated with RVV-X (125 nM) in the presence of calcium (2 mM) for 20 minutes at room temperature. Samples were then subjected to SDS-PAGE and Coomassie Blue staining.  65 3.2.4 Assessment of fibrinolytic function 3.2.4.1 Plasmin-mediated fragmentation of FXa  To determine the effect of mutation at Lys330 on the generation of Xa33/13, plasmaderived FX or Lys330Gln recombinant FX was activated by RVV-X and then cleaved by plasmin in the presence of calcium and aPL. Plasma-derived FXaα was rapidly converted by plasmin to FXaβ followed by the appearance of Xa33 as a result of autolysis loop cleavage (Figure 16a). The Lys330Gln mutant showed normal β-peptide release relative to plasmaderived FXa, but no significant appearance of Xa33, indicating that the autolysis loop remained intact despite the existence of three other basic residues in the region (Arg326, Arg332, and Arg336) that could potentially have been targets for plasmin-mediated cleavage (Figure 16a). Thus, plasmin specifically targets Lys330 in the presence of aPL and calcium. Corresponding ligand blots demonstrated that both FXaβ and Xa33 generated from nFXa bound plasminogen (Figure 16b). Similarly, FXaβ derived from plasmin-mediated cleavage of Lys330Gln rFXa also bound plasminogen. While the intensities of plasminogen-bound bands in the ligand blots appear approximately equal for all three of these FXa derivatives, the Coomassie stained gels clearly demonstrate less Xa33 antigen present compared to either FXaβ species, indicating that Xa33 binds more strongly to plasminogen than does FXaβ (Figure 16). This difference in apparent plasminogen binding affinity between the various FXa derivatives is in agreement with previously reported findings [50]. In addition, FXaα also appears to bind plasminogen, although more weakly than FXaβ as evidenced by the similar FXaα and FXaβ antigen levels, but disproportionate plasminogen binding to the nFXa control (Figure 16). 3.2.4.2 tPA-mediated plasmin generation  Given that Lys330Gln FXaβ binds plasminogen, but is not converted to Xa33/13, the tPA cofactor function of plasma-derived and Lys330Gln rFX and their respective derivatives was  Plasma-derived FX  Lys330Gln rFX  A  FXa  66  75 kDa  FX FXaα FXaβ Xa33  50 kDa 25 kDa  75 kDa  B  50 kDa  FXaα FXaβ Xa33  25 kDa  0* 10* 0 1  5 10 15 20 30 60  0* 10* 0 1 5 10 15 20 30 60  Plasmin Incubation Time (min)  Figure 16: Lys330Gln mutation prevents Xa33/13 generation, but does not prevent plasminogen binding to FXaβ  Plasma-derived FX or recombinant Lys330Gln FX (5 µM) was treated with RVV-X (125 nM) for 20 minutes at room temperature to produce FXa. 50 nM plasmin then was added under conditions facilitating anionic phospholipid-binding in the presence of calcium. The reaction mixture was sampled over time (0-60 minutes) and then subjected to (A) SDS-PAGE and Coomassie staining, or (B) ligand blot analysis to identify effects of mutation on Xa33/13 production and plasminogen binding, respectively. Two samples were taken prior to addition of plasmin: one was taken prior to activation with RVV-X (0*); one was taken half way through FX activation (10*). Plasma-derived FXa was also run as a control.  67 evaluated by chromogenic assay measuring plasmin generation (Figure 17). In the absence of any cofactor, tPA-mediated plasminogen activation was slow. At ten minutes, maximal rates of plasmin generation in the presence of FXa-derived cofactors were observed prior to the start of a plateau. Lys330Gln FX increased plasmin generation by approximately four-fold while nFX yielded only a 2.5-fold enhancement. Addition of plasma-derived FXa (mix of FXaα and FXaβ), Xa33/13 generated from plasma-derived FX, or Lys330Gln FXaβ resulted in a 10.5-, 11.1-, and 12.6-fold increase in plasmin generation at ten minutes, respectively. Western blots following the fate of FX and FXa during this chromogenic assay revealed that reductions in cofactor activity corresponded to loss of antigen due to proteolysis of these auxiliary cofactors (Figure 18). Plasma-derived FX, which showed the lowest tPA cofactor activity, was rapidly degraded over the first 15 minutes of the assay. Recombinant Lys330Gln FX, however, appeared to be more stable following initial proteolysis, likely within the βpeptide. This difference in apparent stability between the two zymogens may explain why the mutant FX displayed superior tPA cofactor ability in this assay. The activated auxiliary cofactors showed similar initial acceleration of plasmin generation and all began to plateau after approximately 15 to 20 minutes. These plateaus corresponded to a loss of antigen - Xa33 in both the plasma-derived FXa and Xa33/13 samples, and FXaβ in the Lys330Gln FXaβ sample – on the western blots of all three cofactors between 15 and 30 minutes. Both plasma-derived and Lys330Gln FXa were partially cleaved to Xa40, implying that phospholipid binding was incomplete in this assay. It should be noted that this particular antibody does not detect Xa13 and so this fragment was not observed on any western blot. 3.2.4.3 Purified fibrin clot lysis assay  To further investigate the effect of the Lys330Gln mutation on the ability of FX(a) to participate in fibrinolysis, the plasma-derived or recombinant FX and FXa derivatives were  68  15  Fold enhancement  Plasmin generation (A405/min)  50 40  13 11 9 7 5 3 1 no cofactor  30  nFX  nFXa  Xa33/13  rFX (K330Q)  rFXaβ (K330Q)  20 10 0 0  10  20  30  40  50  Time (min) Figure 17: FXaβ produced from recombinant K330Q mutant FX participates in tPAmediated plasmin generation to a similar extent as plasma-derived FXa and Xa33/13  The conversion of 0.5 µM Lys-plasminogen into plasmin by 1 pM tPA in the presence of phospholipid (50 µM), calcium (5 mM) and the carboxypeptidase inhibitor GEMSA (50 nM) was monitored by measuring plasmin-mediated cleavage of the chromogenic substrate, S-2251 in the absence (black) or presence of 100 nM plasma-derived FX (red), plasma-derived FXa (orange), plasma-derived Xa33/13 (yellow), recombinant Lys330Gln mutant FX (green), or recombinant Lys330Gln FXaβ (blue). Arbitrary fit. Each point represents the average of at least duplicate samples with error bars indicating standard deviation. Inset: Plasmin generation of auxiliary cofactors was compared to tPA alone at the 10-minute timepoint to obtain the relative fold enhancement in plasmin generation for each cofactor. This timepoint was selected for comparison purposes because the activated cofactor curves began to plateau after 10 minutes.  69  nFX  rFX (K330Q) 75 kDa  FX FXβ FXγ  50 kDa 25 kDa 0  5  10 15 30 45  0  nFXa  5  10 15 30 45  Xa33/13  rFXaβ (K330Q) 75 kDa  FXaα FXaβ Xa40 Xa33 Xa28  50 kDa 25 kDa 0  5  10 15 30 45  0  5  10 15 30 45  0  5  10 15 30 45  Time (min)  Figure 18: Plasma-derived normal FX is more rapidly degraded than other cofactors during the tPA-mediated plasmin generation chromogenic assay  The fate of plasma-derived (nFX) and recombinant Lys330Gln (K330Q) FX(a) derivatives were followed by western blot analysis during conversion of Lys-plasminogen (0.5 µM) into plasmin by tPA (1 pM) in the presence of phospholipid (50 µM), calcium (5 mM) and the carboxypeptidase inhibitor GEMSA (50 nM). At the indicated timepoints, samples were removed from the main reaction mixture and the reaction was stopped with Laemmli sample buffer. Samples were heated and subjected to SDS-PAGE and western blot as described.  70 combined with other purified plasma-derived proteins to generate fibrin clots. Clot formation and subsequent dissolution were monitored and the time required for the fibrin clots to be 50 % dissolved - “half-lysis” time - was calculated for each cofactor. The addition of plasma-derived FX had no effect on fibrinolysis (Figure 19). Lys330Gln FX, however, significantly enhanced clot lysis with a 3.3-fold acceleration of the half-lysis time compared to fibrin alone. Both plasma-derived FXa and Xa33/13 also accelerated clot lysis, although to a lesser extent than Lys330Gln FX with two- and 1.6-fold accelerations of the half-lysis time, respectively. The most dramatic effect on fibrinolysis was observed upon addition of Lys330Gln FXaβ, which resulted in a half-lysis time almost nine-fold faster than those obtained in the absence of any auxiliary cofactor. In an attempt to explain these differences in fibrinolysis rates between the auxiliary cofactors, the fate of FX and FXa derivatives over the course of the lysis assay was followed by western blot (Figure 20). Plasma-derived FX persisted throughout the lysis assay without significant proteolysis, however, Lys330Gln FX contained notable quantities of a slightly smaller FX species, consistent with the mobility of FXβ on SDS-PAGE, and was further partially converted to a 53 kDa species. While some Lys330Gln FXaβ was apparent throughout fibrinolysis, the Xa33 antigen from plasma-derived Xa33/13 was lost prior to the start of the fast lysis phase, providing a possible explanation for the poorer tPA cofactor function of Xa33/13 compared to Lys330Gln rFXaβ in purified fibrin clot lysis. Plasma-derived FXa was partially proteolysed to Xa33/13 at the start of the slow lysis phase, suggesting that this derivative may promote fibrinolysis. However, the persistence of both FXaβ and Xa33 bands from plasmaderived FXa throughout the entire lysis assay was in contrast with its apparent cofactor function, which, while better than Xa33/13, was still inferior to that of the activated Lys330Gln mutant. Thus, the simple presence of cofactor antigen during the fibrinolytic stages, as monitored by  71  Clot turbidity (A405nm)  0.4  rFX (K330Q)  0.3  Xa33/13 FXa no cofactor  0.2 FX  rFXaβ (K330Q)  0.1  0  500  1000 1500 Time (min) Figure 19: FXaβ generated from recombinant Lys330Gln mutant FX accelerates purified clot lysis faster than plasma-derived FX, FXa or Xa33/13  Thrombin (3 nM), calcium (5 mM), fibrinogen (3 µM), anionic phospholipid (50 µM), Lysplasminogen (0.6 µM), tPA (1 pM) were combined in the absence (no cofactor) or presence of 100 nM plasma-derived FX, plasma-derived FXa, plasma-derived Xa33/13, recombinant Lys330Gln mutant FX (rFX), or FXaβ generated from Lys330 mutant FX (rFXaβ) at room temperature. The formation and dissolution of the clot was monitored by measuring optical density at 405 nm on a Spectramax 190 plate reader at 5-minute intervals. Solid line: inverse sigmoidal fit (by Graphpad); grey shade: standard deviation of averaged data (n = 3).  72  nFX  rFX (K330Q) 75 kDa  FX FXβ FXa  50 kDa 25 kDa  nFXa  Xa33/13  rFXaβ (K330Q) 75 kDa  FXaα FXaβ Xa40 Xa33  50 kDa  End  Half Lysis  Fast Lysis  Slow Lysis  Clot  0  End  Half Lysis  Fast Lysis  Slow Lysis  Clot  0  End  Half Lysis  Fast Lysis  Slow Lysis  Clot  0  25 kDa  Figure 20: Western blots of timecourse samples of purified fibrin clot lysis assay fail to provide a comprehensive explanation for the effects of auxiliary cofactors on fibrinolysis rates  Purified fibrin clot lysis assays were conducted as described in Figure 19. Sample buffer was added to individually prepared clots at various timepoints based on the lysis profiles of a concurrently run assay. Samples were heated for 5 minutes at 95 °C and subjected to SDSPAGE and western blot analysis using a mouse anti-human FX antibody that recognizes the heavy chain of FX(a).  73 western blot, fails to provide an obvious explanation for the variable enhancement of clot lysis by the auxiliary cofactors. Lysis samples were then subjected to ligand blots using plasminogen-HRP to determine whether small proteolytic changes not apparent by SDS-PAGE (eg. “nibbling” of the C-terminal lysine residues) could explain the loss of tPA cofactor function in the absence of gross molecular weight changes visible by western blot. Unfortunately, due to the complex mixture of proteins in the purified fibrin clot lysis assay, including numerous fibrin degradation products that bind plasminogen, ligand blots failed to provide the required resolution (data not shown). 3.2.4.4 Plasma clot lysis assay  To expand the fibrinolysis findings to a more physiologically relevant and complex system, similar clot lysis experiments were conducted in plasma. Contrary to our observations in purified clot lysis, in plasma, the zymogens were found to be the best tPA cofactors (Figure 21). In the absence of auxiliary cofactors, clots did not fully lyse within the 6,000 minute experimental duration. Addition of plasma-derived FX yielded a half-lysis time of approximately 800 minutes, while clots generated in the presence of Lys330Gln rFX had a halflysis time of just over 1200 minutes. The activated cofactors (plasma-derived FXa and Xa33/13, and Lys330Gln FXaβ), which all accelerated fibrinolysis in the purified system, had a variable effect on plasma clot lysis. Addition of Lys330Gln rFXaβ yielded a half-lysis time of approximately 1650 minutes. Clots generated in the presence of plasma-derived FXa or Xa33/13 did not fully lyse within the timeframe of the assay and displayed similar lysis profiles as that formed in the absence of auxiliary cofactors, with an estimated half-lysis time of at least 4,000 minutes. Plasma lysis samples were then subjected to western blot analysis to follow the fate of FX and FXa derivatives over the course of the assay (Figure 22). Both plasma-derived and  74  Clot turbidity (A405nm)  0.7  0.6 no cofactor  0.5  Xa33/13  0.4  FX  FXa  rFX (K330Q)  0.3  rFXaβ (K330Q)  0.2 0  1000  2000 3000 Time (min)  4000  5000  Figure 21: FX zymogens, both plasma-derived and recombinant Lys330Gln, accelerate plasma clot lysis faster than the FXa derivatives  Thrombin (3 nM), calcium (20 mM), penicillin/streptomycin (1 %), tPA (50 pM) were combined with normal plasma in the absence (no cofactor) or presence of 1 µM plasma-derived FX (nFX), plasma-derived FXa (nFXa), plasma-derived Xa33/13, recombinant Lys330Gln mutant FX (rFX), or FXaβ generated from Lys330Gln FX (rFXaβ) at room temperature. The formation and dissolution of the clot was monitored by measuring optical density at 405 nm on a Spectramax 190 plate reader at 5-minute intervals. The average of at least two replicates is indicated by a dotted line and the fitted data (by GraphPad) is represented by a solid line. The R2 values for the no cofactor, nFX, rFX, nFXa, Xa33/13, and rFXaβ lines are 0.52, 0.60, 0.78, 0.88, 0.65, and 0.98, respectively.  Lys330Gln FXaβ  Xa33/13  nFXa  nFX  Lys330Gln FX  75  FXaserpins FXa-AT  100 kDa 75 kDa  FX  FXaα  50 kDa  FXaβ Xa33  Lysis  0  Lysis  0  Lysis  0  Lysis  0  Lysis  0  25 kDa  Figure 22: The fate of FX and FXa derivatives during plasma clot lysis  The plasma clot lysis assay was set up as described in Figure 21. Sample buffer was added either prior to addition of thrombin (to initiate clotting) or at the start of fibrinolysis to individual clots generated in the presence of plasma-derived FX (nFX), Lys330Gln rFX, plasma-derived FXa (nFXa), Xa33/13, or Lys330Gln FXaβ. Samples were then subjected to SDS-PAGE and western blot analysis to follow the fate of the FX(a) derivatives over the course of lysis.  76 recombinant Lys330Gln FX were stable throughout the assay, although some high molecular weight species, possibly FXa complexed with serpins, were observed during lysis. Plasmaderived FXa contained both FXaα and FXaβ as well as minor amounts of Xa33 at the start of the assay. The intensity of these bands diminished during lysis with a corresponding appearance of higher molecular weight species, including FXa-AT and what we expect were other FXa-serpin complexes. Conversely, plasma-derived pre-generated Xa33/13 did not form a complex with AT, although some Xa33 did disappear during lysis and we did observe the appearance of the higher molecular weight species. Surprisingly, Lys330Gln FXaβ antigen was entirely lost prior to the start of lysis, and we observed only minor quantities of the higher molecule weight species. Because the plasma system was even more complex than the purified fibrin assay, ligand blots using plasminogen-HRP were not attempted on the plasma lysis timecourse samples.  3.3 Discussion To facilitate both the appropriate generation of stable fibrin blood clots and the timely dissolution of clots once vascular repair is initiated, coagulation and fibrinolysis must occur sequentially in a highly regulated manner. To prevent counterproductive overlap between the two opposing pathways, cross-talk between the pathways coordinates the haemostatic response such that coagulation is downregulated as fibrinolysis is activated. The thrombinthrombomodulin complex is one well-established link between coagulation, fibrinolysis, and anticoagulation (reviewed in [186]). Previous studies have identified plasmin-mediated modulation of FX and FXa as another link between coagulation and fibrinolysis [50,123,159,170-172]. Just as plasmin cleaves polymerized fibrin to expose tPA and plasminogen binding sites, plasmin similarly exposes C-terminal lysine residues on FXa bound to anionic phospholipid surfaces, which accelerates fibrinolysis. Despite this identification of a  77 novel link between the formation and dissolution of blood clots and the clear potential for therapeutic development of novel thrombolytic agents, the exact amino acid residues that are necessary for this functional conversion remain unknown. In an attempt to identify the mechanism behind this conversion of FXa from a clotting enzyme to a clot-dissolving tPA cofactor, Lys330 - a basic residue within the autolysis loop of FXa - was mutated to glutamine to prevent targeted proteolysis by plasmin within this region. The effects of this mutation on both procoagulant and fibrinolytic function were then investigated using a variety of assays. Mutation of Lys330 to glutamine resulted in no significant changes in procoagulant function: Lys330Gln FX was completely and normally activated to FXa by RVV-X, indicating proper orientation of the surface regions required for FX activation; and mutant FX facilitated clot formation in plasma with the same specific activity as plasma-derived FX, indicating that there were no major conformational changes in the enzyme active site and further confirming that this mutation does not disrupt the physiological incorporation of FX(a) into the Xase and prothrombinase complexes. These findings are in agreement with a previous mutagenesis study in which a Lys330Ala FX mutant was found to participate normally in the prothrombinase complex [53]. With confirmation that mutation of Lys330 to glutamine does not alter procoagulant function of FXa, I then investigated the role of Lys330 in the acquisition of novel fibrinolytic function. As expected, plasmin cleavage of plasma-derived FXa bound to aPL resulted in excision of the heavy chain C-terminal β-peptide, followed by cleavage in the autolysis loop to yield Xa33/13 (Figure 16). This FXa derivative, named for the apparent molecular weights of the two non-covalently associated fragments, has two potential plasminogen binding sites by virtue of its newly exposed C-terminal lysines on opposite sides of the protein (Figure 5) [49,50,170]. Mutation of Lys330 to glutamine prevented plasmin-mediated conversion of FXaβ  78 to Xa33/13 despite the presence of multiple basic residues within the autolysis loop that could potentially have been targeted by plasmin. This selectivity is remarkable given that plasmin is generally considered to be an enzyme with broad substrate specificity and is reported to target multiple residues in the FXa β-peptide region [50,169]. Despite this relative promiscuity, plasmin does show some preference for aromatic or at least non-polar amino acid residues at P2 of the plasmin recognition sequence within the substrate, and non-polar or at least neutral amino acid residues at P3 [158,162,187-192]. Of the four basic residues in the FXa autolysis loop, only Arg326 is preceded by this preferred recognition sequence with Gly at P2 and Phe at P3 [193]. Based solely on amino acid sequence analysis, Lys330 is predicted to be the least preferred cleavage site as it is preceded by Thr-His-Glu (P4-P2), all of which are polar and/or charged residues [193]. Given that the current study has found that Lys330 is the only basic residue in the autolysis loop of aPL-bound FXa targeted for cleavage by plasmin, amino acid sequence alone cannot explain plasmin-mediated cleavage of the autolysis loop. This suggests that a very specific conformation of FXa is required to permit plasmin cleavage in this region and that this conformation promotes cleavage specifically at Lys330 when FXa is bound to aPL. The elimination of this autolysis loop cleavage site appears to stabilize Lys330Gln FXa in its FXaβ form, as evidenced by the persistence of the plasminogen-binding FXaβ band observed during purified plasmin cleavage (Figure 16). This suggests that, despite presumably having only one plasminogen-binding site compared to the two present in Xa33/13, FXaβ derived from Lys330Gln FXa may also be a potent fibrinolytic cofactor. To confirm this hypothesis, the ability of both the mutant and plasma-derived FX and FXa derivatives to facilitate plasminogen activation was studied. In two separate purified assays, Lys330Gln rFX and rFXa derivatives performed at least as well as the plasma-derived counterparts. There was, however, a discrepancy between the effect of Lys330 mutation in the chromogenic assay and in the purified  79 fibrinolysis system. All activated cofactors - both plasma-derived and recombinant mutants displayed identical abilities to facilitate tPA-mediated activation of plasminogen in the chromogenic assay. However, in the purified fibrinolysis system, Lys330Gln rFXaβ accelerated clot lysis more than 4-fold faster than the fastest plasma-derived derivative, FXa. This suggests that there is a fundamental difference between auxiliary cofactor function of FXa derivatives in the presence of fibrin(ogen) compared to the cofactor activity with only aPL. There is one report in the literature indicating that, in addition to binding anionic phospholipid in the vicinity of a clot, FXa can also bind directly to fibrin and some fibrin derivatives [194]. The authors found that this interaction required a functional Gla domain, but were not able to determine whether the Gla domain itself bound fibrin or whether an unidentified, distally located exosite exposed following proper Gla domain formation was responsible for fibrin binding. Despite this initial report, very little is known about the direct interaction of FX or FXa with fibrin within the context of a clot, and absolutely nothing is known about the physiological role of fibrin in the conversion of FXa into a fibrinolytic cofactor. Unpublished work from our laboratory, however, suggests that fibrin may provide a protein-binding surface counterpart to aPL that promotes the plasmin-mediated conversion of FXa into Xa33/13. Purified fibrinolysis assays using plasma-derived FXa as an auxiliary cofactor were conducted in the presence or absence of aPL. Not only did the absence of aPL not affect the acceleration of clot lysis by FXa, western blots following the fate of FXa during these purified fibrinolysis assays demonstrated that plasmin cleaved FXaα to FXaβ and Xa33/13 normally in the absence of phospholipid (Talbot and Pryzdial, unpublished). While aPL is required for the conversion of FXa into a fibrinolytic tPA cofactor in purified protein digests and in the chromogenic plasmin generation assay, the fibrinolysis results strongly suggest that within the context of a clot, fibrin may be a  80  Figure 23: Auxiliary cofactor model of fibrinolysis with both aPL and fibrin as reaction surfaces promoting the plasmin-mediated conversion of FXa into a tPA cofactor  FXa can bind to either anionic phospholipids or fibrin. Clot-bound FXa is modulated by initial low levels of plasmin generated by plasminogen (Pg) and tPA binding to intact fibrin. The resulting FXa derivatives (Xa der.) contain exposed C-terminal lysines (K), which allow them to act as tPA cofactors to enhance plasmin generation and prime the clot. In addition to degrading the primed fibrin clot, plasmin also further proteolyses the auxiliary cofactors, leading to loss of fibrinolytic cofactor function over time.  81  Fibrinogen Va  II  IIa  Xa  Xa Intact Fibrin  Intact Fibrin  Prothrombinase Pg tPA  Pn [Low]  Pg K  Xa der.  Auxiliary Cofactor  tPA  Pg  K K  Xa der  tPA  Primed Fibrin  Pg tPA  K  K  Xa der  Xa der  Auxiliary Cofactor  Pn [High]  K  Xa der.  Pg tPA  Pg  tPA K  (Loss of function)  Xa der  (Loss of function)  Degraded Fibrin  82 relevant modulator in this functional conversion of FXa (Figure 23). Given that the derivatives generated by plasmin-mediated cleavage of FXa vary depending on whether or not FXa is bound to aPL, interaction with fibrin may also alter the proteolytic profile of FXa, although not necessarily at the same residues as aPL-bound FXa. At this time, we are unable draw unambiguous conclusions regarding the relative rates of plasmin-mediated cleavage of FXa derivatives on fibrin vs. anionic phospholipids within the clot. Nor can we comment quantitatively on potential differences between the binding affinities of the various FXa derivatives for the two reaction surfaces. However, while we did not observe any disruptions in Lys330Gln rFX(a) binding to aPL (not shown), we speculate that mutation at Lys330 may somehow alter the interaction of FX or FXa with fibrin such that the fibrinolytic potential of the mutant is preserved better than that of the plasma-derived FXa derivatives. For example, one such possibility is that Xa33/13 has enhanced affinity for fibrin due to conformational changes resulting from autolysis loop cleavage, and that fibrin-bound FXa derivatives are more susceptible to further proteolytic degradation and loss of function than are those bound to aPL. The single report of FXa binding to fibrin localized this interaction to the Aα82-123 peptide, which is located within the coiled-coiled region of fibrin(ogen) between the central E and outer D regions [194]. This area is particularly sensitive to plasmin digestion [195], suggesting that the interaction of FXa with fibrin may also promote the plasmin-mediated cleavage of fibrin-bound FXa. Thus, pre-generated Xa33/13 may preferentially bind fibrin and be rapidly degraded while plasma-derived FXa and mutant rFXaβ may also bind aPL and be partially protected from extensive proteolysis, preserving their auxiliary cofactor potential. Whether as a result of fibrin binding or not, the persistence of FX(a) antigen in both purified assays did at least partially correlate to fibrinolytic function. In the chromogenic assay, the approximately equal acceleration of tPA-mediated plasmin generation by plasma-derived  83 FXa and Xa33/13, and mutant FXaβ correlated well with the presence of FXa antigen in the corresponding western blot. Similarly, the superiority of Lys330Gln rFXaβ over plasma-derived Xa33/13 in the purified fibrinolysis assay was likely due to the greater stability of the mutant antigen throughout the assay compared to the rapid degradation of the plasma-derived Xa33. Together, these findings provide evidence that, in the context of a purified fibrin clot, Xa33/13 may be more susceptible to extensive proteolytic degradation, thereby reducing its fibrinolytic potential despite the presence of two plasminogen-binding sites. Conversely, while Lys330Gln FXaβ has only one plasminogen-binding site and thus might be expected to display less fibrinolytic enhancement than Xa33/13, this prevention of autolysis loop cleavage appears to stabilize clot-bound FXaβ as a functional tPA cofactor in the purified system. It should be noted, however, that reasoning that a loss of antigen may be the primary cause of reduced fibrinolytic cofactor function is not consistent with the results obtained using plasmaderived FXa in the purified fibrinolysis assay. In this case, despite the fact that both FXaβ and Xa33 antigen bands were present at the start of the fibrinolytic phase and persisted until lysis was complete, plasma-derived FXa was only half as effective at dissolving the fibrin clot as was Lys330Gln rFXaβ. It is possible that small differences in molecular weights of FXa derivatives, which would not be apparent on a western blot, drastically alter the fibrinolytic potential of the derivatives. For example, on a western blot, FXaβ with a C-terminal lysine (eg. Lys427) would be indistinguishable from FXaβ with Arg429 as its C-terminal residue. The latter derivative, however, would not be expected to possess significant fibrinolytic function while derivatives with C-terminal lysines in this region are potent tPA cofactors. Similarly, following cleavage at Lys330 in the autolysis loop, secondary cleavages that are not visible by western blot may occur at nearby basic residues in this region (eg. Arg326), altering the plasminogen-binding ability of the Xa33/13-like derivative. Thus, the persistence of antigen bands consistent with FXaβ and  84 Xa33 throughout the fibrinolysis assay does not necessarily correlate to the persistence of plasminogen-binding ability. Unfortunately, the ligand blots conducted to follow the plasminogen-binding abilities of the various FXa derivatives during the fibrinolysis assay were complicated by the presence of multiple bands that bound plasminogen, likely fibrin and fibrin degradation products, and did not provide a clear explanation for the observed differences between the activated plasma-derived and mutant cofactors. As a result, while the superior performance of Lys330Gln rFXaβ over plasma-derived Xa33/13 appears to be due to the rapid degradation of the pre-generated Xa33/13 prior to the start of fibrinolysis, we cannot yet unambiguously explain the inferior performance of the FXaβ and Xa33/13 generated in situ from plasma-derived FXa. It has been previously shown that, in addition to cleaving FXa, plasmin also converts aPLbound FX into a tPA cofactor [159]. The current study confirms that observation and extends the investigation of the role of the zymogen, and Lys330 in particular, into both purified and plasma fibrinolysis. In the chromogenic assay, plasma-derived FX was rapidly proteolysed to FXβ, FX47/13 (the zymogen equivalent of Xa33/13), and then to smaller, undetectable fragments as expected, while Lys330Gln FX was partially stabilized as FXβ and a 53 kDa derivative, which is likely the zymogen equivalent of Xa40. This partial stabilization of rFXβ, which is predicted to bind plasminogen when generated by plasmin cleavage of aPL-bound FX  in situ, may explain why the mutant zymogen displays an intermediate effect on plasminogen activation in this assay – less than the activated cofactors, but more than plasma-derived FX. A similar trend was observed in the purified fibrinolysis assay wherein Lys330Gln rFX was less effective than rFXaβ at accelerating clot lysis, but was approximately three-fold more effective than plasma-derived FX, which had no effect on the rate of clot lysis. No significant proteolysis of plasma-derived FX was observed by western blot during the purified fibrinolysis assay.  85 However, the mutant rFX contained considerable starting quantities of a FX degradation product, likely FXβ. In addition, the mutant zymogen appears to have been fully converted to FXβ, and was further partially degraded to the 53 kDa derivative over the course of the experiment. While the starting FXβ derivative does not bind plasminogen, it is likely that the FXβ generated by plasmin in situ does bind plasminogen and is responsible for the observed discrepancy between the fibrinolytic effects of plasma-derived and mutant zymogens in the purified fibrinolysis system. However, as already discussed, we were unable to unambiguously determine whether differences in plasminogen-binding patterns may explain the difference in tPA cofactor function between plasma-derived and Lys330Gln FX because ligand blots were not successful. The apparent fibrinolytic advantage that Lys330Gln rFX and rFXaβ have over plasmaderived FX and FXa derivatives becomes less clear, however, in the more complex plasma system. As expected, the activated auxiliary cofactors were less effective than the zymogens, possibly due to proteolysis and resulting loss of function prior to the start of fibrinolysis. When the effects of the activated cofactors were compared, the results were qualitatively similar to those obtained in the purified fibrinolysis system: recombinant Lys330Gln rFXaβ accelerated fibrinolysis faster than plasma-derived FXa and Xa33/13. The fibrinolytic effects of all activated cofactors, however, were diminished compared to the purified fibrinolysis system. In particular, plasma-derived FXa and Xa33/13 minimally enhanced fibrinolysis in plasma. This raises the question: what components are present in plasma, but absent in the purified system, that could explain these observed differences? In plasma, FXa binds rapidly to the serine protease inhibitor, antithrombin (AT), and unpublished work from our laboratory indicates that this interaction enhances plasmin-mediated cleavage of FXa by approximately 40-fold. In addition, FXa-AT is not cleaved to Xa40-AT in  86 the absence of aPL, but rather to Xa33/13-AT, suggesting that interaction with AT facilitates a conformational rearrangement of FXa such that the autolysis loop is more readily accessible for cleavage by plasmin regardless of aPL- (and possibly fibrin-) binding. The resulting Xa33/13AT complex, in which AT is covalently linked to the 13 kDa fragment of Xa33/13, accelerates tPA-mediated plasmin generation in a chromogenic assay to a greater extent than do FXa or Xa33/13 alone (unpublished). However, this complex is also extremely susceptible to further proteolysis in purified protein digests (unpublished). Mutation of Lys330 to glutamine likely has a dual effect on this FXa-AT interaction and subsequent acceleration of fibrinolysis. First, a Lys330Ala mutation was previously shown to enhance the interaction of FXa with AT by approximately two-fold in the absence of heparin, indicating that lysine at this position modestly impairs the inhibitory interaction [53]. Although not explicitly investigated in this study, if the negative charge on lysine is the basis for this inhibitory effect, we would expect that the Lys330Gln mutation would have a similar effect, and that the mutant rFXa would display enhanced interaction with AT. Second, due to mutation at Lys330, the autolysis loop of the mutant FXa-AT complex is not expected to be cleaved by plasmin to yield Xa33/13-AT, and thus we expected that the mutant may be at least partially protected from the extensive degradative proteolysis observed with plasma-derived FXa-AT. Surprisingly, western blots following the fate of activated auxiliary cofactors during plasma lysis revealed that Lys330Gln rFXaβ antigen was lost at some point prior to the start of fibrinolysis while the plasma-derived FXa antigen was still present during lysis and formed higher molecular weight complexes, including FXa-AT. While we did not observe the formation of a mutant rFXaβ-AT complex, we cannot rule out that such a complex was generated during clot formation, but was rapidly degraded prior to sampling during lysis. Contrary to our hypothesis, this suggests that mutation at Lys330 does not protect FXa-AT from extensive  87 proteolytic degradation, and may even promote rapid proteolysis. We do not currently have a reasonable explanation for the enhancement of plasma clot lysis by rFXaβ given its rapid disappearance prior to fibrinolysis, although a detailed investigation into the effect of Lys330Gln mutation on the interaction of FXa with AT and other serpins during coagulation and fibrinolysis may provide further insights. Contrary to our findings in the purified fibrinolysis system, both zymogens were more effective than the activated FXa derivatives in plasma clot lysis: plasma-derived FX accelerated fibrinolysis 1.5-fold faster than recombinant Lys330Gln FX, and at least five-fold faster than fibrin alone. As with the activated cofactors, this discrepancy between the effects of the zymogens in the purified fibrinolysis assay and the plasma clot lysis system raises the question: what components are present in plasma, but absent in the purified system, that could explain these observed differences? Unlike the activated auxiliary cofactors, the zymogens would not be susceptible to inhibition by antithrombin, suggesting that their superior function in plasma may be at least partially due to protection from the rapid degradation and loss of function associated with interaction with AT. This does not, however, explain why plasma-derived FX outperformed the mutant zymogen in the plasma lysis assay, while Lys330Gln FX was a better tPA cofactor in all of the purified systems, including the purified fibrinolysis assay. This suggests that there may be some as yet unidentified constituent of plasma, in addition to fibrin(ogen) and plasmin, that plays a role in the conversion of FX into a clot-dissolving cofactor. If this unidentified cofactor facilitates the acquisition of fibrinolytic function, it is possible that mutation at Lys330 impairs this interaction. Alternatively, mutation at Lys330 may promote the interaction of FX with a cofactor that inhibits the conversion of FX into a functional tPA cofactor. Thus, while it displays superior fibrinolytic function in purified assays,  88 Lys330Gln rFX zymogen loses its fibrinolytic advantage over plasma-derived FX in plasma, possibly due to altered interaction with an as yet unidentified cofactor. Finally, while we have used plasmin to proteolytically generate the FXa derivatives investigated in this study, we do not believe that plasmin is the only enzyme that can generate these derivatives in vivo. Previous work in our laboratory has demonstrated that similar derivatives can be obtained by autoproteolysis of FX(a), albeit at significantly slower rates than by plasmin [50]. These autolytically produced derivatives are not, however, identical to those generated by plasmin cleavage, and their fibrinolytic properties in the presence of fibrin and other plasma components are currently unknown [50]. Protamine sulfate – a drug used clinically to reverse heparin-induced anticoagulation – has been implicated as a cause of post-operative haemorrhage and was previously found to decrease the duration and strength of clots, and enhance fibrinolysis [196]. The authors attributed these effects primarily to inhibition of extrinsic pathway-mediated thrombin generation and the structural weakness of the resulting clots. Recently, however, it has been demonstrated that protamine sulfate enhances FXamediated conversion of FXa and FXa-AT into FXaβ, Xa33/13, and Xa28 and their AT-bound counterparts [197]. While the authors of this study did not consider or investigate the potential fibrinolytic properties of these derivatives, we speculate that they may bind plasminogen and that this generation of auxiliary tPA cofactors could be one of the reasons for observed enhancements in fibrinolysis and the increased risk of haemorrhage associated with protamine sulfate treatment. Further research is warranted to confirm this hypothesis, which could lead to improvements in safety and efficacy of protamine sulfate administration to reverse heparinmediated anticoagulation, and a better balance between coagulation, fibrinolysis, and anticoagulation in clinical settings.  89  4 PRELIMINARY STUDIES OF A ROLE FOR THE β-PEPTIDE IN CONVERSION OF FXa INTO A FIBRINOLYTIC COFACTOR 4.1 Overview and specific goals Prior to cleavage of the autolysis loop during conversion of aPL-bound FXa into a fibrinolytic tPA cofactor, plasmin first excises the short β-peptide from the C-terminus of the heavy chain. This process, however, is not well understood and it is currently not known if βpeptide excision is a necessary prerequisite for autolysis loop cleavage or rather that the cleavages are independent and the relative kinetics dictate the order of proteolysis. Similar to the autolysis loop, multiple basic residues in this region are potential targets for plasmin cleavage.  β-peptide cleavage, however, is likely more heterogeneous than autolysis loop cleavage as previous studies have identified different C-terminal exposed residues following removal of the  β-peptide [49,50,56,169]. To confirm that different plasmin cleavages in this region can produce a fibrinolytic cofactor, the roles of the five basic β-peptide residues were studied. It was hypothesized that no single residue would be obligate for generation of FXaβ and further that no individual mutation would prevent the proteolytic conversion of FXa into Xa33/13. To address these hypotheses, the specific goals were: 1. To generate recombinant FX with individual basic β-peptide residues mutated to glutamine (Lys427Gln, Arg429Gln, Lys433Gln, and Lys435Gln) and additionally create a triple-point FX mutant (Lys427Gln/Lys433Gln/Lys435Gln) in which only an arginine is available for plasmin cleavage in this region; 2. To determine the effect of these mutations on activation of FX; 3. To establish the effect of these mutations on procoagulant FXa function;  90 4. To determine the effect of these mutations on conversion of FXaα to FXaβ and Xa33/13 by plasmin 5. To establish whether exposure of a C-terminal arginine following β-peptide excision prevents subsequent Xa33/13 generation.  4.2 Results 4.2.1 Mutagenesis and production of recombinant factor X  To examine the role of basic β-peptide region residues in the conversion of FXa from a clotting enzyme to a fibrinolytic cofactor, individual single-point mutations to glutamine at Lys427, Arg429, Lys433, and Lys435 were generated by site-directed mutagenesis. Additionally, a triple-point Lys427Gln/Lys433Gln/Lys435Gln mutant was similarly created to prevent plasminogen binding in this region following β-peptide excision. As with the Lys330Gln mutant, vectors were stably expressed in HEK 293 cells, and recombinant FX was secreted into serum-free culture media. FX antigen levels in culture media were analyzed by western blot (Figure 24a). Typical expression levels were approximately 5-20 ng/µL, similar to levels reported by others [45,181,185], indicating that mutation in the β-peptide region did not have a significant effect on FX expression or secretion. However, both Lys433Gln and Lys427Gln clones had SDS-PAGE band patterns consistent with partial activation of FX during cell culture (Figure 24a). 4.2.2 Assessment of procoagulant function 4.2.2.1 Factor Xa activity  To assess whether antigen levels corresponded with FXa activity levels of the β-peptide region mutants, clotting assays were conducted on serum-free culture media. As with the prothrombin time clotting assays conducted on wildtype and Lys330Gln recombinant FX, all β-  pCMV4  3K  K427Q  R429Q  K433Q  K435Q  A  wtFX  nFX  91  75 kDa  FX  50 kDa  B  FX Specific Activity (units/mg)  FXa 250 200 150 100 50 0 nFX  wtFX  K435Q K433Q R429Q K427Q  3K  pCMV4  Figure 24: Detectable levels of functional β-peptide FX mutants were secreted by stably transfected HEK 293 cells  A) Recombinant FX mutants in culture media were subjected to SDS-PAGE and western blot analysis to determine the antigenic FX content of unpurified culture media. (nFX: 100 ng plasma-derived FX, wtFX: recombinant wildtype FX, K435Q: Lys435Gln, K433Q: Lys433Gln, R429Q: Arg429Gln, K427Q: Lys427Gln, 3K: Lys427Gln/Lys433Gln/Lys435Gln, pCMV4: vector alone negative control). B) FXa activity of recombinant FX mutants in culture media was analysed by Innovin-initiated clotting assay. FX-containing culture media or normal plasmaderived FX was incubated with FX-deficient plasma (50 µL) at 37 °C and clotting time was measured upon addition of 100 µL of Innovin. Clot formation was measured electromechanically.  92 peptide mutants facilitated clot formation, but due to the variable levels of FX antigen in conditioned media, specific activity values were calculated to determine which mutants yielded the most functional protein (Figure 24b). As before, the wildtype FX was only 33 % functional compared to plasma-derived FX, suggesting that the cells were not able to modify the majority of expressed protein properly. Furthermore, all of the β-peptide mutants displayed altered specific activity levels compared to wtFX. Lys435Gln and the triple point mutant (Lys427Gln/Lys433Gln/Lys435Gln) showed 35 % and 60 % specific activity compared to wildtype, respectively. Conversely, the specific activity of Lys433Gln was 150 % while the specific activities of Lys427Gln and Arg429Gln FX were found to be significantly increased to 315 % and 390 %, respectively, compared to wildtype FX. 4.2.2.2 Activation by RVV-X  A previous study identified a 15-amino acid sequence at the C-terminal end of the heavy chain of FX that participates in activation of FX by RVV-X [82]. Both Lys427 and Arg429 were included in this region, although the study did not identify individual residues that play a role in the FX:RVV-X interaction. To determine whether the individual β-peptide mutants generated in this study display normal FX activation by RVV-X or whether one or more of these basic residue mutations disrupts RVV-X interaction with FX, plasma-derived FX and each β-peptide mutant rFX were activated with RVV-X and timecourse samples were subjected to western blot analysis (Figure 25). While 77 % of plasma-derived FX was converted to FXa within 20 minutes under the conditions of this assay, only 26 % of wtFX was activated. 77 % of Lys433Gln FX and 71 % of Arg429Gln FX were activated by RVV-X, respectively. However, less than half of the triple-point mutant (47 %) was activated by RVV-X within 20 minutes, and only 33 % of the Lys427Gln mutant was converted to FXa within the same timeframe. The most drastic impairment of FX activation was observed with the Lys435Gln mutant, which remained  93  nFX  K435Q  K433Q  R429Q  K427Q  3K 75 kDa  FX 50 kDa  FXaα FXaβ  0  20  0  20  0  20  0  20  0  20  0  20  Activation with RVV-X (minutes) Figure 25: Lys435Gln, Lys427Gln, and the triple-point rFX mutant are poorly activated by RVV-X  10 µM plasma-derived FX (nFX), unpurified Lys435Gln (K435Q), Lys433Gln (K433Q), Arg429Gln (R429Q), Lys427Gln (K427Q), or the Lys427Gln/Lys433Gln/Lys435Gln triplepoint mutant (3K) was incubated with RVV-X (125 nM) in the presence of calcium (2 mM) for 20 minutes at room temperature. Samples were then subjected to SDS-PAGE and western blot analysis using a mouse antibody against human FX(a) as described.  94 largely unactivated (83 %) by RVV-X. These findings suggest that Lys427 and Lys435 may be involved in RVV-X-mediated activation of FX. Despite the variable levels of FX activation, all  β-peptide mutants displayed sufficient levels of FXa for further digest with plasmin to assess the importance of each residue in plasmin-mediated cleavage of FXaα to FXaβ and Xa33/13. 4.2.3 Assessment of fibrinolytic function 4.2.3.1 Plasmin-mediated fragmentation  To confirm that plasmin cleaves the β-peptide region at multiple residues in contrast to the autolysis loop, individual β-peptide mutants as well as the triple-point mutant were activated with RVV-X and then subjected to plasmin cleavage under aPL-binding conditions. As expected, while no single β-peptide mutation was sufficient to completely prevent excision of the the β-peptide, all mutants showed moderate impairment of conversion of FXaα to FXaβ (Figure 26). Despite delays in this first cleavage, all single-point mutants were ultimately cleaved a second time by plasmin to yield Xa33/13, confirming the hypothesis that no specific single mutation in the β-peptide region prevents proteolytic conversion of FXa to Xa33/13. The combined set of three β-peptide mutations (Lys427Gln/Lys433Gln/Lys435Gln), however, considerably impaired the plasmin-mediated conversion of FXaα to FXaβ, generating only very small amounts of both FXaβ (presumably through minor cleavage at Arg429) and subsequently Xa33/13. This suggests that plasmin shows a strong preference for cleavage after lysine in the βpeptide region when FXa is bound to aPL. The minute quantities of FXaβ that were produced were further proteolysed to Xa33/13, suggesting that the exposure of a C-terminal arginine in the β-peptide of aPL-bound FXa, while not favoured, does not prevent subsequent autolysis loop cleavage.  95  nFX  K435Q  K433Q  75 kDa 50 kDa  FX FXaα FXaβ Xa33  25 kDa 0 1  5 10 15 30  R429Q  0 1 5 10 15 30  0 1 5  K427Q  10 15 30  3K 75 kDa 50 kDa  FX FXaα FXaβ Xa33  25 kDa 0 1  FXa(alpha) remaining (Percent of starting antigen)  A  B  5 10 15 30  0 1 5  10 15 30  0 1  5 10 15 30  Incubation with Plasmin (min) 100 90 80 70 60 50 40 30 20 10 0 0  5  10  15  20  25  30  Time (min)  Figure 26: Under conditions facilitating anionic phospholipid-binding, β-peptide mutation impairs FXaβ production  Plasma-derived FX (nFX) or recombinant mutants in culture media were treated with 125 nM purified RVV-X for 20 minutes to produce FXa. At t=0, 0.1 µM plasmin was added under conditions facilitating phospholipid-binding in the presence of calcium. A) Western blots. The reaction mixture was sampled over time and then subjected to SDS-PAGE and western blot analysis for effects of mutation on Xa33/13 and FXaβ production. B) Western blot quantification. The amount of FXaα remaining (compared to starting antigen) on the western blots from (A) was quantified using GeneTools software. nFX: blue; Lys435Gln (K435Q): orange; Lys433Gln (433Q): cyan; Arg429Gln (R429Q): red; Lys427Gln (K427Q): green; Lys427Gln/Lys433Gln/Lys435Gln (3K): black. Arbitrary fit.  96 4.2.3.2 Plasminogen binding of factor Xa derivatives  In order to determine whether the exposure of an arginine residue following excision of the  β-peptide from aPL-bound FXa altered the subsequent plasmin-mediated cleavage of the autolysis loop, the plasminogen binding ability of the FXa derivatives generated by plasmin cleavage of the triple-point mutant was measured by ligand blot using plasminogen-HRP (Figure 27). FXaβ, Xa33, and Xa28 generated from normal plasma-derived FX were again found to bind plasminogen strongly. FXaα also bound plasminogen, although much more weakly than did the other derivatives. No significant plasminogen binding to FX(a) derivatives of the triple-point mutant was observed, although given the minute quantities of FXaβ and Xa33/13 generated, we cannot yet determine conclusively if these derivatives, if/when generated in sufficient quantities, bind plasminogen. Large-scale protein expression and purification would be required to confirm that FXaβ derived from the triple-point mutant does not bind plasminogen, and to determine whether the subsequent site of autolysis loop cleavage is altered.  4.3 Discussion Unlike the autolysis loop, where plasmin appears to target only Lys330 despite the presence of a number of other basic residues nearby, cleavage of the β-peptide is likely more heterogeneous. Early reports on the differences between FXaα and FXaβ as well as the first crystal structure of FXa indicate that Arg429 can be targeted by plasmin during β-peptide excision [49,198]. In addition, both Lys433 and Lys435 were previously identified as cleavage sites in the FXa β-peptide region by a brief abstract two decades ago attempting to characterize the structure and function of the C-terminal peptide [169]. This experimental data is largely in agreement with amino acid sequence analysis of the β-peptide region; all three of the lysine residues in the β-peptide region (Lys427, Lys433 and Lys435) are preceded by amino acid sequences that at least partially match the preferred plasmin recognition sequence [187,193]. In  97  nFX antigen  nFX Pgn binding 75 kDa  FX FXaα FXaβ Xa40 Xa33 Xa28  50 kDa 25 kDa  3K FX antigen  3K FX Pgn binding 75 kDa  FX FXaα FXaβ Xa33  50 kDa 25 kDa 0* 0 1  2  5 10 15 20 30  0* 0 1  2  5 10 15 20 30  Incubation with Plasmin (min) Figure 27: The triple-point mutant shows drastically reduced conversion of FXaα to FXaβ, although it is unclear if FXaβ and Xa33 generated from this mutant bind plasminogen  Plasma-derived FX (nFX) and recombinant triple-point (3K) mutant FX in culture media were treated with 125 nM RVV-X for 20 minutes to produce FXa. At t=0, 0.1 µM plasmin was added under conditions facilitating phospholipid-binding in the presence of calcium. The reaction mixture was sampled over time and then subjected to ligand blot analysis to monitor plasminogen binding of the various FX(a) derivatives. Samples were also diluted at least tenfold and subjected to western blot analysis to follow the fate of FX(a) following plasmin cleavage.  98 addition, a previous study investigating the plasminogen binding capabilities of plasmin-cleaved FXa derivatives indicated that either lysine or arginine residues may be targeted depending on whether or not FX(a) is bound to aPL [50]. Thus, the current study aimed to confirm that plasmin can target more than one basic residue in the β-peptide region, and that no single βpeptide mutation prevents the subsequent plasmin-mediated cleavage of the autolysis loop. Basic residues in the β-peptide region were independently mutated to glutamine to prevent plasmin cleavage at each residue. In addition, a triple-point Lys427Gln/Lys433Gln/Lys435Gln FX mutant was also generated, which was expected to only be cleaved at Arg429 and thus was not predicted to strongly bind plasminogen upon plasmin-mediated excision of the β-peptide. While none of the β-peptide mutations appeared to disrupt FX expression, the mutants displayed surprisingly variable specific activity values, indicating that the levels of functional protein expression did not correspond well to FX antigen levels. In particular, the Lys435Gln recombinant FX mutant demonstrated poor activity in the prothrombin time clotting assay, which measures extrinsic function, while the Lys427Gln and Arg429Gln mutants displayed a major increase in specific activity compared to wildtype FX, although the values were only modestly increased compared to plasma-derived FX. There are two possible explanations for this unexpected variability: (1) observed reductions in functional FX levels of some mutants were the result of deficiencies in post-translational modifications, likely γ-glutamyl carboxylation, as has been previously described [45,181], and was already found here to be a problem with both wildtype and Lys330Gln recombinant FX expression; or (2) the β-peptide mutations variably disrupt normal procoagulant function of FX, suggesting that individual basic residues in this region may play a role in activation of FX by the extrinsic Xase complex. If the first possibility is correct, co-expression with VKOR, as was successfully done with the Lys330Gln FX mutant, may increase the expression of fully modified, functional FX.  99 Alternatively, the second possible explanation is supported by a previous study that found that the 15-amino acid sequence near the C-terminus of the heavy chain, which plays a role in RVVX mediated activation of FX, also affects both extrinsic and intrinsic function [82]. Given this earlier finding that a portion of the β-peptide region may be involved in activation of FX [82], and that RVV-X was used in this study to activate FX prior to plasmin cleavage, activation profiles of each FX mutant were generated to determine whether β-peptide mutants displayed abnormal FX activation with RVV-X. The Lys435Gln recombinant FX mutant and to a lesser extent the Lys427Gln and triple-point mutants were poorly activated by RVV-X in our assay. This raises the possibility that either or both of these residues could be involved in RVV-X-mediated activation of FX. The Lys427Gln mutant demonstrated relatively normal extrinsic function compared to plasma-derived FX, suggesting that the Gla domain of this particular mutant may be properly γ-glutamyl carboxylated and providing further evidence that this residue may be specifically involved in RVV-X-mediated activation of FX. Conversely, the Lys435Gln mutant displayed reduced extrinsic pathway specific activity, suggesting either that this residue may be involved in both extrinsic and RVV-X-mediated activation of FX, or alternatively that the Gla domain of this particular clone was incompletely modified and thus the secreted rFX was poorly activatable in general. If the second possibility is true, co-expression of VKOR would likely increase the ratio of functional FX expression. As the identification of residues involved in activation of FX through the various activation complexes was not the primary focus of this study, no further investigation in this area was conducted, although these mutants could be used for such a study in the future. Despite the variability in extent of FX activation, all β-peptide mutants ultimately generated at least some FXa, which was then subjected to plasmin cleavage. As expected, no single βpeptide mutation was sufficient to prevent conversion of FXaα to FXaβ, indicating that plasmin  100 can cleave this site at any of the four basic amino acids. In addition, all individual β-peptide mutants were subsequently cleaved to yield Xa33/13, although we were not able to assess the plasminogen-binding capabilities of these FXa derivatives and we thus cannot yet determine whether a particular β-peptide mutation altered the site of autolysis loop cleavage. The activated triple-point (Lys427Gln/Lys433Gln/Lys435Gln) mutant yielded small quantities of FXaβ, indicating that while plasmin may prefer to cleave after lysine in the β-peptide region when FXa is bound to aPL, it can also cleave after Arg429 when no lysines are available. FXaβ derived from this mutant was also further proteolysed to Xa33/13, confirming that exposure of a Cterminal lysine residue is not a necessary pre-requisite for autolysis loop cleavage in general. As with the other β-peptide mutants, we have not yet been able to confirm by ligand blot whether this set of mutations alters which basic residue in the autolysis loop is subsequently targeted by plasmin during Xa33/13 generation. However, this is an ongoing area of research in our laboratory.  101  5 FACTOR X-DEFICIENT PATIENT STUDY 5.1 Overview and specific goals FX deficiency is exceedingly rare and patients often present in early childhood with multiple bleeding events. We became aware of a unique local case wherein the propositus was an elderly male who had relatively few instances of clinically relevant bleeding throughout life, suggesting mild FX deficiency. However, on one occasion, during routine minor surgery, he experienced unexplained serious bleeding that required large volumes of plasma and red cell concentrates and an extended hospital stay to stabilize his condition. Given our identification of a link between coagulation and fibrinolysis, we initially hypothesized that the patient may have a novel mutation in the F10 gene that yields a hyperfibrinolytic FX protein with normal procoagulant activity. To address this hypothesis, the specific goals were: 1. To identify the mutation(s) present in the patient’s F10 gene; 2. To determine the effect of mutation(s) on FXa activity in plasma; 3. To generate recombinant FX containing the identified mutation in order to study the effect of the mutation on FX expression and biochemical function.  5.2 Results 5.2.1 Assessment of plasma factor X antigen levels  Western blots conducted in the laboratory on patient plasma confirmed the clinical diagnosis of FX deficiency, demonstrating 15 % circulating plasma FX antigen levels in agreement with clinical measurements (Figure 28).  75 kDa 50 kDa  FX Remaining (%)  FX  B 15 % Normal  A  100 % Patient  102  100 Normal  Patient  Xa-AT FX FXa  75  0  50  1  5 10 15  0  1  5 10 15  Extrinsic FX activation (min)  25  0 0  5  10  15  Time (min)  Figure 28: Factor X antigen levels in patient plasma are reduced to 15 % compared to normal plasma, but FX activation through the extrinsic pathway is normal  A) Factor X antigen levels of patient plasma and normal pooled plasma were compared by western blot analysis. Normal plasma was diluted to 15% in commercially immunodepleted FXdeficient plasma to match patient FX antigen on the blot. B) Normal plasma diluted to 15 % in FX-deficient plasma (squares) or undiluted patient plasma (triangles) was treated with calcium and Innovin at 37 °C to initiate clot formation through the extrinsic pathway. Timecourse samples were stopped with Laemmli sample buffer and subjected to SDS-PAGE and western blot analysis. Disappearance of FX compared to the amount of starting antigen was quantified using the GeneTools software. Arbitrary fit. Inset: Western blot samples used for quantification, indicating activationof FX to FXa and formation of the FXa-antithrombin complex (Xa-AT).  103 5.2.2 Determination of factor X extrinsic pathway function 5.2.2.1 Plasma factor X activation profile  To determine whether patient plasma FX was activated normally through the extrinsic pathway, both normal and patient plasma were activated with Innovin, a commercially available extrinsic pathway activator comprised of TF, calcium, and anionic phospholipid. Patient FX showed proteolytic conversion to FXa at a rate identical to that of normal plasma FX (Figure 28). 5.2.2.2 Plasma factor X clotting activity  To evaluate the ability of patient plasma FX to be activated through the extrinsic branch of the coagulation cascade, FXa activity levels were assayed using the prothrombin time (PT) test. These laboratory measurements revealed that the levels of FX antigen (15 %) and extrinsic clotting activity (15 %) were consistent; therefore the specific activity is comparable to nFX by this assay (Figure 29). 5.2.3 Determination of factor X intrinsic pathway function 5.2.3.1 Plasma factor X activation profile  With activation of FX through the extrinsic pathway found to be completely accounted for by the patient having only 15 % antigen, we then looked to see if a defect existed in the intrinsic pathway. Both normal and patient plasma were activated with aPTT reagent, a commercially available intrinsic pathway activator comprised of rabbit brain phospholipids and micronized silica. The initial rates of FXa generation through the intrinsic pathway were similar in normal and patient plasma (Figure 30). However, while conversion of FX to FXa was complete within 15 minutes in normal plasma, full activation of patient FX was not observed within the timeframe of this assay. Instead, activation of FX in patient plasma began to plateau after 5  104  Specific Activity (units/mg)  Clotting Time (s)  100 80 60  40 35 30 25 20 15 10 5 0  Normal  Patient  40 20 0  0  5  10  Sample Plasma (%) Figure 29: Patient plasma has 15 % extrinsic clotting activity compared to normal plasma  Patient (squares) and normal (diamonds) plasma were titrated against immuno-depleted FXdeficient plasma. Sample plasma was incubated with FX-deficient plasma for 1 min. at 37 °C prior to addition of Innovin to initiate clotting. Clot formation was monitored electromechanically. Samples were run in at least duplicate (error bars indicating standard deviation are smaller than data symbols). Arbitrary fit. Inset shows calculated specific activity of FX in each plasma with error bars indicating standard deviation.  105  FX Remaining (%)  100 100 Normal  75  Patient  Xa-AT FX FXa  50  0 1 2 3 4 5 8 10 15 30  0 1 2 3 4 5 8 10 15 30  Intrinsic Intrinsic FX FXactivation activation(min) (min)  25  0 0  5  10  15  20  25  30  Time (min) Figure 30: Patient plasma factor X activation through the intrinsic pathway is impaired  FX activation in normal plasma (diluted to 15 % in FX-immunodepleted plasma; squares) and patient plasma (triangles) was followed by western blot. FX activation was initiated by addition of aPTT reagent and 25 mM CaCl2 at 37 °C. Timecourse samples were stopped with Laemmli sample buffer and subjected to SDS-PAGE and western blot analysis using a mouse antibody against human FX(a). Disappearance of FX over time compared to the amount of starting antigen was quantified using GeneTools software. Arbitrary fit. Inset: Western blot samples used for quantification, indicating activation of FX to FXa and formation of the FXaantithrombin complex (Xa-AT).  106 minutes and approximately 20 % of the FX remained unactivated at 15 minutes. Both normal and patient plasma demonstrated the appearance of activation products of the expected sizes for FXa and FXa bound to a serpin, likely antithrombin (Figure 30), indicating that, while delayed in patient plasma, the fragments leading to activation of FX were normal. 5.2.3.2 Plasma factor X clotting activity  To confirm the delayed intrinsic activation profile findings, the ability of patient FX to participate in clot formation initiated through the intrinsic pathway was measured using the activated partial thromboplastin time (aPTT) assay. Intrinsic clotting activity levels of patient FX were found to be only 5 % compared to normal plasma (Figure 31), thus confirming the existence of a defect in this pathway. 5.2.4 DNA sequence analysis  To identify the molecular genetic basis of disease in this patient, the F10 gene (8 exons and flanking intronic sequences) was amplified using PCR. Subsequent DNA sequence analysis identified two heterozygous point mutations. The first is a previously reported mutation, which disrupts the splice site between exons I and II (IVS1 +1 G>A) [199] and is not secreted into blood because of this disruption. The second allele encodes a novel point mutation at nucleotide 28145 (C>T) resulting in an arginine to cysteine (Arg386Cys) substitution in the serine protease domain of FX (Figure 32). With one allele expressing optimally, 50% circulating antigen should be predicted. 5.2.5 Arg386 mutation 5.2.5.1 Factor X antigen expression levels  To begin to address the physiological role that Arg386 may play in coagulation and consequently explain the pathological clinical effect of the Arg386Cys mutation, two  107 3 Specific Activity (units/mg)  Clotting Time (s)  130 110 90  2 1 0  Normal  Patient  70 50 30 0  2  4  6  Sample Plasma (%) Figure 31: Patient plasma has 5 % intrinsic clotting activity compared to normal plasma  Patient (squares) and normal (diamonds) plasma were titrated against immuno-depleted FXdeficient plasma. Sample plasma was incubated with FX-deficient plasma and aPTT reagent for 5 min. at 37 °C prior to addition of CaCl2 to initiate clot formation. Clot formation was monitored electromechanically. Samples were run in at least duplicate (error bars indicating standard devation are smaller than data symbols). Arbitrary fit. Inset shows calculated specific activity of FX in each plasma with error bars indicating standard deviation (p-value <0.05).  108  A  B  A G T C G/A T A A G  C A C C C/T G C T T  Figure 32: Identification of two single-point mutations of the F10 gene from FX-deficient patient DNA sample  The entire F10 gene (8 exons and surrounding intronic sequences) was amplified using PCR using a combination of previously described and newly designed primers [184], and sequenced. A) A heterozygous mutation at IVS1 +1 G>A was identified. This mutation is located in the splice site between exons I and II, and has been previously reported in the literature [199]. B) A novel heterozygous mutation at 28145 C>T was also identified. This mutation is located in exon VIII, which codes for the protease domain of FX and results in an Arg Cys substitution at amino acid residue 386.  109 recombinant FX mutants, Arg386Ala and Arg386Cys, were generated. Both FX mutants were stably transfected into HEK 293 cells. Western blot analysis of FX antigen secreted into serumfree culture media indicated that the Arg386Ala mutation does not result in significant reductions in average FX antigen levels compared to wildtype (13 ng/µL and 15 ng/µL, respectively), with three out of four clones expressing detectable levels of rFX (Figure 33, Table 4). Conversely, the Arg386Cys mutation resulted in ~3 % secretion of rFX antigen (0.5 ng/µL) compared to wildtype with only one out of three clones expressing detectable levels of rFX (Figure 33, Table 4). This poor in vitro secretion is consistant with the observed <50 % patient FX antigen, indicating expression and secretion of this mutation is inefficient. 5.2.5.2 Mutant Factor X clotting activity  As expression of a sufficient quantity of Arg386Cys was not possible for clotting experiments, Arg386Ala FX mutant was subjected to both PT and aPTT clotting assays to determine whether the differential pathway function observed in the patient plasma was also seen with the recombinant variant protein. Compared to nFX, the Arg386Ala rFX extrinsic pathway specific activity was insignificantly different (Figure 34a). However, the intrinsic pathway specific activity of the mutant was approximately 80 % lower than that of the plasmaderived FX (Figure 34b), consistent with patient FX.  5.3 Discussion Given the rarity of FX deficiency and the heterogeneous nature of its clinical presentation, it is challenging to predict which patients will experience bleeding episodes and to develop appropriate prevention and treatment options for these individuals. The current classification system is unable to accurately categorize many of the FX defects identified in recent years, which is partly due to a failure to reliably correlate clinical phenotypes with a particular  110  wtFX  R386A R386C 75 kDa  FX 50 kDa FXa  Figure 33: Stable expression of recombinant wildtype FX (wtFX), Arg386Ala (R386A), and Arg386Cys (R386C) FX mutants in HEK 293 cells  Unpurified culture media was subjected to SDS-PAGE and western blot analysis as described to determine the level of FX antigen secreted from HEK 293 cells.  111  FX Antigen Expression Range (ng/µL) 0.2-45  Number of Clones Secreting FX (positive/total)  wtFX  Average FX Antigen Expression (ng/µL) 15  4/4  FX Antigen Expression of Selected Clone (ng/µL) 5.8  R396A  13  0-40  3/4  2.2  R386C  0.5  0-1.6  1/3  (1.6)  Table 4: Comparison of FX antigen expression levels from wildtype (wtFX)-, Arg386Cys (R386C)-, and Arg386Ala (R386A)-expressing cells  112  1  0.1  Intrinsic Specific Activity (units/mg)  B  Extrinsic Specific Activity (units/mg)  A  10  1  0.1  nFX  R386A  nFX  R386A  Figure 34: Arg386Ala FX mutation results in normal extrinsic and reduced intrinsic clotting function compared to plasma-derived FX  Plasma-derived normal FX (nFX) or unpurified culture media containing recombinant Arg386Ala mutant FX (R386A) were titrated against immuno-depleted FX-deficient plasma. Clot formation was monitored electromechanically. Samples were run in at least duplicate. Specific activity values were calculated based on standard curves generated using normal plasma where one unit was defined as the FXa activity in 50 µL of undiluted normal plasma. FX antigen levels were quantified by western blot analysis as described (Figure 33). Error bars indicate standard deviation. A) Extrinsic function. Samples were incubated with FX-deficient plasma for 1 min. at 37 °C prior to addition of Innovin to initiate clotting. B) Intrinsic function. Samples were incubated with FX-deficient plasma and aPTT reagent for 5 min. at 37 °C prior to addition of CaCl2 to initiate clot formation. Statistical analysis of the intrinsic specific activity data in (B) demonstrates that R386A rFX has significantly less activity than plasma-derived FX when clotting is initiated through the intrinsic pathway (p-value < 0.0005).  113 genotype [176,177,200]. Mutations on different exons may yield similar bleeding tendencies. Conversely, with the exception of Gla domain mutations, which result in a relatively uniform clinical phenotype [201], mutations in other areas of the F10 gene do not yield predictable patterns of bleeding based on the location of mutation. Modifications to the current classification system have been proposed to include a third category (Type III), which would include defects that result in abnormal FX function in a variety of tests [177]. This category would then be subdivided based on functional assay results to better represent the heterogeneity of the condition and simplify the classification of FX defects for clinical laboratories. Our identification here of a fifth case of FX deficiency wherein there is a differential effect on the two branches of coagulation predominantly affecting the intrinsic pathway provides further support for the creation of this third category in the FX deficiency classification system. In the current study, a propositus who was previously diagnosed with FX deficiency by clinical laboratory measurements was studied further to determine the molecular basis of disease. He has experienced relatively few serious bleeding events throughout his 75 years beyond minor haematuria and epistaxis, despite multiple hernia surgeries and dental extractions, although these procedures were preceded by plasma infusion. However, with prostate surgery, the patient had unexpected bleeding, that could not be explained surgically, requiring large volumes of plasma and red cell concentrates. Post-surgery, the patient was hospitalized over 50 days before his bleeding could be controlled. Neither parent had a history of bleeding, but two of three brothers had FX deficiency and reported bleeding with surgical procedures. The propositus’ three children have been tested and none are affected. Our laboratory measurements confirmed the clinical diagnosis of FX deficiency with FX antigen levels reduced to 15 % of normal. All other coagulation factors were within normal ranges and there was no evidence of circulating inhibitors (Table 5). Sequencing of the patient’s  114  Coagulation Factor FX FXI Prothrombin FV FVII FVIII FIX  Patient Level 0.15 U 0.77 U 0.73 U 0.91 U 0.78 U 1.29 U 0.71 U  Normal Range > 0.60 U > 0.60 U > 0.65 U > 0.60 U > 0.60 U 0.5-1.50 U 0.5-1.50 U  Table 5: Clinical measurements of coagulation factors in FX-deficient patient plasma  115  F10 gene identified two heterozygous mutations: a novel mutation, Arg386Cys, in the coding region of FX; and the second case of a previously identified splice site mutation, IVS1 +1 G>A [199]. The disruption of the splice site between exons I and II resulting from this mutation has been hypothesized to lead to premature degradation of FX mRNA transcripts [199]. This loss of mRNA would explain a 50 % loss of circulating FX antigen in a heterozygous patient such as the one described here. Based on the known crystal structure of FXa [49], we speculate that mutation of Arg386 to cysteine may result in disruption of nearby disulfide bonds, in particular the solitary covalent link between the heavy and light chains of FX (Figure 35). This likely explains the 35 % further reduction in antigen levels from 50 % (due to the splice site disruption) to the 15 % antigen measured by western blot. I also found that the patient’s circulating plasma FX had normal extrinsic clotting function as the 15 % activity correlated to the observed 15 % antigen levels. Unlike extrinsic function, however, the intrinsic clotting activity of the patient FX was reduced beyond observed antigen levels to 5 %. Thus, the patient’s FX defect predominantly affects the intrinsic pathway while maintaining normal functioning in the extrinsic pathway. The orientation of Arg386 towards a surface region that is proposed to be involved in the formation of the intrinsic Xase complex (Figure 36) suggests that Arg386 may play a role in docking of the substrate to the intrinsic Xase complex, and provides further evidence to explain the differential effect on clotting of this novel FX variant. As expected, the Arg386Ala mutant FX generated recombinantly in this study did not display any apparent secretion issues as FX antigen levels were similar to those observed for wtFX. Our preliminary findings with the Arg386Cys mutant FX, however, suggest that replacement of the arginine residue with a cysteine rather than an alanine has a dramatic effect on FX expression. Only one clone produced detectable FX antigen levels, which were 30-fold  116  A  B  Figure 35: Arg386Cys mutation may impair FX folding by disrupting proper disulfide bond formation  Crystal structure of FXa (PDB accession code: 1HCG [49]). The heavy chain (blue) and a portion of the light chain (green), as well as the active site (orange) are indicated. A) All cysteine residues (white) are highlighted to demonstrate the proximity of Arg386 (red) to multiple disulfide bonds with FXa. In particular, the sole covalent link between the heavy and light chains, a disulfide bond (yellow circle) is quite close to Arg386, suggesting that mutation of this residue to cysteine may disrupt proper FX folding. B) All known Arg Cys FX mutations are shown in white. Crystal structure visualized using Rasmol 2 software (http://rasmol.org).  117  A  B  Figure 36: Arg386 may participate in binding FVIIIa and/or FIXa in the intrinsic FX activating complex  Crystal structure of FXa (PDB accession code: 1HCG [49]). The heavy chain (blue), a portion of the light chain (green), active site (orange) and Arg386 (red) are indicated as in Figure 12. A) Two different regions involved in formation of the intrinsic tenase complex are highlighted: the 250-260 loop is white; the 384-394 peptide sequence is coloured grey [55,62,63,82]. B) The FX mutations responsible for FX Roma (Arg359Thr; white; [202,203]) and FX Kurayoshi (Arg139Ser; grey; [204]), which predominantly affect intrinsic pathway function of FX, are indicated. Crystal structures visualized using Rasmol 2 software (http://rasmol.org).  118 lower than those observed in either wildtype or Arg386Ala rFX. This supports our hypothesis that the Arg386Cys mutation observed in the FX-deficient patient is partly responsible for the reduction in circulating plasma FX levels, possibly through disruption of normal disulfide bond formation, resulting in intracellular degradation of the grossly misfolded protein through the unfolded protein response pathway. The extrinsic and intrinsic clotting activities of Arg386Ala mutant FX further confirm our functional findings with FX-deficient patient plasma. The variant displayed normal extrinsic function, while intrinsic pathway function was impaired by 80 % compared to plasma-derived FX. In another study, an Arg386Ala recombinant FX mutant was found to have normal extrinsic clotting activity [80], which is in agreement with our findings. Unfortunately, intrinsic clotting function of this recombinant mutant was not reported, although we would expect to see impaired clotting through this pathway based on the functional analyses conducted on our own Arg386Ala mutant. Only four FX mutations that predominantly affect the intrinsic pathway have been previously described in the literature [203-207]. The first, FX Melbourne, was described in 1974 and displayed abnormal intrinsic function, but normal FX antigen levels, as well as normal extrinsic function and RVV-X activation [205]. The mutation(s) responsible for this phenotype were not identified. Similarly, the genetic mutation associated with FX Vellore was also not identified, but this defect resulted in drastically reduced intrinsic activity (<2 %) and a moderate reduction in extrinsic function [207]. Two other FX defects that predominantly affect the intrinsic pathway have also been published, and in both cases, molecular studies have identified the mutation responsible for this rare phenotype. FX Roma yielded laboratory results similar to those obtained for FX Vellore, and was the result of a Thr359Met substitution [203,206]. In addition to the disproportionate decrease in intrinsic function, FX Kurayoshi - an Arg139Ser  119 mutation - was also found to be poorly activated by RVV-X [204]. Given the rarity of these mutations and the lack of molecular analyses accompanying half of them, it is difficult to speculate on a possible link between them. The Arg139 mutation (FX Kurayoshi) is less than 20 Å from Arg386 with both basic residues pointing away from the rest of the molecule and in the same general direction near the heavy chain-light chain interface and the 250-260 loop, which is known to be involved in the intrinsic pathway-mediated activation of FX (Figure 36) [63,82]. The proximity of these two mutated amino acids to residues believed to be involved in formation of the intrinsic Xase complex [56,63,82] provides a biochemical and structural explanation for their differential effect on intrinsic function, and suggests that Arg139 and Arg386 may play at least minor roles in substrate recognition during FX activation by the FIXa/FVIIIa complex. There have been five other arginine to cysteine substitutions in FX reported in the literature (Figure 35) [208-212]. A heterozygous Arg306Cys mutation, FX Nagoya 1, was identified in a patient with mild FX deficiency, and was associated with <10 % antigen levels and 3 % extrinsic function [210]. Intrinsic function was not reported. The authors speculated that, given the location of the mutation near the second EGF domain, this mutation likely disrupted local alpha-helix formation, which may have lead to the observed secretion problem [210]. Similarly, an unnamed and incompletely characterized FX deficiency, resulting from an Arg347Cys mutation, displayed a severe reduction in extrinsic FX activity (<1 %) while intrinsic activity and antigen levels were not disclosed [211]. FX Wenatchee I (Arg139Cys) caused comparable reductions in extrinsic activity (57 %) and intrinsic activity (50 %) while circulating FX antigen levels were found to be normal [209]. Recently, a report describing FX Umuahia was published as a letter to the editor [212]. The patient was found to have <1 % antigen levels as well as prolonged PT and APTT times, resulting in a diagnosis of severe FX deficiency. This report did  120 not reveal the exact location of the novel mutation, but suggested indirectly that the mutation resided in exon IV of the F10 gene, which codes for the first EGF domain. According to the published FX reference sequence [193], there are no arginine residues in exon IV nor, to our knowledge, are there any polymorphisms in this region that result in an arginine. There are however six arginines and two arginines in the neighbouring exons III and V, respectively. Consequently, the molecular basis of this mutation is not clear and without further details, we cannot speculate on how, if at all, FX Umuahia is related to the defect described in our current study. Interestingly, FX San Antonio (Arg326Cys) is the only other arginine to cysteine mutation in FX to demonstrate a differential effect on the two branches of the coagulation cascade [208]. However, unlike the Arg386Cys mutation described in this study, Arg326Cys resulted in reduced antigen levels (36 %) and extrinsic function (14 %), but normal intrinsic activity [208]. The opposing effects on coagulation of these mutations highlights the difficulties associated with both categorizing FX deficiencies and predicting their physiological effects in the absence of detailed molecular and biochemical studies.  121  6 SUMMARY 6.1 Role of Lys330 in conversion of FXa into a clot-dissolving cofactor The auxiliary cofactor model of fibrinolysis proposes that coagulation proteins bound to the clot are targeted for proteolysis by small quantities of plasmin generated during the initial stages of fibrinolysis. These modulated proteins can then act as auxiliary plasminogen binding sites, enhancing tPA-mediated plasmin generation and accelerating the dissolution of the fibrin clot. In the current thesis, I have studied FX(a) as a model tPA auxiliary cofactor. Plasmin first excises the C-terminal β-peptide from the heavy chain of aPL-bound FXa and then cleaves FXa a second time, in the autolysis loop. I have demonstrated that cleavage in the autolysis loop is not required for the functional conversion of FXa from a clotting enzyme into a fibrinolytic tPA cofactor. Mutation of Lys330, the basic residue in the autolysis loop of FXa that is targeted by plasmin, prevents the generation of Xa33/13 and yields a stabilized plasminogen-binding FXaβ derivative. In a purified system, this mutant FXaβ dissolved fibrin clots 4.5-fold and 5.5-fold faster than did plasma-derived FXa and Xa33/13, respectively. This superiority of the Lys330Gln mutant is likely due to the enhanced stability of this derivative, as it appears that autolysis loop cleavage makes FXa more susceptible to further proteolytic degradation correlating to loss of function. Additionally, while aPL was used in a number of purified assays as the reaction surface for plasmin-mediated proteolysis of FXa, the physiological role of fibrin in the conversion of FX and FXa into clot-dissolving cofactors, and the effect of mutation at Lys330 on the interaction of FX(a) with fibrin, remain unclear and should be investigated in greater detail. Despite its superiority over plasma-derived FX in our purified assay, the fibrinolytic advantage of the mutant zymogen was lost in plasma, as plasma-derived FX accelerated fibrin clot dissolution 1.5-fold faster than did Lys330Gln rFX. We speculate that there may be an as  122 yet unidentified constituent of plasma, in addition to fibrin(ogen) and plasmin, that plays a role in the conversion of FX into a clot-dissolving cofactor, and that mutation at Lys330 alters the interaction of FX with this cofactor. Ultimately, this work has highlighted the importance of conducting studies in increasingly complex experimental systems: purified assays do not and cannot accurately represent what will happen in plasma, just as results obtained in plasma alone may differ from those obtained in the presence of platelets and other blood cells, under flow, and within the vasculature of animals and humans. Thus, the development of novel therapeutic agents should involve detailed analyses at all experimental levels to ensure that patients receive the safest and most effective drugs available. Furthermore, a more comprehensive understanding of the physiological proteinprotein interactions in blood will permit rational design of novel thrombolytic agents and improvements to existing therapies.  6.2 Role of β-peptide in functional conversion of FXa Unlike in the autolysis loop, where plasmin appears to cleave aPL-bound FXa only after Lys330 despite the presence of other nearby basic residues, excision of the β-peptide is the result of a more heterogeneous cleavage pattern. We have confirmed that no single residue is uniquely targeted by plasmin during FXaα conversion to FXaβ. Furthermore, no single point mutation in this region prevents subsequent autolysis loop cleavage. Simultaneous mutation of all three lysine residues in the β-peptide cleavage region, however, drastically impairs plasminmediated proteolysis in this region, indicating that when FXa is bound to aPL, plasmin has a strong preference for the lysine residues in the native positions rather than arginine. The small amount of FXaβ that is generated when only Arg429 is available appears to be further converted to Xa33/13, suggesting that exposure of a C-terminal lysine residue on the plasmin-modulated heavy chain is not a necessary pre-requisite for autolysis loop cleavage. We were not, however,  123 able to determine if the basic residue targeted by plasmin during autolysis loop cleavage in this triple-point mutant was altered. In addition, an inadvertent outcome of this work was the corroboration that individual βpeptide residues may be differentially involved in FX activation. In particular, individual mutation at Lys427 impaired recombinant FX activation by RVV-X, but did not affect extrinsic clotting activity compared to plasma-derived FX. Conversely, the Lys433Gln mutant FX was normally activated by RVV-X, but displayed a modest decrease in extrinsic clotting function compared to plasma-derived FX. Mutation of Lys435 to glutamine, however, resulted in a major reduction in FX activation by RVV-X and FXa activity initiated through the extrinsic pathway. These data suggest that some mutants may variably disrupt FX activation, suggesting that individual basic residues in this region play a role in differential activation of FX by RVV-X and the extrinsic Xase complex.  6.3 Factor X-deficient patient Factor X deficiency is a rare coagulation disorder characterized by a decrease in circulating FX antigen and/or activity levels, which can result in a variable bleeding diathesis. In this study, a propositus now aged 75 with a mild bleeding disorder was described. With prostate surgery, he had unexpected bleeding, that could not be explained surgically, requiring large volumes of plasma and red cell concentrates and extended hospitalization. Other surgical challenges, including dental extractions, were not complicated by bleeding but were preceded by plasma infusion. Quantification of plasma FX antigen revealed 15 % of normal, which correlated precisely with 15 % extrinsic pathway activity. Intrinsic pathway clotting activity, however, was further reduced to 5 % of normal. When initiated through the extrinsic pathway, the patient’s FX kinetic fragmentation profile in plasma was identical to normal. However, when clotting was triggered through the intrinsic pathway, activation to FXa and appearance of other fragments  124 were notably impaired. This further confirms that the patient’s FX defect predominantly affects the intrinsic pathway while maintaining normal function in the extrinsic pathway. DNA sequence analysis identified two heterozygous mutations, which were presumably on different alleles based on a lack of parental bleeding. The first was a previously reported mutation that disrupts the splice site between exons I and II (IVS1 +1 G>A) and was hypothesized to lead to premature degradation of FX mRNA transcripts [199]. This explains a 50 % loss of antigen in our heterozygous patient. The second was a novel mutation at nucleotide 28145 (C>T) which resulted in an Arg386 to cysteine (Arg386Cys) substitution in the serine protease domain of FX. According to the published crystal structure of FXa [49], Arg386 is located in the heavy chain of FXa near the heavy chain-light chain interface, and particularly close to the single disulfide bond linking the two chains together. We speculate that consequent alternate disulfide bond formation and protein folding may explain the further reduction in antigen levels from the expected 50 % to the observed 15 %. In addition, the side chain of Arg386 is oriented towards a surface region of the protein thought to be involved in substrate recognition by the intrinsic Xase complex [63,82], providing a possible explanation for the differential effect on the two branches of the coagulation cascade. Finally, recombinant Arg386Ala and Arg386Cys FX mutants were generated to investigate the role of this residue in FX expression and function as it relates to the patient’s clinical phenotype. As expected, the Arg386Cys mutant was very poorly expressed in vitro, providing further evidence that this mutation may disrupt normal disulfide bond formation and protein folding, resulting in reduced FX secretion from cells. The Arg386Ala mutant was normally secreted and used for functional studies. It displayed a significant reduction in intrinsic pathway activity with corresponding normal extrinsic pathway function consistent with the patient’s plasma FX. Taken together, our patient and recombinant studies identify a novel FX mutation in  125 the protease domain that predominantly affect the intrinsic pathway, and provide evidence that Arg386 may play a physiological role in substrate recognition in the intrinsic Xase complex.  126  7 FUTURE STUDIES 7.1 Fibrin, antithrombin, and the stabilization of Xa33/13 It has been shown here that, despite having only one predicted exposed C-terminal lysine residue, Lys330Gln rFXaβ is a more potent enhancer of purified fibrinolysis than is plasmaderived FXa or Xa33/13, possibly due to enhanced stabilization of the mutant in its FXaβ form. Because the fibrinolytic advantage of the mutant in the purified system appears to be a result of resistance to proteolysis, this raises the possibility that if the proteolytic degradation of Xa33/13 could be similarly prevented, we may be able to create an even more effective fibrinolytic agent. It is not currently known if Xa28 generated by further plasmin-mediated cleavage of Xa33/13 is identical to the 28 kDa fragment generated from FX47/13, which is cleaved by plasmin at Arg295 [159]. N-terminal sequence analysis of the derivatives resulting from proteolysis of Xa33/13, in particular Xa28, may identify residues that could be targeted for mutagenesis to non-cleavable residues in a similar manner as was performed in this study. It is expected that this stabilized mutant-derived Xa33/13 would be an even more effective fibrinolytic cofactor than Lys330Gln rFXaβ, making it an ideal candidate for further therapeutic development. Given the surprising ability of Lys330Gln rFXaβ to accelerate plasma fibrinolysis despite the loss of antigen prior to the start of lysis, we recommend further investigation into the effect of mutation at Lys330 to glutamine on interaction of FXa with AT and the subequent fibrinolytic potential of this complex. Binding experiments similar to those conducted previously [53] coupled with fibrinolysis assays like the ones outlined in the current study may provide further insight into the physiological importance of the autolysis loop in the functional conversion of FXa into a fibrinolytic tPA cofactor and the role of FXa-AT in fibrinolysis. An interesting possibility coming from this study is the potential direct binding of FXa derivatives to fibrin [194] and the potential role of this interaction in the conversion of FXa into  127 a fibrinolytic tPA cofactor. The addition into our fibrinolysis assays of a synthetic peptide mimicking the fibrin(ogen) Aα82-123 fragment previously demonstrated to be responsible for FXa binding [194] may indicate whether this interaction plays a physiological role in the auxiliary cofactor model of fibrinolysis. Reductions in observed enhancement of fibrinolysis by the FXa derivatives in the presence of this peptide would provide evidence that it is fibrin itself, rather than anionic phospholipid, that facilitates plasmin-mediated conversion of FXa into a functional tPA cofactor. Additionally, surface plasmon resonance studies could be conducted by immobilizing the fibrin fragment or aPL and determining whether the various FXa derivatives display different binding affinities for fibrin and/or aPL, and whether mutation at Lys330 alters these binding affinities. These studies would allow us to draw conclusions about the relative importance of these two reaction surfaces within the clot and further refine our revised auxiliary cofactor model of fibrinolysis (Figure 23) to reflect a more detailed understanding of this connection between coagulation and fibrinolysis.  7.2 Role of the β-peptide in fibrinolysis The work presented in this study demonstrates that no single-point mutation in the βpeptide region is sufficient to prevent plasmin-mediated excision of the β-peptide from FXa or subsequent autolysis loop cleavage. To determine conclusively the role of the β-peptide in the conversion of FXa from a coagulation enzyme to a fibrinolytic cofactor, a Masters student in the lab is currently generating a number of additional recombinant FX mutants. I have shown here that plasmin is minimally able to cleave the Lys427Gln/Lys433Gln/Lys435Gln mutant FXa in the β-peptide region, but because this cleavage likely occurs at Arg429, the resulting FXaβ is not expected to contain an exposed C-terminal lysine. Further treatment of this mutant with plasmin produces very small quantities of Xa33/13, indicating that exposure of a C-terminal lysine in the β-peptide region is not a pre-requisite for Xa33/13 generation. It has not yet been  128 determined how many molecules of plasminogen this Xa33/13-like species can bind, but we predict that, unlike Xa33/13 generated from nFXa, this mutant derivative will bind only one plasminogen because of C-terminal lysine exposure following autolysis loop cleavage. Surface plasmon resonance experiments similar to those conducted previously [171] would confirm this hypothesis. In addition to the triple-point mutant that was described in this study, a quadruple-point mutant in which the four basic residues in the β-peptide region (Lys427, Arg429, Lys433, and Lys435) are all altered to glutamine will be created. We predict that this four-point mutation will completely inhibit plasmin-mediated cleavage in the β-peptide region and that the activated mutant will consequently be stabilized as FXaα and thus would not be expected to bind plasminogen or enhance fibrinolysis. Alternatively, if β-peptide excision is not a necessary prerequisite for autolysis loop cleavage, the direct conversion of FXaα to a Xa33/13-like species may be observed and such a derivative would contain both an intact β-peptide and a cleaved autolysis loop, and would be expected to bind only one plasminogen molecule. Comparison of this mutant to the Lys427Gln/Lys433Gln/Lys435Gln mutant, which is also expected to bind only one plasminogen, would indicate which C-terminal lysine residue plays the more significant role in FXa acquisition of fibrinolytic function. Experiments similar to the ones described in this study will be carried out to confirm these hypotheses. Furthermore, recombinant FX with an Arg429Lys mutation combined with the Lys330Gln mutation would yield a stabilized FXaβ derivative that must have a C-terminal exposed lysine residue. This combination of mutations would maximize the plasminogen binding capacity of the stabilized mutant-derived FXaβ, which may consequently show increased fibrinolytic cofactor effects over the Lys330Gln mutation alone. Ultimately, a combination of mutations including Lys330Gln, Arg429Gln or as yet unidentified residue(s) yielding Xa28 or other  129 proteolytic fragments may be required to generate a stable, effective, and optimal fibrinolytic tPA cofactor suitable for therapeutic purposes. Finally, an unintended component of this work was the corroboration that individual βpeptide residues may be differentially involved in FX activation, in agreement with a previous report [82]. Unfortunately, due to complications commonly associated with the recombinant expression of vitamin K-dependent proteins, we cannot yet confirm unambiguously that Lys427 and Lys435, in particular, are involved in FX activation. Addition of the VKOR gene to cells expressing each of the β-peptide mutants and a complete analysis of multiple clones, as was done here with wildtype and Lys330Gln FX, would indicate whether the apparent reduction in functional protein was the result of incomplete post-translational modification of the Gla domain. If specific activity levels could not be rescued by co-expression with VKOR, then a more detailed investigation of the effect of β-peptide mutations on FX activation, including initiation through the intrinsic pathway, could be conducted. Thus, although it was not the focus of the current study, the β-peptide mutants generated here could be used in future studies to identify which basic residues in this region play a role in formation of the Xase complexes.  7.3 Effect of Arg386Cys mutation on FX translation and secretion We have identified a novel mutation in a patient with mild FX deficiency wherein Arg386 in the FX protease domain is substituted for cysteine. Measurements of FX antigen in patient plasma combined with our initial recombinant protein experiments suggest that the addition of a cysteine residue drastically reduces the levels of circulating (or secreted) FX. It is currently unclear at which point during protein processing and trafficking [213] FX expression is halted as a result of this mutation. Future experiments to assess the intracellular component of this defect could include analysis of antigenic and activity levels of cell lysates. Immunofluorescence microscopy could also be used to demonstrate differences between wildtype and Arg386Cys FX  130 co-localization with endoplasmic reticulum- and/or Golgi-resident proteins as was done previously with a functionally similar FVIII mutation [214]. Furthermore, a detailed analysis of the disulfide bonds present in the secreted Arg386Cys FX recombinant protein and comparison to disulfide bonds found in wildtype FX would provide insight into potential protein misfolding that still results in secretion of at least partially functional protein. This identification and location of any differences between wildtype and Arg386Cys mutant disulfide bonds could be accomplished by mass spectrometric peptide mapping as has been described by others [215]. Functional assays conducted during the current study demonstrate that the Arg386Cys FX mutation is one of only a handful known to disrupt the intrinsic pathway without affecting the extrinsic pathway [203-206]. Determination of the precise role of Arg386 in intrinsic pathwaymediated FX activation would require measuring the interaction of the Arg386Ala or Arg386Cys recombinant FX mutant with the intrinsic Xase complex in a purified system. This could be accomplished by incubating plasma-derived FX or the recombinant FX mutants with purified FVIIIa, FIXa, calcium, and aPL and following FX activation over time by SDS-PAGE. Alternatively, fluorescence spectroscopy studies could also be used to follow binding and release of FX(a) from the intrinsic Xase complex [216]. Combined, these studies would allow us to determine if this novel coagulation defect is a result of altered binding or dissociation rates, or catalytic conversion of FX to FXa within the intrinsic Xase complex.  131  BIBLIOGRAPHY 1. Furie B, Furie BC. Molecular and cellular biology of blood coagulation. N Engl J Med 1992; 326: 800-806. 2. Mann KG, Krishnaswamy S, Lawson JH. Surface-dependent hemostasis. Semin Hematol 1992; 29: 213-226. 3. Colman RW, Marder VJ, Salzman EW, Hirsh J. Hemostasis and thrombosis: basic principles and clinical practice. Philadelphia, PA: J.B.Lippincott Co., 1987. 4. Davie EW. Biochemical and molecular aspects of the coagulation cascade. Thromb Haemost 1995; 74: 1-6. 5. Cesarman-Maus G, Hajjar KA. Molecular mechansims of fibrinolysis. Br J Haematol 2005; 129: 307-321. 6. Smith SB, Gailani D. Update on the physiology and pathology of factor IX activation by factor XIa. Expert Rev Hematol 2008; 1: 87-98. 7. Soeda T, Nogami K, Matsumoto T, Ogiwara K, Shima M. Mechanisms of factor VIIacatalyzed activation of factor VIII. J Thromb Haemost 2010; 8: 2494-2503. 8. Davie EW, Ratnoff OD. Waterfall sequence of intrinsic blood clotting. Science 1964; 145: 1310-1312. 9. Giesen PL, Willems GM, Hemker HC, Hermens WT. Membrane-mediated assembly of the prothrombinase complex. J Biol Chem 1991; 266 (28): 18720-18725. 10. Krishnaswamy S. Prothrombinase complex assembly. Contributions of protein-protein and protein-membrane interactions toward complex formation. J Biol Chem 1990; 265 (7): 3708-3718. 11. Schwalbe RA, Ryan J, Stern DM, Kisiel W, Dahlbäck B, Nelsestuen GL. Protein structural requirements and properties of membrane binding by gamma-carboxyglutamic acid-containing plasma proteins and peptides. J Biol Chem 1989; 264: 20288-20296. 12. Bloom JW, Nesheim ME, Mann KG. Phospholipid-binding properties of bovine factor V and factor Va. Biochem 1979; 18: 4419-4425. 13. Krishnaswamy S, Mann KG. The binding of factor Va to phospholipid vesicles. J Biol Chem 1988; 263: 5714-5723. 14. Rosing J, Tans G, Goversriemslag JWP, Zwaal RFA, Hemker HC. Role of phospholipids and factor Va in the prothrombinase complex. J Biol Chem 1980; 255: 274-283. 15. Pryzdial EL, Mann KG. The association of coagulation factor Xa and factor Va. J Biol Chem 1991; 266: 8969-8977.  132 16. Nesheim ME, Taswell JB, Mann KG. The contribution of bovine factor V and factor Va to the activity of prothrombinase. J Biol Chem 1979; 254: 10952-10962. 17. Lundblad RL, Uhteg LC, Vogel CN, Kingdon HS, Mann KG. Preparation and partial characterization of two forms of bovine thrombin. Biochem Biophys Res Commun 1975; 66: 482-489. 18. Davie EW, Kulman JD. An overview of the structure and function of thrombin. Semin Thromb Hemost 2006; 32: 3-15. 19. Ruf W, Dorfleutner A, Riewald M. Specificity of coagulation factor signaling. J Thromb Haemost 2003; 1: 1495-1503. 20. Adam F, Guillin MC, Jandrot-Perrus M. Glycoprotein Ib-mediated platelet activation - A signalling pathway triggered by thrombin. Eur J Biochem 2003; 270: 2959-2970. 21. Kane WH, Lindhout MJ, Jackson CM, Majerus PW. Factor Va-dependent binding of factor Xa to human platelets. J Biol Chem 1980; 255: 1170-1174. 22. Nesheim ME, Foster WB, Hewick R, Mann KG. Characterization of factor V activation intermediates. J Biol Chem 1984; 259: 3187-3196. 23. Jenny RJ, Pittman DD, Toole JJ, Kriz RW, Aldape RA, Hewick RM, Kaufman RJ, Mann KG. Complete cDNA and derived amino acid sequence of human factor V. Proc Natl Acad Sci U S A 1987; 84: 4846-4850. 24. Camire RM, Bos MHA. The molecular basis of factor V and VIII procofactor activation. J Thromb Haemost 2009; 7: 1951-1961. 25. Krishnaswamy S, Russell GD, Mann KG. The reassociation of factor Va from its isolated subunits. J Biol Chem 1989; 264: 3160-3168. 26. Guinto ER, Esmon CT. Formation of a calcium-binding site on bovine activated factor V following recombination of the isolated subunits. J Biol Chem 1982; 257: 10038-10043. 27. Mann KG, Lawler CM, Vehar GA, Church WR. Coagulation Factor V contains copper ion. J Biol Chem 1984; 259: 12949-12951. 28. Mann KG, Kalafatis M. Factor V: a combination of Dr Jekyll and Mr Hyde. Blood 2003; 101: 20-30. 29. Krishnaswamy S, Jones KC, Mann KG. Prothrombinase complex assembly. Kinetic mechanism of enzyme assembly on phospholipid vesicles. J Biol Chem 1988; 263: 3823-3834. 30. Leytus SP, Foster DC, Kurachi K, Davie EW. Gene for human factor X: a blood coagulation factor whose gene organization is essentially identical with that of factor IX and protein C. Biochem 1986; 25 (18): 5098-5192.  133 31. MacGillivray RTA, Fung MR. 6 Molecular biology of factor X. Baillière's Clinical Haematology 1989; 2: 897-917. 32. Hertzberg M. Biochemistry of factor X. Blood Rev 1994; 8: 56-62. 33. Davidson CJ, Hirt RP, Lal K, Snell P, Elgar G, Tuddenham EGD, Mcvey JH. Molecular evolution of the vertebrate blood coagulation network. Thromb Haemost 2003; 89: 420428. 34. Leytus SP, Chung DW, Kisiel W, Kurachi K, Davie EW. Characterization of a cDNA coding for human factor X. Proc Natl Acad Sci USA 1984; 81 (12): 3699-3702. 35. Fair DS, Revak DJ, Hubbard JG, Girolami A. Isolation and characterization of the Factor-X Friuli variant. Blood 1989; 73: 2108-2116. 36. Wallin R, Stanton C, Ross RP. Intracellular proteolytic processing of the 2-chain vitamin-K-dependent coagulation factor X. Thromb Res 1994; 73: 395-403. 37. Sinha U, Wolf DL. Carbohydrate residues modulate the activation of coagulation factor X. J Biol Chem 1993; 268: 3048-3051. 38. Fernlund P, Stenflo J. Beta-hydroxyaspartic acid in vitamin K-dependent proteins. J Biol Chem 1983; 258: 12509-12512. 39. Montreuil J, Vliegenthart JFG, Schachter H. Glycoproteins II. New York: Elsevier, 1997. 40. Nakagawa H, Takahashi N, Fujikawa K, Kawamura Y, Iino M, Takeya H, Ogawa H, Suzuki K. Identification of the oligosaccharide structures of human coagulation factor X activation peptide at each glycosylation site. Glycoconj J 1995; 12: 173-181. 41. Stenflo J. Contributions of Gla and EGF-like domains to the function of vitamin Kdependent coagulation factors. Crit Rev Eukaryot Gene Expr 1999; 9: 59-88. 42. Nelsestuen GL, Shah AM, Harvey SB. Vitamin K-dependent proteins. Vitam Horm 2000; 58: 355-389. 43. Nelsestuen GL, Kisiel W, Di Scipicio RG. Interaction of vitamin K dependent proteins with membranes. Biochem 1978; 17: 2134-2138. 44. Wajih N, Sane DC, Hutson SM, Wallin R. Engineering of a recombinant vitamin Kdependent γ-carboxylation system with enhanced γ-carboxyglutamic acid forming capacity. J Biol Chem 2005; 280: 10540-10547. 45. Sun YM., Jin DY., Camire RM, Stafford DW. Vitamin K epoxide reductase significantly improves carboxylation in a cell line overexpressing factor X. Blood 2005; 106: 38113815. 46. Wu SM, Cheung WF, Frazier D, Stafford DW. Cloning and expression of the cDNA for human gamma-glutamyl carboxylase. Science 1991; 254: 1634-1636.  134 47. Presnell SR, Stafford DW. The Vitamin K-dependent carboxylase. Thromb Haemost 2002; 87: 937-946. 48. Sunnerhagen MS, Persson E, Dahlqvist I, Drakenberg T, Stenflo J, Mayhew M, Robin M, Handford P, Tilley JW, Campbell ID. The effect of aspartate hydroxylation on calcium binding to epidermal growth factor-like modules in coagulation factors IX and X. J Biol Chem 1993; 268: 23339-23344. 49. Padmanabhan K, Padmanabhan KP, Tulinsky A, Park CH, Bode W, Huber R, Blankenship DT, Cardin AD, Kisiel W. Structure of human des(1-45) factor Xa at 2.2A resolution. J Mol Biol 1993; 232: 947-966. 50. Pryzdial ELG, Kessler GE. Autoproteolysis or plasmin-mediated cleavage of factor Xa exposes a plasminogen binding site and inhibits coagulation. J Biol Chem 1996; 271: 16614-16620. 51. Wei A, Alexander RS, Duke J, Ross H, Rosenfeld SA, Chang CH. Unexpected binding mode of tick anticoagulant peptide complexed to bovine factor Xa. J Mol Biol 1998; 283: 147-154. 52. Johnson DJ, Li W, Adams TE, Huntington JA. Antithrombin-S195A factor Xa-heparin structure reveals the allosteric mechanism of antithrombin activation. EMBO J 2006; 25: 2029-2037. 53. Manithody C, Yang L, Rezaie AR. Role of basic residues of the autolysis loop in the catalytic function of factor Xa. Biochem 2002; 41: 6780-6788. 54. Rezaie AR, Manithody C, Yang LK. Identification of factor Xa residues critical for interaction with protein Z-dependent protease inhibitor - Both active site and exosite interactions are required for inhibition. J Biol Chem 2005; 280: 32722-32728. 55. Venkateswarlu D, Perera L, Darden T, Pedersen LG. Structure and dynamics of zymogen human blood coagulation factor X. Biophys J 2002; 82: 1190-1206. 56. Kamata K, Kawamoto H, Honma T, Iwama T, Kim S-H. Structural basis for chemical inhibition of human blood coagulation factor Xa. Proc Natl Acad Sci USA 1998; 95: 6630-6635. 57. Cook BC, Rudolph AE, Kurumbail RG, Porche-Sorbet RM, Miletich JP. Directed glycosylation of human coagulation factor X at residue 333. Insight into factor Cadependent prothrombin catalysis. J Biol Chem 2000; 275 (49): 38774-38779. 58. Larson PJ, Camire RM, Wong D, Fasano NC, Monroe DM, Tracy PB, High KA. Structure/function analyses of recombinant variants of human factor Xa: factor Xa incorporation into prothrombinase on the thrombin-activated platelet surface is not mimicked by synthetic phospholipid vesicles. Biochem 1998; 37: 5029-5038. 59. Rudolph AE, Mullane MP, Porche-Sorbet R, Miletich JP. Expression, purification, and characterization of recombinant human factor X. Protein Expr Purif 1997; 10: 373-378.  135 60. Rudolph AE, Porche-Sorbet RM, Miletich JP. Substitution of asparagine for arginine 347 of recombinant factor Xa markedly reduces factor Va binding. Biochem 2000; 39: 2861-2867. 61. Rudolph AE, Porche-Sorbet R, Miletich JP. Definition of a factor Va binding site in factor Xa. J Biol Chem 2001; 276: 5123-5128. 62. Chen L, Yang L, Manithody C, Rezaie AR. Contribution of the charged residues of the 70-80-loop to the zymogenic and enzymatic properties of factor X/Xa. Blood 2003; 102: 128A. 63. Chen L, Manithody C, Yang LK, Rezaie AR. Zymogenic and enzymatic properties of the 70-80 loop mutants of factor X/Xa. Protein Sci 2004; 13: 431-442. 64. Kittur FS, Manithody C, Rezaie AR. Role of the N-terminal epidermal growth factorlike domain of factor X/Xa. J Biol Chem 2004; 279: 24189-24196. 65. Manithody C, Rezaie AR. Functional mapping of charged residues of the 82-116 sequence in factor Xa: Evidence that lysine 96 is a factor Va independent recognition site for prothrombin in the prothrombinase complex. Biochem 2005; 44: 10063-10070. 66. Mathur A, Rezaie AR. Role of the acidic patch E36-E39 (chymotrypsin numbering) of the protease domain of coagulation factor X. Blood 2000; 96: 633A-+. 67. Monnaie D, Arosio D, Griffon N, Rose T, Rezaie AR, Di Cera E. Identification of a binding site for quaternary amines in factor Xa. Biochem 2000; 39: 5349-5354. 68. Qureshi SH, Yang LK, Yegneswaran S, Rezaie AR. FRET studies with factor X mutants provide insight into the topography of the membrane-bound factor X/Xa. Biochem J 2007; 407: 427-433. 69. Rezaie AR. Identification of basic residues in the heparin-binding exosite of factor Xa critical for heparin and factor Va binding. J Biol Chem 2000; 275 (5): 3320-3327. 70. Rezaie AR, Kittur FS. The critical role of the 185-189-loop in the factor Xa interaction with Na plus and factor Va in the prothrombinase complex. J Biol Chem 2004; 279: 48262-48269. 71. Rezaie AR, Yang LK, Manithody C. Mutagenesis studies toward understanding the mechanism of differential reactivity of factor Xa with the native and heparin-activated antithrombin. Biochem 2004; 43: 2898-2905. 72. Rezaie AR, Yang LK. Probing the molecular basis of factor Xa specificity by mutagenesis of the serpin, antithrombin. Biochim Biophys Acta 2001; 1528: 167-176. 73. Rezaie AR, He XH, Cheng M. Identification and characterization of the sodium binding site of factor Xa. Thromb Haemost 1999; 36. 74. Rezaie AR, Esmon CT. Contribution of residue-192 in factor Xa to enzyme specificity and function. J Biol Chem 1995; 270: 16176-16181.  136 75. Rezaie AR, Esmon CT. Asp-70-Lys mutant of factor X lacks high-affinity Ca2+ binding-site yet retains function. J Biol Chem 1994; 269: 21495-21499. 76. Rezaie AR, He XH. Sodium binding site of factor Xa: Role of sodium in the prothrombinase complex. Biochem 2000; 39: 1817-1825. 77. Bianchini EP, Orcutt SJ, Panizzi P, Bock PE, Krishnaswamy S. Ratcheting of the substrate from the zymogen to proteinase conformations directs the sequential cleavage of prothrombin by prothrombinase. Proc Natl Acad Sci USA 2005; 102: 10099-10104. 78. Bianchini EP, Pike RN, Le Bonniec BF. The elusive role of the potential factor X cationbinding exosite-1 in substrate and inhibitor interactions. J Biol Chem 2004; 279: 36713679. 79. Levigne S, Thiec F, Cherel G, Irving JA, Fribourg C, Christophe OD. Role of the alphahelix 163-170 in factor Xa catalytic activity. J Biol Chem 2007; 282: 31569-31579. 80. Norledge BV, Petrovan RJ, Ruf W, Olson AJ. The tissue factor/factor VIIa/factor Xa complex: A model built by docking and site-directed mutagenesis. Proteins 2003; 53: 640-648. 81. Baugh BJ, Dickenson CD, Ruf W, Krishnaswamy S. Exocite interactions detrmine the affinity of factor X for the intrinsic tenase complex. J Biol Chem 2000; 275: 2882628833. 82. Chattopadhyay A, Fair DS. Molecular recognition in the activation of human blood coagulation factor X. J Biol Chem 1989; 264: 11035-11043. 83. Monteiro RQ. Targeting exosites on blood coagulation proteases. An Acad Bras Cienc2005; 77: 275-280. 84. Thiec F, Cherel G, Christophe OD. Role of the Gla and first epidermal growth factorlike domains of factor X in the prothrombinase and tissue factor-factor VIIa complexes. J Biol Chem 2003; 278: 10393-10399. 85. Chuang TF, Sargeant RB, Hougie C. Intrinsic activation of factor X in blood coagulation. Biochim Biophys Acta 1972; 273: 287-&. 86. Furukawa Y, Matsunaga Y, Hayashi K. Purification and characterization of a coagulant protein from venom of Russells viper. Biochim Biophys Acta 1976; 453: 48-61. 87. Leventis PA, Grinstein S. The distribution and function of phosphatidylserine in cellular membranes. Annu Rev Biophys 2010; 39: 407-427. 88. Bevers EM, Comfurius P, Dekkers DWC, Zwaal RFA. [review] Lipid translocation across the plasma membrane of mammalian cells. Biochim Biophys Acta 1999; 1439: 317-330.  137 89. Bevers EM, Comfurius P, Dekkers DWC, Harmsma M, Zwaal RF. Transmembrane phospholipid distribution in blood cells: control mechanisms and pathological significance. Biol Chem 1998; 379: 973-986. 90. Zwaal RFA, Comfurius P, Bevers EM. Surface exposure of phosphatidylserine in pathological cells. Cell Mol Life Sci 2005; 62: 971-988. 91. Wang SX, Hur E, Sousa CA, Brinen L, Slivka EJ, Fletterick RJ. The extended interactions and Gla domain of blood coagulation factor Xa. Biochem 2003; 42: 79597966. 92. Huang M, Rigby AC, Morelli X, Grant MA, Huang G, Furie B, Seaton B, Furie BC. Structural basis of membrane binding by Gla domains of vitamin K-dependent proteins. Nat Struct Mol Biol 2003; 10: 751-756. 93. Wikström A, Deinum J. Probing the interaction of coagulation factors with phospholipid vesicle surfaces by surface plasma resonance. Anal Biochem 2007; 362: 98-107. 94. Mertens K, Cupers R, Van Wijngaarden A, Bertina RM. Binding of human bloodcoagulation Factors IXa and X to phospholipid membranes. Biochem J 1984; 223: 599605. 95. Hathcock J, Rusinova E, Vaananen H, Nemerson Y. Lipid-bound factor Xa regulates tissue factor activity. Biochem 2007; 46: 6134-6140. 96. Côte HCF, Bajzar L, Stevens WK, Samis JA, Morser J, MacGillivray RTA, Nesheim ME. Functional characterization of recombinant human meizothrombin and meizothrombin(desF1). J Biol Chem 1997; 272 (10): 6194-6200. 97. Esmon CT, Owen WG, Jackson CM. A plausible mechanism for prothrombin activation by factor Xa, factor Va, phospholipid, and calcium ions. J Biol Chem 1974; 249: 80458047. 98. Esmon CT, Owen WG, Jackson CM. The conversion of prothrombin to thrombin. V. The activation of prothrombin by factor Xa in the presence of phospholipid. J Biol Chem 1974; 249: 7798-7807. 99. Broze GJ, Warren LA, Novotny WF, Higuchi DA, Girard JJ, Miletich JP. The lipoprotein-associated coagulation inhibitor that inhibits the factor-VII-tissue factor complex also inhibits factor Xa - Insight into its possible mechanism of action. Blood 1988; 71: 335-343. 100. Rao LV, Rapaport SI. Studies of a mechanism inhibiting the initiation of the extrinsic pathway of coagulation. Blood 1987; 69: 645-651. 101. Rezaie AR. Determinants of specificity of factor Xa interaction with its physiological inhibitors. Mini Rev Med Chem 2006; 6: 859-865. 102. Broze GJ, Miletich JP. Characterization of the inhibition of tissue factor in serum. Blood 1987; 69: 150-155.  138 103. Lindahl AK. Tissue factor pathway inhibitor: From unknown coagulation inhibitor to major antithrombotic principle. Cardiovasc Res 1997; 33: 286-291. 104. Huang Z-F, Wun T-C, Broze GJ. Kinetics of factor Xa inhibition by tissue factor pathway inhibitor. J Biol Chem 1993; 268 (36): 26950-26955. 105. Franssen J, Salemink I, Willems GM, Wun TC, Hemker HC, Lindhout T. Prothrombinase is protected from inactivation by tissue factor pathway inhibitor – Competition between prothrombin and inhibitor. Biochem J 1997; 323: 3337. 106. Han X, Huang Z-F, Fiehler R, Broze GJ, Jr. The protein Z-dependent protease inhibitor is a serpin. Biochem 1999; 38: 11073-11078. 107. Han X, Fiehler R, Broze GJ. Characterization of the protein Z-dependent protease inhibitor. Blood 2000; 96: 3049-3055. 108. Conard J, Brosstad F, Lie Larsen M, Samama M, Abildgaard U. Molar Antithrombin Concentration in Normal Human Plasma. Haemostasis 1983; 13: 363-368. 109. Olson ST, Björk I, Shore JD. [30] Kinetic characterization of heparin-catalyzed and uncatalyzed inhibition of blood coagulation proteinases by antithrombin. In: Laszlo Lorand KGM (editor). Methods in Enzymology. Proteolytic enzymes in coagulation, fibrinolysis, and complement activation Part A: Mammalian blood coagulation factors and inhibitors. Academic Press, 1993; 525-559. 110. Craig PA, Olson ST, Shore JD. Transient kinetics of heparin-catalyzed protease inactivation by antithrombin III: Characteristics of assembly, product formation and heparin dissociation steps in the factor Xa reaction. J Biol Chem 1989; 264: 5452-5461. 111. Ellis V, Scully MF, Kakkar VV. The acceleration of the inhibition of platelet prothrombinase complex by heparin. Biochem J 1986; 233: 161-165. 112. Teitel JM, Rosenberg RD. Protection of factor Xa from neutralization by the heparinantithrombin complex. J Clin Invest 1983; 71: 1383-1391. 113. Miletich JP, Jackson CM, Majerus PW. Properies of the factor Xa binding site on human platelets. J Biol Chem 1978; 253: 6908-6916. 114. Marciniak E. Factor-Xa Inactivation by antithrombin III - Evidence for biological stabilization of factor Xa by factor V-phospholipid complex. Br J Haematol 1973; 24: 391-400. 115. Walker FJ, Esmon CT. Effects of phospholipid and factor Va on the inhibition of factor Xa by antithrombin III. Biochem Biophys Res Comm 1979; 90: 641-647. 116. Lindhout T, Baruch D, Schoen P, Franssen J, Hemker HC. Thrombin generation and inactivation in the presence of antithrombin III and heparin. Biochem 1986; 25: 59625969.  139 117. Billy D, Speijer H, Lindhout T, Hemker HC, Willems GM. Inhibition of prothrombinase at macroscopic lipid membranes - Competition between antithrombin and prothrombin. Biochem 1995; 34: 13699-13704. 118. Billy D, Speijer H, Lindhout T, Hemker HC, Willems GM. Prothrombin protects prothrombinase from inhibition by antithrombin-heparin. Thromb Haemost 1995; 73: 1236. 119. Billy D, Speijer H, Willems G, Hemker HC, Lindhout T. Prothrombin activation by prothrombinase in a tubular flow reactor. J Biol Chem 1995; 270: 1029-1034. 120. Rezaie AR. Prothrombin protects factor Xa in the prothrombinase complex from inhibition by the heparin-antithrombin complex. Blood 2001; 97: 2308-2313. 121. Medved L, Nieuwenhuizen W. Molecular mechanisms of initiation of fibrinolysis by fibrin. Thromb Haemost 2003; 89: 409-419. 122. Lijnen HR, Collen D. Molecular interactions between tissue-type plasminogen activator and plasminogen. Meth Enz 1994; 223: 197-206. 123. Talbot K, Meixner SC, Pryzdial ELG. Enhanced fibrinolysis by proteolysed coagulation factor Xa. Biochem Biophys Acta 2010; 1804: 723-730. 124. Mosesson MW. Fibrinogen and fibrin structure and functions. J Thromb Haemost 2005; 3: 1894-1904. 125. Weisel JW. Fibrinogen and fibrin. In: David ADP (editor). Advances in Protein Chemistry. Fibrous proteins: Coiled-coils, collagen and elastomers. Academic Press, 2005; 247-299. 126. van Zonneveld AJ, Veerman H, Pannekoek H. On the interaction of the finger and the kringle-2 domain of tissue-type plasminogen activator with fibrin. J Biol Chem 1986; 261 (30): 14214-14218. 127. Christensen U. The Ah-site of plasminogen and 2 C-terminal fragments - A weak lysinebinding site preferring ligands not carrying a free carboxylate function. Biochem J 1984; 223: 413-421. 128. Grailhe P, Nieuwenhuizen W, Angles-Cano E. Study of tissue-type plasminogen activator binding sites on fibrin using distinct fragments of fibrinogen. Eur J Biochem 1994; 219: 961-967. 129. Schielen WJG, Adams HPHM, Vanleuven K, Voskuilen M, Tesser GI, Nieuwenhuizen W. The sequence gamma-(312-324) is a fibrin-specific epitope. Blood 1991; 77: 21692173. 130. Tsurupa G, Medved L. Identification and characterization of novel tPA- and plasminogen-binding sites within fibrin(ogen) alpha C-domains. Biochem 2001; 40: 801808.  140 131. Collen D. The plasminogen (fibrinolytic) system. Thromb Haemost 1999; 82: 259-270. 132. Gong Y, Kim S-O, Felez J, Grella DK, Castellino FJ, Miles LA. Conversion of Gluplasminogen to Lys-plasminogen is necessary for optimal stimulation of plasminogen activation on the endothelial cell surface. J Biol Chem 2001. 133. Nesheim M, Fredenburgh JC, Larsen GR. The dissociation constants and stoichiometries of the interaction of Lys-plasminogen and chloromethylketone derivatives of tissue plasminogen activator and the variant delta-FEIX with intact fibrin. J Biol Chem 1990; 265: 21541-21548. 134. Suenson E, Bjerrum P, Holm A, Lind B, Meldal M, Selmer J, Petersen LC. The role of fragment X polymers in the fibrin enhancement of tissue plasminogen activatorcatalyzed plasmin formation. J Biol Chem 1990; 265: 22228-222237. 135. Fredenburgh JC, Nesheim ME. Lys-plasminogen is a significant intermediate in the activation of Glu-plasminogen during fibrinolysis in vitro. J Biol Chem 1992; 267 (36): 26150-26156. 136. Hoylaerts M, Rijken DC, Lijnen HR, Collen D. Kinetics of the activation of plasminogen by human tissue plasminogen activator: Role of fibrin. J Biol Chem 1982; 257 (6): 2912-2919. 137. Carmeliet P, Collen D. Gene targeting and gene transfer studies of the biological role of the plasminogen/plasmin system. Thromb Haemost 1995; 74: 429-436. 138. Novokhatny V. Structure and activity of plasmin and other direct thrombolytic agents. Thromb Res 2008; 122: S3-S8. 139. Collen D, Wiman B. Antiplasmin, fast-reacting plasmin inhibitor of human plasma. Thromb Haemost 1977; 38: 61. 140. Wiman B, Collen D. Purification and characterization of human antiplasmin, fast-Acting plasmin inhibitor in plasma. Eur J Biochem 1977; 78: 19-26. 141. Wiman B, Almqvist A, Ranby M. The non-covalent interaction between plasmin and alpha-2-antiplasmin. Fibrinolysis 1989; 3: 231-235. 142. Sugiyama N, Sasaki T, Iwamoto M, Abiko Y. Binding-site of alpha-2-plasmin inhibitor to plasminogen. Biochim Biophys Acta 1988; 952: 1-7. 143. Lee AYY, Fredenburgh JC, Stewart RJ, Rischke JA, Weitz JI. Like fibrin, (DD)E, the major degradation product of crosslinked fibrin, protects plasmin from inhibition by alpha(2)-antiplasmin. Thromb Haemost 2001; 85: 502-508. 144. Tate KM, Higgins DL, Holmes WE, Winkler ME, Heyneker HL, Vehar GA. Functional role of proteolytic cleavage at arginine-275 of human tissue plasminogen activator as assessed by site-directed mutagenesis. Biochem 1987; 26: 338-343.  141 145. Sheehan JJ, Tsirka SE. Fibrin-modifying serine proteases thrombin, tPA, and plasmin in ischemic stroke: A review. Glia 2005; 50: 340-350. 146. Collen D, Lijnen HR. The tissue-type plasminogen activator story. Arterioscler Thromb Vasc Biol 2009; 29: 1151-1155. 147. Thrombosis and Hemorrhage. Philadelphia: Lippincott Williams & Wilkins, 2003. 148. Longstaff C, Williams S, Thelwell C. Fibrin binding and the regulation of plasminogen activators during thrombolytic therapy. Cardiovasc Hematol Agents Med Chem 2008; 6: 212-223. 149. Bdeir K, Murciano JC, Tomaszewski J, Koniaris L, Martinez J, Cines DB, Muzykantov VR, Higazi AA-R. Urokinase mediates fibrinolysis in the pulmonary microvasculature. Blood 2000; 96: 1820-1826. 150. Schaller J, Gerber S. The plasmin-antiplasmin system: structural and functional aspects. Cell Mol Life Sci 2011; 68: 785-801. 151. Statistics Canada. Mortality, Summary List of Causes. 84F0209X. 2007. Statistics Canada. 152. Public Health Agency of Canada. Tracking Heart Disease and Stroke in Canada. 2009. Government of Canada. 153. Canadian Institute for Health Information. Inpatient hospitalizations and average length of stay trends in Canada, 2003-04 and 2004-05. 2005. Government of Canada. 30-112005. 154. Mitka M. Heart disease a global health threat. JAMA 2004; 291: 2533. 155. Sikri N, Bardia A. A history of streptokinase use in acute myocardial infarction. Tex Heart Inst J 2007; 34: 318-327. 156. Gulba DC, Bode C, Runge MS, Huber K. Thrombolytic agents - an updated overview. Fibrinolysis Proteolysis 1998; 12 (Suppl 2): 39-58. 157. Verstraete M. New therapeutic agents in thombosis and thrombolysis. In: Sasahara AA, Loscalzo JL (editors). New York: M. Dekker, 1997; 477-478. 158. Zeibdawi AR, Pryzdial ELG. Mechanism of FVa inactivation by plasmin: Loss of A2 and A3 domains from a Ca2+-dependent complex of fragments bound to phospholipid. J Biol Chem 2001; 276 (23): 19929-19936. 159. Pryzdial ELG, Lavigne N, Dupuis N, Kessler G. Plasmin converts factor X from coagulation zymogen to fibrinolysis cofactor. J Biol Chem 1999; 274: 8500-8505. 160. Omar MN, Mann KG. Inactivation of factor Va by plasmin. J Biol Chem 1987; 262: 9750-9755.  142 161. Pasquini R, Hershgol, EJ. Effects of plasmin on human factor VIII (Ahf). Blood 1973; 41: 105-111. 162. Samis JA, Ramsey G.D., Walker JB, Nesheim ME, Giles AR. Proteolytic processing of human coagulation factor IX by plasmin. Blood 2000; 95 (3): 943-951. 163. del Zoppo GJ, Saver JL, Jauch EC, Adams HP, Jr., on behalf of the American Heart Association Stroke Council. Expansion of the time window for treatment of acute ischemic stroke with intravenous tissue plasminogen activator: A science advisory from the American Heart Association/American Stroke Association. Stroke 2009; 40: 29452948. 164. Hatcher MA, Starr JA. Role of tissue plasminogen activator in acute ischemic stroke. Ann Pharmacother 2011; 45: 364-371. 165. Hacke W, Kaste M, Bluhmki E, Brozman M, Davalos A, Guidetti D, Larrue V, Lees KR, Medeghri Z, Machnig T, Schneider D, von Kummer R, Wahlgren N, Toni D. Thrombolysis with alteplase 3 to 4.5 hours after acute ischemic stroke. New Engl J Med 2008; 359: 1317-1329. 166. Lansburg MG, Bluhmki E, Thijs VN. Efficacy and safety of tissue plasminogen activator 3 to 4.5 hours after acute ischemic stroke: a metaanalysis. Stroke 2009; 40: 2438-2441. 167. Bambauer KZ, Johnston SC, Bambauer DE, Zivin JA. Reasons why few patients with acute stroke receive tissue plasminogen activator. Arch Neurol 2006; 63: 661-664. 168. Mitka M. Tensions remain over tPA for stroke. JAMA 2003; 289: 1363-1364. 169. Eby CS, Mullane MP, Porche-Sorbet RM, Miletich JP. Characterization of the structure and function of the carboxy terminal peptide of human factor X. Blood 1992; 80(10) Suppl 1: 306a. 170. Grundy JE, Lavigne N, Hirama T, MacKenzie CR, Pryzdial ELG. Binding of plasminogen and tissue plasminogen activator to plasmin-modulated factor X and factor Xa. Biochem 2001; 40: 6293-6302. 171. Grundy JE, Hancock MA, Meixner SC, Mackenzie CR, Koschinsky ML, Pryzdial ELG. Plasminogen binds to plasmin-modulated factor Xa by Ca(2+) - and C-terminal lysinedependent and -independent interactions. Thromb Haemost 2007; 97: 38-44. 172. Pryzdial ELG, Bajzar L, Nesheim ME. Prothrombinase components can accelerate tissue plasminogen activator-catalyzed plasminogen activation. J Biol Chem 1995; 270: 1787117877. 173. Uprichard J, Perry DJ. Factor X deficiency. Blood Rev 2002; 16: 97-110. 174. Dewerchin M, Liang Z, Moons L, Carmeliet P, Casrellino FJ, Collen D, Rosen ED. Blood coagulation factor X deficiency casuses partial embryonic lethality and fatal neonatal bleeding in mice. Thromb Haemost 2000; 83: 185-190.  143 175. Menegatti M, Peyvandi F. Factor X deficiency. Semin Thromb Haemost 2009; 25: 407415. 176. Girolami A, Scarparo P, Vettore S, Candeo N, Scandellari R, Lombardi AM. Unexplained discrepancies in the activity-antigen ratio in congenital FX deficiencies with defects in the catalytic domain. Clin Appl Thromb Hemost 2009; 15: 621-627. 177. Girolami A, Vettore S, Scarparo P, Lombardi AM. Persistent validity of a classification of congenital factor X defects based on clotting, chromogenic and immunological assays even in the molecular biology era. Haemophilia 2011; 17: 17-20. 178. Girolami A, Scarparo P, Scandellari R, Allemand E. Congenital factor X deficiencies with a defect only or predominantly in the extrinsic or in the intrinsic system: A critical evaluation. Am J Hematol 2008; 83: 668-671. 179. Tissue plasminogen activator for acute ischemic stroke. The National Institute of Neurological Disorders and Stroke rt-PA Stroke Study Group. New Engl J Med 1995; 333: 1581-1588. 180. Zeibdawi AR, Grundy JE, Lasia B, Pryzdial ELG. Coagulation factor Va Glu96Asp111:A chelator-sensitive site involved in function and subunit association. Biochem J 2004; 377: 141-148. 181. Camire RM, Larson PJ, Stafford DW, High KA. Enhanced gamma-carboxylation of recombinant factor X using a chimeric construct containing the prothrombin propeptide. Biochem 2000; 39: 14322-14329. 182. Hallgren KW, Qian W, Yakubenko AV, Runge KW, Berkner KL. r-VKORC1 expression in factor IX BHK cells increases the extent of factor IX carboxylation but is limited by saturation of another carboxylation component or by a shift in the ratelimiting step. Biochem 2006; 45: 5587-5598. 183. Wajih N, Sane DC, Hutson SM, Wallin R. Engineering of a recombinant vitamin Kdependent γ-carboxylation system with enhanced γ-carboxyglutamic acid forming capacity. J Biol Chem 2005; 280: 10540-10547. 184. James HL, Girolami A, Fair DS. Molecular defect in coagulation factor X friuli results from a substitution of serine for proline at position 343. Blood 1991; 77: 317-323. 185. Himmelspach M, Pfleiderer M, Fischer BE, Plaimauer B, Antoine G, Falkner FG, Dorner F, Schlokat U. Recombinant human factor X: High yield expression and the role of furin in proteolytic maturation in vivo and in vitro. Thromb Res 2000; 97: 51-67. 186. Nesheim ME, Wang W, Boffa M, Nagashima M, Morser J, Bajzar L. Thrombin, thrombomodulin and TAFI in the molecular link between coagulation and fibrinolysis. Thromb Haemost 1997; 78: 386-391. 187. Hervio LS, Coombs GS, Bergstrom RC, Trivedi K, Corey DR, Madison EL. Negative selectivity and the evolution of protease cascades: the specificity of plasmin for peptide and protein substrates. Chem Biol 2000; 7: 443-452.  144 188. Cottrell BA, Doolittle RF. The amino acid sequence of a 27-residue peptide feleased from the [alpha]-chain carboxy-terminus during the plasmic digestion of human fibrinogen. Biochem Biophys Res Comm 1976; 71: 754-761. 189. Doolittle RF, Cassman KG, Cottrell BA, Friezner SJ, Takagi T. Amino acid sequence studies on the γ-chain of human fibrinogen. Covalent structure of the γ-chain portion of fragment D. Biochem 1977; 16: 1710-1715. 190. Takagi T, Doolittle RF. Amino acid sequence studies on plasmin-derived fragments of human fibrinogen. Amino-terminal sequences of intermediate and terminal fragments. Biochem 1975; 14: 940-946. 191. Takagi T, Doolittle RF. Amino acid sequence studies on the gamma-chain of human fibrinogen. Location of four plasmin attack points and a covalent cross-linking site. Biochem 1975; 14: 5149-5156. 192. Nogami K, Shima M, Matsumoto T, Nishiya K, Tanaka I, Yoshioka A. Mechanisms of plasmin-catalyzed inactivation of factor VIII - A crucial role for proteolytic cleavage at Arg(336) responsible for plasmin-catalyzed factor VIII inactivation. J Biol Chem 2007; 282: 5287-5295. 193. Human F10 DNA and amino acid sequence. http://pga.gs.washington.edu/data/f10/f10.ColorFasta.html . 2011. SeattleSNPs. 15-40011. 194. Iino M, Takeya H, Takemitsu T, Nakagaki T, Gabazza EC, Suzuki K. Characterization of the binding of factor Xa to fibrinogen/fibrin derivatives and localization of the factor Xa binding site on fibrinogen. Eur J Biochem 1995; 232: 90-97. 195. Hantgan RW, Francis CW, Marder VJ. Fibrinogen structure and physiology. In: Colman RW, Hirsch J, Marder VJ, Salzman EW (editors). Hemostasis and thrombosis: Basic principles and clinical practice. Philadelphia, PA: J.B. Lippincott Co., 1987; 277-300. 196. Nielsen VG. Protamine enhances fibrinolysis by decreasing clot strength: Role of tissue factor-initiated thrombin generation. Ann Thorac Surg 2006; 81: 1720-1727. 197. Coggin MH, Ahl R, Roland A, Beck D, Brecher AS. Protamine sulfate stimulates degradation of factor Xa and the factor Xa-antithrombin complex. Blood Coagul Fibrinolysis 2011; 22(4): 247-53. 198. Fujikawa K, Titani K, Davie EW. Activation of bovine factor X (Stuart factor): conversion of factor Xa-alpha to factor Xa-beta. Proc Natl Acad Sci U S A 1975; 72: 3359-3363. 199. Wang WB, Fu QH, Zhou RF, Wu WM, Ding QL, Hu YQ, Wang XF, Wang HL, Wang ZY. Molecular characterization of two novel mutations causing factor X deficiency in a Chinese pedigree. Haemophilia 2005; 11: 31-37.  145 200. Girolami A, Vettore S. Discrepancies between clotting and chromogenic assays in congenital coagulation disorders: the hemostatic coin has only one face, chromogenic substrates many. Blood Coagul Fibrinolysis 2009; 20: 484-485. 201. Girolami A, Allemand E, Scandellari R, Lombardi AM, Girolami B. The clinical and laboratory significance of cases of congenital FX deficiency due to defects in the Gladomain. Hematology 2009; 14: 177-181. 202. Stefano VD, Leone G, Ferrelli R, Hassan HJ, Macioce G, Bizzi B. Factor X Roma: a congenital factor X variant defective at different degrees in the intrinsic and the extrinsic activation. Br J Haematol 1988; 69: 387-391. 203. Odom MW, Leone G, De Stefano V, Montiel MM, Boland EJ, Anderson J, Jagadeeswaran P. Five novel point mutations: two causing haemophilia B and three causing factor X deficiency. Mol Cell Probes 1994; 8: 63-65. 204. Iijima K, Murakami M, Kimura O, Murakami F, Shimomura T, Ikawa S. A dysfunctional factor X (factor X Kurayoshi) with a substitution of Arg139 for Ser at the carboxyl-terminus of the light chain. Thromb Res 2001; 101: 311-316. 205. Parkin JD, Madaras F, Sweet B, Castaldi PA. Family with an abnormal factor X. Pathology 1974; 6: 97. 206. Stefano VD, Leone G, Ferrelli R, Hassan HJ, Macioce G, Bizzi B. Factor X Roma: a congenital factor X variant defective at different degrees in the intrinsic and the extrinsic activation. Br J Haematol 1988; 69: 387-391. 207. Nair, S. C., Baidya, S., Sukumaran, D., and Sudhakar, D. Srivastava A. Hereditary Dysfunctional Factor X - Is that Passovoy Factor? J Thromb Haemost 2007; 5[Suppl 2]. 208. Reddy SV, Zhou ZQ, Rao KJ, Scott JP, Watzke H, High KA, Jagadeeswaran P. Molecular characterization of human factor X San Antonio. Blood 1989; 74: 1486-1490. 209. Kim DJ, Thompson AR, Nash DR, James HL. Factors X Wenatchee I and II: compound heterozygosity involving two variant proteins. Biochim Biophys Acta 1995; 1271: 327334. 210. Miyata T, Kojima T, Suzuki K, Umeyama H, Yamazaki T, Kamiya T, Toyoda H, Kato H. Factor X Nagoya 1 and Nagoya 2: a CRM- factor X deficiency and a dysfunctional CRM+ factor X deficiency characterized by substitution of Arg306 by Cys and of Gly366 by Ser, respectively. Thromb Haemost 1998; 79: 486-490. 211. Herrmann F, Auerswald G, Ruiz-Saez A, Navarrete M, Pollmann H, Lopaciuk S, Batorova A, Wulff K, The Greifswald Factor X Deficiency Study Group. Factor X deficiency: clinical manifestation of 102 subjects from Europe and Latin America with mutations in the factor 10 gene. Haemophilia 2006; 12: 479-489. 212. Barone A, Campbell J, Griffin G, Hill M. Factor X Umuahia: A severe bleeding diathesis associated with a novel mutation. Pediatr Blood Cancer 2010; 55: 1246.  146 213. Stanton C, Wallin R. Processing and trafficking of clotting factor X in the secretory pathway. Effects of warfarin. Biochem J 1992; 284: 25-31. 214. Summers RJ, Meeks SL, Healey JF, Brown HC, Parker ET, Kempton CL, Doering CB, Lollar P. Factor VIII A3 domain substitution N1922S results in hemophilia A due to domain-specific misfolding and hyposecretion of functional protein. Blood 2011; 117: 3190-3198. 215. Lim A, Wally J, Walsh MT, Skinner M, Costello CE. Identification and location of a cysteinyl posttranslational modification in an amyloidogenic kappa 1 light chain protein by electrospray ionization and matrix-assisted laser desorption/ionization mass spectrometry. Anal Biochem 2001; 295: 45-56. 216. Lollar P, Parker ET, Curtis JE, Helgerson SL, Hoyer LW, Scott ME, Scandella D. Inhibition of human factor VIIIa by anti-A2 subunit antibodies. J Clin Invest 1994; 93: 2497-2504.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0105146/manifest

Comment

Related Items