UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Involvement of adenosine signalling in the release of gastric and pancreatic peptides Yang, Gary Kaiyuan 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_fall_yang_gary.pdf [ 6.11MB ]
Metadata
JSON: 24-1.0105088.json
JSON-LD: 24-1.0105088-ld.json
RDF/XML (Pretty): 24-1.0105088-rdf.xml
RDF/JSON: 24-1.0105088-rdf.json
Turtle: 24-1.0105088-turtle.txt
N-Triples: 24-1.0105088-rdf-ntriples.txt
Original Record: 24-1.0105088-source.json
Full Text
24-1.0105088-fulltext.txt
Citation
24-1.0105088.ris

Full Text

INVOLVEMENT OF ADENOSINE SIGNALLING IN THE RELEASE OF GASTRIC AND PANCREATIC PEPTIDES   by   Gary Kaiyuan Yang  B.Sc. (Hons.), University of British Columbia, 2006    A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES (Physiology)    THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  June 2011    ©  Gary Kaiyuan Yang, 2011  ii ABSTRACT Adenosine is precursor and a metabolic intermediate of adenosine triphosphate in energy transfer, and cyclic adenosine monophosphate in signal transduction.  Recent studies have demonstrated that the role of adenosine in the body is much more than just structural as it can also behave as an important regulator of homeostatic functions.  Adenosine signalling relies on the activation of the A1, A2A, A2B and A3 adenosine receptors.  Through the development of pharmacological tools and genetic knockout mouse models of specific receptor subtypes, the involvement of these receptors in various physiological systems is quickly being established. This thesis investigates the function of adenosine in the digestive system and specifically how adenosine regulates the release of gastric and pancreatic peptides. With the use of a novel vascularly perfused isolated mouse stomach model and specific A1 and A2A receptor knockout animals, the role of adenosine on the release of somatostatin and ghrelin was determined.  Lower concentrations of adenosine can inhibit the release of somatostatin and ghrelin via the activation of A1 receptors, while higher concentrations can stimulate their release via activation of A2A receptors.  Given the importance of somatostatin in regulating gastric acid secretion and motility, and ghrelin in regulating systemic energy balance, better understanding of how the release of these two peptides is regulated may reveal potential therapies for eating disorders, gastrointestinal dysfunctions and metabolic diseases. In the pancreas, adenosine was shown to regulate both insulin and glucagon secretion from the pancreatic islets.  Studies presented in this thesis demonstrate that adenosine signalling interacts with the effects of the incretin hormone GLP-1 in the pancreas such that concomitant administration of adenosine and GLP-1 in the perfused pancreas induced greater insulin release than GLP-1 administration alone.  Furthermore, A1 receptor knockout mice exhibited more frequent pulses of insulin secretion, which may have contributed to their superior glucose tolerance compared to wild type control mice.  These findings on the role of adenosine signalling in the pancreas may have implications in the etiology of diabetes mellitus.  The involvement of adenosine signalling in the digestive tract further illustrates the importance of adenosine as a metabolic regulator in homeostasis.  iii PREFACE Studies in this thesis have been published in the following articles:  Yang GK, Chen JF, Kieffer TJ and Kwok YN (2009) Regulation of somatostatin release by adenosine in the mouse stomach. J Pharmacol Exp Ther 329:729-737.  Studies in this publication are described in Chapter 3  Yang GK, Yip L, Fredholm BB, Kieffer TJ and Kwok YN (2011) Involvement of adenosine signaling in controlling the release of ghrelin from the mouse stomach. J Pharmacol Exp Ther 336:77-86.  Studies in this publication are described in Chapter 4  Contributions of authors:  Drs. J-F Chen, NE Dale, BB Fredholm, JD Johnson, TJ Kieffer, YN Kwok, CHS McIntosh, MA Schwarzschild and PE Squires provided materials and analysis tools.  Drs. E Túduri and L Yip, Mrs. C Nian and Mr. A Asadi provided technical training.  Miss. C Tsui provided assistance for perfusion sample collections and radioimmunoassays in Chapter 5.  All studies were conceived and designed by GK Yang, Dr. TJ Kieffer and Dr. YN Kwok. All studies described in Chapters 3, 4, 5 and 6 were performed by GK Yang.  The writing of this thesis and all publications were performed by GK Yang with editing provided by Drs. TJ Kieffer and YN Kwok.  Edits to the 2011 publication was also provided by Drs. L Yip and BB Fredholm. Certificates of approval:  The animal studies presented in this thesis were performed with ethics approval from the University of British Columbia Animal Care Committee (certificate # A05-1337, A07-0173 and A09-0418).     iv TABLE  OF  CONTENTS ABSTRACT ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  i i PREFACE ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  i ii TABLE  OF  CONTENTS ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  iv LIST  OF  TABLES ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .vii LIST  OF  FIGURES ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  viii LIST  OF  ABBREVIATIONS ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  x ACKNOWLEDGEMENTS ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .xii DEDICATION ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  xiii CHAPTER 1 –  INTRODUCTION ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  1 1.1 Adenosine signalling .............................................................................................................. 3 Regulation of adenosine levels .......................................................................................... 3 The adenosine receptors .................................................................................................... 6 1.2 Regulation of gastric acid secretion ....................................................................................... 7 Gastric acid ........................................................................................................................ 7 Gastrin ............................................................................................................................... 8 Somatostatin ...................................................................................................................... 9 Adenosine on gastric acid secretion .................................................................................. 9 1.3 Ghrelin .................................................................................................................................. 12 Discovery of ghrelin ........................................................................................................ 12 Physiological functions of ghrelin ................................................................................... 13 Regulation of ghrelin release ........................................................................................... 15 1.4 Diabetes and the endocrine pancreas ................................................................................... 17 Type 2 diabetes mellitus .................................................................................................. 17 Insulin .............................................................................................................................. 17 Glucagon .......................................................................................................................... 19 Temporal secretions of insulin and glucagon .................................................................. 20 Cyclic adenosine monophosphate ................................................................................... 22 1.5 Current understanding on the role of adenosine in the pancreas .......................................... 23 Sources of ATP and adenosine in the pancreatic islet ..................................................... 23 Purinergic signalling in the pancreatic islet ..................................................................... 23 1.6 Thesis investigation .............................................................................................................. 25 CHAPTER 2 –  METHODS ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  27 2.1 Animals ................................................................................................................................ 27 Adenosine A1 receptor knockout mice ............................................................................ 27 Adenosine A2A receptor knockout mice .......................................................................... 28 2.2 in vivo analysis of glucose metabolism................................................................................ 28 v Food and water intake tracking ....................................................................................... 28 High fat diet study ........................................................................................................... 29 Nutrient and hormone challenge tests ............................................................................. 29 2.3 Preparation of in situ vascularly perfused isolated organ systems ....................................... 30 Surgical isolation of mouse stomach ............................................................................... 30 Surgical isolation of mouse pancreas .............................................................................. 31 Perfusate preparation ....................................................................................................... 32 Glucose entrainment ........................................................................................................ 33 2.4 ex vivo preparation of mouse islets ...................................................................................... 33 Isolation and culturing of mouse islets ............................................................................ 33 Calcium imaging ............................................................................................................. 34 2.5 Immunohistological staining ................................................................................................ 35 Paraffin sections .............................................................................................................. 35 Hematoxylin & eosin staining ......................................................................................... 36 Floating sections .............................................................................................................. 36 Antibodies ........................................................................................................................ 36 2.6 Drugs .................................................................................................................................... 37 2.7 Assays................................................................................................................................... 38 2.8 Data analysis ........................................................................................................................ 39 CHAPTER 3 –  EFFECT OF ADENOSINE ON THE REGULATION OF SOMATOSTATIN RELEASE ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  41 3.1 Effect of adenosine analogues on somatostatin release ....................................................... 42 Basal somatostatin release from the perfused mouse stomach ........................................ 42 Effect of adenosine on gastric somatostatin release ........................................................ 42 Effect of selective adenosine agonists on gastric somatostatin release ........................... 43 Effect of adenosine antagonists on adenosine-induced somatostatin release .................. 45 3.2 Distribution of adenosine receptors and somatostatin in the mouse stomach ...................... 47 3.3 Effect of adenosine on somatostatin release in A1R -/-  and A2AR -/- mice .............................. 49 Effect of adenosine analogues on somatostatin release in A1R -/-  and A2AR -/-  mice ........ 49 Effect of endogenous adenosine on somatostatin release ................................................ 50 3.4 Chapter summary ................................................................................................................. 51 CHAPTER 4 –  EFFECT OF ADENOSINE ON THE REGULATION OF GHRELIN RELEASE ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  54 4.1 Effect of adenosine analogues on ghrelin release ................................................................ 55 Effect of adenosine on ghrelin release ............................................................................. 55 Effect of selective adenosine agonists on ghrelin release................................................ 55 Effect of adenosine antagonists on adenosine-induced ghrelin release ........................... 58 4.2 Cellular distribution and localization of adenosine receptors and ghrelin ........................... 60 4.3 Neural component of adenosine signalling on ghrelin release ............................................. 64 Co-localization of PGP 9.5 with adenosine receptors and ghrelin .................................. 64 vi Effect of tetrodotoxin on adenosine-induced ghrelin release .......................................... 65 4.4 Effect of adenosine analogues on ghrelin release in A1R -/- and A2AR -/- mice ....................... 65 4.5 Interaction between adenosine-induced release of somatostatin and ghrelin ...................... 68 4.6 Chapter summary ................................................................................................................. 70 CHAPTER 5 –  INTERACTION BETWEEN ADENOSINE AND GLP-1 SIGNALLING ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  73 5.1 Effect of adenosine analogues on GLP-1-induced insulin and glucagon release ................ 74 Effect of adenosine on GLP-1-induced insulin release ................................................... 74 Effect of adenosine analogues on GLP-1-induced insulin release .................................. 75 Effect of adenosine analogues on glucagon release ........................................................ 77 Effect of endogenous adenosine on insulin and glucagon release .................................. 78 5.2 Effect of adenosine on calcium oscillations in isolated mouse islets ................................... 79 5.3 Chapter summary ................................................................................................................. 81 CHAPTER 6 –  EFFECT OF ADENOSINE A1  RECEPTORS ON GLUCOSE HOMEOSTASIS AND INSULIN SECRETION ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  84 6.1 Glucose tolerance and insulin sensitivity in A1R -/-  mice ...................................................... 84 Body weight, food and water intake of A1R -/-  mice ........................................................ 84 Glucose tolerance in A1R -/-  mice ..................................................................................... 85 Insulin sensitivity in A1R -/-  .............................................................................................. 88 Effect of glucose on glucagon release in A1R -/- ............................................................... 88 6.2 Effect of high fat diet on glucose homeostasis in A1R -/-  mice ............................................. 89 Glucose tolerance and insulin sensitivity before diet change .......................................... 90 Short-term effects of high fat diet ................................................................................... 91 Long-term effects of high fat diet .................................................................................... 92 Body weight and fasting blood glucose ........................................................................... 93 Insulin and glucagon release from the perfused pancreas ............................................... 94 6.3 Effect of adenosine on glucose-induced pulsatile insulin secretion ..................................... 95 Pulsatile insulin release in A1R -/-  mice ............................................................................ 96 Effect of high fat diet on pulsatile insulin release in A1R -/-  mice .................................... 98 6.4 Chapter summary ................................................................................................................. 98 CHAPTER 7 –  CONCLUSION ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  100 7.1 Adenosine as a metabolic regulator ................................................................................... 100 7.2 Challenges with the development of adenosine therapeutics ............................................. 103 7.3 The future of adenosine signalling ..................................................................................... 105 REFERENCES ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  106  vii LIST OF  TABLES Table 1 - List of primary antibodies used. .................................................................................... 36 Table 2 - List of secondary antibodies used. ................................................................................ 37 Table 3 - Affinity of adenosine receptor agonists and antagonists at the four adenosine receptor subtypes ........................................................................................................................................ 38   viii LIST OF  FIGURES Figure 1 - Effect of adenosine signalling in various physiological systems .................................. 2 Figure 2 - Extracellular synthesis, metabolism and signalling of adenosine. ................................. 5 Figure 3 – Proposed adenosine signalling pathways involved in the regulation of gastric acid secretion. ....................................................................................................................................... 12 Figure 4 - Physiological effects of ghrelin. .................................................................................. 15 Figure 5 - Canonical and supplemental pathways of insulin release in β-cells ............................ 19 Figure 6 - Isolated mouse stomach vascular perfusion setup. ...................................................... 30 Figure 7 - Hematoxylin and eosin stain of the vascularly perfused stomach. .............................. 31 Figure 8 - Isolated mouse pancreas vascular perfusion preparation. ............................................ 32 Figure 9 - Ratiometric analysis of calcium levels with a Fura-2 dye. .......................................... 35 Figure 10 - Effect of adenosine on somatostatin release in the vascularly perfused isolated mouse stomach. ........................................................................................................................................ 43 Figure 11 - Effect of adenosine A1 and A3 agonists on gastric somatostatin release. .................. 44 Figure 12 - Effect of the adenosine A2A agonist on gastric somatostatin release. ........................ 45 Figure 13 - Effect of adenosine A1 and A2A antagonist on gastric somatostatin release. ............. 46 Figure 14 - Confocal images showing immunohistological staining of somatostatin, A1R and A2AR in the mouse corpus mucosa and muscular layers. ............................................................. 48 Figure 15 - Effect of adenosine on somatostatin release in wild type, A1R -/-  and A2AR -/-  mice. .. 50 Figure 16 - Effect of EHNA on gastric somatostatin release. ...................................................... 51 Figure 17 - Effect of adenosine on ghrelin release from the isolated mouse stomach. ................ 55 Figure 18 - Effect of adenosine A1 and A3 agonists on ghrelin release. ....................................... 56 Figure 19 - Effect of the A2A agonist CGS 21680 on ghrelin release. .......................................... 57 Figure 20 - Minimal involvement of A2B receptors in NECA- and CGS 21680-induced ghrelin release. .......................................................................................................................................... 58 Figure 21 - Effect of A1 receptor antagonist on ghrelin release. .................................................. 59 Figure 22 - Effect of A2A receptor antagonist on ghrelin release. ................................................ 59 Figure 23 - Confocal images showing immunohistological staining of ghrelin, A1 receptor and A2A receptor in the mouse gastric mucosa. ................................................................................... 61 Figure 24 - Control immunohistological staining of ghrelin and A1 receptor in the mouse gastric mucosa. ......................................................................................................................................... 62 Figure 25 - Confocal images showing immunohistological staining of ghrelin, A1 receptor and A2A receptor in the mouse gastric muscle layers. ......................................................................... 63 Figure 26 - Expression of ghrelin IR in nerve fibres of the mouse gastric muscle layers. ........... 64 Figure 27 - Effect of tetrodotoxin on the stimulatory effect of adenosine on ghrelin release. ..... 65 Figure 28 - Basal ghrelin release in vascularly perfused isolated mouse stomach from wild type, A1R -/-  and A2AR -/-  mice. ................................................................................................................ 66 Figure 29 - Effect of adenosine analogues on ghrelin release in A1R -/-  and A2AR -/-  mice............ 67 Figure 30 - Effect of EHNA on gastric ghrelin release in vascularly perfused isolated mouse stomach. ........................................................................................................................................ 68 Figure 31 - Effect of somatostatin analogues on ghrelin release in vascularly perfused isolated mouse stomach.............................................................................................................................. 69 ix Figure 32 - Expression of somatostatin immunoreactivity and ghrelin immunoreactivity in the gastric mucosa .............................................................................................................................. 70 Figure 33 - Effect of adenosine on GLP-1-induced insulin release in the vascularly perfused isolated mouse pancreas. .............................................................................................................. 74 Figure 34 - Effect of adenosine analogues on GLP-1-induced insulin release in the vascularly perfused isolated mouse pancreas. ................................................................................................ 76 Figure 35 - Effect of CPA and CGS 21680 on glucagon release in the vascularly perfused isolated mouse pancreas. .............................................................................................................. 78 Figure 36 - Effect of EHNA on GLP-1-induced insulin and glucagon release in the vascularly perfused isolated mouse pancreas. ................................................................................................ 79 Figure 37 - Representative traces on the effect of adenosine on calcium oscillations in isolated mouse islets. .................................................................................................................................. 80 Figure 38 - Effect of adenosine on calcium levels in isolated mouse islets. ................................ 81 Figure 39 - Body weight, food intake and water intake of A1R -/-  mice. ....................................... 85 Figure 40 - Oral glucose tolerance test in A1R -/-  and wild type control mice............................... 86 Figure 41 - Intraperitoneal glucose tolerance test in A1R -/-  and wild type control mice. ............. 87 Figure 42 - Intraperitoneal insulin and arginine challenge in A1R -/-  mice. ................................... 88 Figure 43 - Effect of intraperitoneal glucose injection on plasma glucagon levels in A1R -/-  mice.  ...................................................................................................................................................... 89 Figure 44 - High fat diet study plan for A1R -/-  mice. .................................................................... 90 Figure 45 - Group matching for the high fat diet study in A1R -/-  mice prior to diet change. ....... 91 Figure 46 - Short-term effects of high fat diet on glucose tolerance and insulin sensitivity of A1R - /-  mice. ........................................................................................................................................... 92 Figure 47 - Long-term effects of high fat diet on glucose tolerance and insulin sensitivity of A1R - /-  mice. ........................................................................................................................................... 93 Figure 48 - Food intake, body weight and fasting blood glucose monitoring for high fat diet study in A1R -/-  mice. ..................................................................................................................... 94 Figure 49 - Insulin and glucagon release from vascularly perfused pancreas from A1R -/-  mice. . 95 Figure 50 - Insulin secretion induced by steady glucose infusion in vascularly perfused C57Bl/6 mouse pancreas. ............................................................................................................................ 97 Figure 51 - Insulin secretion induced by oscillatory glucose infusion in vascularly perfused pancreas from wild type controls and A1R -/-  mice. ....................................................................... 97 Figure 52 - Insulin secretion induced by oscillatory glucose infusion in vascularly perfused pancreas from A1R +/+  and A1R -/-  mice fed a high fat diet. ............................................................ 98  x LIST OF  ABBREVIATIONS Ado adenosine ADA adenosine deaminase ADP adenosine diphosphate AMP adenosine monophosphate ANOVA analysis of variance AOPCP adenosine-5‟-O-(α, β-methylenediphosphate); α, β-methylene ADP; AMP-CP ATP adenosine triphosphate cAMP cyclic adenosine monophosphate CCK cholecystokinin CCPA 2-chloro-N 6 -cyclopentyladenosine CGS 21680 2-p-(2-carboxyethyl)phenethylamino-5‟N-ethylcarboxamidoadenosine hydrochloride CPA N 6 -cyclopentyladenosine C-SOM cyclosomatostatin DNA deoxyribosenucleic acid DPCPX 8-cyclopentyl-1,3-dipropylxanthine DPP-IV dipeptidyl peptidase-IV EHNA erythro-9-(2-hydroxy-3-nonyl)adenine hydrochloride ELISA enzyme-linked immunosorbent assay Epac2 exchange protein directly activated by cAMP 2; cAMP-regulated guanine nucleotide exchange factor II; cAMP-GEFII GH growth hormone GHS-R growth hormone secretagogue receptor GI gastrointestinal GIP gastric inhibitory polypeptide; glucose-dependent insulinotropic polypeptide GLP-1 glucagon-like peptide-1 GPCR G protein-coupled receptor HBSS Hanks‟ balanced salt solution HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid hr hour(s) xi IB-MECA 1-deoxy-1-[6-[[(3-iodophenyl) methyl] amino]-9H-purin-9-yl]-N-methyl--D- ribofuranuronamide i.p. intraperitoneal IPGTT intraperitoneal glucose tolerance test IR immunoreactivity KATP channel ATP-sensitive potassium channel min minute(s) NECA 5‟N-ethylcarboxamidoadenosine OGTT oral glucose tolerance test PBS phosphate buffered saline PCR polymerase chain reaction(s) PGP 9.5 protein gene peptide 9.5 PKA protein kinase A RIA radioimmunoassay rpm revolutions per minute RPMI Roswell Park Memorial Institute RRP readily releasable pool SCH 58261 2-(2-Furanyl)-7-(2-phenylethyl)-7H-pyrazolo[4,3-e][1,2, 4]triazolo[1,5- c]pyrimidin-5-amine SNARE soluble N-ethylmaleimide-sensitive factor attachment protein receptors T2DM type 2 diabetes mellitus TTX tetrodotoxin UBC University of British Columbia ZM 241385 4-(2-[7-amino-2-(2-furyl)[1,2,4]triazolo[2,3-][1,3,5] triazin-5- ylamino]ethyl)phenol   xii ACKNOWLEDGEMENTS  The journey of a graduate student, from the confusion associated with the first failed PCR to the joy of holding the final bound thesis, is a long but eventful one.  At the end of this journey, I have come to two realizations.  Firstly, graduate school is not just the place to examine specific research questions such as whether or not adenosine can differentiate embryonic stem cells into GIP-releasing hepatocytes; more than that, it is also the training ground where we gain the knowledge, skills and maturity that become significant in defining who we are.  Secondly, like any challenge in life, a PhD does not have to be done alone.  Here I want to thank all the people that contributed to shaping my life over the last five years. The graduate supervisor is the spark, the catalyst and the fuel in any graduate school work.  I was fortunate enough to have two.  To Kenny and Tim, thank you for the timely encouragements and critiques that always challenged me to improve.  The different personality and expertise that each of you possess created a unique graduate experience which I will always cherish.  There is no doubt that I would not be anywhere near where I am today if it were not for your patience and guidance. Some say the most important aspect to take into consideration when choosing a lab is the camaraderie of the existing members.  To Blair, Cathy, Frank, Heather, Irene, Jasna and Mike, thank you all for embarking on this journey with me while keeping the office full of laughter and the drawers stocked with food.  To Eva, Linda and the Kieffer Lab, thank you for providing me with support on both a technical and personal level throughout my training.  To all the members of the Diabetes Research Group as well as fellow Physiology graduate students, thank you for sharing this exciting time with me through softball, ultimate, camping trips and research retreats. Productivity in the lab is closely tied to life outside of the lab.  I want to thank all my friends that stood with me along the way, lending an ear or a hand whenever needed.  Above all, Victoria, thank you for being a friend, a companion and a partner and for turning the worst days into the best.  Your words of encouragements will always drive my determination.  Last but not least, it is important to never forget where one comes from.  To Kevin, thank you for being the wonderful and distinctive brother that you are.  To my parents, thank you for always being there as an endless source of support and unconditional love.  For bringing me this far, figuratively and literally, and for all the years to come, I dedicate this thesis to you. xiii DEDICATION                 To my parents  1 CHAPTER  1  –  INTRODUCTION  The human body in its entirety is under constant self-monitor and regulation.  Under resting conditions, these homeostatic mechanisms, which involve various neural and hormonal pathways, act in concert to provide remarkable control on bodily functions to maintain a status of metabolic equilibrium.  Following a meal or exercise, metabolic changes trigger adjustments in the activities of homeostatic signals to offset this imbalance and eventually return the body to basal status.  Under pathological states, however, the homeostatic machineries in the body may become impaired or overwhelmed.  If no external corrective measures are given, then the unchecked impairment could result in a reduced quality of life and a shortened lifespan. Therefore, the focus of modern medicine aims at modulating the homeostatic pathways that are affected by a particular disease in a preventive, curative or palliative manner.  Further understanding of known signalling pathways and identifying novel ones are thus essential in biomedical research in the interest of medical advancements.  It was originally thought that the purine nucleoside, adenosine, is only important as the structural precursor for adenosine triphosphate (ATP), a molecule important in energy transfer and cyclic adenosine monophosphate (cAMP), a molecule important in signal transduction. Since the discovery of purinergic neurotransmission by Professor Geoffrey Burnstock in 1972 (Burnstock, 1972), the direct receptor-dependent signalling pathways of adenosine have gained much attention for their therapeutic potential (Figure 1).  The ubiquitous distribution of adenosine and metabolic dependency of adenosine levels rationalize the involvement of adenosine signalling in various homeostatic controls (Jacobson and Gao, 2006).  One of the physiological systems that exhibits frequent changes in metabolic states is the gastrointestinal (GI) tract. 2  Figure 1 - Effect of adenosine signalling in various physiological systems Adenosine has been shown to have diverse effects in different tissues of the body which has led to numerous therapeutic developments (Jacobson and Gao, 2006).  Brackets identify the adenosine receptor subtypes that are thought to be involved in the specific effect.  This is not meant to be an exhaustive representation of all actions of adenosine in the body.  Furthermore, the effects listed are dependent on local adenosine concentrations and not all effects may occur concurrently. 3  Following ingestion of a meal, the body prepares itself for the incoming nutrients via a collaborative effort from multiple organs including the stomach and the pancreas.  The metabolic changes in these organs trigger the release of various regulatory peptides that not only affect nutrient digestion and absorption in the tract but also modulate central regulation of appetite and peripheral control of sugar and fat homeostasis.  Therefore, understanding the meal-dependent release of these regulatory peptides has important therapeutic implications in treating digestive problems, eating disorders and metabolic diseases.  With the identification of adenosine receptors in the stomach and the pancreas (Fredholm et al., 2001), the involvement of adenosine signalling in regulating the release of these peptides warrants further investigation.  This thesis introduces the current understandings of adenosine signalling in the stomach and the pancreas, investigates the involvement of adenosine in regulating the gastric hormones, somatostatin and ghrelin, and the pancreatic hormones insulin and glucagon, and discusses the physiological and pharmacological implications of these findings. 1.1 ADENOSINE SIGNALLING Regulation of adenosine levels  The receptor-mediated actions of adenosine depend on the local levels of extracellular adenosine.  Under basal resting conditions in mice, the extracellular adenosine concentration was estimated to be in the nanomolar range in the brain (Mizoguchi et al., 2001; Pham et al., 2003), liver (Peng et al., 2008) and peritoneal cavity (Rogachev et al., 2006).  Basal adenosine levels in the circulation have been estimated to also be in the nanomolar range in other species including rat (Phillis et al., 1992; Conlay et al., 1997) and human (Yoneyama et al., 2000).  Under ischemic stress or heightened metabolic states, adenosine levels can rapidly rise to micromolar levels and produce much more intense receptor activation (Fredholm, 2007).  Furthermore, due to the different affinities of the adenosine receptor subtypes to adenosine and the different densities of specific adenosine receptor subtypes (Fredholm, 2007), a change in adenosine concentrations could alter the relative receptor activation and elicit additional or opposite responses.  Increases in extracellular adenosine concentration depend on two pathways: intracellular adenosine released through membrane transporters (Baldwin et al., 1999) and extracellular breakdown of adenine nucleotides (Zimmermann, 2000), such as ATP. In tissues other than the liver, de novo synthesis has a minimal contribution to intracellular adenosine levels.  Instead, adenosine comes from enzymatic recycling of molecules 4 with an adenine ring.  Intracellular adenosine levels can change depending on the activity of the enzymes involved.  ATPases inside the cell are involved in the conversions between ATP, adenosine diphosphate (ADP) and adenosine monophosphate (AMP), while endo 5‟-nucleotidase converts AMP into adenosine (Schubert et al., 1979) (Figure 2).  Adenosine can also be phosphorylated back to AMP by adenosine kinase or further deaminated to inosine by adenosine deaminase (ADA) (Fredholm, 2007).  In cell types that have higher intracellular than extracellular adenosine levels, adenosine can be released down the concentration gradient via equilibrative nucleoside transporters (ENT) on the cell membrane (Baldwin et al., 1999). Therefore, increased cellular activity and ATP usage will increase intracellular adenosine concentrations and thereby elicit an increase in extracellular adenosine levels.  Furthermore, hypoxia has been shown to greatly increase extracellular adenosine levels and this is partially via the hypoxia-induced inhibition of ATP synthesis and reduced adenosine kinase activity within the cell (Decking et al., 1997; Fredholm, 2007). Extracellular adenosine can also be generated from the metabolic breakdown of extracellular adenine nucleotides (Fredholm et al., 2001).  This is especially significant during tissue damage when nearby cell lysis results in the release of intracellular adenine nucleotides (Fredholm, 2007).  In tissues that express extracellular membrane-bound ecto-enzymes, these adenine nucleotides can be rapidly broken down into adenosine.  Nucleoside triphosphate diphosphohydrolase, CD 39, converts ATP and ADP into AMP while ecto-5‟-nucleotidase, CD 73, converts AMP into adenosine (Fredholm et al., 2001) (Figure 2).  Adenosine derived from this pathway can also enter the cell through concentrative nucleoside transporters and potentially through ENT depending on the gradient difference of intracellular and extracellular adenosine concentrations (Fredholm et al., 2001).  5  Figure 2 - Extracellular synthesis, metabolism and signalling of adenosine. Extracellular adenosine can arise from cellular release and from metabolic breakdown of extracellular adenine nucleotides.  Adenosine can bind and activate adenosine receptors (A1R, A2AR, A2BR and A3R) on nearby cells and thereby modulate adenylate cyclase activity and intracellular cyclic AMP (cAMP) levels.  ATP: adenosine triphosphate; ADP: adenosine diphosphate; AMP: adenosine monophosphate; Ado: adenosine; Ino: inosine; CD 39: nucleoside triphosphate diphosphohydrolase; CD 73: ecto-5‟-nucleotidase; ADA: adenosine deaminase; AK: adenosine kinase. The contribution of released and extracellularly synthesized adenosine to the total extracellular pool can vary with cell types depending on the concentration gradient across the membrane and the expression of enzymes and nucleoside transporters (Fredholm, 2007).  As such, selective blockade of an enzyme or transporter may induce different responses in different cell types (Fredholm, 2007).  For instance, the ENT blocker dipyridamole was effective at inhibiting adenosine release from neurons but not from astrocytes (Parkinson et al., 2005).  In contrast, the CD 73 inhibitor AOPCP (adenosine-5‟-O-(α, β-methylenediphosphate); α, β- methylene ADP; AMP-CP) was effective at decreasing extracellular adenosine levels in 6 astrocyte but not in neuronal cultures (Parkinson et al., 2005).  Therefore, understanding the relative contribution of both sources of extracellular adenosine in the target tissue can aid in refining therapeutic approaches to induce more tissue-specific effects.  In addition, with a short half-life of less than 10 s (Moser et al., 1989), adenosine released from one site would likely induce physiological responses in the immediate proximity and not have any direct systemic effects.  This makes adenosine potentially suited for treating acute disorders in a localized manner. The adenosine receptors The physiological functions of adenosine signalling have been identified in various systems (Jacobson and Gao, 2006).  To date, there are four adenosine receptor subtypes identified based on their structural and functional properties: A1, A2A, A2B and A3 (Fredholm et al., 2001).  These G protein-coupled receptors (GPCRs) are distributed in various tissues throughout the body including the brain, the heart, the kidneys, the GI tract, the lungs, the liver and the pancreas in various species including humans (Fredholm et al., 2001).  Activation of adenosine receptors leads to signal amplification via various secondary messengers.  Most notable effects of adenosine are on the activity of adenylate cyclase and the subsequent production of cAMP (Fredholm et al., 2001).  Both A1 and A3 receptors are coupled to the Gi protein and once activated lead to the inhibition of adenylate cyclase activity and reduced levels of cAMP (Fredholm et al., 2001) (Figure 2).  Conversely, both A2A and A2B receptors are coupled to the Gs protein and their activation leads to increased adenylate cyclase activity and augmented levels of cAMP (Fredholm et al., 2001) (Figure 2).  Therefore, adenosine signalling may interact with other cAMP-dependent signalling pathways.  Furthermore, dimerization of adenosine receptors with other GPCRs, such as the purine P2Y receptor and the dopamine receptors, has been identified (Prinster et al., 2005; Franco et al., 2006).  The receptor dimer may display different properties than either monomer alone.  Adenosine receptors can also form homo- and heterodimers with other adenosine receptors (Franco et al., 2006).  The functional significance of these dimers is currently unknown but may increase stability and binding affinity to the ligand (Prinster et al., 2005). When assessing the contribution of a specific adenosine receptor subtype to the overall activity of adenosine, the relative binding affinity to adenosine is just as important as the receptor density and its distribution on a tissue.  The A1, A2A and A3 receptors can be activated by nanomolar concentrations of adenosine while A2B receptor activation requires micromolar 7 concentrations of adenosine (Fredholm, 2007).  Therefore, it is hypothesized that while A1, A2A and A3 receptors are activated during physiological conditions and may exhibit a basal tone of activity, A2B receptor-mediated effects may become more significant during pathological conditions  (Fredholm, 2007).  Although A1, A2A and A3 receptors share similar binding affinity to adenosine, receptor distribution is not uniform across the body (Fredholm et al., 2001) and therefore, the relative contribution of each subtype in different tissues needs to be independently analyzed.  Understanding the specific roles of an adenosine receptor subtype in a tissue has relied on pharmacological approaches using receptor-selective agonists and antagonists.  However, none of the adenosine analogues that currently exist are receptor-specific and at concentrations needed to elicit an effect, activation of other receptors may occur (Yaar et al., 2005).  Therefore, the use of tissue-specific and global knockouts of a specific adenosine receptor subtype in combination with pharmacological studies have been helpful in the recent years in clarifying established receptor-response relationships and identifying novel physiological functions of adenosine signalling (Yaar et al., 2005).  The studies in this thesis attempts to expand upon the current understanding on the role of adenosine signalling in the stomach and the pancreas.  Therefore, an overview on the relevant gastric and pancreatic endocrine functions currently established will first be discussed. 1.2 REGULATION OF GASTRIC ACID SECRETION Gastric acid  The stomach acts as the site of temporary food storage and allows a regulated amount of semi-digested nutrients to pass into the small intestine for further chemical and enzymatic digestion and nutrient absorption.  In humans, It can expand from an empty volume of approximately 50 ml up to 1000 ml following a meal (Sherwood, 2010).  Aside from being a site of storage, the stomach also churns rigorously for the physical digestion of food (Sherwood, 2010).  Furthermore, the stomach releases concentrated hydrochloric acid and digestive enzymes into the gastric lumen to continue the digestion of food particles eventually turning the ingested food into the semifluid chyme (Sherwood, 2010).  The pylorus located at the junction between the stomach and the small intestine regulates the rate of chyme released into the intestines and thereby regulate the rate of nutrient absorption into the systemic circulation (Sherwood, 2010). 8  The harsh environment of the gastric lumen serves not only to promote chemical digestion of food, but also to protect the host organism from ingested pathogens.  What protects the mucosal cells that line the gastric lumen from acidic and enzymatic damage is a thick mucus layer maintained by the goblet cells of the gastric wall (Sherwood, 2010).  However, this mucus layer could become overwhelmed if there is a deficiency in mucin secretion or an unregulated acid secretion (Schubert and Peura, 2008).  Not surprisingly, damage to the mucus layer can result in ulceration of the gastric lining and, if left untreated, can lead to excessive bleeding (Schubert and Peura, 2008).  Conversely, insufficient acid secretion by the stomach can lead to digestive problems including malabsorption of ingested nutrients and increase the chances of infections.  Therefore, gastric acid secretion from the parietal cells is tightly regulated by the parasympathetic nervous system and several gastric peptides (Schubert and Peura, 2008).  Most notable of these peptides are the acid secretagogue, gastrin, and the acid inhibitor, somatostatin. Gastrin It has been more than a century since the original identification of a stomach-released substance that stimulates gastric acid secretion (Edkins, 1905).  Since then, the importance of this gastric substance, gastrin, has been greatly acknowledged both in its role in regulating luminal pH and in various gastric diseases (Schubert and Peura, 2008).  Gastrin is released from G-cells in the antral mucosa of the stomach and in the duodenum.  Two major forms of gastrin exist in the circulation: a 34 amino acid peptide (big gastrin) and a 17 amino acid peptide (little gastrin) (Yalow and Berson, 1970; Rehfeld et al., 1974); although minor components including a 14 amino acid form (mini gastrin) have been identified (Gregory et al., 1979).  The gastrin receptor has been identified on parietal cells indicating a direct stimulatory effect on parietal cell acid secretion (Roche et al., 1991; Kopin et al., 1992).  Furthermore, gastrin has been shown to stimulate the release of the acid-secretagogue histamine from enterochromaffin-like cells (Waldum et al., 1991; Chuang et al., 1992), suggesting an alternative indirect signalling pathway of gastrin on acid secretion. Following meal ingestion, gastrin gene expression (Wu et al., 1991) and release (Mayer et al., 1974; Lee et al., 1976; Llanos et al., 1977; Feldman et al., 1978) are increased, thereby increasing gastric acid secretion (Feldman et al., 1978) that is needed for digestion.  In healthy individuals, this increase in gastric acidity results in a negative feedback loop that down- regulates gastrin release (Wu et al., 1990).  This feedback has been suggested to be secondary to 9 the inhibitory effects of another gastric peptide somatostatin (Phillip et al., 1977; Chiba et al., 1981; McIntosh et al., 1991). Somatostatin Somatostatin exists predominantly as either a 14 or a 28 amino acid polypeptide which has been found in virtually every organ throughout the body (Chiba and Yamada, 1994) including the stomach (Conlon, 1984).  Although somatostatin has various effects throughout the body via activation of somatostatin receptors, the low circulating concentrations of somatostatin suggest that the peptide may act mainly via paracrine signalling within a particular tissue rather than as a classic circulating endocrine hormone (Chiba and Yamada, 1994).  In the stomach, somatostatin is released from gastric mucosal D-cells and acts as the main inhibitor of gastric functions by decreasing gastric motility, acid secretion and the release of various gastric peptides (Chiba and Yamada, 1994).  This off-switch to the stomach may have important implications in gastroprotection under stressful or pathological conditions associated with increased acid secretion.  Therefore, efforts have been made to understand the mechanisms involved in the regulation of its secretion. The release of gastric somatostatin is increased by meal ingestion (Penman et al., 1981; Colturi et al., 1984) and a decrease in luminal pH (Gustavsson and Lundquist, 1978; Holst et al., 1983; Schubert et al., 1988).  It was found that hormonal factors such as gastric inhibitory polypeptide (glucose-dependent insulinotropic polypeptide; GIP) (McIntosh et al., 1981; McIntosh et al., 1983) and cholecystokinin (CCK) (Soll et al., 1985; Buchan et al., 1990) as well as neurotransmitters (Koop et al., 1980; McIntosh et al., 1981; Koop et al., 1982) regulate somatostatin release.  These findings suggest that gastric somatostatin may act as a consolidated inhibitory control on gastric functions. Adenosine on gastric acid secretion The involvement of adenosine signalling in the stomach was originally established from an observation that administration of the bronchodilator theophylline, clinically used to treat respiratory diseases, was associated with increases in gastric acid secretion (Krasnow and Grossman, 1949; Foster et al., 1979).  The mechanism was originally thought to be via phosphodiesterase inhibition leading to a rise in cAMP levels in acid-secreting parietal cells; however, the doses of theophylline clinically administered in humans are much lower than concentrations required to achieve significant inhibition on phosphodiesterase activity (Gerber et 10 al., 1985).  In addition, theophylline also acts as a potent adenosine receptor antagonist and can achieve significant antagonism at the doses usually administered in treatments of chronic obstructive pulmonary disease and asthma.  In fact, adenosine receptors were identified on acid- secreting parietal cells in various species forging a link between adenosine signalling in the stomach and the regulation of gastric acid secretion.   Later clinical studies found elevated levels of ADA in patients suffering from hypersecretion of gastric acid (Namiot et al., 1990; Namiot et al., 1991).  These observations warranted further investigations and led to discoveries of the involvement of adenosine signalling in regulating the release of other gastric peptides involved in acid regulation and other peripheral functions. Numerous studies have been done to characterize the adenosine signalling pathways involved in regulating gastric acid secretion.  In the early studies in dogs, Gerber et al. found that adenosine inhibited gastric acid secretion in vivo and inhibited acid secretion in isolated canine parietal cells (Gerber et al., 1984; Gerber et al., 1985; Gerber and Payne, 1988).  These studies suggested the existence of the inhibitory adenosine A1 receptors on the canine parietal cells such that activation by adenosine leads to inhibition of adenylate cyclase activity and a decrease in cAMP levels.  Such a direct effect of adenosine on acid secretion was also observed in parietal cells isolated from guinea pigs (Heldsinger et al., 1986) and rabbits (Ota et al., 1989).  While adenosine also inhibited acid secretion from parietal cells in guinea pigs (Heldsinger et al., 1986), it augmented acid secretion in rabbit parietal cells (Ota et al., 1989) suggesting the existence of stimulatory adenosine receptor subtypes, rather than the inhibitory A1 receptor, on rabbit parietal cells (Ota et al., 1989).  These findings demonstrate the species-variability in adenosine signalling and that the effect of adenosine depends on the local distribution of the particular adenosine receptor subtypes.  The pathways are further complicated by the observation that adenosine inhibited cholinergic stimulation of acid secretion in vivo (Gerber et al., 1984) but not in isolated parietal cells (Gerber et al., 1985) suggesting the potential involvement of other indirect pathways in which adenosine modulates gastric acid secretion. In addition to the direct action on canine parietal cells, adenosine has also been shown to inhibit the release of the acid-secretagogue gastrin from canine antral G-cells (Schepp et al., 1990).  Furthermore, while adenosine inhibits acid secretion in rats in vivo (Glavin et al., 1987), it has no effect on basal or histamine-stimulated acid secretion in rat parietal cells (Puurunen et al., 1987).  It was demonstrated that adenosine can abolish carbachol- and norepinephrine- stimulated gastrin release (DeSchryver-Kecskemeti et al., 1981; Harty et al., 1984).  Further 11 analysis using receptor-selective adenosine analogues showed that adenosine suppresses the release of gastrin in a concentration-dependent manner through the adenosine A1 receptor (Yip et al., 2004b).  In addition, the presence of A1 receptor immunoreactivity (IR) on mucosal G-cells suggest that the effects of adenosine on gastrin secretion may be mediated by a direct action (Yip et al., 2004b). Adenosine has also been shown to modulate somatostatin release in the perfused rat stomach in a concentration-dependent manner (Kwok et al., 1990).  When perfused at a concentration below 0.01 M, adenosine inhibited somatostatin release whereas perfusing a concentration of adenosine above 0.6 M augmented somatostatin release (Kwok et al., 1990). Furthermore, inhibiting the activity of ADA and thereby increasing endogenous adenosine activity caused an increase in somatostatin release, suggesting that the predominant effect of adenosine on D-cells is stimulatory (Yip and Kwok, 2004) and therefore adenosine may inhibit acid secretion through multiple pathways (Figure 3).  Further examination using receptor- selective agonists suggested that selective A1 receptor activation leads to inhibition of somatostatin release while selective A2A receptor activation leads to stimulation of somatostatin release (Yip and Kwok, 2004).  Immunohistological studies in the rat stomach revealed the presence of both A1 and A2A receptors on D-cells thereby suggesting a direct effect of adenosine on regulating somatostatin release.  These findings were supported by the studies involving A2A receptor-selective antagonists, which inhibited both basal and adenosine-induced somatostatin release (Yip and Kwok, 2004).  However, the A1 receptor-selective antagonist did not stimulate somatostatin release but instead had an inhibitory effect (Yip and Kwok, 2004).  These results were not expected and could be due to the non-specificity of the antagonist thereby causing inhibition of other stimulatory adenosine receptors.  This finding also exemplifies the limitations of using receptor-selective adenosine analogues alone in determining the roles of specific adenosine receptors and warrants further investigations using specific adenosine receptor knockout mice.  However, due to the species-specificity of adenosine signalling and the lack of previous studies examining adenosine signalling in the mouse stomach, it would be prudent to first establish this signalling pathway using wild type mice prior to the employment of knockout mouse models. 12  Figure 3 – Proposed adenosine signalling pathways involved in the regulation of gastric acid secretion. Adenosine can have a direct inhibitory effect on the acid-releasing parietal cells or act indirectly by inhibiting the release of the acid-secretagogue gastrin or by stimulating the release of the acid-inhibitor somatostatin.  Not all the pathways have equal weight in all species.  One discrepancy to this diagram is found in rabbits, where adenosine is found to stimulate, rather than inhibit, parietal cells (Ota et al., 1989). 1.3 GHRELIN Discovery of ghrelin  The discovery of the gastric hormone, ghrelin, was exciting in both fields of basic research and clinical medicine.  Its discovery involved a systematic search for the natural ligand 13 that binds the then orphan growth hormone secretagogue receptor (GHS-R) (Kojima et al., 1999). Synthetic ligands for this receptor have been generated due to their potential therapeutic actions in treating growth hormone (GH)-deficiency as well as for states of restricted growth that were not related to GH-deficiency such as Turner syndrome, intrauterine growth retardation and Prader-Willi syndrome (Kojima and Kangawa, 2005).  Although numerous synthetic ligands have been used to target GHS-R activation in the hypothalamus to induce growth hormone release, no natural ligand for this receptor was known (Kojima and Kangawa, 2005).  In 1999, Masayasu Kojima and colleagues used a biosensor to test the activity of various rat tissue extracts on activation of the rat GHS-R (Kojima et al., 1999).  Surprisingly, an endogenous ligand was identified in the stomach extract and upon purification was determined to be a 28 amino acid peptide with an octanoylated serine 3 (Kojima et al., 1999).  This peptide received the appropriate name of ghrelin for its ability to stimulate GH release („ghre‟ being the root word for „grow‟) (Kojima et al., 1999). The enzyme responsible for octanoylating ghrelin was identified by two independent research groups in 2008 and was named ghrelin o-acyltransferase (GOAT) (Gutierrez et al., 2008; Yang et al., 2008a).  As expected, the tissue expression of GOAT corresponds to that of ghrelin with highest levels detected in the stomach, intestines and the pancreas (Gutierrez et al., 2008; Yang et al., 2008a).  GOAT expression is subject to negative feedback regulation by acyl-ghrelin (Yang et al., 2008b) which could explain the relatively consistent ratio of circulating acyl-ghrelin (10-20%) to desacyl-ghrelin (80-90%) (van der Lely et al., 2004).  While it is speculated that desacyl-ghrelin has distinct physiological functions by acting on an unidentified receptor, only acyl-ghrelin is capable of activating GHS-R in various tissues and carrying out its effects (Matsumoto et al., 2001; Broglio et al., 2003a).  Since acyl-ghrelin was the first identified octanolyated protein in animals, it is likely to be the only substrate for GOAT (Gardiner and Bloom, 2008).  Therefore, pharmacological inhibition of GOAT could decrease circulating acyl- ghrelin levels with minimal side effects and prove to have therapeutic applications. Physiological functions of ghrelin  Upon its discovery, numerous actions of exogenous ghrelin were quickly identified. Aside from being a GH secretagogue (Arvat et al., 2000; Date et al., 2000b; Kamegai et al., 2000; Peino et al., 2000; Seoane et al., 2000; Takaya et al., 2000; Hataya et al., 2001; Tolle et al., 2001; Muller et al., 2002; Yamazaki et al., 2002), ghrelin also stimulates prolactin and adrenocorticotrophic hormone release (Nagaya et al., 2001a; Mozid et al., 2003), stimulates the 14 release of arginine vasopressin (Ishizaki et al., 2002; Mozid et al., 2003), stimulates acid secretion and motility (Masuda et al., 2000; Date et al., 2001), induces lipogenesis (Tschop et al., 2000; Choi et al., 2003), stimulates food intake (Wren et al., 2000; Asakawa et al., 2001; Kamegai et al., 2001; Nakazato et al., 2001; Shintani et al., 2001; Wren et al., 2001a; Wren et al., 2001b; Lawrence et al., 2002), increases cardiac output (Nagaya et al., 2001a; Nagaya et al., 2001b; Makino et al., 2002) and elicits vasodilatation (Okumura et al., 2002; Wiley and Davenport, 2002), promotes gluconeogenesis (Murata et al., 2002), promotes cell survival and proliferation (Baldanzi et al., 2002; Pettersson et al., 2002) and modulates pancreatic endocrine (Broglio et al., 2001; Adeghate and Parvez, 2002; Date et al., 2002; Egido et al., 2002; Arosio et al., 2003; Broglio et al., 2003b; Colombo et al., 2003) and exocrine secretions (Zhang et al., 2001) (Figure 4).  Of the various actions of ghrelin identified, its effect on stimulating appetite and lipogenesis received the most attention in the clinical field (Leite-Moreira and Soares, 2007). To date, ghrelin is the most potent orexigenic hormone identified and was therefore given the title of “the hunger hormone” (Higgins et al., 2007).  In line with its stimulatory effects on appetite, circulating ghrelin levels rise during fasting periods and fall following meal ingestion (Cummings et al., 2001; Toshinai et al., 2001; Tschop et al., 2001a).  Furthermore, higher levels of ghrelin are associated with weight loss (Hansen et al., 2002) leanness, anorexia nervosa (Otto et al., 2001) and bulimia (Otto et al., 2001; Tanaka et al., 2002), whereas lower levels of ghrelin are associated with weight gain (Otto et al., 2001), obesity (Tschop et al., 2001b; DelParigi et al., 2002), Prader-Willi syndrome (Cummings et al., 2002; DelParigi et al., 2002) and type 2 diabetes mellitus (T2DM) (Shiiya et al., 2002).  These observations suggest that regulation of ghrelin release is tied to the metabolic and energy state of the body.  In situations of energy shortage, ghrelin levels rise to stimulate food intake and fat storage whereas in situations of energy excess, ghrelin levels drop (Cummings et al., 2001).  Polymorphisms and mutations in the ghrelin gene have also been correlated with an increased susceptibility to weight gain (Ukkola et al., 2001; Korbonits et al., 2002), hypertension (Poykko et al., 2003) and the development of impaired glucose tolerance (Mager et al., 2006a; Mager et al., 2008) and T2DM (Poykko et al., 2003; Mager et al., 2006b).  The potential role of ghrelin in the etiology of eating disorders and metabolic diseases warranted further investigation on the therapeutic potential of modulating endogenous ghrelin levels (Peeters, 2006; Leite-Moreira and Soares, 2007). 15  Figure 4 - Physiological effects of ghrelin. The hormone, ghrelin, released from the stomach has various central and peripheral effects. Many of the effects of ghrelin, as outlined here, have important implication in metabolic diseases. Regulation of ghrelin release  The stomach and the intestines are the main sources of ghrelin release (Kojima and Kangawa, 2005).  The specific cell type responsible has been identified to be X/A-like cells in the rodents (Date et al., 2000a) and P/D1 cells in humans (Date et al., 2000a; Rindi et al., 2002). These cells exist as both open-type cells, coming in direct contact with the gastric and intestinal lumen and closed-type cells, not in direct contact with luminal contents (Sakata et al., 2002). 16 Furthermore, it was determined that the majority of cells in the stomach are of the closed-type whereas the proportion of open-type cells increases in the direction towards the lower intestinal tract (Sakata et al., 2002), suggesting a potential region-specific function of ghrelin-releasing cells.  The low abundance of open-type cells in the stomach suggests that the nutrient-inhibitory effect of ghrelin release may be mainly indirect involving other regulatory factors.  It was demonstrated that the ingestion of a mixed meal containing all three classes of macronutrients, carbohydrates, proteins and fat, inhibits ghrelin release (Cummings et al., 2001). However, the exact contribution of each macronutrient class and the signalling pathways involved in such regulation remain under debate.  An early study demonstrated that ingestion of a high carbohydrate meal will produce a greater decrease in circulating ghrelin levels than a high fat meal (Monteleone et al., 2003).  The authors also noted higher plasma glucose and insulin levels following ingestion of the carbohydrate meal supporting the idea that circulating glucose and insulin are important in the meal-induced inhibition on ghrelin release (McCowen et al., 2002; Briatore et al., 2003; Murdolo et al., 2003; Broglio et al., 2004; Kamegai et al., 2004; Overduin et al., 2005).  However, another study showed that intravenous glucose infusion is without effect while infusion of supraphysiological levels of insulin are required for significant inhibition of ghrelin release (Schaller et al., 2003) suggesting that other indirect pathways may be involved.  The contribution of CCK in meal-dependent regulation of ghrelin release has gained popularity.  It was demonstrated early on that gastrin has minimal effects on regulating ghrelin release (Dornonville de la Cour et al., 2001) and that glucose-induced suppression of ghrelin release requires nutrients entrance to the duodenum (Williams et al., 2003) thereby suggesting a potential intestinal regulatory pathway.  The suppression of ghrelin release upon ingestion of protein-rich meals (Teresa Vallejo-Cremades et al., 2005; Blom et al., 2006) and soybean trypsin inhibitor (Gomez et al., 2004), a CCK secretagogue, suggested the contribution of CCK in this meal-dependent inhibition.  A recent study by Al Massadi et al. demonstrated that direct application of L-glutamine and intralipid emulsions on an in vitro gastric explant model can produce inhibition of ghrelin release (Al Massadi et al., 2010).  Furthermore, somatostatin analogues have also been demonstrated to have prominent inhibitory effects on gastric ghrelin release (Broglio et al., 2002b; Shimada et al., 2003; Silva et al., 2005).  Another potential candidate involved in the regulation of ghrelin release is adenosine signalling.  The abundance of adenosine receptors in the stomach and its already established role in regulating the release of 17 other gastric peptides (Kwok et al., 1990; Yip and Kwok, 2004; Yip et al., 2004b) make adenosine a potential factor in regulating ghrelin release.  Given the potent effect of ghrelin in regulating energy homeostasis and correlations with various eating disorders and metabolic diseases, further understanding of how ghrelin release is regulated could lead to developments of new therapeutic treatments for various diseases including diabetes. 1.4 DIABETES AND THE ENDOCRINE PANCREAS Type 2 diabetes mellitus  Diabetes mellitus is a debilitating disease characterized by abnormal glucose homeostasis due to insufficient secretion and action of the hormone insulin, which is responsible for triggering cellular glucose uptake.  The most common form of this disease is T2DM, which accounts for approximately 90% of all diabetic cases.  T2DM is generally characterized by a decreased sensitivity to insulin in the body and the inability of the insulin-secreting pancreatic β- cells to compensate for this higher demand (Gavin et al., 2002; Spellman, 2007).  Therefore, most treatment regimens for T2DM are targeted at increasing β-cell secretion of insulin and at restoring insulin sensitivity in the body.  Even with the current therapies available, people with T2DM will not be able to manage meal-induced changes in blood glucose levels as tightly as healthy individuals and will face the consequences of this chronic hyperglycemia that leads to heart and kidney failures, blindness and other microvascular diseases ultimately resulting in an average reduced life expectancy of 10 years (Canadian Diabetes Association, 2011; World Health Organization, 2011).  Currently, an estimated 285 million people worldwide have diabetes and this number is on the constant rise with 7 million new cases each year (Canadian Diabetes Association, 2011).  Given the growing incidence and reduced lifestyle associated with this disease, the demand for new therapeutic approaches to stop or reverse disease progression, rather than delay, is more urgent than ever. Insulin  Upon its discovery and isolation by Drs. Frederick Banting, John Macleod, James Collip and Charles Best (Banting and Best, 1922; Banting et al., 1922), insulin was quickly recognized for its importance in carbohydrate metabolism and diabetes.  Following ingestion of a meal, gut- derived hormonal, neural and nutritional signals act in concert to stimulate insulin secretion from β-cells.  Insulin facilitates glucose uptake in the muscle, the fat and the liver promoting energy usage and storage.  When there is an insufficient action of insulin at these target tissues either 18 due to reduced sensitivity to insulin or a defect in insulin release, the body is unable to effectively clear the high levels of glucose in the blood and diabetes ensues.  Upon the development of the insulin radioimmunoassay (RIA) (Yalow and Berson, 1959), studies have quickly associated the incidence of insulin resistance with high plasma levels of insulin, thereby termed hyperinsulinemia (Perley and Kipnis, 1967; Bagdade et al., 1974).  Since then, numerous studies have examined the cause and effect relationship between systemic insulin resistance and β-cell secretory changes resulting in hyperinsulinemia.  While some studies suggested that insulin resistance is secondary to hyperinsulinemia (Juan et al., 1999), others have suggested that hyperinsulinemia is a compensatory mechanism to battle the decreased insulin sensitivity (Chalkley et al., 2002), and that T2DM only develops when the β-cells fail to secrete enough insulin to meet the demand.  In other cases, T2DM occurs in the absence of insulin resistance and results from intrinsic β-cell dysfunctions (Fajans, 1989).  Regardless of the sequence of events, insulin secretory failure is clearly an important marker in the etiology of T2DM.  The canonical pathway involved in the glucose-dependent insulin release from β-cells has led to the development of numerous anti-diabetic medications with many more still in trials (Bloom et al., 2008).  Circulating glucose is taken up into the β-cell via the glucose transporter, GLUT 1 (or GLUT 2 in rodents) (De Vos et al., 1995), and undergoes the canonical pathway to stimulate exocytosis of insulin granules (Figure 5).  Intracellular glucose undergoes glycolysis and oxidative phosphorylation to cause a rise in ATP and therefore an increase in the intracellular ATP to ADP ratio (ATP/ADP).  Such an increase in ATP/ADP is a key event in β- cell activation and exocytosis of insulin granules (Eliasson et al., 1997; Olsen et al., 2003) via closure of the ATP-sensitive K +  (KATP) channels causing membrane depolarization.  This change in membrane potential opens the L-type voltage-dependent Ca 2+  channels causing an influx of Ca 2+ , which is necessary for exocytosis of the insulin granules (Ammala et al., 1993b).  Granular exocytosis involves the interaction of various soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNARE) proteins located on both the insulin granule and β-cell plasma membranes (Eliasson et al., 2008).  The interaction of these SNARE proteins and subsequent fusion of the insulin granules occur in a Ca 2+ -dependent manner (Eliasson et al., 2008).  Therefore, any disruption in this intricate sequence of events could result in insulin secretory defects. 19  Figure 5 - Canonical and supplemental pathways of insulin release in β-cells The canonical pathway of glucose-dependent insulin release is outlined by red arrows while the cAMP-dependent supplemental pathways are outlined by yellow arrows.  Blue arrows indicate the potential involvement of ATP and adenosine in regulating the supplemental pathway of insulin release.  Effect of adenosine receptor activation on adenylate cyclase activity depends on the specific adenosine receptor subtype.  ADOR: adenosine receptor; cAMP: cyclic adenosine monophosphate; ATP: adenosine triphosphate; ADP: adenosine diphosphate; GLUT1/2: glucose transporter 1 or 2; KATP channel: ATP-sensitive potassium channel. Glucagon  Though insufficient insulin secretion was initially regarded as the hallmark for the progression of T2DM, more recent studies (Berelowitz and Eugene, 1996) have suggested various other factors to be involved, and accordingly T2DM is now accepted as a multihormonal disorder (Gavin et al., 2002; Spellman, 2007).  One such factor is the neighbor hormone to insulin, glucagon.  Glucagon is released by the pancreatic α-cells and is one of the most important counter-regulatory hormones that oppose the actions of insulin.  It facilitates glucose production by the liver through both glycogenolysis and gluconeogenesis resulting in increased plasma glucose levels (Unger and Orci, 1976).  These effects of glucagon become essential during fasting periods when an adequate plasma glucose level must be maintained for normal 20 brain functions.  Though hyperglycemia can lead to various complications in the long-term, severe hypoglycemia can acutely lead to coma or death.  Therefore, the proper functioning of the counter-regulatory response is essential for the health of an individual.  However, people with T2DM have abnormal glucagon secretions resulting in hyperglucagonemia during both fasting and fed states (Unger and Orci, 1976; Unger, 1978; Unger, 1985).  Such elevated glucagon secretions have been linked to the initiation and maintenance of hyperglycemia seen in T2DM (Jiang and Zhang, 2003).  Inhibition of glucagon activity alone in diabetic rats can alleviate hyperglycemia (Johnson et al., 1982) suggesting that the ratio of glucagon to insulin may be significant in the diabetic phenotype.  These findings have increased the interest in understanding the normal and pathological release kinetics of glucagon.  Like the β-cells, the glucagon-releasing α-cells also express GLUT 1 (Heimberg et al., 1995) and ATP-sensitive potassium channels (KATP channels) (Suzuki et al., 1997; Bokvist et al., 1999), and therefore respond to circulating glucose with a change in membrane potential. However, opposite to β-cells, α-cells are stimulated under low glucose conditions and inhibited in the presence of high glucose.  This differential response to glucose between α- and β-cells results from the expression of additional voltage-gated Na +  channels and the T-type voltage- dependent Ca 2+  channels in the α-cell plasma membrane (Gopel et al., 2000; Leung et al., 2006; MacDonald et al., 2007).  Furthermore, the KATP channels in the α-cells have lower activity under low glucose conditions than in the β-cells due to higher basal ATP/ADP (Detimary et al., 1998).  Under low glucose conditions, the T-type Ca 2+  channels are involved in the pacemaking of the α-cell activity inducing a transient depolarization that leads to the opening of the voltage- gated Na +  channels (Rorsman et al., 2008).  The rapid depolarization induced by the influx of Na +  activates the N-type and L-type Ca 2+  channels that participate in the fusion and exocytosis of glucagon granules (Rorsman et al., 2008).  Following a meal, glucose metabolism results in a further elevation in ATP levels and subsequent inhibition of the KATP channels (Rorsman et al., 2008).  This causes a steady membrane depolarization, which inactivates the Na +  channels leading to an inhibition of glucagon secretion (Rorsman et al., 2008). Temporal secretions of insulin and glucagon  Following ingestion of a carbohydrate meal, plasma insulin levels increase whereas glucagon levels decrease abruptly (Muller et al., 1970; Unger, 1971).  The decreased plasma glucagon levels do not return to basal until blood glucose and plasma insulin have returned to fasting levels (Muller et al., 1970; Unger, 1971).  The opposing effects of glucagon and insulin 21 on the regulation of glucose metabolism corresponds to the meal-dependent regulations in their inverse release, and a disruption in this regulation has been correlated with T2DM (Muller et al., 1970; Unger, 1971) and impaired glucose tolerance (Mitrakou et al., 1992). In the body, insulin and glucagon release follow specific temporal patterns.  It is well- established that insulin secretion following a glucose challenge exhibits a biphasic response with a 1 st  phase burst lasting about 10 minutes followed by a steady 2 nd  phase that is sustained during hyperglycemia (Curry et al., 1968).  Interestingly, patients with T2DM have a selective loss of the 1 st  phase insulin secretion that manifests early in the development of the disease (Weyer et al., 1999).  One explanation behind the biphasic secretion of insulin comes from the observation that secretory insulin granules exist in two distinct populations: 1) a readily releasable pool (RRP) of granules that are docked near a Ca 2+  channel and can rapidly respond to an influx of Ca 2+ , and 2) a reserve pool of granules that need to be physically translocated and chemically modified to be primed for release (Parsons et al., 1995).  The 1 st  phase insulin response can therefore be attributed to the rapid release of the RRP while the sustained 2 nd  phase response relies on the continuous priming of the granules in the reserve pool and their subsequent release.  Therefore, it is no surprise that a dissociation of insulin granules from the Ca 2+  channels and thereby a depletion of the RRP (Eliasson et al., 2008; Hoppa et al., 2009) or a defect in the priming of the reserve pool could result in secretory defects and disturbances in glucose homeostasis.  Such a spatial and functional separation in the secretory vesicle population have also been observed for α-cell glucagon granules (Barg, 2003) as well as a biphasic release of glucagon following stimulation with low glucose and arginine (Iversen, 1971; Oliver et al., 1976).  Aside from the biphasic pattern of insulin and glucagon release, secretions of these islet hormones also follow regular oscillatory patterns that can be most easily observed during the 2 nd  phase response.  Following stimulation, cytoplasmic Ca 2+  levels oscillate with a regular frequency that synchronizes with a pulsatile release of insulin and glucagon in β- and α-cells, respectively (Bergsten et al., 1994; Tuduri et al., 2008).  Such oscillations could serve to reduce receptor down-regulation on target tissues and prevent signal desensitization (Jiang and Zhang, 2003; Tengholm and Gylfe, 2009).  Intriguingly, the oscillatory release of insulin and glucagon are anti-synchronous (Hellman et al., 2009) further suggesting an intricate cross-talk between the two islet cells.  Pulsatile administrations of insulin and glucagon are also more effective than continuous infusions at regulating hepatic glucose metabolism suggesting the physiological importance of these oscillations (Bratusch-Marrain et al., 1986; Jiang and Zhang, 2003). 22 Furthermore, abnormal frequency and amplitude in the oscillatory release of insulin is found in individuals with T2DM (Lang et al., 1981; Matthews et al., 1983; Polonsky et al., 1988) and also relatives of people with T2DM that are genetically more susceptible to the disease (O'Rahilly et al., 1988).  Therefore, disturbances in these temporal patterns of insulin and glucagon secretion may be important determinants in the development of T2DM and understanding the factors governing their manifestation may elucidate novel therapeutic approaches in preventing or reversing the disease etiology.  One of these factors involves the intracellular messenger, cAMP. Cyclic adenosine monophosphate  The cAMP signalling pathway is critical in the supplemental pathway of insulin secretion from β-cells (Figure 5).  ATP is converted to cAMP by the enzyme adenylate cyclase, which is activated mainly by Gαs-coupled receptor agonists such as GIP, glucagon-like peptide-1 (GLP-1) and glucagon (Ahren, 2009).  Intriguingly, glucagon and GLP-1 administration in rat insulinoma cells induced oscillations in cAMP levels that are synchronized with cytoplasmic Ca 2+  oscillations, suggesting a potential role of cAMP in the generation of pulsatile insulin release (Dyachok et al., 2006).  Various mechanisms of action of cAMP have been proposed which are mainly mediated by the cAMP downstream effectors, protein kinase A (PKA) and exchange factor directly activated by cAMP 2 (Epac2).  PKA phosphorylates KATP channels (Holz et al., 1993; Gromada et al., 2004) and voltage-dependent Ca 2+  channels (Ammala et al., 1993a; Kanno et al., 1998) favoring depolarization and Ca 2+  influx.  Furthermore, PKA and Epac2 can activate inositol trisphosphate 3 receptors (Liu et al., 1996; Dyachok and Gylfe, 2004) and ryanodine receptors (Kang et al., 2005), respectively, on the endoplasmic reticulum to induce Ca 2+  release into the cytoplasm from the intracellular stores.  However, the main effects of cAMP on potentiating secretion are suggested to be exerted at the exocytotic machinery downstream of Ca 2+  influx (Renstrom et al., 1997).  PKA can phosphorylate many of the exocytosis-related proteins and has been deemed responsible for the priming of insulin granules in the 2 nd  phase secretion (Renstrom et al., 1997; Seino et al., 2009).  Conversely, Epac2 has been shown to act on the vesicular proteins Piccolo and Rim2, and thereby could be responsible in the rapid exocytosis seen in the 1 st  phase response (Renstrom et al., 1997; Eliasson et al., 2003; Holz et al., 2006).  Interestingly, forskolin, an activator of adenylate cyclase, can increase the intracellular cAMP levels in β- and α-cells causing an increase in insulin and glucagon secretion respectively (Hermansen, 1985).  Furthermore, the forskolin-mediated effects are glucose-dependent such that insulin potentiation occurs in the presence of high glucose and glucagon potentiation occurs 23 under low glucose conditions (Hermansen, 1985).  Modulators of the cAMP pathway could therefore affect glucose-sensitivity and secretory mechanics in the β- and α-cells and present as an interesting area that requires further investigation.  One of the potential modulators of the islet cAMP pathway involves the islet-produced purinergic signals. 1.5 CURRENT UNDERSTANDING ON THE ROLE OF ADENOSINE IN THE PANCREAS Sources of ATP and adenosine in the pancreatic islet  In the pancreas, since intracellular ATP levels are high, extracellular ATP can rapidly arise from transient or permanent damage of cell membrane during trauma.  In the pancreatic islets, ATP can also be released in a regulated manner from sympathetic and parasympathetic nerves as well as intrinsic nerves (Su et al., 1971; Burnstock et al., 1978; White and MacDonald, 1990; McConalogue and Furness, 1994).  Furthermore, ATP is also present in insulin-containing granules of the β-cells (Leitner et al., 1975; Detimary et al., 1995; Detimary et al., 1996; Hazama et al., 1998) and has been shown to be released following stimulation prior to the release of insulin (Obermuller et al., 2005).  These pathways could also lead to changes in extracellular adenosine levels in the islets.  Intriguingly, the fusion of insulin granules with the cell membrane has been described to be either complete exocytosis or of a kiss-and-run manner where granules fuse and open but close rapidly without completely emptying the contents (MacDonald et al., 2006).  Due to the much smaller size of ATP molecules compared to that of insulin, the formation of smaller kiss-and-run fusion pores would only allow ATP molecules to be released (MacDonald et al., 2006).  The frequency of the kiss-and-run events in β-cells is approximately 30% of all granule fusion in healthy individuals (MacDonald et al., 2005; MacDonald et al., 2006; Michael et al., 2006) but rises to much higher levels following long-term exposure to glucose (Tsuboi et al., 2006).  This could in part account for the decreased insulin secretion seen in T2DM but the particular implications of the potentially increased release of ATP, and subsequently increased levels of adenosine, in the absence of insulin secretion is not well understood. Purinergic signalling in the pancreatic islet  Aside from being an energy source and an intracellular secondary messenger for the KATP channel, ATP also acts as an extracellular signalling molecule in the pancreatic islets of Langerhans.  As early as the era when the purinergic signalling hypothesis was first formed, effects of ATP on the insulin-secreting β-cells were already observed (Rodriguez Candela and 24 Garcia-Fernandez, 1963; Levine et al., 1970; Loubatieres-Mariani et al., 1979).  Furthermore, ATP stimulated insulin secretion from isolated rat islets when administered at concentrations less than 1 µM, while it inhibited insulin secretion when administered at concentrations greater than 10 µM (Verspohl et al., 2002).  The stimulatory effect of ATP was demonstrated to be via direct receptor-dependent activity at various subtypes of the P2 receptor (Stam et al., 1996; Wang et al., 1996; Chapal et al., 1997; Petit et al., 1998; Fischer et al., 1999; Poulsen et al., 1999; Fernandez- Alvarez et al., 2001; Coutinho-Silva et al., 2003; Leon et al., 2005; Farret et al., 2006; Cheung et al., 2007; Coutinho-Silva et al., 2007; Lugo-Garcia et al., 2007), whereas the inhibitory effects following administration of higher levels of ATP is due to adenosine signalling following ATP breakdown (Verspohl et al., 2002).  Furthermore, the inhibitory effect of adenosine overrode the stimulatory effect of ATP when ATP was administered at concentrations above 10 µM (Verspohl et al., 2002).  This is important when considering that the local concentration of ATP at the extracellular surface of pancreatic β-cells is estimated to be greater than 25 µM following glucose stimulation (Hazama et al., 1998).  In addition, immunohistological staining in dispersed islet cells has identified adenosine A1 receptors on β- and α-cells as well as adenosine A2A receptors on α-cells (Tuduri et al., 2008).  Adenosine and A1 receptor agonists have been shown to inhibit insulin release in the perfused rat pancreas (Hillaire-Buys et al., 1987) and in INS-1 cells (Verspohl et al., 2002; Topfer et al., 2008).  Adenosine and adenosine analogues have also been shown to stimulate glucagon release in the perfused rat pancreas in a concentration- dependent manner (Chapal et al., 1985) and to potentiate arginine-induced glucagon secretion (Petrack et al., 1981).  Therefore, the hypothesis exists that the ATP released concurrently with insulin could act to stimulate further release of ATP and insulin; however, the eventual build-up of adenosine metabolized from extracellular ATP could act as feedback inhibition on the β-cells while stimulating glucagon release from the α-cells thereby contributing to the generation of the anti-synchronous pattern in the oscillatory release of insulin and glucagon (Novak, 2008). It has been long suggested that adenosine may be an important regulator of insulin release via its effects on adenylate cyclase (Ismail et al., 1977).  The A1R is coupled to the Gαi protein; therefore, receptor activation and G protein activation leads to a downstream inhibition of adenylate cyclase activity (Fredholm et al., 2001).  Conversely, the A2AR is coupled to the Gαs protein and activation leads to increased adenylate cyclase activity (Fredholm et al., 2001). Alterations in extracellular adenosine levels or changes in the expression or downstream signalling effects of these receptors in the islets could lead to changes in the intrinsic glucose- 25 sensitivity and secretory mechanics of β- and α-cells.  Furthermore, extra-pancreatic β-cell- regulatory factors including GIP and GLP-1 also act via the cAMP pathway (Holst, 2007; Ahren, 2009; McIntosh et al., 2009) and therefore, deviations from normal adenosine signalling in the islets could lead to a decreased potency of these incretin hormones and contribute to the abnormal glucose homeostasis in T2DM.  However, the exact physiological consequence of altered adenosine signalling in the pancreas awaits clarification. 1.6 THESIS INVESTIGATION  The physiological roles of adenosine signalling in the body are diverse and complex.  As such, pharmaceutical targeting of adenosine receptors remains an, albeit difficult, area of high interest (Jacobson and Gao, 2006).  Better understanding of the specific roles of adenosine in a particular tissue can aid in the search for a tissue-specific analogue with therapeutic applications. The focus of this thesis investigation is on the role of adenosine signalling in regulating the hormones that are involved in energy homeostasis.  From the ingestion of a meal, through digestion and absorption to the final glucose uptake for usage or storage, the body coordinates a set of hormonal signals to carry out the various tissue-specific processes.  As the local concentration of adenosine is closely tied to the metabolic states of nearby cells (Fredholm, 2007), it is conceivable that adenosine may be an underappreciated player in the energy homeostatic pathways, and may act as a primitive paracrine and autocrine signal in these systems.  Following food intake, the stomach churns and secretes pepsin and gastric acid for nutrient digestion (Sherwood, 2010).  As hypersecretion of acid can result in gastric ulcers, the amount of acid secretion is kept in check by somatostatin (Chiba and Yamada, 1994), which has been demonstrated to be under adenosine control using pharmacological studies in rats (Kwok et al., 1990).  Studies in Chapter 3 will further investigate this pathway in mice with the added benefit of specific receptor knockout models for A1 and A2A receptors.  The findings will complement existing pharmacological studies and furthermore, the novel isolated mouse stomach vascular perfusion model developed could be used to investigate the release of other gastric hormones.  As digested nutrients are absorbed, the stomach sends numerous neural and hormonal signals to the rest of the body to prepare for the incoming nutrients (Sherwood, 2010). One of these hormonal signals is the relatively novel gastric peptide, ghrelin.  Given the abundance of adenosine receptors in the stomach, adenosine signalling could also be involved in regulating ghrelin release.  This will be examined in detail in Chapter 4.   The incretin 26 hormones are also released following nutrient entry into different regions of the small intestine and can act on the pancreas to regulate insulin and glucagon release (Holst, 2007; McIntosh et al., 2009).  In the pancreatic islets, incretin signalling (Holst, 2007; McIntosh et al., 2009) and adenosine signalling (Novak, 2008) can both act on β- and α-cells via modulating intracellular adenylate cyclase activity and thereby regulate intracellular cAMP levels.  However, the significance of the interaction between these two pathways remains unclear.  Therefore, the studies in Chapter 5 will explore the effects of adenosine signalling on the effects of GLP-1 on inducing glucose-dependent insulin release.  Earlier studies have suggested that the adenosine A1 receptor in the pancreatic islet is involved in insulin secretion (Hillaire-Buys et al., 1987; Verspohl et al., 2002; Topfer et al., 2008) but the exact physiological significance of this mechanism is currently unknown.  Therefore, a series of in vivo and in situ experiments were performed as described in Chapter 6 to characterize glucose homeostasis and insulin and glucagon release in adenosine A1 receptor knockout mice (A1R -/- ).  27 CHAPTER 2 – METHODS  This chapter describes the general methods that were used to generate the results presented in the subsequent chapters.  This will include the details regarding experimental models, reagents purchased, reagent preparation, specific experimental procedures and data analysis.  More details regarding a procedure that is only used once will be given in the respective chapter. 2.1 ANIMALS Mice were treated in accordance with guidelines of the University of British Columbia (UBC) Committee on Animal Care.  Male mice, age 8-12 weeks (20-40 g) were used unless otherwise stated.  CD-1 mice were obtained from the UBC Animal Care Centre or Charles River Laboratories, Inc. (Wilmington, MA) and were used in the studies described in Chapters 3 and 4. C57Bl/6 mice were obtained from the UBC Animal Care Centre or The Jackson Laboratory (Bar Harbor, ME) and were used in the studies described in Chapters 5 and 6.  All mice were housed in temperature-controlled rooms (18-22C) with 12 hr light/dark cycles, and received a standard chow diet (#5015 from LabDiet, St. Louis, MO; calories provided by fat 25.3%, protein 19.8% and carbohydrate 54.9%), except when stated otherwise.  Daily monitoring of the mice was carried out by the staff in the animal facilities to check on animal health and to ensure that cages were kept clean with accessible food and water. Adenosine A1 receptor knockout mice  A1R -/-  mice were provided by Dr. B.B. Fredholm (Karolinska Institute, Stockholm, Sweden).  A phosphoglycerokinase-neo cassette was cloned into the exon of the A1R gene that allowed the generation of chimeric mice on a 129/OlaHsd background and then backcrossed with a C57BL/6 background (Johansson et al., 2001) for more than 10 generations before heterozygous breeding pairs were shipped to our laboratory.  Mice were bred in harem with pups weaned at 3 weeks of age.  Weaned mice were separated by sex and ear notch samples were digested in proteinase K solution (0.1 g/ml chelex, 0.1 g/ml proteinase K, 0.1% tween 20) for 15 min at 55C followed by 45 min at 95C.  Digested DNA samples were then stored at 4C until polymerase chain reactions (PCR) were performed to amplify the DNA product.  The primers used for PCR were as follows: 28 A1R forward 5‟ TACTTCAACTTCTTCGTCTGGGT A1R reverse 5‟ CTTGTGGATTCGGAAGGCATAGA Neo forward 5‟ GAACAAGATGGATTGCACGC Neo reverse 5‟ ACAACGTCGAGCACAGCTGC  PCR was carried out using standard reaction mix with Platinum Taq (Invitrogen, Carlsbad, CA; 3 l template plus 0.2 M of each primer, 1.5 mM MgCl2, 0.2 mM dNTPs, 1 x PCR buffer and 1 U Taq polymerase): 2 min at 94C; 35 cycles of 94C for 30 sec, 55C for 30 sec and 72C for 30 sec; and 72C for 10 min.  PCR products were then loaded into wells in a 1.5% agarose gel with loading dye and gel electrophoresis was performed.  Product sizes were compared to the 100 base pair DNA ladder (Invitrogen).  Wild type mice had a single band product at 350 bp, A1R -/-  mice had a single band product at 244 bp and A1R +/-  had both bands. Adenosine A2A receptor knockout mice A2AR -/-  mice were provided by Dr. J.-F. Chen (Boston University; Boston, MA) and Dr. M.A. Schwarzschild (Massachusetts General Hospital/Harvard University; Cambridge, MA). The 3‟ end of exon 2 was replaced with a phosphoglycerokinase-neo cassette to generate the mutant gene product, which was then implanted into 129/SvJae mice (Chen et al., 1999).  Mice were then backcrossed with C57BL/6 mice for more than 10 generation before being shipped to our laboratory.  Procedures for weaning and genotyping of A2AR -/-  mice were similar to those for A1R -/-  mice.  Wild type mice had a single band product of 166 bp, A2AR -/-  mice had a single band product at 244 bp and A2AR +/-  mice had both bands.  The primers used were as follows: A2AR forward 5‟ AGCCAGGGGTTACATCTGTG A2AR reverse 5‟ TACAGACAGCCTCGACATGTG Neo forward 5‟ GAACAAGATGGATTGCACGC Neo reverse 5‟ ACAACGTCGAGCACAGCTGC 2.2 IN VIVO ANALYSIS OF GLUCOSE METABOLISM Food and water intake tracking  Mice were individually caged in an enriched environment with a set amount of food and water at the start of the experiment.  Food intake was tracked every two days by weighing the amount of food left on the cage tops.  Food crumbs that had fallen into the cages were also weighed to minimize error in the measurements.  Water intake was tracked by recording the 29 changes in the weight of the water bottle every two days.  To account for the potential difference in the rate of water dispensing or leaking out from the bottle, the water bottles between experimental animals were interchanged every week. High fat diet study  Mice weaned at 3 weeks of age were placed on a normal chow diet (#D12450B from Research Diets Inc., New Brunswick, NJ; calories provided by fat 10%, protein 20% and carbohydrate 70%).  At 7 weeks of age, the mice were split into groups with matching weight, glucose tolerance and insulin sensitivity.  The control group continued to feed on a normal chow whereas the high fat diet group received a diet change (#D12451 from Research Diets Inc.; calories provided by fat 45%, protein 20% and carbohydrate 35%). Nutrient and hormone challenge tests  Oral and intraperitoneal (i.p.) glucose tolerance tests (OGTT and IPGTT) were performed following a 6 hr fast with 2 g/kg of glucose as reported previously to be the optimal conditions at differentiating between mice with normal and abnormal glucose tolerance (Andrikopoulos et al., 2008).  Mice were held by the scruff of their necks while glucose was introduced either orally with the tip of a gavage needle inserted down the esophagus to ensure entry of the entirety of the glucose solution, or via i.p. route by injection into the abdominal cavity.  In the same experiments, glucose-stimulated insulin secretion was also assessed.  Blood samples were collected from the saphenous vein at 0, 7, 15, 30, 60, 90 and 120 min following glucose administration.  For blood collection, mice were restrained in a 50 ml falcon tube with the bottom cut out.  Glucose levels were determined using the OneTouch Ultra glucometer (LifeScan Canada Ltd., Burnaby, BC).  Insulin tolerance tests were also performed following a 6 hr fast with an i.p. injection of 0.75 U/kg synthetic human insulin (Novo Nordisk, Toronto, ON) with blood glucose monitored at 0, 10, 20, 30, 60 and 120 min following injection.  i.p. arginine challenges were performed with an injection of 2 g/kg L-arginine followed by blood glucose monitoring at similar time points.  For an assessment of the glucose-induced changes in plasma glucagon levels, 2 g/kg i.p. glucose was administered following an overnight fast and blood samples were collected at 0 and 10 min following injection. 30 2.3 PREPARATION OF IN SITU VASCULARLY PERFUSED ISOLATED ORGAN SYSTEMS Surgical isolation of mouse stomach  A schematic setup of the isolated mouse stomach for vascular perfusion is shown in Figure 6.  Figure 6 - Isolated mouse stomach vascular perfusion setup. Mouse stomachs were isolated in situ by tying off vasculature branches from the aorta that supply other peripheral organs.  Perfusate and drugs were introduced via the aortic cannula and samples were collected from the portal vein cannula.  For the duration of the experiment, perfusate was continuously gassed with oxygen and maintained at 37°C. The surgical preparation of the in situ mouse stomach was modified from the rat stomach preparation, which has been previously described (Yip and Kwok, 2004).  Mice were deprived of food for at least 12 hr before they were anaesthetized with an i.p. injection (65 mg/kg) of sodium pentobarbital (Bimeda-MTC Animal Health Inc., Cambridge, ON).  A midline incision was made on the abdomen to expose the internal organs.  Vessels supplying the adrenal glands and kidneys and the superior mesenteric artery were tied off or cut between double ligatures.  The spleen and the pancreas were then carefully dissected away from the stomach.  A duodenal cannula was inserted past the pylorus to allow for drainage of gastric contents before the rest of the gut was removed.  An aortic cannula was inserted to allow for introduction of perfusate and a portal vein cannula was inserted for sample collection.  The vasculatures were cleared of blood with perfusion of saline containing heparin (300 U/ml; Sigma-Aldrich, St. Louis, MO) prior to introduction of perfusate.  Both the preparation and perfusate were kept at 37C by 31 thermostatically controlled units.  Following perfusion, the gastric tissue morphology was still intact and no major histological abnormality was observed (Figure 7).  Figure 7 - Hematoxylin and eosin stain of the vascularly perfused stomach. Comparison of stomach mucosal morphology of a freshly fixed stomach (A, D) to a post- perfusion stomach, fixed immediately after 1.5 hrs of perfusion (B, E) and a stomach that was fixed 1 hr after the animal was sacrificed (not perfused; C, F).  The mucosal region is shown.  At the lower magnification, the cytoplasm on the dead stomach appears to be lighter in color and less defined (C).  This typical swelling and blebbing is a sign of cellular necrosis.  At a higher magnification, this cytoplasmic blebbing is more apparent as indicated by the arrow (F). Swelling and cytoplasmic blebbing was not observed in the perfused stomach (B, E). Magnification were set at 160  (A, B, C) or 640  (D, E, F). Surgical isolation of mouse pancreas  The surgical isolation of the mouse pancreas has been previously described (Fujita et al., 2010) and is similar to the stomach isolation procedures with modifications.  Mice were anaesthetized with i.p. injections of xylazine (15 mg/kg; Bayer Inc., Toronto, ON) and ketamine (120 mg/kg; Bioniche Animal Health Canada Inc., Belleville, ON).  Following ligation of the vasculature supplying the kidneys and adrenal glands, the spleen and the stomach were removed. The superior mesenteric artery was left intact and the majority of the gut was removed.  The finished preparation contains a segment of the duodenum that is closely connected to the pancreas via a vascular network (Figure 8). 32  Figure 8 - Isolated mouse pancreas vascular perfusion preparation. Mouse pancreata were isolated in situ by tying off vasculatures branching from the aorta that supply other peripheral organs.  Perfusate and drugs were infused through the aortic cannula and samples were collected from the portal vein cannula.  For the duration of the experiment, perfusate was continuously gassed with oxygen and maintained at 37°C. Perfusate preparation  The preparation of perfusate has been previously described (Yip and Kwok, 2004).  The perfusate consisted of Krebs‟ solution (in mM: 120 NaCl, 4.4 KCl, 2.5 CaCl2, 1.2 MgSO4·7H2O, 1.5 KH2PO4, 25 NaHCO3 and 5.1 dextrose) containing 3% dextran (Clinical grade; Sigma- Aldrich) and 0.2% bovine serum albumin (RIA grade; Sigma-Aldrich).  The glucose concentration in the perfusate was altered in the perfused pancreas experiments as described below.  The perfusate was continuously gassed with 95% oxygen and 5% carbon dioxide and maintained at a pH of 7.4.  Perfusate was delivered into the stomach by a peristaltic pump at 1 ml/min.  For stomach perfusion experiments, 5 min samples were collected and 1000 KIU/ml aprotinin (Bayer Inc.) was added to each sample before storing them at -20C until assayed.  For pancreas perfusion experiments, 1 min samples were collected to improve resolution of the 33 changes in insulin secretion.  All drugs were infused via a side arm of the aortic cannula at a rate of 0.1 ml/min. For stomach perfusion experiments described in Chapters 3 and 4, the isolated stomachs were first perfused for 30 min prior to the start of sample collection to allow a steady basal state to establish.  For the pancreas perfusion study in Figure 49, perfusate containing different glucose and arginine concentrations was made to selectively stimulate either β-cell insulin secretion or α-cell glucagon secretion as demonstrated previously (Gerich et al., 1974). Specifically, perfusate containing 2 mM glucose and 10 mM arginine was used to stimulate glucagon secretion, while perfusate containing 20 mM glucose and 10 mM arginine was used to stimulate insulin secretion.  Prior to the start of sample collection, the pancreas preparations were perfused with perfusate containing 5 mM glucose for 30 min.  The different perfusate solutions were kept in separate flasks that were constantly stirred and oxygenated.  Switching between solutions was achieved by manually controlling a series of valves in the network of tubing.  For the pancreas perfusion studies presented in Chapter 5, perfusate containing 4.4 mM glucose was first perfused into the pancreas preparations for 30 min prior to switching to perfusate containing 16.67 mM glucose.  Sample collection started 10 min following 16.67 mM glucose infusion. Glucose entrainment  Introduction of an oscillating glucose concentration was achieved with a Standard Infuse/Withdraw PHD Ultra Syringe Pump (Harvard Apparatus, Holliston, MA).  Oscillating glucose levels between 6.3 mM and 7.7 mM were perfused into the isolated pancreas at 1 ml/min with a period of 10 min.  To ensure the perfusion pressure remained steady in the set up during the experiment, the pump speed was optimized for each preparation with the pressure monitored by a pressure transducer/signal amplifier that transmitted the signals to a computer via LabView 8.0 (National Instruments, Austin, TX).  The pressure readings were only monitored prior to the experiment for optimization of the pump speed. 2.4 EX VIVO PREPARATION OF MOUSE ISLETS Isolation and culturing of mouse islets  Islets were isolated using a protocol described previously with modifications (Wideman et al., 2006).  Mice were sacrificed followed by an intra-pancreatic ductal injection of collagenase XI (Sigma-Aldrich.; 1000 U/ml) dissolved in Hanks‟ balanced salt solution (HBSS; 34 in mM: 137 NaCl, 5.4 KCl, 4.2 NaH2PO4, 4.1 KH2PO4, 10 HEPES, 1 MgCl2 and 5 dextrose). The pancreas was dissected out and digested in collagenase in a 15 ml falcon tube placed in a shaking water bath at 37C for 13 min.  Following digestion, collagenase-free HBSS with 1 mM CaCl2 was added to the tube and the extract was centrifuged at 1000 rpm for 1 min.  The supernatant was then discarded and fresh collagenase-free HBSS was added to the tube to resuspend the extract.  The extract was then passed through a 100 m cell strainer (BD Biosciences Discovery Labware, Bedford, MA).  The filtrate was discarded and the filtered substances were washed into a petri dish with fresh collagenase-free HBSS.  Islets were then hand-picked and separated into groups of approximately 10 islets in 2 ml of RPMI 1640 culture media (Invitrogen) with 10% fetal bovine serum (Invitrogen), 100 U/ml penicillin and 100 μg/ml streptomycin in individual culture dishes with a cover slip at the bottom.  The culture dishes were incubated for 2 days at 37C in the CO2 incubator to allow islet adhesion to the cover slip. Calcium imaging  The protocol for Ca 2+  imaging in a perifusion chamber has been previously described (Luciani et al., 2007).  On the day of experimentation, islets were incubated in a final concentration of 5 M Fura-2, AM (Invitrogen) in RPMI media at 37C for 30 min prior to imaging.  Coverslips with adhered islets were then mounted onto an imaging chamber held at 37C on the Zeiss Axiovert 200 M inverted microscope (Carl Zeiss, Toronto, ON).  Islets were initially perifused at 1 ml/min with modified Ringer‟s solution containing (mM) 141 NaCl, 5.5 KCl, 20 HEPES, 1 MgCl2, 2 CaCl2 and 3 glucose adjusted to pH 7.4.  Fura-2 was excited at 340 nm and 380 nm by excitation filters (Chroma Technology, Rockingham, VT) in a Lambda DG-4 wavelength switcher (Sutter Instrument Company, Novato, CA) while the emission wavelength was set at 510 nm.  Measuring the ratio of the emissions at 340 nm and 380 nm of light allows accurate correlation with the amount of intracellular Ca 2+  and corrects for the gradual loss of signal due to photo bleaching and dye leakage (Figure 9).  The use of intact islets under 10 mM glucose allowed us to measure Ca 2+  oscillations in the -cells with paracrine signals from adjacent cells.    35  Figure 9 - Ratiometric analysis of calcium levels with a Fura-2 dye. The gradual loss of signal following excitation at 340 nm (A) and 380 nm (B) can be corrected by expressing the data as a ratio of the two measurements (C).  Islets were perifused with a steady 10 mM glucose Ringer‟s solution. 2.5 IMMUNOHISTOLOGICAL STAINING Paraffin sections  Animals were sacrificed and the stomach and the pancreas were dissected out.  The stomach was cut open along the greater curvature with the intragastric contents washed out with saline.  The tissues were fixed with 4% paraformaldehyde overnight at 4C.  The tissues were then placed in 70% ethanol and stored at 4C until sectioning.  The tissues were sent to Wax-it Histology Services (Vancouver, BC) and cut at 5 m sections.  Sections were dewaxed in a series of xylene washes followed by rehydration with 100%, 95% and 70% ethanol and phosphate buffered saline (PBS).  An antigen retrieval procedure was carried out by heating up the sections in citrate buffer at pH 6 in a microwave that was thermostatically controlled at 95C for 10 min.  The sections were then cooled down in running water followed by PBS.  Tissue sections were encircled with the Immunedge pen and incubated with the blocking buffer for 30 min.  Tissues were then incubated in primary antibody solutions in a humid chamber at 4C overnight.  The following day, the slides were washed in PBS for 3  10 min.  The secondary antibody solutions were then added to incubate the tissues for 1 hr in a humid chamber at room temperature.  The slides were then washed again in PBS for 3  10 min before mounting the coverslip with the DAPI hardset mounting medium (Vector Laboratories, Burlington, ON). Imaging was performed using an Axiovert 200 inverted fluorescent microscope (Carl Zeiss) connected to the Retiga 2000R camera (QImaging, Burnaby BC).  Openlab 5.0 software (Improvision, Lexington, MA) was used to analyze the images. 36 Hematoxylin & eosin staining  For the control experiment in Figure 7, paraffin sections were deparafinized and rehydrated through 5 min washes in xylene followed by 100%, 95% and 70% ethanol, PBS and water.  Slides were then incubated in hematoxylin (Gill‟s Formula; Vector Laboratories) for 3 min and then washed in water.  The slides were then dipped in acid rinse solution containing 2 ml glacial acetic acid and 98 ml distilled water before incubating in bluing solution (0.45% NH4OH in 70% ethanol) for 1 min.  The slides were dipped in water ten times before incubating in eosin (Eosin Y alcohol with phloxine; Sigma-Aldrich) for 1 min, followed by rinsing with water.  Finally, the slides were dehydrated by incubating for 2 min sequentially in 70%, 95% and 100% ethanol followed by xylene solution before mounting the glass cover slide with permanent mounting medium (Vector Laboratories). Floating sections  For floating section preparation, tissue sections were fixed overnight in 4% paraformaldehyde and then placed in 20% sucrose solution overnight.  The isolated tissues were then rapidly frozen with liquid nitrogen and sectioned (40 m) in a cryostat set at -25C. Following sectioning, the tissues were kept in PBS before being washed serially in 50 mM NH4Cl (30 min), 100 mM glycine (10 min) and 1% bovine serum albumin (60 min).  Sections were then incubated with the primary antibody solution for 72 hr at 4C and then the secondary antibody solution overnight at 4C before being mounted onto glass slides.  Imaging was performed using an Olympus Fluoview FV1000 confocal microscopy (Olympus, Tokyo, Japan). Antibodies  Specific primary and secondary antibodies used are listed in Table 1 and Table 2, respectively. Table 1 - List of primary antibodies used.  37 Table 2 - List of secondary antibodies used.  Specificities of the secondary antibodies were checked by incubating tissue sections with the secondary antibody alone to rule out non-specific binding.  The control staining for figure 24 was performed by pre-incubating A1 and ghrelin primary antibodies with the A1 receptor control peptide (sequence provided by Sigma-Aldrich and synthesized by Nucleic Acid Potein Service Unit, UBC) for 1 hr at room temperature prior to staining. 2.6 DRUGS  The following drugs were purchased from Sigma-Aldrich: adenosine hemisulfate salt, 2- chloro-N 6 -cyclopentyladenosine (CCPA), N 6 -cyclopentyladenosine  (CPA) 2-p-(2- carboxyethyl)phenethylamino-5‟N-ethylcarboxamidoadenosine hydrochloride (CGS 21680), 1- deoxy-1-[6-[[(3-iodophenyl) methyl] amino]-9H-purin-9-yl]-N-methyl--D-ribofuranuronamide (IB-MECA), 5‟N-ethylcarboxamidoadenosine (NECA), 8-cyclopentyl-1,3-dipropylxanthine (DPCPX), adenosine-5‟-O-(α, β-methylenediphosphate) (AOPCP), sodium nitroprusside and erythro-9-(2-hydroxy-3-nonyl)adenine hydrochloride (EHNA).  4-(2-[7-amino-2-(2- furyl)[1,2,4]triazolo[2,3-][1,3,5] triazin-5-ylamino]ethyl)phenol (ZM 241385) and 2-(2- Furanyl)-7-(2-phenylethyl)-7H-pyrazolo[4,3-e][1,2,4]triazolo[1,5-c]pyrimidin-5-amine (SCH 58261) were procured from Tocris Bioscience (Ellisville, MO).  Tetrodotoxin (TTX) with citrate was purchased from Alomone Labs Ltd. (Jerusalem, Israel).  Octreotide, and GLP-1 were purchased from American Peptides (Sunnyvale, CA).  Cyclo-somatostatin (C-SOM) was purchased from Bachem Americas (Torrance, CA).  Adenosine and nitroprusside were dissolved in saline, adenosine analogs were dissolved in small volumes of dimethyl sulfoxide (BDH, Toronto, ON) and TTX was dissolved in distilled water.  All drugs were then diluted with perfusate to achieve the desired infusion concentration and kept in a syringe that was controlled by a separate infusion pump.  During the periods of drug administration, the drug syringe was connected to the aortic cannula and thus mixed with the main flow of perfusate entering the stomach preparation.  The concentration of the drug solution and the rate of the drug infusion pump were calculated to achieve the desired final drug concentration that reached the stomach. 38 The final concentration of dimethyl sulfoxide in the perfusate was less than 0.5%, which has been shown not to alter gastric peptide release (Yip and Kwok, 2004).  Termination of drug infusion was achieved by disconnecting the drug solution syringe from the aortic cannula and stopping the drug infusion pump.  The affinity at the four different adenosine receptor subtypes of the agonists and antagonists used in the experiments described in this thesis are shown in Table 3. Table 3 - Affinity of adenosine receptor agonists and antagonists at the four adenosine receptor subtypes Data obtained from binding experiments with recombinant human adenosine receptor subtypes except for values indicated by star (*), which were obtained from cAMP functional assays (Jacobson, 1998; Klotz et al., 1998; Gao et al., 2003; Weiss et al., 2003; Yan et al., 2003; Moro et al., 2006).  Values denoted in bold red indicate a Ki value of the adenosine analogue that is ten times more selective for the receptor subtype in that column than the other three receptor subtypes.  Table extracted from a more complete list (Jacobson and Gao, 2006).  2.7 ASSAYS  The RIA used for the measurement of somatostatin-like IR has been described previously (McIntosh et al., 1987; Kwok et al., 1988; Kwok et al., 1990).  Tyr 1 -somatostatin labelled with radioactive 125 I was purified using a CM-cellulose 52 column and the fraction containing the highest radioactivity was used in the assay.  Monoclonal antibody SOMA-3 (UBC) and the purified label were then added to the samples.  The mixture were incubated for 72 hrs at 4°C.  A charcoal solution contained dextran T70 (Pharmacia, Uppsala, Sweden), decolorizing carbon (Fisher Scientific, Fair Lawn, NJ) and human hormone-free plasma (University of British 39 Columbia, Vancouver, BC) were added to trap unbound radioactive peptide.  After centrifuging and drying, the radioactivity in the charcoal pellet was measured.  The drugs used in the somatostatin studies do not cross-react with this antibody (Yip and Kwok, 2004).  Ghrelin levels were measured using a specific RIA kit (RK-031-31; Phoenix Pharmaceuticals Inc., Burlingame, CA) according to manufacturer‟s instructions.  This RIA kit detects total ghrelin content which includes the acylated and the non-acylated forms.  Insulin levels in perfusion samples were determined using a specific RIA kit (RI-13K; Millipore, Billerica, MA).  For plasma samples, insulin levels were determined using a specific enzyme- linked immunosorbent assay (ELISA) kit (80-INSMSU-E01; ALPCO, Salem, NH).  Glucagon levels were measured using a specific RIA kit (GL-32K; Millipore).  The biochemistry behind RIAs and ELISAs depends on antibody recognition of specific epitopes that are present on the peptides of interest.  The epitopes chosen have been selected against other commonly known peptides by manufacturers to limit non-specific binding. Furthermore, the studies presented here were focused on changes in peptide levels over time or between groups and therefore, for the sake of simplicity, levels of peptides determined by RIA and ELISA are labelled or referred to as the peptide itself rather than peptide IR (e.g. somatostatin instead of somatostatin-like IR). 2.8 DATA ANALYSIS  Data analysis was carried out using Prism 5.0 (Graphpad, La Jolla, CA).  Results are expressed as mean ± SEM for all the hormones measured.  For glucose entrainment studies examining autocorrelation coefficients, MATLAB 7.8 (MathWorks, Natick, MA) was used.  The autocorrelation analysis detects non-randomness or repetition in the dataset.  For all statistical analyses, p ≤ 0.05 is considered to be significant.  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001. For studies involving somatostatin and ghrelin release, results are expressed as a percentage of basal release and were calculated as follows: peptide release (%) = [peptide release during a 5 min period (pg/min)] ÷ [peptide released during the first 5 min (pg/min)]  100. When comparing the actions of different drugs and for analysis of the concentration-dependent response of specific drugs, results are expressed as percentage change, which was calculated as follows: peptide release (% change) = [(mean peptide release during drug perfusion periods – mean peptide release during basal periods) pg/min ÷ mean peptide release during basal periods 40 (pg/min)]  100.  For the pancreas perfusion studies in Chapter 5, the release of insulin and glucagon at specific time periods are normalized to the basal glucose alone periods: peptide release above glucose alone = [peptide release during the 1 min period] – [average peptide release per min during time 0-10 min]. Repeated measures analysis of variance (ANOVA) was performed for experiments examining percent peptide release during 5 min periods followed by the Dunnett‟s multiple comparison test.  This post-hoc test compares each experimental period with the control period immediately before drug administration.  One-way ANOVA was performed where percentage changes of peptide release under different treatment conditions were compared.  Means were compared using Tukey‟s pair-wise multiple comparison test when a significant F-value was detected.  For in vivo studies examining plasma glucose, insulin and glucagon levels between two different groups of animals, two-way ANOVA was performed with Bonferroni post-test. Comparisons of summarized drug effects were performed by two-tailed student‟s t-tests.  41 CHAPTER  3  –  EFFECT  OF  ADENOSINE  ON THE REGULATION  OF  SOMATOSTATIN  RELEASE 1   Somatostatin released from the stomach serves as the main inhibitor for gastric functions, acting as the negative regulator of gastric acid and pepsin secretion and as the brake on gastric motility and emptying (Chiba and Yamada, 1994).  Previous studies have shown that adenosine stimulates somatostatin release concentration-dependently in the perfused rat stomach (Kwok et al., 1990).  In addition, immunohistological studies in the rat stomach have suggested that both the A1 and the A2A receptors are found on somatostatin-releasing mucosal D-cells and on somatostatin-positive neurons in the myenteric plexus (Yip and Kwok, 2004; Yip et al., 2004b). Pharmacological studies have demonstrated opposite roles of the A1 and A2A receptors in the rat stomach with A1-selective activation leading to inhibition and A2A-selective activation leading to stimulation of somatostatin release (Yip and Kwok, 2004).  Preferential activation of the A1 or the A2A receptor depended on the concentration of adenosine administered.  Therefore, local changes in adenosine concentration during different meal states in vivo could then have different effects on somatostatin release.  These previous studies have been performed in the rat stomach using the vascular stomach perfusion model (Kwok et al., 1990; Yip and Kwok, 2004; Yip et al., 2004b).  Evidence on specific receptor involvement has relied on the use of receptor-selective agonist and antagonists.  As such, results obtained with the use of certain adenosine analogues may be masked by their non-specificity on other receptors.  For example, although the A1 receptor- selective agonist, CPA, produced an inhibition of somatostatin release at 0.1 µM, it stimulated somatostatin release when perfused at 1.0 µM (Yip and Kwok, 2004).  Furthermore, blockade of the inhibitory A1 receptor with the selective antagonist DPCPX, also inhibited somatostatin release (Yip and Kwok, 2004).  These results could be attributed to the A1 receptor-selective analogues also binding to other subtypes of adenosine receptors at the concentrations infused and therefore clouds the strength of the conclusion on the involvement of specific adenosine receptor subtypes.  Further investigations using specific adenosine receptor knockout animals are warranted to supplement these earlier findings.  1  A portion of Chapter 3 has been published. Yang GK, Chen JF, Kieffer TJ and Kwok YN (2009) Regulation of somatostatin release by adenosine in the mouse stomach. J Pharmacol Exp Ther 329:729-737. 42  The use of knockout animals has been beneficial in strengthening the understanding of the role of a specific adenosine receptor in a particular system (Yaar et al., 2005).  The isolated vascular organ perfusion model allows for detailed examination of a particular tissue without external hormonal or neural inputs.  Together, the knockout mice and the perfusion model provide a delicate and well-controlled method for the investigation of the roles of A1 and A2A receptors on the regulation of somatostatin release from the stomach.  Since the availability of adenosine receptor knockout animals are restricted to mice, it would be crucial to first develop a novel vascular stomach perfusion preparation that is suitable by modeling after the rat preparation.  In addition, the actions of adenosine in the stomach have been shown to vary among species.  Therefore, studies in this chapter investigated the role of adenosine on somatostatin release in the mouse stomach first by using pharmacological studies on wild type animals before using the receptor knockout animal models. 3.1 EFFECT OF ADENOSINE ANALOGUES ON SOMATOSTATIN RELEASE Basal somatostatin release from the perfused mouse stomach To determine the amount of somatostatin released from the vascular perfusion of the isolated mouse stomach, 5 min samples were collected following a 30 min equilibration period. In the four mice tested, the individual rate of somatostatin release were 121 ± 4, 185 ± 9, 235 ± 6 and 299 ± 6 pg/min.  Although there were inter-individual variations in the release rate under the basal state, the release of somatostatin of each mouse was relatively constant throughout the 50 min experimental period (Figure 10A).  Therefore, subsequent results are expressed as a percentage of somatostatin release obtained during the basal period. Effect of adenosine on gastric somatostatin release  To examine the effect of adenosine on somatostatin release, various concentrations of adenosine (0.01 – 10 µM) were perfused into the stomach preparation.  Perfusion of 0.01 µM adenosine inhibited somatostatin release promptly and this inhibition persisted for 10 min after drug infusion had stopped (Figure 10B).  Perfusion of 0.1 µM adenosine did not significantly alter somatostatin release (Figure 10C) while both 1.0 µM and 10 µM adenosine caused a significant stimulation of somatostatin release (Figure 10D, E).  Taken together, adenosine exhibited a concentration-dependent effect on somatostatin release in the mouse stomach (Figure 10F): an inhibitory effect at a lower concentration and stimulatory effect at higher concentrations. This observation is similar to previous findings in the rat stomach (Yip and Kwok, 2004) 43 suggesting the possible involvement of A1 and A2A receptors in the mouse stomach, as previously demonstrated in the rat stomach (Yip and Kwok, 2004).  Figure 10 - Effect of adenosine on somatostatin release in the vascularly perfused isolated mouse stomach. (A) Basal release of somatostatin.  Effect of 0.01 μM (B), 0.1 μM (C), 1.0 μM (D) and 10 μM (E) adenosine (Ado) on somatostatin release.  (F) Concentration-dependent action of adenosine on somatostatin release (F).  n ≥ 4.  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when compared to basal levels. Effect of selective adenosine agonists on gastric somatostatin release To examine the specific adenosine receptors involved in the actions of adenosine on somatostatin release, the effect of A1-selective (CPA and CCPA), A2A-selective (CGS 21680), and A3-selective (IB-MECA) agonists were examined.  Perfusion of CPA and CCPA at 0.1 µM inhibited somatostatin release immediately (Figure 11A, B); however, perfusion of 1.0 µM CCPA (Figure 11C) stimulated somatostatin release.  A similar effect of A1 agonists was also observed previously in the rat stomach (Yip and Kwok, 2004) suggesting that it could be due to non-specific activation of other adenosine receptor subtypes at a higher concentration of CCPA. Perfusion of 0.1 µM IB-MECA (Figure 11D) had a delayed inhibitory effect on somatostatin release whereas 1.0 µM IB-MECA (Figure 11E) did not significantly alter the release of somatostatin.  This effect is comparable to the previously observed effects in the rat stomach (Yip and Kwok, 2004) and could be attributed to an accumulative effect of IB-MECA in the local tissue that also acts in a non-specific manner on the A1 receptor and therefore producing the 44 delayed response.  However, at 1.0 µM, IB-MECA may activate both the inhibitory A1 and the stimulatory A2A receptors and therefore have no net influence on somatostatin release.  A summary of the effects of A1 and A3 agonists are shown in Figure 11F.  Figure 11 - Effect of adenosine A1 and A3 agonists on gastric somatostatin release. Somatostatin release following administration of A1 agonists CPA (A) and CCPA (B, C). Somatostatin release following administration of the A3 agonist at 0.1 μM (D) and at 1.0 μM (E). (F) Summary of the drug effects by comparing somatostatin release during drug perfusion periods to basal levels.  n ≥ 4.  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when compared to basal levels. Perfusion of CGS 21680 (0.001 – 10 µM) produced a concentration-dependent increase in somatostatin release (Figure 12), suggesting that A2A receptor activation is involved in the stimulation with higher concentrations of adenosine (≥ 1 µM).  Since A2A receptor activation in the vasculature is associated with vasodilation and could therefore lead to a greater flow rate, it would be important to determine whether the increase in somatostatin release rate is secondary to the vasodilation effect.  To investigate this possibility, the vasodilator, nitroprusside (1.0 µM) was perfused.  This concentration of nitroprusside has been shown previously to induce a greater drop in perfusion pressure than 1.0 µM CGS 21680 (Yip and Kwok, 2004).  Perfusion of this vasodilator did not significantly alter the release of somatostatin with the percentage change of release being 4 ± 11%.  Taken together, results from the previous (Yip and Kwok, 2004) and present studies suggest a similar contribution of A1 and A2A receptor signalling on the regulation of somatostatin release in both rat and mouse stomachs. 45  Figure 12 - Effect of the adenosine A2A agonist on gastric somatostatin release. Effect of the A2A agonist CGS 21680 (CGS) at 0.001 μM (A), 0.01 μM (B), 0.1 μM (C), 1.0 μM (D) and 10 μM (E) on somatostatin release.  (F) Concentration-dependent effect of CGS 21680. n ≥ 5.  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when compared to basal levels. Effect of adenosine antagonists on adenosine-induced somatostatin release  To further establish the role of adenosine A1 and A2A receptors on regulating gastric somatostatin release, the effect of the receptor-selective antagonists were studied.  Perfusion of the A1 receptor-selective antagonist, DPCPX, alone caused an inhibition in somatostatin release (Figure 13A).  This is counterintuitive since A1 receptor activation results in inhibition of somatostatin release and therefore blockade of the A1 receptor should have a net stimulatory effect.  This discrepancy was also observed previously in the rat stomach (Yip and Kwok, 2004) and could be attributed to the drug having non-specific activity on other receptor subtypes.  As expected, DPCPX did not block the stimulatory effect of 10 µM adenosine (Figure 13B) since the evidence from the agonist studies suggest that A2A receptor activation is involved at this concentration of adenosine.  One would expect that if A1 receptor activation inhibits somatostatin release, then somatostatin release in the presence of adenosine would be enhanced once the A1 receptor-mediated inhibitory pathway is removed.  However, this is not the case (Figure 13E).  It is possible that the concentration of adenosine used had maximally stimulated somatostatin release; hence, blocking the inhibitory A1 receptors might not further augment somatostatin release.  In addition, a previous study on rat striatal synaptosomes has shown that stimulation of the A2A receptor caused desensitization of the coexpressed A1 receptor (Dixon et 46 al., 1997).  Therefore the activation of the A2A receptor in the presence of this high concentration of adenosine might have induced changes in the A1 receptor signalling pathway; as such, the addition of the A1 receptor antagonist, DPCPX would not further augment somatostatin release. In addition, the possibility of non-specific effects of DPCPX cannot be ruled out.  Figure 13 - Effect of adenosine A1 and A2A antagonist on gastric somatostatin release. Effect of the A1 antagonist DPCPX in the absence (A) and presence (B) of adenosine (Ado). Effect of the A2A antagonist ZM 241385 (ZM) in the absence (C) and presence (D) of adenosine. (E) Summary of the drug effects by comparing somatostatin release during drug perfusion periods to basal levels.  n ≥ 4.  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when compared to basal levels. Perfusion of the A2A receptor-selective antagonist, ZM 241385, caused an inhibition of somatostatin release (Figure 13C).  This observation suggests that the A2A receptor may exert a tonic action on the basal release of somatostatin such that when A2A receptors are blocked, somatostatin release decreases.  This result also suggests that the inhibitory effect of DPCPX perfusion alone could also be attributed to non-specific inhibition of the A2A receptor. Furthermore, ZM 241385 also abolished the adenosine-induced somatostatin release (Figure 13D), thereby adding further support to the notion that A2A receptor activation is required for the stimulatory actions of adenosine. 47 3.2 DISTRIBUTION OF ADENOSINE RECEPTORS AND SOMATOSTATIN IN THE MOUSE STOMACH  To determine the distribution of adenosine receptors and somatostatin in the mouse stomach, immunohistological staining was performed with antibodies targeting against A1 and A2A receptors as well as against somatostatin (Figure 14).  Somatostatin IR was identified in both the gastric mucosa and the myenteric plexus.  Co-staining with A1 and A2A receptor antibodies revealed that neither A1 nor A2A IR co-localized on the same cells in the gastric mucosa as somatostatin IR.  Furthermore, A2A receptor IR was not found in the gastric mucosa.  However, both A1 and A2A IR were identified on somatostatin IR neurons in the myenteric plexus (Figure 14).  This is in contrast with previous studies in the rat stomach that found co-localization of A1 and A2A IR with somatostatin IR in both the gastric mucosa and in the myenteric plexus (Yip and Kwok, 2004), thus further illustrating the potential differences in adenosine signalling between species.  In addition, this observation suggests that the effects of adenosine on somatostatin release in the mouse stomach may be mainly acting through a neural component. 48  Figure 14 - Confocal images showing immunohistological staining of somatostatin, A1R and A2AR in the mouse corpus mucosa and muscular layers. Representative images (n ≥ 3) of co-staining of somatostatin with A1 receptor in the corpus mucosa (A, B, C) and the corpus muscle layer (D, E, F).  Co-staining of somatostatin with A2A receptor in the corpus mucosa (G, H, I) and the corpus muscle layer (J, K, L).  Co-localization is shown in the merged images as yellow.  CM, circular muscle; LM, longitudinal muscle. 49 3.3 EFFECT OF ADENOSINE ON SOMATOSTATIN RELEASE IN A1R -/-  AND A2AR -/- MICE Effect of adenosine analogues on somatostatin release in A1R -/-  and A2AR -/-  mice Based on the evidence from both immunohistological studies and pharmacological studies using receptor-selective agonists and antagonists, it is proposed that in the mouse stomach, adenosine can regulate somatostatin release by differential activation of either the inhibitory A1 or the stimulatory A2A receptor.  To further establish the roles of these two receptors, specific A1 and A2A receptor knockout animals were used.  Numerous physiological pathways of adenosine had been identified or confirmed with the use of these knockout animals (Yaar et al., 2005).  Both knockout models appear to have normal breeding and do not show any obvious signs of behavioural abnormality.  However, no studies have been done to examine their gastric functions and specifically, how the regulation of gastric somatostatin may be altered. Intriguingly, the basal somatostatin release as determined by vascular perfusion in the isolated organ was significantly higher in A1R -/-  mice (339 ± 49 pg/min; n = 5) when compared to the wild type counterparts (71 ± 23 pg/min; n = 5).  This suggests that alterations in the expression and distribution of adenosine receptors in the stomach may have physiological consequences on the basal release of somatostatin, which may then have further implications on the gastric function of these animals.  Conversely, basal somatostatin release in A2AR -/-  mice (72 ± 8 pg/min; n = 5) was not significantly different from wild type levels.  To determine the effects of adenosine in these receptor-knockout models, 10 µM adenosine was perfused into the isolated stomach.  Interestingly, adenosine inhibited somatostatin release in A2AR -/-  mice (Figure 15B) and the release rate returned to basal levels following termination of drug infusion.  This is in contrast with the stimulatory effect observed in both wild type (Figure 15A) and A1R -/-  mice (Figure 15C).  These results support the proposal that A2A receptor activation is required for the stimulatory effect of adenosine.  The A1 receptor- selective antagonist, DPCPX, did not block the stimulatory effect of adenosine in the wild type controls (Figure 15D) but it abolished the adenosine-induced inhibition of somatostatin release in A2AR -/-  mice (Figure 15E).  Results of the knockout animal studies are summarized in Figure 15F. Thus, it is likely that in the absence of the A2A receptor, only the inhibitory effect of the A1 receptor on somatostatin release is apparent.  These observations not only support the idea that A1 receptor activation is required for the inhibitory effect of adenosine but also suggest that the 50 involvement of A2B and A3 receptors are minimal in the purinergic control of gastric somatostatin release.  Figure 15 - Effect of adenosine on somatostatin release in wild type, A1R -/-  and A2AR -/-  mice. Effect of adenosine (Ado) on somatostatin release in wild type (A; black), A2AR -/-  mice (B; blue) and A1R -/-  mice (C; red).  Effect of the A1 antagonist DPCPX on adenosine-induced somatostatin release in wild type but  not cause a significant change in somatostatin release in the presence of adenosine in wild type (D) and A2AR -/-  mice (E).  (F) Summary of the drug effects by comparing somatostatin release during drug perfusion periods to basal levels.  n ≥ 4.  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when compared to basal levels; †p ≤ 0.05 for comparison as indicated by the bar. Effect of endogenous adenosine on somatostatin release To determine the role of endogenous adenosine on regulating gastric somatostatin release in the mouse stomach, the effect of the ADA inhibitor, EHNA, was examined.  Since ADA is important for the breakdown of adenosine, blocking this enzyme should cause an accumulation of endogenously released adenosine.  In wild type mice, EHNA caused an increase in somatostatin release and this effect could be blocked by ZM 241385 (Figure 16A, B), suggesting that the predominant role of endogenously released adenosine on somatostatin is stimulatory via the A2A receptor.  This notion is also supported by the use of knockout animals where EHNA did not cause a significant increase of somatostatin release in A2AR -/-  mice (Figure 16C).  It is surprising that EHNA did not cause an inhibition of somatostatin release in A2AR -/-  since it is expected that in the absence of A2A receptors, the effect of the inhibitory A1 receptors would be unmasked.  The adenosine concentration in the stomach after EHNA perfusion was not 51 determined.  Therefore, it is possible that the extracellular concentration of adenosine that accumulated in the presence of EHNA was not sufficient to activate the A1 receptor.  Figure 16 - Effect of EHNA on gastric somatostatin release. Effect of the adenosine deaminase inhibitor EHNA on somatostatin release in the absence (A) and presence (B) of the A2A antagonist ZM 241385 (ZM) in wild type mice (black).  Perfusion of EHNA in A2AR -/-  mice (C; blue).  Effect of the CD73 inhibitor AOPCP on somatostatin release. n ≥ 4.  *p ≤ 0.05 when compared to basal levels. To examine the consequence of inhibiting extracellular synthesis of adenosine, the ecto- 5‟-nucleotidase blocker, AOPCP, was administered.  Interestingly, AOPCP did not induce a significant change in somatostatin release (Figure 16D).  This does not necessarily mean that there is no tonic control of somatostatin release by adenosine.  Instead, this might demonstrate that when considering somatostatin release, the source of extracellular adenosine may be mainly contributed by cellular release through transporters rather than from the breakdown of adenine nucleotides.  The proportional contribution from these two sources of adenosine can vary between cell types and therefore further investigation in the mouse stomach using inhibitors of the nucleoside transporters and ATP metabolism would be required. 3.4 CHAPTER SUMMARY  The stomach releases various regulatory peptides that are important in coordinating metabolism in both digestive and interdigestive periods.  One potential mechanism involved in 52 controlling the release of these regulatory peptides is adenosine signalling because adenosine is known to modulate various physiological responses, and its extracellular concentration could be elevated during cellular metabolism.  For the purpose of investigating the purinergic control of somatostatin release in the mouse stomach, a novel isolated mouse stomach vascular perfusion model was developed.  Studies in this chapter have demonstrated the validity of this preparation and it can therefore become a useful model with numerous applications when examining the various factors involved in the release of gastric peptides.  In this chapter, it was demonstrated that adenosine augments somatostatin release when perfused at a concentration higher than 1.0 µM, and this is dependent on the activation of A2A receptors.  Conversely, perfusing a concentration of adenosine lower than 0.1 µM induces an inhibitory effect on somatostatin release and this is likely dependent on the activation of A1 receptors.  These findings were supported by pharmacological studies paired with the use of specific receptor-knockout animals.  Immunohistological evidence also suggested that neural elements are involved in this adenosine signalling pathway.  The receptor knockout animals used in this study were devoid of the particular receptor throughout development in all tissues.  It is possible that in these animals, compensatory or other changes might have taken place in the stomach.  Heterodimers of adenosine A1 or A2A receptors with other GPCRs have been reported in numerous cell types (Prinster et al., 2005; Franco et al., 2006).  These heterodimeric complexes could alter the binding affinity of A1 and A2A receptors to adenosine and also affect the intracellular signalling mechanisms.  It is unknown whether these heterodimeric receptors exist in the mouse stomach and whether changes of these receptors occur in A1R -/-  and A2AR -/-  mice.  Nonetheless, these studies support the notion of a tonic release of adenosine in the stomach that may be physiologically significant in regulating the release of somatostatin.  Furthermore, these studies imply that the principal action of adenosine on somatostatin release is stimulatory in nature.  With increased gastric activity and increased cellular metabolism during feeding, local adenosine levels in the stomach may be elevated.  Conversely, during fasting or starvation, the level of adenosine may be lowered.  Furthermore, omeprazole-induced achlorhydria has been shown to reduce the expressions of A1 and A2A receptor genes in the perfused rat stomach (Yip et al., 2004a).  Therefore, the adenosine signalling pathway may be a link between prandial and postprandial state and somatostatin release.  The presence of adenosine receptors on various cells 53 in the gastric mucosa and neural elements in the muscular layers suggests that adenosine may also play an important role in modulating the release of other gastric regulatory peptides in a meal-dependent manner.  The next chapter explores the involvement of adenosine signalling in the regulation of one of the newest gastric hormones identified, ghrelin.  54 CHAPTER  4  –  EFFECT  OF  ADENOSINE  ON THE REGULATION  OF  GHRELIN  RELEASE 2   The excitement that came with the discovery of ghrelin lies within the potent orexigenic and lipogenic actions of this gastric peptide.  A previous study revealed that ghrelin knockout mice tend to have higher percentage of lean body mass and a lower percentage of body fat following a high fat diet compared to wild type controls (Wortley et al., 2004).  These findings suggest the potential of using ghrelin antagonists in the treatment of weight gain, obesity and diabetes especially in the context of a high fat diet.  Therefore, further understanding of how ghrelin levels are regulated or more specifically, how the release of ghrelin from the stomach can be modulated, could encourage further strides towards novel therapeutic options for metabolic diseases.  A link between adenosine and ghrelin was initially suggested by studies indicating that adenosine can act directly on ghrelin receptors (Smith et al., 2000; Carreira et al., 2004). However, later studies have questioned this direct link (Johansson et al., 2005).  Previous studies have shown an abundance of adenosine receptors in the mucosa of the stomach (Yip and Kwok, 2004; Yip et al., 2004b).  These observations suggest that adenosine may play a role in regulating the release of various gastric peptides including ghrelin.  Therefore, the objective of the studies in this chapter was to identify and characterize the role of adenosine signalling on ghrelin release.  Specifically, the isolated mouse stomach vascular perfusion model was used and the sequence of experiments carried out is similar to the characterization of adenosine on somatostatin release in the previous chapter.  Therefore, initial experiments were carried out with pharmacological tools using receptor-selective agonists and antagonists.  Receptor-specific knockout animals were then used to complement the findings and add support to the conclusion. However, since there are no previously published data investigating the interaction between adenosine signalling and ghrelin release, it was imperative to examine the involvement of all four adenosine receptor subtypes with care.  2  A portion of Chapter 4 has been published. Yang GK, Yip Y, Fredholm BB, Kieffer TJ and Kwok YN (2011) Involvement of adenosine signaling in controlling the release of ghrelin from the mouse stomach. J Pharmacol Exp Ther 336(1):77-86. 55 4.1 EFFECT OF ADENOSINE ANALOGUES ON GHRELIN RELEASE Effect of adenosine on ghrelin release  The basal release of ghrelin varied among mice ranging from 388 ± 32 to 432 ± 75 pg/min.  Although there were inter-animal differences, the basal release of ghrelin remained relatively constant for each animal with an average percentage change of -1 ± 6%.  Therefore, ghrelin release was expressed as percentage release relative to the initial 5 min period of release. To examine the effect of adenosine on the release of gastric ghrelin, three different concentrations of adenosine were perfused into the isolated stomach.  At 1.0 µM and 10 µM, ghrelin release was promptly increased upon the administration of adenosine and returned to basal levels immediately after cessation of adenosine perfusion (Figure 17B, C).  However, 0.1 µM did not significantly affect ghrelin release (Figure 17 A).  The effect of various concentrations of adenosine on ghrelin release was summarized in Figure 17D.  These results suggest that adenosine stimulates ghrelin release concentration-dependently.  Figure 17 - Effect of adenosine on ghrelin release from the isolated mouse stomach. Effect of adenosine at 0.1 μM (A), 1.0 μM (B) and 10 μM (C) on ghrelin release.  (D) Concentration-dependent stimulatory effect of adenosine on ghrelin release.  n ≥ 4.  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when compared to basal levels. Effect of selective adenosine agonists on ghrelin release  To examine the adenosine receptor subtypes involved in the stimulatory action of adenosine on ghrelin release, receptor-selective analogues are used.  Administration of 0.1 µM of 56 the A1 agonist CPA did not significantly alter ghrelin release (Figure 18A).  However, administration of 0.1 µM CCPA inhibited ghrelin release promptly (Figure 18B).  CCPA is more selective for the A1 receptor than CPA (Table 3) and therefore may be more appropriate for identifying the role of A1 receptors without non-specifically activating other adenosine receptor subtypes.  Thus, adenosine A1 receptors may have an inhibitory effect on ghrelin release, which is similar to the somatostatin release regulated by adenosine as described in Chapter 3. Administration of 0.1 µM of the A3 agonist IB-MECA had no significant effect on ghrelin release (Figure 18C) suggesting a minimal involvement of the A3 receptor.  Figure 18 - Effect of adenosine A1 and A3 agonists on ghrelin release. Effect of A1 agonists CPA (A) and CCPA (B) and the A3 agonist (C) on ghrelin release.  n ≥ 4. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when compared to basal levels.  Since selective activation of the Gαi-associated A1 receptor caused a decrease in ghrelin release, the stimulatory effect of adenosine on ghrelin release could be mediated via the Gαs- associated A2A and A2B receptors.  Indeed, perfusion of various concentrations of the A2A agonist CGS 21680 (0.001 – 10 µM) revealed a concentration-dependent stimulatory effect on ghrelin release (Figure 19), suggesting that A2A receptor activation may be responsible for the observed effects of adenosine. 57  Figure 19 - Effect of the A2A agonist CGS 21680 on ghrelin release. Effect of the A2A agonist CGS 21680 (CGS) at 0.001 μM (A), 0.01 μM (B), 0.1 μM (C), 1.0 μM (D) and 10 μM (E) on ghrelin release.  (F) Concentration-dependent stimulatory effect of CGS 21680 on ghrelin release.  n ≥ 5.  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when compared to basal levels. Although A2B receptors have much lower affinity for adenosine and many A2-selective analogues than A2A receptors (Fredholm et al., 2001), A2B receptor activation may still have minor contributions to the stimulatory effects observed.  To examine the involvement of A2B receptors, the effect of the non-selective agonist NECA was used.  The stimulatory effect of NECA (Figure 20A) was abolished in the presence of the A2A antagonist ZM 241385 (Figure 20B) thereby suggesting that A2B receptors are not involved in NECA-induced ghrelin release. In addition, the stimulatory effect of CGS 21680 could also be blocked by ZM 241385 (Figure 20C) or by the more selective A2A antagonist SCH 58261 (Figure 20D), thus demonstrating that A2B receptors are unlikely to be involved in CGS 21680-induced ghrelin release.  Results of these studies are summarized in Figure 20E. 58  Figure 20 - Minimal involvement of A2B receptors in NECA- and CGS 21680-induced ghrelin release. Effect of the adenosine agonist NECA in the absence (A) and presence of the A2A antagonist ZM 241385 (ZM; B).  Effect of ZM 241385 (C) or another A2A antagonist SCH 58261 (SCH; D) on the stimulatory effect of the A2A agonist CGS 21680 (CGS) on ghrelin release.  (E) Summary of the drug effects by comparing ghrelin release during drug perfusion periods to basal levels.  n ≥ 4.  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when compared to basal levels. Effect of adenosine antagonists on adenosine-induced ghrelin release  Results from the above agonist studies suggest that A1 and A2A receptors may be involved in regulating ghrelin release.  To further establish their roles, A1 and A2A receptor- selective antagonists were used.  Perfusion of the A1 receptor antagonist, DPCPX, at 0.1 µM and 1.0 µM did not significantly alter ghrelin release (Figure 21A, C).  Furthermore, neither concentration of DPCPX altered the adenosine-stimulated ghrelin release (Figure 21B, D). Perfusion of ZM 241385 alone at 0.1 µM did not induce a significant change in ghrelin release (Figure 22A); however, this concentration was sufficient at blocking the stimulatory effect of 10 µM adenosine (Figure 22B).  Furthermore, perfusion of ZM 241385 at 1.0 µM caused a significant inhibition in ghrelin release both in the absence and presence of adenosine (Figure 22C, D) suggesting that A2A receptors exert a tonic control on ghrelin release.  Taken together, these studies suggest that A2A receptors are responsible for the observed adenosine-induced stimulation on ghrelin release. 59  Figure 21 - Effect of A1 receptor antagonist on ghrelin release. Effect of the A1 antagonist DPCPX at 0.1 μM in the absence (A) and presence (B) of adenosine (Ado).  Effect of 1.0 μM DPCPX in the absence (C) and presence (D) of adenosine.  n ≥ 4.  *p ≤ 0.05; ***p ≤ 0.001 when compared to basal levels.  Figure 22 - Effect of A2A receptor antagonist on ghrelin release. Effect of the A2A antagonist ZM 241385 (ZM) at 0.1 μM in the absence (A) and presence (B) of adenosine (Ado).  Effect of 1.0 μM ZM 241385 in the absence (C) and presence (D) of adenosine.  n ≥ 4.  *p ≤ 0.05; ***p ≤ 0.001 when compared to basal levels. 60 4.2 CELLULAR DISTRIBUTION AND LOCALIZATION OF ADENOSINE RECEPTORS AND GHRELIN  In Chapter 3, it was identified that adenosine A1 receptors were localized in the mouse gastric mucosa on non-somatostatin IR cells (Figure 14).  To determine whether these receptors are located on ghrelin-containing cells, immunohistological studies were carried out.  Ghrelin IR was observed in both the corporal and antral mucosa of the stomach (Figure 23A, D, G, J).  Most of the cells containing ghrelin IR were closed cells and this agrees with previous findings. Intriguingly, ghrelin IR in the mucosa co-localized with A1R IR (Figure 23C, F) but not with A2AR IR (Figure 23I, L).  Further control straining performed for A1R and ghrelin eliminates the possibility of the bleeding effect on different colour filters and non-specific binding (Figure 24). Results from pharmacological studies suggest that A2A receptor activation exerts a greater stimulatory effect on ghrelin release than the inhibitory effect of A1 receptor activation. Therefore, there may be an alternative pathway for adenosine to act via A2A receptors in stimulating ghrelin release rather than acting on the ghrelin-containing cells in the mucosa directly. 61  Figure 23 - Confocal images showing immunohistological staining of ghrelin, A1 receptor and A2A receptor in the mouse gastric mucosa. Representative images (n ≥ 3) showing co-staining of ghrelin with A1 receptor in the corpus mucosa (A, B, C) and the antral mucosa (D, E, F).  Co-staining of ghrelin with A2A receptor in the corpus mucosa (G, H, I) and the antral mucosa (J, K, L).  Co-localizations of the signals are depicted in yellow (C, F). 62  Figure 24 - Control immunohistological staining of ghrelin and A1 receptor in the mouse gastric mucosa. Representative images (n ≥ 3) showing A1 receptor immunoreactivity (IR) and ghrelin IR co- localization are examined in the corpus mucosa to determine the antibody specificity.  Double staining experiments were carried out in the absence of the A1 receptor antibody (A, B) or ghrelin antibody (C, D).  Incubation of both primary antibodies with the A1 receptor control peptide (E, F). Indeed, immunohistological staining in the gastric muscle layers reveal co-localization of ghrelin IR with both A1R IR and A2AR IR (Figure 25).  These results suggest that adenosine may regulate ghrelin release from gastric endocrine cells by interacting with A1 and A2A receptors in the enteric plexus, in addition to its effect on A1 receptors on the ghrelin-containing cells in gastric mucosa. 63  Figure 25 - Confocal images showing immunohistological staining of ghrelin, A1 receptor and A2A receptor in the mouse gastric muscle layers. Representative images (n ≥ 3) showing co-staining of ghrelin with A1 receptor in the corpus (A, B, C) and the antral muscle layers (D, E, F).  Co-staining of ghrelin with A2A receptor in the corpus (G, H, I) and the antral muscle layers (J, K, L).  Co-localizations of the signals are depicted in yellow (C, F, I, L).  CM, circular muscle, LM: longitudinal muscle. 64 4.3 NEURAL COMPONENT OF ADENOSINE SIGNALLING ON GHRELIN RELEASE Co-localization of PGP 9.5 with adenosine receptors and ghrelin  The existence of ghrelin in the nerve fibres suggests a neural function of ghrelin in the stomach.  To verify the observed ghrelin IR is in the nerve fibres, corporal and antral muscle sections were costained with ghrelin and the neuronal marker PGP 9.5 (Figure 26).  Co- localization of PGP 9.5 IR and ghrelin IR was observed in the myenteric plexus and the nerve fibres in the muscle layers of both the corpus and the antrum.  These results suggest that ghrelin may also be released from the gastric enteric neurons.  The co-localization of ghrelin IR with both A1R IR and A2AR IR in the myenteric plexus and nerve fibres suggests that adenosine may also regulate release of this source of ghrelin.  The presence of ghrelin IR in neural elements has been reported in the guinea pig gastric myenteric plexus, whereas ghrelin receptors were observed in the gastric longitudinal muscle and myenteric plexus (Xu et al., 2005).  Figure 26 - Expression of ghrelin IR in nerve fibres of the mouse gastric muscle layers. Representative images (n ≥ 3) showing co-staining of ghrelin with PGP 9.5 in the muscle layers in the mouse corpus (A, B, C) and antrum (D, E, F) mucosa.  Co-localization is indicated in yellow in the merged images (C, F).  CM, circular muscle; LM, longitudinal muscle. 65 Ghrelin receptors have also been located in the enteric nervous systems of rat and human stomachs and colons (Dass et al., 2003).  It is noteworthy that ghrelin accelerates gastric emptying and induces phase III of the migrating motor complex (Masuda et al., 2000; Fujino et al., 2003; Tack et al., 2005; Verhulst et al., 2008).  Therefore, adenosine receptor activation might also be involved in the control of gastric emptying by regulating ghrelin signalling in the enteric neurons. Effect of tetrodotoxin on adenosine-induced ghrelin release  To determine the contribution of the neural pathway of adenosine signalling on ghrelin release, the sodium channel blocker tetrodotoxin (TTX) was administered to abolish the neural components.  The perfusion of 1 µM TTX abolished the stimulatory effect of 1 µM adenosine on ghrelin release (Figure 27).  This supports the notion that the stimulatory action of adenosine on ghrelin release requires neural elements.  Figure 27 - Effect of tetrodotoxin on the stimulatory effect of adenosine on ghrelin release. (A) Effect of tetrodotoxin (TTX) on the stimulatory effect of adenosine (Ado) on ghrelin release. (B) Comparing the effect of 1.0 μM adenosine in the absence and presence of tetrodotoxin.  n ≥ 4. 4.4 EFFECT OF ADENOSINE ANALOGUES ON GHRELIN RELEASE IN A1R -/- AND A2AR -/- MICE  Evidence from pharmacological and immunohistological studies suggests that adenosine predominantly stimulates ghrelin release via A2A receptor activation and has a minor inhibitory effect via A1 receptor-selective activation.  To further verify these findings, specific A1 and A2A receptor-specific knockout animals were used.  The basal release rate of ghrelin in wild type controls for A1R -/-  and A2AR -/-  mice were similar at 573 ± 101 pg/min (n = 10) and 499 ± 52 pg/min (n = 10), respectively.  In addition, both lines of animals had been backcrossed onto a C57BL/6 background for more than 10 generations.  Therefore, in the subsequent studies only 66 data from the wild type controls of A2AR -/-  are shown.  Intriguingly, while the basal release of ghrelin from stomachs of A1R -/-  were comparable with wild type animals, A2AR -/-  mice had significantly lower basal release rates of ghrelin (Figure 28).  This is potentially related to a tonic stimulatory role of A2A receptors in regulating basal ghrelin release.  Therefore, in the absence of A2A receptors such as in A2AR -/- , basal rate of release is decreased.  Figure 28 - Basal ghrelin release in vascularly perfused isolated mouse stomach from wild type, A1R -/-  and A2AR -/-  mice. The basal release of ghrelin from A1R -/-  (red) and A2AR -/-  (blue) mice were compared with their respective wild type controls (black).  n = 10.  †p ≤ 0.05 for comparison as indicated by the bar.  To further establish the roles of A1 and A2A receptors on ghrelin release, the effects of adenosine in the isolated stomachs of A1R -/- and A2AR -/-  mice were examined.  As expected, adenosine stimulated ghrelin release in A1R -/-  mice (Figure 29A) as it did in wild type and the effects were comparable (Figure 29E).  The stimulatory effect was abolished by ZM 241385 (Figure 29B).  Intriguingly, adenosine caused an inhibition of ghrelin release in A2AR -/-  mice (Figure 29C) and this effect could be blocked by DPCPX (Figure 29D).  These results further establish the role of A2A receptors in the stimulatory effect of adenosine on ghrelin release. Furthermore, the inhibitory effect of A1 receptor activation only becomes apparent in the absence of A2A receptor signalling.    67  Figure 29 - Effect of adenosine analogues on ghrelin release in A1R -/-  and A2AR -/-  mice. Effect of adenosine (Ado) on ghrelin release in A1R -/-  (red; A) and A2AR -/-  (blue; C) mice.  The A2A antagonist ZM 241385 (ZM) inhibited adenosine-induced ghrelin release in A1R -/- (B).  The A1 antagonist DPCPX abolished the adenosine-mediated inhibition of ghrelin release in A2AR -/-  (D).  (E) Summary of the drug effects by comparing ghrelin release during drug perfusion periods to basal levels.  n ≥ 4.  *p ≤ 0.05; ***p ≤ 0.001 when compared to basal levels.  †p ≤ 0.05; ††† p ≤ 0.001 for comparisons as indicated by bars.  WT, wild type controls (black).  To determine whether the effects observed with adenosine are physiologically relevant, the ADA inhibitor EHNA was again used.  Extracellular adenosine can be rapidly metabolized by ADA; therefore, EHNA should increase the availability of endogenous adenosine.  In wild type controls, EHNA enhanced ghrelin release in a delayed manner and was significantly elevated after the cessation of EHNA delivery (Figure 30A).  This stimulatory effect of EHNA was still present in A1R -/-  mice (Figure 30B) but not in A2AR -/-  mice (Figure 30C), consistent with the idea that the principal action of adenosine on ghrelin release is stimulatory in nature via the A2A receptors.  In A1R -/-  mice, the stimulatory effect of EHNA seemed to be greater than that of wild type mice (Figure 30D).  This could be caused by an increase in accumulation of endogenous adenosine acting on the A2A receptor, indicating a minor contribution of the A1 receptor on the basal tone of ghrelin release. 68  Figure 30 - Effect of EHNA on gastric ghrelin release in vascularly perfused isolated mouse stomach. Effect of the adenosine deaminase inhibitor EHNA on ghrelin release in wild type controls (WT; black; A), A1R -/-  mice (red; B) and A2AR -/-  mice (blue; C).  (D) Summary of the drug effects by comparing ghrelin release during drug perfusion periods to basal levels.  n ≥ 4.  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when compared to basal levels.  †† p ≤ 0.001 for comparisons as indicated by bars. 4.5 INTERACTION BETWEEN ADENOSINE-INDUCED RELEASE OF SOMATOSTATIN AND GHRELIN  Since adenosine also enhances somatostatin release, the possible involvement of somatostatin signalling in the adenosine-stimulated ghrelin release in the stomach was examined using the somatostatin agonist, octreotide, and antagonist, cyclosomatostatin (C-SOM). Administration of 1.0 µM octreotide promptly inhibited the release of ghrelin and the release returned to basal levels upon cessation of the drug perfusion (Figure 31A).  This is consistent with previous reports demonstrating the inhibitory role of somatostatin on ghrelin release (Tannenbaum and Bowers, 2001; Broglio et al., 2002a; Broglio et al., 2002b; Shimada et al., 2003; Silva et al., 2005).  To determine if the somatostatin-mediated inhibitory effect may dampen the release of ghrelin stimulated by adenosine, the effect of C-SOM on adenosine- stimulated ghrelin release was examined.  Perfusion of C-SOM augmented adenosine-induced ghrelin release (Figure 31B, C), suggesting that the somatostatin-mediated inhibition of ghrelin release is intact during adenosine perfusion but does not completely abolish the adenosine- mediated stimulation. 69  Figure 31 - Effect of somatostatin analogues on ghrelin release in vascularly perfused isolated mouse stomach. The somatostatin analogue octreotide (Oct) inhibited ghrelin release (A) while the somatostatin receptor antagonist cyclo-somatostatin (C-Som) augmented adenosine-induced ghrelin release (B, C).  n ≥ 5.  ***p ≤ 0.001 when compared to basal levels.  † p ≤ 0.05 for comparison as indicated by the bar.  Most of the effects of somatostatin in the stomach are thought to be mediated through a paracrine pathway such that the somatostatin-releasing D-cells are in close proximity with its target cells including parietal cells and G-cells (Kusumoto et al., 1979; Larsson et al., 1979).  A subset of ghrelin IR cells has indeed been shown to be in direct contact with somatostatin IR cells in the rat stomach (Shimada et al., 2003).  To investigate whether or not this is also true in the mouse stomach, immunohistological staining was carried out to determine the distribution of somatostatin-containing cells in relation to ghrelin-containing cells.  Three non-serial sections of 5 μm depth were obtained from each mouse (n = 4).  Following immunohistological staining, at least 100 ghrelin IR cells were counted per section for a total of at least 300 ghrelin IR cells per mouse.  A positive score is defined by a ghrelin IR cell that is in immediate proximity with a somatostatin IR cell.  The cell scoring revealed that only 4.8 ± 0.9% of ghrelin IR cells were in direct contact with a somatostatin IR cell (n = 4; Figure 32).  However, it is conceivable that somatostatin may affect ghrelin release via indirect pathways by modulating the release of other gastric peptides or neurotransmitters.  Nonetheless, the release of somatostatin and ghrelin may still be differentially regulated by adenosine in vivo since the local tissue concentrations of adenosine in the vicinity of the ghrelin- and somatostatin-releasing cells may differ.  Therefore, it is possible for adenosine to exert concomitant control on the release of multiple hormones. 70  Figure 32 - Expression of somatostatin immunoreactivity and ghrelin immunoreactivity in the gastric mucosa Ghrelin IR (green; A) and somatostatin IR (red; B) were stained in the mouse gastric mucosa. Merged image (C) shows a cell positive for ghrelin IR lying in close proximity to a cell positive for somatostatin IR as indicated by the arrow.  Representative images (n = 4). 4.6 CHAPTER SUMMARY  Ghrelin is important in the integrated responses of energy balance and gastric motility. Therefore, understanding the mechanisms underlying the regulation of its release by adenosine may enable better understanding of the pathophysiology associated with abnormal ghrelin levels. The studies in this chapter evaluated the role of adenosine in controlling ghrelin release from the mouse stomach by using both pharmacological tools and selective adenosine receptor knockout mice.  It can then be concluded that the predominant effect of adenosine on ghrelin release is stimulatory via activation of the A2A receptor.  In addition, under A2A receptor blockade, the inhibitory role of A1 receptor activation becomes unmasked.  Recent evidence has suggested that the two forms of ghrelin undergo differential regulation in secretion (Gauna et al., 2007b) and this could in part depend on the components of the ingested meal (Kirchner et al., 2009).  Specifically, acyl-ghrelin levels actually increase, rather than decrease, following a meal rich in medium-chain fatty acids.  In addition, desacyl- ghrelin release from the perfused rat stomach increased with lower ingtragastric pH while acyl- ghrelin levels were not affected by intragastric pH (Mizutani et al., 2009).  Although only acyl- ghrelin, and not desacyl-ghrelin can activate the GHS-R and regulate the majority of the known functions of ghrelin (Matsumoto et al., 2001; Broglio et al., 2003a), studies have indicated other 71 actions of desacyl-ghrelin in glucose metabolism (Gauna et al., 2007a; Granata et al., 2010) suggesting an alternative mechanism potentially involving other unidentified receptors.  This hypothesis is supported by the observation that double genetic knockouts of ghrelin and GHS-R exhibited decreased body weight, increased energy expenditure and increased motor activity under a standard chow diet than single knockout of either ghrelin or GHS-R (Pfluger et al., 2008). Therefore, depending on the components of the meal ingested, different ratios of acyl- and desacyl-ghrelin may be released resulting in different systemic effects.  The RIA kit used in the studies described in this chapter measures total ghrelin levels and therefore it is unclear at this point whether or not adenosine signalling may regulate the production and release of the two forms of ghrelin differently.  Further studies should focus on examining the potentially different regulatory mechanisms of adenosine on the release of these two forms of ghrelin.  The opposing effects on ghrelin release exhibited by A1 and A2A receptor activation suggests that the second messenger cAMP may be involved in this mechanism.  This is supported by the prominent effects of cAMP-altering peptides on ghrelin release including somatostatin, glucagon, GIP and GLP-1 (Shimada et al., 2003; Martin et al., 2005). Somatostatin receptors are coupled to the Gαi protein, and its activation has been shown to decrease ghrelin release.  Conversely, GIP and glucagon receptors are coupled to the Gαs protein, and their activation leads to increased ghrelin release (Kamegai et al., 2004; Lippl et al., 2004). Although GLP-1 receptors are also coupled to the Gαs protein, its activation leads to a decrease in ghrelin release.  This could be caused by the stimulated release of inhibitory peptides by GLP- 1, including somatostatin (Jia et al., 1994), thereby hinting at the complexity of this regulatory system. The exact interaction of adenosine signalling with GIP and GLP-1 awaits clarification. In the GI tract, these incretin hormones have important functions in regulating digestion, gastric emptying and absorption (Baggio and Drucker, 2007; Holst, 2007; McIntosh et al., 2009).  All of these functions could therefore be modulated by adenosine signalling on the target tissue. Furthermore, the role of GLP-1 on the release of the pancreatic hormone insulin has gained a lot of attention in the last two decades due to its prominent effect at stimulating glucose-stimulated insulin release and numerous drug therapies have been targeting the GLP-1 signalling pathway for the treatment of T2DM.  Since the endocrine pancreas has also been identified to be a rich source of purine compounds (Leitner et al., 1975; Detimary et al., 1995; Detimary et al., 1996; Hazama et al., 1998), it is likely that adenosine signalling in the pancreas could interact with the 72 effects of GLP-1.  The interaction between adenosine signalling and GLP-1 signalling on insulin secretion is explored in Chapter 5 using an isolated mouse pancreas vascular perfusion model. 73 CHAPTER  5  –  INTERACTION  BETWEEN  ADENOSINE  AND GLP-1  SIGNALLING  The “incretin effect” is described as the amplification of insulin secretion by GI hormones.  This was originally identified in humans where in adjusted glucose administration, such that systemic plasma glucose levels are comparable, oral administration caused a 2-3 fold higher insulin response than intravenous administration (Elrick et al., 1964; Perley and Kipnis, 1967).  The two most prominent incretin hormones currently identified are GIP and GLP-1. Intriguingly, diminished levels of circulating GLP-1 (Vilsboll et al., 2001) and resistance to the GIP-induced insulinotropic response (Nauck et al., 1993) are observed in people with T2DM. Therefore, GLP-1 replacement therapy or GIP signal-sensitizing therapy were presented as viable options for the treatment of T2DM.  Mice lacking both the GIP and GLP-1 receptors demonstrated decreased glucose-stimulated insulin secretion following oral, but not i.p., administration (Hansotia and Drucker, 2005).  Furthermore, isolated islets from these double receptor knockout mice were responsive to the adenylate cyclase activator forskolin-induced insulin release, illustrating normal intracellular β-cell signalling pathways in these mice and further suggesting the potential of incretin-replacement therapies in T2DM.  To date, GLP-1 mimetics (Madsbad et al., 2004; DeFronzo et al., 2005) and inhibitors of the enzyme responsible for breaking down GIP and GLP-1, dipeptidyl peptidase-IV (DPP-IV) (Ahren et al., 2005; Aschner et al., 2006), are approved for use in treating T2DM, with the idea of increasing GLP-1 signalling and have demonstrated marked success.  Unlike synthetic insulin injections and glucose-independent drugs like sulfonylureas and glinides, GLP-1 induces insulin release in a glucose-dependent manner.  Therefore, the associated risks of hypoglycaemia are greatly reduced in GLP-1 therapies.  In the β-cell, GLP-1 activates the downstream second messenger, adenylate cyclase, resulting in an intracellular accumulation of cAMP (Moens et al., 1996; Delmeire et al., 2003). This then leads to the activation of PKA (Ammala et al., 1994; Lester et al., 2001) and Epac2 (Ozaki et al., 2000; Kashima et al., 2001), resulting in augmentation of insulin secretory events. Previous studies have demonstrated that adenosine can inhibit insulin secretion potentially via the Gαi-coupled A1 receptor activation on β-cells (Hillaire-Buys et al., 1987; Verspohl et al., 2002; Topfer et al., 2008; Tuduri et al., 2008).  Interaction between adenosine signalling and muscarinic signalling has been previously suggested in regulating insulin release (Biden and Browne, 1993).  The shared second messenger of adenylate cyclase between adenosine and 74 GLP-1 signalling suggest that the two may also have an intricate interaction in the pancreatic islet.  Abnormal levels of adenosine signalling in the pancreas could then alter the stimulatory signals by GLP-1. 5.1 EFFECT OF ADENOSINE ANALOGUES ON GLP-1-INDUCED INSULIN AND GLUCAGON RELEASE Effect of adenosine on GLP-1-induced insulin release  To determine the role of adenosine on GLP-1-induced insulin release, 10 μM adenosine was administered in the presence of 16.7 mM glucose into the isolated mouse pancreas vascular perfusion model prior to the administration of GLP-1.  GLP-1-induced insulin release does not seem to be affected by the presence of adenosine.  However, a delayed stimulatory effect on insulin release approximately 12 min following combined drug administration was observed (Figure 33B).  This effect was not seen with GLP-1 perfusion alone (Figure 33A).  Perfusion of 10 μM adenosine caused a slight increase in insulin release (Figure 33C).  Figure 33 - Effect of adenosine on GLP-1-induced insulin release in the vascularly perfused isolated mouse pancreas. GLP-1 was administered alone (A) or in the presence of adenosine (Ado; B).  Average insulin release during three different time periods were compared between GLP-1 alone and GLP-1 with adenosine administration (C).  n = 5.  *p ≤ 0.05 when compared to basal levels (glucose alone; time 0-10 min).  † p ≤ 0.05 for comparison as indicated by the bar. Previous studies have suggested that adenosine inhibits insulin release potentially through activation of A1 receptors on the β-cells (Hillaire-Buys et al., 1987; Verspohl et al., 2002; Topfer et al., 2008).  The lack of an inhibitory effect of adenosine on insulin release in this study could be due to activation of A2A receptors in the islet causing indirect stimulation on β-cells. Previous studies have suggested that A2A receptors are located on the glucagon-releasing α-cells (Tuduri et al., 2008) and that adenosine can stimulate glucagon release in the rat pancreas 75 (Petrack et al., 1981; Chapal et al., 1985).  Furthermore, since glucagon has been demonstrated to stimulate insulin release in mice (Pederson et al., 1998), rats (Kieffer et al., 1996) and humans (Huypens et al., 2000), it is possible that adenosine in our model could have caused an increase in insulin release secondary to an increase in glucagon release.  This indirect stimulation could counter the direct inhibition of insulin secretion by adenosine via A1 receptors.  The delayed stimulatory effect of adenosine on insulin release could then be attributed to the time it took for glucagon levels to increase in the islets and act on the β-cells.  Therefore, in the following sections the effect of adenosine on glucagon secretion is described. Effect of adenosine analogues on GLP-1-induced insulin release To determine the contribution of A1 and A2A receptor activation to the observed effects of adenosine, the selective agonists CPA and CGS 21680 were used, respectively.  Perfusion of 0.1 μM CPA alone did not cause a significant change in insulin release (Figure 34A).  This result is not expected as previous studies showed that perfusion of the A1 agonist L-PIA induced an inhibition of insulin release in the perfused rat pancreas (Hillaire-Buys et al., 1987).  The difference could be attributed to species differences and the higher glucose level used here (16.7 mM; compared to 8.3 mM used previously).  CPA in combination with GLP-1 resulted in a rebound stimulation following drug termination (Figure 34A) similar to the effects of adenosine (Figure 33B).   76  Figure 34 - Effect of adenosine analogues on GLP-1-induced insulin release in the vascularly perfused isolated mouse pancreas. The effect of the A1 agonist CPA (A), A2A agonist CGS 21680 (B) and A1 antagonist DPCPX (C) on GLP-1-induced insulin release were examined.  (D) Summary of drug effects (time 10-20 min) on insulin release.  n ≥ 4.  *p ≤ 0.05 when compared to basal levels (glucose alone).  † p ≤ 0.05 when compared to no drug control (black). Perfusion of 0.1 μM CGS 21680 alone stimulated insulin release (Figure 34B, D).  The stimulatory effect of CGS 21680 is unlikely due to a direct effect on the β-cells since previous studies in dispersed mouse islets did not identify A2A receptors on β-cells (Tuduri et al., 2008). Therefore, this could be due to an indirect stimulatory effect of augmented glucagon release (Chapal et al., 1985).  Taken together, the effects observed with the perfusion of adenosine may be due to the activation of both A1 and A2A receptors as indicated by results obtained with the agonists, CPA and CGS 21680.  Previous studies have demonstrated that prolonged exposure (15-30 min) to adenosine analogues leads to desensitization of A1 receptor signals but not A2A receptor signals (McKenzie et al., 1991; Abbracchio et al., 1992; Milligan, 1993).  Specifically, down-regulation of Gαi, but not Gαs, was observed.  Therefore, it is possible that adenosine activated A1 receptors on the β-cells leading to increased Gαi activity while GLP-1 activated GLP-1 receptors leading to increased Gαs activity.  Following the long exposure to the adenosine analogue, intracellular Gαi may have down-regulated or redistributed and therefore desensitized the inhibitory A1 receptor activity.  This could have also occurred near the end of the drug 77 perfusion periods leading to the secondary rise in insulin release.  This increase in insulin release is further exacerbated following termination of drug perfusion. If adenosine is exerting an inhibitory effect on adenylate cyclase activity in the β-cells via A1 receptor activation, then blockade of A1 receptors should cause an augmented release of insulin.  To examine this, the A1 receptor antagonist, DPCPX, was used.  Perfusion of DPCPX alone did not produce a significant augmentation in insulin release (Figure 35C).  In the presence of both GLP-1 and DPCPX, insulin release seemed to fluctuate over time.  The A1 receptor has been previously suggested to be important in the regulation of pulsatile insulin release patterns (Novak, 2008).  DPCPX administration has been shown to induce pulses of calcium oscillations in isolated islets (Salehi et al., 2009).  Furthermore, A1R -/-  mice exhibit pulses during the 2 nd  phase insulin release which were not observed in wild type controls (Salehi et al., 2009).  As abnormal pulses of insulin secretion have been correlated with impaired glucose tolerance and suggested to precede the development of T2DM (O'Rahilly et al., 1988), these findings further demonstrate the potential clinical significance of adenosine signalling in the islet. Effect of adenosine analogues on glucagon release Aside from the A1 receptor-mediated effects of adenosine on insulin release, adenosine may have also affected glucagon release via A2A receptor activation.  Therefore, the effects of adenosine, CPA and CGS 21680 on glucagon release were examined.  Perfusion of GLP-1 in the presence of 16.67 mM glucose did not have a significant effect on glucagon secretion (Figure 35A).  Adenosine stimulated glucagon release from the perfused pancreas while GLP-1 seemed to have inhibited this augmented release (Figure 35B).  A similar effect was observed with CGS 21680 (Figure 35D) while CPA had no significant effect on glucagon release (Figure 35C).  It is important to note that adenosine and CGS 21680 may have stimulated a burst of glucagon release from the RRP of glucagon granules, which may explain the decline in glucagon release following 10-15 min of drug effect.  Therefore, the decline in the adenosine- and CGS 21680- induced glucagon release may not be due to the addition of GLP-1.  Nonethesless, these results suggest that adenosine stimulates glucagon release in an A2A receptor-dependent manner. Furthermore, the augmented glucagon release in the perfused mouse pancreas could further stimulate insulin release from the β-cells (Pederson et al., 1998).  Therefore, the pattern of insulin release observed during concomitant perfusion of adenosine and GLP-1 could have been a compound effect of both direct A1 receptor activation on β-cells and indirect A2A receptor activation on α-cells, which could potentially lead to glucagon-induced insulin release. 78  Figure 35 - Effect of CPA and CGS 21680 on glucagon release in the vascularly perfused isolated mouse pancreas. Effect of GLP-1 alone (A) or in combination with adenosine (Ado; B), the A1 agonist CPA (C) and the A2A agonist CGS 21680 (D) on glucagon release.  (E) Summary of drug effect (time 10- 20 min) on insulin release.  n ≥ 3.  *p ≤ 0.05 when compared to basal levels (glucose alone).  † p ≤ 0.05 when compared to no drug control (black). Effect of endogenous adenosine on insulin and glucagon release  To determine if the observed effects of adenosine on insulin and glucagon release are physiologically relevant, the ADA inhibitor EHNA was used.  At 1 μM, this enzyme inhibitor has been shown to augment the response of adenosine in the mouse stomach as demonstrated in Chapters 3 and 4.  Intriguingly, perfusion of 1.0 μM EHNA did not alter insulin (Figure 36A) or glucagon (Figure 36B) release under glucose stimulation compared to control periods of glucose alone.  However, EHNA augmented GLP-1-induced insulin release (Figure 36C).  This suggests that endogenous adenosine levels have physiologically relevant interactions with GLP-1 signalling, specifically on regulating insulin release from the β-cells.  Since the β-cell is a rich source for extracellular purine nucleotide and nucleosides, blockade of ADA with EHNA would conceivably have a more significant effect on β-cells than on α-cells.  However, it is important to note that these studies were performed in conjunction with previous measurements of insulin levels and hence the perfusate had a glucose concentration of 16.7 mM.  This high glucose could have inhibited any effects that EHNA may have on α-cells under low glucose conditions.  In addition, because of the rich stores of purines in the islet, it is unclear exactly what the changes 79 in extracellular adenosine levels would be in the presence of EHNA.  This warrants the use of real-time measurements of adenosine in isolated islets in future studies.  Figure 36 - Effect of EHNA on GLP-1-induced insulin and glucagon release in the vascularly perfused isolated mouse pancreas. Effect of the adenosine deaminase inhibitor EHNA on GLP-1-mediated insulin (A) and glucagon (B) release.  Average insulin release (time 20-35 min) were compared between GLP-1 alone (Figure 33A) and GLP-1 with EHNA administration (C).  n ≥ 3.  *p ≤ 0.05 when compared to basal levels (glucose alone).  † p ≤ 0.05 for comparison as indicated by the bar. 5.2 EFFECT OF ADENOSINE ON CALCIUM OSCILLATIONS IN ISOLATED MOUSE ISLETS  The cAMP signalling pathway in the β-cells supplements the canonical pathway of glucose-induced exocytosis of insulin granules.  Specifically, cAMP leads to two main downstream effector signals, PKA and Epac2, both of which act in concert to promote calcium influx and insulin release.  Previous studies have shown a direct correlation between cAMP fluctuations and calcium oscillations in the β-cell following GLP-1 stimulation (Dyachok et al., 2006).  Since adenosine signalling also acts via the cAMP pathway, it is conceivable that adenosine could also affect calcium oscillations in the β-cells.  To determine the effect of adenosine on calcium oscillations, the isolated islet perifusion model was employed.  Adenosine had a concentration-dependent effect on calcium oscillations.  Lower concentrations (≤ 1.0 μM) did not produce any significant changes in calcium oscillations (Figure 37A, B).  Higher concentrations (≥ 10 μM) caused a widening effect in the calcium pulses (Figure 37C, D). Furthermore, at 100 μM of adenosine, the peaks in calcium oscillations began to merge resulting in a longer elevation of intracellular calcium (Figure 38).  Since calcium oscillations are closely correlated with pulsatile release of insulin, this change in intracellular calcium levels induced by adenosine could lead to greater release of insulin.  Regular pulses of insulin release are suggested to be important in normal glucose homeostasis (Matthews et al., 1983).  The abolition of regular 80 calcium oscillations by high levels of adenosine could lead to signal desensitization, insulin resistance and impaired glucose tolerance.  Furthermore, chronically elevated levels of intracellular calcium could lead to glucose unresponsiveness (Minami et al., 2002).  Therefore, fluctuations in adenosine levels in the vicinity of the pancreatic islets may have important implications on insulin secretion and on systemic insulin sensitivity and glucose homeostasis. Understanding the changes in local adenosine levels in the pancreatic islets following different stimulators would allow better insight on the physiological importance of adenosine signalling in the regulation of insulin secretion.  Figure 37 - Representative traces on the effect of adenosine on calcium oscillations in isolated mouse islets. Adenosine (Ado) is administered to the isolated islets at 0.01μM (A), 0.1 μM (B), 1.0 μM (C) and 10 μM (D).  Representative traces from islets of two different mice are shown for each concentration.   81  Figure 38 - Effect of adenosine on calcium levels in isolated mouse islets. Areas under the curve were calculated for the periods of adenosine (Ado) infusion (red) compared to control islets without the addition of adenosine (black).  Values are corrected for baseline during 3 mM glucose perifusion.  Data from at least 3 islets are averaged before pooling with other animal data.  n ≥ 3.  *p ≤ 0.05; ***p ≤ 0.001 when compared to control without adenosine. 5.3 CHAPTER SUMMARY  The involvement of adenosine signalling in the pancreatic islet was recognized early in the development of the purinergic signalling hypothesis (Ismail et al., 1977).  The studies in this chapter provide insight on how adenosine signalling in the pancreatic islet could affect incretin- mediated effects on insulin and glucagon release as well as how adenosine may alter calcium oscillations in the isolated islet which may in turn alter the normal pulsatile insulin release patterns.  Extracellular adenosine levels can be elevated with tissue damage or increased cellular metabolism.  Therefore, it is possible that in a T2DM islet, where β-cells exhibit increased activity to balance the increased insulin demand in peripheral tissues, chronically elevated levels of adenosine could occur.  Furthermore, since ATP is released from the same granules as insulin, increased insulin release would also result in a rise in local adenosine levels.  It was recently suggested through immunohistological studies that the enzyme responsible for the last conversion from AMP to adenosine, 5‟ ecto-nucleotidase, is not found in the mouse and human islets (Lavoie et al., 2010).  So far no functional study has been done to substantiate these histological findings.  However, it is possible that islets possess cytosolic 5‟ endo-nucleotidases, which are structurally different from the ecto-form (Lai and Wong, 1991; Zimmermann, 1996), and could still produce adenosine intracellularly.  Therefore, extracellular adenosine may arise from exocytosis of adenosine from the insulin granules or direct cellular release via transporters from islet cells.  In later stages of T2DM, overworked β-cells may induce inflammatory responses and tissue damage that could further exacerbate the increase in local adenosine levels, which can in turn alter β-cell function in a protective or destructive manner.  To determine the 82 exact elevation in adenosine levels, real-time measurements of adenosine concentration should be performed in islets from patients with T2DM or from diabetic mouse models.  Much of the actions of adenosine could be attributed to changes in intracellular cAMP levels.  Therefore, to further our understanding on the physiological significance of adenosine signalling in the pancreatic islet, future studies should focus on examining changes in cAMP following adenosine administration alone or in combination with other cAMP-modulating peptides including GIP, GLP-1 and glucagon.  In addition, the loss of GIP sensitivity seen in people with T2DM might also be attributed to an adenosine-mediated pathway.  Adenosine receptors have been shown to heterodimerize with other GPCRs in various tissues (Prinster et al., 2005; Franco et al., 2006).  It is unknown whether or not adenosine receptors in the islet could dimerize or interact with GIP receptors.  If such an interaction exists, it is possible that alterations in adenosine signalling in T2DM islets could lead to changes in GIP signalling. However, since adenosine receptors (Class 1) and the incretin receptors (Class 2) belong to different GPCR subclasses (Foord et al., 2005) and dimerization between GPCRs of different subclasses have not yet been identified, it is unclear whether or not such an interaction would be possible. The interactions of adenosine signalling and the incretin hormones may extend beyond the target sites.  The enzymes responsible for the breakdown of adenosine, ADA (Brady, 1942), and the incretin hormones GIP and GLP-1, DPP-IV (Kieffer et al., 1995), have been found to be physically bound in the body and may have similar levels of protein expression and enzyme activity (Kameoka et al., 1993).  In addition, elevated ADA activity has been correlated with acute and chronic elevations in blood glucose and inhibition of ADA activity reduced glucose levels in patients with fasting hyperglycemia (Bopp et al., 2009).  It is unclear whether the improved glucose tolerance following ADA inhibition is due to an associated decrease in DPP- IV activity and thereby increasing incretin signalling or due to an increase in extracellular adenosine concentration in a target tissue and thereby increasing adenosine signalling.  Currently, the evidence supporting a functional relationship between ADA and DPP-IV is weak and further investigations are needed to examine the relationship between the expression and activity levels of these two enzymes. Results from this chapter suggest that the A1 receptors are involved in the regulation of insulin release.  The augmented insulin release observed via A2A receptor activation is likely to 83 be due to elevated glucagon levels rather than a direct effect on insulin release.  The importance of A1 receptors in the regulation of insulin release has been suggested previously.  A1R -/-  mice demonstrate elevated 2 nd  phase insulin release (Johansson et al., 2007) and have altered pulses of insulin secretion (Salehi et al., 2009) compared to wild type counterparts.  However, the phenotypic characterization of A1R -/-  mice in terms of glucose homeostasis and insulin sensitivity has been sparse and inconclusive.  Therefore, Chapter 6 provides such a characterization of A1R -/-  with a specific focus on glucose tolerance, insulin release and insulin sensitivity.  84 CHAPTER  6  –  EFFECT  OF  ADENOSINE  A1 RECEPTORS  ON GLUCOSE  HOMEOSTASIS  AND  INSULIN  SECRETION  Pharmacological evidence obtained using adenosine analogues has shown that adenosine could inhibit insulin release via activation of the A1 receptor (Hillaire-Buys et al., 1987; Verspohl et al., 2002; Topfer et al., 2008).  Studies using A1R -/-  mice revealed that insulin release following a non-fasted i.p. glucose injection is higher in pancreas from A1R -/-  mice compared to littermate controls (Johansson et al., 2007).  Whether or not this is also true following orally ingested glucose is unknown.  Furthermore, it is unclear whether or not the observed effects are due to differences in feeding behaviour since the previous experiments were performed under random fed conditions, and due to age differences in the mice used.  Therefore, a thorough characterization of the glucose homeostasis and insulin release in A1R -/- mice is warranted.  A1R activation was shown to be involved in modulating the effect of GLP-1 on insulin release in the perfused pancreas in Chapter 5.  This action combined with earlier findings suggests that A1R in the pancreas may play a significant role in regulating insulin release under normal physiological conditions and potentially under pathological states as well.  A clearer understanding of the role of A1R in regulating insulin release could thus lead to further insights on the normal regulation of insulin release and on the etiological changes that takes place in the pancreatic islet during the onset of T2DM. 6.1 GLUCOSE TOLERANCE AND INSULIN SENSITIVITY IN A1R -/-  MICE Body weight, food and water intake of A1R -/-  mice  A cohort of A1R -/-  and wild type control mice were weaned on week 4 and kept on a breeder chow diet (20% caloric fat).  Long-term tracking revealed that body weight and food intake were comparable between A1R -/-  and A1R +/+  (Figure 39A, B).  However, cumulative water intake was significantly higher in A1R -/-  mice (Figure 39C).  This could be attributed to the effects of A1 receptors in the kidneys regulating tubuloglomerular feedback (Brown et al., 2001). The net increase in filtration rate in A1R -/-  mice results in a higher demand for rehydration. 85  Figure 39 - Body weight, food intake and water intake of A1R -/-  mice. Tracking data for body weight (A), food intake (B) and water intake (C) for A1R -/-  mice (red) and the wild type controls (A1R +/+; black).  n ≥ 5.  *p ≤ 0.05 when comparing the A1R -/-  to the wild type controls. Glucose tolerance in A1R -/-  mice  To examine glucose homeostasis in the A1R -/-  compared to the wild type controls, a series of OGTTs were performed.  The glucose tolerance test was performed following a 6 hr fast with a dose of 2 g/kg orally gavaged into the mice as suggested previously to be the optimal condition for identifying impaired glucose tolerance (Andrikopoulos et al., 2008).  At all three ages tested, A1R -/- mice had better glucose tolerance compared to the wild type mice (Figure 40).  This was especially apparent at the 15 min time point.  No differences were observed in the 2 hr post- prandial glucose between the two groups.  An assessment of plasma insulin levels following the oral glucose gavage did not reveal any significant differences between the two groups.   86  Figure 40 - Oral glucose tolerance test in A1R -/-  and wild type control mice. Oral glucose gavages were performed when A1R -/-  (red) and wild type control (A1R +/+ ; black) mice were at 7 weeks (A, D), 10 weeks (B, E) and 13 weeks (C, F) of age.  Blood glucose measurements were taken at 0, 7, 15, 30, 60, 90 and 120 min following glucose administration (A, B, C).  Plasma samples were collected at 0, 7, 15 and 60 min following glucose administration and were later assayed for insulin (D, E, F).  The inset shows area under the curve (AUC) with arbitrary units.  n ≥ 5.  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when comparing the A1R -/-  to the wild type controls. Depending on the glucose load that is orally ingested, the body can regulate how fast the glucose can enter the circulation to better maintain blood glucose levels.  This can be achieved by regulating gastric emptying of contents into the duodenum for absorption and can involve various GI peptides including GLP-1, GIP, gastrin, somatostatin and CCK.  These regulatory peptides act in concert to regulate gastric emptying and nutrient absorption.  Furthermore, the incretin hormones GLP-1 and GIP can also act on the islet to regulate the release of insulin and glucagon.  Therefore, i.p. glucose injections were performed to examine the effects of A1R in the regulation of glucose homeostasis downstream of these GI hormones.  By injecting glucose directly into the peritoneal cavity and allowing the body tissues to absorb the glucose directly, the factors such as regulated gastric emptying and the incretin hormone effects can be bypassed. Results from these studies indicate that A1R -/-  mice clear glucose more efficiently following an i.p. glucose load than wild type controls (Figure 41).  However, similar to the plasma insulin levels observed following an oral glucose gavage, no differences in plasma insulin levels were observed between the two groups following i.p. glucose administration. 87  Figure 41 - Intraperitoneal glucose tolerance test in A1R -/-  and wild type control mice. Intraperitoneal glucose injections were performed when A1R -/-  (red) and wild type control (A1R +/+ ; black) mice were at 9 weeks (A, C) and 12 weeks (B, D) of age.  Blood glucose measurements were taken at 0, 7, 15, 30, 60, 90 and 120 min following glucose administration (A, B).  Plasma samples were collected at 0, 7, 15 and 60 min following glucose administration and were later assayed for insulin (C, D).  The inset shows area under the curve (AUC) with arbitrary units.  n ≥ 5.  *p ≤ 0.05 when comparing the A1R -/-  to the wild type controls.  ‡p ≤ 0.05 for the comparison as indicated by the bar. These results are different from the previous report, which showed that glucose tolerance following i.p. glucose injections were comparable between A1R -/-  and A1R +/+  mice but elevations in plasma insulin levels were higher in A1R -/-  mice (Johansson et al., 2007).  The discrepancy could be due to a different glucose dose (1 g/kg), different method of blood collection (retrobulbar), different age of mice (3-4 months) and variation in feeding state (freely fed) used in the previous study (Johansson et al., 2007).  Fasting mice prior to an assessment of glucose tolerance minimizes the variable feeding states among individual mice that could alter the blood glucose and plasma insulin levels at the starting point.  Furthermore, as A1R -/-  mice have increased sensitivity to pain (Johansson et al., 2001), accustoming the mice to a less invasive blood collection procedure of saphenous bleeding performed in the present study could minimize the stress-induced differences in glucose and insulin responses between the two genotypes. Collectively, results from the OGTT and the IPGTT suggest that A1R -/-  have better glucose tolerance than wild type control mice and that this improvement cannot be attributed to an elevated insulin secretion.  Other possibilities that could have resulted in this superior glucose 88 tolerance in A1R -/-  mice are differences in insulin sensitivity and in the release of the main counter-regulatory hormone to insulin, glucagon. Insulin sensitivity in A1R -/-   To determine whether the differences in glucose tolerance observed between the A1R -/-  and wild type mice was attributed to a difference in insulin sensitivity, insulin tolerance tests were performed.  At the two ages examined, insulin sensitivity was comparable between the two genotypes (Figure 42A, B).  The absence of a difference in the insulin sensitivity and glucose- stimulated insulin secretion between the two genotypes suggests that the difference in glucose tolerance could arise from differences in the release of other hormones such as glucagon.  To examine whether glucagon activity is altered in A1R -/-  mice, an arginine challenge test was performed.  Arginine is a stimulator of both insulin and glucagon secretion.  Both A1R -/-  and wild type mice exhibited similar responses to arginine (Figure 42C).  Figure 42 - Intraperitoneal insulin and arginine challenge in A1R -/-  mice. Intraperitoneal insulin injections (0.75 U/kg) were performed when A1R -/-  (red) and wild type control (A1R +/+ ; black) mice were at 11 weeks (A) and 14 weeks (B) of age.  Blood glucose measurements were taken at 0, 10, 20, 30, 60, 90 and 120 min following insulin injection. Intraperitoneal arginine injection (2 g/kg) were performed when mice were at 17 weeks of age (C).  Blood glucose measurements were taken at 0, 7, 15, 30, 60, 90 and 120 following injection. n ≥ 5. Effect of glucose on glucagon release in A1R -/-   In healthy individuals, the surge of glucose in the body following a meal inhibits glucagon secretion and promotes glucose disposal.  Conversely, in an individual with diabetes, abnormal glucagon regulation results in sustained elevation in glucagon levels following meals thereby contributing to the chronic hyperglycemia observed (Unger and Orci, 1976; Unger, 1978; Unger, 1985).  To more directly assess glucagon release, a single i.p. injection of glucose was performed and glucagon levels were assessed 10 min following injection.  While blood glucose 89 levels increased in both the A1R -/-  and the wild type controls, a decrease in plasma glucagon following glucose administration was only observed in the wild type controls (Figure 43).  A previous report showed that an i.p. injection of glucose actually induced an increase in plasma glucagon in the A1R -/-  mice (Johansson et al., 2007).  This was contrary to the results of the present study.  In addition, the fasting levels of glucagon appeared lower in A1R -/-  mice compared to wild type controls and thus could have contributed to the faster glucose disposal in these mice following a glucose challenge (Figure 43B).  Figure 43 - Effect of intraperitoneal glucose injection on plasma glucagon levels in A1R -/-  mice. Intraperitoneal administration of glucose was given at a dose of 2 g/kg following an overnight fast.  Plasma samples were collected at 0 and 10 min following glucose administration that was later assayed for glucagon.  n ≥ 5.  *p ≥ 0.05 for comparisons as indicated by bars. 6.2 EFFECT OF HIGH FAT DIET ON GLUCOSE HOMEOSTASIS IN A1R -/-  MICE The significant improvement in glucose tolerance in A1R -/-  mice warranted examination to determine whether or not these mice would be protected from metabolic stressors.  Previous studies have shown that a high fat diet will induce impaired glucose tolerance in the C57Bl/6 background (Winzell and Ahren, 2004; Andrikopoulos et al., 2008), which is the genetic background for these A1R -/-  mice.  For this study, a cohort of A1R -/-  mice were monitored from week 4 and placed on either a normal chow (NC; 10% dietary caloric fat) or a high fat diet (HFD; 45% dietary caloric fat) at week 7.  Littermate control A1R +/+  mice were also placed on these two diets.  The experimental plan is outlined in Figure 44.  90  Figure 44 - High fat diet study plan for A1R -/-  mice. A1R -/-  (red) and wild type control (A1R +/+ ; black) mice were weaned at 3 weeks of age and placed onto a normal chow (10% caloric fat).  At 7 weeks of age, the mice were either kept on the normal chow (closed circle solid line) or placed on a high fat diet (45% caloric fat; open circle dotted line).  Glucose tolerance and insulin sensitivity were measured prior to the diet split, following 3 weeks of diet split (short-term) and following 3 months of diet split (long-term). Pancreas perfusions were performed at the end of the experiment. Glucose tolerance and insulin sensitivity before diet change  Prior to the diet splits, the A1R -/-  mice had faster glucose disposal following both OGTT and IPGTT than the wild type controls (Figure 45A, B).  Insulin release following glucose administration and insulin sensitivity were comparable between the two genotypes (Figure 45C, D, E).  These observations matched the findings in the previous cohort of mice.   91  Figure 45 - Group matching for the high fat diet study in A1R -/-  mice prior to diet change. Glucose was administered orally (A, C) or via i.p. route (B, D) to A1R -/-  and wild type control (A1R +/+ ) mice.  Plasma samples were collected for measurement of insulin levels (C, D).  The inset shows area under the curve (AUC) with arbitrary units.  Insulin was injected via i.p. route and plasma glucose levels were monitored (E).  n ≥ 6.  †p ≤ 0.05; ††p ≤ 0.01; †††p ≤ 0.001 when comparing A1R -/-  with A1R +/+ .  ‡‡‡p ≤ 0.001 for the comparison as indicated by the bar.  Mice were at 5-7 weeks of age. Short-term effects of high fat diet  Glucose tolerance and insulin sensitivity were again examined at 10-12 weeks of age following 3-5 weeks on the HFD (Figure 46).  A1R -/-  mice were not protected from high fat diet- induced impaired glucose tolerance.  Interestingly, glucose disposal over time following an i.p. glucose injection exhibited a different pattern in NC-fed A1R -/-  mice when compared to NC-fed wild type controls (Figure 46B).  Specifically, the peak in blood glucose levels was lower in NC- fed A1R -/-  compared to NC-fed wild type controls but blood glucose levels 2 hrs after injection was higher in NC-fed A1R -/-  than the NC-fed wild type controls.  However, insulin release was not significantly different between the genotypes (Figure 46C, D).  Furthermore, this difference in intraperitoneal glucose tolerance was not attributed to a difference in insulin sensitivity since an insulin challenge did not produce different glucose lowering effects between the genotypes fed with the same diet. 92  Figure 46 - Short-term effects of high fat diet on glucose tolerance and insulin sensitivity of A1R -/-  mice. Glucose was administered orally (A, C) or via i.p. route (B, D) to A1R -/-  and wild type control (A1R +/+ ) mice.  Plasma samples were collected for measurement of insulin levels (C, D).  The inset shows area under the curve (AUC) with arbitrary units.  Insulin was injected via i.p. route and plasma glucose levels were monitored (E).  n ≥ 5.  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when comparing A1R +/+  on a normal chow (NC) with ones on a high fat diet (HFD).  *p ≤ 0.05; **p ≤ 0.01 when comparing A1R -/-  mice on NC to HFD.  †p ≤ 0.05; ††p ≤ 0.01; †††p ≤ 0.001 when comparing A1R -/-  with A1R +/+ .  ‡p ≥ 0.05 for the comparison as indicated by the bar.  Mice were at 10-12 weeks of age. Long-term effects of high fat diet The superior glucose tolerance in A1R -/-  mice did not protect them from HFD-induced impaired glucose tolerance.  To determine if the A1R -/-  mice would become more glucose intolerant than the wild type controls following a longer exposure to the HFD, tracking data were obtained at age of 19-21 weeks following 12-14 weeks on the HFD.  A1R -/-  mice fed a NC still had better glucose tolerance than their wild type counterparts (Figure 47A, B).  However, A1R -/-  mice on HFD exhibited similar impaired glucose intolerance as the wild type counterparts. Furthermore, both HFD-fed groups exhibited higher glucose-stimulated insulin secretion (Figure 47C) and decreased insulin sensitivity (Figure 47D). 93  Figure 47 - Long-term effects of high fat diet on glucose tolerance and insulin sensitivity of A1R -/-  mice. Glucose was administered orally (A, C) or via i.p. route (B) to A1R -/-  and wild type control (A1R +/+ ) mice.  Plasma samples were collected following oral glucose administration for measurement of plasma insulin levels (C).  The inset shows area under the curve (AUC) with arbitrary units.  Insulin was injected via i.p. route and plasma glucose levels were monitored (D). n ≥ 4.  *p ≤ 0.05; **p ≤ 0.01 when comparing A1R +/+  on a normal chow (NC) with ones on a high fat diet (HFD).  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when comparing A1R -/-  mice on NC to HFD.  ‡p ≤ 0.05 for the comparison as indicated by the bar.  Mice were at 19-21 weeks of age. Body weight and fasting blood glucose  An examination of the body weight changes and fasting blood glucose levels over the course of the experimental periods showed that mice on HFD exhibited faster weight gain and had elevated fasting glucose levels compared to mice on NC (Figure 48B, C).  However, no significant differences were observed between the genotypes.  No differences in food intake were observed (Figure 48A).   94  Figure 48 - Food intake, body weight and fasting blood glucose monitoring for high fat diet study in A1R -/-  mice. Tracking data for food intake (A), body weight (B) and fasting blood glucose (C) for A1R -/-  and A1R +/+  on normal chow (NC) and high fat diet (HFD).  Changes in diet occurred at mice age of 7 weeks, which is when food intake tracking began.  n ≥ 4.  *p ≤ 0.05 when comparing A1R +/+  on a NC with ones on a HFD.   *p ≤ 0.05 when comparing A1R -/-  mice on NC to HFD.  †p ≤ 0.05 when comparing A1R -/-  NC with A1R +/+  NC.  ‡p ≤ 0.05 when comparing A1R -/-  HFD with A1R +/+  HFD. Insulin and glucagon release from the perfused pancreas  To further examine whether there may be a difference in insulin and glucagon release from these mice, the vascularly perfused isolated pancreas model was used.  Glucagon release was stimulated with 2 mM glucose and 10 mM L-arginine while insulin release was stimulated with 20 mM glucose and 10 mM L-arginine.  In both genotypes, insulin release was significantly higher in the HFD group compared to the NC group (Figure 49A, B, C).  However, no significant differences were observed between the genotypes.  This finding is in contrast with the previous report showing that A1R -/-  mice exhibited elevated insulin release following pancreas perfusion with 16.7 mM glucose (Johansson et al., 2007; Salehi et al., 2009).  The reason for this discrepancy is unclear but could be due to different basal and stimulatory glucose concentrations used.  Interestingly, while glucagon release was not significantly different between the different diet treatments in the wild type mice (Figure 49D), A1R -/-  mice on the HFD exhibited significantly elevated release of glucagon compared to their NC counterparts (Figure 49E, F).  In addition, upon the administration of high glucose (20 mM), the A1R -/-  HFD pancreas exhibited a delayed reduction in glucagon release (Figure 49E, time points 25-35).  The elevation in glucagon release in A1R -/-  mice following a HFD could have contributed to the impaired glucose tolerance in these mice and to the loss of the protective factor that made the A1R -/-  mice on a NC more glucose tolerant than the wild type controls. 95  Figure 49 - Insulin and glucagon release from vascularly perfused pancreas from A1R -/-  mice. Insulin and glucagon release were assessed with vascularly perfusion of isolated pancreas from A1R +/+  (A, D) and A1R -/-  (B, E) mice.  *p ≤ 0.05; ***p ≤ 0.001 when comparing A1R +/+  on a normal chow (NC) with ones on a high fat diet (HFD).  n ≥ 3.  *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 when comparing A1R -/-  mice on NC to HFD.  Mice were 22 weeks of age. 6.3 EFFECT OF ADENOSINE ON GLUCOSE-INDUCED PULSATILE INSULIN SECRETION  The HFD studies revealed that the absence of the A1 receptor does not significantly protect or predispose the A1R -/-  mice to HFD-induced impaired glucose tolerance and insulin resistance.  It is still unclear at this point what the underlying mechanism is that provides the A1R -/-  mice better glucose tolerance over the wild type controls.  One possibility is having more pronounced pulsatile release patterns of insulin with higher amplitudes, which had been implicated in A1R -/-  mice (Salehi et al., 2009).  The importance of a regular pulsatile release of insulin has been drawn from correlative studies with the development of diabetes (Lang et al., 1981; Matthews et al., 1983; Bratusch-Marrain et al., 1986; O'Rahilly et al., 1988; Polonsky et al., 1988).  Exogenous infusion of minute pulses in glucose can amplify oscillations in insulin secretion in healthy individuals but this property is disturbed in people with diabetes or pre- diabetes (O'Meara et al., 1993; Ehrmann et al., 1995; Hollingdal et al., 2000).  This method relies on the glucose entrainment properties of insulin secretion such that the pulses of insulin release are synchronized to the oscillatory patterns of exogenously administered glucose (Sturis et al., 96 1991).  With the same concept, pancreas perfusions with oscillating glucose levels generated synchronized insulin pulses in Wistar and Zucker control rats but not in the fatty diabetic Zucker rats (Sturis et al., 1994).  Therefore, glucose entrainment presents a viable method to examine the insulin secretory health in A1R -/-  mice. Pulsatile insulin release in A1R -/-  mice A steady infusion of 7 mM glucose did not produce any clear oscillations in insulin release (Figure 50).  This finding is similar to the previous report (Sturis et al., 1994).  The autocorrelation analysis did not reveal any discernable patterns.  Conversely, when glucose was infused in an oscillatory manner between 7 ± 0.7 mM, clear pulses of insulin release were observed and such patterns can be revealed with autocorrelation analyses (Figure 51).  This was observed in both A1R -/-  and wild type control mice.  Peaks in the autocorrelation analysis indicate the period, or time displacement, in which any intrinsic pattern of insulin release repeats. Interestingly, while the wild type mice exhibited an oscillatory pattern with a period of 10 min, which coincides with glucose oscillations, A1R -/-  mice exhibited an oscillatory period of 5 min. A previous study has shown that constant infusion of 16.7 mM glucose can generate regular pulses of insulin release in A1R -/-  but not in the wild type controls suggesting that the absence of A1 receptor may unmask pulses of insulin release (Salehi et al., 2009).  The present study demonstrated that by inducing pulsatile insulin release with an oscillatory glucose infusion, A1R - /-  mice exhibited a higher frequency of regular pulses of insulin release than wild type controls. Pulses of insulin release from β-cells are dependent on intracellular signals that regulate the priming of reserve insulin granules and the exocytotic machinery (Parsons et al., 1995).  Two of these signals are the cAMP-activated factors, PKA and Epac2 (Renstrom et al., 1997; Eliasson et al., 2003).  Since A1 receptor signalling can inhibit adenylate cyclase activity and decrease intracellular cAMP levels (Fredholm et al., 2001), results from the present and previous studies suggest that A1 receptor signalling could be involved in the priming and exocytosis of insulin granules and thereby govern the temporal release patterns of insulin from β-cells. 97  Figure 50 - Insulin secretion induced by steady glucose infusion in vascularly perfused C57Bl/6 mouse pancreas. Steady infusion of 7 mM was achieved and insulin release was measured in samples collected at 1 min intervals.  Two representative mice are shown here (A, C) with their corresponding autocorrelation analysis (B, D).  Figure 51 - Insulin secretion induced by oscillatory glucose infusion in vascularly perfused pancreas from wild type controls and A1R -/-  mice. Oscillatory infusion of 7 ± 0.7 mM was achieved with a periodicity of 10 min.  Insulin release was measured in samples collected at 1 min intervals.  One representative A1R +/+  (A) and A1R -/-  (C) are shown here with their corresponding autocorrelation analysis (B, D).  n = 3. 98 Effect of high fat diet on pulsatile insulin release in A1R -/-  mice  The higher frequency of pulsatile insulin secretion in A1R -/-  may have contributed to improved glucose metabolism in vivo due to improved hepatic actions (Bratusch-Marrain et al., 1986).  To determine the effect of HFD on the pulsatile release patterns of insulin release, pancreas perfusion were performed on mice following 14 weeks of HFD feeding.  The pulses of insulin release were disrupted in HFD-fed A1R -/-  and wild type mice and the autocorrelation analysis no longer displays an apparent pattern (Figure 52).  These results suggest that HFD- induced impaired glucose tolerance also results in disrupted pulsatile insulin release patterns.  In addition, the HFD-induced disruption of the higher frequency of insulin pulses in A1R -/-  may have led to the loss of the superior glucose tolerance observed under NC-feeding.  Further examination on the sequence of events of disruption in pulsatile insulin release and impaired glucose tolerance may provide insight on the exact cause and effects of HFD-induced defects.  Figure 52 - Insulin secretion induced by oscillatory glucose infusion in vascularly perfused pancreas from A1R +/+  and A1R -/-  mice fed a high fat diet. Oscillatory infusion of 7 ± 0.7 mM was achieved with a periodicity of 10 min.  Insulin release was measured in samples collected at 1 min intervals.  One representative A1R +/+  (A) and A1R -/-  (C) are shown here with their corresponding autocorrelation analysis (B, D).  n = 3. 6.4 CHAPTER SUMMARY  The use of genetic knockout animals in modern research has been useful in understanding the physiological roles of specific proteins, hormones and signalling pathways.  In 99 the studies described in this chapter, it was found that A1R -/-  mice have better glucose tolerance than their wild type counterparts and this improvement in glucose clearance is not due to increased levels of insulin release or sensitivity.  In addition, it was found that changes in the regular pulsatile release patterns of insulin from the pancreas could be responsible for the observed differences in glucose homeostasis.  A correlation was also noted between impaired glucose tolerance and disruption in regular pulsatile insulin release in both A1R -/-  and A1R +/+  mice that were fed a HFD suggesting the physiological importance of these regular pulses.  The use of the A1R -/-  mice allowed for a greater appreciation of the physiological consequences of the absence of A1 receptor signalling.  It is important to note that with the use of any global knockout models, the effects observed in vivo are unlikely to be only specific to one particular tissue of interest.  With regards to glucose metabolism and insulin sensitivity, the A1 receptor also has profound effects in the fat and muscle.  Previous studies have demonstrated that adenosine antagonism increases insulin sensitivity in muscle following diet-induced insulin resistance (Budohoski et al., 1984a) and in fatty Zucker rats (Challis et al., 1984).  Conversely, decreased insulin sensitivity in muscle has been observed with adenosine agonists (Budohoski et al., 1984b) and this effect has been attributed to A1 receptor activation (Challiss et al., 1992; Langfort et al., 1993).  In adipocytes, A1 receptor activation leads to improved insulin sensitivity (Klein et al., 1987), while prolonged exposure leads to receptor down-regulation and insulin resistance (Green, 1987).  Desensitization of A1 receptor on adipocytes has also be correlated with diabetes suggesting an etiological link (Barrington et al., 1996).  In addition, overexpression of the A1 receptor in adipocytes of transgenic mice protected them from HFD-induced insulin resistance (Dong et al., 2001).  These studies illustrate the diverse and tissue-dependent effects of A1 receptor signalling on insulin sensitivity.  Since A1R -/-  mice used in the studies in this chapter were knocked out of A1 receptors in all tissues throughout the body, the phenotypic observed responses observed could have been contributed by both pancreatic and extra- pancreatic factors.  The previous studies suggest that A1 receptor blockade should improve insulin sensitivity in muscles but decrease insulin sensitivity in adipocytes.  These two potentially opposing effects on systemic insulin sensitivity in A1R -/-  may have evened out resulting in comparable insulin sensitivity with the wild type controls.  Following a HFD, this balance of A1 receptor effects may have been offset and could have contributed to the observed glucose intolerance and insulin resistance.  Therefore, to complement the findings in the present chapter, future studies should employ pancreas-specific A1 receptor knockout models. 100 CHAPTER  7  –  CONCLUSION  The widespread actions of adenosine have been continuously emerging over the last few decades.  The ubiquitous expression of adenosine receptors across tissues and the activity- dependent changes in local adenosine concentrations make the adenosine signalling pathway an important mode of autocrine and paracrine communication (Fredholm, 2007).  During tissue damage and hypoxia, local adenosine levels show a large increase leading to various tissue- protective responses (Fredholm, 2007).  Furthermore, studies have identified other adenosine signalling pathways that are constitutively active during basal states which have led to the recent understanding of adenosine as an important homeostatic controller in various physiological systems (Jacobson and Gao, 2006).  As demonstrated by the studies presented in this thesis, adenosine signalling is involved in regulating the release of various gastric and pancreatic peptides and could also be involved in pathological states. 7.1 ADENOSINE AS A METABOLIC REGULATOR  The evidence presented in this thesis demonstrates the multi-faceted involvements of adenosine signalling in the digestive system.  As the center for both mechanical and chemical digestion, the stomach undergoes changes in metabolic state throughout the day depending on meal ingestion.  Specifically, fasting periods are associated with low basal metabolism while feeding periods are associated with high cellular metabolism.  Since adenosine levels are directly related to the metabolic state of nearby cells, local adenosine concentrations in the stomach should increase during meal ingestion secondary to increased cell metabolism.  Indeed, stimulation of the acid-secreting parietal cell is associated with increased oxygen consumption (Soll, 1978) and ATP turnover (Sarau et al., 1975).  ATP is rapidly broken down into adenosine in a pathway involving multiple enzymes (Fredholm et al., 2001); therefore, the process of acid secretion can lead to an increase in local concentrations of adenosine.  This burst in local adenosine concentration could lead to appropriate downstream responses that could act both locally, for food digestion and nutrient absorption, and systemically in other central and peripheral tissues for appetite regulation and energy homeostasis. As exemplified by the role of adenosine in regulating gastric acid secretion, adenosine can exert a redundant array of pathways for one function and act as a master regulator.  Previous studies have demonstrated that adenosine inhibits acid secretion by inhibiting parietal cells, 101 inhibiting gastrin release or stimulating somatostatin release (Figure 3).  As such, increases in adenosine levels in the stomach following meal ingestion would result in a compounded inhibitory effect on acid secretion.  The control exerted by this nucleoside suggests that abnormal levels of adenosine or defects in its signalling pathways may result in hypersecretion of acid and gastric ulcers.  Indeed, the activity of ADA in the stomach has been directly correlated with gastric acid output in disease states (Namiot et al., 1990; Namiot et al., 1991).  In patients with achlohydria, low ADA activity was found.  Conversely, patients with gastric ulcers have been associated with high ADA activity.  Since ADA breaks down adenosine, higher levels of ADA should result in a lower level of extracellular adenosine or a faster clearance.  A lack of the acid-inhibitory effect of adenosine in gastric ulcers may worsen the hypersecretion of acid and may contribute to the development of the disease.  As a master regulator with multiple signalling pathways, abnormal levels of adenosine may have strong implications in disease development.  Aside from producing tissue-specific effects, adenosine can also regulate the release of gastric hormones, as demonstrated with the release of ghrelin.  Since ghrelin cells in the stomach are closed cells (Sakata et al., 2002), they are unable to sense the luminal contents directly.  In this situation, adenosine signalling may help in the relay of messages in a short paracrine manner. The effects of ghrelin are not limited to the stomach.  Aside from regulating gastric motility, ghrelin can also affect appetite (Wren et al., 2000; Asakawa et al., 2001; Kamegai et al., 2001; Nakazato et al., 2001; Shintani et al., 2001; Wren et al., 2001a; Wren et al., 2001b; Lawrence et al., 2002) and lipogenesis (Tschop et al., 2000; Choi et al., 2003), and therefore elicit a systemic effect.  The importance of adenosine signalling is then no longer limited to the particular tissue of signal origin.  By regulating the release of hormones, adenosine signalling acts as an important systemic homeostatic regulator.  Furthermore, the studies examining ghrelin and somatostatin release illustrate the ability of adenosine to regulate different cell types in a similar manner: low levels of adenosine inhibit the release of both somatostatin and ghrelin while higher levels lead to the stimulated release of both peptides.  The opposing actions of adenosine on a single cell type also demonstrate the versatility of its signal and its strong dependence on local tissue activity and thereby adenosine levels.  The concomitant release of ghrelin and somatostatin following adenosine stimulation is complicated by the inhibitory role of somatostatin on ghrelin release.  It is possible that the inhibitory effect of somatostatin on ghrelin releases is not as physiologically relevant as the two 102 cell types are rarely in close contact.  This also signifies the importance of examining the effects of adenosine in not just tissue-specific, but region-specific manners.  Also, this shows that adenosine may also modulate the effect of other regulators.  This was better exemplified by the interaction between adenosine signalling and GLP-1-signalling on the pancreatic β-cell. Signalling through GPCRs, which make up a large family of hormone receptors, adenosine in the target site may prime the recipient tissue and modulate the responses elicited by the incoming hormonal signal.  Therefore, not only can adenosine modulate hormone secretion at the site of hormone release, it may also modulate specific responses at the target site.  It is important to note that under physiological conditions, these two pools of adenosine, at the source and at the target sites, may be segregated and may exhibit completely different concentrations and signalling pathways.  In addition, adenosine signalling in different target tissues may result in alternative responses to the same hormone.  This is exemplified in the findings that while adenosine A1 receptor activation increases insulin sensitivity in the adipocytes (Klein et al., 1987; Dong et al., 2001), A1 receptor activation leads to decreased insulin sensitivity in muscles (Budohoski et al., 1984b; Challiss et al., 1992; Langfort et al., 1993).  Adenosine signalling through an autocrine pathway can be exemplified in the pancreatic islets.  β-cells contain ATP in the secretory insulin granules and can release ATP independently, via kiss-and-run, or with insulin, via granule exocytosis (MacDonald et al., 2006).  ATP itself has been demonstrated to have a positive feedback effect on stimulating β-cells (Verspohl et al., 2002).  However, high levels of ATP have been demonstrated to have inhibitory effects on insulin release and this is hypothesized to be due to adenosine formation and activation of the inhibitory A1 receptors on the β-cells (Verspohl et al., 2002).  Alternatively, adenosine may have been formed intracellularly in other islet cell types and released as adenosine directly.  Studies from this thesis and others further demonstrate that adenosine A1 receptor signalling is involved in the pulsatile release of insulin.  Aside from an auto-regulatory effect, ATP and adenosine have also been postulated to be involved in the intra- and inter-islet communications.  A human pancreas has approximately one million islets with each islet containing up to thousands of cells. Intriguingly, the islet hormones, insulin, glucagon and somatostatin, are all released in regulated oscillations (Hellman et al., 2009) that could serve to reduce receptor down-regulation on target tissues and prevent signal desensitization (Jiang and Zhang, 2003; Tengholm and Gylfe, 2009). Such coordinated releases of these pancreatic hormones require strong synchronized communication between individual cells.  The abundance of ATP and adenosine receptors as 103 well as the synchronized secretion of ATP with insulin and possibly the metabolic rate- dependent adenosine secretion makes these purinergic signals excellent candidates for setting the synchronized pace in the pancreas. These are just a few examples showing the diverse mechanisms involved in adenosine signalling in metabolism.  Meal-regulated changes in metabolism may elicit changes in adenosine levels in various tissues.  As such, all these different responses of adenosine in the digestive tract can occur concurrently when under the meticulous orchestration of normal physiology.  However, such intricate regulation in a multi-tissue-specific manner becomes challenging in therapeutic developments. 7.2 CHALLENGES WITH THE DEVELOPMENT OF ADENOSINE THERAPEUTICS  Despite the involvement of adenosine regulation in various physiological systems, the only approved clinical application of adenosine, to date, is its use in acute treatment of supraventricular tachycardia, while some other adenosine analogues are currently in clinical trials (Moro et al., 2006).  As evidence supporting the beneficial role of adenosine in clinical settings emerges, more drug companies may begin to investigate the therapeutic potential of receptor-selective analogues of adenosine.  However, several challenges are involved in the development of adenosine therapeutics.  The widespread actions of adenosine signalling throughout the body demonstrate the key involvement of adenosine in homeostasis but also identify the main problem associated with adenosine therapeutics.  The therapeutic potential of using adenosine agonists and antagonists have been identified in various tissues (Jacobson and Gao, 2006; Jacobson, 2009), but the challenge lies in dissecting out specific desirable effects for the treatment of a disease while negating the undesirable side effects on other tissues.  Part of this challenge can be resolved with the use of adenosine analogues that will select for one of the four receptor subtypes.  However, each adenosine receptor subtype is expressed widely across the body (Fredholm et al., 2001).  A possible solution to alleviate some of the unwanted side effects is the use of partial receptor agonists, based on the understanding of receptor reserves. The concept of receptor reserve was first presented over half a century ago and revolutionized the existing receptor theories at the time (Stephenson, 1956).  This concept suggests that when a particular agonist is considered, a maximal effect could be produced when 104 only a proportion of the existing receptors are occupied (Stephenson, 1956).  As such, when evaluating the potency of a particular agonist, one should take into account its affinity and binding capacity to the receptor, and its efficacy on the specific response.  With this concept, a weak, or partial, agonist that occupies the receptor but elicits a weaker response than that elicited by the endogenous ligand will also act as a partial antagonist (Stephenson, 1956).  Even though a specific adenosine receptor subtype may be expressed in numerous tissues, its abundance among tissues varies (Fredholm et al., 2001).  Whether the administration of a partial adenosine agonist will have agonistic or antagonistic activities in a particular tissue will thus depend on the tonic level of adenosine activity in this site.  Specifically, in a tissue where high tonic activity of the adenosine receptor subtype exists, a partial agonist would have strong antagonistic effects whereas an agonist would have a weak agonistic effect.  Conversely, in a tissue where low tonic activity exists, a partial agonist would have a weak agonistic effect whereas an agonist would have a strong agonistic effect.  Therefore, better understanding of both the tonic activity of the specific adenosine receptor subtype in the tissue of interest and the pharmacokinetic properties of a particular drug could lead to the development of adenosine therapies with less unwanted side effects.  Although the short half-life makes adenosine a suitable treatment option for acute disorders, the use of adenosine in metabolic disorders requires long-term activity and may not be practical.  Many of the receptor-selective adenosine analogues developed have much longer half- lives that could enable chronic treatments.  However, chronic treatment can lead to signal desensitization, specifically for A1 and A3 receptors (Hoffman et al., 1986; Green, 1987; Green et al., 1990; Fredholm et al., 2001; Zannikos et al., 2001).  The degree of desensitization in GPCRs are suggested to be lower with the use of partial, rather than full, agonists as demonstrated with opioid receptors (Vachon et al., 1987; Kovoor et al., 1998), which again warrants the development of partial agonists for adenosine therapies. Adenosine receptors have been found to dimerize with other GPCRs in a tissue- dependent manner (Agnati et al., 2003; Prinster et al., 2005; Franco et al., 2006; Nakata et al., 2010).  Interactions between GPCRs that are coupled could have synergistic or antagonistic effects (Agnati et al., 2003).  Furthermore, selective activation of the coupled GPCR could change the downstream signals and alter the binding affinity of the coupled adenosine receptor (Agnati et al., 2003).  Therefore, a clearer grasp of the tissue-dependent heterodimers of 105 adenosine receptors could lead to tissue-specific therapies via indirect modulation of adenosine signalling by targeting the dimerized GPCR. 7.3 THE FUTURE OF ADENOSINE SIGNALLING  Adenosine signalling exists in virtually every physiological system in the human body (Jacobson and Gao, 2006).  As soon as clear roles of adenosine were identified in fat, muscle, the brain, the heart and the kidneys, research in the therapeutic potentials of adenosine analogues have become an area of high interest (Jacobson and Gao, 2006).  The studies presented in this thesis expand our understanding on the intricate involvement of adenosine signalling in the digestive system.  Furthermore, the results obtained demonstrate the numerous means by which adenosine can behave as a regulator of metabolism and energy balance.  With an extensive and constantly growing list of effects of adenosine throughout the body, suitable clinical uses of adenosine are anticipated.  The recent advancements in our knowledge in both the pharmacokinetics of adenosine analogues and the tissue-specific dimerization of adenosine receptors, could help to overcome the therapeutic challenges associated with adenosine therapy and could lead to the development of adenosine-based drugs for various indications (Jacobson and Gao, 2006; Moro et al., 2006) in the not so distant future.  106 REFERENCES Abbracchio MP, Fogliatto G, Paoletti AM, Rovati GE and Cattabeni F (1992) Prolonged in vitro exposure of rat brain slices to adenosine analogues: selective desensitization of adenosine A1 but not A2 receptors. Eur J Pharmacol 227:317-324. Adeghate E and Parvez H (2002) Mechanism of ghrelin-evoked glucagon secretion from the pancreas of diabetic rats. Neuroendocrinol Lett 23:432-436. Agnati LF, Ferre S, Lluis C, Franco R and Fuxe K (2003) Molecular mechanisms and therapeutical implications of intramembrane receptor/receptor interactions among heptahelical receptors with examples from the striatopallidal GABA neurons. Pharmacol Rev 55:509-550. Ahren B (2009) Islet G protein-coupled receptors as potential targets for treatment of type 2 diabetes. Nat Rev Drug Discov 8:369-385. Ahren B, Pacini G, Foley JE and Schweizer A (2005) Improved meal-related beta-cell function and insulin sensitivity by the dipeptidyl peptidase-IV inhibitor vildagliptin in metformin- treated patients with type 2 diabetes over 1 year. Diabetes Care 28:1936-1940. Al Massadi O, Pardo M, Roca-Rivada A, Castelao C, Casanueva FF and Seoane LM (2010) Macronutrients act directly on the stomach to regulate gastric ghrelin release. J Endocrinol Invest 33:599-602. Ammala C, Ashcroft FM and Rorsman P (1993a) Calcium-independent potentiation of insulin release by cyclic AMP in single beta-cells. Nature 363:356-358. Ammala C, Eliasson L, Bokvist K, Berggren PO, Honkanen RE, Sjoholm A and Rorsman P (1994) Activation of protein kinases and inhibition of protein phosphatases play a central role in the regulation of exocytosis in mouse pancreatic beta cells. Proc Natl Acad Sci U S A 91:4343-4347. Ammala C, Eliasson L, Bokvist K, Larsson O, Ashcroft FM and Rorsman P (1993b) Exocytosis elicited by action potentials and voltage-clamp calcium currents in individual mouse pancreatic B-cells. J Physiol 472:665-688. Andrikopoulos S, Blair AR, Deluca N, Fam BC and Proietto J (2008) Evaluating the glucose tolerance test in mice. Am J Physiol Endocrinol Metab 295:E1323-1332. Arosio M, Ronchi CL, Gebbia C, Cappiello V, Beck-Peccoz P and Peracchi M (2003) Stimulatory effects of ghrelin on circulating somatostatin and pancreatic polypeptide levels. J Clin Endocrinol Metab 88:701-704. 107 Arvat E, Di Vito L, Broglio F, Papotti M, Muccioli G, Dieguez C, Casanueva FF, Deghenghi R, Camanni F and Ghigo E (2000) Preliminary evidence that Ghrelin, the natural GH secretagogue (GHS)-receptor ligand, strongly stimulates GH secretion in humans. J Endocrinol Invest 23:493-495. Asakawa A, Inui A, Kaga T, Yuzuriha H, Nagata T, Ueno N, Makino S, Fujimiya M, Niijima A, Fujino MA and Kasuga M (2001) Ghrelin is an appetite-stimulatory signal from stomach with structural resemblance to motilin. Gastroenterology 120:337-345. Aschner P, Kipnes MS, Lunceford JK, Sanchez M, Mickel C and Williams-Herman DE (2006) Effect of the dipeptidyl peptidase-4 inhibitor sitagliptin as monotherapy on glycemic control in patients with type 2 diabetes. Diabetes Care 29:2632-2637. Bagdade JD, Porte D, Jr., Brunzell JD and Bierman EL (1974) Basal and stimulated hyperinsulinism: reversible metabolic sequelae of obesity. J Lab Clin Med 83:563-569. Baggio LL and Drucker DJ (2007) Biology of incretins: GLP-1 and GIP. Gastroenterology 132:2131-2157. Baldanzi G, Filigheddu N, Cutrupi S, Catapano F, Bonissoni S, Fubini A, Malan D, Baj G, Granata R, Broglio F, Papotti M, Surico N, Bussolino F, Isgaard J, Deghenghi R, Sinigaglia F, Prat M, Muccioli G, Ghigo E and Graziani A (2002) Ghrelin and des-acyl ghrelin inhibit cell death in cardiomyocytes and endothelial cells through ERK1/2 and PI 3-kinase/AKT. J Cell Biol 159:1029-1037. Baldwin SA, Mackey JR, Cass CE and Young JD (1999) Nucleoside transporters: molecular biology and implications for therapeutic development. Mol Med Today 5:216-224. Banting FG and Best CH (1922) The internal secretion of the pancreas. J Lab Clin Med 7:465- 480. Banting FG, Best CH, Collip JB, Campbell WR and Fletcher AA (1922) Pancreatic extracts in the treatment of diabetes mellitus. Can Med Assoc J 12:141-146. Barg S (2003) Mechanisms of exocytosis in insulin-secreting B-cells and glucagon-secreting A- cells. Pharmacol Toxicol 92:3-13. Barrington WW, Crum M, Forst C, Scheetz M and Weide LG (1996) Desensitization of the adipocyte A(1) adenosine receptor during untreated experimental diabetes mellitus. Endocrine 4:199-205. Berelowitz M and Eugene HG (1996) Non-insulin dependent diabetes mellitus secondary to other endocrine disorders, in Diabetes Mellitus (LeRoith D, Taylor SI and Olefsky JM eds) pp 496-502, Lippincott-Raven, New York. 108 Bergsten P, Grapengiesser E, Gylfe E, Tengholm A and Hellman B (1994) Synchronous oscillations of cytoplasmic Ca2+ and insulin release in glucose-stimulated pancreatic islets. J Biol Chem 269:8749-8753. Biden TJ and Browne CL (1993) Cross-talk between muscarinic- and adenosine-receptor signalling in the regulation of cytosolic free Ca2+ and insulin secretion. Biochem J 293 ( Pt 3):721-728. Blom WA, Lluch A, Stafleu A, Vinoy S, Holst JJ, Schaafsma G and Hendriks HF (2006) Effect of a high-protein breakfast on the postprandial ghrelin response. Am J Clin Nutr 83:211- 220. Bloom SR, Kuhajda FP, Laher I, Pi-Sunyer X, Ronnett GV, Tan TM and Weigle DS (2008) The obesity epidemic: pharmacological challenges. Mol Interv 8:82-98. Bokvist K, Olsen HL, Hoy M, Gotfredsen CF, Holmes WF, Buschard K, Rorsman P and Gromada J (1999) Characterisation of sulphonylurea and ATP-regulated K+ channels in rat pancreatic A-cells. Pflugers Arch 438:428-436. Bopp A, De Bona KS, Belle LP, Moresco RN and Moretto MB (2009) Syzygium cumini inhibits adenosine deaminase activity and reduces glucose levels in hyperglycemic patients. Fundam Clin Pharmacol 23:501-507. Brady T (1942) Adenosine deaminase. The Biochemical journal 36:478-484. Bratusch-Marrain PR, Komjati M and Waldhausl WK (1986) Efficacy of pulsatile versus continuous insulin administration on hepatic glucose production and glucose utilization in type I diabetic humans. Diabetes 35:922-926. Briatore L, Andraghetti G and Cordera R (2003) Acute plasma glucose increase, but not early insulin response, regulates plasma ghrelin. Eur J Endocrinol 149:403-406. Broglio F, Arvat E, Benso A, Gottero C, Muccioli G, Papotti M, van der Lely AJ, Deghenghi R and Ghigo E (2001) Ghrelin, a natural GH secretagogue produced by the stomach, induces hyperglycemia and reduces insulin secretion in humans. J Clin Endocrinol Metab 86:5083-5086. Broglio F, Arvat E, Benso A, Gottero C, Prodam F, Grottoli S, Papotti M, Muccioli G, van der Lely AJ, Deghenghi R and Ghigo E (2002a) Endocrine activities of cortistatin-14 and its interaction with GHRH and ghrelin in humans. J Clin Endocrinol Metab 87:3783-3790. Broglio F, Benso A, Gottero C, Prodam F, Gauna C, Filtri L, Arvat E, van der Lely AJ, Deghenghi R and Ghigo E (2003a) Non-acylated ghrelin does not possess the pituitaric 109 and pancreatic endocrine activity of acylated ghrelin in humans. J Endocrinol Invest 26:192-196. Broglio F, Gottero C, Benso A, Prodam F, Destefanis S, Gauna C, Maccario M, Deghenghi R, van der Lely AJ and Ghigo E (2003b) Effects of ghrelin on the insulin and glycemic responses to glucose, arginine, or free fatty acids load in humans. J Clin Endocrinol Metab 88:4268-4272. Broglio F, Gottero C, Prodam F, Destefanis S, Gauna C, Me E, Riganti F, Vivenza D, Rapa A, Martina V, Arvat E, Bona G, van der Lely AJ and Ghigo E (2004) Ghrelin secretion is inhibited by glucose load and insulin-induced hypoglycaemia but unaffected by glucagon and arginine in humans. Clin Endocrinol (Oxf) 61:503-509. Broglio F, Koetsveld Pv P, Benso A, Gottero C, Prodam F, Papotti M, Muccioli G, Gauna C, Hofland L, Deghenghi R, Arvat E, Van Der Lely AJ and Ghigo E (2002b) Ghrelin secretion is inhibited by either somatostatin or cortistatin in humans. J Clin Endocrinol Metab 87:4829-4832. Brown R, Ollerstam A, Johansson B, Skott O, Gebre-Medhin S, Fredholm B and Persson AE (2001) Abolished tubuloglomerular feedback and increased plasma renin in adenosine A1 receptor-deficient mice. Am J Physiol Regul Integr Comp Physiol 281:R1362-1367. Buchan AM, Curtis SB and Meloche RM (1990) Release of somatostatin immunoreactivity from human antral D cells in culture. Gastroenterology 99:690-696. Budohoski L, Challiss RA, Cooney GJ, McManus B and Newsholme EA (1984a) Reversal of dietary-induced insulin resistance in muscle of the rat by adenosine deaminase and an adenosine-receptor antagonist. Biochem J 224:327-330. Budohoski L, Challiss RA, Lozeman FJ, McManus B and Newsholme EA (1984b) Increased insulin sensitivity in soleus muscle from cold-exposed rats: reversal by an adenosine- receptor agonist. FEBS Lett 175:402-406. Burnstock G (1972) Purinergic nerves. Pharmacol Rev 24:509-581. Burnstock G, Cocks T, Kasakov L and Wong HK (1978) Direct evidence for ATP release from non-adrenergic, non-cholinergic ("purinergic") nerves in the guinea-pig taenia coli and bladder. Eur J Pharmacol 49:145-149. Canadian Diabetes Association (2011) Diabetes and you: The prevalence and costs of diabetes. Accessed March 2011. 110 Carreira MC, Camina JP, Smith RG and Casanueva FF (2004) Agonist-specific coupling of growth hormone secretagogue receptor type 1a to different intracellular signaling systems. Role of adenosine. Neuroendocrinology 79:13-25. Chalkley SM, Hettiarachchi M, Chisholm DJ and Kraegen EW (2002) Long-term high-fat feeding leads to severe insulin resistance but not diabetes in Wistar rats. Am J Physiol Endocrinol Metab 282:E1231-1238. Challis RA, Budohoski L, McManus B and Newsholme EA (1984) Effects of an adenosine- receptor antagonist on insulin-resistance in soleus muscle from obese Zucker rats. Biochem J 221:915-917. Challiss RA, Richards SJ and Budohoski L (1992) Characterization of the adenosine receptor modulating insulin action in rat skeletal muscle. Eur J Pharmacol 226:121-128. Chapal J, Hillaire-Buys D, Bertrand G, Pujalte D, Petit P and Loubatieres-Mariani MM (1997) Comparative effects of adenosine-5'-triphosphate and related analogues on insulin secretion from the rat pancreas. Fundam Clin Pharmacol 11:537-545. Chapal J, Loubatieres-Mariani MM, Petit P and Roye M (1985) Evidence for an A2-subtype adenosine receptor on pancreatic glucagon secreting cells. Br J Pharmacol 86:565-569. Chen JF, Huang Z, Ma J, Zhu J, Moratalla R, Standaert D, Moskowitz MA, Fink JS and Schwarzschild MA (1999) A(2A) adenosine receptor deficiency attenuates brain injury induced by transient focal ischemia in mice. J Neurosci 19:9192-9200. Cheung KK, Coutinho-Silva R, Chan WY and Burnstock G (2007) Early expression of adenosine 5'-triphosphate-gated P2X7 receptors in the developing rat pancreas. Pancreas 35:164-168. Chiba T, Kadowaki S, Taminato T, Chihara K, Seino Y, Matsukura S and Fujita T (1981) Effect of antisomatostatin gamma-globulin on gastrin release in rats. Gastroenterology 81:321- 326. Chiba T and Yamada T (1994) Gut Somatostatin, in Gut Peptides: Biochemistry and Physiology (Walsh JH and Dockray GJ eds) pp 123-145, Raven Press, New York. Choi K, Roh SG, Hong YH, Shrestha YB, Hishikawa D, Chen C, Kojima M, Kangawa K and Sasaki S (2003) The role of ghrelin and growth hormone secretagogues receptor on rat adipogenesis. Endocrinology 144:754-759. Chuang CN, Tanner M, Chen MC, Davidson S and Soll AH (1992) Gastrin induction of histamine release from primary cultures of canine oxyntic mucosal cells. Am J Physiol Gastrointest Liver Physiol 263:G460-465. 111 Colombo M, Gregersen S, Xiao J and Hermansen K (2003) Effects of ghrelin and other neuropeptides (CART, MCH, orexin A and B, and GLP-1) on the release of insulin from isolated rat islets. Pancreas 27:161-166. Colturi TJ, Unger RH and Feldman M (1984) Role of circulating somatostatin in regulation of gastric acid secretion, gastrin release, and islet cell function. Studies in healthy subjects and duodenal ulcer patients. J Clin Invest 74:417-423. Conlay LA, Conant JA, deBros F and Wurtman R (1997) Caffeine alters plasma adenosine levels. Nature 389:136. Conlon JM (1984) Isolation and structure of guinea pig gastric and pancreatic somatostatin. Life Sci 35:213-220. Coutinho-Silva R, Parsons M, Robson T, Lincoln J and Burnstock G (2003) P2X and P2Y purinoceptor expression in pancreas from streptozotocin-diabetic rats. Mol Cell Endocrinol 204:141-154. Coutinho-Silva R, Robson T, Beales PE and Burnstock G (2007) Changes in expression of P2X7 receptors in NOD mouse pancreas during the development of diabetes. Autoimmunity 40:108-116. Cummings DE, Clement K, Purnell JQ, Vaisse C, Foster KE, Frayo RS, Schwartz MW, Basdevant A and Weigle DS (2002) Elevated plasma ghrelin levels in Prader Willi syndrome. Nat Med 8:643-644. Cummings DE, Purnell JQ, Frayo RS, Schmidova K, Wisse BE and Weigle DS (2001) A preprandial rise in plasma ghrelin levels suggests a role in meal initiation in humans. Diabetes 50:1714-1719. Curry DL, Bennett LL and Grodsky GM (1968) Dynamics of insulin secretion by the perfused rat pancreas. Endocrinology 83:572-584. Dass NB, Munonyara M, Bassil AK, Hervieu GJ, Osbourne S, Corcoran S, Morgan M and Sanger GJ (2003) Growth hormone secretagogue receptors in rat and human gastrointestinal tract and the effects of ghrelin. Neuroscience 120:443-453. Date Y, Kojima M, Hosoda H, Sawaguchi A, Mondal MS, Suganuma T, Matsukura S, Kangawa K and Nakazato M (2000a) Ghrelin, a novel growth hormone-releasing acylated peptide, is synthesized in a distinct endocrine cell type in the gastrointestinal tracts of rats and humans. Endocrinology 141:4255-4261. 112 Date Y, Murakami N, Kojima M, Kuroiwa T, Matsukura S, Kangawa K and Nakazato M (2000b) Central effects of a novel acylated peptide, ghrelin, on growth hormone release in rats. Biochem Biophys Res Commun 275:477-480. Date Y, Nakazato M, Hashiguchi S, Dezaki K, Mondal MS, Hosoda H, Kojima M, Kangawa K, Arima T, Matsuo H, Yada T and Matsukura S (2002) Ghrelin is present in pancreatic alpha-cells of humans and rats and stimulates insulin secretion. Diabetes 51:124-129. Date Y, Nakazato M, Murakami N, Kojima M, Kangawa K and Matsukura S (2001) Ghrelin acts in the central nervous system to stimulate gastric acid secretion. Biochem Biophys Res Commun 280:904-907. De Vos A, Heimberg H, Quartier E, Huypens P, Bouwens L, Pipeleers D and Schuit F (1995) Human and rat beta cells differ in glucose transporter but not in glucokinase gene expression. J Clin Invest 96:2489-2495. Decking UK, Schlieper G, Kroll K and Schrader J (1997) Hypoxia-induced inhibition of adenosine kinase potentiates cardiac adenosine release. Circulation research 81:154-164. DeFronzo RA, Ratner RE, Han J, Kim DD, Fineman MS and Baron AD (2005) Effects of exenatide (exendin-4) on glycemic control and weight over 30 weeks in metformin- treated patients with type 2 diabetes. Diabetes Care 28:1092-1100. Delmeire D, Flamez D, Hinke SA, Cali JJ, Pipeleers D and Schuit F (2003) Type VIII adenylyl cyclase in rat beta cells: coincidence signal detector/generator for glucose and GLP-1. Diabetologia 46:1383-1393. DelParigi A, Tschop M, Heiman ML, Salbe AD, Vozarova B, Sell SM, Bunt JC and Tataranni PA (2002) High circulating ghrelin: a potential cause for hyperphagia and obesity in prader-willi syndrome. J Clin Endocrinol Metab 87:5461-5464. DeSchryver-Kecskemeti K, Greider MH, Rieders ER, Komyati SE and McGuigan JE (1981) In vitro gastrin secretion by rat antrum: effects of neurotransmitter agonists, antagonists, and modulators of secretion. Lab Invest 44:158-163. Detimary P, Dejonghe S, Ling Z, Pipeleers D, Schuit F and Henquin JC (1998) The changes in adenine nucleotides measured in glucose-stimulated rodent islets occur in beta cells but not in alpha cells and are also observed in human islets. J Biol Chem 273:33905-33908. Detimary P, Jonas JC and Henquin JC (1995) Possible links between glucose-induced changes in the energy state of pancreatic B cells and insulin release. Unmasking by decreasing a stable pool of adenine nucleotides in mouse islets. J Clin Invest 96:1738-1745. 113 Detimary P, Jonas JC and Henquin JC (1996) Stable and diffusible pools of nucleotides in pancreatic islet cells. Endocrinology 137:4671-4676. Dixon AK, Widdowson L and Richardson PJ (1997) Desensitisation of the adenosine A1 receptor by the A2A receptor in the rat striatum. J Neurochem 69:315-321. Dong Q, Ginsberg HN and Erlanger BF (2001) Overexpression of the A1 adenosine receptor in adipose tissue protects mice from obesity-related insulin resistance. Diabetes Obes Metab 3:360-366. Dornonville de la Cour C, Bjorkqvist M, Sandvik AK, Bakke I, Zhao CM, Chen D and Hakanson R (2001) A-like cells in the rat stomach contain ghrelin and do not operate under gastrin control. Regul Pept 99:141-150. Dyachok O and Gylfe E (2004) Ca(2+)-induced Ca(2+) release via inositol 1,4,5-trisphosphate receptors is amplified by protein kinase A and triggers exocytosis in pancreatic beta-cells. J Biol Chem 279:45455-45461. Dyachok O, Isakov Y, Sagetorp J and Tengholm A (2006) Oscillations of cyclic AMP in hormone-stimulated insulin-secreting beta-cells. Nature 439:349-352. Edkins JS (1905) On the chemical mechanism of gastric secretion. Proc Roy Soc Lond 76:376. Egido EM, Rodriguez-Gallardo J, Silvestre RA and Marco J (2002) Inhibitory effect of ghrelin on insulin and pancreatic somatostatin secretion. Eur J Endocrinol 146:241-244. Ehrmann DA, Sturis J, Byrne MM, Karrison T, Rosenfield RL and Polonsky KS (1995) Insulin secretory defects in polycystic ovary syndrome. Relationship to insulin sensitivity and family history of non-insulin-dependent diabetes mellitus. J Clin Invest 96:520-527. Eliasson L, Abdulkader F, Braun M, Galvanovskis J, Hoppa MB and Rorsman P (2008) Novel aspects of the molecular mechanisms controlling insulin secretion. J Physiol 586:3313- 3324. Eliasson L, Ma X, Renstrom E, Barg S, Berggren PO, Galvanovskis J, Gromada J, Jing X, Lundquist I, Salehi A, Sewing S and Rorsman P (2003) SUR1 regulates PKA- independent cAMP-induced granule priming in mouse pancreatic B-cells. J Gen Physiol 121:181-197. Eliasson L, Renstrom E, Ding WG, Proks P and Rorsman P (1997) Rapid ATP-dependent priming of secretory granules precedes Ca(2+)-induced exocytosis in mouse pancreatic B-cells. J Physiol 503 ( Pt 2):399-412. Elrick H, Stimmler L, Hlad CJ, Jr. and Arai Y (1964) Plasma Insulin Response to Oral and Intravenous Glucose Administration. J Clin Endocrinol Metab 24:1076-1082. 114 Fajans SS (1989) Maturity-onset diabetes of the young (MODY). Diabetes Metab Rev 5:579-606. Farret A, Filhol R, Linck N, Manteghetti M, Vignon J, Gross R and Petit P (2006) P2Y receptor mediated modulation of insulin release by a novel generation of 2-substituted-5'-O-(1- boranotriphosphate)-adenosine analogues. Pharm Res 23:2665-2671. Feldman M, Walsh JH, Wong HC and Richardson CT (1978) Role of gastrin heptadecapeptide in the acid secretory response to amino acids in man. J Clin Invest 61:308-313. Fernandez-Alvarez J, Hillaire-Buys D, Loubatieres-Mariani MM, Gomis R and Petit P (2001) P2 receptor agonists stimulate insulin release from human pancreatic islets. Pancreas 22:69- 71. Fischer B, Chulkin A, Boyer JL, Harden KT, Gendron FP, Beaudoin AR, Chapal J, Hillaire- Buys D and Petit P (1999) 2-thioether 5'-O-(1-thiotriphosphate)adenosine derivatives as new insulin secretagogues acting through P2Y-Receptors. J Med Chem 42:3636-3646. Foord SM, Bonner TI, Neubig RR, Rosser EM, Pin JP, Davenport AP, Spedding M and Harmar AJ (2005) International Union of Pharmacology. XLVI. G protein-coupled receptor list. Pharmacol Rev 57:279-288. Foster LJ, Trudeau WL and Goldman AL (1979) Bronchodilator effects on gastric acid secretion. JAMA 241:2613-2615. Franco R, Casado V, Mallol J, Ferrada C, Ferre S, Fuxe K, Cortes A, Ciruela F, Lluis C and Canela EI (2006) The two-state dimer receptor model: a general model for receptor dimers. Mol Pharmacol 69:1905-1912. Fredholm BB (2007) Adenosine, an endogenous distress signal, modulates tissue damage and repair. Cell Death Differ 14:1315-1323. Fredholm BB, AP IJ, Jacobson KA, Klotz KN and Linden J (2001) International Union of Pharmacology. XXV. Nomenclature and classification of adenosine receptors. Pharmacol Rev 53:527-552. Fujino K, Inui A, Asakawa A, Kihara N, Fujimura M and Fujimiya M (2003) Ghrelin induces fasted motor activity of the gastrointestinal tract in conscious fed rats. J Physiol 550:227- 240. Fujita Y, Wideman RD, Asadi A, Yang GK, Baker R, Webber T, Zhang T, Wang R, Ao Z, Warnock GL, Kwok YN and Kieffer TJ (2010) Glucose-dependent insulinotropic polypeptide is expressed in pancreatic islet alpha-cells and promotes insulin secretion. Gastroenterology 138:1966-1975. 115 Gao ZG, Blaustein JB, Gross AS, Melman N and Jacobson KA (2003) N6-Substituted adenosine derivatives: selectivity, efficacy, and species differences at A3 adenosine receptors. Biochem Pharmacol 65:1675-1684. Gardiner J and Bloom S (2008) Ghrelin gets its GOAT. Cell Metab 7:193-194. Gauna C, Kiewiet RM, Janssen JA, van de Zande B, Delhanty PJ, Ghigo E, Hofland LJ, Themmen AP and van der Lely AJ (2007a) Unacylated ghrelin acts as a potent insulin secretagogue in glucose-stimulated conditions. Am J Physiol Endocrinol Metab 293:E697-704. Gauna C, Uitterlinden P, Kramer P, Kiewiet RM, Janssen JA, Delhanty PJ, van Aken MO, Ghigo E, Hofland LJ, Themmen AP and van der Lely AJ (2007b) Intravenous glucose administration in fasting rats has differential effects on acylated and unacylated ghrelin in the portal and systemic circulation: a comparison between portal and peripheral concentrations in anesthetized rats. Endocrinology 148:5278-5287. Gavin JR, Alberti KGMM, Davidson MB, DeFronzo RA, Drash A, Gabbe SG, Genuth S, Harris MI, Kahn R, Keen H, Knowler WC, Lebovitz H, Maclaren NK, Palmer JP, Raskin P, Rizza RA and Stern MP (2002) Report of the expert committee on the diagnosis and classification of diabetes mellitus. Diabetes Care 25:S5-S20. Gerber JG, Fadul S, Payne NA and Nies AS (1984) Adenosine: a modulator of gastric acid secretion in vivo. J Pharmacol Exp Ther 231:109-113. Gerber JG, Nies AS and Payne NA (1985) Adenosine receptors on canine parietal cells modulate gastric acid secretion to histamine. J Pharmacol Exp Ther 233:623-627. Gerber JG and Payne NA (1988) Endogenous adenosine modulates gastric acid secretion to histamine in canine parietal cells. J Pharmacol Exp Ther 244:190-194. Gerich JE, Charles MA and Grodsky GM (1974) Characterization of the effects of arginine and glucose on glucagon and insulin release from the perfused rat pancreas. J Clin Invest 54:833-841. Glavin GB, Westerberg VS and Geiger JD (1987) Modulation of gastric acid secretion by adenosine in conscious rats. Can J Physiol Pharmacol 65:1182-1185. Gomez G, Englander EW and Greeley GH, Jr. (2004) Nutrient inhibition of ghrelin secretion in the fasted rat. Regul Pept 117:33-36. Gopel SO, Kanno T, Barg S, Weng XG, Gromada J and Rorsman P (2000) Regulation of glucagon release in mouse -cells by KATP channels and inactivation of TTX-sensitive Na+ channels. J Physiol 528:509-520. 116 Granata R, Volante M, Settanni F, Gauna C, Ghe C, Annunziata M, Deidda B, Gesmundo I, Abribat T, van der Lely AJ, Muccioli G, Ghigo E and Papotti M (2010) Unacylated ghrelin and obestatin increase islet cell mass and prevent diabetes in streptozotocin- treated newborn rats. J Mol Endocrinol 45:9-17. Green A (1987) Adenosine receptor down-regulation and insulin resistance following prolonged incubation of adipocytes with an A1 adenosine receptor agonist. J Biol Chem 262:15702- 15707. Green A, Johnson JL and Milligan G (1990) Down-regulation of Gi sub-types by prolonged incubation of adipocytes with an A1 adenosine receptor agonist. J Biol Chem 265:5206- 5210. Gregory RA, Tracy HJ, Harris JI, Runswick MJ, Moore S, Kenner GW and Ramage R (1979) Minigastrin; corrected structure and synthesis. Hoppe-Seyler's Zeitschrift fur physiologische Chemie 360:73-80. Gromada J, Brock B, Schmitz O and Rorsman P (2004) Glucagon-like peptide-1: regulation of insulin secretion and therapeutic potential. Basic Clin Pharmacol Toxicol 95:252-262. Gustavsson S and Lundquist G (1978) Participation of antral somatostatin in the local regulation of gastrin release. Acta endocrinologica 88:339-346. Gutierrez JA, Solenberg PJ, Perkins DR, Willency JA, Knierman MD, Jin Z, Witcher DR, Luo S, Onyia JE and Hale JE (2008) Ghrelin octanoylation mediated by an orphan lipid transferase. Proc Natl Acad Sci U S A 105:6320-6325. Hansen TK, Dall R, Hosoda H, Kojima M, Kangawa K, Christiansen JS and Jorgensen JO (2002) Weight loss increases circulating levels of ghrelin in human obesity. Clin Endocrinol (Oxf) 56:203-206. Hansotia T and Drucker DJ (2005) GIP and GLP-1 as incretin hormones: lessons from single and double incretin receptor knockout mice. Regul Pept 128:125-134. Harty RF, Maico DG, Brown CM and McGuigan JE (1984) Effects of calcium on cholinergic- stimulated gastrin release in the rat. Mol Cell Endocrinol 37:133-138. Hataya Y, Akamizu T, Takaya K, Kanamoto N, Ariyasu H, Saijo M, Moriyama K, Shimatsu A, Kojima M, Kangawa K and Nakao K (2001) A low dose of ghrelin stimulates growth hormone (GH) release synergistically with GH-releasing hormone in humans. J Clin Endocrinol Metab 86:4552. Hazama A, Hayashi S and Okada Y (1998) Cell surface measurements of ATP release from single pancreatic beta cells using a novel biosensor technique. Pflugers Arch 437:31-35. 117 Heimberg H, De Vos A, Pipeleers D, Thorens B and Schuit F (1995) Differences in glucose transporter gene expression between rat pancreatic alpha- and beta-cells are correlated to differences in glucose transport but not in glucose utilization. J Biol Chem 270:8971- 8975. Heldsinger AA, Vinik AI and Fox IH (1986) Inhibition of guinea-pig oxyntic cell function by adenosine and prostaglandins. J Pharmacol Exp Ther 237:351-356. Hellman B, Salehi A, Gylfe E, Dansk H and Grapengiesser E (2009) Glucose Generates Coincident Insulin and Somatostatin Pulses and Antisynchronous Glucagon Pulses from Human Pancreatic Islets. Endocrinology. Hermansen K (1985) Forskolin, an activator of adenylate cyclase, stimulates pancreatic insulin, glucagon, and somatostatin release in the dog: studies in vitro. Endocrinology 116:2251- 2258. Higgins SC, Gueorguiev M and Korbonits M (2007) Ghrelin, the peripheral hunger hormone. Ann Med 39:116-136. Hillaire-Buys D, Bertrand G, Gross R and Loubatieres-Mariani MM (1987) Evidence for an inhibitory A1 subtype adenosine receptor on pancreatic insulin-secreting cells. Eur J Pharmacol 136:109-112. Hoffman BB, Chang H, Dall'Aglio E and Reaven GM (1986) Desensitization of adenosine receptor-mediated inhibition of lipolysis. The mechanism involves the development of enhanced cyclic adenosine monophosphate accumulation in tolerant adipocytes. J Clin Invest 78:185-190. Hollingdal M, Juhl CB, Pincus SM, Sturis J, Veldhuis JD, Polonsky KS, Porksen N and Schmitz O (2000) Failure of physiological plasma glucose excursions to entrain high-frequency pulsatile insulin secretion in type 2 diabetes. Diabetes 49:1334-1340. Holst JJ (2007) The physiology of glucagon-like peptide 1. Physiol Rev 87:1409-1439. Holst JJ, Jensen SL, Knuhtsen S, Nielsen OV and Rehfeld JF (1983) Effect of vagus, gastric inhibitory polypeptide, and HCl on gastrin and somatostatin release from perfused pig antrum. Am J Physiol 244:G515-522. Holz GG, Kang G, Harbeck M, Roe MW and Chepurny OG (2006) Cell physiology of cAMP sensor Epac. J Physiol 577:5-15. Holz GGt, Kuhtreiber WM and Habener JF (1993) Pancreatic beta-cells are rendered glucose- competent by the insulinotropic hormone glucagon-like peptide-1(7-37). Nature 361:362- 365. 118 Hoppa MB, Collins S, Ramracheya R, Hodson L, Amisten S, Zhang Q, Johnson P, Ashcroft FM and Rorsman P (2009) Chronic palmitate exposure inhibits insulin secretion by dissociation of Ca(2+) channels from secretory granules. Cell Metab 10:455-465. Huypens P, Ling Z, Pipeleers D and Schuit F (2000) Glucagon receptors on human islet cells contribute to glucose competence of insulin release. Diabetologia 43:1012-1019. Ishizaki S, Murase T, Sugimura Y, Kakiya S, Yokoi H, Tachikawa K, Arima H, Miura Y and Oiso Y (2002) Role of ghrelin in the regulation of vasopressin release in conscious rats. Endocrinology 143:1589-1593. Ismail NA, El Denshary EE and Montague W (1977) Adenosine and the regulation of insulin secretion by isolated rat islets of Langerhans. Biochem J 164:409-413. Iversen J (1971) Secretion of glucagon from the isolated, perfused canine pancreas. J Clin Invest 50:2123-2136. Jacobson KA (1998) Adenosine A3 receptors: novel ligands and paradoxical effects. Trends Pharmacol Sci 19:184-191. Jacobson KA (2009) Introduction to adenosine receptors as therapeutic targets. Handb Exp Pharmacol:1-24. Jacobson KA and Gao ZG (2006) Adenosine receptors as therapeutic targets. Nat Rev Drug Discov 5:247-264. Jia X, Brown JC, Kwok YN, Pederson RA and McIntosh CH (1994) Gastric inhibitory polypeptide and glucagon-like peptide-1(7-36) amide exert similar effects on somatostatin secretion but opposite effects on gastrin secretion from the rat stomach. Can J Physiol Pharmacol 72:1215-1219. Jiang G and Zhang BB (2003) Glucagon and regulation of glucose metabolism. Am J Physiol Endocrinol Metab 284:E671-678. Johansson B, Halldner L, Dunwiddie TV, Masino SA, Poelchen W, Gimenez-Llort L, Escorihuela RM, Fernandez-Teruel A, Wiesenfeld-Hallin Z, Xu XJ, Hardemark A, Betsholtz C, Herlenius E and Fredholm BB (2001) Hyperalgesia, anxiety, and decreased hypoxic neuroprotection in mice lacking the adenosine A1 receptor. Proc Natl Acad Sci U S A 98:9407-9412. Johansson S, Fredholm BB, Hjort C, Morein T, Kull B and Hu PS (2005) Evidence against adenosine analogues being agonists at the growth hormone secretagogue receptor. Biochem Pharmacol 70:598-605. 119 Johansson SM, Salehi A, Sandstrom ME, Westerblad H, Lundquist I, Carlsson PO, Fredholm BB and Katz A (2007) A1 receptor deficiency causes increased insulin and glucagon secretion in mice. Biochem Pharmacol 74:1628-1635. Johnson DG, Goebel CU, Hruby VJ, Bregman MD and Trivedi D (1982) Hyperglycemia of diabetic rats decreased by a glucagon receptor antagonist. Science 215:1115-1116. Juan CC, Fang VS, Kwok CF, Perng JC, Chou YC and Ho LT (1999) Exogenous hyperinsulinemia causes insulin resistance, hyperendothelinemia, and subsequent hypertension in rats. Metabolism 48:465-471. Kamegai J, Tamura H, Shimizu T, Ishii S, Sugihara H and Oikawa S (2004) Effects of insulin, leptin, and glucagon on ghrelin secretion from isolated perfused rat stomach. Regul Pept 119:77-81. Kamegai J, Tamura H, Shimizu T, Ishii S, Sugihara H and Wakabayashi I (2000) Central effect of ghrelin, an endogenous growth hormone secretagogue, on hypothalamic peptide gene expression. Endocrinology 141:4797-4800. Kamegai J, Tamura H, Shimizu T, Ishii S, Sugihara H and Wakabayashi I (2001) Chronic central infusion of ghrelin increases hypothalamic neuropeptide Y and Agouti-related protein mRNA levels and body weight in rats. Diabetes 50:2438-2443. Kameoka J, Tanaka T, Nojima Y, Schlossman SF and Morimoto C (1993) Direct association of adenosine deaminase with a T cell activation antigen, CD26. Science 261:466-469. Kang G, Chepurny OG, Rindler MJ, Collis L, Chepurny Z, Li WH, Harbeck M, Roe MW and Holz GG (2005) A cAMP and Ca2+ coincidence detector in support of Ca2+-induced Ca2+ release in mouse pancreatic beta cells. J Physiol 566:173-188. Kanno T, Suga S, Wu J, Kimura M and Wakui M (1998) Intracellular cAMP potentiates voltage- dependent activation of L-type Ca2+ channels in rat islet beta-cells. Pflugers Arch 435:578-580. Kashima Y, Miki T, Shibasaki T, Ozaki N, Miyazaki M, Yano H and Seino S (2001) Critical role of cAMP-GEFII--Rim2 complex in incretin-potentiated insulin secretion. J Biol Chem 276:46046-46053. Kieffer TJ, Heller RS, Unson CG, Weir GC and Habener JF (1996) Distribution of glucagon receptors on hormone-specific endocrine cells of rat pancreatic islets. Endocrinology 137:5119-5125. 120 Kieffer TJ, McIntosh CH and Pederson RA (1995) Degradation of glucose-dependent insulinotropic polypeptide and truncated glucagon-like peptide 1 in vitro and in vivo by dipeptidyl peptidase IV. Endocrinology 136:3585-3596. Kirchner H, Gutierrez JA, Solenberg PJ, Pfluger PT, Czyzyk TA, Willency JA, Schurmann A, Joost HG, Jandacek RJ, Hale JE, Heiman ML and Tschop MH (2009) GOAT links dietary lipids with the endocrine control of energy balance. Nat Med 15:741-745. Klein HH, Ciaraldi TP, Freidenberg GR and Olefsky JM (1987) Adenosine modulates insulin activation of insulin receptor kinase in intact rat adipocytes. Endocrinology 120:2339- 2345. Klotz KN, Hessling J, Hegler J, Owman C, Kull B, Fredholm BB and Lohse MJ (1998) Comparative pharmacology of human adenosine receptor subtypes - characterization of stably transfected receptors in CHO cells. Naunyn-Schmiedeberg's archives of pharmacology 357:1-9. Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H and Kangawa K (1999) Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402:656-660. Kojima M and Kangawa K (2005) Ghrelin: structure and function. Physiol Rev 85:495-522. Koop H, Behrens I, Bothe E, McIntosh CH, Pederson RA, Arnold R and Creutzfeldt W (1982) Adrenergic and cholinergic interactions in rat gastric somatostatin and gastrin release. Digestion 25:96-102. Koop H, Behrens I, McIntosh CH, Pederson RA, Arnold R and Creutzfeldt W (1980) Adrenergic modulation of gastric somatostatin release in rats. FEBS Lett 118:248-250. Kopin AS, Lee YM, McBride EW, Miller LJ, Lu M, Lin HY, Kolakowski LF, Jr. and Beinborn M (1992) Expression cloning and characterization of the canine parietal cell gastrin receptor. Proc Natl Acad Sci U S A 89:3605-3609. Korbonits M, Gueorguiev M, O'Grady E, Lecoeur C, Swan DC, Mein CA, Weill J, Grossman AB and Froguel P (2002) A variation in the ghrelin gene increases weight and decreases insulin secretion in tall, obese children. J Clin Endocrinol Metab 87:4005-4008. Kovoor A, Celver JP, Wu A and Chavkin C (1998) Agonist induced homologous desensitization of mu-opioid receptors mediated by G protein-coupled receptor kinases is dependent on agonist efficacy. Molecular pharmacology 54:704-711. Krasnow S and Grossman MI (1949) Stimulation of gastric secretion in man by theophylline ethylenediamine. Proc Soc Exp Biol Med 71:335. 121 Kusumoto Y, Iwanaga T, Ito S and Fujita T (1979) Juxtaposition of somatostatin cell and parietal cell in the dog stomach. Arch Histol Jpn 42:459-465. Kwok YN, McIntosh C and Brown J (1990) Augmentation of release of gastric somatostatin-like immunoreactivity by adenosine, adenosine triphosphate and their analogs. J Pharmacol Exp Ther 255:781-788. Kwok YN, McIntosh CH, Sy H and Brown JC (1988) Inhibitory actions of tachykinins and neurokinins on release of somatostatin-like immunoreactivity from the isolated perfused rat stomach. J Pharmacol Exp Ther 246:726-731. Lai KM and Wong PC (1991) A comparison of the properties of 5'-nucleotidase purified from the cytosolic and synaptic plasma membrane fractions of rat forebrain. Int J Biochem 23:1123-1130. Lang DA, Matthews DR, Burnett M and Turner RC (1981) Brief, irregular oscillations of basal plasma insulin and glucose concentrations in diabetic man. Diabetes 30:435-439. Langfort J, Budohoski L, Dubaniewicz A, Challiss RA and Newsholme EA (1993) Exercise- induced improvement in the sensitivity of the rat soleus muscle to insulin is reversed by chloroadenosine--the adenosine receptor agonist. Biochem Med Metab B 50:18-23. Larsson LI, Goltermann N, de Magistris L, Rehfeld JF and Schwartz TW (1979) Somatostatin cell processes as pathways for paracrine secretion. Science 205:1393-1395. Lavoie EG, Fausther M, Kauffenstein G, Kukulski F, Kunzli BM, Friess H and Sevigny J (2010) Identification of the ectonucleotidases expressed in mouse, rat, and human Langerhans islets: potential role of NTPDase3 in insulin secretion. Am J Physiol Endocrinol Metab 299:E647-656. Lawrence CB, Snape AC, Baudoin FM and Luckman SM (2002) Acute central ghrelin and GH secretagogues induce feeding and activate brain appetite centers. Endocrinology 143:155- 162. Lee KY, Tai HH and Chey WY (1976) Plasma secretin and gastrin responses to a meat meal and duodenal acidification in dogs. Am J Physiol 230:784-789. Leite-Moreira AF and Soares JB (2007) Physiological, pathological and potential therapeutic roles of ghrelin. Drug Discov Today 12:276-288. Leitner JW, Sussman KE, Vatter AE and Schneider FH (1975) Adenine nucleotides in the secretory granule fraction of rat islets. Endocrinology 96:662-677. 122 Leon C, Freund M, Latchoumanin O, Farret A, Petit P, Cazenave JP and Gachet C (2005) The P2Y(1) receptor is involved in the maintenance of glucose homeostasis and in insulin secretion in mice. Purinerg Signal 1:145-151. Lester LB, Faux MC, Nauert JB and Scott JD (2001) Targeted protein kinase A and PP-2B regulate insulin secretion through reversible phosphorylation. Endocrinology 142:1218- 1227. Leung YM, Ahmed I, Sheu L, Tsushima RG, Diamant NE and Gaisano HY (2006) Two populations of pancreatic islet alpha-cells displaying distinct Ca2+ channel properties. Biochem Biophys Res Commun 345:340-344. Levine RA, Oyama S, Kagan A and Glick SM (1970) Stimulation of insulin and growth hormone secretion by adenine nucleotides in primates. J Lab Clin Med 75:30-36. Lippl F, Kircher F, Erdmann J, Allescher HD and Schusdziarra V (2004) Effect of GIP, GLP-1, insulin and gastrin on ghrelin release in the isolated rat stomach. Regul Pept 119:93-98. Liu YJ, Grapengiesser E, Gylfe E and Hellman B (1996) Crosstalk between the cAMP and inositol trisphosphate-signalling pathways in pancreatic beta-cells. Arch Biochem Biophys 334:295-302. Llanos OL, Villar HV, Konturek SJ, Rayford PL and Thompson JC (1977) Release of antral and duodenal gastrin in response to an intestinal meal. Ann Surg 186:614-618. Loubatieres-Mariani MM, Chapal J, Lignon F and Valette G (1979) Structural specificity of nucleotides for insulin secretory action from the isolated perfused rat pancreas. Eur J Pharmacol 59:277-286. Luciani DS, Ao P, Hu X, Warnock GL and Johnson JD (2007) Voltage-gated Ca(2+) influx and insulin secretion in human and mouse beta-cells are impaired by the mitochondrial Na(+)/Ca(2+) exchange inhibitor CGP-37157. Eur J Pharmacol 576:18-25. Lugo-Garcia L, Filhol R, Lajoix AD, Gross R, Petit P and Vignon J (2007) Expression of purinergic P2Y receptor subtypes by INS-1 insulinoma beta-cells: a molecular and binding characterization. Eur J Pharmacol 568:54-60. MacDonald PE, Braun M, Galvanovskis J and Rorsman P (2006) Release of small transmitters through kiss-and-run fusion pores in rat pancreatic beta cells. Cell Metab 4:283-290. MacDonald PE, De Marinis YZ, Ramracheya R, Salehi A, Ma X, Johnson PR, Cox R, Eliasson L and Rorsman P (2007) A K ATP channel-dependent pathway within alpha cells regulates glucagon release from both rodent and human islets of Langerhans. PLoS Biol 5:e143. 123 MacDonald PE, Obermuller S, Vikman J, Galvanovskis J, Rorsman P and Eliasson L (2005) Regulated exocytosis and kiss-and-run of synaptic-like microvesicles in INS-1 and primary rat beta-cells. Diabetes 54:736-743. Madsbad S, Schmitz O, Ranstam J, Jakobsen G and Matthews DR (2004) Improved glycemic control with no weight increase in patients with type 2 diabetes after once-daily treatment with the long-acting glucagon-like peptide 1 analog liraglutide (NN2211): a 12-week, double-blind, randomized, controlled trial. Diabetes Care 27:1335-1342. Mager U, Degenhardt T, Pulkkinen L, Kolehmainen M, Tolppanen AM, Lindstrom J, Eriksson JG, Carlberg C, Tuomilehto J and Uusitupa M (2008) Variations in the ghrelin receptor gene associate with obesity and glucose metabolism in individuals with impaired glucose tolerance. PLoS One 3:e2941. Mager U, Kolehmainen M, Lindstrom J, Eriksson JG, Valle TT, Hamalainen H, Ilanne-Parikka P, Keinanen-Kiukaanniemi S, Tuomilehto JO, Pulkkinen L and Uusitupa MI (2006a) Association between ghrelin gene variations and blood pressure in subjects with impaired glucose tolerance. Am J Hypertens 19:920-926. Mager U, Lindi V, Lindstrom J, Eriksson JG, Valle TT, Hamalainen H, Ilanne-Parikka P, Keinanen-Kiukaanniemi S, Tuomilehto J, Laakso M, Pulkkinen L and Uusitupa M (2006b) Association of the Leu72Met polymorphism of the ghrelin gene with the risk of Type 2 diabetes in subjects with impaired glucose tolerance in the Finnish Diabetes Prevention Study. Diabet Med 23:685-689. Makino Y, Hosoda H, Shibata K, Makino I, Kojima M, Kangawa K and Kawarabayashi T (2002) Alteration of plasma ghrelin levels associated with the blood pressure in pregnancy. Hypertension 39:781-784. Martin B, Lopez de Maturana R, Brenneman R, Walent T, Mattson MP and Maudsley S (2005) Class II G protein-coupled receptors and their ligands in neuronal function and protection. Neuromolecular Med 7:3-36. Masuda Y, Tanaka T, Inomata N, Ohnuma N, Tanaka S, Itoh Z, Hosoda H, Kojima M and Kangawa K (2000) Ghrelin stimulates gastric acid secretion and motility in rats. Biochem Biophys Res Commun 276:905-908. Matsumoto M, Hosoda H, Kitajima Y, Morozumi N, Minamitake Y, Tanaka S, Matsuo H, Kojima M, Hayashi Y and Kangawa K (2001) Structure-activity relationship of ghrelin: pharmacological study of ghrelin peptides. Biochem Biophys Res Commun 287:142-146. 124 Matthews DR, Lang DA, Burnett MA and Turner RC (1983) Control of pulsatile insulin secretion in man. Diabetologia 24:231-237. Mayer G, Arnold R, Feurle G, Fuchs K, Ketterer H, Track NS and Creutzfeldt W (1974) Influence of feeding and sham feeding upon serum gastrin and gastric acid secretion in control subjects and duodenal ulcer patients. Scand J Gastroenterol 9:703-710. McConalogue K and Furness JB (1994) Gastrointestinal neurotransmitters. Baillieres Clin Endocrinol Metab 8:51-76. McCowen KC, Maykel JA, Bistrian BR and Ling PR (2002) Circulating ghrelin concentrations are lowered by intravenous glucose or hyperinsulinemic euglycemic conditions in rodents. J Endocrinol 175:R7-11. McIntosh CH, Kwok YN, Mordhorst T, Nishimura E, Pederson RA and Brown JC (1983) Enkephalinergic control of somatostatin secretion from the perfused rat stomach. Can J Physiol Pharmacol 61:657-663. McIntosh CH, Kwok YN, Tang C and Brown JC (1987) The use of monoclonal antibodies in radioimmunoassays for gastrointestinal hormones. J Clin Immunoassay 10:679-684. McIntosh CH, Pederson RA, Koop H and Brown JC (1981) Gastric inhibitory polypeptide stimulated secretion of somatostatinlike immunoreactivity from the stomach: inhibition by acetylcholine or vagal stimulation. Can J Physiol Pharmacol 59:468-472. McIntosh CH, Tang CL, Malcolm AJ, Ho M, Kwok YN and Brown JC (1991) Effect of a purified somatostatin monoclonal antibody and its Fab fragments on gastrin release. Am J Physiol 260:G489-498. McIntosh CH, Widenmaier S and Kim SJ (2009) Glucose-dependent insulinotropic polypeptide (Gastric Inhibitory Polypeptide; GIP). Vitam Horm 80:409-471. McKenzie FR, Adie EJ and Milligan G (1991) Prostanoid-mediated downregulation of Gs in NG108-15 cells. Biochem Soc Trans 19:81S. Michael DJ, Ritzel RA, Haataja L and Chow RH (2006) Pancreatic beta-cells secrete insulin in fast- and slow-release forms. Diabetes 55:600-607. Milligan G (1993) Agonist regulation of cellular G protein levels and distribution: mechanisms and functional implications. Trends Pharmacol Sci 14:413-418. Minami K, Yokokura M, Ishizuka N and Seino S (2002) Normalization of intracellular Ca(2+) induces a glucose-responsive state in glucose-unresponsive beta-cells. J Biol Chem 277:25277-25282. 125 Mitrakou A, Kelley D, Mokan M, Veneman T, Pangburn T, Reilly J and Gerich J (1992) Role of reduced suppression of glucose production and diminished early insulin release in impaired glucose tolerance. N Engl J Med 326:22-29. Mizoguchi A, Eguchi N, Kimura K, Kiyohara Y, Qu WM, Huang ZL, Mochizuki T, Lazarus M, Kobayashi T, Kaneko T, Narumiya S, Urade Y and Hayaishi O (2001) Dominant localization of prostaglandin D receptors on arachnoid trabecular cells in mouse basal forebrain and their involvement in the regulation of non-rapid eye movement sleep. Proc Natl Acad Sci U S A 98:11674-11679. Mizutani M, Atsuchi K, Asakawa A, Matsuda N, Fujimura M, Inui A, Kato I and Fujimiya M (2009) Localization of acyl ghrelin- and des-acyl ghrelin-immunoreactive cells in the rat stomach and their responses to intragastric pH. Am J Physiol Gastrointest Liver Physiol 297:G974-980. Moens K, Heimberg H, Flamez D, Huypens P, Quartier E, Ling Z, Pipeleers D, Gremlich S, Thorens B and Schuit F (1996) Expression and functional activity of glucagon, glucagon- like peptide I, and glucose-dependent insulinotropic peptide receptors in rat pancreatic islet cells. Diabetes 45:257-261. Monteleone P, Bencivenga R, Longobardi N, Serritella C and Maj M (2003) Differential responses of circulating ghrelin to high-fat or high-carbohydrate meal in healthy women. J Clin Endocrinol Metab 88:5510-5514. Moro S, Gao ZG, Jacobson KA and Spalluto G (2006) Progress in the pursuit of therapeutic adenosine receptor antagonists. Med Res Rev 26:131-159. Moser GH, Schrader J and Deussen A (1989) Turnover of adenosine in plasma of human and dog blood. Am J Physiol 256:C799-806. Mozid AM, Tringali G, Forsling ML, Hendricks MS, Ajodha S, Edwards R, Navarra P, Grossman AB and Korbonits M (2003) Ghrelin is released from rat hypothalamic explants and stimulates corticotrophin-releasing hormone and arginine-vasopressin. Horm Metab Res 35:455-459. Muller AF, Lamberts SW, Janssen JA, Hofland LJ, Koetsveld PV, Bidlingmaier M, Strasburger CJ, Ghigo E and Van der Lely AJ (2002) Ghrelin drives GH secretion during fasting in man. Eur J Endocrinol 146:203-207. Muller WA, Faloona GR, Aguilar-Parada E and Unger RH (1970) Abnormal alpha-cell function in diabetes. Response to carbohydrate and protein ingestion. N Engl J Med 283:109-115. 126 Murata M, Okimura Y, Iida K, Matsumoto M, Sowa H, Kaji H, Kojima M, Kangawa K and Chihara K (2002) Ghrelin modulates the downstream molecules of insulin signaling in hepatoma cells. J Biol Chem 277:5667-5674. Murdolo G, Lucidi P, Di Loreto C, Parlanti N, De Cicco A, Fatone C, Fanelli CG, Bolli GB, Santeusanio F and De Feo P (2003) Insulin is required for prandial ghrelin suppression in humans. Diabetes 52:2923-2927. Nagaya N, Kojima M, Uematsu M, Yamagishi M, Hosoda H, Oya H, Hayashi Y and Kangawa K (2001a) Hemodynamic and hormonal effects of human ghrelin in healthy volunteers. Am J Physiol Regul Integr Comp Physiol 280:R1483-1487. Nagaya N, Miyatake K, Uematsu M, Oya H, Shimizu W, Hosoda H, Kojima M, Nakanishi N, Mori H and Kangawa K (2001b) Hemodynamic, renal, and hormonal effects of ghrelin infusion in patients with chronic heart failure. J Clin Endocrinol Metab 86:5854-5859. Nakata H, Suzuki T, Namba K and Oyanagi K (2010) Dimerization of G protein-coupled purinergic receptors: increasing the diversity of purinergic receptor signal responses and receptor functions. J Recept Signal Transduct Res 30:337-346. Nakazato M, Murakami N, Date Y, Kojima M, Matsuo H, Kangawa K and Matsukura S (2001) A role for ghrelin in the central regulation of feeding. Nature 409:194-198. Namiot Z, Rutkiewicz J, Stasiewicz J, Baranczuk E and Marcinkiewicz M (1991) Adenosine deaminase activity in the gastric mucosa in patients with gastric ulcer. Effects of ranitidine and sucralfate. Eur J Pharmacol 205:101-103. Namiot Z, Rutkiewicz J, Stasiewicz J and Gorski J (1990) Adenosine deaminase activity in the human gastric mucosa in relation to acid secretion. Digestion 45:172-175. Nauck MA, Heimesaat MM, Orskov C, Holst JJ, Ebert R and Creutzfeldt W (1993) Preserved incretin activity of glucagon-like peptide 1 [7-36 amide] but not of synthetic human gastric inhibitory polypeptide in patients with type-2 diabetes mellitus. J Clin Invest 91:301-307. Novak I (2008) Purinergic receptors in the endocrine and exocrine pancreas. Purinergic Signal 4:237-253. O'Meara NM, Sturis J, Van Cauter E and Polonsky KS (1993) Lack of control by glucose of ultradian insulin secretory oscillations in impaired glucose tolerance and in non-insulin- dependent diabetes mellitus. J Clin Invest 92:262-271. O'Rahilly S, Turner RC and Matthews DR (1988) Impaired pulsatile secretion of insulin in relatives of patients with non-insulin-dependent diabetes. N Engl J Med 318:1225-1230. 127 Obermuller S, Lindqvist A, Karanauskaite J, Galvanovskis J, Rorsman P and Barg S (2005) Selective nucleotide-release from dense-core granules in insulin-secreting cells. J Cell Sci 118:4271-4282. Okumura H, Nagaya N, Enomoto M, Nakagawa E, Oya H and Kangawa K (2002) Vasodilatory effect of ghrelin, an endogenous peptide from the stomach. J Cardiovasc Pharmacol 39:779-783. Oliver JR, Williams VL and Wright PH (1976) Studies on glucagon secretion using isolated islets of Langerhans of the rat. Diabetologia 12:301-306. Olsen HL, Hoy M, Zhang W, Bertorello AM, Bokvist K, Capito K, Efanov AM, Meister B, Thams P, Yang SN, Rorsman P, Berggren PO and Gromada J (2003) Phosphatidylinositol 4-kinase serves as a metabolic sensor and regulates priming of secretory granules in pancreatic beta cells. Proc Natl Acad Sci U S A 100:5187-5192. Ota S, Hiraishi H, Terano A, Mutoh H, Kurachi Y, Shimada T, Ivey KJ and Sugimoto T (1989) Effect of adenosine and adenosine analogs on [14C]aminopyrine accumulation by rabbit parietal cells. Dig Dis Sci 34:1882-1889. Otto B, Cuntz U, Fruehauf E, Wawarta R, Folwaczny C, Riepl RL, Heiman ML, Lehnert P, Fichter M and Tschop M (2001) Weight gain decreases elevated plasma ghrelin concentrations of patients with anorexia nervosa. Eur J Endocrinol 145:669-673. Overduin J, Frayo RS, Grill HJ, Kaplan JM and Cummings DE (2005) Role of the duodenum and macronutrient type in ghrelin regulation. Endocrinology 146:845-850. Ozaki N, Shibasaki T, Kashima Y, Miki T, Takahashi K, Ueno H, Sunaga Y, Yano H, Matsuura Y, Iwanaga T, Takai Y and Seino S (2000) cAMP-GEFII is a direct target of cAMP in regulated exocytosis. Nat Cell Biol 2:805-811. Parkinson FE, Xiong W and Zamzow CR (2005) Astrocytes and neurons: different roles in regulating adenosine levels. Neurol Res 27:153-160. Parsons TD, Coorssen JR, Horstmann H and Almers W (1995) Docked granules, the exocytic burst, and the need for ATP hydrolysis in endocrine cells. Neuron 15. Pederson RA, Satkunarajah M, McIntosh CH, Scrocchi LA, Flamez D, Schuit F, Drucker DJ and Wheeler MB (1998) Enhanced glucose-dependent insulinotropic polypeptide secretion and insulinotropic action in glucagon-like peptide 1 receptor -/- mice. Diabetes 47:1046- 1052. Peeters TL (2006) Potential of ghrelin as a therapeutic approach for gastrointestinal motility disorders. Curr Opin Pharmacol 6:553-558. 128 Peino R, Baldelli R, Rodriguez-Garcia J, Rodriguez-Segade S, Kojima M, Kangawa K, Arvat E, Ghigo E, Dieguez C and Casanueva FF (2000) Ghrelin-induced growth hormone secretion in humans. Eur J Endocrinol 143:R11-14. Peng Z, Fernandez P, Wilder T, Yee H, Chiriboga L, Chan ES and Cronstein BN (2008) Ecto-5'- nucleotidase (CD73)-mediated extracellular adenosine production plays a critical role in hepatic fibrosis. Nucleos Nucleot Nucl 27:821-824. Penman E, Wass JA, Medbak S, Morgan L, Lewis JM, Besser GM and Rees LH (1981) Response of circulating immunoreactive somatostatin to nutritional stimuli in normal subjects. Gastroenterology 81:692-699. Perley MJ and Kipnis DM (1967) Plasma insulin responses to oral and intravenous glucose: studies in normal and diabetic sujbjects. J Clin Invest 46:1954-1962. Petit P, Hillaire-Buys D, Manteghetti M, Debrus S, Chapal J and Loubatieres-Mariani MM (1998) Evidence for two different types of P2 receptors stimulating insulin secretion from pancreatic B cell. Brit J Pharmacol 125:1368-1374. Petrack B, Czernik AJ, Ansell J and Cassidy J (1981) Potentiation of arginine-induced glucagon secretion by adenosine. Life sciences 28:2611-2615. Pettersson I, Muccioli G, Granata R, Deghenghi R, Ghigo E, Ohlsson C and Isgaard J (2002) Natural (ghrelin) and synthetic (hexarelin) GH secretagogues stimulate H9c2 cardiomyocyte cell proliferation. J Endocrinol 175:201-209. Pfluger PT, Kirchner H, Gunnel S, Schrott B, Perez-Tilve D, Fu S, Benoit SC, Horvath T, Joost HG, Wortley KE, Sleeman MW and Tschop MH (2008) Simultaneous deletion of ghrelin and its receptor increases motor activity and energy expenditure. Am J Physiol Gastrointest Liver Physiol 294:G610-618. Pham T, Carrega L, Sauze N, Fund-Saunier O, Devaux C, Peragut JC, Saadjian A and Guieu R (2003) Supraspinal antinociceptive effects of mu and delta agonists involve modulation of adenosine uptake. Anesthesiology 98:459-464. Phillip J, Domschke S, Domschke W, Urbach HJ, Reiss M and Demling L (1977) Inhibition by somatostatin of gastrin release and gastric acid responses to meals and to pentagastrin in man. Scand J Gastroenterol 12:261-265. Phillis JW, O'Regan MH and Perkins LM (1992) Measurement of rat plasma adenosine levels during normoxia and hypoxia. Life Sci 51:PL149-152. 129 Polonsky KS, Given BD, Hirsch LJ, Tillil H, Shapiro ET, Beebe C, Frank BH, Galloway JA and Van Cauter E (1988) Abnormal patterns of insulin secretion in non-insulin-dependent diabetes mellitus. N Engl J Med 318:1231-1239. Poulsen CR, Bokvist K, Olsen HL, Hoy M, Capito K, Gilon P and Gromada J (1999) Multiple sites of purinergic control of insulin secretion in mouse pancreatic beta-cells. Diabetes 48:2171-2181. Poykko S, Ukkola O, Kauma H, Savolainen MJ and Kesaniemi YA (2003) Ghrelin Arg51Gln mutation is a risk factor for Type 2 diabetes and hypertension in a random sample of middle-aged subjects. Diabetologia 46:455-458. Prinster SC, Hague C and Hall RA (2005) Heterodimerization of g protein-coupled receptors: specificity and functional significance. Pharmacol Rev 57:289-298. Puurunen J, Ruoff HJ and Schwabe U (1987) Lack of direct effect of adenosine on the parietal cell function in the rat. Pharmacol Toxicol 60:315-317. Rehfeld JF, Stadil F and Vikelsoe J (1974) Immunoreactive gastrin components in human serum. Gut 15:102-111. Renstrom E, Eliasson L and Rorsman P (1997) Protein kinase A-dependent and -independent stimulation of exocytosis by cAMP in mouse pancreatic B-cells. J Physiol 502 ( Pt 1):105-118. Rindi G, Necchi V, Savio A, Torsello A, Zoli M, Locatelli V, Raimondo F, Cocchi D and Solcia E (2002) Characterisation of gastric ghrelin cells in man and other mammals: studies in adult and fetal tissues. Histochem Cell Biol 117:511-519. Roche S, Bali JP, Galleyrand JC and Magous R (1991) Characterization of a gastrin-type receptor on rabbit gastric parietal cells using L365,260 and L364,718. Am J Physiol 260:G182-188. Rodriguez Candela JL and Garcia-Fernandez MC (1963) Stimulation of secretion of insulin by adenosine-triphosphate. Nature 197:1210. Rogachev B, Ziv NY, Mazar J, Nakav S, Chaimovitz C, Zlotnik M and Douvdevani A (2006) Adenosine is upregulated during peritonitis and is involved in downregulation of inflammation. Kidney Int 70:675-681. Rorsman P, Salehi SA, Abdulkader F, Braun M and MacDonald PE (2008) K(ATP)-channels and glucose-regulated glucagon secretion. Trends Endocrinol Metab 19:277-284. 130 Sakata I, Nakamura K, Yamazaki M, Matsubara M, Hayashi Y, Kangawa K and Sakai T (2002) Ghrelin-producing cells exist as two types of cells, closed- and opened-type cells, in the rat gastrointestinal tract. Peptides 23:531-536. Salehi A, Parandeh F, Fredholm BB, Grapengiesser E and Hellman B (2009) Absence of adenosine A(1) receptors unmasks pulses of insulin release and prolongs those of glucagon and somatostatin. Life Sci. Sarau HM, Foley J, Moonsammy G and Wiebelhaus VD (1975) Metabolism of dog gastric mucosa. Nucleotide levels in parietal cells. J Biol Chem 250:8321-8329. Schaller G, Schmidt A, Pleiner J, Woloszczuk W, Wolzt M and Luger A (2003) Plasma ghrelin concentrations are not regulated by glucose or insulin: a double-blind, placebo-controlled crossover clamp study. Diabetes 52:16-20. Schepp W, Soll AH and Walsh JH (1990) Dual modulation by adenosine of gastrin release from canine G-cells in primary culture. Am J Physiol 259:G556-563. Schubert ML, Edwards NF and Makhlouf GM (1988) Regulation of gastric somatostatin secretion in the mouse by luminal acidity: a local feedback mechanism. Gastroenterology 94:317-322. Schubert ML and Peura DA (2008) Control of gastric acid secretion in health and disease. Gastroenterology 134:1842-1860. Schubert P, Komp W and Kreutzberg GW (1979) Correlation of 5'-nucleotidase activity and selective transneuronal transfer of adenosine in the hippocampus. Brain research 168:419-424. Seino S, Takahashi H, Fujimoto W and Shibasaki T (2009) Roles of cAMP signalling in insulin granule exocytosis. Diabetes Obes Metab 11 Suppl 4:180-188. Seoane LM, Tovar S, Baldelli R, Arvat E, Ghigo E, Casanueva FF and Dieguez C (2000) Ghrelin elicits a marked stimulatory effect on GH secretion in freely-moving rats. Eur J Endocrinol 143:R7-9. Sherwood L (2010) Human Physiology: From Cells to Systems, 7th ed. Brooks/Cole, Belmont. Shiiya T, Nakazato M, Mizuta M, Date Y, Mondal MS, Tanaka M, Nozoe S, Hosoda H, Kangawa K and Matsukura S (2002) Plasma ghrelin levels in lean and obese humans and the effect of glucose on ghrelin secretion. J Clin Endocrinol Metab 87:240-244. Shimada M, Date Y, Mondal MS, Toshinai K, Shimbara T, Fukunaga K, Murakami N, Miyazato M, Kangawa K, Yoshimatsu H, Matsuo H and Nakazato M (2003) Somatostatin 131 suppresses ghrelin secretion from the rat stomach. Biochem Biophys Res Commun 302:520-525. Shintani M, Ogawa Y, Ebihara K, Aizawa-Abe M, Miyanaga F, Takaya K, Hayashi T, Inoue G, Hosoda K, Kojima M, Kangawa K and Nakao K (2001) Ghrelin, an endogenous growth hormone secretagogue, is a novel orexigenic peptide that antagonizes leptin action through the activation of hypothalamic neuropeptide Y/Y1 receptor pathway. Diabetes 50:227-232. Silva AP, Bethmann K, Raulf F and Schmid HA (2005) Regulation of ghrelin secretion by somatostatin analogs in rats. Eur J Endocrinol 152:887-894. Smith RG, Griffin PR, Xu Y, Smith AG, Liu K, Calacay J, Feighner SD, Pong C, Leong D, Pomes A, Cheng K, Van der Ploeg LH, Howard AD, Schaeffer J and Leonard RJ (2000) Adenosine: A partial agonist of the growth hormone secretagogue receptor. Biochem Biophys Res Commun 276:1306-1313. Soll AH (1978) The actions of secretagogues on oxygen uptake by isolated mammalian parietal cells. J Clin Invest 61:370-380. Soll AH, Amirian DA, Park J, Elashoff JD and Yamada T (1985) Cholecystokinin potently releases somatostatin from canine fundic mucosal cells in short-term culture. Am J Physiol 248:G569-573. Spellman CW (2007) Islet cell dysfunction in progression to diabetes mellitus. J Am Osteopath Assoc 107 Suppl:S1-5. Stam NJ, Klomp J, Van de Heuvel N and Olijve W (1996) Molecular cloning and characterization of a novel orphan receptor (P2P) expressed in human pancreas that shows high structural homology to the P2U purinoceptor. FEBS letters 384:260-264. Stephenson RP (1956) A modification of receptor theory. Brit J Pharm Chemoth 11:379-393. Sturis J, Pugh WL, Tang J, Ostrega DM, Polonsky JS and Polonsky KS (1994) Alterations in pulsatile insulin secretion in the Zucker diabetic fatty rat. Am J Physiol 267:E250-259. Sturis J, Van Cauter E, Blackman JD and Polonsky KS (1991) Entrainment of pulsatile insulin secretion by oscillatory glucose infusion. J Clin Invest 87:439-445. Su C, Bevan JA and Burnstock G (1971) [3H]adenosine triphosphate: release during stimulation of enteric nerves. Science 173:336-338. Suzuki M, Fujikura K, Inagaki N, Seino S and Takata K (1997) Localization of the ATP- sensitive K+ channel subunit Kir6.2 in mouse pancreas. Diabetes 46:1440-1444. 132 Tack J, Depoortere I, Bisschops R, Verbeke K, Janssens J and Peeters T (2005) Influence of ghrelin on gastric emptying and meal-related symptoms in idiopathic gastroparesis. Aliment Pharmacol Ther 22:847-853. Takaya K, Ariyasu H, Kanamoto N, Iwakura H, Yoshimoto A, Harada M, Mori K, Komatsu Y, Usui T, Shimatsu A, Ogawa Y, Hosoda K, Akamizu T, Kojima M, Kangawa K and Nakao K (2000) Ghrelin strongly stimulates growth hormone release in humans. J Clin Endocrinol Metab 85:4908-4911. Tanaka M, Naruo T, Muranaga T, Yasuhara D, Shiiya T, Nakazato M, Matsukura S and Nozoe S (2002) Increased fasting plasma ghrelin levels in patients with bulimia nervosa. Eur J Endocrinol 146:R1-3. Tannenbaum GS and Bowers CY (2001) Interactions of growth hormone secretagogues and growth hormone-releasing hormone/somatostatin. Endocrine 14:21-27. Tengholm A and Gylfe E (2009) Oscillatory control of insulin secretion. Mol Cell Endocrinol 297:58-72. Teresa Vallejo-Cremades M, Gomez de Segura IA, Gomez-Garcia L, Perez-Vicente J and De Miguel E (2005) A high-protein dietary treatment to intestinally hypotrophic rats induces ghrelin mRNA content and serum peptide level changes. Clin Nutr 24:904-912. Tolle V, Zizzari P, Tomasetto C, Rio MC, Epelbaum J and Bluet-Pajot MT (2001) In vivo and in vitro effects of ghrelin/motilin-related peptide on growth hormone secretion in the rat. Neuroendocrinology 73:54-61. Topfer M, Burbiel CE, Muller CE, Knittel J and Verspohl EJ (2008) Modulation of insulin release by adenosine A1 receptor agonists and antagonists in INS-1 cells: the possible contribution of 86Rb+ efflux and 45Ca2+ uptake. Cell Biochem Funct 26:833-843. Toshinai K, Mondal MS, Nakazato M, Date Y, Murakami N, Kojima M, Kangawa K and Matsukura S (2001) Upregulation of Ghrelin expression in the stomach upon fasting, insulin-induced hypoglycemia, and leptin administration. Biochem Biophys Res Commun 281:1220-1225. Tschop M, Smiley DL and Heiman ML (2000) Ghrelin induces adiposity in rodents. Nature 407:908-913. Tschop M, Wawarta R, Riepl RL, Friedrich S, Bidlingmaier M, Landgraf R and Folwaczny C (2001a) Post-prandial decrease of circulating human ghrelin levels. J Endocrinol Invest 24:RC19-21. 133 Tschop M, Weyer C, Tataranni PA, Devanarayan V, Ravussin E and Heiman ML (2001b) Circulating ghrelin levels are decreased in human obesity. Diabetes 50:707-709. Tsuboi T, Ravier MA, Parton LE and Rutter GA (2006) Sustained exposure to high glucose concentrations modifies glucose signaling and the mechanics of secretory vesicle fusion in primary rat pancreatic beta-cells. Diabetes 55:1057-1065. Tuduri E, Filiputti E, Carneiro EM and Quesada I (2008) Inhibition of Ca2+ signaling and glucagon secretion in mouse pancreatic alpha-cells by extracellular ATP and purinergic receptors. Am J Physiol Endocrinol Metab 294:E952-960. Ukkola O, Ravussin E, Jacobson P, Snyder EE, Chagnon M, Sjostrom L and Bouchard C (2001) Mutations in the preproghrelin/ghrelin gene associated with obesity in humans. J Clin Endocrinol Metab 86:3996-3999. Unger RH (1971) Glucagon physiology and pathophysiology. N Engl J Med 285:443-449. Unger RH (1978) Role of glucagon in the pathogenesis of diabetes: the status of the controversy. Metabolism 27:1691-1709. Unger RH (1985) Glucagon physiology and pathophysiology in the light of new advances. Diabetologia 28:574-578. Unger RH and Orci L (1976) Physiology and pathophysiology of glucagon. Physiol Rev 56:778- 826. Vachon L, Costa T and Herz A (1987) Opioid receptor desensitization in NG 108-15 cells. Differential effects of a full and a partial agonist on the opioid-dependent GTPase. Biochem Pharmacol 36:2889-2897. van der Lely AJ, Tschop M, Heiman ML and Ghigo E (2004) Biological, physiological, pathophysiological, and pharmacological aspects of ghrelin. Endocr Rev 25:426-457. Verhulst PJ, De Smet B, Saels I, Thijs T, Ver Donck L, Moechars D, Peeters TL and Depoortere I (2008) Role of ghrelin in the relationship between hyperphagia and accelerated gastric emptying in diabetic mice. Gastroenterology 135:1267-1276. Verspohl EJ, Johannwille B, Waheed A and Neye H (2002) Effect of purinergic agonists and antagonists on insulin secretion from INS-1 cells (insulinoma cell line) and rat pancreatic islets. Can J Physiol Pharmacol 80:562-568. Vilsboll T, Krarup T, Deacon CF, Madsbad S and Holst JJ (2001) Reduced postprandial concentrations of intact biologically active glucagon-like peptide 1 in type 2 diabetic patients. Diabetes 50:609-613. 134 Waldum HL, Sandvik AK, Brenna E and Petersen H (1991) Gastrin-histamine sequence in the regulation of gastric acid secretion. Gut 32:698-701. Wang CZ, Namba N, Gonoi T, Inagaki N and Seino S (1996) Cloning and pharmacological characterization of a fourth P2X receptor subtype widely expressed in brain and peripheral tissues including various endocrine tissues. Biochem Biophys Res Commun 220:196-202. Weiss SM, Benwell K, Cliffe IA, Gillespie RJ, Knight AR, Lerpiniere J, Misra A, Pratt RM, Revell D, Upton R and Dourish CT (2003) Discovery of nonxanthine adenosine A2A receptor antagonists for the treatment of Parkinson's disease. Neurology 61:S101-106. Weyer C, Bogardus C, Mott DM and Pratley RE (1999) The natural history of insulin secretory dysfunction and insulin resistance in the pathogenesis of type 2 diabetes mellitus. J Clin Invest 104:787-794. White TD and MacDonald WF (1990) Neural release of ATP and adenosine. Ann N Y Acad Sci 603:287-298; discussion 298-289. Wideman RD, Yu IL, Webber TD, Verchere CB, Johnson JD, Cheung AT and Kieffer TJ (2006) Improving function and survival of pancreatic islets by endogenous production of glucagon-like peptide 1 (GLP-1). Proc Natl Acad Sci U S A 103:13468-13473. Wiley KE and Davenport AP (2002) Comparison of vasodilators in human internal mammary artery: ghrelin is a potent physiological antagonist of endothelin-1. Br J Pharmacol 136:1146-1152. Williams DL, Cummings DE, Grill HJ and Kaplan JM (2003) Meal-related ghrelin suppression requires postgastric feedback. Endocrinology 144:2765-2767. Winzell MS and Ahren B (2004) The high-fat diet-fed mouse: a model for studying mechanisms and treatment of impaired glucose tolerance and type 2 diabetes. Diabetes 53 Suppl 3:S215-219. World Health Organization (2011) Media centre: Diabetes fact sheet. Accessed March 2011. Wortley KE, Anderson KD, Garcia K, Murray JD, Malinova L, Liu R, Moncrieffe M, Thabet K, Cox HJ, Yancopoulos GD, Wiegand SJ and Sleeman MW (2004) Genetic deletion of ghrelin does not decrease food intake but influences metabolic fuel preference. Proc Natl Acad Sci U S A 101:8227-8232. Wren AM, Seal LJ, Cohen MA, Brynes AE, Frost GS, Murphy KG, Dhillo WS, Ghatei MA and Bloom SR (2001a) Ghrelin enhances appetite and increases food intake in humans. J Clin Endocrinol Metab 86:5992. 135 Wren AM, Small CJ, Abbott CR, Dhillo WS, Seal LJ, Cohen MA, Batterham RL, Taheri S, Stanley SA, Ghatei MA and Bloom SR (2001b) Ghrelin causes hyperphagia and obesity in rats. Diabetes 50:2540-2547. Wren AM, Small CJ, Ward HL, Murphy KG, Dakin CL, Taheri S, Kennedy AR, Roberts GH, Morgan DG, Ghatei MA and Bloom SR (2000) The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology 141:4325-4328. Wu SV, Giraud A, Mogard M, Sumii K and Walsh JH (1990) Effects of inhibition of gastric secretion on antral gastrin and somatostatin gene expression in rats. Am J Physiol 258:G788-793. Wu V, Sumii K, Tari A, Sumii M and Walsh JH (1991) Regulation of rat antral gastrin and somatostatin gene expression during starvation and after refeeding. Gastroenterology 101:1552-1558. Xu L, Depoortere I, Tomasetto C, Zandecki M, Tang M, Timmermans JP and Peeters TL (2005) Evidence for the presence of motilin, ghrelin, and the motilin and ghrelin receptor in neurons of the myenteric plexus. Regul Pept 124:119-125. Yaar R, Jones MR, Chen JF and Ravid K (2005) Animal models for the study of adenosine receptor function. J Cell Physiol 202:9-20. Yalow RS and Berson SA (1959) Assay of plasma insulin in human subjects by immunological methods. Nature 184 (Suppl 21):1648-1649. Yalow RS and Berson SA (1970) Size and charge distinctions between endogenous human plasma gastrin in peripheral blood and heptadecapeptide gastrins. Gastroenterology 58:609-615. Yamazaki M, Nakamura K, Kobayashi H, Matsubara M, Hayashi Y, Kangawa K and Sakai T (2002) Regulational effect of ghrelin on growth hormone secretion from perifused rat anterior pituitary cells. J Neuroendocrinol 14:156-162. Yan L, Burbiel JC, Maass A and Muller CE (2003) Adenosine receptor agonists: from basic medicinal chemistry to clinical development. Expert Opin Emerg Dr 8:537-576. Yang J, Brown MS, Liang G, Grishin NV and Goldstein JL (2008a) Identification of the acyltransferase that octanoylates ghrelin, an appetite-stimulating peptide hormone. Cell 132:387-396. Yang J, Zhao TJ, Goldstein JL and Brown MS (2008b) Inhibition of ghrelin O-acyltransferase (GOAT) by octanoylated pentapeptides. Proc Natl Acad Sci U S A 105:10750-10755. 136 Yip L and Kwok YN (2004) Role of adenosine A2A receptor in the regulation of gastric somatostatin release. J Pharmacol Exp Ther 309:804-815. Yip L, Leung HC and Kwok YN (2004a) Effect of omeprazole on gastric adenosine A1 and A2A receptor gene expression and function. J Pharmacol Exp Ther 311:180-189. Yip L, Leung HC and Kwok YN (2004b) Role of adenosine A1 receptor in the regulation of gastrin release. J Pharmacol Exp Ther 310:477-487. Yoneyama Y, Suzuki S, Sawa R, Otsubo Y, Power GG and Araki T (2000) Plasma adenosine levels increase in women with normal pregnancies. Am J Obstet Gynecol 182:1200-1203. Zannikos PN, Rohatagi S and Jensen BK (2001) Pharmacokinetic-pharmacodynamic modeling of the antilipolytic effects of an adenosine receptor agonist in healthy volunteers. J Clin Pharmacol 41:61-69. Zhang W, Chen M, Chen X, Segura BJ and Mulholland MW (2001) Inhibition of pancreatic protein secretion by ghrelin in the rat. J Physiol 537:231-236. Zimmermann H (1996) Biochemistry, localization and functional roles of ecto-nucleotidases in the nervous system. Prog Neurobiol 49:589-618. Zimmermann H (2000) Extracellular metabolism of ATP and other nucleotides. Naunyn Schmiedebergs Arch Pharmacol 362:299-309.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0105088/manifest

Comment

Related Items