UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Transcription regulation of two natural killer cell activating receptors, NKG2D and NCR1 Lai, Chieh Min 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_fall_lai_chieh min.pdf [ 3.04MB ]
Metadata
JSON: 24-1.0103444.json
JSON-LD: 24-1.0103444-ld.json
RDF/XML (Pretty): 24-1.0103444-rdf.xml
RDF/JSON: 24-1.0103444-rdf.json
Turtle: 24-1.0103444-turtle.txt
N-Triples: 24-1.0103444-rdf-ntriples.txt
Original Record: 24-1.0103444-source.json
Full Text
24-1.0103444-fulltext.txt
Citation
24-1.0103444.ris

Full Text

TRANSCRIPTION REGULATION OF TWO NATURAL KILLER CELL ACTIVATING RECEPTORS, NKG2D AND NCR1  by  Chieh Min Lai B.Sc. (Honours), The University of British Columbia, 2006  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies  (Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April, 2012  © Chieh Min Lai, 2012    Abstract Natural Killer (NK) immune lymphocytes are mainly known to eliminate cancerous and virus infected cells. When they encounter another host cell, they utilize surface receptors to scan the target cell for telltale disease-associated ligands. Therefore, these receptors play a central role in regulating NK cell effector functions that include direct cytotoxicity and cytokine release. NKG2D and NCR1 are among the most studied NK receptors identified to date. NKG2D binds a range of stress induced MHC class I like ligands while NCR1 binds the viral protein, haemagglutinin, as well as unidentified tumour ligands. Knockout mouse models have highlighted the importance of these receptors in combating tumorigenesis, virus infections, and in the development of autoimmune disorders. The expression of these receptors is specific: NKG2D is expressed only on NK cells and a minority of T cell subsets while NCR1 is even more restricted to the NK lineage. Yet the basis behind the transcriptional regulation of NKG2D and NCR1 has remained a mystery. I have found genetic and epigenetic mechanisms that control the expression of the receptors, including involvement of a retrotransposon in regulation of the mouse Nkg2d gene. Luciferase assays were used to delineate crucial DNA elements such as promoters and enhancers. Bioinformatic and RNA expression techniques have led to the discovery of GABP, RUNX3 and RUNX1 as regulators of NKG2D and NCR1. The role of these transcription factors were verified using gel shift, chromatin immunoprecipitation, knockdown, dominant negative and overexpression experiments. My results shed light on transcription regulation of crucial NK receptors. At the same time, it allows me to make inferences on the NK genetic regulatory program.  ii     Preface A version of chapter 2 has been published: Lai, C.B., Zhang, Y., Rogers, S.L., and Mager, D.L. (2009) Creation of the two isoforms of rodent NKG2D was driven by a B1 retrotransposon insertion. Nucleic Acids Research. 37:3032-3043. I conducted all wet lab experiments and wrote the manuscript. Ying Zhang conducted the genome wide bioinformatics experiments. Sally L. Rogers conceptualized early portions of the projects and some of the experiments. A version of chapter 3 has been accepted for publication by the Journal of Biological Chemistry and is in press as of January 2012: Lai, C.B. and Mager, D.L. (2012) The role of runtrelated transcription factor 3 (RUNX3) in transcription regulation of natural cytotoxicity receptor 1 (NCR1/NKp46), an activating NK cell receptor. I conducted all experiments and wrote the manuscript. The only exception is the RUNX3 knockout NK cells. I performed the chromatin immunoprecipitation experiments on these cells but they originally were provided by Dr. Ditsa Levanon and Dr. Yoram Groner.  iii     Table of contents Abstract ........................................................................................................................................... ii Preface............................................................................................................................................ iii Table of contents ............................................................................................................................ iv List of tables .................................................................................................................................. vii List of figures ............................................................................................................................... viii List of abbreviations ........................................................................................................................x Acknowledgements ........................................................................................................................xv 1  INTRODUCTION .....................................................................................................................1 1.1  1.2  1.3  1.4  1.5  Defining natural killer cells .............................................................................................2 1.1.1  NK cells in disease .............................................................................................2  1.1.2  NK effector functions ........................................................................................4  NK cell receptors .............................................................................................................5 1.2.1  Inhibitory receptors and the missing self ...........................................................5  1.2.2  Inhibitory receptor expression patterns ..............................................................8  1.2.3  Activating receptors and the induced self ..........................................................9  1.2.4  Activating receptor expression patterns ...........................................................12  1.2.5  Receptor signaling and the altered balance theory ..........................................12  1.2.6  NK receptor gene regulation ............................................................................15 1.2.6.1  Role of cis elements and transcription factors ..................................15  1.2.6.2  Role of epigenetics ............................................................................22  KLRK1/NKG2D ...........................................................................................................23 1.3.1  NKG2D ligands ...............................................................................................23  1.3.2  NKG2D in diseases ..........................................................................................24  1.3.3  NKG2D expression pattern ..............................................................................26  NCR1/NKp46 ................................................................................................................27 1.4.1  NKp46 ligands .................................................................................................27  1.4.2  NKp46 in diseases............................................................................................28  1.4.3  NKp46 expression pattern................................................................................29  Thesis objectives ...........................................................................................................32 iv      2 CREATION OF THE TWO ISOFORMS OF RODENT NKG2D WAS DRIVEN BY A B1 RETROTRANSPOSON INSERTION ....................................................................................33 2.1  Introduction ...................................................................................................................34  2.2  Materials and methods...................................................................................................35  2.3  2.4  2.2.1  Cell culture .......................................................................................................35  2.2.2  Mice .................................................................................................................35  2.2.3  RT-PCR and sequencing ..................................................................................36  2.2.4  Sequence alignment .........................................................................................37  2.2.5  5’RACE............................................................................................................37  2.2.6  Generation of luciferase reporter constructs ....................................................37  2.2.7  Cell transfection and luciferase assays ............................................................39  2.2.8  EMSA ..............................................................................................................39  2.2.9  siRNA and real-time RT-PCR .........................................................................40  Results ..........................................................................................................................41 2.3.1  A rodent SINE element is linked to alternative exon 1 usage .........................41  2.3.2  The SINE element has polymerase II promoter potential ................................43  2.3.3  The mouse B1 element contributes a functional GABP binding site ..............45  2.3.4  GABP binds the identified mB1 enhancer site in vitro....................................47  2.3.5  GABP binds a separate site in rat B1 in vitro ..................................................49  2.3.6  GABP is required for full NKG2D-L expression in vivo ................................51  2.3.7  Mouse B1 promoter activity is not tissue specific ...........................................52  2.3.8  Splice signals are conserved in mammals, with the exception of rodents .......53  Discussion .....................................................................................................................55  3 THE ROLE OF RUNX3 IN TRANSCRIPTION REGULATION OF NCR1/NKP46, AN ACTIVATING NK CELL RECEPTOR ..................................................................................63 3.1  Introduction ...................................................................................................................64  3.2  Materials and methods...................................................................................................64 3.2.1  PBMC flow cytometry .....................................................................................64  3.2.2  Cell culture .......................................................................................................65  3.2.3  RT-PCR and real-time PCR .............................................................................66 v      3.3.  3.2.4  Generation of luciferase reporter constructs ....................................................66  3.2.5  Transient transfection and luciferase assays ....................................................68  3.2.6  Western blot .....................................................................................................68  3.2.7  EMSA ..............................................................................................................69  3.2.8  Chromatin immunoprecipitation ......................................................................69  3.2.9  Retrovirus transduction and fluorescence assisted cell sorting........................70  Results ..........................................................................................................................70 3.3.1  NKp46/NCR1 expression specificity stems from the transcript level .............70  3.3.2  The human NCR1 promoter contains essential and enhancing regions ...........72  3.3.3  NCR1 promoter contains RUNX sites and RUNX members are expressed in NK cells ...........................................................................................................76  3.3.4  Human and mouse NK cells use the distal promoter of RUNX3 .....................80  3.3.5  RUNX binding motif mutations decrease NCR1 promoter strength ...............81  3.3.6  RUNX3 and RUNX1 bind the promoter in vitro .............................................83  3.3.7  RUNX binds the promoter of NCR1 ................................................................85  3.3.8  Dominant negative RUNX interferes with NCR1 transcription ......................87  3.3.9  RUNX3 overexpression increases NCR1 expression ......................................88  3.3.10 The NCR1 promoter behaves differently in non-NK cells...............................90 3.4  Discussion .....................................................................................................................92  4 GENERAL DISCUSSION AND CONCLUSIONS................................................................97 4.1  Summary and significance of findings ..........................................................................98  4.2  ETS and RUNX members in the NK genetic program .................................................99  4.3  Concluding remarks ....................................................................................................107  REFERENCES ............................................................................................................................108  vi     List of tables Table 3.1 Primers used for experiments in chapter 3.....................................................................66 Table 4.1 Effects of ETS and RUNX gene targeting ...................................................................100  vii     List of figures Figure 1.1 NK receptor and ligands .................................................................................................6 Figure 1.2 Hypotheses of NK cell activation .................................................................................14 Figure 1.3 Promoters of Ly49 genes ..............................................................................................17 Figure 1.4 Promoters of KIR genes ................................................................................................19 Figure 1.5 Promoter of the human NKG2A gene ...........................................................................20 Figure 1.6 Expression of NKG2D and NCR1 on different cell types ...........................................31 Figure 2.1 NKG2D genomic organization and splicing pattern.....................................................42 Figure 2.2 Detection of an RNA polymerase II promoter in SINE elements ................................44 Figure 2.3 Identification of transcription factor binding sites that contribute to Nkg2d-L regulation .......................................................................................................................................46 Figure 2.4 GABP forms protein-DNA complex within mB1 in EMSA ........................................48 Figure 2.5 GABP forms protein-DNA complex within rB1 in EMSA .........................................50 Figure 2.6 Transient knockdown reveals requirement of GABP for full expression of Nkg2d-L but not Nkg2d-S..............................................................................................................................51 Figure 2.7 Detection of promoter activity in different cell lines ...................................................52 Figure 2.8 Analysis of the NKG2D splice signal and start codons ................................................54 Figure 3.1 NCR1 transcript is NK specific ....................................................................................71 Figure 3.2 RUNX binding sites are conserved at the NCR1 promoter ..........................................73 Figure 3.3 Luciferase reporter assay of NCR1 promoter in NK92 ................................................74 Figure 3.4 Promoter constructs transfected into KY-2 mouse NK cell line ..................................75 Figure 3.5 Identification of RUNX sites in the NCR1 promoter ...................................................77 Figure 3.6 Ncr1, Runx1 and Runx3 expression in mouse hematopoietic cells ..............................79 viii     Figure 3.7 NK cells utilize the distal RUNX3 promoter ...............................................................81 Figure 3.8 RUNX motif mutations decrease NCR1 promoter strength .........................................82 Figure 3.9 RUNX forms protein-DNA complexes with NCR1 promoter elements in vitro..........84 Figure 3.10 RUNX binds the NCR1 promoter ...............................................................................86 Figure 3.11 dn-RUNX decreases Ncr1 expression ........................................................................88 Figure 3.12 RUNX3 overexpression enhances Ncr1 expression ...................................................89 Figure 3.13 NCR1 promoter activity and chromatin environment in non-NK cells ......................91 Figure 4.1 Portion of the NK program concerning ETS and RUNX members ...........................105  ix     List of abbreviations 2-ME  2-Mercaptoethanol  5’ RACE  5’ Rapid amplification of cDNA ends  ACTB  Beta actin  ADCC  Antibody-dependent cellular cytotoxicity  AML  Acute myeloid leukemia  ANOVA  Analysis of variance  AP1  Activator protein 1  APC  Allophycocyanin  ATF  Activating transcription factor  β2m  Beta-2 microglobulin  BAT3  HLA-B-associated transcript 3  CBFβ  Core binding factor, beta subunit  CD  Cluster of differentiation  C/EBP  CCAAT-enhancer binding protein  ChIP  Chromatin immunoprecipitation  CREB-2  cyclic AMP response element binding protein 2  CTL  Cytotoxic T lymphocyte  DAP10  DNAX-activating protein of 10kDa  DAP12  DNAX-activating protein of 12kDa  DC  Dendritic cells  DN  Dominant negative  DP  Double positive x      E2F1  E2F transcription factor 1  EBV  Epstein-Barr virus  ELF  ETS-related transcription factor, E74 like factor  EMSA  Electrophoretic mobility shift assay  ETS  E-twenty-six  FACS  Fluorescence activated cell sorting  FITC  Fluorescein isothiocyanate  GABP  GA binding protein  GAPDH  Glyceraldehyde-3-phosphate dehydrogenase  GATA  GATA binding protein  γc  Gamma chain  GFP  Green fluorescence protein  H3K4me3  Histone 3 lysine 4 trimethylation  H3K27me3  Histone 3 lysine 27 trimethylation  HA  Hemagglutinin  HCMV  Human cytomegalovirus  HLA  Human leukocyte antigen  HSC  Hematopoietic stem cell  HSV  Herpes simplex virus  IFNG  Interferon gamma  Ig  Immunoglobulin  IL  Interleukin  ILC22  Innate lymphoid cell, IL-22 secreting xi      Inh./I.  Inhibitory  iNK  Immature natural killer  ITAM  Immunoreceptor tyrosine-based activation motif  ITIM  Immunoreceptor tyrosine-based inhibitory motif  KIR  Killer immunoglobulin-like receptors  LINE  Long interspersed nuclear element  LRC  Leukocyte receptor complex  MCA  3-methylcholanthrene  MCMV  Mouse cytomegalovirus  MEF  Myeloid ELF-1 like factor  MHC  Major histocompatibility complex  MICA/B  MHC class I polypeptide related sequence A/B  MOPS  3-(N-morpholino) propanesulfonic acid  MYC  Avian myelocytomatosis viral oncogene homolog  NCR  Natural cytotoxicity receptor  NF-E2  Nuclear factor erythroid derived 2  NF-κB  Nuclear factor kappa-light-chain enhancer of activating B cells  NK  Natural killer  NKC  Natural killer complex  NKG2  Natural killer group two  NKG2D-S/L Natural killer group two D – short/long isoform NKP  Natural killer progenitor  NKT  Natural killer T xii      NOD  Non-obese diabetic mouse  PBMC  Peripheral blood mononuclear cells  PBS  Phosphate buffered saline  PE  Phycoerythrin  PI3K  Phosphatidylinositol-3 kinase  Poly I:C  Polyinosinic:polycytidylic acid  PRF1  Perforin 1  PVDF  Polyvinyl difluoride  RAE1  Retinoic acid early transcript 1  RLM  RNA ligase mediated  RPMI  Roswell Park Memorial Institute  RUNX  Runt related transcription factor  SD  Standard deviation  SDS  Sodium dodecyl sulfate  SINE  Short interspersed nuclear element  SP  Single positive  SP1  Specificity Protein 1  SPI1  Spleen focus forming virus proviral integration 1  STAT  Signal transducer and activator of transcription family  SYK  Spleen tyrosine kinase  TCF-1  T cell factor 1  TCR  T cell receptor  TESS  Transcription Element Search Software xiii      TH1/2  T helper 1/2  TRAIL  Tumor necrosis factor related apoptosis-inducing ligand  TSS  Transcription start site  ULBP  UL16 binding protein  UTR  Untranslated region  YFP  Yellow fluorescence protein  YY1  Ying Yang 1  ZAP70  Zeta chain associated protein kinase of 70kDa  xiv     Acknowledgements To Dixie, for your guidance and patience. You encouraged me when nothing worked and challenged me when everything did. You taught me how to pursue scientific knowledge and gave me the freedom to go after what interested me. I am truly fortunately to have become your student and am forever grateful. To my committee members, Drs. Fumio Takei, Matthew Lorincz, and Kelly McNagny, for all your support and criticism of my work. Your suggestions have been highly valuable. To past members of the Mager lab, especially Sally, Arefeh, and Irina who helped me with ideas and techniques when I first began. To Liane, who diligently keeps the lab functional and also trained me in many procedures. I pestered all of you with questions ad nauseam but you always patiently worked with me. To current members of the lab, Mark, Rita, Katharine, and Ying, who make the lab a great place to come to everyday. You have given the lab a positive and vibrant feel. You’ve hit the perfect balance between pouring ourselves into doing science and distracting ourselves just enough to stay sane (I enjoyed the hockey talks, luciferase jokes and lab skits). To Dave and Michelle, who, through GrasPods, showed me how to strive for what I believed in and how to make our community better for the next generation of trainees. To my sister and my brother-in-law, who share my passion in science. I love how we get caught up so easily in our nerdy discussions of biology. To my parents, Lucie and Jason, who always provide unconditional love and support. You taught me what is important in life and how to go about leading a meaningful one. Thank you.  xv     CHAPTER 1  INTRODUCTION  1  1.1  Defining natural killer cells Natural killer (NK) cells are large granular lymphocytes (LGL), initially discovered for  their ability to lyse tumor cells without prior immunization (Kiessling et al., 1975a; Kiessling et al., 1975b). Similarly, they can mount a response against virus infected cells without previous exposure. Thus NK cells have long been considered a branch of the innate immune system, even if they are morphologically more akin to adaptive immune lymphocytes. There are certain hallmarks of adaptive T and B cells that NK cells do not possess. NK cells do not utilize rearranged V(D)J based receptors. In addition, NK cells act quickly and do not require multiple days to mount a response. Recently, however, Sun et al. described certain traits in NK cells that would normally be attributed only to the adaptive immune system (Sun et al., 2009). A subpopulation of NK cells poised to respond best against mouse cytomegalovirus (MCMV) preferentially expand during MCMV infection. This population subsequently contracts but forms long lived ‘memory’ cells which mount a more effective recall response upon second challenge. NK cells can also be defined by their surface phenotype. Nearly all human NK cells express CD56 (neural cell adhesion molecule, NCAM). Since a small proportion of T cells also express the molecule, NK isolation using CD56 must be accompanied by depletion of CD3 (Tcell receptor component) positive cells (Lanier et al., 1989). In mouse, the NK1.1+ CD3phenotype is widely used to describe NK cells. However, the NK1.1 antigen is not present in all mouse strains and DX5 may be used in its place (Arase et al., 2001; Carlyle et al., 2006).  1.1.1  NK cells in disease Many lines of evidence support the fact that NK cells play an important role in protecting  the host against pathogens and neoplastic transformation. The best cases are made in individuals 2  that lack NK cells or lack functionally competent NK cells. Only a handful of these patients have been reported but all show susceptibility to viruses such as human cytomegalovirus (HCMV), Epstein-Barr virus (EBV), herpes simplex virus (HSV), varicella zoster virus (VZV), or human papillomavirus (HPV). These infections are often recurrent, severe and sometimes fatal (Orange, 2006). Mouse models of NK depletion via anti-NK1.1 or transgenic NK deficiency reflect clinical observations. These mice show increased susceptibility toward viruses including MCMV, HSV-1 and influenza (Lee et al., 2007). Historically, ex vivo NK cells are known to spontaneously lyse tumor cell lines such as YAC-1 and K562. In vivo, a clear picture has not fully emerged. Mice selectively deficient for NK cells show poorer control of lung metastasis and tumor outgrowth compared to wild type (Kim et al., 2000). In humans, patient data that definitively link NK deficiency to increased tumorigenesis has been lacking. However, one epidemiological study shows that low NK cytotoxicity in peripheral blood correlates with increased incidence of cancer (Imai et al., 2000). Perhaps the best evidence of anti-cancer effects comes from explorations of NK cell immunotherapy (Ljunggren and Malmberg, 2007). Whether by allogeneic stem cell transplant or by direct infusion, preliminary studies of NK cell therapies have shown better clinical outcomes for leukemia patients. On the other end of the spectrum, aberrant NK cell numbers or activities are postulated to have autoimmune clinical consequences. Alterations in NK frequency or function have been linked to diseases such as diabetes and rheumatoid arthritis. It is important to note that historically, the bulk of the evidence consists only of correlations between NK cells and autoimmune disease states (Schleinitz et al., 2010). More recently, mouse models have been used  3  to elucidate molecular mechanisms behind NK cells’ contribution toward the development of type 1 diabetes (discussed later in this chapter).  1.1.2  NK effector functions One way that NK cells mediate immunity is through direct killing of diseased host cells.  Cytotoxicity involves the recognition and attachment of NK cells to infected or tumorigeneic cells followed by a focused release of lytic granules at the contact site. Pore forming perforins and pro-apoptotic granzymes are the major effectors exocytosed in this process. Perforin pore formation on the target cell plasma membrane triggers Ca2+ influx and membrane repair. Thus perforin and granzymes are endocytosed into the cell. Initially, perforin pores on these endosomes allow granzymes to leak out slowly. After approximately fifteen minutes, these endosomes rupture and release their contents entirely into the cytoplasm (Thiery et al., 2011). Aside from lytic granules, NK cells can also induce target cells to activate the apoptotic program via surface tumor necrosis factor –related apoptosis-inducing ligand (TRAIL). Under normal conditions, only liver NK cells express TRAIL on cell surface. Trail-dependent, liver NK cytotoxicity has been shown to reduce liver metastasis and virus replication in mouse models (Sato et al., 2001; Takeda et al., 2001). Another important effector function of NK cells is the release of cytokines. These soluble factors attract and modulate different immune cells to achieve a robust and concerted immune response. For example, NK cells are an important source of interferon gamma (IFNγ), which enhances T helper 1 (TH1) cell polarization, macrophage activation, and dendritic cell priming.  4  1.2  NK cell receptors Since NK cells target self cells, it is vital to the host that NK cells tolerate healthy cells  and only become activated in response to diseased cells. NK cells’ friend-or-foe recognition system is rooted in a multitude of surface receptors (Figure 1.1). Some of these receptors are inhibitory and shut down the NK response. Others are activating and promote cytolytic attack and cytokine secretion. Like pattern recognition receptors of the innate immune system, these receptors are germ-line encoded and not rearranged (Kelley et al., 2005; McQueen and Parham, 2002).  1.2.1  Inhibitory receptors and the missing self The ligands that allow for NK tolerance were known long before the discovery of the  inhibitory receptors that bind them. Phenomena such as rejection of allogeneic bone marrow graft or F1 hybrid resistance suggested a link between major histocompatibility complex (MHC) class I proteins and NK recognition. MHC class I is a family of transmembrane receptors expressed on all healthy nucleated cells that presents antigens to CD8+ T cells. In 1986, Karre et al. published a landmark study in Nature describing the ‘missing self hypothesis’ that elegantly explained the link as well as forecasted the existence of inhibitory receptors (Karre et al., 1986). The hypothesis proposes that unlike T cells, NK cells do not rely on recognition of tumor or pathogen associated antigens on MHC class I receptors. Instead, NK cells reject those cells that lose expression of MHC class I. In a healthy host MHC class I expression protects host cells from NK attack. Conversely, tumor cells or virus infected cells down-regulate MHC class I, presumably to escape cytotoxic T lymphocytes, and become susceptible to NK cytolysis.  5  Figure 1.1 NK receptor and ligands. NK receptors and associated adapters are shown at the bottom. Corresponding ligands are shown at the top.  6  The next breakthrough came with the discovery of the Ly49 NK receptors. The molecule was first described by the Takei laboratory using monoclonal antibodies (Chan and Takei, 1986; Takei, 1983). Subsequently, individual members of the receptor family were cloned (Wong et al., 1991; Yokoyama et al., 1989) and in 1992, Karlhofer et al. showed that mouse Ly49 receptors bind MHC class I and subsequently dampens NK cytotoxicity (Karlhofer et al., 1992). Furthermore, the study showed that a tumor cell line vulnerable to NK attack due to a missing MHC class I protein can be rendered resistant when transfected with the proper MHC class I. Soon after, the killer cell immunoglobulin-like receptors (KIRs) were identified as the human equivalent of inhibitory NK receptors (Moretta et al., 1993). While the Ly49 and KIR receptors serve the same function, they are in fact different in many respects. In human, LY49 exists as a single copy pseudogene. In mouse and rat, the Ly49 family receptors are both polygenic and polymorphic, having undergone expansion after the primate-rodent divergence (Kelley et al., 2005; McQueen et al., 1998; Wong et al., 1991). The cluster of genes is located in the natural killer complex (NKC) on chromosome 6 in mouse. Structurally, the Ly49 receptors belong in the c-type lectin like superfamily, though they bind the MHC class I protein instead of carbohydrates. The KIR receptors selectively expanded in primates and some human haplotypes have as many as 17 KIR genes and pseudogenes (Kelley et al., 2005). In human, the KIR cluster is located in the leukocyte receptor complex (LRC) on chromosome19. In mouse, only 2 copies of KIR have been found. In terms of structure, KIRs belong in the immunoglobulin-like receptor superfamily. Not to be overlooked is the CD94/NKG2A (NK group 2 member A) heterodimer, another lectin-like inhibitory receptor (Brooks et al., 1997; Lazetic et al., 1996). Both the CD94 and 7  NKG2A genes are found in the NKC and they are conserved in rodents and primates (Kelley et al., 2005). The ligand for CD94/NKG2A is not classical MHC class I proteins but rather the MHC class I related molecule, HLA-E (human leukocyte antigen E) in human and Qa-1b in mouse (Braud et al., 1998; Lee et al., 1998; Vance et al., 1998). HLA-E and Qa-1b bind cleaved peptides which are byproducts of MHC class I protein synthesis. This binding allows HLA-E and Qa-1b to be expressed on cell surface. Thus, CD94/NKG2A allows NK cells to indirectly scan targets for MHC class I expression.  1.2.2  Inhibitory receptor expression patterns MHC class I members are expressed in a co-dominant manner. Nucleated cells will  express both parental alleles from multiple MHC class I genes. The NK inhibitory receptors, on the other hand, are expressed in a variegated manner. In C57BL/6 mice, for example, one study showed that a single adult NK cell expresses on average only two out of a possible of nine inhibitory Ly49 genes or Nkg2a included in the analysis (Kubota et al., 1999). As many as five inhibitory receptors can be detected on one NK cell but the chance of finding NK cells expressing more than two becomes increasingly difficult. Indeed, the probability of inhibitory receptor coexpression can be predicted by multiplying the expression frequencies of individual genes (product rule, (Raulet et al., 1997)). For the most part, inhibitory receptors are expressed stochastically and independently of one another. There are a few exceptions to these models. For example, coexpression of NKG2A and inhibitory KIRs is lower than expected. In addition, KIR2DL4 is ubiquitously expressed at the mRNA level while KIR3DL3 is almost undetectable on NK cell surfaces (Trundley et al., 2006; Valiante et al., 1997).  8  Consequently, a host will harbor unique pools of NK cells with different receptor patterns. If even one MHC class I gene becomes downregulated in a diseased cell, a compartment of the NK population should become ‘dis-inhibited’ and ready to respond. Though initially described on NK cells, inhibitory Ly49, KIR, and NKG2A receptors have subsequently been shown to be expressed on subsets of T and NKT cells (Takei et al., 2001; Uhrberg et al., 2001). The receptors continue to have appreciable inhibiting action in these non-NK cell types.  1.2.3  Activating receptors and the induced self After the discoveries of inhibitory receptors, it became apparent that the missing-self  theory could not account for all circumstances (Smith et al., 2001). The theory of NK regulation needed to accommodate for a different class of receptors that confer stimulatory signals. The basis of the ‘induced-self’ is that transformed or infected cells express aberrant ligands which bind the activating receptors to alert NK cells. There are in fact quite a few known activating NK receptors but I will discuss only the major ones. The Fc gamma receptor III A (FcγRIIIA, CD16) was one of the first activating NK receptors discovered (Lanier et al., 1983). It does not conform easily to the notion of induced self because it does not bind induced surface ligands on sick cells. Instead, CD16 binds the common region of IgG. In other words, CD16-dependent NK mediated attack of target cells must be bridged by soluble IgG that recognizes disease induced antigens on the target. This mode of targeting is also known as antibody-dependent cellular cytotoxicity (ADCC). A minority of the Ly49 genes are known to be activating. In C57BL/6 mice, these are Ly49d and Ly49h. The ligand for Ly49D seems to be an MHC class I molecule (George et al., 9  1999), though the biological significance of this pairing is unclear. Ly49H, on the other hand, has long been recognized to mediate MCMV resistance. Instead of mouse MHC class I molecules, the Ly49H receptor binds to a structurally related m157 MCMV viral protein (Arase et al., 2002; Smith et al., 2002). BALB/c mice, which do not have the gene and are susceptible to MCMV, can be protected from the virus by introducing a Ly49h transgene (Lee et al., 2003). It has been suggested that the m157 virulence factor was initially a MHC class I gene captured by the MCMV genome. This factor could bind inhibitory Ly49 receptors to help MCMV escape NK immunity. Subsequently, C57BL/6 mice acquired a new Ly49 member, Ly49H, which is activating and helps the mice combat MCMV infections (Lanier, 2005). Similarly, a few of the KIRs have been found to be activating. These include KIR2DS1-5 and KIR3DS1 (Carr et al., 2007; Moretta et al., 1995). One KIR, KIR2DL4, seem to have both inhibiting and activating capabilities (Lanier, 2005). The ligands for these receptors are thought to be classical MHC class I molecules, or are currently unknown. The physiological relevance of having both activating and inhibitory receptors recognize MHC class I proteins is perplexing, though the activating KIRs generally bind with weaker affinity compared to the inhibiting KIRs. The NKG2 family contains activating receptors as well. NKG2C has relatively high peptide sequence homology with NKG2A (Houchins et al., 1991). It too dimerizes with CD94 and binds HLA-E (Braud et al., 1998). Recently, Lopez-Verges et al. showed that a functionally competent CD57+ NKG2Chi natural killer population selectively expands during HCMV infection (Lopez-Verges et al., 2011). This population expresses low levels of NKG2A and HLA-E:NKG2A initiated inhibition may be overwhelmed by HLA-E:NKG2C activation. NKG2D, a distant member of the NKG2 family, is a prominent activating receptor that will be discussed in further detail in section 1.3. 10  The natural cytotoxicity receptors discovered by the Moretta groups are yet another set of activating receptors (Pende et al., 1999; Sivori et al., 1997; Vitale et al., 1998). The protein products of NCR1, NCR2, and NCR3 are also known as NKp46 (CD335), NKp44 (Cd336), and NKp30 (CD337), respectively. All three belong to the immunoglobulin superfamily, though only NCR1 is highly conserved in mammals and located in the LRC (Kelley et al., 2005). NCR2/NKp44 is located on chromosome 6 in human. It is not present in the mouse genome. NCR3/NKp30 is also found on human chromosome 6, close to the MHC cluster. This gene exists as a pseudogene in mouse due to a premature stop codon. The ligands for the NCRs are disease associated. The hemagglutinin fusion glycoprotein of influenza virus and Sendai virus have been shown to be ligands for NKp44 (Arnon et al., 2001). Many tumor cell lines can be stained with soluble NKp30 and NKp44 extracellular domain, indicating that tumor ligands exist as well (Byrd et al., 2007). However, the identity of these proteins remains largely unknown. For NKp30, two tumor ligands have been discovered recently. The first is human leukocyte antigen B-associated transcript 3 (BAT3), a soluble factor released by tumors (Pogge von Strandmann et al., 2007). The other is B7-H6, a surface molecule only detected on some leukemia and solid tumor cells (Brandt et al., 2009). A more detailed discussion of NKp46 can be found in section 1.4. Our understanding of NK regulation has come a long way since the discovery of inhibitory NK receptors. With increasing numbers of activating receptors and ligands being found, it is now undeniable that NK recognition depends on much more than the missing self.  1.2.4  Activating receptor expression patterns  11  The activating Ly49s, KIRs and NKG2C are still expressed in a variegated fashion (Kubota et al., 1999; Takei et al., 2001; Valiante et al., 1997). However, the activating Ly49s seem to deviate from the product rule. The coexpression of Ly49D/Ly49G and Ly49D/Ly49H are both higher than would be expected by chance (Kubota et al., 1999; Rouhi et al., 2009; Smith et al., 2000). In terms of tissue specificity, Ly49D and Ly49H are restricted to NK while the activating KIRs and NKG2C can be found on subsets of T and NKT cells also (Takei et al., 2001; Uhrberg et al., 2001). The other activating receptors seem to be constitutively expressed on NK cells. Indeed, CD16 was one of the first markers used to describe cells with natural killing ability (Lanier et al., 1983). However, the receptor is not specific to NK cells and is expressed on neutrophils and macrophages as well. NCR3/NKp30 has been proposed to be specifically expressed on NK cells since all NKp30+ cells are also CD16+, CD3-, HLA-DR- (Pende et al., 1999). NCR2/NKp44 is initially absent on freshly isolated NK cells and only expressed after interleukin-2 (IL-2) priming (Vitale et al., 1998). It too is considered NK specific, though one report suggests that a small fraction of γδT cells also expresses it (Cantoni et al., 1999). The expression patterns of NKG2D and NCR1/NKp46 will be discussed in sections 1.3 and 1.4.  1.2.5  Receptor signaling and the altered balance theory By themselves, the activating receptors described above have no signaling capability.  Their transmembrane domains contain positively charged lysine or arginine residues. These amino acids allow the receptors to associate with membrane bound adapters that have negatively charged aspartic acids in the transmembrane region (Lanier, 2003). Adapters expressed by NK cells include CD3ζ, FcεRIγ, DNAX-activating protein of 12 kDa (DAP12) and DAP10. The 12  adapters are essential for initiating the signaling cascade because they contain one or more immunoreceptor tyrosine-based activation motifs (ITAMs) in the intracellular regions. Receptor ligation results in phosphorylation of the ITAMs, which in turn recruits and activates spleen tyrosine kinase (SYK) or zeta chain associated protein kinase of 70 kDa (ZAP70). The actions of these enzymes initiate the rest of the cascade. The exception is DAP10. DAP10 contains a YxxM motif (amino acid codes, x is any amino acid) instead of ITAMs. It recruits phosphatidylinositol3 kinase (PI3K) to propagate signaling (Lanier, 2003). On the flip side, NK inhibitory receptors do not rely on adapters. The intracellular domains of these receptors contain immunoreceptor tyrosine-based inhibitory motifs (ITIMs). When the receptors are engaged, the ITIMs become phosphorylated. This event leads to recruitment and activation of phosphatases including Src homology containing tyrosine phosphatase 1 (SHP-1), SHP-2, and SH2 domain containing inositol-5 phosphatase (SHIP). The phosphatases act directly on components of the activating pathway to shut down the signal cascade (Lanier, 2003). The currently accepted altered balance theory (Figure 1.2) attempts to integrate the missing and induced self hypotheses as well as known signaling mechanisms (Regunathan et al., 2005). Normally, cells will express an abundance of MHC class I proteins that bind NK inhibitory receptors. Even if the cells express a relatively low level of activating ligands, the ITAM coupled cascade will be overwhelmed by the inhibitory receptor associated phosphatases. If the cells become very sick, they decrease MHC class I expression and gain activating ligands on the cell surface. Eventually the balance is tipped such that the activation cascade overcomes the phosphatase activity. Finally, the NK cell initiates cytokine secretion and cytotoxicity against  13  Figure 1.2 Hypotheses of NK cell activation. NK cells are activated to kill if the balance of inhibitory to activating signals arising from corresponding receptors is perturbed. MHC class I molecules protect healthy cells from NK attack due to binding of NK inhibitory receptors. If MHC class I expression decreases or if activating ligands are upregulated, NK activating receptor signals overpower the inhibitory signals and the NK cell initiates aggression. 14  the diseased cell.  1.2.6  NK receptor gene regulation Activating and inhibitory receptors are central to understanding the biology of natural  killer cells. They can be expressed constitutively on nearly all NK cells or stochastically on a subpopulation. They can be expressed solely on NK cells or also on T cell types. However, the mechanism behind how this transcriptional pattern is established is underexplored. In the last decade, some studies have slowly begun to address the gene regulation of the inhibitory receptors. On the other hand, almost no work has been done concerning the activating receptors.  1.2.6.1 Role of cis elements and transcription factors Most of the initial experiments concerning the promoter of Ly49 genes were conducted in a NK-like T lymphoid cell line, EL4. In this system, use of in vitro electrophoretic mobility shift assay (EMSA) identified activating transcription factor 2 (ATF-2, also known as cyclic AMP response element binding protein 2, CREB-2) and T cell factor 1 (TCF-1) as regulators of the Ly49a promoter (Held et al., 1999; Kubo et al., 1999). The importance of TCF-1 was further confirmed by analyzing the NK cells of knockout and transgenic Tcf1 mice (Held et al., 1999; Held et al., 2003; Ioannidis et al., 2003). TCF-1 deficiency results in decreased Ly49A+ NK cells and vice versa for TCF-1 transgenic overexpression. It is tempting to speculate that the stochastic expression of Ly49s arises from limiting transcription factor availability. One confounding factor is that the expression patterns of other Ly49s in the knockout do not correlate well with the number of TCF-1 binding sites (Held et al., 1999; Kunz and Held, 2001). Thus it remains possible that TCF-1 is acting indirectly or there is a redundant factor for other Ly49s. 15  Subsequent studies have painted a much more complex picture (Figure 1.3). McQueen et al. and Wilhelm et al. discovered a downstream promoter near exon 2 (Pro3) where most Ly49j and Ly49g transcripts originated (McQueen et al., 2001; Wilhelm et al., 2001). However, these might be isolated cases and most other Ly49 genes seem to preferentially use the exon 1 promoter (Pro2) (Gays et al., 2011). Saleh et al. also found an upstream promoter (Pro1) that is only active in bone marrow, liver, fetal thymus, and in an immature NK cell line, LNK (Saleh et al., 2002). This promoter actually has bidirectional activity and EMSA analysis using nuclear extract of the LNK mouse NK cell line indicates the involvement of nuclear factor kappa-lightchain enhancer of activated B cells (NF-κB), runt related transcription factor 1 (RUNX1), and CCAAT-enhancer binding protein delta (C/EBPδ). The promoter also binds ETS-related transcription factor 4 (ELF4, also known as myeloid ELF1-like, MEF) from EL4 cell line nuclear lysate, but not LNK nuclear lysate (Saleh et al., 2004). Indeed, mouse NK cells that express dominant negative RUNX or are NF-κB/p50 null show decreased Ly49 expression (Ohno et al., 2008; Pascal et al., 2007). The bidirectional promoter data prompted Saleh et al. to devise a model where the forward and reverse active promoter configurations were mutually exclusive and act as a probabilistic switch (Saleh et al., 2004). Pro1 is only active in immature NK cells and forward transcription results in Pro2 gaining transcription competency. As NK cells mature, they express the necessary transcription factors such as TCF-1 that activate Pro2 to express the Ly49 gene. If, at the immature stage, Pro1 begins transcribing in the reverse direction instead, Pro2 would be kept in closed state by repressive factors as NK cells mature.  16  Figure 1.3 Promoters of Ly49 genes. Schematic diagrams of (A) inhibitory Ly49 promoters and (B) activating Ly49 promoters are shown. Short and tall black boxes represent 5’ untranslated and coding regions with ATG start codon demarked. Orange arrows represent locations of promoters and their directionality. Colored boxes depict transcription factor binding sites backed by molecular evidence (EMSA or ChIP). Distances between objects are not to scale.  17  The cis-regulatory elements and transcription factors that control activating Ly49d and Ly49h are poorly characterized. Genomic alignment indicate that a stretch of non-coding sequence within exon 1 of Ly49d/h is absent in inhibitory Ly49s. Motif scanning and EMSA supershift experiments demonstrate that, at least in vitro, Yin Yang 1 (YY1) binds this unique region (Rouhi et al., 2009). The KIR genes also utilize two promoters (Figure 1.4). Initially, much attention was focused on the proximal promoter immediately upstream of the first coding exon. The proximal promoters of different KIR genes share homology but display divergent strengths (Stewart et al., 2003; van Bergen et al., 2005). KIR3DL1’s promoter is best characterized and EMSA experiments were used to show that in vitro, the promoter is bound by ATF-1/CREB, RUNX2, RUNX3, specificity protein 1 (Sp1), YY1, GA binding protein (GABP), E74-like factor 1 (ELF1) and signal transducer and activator of transcription family 5 (STAT5) (Presnell et al., 2006; Trompeter et al., 2005; van Bergen et al., 2005). More recently, chromatin immunoprecipitation (ChIP) was used to demonstrate binding of E2F transcription factor 1 (E2F1) at this cis regulatory region (Gao and Yu, 2008). Luciferase assays have further confirmed that optimal proximal promoter activity depends on the ETS, STAT, SP1 and E2F binding motifs (Presnell et al., 2006; Xu et al., 2005). The promoter of KIR2DL4 has received some attention because the expression of this gene is not stochastic and can be found on nearly all NK cells. Many putative transcription factor binding sites have been identified but most have not been verified with the exception of RUNX3 by EMSA (Stewart et al., 2003; Trompeter et al., 2005). Interestingly, while many groups have looked at the effect of mutating the RUNX binding sites in various KIR promoters, there is no clear consensus of whether the site acts as an enhancer  18  Figure 1.4 Promoters of KIR genes. Schematic diagrams of KIR3DL1 promoter (A) and KIR2DL4 promoter (B) are shown. Short and tall black boxes represent 5’ untranslated and coding regions with ATG start codon demarked. Orange arrows represent locations of promoters and their directionality. Gray arrows indicate transposons. Colored boxes depict transcription factor binding sites backed by molecular evidence (EMSA or ChIP). White boxes depict putative sites based on sequence scan only. Asterisks (*) mark RUNX sites with contentious transactivating/repressing effects for different KIR promoters. Distances between objects are not to scale. 19  Figure 1.5 Promoter of the human NKG2A gene. Schematic diagram of human NKG2A promoter is shown. Short and tall black boxes represent 5’ untranslated and coding regions with ATG start codon demarked. Orange arrows represent locations of promoters and their directionality. Colored box depicts transcription factor binding sites backed by molecular evidence (EMSA or ChIP). Distances between objects are not to scale.  20  or suppressor of transcription (Mulrooney et al., 2008; Presnell et al., 2006; Trompeter et al., 2005; Vilches et al., 2000; Xu et al., 2005). Searching upstream of the proximal region, Stulberg et al. discovered distal promoters (Stulberg et al., 2007). The distal promoters are contributed by long interspersed and short interspersed nuclear elements (LINEs and SINEs) that contain putative nuclear factor erythroid derived-2 (NF-E2), ETS, RUNX and YY1 binding sites. Avian myelocytomatosis viral oncogene homolog (MYC) has been shown to bind and transactivate the KIR3DL1 distal LINE-associated promoter in an IL-15 dependent manner (Cichocki et al., 2009). The two promoter system of KIRs is markedly different from that of the Ly49s. The KIR distal promoter is actually unidirectional toward the KIR gene while the previously described proximal promoter is bidirectional and probabilistic (Davies et al., 2007; Li et al., 2008). Interestingly, KIR expression is only detected in the absence of proximal reverse transcripts. This led Davies et al. to propose that the proximal reverse transcript forms double stranded RNA (dsRNA) with the distal transcript from upstream, resulting in directed epigenetic modifications to silence the gene (Davies et al., 2007). As for the genetic control of NKG2 and NCR families, almost nothing is known. The human NKG2A promoter has been examined. Marusina et al. discovered that there are two major regions containing transcription start sites, one before exon 1 and one in intron 1 (Figure 1.5). GATA binding protein 3 (GATA3) was found to bind and positively regulate the NKG2A promoter upstream of exon 1 (Marusina et al., 2005).  21  1.2.6.2 Role of epigenetics Epigenetic marks such as chromatin modifications and promoter CpG methylation are known to correlate with the expression and tissue restriction patterns of some NK receptors. Expression of inhibitory and activating Ly49s can be found in lockstep with DNA methylation and euchromatic acetylated histone marks at the corresponding Ly49 promoters. Furthermore, treatment of the EL4 cell line with epigenetic modifying drugs (DNA methyltransferase and histone deacetylase inhibitors) induces upregulation of Ly49 genes. In tissues that do not express Ly49, the promoter was found to be variably to heavily methylated (Rouhi et al., 2006; Rouhi et al., 2007; Rouhi et al., 2009). Similar results were obtained for the mouse Nkg2a. Furthermore, Rogers et al. showed that that the loss of methylation at the Nkg2a promoter corresponds to the appearance of NKG2A during NK cell differentiation (Rogers et al., 2006). The KIR promoters are also hypomethylated when the genes are expressed. Treating NK cells with DNA methyltransferase inhibitors induced de novo expression of formerly silent KIR genes (Chan et al., 2003; Santourlidis et al., 2002). Surprisingly, histone deacetylase inhibitors did not have the same effect. In fact, euchromatic histone marks are enriched at the promoters of both expressed and non-expressed KIR genes in NK cells (Chan et al., 2005). By analyzing early and differentiated lymphoid cells, Santourlidis et al. noticed that KIR promoter methylation always associated closely with gene silencing while heterochromatic marks were generally higher only in progenitor, B, and CD4+ T cells (Santourlidis et al., 2008). Thus a model was proposed where euchromatic histone signatures pave the way for expression competency in NK and CD8+ T cells. DNA methylation further restricts and maintains stochastic gene expression. To date, aside from Ly49d and Ly49h, the role of epigenetics in regulating activating NK receptors has not been explored. 22  1.3  KLRK1/NKG2D NKG2D is arguably the best studied activating receptor to date, thanks to its role in  cancer biology. Though initially grouped into the NKG2 family, it differs drastically from other family members. The receptor has low peptide sequence similarity to NKG2A/C (Houchins et al., 1991). The receptor has a c-type lectin-like structure and is well conserved in the mammalian tree. It does not interact with CD94 but instead forms a homodimer on cell surface.  1.3.1 NKG2D ligands The NKG2D receptor binds a gamut of MHC class I like ligands. This area has been explored extensively in the mouse and human systems (Eagle and Trowsdale, 2007). In mouse, ligands identified to date include retinoic acid early transcript 1 alpha through epsilon (RAE1αε), murine UL16 binding protein like transcript 1 (MULT1), and H60. In human, they are MHC class I polypeptide related sequence A and B (MICA, MICB) as well as UL16 binding proteins 1 through 5 (ULBP1-5). In cattle, 30 ULBP-like genes have been found. In addition, the ligands display polymorphism within a species. This diversity is unlike most other NK receptors which only have one or two ligands. All ligands share the MHC class I like α1α2 extracellular domain responsible for interacting with the NKG2D receptor. This domain does not bind antigenic peptide nor does the ligand associate with β2 microglobulin. NKG2D ligands are normally found only on diseased cells (Nausch and Cerwenka, 2008). Indeed, this observation was a predominant driving force behind the induced-self hypothesis. They have been detected on numerous cancer cell lines and primary tumors of different origins. However, expression is not a general phenomenon of all cancer cells and the 23  level of expression of each ligand can vary. As well, their expression is linked to virus and bacterial infections. Mechanistically, pathogenic or transformative stress pathways lie upstream of ligand expression. Alpha interferon, heat shock, oxidative stress or DNA breakage have all been shown to induce NKG2D ligands. In recent years, the ligands have been found in normal contexts (Eagle et al., 2009). They have been detected on healthy tissue such as intestinal epithelium or stimulated T and B cells. Of note, normal processes such as T cell activation lead to ATM/ATR (ataxia telangiectasia mutated/ATM and Rad3 related) pathways that are shared by stress responses such as DNA damage. It has been proposed that NK cells may play a regulatory role in dampening T cell responses in this context. However, the significance of ligand expression in most healthy situations is not entirely clear.  1.3.2  NKG2D in diseases The biological significance of NKG2D has been explored in multiple ways. Initially,  neutralizing anti-NKG2D antibodies were used to block the receptor. This results in decreased NK cytotoxicity, IFNγ secretion, and increased tumorigenesis (Diefenbach et al., 2001; Smyth et al., 2005). NKG2D depletion can also be achieved by transgenic persistent expression of MICA. These mice display impaired tumor rejection and decreased response against pathogens (Wiemann et al., 2005). In 2008, Guerra et al. reported the generation of an Nkg2d knockout mouse (Guerra et al., 2008). Using a spontaneous prostate cancer mouse model, they showed that Nkg2d deficiency resulted in an increase of highly malignant tumors. Similarly, they used a spontaneous lymphoma model to show that lack of Nkg2d hastened the onset of malignancy. Interestingly, they noticed that tumor cells in Nkg2d deficient mice tend to have higher levels of 24  NKG2D ligand expression, hinting that the receptor may mediate surveillance and immunoediting of the tumor. Zafirova et al. also created Nkg2d deficient mice, with notable similarities and differences between these mice and Guerra’s (Zafirova et al., 2009). Consistent with the first mouse model, Zafirova’s mice showed defective cytotoxicity against tumor cell lines. But there are some discrepancies between the two mice regarding NK development and T/B cell compartments in the spleen which awaits side-by-side experimentation. In addition, Zafirova reported the paradoxical finding of enhanced MCMV resistance with Nkg2d knocked out. The authors theorized that the observation is a result of general NK dysregulation resulting in enhanced signaling from other activating receptors. The gene targeting studies give ambiguous results concerning NKG2D’s role in MCMV control. However, there is indirect evidence supporting the importance of the receptor in viral immunity. Studies with HCMV, MCMV, and other viruses have uncovered a host of mechanisms that inhibit the NKG2D signaling axis (Jonjic et al., 2008). HCMV and MCMV have evolved viral proteins that bind freshly translated NKG2D ligands, causing intracellular retention and down-modulation of surface expression. Some viruses encode miRNAs that target NKG2D ligand transcripts to inhibit translation. Finally, orthopox virus encodes a MHC class I like soluble protein that, when secreted into serum, acts as a decoy for NKG2D. Tumor cells display similar strategies, attesting to the pressure for these cells to evade NKG2D mediated immunosurveillance. Ligand shedding by proteolytic release of the extracellular domain has been described (Groh et al., 2002; Salih et al., 2002). These soluble ligands are found in the sera of cancer patients and markedly decrease NKG2D receptor expression. Intracellular retention of ligands has also been reported (Fuertes et al., 2008). 25  In terms of autoimmune diseases, there is convincing evidence of NKG2D participation in type 1 diabetes from non-obese diabetic (NOD) mice. The NOD mouse is a widely used model of human diabetes and develops the disease spontaneously. Ogasawara et al. found that RAE1 proteins are initially absent on NOD pancreas but gradually appears after onset of insulitis (Ogasawara et al., 2004). Administration of NKG2D blocking antibody resulted in significant protection from development of the disease in NOD mice. It is important to note that the autoreactive culprit identified in this study was CD8+NKG2D+ T cells and not NK cells.  1.3.3  NKG2D expression pattern Unlike the inhibitory receptors, NKG2D is ubiquitously expressed on all NK cells.  However, by itself, NKG2D is not a great NK-specific marker because it is present on various T cell types (Figure 1.6). Subsets of NKT cells and γδT cells express the receptor. Human CD8+ T cells show surface expression while mouse CD8+ T cells need to be activated before they express the receptor. CD4+ T cells, under normal conditions, lack the receptor (Ehrlich et al., 2005; Jamieson et al., 2002). However NKG2D expression on CD4+ T cells has been reported in cancer or autoimmune patients (Nausch and Cerwenka, 2008). In an ironic twist, NKG2D receptor can be found on primary epithelial type cancer cells and on tumor cell lines (Benitez et al., 2011). In this context, the receptor seems to act as a growth receptor, inducing signaling pathways that promote metabolic activity and proliferation. The presence of the receptor correlated with disease progression in a small cohort of breast, colon, prostate, and ovarian carcinoma patients.  26  1.4  NCR1/NKp46 NKp46 is a type 1 transmembrane receptor with two extracellular immunoglobulin-like  domains. It was initially discovered by screening for novel antibodies capable of redirected killing (also known as reverse ADCC: target cells express Fc receptors that bind the Fc region of an antibody while the antigen binding site recognizes an NK receptor). Sivori et al. reported that antibody crosslinking of the receptor markedly induced calcium mobilization, cytolytic activity, and IFNγ release (Sivori et al., 1997). The receptor signals through CD3ζ and FcεRIγ, though neither adapter is required for surface expression (Biassoni et al., 1999; Pessino et al., 1998).  1.4.1 NKp46 ligands To date, few ligands have been identified for the NKp46 receptor. Much like the NKp44 receptor, NKp46 also recognizes influenza and Sendai virus hemagglutinin (Mandelboim et al., 2001). These viral proteins are expressed on the surface of virus particles and mediate the fusion of viral and host cell membrane to allow virus entry. Thus the surface of infected host cells will bear telltale hemagglutinin signatures. Tumor ligands for NKp46 have long been postulated but have so far eluded identification. NK cells aggression toward tumor cell lines can be diminished by anti-NKp46 blocking (El-Sherbiny et al., 2007; Pessino et al., 1998; Sivori et al., 1997). In addition, Higher NKp46 expression on human NK cells correlates with stronger cytotoxicity against tumor cell lines (Sivori et al., 1999). Finally, Gur et al. used NKp46-Ig (NKp46 fused to immunoglobulin) staining to show NKp46 ligand expression on normal, healthy human and mouse pancreatic beta cells (Gur et al., 2010; Gur et al., 2011).  27  1.4.2  NKp46 in diseases Certainly, ligand expression patterns allude to NKp46 receptor functions in combating  diseases. As expected, an Ncr1 knockout mouse displays various phenotypes in pathogenic defense, cancer development and autoimmune disorders. These mice succumb to influenza virus infection (Gazit et al., 2006). In this model, approximately 60% of wild type and Ncr1+/- mice survive pathogenic insult. Dramatically, none of the homozygous Ncr1-/- littermates survived. NK cells still accumulated at the site of infection, the lung, but were unable to fight off the infection. The effect of NKp46 deficiency on tumorigenesis has also been tested via tumor cell line inoculation and clearance experiments. Ncr1-/- mice do show a decreased ability to reject some lymphoma cell lines. However, it is important to point out that NKp46 mediated sensitivity is dependent on the lymphoma cell line used and the strain background of the mouse (Gazit et al., 2006; Halfteck et al., 2009). Elboim et al. used a different model to address the question of tumorigenesis (Elboim et al., 2010). Instead of inoculating cancer cells, they used a well established 3-methylcholanthrene (MCA)-induced fibrosarcoma model. NKp46 deficiency had no effect on the development of fibrosarcomas. However, tumors arising in wild type mice expressed NKp46 ligands while those from Ncr1-/- mice did not. The authors concluded that NKp46+ NK cells are involved in immunosurveillance and immune editing of tumors. There is also some evidence of tumor evasion from NKp46 targeting in clinical data. NK cells from acute myeloid leukemia (AML) patients have lower NKp46 surface expression (Costello et al., 2002; Fauriat et al., 2007). Moreover, those patients that achieve remission after clinical intervention displayed restoration of NKp46 expression. If the disease relapses, NKp46 again becomes down-  28  regulated. Indeed, a statistical analysis revealed that lower NKp46 levels correlates with poorer survival in AML patients (Fauriat et al., 2007). In recent years, NCR1 has been functionally linked to type 1 diabetes as well. The discovery of NKp46 ligand on pancreatic beta cells led Gur et al. to investigate the role of NCR1 in the development of the autoimmune disorder (Gur et al., 2010). The beta cells induced NK degranulation but not IFNγ release. In healthy humans and mice, beta cells are protected from destruction due to lack of NK infiltration of the pancreas (Gur et al., 2010; Gur et al., 2011). Using a well established method, Gur et al. chemically induced diabetes in mouse and found that a significantly higher number of Ncr1-/- did not develop diabetes compared to wild type (Gur et al., 2010). They also experimented with NOD mice. The presence of NKp46-blocking antibody prevented the onset of the autoimmune disease in a substantial number of animals. While these results are reminiscent of protection induced by NKG2D-blocking, there are notable differences. NKp46 ligand appears in the pancreas much earlier than RAE1 family NKG2D ligands. In addition, the autoreactive NKp46+ lymphocytes are NK cells. NKp46-blocking did not prevent the appearance of NK cells in the pancreas, but it did down-regulate NKp46 surface expression (possibly by internalization). Degranulation is greatly impaired in these NK cells.  1.4.3 NKp46 expression pattern Since its discovery, NKp46 has been hailed as a bona fide NK specific marker. NCR1 is well conserved in mammals and remarkably, the specificity spans all mammals tested. Flow cytometry has been used to show that in human peripheral blood mononuclear cells (PBMC), NKp46 is not present on αβT cells, γδT cells, NKT cells, B cells, dendritic cells, nor granulocytes (Sivori et al., 1997; Walzer et al., 2007). Instead, most human NK cells defined by 29  the CD56+CD3- phenotype are NKp46+. A similar scenario can be found for three monkey species (Walzer et al., 2007), mouse (Narni-Mancinelli et al., 2011; Walzer et al., 2007), rat (Westgaard et al., 2004), cow (Storset et al., 2004), and sheep (Connelley et al., 2011). In some of these animals, a portion of NKp46+ cells also co-express CD8. However, these cells do not seem to be T cells and show innate NK cell phenotype and characteristics. In the last few years, the specificity of NKp46 expression has been challenged (Figure 1.6). A miniscule population (<0.5%) of mouse CD3+ αβT cells consistently show NKp46 staining (Walzer et al., 2007; Yu et al., 2011). A small proportion of human peripheral blood and umbilical cord derived CD8+ T cells acquire NKp46 after culturing with interleukin-15 (IL15) for more than 12 days (Correia et al., 2011b; Tang et al., 2008). A CD3+ NK1.1+ mouse NKT subpopulation that expresses NKp46 has been described. These cells are also DX5+ CD94+ NKG2A+ and Ly49D+/-. They are highly responsive to IL-15, forming large granular lymphocytic leukemia in IL-15 transgenic mice (Yu et al., 2011). These reports hint that there may be an intimate link between IL-15 signaling and NKp46 expression. There is also a rare mouse γδT cell subset that expresses NKp46. As with the NKp46+ NKT cells, it is not easy to categorize these cells. They express T cell gamma delta receptor (TCRγδ) on their cell surface and CD3 intracellularly, have a thymic origin and stain for interleukin-7 receptor/CD127. Yet they also express NK markers such as NK1.1, NKG2A, and DX5 to varying degrees (Stewart et al., 2007). A similar situation can be found in the human γδT population and culturing of human γδT with pan-T-cell mitogens induces an upregulation of the receptor (Correia et al., 2011a; Stewart et al., 2007). Recently, a novel IL-22 producing, RORγt+ (RAR-related orphan receptor gamma t) innate lymphoid cell type has been found to expresses NKp46. These cells participate in 30  pathogenic defense in mucosal settings. They can be detected in both mouse and human and have been called NK22, NCR22, LTi (lymphoid tissue inducer)-like NK, and ILC22 (innate lymphoid cell, IL-22 secreting) cells. Though NKp46 is a key marker used to identify these cells, the receptor itself seems to be dispensable for the function of the cells (Spits and Di Santo, 2011). It is important to keep in mind that despite these recent discoveries, NKp46 remains the best characterized receptor that most faithfully labels NK cells in bone marrow, blood and spleen. Exploring its regulation can thus shed light on the molecular programming of natural killer cells.  Figure 1.6 Expression of NKG2D and NCR1 on different cell types. Surface expression (with flow cytometry evidence) of NKp46/NCR1 and NKG2D is summarized for NK and T cell types.  31  1.5  Thesis objectives The goal of my thesis was to explore the oftentimes overlooked transcriptional regulatory  mechanisms that govern NK cell activating receptors. To date, most reports on NK receptor gene regulation have focused only on the inhibitory class. But there is a clear difference in expression patterns between the inhibitory and activating classes. Inhibitory receptors tend to be stochastically expressed. Most activating receptors, except for the activating Ly49’s and KIR’s, are ubiquitous on the NK population. In addition, a few activating receptors show high tissue specificity. I chose to concentrate on two well characterized and conserved receptors on NK cells: NKG2D and NKp46. In chapter 2, I will discuss the discovery of a genetic element that sets up a novel splicing event in rodent Nkg2d. I characterized the cis-regulatory sequence in this element and identified a transcription factor associated with it. A version of this chapter has been published: Lai, C.B., Zhang Y., Rogers S.L., and Mager D.L. (2009) Creation of the two isoforms of rodent NKG2D was driven by a B1 retrotransposon insertion. Nucleic Acids Res. 37(9): 3032-3043. In chapter 3, I will discuss the characterization of the proximal regulatory region of NCR1 as well as the identification of a transcription factor controlling the region. A version of this chapter was submitted to the Journal of Biological Chemistry: Lai, C.B. and Mager D.L. The role of runt-related transcription factor 3 (RUNX3) in transcription regulation of natural cytotoxicity receptor 1 (NCR1/NKp46), an activating NK cell receptor. It has been accepted and is in press as of January 2012. In chapter 4, I will summarize my findings and discuss how my work relates to NK cell genetic programming.  32  CHAPTER 2  CREATION OF THE TWO ISOFORMS OF RODENT NKG2D WAS DRIVEN BY A B1 RETROTRANSPOSON INSERTION  33  2.1  Introduction Alternative splicing produces two different isoforms of Nkg2d in mouse. This pattern is  the result of mutually exclusive alternate exon 1a/1b usage. One isoform, Nkg2d-L, produces a longer protein with 13 extra amino acids at the N-terminus compared to the shorter isoform (Nkg2d-S). This difference results in divergent signaling consequences (Diefenbach et al., 2002). Both isoforms bind and signal through the DAP10 adapter. Additionally, NKG2D-S associates with DAP12 while NKG2D-L does not (Diefenbach et al., 2002; Gilfillan et al., 2002). The downstream pathways for the 2 adapters are dissimilar: DAP12 is capable of inducing NK cytotoxicity and cytokine release but DAP10 can only induce NK cytolysis (Zompi et al., 2003). This means that NKG2D-L can only trigger cytotoxicity. In CD8+ T cells, NKG2D serves a costimulatory role and the 2 isoforms are functionally the same because CD8+ T cells express DAP10 but not DAP12. In NK cells, interestingly, expression of NKG2D-S depends on the stimulatory status. Resting NK cells express only NKG2D-L. NK cells stimulated with IL-2 or polyinosinic:polycytidylic acid (poly I:C) expresses both forms (Diefenbach et al., 2002). Thus isoform and adapter selections provide functional diversification of the NKG2D receptor. The situation in human is slightly different. The human NKG2D gene still has two transcription start sites, but the second exon (where the coding region begins) is never skipped in productive transcripts (Andre et al., 2004). In essence, the mRNA arising from the two promoters encodes the same protein. This protein is homologous to mouse NKG2D-L. Similarly, it binds only DAP10 and drives NK cytotoxicity but not cytokine release (Andre et al., 2004; Billadeau et al., 2003; Wu et al., 2000). As in the mouse, NKG2D/DAP10 only acts in a co-stimulatory manner in human CD8+ T cells (Groh et al., 2001).  34  While many studies have concentrated on the function and signaling of NKG2D, surprisingly little is known about its transcriptional regulation. Here I show that the spliced isoforms of mouse Nkg2d arise from the use of alternative promoters. I focus on the promoter for mouse Nkg2d-L and show it to be derived from a rodent-specific B1 retrotransposon with a functional binding site for GABP, a member of the ETS family. I propose that insertion of this retrotransposon, through unusual donation of a polymerase II promoter, led to the alternative splicing patterns maintained in both mouse and rat that, in turn, result in functionally distinct NKG2D isoforms. These results document an intriguing example of how retrotransposons can affect the evolution of host gene expression and, more specifically, lend insight into the transcriptional regulation of Nkg2d.  2.2  Materials and methods  2.2.1 Cell culture LNK (mouse NK cell line), EL4 (mouse T cell line) and RNK16 (rat NK cell line) were cultured in RPMI 1640 medium supplemented with 10% (v/v) fetal bovine serum, 100 U/mL penicillin, 100 U/mL streptomycin, 50 μM 2-ME, and 2 mM L-glutamine. LNK cells were further supplemented with 1000 U/mL IL-2 (Peprotech). NIH 3T3 (mouse embryonic fibroblast cell line) were cultured in Dulbecco's Modified Eagle's Medium supplemented with 10% fetal calf serum.  2.2.2  Mice C57BL/6 (B6) mice were purchased from The Jackson Laboratory and bred in our animal  facility. The use of animals for this study was approved by the Animal Care Committee of the 35  University of British Columbia, and animals were maintained in accordance with the guidelines of the Canadian Council on Animal Care.  2.2.3 RT-PCR and sequencing All RT-PCR was performed using Superscript III (Invitrogen) using random primers according to manufacturer’s instructions. For Sprague Dawley rat total RNA (Clonetech), PCR was then carried out using gene-specific primers: rat exon 1a forward, 5’GATTCACAAGAAACAGGACCTC; rat exon 1b forward, 5’-TGGCATGGGTTCGTGATC; rat exon 5 reverse, 5’-CAACAAGGACTCGAACAACG. PCR products were cloned into pGEMT vector (Promega) according to manufacturer’s instructions. Sequencing was performed using the T7 primer by McGill University and Genome Québec Innovation Centre Sequencing Platform. For LNK, RNK16, EL4, and NIH 3T3 cell lines, total RNA was collected using Rneasy minikit and QIAshredder homogenizer (QIAGEN). The RNA samples were treated with DNase I twice: during purification using the on-column protocol of the Rneasy minikit and after elution using DNase I from Invitrogen. PCR primers used were: mouse exon 1a forward, 5’GAAACAGGATCTCCCTTCTCT; mouse exon 1b forward, 5’ACAACCTGGATCAGTTTCTGAA; mouse exon 6 reverse, 5’GGTTCCAGGTTTTCTCTTCATT; rat exon 1a forward, 5’GATTCACAAGAAACAGGACCTC; rat exon 1b forward, 5’-TGGCATGGGTTCGTGATC; rat exon 6 reverse, 5’-GGTTCCAGGCTTTGTTCTCA; GAPDH forward, 5’GTGGAGTCTACTGGTGTCTTC; GAPDH reverse, 5’-GTGGCAGTGATGGCATGGAC.  36  2.2.4  Sequence alignment Nucleotides positioned from -75 to +75 from the splice acceptor site of human NKG2D  exon 2 were used as the reference sequence in UCSC Genome browser (http://genome.ucsc.edu). From the conservation tract, the orthologous sequences of rhesus, mouse, rat, guinea pig, hedgehog, horse, cow, and armadillo were obtained. These sequences were aligned using Multiple Alignment using Fast Fourier Transform and G-INS-i strategy (MAFFT, http://align.bmr.kyushu-u.ac.jp/mafft/online/server/index.html). The same was done for -50 to +50 of the ATG in human exon 3 and for aligning PB1D9 with B1Mur3.  2.2.5 5’ RACE C57BL/6 mouse spleens were homogenized. Total RNA was extracted from LNK cells and mouse splenocytes using Rneasy minikit and QIAshredder homogenizer (QIAGEN). Sprague Dawley Rat total RNA was purchased from Clonetech. 5’ RACE was performed using FirstChoice RLM-RACE kit (Ambion) according to manufacturer’s instructions. The primers used were: mouse exon 6 reverse flanking, 5’-GGTTCCAGGTTTTCTCTTCATT; mouse exon 6 reverse nested, 5’-TTGTTTCTGTGACATATCCAGTT; rat reverse exon 6 flanking, 5’GGTTCCAGGCTTTGTTCTCA; rat reverse exon 5 nested, 5’CAACAAGGACTCGAACAACG.  2.2.6 Generation of luciferase reporter constructs Promoter fragments were generated by PCR using forward primers with KpnI site inserted at the 5’ end and reverse primers with NheI site inserted at the 5’ end. PCR products were digested with KpnI/NheI (NEB) and cloned into pGL4.10 firefly luciferase promoter vector 37  (Promega). The only exception is the generation of a construct containing the mouse B1 and a 391bp fragment at separate sites. For this construct, the mouse B1 was cloned into the multiple cloning region using KpnI/NheI while the 391bp fragment was inserted into a BamHI site downstream of the luciferase reporter gene. The primers used are as follows: mouse B1 forward: 5’-AAGGTACCCGGAAGTGGTGTCACATA; mouse B1 reverse: 5’AAGCTAGCTTTTTTAAGACAGTGTATC; mouse -391 of B1 forward: 5’AAGGTACCCTGACATTTATTTATCTT; mouse -1 of B1 reverse: 5’AAGCTAGCAATCTGTCCTAATTTCTG; mouse 391bp BamHI forward: 5’AAGGATCCCTGACATTTATTTATCTT; mouse 391bp BamHI reverse: 5’AAGGATCCAATCTGTCCTAATTTCTG; rat B1 forward: 5’AAGGTACCAACCAGAAGCAGTGTCACC; rat B1 reverse: 5’AAGCTAGCTTTCTAAAGACAGTTTGTCTCTCT; B1 3’ 32bp truncation reverse: 5’AAGCTAGCGGCTACCTCAGATTTACAG; B1 3’ 59bp truncation reverse: 5’AAGCTAGCTGCCTCTGCTTCCTGAATG. The PB1D9 fragment truncated 20bp at the 5’ end and 59bp at the 3’ end was cloned by annealing complementary oligonucleotides, digesting with KpnI/NheI, and ligating into pGL4.10. The oligonucleotide sequences were: 5’AAGGTACCTTTAATCTCAGCATTCAGGAAGCAGAGGCAGCTAGCAA and 5’TTGCTAGCTGCCTCTGCTTCCTGAATGCTGAGATTAAAGGTACCTT. 1 μg of each oligonucleotide was mixed in 20 μL of water and heated to 95ºC then allowed to cool to room temperature. Primers used to clone GABP and AP1 mutants were: GABP mutant forward: 5’AAGGTACCCGTTAGTGGTGTCACATA (mutation is underlined); AP1 mutant forward: 5’AAGGTACCCGGAAGTGGTGGCACATA; double mutant forward: 5’AAGGTACCCGTTAGTGGTGGCACATA. 38  2.2.7  Cell transfection and luciferase assays LNK, EL4 and NIH 3T3 cells were transfected using Lipofectamine 2000 (Invitrogen)  according to manufacturer’s instructions. Briefly, 2.5 × 106 LNK and EL4 cells, and 6 × 105 NIH 3T3 cells, were seeded into 500 μL of growth media in 24-well plates for 24 hours at 37ºC. For each well, transfection media was prepared: 2 μL of Lipofectamine 2000 reagent was mixed with 1 μg of DNA for LNK and EL4 while 0.5 μL of Lipofectamine 2000 reagent was mixed with 0.6 μg of DNA for NIH 3T3. Transfection media was brought up to 100 μL using unsupplemented media and incubated at 37ºC for 20 minutes. Next, growth media in each well was exchanged with 150 μL of unsupplemented media and 100 μL of transfection media. Cells were incubated at 37ºC for 6 hours before being topped up with 250 μL of media supplemented with 20% fetal bovine serum and IL-2 where necessary. Cells were then incubated at 37ºC for 16 hours before assaying. Luciferase activity was assayed using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s instructions. Firefly luciferase activity was normalized relative to Renilla luciferase activity for each transfection and calculated as fold increase over pGL4.10-BASIC (pGL4B).  2.2.8  EMSA Double stranded probes were generated by annealing the following oligomers to their  complementary oligomers: mouse wild type: 5’AGGACAGATTCGGAAGTGGTGTCACATATCTTTA; mouse GABP mutant: 5’AGGACAGATTCGTTAGTGGTGTCACATATCTTTA; mouse AP1 mutant: 5’39  AGGACAGATTCGGAAGTGGTGGCACATATCTTTA; mouse double mutant: 5’AGGACAGATTCGTTAGTGGTGGCACATATCTTTA; rat GABP1 wild type: 5’GAGCCTGAACCAGAAGCAGTGTCACCTA; rat GABP1 mutant: 5’GAGCCTGAACCATTAGCAGTGTCACCTA; rat GABP2 wild type: 5’TGGTCTATACAGGAAGTTCTAAGATATC; rat GABP2 mutant: 5’TGGTCTATACAGTTAGTTCTAAGATATC. Nuclear extraction, probe labeling and the gel shift assay were preformed as described before (Maksakova and Mager, 2005). Protein concentration was determined using the Qubit Quantitation Platform (Invitrogen). GABPα antibody (H-2 X) and c-Jun antibody (G-4 X) were purchased from Santa Cruz Biotechnology.  2.2.9 siRNA and real-time RT-PCR LNK cells (5 × 104 per well) were seeded in 96-well plates and grown overnight in 100 μL serum-free RPMI 1640 medium supplemented with 1000 U/mL IL-2. The next day, the growth media was removed and cells were transfected with 1 μM Accell SMARTpool mouse GABPA siRNA or Accell Non-Targeting Pool siRNA using 100 μL Accell siRNA Delivery media (Dharmacon) supplemented with 1000 U/mL IL-2. An untreated sample was also included where the media was exchanged but no siRNA was added. Seventy-two hours later, total RNA collection and RT-PCR was carried out as described above. Three wells were pooled per treatment. The resultant cDNA was used as template in real-time PCR using the 7500 Fast RealTime PCR System (Applied Biosystems). Relative expression was determined using the 2-∆∆CT method. Threshold cycles for Gabp, Nkg2d-S and Nkg2d-L were normalized to Gapdh. Primers used were GAPDH forward: 5’-GACTTCAACAGCAACTCCCAC; GAPDH reverse: 5’TCCACCACCCTGTTGCTGTA; NKG2D-S forward: 5’40  GAAGGCTTTGACTCACAAGAAACAGG; NKG2D-L forward: 5’TGGCATTGATTCGTGATCGAAAGTCT; NKG2D reverse: 5’CTCCAGGTTGACTGGTAGTTAGTGC.  2.3  Results  2.3.1 A rodent SINE element is linked to alternative exon 1 usage To begin to dissect the transcriptional regulation of mouse NKG2D, I first examined the mouse Nkg2d sequence via the UCSC Genome browser (http://genome.ucsc.edu) and noticed a repetitive B1 element, termed PB1D9, inserted at the 3’ end of intron 1. An orthologous SINE element is found in the rat (termed B1Mur3), but not in the human, NKG2D gene. The two B1 elements differ by a 5’ 3 bp deletion in the mouse B1 and an internal 30 bp insertion in the rat B1, but are otherwise 84.4% identical (aligned using MAFFT, http://align.bmr.kyushuu.ac.jp/mafft/online/server/index.html). Although annotated differently in mouse and rat by Repbase (http://www.girinst.org/repbase/index.html), these B1 elements represent the same ancestral insertion. To avoid confusion, I will refer to the mouse element as mB1 and the rat element as rB1. While there are two mouse NKG2D isoforms arising from transcripts that alternatively encode exon 1a or 1b, there is only one human NKG2D protein from transcripts that always include exon 2, which is homologous to mouse exon 1b (Figure 2.1A). The situation in rat is less clear. A rat mRNA initiating near the region homologous to mouse exon 1b has been previously described (Berg et al., 1998). However, a rat genomic sequence that is highly similar to mouse exon 1a is found upstream of this initiation exon (Figure 2.1A). To see if rat Nkg2d splicing patterns resemble those of the mouse, I undertook reverse-transcriptase-polymerase  41  chain reaction (RT-PCR) on Sprague Dawley rat splenic total RNA. Primers were designed in rat sequences orthologous to mouse exons 1a and 4. Sequencing of the amplified product shows that  Figure 2.1 NKG2D genomic organization and splicing pattern. (A) A comparison of NKG2D exon-intron organization and splice variants in human, mouse, and rat. Human exon nomenclature was revised based on 5’RACE from another study (Andre et al., 2004). Exons are labeled with Roman numerals. Translated regions are shown as thicker solid boxes. Open boxes indicate the B1 element present in mouse and rat. Rat exon 1a was previously uncharacterized and hence the first intron is shown as dotted line. (B) RT-PCR detection of a Nkg2d-S transcript in rat. Total RNA from Sprague Dawley rat was used for reverse transcriptase reactions. Primers used for PCR are marked by arrows. PCR product was sequenced and shown as spliced transcript in the diagram. 42  a rat transcript indeed includes the region orthologous to mouse exon 1a and splices out the previously reported exon (Figure 2.1B). Furthermore, the splice sites used are the same as that of the mouse. I herein designate the exon found by RT-PCR as rat exon 1a and the alternative exon as rat exon 1b. As was done with the mouse (Diefenbach et al., 2002), I also designate the isoform arising from exon 1a as rNKG2D-S and the isoform arising from exon 1b as rNKG2D-L. These results suggest that the Nkg2d splicing pattern in rat is identical to that of the mouse and that both species harbor a SINE element at the 3’ end of intron 1. In comparison, human does not have the SINE element and splicing of NKG2D always gives rise to one protein.  2.3.2  The SINE element has polymerase II promoter potential To determine if the SINE element is contributing an alternative promoter element, I first  looked for transcription start sites (TSS) for mouse and rat Nkg2d-L transcripts using 5’ rapid amplification of cDNA ends (5’ RACE). Primers were designed in mouse exon 6 and rat exons 4 and 6. Two start sites were found within the mB1 element using C57BL/6 splenocytes (Figure 2.2A). Two additional sites were found using LNK, a mouse NK cell line that expresses both NKG2D isoforms (Figure 2.2B). Surprisingly, while one was located in the SINE element, the other lies downstream of the ATG1 start codon. Theoretically, this transcript could still be translated into NKG2D-S using the ATG2 start codon in exon 2. Further experiments are needed to verify this possibility. With RNA from Sprague Dawley rat spleen, I found a dispersed pattern of TSS (Figure 2.2C). Two start sites were within the rB1 element while 7 were downstream of the SINE but upstream of ATG1.  43  Figure 2.2 Detection of an RNA polymerase II promoter in SINE elements. (A) RLM-5’ RACE of mouse Nkg2d. Underlined sequence represents the mB1 element inserted in front of exon 1b. Single stars mark transcription start sites found in C57BL/6 mouse spleen. Stacked double stars mark transcription start sites found in LNK mouse cell line. ATG1 start codon for mNKG2D-L is in brackets. Splice donor site of exon 1b is denoted with an arrow. (B) Detection of Nkg2d splice forms in LNK, RNK16, EL4, and NIH 3T3 cell lines with RT-PCR. The mouse exon-intron structure of Nkg2d is shown with exons labeled in roman numerals. Primers used are shown as arrowheads. (C) 5’RACE of rat Nkg2d. Single stars mark transcription start sites found in Sprague Dawley rat spleen. Underlined sequence represents the rB1 element. ATG1 start codon for rNKG2D-L is in brackets. Splice donor site of exon 1b is denoted with an arrow. (D) Luciferase reporter assay of SINE elements. Fragments including the rodent SINEs and 391bp upstream of the mouse SINE were cloned into pGL4B and assayed using a dual-luciferase system. Promoter activity was normalized to co-transfected Renilla luciferase activity and calculated as fold above pGL4B. Data indicate mean (±SD) of three independent experiments. 44  The 5’RACE experiments suggest that the rodent SINE element contains a functional promoter. To examine this possibility, the mouse and rat SINE elements and the upstream region were tested in luciferase reporter assays. Various fragments including and excluding mB1 and rB1 were cloned into pGL4B. These constructs were transiently transfected into LNK cells and promoter activity was measured. As shown in Figure 2.2D, both mB1 and rB1 elements by themselves display promoter activity. A fragment 391bp upstream of mB1 shows no appreciable activity. Paradoxically, when this upstream region combined with mB1 was tested, the promoter activity was abolished. However, if this fragment was separated from mB1 in the same construct, only a small decrease in promoter activity was observed compared to a construct with mB1 alone. These results demonstrate that transcription not only starts within the SINE elements, but also that they contain polymerase II promoters.  2.3.3  The mouse B1 element contributes a functional GABP binding site Transposable elements harboring functional enhancer sites are not uncommon (Jordan et  al., 2003). Thus, I interrogated the mouse mB1 sequence for potential transcription factor binding sites using TESS (http://www.cbil.upenn.edu/cgi-bin/tess/tess). Curated results containing only mouse-specific, hematopoietic or lymphocyte related transcription factors are shown in Figure 2.3A. To determine which of these sites contribute functional regulatory elements, luciferase reporter assays were carried out using truncated fragments of mB1 in pGL4B, transiently transfected in LNK cells. Surprisingly, fragments that truncate the 3’ end of mB1 display much higher activity than the entire 109bp mB1 (Figures 2.2D and 2.3B). A 77bp fragment that eliminates the predicted TCF1, CEBPβ, and YY1 binding sites at the 3’ end shows  45  Figure 2.3 Identification of transcription factor binding sites that contribute to Nkg2d-L regulation. (A) TESS search for transcription factor binding sites in mB1. The sequence of the mB1 inserted in front of mouse Nkg2d exon 1b is shown. Potential transcription factor binding sites are indicated with brackets. Only mouse-specific, hematopoietic or lymphocyte related factors are shown. (B) Luciferase reporter assay of truncated and mutated SINE elements. mB1 sequence was truncated at the 5’ and 3’ ends or mutated at specific transcription factor binding sites, cloned into pGL4B and assayed using a dual-luciferase system. Mutated sites are indicated with an X. Promoter activities were normalized to co-transfected Renilla luciferase activity and calculated as fold above pGL4B. Data indicate mean (±SD) of two independent experiments. 46  40-fold activity over basal. Of note, this piece removes an ATG at the +78 position. When the 77bp segment was further 3’ truncated to 50bp, eliminating two more TCF1 and one GATA3 binding site, 97-fold activity over basal was observed. Luciferase activity dropped to 3-fold over basal when 20bp were deleted at the 5’ end of the 50bp segment. This construct deletes a GABP, an AP1, and a GATA3 binding site. These results suggest that the essential transcription factor binding sites are within the first 20bp of mB1. To further narrow down the essential transcription factor binding sites, I mutated the potential GABP and AP1 binding sites and repeated the reporter assays in LNK cells. I chose to mutate the 77bp construct because the ATG at position +78 may be interfering with luciferase expression. Promoter activity does not decrease appreciably using an AP1 mutant construct (Figure 2.3B). On the other hand, the GABP mutant and double mutant only show 2 and 4 fold activity over basal, respectively. These results indicate that the GABP binding site is essential to enhancing transcription from the mB1 polymerase II promoter.  2.3.4  GABP binds the identified mB1 enhancer site in vitro The core GGAA nucleotides in the binding sites of ETS family members, of which  GABP is a member, are highly conserved. To determine if GABP is indeed binding to this mB1 element, electrophoretic mobility shift assays (EMSA) were performed. When a DNA oligomer spanning the 5’ end of mB1 was incubated with LNK nuclear extracts, two complexes are clearly visible in EMSAs, labeled I and II (Figure 2.4). Complex I contains GABP since it can be supershifted by anti-GABPα antibody. This complex is decreased or abolished using wild type unlabeled oligomers in a dose dependent manner (10-, 25-, 50-, and 100-fold excess). Complex I  47  Figure 2.4 GABP forms protein-DNA complex within mB1 in EMSA. Sequences of probes and competitors used are shown at the top. Mutations are underlined. As control, lane 1 contains only γ32P labeled WT probe. LNK nuclear extract was incubated with labeled WT probe at 4°C for 20 min (lane 2). For competition assays, unlabeled competitors were incubated with LNK nuclear extract at 4°C for 20 min before addition of labeled WT probe for another 20 min incubation. WT competitors were used at 10-, 25-, 50-, and 100-fold molar excess (lanes 3-6). Competitors with GABP, AP1, or both binding sites mutated were used at 100-fold molar excess (lanes 7-9). Supershift assays were carried out using 5 μg of anti-GABPα (lane 10) or anti-c-Jun (lane 11) antibodies.  48  is still clearly visible when unlabeled oligomers containing a mutated GABP site or with mutations in both the GABP and AP1 sites were used as competitors. The fact that these signals are lower compared to complex I without competitors is likely the result of non-specific competition at 100-fold excess. In agreement with previous experiments, the oligomer did not seem to bind AP1. A competition assay using unlabeled oligomers with a mutated AP1 site did not produce any complexes. In addition, anti-AP1 antibody did not induce a supershift. The identity of complex II is currently unknown. It is possible that this complex contains GATA3, since the oligomer spans a GATA3 binding site. Furthermore, all mutant competitors were equally effective at abolishing this complex and neither anti-GABP nor anti-AP1 antibodies supershifted the complex. Taken together, these results suggest that GABP, but not AP1, is an important factor in transcription from mB1.  2.3.5 GABP binds a separate site in rat B1 in vitro We wondered if GABP regulation of the B1 promoter is conserved between mouse and rat. An alignment of mB1 with rB1 shows that rB1 has an AGAA sequence instead of the core GGAA sequence at the mB1 GABP binding site (Figure 2.5A). However, a separate potential GABP binding site is found in the internal insertion of rB1 using TESS (http://www.cbil.upenn.edu/cgi-bin/tess/tess). These sites in rB1 were labeled GABP1 and GABP2, respectively. To see if either of these sites bind rat GABP, I subjected them to EMSA. DNA oligomers containing GABP2, but not GABP1, formed DNA-protein interactions with RNK16 (an Nkg2d expressing rat NK cell line) nuclear extract (Figure 2.5B). The identity of the protein in this sole complex, labeled III, was confirmed to be GABP in a supershift assay using an anti-GABPα antibody. Complex III can be abolished using wild type unlabeled oligomers at 49  100-fold excess but not with oligomers where the GABP2 site is mutated. These results suggest that GABP also regulates transcription from the rB1 promoter but uses a different binding site compared to mB1.  Figure 2.5 GABP forms protein-DNA complex within rB1 in EMSA. (A) DNA sequence alignment of mB1 and rB1. Identical bases are indicated by vertical lines and absent bases are shown as double dashes. Potential GABP binding sites are labeled with brackets. (B) Sequences of probes and competitors used are shown at the top. Mutations are underlined. As control, lane 1 contains only γ32P labeled GABP1 and GABP2 WT probes. RNK16 nuclear extract was incubated with labeled GABP1 and GABP2 WT probes at 4°C for 20 min (lanes 2, 5). For competition assays, unlabeled competitors were incubated with LNK nuclear extract at 4°C for 20 min before addition of labeled WT probe for another 20 min incubation. WT competitors were used at 100-fold molar excess (lanes 3, 6). Mutant competitors were also used at 100-fold molar excess (lanes 4, 7). Supershift assays were carried out using 5 μg of anti-GABPα (lanes 8, 9) antibody. 50  2.3.6  GABP is required for full NKG2D-L expression in vivo To show that GABP is involved in the transcription of the natural Nkg2d locus, I adopted  an RNAi strategy. I examined the effects of transient siRNA knockdown of Gabpα in the LNK cell line. Transcript levels of Gabpα, Nkg2d-S, and Nkg2d-L were assayed via real-time RT-PCR. As shown in Figure 2.6, Gabpα transcripts decreased approximately 70% with Gabpα siRNA. The negative control siRNA did not decrease the expression of the three genes compared to untreated samples. Gabpα knockdown had no effect on Nkg2d-S levels but decreased the expression of Nkg2d-L by 24% compared to the negative control. This suggests that the mB1 associated Nkg2d-L, but not Nkg2d-S, is regulated at least in part by GABP.  Figure 2.6 Transient knockdown reveals requirement of GABP for full expression of Nkg2d-L but not Nkg2d-S. LNK cells were treated with GABPα or negative control Accell siRNA. Transcript levels of Gabpα, Nkg2d-S and Nkg2d-L were assayed by real-time RT-PCR and normalized to the levels of Gapdh. mRNA levels from untreated cells (incubated with carrier media but no siRNA) were set to one. Results are the mean (±SD) of three independent experiments. Asterisk, P = 0.03 (Student’s t-test). 51  2.3.7  Mouse B1 promoter activity is not tissue specific Since GABP is a ubiquitous transcription factor, it likely does not confer tissue  specificity. To investigate this issue, I tested a 3’ truncated fragment of mB1 in pGL4B using the EL4 and NIH 3T3 cell lines. EL4 is a mouse T-lymphoblastoid cell line and NIH 3T3 is a mouse embryonic fibroblast cell line. Neither cell lines express NKG2D (Figure 2.2B). The promoter activity of this construct in EL4 is comparable to that of LNK cells (Figure 2.7). The activity in NIH 3T3 is approximately 3-fold higher than in LNK and EL4 cells. This data demonstrates that the promoter and enhancers within the truncated mB1 retrotransposon are not tissue specific.  Figure 2.7 Detection of promoter activity in different cell lines. A truncated 77bp mB1 sequence cloned into pGL4B was assayed using a dual-luciferase system in LNK, EL4, and NIH 3T3 cells. Promoter activities were normalized to co-transfected Renilla luciferase activity and calculated as fold above pGL4B. Data indicate mean (±SD) of at least two independent experiments. 52  2.3.8  Splice signals are conserved in mammals, with the exception of rodents We wondered if the splicing pattern seen in rodents and human correlated with  divergence of splice signals. Alignment of nine mammalian species at the intron1-exon1b border shows the absence of splice acceptor signals in rodents: mouse, rat, and guinea pig (Figure 2.8A). It is possible that the selection pressure to maintain this splice signal was alleviated after the inserted SINE became capable of initiating transcription of Nkg2d-L. An added effect is the emergence of Nkg2d-S, initiating at exon 1a and skipping exon 1b now that the splice acceptor is eliminated. Interestingly, out of the nine mammals, only mouse and rat have a SINE B1 element at this splice junction. Thus, the evolution of guinea pig Nkg2d is different from the mouse and rat subclade. Furthermore, we noted that guinea pig and cow were the only species out of the nine examined that have lost the ATG1 start codon (Figure 2.8B). Both retain the ATG2 start codon while hedgehog does not (Figure 2.8C). This data shows that the SINE is specific to a subclade of rodents, and the splice acceptor signal at the intron1-exon1b junction is not present in rodents.  53  Figure 2.8 Analysis of the NKG2D splice signal and start codons. (A) DNA sequence alignment of 9 mammalian species near the splice acceptor site of human exon 2 using the human sequence as reference. Identical bases to the human reference are shown as dashes. Absent bases are shown as double dashes. The 5’ end of B1 sequences in mouse and rat are underlined. (B) DNA sequence alignment near the ATG start codon of human NKG2D using the human sequence as reference. (C) DNA sequence alignment near the ATG2 start codon of mouse Nkg2d using the human sequence as reference.  54  2.4  Discussion In the present study, I show that the two splice forms of mouse and rat Nkg2d arise from  usage of alternative promoters. The promoter for mouse and rat Nkg2d-L is a SINE retrotransposon with a functional GABP binding site. Comparative genomics data suggests a complex evolutionary model. Since guinea pigs lack the orthologous SINE element, I believe the B1 inserted after the divergence of guinea pig from the mouse and rat subclade. The identified GABP binding site in the mouse is not found in the consensus B1 sequence, likely emerging through mutation. This novel regulatory element may have allowed the SINE to mediate transcription of the long isoform of Nkg2d directly from exon 1b, lifting the selection pressure to maintain a splice acceptor signal at the intron1-exon1b junction. The mutation of this splice acceptor site forces the transcript starting from exon 1a to splice directly to exon 2, thus creating NKG2D-S. The mutation and its consequences on splicing we have just described may apply to both mouse and rat. The only difference between the two species is the position of the acquired GABP binding site. Thus, this study presents an interesting example of convergent evolution to achieve the same means in animals that share similar niches. The 13 amino acid difference at the N-terminus of the two isoforms results in differential adapter affinities: NKG2D-L binds only DAP10 while NKG2D-S binds both DAP10 and DAP12 (Diefenbach et al., 2002). Signal cascades of these two adapters are reviewed elsewhere (Tassi et al., 2006). In essence, DAP12 coupled SYK and ZAP70 signaling is strongly stimulatory and initiates cytotoxic and cytokine release pathways. On the other hand, DAP10 signaling resembles co-stimulatory pathways of CD28 in T cells. While DAP10 can initiate NK killing response through GRB2/VAV1, it cannot trigger cytokine release. This is shown in the inability of antiNKG2D treated, DAP12 knockout mouse NK cells to produce IFNγ (Zompi et al., 2003). 55  Malarkannan et al. also showed that DAP12/SYK/ZAP70-dependent activation of PLCγ2 (phospholipase C gamma 2) leading to the Bcl10 (B-cell CLL/lymphoma 10)/NF-κB pathway is absolutely essential to mouse NK cytokine production (Malarkannan et al., 2007). Diefenbach et al. reported that while the long form of NKG2D is always expressed, the short form is only expressed after NK priming with IL-2 or poly I:C (Diefenbach et al., 2002). Thus, it is possible that the two differentially expressed splice forms provide the mouse and rat with beneficial functional flexibility in a context dependent manner. In my model, I also believe that the losses of ATG1 in guinea pig and in cow are separate events of convergent evolution. The Nkg2d genes in these two animals likely produce only the short protein form. Indeed, Fikri et al. has reported the characterization of a short NKG2D form in cow (Fikri et al., 2007). Although the flexibility of signaling found in mouse and rat may not be present in guinea pigs and cows, NKG2D in the latter two can at least signal through DAP12 and may therefore be beneficial. Lastly, the loss of ATG1 in guinea pigs may also have lifted selection pressure for retention of the splice acceptor site, allowing it to mutate away. Our results that repetitive elements aid in the regulation of an NK receptor gene resonate with findings that link an AluSx and a LINE L1M5 element to the regulation of a human NK inhibitory receptor: KIR3DL1 (Stulberg et al., 2007). Of particular interest is the fact that this AluSx SINE element also contains a binding site for an ETS member, ELK1. Removal of this SINE element abolished KIR3DL1 distal promoter activity. The enrichment of transposable elements within immune genes has been noted before as a possible mechanism of rapid evolution and functional diversification (van de Lagemaat et al., 2003). Our findings fit this model. While an Alu element may have contributed to the evolution of KIR3DL1 by supplying the gene with  56  regulatory elements, a B1 has managed to both provide regulatory signals and aid in the formation of a second, functionally distinct isoform of NKG2D in mouse and rat. Recent ChIP-sequencing studies have shown that some classes of repetitive elements bind specific transcription factors and establish transcription regulatory networks on a genomewide basis. Binding for the transcription factor p53 was shown to be enriched in LTR10 and MER61 elements of the endogenous retrovirus ERV1 family (Bourque et al., 2008; Wang et al., 2007). Bourque et al. further showed that ESR1 (estrogen receptor 1), POU5F1-SOX2 (POU class 5 homeobox 1-SRY box 2), and CTCF (CCCTC-binding factor) binding sites are pervasive in MIR, ERVK, and B2 repeats, respectively (Bourque et al., 2008). Finally, Roman et al. described a new subclass of B1 element that harbors functional AhR (aryl hydrocarbon receptor) and Slug binding sites (Roman et al., 2008). Thus some classes of transposable elements are postulated to disperse specific control elements and drive regulatory expansion. I therefore questioned if B1 elements in the mouse genome may also be involved in the regulatory network of GABP. Since only human GABP ChIP-sequencing data is available (Valouev et al., 2008) and B1 is a rodent specific SINE element, we decided to take an in silico approach. Neither the mB1 nor the rB1 GABP binding sites are present in the consensus sequences of 15 B1 subfamily members found in RepBase. A bioinformatics scan of all GABP binding motifs to see how many lie in B1 elements is impractical since the core binding sequence is short. We opted instead to compare the prevalence of GABP-site-containing B1 elements throughout the genome and those near promoters. A survey of all B1 elements (252,832) in the mouse genome revealed that only 4,877 (1.93%) of all B1 elements contain at least one GABP binding site. For the elements that lie in a 10kb window centered around transcription start sites (70,804) of all mouse RefSeq genes, we found only 1,240 (1.75%) to have at least one GABP binding site. We also subjected 57  these RefSeq genes to Gene Ontology (GO) analysis. A comparison of the genes with B1 elements in the 10kb window and genes with GABP motif associated B1 elements in the 10kb window show no over representation of any gene classes. These data suggest that there is no selective retention of B1 elements with GABP sites near promoters and argue against this transposon family acting as the foundation of GABP regulatory networks. However, we cannot rule out the possibility that these B1elements, although a minority, fortuitously bind GABP in vivo. A ChIP-sequencing experiment in mouse would be needed to address this likelihood directly. B1 elements evolved from the 7SL RNA gene, a small non-coding RNA species. As such, they are thought to be transcribed through an internal polymerase III promoter (Kriegs et al., 2007). The B1 element identified that regulates mouse and rat Nkg2d represents a novel source of polymerase II promoter signals. B2 elements, a close relative of B1 that evolved from tRNA, have been found to provide a polymerase II promoter to the mouse gene Lama3 (Ferrigno et al., 2001). To our knowledge, this is the first instance that B1 elements are shown to also contain polymerase II promoters. Presently, we cannot explain why promoter activity decreases when the mB1 element is combined with 391bp of upstream region. At least two non-mutually exclusive explanations are possible. Firstly, the 391bp fragment may contain an uncharacterized repressor. A search using TESS locates multiple transcription factor binding sites. It remains to be seen if any of these are functional and bind negative regulators. The promoter activity of a construct containing mB1 decreases only slightly if the 391bp fragment was inserted downstream of the reporter gene. This suggests that any repressor present on the fragment would be position dependent. The other possibility is that of chromatin effects. The reporter assays were conducted using a transiently 58  transfected plasmid. This experimental system does not take into account the 3-dimensional conformations or the degree of histone packaging of the DNA fragment in the context of the Nkg2d gene. It is possible that the suppressive effect of the 391bp segment is not seen in the endogenous context. The mechanisms that underlie the increased promoter activity with 3’ truncated mB1 are also unclear. Again, it is possible that the truncations removed repressor binding sites. At least four sites found via TESS in the truncated regions bind transcription factors known to be both activating and repressing. Two sites can bind TCF1, a factor that is activating when bound to βcatenin but repressive when interacting with Groucho (Roose and Clevers, 1999). YY1 is a repressor when not interacting with E1A while E12/E47 has been shown to act as a repressor to E-Cadherin (Gordon et al., 2006; Perez-Moreno et al., 2001). Whether any of these sites are functional remains to be shown. An additional possibility is the presence of an ATG sequence that is removed in all 3’ truncation constructs. Others have noted the possibility that ATG start codons can compete with reporter gene start codon and decrease reporter signal (Davies et al., 2007). The ETS member GABP was first implicated to regulate a range of housekeeping genes such as ribosomal protein genes and a cytochrome c oxidase gene (Genuario et al., 1993; Genuario and Perry, 1996; Sucharov et al., 1995). GABP has also been linked to critical S-phase genes and cell-cycle progression (Yang et al., 2007). Recently, a string of reports have shown that GABP plays an important role in immune functions. In the myeloid lineage, GABP is known to regulate the genes for integrin CD18 as well as IgA Fc receptor (Rosmarin et al., 1995; Shimokawa and Ra, 2005). The effect of GABP in lymphocyte biology is even more prominent. GABP was recently shown to regulate Fc receptor γ using monocyte, basophile, and T cell lines 59  (Takahashi et al., 2008). In T cells, GABP bridges JNK/SAPK (JUN N-terminal kinase/stress activated protein kinase) signaling and enhanced IL-2 expression when artificially stimulated (Hoffmeyer et al., 1998). GABP is also known to enhance transcription of Fas, IL-16, gamma chain receptor and IL-7 receptor α (Bannert et al., 1999; Li et al., 1999; Markiewicz et al., 1996; Xue et al., 2004). Lastly, GABP deficiency leads to defective B cell development, presumably because GABP binds to regulatory regions of Pax5 (paired box 5) and CD79a (Xue et al., 2007). In this report, we link GABP directly to NK cells by showing its positive regulatory effects on mouse and rat Nkg2d. ETS family members share highly similar binding sites. In a genome wide study, Hollenhorst et al. reported widespread co-occupancy of GABP, ETS1 and ELF1 at promoters of human genes (Hollenhorst et al., 2007). We cannot rule out the possibility that the binding site we discovered bind these factors as well. GABP may compete with ETS1 or ELF1 for binding while all three may act synergistically to enhance Nkg2d-L transcription. This would reflect the CD18 example, where GABP and PU.1 compete for binding sites but cooperatively activate the gene (Rosmarin et al., 1995). Alternatively, these ETS members may not be competing but rather forming a complex in mB1. While EMSA experiments showed robust binding of GABP to the B1 elements, knocking down Gabpα showed only a moderate decrease in Nkg2d-L transcript levels. This could be due to an incomplete knockdown of the transcription factor. We only achieved approximately 70% silencing. The remaining GABP may be enough to sustain the observed Nkg2d-L expression. Another possibility is that GABP augments but is not absolutely required for Nkg2d-L expression. Other transcription factors that bind the B1 promoter may need to be silenced to see a more dramatic decrease to Nkg2d-L mRNA levels. Finally, similar ETS family binding motifs 60  may allow other ETS member members to bind the B1 element and compensate for the loss of GABP. In mouse, NKG2D is known to be expressed only on NK cells, activated CD8+ T cells, and some NKT and γδT cells (Raulet, 2003). The fact that the mB1 promoter is capable of inducing reporter gene expression in NK, T, and embryonic fibroblast cell lines leaves the question of NKG2D tissue specific expression open. This is perhaps not surprising since GABP is a factor expressed in a broad range of tissue (Brown and McKnight, 1992). We can think of at least two ways that specificity of Nkg2d-L expression can be achieved. There could be additional enhancer sites that bind tissue specific transcription factors we have not uncovered. Another possibility is epigenetic regulation through DNA methylation and histone modifications. Although the upstream regions of Nkg2d exons 1a and 1b are CpG poor, the expression of Ly49a, another NK receptor gene, was shown to correlate with methylation at a CpG poor promoter (Rouhi et al., 2006). The expression of other NK receptor genes within the NK complex, Ly49g and Nkg2a, have also been linked to CpG methylation or histone acetylation (Rogers et al., 2006; Rouhi et al., 2007). In addition, Santourlidis et al. suggests in a recent report that euchromatic histone marks open up the KIR loci early in development but use DNA methylation to silence specific KIR members and establish clonal expression later on (Santourlidis et al., 2008). As more studies emerge, the differences between human and mouse NK cells are starting to be appreciated. While mouse NKG2D-L is the isoform that more closely mimics human NKG2D, there are notable discrepancies. NKG2D is expressed on human CD8+ T cells regardless of activation status in human, but only on activated mouse CD8+ T cells. The receptor is also found on γδT cells of intestinal intraepithelial origin in human but not mouse (Raulet, 61  2003). Since human NKG2D does not harbor a SINE element at the same position as the mouse, the mode of regulation is unknown and likely different from mouse. Further, nothing is known about the regulation of the mouse short isoform, which responds to IL-2 and polyinosinic:polycytidylic acid treatment (Diefenbach et al., 2002). Dissecting the genomic and epigenetic factors that control these processes have therapeutic potential since it may allow the manipulation of an important NK activating receptor involved in cancer immunosurveillance, viral clearance, and autoimmune diseases.  62  CHAPTER 3  THE ROLE OF RUNX3 IN TRANSCRIPTION REGULATION OF NCR1/NKP46, AN ACTIVATING NK CELL RECEPTOR  63  3.1  Introduction NCR1/NKp46 is unique among NK surface receptors. Unlike some of the other receptors,  NCR1 is highly conserved in mammals (Jozaki et al., 2010; Kelley et al., 2005; Storset et al., 2004) and exhibits relatively high expression specificity (see section 1.4.3). In the bone marrow, blood and spleen, NKp46 is currently the best NK marker available (Walzer et al., 2007). The expression pattern of NCR1 suggests specific transcriptional control. Thus studying its regulation provides an opportunity to identify important transcription factors of the natural killer lineage. Furthermore, the NCR1 promoter is on the verge of becoming a widely used and efficacious tool to study the biology of conventional NK cells. Already, one study has used it to ablate NK cells in vivo while another used it to create NK-specific Stat5 deficient mouse (Eckelhart et al., 2011; Walzer et al., 2007). Yet the mechanism behind its precise control has so far gone largely unaddressed. Here I focus on the proximal upstream region of the human NCR1 gene. I identify two cis-regulatory elements in this region and describe a role for RUNX proteins in regulating NCR1 expression.  3.2  Materials and Methods  3.2.1 PBMC flow cytometry Peripheral blood was obtained from healthy donors and PBMC isolated by density centrifugation on Ficoll PLUS (StemCell Technologies). PBMC was then washed with PBS containing 5% human serum (Sigma H4522) and Fc receptors blocked using human FcR blocking reagent (Miltenyi). Next the cells were stained using monoclonal antibodies: CD335/NKp46-APC (Miltenyi 130-092-609), CD3-FITC (BD 555332), CD56-PE (StemCell Technologies 10526), CD14-FITC (StemCell Technologies 10406), CD15-FITC (BD #555401), 64  CD19-PE (Beckman Coulter IM1285U), and CD33-PE (BD 347787). Isotype control antibodies were: IgG1-APC (BD 555751), IgG1-FITC (StemCell Technologies 10310), IgG1-PE (StemCell Technologies 10311), IgG2b-FITC (BD 555742), IgG2b-PE (BD 555743), and IgM-FITC (BD 555583). Lastly propidium iodide was added to 5 µg/mL. Four color analysis was carried out using FACSCalibur.  3.2.2  Cell culture NK92 (human NK cell line, (Gong et al., 1994)) was cultured in Minimum Essential  Medium Eagle with Earle’s salts and non-essential amino acids, supplemented with 12.5% (v/v) fetal bovine serum, 12.5% (v/v) horse serum, 2 mM L-glutamine, 100 μM 2-mercaptoethanol, 100 U/mL IL-2 (Peprotech). KY-2 and LNK (both mouse NK cell lines) were cultured in RPMI 1640 medium supplemented with 10% (v/v) fetal bovine serum, 2 mM L-glutamine, and 50 μM 2-mercaptoethanol. LNK and KY-2 used 1000 U/mL and 200 U/mL of IL-2, respectively. U2OS (human osteosarcoma), K562 (human erythroleukemia), LoVo (human colorectal adenocarcinoma), HEK-293 (human embryonic kidney), and NIH-3T3 (mouse embryonic fibroblast) were cultured in Dulbecco's Modified Eagle's Medium supplemented with 10% (v/v) fetal bovine serum (fetal calf serum for NIH-3T3). IM-9 (human B-lymphoblastoid), Jurkat (human T-lymphocyte), THP-1 (human acute monocytic leukemia), and HL-60 (human acute promyelocytic leukemia) cell lines were cultured in RPMI 1640 medium supplemented with 10% (v/v) fetal bovine serum. Mouse NK cells were isolated from spleen of Runx3 deficient (Levanon et al., 2002) and wild type mice by negative selection (R&D MagCollect Mouse NK Cell Isolation Kit, MAGM210) and cultured for seven days in RPMI 1640 medium containing 10% (v/v) fetal calf serum, 2 mM L-glutamine, 1% sodium pyruvate, 1% non-essential amino acids, 65  50 μM 2-mercaptoethanol and 1000 U/mL IL-2 (Beit-Haemek Israel, 30-T209B). All cultures were supplemented with 100 U/mL penicillin, 100 U/mL streptomycin.  3.2.3  RT-PCR and real-time PCR Total RNA from cells were collected using RNeasy Mini kit and QIAshredder  homogenizer (QIAGEN). RNA samples were treated with Turbo DNase (Ambion) before cDNA conversion using Superscript III and random primers (Invitrogen). Primers used for PCR are listed in Table 3.1. Real-time PCR was done using the 7500 Fast Real-Time PCR System (Applied biosystems). Relative expression was determined using the 2-∆∆CT method. Threshold cycles were normalized to ACTB.  3.2.4 Generation of luciferase reporter constructs Promoter fragments were generated by PCR using forward primers with KpnI site inserted at the 5’ end and reverse primers with NheI site inserted at the 5’ end. PCR products were digested with KpnI/NheI (NEB) and cloned into pGL4.10 (pGL4B) firefly luciferase promoter vector (Promega). RUNX mutations were introduced into the 5’270 construct using QuickChange Lightning Site-Directed Mutagenesis kit (Stratagene). For all primer sequences, see Table 3.1.  Primer set name Forward Primer EMSA(enhancer)-WT 5’gttgctggctagaccacagatgtgtcagag EMSA(enhancer)-MU 5’gttgctggctagacgttagatgtgtcagag EMSA(essential)-WT 5’tggtgctcacccaccacttcctgtgtatct EMSA(essential)-MU 5’tggtgctcacccacgttttcctgtgtatct Table 3.1 Primers used for experiments in chapter 3  66  Reverse Primer 5’ctctgacacatctgtggtctagccagcaac 5’ctctgacacatctaacgtctagccagcaac 5’agatacacaggaagtggtgggtgagcacca 5’agatacacaggaaaacgtgggtgagcacca  Primer set name Forward Primer Reverse Primer hNCR1-RT-PCR 5’caccctctcggttcatcc 5’gagattctgggcagtgtg hACTB-RT-PCR 5’aaggagatcactgccctggc 5’ccacatctgctggaaggtgg 5’95-pGL4B 5’aaggtacccgctggtgctcacccacc 5’aagctagctcgctcagattctgccgg 5’200-pGL4B 5’aaggtaccgtgtcagagggaccacgg Same as above 5’270-pGL4B 5’aaggtaccgagaagttgacccagaaatgc Same as above 5’395-pGL4B 5’aaggtacccctgttccagtatctcactg Same as above 3’276-pGL4B Same as above 5’aagctagcgactgctttcatcagaacg 3’196-pGL4B Same as above 5’aagctagcatctgtggtctagccagc 3’105-pGL4B Same as above 5’aagctagctacccagagctgactgtg hPU.1-RT-PCR 5’ccaaacgcacgagtattacc 5’aagctctcgaactcgctgtg hCJUN-RT-PCR 5’aaggaagctggagagaatcg 5’tgtttaagctgtgccacctg hJUNB-RT-PCR 5’cgatctgcacaagatgaacc 5’tgctgaggttggtgtaaacg hJUND-RT-PCR 5’gcctcatcatccagtccaac 5’tctgcttgtgtaaatcctccag hCEBPa-RT-PCR 5’tggacaagaacagcaacgag 5’ttgtcactggtcagctccag hMYB-RT-PCR 5’cagcccactgttaacaacgac 5’ctggctgagggacattgac hMEIS1-RT-PCR 5’ggaggatcaaaatcagacagtg 5’tcctcctgaacgagtagatgc hCP2-RT-PCR 5’ggtgaagagtatattccgtgtgg 5’attctgtctccaggtcggttc hE2A-RT-PCR 5’gaagcagcagcacgtttg 5’gagaaggaggatgcagatgg hRUNX1-qPCR 5’tcaggtttgtcggtcgaag 5’gcccatccactgtgattttg hRUNX3-qPCR 5’gttcaacgaccttcgcttc 5’gtccacggtcaccttgatg hRUNX3dist-RT-PCR 5’acctactcgccgaccttcat Same as above hRUNX3prox-RT-PCR 5’tattcccgtagacccaagca Same as above mNcr1-RT-PCR 5’tggctcttacaacgactatgc 5’agaagaagtagggtcggtaggtg mRunx1-RT-PCR 5’tagcgagattcaacgacctc 5’atggtaggtggcaacttgtg mRunx3-RT-PCR 5’ggttcaacgaccttcgattc 5’cggtggtaggtagccacttg mActb-RT-PCR 5’aaggccaaccgtgaaaagat 5’gtggtacgaccagaggcatac distRUNXmut 5’gagttgctggctagacgttagatgtgtcagaggg 5’ccctctgacacatctaacgtctagccagcaactc proxRUNXmut 5’gctggtgctcacccacgttttcctgtgtatctatc 5’gatagatacacaggaaaacgtgggtgagcaccagc hNCR1promoter-ChIP 5’ctgatgaaagcagtcaacgtg 5’gggccagggagatagatacac h+8intergenic-ChIP 5’tatcttgacaagggctcacg 5’gcttcagcactgaatgatcc hCD122promoter-ChIP 5’caagcaggtccctctaggtg 5’taaacggagtaaggggcttc mNCR1promoter-ChIP 5’aaatgggttgcagactgagc 5’accattgacctaggacttcagg mIfng-qPCR 5’cacggcacagtcattgaag 5’ccagttcctccagatatccaag mPrf1-qPCR 5’gtgtcgcatgtacagttttcg 5’tgtggtaagcatgctctgtg m18S-qPCR 5’gtaacccgttgaaccccatt 5’ccatccaatcggtagtagcg mB2m-qPCR 5’catggctcgctcggtgacc 5’aatgtgaggcgggtggaactg mCD43-qPCR 5’agtttctttgacccccttgg 5’ttctggaagcagtgctgatg Table 3.1 Primers used for experiments in chapter 3 continued  67  3.2.5 Transient transfection and luciferase assays NK92 and U2OS cells were transiently transfected with Lipofectamine LTX with PLUS reagent (Invitrogen) according to manufacturer’s instructions. Briefly, 1.0 × 105 NK92 cells and 5.0 × 105 U2OS cells were seeded into 500 μL of growth media without penicillin/streptomycin in 24-well plates for 24 hours at 37ºC. For each well, 100 μL LTX transfection media was prepared: 2 μL of LTX reagent, 1 μg of vector, 0.1 μg of pRL-TK, 1 μL PLUS and topped up with media without serum. The mix was incubated for 30 minutes prior to addition to wells. Cells were incubated at 37ºC for 24 hours before assaying. Luciferase activity was assayed using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s instructions. Firefly luciferase activity was normalized relative to Renilla luciferase activity for each transfection and calculated as fold increase over pGL4.10-BASIC (pGL4B).  3.2.6  Western blot Nuclear extraction was performed as described before (Maksakova and Mager, 2005).  Protein concentration was determined using the Nanodrop ND-1000 (Thermo Scientific). NuPAGE Novex 4-12% Bis-Tris gels (Invitrogen) were used to resolve the protein sample in MOPS SDS running buffer (Invitrogen). Proteins were transferred onto Immobilon-P PVDF membrane (Millipore) in transfer buffer (25 mM Tris, 192 mM glycine, 10% methanol, 0.1% SDS). The membrane was blocked for 1 hour with blocking solution - 5% (w/v) skim milk reconstituted with TBST buffer (20 mM Tris, 150 mM NaCl, 0.1% Tween-20). Primary antibody was then added at 1:3000 anti-RUNX3 (Abcam ab11905) and 1:3000 anti-ACTB (Sigma A2066) overnight at 4ºC with constant agitation. The membrane was washed five times with TBST 68  buffer at room temperature with five minute intervals. Goat anti-rabbit (Sigma A0545) at 1:10,000 was diluted in TBST buffer with 0.5% (w/v) of skim milk. The membrane was incubated in this secondary antibody solution for one hour at room temperature under constant agitation. Washes were carried out as above. Protein was detected using SuperSignal (Thermo Scientific) and Kodak BioMax MR Film.  3.2.7  EMSA Wild type and mutated double stranded probes containing the putative RUNX binding  sites were generated by annealing oligomers (oligos listed in Table 3.1). Nuclear extraction, probe labeling and the gel shift assay were preformed as described before (Maksakova and Mager, 2005). Seven μg of protein was used per binding reaction (protein concentration was determined using the Nanodrop ND-1000 (Thermo Scientific). For supershift experiments, 2.5 μL of anti-RUNX3 (Abcam ab11905) and 2.5 μg of anti-RUNX1 (Abcam ab23980) were used.  3.2.8  Chromatin immunoprecipitation ChIP assay was performed as described previously (Wederell et al., 2008) with the  following modifications. Formaldehyde crosslinking was done for 15 minutes at room temperature for cell lines and 10 minutes for mouse NK cells. Sonication was done using 30s on, 30s off cycles (25 cycles for NK92, 30 cycles for U2OS and IM-9, 20 cycles for mouse NK cells). Preclearing and pulldown utilized Protein A/G beads (Thermo Scientific). Immunoprecipitation was accomplished with 5 μL or 5 μg anti-RUNX3 (Abcam ab11905), antiRUNX1 (Abcam ab23980), anti-histone 3 lysine 4 trimethylation (Millipore CS200580), antihistone 3 lysine 27 trimethylation (Abcam ab6002) and normal rabbit IgG (Millipore). 69  3.2.9  Retrovirus transduction and fluorescence assisted cell sorting Control MIGR1, dn-RUNX on MIGR1 backbone (HA-NLS-Runt), and human RUNX3  (hRUNX3) cDNA on MIY backbone (MIY-hRUNX3) have been described previously (Fu et al., 2011; Hayashi et al., 2000). These vectors were transiently transfected into Plat-E (Morita et al., 2000) using Turbofect in vitro reagent (Fermentas) according to manufacturer instructions. Forty-eight hours later, viral supernatant was collected and used immediately or stored in -80°C. KY-2 cells’ growth medium was switched with viral supernatant plus 4 μg/mL polybrene (Sigma) and 200 U/mL IL-2 (Peprotech). For the MIY-hRUNX3 experiments, the viral supernatant was switched back to growth medium after twenty-four hours. For the dn-RUNX experiments, KY-2 cells were subjected to a second round of infection as above after twenty-four hours. Another twenty-four hours passed for the second round before the KY-2 culture was switched back to growth medium. Two days or four days after the switch, fluorescence assisted cell sorting was used to isolate GFP+ or YFP+ cells. Cells were allowed to recover from sorting stress for 24 hours in growth media before RNA collection.  3.3  Results  3.3.1 NKp46/NCR1 expression specificity stems from the transcript level NKp46/NCR1 is widely accepted as a bona fide NK marker at least in blood. There is good evidence for NKp46 specificity at the cell surface in both human and mouse (Sivori et al., 1997; Walzer et al., 2007). Indeed, in healthy human peripheral blood mononuclear cells (PBMC), almost all NKp46+ cells also express CD56 but not T, B or myeloid lineage markers CD3, CD19, CD14, CD15 and CD33 (Figure 3.1A). However, few have checked if the 70  Figure 3.1 NCR1 transcript is NK specific. (A) Phenotypic analysis of healthy human PBMC. Freshly isolated PBMC were stained for NKp46 and other indicated lineage markers. Dot plots show representative data from three independent experiments. (B) RT-PCR detection of NCR1 in human cell lines with ACTB as internal control. Total RNA from indicated cell lines was used for reverse transcriptase reactions. (C) Microarray of NCR1 expression. Data accessed through BioGPS (Wu et al., 2009). Human data from GeneAtlas U133A probe set 207860_at (Su et al., 2004). Mouse data from GeneAtlas MOE430 probe set 1422089_at (Lattin et al., 2008). Only relevant hematopoietic cell types are shown.  71  expression pattern is reflected at the transcriptional level in human. I addressed this issue by performing semi-quantitative RT-PCR on a panel of human cell lines and surveying publicly available microarray data. In accordance with a previous study (Pessino et al., 1998), out of a panel of human cell lines (NK, T, B, monocyte, promyeloblast, erythroid, osteosarcoma, and embryonic kidney), only the NK cell line shows NCR1 expression (Figure 3.1B). In primary tissue, as shown by published microarray data, NCR1 transcripts are also confined to the NK lineage (Figure 3.1C). These results suggest that the NK-specific expression of NKp46 is transcriptionally controlled and that the cell line, NK92, is a good NK model to further study the mechanism of its regulation.  3.3.2  The human NCR1 promoter contains essential and enhancing regions Walzer et al. was able to drive NK specific expression using just 400bp of non-coding  sequence upstream of the human NCR1 gene (Walzer et al., 2007), suggesting that all the important cis-regulatory elements are immediately upstream of the gene itself. In agreement with this, the level of genomic conservation upstream of the start codon of human NCR1 is limited to approximately 300bp (Figure 3.2). To further pinpoint the crucial cis-regulatory elements, I cloned -396 to +1 relative to the ATG into pGL4B (designated FL – see Figure 3.3). I also made truncation mutants designated with the suffix 5’- or 3’- (depending on the direction of truncation), followed by the size of the remaining promoter. These constructs were transiently transfected into NK92 cells and luciferase assays conducted. The 5’-95 construct, corresponding to the region immediately upstream of the ATG, shows appreciable promoter activity (approximately four-fold above background). This fragment acts as an essential promoter because its removal, as seen in the 3’ truncations, completely abrogates activity. In addition, I 72  73  Figure 3.2 RUNX binding sites are conserved at the NCR1 promoter. NCR1 proximal upstream regions in 10 mammals were aligned using EBI Clustal2W. Bases identical in at least 8 species are highlighted in yellow. TESS sites that are found in multiple species are boxed. Note only RUNX and ETS sites are highly conserved. The distal RUNX site in mouse and rat are found in the antisense direction and offset by a few base pairs, suggesting convergent evolution. The tissue specific and essential regulatory sequences are marked by solid and dashed lines under the sequence, respectively.  Figure 3.3 Luciferase reporter assay of NCR1 promoter in NK92. A diagram of the promoter and first three exons of NCR1 is shown at the top. 5’UTR and coding regions are shown as thin and thick gray boxes, respectively. The black arrow depicts the TSS. Promoter fragments truncated from the 5’ and 3’ ends were cloned into pGL4B and transiently transfected into NK92. Firefly luciferase activity was assayed normalized to co-transfected Renilla luciferase activity. Promoter strength is calculated as fold above pGL4B empty vector. Data shown represents means with standard deviations of more than three experiments. Tests of significance were carried out using ANOVA followed by Tuckey’s post-test (*** P<0.001). 74  observe a significant gain of promoter strength between 5’-200 and 5’-270 constructs (from six to thirteen fold above background). Thus there appears to exist an enhancer between -270 and 200. The differences between 5’-95 and 5’-200, or between FL and 5’270 were not statistically significant. I conclude that our assay was not sensitive enough to detect any additional cisregulatory sequences between -95 to -200, and -270 to -396. These human constructs showed a similar trend in the mouse NK cell line, KY-2, suggesting that the promoter is not species specific (Figure 3.4).  Figure 3.4 Promoter constructs transfected into KY-2 mouse NK cell line. 2.5 × 105 KY-2 cells were transfected using Lipofectamine 2000 (Invitrogen) according to manufacturer instructions. Transfection mix consisted of 1 μg vector, 0.1 μg pRL-TK, and 2 μg Lipofectamine 2000. Cells were incubated for 24 hours before assaying using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s instructions. Firefly luciferase activity was normalized relative to Renilla luciferase activity for each transfection and calculated as fold increase over pGL4.10-BASIC (pGL4B).  75  3.3.3  NCR1 promoter contains RUNX sites and RUNX members are expressed in NK  cells To identify the transcription factors that regulate the NCR1 promoter, I scanned the promoter sequence for transcription factor binding motifs using TESS (http://www.cbil.upenn.edu/cgi-bin/tess/tess). Curated results containing only mammalian hematopoietic transcription factors are shown in Figure 3.5A. To narrow down the list, I focused on the essential and enhancing cis-regulatory regions and took two approaches. Firstly, I carried out a semi-quantitative RT-PCR screen to check the expression of the predicted transcription factors in NK versus other cell types. None of the predicted factors had an expression pattern as specific as NCR1 (Figure 3.5B). However, I noticed that runt-related transcription factor 3 (RUNX3/AML2) was confined mostly to the lymphoid lineage, and was relatively high in NK92 cells. RUNX3 is closely related to two other runt family members, RUNX1 and RUNX2. I focused on RUNX1 and RUNX3, quantitatively confirming their expression by real-time PCR. The results mirrored the semi-quantitative RT-PCR results for the most part (Figure 3.5C). Human cell lines express varying amounts of RUNX1 compared to NK92. RUNX3 was highest in NK92 and IM-9 while other cell lines expressed undetectable or more than fivefold less compared to NK92. Using semi-quantitative RT-PCR, I also checked Runx1 and Runx3 mRNA in mouse NK cell lines, LNK and KY-2, as well as non-NK cell lines, NIH-3T3 and Ms1. In the mouse NK cell lines, Ncr1 and Runx3 are detectable while in the non-NK cell lines, only Runx1 is detectable (Figure 3.6). These human and mouse results agree with primary tissue data from publicly available microarray studies (Figure 3.5D, Figure 3.6). Next, I aligned approximately 400bp upstream of NCR1 from ten mammalian species using EBI ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/) and checked if the binding 76  77  Figure 3.5 Identification of RUNX sites in the NCR1 promoter. (A) TESS search for transcription factor binding sites in the NCR1 promoter. Potential binding motifs are indicated in brackets. Only mammalian hematopoietic related factors are shown. Lower case and upper case denote intergenic and genic sequences, respectively. Sequences in bold indicate the enhancing and essential regions. (B) RT-PCR detection of transcription factors in human cell lines. Total RNA from indicated cell lines was used for reverse transcriptase reactions. Primers as indicated in Materials and Methods were used to detect various transcription factors and ACTB. (C) Realtime PCR detection of RUNX1 and RUNX3. Transcript levels of the two RUNX members were assayed and normalized to ACTB. mRNA levels in the NK92 cell line were set to one. Data shown represents means with standard deviations of three experiments. (D) Microarray of RUNX3 expression. Data accessed through BioGPS (Wu et al., 2009) from GeneAtlas U133A probe set 207860_at (Su et al., 2004). Only relevant hematopoietic cell types are shown.  78  Figure 3.6 Ncr1, Runx1 and Runx3 expression in mouse hematopoietic cells. (A) RT-PCR detection in mouse cell lines with Actb as internal control. Total RNA from indicated cell lines was used for reverse transcriptase reactions. (B) Microarray of Runx1 and Runx3 expression. Data accessed through BioGPS (Wu et al., 2009). Mouse data from GeneAtlas MOE430 probe set 1427650_a_at for Runx1 and 1440275_at for Runx3 (Lattin et al., 2008). Only relevant hematopoietic cell types are shown.  79  motifs identified by TESS were conserved (Figure 3.5A, Figure 3.2). This alignment revealed that only two RUNX sites and one ETS site were highly conserved. The enhancing region harbours one RUNX site that matches the RUNX consensus (ACCACA). The essential region contains an imperfect binding site (ACCACT) and an ETS site. Both the expression data and binding motif conservation at NCR1 promoter point toward RUNX proteins as possible regulators of NKp46.  3.3.4 Human and mouse NK cells use the distal promoter of RUNX3 The presence of RUNX3 transcripts does not guarantee functional RUNX3 protein. In both human and mouse, expression of RUNX3 is regulated by two promoters (Bangsow et al., 2001; Rini and Calabi, 2001). While Runx3 mRNA can be detected in both mouse CD8+ and CD4+ T cells, only the CD8+ population expresses the distal transcript isoform and detectable levels of RUNX3 protein (Egawa et al., 2007; Sato et al., 2005). In mouse NK cells, the distal form of Runx3 transcript is expressed starting at the CD122+ NK1.1-, NKP stage. RUNX protein has also been found in mouse NK lysates using a pan-RUNX antibody (Ohno et al., 2008). The transcription factor screen in Figure 3.5B and 3.5C utilized primers that did not differentiate between proximal and distal RUNX3. To resolve this issue, we performed RT-PCR using promoter specific primers. In NK92 cells, the distal transcript was preferentially expressed and the proximal transcript barely detectable (Figure 3.7B). By western blotting, RUNX3 protein can be seen in NK92 nuclear extracts (Figure 3.7C). Therefore, human NK cells express the distal form of RUNX3 at the mRNA and protein levels.  80  Figure 3.7 NK cells utilize the distal RUNX3 promoter. (A) Diagram of RUNX3 gene structure at 5’ end. Thin and thick gray boxes represent 5’UTR and coding regions, respectively. Arrows indicate primers used to detect RUNX3 mRNA isoforms: distal forward, proximal forward, and common reverse primers. (B) RT-PCR detection of RUNX3 isoforms in human NK cell lines. Total RNA from NK92 was used for reverse transcriptase reactions. (C) Western blot analysis of RUNX3 protein in NK92. Immunoblotting was performed on nuclear extracts. Arrows in the upper panel correspond to the positions of RUNX3 protein (using anti-human RUNX3 antibody) and the lower panel shows the position of ACTB protein (loading control).  3.3.5  RUNX binding motif mutations decrease NCR1 promoter strength  The essential and enhancing regions contain a well-conserved RUNX binding site each. I hypothesized that the recognition motifs were important to NCR1 promoter activity. Mutations were introduced to these motifs in our pGL4B construct containing the promoter from +1 to 270. Luciferase assays were then performed in NK92 cells. Destroying the RUNX binding site in the enhancing region results in a drop of promoter strength from thirteen fold to four fold above background (Figure 3.8). When the same mutation was introduced into the motif in the essential region, promoter strength decreased to three fold above background. However, I cannot rule out a contribution from the ETS binding site since the mutation overlaps both the RUNX and ETS  81  sites. The results indicate that these motifs are required for optimal expression from the NCR1 promoter.  Figure 3.8 RUNX motif mutations decrease NCR1 promoter strength. Mutations shown at top left were introduced into a promoter fragment from +1 to -270 in pGL4B backbone. The vector was transiently transfected into NK92 and luciferase activity measured using a dualluciferase system. Firefly luciferase activity was normalized to co-transfected Renilla luciferase and calculated as fold above pGL4B empty vector. Data shown represents means with standard deviations of three experiments.  82  3.3.6  RUNX3 and RUNX1 bind the promoter in vitro All members of the runt family bind the conserved motif, 5’ACCRCA3’. I wondered if  either RUNX1 or RUNX3 can indeed bind the predicted motifs in the NCR1 promoter. To test this possibility, electrophoretic mobility shift assays (EMSA) were performed. I tested the two RUNX sites separately. Probes spanning the putative RUNX binding site in the enhancer were shifted by NK92 nuclear extract (Figure 3.9). Two bands are clearly visible, labeled I and II. The bands were completely abolished with the introduction of unlabeled wild type competing oligomers at 200-fold excess. If unlabeled competing oligomers with a mutated RUNX site were used instead, both bands I and II were still visible, though weaker. The decrease in signal strength is likely the result of nonspecific binding of mutant probes at molar excess. I confirmed that the identities of the binding proteins were RUNX3 and RUNX1 by supershift experiments. When anti-RUNX3 or anti-RUNX1 was incubated with NK92 nuclear proteins beforehand, a supershifted band III was observed. Band II, whose signal strength decreased, most likely contains the RUNX3/RUNX1-DNA complexes. The identity of band I is currently unknown. Probes spanning the predicted RUNX binding site in the essential region were also shifted by NK92 nuclear extract (Figure 3.9). Again, multiple bands are visible, labeled IV and V. The bands completely disappear with competition from wild type but not mutant unlabeled oligomers at 200-fold excess. Neither anti-RUNX3 nor anti-RUNX1 antibodies supershifted these bands. Thus the nuclear proteins binding the essential region and forming bands IV and V are neither RUNX1 nor RUNX3. Side by side comparison of shift patterns between the essential and enhancer regions show that the band positions are not the same, further hinting that RUNX proteins are not binding the essential region. The most likely candidates remaining are ETS family members, based on our motif prediction and reporter assay results. 83  Taken together, these results suggest that RUNX1 and RUNX3 both bind the enhancer region in the NCR1 promoter.  Figure 3.9 RUNX forms protein-DNA complexes with NCR1 promoter elements in vitro. EMSA was performed using probes containing RUNX motifs in the enhancer (lane 2-6) and essential (lane 7-11) region. A side-by-side comparison of band shift patterns between the two regions is shown in lanes 12 and 13. As control, lane 1 contains only γ32P labeled WT enhancer and essential probe. NK92 nuclear extract was incubated with labeled WT probe at 4°C for 20 min (lane 2 and 7). For competition assays, unlabeled competitors were incubated with NK92 nuclear extract at 4°C for 20 min before addition of labeled WT probe. Competitors were used at 200-fold excess (lanes 3, 4, 8 and 9). Supershift assays were carried out using anti-RUNX3 (lane 5 and 10) or anti-RUNX1 (lane 6 and 11) antibodies.  84  3.3.7  RUNX binds the promoter of NCR1 All three members of the runt family bind the conserved motif, 5’ACCRCA3’. I  examined if RUNX1 and RUNX3 were enriched at the human NCR1 promoter specifically in NK cells by using chromatin immunoprecipitation (ChIP). As a negative control, I chose an intergenic region 8kb downstream of NCR1. This region is not known to contain any regulatory sequences. As a positive control, the promoter of CD122 was analyzed. We chose CD122 because in mouse NK cells, the Cd122 promoter was previously shown to bind RUNX protein using a pan-RUNX antibody (Ohno et al., 2008). I performed the ChIP assay using anti-human RUNX3 and anti-human RUNX1 specific antibodies. In NK92 cells, the negative control region did not show significant enrichment of either transcription factors (Figure 3.10A). The CD122 promoter shows significant enrichment of RUNX1 (seven fold) and RUNX3 (eleven fold) over isotype background. At the NCR1 promoter, we also detect significant enrichment of RUNX1 (fivefold) and RUNX3 (sixteen fold). To determine if RUNX binding to the NCR1 promoter is NK specific, ChIP was performed in other cell lines, namely IM-9 and U2OS. Compared to NK92, IM-9 expresses equivalent levels of RUNX3 transcripts, but tenfold less RUNX1. On the other hand, U2OS expresses equivalent levels of RUNX1 transcripts, but twenty-five fold less RUNX3 (Figure 3.5C). Neither of these cells showed enrichment for RUNX1 or RUNX3 at the NCR1 promoter (Figure 3.10A). Thus, RUNX transcription factors bind the NCR1 promoter in a NK-specific manner. In a Runx3 deficient mouse, flow cytometric analysis revealed that NKp46 is expressed at a comparable level to wild type (D. Levanon, personal communication). I wondered if RUNX1 can compensate for RUNX3 in regulating Ncr1 expression. To test this possibility, I performed 85  Figure 3.10 RUNX binds the NCR1 promoter. ChIP was performed in (A) NK92, IM-9, U2OS, and (B) mouse wild type and Runx3 deficient NK cells using anti-human RUNX3, antihuman/mouse RUNX1, and IgG isotype control. Precipitated DNA was assayed by real-time PCR using primers specific for the human NCR1 promoter, an intergenic region 8kb downstream of human NCR1, the human CD122 promoter, and the mouse Ncr1 promoter. Enrichment is calculated as fold over IgG control. Data shown represents means with standard deviations of three experiments. 86  ChIP on NK cells isolated from Runx3 knockout and wild type mice. In wild type NK cells, I could not detect RUNX1 enrichment at the Ncr1 promoter compared to isotype levels. However in Runx3 deficient NK cells, RUNX1 is enriched at the same location by about threefold (Figure 3.10B). These results indicate that in mouse NK cells, RUNX1 does not bind Ncr1 promoter normally but takes the place of RUNX3 when the latter is absent.  3.3.8  Dominant negative RUNX interferes with NCR1 transcription To test the effects of all RUNX proteins on NCR1 expression, I used mouse dominant  negative RUNX (dn-RUNX, (Ohno et al., 2008)). Dn-RUNX consists of the DNA binding Runt domain of RUNX transcription factors, without the transactivation domain. Since all RUNX members bind the same motif, dn-RUNX acts as a pan-RUNX competitive inhibitor. I introduced dn-RUNX by retroviral transduction into KY-2 and isolated infected cells at day 4 and day 6 post transduction by fluorescence activated cell sorting (FACS) using the GFP marker on the vector. Subsequently, transcript levels of various genes were assayed by real-time PCR. 18S RNA, which acts as negative control, did not change significantly throughout the time points (Figure 3.11). As positive controls, I examined Ifng, Prf1, and Cd43 (sialophorin). Interferon gamma and perforin have been shown to be regulated by Runx3 in mouse CD4+ and CD8+ T cells (Cruz-Guilloty et al., 2009; Djuretic et al., 2007; Wang et al., 2008; Yagi et al., 2010). Additionally, Ohno et al. showed that interferon gamma and CD43 are perturbed in dnRUNX expressing NK cells (Ohno et al., 2008). Compared to empty vector transduced KY-2 cells, dn-RUNX transduced cells show decreased expression of all positive control genes to approximately 50% for Ifng, Prf1 and 73% for Cd43 on day 4. On day 6, the downregulation of these genes was more pronounced, ranging from 17-55% expression compared to empty vector 87  control. Ncr1 was similarly decreased in expression at both time points (44% and 22% on day 4 and 6 compared to empty vector, respectively). These results suggest that the RUNX proteins are required for optimal transcription of Ncr1, differentiation markers, and effector genes in mouse NK cells.  Figure 3.11 dn-RUNX decreases Ncr1 expression. Gene expression was measured by real-time PCR. Actb is the endogenous control. Expression levels in dn-RUNX transductants were normalized to levels in empty vector control transductants. Data shown represents means with standard deviations of three experiments.  3.3.9  RUNX3 over-expression increases NCR1 expression To more directly examine the role of RUNX3 in regulation of NCR1, I decided to over-  express RUNX3 in NK cells. I transduced human RUNX3 (hRUNX3) cDNA into KY-2 cells and selected using the vector’s YFP by FACS. Human RUNX3 expression in mouse KY-2 was 88  verified by real-time PCR (Figure 3.12A). Over-expression of hRUNX3 did not lead to an increase in endogenous mouse Runx3, nor the negative controls, 18S RNA and beta-2 microglobulin (Figure 3.12B). Interestingly, Prf1 mRNA levels did not change. Additionally, while Ifng levels seemed to increase mildly, the change was not statistically significant. Both Cd43 and Ncr1 mRNA increased almost four fold compared to empty vector control. These results imply that RUNX3 specifically contributes to Cd43 and Ncr1 expression while other RUNX family members may be more important in regulating Prf1 and Ifng.  Figure 3.12 RUNX3 overexpression enhances Ncr1 expression. Gene expression was measured by real-time PCR with Actb as the endogenous control. (A) Expression of human RUNX3 levels in MIY-hRUNX3 transductants with respect to endogenous mouse Runx3 (set to 1). (B) Expression of various genes in these transductants normalized to levels in empty vector control transductants. The prefixes h and m denote human and mouse, respectively. Data shown represents means with standard deviations of three experiments.  89  3.3.10 The NCR1 promoter behaves differently in non-NK cells We wondered if the essential and enhancer elements of the NCR1 promoter were tissue specific. Thus, I performed luciferase assays using the 5’ truncation constructs in the U2OS cell line. In these cells, the constructs behaved differently compared to the NK92 cells (Figure 3.13A). The essential region by itself still confers high promoter activity but the region between 200 and -270 actually downregulates promoter strength. This trend is also observed in HeLa cells (data not shown), suggesting that the effects are not an artifact of the U2OS cell line. Thus, the essential region acts primarily as a pan-tissue promoter. On the other hand, the -200 to -270 region acts as an enhancer or suppressor, depending on the cellular context (henceforth termed the switch region). Furthermore, we investigated the chromatin context of the promoter in NK92 and IM-9 cells. To this end, I performed ChIP using antibodies toward histone modifications histone 3 lysine 4 trimethylation (H3K4me3) and histone 3 lysine 27 trimethylation (H3K27me3). H3K4me3 is a chromatin mark strongly linked to the promoters of actively transcribing genes while the H3K27me3 mark is considered repressive and linked to silent loci (Barski et al., 2007). H3K4me3 was found to be highly enriched at the NCR1 promoter only in NK92 cells (Figure 3.13B). Conversely, at the same location, IM-9 cells display preferential enrichment of H3K27me3. Thus, the chromatin configuration is favorable to expression in NK cells and closed in non-NK cells.  90  Figure 3.13 NCR1 promoter activity and chromatin environment in non-NK cells. (A) 5’ truncation promoter constructs as in Figure 3.4 were transiently transfected into U2OS cells. Firefly luciferase activity was assayed normalized to co-transfected Renilla luciferase activity. Promoter strength is calculated as fold above pGL4B empty vector. Data shown represents means with standard deviations of more than three experiments. Tests of significance were carried out using ANOVA followed by Tuckey’s post-test (*** P<0.001). (B) ChIP was performed in NK92 and IM-9 cells using anti-human H3K4me3, anti-human H3K27me3, and IgG isotype control. Precipitated DNA was assayed by real-time PCR using primers specific for the NCR1 promoter. Enrichment is calculated as fold over IgG control. Data shown represents means with standard deviations of three experiments.  91  3.4  Discussion Tissue-restricted expression is not an uncommon phenomenon. What makes NCR1  unique is the small number of known NK-specific genes. Even more remarkable is the fact that the specificity can arise from a short proximal promoter of approximately 270bp. The luciferase assay results further show that the lineage-limiting sequence to be confined to a 70bp region. Within the switch region, I found a runt binding motif. The binding motif is the same for all members of the runt family: RUNX1, RUNX2, and RUNX3. RUNX1 is a crucial transcription factor in the hematopoietic system. Its deficiency results in blocked hematopoiesis during development and conditional mutants have abnormalities in lymphoid as well as myeloid lineages (Growney et al., 2005). The transcription factor is also known to regulate multiple hematopoietic genes (Cohen, 2009). RUNX2 is primarily involved in bone formation and not so much in hematopoiesis (Cohen, 2009). Finally, RUNX3 is a key player in T cell development and function. Runx3 knockout models indicate that the protein is required for cytotoxic T lymphocyte specification, down-regulating CD4 and up-regulating CD8 (Taniuchi et al., 2002; Woolf et al., 2003). Runx3 is re-expressed when naïve CD4+ T cells differentiate into TH1 but not TH2 cells (Djuretic et al., 2007). In CD8 T cells and TH1 cells, RUNX3 controls multiple effector function genes including granzyme, interferon gamma, and perforin. Indeed, the current paradigm indicates both RUNX1 and RUNX3 to be important players in T cell differentiation (Cohen, 2009; Collins et al., 2009). In NK cells, the importance of the RUNX proteins is only beginning to emerge. The human KIR genes are known to have RUNX binding sites and variants with mutated RUNX sites are not expressed (Vilches et al., 2000). The cofactor for the RUNX proteins, core binding factor beta (CBFβ), is required for proper mouse NK cell development (Guo et al., 2008). Furthermore, 92  RUNX proteins regulate genes such as Cd122 and Ly49 and Runx3 undergoes a dramatic upregulation during NK differentiation: it is low in hematopoietic stem cells and peaks at the immature NK stage (Guo et al., 2008; Ohno et al., 2008). Certainly, when comparing different hematopoietic cell types, RUNX3 seems to be consistently over-expressed in NK cells in human and mouse. In our cell lines, only IM-9 matched the high level of RUNX3 expression in NK cells. It is known that naïve B cells usually express RUNX1, but switch to RUNX3 when transformed by Epstein-Barr virus (EBV) (Spender et al., 2002). This could explain why IM-9, an EBV transformed B lymphoblastic cell line, has RUNX3 mRNA levels as high as NK92 cells. I link RUNX1 and RUNX3 directly to an important determinant of NK function by showing that these transcription factors bind a RUNX site in the endogenous NCR1 promoter. A pan-RUNX dominant negative protein disrupts optimal NCR1 expression while RUNX3 over-expression had the opposite effect. While both RUNX1 and RUNX3 can bind the enhancer region, the higher level of RUNX3 expression in NK cells may result in preferred binding of RUNX3 at the NCR1 promoter. I hypothesize that RUNX1 may act as a redundant factor and bind the promoter if RUNX3 is disrupted. This redundancy is not surprising if one takes into account the relative importance of the NCR1 receptor in host immune defense. Our dn-Runx results also show a down-regulation of Ifng and Prf1, indicating a link between the RUNX proteins and NK effector function. In contrast, Ohno et al. showed that dnRunx upregulated Ifng (Ohno et al., 2008). This discrepancy may be due to several fundamental differences in methodology. Ohno et al. used NK1.1+ CD3- cells from spleen of dn-RUNX transgenic mice to test intracellular IFNG protein levels. I used a dn-RUNX transduced mouse NK cell line and tested transcript levels by real-time PCR. It is also possible that RUNX affects Ifng differently at transcriptional and translational levels. 93  Already, the limited amount of evidence available for RUNX3 in NK, CD8+ T, and TH1 cells implicate the transcription factor as an important mediator of cell-mediated immunity. Of course, this notion suggests that RUNX3 alone is not enough to direct NK-specificity, merely potentiating transcription in cytotoxic and TH1 lymphocytes. In fact, no single transcription factor has been shown to conclusively act as a “master regulator” of the NK program so far. Such a factor would be required for the expression of the NK program and repression of non-NK genes. Another possibility is that multiple factors which are not lineage specific act in a combinatorial way to restrict expression of NK genes such as NCR1. RUNX3 could be such a factor and the search is still on to identify others. To date, no studies have investigated the NK compartment in the existing complete Runx3 knockout mouse models (Levanon and Groner, 2009). With the development of Ncr1-cre mouse, it is now possible to delete genes specifically in the NK lineage. Though Ncr1 is under the control of Runx3, it should still be possible to selectively delete the Runx3 locus. Studies that examine the downstream targets of RUNX3 could lead to new perspectives in NK cell biology. The pathway leading to RUNX3 expression is also of interest. Park et al. recently showed that RUNX3 is induced by γc receptor signaling during CD8 T specification (Park et al., 2010). The process is dependent on STAT5 or STAT6, as γc-related cytokine stimulation of thymocytes from STAT5/6 double knockout mouse did not induce Runx3 expression. Major γc receptors are also known to play important roles in NK development and stimulation (Williams et al., 1998). Downstream of the receptors, STAT5 deficiency in NK was recently shown to lead to a blockage at the Lin- CD122+ NKP stage (Eckelhart et al., 2011). Finally, RUNX proteins positively regulate IL2Rβ/CD122 in NK cells (Ohno et al., 2008). The link between STAT5/6 and RUNX3 in NK cells still needs to be experimentally established. However, the emerging picture is one 94  where the IL-15 receptor, which first appears in the NKP stage, activates appropriate STAT members including STAT5 in cells committed to the NK lineage. This axis may lead to induction of transcription factors including RUNX3 to turn on NK related genes such as NCR1. RUNX3, in turn, acts in a positive feedback loop to further up-regulate IL2Rβ/CD122, a subunit of the IL15 receptor. In fact, surface NKp46 can be forcibly induced in a small proportion of human CD8+ T cells (~5%), when these cells are cultured ex vivo for 12 days with IL-15 (Correia et al., 2011b). This suggests that the axis plays an important, though by itself not sufficient, role in the NK program. Aside from the runt binding motif, I also noticed an ETS binding motif that can contribute to NCR1 transcriptional regulation. The ETS family transcription factors have many members and a few in particular are known to participate in NK development and function (Hesslein and Lanier, 2011). Furthermore, I previously showed that GABP, another member of the family, is required for optimal though not absolute expression of the mouse Nkg2d long isoform (Chapter 2) (Lai et al., 2009). The ETS motif in the NCR1 promoter lies in the essential region, which does not seem to be responsible for tissue specificity. Nevertheless, mutations to the binding site affect the activity of the promoter. Though an imperfect RUNX binding site was identified right next to the ETS site, we could not detect binding of RUNX1 nor RUNX3 to this site in vitro. Thus these RUNX proteins seem to be solely involved in enhancing promoter activity in the NK lineage while ETS proteins may be involved in setting up the basal activity. In non-NK cells, I observed that the essential region by itself has appreciable promoter activity. However, this activity is suppressed by the switch region. The flip of function in this cis-regulatory region is intriguing, as it suggests that NK specificity requires a dual mode of control: context-dependent enhancer and repressor. The identity of the suppressing transcription 95  factor remains a mystery. The RUNX proteins do possess repressor activity depending on bound co-repressors or histone deacetylases (Durst and Hiebert, 2004). However, they are not bound to the NCR1 promoter in non-NK cells and thus are unlikely to be involved in repression of NCR1 expression. Histone modifications act as an additional level of tissue-specific control, since I found the enrichment of permissive and repressive chromatin marks in NK and non-NK cell lines, respectively. An understanding of NCR1 regulation bears clinical as well as research potential. Since mouse models show a strong relationship between the receptor and diseases such as influenza and diabetes, one clinical goal is to efficaciously manage the expression of the receptor to benefit diseases outcomes. Such studies also provide insight into the understanding of the NK program, which noticeably lags behind our understanding of T and B lymphocyte programs. As the usage of the NCR1 promoter for transgenic studies gains traction, rational manipulation of the promoter will provide greater flexibility in the usage of this molecular tool.  96  CHAPTER 4  GENERAL DISCUSSION AND CONCLUSIONS  97  4.1  Summary and significance of findings In this thesis, I set out to examine the transcription regulation of NK cell activating  receptors which show a distinct expression pattern. I believe I have made some useful contributions to the field. First I focused on Nkg2d, a gene that has been intensively studied using mouse models yet displays divergent splice patterns between rodents and human. I showed that the alternative usage of Nkg2d exons Ia and Ib in rodents arose from the insertion of a SINE B1 element after the divergence of rodent and primates. Indeed I showed that transcription initiates within/downstream of the transposable element. Amazingly, the element acts as a non-specific Pol II promoter, which had not been reported before for the normally Pol III associated B1’s. I analyzed the sequence of the element and found several putative transcription factor binding sites. My findings indicate that the factor, GABP, binds the B1 element at slightly different locations in the mouse and rat. I also demonstrate that GABP contributes to optimal expression of the Nkg2d-L rodent isoform. Next I examined NCR1/NKp46, a gene that shows relatively high NK-specific expression. The gene had previously been shown to possess a small tissue-specific promoter (Walzer et al., 2007). I expanded on these findings and identified within this region two key cisregulatory sequences: a 95bp basal promoter and a 70bp tissue-specific switch region. By looking for possible transcription factors that bind the 70bp region, I noticed that RUNX3 is highly expressed in both mouse and human NK cells compared to other blood lineages in each species. Indeed, there is a conserved RUNX binding site in the tissue-specific switch region that enhances promoter strength in NK cells. I demonstrated that both RUNX3 and RUNX1 bind the promoter of NCR1 in vitro and in vivo. RUNX1 binding increases in the absence of RUNX3 possibly as a compensatory mechanism. Over-expression of RUNX3 led to increased expression 98  of not only Ncr1, but also Ifng and Cd43 in a mouse NK cell line. Conversely, a pan-RUNX dominant negative protein decreased Ncr1, Ifng, Prf1, and Cd43. Additionally, I showed that the NCR1 promoter is enriched for H3K4me3 in NK92 cells and H3K27me3 in IM-9 cells, suggesting tissue-specific epigenetic regulation of the locus.  4.2  ETS and RUNX members in the NK genetic program NK cells were discovered later than T and B lymphocytes and our understanding of an  NK cell’s genetic program has lagged behind. By genetic program, I am referring to the genes that define the NK cell – its lineage commitment, differentiation, and function. These genes consist of transcription factors, receptors, signaling modules and effectors that together form an array specific to NK cells. While commitment, differentiation and function may represent different aspects of the NK lymphocyte, they need not resort to completely distinct genetic pathways and probably share multiple components of a complex network. While a few pieces of this jigsaw puzzle have been discovered, we are far from a complete picture. Especially interesting are the transcription factors because they can be responsible for turning on multiple downstream targets and regulate large portions of the network. Identification of these factors should be a major goal of the field as it may allow control and manipulation of NK cells for therapeutic purposes. By studying the promoters of two key activating receptors, I’ve identified transcription factors GABP, RUNX3 and RUNX1 in the NK genetic network. GABP is in a growing list of Etwenty-six (ETS) transcription factor family members, ETS1, PU.1 (encoded by spleen focus forming virus proviral integration oncogene SPI1) and ELF4, known to participate in the NK program (see Table 4.1). 99  Target  NK effects +  Ets1  Spi1* (PU.1)  Elf4  Gabp*  Cbfβ*  T effects  B effects  NKT effects  Reference  Deficient  None reported  Increased  (Barton et al., 1998)  Deficient  Deficient  Deficient  (Colucci et al., 2001)  None reported  None reported  Deficient  (Lacorazza et al., 2002)  -  -Decreased DX5 CD3 cells -Less cytotoxic, IFNγ secretion -Mildly decreased IL-15Rα mRNA -Decreased NKP (CD122+NK1.1- DX5-) -Cytotoxicity not affected -Absent IL-7Rα mRNA -Decreased NK1.1+/DX5+ CD3cells -Less cytotoxic, less intracellular IFNγ  ? -Decreased NKP (CD122+NK1.1-) in fetus -Decreased Lin- NK1.1+ DX5+/cells but unperturbed NKP in chimeric mouse  Deficient  Deficient  ?  (Ristevski et al., 2004; Xue et al., 2007; Yu et al., 2010)  Deficient  None reported  ?  (Guo et al., 2008) (Ichikawa et al., 2004; Woolf et al., 2003)  Runx1*  ?  affected  affected  ?  Runx2  ?  ?  ?  ?  ?  CD8 SP and TH1 cells affected  None reported  Runx3  ?  (Djuretic et al., 2007; Taniuchi et al., 2002; Woolf et al., 2003)  *Generated by chimeric mouse, conditional knockout, or hypomorphic alleles Table 4.1 Effects of ETS and RUNX gene targeting  Ets1 deficiency results in decreased CD49b+ mature mouse NK cells. Exactly what stage a differentiating NK progenitor cell becomes stuck in the absence of Ets1 is currently unknown. The NK cells remaining in this knockout mouse are also defective in cytolysis, IFNγ production,  100  and clearing tumor cell inoculums. Of note, the Ets1-/- mouse also has decreased absolute T cell numbers and thus ETS1 should not be considered an NK-specific regulator (Barton et al., 1998). The PU.1 protein is expressed at higher levels in NK than in T or pre-B cells. Since knocking out PU.1/Spi1 resulted in embryonic lethality, a chimeric mouse was used to show that CD122+ NK1.1- NK progenitors are greatly reduced. Though greatly diminished in number, mature NK still exhibit cytotoxic competency. These results must be interpreted with caution because T and B lymphocytes in these mice are also dramatically reduced, possibly due to loss of IL-7 receptor expression (Colucci et al., 2001). Weigelt et al. showed that in macrophage and microglia, PU.1 binds conserved motifs in the promoter of DAP12. Luciferase assays and knockdown experiments confirmed that PU.1 is a transactivator of this adapter protein (Weigelt et al., 2007). Musikacharoen et al., using macrophages as well, showed that PU.1 also binds the promoter and enhances the transcription of IL-12Rβ1 (Musikacharoen et al., 2005). Though these experiments were done in macrophages, they in fact fit quite well with observations made in the PU.1 null mouse. Ly49D depends on DAP12 for cell surface expression and signaling. PU.1/Spi1-/- NK cells show ten-fold less Ly49D surface levels compared to wild type. Similarly, IL-12 treatment of PU.1/Spi1-/- NK cells resulted in six-fold less proliferation (Colucci et al., 2001). ELF4 deficient mice have an unperturbed T and B cell compartment, but diminished CD49b+ CD3- mature NK cells and NK1.1+ αβTCR+ NKT cells. Furthermore, ELF4 deficiency results in defective IFNγ secretion and perforin expression in splenocytes. Further analysis showed that ELF4 but not ETS1 nor PU.1 single handedly transactivates the human perforin promoter in a non-NK environment. EMSA and ChIP were also used to show direct interactions between the perforin promoter sequence and the transcription factor in NK cells. Interestingly, 101  while CD8+ T cells are less cytotoxic in Elf4-/- mouse, perforin expression in these cells is not affected, suggesting that ELF4 regulation of the perforin promoter is NK specific (Lacorazza et al., 2002). Finally, GABP plays a role in the activation of numerous myeloid and lymphoid related genes as reviewed in section 2.4. GABP deficiency is embryonic lethal, but conditional knockouts and chimeras have been used to show that the factor is required for normal T and B cell development (Ristevski et al., 2004; Xue et al., 2007; Yu et al., 2010). In NK cells, GABP is implicated to the regulation of the KIR3DL1 promoter (as discussed in 1.2.6.1) and now Nkg2d. GABP deficient chimeric mouse may provide more clues. There is already biochemical evidence of GABP regulating the promoters of γc chain, IL-2Rβ, and IL-7Rα in other immune cells (DeKoter et al., 2007; Lin et al., 1993; Markiewicz et al., 1996). Thus a knockout phenotype of decreased NK may be expected but T and B cell compartments may also be perturbed (akin to PU.1 deficiency). Each individual of the aforementioned ETS members seem to regulate NK development or function in some way (see Figure 4.1). But how do they cooperate as a family in the NK genetic network? Since the ETS family members all share highly similar binding motifs, it is possible that they are simply redundant. This would explain the fact that none of the ETS member knockout models completely abrogate the NK compartment – usually a fraction of detectable NK cells remain. Another possibility is that they cooperate at regulatory regions. Genome-wide studies supports this notion: ETS1, ELF1 and GABP has been shown to cooccupy specific genomic regions in Jurkat cells (Hollenhorst et al., 2007; Hollenhorst et al., 2009).  102  As discussed in section 3.4, the effect of RUNX proteins on T cell differentiation has been an area of rigorous study while the effect on NK cell differentiation and function is still not entirely clear. I and others have shown that the RUNX proteins regulate various NK related genes. These include cell surface inhibitory and activating receptors (NCR1, KIR, Ly49, see sections 1.2.6.1 and chapter 3) and differentiation markers (CD122, CD43, see chapter 3). The promoter studies that connect RUNX to Ly49 regulation has been borne out by transgenic dnRUNX. Compared to wild type, mouse NK cells with two copies of dn-RUNX show 2-5 fold less surface Ly49C/I, Ly49F, Ly49G2 and Ly49D. The effect is dose dependent, since NK cells with only one copy of the dn-RUNX transgene show a moderate loss of Ly49 surface expression half way between wild type and NK expressing two copies of dn-RUNX (Ohno et al., 2008). RUNX also regulates effector function genes such as Prf1 and Ifng in NK, CTL and TH1 cells, though there are some bits of conflicting data for NK cells that still need to be clarified (see sections 3.3.7, 3.4 and Figure 4.1). Guo et al. was able to study the effects of CBFβ on NK differentiation using hypomorphic alleles to alter CBFβ dosage (Guo et al., 2008). CBFβ is a shared cofactor for RUNX1, 2, and 3 and its perturbation would theoretically affect all three members of the RUNX family. When CBFβ is only expressed at 15% compared to wild type, fetal liver and fetal thymus cells become almost completely devoid of CD122+ cells, let alone CD122+ NK1.1+ cells. In chimeras, CBFβ affects NK1.1+ and DX5+ NK cells in a dose dependent manner. If CBFβ is expressed at 30% that of wild type, the amount of NK1.1+ DX5+/- NK cells show a noticeable decrease. If CBFβ expression is dropped further to 15% of wild type, the NK cells completely disappear. However, CD122+ Lin- cells are still detectable. Thus the fetal liver/thymus results and transplanted chimera results implicate CBFβ in differentiation stages prior to the NKP stage 103  and between the NKP to iNK stage, respectively. Two studies have shown that the expression of Runx3, especially, increases incrementally from hematopoietic stem cells, to NKP’s to iNK cells (Guo et al., 2008; Ohno et al., 2008). In addition, RUNX3 levels are dramatically higher in mature NK compared to other blood cell lineages. These results and my own point toward RUNX3 to be the key RUNX family member involved in the NK genetic network. The relationship between ETS and RUNX family members is beginning to be appreciated. Interestingly, genome wide studies have shown that ETS members and RUNX (pan-RUNX because the ChIP antibody used does not differentiate between RUNX family members) also cooccupy certain regulatory regions in Jurkat cells (Hollenhorst et al., 2007; Hollenhorst et al., 2009). In fact, specific cases of co-operative regulation have been reported. For example, RUNX3, RUNX1, and ETS1 co-regulate the Cd6 gene in T cells (Arman et al., 2009). A similar scenario may prove to be true for the NCR1 promoter. Another possibility is for ETS and RUNX3 to fall into a linear pathway. The RUNX3 gene has two promoters that has been labeled distal (or P1) and proximal (or P2). Mouse CD8+ T cells and NK cells both preferentially use the distal promoter ((Egawa et al., 2007; Sato et al., 2005) and section 3.3.4). Transcription factor binding site scanning has found putative ETS family binding sites in this distal promoter (Bangsow et al., 2001; Rini and Calabi, 2001). In TH1 cells, ChIP experiments have shown that ETS1 does indeed bind two sites in the distal promoter and one site in an intronic region of Runx3. ETS1 induces Runx3 expression and is required for the transition from CD4+ CD8+ DP T cell to CD8+ SP T cell. ETS1 deficiency results in loss of the CD8+ SP T cell population and an accumulation of the CD4+ CD8+ DP T cells. Ectopic over-expression of a Runx3 transgene in Ets1-/- thymocytes led to “rescuing” and reemergence of the CD4- C8+ SP T population (Zamisch et al., 2009). Thus Runx3 seems to be a direct target of ETS1, at least in CTL’s (see Figure 4.1). 104  105  Further upstream, ETS1 could be under the control of γc receptor signaling. IL-2 and IL15 receptor signaling is known to enhance protein synthesis and stability of ETS1 in NK cells (Grund et al., 2005). RUNX3 induction in CD8+ T cell specification is also downstream of STAT5/6, which is activated through γc receptors (Park et al., 2010). What is the relationship between STAT5, ETS1 and RUNX3 in the NK program? Do STAT5 and ETS1 interact and converge on the RUNX3 promoter or enhancer in NK cells? Are other ETS members involved and how do ETS family member expression levels correlate to increasing RUNX3 transcription during NK differentiation? CD8+ T cells and NK cells seem to share similar regulatory program components in terms of transcription factors and related pathways. But genes like NCR1 are specific for NK cells. What other factors are involved and how do they cooperate with ETS and RUNX members? These are questions that await rigorous examination.  Figure 4.1 Portion of the NK program concerning ETS and RUNX members. A model of ETS and RUNX family mediated regulation of cytokine receptors, transcription factors, inhibitory and activating receptors and effectors based on current evidence and hypotheses. Connections can be direct or indirect. NK receptors with an “i.” prefix are inhibitory.  106  4.3  Concluding remarks NK cells impact human health in many ways. They provide frontline defense against  pathogens and tumorigenic cells and must be reigned in to prevent autoimmunity. Undoubtedly, harnessing the power of NK cells will lead to the development of clinical innovations for patients. For this to happen, we need a detailed understanding of NK biology. There are many ways to define NK cells. As history has shown, they were first defined by function, then by surface markers when the field of immunology embraced monoclonal antibodies. The field has since begun picking apart the receptors, signaling pathways, effectors and regulators in NK cells. Like a well practiced orchestra, these interconnected components work in concert to produce the symphony that is the NK program – responsible for all aspects of NK differentiation, function and biology. In this thesis, I set out to study the transcription regulation of two activating receptors with some degree of tissue specificity and my findings have allowed me to make some inferences on the NK program. The discovery of GABP in regulating Nkg2d supports the notion that ETS family members in general play a crucial role in NK cells. By studying the NCR1 promoter, I further put the spotlight on RUNX3, a previously underappreciated factor in NK cells and a potential area of future studies.  107  REFERENCES  108  Andre, P., Castriconi, R., Espeli, M., Anfossi, N., Juarez, T., Hue, S., Conway, H., Romagne, F., Dondero, A., Nanni, M., et al. (2004). Comparative analysis of human NK cell activation induced by NKG2D and natural cytotoxicity receptors. Eur J Immunol 34, 961-71. Arase, H., Mocarski, E.S., Campbell, A.E., Hill, A.B., and Lanier, L.L. (2002). Direct recognition of cytomegalovirus by activating and inhibitory NK cell receptors. Science 296, 1323-1326. Arase, H., Saito, T., Phillips, J.H., and Lanier, L.L. (2001). Cutting edge: the mouse NK cellassociated antigen recognized by DX5 monoclonal antibody is CD49b (alpha 2 integrin, very late antigen-2). J. Immunol. 167, 1141-1144. Arman, M., Aguilera-Montilla, N., Mas, V., Puig-Kroger, A., Pignatelli, M., Guigo, R., Corbi, A.L., and Lozano, F. (2009). The human CD6 gene is transcriptionally regulated by RUNX and Ets transcription factors in T cells. Mol. Immunol. 46, 2226-2235. Arnon, T.I., Lev, M., Katz, G., Chernobrov, Y., Porgador, A., and Mandelboim, O. (2001). Recognition of viral hemagglutinins by NKp44 but not by NKp30. Eur. J. Immunol. 31, 26802689. Bangsow, C., Rubins, N., Glusman, G., Bernstein, Y., Negreanu, V., Goldenberg, D., Lotem, J., Ben-Asher, E., Lancet, D., Levanon, D., and Groner, Y. (2001). The RUNX3 gene--sequence, structure and regulated expression. Gene 279, 221-232. Bannert, N., Avots, A., Baier, M., Serfling, E., and Kurth, R. (1999). GA-binding protein factors, in concert with the coactivator CREB binding protein/p300, control the induction of the interleukin 16 promoter in T lymphocytes. Proc. Natl. Acad. Sci. U. S. A. 96, 1541-1546. Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Schones, D.E., Wang, Z., Wei, G., Chepelev, I., and Zhao, K. (2007). High-resolution profiling of histone methylations in the human genome. Cell 129, 823-837. Barton, K., Muthusamy, N., Fischer, C., Ting, C.N., Walunas, T.L., Lanier, L.L., and Leiden, J.M. (1998). The Ets-1 transcription factor is required for the development of natural killer cells in mice. Immunity 9, 555-563. Benitez, A.C., Dai, Z., Mann, H.H., Reeves, R.S., Margineantu, D.H., Gooley, T.A., Groh, V., and Spies, T. (2011). Expression, signaling proficiency, and stimulatory function of the NKG2D lymphocyte receptor in human cancer cells. Proc. Natl. Acad. Sci. U. S. A. 108, 4081-4086. Berg, S.F., Dissen, E., Westgaard, I.H., and Fossum, S. (1998). Molecular characterization of rat NKR-P2, a lectin-like receptor expressed by NK cells and resting T cells. Int. Immunol. 10, 379385.  109  Biassoni, R., Pessino, A., Bottino, C., Pende, D., Moretta, L., and Moretta, A. (1999). The murine homologue of the human NKp46, a triggering receptor involved in the induction of natural cytotoxicity. Eur. J. Immunol. 29, 1014-1020. Billadeau, D.D., Upshaw, J.L., Schoon, R.A., Dick, C.J., and Leibson, P.J. (2003). NKG2DDAP10 triggers human NK cell-mediated killing via a Syk-independent regulatory pathway. Nat Immunol 4, 557-64. Bourque, G., Leong, B., Vega, V.B., Chen, X., Lee, Y.L., Srinivasan, K.G., Chew, J.L., Ruan, Y., Wei, C.L., Ng, H.H., and Liu, E.T. (2008). Evolution of the mammalian transcription factor binding repertoire via transposable elements. Genome Res. 18, 1752-1762. Brandt, C.S., Baratin, M., Yi, E.C., Kennedy, J., Gao, Z., Fox, B., Haldeman, B., Ostrander, C.D., Kaifu, T., Chabannon, C., et al. (2009). The B7 family member B7-H6 is a tumor cell ligand for the activating natural killer cell receptor NKp30 in humans. J. Exp. Med. 206, 14951503. Braud, V.M., Allan, D.S., O'Callaghan, C.A., Soderstrom, K., D'Andrea, A., Ogg, G.S., Lazetic, S., Young, N.T., Bell, J.I., Phillips, J.H., Lanier, L.L., and McMichael, A.J. (1998). HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature 391, 795-799. Brooks, A.G., Posch, P.E., Scorzelli, C.J., Borrego, F., and Coligan, J.E. (1997). NKG2A complexed with CD94 defines a novel inhibitory natural killer cell receptor. J. Exp. Med. 185, 795-800. Brown, T.A., and McKnight, S.L. (1992). Specificities of protein-protein and protein-DNA interaction of GABP alpha and two newly defined ets-related proteins. Genes Dev. 6, 2502-2512. Byrd, A., Hoffmann, S.C., Jarahian, M., Momburg, F., and Watzl, C. (2007). Expression analysis of the ligands for the Natural Killer cell receptors NKp30 and NKp44. PLoS One 2, e1339. Cantoni, C., Bottino, C., Vitale, M., Pessino, A., Augugliaro, R., Malaspina, A., Parolini, S., Moretta, L., Moretta, A., and Biassoni, R. (1999). NKp44, a triggering receptor involved in tumor cell lysis by activated human natural killer cells, is a novel member of the immunoglobulin superfamily. J. Exp. Med. 189, 787-796. Carlyle, J.R., Mesci, A., Ljutic, B., Belanger, S., Tai, L.H., Rousselle, E., Troke, A.D., Proteau, M.F., and Makrigiannis, A.P. (2006). Molecular and genetic basis for strain-dependent NK1.1 alloreactivity of mouse NK cells. J. Immunol. 176, 7511-7524. Carr, W.H., Rosen, D.B., Arase, H., Nixon, D.F., Michaelsson, J., and Lanier, L.L. (2007). Cutting Edge: KIR3DS1, a gene implicated in resistance to progression to AIDS, encodes a DAP12-associated receptor expressed on NK cells that triggers NK cell activation. J. Immunol. 178, 647-651. 110  Chan, H.W., Kurago, Z.B., Stewart, C.A., Wilson, M.J., Martin, M.P., Mace, B.E., Carrington, M., Trowsdale, J., and Lutz, C.T. (2003). DNA methylation maintains allele-specific KIR gene expression in human natural killer cells. J. Exp. Med. 197, 245-255. Chan, H.W., Miller, J.S., Moore, M.B., and Lutz, C.T. (2005). Epigenetic control of highly homologous killer Ig-like receptor gene alleles. J. Immunol. 175, 5966-5974. Chan, P.Y., and Takei, F. (1986). Expression of a T cell receptor-like molecule on normal and malignant murine T cells detected by rat monoclonal antibodies to nonclonotypic determinants. J. Immunol. 136, 1346-1353. Cichocki, F., Hanson, R.J., Lenvik, T., Pitt, M., McCullar, V., Li, H., Anderson, S.K., and Miller, J.S. (2009). The transcription factor c-Myc enhances KIR gene transcription through direct binding to an upstream distal promoter element. Blood 113, 3245-3253. Cohen, M.M.,Jr. (2009). Perspectives on RUNX genes: an update. Am. J. Med. Genet. A. 149A, 2629-2646. Collins, A., Littman, D.R., and Taniuchi, I. (2009). RUNX proteins in transcription factor networks that regulate T-cell lineage choice. Nat. Rev. Immunol. 9, 106-115. Colucci, F., Samson, S.I., DeKoter, R.P., Lantz, O., Singh, H., and Di Santo, J.P. (2001). Differential requirement for the transcription factor PU.1 in the generation of natural killer cells versus B and T cells. Blood 97, 2625-2632. Connelley, T., Storset, A.K., Pemberton, A., Machugh, N., Brown, J., Lund, H., and Morrison, I.W. (2011). NKp46 defines ovine cells that have characteristics corresponding to NK cells. Vet. Res. 42, 37. Correia, D.V., Fogli, M., Hudspeth, K., da Silva, M.G., Mavilio, D., and Silva-Santos, B. (2011a). Differentiation of human peripheral blood Vdelta1+ T cells expressing the natural cytotoxicity receptor NKp30 for recognition of lymphoid leukemia cells. Blood 118, 992-1001. Correia, M.P., Costa, A.V., Uhrberg, M., Cardoso, E.M., and Arosa, F.A. (2011b). IL-15 induces CD8+ T cells to acquire functional NK receptors capable of modulating cytotoxicity and cytokine secretion. Immunobiology 216, 604-612. Costello, R.T., Sivori, S., Marcenaro, E., Lafage-Pochitaloff, M., Mozziconacci, M.J., Reviron, D., Gastaut, J.A., Pende, D., Olive, D., and Moretta, A. (2002). Defective expression and function of natural killer cell-triggering receptors in patients with acute myeloid leukemia. Blood 99, 3661-3667. Cruz-Guilloty, F., Pipkin, M.E., Djuretic, I.M., Levanon, D., Lotem, J., Lichtenheld, M.G., Groner, Y., and Rao, A. (2009). Runx3 and T-box proteins cooperate to establish the transcriptional program of effector CTLs. J. Exp. Med. 206, 51-59. 111  Davies, G.E., Locke, S.M., Wright, P.W., Li, H., Hanson, R.J., Miller, J.S., and Anderson, S.K. (2007). Identification of bidirectional promoters in the human KIR genes. Genes Immun. 8, 245253. DeKoter, R.P., Schweitzer, B.L., Kamath, M.B., Jones, D., Tagoh, H., Bonifer, C., Hildeman, D.A., and Huang, K.J. (2007). Regulation of the interleukin-7 receptor alpha promoter by the Ets transcription factors PU.1 and GA-binding protein in developing B cells. J. Biol. Chem. 282, 14194-14204. Diefenbach, A., Jensen, E.R., Jamieson, A.M., and Raulet, D.H. (2001). Rae1 and H60 ligands of the NKG2D receptor stimulate tumour immunity. Nature 413, 165-171. Diefenbach, A., Tomasello, E., Lucas, M., Jamieson, A.M., Hsia, J.K., Vivier, E., and Raulet, D.H. (2002). Selective associations with signaling proteins determine stimulatory versus costimulatory activity of NKG2D. Nat Immunol 3, 1142-9. Djuretic, I.M., Levanon, D., Negreanu, V., Groner, Y., Rao, A., and Ansel, K.M. (2007). Transcription factors T-bet and Runx3 cooperate to activate Ifng and silence Il4 in T helper type 1 cells. Nat. Immunol. 8, 145-153. Durst, K.L., and Hiebert, S.W. (2004). Role of RUNX family members in transcriptional repression and gene silencing. Oncogene 23, 4220-4224. Eagle, R.A., Jafferji, I., and Barrow, A.D. (2009). Beyond Stressed Self: Evidence for NKG2D Ligand Expression on Healthy Cells. Curr. Immunol. Rev. 5, 22-34. Eagle, R.A., and Trowsdale, J. (2007). Promiscuity and the single receptor: NKG2D. Nat Rev Immunol 7, 737-44. Eckelhart, E., Warsch, W., Zebedin, E., Simma, O., Stoiber, D., Kolbe, T., Rulicke, T., Mueller, M., Casanova, E., and Sexl, V. (2011). A novel Ncr1-Cre mouse reveals the essential role of STAT5 for NK-cell survival and development. Blood 117, 1565-1573. Egawa, T., Tillman, R.E., Naoe, Y., Taniuchi, I., and Littman, D.R. (2007). The role of the Runx transcription factors in thymocyte differentiation and in homeostasis of naive T cells. J. Exp. Med. 204, 1945-1957. Ehrlich, L.I., Ogasawara, K., Hamerman, J.A., Takaki, R., Zingoni, A., Allison, J.P., and Lanier, L.L. (2005). Engagement of NKG2D by cognate ligand or antibody alone is insufficient to mediate costimulation of human and mouse CD8+ T cells. J. Immunol. 174, 1922-1931. Elboim, M., Gazit, R., Gur, C., Ghadially, H., Betser-Cohen, G., and Mandelboim, O. (2010). Tumor immunoediting by NKp46. J. Immunol. 184, 5637-5644.  112  El-Sherbiny, Y.M., Meade, J.L., Holmes, T.D., McGonagle, D., Mackie, S.L., Morgan, A.W., Cook, G., Feyler, S., Richards, S.J., Davies, F.E., Morgan, G.J., and Cook, G.P. (2007). The requirement for DNAM-1, NKG2D, and NKp46 in the natural killer cell-mediated killing of myeloma cells. Cancer Res. 67, 8444-8449. Fauriat, C., Just-Landi, S., Mallet, F., Arnoulet, C., Sainty, D., Olive, D., and Costello, R.T. (2007). Deficient expression of NCR in NK cells from acute myeloid leukemia: Evolution during leukemia treatment and impact of leukemia cells in NCRdull phenotype induction. Blood 109, 323-330. Ferrigno, O., Virolle, T., Djabari, Z., Ortonne, J.P., White, R.J., and Aberdam, D. (2001). Transposable B2 SINE elements can provide mobile RNA polymerase II promoters. Nat. Genet. 28, 77-81. Fikri, Y., Nyabenda, J., Content, J., and Huygen, K. (2007). Cloning, sequencing, and cell surface expression pattern of bovine immunoreceptor NKG2D and adaptor molecules DAP10 and DAP12. Immunogenetics Fu, Y., Chang, A.C., Fournier, M., Chang, L., Niessen, K., and Karsan, A. (2011). RUNX3 maintains the mesenchymal phenotype after termination of the Notch signal. J. Biol. Chem. 286, 11803-11813. Fuertes, M.B., Girart, M.V., Molinero, L.L., Domaica, C.I., Rossi, L.E., Barrio, M.M., Mordoh, J., Rabinovich, G.A., and Zwirner, N.W. (2008). Intracellular retention of the NKG2D ligand MHC class I chain-related gene A in human melanomas confers immune privilege and prevents NK cell-mediated cytotoxicity. J. Immunol. 180, 4606-4614. Gao, X.N., and Yu, L. (2008). E2F1 contributes to the transcriptional activation of the KIR3DL1 gene. Biochem. Biophys. Res. Commun. 370, 399-403. Gays, F., Koh, A.S., Mickiewicz, K.M., Aust, J.G., and Brooks, C.G. (2011). Comprehensive analysis of transcript start sites in ly49 genes reveals an unexpected relationship with gene function and a lack of upstream promoters. PLoS One 6, e18475. Gazit, R., Gruda, R., Elboim, M., Arnon, T.I., Katz, G., Achdout, H., Hanna, J., Qimron, U., Landau, G., Greenbaum, E., et al. (2006). Lethal influenza infection in the absence of the natural killer cell receptor gene Ncr1. Nat. Immunol. 7, 517-523. Genuario, R.R., Kelley, D.E., and Perry, R.P. (1993). Comparative utilization of transcription factor GABP by the promoters of ribosomal protein genes rpL30 and rpL32. Gene Expr. 3, 279288. Genuario, R.R., and Perry, R.P. (1996). The GA-binding protein can serve as both an activator and repressor of ribosomal protein gene transcription. J. Biol. Chem. 271, 4388-4395. 113  George, T.C., Mason, L.H., Ortaldo, J.R., Kumar, V., and Bennett, M. (1999). Positive recognition of MHC class I molecules by the Ly49D receptor of murine NK cells. J. Immunol. 162, 2035-2043. Gilfillan, S., Ho, E.L., Cella, M., Yokoyama, W.M., and Colonna, M. (2002). NKG2D recruits two distinct adapters to trigger NK cell activation and costimulation. Nat Immunol 3, 1150-5. Gong, J.H., Maki, G., and Klingemann, H.G. (1994). Characterization of a human cell line (NK92) with phenotypical and functional characteristics of activated natural killer cells. Leukemia 8, 652-658. Gordon, S., Akopyan, G., Garban, H., and Bonavida, B. (2006). Transcription factor YY1: structure, function, and therapeutic implications in cancer biology. Oncogene 25, 1125-1142. Groh, V., Rhinehart, R., Randolph-Habecker, J., Topp, M.S., Riddell, S.R., and Spies, T. (2001). Costimulation of CD8alphabeta T cells by NKG2D via engagement by MIC induced on virusinfected cells. Nat. Immunol. 2, 255-260. Groh, V., Wu, J., Yee, C., and Spies, T. (2002). Tumour-derived soluble MIC ligands impair expression of NKG2D and T-cell activation. Nature 419, 734-738. Growney, J.D., Shigematsu, H., Li, Z., Lee, B.H., Adelsperger, J., Rowan, R., Curley, D.P., Kutok, J.L., Akashi, K., Williams, I.R., Speck, N.A., and Gilliland, D.G. (2005). Loss of Runx1 perturbs adult hematopoiesis and is associated with a myeloproliferative phenotype. Blood 106, 494-504. Grund, E.M., Spyropoulos, D.D., Watson, D.K., and Muise-Helmericks, R.C. (2005). Interleukins 2 and 15 regulate Ets1 expression via ERK1/2 and MNK1 in human natural killer cells. J. Biol. Chem. 280, 4772-4778. Guerra, N., Tan, Y.X., Joncker, N.T., Choy, A., Gallardo, F., Xiong, N., Knoblaugh, S., Cado, D., Greenberg, N.M., and Raulet, D.H. (2008). NKG2D-deficient mice are defective in tumor surveillance in models of spontaneous malignancy. Immunity 28, 571-580. Guo, Y., Maillard, I., Chakraborti, S., Rothenberg, E.V., and Speck, N.A. (2008). Core binding factors are necessary for natural killer cell development and cooperate with Notch signaling during T-cell specification. Blood 112, 480-492. Gur, C., Enk, J., Kassem, S.A., Suissa, Y., Magenheim, J., Stolovich-Rain, M., Nir, T., Achdout, H., Glaser, B., Shapiro, J., et al. (2011). Recognition and killing of human and murine pancreatic beta cells by the NK receptor NKp46. J. Immunol. 187, 3096-3103. Gur, C., Porgador, A., Elboim, M., Gazit, R., Mizrahi, S., Stern-Ginossar, N., Achdout, H., Ghadially, H., Dor, Y., Nir, T., et al. (2010). The activating receptor NKp46 is essential for the development of type 1 diabetes. Nat. Immunol. 11, 121-128. 114  Halfteck, G.G., Elboim, M., Gur, C., Achdout, H., Ghadially, H., and Mandelboim, O. (2009). Enhanced in vivo growth of lymphoma tumors in the absence of the NK-activating receptor NKp46/NCR1. J. Immunol. 182, 2221-2230. Hayashi, K., Natsume, W., Watanabe, T., Abe, N., Iwai, N., Okada, H., Ito, Y., Asano, M., Iwakura, Y., Habu, S., Takahama, Y., and Satake, M. (2000). Diminution of the AML1 transcription factor function causes differential effects on the fates of CD4 and CD8 singlepositive T cells. J. Immunol. 165, 6816-6824. Held, W., Clevers, H., and Grosschedl, R. (2003). Redundant functions of TCF-1 and LEF-1 during T and NK cell development, but unique role of TCF-1 for Ly49 NK cell receptor acquisition. Eur. J. Immunol. 33, 1393-1398. Held, W., Kunz, B., Lowin-Kropf, B., van de Wetering, M., and Clevers, H. (1999). Clonal acquisition of the Ly49A NK cell receptor is dependent on the trans-acting factor TCF-1. Immunity 11, 433-442. Hesslein, D.G., and Lanier, L.L. (2011). Transcriptional control of natural killer cell development and function. Adv. Immunol. 109, 45-85. Hoffmeyer, A., Avots, A., Flory, E., Weber, C.K., Serfling, E., and Rapp, U.R. (1998). The GABP-responsive element of the interleukin-2 enhancer is regulated by JNK/SAPK-activating pathways in T lymphocytes. J. Biol. Chem. 273, 10112-10119. Hollenhorst, P.C., Chandler, K.J., Poulsen, R.L., Johnson, W.E., Speck, N.A., and Graves, B.J. (2009). DNA specificity determinants associate with distinct transcription factor functions. PLoS Genet. 5, e1000778. Hollenhorst, P.C., Shah, A.A., Hopkins, C., and Graves, B.J. (2007). Genome-wide analyses reveal properties of redundant and specific promoter occupancy within the ETS gene family. Genes Dev. 21, 1882-1894. Houchins, J.P., Yabe, T., McSherry, C., and Bach, F.H. (1991). DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. J. Exp. Med. 173, 1017-1020. Ichikawa, M., Asai, T., Saito, T., Seo, S., Yamazaki, I., Yamagata, T., Mitani, K., Chiba, S., Ogawa, S., Kurokawa, M., and Hirai, H. (2004). AML-1 is required for megakaryocytic maturation and lymphocytic differentiation, but not for maintenance of hematopoietic stem cells in adult hematopoiesis. Nat. Med. 10, 299-304. Imai, K., Matsuyama, S., Miyake, S., Suga, K., and Nakachi, K. (2000). Natural cytotoxic activity of peripheral-blood lymphocytes and cancer incidence: an 11-year follow-up study of a general population. Lancet 356, 1795-1799. 115  Ioannidis, V., Kunz, B., Tanamachi, D.M., Scarpellino, L., and Held, W. (2003). Initiation and limitation of Ly-49A NK cell receptor acquisition by T cell factor-1. J. Immunol. 171, 769-775. Jamieson, A.M., Diefenbach, A., McMahon, C.W., Xiong, N., Carlyle, J.R., and Raulet, D.H. (2002). The role of the NKG2D immunoreceptor in immune cell activation and natural killing. Immunity 17, 19-29. Jonjic, S., Babic, M., Polic, B., and Krmpotic, A. (2008). Immune evasion of natural killer cells by viruses. Curr. Opin. Immunol. 20, 30-38. Jordan, I.K., Rogozin, I.B., Glazko, G.V., and Koonin, E.V. (2003). Origin of a substantial fraction of human regulatory sequences from transposable elements. Trends Genet. 19, 68-72. Jozaki, K., Shinkai, H., Morozumi, T., Tanaka-Matsuda, M., Eguchi-Ogawa, T., Wada, Y., and Uenishi, H. (2010). Cloning, expression, and polymorphisms of natural killer cell receptor NCR1 in pigs. Anim. Biotechnol. 21, 156-163. Karlhofer, F.M., Ribaudo, R.K., and Yokoyama, W.M. (1992). MHC class I alloantigen specificity of Ly-49+ IL-2-activated natural killer cells. Nature 358, 66-70. Karre, K., Ljunggren, H.G., Piontek, G., and Kiessling, R. (1986). Selective rejection of H-2deficient lymphoma variants suggests alternative immune defence strategy. Nature 319, 675-678. Kelley, J., Walter, L., and Trowsdale, J. (2005). Comparative genomics of natural killer cell receptor gene clusters. PLoS Genet 1, 129-39. Kiessling, R., Klein, E., Pross, H., and Wigzell, H. (1975a). "Natural" killer cells in the mouse. II. Cytotoxic cells with specificity for mouse Moloney leukemia cells. Characteristics of the killer cell. Eur. J. Immunol. 5, 117-121. Kiessling, R., Klein, E., and Wigzell, H. (1975b). "Natural" killer cells in the mouse. I. Cytotoxic cells with specificity for mouse Moloney leukemia cells. Specificity and distribution according to genotype. Eur. J. Immunol. 5, 112-117. Kim, S., Iizuka, K., Aguila, H.L., Weissman, I.L., and Yokoyama, W.M. (2000). In vivo natural killer cell activities revealed by natural killer cell-deficient mice. Proc. Natl. Acad. Sci. U. S. A. 97, 2731-2736. Kriegs, J.O., Churakov, G., Jurka, J., Brosius, J., and Schmitz, J. (2007). Evolutionary history of 7SL RNA-derived SINEs in Supraprimates. Trends Genet. 23, 158-161. Kubo, S., Nagasawa, R., Nishimura, H., Shigemoto, K., and Maruyama, N. (1999). ATF-2binding regulatory element is responsible for the Ly49A expression in murine T lymphoid line, EL-4. Biochim. Biophys. Acta 1444, 191-200. 116  Kubota, A., Kubota, S., Lohwasser, S., Mager, D.L., and Takei, F. (1999). Diversity of NK cell receptor repertoire in adult and neonatal mice. J. Immunol. 163, 212-216. Kunz, B., and Held, W. (2001). Positive and negative roles of the trans-acting T cell factor-1 for the acquisition of distinct Ly-49 MHC class I receptors by NK cells. J. Immunol. 166, 61816187. Lacorazza, H.D., Miyazaki, Y., Di Cristofano, A., Deblasio, A., Hedvat, C., Zhang, J., CordonCardo, C., Mao, S., Pandolfi, P.P., and Nimer, S.D. (2002). The ETS protein MEF plays a critical role in perforin gene expression and the development of natural killer and NK-T cells. Immunity 17, 437-449. Lai, C.B., Zhang, Y., Rogers, S.L., and Mager, D.L. (2009). Creation of the two isoforms of rodent NKG2D was driven by a B1 retrotransposon insertion. Nucl. Acids Res. 37, 3032-3043. Lanier, L.L. (2005). NK cell recognition. Annu. Rev. Immunol. 23, 225-274. Lanier, L.L. (2003). Natural killer cell receptor signaling. Curr. Opin. Immunol. 15, 308-314. Lanier, L.L., Le, A.M., Phillips, J.H., Warner, N.L., and Babcock, G.F. (1983). Subpopulations of human natural killer cells defined by expression of the Leu-7 (HNK-1) and Leu-11 (NK-15) antigens. J. Immunol. 131, 1789-1796. Lanier, L.L., Testi, R., Bindl, J., and Phillips, J.H. (1989). Identity of Leu-19 (CD56) leukocyte differentiation antigen and neural cell adhesion molecule. J. Exp. Med. 169, 2233-2238. Lattin, J.E., Schroder, K., Su, A.I., Walker, J.R., Zhang, J., Wiltshire, T., Saijo, K., Glass, C.K., Hume, D.A., Kellie, S., and Sweet, M.J. (2008). Expression analysis of G Protein-Coupled Receptors in mouse macrophages. Immunome Res. 4, 5. Lazetic, S., Chang, C., Houchins, J.P., Lanier, L.L., and Phillips, J.H. (1996). Human natural killer cell receptors involved in MHC class I recognition are disulfide-linked heterodimers of CD94 and NKG2 subunits. J. Immunol. 157, 4741-4745. Lee, N., Llano, M., Carretero, M., Ishitani, A., Navarro, F., Lopez-Botet, M., and Geraghty, D.E. (1998). HLA-E is a major ligand for the natural killer inhibitory receptor CD94/NKG2A. Proc. Natl. Acad. Sci. U. S. A. 95, 5199-5204. Lee, S.H., Miyagi, T., and Biron, C.A. (2007). Keeping NK cells in highly regulated antiviral warfare. Trends Immunol. 28, 252-259. Lee, S.H., Zafer, A., de Repentigny, Y., Kothary, R., Tremblay, M.L., Gros, P., Duplay, P., Webb, J.R., and Vidal, S.M. (2003). Transgenic expression of the activating natural killer receptor Ly49H confers resistance to cytomegalovirus in genetically susceptible mice. J. Exp. Med. 197, 515-526. 117  Levanon, D., Bettoun, D., Harris-Cerruti, C., Woolf, E., Negreanu, V., Eilam, R., Bernstein, Y., Goldenberg, D., Xiao, C., Fliegauf, M., et al. (2002). The Runx3 transcription factor regulates development and survival of TrkC dorsal root ganglia neurons. EMBO J. 21, 3454-3463. Levanon, D., and Groner, Y. (2009). Runx3-deficient mouse strains circa 2008: resemblance and dissimilarity. Blood Cells Mol. Dis. 43, 1-5. Li, H., Pascal, V., Martin, M.P., Carrington, M., and Anderson, S.K. (2008). Genetic control of variegated KIR gene expression: polymorphisms of the bi-directional KIR3DL1 promoter are associated with distinct frequencies of gene expression. PLoS Genet. 4, e1000254. Li, X.R., Chong, A.S., Wu, J., Roebuck, K.A., Kumar, A., Parrillo, J.E., Rapp, U.R., Kimberly, R.P., Williams, J.W., and Xu, X. (1999). Transcriptional regulation of Fas gene expression by GA-binding protein and AP-1 in T cell antigen receptor.CD3 complex-stimulated T cells. J. Biol. Chem. 274, 35203-35210. Lin, J.X., Bhat, N.K., John, S., Queale, W.S., and Leonard, W.J. (1993). Characterization of the human interleukin-2 receptor beta-chain gene promoter: regulation of promoter activity by ets gene products. Mol. Cell. Biol. 13, 6201-6210. Ljunggren, H.G., and Malmberg, K.J. (2007). Prospects for the use of NK cells in immunotherapy of human cancer. Nat. Rev. Immunol. 7, 329-339. Lopez-Verges, S., Milush, J.M., Schwartz, B.S., Pando, M.J., Jarjoura, J., York, V.A., Houchins, J.P., Miller, S., Kang, S.M., Norris, P.J., Nixon, D.F., and Lanier, L.L. (2011). Expansion of a unique CD57+NKG2Chi natural killer cell subset during acute human cytomegalovirus infection. Proc. Natl. Acad. Sci. U. S. A. 108, 14725-14732. Maksakova, I.A., and Mager, D.L. (2005). Transcriptional regulation of early transposon elements, an active family of mouse long terminal repeat retrotransposons. J. Virol. 79, 1386513874. Malarkannan, S., Regunathan, J., Chu, H., Kutlesa, S., Chen, Y., Zeng, H., Wen, R., and Wang, D. (2007). Bcl10 plays a divergent role in NK cell-mediated cytotoxicity and cytokine generation. J. Immunol. 179, 3752-3762. Mandelboim, O., Lieberman, N., Lev, M., Paul, L., Arnon, T.I., Bushkin, Y., Davis, D.M., Strominger, J.L., Yewdell, J.W., and Porgador, A. (2001). Recognition of haemagglutinins on virus-infected cells by NKp46 activates lysis by human NK cells. Nature 409, 1055-1060. Markiewicz, S., Bosselut, R., Le Deist, F., de Villartay, J.P., Hivroz, C., Ghysdael, J., Fischer, A., and de Saint Basile, G. (1996). Tissue-specific activity of the gammac chain gene promoter depends upon an Ets binding site and is regulated by GA-binding protein. J. Biol. Chem. 271, 14849-14855. 118  Marusina, A.I., Kim, D.K., Lieto, L.D., Borrego, F., and Coligan, J.E. (2005). GATA-3 is an important transcription factor for regulating human NKG2A gene expression. J. Immunol. 174, 2152-2159. McQueen, K.L., Freeman, J.D., Takei, F., and Mager, D.L. (1998). Localization of five new Ly49 genes, including three closely related to Ly49c. Immunogenetics 48, 174-183. McQueen, K.L., and Parham, P. (2002). Variable receptors controlling activation and inhibition of NK cells. Curr. Opin. Immunol. 14, 615-621. McQueen, K.L., Wilhelm, B.T., Takei, F., and Mager, D.L. (2001). Functional analysis of 5' and 3' regions of the closely related Ly49c and j genes. Immunogenetics 52, 212-223. Moretta, A., Sivori, S., Vitale, M., Pende, D., Morelli, L., Augugliaro, R., Bottino, C., and Moretta, L. (1995). Existence of both inhibitory (p58) and activatory (p50) receptors for HLA-C molecules in human natural killer cells. J. Exp. Med. 182, 875-884. Moretta, A., Vitale, M., Bottino, C., Orengo, A.M., Morelli, L., Augugliaro, R., Barbaresi, M., Ciccone, E., and Moretta, L. (1993). P58 molecules as putative receptors for major histocompatibility complex (MHC) class I molecules in human natural killer (NK) cells. Antip58 antibodies reconstitute lysis of MHC class I-protected cells in NK clones displaying different specificities. J. Exp. Med. 178, 597-604. Morita, S., Kojima, T., and Kitamura, T. (2000). Plat-E: an efficient and stable system for transient packaging of retroviruses. Gene Ther. 7, 1063-1066. Mulrooney, T.J., Hou, L., Steiner, N.K., Chen, M., Belle, I., Ng, J., and Hurley, C.K. (2008). Promoter variants of KIR2DL5 add to diversity and may impact gene expression. Immunogenetics 60, 287-294. Musikacharoen, T., Oguma, A., Yoshikai, Y., Chiba, N., Masuda, A., and Matsuguchi, T. (2005). Interleukin-15 induces IL-12 receptor beta1 gene expression through PU.1 and IRF 3 by targeting chromatin remodeling. Blood 105, 711-720. Narni-Mancinelli, E., Chaix, J., Fenis, A., Kerdiles, Y.M., Yessaad, N., Reynders, A., Gregoire, C., Luche, H., Ugolini, S., Tomasello, E., Walzer, T., and Vivier, E. (2011). Fate mapping analysis of lymphoid cells expressing the NKp46 cell surface receptor. Proc. Natl. Acad. Sci. U. S. A. Nausch, N., and Cerwenka, A. (2008). NKG2D ligands in tumor immunity. Oncogene 27, 59445958. Ogasawara, K., Hamerman, J.A., Ehrlich, L.R., Bour-Jordan, H., Santamaria, P., Bluestone, J.A., and Lanier, L.L. (2004). NKG2D blockade prevents autoimmune diabetes in NOD mice. Immunity 20, 757-767. 119  Ohno, S., Sato, T., Kohu, K., Takeda, K., Okumura, K., Satake, M., and Habu, S. (2008). Runx proteins are involved in regulation of CD122, Ly49 family and IFN-gamma expression during NK cell differentiation. Int. Immunol. 20, 71-79. Orange, J.S. (2006). Human natural killer cell deficiencies. Curr. Opin. Allergy Clin. Immunol. 6, 399-409. Park, J.H., Adoro, S., Guinter, T., Erman, B., Alag, A.S., Catalfamo, M., Kimura, M.Y., Cui, Y., Lucas, P.J., Gress, R.E., et al. (2010). Signaling by intrathymic cytokines, not T cell antigen receptors, specifies CD8 lineage choice and promotes the differentiation of cytotoxic-lineage T cells. Nat. Immunol. 11, 257-264. Pascal, V., Nathan, N.R., Claudio, E., Siebenlist, U., and Anderson, S.K. (2007). NF-kappa B p50/p65 affects the frequency of Ly49 gene expression by NK cells. J. Immunol. 179, 17511759. Pende, D., Parolini, S., Pessino, A., Sivori, S., Augugliaro, R., Morelli, L., Marcenaro, E., Accame, L., Malaspina, A., Biassoni, R., et al. (1999). Identification and molecular characterization of NKp30, a novel triggering receptor involved in natural cytotoxicity mediated by human natural killer cells. J. Exp. Med. 190, 1505-1516. Perez-Moreno, M.A., Locascio, A., Rodrigo, I., Dhondt, G., Portillo, F., Nieto, M.A., and Cano, A. (2001). A new role for E12/E47 in the repression of E-cadherin expression and epithelialmesenchymal transitions. J. Biol. Chem. 276, 27424-27431. Pessino, A., Sivori, S., Bottino, C., Malaspina, A., Morelli, L., Moretta, L., Biassoni, R., and Moretta, A. (1998). Molecular cloning of NKp46: a novel member of the immunoglobulin superfamily involved in triggering of natural cytotoxicity. J. Exp. Med. 188, 953-960. Pogge von Strandmann, E., Simhadri, V.R., von Tresckow, B., Sasse, S., Reiners, K.S., Hansen, H.P., Rothe, A., Boll, B., Simhadri, V.L., Borchmann, P., et al. (2007). Human leukocyte antigen-B-associated transcript 3 is released from tumor cells and engages the NKp30 receptor on natural killer cells. Immunity 27, 965-974. Presnell, S.R., Zhang, L., Ramilo, C.A., Chan, H.W., and Lutz, C.T. (2006). Functional redundancy of transcription factor-binding sites in the killer cell Ig-like receptor (KIR) gene promoter. Int. Immunol. 18, 1221-1232. Raulet, D.H. (2003). Roles of the NKG2D immunoreceptor and its ligands. Nat Rev Immunol 3, 781-90. Raulet, D.H., Held, W., Correa, I., Dorfman, J.R., Wu, M.F., and Corral, L. (1997). Specificity, tolerance and developmental regulation of natural killer cells defined by expression of class Ispecific Ly49 receptors. Immunol. Rev. 155, 41-52. 120  Regunathan, J., Chen, Y., Wang, D., and Malarkannan, S. (2005). NKG2D receptor-mediated NK cell function is regulated by inhibitory Ly49 receptors. Blood 105, 233-240. Rini, D., and Calabi, F. (2001). Identification and comparative analysis of a second runx3 promoter. Gene 273, 13-22. Ristevski, S., O'Leary, D.A., Thornell, A.P., Owen, M.J., Kola, I., and Hertzog, P.J. (2004). The ETS transcription factor GABPalpha is essential for early embryogenesis. Mol. Cell. Biol. 24, 5844-5849. Rogers, S.L., Rouhi, A., Takei, F., and Mager, D.L. (2006). A role for DNA hypomethylation and histone acetylation in maintaining allele-specific expression of mouse NKG2A in developing and mature NK cells. J Immunol 177, 414-21. Roman, A.C., Benitez, D.A., Carvajal-Gonzalez, J.M., and Fernandez-Salguero, P.M. (2008). Genome-wide B1 retrotransposon binds the transcription factors dioxin receptor and Slug and regulates gene expression in vivo. Proc. Natl. Acad. Sci. U. S. A. 105, 1632-1637. Roose, J., and Clevers, H. (1999). TCF transcription factors: molecular switches in carcinogenesis. Biochim. Biophys. Acta 1424, M23-37. Rosmarin, A.G., Caprio, D.G., Kirsch, D.G., Handa, H., and Simkevich, C.P. (1995). GABP and PU.1 compete for binding, yet cooperate to increase CD18 (beta 2 leukocyte integrin) transcription. J. Biol. Chem. 270, 23627-23633. Rouhi, A., Brooks, C.G., Takei, F., and Mager, D.L. (2007). Plasticity of Ly49g expression is due to epigenetics. Mol Immunol 44, 821-6. Rouhi, A., Gagnier, L., Takei, F., and Mager, D.L. (2006). Evidence for epigenetic maintenance of Ly49a monoallelic gene expression. J. Immunol. 176, 2991-2999. Rouhi, A., Lai, C.B., Cheng, T.P., Takei, F., Yokoyama, W.M., and Mager, D.L. (2009). Evidence for high bi-allelic expression of activating Ly49 receptors. Nucleic Acids Res. 37, 5331-5342. Saleh, A., Davies, G.E., Pascal, V., Wright, P.W., Hodge, D.L., Cho, E.H., Lockett, S.J., Abshari, M., and Anderson, S.K. (2004). Identification of probabilistic transcriptional switches in the Ly49 gene cluster: a eukaryotic mechanism for selective gene activation. Immunity 21, 5566. Saleh, A., Makrigiannis, A.P., Hodge, D.L., and Anderson, S.K. (2002). Identification of a novel Ly49 promoter that is active in bone marrow and fetal thymus. J. Immunol. 168, 5163-5169. Salih, H.R., Rammensee, H.G., and Steinle, A. (2002). Cutting edge: down-regulation of MICA on human tumors by proteolytic shedding. J. Immunol. 169, 4098-4102. 121  Santourlidis, S., Graffmann, N., Christ, J., and Uhrberg, M. (2008). Lineage-specific transition of histone signatures in the killer cell Ig-like receptor locus from hematopoietic progenitor to NK cells. J. Immunol. 180, 418-425. Santourlidis, S., Trompeter, H.I., Weinhold, S., Eisermann, B., Meyer, K.L., Wernet, P., and Uhrberg, M. (2002). Crucial role of DNA methylation in determination of clonally distributed killer cell Ig-like receptor expression patterns in NK cells. J. Immunol. 169, 4253-4261. Sato, K., Hida, S., Takayanagi, H., Yokochi, T., Kayagaki, N., Takeda, K., Yagita, H., Okumura, K., Tanaka, N., Taniguchi, T., and Ogasawara, K. (2001). Antiviral response by natural killer cells through TRAIL gene induction by IFN-alpha/beta. Eur. J. Immunol. 31, 3138-3146. Sato, T., Ohno, S., Hayashi, T., Sato, C., Kohu, K., Satake, M., and Habu, S. (2005). Dual functions of Runx proteins for reactivating CD8 and silencing CD4 at the commitment process into CD8 thymocytes. Immunity 22, 317-328. Schleinitz, N., Vely, F., Harle, J.R., and Vivier, E. (2010). Natural killer cells in human autoimmune diseases. Immunology 131, 451-458. Shimokawa, T., and Ra, C. (2005). C/EBPalpha functionally and physically interacts with GABP to activate the human myeloid IgA Fc receptor (Fc alphaR, CD89) gene promoter. Blood 106, 2534-2542. Sivori, S., Pende, D., Bottino, C., Marcenaro, E., Pessino, A., Biassoni, R., Moretta, L., and Moretta, A. (1999). NKp46 is the major triggering receptor involved in the natural cytotoxicity of fresh or cultured human NK cells. Correlation between surface density of NKp46 and natural cytotoxicity against autologous, allogeneic or xenogeneic target cells. Eur. J. Immunol. 29, 16561666. Sivori, S., Vitale, M., Morelli, L., Sanseverino, L., Augugliaro, R., Bottino, C., Moretta, L., and Moretta, A. (1997). P46, a Novel Natural Killer Cell-Specific Surface Molecule that Mediates Cell Activation. J. Exp. Med. 186, 1129-1136. Smith, H.R., Chuang, H.H., Wang, L.L., Salcedo, M., Heusel, J.W., and Yokoyama, W.M. (2000). Nonstochastic coexpression of activation receptors on murine natural killer cells. J. Exp. Med. 191, 1341-1354. Smith, H.R., Heusel, J.W., Mehta, I.K., Kim, S., Dorner, B.G., Naidenko, O.V., Iizuka, K., Furukawa, H., Beckman, D.L., Pingel, J.T., et al. (2002). Recognition of a virus-encoded ligand by a natural killer cell activation receptor. Proc. Natl. Acad. Sci. U. S. A. 99, 8826-8831. Smith, H.R., Idris, A.H., and Yokoyama, W.M. (2001). Murine natural killer cell activation receptors. Immunol. Rev. 181, 115-125.  122  Smyth, M.J., Swann, J., Cretney, E., Zerafa, N., Yokoyama, W.M., and Hayakawa, Y. (2005). NKG2D function protects the host from tumor initiation. J. Exp. Med. 202, 583-588. Spender, L.C., Cornish, G.H., Sullivan, A., and Farrell, P.J. (2002). Expression of transcription factor AML-2 (RUNX3, CBF(alpha)-3) is induced by Epstein-Barr virus EBNA-2 and correlates with the B-cell activation phenotype. J. Virol. 76, 4919-4927. Spits, H., and Di Santo, J.P. (2011). The expanding family of innate lymphoid cells: regulators and effectors of immunity and tissue remodeling. Nat. Immunol. 12, 21-27. Stewart, C.A., Van Bergen, J., and Trowsdale, J. (2003). Different and divergent regulation of the KIR2DL4 and KIR3DL1 promoters. J. Immunol. 170, 6073-6081. Stewart, C.A., Walzer, T., Robbins, S.H., Malissen, B., Vivier, E., and Prinz, I. (2007). Germline and rearranged Tcrd transcription distinguish bona fide NK cells and NK-like gammadelta T cells. Eur. J. Immunol. 37, 1442-1452. Storset, A.K., Kulberg, S., Berg, I., Boysen, P., Hope, J.C., and Dissen, E. (2004). NKp46 defines a subset of bovine leukocytes with natural killer cell characteristics. Eur. J. Immunol. 34, 669-676. Stulberg, M.J., Wright, P.W., Dang, H., Hanson, R.J., Miller, J.S., and Anderson, S.K. (2007). Identification of distal KIR promoters and transcripts. Genes Immun. 8, 124-130. Su, A.I., Wiltshire, T., Batalov, S., Lapp, H., Ching, K.A., Block, D., Zhang, J., Soden, R., Hayakawa, M., Kreiman, G., et al. (2004). A gene atlas of the mouse and human proteinencoding transcriptomes. Proc. Natl. Acad. Sci. U. S. A. 101, 6062-6067. Sucharov, C., Basu, A., Carter, R.S., and Avadhani, N.G. (1995). A novel transcriptional initiator activity of the GABP factor binding ets sequence repeat from the murine cytochrome c oxidase Vb gene. Gene Expr. 5, 93-111. Sun, J.C., Beilke, J.N., and Lanier, L.L. (2009). Adaptive immune features of natural killer cells. Nature 457, 557-561. Takahashi, K., Hayashi, N., Shimokawa, T., Umehara, N., Kaminogawa, S., and Ra, C. (2008). Cooperative regulation of Fc receptor gamma-chain gene expression by multiple transcription factors, including Sp1, GABP, and Elf-1. J. Biol. Chem. 283, 15134-15141. Takeda, K., Hayakawa, Y., Smyth, M.J., Kayagaki, N., Yamaguchi, N., Kakuta, S., Iwakura, Y., Yagita, H., and Okumura, K. (2001). Involvement of tumor necrosis factor-related apoptosisinducing ligand in surveillance of tumor metastasis by liver natural killer cells. Nat. Med. 7, 94100.  123  Takei, F. (1983). Two surface antigens expressed on proliferating mouse T lymphocytes defined by rat monoclonal antibodies. J. Immunol. 130, 2794-2797. Takei, F., McQueen, K.L., Maeda, M., Wilhelm, B.T., Lohwasser, S., Lian, R.H., and Mager, D.L. (2001). Ly49 and CD94/NKG2: developmentally regulated expression and evolution. Immunol. Rev. 181, 90-103. Tang, Q., Grzywacz, B., Wang, H., Kataria, N., Cao, Q., Wagner, J.E., Blazar, B.R., Miller, J.S., and Verneris, M.R. (2008). Umbilical cord blood T cells express multiple natural cytotoxicity receptors after IL-15 stimulation, but only NKp30 is functional. J. Immunol. 181, 4507-4515. Taniuchi, I., Osato, M., Egawa, T., Sunshine, M.J., Bae, S.C., Komori, T., Ito, Y., and Littman, D.R. (2002). Differential requirements for Runx proteins in CD4 repression and epigenetic silencing during T lymphocyte development. Cell 111, 621-633. Tassi, I., Klesney-Tait, J., and Colonna, M. (2006). Dissecting natural killer cell activation pathways through analysis of genetic mutations in human and mouse. Immunol. Rev. 214, 92105. Thiery, J., Keefe, D., Boulant, S., Boucrot, E., Walch, M., Martinvalet, D., Goping, I.S., Bleackley, R.C., Kirchhausen, T., and Lieberman, J. (2011). Perforin pores in the endosomal membrane trigger the release of endocytosed granzyme B into the cytosol of target cells. Nat. Immunol. 12, 770-777. Trompeter, H.I., Gomez-Lozano, N., Santourlidis, S., Eisermann, B., Wernet, P., Vilches, C., and Uhrberg, M. (2005). Three structurally and functionally divergent kinds of promoters regulate expression of clonally distributed killer cell Ig-like receptors (KIR), of KIR2DL4, and of KIR3DL3. J. Immunol. 174, 4135-4143. Trundley, A.E., Hiby, S.E., Chang, C., Sharkey, A.M., Santourlidis, S., Uhrberg, M., Trowsdale, J., and Moffett, A. (2006). Molecular characterization of KIR3DL3. Immunogenetics 57, 904916. Uhrberg, M., Valiante, N.M., Young, N.T., Lanier, L.L., Phillips, J.H., and Parham, P. (2001). The repertoire of killer cell Ig-like receptor and CD94:NKG2A receptors in T cells: clones sharing identical alpha beta TCR rearrangement express highly diverse killer cell Ig-like receptor patterns. J. Immunol. 166, 3923-3932. Valiante, N.M., Uhrberg, M., Shilling, H.G., Lienert-Weidenbach, K., Arnett, K.L., D'Andrea, A., Phillips, J.H., Lanier, L.L., and Parham, P. (1997). Functionally and structurally distinct NK cell receptor repertoires in the peripheral blood of two human donors. Immunity 7, 739-751. Valouev, A., Johnson, D.S., Sundquist, A., Medina, C., Anton, E., Batzoglou, S., Myers, R.M., and Sidow, A. (2008). Genome-wide analysis of transcription factor binding sites based on ChIPSeq data. Nat. Methods 5, 829-834. 124  van Bergen, J., Stewart, C.A., van den Elsen, P.J., and Trowsdale, J. (2005). Structural and functional differences between the promoters of independently expressed killer cell Ig-like receptors. Eur. J. Immunol. 35, 2191-2199. van de Lagemaat, L.N., Landry, J.R., Mager, D.L., and Medstrand, P. (2003). Transposable elements in mammals promote regulatory variation and diversification of genes with specialized functions. Trends Genet. 19, 530-536. Vance, R.E., Kraft, J.R., Altman, J.D., Jensen, P.E., and Raulet, D.H. (1998). Mouse CD94/NKG2A is a natural killer cell receptor for the nonclassical major histocompatibility complex (MHC) class I molecule Qa-1(b). J. Exp. Med. 188, 1841-1848. Vilches, C., Gardiner, C.M., and Parham, P. (2000). Gene structure and promoter variation of expressed and nonexpressed variants of the KIR2DL5 gene. J. Immunol. 165, 6416-6421. Vitale, M., Bottino, C., Sivori, S., Sanseverino, L., Castriconi, R., Marcenaro, E., Augugliaro, R., Moretta, L., and Moretta, A. (1998). NKp44, a novel triggering surface molecule specifically expressed by activated natural killer cells, is involved in non-major histocompatibility complexrestricted tumor cell lysis. J. Exp. Med. 187, 2065-2072. Walzer, T., Blery, M., Chaix, J., Fuseri, N., Chasson, L., Robbins, S.H., Jaeger, S., Andre, P., Gauthier, L., Daniel, L., et al. (2007). Identification, activation, and selective in vivo ablation of mouse NK cells via NKp46. Proc. Natl. Acad. Sci. U. S. A. 104, 3384-3389. Wang, L., Wildt, K.F., Castro, E., Xiong, Y., Feigenbaum, L., Tessarollo, L., and Bosselut, R. (2008). The zinc finger transcription factor Zbtb7b represses CD8-lineage gene expression in peripheral CD4+ T cells. Immunity 29, 876-887. Wang, T., Zeng, J., Lowe, C.B., Sellers, R.G., Salama, S.R., Yang, M., Burgess, S.M., Brachmann, R.K., and Haussler, D. (2007). Species-specific endogenous retroviruses shape the transcriptional network of the human tumor suppressor protein p53. Proc. Natl. Acad. Sci. U. S. A. 104, 18613-18618. Wederell, E.D., Bilenky, M., Cullum, R., Thiessen, N., Dagpinar, M., Delaney, A., Varhol, R., Zhao, Y., Zeng, T., Bernier, B., et al. (2008). Global analysis of in vivo Foxa2-binding sites in mouse adult liver using massively parallel sequencing. Nucleic Acids Res. 36, 4549-4564. Weigelt, K., Ernst, W., Walczak, Y., Ebert, S., Loenhardt, T., Klug, M., Rehli, M., Weber, B.H., and Langmann, T. (2007). Dap12 expression in activated microglia from retinoschisin-deficient retina and its PU.1-dependent promoter regulation. J. Leukoc. Biol. 82, 1564-1574. Westgaard, I.H., Berg, S.F., Vaage, J.T., Wang, L.L., Yokoyama, W.M., Dissen, E., and Fossum, S. (2004). Rat NKp46 activates natural killer cell cytotoxicity and is associated with FcepsilonRIgamma and CD3zeta. J. Leukoc. Biol. 76, 1200-1206. 125  Wiemann, K., Mittrucker, H.W., Feger, U., Welte, S.A., Yokoyama, W.M., Spies, T., Rammensee, H.G., and Steinle, A. (2005). Systemic NKG2D down-regulation impairs NK and CD8 T cell responses in vivo. J. Immunol. 175, 720-729. Wilhelm, B.T., McQueen, K.L., Freeman, J.D., Takei, F., and Mager, D.L. (2001). Comparative analysis of the promoter regions and transcriptional start sites of mouse Ly49 genes. Immunogenetics 53, 215-224. Williams, N.S., Klem, J., Puzanov, I.J., Sivakumar, P.V., Schatzle, J.D., Bennett, M., and Kumar, V. (1998). Natural killer cell differentiation: insights from knockout and transgenic mouse models and in vitro systems. Immunol. Rev. 165, 47-61. Wong, S., Freeman, J.D., Kelleher, C., Mager, D., and Takei, F. (1991). Ly-49 multigene family. New members of a superfamily of type II membrane proteins with lectin-like domains. J. Immunol. 147, 1417-1423. Woolf, E., Xiao, C., Fainaru, O., Lotem, J., Rosen, D., Negreanu, V., Bernstein, Y., Goldenberg, D., Brenner, O., Berke, G., Levanon, D., and Groner, Y. (2003). Runx3 and Runx1 are required for CD8 T cell development during thymopoiesis. Proc. Natl. Acad. Sci. U. S. A. 100, 77317736. Wu, C., Orozco, C., Boyer, J., Leglise, M., Goodale, J., Batalov, S., Hodge, C.L., Haase, J., Janes, J., Huss, J.W.,3rd, and Su, A.I. (2009). BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources. Genome Biol. 10, R130. Wu, J., Cherwinski, H., Spies, T., Phillips, J.H., and Lanier, L.L. (2000). DAP10 and DAP12 form distinct, but functionally cooperative, receptor complexes in natural killer cells. J. Exp. Med. 192, 1059-1068. Xu, J., Vallejo, A.N., Jiang, Y., Weyand, C.M., and Goronzy, J.J. (2005). Distinct transcriptional control mechanisms of killer immunoglobulin-like receptors in natural killer (NK) and in T cells. J. Biol. Chem. 280, 24277-24285. Xue, H.H., Bollenbacher, J., Rovella, V., Tripuraneni, R., Du, Y.B., Liu, C.Y., Williams, A., McCoy, J.P., and Leonard, W.J. (2004). GA binding protein regulates interleukin 7 receptor alpha-chain gene expression in T cells. Nat. Immunol. 5, 1036-1044. Xue, H.H., Bollenbacher-Reilley, J., Wu, Z., Spolski, R., Jing, X., Zhang, Y.C., McCoy, J.P., and Leonard, W.J. (2007). The transcription factor GABP is a critical regulator of B lymphocyte development. Immunity 26, 421-431. Yagi, R., Junttila, I.S., Wei, G., Urban, J.F.,Jr, Zhao, K., Paul, W.E., and Zhu, J. (2010). The transcription factor GATA3 actively represses RUNX3 protein-regulated production of interferon-gamma. Immunity 32, 507-517. 126  Yang, Z.F., Mott, S., and Rosmarin, A.G. (2007). The Ets transcription factor GABP is required for cell-cycle progression. Nat. Cell Biol. 9, 339-346. Yokoyama, W.M., Jacobs, L.B., Kanagawa, O., Shevach, E.M., and Cohen, D.I. (1989). A murine T lymphocyte antigen belongs to a supergene family of type II integral membrane proteins. J. Immunol. 143, 1379-1386. Yu, J., Mitsui, T., Wei, M., Mao, H., Butchar, J.P., Shah, M.V., Zhang, J., Mishra, A., AlvarezBreckenridge, C., Liu, X., et al. (2011). NKp46 identifies an NKT cell subset susceptible to leukemic transformation in mouse and human. J. Clin. Invest. 121, 1456-1470. Yu, S., Zhao, D.M., Jothi, R., and Xue, H.H. (2010). Critical requirement of GABPalpha for normal T cell development. J. Biol. Chem. 285, 10179-10188. Zafirova, B., Mandaric, S., Antulov, R., Krmpotic, A., Jonsson, H., Yokoyama, W.M., Jonjic, S., and Polic, B. (2009). Altered NK cell development and enhanced NK cell-mediated resistance to mouse cytomegalovirus in NKG2D-deficient mice. Immunity 31, 270-282. Zamisch, M., Tian, L., Grenningloh, R., Xiong, Y., Wildt, K.F., Ehlers, M., Ho, I.C., and Bosselut, R. (2009). The transcription factor Ets1 is important for CD4 repression and Runx3 upregulation during CD8 T cell differentiation in the thymus. J. Exp. Med. 206, 2685-2699. Zompi, S., Hamerman, J.A., Ogasawara, K., Schweighoffer, E., Tybulewicz, V.L., Di Santo, J.P., Lanier, L.L., and Colucci, F. (2003). NKG2D triggers cytotoxicity in mouse NK cells lacking DAP12 or Syk family kinases. Nat Immunol 4, 565-72.  127  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0103444/manifest

Comment

Related Items