Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Role of heat shock protein 27 and Lyn tyrosine kinase in regulation of androgen receptor expression and… Zardan, Anousheh 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2012_spring_zardan_anousheh.pdf [ 9.98MB ]
Metadata
JSON: 24-1.0103441.json
JSON-LD: 24-1.0103441-ld.json
RDF/XML (Pretty): 24-1.0103441-rdf.xml
RDF/JSON: 24-1.0103441-rdf.json
Turtle: 24-1.0103441-turtle.txt
N-Triples: 24-1.0103441-rdf-ntriples.txt
Original Record: 24-1.0103441-source.json
Full Text
24-1.0103441-fulltext.txt
Citation
24-1.0103441.ris

Full Text

ROLE OF HEAT SHOCK PROTEIN 27 AND LYN TYROSINE KINASE  IN REGULATION OF ANDROGEN RECEPTOR EXPRESSION AND ACTIVITY  IN PROSTATE CANCER  by  Anousheh Zardan  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF  THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  The Faculty of Graduate Studies  (Experimental Medicine)    THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)  April 2012  © Anousheh Zardan, 2012   ii  Abstract  Prostate Cancer (PCa) is the most common male cancer and the second leading cause of  cancer‐related deaths  in North America. While many gains have been made  in early detection  and treatment of localized PCa, many men still die of the metastatic disease. Androgen ablation  therapy remains the most effective therapy for patients with advanced disease. While ~80% of  patients  respond  initially  to  this  treatment,  most  patients  progress  to  Castrate  Resistant  Prostate Cancer (CRPC) stage. Current literature indicates that CRPC tumours are not uniformly  hormone  refractory  and  may  remain  sensitive  to  therapies  directed  against  the  AR  axis.  Therefore,  several  new  classes  of  AR‐targeting  agents  are  now  in  clinical  development,  including  more  potent  AR  antagonists  (MDV3100)  and  inhibitors  of  steroidogenesis  (abiraterone).  Although  enthusiasm  for  this  approach  remains  high,  prostate  tumour  heterogeneity and  the  inevitable development of  resistance dictates a critical need  to better  understand the mechanisms of resistance in which AR remain active.   In the current doctoral thesis role of heat shock protein (Hsp) 27 and Lyn tyrosine kinase  in regulation of AR protein expression was investigated. The central hypothesis is that increased  expression and activity of Hsp27 and Lyn kinase stabilizes and activates AR protein and leads to  prostate cancer progression through promoting prostate cancer cell survival.  Three  specific  objectives  were  accomplished  in  this  thesis.  First,  the  relationship  between Hsp27  and AR was  studied.  To  this  end,  it was  demonstrated  that  expression  and  iii  activity  of Hsp27  via  a  nongenomic mechanism  regulates  AR  protein  stability,  shuttling  and  transcriptional activity.  In the next step, the underlying molecular mechanisms through which  Lyn  tyrosine  kinase  regulates AR activity  in  the  castrated environment was  investigated. The  experiments demonstrated that Lyn kinase regulates AR protein expression and transcriptional  activity and that it plays a key role in PCa progression to the castrated resistant stage. Finally, a  novel role for Lyn kinase in Epidermal Growth Factor‐mediated (EGF‐mediated) AR activity was  defined.   The  results obtained  in  this  thesis defined new pathways  involved  in  regulation of AR  protein  stability  and  justified  further  investigation  of  Hsp27  and  Lyn  kinase  as  therapeutic  targets for CRPC.              iv  Preface  The  publications  presented  in  this  thesis  are  based  on  the  work  that  I  carried  out  towards  the  completion  of my  PhD  program. Manuscripts  listed  in  this  thesis  either  have  already been published or will be submitted for publication as co‐authored works.  A version of  chapter 2 of  this  thesis has been published  in Cancer Research as noted  below:   Chapter 2: Cooperative  interactions between androgen receptor and Hsp27 facilitate  AR  transcriptional  activity.  Amina  Zoubeidi,  Anousheh  Zardan,  Eliana  Beraldi,  Ladan  Fazli,  Richard Sowery, Paul S. Rennie, Colleen C. Nelson, Martin E. Gleave, Cancer Research. 2007 Nov  1;67(21):10455‐65. Dr. Martin Gleave was  the  principal  investigator  of  this manuscript.  The  main  idea  of  studying  the  interaction  between Hsp27  and AR was  introduced  by Dr. Amina  Zoubeidi.  I  designed  and  performed  all  the  in  vitro  experiments  to  demonstrate  a)  the  interaction  between  AR/Hsp27  and  b)  the  role  of Hsp27  on  AR  protein  stability. Dr.  Amina  Zoubeidi designed and performed all the experiments to demonstrate the role of Hsp27 on AR  transcriptional activity (transactivation assays, immunofluorescence, EMSA). Mrs. Eliana Beraldi  performed the ChIP analysis. Ms. Virginia Yago and Ms. Mary Bowden helped with the  in vivo  experiments. Preparation and analysis of protein samples  from  tumours was done by myself.  Dr. Ladan Fazli, the research pathologist at the Vancouver Prostate Centre, was involved in the  analysis  of  all  the  immunohistochemistry  staining  of  prostate  tissues.  Dr.  Amina  Zoubeidi  v  drafted the manuscript and finalized it for publication. Dr. Richard Sowery, Dr. Paul Rennie, Dr.  Colleen Nelson and Dr. Martin Gleave reviewed the work and provided insightful comments.  Chapter 3: Lyn tyrosine kinase regulates androgen receptor expression and activity in  castrate  resistant prostate cancer. Anousheh Zardan, Eliana Beraldi, Ladan Fazli, KaMun Nip,  Michael E. Cox, Martin E. Gleave and Amina Zoubeidi. A version of chapter 3 will be submitted  for publication. Dr. Amina Zoubeidi was the principal investigator for the manuscript. All the in  vitro and in vivo experiments performed in this chapter were designed, performed and analyzed  by myself and reviewed by Dr. Amina Zoubeidi and Dr. Michael Cox. Ms. Kamun Nip provided  some help with the initial western blot analysis and Mrs. Eliana Beraldi performed the caspase‐ 3 activity assay. Ms. Virginia Yago and Mr.  Igor Moskalev were  involved  in mice bleeding. Dr.  Ladan  Fazli  analyzed  all  of  the  immunohistochemistry  staining  of  the  prostate  tissues.  Dr.  Martin Gleave reviewed the data and provided helpful comments. The manuscript was drafted  by myself and reviewed by Dr. Amina Zoubeidi, Dr. Michael Cox and Dr. Martin Gleave.   Chapter  4:  Lyn  tyrosine  kinase  promotes  castration  resistant  prostate  cancer  progression through EGF‐mediated phosphorylation of androgen receptor. Anousheh Zardan,  Eliana  Beraldi, Martin  Gleave, Michael  Cox,  Amina  Zoubedi.  A  version  of  chapter  4 will  be  submitted for publication. Dr. Amina Zoubeidi is the principal investigator of this manuscript. All  the experiments  in this chapter were designed, performed and analyzed by myself, Anousheh  Zardan,  and  reviewed by Dr. Amina  Zoubeidi. Mrs.  Eliana Beraldi helped with  the  caspase‐3  activity assay. The manuscript was drafted by myself and reviewed by Dr. Amina Zoubeidi, Dr.  Michael Cox and Dr. Martin Gleave.   vi  The  work  presented  in  this  thesis  has  been  carried  out  with  the  approval  of  the  University of British Columbia Animal Care and Ethics Board Committees under  the  following  certificate numbers respectively: A10 – 0165, 4597 – 11.      vii  Table of Contents  Abstract ................................................................................................................................ii  Preface ................................................................................................................................ iv  Table of Contents ............................................................................................................... vii  List of Figures ....................................................................................................................... x  List of Abbreviations .......................................................................................................... xii  Acknowledgements ........................................................................................................... xvi  CHAPTER 1:  Introduction ................................................................................................. 1  1.1  The Prostate ...................................................................................................................... 1  1.1.1  Origin, Anatomy and Function ................................................................................................... 1  1.1.2  Histology and Cells ..................................................................................................................... 2  1.2  Androgens ......................................................................................................................... 5  1.2.1  Production, Function and Metabolism ....................................................................................... 5  1.3  Androgen‐Receptor (AR) ................................................................................................... 8  1.3.1  Structure, Biology and Function ................................................................................................. 8  1.3.2  AR Co‐Regulators (Co‐activator and Co‐Repressors) ............................................................... 12  1.4  Prostate Cancer (PCa) ..................................................................................................... 13  1.4.1  Development ............................................................................................................................ 13  1.4.2  Epidemiology and Risk Factors ................................................................................................. 13  1.4.3  Diagnosis and Prognosis ........................................................................................................... 15  1.5  Treatment ....................................................................................................................... 17  1.6  Development of Castration Resistant Prostate Cancer (CRPC) ....................................... 21  1.7  Chaperone Proteins ........................................................................................................ 27  1.7.1  Biology and Function ................................................................................................................ 27  1.7.2  Small Heat Shock Proteins (sHsps) ........................................................................................... 30  1.7.3  The Importance of Hsps in AR Stability and Function .............................................................. 30  1.7.4  Heat Shock Protein 27 (Hsp27) ................................................................................................ 31  1.8  Protein Kinases ................................................................................................................ 33  1.8.1  Tyrosine Kinases and Their Role in Cancer Progression ........................................................... 34  1.8.2  Tyrosine Kinases and Their Role and PCa ................................................................................. 35  1.8.3  Lyn Tyrosine Kinase .................................................................................................................. 36  1.9  Prostate Cancer Cell Line Models ................................................................................... 39  1.10  Thesis Hypothesis and Specific Objectives .................................................................. 40  viii  CHAPTER 2:  Cooperative  Interactions  between  Androgen  Receptor  and  Hsp27  Facilitate AR Transcriptional Activity ................................................................................ 45  2.1  Introduction .................................................................................................................... 45  2.2  Materials and Methods ................................................................................................... 47  2.2.1  Cell Culture and ASO Transfection ........................................................................................... 47  2.2.2  Plasmids and Reagents and Antibodies ................................................................................... 48  2.2.3  Cell Proliferation and Apoptosis Assays ................................................................................... 48  2.2.4  Western Blot Analysis and Immunoprecipitation .................................................................... 48  2.2.5  Immunofluorescence ............................................................................................................... 49  2.2.6  Transfection and Luciferase Assay ........................................................................................... 49  2.2.7  Northern Blot Analysis ............................................................................................................. 50  2.2.8  Electromobility Shift Assay (EMSA) .......................................................................................... 50  2.2.9  Chromatin Immunoprecipitation (ChIP) ................................................................................... 50  2.2.10  Reverse Transcription‐PCR ..................................................................................................... 51  2.2.11  Protein Stability ...................................................................................................................... 51  2.2.12  In vivo Imaging of Luciferase Activity ..................................................................................... 51  2.2.13  Animal Treatment .................................................................................................................. 52  2.3  Results ............................................................................................................................. 52  2.3.1  Androgens and Hsp27 Protect LNCaP Cells from Apoptotic Stress .......................................... 52  2.3.2  Androgens Lead to Rapid Hsp27 Phosphorylation via p38 MAPK Pathway ............................. 54  2.3.3  Androgen‐induced Hsp27 Phosphorylation is AR‐dependent .................................................. 57  2.3.4  Effect of Hsp27 on Genomic Activity of AR .............................................................................. 60  2.3.5  Hsp27 Knockdown Induces AR Degradation via the Proteasome‐mediated Pathway ............ 64  2.3.6  Hsp27 Knockdown Disrupts AR‐Hsp90 Association and  Increases AR‐MDM2 Association and  Ubiquitination ....................................................................................................................................... 68  2.3.7  In  vivo  Hsp27  Knockdown  by  OGX‐427  Decreases  LNCaP  Proliferation  Rates,  Serum  PSA  Levels, and AR Client Protein Expression Levels ................................................................................... 68  2.4  Discussion ........................................................................................................................ 72  CHAPTER 3:  Lyn Tyrosine Kinase Regulates Androgen Receptor Expression and Activity  in Castrate Resistant Prostate Cancer .............................................................................. 76  3.1  Introduction .................................................................................................................... 76  3.2  Materials and Methods ................................................................................................... 78  3.2.1  Cell Culture and siRNA Transfection ........................................................................................ 78  3.2.2  Plasmid, Reagents and Antibodies ........................................................................................... 78  3.2.3  Cell Proliferation and Apoptosis Assays ................................................................................... 79  3.2.4  Cell Cycle Analysis .................................................................................................................... 79  3.2.5  Transfection and Luciferase Assay ........................................................................................... 80  3.2.6  Chromatin Immunoprecipitation (ChIP) ................................................................................... 80  3.2.7  Quantitative Reverse Transcription‐PCR .................................................................................. 80  3.2.8  Protein Stability ........................................................................................................................ 81  3.2.9  Animal Treatment .................................................................................................................... 81  3.2.10  Immunohistochemistry Analysis ............................................................................................ 82  3.3  Results ............................................................................................................................. 83  3.3.1  Lyn Expression Is Increased with Progression to CRPC ............................................................ 83  ix  3.3.2  Lyn and p‐Lyn Y396 Expression Is Elevated in CRPC Specimens ................................................. 84  3.3.3  In vivo Lyn Over‐Expression Accelerates Castrate‐Resistant LNCaP Tumour Growth and Serum  PSA Relapse to Pre‐Castration Levels ................................................................................................... 86  3.3.4  Lyn Knockdown Leads to AR Degradation through the Proteasome‐Mediated Pathway ....... 90  3.3.5  Lyn Regulates AR Transcriptional Activity ................................................................................ 94  3.3.6  Lyn Knockdown Induces Cell Cycle Arrest and Apoptosis in LNCaP Cells ................................. 97  3.4  Discussion ........................................................................................................................ 99  CHAPTER 4:  Lyn  Tyrosine  Kinase  Promotes  Castration  Resistant  Prostate  Cancer  Progression through EGF‐Mediated Phosphorylation of Androgen Receptor ............... 102  4.1  Introduction .................................................................................................................. 102  4.2  Materials and Methods ................................................................................................. 104  4.2.1  Cell Culture and siRNA Transfection ...................................................................................... 104  4.2.2  Plasmid, Reagents and Antibodies ......................................................................................... 104  4.2.3  Cell Apoptosis Assays ............................................................................................................. 105  4.2.4  Immunoprecipitation Analysis ............................................................................................... 105  4.2.5  Transfection and Luciferase Assay ......................................................................................... 105  4.3  Results ........................................................................................................................... 106  4.3.1  Lyn is Phospho‐Activated on Y396 upon EGF ........................................................................... 106  4.3.2  Lyn Knockdown Inhibits EGF‐Induced ERK Phosphorylation .................................................. 107  4.3.3  Lyn Knockdown Inhibits R1881 and EGF induced AR Transcriptional Activity ....................... 108  4.3.4  Lyn Kinase Binds to AR Directly and Regulates AR Tyrosine Phosphorylation ....................... 110  4.3.5  Lyn Knockdown Induces Apoptosis in LNCaP Cells in The Presence of EGF and R1881 ......... 113  4.4  Discussion ...................................................................................................................... 115  CHAPTER 5:  Conclusion and Suggestions for Future Work .......................................... 118  5.1  General Discussion and Conclusion .............................................................................. 118  5.2  Suggestions for Future Work ........................................................................................ 127  Bibliography .................................................................................................................... 130  Appendix 1: Androgen Prevents Apoptosis Induced by Paclitaxel ................................. 169  Appendix 2: AR Interacts with Hsp27 via the N‐terminal and Ligand‐Binding Domains 170  Appendix 3: Validation of Pb‐Luc Functionality in vitro and in cellulo ........................... 171  Appendix 4: OGX‐427 Suppresses Probasin Luciferase (Pb‐Luc) .................................... 173  Appendix 5: Effect of OGX‐427 on AR, Hsp27 and Hsp90 Levels in LNCaP Xenografts .. 174  Appendix 6: Expression of Hsp27 Modulates UPR ......................................................... 175  Appendix 7: Role of Hsp27 Expression on Accumulation of Ubiquitinated Proteins ..... 178  Appendix 8: Hsp27 Knockdown Induces Autophagy in PC3 Cells ................................... 180  x  List of Figures  Figure 1.1. Schematic depiction of the male reproductive system. ................................... 2  Figure  1.2.  Schematic  illustration  of  the  cell  types  within  a  section  of  the  human  prostatic ducts. ....................................................................................................... 3  Figure 1.3. Hypothalamus‐pituitary‐gonadal hormonal Axis.............................................. 7  Figure 1.4. Protein structure of AR. .................................................................................... 8  Figure 1.5. Mechanism of androgen action in a prostate cell. ......................................... 11  Figure 1.6. The steroidogenesis pathways. ...................................................................... 24  Figure 1.7. Molecular mechanisms involved in the progression of CRPC. ....................... 27  Figure 1.8. The stress‐response pathway in cancer cells. ................................................. 29  Figure 1.9. Structural schematic of the Lyn tyrosine kinases  in their  inactive and active  configurations. ...................................................................................................... 38  Figure 2.1. Androgen enhances LNCaP cell survival. ........................................................ 54  Figure 2.2. Androgen phosphorylation of Hsp27 requires p38 MAPK pathway. ............. 56  Figure 2.3. Androgen‐induced Hsp27 phosphorylation requires AR. ............................... 59  Figure 2.4. Effect of Hsp27 on AR trans‐activation. .......................................................... 64  Figure 2.5. Effect of Hsp27 knockdown on AR expression and stability. ......................... 67  Figure 2.6. OGX‐427 suppresses probasin luciferase (Pb‐Luc) bioluminescence as well as  AR, Hsp90 and Hsp27 levels in vivo. ..................................................................... 71  Figure 3.1.  Lyn expression in PCa progression. ................................................................ 86  Figure 3.2. Lyn over‐expression accelerates castrate‐resistant LNCaP tumour growth and  serum PSA relapse to pre‐castration levels. ......................................................... 90  Figure 3.3. Effect of Lyn knockdown on AR expression and stability. .............................. 93  Figure 3.4. Effect of Lyn of AR transactivation. ................................................................ 96  Figure 3.5. Effect of Lyn knockdown on LNCaP cell survival. ............................................ 98  Figure 4.1. Lyn is activated in EGF pathway but not in Il‐6 pathway. ............................. 107  xi  Figure  4.2.  Effect of  Lyn  knockdown on  EGF‐induced  ERK phosphorylation  and R1881  and EGF induced AR transcriptional activity. ...................................................... 109  Figure 4.3. Lyn directly interacts and affects tyrosine phosphorylation and transactivaion  of AR. ................................................................................................................... 112  Figure 4.4. Lyn knockdown induces apoptosis in LNCaP cells. ....................................... 114  Figure 5.1. Regulation of AR by Lyn in CRPC. .................................................................. 127    Figure A.1. Androgen prevents apoptosis induced by paclitaxel. .................................. 169  Figure A.2. AR interacts with Hsp27 via the N‐terminal and Ligand‐Binding domains. . 170  Figure A.3. Validation of Pb‐Luc functionality in vitro and in cellulo. ............................. 172  Figure A.4. OGX‐427 suppresses Probasin luciferase (Pb‐Luc). ...................................... 173  Figure A.5. Effect of OGX‐427 on AR, Hsp27 and Hsp90 levels in LNCaP xenografts. .... 174  Figure A.6. Expression of Hsp27 modulates UPR. ........................................................... 177  Figure A.7. Effect of Hsp27 knockdown on accumulation of ubiquitinated proteins. ... 179  Figure A.8. Hsp27 knockdown induces autophagy in PC3 cells. ..................................... 180          xii  List of Abbreviations  AA  Amino Acid  ACTH  Adrenocorticotropic Hormone  AD  Androgen Deprivation  ADT  Androgen Deprivation Therapy  AF‐1  Activation Function‐1  AF‐2  Activation Function‐2  AIS  Androgen Insensitivity Syndrome  AND  Androstenedione  AR  Androgen Receptor  ARA55  Androgen Receptor Associated protein 55   ARA70  Androgen Receptor Associated protein 70   ARE  Androgen Response Element  ASO  Antisense Oligonucleotide  ATP  Adenosine‐5'‐triphosphate   Bcl‐2  B‐cell lymphoma 2  BPH  Benign Prostate Hyperplasia  BRCA2  Breast Cancer 2 susceptibility protein  CA  Constitutively Active  CAIS  Complete Androgen Insensitivity Syndrome  ChIP  Chromatin Immunoprecipitation  CREB  cAMP Response Element Binding protein  CRH  Corticotropin‐Releasing Hormone  CRPC  Castrate Resistant Prostate Cancer  c‐Src  cellular‐Src  CSS  Charcoal Stripped fetal bovine Serum  CTD  COOH‐Terminal Domain  CYP17A1  Cytochrome P450 17A1  DHEA  Dehydroepiandrosterone  DHT  Dihydrotestosterone  DN  Dominant Negative  DNA  Deoxyribonucleic Acid  DRE  Digital Rectal Exam  EBRT  External Beam Radiation Therapy  EGF  Epidermal Growth Factor  EGF  Epidermal Growth Factor  EGFR  Epidermal Growth Factor Receptor  EMSA  Electrophoretic Mobility Shift Assay  EMT  Epithelial‐Mesenchymal Transition  xiii  EPCA  Early Prostate Cell Antigen  ER  Endoplasmic Reticulum  ER  Estrogen Receptor  ERG  Ets Related Gene  ERK  Extracellular signal‐Regulated Kinase  FACS  Fluorescence‐Activated Cell Sorting  FAK  Focal Adhesion Kinase  FBS  Fetal Bovine Serum  FDA  Food and Drug Administration  FGFR  Fibroblast Growth Factor Receptor  FKBP52  FK506‐Binding Protein 52  FSH  Follicle‐Stimulating Hormone  GnRH  Gonadotropin‐Releasing Hormone  gp130  Glycoprotein 130  GRIP1  Glucocorticoid Receptor Interacting Protein 1  GST  Glutathione S‐Transferase  HAT  Histone Acetyltransferase  HDAC  Histone Deacetylases  HER‐2  Human Epidermal growth factor Receptor 2  HGFR  Hepatocyte Growth Factor Receptor  HSE  Heat Shock Element  HSF‐1  Heat Shock Factor 1  Hsp  Heat Shock Protein  IGF‐1  Insulin Growth Factor‐1  IgG  Immunoglobulin  IL‐4  Interleukin‐4  IL‐6  Interleukin‐6  JAK  Janus Kinase  KLK3  Kallikrein‐related peptidase 3  LBD  Ligand Binding Domain  LH  Luteinizing Hormone  LHRH  Luteinizing Hormone‐Releasing Hormone  LMTK2  Lemur Tyrosine Kinase 2   M  Metastasis  MAPK  Mitogen‐Activated Protein Kinase  MM  Mismatch  mRNA  messenger Ribonucleic Acid  MSMB  Microseminoprotein Beta  NCoR  Nuclear Co‐Repressor  NES  Nuclear Export Signal  NGFR  Nerve Growth Factor Receptor  NLS  Nuclear Localization Signal  NRTK  None‐Receptor Tyrosine Kinase  NTD  NH2‐Terminal Domain  ODN  Oligodeoxynucleotide  xiv  PAP  Prostatic Acid Phosphatase  PARP  Poly Adenosine diphosphate Ribose Polymerase   PCa  Prostate Cancer  PCA3  Prostate Cancer Antigen 3  PCR  Polymerase Chain Reaction  PD‐1  Programmed Death 1  PI3K  Phosphoinositide 3‐Kinase  PKB  Protein Kinase B  PPII  Polyproline type II  PR  Progesterone Receptor  PSA  Prostate Specific Antigen  PSCA  Prostate Stem Cell Antigen  PSMA  Prostate‐Specific Membrane Antigen  PTEN  Phosphatase and Tensin homolog   RNA  Ribonucleic Acid  RTK  Receptor Tyrosine Kinase  RTK  Receptor Tyrosine Kinase  Ser  Serine  SFK  Src Family Kinase  SH1  Src Homology 1  SH2  Src Homology 2  SH3  Src Homology 3  SHBG  Sex Hormone‐Binding Globulin  shRNA  short hairpin Ribonucleic Acid  sHSP  small Heat Shock Protein  siRNA  small interfering Ribonucleic Acid  SMRT  Silencing Mediator for Retinoic and Thyroid hormone receptors  Src  Sarcoma  SRC‐1  Steroid Receptor Co‐activator 1  STAT3  Signal Transducer and Activator of Transcription 3  T  Testosterone  TGF‐α  Transforming Growth Factor‐α  TIF2  Transcriptional Intermediary Factor 2  TM  Triple Mutant  TMA  Tissue Microarray  TMPRSS2  Transmembrane Protease, Serine 2  TNF‐α  Tumor Necrosis Factor‐α  TNM  Tumour Node Metastasis   TPR  Tetratricopeptide Repeat  TRUS  Transrectal Ultrasound  TURP  Trans‐Urethral Resection of Prostate  Tyr  Tyrosine  UGE  Urogenital Sinus Epithelium  UGM  Urogenital Sinus Mesenchyme  UGS  Urogenital Sinus  xv  UPS  Ubiquitin‐Proteasome System  UV  Ultraviolet  VEGF  Vascular Endothelial Growth Factor  v‐Src  viral‐Sarcoma  WT  Wild Type        xvi  Acknowledgements  First  and  foremost,  I  would  like  to  express  my  sincere  gratitude  to  my  research  supervisors, Dr. Martin Gleave and Dr. Amina Zoubeidi for their continued support, motivation  and enthusiasm throughout my PhD study.  It has truly been a great honour to work under their  supervision and benefit from their inspirational guidance.  Besides  my  research  supervisors,  I  would  like  to  thank  my  other  thesis  advisory  committee members,  Dr. Michael  Cox,  Dr.  Christopher  Ong  and  Dr.  Sandra  Dunn  for  their  encouragement and insightful comments. I would particularly like to thank Dr. Michael Cox for  being more than a committee member for me. Without his guidance and endless support and  immense knowledge I could not finish this work.  I am grateful to all the members of the Vancouver Prostate Centre and all my graduate  friends and  fellow  lab mates  in Dr. Gleave, Dr. Cox and Dr. Zoubeidi’s research groups:  Jenny  Bazov,  Eliana  Beraldi,  Thomas  Cordonnier,  Susan  Ettinger,  Ladan  Fazli,  Yubin  Gao,  Mazyar  Ghaffari,  Killian  Gust,  Masaki  Shiota,  Darya  Habibi,  Masafumi  Kumano,  Hidetoshi  Kuruma,  François Lamoureux, Na Li,   Susan Moore,  Igor Moskalev, Ka Mun Nip, Mitali Pandey, Manju  Sharma,  Payman  Tavassoli,  Virginia  Yago  and  Fan  Zhang  for  their  friendship  and  invaluable  support.  I wish to also thank the following organizations whose financial support made this work  possible: The Terry Fox Foundation, the National Cancer  Institute of Canada (Canadian Cancer  xvii  Society Research Institute), University of British Columbia (Four Year Fellowship Award, Faculty  of Medicine Graduate Student Award, Faculty of Medicine Albert B and Mary Steiner Summer  Research Award, Faculty of Medicine Roman M Babicki Fellowship  in Medical Research),  the  Prostate  Cancer  Foundation  BC  (Prostate  Disease  Fellowship)  and  the  Australian‐Canadian  Prostate Cancer Research Alliance (Travel Award).  Last but not the  least,  I am grateful to have the  love and support of my parents, Mina  and Alireza, my brother Arshia, my best friend Yasamin and my caring husband Mehran. They  stood by me in the ups and downs of this journey and made it all very much worthwhile.       xviii         To my husband and best friend  Mehran     1  CHAPTER 1: Introduction  1.1 The Prostate  1.1.1 Origin, Anatomy and Function  Development of the prostate gland is a result of epithelial invaginations of the posterior  urogenital sinus  (UGS)  (1, 2). This process occurs under the direct  influence of the underlying  mesenchyme  during  the  third  fetal month  (1‐3).  UGS  develops  into  the  prostate,  prostatic  urethra and bulbourethral glands  in males,  the  lower vagina and urethra  in  females, and  the  bladder in males and females (4). At the time of birth, prostate weighs only a few grams which  increases  to about 20 g by  the age of 30  (5). Both histology and weight of  the prostate are  stable for the next 25 years (5).    The prostate gland is located on the pelvic floor, inferior to the bladder and anterior to  the rectum in the extraperitoneal compartment (6). The main function of the adult prostate, as  an accessory sex organ, is in male reproduction where it plays a major role as a secretory gland  to promote successful fertilization (5). As an exocrine gland, the prostate produces and secretes  several components of the seminal fluid including the enzymes involved in coagulation, gelation  and liquefaction to facilitate the female egg fertility (3, 7). Furthermore, prostatic fluid reduces  the  acidity  of  the  urethra,  enhances  sperm  motility  and  is  involved  in  the  nutrition  of  spermatozoa (5). The prostate has a highly developed smooth muscle stromal component that  functions as a secondary urinary sphincter and controls urine output and  the  transmission of  2  seminal  fluid during  ejaculation  (5).   Prostate  also  acts  as  an  endocrine  gland by  converting  testosterone (T) to its biologically active and more potent form dihydrotestostrone (DHT) which  controls the development of the gland.    Figure 1.1. Schematic depiction of the male reproductive system.  The  schematic  demonstrates  the  relative  location  of  prostate  gland  to  the  nearby  organs.      1.1.2 Histology and Cells  The  prostate  is  composed  of  the  glandular  and  fibromuscular  components  (8,  9).  Histologically,  the  branched  ductal  glandular  structure  of  the  prostate  consists  of  secretory  luminal  epithelial  cells, which  are  surrounded  by  the  stromal  tissue.  The  epithelium  of  the  prostate is composed of two cell layers: a secretory luminal layer of columnar cells and a basal  layer of cuboidal cells (1, 10). A third population of cells with neuroendocrine characteristics are  present sporadically  throughout the prostatic epithelium with cell bodies in the basal layer and  3  projections to the  luminal surface which are scattered throughout the other two  lineages (10,  11). The fibromuscular stroma of the prostate gland  is composed primarily of: smooth muscle  cells, fibroblast and endothelial cells (12).       Figure  1.2.  Schematic  illustration  of  the  cell  types  within  a  section  of  the  human  prostatic ducts.  The epithelium of  the prostate  consists of  two  cell  layers:  the  secretory  luminal  layer  and the basal  layer of epithelial cells. Neuroendocrine cells are the third population of  cells  that  are present  in  the prostatic  epithelium which  are  scattered  throughout  the  other two lineages.     Secretory  luminal  epithelial  cells  of  the  prostate  are  the  exocrine  component  of  the  gland which are responsible for the production of the enzymes such as prostate specific antigen  (PSA), prostatic acid phosphatase  (PAP) and human kallikrein‐2  into  the glandular  lumen  (10,  11). Secretory cells express androgen receptor (AR) at high levels and require testosterone for  maintaining their secretory activity  (11, 13, 14). The basal cells of the prostate are androgen‐ independent  and  nonsecretory  epithelial  cells  (14,  15).  It  is  believed  that  the  basal  cells  4  modulate and mediate the endocrine and paracrine functions and are the proliferative section  of  the gland  (14). While  less  is known about  the  function of  the neuroendocrine cells of  the  prostate  epithelium,  these  cells  are  characterized  as  non‐proliferative  and  androgen‐ independent (16, 17). They can be characterized by the expression of the neuropeptides such  as  chromogranin  A  and  calcitonin  and  have  been  attributed  with  regulating  glandular  homeostasis  (14,  18,  19).  In mature  gland,  the  fibromuscular  compartment  of  the  prostate  provides  a  supportive matrix  for  the  ductal  epithelial  cells.  The  smooth‐muscle  cells  of  the  stroma mediate the required contractions for the prostatic secretion from the gland (20, 21).   Cunha  et  al.  has  shown  that  the  interaction  between  the  stroma  and  epithelial  compartments of the prostate gland play a major role in the normal prostate development (22).  Differential expression of AR  in epithelial and mesenchymal compartments of urogenital sinus  revealed the central role of the AR signaling during the embryonic development of the prostate  (23‐25).  In  the  course  of  the  embryonic  development,  AR  is  initially  only  expressed  in  the  mesenchymal  compartment  of  the  urogenital  sinus  (UGM)  and  the  epithelial  compartment  (UGE) is AR negative (24, 25). Testosterone acts through the AR in the UGM and results in the  production of paracrine growth factors known as andromedins which  induce the formation of  the prostatic buds from the undifferentiated UGE (23, 26). Furthermore, andromedins promote  the  growth,  branching  morphogenesis  and  differentiation  of  prostatic  epithelial  into  the  secretory epithelial cells (23). Conversely, the developing epithelium induces the differentiation  of  the primitive mesenchymal  cells  into  the  smooth muscle  cells  (22, 27).  In  the  absence of  epithelial compartment the urogenital sinus mesenchyme will not  form smooth muscles  (22).  Expression of AR in epithelial cells of the prostate begins shortly after birth (28).   5  1.2 Androgens  1.2.1 Production, Function and Metabolism  In mammals,  gonadal  steroids  are  responsible  for  the  gender‐specific  characteristics  (29). Androgens and estrogens are a  subclass of gonadal  steroids which are  formed  in males  and  females  and  play  a  physiologic  role  in  both  genders  (30).  Testosterone  is  the  major  circulating  androgen  in mature males.  It  is  synthesized  from  cholesterol  through  a  series  of  enzymatic steps by the testicular Leydig cells (31‐33).  In addition to Leydig cells, extragonadal  synthesis of  two weak androgens, dehydroepiandostrone and androstenedione,  from adrenal  glands and in small amounts from the brain cells has been reported (17, 31, 34).   During  embryonic  development,  testosterone  is  produced  by  the  foetal  testis,  under  stimulation of maternal luteinizing hormone‐releasing hormone (LHRH) , and is needed for the  development of the Wolffian ducts which give rise to the formation of epididymis and seminal  vesicles (35). During this stage, production of androgens is also pivotal for the development of  the  prostate  and  the  penis  (35).  However,  in  adult male  body  androgens  produced  by  the  Leydig  cells  of  the  testes  and  adrenal  glands  play  a major  role  in  the maintenance  of male  reproduction (35). Androgens play a crucial role in the control of prostate gland growth at the  time of puberty  and  in maintaining  it  in maturity  (36). Growth of  the prostate  gland during  puberty  includes  both  the  stromal  and  epithelial  elements  of  the  prostate  (36).  It  has  been  reported  that  growth  of  the  prostate  gland  does  not  occur  in males  following  prepubertal  castration  (37).  Androgens  are  also  required  for  development  and  maintenance  of  other  characteristics  such  as  the  muscle  formation,  body  composition,  bone  mineralization,  fat  metabolism and cognitive functions (31, 32, 35, 38).   6  The important role of androgens in regulation of prostate cell proliferation and survival  was established  in twentieth century by Charles Huggins (39).  In 1947, Huggins demonstrated  that  castration  causes  regression of  the hyperplastic prostate  (37). His experiments  revealed  that  only  in  the  presence  of  the  physiologically  sufficient  amount  of  androgenic  hormones,  cystic hyperplasia of  the prostate occurs  in  senile dogs  (40).  Interestingly,  removal of  testes  resulted in marked atrophy in both normal and cystic prostates and daily injection of androgen  led to the reconstruction of the gland  in the dogs (40). Huggins experiments for the first time  revealed the hormone‐dependent nature of the prostate gland and gave rise to the concept of  hormonal‐therapy for the treatment of prostate cancer.   Regulation  of  androgen  production  from  the  gonads  is  through  the  secretion  of  gonadotropin releasing hormone (GnRH) from the hypothalamus as well as the gonadotropins,  luteinizing  hormone  (LH)  and  follicle  stimulating  hormone  (FSH)  from  the  anterior  pituitary  gland  (the hypothalamic‐pituitary‐gonadal axis)  (31, 32).  In adult male body,  secretion of  the  GnRH from the specialized neurons of the hypothalamus stimulates the anterior pituitary gland  to release the Luteinizing hormone (LH) (41). Release of LH in turn stimulates the production of  androgens in Leydig cells of the testes (41, 42). LH interacts with the testicular LH receptor and  activates  the  steroidogenic pathways within  the  Leydig  cells of  the  testes which  lead  to  the  secretion of androgens  (32). The presence of the estradiol, a testosterone metabolite  inhibits  further secretion of both GnRH and LH/FSH production through a negative‐feedback loop (32).   7    Figure 1.3. Hypothalamus‐pituitary‐gonadal hormonal Axis.  Regulation  of  androgen  production  from  the  gonads  is  through  the  secretion  of  gonadotropin  releasing  hormone  (GnRH)  from  the  hypothalamus  as  well  as  the  gonadotropins, luteinizing hormone (LH) and follicle stimulating hormone (FSH) from the  anterior  pituitary  gland  (the  hypothalamic‐pituitary‐gonadal  axis).  This  process  is  regulated  through  a  negative  feedback  loop.  DHEA:  Dehydroepiandrosterone,  ACTH:  Adenocorticotropic Hormone, CRH: Corticotropin‐releasing hormone.      In  the circulation  testosterone  is bound  to albumin and  sex‐hormone‐binding globulin  (SHBG) and a small fraction of it is dissolved freely in the serum (43). Within the prostate gland  testosterone is converted to its more potent form DHT, which has five fold higher affinity for AR  compared  to  the  testosterone,  by  the  enzyme  5‐α  reductase  (35).  Three  isoforms  of  this  enzyme have been  cloned,  type 1,  type 2 and  type 3  (35, 44, 45). The 5‐α  reductase  type 1  enzyme  is widely  distributed  in  the  body;  however,  the  expression  of  the  type  2  enzyme  is  limited  to  the  androgen‐dependent  organs  (44).  The  newly  identified  5‐α  reductase  type  3  8  enzyme is shown to be structurally different from type 1 and type 2 isoforms and its role in vivo  as a 5α‐reductase remains to be established (45, 46).  1.3 Androgen‐Receptor (AR)  1.3.1 Structure, Biology and Function  Testosterone exerts its biological functions via binding to the AR (35). AR belongs to the  nuclear  hormone  receptor  superfamily  which  includes  the  following  families  of  receptors:  steroid hormone  receptors,  thyroid/retinoid and vitamin D  receptors as well as several other  orphan  receptors  (47,  48).  It  has  been  shown  that  products  of  lipid  metabolism  such  as  cholesterol derivatives bind to the nuclear receptors and regulate gene expression (47, 49). In  males, AR  is expressed predominantly  in sexual organs  including the prostate, testes, seminal  vesicle  and  ejaculatory  duct  (50,  51).  Expression  of  AR  in  non‐sexual  organs  such  as  liver,  kidney,  brain  and  skeletal  muscle  has  also  been  reported  in  males  (50,  51).  In  females,  expression  of  AR  in  reproductive  organs  such  as  uterus,  ovary  and  endometrium  has  been  shown  (51, 52). All nuclear  receptors  typically  contain a NH2‐terminal  region  (NTD), a  ligand  binding domain (LBD) and a COOH‐terminal region (CTD) (47, 49, 53).     Figure 1.4. Protein structure of AR.   Location  of  the  N‐terminus  domain,  DNA  binding  domain,  Hinge  region  and  Ligand  binding domain of human AR protein.      9  The human AR gene is located on the X‐chromosome and includes eight exons (53, 54).  Exon one of AR gene codes for the N‐terminal domain (NTD) of AR (49, 53). Exons two and exon  three code for the DNA‐binding domain (DBD) of AR and exon four to eight code for the  ligand  binding domain which  is  located  at  the C‐terminal domain  (CTD) of  the protein  (49, 53). AR  protein also contains a hinge region which is located in between the DBD and the LBD (48, 49,  53).  Two  transactivation  domains  have  been  characterized  in  AR  protein:  the  Activation  function‐1 (AF1) and the Activation function‐2 (AF2) (55‐57). The AF1 is located in the NTD and  has the main transactivation potential and the AF2 is located in the LBD (55, 58‐60).  The NTD of AR  is the main transcriptional regulatory region of the AR protein and has  been  reported  to  be  highly  flexible with minimal  secondary  structures  (53,  61).  It  has  been  shown  that  in  the absence of androgenic  ligands  the NTD of AR can become phosphorylated  and activated by protein kinase pathways (62‐64). The central part of the AR protein contains  the DBD which  includes  three alpha helices structures  that are organized  into  two zinc  finger  motifs and are  linked through eight cysteine residues (53, 61). These alpha helices motifs play  an  important  role  in  the  recognition  and  binding  of AR  to  the  androgen  response  elements  (AREs) on the DNA of the AR target genes  (57, 61). The LBD of AR has been characterized by  crystallography and is important in the recognition of androgenic ligands by AR (61, 65). Hinge  region of AR has long been considered a flexible region that connects the DBD to the LBD, and  helps with proper dimerization and binding of AR to DNA (66, 67). However, recent studies have  demonstrated that the hinge region of AR plays an active role in binding of AR to DNA as well as  AR nuclear localization (67, 68).   10  The ligand unbound AR is located in the cytoplasm associated with chaperone proteins  such as heat shock proteins (Hsps) (69‐71).  Hsps such as Hsp90 tether AR in the cytoplasm and  modulate AR conformation  to prepare  it  for optimal  ligand binding  (71‐73). Binding of AR  to  testosterone  or  DHT,  induces  a  conformational  change within  the  LBD  of  AR  that  leads  to  dissociation of AR from the Hsps (71). This conformational change allows AR to interact with co‐ regulators such as ARA70, Filamin‐A and importin‐α, that bind to the nuclear localization signal  (NLS) of the AR and facilitate receptor dimerization and nuclear localization (71). In the nucleus  AR  binds  to AREs  and  recruits  the  histone  acetyltransferase  (HAT)  enzymes,  an  array  of  co‐ regulators  (co‐activator  and  co‐repressors)  and  also  the  general  transcription machinery  (48,  71,  74).  Formation  of  these  multiprotein  transcriptional  complexes  results  in  a  tight  transcriptional  regulation  of  a  number  of  genes  involved  in  the  growth, maintenance  and  differentiation  of  the  prostate  (55,  61,  75).  Loss  of  ligand  (testosterone  or  DHT)  from  AR  promotes the nuclear export signal (NES) to shuttle AR back to the cytoplasm where  it can be  tethered by the Hsps in preparation for ligand binding (71, 74).             11      Figure 1.5. Mechanism of androgen action in a prostate cell.  Hsps,  tether  AR  in  the  cytoplasm  and modulate  AR  conformation  to  prepare  it  for  optimal ligand binding. Binding of AR to testosterone or DHT, induces a conformational  change within  the LBD of AR  that  leads  to dissociation of AR  from  the Hsps,  receptor  dimerization  and nuclear  localization.  In  the nucleus AR binds  to AREs and  through a  tight  transcriptional  regulation  of  a  number  of  genes  promotes  the  growth  and  maintenance  and  differentiation of  the prostate  cells.  Loss of  ligand  (testosterone or  DHT)  from  AR  promotes  the  nuclear  export  signal  (NES)  to  shuttle  AR  back  to  the  cytoplasm where  it can be  tethered by  the Hsps  in preparation  for  ligand binding. AR:  Androgen  Receptor,  Hsp:  Heat  Shock  Protein,  SHBG:  Sex  Hormone‐Binding  Globulin,  SRD5A2(1,3): steroid‐5‐α‐reductases.         12  1.3.2 AR Co‐Regulators (Co‐activator and Co‐Repressors)  Nearly 200 androgen receptor co‐regulators have been characterized  (76, 77). The co‐ regulators of AR  are described  as  the  transcription  chaperones  and  can be  classified  in  four  main categories: a)  the molecular chaperones, b)  the histone modifiers, c)  the DNA structure  modifiers  and  d)  the  transcription  coordinators  (14,  77).  They  act  in  different  subcellular  locations and can influence DNA binding, nuclear localization, stability of AR as well as linking it  to the transcriptional machinery (14, 78). The co‐regulators of AR can be either co‐activators or  co‐repressors.  The  former  function  to  enhance  the  transactivation  of  AR  while  the  latter  function to inhibit AR transcription initiation (71).   The p160  family of co‐activators  including the Steroid Receptor Co‐activator 1  (SRC‐1),  Transcriptional  Intermediary Factor 2  (TIF2) and Glucocorticoid Receptor  Interacting Protein 1  (GRIP1) is the first identified and one of the well‐studied families of AR co‐activators (71). These  co‐activators  stabilize  ligand‐bound AR which  results  in enhancing AR  transactivation  (71, 79,  80).  Another  class  of  co‐activators  is  the  histone  acetyltransferases  (HATs),  such  as  cAMP  Response Element Binding protein (CREB)‐binding protein, which  interact and  link AR with the  transcriptional machinery (71, 81, 82).   AR co‐repressors  inhibit  the  transcription  initiation of AR  through  interacting with  the  NTD and LBD (71). Two classes of well‐characterized AR co‐repressors are the nuclear repressor  co‐repressors  (NCoR)  and  Silencing  Mediator  for  Retinoid  and  Thyroid  hormone  receptors  (SMRT)  (71). SMRT activity can be enhanced both  in  the presence and  in  the absence of  the  ligand, while NCOR only gets activated  in the presence of  ligand  (48, 71, 83). Both SMRT and  NCOR  mediate  AR  repression  through  recruitment  of  histone  deacetylases  (HDAC)  which  13  stimulates DNA packaging into nucleosomes and inhibits the interaction between transcription  machinery and nuclear receptors (71, 84).  1.4 Prostate Cancer (PCa)  1.4.1 Development  Cancer of the prostate  is a result of the disrupted cellular homeostasis of the prostate  gland  (85).  There  are  two  major  theories  about  the  underlying  molecular  mechanisms  of  prostate  cancer  initiation. The  first  theory  indicates  that disruption  in  cellular homeostasis  is  mainly  the  result  of  the  accumulation  of  molecular  abnormalities  that  result  in  genomic  instabilities  (86,  87).  Genomic  instability  leads  to  uncontrolled  proliferation  potential which  serves as the  first step  in the process of tumour  initiation  (87, 88). Additional mutations over  the course of cancer progression confer advantages to the cell to increase the survival, invasion  and metastasis potential (88). The second theory proposes that cancer stem cells, which are a  rare phenotypically‐distinct subpopulation of cells with the potential to form new tumours, are  responsible  for  the  initiation  of  PCa  (89,  90).  More  than  90%  of  prostate  cancers  are  adenocarcinoma and arise from the epithelial compartment of the gland (91). Prostate cancer is  multifocal and heterogeneous cancer  in nature with as many as 5 or 6 tumours occurring  in a  single prostate (92, 93).  1.4.2 Epidemiology and Risk Factors  PCa  is  the  third  leading cause of cancer‐related mortality and  the most  frequent non‐ skin cancer  in Canadian men  (94).  In 2011, PCa will continue as  the  leading cause of cancer,  with  an  estimated  25,500  newly  diagnosed  cases,  resulting  in  approximately  4,100  deaths  14  among Canadian men (94). Worldwide PCa is the second most diagnosed and the sixth leading  cause of cancer‐related mortalities (95).   Several risk factors have been described to increase the chance of PCa development and  progression  (96).  Age  is  the  number  one  risk  factor  associated with  PCa  development  and  progression (96, 97). Studies on PCa autopsies have shown that even by the age of 20, around  10% of men have PCa cells in their prostate gland (96, 97). The risk increases to about 30% by  the age of 50 and 80% by the age of 80 (96‐99).   Family history  is another  important  factor  in PCa development  (100, 101). Risk of PCa  development has been shown to be higher  in male relatives of PCa patients  (101‐103).  It has  been  reported  that  there  is a 2.41  fold  increased  risk of PCa development  for men with  first  degree  relatives with PCa  (100, 103). There  is also evidence  that chances of PCa diagnosis  is  15% higher for men who had a father or brother diagnosed with PCa in comparison with 8% in  the control population (100, 104). The common  loci associated with PCa has been reported to  be at 8q24 and 17q (105). There are a number of genes reported by different groups to have  correlation with PCa susceptibility such as AR, SRD5A2, BRCA2, MSMB, LMTK2, KLK3, CYP17A1  (105, 106).  A  further  important  factor  in  incident,  progression  and  mortality  rate  of  PCa  is  Race/ethnicity  (96). African American men  are more  likely  to have  a worse prognosis  and  a  higher mortality  rate  compared  to White men  (96, 97, 107). The PCa  incidence  rates and  its  associated mortality rates have been shown to be much  lower  in most of Asian countries (99,  107, 108).   15  Diet  and  the  average  dietary  fat  intake  also  appear  to  have  an  impact  in  PCa  development, progression and mortality rate (96, 109).   1.4.3 Diagnosis and Prognosis  Routine PSA blood  test  screening and digital  rectal exam  (DRE)  in North America has  helped to shift the stage of disease at the time of diagnosis to a much earlier and more curable  stage (110). PSA blood test was developed in the late 20th century and is considered to be the  most  important biomarker  for detection and monitoring of PCa  in  the early  stages  (91, 111).  Elevation  of  PSA  levels  to more  than  4.0  ng/ml  in  the  blood  is  considered  as  suspected  for  cancer  (85, 112). PSA  is a member of  the  family of kallikrein proteases  (HK3) which  is mainly  produced  by  the  luminal  secretory  epithelial  cells  of  the  prostate  (91).  PSA  blood  test  is  a  sensitive, relatively inexpensive and non‐invasive procedure (113, 114). The main disadvantage  of  PSA  test  is  that  it  is not  specific  to  the  cancer  of  the prostate  and  common pathological  conditions  including  benign  prostate  hyperplasia  (BPH)  and  prostatitis  can  result  in  false  positive test results (91, 114).   DRE  is  another  basic  tool  for  early  detection  of  prostate  cancer which  often  detects  cancers missed by other methods (91). The main advantage of DRE is that it may detect cancer  in  men  with  small,  well  differentiated  tumours  that  have  normal  PSA  levels  (91,  115).  Moreover, DRE  is  also  a well‐tolerated  and  relatively  inexpensive  procedure  (91).  The main  limitation of this test is that important cancers are located in parts of the gland that are distant  and evasive to digital palpation (91). PSA combined with DRE appears to be the most effective  16  screening  tool  for  early  detection  of  PCa,  however  the  important  adverse  effect  of  PCa  screening has been shown to be the overdiagnosis and overtreatment of the patients (91, 116).   Transrectal ultrasound  (TRUS) and needle biopsy are used as  further  steps  to confirm  diagnosis and aid the grading of the cancer (91). These procedures are highly sensitive and play  a very  important role  in screening and early diagnosis of PCa (91). Any positive case detected  from these procedures will usually be followed up by histological examination to determine the  stage of cancer as well as to detect any localized cancer outside the prostate (91).   The most commonly used system for histological classification of PCa is Gleason grading  (117, 118).  In  this method, grades  from 1‐5 are given  to  the  tumour biopsies  taken  from  the  patient  (117).  Histological  grading  of  the  cancer  is  determined  based  on  the Gleason  score  which is described as the sum of the grades assigned to the most common patterns of glandular  structures  observed  within  the  tumour  sample  (119).  Gleason  grade  1  indicates  a  normal  pattern  and Gleason  grade  5  demonstrates  that  no  glandular  structure was  observed  (119).  Gleason scores between 2‐4 are considered as low grade/well differentiated, scores between 5‐ 7  indicate  a moderate  grade/moderately  differentiated  and  scores  from  8‐10  are  the  high  grade/poorly differentiated cancers (119). The Tumour, Node, Metastasis (TNM) staging system  is another system used by physicians to determine the stage of the prostate cancer (120). The  TNM system includes a) the size and local growth of the tumour (T) b) the extent of lymph node  metastasis (N) and 3) the incidence of distant metastasis (M) (120).  As discussed the established biomarkers for PCa screening have limitations and there is  a need for identification of biomarkers with more diagnostic and prognostic values. There are a  17  number of promising biomarker  candidates under  investigation  for PCa  including  the human  kallikrein  2,  Prostate Membrane‐Specific  Antigen  (PSMA), circulating  tumour  cells,  Prostate  Stem  Cell  Antigen  (PSCA),  Early  Prostate  Cell  Antigen  (EPCA),  TMPRSS2‐ERG  gene  fusion  rearrangement, serum calcium, caveolin‐1,  the Prostate Cancer Antigen 3  (PCA3 or DD3) and  exosomes  (91, 121). Data obtained  from  these  studies will hopefully have  an  impact on  the  discovery of PCa in early stages as well as prediction of malignant phenotype.  1.5 Treatment  Stage of the disease is the most important factor in choosing the right treatment option  for patients with PCa (122). When confined to the prostate gland, active surveillance, radiation  therapy and surgery are the treatment options for patients (123‐126).  Active  surveillance  is  a  strategy  used  for  patients with  low  risk  disease  or  those  in  relatively  early  stages  of  PCa  when  patient’s  age  and  health  status  predict  a  short  life  expectancy  (122,  127).  These  patients  are  closely monitored  by  prostate  biopsies,  PSA  level  measurements and DRE at  regular  intervals, and  the decisions are made based on  individual  patient’s  condition  and  the  rate  of  disease  progression  (122,  127,  128).  In  recent  years,  however, active surveillance and monitoring by biopsy, PSA test and DRE have been adopted by  many  physicians  as  a  common  treatment  strategy  to  overcome  the  overdiagnosis  and  overtreatment of patients with clinically insignificant disease (128, 129).   Radiation therapy, is another treatment option for patients with localized PCa (122). PCa  patients who prefer to avoid the risks of invasive surgery choose radiation therapy (130). There  18  are two forms of radiation therapy used for the treatment of PCa patients: the external beam  radiation therapy (EBRT) and internal radiation therapy (brachytherapy) (131, 132).   Radical  prostatectomy  is  a  surgical  procedure  to  remove  the  prostate  gland  and  the  attached seminal vesicles (133). Radical prostatectomy  is one of the most effective treatment  approaches to maximize the quality of life of the patients with locally confined PCa (134, 135).  However,  it  is  an  invasive  procedure  and  it  is  associated with  side  effects  such  as  erectile  dysfunction and decline in urinary function (135, 136).   Almost  10‐20%  of  patients  diagnosed with  PCa  progress  to  the  advanced‐metastatic  castration  resistant  prostate  cancer  (58,  137).  The  only  treatment  option  available  to  the  patients with metastatic PCa is hormone ablation therapy (138). Hormone ablation therapy can  be  performed  either  through  the  orchiectomy  (surgical  removal  of  testicles)  or  medical  castration (inhibition of hormone production) (138, 139).   Despite  the  early  response  to  hormone  ablation  therapy,  almost  all  patients  will  advance  to  the  castration  resistant  stage  (140).  Until  recently,  only  docetaxel‐based  chemotherapy  was  shown  to  improve  survival  in  patients  with  CRPC  (58).  The  improved  understanding of the underlying mechanisms that lead to the development of CRPC resulted in  development of new drugs with promising therapeutic potential as discussed below:  A. AR antagonists: One of  the major mechanisms  that contribute  to  the development of  the  CRPC  is maintained AR signaling  (58, 140, 141). Two classes of steroidal and nonsteroidal  anti androgens are developed which act by competing with endogenous androgen to bind  to  AR  (58,  142).  It  has  been  shown  that  steroidal  AR  antagonists  such  as  cyproterone  19  acetate and mifepristone and nonsteroidal AR antagonists  including nilutamide,  flutamide  and bicalutamide have a modest benefit to the patients (58, 143, 144).   MDV‐3100  is  a  new  and  promising  AR  antagonist.  It  has  approximately  eight  fold more  affinity  for AR  in  comparison with bicalutamide and  reduces  the efficiency of AR nuclear  localization  (58, 145).  In  the phase  I/II clinical  trial,  total of 140 patients with progressive  CRPC, in two subgroups of chemotherapy‐naïve and post‐chemotherapy, were treated with  30‐600 mg/day of MDV3100. A 62% and 51% decline from the baseline  in serum PSA was  observed respectively. Two phase III clinical trials of MDV3100 on progressive CRPC patients  (in  two groups of progressive chemotherapy‐naïve and docetaxel‐pretreated) are ongoing  with interim promising results (146, 147).  B. CYP17  inhibitors:  Abiraterone  acetate  is  a  small molecule  inhibitor  of  cytochrome  P450  (CYP17) enzyme  (148, 149). Cytochrome P450  is one of the key enzymes  for both adrenal  and  intratumoural de novo synthesis of androgens (58, 150). In a phase II clinical trial with  47 chemotherapy‐naïve CRPC patients, a 50% decline from the baseline  in serum PSA was  observed  in  30%  of  the  patients  (146). When  combined with  prednisone  (corticosteroid  drug),  a  50%  decline  from  the  baseline  in  serum  PSA  was  observed  in  79%  of  the  chemotherapy‐naïve  CRPC  patients  (146).  In  a  phase  III  clinical  trial  1195  patients with  metastatic  CRPC  post‐docetaxel  therapy were  treated with  abiraterone  plus  prednisone  resulted in longer overall survival time compared with the patients treated with prednisone  plus placebo  (14.8 versus 10.9 months)  (146). A second phase  III  trial with abiraterone  in  chemotherapy‐naïve metastatic CRPC patients has completed  in 2011  (146). Based on the  20  favourable results obtained  in the clinical trials this drug was approved by FDA to be used  for the treatment of patients with progressing CRPC after docetaxel therapy (58).  Similar  to  abiraterone  acetate,  TAK‐700  is  another  novel  inhibitor  of  cytochrome  P450  (CYP17) enzyme that shows initial positive results in phase I/II clinical trials (146).   C. Chemotherapy:  A  number  of  chemotherapeutic  agents  have  been  employed  for  the  treatment of CRPC, but docetaxel was the only one with both palliative and life‐prolonging  results  (151‐153).  Based  on  promising  results  obtained  from  two  phase  III  clinical  trials,  docetaxel was  approved  by  FDA  for  treatment  of men with metastatic  CRPC  (151,  152).  Unfortunately, despite the promising clinical trial results, all patients treated with docetaxel  eventually either developed resistance to this treatment agent or were not able to tolerate  its side effects  in  long term (153). In 2010, cabazitaxel received FDA approval as a second‐ line treatment option for patients who failed the docetaxel therapy (58, 154).  D. Immunotherapy: Development of an  immunotherapy  for PCa has been a challenging  task  (58).  Recently,  it  has  been  reported  that  PCa  is  more  immunogenic  than  previously  appreciated  (155) and  the  first  immunotherapeutic compound  for  the  treatment of CRPC  was approved  in 2010 by FDA  (156). This  immunotherapeutic agent  is  called Sipuleucel‐T  which is a immunotherapy antibody against immune checkpoint programmed death‑1 (PD‑ 1) protein  (58). Sipuleucel‐T  is approved  for  the  treatment of asymptomatic or minimally  symptomatic metastatic CRPC (156, 157).  There are a number of other promising drug candidates for the treatment of CRPC such  as  Orteronel  or  TOK‐001  (CYP17  inhibitors)  (58,  158),  Alpharadin  (Immunogenic  drug)  (58),  21  inhibitors of  cytoprotective  chaperones  (OGX‐011, OGX‐427, Hsp90  inhibitors), Src  (Sarcoma)  family kinase inhibitor drugs (Dasatinib, Bosutinib) (159‐161) now in clinical trials. It is a hopeful  period  in  finding  the  treatment  of  CRPC  and  with  continued  efforts  in  understanding  the  underlying molecular mechanisms of this part of the disease, better therapeutic strategies are  expected to be developed.  1.6 Development of Castration Resistant Prostate Cancer (CRPC)  All prostate tumours depend on androgen (AD) and regress in response to the removal  of  circulating  androgen  by  castration  (162).  Despite  the  initial  response  to  the  removal  of  androgens almost all patients with advanced PCa progress to a stage called castration resistant  prostate cancer  (CRPC),  in which  the prostate cells grow despite  the  low  levels of androgens  available  to  them  (162).  Some of  the proposed  theories  for progression of PCa  to  the CRPC  stage will be discussed in this section:  A. Role  of  AR  in  the  development  of  CRPC:  In  recent  years  it  was  reported  that  despite  androgen  deprivation  therapies,  very  low  levels  of  androgens  are  still  detectable  in  the  serum  and  tissue  of patients with  CRPC  (163‐165).  Therefore,  CRPC  is  described  as  the  advanced form of PCa which  is resistant to hormone ablation but  is not free of androgens  (163). AR was  observed  to  be  expressed  and  functionally  active  in  the  castrate  resistant  prostate  tumours  (163, 165).  It has been  reported by different groups  that AR  stimulates  the proliferation and survival of PCa cells and stays active in advanced forms of the disease  (163,  166).  The  following  theories  describe  how  AR  becomes  active  in  a  low  androgen  condition and play a role in the development of CRPC:  22  i. Hypersensitive  pathway:  This  theory  indicates  that  AR,  through  mutations,  amplifications of its gene becomes extremely sensitive to the low levels of androgens  available in a castrated environment (139, 167).  ii. Ligand independent activation: The pathway describes the mechanisms through which  AR becomes activated by growth factors and receptor tyrosine kinases. Growth factors  and cytokines such as Insulin Growth Factor‐1 (IGF‐1), Epidermal Growth Factor (EGF)  and Interleukin‐4 and‐6 have been shown to be overexpressed in CRPC. These growth  factors  and  cytokines  activate  receptor  tyrosine  kinases  (RTKs)  and  lead  to  AR  phosphorylation via either protein kinase B (Akt) or mitogen‐activated protein kinase  (MAPK), resulting in activation of AR in the absence of androgens (139, 167‐170).   iii. Promiscuous pathway: This pathway describes how  ligands other  than DHT  such  as  non‐androgenic  steroids  (progestins  and  estrogens)  and  anti‐androgens  (flutamide  and hydroxyflutamide) can activate AR. Activation of AR through this pathway  is the  result of mutations in the LBD of AR that leads to nonspecific binding of AR to ligands  other than DHT. The most frequently found mutations in LBD of AR in patient tumours  are the H874Y, T877A, and T877S (139, 163, 168).  iv. Co‐activators and co‐repressors: Increased expression of AR co‐activators such as SRC‐ 1, TIF‐2 and ARA70 has been reported in CRPC. Overexpression of AR co‐activators in  CRPC  has  been  shown  to  increase  the  transcriptional  activity  of  AR  in  response  to  nonspecific  ligands  such  as  adrenal  androgens  and  other  steroids.  Furthermore,  several kinase pathways have been reported to enhance the transcriptional activity of  AR via phosphorylation of the AR co‐activators (139, 171‐173).  23  v. Intracrine androgen metabolism: In recent years reports from several groups indicated  a  significant mechanism  for  the development of CRPC. These  reports demonstrated  that  although  the  concentration  of  serum  testosterone  was  significantly  low  after  castration,  levels  of  intratumoural  androgens  were  sufficient  for  activation  of  AR.  Intraprostatic androgens were shown to be synthesized from cholesterol via a de novo  steroidogenesis  pathway mediated  by  steroidogenic  enzymes.  Expression  of  all  the  steroidogenic  enzymes  involved  in  the  biosynthesis  of  androgens  including  cytochrome  P450  (CYP17),  was  demonstrated  to  be  up‐regulated  in  CRPC  tumour  specimens (164, 174). CRPC tumours build an intratumoural signaling system via which  they  attain  the  ability  to  convert  adrenal  steroids  to  androgen  at  concentrations  adequate to activate AR (174, 175). This discovery opened a new door to describe why  prostate cells survive the androgen deprivation therapies (139, 175‐177).    24    Figure 1.6. The steroidogenesis pathways.  All  steroid  hormones  are  synthesized  from  cholesterol.  Expression  of  all  the  steroidogenic enzymes involved in the biosynthesis of androgens is demonstrated to be  up‐regulated in CRPC tumour specimens. CRPC tumours build an intratumoural signaling  system  via which  they  attain  the  ability  to  convert  adrenal  steroids  to  androgen  at  concentrations adequate to activate AR.      vi. AR  splice  variants:  Discovery  of  AR  splice  variants,  as  a  result  of  alternative  gene  splicing in CRPC, which lack the LBD of AR (ARΔLBD) is yet another significant discovery  of the recent years.   Several AR splice  isoforms have been found  in both normal and  pathologic  conditions  (178).  The  mRNA  encoding  for  AR45  which  is  a  naturally  occurring AR  splice variant has been  identified  in human placenta  tissue  (178, 179).  This splice variant of AR  is a  result of alternative splicing of a newly described exon  located  inside  intron one of AR gene which substitutes the exon one of wild‐type AR  25  (178, 179). This mRNA gives rise to a 45 KDa AR protein variant that contains the DBD  and  CTD of wild‐type AR as well as a unique seven amino acid sequence replacing the  NTD  of wild‐type  AR  (178,  179).  There  are  still  debates  on whether  this mRNA  is  translated  into  a AR protein  variant  in normal  tissue but  its  ectopic expression has  revealed that this AR splice variant binds to androgens and translocates to the nucleus  and negatively regulates wild‐type AR (178).    Furthermore, a number of other AR splice mRNAs have been reported to be present in  pathologic  conditions  such  as  AIS  (Androgen  insensitivity  syndrome)  and  CAIS  (Complete  Androgen  Insensitivity  Syndrome)  which  give  rise  to  dysfunctional  AR  proteins  (178).  In  addition,  Gain‐of‐function  variants  of  AR  have  been  recently  discovered in malignant prostate cells and their expression level have been shown to  increase  significantly  with  the  progression  to  the  CRPC  stage  (178).  These  splice  variants possess the NTD and DBD of wild‐type AR and have been shown to promote  growth and survival of prostate cells  in  the castrated environment  (178). Proteolytic  degradation  of  full‐length  AR  by  calpain‐2  as  well  as  alternative  splicing  are  the  proposed mechanisms for synthesis of these AR splice variants (178). The AR1/2/2b and  AR1/2/3/2b, AR3, AR4, AR5, AR23 are some of the variants that have been characterized  in  hormone‐refractory  prostate  cancer  cell  lines  including  CWR22  and  22RV1  by  different groups (178). In contrast to wild‐type AR which is responsible for androgen‐ dependent  expression  of  AR  target  genes  and  androgen‐dependent  prostate  cell  growth,  AR  splice  variants  are  shown  to  be  responsible  for  androgen‐independent  expression of AR target genes and androgen‐independent prostate cancer cell growth  26  (178). Therefore,  the expression and activity of  these AR variants  is  independent of  the  presence  of  androgens  or  anti‐androgens  which  indicates  a  correlation  to  androgen independence in prostate cancer cells (139, 180, 181).  B. Bypass  pathway:  This  theory  indicates  that  activation  of  oncogenes  or  inactivation  of  tumour  suppressors  in  CRPC  results  in  up‐regulation  of  growth  and  survival  signals  via  pathways  other  than  AR  pathway.  Up‐regulation  of  Chaperone  proteins  (Hsp27,  Hsp90,  Clusterin),  growth  factors  (IGF‐1,  EGF),  Bcl‐2  protein  and  PI3K  pathway  are  examples  of  some of the alterations that have been reported in CRPC which result in growth and survival  of prostate cells in the castrated environment (139, 182).  An accumulating body of evidence  indicates a central  role  for AR and  its underlying signaling  pathway  in  the development of CRPC. A detailed understanding of  the principal mechanisms  leading  to  the  activation  of  AR  in  CRPC  will  support  the  development  of  more  promising  therapeutic strategies for patients in this stage.   27    Figure 1.7. Molecular mechanisms involved in the progression of CRPC.  CRPC  progression  depend  on  several  interconnected  mechanisms  that  render  cell  survival  either  via maintaining  the  activity  of AR  or  through  keeping  the  growth  and  survival  of  prostate  cells  by  bypassing  the AR  pathway.  The  schematic  demonstrates  some of the major molecular mechanisms involved in the progression of CRPC.    1.7 Chaperone Proteins  1.7.1 Biology and Function  The term molecular chaperone was coined  in 1987 to define a newly recognized group  of proteins which  interact and stabilize other proteins to obtain their functionally active state  without being physically  involved  in their  final structure  (183‐185). This group of proteins are  28  composed of  several different and unrelated  families of proteins with highly  similar  function  (184).    In  normal  cellular  condition  chaperone  proteins  are  involved  in  (a)  proper  de  novo  protein folding, (b) re‐folding of denatured proteins after stress, (b) assembly and disassembly  of multi‐subunit proteins, (c) facilitation of protein trafficking across the intracellular organelles  such  as  the:  endoplasmic  reticulum  (ER),  nucleus  and  mitochondria  and  (d)  removal  of  misfolded  and  aggregated  proteins  through  the  protein  degradation  pathways  (ubiquitin‐ proteasome system (UPS) and autophagy system) (184, 186).   Expression of  chaperone proteins  rapidly  increases under  stressful  conditions  such  as  heat shock and UV irradiation (187). Therefore, they are also categorized as heat shock proteins  (Hsps) or cell stress proteins (187). Chaperone proteins are classified based on their molecular  weight  (184,  187).  The  high molecular  weight  chaperone  proteins  act  in  a  ATP‐dependent  manner and the small chaperone proteins are ATP‐independent (184). Mammalian chaperone  proteins are categorized  in 4 major families of Hsp60, Hsp70, Hsp90 and the small heat shock  proteins including Hsp27 (188).  Expression of Hsps is regulated by transcription factor, heat shock factor 1 (HSF1) (189).  This  transcription  factor becomes activated upon several different protein‐denaturing cellular  stresses such as hypoxia, heat shock and UV irradiation (189, 190). Activation of HSF1 leads to  increased expression of Hsps  and helps  the process of protein  refolding  and  inhibits protein  aggregation inside the cell (189). Interestingly, it has been reported that HSF1 deficiency lowers  the  incidence  of  tumours  in  mice  (189,  191).  Furthermore,  short  hairpin  RNAs  (shRNAs)  29  knockdown  of HSF1  in human  cancer  cell  lines  demonstrated  the  significant  role of HSF1  in  cancer  cell viability and human malignancies  (189‐191). The mechanism  through which HSF1  functions in promoting the tumourigenesis is believed to be through the up‐regulation of Hsps  and other  chaperone proteins which  functions  to provide  relief  to  the  stress experienced by  cancer cells (189).           Figure 1.8. The stress‐response pathway in cancer cells.  The stress‐response pathway in cancer cells occurs via the activation of HSF1. Activation  of HSF1  leads  to  increased expression of chaperone proteins  including  the Hsps which  direct the unfolded proteins towards refolding or proteasome degradation and protect  the cancer cells from the accumulation of misfolded proteins which leads to apoptosis.      30  1.7.2 Small Heat Shock Proteins (sHsps)  Small  heat  shock  proteins  are  ATP‐independent  molecular  chaperones  that  are  characterized by a conserved sequence of 80‐100 AA, which  is called the α‐crystalline domain  (192).  This  domain  has  been  shown  to  play  an  important  role  in  dimerization  and  proper  function of  the sHsps  (192, 193). The N‐terminal domain of sHsps  is hydrophobic and plays a  role  in substrate binding and oligomer formation. However, their C‐terminal domain  is flexible  and  amorphous  and  is mainly  involved  in  the  stability  and  assembly  of  oligomers  (194).  In  recent years, expression of sHsps has been reported by several groups to be  involved  in many  human  diseases  including  cancer  (188,  195‐198).  Expression  of  sHsps  has  been  shown  to  increase  after  cellular  insults  such  as  toxic  radicals,  carcinogens,  hormone  therapy  and  chemotherapy  (199‐201).  Cancer  cells  are  frequently  exposed  to  rapid  changes  in  their  environment (including nutrient deprivation and hypoxia) and must be able to adapt effectively  to survive (202, 203). Increased expression of sHsps has been shown to be one of the common  mechanisms that cancer cells use to cope with these cellular insults (202).   1.7.3 The Importance of Hsps in AR Stability and Function  Chaperone  proteins  play  a major  role  in  the  process  of  conformational maturation,  stability and  transcriptional activity of  cytoplasmic  steroid  receptors  (204). Association of AR  with  chaperone  proteins  such  as Hsp90, Hsp70,  and Hsp56  (FKBP52)  play  a  key  role  in  the  process of assembly, maturation, stability and function of AR (204, 205). Interaction of AR with  these proteins  is required  for maintaining  the high‐affinity,  ligand‐binding conformation  (204,  205).   31  In the absence of androgenic ligand Hsp90, Hsp70 and Hsp56 interact directly with LBD  of AR and keep it in an inactive but highly responsive state (206, 207). In the presence of ligand,  AR  goes  through  a  conformational  change  into  the  DNA‐binding  state which  is  assisted  by  Hsp90  (206,  208).  Hsp90  dissociates  from  the  ligand‐bound  AR  and  this  leads  to  the  dimerization and nuclear localization of AR (209). Chaperone proteins such as Hsp70 have been  shown  to be  involved  in  the process of nuclear  localization  and  transactivation of AR  (206).  Interaction  with  these  chaperone  proteins  play  an  important  role  in  AR  stability  and  manipulation of Hsps results in AR ubiquitination and degradation via the proteasome pathway  (206).   Increased  expression  of Hsp90, Hsp70  and Hsp56  has  been  reported  to  promote  AR  transcriptional activity and to be associated with PCa development (206, 210‐212). Therefore,  understanding the mechanism through which chaperone proteins regulate AR protein stability  and activity during  the PCa progression  to advanced stages  is essential  (206). Employment of  treatment strategies to  inhibit the function of these proteins serves as a potential therapeutic  option for treatment of PCa (206).   1.7.4 Heat Shock Protein 27 (Hsp27)  In 1982, Hickey et al. demonstrated  that  incubation of HeLa cells at high  temperature  resulted in accumulation of a previously unknown protein with the molecular weight of 27kDa  (213, 214). Hsp27 belongs to the family of sHsps and its activity is regulated by phosphorylation  (202). This Hsp is expressed in almost all human tissues in normal conditions and its expression  is  reported  to  dramatically  increase  under  certain  pathological  conditions  such  as  cardiac  32  disease  and  cancer  (195,  214‐216).  Regulation  of  Hsp27  expression  is  under  the  control  of  transcription factor, HSF‐1 which interacts with two heat shock elements (HSE) in the promoter  of Hsp27 gene (202, 214). In normal conditions Hsp27 is mainly located in the cytoplasm of the  cells: however under stress conditions the amount of Hsp27 in the nucleus increases (214, 217).  Human  Hsp27  protein  consists  of  205  residues  and  its  structure  involves  an  NH2‐terminal  domain  (which  includes  the  WDPF‐motif),  the  α‐crystallin  domain  and  a  short  C‐terminal  domain  (which  play  an  important  role  in  Hsp27  oligomerization)  (214).  Hsp27  protein  is  phosphorylated at multiple sites by few protein kinases (214, 218). Ser15, Ser78 and Ser82 have  been characterized as the main phosphorylation sites of Hsp27 (214).   Under  stress  conditions,  it  has  been  shown  that  expression  of  Hsp27  increases  to  prevent protein aggregation and  facilitate elimination of misfolded proteins  (219). Hsp27 also  plays  a  role  as  a  scaffolding  protein  to  facilitate  protein‐protein  interactions  as  well  as  phosphorylation  of  signaling  pathways  (219,  220). Moreover,  It  has  also  been  reported  that  Hsp27  interacts with key regulators of apoptosis such as procaspase‐3 and cytochrome C and  inhibits cell death  (221, 222). Overexpression and activity of Hsp27  is associated with several  malignancies including PCa (197, 202, 223‐225). Hsp27 overexpression is considered a powerful  biomarker and a potential therapeutic target of aggressive PCa (219, 226‐228).   Our  laboratory  has  previously  reported  that  knockdown  of  Hsp27  results  in  a  suppression of prostate tumour growth and sensitizes prostate cancer cells to chemo‐therapy,  hormone‐therapy,  and  radiation‐therapy  (226,  228,  229).  Based  on  the  promising  results  obtained  in  our  lab  and  reports  in  the  literature  indicating  a  potential  role  for  Hsp27  as  a  33  therapeutic  target  for  advanced  PCa,  OGX‐427,  a  selective  second  generation  antisense  oligonucleotide (ASO)  inhibitor of Hsp27 was developed which  is now  in the phase  I/II clinical  trials  for several cancer types  (219). Hsp27 knockdown demonstrates promising results  in the  clinical trials, thus, a better understanding of its mechanism of action is needed.   1.8 Protein Kinases  Phosphorylation is one of the major control mechanisms for the cellular functions (230‐ 232). Phosphorylation and dephosphorylation of  target substrates such as proteins and  lipids  inside the cell orchestrates the activation of signaling pathways in response to extracellular and  intracellular signals to regulate the growth, proliferation and survival of cells (232). 539 protein  kinase genes have been  identified  to be encoded by  the human genome  (232). Based on  the  target amino acid (s) that protein kinases phosphorylate, they are divided  into three different  categories of (a) Serine/Threonine kinases, (b) Tyrosine kinases, and (c) Dual‐specificity kinases  (230). Protein kinases catalyze a reversible chemical reaction through which a phosphate group  from ATP of the donor molecule is transferred to the serine, threonine or tyrosine of the target  protein (233).   Deregulation  of  protein  kinases  activity  has  been  implicated  with  various  disorders  including  immunological diseases, neurological complications and cancer  (234). Study of Rous  sarcoma  virus  which  carried  v‐src  gene  on  its  genome  led  to  the  discovery  of  first  proto‐ oncogene  Src  protein  tyrosine  kinase  in  1970  (235,  236).  Raf  kinase  was  the  first  serine/threonine  kinase with  Src‐like  oncogenic  potential  to  be  discovered  (237). Oncogenic  34  signals initiated from mutated serine/threonine and tyrosine kinases have been shown to result  in anchorage‐independent growth, excessive cell proliferation and cancer cell metastasis (238).   1.8.1 Tyrosine Kinases and Their Role in Cancer Progression  Tyrosine phosphorylation plays a fundamentally important role in regulation of different  cellular  functions  including:  cell  proliferation,  transcriptional  activation,  differentiation  and  development (239). Tyrosine kinases are divided into two classes: 1) Receptor tyrosine kinases  (RTKs),  and  2)  non‐receptor  (cytosolic)  tyrosine  kinases  (NRTKs)  (239,  240).  RTKs  are  type  I  transmembrane  proteins  which  possess  an  N‐terminal  extracellular  domain,  a  single  transmembrane  domain,  and  a  C‐terminal  cytoplasmic  domain  (239).  They  can  bind  the  activating ligands through their NTD and their CTD include the catalytic domain (239, 240).   NRTKs are characterized as  intracellular proteins, however, a subset of them are found  to be associated with membranes through a membrane targeting post‐translationally modified  N‐terminus (239). The membrane‐associated NRTKs act as the catalytic subunits for receptors  which  lack  catalytic  function  (239).  Both  RTKs  and  NRTKs  are  activated  in  a  ligand‐induced  fashion resulting in tyrosine phosphorylation of the cytoplasmic proteins and thereby activation  of their underlying signaling pathways  (239). Aberrant activation of tyrosine kinases has been  reported in different human malignancies and a number of tyrosine kinase inhibitor drugs have  been approved for clinical implications (239).    35  1.8.2 Tyrosine Kinases and Their Role and PCa  Both receptor and non‐receptor tyrosine kinases have been shown to play a significant  role in the growth and metastatic progression of prostate cancer (241, 242). Epidermal Growth  Factor Receptor (EGFR), Insulin‐like Growth Factor‐1 (IGF‐1R), Human Epidermal growth factor  Receptor  2  (HER‐2),  Nerve  Growth  Factor  Receptor  (NGFR),  c‐MET  Receptor  and  Fibroblast  Growth Factor Receptor  (FGFR) are examples of some of  the RTKs  that have been associated  with  PCa  carcinogenesis  (241,  243‐245).  These  RTKs  have  been  reported  to  be  involved  in  different  aspects  of  PCa  carcinogenesis  including  tumour  growth,  metastasis  and  drug  resistance  (241). For  instance, elevated expression of HER2 and  IGF‐1R  in advanced stages of  PCa has been reported to confer androgen  independence (241, 246, 247). On the other hand,  activation  of  AR  downstream  of  EGFR  and  IGF1‐R  signaling  has  been  described  to  promote  prostate cancer cell proliferation and survival  in the absence of androgenic  ligands (241, 248).   Furthermore, overexpression of c‐MET receptor and its ligand, HGF (Hepatocyte growth factor),  is shown to be involved in drug resistance and metastasis of PCa tumours (241, 249).   Several NRTKs have also been associated with prostate cancer carcinogenesis (169, 170,  242). Amongst  the NRTKs, members of  the  Src,  FAK, ETK,  JAK1/2 and ACK NRTKs have been  shown to play a major role in both early and advanced stages of PCa (242). Src kinase as well as  its  two  other  family members  Lyn  and  Fyn  are  reported  to  be  involved  in  PCa  progression  through  the  regulation  of  PCa  cell  growth,  migration,  metastasis  (241,  242,  250,  251).  Furthermore, it was recently shown that Src kinase plays a key role in tyrosine phosphorylation  and transcriptional activity of AR in the castrated environment (169, 241). Members of the FAK  family of NRTKs are shown to be  involved  in prostate cancer cell adhesion and migration and  36  their presence was demonstrated to be essential for castration‐resistant formation of PCa (241,  252). The ETK and JAK1/2 family members are reported to be associated with regulation of PCa  cell  survival, migration  and  angiogenesis  (241,  253). Moreover,  similar  to  Src  kinase,  Ack‐1  kinase has also been revealed to interact directly and tyrosine phosphorylate AR (170). Tyrosine  phosphorylation  of  AR  via  Ack‐1  likewise  plays  an  important  role  in  regulation  of  AR  transcriptional activity (170, 241).   Increased  expression  and  activity  of  different members  of  the  RTKs  and NRTKs  have  been  implicated  in  prostate  carcinogenesis  (241).  These  proteins  regulate  key  aspects  of  prostate  cancer  progression,  particularly  in  the  development  of  CRPC  (241).  Therefore,  inhibition of their activity  is an encouraging therapeutic option  for CRPC. Several  inhibitors of  tyrosine kinases are now  in clinical trials; thus  it  is key to  increase our understanding of their  role  in  different  stages  of  prostate  cancer  progression  to  help  the  development  of  more  effective and specific drugs to inhibit their function.  1.8.3 Lyn Tyrosine Kinase  Lyn tyrosine kinase was identified in 1987 as a member of the Src family of NRTKs (254).  Src family of NRTKs includes eleven family members of Src, Lyn, Yes, Lck, Hck, Fgr, Blk, Brk, Srm,  Fyn and Frk (255). All the members of the Src family contain the following domain structures: a  unique myristylated N‐terminal domain, SH3 and SH2 domains, a kinase catalytic domain (SH1)  and a regulatory C‐terminal domain (255, 256). The NTD of Lyn kinase mediates the association  of the protein with the plasma membrane (256). The SH2 and SH3 domains of the protein play a  role  in  recognition  of  substrate  or  adaptor  proteins  as well  as  fixation  of  the  protein  in  its  37  inactive  state  (256). The  kinase domain of  the protein  is  required  for enzyme activity of  the  protein (256).   Lyn  is  ordinarily  maintained  in  a  closed  inactive  conformation  through  two  major  intramolecular  inhibitory  interactions,  namely  binding  of  the  phosphorylated  C‐terminal  tyrosine  residue,  Tyr508  to  the  Src  Homology  2  (SH2)  domain  and  interaction  of  a  PPII  (polyproline type II helical) motif in the SH2‐kinase linker with the SH3 domain (257‐259).  The  activation  of  Lyn  involves  disruption  of  these  inhibitory  interactions  through  multiple  mechanisms,  such  as  dephosphorylation  of  Tyr508,  displacement  of  the  tail  from  the  SH2  domain,  displacement  of  the  PPII  motif  from  the  SH3  domain  and  is  characterized  by  autophosphorylation of the specific Lyn Tyr396 in the activation‐loop (259, 260).     38                      Figure 1.9. Structural schematic of the Lyn tyrosine kinases in their inactive and active  configurations.  Lyn  is ordinarily maintained  in a closed  inactive conformation (left) through two major  intramolecular inhibitory interactions, namely binding of the phosphorylated C‐terminal  tyrosine  residue, Tyr508  to  the Src Homology 2  (SH2) domain and  interaction of a PPII  (polyproline  type  II helical) motif  in  the  SH2‐kinase  linker with  the  SH3 domain.    The  activation  of  Lyn  (right)  involves  disruption  of  these  inhibitory  interactions  through  multiple mechanisms, such as dephosphorylation of Tyr508, displacement of the tail from  the  SH2  domain,  displacement  of  the  PPII  motif  from  the  SH3  domain  and  is  characterized by autophosphorylation of the specific Lyn Tyr396 in the activation‐loop.     Lyn kinase  is expressed primarily by hematopoietic cells and plays a key  role  in  signal  transduction  from  cell  surface  receptors  such  as  B  cells  and  cytokine  receptors  (256,  261).  Involvement  of  Lyn  in  other  cellular  functions  such  as  cell  proliferation,  apoptosis  and  39  cytoskeletal change has been reported (256, 262, 263). Alternative splicing of exon II of the Lyn  gene gives rise to the two Lyn isoforms with the molecular weight of 53 and 56 KDa (264).  Expression  and  activity  of  Lyn  kinase  has  also  been  reported  to  be  associated with  several  types of  cancers  including breast  and prostate  cancer  (52, 251, 265).  Lyn  kinase has  been identified as a regulator of the invasion and metastasis capacity of the breast cancer cell  lines and its knockdown resulted in the inhibition of the migration and invasion potential of the  cells (265). It is also reported that Lyn kinase is expressed in the majority of primary human PCa  specimens  (251)  and  its  expression  is  up‐regulated  in  CRPC  (266).  Targeting  Lyn  expression  using antisense oligonucleotides and siRNA, or Lyn activity using inhibitory peptide against Lyn  kinase domain resulted in reduced cell proliferation in PCa cell lines (267) and reduced tumour  volume in the DU145 xenograft model (251).   Despite structural similarities between the members of the SFKs, genetic manipulations  revealed  a unique  role  for  each member  of  the  family  (52,  251,  268‐270). Growing  body  of  literature suggests an  important role  for Lyn kinase  in progression of prostate cancer but the  underlying mechanisms through which Lyn mediates this role remains undefined.  In chapter 3  and 4 of  the  current  thesis we will discuss  the  role of  Lyn  kinase  in  regulation of AR  in  the  castrated environment and provide the mechanism through which Lyn exerts its effects.  1.9 Prostate Cancer Cell Line Models  LNCaP, PC3 and DU145 cells are  the  three cell  lines  that are most commonly used  for  the  study of different  stages of PCa  in vitro  (271). LNCaP cells are derived  from a metastatic  40  lesion of a human prostate adenocarcinoma (272). These cells possess AR and treatment with  androgens modulates  their proliferation potential  thus making  them a suitable model  for  the  study of androgen‐dependent prostate cancer (272). However, the AR in LNCaP cells has been  reported to contain a mutation (T877A) in the LBD which results in the activation of LNCaP AR  in response to several steroids and antiandrogens (273, 274).  C4‐2 cell line is a cell line derived from LNCaP cells grown as xenografts after castration.  These are considered to be castrate resistant, but still androgen sensitive; as the AR‐mediated  gene expression is still responsive to the treatment with androgen in this cell line (275).  PC‐3  and  DU145  cells  are  the  cell  line  models  for  the  in  vitro  study  of  androgen‐ independent  PCa.  These  cells  are  derived  from  the  bone  and  brain  metastatic  lesions  of  prostate adenocarcinoma, respectively  (276, 277). Expression of AR  in both of these cell  lines  has been reported to be negative (278).  1.10 Thesis Hypothesis and Specific Objectives  It  is now clear  that  the AR  signaling pathway plays a central  role  in  the  initiation and  progression of the PCa (77, 279). It has been reported that AR is expressed in almost all primary  prostate cancers (77, 280, 281). Furthermore, a correlation between the level of AR in primary  and metastatic  PCa  and  disease  progression  has  been  observed  in  both  human  and  animal  models  (77, 282, 283). Therefore,  it  is now generally accepted  that  the  complex  interplay of  multiple mechanisms,  leading to aberrant activation of AR, plays an essential role  in evolution  of PCa from an organ confined to the castrated‐resistant disease (77, 162, 283). Exploring the  41  mechanisms behind AR  signaling  in both primary and CRPC  is crucial  for development of  the  new and more clinically beneficial therapeutic strategies for PCa patients (163, 284).   The significant role of chaperone proteins and protein kinases  in PCa disease  initiation  and progression has been reported by our research group and others (52, 285‐290). Moreover,  inhibition  of  chaperone  proteins  and  protein  kinases  expression  delay  prostate  xenograft  growth  and  castrate‐resistant  progression  (226,  229,  267,  291,  292).  Therefore,  we  hypothesized that increased expression and activity of Hsp27 and Lyn kinase play a key role in  enhancing the transcriptional activity of AR which results in prostate cancer cell survival.   In order to test this hypothesis the following objectives and specific aims were followed:  Objective  #1:  To  attest  Hsp27  promotes  prostate  cancer  cell  survival,  through  interaction and regulation of AR protein expression and transcriptional activity.  Specific  aims:  (a)  to  investigate  the  relationship  between  AR  and  Hsp27  in  prostate  cancer  cells;  (b)  to determine  the possible  effect(s) of Hsp27  gain or  loss of  function on AR  protein expression and activity;    (c)  to evaluate  the  in vivo effect(s) of Hsp27 knockdown on  prostate cancer progression using the LNCaP xenograft model.  Objective  #2:  To  attest  Lyn  tyrosine  kinase  regulates AR pathway  and  participates  in  prostate cancer progression to castrate resistant stage.  Specific Aims:  (a)  to determine  the expression  level of Lyn  in  the prostate cancer cell  lines  as  well  as  in  human  tissue  specimens  and  the  importance  of  Lyn  expression  in  PCa  progression to CRPC; (b) to investigate the possible role of Lyn in regulation of AR; (c) to define  the molecular mechanism through which Lyn contributes to PCa progression.  42  Objective  #3:  To  attest  Lyn  facilitates CRPC  by  integrating  the  growth  factors  and/or  cytokines  signaling  pathways,  thereby  enhancing  AR  transcriptional  activity  via  tyrosine  phosphorylation which ultimately promotes prostate cancer cell survival.  Specific Aims:  (a)  to determine  if epidermal growth  factor  (EGF)‐ and/or  interleukin‐6  (IL‐6)‐signaling pathway(s) lead to Lyn phosphorylation in CRPC; (b) to investigate the molecular  mechanisms through which Lyn phosphorylation modulate AR transcriptional activity.  To address  the  first objective three specific aims were generated. First, we performed  experiments to study the  interaction between AR and Hsp27. Data obtained from this part of  the  experiments  revealed  that  Hsp27  is  rapidly  phospho‐activated  upon  treatment  with  androgens  and  interacts  with  AR  directly.  Based  on  these  observations,  we  then  designed  experiments to examine our second objective. Using gain‐ and loss‐ of function experiments we  determined that Hsp27 expression regulates the transcriptional activity of AR. Furthermore, we  showed  that  Hsp27  knockdown  leads  to  decreased  AR  protein  expression  levels  without  affecting the mRNA  levels of AR. Our results  indicated that, absence of Hsp27 destabilizes AR  through disruption of AR/Hsp90 complex and leads to the binding of AR to the E3 ligase MDM2  and  its  rapid  degradation  via  the  proteasome.  As  the  last  step  and  to  confirm  our  in  vitro  findings we examined  the  in vivo effect of Hsp27 knockdown on  the progression of prostate  cancer using  LNCaP  xenograft model.    Treatment of mice  tumours with OGX‐427  (ASO drug  targeting Hsp27) resulted in 15% decrease in tumour volume and 60% reduction in serum PSA.  This set of data further confirmed the in vitro results and shed light on the importance of Hsp27  in regulation of AR in PCa (chapter 2).    43  Current literature suggests that Lyn kinase promotes prostate cancer cell survival in vivo  and  in  vitro. Therefore,  in  chapter 3 we  focused on  investigating  the molecular mechanisms  through  which  Lyn  tyrosine  kinase  regulates  the  proliferation  and  survival  of  PCa  cells.  In  addressing this objective three specific aims were followed. First, expression of Lyn kinase was  analyzed and consistent increase in expression of Lyn kinase in the low androgen environment  was detected in both in vitro and in vivo models of PCa. Furthermore, the role of Lyn kinase in  CRPC progression was  investigated  through  the  in vivo experiments using Lyn overexpressing  LNCaP cells to  look for the effect of Lyn on the progression of PCa to the CRPC stage. Results  obtained from our in vivo experiments revealed that Lyn overexpression caused a higher rate of  tumour growth and PSA relapse after castration. Next, we investigated the mechanism through  which Lyn contributes  to  the progression of CRPC and examined whether  this role  is  through  the  regulation  of  AR.  Data  gained  from  this  part  proved  that  Lyn  kinase  has  a  key  role  in  regulation of AR transcriptional activity. Finally, the underlying mechanism through which Lyn  regulates AR transcriptional activity was investigated. Results obtained from this part indicated  that  Lyn  knockdown  disrupts  the  binding  between  AR/Hsp90  and  therefore  leads  to  AR  destabilization, ubiquitination  and degradation.  Effect of  Lyn  knockdown on AR  stability was  shown to be reflected in the cell survival and proliferation potential of LNCaP cells (chapter 3).  Lyn kinase participates in signal transduction via cell surface receptors that lack intrinsic  tyrosine  kinase  activity  in  response  to  a wide  range  of  extracellular  stimuli,  such  as  growth  factors  and  cytokines.  It  has  been  reported  that  in  the  absence  of  androgens,  signal  transduction pathways, downstream of  the growth  factors and  cytokines, phosphorylate and  activate  AR.  Therefore,  in  chapter  4  we  explored  the  signaling  pathway(s)  leading  to  Lyn  44  phosphorylation  in PCa  cells and also  investigated whether  Lyn modulates AR  transcriptional  activity downstream of growth  factor or cytokine signaling pathways. First, we demonstrated  that  Lyn  kinase  is  phosphorylated upon  EGF  and  not  upon  IL‐6  stimulation.  This  set  of  data  suggested  that  Lyn  can  be  involved  in  EGF‐mediated  AR  transactivation.  Further  studies  demonstrated  that  Lyn  knockdown  inhibits  the  EGF‐mediated  phosphorylation  of  ERK.  ERK  kinase has been reported to regulate AR transcriptional activity through the phosphorylation of  AR co‐activators, SRC‐1 and SRC‐2. Therefore, regulation of AR transcriptional activity indirectly,  through  EGF‐mediated  ERK  phosphorylation,  was  one  of  the  possible mechanisms  that  we  described  for  Lyn‐mediated  regulation  of  AR  transactivation.  Next,  through  immunoprecipitation analysis we observed that AR and Lyn interact directly. Additionally, using  Lyn kinase dominant negative (DN) and constitutively active (CA) constructs, we demonstrated  that AR tyrosine phosphorylation is decreased in the presence of Lyn DN construct. The last set  of experiments performed in this part indicated that Lyn kinase plays a key role in regulation of  growth factor‐induced AR transcriptional activity (chapter 4).   These data have identified for the first time that protein expression and transactivation  of  AR  can  be modulated  by Hsp27  and  Lyn  tyrosine  kinase.  Furthermore, we  identified  the  underlying molecular mechanisms  involved  in  this process. Data obtained  in  this  thesis helps  improve  understanding  of  the molecular mechanisms  involved  in  the  regulation  of  PCa  cell  survival by Lyn and Hsp27 towards development of better treatment strategies to  inhibit their  function.      45  CHAPTER 2: Cooperative  Interactions  between  Androgen  Receptor and Hsp27 Facilitate AR Transcriptional Activity1  2.1 Introduction  The AR, a ligand‐dependent transcription factor and member of the class I subgroup of  the nuclear receptor superfamily, plays a key role in prostate carcinogenesis and progression. In  response  to androgen,  cytoplasmic AR  rapidly  translocates  to  the nucleus and  interacts with  sequence specific Androgen Response Elements (ARE)  in the transcriptional regulatory regions  of target genes (75, 293). The classical model of androgen‐regulated AR transcriptional activity  has not fully defined the many diverse effects of androgens on PCa cell survival and growth. In  addition  to  this  transcriptional  genomic  action,  androgens  and  other  steroid  hormones  like  progesterone and estrogen can exert rapid non‐genomic effects that are initiated at the plasma  membrane, presumably in conjunction with surface receptors (49, 294).     Similar  to  progesterone  (PR)  and  estrogen  (ER)  receptors,  AR  can  interact  with  the  intracellular tyrosine kinase c‐Src to activate MAPK pathway  (295, 296).  In androgen sensitive  LNCaP PCa cells, AR interacts with the SH3 domain of Src within minutes of androgen treatment  to promote  cell  survival, proliferation,  and differentiation  (295, 296). Androgens  also  rapidly  stimulate Raf‐1 and Erk‐2, both components of  the MAPK signaling cascade  (295), suggesting  that  androgen‐stimulated  MAPK  activation  occurs  via  non‐genomic  mechanisms.  This  non‐                                                        1 A version of this chapter has been published. Zoubeidi A, Zardan A, Beraldi E, Fazli L, Sowery R, Rennie P,  Nelson C, Gleave M. Cooperative interactions between androgen receptor (AR) and heat‐shock protein 27 facilitate  AR transcriptional activity. Cancer Research. (2007) Nov 1; 67(21):10455‐65.  46  genomic  action  of  androgen  can  also  influence  classical  genomic  AR  activity,  including  modulation of AR by  co‐activators  (297). PI3 kinase/Akt  is another pathway  involved  in non‐ genomic activity of ER and PR (298, 299) as well as AR (294, 300).  In fact, androgen‐activated  PI3K and Akt enhance cell growth and survival  in AR positive cells, which can be  inhibited by  PI3K inhibitors or dominant‐negative Akt. AR is found in a large protein complex with p85α‐PI3K  and Src, both required for androgen‐stimulated PI3K/Akt activation (294, 300).  Molecular  chaperones are  involved  in processes of  folding, activation,  trafficking, and  transcriptional activity of most steroid receptors,  including AR.  In the absence of  ligand, AR  is  predominately  cytoplasmic, maintained  in  an  inactive, but highly  responsive  state by  a  large  dynamic  heterocomplex  composed  of  heat  shock  proteins  (Hsps),  co‐chaperones,  and  tetratricopeptide  repeat  (TPR)‐containing proteins.    Ligand binding  leads  to a  conformational  change  in  the  AR  and  a  dissociation  from  the  large  Hsp  complex.  Subsequently,  the  AR   dimerizes,  translocates  to  the  nucleus,  binds  to  its  ARE  and  interacts with  co‐activators,  to  modulate target gene expression (301).   Dissociation of  the AR‐chaperone  complex after  ligand binding  is viewed as a general  regulatory mechanism of AR signaling (301). However, molecular chaperones remain important  players  in the events downstream of receptor activation, and throughout the  life cycle of the  AR.  For  example,  the  Hsp90  inhibitor,  geldanamycin,  destabilizes  AR  and  increases  its  proteasomal degradation,  thereby decreasing expression of AR‐regulated genes  (209). Recent  reports further highlight the important roles of other co‐chaperones on AR activation. Bag‐1L is  overexpressed  in  hormone  refractory  PCa  (302)  and  enhances  transactivation  of  the  AR  by  47  using its NH2 and COOH‐terminal domains to bind to COOH‐ and NH2‐terminal sequences of AR  (73) . Another co‐chaperone, FKBP52 (Hsp52), also increases AR transactivation (303, 304) and  FKBP52  knockout  mice  exhibit  defects  in  male  reproductive  tissues  including  ambiguous  external genitalia and defects in prostate and seminal vesicle development.  Another class of Hsps  that complex with ER and glucocorticoid receptor  (GR) are ATP‐  independent  and  include  Hsp27  (305).  Hsp27  is  a  cytoprotective  chaperone  expressed  in  response to many stress signals to regulate key effectors of the apoptotic machinery including  the  apoptosome,  the  caspase  activation  complex  (221,  306),  and  proteasome‐mediated  degradation of apoptosis‐regulatory proteins (307, 308). Antisense knockdown of Hsp27 delays  PCa  xenograft  growth  and  androgen‐independent  progression  (226,  229).  While  Hsp27  expression, in prostate, is induced by estrogens and glucocorticoids (309, 310), its relationship  with AR and androgens  is undefined. Here we  identify a feed‐forward  loop whereby androgen  bound AR  induces  rapid Hsp27 phosphorylation  that  in  turn cooperatively  facilitates genomic  activity of the AR, thereby enhancing PCa cell survival.  2.2 Materials and Methods  2.2.1 Cell Culture and ASO Transfection  LNCaP cells are maintained in RPMI with 5% fetal bovine serum (311) and treated with  Hsp27  ASO  designated OGX‐427  (OncoGenex  Technology,  Inc,  Vancouver,  B.C)  or mismatch  (MM) control oligonucleotide (ODN) with oligofectamine, in serum free OPTI‐MEM (Invitrogen‐ Life Technologies,  Inc., Burlington, Ontario, Canada)  for 20 min. 4 h  later, 5% FBS was added.  48  Cells were  treated  once  daily  for  two  successive  days  and  harvested  48  h  after  the  second  treatment.   2.2.2 Plasmids and Reagents and Antibodies  An Hsp27 wild type (WT) was subcloned into pcDNA3.1‐GFP (Invitrogen‐Life Technology,  Inc). The Hsp27 triple mutant was generated by introducing direct mutagenesis replacing Serine  15, 78 and 82 with alanine using QuikChange® II XL, site directed mutagenesis Kit according to  manufacture  instructions  (Stratagene,  La  Jolla,  CA).  R1881  (Perkin‐Elmer,  Boston, MA)  was  dissolved  in  100%  ethanol.  Cyclohexamide, MG‐132,  SB  203580,  LY  294002 were  purchased  from (Clabiochem, San Diego, CA), Hsp27, pHsp27, Hsp90 (StressGen Victoria, British Columbia,  Canada), MDM2, AR N‐20, AR‐441  (Santa Cruz Biotechnology,  Inc., Santa Cruz, CA), pAkt/Akt,  pp38/p38; PARP (Cell Signaling, CA).   2.2.3 Cell Proliferation and Apoptosis Assays  LNCaP cells were plated in RPMI with 5% FBS and switched to CSS the next day with or  without 10 nM R1881. After a time course exposure, LNCaP cell growth was measured using the  crystal violet assay, as previously described (229). Detection and quantitation of apoptotic cells  were  performed  by  flow  cytometric  analysis,  as  previously  described  (229).  Each  assay was  performed six times.  2.2.4 Western Blot Analysis and Immunoprecipitation  Total whole cell lysate (500 µg) were pre‐cleared with protein‐G sepharose (Invitrogen‐ Life Technologies, Inc.) for 1 h at 4˚C and immunoprecipitated with 2 µg of anti‐Hsp27, anti‐AR,  or  IgG as a  control overnight at 4˚C. The  immune  complexes were  recovered with protein‐G  49  sepharose for 2 h and then washed with RIPA buffer, centrifuged, and subjected to SDS‐PAGE  following by western blotting.  2.2.5 Immunofluorescence  LNCaP  cells were  grown  on  coverslips  and  treated  +/‐  R1881  for  15 min.  For Hsp27  knockdown,  cells were  treated with 50 nM Hsp27 ASO as described above.   After  treatment  cells were fixed MeOH+3% acetone for 10 min at ‐20 ˚C. Cells were then washed 3 times with  PBS and incubated with 0.2% Triton/PBS for 10 min, followed by washing and 30 min blocking in  3% non‐fat milk prior addition of antibodies overnight to detect Hsp27 (1:500), and AR (1:250).   Antigens  were  visualized  using  anti‐rabbit  or  anti‐mouse  antibodies  coupled  to  FITC  or  Rhodamine, respectively (1:500; 30 min). Photomicrographs were taken at a 20X magnification  using  Zeiss  Axioplan  II  fluorescence microscope  followed  by  analysis with  imaging  software  (Northern Eclipse, Empix Imaging, Inc., Mississauga, Ontario, Canada).   2.2.6 Transfection and Luciferase Assay  LNCaP cells (2.5 X 105) were cultured on 6‐well plates and transfected using lipofectin (6  µl/well)  (Invitrogen‐Life  Technologies,  Inc.).  The  total  amount  of  plasmid  DNA  used  was  normalized  to 2 µg/well by  the addition of a  control plasmid  (Empty pcDNA 3.1). 24 h after  transfection media was replaced to CSS +/‐ R1881 for 24 h. Luciferase activities measured using  Dual‐Luciferase Reporter Assay  System  (Promega) with  the  aid  of  a microplate  luminometer  (EG&G Berthold). All experiments were carried out in triplicate wells and repeated 5 times using  different preparation of plasmids.  50  2.2.7 Northern Blot Analysis  Total  RNA was  isolated  from  LNCaP  cells  treated with  treated with OGX‐427  or MM  control,  transfected with Empty vector, Hsp27‐WT or Hsp27‐TM, and  treated with SB203580  prior to R1881 (10 nM) treatment for 24 h using TRIZOL/chloroform extraction (Invitrogen Life  Technology  Inc.). 10 µg aliquot from each sample was subjected to horizontal electrophoresis  and followed by hybridization with Hsp27 (700 pb) or PSA (2 kb) cDNA probe as described (229),  human  glyceraldehyde  phosphate  dehydrogenase  (GAPDH)  cDNA  probe  for  normalization  of  loading levels.  2.2.8 Electromobility Shift Assay (EMSA)  LNCaP cells were treated with indicated concentrations of OGX‐427 or MM control. 48 h  after  the  second  treatment,  nucleoplasmic  proteins  were  extracted  using  CeLytic  NuCLEAR  Extraction  Kit  (Sigma).  Nuclear  extract  (10  µg)  was  incubated  in  a  final  volume  of  20  µl  containing DNA‐binding buffer, and 1.5 g of pol (deoxyiosinic‐deoxycytidic acid) (Roche) for 10  min  at  room  temperature,  then  incubated  for  20  min  at  room  temperature  with  double‐ stranded 32P‐labeled (with specific activity around 300,000 cpm) PSA‐ARE oligonucleotide (312).   2.2.9 Chromatin Immunoprecipitation (ChIP)  LNCaP cells were treated with 10 nM of R1881 for 4 h and parafolmaldehyde‐crosslinked  and  sonicated.  ChIP  assay  was  performed  using  EZ  ChIP  kit  according  to  the manufacture  (Upstate) on the PSA gene regions ARE I and ARE III as described by (313).   51  2.2.10 Reverse Transcription‐PCR  4 µg of total RNA were reverse transcribed to produce cDNA using 100 pmol of random  hexamer primers  (Pharmacia) and Moloney murine  leukemia virus  reverse  transcriptase  (Life  Technologies). The cDNA was successively amplified with 2 pairs of AR specific primers. 5 µl of  cDNA were used as  the  starting DNA  template  in  the PCR assay. To verify RNA quality, each  sample was amplified with a set of primers specific to b‐actin  (5’‐TGA TCC ACA TCT GCT GGA  AGG TGG‐3’ sense) and 5’‐GGA CCT GAC TGA CTA CCT CAT GAA‐3’ antisense). Analysis of PCR  products  was  done  by  electrophoresis  in  2%  agarose  gel  and  visualized  ethidium  bromide  staining.  2.2.11 Protein Stability  LNCaP cells were plated and treated with OGX‐427 or MM control, or transfected with  Hsp27 WT or Empty vector as described above. Media was changed 48 h  later  to RPMI + 5%  serum containing 10 µM of cyclohexamide incubated at 37°C for 2‐6 or 16 h. Western blot was  performed using AR, Hsp27 and vinculin antibodies.     2.2.12 In vivo Imaging of Luciferase Activity  Bioluminescent  imaging  was  performed  with  a  highly  sensitive,  cooled  CCD  camera  mounted  in a  light‐tight specimen box (Xenogen Corporation, Alameda, CA), using protocol as  previously described (314). Before imaging, mice were injected intra‐peritoneal with 100 mg/Kg  of the substrate D‐luciferin and anesthetized with 1% of isoflurane. 15 min post injection, mice  were imaged by IVIS 200 and the Bioluminescence was monitored by Living Image software.   52  2.2.13 Animal Treatment  Male athymic nude mice  (Harlan Sprague‐Dawley,  Inc.,  Indianapolis,  IN) were  injected  subcutaneously with 1x106 LNCaP‐Probasin‐driven luciferase cells. Once tumours were palpable  with  serum  PSA  levels  ~  25  ng/ml  and  bioluminescence  detectable  using  the  IVIS‐Imaging  System, mice were  treated with  20 mg/Kg of OGX‐427 or MM  control  intra‐peritoneal once  daily for 7 days. Tumour volume, serum PSA, and bioluminescence measurements were done at  baseline and on days 4 and 8.  Statistical Analysis: All data were analyzed by  two‐tailed unpaired  student’s  t  test or  one‐way analysis of variance (ANOVA) with post‐hoc test. Levels of statistical significance were  set at P < 0.05.  2.3 Results  2.3.1 Androgens and Hsp27 Protect LNCaP Cells from Apoptotic Stress  Androgen  is  an  important  survival  factor  in  prostate  epithelial  cells.  The  synthetic  androgen  R1881  enhances  LNCaP  cell  survival  in  the  presence  of  cytotoxic  stress,  including  etoposide  (315),  cyclohexamide  (300),  and  PI3K  inhibitors  (316). We  recently  reported  that  Hsp27 conferred  resistance  to androgen ablation  in LNCaP  (229) and next  set out  to explore  whether  androgen‐  and  Hsp27‐induced  pro‐survival  activities  were  interrelated.  Before  beginning to study relationships between androgen and Hsp27, we first confirmed that R1881  added  to  androgen  depleted,  charcoal‐stripped  serum  (CSS)  increased  LNCaP  cell  growth  (Figure 2.1. A  left) and decreased apoptotic (Figure 2.1. A right) rates compared to CSS alone.  R1881 protected LNCaP cells  to paclitaxel  treatment,  lowering apoptotic  rates and  increasing  53  cell growth  (Appendix 1). R1881 also protected  LNCaP  cells  from apoptosis  induced by OGX‐ 427,  a  2nd  generation  ASO  that  potently  decreases  Hsp27  levels  (229).  OGX‐427‐induced  knockdown of Hsp27 was associated with decreased apoptotic rates  in R1881‐treated cells, as  measured by FACS and PARP cleavage (Figure 2.1. B, C). Collectively, these results indicate that  androgens suppress apoptosis induced by Hsp27 knockdown or paclitaxel.    A      B        54  C   Figure 2.1. Androgen enhances LNCaP cell survival.   A, left: R1881 enhances LNCaP cell growth. Cells were treated with 1 nM R1881 for 2, 4,  and 6 days and cell growth rates determined by MTS assay and compared with control  (day of treatment defined as 100%). A, right: R1881 protects LNCaP cells from apoptosis.  Cells were treated with 1 nM R1881 for 4 days, and proportion of cells in sub G0, G0‐G1,  S, G2‐M was determined by Propidium iodide staining.   B and C: R1881 protects cells  from apoptosis  induced by OGX‐427. B,  left: Cell growth  rates were compared  to control  (one day after  transfection) using MTS assay 2 and 5  days  post  transfection.  B,  right:  Apoptotic  rates  were  determined  5  days  post  transfection. C: LNCaP cells were pretreated with 10 nM R1881 or CSS for 48 h prior to  treatment with OGX‐427  or MM  control.  PARP  cleavage  and Hsp27  expression  levels  were measured by western blot. All experiments were repeated at least 3 times.        2.3.2 Androgens Lead to Rapid Hsp27 Phosphorylation via p38 MAPK Pathway  Androgens stimulate growth and survival via both genomic and non‐genomic pathways.  Recently identified non genomic effects include activation of Src, PI3 Kinase and Akt (294, 300).  Since  Akt  has  been  reported  to  phosphorylate Hsp27  in  intact  neutrophils  (317), we  tested  whether  androgen  leads  to  Hsp27  phosphorylation.  Interestingly,  androgen  induced  rapid  phosphorylation of Hsp27 on both Ser 78 and Ser 82 residues  in a dose‐ and time‐dependent  manner  (Figure 2.2. A). Within 15 min after  incubation with 10 nM R1881, Ser 78 and Ser 82  phosphorylation levels increased 3.2 and 5.3 fold, respectively (Figure 2.2. A, right).   55  To  identify  upstream  effectors  of  androgen‐induced  Hsp27  phosphorylation,  we  analyzed R1881‐induced changes in p38 kinase and Akt phosphorylation levels, both previously  associated  with  Hsp27  activation  (317,  318).  R1881  enhances  p38  kinase  and  Akt  phosphorylation in a time‐dependent manner, with maximum stimulation at 15 min and 5 min,  respectively (Figure 2.2. B, left‐right). These results suggest that Hsp27 may be phosphorylated  via p38 and/or Akt pathways. Pre‐incubation of LNCaP cells with  the p38 kinase  inhibitor, SB  203580,  abolished  R1881‐induced Hsp27  phosphorylation  (Figure  2.2.  C,  left), while  the  Akt  inhibitor, LY98059, did not alter androgen‐induced Hsp27 phosphorylation (Figure 2.2. C, right),  indicating that androgen‐induced Hsp27 phosphorylation occurs via the p38 kinase pathway.    A       56  B             C        Figure 2.2. Androgen phosphorylation of Hsp27 requires p38 MAPK pathway.   A: R1881  leads to rapid phosphorylation of Hsp27 on both Ser 78 and 82 residues  in a  dose (left) and time dependent (right) manner: LNCaP cells were maintained  in CSS for  16 h before R1881  treatment.  Total proteins were  analyzed by western blotting with  anti‐phospho‐Hsp27 Ser 78 or 82 or anti‐Total Hsp27 for control loading.   B:  R1881  leads  to  phosphorylation  of  p38  kinase  (left)  and  Akt  (right)  in  a  time  dependent manner as  shown using  anti‐phospho‐Akt or anti‐phospho‐p38 antibodies.  Anti‐total Akt or anti‐total p38 was used for control loading.   C: The p38  inhibitor SB203580 (10 µM) (left), but not the Akt  inhibitor LY98059 (right),  inhibits R1881 induced Hsp27 phosphorylation. After 5 min or 15 min R1881 (for Akt or  p38 respectively), total  lysates were analyzed by western blotting Hsp27 anti‐phospho‐ Hsp27 Ser 78 or 82 or anti‐Total Hsp27 for control loading.    57  2.3.3 Androgen‐induced Hsp27 Phosphorylation is AR‐dependent  To determine whether AR  is required for androgen‐induced phosphorylation of Hsp27,  changes in Ser 78 and Ser 82 phosphorylation levels were analyzed after treatment with R1881  +/‐  the  anti‐androgen  bicalutimide.  Bicalutimide  inhibited  R1881‐induced  Hsp27  phosphorylation at both sites (Figure 2.3. A), suggesting that ligand binding to AR is required for  Hsp27 phosphorylation by R1881. Next, PC3 cells, which do not express endogenous AR, were  transfected with increasing amounts of AR or Empty vector with or without R1881. As shown in  Figure  2.3.  B, Hsp27  phosphorylation  levels  at  both  Ser  78  and  Ser  82  sites  increased with  increasing AR levels after R1881 treatment. In AR negative PC3 cells, Hsp27 phosphorylation is  insensitive  to androgens but  is enhanced when AR  is  transiently over‐expressed  in PC3  cells.  These results confirm that AR is required for androgen‐induced Hsp27 phosphorylation.    To  further  define  mechanisms  of  androgen‐induced  Hsp27  phosphorylation,  we  determined whether Hsp27 and AR interact using co‐immunoprecipitation for Hsp27 and AR in  LNCaP  cells.  Hsp27  is  detected  in  AR  immunoprecipitated  complexes  and  conversely,  AR  is  detected  in  Hsp27  immunoprecipitated  complexes  (Figure  2.3.  C,  left).  The  domain  of  AR  required for the interaction with Hsp27 was next analyzed using GST‐pull down assays. GST‐pull  down  after  initial  equimolar  normalization  of GST‐AR  domain  fusion  as  previously  described  (319), indicates that Hsp27 binds with N‐terminal and ligand binding (C‐terminal) domains, but  not the DNA‐binding domain of AR (Appendix 2). Furthermore, immunofluorescence illustrates  that  Hsp27  and  AR  co‐localize  in  the  cytoplasm  of  LNCaP  cells  cultured  in  the  absence  of  androgens.  Importantly, and of potential  functional  relevance, both proteins  translocate and  co‐localize in the nucleus after R1881 treatment (Figure 2.3. C, right).  58  Prior to ligand binding, AR exists in a complex with Hsp90 and other co‐chaperones. The  AR‐Hsp90  interaction maintains  AR  in  a  ligand‐binding  conformation  necessary  for  efficient  response to hormone (320). Upon ligand binding, AR is released from Hsp90 and is translocated  into the nucleus. Interestingly, AR immunoprecipitation blots show that shortly after androgen  treatment,  Hsp27  levels  rise  in  complex  with  AR  as  Hsp90  levels  decrease  (Figure  2.3.  D),  suggesting that upon ligand binding, phospho‐activated Hsp27 replaces Hsp90 to chaperone AR  into the nucleus.    A       B       59  C         D       Figure 2.3. Androgen‐induced Hsp27 phosphorylation requires AR.   A: Bicalutimide inhibits R1881‐induced Hsp27 phosphorylation. LNCaP cells were starved  for 16 h before adding 10 nM R1881 for 15 min +/‐ 1 µM bicalutamide, and total protein  analyzed by Western blotting with anti‐phospho‐Hsp27 Ser 78 or 82, or anti‐Total Hsp27  for control loading.   B: Androgen increases phospho‐Hsp27 levels in AR‐transfected PC‐3 cells. PC3 cells were  transiently transfected with 100‐500 ng of pcDNA‐hAR followed by 10 nM R1881 for 15  min  and  total protein  then  analyzed by Western blotting with  anti‐AR,  anti‐phospho‐ Hsp27 Ser 78 or 82, or anti‐Total Hsp27 for control loading.   C: AR interacts with Hsp27. 500 µg of total extract were immunoprecipitated with 2 µg  of  anti‐Hsp27,  anti‐AR,  or  IgG  as  a  control  overnight  at  4ºC.  The  immune  complexes  were  recovered with  protein‐G  sepharose  for  2  h  and  submitted  to western  blotting  with  anti‐AR  or  anti‐Hsp27  (left).  AR  and  Hsp27  co‐localize  and  translocate  into  the  nucleus  after  R1881:  LNCaP  cells  were  treated  +/‐  R1881  for  15  min  and  fixed  in  Methanol/Acetone  for  immunofluorescence  staining  with  anti‐Hsp27  and  anti‐AR  antibodies (right).   D: Androgen increases Hsp27 levels in complex with AR as Hsp90 levels decrease. LNCaP  cells were maintained in CSS for 16 h and treated for indicated times with 10 nM R1881.  500  µg  of  total  extract  were  immunoprecipitated  using  AR  and  western  blot  were  performed using Hsp90, Hsp27 and AR antibodies.   60  2.3.4 Effect of Hsp27 on Genomic Activity of AR  Many proteins participate in the activation of AR, either by direct binding or as part of a  tertiary complex regulating activity of other transactivators. Since Hsp27 co‐localizes with and  shuttles  ligand‐activated  AR  during  nuclear  translocation,  we  next  investigated  how  Hsp27  expression and phosphorylation affected AR transcriptional activity. This was done by gain‐of‐ function  strategies  using  over‐expressing  wild‐type  (WT)  Hsp27,  as  well  as  loss‐of‐function  strategies  using  an  Hsp27  ASO  (OGX‐427),  dominant‐negative  Hsp27  phosphorylation  triple  mutant  (TM)  or  an  Hsp27  phosphorylation  inhibitor  (p38  kinase  inhibitor,  SB  203580).  PSA  transactivation  assays  were  performed  using  LNCaP  cells  transiently  transfected  with  the  luciferase  reporter  plasmid  regulated  by  the  PSA  enhancer‐promoter  region  (6.1  Kb)  in  the  presence or absence of increasing amount of exogenous WT Hsp27 plasmid (0, 0.25, 0.5 and 1  µg).  R1881  treatment  increased  AR  reporter  gene  expression  34‐fold,  while  WT  Hsp27  overexpression  increases  androgen‐stimulated  transcriptional  activity  of  PSA  a  further  3‐fold  (Figure 2.4. A, left). In contrast, Hsp27 knockdown using OGX‐427 decreased transactivation of  the androgen  regulated PSA  reporter  in a dose‐dependent manner,  further  supporting a  role  for Hsp27 in AR transactivation (Figure 2.4. A, right).     To  determine  whether  Hsp27  phosphorylation  is  required  for  R1881‐induced  AR‐ mediated  gene  activation,  we  over‐expressed  an  Hsp27  triple  mutant  (Ser15,  78  and  82  substituted  by  alanine)  in  a  dose‐dependent manner  and  tested  its  ability  to  affect  R1881‐ stimulated PSA transactivation. As shown in Figure 2.4. B (left), Hsp27 TM transfection inhibited  luciferase transactivation from the PSA enhancer  in response to R1881. Similarly,  inhibition of  androgen‐induced, p38 kinase‐mediated Hsp27 phosphorylation using the p38 kinase inhibitor,  61  SB  203580,  suppressed  R1881‐mediated  transactivation  of  PSA  enhancer  driven‐luciferase  activity  (Figure  2.4.  B,  right).  Collectively,  these  results  indicate  that  androgen‐induced  p38  kinase‐mediated phosphorylation of Hsp27 is important for AR‐mediated PSA expression.   The preceding data identified a role for phospho‐Hsp27 in the transactivation of PSA. To  provide  further  evidence  to  substantiate  this  hypothesis,  northern  blot  analyses  were  performed  (Figure  2.4.  C)  and  indicated  that  levels  of  AR‐regulated  endogenous  PSA mRNA  decreases  significantly  after  Hsp27  knockdown  (OGX‐427)  (Figure  2.4.  C,  left),  p38  kinase  inhibition  (SB  203580)  (Figure  2.4.  C,  right)  or Hsp27  phosphorylation  inhibition  (Hsp27  TM)  (Figure  2.4.  C, middle).  These  results  confirm  that  Hsp27  levels  and  phosphorylation  status  enhance AR‐mediated PSA mRNA expression.  As a transcription factor, AR translocates to the nucleus after androgen binding where it  interacts with androgen response element (ARE) to transactivate  its target genes. Suppression  of  Hsp27  levels  or  phosphorylation  negatively  regulates  androgen‐stimulated  transcriptional  activity of PSA. To determine whether AR interaction with its response elements is affected by  Hsp27  levels, we next analyzed effects of Hsp27 knockdown on AR binding  to PSA‐ARE using  Electrophoretic Mobility  Shift Assay  (EMSA) with  nuclear  lysates  of  LNCaP  cells  treated with  OGX‐427. As shown in Figure 2.4. D, 10 nM R1881 increased AR binding to ARE, and this effect  was specifically blocked by excess cold PSA oligonucleotide. Hsp27 knockdown using OGX‐427  decreased AR binding to its ARE, confirming that Hsp27 knockdown decreases AR binding to its  ARE.  Collectively,  the  preceding  data  indicates  that  phospho‐activated Hsp27  plays  a  critical  role in androgen‐induced nuclear translocation and transcriptional activity of the AR.   62  We  next  explored whether  Hsp27  forms  a  complex with  AR  on  the  ARE  of  the  PSA  promoter using ChIP assay in LNCaP cells ‐/+ R1881 (β‐actin fragment was amplified as control).   As shown  in Figure 2.4. E, Hsp27  is present, along with AR (which serves as a positive control)  on  the AREs.    In  the presence of R1881, higher  levels of AR and Hsp27 were recruited  to  the  promoter proximal region (ARE I) and also to the enhancer region (ARE III) of the PSA promoter.  These data indicate that Hsp27 continues to interact with the AR transcriptional complex at the  level of the ARE, and appears to be regulated by androgen.  A       B           63  C          D              E         64  Figure 2.4. Effect of Hsp27 on AR trans‐activation.   A: Hsp27 over‐expression increases AR transactivation. LNCaP cells were transiently co‐ transfected  with  1  µg  of  PSA‐Luciferase  and  indicated  concentrations  of WT  Hsp27,  followed by R1881 or vehicle  for 24 h.   Total amount of plasmid DNA  transfected was  normalized to 2 µg/well by addition of Empty vector (left). Hsp27 knockdown decreases  AR  transactivation.  LNCaP  cells were  treated with  indicated dose of OGX‐427 or MM  control  (right).  Cells  were  harvested  and  luciferase  activity  was  determined.  Data  represents means of at least 3 independent experiments performed in triplicate. Fold is  measured relative to PSA activation with no treatment.   B: Effect of Hsp27 phosphorylation on AR transactivation. LNCaP cells were transiently  co‐transfected with 1 µg of PSA‐Luciferase with  indicated concentrations of Hsp27 TM  (Ser 15, 78 and 82 were mutated to alanine) followed by R1881 or vehicle for 24 h.  The  total amount of plasmid DNA  transfected was normalized  to 2 µg/well by addition of  Empty vector (left). LNCaP cells were transfected with 1 µg/well of PSA‐Luciferase prior  to  indicated concentration of SB 203580 for 1 h prior to R1881 treatment (right). Data  represents means of at least 3 independent experiments performed in triplicate. Fold is  measured relative to PSA activation with no treatment.   C: Hsp27 knockdown decreases PSA mRNA expression (left). LNCaP cells were treated as  indicated and RNA extracted for Northern blot analysis of PSA and Hsp27, using GAPDH  as  a  loading  control.  Hsp27  triple mutant  decreases  PSA mRNA  expression  (middle).  LNCaP cells were transfected with Hsp27 TM, 24h after transfection, cells were treated  with  R1881  for  16  h  and  RNA was  extracted  for  Northern  blot  analysis.  p38  kinase  inhibition decreases PSA mRNA expression (right). LNCaP cells were treated for 2 h with  SB203580 (10 µM) prior to R1881 and RNA were extracted for Northern blot analysis.   D:  Hsp27  knockdown  decreases  AR  binding  to  its  response  elements.  EMSA  was  performed  using  radiolabeled  PSA  oligonucleotides with  nuclear  cell  extracts  isolated  from LNCaP treated with different concentrations of Hsp27 ASO. For controls, 10 µg of  nuclear protein were incubated 20 min with cold PSA oligonucleotide.   E: Hsp27 recruitment to the promoter of PSA gene. LNCaP cells were treated with 10 nM  R1881  for  4  h.  Soluble  chromatin was  prepared  from  formaldehyde‐cross‐linked  and  sonicated  cell  culture.  Immunoprecipitation  was  performed  using  AR  or  Hsp27  antibodies, along with IgG as control. The final DNA extractions were amplified using the  primers for AREI and ARE III.      2.3.5 Hsp27 Knockdown Induces AR Degradation via the Proteasome‐mediated Pathway   Hsp27 knockdown or inhibition of phosphorylation inhibits androgen stimulated nuclear  translocation of the AR with subsequent suppression of AR regulated gene expression. In order  to  investigate the fate of AR after Hsp27 knockdown, changes  in AR mRNA and protein  levels  after  treatment with OGX‐427 were  evaluated. AR mRNA  levels  did  not  change  after Hsp27  65  knockdown  (Figure  2.5.  A,  left).  In  contrast Hsp27  knockdown  decreased  AR  (Figure  2.5.  A,  middle) and Hsp90 (Figure 2.5. A, right) protein levels in a dose dependent manner. The effect  of Hsp27 knockdown on AR protein  stability was next evaluated using  cyclohexamide, which  inhibits protein synthesis. As shown in Figure 2.5. B, left, AR protein levels decrease significantly  with  rapid  degradation  after  OGX‐427‐induced  knockdown  of  Hsp27.  In  contrast,  Hsp27  overexpression prolonged AR half‐life compared  to Empty vector‐transfected controls  (Figure  2.5. B, right). AR degradation after Hsp27 knockdown occurs via the proteasome pathway, since  treatment with  the proteasome  inhibitor MG‐132  suppressed Hsp27  knockdown‐induced AR  degradation  (Figure  2.5.  C).  Taken  together  these  findings  indicate  that  Hsp27  knockdown  induces AR degradation via a proteasome‐mediated pathway.      66  A     B    C       67  D       Figure 2.5. Effect of Hsp27 knockdown on AR expression and stability.  A: AR mRNA levels are not affected by Hsp27 knockdown (left). LNCaP cells were treated  in a dose dependent manner with OGX‐427 or MM control oligos, and AR, Hsp27 mRNA  levels  in LNCaP cells was analyzed by RT‐PCR and actin was monitored as a control. AR  and Hsp90 protein levels are decreased by Hsp27 knockdown. LNCaP cells were treated  with  indicated  concentration  of  OGX‐427  or  MM  controls  and  protein  levels  of  AR  (middle) Hsp90  (right) and Hsp27 determined by western blot. Vinculin was used as a  loading control.   B: Hsp27 levels affect AR stability. LNCaP cells were treated with 70 nM OGX‐427 or MM  control (left panel) or transfected with Empty vector or Hsp27 WT and then treated with  10 µmol/L cycloheximide for indicated time period. DMSO was used as control. AR and  Hsp27 protein levels were measured by Western blot analysis.   C:  Hsp27  knockdown  accelerates  proteasomal  degradation  of  AR.  LNCaP  cells  were  treated with OGX‐427 or MM control and 10 µmol/L MG‐132 for 6 h. DMSO was used as  control. AR protein level was measured by western blot analysis.   D: Effect of Hsp27 knockdown on AR/Hsp90 association: LNCaP cells were treated with  70  nM  OGX‐427  or  MM  control  in  the  presence  of  FBS.  Immunoprecipitation  was  performed  using  AR  antibody  and  western  blot  analysis  was  done  using  Hsp90  antibodies (left). Effect of Hsp27 knockdown on AR/MDM2 association. LNCaP cells were  treated  with  70  nM  OGX‐427  in  the  presence  of  MG‐132  (10  µmol/L)  for  6  h.  AR  immunoprecipitation and western blot was performed with anti‐MDM2 (middle). Effect  of Hsp27 knockdown on AR/ubiquitin association. LNCaP cells were treated with 70 nM  OGX‐427  in the presence of MG‐132  (10 µmol/L)  for 6 h. AR  immunoprecipitation and  western blot was performed with anti‐ubiquitin antibody (right). Input was blotted with  Hsp27 antibody.      68  2.3.6 Hsp27  Knockdown  Disrupts  AR‐Hsp90  Association  and  Increases  AR‐MDM2  Association and Ubiquitination  AR forms a heterodimer complex with Hsp90 to provide stability for ligand‐unbound AR  (76). Indeed, without Hsp90 binding, the unfolded protein will be recognized and degraded by  the  ubiquitin‐proteasome  system  (209,  320).  Hsp27  knockdown  by  OGX‐427  significantly  disrupts the association between AR and Hsp90 (Figure 2.5. D,  left). This  indicates that Hsp27  knockdown‐induced  dissociation  between  AR  and  Hsp90  may  render  the  AR‐Hsp90  heterocomplex vulnerable to degradation by the proteasome‐mediated pathway. Since AR has  been  reported  to  be  ubiquitinated  by  the  E3  ligase, MDM2  (321,  322), we  next  set  out  to  determine  whether  interaction  between  MDM2  and  AR  increased  after  OGX‐427‐induced  Hsp27  knockdown.  As  predicted,  Hsp27  knockdown  increased  the  association  between  endogenous MDM2 and AR as shown by co‐immunoprecipitation experiments in Figure 2.5. D,   middle.  Furthermore, Hsp27  knockdown  increased  levels  of  ubiquitinated  AR  (Figure  2.5. D,  right). These results indicate that OGX‐427‐induced Hsp27 knockdown dissociates the Hsp90‐AR  heterocomplex, and increases MDM2‐mediated AR ubiquitination and degradation.  2.3.7 In  vivo Hsp27  Knockdown  by OGX‐427 Decreases  LNCaP  Proliferation  Rates,  Serum  PSA Levels, and AR Client Protein Expression Levels  Our results establish a novel mechanism whereby ligand‐activated AR phospho‐activates  Hsp27  to  cooperatively  enhance AR  nuclear  translocation  and  transcriptional  activity. Hsp27  knockdown  leads to AR degradation, and reduced PSA transcription and LNCaP cell growth  in  vitro. We sought to determine whether in vivo Hsp27 knockdown with OGX‐427 decreased AR  activity in LNCaP xenografts. Male nude mice were injected subcutaneously with 1x106 LNCaP‐ Probasin‐driven luciferase transfected cells (Appendix 3) and once tumours were palpable with  69  serum  PSA  levels  ~25  ng/ml  and  bioluminescence  was  detectable  using  the  IVIS  Xenogen  monitor, mice were treated with 20 mg/kg of OGX‐427 or mismatch control. A bioluminescent  signal  first  became  detectable  when  serum  PSA  levels  reached  ~5  ng/ml,  and  was  easily  detected at serum PSA levels above 20 ng/ml. Mice were subjected to three different types of  measurements: bioluminescence of probasin‐promoter driven luciferase activity (a measure of  in vivo AR activity in LNCaP xenografts), serum PSA levels, and tumour volume. Measurements  were done at baseline before  treatment  (day 0), during  treatment  (day 4), and at  the end of  treatment  (day  8).  Beginning  day  4,  OGX‐427  decreased  bioluminescence  and  reduced  circulating PSA levels by 60% (p <0.01) with a slight 15% decrease in tumour volume (Figure 2.6.  A  and B),  individual data  are presented  in  (Appendix  4).  In  contrast, mice  treated with MM  control  ODN  showed  an  anticipated  increasing  trend  on  bioluminescence  and  PSA  levels,  coincident with  increasing tumour volume during the 8 day treatment period. Western blot of  snap frozen xenograft samples (Figure 2.6. C) and immuno‐staining data (Appendix 5) indicates  that OGX‐427 decreased LNCaP xenograft levels of AR, Hsp27, and Hsp90. In addition, OGX‐427  also decreased Ki67 staining (Appendix 5). Collectively, these data suggest that the in vivo anti‐ cancer activity of OGX‐427 results, in part, from AR disruption, and that serum PSA may prove a  useful surrogate of pharmacodynamic activity as OGX‐427 moves into human trials.       70  A             B       C       71  D   Figure 2.6. OGX‐427 suppresses probasin  luciferase  (Pb‐Luc) bioluminescence as well  as AR, Hsp90 and Hsp27 levels in vivo.  A: In vivo imaging of LNCaP‐Pb‐Luc xenografts after OGX‐427 treatment by IVIS imaging  system:  Intact male mice were  injected  subcutaneously with 1x106 LNCaP‐Pb‐Luc  cells  and once tumours formed with serum PSA levels ~25ng/ml, were treated with 20 mg/Kg  of OGX‐427  or MM  for  7  days. Bioluminescence  indicates  probasin  luciferase  activity  before (day 0), during (day 4), and after (day 8) treatment.   B: Effect of OGX‐427 treatment on serum PSA levels. Changes in serum PSA levels from  mice  treated with OGX‐427  or MM  control were measured  using  IMX  immunoassays  (left).  Effect  of OGX‐427  treatment on  LNCaP  tumour  volume.  Xenograft  volume was  measured  by  caliper  at  indicated  time  (right).  Data  represents  average  ±  SEM  of  5  mice/group.   C: Total LNCaP xenograft proteins were extracted  in RIPA buffer after MM or OGX‐427  treatment  (5 mice/group)  and western  blots  performed with  AR,  Hsp90,  and  Hsp27  antibodies; Vinculin was used as a loading control.   D: Schema  illustrating cooperative  interactions between  ligand‐activated AR and Hsp27  phosphorylation: Androgen binding to AR leads to rapid Hsp27 phosphorylation via p38  kinase pathway, which displaces Hsp90 and chaperones AR  to  the nucleus  to enhance  activation of AR‐regulated genes (left). OGX‐427 induced Hsp27 knockdown destabilizes  AR/Hsp90  heterocomplex  and  leads  to  MDM2‐mediated  ubiquitination  and  AR  proteasomal degradation (right).     72  2.4 Discussion  Hsp27 is an ATP‐independent chaperone that is phospho‐activated by cell stress to form  dimers  or  small  oligomers  that  prevent  aggregation  and/or  regulate  activity/degradation  of  certain client proteins. The chaperone activity of Hsp27 is regulated by stress‐induced changes  in phosphorylation and oligomerization (323). As a cytoprotective chaperone situated as a ‘Hub’  at  the  center  of many  pathways  regulating  cellular  response  to  therapeutic  stress,  targeted  inhibition  of  Hsp27  would  inhibit  many  pathways  implicated  in  cancer  progression  and  resistance.    The  cytoprotective  effects  of  Hsp27  result  from  its  ubiquitin  binding  and  degradation  of  I‐ĸB  (307),  direct  interference  of  caspase  activation, modulation  of  oxidative  stress,  and  regulation of  the  cytoskeleton  (306, 324).   Higher  levels of Hsp27  are  commonly  detected in many cancers including prostate (226, 229, 325), and is associated with metastasis,  poor prognosis and resistance to chemotherapy or radiation (326, 327). We recently reported  that  over‐expression  of  Hsp27  in  LNCaP  cells  suppressed  castration‐induced  apoptosis  and  confers  androgen‐resistance  (229),  while  Hsp27  knockdown  using  ASO  potently  decreases  Hsp27 levels, increases caspase‐3 cleavage and apoptosis, enhances paclitaxel chemosensitivity,  and delays tumour progression in vivo (226, 229).   Human Hsp27  is phosphorylated on three serine residues, Ser15, Ser78 and Ser82. p38  kinase and Akt were reported to be the Hsp27 kinases (317, 318) although PKC α, δ and cAMP‐ dependent kinase can also phosphorylate Hsp27  (328). Hsp27 becomes phosphorylated when  exposed to angiotensin (328), IL‐6 , IL‐1, heat shock and TNF‐α (329). Using LNCaP cells, which  express AR and are sensitive to androgens, we demonstrate that androgens increase phospho‐ Hsp27 levels within minutes in a dose, time, and p38 Kinase pathway dependent manner. This  73  rapid androgen/AR‐mediated Hsp27 phosphorylation  identifies a non‐genomic mechanism  for  AR in LNCaP cells. These findings are in agreement with previous studies indicating that steroids  can  act  via  classical  steroid  receptors  or  through  atypical membrane  receptors  and  that  AR  mediates non‐genomic  activation  in  response  to  androgens  (296, 300).  Ligand binding  to AR  induces  its association with Src via Src SH3 domain and AR proline‐rich domain triggering Src‐ dependent pathway activation  (296, 300).  In AR‐negative COS‐1 and PC3 cells, transfection of  AR is necessary for R1881 induction of c‐Src/Raf/ERK and Akt, respectively. In AR positive LNCaP  cells, the anti‐androgen bicalutamide suppresses R1881‐stimulated Hsp27 phosphorylation.  In  AR negative PC3 cells, Hsp27 phosphorylation is insensitive to androgens but is enhanced when  AR is transiently over‐expressed in PC3 cells. This non‐genomic stimulation is supported further  by  interaction  and  co‐localization  of Hsp27 with AR. Hsp27  binds with AR  via  its N‐terminal  domain  and may  directly  or  indirectly  involve  other  AR  co‐regulators  including  STAT3  and  ARA55, both of which have been reported to associate with Hsp27 (330, 331).   In the classical model of androgen action, in response to androgens, AR dissociates from  Hsp90 (301). Interestingly, we found that following androgen treatment Hsp27 becomes more  abundantly  associated with AR  as AR  dissociates  from Hsp90,  suggesting  a  dynamic  role  for  molecular chaperones  in AR shuttling. This non‐genomic action of AR ultimately  influences  its  classical  genomic  effects.  Once  in  the  nucleus,  ligand‐bound  nuclear  receptors  like  AR  are  recruited  to  target  gene  promoters  either  through  direct  binding  to  hormone  response  elements or association with other promoter‐bound transcription factors (301). Many proteins  participate in the activation of AR, some through directly binding to AR, and others via a tertiary  complex with other transactivators. Hsp27 has now been identified as a chaperone interacting  74  with the AR transcriptional complex at the level of its ARE. Recent reports indicate that the AR  co‐activators STAT3 and ARA55 also interact with Hsp27 (229, 330). Hence, Hsp27 and AR may  complex  with  either  ARA55  or  STAT3  to  cooperatively  promote  AR  translocation  and  transactivation.  Interestingly,  PSA  transactivation  in  LNCaP  cells  is  enhanced  by  Hsp27  overexpression and suppressed by Hsp27 knockdown or  inhibition of Hsp27 phosphorylation.  Similarly,  in ER+ MCF‐7 breast  cancer  cells,  inhibition of p38  kinase  signaling  also blocks ER‐ mediated  transcription  by  inhibiting  nuclear  translocation  of  ERα  (332).  Furthermore, Hsp27  knockdown decreases AR nuclear translocation and binding to its ARE.   Previous  studies  emphasize  the  importance  of  Hsps  in  steroid  receptor  stability.  For  example,  Hsp90  inhibitors  such  as  geldanamycin  induce  steroid  receptor  degradation  by  directly binding  to  the ATP‐binding pocket of Hsp90 and  thereby  inhibiting  its  function  (209,  320). Results shown in Figure 2.5. and Figure 2.6. indicate that Hsp27 knockdown de‐stabilizes  AR by inducing dissociation of the AR/Hsp90 heterocomplex and increasing AR association with  the  E3  ligase  MDM2,  with  subsequent  ubiquitin‐proteasome‐mediated  AR  degradation.   Although  both  OGX‐427  and  geldanamycin  share  the  ability  to  abrogate  the  interaction  between AR and Hsp90,  they do  so by different mechanisms.  Interestingly, OGX‐427  induces  degradation of Hsp27, AR, and Hsp90, while geldanamycin binding to the ATP‐binding pocket of  Hsp90 inhibits its chaperone activity (333), induces degradation of client proteins (334), and is  accompanied by stress‐activated increases in Hsp70 and Hsp27 (335).   The effects of OGX‐427 on AR expression and activity in vitro were recapitulated in vivo.  OGX‐427  induced rapid decreases  in probasin‐luciferase reporter driven bioluminescence that  75  correlated with early decreases in serum PSA, and decreased LNCaP xenograft levels of AR and  its chaperones, Hsp90 and Hsp27. In PCa where the AR is critically important, ligand‐activated AR  leads to rapid p38 kinase‐mediated phosphorylation of Hsp27, which in turn, complexes with and  chaperones  the  AR  to  enhance  its  stability,  shuttling,  and  transcriptional  activity.  OGX‐427‐ induced knockdown of Hsp27 destabilizes the AR and enhances its ubiquitination and degradation.  Collectively,  these  data  identify  a  novel  mechanism  for  Hsp27  as  an  AR  chaperone  (as  summarized  in model  illustrated  in Figure 2.6. D) and  justifies  further  investigation  targeting  Hsp27 as therapeutic for PCa.  76  CHAPTER 3: Lyn  Tyrosine  Kinase  Regulates  Androgen  Receptor  Expression  and  Activity  in  Castrate  Resistant  Prostate Cancer2  3.1 Introduction  PCa  is  the  second  leading cause of cancer‐related death  in North American men  (95).  Despite improvement in the disease diagnosis, management options for patients with advanced  forms  of  the  disease  are  limited  to  androgen‐ablation  therapy.  This  treatment  induces  apoptosis in androgen‐sensitive tumour cells; however most of the patients suffer from disease  progression to CRPC within 2 years of treatment initiation (336‐341). AR stays active and plays a  crucial role during progression of PCa to CRPC (176, 177). A growing body of evidence supports  the relevant role of tyrosine kinases in AR reactivation during CRPC progression (169, 342).   Src family of non‐receptor tyrosine kinases (SFKs)  including Src, Frk, Fyn, Yes, Hck, Lck,  Blk, Fgr, Yrk, Brk and Srm modulate a wide range of cellular processes including cell migration,  differentiation and proliferation  (343, 344). Different members of  the Src  family share similar  domain  structure but  recent  studies  revealed  that each  family member may possess unique  roles (344, 345).  Src family members can confer signaling through their ability to phosphorylate                                                         2 A version of this chapter will be submitted for publication. Zardan A, Beraldi E, Fazli L, Nip K, Lamoureux  F, Gust K, Cox ME, Gleave ME and Zoubeidi A.  Lyn  tyrosine kinase  regulates androgen  receptor expression and  activity in castrate resistant prostate cancer.    77  particular substrate or by their spatial compartmentalization in membrane micro‐domains and  subcellular distribution  (113, 258, 259, 346, 347). Lyn tyrosine kinase  is an SFK that  like other  members of  the SFK  is  thought  to participate  in signal  transduction via cell surface  receptors  that lack intrinsic tyrosine kinase activity in response to a large number of extracellular stimuli,  such as growth factors and cytokines (251, 261).   Lyn kinase like other members of the family is ordinarily maintained in a closed inactive  conformation through two major  intramolecular  inhibitory  interactions, namely binding of the  phosphorylated C‐terminal  tyrosine  residue, Tyr508,  to  the  Src homology 2  (SH2) domain  and  interaction of the polyproline type II helical motif in the SH2‐kinase linker with the SH3 domain  (257,  258).  Lyn  activation  involves  disruption  of  these  inhibitory  interactions  through  the  combined effects of Tyr508 dephosphorylation, displacement of  the  tail  from  the SH3 domain,  displacement of  the PPII motif  from  the SH3 domain and autophosphorylation of  the specific  Lyn Tyr396 in the activation loop.  Knockout  studies  clearly  indicate  that  each  SFK  member  plays  unique  physiological  function (270).  In vitro analysis of PCa cells demonstrated that targeting Lyn expression, using  ASO  and  siRNA,  or  Lyn  activity  ,  using  inhibitory  peptide,  affects  proliferation  and  tumour  volume in the DU145 xenograft model, whereas Src knockdown affects migration and invasion  (267,  348).  Furthermore,  Lyn‐deficient  mice  display  a  compromised  prostate  gland  development  (251,  275)  while  Src‐deficient  mice  fail  to  remodel  bone  indicating  impaired  osteoclast  function and exhibit osteoporosis  (275, 348). Unlike  Src,  Lyn was  found  to be up‐ regulated in leukemia patients resistant to the Bcr‐Abl inhibitor, Imatinib/Gleevec (349). Lyn is  78  expressed in normal prostate epithelium and majority of the primary human PCa specimens and  is  up‐regulated  in  CRPC  (266).  Current  literature  suggests  a  distinctive  role  for  Src  and  Lyn  kinase, even when expressed  in  the same cell  types  in normal and cancer circumstances  (52,  267).  Here  we  report  that  both  expression  and  activation  state  of  Lyn  kinase  positively  correlates with PCa progression  to CRPC. We also  show  that  Lyn kinase  regulates expression  and  activity  of  AR.  Furthermore,  inhibition  of  Lyn  expression  and  activity  using  siRNA  techniques  disrupts  the  binding  of  AR  to  heat  shock  protein  90  (Hsp90)  and  increases  the  ubiquitination and degradation of AR.  3.2 Materials and Methods  3.2.1 Cell Culture and siRNA Transfection   LNCaP cells were maintained in RPMI with 5% fetal bovine serum (311) and treated with  Lyn siRNA or scrambled siRNA control with oligofectamine in serum free OPTI‐MEM (Invitrogen‐ Life Technologies,  Inc., Burlington, Ontario, Canada)  for 20 min. 4 h  later, 5% FBS was added.  Cells were  treated  once  daily  for  two  successive  days  and  harvested  48  h  after  the  second  treatment.   3.2.2 Plasmid, Reagents and Antibodies  Lyn wild‐type, Empty vector, dominant negative and constitutively active plasmids were  generously provided by Dr. Charles W. Emala (Columbia University, New York, New York) (350).   AR (N‐20), Lyn (H‐6), PSA (C‐19) antibodies were purchased from Santa Cruz Biotechnology, Inc.,  79  and Src, PARP antibodies were purchased from  Cell Signaling, California., Actin antibody (Clone  C4)  was  purchased  from  Millipore,  California.,  Anti‐Lyn  (phosphor‐Y396)  antibody  was  purchased  from  Abcam.  Lyn  siRNA  (human,  sc‐29393)  was  purchased  from  Santa  Cruz  Biotechnology, Inc. Transfection reagent OligofectAMINE, lipofectin and serum‐free OPTI‐MEM  media were purchased from Invitrogen Life Technologies Inc.  3.2.3 Cell Proliferation and Apoptosis Assays  LNCaP  cells were  transfected with  Lyn  siRNA or  scrambled  siRNA  control  twice.  72 h  post  second  transfection,  cell growth was measured using  the  crystal violet assay. Detection  and  quantitation  of  apoptotic  cells  were  done  by  flow‐cytometry  (described  below)  and  western blotting  analysis. Each  assay was done  three  times. Caspase‐3  activity was  assessed  using the kit CaspACE Assay System, Fluorometric (Promega, Madison, WI, USA). 50 µg of total  cell  lysate were  incubated with caspase‐3 substrate AC‐DEVD‐AMC at room temperature for 4  h.  The  caspase‐3  activity  was  quantified  in  a  fluorometer  with  excitation  at  360  nm  and  emission 460 nm.  3.2.4 Cell Cycle Analysis  LNCaP cells were transfected twice with Lyn siRNA or scrambled siRNA control. 5 days  post transfection, cells were trypsinized, washed twice and  incubated  in PBS containing 0.12%  Triton X‐100, 0.12 mM  EDTA  and  100  μg/ml  ribonuclease A. Cellular  total DNA  content was  measured by staining fixed cells with 50 μg/ml propidium iodide for 20 min at 4°C and cell cycle  distribution  was  analyzed  by  flow  cytometry  (Beckman  Coulter  Epics  Elite,  Beckman,  Inc.,  80  Miami, FL), based on the percentage of cells at the sun G0, G1, S and G2 phases. Each assay was  done in triplicate.  3.2.5 Transfection and Luciferase Assay  LNCaP cells (2.5 X 105) were plated on 6‐well plates and transfected using  lipofectin (6  µl/well)  (Invitrogen‐Life  Technologies,  Inc.).  The  total  amount  of  plasmid  DNA  used  was  normalized  to 2 µg/well by  the addition of a control plasmid. Media was replaced by CSS +/‐  R1881,  24  h  after  transfection  for  another  24  h.  Luciferase  activities  measured  using  the  microplate luminometer (EG&G Berthold). All experiments were carried out in triplicate.  3.2.6 Chromatin Immunoprecipitation (ChIP)  LNCaP cells were  treated with 10 nM of R1881  for 4 h and subsequently, were cross‐ linked  with  paraformaldehyde  and  sonicated.  ChIP  assay  was  performed  using  EZ  ChIP  kit  according to the manufacture (Upstate) on the PSA gene regions ARE I.  3.2.7 Quantitative Reverse Transcription‐PCR  Total RNA was extracted from cultured cells after 48 h of treatment using TRIzol reagent  (Invitrogen  Life  Technologies,  Inc.).  2  μg  of  total  RNA  was  reversed  transcribed  using  the  Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Science).   Real  time  monitoring  of  PCR  amplification  of  complementary  DNA  (cDNA)  was  performed  using  DNA  primers  Lyn  forward  primer:  CAGGGAGGAGCCCATTTACA  and  Lyn  Reverse  primer:  CAGCACTTTGCCACCTTCATC,  on  ABI  PRISM  7900  HT  Sequence  Detection System (applied Biosystems) with SYBR PCR Master Mix (Applied Biosystems). Target  81  gene expression was normalized to β‐actin levels in respective samples as an internal standard.  The comparative cycle threshold (Ct) method was used to calculated relative quantification of  target mRNAs. Each assay was performed in triplicate.  3.2.8 Protein Stability  LNCaP  cells were  plated  and  treated with  Lyn  siRNA  or  scrambled  siRNA  control,  or  transfected with Lyn WT or Empty vector as described above. Media was changed 48 h later to  RPMI  +  5%  serum  containing  10  µM  of  cyclohexamide  incubated  at  37°C  for  2‐6  or  16  h.  Western blot was performed using AR, Lyn and Vinculin antibodies.     3.2.9 Animal Treatment  LNCaP  cells  stably  overexpressing  Lyn  kinase  (LNCaPLyn)  or  Empty  vector  (LNCaPEmpty)  were generated using clonal selection. Male athymic nude mice (Harlan Sprague‐Dawley,  Inc.)  were  injected  subcutaneously with 2 × 106 LNCaPEmpty or LNCaPLyn cells  (suspended  in 0.1 mL  Matrigel; BD Biosciences). The mice were castrated once tumours reach between 300 and 500  mm3 or the PSA  level  increased above 50 ng/mL. Rate of tumour growth and PSA relapse was  determined after castration. Each experimental group consisted of 6 mice. Tumour volume was  measured once weekly  (V=  4/3  πR3).  Serum PSA  level was determined weekly by  enzymatic  immunoassay (Abbott IMX). PSA doubling time (PSA dt) and velocity were calculated by the log‐ slope method  (PSAt  =  PSAinitial  ×  emt)  (160).  Data  points were  expressed  as  average  tumour  volume ± SEM or average PSA concentration ± SEM.   When tumour volume reached 10% or more of body weight, mice were sacrificed and  tumours were  harvested  for  evaluation  of  protein  expression  by Western  blot  analyses  and  82  immunohistochemistry. All animal procedures were carried out according to the guidelines of  the  Canadian  Council  on  Animal  Care  and  appropriate  institutional  certification  (Animal  protocol: A10‐0165).   3.2.10 Immunohistochemistry Analysis  PCa tissue specimens were obtained from Vancouver Prostate Centre Tissue Bank. The  H&E  slides were  reviewed  to mark  the desired  areas  and  the  corresponding paraffin blocks.  Three TMAs were manually constructed (Beecher Instruments, MD, USA) by punching duplicate  cores of 1mm  for each  sample. All  the  specimen were  from  radical prostatectomy except 12  CRPC  samples  which  were  obtained  from  transurethral  resection  of  the  prostate  (TURP).  Immunohistochemical  staining  was  conducted  by  Ventana  autostainer model  Discover  XT™  (Ventana Medical System, Tuscan, Arizona) with enzyme labeled biotin streptavidin system and  solvent  resistant  DAB  Map  kit  by  using  1:10  concentration  of  Lyn  (H‐6),  p‐Lyn  and  Src  antibodies.     Statistical Analysis: All data were analyzed by  two‐tailed unpaired  student’s  t  test or  one‐way analysis of variance  (ANOVA) with post‐hoc test. Overall survival was analyzed using  Kaplan–Meier curves, and statistical significance between the groups was assessed with the log‐ rank test (GraphPad Prism). Levels of statistical significance were set at P < 0.05.  83  3.3 Results  3.3.1 Lyn Expression Is Increased with Progression to CRPC   To elucidate the role of Lyn in PCa progression to CRPC, we first analyzed the expression  of Lyn  in  three cell  lines  routinely used  in  the  field  (LNCaP, C4‐2 and PC‐3). This panel of cell  lines  includes  cells with androgen‐dependent and androgen‐independent growth  features, as  well as positivity and negativity  in  terms of AR protein expression. Levels of endogenous Lyn  were  detected  by  western  blot  analysis.  Whole  protein  cell  lysates  were  prepared  from  androgen‐dependent  LNCaP  cells,  the  LNCaP  lineage‐derived  castrate‐resistant  subline,  C4‐2  cells,  and  an  independently derived AR‐deficient  castrate‐resistant  cell  line, PC‐3  cells.   C4‐2  cells express functional AR and can be grown in an androgen‐independent manner which makes  them an excellent model representing transition of the  initial androgen‐dependent disease to  the CRPC state. As shown in Figure 3.1. A, left, Lyn expression was very low in PC‐3 cells which  lack AR compared to LNCaP and C4‐2 cells which express AR. Furthermore, up‐regulation of Lyn  kinase  expression  was  more  significant  in  castrate  resistant  C4‐2  cells  in  comparison  with  castrate sensitive LNCaP cells  (Figure 3.1. A,  left).   These  findings suggest that Lyn expression  correlates with AR protein expression and progression to CRPC. We next evaluated changes  in  Lyn expression  levels  in the LNCaP xenograft model, which mimics progression to CRPC, after  castration.  Consistent  with  results  from  the  LNCaP  and  C4‐2  cell  lines,  western  blots  of  treatment‐naïve and castrate‐resistant LNCaP tumours showed that Lyn levels clearly increased  after  castration  (Figure  3.1.  A,  right).  To  further  confirm  that  the  up‐regulation  of  Lyn  is  a  consequence of androgen ablation, LNCaP cells were cultured in charcoal striped serum (CSS) to  84  mimic androgen ablation  in vitro and Lyn expression was analyzed at the protein  level. Figure  3.1. A, (middle), shows that androgen ablation up‐regulates Lyn in a time dependent manner.  3.3.2 Lyn and p‐Lyn Y396 Expression Is Elevated in CRPC Specimens  To  support  and  further  clarify  the  findings  from  the  model  systems,  immunohistochemistry  analysis  was  performed  using  a  human  prostate  tissue  microarray  (TMA).  This  TMA  was  constructed  from  152  naïve  PCa  specimens  and  20  CRPC  specimens  (obtained via  transurethral  resection of  the prostate). Using  this TMA, we  first measured  the  expression  level of total Lyn kinase and found that Lyn expression  level was on average 2‐fold  higher in CRPC specimens as compared with naïve tumour specimens (*, P < 0.05; Figure 3.1. B).  Expression  level  of  Src  kinase was  likewise measured  using  the  same  TMA.  Interestingly,  in  comparison with Lyn expression  level, which was 2  fold higher  in CRPC specimens, Src kinase  expression was only  increased 0.5‐fold  (ns, not  significant,  Figure 3.1. D). Next we  stained  a  TMA constructed from 146 naïve PCa and 14 CRPC, specimens to look for the activated form of  Lyn kinase, p‐Lyn Y396. A significantly positive correlation was also observed with the expression  level  of  p‐Lyn  Y396  and  tumour  progression  to  CRPC  (**,  P  <  0.01;  Figure  3.1.  C).  The  immunohistochemistry  data  further  suggest  the  important  and  specific  role  of  Lyn  in  CRPC  development.   A    85  B      C   D   86  Figure 3.1.  Lyn expression in PCa progression.   A,  left: Lyn expression  in PCa cell  lines: Total proteins from LNCaP, C4‐2 and PC‐3 cells  were  extracted using RIPA buffer.   Western blot were performed using  Lyn,  and PSA  antibodies;  Actin  was  used  as  loading  control.  A,  right:  Lyn  expression  in  CRPC  progression  in LNCaP xenograft model, Proteins were extracted from LNCaP xenografts  before  castration  (intact)  or  after  progression  to  castration  resistant. Western  blots  were performed using Lyn antibody and Actin was used as a loading control. A, middle:  Lyn expression after R1881 and CSS Treatment: LNCaP cells were cultured  in R1881 or  CSS media and Lyn expression was analyzed at the protein level.   B,  C  and  D:  Immunohistochemistry  analysis  for  total  Lyn,  p‐Lyn  Y396  and  total  Src  expression  level  in  PCa  tumours  (*,  P  <  0.05;  **,  P  <  0.01;  ns,  not  significant;  respectively). Specimens  from untreated  tumours  (PCa naïve) and CRPC patients were  submitted  to  immunohistochemical  staining  conducted by Ventana autostainer model  Discover  XT™  (Ventana Medical  System,  Tuscan, Arizona) with  enzyme  labeled  biotin  streptavidin system and solvent resistant DAB Map kit by using: 1/10 concentration of  Lyn (H‐6): sc‐7274, Anti‐Lyn (p‐Lyn Y396): ab40660, Anti‐Src: SC‐130124.  Specimens were  graded from 0 to +3 intensity representing the range from no staining to heavy staining  by visual scoring and automated quantitative image analysis by pro‐plusimage software.      3.3.3 In vivo Lyn Over‐Expression Accelerates Castrate‐Resistant LNCaP Tumour Growth and  Serum PSA Relapse to Pre‐Castration Levels  To further study the role of Lyn kinase in progression of PCa to castrate resistant stage,  LNCaP xenograft model was used.  LNCaP cells  stably overexpressing Lyn kinase  (LNCaPLyn) or  Empty  vector  (LNCaPEmpty) were  generated  using  clonal  selection.  Two  clones  that  exhibited  increased expression of Lyn kinase compared to control cells were selected for further studies  (Figure 3.2. A, left). Serum PSA level and tumour volumes were followed weekly and mice were  castrated when serum PSA values reached 50 ng/ml. We did not observe a significant difference  in  the  rate of  tumour  take or disease  initiation between  the mice  injected with LNCaPLyn and  LNCaPEmpty (data not shown). Interestingly, a higher rate of tumour growth and PSA relapse was  observed  after  castration  in  mice  bearing  the  LNCaPLyn  xenograft  tumour  compare  to  the  LNCaPEmpty xenograft tumour (*, P < 0.05; ***, P < 0.001; respectively, Figure 3.2. B and C, n=6).  The PSA velocity  (rate of change of PSA overtime) was analyzed and  the  results confirmed a  87  significant higher  rate  in LNCaPLyn‐ compared  to  the LNCaPEmpty‐tumour bearing mice  (**, P <  0.01;  Figure  3.2.  D)  (160).  Consequently,  significant  prolongation  of  the  progression‐free  survival was observed in LNCaPEmpty compared with the LNCaPLyn group (**, P < 0.01, Figure 3.2.  E). Total protein was extracted from the xenograft tumours and levels of AR, PSA, FKBP52, Akt,  pAkt were  analyzed  (Figure  3.2.  F).  Results  of  protein  analysis  revealed  a  higher AR  protein  expression as well as  its target genes, PSA and FKBP52  in the extracts obtained from LNCaPLyn  tumours compared with the LNCaPEmpty. Furthermore, a higher protein expression and activity  of  Akt,  a  key  mediator  of  cell  survival,  was  observed  in  the  LNCaPLyn  tumour  extracts  in  comparison with the LNCaPEmpty. Since the expression of indicated AR target genes was shown  to  be  higher  in  the  LNCaPLyn‐bearing  tumours,  we  sought  to  investigate  the  effect  of  Lyn  overexpression on  the AR  transcriptional activity.  Interestingly, our  results  indicated  that Lyn  Wild  Type  (WT)  overexpression  enhances  R1881  inducing  AR  transcriptional  activity  (as  measured by PSA luciferase activity) (**, P < 0.01; Figure 3.2. G).    A                                                                                        88  B         C                         D             89  E     F       G         90  Figure  3.2.  Lyn  over‐expression  accelerates  castrate‐resistant  LNCaP  tumour  growth  and serum PSA relapse to pre‐castration levels.   A  Left:  Generating  the  stable  cell  lines  over‐expression  Lyn  kinase  or  Empty  vector.  LNCaP  cells  stably  overexpressing  Lyn  kinase  (LNCaPLyn)  or  Empty  vector  (LNCaPEmpty)  were generated using clonal selection. Control cells and Clone #4 were used for the  in  vivo injection.   A right and B: Comparison of tumour size between LNCaPLyn and LNCaPEmpty xenografts  tumours post castration (*, P < 0.05; data represents average ± SEM of 6 mice/group).  Lyn overexpression accelerated the tumour growth post castration.   C: Lyn overexpression accelerated tumour PSA relapse to pre‐castration  level (***, P <  0.001; data represents average ± SEM of 6 mice/group).   D:  PSA  velocity  change  in mice  bearing  LNCaPLyn  tumour  compare  to  the  LNCaPEmpty  tumour (**, P < 0.01; data represents average ± SEM of 6 mice/group). Analysis shows  the  rate  of  change  of  PSA  level  in mice,  from  the  time  of  castration  to  the  time  of  sacrifice of the mice.   E: Comparison of progression‐free survival between LNCaPLyn and LNCaPEmpty xenografts  tumours post castration (**, P < 0.01; data represents average ± SEM of 6 mice/group).  Progression‐free  survival was  defined  as  time  for  the  first  tumour  volume  doubling.  Significant prolongation of the progression‐free survival was observed in the LNCaPEmpty  xenograft bearing mice compared with LNCaPLyn bearing mice.   F: Western blot analysis of  total protein extracted  from  the  xenograft  tumours. Total  protein was extracted from the xenograft tumours and  levels of AR, PSA, FKBP52, Akt,  pAkt were analyzed.   G:  Effect  of  Lyn  overexpression  on  AR  transcriptional  activity.  1  µg/well  of  PSA‐ Luciferase with 6 µg of Lyn WT or Lyn Empty plasmids were  transiently  transfected  to  the  LNCaP  cells  followed  by  R1881  or  vehicle  for  24h.  **,  P  <  0.01; Data  represents  means of at  least 3  independent experiments performed  in triplicate. Fold  is measured  relative to PSA activation with no treatment.       3.3.4 Lyn Knockdown Leads to AR Degradation through the Proteasome‐Mediated Pathway   Lyn expression  and  activity demonstrated  a direct  correlation with CRPC progression  and PSA relapse post‐castration, both  in vivo and  in vitro, as well as  in human tissue samples.  Furthermore,   Lyn  overexpression  increased  AR  transcriptional  activity.  Thus,  we  sought  to  further  investigate  the  potential  association  between AR  and  Lyn.  First, we  investigated  the  effect of Lyn kinase knockdown on AR protein expression and compared it with Src knockdown.  91  Western blot analysis  showed  that protein expression of AR and PSA, an AR‐regulated gene,  were decreased by Lyn but not Src knockdown (Figure 3.3. A, left, middle).   To investigate the molecular mechanisms for AR protein degradation, we first examined  the effect of Lyn knockdown on AR mRNA expression and  found that Lyn knockdown did not  influence AR mRNA level (Figure 3.3. A, right). Next, we studied the effect of Lyn knockdown on  AR protein stability. To do this, LNCaP cells were treated with Lyn siRNA or scrambled control  followed by cyclohexamide treatment for 3 h, 6 h and 16 h. AR protein decay was monitored  under RPMI containing 15% FBS condition. We observed a reduction in AR protein stability after  the Lyn knockdown treatment (Figure 3.3. B, left). Moreover, in order to examine the effect of  Lyn overexpression on AR protein stability, we performed the same experiment using LNCaPLyn  and LNCaPEmpty cells and observed that overexpression of Lyn kinase resulted  in an  increase  in  the  stability  of  AR  (Figure  3.3.  B,  right).  To  test  whether  Lyn  knockdown  enhances  AR  degradation through the proteasome pathway, LNCaP cells were treated, 48 h post Lyn siRNA  (10nM) treatment, with the proteasome inhibitor MG‐132 for 6 h. MG‐132 treatment resulted  in  suppression of Lyn knockdown‐induced AR degradation and  indicated  that Lyn knockdown  leads to AR degradation via the proteasome pathway (Figure 3.3. C).   Next, we sought to investigate the mechanism through which Lyn knockdown directs AR  for  degradation  via  the  proteasome  pathway.  To  study  this,  AR  protein  was  immunoprecipitated from whole‐cell extracts of Lyn siRNA‐ and scrambled siRNA‐treated LNCaP  cells  followed  by  western  blot  analysis  to  detect  the  AR/Hsp90  association  as  well  as  the  amount  of  ubiquitinated  AR  protein.  Results  obtained  from  the  immunoprecipitation  92  experiment  revealed  that  Lyn  knockdown  disrupts  the  association  between  AR  and  Hsp90  (Figure 3.3. D). Moreover, AR was shown  to be more ubiquitinated  in Lyn siRNA‐treated cells  compared with control siRNA‐treated cells  (Figure 3.3. D). Therefore,  these data suggest  that  Lyn knockdown results in dissociation of AR from Hsp90 which in turn leads to ubiquitination of  unstably‐folded AR and its degradation by the proteasome‐mediated pathway.    A                      B      93  C    D      Figure 3.3. Effect of Lyn knockdown on AR expression and stability.   A: AR mRNA levels are not affected by Lyn knockdown (right). LNCaP cells were treated  with Lyn siRNA or scrambled siRNA control and AR and Lyn mRNA  levels  in LNCaP cells  were analyzed by RT‐PCR. β‐actin was monitored as internal control. AR protein level is  decreased  by  Lyn  knockdown  but  not  Src  knockdown  (left  and middle). Vinculin was  used as a loading control.   B: Lyn kinase levels affect AR stability. LNCaP cells were treated with 10 nM Lyn siRNA or  scrambled siRNA control (left panel) or transfected with Empty vector or Lyn WT (right  panel) and then treated with 10 µmol/L cycloheximide for indicated time period. AR and  Hsp27 protein levels were measured by Western blot analysis.   C: Lyn knockdown accelerates proteasomal degradation of AR. LNCaP cells were treated  with Lyn siRNA or scrambled siRNA control and 10 µmol/L MG‐132 for 6 h. AR protein  level was measured by western blot analysis.   D: Effect of Hsp27 knockdown on AR/Hsp90 and AR/ubiquitin association: LNCaP cells  were treated with 10 nM Lyn siRNA or scrambled siRNA control in the presence of FBS.  Immunoprecipitation was performed using AR antibody and western blot analysis was  done using Hsp90 and ubiquitin antibodies.  Input was blotted with AR, Lyn and Hsp90  antibodies. Vinculin was used as a loading control.   94  3.3.5 Lyn Regulates AR Transcriptional Activity   To  further  clarify  the  effect  of  Lyn  knockdown  on  AR  activity,  modulation  of  AR  transcriptional activity and expression of AR downstream target genes were  investigated after  Lyn knockdown. Our results demonstrated that Lyn knockdown using siRNA, abrogates  ligand  dependent activation of AR  (as measured by PSA  luciferase activity)  (****, P < 0.0001; Figure  3.4.  A).  To  confirm  AR  transactivation  assay  results,  we  evaluated  the  expression  of  well‐ characterized,  ARE‐containing,  AR‐dependent  genes  using  qRT‐PCR.  We  found  that  Lyn  knockdown  decreased  the  expression  of  the  androgen‐dependent  endogenous  genes  like  FKBP52  and  NKX3.1  (Figure  3.4.  B).  These  results  demonstrates  that  Lyn  is  an  important  regulator  of  ligand‐dependent  AR  transcriptional  activity.  Next,  we  explored  whether  Lyn  knockdown affects the binding of AR to the ARE of the PSA promoter using ChIP assay in LNCaP  cells ‐/+ R1881. Results obtained from this study  indicated that binding of AR to the promoter  proximal  region  (ARE  I)  is  abrogated  in  the  absence  of  Lyn  kinase  (Figure  3.4.  C).  Since  Src  tyrosine kinase has been  reported  to modulate AR  transcriptional activity  (169) we sought  to  compare  the  effect  of  Src  knockdown  with  Lyn  knockdown.  The  result  showed  that  Lyn  abrogates AR  transcriptional  activity  21  times more  than  Src  knockdown  (****,  P  <  0.0001;  Figure 3.4. D).      95  A           B             96  C        D      Figure 3.4. Effect of Lyn of AR transactivation.   A:  Lyn  siRNA  inhibits  androgen  inducing  AR  transactivation.  LNCaP were  transfected  with 10 nM siRNA Lyn or control. After 24 h, cells were transfected with PSA‐Luciferase  promoter  and  24  h  later were  stimulated with  10nM  of  R1881  for  4  h  followed  by  Luciferase  activity measurement. ****, P < 0.0001; Columns, means of  at  least  three  independent experiments done in triplicate.    B: Lyn knockdown decreases AR‐dependent genes. RNA was extracted from LNCaP cells  treated  with  siRNA  Lyn  or  siRNA  Ctr.  Lyn,  FKBP52  and  NKX3.1  mRNA  levels  were  analyzed by qRT‐PCR and normalized to β‐actin.   C: AR recruitment to the promoter of PSA gene after Lyn knockdown. LNCaP cells were  treated with 10 nM siRNA Lyn or control followed by 24 h treatment with R1881 (1 nM).  Soluble  chromatin  was  prepared  from  formaldehyde‐cross‐linked  and  sonicated  cell  culture.  Immunoprecipitation  was  performed  using  AR  antibody,  along  with  IgG  as  control. The final DNA extractions were amplified using the primers for ARE I.   D:  Effect  of  Lyn  and  Src  knockdown  on  AR  transcription  activity.  LNCaP  cells  were  transfected with 10 nM  siRNA Lyn, Src and control. After 24 h, cells were  transfected  with PSA‐luciferase promoter and 24 h later were stimulated with 10 nM R1881 for 4 h.  Luciferase activities were subsequently measured. ****, P < 0.0001; Columns, means of  at least three independent experiments done in triplicate.           97  3.3.6 Lyn Knockdown Induces Cell Cycle Arrest and Apoptosis in LNCaP Cells  Since AR mediates cell proliferation and  survival  in LNCaP cells, we hypothesized  that  long‐term  treatment  with  Lyn  siRNA  leads  to  inhibition  of  LNCaP  cell  growth  and  survival  through inhibition of AR function. Inhibition of AR protein expression is observed 48 h post Lyn  siRNA  transfection without affecting  the LNCaP cell viability. However, 72 h post  transfection  we  started  to  observe  a  decrease  in  LNCaP  cell  proliferation  potential  (60%) measured  by  crystal violet assay (****, P < 0.0001; Figure 3.5. A). This was accompanied by decreased levels  of  cell‐cycle proteins, Cyclin B1, Cyclin D1  and CDC25A  (Figure 3.5. B). Next, we  studied  the  long‐term  (5  days)  effect  of  Lyn  knockdown  on  cell  cycle  progression  using  Fluorescence‐ Activated Cell Sorting (FACS) analysis. Results demonstrated that Lyn siRNA treatment led to an  increase  in  the  fraction  of  cells  undergoing  apoptosis  (sub‐G1  fraction)  compared with  the  scrambled  treated  cells  (****,  P  <  0.0001;  Figure  3.5.  C).  Consequently,  a  reduction  in  the  percentage of  cells  in  the G1,  S  and G2/M  fractions were  detected  (***,  P  <  0.001;  ns,  not  significant; ****, P < 0.0001; respectively; Figure 3.5. C). Furthermore, our western blot analysis  showed that Lyn knockdown induces PARP cleavage (Figure 3.5. D, right) and increases caspase‐ 3  activation  5  days  post  transfection  (****,  P  <  0.0001;  Figure  3.5.  D,  left).  These  results  revealed  that  Lyn  kinase  contributes  to  LNCaP  cells  proliferative  potential  through  the  regulation of AR protein expression and activity.      98  A                                                                      B                                          C                                                                      D                                      Figure 3.5. Effect of Lyn knockdown on LNCaP cell survival.   A: Effect of Lyn knockdown on LNCaP cell proliferation. LNCaP cells were plated on 12  wells  and  treated  with  10nM  of  Lyn  siRNA  or  control  siRNA.  Cell  proliferation  was  measured  72  h  post  transfection  using  a  crystal  violet  assay  (****,  P  <  0.0001;  experiment was repeated at least 3 times).   B: Effect of Lyn knockdown on  the expression of cell cycle proteins. LNCaP cells were  treated with 10nM Lyn siRNA and scrambled siRNA control. Total protein was extracted  from the cells 72 h post Lyn siRNA transfection and subjected to western blot analysis  for cell cycle proteins such as Cyclin B1, Cyclin D1 and CDC2.   C: Lyn knockdown induces cell cycle arrest in LNCaP cells. LNCaP cells were treated with  10 nM Lyn siRNA or scrambled siRNA control. Proportion of cells in sub G0, G1, S and G2  was determined by propidium iodide (PI) staining (****, P < 0.0001; ***, P < 0.001; ns,  not significant; ****, P < 0.0001; respectively).   D:  Lyn  knockdown 5 days post  Lyn  siRNA  transfection  induces Caspase‐3  activity  and  PARP‐Cleavage. Total proteins  (50  μg)  from each  condition were  lysed and monitored  for  their  ability  to  cleave  the  fluorogenic  substrate  Ac‐DEVD‐AMC.  Fluorescence  generated by  the  cleavage was quantified by using  a  spectrofluorometer.    (****, P <  0.0001; experiment was repeated at least 3 times).   99  3.4 Discussion  In  androgen‐dependent  tumours  prostate  cells  proliferate  as  a  result  of  androgen  stimulation  (171). By  contrast, during  the development of CRPC, prostate  cells  increase  their  sensitivity  to  the  low  levels  of  androgens  and  up‐regulate  various  oncogenic  molecular  pathways  where  the  AR  is  activated  by  growth  factors  and  AR  antagonists.  The  crosstalk  between  oncogenic  signaling  pathways  makes  it  difficult  for  development  of  an  effective  therapy against this form of the disease. Targeting tyrosine kinases which play key roles in the  interaction  between  various  signaling  pathways  together  with  combination  treatments  has  been shown to yield promising results (351).   The significant role of SFKs in the development of PCa and progression to its CRPC stage  has been shown by different groups (352‐354) but it is not clear which, if any SFK member plays  the dominant role.  A recent study suggests that Lyn kinase does not play a role in PCa disease  initiation  in comparison with Src and Fyn  (355). Our  results  indicate  that  in  fact Lyn  tyrosine  kinase  expression  decreases  in  the  presence  of  androgens  and  increases  in  the  absence  of  androgens both  in vivo and  in vitro. In human tissues expression of Lyn kinase  increases more  than 2  fold  in CRPC  tissue  samples compared  to PCa naïve  tumours. Src kinase  shows a high  expression level in naïve tumours and its expression does not increase significantly with disease  progression. This result further  indicates that different Src family kinase members correlate to  different stages of PCa progression.  Transcriptional  activity  of  AR  is  essential  in  sexual  development  and maintenance  of  normal  male  reproductive  organs.  It  also  plays  a  significant  role  in  progression  of  PCa  to  100  advanced  stages  (356,  357). Our  results  suggest  that  Lyn  kinase  regulates AR  activity  in  the  androgen‐deprived condition  in vitro and, after castration,  in vivo. As shown  in Figure 3.2. AR  signaling  stays  active  in  LNCaPLyn  xenograft  tumours  after  castration  and  plays  a  key  role  in  transcription of androgen‐regulated genes, involved in prostate cancer cell growth and survival,  such as PSA. Furthermore, knockdown of endogenous Lyn  inhibited  transcriptional activity of  androgen‐stimulated AR and expression of androgen target genes (Figure 3.5. D).   In  the  classic model  of  androgen  action,  AR  dissociates  from  Hsp90  in  response  to  androgens and  translocates  to  the nucleus  (358).  In  the absence of  ligand, dissociation of AR  from Hsp90  leads to AR ubiquitination and degradation  (359). We  found that Lyn knockdown  results in dissociation of AR from Hsp90. As a result of this dissociation the unstably‐folded AR  protein was shown to be recognized and degraded by the ubiquitin‐proteasome system. To our  knowledge Lyn kinase knockdown is the only known tyrosine kinase that affects the stability of  AR protein. Src and Ack‐1 (169, 170) kinases have been reported to regulate AR transcriptional  activity but this occurs without affecting the AR protein stability. This data points to a role for  Lyn kinase in stabilizing AR in the androgen deprived conditions rather than in disease initiation.   Growth factor signaling has been shown to play an  important role  in CRPC progression  and regulation of AR  in the  low androgen condition (246, 360‐364). Indeed, IL‐6 and EGF both  have been shown to activate tyrosine kinases in PCa (365, 366) and induce AR phosphorylation  on tyrosine (pTyr) via Src and Ack‐1 (169, 366, 367). Since phosphorylation has been reported to  be one of the major mechanisms in regulation of AR stability (169, 170, 368, 369) it is important  to investigate the potential role of Lyn kinase in tyrosine phosphorylation of AR. Future studies  101  will be necessary  to explore  the other possible mechanisms  through which  Lyn  kinase  could  regulate AR stability and activity in the low androgen environment. This will help us to improve  our understanding of the role of Lyn kinase as well as the therapeutic effect of Lyn inhibition in  the progression of PCa to the CRPC stage.      102  CHAPTER 4: Lyn  Tyrosine  Kinase  Promotes  Castration  Resistant Prostate Cancer Progression  through EGF‐Mediated  Phosphorylation of Androgen Receptor 3  4.1 Introduction  AR plays a key  role  in proliferation of both normal and  cancerous prostate  cells  (12).  Interaction with  growth  factor  signaling  pathways  is  one  of  the main mechanisms  through  which  AR maintains  the  homeostasis  of  normal  prostate  gland  (12,  370‐372).  Alterations  in  expression level of peptide growth factors and their receptors are very commonly found in PCa  tumours  (370‐373).  Fibroblast  growth  factors    (FGFs),  insulin‐like  growth  factors    (IGFs),  epidermal  growth  factor  (EGF)  and  transforming  growth  factor  α  (TGF‐α)  are  some  of  the  growth factor families that play a key role  in the growth and survival of normal prostate cells  and  are  mostly  up‐regulated  in  cancerous  prostate  cells  (12,  373‐376).  In  cancer  cells  interaction of AR with these signaling pathways through a non‐genomic mechanism induces cell  proliferation and survival in prostate epithelial cells (377, 378).   Epidermal growth factor (EGF) and epidermal growth factor receptor (EGFR) have been  reported to be involved in androgen‐independent growth of PCa (12). Up‐regulation of EGF and  EGFR  is directly correlated with progression of PCa to advanced stages (379). One of the main                                                         3 A version of this chapter will be submitted for publication. Zardan A, Beraldi E, Cox ME, Gleave ME and  Zoubeidi  A.  Lyn  Tyrosine  Kinase  Facilitates  Castration  Resistant  Prostate  Cancer  through  EGF‐Mediated  Phosphorylation of Androgen Receptor.    103  mechanisms through which EGF and EGFR promote growth and survival of PCa cells is through  the phosphorylation and regulation of AR transcriptional activity, specifically in the absence of  androgens  (169,  170).  Several  studies  have  reported  that  EGF  stimulation  activates  a  kinase  pathway involving serine/threonine and tyrosine kinases and leads to direct phosphorylation of  AR or  its co‐activators    (169, 170, 380‐382). The Serine/Threonine kinase, Extracellular  signal  regulated kinase  (ERK)  is one of the kinases that can regulate AR transcriptional activity upon  EGF  stimulation,  by  phosphorylating  AR  as  well  as  its  co‐activators  such  as  ARA70  (361).  Recently,  it  has  been  demonstrated  that  EGF  stimulation  of  PCa  cells  also  results  in  a  rapid  tyrosine  phosphorylation  of AR  on  Tyr267  and  Tyr534  via Ack‐1  and  Src  tyrosine  kinase which  accelerates transcriptional activity of AR (169, 170). These findings revealed the important role  of tyrosine phosphorylation in ligand‐independent activation of AR.  Genetic knockout of different SFKs has been shown to result in particular developmental  defects and  indicated a specific  role  for each Src  family member  (52, 348, 383, 384). Despite  structural  similarities  between  the members  of  the  Src  family  of  tyrosine  kinases,  current  literature  suggests  a  unique  role  for  different  members  of  this  family  in  initiation  and  progression of PCa to advanced stages (52, 242, 267). Lyn tyrosine kinase  is a member of the  Src  family  of  non‐receptor  tyrosine  kinases  and  participates  in  signal  transduction  via  cell  surface receptors that lack the tyrosine kinase activity (242, 265). Although Lyn kinase does not  play a crucial role in PCa disease initiation (52), here we report that Lyn kinase play a main role  in  EGF‐mediated  regulation  of  AR  in  a  castrated  environment. Our  results  indicate  that  Lyn  kinase  is phosphorylated and activated upon EGF treatment and  its siRNA knockdown  inhibits  the EGF‐mediated ERK phosphorylation and activation. Moreover, we demonstrated  that Lyn  104  kinase  interacts directly with AR and overexpression of a Lyn dominant negative construct  in  LNCaP cells leads to a decrease in the level of AR tyrosine phosphorylation. More importantly,  this data  shows  that  transcriptional  activity of AR  induced by R1881  alone,  EGF  alone, or  in  combination  is  inhibited after Lyn knockdown. Altogether, this report demonstrates a role for  Lyn kinase in regulation of AR transcriptional activity via tyrosine phosphorylation.  4.2 Materials and Methods  4.2.1 Cell Culture and siRNA Transfection  LNCaP cells were maintained in RPMI with 5% fetal bovine serum (311) and treated with  Lyn siRNA or scrambled siRNA control with oligofectamine in serum free OPTI‐MEM (Invitrogen‐ Life Technologies,  Inc., Burlington, Ontario, Canada)  for 20 min. 4 h  later, 5% FBS was added.  Cells were  treated  once  daily  for  two  successive  days  and  harvested  48  h  after  the  second  treatment.    4.2.2 Plasmid, Reagents and Antibodies  Lyn wild‐type, Empty vector, dominant negative and constitutively active plasmids were  generously provided by Dr. Charles W. Emala (Columbia University, New York, New York) (350).   AR (N‐20), Lyn (H‐6), PSA (C‐19) antibodies were purchased from Santa Cruz Biotechnology, Inc.,  and Src, PARP antibodies were purchased from  Cell Signaling, California., Actin antibody (Clone  C4)  was  purchased  from  Millipore,  California.,  Anti‐Lyn  (phosphor‐Y396)  antibody  was  purchased  from  Abcam.  Lyn  siRNA  (human,  sc‐29393)  was  purchased  from  Santa  Cruz  Biotechnology, Inc. Transfection reagent OligofectAMINE, lipofectin and serum‐free OPTI‐MEM  media were purchased from Invitrogen Life Technologies Inc.  105  4.2.3 Cell Apoptosis Assays  LNCaP cells were transfected twice with Lyn siRNA or scrambled siRNA control. 5 days  post transfection, detection and quantitation of apoptotic cells were assessed by western blot  analysis  and  measurement  of  caspase‐3  activity.  Each  assay  was  performed  three  times.  Caspase‐3 activity was assessed using  the kit CaspACE Assay System, Fluorometric  (Promega,  Madison, WI, USA). 50 µg of total cell lysate were incubated with caspase‐3 substrate AC‐DEVD‐ AMC at room temperature for 4 h. The caspase‐3 activity was quantified in a fluorometer with  excitation at 360 nm and emission 460 nm.  4.2.4 Immunoprecipitation Analysis  Total  proteins  (1  mg)  were  pre‐cleared  with  protein‐G  sepharose  (Invitrogen‐Life  Technologies, Inc) for 1 h at 4˚C and immunoprecipitated with 2 µg of anti‐Lyn, anti‐AR, or IgG  as a control overnight at 4˚C. The immune complexes were recovered with protein‐G sepharose  for 2 h and  then washed with RIPA buffer at  least  three  times, centrifuged, and subjected  to  SDS‐PAGE following by western blotting.  4.2.5 Transfection and Luciferase Assay  LNCaP cells (2.5 X 105) were plated on 6‐well plates and transfected using  lipofectin (6  µl/well)  (Invitrogen‐Life  Technologies,  Inc.).  The  total  amount  of  plasmid  DNA  used  was  normalized  to 2 µg/well by  the addition of a control plasmid. Media was replaced by CSS +/‐  R1881,  24  h  after  transfection  for  another  24 h.  Luciferase  activity was measured using  the  microplate luminometer (EG&G Berthold). All experiments were carried out in triplicate.  106  Statistical Analysis: All data were analyzed by  two‐tailed unpaired  student’s  t  test or  one‐way analysis of variance (ANOVA) with post‐hoc test.  Levels of statistical significance were  set at P < 0.05.  4.3 Results  4.3.1 Lyn is Phospho‐Activated on Y396 upon EGF  Growth factors (eg. EGF) and cytokines (eg. IL‐6) have been reported to be up‐regulated  in CRPC. Both EGF and IL‐6 phosphorylate AR in tyrosine via Ack‐1 and Src and thereby enhance  AR  transcriptional  activity.  We  examined  if  Lyn  is  downstream  of  EGF  and  IL‐6  signaling  pathways. LNCaP cells were serum starved overnight and treated with 50 ng/ml of EGF or IL‐6  for  15min.  Lyn  phosphorylation  on  its  active  site  Tyr396  was  analyzed  after  EGF  and  IL‐6  stimulation. We found that only EGF  induces Lyn phosphorylation on Tyr396 (Figure 4.1. A) but  not IL‐6 (Figure 4.1. B). Phosphorylation of ERK and STAT‐3 were used as positive controls. This  data  suggests  that  Lyn  can be  involved  in EGF‐induced activation of AR phosphorylation and  transcriptional activity. Our finding in parallel with data in the literature helped us to formulate  a  working  model  whereby  treatment  induced  by  androgen  withdrawal  up‐regulates  EGF  pathway  that  is  known  to mediate  CRPC. We  propose  that  Lyn  is  a  part  of  EGF  signaling  pathway  to  facilitate  CRPC  via  phosphorylation  and/or  stabilization  of  AR  and  thereby  enhancing AR transcription activity and cell survival.        107  A                                                                                   B   Figure 4.1. Lyn is activated in EGF pathway but not in Il‐6 pathway.  LNCaP cells were serum starved for 24 h and treated with 50 ng/ml EGF (A) or  50 ng/ml  IL‐6  (B)  for  5 min.  Proteins were  extracted  and direct western  blots were performed  using  phospho‐specific  antibodies  against  Lyn  and  Erk  for  EGF  pathway  and  Lyn  and  STAT Tyr727 for IL‐6 pathway. Total proteins (T‐Erk and T‐STAT3) as well as Vinculin were  used as controls.      4.3.2 Lyn Knockdown Inhibits EGF‐Induced ERK Phosphorylation  Phosphorylation  and  activation  of  ERK  upon  EGF  treatment  in  LNCaP  cells  has  been  reported before  (385, 386), however the possible role of Lyn  in modulating this response has  not yet been reported. Since ERK activation was reported to enhance transcriptional activity of  AR (361), we next examined the possible effect of Lyn knockdown on the phosphorylation and  activation of ERK kinase. LNCaP cells were transfected with 10 nM of Lyn siRNA or scrambled  control twice and were serum starved before EGF stimulation overnight. Treatment of cells with  50 ng/ml EGF for 15 min resulted in ERK phosphorylation and activation in control but not Lyn  knockdown cells (Figure 4.2. A). This result points to a role for Lyn as regulator of EGF‐mediated  ERK phosphorylation and AR transcriptional activity.  108  4.3.3 Lyn Knockdown Inhibits R1881 and EGF induced AR Transcriptional Activity  Binding  of  R1881  to  AR  leads  to  the  conformational  change  in  AR  protein  and  its  dimerization,  nuclear  localization  and  DNA  binding  (43).  It  has  been  reported  that  EGF  stimulation enhances AR transcriptional activity  (172). To  further  investigate the effect of Lyn  kinase on EGF‐enhanced AR transcriptional activity LNCaP cells were transfected with Lyn siRNA  or scrambled control. Cells were then treated with R1881 (10 nM), EGF (50 nM) or R1881 (10  nM) + EGF  (50 nM) overnight and AR  transcriptional activity was measured by PSA  luciferase  activity  (**, P < 0.01; ***, P < 0.001, ***, P < 0.001;  respectively; Figure 4.2. B). as  reported  previously,  R1881  treatment  induced  AR  transcriptional  activity  and  this  effect was  further  increased  when  R1881  was  combined  with  EGF  in  the  control  cells  (387)  (Figure  4.2.  B).  Conversely,  Lyn  knockdown  abrogated  the effect of R1881  and/or EGF on AR  transcriptional  activity. Data obtained from this experiment suggest that Lyn kinase might also play a role as  mediator of EGF‐enhanced AR transcriptional activity.      109  A   B   Figure 4.2. Effect of Lyn knockdown on EGF‐induced ERK phosphorylation and R1881  and EGF induced AR transcriptional activity.  A:  Lyn  knockdown  inhibits  EGF  induced  ERK  phosphorylation.    LNCaP  cells  were  transfected with 10 nM of Lyn siRNA or scrambled siRNA control twice and then were  serum starved for 24 h before stimulation with EGF (50 ng/ml) for 15 min. Total protein  was  analyzed  by  Western  blotting  with  anti‐Total  ERK  and  anti‐phospho‐ERK.  Anti‐ Vinculin was used as loading control.   B:  Lyn  knockdown  abrogates  R1881  and/or  EGF  induced  AR  transcriptional  activity.  LNCaP cells were transfected with 10 nM of Lyn siRNA or scrambled siRNA control. Cells  were then transfected with 1 µg of PSA‐Luciferase for 24 h followed by treatment with  R1881 (1 nM), EGF (50 ng/ml) or both for 24 h. Cells were harvested and PSA‐luciferase  activity was measured. **, P < 0.01; ***, P < 0.001, ***, P < 0.001; respectively; Data  represents means of at least 3 independent experiments performed in triplicate. Fold is  measured relative to PSA‐luciferase activation with no treatment.   110  4.3.4 Lyn Kinase Binds to AR Directly and Regulates AR Tyrosine Phosphorylation  The NTD of AR has been reported to be phosphorylated via alternate pathways such as  cAMP/PKA,  IL‐6 and EGF  in  the androgen‐deprived environment and  to affect  transcriptional  activity of AR (364, 388, 389). Tyrosine phosphorylation of AR, upon EGF stimulation by Src and  Ack1, has been recently reported to accelerate AR transcriptional activity (169, 170). It has been  shown  that both  Src  and Ack1  kinase bind  and phosphorylate AR upon EGF  treatment  (169,  170).  Our  data  indicated  that  Lyn  kinase  is  phosphorylated  upon  EGF  stimulation  and  its  knockdown  inhibits  the  EGF‐enhanced  AR  transcriptional  activity.  Therefore,  we  sought  to  investigate whether Lyn could directly interact and phosphorylate AR, similar to Src and Ack‐1,  to  modulate  AR  transcriptional  activity.  To  address  this,  immunoprecipitation  analysis  was  performed where AR was detected in Lyn immunoprecipitated complex. We tried the converse  immunoprecipitation  to  look  for  Lyn  kinase  in  AR  immunoprecipitated  complex;  however,  binding of Lyn kinase to AR was not detectable due to interference with IgG heavy chain (Figure  4.3. A).   Next, we studied the effect of Lyn knockdown on AR NTD transcriptional activity which  is known to be the result of phosphorylation. LNCaP cells were first treated with either Lyn or  scrambled  siRNA. Then,  they were  transfected with plasmids  containing both AR N‐terminus  and  luciferase  reporter  (regulated by  the PSA enhancer‐promoter  region).  Finally,  cells were  serum  starved  overnight  and  stimulated  with  ‐/+  EGF  (50  nM)  for  24  h.  Measuring   transactivation  of  AR  NTD  using  Luciferase  assay  showed  a  reduction  after  Lyn  knockdown  compared with control cells (***, P < 0.001; ***, P < 0.001; respectively; Figure 4.3. B).     111  Furthermore,  we  investigated  the  effect  of  Lyn  kinase  dominant  negative  and  constitutively  active  overexpression  on  tyrosine  phosphorylation  status  of  AR  using  immunoprecipitation  analysis.  To  do  this  we  introduced  Lyn  dominant  negative  and  constitutively active plasmids  into  LNCaP  cells,  followed by  serum  starvation and  stimulation  with ‐/+ EGF (50 nM) for 5 min.   AR was  immunoprecipitated from these cells and  its tyrosine  phosphorylation status was analyzed. We observed that AR tyrosine phosphorylation decreased  in  LNCaP  cells  that were  transfected with  Lyn dominant negative  compared with  the  cells  in  which the constitutively active construct was transfected  (Figure 4.3. C). Thus,  it appears that  Lyn  kinase  binds  and  tyrosine  phosphorylates  NTD  of  AR  which  leads  to  enhanced  AR  transcriptional activity.     A       112  B    C         Figure  4.3.  Lyn  directly  interacts  and  affects  tyrosine  phosphorylation  and  transactivaion of AR.  A: Lyn interacts with AR. 500 µg of total protein extracts were immunoprecipitated with  2  µg  of  anti‐AR,  or  IgG  as  a  control  overnight  at  4ºC.  The  immune  complexes were  recovered with protein‐G sepharose for 2 h and submitted to western blotting with anti‐ Lyn or anti‐AR antibodies.  B: Lyn knockdown abrogates AR NTD, transcriptional activity. LNCaP cells were treated  with 10 nM of Lyn siRNA or scrambled siRNA control twice. Cells were then transfected  with 1 µg of plasmids containing both AR N‐terminus and luciferase reporter (regulated  by  the PSA enhancer‐promoter region)  followed by  treatment with EGF  (50 ng/ml)  for  24 h. Cells were harvested and luciferase activity was measured. (***, P < 0.001; ***, P  <  0.001;  respectively;  Data  represents means  of  at  least  3  independent  experiments  performed in triplicate. Fold is measured relative to PSA activation with no treatment.   C:  Lyn  dominant  negative  (DN)  expression  leads  to  decreased  AR  tyrosine  phosphorylation. LNCaP cells were  transfected with plasmids expressing Lyn dominant  113  negative or constitutively active constructs followed by treatment with EGF (50 ng/ml)  for 5 min. 500 µg of total extract were immunoprecipitated with 2 µg of anti‐AR, or IgG  as a control overnight at 4ºC. The  immune complexes were  recovered with protein‐G  sepharose for 2 h and submitted to western blotting with anti‐phophotyrosine and AR  antibodies. Vinculin was used as loading control.      4.3.5 Lyn Knockdown Induces Apoptosis in LNCaP Cells in The Presence of EGF and R1881  AR plays a  crucial  role  in maintaining PCa  cell  survival  through  ligand dependent and  independent mechanisms. EGF treatment has been shown to have a positive effect on PCa cell  survival,  especially  in  combination  with  R1881  (12,  172).  Since  Lyn  knockdown  led  to  the  inhibition of AR transcriptional activity  in the presence of both EGF and R1881, we decided to  analyze the effect of long‐term (5 days) Lyn knockdown on LNCaP cell survival in the presence  of R1881 and EGF. LNCaP cells were transfected with 10 nM Lyn siRNA or scrambled control.  Caspase‐3 activation and cleaved‐PARP were used to measure the rate of cell death 5 days post  transfection.  The  results  indicated  that  Lyn  knockdown  significantly  increased  the  activation  level of  caspase‐3  (****, P < 0.0001; ****, P < 0.0001; ****, P < 0.0001; ****, P < 0.0001;  respectively;  Figure  4.4. A)  as well  as  the  amount  of  cleaved  PARP  even  in  the  presence  of  R1881 (10 nm) and EGF (50 nM) (Figure 4.4. B). This demonstrates that Lyn kinase is involved in  promoting  LNCaP  cell  survival  via  regulating  EGF  and/or  R1881‐enhanced  AR  transcriptional  activity.      114  A    B    Figure 4.4. Lyn knockdown induces apoptosis in LNCaP cells.  A:  Lyn knockdown  increases  the amount of  cleaved PARP  in  LNCaP  cells.    LNCaP  cells  were treated with 10 nM siRNA Lyn or scrambled siRNA control twice followed by CSS,  R1881  (10  nM),  EGF  (50  nM)  or  R1881+EGF  treatment  for  5  days.  Total  protein was  extracted and analyzed by Western blotting with anti‐Lyn, anti‐PARP antibodies. Vinculin  was used as loading control.   B:  Lyn  knockdown  increases  caspase‐3  activity. Total  proteins  (50  μg)  from  each  condition were lysed and monitored for their ability to cleave the fluorogenic substrate  Ac‐DEVD‐AMC.  Fluorescence  generated  by  the  cleavage  was  quantified  by  using  a  spectrofluorometer  (****, P < 0.0001; ****, P < 0.0001; ****, P < 0.0001; ****, P <  0.0001; respectively). All experiments were repeated at least 3 times.   115  4.4 Discussion  Under low or absent androgen condition, growth factor signaling pathways play a crucial  role  in maintaining  the  growth  and  survival  of  PCa  cells  (43,  386).  It  has  been  shown  that  growth  factor‐mediated  transcriptional  activity of AR  is one of  the  key mechanisms  through  which PCa cells survive and proliferate  in  the  low androgen condition  (386). Up‐regulation of  several peptide growth factor families including EGF, IGF, FGF and TGF‐α and their downstream  signaling pathways have been reported to correlate with progression of PCa to advanced stages  (12,  373‐376).  In  the  absence  of  androgens,  peptide  growth  factors  activate  a  number  of  serine/threonine  or  tyrosine  kinases  and  these  kinases  activate  AR  either  through  direct  phosphorylation or  indirectly via phosphorylation of AR co‐activators  (63, 169, 170, 379). Src  and Ack‐1 both belong to the family of NRTKs and have been reported to interact directly and  tyrosine  phosphorylate  AR.  This  tyrosine  phosphorylation  then  leads  to  enhanced  AR  transcriptional activity in the absence of ligand (169, 170).   Lyn tyrosine kinase  is a member of the Src family of NRTKs and has been shown to be  up‐regulated  in  PCa  and  play  a  role  in  disease  progression  (52,  251,  266,  267). Our  results  demonstrate  for  the  first  time  that  Lyn  kinase  is phophoactivated upon EGF  stimulation and  that  Lyn  knockdown  inhibits  EGF‐mediated  ERK  phosphorylation.  This  decrease  in  the  phosphorylation  of  ERK  then  results  in  a  decrease  in  transcriptional  activity  of  AR  in  the  presence of EGF, R1881 as well as the combination of both. ERK has been reported to play a  role in modulation of AR transcriptional activity in the androgen‐deprived conditions (360, 361).  Therefore, we concluded  that one of  the mechanisms  through which Lyn kinase regulates AR  transcriptional activity is via modulation of ERK. As the next step we looked for the possibility of  116  any direct  interaction between AR and Lyn kinase and observed a direct  interaction between  Lyn and AR. Since binding of AR to the previously  identified NRTKs resulted  in the AR tyrosine  phosphorylation and modulation of  its transcriptional activity, we subsequently examined the  effect of Lyn kinase DN and CA overexpression on  the  tyrosine phosphorylation status of AR.  Overexpression  of  Lyn  DN  construct  resulted  in  a  decrease  in  AR  tyrosine  phosphorylation  compared with the CA overexpressing cells. Furthermore, we studied the effect of Lyn kinase  expression and activity on AR ligand‐independent transcriptional activity through analysis of the  effect  of  Lyn  kinase  on  AR  NTD  transcriptional  activity.  Ligand  independent  regulatory  phosphorylation  of  AR  has  been  mostly  associated  with  its  NTD  (63,  163,  364).  Thus,  we  overexpressed AR NTD  in LNCaP cells previously  treated with Lyn siRNA or scrambled control  and analyzed  the effect of Lyn kinase on AR NTD  transcriptional activity after EGF  treatment.  This  result  showed  a  significant  decrease  in  transcriptional  activity  of  AR  NTD  after  Lyn  knockdown.   In this study we indicated that Lyn kinase can play a role in tyrosine phosphorylation of  AR  upon  EGF  treatment.  Tyrosine  phosphorylation  of  AR  upon  EGF  stimulation  via  Ack1  on  Tyr267 and via Src on Tyr534 has been previously reported (169, 170). However, dasatinib, a small  molecule  inhibitor of Src and Ack1, abrogated EGF  induced AR phosphorylation on Tyr534 but  not EGF inducing AR phosphorylation on Tyr267. This data suggests the existence of an additional  unidentified tyrosine kinase involved in this process.  Lyn tyrosine kinase can potentially be the  tyrosine kinase that also phosphorylates AR on Tyr267.   117   The members of  the Src  family of NRTKs share structural similarities, although  recent  reports suggest a distinct role for each member of the family. A number of different Src family  kinase inhibitors such as dasatinib are currently in clinical trials for the treatment of CRPC (390).  A better understanding of the mechanisms through which SFKs affect different aspects of PCa  from initiation to CRPC progression will help the researchers to develop more effective drugs.       118  CHAPTER 5: Conclusion and Suggestions for Future Work  5.1 General Discussion and Conclusion  Development of PCa requires a functional AR and its underlying signaling pathway (284,  391).  Inherited  syndromes,  such  as  androgen  insensitivity  and  spinal  or  bulbar  muscular  atrophy,  in which AR signaling  is absent or  reduced,  result  in  immature prostate and will not  develop the carcinoma of the prostate (284, 391, 392). Androgen deprivation therapy remains  the most effective treatment option for men with advanced forms of PCa. Unfortunately, ADT  only provides a short‐term survival benefit for patients due to the development of lethal CRPC.  Recent  literature  suggests  an  important  role  for  AR  and  AR  signaling  pathway  during  the  progression  to  CRPC.  A  number  of  different  mechanisms  have  been  associated  with  the  emergence  of  CRPC  including  re‐activation  of  AR  axis,  elevated  expression  of  AR  spliced  variants,  activation  of  alternative  signaling  pathways  and  up‐regulation  of  stress‐induced  survival genes.   Over  the  course of my PhD  two new drugs,  abiraterone  acetate  (FDA  approved)  and  MDV3100  (in  phase  three  clinical  trial),  were  developed  and  indicated  survival  benefit  to  patients with metastatic CRPC who  are no  longer  responding  to  the  chemotherapeutic drug  docetaxel (148, 393, 394). Abiraterone acetate is a potent and selective inhibitor of CYP17, one  of the key enzymes in androgen biosynthesis, and MDV‐3100 is an AR antagonist that blocks the  binding of androgens  to AR and  inhibits  the nuclear  translocation of AR  (145, 148, 394, 395).  Despite  the  promising  results  from  administration  of  these  two  drugs  disease  still  progress  119  (396). Interestingly the progression in most cases corresponds to an increase in the serum PSA  levels, which suggests the reactivation of AR signaling pathway (396‐398). Thus, we believe that  the  critical  question  at  this  time  is  to  find  out  the  underlying  mechanisms  that  result  in  reactivation of AR and development of resistance to MDV3100 and abiraterone acetate. These  drugs do not affect the protein expression of AR; therefore, the AR protein is still present in the  prostate  cells  and  can  always become  re‐activated  via  the  crosstalk with  several  known  and  unknown interconnected signaling networks leading to disease progression. Therefore, indirect  targeting of AR via targeting the mechanisms that result  in stabilization of AR appears to be a  more effective approach.    In  this  thesis we used  two approaches  to  look  for  the mechanisms  that  lead  to  AR  stabilization  in  order  to  help  the  development  of  the  therapies  for more  effective AR  targeting. The  first approach was  to  study  the  role of  chaperone proteins  in AR  stability which  led to the  identification of Hsp27 as a chaperone protein with the potential to  regulate AR protein stability as well as activation. Next, based on the interesting findings in the  literature, role of tyrosine kinases in regulation of AR was investigated. This approach resulted  in  the  identification  of  Lyn  kinase  as  the  only  known  tyrosine  kinase  with  the  capacity  to  regulate protein  stability of AR. The  results obtained  in  this  thesis will be discussed  in detail  below:  Previous reports indicated the important role of heat shock proteins in steroid receptor  stabilization (209, 303, 320). Direct or indirect interaction of chaperone proteins such as Hsp90  and  FKBP52  with  AR  has  been  indicated  to  play  a  role  in  regulation  of  AR  stability  and  transcriptional activity (212, 399, 400). Inhibition of Hsp90 expression has been shown to result  in  AR  destabilization  and  degradation  via  the  proteasome  degradation  pathway  (209,  320).  120  Therefore, over the last few years inhibition of chaperone protein activity has been studied as a  potential strategy for treatment of patients with PCa (209, 320). Hsp90 is one of the chaperone  proteins that has been shown to be overexpressed  in CRPC.   Aside  from AR,   Hsp90  interacts  with and stabilizes many proteins involved in promoting the cell growth and survival of prostate  cells such as Akt (401). Therefore, a number of Hsp90 inhibitors have been developed to target  this chaperone protein for the treatment of the CRPC (402, 403). However, inhibition of Hsp90  as  monotherapy  with  agents  such  as  geldanamycin  (small‐molecule  inhibitor)  was  not  efficacious (404). As reported in the literature, some of the major mechanisms that contribute  to resistance to Hsp90 inhibitors were a) the induction of a heat shock response which leads to  increased  expression  of  other  Hsps  such  as  Hsp70  and  Hsp27  which  attenuates  drug  effectiveness  (160)  and  b)  activation  of  tyrosine  kinase  c‐Src  signaling which  promoted  the  growth of prostate carcinoma cells (405).   Previous  reports by our group  indicated  that expression  level of Hsp27  increases with  disease  progression  to  CRPC  (226).  It was  further  revealed  that Hsp27  has  a  cytoprotective  function  in CRPC and  inhibition of  its expression  leads  to PCa cell death  (226). Therefore, we  sought to investigate the possible role of Hsp27 in modulation of AR stability which could also  play a role in antagonizing the anticancer effect of Hsp90 inhibitors for the treatment of CRPC.  To  address  this  hypothesis  as  described  in  detail  in  chapter  2,  we  designed  a  series  of  experiments  through which we  indicated  that  treatment with androgens  results  in  rapid, AR‐ dependent  phosphorylation  of  Hsp27  via  the  p38MAPK  pathway  on  both  Ser78  and  Ser82  phosphorylation sites. As the next step we performed experiments to find out whether AR and  Hsp27 interact directly.  Our results showed that Hsp27 interacts directly with the NTD and LBD  121  of  AR,  colocalizes  with  AR  in  cytoplasm  and  translocate  to  the  nucleus  upon  androgen  treatment. This set of data suggested that Hsp27 could play an  important role  in chaperoning  AR  to  the  nucleus  and  modulating  AR  transcriptional  activity.  To  test  this  hypothesis  we  performed  a  series  of  gain  and  loss  of  function  experiments  and  demonstrated  that Hsp27  phosphorylation  is  required  for  AR  transcriptional  activity  and  that Hsp27  knockdown  using  OGX‐427 inhibits AR‐mediated gene activation. Since, it was previously reported that other heat  shock  proteins  such  as  Hsp90 modulate  AR  nuclear  localization  and  transcriptional  activity  (209), we  sought  to  investigate  the  specific mechanism  through which  Hsp27  regulates  AR  transactivation.  Interestingly,  our  results  indicated  that  unlike Hsp90  that  interacts with  the  ligand‐unbound AR  (320), Hsp27  interacts with  ligand‐bound AR,  and  in  fact Hsp27  replaces  Hsp90  in the AR complex. We further provided evidence that Hsp27 modulates the binding of  AR to ARE in the nucleus and that it continues to interact with AR at the level of ARE.   In chapter 2 of this thesis, for the first time, we demonstrated the mechanisms through  which  Hsp27  modulates  AR  protein  stability.  Our  results  indicated  that  Hsp27  knockdown  destabilizes  AR  and  leads  to  AR  protein  degradation  through  the  proteasomal  degradation  pathway. We  believe  this  finding  describes  one  of  the  possible mechanisms  through which  Hsp27  promotes  PCa  cell  survival.  Our  in  vivo  experiments  using  LNCaP  xenograft  tumours  further confirmed our  in vitro findings. We observed that treatment of LNCaP xenografts with  antisense  inhibitor of Hsp27 (OGX‐427) decreases AR transcriptional activity, serum PSA  levels  as well as tumour volume. Our western blot and immunostaining analysis indicated that protein  levels of AR, Hsp27 and Hsp90 decrease after treatment with OGX‐427. Collectively, our in vitro  122  and  in  vivo  data  in  chapter  2  indicates  a  central  role  for  Hsp27  in  regulation  of  AR  transcriptional activity through modulation of its protein stability.  Castration‐  and  chemo‐resistance  are  the main  obstacles  in  treatment  of  patients  in  advanced  stages of PCa. Hsp27 protein was  identified as a prognostic marker  for PCa  in our  group  in  an  attempt  to  better  understand  the  mechanisms  of  treatment  resistant  and  to  determine new therapeutic targets. Previously,  it has been shown by our research group and  others  that Hsp27  expression  level  increases  after  chemotherapy  and  hormone  therapy  and  that  is  associated  with  CRPC  progression  (226,  325).  Interestingly,  some  previous  studies  indicated that expression of Hsp27 plays an essential role in maintaining the activity of steroid  hormone  receptors  (305).    Based  on  the  previous  reports  we  thought  it  was  essential  to  investigate  the possible  role of Hsp27  in  regulation of AR  activity. Our  findings  in  chapter  2  provided  supportive  evidence  that  targeting  Hsp27  is  a  promising  therapeutic  strategy  in  treatment of CRPC. OGX‐427,  the antisense  inhibitor of Hsp27,  is currently  in phase  II clinical  trials for treatment of prostate, bladder, ovarian, breast and lung cancers in United States and  Canada. The data presented  in chapter 2 helped  improve the overall understanding of Hsp27  mechanism of action in regulation of AR in PCa.   Expression  of  Hsp27  has  also  been  reported  to  increase  after  the  treatment  with  anticancer agents to confer therapeutic resistance (197).  Preliminary data generated in the last  year of my PhD (Appendix 6, 7 and 8) demonstrated an important role for Hsp27 in regulation  of  two  of  the  interlinked  protein  degradation  pathways:  a)  the  Unfolded  Protein  Response  (UPR) and b) Autophagy. These two pathways have been reported to be activated in response  123  to the Endoplasmic Reticulum (ER) stress caused by accumulation of misfolded proteins  in cell  stress  conditions  (406,  407). Many  different  stressors  can  disturb  protein  folding  including  anticancer therapeutics (408). Activation of UPR as a cytoprotective mechanism results in either  improved protein folding or degradation of proteins via the proteasome‐degradation pathway  (408). If the accumulated misfolded proteins cannot be degraded via the proteasome pathway  the  UPR  up‐regulates  the  autophagy  machinery  which  is  one  of  the  major  lysosomal  degradation pathways to degrade the misfolded protein aggregates (408, 409).   Since  investigating  the mechanisms  that  lead  to drug  resistance  such as  resistance  to  MDV3100  is  the  new  research  focus  in  our  laboratory,  we  took  a  step  to  investigate  the  potential  role of Hsp27  in  regulation of UPR  and autophagy  cytoprotective pathways. Hsp27  appears to play a key role in regulation of UPR and autophagy in PCa cells (Appendix 6, 7 and 8).  Inhibition  of  proteasome  activity  via  treatment  with  MG132  was  used  to  model  the  accumulation  of  the misfolded  proteins  in  the  ER  and  initiation  of  the  UPR  (Appendix  6).  Initiation of UPR  led to an  increase  in expression and activity of Hsp27  in correlation with up‐ regulation  of  the  UPR‐related  proteins  expression  (Appendix  6).  Furthermore,  Hsp27  knockdown with both siRNA and ASO resulted  in an  increase  in accumulation of ubiquitinated  proteins and  induction of UPR  (Appendix 7 and 8). However, Hsp27 overexpression caused a  decrease in the amount of ubiquitinated proteins as well as UPR induction (Appendix 7 and 8).  Moreover,  Hsp27  knockdown  affected  the  expression  level  of  the  autophagy  protein  LC3  (Appendix 8). The ongoing  research  in our  laboratory  investigates  the molecular mechanisms  through which Hsp27 regulates the UPR and autophagy pathways of cell survival. Both UPR and  autophagy  have  been  shown  to  play  a  role  in  cancer  cell  survival  and  development  of  124  therapeutic resistance (408, 410). Our preliminary observations suggest a central role for Hsp27  in  regulation  of  PCa  cell  survival  and  development  of  therapeutic  resistance  through  the  regulation of UPR and autophagy.   As noted earlier, crosstalk between AR and growth factor signaling pathways is another  important  mechanism  through  which  PCa  cells  survive  and  proliferate  despite  androgen  deprivation therapy (380). NRTKs play a key role in integrating signal transduction for multiple  growth factor receptors involved in the proliferation, invasion and metastasis of PCa cells (411,  412).  In 2005, Guo et al. brought  to attention a new  role  for  the NRTK, Src,  in  regulating AR  transcriptional activity via direct  interaction and  tyrosine phosphorylation of AR upon growth  factor  stimulation  (169).  Another  report  in  2007  by  Mahajan  et  al.  further  confirmed  the  importance of NRTK, Ack‐1  in  regulation of AR  transcriptional  activity  via  similar mechanism  (170). Previously, it was reported that expression of NRTK, Lyn is higher in poorly differentiated  regions of prostate  tumours and correlates with PCa disease progression  to advanced  stages  (251). Moreover, knockdown of Lyn kinase in PCa cells reduces the PCa cell growth (251, 267).   Despite  the  evidence  suggesting  an  important  role  for  Lyn  kinase  in  PCa  disease  progression  there  are  few  reports  on  the  underlying mechanism  through which  Lyn  kinase  renders  this effect.  In chapter 3 we  first confirmed  that expression and activity of Lyn kinase  increases with  the progression of PCa  to CRPC both  in  vivo  and  in  vitro.  In  LNCaP  xenograft  model  overexpression  of  Lyn  kinase  accelerated  the  castrate‐resistant  tumour  growth  and  serum PSA relapse to pre‐castration  level; however,  it did not affect the tumour  incidence or  tumour  growth  before  castration.  Cai  et  al.  observed  similar  results  through  their    in  vivo  125  experiments  performed  in  search  of  finding  the  quantitative  variation  in  transformation  of  prostate  epithelium  by  SFK members  and  further  confirmed  that  ectopic  expression  of  Lyn  kinase had no effect on PCa disease initiation (52). We believe that unlike Src kinase that has a  strong oncogenic potential,  Lyn kinase  is a key  regulator of PCa cell  survival after  castration.  Interestingly,  as  shown  in  chapter  3,  expression  level  of  Lyn  kinase  seems  to  be  negatively  regulated by the level of androgens. Treatment with the synthetic androgen R1881 suppressed  the expression of Lyn kinase, whereas LNCaP cells which were kept  in the androgen‐deprived  medium CSS for 24 h exhibited a higher level of Lyn kinase expression.   Serine/threonine and tyrosine phosphorylation of AR protein at multiple residues have  been  shown  to  regulate  AR  nuclear  localization  and  transcriptional  activity  (413‐416).  Phosphorylation  of  AR  on  these  residues  has  been  reported  to  regulate  AR  transcriptional  activity  in  the absence of androgenic stimuli and  to promote  the development of CRPC  (169,  170, 414). Our results indicated that Lyn kinase expression is negatively regulated by androgens  and positively correlates with the progression of PCa to CRPC stage  (chapter 3). Moreover,  in  vivo  Lyn  overexpression  accelerated  the  castrate‐resistant  tumour  growth  and  serum  PSA  relapse to pre‐castration level. These results suggested a role for Lyn kinase in PCa progression  via regulation of AR activity in the absence or low levels of androgenic stimuli. In chapter 3, we  demonstrated that Lyn kinase regulates the protein stability of AR and, as a result, affects  its  transcriptional  activity.  Phosphorylation  of  AR  has  been  reported  to  be  one  of  the  major  mechanisms  involved  in AR protein stability (169, 170, 368, 369, 417). Our data  indicated that  Lyn kinase is phosphorylated upon EGF treatment and that its expression affects EGF‐mediated  ERK  phosphorylation  (chapter  4).  Furthermore,  knockdown  of  Lyn  kinase  reduced  the  126  transcriptional  activity  of  AR  N‐terminus  upon  EGF  stimulation  (chapter  4).  Through  immunoprecipitation  analysis  we  also  demonstrated  that  overexpression  of  the  Lyn  kinase  dominant  negative  construct  resulted  in  a  decrease  in  total  tyrosine  phosphorylation  of  AR  (chapter 4). Collectively, data obtained in chapter 3 and 4 of this thesis suggests that Lyn kinase  plays an important role in regulation of AR protein stability and tyrosine phosphorylation in the  absence  of  androgens.  This  data  also  supports  and  provides  a  rationale mechanism  for  the  results  reported  by  Park  et  al.  indicating  that  Lyn  kinase  knockdown  affects  PCa  cellular  proliferation  (267).  AR  is  the  central  regulator  of  both  normal  and  cancerous  prostate  cell  survival. Thus, effect of  Lyn kinase knockdown on AR protein expression disrupts  the  central  proliferation pathway  in prostate cells and results  in  inhibition of cell proliferation  in prostate  cells.  Another  important aspect of  this  thesis was  the comparative studies between Src and  Lyn kinase.  These two members of the SFKs seem to play a predominant role in PCa, although  evidence  from  different  studies  suggest  that  either member  has  a  very  specific  role  in  the  disease progression (52, 267). Our results  indicated that Src kinase  is highly expressed  in both  primary and advanced PCa tissue specimens, whereas, expression of Lyn kinase increases with  the progression of PCa to the castrate resistant stage. This  finding suggests a specific role  for  Lyn  kinase  in  the  androgen  deprived  environment. We  also  observed  that  the  effect  of  Lyn  kinase on AR transcriptional activity was more potent than Src kinase. This could be due to the  fact that the knockout of Lyn but not Src kinase affected the protein expression of AR. This set  of data  supports  the previous  findings on  the distinguishable  role of Src and  Lyn  kinase  (52,  127  267). Therefore, targeting specific members of the SFKs  in different stages of PCa progression  might be a more promising therapeutic approach.     Figure 5.1. Regulation of AR by Lyn in CRPC.   AR signaling pathway  in androgen‐dependent PCa and our hypothetical model showing  Lyn as a downstream effectors of EGF signaling pathway regulating AR in CRPC.      5.2 Suggestions for Future Work  The work presented in this thesis demonstrated the detailed mechanism through which  Hsp27  and  Lyn  tyrosine  kinase  regulate  AR  protein  stability  and  transcriptional  activity  in  different  stages of PCa. Both Hsp27  and  Lyn  kinase have been  characterized  to be potential  128  therapeutic  targets  for  the  treatment  of  CRPC,  therefore  a  better  understanding  of  the  mechanisms through which they promote the survival and proliferation of PCa cells is essential.   Our data  in chapter 2  indicated  the  role of Hsp27  in PCa cell survival  in an androgen‐ dependent manner.  Our  group  and  others  have  also  demonstrated  that  Hsp27  is  a  central  regulator  of  prostate  cell  survival  in  an  androgen‐deprived  condition  (197,  216,  226,  229).  Expression of Hsp27  is reported to  increase after hormone ablation and chemotherapy and  is  associated with CRPC (226, 229, 325). Hsp27 has been reported to become phospho‐activated  downstream of Akt and MAPK pathway upon growth factor stimulation and to promote survival  and proliferation of PCa cells in the absence of androgens (216, 418, 419). Investigation of the  exact mechanism through which Hsp27 promotes proliferation and survival of PCa cells  in the  castrated environment is a great area for future research.  Hsp27  has  been  linked  to  epithelial  to  mesenchymal  transition  (EMT),  migration,  invasion and metastasis  in solid  tumours such as breast and kidney cancer  (218, 420‐422).  In  prostate cell  lines,  it has been reported that Hsp27 knockdown  inhibits the VEGF‐induced cell  migration and TGFβ‐induced cell invasion (423). These results suggest a potential role for Hsp27  in PCa  invasion, migration and EMT and  further highlight  the need  for  future  investigation of  the role of Hsp27 in PCa cell invasion and metastasis.  As mentioned  earlier, we  have  preliminary  data  (Appendix  6,  7  and  8)  suggesting  a  central  role  for Hsp27  in  regulation  of UPR  and  autophagy.  These  two  pathways  have  been  shown to play an important role in conferring cytoprotection and therapy resistance (408, 410).  Therefore, investigating the specific molecular mechanisms through which Hsp27 regulates UPR  129  and autophagy will help understanding and modeling of the mechanisms of drug resistance and  supports that Hsp27 is a promising therapeutic target for PCa.  Our results in chapter 3 and 4 shed light on the specific role of Lyn kinase in regulation  of AR protein expression and  transactivation  in  the castrated environment. Similar  to Hsp27,  Lyn kinase expression and activity have been associated with cancer metastasis and the process  of EMT  in other cancers  such as Ewing’s Sarcoma and breast cancer  (265, 424). Since  recent  report  by  Cai  et  al.  demonstrated  a more  important  role  for  Lyn  kinase  in  acceleration  of  tumorigenesis  than  tumour  initiation  (52), we  suggest    further  investigation on  the potential  role of Lyn kinase in regulation of PCa invasion, metastasis and EMT.  The  data  obtained  in  chapter  3  and  4,  also  demonstrated  that  Lyn  kinase  affects AR  tyrosine phosphorylation; however, due  to  the  fact  that phospho‐tyrosine AR  antibodies  are  not  commercially  available,  the  exact  tyrosine  phosphorylation  site  on  AR,  that  is  phosphorylated  by  Lyn  kinase, was  not  determined.  Previous  reports  have  shown  that  EGF  treatment results in AR phosphorylation on Tyr267 via Ack‐1 and Tyr534 via Src kinase. It has also  been  shown  that  a  small  molecule  inhibitor,  dasatinib,  targeting  Src  and  Ack‐1  activity  abrogates EGF inducing AR phosphorylation on Tyr534 but not EGF inducing AR phosphorylation  on  Try267.  Lyn  kinase  could  potentially  be  the  additional  unidentified  kinase  involved  in  this  process. Thus,  it  is  important  to  identify  the  tyrosine phosphorylation  site of  Lyn on AR and  clarify if the Tyr267 is phosphorylated by Lyn kinase.      130  Bibliography 1.  (2009) Prostate Cancer, Cambridge University Press  2.  Cunha,  G.  R.,  Tuohimaa,  P.,  and  Visakorpi,  T.  (2004)  Steroids  and  prostate  cancer.  J  Steroid Biochem Mol Biol 92, 219‐220  3.  Thomson,  A.  A.,  Cunha,  G.  R.,  and Marker,  P.  C.  (2008)  Prostate  development  and  pathogenesis. Differentiation 76, 559‐564  4.  Staack,  A.,  Donjacour,  A.  A.,  Brody,  J.,  Cunha,  G.  R.,  and  Carroll,  P.  (2003)  Mouse  urogenital development: a practical approach. Differentiation 71, 402‐413  5.  Kumar,  V.  L.,  and  Majumder,  P.  K.  (1995)  Prostate  gland:  structure,  functions  and  regulation. Int Urol Nephrol 27, 231‐243  6.  Lee,  C.  H.,  Akin‐Olugbade, O.,  and  Kirschenbaum,  A. Overview  of  prostate  anatomy,  histology, and pathology. Endocrinol Metab Clin North Am 40, 565‐575  7.  Walsh,  P.  C.  (1992) Why make  an  early  diagnosis  of  prostate  cancer.  The  Journal  of  urology 147, 853‐854  8.  McNeal,  J. E.  (1972) The prostate and prostatic urethra: a morphologic  synthesis. The  Journal of urology 107, 1008‐1016  9.  Dixon, S. C., Kruger, E. A., Bauer, K. S., and Figg, W. D. (1999) Thalidomide up‐regulates  prostate‐specific antigen  secretion  from LNCaP cells. Cancer Chemother Pharmacol 43  Suppl, S78‐84  10.  Long, R. M., Morrissey, C., Fitzpatrick, J. M., and Watson, R. W. (2005) Prostate epithelial  cell differentiation and its relevance to the understanding of prostate cancer therapies.  Clin Sci (Lond) 108, 1‐11  11.  McNeal, J. E. (1988) Normal histology of the prostate. Am J Surg Pathol 12, 619‐633  12.  Russell,  P.  J.,  Bennett,  S.,  and  Stricker,  P.  (1998)  Growth  factor  involvement  in  progression of prostate cancer. Clinical chemistry 44, 705‐723  131  13.  Bonkhoff, H., Stein, U., and Remberger, K. (1995) Endocrine‐paracrine cell types  in the  prostate and prostatic adenocarcinoma are postmitotic cells. Hum Pathol 26, 167‐170  14.  Neill, J. D. (2006) Knobil and Neill's physiology of reproduction Vol. 2  15.  Bonkhoff, H., Stein, U., and Remberger, K. (1994) The proliferative function of basal cells  in the normal and hyperplastic human prostate. The Prostate 24, 114‐118  16.  Bordini, B., and Rosenfield, R. L.  (2011) Normal pubertal development: part  II: clinical  aspects of puberty. Pediatr Rev 32, 281‐292  17.  Mainwaring, W. I. (1977) The mechanism of action of androgens. Monogr Endocrinol 10,  1‐178  18.  Abrahamsson, P. A., and di Sant'Agnese, P. A. (1993) Neuroendocrine cells in the human  prostate gland. Journal of andrology 14, 307‐309  19.  Bonkhoff,  H.  (1998)  Neuroendocrine  cells  in  benign  and  malignant  prostate  tissue:  morphogenesis, proliferation, and androgen receptor status. The Prostate. Supplement  8, 18‐22  20.  Chung, L. W., Gleave, M. E., Hsieh,  J. T., Hong, S.  J., and Zhau, H. E.  (1991) Reciprocal  mesenchymal‐epithelial  interaction  affecting  prostate  tumour  growth  and  hormonal  responsiveness. Cancer Surv 11, 91‐121  21.  (2005) Textbook of Benign Prostatic Hyperplasia, Taylor and Francis Group  22.  Cunha, G.  R.,  Fujii, H., Neubauer,  B.  L.,  Shannon,  J. M.,  Sawyer,  L.,  and  Reese,  B.  A.  (1983) Epithelial‐mesenchymal  interactions  in prostatic development.  I. morphological  observations of prostatic induction by urogenital sinus mesenchyme in epithelium of the  adult rodent urinary bladder. J Cell Biol 96, 1662‐1670  23.  Cunha, G. R., Hayward, S. W., and Wang, Y. Z. (2002) Role of stroma in carcinogenesis of  the prostate. Differentiation 70, 473‐485  24.  Takeda, H., and Chang, C. (1991) Immunohistochemical and in‐situ hybridization analysis  of androgen receptor expression during the development of the mouse prostate gland.  The Journal of endocrinology 129, 83‐89  25.  Cooke,  P.  S.,  Young,  P.,  and  Cunha,  G.  R.  (1991)  Androgen  receptor  expression  in  developing male reproductive organs. Endocrinology 128, 2867‐2873  132  26.  Isaacs, J. T., and Isaacs, W. B. (2004) Androgen receptor outwits prostate cancer drugs.  Nature medicine 10, 26‐27  27.  Chung, L. W., and Cunha, G. R.  (1983) Stromal‐epithelial  interactions:  II. Regulation of  prostatic growth by embryonic urogenital sinus mesenchyme. The Prostate 4, 503‐511  28.  Pu,  Y.,  Huang,  L.,  Birch,  L.,  and  Prins,  G.  S.  (2007)  Androgen  regulation  of  prostate  morphoregulatory  gene  expression:  Fgf10‐dependent  and  ‐independent  pathways.  Endocrinology 148, 1697‐1706  29.  Wilson,  J.  D.  (1999)  The  role  of  androgens  in male  gender  role  behavior.  Endocrine  reviews 20, 726‐737  30.  Zumpe, D., and Michael, R. P.  (1985) Effects of  testosterone on  the behavior of male  cynomolgus monkeys (Macaca fascicularis). Horm Behav 19, 265‐277  31.  Michels, G., and Hoppe, U. C. (2008) Rapid actions of androgens. Front Neuroendocrinol  29, 182‐198  32.  Dufau, M. L., Winters, C. A., Hattori, M., Aquilano, D., Baranao, J. L., Nozu, K., Baukal, A.,  and Catt, K. J. (1984) Hormonal regulation of androgen production by the Leydig cell. J  Steroid Biochem 20, 161‐173  33.  Makridakis,  N. M.,  and  Reichardt,  J.  K.  (2001) Molecular  epidemiology  of  hormone‐ metabolic loci in prostate cancer. Epidemiol Rev 23, 24‐29  34.  Labrie, F. (2004) Adrenal androgens and intracrinology. Semin Reprod Med 22, 299‐309  35.  Dohle, G. R., Smit, M., and Weber, R. F. A.  (2003) Androgens and male  fertility. World  journal of urology 21, 341‐345  36.  Wilson, J. D.  (2011) The critical role of androgens  in prostate development. Endocrinol  Metab Clin North Am 40, 577‐590  37.  Huggins, C. (1947) The Etiology of Benign Prostatic Hypertrophy. Bull N Y Acad Med 23,  696‐704  38.  Svechnikov,  K.,  Izzo,  G.,  Landreh,  L.,  Weisser,  J.,  and  Soder,  O.  (2010)  Endocrine  disruptors and Leydig cell function. J Biomed Biotechnol vol. 2010  39.  Huggins,  C.,  and  Hodges,  C.  V.  (1972)  Studies  on  prostatic  cancer.  I.  The  effect  of  castration,  of  estrogen  and  androgen  injection  on  serum  phosphatases  in metastatic  carcinoma of the prostate. CA: a cancer journal for clinicians 22, 232‐240  133  40.  Huggins, C., and Clark, P.  J.  (1940) Quantitative Studies of Prostatic Secretion  :  Ii. The  Effect of Castration and of Estrogen  Injection on  the Normal and on  the Hyperplastic  Prostate Glands of Dogs. J Exp Med 72, 747‐762  41.  Bordini,  B.,  and  Rosenfield,  R.  L.  (2011)  Normal  pubertal  development:  Part  I:  The  endocrine basis of puberty. Pediatr Rev 32, 223‐229  42.  Chen, H. C., Shimohigashi, Y., Dufau, M. L., and Catt, K.  J.  (1982) Characterization and  biological properties of chemically deglycosylated human chorionic gonadotropin. Role  of carbohydrate moieties in adenylate cyclase activation. J Biol Chem 257, 14446‐14452  43.  Feldman,  B.  J.,  and  Feldman,  D.  (2001)  The  development  of  androgen‐independent  prostate cancer. Nat Rev Cancer 1, 34‐45  44.  Pozzi, P., Bendotti, C., Simeoni, S., Piccioni, F., Guerini, V., Marron, T. U., Martini, L., and  Poletti, A.  (2003) Androgen 5‐alpha‐reductase  type 2  is highly expressed and active  in  rat spinal cord motor neurones. J Neuroendocrinol 15, 882‐887  45.  Uemura,  M.,  Tamura,  K.,  Chung,  S.,  Honma,  S.,  Okuyama,  A.,  Nakamura,  Y.,  and  Nakagawa, H. (2008) Novel 5 alpha‐steroid reductase (SRD5A3, type‐3) is overexpressed  in hormone‐refractory prostate cancer. Cancer science 99, 81‐86  46.  Cai,  C.,  and  Balk,  S.  P.  (2011)  Intratumoral  androgen  biosynthesis  in  prostate  cancer  pathogenesis and response to therapy. Endocrine‐related cancer 18, R175‐182  47.  Aranda,  A.,  and  Pascual,  A.  (2001) Nuclear  hormone  receptors  and  gene  expression.  Physiol Rev 81, 1269‐1304  48.  Heinlein, C. A., and Chang, C. (2002) Androgen receptor (AR) coregulators: an overview.  Endocrine reviews 23, 175‐200  49.  Heinlein, C. A.,  and Chang, C.  (2002)  The  roles of  androgen  receptors  and  androgen‐ binding proteins in nongenomic androgen actions. Mol Endocrinol 16, 2181‐2187  50.  Keller, E. T., Ershler, W. B., and Chang, C. (1996) The androgen receptor: a mediator of  diverse responses. Front Biosci 1, d59‐71  51.  Morales, M. M., Carroll, T. P., Morita, T., Schwiebert, E. M., Devuyst, O., Wilson, P. D.,  Lopes, A. G., Stanton, B. A., Dietz, H. C., Cutting, G. R., and Guggino, W. B. (1996) Both  the wild  type and a  functional  isoform of CFTR are expressed  in kidney. Am  J Physiol  270, F1038‐1048  134  52.  Cai, H., Smith, D. A., Memarzadeh, S., Lowell, C. A., Cooper, J. A., and Witte, O. N. (2011)  Differential  transformation  capacity  of  Src  family  kinases  during  the  initiation  of  prostate cancer. Proc Natl Acad Sci U S A 108, 6579‐6584  53.  Gelmann, E. P.  (2002) Molecular biology of  the  androgen  receptor.  Journal of  clinical  oncology : official journal of the American Society of Clinical Oncology 20, 3001‐3015  54.  Brinkmann, A. O., Blok, L. J., de Ruiter, P. E., Doesburg, P., Steketee, K., Berrevoets, C. A.,  and  Trapman,  J.  (1999) Mechanisms  of  androgen  receptor  activation  and  function.  J  Steroid Biochem Mol Biol 69, 307‐313  55.  Lavery, D. N., and McEwan,  I.  J.  (2005) Structure and  function of steroid receptor AF1  transactivation domains: induction of active conformations. Biochem J 391, 449‐464  56.  Jenster, G., van der Korput, H. A., Trapman, J., and Brinkmann, A. O. (1995) Identification  of two transcription activation units  in the N‐terminal domain of the human androgen  receptor. J Biol Chem 270, 7341‐7346  57.  Jenster, G., van der Korput, H. A., van Vroonhoven, C., van der Kwast, T. H., Trapman, J.,  and  Brinkmann,  A.  O.  (1991)  Domains  of  the  human  androgen  receptor  involved  in  steroid binding, transcriptional activation, and subcellular localization. Mol Endocrinol 5,  1396‐1404  58.  Yap,  T.  A.,  Zivi,  A.,  Omlin,  A.,  and  de  Bono,  J.  S.  (2011)  The  changing  therapeutic  landscape of castration‐resistant prostate cancer. Nat Rev Clin Oncol 8, 597‐610  59.  Oefelein, M.  G.,  Agarwal,  P.  K.,  and  Resnick, M.  I.  (2004)  Survival  of  patients  with  hormone refractory prostate cancer  in the prostate specific antigen era. The Journal of  urology 171, 1525‐1528  60.  Tenniswood, M. P., Guenette, R. S., Lakins, J., Mooibroek, M., Wong, P., and Welsh, J. E.  (1992) Active cell death in hormone‐dependent tissues. Cancer Metastasis Rev 11, 197‐ 220  61.  Lavery, D. N., and Bevan, C. L.  (2011) Androgen receptor signalling  in prostate cancer:  the functional consequences of acetylation. J Biomed Biotechnol vol. 2011, 862125  62.  Klocker, H., Culig, Z., Kaspar, F., Hobisch, A., Eberle, J., Reissigl, A., and Bartsch, G. (1994)  Androgen signal transduction and prostatic carcinoma. World journal of urology 12, 99‐ 103  135  63.  Ueda,  T., Mawji,  N.  R.,  Bruchovsky,  N.,  and  Sadar, M.  D.  (2002)  Ligand‐independent  activation of  the  androgen  receptor by  interleukin‐6  and  the  role of  steroid  receptor  coactivator‐1 in prostate cancer cells. J Biol Chem 277, 38087‐38094  64.  Ueda, T., Bruchovsky, N., and Sadar, M. D. (2002) Activation of the androgen receptor N‐ terminal domain by  interleukin‐6 via MAPK and STAT3 signal  transduction pathways.  J  Biol Chem 277, 7076‐7085  65.  Nahoum, V.,  and Bourguet, W.  (2007) Androgen  and estrogen  receptors: potential of  crystallography in the fight against cancer. Int J Biochem Cell Biol 39, 1280‐1287  66.  Khorasanizadeh,  S.,  and  Rastinejad,  F.  (2001)  Nuclear‐receptor  interactions  on  DNA‐ response elements. Trends Biochem Sci 26, 384‐390  67.  Haelens, A., Tanner, T., Denayer, S., Callewaert, L., and Claessens, F.  (2007) The hinge  region  regulates  DNA  binding,  nuclear  translocation,  and  transactivation  of  the  androgen receptor. Cancer research 67, 4514‐4523  68.  Schoenmakers, E., Alen, P., Verrijdt, G., Peeters, B., Verhoeven, G., Rombauts, W., and  Claessens,  F.  (1999)  Differential  DNA  binding  by  the  androgen  and  glucocorticoid  receptors  involves the second Zn‐finger and a C‐terminal extension of the DNA‐binding  domains. Biochem J 341 (Pt 3), 515‐521  69.  He,  B.,  Kemppainen,  J.  A.,  Voegel,  J.  J.,  Gronemeyer,  H.,  and  Wilson,  E.  M.  (1999)  Activation function 2  in the human androgen receptor  ligand binding domain mediates  interdomain communication with the NH(2)‐terminal domain.  J Biol Chem 274, 37219‐ 37225  70.  Loy, C. J., Sim, K. S., and Yong, E. L. (2003) Filamin‐A fragment localizes to the nucleus to  regulate  androgen  receptor  and  coactivator  functions.  Proc Natl Acad  Sci U  S A  100,  4562‐4567  71.  Bennett, N. C., Gardiner, R. A., Hooper,  J. D.,  Johnson, D. W., and Gobe, G. C.  (2010)  Molecular cell biology of androgen receptor signalling.  Int  J Biochem Cell Biol 42, 813‐ 827  72.  Cardozo, C. P., Michaud, C., Ost, M. C., Fliss, A. E., Yang, E., Patterson, C., Hall, S. J., and  Caplan,  A.  J.  (2003)  C‐terminal  Hsp‐interacting  protein  slows  androgen  receptor  synthesis and reduces its rate of degradation. Arch Biochem Biophys 410, 134‐140  136  73.  Shatkina,  L., Mink,  S., Rogatsch, H.,  Klocker, H.,  Langer, G., Nestl, A.,  and Cato, A. C.  (2003) The cochaperone Bag‐1L enhances androgen receptor action via interaction with  the NH2‐terminal region of the receptor. Mol Cell Biol 23, 7189‐7197  74.  He, B., Lee, L. W., Minges, J. T., and Wilson, E. M. (2002) Dependence of selective gene  activation on the androgen receptor NH2‐ and COOH‐terminal  interaction. J Biol Chem  277, 25631‐25639  75.  Simental,  J.  A.,  Sar,  M.,  Lane,  M.  V.,  French,  F.  S.,  and  Wilson,  E.  M.  (1991)  Transcriptional  activation  and  nuclear  targeting  signals  of  the  human  androgen  receptor. J Biol Chem 266, 510‐518  76.  Heemers, H. V., and Tindall, D. J. (2007) Androgen receptor (AR) coregulators: a diversity  of  functions  converging  on  and  regulating  the  AR  transcriptional  complex.  Endocrine  reviews 28, 778‐808  77.  Lonergan, P. E., and Tindall, D. J. (2011) Androgen receptor signaling in prostate cancer  development and progression. J Carcinog 10, 20  78.  Lee,  D.  K.,  and  Chang,  C.  (2003)  Endocrine mechanisms  of  disease:  Expression  and  degradation of androgen receptor: mechanism and clinical implication. J Clin Endocrinol  Metab 88, 4043‐4054  79.  Ding, X. F., Anderson, C. M., Ma, H., Hong, H., Uht, R. M., Kushner, P. J., and Stallcup, M.  R.  (1998)  Nuclear  receptor‐binding  sites  of  coactivators  glucocorticoid  receptor  interacting protein 1 (GRIP1) and steroid receptor coactivator 1 (SRC‐1): multiple motifs  with different binding specificities. Mol Endocrinol 12, 302‐313  80.  Hong, H., Darimont, B. D., Ma, H., Yang, L., Yamamoto, K. R., and Stallcup, M. R. (1999)  An additional  region of  coactivator GRIP1  required  for  interaction with  the hormone‐ binding domains of a subset of nuclear receptors. J Biol Chem 274, 3496‐3502  81.  Shen, H. C., and Coetzee, G. A. (2005) The androgen receptor: unlocking the secrets of  its unique transactivation domain. Vitam Horm 71, 301‐319  82.  Shen, H. C., Buchanan, G., Butler, L. M., Prescott,  J., Henderson, M., Tilley, W. D., and  Coetzee, G. A. (2005) GRIP1 mediates the interaction between the amino‐ and carboxyl‐ termini of the androgen receptor. Biol Chem 386, 69‐74  83.  Cheng, S., Brzostek, S., Lee, S. R., Hollenberg, A. N., and Balk, S. P. (2002)  Inhibition of  the dihydrotestosterone‐activated androgen receptor by nuclear receptor corepressor.  Mol Endocrinol 16, 1492‐1501  137  84.  Liao, G., Chen, L. Y., Zhang, A., Godavarthy, A., Xia, F., Ghosh, J. C., Li, H., and Chen, J. D.  (2003)  Regulation  of  androgen  receptor  activity  by  the  nuclear  receptor  corepressor  SMRT. J Biol Chem 278, 5052‐5061  85.  Nieto, M., Finn, S.,  Loda, M., and Hahn, W. C.  (2007) Prostate  cancer: Re‐focusing on  androgen receptor signaling. Int J Biochem Cell Biol 39, 1562‐1568  86.  Luo,  J., Duggan, D.  J., Chen, Y., Sauvageot,  J., Ewing, C. M., Bittner, M. L., Trent,  J. M.,  and  Isaacs,  W.  B.  (2001)  Human  prostate  cancer  and  benign  prostatic  hyperplasia:  molecular dissection by gene expression profiling. Cancer research 61, 4683‐4688  87.  Baker,  S.  G.,  Cappuccio,  A.,  and  Potter,  J.  D.  (2010)  Research  on  early‐stage  carcinogenesis: are we approaching paradigm  instability?  Journal of clinical oncology  :  official journal of the American Society of Clinical Oncology 28, 3215‐3218  88.  Kim, Y., Stolarska, M. A., and Othmer, H. G. (2011) The role of the microenvironment in  tumor growth and invasion. Prog Biophys Mol Biol 106, 353‐379  89.  Collins, A. T., Berry, P. A., Hyde, C., Stower, M. J., and Maitland, N. J. (2005) Prospective  identification  of  tumorigenic  prostate  cancer  stem  cells.  Cancer  research  65,  10946‐ 10951  90.  Hamburger, A. W.,  and  Salmon,  S.  E.  (1977)  Primary  bioassay  of  human  tumor  stem  cells. Science 197, 461‐463  91.  Madu, C. O., and Lu, Y. (2010) Novel diagnostic biomarkers for prostate cancer. J Cancer  1, 150‐177  92.  Miller,  G.  J.,  and  Cygan,  J. M.  (1992)  Diagnostic  correlations  with  whole mounts  of  radical prostatectomy specimens. Monogr Pathol, 183‐197  93.  Buhmeida,  A.,  Pyrhonen,  S.,  Laato,  M.,  and  Collan,  Y.  (2006)  Prognostic  factors  in  prostate cancer. Diagn Pathol 1, 4  94.  Statistics, C. C. S. s. S. C. o. C. (2011) Canadian Cancer Statistics 2011.  (Toronto, O. C. C.  S., ed)  95.  Jemal, A., Bray,  F., Center, M. M.,  Ferlay,  J., Ward,  E.,  and  Forman, D.  (2011) Global  cancer statistics. CA: a cancer journal for clinicians 61, 69‐90  96.  Chodak, G. (2006) Prostate cancer: epidemiology, screening, and biomarkers. Rev Urol 8  Suppl 2, S3‐8  138  97.  Sakr, W.  A.,  Haas,  G.  P.,  Cassin,  B.  F.,  Pontes,  J.  E.,  and  Crissman,  J.  D.  (1993)  The  frequency  of  carcinoma  and  intraepithelial  neoplasia  of  the  prostate  in  young male  patients. The Journal of urology 150, 379‐385  98.  Gronberg, H. (2003) Prostate cancer epidemiology. Lancet 361, 859‐864  99.  Soos,  G.,  Tsakiris,  I.,  Szanto,  J.,  Turzo,  C.,  Haas,  P.  G.,  and  Dezso,  B.  (2005)  The  prevalence  of  prostate  carcinoma  and  its  precursor  in  Hungary:  an  autopsy  study.  European urology 48, 739‐744  100.  Haas, G. P., and Sakr, W. A. (1997) Epidemiology of prostate cancer. CA: a cancer journal  for clinicians 47, 273‐287  101.  Bostwick, D. G., Burke, H. B., Djakiew, D., Euling, S., Ho, S. M., Landolph, J., Morrison, H.,  Sonawane, B., Shifflett, T., Waters, D. J., and Timms, B.  (2004) Human prostate cancer  risk factors. Cancer 101, 2371‐2490  102.  Tulinius, H., Egilsson, V., Olafsdottir, G. H., and Sigvaldason, H. (1992) Risk of prostate,  ovarian,  and  endometrial  cancer  among  relatives  of women with  breast  cancer.  BMJ  305, 855‐857  103.  Spitz, M. R., Currier, R. D., Fueger, J. J., Babaian, R. J., and Newell, G. R. (1991) Familial  patterns of prostate cancer: a case‐control analysis. The  Journal of urology 146, 1305‐ 1307  104.  Carter,  B.  S.,  Bova, G.  S.,  Beaty,  T. H.,  Steinberg, G. D.,  Childs,  B.,  Isaacs, W.  B.,  and  Walsh, P. C. (1993) Hereditary prostate cancer: epidemiologic and clinical features. The  Journal of urology 150, 797‐802  105.  Eeles,  R.  A.,  Kote‐Jarai,  Z.,  Giles,  G.  G.,  Olama,  A.  A.,  Guy,  M.,  Jugurnauth,  S.  K.,  Mulholland, S., Leongamornlert, D. A., Edwards, S. M., Morrison, J., Field, H. I., Southey,  M. C., Severi, G., Donovan,  J. L., Hamdy, F. C., Dearnaley, D. P., Muir, K. R., Smith, C.,  Bagnato, M., Ardern‐Jones, A. T., Hall, A. L., O'Brien, L. T., Gehr‐Swain, B. N., Wilkinson,  R. A., Cox, A., Lewis, S., Brown, P. M., Jhavar, S. G., Tymrakiewicz, M., Lophatananon, A.,  Bryant, S. L., Horwich, A., Huddart, R. A., Khoo, V. S., Parker, C. C., Woodhouse, C.  J.,  Thompson, A., Christmas, T., Ogden, C., Fisher, C., Jamieson, C., Cooper, C. S., English, D.  R.,  Hopper,  J.  L.,  Neal,  D.  E.,  and  Easton,  D.  F.  (2008) Multiple  newly  identified  loci  associated with prostate cancer susceptibility. Nat Genet 40, 316‐321  106.  Lindstrom, S., Wiklund, F., Adami, H. O., Balter, K. A., Adolfsson,  J., and Gronberg, H.  (2006)  Germ‐line  genetic  variation  in  the  key  androgen‐regulating  genes  androgen  139  receptor,  cytochrome  P450,  and  steroid‐5‐alpha‐reductase  type  2  is  important  for  prostate cancer development. Cancer research 66, 11077‐11083  107.  Jones, B. A., Liu, W. L., Araujo, A. B., Kasl, S. V., Silvera, S. N., Soler‐Vila, H., Curnen, M.  G.,  and Dubrow,  R.  (2008)  Explaining  the  race  difference  in  prostate  cancer  stage  at  diagnosis. Cancer Epidemiol Biomarkers Prev 17, 2825‐2834  108.  Williams, H., and Powell,  I. J. (2009) Epidemiology, pathology, and genetics of prostate  cancer  among  African Americans  compared with  other  ethnicities. Methods Mol  Biol  472, 439‐453  109.  Kelavkar, U. P., Hutzley, J., Dhir, R., Kim, P., Allen, K. G., and McHugh, K. (2006) Prostate  tumor growth and recurrence can be modulated by the omega‐6:omega‐3 ratio in diet:  athymic mouse xenograft model simulating radical prostatectomy. Neoplasia 8, 112‐124  110.  Wolf, A. M., Wender, R. C., Etzioni, R. B., Thompson,  I. M., D'Amico, A. V., Volk, R.  J.,  Brooks, D. D., Dash, C., Guessous,  I., Andrews, K., DeSantis, C., and Smith, R. A. (2010)  American Cancer  Society  guideline  for  the early detection of prostate  cancer: update  2010. CA: a cancer journal for clinicians 60, 70‐98  111.  Chen, Z., Prestigiacomo, A., and Stamey, T. A. (1995) Purification and characterization of  prostate‐specific  antigen  (PSA)  complexed  to  alpha  1‐antichymotrypsin:  potential  reference  material  for  international  standardization  of  PSA  immunoassays.  Clinical  chemistry 41, 1273‐1282  112.  Crawford, E. D. (2003) Epidemiology of prostate cancer. Urology 62, 3‐12  113.  Engen, J. R., Wales, T. E., Hochrein, J. M., Meyn, M. A., 3rd, Banu Ozkan, S., Bahar, I., and  Smithgall, T. E. (2008) Structure and dynamic regulation of Src‐family kinases. Cell Mol  Life Sci 65, 3058‐3073  114.  D'Amico, A. V. (2003) Therapeutic strategies for localized and locally advanced prostate  cancer: combining androgen suppression with definitive local therapy. Rev Urol 5 Suppl  6, S40‐46  115.  Mahon, S. M. (2005) Screening for prostate cancer: informing men about their options.  Clin J Oncol Nurs 9, 625‐627  116.  Hakama, M., Coleman, M. P., Alexe, D. M.,  and Auvinen, A.  (2008) Cancer  screening:  evidence and practice in Europe 2008. Eur J Cancer 44, 1404‐1413  140  117.  Tabesh, A., Teverovskiy, M., Pang, H. Y., Kumar, V. P., Verbel, D., Kotsianti, A., and Saidi,  O.  (2007) Multifeature  prostate  cancer  diagnosis  and Gleason  grading  of  histological  images. IEEE Trans Med Imaging 26, 1366‐1378  118.  Epstein,  J.  I.  (2010) An update of  the Gleason grading  system. The  Journal of urology  183, 433‐440  119.  LaSpina,  M.,  and  Haas,  G.  P.  (2008)  Update  on  the  diagnosis  and  management  of  prostate cancer. Can J Urol 15 Suppl 1, 3‐13; discussion 13  120.  Cowherd, S. M. (2012) Tumor staging and grading: a primer. Methods Mol Biol 823, 1‐18  121.  Danila, D. C., Fleisher, M., and Scher, H. I. (2011) Circulating tumor cells as biomarkers in  prostate cancer. Clin Cancer Res 17, 3903‐3912  122.  Pirtskhalaishvili, G., Hrebinko, R. L., and Nelson, J. B. (2001) The treatment of prostate  cancer: an overview of current options. Cancer Pract 9, 295‐306  123.  Bill‐Axelson,  A., Holmberg,  L.,  Ruutu, M., Haggman, M.,  Andersson,  S. O.,  Bratell,  S.,  Spangberg, A., Busch, C., Nordling, S., Garmo, H., Palmgren, J., Adami, H. O., Norlen, B.  J.,  and  Johansson,  J.  E.  (2005) Radical prostatectomy  versus watchful waiting  in early  prostate cancer. The New England journal of medicine 352, 1977‐1984  124.  Morgan, V. A.,  Kyriazi,  S., Ashley,  S.  E.,  and DeSouza, N. M.  (2007)  Evaluation  of  the  potential  of  diffusion‐weighted  imaging  in  prostate  cancer  detection. Acta  Radiol  48,  695‐703  125.  Morgan,  P.  B.,  Hanlon,  A.  L.,  Horwitz,  E. M.,  Buyyounouski, M.  K.,  Uzzo,  R.  G.,  and  Pollack, A. (2007) Radiation dose and late failures in prostate cancer. Int J Radiat Oncol  Biol Phys 67, 1074‐1081  126.  Parker, C.  (2004) Active  surveillance  of  early prostate  cancer:  rationale,  initial  results  and future developments. Prostate Cancer Prostatic Dis 7, 184‐187  127.  Parker, C.  (2004) Active  surveillance:  towards a new paradigm  in  the management of  early prostate cancer. Lancet Oncol 5, 101‐106  128.  Klotz, L., Zhang, L., Lam, A., Nam, R., Mamedov, A., and Loblaw, A. (2010) Clinical results  of  long‐term  follow‐up  of  a  large,  active  surveillance  cohort  with  localized  prostate  cancer.  Journal of clinical oncology  : official  journal of  the American Society of Clinical  Oncology 28, 126‐131  141  129.  Klotz, L. (2009) Active surveillance for favorable risk prostate cancer. Pro. The Journal of  urology 182, 2565‐2566  130.  Bhatnagar,  V.,  and  Kaplan,  R.  M.  (2005)  Treatment  options  for  prostate  cancer:  evaluating the evidence. Am Fam Physician 71, 1915‐1922  131.  Guedea,  F.,  Ramos,  A.,  Herruzo,  I.,  Sanchez  Calzado,  J.  A.,  Contreras,  J.,  Romero,  J.,  Craven‐Bartle, J., Willisch, P., Lopez Torrecilla, J. L., Maldonado, X., Sancho, G., Zapatero,  A., Ferrer, M., Pardo, Y., Fernandez, P., Marino, A., Hervas, A., Macis, V., Boladeras, A.,  Ferrer, F., and Davis, B. J. (2010) Treatment of  localised prostate cancer with radiation  therapy: evidence versus opinion. Clin Transl Oncol 12, 315‐317  132.  Martin, T., Wenz, F., Bohmer, D., Sedlmayer, F., Hinkelbein, W., Henkel, T. O., Miller, K.,  and Wiegel, T.  (2010)  [Radiation  therapy  for prostate cancer  in  the new S3 guideline.  Part 2: postoperative radiation therapy and brachytherapy]. Urologe A 49, 216‐220  133.  Hammad, F. T. (2008) Radical prostatectomy. Ann N Y Acad Sci 1138, 267‐277  134.  Rayala, H.  J., and Richie,  J. P.  (2009) Radical prostatectomy  reigns  supreme. Oncology  (Williston Park) 23, 863‐867  135.  Fu, Q., Moul,  J. W., and  Sun,  L.  (2011) Contemporary  radical prostatectomy. Prostate  Cancer 2011, 645030  136.  Stanford,  J. L., Feng, Z., Hamilton, A. S., Gilliland, F. D., Stephenson, R. A., Eley,  J. W.,  Albertsen, P. C., Harlan, L. C., and Potosky, A. L. (2000) Urinary and sexual function after  radical  prostatectomy  for  clinically  localized  prostate  cancer:  the  Prostate  Cancer  Outcomes Study. JAMA 283, 354‐360  137.  Pienta,  K.  J.,  and  Bradley,  D.  (2006)  Mechanisms  underlying  the  development  of  androgen‐independent prostate cancer. Clin Cancer Res 12, 1665‐1671  138.  Beltran, H., Beer, T. M., Carducci, M. A., de Bono, J., Gleave, M., Hussain, M., Kelly, W.  K.,  Saad,  F.,  Sternberg, C., Tagawa,  S. T.,  and  Tannock,  I.  F.  (2011) New  therapies  for  castration‐resistant prostate cancer: efficacy and safety. European urology 60, 279‐290  139.  Dutt, S. S., and Gao, A. C. (2009) Molecular mechanisms of castration‐resistant prostate  cancer progression. Future Oncol 5, 1403‐1413  140.  Nadiminty,  N.,  and  Gao,  A.  C.  (2011)  Mechanisms  of  persistent  activation  of  the  androgen receptor  in CRPC: recent advances and future perspectives. World  journal of  urology   142  141.  Blumberg, J. M., Kwon, E. O., Cheetham, T. C., Niu, F., Shapiro, C. E., Pacificar, J., Loo, R.  K., Williams,  S. G.,  and Chien, G. W.  (2011)  Early  development  of  castrate  resistance  varies with different dosing regimens of luteinizing hormone releasing hormone agonist  in primary hormonal therapy for prostate cancer. Urology 77, 412‐416  142.  Chen,  Y., Clegg, N.  J.,  and  Scher, H.  I.  (2009) Anti‐androgens  and  androgen‐depleting  therapies in prostate cancer: new agents for an established target. Lancet Oncol 10, 981‐ 991  143.  Taplin, M. E., Manola,  J., Oh, W. K., Kantoff, P. W., Bubley, G.  J., Smith, M., Barb, D.,  Mantzoros, C., Gelmann, E. P., and Balk, S. P.  (2008) A phase  II  study of mifepristone  (RU‐486)  in  castration‐resistant  prostate  cancer,  with  a  correlative  assessment  of  androgen‐related hormones. BJU Int 101, 1084‐1089  144.  Harris, W.  P., Mostaghel,  E.  A.,  Nelson,  P.  S.,  and Montgomery,  B.  (2009)  Androgen  deprivation  therapy:  progress  in  understanding  mechanisms  of  resistance  and  optimizing androgen depletion. Nat Clin Pract Urol 6, 76‐85  145.  Scher, H. I., Beer, T. M., Higano, C. S., Anand, A., Taplin, M. E., Efstathiou, E., Rathkopf,  D.,  Shelkey,  J.,  Yu,  E.  Y.,  Alumkal,  J., Hung, D., Hirmand, M.,  Seely,  L., Morris, M.  J.,  Danila, D. C., Humm,  J., Larson, S., Fleisher, M., and Sawyers, C. L.  (2010) Antitumour  activity of MDV3100  in castration‐resistant prostate cancer: a phase 1‐2 study. Lancet  375, 1437‐1446  146.  Aggarwal,  R.,  and  Ryan,  C.  J.  (2011)  Castration‐resistant  prostate  cancer:  targeted  therapies and individualized treatment. Oncologist 16, 264‐275  147.  Higano, C. S., and Crawford, E. D. (2011) New and emerging agents for the treatment of  castration‐resistant prostate cancer. Urol Oncol 29, 1‐8  148.  Logothetis,  C.  J.,  Efstathiou,  E., Manuguid,  F.,  and  Kirkpatrick,  P.  (2011)  Abiraterone  acetate. Nat Rev Drug Discov 10, 573‐574  149.  (2011) Abiraterone acetate  (Zytiga)  for metastatic castration‐resistant prostate cancer.  Med Lett Drugs Ther 53, 63‐64  150.  Bianchini, D., Zivi, A., Sandhu, S., and de Bono,  J. S.  (2010) Horizon scanning  for novel  therapeutics for the treatment of prostate cancer. Expert Opin Investig Drugs 19, 1487‐ 1502  151.  Tannock,  I.  F., de Wit, R., Berry, W. R., Horti,  J., Pluzanska, A., Chi, K. N., Oudard,  S.,  Theodore, C., James, N. D., Turesson, I., Rosenthal, M. A., and Eisenberger, M. A. (2004)  143  Docetaxel  plus  prednisone  or  mitoxantrone  plus  prednisone  for  advanced  prostate  cancer. The New England journal of medicine 351, 1502‐1512  152.  Petrylak, D. P., Tangen, C. M., Hussain, M. H., Lara, P. N., Jr., Jones, J. A., Taplin, M. E.,  Burch, P. A., Berry, D., Moinpour, C., Kohli, M., Benson, M. C., Small, E. J., Raghavan, D.,  and Crawford,  E. D.  (2004) Docetaxel  and  estramustine  compared with mitoxantrone  and prednisone for advanced refractory prostate cancer. N Engl J Med 351, 1513‐1520  153.  Antonarakis, E. S., and Armstrong, A.  J.  (2011) Evolving  standards  in  the  treatment of  docetaxel‐refractory castration‐resistant prostate cancer. Prostate Cancer Prostatic Dis  14, 192‐205  154.  de Bono, J. S., Oudard, S., Ozguroglu, M., Hansen, S., Machiels, J. P., Kocak, I., Gravis, G.,  Bodrogi, I., Mackenzie, M. J., Shen, L., Roessner, M., Gupta, S., and Sartor, A. O. (2010)  Prednisone plus cabazitaxel or mitoxantrone for metastatic castration‐resistant prostate  cancer  progressing  after  docetaxel  treatment:  a  randomised  open‐label  trial.  Lancet  376, 1147‐1154  155.  Wang,  X.,  Yu,  J.,  Sreekumar,  A.,  Varambally,  S.,  Shen,  R.,  Giacherio,  D.,  Mehra,  R.,  Montie, J. E., Pienta, K. J., Sanda, M. G., Kantoff, P. W., Rubin, M. A., Wei, J. T., Ghosh,  D., and Chinnaiyan, A. M. (2005) Autoantibody signatures  in prostate cancer. The New  England journal of medicine 353, 1224‐1235  156.  Kantoff,  P. W.,  Higano,  C.  S.,  Shore,  N.  D.,  Berger,  E.  R.,  Small,  E.  J.,  Penson,  D.  F.,  Redfern,  C.  H.,  Ferrari,  A.  C.,  Dreicer,  R.,  Sims,  R.  B.,  Xu,  Y.,  Frohlich,  M.  W.,  and  Schellhammer,  P.  F.  (2010)  Sipuleucel‐T  immunotherapy  for  castration‐resistant  prostate cancer. N Engl J Med 363, 411‐422  157.  Higano, C. S., Small, E. J., Schellhammer, P., Yasothan, U., Gubernick, S., Kirkpatrick, P.,  and Kantoff, P. W. (2010) Sipuleucel‐T. Nat Rev Drug Discov 9, 513‐514  158.  Handratta, V. D., Vasaitis, T. S., Njar, V. C., Gediya, L. K., Kataria, R., Chopra, P., Newman,  D.,  Jr.,  Farquhar, R., Guo,  Z., Qiu,  Y.,  and Brodie, A. M.  (2005) Novel C‐17‐heteroaryl  steroidal  CYP17  inhibitors/antiandrogens:  synthesis,  in  vitro  biological  activity,  pharmacokinetics, and antitumor activity in the LAPC4 human prostate cancer xenograft  model. J Med Chem 48, 2972‐2984  159.  Saad, F., Hotte, S., North, S., Eigl, B., Chi, K., Czaykowski, P., Wood, L., Pollak, M., Berry,  S.,  Lattouf,  J.  B., Mukherjee,  S.  D.,  Gleave, M.,  and Winquist,  E.  (2011)  Randomized  phase  II trial of Custirsen (OGX‐011)  in combination with docetaxel or mitoxantrone as  second‐line  therapy  in  patients  with  metastatic  castrate‐resistant  prostate  cancer  progressing after first‐line docetaxel: CUOG trial P‐06c. Clin Cancer Res 17, 5765‐5773  144  160.  Lamoureux, F., Thomas, C., Yin, M. J., Kuruma, H., Beraldi, E., Fazli, L., Zoubeidi, A., and  Gleave, M. E. (2011) Clusterin  inhibition using OGX‐011 synergistically enhances Hsp90  inhibitor activity by suppressing the heat shock response  in castrate‐resistant prostate  cancer. Cancer research 71, 5838‐5849  161.  Edwards,  J.  (2010) Src kinase  inhibitors: an emerging therapeutic treatment option  for  prostate cancer. Expert Opin Investig Drugs 19, 605‐614  162.  Scher,  H.  I.,  and  Sawyers,  C.  L.  (2005)  Biology  of  progressive,  castration‐resistant  prostate  cancer:  directed  therapies  targeting  the  androgen‐receptor  signaling  axis.  Journal of clinical oncology : official journal of the American Society of Clinical Oncology  23, 8253‐8261  163.  Lamont, K. R., and Tindall, D. J.  (2011) Minireview: Alternative activation pathways  for  the androgen receptor in prostate cancer. Mol Endocrinol 25, 897‐907  164.  Mohler, J. L. (2008) Castration‐recurrent prostate cancer  is not androgen‐independent.  Adv Exp Med Biol 617, 223‐234  165.  Lamont,  K.  R.,  and  Tindall, D.  J.  (2010) Androgen  regulation  of  gene  expression. Adv  Cancer Res 107, 137‐162  166.  Debes, J. D., and Tindall, D. J. (2002) The role of androgens and the androgen receptor in  prostate cancer. Cancer Lett 187, 1‐7  167.  Arnold,  J.  T.,  and  Isaacs,  J.  T.  (2002)  Mechanisms  involved  in  the  progression  of  androgen‐independent prostate cancers: it is not only the cancer cell's fault. Endocrine‐ related cancer 9, 61‐73  168.  Dehm,  S. M.,  and  Tindall,  D.  J.  (2005)  Regulation  of  androgen  receptor  signaling  in  prostate cancer. Expert Rev Anticancer Ther 5, 63‐74  169.  Guo, Z., Dai, B.,  Jiang, T., Xu, K., Xie, Y., Kim, O., Nesheiwat,  I., Kong, X., Melamed,  J.,  Handratta, V. D., Njar, V. C., Brodie, A. M., Yu, L. R., Veenstra, T. D., Chen, H., and Qiu, Y.  (2006) Regulation of androgen receptor activity by tyrosine phosphorylation. Cancer Cell  10, 309‐319  170.  Mahajan, N. P., Liu, Y., Majumder, S., Warren, M. R., Parker, C. E., Mohler, J. L., Earp, H.  S., and Whang, Y. E. (2007) Activated Cdc42‐associated kinase Ack1 promotes prostate  cancer progression via androgen receptor tyrosine phosphorylation. Proc Natl Acad Sci  U S A 104, 8438‐8443  145  171.  Grossmann, M. E., Huang, H., and Tindall, D.  J.  (2001) Androgen  receptor  signaling  in  androgen‐refractory prostate cancer. Journal of the National Cancer Institute 93, 1687‐ 1697  172.  Gregory, C. W., Fei, X., Ponguta, L. A., He, B., Bill, H. M., French, F. S., and Wilson, E. M.  (2004)  Epidermal  growth  factor  increases  coactivation  of  the  androgen  receptor  in  recurrent prostate cancer. J Biol Chem 279, 7119‐7130  173.  Attar, R. M., Takimoto, C. H., and Gottardis, M. M. (2009) Castration‐resistant prostate  cancer: locking up the molecular escape routes. Clin Cancer Res 15, 3251‐3255  174.  Molina,  A.,  and  Belldegrun,  A.  (2011)  Novel  therapeutic  strategies  for  castration  resistant  prostate  cancer:  inhibition  of  persistent  androgen  production  and  androgen  receptor mediated signaling. The Journal of urology 185, 787‐794  175.  Mohler, J. L., Titus, M. A., Bai, S., Kennerley, B. J., Lih, F. B., Tomer, K. B., and Wilson, E.  M.  (2011)  Activation  of  the  androgen  receptor  by  intratumoral  bioconversion  of  androstanediol  to  dihydrotestosterone  in  prostate  cancer.  Cancer  research  71,  1486‐ 1496  176.  Montgomery, R. B., Mostaghel, E. A., Vessella, R., Hess, D. L., Kalhorn, T. F., Higano, C. S.,  True,  L.  D.,  and  Nelson,  P.  S.  (2008)  Maintenance  of  intratumoral  androgens  in  metastatic prostate cancer: a mechanism for castration‐resistant tumor growth. Cancer  research 68, 4447‐4454  177.  Locke, J. A., Guns, E. S., Lubik, A. A., Adomat, H. H., Hendy, S. C., Wood, C. A., Ettinger, S.  L., Gleave, M. E., and Nelson, C. C. (2008) Androgen  levels  increase by  intratumoral de  novo steroidogenesis during progression of castration‐resistant prostate cancer. Cancer  research 68, 6407‐6415  178.  Dehm, S. M., and Tindall, D. J. (2011) Alternatively spliced androgen receptor variants.  Endocrine‐related cancer 18, R183‐196  179.  Ahrens‐Fath,  I.,  Politz,  O.,  Geserick,  C.,  and  Haendler,  B.  (2005)  Androgen  receptor  function is modulated by the tissue‐specific AR45 variant. FEBS J 272, 74‐84  180.  Guo,  Z.,  and Qiu,  Y.  (2011) A new  trick of  an old molecule:  androgen  receptor  splice  variants taking the stage?! Int J Biol Sci 7, 815‐822  181.  Watson, P. A., Chen, Y. F., Balbas, M. D., Wongvipat, J., Socci, N. D., Viale, A., Kim, K., and  Sawyers, C. L. (2010) Constitutively active androgen receptor splice variants expressed in  146  castration‐resistant  prostate  cancer  require  full‐length  androgen  receptor.  Proc  Natl  Acad Sci U S A 107, 16759‐16765  182.  Shi, X. B., Ma, A. H., Tepper, C. G., Xia, L., Gregg, J. P., Gandour‐Edwards, R., Mack, P. C.,  Kung, H. J., and deVere White, R. W. (2004) Molecular alterations associated with LNCaP  cell progression to androgen independence. The Prostate 60, 257‐271  183.  Ellis, J. (1987) Proteins as molecular chaperones. Nature 328, 378‐379  184.  Hartl,  F. U., Bracher, A.,  and Hayer‐Hartl, M.  (2011) Molecular  chaperones  in protein  folding and proteostasis. Nature 475, 324‐332  185.  Hartl, F. U., and Hayer‐Hartl, M.  (2009) Converging concepts of protein  folding  in vitro  and in vivo. Nat Struct Mol Biol 16, 574‐581  186.  Hayes, S. A., and Dice, J. F. (1996) Roles of molecular chaperones in protein degradation.  J Cell Biol 132, 255‐258  187.  Evstigneeva,  R.  P.,  and  Pal'keeva, M.  E.  (2000)  [Methods  of  searching  for  antigenic  determinants for proteins with known primary structure]. Bioorg Khim 26, 243‐262  188.  So, A., Hadaschik, B., Sowery, R., and Gleave, M.  (2007) The  role of  stress proteins  in  prostate cancer. Curr Genomics 8, 252‐261  189.  Solimini, N. L., Luo, J., and Elledge, S. J.  (2007) Non‐oncogene addiction and the stress  phenotype of cancer cells. Cell 130, 986‐988  190.  Luo,  J., Solimini, N. L., and Elledge, S.  J.  (2009) Principles of cancer  therapy: oncogene  and non‐oncogene addiction. Cell 136, 823‐837  191.  Dai,  C., Whitesell,  L.,  Rogers,  A.  B.,  and  Lindquist,  S.  (2007) Heat  shock  factor  1  is  a  powerful multifaceted modifier of carcinogenesis. Cell 130, 1005‐1018  192.  Bhattacharyya,  J., Padmanabha Udupa, E. G., Wang,  J., and Sharma, K. K.  (2006) Mini‐ alphaB‐crystallin: a functional element of alphaB‐crystallin with chaperone‐like activity.  Biochemistry 45, 3069‐3076  193.  Sun, Y., and MacRae, T. H.  (2005) Small heat  shock proteins: molecular  structure and  chaperone function. Cell Mol Life Sci 62, 2460‐2476  194.  Lindner, R. A., Carver, J. A., Ehrnsperger, M., Buchner, J., Esposito, G., Behlke, J., Lutsch,  G., Kotlyarov, A., and Gaestel, M. (2000) Mouse Hsp25, a small shock protein. The role  147  of its C‐terminal extension in oligomerization and chaperone action. Eur J Biochem 267,  1923‐1932  195.  Ciocca, D. R., and Calderwood, S. K.  (2005) Heat  shock proteins  in  cancer: diagnostic,  prognostic, predictive, and treatment implications. Cell Stress Chaperones 10, 86‐103  196.  Calderwood, S. K., Khaleque, M. A., Sawyer, D. B., and Ciocca, D. R.  (2006) Heat shock  proteins in cancer: chaperones of tumorigenesis. Trends Biochem Sci 31, 164‐172  197.  Andrieu, C., Taieb, D., Baylot, V., Ettinger, S., Soubeyran, P., De‐Thonel, A., Nelson, C.,  Garrido, C., So, A., Fazli, L., Bladou, F., Gleave, M.,  Iovanna, J. L., and Rocchi, P. (2010)  Heat  shock  protein  27  confers  resistance  to  androgen  ablation  and  chemotherapy  in  prostate cancer cells through eIF4E. Oncogene 29, 1883‐1896  198.  Hadchity, E., Aloy, M. T., Paulin, C., Armandy, E., Watkin, E., Rousson, R., Gleave, M.,  Chapet,  O.,  and  Rodriguez‐Lafrasse,  C.  (2009)  Heat  shock  protein  27  as  a  new  therapeutic target for radiation sensitization of head and neck squamous cell carcinoma.  Mol Ther 17, 1387‐1394  199.  Cotto,  J.  J.,  and Morimoto,  R.  I.  (1999)  Stress‐induced  activation  of  the  heat‐shock  response: cell and molecular biology of heat‐shock factors. Biochem Soc Symp 64, 105‐ 118  200.  Lebret, T., Watson, R. W., Molinie, V., O'Neill, A., Gabriel, C., Fitzpatrick, J. M., and Botto,  H. (2003) Heat shock proteins HSP27, HSP60, HSP70, and HSP90: expression  in bladder  carcinoma. Cancer 98, 970‐977  201.  Lebret, T., Watson, R. W., and Fitzpatrick, J. M. (2003) Heat shock proteins: their role in  urological tumors. The Journal of urology 169, 338‐346  202.  Fulda, S., Gorman, A. M., Hori, O., and Samali, A.  (2010) Cellular stress responses: cell  survival and cell death. Int J Cell Biol 2010, 214074  203.  Fulda, S. (2010) Evasion of apoptosis as a cellular stress response in cancer. Int J Cell Biol  2010, 370835  204.  Ni, L., Yang, C. S., Gioeli, D., Frierson, H., Toft, D. O., and Paschal, B. M. (2010) FKBP51  promotes assembly of the Hsp90 chaperone complex and regulates androgen receptor  signaling in prostate cancer cells. Mol Cell Biol 30, 1243‐1253  205.  Tao,  Y.  J.,  and  Zheng, W.  (2011) Chaperones  and  the maturation of  steroid hormone  receptor complexes. Oncotarget 2, 104‐106  148  206.  Prescott, J., and Coetzee, G. A. (2006) Molecular chaperones throughout the life cycle of  the androgen receptor. Cancer Lett 231, 12‐19  207.  Pratt, W. B., and Toft, D. O. (1997) Steroid receptor interactions with heat shock protein  and immunophilin chaperones. Endocrine reviews 18, 306‐360  208.  Terouanne, B., Paris,  F.,  Servant, N., Georget, V.,  and  Sultan, C.  (2002)  Evidence  that  chlormadinone acetate exhibits antiandrogenic activity in androgen‐dependent cell line.  Mol Cell Endocrinol 198, 143‐147  209.  Vanaja, D. K., Mitchell, S. H., Toft, D. O., and Young, C. Y. (2002) Effect of geldanamycin  on androgen receptor function and stability. Cell Stress Chaperones 7, 55‐64  210.  Suzuki, Y., Kondo, Y., Hara, S., Kimata, R., and Nishimura, T. (2010) Effect of the hsp90  inhibitor  geldanamycin  on  androgen  response  of  prostate  cancer  under  hypoxic  conditions. Int J Urol 17, 281‐285  211.  Tan, S. S., Ahmad, I., Bennett, H. L., Singh, L., Nixon, C., Seywright, M., Barnetson, R. J.,  Edwards,  J., and Leung, H. Y.  (2010) GRP78 up‐regulation  is associated with androgen  receptor  status, Hsp70‐Hsp90  client proteins  and  castrate‐resistant prostate  cancer.  J  Pathol   212.  De Leon, J. T., Iwai, A., Feau, C., Garcia, Y., Balsiger, H. A., Storer, C. L., Suro, R. M., Garza,  K. M., Lee, S., Kim, Y. S., Chen, Y., Ning, Y. M., Riggs, D. L., Fletterick, R.  J., Guy, R. K.,  Trepel, J. B., Neckers, L. M., and Cox, M. B. (2011) Targeting the regulation of androgen  receptor signaling by the heat shock protein 90 cochaperone FKBP52 in prostate cancer  cells. Proc Natl Acad Sci U S A 108, 11878‐11883  213.  Hickey, E. D., and Weber, L. A. (1982) Modulation of heat‐shock polypeptide synthesis in  HeLa cells during hyperthermia and recovery. Biochemistry 21, 1513‐1521  214.  Mymrikov, E. V., Seit‐Nebi, A. S., and Gusev, N. B. (2011) Large potentials of small heat  shock proteins. Physiol Rev 91, 1123‐1159  215.  Huang, Q.,  Ye,  J.,  Chen, W., Wang,  L.,  Lin, W.,  Lin,  J.,  and  Lin,  X.  (2010) Heat  shock  protein  27  is  over‐expressed  in  tumor  tissues  and  increased  in  sera  of  patients with  gastric adenocarcinoma. Clin Chem Lab Med 48, 263‐269  216.  Zoubeidi, A., Zardan, A., Wiedmann, R. M., Locke, J., Beraldi, E., Fazli, L., and Gleave, M.  E.  (2010)  Hsp27  promotes  insulin‐like  growth  factor‐I  survival  signaling  in  prostate  cancer via p90Rsk‐dependent phosphorylation and inactivation of BAD. Cancer research  70, 2307‐2317  149  217.  McClaren, M., and Isseroff, R. R. (1994) Dynamic changes in intracellular localization and  isoforms of the 27‐kD stress protein in human keratinocytes. J Invest Dermatol 102, 375‐ 381  218.  Kostenko,  S.,  and Moens, U.  (2009) Heat  shock  protein  27  phosphorylation:  kinases,  phosphatases, functions and pathology. Cell Mol Life Sci 66, 3289‐3307  219.  (2010) Drug Management for Prostate Cancer, Springer  220.  Wu, R., Kausar, H., Johnson, P., Montoya‐Durango, D. E., Merchant, M., and Rane, M. J.  (2007) Hsp27  regulates Akt activation and polymorphonuclear  leukocyte apoptosis by  scaffolding MK2 to Akt signal complex. J Biol Chem 282, 21598‐21608  221.  Paul, C., Manero, F., Gonin, S., Kretz‐Remy, C., Virot, S., and Arrigo, A. P. (2002) Hsp27 as  a negative regulator of cytochrome C release. Mol Cell Biol 22, 816‐834  222.  Pandey, P., Farber, R., Nakazawa, A., Kumar, S., Bharti, A., Nalin, C., Weichselbaum, R.,  Kufe,  D.,  and  Kharbanda,  S.  (2000)  Hsp27  functions  as  a  negative  regulator  of  cytochrome c‐dependent activation of procaspase‐3. Oncogene 19, 1975‐1981  223.  Zhang, Y., and Shen, X. (2007) Heat shock protein 27 protects L929 cells from cisplatin‐ induced apoptosis by enhancing Akt activation and abating suppression of thioredoxin  reductase activity. Clin Cancer Res 13, 2855‐2864  224.  Taba, K., Kuramitsu, Y., Ryozawa, S., Yoshida, K., Tanaka, T., Maehara, S., Maehara, Y.,  Sakaida,  I.,  and  Nakamura,  K.  (2010)  Heat‐shock  protein  27  is  phosphorylated  in  gemcitabine‐resistant pancreatic cancer cells. Anticancer Res 30, 2539‐2543  225.  Zhu, Z., Xu, X., Yu, Y., Graham, M., Prince, M. E., Carey, T. E., and Sun, D. (2010) Silencing  heat  shock  protein  27  decreases  metastatic  behavior  of  human  head  and  neck  squamous cell cancer cells in vitro. Mol Pharm 7, 1283‐1290  226.  Rocchi,  P.,  So,  A.,  Kojima,  S.,  Signaevsky,  M.,  Beraldi,  E.,  Fazli,  L.,  Hurtado‐Coll,  A.,  Yamanaka, K., and Gleave, M.  (2004) Heat  shock protein 27  increases after androgen  ablation and plays a cytoprotective role  in hormone‐refractory prostate cancer. Cancer  research 64, 6595‐6602  227.  Garrido, C., Fromentin, A., Bonnotte, B., Favre, N., Moutet, M., Arrigo, A. P., Mehlen, P.,  and  Solary,  E.  (1998)  Heat  shock  protein  27  enhances  the  tumorigenicity  of  immunogenic rat colon carcinoma cell clones. Cancer research 58, 5495‐5499  150  228.  Kamada, M., So, A., Muramaki, M., Rocchi, P., Beraldi, E., and Gleave, M. (2007) Hsp27  knockdown  using  nucleotide‐based  therapies  inhibit  tumor  growth  and  enhance  chemotherapy in human bladder cancer cells. Mol Cancer Ther 6, 299‐308  229.  Rocchi, P., Beraldi, E., Ettinger,  S.,  Fazli,  L., Vessella, R.  L., Nelson, C.,  and Gleave, M.  (2005)  Increased  Hsp27  after  androgen  ablation  facilitates  androgen‐independent  progression  in prostate cancer via signal  transducers and activators of  transcription 3‐ mediated suppression of apoptosis. Cancer research 65, 11083‐11093  230.  Millward,  T.,  Cron,  P.,  and  Hemmings,  B.  A.  (1995)  Molecular  cloning  and  characterization of a conserved nuclear serine(threonine) protein kinase. Proc Natl Acad  Sci U S A 92, 5022‐5026  231.  Witters, L. A. (1990) Protein phosphorylation and dephosphorylation. Curr Opin Cell Biol  2, 212‐220  232.  Brognard,  J.,  and Hunter,  T.  (2011)  Protein  kinase  signaling  networks  in  cancer.  Curr  Opin Genet Dev 21, 4‐11  233.  Ventura,  J.  J.,  and  Nebreda,  A.  R.  (2006)  Protein  kinases  and  phosphatases  as  therapeutic targets in cancer. Clin Transl Oncol 8, 153‐160  234.  Zhang, J., Yang, P. L., and Gray, N. S. (2009) Targeting cancer with small molecule kinase  inhibitors. Nat Rev Cancer 9, 28‐39  235.  Sourvinos,  G.,  Tsatsanis,  C.,  and  Spandidos,  D.  A.  (2000) Mechanisms  of  retrovirus‐ induced oncogenesis. Folia Biol (Praha) 46, 226‐232  236.  Martin, G. S. (2004) The road to Src. Oncogene 23, 7910‐7917  237.  Kolch, W., Kotwaliwale, A., Vass, K., and  Janosch, P.  (2002) The  role of Raf kinases  in  malignant transformation. Expert Rev Mol Med 4, 1‐18  238.  Tsatsanis,  C.,  and  Spandidos,  D.  A.  (2004)  Oncogenic  kinase  signaling  in  human  neoplasms. Ann N Y Acad Sci 1028, 168‐175  239.  Hunter, T. (2009) Tyrosine phosphorylation: thirty years and counting. Curr Opin Cell Biol  21, 140‐146  240.  Manning,  G., Whyte,  D.  B., Martinez,  R.,  Hunter,  T.,  and  Sudarsanam,  S.  (2002)  The  protein kinase complement of the human genome. Science 298, 1912‐1934  151  241.  Kung, H.  J.  (2011) Targeting  tyrosine kinases and autophagy  in prostate  cancer. Horm  Cancer 2, 38‐46  242.  Chang,  Y.  M.,  Kung,  H.  J.,  and  Evans,  C.  P.  (2007)  Nonreceptor  tyrosine  kinases  in  prostate cancer. Neoplasia 9, 90‐100  243.  Damon, S. E., Plymate, S. R., Carroll, J. M., Sprenger, C. C., Dechsukhum, C., Ware, J. L.,  and  Roberts,  C.  T.,  Jr.  (2001)  Transcriptional  regulation  of  insulin‐like  growth  factor‐I  receptor gene expression in prostate cancer cells. Endocrinology 142, 21‐27  244.  Ozen,  M.,  Giri,  D.,  Ropiquet,  F.,  Mansukhani,  A.,  and  Ittmann,  M.  (2001)  Role  of  fibroblast growth factor receptor signaling in prostate cancer cell survival. Journal of the  National Cancer Institute 93, 1783‐1790  245.  Ricciardelli, C., Jackson, M. W., Choong, C. S., Stahl, J., Marshall, V. R., Horsfall, D. J., and  Tilley, W. D.  (2008)  Elevated  levels  of HER‐2/neu  and  androgen  receptor  in  clinically  localized prostate cancer identifies metastatic potential. The Prostate 68, 830‐838  246.  Wen, Y., Hu, M. C., Makino, K., Spohn, B., Bartholomeusz, G., Yan, D. H., and Hung, M. C.  (2000)  HER‐2/neu  promotes  androgen‐independent  survival  and  growth  of  prostate  cancer cells through the Akt pathway. Cancer research 60, 6841‐6845  247.  Marelli, M. M., Moretti, R. M., Procacci, P., Motta, M., and Limonta, P. (2006) Insulin‐like  growth  factor‐I promotes migration  in human  androgen‐independent prostate  cancer  cells via the alphavbeta3 integrin and PI3‐K/Akt signaling. Int J Oncol 28, 723‐730  248.  Culig, Z., Hobisch, A., Cronauer, M. V., Radmayr, C., Trapman, J., Hittmair, A., Bartsch, G.,  and  Klocker,  H.  (1994)  Androgen  receptor  activation  in  prostatic  tumor  cell  lines  by  insulin‐like  growth  factor‐I,  keratinocyte  growth  factor,  and  epidermal  growth  factor.  Cancer research 54, 5474‐5478  249.  Fan, S., Meng, Q., Laterra, J. J., and Rosen, E. M. (2009) Role of Src signal transduction  pathways in scatter factor‐mediated cellular protection. J Biol Chem 284, 7561‐7577  250.  Saito, Y. D.,  Jensen, A. R., Salgia, R., and Posadas, E. M.  (2010) Fyn: a novel molecular  target in cancer. Cancer 116, 1629‐1637  251.  Goldenberg‐Furmanov, M.,  Stein,  I.,  Pikarsky,  E.,  Rubin,  H.,  Kasem,  S., Wygoda, M.,  Weinstein, I., Reuveni, H., and Ben‐Sasson, S. A. (2004) Lyn is a target gene for prostate  cancer:  sequence‐based  inhibition  induces  regression  of  human  tumor  xenografts.  Cancer research 64, 1058‐1066  152  252.  Slack‐Davis,  J.  K.,  Hershey,  E.  D.,  Theodorescu,  D.,  Frierson,  H.  F.,  and  Parsons,  J.  T.  (2009) Differential requirement for focal adhesion kinase signaling in cancer progression  in the transgenic adenocarcinoma of mouse prostate model. Mol Cancer Ther 8, 2470‐ 2477  253.  Qiu, Y., and Kung, H. J. (2000) Signaling network of the Btk family kinases. Oncogene 19,  5651‐5661  254.  Yamanashi,  Y.,  Fukushige,  S.,  Semba,  K.,  Sukegawa,  J., Miyajima,  N., Matsubara,  K.,  Yamamoto,  T.,  and  Toyoshima,  K.  (1987)  The  yes‐related  cellular  gene  lyn  encodes  a  possible tyrosine kinase similar to p56lck. Mol Cell Biol 7, 237‐243  255.  Parsons,  S.  J.,  and  Parsons,  J.  T.  (2004)  Src  family  kinases,  key  regulators  of  signal  transduction. Oncogene 23, 7906‐7909  256.  Kinoshita, T., Miyano, N., Nakai, R., Yokota, K., Ishiguro, H., and Tada, T. (2008) Protein  purification  and  preliminary  crystallographic  analysis  of  human  Lyn  tyrosine  kinase.  Protein Expr Purif 58, 318‐324  257.  Moarefi, I., LaFevre‐Bernt, M., Sicheri, F., Huse, M., Lee, C. H., Kuriyan, J., and Miller, W.  T. (1997) Activation of the Src‐family tyrosine kinase Hck by SH3 domain displacement.  Nature 385, 650‐653  258.  Sicheri, F., Moarefi, I., and Kuriyan, J. (1997) Crystal structure of the Src family tyrosine  kinase Hck. Nature 385, 602‐609  259.  Williams,  J.  C., Weijland,  A.,  Gonfloni,  S.,  Thompson,  A.,  Courtneidge,  S.  A.,  Superti‐ Furga, G., and Wierenga, R. K. (1997) The 2.35 A crystal structure of the inactivated form  of chicken Src: a dynamic molecule with multiple regulatory interactions. J Mol Biol 274,  757‐775  260.  Trentin,  L.,  Frasson,  M.,  Donella‐Deana,  A.,  Frezzato,  F.,  Pagano,  M.  A.,  Tibaldi,  E.,  Gattazzo,  C.,  Zambello,  R.,  Semenzato,  G.,  and  Brunati,  A. M.  (2008)  Geldanamycin‐ induced  Lyn dissociation  from  aberrant Hsp90‐stabilized  cytosolic  complex  is  an early  event  in  apoptotic mechanisms  in  B‐chronic  lymphocytic  leukemia.  Blood  112,  4665‐ 4674  261.  Hibbs, M. L., and Dunn, A. R. (1997) Lyn, a src‐like tyrosine kinase. Int J Biochem Cell Biol  29, 397‐400  153  262.  Suzuki, T., Shoji, S., Yamamoto, K., Nada, S., Okada, M., Yamamoto, T., and Honda, Z.  (1998) Essential roles of Lyn in fibronectin‐mediated filamentous actin assembly and cell  motility in mast cells. J Immunol 161, 3694‐3701  263.  Simon, H. U., Yousefi, S., Dibbert, B., Hebestreit, H., Weber, M., Branch, D. R., Blaser, K.,  Levi‐Schaffer, F., and Anderson, G. P. (1998) Role for tyrosine phosphorylation and Lyn  tyrosine kinase in fas receptor‐mediated apoptosis in eosinophils. Blood 92, 547‐557  264.  Iqbal, M. S., Tsuyama, N., Obata, M., and Ishikawa, H. (2010) A novel signaling pathway  associated with  Lyn, PI  3‐kinase  and Akt  supports  the proliferation of myeloma  cells.  Biochemical and biophysical research communications 392, 415‐420  265.  Choi, Y. L., Bocanegra, M., Kwon, M. J., Shin, Y. K., Nam, S. J., Yang, J. H., Kao, J., Godwin,  A. K., and Pollack,  J. R.  (2010)  LYN  is a mediator of epithelial‐mesenchymal  transition  and a target of dasatinib in breast cancer. Cancer research 70, 2296‐2306  266.  Tatarov, O., Mitchell, T. J., Seywright, M., Leung, H. Y., Brunton, V. G., and Edwards, J.  (2009) SRC family kinase activity is up‐regulated in hormone‐refractory prostate cancer.  Clin Cancer Res 15, 3540‐3549  267.  Park, S. I., Zhang, J., Phillips, K. A., Araujo, J. C., Najjar, A. M., Volgin, A. Y., Gelovani, J. G.,  Kim, S. J., Wang, Z., and Gallick, G. E. (2008) Targeting SRC family kinases inhibits growth  and  lymph node metastases  of  prostate  cancer  in  an  orthotopic  nude mouse model.  Cancer research 68, 3323‐3333  268.  Sen, B., and Johnson, F. M. (2011) Regulation of SRC family kinases in human cancers. J  Signal Transduct 2011, 865819  269.  Dunlap, D. Y., Ikeda, I., Nagashima, H., Vogel, C. F., and Matsumura, F. (2002) Effects of  src‐deficiency on the expression of in vivo toxicity of TCDD in a strain of c‐src knockout  mice  procured  through  six  generations  of  backcrossings  to  C57BL/6 mice.  Toxicology  172, 125‐141  270.  Beavitt, S.  J., Harder, K. W., Kemp,  J. M.,  Jones,  J., Quilici, C., Casagranda, F., Lam, E.,  Turner, D., Brennan,  S.,  Sly, P. D., Tarlinton, D. M., Anderson, G. P.,  and Hibbs, M.  L.  (2005)  Lyn‐deficient mice develop  severe, persistent asthma:  Lyn  is a  critical negative  regulator of Th2 immunity. J Immunol 175, 1867‐1875  271.  Peehl, D. M.  (2005) Primary  cell  cultures  as models of prostate  cancer development.  Endocrine‐related cancer 12, 19‐47  154  272.  Horoszewicz, J. S., Leong, S. S., Kawinski, E., Karr, J. P., Rosenthal, H., Chu, T. M., Mirand,  E. A.,  and Murphy, G.  P.  (1983)  LNCaP model  of  human  prostatic  carcinoma.  Cancer  research 43, 1809‐1818  273.  Veldscholte,  J., Berrevoets, C. A., Brinkmann, A. O., Grootegoed,  J. A., and Mulder, E.  (1992) Anti‐androgens and  the mutated androgen  receptor of LNCaP cells: differential  effects on binding affinity, heat‐shock protein  interaction, and transcription activation.  Biochemistry 31, 2393‐2399  274.  Veldscholte, J., Berrevoets, C. A., Ris‐Stalpers, C., Kuiper, G. G., Jenster, G., Trapman, J.,  Brinkmann, A. O., and Mulder, E. (1992) The androgen receptor in LNCaP cells contains a  mutation in the ligand binding domain which affects steroid binding characteristics and  response to antiandrogens. J Steroid Biochem Mol Biol 41, 665‐669  275.  Thalmann, G. N., Anezinis, P. E., Chang, S. M., Zhau, H. E., Kim, E. E., Hopwood, V. L.,  Pathak,  S.,  von  Eschenbach,  A.  C.,  and  Chung,  L.  W.  (1994)  Androgen‐independent  cancer progression and bone metastasis in the LNCaP model of human prostate cancer.  Cancer research 54, 2577‐2581  276.  Kaighn,  M.  E.,  Narayan,  K.  S.,  Ohnuki,  Y.,  Lechner,  J.  F.,  and  Jones,  L.  W.  (1979)  Establishment  and  characterization  of  a  human  prostatic  carcinoma  cell  line  (PC‐3).  Invest Urol 17, 16‐23  277.  Stone,  K.  R., Mickey,  D.  D., Wunderli,  H., Mickey,  G.  H.,  and  Paulson,  D.  F.  (1978)  Isolation of a human prostate carcinoma cell line (DU 145). Int J Cancer 21, 274‐281  278.  Dagvadorj, A.,  Tan,  S. H.,  Liao,  Z., Cavalli,  L. R., Haddad, B. R.,  and Nevalainen, M.  T.  (2008)  Androgen‐regulated  and  highly  tumorigenic  human  prostate  cancer  cell  line  established from a transplantable primary CWR22 tumor. Clin Cancer Res 14, 6062‐6072  279.  Tam,  C. W.,  and  Shiu,  S.  Y.  (2011)  Functional  interplay  between melatonin  receptor‐ mediated antiproliferative signaling and androgen receptor signaling in human prostate  epithelial cells: potential implications for therapeutic strategies against prostate cancer.  J Pineal Res 51, 297‐312  280.  Ruizeveld  de Winter,  J.  A.,  Janssen,  P.  J.,  Sleddens, H. M.,  Verleun‐Mooijman, M.  C.,  Trapman, J., Brinkmann, A. O., Santerse, A. B., Schroder, F. H., and van der Kwast, T. H.  (1994) Androgen receptor status in localized and locally progressive hormone refractory  human prostate cancer. Am J Pathol 144, 735‐746  155  281.  Sadi,  M.  V.,  and  Barrack,  E.  R.  (1991)  Androgen  receptors  and  growth  fraction  in  metastatic prostate cancer as predictors of time to tumour progression after hormonal  therapy. Cancer Surv 11, 195‐215  282.  Henshall,  S.  M.,  Quinn,  D.  I.,  Lee,  C.  S.,  Head,  D.  R.,  Golovsky,  D.,  Brenner,  P.  C.,  Delprado, W., Stricker, P. D., Grygiel, J. J., and Sutherland, R. L. (2001) Altered expression  of  androgen  receptor  in  the malignant  epithelium  and  adjacent  stroma  is  associated  with early relapse in prostate cancer. Cancer research 61, 423‐427  283.  Chen, C. D., Welsbie, D. S., Tran, C., Baek, S. H., Chen, R., Vessella, R., Rosenfeld, M. G.,  and  Sawyers,  C.  L.  (2004)  Molecular  determinants  of  resistance  to  antiandrogen  therapy. Nature medicine 10, 33‐39  284.  Taplin, M. E. (2007) Drug insight: role of the androgen receptor in the development and  progression of prostate cancer. Nature clinical practice. Oncology 4, 236‐244  285.  Keller, E. T.  (2011) Role of Raf Kinase  Inhibitor Protein  in Pathophysiology of Prostate  Cancer. For Immunopathol Dis Therap 2, 89‐94  286.  Kutikov, A., Makhov, P., Golovine, K., Canter, D. J., Sirohi, M., Street, R., Simhan, J., Uzzo,  R. G., and Kolenko, V. M.  (2011)  Interleukin‐6: a potential biomarker of  resistance  to  multitargeted receptor tyrosine kinase inhibitors in castration‐resistant prostate cancer.  Urology 78, 968 e967‐911  287.  Liu, X., Yan, Z., Huang, L., Guo, M., Zhang, Z., and Guo, C. (2011) Cell surface heat shock  protein 90 modulates prostate cancer cell adhesion and  invasion through the  integrin‐ beta1/focal adhesion kinase/c‐Src signaling pathway. Oncol Rep 25, 1343‐1351  288.  Thorburn,  A.,  and  Debnath,  J.  (2011)  Targeting  chaperone‐mediated  autophagy  in  cancer. Sci Transl Med 3, 109ps145  289.  Lamoureux, F., Thomas, C., Yin, M. J., Kuruma, H., Fazli, L., Gleave, M. E., and Zoubeidi,  A.  (2011)  A  novel  HSP90  inhibitor  delays  castrate‐resistant  prostate  cancer  without  altering serum PSA levels and inhibits osteoclastogenesis. Clin Cancer Res 17, 2301‐2313  290.  Shiota, M., Zoubeidi, A., Kumano, M., Beraldi, E., Naito, S., Nelson, C. C., Sorensen, P. H.,  and Gleave, M. E. (2011) Clusterin Is a Critical Downstream Mediator of Stress‐Induced  YB‐1 Transactivation in Prostate Cancer. Mol Cancer Res   291.  Zoubeidi,  A.,  Chi,  K.,  and Gleave, M.  (2010)  Targeting  the  cytoprotective  chaperone,  clusterin, for treatment of advanced cancer. Clin Cancer Res 16, 1088‐1093  156  292.  July,  L. V., Akbari, M., Zellweger, T.,  Jones, E. C., Goldenberg, S.  L., and Gleave, M. E.  (2002) Clusterin expression  is  significantly enhanced  in prostate cancer cells  following  androgen withdrawal therapy. The Prostate 50, 179‐188  293.  Rennie, P.  S., Bruchovsky, N.,  Leco, K.  J.,  Sheppard, P. C., McQueen,  S. A., Cheng, H.,  Snoek, R., Hamel, A., Bock, M. E., MacDonald, B. S., and et al. (1993) Characterization of  two cis‐acting DNA elements involved in the androgen regulation of the probasin gene.  Mol Endocrinol 7, 23‐36  294.  Sun, M., Yang, L., Feldman, R.  I., Sun, X. M., Bhalla, K. N.,  Jove, R., Nicosia, S. V., and  Cheng, J. Q. (2003) Activation of phosphatidylinositol 3‐kinase/Akt pathway by androgen  through  interaction of p85alpha, androgen  receptor, and Src.  J Biol Chem 278, 42992‐ 43000  295.  Kousteni,  S., Bellido, T., Plotkin,  L.  I., O'Brien, C. A., Bodenner, D.  L., Han,  L., Han, K.,  DiGregorio,  G.  B.,  Katzenellenbogen,  J.  A.,  Katzenellenbogen,  B.  S.,  Roberson,  P.  K.,  Weinstein, R. S., Jilka, R. L., and Manolagas, S. C. (2001) Nongenotropic, sex‐nonspecific  signaling through the estrogen or androgen receptors: dissociation from transcriptional  activity. Cell 104, 719‐730  296.  Migliaccio, A., Castoria, G., Di Domenico, M., de  Falco, A., Bilancio, A.,  Lombardi, M.,  Barone, M. V., Ametrano, D., Zannini, M. S., Abbondanza, C., and Auricchio, F.  (2000)  Steroid‐induced  androgen  receptor‐oestradiol  receptor  beta‐Src  complex  triggers  prostate cancer cell proliferation. EMBO J 19, 5406‐5417  297.  Yeh, S., Lin, H. K., Kang, H. Y., Thin, T. H., Lin, M. F., and Chang, C. (1999) From HER2/Neu  signal cascade to androgen receptor and its coactivators: a novel pathway by induction  of androgen target genes through MAP kinase  in prostate cancer cells. Proc Natl Acad  Sci U S A 96, 5458‐5463  298.  Haynes, M. P., Sinha, D., Russell, K. S., Collinge, M., Fulton, D., Morales‐Ruiz, M., Sessa,  W.  C.,  and  Bender,  J.  R.  (2000) Membrane  estrogen  receptor  engagement  activates  endothelial nitric oxide synthase via  the PI3‐kinase‐Akt pathway  in human endothelial  cells. Circ Res 87, 677‐682  299.  Zhang, Z., Kumar, R., Santen, R. J., and Song, R. X. (2004) The role of adapter protein Shc  in estrogen non‐genomic action. Steroids 69, 523‐529  300.  Baron, S., Manin, M., Beaudoin, C., Leotoing, L., Communal, Y., Veyssiere, G., and Morel,  L. (2004) Androgen receptor mediates non‐genomic activation of phosphatidylinositol 3‐ OH kinase in androgen‐sensitive epithelial cells. J Biol Chem 279, 14579‐14586  157  301.  Edwards,  J., and Bartlett,  J. M.  (2005) The androgen  receptor and  signal‐transduction  pathways  in hormone‐refractory prostate cancer. Part 2: Androgen‐receptor cofactors  and bypass pathways. BJU Int 95, 1327‐1335  302.  Yamanaka,  K.,  Gleave, M., Muramaki, M.,  Hara,  I.,  and Miyake,  H.  (2005)  Enhanced  radiosensitivity  by  inhibition  of  the  anti‐apoptotic  gene  clusterin  using  antisense  oligodeoxynucleotide in a human bladder cancer model. Oncol Rep 13, 885‐890  303.  Cheung‐Flynn, J., Prapapanich, V., Cox, M. B., Riggs, D. L., Suarez‐Quian, C., and Smith, D.  F. (2005) Physiological role for the cochaperone FKBP52 in androgen receptor signaling.  Mol Endocrinol 19, 1654‐1666  304.  Yang, Z., Wolf, I. M., Chen, H., Periyasamy, S., Chen, Z., Yong, W., Shi, S., Zhao, W., Xu, J.,  Srivastava, A., Sanchez, E. R., and Shou, W. (2006) FK506‐binding protein 52 is essential  to uterine reproductive physiology controlled by the progesterone receptor A  isoform.  Mol Endocrinol 20, 2682‐2694  305.  Miller,  H.,  Poon,  S.,  Hibbert,  B.,  Rayner,  K.,  Chen,  Y.  X.,  and  O'Brien,  E.  R.  (2005)  Modulation of estrogen  signaling by  the novel  interaction of heat  shock protein 27, a  biomarker for atherosclerosis, and estrogen receptor beta: mechanistic  insight  into the  vascular effects of estrogens. Arterioscler Thromb Vasc Biol 25, e10‐14  306.  Concannon,  C.  G.,  Orrenius,  S.,  and  Samali,  A.  (2001)  Hsp27  inhibits  cytochrome  c‐ mediated  caspase  activation  by  sequestering  both  pro‐caspase‐3  and  cytochrome  c.  Gene Expr 9, 195‐201  307.  Parcellier, A., Schmitt, E., Gurbuxani, S., Seigneurin‐Berny, D., Pance, A., Chantome, A.,  Plenchette,  S.,  Khochbin,  S.,  Solary,  E.,  and  Garrido,  C.  (2003)  HSP27  is  a  ubiquitin‐ binding protein  involved  in  I‐kappaBalpha proteasomal degradation. Mol Cell Biol  23,  5790‐5802  308.  Chauhan, D., Li, G., Podar, K., Hideshima, T., Shringarpure, R., Catley, L., Mitsiades, C.,  Munshi, N., Tai, Y. T., Suh, N., Gribble, G. W., Honda, T., Schlossman, R., Richardson, P.,  Sporn, M. B., and Anderson, K. C.  (2004) The bortezomib/proteasome  inhibitor PS‐341  and triterpenoid CDDO‐Im  induce synergistic anti‐multiple myeloma  (MM) activity and  overcome bortezomib resistance. Blood 103, 3158‐3166  309.  Mendelsohn, M. E., Zhu, Y., and O'Neill, S. (1991) The 29‐kDa proteins phosphorylated in  thrombin‐activated human platelets are forms of the estrogen receptor‐related 27‐kDa  heat shock protein. Proc Natl Acad Sci U S A 88, 11212‐11216  158  310.  Barr, C. S., and Dokas, L. A. (1999) Glucocorticoids regulate the synthesis of HSP27 in rat  brain slices. Brain Res 847, 9‐17  311.  Gleave, M. E., Hsieh,  J. T., Wu, H. C., von Eschenbach, A. C., and Chung, L. W.  (1992)  Serum prostate  specific antigen  levels  in mice bearing human prostate  LNCaP  tumors  are determined by  tumor volume and endocrine and growth  factors. Cancer  research  52, 1598‐1605  312.  Sadar, M. D., and Gleave, M. E.  (2000) Ligand‐independent activation of the androgen  receptor by  the differentiation agent butyrate  in human prostate  cancer cells. Cancer  research 60, 5825‐5831  313.  Shang,  Y.,  Myers,  M.,  and  Brown,  M.  (2002)  Formation  of  the  androgen  receptor  transcription complex. Mol Cell 9, 601‐610  314.  Rehemtulla, A., Stegman, L. D., Cardozo, S.  J., Gupta, S., Hall, D. E., Contag, C. H., and  Ross,  B.  D.  (2000)  Rapid  and  quantitative  assessment  of  cancer  treatment  response  using in vivo bioluminescence imaging. Neoplasia 2, 491‐495  315.  Berchem, G.  J., Bosseler, M., Sugars, L. Y., Voeller, H.  J., Zeitlin, S., and Gelmann, E. P.  (1995)  Androgens  induce  resistance  to  bcl‐2‐mediated  apoptosis  in  LNCaP  prostate  cancer cells. Cancer Res 55, 735‐738  316.  Carson, J. P., Kulik, G., and Weber, M. J. (1999) Antiapoptotic signaling in LNCaP prostate  cancer cells: a survival signaling pathway  independent of phosphatidylinositol 3'‐kinase  and Akt/protein kinase B. Cancer Res 59, 1449‐1453  317.  Rane, M. J., Pan, Y., Singh, S., Powell, D. W., Wu, R., Cummins, T., Chen, Q., McLeish, K.  R.,  and Klein,  J. B.  (2003) Heat  shock protein 27  controls  apoptosis by  regulating Akt  activation. J Biol Chem 278, 27828‐27835  318.  Rane, M. J., Coxon, P. Y., Powell, D. W., Webster, R., Klein, J. B., Pierce, W., Ping, P., and  McLeish,  K.  R.  (2001)  p38  Kinase‐dependent  MAPKAPK‐2  activation  functions  as  3‐ phosphoinositide‐dependent  kinase‐2  for Akt  in  human  neutrophils.  J Biol  Chem  276,  3517‐3523  319.  Wafa,  L. A., Cheng, H., Rao, M. A., Nelson, C. C., Cox, M., Hirst, M., Sadowski,  I., and  Rennie, P. S. (2003) Isolation and identification of L‐dopa decarboxylase as a protein that  binds  to  and  enhances  transcriptional  activity  of  the  androgen  receptor  using  the  repressed transactivator yeast two‐hybrid system. Biochem J 375, 373‐383  159  320.  Solit, D. B., Scher, H.  I., and Rosen, N. (2003) Hsp90 as a therapeutic target  in prostate  cancer. Semin Oncol 30, 709‐716  321.  Cha, T. L., Qiu, L., Chen, C. T., Wen, Y., and Hung, M. C. (2005) Emodin down‐regulates  androgen receptor and inhibits prostate cancer cell growth. Cancer Res 65, 2287‐2295  322.  Gaughan, L., Logan,  I. R., Neal, D. E., and Robson, C. N.  (2005) Regulation of androgen  receptor and histone deacetylase 1 by Mdm2‐mediated ubiquitylation. Nucleic Acids Res  33, 13‐26  323.  Haslbeck, M., and Buchner, J. (2002) Chaperone function of sHsps. Prog Mol Subcell Biol  28, 37‐59  324.  Schneider, G. B., Hamano, H., and Cooper, L. F. (1998) In vivo evaluation of hsp27 as an  inhibitor  of  actin  polymerization:  hsp27  limits  actin  stress  fiber  and  focal  adhesion  formation after heat shock. J Cell Physiol 177, 575‐584  325.  Cornford, P. A., Dodson, A. R., Parsons, K. F., Desmond, A. D., Woolfenden, A., Fordham,  M., Neoptolemos,  J. P., Ke, Y., and Foster, C. S.  (2000) Heat  shock protein expression  independently predicts clinical outcome  in prostate cancer. Cancer  research 60, 7099‐ 7105  326.  Whelan, R. D., and Hill, B. T. (1993) Differential expression of steroid receptors, hsp27,  and pS2  in a  series of drug  resistant human breast  tumor  cell  lines derived  following  exposure to antitumor drugs or to fractionated X‐irradiation. Breast Cancer Res Treat 26,  23‐39  327.  Richards,  I. M.,  Kolbasa,  K.  P.,  Hatfield,  C.  A., Winterrowd,  G.  E.,  Vonderfecht,  S.  L.,  Fidler, S. F., Griffin, R. L., Brashler, J. R., Krzesicki, R. F., Sly, L. M., Ready, K. A., Staite, N.  D., and Chin,  J. E.  (1996) Role of very  late activation antigen‐4  in  the antigen‐induced  accumulation  of  eosinophils  and  lymphocytes  in  the  lungs  and  airway  lumen  of  sensitized brown Norway rats. Am J Respir Cell Mol Biol 15, 172‐183  328.  Meier, M.,  King, G.  L.,  Clermont, A.,  Perez, A., Hayashi, M.,  and  Feener,  E.  P.  (2001)  Angiotensin AT(1)  receptor  stimulates heat  shock protein  27 phosphorylation  in  vitro  and in vivo. Hypertension 38, 1260‐1265  329.  Belka,  C.,  Ahlers,  A.,  Sott,  C.,  Gaestel,  M.,  Herrmann,  F.,  and  Brach,  M.  A.  (1995)  Interleukin  (IL)‐6  signaling  leads  to  phosphorylation  of  the  small  heat  shock  protein  (Hsp)27  through  activation  of  the  MAP  kinase  and  MAPKAP  kinase  2  pathway  in  monocytes and monocytic leukemia cells. Leukemia 9, 288‐294  160  330.  Song, H., Ethier, S. P., Dziubinski, M. L., and Lin,  J.  (2004) Stat3 modulates heat shock  27kDa protein expression  in breast epithelial cells. Biochem Biophys Res Commun 314,  143‐150  331.  Jia, Y., Ransom, R. F., Shibanuma, M.,  Liu, C., Welsh, M.  J., and Smoyer, W. E.  (2001)  Identification  and  characterization of hic‐5/ARA55  as  an hsp27 binding protein.  J Biol  Chem 276, 39911‐39918  332.  Frigo,  D.  E.,  Basu,  A., Nierth‐Simpson,  E. N., Weldon,  C.  B.,  Dugan,  C. M.,  Elliott,  S.,  Collins‐Burow, B. M., Salvo, V. A., Zhu, Y., Melnik, L. I., Lopez, G. N., Kushner, P. J., Curiel,  T.  J., Rowan, B. G., McLachlan,  J. A.,  and Burow, M.  E.  (2006) p38 mitogen‐activated  protein kinase stimulates estrogen‐mediated transcription and proliferation through the  phosphorylation  and  potentiation  of  the  p160  coactivator  glucocorticoid  receptor‐ interacting protein 1. Mol Endocrinol 20, 971‐983  333.  Whitesell,  L., Mimnaugh,  E. G., De Costa, B., Myers, C.  E.,  and Neckers,  L. M.  (1994)  Inhibition of heat shock protein HSP90‐pp60v‐src heteroprotein complex  formation by  benzoquinone  ansamycins:  essential  role  for  stress  proteins  in  oncogenic  transformation. Proc Natl Acad Sci U S A 91, 8324‐8328  334.  Neckers, L., Schulte, T. W., and Mimnaugh, E. (1999) Geldanamycin as a potential anti‐ cancer agent:  its molecular target and biochemical activity.  Invest New Drugs 17, 361‐ 373  335.  Winklhofer,  K.  F.,  Reintjes,  A.,  Hoener,  M.  C.,  Voellmy,  R.,  and  Tatzelt,  J.  (2001)  Geldanamycin restores a defective heat shock response in vivo. J Biol Chem 276, 45160‐ 45167  336.  Gleave, M. E., Goldenberg, S. L., Chin, J. L., Warner, J., Saad, F., Klotz, L. H., Jewett, M.,  Kassabian,  V.,  Chetner,  M.,  Dupont,  C.,  and  Van  Rensselaer,  S.  (2001)  Randomized  comparative  study of 3 versus 8‐month neoadjuvant hormonal  therapy before  radical  prostatectomy:  biochemical  and  pathological  effects.  J  Urol  166,  500‐506;  discussion  506‐507  337.  Bruchovsky, N., Klotz, L. H., Sadar, M., Crook, J. M., Hoffart, D., Godwin, L., Warkentin,  M., Gleave, M. E., and Goldenberg, S. L.  (2000)  Intermittent androgen suppression  for  prostate cancer: Canadian Prospective Trial and related observations. Mol Urol 4, 191‐ 199;discussion 201  338.  Goldenberg, S. L., Gleave, M. E., Taylor, D., and Bruchovsky, N. (1999) Clinical Experience  with  Intermittent  Androgen  Suppression  in  Prostate  Cancer:  Minimum  of  3  Years'  Follow‐Up. Mol Urol 3, 287‐292  161  339.  Goldenberg,  S.  L.,  Bruchovsky, N., Gleave, M.  E.,  and  Sullivan,  L. D.  (1996)  Low‐dose  cyproterone acetate plus mini‐dose diethylstilbestrol‐‐a protocol for reversible medical  castration. Urology 47, 882‐884  340.  Gleave,  M.,  Goldenberg,  S.  L.,  Bruchovsky,  N.,  and  Rennie,  P.  (1998)  Intermittent  androgen  suppression  for  prostate  cancer:  rationale  and  clinical  experience.  Prostate  Cancer Prostatic Dis 1, 289‐296  341.  Bruchovsky, N., Sadar, M. D., Akakura, K., Goldenberg, S. L., Matsuoka, K., and Rennie, P.  S.  (1996)  Characterization  of  5alpha‐reductase  gene  expression  in  stroma  and  epithelium of human prostate. J Steroid Biochem Mol Biol 59, 397‐404  342.  Mahajan, K., Challa, S., Coppola, D., Lawrence, H., Luo, Y., Gevariya, H., Zhu, W., Chen, Y.  A., Lawrence, N. J., and Mahajan, N. P. Effect of Ack1 tyrosine kinase inhibitor on ligand‐ independent androgen receptor activity. Prostate 70, 1274‐1285  343.  Thomas, S. M., and Brugge, J. S. (1997) Cellular functions regulated by Src family kinases.  Annu Rev Cell Dev Biol 13, 513‐609  344.  Summy,  J. M.,  and Gallick, G.  E.  (2003)  Src  family  kinases  in  tumor  progression  and  metastasis. Cancer Metastasis Rev 22, 337‐358  345.  Osterhout,  D.  J.,  Wolven,  A.,  Wolf,  R.  M.,  Resh,  M.  D.,  and  Chao,  M.  V.  (1999)  Morphological  differentiation  of  oligodendrocytes  requires  activation  of  Fyn  tyrosine  kinase. J Cell Biol 145, 1209‐1218  346.  Moreau, K. L., Donato, A. J., Tanaka, H., Jones, P. P., Gates, P. E., and Seals, D. R. (2003)  Basal  leg  blood  flow  in  healthy women  is  related  to  age  and  hormone  replacement  therapy status. J Physiol 547, 309‐316  347.  Veracini, L., Franco, M., Boureux, A., Simon, V., Roche, S., and Benistant, C. (2006) Two  distinct pools of Src  family  tyrosine kinases  regulate PDGF‐induced DNA synthesis and  actin dorsal ruffles. J Cell Sci 119, 2921‐2934  348.  Soriano, P., Montgomery, C., Geske, R., and Bradley, A.  (1991) Targeted disruption of  the c‐src proto‐oncogene leads to osteopetrosis in mice. Cell 64, 693‐702  349.  Donato, N.  J., Wu,  J.  Y.,  Stapley,  J., Gallick, G.,  Lin, H., Arlinghaus, R.,  and  Talpaz, M.  (2003) BCR‐ABL  independence and LYN kinase overexpression  in chronic myelogenous  leukemia cells selected for resistance to STI571. Blood 101, 690‐698  162  350.  Kasahara,  K., Nakayama,  Y.,  Ikeda,  K.,  Fukushima,  Y., Matsuda, D., Horimoto,  S.,  and  Yamaguchi, N. (2004) Trafficking of Lyn through the Golgi caveolin involves the charged  residues on alphaE and alphaI helices in the kinase domain. J Cell Biol 165, 641‐652  351.  McCarty, M. F. (2004) Targeting multiple signaling pathways as a strategy for managing  prostate cancer: multifocal signal modulation therapy. Integr Cancer Ther 3, 349‐380  352.  Nam, S., Kim, D., Cheng, J. Q., Zhang, S., Lee, J. H., Buettner, R., Mirosevich, J., Lee, F. Y.,  and Jove, R. (2005) Action of the Src family kinase inhibitor, dasatinib (BMS‐354825), on  human prostate cancer cells. Cancer research 65, 9185‐9189  353.  Recchia, I., Rucci, N., Festuccia, C., Bologna, M., MacKay, A. R., Migliaccio, S., Longo, M.,  Susa,  M.,  Fabbro,  D.,  and  Teti,  A.  (2003)  Pyrrolopyrimidine  c‐Src  inhibitors  reduce  growth, adhesion, motility and invasion of prostate cancer cells in vitro. Eur J Cancer 39,  1927‐1935  354.  Lee,  L.  F.,  Guan,  J.,  Qiu,  Y.,  and  Kung,  H.  J.  (2001)  Neuropeptide‐induced  androgen  independence  in prostate cancer cells:  roles of nonreceptor  tyrosine kinases Etk/Bmx,  Src, and focal adhesion kinase. Mol Cell Biol 21, 8385‐8397  355.  Cai,  H.,  Smith,  D.  A., Memarzadeh,  S.,  Lowell,  C.  A.,  Cooper,  J.  A.,  and Witte, O.  N.  Differential  transformation  capacity  of  Src  family  kinases  during  the  initiation  of  prostate cancer. Proc Natl Acad Sci U S A 108, 6579‐6584  356.  Chen,  J.,  Hwang,  D.  J.,  Bohl,  C.  E., Miller,  D. D.,  and  Dalton,  J.  T.  (2005)  A  selective  androgen receptor modulator  for hormonal male contraception.  J Pharmacol Exp Ther  312, 546‐553  357.  Notini, A.  J., Davey, R. A., McManus,  J. F., Bate, K. L., and Zajac,  J. D.  (2005) Genomic  actions of the androgen receptor are required for normal male sexual differentiation in  a mouse model. J Mol Endocrinol 35, 547‐555  358.  Edwards,  J., and Bartlett,  J. M.  (2005) The androgen  receptor and  signal‐transduction  pathways in hormone‐refractory prostate cancer. Part 1: Modifications to the androgen  receptor. BJU Int 95, 1320‐1326  359.  Pratt, W.  B., Morishima,  Y.,  and  Osawa,  Y.  (2008)  The  Hsp90  chaperone machinery  regulates signaling by modulating ligand binding clefts. J Biol Chem 283, 22885‐22889  360.  Craft, N., Shostak, Y., Carey, M., and Sawyers, C. L.  (1999) A mechanism  for hormone‐ independent prostate cancer through modulation of androgen receptor signaling by the  HER‐2/neu tyrosine kinase. Nat Med 5, 280‐285  163  361.  Yeh, S., Chang, H. C., Miyamoto, H., Takatera, H., Rahman, M., Kang, H. Y., Thin, T. H.,  Lin,  H.  K.,  and  Chang,  C.  (1999)  Differential  induction  of  the  androgen  receptor  transcriptional activity by selective androgen receptor coactivators. Keio J Med 48, 87‐92  362.  Nazareth,  L. V.,  and Weigel, N.  L.  (1996) Activation of  the human  androgen  receptor  through a protein kinase A signaling pathway. J Biol Chem 271, 19900‐19907  363.  Ikonen, T., Palvimo, J. J., Kallio, P. J., Reinikainen, P., and Janne, O. A. (1994) Stimulation  of  androgen‐regulated  transactivation  by  modulators  of  protein  phosphorylation.  Endocrinology 135, 1359‐1366  364.  Sadar, M. D. (1999) Androgen‐independent  induction of prostate‐specific antigen gene  expression  via  cross‐talk  between  the  androgen  receptor  and  protein  kinase A  signal  transduction pathways. J Biol Chem 274, 7777‐7783  365.  Grasso, A. W., Wen, D., Miller, C. M., Rhim, J. S., Pretlow, T. G., and Kung, H. J. (1997)  ErbB kinases and NDF signaling in human prostate cancer cells. Oncogene 15, 2705‐2716  366.  Qiu, Y., Robinson, D., Pretlow, T. G., and Kung, H.  J.  (1998) Etk/Bmx, a tyrosine kinase  with a pleckstrin‐homology domain,  is an effector of phosphatidylinositol 3'‐kinase and  is  involved  in  interleukin 6‐induced neuroendocrine differentiation of prostate  cancer  cells. Proc Natl Acad Sci U S A 95, 3644‐3649  367.  Liu, Y., Karaca, M., Zhang, Z., Gioeli, D., Earp, H. S., and Whang, Y. E. Dasatinib  inhibits  site‐specific  tyrosine  phosphorylation  of  androgen  receptor  by  Ack1  and  Src  kinases.  Oncogene 29, 3208‐3216  368.  Weigel,  N.  L.,  and  Moore,  N.  L.  (2007)  Steroid  receptor  phosphorylation:  a  key  modulator of multiple receptor functions. Mol Endocrinol 21, 2311‐2319  369.  Liu, Y., Karaca, M., Zhang, Z., Gioeli, D., Earp, H. S., and Whang, Y. E.  (2010) Dasatinib  inhibits  site‐specific  tyrosine  phosphorylation  of  androgen  receptor  by  Ack1  and  Src  kinases. Oncogene 29, 3208‐3216  370.  Schuurmans, A. L., Bolt,  J., and Mulder, E.  (1988) Androgens and  transforming growth  factor  beta  modulate  the  growth  response  to  epidermal  growth  factor  in  human  prostatic tumor cells (LNCaP). Mol Cell Endocrinol 60, 101‐104  371.  Story, M.  T.,  Hopp,  K.  A.,  and Molter, M.  (1996)  Expression  of  transforming  growth  factor beta 1 (TGF beta 1), ‐beta 2, and‐ beta 3 by cultured human prostate cells. J Cell  Physiol 169, 97‐107  164  372.  Story, M. T., Hopp, K. A., and Meier, D. A. (1996) Regulation of basic fibroblast growth  factor  expression  by  transforming  growth  factor  beta  in  cultured  human  prostate  stromal cells. The Prostate 28, 219‐226  373.  McKeehan, W. L. (1991) Growth factor receptors and prostate cell growth. Cancer Surv  11, 165‐175  374.  Roberts, A. B., and Sporn, M. B. (1985) Transforming growth factors. Cancer Surv 4, 683‐ 705  375.  Kim,  I. Y., Ahn, H. J., Zelner, D. J., Shaw, J. W., Sensibar, J. A., Kim, J. H., Kato, M., and  Lee, C.  (1996) Genetic change  in  transforming growth  factor beta  (TGF‐beta)  receptor  type  I gene correlates with  insensitivity  to TGF‐beta 1  in human prostate cancer cells.  Cancer research 56, 44‐48  376.  Sherwood, E. R., Fong, C. J., Lee, C., and Kozlowski, J. M. (1992) Basic fibroblast growth  factor:  a potential mediator of  stromal  growth  in  the human prostate.  Endocrinology  130, 2955‐2963  377.  Cunha, G. R.,  and Donjacour, A. A.  (1989) Mesenchymal‐epithelial  interactions  in  the  growth and development of the prostate. Cancer Treat Res 46, 159‐175  378.  Byrne, R. L., Leung, H., and Neal, D. E. (1996) Peptide growth factors  in the prostate as  mediators of stromal epithelial interaction. Br J Urol 77, 627‐633  379.  Bonaccorsi, L., Carloni, V., Muratori, M., Formigli, L., Zecchi, S., Forti, G., and Baldi, E.  (2004)  EGF  receptor  (EGFR)  signaling  promoting  invasion  is  disrupted  in  androgen‐ sensitive prostate cancer cells by an  interaction between EGFR and androgen receptor  (AR). Int J Cancer 112, 78‐86  380.  Zhu, M.  L.,  and  Kyprianou, N.  (2008)  Androgen  receptor  and  growth  factor  signaling  cross‐talk in prostate cancer cells. Endocrine‐related cancer 15, 841‐849  381.  Sherwood, E. R., Van Dongen,  J. L., Wood, C. G., Liao, S., Kozlowski,  J. M., and Lee, C.  (1998)  Epidermal  growth  factor  receptor  activation  in  androgen‐independent  but  not  androgen‐stimulated growth of human prostatic  carcinoma  cells. Br  J Cancer 77, 855‐ 861  382.  Leotoing,  L., Manin, M., Monte, D., Baron,  S., Communal,  Y.,  Lours, C., Veyssiere, G.,  Morel, L., and Beaudoin, C. (2007) Crosstalk between androgen receptor and epidermal  growth  factor  receptor‐signalling  pathways:  a  molecular  switch  for  epithelial  cell  differentiation. J Mol Endocrinol 39, 151‐162  165  383.  Stein,  P.  L.,  Lee, H. M., Rich,  S.,  and  Soriano,  P.  (1992)  pp59fyn mutant mice  display  differential signaling in thymocytes and peripheral T cells. Cell 70, 741‐750  384.  Chan,  V.  W.,  Meng,  F.,  Soriano,  P.,  DeFranco,  A.  L.,  and  Lowell,  C.  A.  (1997)  Characterization of the B  lymphocyte populations  in Lyn‐deficient mice and the role of  Lyn in signal initiation and down‐regulation. Immunity 7, 69‐81  385.  El Sheikh, S. S., Domin, J., Abel, P., Stamp, G., and Lalani el, N. (2004) Phosphorylation of  both  EGFR  and  ErbB2  is  a  reliable  predictor  of  prostate  cancer  cell  proliferation  in  response to EGF. Neoplasia 6, 846‐853  386.  Ghosh, P. M., Malik, S. N., Bedolla, R. G., Wang, Y., Mikhailova, M., Prihoda, T. J., Troyer,  D. A., and Kreisberg,  J.  I.  (2005) Signal  transduction pathways  in androgen‐dependent  and  ‐independent prostate cancer cell proliferation. Endocrine‐related cancer 12, 119‐ 134  387.  Shigemura, K., Isotani, S., Wang, R., Fujisawa, M., Gotoh, A., Marshall, F. F., Zhau, H. E.,  and  Chung,  L.  W.  (2009)  Soluble  factors  derived  from  stroma  activated  androgen  receptor phosphorylation in human prostate LNCaP cells: roles of ERK/MAP kinase. The  Prostate 69, 949‐955  388.  Blaszczyk,  N.,  Masri,  B.  A.,  Mawji,  N.  R.,  Ueda,  T.,  McAlinden,  G.,  Duncan,  C.  P.,  Bruchovsky, N.,  Schweikert, H. U.,  Schnabel, D.,  Jones, E. C.,  and  Sadar, M. D.  (2004)  Osteoblast‐derived  factors  induce  androgen‐independent proliferation  and  expression  of prostate‐specific antigen  in human prostate  cancer cells. Clin Cancer Res 10, 1860‐ 1869  389.  Quayle, S. N., Mawji, N. R., Wang, J., and Sadar, M. D. (2007) Androgen receptor decoy  molecules block the growth of prostate cancer. Proc Natl Acad Sci U S A 104, 1331‐1336  390.  Aleshin,  A.,  and  Finn,  R.  S.  (2010)  SRC:  a  century  of  science  brought  to  the  clinic.  Neoplasia 12, 599‐607  391.  Griffin, J. E. (1992) Androgen resistance‐‐the clinical and molecular spectrum. The New  England journal of medicine 326, 611‐618  392.  Caskey, C. T., Pizzuti, A., Fu, Y. H., Fenwick, R. G.,  Jr., and Nelson, D.  L.  (1992) Triplet  repeat mutations in human disease. Science 256, 784‐789  393.  Iacovelli, R., Palazzo, A., Procopio, G., Gazzaniga, P., and Cortesi, E. (2011) Abiraterone  acetate in castration‐resistant prostate cancer. Anticancer Drugs   166  394.  Payton,  S.  (2010)  Prostate  cancer:  MDV3100  has  antitumor  activity  in  castration‐ resistant disease. Nat Rev Urol 7, 300  395.  Yang,  L.  P.  (2011)  Abiraterone  Acetate:  In  Metastatic  Castration‐Resistant  Prostate  Cancer. Drugs   396.  Seruga, B., Ocana, A., and Tannock, I. F. (2011) Drug resistance in metastatic castration‐ resistant prostate cancer. Nat Rev Clin Oncol 8, 12‐23  397.  Sartor, A. O. (2011) Progression of metastatic castrate‐resistant prostate cancer: impact  of therapeutic intervention in the post‐docetaxel space. J Hematol Oncol 4, 18  398.  Ryan, C. J., Shah, S., Efstathiou, E., Smith, M. R., Taplin, M. E., Bubley, G. J., Logothetis, C.  J., Kheoh, T., Kilian, C., Haqq, C. M., Molina, A., and Small, E. J. (2011) Phase II study of  abiraterone  acetate  in  chemotherapy‐naive  metastatic  castration‐resistant  prostate  cancer  displaying  bone  flare  discordant with  serologic  response.  Clin  Cancer  Res  17,  4854‐4861  399.  Chen, H.,  Yong, W., Hinds,  T. D.,  Jr.,  Yang,  Z.,  Zhou,  Y.,  Sanchez,  E. R.,  and  Shou, W.  (2010)  Fkbp52  regulates  androgen  receptor  transactivation  activity  and male  urethra  morphogenesis. J Biol Chem 285, 27776‐27784  400.  Fang, Y., Fliss, A. E., Robins, D. M., and Caplan, A.  J.  (1996) Hsp90  regulates androgen  receptor hormone binding affinity in vivo. J Biol Chem 271, 28697‐28702  401.  Whitesell, L., and Lindquist, S. L. (2005) HSP90 and the chaperoning of cancer. Nat Rev  Cancer 5, 761‐772  402.  Solit, D. B., Zheng, F. F., Drobnjak, M., Munster, P. N., Higgins, B., Verbel, D., Heller, G.,  Tong, W., Cordon‐Cardo, C., Agus, D. B., Scher, H. I., and Rosen, N. (2002) 17‐Allylamino‐ 17‐demethoxygeldanamycin  induces  the  degradation  of  androgen  receptor  and HER‐ 2/neu and inhibits the growth of prostate cancer xenografts. Clin Cancer Res 8, 986‐993  403.  Chiosis, G., Huezo, H., Rosen, N., Mimnaugh,  E., Whitesell,  L.,  and Neckers,  L.  (2003)  17AAG:  low target binding affinity and potent cell activity‐‐finding an explanation. Mol  Cancer Ther 2, 123‐129  404.  Heath, E. I., Hillman, D. W., Vaishampayan, U., Sheng, S., Sarkar, F., Harper, F., Gaskins,  M., Pitot, H. C., Tan, W.,  Ivy,  S. P., Pili, R., Carducci, M. A., Erlichman, C.,  and  Liu, G.  (2008)  A  phase  II  trial  of  17‐allylamino‐17‐demethoxygeldanamycin  in  patients  with  hormone‐refractory metastatic prostate cancer. Clin Cancer Res 14, 7940‐7946  167  405.  Yano, A., Tsutsumi, S., Soga, S., Lee, M. J., Trepel, J., Osada, H., and Neckers, L.  (2008)  Inhibition of Hsp90 activates osteoclast c‐Src signaling and promotes growth of prostate  carcinoma cells in bone. Proc Natl Acad Sci U S A 105, 15541‐15546  406.  Ding, W. X., Ni, H. M., Gao, W., Yoshimori, T., Stolz, D. B., Ron, D., and Yin, X. M. (2007)  Linking of autophagy to ubiquitin‐proteasome system is important for the regulation of  endoplasmic reticulum stress and cell viability. Am J Pathol 171, 513‐524  407.  Ding, W. X., and Yin, X. M.  (2008) Sorting,  recognition and activation of  the misfolded  protein  degradation  pathways  through  macroautophagy  and  the  proteasome.  Autophagy 4, 141‐150  408.  Verfaillie,  T.,  Salazar,  M.,  Velasco,  G.,  and  Agostinis,  P.  (2010)  Linking  ER  Stress  to  Autophagy: Potential Implications for Cancer Therapy. Int J Cell Biol 2010, 930509  409.  Ogata, M.,  Hino,  S.,  Saito,  A., Morikawa,  K.,  Kondo,  S.,  Kanemoto,  S., Murakami,  T.,  Taniguchi, M., Tanii,  I., Yoshinaga, K.,  Shiosaka,  S., Hammarback,  J. A., Urano,  F.,  and  Imaizumi, K. (2006) Autophagy is activated for cell survival after endoplasmic reticulum  stress. Mol Cell Biol 26, 9220‐9231  410.  Janku, F., McConkey, D. J., Hong, D. S., and Kurzrock, R. (2011) Autophagy as a target for  anticancer therapy. Nat Rev Clin Oncol 8, 528‐539  411.  Martin, G. S. (2001) The hunting of the Src. Nat Rev Mol Cell Biol 2, 467‐475  412.  Irby, R. B.,  and  Yeatman,  T.  J.  (2000) Role of  Src expression  and  activation  in human  cancer. Oncogene 19, 5636‐5642  413.  Gioeli, D., Ficarro, S. B., Kwiek, J. J., Aaronson, D., Hancock, M., Catling, A. D., White, F.  M., Christian, R. E., Settlage, R. E., Shabanowitz, J., Hunt, D. F., and Weber, M. J. (2002)  Androgen  receptor  phosphorylation.  Regulation  and  identification  of  the  phosphorylation sites. J Biol Chem 277, 29304‐29314  414.  Kraus,  S., Gioeli, D., Vomastek,  T., Gordon, V.,  and Weber, M.  J.  (2006) Receptor  for  activated C kinase 1 (RACK1) and Src regulate the tyrosine phosphorylation and function  of the androgen receptor. Cancer research 66, 11047‐11054  415.  Gioeli, D., Black, B. E., Gordon, V., Spencer, A., Kesler, C. T., Eblen, S. T., Paschal, B. M.,  and  Weber,  M.  J.  (2006)  Stress  kinase  signaling  regulates  androgen  receptor  phosphorylation, transcription, and localization. Mol Endocrinol 20, 503‐515  168  416.  Ponguta,  L.  A.,  Gregory,  C. W.,  French,  F.  S.,  and Wilson,  E. M.  (2008)  Site‐specific  androgen receptor serine phosphorylation linked to epidermal growth factor‐dependent  growth of castration‐recurrent prostate cancer. J Biol Chem 283, 20989‐21001  417.  Gioeli, D.,  and  Paschal,  B. M.  (2011)  Post‐translational modification  of  the  androgen  receptor. Mol Cell Endocrinol   418.  Landry, J., Lambert, H., Zhou, M., Lavoie, J. N., Hickey, E., Weber, L. A., and Anderson, C.  W.  (1992) Human HSP27  is  phosphorylated  at  serines  78  and  82  by  heat  shock  and  mitogen‐activated kinases  that  recognize  the  same amino acid motif as S6 kinase  II.  J  Biol Chem 267, 794‐803  419.  Rouse, J., Cohen, P., Trigon, S., Morange, M., Alonso‐Llamazares, A., Zamanillo, D., Hunt,  T., and Nebreda, A. R. (1994) A novel kinase cascade triggered by stress and heat shock  that stimulates MAPKAP kinase‐2 and phosphorylation of the small heat shock proteins.  Cell 78, 1027‐1037  420.  Wei,  L.,  Liu, T. T., Wang, H. H., Hong, H. M., Yu, A.  L., Feng, H. P., and Chang, W. W.  (2011)  Hsp27  participates  in  the  maintenance  of  breast  cancer  stem  cells  through  regulation  of  epithelial‐mesenchymal  transition  and  nuclear  factor‐kappa  B.  Breast  Cancer Res 13, R101  421.  Vidyasagar, A., Reese, S., Acun, Z., Hullett, D., and Djamali, A. (2008) HSP27 is involved in  the  pathogenesis  of  kidney  tubulointerstitial  fibrosis. Am  J  Physiol  Renal  Physiol  295,  F707‐716  422.  Zhang,  D.,  Wong,  L.  L.,  and  Koay,  E.  S.  (2007)  Phosphorylation  of  Ser78  of  Hsp27  correlated  with  HER‐2/neu  status  and  lymph  node  positivity  in  breast  cancer.  Mol  Cancer 6, 52  423.  Di, K., Wong, Y. C., and Wang, X. (2007)  Id‐1 promotes TGF‐beta1‐induced cell motility  through HSP27  activation  and disassembly of  adherens  junction  in prostate epithelial  cells. Exp Cell Res 313, 3983‐3999  424.  Guan, H.,  Zhou,  Z., Gallick, G.  E.,  Jia,  S.  F., Morales,  J.,  Sood,  A.  K.,  Corey,  S.  J.,  and  Kleinerman, E. S. (2008) Targeting Lyn  inhibits tumor growth and metastasis  in Ewing's  sarcoma. Mol Cancer Ther 7, 1807‐1816        169  Appendix  1:  Androgen  Prevents  Apoptosis  Induced  by  Paclitaxel  A                                                                        B             Figure A.1. Androgen prevents apoptosis induced by paclitaxel.  A and B: LNCaP cells were pretreated with 10 nM R1881 or CSS for 48 h for 48 h prior to  treatment with 25 nM of paclitaxel or vehicle. Cell growth rates (A) were determined by  MTS assay and compared with control (day of treatment defined as 100%). The fraction  of cells in sub G0, G0‐G1, S, G2‐M phases was determined by Propidium iodide staining  (B) after 48 h paclitaxel treatment.           170  Appendix 2: AR  Interacts with Hsp27 via  the N‐terminal and  Ligand‐Binding Domains      Figure A.2. AR interacts with Hsp27 via the N‐terminal and Ligand‐Binding domains.   Left panel  illustrates schema of AR deletion constructs of AR, which were expressed  in  bacteria  and  purified  using  GST  column  for  pull  down  assays  using  total  LNCaP  cell  extracts and western blot using Hsp27.        171  Appendix 3: Validation of Pb‐Luc Functionality  in vitro and  in  cellulo  A                                                                                    B    C                                                                                    D        172  Figure A.3. Validation of Pb‐Luc functionality in vitro and in cellulo.  Cloning: The probasin promoter  (‐426/+28) was  subcloned  into pXP2  (Promega) using  HindIII and BamHI restriction enzymes. LNCaP were cotransfected pXP2‐Pb‐Luciferase in  combination  with  pSV2neo  for  cell  selection.  Stable  clonal  LNCaP  expressing  Pb‐Luc  were  selected using 500 µg of G418. Positive clones were  tested  for  their  capacity  to  express luciferase activity and to respond to R1881 in vitro.  A: Effect of R1881 on Pb‐Luc  in cellulo. LNCaP‐Pb‐Luc cells were treated with different  concentrations of R1881 for 16 h. Bioluminescence imaging was performed IVIS system  and 150 µg/ml of luciferin as a substrate.   B: Effect of R1881 on Pb‐Luc in vitro. LNCaP‐Pb‐Luc treated with different concentrations  of R1881 for 16 h. LNCaP‐Pb‐Luc were lysed in lysis buffer (Promega) and the luciferase  activity was measured using luminometer.  C: Effect of OGX‐427 on Probasin  luciferase activity  in cellulo. LNCaP‐Pb‐Luc cells were  transfected with 70 nM of OGX 427 or MM. 24 h after transfection; cells were submitted  to 16 h R1881 treatment. Bioluminescence imaging was performed IVIS system and 150  µg/ml of luciferin as a substrate.   D:  Effect  of OGX‐427  on  Probasin‐luciferase  activity  in  vitro.  LNCaP‐Pb‐Luc  cells were  transfected with 70 nM of OGX 427 or MM. 24 h after transfection; cells were submitted  to 16 h R1881  treatment. LNCaP‐Pb‐Luc cells were  lysed  in  lysis buffer  (Promega) and  the luciferase activity was measured using luminometer.    173  Appendix 4: OGX‐427 Suppresses Probasin Luciferase (Pb‐Luc)  A                                                                                     B      Figure A.4. OGX‐427 suppresses Probasin luciferase (Pb‐Luc).   Intact male mice  received  a  subcutaneous  injection  of  1x106  LNCaP‐Pb‐Luc  cells  and  treated with 20 mg/Kg of OGX‐427 or MM for 7 days when PSA reached 25 ng/ml.   A:  Circulating  serum  PSA  from  mice  treated  with  MM  was  measured  by  IMX  immunoassay before  (day 0) during  (day 4)  and  after  (day 8)  the  treatment,  the PSA  value was normalize to day 0. The figure showed the PSA level from different mice after  MM treatment.  B:  Circulating  serum  PSA  from  mice  treated  with  OGX‐427  was  measured  by  IMX  immunoassay before  (day 0) during  (day 4)  and  after  (day 8)  the  treatment,  the PSA  value was normalize to day 0. The figure showed the PSA level from different mice after  OGX‐427 treatment.       174  Appendix  5:  Effect  of  OGX‐427  on  AR,  Hsp27  and  Hsp90  Levels in LNCaP Xenografts           Figure A.5. Effect of OGX‐427 on AR, Hsp27 and Hsp90 levels in LNCaP xenografts.   Mice were sacrificed on day 8 and  tumour tissues were  fixed  in paraformaldehyde  for  immunohistochemistry. Hematoxylin and Eosin stained slides from 15 LNCaP xenografts  were marked for areas of interest avoiding necrotic foci in donor paraffin blocks. A TMA  was constructed creating a quadruplet TMA  layout and ordered by group of treatment  (one  tumour of control, 6  tumours of MM control and 8  tumours of OGX‐427  treated  mice,  with  a  total  of  60  cores.  Sections  cut  from  TMA  were  processed  for  antigen  retrieval as previously described  (312), and  stained with antibodies against AR  (N‐20),  Hsp90 (Santa Cruz), Hsp‐27 (Novo Castra), Ki67 (Dako Mississauga, Ont, Canada).       175  Appendix 6: Expression of Hsp27 Modulates UPR  A             B     176  C             D          177  Figure A.6. Expression of Hsp27 modulates UPR.   A:  Treatment  with  5  µM  MG132  (inhibition  of  proteasome  activity)  induces  UPR.  Expression of Hsp27 and UPR related proteins was measured by western blot analysis.   B: PC3 cells were  transfected with 10 nM of Hsp27  siRNA or  scrambled  siRNA control  twice  and  protein  expression  of  Hsp27  and  UPR  related  proteins  was measured  by  western blot analysis.   C: PC3 cells were transfected with 50 nM of OGX‐427 or MM control twice and protein  expression of Hsp27 and UPR related proteins was measured by western blot analysis.   D: protein expression of Hsp27 and UPR related proteins was measured by western blot  analysis  in  PC3  cells  stably  overexpressing  Hsp27,  compared  to  the  Empty  vector  overexpressing cells after  treatment with  indicated amounts of MG132.  (Material and  methods were followed as indicated in chapter 2).    178  Appendix  7:  Role  of  Hsp27  Expression  on  Accumulation  of  Ubiquitinated Proteins  A         B             179    C         Figure A.7. Effect of Hsp27 knockdown on accumulation of ubiquitinated proteins.   A: PC3 cells were  transfected with 10 nM of Hsp27 siRNA or scrambled siRNA control  twice and accumulation of ubiquitinated proteins was analyzed by western blot analysis  using Ubiquitin antibody.   B:  PC3  cells  were  transfected  with  25  nM  of  OGX‐427  or  MM  control  twice  and  accumulation  of  ubiquitinated  proteins  was  analyzed  by  western  blot  analysis  using  Ubiquitin antibody.   C:  Accumulation  of  ubiquitinated  proteins  was  analyzed  in  PC3  cells  overexpressing  Hsp27  and  compared  with  Empty  vector  overexpressing  cells,  after  incubation  with  indicated concentrations of MG132. (Material and methods were followed as  indicated  in chapter 2).        180  Appendix  8:  Hsp27  Knockdown  Induces  Autophagy  in  PC3  Cells  A       B       Figure A.8. Hsp27 knockdown induces autophagy in PC3 cells.   PC3  cells were  transfected with 25 nM of OGX‐427 or MM  control  twice and protein  expression level of Hsp27 and LC3 protein was analyzed by western blot analysis. B: PC3  cells were transfected with 10 nM of Hsp27 siRNA or scrambled siRNA control twice and  protein  expression  level  of  Hsp27  and  LC3  protein  was  analyzed  by  western  blot  analysis. (Material and methods were followed as indicated in chapter 2). 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share