Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Defining the complex interactions between the intestinal microbiota, mucus secretion, and infection Wlodarska, Marta 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2014_spring_wlodarska_marta.pdf [ 34.35MB ]
Metadata
JSON: 24-1.0103417.json
JSON-LD: 24-1.0103417-ld.json
RDF/XML (Pretty): 24-1.0103417-rdf.xml
RDF/JSON: 24-1.0103417-rdf.json
Turtle: 24-1.0103417-turtle.txt
N-Triples: 24-1.0103417-rdf-ntriples.txt
Original Record: 24-1.0103417-source.json
Full Text
24-1.0103417-fulltext.txt
Citation
24-1.0103417.ris

Full Text

DEFINING THE COMPLEX INTERACTIONS BETWEEN THE INTESTINAL MICROBIOTA, MUCUS SECRETION, AND INFECTION  by Marta Wlodarska  B.Sc., The University of British Columbia, 2007  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)   April 2014  © Marta Wlodarska, 2014    ii Abstract  Inflammatory bowel disease (IBD) is a debilitating disease characterized by chronic inflammation caused by multiple factors involving the immune system, intestinal microbiota and epithelial barrier. Microbial dysbiosis is implicated in disease, as there are significant differences in the microbiota composition between affected and healthy individuals. It is not clear if deterioration of microbial composition results in disease or is a consequence of disease. Mucus production by goblet cells serves as one of the crucial mucosal defenses at the interface between the eukaryotic and prokaryotic cells and yet the immunoregulatory pathways involved remain uncharacterized. The inner mucus layer of the intestine functions as a barrier, which serves to minimize microbial translocation, prevents excessive immune activation, and decrease infection. Here we have described methodology to alter the thickness of the inner mucus layer through treatment with antibiotic or a phytonutrient. We showed that the antibiotic metronidazole caused significant thinning of the inner mucus layer accompanied by a dramatic change in the microbial community structure. In contrast, treatment with the phytochemical eugenol resulted in significant thickening of the inner mucus layer that was accompanied by a change in the microbial community. These changes in community structure were complementary; DNA sequencing showed that groups depleted by metronidazole treatment were more abundant with eugenol treatment. To investigate how changes in the integrity of the inner mucus layer affect intestinal defense, Citrobacter rodentium (Cr) was used to examine susceptibility to enteric-induced colitis. Metronidazole-induced reduction in mucus thickness correlated with exacerbated severity of Cr-induced colitis. Thickening of the inner mucus layer with eugenol treatment resulted in protection from Cr-induced colitis. Further, we identified a novel innate immune    iii pathway involved in regulation of goblet cell function and mucus layer production. The NLRP6 inflammasome was shown to regulate mucus secretion and deficiency in any component of the NLRP6 inflammasome resulted in impaired goblet cell function preventing mucin granule exocytosis and mucus layer formation. Abrogated mucus secretion led to increased invasiveness and pathology of Cr infection. Mechanistically, NLRP6 deficiency led to stalled autophagy in goblet cells, providing a link between inflammasome activity, autophagy, mucus exocytosis, and antimicrobial barrier function.    iv Preface A version of Chapter 2 has been published. Wlodarska M, Willing B, Keeney KM, Menendez A, Bergstrom KS, Gill N, Russell SL, Vallance BA, and Finlay BB. Antibiotic treatment alters the colonic mucus layer and predisposes the host to exacerbated Citrobacter rodentium-induced colitis. Infect Immun. 2011 Apr; 79(4): 1536-45. Prof. Vallance and Finlay provided insights and guidance for this project. Dr. Willing performed and analyzed the T-RFLP community analysis. Dr. Keeney, Dr. Menendez, Dr. Bergstrom, Dr. Gill and Ms. Russell provided technical assistance (in descending magnitude) with experiments. I designed all experiments, completed all data analysis (except for the microbial community analysis) and wrote the manuscript.   A version of Chapter 3 is currently being prepared for submission. Dr. Willing performed the pyrosequencing community analysis, wrote the bioinformatics section of the methods and materials and aided in the writing of section 3.6. For the remainder of this manuscript, I designed and performed all experiments, analyzed all data, and wrote the majority of the manuscript. Dr. David Bravo, head of R&D at Pancosma, provided funding and the purified plant extracts for the project.  A version of Chapter 4 has been published. Wlodarska M, Thaiss CA, Nowarski R, Henao-Mejia J, Zhang JP, Brown EM, Frankel G, Levy M, Katz MN, Philbrick WM, Elinav E, Finlay BB and Flavell RA. NLRP6 inflammasome regulates the intestinal host-microbial interface by orchestrating goblet cell mucus secretion. Cell. 2014 Feb 27;156(5):1045-59. Prof. Elinav, Prof. Finlay and Prof. Flavell provided insights and guidance for this project. Prof. Eilnav offered technical support for infection of the NLRP6 deficient mice with C. rodentium    v and electron microscopy studies. Further he aided in planning of experiments and in the writing of the manuscript. Mr. Thaiss provided help with manuscript editing. Dr. Nowarski was involved in maintaining breeding colonies of all genetic deficient mice used and was responsible for breeding the LC3-GFP expressing NLRP6-deficient mice and helped with the microscopy work and provided other technical assistance. Dr. Henao-Mejia and Dr. Elinav preformed the C. rodentium experiments in the ASC and Caspase-1/11 deficient mice. Dr. Zhang performed the in situ hybridization studies with the NLRP6 probe. Mr. Brown performed the assays to determine the IgA and IgG C. rodentium specific titers. Dr. Frankel provided the luminescent strain of C. rodentium used in the studies. I designed and executed the majority of the experiments performed, analyzed the majority of the data (excluding the in situ hybridization studies and ASC- and Casp-1/11- deficiency infection studies) and wrote the manuscript.   Versions of figures in Chapter 1 and Chapter 5 have been published. Figure 1.1 has been published in Wlodarska M. and Finlay BB. Host immune response to antibiotic perturbation of the microbiota. Mucosal Immunol. 2010 Mar; 3(2): 100-3. Prof. Finlay edited and provided insights on the manuscript. I wrote the entirety of the manuscript. Figure 5.1 in Chapter 5 has been published in Gill N, Wlodarska M, and Finlay BB. Roadblocks in the gut: barriers to enteric infection. Cell Microbiol. 2011 May; 13(5): 660-9. Prof. Finlay edited and provided insights on the manuscript. Dr. Gill wrote 70% of the manuscript, I wrote the remaining 30% and designed all the figures.        vi Publications arising from my PhD work:   1. Wlodarska M, Thaiss CA, Nowarski R, Henao-Mejia J, Zhang JP, Brown EM, Frankel G, Levy M, Katz MN, Philbrick WM, Elinav E, Finlay BB and Flavell RA. NLRP6 inflammasome regulates the intestinal host-microbial interface by orchestrating goblet cell mucus secretion. Cell. In press. 2. Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, and Finlay BB. Recent advances in understanding enteric pathogenic Escherichia coli. Clin Microbiol Rev. 2013 Oct; 26(4):822-80. 3. Gill N, Wlodarska M, and Finlay BB. Roadblocks in the gut: barriers to enteric infection. Cell Microbiol. 2011 May; 13(5): 660-9. 4. Wlodarska M, Willing B, Keeney KM, Menendez A, Bergstrom KS, Gill N, Russell SL, Vallance BA, and Finlay BB. Antibiotic treatment alters the colonic mucus layer and predisposes the host to exacerbated Citrobacter rodentium-induced colitis. Infect Immun. 2011 Apr; 79(4): 1536-45. 5. Gill N, Wlodarska M and Finlay BB. The future of mucosal immunology: studying an integrated system-wide organ. Nat Immunol. 2010 Jul; 11(7): 558-60.  6. Wlodarska M and Finlay BB. Host immune response to antibiotic perturbation of the microbiota. Mucosal Immunol. 2010 Mar; 3(2): 100-3.   The mouse work presented in this thesis was approved by the UBC Animal Care Committee, certificate number: A10-0089     vii Table of Contents  Abstract .......................................................................................................................................... ii	  Preface ........................................................................................................................................... iv	  Table of Contents ........................................................................................................................ vii	  List of Tables ............................................................................................................................... xii	  List of Figures ............................................................................................................................. xiii	  List of Symbols ........................................................................................................................... xvi	  List of Abbreviations ................................................................................................................ xvii	  Acknowledgements ...................................................................................................................... xx	  Dedication .................................................................................................................................. xxii	  Chapter 1: Introduction ................................................................................................................1	  1.1	   The intestinal microbiota ................................................................................................... 1	  1.1.1	   Intestinal microbiota and human health ...................................................................... 2	  1.1.2	   Intestinal microbiota and inflammatory bowel diseases ............................................. 3	  1.1.3	   Impact of the intestinal microbiota on innate immunity ............................................. 5	  1.1.4	   Microbial influence on goblet cell function and mucus layer integrity ...................... 7	  1.2	   Goblet cells and the mucus layer ....................................................................................... 8	  1.2.1	   Regulatory mechanisms for mucus production ......................................................... 10	  1.2.2	   The mucus layer is an intestinal barrier to enteric pathogens ................................... 12	  1.3	   Citrobacter rodentium as a murine model of colitis ........................................................ 12	  1.4	   Conclusion ....................................................................................................................... 13	     viii Chapter 2: Antibiotic treatment alters the colonic mucus layer and predisposes the host to exacerbated Citrobacter rodentium- induced colitis ..................................................................15	  2.1	   Abstract ............................................................................................................................ 15	  2.2	   Introduction ...................................................................................................................... 16	  2.3	   Methods and materials ..................................................................................................... 18	  2.3.1	   Mice .......................................................................................................................... 18	  2.3.2	   Bacterial strains and infection of mice ...................................................................... 19	  2.3.3	   Tissue collection ....................................................................................................... 19	  2.3.4	   Microbial composition analysis ................................................................................ 19	  2.3.5	   Citrobacter rodentium CFU and cytokine determination ......................................... 20	  2.3.6	   Immunohistochemistry ............................................................................................. 21	  2.3.7	   FACS analysis ........................................................................................................... 21	  2.3.8	   RNA isolation and cDNA synthesis ......................................................................... 22	  2.3.9	   Real time polymerase chain reaction ........................................................................ 22	  2.3.10	   Measurements of mucus thickness ex vivo ............................................................. 23	  2.3.11	   Histopathological scoring ....................................................................................... 23	  2.3.12	   Statistical analysis ................................................................................................... 23	  2.4	   Metronidazole pre-treatment increases the severity of C. rodentium- induced colitis .... 24	  2.5	   Metronidazole treatment increases the inflammatory tone of the colon .......................... 30	  2.6	   Metronidazole treatment compromises goblet cell function and inner mucus layer production ................................................................................................................................. 32	  2.7	   Metronidazole pre-treatment increases the rate of C. rodentium-attachment to IECs ..... 34	  2.8	   Discussion ........................................................................................................................ 37	     ix 2.9	   Summary .......................................................................................................................... 41	  Chapter 3: Diet supplementation with a phytonutrient protects against enteric infection by shifting the microbiota and stimulating mucus secretion ........................................................42	  3.1	   Abstract ............................................................................................................................ 42	  3.2	   Introduction ...................................................................................................................... 42	  3.3	   Methods and materials ..................................................................................................... 45	  3.3.1	   Mice .......................................................................................................................... 45	  3.3.2	   Tissue collection ....................................................................................................... 46	  3.3.3	   RNA isolation and cDNA synthesis ......................................................................... 46	  3.3.4	   Real time polymerase chain reaction ........................................................................ 46	  3.3.5	   Measurements of mucus thickness ex vivo ............................................................... 47	  3.3.6	   Microbial analysis ..................................................................................................... 47	  3.3.7	   Bioinformatics ........................................................................................................... 47	  3.3.8	   Bacterial strains and infection of mice ...................................................................... 48	  3.3.9	   Citrobacter rodentium CFU and cytokine determination ......................................... 48	  3.3.10	   Immunohistochemistry ........................................................................................... 49	  3.3.11	   Histopathological scoring ....................................................................................... 49	  3.3.12	   Statistical analysis ................................................................................................... 50	  3.4	   Phytonutrients alter gene expression in the colon ............................................................ 50	  3.5	   Eugenol treatment stimulates the production of the inner mucus layer ........................... 53	  3.6	   Eugenol significantly alters the microbial composition in the intestine and microbial changes correlate with mucus production ................................................................................. 55	     x 3.7	   Eugenol treatment confers resistance to C. rodentium infection and reduces systemic inflammation ............................................................................................................................. 61	  3.8	   Discussion ........................................................................................................................ 64	  3.9	   Summary .......................................................................................................................... 66	  Chapter 4: NLRP6 inflammasome regulates the intestinal host-microbial interface by orchestrating goblet cell-mediated mucus secretion .................................................................68	  4.1	   Abstract ............................................................................................................................ 68	  4.2	   Introduction ...................................................................................................................... 68	  4.3	   Methods and materials ..................................................................................................... 71	  4.3.1	   Mice .......................................................................................................................... 71	  4.3.2	   Bacterial strains and infection of mice ...................................................................... 71	  4.3.3	   Citrobacter rodentium CFU, antibody titers and cytokine determination ................ 72	  4.3.4	   Bioluminescent imaging (BLI) in vivo and ex vivo .................................................. 72	  4.3.5	   RNA isolation and cDNA synthesis ......................................................................... 72	  4.3.6	   Real-time polymerase chain reaction ........................................................................ 73	  4.3.7	   Immunofluorescence ................................................................................................. 74	  4.3.8	   In situ hybridization .................................................................................................. 74	  4.3.9	   Transmission and scanning electron microscopy ..................................................... 75	  4.3.10	   Goblet cell and mucus layer preservation ex vivo ................................................... 75	  4.3.11	   Western blot ............................................................................................................ 75	  4.3.12	   Histopathological scoring ....................................................................................... 75	  4.3.13	   Statistical analysis ................................................................................................... 76	  4.4	   NLRP6 inflammasome deficiency impairs host mediated enteric pathogen clearance ... 77	     xi 4.5	   NLRP6 contributes to homeostasis through regulation of goblet cell function ............... 83	  4.6	   Distinct microbial configuration of NLRP6-deficient mice is not responsible for stalled mucus secretion ......................................................................................................................... 89	  4.7	   NLRP6 regulates goblet cell mucus granule secretion .................................................... 92	  4.8	   NLRP6 inflammasome is critical for autophagy in intestinal epithelial cells ................. 97	  4.9	   Discussion ...................................................................................................................... 102	  4.10	   Summary ...................................................................................................................... 105	  Chapter 5: Conclusion ...............................................................................................................107	  5.1	   Limitations of interpreting microbial analyses .............................................................. 111	  5.2	   Future research directions .............................................................................................. 112	  Bibliography ...............................................................................................................................114	      xii List of Tables Table 1.1 PRR-related polymorphisms and mutations associated with Crohn’s disease ............... 4	  Table 2.1 Primer sequences for microbiota composition .............................................................. 20	  Table 2.2 Primer sequences for host gene expression analysis .................................................... 22	  Table 3.1 Primer sequences for host mucin and inflammatory gene expression analysis ............ 47	  Table 4.1 Primer sequences for host inflammasome and mucin gene expression analysis .......... 73	        xiii List of Figures Figure 1.1 Microbial composition and MAMP diffusion affects intestinal homeostasis ............... 7	  Figure 2.1 Metronidazole treatment leads to increased severity of C. rodentium-induced colitis 25	  Figure 2.2 Characterization of increased severity of C. rodentium-induced colitis ..................... 26	  Figure 2.3 C. rodentium burdens are unchanged with antibiotic treatment .................................. 27	  Figure 2.4 Metronidazole treatment and streptomycin treatment differentially alters the microbial composition of the colon ............................................................................................................... 29	  Figure 2.5 Antibiotic treatment does not cause histopathological changes in the colon .............. 30	  Figure 2.6 Metronidazole treatment results in increased epithelial cell stimulation .................... 30	  Figure 2.7 Metronidazole treatment alters the homeostatic balance of the colon ........................ 31	  Figure 2.8 Metronidazole treatment alters goblet cell- related gene expression .......................... 33	  Figure 2.9 Metronidazole treatment causes a thinning of the inner mucus layer ......................... 34	  Figure 2.10 Visualization of mucin 2 shows antibiotic effects on inner mucus layer thickness .. 34	  Figure 2.11 Metronidazole treatment increases the rate of C. rodentium-attachment to intestinal epithelial cells ............................................................................................................................... 36	  Figure 3.1 Phytochemical treatment results in pleiotropic effects on intestinal gene expression 52	  Figure 3.2 Eugenol treatment results in thickening of the inner mucus layer .............................. 54	  Figure 3.3 Metronidazole treatment results in thinning of the inner mucus layer which is not rescued with concurrent eugenol treatment .................................................................................. 55	  Figure 3.4 Microbial diversity is greatly reduced with metronidazole treatment ......................... 56	  Figure 3.5 Eugenol alters the abundance of specific OTUs .......................................................... 58	  Figure 3.6 Families of the Clostridiales order are enhanced with eugenol treatment ................... 59	  Figure 3.7 Treatments cause differential alterations to the intestinal microbiome ....................... 60	     xiv Figure 3.8 Eugenol treatment results in decreased C. rodentium burdens .................................... 62	  Figure 3.9 C. rodentium growth in eugenol supplemented LB ..................................................... 62	  Figure 3.10 Attachment of C. rodentium is limited with eugenol treatment ................................ 63	  Figure 4.1 NLRP6 protects from enhanced enteric infection ....................................................... 78	  Figure 4.2 WT littermates show a similar trend in C. rodentium clearance ................................. 79	  Figure 4.3 Innate and adaptive arms of the immune response to C. rodentium are intact ............ 79	  Figure 4.4 NLRP6 is not required for the antimicrobial response or production of inflammasome-related cytokines ........................................................................................................................... 80	  Figure 4.5 NLPR6 is not required for cellular recruitment in response to infection .................... 81	  Figure 4.6 ASC recruitment is required for clearance of C. rodentium ........................................ 82	  Figure 4.7 Caspase-1/11 activation is required for clearance of C. rodentium ............................. 83	  Figure 4.8 NLRP6 is expressed in goblet cells ............................................................................. 84	  Figure 4.9 NLRP6 inflammasome activity is required for maintaining goblet cell function ....... 86	  Figure 4.10 NLRP6 sensor is required for mucus secretion ......................................................... 87	  Figure 4.11 NLRP6 inflammasome activity is required for protection from C. rodentium invasiveness .................................................................................................................................. 88	  Figure 4.12 NLRP6 sensor has limited effects on goblet cell gene expression ............................ 89	  Figure 4.13 Transmissible colitogenic gut microbiota of NLRP6 deficient mice is not the cause of abnormal goblet cell function and mucus secretion ................................................................. 91	  Figure 4.14 Goblet cell function and mucus secretion is independent of signaling through IL-1R and IL-18 ....................................................................................................................................... 92	  Figure 4.15 NLRP6 inflammasome is required for mucus granule exocytosis ............................ 93	  Figure 4.16 Intact mucin granules are present in the lumen of NLRP6-deficient mice ............... 94	     xv Figure 4.17 The intestinal surface reveals protruding mucin granules in NLRP6-deficient mice 95	  Figure 4.18 Members of the NLRP6 inflammasome complex, Caspase-1/11 and ASC, are required for mucus exocytosis ...................................................................................................... 96	  Figure 4.19 NLRP6 is required for autophagosome formation in the intestinal epithelium ......... 98	  Figure 4.20 NLRP6 deficiency leads to reduced LC3-GFP+ autophagosome formation ............. 99	  Figure 4.21 NLRP6 inflammasome signaling is required for autophagy in intestinal epithelial cells ............................................................................................................................................. 100	  Figure 4.22 NLRP6 deficiency results in mitochondrial dysfunction ........................................ 100	  Figure 4.23 Autophagy is required for goblet cell function and mucus secretion in the intestine..................................................................................................................................................... 101	  Figure 5.1 The mucus layer functions as an important intestinal barrier .................................... 108	  Figure 5.2 NLRP6 inflammasome regulation of mucus secretion .............................................. 110	      xvi List of Symbols  α alpha β beta  γ gamma µ micron % percent Gene-/- genetic deletion of “gene”      xvii List of Abbreviations A/E attaching/ effacing AB/PAS alcian blue/ periodic acid-Schiff AMP antimicrobial peptide ASC apoptosis-associated speck-like protein containing a carboxy-terminal CARD Atg5/7 autophagy-related gene 5 or 7 CARD caspase activation and recruitment domain CD cluster of differentiation  CFU colony forming units CO carbon dioxide DAPI 4',6-diamidino-2-phenylindole DC dendritic cell DNA deoxyribonucleic acid DPI days post infection DSS dextran sodium sulphate  E. coli Escherichia coli EDTA ethylenediaminetetraacetic acid EHEC Enterohaemorrhagic Escherichia coli EPEC Enteropathogenic Escherichia coli ER endoplasmic reticulum  FACS fluorescence-activated cell sorting GAPDH glyceraldehyde 3-phosphate dehydrogenase GC goblet cell GF germ free GFP green fluorescent protein H&E hematoxylin and eosin HRP horseradish peroxidase i inner mucus layer IBD inflammatory bowel disease IEC intestinal epithelial cell List of Abbreviations    xviii Ig immunoglobulin  IL Interleukin IL-1R interleukin-1 receptor IFN Interferon JAX Jackson Laboratory LB Luria broth LC3 light chain 3 LP lamina propria LPS lipopolysaccharide LTA lipoteichoic acid M cell microfold cell MAMP microbe-associated molecular pattern mCLCA3 murine calcium-activated chloride channel 3 MCP-1 monocyte chemotactic protein-1 Met Metronidazole MLNs mesenteric lymph nodes MPO myeloperoxidase mRNA messenger ribonucleic acid Muc Mucin MyD88 myeloid differentiation primary response gene 88 NaCl sodium chloride NADPH nicotinamide adenine dinucleotide phosphate NCI National Cancer Institute  NK natural killer NLR nucleotide-binding oligomerization domain-like receptor NLRC Nod-like receptor family CARD domain-containing protein  NLRP Nod-like receptor family pyrin domain containing NOD nucleotide-binding oligomerization domain OTU operational taxonomic unit List of Abbreviations    xix p.i. post infection PBS phosphate-buffered saline PCR polymerase chain reaction PRR pattern recognition receptor PSA polysaccharide A R-SNARE arginine- containing soluble N-ethylmaleimide-sensitive factor attachment protein receptor Reg3 regenerating islet-derived protein 3 Relm resistin-like molecule ROS reactive oxygen species rRNA ribosomal ribonucleic acid RT-PCR real-time polymerase chain reaction SEM scanning electron microscopy Strep Streptomycin T-RFLP terminal-restriction fragment length polymorphism TEM transmission electron microscopy TFF3 trefoil factor 3 TGF transforming growth factor Tir translocated intimin receptor TLR toll-like receptor TNF tumor necrosis factor TRF terminal restriction fragment TSLP thymic stromal lymphopoietin U Untreated UBC University of British Columbia UC ulcerative colitis UEA-1 Ulex europaeus agglutinin I VAMP-8 vesicle-associated membrane protein 8 WT wild-type    xx Acknowledgements  I would like to thank my supervisor Dr. Brett Finlay for giving me the opportunity to work in his lab, for giving me intellectual freedom in my scientific pursuits as well as stressing the importance of a strong work ethic and a work-life balance. I have had incredible opportunities within the lab not typically given to graduate students (writing reviews, attending conferences, establishing collaborations, managing projects) that have aided my scientific development and were only possible with Brett’s encouragement.  I have been extremely fortunate to be exposed to many talented scientists that have influenced my education and research process. My PhD committee, Dr. Ken Harder, Dr. Tobias Kollmann and Dr. Bruce Vallance, who have offered important experimental aid and advice throughout the years. A special thank you to Dr. Bruce Vallance who very freely shared his thoughts on mucosal immunology and was critical in developing my experimental skills and research questions that contributed to my first research publication outlined in Chapter 2 of this thesis. I must also thank a former graduate student in the Vallance lab, Dr. Kirk Bergstrom, who shared in my fascination of intestinal mucus and spent a great deal of time teaching me experimental methods and discussing my ideas. His guidance really set the stage for my in depth examination of goblet cell function. Also, a special thank you to Dr. Richard Flavell and his former post-doctoral fellow and current Professor, Dr. Eran Elinav, who collaborated on the NLRP6 story outlined in Chapter 4 of this thesis. I feel very fortunate to have been able to spend time in the Flavell lab, to be exposed to a new research environment, and to work alongside very bright scientists. Richard and Eran have been extremely supportive of the project, both of their guidance had a huge impact on its success. Eran was a pleasure to work alongside and has taught me a great deal about the research process.   Not only have I had great mentors throughout my graduate research but I have also gained experimental advice and help from many former and current colleagues, including graduate students and post-doctoral fellows. It’s hard to choose a select few as every member of the Finlay Lab has helped or encouraged me in some way. But I would like to highlight the    xxi following that dramatically changed my graduate experience, personally and/or experimentally (in no particular order):  Dr. Matthew Croxen, scientific advice, cloning help and a great supporter and friend.  Dr. Kristie Keeney, huge amounts of help throughout every year as well as a great friend. Dr. Ben Willing, a great microbial ecologist. Dr. Stephanie Shames, teaching me that cool things can happen “in vitro” and for acting like family during my times at Yale. Dr. Wanyin Deng, my bay-mate and Citrobacter expert. Robyn Law, for all the support and for appreciating sarcasm and reality T.V.  Eric Brown, sharing his thoughtful scientific advice, encouragement and support, wine enthusiast, and a great friend.  Lastly, a big thank-you to my Mom, Dad and Brother who have supported me throughout my life, who always offer support in times of stress and doubt and always ask how my mice are doing.     xxii Dedication           To my family and friends who supported me throughout this journey.   1  Chapter 1: Introduction  1.1 The intestinal microbiota Mammals are colonized with a diverse and abundant indigenous microbiota which colonizes many organs including the skin, genitourinary, respiratory, and intestinal tract (Artis, 2008; Round and Mazmanian, 2009). However, the greatest density, magnitude and diversity of the microbiota, including viruses, fungi and bacteria, is found in the large intestine. The intestinal microbiota can be thought of as an “organ”, essential for nutrient acquisition, metabolism of indigestible compounds, defense against colonization by pathogens and the development of intestinal architecture and immune system (Pédron and Sansonetti, 2008; Round and Mazmanian, 2009). The intestine in turn provides a nutrient rich environment where the microbiota establish a diverse microbial community, containing over 500 species of bacteria (Eckburg et al., 2005; Xu and Gordon, 2003), which compositionally changes through the length of the colon but remains a remarkably stable and resilient ecosystem (Consortium, 2012). Unfortunately, most of these bacteria are difficult to grow in culture, making this community difficult to study.  Even with this inherent difficulty, a significant effort is underway to further define the human microbiome (Consortium, 2012; Turnbaugh et al., 2007). Bacteria comprising the intestinal microbiota cluster within a number of phyla.  In the mouse and human intestine, greater than 90% of the organisms belong to two main phyla, the Firmicutes (Gram positive) and the Bacteroidetes (mainly Gram negative) (Frank et al., 2007; Lepage et al., 2005; Round and Mazmanian, 2009). The Gamma-Proteobacteria are the third most common phylum, but they represent only a small fraction of the total, with other phyla, including Actinobacteria, Verrucomicrobia, and Cyanobacteria comprising a much smaller  2  portion (Frank et al., 2007).  This composition is altered during intestinal disease, for example in patients with inflammatory bowel disease (IBD), but it even varies among healthy individuals. Most of this microbial variation in healthy individuals cannot be explained, however diet, environment, host genetics and early microbial exposure have all been implicated (Consortium, 2012). Recently these microbial variations have been classified into “enterotypes” based on changes in the abundance of three genera: Bacteroides, Prevotella and Ruminococcus; however, the enterotypes could not be associated with environmental or genetic factors (Arumugam et al., 2011).  1.1.1 Intestinal microbiota and human health  Although the microbiota is not essential for life, many benefits have been ascribed to being colonized immediately following birth.  Germ-free (GF) mice have defects in the development of intestinal tissues, show reduced vascular, nutritional and endocrine function, and are more susceptible to infection than conventionally colonized animals (Edelman and Kasper, 2008). Studies using GF mouse models have shown that the microbiota is essential for the maturation of the immune system as both gastrointestinal and systemic immune responses are deficient in these mice (Mazmanian et al., 2008).  In the intestine this deficiency manifests as underdeveloped gut associated lymphoid tissue (GALT) and fewer and smaller Peyer’s patches and mesenteric lymph nodes (MLNs) (Round and Mazmanian, 2009).  The systemic deficiency is seen in the splenic lymphoid tissue which lacks T and B cell zones; this deficiency can be corrected upon colonization of the GF mouse with the microbiota from conventionally housed mice using a fecal transfer technique (Mazmanian et al., 2008).    The intestinal epithelium, and its protective mucus cover, is the primary defense against pathogens and prevents leakage of the microbiota into the underlying immune tissue, including  3  the Peyer’s patches and mesenteric lymph nodes (MLNs). In GF mice the development of this intestinal epithelium is impaired; the normal villous structure is poorly developed and morphologically abnormal, exhibits a decreased rate of cell turnover and lower expression of defensins and antimicrobial peptides (AMPs) (Kumar et al., 2009; Louis and Flint, 2009; Rakoff-Nahoum and Medzhitov, 2008). The altered intestinal architecture has been attributed to a lack of butyrate production (Louis and Flint, 2009). The main sources of butyrate within the gut, are the Gram-positive Firmicutes (Louis and Flint, 2009). Butyrate is a major source of energy to the colonic mucosa; it is also an important regulator of gene expression, inflammation, differentiation and apoptosis in colonic cells (Louis and Flint, 2009). The altered phenotype in GF mice provides evidence that the mammalian genome does not encode all the required information for healthy development of some internal organs.   1.1.2 Intestinal microbiota and inflammatory bowel diseases As Western societies have progressed, advances in health and hygiene have altered human-microbe interactions through increased sanitation, antibiotic use, and vaccination. Concordantly, epidemiological studies have shown an alarming increase in the occurrence of IBD, which includes both Crohn's disease and ulcerative colitis. Susceptibility and severity of IBD has been linked to alteration in the microbiota composition, that results in disease in a genetically susceptible individual. Around 100 genetic loci have been linked with the development of IBD (Khor et al., 2011), and many of these genes have a role in orchestrating interactions between the immune system and the microbiota (see table 1.1). Assuming these genetic susceptibilities alter host-microbe interactions, they may promote microbial dysbiosis and inflammatory processes in the intestine. The resulting inflammation can be further  4  exacerbated by the genetic deficiency, creating a vicious cycle of intestinal inflammation leading to disease.  Table 1.1 Select PRR-related polymorphisms and mutations associated with Crohn’s disease Pathway/site affected Genetic abnormalities Paneth cells NOD2 Bacterial sensing TLR4, TLR9, CD14  Innate mucosal defense NOD2, CARD8, NLRP3, CARD9 Autophagy NOD2   Table adapted from Brown et al., 2013  There are significant differences in microbiota composition of IBD patients and healthy individuals implicating microbial factors in the initiation and perpetuation of colitis (Frank et al., 2007; Garrett et al., 2007; Lepage et al., 2005; Scanlan et al., 2008). It is unknown if such changes precede and contribute to the onset of IBD or are simply a result of IBD. Moreover, antibiotics are used extensively in the treatment of IBD however with variable efficacy (Gionchetti et al., 2006; Pélissier et al., 2010). As the molecular basis of the microbiota’s protective effects or the processes triggered as a result of its perturbation are not fully understood, it is important to elucidate the mechanisms by which antibiotic-induced microbial shifts perturb the homeostatic state of the intestinal immune system. While the microbiota likely represent a physical barrier that prevents pathogens from interacting with, and penetrating, the intestinal mucosa (Stecher and Hardt, 2008); other studies suggest a much higher degree of complexity that involves a direct role for the microbiota in dictating the immunological tone of the intestine (Cash et al., 2006; Ivanov et al., 2008; Salzman et al., 2007).  5  1.1.3 Impact of the intestinal microbiota on innate immunity Changes in the microbiota composition induced by antibiotic treatment, and those seen in IBD, may lead to variation in the concentrations of specific microbes and their associated microbe-associated molecular patterns (MAMPs). MAMPs are evolutionarily conserved molecules expressed by both pathogens and commensals that include cell surface markers such as lipopolysaccharide (LPS), polysaccharide A (PSA), lipoteichoic acid (LTA), and peptidoglycan. MAMPs are detected by pattern-recognition receptors (PRRs) including surface-bound Toll-like receptors (TLRs) and intracellular nuclear oligomerization domain like receptors (NLRs) expressed by dendritic cells, M cells, and intestinal epithelial cells (IECs) (Hooper, 2009; Takeuchi and Akira, 2010). Expression of these PRRs is crucial to maintain immunological tolerance to the intestinal microbiota, contributing to intestinal homeostasis (Abreu, 2010). As shown in figure 1, a significant alteration in microbial composition disturbs intestinal homeostasis via altered PRR-MAMP interactions resulting in weakening of the mucosal barrier through disruption of mucin, cytokine (e.g. IL-22), IgA, and antimicrobial peptide production (Carvalho et al., 2012). Genetic polymorphisms in PPRs positively correlate with disease occurrence (see table 1.1) and this may be a result from altered immune interaction with the microbiota. For example, mice lacking the PRR adaptor protein MyD88 have increased colonization of the liver and spleen by commensal microbiota and reconstitution of MyD88 expression in Paneth cells limited microbial penetration into these tissues, through the restoration of antimicrobial production (Slack et al., 2009; Vaishnava et al., 2008). Further, deficiency of TLR5, which signals through MyD88 and recognizes MAMPs associated with bacterial flagellin, led to an increased translocation of commensals to the liver and spleen and increased susceptibility to colitis (Vijay-Kumar et al., 2007, 2010). TLR- and MyD88- deficient mouse  6  colonies have been shown to have a significantly different intestinal microbial composition than WT mice (Ubeda et al., 2012). However, this microbial divergence is only seen in long-term isolation of PRR-deficient mouse colonies (Ubeda et al., 2012). Scrutiny of the reported phenotypes for MyD88- and TLR- deficient mice suggest that vertical transmission of the altered microbiota provides an initial microbial trigger that is required for the reported phenotypes (Ubeda et al., 2012). Recently the inflammasome, an immune complex formed to mediate signaling through specific NLR sensors, has garnered increased attention as an important regulator of microbial and intestinal homeostasis. Deficiency of NLRP6 led to an altered colonic microbiota, decreased production of IL-18 and increased susceptibility to DSS-colitis (Elinav et al., 2011a). PRR-MAMP interactions can also be exploited to alter mucosal homeostasis to promote protection from inflammation and infection, a novel strategy that could be utilized to treat intestinal disease. For example, administration of a commensal surface molecule, PSA, to mice resulted in suppression of IL-17 and promotion of IL-10 production by CD4+ cells, effectively protecting the host from experimentally induced colitis by Helicobacter hepaticus (Mazmanian et al., 2008). It is likely that a large portion of the microbiota have similar MAMPs, functioning as “symbiosis factors” to promote protective intestinal immune responses. Probiotics have also shown promise in improving colonic health, and much focus has been given to possible therapeutic strategies for IBD utilizing these agents (Borchers et al., 2009; Mennigen et al., 2009). The beneficial effects of administering probiotics, likely mimicked by symbiosis factors including PSA, may involve the restoration of microbial signals, some of which are detected by PRRs of the innate immune system.   7   Figure 1.1 Microbial composition and MAMP diffusion affects intestinal homeostasis  Microbiota-specific fluctuations are detected by IECs and may result in a defective mucosal barrier. Decreased mucus secretion by goblet cells leads to increased signaling through PRR-MAMPs due to increased commensal/MAMP contact. Altered PRR-MAMP interactions result in decreased tight junction protein expression, increasing the permeability of the IEC barrier, allowing for microbial translocation to underlying tissues resulting in inflammation.  1.1.4 Microbial influence on goblet cell function and mucus layer integrity  Goblet cells (GC), a type of specialized IEC, have a protective role in the intestine through the production of protective bioactive compounds including mucins, trefoil factors, and other antimicrobials (Van Klinken et al., 1995; Thim, 1997). These molecules are sequestered and concentrated within the mucus layer and provide defense against pathogens as well as prevent bacterial penetration of the intestinal epithelium, and they play a key role in the maintenance of healthy intestinal homeostasis (Hollingsworth and Swanson, 2004; Makkink et al., 2002). Stimuli that result in the production of these protective bioactive compounds are poorly understood but likely involve the microbiota. Insults resulting in a breach of the mucus  8  layer may facilitate release of these compounds, possibly functioning to both alert the host and control penetration of the microbiota to underlying tissues.  Studies using mucin knock-out mice, GF mice, and probiotics suggest that the intestinal mucus layer is a major barrier regulating microbe- IEC interactions, and that mucus integrity is largely affected by the microbiota (Johansson et al., 2008; Mack et al., 1999; Van der Sluis et al., 2006). GF mice produce an inner mucus layer that is thinner than conventionally housed mice, suggesting that bacterial stimulation by the microbiota is important for a healthy mucus layer under homeostatic conditions (Johansson et al., 2008). A defective mucus barrier leads to increased stimulation of IECs by the microbiota through increased MAMP diffusion (see Figure 1), excessive commensal contact with IECs, and commensal translocation to the underlying lamina propria (LP). Hyper-stimulation of IECs and commensal translocation could lead to disruption of intestinal homeostasis and induction of an inflammatory response, leading to increased host susceptibility to enteric pathogens (Sekirov et al., 2008). Similarly, an aberrant inflammatory response to commensals is thought to be a major component in the etiology of IBD, and defects in mucin production induced by intestinal microbiota shifts, could be a mechanism by which this occurs.   1.2 Goblet cells and the mucus layer Goblet cells are specialized intestinal epithelial cells that produce and secrete mucins into the lumen of the colon. In the mouse colon, the major secretory mucins include: Muc2, Muc5AC and Muc6, with Muc2 being the main contributor to the formation of the mucus layer (McGuckin et al., 2011; Tytgat et al., 1994). Muc2 biosynthesis involves protein dimerization in the ER, extensive O-glycosylation in the Golgi apparatus, oligomerization and dense packing of these  9  large net-like structures into secretory granules of the goblet cell (Ambort et al., 2012). Mucin-containing granules are stored within a highly organized array of microtubules and intermediate filaments called the theca, which separates mucin granules from the rest of the cytoplasm and gives mature goblet cells their distinctive shape (Forstner, 1995). Exocytosis of mucin occurs when apically oriented mucin granules fuse with the plasma membrane in a complex but not understood process (Ambort et al., 2012; Forstner, 1995). The resultant intestinal mucus layer consists of two stratified layers and plays a key role in the maintenance of intestinal homeostasis; it protects the epithelium from dehydration, physical abrasion, and commensal and invading microorganisms (Johansson et al., 2008; Linden et al., 2008). The inner mucus layer composition is dense and thought to be sterile, while the outer layer is a loose matrix containing microbes (Johansson et al., 2008). The inner mucus layer functions as a barrier, which serves to minimize microbial translocation and prevent excessive immune activation. However, MAMPs are thought to be able to diffuse through this layer to stimulate the underlying IECs through TLRs and NLRs (Hooper, 2009).  This is demonstrated by GF mice that respond to colonization with microbiota by increasing Muc2 sulfate incorporation (Schwerbrock et al., 2004).  Sulfate incorporation of Muc2 occurs within goblet cells prior to secretion and is thought to confer resistance to enzymatic degradation.  Additionally, treatment of mucin-secreting IECs with a probiotic strain, Lactobacillus plantarum 299v, increases Muc2 and Muc3 expression and inhibits enteric pathogen adherence (Mack et al., 1999).  These studies suggest that probiotic strains protect the host from intestinal inflammation through strengthening of the mucus barrier, without direct IEC contact, and preventing colonization by enteric pathogens.    10  Intestinal microbes can colonize the outer loose mucus layer by expressing glycan receptors involved in binding to the carbohydrates decorating the Muc2 protein (Larsson et al., 2011). When microbe-Muc2 complexes are sampled by dendritic cells (DCs) the presence of Muc2 promotes the generation of tolergenic signals to the specific microbial antigens, leading to secretion of IL-10, TGF-β, and retinoic acid, which drives the development of T regulatory cells establishing immunological tolerance to the intestinal microbiota (Shan et al., 2013). This process requires the microbe-Muc2 complex to bind galectin-3 (a carbohydrate-binding protein) enabling dendritic cell engagement via a PRR on the surface of DCs, Dectin-1 (Shan et al., 2013). The process that results in DC exposure to the microbe-Muc2 complex is unclear but may involve extension of dendrites by the DC into the intestinal lumen or alternatively, goblet cells may recycle some secreted mucins through the endocytic pathway and subsequently secrete mucin containing vesicles basolaterally (Shan et al., 2013). Muc2-deficient mice, which lack a normal intestinal mucus layer, are more susceptible to intestinal inflammation and infection, stemming from heightened commensal or pathogenic microbial interactions with the epithelial layer and potentially insufficient generation of immunological tolerance to commensals (Gill et al., 2011; Van der Sluis et al., 2008, 2006). 1.2.1 Regulatory mechanisms for mucus production  Further understanding the regulatory pathways involved in mucus secretion is essential to improve our understanding of gut inflammatory diseases and may lead to the development of novel therapeutics involving modulation of mucus secretion. Current studies suggest immune involvement in the regulation of intestinal mucus secretion however prior to this thesis no such pathways have been elucidated. Mucus secretion occurs by two distinct pathways, baseline and regulated secretion (Specian and Oliver, 1991). Baseline or constitutive secretion is the continual  11  secretion of mucin to maintain the mucus layer whereas regulated secretion results in a massive discharge of mucin in response to environmental and/or pathophysiological stimuli, emptying the theca of mucin granules induced by a wide array of bioactive factors (hormones, neuropeptides, inflammatory mediators including cytokines and lipids) (Heazlewood et al., 2008; Specian and Oliver, 1991). Fusion of the granules with the plasma membrane during baseline secretion involves typical docking proteins, including the membrane-associated R-SNARE VAMP-8 (Rodríguez-Piñeiro et al., 2012). A recent proteomic study of mucin granules developed a database of mucin granule-associated proteins; within this database was the autophagy-related protein, Atg5 (Rodríguez-Piñeiro et al., 2012). Autophagy is a highly conserved biological process that functions as a cellular recycling center. Autophagy results in engulfment of macromolecular contents through the formation of a double-layered membrane (autophagosome) around the contents and subsequent fusion with lysosomes (lysophagosome) resulting in lysosomal degradation (Carneiro and Travassos, 2013). This catabolic pathway allows for recycling of proteins and macromolecular components into their basic constituents and subsequent reuse. Interestingly, autophagy has also been shown to be critical for proper function of secretory pathways in osteoclasts (DeSelm et al., 2011), mast cells (Ushio et al., 2011) and Paneth cells (Cadwell et al., 2008). Additionally, a recent study showed the importance of the autophagic process in maintaining mucus secretion by goblet cells (Patel et al., 2013). Autophagy proteins are required for mucus secretion by a mechanism that requires fusion of autophagosomes with endosomes, which leads to significant generation of reactive oxygen species (ROS) via the NADPH oxidases, localized within endosomes (Patel et al., 2013). ROS production leads to an elevation of cellular calcium levels leading to mucin granule release (Patel et al., 2013). Mutations in any three of these pathways (autophagy, endocytosis, ROS generation  12  by NADPH oxidases) leads to abrogated mucus secretion and an accumulation of mucin granules (Patel et al., 2013).  1.2.2 The mucus layer is an intestinal barrier to enteric pathogens  Muc2-deficient mice, which lack a normal intestinal mucus layer, are more susceptible to the development and perpetuation of Citrobacter rodentium-induced colitis due to a closer interaction of intestinal microbes with the epithelial barrier (Bergstrom et al., 2010). The importance of the mucus layer as a barrier to enteric pathogens is emphasized by the fact that many of these pathogens have also acquired virulence factors to overcome and penetrate the intestinal mucus barrier. For instance, attaching and effacing (A/E) Enterohaemorrhagic E. coli (EHEC) and Enteropathogenic E. coli  (EPEC) facilitate colonization of the host by first adhering to the mucus layer, mediated by the adhesive properties of their flagella (Erdem et al., 2007).  Further, once attachment is achieved these A/E pathogens can secrete proteases that can degrade the mucus layer (Navarro-Garcia et al., 2010). This virulence strategy is shared among other enteric pathogens; the parasite Entamoeba histolytica encodes cysteine proteases that cleave Muc2 in order to dissolve the mucus layer and gain access to the underlying epithelium (Lidell et al., 2006).  1.3 Citrobacter rodentium as a murine model of colitis C. rodentium is a natural mouse A/E pathogen related to the human A/E pathogens, EHEC and EPEC, which are important causes of diarrheal diseases causing much morbidity and mortality worldwide. C. rodentium infection of mice results in intestinal inflammation with similar features to ulcerative colitis and infection is restricted to the intestinal lumen (Mundy et al., 2005). Pathological features of C. rodentium infection include acute colitis (defined as  13  inflammation and cellular infiltration of the intestinal epithelium), mucosal hyperplasia, barrier disruption, loose stools, and morbidity are dependent on the genetic background of the mouse strain (Mundy et al., 2005). C57Bl/6 mice are able to clear the infection typically after 21 days (Mundy et al., 2005). C. rodentium first colonizes the lymphoid tissue in the cecum, i.e. the cecal patch, and then infection quickly progresses (2-3 days) to the distal colon (Mundy et al., 2005). Attachment to the intestinal epithelium requires penetration of the mucus layer, which is accomplished via the secretion of a protein with mucinase activity, Pic, characterized in some pathogenic E. coli strains but not yet in C. rodentium (Grys et al., 2006; Navarro-Garcia et al., 2010). Penetration of the mucus layer allows for subsequent attachment by the translocation of its own intimin receptor, Tir, allowing bacterial attachment to the epithelium (Deng et al., 2003). Clearance of the infection is mediated by the adaptive immune system requiring CD4+ T cells and IgG secretion by B cells (Mundy et al., 2005).  1.4 Conclusion Current literature outlined here suggests that the architecture of the intestinal microbiota has great consequences for the maintenance of mucosal barriers. We hypothesize that the community structure of the intestinal microbiota is crucial to the maintenance of goblet cell function and mucus production and disruption of its composition will alter this intestinal barrier affecting the outcome and severity of C. rodentium-induced colitis.  We aimed to determine: (1) the consequence of antibiotic- induced microbial perturbations on mucosal homeostasis, maintenance of goblet cell function, and the outcome and severity of C. rodentium- induced colitis; (2) the influence of diet supplementation with phytonutrients on the microbial community, mucosal barriers and protection from enteric pathogens; (3) the novel innate  14  immune pathways involved in maintenance of goblet cell function and mucus layer production. An aberrant inflammatory response to commensals is a major component in the etiology of inflammatory bowel diseases and changes in the microbial architecture of the intestine could result in defects in mucosal barriers, including the mucus layer. This work will collectively increase our understanding of the interplay between the microbiota and immune responses and how this impacts colitis. These are issues central to a greater understanding of IBD in general, and may lead to the development of new and much needed diagnostic and therapeutic tools.     15  Chapter 2: Antibiotic treatment alters the colonic mucus layer and predisposes the host to exacerbated Citrobacter rodentium- induced colitis   2.1  Abstract   Antibiotics are often used in the clinic to treat bacterial infections, but the effects of these drugs on microbiota composition and on intestinal immunity are poorly understood. Citrobacter rodentium was used as a model enteric pathogen to investigate the effect of microbial perturbation on intestinal barriers and susceptibility to colitis. Streptomycin and metronidazole were used to induce alterations in the composition of the microbiota prior to infection with C. rodentium. Metronidazole pre-treatment increased susceptibility to C. rodentium- induced colitis compared to untreated and streptomycin pre-treated mice, six days post infection. Both antibiotic treatments altered microbial composition, without affecting total numbers, but metronidazole treatment resulted in a more dramatic change including a reduced population of Porphyromonadaceae and increased Lactobacilli. Disruption of the microbiota with metronidazole, but not streptomycin treatment resulted in increased inflammatory tone of the intestine characterized by increased bacterial stimulation of the epithelium, altered goblet cell function and thinning of the inner mucus layer suggesting a weakened mucosal barrier. This reduction in mucus thickness correlates with increased attachment of C. rodentium to the intestinal epithelium contributing to the exacerbated severity of C. rodentium-induced colitis in metronidazole pre-treated mice. These results suggest that antibiotic perturbation of the microbiota can disrupt intestinal homeostasis and integrity of intestinal defenses, which protect against invading pathogens and intestinal inflammation.   16  2.2 Introduction The intestinal microbiota is essential for many aspects of host physiology, as microbial by-products of digestion provide vitamins and nutrients to host cells, immune development, and contribute to colonization resistance to potential pathogens (Round and Mazmanian, 2009). Compositional changes in the intestinal microbiota can lead to severe dysregulation of the physiological and immunological intestinal homeostasis, with serious adverse consequences for the host (Round and Mazmanian, 2009). A well-known case of this is antibiotic treatment and previous studies have shown that antibiotic treatment can predispose the host to enteric infections (Sekirov et al., 2008). Additionally, Brandl et al. showed that administration of a broad-spectrum combination of metronidazole, neomycin and vancomycin promoted infection by vancomycin-resistant Enterococcus (Brandl et al., 2008). Further, there are significant differences in microbiota composition of IBD patients and healthy individuals implicating microbial factors in the initiation and perpetuation of colitis (Frank et al., 2007; Garrett et al., 2007; Lepage et al., 2005; Scanlan et al., 2008). It is unknown if such changes precede and contribute to the onset of IBD and/or are simply a result of IBD.  The intestinal epithelium and its protective mucin cover are the primary defenses against pathogen permeation and microbial leakage into the underlying lamina propria (LP). Antimicrobial proteins secreted by intestinal epithelial cells (IEC) include defensins, cathelicidins, and C-type lectins (Reg3β and Reg3γ) (Hooper, 2009). They function by disrupting bacterial surface structures and contribute to the maintenance of microbiota composition. Their expression has been shown to rely on intestinal epithelial cell (IEC) stimulation by microbes and their products (Cash et al., 2006). Additionally, recognition of commensals by IECs has been  17  shown to be important in regulating the inflammatory state of the intestine, through regulation of the IL-25-IL-23-IL-17 axis and T helper 17 cells (Zaph et al., 2008).  Goblet cells, a type of specialized IEC, have a protective role in the intestine through the production of bioactive compounds including mucins, trefoil factors, and other antimicrobials (Van Klinken et al., 1995; Thim, 1997). These molecules provide defense against pathogens by preventing bacterial penetration of the intestinal epithelium, and they play a key role in the maintenance of healthy intestinal homeostasis (Makkink et al., 2002). Studies using mucin knock-out mice, GF mice, and probiotics suggest that the intestinal mucus layer is a major mediator of microbe- IEC interactions, and that mucus integrity is largely affected by the microbiota (Ivanov et al., 2008; Mack et al., 1999; Van der Sluis et al., 2006). The mucus layer in the large intestine consists of two stratified layers mainly composed of secreted mucin Muc2 (Johansson et al., 2008). The inner mucus layer composition is dense and devoid of the microbiota, while the outer layer is a loose matrix that houses the microbiota (Johansson et al., 2008). The inner dense mucus layer functions as a barrier, which serves to minimize microbial translocation and prevent excessive immune activation (Hollingsworth and Swanson, 2004). Mice deficient in Muc2 production have an altered intestinal mucus layer and spontaneously develop colitis, suggesting that defects in mucin production lead to altered microbe-IEC interactions (Van der Sluis et al., 2006). Under homeostatic conditions, this bacterial stimulation comes from the microbiota and seems to be important for a healthy mucus layer as GF mice produce an inner mucus layer that is thinner than conventionally housed mice (Johansson et al., 2008). This study aimed to define the effect of metronidazole (met) and streptomycin (strep) on mucosal defense. I hypothesized that an alteration in intestinal microbial composition by  18  antibiotic treatments would alter susceptibility to the natural mouse pathogen, Citrobacter rodentium (C. rodentium), which results in intestinal inflammation with similar features to ulcerative colitis (Mundy et al., 2005). Both antibiotics induced distinct alterations in the microbiota composition, altering the susceptibility of the host to subsequent C. rodentium-induced colitis. I found that mice pre-treated with metronidazole suffered a more severe form of C.rodentium-induced colitis compared to streptomycin pre-treated or untreated mice. Further, the results demonstrate that some antibiotic treatments can not only induce compositional changes in the commensal population but also affect the inflammatory tone of the intestine, interfering with the protective function of goblet cells. Metronidazole treatment reduced Muc2 production and caused a thinning of the protective mucus layer, suggesting that intestinal homeostatic changes and depletion of the mucus layer by some antibiotics may predispose the host to enteric infection and potentially, other inflammatory bowel diseases.  2.3 Methods and materials 2.3.1 Mice 8 to 10 week old C57BL/6 female mice (Jackson Laboratory, Bar Harbor, ME) were housed in the animal facility at the University of British Columbia (UBC) in accordance with guidelines of the UBC Animal Care Committee and the Canadian Council on the use of Laboratory Animals. Mice were fed a standard sterile chow diet (Laboratory Rodent Diet 5001, Purina Mils, St. Louis, Missouri) ad libitum throughout experiments. Antibiotic treated mice were given metronidazole (Sigma) at 750 mg/L or streptomycin (Sigma) at 450 mg/L in drinking water for 4 days. Untreated, control, mice received sterilized water. After 4 days, the antibiotics were withdrawn and mice were infected or euthanized and tissues harvested.  19  2.3.2 Bacterial strains and infection of mice  Mice were infected by oral gavage with 0.1 mL of an overnight culture of LB containing approximately 2.5 x 108 cfu of a streptomycin-resistant derivative of C. rodentium DBS100.   2.3.3 Tissue collection Uninfected mice, or mice at day 2, 4, 6 and 21-post infection (p.i.), were euthanized by CO2 asphyxiation and their spleen, mesenteric lymph nodes, and large intestines dissected for further analysis. The large intestine was divided into cecum and colon. The piece of the distal colon collected for subsequent studies was the terminal 5 mm. Tissues were immediately placed in 10% neutral buffered formalin for histological studies, ethanol–Carnoy’s fixative for mucin studies, or frozen at -20ºC for subsequent microbial composition analysis.  2.3.4 Microbial composition analysis Changes in microbial composition were assessed in tissue samples collected from the distal colon by terminal-restriction fragment length polymorphism analysis (T-RFLP) and cloning and sequencing as previously described (Willing et al., 2009). Briefly, total bacterial 16S rRNA genes were PCR amplified using broad-range Eubacteria primers 27F and 926r (Table 2.1) and subjected to digestion with HaeIII and MspI. Fragment length determination of 6-FAM labeled products was performed on an ABI 3730 capillary sequencer (Applied Biosystems) and electrophoregrams were processed using GeneMarker (State College, PA). Peaks of interest were compared to reference clone libraries generated using DNA isolated from the ileum, cecum and feces of C57BL/6 mice treated with streptomycin, metronidazole or untreated. PCR amplified products were cloned into the pCR® 4 TOPO vector and transformed into E. coli TOP10 chemically competent cells (Invitrogen). Sequences were classified using the naïve Bayesian rRNA classifier in RDP (Willing et al., 2009). Real-time PCRs were completed using 16S rRNA  20  group-specific primers (Table 1) to determine the relative abundance of selected bacterial groups (standard curves from ATCC strains or purified 16S rRNA gene clones) including Bacteroidales (purified clone), Bifidobacterium (purified clone), Clostridium coccoides cluster (ATCC 47340D), and Lactobacillus (ATCC 4357D) in colon samples. Results were normalized to total bacterial 16S rRNA gene copies in the sample. To test whether treatments resulted in reduced bacterial abundance, total bacterial 16S rRNA gene copies were also quantified in fecal samples, because colon samples had varying contents of digesta. Measurement of 16S rRNA gene copies correlates well with bacterial number. All real-time PCR reactions were performed using Quantitect SYBR-Green Mastermix (Qiagen). Table 2.1 Primer sequences for microbiota composition  Target (sequence reference)  Primer Sequence Tm(ºC) Eubacteria 16S rRNA (TRFLP and cloning) Bact-27f * AGAGTTTGATCMTGGCTCAG 55 926r CCGTCAATTCCTTTRAGTTT  Eubacteria 16S rRNA (total bacteria) (Amann et al., 1990) UniF340 ACTCCTACGGGAGGCAGCAGT 63 UniR514 ATTACCGCGGCTGCTGGC  Bacteroidales 16S rRNA  (Doré et al., 1998) BactF285 GGTTCTGAGAGGAAGGTCCC 61 UniR338 GCTGCCTCCCGTAGGAGT  Bifidobacterium 16S rRNA  (Langendijk et al., 1995) Bif164F GGGTGGTAATGCCGGATG 62 Bif662R CCACCGTTACACCGGGAA  Clostridium coccoides 16S rRNA  (Franks et al., 1998) UniF338 ACTCCTACGGGAGGCAGC 60 CcocR491 GCTTCTTAGTCAGGTACCGTCAT  Lactobacillus 16S rRNA  (Rinttilä et al., 2004) LabF362 AGCAGTAGGGAATCTTCCA 56 LabR677 CACCGCTACACATGGAG     *6-FAM labeled 5' end for T-RFLP 2.3.5 Citrobacter rodentium CFU and cytokine determination  Whole mouse MLNs, ceca (fecal matter and tissue), and colon (fecal matter and tissue) tissues were collected in 1 mL of sterile PBS supplemented with complete EDTA-free protease inhibitor cocktail (Roche Diagnostics) at a final concentration recommended by the manufacturer.  Tissues were weighed, homogenized in a MixerMill 301 bead miller (Retsch) for 5 minutes at 30Hz at room temperature. Tissue homogenates were serially diluted in PBS and  21  plated onto MacConkey Agar (Difco), incubated overnight at 37ºC, and bacterial colonies were enumerated the following day, normalizing them to the tissue weight (per gram). C. rodentium colonies were clearly identified by their unique characteristic of being round with a red center and a white rim. Colon homogenates were centrifuged twice at 15,000 g for 20 min at 4°C to remove cell debris, and the supernatants were aliquoted and stored at -80°C. Cytokine levels in colon homogenates were determined with the BD Cytometric Bead Array Mouse Inflammation Kit (BD Biosciences), according to the manufacturer’s recommendations, and normalized to tissue weight (per gram).  2.3.6 Immunohistochemistry Sections of 5 µm were deparaffinized and rehydrated. Antigen retrieval was performed prior to blocking and staining by placing deparaffinized, rehydrated slides in 10 mM citric acid pH 6.0 at 90-100°C for 20 min, followed by cooling to room temperature. Immunostaining was carried out using antibodies against Tir (antibody production described before (Deng et al., 2003)) or murine Muc2 (H-300, Santa Cruz) antibody at 4°C overnight followed by incubation with an Alexa488-conjugated secondary antibody (Invitrogen) for 1 h at room temperature. Tissues were mounted using ProLong Gold® Antifade (Molecular Probes/Invitrogen) that contains 4’,6’-diamidino-2-phenylindole (DAPI) for DNA staining. 2.3.7 FACS analysis  Lamina propria cells were isolated from the excised murine colon. To achieve this, the colon was opened longitudinally washed and diced into small 0.5 cm sections. These sections were treated with collagenase from Clostridium histolgticum VIII (Sigma) at 37°C for one hour. The cell suspension was purified using a 30% percol gradient. Purified splenic and lamina propria cells were stained with fluorochrome-conjugated antibodies against CD45, CD3e, CD49b  22  (clone DX5) and F4/80 (all from BD Biosciences) before being analyzed with a LSR II (BD Biosciences) using CellQuest and FlowJo 6.1.1 software.  2.3.8 RNA isolation and cDNA synthesis  The terminal 2-3 mm of the colon were excised, immediately submerged in RNAlater™ (Qiagen), and stored at 4ºC overnight and then at -80ºC for subsequent RNA extraction. RNA was extracted using RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions. RNA concentration was determined using a NanoDrop ND-1000 (NanoDrop Technologies, Wilmington, DE, USA) and reverse transcription was performed with the Quantitect RT kit (Qiagen) using 1 µg RNA as template.  2.3.9 Real time polymerase chain reaction Real-time PCR was performed using Quantitect SYBR-Green Mastermix (Qiagen) and QuantiTect Reg3γ, Relmß, IL-25, and TSLP primers (Qiagen) in addition to the primers listed in Table 2.2. PCR was performed on an Opticon 2 (Bio-Rad) and cycles consisted of 95°C for 15 min and 40 cycles of 94°C for 15 s, 60°C for 30s and 72°C for 30s. Glyceraldehyde-phosphate-dehydrogenase (GAPDH) was used for normalization. The fold difference in expression was calculated as 2-∆∆C(t).  Table 2.2 Primer sequences for host gene expression analysis  Target (sequence reference) Primer Sequence Tm(ºC) Muc2  (Hoebler et al., 2006) MUC2-F GCTGACGAGTGGTTGGTGAATG 60 MUC2-R GATGAGGTGGCAGACAGGAGAC TFF3  (Hoebler et al., 2006) TFF3-F CCTGGTTGCTGGGTCCTCTG 60 TFF3-R GCCACGGTTGTTACACTGCTC GAPDH GAPDH-F ATTGTCAGCAATGCATCCTG 60 GAPDH-R ATGGACTGTGGTCATGAGCC   23  2.3.10 Measurements of mucus thickness ex vivo The terminal 5 mm of the colon were excised, immediately submerged in ethanol–Carnoy’s fixative at 4°C for 2 hours and then placed into 100% ethanol. Fixed colon tissues were embedded in paraffin and cut into 5 µm sections. Tissues were stained with Alcian blue/PAS.  2.3.11 Histopathological scoring Tissues were fixed in 10% neutral buffered formalin overnight and then placed into 70% ethanol. Fixed cecal tissues were embedded in paraffin and cut into 5 µm sections. Tissues were stained with hematoxylin and eosin (H&E), using standard techniques by the UBC Histology Laboratory. Tissue sections were assessed for pathology in four regions: lumen, surface epithelium, mucosa and submucosa. Pathology in the lumen was based on the presence of necrotic epithelial cells (0 = none; 1 = scant; 2 = moderate; 3 = dense).  The surface epithelium was scored for regenerative change (0 = none; 1 = mild; 2 = moderate; 3 = severe), desquamation (0 = no change; 1 = < 10 epithelial cells shedding per lesion; 2 = 11–20 epithelial cells shedding per lesion) and ulceration (3 = epithelial ulceration; 4 = epithelial ulceration with severe crypt destruction). The mucosa was scored for hyperplasia (scored based on crypt length/high-power field averaged from four fields at 400X magnification where 0 = < 140 µm; 1 = 141–285 µm; 2 = 286–430 µm; 3 = > 431 µm) and goblet cell depletion (scored based on number of goblet cells/high-power field averaged from four fields at 400X magnification where 0 = >50; 1 = 25-50; 2 = 10-25; 3 = <10). Lastly, the submucosa was scored for edema (0 = no change; 1 = mild; 2 = moderate; 3 = profound). The maximum score that could result from this scoring is 21.  2.3.12 Statistical analysis  T-RFLP profiles were subjected to cluster analysis using Bray-Curtis metrics (31). Statistical significance was calculated by using a two-tailed Student’s t-test unless otherwise  24  stated, with assistance from GraphPad Prism Software Version 4.00 (GraphPad Software, San Diego California USA, www.graphpad.com).  If not otherwise specified statistical significance was given as *** p-value < 0.001; ** p-value < 0.01; * p-value < 0.05; ns (not significant) p-value > 0.05. The results are expressed as the mean value with standard error of the mean (SEM), unless otherwise indicated.  2.4 Metronidazole pre-treatment increases the severity of C. rodentium- induced colitis To study the role of the microbiota in protection against enteric infections, two different antibiotics, streptomycin and metronidazole, were used to induce alterations in the intestinal microbial composition prior to infection with C. rodentium. Streptomycin is a broad-spectrum antibiotic that kills sensitive microbes by binding to the 30S subunit of the bacterial ribosome and inhibiting protein synthesis (Biswas and Gorini, 1972). Metronidazole targets anaerobic bacteria and sensitive protozoa, as these organisms are capable of nitroreduction of metronidazole converting it to its active form, leading to DNA damage (Searle and Willson, 1976). An analysis of the ceca from metronidazole pre-treated, infected mice six days post infection (p.i.) showed significantly increased inflammation compared to untreated, infected mice (Fig 2.1, Fig 2.2A, B).   25   Figure 2.1 Metronidazole treatment leads to increased severity of C. rodentium-induced colitis H&E stained cecal and distal colon sections from untreated, streptomycin and metronidazole pre-treated mice at day 0 and 6 days p.i.. No inflammation is evident in cecal sections of untreated and antibiotic pre-treated mice prior to infection (left panel; original magnification = 50X; scale =100 µm). Notably, there is an increase in inflammation throughout the cecal mucosa and submucosa of metronidazole pre-treated mice (original magnification = 50X; scale =100 µm).  Goblet cell depletion and hyperplasia is more extensive in the mucosa of metronidazole pre-treated mice (black arrowhead = goblet cell, right panel, original magnification = 400X) both in the cecum and distal colon.   This was characterized by greater submucosal edema, more extensive damage to the surface mucosa and ulceration, extensive regions of mucosal hyperplasia, and increased goblet cell depletion in metronidazole pre-treated mice six days p.i. (Fig 2.2A). Six days p.i., streptomycin pre-treated mice showed overall pathology not significantly different from untreated mice (Fig 2.2B). This study focused on cecal pathology since this is the first site colonized by C. rodentium, and as a result, it exhibits inflammation and tissue pathology prior to the distal colon. However, I did note that metronidazole treatment results in a modest increase in distal colon pathology six days p.i., with significantly greater goblet cell depletion and hyperplasia (Fig 2.2C,  26  D). Later in the infection, ten days p.i., there is increased pathology in the distal colon of metronidazole pre-treated mice compared to streptomycin treated and untreated mice (Fig 2.2B).    Figure 2.2 Characterization of increased severity of C. rodentium-induced colitis  (A) Independent histology damage scores from cecal tissues of untreated, streptomycin pre-treated and metronidazole pre-treated mice at day 6 p.i.. Scores were determined under blinded conditions. Each bar represents one individual based on inflammation and damage to the submucosa, mucosa, surface epithelium and lumen. (B) Cumulative histology damage scores from cecal tissue at day 6 p.i. and distal colon tissue at day 10 p.i. of untreated, streptomycin pre-treated and metronidazole pre-treated mice. Scores were determined under blinded conditions. Cecal results represent the means of two independent infections, n=4 per group. Distal colon results represent the means of independent infections, n= 3-6. U= untreated; DC= distal colon. (***p = 0.0003; **p = 0.0075) (C) Goblet cell numbers of untreated, streptomycin pre-treated and metronidazole pre-treated mice. Goblet cell numbers prior to infection and day 6 p.i. in the distal colon are shown. Results represent the means of two independent experiments, n=4 per group. U= untreated. (**p = 0.0011) (D) Hyperplasia was measured as changes in crypt length in untreated, streptomycin pre-treated and metronidazole pre-treated mice. Hyperplasia prior to infection and day 6 p.i. in the distal colon is shown. Results represent the means of two independent experiments, n=4 per group. U= untreated. (**p = 0.0044)  A BSubmucosaMucosaSurface EpitheliumLumenCecum 6 DPI0510152025Untreated Strep MetPathology Score0255075**U Strep Met U Strep MetGoblet Cell Number 6 DPIUninfected 6 DPI01020304050**U Strep Met U Strep MetUninfected 6 DPI% Hyperplasia 6 DPIC DU Strep Met***Total Pathology Score 0510152025U Strep Met**    Cecum 6 DPI DC 10 DPI 27  Increased mucosal damage seen in metronidazole pre-treated, infected mice was not due to increased C. rodentium burdens as numbers were similar to untreated and streptomycin pre-treated mice in the cecum, colon and mesenteric lymph nodes, six days p.i. (Fig 2.3).   Figure 2.3 C. rodentium burdens are unchanged with antibiotic treatment Enumeration of C. rodentium in the cecum, colon and mesenteric lymph node tissue at day 6 p.i.. Each data point represents one individual. Results are pooled from three separate infections, n=4-6 per group. Horizontal line represents the median for each group. U= untreated.  In order to elucidate any competitive advantage given to C. rodentium specific to metronidazole pre-treatment, and not with streptomycin treatment, we determined total microbial numbers and composition in the large intestine prior to infection. Total fecal microbial numbers, as determined by real-time PCR, were not significantly affected by either four-day antibiotic treatment (Fig 2.4A). Conversely, both streptomycin and metronidazole had distinct effects on bacterial community composition of the distal colon, as assessed by terminal restriction fragment length polymorphism (T-RFLP) (Fig 2.4B). Terminal restriction fragment lengths that differed between treatments were compared to established clone libraries and validated by qPCR. Streptomycin treatment resulted in substantial changes to the microbiota composition but did not affect the abundance of the Bacteroidales order, specifically the Porphyromonadaceae family 1051061071081091010CFU/g Cecum tissue 6 DPICFU/g Colon tissue 6 DPI1051061071081091010CFU/g mLN tissue 6 DPIU Strep Met014567101010101010U Strep MetU Strep Met 28  (Fig 2.4B). Porphyromonadaceae represent the most abundant family of the Bacteroidales order found in untreated mice. Metronidazole treatment resulted in a more significant disturbance in the microbial composition of the colon compared to streptomycin-treated mice (Fig 2.4B). Metronidazole depleted the population of obligate anaerobic Bacteroidales, but aerotolerant populations, including Lactobacilli, became more abundant resulting in no significant effect of metronidazole on total bacterial numbers (Fig 2.4A, C). Conversely, streptomycin depleted the Lactobacilli population (Fig 2.4C). The Clostridium coccoides group was also depleted by metronidazole treatment, while streptomycin resulted in partial depletion, although not significant, compared to the control (Fig 2.4C). Bifidobacteria spp, which were previously correlated to increased mucus thickness (Pélissier et al., 2010), were undetected in all treatment groups. The differential shift in microbial composition between streptomycin and metronidazole-treated mice confirm a distinct effect of either antibiotic on the host microbiota.           29          Figure 2.4 Metronidazole treatment and streptomycin treatment differentially alters the microbial composition of the colon (A) Total bacterial number determined by real-time PCR measuring Eubacteria 16S rRNA in feces of untreated, streptomycin and metronidazole treated mice. Results are averaged from two independent experiments, n=3-4 mice per group. (B) Similarity tree using Bray Curtis metrics of bacterial 16S rRNA gene terminal-restriction fragment profiles from distal colon samples. Bar graphs represent average T-RFLP profiles from each treatment group and the bacterial families represented by terminal restriction fragment lengths (TRFs; cut with MspI) of interest are indicated. U= untreated mice; S= streptomycin treated mice; M= metronidazole treated mice. Results are representative of two independent experiments, n=3-4 mice per group. (C) Real-time PCR quantification of select bacterial populations using group specific primers on DNA extracted from distal colon samples. Abundance of target groups was normalized to the total bacterial 16S rRNA gene copies in each sample. Results are averaged from two independent experiments, n=3-4 mice per group. (***p < 0.0001)A B C***U Strep Met U Strep Met U Strep Met010306015******                   Abundance (% of total 16S rRNA gene copies)Bacteroidales Lactobacilli C. coccoidesU Strep Met          Bacterial Abundance (LOG 16S rRNA gene copies/g feces)10111213TRF 84 Porphyro-monadaceaeTRF 86 Porphyro-monadaceaeTRF 86 Porphyro-monadaceaeTRF 86 Porphyro-monadaceaeTRF 70EnterococcaceaeTRF 187 LactobacillaceaeTRF 493 Entero-bacteriaceaeTRF 92 LachnospiraceaeTRF 93 RikenellaceaeU Strep Met050100TRF 84 Porphyro-monadaceaeTRF 132 LachnospiraceaeTRF 209 LachnospiraceaeTRF 151 LachnospiraceaeTRF 574 LactobacillaceaeTRF 295 & 297RuminococcaceeSimilarity S3S4S1S2U4U1U2U3M1M2M4M3Microbial composition (% of total TRFs)A B C***U Strep Met U Strep Met U Strep Met010306015******                   Abundance (% of total 16S rRNA gene copies)Bacteroidales Lactobacilli C. coccoidesU Strep Met          Bacterial Abundance (LOG 16S rRNA gene copies/g feces)10111213TRF 84 Porphyro-monadaceaeTRF 86 Porphyro-monadaceaeTRF 86 Porphyro-monadaceaeTRF 86 Porphyro-monadaceaeTRF 70EnterococcaceaeTRF 187 LactobacillaceaeTRF 493 Entero-bacteriaceaeTRF 92 LachnospiraceaeTRF 93 RikenellaceaeU Strep Met050100TRF 84 Porphyro-monadaceaeTRF 132 LachnospiraceaeTRF 209 LachnospiraceaeTRF 151 LachnospiraceaeTRF 574 LactobacillaceaeTRF 295 & 297RuminococcaceeSimilarity S3S4S1S2U4U1U2U3M1M2M4M3Microbial composition (% of total TRFs) 30  2.5 Metronidazole treatment increases the inflammatory tone of the colon To understand the mechanism underlying the increased C. rodentium-induced damage observed in metronidazole-treated mice, we analyzed the effect of the antibiotic treatments over several parameters of intestinal immune function.  As shown in Fig 2.5, a four-day treatment with either antibiotic did not result in overt intestinal inflammation.   Figure 2.5 Antibiotic treatment does not cause histopathological changes in the colon H&E stained distal colon sections from untreated, streptomycin and metronidazole treated mice at day 0. No overt inflammation evident. (Original magnification = 400X; scale = 50 µm).  However, metronidazole-treated mice, but not streptomycin-treated mice, showed an increase in mRNA expression of both IL-25 and Reg3γ, but not thymic stromal lymphopoietin (TSLP), indicating increased microbial stimulation of the intestinal epithelium (Fig 2.6) (Cash et al., 2006; Zaph et al., 2008).            Figure 2.6 Metronidazole treatment results in increased epithelial cell stimulation Quantitative RT-PCR results of IL-25 (*p = 0.0371), Reg3γ (*p = 0.0177) and TSLP expression in the distal colon of untreated and metronidazole treated mice. Results are averaged from three independent experiments, n= 4-6 mice per group. U= untreated mice. 0.00.51.01.52.02.5IL25 relative expressionU MetStrep*U MetStrep0.00.40.81.21.6TSLP relative expressionREG3γ relative expressionU MetStrep0123456 * 31   The spleen and colon of untreated and metronidazole-treated mice were excised and cells isolated for FACS analysis. Increased stimulation of the epithelium after metronidazole treatment had no effect on colonic T-cells numbers (Fig 2.7A), but resulted in increased macrophage and NK cell infiltration of the intestinal lamina propria (LP); metronidazole-treated mice exhibited a 3-fold increase in the frequency of macrophages (*p = 0.0382) and a 4-fold increase in the frequency of NK cells (*p = 0.0225), (Fig 2.7A, C). In contrast, splenic NK and macrophage cell numbers were unchanged by metronidazole treatment (Fig 2.7B, C) indicating that the increased frequency of these innate immune cells is a local (intestinal) and not a systemic effect of oral metronidazole.  Figure 2.7 Metronidazole treatment alters the homeostatic balance of the colon FACS analysis of macrophage, NK cell and T-cell recruitment to the lamina propria (A) and spleen (B) in untreated and metronidazole treated mice. Both splenic and lamina propria cells were stained with fluorescently labeled CD45, CD3ε, CD49b and F480. Only CD45 positive cells were examined for the expression of CD3ε, CD49b and F480. T-cells are defined as CD45+CD3ε+CD49b-; NK cells are defined as CD45+ CD3ε-CD49b+; macrophages are defined as CD45+F480+. (C) Flow cytometric analysis of CD49b+ and F4/80+ populations within the CD45+ lymphocytes in the lamina propria and spleen of untreated and metronidazole treated mice. Data from one mice per group is shown and is representative of 2 independent experiments, n= 4 per group.   A               Total CD45+ LP LymphocytesMacs NK T-CellsUntreated MetF480CD49bLPSpleenC2.952.208.377.450.991.980.832.17B               Total CD45+ Splenic LymphocytesMacs NK T-CellsUntreatedMet***03.0x1036.0x1039.0x1031.2x10401.5x1063.0x1061.0x1072.0x107 32  2.6 Metronidazole treatment compromises goblet cell function and inner mucus layer production  Metronidazole-treated animals showed evidence of increased bacterial stimulation of the epithelium and innate immune cell infiltration of the LP (Fig 2.6 and 2.7). We hypothesized this could be a result of an altered inner mucus layer in the intestine, allowing for a closer microbe-epithelial interaction in metronidazole-treated mice with respect to untreated mice. To verify this, we assessed goblet cell function by transcriptional analysis of the goblet cell-specific proteins Muc2, TFF3, and Relmß. These proteins have defined roles in intestinal homeostasis; Muc2 is the main component of the intestinal mucin layer (Johansson et al., 2008), TFF3 synergizes with Muc2 enhancing the protective properties of the mucus layer (Van der Sluis et al., 2006), and Relmß has an important role in innate immunity and host defense (Artis et al., 2004). The results in Fig 2.8 show that metronidazole treatment caused a significant down regulation of Muc2, TFF3, and Relmß mRNA expression in the distal colon, as compared to untreated mice, strongly suggesting that goblet cell function was affected by metronidazole treatment. In contrast, streptomycin-treatment did not affect the levels of Muc2 and TFF3 expression (Fig 2.8).        33   Figure 2.8 Metronidazole treatment alters goblet cell- related gene expression Quantitative RT-PCR results of Muc2, TFF3 and RELMß expression in the distal colon. Results are averaged from three independent experiments, n= 3-6 mice per group. U= untreated mice. (**p = 0.0017; **p = 0.0008)  The reduction in Muc2 mRNA expression after metronidazole treatment was reflected in a significant decrease in the colonic inner mucus layer thickness, as shown by AB/PAS staining (Fig 2.9A, B). While the inner mucus layer of untreated mice was on average 23 µm (+/- 3 µm) thick (Fig 2.9A), metronidazole-treated mice exhibited a significantly thinner inner mucus layer, measured to be 13 µm (+/- 1 µm) thick, a reduction of 39% compared to untreated mice (Fig 2.9A). The inner mucus layer of streptomycin-treated mice was on average 21 µm (+/- 1 µm) thick and did not differ from untreated mice (Fig 2.9A, B), corresponding to the unaltered Muc2 mRNA expression in these animals. Thinning of the inner mucus layer in the distal colon induced by metronidazole treatment was confirmed by immunofluorescence using an antibody specific for murine Muc2 (Fig 2.10). These findings indicate that metronidazole treatment affects goblet cell Muc2 production resulting in thinning of the inner mucus layer.    0.000.500.751.001.251.500.25Muc2 relative expression 0.00.51.01.52.0TFF3 relative expression U MetStrepU MetStrep0.00.51.01.52.0Relmβ relative expression U MetStrep*********** 34   Figure 2.9 Metronidazole treatment causes a thinning of the inner mucus layer (A) Quantification of inner mucin layer thickness. Distal colon sections were fixed in ethanol-Carnoy’s fixative, embedded in paraffin and stained with AB/PAS to visualize and quantify the inner mucus layer. The inner mucus width was determined by an average of 4 measurements per field with 4 fields counted per tissue section. Results are averaged from two independent experiments, n= 3 mice per group. U= untreated mice. (***p = 0.0003) (B) AB/PAS stained ethanol-Carnoy’s fixed distal colon sections showing the inner mucin layer (white arrowheads). i = inner mucin layer; GC = goblet cell. Original magnification = 400X. Scale = 20 µm.   Figure 2.10 Visualization of mucin 2 shows antibiotic effects on inner mucus layer thickness  Representative immunostaining of the inner mucin layer using an antibody that recognizes murine Muc2 (green) with DAPI (blue) as a counter stain. The inner mucin layer is thinner in metronidazole treated C57BL/6 mice. i = inner mucin layer; GC = goblet cell. Original magnification = 400X. Scale = 20 µm.  2.7 Metronidazole pre-treatment increases the rate of C. rodentium-attachment to IECs C. rodentium-induced colitis 6 days p.i. was more severe in metronidazole pre-treated mice but no difference in C. rodentium burden was seen (Fig 2.1 and 2.3). Moreover, metronidazole-treated animals showed evidence of increased inflammatory tone of the intestine BiiiGCGCGCUntreated Strep Met0102030Inner Mucin Layer Width (µm)***U MetStrepAUntreated Strep MetiiiGCGCGCDAPI/Muc2 35  characterized by increased bacterial stimulation of the epithelium (Fig 2.6) and a thinner inner mucus layer (Fig 2.9) suggesting a weakened mucosal barrier. To verify this, we performed immunostaining for the C. rodentium-derived infection marker Tir (translocated intimin receptor) on colon sections 2, 4, and 6 days p.i., as a measure of the rate of C. rodentium attachment to the intestinal epithelium. The results shown in figure 2.11 demonstrate that metronidazole pre-treatment facilitates C. rodentium attachment to the epithelium (Fig 2.11A), resulting in significantly higher numbers of colonic bacteria at the early stages of infection (Fig 2.11B) and deeper penetration of C. rodentium earlier in infection, at 4 days p.i. (Fig 2.11A, asterisk). At 21 days p.i., C. rodentium numbers in the colon decrease; however, a small subpopulation of metronidazole pre-treated mice remain highly colonized (Fig 2.11B). Complementing the increase in C. rodentium attachment to the epithelium, the production of pro-inflammatory cytokines upon C. rodentium infection also indicate differences in the inflammatory tone between untreated and metronidazole-treated mice (Fig 2.11C). Colonic levels of TNFα, IFNγ, and MCP-1 was found to be 6-fold, 5-fold, and 4-fold higher, respectively, in metronidazole pre-treated, infected mice 2 days p.i.. However, the expression of TNFα, IFNγ, and MCP-1 is not significantly higher prior to infection or at later days after infection in metronidazole pre-treated mice (Fig 2.11C). Collectively, these results indicate that metronidazole treatment triggers an immune homeostatic imbalance in the intestinal epithelium, which might have an important impact on the severity of subsequent infections.   36   Figure 2.11 Metronidazole treatment increases the rate of C. rodentium-attachment to intestinal epithelial cells (A) Representative immunostaining for the C. rodentium-specific effector Tir (green) in colon, with DAPI (blue) as a counter stain, at various time points of untreated and metronidazole pre-treated mice. Note Tir staining present at day 2 p.i. in metronidazole pre-treated mice which is absent in untreated mice. C. rodentium penetrates deeper into crypts of metronidazole pre-treated mice compared to untreated mice on day 4 p.i. (asterisk). Original magnification = 100X. Scale = 100 µm. (B) Enumeration of C. rodentium in the colon at days 2, 4, 6 and 21 p.i. (2 DPI, 4 DPI, 6 DPI and 21 DPI, respectively). Each data point represents one individual. Results are pooled from two separate infections, n=4-6 per group. (**p = 0.0068). Day 21 p.i. results represent a single experiment, n=6. Horizontal line represents the median for each group. U= untreated. (C)  Cytokine and chemokine production in the colon at days 2, 4 and 6 p.i. (2 DPI, 4 DPI and 6 DPI, respectively). Results are pooled from two separate infections, n=4-6 per group. Cytokines, TNFα and IFNγ, and chemokine, MCP-1, production is 6-fold (*p = 0.0343), 5-fold (**p = 0.0033) and 4-fold (***p = 0.0007) elevated, respectively, at day 2 p.i. in metronidazole pre-treated mice compared to untreated mice.     37  2.8 Discussion  In this study we showed that metronidazole, but not streptomycin pre-treatment results in increased severity of C. rodentium-induced colitis. Further, we confirmed that both antibiotics differentially alter the composition of the microbiota. Additionally, only metronidazole treatment resulted in altered goblet cell function and thinning of the inner mucus layer, resulting in microbial-induced immune activation prior to infection.   The intestinal mucus layer plays a key role in the maintenance of intestinal homeostasis; it protects the epithelium from dehydration, physical abrasion and invading microorganisms (Linden et al., 2008). Muc2-deficient mice, which have an altered intestinal mucus layer, are more susceptible to the development and perpetuation of DSS- and C. rodentium-induced colitis  (Bergstrom et al., 2010; van der Sluis et al., 2008, 2006) due to a closer interaction of intestinal microbes with the epithelial barrier. Recent work has also shown that most of the antimicrobial activity of the intestinal lumen localizes to the mucin layer (Johansson et al., 2009), attesting to its role as a barrier to bacterial penetration of the epithelium. The thickness of the inner mucus layer varies along the length of the intestinal tract, and is thickest in the most distal portion (Atuma et al., 2001), which also harbors the highest concentrations of bacteria. We have shown here that metronidazole-induced changes in the microbiota composition associate with a decrease in Muc2 production and reduction of the inner mucus layer in the distal colon. The metronidazole-induced reduction in the Bacteroidales order within the Bacteroides phylum is particularly interesting; members of the Bacteroidetes phylum, specifically Bacteroides thetaiotaomicron, have been shown to be important colonizers and grazers of the outer mucus layer in humans (Kline et al., 2009; Martens et al., 2009; Sonnenburg et al., 2004). Degradation of these mucin peptides and O-linked glycans serves as an energy source for the intestinal  38  microbiota and consequently results in the production of short-chain fatty acids such as acetate and butyrate (Dharmani et al., 2009), which are able to diffuse through the inner mucus layer and stimulate the underlying epithelial cells to produce Muc2 (Burger-van Paassen et al., 2009). The mechanism by which metronidazole treatment causes a reduction in the expression of Muc2 may be by breaking up an important feedback mechanism between commensal utilization of mucins and host-production of mucins. A recent study has shown that metronidazole treatment results in thickening of the mucus layer in the proximal colon of rats (Pélissier et al., 2010). The reasons for this discrepancy with our results may be due to the different dose of metronidazole administered and area of intestinal tract studied. Additionally, although this study suggests metronidazole causes thickening of the mucus layer they have also shown a closer association of microbes with the intestinal epithelium (Pélissier et al., 2010). This closer microbe- IEC interaction would be more consistent with our findings that metronidazole causes thinning of the inner mucus layer which acts as a barrier between the microbiota and epithelium that is devoid of bacteria. They also speculated that a thickened mucus layer was associated with increased Bifidobacterium sp., however, this population of bacteria was undetectable in all treatment groups in our study.    Metronidazole treatment did not cause any overt signs of inflammation in the distal colon, however we did note an increase in the expression of both IL-25 and Reg3γ mRNA with no effect on other cytokines secreted by intestinal epithelial cells, such as TLSP. In light of previous studies (Brandl et al., 2008; Cash et al., 2006; Keilbaugh et al., 2005; Zaph et al., 2008), this is interpreted as increased stimulation of the colonic epithelium by the microbiota as a result of a depleted inner mucus layer. The increased epithelial stimulation was accompanied by recruitment of NK cells and macrophages to the lamina propria, which suggested the  39  development of a pro-inflammatory immunological tone. Our findings are consistent with similar experiments performed in Muc2 knock-out mice showing that these mice exhibit enhanced mucosal permeability and subclinical levels of chronic inflammation due to increased stimulation of epithelial cells by intestinal bacteria (Van der Sluis et al., 2006; Yang et al., 2008). C. rodentium infection of metronidazole-pretreated animals resulted in robust TNFα and IFNγ cytokine and MCP-1 chemokine production early in infection, which further strengthens the interpretation that metronidazole treatment triggers an immune homeostatic imbalance. Upon infection by C. rodentium, innate immune cells, including epithelial cells, NK cells and macrophages, respond by production of TNFα, IFNγ and MCP-1. If these cells are already stimulated and recruited prior to infection, the initial inflammatory response would be heightened as is observed in metronidazole pre-treated mice.   In keeping with the recognized roles of the mucus layer, the reduction in thickness may have allowed for increased attachment of C. rodentium to the intestinal epithelium. This most likely represents a major factor contributing to the exacerbated severity of C. rodentium-induced colitis in metronidazole pre-treated animals. It has been previously shown that colonizing the outer and inner mucus layer is a key step for the pathogenesis of C. rodentium and other attaching and effacing pathogens (Bergstrom et al., 2008). However, we cannot eliminate the possibility that increased C. rodentium attachment results from the elimination of intestinal bacteria that are natural competitors of C. rodentium. Metronidazole treatment resulted in the most drastic change in microbiota composition. However, if the compositional changes result in a competitive advantage and/or newly vacant niches for C. rodentium, we would have expected to detect an increase in C. rodentium burden, but this was not the case. In fact, C. rodentium colonization of the cecum, colon and mesenteric lymph nodes of metronidazole pre-treated mice  40  was equivalent to untreated mice at 6 days p.i.   Our results have serious implications with regard to the use of antibiotics in the treatment of chronic intestinal inflammatory conditions such as IBD. Metronidazole is used extensively in the treatment of IBD, with variable efficacy (Gionchetti et al., 2006; Sartor, 2004). In ulcerative colitis, metronidazole has been found to be ineffective in double-blind, placebo-controlled trials, when compared to standard steroid treatment (Chapman et al., 1986; Mantzaris et al., 1994). In Crohn’s disease, the use of metronidazole is still highly controversial as it shows variable efficacy (Ambrose et al., 1985; Blichfeldt et al., 1978; Sutherland et al., 1991; Thia et al., 2009). Streptomycin treatment did not show the same effects as metronidazole thus, our data outline a scenario in which certain antibiotic treatments (e.g. metronidazole) would have an effect on both the microbial composition and immune status of the intestine. We show that metronidazole treatment has a dramatic impact on the immunological tone of the intestinal epithelium, altering goblet cell function leading to thinning of the inner mucus layer, changes that are punctuated by an increased susceptibility to enteric pathogens. Such a chain of events may very well contribute to the onset or maintenance of chronic intestinal inflammatory conditions and promote the occurrence of opportunistic enteric infections.  The difference in outcome between the streptomycin and metronidazole treatments strongly suggest that the antibiotic effects on the intestinal environment are driven by their distinct impact on the intestinal commensal population. Future studies aim to elucidate the mechanism by which the microbiota may control or influence goblet cell function and mucus production in the intestine.    41  2.9 Summary   This chapter demonstrates that metronidazole, but not streptomycin pre-treatment results in increased severity of C. rodentium-induced colitis. Furthermore, I show that a specific shift in the microbiota composition caused by metronidazole treatment results in intestinal homeostatic imbalance, defined here by increased epithelial cell stimulation and cellular recruitment in the colon. Interestingly, metronidazole treatment also caused diminished expression of Muc2 and thinning of the inner mucus layer, leading to an increased attachment rate of C. rodentium and increased susceptibility to colitis.    42  Chapter 3: Diet supplementation with a phytonutrient protects against enteric infection by shifting the microbiota and stimulating mucus secretion  3.1 Abstract Phytonutrients are gaining interest for their use as health promoting feed additives in animal production. However their mechanism of action and ability to alter mucosal immune responses in the intestine is unknown. We characterized the immunomodulatory function of six phytonutrients; anethol, capsicum oleoresin, carvacrol, cinnamaldehyde, eugenol, and garlicon40, all with known antimicrobial and anti-inflammatory properties. All six phytonutrients showed variable changes to expression of innate immune genes, however only eugenol was found to stimulate production of the inner mucus layer, an important mucosal barrier to promote intestinal homeostasis and prevent infection. The mechanism by which eugenol causes mucus layer thickening may involve microbial stimulation as analysis of the intestinal microbiota composition showed eugenol treatment led to increased abundance of specific families within the Clostridiales order. Eugenol treatment confers resistance to colitis induced by the attaching and effacing pathogen, Citrobacter rodentium. These results suggest that eugenol acts to strengthen the mucosal barrier by increasing the thickness of the inner mucus layer, which protects against invading pathogens and intestinal inflammation.   3.2 Introduction The animal production industry supplements livestock feed is supplemented with antibiotics to prevent bacterial infections, but they are used at a sub therapeutic dose intended to promote growth of the animals (Cho et al., 2012; Clark et al., 2012). The animals access the feed  43  on a “free choice” basis so the dosage of antibiotics received is not monitored or controlled (Love et al., 2011). Subsequently, this constant antimicrobial exposure results in selection of antibiotic-resistant microbes (both pathogenic and commensal and these microbes may gain multi-drug resistant cassettes conferring resistance to multiple antibiotics) within the animals (Love et al., 2011). Humans are then exposed to these antibiotic-resistant microbes through multiple pathways, including direct animal contact, contact with soil and water contaminated with animal waste, and lastly, consumption or handling of food products (Clark et al., 2012). This transfer of antibiotic-resistant microbes to humans has great consequences to health as many of the antibiotics or classes of antibiotics are also used to treat clinical infections in humans making certain infectious diseases difficult to cure (McEwen and Fedorka-Cray, 2002).  This controversial practice of antibiotic use in livestock feed is still in use in North America but banned in many countries around the world, including those belonging to the European Union (Clark et al., 2012). In order to change animal production practices in North America alternate strategies must be developed to promote animal health and growth comparable to what is gained with antibiotic use. A variety of plant extracts, or phytonutrients, have a history of use in traditional medicine as supplements to enhance the immune system and gain resistance to various diseases. Current research has also shown efficacy of the use of phytonutrients as feed supplements for animal production, as they have been shown to enhance immunity genes and promote growth (Makkar et al., 2007).  The supplementation of broiler chicken feed with a mixture of the phytonutrients, carvacrol (oregano extract), cinnamaldehyde (cinnamon extract) and Capsicum oleoresin (hot chili pepper extract), was shown to enhance breast muscle development (Bravo et al., 2011). In addition to developmental effects, the combination of these phytonutrients led to increased expression of genes involved in antigen presentation and the  44  humoral immune response conferring protection to coccidiosis caused by infection with Eimeria acervulina (Lillehoj et al., 2011). Further, prophylactic treatment of rats with carvacrol and eugenol (clove extract) was sufficient to protect against Candida albicans infection (Chami et al., 2004). Both carvacrol and eugenol have shown to possess anti-bacterial activity against Escherichia coli (Gaysinsky et al., 2005), eugenol was found to alter the integrity of the bacterial membrane (Gill and Holley, 2006) as well as inhibit quorum sensing (Zhou et al., 2013).  The ability of a phytonutrient to alter intestinal homeostasis and microbial composition depends on its absorption in the intestine, the ability of microbes to utilize it as a metabolic substrate, and any antimicrobial effects (Bosscher et al., 2009). We hypothesize that phytonutrients can stimulate both innate and microbial factors to protect against infection; perhaps shifting the microbial composition to promote expression of innate factors, including stimulating mucus secretion, and increasing colonization resistance. Together these effects could protect the host from enteric infections. Mucus is secreted in the intestine by specialized intestinal epithelial cells called goblet cells. In the large intestine secreted mucus forms a bi-layered structure; the inner mucus layer lies directly on top of the epithelium and acts as a barrier to microbes and the outer mucus layer is of loose composition and houses intestinal microbes. The intestinal microbiota is important for the stimulation and regulation of mucus production. Members of the Bacteroidetes phylum, specifically B. thetaiotaomicron, have been shown to be important colonizers and grazers of the outer mucus layer in humans (Kline et al., 2009; Martens et al., 2009; Sonnenburg et al., 2004). Degradation of mucin peptides and O-linked glycans serves as an energy source and consequently results in the production of short-chain fatty acids such as butyrate (Dharmani et al., 2009; Johansson et al., 2013). Butyrate production has been implicated in a feedback mechanism that is involved in upregulating mucus production by  45  epithelial cells, providing additional attachment sites (Brown et al., 2003; Burger-van Paassen et al., 2009). In order to outcompete the microbiota, enteric pathogens must acquire more effective strategies to bind to carbohydrates decorating intestinal mucus.  In this study, we explore the ability of six phytonutrients: anethol (fennel extract), capsicum oleoresin (hot chili pepper extract), carvacrol (oregano extract), cinnamaldehyde (cinnamon extract), eugenol (clove extract), and garlicon40 (garlic extract) to modulate intestinal immune responses. Furthermore, we define a novel mode of action of eugenol that involves stimulating mucus production increasing the thickness of the inner mucus layer, and shifting the composition of the intestinal microbiota leading to increased resistance to an enteric pathogen.   3.3 Methods and materials  3.3.1 Mice 8 to 10 week old C57BL/6 female mice (Jackson Laboratory, Bar Harbor, ME) were housed in the animal facility at the University of British Columbia (UBC) in accordance with guidelines of the UBC Animal Care Committee and the Canadian Council on the use of Laboratory Animals. Mice were fed a standard sterile chow diet (Laboratory Rodent Diet 5001, Purina Mils, St. Louis, Missouri) ad libitum throughout experiments. Phytonutrient treated mice were given 13.3 ug/mL of the phytonutrient in drinking water for 7 days. Phytonutrients were provided by Pancosma Inc.  Antibiotic treated mice were given metronidazole (Sigma) at 750 mg/L in drinking water for 4 days. Untreated, control, mice received sterilized water. After 7 days, mice were infected with phytonutrient treatment continuing for the duration of the infection or euthanized and tissues harvested.  46  3.3.2 Tissue collection Uninfected mice, or mice at day 3 or 7 post infection (p.i.), were euthanized by CO2 asphyxiation and their spleen and large intestines dissected for further analysis. The large intestine was divided into cecum and colon. The piece of the distal colon collected for subsequent studies was the terminal 5 mm. Tissues were immediately placed in 10% neutral buffered formalin for histological studies, ethanol–Carnoy’s fixative for mucin studies, or frozen at -20ºC for subsequent microbial composition analysis.  3.3.3 RNA isolation and cDNA synthesis The terminal 2-3 mm of the colon were excised, immediately submerged in RNAlater™ (Qiagen) and stored at 4ºC overnight and then at -80ºC for subsequent RNA extraction. RNA was extracted using RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions. RNA concentration was determined using a NanoDrop ND-1000 (NanoDrop Technologies, Wilmington, DE, USA) and reverse transcription was performed with the Quantitect RT kit (Qiagen) using 1 µg RNA as template.  3.3.4 Real time polymerase chain reaction Real-time PCR was performed using Quantitect SYBR-Green Mastermix (Qiagen) and QuantiTect Reg3γ and IL-33 primers (Qiagen) in addition to the primers listed in Table 3.1. PCR was performed on an Opticon 2 (Bio-Rad) and cycles consisted of 95°C for 15 min and 40 cycles of 94°C for 15 s, 60°C for 30s and 72°C for 30s. Glyceraldehyde-phosphate-dehydrogenase (GAPDH) was used for normalization. The fold difference in expression was calculated as 2-∆∆C(t).    47  Table 3.1 Primer sequences for host mucin and inflammatory gene expression analysis Target Primer Sequence Muc2  MUC2-F GCTGACGAGTGGTTGGTGAATG MUC2-R GATGAGGTGGCAGACAGGAGAC Muc3 MUC3-F CGTGGTCAACTGCGAGAATGG MUC3-R CGGCTCTATCTCTACGCTCTCC IFNγ IFNγ-F TCAAGTGGCATAGATGTGGAAGAA IFNγ-R TGGCTCTGCAGGATTTTCATG TFF3 TFF3-F CCTGGTTGCTGGGTCCTCTG TFF3-R GCCACGGTTGTTACACTGCTC GAPDH GAPDH-F ATTGTCAGCAATGCATCCTG GAPDH-R ATGGACTGTGGTCATGAGCC  3.3.5 Measurements of mucus thickness ex vivo The terminal 5 mm of the colon were excised, immediately submerged in ethanol–Carnoy’s fixative at 4°C for 2 hours and then placed into 100% ethanol. Fixed colon tissues were embedded in paraffin and cut into 5 µm sections. Tissues were stained with Alcian blue/PAS.  3.3.6 Microbial analysis For composition analyses, fecal pellets from untreated, phytonutrient or antibiotic treated mice were homogenized using a bead-beating method, 60 sec at level 5  (FastPrep instrument, MP Biomedicals, Solon, OH), and total DNA was extracted (Ultra Clean Fecal DNA kit, Mo Bio Laboratories, Carlsbad, CA). 16S rRNA gene fragments were PCR amplified with nucleotide-bar-coded primer pairs 27F: 5′-AGAGTTTGATCMTGGCTCAG-3′and 510R: 5′-GWATTACCGCGGCKGCTG-3′. PCR products were gel-purified (QIAquick gel extraction kit, Qiagen, Valencia, CA). Each amplicon (100 ng) was pooled and pyrosequenced using a 454 Titanium platform (Roche, Branford, CT).  3.3.7 Bioinformatics Sequences were processed using MOTHUR according to the standard operating as previously described, accessed on July 10, 2013 (Schloss et al., 2011). Quality sequences were  48  obtained by removing sequences with; ambiguous bases, quality read length less than 200 bases and chimeras identified using chimera.uchime. Quality sequences were aligned to the silva bacterial reference alignment and operational taxonomic units (OTU) were generated using a dissimilarity cutoff of 0.03. Sequences were classified using the classify.seqs command with RDP as reference. Inverse Simpson’s diversity index was used to calculate diversity. The Bray Curtis index was used as a measure of similarity in microbial composition. Diversity, similarity and abundance of bacterial OTUs and families were compared using the Mann-Whitney U-test or student’s t-test. Bonferroni correction was applied in cases of multiple comparisons. 3.3.8 Bacterial strains and infection of mice Mice were infected by oral gavage with 0.1 mL of an overnight culture of LB containing approximately 2.5 x 108 cfu of a streptomycin-resistant derivative of C. rodentium DBS100.   3.3.9 Citrobacter rodentium CFU and cytokine determination  The colon was excised and colonic tissue was separated from fecal contents, the tissue was extensively washed in sterile PBS. Whole spleen, feces and colon tissues were collected in 1 mL of sterile PBS supplemented with complete EDTA-free protease inhibitor cocktail (Roche Diagnostics) at a final concentration recommended by the manufacturer.  Tissues were weighed, homogenized in a MixerMill 301 bead miller (Retsch) for 5 minutes at 30Hz at room temperature. Tissue homogenates were serially diluted in PBS and plated onto MacConkey Agar (Difco), incubated overnight at 37ºC, and bacterial colonies were enumerated the following day, normalizing them to the tissue weight (per gram). C. rodentium colonies were clearly identified by their unique characteristic of being round with red center and a white rim. Colon and spleen homogenates were centrifuged twice at 15,000 g for 20 min at 4°C to remove cell debris, and the supernatants were aliquoted and stored at -80°C. Cytokine levels in colon and spleen  49  homogenates were determined with the BD Cytometric Bead Array Mouse Inflammation Kit (BD Biosciences), according to the manufacturer’s recommendations, and normalized to tissue weight (per gram).  3.3.10 Immunohistochemistry Sections of 5 µm in thickness were deparaffinized and rehydrated. Antigen retrieval was performed prior to blocking and staining by placing deparaffinized, rehydrated slides in 10 mM citric acid pH 6.0 at 90-100°C for 20 min, followed by cooling to room temperature. Immunostaining was carried out using antibodies against Tir (antibody production described before (14)) antibody at 4°C overnight followed by incubation with an Alexa488-conjugated secondary antibody (Invitrogen) for 1 h at room temperature. Tissues were mounted using ProLong Gold® Antifade (Molecular Probes/Invitrogen) that contains 4’,6’-diamidino-2-phenylindole (DAPI) for DNA staining. 3.3.11 Histopathological scoring  Tissues were fixed in 10% neutral buffered formalin overnight and then placed into 70% ethanol. Fixed cecal tissues were embedded in paraffin and cut into 5 µm sections. Tissues were stained with hematoxylin and eosin (H&E), using standard techniques by the UBC Histology Laboratory. Tissue sections were assessed for pathology in four regions: lumen, surface epithelium, mucosa and submucosa. Pathology in the lumen was based on the presence of necrotic epithelial cells (0 = none; 1 = scant; 2 = moderate; 3 = dense).  The surface epithelium was scored for regenerative change (0 = none; 1 = mild; 2 = moderate; 3 = severe), desquamation (0 = no change; 1 = < 10 epithelial cells shedding per lesion; 2 = 11–20 epithelial cells shedding per lesion) and ulceration (3 = epithelial ulceration; 4 = epithelial ulceration with severe crypt destruction). The mucosa was scored for hyperplasia (scored based on crypt length/high-power  50  field averaged from four fields at 400X magnification where 0 = < 140 µm; 1 = 141–285 µm; 2 = 286–430 µm; 3 = > 431 µm) and goblet cell depletion (scored based on number of goblet cells/high-power field averaged from four fields at 400X magnification where 0 = >50; 1 = 25-50; 2 = 10-25; 3 = <10). Lastly, the submucosa was scored for edema (0 = no change; 1 = mild; 2 = moderate; 3 = profound). The maximum score that could result from this scoring is 21.  3.3.12 Statistical analysis Statistical significance was calculated by using a two-tailed Student’s t-test unless otherwise stated, with assistance from GraphPad Prism Software Version 4.00 (GraphPad Software, San Diego California USA, www.graphpad.com).  If not otherwise specified statistical significance was given as *** p-value < 0.001; ** p-value < 0.01; * p-value < 0.05; ns (not significant) p-value > 0.05. The results are expressed as the mean value with standard error of the mean (SEM), unless otherwise indicated.  3.4 Phytonutrients alter gene expression in the colon In Europe, antibiotic use as growth promoting agents has been banned which has led to growing interest to understand if phytonutrients, proven growth promoting agents, also have immunomodulatory and antibacterial functions. Due to their potential beneficial use in the feed industry and previously identified antimicrobial and anti-inflammatory properties, I characterized the immunomodulatory function of six phytonutrients, anethol, anethol, capsicum oleoresin, carvacrol, cinnamaldehyde, eugenol, and garlicon40. After treatment with each phytonutrient for 7 days, analysis of gene expression in the distal colon showed that each phytonutrient caused unique and pleiotropic changes in gene expression (Fig 3.1). Although the mode of action of these phytonutrients is still unknown, our gene expression changes suggest that phytonutrients  51  may function through multiple mechanisms. First perhaps by acting on the large intestine to strengthen mucosal defenses through the upregulation of antimicrobial peptides, including Reg3γ, and by maintaining the integrity of the important mucus barrier in the intestine by regulating mucus layer associated proteins, including Muc2 and Muc3, and intestinal trefoil factor (TFF3) which synergizes with Muc2 enhancing the protective properties of the mucus layer (Thim, 1997). Lastly, changes in cytokine gene expression, including IFNγ and IL-33, suggest that the phytonutrients may act to stimulate innate immunity. These phytonutrients could be acting directly on host cells or indirectly by causing changes in the microbial ecosystem thereby causing downstream host-expression changes.   52    Figure 3.1 Phytochemical treatment results in pleiotropic effects on intestinal gene expression Quantitative RT-PCR results shown of Reg3γ, TFF-3, IFNγ, Muc2, Muc3 and IL-33 expression in the distal colon of untreated and phytonutrient treated mice. P values are shown in the table for all graphs, n= 5 mice per group.Reg3γUntreatedAnetholCapsicum OleoresinCarvacrolCinnamaldehydeEugenolGarlicon40024681012Relative  Expression** **Muc2UntreatedAnetholCapsicum OleoresinCarvacrolCinnamaldehydeEugenolGarlicon400.00.51.01.52.0Relative  Expression****TFF-3UntreatedAnetholCapsicum OleoresinCarvacrolCinnamaldehydeEugenolGarlicon400.000.250.500.751.001.251.501.75Relative  Expression***IFNγUntreatedAnetholCapsicum OleoresinCarvacrolCinnamaldehydeEugenolGarlicon40012345Relative  Expression**UntreatedAnetholCapsicum OleoresinCarvacrolCinnamaldehydeEugenolGarlicon400.000.250.500.751.001.25Relative Expression*Muc3UntreatedAnetholCapsicum OleoresinCarvacrolCinnamaldehydeEugenolGarlicon400123Relative Expression*IL-33Reg3γUntreatedAnetholCapsicum OleoresinCarvacrolCinnamaldehydeEugenolGarlicon4001234567891011Relative  Expression** **TFF-3UntreatedAnetholCapsicum OleoresinCarvacrolCinnamaldehydeEugenolGarlicon400.000.250.500.751.001.251.501.75Relative  Expression***IFNγUntreatedAnetholCapsicum OleoresinCarvacrolCinnamaldehydeEugenolGarlicon40012345Relative  Expression**Muc2UntreatedAnetholCapsicum OleoresinCarvacrolCinnamaldehydeEugenolGarlicon400.00.51.01.52.0Relative  Expression*** *Increased expressionDecreased expressionNo change 53  3.5 Eugenol treatment stimulates the production of the inner mucus layer In chapter 2 of this thesis, I have shown that treatment with the antibiotic metronidazole causes a reduction in goblet cell gene expression and thinning of the inner mucus layer (shown in Fig 3.2) resulting in heightened susceptibility to Citrobacter rodentium infection (Wlodarska et al. 2011). Here I find that phytonutrient treatment results in various changes in goblet cell-specific genes, including TFF-3 and Muc2 (Fig 3.1), which led us to hypothesize that phytonutrients may have an effect on the integrity of the inner mucus layer in the large intestine. To verify this I visualized the inner mucus layer after 7 days of phytonutrient treatment as shown by AB/PAS stain (Fig 3.2B). Treatment with any of the phytonutrients did not cause a reduction in inner mucus layer thickness, therefore preserving this important host defense. However, eugenol treatment caused an increase in inner mucus layer thickness (Fig 3.2A, B). The inner mucus layer of untreated mice was on average 21 µm (+/- 4 µm) thick, eugenol-treated mice exhibited a significantly thicker inner mucus layer, measured to be 34 µm (+/- 6 µm) thick, an increase of 59% compared to untreated mice (Fig 3.2A). This suggests that eugenol may enhance host defense through thickening of the inner mucus layer.   54     Figure 3.2 Eugenol treatment results in thickening of the inner mucus layer (A) Quantification of inner mucin layer thickness. Distal colon sections stained with AB/PAS to visualize and quantify the inner mucus layer. The width was determined by an average of 5-10 measurements per field with 4 fields counted per tissue section. Results are averaged from one or two independent experiments, n= 5-10 mice per group. U= untreated mice. (*p = 0.038 ;***p = 0.0003) (B) AB/PAS stained ethanol-Carnoy’s fixed distal colon sections showing the inner mucin layer (white bars). i = inner mucin layer. Original magnification = 400X. UntreatedMetronidazoleAnetholCapsicum oleoresinCarvacrolCinnamaldehydeEugenolGarlicon40010203040Inner Mucus Layer Thickness (µm)****AAnethol Capsicum oleoresin Carvacrol i i iiUntreatedCinnamaldehyde Eugenol Garlicon40ii iMetronidazoleiUntreatedMetronidazoleAnetholCapsicum oleoresinCarvacrolCinnamaldehydeEugenolGarlicon40010203040 ***Inner Mucus Layer Thickness (+m)*A B 55  3.6 Eugenol significantly alters the microbial composition in the intestine and microbial changes correlate with mucus production As previously stated, metronidazole treatment results in a significant change in the inflammatory tone of the intestine, drastic changes in the microbial community and thinning of the inner mucus layer. Combining metronidazole treatment with eugenol treatment resulted in a thinner inner mucus layer, similar to metronidazole treatment alone (Fig 3.3).    Figure 3.3 Metronidazole treatment results in thinning of the inner mucus layer which is not rescued with concurrent eugenol treatment (A) Quantification of inner mucus layer thickness. Distal colon sections were fixed in ethanol-Carnoy’s fixative, embedded in paraffin and stained with AB/PAS to visualize and quantify the inner mucus layer. The inner mucus width was determined by an average of 5-10 measurements per field with 4 fields counted per tissue section. Results are from one experiments, n= 5 mice per group. U= untreated mice. (*p = 0.038, ***p = 0.0003, ***p = 0.0001) (B) AB/PAS stained ethanol-Carnoy’s fixed distal colon sections showing the inner mucin layer (white arrowheads). i = inner mucin layer. Original magnification = 400X.  Untreated MetronidazoleEugenol Eugenol+ MetronidazoleU Met Eug Met+ Eug010203040*******Inner Mucus Layer Thickness (+m)i ii iA B 56  I hypothesize that the drastic change metronidazole treatment causes to the intestinal microbiota may be trigger for depletion of the inner mucus layer and eugenol may also be utilizing a similar (but reverse) mechanism to cause thickening of the inner mucus layer. To correlate eugenol treatment with effects on the intestinal microbiome, fecal samples from eugenol, metronidazole, both metronidazole and eugenol and untreated mice were assessed by pyrosequencing the V1-V3 regions of bacterial 16S rRNA genes. After quality filtering sequences the mean number of sequences (±SE) was 1100±160.  Microbial diversity, as indicated by Simpson’s Reciprocal index (Fig 3.4), was similar in untreated and eugenol treated samples, with a striking reduction after metronidazole treatment (P<0.05). Remarkably, combinational treatment of metronidazole and eugenol resulted in increased diversity compared to metronidazole alone (P<0.005).    Figure 3.4 Microbial diversity is greatly reduced with metronidazole treatment Simpson’s Reciprocal Index of diversity was used to determine diversity of fecal communities after treatment with eugenol, metronidazole, metronidazole and eugenol or untreated mice. Data from one experiment, n= 4-7. U= untreated mice. (*p = 0.0362, **p = 0.0048)    Although eugenol treatment did not have a significant effect on the diversity of the intestinal community compared to untreated mice, it did increase the abundance of specific operational U Eug Met Met+Eug05101520Inverse Simpson Diversity*** 57  taxonomic units (OTUs) classified within the Clostridiales order, including members of the genera Marvinbrytantia, Ruminococcus, Clostridium sensu stricto, and Clostridium XI (Fig 3.5, Fig 3.6B,C), which coincide with increased mucin production. At the family level, only two bacterial families, Clostridiaceae 1 and Peptostreptococcaceae, were selectively increased with eugenol treatment (Figure 3.6B). Marvinbrytantia and Ruminococcus families were also increased in the combined treatment of eugenol and metronidazole but this increase in abundance did not coincide with increased mucus production, suggesting the increased abundance of Clostridiaceae 1 and Peptostreptococcaceae families may be responsible for stimulating mucus secretion and mucus thickening. Clostridiaceae 1 was dominated by a single OTU classified in the Clostridium sensu stricto genus and represented a large component of the eugenol treated microbiota (11.2%±3.3), whereas it was at relatively low abundance in untreated mice (0.4%±0.1).  The Peptostreptococcaceae family was also dominated by a single OTU, which was classified in the genus Clostridium XI, however the increase was less substantial (1.1%±0.4 in eugenol vs. 0.6%±0.2 in untreated). Similarity within groups, as measured by Bray Curtis index, was greater (P<0.001) for eugenol (56.8±1.8) as compared to untreated mice (34.7±4.8), which may indicate a stabilizing effect on the community (Fig 3.6A).   58   Figure 3.5 Eugenol alters the abundance of specific OTUs Heatmap showing the relative abundance of fecal bacterial OTUs that differed between mice treated with eugenol, metronidazole, combination of both or untreated mice (P<0.05). Classification scheme: p, phylum; c, class; o, order; f, family; g, genus.      p_unclassified Bacteroidetesp_unclassified Bacteroidetesg_Clostridium sensu strictog_Marvinbryantiag_Marvinbryantiag_Marvinbryantiaf_unclassified Lachnospiraceaef_unclassified Lachnospiraceaef_unclassified Lachnospiraceae f_Lachnospiraceae incertae sedisf_unclassified Lachnospiraceaef_unclassified Lachnospiraceaeg_Clostridium XIg_Ruminococcusf_unclassified Ruminococcaceaeo_unclassified Clostridialeso_Clostridialeso_unclassified Clostridialeso_unclassified Clostridiales   Untreated         Eugenol       Met   Met+Euglow                     highundetected 59    Figure 3.6 Families of the Clostridiales order are enhanced with eugenol treatment  (A) Similarity between the microbiota of untreated and eugenol treated feces was measured by Bray Curtis index and depicted in a dendogram. U= untreated, E= eugenol treated (B) The miniature phylogeny tree shows the specific families belonging to the Clostridiales order and any relevant genus’ whose abundance is increased with eugenol treatment. Brackets indicate the classification. (C) Abundances of OTUs that increased with eugenol treatment, including Clostridium sensu stricto (Eug: **p = 0.0016, Eug vs. Met+Eug: **p = 0.0062), Lachnospiraceae (*p = 0.0127, **p = 0.0043), Peptostreptococcaceae (*p = 0.0127, **p = 0.0043), and Ruminococcaceae (**p = 0.0043). Data represented as percent of total OTUs.   The combined metronidazole and eugenol treatment resulted in less dramatic alterations in microbial composition when compared to metronidazole. The addition of eugenol to metronidazole resulted in elevated levels of the Bacteroidales and Clostridiales orders compared to metronidazole alone (P<0.05). However, the two bacterial families elevated in the eugenol treatment Clostridiaceae 1 and Peptrostreptococcaceae were depleted by both metronidazole treatments (P<0.05). The inability of eugenol to induce mucin expression in the presence of metronidazole further supports the potential role of these organisms in inducing mucin expression.   60   Figure 3.7 Treatments cause differential alterations to the intestinal microbiome Family level phylogenetic classification of 16S rRNA gene frequencies in feces collected from untreated, eugenol, metronidazole or combined treatment. Those indicated with a classification level other than family level (f) could only be identified confidently to the level indicated. Classification scheme: p, phylum; c, class; o, order; f, family. Representative data is shown for each group, n= 8-4. Stars indicate significant family changes between eugenol and untreated mice (P<0.05). Rare taxa are represented by “Other”.  EugenolControlMetronidazole Metronidazole + Eugenol**_f_f_f_f_f_f_f_f_f_f_f_o_o_c_o_c_p 61  3.7 Eugenol treatment confers resistance to C. rodentium infection and reduces systemic inflammation The inner mucus layer is known to be an important host defense to enteric pathogens, including the attaching and effacing pathogen, C. rodentium, and genetic mutations that result in abrogated mucus secretion result in exacerbated disease (Bergstrom et al., 2008, 2010; Heazlewood et al., 2008; Linden et al., 2008; Van der Sluis et al., 2006). As eugenol treatment results in thickening of the inner mucus layer I investigated if this would be sufficient to confer increased colonization resistance to C. rodentium. Eugenol- treated mice show decreased C. rodentium burdens in the colon at 3 days post infection (p.i.) and in the feces at 6 days p.i. (Fig 3.8A). Further I investigated the rate of attachment of C. rodentium by determining the luminal (fecal associated) and the adherent (attached to the intestinal epithelium) burdens early in infection, at 3 days p.i.. Eugenol treatment lead to decreased attachment of C. rodentium at 3 days p.i. (Fig 3.8B). Eugenol does not have a direct antimicrobial effect on C. rodentium as growth was unaltered in Luria broth supplemented with eugenol (Fig 3.9). At the dose given to mice (denoted by 1X), eugenol does not affect growth, but at increased doses (denoted by 5X and 10X) eugenol has a direct antimicrobial effect, slowing growth (Fig 3.9).    62   Figure 3.8 Eugenol treatment results in decreased C. rodentium burdens (A) Enumeration of C. rodentium in the colon and feces at day 3 and day 6 p.i., respectively. Each data point represents one mouse. Results are pooled from two separate infections, n=10-13 per group. Significance determined using the Mann-Whitney U-test. (**p = 0.0048; *p = 0.0431) (B) Both luminal (fecal matter) and adherent (extensively washed colons) bacterial colonization is reduced in eugenol treated mice. Results are pooled from two separate experiments, n=9 per group. Significance determined using the Mann-Whitney U-test. (*p = 0.05; ***p < 0.0008) Dashed line represents detection limit. Horizontal line represents the median for each group. U= untreated.    Figure 3.9 C. rodentium growth in eugenol supplemented LB C. rodentium was grown with or without eugenol in increasing dosages, 13.3ug/mL (1X), 66.5ug/mL (5X) and 133ug/mL (10X) and growth was determined using optical density measurements every hour for 20 hours at 600nm.  3 DPI 6 DPI U Eug123456789101112LOG CFU /g colon **U Eug6789101112LOG CFU /g feces*U Eugenol U Eugenol 1234567891011LOG CFU /g Luminal Adherant*** *A B0 2 4 6 8 10 12 14 16 18 200.00.20.40.60.8HoursOptical density 600nmUntreatedEugenol 10XEugenol 5XEugenol 1X 63  To verify this decreased intestinal epithelial attachment, I performed immunostaining for the C. rodentium-derived infection marker Tir (translocated intimin receptor) on colon sections 3 days p.i. to visualize the extent of C. rodentium attachment. The results shown in figure 3.10A demonstrate that eugenol treatment inhibits C. rodentium attachment to the epithelium, resulting in significantly lower numbers of pathogen burden at the early stages of infection (Fig 3.8B), however pathological changes were minor in both untreated and eugenol- treated mice at 3 days p.i. (Fig 3.10B).   Figure 3.10 Attachment of C. rodentium is limited with eugenol treatment (A) Representative immunostaining for the C. rodentium-specific effector Tir (green) in colon, with DAPI (blue) as a counter stain, at 3 days p.i. of untreated and eugenol treated mice. Note Tir staining present at day 3 p.i. in untreated mice which is absent in eugenol treated mice. Original magnification = 100X. (B) H&E stained distal colon sections from untreated and eugenol treated mice at day 3 p.i.. Minor inflammation is evident in untreated and eugenol treated mice (top panel original magnification = 50X; bottom panel original magnification = 400X).   DAPI, TIRUntreatedEugenolA B3 DPI Untreated Eugenol50x400x 64  3.8 Discussion In this study I showed that dietary supplementation with low doses of phytonutrients are sufficient to cause changes in gene expression in the intestine. As all six phytonutrients caused dramatic changes in gene expression related to goblet cell function I complemented this screen with an investigation of mucus layer integrity. This important variable to intestinal health (mucus thickness) was assessed after treatment with all 6 phytonutrients and the only significant change was observed after treatment with eugenol, which resulted in an increase in thickness of the inner mucus layer. As germ-free mice lack a distinct intestinal mucus layer, it is clear the intestinal microbiota function to promote mucus production (Johansson et al., 2008). Thus I sought to characterize the impact eugenol had on the intestinal microbial community and found after Bray-Curtis analysis, the microbiota of eugenol treated mice clustered away from the wild-type controls, implying a significant change in community composition. The largest differences were seen in the order Clostridiales, which were enriched with eugenol treatment, and notably absent in metronidazole treated mice, which have a significant thinning of the inner mucus layer. Thus eugenol may mediate this mucus thickening effect by increasing the abundance of specific genera within the Clostridiales order. Further these changes in microbial composition and mucus secretion correlated with heightened colonization resistance to C. rodentium.   Members of the microbiota are known degraders of the outer mucus layer, feeding on the carbohydrates associated with intestinal mucins (Sonnenburg et al., 2005). The thickening of the inner mucus layer after eugenol treatment coincides with an increase in abundance of members of the Clostridiales order. This can be further narrowed to two families of bacteria, the Clostridiaceae 1 and Peptostreptococcaceae, as both did not increase in abundance with the combined treatment of metronidazole and eugenol (which does not result in mucus thickening  65  compared to eugenol alone). However both of these families were increased with eugenol treatment alone. Previous studies have found that members of the Clostridiales order, including Clostridium perfringens and Clostridium septicum, exhibit mucinase activity and can utilize associated oligosaccharides as energy sources (Deplancke et al., 2002; Macfarlane et al., 2001). As has been previously shown with Bacteroides thetaiotaomicron (Sonnenburg et al., 2005), the byproducts of this nutrient utilization could result in bacterial waste products that can stimulate the intestinal epithelium to produce more mucus. However, additional studies are needed to explore a direct relationship between Clostridiaceae 1 and Peptostreptococcaceae families and mucus secretion.   There is very little information in the literature on either the function of eugenol or characterization of its properties. Eugenol is a phenylpropene (4-Allyl-2-methoxyphenol) and previous studies have shown that it is absorbed into the tissues of rats, including the intestine (Sober et al., 1950; Weinberg et al., 1972), therefore it is possible that the effect of diet supplementation with eugenol is a direct interaction with intestinal tissue stimulating mucus secretion, independent of the microbial changes eugenol treatment induces. Future studies to assess the ability of eugenol to function as a mucus secretagogue should be done to determine the tissue specific effects of eugenol.   Eugenol treatment, likely through combined effects on the microbial composition and increased inner mucus layer thickness, resulted in decreased colonization of C. rodentium in the large intestine. Reduced colonization is likely not a consequence of bactericidal effects of eugenol as growth of C. rodentium was unchanged in Luria broth at the dose (the 1X dose) used to treat the mice. This decreased colonization was due to inhibited attachment of C. rodentium to the surface of the intestinal epithelium. In chapter 2 of this thesis, I have shown that thinning of  66  the inner mucus layer results in an increased rate of attachment by C. rodentium (Wlodarska et al., 2011). It is probable that an increase in the thickness of the inner mucus layer would delay pathogen adherence as I have seen with in vitro studies showing delayed EPEC adherence to mucus-producing T84 colonic adenocarcinoma cell line after treatment with a calcium ionophore, a known mucus secretagogue (data not shown) (McCool et al., 1990). Further, the probiotics Lactobacillus plantarum 299v and Lactobacillus rhamnosus were shown to upregulate mucus production, specifically Muc2 and Muc3, inhibiting EPEC adherence to HT-29 intestinal epithelial cells (Mack et al., 1999). Probiotics have been touted as replacements to antibiotic growth promoters by inducing a healthier intestinal environment through innate immune induction and pathogen exclusion (Bosscher et al., 2009). However, the literature regarding the use of probiotics show variable efficacy and several factors can interfere with universal use, such as the colonization ability of the probiotic in different animals, mechanism of action (can be host dependent, with significant variability), as well as stability in feed. The results presented here demonstrate that low doses of phytochemicals, specifically eugenol, could provide a working alternative or be used in conjunction with probiotics to improve intestinal health and reduce enteric pathogen burden.    3.9 Summary  In this study I have shown that low dose dietary supplementation with eugenol resulted in thickening of the inner mucus layer. This low dose treatment was able to change the configuration of the microbiota selectively increasing the abundance of the Clostridiales order, including members of the genera Marvinbrytantia, Ruminococcus, Clostridium sensu stricto and Clostridium XI. I also showed that eugenol treatment was able to inhibit adherence of C.  67  rodentium to the intestinal epithelium early in infection, a likely consequence of a thicker inner mucus layer. Future studies should focus on whether signals imparted by eugenol are a direct effect or mediated through inducing shifts in the intestinal microbiota and if the latter, characterizing the microbial signals required for mucus production.   68  Chapter 4: NLRP6 inflammasome regulates the intestinal host-microbial interface by orchestrating goblet cell-mediated mucus secretion   4.1 Abstract Mucus production by goblet cells of the large intestine serves as a crucial anti microbial protective mechanism at the interface between the eukaryotic and prokaryotic cells of the mammalian intestinal ecosystem. However, the regulatory pathways involved in goblet cell-induced mucus secretion remain largely unknown. Here I demonstrate that the NLRP6 inflammasome, a recently described regulator of colonic microbiota composition and bio-geographical distribution, is a critical orchestrator of goblet cell mucin granule exocytosis. NLRP6 deficiency leads to defective autophagy in goblet cells and abrogated mucin secretion into the large intestinal lumen. Consequently, NLRP6 inflammasome-deficient mice are unable to clear enteric pathogens from the mucosal surface, rendering them highly susceptible to persistent infection. Thus, our study identifies the first innate immune regulatory pathway governing goblet cell mucus secretion, linking non-hematopoietic inflammasome signaling to autophagy and highlighting the goblet cell as a critical innate immune player in the control of intestinal host-microbial mutualism.  4.2 Introduction Inflammasomes are cytoplasmic multi-protein complexes that are expressed in various cell lineages and orchestrate diverse functions during homeostasis and inflammation. The complexes are composed of one of several NLR proteins, such as NLRP1, NLRP3, NLRC4 and NLRP6, which function as innate sensors of endogenous or exogenous stress or damage- 69  associated molecular patterns. NLRP6 is a newly identified NLR protein that has been shown to participate in inflammasome signaling (Grenier et al., 2002) and to play critical roles in defense against infection, auto-inflammation and tumorigenesis (Anand et al., 2012; Chen et al., 2011; Elinav et al., 2011; Hu et al., 2013; Normand et al., 2011). NLRP6 is defined by a tripartite structure, resembling NLRP3, consisting of an N-terminal Pyrin domain, a central nucleotide-binding oligomerization domain, and a C-terminal leucine-rich repeat (Strowig et al., 2012). Upon sensing the relevant signal, NLRP6 is recruited to the cytosol by oligomerization of the adaptor protein, apoptosis-associated speck-like protein containing a CARD (ASC), leading to caspase-1 activation and subsequent cleavage of its major effector proinflammatory cytokine, pro-IL-18, into its biologically active form (Grenier et al., 2002). NLRP6 is highly expressed in the intestinal epithelium (Chen et al., 2011; Elinav et al., 2011; Normand et al., 2011) and thought to be expressed in myeloid cell subsets (Anand et al., 2012; Chen et al., 2011), but the signal(s) and mechanisms leading to NLRP6 downstream effects remain elusive.  It is becoming clear that NLRP6 plays critical roles in non-hematopoietic cells of the intestine, including epithelial cells, in maintaining intestinal homeostasis and a healthy intestinal microbiota. NLRP6 is essential for mucosal self-renewal and proliferation, rendering NLRP6 deficient mice more susceptible to intestinal inflammation and to chemically-induced colitis as well as increased tumor development (Chen et al., 2011; Normand et al., 2011). Further contributing to intestinal health, NLRP6 participates in the steady-state regulation of the intestinal microbiota, partly through the basal secretion of IL-18 (Elinav et al., 2011). NLRP6 deficiency leads to the development of a colitogenic microbiota that is aberrantly and intimately associated at the base of the colonic crypt, stimulating a pro-inflammatory immune response. The presence of this colitogenic microbiota was shown to be the cause of increased susceptibility  70  to chemically-induced colitis in NLRP6 deficient mice (Elinav et al., 2011). However, the mechanisms by which the absence of a single inflammasome component leads to changes in intestinal microbial community composition and biogeographical distribution remain elusive. Microbial dysbiosis resulting in mucosa-associated microbes combined with an increased susceptibility to DSS-induced colitis in NLRP6 deficient mice suggests that NLRP6 may play an important role in intestinal barrier maintenance. The primary defense against microbial and pathogen penetration into the lamina propria is the single layer of epithelial cells and its associated protective mucus layer. Goblet cells (GC), specialized intestinal epithelial cells, produce and secrete mucins, predominantly Muc2, into the intestinal lumen, thereby forming the mucus layer (Tytgat et al., 1994). Muc2-containing granules (hereby referred to as mucin granules) are stored within a highly organized array of microtubules and intermediate filaments called the theca (Forstner, 1995). Exocytosis of mucin occurs when apically oriented mucin granules fuse with the plasma membrane in a complex but not understood process (Ambort et al., 2012; Forstner, 1995). The resultant intestinal mucus layer consists of two stratified layers and plays a key role in the maintenance of intestinal homeostasis; it protects the epithelium from dehydration, physical abrasion, and commensal and invading microorganisms (Johansson et al., 2008; Linden et al., 2008). The inner mucus layer functions as a barrier and its composition is dense and devoid of the microbiota, while the outer layer is a loose matrix containing the microbiota (Johansson et al., 2008). Muc2 deficiency leads to exacerbated disease by the attaching and effacing (A/E) pathogen, Citrobacter rodentium, characterized by an increased rate of pathogen colonization and an inability to clear pathogen burdens through increased mucus secretion (Bergstrom et al., 2010; Linden et al., 2008).  71  In this study, I describe a mechanism by which NLRP6 inflammasome simultaneously influences intestinal barrier function and microbial homeostasis. NLRP6 localizes to the apical mucosal region of the intestinal epithelium with dense concentration in goblet cells, where it critically regulates mucus secretion. In mice that are deficient for NLRP6, ASC, or caspase-1, mucin granule exocytosis and resultant mucus layer formation by goblet cells is impaired, leading to increased susceptibility to enteric infection. Mechanistically, NLRP6 deficiency leads to abrogation of autophagy in goblet cells, providing a link between inflammasome activity, autophagy, mucus exocytosis, and antimicrobial barrier function.  4.3 Methods and materials  4.3.1 Mice NLRP6-/- (Elinav et al., 2011b), ASC-/- (Sutterwala et al., 2006), Casp1/11-/- (Kuida et al., 1995), Atg5+/-, IL-1R-/- and IL-18-/- (Takeda et al., 1998) mice were described in previous publications or purchased from JAX mice. All mice were backcrossed at least 10 times to C56Bl/6. WT C56Bl/6 mice were purchased from NCI. GFP-LC3 transgenic mice were obtained from Jackson laboratories and crossed with NLRP6-/- mice. All mice were specific pathogen-free, maintained under a strict 12h light cycle (lights on at 7:00am and off at 7:00pm), and given a regular chow diet (Harlan, diet #2018) ad libitum. 4.3.2 Bacterial strains and infection of mice Mice were infected by oral gavage with 0.1 mL of an overnight culture of LB containing approximately 2.5 x 108 cfu of a kanamycin-resistant, luciferase-expressing construct of C. rodentium DBS100 (ICC180).  72  4.3.3 Citrobacter rodentium CFU, antibody titers and cytokine determination Whole mouse spleen and colon tissues were collected in 1 mL of sterile PBS supplemented with complete EDTA-free protease inhibitor cocktail (Roche Diagnostics) at a final concentration recommended by the manufacturer. Tissues were weighed, homogenized in a MixerMill 301 bead miller (Retsch) for 2 minutes at room temperature. Tissue homogenates were serially diluted in PBS and plated on to LB kanamycin plates, incubated overnight at 37ºC, and bacterial colonies were enumerated the following day, normalizing them to the tissue weight (per gram). C. rodentium colonies were clearly identified by kanamycin resistance and luciferase signal. Colon homogenates were centrifuged twice at 15,000 g for 20 min at 4°C to remove cell debris, and the supernatants were aliquoted and stored at -80°C. ELISA plates were coated with whole C. rodentium, incubated with colonic or splenic lysates to determine IgA and IgG antibody titers, respectively. Cytokine levels in colon homogenates were determined with the BD Cytometric Bead Array Mouse Inflammation Kit (BD Biosciences), according to the manufacturer’s recommendations, and normalized to tissue weight (per gram).  4.3.4 Bioluminescent imaging (BLI) in vivo and ex vivo For in vivo BLI, mice were anesthetized with 1% isoflurane. Bioluminescence was quantified using Living Image software (Perkin Elmer), using 10 seconds exposure. For ex vivo BLI, colons were resected, extensively washed from all fecal matter, and immediately imaged. BLI was also used to visualize plated CFU dilutions.  4.3.5 RNA isolation and cDNA synthesis The terminal 2-3 mm of the colon were excised, immediately submerged in RNAlater™ (Qiagen) and stored at 4ºC overnight and then at -80ºC for subsequent RNA extraction. RNA was extracted using RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions.  73  RNA concentration was determined using a NanoDrop ND-1000 (NanoDrop Technologies, Wilmington, DE, USA) and reverse transcription was performed with the Quantitect RT kit (Qiagen) using 1 µg RNA as template.  4.3.6 Real-time polymerase chain reaction Real-time PCR was performed using Quantitect SYBR-Green Mastermix (Qiagen) and QuantiTect Relmß, Reg3ß and Reg3γ (Qiagen) in addition to NLRP6, IL-22, IL-18, Muc2, TFF-3, Muc1, Muc3, and Muc 4 (listed in Table 1). PCR was performed on an Opticon 2 (Bio-Rad) and cycles consisted of 95°C for 15 min and 40 cycles of 94°C for 15 s, 60°C for 30s and 72°C for 30s. Glyceraldehyde-phosphate-dehydrogenase (GAPDH) was used for normalization. The fold difference in expression was calculated as 2-∆∆C(t).  Table 4.1 Primer sequences for host inflammasome and mucin gene expression analysis Target	   Primer	   Sequence	  NLRP6	   NLRP6-­‐F	   CACACCCAGAATGAGACCAG	  NLRP6-­‐R	   GTAGCCATAAGCAGCTCCCT	  IL-­‐22	   IL-­‐22-­‐F	   GCAATCAGCTCAGCTCCTGT	  	   IL-­‐22-­‐R	   CGCCTTGATCTCTCCACTCT	  IL-­‐18	   IL-­‐18-­‐F	   CAGGCCTGACATCTTCTGCAA	  IL-­‐18-­‐R	   TCTGACATGGCAGCCATTGT	  Muc2	   Muc2-­‐F	   GCTGACGAGTGGTTGGTGAATG	  Muc2-­‐R	   GATGAGGTGGCAGACAGGAGAC	  TFF3	   TFF3-­‐F	   CCTGGTTGCTGGGTCCTCTG	  TFF3-­‐R	   GCCACGGTTGTTACACTGCTC	  Muc1	   Muc1-­‐F	   FGCAGTCCTCAGTGGCACCTC	  Muc1-­‐R	   CACCGTGGGCTACTGGAGAG	  Muc3	   Muc3-­‐F	   CGTGGTCAACTGCGAGAATGG	  Muc3-­‐R	   CGGCTCTATCTCTACGCTCTCC	  Muc4	   Muc4-­‐F	   CAGCAGCCAGTGGGGACAG	  Muc4-­‐R	   CTCAGACACAGCCAGGGAACTC	  GAPDH	   GAPDH-­‐F	   ATTGTCAGCAATGCATCCTG	  GAPDH-­‐R	   ATGGACTGTGGTCATGAGCC	    74  4.3.7 Immunofluorescence Paraffin embedded tissues, either Bouins or Carnoys-fixed, were deparaffinized and rehydrated. Antigen retrieval was performed  in 10 mM citric acid pH 6.0 at 90-100°C. Immunostaining was carried out using antibodies against Tir, Clca3 (M-53, Santa Cruz), Muc2 (H-300, Santa Cruz), MPO (Ab-1, Thermo Scientific) and CD90.1 (eBioscience) followed by incubation with an Alexa-conjugated secondary antibody (Invitrogen) or the FITC conjugated UEA-I lectin (EY laboratories). Tissues were mounted using ProLong Gold® Antifade (Molecular Probes/Invitrogen) that contains 4’,6’-diamidino-2-phenylindole (DAPI) for DNA staining.  4.3.8 In situ hybridization  Segments of the ascending colon were dissected and fixed in 4% paraformaldehyde in 1X PBS overnight at 4ºC, washed in 70% ethanol and then paraffin-embedded.  7 mm tissue sections were soaked in xylene to remove paraffin and then post-fixed for 10 min. After washing with 1X PBS, sections were digested with 3 mg/ml proteinase K at room temperature for 20 min and washed in PBS again before acetylation with 0.25% acetic anhydride in 0.1M triethanolamine/0.9% NaCl (pH 8.0) for 10 min.  Slides were then rinsed with 2X saline-sodium citrate followed by incubation in 0.66% N-ethylmaleimide for 30 min.  After rinsing in 2X saline-sodium citrate, sections were dehydrated through graded ethanols, soaked in chloroform for 2 min, rehydrated to 95% ethanol and air-dried.  Hybridization with 35S-labeled cRNA probes (sense or antisense) composed of a 412 bp segment of the mouse NLRP6 gene (representing nucleotides 63 to 474 of the mRNA) was performed as described (Wysolmerski et al., 1998). Sections were then stained by the periodic acid-Schiff technique (with Alcian blue counterstain)  75  to identify mucin-containing cells and airdried, followed by the application of photographic emulsion (Kodak NTB) and development after an exposure time of three weeks. 4.3.9 Transmission and scanning electron microscopy Mice were perfused via their left ventricles using 4% paraformaldehyde in PBS. Selected tissues were fixed in 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer pH 7.4 for 1–2 h. Samples were rinsed three times in sodium cacodylate buffer and post-fixed in 1% osmium tetroxide for 1 h, en bloc stained in 2% uranyl acetate in maleate buffer pH 5.2 for a further hour then rinsed, dehydrated, infiltrated with Epon812 resin, and baked overnight at 60 °C. Hardened blocks were cut using a Leica UltraCut UCT. 60-nm-thick sections were collected and stained using 2% uranyl acetate and lead citrate. Samples were all viewed in an FEI Tencai Biotwin TEM at 80 kV. Images were taken using Morada CCD and iTEM (Olympus) software. 4.3.10 Goblet cell and mucus layer preservation ex vivo The terminal 5 mm of the colon were excised, immediately submerged in ethanol–Carnoy’s fixative at 4°C for 2 hours and then placed into 100% ethanol. Fixed colon tissues were embedded in paraffin and cut into 5 µm sections. Tissues were stained with Alcian blue/PAS.  4.3.11 Western blot Colonic epithelial cells were isolated from the colon using an EDTA/PBS wash. Total cells were lysed with MP-40 and protease inhibitor cocktail (Roche Diagnostics). Membranes were probed with anti-LC3 (Novus Biologicals), anti-p62 (Sigma) and anti-actin then an anti-rabbit/goat-HRP antibody.  4.3.12 Histopathological scoring Tissues were fixed in Bouin’s medium and then placed into 70% ethanol. Fixed distal colon tissues were embedded in paraffin and cut into 5 µm sections. Tissues were stained with  76  hematoxylin and eosin (H&E), using standard techniques by the Yale Research Histology Laboratory. Tissue sections were assessed for pathology in four regions: lumen, surface epithelium, mucosa and submucosa. Pathology in the lumen was based on the presence of necrotic epithelial cells (0 = none; 1 = scant; 2 = moderate; 3 = dense). The surface epithelium was scored for regenerative change (0 = none; 1 = mild; 2 = moderate; 3 = severe), desquamation (0 = no change; 1 = < 10 epithelial cells shedding per lesion; 2 = 11–20 epithelial cells shedding per lesion) and ulceration (3 = epithelial ulceration; 4 = epithelial ulceration with severe crypt destruction). The mucosa was scored for hyperplasia (scored based on crypt length/high-power field averaged from four fields at 400X magnification where 0 = < 140 µm; 1 = 141–285 µm; 2 = 286–430 µm; 3 = > 431 µm) and goblet cell depletion (scored based on number of goblet cells/high-power field averaged from four fields at 400x magnification where 0 = >50; 1 = 25-50; 2 = 10-25; 3 = <10). Lastly, the submucosa was scored for edema (0 = no change; 1 = mild; 2 = moderate; 3 = profound). The maximum score that could result from this scoring is 21. 4.3.13 Statistical analysis Statistical significance was calculated by using a two-tailed Student’s t-test unless otherwise stated, with assistance from GraphPad Prism Software Version 4.00 (GraphPad Software, San Diego, California, USA). If not otherwise specified statistical significance was given as **** p-value < 0.0001; *** p-value < 0.001; ** p-value < 0.01; * p-value < 0.05; ns (not significant) p-value > 0.05. The results are expressed as the mean value with standard error of the mean (SEM), unless otherwise indicated.   77  4.4 NLRP6 inflammasome deficiency impairs host mediated enteric pathogen clearance  The NLPR6 inflammasome regulates colonic microbial ecology to allow for the maintenance of a stable community structure in the intestine	  (Elinav et al., 2011). A major cause of microbial community disruption in the intestine is enteric infection. Mice infected with Citrobacter rodentium or Salmonella enterica undergo massive changes in microbiota composition (Lupp et al., 2007; Stecher et al., 2007). To analyze whether NLRP6 plays a role in host defense against enteric infections, we tested the ability to clear C. rodentium by NLRP6-deficient mice. We used a bioluminescent variant of C. rodentium which allows for non-invasive in vivo monitoring of bacterial growth over the time course of the infection (Wiles et al., 2006). Remarkably, at day 9 p.i., Nlrp6-/- mice were extensively colonized with C. rodentium when compared to WT mice (Fig 4.1A). Total C. rodentium luminal (fecal matter only) and adherent (washed intestinal tissue only) burden of the large intestine were also significantly higher in Nlrp6-/- mice at day 15 p.i. when compared to wild-type (WT) mice (Fig 4.1B). Strikingly, at this late time-point 86% of the Nlrp6-/- mice still had C. rodentium attached to the intestinal epithelium, in contrast to 0% of WT mice (Fig 4.1B). This trend was the same regardless if WT mice were purchased from NCI (Fig 4.1B) or WT littermates (Fig 4.2).	  Nlrp6-/- mice also showed a significant increase in pathology in the distal colon at day 15 p.i. (Fig 4.1C), confirming the high intestinal burdens of C. rodentium. This increase in pathology was characterized by greater submucosal edema, more extensive damage to the surface mucosa and ulceration, and extensive regions of mucosal hyperplasia (Fig 4.1D).      78    Figure 4.1 NLRP6 protects from enhanced enteric infection WT and Nlrp6-/- mice were infected with 109 CFU of bioluminescent C. rodentium and analyzed. (A) In vivo whole body bioluminescence imaging of WT and Nlrp6-/- mice on day 9 p.i. shows increased bacterial growth in Nlrp6-/- mice. (B) Both luminal (fecal matter) and adherent (extensively washed colons) bacterial colonization is enhanced in Nlrp6-/- mice. Results are pooled from two separate experiments, n=12-14 per group. Significance determined using the Mann-Whitney U-test. (**p <= 0.0033; ****p < 0.0001) (C) H&E stained distal colon sections from WT and Nlrp6-/- mice show an increase in inflammation and crypt ulceration throughout the mucosa of Nlrp6-/- mice. Magnification = 5x, 10x; scale = 200 µm. (D) Histology damage scores from distal colon tissues of Nlrp6-/- and WT mice. Each bar represents one individual based on inflammation and damage to the submucosa, mucosa, surface epithelium and lumen.         79  Figure 4.2 WT littermates show a similar trend in C. rodentium clearance At day 17 p.i., adherent (extensively washed colons) bacterial colonization is enhanced in Nlrp6 deficient mice compared to WT littermates. Results are from a single experiments, n=6-7 per group. Significance determined using the Mann-Whitney U-test. (**p <= 0.0087)  The increased C. rodentium burden and pathology at day 15 p.i. was not accompanied by decreased production of pro-inflammatory cytokines, TNFα, IFNγ, MCP-1, and IL-6, in the colon or spleen at day 15 p.i. (Fig 4.3A). To elucidate the efficacy of the adaptive immune response in the NLRP6 deficient mice we measured C. rodentium-specific antibodies, IgA levels in the colon and IgG levels in the spleen (Fig 4.3B).   Figure 4.3 Innate and adaptive arms of the immune response to C. rodentium are intact (A) Secretion of pro-inflammatory cytokines in the colon and spleen is unchanged between WT and Nlrp6-/- mice at day 15 p.i.. Results are pooled from two separate infections of WT and Nlrp6-/- mice, n=13 and 14 respectively. (B) C. rodentium specific colonic IgA and systemic IgG titers at day 15 p.i. as determined by ELISA. Results are pooled from two separate experiments, n=9-13 per group.  050100150200250300350pg/g tissueWTNLRP6 -/-TNFα     IFNγ   MCP-1    IL-6ColonA0250500100020003000pg/g tissueWTNLRP6 -/-TNFα     IFNγ   MCP-1    IL-6Spleen0246810Reciprocal Log2 TiterWTNLRP6-/-IgAIgGBWT NLRP6-/- WT NLRP6-/-024681017 DPI  LOG CFU/gLuminal Adherant** 80   Further signaling through the IL-22 pathway and its related downstream anti-microbial peptides, including Reg3β and Reg3γ, was explored with gene expression studies and showed no differences between WT and NLRP6-/- mice (Fig 4.4). Likewise, colonic IL-1β and IL-18 mRNA levels were similar in naïve and infected WT and NLRP6-/- mice (Fig 4.4).   Figure 4.4 NLRP6 is not required for the antimicrobial response or production of inflammasome-related cytokines Quantitative RT-PCR showing expression of IL-22, antimicrobial peptides, Reg3β and Reg3γ, inflammasome-related cytokines, IL-1β and IL-18, relative to gapdh in the distal colon of WT and Nlrp6-/- mice over the course of C. rodentium infection, n= 4-9.     Cellular infiltration during the course of C. rodentium infection was determined by neutrophil and T cell numbers in the intestine, as measured by myeloperoxidase and CD90.1 immunohistochemistry, respectively. Both cell types were reactively elevated in NLRP6-/- as compared to WT mice (Fig 4.5A, B). This suggested that increased bacterial colonization in 050100150Relative Expression Day 0 Day 7 Day 15WTNLRP6-/-IL-220510200400600800Relative Expression Day 0 Day 7 Day 15WTNLRP6IL-1β0102030200040006000800010000Relative Expression Day 0 Day 7 Day 15WTNLRP6-/-Reg3β0.00.51.01.5Relative Expression Day 0 Day 7 Day 15WTNLRP6-/-IL-180102030200400600800Relative Expression Day 0 Day 7 Day 15WTNLRP6-/-Reg3γ 81  Nlrp6-/- mice was not a result of an ineffective immune response to the pathogen, but rather by an alternate non-hematopoietic cell-mediated mechanism.  Figure 4.5 NLPR6 is not required for cellular recruitment in response to infection Immunofluorescence analysis of (A) neutrophil, MPO positive cells, and (B) T-cells, CD90.1 positive cells, infiltration of distal colon sections at day 7 and 15 post infection. Total cell number was determined by enumerating all cells per 40x field with 5 fields counted per tissue section. Immunofluorescence images are representative of day 15 p.i. trends. Results are averaged from a single experiment, n= 4-6 mice per group (**p = 0.0039).  To determine whether an NLRP6 inflammasome was necessary for host defense to C. rodentium, we studied mice deficient in ASC and caspase-1 for their ability to clear C. rodentium infection. Like Nlrp6-/- mice, Asc-/- (Fig 4.6A-C) and Caspase-1/11-/- (Fig 4.7A-C) mice were unable to clear C. rodentium from the colon and remained highly colonized at day 9 p.i. compared to WT mice, which began to clear infection at day 9 p.i.. As a result, mice lacking any  82  inflammasome component featured enhanced colonic and systemic colonization with C. rodentium (Fig 4.6D, E and Fig 4.7D). Collectively, these results suggested that NLRP6 inflammasome activation is pivotal for host defense against A/E pathogen infection.  Figure 4.6 ASC recruitment is required for clearance of C. rodentium WT and Asc-/- mice were infected with 109 CFU of bioluminescent C. rodentium and analyzed on day 9 post infection. (A, B) Representative images (A) and time course quantification (B) of in vivo whole body bioluminescence imaging shows elevated bacterial growth in the intestine of Asc-/- mice. (C) Ex vivo imaging of extensively washed colonic explants shows enhanced bacterial attachment to colons of Asc-/- mice. (D, E) Bacterial plating demonstrates a higher colonic (D) and systemic (E) colonization of Asc-/- mice.    83   Figure 4.7 Caspase-1/11 activation is required for clearance of C. rodentium WT and Caspase-1/11-/- mice were infected with 109 CFU of bioluminescent C. rodentium and analyzed on day 9 post infection. (A, B) Representative images (A) and time course quantification (B) of in vivo whole body bioluminescence imaging shows elevated bacterial growth in the intestine of Caspase- 1/11-/- mice. (C) Quantification of ex vivo imaging of extensively washed colonic explants shows enhanced bacterial attachment to colons of Caspase-1/11-/- mice. (D) Bacterial plating demonstrates a higher colonic and systemic colonization of Caspase-1/11-/- mice.   4.5 NLRP6 contributes to homeostasis through regulation of goblet cell function To understand the mechanism by which NLRP6 inflammasome activity contributes to host defense to enteric infection, we sought to identify the cell type mediating this anti-pathogen response. The Flavell Laboratory has previously shown that NLRP6 is highly expressed within the non-hematopoietic intestinal compartment, especially within intestinal epithelial cells (Elinav et al., 2011, 2013). However, these cells can be further divided based on morphologic and functional differences into various subsets, including enterocytes, goblet cells, Paneth cells and intestinal stem cells. To begin our investigation of the cellular source of NLRP6 activity, we A B CD 84  performed a series of in-situ hybridization studies on colonic sections from WT, ASC-/- and Nlrp6-/- mice. We found NLRP6 to be highly expressed throughout the intestinal mucosa of WT mice, concentrated in the apical mucosal region (Fig 4.8A, upper panel), specifically in goblet cells seen as extensive probe binding in areas surrounding the theca containing mature mucin granules (Fig 4.8A, lower panel). Intestines deficient in the adaptor protein, ASC, show similar NLRP6 expression and localization pattern (Fig 4.8B), whereas Nlrp6-/- mice remained negative to this staining (Fig 4.8C). This expression pattern of NLRP6 suggested that NRLP6 contribute to mucosal defense by regulating goblet cell function and mucus production.  Figure 4.8 NLRP6 is expressed in goblet cells In situ hybridization with an NLRP6-specific probe, visible as black dots, with an H&E counter stain. The theca (housing all mucin-containing granules) within goblet cells is not stained with H&E and identified as un-stained circles allowing localization of goblet cells within the epithelium. Here the theca have been identified and are outlined with black circles. (A) Representative localization of NLRP6 in a WT distal colon section, showing that staining is concentrated in the apical region of the epithelium. Magnifications demonstrate an enrichment of NLRP6 probe binding in proximity to goblet cells. (B) As in (A), but in Asc-/- mice. (C) No nonspecific probe binding is seen in Nlrp6-/- distal colon sections.  85   Mucus secretion is critically important in host defense against multiple enteric pathogens, including the A/E family of pathogens that adhere to the host surface epithelial layer where they perform their pathogenic functions (Gill et al., 2011). As an important line of defense, the host utilizes mucus secretion as a method to prevent attachment and remove the adherent load from the mucosal surface (Bergstrom et al., 2010). To explore whether defective goblet cell-mediated mucus secretion was indeed responsible for the enhanced susceptibility of NLRP6 inflammasome deficient mice to enteric infection, we sought to characterize goblet cell function in Nlrp6 inflammasome deficient and WT mice. Intriguingly, we found that the intestinal epithelium of Nlpr6-/-, Asc-/-, and Caspase 1/11-/- mice lack a thick continuous overlaying inner mucus layer (Fig 4.9A and B, “i” inner mucus layer) and exhibit a marked goblet cell hyperplasia (Fig 4.9A, C), suggesting a dramatic functional alteration in goblet cell mucus secretion in NLRP6 inflammasome deficient mice.    86   Figure 4.9 NLRP6 inflammasome activity is required for maintaining goblet cell function A) AB/PAS stained distal colon sections showing the inner mucin layer (“i”) and goblet cells (asterisks). Magnification = 400x; scale bar = 50 µm. (B) Quantification of inner mucus layer thickness in the distal colon. Thickness was determined by an average of 5 measurements per field with 4 fields counted per tissue section. The inner mucus layer is absent in Nlrp6-/- and Asc-/- mice and significantly thinner in Caspase1/11-/- mice, n= 8, 4, and 5 mice, respectively (***p = <0.0001). (C) Quantification of goblet cell number in the distal colon. Total goblet cell number was determined by enumerating all PAS+ goblet cells per 40x field with 5 fields counted per tissue section. Nlrp6-/- (***p = 0.0001), Asc-/- (***p = 0.0001) and Caspase1/11-/- (***p = 0.0007) mice exhibit goblet cell hyperplasia, n= 8, 4, 5 mice, respectively.  Further exploring this deficiency, we used transmission electron microscopy to visualize the theca of goblet cells, which is normally packed with mucin granules. In WT mice, once the theca containing mucin granules reach the apical surface of the intestinal epithelium fusion with the epithelium occurs, releasing the stored mucins and associated proteins into the intestinal lumen (Fig 4.10A, left panel). In contrast, the distal colon of Nlrp6-/- mice featured increased accumulation of intracellular mucin granules and an apparent inability of these granules to fuse with the apical surface of the intestinal epithelium (Fig 4.10A, right panel). Likewise, mucus  87  staining of Carnoy’s solution-fixed intestinal sections with the lectin Ulex europaeus agglutinin I (UEA-1) revealed a lack of intact mucus layer and goblet cell hyperplasia in Nlrp6-/- intestinal sections (Figure 4.10B).  Figure 4.10 NLRP6 sensor is required for mucus secretion (A) Representative transmission electron microscopy images taken from colonic sections of WT and Nlrp6-/- mice, n= 4 mice per group. (B) Representative epifluorescent staining for mucus using the lectin UEA-1 (green) with DAPI (blue) as a counter stain. The inner mucin layer is absent in Nlrp6-/- mice. i = inner mucin layer. Original magnification = 200x; scale bar = 50 µm.   The abrogated mucus secretion in Nlrp6-/- mice was expected to enable increased attachment of C. rodentium during infection. To address this, we performed immunostaining for the C. rodentium-derived infection marker Tir (translocated intimin receptor) on colon sections at day 7 p.i. as a measure of C. rodentium attachment to and infection of the intestinal epithelium. In the early stages of infection in WT mice, C. rodentium primarily infected the mucosal surface (Tir-positive) but did not invade the crypts (Fig 4.11A). However, in Nlrp6-/- mice, C. rodentium was dramatically more invasive, penetrated deeper into the crypts and was found more frequently associated with goblet cells (Muc2-positive, Fig 4.11B). These results, in complete agreement with previous studies from the Flavell lab featuring commensal bacteria in close approximation to the normally near-sterile crypt base (Elinav et al., 2011), demonstrate that NLRP6 deficiency and resultant mucus alterations, result in abnormal microbial approximation A B 88  to the host mucosal surface, leading to infectious, inflammatory, metabolic, and neoplastic consequences (Chen et al., 2011; Elinav et al., 2011; Normand et al., 2011).   Figure 4.11 NLRP6 inflammasome activity is required for protection from C. rodentium invasiveness (A) Representative immunostaining for the C. rodentium effector Tir (green) and the mucus specific protein Muc2 (red) in colon, with DAPI (blue) as a counter stain, in WT and Nlrp6-/- mice at 7 days p.i. The inner mucus layer is visible in WT mice and is lacking in the Nlrp6-/- mice. Magnification = 200X; scale bar = 50 µm, i = inner mucus layer. (B) In Nlrp6-/- mice, C. rodentium (green) appears to be more invasive, as shown by deeper penetration into the crypts, which often co-localizes with muc2 (red).   To further define this observed defect in mucus secretion, transcriptional regulation of goblet cell-specific proteins including the mucins, Muc1, Muc2, Muc3 and Muc4, TFF-3, and Relmß was assessed. These proteins have defined roles in intestinal homeostasis; Muc2 is a gel-forming mucin and the main component of the intestinal mucus layer (Johansson et al., 2008), Muc1, Muc3, and Muc4 are surface bound mucins with roles in signaling and tumorigenesis, TFF3 synergizes with Muc2 to enhance the protective properties of the mucus layer (Van der Sluis et al., 2006), and Relmß has an important role in innate immunity and host defense (Artis et al., 2004; Nair et al., 2008). No reduction was seen in any goblet cell specific protein transcript levels in Nlrp6-/- mice (Fig 4.12). In fact, Relmß expression was significantly elevated in these A B 89  mice (Fig 4.12). This suggests that the deficiency in mucus production in Nlrp6-/- mice is not due to reduced transcript production. Figure 4.12 NLRP6 sensor has limited effects on goblet cell gene expression Quantitative RT-PCR results of muc1-4, tff3, relmb (*p=0.0363), and nlrp6 (*p = 0.0281), relative to gapdh expression in the distal colon of WT and Nlrp6-/- mice. Two independent experiments, results are representative from a single experiment, n=4 per group.  4.6 Distinct microbial configuration of NLRP6-deficient mice is not responsible for stalled mucus secretion Previous data has demonstrated that NLRP6 inflammasome deficient mice feature a distinct microbiota configuration, which drives a context-specific susceptibility to intestinal auto-inflammation, non-alcoholic fatty liver disease, and colorectal cancer, through several microbial-induced mechanisms (Elinav et al., 2011, 2013; Henao-Mejia et al., 2012, 2013; Hu et al., 2013). To study whether the inflammasome deficient microbiota is responsible for the altered steady-state goblet cell phenotype, we cohoused WT mice with Nlrp6-/- or Asc-/- mice. This co-housing was previously shown to induce full microbiota configuration transfer into cohoused WT mice, allowing for direct assessment of the inflammasome deficient microbiota as compared to WT microbiota in singly housed WT mice (Elinav et al., 2011). As is shown in Figure 4.13A, WT mice cohoused with NLRP6- or ASC- deficient mice featured a comparable mucus layer and goblet cell function, defined by inner mucus layer thickness (Fig 4.13B) and goblet cell number  90  (Fig 4.13C, D) to that of singly-housed WT mice, ruling out a significant microbiota contribution to the observed goblet cell impairment in NLRP6 inflammasome deficient mice.           91   Figure 4.13 Transmissible colitogenic gut microbiota of NLRP6 deficient mice is not the cause of abnormal goblet cell function and mucus secretion (A) Representative AB/PAS stained colon sections showing the inner mucus layer (i) in WT singly housed mice, WT co-housed mice with Nlrp6-/- or Asc-/- mice and Nlrp6-/- and Asc-/- mice co-housed with WT mice. WT mice show normal goblet cell number (asterisks) and inner mucus layer (i) independent of singly housed or co-housed status. Co-housing Nlrp6-/- and Asc-/- mice with WT does not rescue the defect in mucus production and goblet cell hyperplasia is maintained. Scale bar = 50 µm. (B) Quantification of inner mucus layer thickness in the distal colon. Thickness was determined by an average of 5 measurements per field with 4 fields counted per tissue section. The inner mucus layer of singly house WT mice is similar to WT mice co-housed with Nlrp6-/- mice or Asc-/- mice, n= 3 mice per group. (C, D) Co-housing WT mice with Nlrp6-/- (C) or Asc-/- (D) mice does not result in goblet cell hyperplasia as exhibited by Nlrp6-/- (C, **p = 0.0040) or Asc-/- (D, *p = 0.0279) mice cohoused with WT mice, n= 3 mice per group.   010203040Mucus Thickness (µm)WT         WT           WT   (NLRP6-/-)  (ASC-/-)B020406080100PAS+ Goblet Cells/ 40X field WT         WT       NLRP6-/-   (NLRP6-/-)   (WT)**C050100150PAS+ Goblet Cells/ 40X field WT         WT         ASC-/-     (ASC-/-)     (WT)*D 92  Likewise, mucus layer and goblet hyperplasia were normal in IL-1R-/- and IL-18-/- mice (Figure 4.14), suggesting that the primary goblet cell defect in the absence of NLPR6 was mediated by IL-1- and IL-18-independent mechanisms.  Figure 4.14 Goblet cell function and mucus secretion is independent of signaling through IL-1R and IL-18 (A) Representative AB/PAS stained colon sections showing the inner mucus layer (i) in WT, IL-1R-/- and IL-18-/- mice. Scale bar = 50 µm. (B) Quantification of inner mucus layer thickness in the distal colon. The inner mucus layer of WT mice is similar to IL-1R and IL-18 deficient mice, n= 4-6 mice per group. (C) Quantification of goblet cell number in the distal colon. Total goblet cell number was determined by enumerating all PAS+ goblet cells per 40x field with 5 fields counted per tissue section. Goblet cell number is unchanged with IL-1R or IL-18 deficiency, n= 4-6 mice per group.  4.7 NLRP6 regulates goblet cell mucus granule secretion  In addition to the lack of a continuous inner mucus layer in Nlrp6-/- mice, compared to WT mice (Fig 4.15A, “i”), clusters of mucin granule-like structures were also found in the lumen of Nlrp6-/- mice (Fig 4.15A, inset “a”). In several cases, these structures were densely packed in the intestinal lumen (Fig 4.15B, arrow). They measured 6.28µm ±0.80µm in diameter (100  93  granule clusters measured, data not shown) and were never found in WT mice. This width compares to the size of mucin-containing granules in the theca of mature goblet cells found in the mucosa, which measured 7.29µm ±2.18µm in diameter (100 theca measured, data not shown).   Figure 4.15 NLRP6 inflammasome is required for mucus granule exocytosis Representative AB/PAS stained colon sections showing the inner mucus layer (i) in WT mice. Nlrp6-/- mice show the presence of mucus granules-like structures within the lumen (inset “a”). Scale bar = 50 µm. (B) AB/PAS stained Nlrp6-/- distal colon section showing accumulation of mucus granule-like structures in the lumen (arrowhead) and an increased number of large PAS+ goblet cells (asterisks). Scale bar = 50 µm.  In order to further confirm that these structures were clusters of mucin granules, we used immunofluorescence (Fig 4.16A) and transmission electron microscopy (Fig 4.16B). Murine calcium-activated chloride channel family member 3 (mCLCA3) was previously identified as a protein exclusively associated with mucin granule membranes of intestinal goblet cells (Leverkoehne and Gruber, 2002). Immunofluorescence utilizing an anti-mCLCA3 antibody demonstrated punctate staining in the lumen of Nlrp6-/- intestinal tissue (Fig 4.16A) suggesting the presence of intact mucin granules in the lumen. In contrast, WT tissue showed punctate staining at the surface of the intestinal epithelium, where mucin granules fuse with the intestinal  94  epithelium, and some diffuse staining in the lumen (Fig 4.16A), as previously reported (Leverkoehne and Gruber, 2002). Transmission electron microscopy showed mucin granules protruding into the intestinal lumen with their membranes intact, with none of the granules found to fuse with or empty into the lumen. Furthermore, these intact membrane-bound structures were also present inside the lumen (Fig 4.16B).   Figure 4.16 Intact mucin granules are present in the lumen of NLRP6-deficient mice (A) Representative immunostaining for the goblet cell specific protein, Clca3 (green), with DAPI (blue) as a counter stain in distal colon sections. Arrowheads show diffuse staining of Clca3 in the WT lumen and punctate staining in the Nlrp6-/- lumen. Representative transmission electron microscopy images (insets a and b) show intact mucus secretion by a goblet cell in WT and dysfunctional mucus granule exocytosis and the presence of granule-like structures in Nlrp6-/- distal colon tissue. (B) Transmission electron microscopy image of the Nlrp6-/- distal colon showing protrusion of mucus granules into the lumen without mucus secretion and intact mucus granules saturating the intestinal lumen, n= 4 mice.  Utilizing scanning electron microscopy, many protruding mucin granules were observed in the intestinal epithelium of Nlrp6-/- mice (Fig 4.17A, arrows), which were rarely seen in WT mice. Further, enlargement of the mucin granule protrusions clearly shows that each is made up of multiple granules (Fig 4.17B). It is likely that these protruding mucin granules get sloughed off into the intestinal lumen via the shearing force of fecal matter passing through the intestine explaining their luminal presence in Nlrp6-/- mice.  "# 95   Figure 4.17 The intestinal surface reveals protruding mucin granules in NLRP6-deficient mice (A) Representative scanning electron microscopy images of the distal colon of WT and Nlrp6-/- mice, n= 2 mice per group. A smooth intestinal epithelium is seen in WT mice. A large number of goblet cells with mucus granules protruding into the lumen (arrowheads) are seen in Nlrp6-/- mice. (B) Enlarged scanning electron microscopy image of four goblet cells with protruding mucus granules into the Nlrp6-/- intestinal lumen.  To determine if this novel function of NLRP6 requires recruitment of members of the classical inflammasome pathway to regulate mucus secretion, we utilized transmissive (TEM) and scanning (SEM) electron microscopy to characterize the intestinal mucus layer of caspase-1/11-/- and Asc-/- mice. In agreement with the observations above, we found caspase-1/11-/- and Asc-/- mice also feature goblet cells lacking mucus secretion. Caspase-1/11-/- mice feature goblet cells with a weakly packed theca that upon fusion with the intestinal epithelium does not readily release contained mucin granules (Fig 4.18D, E). Similar to Nlrp6-/- mice, Asc-/- mice show the accumulation of densely packed goblet cells with mucus granules protruding into the intestinal lumen without mucus secretion (Fig 4.18G). Findings similar to the Nlrp6-/- intestinal wall were evident with scanning electron microscopy in both the Caspase-1/11- and Asc-deficient intestinal epithelium (4.18 F, H), suggesting that both the assembly of the inflammasome complex and recruitment of ASC are required for appropriate mucus granule fusion with the intestinal epithelium and subsequent mucus secretion.  96   Figure 4.18 Members of the NLRP6 inflammasome complex, Caspase-1/11 and ASC, are required for mucus exocytosis (A, D, G) Representative transmission electron microscopy images of the distal colon of WT (A), Caspase-1/11-/- (D) and Asc-/- (G) mice. Lack of visible mucus secretion in Caspase-1/11 (D) and Asc (G) deficient distal colon, n=2-4 per group. (B, E) Enlarged images demonstrate emptying of the theca by WT goblet cells (B) and smaller theca with stalled secretion in Caspase-1/11-/- (E) goblet cells. (C, F, H) Representative scanning electron microscopy images of the surface of the distal colon of WT (C), Caspase-1/11-/- (F), and Asc-/- (H) mice, n= 2 per group. Scale = 20 µm. (I) Enlarged image showing protruding mucus granules (arrow heads) in Asc-/- mice (H), scale = 20 µm.   % & '()* 97  4.8 NLRP6 inflammasome is critical for autophagy in intestinal epithelial cells We next sought to dissect the molecular pathways by which NLRP6 inflammasome signaling regulates goblet cell mucus secretion. Paneth cells are a small intestinal secretory epithelial cell subset that has been recently demonstrated to feature profound functional importance in orchestration of the small intestinal host-microbial interface by secretion of a variety of host-protective mediators. Paneth cells are normally not found within the large intestine, where the much less studied goblet cells are believed to mediate many similar host-protective secretory functions. In Paneth cells, autophagy has been shown to be critical for proper function of secretory pathways (Cadwell et al., 2008). Similar autophagy-mediated regulation of secretory pathways has been described in osteoclasts (DeSelm et al., 2011) and mast cells (Ushio et al., 2011). Furthermore, a recent proteomic study demonstrated the presence of an autophagy related protein, Atg5, in intestinal mucin granules (Rodríguez-Piñeiro et al., 2012). Moreover, mice with deletion of Atg7 in intestinal epithelial cells were recently found to feature enhanced susceptibility to C. rodentium infection (Inoue et al., 2012). To determine if defective autophagy provided the mechanistic link between NLRP6 deficiency, goblet cell dysfunction, and enhanced enteric infection, we crossbred NLRP6 deficient mice with transgenic mice systemically expressing GFP fused to LC3. LC3 functions as a marker protein for autophagosomes (Mizushima et al., 2004). During the formation of the autophagosome, the unconjugated cytosolic form of LC3 (called LC3-I) is converted to the phosphatidylethanolamine-conjugated (lipidated) form (called LC3-II) and incorporated into the membrane that is visible as discrete puncta using immunofluorescence analysis (Choi et al., 2013). In WT mice the LC3-GFP signal had a characteristic punctate staining indicative of the formation of autophagosomes (Fig 4.19).   98   Figure 4.19 NLRP6 is required for autophagosome formation in the intestinal epithelium  Representative immunofluorescence image of the WT (LC3, top panel) and NLRP6 deficient (LC3:Nlrp6-/-, bottom panel) intestinal epithelium shows abrogated autophagy in the absence of NLRP6. Goblet cells are stained with the mucus specific protein Muc2 (red), epithelial cell nuclei are indicated with DAPI (blue). Formation of autophagosomes is visualized utilizing the LC3-GFP endogenously expressed protein (green). Scale = 70 µm.    This LC3-GFP autophagosome staining was also seen localized within goblet cells (cells both Muc2- and GFP-positive, Fig 4.20A). Strikingly, in NLRP6 deficient intestinal tissue, there was a significant reduction in both punctate LC3-GFP staining, which represents formation of autophagosomes (Fig 4.20B). NLRP6 deficiency also led to reduced levels of the LC3-GFP protein and an accumulation of p62 in isolated intestinal epithelial cells (Fig 4.20C, D), indicative of diminished autophagosome formation.  99   Figure 4.20 NLRP6 deficiency leads to reduced LC3-GFP+ autophagosome formation (A) Quantitation of autophagosome formation through enumeration of LC3 puncta per 100 epithelial cells, n= 5 mice per group (***p < 0.0001). (B) Magnification of intestinal epithelial cells showing WT goblet cells (Muc2 positive; red) active in the formation of autophagosomes, seen as punctate staining with the LC3-GFP endogenous protein co-localizing with Muc2 positive cells. (C) Immunoblot analysis of total LC3-GFP, p62 and actin (loading control) proteins in isolated intestinal epithelial cells from WT LC3-GFP transgenic mice and NLRP6 deficient GFP-LC3 transgenic mice. (D) LC3-GFP band intensities in (C) were quantified using ImageJ software and normalized to actin band intensity, n= 5 mice per group (**p = 0.0067).  Endogenous LC3 is measured as two distinct proteins, LC3-I the non-lipidated and cytosolic form, and LC3-II the lipidated form that is integrated into the autophagosome membrane. The LC3-I/LC3-II levels were severely altered in Nlrp6-/- mice in intestinal epithelial cells, featuring an elevated LC3-I/LC3-II ratio and accumulation of P62 (Fig 4.21).  Assembly of the NLRP6 inflammasome was essential for autophagy to occur normally within the intestinal epithelium as both ASC-/- and Caspase-1/11-/- mice show a similar accumulation of LC3-1 and p62 as NLRP6-/- mice (Fig 4.21). An accumulation of degenerating mitochondria, unhealthy mitochondria described as lacking intact cristae and containing dense inclusion bodies of proteins, in NLRP6 deficient intestinal epithelium (Fig 4.22) further supported a defect in autophagy processes in the absence of NLRP6. Altogether, these results suggest that NLRP6 deficiency mediates profound autophagy impairment in goblet cells that, like in the functionally correlative Paneth cell, result in secretion alterations that lead to significant impairment in colonic host-microbial interactions.  "#$% 100   Figure 4.21 NLRP6 inflammasome signaling is required for autophagy in intestinal epithelial cells (A) Immunoblot analysis of total endogenous LC3-I/II, p62 and actin (loading control) proteins in isolated intestinal epithelial cells of WT, Nlrp6-/-, Asc-/- and Caspase-1/11-/- mice. (B) Accumulation of LC3-I in isolated epithelial cells from Nlrp6-/- (**p = 0.0015), Asc-/- (**p = 0.0013) and Caspase-1/11-/- (**p = 0.0025) mice. LC3-I and LC3-II band intensities were quantified and each normalized to actin band intensity using ImageJ software then % LC3-I was determined. Data represents n= 6 (WT, Nlrp6-/-, Asc-/-) or n= 4 (Caspase-1/11-/-) mice. (C) Increased abundance of p62 in Nlrp6-/- (*p = 0.0349), Asc-/- (ns, p = 0.2115) and Caspase-1/11-/- (*p = 0.0284) mice. P62 band intensity was quantified and normalized to actin band intensity using ImageJ software. Data represents n= 6 (WT, Nlrp6-/-, Asc-/-) or n= 4 (Caspase-1/11-/-) mice.    Figure 4.22 NLRP6 deficiency results in mitochondrial dysfunction Mitochondrial dysfunction was characterized in Nlrp6-/- mice as a decease in total healthy mitochondria (***p < 0.0001) and an accumulation of unhealthy (***p < 0.0001) and dense inclusion body containing (***p = 0.0002) mitochondria. Mitochondria were scored and enumerated in WT and Nlrp6-/- intestinal epithelial cells as healthy (black), unhealthy (red) and dense inclusion body containing (blue), n= 25 or 28 epithelial cells, respectively. Representative transmission electron microscopy images are shown (magnification = 11500X) and healthy (black asterisk), unhealthy (red asterisk) and dense inclusion body containing (blue asterisk) mitochondria are depicted within WT and Nlrp6-/- intestinal epithelial cells.   To definitely establish the link between inflammasome signaling and autophagy in mediating the goblet cell phenotype, we examined ATG5+/- mice for goblet cell abnormalities. Remarkably, even partial deficiency of autophagy signaling (the homozygous mice are embryonically lethal) "#$ 101  fully recapitulated the phenotype of mucus layer impairment, goblet cell hyperplasia, and secretory defects (Fig 4.23A-D), substantiating the role of autophagy downstream of inflammasome signaling as a driver of goblet cell secretory function.  Figure 4.23 Autophagy is required for goblet cell function and mucus secretion in the intestine (A) Representative AB/PAS stained colon sections showing the inner mucus layer (i) in WT mice. Atg5 heterozygous mice show reduced production of the inner mucus layer and goblet cell hyperplasia (asterisk). Scale bar = 50 µm. (B) Quantification of inner mucus layer thickness in the distal colon. Thickness was determined by an average of 5 measurements per field with 4 fields counted per tissue section. The inner mucus layer is significantly thinner in the Atg5+/- distal colon, n= 3 mice (***p = <0.0001). (C) Quantification of goblet cell number in the distal colon. Total goblet cell number was determined by enumerating all PAS+ goblet cells per 40x field with 5 fields counted per tissue section. Atg5+/- mice exhibit goblet cell hyperplasia, n= 3 mice (**p = 0.0030). (D) Transmission electron microscopy image of Atg5+/- showing reduced mucus secretion. Fusion and granule release is stalled in Atg5+/- mice.      102  4.9 Discussion I have shown that NLRP6 mRNA is highly expressed in the intestinal epithelium, specifically locating to apical regions surrounding the theca of mature goblet cells. We have not found evidence of NLRP6 mRNA expression in the submucosal colonic region, including myofibroblasts (Normand et al., 2011). Inflammasome signaling has classically been shown to mediate its immune functions through the production of pro-inflammatory cytokines, although there is recent supporting evidence that inflammasome function is also important in the biological function of a cell beyond IL-1β and IL-18 production. As an example, caspase-1/inflammasome signaling is essential in adipocyte differentiation and influencing insulin resistance in these cells (Stienstra et al., 2010). Indeed, our findings point towards an IL-1- & IL-18-independent goblet cell intrinsic function of inflammasomes in regulating granule secretion. Nevertheless, both cytokines may still play key roles in the orchestration of multiple host-microbiota and inflammatory protective mucosal responses that may integrate with the cytokine-independent inflammasome roles described herein in shaping the host responses to its environment. The exact cell and context-specific roles of IL-1 and IL-18 in contributing to the overall roles mediated by intestinal inflammasomes thus merit further studies. As of yet, there have been only very few studies exploring the immune pathways that regulate mucus secretion (Songhet et al., 2011). Here, we showed that NLRP6 is essential for baseline mucus secretion in both healthy and disease states, making it the first innate immune pathway to be implicated in regulating mucus secretion. The lack of mucus secretion and inability to form an adherent, continuous inner mucus layer would allow for close microbe-epithelium interactions in NLRP6 deficient mice, and provides an explanation for the previously described observation that the dysbiotic microbiota in Nlrp6 deficient mice is intimately  103  associated with the mucosa (Elinav et al., 2011). This impaired host-microbial interface leads to context-dependent consequences that may include transcriptional epithelial cell reprograming of CCL5 (Elinav et al., 2011), influx of bacterial products into the portal circulation upon dietary induction of the metabolic syndrome (Henao-Mejia et al., 2012), and promotion of the IL-6 signaling pathway in immune cells during inflammation-induced cancer (Hu et al., 2013). As such, the combination of environment (mediating compositional and functional microbiota alterations) and genetics (mediating mucus barrier defects through NLRP6 inflammasome deficiency), jointly drive compound ‘multi-factorial’ phenotypes such as colonic auto-inflammation, non-alcoholic steatohepatitis (NASH), and inflammation induced cancer (Chen et al., 2011; Henao-Mejia et al., 2012; Normand et al., 2011). The same alteration in the host-microbial interface may alternatively result in exacerbated infection when a pathogen, such as C. rodentium or its human correlate Enteropathogenic E. Coli, are introduced into the ecosystem. Therefore, we propose a unified model explaining how host genetic variability (manifested as susceptibility traits in some individuals) coupled with distinct environmental insults may result in seemingly unrelated and variable phenotypic consequences. In human inflammatory bowel disease, as one example, such a model may explain the wide variability in clinical manifestations, even in the lifespan of individual patients, as a variety of intestinal and extra-intestinal auto-inflammatory manifestations, susceptibility to certain infections and a tendency for neoplastic transformation (Grivennikov et al., 2010). Autophagy has been characterized as being crucial in maintaining the integrity of the Paneth cell granule exocytosis pathway (Cadwell et al., 2008). Deficiency in Atg16L1 leads to decreased number and disorganized granules, decreased lysozyme secretion, intact granules present in the crypt lumen and an abundance of degenerating mitochondria. The striking  104  similarities in the phenotype previously described for Atg16L1 deficient Paneth cells and what we have described for goblet cells in the NLRP6 deficient intestine led us to characterize autophagy in the Nlrp6-/- mice. Utilizing transgenic mice with GFP fused to LC3, we visualized the formation of autophagosomes in the intestinal epithelium, including within goblet cells. NLRP6 deficient epithelium lacked visible autophagosome formation and an altered LC3I/II ratio. This suggests that the activity of the NLRP6 inflammasome is critical for autophagy induction and activity in the intestinal epithelium. Corresponding to a reduction in the activity of autophagy in the intestine of Nlrp6-/- mice, there was an accumulation of p62 and an abundance of degenerating mitochondria, both targets of autophagy for degradation. Given the important function of autophagy in numerous secretory pathways (Cadwell et al., 2008; DeSelm et al., 2011; Ushio et al., 2011) it is likely that the mechanism by which NLRP6 deficiency leads to defective mucus granule exocytosis involves inhibition of the autophagic processes required for proper secretion of mucus granules. Such autophagy-induced regulation of goblet cell secretory functions was recently demonstrated to involve downstream reactive oxygen species signaling (Patel et al., 2013). Penetrating the inner mucus layer is essential in the pathogenesis of C. rodentium and is likely achieved by the production of virulence factors with mucinase activity (Bergstrom et al., 2010). Further, goblet cell-driven mucus secretion has been shown to be critical in resolving C. rodentium infection by dissociating adherent C. rodentium from the intestinal mucosa (Bergstrom et al., 2008, 2010). Likewise, in our study, increased susceptibility to C. rodentium in Nlrp6-/- mice is a consequence of the lack of an inner mucus layer and abrogated mucus secretion in the NLRP6 deficient mucosa. Further, NLRP6-mediated defense against this mucosal pathogen is dependent on inflammasome assembly, as deficiency in ASC and caspase-1 all  105  resulted in increased C. rodentium burdens late in infection. Notably, other NLRP6 regulatory effects may contribute to containment of intestinal infection, such as those mediated by regulation of microbiota composition A recent study has shown increased resistance of Nlrp6-/- mice to systemically administered bacterial pathogens, including Listeria monocytogenes, Salmonella Typhimurium and Escherichia coli (Anand et al., 2012). These results probably stem from differences in systemic versus local host related mechanisms of innate immune protection against invading pathogens. In a systemic bacterial infection, myeloid cells in circulation would be the primary responders to infection whereas in an intestinal bacterial infection epithelial cells would be involved in pathogen detection. It is not without precedent that inflammasome sensors have seemingly opposing functions depending on the cell type involved, with important differences in hematopoietic cells versus non-hematopoietic cells for the NLRP6 inflammasome characterized (Anand et al., 2012; Chen et al., 2011). Notably, the alteration in the mucosal anti-pathogenic immune response may be accompanied by a compensatory hyperactive systemic immune response, providing yet another example of the plasticity and adaptability of the seemingly ‘primitive’ innate immune arm (Slack et al., 2009).  4.10 Summary I have described here the first mechanism regulating mucin granule exocytosis by goblet cells in the large intestine, mediated by the NLRP6 inflammasome. NLRP6 control of mucus secretion directly affected its ability to regulate intestinal and microbial homeostasis while providing protection from enteric pathogens. Genetic deletion of NLRP6 and key components of the inflammasome signaling pathway, caspase-1 and ASC, led to stalled mucus secretion  106  characterized by protruding mucin granules. Rather than fusing into the apical basement membrane and releasing their content, they were sloughed off into the intestinal lumen in their entirety. I demonstrated that NLRP6 is important in maintaining autophagy in the intestinal epithelium, a process previously shown to be critically important in intestinal granule exocytosis pathway.           107  Chapter 5: Conclusion   Mucus production and formation of the mucus layer is a critical barrier in the large intestine. The bi-layered structure of the mucus layer provides a dual level of protection; the outer mucus layer is colonized with high numbers of the intestinal microbiota providing colonization resistance, while the dense inner mucus layer lies directly on top of the intestinal epithelium limiting microbial penetration. Colonization of the outer mucus layer by the microbiota is critical for maintaining immunological tolerance to these microbes, as antigen sampling of these mucin-microbe interactions by dendritic cells or goblet cells themselves leads to a tolerance response, defined as induction of T regulatory cells (Shan et al., 2013). During disease states in the intestine, including inflammatory disorders (e.g. IBD) or enteric infections (e.g. C. rodentium), there are extreme changes to the microbial community (Frank et al., 2007; Lupp et al., 2007). The changes in the microbial architecture of the intestine can further disrupt intestinal homeostasis and mucosal barriers, including altering mucus secretion by goblet cells. Depletion of the total microbial numbers or vacancy of previously occupied niches would weaken the colonization resistance offered by a normal microbiota, exposing the host to enteric pathogens. A depletion of the inner mucus layer weakens the barrier between microbes and host cells by reducing the physical size of the barrier and depleting the biochemical defenses through decreased concentration of antimicrobial peptides and antibodies. This would result in increased microbial stimulation to the host and vulnerability to enteric pathogens, many of which encode proteases that cleave mucin peptides and gain access to the underlying epithelium (see figure 5.1). Together this would result in a host more susceptible to aberrant inflammatory responses to  108  the microbiota and invasion by enteric pathogens, leading to inflammation that would further potentiate the changes in microbial architecture further driving the inflammatory cycle.  Figure 5.1 The mucus layer functions as an important intestinal barrier  (A) The outer mucus layer serves houses the intestinal microbiota resulting in colonization resistance to pathogens. (B) Antimicrobial peptides, secreted by enterocytes and Paneth cells along with secretory IgA can be found in the inner mucus layer together forming an additional biochemical barrier to enteric pathogens. However, some pathogens secrete proteases that cleave mucins facilitating access to the underlying epithelium. (C) Intestinal epithelial cells, including goblet cells, play a critical role in tolerance to intestinal microbes and preventing microbial translocation into the underlying lamina propria. (adapted from Gill, Wlodarska and Finlay, 2011)   Increased understanding of how goblet cells regulate mucus secretion may improve our ability to treat enteric infections and inflammatory disorders of the intestine. In this thesis, we outlined two models that contrastingly affect mucus production and secretion by goblet cells. Metronidazole treatment resulted in a thinning of the inner mucus layer whereas eugenol treatment resulted in thickening of the inner mucus layer. Interestingly, both these treatment methods were shown to coincide with changes in the intestinal microbiota.  Metronidazole- induced microbial changes were analyzed using two community analysis techniques, T-RFLP and 454 pyrosequencing with both showing similar trends. Metronidazole targets anaerobic  109  species and resulted in depletion of the obligate anaerobic Bacteroidales but aerotolerant populations, including Lactobacilli, were more abundant. The Clostridium coccoides, Marvinbrytantia, Ruminococcus, Clostridium sensu stricto and Clostridium XI genera were also depleted by metronidazole treatment. Where as low dose eugenol treatment was able to change the configuration of the microbiota in a complimentary manner to metronidazole treatment by selectively increasing the abundance of the Clostridiales order, including members of the genera Marvinbrytantia, Ruminococcus, Clostridium sensu stricto and Clostridium XI. Combined treatment with metronidazole and eugenol showed that even in a circumstance where the microbiota is drastically altered (through the dominant action of metronidazole), eugenol still promotes growth of certain members of the Clostridiales order, including Clostridium sensu stricto and Clostridium XI. This data suggests that perhaps certain microbes may have host feed back mechanisms to promote mucus secretion by goblet cells, as was previously described for B. thetaiotaomicron and butyrate production (Kline et al., 2009).   The opposing effects of metronidazole and eugenol also result in contrasting susceptibilities to enteric infection, defined by the ability of C. rodentium to colonize and infect the intestinal epithelium. Metronidazole treatment resulted in thinning of the inner mucus layer and increased rate of attachment to the epithelium by C. rodentium and increased severity of colitis. In contrast, eugenol treatment caused thickening of the inner mucus layer and inhibited adherence of C. rodentium to the intestinal epithelium early in infection. These correlative observations provide additional evidence that the inner mucus layer can be manipulated (in terms of thickness) and result in altered colonization resistance to enteric pathogens. These findings are further supported by previous studies that show the mucus layer is critical to prevent microbial driven inflammation and protection against pathogens (Bergstrom et al., 2008; Johansson et al.,  110  2008; Schwerbrock et al., 2004; van der Sluis et al., 2008).     In this thesis we demonstrated the importance of the NLRP6 inflammasome in mucin-granule exocytosis, for the first time showing the relevance of inflammasome signaling in initiation of autophagy and maintenance of goblet cell function (see figure 5.2). NLRP6 control of mucus secretion directly affects its ability to regulate intestinal and microbial homeostasis while creating a protective niche from enteric pathogens.  Figure 5.2 NLRP6 inflammasome regulation of mucus secretion (A) Assembly of the NLRP6 inflammasome is required for mucus secretion in a process that involves recruitment of autophagy. (B) NLRP6 deficiency results in stalled mucin granule secretion, preventing the formation of the inner mucus layer, resulting in intimate interaction of the intestinal microbiota with the epithelium.   Mucus secretion required not only the NLRP6 sensor, but also assembly of the inflammasome complex dependent on recruitment of the adaptor protein ASC and activation of caspase-1/11. Deficiency in any of these components led to abrogated mucus secretion characterized by protruding mucin granules into the intestinal lumen due to an inability to fuse with the apical  111  basement membrane to release their content. We suggest that goblet cells, previously regarded as passive contributors to the formation of the biophysical protective mucosal layers, may be actually active, regulatory hubs integrating signals from the host and its environment as an integral component of the innate immune response, in a process dependent on the NLRP6 inflammasome.  5.1 Limitations of interpreting microbial analyses  In chapter 2 and 3 of this thesis, I utilized two community analysis techniques, T-RFLP and 454 pyrosequencing, to determine changes in microbial composition with metronidazole and eugenol treatment. Both techniques have inherent technical challenges, including lack of complete microbiome coverage or identifying OTUs at the species level. Accepting the technical challenges, data from the 454 pyrosequencing led us to hypothesize that the Clostridiales order, including members of the genera Clostridium sensu stricto and Clostridium XI are involved in stimulating mucus secretion by goblet cells. In order to directly show this relationship, mono-colonization of GF mice would need to be used. This would allow monitoring the thickness of the inner mucus layer when GF mice are colonized with strains from the Clostridiales order compared to unrelated strains. However, mono-colonization studies also represent an artificial scenario where the complex network of interactions between microbes is eliminated. Studies have shown that mono-colonization with one commensal microbe leads to a specific host response that is altered if the commensal is pooled with another bacterial strain that occupies the same niche (Derrien et al., 2011; Kelly et al., 2004; Lee et al., 2013). Mono colonization of GF mice with Clostridia strains has shown their importance in driving T regulatory cell induction; however, recently it was shown that the extent of T regulatory cell induction correlates with the number of Clostridia strains administered, with a larger community of strains producing the  112  greatest induction of T regulatory cells (Atarashi et al., 2013). This suggests a dose-dependent interaction of the microbiota with the host; the dose is defined as the number of strains administered. Development of a technique that would allow the monitoring and manipulation of certain members within the natural or steady state microbial ecosystem would aid in our understanding of how individual microbes or group of microbes function(s) in the microbiota. 5.2 Future research directions  In chapter 3 of this thesis we showed that the phytochemical eugenol is capable of inhibiting early colonization by C. rodentium and hypothesized that this was due to the stimulatory effect of eugenol on the inner mucus layer. Our microbial analysis data showed that eugenol also causes an upregulation of specific members of the Clostridiales order so the increased mucus secretion could either be a direct (eugenol acting on goblet cells) or indirect (eugenol alters microbes which stimulate mucus secretion) effect. In vitro studies showing a direct effect of eugenol on mucus secretion by goblet cells would help elucidate the mechanism. Similarly, the antibacterial potential of eugenol needs to be more closely assessed, specifically the growth rate of C. rodentium in nutrient limiting media and any antibacterial effects on the intestinal microbiota.   In chapter 4 of this thesis, I propose a novel innate immune signaling pathway, requiring the NLRP6 inflammasome, involved in regulating mucus secretion. Further mechanistic studies to assess the ligand for the NLRP6 inflammasome and how it coordinates the detection of the microbial community, perhaps via metabolic by-products, to stimulate autophagy and the mucin-granule exocytosis pathway are of significant interest. A recent study by Patel et al. also show the dependence of mucus secretion on three pathways involving autophagy, endocytosis and ROS production by NADPH oxidases (Patel et al., 2013). It is possible that ligation of NLRP6  113  also activates autophagy in a pathway that involves endocytosis or ROS production.   Further understanding of the pathways regulating secretory function of goblet cells is critical for the development of targeted treatments for diseases that result in abrogated mucus production, such as inflammatory bowel disease. Additionally, an increased understanding of the microbes that regulate mucus secretion will be useful in the design of therapeutics that can increase the abundance of these specific species in order to stimulate production of the mucus barrier, providing prophylactic protection from microbiota-driven inflammation and enteric pathogens.   114  Bibliography Abreu, M.T. (2010). Toll-like receptor signalling in the intestinal epithelium: how bacterial recognition shapes intestinal function. Nature Reviews Immunology 10, 131–144. Amann, R.I., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R., and Stahl, D.A. (1990). Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 56, 1919–1925. Ambort, D., Johansson, M.E.V., Gustafsson, J.K., Nilsson, H.E., Ermund, A., Johansson, B.R., Koeck, P.J.B., Hebert, H., and Hansson, G.C. (2012). Calcium and pH-dependent packing and release of the gel-forming MUC2 mucin. Proc. Natl. Acad. Sci. U.S.A. 109, 5645–5650. Ambrose, N.S., Allan, R.N., Keighley, M.R., Burdon, D.W., Youngs, D., Barnes, P., and Lennard-Jones, J.E. (1985). Antibiotic therapy for treatment in relapse of intestinal Crohn’s disease. A prospective randomized study. Dis. Colon Rectum 28, 81–85. Anand, P.K., Malireddi, R.K.S., Lukens, J.R., Vogel, P., Bertin, J., Lamkanfi, M., and Kanneganti, T.-D. (2012). NLRP6 negatively regulates innate immunity and host defence against bacterial pathogens. Nature 488, 389–393. Artis, D. (2008). Epithelial-cell recognition of commensal bacteria and maintenance of immune homeostasis in the gut. Nat. Rev. Immunol. 8, 411–420. Artis, D., Wang, M.L., Keilbaugh, S.A., He, W., Brenes, M., Swain, G.P., Knight, P.A., Donaldson, D.D., Lazar, M.A., Miller, H.R.P., et al. (2004). RELMβ/FIZZ2 is a goblet cell-specific immune-effector molecule in the gastrointestinal tract. PNAS 101, 13596–13600. Arumugam, M., Raes, J., Pelletier, E., Le Paslier, D., Yamada, T., Mende, D.R., Fernandes, G.R., Tap, J., Bruls, T., Batto, J.-M., et al. (2011). Enterotypes of the human gut microbiome. Nature 473, 174–180. Atarashi, K., Tanoue, T., Oshima, K., Suda, W., Nagano, Y., Nishikawa, H., Fukuda, S., Saito, T., Narushima, S., Hase, K., et al. (2013). Treg induction by a rationally selected mixture of Clostridia strains from the human microbiota. Nature 500, 232–236. Atuma, C., Strugala, V., Allen, A., and Holm, L. (2001). The adherent gastrointestinal mucus gel layer: thickness and physical state in vivo. Am. J. Physiol. Gastrointest. Liver Physiol. 280, G922–929. Bergstrom, K.S.B., Guttman, J.A., Rumi, M., Ma, C., Bouzari, S., Khan, M.A., Gibson, D.L., Vogl, A.W., and Vallance, B.A. (2008). Modulation of intestinal goblet cell function during infection by an attaching and effacing bacterial pathogen. Infect. Immun. 76, 796–811. Bergstrom, K.S.B., Kissoon-Singh, V., Gibson, D.L., Ma, C., Montero, M., Sham, H.P., Ryz, N., Huang, T., Velcich, A., Finlay, B.B., et al. (2010). Muc2 Protects against Lethal Infectious  115  Colitis by Disassociating Pathogenic and Commensal Bacteria from the Colonic Mucosa. PLoS Pathog 6, e1000902. Biswas, D.K., and Gorini, L. (1972). The attachment site of streptomycin to the 30S ribosomal subunit. Proc. Natl. Acad. Sci. U.S.A. 69, 2141–2144. Blichfeldt, P., Blomhoff, J.P., Myhre, E., and Gjone, E. (1978). Metronidazole in Crohn’s disease. A double blind cross-over clinical trial. Scand. J. Gastroenterol. 13, 123–127. Borchers, A.T., Selmi, C., Meyers, F.J., Keen, C.L., and Gershwin, M.E. (2009). Probiotics and immunity. J. Gastroenterol. 44, 26–46. Bosscher, D., Breynaert, A., Pieters, L., and Hermans, N. (2009). Food-based strategies to modulate the composition of the intestinal microbiota and their associated health effects. J. Physiol. Pharmacol. 60 Suppl 6, 5–11. Brandl, K., Plitas, G., Mihu, C.N., Ubeda, C., Jia, T., Fleisher, M., Schnabl, B., DeMatteo, R.P., and Pamer, E.G. (2008). Vancomycin-resistant enterococci exploit antibiotic-induced innate immune deficits. Nature 455, 804–807. Bravo, D., Utterback, P., and Parsons, C.M. (2011). Evaluation of a mixture of carvacrol, cinnamaldehyde, and capsicum oleoresin for improving growth performance and metabolizable energy in broiler chicks fed corn and soybean meal. J Appl Poult Res 20, 115–120. Brown, A.J., Goldsworthy, S.M., Barnes, A.A., Eilert, M.M., Tcheang, L., Daniels, D., Muir, A.I., Wigglesworth, M.J., Kinghorn, I., Fraser, N.J., et al. (2003). The Orphan G protein-coupled receptors GPR41 and GPR43 are activated by propionate and other short chain carboxylic acids. J. Biol. Chem. 278, 11312–11319. Brown, E.M., Sadarangani, M., and Finlay, B.B. (2013). The role of the immune system in governing host-microbe interactions in the intestine. Nat Immunol 14, 660–667. Burger-van Paassen, N., Vincent, A., Puiman, P.J., van der Sluis, M., Bouma, J., Boehm, G., van Goudoever, J.B., van Seuningen, I., and Renes, I.B. (2009). The regulation of intestinal mucin MUC2 expression by short-chain fatty acids: implications for epithelial protection. Biochem. J. 420, 211–219. Cadwell, K., Liu, J.Y., Brown, S.L., Miyoshi, H., Loh, J., Lennerz, J.K., Kishi, C., Kc, W., Carrero, J.A., Hunt, S., et al. (2008). A key role for autophagy and the autophagy gene Atg16l1 in mouse and human intestinal Paneth cells. Nature 456, 259–263. Carneiro, L.A.M., and Travassos, L.H. (2013). The Interplay between NLRs and Autophagy in Immunity and Inflammation. Front Immunol 4. Carvalho, F.A., Aitken, J.D., Vijay-Kumar, M., and Gewirtz, A.T. (2012). Toll-like receptor-gut microbiota interactions: perturb at your own risk! Annu. Rev. Physiol. 74, 177–198.  116  Cash, H.L., Whitham, C.V., Behrendt, C.L., and Hooper, L.V. (2006). Symbiotic bacteria direct expression of an intestinal bactericidal lectin. Science 313, 1126–1130. Chami, F., Chami, N., Bennis, S., Trouillas, J., and Remmal, A. (2004). Evaluation of carvacrol and eugenol as prophylaxis and treatment of vaginal candidiasis in an immunosuppressed rat model. J. Antimicrob. Chemother. 54, 909–914. Chapman, R.W., Selby, W.S., and Jewell, D.P. (1986). Controlled trial of intravenous metronidazole as an adjunct to corticosteroids in severe ulcerative colitis. Gut 27, 1210–1212. Chen, G.Y., Liu, M., Wang, F., Bertin, J., and Núñez, G. (2011). A functional role for Nlrp6 in intestinal inflammation and tumorigenesis. J. Immunol. 186, 7187–7194. Cho, I., Yamanishi, S., Cox, L., Methé, B.A., Zavadil, J., Li, K., Gao, Z., Mahana, D., Raju, K., Teitler, I., et al. (2012). Antibiotics in early life alter the murine colonic microbiome and adiposity. Nature 488, 621–626. Choi, A.M.K., Ryter, S.W., and Levine, B. (2013). Autophagy in Human Health and Disease. New England Journal of Medicine 368, 651–662. Clark, S., Daly, R., Jordan, E., Lee, J., Mathew, A., and Ebner, P. (2012). Extension Education Symposium: The future of biosecurity and antimicrobial use in livestock production in the United States and the role of extension. J. Anim. Sci. 90, 2861–2872. Consortium, T.H.M.P. (2012). Structure, function and diversity of the healthy human microbiome. Nature 486, 207–214. Deng, W., Vallance, B.A., Li, Y., Puente, J.L., and Finlay, B.B. (2003). Citrobacter rodentium translocated intimin receptor (Tir) is an essential virulence factor needed for actin condensation, intestinal colonization and colonic hyperplasia in mice. Mol. Microbiol. 48, 95–115. Deplancke, B., Vidal, O., Ganessunker, D., Donovan, S.M., Mackie, R.I., and Gaskins, H.R. (2002). Selective growth of mucolytic bacteria including Clostridium perfringens in a neonatal piglet model of total parenteral nutrition. Am. J. Clin. Nutr. 76, 1117–1125. Derrien, M., Van Baarlen, P., Hooiveld, G., Norin, E., Müller, M., and de Vos, W.M. (2011). Modulation of Mucosal Immune Response, Tolerance, and Proliferation in Mice Colonized by the Mucin-Degrader Akkermansia muciniphila. Front Microbiol 2, 166. DeSelm, C.J., Miller, B.C., Zou, W., Beatty, W.L., van Meel, E., Takahata, Y., Klumperman, J., Tooze, S.A., Teitelbaum, S.L., and Virgin, H.W. (2011). Autophagy proteins regulate the secretory component of osteoclastic bone resorption. Dev. Cell 21, 966–974. Dharmani, P., Srivastava, V., Kissoon-Singh, V., and Chadee, K. (2009). Role of intestinal mucins in innate host defense mechanisms against pathogens. J Innate Immun 1, 123–135.  117  Doré, J., Sghir, A., Hannequart-Gramet, G., Corthier, G., and Pochart, P. (1998). Design and evaluation of a 16S rRNA-targeted oligonucleotide probe for specific detection and quantitation of human faecal Bacteroides populations. Syst. Appl. Microbiol. 21, 65–71. Eckburg, P.B., Bik, E.M., Bernstein, C.N., Purdom, E., Dethlefsen, L., Sargent, M., Gill, S.R., Nelson, K.E., and Relman, D.A. (2005). Diversity of the Human Intestinal Microbial Flora. Science 308, 1635–1638. Edelman, S.M., and Kasper, D.L. (2008). Symbiotic commensal bacteria direct maturation of the host immune system. Curr. Opin. Gastroenterol. 24, 720–724. Elinav, E., Strowig, T., Kau, A.L., Henao-Mejia, J., Thaiss, C.A., Booth, C.J., Peaper, D.R., Bertin, J., Eisenbarth, S.C., Gordon, J.I., et al. (2011). NLRP6 inflammasome regulates colonic microbial ecology and risk for colitis. 745–757. Elinav, E., Henao-Mejia, J., and Flavell, R.A. (2013). Integrative inflammasome activity in the regulation of intestinal mucosal immune responses. Mucosal Immunol 6, 4–13. Erdem, A.L., Avelino, F., Xicohtencatl-Cortes, J., and Giron, J.A. (2007). Host Protein Binding and Adhesive Properties of H6 and H7 Flagella of Attaching and Effacing Escherichia coli. J Bacteriol 189, 7426–7435. Forstner, G. (1995). Signal Transduction Packaging and Secretion of Mucins. Annual Review of Physiology 57, 585–605. Frank, D.N., St Amand, A.L., Feldman, R.A., Boedeker, E.C., Harpaz, N., and Pace, N.R. (2007). Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proc. Natl. Acad. Sci. U.S.A. 104, 13780–13785. Franks, A.H., Harmsen, H.J., Raangs, G.C., Jansen, G.J., Schut, F., and Welling, G.W. (1998). Variations of bacterial populations in human feces measured by fluorescent in situ hybridization with group-specific 16S rRNA-targeted oligonucleotide probes. Appl. Environ. Microbiol. 64, 3336–3345. Garrett, W.S., Lord, G.M., Punit, S., Lugo-Villarino, G., Mazmanian, S.K., Ito, S., Glickman, J.N., and Glimcher, L.H. (2007). Communicable ulcerative colitis induced by T-bet deficiency in the innate immune system. Cell 131, 33–45. Gaysinsky, S., Davidson, P.M., Bruce, B.D., and Weiss, J. (2005). Growth inhibition of Escherichia coli O157:H7 and Listeria monocytogenes by carvacrol and eugenol encapsulated in surfactant micelles. J. Food Prot. 68, 2559–2566. Gill, A.O., and Holley, R.A. (2006). Disruption of Escherichia coli, Listeria monocytogenes and Lactobacillus sakei cellular membranes by plant oil aromatics. Int. J. Food Microbiol. 108, 1–9. Gill, N., Wlodarska, M., and Finlay, B.B. (2011). Roadblocks in the gut: barriers to enteric infection. Cell. Microbiol. 13, 660–669.  118  Gionchetti, P., Rizzello, F., Lammers, K.-M., Morselli, C., Sollazzi, L., Davies, S., Tambasco, R., Calabrese, C., and Campieri, M. (2006). Antibiotics and probiotics in treatment of inflammatory bowel disease. World J. Gastroenterol. 12, 3306–3313. Grenier, J.M., Wang, L., Manji, G.A., Huang, W.J., Al-Garawi, A., Kelly, R., Carlson, A., Merriam, S., Lora, J.M., Briskin, M., et al. (2002). Functional screening of five PYPAF family members identifies PYPAF5 as a novel regulator of NF-kappaB and caspase-1. FEBS Lett. 530, 73–78. Grivennikov, S.I., Greten, F.R., and Karin, M. (2010). Immunity, inflammation, and cancer. Cell 140, 883–899. Grys, T.E., Walters, L.L., and Welch, R.A. (2006). Characterization of the StcE protease activity of Escherichia coli O157:H7. J. Bacteriol. 188, 4646–4653. Heazlewood, C.K., Cook, M.C., Eri, R., Price, G.R., Tauro, S.B., Taupin, D., Thornton, D.J., Png, C.W., Crockford, T.L., Cornall, R.J., et al. (2008). Aberrant mucin assembly in mice causes endoplasmic reticulum stress and spontaneous inflammation resembling ulcerative colitis. PLoS Med. 5, e54. Henao-Mejia, J., Elinav, E., Jin, C., Hao, L., Mehal, W.Z., Strowig, T., Thaiss, C.A., Kau, A.L., Eisenbarth, S.C., Jurczak, M.J., et al. (2012). Inflammasome-mediated dysbiosis regulates progression of NAFLD and obesity. Nature 482, 179–185. Henao-Mejia, J., Elinav, E., Thaiss, C.A., Licona-Limon, P., and Flavell, R.A. (2013). Role of the intestinal microbiome in liver disease. J. Autoimmun. 46, 66–73. Hoebler, C., Gaudier, E., De Coppet, P., Rival, M., and Cherbut, C. (2006). MUC genes are differently expressed during onset and maintenance of inflammation in dextran sodium sulfate-treated mice. Dig. Dis. Sci. 51, 381–389. Hollingsworth, M.A., and Swanson, B.J. (2004). Mucins in cancer: protection and control of the cell surface. Nat. Rev. Cancer 4, 45–60. Hooper, L.V. (2009). Do symbiotic bacteria subvert host immunity? Nat. Rev. Microbiol. 7, 367–374. Hu, B., Elinav, E., Huber, S., Strowig, T., Hao, L., Hafemann, A., Jin, C., Eisenbarth, S.C., and Flavell, R.A. (2013). Microbiota-induced activation of epithelial IL-6 signaling links inflammasome-driven inflammation with transmissible cancer. Proc. Natl. Acad. Sci. U.S.A. 110, 9862–9867. Inoue, J., Nishiumi, S., Fujishima, Y., Masuda, A., Shiomi, H., Yamamoto, K., Nishida, M., Azuma, T., and Yoshida, M. (2012). Autophagy in the intestinal epithelium regulates Citrobacter rodentium infection. Arch. Biochem. Biophys. 521, 95–101.  119  Ivanov, I.I., Frutos, R. de L., Manel, N., Yoshinaga, K., Rifkin, D.B., Sartor, R.B., Finlay, B.B., and Littman, D.R. (2008). Specific microbiota direct the differentiation of IL-17-producing T-helper cells in the mucosa of the small intestine. Cell Host Microbe 4, 337–349. Johansson, M.E.V., Phillipson, M., Petersson, J., Velcich, A., Holm, L., and Hansson, G.C. (2008). The inner of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria. Proc. Natl. Acad. Sci. U.S.A. 105, 15064–15069. Johansson, M.E.V., Thomsson, K.A., and Hansson, G.C. (2009). Proteomic analyses of the two mucus layers of the colon barrier reveal that their main component, the Muc2 mucin, is strongly bound to the Fcgbp protein. J. Proteome Res. 8, 3549–3557. Johansson, M.E.V., Sjövall, H., and Hansson, G.C. (2013). The gastrointestinal mucus system in health and disease. Nat Rev Gastroenterol Hepatol 10, 352–361. Keilbaugh, S.A., Shin, M.E., Banchereau, R.F., McVay, L.D., Boyko, N., Artis, D., Cebra, J.J., and Wu, G.D. (2005). Activation of RegIIIbeta/gamma and interferon gamma expression in the intestinal tract of SCID mice: an innate response to bacterial colonisation of the gut. Gut 54, 623–629. Kelly, D., Campbell, J.I., King, T.P., Grant, G., Jansson, E.A., Coutts, A.G.P., Pettersson, S., and Conway, S. (2004). Commensal anaerobic gut bacteria attenuate inflammation by regulating nuclear-cytoplasmic shuttling of PPAR-gamma and RelA. Nat. Immunol. 5, 104–112. Khor, B., Gardet, A., and Xavier, R.J. (2011). Genetics and pathogenesis of inflammatory bowel disease. Nature 474, 307–317. Kline, K.A., Fälker, S., Dahlberg, S., Normark, S., and Henriques-Normark, B. (2009). Bacterial adhesins in host-microbe interactions. Cell Host Microbe 5, 580–592. Van Klinken, B.J., Dekker, J., Büller, H.A., and Einerhand, A.W. (1995). Mucin gene structure and expression: protection vs. adhesion. Am. J. Physiol. 269, G613–627. Kuida, K., Lippke, J.A., Ku, G., Harding, M.W., Livingston, D.J., Su, M.S., and Flavell, R.A. (1995). Altered cytokine export and apoptosis in mice deficient in interleukin-1 beta converting enzyme. Science 267, 2000–2003. Kumar, A., Wu, H., Collier-Hyams, L.S., Kwon, Y.-M., Hanson, J.M., and Neish, A.S. (2009). The bacterial fermentation product butyrate influences epithelial signaling via reactive oxygen species-mediated changes in cullin-1 neddylation. J. Immunol. 182, 538–546. Langendijk, P.S., Schut, F., Jansen, G.J., Raangs, G.C., Kamphuis, G.R., Wilkinson, M.H., and Welling, G.W. (1995). Quantitative fluorescence in situ hybridization of Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes and its application in fecal samples. Appl. Environ. Microbiol. 61, 3069–3075.  120  Larsson, J.M.H., Karlsson, H., Crespo, J.G., Johansson, M.E.V., Eklund, L., Sjövall, H., and Hansson, G.C. (2011). Altered O-glycosylation profile of MUC2 mucin occurs in active ulcerative colitis and is associated with increased inflammation. Inflamm. Bowel Dis. 17, 2299–2307. Lee, S.M., Donaldson, G.P., Mikulski, Z., Boyajian, S., Ley, K., and Mazmanian, S.K. (2013). Bacterial colonization factors control specificity and stability of the gut microbiota. Nature 501, 426–429. Lepage, P., Seksik, P., Sutren, M., de la Cochetière, M.-F., Jian, R., Marteau, P., and Doré, J. (2005). Biodiversity of the mucosa-associated microbiota is stable along the distal digestive tract in healthy individuals and patients with IBD. Inflamm. Bowel Dis. 11, 473–480. Leverkoehne, I., and Gruber, A.D. (2002). The murine mCLCA3 (alias gob-5) protein is located in the mucin granule membranes of intestinal, respiratory, and uterine goblet cells. J. Histochem. Cytochem. 50, 829–838. Lidell, M.E., Moncada, D.M., Chadee, K., and Hansson, G.C. (2006). Entamoeba histolytica cysteine proteases cleave the MUC2 mucin in its C-terminal domain and dissolve the protective colonic mucus gel. Proc. Natl. Acad. Sci. U.S.A. 103, 9298–9303. Lillehoj, H.S., Kim, D.K., Bravo, D.M., and Lee, S.H. (2011). Effects of dietary plant-derived phytonutrients on the genome-wide profiles and coccidiosis resistance in the broiler chickens. BMC Proc 5, 1–8. Linden, S.K., Sutton, P., Karlsson, N.G., Korolik, V., and McGuckin, M.A. (2008). Mucins in the mucosal barrier to infection. Mucosal Immunol 1, 183–197. Louis, P., and Flint, H.J. (2009). Diversity, metabolism and microbial ecology of butyrate-producing bacteria from the human large intestine. FEMS Microbiol. Lett. 294, 1–8. Love, D.C., Davis, M.F., Bassett, A., Gunther, A., and Nachman, K.E. (2011). Dose Imprecision and Resistance: Free-Choice Medicated Feeds in Industrial Food Animal Production in the United States. Environ Health Perspect 119, 279–283. Lupp, C., Robertson, M.L., Wickham, M.E., Sekirov, I., Champion, O.L., Gaynor, E.C., and Finlay, B.B. (2007). Host-mediated inflammation disrupts the intestinal microbiota and promotes the overgrowth of Enterobacteriaceae. Cell Host Microbe 2, 204. Macfarlane, S., Hopkins, M.J., and Macfarlane, G.T. (2001). Toxin Synthesis and Mucin Breakdown Are Related to Swarming Phenomenon in Clostridium septicum. Infect. Immun. 69, 1120–1126. Mack, D.R., Michail, S., Wei, S., McDougall, L., and Hollingsworth, M.A. (1999). Probiotics inhibit enteropathogenic E. coli adherence in vitro by inducing intestinal mucin gene expression. Am. J. Physiol. 276, G941–950.  121  Makkar, H.P.S., Francis, G., and Becker, K. (2007). Bioactivity of phytochemicals in some lesser-known plants and their effects and potential applications in livestock and aquaculture production systems. Animal 1, 1371–1391. Makkink, M.K., Schwerbrock, N.M.J., Mähler, M., Boshuizen, J.A., Renes, I.B., Cornberg, M., Hedrich, H.J., Einerhand, A.W.C., Büller, H.A., Wagner, S., et al. (2002). Fate of goblet cells in experimental colitis. Dig. Dis. Sci. 47, 2286–2297. Mantzaris, G.J., Hatzis, A., Kontogiannis, P., and Triadaphyllou, G. (1994). Intravenous tobramycin and metronidazole as an adjunct to corticosteroids in acute, severe ulcerative colitis. Am. J. Gastroenterol. 89, 43–46. Martens, E.C., Roth, R., Heuser, J.E., and Gordon, J.I. (2009). Coordinate regulation of glycan degradation and polysaccharide capsule biosynthesis by a prominent human gut symbiont. J. Biol. Chem. 284, 18445–18457. Mazmanian, S.K., Round, J.L., and Kasper, D.L. (2008). A microbial symbiosis factor prevents intestinal inflammatory disease. Nature 453, 620–625. McCool, D.J., Marcon, M.A., Forstner, J.F., and Forstner, G.G. (1990). The T84 human colonic adenocarcinoma cell line produces mucin in culture and releases it in response to various secretagogues. Biochem. J. 267, 491–500. McEwen, S.A., and Fedorka-Cray, P.J. (2002). Antimicrobial use and resistance in animals. Clin. Infect. Dis. 34 Suppl 3, S93–S106. McGuckin, M.A., Lindén, S.K., Sutton, P., and Florin, T.H. (2011). Mucin dynamics and enteric pathogens. Nat. Rev. Microbiol. 9, 265–278. Mennigen, R., Nolte, K., Rijcken, E., Utech, M., Loeffler, B., Senninger, N., and Bruewer, M. (2009). Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am. J. Physiol. Gastrointest. Liver Physiol. 296, G1140–1149. Mizushima, N., Yamamoto, A., Matsui, M., Yoshimori, T., and Ohsumi, Y. (2004). In vivo analysis of autophagy in response to nutrient starvation using transgenic mice expressing a fluorescent autophagosome marker. Mol. Biol. Cell 15, 1101–1111. Mundy, R., MacDonald, T.T., Dougan, G., Frankel, G., and Wiles, S. (2005). Citrobacter rodentium of mice and man. Cell. Microbiol. 7, 1697–1706. Nair, M.G., Guild, K.J., Du, Y., Zaph, C., Yancopoulos, G.D., Valenzuela, D.M., Murphy, A., Stevens, S., Karow, M., and Artis, D. (2008). Goblet cell-derived resistin-like molecule beta augments CD4+ T cell production of IFN-gamma and infection-induced intestinal inflammation. J. Immunol. 181, 4709–4715.  122  Navarro-Garcia, F., Gutierrez-Jimenez, J., Garcia-Tovar, C., Castro, L.A., Salazar-Gonzalez, H., and Cordova, V. (2010). Pic, an autotransporter protein secreted by different pathogens in the Enterobacteriaceae family, is a potent mucus secretagogue. Infection and Immunity 78, 4101–4109. Normand, S., Delanoye-Crespin, A., Bressenot, A., Huot, L., Grandjean, T., Peyrin-Biroulet, L., Lemoine, Y., Hot, D., and Chamaillard, M. (2011). Nod-like receptor pyrin domain-containing protein 6 (NLRP6) controls epithelial self-renewal and colorectal carcinogenesis upon injury. Proc. Natl. Acad. Sci. U.S.A. 108, 9601–9606. Patel, K.K., Miyoshi, H., Beatty, W.L., Head, R.D., Malvin, N.P., Cadwell, K., Guan, J.-L., Saitoh, T., Akira, S., Seglen, P.O., et al. (2013). Autophagy proteins control goblet cell function by potentiating reactive oxygen species production. EMBO J. 32, 3130–3144. Pédron, T., and Sansonetti, P. (2008). Commensals, bacterial pathogens and intestinal inflammation: an intriguing ménage à trois. Cell Host Microbe 3, 344–347. Pélissier, M.-A., Vasquez, N., Balamurugan, R., Pereira, E., Dossou-Yovo, F., Suau, A., Pochart, P., and Magne, F. (2010). Metronidazole effects on microbiota and mucus layer thickness in the rat gut. FEMS Microbiol. Ecol. 73, 601–610. Rakoff-Nahoum, S., and Medzhitov, R. (2008). Innate immune recognition of the indigenous microbial flora. Mucosal Immunol 1 Suppl 1, S10–14. Rinttilä, T., Kassinen, A., Malinen, E., Krogius, L., and Palva, A. (2004). Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J. Appl. Microbiol. 97, 1166–1177. Rodríguez-Piñeiro, A.M., Post, S. van der, Johansson, M.E.V., Thomsson, K.A., Nesvizhskii, A.I., and Hansson, G.C. (2012). Proteomic study of the mucin granulae in an intestinal goblet cell model. J. Proteome Res. 11, 1879–1890. Round, J.L., and Mazmanian, S.K. (2009). The gut microbiota shapes intestinal immune responses during health and disease. Nat. Rev. Immunol. 9, 313–323. Salzman, N.H., Underwood, M.A., and Bevins, C.L. (2007). Paneth cells, defensins, and the commensal microbiota: a hypothesis on intimate interplay at the intestinal mucosa. Semin. Immunol. 19, 70–83. Sartor, R.B. (2004). Therapeutic manipulation of the enteric microflora in inflammatory bowel diseases: antibiotics, probiotics, and prebiotics. Gastroenterology 126, 1620–1633. Scanlan, P.D., Shanahan, F., Clune, Y., Collins, J.K., O’Sullivan, G.C., O’Riordan, M., Holmes, E., Wang, Y., and Marchesi, J.R. (2008). Culture-independent analysis of the gut microbiota in colorectal cancer and polyposis. Environ. Microbiol. 10, 789–798.  123  Schloss, P.D., Gevers, D., and Westcott, S.L. (2011). Reducing the Effects of PCR Amplification and Sequencing Artifacts on 16S rRNA-Based Studies. PLoS ONE 6, e27310. Schwerbrock, N.M.J., Makkink, M.K., van der Sluis, M., Büller, H.A., Einerhand, A.W.C., Sartor, R.B., and Dekker, J. (2004). Interleukin 10-deficient mice exhibit defective colonic Muc2 synthesis before and after induction of colitis by commensal bacteria. Inflamm. Bowel Dis. 10, 811–823. Searle, A.J., and Willson, R.L. (1976). Metronidazole (Flagyl): degradation by the intestinal flora. Xenobiotica 6, 457–464. Sekirov, I., Tam, N.M., Jogova, M., Robertson, M.L., Li, Y., Lupp, C., and Finlay, B.B. (2008). Antibiotic-induced perturbations of the intestinal microbiota alter host susceptibility to enteric infection. Infect. Immun. 76, 4726–4736. Shan, M., Gentile, M., Yeiser, J.R., Walland, A.C., Bornstein, V.U., Chen, K., He, B., Cassis, L., Bigas, A., Cols, M., et al. (2013). Mucus enhances gut homeostasis and oral tolerance by delivering immunoregulatory signals. Science 342, 447–453. Slack, E., Hapfelmeier, S., Stecher, B., Velykoredko, Y., Stoel, M., Lawson, M.A.E., Geuking, M.B., Beutler, B., Tedder, T.F., Hardt, W.-D., et al. (2009). Innate and adaptive immunity cooperate flexibly to maintain host-microbiota mutualism. Science 325, 617–620. Van der Sluis, M., Bouma, J., Vincent, A., Velcich, A., Carraway, K.L., Büller, H.A., Einerhand, A.W.C., van Goudoever, J.B., Van Seuningen, I., and Renes, I.B. (2008). Combined defects in epithelial and immunoregulatory factors exacerbate the pathogenesis of inflammation: mucin 2-interleukin 10-deficient mice. Lab Invest 88, 634–642. Van der Sluis, M., De Koning, B.A.E., De Bruijn, A.C.J.M., Velcich, A., Meijerink, J.P.P., Van Goudoever, J.B., Büller, H.A., Dekker, J., Van Seuningen, I., Renes, I.B., et al. (2006). Muc2-deficient mice spontaneously develop colitis, indicating that MUC2 is critical for colonic protection. Gastroenterology 131, 117–129. Sober, H.A., Hollander, F., and Sober, E.K. (1950). Toxicity of Eugenol Determination of LD50 on Rats. Exp Biol Med (Maywood) 73, 148–151. Songhet, P., Barthel, M., Stecher, B., Müller, A.J., Kremer, M., Hansson, G.C., and Hardt, W.-D. (2011). Stromal IFN-γR-signaling modulates goblet cell function during Salmonella Typhimurium infection. PLoS ONE 6, e22459. Sonnenburg, J.L., Angenent, L.T., and Gordon, J.I. (2004). Getting a grip on things: how do communities of bacterial symbionts become established in our intestine? Nat. Immunol. 5, 569–573. Sonnenburg, J.L., Xu, J., Leip, D.D., Chen, C.-H., Westover, B.P., Weatherford, J., Buhler, J.D., and Gordon, J.I. (2005). Glycan foraging in vivo by an intestine-adapted bacterial symbiont. Science 307, 1955–1959.  124  Specian, R.D., and Oliver, M.G. (1991). Functional biology of intestinal goblet cells. Am J Physiol Cell Physiol 260, C183–C193. Stecher, B., and Hardt, W.-D. (2008). The role of microbiota in infectious disease. Trends Microbiol. 16, 107–114. Stecher, B., Robbiani, R., Walker, A.W., Westendorf, A.M., Barthel, M., Kremer, M., Chaffron, S., Macpherson, A.J., Buer, J., Parkhill, J., et al. (2007). Salmonella enterica serovar typhimurium exploits inflammation to compete with the intestinal microbiota. 2177–2189. Stienstra, R., Joosten, L.A.B., Koenen, T., van Tits, B., van Diepen, J.A., van den Berg, S.A.A., Rensen, P.C.N., Voshol, P.J., Fantuzzi, G., Hijmans, A., et al. (2010). The inflammasome-mediated caspase-1 activation controls adipocyte differentiation and insulin sensitivity. Cell Metab. 12, 593–605. Strowig, T., Henao-Mejia, J., Elinav, E., and Flavell, R. (2012). Inflammasomes in health and disease. Nature 481, 278–286. Sutherland, L., Singleton, J., Sessions, J., Hanauer, S., Krawitt, E., Rankin, G., Summers, R., Mekhjian, H., Greenberger, N., and Kelly, M. (1991). Double blind, placebo controlled trial of metronidazole in Crohn’s disease. Gut 32, 1071–1075. Sutterwala, F.S., Ogura, Y., Szczepanik, M., Lara-Tejero, M., Lichtenberger, G.S., Grant, E.P., Bertin, J., Coyle, A.J., Galán, J.E., Askenase, P.W., et al. (2006). Critical role for NALP3/CIAS1/Cryopyrin in innate and adaptive immunity through its regulation of caspase-1. Immunity 24, 317–327. Takeda, K., Tsutsui, H., Yoshimoto, T., Adachi, O., Yoshida, N., Kishimoto, T., Okamura, H., Nakanishi, K., and Akira, S. (1998). Defective NK Cell Activity and Th1 Response in IL-18–Deficient Mice. Immunity 8, 383–390. Takeuchi, O., and Akira, S. (2010). Pattern recognition receptors and inflammation. Cell 140, 805–820. Thia, K.T., Mahadevan, U., Feagan, B.G., Wong, C., Cockeram, A., Bitton, A., Bernstein, C.N., and Sandborn, W.J. (2009). Ciprofloxacin or metronidazole for the treatment of perianal fistulas in patients with Crohn’s disease: a randomized, double-blind, placebo-controlled pilot study. Inflamm. Bowel Dis. 15, 17–24. Thim, L. (1997). Trefoil peptides: from structure to function. Cell. Mol. Life Sci. 53, 888–903. Turnbaugh, P.J., Ley, R.E., Hamady, M., Fraser-Liggett, C.M., Knight, R., and Gordon, J.I. (2007). The human microbiome project. Nature 449, 804–810. Tytgat, K.M., Büller, H.A., Opdam, F.J., Kim, Y.S., Einerhand, A.W., and Dekker, J. (1994). Biosynthesis of human colonic mucin: Muc2 is the prominent secretory mucin. Gastroenterology 107, 1352–1363.  125  Ubeda, C., Lipuma, L., Gobourne, A., Viale, A., Leiner, I., Equinda, M., Khanin, R., and Pamer, E.G. (2012). Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J. Exp. Med. 209, 1445–1456. Ushio, H., Ueno, T., Kojima, Y., Komatsu, M., Tanaka, S., Yamamoto, A., Ichimura, Y., Ezaki, J., Nishida, K., Komazawa-Sakon, S., et al. (2011). Crucial role for autophagy in degranulation of mast cells. J. Allergy Clin. Immunol. 127, 1267–1276.e6. Vaishnava, S., Behrendt, C.L., Ismail, A.S., Eckmann, L., and Hooper, L.V. (2008). Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A 105, 20858–20863. Vijay-Kumar, M., Sanders, C.J., Taylor, R.T., Kumar, A., Aitken, J.D., Sitaraman, S.V., Neish, A.S., Uematsu, S., Akira, S., Williams, I.R., et al. (2007). Deletion of TLR5 results in spontaneous colitis in mice. J Clin Invest 117, 3909–3921. Vijay-Kumar, M., Aitken, J.D., Carvalho, F.A., Cullender, T.C., Mwangi, S., Srinivasan, S., Sitaraman, S.V., Knight, R., Ley, R.E., and Gewirtz, A.T. (2010). Metabolic Syndrome and Altered Gut Microbiota in Mice Lacking Toll-Like Receptor 5. Science 328, 228–231. Weinberg, J.E., Rabinowitz, J.L., Zanger, M., and Gennaro, A.R. (1972). 14C-Eugenol: I. Synthesis, Polymerization, and Use. J DENT RES 51, 1055–1061. Willing, B., Vörös, A., Roos, S., Jones, C., Jansson, A., and Lindberg, J.E. (2009). Changes in faecal bacteria associated with concentrate and forage-only diets fed to horses in training. Equine Vet. J. 41, 908–914. Wlodarska, M., Willing, B., Keeney, K.M., Menendez, A., Bergstrom, K.S., Gill, N., Russell, S.L., Vallance, B.A., and Finlay, B.B. (2011). Antibiotic treatment alters the colonic mucus layer and predisposes the host to exacerbated Citrobacter rodentium-induced colitis. Infection and Immunity 79, 1536–1545. Xu, J., and Gordon, J.I. (2003). Honor thy symbionts. PNAS 100, 10452–10459. Yang, K., Popova, N.V., Yang, W.C., Lozonschi, I., Tadesse, S., Kent, S., Bancroft, L., Matise, I., Cormier, R.T., Scherer, S.J., et al. (2008). Interaction of Muc2 and Apc on Wnt signaling and in intestinal tumorigenesis: potential role of chronic inflammation. Cancer Res. 68, 7313–7322. Zaph, C., Du, Y., Saenz, S.A., Nair, M.G., Perrigoue, J.G., Taylor, B.C., Troy, A.E., Kobuley, D.E., Kastelein, R.A., Cua, D.J., et al. (2008). Commensal-dependent expression of IL-25 regulates the IL-23-IL-17 axis in the intestine. J. Exp. Med. 205, 2191–2198. Zhou, L., Zheng, H., Tang, Y., Yu, W., and Gong, Q. (2013). Eugenol inhibits quorum sensing at sub-inhibitory concentrations. Biotechnol. Lett. 35, 631–637.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0103417/manifest

Comment

Related Items