UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of Fundulus heteroclitus embryonic cell lines and their applications to fish health Gignac, Sarah Jane 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2014_spring_gignac_sarah.pdf [ 110.54MB ]
Metadata
JSON: 24-1.0103410.json
JSON-LD: 24-1.0103410-ld.json
RDF/XML (Pretty): 24-1.0103410-rdf.xml
RDF/JSON: 24-1.0103410-rdf.json
Turtle: 24-1.0103410-turtle.txt
N-Triples: 24-1.0103410-rdf-ntriples.txt
Original Record: 24-1.0103410-source.json
Full Text
24-1.0103410-fulltext.txt
Citation
24-1.0103410.ris

Full Text

          CHARACTERIZATION OF FUNDULUS HETEROCLITUS EMBRYONIC CELL LINES AND THEIR APPLICATIONS TO TOXICOLOGY AND FISH HEALTH    by  Sarah Jane Gignac   B.A., Wilfrid Laurier University, 2012   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF  THE REQUIREMENTS FOR THE DEGREE OF   MASTER OF SCIENCE   in   The Faculty of Graduate and Postdoctoral Studies  (Zoology)    THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)  April 2014  © Sarah Jane Gignac, 2014   ii ABSTRACT Common killifish, or mummichogs (Fundulus heteroclitus), are a species of estuarine teleost that are widely used in comparative physiology, toxicology and embryology. Their ability to withstand extreme environmental conditions, widespread distribution, and relatively sedentary nature, makes them ideal as sentinel species of estuarine health. However, the lack of cell lines derived from F. heteroclitus places limitations on the utility of this species in environmental research. In contrast, cell cultures derived from other model organisms have assisted and facilitated our understanding of the effects that environmental contaminants have on organisms in vitro. The development and use of novel F. heteroclitus cell lines for toxicological and parasitological applications is reported here. Continuous proliferating cells were derived from pre-hatch embryos of killifish and have been maintained for 3 years. Three stable cell lines were obtained from the head and body tissues of F. heteroclitus; these stable cell lines have been dubbed KilliFish Embryo 1, 3, and 5 (KFE-1, KFE-3, KFE-5). All three cell lines have been characterized for origin and functionality, as well as for applications in toxicology, studying effects of model chemical pollutants, and in parasitology to evaluate a cod-infecting microsporidia that has been an emerging pathogen of concern, for their ability to infect and grow in cell lines derived from sentinel species. KFE-1 has characteristics of neuroepithelial cells, whereas KFE-3 are possibly liver derived cells, and KFE-5 are distinctly myogenic, as this line has cells that appear to be striated muscle cells. Like intact F. heteroclitus, these cell lines can withstand a wide temperature range from 4°C to 37°C. Mechanisms of thermotolerance and ability to withstand salinity and hypoxia as well as chemical toxicity tolerance could be readily studied with these new cell lines.    iii PREFACE This dissertation is an original product of the author, S.J. Gignac. This is a true copy of the thesis, including any required final revisions, as accepted by my examiners. The majority of the work was conducted at Wilfrid Laurier University in Waterloo, Ontario, from where I transferred after one year of being enrolled in the Masters of Science in Integrative Biology, as my main supervisor, Dr. Lucy Lee moved to BC. A version of Chapter 2 has been submitted for publication. [Sarah J. Gignac, Nguyen T. K. Vo, Michael S. Mikhaeil, J. Andrew N. Alexander, Deborah L. MacLatchy, Patricia M. Schulte and Lucy E. J. Lee. 2014. Derivation of a continuous myogenic cell culture from an embryo of common killifish, Fundulus heteroclitus. Comparative Biochemistry and Physiology A, Ms#23276] and a version of Chapter 3 is in preparation and will be submitted to In Vitro Cell & Developmental Biology-Animal.    iv TABLE OF CONTENTS  ABSTRACT .................................................................................................................................. ii PREFACE .................................................................................................................................... iii TABLE OF CONTENTS ............................................................................................................. iv LIST OF TABLES ..................................................................................................................... viii LIST OF FIGURES ...................................................................................................................... ix LIST OF ABBREVIATIONS .................................................................................................... xii ACKNOWLEGDMENTS .......................................................................................................... xiv CHAPTER 1: GENERAL INTRODUCTION ........................................................................... 1 1.1. Cell lines ............................................................................................................................................ 1 1.1.1. History and purpose of cell lines ................................................................................................ 1 1.1.2. Development and characterization of cell lines .......................................................................... 2 1.2. Fundulus heteroclitus ....................................................................................................................... 6 1.2.1. Background information on Fundulus heteroclitus .................................................................... 6 1.2.2. Previous work on Fundulus heteroclitus at the in vivo level ...................................................... 6 1.2.3. Previous work on Fundulus heteroclitus at the in vitro level ..................................................... 7 1.3. Testing of Chemicals ........................................................................................................................ 8 1.3.1. Fish cell lines for toxicology testing ........................................................................................... 8 1.3.2. Environmental contaminants: copper ....................................................................................... 10 1.3.3. Environmental contaminants: ammonium chloride .................................................................. 11 1.4. Testing growth and effects of intracellular pathogens/parasites in vitro .................................. 12 1.4.1. Microsporidia ............................................................................................................................ 13 1.4.2. Microsporidia classification ...................................................................................................... 13 1.4.3. Microsporidiosis ....................................................................................................................... 13 1.4.4. Anncaliia algerae ...................................................................................................................... 15 1.4.5. Loma morhua ............................................................................................................................ 16 1.4.6. Stress and infectivity ................................................................................................................. 17 1.5. Objectives ........................................................................................................................................ 18 1.6. Hypotheses ...................................................................................................................................... 18 CHAPTER 2: KFE-5 CELL LINE CHARACTERIZATION ................................................ 20 2.1. Fish myogenesis and myocytic cell cultures ................................................................................. 20 2.1.1. The aims of the study ................................................................................................................ 22 2.2. Materials and methods ................................................................................................................... 23 2.2.1. KFE-5 cell line .......................................................................................................................... 23 2.2.2. KFE-5 cell culture maintenance ............................................................................................... 23 2.2.3. KFE-5 cell line origin ............................................................................................................... 24 2.2.4. Dissociation of KFE-5 cultures ................................................................................................. 25 2.2.5. Cryopreservation of KFE-5 ...................................................................................................... 25 2.2.6. Effects of temperature on mitochondrial abundance and morphology in KFE-5 cells ............. 27 2.2.7. Continuous cell line properties ................................................................................................. 27 2.2.7.1. KFE-5 alkaline phosphatase staining ................................................................................................ 27 2.2.7.2. KFE-5 spheroid body formation ....................................................................................................... 28 2.2.7.3. KFE-5 senescence staining ............................................................................................................... 29 2.2.8. Long-term storage of KFE-5 ..................................................................................................... 30 2.2.9. Immunocytochemistry with KFE-5 for muscle markers .......................................................... 30  v 2.3.1. Protein extraction and Western blot analysis with KFE-5 ........................................................ 33 2.3.2. Data analysis ............................................................................................................................. 34 2.4. Results ............................................................................................................................................. 35 2.4.1. KFE-5 cell line authentication .................................................................................................. 35 2.4.2. KFE-5 cell morphology ............................................................................................................ 35 2.4.3. Thawing KFE-5 cell line ........................................................................................................... 39 2.4.4. Effects of temperature on mitochondrial abundance and morphology in KFE-5 cells ............. 39 2.4.5. Continuous cell line properties ................................................................................................. 41 2.4.5.1. Alkaline Phosphatase staining with KFE-5 ...................................................................................... 41 2.4.5.2 KFE-5 spheroid body formation ........................................................................................................ 41 2.4.5.3. KFE-5 senescence staining ............................................................................................................... 43 2.4.6. Long-term storage with KFE-5 ................................................................................................. 43 2.4.7. KFE-5 immunocytochemistry ................................................................................................... 45 2.4.8. Western blot analysis with KFE-5 ............................................................................................ 46 2.5. Discussion ........................................................................................................................................ 47 CHAPTER 3: KFE-1 CELL LINE CHARACTERIZATION ................................................ 50 3.1. Neuroepithelial cell cultures .......................................................................................................... 50 3.1.1. The aims of the study ................................................................................................................ 51 3.2. Materials and methods ................................................................................................................... 52 3.2.1. KFE-1 cell line .......................................................................................................................... 52 3.2.2. KFE-1 cell culture maintenance ............................................................................................... 52 3.2.3. KFE-1 cell line origin ............................................................................................................... 52 3.2.4. Dissociation of KFE-1 cultures ................................................................................................. 52 3.2.5. Cryopreservation of KFE-1 ...................................................................................................... 53 3.2.6. Effect of FBS concentrations on KFE-1 cell growth ................................................................ 53 3.2.7. Effect of temperature on KFE-1 cell growth ............................................................................ 53 3.2.8. Effects of temperature on mitochondrial abundance and morphology in KFE-1 cells ............. 54 3.2.9. Continuous cell line properties ................................................................................................. 54 3.2.9.1. KFE-1 alkaline phosphatase staining ................................................................................................ 54 3.2.9.2. KFE-1 spheroid body formation ....................................................................................................... 54 3.2.9.3. KFE-1 senescence staining ............................................................................................................... 54 3.3.1. Immunocytochemistry with KFE-1 for neuroepithelial markers .............................................. 55 3.3.2. Data analysis ............................................................................................................................. 58 3.4. Results ............................................................................................................................................. 59 3.4.1. KFE-1 cell line authentication .................................................................................................. 59 3.4.2. KFE-1 cell morphology ............................................................................................................ 59 3.4.3. Thawing KFE-1 cell line ........................................................................................................... 61 3.4.4. KFE-1 growth curves using various concentrations of FBS ..................................................... 61 3.4.5. Growth temperature preference on KFE-1 ............................................................................... 62 3.4.6. Effects of temperature on mitochondrial abundance and morphology in KFE-5 cells ............. 64 3.4.7. Continuous cell line properties ................................................................................................. 66 3.4.7.1. Alkaline phosphatase staining with KFE-1 ...................................................................................... 66 3.4.7.2. KFE-1 Spheroid body formation ...................................................................................................... 66 3.4.7.3. KFE-1 senescence staining ............................................................................................................... 67 3.4.8. KFE-1 immunocytochemistry ................................................................................................... 67 3.5. Discussion ........................................................................................................................................ 70 CHAPTER 4: KFE-3 CELL LINE CHARACTERIZATION ................................................ 77 4.1. Liver cell cultures ........................................................................................................................... 77 4.1.1. The aims of the study ................................................................................................................ 78 4.2. Materials and methods ................................................................................................................... 79  vi 4.2.1. KFE-3 cell line .......................................................................................................................... 79 4.2.2. KFE-3 cell culture maintenance ............................................................................................... 79 4.2.3. KFE-3 cell line origin ............................................................................................................... 79 4.2.4. Dissociation of KFE-3 cultures ................................................................................................. 79 4.2.5. Cryopreservation of KFE-3 ...................................................................................................... 79 4.2.6. Effect of FBS concentrations on KFE-3 cell growth ................................................................ 80 4.2.7. Effect of temperature on KFE-3 cell growth ............................................................................ 80 4.2.8. Effects of temperature on mitochondrial abundance and morphology in KFE-3 cells ............. 80 4.2.9. Continuous cell line properties ................................................................................................. 81 4.2.9.1. KFE-3 Alkaline phosphatase staining ............................................................................................... 81 4.2.9.2. KFE-3 Spheroid body formation ...................................................................................................... 81 4.2.9.3. KFE-3 senescence staining ............................................................................................................... 81 4.3.1. Immunocytochemistry with KFE-3 .......................................................................................... 81 4.3.2. Data analysis ............................................................................................................................. 83 4.4. Results ............................................................................................................................................. 84 4.4.1. KFE-3 cell line authentication .................................................................................................. 84 4.4.2. KFE-3 cell morphology ............................................................................................................ 84 4.4.3. Thawing KFE-3 cell line ........................................................................................................... 86 4.4.4. KFE-3 Growth curves using various concentrations of FBS .................................................... 87 4.4.5. Growth temperature preference on KFE-3 ............................................................................... 88 4.4.6. Effects of temperature on mitochondrial abundance and morphology in KFE-3 cells ............. 89 4.4.7. Continuous cell line properties ................................................................................................. 91 4.4.7.1. Alkaline phosphatase staining with KFE-3 ...................................................................................... 91 4.4.7.2. KFE-3 spheroid body formation ....................................................................................................... 91 4.4.7.3. KFE-3 Senescence staining .............................................................................................................. 91 4.8.1. KFE-3 immunocytochemistry ................................................................................................... 92 4.5. Discussion ........................................................................................................................................ 93 CHAPTER 5: POTENTIAL APPLICATIONS OF KILLIFISH CELL LINES .................. 97 5.1. Applications of killifish cell lines .................................................................................................. 97 5.1.1. Assays for acute toxicity testing ............................................................................................... 99 5.1.1.1. Metabolic activity ............................................................................................................................. 99 5.1.1.2. Membrane integrity ......................................................................................................................... 100 5.1.1.3. Lysosome function .......................................................................................................................... 100 5.1.2. The aims of the study .............................................................................................................. 101 5.2. Materials and methods ................................................................................................................. 102 5.2.1. Toxicity ................................................................................................................................... 102 5.2.1.1. Standardization of fluorometric assays ........................................................................................... 102 5.2.1.2. Copper exposure with KFE-5 ......................................................................................................... 102 5.2.1.3. Ammonium chloride exposure on KFE-5 ....................................................................................... 103 5.2.1.4. KFE-5 exposure to RU 486 ............................................................................................................ 104 5.2.2. Microsporidia .......................................................................................................................... 105 5.2.2.1. Anncaliia algerae spores ................................................................................................................ 105 5.2.2.2. Spore purification ........................................................................................................................... 106 5.2.2.3. KFE-5 cell line infected with Anncaliia algerae ............................................................................ 106 5.2.2.4. KFE-1 and KFE-3 cell lines infected with Anncaliia algerae ........................................................ 107 5.2.2.5. KFE-5 pre-exposure to cortisol and infectivity with Anncaliia algerae ........................................ 108 5.2.2.6. Loma morhua spores ....................................................................................................................... 109 5.2.2.7. KFE-5 cell line infected with Loma morhua .................................................................................. 109 5.2.3. Data analysis ........................................................................................................................... 110 5.3. Results ........................................................................................................................................... 111 5.3.1 Toxicity assays with KFE-5 ..................................................................................................... 111 5.3.1.1. Standardizing fluorometric assays for KFE cell lines .................................................................... 111  vii 5.3.1.2. Copper exposure ............................................................................................................................. 113 5.4.3.3. Ammonium chloride exposure ........................................................................................................ 116 5.3.1.4. RU 486 exposure ............................................................................................................................ 119 5.3.2. Microsporidia .......................................................................................................................... 121 5.3.2.1. KFE-5 infected with Anncaliia algerae .......................................................................................... 121 5.3.2.2. KFE-1 and KFE-3 infected with Anncaliia algerae ....................................................................... 126 5.3.2.3. Pre-exposure to cortisol and infectivity with Anncaliia algerae .................................................... 129 5.3.2.4. KFE-5 infected with Loma morhua ................................................................................................ 130 5.4. Discussion ...................................................................................................................................... 131 CHAPTER 6: GENERAL DISCUSSION ............................................................................... 137 6.1. Discussion ...................................................................................................................................... 137 6.2. Future prospects ........................................................................................................................... 141 6.3. Conclusion ..................................................................................................................................... 143 REFERENCES .......................................................................................................................... 144 Appendices ........................................................................................................................................... 173 Appendix A: Hoechst staining for mycoplasma observation ........................................................... 173 Appendix B: May-Grünwald Giemsa Staining ................................................................................. 174 Appendix C: DAPI staining .............................................................................................................. 175 Appendix D: Rhodamine 123 stain ................................................................................................... 176 Appendix E: Immunocytochemistry ................................................................................................. 177 Appendix F: Alkaline phosphatase staining ..................................................................................... 178 Appendix G: Senescence staining ..................................................................................................... 179 Appendix H: AB and CFDA-AM assay protocol ............................................................................. 180 Appendix I: L-15 Exposure medium (L-15/ex) ................................................................................ 181 Appendix J: KFE-5 exposure to NH4Cl ............................................................................................ 182        viii LIST OF TABLES  Table 2.1. Antibodies and incubation conditions for ICC with KFE-5……………………….... 32 Table 2.2. Primary antibodies used for KFE-5 western blot…………………………………… 34  Table 2.3. KFE-5 cell line viability after thawing……………………………………………… 39 Table 3.1. Antibodies and incubation conditions for ICC with KFE-1……………………….... 56 Table 3.2. KFE-1 cell line viability after thawing……………………………………………… 61 Table 4.1. Antibodies and incubation conditions for ICC with KFE-3……………………….... 82 Table 4.2. KFE-3 cell line viability after thawing………………………………………………86 Table 5.1. Killifish cell line IC50 values after exposure to CuSO4!5H2O…………………….. 115    ix LIST OF FIGURES  Figure 1.1. Schematic diagram of cell line development by explant culture methods………….. 3  Figure 1.2. Flow chart depicting cell culture characterization……………………………..……. 4 Figure 1.3. Life cycle of microsporidia……………………………………………………..….. 15 Figure 2.1. Phase contrast micrographs of KFE-5 showing distinct striations in myocytes….... 36 Figure 2.2. Phase contrast and fluorescence micrographs of KFE-5 at passage 28 with binucleated myoblasts…………………………………………………………........ 37 Figure 2.3. Phase contrast micrographs of KFE-5 cell line morphology at passage 27  at various cell densities…………………………………………………………….. 37 Figure 2.4. KFE-5 cell line characteristics……………………………………………………... 38 Figure 2.5. KFE-5 live cells stained with rhodamine 123 for mitochondria ………………….. 40 Figure 2.6. Phase contrast micrographs of KFE-5 spheroid bodies……………………………. 42 Figure 2.7. Phase contrast micrographs of KFE-5 at passage 40 plated spheroid bodies……… 42 Figure 2.8. KFE-5 cell line at passage 34 long-term storage at RT…………………………..... 43 Figure 2.9. Phase contrast micrographs of KFE-5 at passage 34 long-term storage at RT……. 44 Figure 2.10. Immunocytochemical staining of KFE-5 cells with "-actinin and myosin………. 45 Figure 2.11. KFE-5 cell line at passage 30 tested for desmin using western blot analysis……. 46 Figure 3.1. Phase contrast micrographs of KFE-1 cell line morphology at passage 25………... 60 Figure 3.2. Confluent cultures of KFE-1 at passage 17 stained with Hoechst to detect for the presence of myocoplasma………………………………………………………….. 60 Figure 3.3. Effect of Fetal Bovine Serum concentration on KFE-1 proliferation over 4 days… 62 Figure 3.4. Temperature effects on KFE-1 cells over 7 days…………………………………... 63 Figure 3.5. Phase contrast micrographs of KFE-1 cultures displaying increased cell  size with increasing temperature…………………………………………………… 63 Figure 3.6. KFE-1 live cells stained with rhodamine 123 for mitochondria……………………65 Figure 3.7. Phase contrast micrographs of KFE-1 spheroid bodies…………………………….66 Figure 3.8. Immunocytochemical staining of KFE-1 cells with vimentin, ZO-1,                     occludin, neurofilament-200, GFAP, and serotonin…………….............................. 68  Figure 3.9. Immunocytochemical staining of KFE-1 cells with SSEA-1……………………… 69  x Figure 4.1. Phase contrast micrographs of KFE-3 cell line morphology………………………. 85 Figure 4.2. Under-confluent cultures of KFE-3 at passage 14 stained with Hoechst to  detect for the presence of myocoplasma………………………………………….... 85 Figure 4.3. Effect of Fetabl Bovine Serum concentration on KFE-3 proliferation                     over 6 days………………......................................................................................... 87 Figure 4.4. Temperature effects on KFE-3 cells over 10 days………………………………… 88 Figure 4.5. KFE-3 live cells stained with rhodamine 123 for mitochondria…………………… 90 Figure 4.6. Phase contrast micrographs of KFE-3 spheroid bodies…………………………..... 91 Figure 4.7. Immunocytochemical staining of KFE-3 cells with ZO-1 and vimentin………….. 92 Figure 5.1. Standard curve for AB with killifish cell lines in a 96-well microplate…………. 112 Figure 5.2. Viability of killifish cell lines after 24 hours exposure to CuSO4!5H2O………… 114 Figure 5.3. Phase contrast micrographs of killifish cell lines exposed to CuSO4!5H2O                    for 24 hours……...................................................................................................... 115 Figure 5.4. Phase contrast micrographs of KFE-5 at passage 30 after 24 hours exposure  to NH4Cl with neutral red dye uptake in cell lysosomes…………………………. 116 Figure 5.5. Phase contrast micrographs of KFE-1 at passage 25 after 24 hours exposure  to NH4Cl with neutral red dye uptake in cell lysosomes…………………………. 117 Figure 5.6. Phase contrast micrographs of KFE-3 at passage 28 after 24 hours exposure  to NH4Cl………………………………………………………………………….. 118 Figure 5.7. Phase contrast micrographs of KFE-5 at passage 40 showing morphological  effects of cortisol exposure, and inhibited when RU 486 was added…………….. 120 Figure 5.8. Phase contrast micrographs of KFE-5 at passage 33 after 3 to 6 days post- infection with A. algerae…………………………………………………………. 122 Figure 5.9. Phase contrast micrographs of KFE-5 and ZEB2J after 13 days post-infection         with A. algerae……………………………………………………………………. 123 Figure 5.10. KFE-5 and ZEB2J infectivity of A. algerae spores over 13 days post-infection……………………………………………………………………. 124 Figure 5.11. KFE-5 at passage 33 infected with A. algerae after 3 and 12 days post-split…... 124 Figure 5.12. Phase contrast and fluorescent micrographs of KFE-5 at passage 33 infected  with A. algerae 12 days post-split………………………………………………. 125 Figure 5.13. KFE-3 and KFE-1 infected with A. algerae over 28 days post-infection………. 126   xi Figure 5.14. Phase contrast and fluorescent micrographs of KFE-1, KFE-3 and ZEB2J  infected with A. algerae 7 days post-split………………………………………. 127 Figure 5.15. KFE-3 and KFE-1 infected with A. algerae after 7 days post-split…………….. 128 Figure 5.16. KFE-5 at passage 40 exposed to cortisol for 72 hours then infected with  A. algerae spores………………………………………………………………... 129 Figure 5.17. Phase contrast micrographs of KFE-5 at passage 28 after 8 days post- infection with L. morhua………………………………………………………... 130 Figure A1. Phase contrast micrographs of killifish cell lines with ALP staining…………….. 178 Figure A2. Representative data for percentage of cells staining positive for ALP…………....178 Figure A3. Phase contrast micrographs of killifish cell lines with #-galactosidase                     senescence staining……………………………………………………………….. 179 Figure A4. Representative data for percentage of cells staining positive for                    #-galactosidase senescence staining……………………………………………….179 Figure A5. Viability of KFE-5 at passage 33 after 24 hours exposure to NH4Cl…………….. 182     xii LIST OF ABBREVIATIONS  1°    Primary 2°    Secondary ab    Antibody AB    Alamar blue ANOVA   Analysis of variance ALP    Alkaline phosphatase ATCC    American type culture collection BCA    Bicinchoninic acid bp    Base pair BSA    Bovine serum albumin CaCl2    Calcium chloride CFDA-AM   5-carboxyfluorescein diacetate-acetoxymethyl ester CM    Conditioned media CNS    Central nervous system COI    Cytochrome c oxidase subunit 1 CuSO4!5H2O   Copper sulfate pentahydrate CYP1A    Cytochrome P4501A DAPI    4',6-diamidino-2-phenylindole DMSO    Dimethyl sulfoxide DNA    Deoxyribonucleic acid EDC    Endocrine disrupting compounds EROD    Ethoxyresorufin-O-deethylase EtOH    Ethanol FBS    Fetal bovine serum FHML    Fathead minnow liver g     Gram GFAP    Glial fibrillary acidic protein GFSK    Goldfish skin cell line hr    Hour GR    Glucocorticoid receptor HSC    Hepatic stellate cell IC50    Half maximal inhibitory concentration ICC    Immunocytochemistry IF    Intermediate filament IgG    Immunoglobulin G IgM    Immunoglobulin M KFE-1    Killifish embryo-1 cell line KFE-3    Killifish embryo-3 cell line KFE-5    Killifish embryo-5 cell line L-15    Leibovitz-15 L-15/ex    L-15 exposure media LC50    Lethal concentration, 50% mA    Milliampere MGAA    Methanol glacial acetic acid  xiii min    Minute mL    Milliliter mM    Millimolar mo    Month n    Sample size NCBI    National center for biotechnology NEC    Neuroepithelial cell NF-200    Neurofilament-200 ng    Nanogram NH4Cl    Ammonium chloride NR    Neutral red p    P-value PBS    Phosphate buffered saline RFU    Relative fluorescence unit RK-13    Rabbit kidney epithelial cell line RT    Room temperature RTgill-W1   Rainbow trout gill cell line RTL-W1   Rainbow trout liver cell line RU 486    Mifepristone SSEA-1    Stage specific embryonic antigen 1 TBST    Tris-buffered saline with tween 20 TC    Tissue culture V    Volt x g    Centrifugal force in gravity X-Gal    5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside ZEB2J    Zebrafish embryonic cell line ZO-1    Tight junction protein 1 µg    Microgram µL    Microliter µm     Micrometer    xiv ACKNOWLEGDMENTS  I would like to thank WLU’s Biology department for initially accepting me into their MSc Integrative Biology program, and soon after, allowing me to leave and transfer to UBC. My time spent at UBC’s department of Zoology was truly inspirational, even though the time spent was quite short. For these reasons, I will forever be grateful to Dr. Lucy Lee, who moved to the West Coast and decided to take me with her. It has been truly amazing to be part of the UBC community; thusly, I would like to express my sincerest gratitude to those that not only made my arrival to the Zoology department at UBC a reality, but one of the most positive and influential experiences of my life to date.  Foremost, I wish to thank both the Lee Lab and the Schulte Lab. I began my degree at WLU and met some truly amazing people in the Lee lab, particularly Katelin Spiteri for her support, advice, encouragement and willingness to listen to any problems I encountered. I always looked forward to her company in the lab and the great times we had outside of the lab. I would also like to thank Richelle Monaghan for the help and suggestions regarding the work completed using microsporidia. Special thanks to Nguyen Vo for his excellent help with training and constant support and suggestions—he was always there to help no matter time or day. After I transferred to UBC, I entered the Schulte lab, and everyone was very welcoming, and I would like to thank each and every one of the Schulte Lab members for their help, suggestions and encouragement.  To Lucy, I am very appreciative to be one of her students. It has been great pleasure to be in her lab for many years and I have learned so much from her. I thank her for providing the freedom to pursue my own interests and make my own mistakes, for encouragement and support, and most importantly, fostering a love for science.   xv To Trish, I am extremely thankful for being accepted into her lab. I have made many friends, have had great experiences (in and outside of the lab), and have learned a lot from her. I especially want to thank her for providing excellent ideas, suggestions, and constant encouragement.   Lastly, I would like to express my deepest gratitude to my family and friends. My parents are the most positive, encouraging, inspirational and supportive people in my life. I can’t even begin to describe how important and amazing they are. I will express my gratitude for their decision to help move me from Ontario to British Columbia partway through my MSc degree. Their generosity and support is truly amazing and I would have not been able to do this without their help.     1 CHAPTER 1: GENERAL INTRODUCTION 1.1. Cell lines 1.1.1. History and purpose of cell lines Tissue culture, a generic term that includes cell culture, tissue culture, and organ culture, is a technique that was developed early in the twentieth century in order to examine whether cells could survive in a growth medium free of any physiological system, outside of their natural environment (Harrison, 1907). Ross Harrison, known as the “father” of tissue culture, was interested in studying cellular differentiation during embryonic development by using a “hanging drop” method that microbiologists used to study live bacteria. This technique was improved by Burrows and Carrel and was fundamental in developing tissue culture techniques, which allowed cells to have the ability to divide indefinitely in vitro (Langdon, 2004a). Cell culture research methods quickly advanced in the 1950’s and 1960’s and were utilized in virology and pharmacology (Schindler, 1969; Hilleman, 2000; Ozturk and Hu, 2006), two fields that continue to exploit cell culture technology today.  Cell lines can be cultivated from a wide variety of organisms including plants, invertebrates, non-mammalian vertebrates, and mammals (Lannan, 1994; Walker and Rapley, 2008). Cell culture is a convenient alternative technique for animal research and is useful in fields such as stem-cell engineering (Ashton et al., 2011), toxicology (Eisenbrand et al., 2002; Bols et al., 2005), virology (McClean, 1957; Agy et al., 1991), oncology (Lucey et al., 2009), pharmacology (Schindler, 1969; Sambruy et al., 2001) and immunology (Schulze-Horsel et al., 2009). Cell culture is also beneficial to scientific research due to the low maintenance requirements of cultures and their usefulness in experimental testing due to the elimination of in vivo issues such as the bioaccumulation of chemicals (Bols et al., 2005). Furthermore, factors that affect cell growth, such as temperature, humidity, osmotic pressure, growth media, pH, and  2 CO2 concentration, can be rigorously controlled. The ability of researchers to manipulate physicochemical and physiological conditions provides greater consistency and reproducibility of experimental results. This allows numerous studies to be conducted on the existing cell line, without harming multiple organisms. Consequently, animal cell cultures have recently been put at the forefront of experimental testing in animals as they follow the three “R’s” of humane animal experimentation: reduce, replace, and refine (Cotton, 1993; Festing and Wilkinson, 2007). Cell culture research provides a reduction in the number of animals used in experimental testing, and presents new techniques and procedures to replace and improve animal testing (Cotton, 1993). However, it is unlikely that cell cultures will ever replace the use of intact animals, as whole organisms are complex entities, and to resolve the mysteries of the functioning whole animals will still require experimentation with the in vivo animal and in set ecosystems. The questions sought with cells in culture are generally isolated problems that could be screened or rapidly explored with cell lines. Nevertheless, in vitro cell culture research is needed that can complement in vivo work and reduce, refine and supplement findings with whole-animals. 1.1.2. Development and characterization of cell lines Cell culture involves the maintenance and cultivation of cells in vitro. The cells are cultured under specific conditions in an artificial environment comprised of specific growth media, proper temperature conditions, and an ideal surface to maintain cell growth for adherent cells, although some cells can grow in liquid suspension. Primary cultures (Figure 1.1 A) are freshly derived cells isolated from desired organs or tissue fragments that are capable of maintaining their differentiated state. The primary cultures mainly express proteins that characterize the tissue they are derived from (Bols et al., 2005) and last from a few days up to several months (Freshney, 2005). Once cells reach confluency (Figure 1.1 B), occupying the available tissue culture surface, the cell population can be passaged or subcultured to a new  3 vessel with fresh growth medium. After the first successful passage the primary cultures become known as a cell line (Schaeffer, 1990) (Figure 1.1 C). A cell line can sustain a longer lifespan than primary cultures and are either finite (with a short life span of a few months to a few years) or continuous (can be grown almost indefinitely) as immortal cell lines, growing beyond the normal age limit of their species of origin (Freshney, 2005).   Characterization of cell lines is an important concept in the study of cell culture in order to authenticate the type of cells that constitute the cell line. Aspects of characterization include species identification and identification of cell lineage or tissue/organ of origin, using biomarkers                             Figure 1.1. Schematic diagram of cell line development by explant culture methods. (A) Primary culture is a culture of cells, tissues, or organs isolated from the organism and proliferated under the appropriate conditions until the cells occupy the entire culture surface. (B) When the cells within the culture flask become confluent, the cells can be passaged to new culture flasks. (C) A cell line arises from a primary culture at the first time of successful passaging. (Produced using information from Freshney, 2005).      4 capable of identifying each individual cell line (Figure 1.2) (Freshney, 2005). If the correct environmental conditions are established, some cell lines may mature toward a more specialized cell type—a phenomenon known as cellular differentiation (Freshney, 2005). Cellular differentiation can alter the size, morphology, signal responsiveness, membrane integrity, and metabolic activity of cells (Rosen and MacDougald, 2006).     Figure 1.2. Flow chart depicting cell culture characterization. (A) DNA profiling is a technique used to confirm cell line identity to avoid misidentification or cross-contamination. Chromosome analysis, such as karyotyping, can also be used to help confirm species identity. (B) Cell morphology can help identify cell type; however, results can be ambivalent, as similarities can exist between cells of different origins. Growth characteristics will determine which temperature and growth serum to be used for regular maintenance of cultures. (C) Staining cell lines with specific stains will help determine cell type. Immunocytochemistry can be used to detect specific antigens. (D) Once the cell line has been characterized cells can be grown at optimal conditions and used to compare to other cell lines. (E) Experimental testing such as exposure to toxicants and infectivity to pathogens can then be performed. (Produced using information from Freshney, 2005).      5 After subsequent passaging, cells may reach a replication limit, which occurs as a decline in mitotic activity followed by a cessation of cell division, known as senescence (Schaeffer, 1990; Sedivy, 1998). The concept of cell senescence and immortality was recognized before the 1960’s when the Hayflick limit was developed (Hayflick and Moorhead, 1961; Hayflick, 1983; Shay and Wright, 2000). This limit is known as the “theory of aging” where cells in vivo and in vitro have finite capacity to replicate because of the telomere shortening that occurs during DNA replication (Shay and Wright, 2000). However, some fish species can grow with little senescence due to high telomerase activity, and as a consequence fish cell lines may be considered immortal or continuous (Klapper et al., 1998). Nonetheless, cellular senescence should be evaluated when characterizing a cell line, especially if there are any noticeable changes in the cell morphology or in the cell karyotype.  Maintaining aseptic techniques is very important in cell culture, as contamination of cells in culture can result from a multitude of sources including bacterial, fungal, viral, and/or other cell lines (Freshney, 2005). Contamination can arise from reagents, such as liquid media or growth serum, as well as lab supplies including pipettes, culture vessels, and equipment such as incubators and flow hoods (Freshney, 2005; Stacey, 2011). Proper aseptic techniques can help reduce the potential for contamination, as well as maintenance and frequent observation of cultures. Microbial contamination can be recognized as medium colour change (change in pH), turbidity of medium, and the presence of filamentous structures resulting from fungal contamination (Freshney, 2005). Various screening protocols are used to ensure that cultures are free of contamination, such as cell line identity, adding antibiotic and/or antimycotic agents to the medium to prevent the growth of bacteria that have contaminated a culture, as well as staining for particular bacteria such as Hoechst to detect for mycoplasma—a common bacterial  6 infection in cell culture (Langdon, 2004b; Freshney, 2005). Another concern to be kept in mind when developing cell cultures is the source of the tissue as the cells themselves could have endogenous contaminants, including viruses and other intracellular pathogens (Mather and Roberts, 1998). 1.2. Fundulus heteroclitus 1.2.1. Background information on Fundulus heteroclitus The common killifish or mummichog (Fundulus heteroclitus) is a non-migratory teleost fish that commonly resides in euryhaline environments (Burnett et al., 2007). Populations of F. heteroclitus are mainly found in estuaries along eastern North America, from southwestern Newfoundland to northeastern Florida (Bigelow and Schroeder, 1953; Samaritan and Schmidt, 1982; Able and Felley, 1986). F. heteroclitus is a beneficial field model to examine various responses to natural environmental changes of an estuary. These fish can acclimate to freshwater and saltwater environments (Kaneko and Katoh, 2004; Bucking et al., 2012), tolerate low oxygen levels (Stierhoff et al., 2003), and can survive at various temperatures ranging from 5-35°C (Sidell et al., 1983). F. heteroclitus is considered a model organism for studying environmental effects on human health because this fish inhabits coastal environments near urbanized areas and is exposed to the same stressors that accompany urban development, namely contaminants and pathogens (Burnett et al., 2007).  1.2.2. Previous work on Fundulus heteroclitus at the in vivo level F. heteroclitus has proven useful in understanding the physiology, toxicology, evolutionary genetics, and gene regulation in fish (reviewed in Burnett et al., 2007; Whitehead et al., 2011). It is an effective model to examine developmental responses of fish to natural conditions that occur in estuarine ecosystems, partly due to its ability to acclimate to the alterations in chemical composition in the water and its tolerance to toxic substances and  7 contaminated sites (Weis and Weis, 1989; Nacci et al., 2002; Ownby et al., 2002; Bacanskas et al., 2004; McLusky and Elliot, 2004; Roark et al., 2005). F. heteroclitus thrives in heavily-populated coastal regions allowing easy capture (Burnett et al., 2007). It is simple to maintain in the laboratory due to its resilience in a range of environmental conditions and insensitivity to the lethal effects of certain chemicals (Burnett et al., 2007; Arzuaga and Elskus, 2010). Numerous physiological conditions have been studied at the in vivo level and have increased our knowledge on the mechanisms of how fish adapt to environmental changes. Physiological conditions and abiotic factors that have been studied in F. heteroclitus include osmoregulation (Scott et al., 2004; Kidder et al., 2006; Scott et al., 2006), oxygen levels (Kidder et al., 2006; Richards et al., 2008; Genz and Grosell, 2011), temperature ranges (Bulger, 1984; Fangue et al., 2006; Healy et al., 2010; Schulte et al., 2011), and endocrine signaling (Lister et al., 2011). 1.2.3. Previous work on Fundulus heteroclitus at the in vitro level Cell culture research on fish tissue was relatively minimal at the beginning of the twentieth century (Dederer, 1921); prior cell culture research had focused mainly on human, mammalian, avian, and amphibian tissues (Lewis, 1916). Despite that, fish cell culture studies were thought to be ideal to study because of the ease of obtaining and maintaining embryos, as well as the substantial amount of culture growth that can take place at room temperature (Dederer, 1921). Cell culture research on F. heteroclitus first began in the 1920’s with a variety of cell types present in the cultures: cells from the ectoderm, digestive tract and mesenchyme, including nerve fibres, pavement cells, pigment cells and clasmatocytes, with the oldest primary cultures lasting 10 days (Dederer, 1921). Since then, there have been many studies done at the primary culture level (Dederer, 1921; Lewis, 1921; Goodrich, 1924; Trinkaus, 1963; Green, 1968; Clark et al., 1985; Petrino et al., 1989; Marshall et al., 1995). Although there is mention of a killifish cell line in the webpages of the Mount Desert Island Biological Lab [“Established cell  8 lines include the first cell lines from pufferfish (Fugu and Tetraodon sp.), zebrafish (Danio), killifish (Fundulus), swordtail (Xiphophorus), shark (S. acanthias), and skate (L. erinacea)” (see http://www.mdibl.org/cell_culture.php)], a thorough search of the scientific literature failed to provide any reports on the establishment or use of F. heteroclitus cell lines other than my own Honours Thesis work at Wilfrid Laurier University that describes the establishment of KFE-5 (Gignac, 2012). 1.3. Testing of Chemicals Cell lines have been extremely useful for testing the effectiveness and bioactivity of chemicals from hormones and growth factors, to nutrients, vitamins, pharmacochemicals and toxicants (Freshney, 2001; Freshney, 2010; Bols et al., 2005). Since most chemicals ultimately end in the aquatic environment, fish cell lines have become popular as easily manipulable models to evaluate toxicity of aquatic contaminants and their cellular mechanisms of action (Rachlin and Perlmutter, 1968; Bols et al., 2005). Since Fundulus are well known as tolerant organisms to aquatic pollution, responses at the cellular-level using cell lines derived from these species would provide a wealth of information on mechanisms of toxicity tolerance compared to other cell lines derived from more sensitive species. 1.3.1. Fish cell lines for toxicology testing All types of pollution are interconnected whether occurring in the air, land, or water and will eventually enter the aquatic environment (Williams, 1996). Pollutants, such as those found in wastewater runoff, are likely to harm aquatic life, pose hazards to human health, and hinder recreational aquatic activities (Williams, 1996). Fish and other aquatic animals are exposed to a variety of stressors such as aquatic pollutants and toxicants that threaten the animals’ homeostasis (Chrousos and Gold, 1992; Harper and Wolf, 2009). Uptake of pollutants and toxicants in fish occurs via drinking, skin absorption, and absorption through their respiratory  9 systems (Bonga, 1997; Harper and Wolf, 2009). Therefore, exposure to various chemicals may directly compromise the fish through interference with specific neuroendocrine control mechanisms (Bonga, 1997; Harper and Wolf, 2009).  Cell lines from teleost fish have been purported as a supplement to whole-animal testing in the toxicology field because they can be utilized as a possible tool to screen anthropogenic chemicals and complex chemical mixtures (Segner, 1998; Dayeh et al., 2009). Cell lines derived from teleost fish can be used to study the effects of environmental contaminants, including endocrine-disrupting compounds (EDCs), toxicants (e.g., ammonium and copper), and xenobiotics, (e.g., polycyclic aromatic hydrocarbons), that can produce a variety of biological effects (Sutherland, 1992). For fish cells in culture, exposure to various chemicals can generate a stress response that can be observed by changes in cell number, morphology, extracellular and intracellular pH, viability, metabolic functions and membrane integrity (Freshney, 2001; Bols et al., 2005). Thus, understanding the effect of various stressors such as toxicants on fish cell cultures can assist in analyzing the health of the aquatic environment.  Fish cell lines for toxicology studies are beneficial to scientific research due to the low maintenance requirements: simple experimental set-up (Dayeh et al., 2005), highly reproducible (Bols et al., 2005; Lee et al., 2008), easily quantifiable (Dayeh et al., 2005), relatively inexpensive (Dayeh et al., 2005; Lee et al., 2008), and assays can be done very fast via high throughput screening (Dayeh et al., 2005; Fent, 2007). In addition to reduced maintenance involved in cell culture research, particular cells are of interest. For instance, toxicants sometimes only affect a particular tissue, e.g., nervous system, thus it is desirable to have a cell line that comprises of a specific tissue or cell type.   10 Several studies have shown that there is a strong correlation between in vitro and in vivo toxicity (Bols, et al., 1985; Segner, 1998; Dayeh et al., 2002; Fent, 2007), so in vitro models could minimize the use of whole-organism studies. However, the toxic effects of chemicals can be less pronounced in fish cells than in whole fish (reviewed by Schirmer, 2006). Therefore, an increase in concentration is needed in cellular studies to produce similar results. It has been observed that cytotoxic effects are decreased when regular media, Leibovitz-15, is supplemented with serum, such as fetal bovine serum, producing a protective effect on the cells (Mothersill and Austin, 2003; Bols et al., 2005); however, the protective effect likely depends on the toxicant being studied (Bols et al., 2005). A modification of L-15 media was developed and is used for exposure testing. This media is named L-15 exposure media (L-15/ex) and contains the minimal amount of nutrients for growth (Schirmer et al., 1997). This modified media is used without FBS, and is used to dilute toxicants for exposure testing.  1.3.2. Environmental contaminants: copper The aquatic environment has been altered considerably by anthropogenic activities; thus, fish are often exposed to many stressors, such as heavy metals. The term heavy metals refers to transitional metals in the periodic table such as copper, zinc, chromium, mercury, and cadmium; these metals may be toxic to aquatic life at low concentrations (Boyd and Tucker, 1998). Copper is a naturally occurring metal and an essential micronutrient, but increasing concentrations of intracellular levels have shown to be toxic to many cell types (Horne and Dunson, 1995; Olivari et al., 2008; Ezeonyejiaku et al., 2011).  The most common issue with metal toxicity in aquaculture is the use of copper sulfate and other copper based chemicals that are used for algae control and the treatment of certain parasites (Boyd and Tucker, 1998). Copper exposure can be very toxic to fish if concentrations  11 are increased and can result in enzymatic (Liu et al., 2010; Chen et al., 2012; Grosell, 2012), cellular (Mazon et al., 2002; Grosell, 2012), and physiological (Grosell, 2012; Adeyemi and Klerks, 2013), changes. Although copper can be toxic at high concentrations, minute amounts of copper are needed in the diet for enzyme cofactors (Irwin, 1997). Copper sulfate pentahydrate (CuSO4!5H2O) is the most commonly used copper source as a contaminant (Sutton and Blackburn, 1971; Moeller, 1980), and is mainly used as an herbicide and algaecide (Sutton and Blackburn, 1971; Irwin, 1997). However, it is toxic to many species of fish at the concentration necessary for algal control, mainly in younger fish (Irwin, 1997), and has shown to significantly decrease metabolic rate (Vutukuru et al., 2005). Moreover, heavy metals such as copper may produce elevated stress levels in fish, increasing catecholamine, blood glucose levels, and cortisol concentration in blood plasma (Nakono and Tomlinson, 1967; Schreck and Lorz, 1978; Nemcsók and Hughes, 1988).  1.3.3. Environmental contaminants: ammonium chloride  Ammonium chloride (NH4Cl) is commonly found in the natural environment from volcanic activity (Craig and Anderson, 1995), and ammonium compounds are also used in the environment in the form of disinfectants, detergents, and fertilizers (Hedtke and Norris, 1980; Lewis, 1991; Grillitsch et al., 2006). NH4Cl is widely applied as a source of nitrogen for agricultural production, and is either used directly for fertilization or in combination with other fertilizers (Craig and Anderson, 1995). NH4Cl is also present in bathing or cleaning products, such as shampoos, to increase viscosity by the addition of salts (Hargreaves, 2003; Klein and Palefsky, 2007). Thus, ammonium compounds are extensively applied to the environment and are able to enter freshwater streams, contaminating the aquatic habitat (Hedtke and Norris, 1980). Ammonium exposure causes chronic and sublethal effects on aquatic animals (Lewis, 1991), and  12 specifically, fish show decreased food consumption and growth rate in response to NH4Cl exposure (Hedtke and Norris, 1980; Rani et al., 1998).  Cultured cells have been used to test the effects of ammonium compounds, specifically NH4Cl exposure to fish cell lines (Dayeh et al., 2009; Slivac et al., 2010). Rainbow trout gill cell line (RTgill-W1) exhibited cytoplasmic vacuolation after 24-hours exposure to NH4Cl (Dayeh et al., 2009). The induction of vacuoles in cell lines indicates either the presence of ammonia, organic weak bases, or bacterial toxins (Seglen and Reith, 1976; Cover et al., 1991; Freshney, 2005; Dayeh et al., 2009). In mammalian cultures ammonium salts increased neutral red uptake (a quantitative assay for cell vacuolation) in cultured cells (Cover et al., 1991). Also, the uptake of weak bases in mammalian cultures indicates a low pH inside the lysosomes, trapping the weak bases and creating an osmotic imbalance and an influx of water entering the lysosomes (Ohkuma and Poole, 1981). Furthermore, a bacterially derived agent that has shown to induce vacuoles in vitro in mammalian cultures is Helicobacter pylori (Catrenich and Chestnut, 1992), and is attributed to cytotoxic activity (Cover et al., 1992).  1.4. Testing growth and effects of intracellular pathogens/parasites in vitro The ease and relatively simple care requirements of cell lines, has made them ideal for facilitating growth of intracellular pathogens, especially of viruses which are the ultimate parasites (Gillen, 2007). There are thousands of reports using cell lines for growing and studying viruses both for mammalian and fish cell lines (Atmar and Englund, 1997; Gupte, 2006; Chey et al., 2010; Freshney, 2010) and this does not need to be introduced here. However, recent emerging pathogens of concern are microsporidians, obligate intracellular pathogens that require host cells to grow and reproduce (Monaghan et al., 2009), and fish cell lines are beginning to be used to study these difficult organisms.  13 1.4.1. Microsporidia Microsporidia are eukaryotic, single-celled, obligate intracellular, fungal parasites that lack mitochondria, golgi, and peroxisomes (Keeling and Fast, 2002; Didier, 2005). The lack of such key organelles makes them the ultimate obligate intracellular parasite, and their study in isolation is difficult, thus host cells are needed for basic research, mechanisms of infection, evaluation of therapeutic chemicals, etc. The microsporidian spores are environmentally resistant; they contain an exospore layer composed of glycoprotein, an endospore layer composed mainly of chitin, and a polar filament used for infecting host cells (Didier et al., 2004). Cell lines have facilitated the study of microsporidians infecting insects or mammals but the literature is scant using fish cell lines (Monaghan et al., 2009) to study fish microsporidiosis (disease caused by microsporidians). Microsporidia are ubiquitous in nature (Kotler and Orenstein, 1998) but aquatic microsporidians have become emerging pathogens of concern (Stentiford et al., 2013) and aquatic animal cell lines are needed to facilitate their study. 1.4.2. Microsporidia classification Based on structural characteristics of the spore, life cycle and host cell relationships, microsporidia have been classified into roughly 150 genera with over 1,200 individual species infecting a range of hosts, predominantly within the animal kingdom (Keeling and Fast, 2002; Didier, 2005). Almost half of the known microsporidian genera have been shown to infect aquatic animals (Stentiford et al., 2013), mainly arthropods and fish (Keeling and Fast, 2002). Of these, over 150 species have been described that infect fish (Lom, 2002). 1.4.3. Microsporidiosis The generalized life cycle of microsporidia (Figure 1.3) begins with the ejection of a polar filament from a spore that will infect a host cell with a sporoplasm (ungerminated spore). The sporoplasm will initiate the stages of sporont development that is characterized by merogony  14 and sporogony. Inside the host cell, the sporoplasm will undergo multiplication by binary fission (merogony) and will develop into meronts, the earliest stage of microsporidian growth (Didier et al., 2004; Monaghan et al., 2009). This development can either occur inside a membrane-bound vacuole termed a parasitophorous vacuole, or with direct contact of the host cell cytoplasm (Cali et al., 2005; Monaghan et al., 2009). Once meronts are formed, sporogony will take place; this step is characterized by the formation of a thick wall around the spore that is an indication of sporont development (Baker et al., 1998; Lom et al., 2000).   15  1.4.4. Anncaliia algerae Anncaliia algerae is a microsporidium that has been shown to infect an exceptionally broad host range experimentally and clinically, infecting mainly insects, aquatic animals and mammals (Trammer et al., 1997; Visvesvara et al., 1999; Monaghan et al., 2010). Various tissues and cell types have been shown to support the growth of A. algerae in a variety of animals with tissue infectivity including the liver (Koudela et al., 2001), kidney (Undeen, 1975), connective tissue (Cali et al., 2010), and specifically fibroblastic cells (Texier et al., 2010), Figure 1.3. Life cycle of microsporidia. (1) The infective form of microsporidia can survive for a long time in the environment due to the resistant spore coat. (2) The spore extrudes its polar filament and inoculates the host cell membrane with the free end of the polar filament (some host cells can ingest the spore via phagocytosis—not shown) (Monaghan et al., 2010). (3) The polar filament injects a sporoplasm into the host cell. (4) Inside the cell, the sporoplasm undergoes multiple rounds of replication through binary fission (merogony). This development can occur either directly contacting the host cytoplasm (a), or within a membrane formed structure known as parasitophorous vacuole (b). (5) The spore will then mature by sporogony. During sporogony, a thick wall will form around the spore to protect the spore from environmental conditions. The spores will continue to multiply taking over the host cell. (6) The spores will be released from the host cell either by disrupting the cell wall or the host cell will die and release the spores into the surrounding environment. The spores are now capable of infecting other cells and restarting the microsporidia life cycle. (Figure retrieved and modified from DPDx, 2012).   16 epithelial cells (Cali et al., 2010), and muscle cells (Weidner et al., 1999; Franzen and Müller, 2001; Field et al., 2012). A. algerae can infect a wide range of both cold-water and warm-water fish cells including a zebrafish embryonic cell line, ZEB2J (Monaghan et al., 2010); therefore, A. algerae can be used as a model to study its infectivity in F. heteroclitus embryonic cells.  A. algerae has been shown to infect muscle cells in a variety of animals (Weidner et al., 1999; Franzen and Müller, 2001; Coyle et al., 2004), most commonly leading to myositis in vivo (Coyle et al., 2004) and has also been successfully grown in muscle cell lines (Cali et al., 2004). The muscle cell line previously used to observe A. algerae inoculation was a rat myoblast cell line (L6E9), and spores were successfully infected in the cell line and all stages of microsporidial spore development were noticed (Cali et al., 2004).  1.4.5. Loma morhua Loma morhua is an aquatic microsporidium that typically infects Atlantic cod (Gadus morhua) (Morrison, 1983), but little work has been done on how to cultivate the microsporidian spores in mass numbers in vitro. Killifish are prone to microsporidial infections; for example, microsporidia from the genus Plistophora has been previously shown to infect killifish (Bond, 1937). Susceptible cell models are actively being sought to meet the increasing interest of growing aquaculture-relevant microsporidia spores in vitro for use in experimental studies. Monaghan et al. (2010) demonstrated that some microsporidia such as A. algerae can cross-infect cultured cells from non-host species and could undergo complete spore developmental cycles. Therefore, we were interested in exploring the use of F. heteroclitus embryonic cells as a "spore factory" for L. morhua, an aquaculture-relevant microsporidium of concern that is known to infect Atlantic cod, and for which no continuous cell lines were available until now (Jensen et al., 2013).   17 F. heteroclitus are a possible prey of Atlantic cod and microsporidial infections could be transmitted indirectly from F. heteroclitus to Atlantic cod. F. heteroclitus are a eurythermal fish species (Rogers et al., 2012) and they may be a prey to bigger fish that eventually get eaten by Atlantic cod. Atlantic cod are cold-water fish species (Bjarnason et al., 1993) and they are a voracious feeder at the top of the trophic level (Frank et al., 2005); as a result, Atlantic cod may indirectly become infected with microsporidian, L. morhua. Therefore, F. heteroclitus could possibly be a vector to the larger, commercially important predatory fish such as Atlantic cod, which are susceptible to L. morhua. F. heteroclitus were also given to Atlantic cod as a prey in survivorship studies (Lindholm et al., 1999). Additionally, F. heteroclitus are used as a sentinel species for environmental monitoring due to its small size, abundance, and reduced mobility than larger fish, increasing the likelihood of reflecting local conditions (Skinner et al., 2005), therefore, studies on this sentinel species is relevant.  1.4.6. Stress and infectivity Environmental toxicants and elevated stress levels have often been associated with increased disease (France and Graham 1986; Holmes, 1996). Anything that can compromise the immune system, such as contaminants can act as a stressor and increase the chance of invasion by parasites (Holmes, 1996). Thus, elevated cortisol levels in fish have shown to significantly decrease their resistance to infectious diseases (Pickering and Duston, 1983). Microsporidial infection generally is not harmful, unless the host is immunosuppressed or stressed by abiotic and/or biotic factors (Lewis, 2002); therefore, pre-exposure to particular steroid hormones, namely cortisol, may increase spore infectivity.     18 1.5. Objectives (1) Characterize three phenotypically distinct cell lines, KFE-1, KFE-3, and KFE-5, derived from F. heteroclitus embryos developed in early 2011 (Chapters 2-4). This was done by evaluating physicochemical conditions for best growth and maintenance, identification of species of origin, and assessment of specific cellular functions to individually distinguish each cell line.   (2) Evaluate the effects of hormones and model contaminants CuSO4!5H2O and NH4Cl on killifish cell lines (Chapter 5). This will be measured with cellular viability assays. Studying chemical effects/toxicant exposure to these fish cell lines may provide valuable insight as in vitro models to complement already developed in vivo models.  (3) Assess infectivity of microsporidia (A. algerae and L. morhua) on killifish cell lines (Chapter 5). Microsporidia spores will be added to the cultures and monitored for cellular infectivity. Pathogen infectivity in these cell lines could prove useful for studying the life cycle of specific opportunistic pathogens.  1.6. Hypotheses  For objective (1): • KFE-1, KFE-3, and KFE-5 are phenotypically distinct populations of cells that express different cell-type specific markers For objective (2): • Exposure of the killifish cell lines to CuSO4!5H2O will induce a decline in cellular metabolic activities and cell membrane integrity as reported in other fish cell lines (Sansom et al., 2013) and will be less sensitive in comparison to other fish cell lines  19 • Exposure of the killifish cell lines to NH4Cl will increase vacuolization in cells as reported for other fish species cell lines (Dayeh et al., 2009)  For objective (3): • Killifish cell lines can be infected with microsporidia and their susceptibility to infection is influenced by cortisol                 20 CHAPTER 2: KFE-5 CELL LINE CHARACTERIZATION 2.1. Fish myogenesis and myocytic cell cultures In this chapter, the establishment of a myoblast cell line, killifish embryo 5 (KFE-5), from a F. heteroclitus pre-hatch embryo is reported. KFE-5 cell line was hypothesized to contain myoblast cells, due to the morphology of the cells in culture. Therefore, specific myoblast markers were examined by using western blot analysis and immunocytochemistry, particularly observing for sarcomeric banding (Claycomb et al., 1998; Berendse et al., 2003), and muscle contraction markers, such as myosin (Claycomb et al., 1998; Cooper, 2000).   Myogenic cell cultures and cell lines are useful to study myogenesis as well as specific factors that are associated with its diseased state (Yaffe and Saxel, 1977). Serving as a convenient tool for medical research, continuous myogenic cell lines have been established from several avian and mammalian species; with two model examples developed from mouse (Yaffe and Saxel, 1977) and rat (Yaffe, 1968). Mammalian skeletal muscle cell lines are capable of differentiating into multinucleated myotubes (Berendse et al., 2003; Manabe et al. 2012), and mammalian cardiomyocyte cell lines have the potential to contract (Claycomb et al., 1998). Cardiomyocyte cell lines derived from mammals have been developed to screen and test cardiac drugs (Claycomb et al., 1998; Elshenawy et al., 2013), and can be used to study signaling pathways (Leiden, 1999; Beharier et al., 2012) and nuclear transcription factors (Leiden, 1999; Kitta et al., 2001). Primary cardiomyocyte cultures derived from zebrafish hearts have been developed as an alternative to in vivo experiments and are able to proliferate sufficiently (Sander et al., 2013). This is important, as mammalian cardiomyocyte cell line proliferation capacity is not yet sufficient, as these cells are terminally differentiated unless the cell cycle or signaling  21 pathways are controlled (Engel et al., 2005; Bersell et al., 2009); therefore, cardiomyocyte cell lines derived from fish could provide a useful alternative to in vivo and in vitro studies.  Skeletal muscle cell lines have been established from mammals for studying differentiation of myogenic cells and to explore various mechanistic pathways (da Costa et al., 2004). Nonetheless, the development of continuous fish skeletal muscle cell cultures remains an ongoing challenge. A multitude of laboratories have attempted to establish muscle cell lines from primary cultures of white muscles from a variety of fish species (Powell et al., 1989; Matschak and Stickland, 1995; Koumans et al., 1990; Mulvaney and Cyrino, 1995; Greenlee et al., 1995; Castillo et al., 2002; Macqueen et al., 2010), but the main concern is that of myoblast proliferation (Funkenstein et al., 2006; Johnston, 2001). Although myoblasts can be isolated and grown in culture, they do not appear to develop into cell lines (Funkenstein et al., 2006). The lack of fish skeletal muscle cell lines impedes the investigation of in vitro testing and characterization of specific muscle growth factors such as myostatin and insulin-like growth factors in fish (Castillo et al., 2002; Funkenstein et al., 2006). However, the present work may pave the way for future research in fish myogenesis in vitro. Muscle development in fish has been studied extensively due to its commercial importance. Skeletal muscle in teleost fish first appears in early embryonic life and forms from the somitic mesoderm, resulting in the formation of two muscle cell populations: the superficial monolayer of muscle cells, and fast white fibres (Devoto et al., 1996). Fish skeletal muscle exhibits an indeterminate growth pattern, and continues to develop throughout life via hypertrophy (increase in size) and hyperplasia (increase in number) (Mommsen, 2001; Rowlerson and Veggetti, 2001), which is in contrast to mammalian muscle growth, increasing only by hypertrophy (Rowe and Goldspink, 1969; Poortmans, 2004). Muscle fibre growth varies  22 between species and is influenced by environmental factors, such as exercise, diet, photoperiods, oxygen, and temperature (Johnston, 1999; Johnston et al., 2011). The muscle phenotype in fish changes as the fish develops, where muscles in the embryo contain high volumes of mitochondria (Vieira and Johnston, 1992). Fish skeletal muscle cell lines could be useful to study growth factors, mitochondria, oxygen levels, and more.  2.1.1. The aims of the study It was hypothesized that KFE-5 consisted of a myogenic cell line; therefore, this study aims to authenticate the cell line by identifying specific factors that are characteristic of myogenic cells. Specific objectives include: (1) observe cellular morphology and myogenic markers; (2) observe for cellular differentiation, such as observing for continuous cell line properties; (3) determine species identification. In order to reach these objectives, specific cell functions were looked at, including immunocytochemistry, western blot analysis, cell staining, and DNA barcoding.     23 2.2. Materials and methods 2.2.1. KFE-5 cell line KFE-5 cell line was previously developed and partially characterized in Gignac (2012), and was developed from a 7-day old F. heteroclitus embryo at the mid-trunk region.  2.2.2. KFE-5 cell culture maintenance  Cells were maintained at 26°C in Leibovitz-15 (L-15) (HyClone SH30525.02) medium supplemented with 10% fetal bovine serum (FBS) (Sigma F1051), and 1% penicillin/streptomycin (Life Technologies 15140-122) (regular medium). Penicillin/streptomycin are antibiotics supplemented to media to control bacterial contamination. L-15 medium contains no proteins or growth factors; therefore, it requires additional supplements to be a complete growth medium. Cells were kept in 75 cm2 flasks (Falcon 353135), unless otherwise stated, and media were changed every other week. Aseptic techniques were followed for all cell culture maintenance and experiments, and all equipment used was autoclaved and/or sterilized prior to use. Occasionally, when cultures looked distressed (cellular debris and/or vacuoles present), conditioned medium (CM) from the same cell line was used when subculturing cells or changing media. CM is a term used to describe the medium in which cells had been cultivated for a period of time that may contain excreted growth factors that may promote the growth of new cells (Calles et al., 2006). The medium is obtained from cultures that have been incubated for longer than 24 hours and sterile filtered using a 0.2 µm pore filter (Acrodisc PN 4612) fitted to a syringe. The CM is added to fresh culture media for up to $ to % of the final volume, and the remaining volume supplemented with fresh media.   24 Cell lines were periodically observed for the presence of mycoplasma, which is a bacterium that commonly affects cells in culture (Freshney et al., 2007). Mycoplasma do not contain a cell wall, therefore they are not affected by most antibiotics (Freshney et al., 2007). There are several ways to detect for the presence of mycoplasma (Freshney et al., 2007); here I used Hoechst staining in cultures that were incubated for 7 days (Appendix A). KFE-5 cultures were also stained with May-Grünwald Giemsa (Appendix B), which is composed of methylene blue and eosin to aid in better visualization of cellular morphology. The cultures were also stained with 4',6-diamidino-2-phenylindole (DAPI) (Appendix C). DAPI is a nuclear fluorescent stain that can be used in multicolour fluorescent techniques. The stain, which binds to the adenine, thymine region of the minor groove of DNA, fluoresces a bright blue colour (Krishan and Dandekar, 2005).  2.2.3. KFE-5 cell line origin Cells were submitted for “DNA barcoding” to identify species of origin from a sequence of their genome, acting as a ‘genetic barcode’ found in every cell (Hebert and Gregory, 2005). In animals, the gene typically used for barcoding is cytochrome c oxidase subunit 1 (COI), which is located in the mitochondrial genome and can be used to identify animals to the species level (Hebert et al., 2003). Barcoding is beneficial in cell culture research to identify if specific cell lines are originated from the specimen of interest. KFE-5 at passage 28 were washed with phosphate buffered saline (PBS) (HyClone AP-9009-10), trypsinized and centrifuged at 500 x g using an International Clinical Centrifuge for 5 min. The supernatant was removed and the pellet was transferred into a 1.5 mL eppendorf tube (Sigma Z637416) with PBS and centrifuged again for 5 min at 500 x g. The PBS was removed and the pellet was frozen at -20°C. The sample was  25 submitted to the Canadian Centre for DNA barcoding (Guelph, ON, Canada) under Fish-BOL (http://www.fishbol.org/).   2.2.4. Dissociation of KFE-5 cultures When flasks were confluent (flask completely covered with a monolayer of cells) they were dissociated by trypsinization and split 1:2 into a new tissue culture (TC) flask. TrypLE TM (cell dissociation reagent) (Invitrogen 12604) was added for 5 min to dissociate the cells. When cells were completely detached from the flask, regular medium were added to inhibit the trypsin in the TrypLE. The cell solution was centrifuged at 500 x g for 5 min using an International Clinical Centrifuge or an International Equipment Company 21000R centrifuge. The supernatant was removed with a vacuum pipette leaving only the pellet. Fresh medium was added and the cell solution was resuspended by pipetting up and down until the cell suspension was homogeneous. Cell count was normally followed using a hemocytometer with trypan blue (Sigma T8154) to distinguish live or dead cells, or using a cell counter (i.e., Bio-Rad TC10). Cells were either split into a new flask, or used for experimentation. 2.2.5. Cryopreservation of KFE-5 Cell lines were regularly cryopreserved in liquid nitrogen to store the cultures for later use. First, cell lines were dissociated (Section 2.2.4.) and after the supernatant was removed 1,000 µL of regular media with 10% or 20% FBS was added and mixed until homogeneous. The cell suspension was added to a Nalgene® cryovial (Sigma V4757) containing dimethyl sulfoxide (DMSO) (Sigma D2650) for a final DMSO concentration of 10%—DMSO is a cryoprotective agent that is used to create a slower cooling rate and to reduce ice crystals from forming and damaging the cells (Rahman et al., 2013). Cells were cryopreserved using two methods:    26 (1) Fast freezing method:  (i) Incubate cryovials in liquid nitrogen  (ii) Store indefinitely (2) Slow freezing method:  (i) Incubate cryovials in nitrogen vapor for 24 hours (ii) Move cryovials to liquid nitrogen  (iii) Store indefinitely  Often, the cryovials with cells were placed in -80°C freezer for 2-24 hours before placed in nitrogen vapor in the slow freezing method. Killifish cell lines were thawed periodically to determine cell viability after being cryopreserved. Cryovials were removed from liquid nitrogen and placed in a container with a lid containing warm water to thaw the cryovials. The cell suspension in the cryovials were removed and placed in 12 mL of regular media and centrifuged for 5 min at 500 x g to generate a pellet. The supernatant was removed and 3 mL of regular media were added and mixed until homogeneous. Cell viability count was followed using a hemocytometer and trypan blue stain (Sigma T8154). The live cells appeared bright against the stain and were divided by total cell count (live cells + dead cells) to give an average of cell viability. The cell suspension was added to a 25 cm2 TC flask (Falcon 353082) and incubated at optimal temperatures. Cells were observed several hours after incubation as well as the following days to monitor cellular attachment.    27 2.2.6. Effects of temperature on mitochondrial abundance and morphology in KFE-5 cells Mitochondrial abundance and morphology was observed in KFE-5 over different temperatures using rhodamine 123, a fluorescent marker for mitochondria in live cells (Johnson et al., 1980; Alberts et al., 1994). KFE-5 at passage 40 were dissociated (Section 2.2.4.) and cells were then resuspended in regular media. Cell concentration was counted using a hemocytometer and cells were equally seeded in 12-well TC plates (Thermo Scientific C41A31E106) at 220,000 cells/mL (1 mL/well). Plates were incubated at 26°C for 24 hours to allow for adherence. After 24 hours plates were moved to initial temperatures of 4, 18, 26 and 37°C. Rhodamine 123 stain was performed on 1 plate from each incubator on days 4, 7, and 10 (Appendix D).  2.2.7. Continuous cell line properties 2.2.7.1. KFE-5 alkaline phosphatase staining  Alkaline phosphatase (ALP) staining is a biomarker used to detect ALP expression and is an indicator for undifferentiated pluripotent stem cells. ALP is also known to be expressed in embryonic germ cells and embryonic stem cells, as well as in bone and liver (Singh et al., 2012).  Therefore, this marker alone is not a definitive method for determining pluripotent stem cells, and other methods are necessary to identify for pluripotent stem cells (see section 2.2.7.2). The presence of ALP was observed in KFE-5, as well as a positive control (zebrafish embryo, ZEB2J) and a negative control (goldfish skin, GFSK). KFE-5 at passage 32, ZEB2J at passage 101, and GFSK at passage 61 were stained in 25 cm2 TC flasks (Falcon 353082). Once flasks were confluent, medium was removed and fixed with 60% buffered citrate acetone. The Leukocyte ALP detection kit protocol was followed (Sigma 85L3R-1KT), using a solution that contains naphthol AS-MX phosphate as a substrate, and fast red violet B salt as the colorimetric test to detect for any enzymatic activity. The cells that contain ALP expression yield a pink colour. To aid in visualization, staining mixture was replaced with PBS and were examined using  28 a phase contrast Olympus microscope. Five fields of view were counted per flask, and the number of pink cells was divided by the total cell number to determine the percentage of ALP-expressed cells. 2.2.7.2. KFE-5 spheroid body formation  Spheroid body formation was performed on KFE-5 to detect for stem cell-like potential. It has been shown that embryoid or spheroid bodies can differentiate into all three germ layers: ectoderm, mesoderm, and endoderm (Kurosawa, 2007). There are several methods that can be done to perform embryoid/spheroid body formation and one was undertaken in this thesis; the hanging drop method. The hanging drop method produces consistent sizes of spheroid bodies by dispersing an equal number of cells in each droplet and allowing gravity-induced cell aggregation.  KFE-5 at passage 40 were dissociated (Section 2.2.4.) and then resuspended in regular medium. Cell concentration was obtained by using a hemocytometer and was taken to ensure that there was an equivalent cell number in each droplet. Cells were seeded at 3,000 cells/20 µL droplet. Droplets of cell solution were placed on the lids of petri dishes (Fisherbrand 08-757-14G) spaced 1 cm apart and were then inverted onto the bottom of the dish containing sterile water to prevent hanging droplets from drying out. The petri dishes were then incubated at room temperature (RT ~22°C) for 72 hours. Images were taken using a phase contrast Motic AE31 microscope.  After 72 hours incubation, spheroids were removed from the lid of the petri dish and seeded in a 12-well TC plate (Falcon 353043). Approximately 5 spheroids were seeded in each well, and 500 µL of regular media were added. Images were taken on days 8, 16 and 24 with a phase contrast Motic AE31 microscope. Media were changed on days 8 and 16. After 24-days incubation at RT, the media was removed and 500 µL of TrypLE (Invitrogen 12604) was added  29 to each of the wells that contained migrating cells from the spheroids. The trypsinized spheroids were added together in a 15 mL conical tube and centrifuged at 500 x g for 5 min. The supernatant was removed and 5 mL of regular media was added to the pellet and mixed until homogeneous. The cell solution was added to a 25 cm2 TC flask (Falcon 353082) and incubated at RT. Images were taken with a phase contrast Motic AE31 microscope on days 3, 7 and 21; and media were changed on days 7 and 14.  2.2.7.3. KFE-5 senescence staining  Senescence staining is commonly conducted to detect for the senescence biomarker, #- galactosidase. After an extended amount of time in culture, cells may reach a replication limit, with a decline in cell division. Cellular senescence may cause cells to lose the ability to proliferate if they have high levels of senescence-associated #-galactosidase expression (Debacq-Chainiaux et al., 2009). The presence of senescent marker, #-galactosidase, was observed in killifish cell lines, as well as an eel brain cell line used as a positive control. KFE-5 at passage 28, and eel brain cell line at passage 67 were stained in 25 cm2 TC flasks (Falcon 353082). Once flasks were confluent, the Senescence Cells Histochemical Staining Kit protocol was followed (Sigma CS0030), using a solution that contains 5-bromo-4-chloro-3-indolyl-#-D-galactopyranoside (X-gal). The senescent cells that contain #-galactosidase expression hydrolyze X-gal, yielding a blue colour. Cells were incubated at RT overnight in the staining solution and flasks were visualized using a phase contrast Olympus microscope. To aid in visualization, staining mixture was replaced with PBS. Nine fields of view were counted per flask, and the number of blue cells were divided by the total cell number to determine the percentage of senescent cells.    30 2.2.8. Long-term storage of KFE-5  Long-term cell storage has been an ongoing challenge in cell culture, especially for mammalian cultures as they are more difficult to maintain due to the need to be kept at 37°C with 5% CO2 with frequent changes of medium (Brennan et al., 2012). Fish cell lines have been shown useful for long-term storage, such as rainbow trout gill cell line (RTgill-W1), which can be incubated at 4°C for up to 78-weeks incubation (1.5 years) without changing medium and does not require CO2 (Brennan et al., 2012). Maintaining KFE-5 cells at RT for 6 months without media change tested the potential for long-term storage of this cell line. Two confluent, 75 cm2 flasks at passage 34 were split (Section 2.2.4.) and seeded into seven 25 cm2 TC flasks (Falcon 353082) with regular medium and incubated at RT. After 48 hours, and 1, 2, 3, 4, 5, and 6 months, media was removed from 1 flask and replaced with PBS and were examined using a phase contrast Olympus microscope. Six random fields of view were taken to examine cell morphology. Cells were then dissociated from the flasks (Section 2.2.4.), and after the supernatant was removed 1 mL of fresh regular medium was added and mixed until the cell suspension was homogenous. The cells were then observed for cell viability using Bio-Rad TC10 with trypan blue (Sigma T8154) detector. The Bio-Rad TC10 automatically detects the trypan blue and counts the live cells as well as a total count.  2.2.9. Immunocytochemistry with KFE-5 for muscle markers  Cell-specific markers, such as immunocytochemistry (ICC), allow the visualization and distribution of specific cellular components by the interaction of target antigens with specific antibodies tagged with a visible label (Ramos-Vara, 2005). ICC can be viewed with fluorescent or confocal microscopy.   KFE-5 cell line was thought to mainly contain myocytes and fibroblastic cells, and was investigated for specific mesoderm cell markers with ICC. The main characteristics in striated  31 muscle cells include sarcomeres, and specific proteins such as myoglobin, myosin, desmin and myogenic regulatory factors; KFE-5 cell line was observed for "-actinin and myosin. Table 2.1 lists the markers, their function and the controls used for ICC with KFE-5 cultures. KFE-5 were fixed with ice-cold absolute methanol for 20 min and the ICC protocol followed in Appendix E.   32 Table 2.1. Antibodies and incubation conditions for ICC with KFE-5.  1° ab against Function of the ab target ab description 1° ab dilution 1° ab incubation time  Blocking buffer  2° ab 2° ab dilution 2° ab incubation time Control Passage number Myosin (Sigma M7523) Detects myosin heavy chain of skeletal muscle Rabbit anti-human 1:200 1.5 hours 1% skim milk goat-anti rabbit (Sigma A11008) 1:300 30 min No 1° ab   26 !-actinin (Sigma A7811)   Localization of sarcomeres; staining the Z-lines in skeletal and cardiac muscle Mouse anti- human and animal muscle (bovine, pig, sheep, rabbit, goat, hamster, cat, rat, mouse, dog, chicken, lizard, snake, frog, fish) 1:500 1 hour 1% skim milk goat-anti mouse (Invitrogen A11001) 1:1000 45 min No 1° ab     34 Antibody (ab) Function description and species reactivity from www.sigmaaldrich.com Secondary ab’s are Alexa Fluor® labeled   33 2.3.1. Protein extraction and Western blot analysis with KFE-5  KFE-5 cell line at passage 30 was scraped from a TC flask using a cell scraper (Falcon 353085) and centrifuged at 500 x g for 4 min. Cell pellets were washed with PBS 1x and then were lysed with radio-immunoprecipitation assay (RIPA) lysis buffer and vortexed for 5 seconds then incubated for 30 min at 4°C. Cell lysate was centrifuged at 16,160 x g for 10 min. The supernatant was transferred into new eppendorf tube (Sigma Z637416) and stored at -20°C; the pellet was discarded. Protein concentrations were determined by bicinchoninic acid (BCA) protein assay (as instructed by the manufacturer Thermo Fisher). A positive control was derived from axial white muscle tissue from a sexually mature male F. heteroclitus, minced into smaller pieces, and then treated in the same way except the tissue pellet was washed with PBS 3x for 10 min each. The concentrations of the protein extracts were determined using the BCA protein assay. The procedure of Western Blotting was slightly adapted from the previously described protocol by DeWitte-Orr et al., (2007). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel was used with 12% resolving gel and 4% stacking gel. Once the gel was cast, the protein and loading buffer were heated to 100°C for 10 min to denature the proteins. Into each lane of the gel 40 µg of the protein sample was loaded and the gel electrophoresis was ran at 125 V for 60 min. The gels were then transferred to nitrocellulose membrane using a wet transfer technique and the electroblotting device (Mini-PROTEAN®) was run at 150 mA for 60 min. The blots were stained with Ponceau S stain (0.1% (w/v) in 1% (v/v) glacial acetic acid) for 5 min and washed extensively with Milli-Q water. The blots were blocked with 5% skim milk in tris-buffered saline with tween 20 (TBST) (blocking buffer) overnight at 4°C. The blots were then incubated with their primary antibody (Table 2.2)  34 in blocking buffer for one hour, washed 3x with TBST, incubated with alkaline phosphatase-conjugated anti-rabbit secondary antibody for one hour, washed 3x with TBST.  Table 2.2. Primary antibodies used for KFE-5 western blot.  1° ab against Function of the target ab ab description 1° ab dilution 2° ab and dilution Desmin (Sigma D8281) IF protein that binds to the Z-band in skeletal, cardiac and smooth muscle* Rabbit anti- mouse, human, chicken, bovine 1:250 Goat anti-rabbit 1:20 000 !-actin (Sigma A2066) Loading control Rabbit anti- amoeba, wide range, chicken, slime mold, vertebrates, human 1:200 Goat anti-rabbit 1:20 000 Intermediate filament (IF) * from Dlugosz et al. 1984 Species reactivity from www.sigmaaldrich.com/  2.3.2. Data analysis  Statistical analysis of the data was performed using commercial statistical software, GraphPad Prism. Mean ± standard deviation was calculated for each data point. Data from ALP staining was tested using a one-way analysis of variance (ANOVA) and a post-hoc Tukey-Kramer multiple comparison test. Data from Senescence staining was tested using a one-way ANOVA and a post-hoc Dunnett test with eel brain cell line used as the control.     35 2.4. Results 2.4.1. KFE-5 cell line authentication  DNA barcoding performed at the University of Guelph confirmed the origin of species for KFE-5 cell line at passage 28 originated from killifish (F. heteroclitus). A 655-bp region of CO1 was sequenced and annotated below:  CCTTTATTTAGTATTTGGTGCCTGAGCCGGTATAGTAGGTACAGCTCTTAGCCTTCTTATTCGGGCGGAACTAAGCCAACCAGGCTCCCTCCTAGGGGATGACCAAATTTATAATGTAATCGTTACAGCACATGCATTTGTAATAATCTTTTTTATAGTTATGCCTATTATAATTGGTGGTTTTGGAAATTGACTAGTCCCTCTTATGATTGGTGCCCCAGACATAGCTTTTCCTCGAATAAATAATATAAGCTTCTGACTACTCCCACCCTCATTTTTACTTCTTTTAGCCTCTTCCGGTGTTGAAGCCGGGGCTGGTACAGGTTGAACAGTCTATCCCCCTCTAGCAGGTAATTTAGCTCATGCTGGGGCTTCTGTAGATTTAACTATTTTTTCCCTTCACTTAGCTGGTATTTCATCAATTTTAGGTGCTATTAATTTTATTACAACTATTATTAACATAAAACCTCCAGCTATCTCCCAATACCAAACCCCTCTGTTCGTCTGAGCTGTCTTAATTACTGCTGTACTTCTTCTACTTTCCTTACCAGTTCTTGCTGCAGGAATTACAATACTGTTAACTGACCGAAATTTAAATACTACATTTTTTGATCCAGCAGGCGGAGGAGATCCAATTCTATACCAACATTTATTC  This CO1 based DNA barcoding result yielded 99.85% match as F. heteroclitus in the Barcode of Life database and 99% match with F. heteroclitus CO1 (Accession No FJ445403) in the National Center for Biotechnology (NCBI) database.  2.4.2. KFE-5 cell morphology   KFE-5 are adherent cells consisting mostly of fibroblastic cells ranging in length from ~50 to 100 µm in fully adherent state. Interspersed among the fibroblastic cells are long spindle-shaped myocytic cells, approximately 50 to 200 µm long. The myocytes showed distinct striations when observed at high magnification (Figure 2.1), and were binucleated (Figure 2.2). Under-confluent, confluent, and super-confluent cultures show a difference in cell morphology (Figure 2.3 A, B & C), with an increase in myocytes as well as noticeable debris deposited over the cell monolayer in the super-confluent cultures (Figure 2.3 C). Once super-confluent cultures have been passaged the cultures no longer show floating debris (Figure 2.3 D). KFE-5 cellular differentiation in culture appear to form colonies of cells, giving the impression of spheroid  36 bodies formed within super-confluent cultures of KFE-5 cell line (Figure 2.4 A). Super-confluent cultures also displayed myogenic clusters of myoblasts surrounded by fibroblastic cells (Figure 2.4 C). KFE-5 was also stained with Hoechst to detect the presence of mycoplasma, using phase contrast and fluorescent microscopy (Figure 2.4 D & E). The presence of mycoplasma was not detected.              Figure 2.1. Phase contrast micrographs of KFE-5 showing distinct striations in myocytes. Panels (A-C) KFE-5 at passage 18 stained with May-Grünwald Giemsa. Panels (D-E) KFE-5 at passage 31, no stain. Striations present in myocytes. Images are taken with a Nikon TE300 inverted phase contrast microscope. Scale bar = 50 µm.   37          Figure 2.2. Phase contrast and fluorescence micrographs of KFE-5 at passage 28 with binucleated myoblasts. Panel (A) phase contrast. Panel (B) fluorescence stained with DAPI. Arrows are pointing to binucleated cells. Images were taken with a Nikon TE300 inverted phase contrast microscope. Scale bar = 100 µm.                          Figure 2.3. Phase contrast micrographs of KFE-5 cell line morphology at passage 27 at various cell densities. Panel (A) under-confluent; Panel (B) confluent; Panel (C) super-confluent; Panel (D) two days after passaging. Photomicrographs were taken with a phase contrast Olympus microscope. Scale bar = 100 "m.    38                               Figure 2.4. KFE-5 cell line characteristics. Panel (A) Confluent cultures show spheroid aggregates at passage 53. Panel (B) highly confluent cultures at passage 50 shows myogenic network formation. Panel (C) Myogenic clusters interspersed between fibroblastic cells at passage 30. Panels (D & E) stained with Hoechst to detect for the presence of myocoplasma at passage 28; Panel (D) phase contrast, Panel (E) fluorescence. Panels A & B taken with a Motic AE31 microscope. Panels C - E taken with a Nikon TE300 microscope. Scale bar = 100 "m.   39 2.4.3. Thawing KFE-5 cell line KFE-5 cell line was frozen in liquid nitrogen and thawed after >1 month of freezing. The cell line was initially frozen in 10% FBS with 10% DMSO and placed directly into liquid nitrogen; however, an increase in cell viability was noticed when cells were held in nitrogen vapor for 24 hours, then moved to liquid nitrogen to be held indefinitely (Table 2.3).   Table 2.3. KFE-5 cell line viability after thawing. Cultures were cryopreserved for >1 month in liquid nitrogen before they were thawed.  Cell line 10% FBS (Liquid indefinitely) 10% FBS (24 hours vapor, liquid indefinitely) 20% FBS (24 hours vapor, liquid indefinitely) KFE-5  27.5% a 83.5% c 87.0% d 31.9% a 74.5% c 76.5% e 34.0% b  87.0% f 31.0% b  87.0% g Passage numbers: a: 27; b: 24; c: 33; d: 29; e: 26; f: 32; g: 29   2.4.4. Effects of temperature on mitochondrial abundance and morphology in KFE-5 cells Mitochondrial abundance and morphology were observed in KFE-5 cell line over different temperatures using a fluorescent marker for mitochondria (rhodamine 123). Cells were incubated from temperatures 4°C to 37°C and images shown were taken on day 7 (Figure 2.5). The cultures showed an increase in myoblasts with temperature from 4°C to 26°C, and decline at higher temperatures of 37°C. Mitochondria at appeared to be filamentous in shape throughout all the incubation temperatures.    40              Figure 2.5. KFE-5 live cells stained with rhodamine 123 for mitochondria. KFE-5 cells at passage 40 were incubated at 4, 18, 26 and 37°C. Images shown were taken on day 7. Left side depicts phase contrast images of rhodamine 123 stained cells and right side depicts fluorescence images of same cells. Images were taken using a Nikon TE300 inverted phase contrast microscope. Scale bar = 50 µm.   41 2.4.5. Continuous cell line properties 2.4.5.1. Alkaline Phosphatase staining with KFE-5 Expression of ALP was observed in killifish cell lines (Figure A1; Appendix F), which stained positive (pink stain). KFE-5 mainly showed ALP expression in the myoblasts, with few fibroblastic cells staining positive. The negative control cell line, GFSK, did not show any cells staining positive for ALP, whereas the positive control, ZEB2J showed an increase in ALP stain in the cell clusters. KFE-5 showed ALP expression, with 29.4% of the cells displaying intense positive (pink) stain (Figure A2; Appendix F).  2.4.5.2 KFE-5 spheroid body formation Embryoid or spheroid bodies are a hallmark of stem cells, and KFE-5 cell line were able to form solid spheroid bodies using the hanging drop method after 72-hours incubation at RT (Figure 2.6). Spheroids were variable in size, approximately 78.4 µm in diameter. Plated spheroids showed only myoblasts migrating out from the spheroids on day 16 (Figure 2.7 A), and on day 24 the wells were completely confluent with myoblasts (Figure 2.7 B). Fourteen spheroids dissociated and replated showed under-confluent cultures of myoblasts on day 3 (Figure 2.7 C) and images on day 21 showed super-confluent cultures of myoblasts (Figure 2.7 D). The myoblasts were ~30-50 µm in length, and only few fibroblast cells were observed.   42                   Figure 2.6. Phase contrast micrographs of KFE-5 spheroid bodies. Photomicrographs of spheroid body formation over 72-hours using the hanging drop method. KFE-5 at passage 40 showed compact spheroid body formation. Spheroid diameter size: Mean: 78.4 µm ±  20.2 µm (n=10). Images were taken with a phase contrast Motic AE31 microscope. Scale bar = 50 µm.         Figure 2.7. Phase contrast micrographs of KFE-5 at passage 40 plated spheroid bodies. Panel (A) Spheroid body plated after 16-days incubation shows myoblasts migrating out from the spheroid. Panel (B) Spheroid body plated after 24-days incubation shows super-confluent cultures of myoblasts migrating out from the spheroid body. The cells are beginning to clump together and grow on top one another. Panel (C) Spheroids dissociated and replated after 3-days incubation show under-confluent cultures of only myoblasts. Panel (D) Spheroids replated after 21-days incubation show confluent myoblast cultures with very few fibroblastic cells. Images were taken with a phase contrast Motic AE31 microscope. Scale bar = 50 µm.   43 2.4.5.3. KFE-5 senescence staining  Killifish cell lines showed minor staining for senescence marker !-galactosidase (Figure A3; Appendix G). The positive control (eel brain) showed the highest enzyme expression, with 74% of the cells appearing blue after staining; KFE-5 cell line had comparatively low levels of !-galactosidase expression, with 1.2% cells positive (Figure A4; Appendix G).  2.4.6. Long-term storage with KFE-5 KFE-5 cell line was evaluated for long-term storage and cell viability over six months without media change. Cells showed a decline in cell viability from 75% to 10% after six months of incubation (Figure 2.8). After one month, the cells were super-confluent, mainly consisting of myoblasts (Figure 2.9 B). After two months cells were occupying the entire culture surface and the flask was starting to contain cellular debris (Figure 2.9 C). After four months the dead cells started lifting off of the TC surface (Figure 2.9 D). After five months the cultures were under-confluent (Figure 2.9 F) and at six months there were hardly any cells in the cultures once the medium was removed (Figure 2.9 G).     Figure 2.8. KFE-5 cell line at passage 34 long-term storage at RT. KFE-5 cell line showed a decline in cell viability from initial plating to 6 months incubation at RT. After 48 hours (hr) of incubation 75% of cells were viable, and declined to 10% viability after 6 months (mo). Cell viability was measured using Bio-Rad TC10 with trypan blue detection. Long-term viability was only completed once, therefore, no statistical analysis was conducted.   44                      Figure 2.9. Phase contrast micrographs of KFE-5 at passage 34 long-term storage at RT. Panel (A) 48-hours incubation. Panel (B) 1-month incubation; super-confluent cultures. Panel (C) 2-months incubation; cellular debris is noticed. Panel (D) 3-months incubation; cellular debris has increased and debris is clinging to adherent cells. Panel (E) 4-months incubation; cellular debris has increased and dead cells are beginning to detach from culture surface. Panel (F) 5-months incubation; more dead cells have detached from culture surface. Panel (G) 6-months incubation; almost no cells are left; cells that are present appear unhealthy and myoblasts are no longer present, only fibroblasts. Images were taken with a phase contrast Olympus microscope. Scale bar = 100 µm.  45 2.4.7. KFE-5 immunocytochemistry KFE-5 cell line showed sarcomeric staining when probed with anti-#-actinin (Figure 2.10 A & B). The staining was restricted to only the sarcomere banding in the myocytes, and did not stain the fibroblastic cells. KFE-5 was also positive for myosin (Figure 2.10 C & D), and was only expressed in the cytoplasm of the myocytes, and not in the fibroblastic cells.            Figure 2.10. Immunocytochemical staining of KFE-5 cells with #-actinin and myosin. Panels (A,B) KFE-5 at passages 34 and (C,D) at passage 26. Panels (A,C), controls (with Alexa Fluor labeled secondary antibodies only). Panel (B): anti-#-actinin 1:500. Inset is magnified myocyte cell to enhance sarcomeric staining. Panel (D) anti-myosin 1:200. All cells were post stained with DAPI (nuclei blue). Images taken with a Zeiss confocal scanning microscope. Scale bar = 50 µm.  46 2.4.8. Western blot analysis with KFE-5  To confirm that the KFE-5 cell line was of muscle origin, desmin protein expression was tested by western blot analysis, with !-actin as a protein reference (Figure 2.11). Desmin was both expressed in the KFE-5 cell line and in F. heteroclitus skeletal muscle tissue. There was non-specific binding in the KFE-5 cell line probed with antibodies against desmin, but not in the loading control.                                                 Figure 2.11. KFE-5 cell line at passage 30 tested for desmin using western blot analysis. KFE-5 was tested with the control: skeletal muscle tissue derived from F. heteroclitus fish. Anti-desmin 1:250; anti-!-actin 1:200. !-actin was used as a loading control. Desmin was present in both KFE-5 and muscle tissue at 55 kDa.   47 2.5. Discussion  The current study supports the hypothesis that KFE-5 does consist of a myogenic cell line. This point is clearly illustrated by distinct sarcomeric banding when myoblasts were observed at high magnification as well as positive expression for #-actinin. Furthermore, the cells were also positive for few stem cell markers, and show relatively low levels of senescence. This provides evidence of the first successful fish muscle cell line.  This study describes a cell line with myogenic potential obtained from an embryo of the common killifish, F. heteroclitus. KFE-5 was derived from the body trunk explant of a late-stage embryo, and has been subcultured for more than 50 passages for 3 years to date. KFE-5 retained a diploid chromosome number for F. heteroclitus (Fisher and Rachlin, 1972); and the cell line was sent to the Canadian Centre for DNA Barcoding and it was confirmed to be of F. heteroclitus origin. KFE-5 cell line morphology appears similar to the mouse myogenic cell line C2C12 (Yaffe and Saxel, 1977), with two cell phenotypes: mononucleated fibroblastic cells, and elongated myoblast cells capable of differentiating into myocytic cells with distinct striations. Super-confluent cultures had increased myoblasts as well as increased debris; debris might be a result of cells occupying all of the available substrate and depleting the available nutrients, causing the cells to lift off of the culture service and die. When super-confluent cultures were passaged, the cell line contained both myoblasts and fibroblasts, and cellular debris was no longer apparent. Decrease in debris could be due to media replacement, as well as a greater area for cells to grow, allowing an environment for exponential growth. KFE-5 cultures showed the ability to form colonies of cells, giving the appearance of spontaneously forming adherent spheroids/embryoids in super-confluent cultures. This appearance was also noticeable in other mammalian cultures (Thomas et al., 2005) and has been observed in stem-cell cultures (Polisetty  48 et al., 2008); therefore, providing more indication that KFE-5 could consist of myogenic stem cells differentiating into myocytes under super-confluent conditions.  There are many methods employed to characterize the cell line, and observation of morphology is the simplest and most direct technique used to identify cells. However, it has certain shortcomings that should be recognized. Cell morphology may be ambiguous, therefore antigen detection can be used to evaluate whether or not cells express the antigen in question, and this can be employed via immunocytochemistry. KFE-5 expressed muscle specific proteins as observed by immunocytochemical staining. Myocytic cells were positive for #-actinin, a protein found in the Z-disc in the sarcomeres of striated myocytes (Sanger et al., 2000), as well as myosin, a motor protein involved in muscular contraction (Keynes et al., 2011). #-actinin was expressed in only myocytic cells and brightly stained the sarcomeres, showing very distinct sarcomeric banding. Myosin was widely expressed in the myocytes, however it showed a more homogeneous localization. Myocytic characteristics were also confirmed via western blot analysis when tested with desmin, an IF protein that binds to the Z-band in skeletal, cardiac and smooth muscle (Dlugosz et al. 1984).  The identity of KFE-5 cells could be attributed to a stem cell population of possibly mesenchymal in origin. It is well known that mesenchymal stem cells give rise to connective tissue and muscle cells. Fibroblasts are the most typical connective tissue cells, whereas muscle cells could be smooth or striated. Among striated muscle, skeletal or cardiac myocytes (Pittenger and Martin, 2004; Awaya et al., 2012) could be derived from the trunk mesenchyme. Thus it is possible that KFE-5 were derived from a mesenchymal stem cell subpopulation with myogenic and fibroblastic potential. Indeed in this study KFE-5 were shown to have stem-like  49 characteristics. KFE-5 was capable of forming embryoid bodies and was positive for ALP expression and was negative for the senescence-associated marker !-galactosidase.  Temperature also affected KFE-5 morphology. Cells appeared to be flatter and rounder at 4°C and mitochondrial abundance, shape and organization were affected when cultures were incubated at temperatures from 4°C to 37°C. This mirrors a previous study with chicken embryo fibroblasts on temperature-induced morphological or organizational change in mitochondria (Collier et al., 1993). In some fish species, cardiomyocytes and muscle fibres are known to contain a high volume of mitochondria to support energy utilization (di Prisco and Verde, 2012), and energy production for muscular contraction, respectively (Johnston, 1987; Johnston et al., 1988; Vieira and Johnston, 1992). In KFE-5, based on the rhodamine 123 fluorescence staining, the mitochondria appeared to be much higher within myoblasts than in fibroblasts. Whereas mitochondria of differentiated skeletal muscle cells are peripherally located, mitochondria of cardiomyocytes are distributed throughout the cytoplasm, providing the possibility that KFE-5 cells could contain cardiomyocitic stem cell precursors. Further tests will need to be performed to fully elucidate the origins of KFE-5.  This study sheds new light on the ability to successfully develop and characterize a fish muscle cell line, as well as the development of one of the first F. heteroclitus cell lines. It was shown that super-confluent cultures appear to change the morphology and express a mesenchymal appearance. Furthermore, the cell line appears to be continuous and does not show signs of cell ageing.     50 CHAPTER 3: KFE-1 CELL LINE CHARACTERIZATION 3.1. Neuroepithelial cell cultures A cell line dervied from a killifish pre-hatch embryo was developed from the cephalic region with characteristics of neuroepithelial cells (NECs), and was positive for: vimentin, tight junction protein 1 (ZO-1), neurofilament-200 (NF-200), glial fibrillary acidic protein ( G FA P ) , and serotonin. KFE-1 cell line was originally hypothesized to consist of an epithelial cell line derived from the cephalic region of the embryo; therefore, neural markers were also explored. Specific neuroepithelial detection involves screening for epithelial, neural, and neuronal markers, as well as detecting if the cells are capable of cellular differentiation to a more specialized cell type, such as an astrocyte.  Cells were observed for seven markers: vimentin, an IF protein  that maintains cell shape and integrity (Mescher, 2010 ) , ZO-1, a tight junction marker that binds to claudin ( Aaku-Sarasate et al., 1996), occludin, a junctional adhesion molecule protein (Aaku-Sarasate et al., 1996), NF-200, an IF protein found in cells of neuronal origin (Cheng et al., 2013), GFAP, an IF protein that distinguishes mostly astrocytes from other glial cells and is found in the central nervous system (CNS)  (O’Callaghan and Miller, 1990), serotonin, a neurotransmitter in the CNS found in neural and non-neural cells (Hara and Zielinski, 2007), and stage-specific embryonic antigen 1 (SSEA- 1 ) an embryonal marker expressed in blastomeres (Gearhart et al., 2009) . NECs have been established from mammals and fish for studying neural and neuronal differentiation (Marone et al., 1995; Nardelli et al., 2003), and tight/adherens junctions (Manabe et al., 2002; Geldmacher-Voss et al., 2003). A killifish NEC line may be useful for elucidating mechanisms of adaptation in extreme environments including hypoxia and salinity tolerance, and differentiation into neural cells, such as astrocytes. Cellular differentiation would involve  51 changing the cell-matrix interaction, growth factors, vitamins, and/or serum supplemented to the media (Freshney, 2010). NECs are stem cells that give rise to all the neural and some neuronal cells in the CNS (Kintner, 2002; Götz and Huttner, 2005). During embryonic development, NECs function as neural stem cells: self-renewal, and the production of post-mitotic neurons that act as newly developed neurons (Yamashita, 2013). Initially, NECs are comprised of a single layer of cells that will form the neural plate and neural tube (Götz and Huttner, 2005), and have been shown to differentiate into neurons, oligodendrocytes, and astrocytes both in vivo and in vitro (Götz and Huttner 2005; Varga et al., 2008). These cells are sometimes named neuroblasts in an effort to delineate them as precursors to neurons. NECs represent the typical features of epithelial cells, which have shown to be a characteristic of other NEC lines when the cultures are non-differentiated (Varga et al., 2008). Given their epithelial nature, NECs may express characteristics common to all epithelial cells such as tight junctions and adherens junctions, which are located at the border between the apical and basolateral domains of the plasma membrane (Aaku-Saraste et al., 1996). During neural tube closure some specific tight junctions are lost from the NECs, whereas other tight junction proteins are increased from the neural plate to neural tube development, leading to a decrease in their epithelial nature (Aaka-Saraste et al., 1996).  3.1.1. The aims of the study It was hypothesized that KFE-1 consisted of a NEC line; therefore, this study aims to authenticate the cell line by identifying specific factors that are characteristic of NECs. Specific objectives include: (1) observe cellular morphology and NEC markers; (2) observe for cellular differentiation, such as observing for continuous cell line properties; (3) determine species  52 identification. In order to reach these objectives, specific cell functions were looked at, including immunocytochemistry, cell staining, growth curves and DNA barcoding.  3.2. Materials and methods 3.2.1. KFE-1 cell line  Primary cultures of KFE-1 were established from 7-day old F. heteroclitus embryos from the cephalic region, and after subsequent passaging a cell line was developed. The cell line was originally named KFE-S1 but later changed to KFE-1 (Gignac, 2012).  3.2.2. KFE-1 cell culture maintenance  KFE-1 cell line was maintained as described as KFE-5 (Section 2.2.2.), in regular medium. Medium were changed every 2 weeks and cells were split (passaged) at confluency and/or if vacuolation or granulation were apparent. If 30% or more of cells contained vacuoles, then media were often changed with $ to % CM. KFE-1 was observed for the presence of mycoplasma by staining with Hoechst in cultures that were incubated for 7 days (Appendix A). 3.2.3. KFE-1 cell line origin  Cells were submitted for “DNA barcoding” to identify species of origin, to confirm if the cell line originated from the specimen of interest. KFE-1 at passage 22 were used for DNA barcoding, and sent to Canadian Centre for DNA barcoding (Guelph, On, Canada) as described in Section 2.2.3. 3.2.4. Dissociation of KFE-1 cultures  KFE-1 cell line was dissociated and transferred to a new TC flask, or TC plate for experimentation (Section 2.2.4.). KFE-1 cell line were often passaged at 70% confluency or higher, and often CM were used if there were a lot of vacuolation or cellular debris present.  53 3.2.5. Cryopreservation of KFE-1  KFE-1 cell line was cryopreserved in liquid nitrogen to store for later use. Cells were cryopreserved as described in KFE-5 cell line (Section 2.2.5.), in regular medium using the slow freezing method. Only 10% FBS was used for cryopreservation with KFE-1 cultures.  3.2.6. Effect of FBS concentrations on KFE-1 cell growth  FBS concentration was tested to determine what concentration is optimal for cell proliferation of KFE-1. FBS is the most common medium supplement for fish cells (Bols and Lee, 1991), and is commonly used as a supplement to growth media to provide for cell growth, and cell attachment (Brunner et al., 2010). FBS contains distinct components, including proteins, electrolytes, attachment factors, enzymes, and carbohydrates (Lawson and Purslow, 2000). KFE-1 at passage 25 were first dissociated (Section 2.2.4.) and then resuspended in regular media. Cell concentration was estimated using a hemocytometer and cells were seeded equally in 6-well TC plates (Falcon 353046) with 60,000 cells/well (2 mL/well). Plates were incubated at 26°C for 24 hours to allow cells to adhere. After cells adhered, a cell count at day 0 was obtained in triplicate using a Coulter Counter. Media were removed and replaced with 2 mL media supplemented with the different concentrations of FBS, 0, 5, 10, and 20% in L-15 media with 1% penicillin/streptomycin. Plates were incubated at 26°C and on days 1, 2 and 4 a cell count was obtained using a Coulter Counter in triplicates with cell diameter ranging from 10-35 µm.  3.2.7. Effect of temperature on KFE-1 cell growth  KFE-1 cultures were tested at various temperatures to determine optimal temperature for cellular proliferation. KFE-1 at passage 18 was dissociated (Section 2.2.4.) and then resuspended in regular media. Cell concentration was counted using a hemocytometer and cells were equally seeded in 6-well TC plates (Falcon 353046) with 50,000 cells/well (2 mL/well) and incubated at 26°C for 24 hours to allow cells to adhere. After 24 hours a cell count for day 0 was  54 obtained in triplicate using a Coulter Counter. Plates were then moved to their test temperatures of 4, 14, 20, 26 and 32°C. Triplicate counts were obtained after days 1, 3 and 7 at these temperatures using a Coulter Counter, with the cell diameter ranging from 10-35 µm.  3.2.8. Effects of temperature on mitochondrial abundance and morphology in KFE-1 cells Mitochondrial abundance and morphology were observed in KFE-1 at different temperatures, by use of rhodamine 123, which is a fluorescent stain used for mitochondrial detection in live cells (Johnson et al., 1980). KFE-1 at passage 35 were dissociated (Section 2.2.4.) and resuspended in regular media. Cells were observed as described for the KFE-5 cell line (Section 2.2.6.), and seeded at 75,000 cells/mL (1 mL/well) in 12-well TC plates (Falcon 353043).   3.2.9. Continuous cell line properties 3.2.9.1. KFE-1 alkaline phosphatase staining  ALP staining is used to detect for stem cell-like potential. KFE-1 at passage 31 was stained as described for KFE-5 (Section 2.2.7.1.) in confluent 25 cm2 TC flasks (Falcon 353082), to detect for ALP expression.  3.2.9.2. KFE-1 spheroid body formation  Spheroid body formation was observed with KFE-1 cell line to detect for stem cell potential by using the hanging drop method (Section 2.2.7.2.). KFE-1 at passage 18 and 40 were used with 3,000 cells/20 µL droplet. KFE-1 spheroids were not plated onto a TC plate.  3.2.9.3. KFE-1 senescence staining  Senescence staining was performed on KFE-1 cell line to detect for the senescence biomarker, !-galactosidase, which is associated with decline in cellular division (Sedivy, 1998). KFE-1 at passage 20 was observed as described as KFE-5 cell line (Section 2.2.8.).   55 3.3.1. Immunocytochemistry with KFE-1 for neuroepithelial markers KFE-1 cell line appeared to have NEC characteristics, thus ICC with putative NEC markers were performed. NECs show epithelial characteristics, including tight junctions and adherens junctions that are commonly present at the cell membrane (Götz and Huttner, 2005). Other NEC markers include nestin (Tohyama et al., 1992; Nardelli et al., 2003; Butt, 2009), vimentin (Stagaard and Møllgård, 1989; Butt, 2009) and GFAP (Butt, 2009). Another antigen that was observed in KFE-1 was an embryonic stage specific marker because the cell line is derived from the embryo, and certain embryonic markers such as SSEA-1 have been shown to be expressed in neural cells (Dodd and Jessell, 1986). Table 3.1 lists the markers, the controls used, and incubation time for ICC with KFE-1 cultures. KFE-1 were fixed with ice-cold absolute methanol for 20 min or unless otherwise specified, and the ICC protocol followed is found in Appendix E.  56   Table 3.1. Antibodies and incubation conditions for ICC with KFE-1.  1° ab against Function of the ab target ab description 1° ab dilution 1° ab incubation time  Blocking buffer  2° ab 2° ab dilution 2° ab incubation time Control Passage number GFAP (Sigma G9269) IF protein; distinguishes astrocytes from other glial cells in development; found in the CNSa Rabbit anti-rat, humana 1:200 2 hours 1% skim milk goat anti-rabbit IgG (A31565 Invitrogen) 1:1200 40 min No 1° ab 25 Vimentin (Sigma V5255)  IF protein; maintains cell shape and integrity; expressed in mesenchymal cellsa Mouse anti-human, frog, rat, rabbit, mouse, chickena 1:200 2 hours 1% skim milk goat anti-mouse IgG (A11001 invitrogen) 1:1200 40 min  No 1° ab 27 Neurofilament-200 (Sigma N4142) IF protein found in cells/tissues that contain neuronal origina Rabbit anti- wide range, bovinea 1:200 2 hours 1% skim milk goat anti-rabbit IgG (A31565 Invitrogen) 1:1200 40 min No 1° ab 25 ZO-1*¥ (Invitrogen 61-7300) Tight junction marker; binds to claudin, occludin and junctional adhesion molecule proteinb Rabbit anti- human, canine, mouse, rat, and guinea pigb 1:100 24 hours 10% goat serum, 0.1% triton X, 4% BSA goat anti-rabbit IgG (A31565 Invitrogen) 1:1000 24 hours No 1° ab 27     57    Table 3.1. Cont’d.  1° ab against Function of the target ab ab description 1° ab dilution 1° ab incubation time  Blocking buffer  2° ab 2° ab dilution 2° ab incubation time Control Passage number Occludin (Invitrogen 71-1500) Tight junction marker; found in epithelial and endothelial cells; creates a barrier to the diffusion of solutesb Rabbit anti-human, mouse, rat, canineb 1:100 24 hours 10% goat serum, 0.1% triton X, 3% BSA goat anti-rabbit IgG (A31565 Invitrogen) 1:1000 1 hour No 1° ab 27 Serotonin (Sigma S5545) Neurotransmitter in the CNS found in neural and non-neural structuresa Rabbit anti-rat, humana 1:1000 1 hour 5% goat serum, 0.1% triton X, 1% BSA goat anti-rabbit IgG (A31565 Invitrogen) 1:1000 1 hour No 1° ab 35* SSEA-1 (DSHB MC-480) Stage specific embryonic antigen. Marker of undifferentiated embryonic stem cellsa  Mouse anti-human, mouse 1:100 24 hours 7.5% goat serum, 0.1% triton X, 1% BSA goat anti-mouse IgM (A21426 Life Technologies) 1:1000 2 hours No 1° ab; ZEB2J cell line 35* Function description and species reactivity from either Sigmaa (www.sigmaaldrich.com) or Life Technologiesb (www.lifetechnologies.com) Secondary ab’s are Alexa Fluor® labeled Bovine serum albumin (BSA) Developmental Studies Hybridoma Bank (DSHB) Immunoglobulin G (IgG) Immunoglobulin M (IgM) * Cells fixed with paraformaldehyde ¥ Cells incubated for one week before fixation 58 3.3.2. Data analysis Statistical analysis of the data was performed using commercial statistical software, GraphPad Prism. Mean ± standard deviation was calculated for each data point. Growth curve for FBS was tested using a one-way ANOVA with a post-hoc Dunnett test, comparing the FBS concentrations at each day to the control (0% FBS). The effects of temperature on growth were analyzed using a one-way ANOVA with a post-hoc Dunnett test, comparing the number of cells at each temperature on each day to that of the control (20°C) cells on that day. Data from ALP staining was analyzed using a one-way ANOVA and a post-hoc Tukey-Kramer multiple comparison test. Data from Senescence staining was analyzed using a one-way ANOVA and a post-hoc Dunnett test with eel brain cell line used as the control.    59 3.4. Results  3.4.1. KFE-1 cell line authentication  DNA barcoding of KFE-1 at passage 22 produced a 655-bp fragment that yielded a 99.85% sequence identity match to reference sequence profiles derived from F. heteroclitus on the Barcode of Life Database and 99% match with F. heteroclitus CO1 (Accession No FJ445403) in the NCBI database (Section 2.4.1.).  3.4.2. KFE-1 cell morphology KFE-1 under-confluent cultures showed a fibroblastic morphology (Figure 3.1 A), whereas confluent cultures had an epithelial morphology, which is similar to other neuroectodermal cells (Varga et al., 2008) (Figure 3.1 B). Cells ranged in size from approximately 50 to 100 "m in diameter, and were polygonal in shape. The cells showed vacuolation and granulation when flasks became super-confluent (Figure 3.1 C & D). KFE-1 was also stained with Hoechst to observe for the presence of mycoplasma, with phase contrast and fluorescent microscopy (Figure 3.2); and the presence of myocoplasma was not observed.   60                        Figure 3.1. Phase contrast micrographs of KFE-1 cell line morphology at passage 25. Panel (A) under-confluent; Panel (B) confluent; Panel (C) super-confluent; Panel (D) shows increased magnification of inset in (C), emphasizing granules and vacuoles located in the cytoplasm of super- confluent cultures. Arrows pointing to vacuoles and arrowheads pointing to granules. Photomicrographs were taken with a phase contrast Olympus microscope. Scale bar = 100 "m.     Figure 3.2. Confluent cultures of KFE-1 at passage 17 stained with Hoechst to detect for the presence of myocoplasma. Panel (A) phase contrast; Panel (B) fluorescence. Images taken with a Nikon TE300 fluorescent microscope. Scale bar = 100 "m.   61 3.4.3. Thawing KFE-1 cell line KFE-1 cell line was frozen in liquid nitrogen and thawed after >1 month of freezing. The cell line was initially frozen in 10% FBS with 10% DMSO and placed directly into liquid nitrogen; however, an increase in cell viability was observed when cells were held in nitrogen vapor for 24 hours, then moved to liquid nitrogen to be held indefinitely (Table 3.2).   Table 3.2. KFE-1 cell line viability after thawing. Cultures were cryopreserved for >1 month in liquid nitrogen before they were thawed.  Cell line 10% FBS (Liquid indefinitely) 10% FBS (24 hours vapor, liquid indefinitely) KFE-1  26.0% a 72.0% b 27.0% a 66.6% b Passage numbers: a: 14; b: 22.   3.4.4. KFE-1 growth curves using various concentrations of FBS  KFE-1 appeared to have an increase in cell proliferation with 5% to 20% FBS (Figure 3.3). Cells with no FBS show an immediate decline in cell number after one day incubation, whereas 10% and 20% FBS showed comparable results; therefore, 10% FBS is optimal for cell growth and maintenance of KFE-1 cell line.    62  3.4.5. Growth temperature preference on KFE-1  KFE-1 has been shown to grow well at warm temperatures of 26°C (Figure 3.4). It appears that KFE-1 cells almost double in one week of incubation at 26°C, and cell growth declines at colder (4-20°C) and higher temperatures (32°C). There is a small increase in cell growth with the high temperature (32°C), and cells have shown to maintain cellular shape (Figure 3.5).       Figure 3.3. Effect of Fetal Bovine Serum concentration on KFE-1 proliferation over 4 days. KFE-1 cells were seeded at passage 25 and received FBS at concentrations of 0, 5, 10, and 20% and were incubated at 26 ° C. Cell count was counted using a Coulter Counter. The means ± standard deviation (n=3) are plotted. A one-way ANOVA followed by a post-hoc Dunnett test was used to compare FBS concentrations to the control (0% FBS) for each time interval in days (p<0.001*). Asterisks colour corresponds with FBS concentration colour in legend.   63    Figure 3.5. Phase contrast micrographs of KFE-1 cultures displaying increased cell size with increasing temperature. KFE-1 cells at passage 25 were incubated for 7 days at temperatures 4, 14, 30, 26, and 32°C. Red outlined cells emphasize increasing cell size with increase in temperature. Images were taken on day 7 with a phase contrast Olympus microscope. Scale bar = 100 µm.                 Figure 3.4. Temperature effects on KFE-1 cells over 7 days. Cells were seeded at passage 18 and incubated at 4, 14, 20, 26, and 32°C. Cell count was counted using Coulter Counter. The means ± standard deviation (n=3) are plotted. A one-way ANOVA followed by a post-hoc Dunnett test was used to compare temperatures to the control (20°C) for each time interval in days (p<0.01*). Asterisks colour corresponds with temperature colour in legend.   64 3.4.6. Effects of temperature on mitochondrial abundance and morphology in KFE-5 cells Mitochondrial abundance and morphology was observed in KFE-1 cell line over different temperatures using a fluorescent marker for mitochondria (rhodamine 123). Cells were incubated at temperatures from 4°C to 37°C and images shown were taken on day 7 (Figure 3.6). Mitochondria at 4°C appeared to be globular to ovoidal in shape and were not well defined, whereas at 18°C the mitochondria were elongated, filamentous, and tubular. At higher temperatures, cells had globular mitochondria (26°C), or ones that were small and spherical in shape (37°C).   65              Figure 3.6. KFE-1 live cells stained with rhodamine 123 for mitochondria. KFE-1 cells at passage 35 were incubated at 4, 18, 26 and 37°C. Images shown were taken on day 7. Left side depicts phase contrast images of rhodamine 123 stained cells and right side depicts fluorescence images of same cells. Images were taken using a Nikon TE300 inverted phase contrast microscope. Scale bar = 50 µm.  66 3.4.7. Continuous cell line properties 3.4.7.1. Alkaline phosphatase staining with KFE-1 KFE-1 showed intense ALP staining in clusters of cells throughout the culture (Figure A1; Appendix F). KFE-1 expressed 56.6% positive cells for the ALP stain (Figure A2; Appendix F).  3.4.7.2. KFE-1 Spheroid body formation  KFE-1 cell line was able to form solid spheroid bodies using the hanging drop method after 72 hours incubation at RT (Figure 3.7). Some of the spheroid bodies had loose clusters of cells surrounding them (Figure 3.7 A & B). Cultures with increased passage number showed more compact spheroid bodies (Figure 3.7 C), and the spheroids were approximately 97.4 µm in diameter.               Figure 3.7. Phase contrast micrographs of KFE-1 spheroid bodies. Photomicrographs of spheroid body formation over 72-hours using the hanging drop method. Panel (A,B) KFE-1 at passage 18 showed loose spheroid formation. Panel (C) KFE-1 at passage 40 showed compact spheroid body formation. Spheroid diameter size: Mean: 97.4 µm ± 11.2 µm (n=10). Images were taken with a phase contrast Olympus (A,B), and Motic AE31 (C) microscope. Scale bar = 50 µm.  67 3.4.7.3. KFE-1 senescence staining  KFE-1 showed weak positive staining for the senescence marker "-galactosidase (Figure A3; Appendix G). KFE-1 had relatively low levels of "-galactosidase expression, with 8.22% cells positive (Figure A4; Appendix G).  3.4.8. KFE-1 immunocytochemistry  KFE-1 cell line showed positive staining for NEC markers (Figure 3.8). Vimentin staining was positive throughout all the cells. ZO-1, was expressed at the periphery of the cells, but stained some cells more strongly than other (Figure 3.8 D); whereas occludin was not expressed in any of the cells (Figure 3.8 F). NF-200 was moderately expressed in some of the cells (Figure 3.8 H), and GFAP was also only observed in some of the cells (Figure 3.8 J). Serotonin was expressed in all cells stained (Figure 3.8 L). None of the controls showed any staining, except for a small amount of background staining in the control for serotonin (Figure 3.8 K).  KFE-1 was also examined for expression of SSEA-1, a marker for embryonic cells, and it was not positive for this marker (Figure 3.9 B). The positive control cell line (ZEB2J) was positive for SSEA-1 (Figure 3.9 C) and this cell line has previously been shown to be positive for this antigen (Xing et al., 2008), expressing red fluorescence in some of the cells.   68        Figure 3.8. Immunocytochemical staining of KFE-1 cells with vimentin, ZO-1, occludin, NF-200, GFAP, and serotonin. Panels (A-F) KFE-1 at passage 27, (G-J) at passage 25, (K-L) at passage 35. Panels A, C, E, G, I & K controls (with Alexa Fluor labeled secondary antibodies only). Panel (B): anti-vimentin 1:200. Panel (D): anti-ZO-1 1:100. Panel (F): anti-occludin 1:100. Panel (H) anti-NF-200 1:200. Panel (J): anti-GFAP 1:200. Panel (L) anti-serotonin 1:1,000. All cells were post stained with DAPI (nuclei blue). Images taken with a Zeiss confocal scanning microscope. Scale bar = 100 µm.  69                           Figure 3.9. Immunocytochemical staining of KFE-1 cells with SSEA-1. Panels (A,B) KFE-1 at passage 35. Panels (C,D) ZEB2J at passage 104. Panels (A & C) are controls (with Alexa Fluor labeled secondary antibodies only). Panels (B & D): anti-SSEA-1 1:100. Arrows are pointing to positive red fluorescence. All cells were post stained with DAPI (nuclei green). Images taken with a Zeiss confocal scanning microscope. Scale bar = 100 µm.  70 3.5. Discussion   The current study supports the hypothesis that KFE-1 does consist of an epithelial cell line with neuroepithelial characteristics. This point is clearly illustrated by the epithelial morphology of the cultures, as well as positive expression for specific NEC markers. Furthermore, the cells were also positive for few stem cell markers and show relatively low levels of senescence. This provides evidence of a successful F. heteroclitus NEC line.  A cell line, KFE-1 derived from the cephalic region of killifish F. heteroclitus embryo was developed. KFE-1 has been subcultured for more than 50 passages for 3 years to date. KFE-1 was confirmed as being derived from F. heteroclitus, via DNA barcoding, and the cell line’s morphology appears similar to the mouse embryonic NEC line, NE-4C (Varga et al., 2008), appearing epithelial-like in confluent cultures.  As a morphological perspective, super-confluent cultures showed vacuolation and granulation in the cells, which could indicate a pH shift in the media to a more alkalotic pH as well as increased ammonia due to high metabolic activity. Cells secrete a number of metabolites and proteins into the culture medium and deamination of glutamine in the L-15 medium during cell metabolism can produce an increase in ammonia, which is toxic and can restrict cell growth (Freshney, 2005). Vacuolization in response to ammonia and/or amine containing compounds have been widely reported in cell lines (Gregorios et al., 1985; Dayeh et al., 2009), and vacuolation is also commonly detected in neural cells (Gregorios et al, 1985; Naumann et l., 2004). The increase in vacuolization and granulation in confluent cultures of KFE-1 cell line could be a result of medium inadequacy and/or increased cellular proliferation causing an increase in cell metabolites. When confluent cultures were split (passaged) to a new culture vessel, vacuolation and granulation was no longer apparent (data not shown).   71  Morphological observation is a simple and direct approach to identify cells, but is not the most effective way to determine the cell type that is present in a culture. Therefore, other measures must be employed in order to successfully identify the lineage or tissue of origin. An effective way to determine the cell type is using antibody detection, thus, NEC markers were observed in KFE-1 cultures, aided by immunocytochemical staining.  The presence of tight and adherens junctions is characteristic of the plasma membrane of NECs (Götz and Huttner, 2005). Components of tight junctional complexes in functional epithelium ZO-1, but not occludin, were immunochemically detected in the confluent KFE-1 monolayers. NECs that were not positive for occludin, but show ZO-1 expression, may represent cells involved in neural tube closure (Aaku-Sarasate et al., 1996). The study conducted by Aaku-Sarasate et al., (1996) found that ZO-1 expression increases from the neural plate to the neural tube stage prior to the onset of neurogenesis, and occludin expression is diminished in NECs. The loss of the tight junction protein occludin in NECs may suggest a decrease in their epithelial nature before the NECs form into a neural or neuronal cell type (Aaku-Saraste et al., 1996). As a result, since KFE-1 is derived from a late-stage embryo, the expression of ZO-1, and not occludin, may suggest that KFE-1 contains NECs that are differentiating into a neural cell type, such as an astrocyte, or other glial cells.  During embryonic development neural progenitor cells from embryonic stem cells differentiate to specialized neural cell types such as astrocytes, oligodendrocytes, and mature neurons (Reubinoff et al., 2001). Astrocytic cells show positive expression for vimentin (Webster and Åström, 2009) that is commonly expressed in mesenchymal-derived cells (Mescher, 2010). In addition, vimentin is an intracellular neural stem cell marker and is expressed at certain stages of embryonic development in NECs (Houle and Fedoroff, 1983;  72 Stagaard and Møllgård, 1989; Schiffer, 2006). It has been stated that vimentin can be used as a marker for early glial differentiation (Webster and Åström, 2009). In humans, vimentin is weakly expressed in undifferentiated NECs (Sarnat, 2008), and a study done on rainbow trout showed that vimentin is expressed in many tissue types, including retinal cells, ocular lens tissue, and glial cells of the spinal cord and brain (Herrman et al., 1996). Therefore, vimentin expression in KFE-1 may suggest an undifferentiated NEC found in the CNS that has yet to make its initial cell fate.  NECs constitute the majority of the CNS and are potentially capable of generating into glial and neuronal cell lineages (Götz and Huttner, 2005). To further confirm KFE-1 cell line’s neuroepithelial hypothesis, cells were stained for neural markers: NF-200, serotonin, and GFAP. NECs have been shown to contain monoamines, particularly, serotonin (Hara and Zielinski, 2007). Serotonin was detected in the cytoplasm of all cells, while NF-200 and GFAP were only detected in a few cells of the cultures. Since only some cells showed immunoreactivity to NF-200 and GFAP, this could suggest that the KFE-1 cell line is differentiating into a neural specific cell type upon reaching confluency. KFE-1 could also be from NECs expressed in the gills of fish. NECs in fish gill filament showed tight junctions and expression of serotonin (Dunel-Erb et al., 1982; Regan et al., 2011).  Stage-specific embryonic antigens are cell-surface molecules that express tissue-specific patterns during development. These antigens act as beneficial markers for identifying embryonic stem cells (Fenderson et al., 2006). SSEA-1 is an antigen expressed in the blastomeres of late-cleavage and morula-stage embryos (Gearhart et al., 2009). SSEA-1 was also detected in the adult mouse CNS (Capela and Temple, 2002), and was expressed in early embryonic development in the neuroepithelium and later seen in the neural tube (Fox et al., 1981).  73 Expression of SSEA-1 positive cells in the mouse CNS comprised of neural stem cells, and later in development the antigen expression was restricted to neuronal brain regions as well as in the spinal cord (Dodd and Jessell, 1986). SSEA-1 is a carbohydrate (Dodd and Jessell, 1986; Ohmori et al., 1989; Sasado et al., 1999) and not a protein, thus unlike protein antigens, monoclonal antibodies should work in all systems (such as fish) if the carbohydrate groups are present. SSEA-1 is mainly expressed in mouse embryonal carcinoma and embryonic stem cells (Gearhart et al., 2009); however, it has also been expressed in fish embryos at the in vivo (Sasado et al., 1999) and in vitro level (Dash et al., 2008; Xing et al., 2008). SSEA-1 has been known to be a hallmark of identifying undifferentiated stem cells (Gearhart et al., 2009); and cellular differentiation has been characterized as a disappearance of this particular antigen (Gearhart et al., 2009). KFE-1 cultures were not positive for SSEA-1 and cultures were compared to the control cell line, ZEB2J, which has previously been shown to be positive for SSEA-1 (Xing et al., 2008). Negative expression of SSEA-1 in KFE-1 cultures suggests that this cell line was derived from a late-stage embryo, unlike the ZEB2J cells that had been derived from blastula-stage embryos (Xing et al., 2008).   In vitro temperature range for cultured fish cells is relatively comparable to temperature zones for whole organisms (Bols et al., 1992). At the whole-organism level F. heteroclitus has been shown to have an optimal temperature range between 25-30°C (Fangue et al., 2009; Schulte et al., 2011; Healy and Schulte, 2012; Schulte, 2014); and KFE-1 cultures proliferated best at 26°C. KFE-1 were occasionally held at RT (~22°C) to slow cell growth, thus reducing the effort required for cell culture maintenance. Temperature also appeared to affect KFE-1 cell size; colder temperature caused the cells to look smaller and at warmer temperatures the cells tended to look larger. This might not be an actual change in the cell size, but might be the result of the  74 cells contracting at colder temperatures, rather than being spread out or flattened at the warmer temperatures. KFE-1 mitochondria displayed a dramatic change in mitochondrial appearance at different temperatures. The morphology of mitochondria is a dynamic process that will vary in every cell type in response to a variety of conditions and signals (Scott and Logan, 2008; Scott and Youle, 2010). Recently it has been shown that temperature can induce autophagy as a stress response, causing the cells to undergo changes to protect themselves against potential damage (Kroemer et al., 2010). Elongated mitochondria have previously been shown to be unaffected by autophagic degradation and maintain ATP production (Gomes et al., 2011; Gomes and Scorrano, 2011). Contrary to that, when elongation is no longer present or blocked, mitochondria consume ATP and induce cell death (Gomes et al., 2011). Also, the quality of mitochondria is maintained through mitophagy, a form of autophagy whereby defective mitochondria are selectively degraded and might be caused by nutrient depletion (Chen and Chan, 2009; Archer, 2013). Therefore, changes in mitochondria morphology may determine cell fate. Extreme temperatures (4°C and 37°C) caused the mitochondria morphology to appear globular and spherical in shape, respectively, and may be indicative of an intracellular stress response.  Serum is used as a supplement to tissue and cell culture media, supplying growth factors, macromolecules and carrier proteins (Gstraunthaler, 2003). FBS is the most commonly used serum to supplement media, due to its abundance of growth factors (Gstraunthaler, 2003; Mothersill and Austin, 2003; Witzeneder et al., 2013). FBS is effective in most human and animal culture media and shows substantial cell proliferation (Gstraunthaler, 2003). Optimal growth parameters for KFE-1 cell line, such as serum concentration were determined, and were significant with 5-20% FBS. Cultures were supplemented with 10% FBS to be consistent with  75 other killifish cell lines. KFE-1 cell line compares with other studies; supplementing FBS to media at a concentration of 10% (v/v) (Gstraunthaler, 2003; Mothersill and Austin, 2003). Embryonic cell lines may comprise of stem cells that can differentiate into a specialized cell type. Stem cell markers include ALP expression and in vertebrates, ALP expression has shown to be detected in embryonic stem cells (Hong et al., 1996), intestinal cells (Sekiguchi et al., 2012), endothelial cells and pericytes (Lindner et al., 1998), as well as bone and liver (Singh et al., 2012), to name a few. In this study, a leukocyte ALP staining kit was used to observe ALP positive cells, and ALP expression was detected in KFE-1 cultures. Positive expression of ALP is not the only marker for stem cells and can be observed in a number of other cell types as listed above, therefore, other methods must be applied. Spheroid body formation was observed, and KFE-1 was capable of forming compact spheroid bodies in suspension culture. Loose cells surrounding the spheroid body were thought to be cells that were differentiating and thereby failed to form a solid sphere of cells. This stem cell-like formation of spheroid bodies has been seen in other fish cell lines (Xing et al., 2008; Vo et al., 2010), as well as in mammalian stem cells (Kurosawa, 2007; Zhou et al., 2010). Other stem cells that have shown to have stem cell potential are NECs, and are often called neural stem cells and are capable of generating into neurons, astrocytes, and oligodendrocytes (Götz and Huttner, 2005). Thus, seeing that KFE-1 has stem cell-like characteristics, such as ALP expression and the ability to form substantial spheroid bodies supports the hypothesis that KFE-1 cells are of neuroepithelial origin.    Cells can lose the ability to proliferate and can replicate only a finite number of times before they senesce (Hayflick and Moorhead, 1961; Shay and Wright, 2000). Senescence associated "-galactosidase expression identifies senescent cells, yielding a blue colour (Debacq-Chainiaux et al., 2009). The senescence associated marker "-galactosidase was positive in 8.22%  76 KFE-1 cells. This low senescence may be characteristic of most fish possibly due to their retained telomerase activity (Klapper et al., 1998). Some fish species can grow with little senescence due to high telomerase activity and as a consequence, fish cell lines may be considered immortal or continuous (Klapper et al., 1998; Ossum et al., 2004). This study provides some evidence of a successful F. heteroclitus NEC line. It was shown that cultures were positive for several neuroepithelial characteristics and responses to temperature were consistent with in vivo models. Furthermore, the cell line appears to be continuous and does not show signs of cell ageing.     77 CHAPTER 4: KFE-3 CELL LINE CHARACTERIZATION 4.1. Liver cell cultures  In this chapter, partial characterization of a new cell line killifish embryo 3 (KFE-3), with epithelial characteristics, possibly derived from liver tissue of a pre-hatch F. heteroclitus embryo is reported. KFE-3 cell line was hypothesized to be an epithelial cell line derived from the internal trunk region of the embryo, and because it shows similar characteristics to other liver cell lines, it was thought to be a liver-like cell line. A cell line with liver characteristics could be used as a tool for measuring the toxic potency of environmental contaminants, and can be compared to other in vitro and in vivo studies. Specific liver cell detection involves screening for specific cell types derived from the liver, as well as induction of cytochrome P4501A (CYP1A), as cytochrome P450 enzymes are mainly concentrated in the liver (Whyte et al., 2000). These enzymes can be tested using ethoxyresorufin-O-deethylase (EROD) assay that monitors enzyme CYP1A (Petrulis et al., 2001); however, due to time constraints, this assay was not conducted in this thesis.  The liver in fish has many similarities to the liver in other animals, and its main functions are to secrete bile, metabolize nutrients, remove old blood cells, eliminate waste, synthesize plasma proteins, and secrete hormones (Buddington and Kuz’mina, 2000; Stanfield and Germann, 2009). The liver contains at least 10 different cell types (Lester et al., 1993), and the most abundant liver cell type is the hepatocyte. Hepatocytes make up approximately 80-85% of the total liver volume (Hampton et al., 1989). Several other liver cell types include oval cells, which are intrahepatic stem cells (Erker and Grompe, 2008), biliary epithelial cells that contribute to bile secretion (Joplin, 1994), sinusoidal endothelial cells that form the wall of the hepatic vasculature (Di Giulio and Hinton, 2008), Kupffer cells, which are primarily found in mammals—although there is now increasing evidence of cells in fish that resemble Kupffer cells,  78 acting as a defense system (Di Giulio and Hinton, 2008), and hepatic stellate cells (HSC) that form the connective tissue of the teleost liver, providing a supportive framework (Di Giulio and Hinton, 2008).  Liver cell lines have been established from a variety of vertebrates: fish (Lee et al., 1993; Ghosh et al., 1994), humans (Javitt, 1990), chickens (Hermann et al., 2003), mice (Pan et al., 2008), among others. Fish cell lines have been mainly used for toxicological exposure testing, and can contribute to the understanding of the biochemistry and cell biology of the liver (Lee et al., 1993; Guguen-Guillouzo and Guillouzo, 2010). Liver cell lines derived from fish, such as rainbow trout liver cell line (RTL-W1), has been widely applied in toxicity exposure testing (Dayeh et al., 2005; Schnell et al., 2009; Wetterauer et al., 2012). RTL-W1 has also been fully characterized (Malhão et al., 2013), observed for evaluating CYP1A (Lee et al., 1993), as well as EROD enzyme activity caused by toxicant exposure testing (Lee et al., 1993; Bols et al., 1999; Schirmer et al., 2004). RTL-W1 has shown promise to compare to whole-organismal studies (Billiard et al., 2004); thus, liver cell cultures are beneficial for biochemical studies, as well as toxicological research (Bols and Lee, 1991). 4.1.1. The aims of the study  It was hypothesized that KFE-3 consisted of a liver-like cell line; therefore, this study aims to authenticate the cell line by identifying factors that are characteristic of liver cells. Specific objectives include: (1) observe cellular morphology; (2) observe for cellular differentiation, such as observing for continuous cell line properties; (3) determine species identification. In order to reach these objectives, specific cell functions were looked at, including immunocytochemistry, cell staining, growth curves and DNA barcoding.   79 4.2. Materials and methods 4.2.1. KFE-3 cell line  Primary cultures of KFE-3 were established from a 7-day old F. heteroclitus embryo (distinct from the ones that gave rise to KFE-1 or KFE-5) from the mid-body region of the embryo, and after subsequent passaging a cell line was developed (Gignac, 2012).  4.2.2. KFE-3 cell culture maintenance  KFE-3 cell line was maintained as described for KFE-5 (Section 2.2.2.), in regular medium. Medium were changed every 2-3 weeks and cells were split (passaged) at confluency. KFE-3 was observed for the presence of mycoplasma by staining with Hoechst in cultures that were incubated for 4 days (Appendix A). 4.2.3. KFE-3 cell line origin  Cells were submitted for “DNA barcoding” to identify species of origin, to confirm if the cell line originated from the specimen of interest. KFE-3 at passage 16 were used for DNA barcoding, and sent to Canadian Centre for DNA barcoding (Guelph, On, Canada) as described in Section 2.2.3.  4.2.4. Dissociation of KFE-3 cultures  KFE-3 cell line was dissociated and transferred to a new TC flask, or TC plate for experimentation (Section 2.2.4.). KFE-3 cell line was often passaged at 90% confluency or in super-confluent cultures (100%+). 4.2.5. Cryopreservation of KFE-3  KFE-3 cell line was cryopreserved in liquid nitrogen to store for later use. Cells were cryopreserved as described in KFE-5 cell line (Section 2.2.5.), in regular medium using the slow freezing method. Only 10% FBS was used for cryopreservation with KFE-3 cultures.     80 4.2.6. Effect of FBS concentrations on KFE-3 cell growth  To determine the optimal FBS concentration for cell proliferation, KFE-3 at passage 20 were first dissociated (Section 2.2.4.) and then resuspended in regular media. Cell concentration was estimated using hemocytometer and cells were seeded equally in 6-well TC plates (Falcon 353046) with 100,000 cells/well (2 mL/well) and incubated for 26°C for 24 hours to allow cells to adhere. FBS growth curves were obtained as described for the KFE-1 cell line (Section 3.2.6.). After cells had adhered, a cell count at day 0 was obtained in triplicate using a Coulter Counter. Media were removed and replaced with 2 mL media supplemented with the different concentrations of FBS. Plates were incubated at 26°C and on days 2, 4, and 6 a cell count was obtained using a Coulter Counter in triplicates with the cell diameter ranging from 10-35 µm.  4.2.7. Effect of temperature on KFE-3 cell growth  KFE-3 at passage 27 was dissociated (Section 2.2.4.) and cells were then resuspended in regular media. Cell concentration was counted using a hemocytometer and cells were equally seeded in 6-well TC plates (Falcon 353046) with 50,000 cells/well (2 mL/well) and incubated at 26°C for 24 hours to allow cells to adhere. The effects of temperature on KFE-3 growth curve were observed as described for the KFE-1 cell line (Section 3.2.7). Cells were incubated at temperatures 4, 14, 20, 26, and 30°C. Triplicate counts were obtained on days 3, 6, and 10 using a Guava Flow CytometryTM.  4.2.8. Effects of temperature on mitochondrial abundance and morphology in KFE-3 cells Mitochondrial abundance and morphology were observed in KFE-3 at different temperatures, by use of rhodamine 123. KFE-3 at passage 26 were dissociated (Section 2.2.4.) and resuspended in regular media. Cells were observed as described for the KFE-5 cell line (Section 2.2.6.), and seeded at 200,000 cells/mL (1 mL/well) in 12-well TC plates (Falcon 353043).    81 4.2.9. Continuous cell line properties 4.2.9.1. KFE-3 Alkaline phosphatase staining  ALP staining is used to detect for stem cell-like potential. KFE-3 at passage 21 was stained as described as KFE-5 (Section 2.2.7.1) in confluent 25 cm2 TC flasks (Falcon 353082), to detect for ALP expression.  4.2.9.2. KFE-3 Spheroid body formation  Spheroid body formation was observed with KFE-3 cell line to detect for stem cell potential by using the hanging drop method (Section 2.2.7.2.). KFE-3 at passages 19 and 27 were used with 3,000 cells/20 µL droplet. KFE-3 spheroids were not plated onto a TC plate. 4.2.9.3. KFE-3 senescence staining  Senescence staining was performed on KFE-3 cell line to detect for the senescence biomarker, "-galactosidase, which is linked with decline in cellular division (Sedivy, 1998). KFE-3 at passage 14 was observed as described for the KFE-5 cell line (Section 2.2.8.).  4.3.1. Immunocytochemistry with KFE-3  KFE-3 cell line is thought to be derived from liver tissue, but cell identity as to whether they are hepatocytes or other liver cells types remains to be elucidated. The main characteristics of hepatocytes are the ability to produce collagen (Chojkier, 1986), albumin (Kaighn and Prince, 1971), as well as other liver cell characteristics, including expression of vimentin and cytokeratin (Marceau et al., 1986). Table 4.1 lists the markers, the controls used, and incubation time for ICC with KFE-3 cultures. KFE-3 were fixed with ice cold absolute methanol for 20 min and the ICC was performed as described in Appendix E.     82 Table 4. 1. Antibodies and incubation conditions for ICC with KFE-3.  1° ab against Function of the target ab ab description 1° ab dilution 1° ab incubation time  Blocking buffer  2° ab 2° ab dilution 2° ab incubation time Control Passage number Vimentin (Sigma V5255)  IF protein; maintains cell shape and integrity; expressed in mesenchymal cellsa Mouse anti- human, frog, rat, rabbit, mouse, chickena 1:200 2 hours 1% skim milk goat anti-rabbit IgG (A31565 Invitrogen) 1:1200 40 min No 1° ab  26 ZO-1 (Invitrogen 61-7300) Tight junction marker; binds to claudin, occludin and junctional adhesion molecule proteinsb Rabbit-anti human, canine, mouse, rat, and guinea pigb 1:100  24 hours 10% goat serum, 0.1% triton X, 4% BSA goat anti-rabbit IgG (A31565 Invitrogen) 1:1000 24 hours  No 1° ab  27 * 1:200  24 hours 10% goat serum, 0.1% triton X, 4% BSA goat anti-rabbit IgG (A31565 Invitrogen) 1:1000 24 hours No 1° ab 26 ¥ Function description from Sigmaa (www.sigmaaldrich.com) or Life Technologiesb (www.lifetechnologies.com) Secondary ab’s are Alexa Fluor® labeled * 24 hours incubation before cells were fixed ¥ 1 week incubation before cells were fixed     83 4.3.2. Data analysis Statistical analysis of the data was performed using commercial statistical software, GraphPad Prism. Mean ± standard deviation was calculated for each group. The effects of FBS on growth were tested using a one-way ANOVA with a post-hoc Dunnett test, comparing cell numbers at each FBS concentrations at each day to the control (0% FBS). The effects of temperature on growth were analyzed using a one-way ANOVA with a post-hoc Dunnett test, comparing the temperature at each day to the control (20°C). Data from ALP staining was tested using a one-way ANOVA and a post-hoc Tukey-Kramer multiple comparison test. Data from Senescence staining was tested using a one-way ANOVA and a post-hoc Dunnett test with eel brain cell line used as the control.    84 4.4. Results  4.4.1. KFE-3 cell line authentication  DNA barcoding of KFE-4 at passage 16 produced a 655-bp fragment that yielded a 99.85% sequence identity match to reference sequence profiles derived from F. heteroclitus on the Barcode of Life Database and 99% match with F. heteroclitus CO1 (Accession No FJ445403) in the NCBI database (Section 2.4.1.).  4.4.2. KFE-3 cell morphology  KFE-3 contained mononucleated adherent cells. Under-confluent cultures showed a fibroblastic morphology (Figure 4.1 A); however, confluent cultures showed a mix of fibroblastic cells with compact, polygonal shaped cells (Figure 4.1 B & C). Fibroblastic cells ranged from approximately 50 to 100 µm in length, while polygonal cells were more spherical in shape and were approximately 25 µm in diameter. Super-confluent cultures displayed cells multilayer growth foci of aggregating on top of one another, forming large clusters of cells (Figure 4.1 D). Aggregated cells in culture were observed in cultures that were not passaged for several weeks. Cells stained with Hoechst were mononucleated, and did not appear to have mycoplasma present (Figure 4.2).    85               Figure 4.1. Phase contrast micrographs of KFE-3 cell line morphology. Panel (A-C) passage 17; Panel (D) passage 32. Panel (A) under-confluent; Panel (B) confluent; Panel (C) confluent; Panel (D) super-confluent. Images were taken with a phase contrast Olympus microscope (A-C), and Motic AE31 microscope (D). Scale bar = 100 !m.              Figure 4.2. Under-confluent cultures of KFE-3 at passage 14 stained with Hoechst to detect for the presence of myocoplasma. Panel (A) phase contrast; Panel (B) fluorescence. Images taken with a Nikon TE300 fluorescent microscope. Scale bar = 100 !m.    86 4.4.3. Thawing KFE-3 cell line KFE-3 cell line was frozen in liquid nitrogen and thawed after >1 month of freezing. The cell line was initially frozen in 10% FBS with 10% DMSO and placed directly into liquid nitrogen; however, an increase in cell viability was observed when cells were held in nitrogen vapor for 24 hours, then moved to liquid nitrogen to be held indefinitely (Table 4.2).   Table 4.2. KFE-3 cell line viability after thawing. Cultures were cryopreserved for >1 month in liquid nitrogen before they were thawed.  Cell line 10% FBS (Liquid indefinitely) 10% FBS (24 hours vapor, liquid indefinitely) KFE-3  38.0% a 71.40% b 48.0% a 68.75% c Passage numbers: a: 14; b: 16; c: 18.       87 4.4.4. KFE-3 Growth curves using various concentrations of FBS  KFE-3 showed increased cell number with 10% FBS concentration (Figure 4.3). Cells with no FBS showed a decline in cell number after 6-days incubation, whereas 5% and 20% FBS showed minimal increase in cell number; therefore, 10% FBS supplemented L-15 media was used as optimal for cell growth and maintenance of KFE-1 cell line.                       Figure 4.3. Effect of Fetal Bovine Serum concentration on KFE-3 proliferation over 6 days. KFE-3 cells were seeded at passage 20 and received FBS at concentrations of 0, 5, 10, and 20% and were incubated at 26 ° C. Cell count was counted using a Coulter Counter. The means ± standard deviation (n=3) are plotted. A one-way ANOVA, followed by a post-hoc Dunnett test was used to compare FBS concentrations to the control (0% FBS) for each time interval in days (p<0.05*, p<0.01**, p<0.0001****). Asterisks colour corresponds with FBS concentration colour in legend.  88 4.4.5. Growth temperature preference on KFE-3  KFE-3 grew well at warm temperatures of 20 to 26°C (Figure 4.4). KFE-3 almost tripled in cell number over ten-days incubation at 26°C, whereas cell growth was slower at colder temperatures (4-14°C). Higher temperatures of 30°C showed an increase in cells up to 6-days incubation, but then cells declined in number.                      Figure 4.4. Temperature effects on KFE-3 cells over 10 days. Cells were seeded at passage 27 and incubated at 4, 14, 20, 26, and 30°C. Cell count was counted using Guava Flow CytometryTM. The means ± standard deviation (n=3) are plotted. A one-way ANOVA followed by a post-hoc Dunnett test was used to compare temperatures to the control (20°C) for each time interval in days (p<0.01*, p<0.001**, p<0.0001***). Asterisks colour corresponds with temperature colour in legend.   89 4.4.6. Effects of temperature on mitochondrial abundance and morphology in KFE-3 cells Mitochondrial abundance and morphology were observed in KFE-3 cultures at different temperatures using a fluorescent marker for mitochondria (rhodamine 123). Cells were incubated at temperatures from 4°C to 37°C and images shown were taken on day 7 (Figure 4.5). Cells were sparse at colder temperatures in comparison to warm temperatures. Mitochondria at 4°C appeared to be compact around the nucleus and filamentous in shape. At 18°C and 26°C the mitochondria were more tubular, and at 37°C the mitochondria were small and spherical in shape.   90              Figure 4.5. KFE-3 live cells stained with rhodamine 123 for mitochondria. KFE-3 cells at passage 26 were incubated at 4, 18, 26 and 37°C. Images shown were taken on day 7. Left side depicts phase contrast images of rhodamine 123 stained cells and right side depicts fluorescence images of same cells. Images were taken using a Nikon TE300 inverted phase contrast microscope. Scale bar = 50 µm.  91 4.4.7. Continuous cell line properties 4.4.7.1. Alkaline phosphatase staining with KFE-3  KFE-3 showed intense ALP staining in clusters of cells throughout the culture (Figure A1; Appendix F). KFE-3 expressed 28.6% positive cells for the ALP stain (Figure A2; Appendix F).  4.4.7.2. KFE-3 spheroid body formation KFE-3 cell line was able to form solid spheroid bodies using the hanging drop method after 72 hours incubation at RT (Figure 4.6). Younger cultures of KFE-3 were unable to form solid aggregates using the hanging drop method (Figure 4.6 A); however, older cultures could form substantial spheroid bodies (Figure 4.6 B & C) indicative of some form of differentiation. The spheroids were small in size, approximately 36.4 µm.   4.4.7.3. KFE-3 Senescence staining  KFE-3 showed moderate positive staining for the senescence marker "-galactosidase (Figure A3; Appendix G). KFE-3 showed the greatest "-galactosidase staining of the three            Figure 4.6. Phase contrast micrographs of KFE-3 spheroid bodies. Photomicrographs of spheroid body formation over 72-hours using the hanging drop method. Panel (A) KFE-3 at passage 19 showed no spheroid formation. Panel (B,C) KFE-3 at passage 27 showed compact spheroid body formation. Spheroid diameter size: Mean: 36.4 µm ± 4.1 µm (n=10). Images were taken with a phase contrast Olympus (A) and Motic AE31 (B,C) microscope. Scale bar = 50 µm.  92 killifish cell lines, with 39.7% of the cells stained (Figure A4; Appendix G). The staining was scattered throughout the KFE-3 cultures.  4.8.1. KFE-3 immunocytochemistry  KFE-3 cell line showed positive staining with for vimentin and ZO-1 (Figure 4.7). Vimentin was positively expressed throughout the cells in culture (Figure 4.7 B). After 24 hours post-passage, ZO-1 was positively expressed in the cytoplasm of the cells (Figure 4.7 D). After one week post-passage, ZO-1 was positively expressed at the periphery of the cells, with some expression seen in the cytoplasm of the cells, surrounding the nucleus (Figure 4.7 F).       Figure 4.7. Immunocytochemical staining of KFE-3 cells with vimentin and ZO-1. Panels (A,B) KFE-3 after 24-hours post-passaging at passage 26, (C-D) KFE-3 cells after 24-hours post-passaging at passage 27, (E-F) KFE-3 cells after 1 week post-passaging at passage 26. Panels A, C, and E are controls (with Alexa Fluor labeled secondary antibodies only). Panel (B): anti-vimentin 1:200. Panel (D): anti-ZO-1 1:100. Panel (F): anti-ZO-1 1:200. All cells were post stained with DAPI (nuclei blue) Arrows in panel F pointing to tight junctions. Images taken with a Zeiss confocal scanning microscope. Scale bar = 50 µm.  93 4.5. Discussion  The current study supports the hypothesis that KFE-3 may comprise of a liver-like cell line. This point is clearly illustrated by the morphology of the cultures as well as the cell lines response to temperature and ability to form spheroids. Furthermore, the cells were also positive for few stem cell markers and show moderate levels of senescence. This provides evidence of a successful F. heteroclitus liver-like cell line; however, more cellular characterization needs to be conducted in order to make a definitive conclusion.  The data presented here demonstrate that KFE-3, which is derived from the body region of a late-stage F. heteroclitus embryo, shows characteristics consistent with a liver-like cell line. KFE-3 has been subcultured for more than 40 passages for 3 years to date. KFE-3 cell line is comprised of mononucleated, adherent cells that formed compact, polygonal shaped cells once cultures reached confluency. This is consistent with RTL-W1 cell line that is predominately polygonal with fibroblastic cells present at low densities (Malhão et al., 2013). Multilayer growth foci were observed in long-term culture of KFE-3. These super-confluent cultures formed aggregations of cells throughout the culture; this was also seen in RTL-W1 in cultures that were left without being passaged (Malhão et al., 2013). However, unlike the RTL-W1 cell line, large 3D cell aggregates were not detected (Malhão et al., 2013).  In order to effectively determine the optimal growth parameters for cell proliferation growth curves are often used. Two factors were tested: serum concentration using FBS, and temperature. KFE-3 grew well in L-15 medium supplemented with 10% FBS. FBS concentration from 0% to 5% showed no increase in cell growth, and concentrations at 20% FBS show very minimal cell growth, therefore cultures were maintained with 10% FBS. Optimal growth in low FBS concentration is characteristic of another fish liver cell line, RTL-W1 (Lee et al., 1993).  94 However, RTL-W1 was able to grow with 5% FBS (Lee et al., 1993), but KFE-3 was not able to proliferate in such a low serum concentration. KFE-3 grew well at 20-26°C and showed a decline in cell growth at warmer temperatures of 30°C. KFE-3 cultures were mainly kept at RT (~22°C) to slow cell growth, thus reducing the effort needed for cell culture maintenance.  KFE-3 cultures showed a dramatic change in mitochondrial appearance with a temperature range from 4°C to 37°C. Mitochondria have been shown to fuse and divide in response to various cellular demands (Chen and Chan, 2009; Archer, 2013), and specific defects in mitochondrial fusion have been shown to decrease mitochondrial movement (Chen and Chan, 2009). Mitochondria have a quality control system known as “mitophagy” that maintains cell health by removing damaged mitochondria via lysosomes (Archer, 2013). At colder temperatures (4°C), KFE-3 mitochondria were more filamentous in shape, and became more globular and spherical at increasing temperatures (26-37°C). Changes in mitochondrial morphology may be indicative of a stress response, and be part of the cells natural way of responding to changing environments (Chen and Chan, 2009).  It was also investigated whether KFE-3 showed any indication of stem cell potential. Embryonic stem cells are pluripotent cells generally derived from the inner cell mass of embryos (Keller, 2005). These cells are in an undifferentiated state in culture, and various growth factors can induce differentiation into a specific cell type (Keller, 2005). Embryonic stem cells can spontaneously differentiate and form 3D aggregates called embryoid bodies or spheroid bodies (Kurosawa, 2007), and may express ALP, a marker of pluripotent stem cells (Hiratsuka, et al., 2011; Singh et al., 2012). KFE-3 showed moderately positive ALP expression, and older passages of KFE-3 were capable of forming compact spheroid bodies in suspension. There were minimal loose cells surrounding the spheroids that may be a result of differentiating cells. KFE-3  95 might be differentiating to a more specialized cell type, which might suggest why the cells were only moderately positive for ALP, and formed loose spheroids.  Cellular senescence is a prevalent condition with cell lines, and most cell lines have only a finite number of replicates before the cultures senesce (Hayflick and Moorhead, 1961; Shay and Wright, 2000). An interesting finding was that KFE-3 cultures were moderately positive for the senescence associated marker "-galactosidase, with 39.7% of cells expressing the blue (senescent) stain. KFE-3 also showed slow cell growth (longer incubation time before cells needed to be passaged—before cultures became confluent), which is a characteristic seen in other senescing cells (Goodwin et al., 2000).  Preliminary cell-type verification in KFE-3 cultures was aided by immunocytochemical staining. Cells had a polygonal morphology, suggestive of an epithelial-like cell. Thus, the tight junction marker ZO-1 was observed in cultures after 24-hours incubation and 1-week incubation prior to fixation. KFE-3 was positive for ZO-1 at both incubation times. ZO-1 is located in the cytoskeleton of cells and will act as a cross-linker to organize and assemble transmembrane proteins at the tight junctions to the cytoskeleton via protein-protein interactions (Phillips and Antonetti, 2007; Sasakawa, 2009). Therefore, since ZO-1 was present after only 24-hours incubation, this can indicate that ZO-1 protein is present in the cell cytoplasm before tight junctions are formed at the cytoplasmic membrane. In the cultures incubated for 1-week prior to staining, the cells showed very faint tight junction expression at the cell-cell contact sites. However, there was also noticeably faint cytoplasmic staining observed, which has also been detected in other cultures (Siliciano and Goodenough, 1988). Biliary epithelial cells represent approximately 5% of the total liver cells, and have been seen to form apical tight junctions between the cells (Lester et al., 1993; Joplin, 1994). KFE-3 cultures were also observed for  96 vimentin, an IF protein that maintains cellular shape and integrity (Mescher, 2010). Vimentin has been expressed in HSCs (Niki et al., 1999; Geerts et al., 2001; Uyama et al., 2006; Kne#evi$ et al., 2009), and is required for stellate cell growth in rodents (Geerts et al., 2001). HSCs are liver-specific pericytes and are involved in the repair, regeneration and fibrosis of the liver (Niki et al., 1999; Geerts et al., 2001). Fibroblasts in the portal connective tissue have also shown to be vimentin positive (Bhunchet and Wake, 1992). Vimentin expression in KFE-3 cultures may indicate that the cells are HSCs; however, additional characterization would be needed to confirm the cell type. Desmin and GFAP have been shown to be other markers of HSCs (Geerts, 2001; Geerts et al., 2001; Uyama et al., 2006; Carotti et al., 2008), and desmin is one of the hallmarks of HSCs (Geerts et al., 2001). Further experiments examining desmin and GFAP expression in KFE-3 would be desirable.   This study provides some evidence of a successful F. heteroclitus cell line with liver-like characteristics. It was shown that the cultures showed similar cell morphology as other fish liver cell lines, and were positive for some liver markers that could indicate the cells are HSCs. The cells could not withstand high concentrations of FBS supplemented to the media, which is a similar characteristic of other liver cell lines. Furthermore, the cell line appears to be continuous and shows minimal signs of cell ageing.       97 CHAPTER 5: POTENTIAL APPLICATIONS OF KILLIFISH CELL LINES 5.1. Applications of killifish cell lines Cell lines derived from mammalian species have been instrumental in many areas of biomedical and biotechnological research, and fish cell lines have also proven useful in an array of applications (Bols and Lee, 1991), including toxicology (Bols et al., 1985; Bols et al., 2005; Lee et al., 2008; Dayeh et al., 2013; Segner, 1998; Segner, 2004); parasitology (Monaghan et al., 2009; Monaghan et al., 2010; Pham et al., 2013) and endocrinology (Bols and lee, 1989), which are areas that have been lightly explored with the killifish cell lines in this chapter.  Cell culture models for cytotoxicity testing can be used as an indicator of biocompatibility to screen for toxic agents by testing specific cell functions (Ekwall et al., 1990; Freshney, 2001). Cytotoxicity may involve cell death or altered metabolic activity; primarily it is the adverse effects from intrusion of substances essential for survival and function (Mothersill and Austin, 2003). General toxicity studies are aimed to detect the biological activity of test substances and a variety of parameters can be employed, including enzyme activity, vital staining, and cytotoxicity endpoints, to name a few (Ekwall et al., 1990; Bols et al., 2005). Cells exposed to toxicants may respond in various ways: necrosis, apoptosis, senescence, differentiation, and/or intracellular damage (Freshney, 2001; Mothersill and Austin, 2003). However, toxic exposure will not always cause cell death as cells may undergo metabolic modifications, or withdraw from the cell cycle (Freshney, 2001). There are also numerous cytotoxicity assays available that can measure mutagenesis, malignant transformation, reproductive survival, and viability (Freshney, 2001).   In vitro cytotoxicity assays have several advantages including careful control of the physiological and physicochemical environment; allowing consistency of sample and  98 reproducibility of data (Freshney, 2001). Additionally, results can be obtained very rapidly and the toxicant concentration and length of exposure can be accurately controlled (Freshney, 2001; Dayeh et al., 2005). There are some limitations of in vitro assays, such as the difficulty of mimicking in vivo toxicokinetics as well as monitoring systemic and physiological effects in vitro (Freshney, 2001; Mothersill and Austin, 2003).   Cell culture models have also been utilized for studying viral and microbial pathogens (Bhunia, 2008; Monaghan et al., 2009; Monaghan et al., 2010; Okamoto, 2011; Arif and Pavlik, 2013; Pham et al., 2013). Certain pathogens require host cells in order to complete their life cycle; therefore, in vitro models are convenient for studying the life process of intracellular parasites (Monaghan et al., 2009). Microsporidia are obligate, intracellular pathogens of concern and are widespread among animals, and are especially prevalent in arthropods and fish (Keeling and Fast, 2002). Microsporidia cannot be cultivated axenically, due to their intracellular need to complete their life cycle, and in vivo or in vitro models are needed in order to cultivate them. Among in vitro models, cell lines derived from target tissues/species are proving to be convenient models (Joseph and Sharma, 2009). In vitro cultivation is important for several reasons: as adjunct to diagnosis, elucidating proteins that may enhance invasive properties, drug screening in order to identify therapeutic agents, studying the physiology and metabolism of the parasite, and more (Visvesvara and Garcia, 2002).  F. heteroclitus has proven a useful model at the in vivo level for a multitude of physiological and toxicological testing (Weis and Weis, 1989; Burnett et al., 2007; Whitehead et al., 2011). This species has been shown to withstand a range of environmental conditions (reviewed in Burnett et al., 2007) and support the growth of intracellular pathogens (Bond, 1937; Ahne et al., 2003). However, the lack of in vitro killifish models impedes further investigation.  99 Therefore, the establishment of a conveniently manipulable and readily available cell culture model derived from this organism is desirable.  5.1.1. Assays for acute toxicity testing  Effective cell viability assays are necessary for in vitro studies especially with cell lines to complement in vivo studies. Specific assays are simple, rapid, effective, safe and a reliable measurement of cell viability (O’Brien et al., 2000; Dayeh et al., 2013). A variety of cell-based bio-assays have been established, and the ones used in this study detect cell metabolism, plasma membrane integrity and lysosomal activity using nontoxic fluorescent indicator dyes (O’Brien et al., 2000; Bopp and Lettieri, 2008; Dayeh et al., 2013). These dyes can be applied to the cells in a multiwell (micro)plate and can be measured quantitatively; the benefits of using a multiwell (micro)plate will permit replication. These assays can be used to establish relative cytotoxicity when exposed to a range of chemicals, toxicants, or even extreme temperatures (Nakayama et al., 1997). A decrease in cell viability is the result of a decline in the results of these assays (Dayeh et al., 2009). In this study, three distinct indicator dyes were used to measure metabolic activity, membrane integrity and lysosomal function.  5.1.1.1. Metabolic activity Alamar blue (AB) is a redox indicator dye designed to measure cell metabolic activity (Bopp and Lettieri, 2008), and can be measured both fluorometrically or spectrophotometrically (O’Brien et al., 2000; Bols et al., 2005; Dayeh et al., 2013). AB uses the nonfluorescent blue redox dye resazurin; 7-hydroxy-10-oxidophenoxazin-10-ium-3-one (Nakayama et al., 1997; O’Brien et al., 2000; Rampersad, 2012). The non-fluorescent resazurin is reduced to a pink, fluorescent resorufin, through cell activity (O’Brien et al., 2000; Bopp and Lettieri, 2008). By using this assay, cells exposed to various factors, such as toxicants, can impair cellular  100 metabolism, therefore decreasing resazurin reduction (O’Brien et al., 2000). This will result in a greater fluorescence output in the viable cells.  5.1.1.2. Membrane integrity 5-carboxyfluorescein diacetate-acetoxymethyl ester (CFDA-AM) is an esterase substrate that can function as a viability probe to detect cell membrane integrity. CFDA-AM measures the conversion of a permeable membrane to carboxyfluorescein from the esterases in living cells (Bopp and Lettieri, 2008). This will indicate the integrity of the plasma membrane, since an intact membrane will require esterase activity. A decline in fluorescence units signifies impaired esterase function, and could be a result of the loss of membrane integrity or an inhibition on esterase activity (Dayeh et al., 2013).  5.1.1.3. Lysosome function Neutral red (NR) (3-amino-7-dimethylamino-2-methylphenazine hydrochloride) is an indicator dye that accumulates in the cell lysosomes of viable cells via diffusion (Dayeh et al., 2009; Dayeh et al., 2013), and can be measured both fluorometrically or spectrophotometrically. Actively functioning cells retain the dye within intact lysosomes whereas damaged/impaired cells have leaky lysosomes and are unable to retain the dye. However, the NR assay may not be a good indicator of cell viability in instances when cell vacuolation is induced that can result from various causes such as spontaneous vacuolization, bacteria or viruses (Henics and Wheatley, 1999). These can lead to lysosomal swelling and vacuolation, and NR accumulating within these elements can give false positive results. Thus, in this study, the cell lines were only observed visually for the uptake of NR accumulation inside vacuoles or lysosomes to avoid false positives that cannot be discerned from quantitative photometric assays.  101 5.1.2. The aims of the study It was hypothesized that the model contaminants, CuSO4%5H2O, will induce a decline in cellular viability and NH4Cl will increase cellular vacuolation. Therefore, this study aims to: (1) measure cellular viability after an acute exposure to CuSO4%5H2O; (2) observe cellular morphology with increasing concentration of CuSO4%5H2O; (3) observe for the presence of vacuolization in cultures exposed to NH4Cl; (4) observe for the uptake of NR dye in lysosomes.  In order to reach these objectives, specific cell viability assays were looked at, including AB, CFDA-AM and NR.  It was also hypothesized that the killifish cell lines can be infected with microsporidia, therefore, this study aims to: (1) assess the infectivity of microsporidia, A. algerae, on killifish cell lines; (2) observe if A. algerae susceptibility is influenced by cortisol exposure on KFE-5 cell line; (3) assess the infectivity of microsporidia, L. morhua, on KFE-5 cell line. In order to reach these objectives, spores were monitored for infectivity over increasing time.       102 5.2. Materials and methods 5.2.1. Toxicity  5.2.1.1. Standardization of fluorometric assays A standard curve was produced using the fluorometric AB assay to help confirm correct cell dosage number in a 96-well TC microplate. To produce a standard curve, KFE-5 at passage 26, KFE-1 at passage 18, and KFE-3 at passage 13 were first dissociated (Section 2.2.4) and counted using a hemocytometer. The initial cell count signified 100% cell concentration. Dilutions were then made from this at 50, 25, 12.5, 6.25, 3.125, 1.65, 0.78% of the initial cell number supplemented with regular media. For each concentration 100 µL of the cell suspension was manually seeded into six wells of a 96-well TC microplate (Falcon 353219) and incubated at 26°C for 24 hours. The plate then followed the AB assay, but omitted the CFDA-AM assay (Appendix H).  5.2.1.2. Copper exposure with KFE-5 In this thesis, copper sulfate pentahydrate (CuSO4%5H2O) was used for exposure testing on killifish cell lines. CuSO4%5H2O exposure was performed multiple times for each cell line, so the passage number varied with each assay performed; KFE-5 from passages 31-37; KFE-1 from passages 32-36; and KFE-3 from passages 21-24. Cells were initially dissociated from TC flasks (Section 2.2.4.) and were seeded in 96-well TC microplates (Falcon 353219) with 55,000, 25,000 and 30,000 cells/well for KFE-5, KFE-1 and KFE-3, respectively. The cultures were then incubated at 26°C for 24 hours in regular media. After incubation, media was removed by flipping the microplates upside down onto paper towel and allowed to drain for 30 seconds. Once media were removed, 100 µL of L-15/ex (Appendix I) were added to the wells to rinse and was then removed by flipping the microplates upside down onto paper towel and let drain for 30 seconds. After the wells were rinsed, concentrations of CuSO4%5H2O were added, diluted in L- 103 15/exposure media (L-15/ex) (Appendix I). Concentrations of 0, 0.1, 1, 5, 10, 25, 50, 100, 250, 500 µg/mL, and were added to the wells at 100 µL/well. The cells were exposed to CuSO4%5H2O at 26°C for 24 hours. After incubation, the toxicant was removed by flipping the microplates upside down onto paper towel and let drain for 30 seconds. Wells were rinsed again with L-15/ex (Appendix I), and then flipped upside down and let drain on paper towel for 30 seconds. Plates then followed the AB and CFDA-AM assay outlined in Appendix H.   5.2.1.3. Ammonium chloride exposure on KFE-5 Ammonium chloride (NH4Cl) is a chemical shown to cause cellular vacuolization in previously published fish cell lines (Dayeh et al., 2009). Killifish cell lines were tested for acute NH4Cl exposure using NR dye. KFE-5 at passages 30 and 33, KFE-1 at passage 25, and KFE-3 at passage 28 were first dissociated (Section 2.2.4.) and seeded into 96-well TC microplates (Falcon 353219) at 55,000, 25,000 and 40,000 cells/well for KFE-5, KFE-1 and KFE-3, respectively. Plates were incubated at 26°C for 24 hours in regular media. After incubation, media was removed by flipping the microplates upside down onto paper towel and let drain for 30 seconds. Once media were removed, 100 µL of L-15/ex (Appendix I) were added to the wells to rinse and was then removed by flipping the microplates upside down onto paper towel and let drain for 30 seconds. After the wells were rinsed, concentrations of NH4Cl were added, diluted in L-15/ex (Appendix I). Concentrations were made at 0, 0.1, 1, 5, 10, 25, 50, 100, 250, 500 µg/mL, and dosed in the wells at 100 µL/well and the cells were exposed to NH4Cl at 26°C for 24 hours. After incubation, the cell lines were observed for vacuoles and images were taken with a phase contrast Olympus microscope. The toxicant was then removed by flipping the microplates upside down onto paper towel and let drain for 30 seconds. Once the toxicant was removed, 100 µL of NR solution (33 µg/mL) diluted in PBS was added to each well and incubated at RT for 1 hour in  104 the dark. After incubation, NR solution was removed by flipping the microplates upside down onto paper towel and let drain for 30 seconds. Wells were then rinsed with 100 µL/well of NR fixative solution (0.5% formaldehyde and 1% calcium chloride (CaCl2) in Milli-Q water)—this removes excess NR dye. After rinsing, 100 µL/well of NR extraction solution (1% acetic acid and 50% ethanol in Milli-Q water) was added to solubilize the lysosomal NR, and then the plates were incubated for 10 min at RT. Cultures were observed for NR uptake in the lysosomes and images were taken with a phase contrast Olympus microscope. The dual viability assay, AB and CFDA-AM was also performed (Appendix H). KFE-3 cultures did not have NR dye added to the cells and both KFE-1 and KFE-3 cultures were not tested with the dual viability assay, AB and CFDA-AM.  5.2.1.4. KFE-5 exposure to RU 486 Mifepristone (RU 486) is a synthetic steroid that is a glucocorticoid receptor (GR) antagonist and also showed to have antiprogestin activity (Johanssen and Allolio, 2007). It was used as an abortifacient when combined with a prostaglandin that blocks progesterone (Johanssen and Allolio, 2007) and used for conditions with hypercortisolism (Johanssen and Allolio, 2007). Mifepristone was first originally named RU 38 486 after the drug company, Roussel Uclaf, and later shortened to RU 486 (Johanssen and Allolio, 2007). RU 486 also has high affinity to bind with the GR, and has shown to bind 18 times greater than that of cortisol (Sartor and Cutler, 1996).  RU 486 works by the negative feedback loop of cortisol, by blocking the GRs (Johanssen and Allolio, 2007).  KFE-5 has previously shown to change cellular morphology when exposed to increasing levels of cortisol (Gignac, 2012), so we wanted to observe if this response could be blocked with the addition of RU 486. KFE-5 at passage 40 was dissociated (Section 2.2.4.) and seeded at  105 200,000 cells/mL in 12-well TC plates (Falcon 353043). Plates were incubated at RT for 24 hours to allow cell adherence and after incubation media were removed and replaced with correct media that contain concentrations of the steroid hormone using physiological and pharmacological doses in vitro: Cortisol: 0, 0.01, 0.1, and 1 µg/mL cortisol in L-15 media supplemented with 5% FBS and 1% penicillin/streptomycin RU 486: 0, 0.01, 0.1, and 1 µg/mL RU 486 in L-15 media supplemented with 5% FBS and 1% penicillin/streptomycin RU 486 + cortisol: 0, 0.01, 0.1, and 1 µg/mL cortisol in media supplemented with 5% FBS and 1% penicillin/streptomycin with the addition of 0.1 µg/mL RU 486 added to each concentration Cortisol (17-hydroxycortisone) were purchased from Sigma (H0888) and RU 486 were received as a gift from Roussel-UCLAF (France). Hormone stock solutions were diluted in 100% ethanol (EtOH), and the controls (0 µg/mL exposure) contained 0.1% EtOH. Media were changed every 3 days with correct media. Pictures were taken on days 3, 4, 7 and 10 with a Nikon TE300 inverted phase contrast microscope.  5.2.2. Microsporidia 5.2.2.1. Anncaliia algerae spores  The microsporidia, A. algerae, was originally obtained from the American Type Culture Collection (ATCC) (ATCC number PRA-168), and were infected in rabbit kidney epithelial cell line (RK-13), by a previous student, Richelle Monaghan (Monaghan, 2011). Spores were then collected and purified (Section 2.3.4.1.) and used to infect killifish cell lines.   106 5.2.2.2. Spore purification Purification was done in order to collect the cultured spores from previously infected cell lines and to eliminate the possibility of contamination of other cell lines. Cells with infected spores were dissociated from the TC flask by using a cell scraper (Falcon 353085), and the contents was placed in a 15 mL conical tube, centrifuged at 1,100 x g for 10 min, and the supernatant removed. The cell/spore pellet was then resuspended in 5 mL sterile TC water at RT for more than 24 hours. The water lysed the cells but not the spores. After incubation, the cell/spore lysate was mixed and pushed through a 25 & gauge needle (Precision Glide 305196) twice and mixed with 5 mL Percoll (Sigma P1644), vortexed for ~5 seconds and centrifuged at 1,800 x g for 30 min. The spores pelleted to the bottom of the conical tube, while the cellular debris was in the Percoll/water supernatant, and removed via aspiration. The spore pellet was resuspended in sterile TC water and was stored at RT. Spores were used within two weeks of purification.  5.2.2.3. KFE-5 cell line infected with Anncaliia algerae A. algerae infectivity was investigated with KFE-5 cell line. A. algerae was used as a model microsporidian as they grow readily in other fish cell lines (Monaghan et al., 2010) and were tested for growth in KFE-5. Microsporidians are very difficult to collect from the whole fish, so a model in vitro system of large spore production could help study the life cycle and infectivity rate. ZEB2J was used as a positive control cell line because this cell line has previously shown to support A. algerae growth, and the spores are capable of growing in a culture system (Monaghan et al., 2010). KFE-5 at passage 33 and ZEB2J at passage 95 were dissociated (Section 2.2.4.) and seeded into three 25 cm2 TC flask (Falcon 353082) and incubated for two days at RT until ~70-80% confluent. Once appropriate confluency levels were reached, flasks were infected with A. algerae—A. algerae were initially kept in sterile Milli-Q  107 water at RT and 300 µL were added to each flask, containing 1,500,000 spores/flask. There was two control flasks: one control that contained A. algerae kept in 30% EtOH for 24 hours, with 300 µL added to each flask, containing 1,500,000 (dead) spores/flask; and a second control (sham) flask contained no spores, just regular media with 300 µL of 30% EtOH. Flasks were incubated at RT and 6 images at random fields of view were taken on days 3, 6, 10 and 13 post-infection, with a Nikon TE300 inverted phase contrast microscope. Before images were taken, flasks were tapped gently on the lab bench to remove any loose spores, and media was removed and replaced with regular media. Images were quantified from counting spores per field of view with the help of a National Institutes of Health imaging software called ImageJ—this software allows the use of a marker to manually mark the spores per field of view. On day 13, post infection, cells were split to a new (25 cm2) TC flask (Falcon 353082) to observe if spores would remain inside the cells after being passaged. Four images at random fields of view were taken on days 3 and 12 post-split with a Nikon TE300 inverted phase contrast microscope. On day 12 post-split, flasks were stained with DAPI (Appendix C), and images were again taken with fluorescence and phase contrast microscopy using a Nikon TE300 microscope.  5.2.2.4. KFE-1 and KFE-3 cell lines infected with Anncaliia algerae KFE-1 and KFE-3 cell line was monitored for A. algerae infectivity. KFE-1 at passage 35, KFE-3 at passage 26 and ZEB2J at passage 104 were dissociated (Section 2.2.4.) and seeded into two 25 cm2 TC flasks (Falcon 353082). Flasks were incubated at optimal temperatures for 24 hours (KFE-1 and KFE-3 at 26°C and ZEB2J at 28°C). After incubation, cells were infected with 2,500,000 spores/flask, and incubated at optimal temperatures. Media were changed on day 5 post-infection and images were taken on days 5 and 27 with a Nikon TE300 phase contrast  108 microscope. On day 27 post-infection, cells were split to a new (25 cm2) TC flask (Falcon 353082) to observe if spores would remain inside the cells after being passaged. On day 7 post-split, flasks were stained with DAPI (Appendix C), and images were taken with fluorescence and phase contrast microscopy using a Nikon TE300 microscope.  5.2.2.5. KFE-5 pre-exposure to cortisol and infectivity with Anncaliia algerae   KFE-5 cell line was pre-exposed to cortisol and then monitored for A. algerae infectivity. Cortisol has previously been shown to increase microsporidial infectivity in cell lines, including ZEB2J, Sf9 (fall armyworm ovarian cell line), and RK-13 when exposed to low doses of the steroid (Rumney, 2011). Two flasks from each cell line (KFE-5 at passage 40 and a control cell line, ZEB2J at passage 103) were dissociated (Section 2.2.4.) and seeded into twelve 25 cm2 TC flasks (Falcon 353082) for each cell line. The flasks were incubated at RT (KFE-5), and 28°C (ZEB2J) for 72 hours until flasks were ~70-80% confluent. After incubation, flasks were exposed to various concentrations of cortisol (17-hydroxycortisone) (Sigma H0888) at 0, 10, 100 and 1,000 ng/mL in regular media for 4 days. After exposure, images were taken with a Nikon TE300 phase contrast microscope, with 3 random fields of view per flask (totaling 9 images for each concentration). Media were changed and the cells were then infected with A. algerae containing 2,300,000 spores/flask. There was two controls: one control that contained A. algerae autoclaved for 75 min at 121°C, with 300 µL added to each flask, containing 2,000,000 autoclaved (dead) spores/flask; and a second control containing no spores, just regular media with 300 µL of sterile water/flask. Flasks were then incubated at optimal temperatures (KFE-5 at RT; ZEB2J at 28°C). After day 3 of infectivity, flasks were tapped gently on the lab bench to remove any loose spores and media were changed with media containing the correct concentrations of cortisol. Images were then taken with a Nikon TE300 phase contrast  109 microscope, with 3 random fields of view per flask (totaling 9 images for each concentration). Flasks were incubated at optimal temperatures. After day 6 of infectivity, flasks were tapped gently on the lab bench to remove any loose spores and media were removed and replaced with PBS (PBS was used so cells would not dry out). Images were then taken with a Nikon TE300 phase contrast microscope, with 3 random fields of view per flask (totaling 9 images for each concentration). Images were quantified from counting spores per field of view with the help of ImageJ. 5.2.2.6. Loma morhua spores  The microsporidia, L. morhua, was originally obtained from the University of New Brunswick (Aaron Frenette & Dr. Michael Duffy). Samples were incubated at 4°C until used, and were removed from their original eppendorf tubes (Sigma Z637416) and placed in 15 mL conical tubes with 10 mL sterile TC water. Samples were centrifuged at 1,100 x g for 10 min and supernatant was removed by aspiration and resuspended with 10 mL fresh sterile TC water and mixed until homogeneous 2x. The samples were stored at RT.  5.2.2.7. KFE-5 cell line infected with Loma morhua  KFE-5 cell line was monitored for L. morhua infectivity. L. morhua was kept in 2 mL vials with water at 4°C, and when used, content was removed and placed in a 15 mL conical tube with sterile water and centrifuged at 1,100 x g for 10 min, supernatant was removed and 5 mL sterile TC water was added and centrifuged at 1,100 x g for 10 min. The supernatant was removed and 10 mL sterile TC water was added and separated into five 2 mL eppendorf tubes (Sigma Z637416), with 2 mL per tube and incubated for 24 hours. After incubation, tubes were centrifuged at 1,100 x g for 10 min and supernatant were removed. EtOH was added to each sample to try and kill any contaminates at varying concentrations, with 2 mL/tube; 20%, 30%,  110 and 70% EtOH, and a control of sterile TC water. KFE-5 at passage 28 were dissociated (Section 2.2.4.) and seeded into four 25 cm2 TC flasks (Falcon 353082) and were incubated at 26°C for 24 hours. After incubation, cells were infected with 700,000 spores per flask/EtOH concentration. On day 8 post-infection, cultures were observed for L. morhua infectivity and images were taken with a phase contrast Nikon TE300 microscope.  5.2.3. Data analysis Statistical analysis of the data was performed using GraphPad Prism. Mean ± standard error or standard deviation was calculated for each data point. Relative fluorescent units (RFUs) calculated for toxicant exposure are averaged and expressed as percent control. Percent control values were used to calculate the inhibitory concentration (IC50 values) of cell viability with GraphPad Prism. Data obtained from the Microsporidial quantified images were analyzed using a one-way ANOVA followed by Dunnett post-hoc test, comparing the control (first day starting point) to the following observed days, for both live and dead spore samples. Microsporidia post-split images were analyzed with either an unpaired or paired t test.       111 5.3. Results 5.3.1 Toxicity assays with KFE-5 5.3.1.1. Standardizing fluorometric assays for KFE cell lines A standard curve for AB was generated to determine optimal cell seeding density and RFUs for 96-well TC microplates (Figure 5.1). An increase in cell number was shown to correlate with an increase in RFUs. The standard curve had a hyperbolic shape, and cell concentrations at 1,500 RFUs were observed for optimal seeding density. Therefore, a seeding of approximately 50,000, 20,000, and 30,000 cells/well in 96-well plate for KFE-5, KFE-1 and KFE-3, respectively, would yield confluent cultures after 24-hours incubation. This will be consistent to compare data with each of the cell lines.   112                                                                                              Figure 5.1. Standard curve for AB with killifish cell lines in a 96-well microplate. (A) KFE-5 at passage 24, (B) KFE-1 at passage 18, and (C) KFE-3 at passage 13. Cells were dosed in the 96-well microplate, incubated for 24 hours at RT and then treated with AB assay after 1 hour incubation. Six well replicates were used for each cell concentration. Since 100 µL of cell suspension is plated into each well of a 96-well microplate, the cell number per well is a 10 fold less than the corresponding cell concentration in cell/mL, thus, the cell concentration (x axis) reduced by * 0.1. Data points are shown as mean RFUs ± standard deviation. Logarithmic trendlines were used for (A) and (B), a polynomial trendline was used for (C).  A B C  113  5.3.1.2. Copper exposure Killifish cell lines were used to evaluate the toxicity of CuSO4%5H2O, by using the dual viability assay, AB and CFDA-AM. Cell exposure caused a dose-dependent decline in cell viability (Figure 5.2). KFE-5 and KFE-3 cell lines showed a hormesis effect with the AB viability assay, but was not seen in KFE-1 cultures, as well as in the CFDA-AM assay in all cell lines. IC50 values (half maximal inhibitory concentration) for killifish cell lines were comparable to other previously tested cell lines (Table 5.1).  The morphology of cells was also monitored during experiments via phase contrast microscopy and showed similar morphological differences between each trial, as well as in comparison to all three killifish cell lines tested (KFE-5, KFE-1 and KFE-3) (Figure 5.3). The change in morphology was detected 24 hours post-exposure at 5 to 10 µg/mL CuSO4%5H2O. Increasing exposure concentration caused the cells in all three killifish cell lines to become more compact in appearance and appeared as though they were lifting off of the TC surface. The treated cultures with exposure testing displayed a compromised cell membrane, and showed no morphological similarities to their controls.     114     Figure 5.2. Viability of killifish cell lines after 24 hours exposure to CuSO4%5H2O. (A) KFE-5 at passages 30-37, (B) KFE-1 at passages 32-36, and (C) KFE-3 at passages 21-24. Cultures were subsequently exposed to varying concentrations of CuSO4%5H2O prepared in L-15/ex media. Chemical exposure lasted 24 hours at which point cellular viability was measured using fluorometric indicator dyes: AB and CFDA-AM. Results are expressed as a percent control of relative fluorescent units (RFUs). Data points represent the mean of six separate experimental trials ± standard deviation; KFE-1 represents the mean of five separate experimental trials ± standard deviation. Each trial was performed with 6 well replicates per chemical concentration.   115         Table 5.1. Killifish cell line IC50 values after exposure to CuSO4%5H2O.  Fish Cell line 24 hours IC50 (µg/mL) ± Standard deviation (n) AB CFDA-AM KFE-5 15.96 ± 7.22(6) 9.49 ± 4(6) KFE-1 4.778 ± 1.11(5) 7.417 ± 1.43(5) KFE-3 13.07 ± 2.97(6) 8.467 ± 2.11(6) RTgill-W1* 6.06 ± 1.25(3) 7.07 ± 0.67(3) FHML* 7.83 ± 3.6(3) 4.9 ± 2.6(3) F. heteroclitus¥ 96 hours LC50 = 0.8106 ± 0.547 (5) µg/mL Fathead minnow liver (FHML) Lethal concentration, 50% (LC50) Sample size (n) * Data retrieved from Sansom et al., 2013.  ¥ Mean calculated from data in Lin and Dunson, 1993; Grosell et al., 2007; PAN Pesticide Database; five studies total                                 Figure 5.3. Phase contrast micrographs of killifish cell lines exposed to CuSO4%5H2O for 24 hours. KFE-5 at passage 37, KFE-1 at passage 34, and KFE-3 at passage 21, were exposed to varying concentrations of CuSO4%5H2O. Morphological changes were observed as low as 5 and 10 µg/mL in all three cell lines. Killifish cell lines are displayed in rows, and exposure concentration in columns. Control contained only L-15/ex media. Images were taken with a phase contrast Olympus microscope. Scale bar = 100 µm.   116 5.4.3.3. Ammonium chloride exposure KFE-5 cell line was used to evaluate NH4Cl exposure and its effects on lysosomes. After 24-hours exposure to NH4Cl, the cells became increasingly vacuolated in proportion to the concentration of NH4Cl (Figure 5.4 C & E). After the NR dye was added to the cells, some of the cells washed off in the process, but the dye was detected inside the vacuoles/lysosomes (Figure 5.4 D & F), and it was not noticed in the control cells (Figure 5.4 B). KFE-5 cells exposed to NH4Cl were also evaluated for cellular viability using the dual assays, AB and CFDA-AM, however, no obvious changes were noticed at the tested concentrations (Figure A5; Appendix J).    Figure 5.4. Phase contrast micrographs of KFE-5 at passage 30 after 24-hours exposure to NH4Cl with neutral red dye uptake in cell lysosomes. Vacuoles were apparent at 250 !g/mL NH4Cl exposure. NH4Cl exposure before (A,C,E) and after (B,D,F) addition of Neutral Red (NR) dye. Control contained only L-15/ex media. Images taken with phase contrast Olympus microscope. Scale bar = 100 µm.   117 KFE-1 and KFE-3 were also used to evaluate NH4Cl exposure and the presence of lysosomes. After 24-hours exposure to NH4Cl, cells were observed for the uptake of NR dye in the lysosomes of KFE-1 cultures (Figure 5.5). KFE-1 showed an increase in vacuolization at 100 µg/mL (Figure 5.5 C). After the NR dye was added to the cells, the dye was detected inside the lysosomes (Figure 5.5 D), and it was not noticed in the control cells (Figure 5.5 B). KFE-3 cultures showed increased vacuolization at 250 µg/mL after 24-hours incubation (Figure 5.6).             Figure 5.5. Phase contrast micrographs of KFE-1 at passage 25 after 24-hours exposure to NH4Cl with neutral red dye uptake in cell lysosomes. Vacuoles were apparent at 100 !g/mL of 24 hours NH4Cl exposure before (A,C,E) and after (B,D,F) addition of Neutral Red (NR) dye. Control contained only L-15/ex media. Images taken with phase contrast Olympus microscope. Scale bar = 100 µm.  118    Figure 5.6. Phase contrast micrographs of KFE-3 at passage 28 after 24 hours exposure to NH4Cl. Vacuoles were apparent at 250 !g/mL of NH4Cl. Control contained only L-15/ex media. Images taken with phase contrast Motic AE31 microscope. Scale bar = 50 µm.  119 5.3.1.4. RU 486 exposure After 7-days incubation RU 486 exposure alone had no influence on the cells appearance, and cells in culture maintained their typical myoblastic and fibroblastic shape. KFE-5 cultures changed cellular morphology when cells were exposed to cortisol. Cortisol exposure caused the myoblastic cells to appear more compact in shape, compared to the control samples. The fibroblastic cells were more irregular in shape in the cortisol exposure, whereas in the controls the fibroblasts appeared much more elongated and had a smooth characteristic. There also seemed to be an increase in cellular debris in the cortisol exposure, which was not noticed in any other the other treatments or controls. Cortisol-induced changes were not observed when cells were exposed to RU 486 and cortisol simultaneously (Figure 5.7).       120                 Figure 5.7. Phase contrast micrographs of KFE-5 at passage 40 showing morphological effects of cortisol exposure, and inhibited when RU 486 was added. After 7-days incubation. The top row represents the controls and the bottom row is the treated samples (1 µg/mL). Controls: 0.1% EtOH in L-15 media with 5% FBS and 1% penicillin/streptomycin. Inset is magnified section of image. Arrows pointing to myoblasts; arrowheads pointing to fibroblasts. Images taken with Nikon TE300 inverted phase contrast microscope. Scale bar = 100 µm.   121 5.3.2. Microsporidia 5.3.2.1. KFE-5 infected with Anncaliia algerae  Signs of A. algerae infection were seen clearly by phase contrast microscopy in the cytoplasm of KFE-5 cultures by 3 days post-infection (Figure 5.8 A). Spores appear phase-bright (mature spores), but after 6 days post-infection, spores are phase-dark (Figure 5.8 B), and assumed the typical sporont shapes (dark spindle shaped spores). Spores were noticeable in the fibroblastic cells, but few were seen in the myoblasts. Very minimal spores were present in the 30% EtOH dead spores in both KFE-5 cultures and the control cell line, ZEB2J, whereas many spores were present when infected with the live spores (Figure 5.9). There was a dramatic increase in spore number over 13 days in both KFE-5 and ZEB2J cell lines (Figure 5.10), with the largest increase noticed in the last 3 days.  After 13 days post-infection, the KFE-5 cell line were passaged into a new flask and incubated at RT. Spores were still detected inside the cultures on day 3 post-split, and dramatically increased after 12 days post-split (Figure 5.11). Cultures were stained with DAPI after 12 days post-split and images show phase contrast and fluorescent microscopy of the cultures, with spores present in both fibroblast and myoblast cells (Figure 5.12).   122   Figure 5.8. Phase contrast micrographs of KFE-5 at passage 33 after 3 to 6 days post-infection with A. algerae. Panel (A) 3 days post-infection. Panel (B) 6 days post-infection. Arrow pointing to sporont; arrowhead pointing to mature spore. Images taken with a Nikon TE300 phase contrast microscope. Scale bar = 50 µm.   123            Figure 5.9. Phase contrast micrographs of KFE-5 and ZEB2J after 13 days post-infection with A. algerae. KFE-5 at passage 33 and ZEB2J at passage 95. 30% EtOH dead spores had minimal spores present in the cultures, whereas many spores were present in those that received live spores. Top row is KFE-5 cell line; bottom row is ZEB2J cell line. Images taken with a phase contrast Nikon TE300 microscope. Scale bar = 50 µm.  124     Figure 5.10 KFE-5 and ZEB2J infectivity of A. algerae spores over 13 days post-infection. KFE-5 at passage 33 on the left graph and ZEB2J at passage 95 on the right graph. An increase in live spores was observed over time. Images were quantified using ImageJ software. The means ± standard error (n=4) are plotted. A one-way ANOVA followed by a Dunnett post hoc test was used to compare day 3 (control) to other days, for dead spores and live spores (p<0.05*, p<0.01**). Asterisk colour corresponds with treatment group in legend.                             Figure 5.11. KFE-5 at passage 33 infected with A. algerae after 3 and 12 days post-split. An increase in spores was observed over increasing days. Images were quantified using ImageJ software. The means ± standard error (n=4) are plotted. For each day, the live spores and dead spores were compared using a paired t-test (p<0.01*). Asterisk colour corresponds with treatment group in the legend.  125               Figure 5.12. Phase contrast and fluorescent micrographs of KFE-5 at passage 33 infected with A. algerae 12 days post-split. Images on the left are phase contrast and images on the right are fluorescent stained with DAPI. Arrows are pointing to spores inside the myoblast. Images taken with a phase contrast and fluorescent Nikon TE300 microscope. Scale bar = 50 µm.   126 5.3.2.2. KFE-1 and KFE-3 infected with Anncaliia algerae   A. algerae infectivity had increased after 28-days incubation (Figure 5.13) and spores were still noticeable inside the cells by 7 days post-split in both KFE-1 and KFE-3 cultures (Figure 5.14). Spores appear phase-bright (mature spores), and phase-dark (sporonts) in the cultures. Spores were noticeable in only a few of the cells of KFE-1 and KFE-3, as well as the control cell line, ZEB2J. KFE-1 and KFE-3 were compared for spore count after 7 days post-split. KFE-1 showed greater amount of spores/field of view (5.15).                   Figure 5.13. KFE-3 and KFE-1 infected with A. algerae over 28 days post-infection. KFE-3 at passage 27 and KFE-1 at passage 35. Both cell lines increased spore number over increasing time. Images were quantified using ImageJ software. The means ± standard error (n=4) are plotted. A one-way ANOVA followed by a Dunnett post hoc test was used to compare days to control day (day 10) (p<0.05*, p<0.01**). Asterisk colour corresponds with treatment group in legend.  127      Figure 5.14. Phase contrast and fluorescent micrographs of KFE-1, KFE-3 and ZEB2J infected with A. algerae 7 days post-split. KFE-1 at passage 36, KFE-3 at passage 28, and ZEB2J at passage 104. Images on the left are phase contrast and images on the right are fluorescent stained with DAPI. Arrow is pointing to mature spores; arrowhead is pointing to sporonts. Images taken with a phase contrast and fluorescent Nikon TE300 microscope. Scale bar = 50 µm.   128                          Figure 5.15. KFE-3 and KFE-1 infected with A. algerae after 7 days post-split. KFE-3 at passage 28 and KFE-1 at passage 36. KFE-1 cultures showed a greater number of spores compared to KFE-3 cultures. Images were quantified using ImageJ software. The means ± standard error (n=10) are plotted. An unpaired t test was conducted comparing the two cell lines (p<0.05*).   129 5.3.2.3. Pre-exposure to cortisol and infectivity with Anncaliia algerae Pre-exposure of KFE-5 cells with cortisol at all tested doses significantly enhanced the number of A. algerae spores present in the cultures (Figure 5.16). Cultures exposed to 1,000 ng/mL cortisol had the greatest increase in spores per field of view of three images/cortisol exposure. There was not a dramatic increase in spores from 3 to 6 days incubation. Autoclaved dead spores were less than 1 spore/field of view.     Figure 5.16. KFE-5 at passage 40 exposed to cortisol for 72 hours then infected with A. algerae spores. An increase in spores was observed with increasing cortisol concentration, but not with time. The control contained 0.1% EtOH. Images were quantified using ImageJ software. The means ± standard error (n=3) were plotted. A one-way ANOVA followed by a Dunnett post hoc test was used to compare the control (0 ng/mL) to the other concentrations per day, for dead spores and live spores (p<0.05*, p<0.01**). Asterisks colour corresponds with treatment group in legend.   130 5.3.2.4. KFE-5 infected with Loma morhua Tests for infectivity with L. morhua was performed only with KFE-5 cells. KFE-5 cells showed some infectivity with L. morhua after 8 days post-infection. Prior to the infection trials, spores had been pre-incubated with 20% EtOH (to kill contaminants such as yeast) for 24 hours that could have affected the viability/infectivity of the spores. Lots of floating spores were noticed in the cultures, but spores were only observed within the myoblasts (Figure 5.17).                          Figure 5.17. Phase contrast micrographs of KFE-5 at passage 28 after 8 days post-infection with L. morhua. Inset is of myoblast cell with L. morhua spores inside the cell. Floating spores are present on top of the fibroblastic cells. Arrows are pointing to floating spores. Images taken with a Nikon TE300 phase contrast microscope. Scale bar = 50 µm.  131 5.4. Discussion The current study supports the hypothesis that the killifish cell lines show responses to model toxicants and can support the growth of pathogens. This point is clearly illustrated by the decline in cell viability with increasing toxicant concentration (CuSO4%5H2O), and increasing vacuolization with NH4Cl. Furthermore, all three killifish cell lines supported the growth of A. algerae and KFE-5 showed increased spore number with increasing cortisol concentration. This provides some evidence that these killifish cell lines are proving useful for rapid screening of ecotoxicants, and studying the life cycle of particular pathogens.  Cell lines could be useful in various areas of research such as toxicology and endocrinology. Toxicants are typically ecotoxicants or contaminants that may be substances discharged into the environment from industrial activities or human actions, and may have an impact on an ecosystem (Connell et al., 1999). Toxicity affects the organism at all degrees of organization, such as the molecular, cellular, tissue, organ and system levels (Bols et al., 2005). Fish cell lines have been studied extensively to exposure testing, including toxicity tests (Schirmer et al., 1998; Dayeh et al., 2002; Schirmer et al., 2004; Dayeh et al., 2009; Sansom et al., 2013; Bain and Kumar, 2014) and steroid testing (Lee and Bols, 1989a; Lee and Bols, 1989b; Castro et al., 2011; Bain and Kumar, 2014). In fish, ecotoxicological exposure testing is needed to assess the impact ecotoxicants may have on fish and the aquatic environment (Bols et al., 2005).  Toxicant exposure testing using viability assays is intended to yield rapid measurements of the status of the cell, primarily detecting plasma membrane integrity and metabolic activity (Freshney, 2001). Cell viability assays, AB and CFDA-AM used in combination, are a very simple, fast, sensitive measurement and thus represent a promising method to evaluate cytotoxic  132 effects of environmental contaminants and toxicants (Dayeh et al., 2013). This does not mean cell culture should replace whole-organismal testing, but instead it is another method that can be used to complement in vivo studies that can be useful as an alternative or preliminary screening test to evaluate key changes in cellular viability. Exposure of killifish cell lines to various toxicants caused cellular responses within 24 hours, and IC50 values were comparable to other previously tested cell lines, FHML and RTgill-W1 (Sansom et al., 2013). The IC50 values were slightly greater than those observed for F. heteroclitus at the whole-organism level; however, cells in culture have been shown to be less sensitive to chemical exposure (Sandbacka et al., 2000; Segner, 2004; Schirmer, 2006), and may require an increase in toxicant concentration in order to produce similar results as in vivo studies. Interestingly, however, the studies conducted at the in vivo level showed a greater range in LC50 values; nonetheless, the in vivo studies were exposed to the toxicant for a longer amount of time; 96 hours vs 24 hours.  All three killifish cell lines were morphologically different at low concentrations of CuSO4%5H2O at 10 µg/mL, when compared to the control, which only contained L-15/ex media. Cells were more compact with increasing exposure, and floating debris was more noticeable. This has been also been observed in Bluegill fry cell line (WF-2) before and after 24-hours CuSO4%5H2O exposure (Sansom, 2010), indicating compromised cell membrane integrity.  It has been shown in previous cell lines that cytoplasmic vacuolation can be caused by ammonia exposure, bacterial toxins, or the presence of organic weak bases, at least in mammalian cells  (Ohkuma and Poole, 1981). After exposure to NH4Cl, the cells in the killifish cell lines became increasingly vacuolated in proportion to the concentration of NH4Cl in the sample. Also, the uptake of NR was observed in KFE-1 and KFE-5 (unfortunately the NR assay was not performed on KFE-3), and NR uptake has been shown to occur specifically in lysosomes  133 (del Peso et al., 2008). Increased vacuolization with NH4Cl exposure and NR uptake is also comparable to the RTgill-W1 (Dayeh et al., 2009). Cytotoxic effects were not evident from the AB and CFDA-AM assay readings with KFE-5 cultures (viability assays were not measured with KFE-1 and KFE-3 cell lines when exposed to NH4Cl). These results have been seen in other cell lines exposed to NH4Cl when tested with these dual viability assays (Schirmer et al., 1998), and might indicate that there is impairment with lysosomes before cell viability was compromised. Fish cells in culture have previously been shown to respond to cortisol; cellular proliferation was inhibited (Lee and Bols, 1989a), cells contained corticosteroid binding sites (Lee and Bols, 1989b), and exposure altered cellular morphology (Lee et al., 1986). RU 486 is a synthetic glucocorticoid receptor antagonist (Johanssen and Allolio, 2007), and has shown to inhibit the effects of cortisol on fibroblastic cells in a rainbow trout fibroblast cell line (RTG-2) (Lee and Bols, 1989a; Lee and Bols, 1989b). KFE-5 exposed to cortisol alone exhibited morphological changes in both fibroblasts and myoblasts; the effectiveness of the GR is in turn counteracted by the addition of RU 486. RU 486 has shown to have a very strong affinity for the GR, and can inhibit glucocorticoid responses both in vivo and in vitro (Gagne et al., 1985). Therefore, RU 486 represents a tool useful for determining the mechanism of glucocorticoid action, and these observations mentioned above may indicate the presence of corticosteroid binding sites in KFE-5 cultures.  Some pathogens complete their life cycle intracellularly, thus, animal cell cultures are a convenient approach to produce and study specific pathogens. Many fish cell cultures have been extensively used to study pathogen susceptibility, specifically viruses (Wolf et al., 1966; Loh et al., 1990; Hong et al., 1998; DeWitte-Orr et al., 2007; Tafalla et al., 2008; Pham et al., 2013); however, parasite infectivity is now being explored using fish cell lines (Nielsen and Buchmann,  134 2000; Monaghan et al., 2009; Monaghan et al., 2010). Cell lines can be useful for analyzing intracellular parasite infectivity by observing the life cycle, which would be difficult to detect at the in vivo level (Nielsen and Buchmann, 2000; Monaghan et al., 2009; Monaghan et al., 2010).  Fish cell cultures and various tissue types have previously been shown to support A. algerae growth in goldfish, zebrafish and fathead minnow (Monaghan et al., 2010). A. algerae growth was supported in KFE-5 cultures when incubated at RT. A. algerae spores were noticeable in both fibroblasts and myoblasts, and the spores were seen at various germination stages. Minimal spores were noticed in 30% EtOH dead spores in KFE-5 cultures, as well as the control cell line, ZEB2J. Spore number dramatically increased with time, and was comparable to ZEB2J, which has previously been shown to support A. algerae growth (Monaghan et al., 2010). The spores were still detected inside KFE-5 cells after the cultures were passaged, indicating that the spores were inside the cells, and not floating above, or adhered to the outside of the cells. A. algerae was mainly noticed in the fibroblastic cells, however, over time the spores were detectable in the myoblasts. In previous studies it has been shown that skeletal muscle cells of mammalian cultures have been able to successfully support the growth of A. algerae (Cali et al., 2004).  A. algerae growth was also supported in KFE-1 and KFE-3 cultures when incubated at RT. A. algerae spores were seen at various germination stages (both sporonts and mature spores were detected), and increased spores were noticed with increasing time. The spores were still detected inside KFE-1 and KFE-3 cells after the cultures were passaged to a new TC vessel. This denotes that the spores were inside the cells, and were not floating above, or adhered to the outside of the cells. KFE-1 cultures showed similar spore count as per KFE-3 cell line, and post-split KFE-1 had a slightly greater increase in spore number.   135 Chronic stress and elevated cortisol levels suppress the immune system and increases susceptibility to infectious diseases (Schreck, 1996), and cortisol is commonly used to indicate both chronic and acute stress in fish (Barton, 2002). Environmental factors that facilitate increased stress to fish may produce an optimal environment for pathogenic organisms and consequently increase their virulence (Schreck, 1996). Pre-exposure of KFE-5 cultures to cortisol and infectivity with A. algerae increased spore number with increasing hormone concentration; however, spore number did not increase with increasing time (days). Perhaps a longer time frame would show greater variation in spore count, unfortunately increasing time were not observed in KFE-5. Similar results were also observed with ZEB2J cell line (data not shown).  The appearance of L. morhua infectivity in KFE-5 cultures was relatively bleak, possibly due to continuous bacterial contamination. L. morhua spores were received from the University of New Brunswick in non-sterile water that could have been the main source of contamination. The prevention of contamination was a major issue with L. morhua, generally due to yeast contamination in the cultures. A number of attempts were conducted to troubleshoot this issue, and the most effective method was incubating the spores with 20% EtOH. This may have affected the viability/infectivity of the spores thus the low infectivity observed with KFE-5 may not necessarily be reflective on the cell line’s ability to support infection by L. morhua and further research will be needed to be performed in the future. Most of the spores were observed floating in the cultures, and cells did not survive beyond 10-days incubation, possibly due to the ethanol content or other factors that remain to be elucidated. This experiment was performed only once due to low availability of spores and further replication will need to be performed. Only one other cell line has shown to be successfully infected with L. morhua and that is a cod  136 cell line (Macleod, 2012).  This study provides evidence that the killifish cell lines respond similar to other fish cell lines with exposure testing and can be used to complement already developed F. heteroclitus in vivo models. It was shown that the cultures could also support the growth of an opportunistic pathogen (A. algerae); however, more work needs to be conducted to determine if cultures can successfully support the growth of L. morhua.    137 CHAPTER 6: GENERAL DISCUSSION 6.1. Discussion Research involving the use of cell lines requires precise knowledge of the species of origin and cell type of the cell line used. This can only be determined by monitoring the cultures for contamination of other cell lines, as well as characteristics that validate the cell line identity. Effective ways to monitor cultures and characterize the cell line involves testing for biomarkers, such as antigen detection, chromosome analysis, and DNA profiling (Kaplan and Hukku, 1998). Here, three distinct cell lines derived from F. heteroclitus embryos have been partially characterized. The cell lines, KFE-5, KFE-1, and KFE-3 showed myogenic, neuroepithelial, and liver-like characteristics, respectively.  Currently, there are no published records of established cell lines derived from F. heteroclitus. The killifish cell lines described in this thesis have the potential to be of use for comparative analysis to in vivo research, especially future studies involving toxicant exposure and observing the effects of abiotic components. These cell lines have been maintained for 3 years and do not show any major signs of cellular aging, or decline in cell growth; thus, they can be considered “continuous” cell lines and have the ability to divide indefinitely (Ratledge and Kristiansen, 2001; Gstraunthaler and Hartung, 2002; Freshney, 2010). Some cell culturists consider continuous cell lines to be “immortal” (Masters, 2000; Gstraunthaler and Hartung, 2002). It should also be noted that while fish cell lines may have decreased senescence due to their high telomerase activity (Klapper et al., 1998), embryonic stem cells appear capable of bypassing cellular senescence (Miura et al., 2004). Therefore, these three killifish cell lines have the potential to divide indefinitely and differentiate into other cell types, a characteristic detected in many stem cell lines (Freshney et al., 2007).  138 Cellular differentiation involves the process whereby an unspecialized cell type (e.g., stem cell) becomes a more specialized cell type (Freshney, 2010), and maintains typical shape and function of the in vivo phenotype (Schaeffer, 1990). Cell lines have the ability to dedifferentiate and stop expressing the in vivo cell type (Freshney, 2010). Dedifferentiation can be caused by: (1) undifferentiated cells growing and taking over the differentiated cells, thus reducing proliferative capacity, (2) the absence of inducers such as extracellular matrices and hormones that are needed to maintain differentiation, (3) reversion to a more primitive cell type, or into stem cells (Freshney, 2010). Because of the possibility of dedifferentiation, the cell lines were continuously monitored for possible phenotypic changes, and they were evaluated for the ability to form spheroid bodies, or stain positively for either ALP or "-galactosidase senescence stain. Over the span of three years, since the primary cultures were developed, only a few characteristics have been observed to change:  KFE-5: increased ALP expression; increased ability to form spheroid bodies; presence of spheroids in confluent cultures KFE-1: increased vacuolization in super-confluent cultures KFE-3: increased ALP expression; increased ability to form spheroid bodies The observed changes in the cell phenotype, such as increasing ALP staining expression in cultures, and the ability to form spheroid bodies may indicate that the cell lines are more stable, and are differentiating into a specific phenotype.  Ultimately, the formation of a novel F. heteroclitus cell line has the potential to aid research on the biology of the fish, including their physiology (reviewed in Burnett et al., 2007), steroidogenesis (Petrino et al., 1989), growth and nutritional requirements (Burton and McCurdy, 1940; Radtke and Dean, 1979), resistance to toxicants (Clark and Di Giulio, 2012; Bozinovic and  139 Oleksiak, 2010; Lister et al., 2011), and response to pathogens (Bond, 1937; Ahne et al., 2003; Baker, 2007; Gagné et al., 2007; Nacci et al., 2009). The killifish cell lines may also assist in the study of EDCs, which currently pollute aquatic environments in areas where F. heteroclitus resides, serving as a complement to in vivo methodologies (Boudreau et al. 2005; Peters et al., 2007; Shaughnessy et al., 2007; Rutherford et al., 2011). Vertebrate cell lines are potentially valuable tools to predict toxicity in whole-animals since the interaction of toxic substances is initiated at the cellular level (Schirmer, 2006). Additionally, cell culture bioassays allow for the elucidation of toxic effects of a chemical compound (Kramer et al., 2009) and can be conducted in a rapid and inexpensive manner (Lee et al., 2008). The responses of cell lines to toxicants compare well with responses seen in the whole organism (Lee et al., 2008), and eliminates some of the in vivo issues such as toxic waste and depuration (Bols et al., 2005). Because the dose response curves in the three killifish cell lines are similar after acute exposure to CuSO4%5H2O, it may suggest that the toxicant is causing general membrane damage that could compromise intracellular organelle membranes, such as mitochondria and the cell membrane, as well as ultra-fast cell death—cell death that happens very quickly in response to a intense stimuli (Dayeh et al., 2013). The presence of vacuoles after NH4Cl exposure is comparable to other cell lines that have been exposed to ammonia compounds (Dayeh et al., 2009), and could be useful for testing other toxicants such as exposure to industrial effluents that have previously shown to cause responses similar to those due to NH4Cl exposure (Dayeh et al., 2002; Dayeh et al., 2009).  The European chemicals regulation REACH (The Regulation on Registration, Evaluation, Authorisation and Restriction of Chemicals 2007) calls for reductions in whole-organism fish testing for toxicological studies, leading to the advancement of in vitro research and a greater  140 acceptance for cell culture toxicant testing. Toxicological testing of chemicals and pharmaceuticals can be easily assessed in cell lines, and as cell lines have been considered an alternate method for the use of whole-organisms with regard to testing water quality (Ahne, 1985). Furthermore, F. heteroclitus has shown to be an important laboratory model to evaluate the toxicity of environmental pollutants when tested in vivo (Eisler, 1986; Burnett et al., 2007).  F. heteroclitus can also support the growth of various intracellular pathogens (Solangi and Overstreet, 1980; Baker, 2007). All three killifish cell lines were capable of supporting the growth of A. algerae, and after cultures were split (passaged) into a new culture vessel the A. algerae spores were still noticeable inside the cells. Thus, the killifish cell lines could be used to support the growth and development of intracellular pathogens like the microsporidia that have been difficult to study in vivo. This can help understand the pathogenesis and life cycles of microsporidian that are detrimental to aquaculture, as well as contribute to the development of therapeutics for commercially important fish.    141 6.2. Future prospects The establishment and characterization of three F. heteroclitus cell lines has provided evidence that these cell lines could be useful in various research areas including toxicology and fish health. However, additional characterization should be conducted to fully understand these cell lines, particularly determining the specific cell type (e.g., molecular markers). Currently we know that KFE-5 consists of a cell line with two different cell types, primarily myocytic cells. It is not clear as to whether or not the myocytes are skeletal or cardiac, as they are striated but they do not appear to form myotubes. KFE-5 has been explored for myogenesis using extracellular matrices (Gignac, 2012); however, the cells do form networks, but they do appear to not fuse together and form myotubes. This lack of a fusion response may be due to the fact that KFE-5 could comprise a population of cardiac myogenic cells rather than skeletal muscle cells. Biomarkers can aid with determining the cell type, such as cardiac troponin-I and troponin-T (Sharma et al., 2004). Furthermore, the cultures could be tested for exposure to inotropic drugs, such as dopamine, epinephrine, and caffeine (Restrepo, 2014) to observe cellular contraction—if KFE-5 is able to contract, it can suggest that the cells are derived from cardiac muscle, as cardiomyocytes contract in response to these drugs listed above. KFE-1 cell line will require additional observation of various biomarkers via immunostaining to confirm their neuroepithelial features, including, nestin, PAX6, SOX1, SOX2, and CDH2 (Loring et al., 2007). Also, NECs are known to be oxygen sensing (Hara and Zielinski, 2007), therefore, responses to hypoxia could be monitored. KFE-1 cultures can also be exposed to concentrations of retinoic acid in order to detect if the cultures will differentiate into a neural cell type, such as astrocytes, which has been seen in other NEC lines derived from mouse (Varga et al., 2008). KFE-3 will also require supplementary immunocytochemical staining in order to identify if the cell line comprises of liver cells. As mentioned in chapter 4, there are a multitude of liver cell types, and  142 biomarkers will help determine the cell type, such as CAM5.2 (Malhão et al., 2013), liver membrane antibody (Tage-Jensen et al., 1982) or desmin and GFAP if the cells are HSCs (Geerts, 2001; Geerts et al., 2001; Uyama et al., 2006). Consequently, all of the cell lines will mostly require additional immunocytochemical staining or western blot analysis to effectively determine the cell type, and a major issue is that we are not certain if the markers are all fish equivalent.  General maintenance of the cell lines involves continuous monitoring of cellular differentiation, such as observing embryonic potentials (including ALP staining and spheroid body formation), as well as senescent staining, microbial contamination, and DNA profiling. This will ensure that the cell lines have not become contaminated with other cell lines, or contain any bacterial contamination.  Cultures were initially established to complement in vivo studies, therefore, a multitude of work can be conducted to compare to whole-fish studies, such as hypoxia and salinity levels, as well as exposure to various toxicants, contaminates, and EDCs. This can be performed via cell viability assays, which have proven effective for killifish cell lines. Another assay that has been beneficial for observing environmental contaminants is an EROD assay. This assay is a sensitive indicator of contaminant exposure in fish to measure CYP1A protein (Whyte et al., 2000) that has been conducted in other liver cultures (Lee et al., 1993; Billiard et al., 2004; Vrzal et al., 2013). Therefore, EROD assays will be beneficial to test on KFE-3 cultures, as cytochrome P450 enzymes are concentrated mainly in the liver (Whyte et al., 2000).     143 6.3. Conclusion This study resulted in the characterization of three distinct cell lines derived from F. heteroclitus. To date, KFE-5, KFE-1, and KFE-3 appear to be the only continuous cell lines derived from the common killifish. The KFE-5 cell line is derived from the mesodermal trunk region and contains striated myocytic cells intercalated with fibroblastic cells, and the myocytes were positive for myogenic markers. Cells of KFE-1 cell line were obtained from the cephalic region and are epitheloid in morphology and are positive for neuroepithelial markers. Cells of the KFE-3 cell line are from the internal trunk region and express liver characteristics. All three cell lines showed positive staining for stem cell characteristics, implicating their embryonal origin. These cells can be maintained at a wide range of temperatures that are consistent with whole-organismal studies (Burnett et al., 2007) and have an optimal temperature range for growth between 19-26°C. The cells were grown in L-15 media supplemented with 10% FBS, and occasionally used CM to aid with cell growth. The cell lines responded to toxicant exposure testing and showed a dose-dependent loss of viability when exposed to CuSO4%5H2O, and increased vacuolization with exposure to NH4Cl. Therefore, KFE-5, KFE-1 and KFE-3 may be applicable for developing screening tests for various aquatic contaminants, such as EDCs that commonly interfere with the endocrine systems in aquatic animals in areas where F. heteroclitus resides (Shaughnessy et al., 2007).  Furthermore, the cell lines can be useful in fish health and for studying environmental issues such as hypoxia and salinity tolerance, and the cell lines’ response to microsporidial infectivity and may be useful for studying the life cycle of particular pathogens.    144 REFERENCES Aaku-Saraste E, Hellwig A, Huttner WB. 1996. Loss of occludin and functional tight junctions, but not ZO-1, during neural tube closure—remodeling of the neuroepithelium prior to neurogenesis. Developmental Biology 180: 664-679.   Able KW, Felley JD. 1986. Geographical variation in Fundulus heteroclitus: tests for concordance between egg and adult morphologies. American Zoology. 26: 145-157.  Adeyemi JA, Klerks PL. 2013. Occurrence of copper acclimation in the least killifish Heterandria formosa, and associated biochemical and physiological mechanisms. Aquatic Toxicology 130-131: 51-57.   Agy MB, Foy K, Gale MJ, Benveniste RE, Clark EA, Katze MG. 1991. Viral and cellular gene expression in CD4+ human lymphoid cell lines infected by the simian immunodeficiency virus, SIV/Mne. Virology. 183: 170-180.  Ahne W. 1985. Use of fish cell cultures for toxicity determination in order to reduce and replace the fish tests. Zentralblatt für Bakteriologie, Mikrobiologie und Hygiene B 180: 480–504.  Ahne W, Blake S, Essbauer S, Nicholson BL. 2003. Characterization of aquabirnaviruses from flounder Pseudopleuronectes americanus and mummichog Fundulus heteroclitus in the Chesapeake Bay, Virginia, USA. Diseases of Aquatic Organisms 56: 201-206.   Alberts B, Bray D, Lewis J, Raff M, Roberts K, Watson JD. 1994. Molecular biology of the cell. 3rd edition. New York (NY): Garland Publishing, Inc. 655 p.  Archer SL. 2013. Mitochondrial dynamics – mitochondrial fission and fusion in human diseases. The New England Journal of Medicine 369: 2236-2251.  Arif B, Pavlik L. 2013. Insect cell culture: virus replication and applications in biotechnology. Journal of Invertebrate Pathology 112: S138-S141.   Arzuaga X, Elskus A. 2010. Polluted-site killifish (Fundulus heteroclitus) embryos are resistant to organic pollutant-mediated induction of CYP1A activity, reactive oxygen species, and heart deformities. Environmental Toxicology and Chemistry. 29: 676-682.   Ashton, RS, Keung AJ, Peltier J, Schaffer DV. 2011. Progress and prospects for stem cell engineering. Annual Review of Chemical and Biomolecular Engineering. 2: 479-502.  Atmar RL, Englund JA. Laboratory methods for the diagnosis of viral diseases. In: Evans AS, Kaslow RA. Viral infections of humans: epidemiology and control. 4th edition. 1997. New York (NY): Plenum Publishing Corporation; 1997. 67 p.    145 Awaya T, Kato T, Mizuno Y, Chang H, Niwa A, Umeda K, Nakahata T, Heike T. 2012. Selective development of myogenic mesenchymal cells from human embryonic and induced pluripotent stem cells, PLoS ONE 7: e51638  Bacanskas LR, Whitaker J, Di Giulio RT. 2004. Oxidative stress in two populations of killifish (Fundulus heteroclitus) with differing contaminant exposure histories. Marine Environmental Research. 58: 597-601.  Bain PA, Kumar A. 2014. Cytotoxicity of binary mixtures of human pharmaceuticals in a fish cell line: Approaches for non-monotonic concentration–response relationships. Chemosphere. In Press. http://dx.doi.org/10.1016/j.chemosphere.2014.01.077  Baker DG. Flynn’s parasites of laboratory animals. 2nd edition. Ames (IA): Blackwell Publishing; 2007. 74-75 p.  Baker JR, Muller R, Rollinson D, Tzipori S. Advances in parasitology: opportunistic protozoa in humans. San Diego (CA): Academic Press Ltd; 1998. 302 p.   Barton BA. 2002. Stress in fishes: a diversity of responses with particular reference to changes in circulating corticosteroids. Integrative and Comparative Biology 42: 517-525.   Beharier O, Dror S, Levy S, Kahn J, Mor M, Etzion S, Gitler D, Katz A, Muslin AJ, Moran A, Etzion Y. 2012. ZnT-1 protect HL-1 cells from simulated ischemia-reperfusion through activation of Ras-ERK signaling. Journal of Molecular Medicine. 90: 127-138.   Berendse M, Grounds MD, Lloyd CM. 2003. Myoblast structure affects subsequent skeletal myotube morphology and sarcomere assembly. Experimental Cell Research 291: 435-450.   Bersell K, Arab S, Haring B, Kühn B. 2009. Neuregulin1/ErbB4 Signaling Induces Cardiomyocyte Proliferation and Repair of Heart Injury. Cell 138: 257-270.  Bhunchet E, Wake K. 1992. Role of mesenchymal cell-populations in porcine serum induced rat-liver fibrosis. Hepatology 16: 1452-1472.  Bhunia AK. Foodborne microbial pathogens: mechanisms and pathogenesis. New York (NY): Springer Science+Business Media, LLC; 2008. 113-123 p.   Bigelow HB, Schroeder WC. 1953. Fishes of the Gulf of Maine. US Fish & Wildlife Service 73: 162.   Billiard SM, Bols NC, Hodson PV. 2004. In vitro and in vivo comparisons of fish-specific CYP1A induction relative potency factors for selected polycyclic aromatic hydrocarbons. Ecotoxicology and Environmental Safety 3: 292-299.    146 Bio-Rad. 2010. TC10TM automated cell counter instruction manual. Available from http://www.bio-rad.com/webroot/web/pdf/lsr/literature/PN10016620B.pdf. [accessed 1 November 2013].   Bjarnason JB, Asgeirsson B, Fox JW. 1993. Psychrophilic proteinases from Atlantic cod. American Chemical Society 516: 69-82.   Bols NC, Boliska SA, Dixon DG, Hodson PV, Kaiser KLE. 1985. The use of fish cell cultures as an indication of contaminant toxicity to fish. Aquatic Toxicology 6: 147-155.   Bols NC, Dayeh VR, Lee LEJ, Schirmer K. 2005. Use of fish cell lines in the toxicology and ecotoxicology of fish. Piscine cell lines in environmental toxicology. Biochemistry and Molecular Biology of Fishes. 6: 43-84.  Bols NC, Lee LEJ. 1989. The corticosteroid receptor and the action of various steroids in rainbow trout fibroblasts. General and Comparative Endocrinology 74: 85-95.   Bols NC, Lee LEJ. 1991. Technology and uses of cell cultures from the tissues and organs of bony fish. Cytotechnology 6: 163-187.   Bols NC, Mosser DD, Steels GB. 1992. Temperature studies and recent advances with fish cells in vitro. Comparative Biochemistry and Physiology 103A: 1-14.   Bols NC, Schirmer K, Joyce EM, Dixon DG, Greenberg BM, Whyte JJ. 1999. Ability of polycyclic aromatic hydrocarbons to induce 7-ethoxyresorufin- o-deethylase activity in a trout liver cell line. Ecotoxicology and Environmental Safety 44: 118–128.  Bond FF, 1937. A microsporidian infection of Fundulus heteroclitus (Linn.). The Journal of Parasitology 23: 229-230.   Bonga SEW. 1997. The stress response in fish. Physiological Reviews. 77: 591-625.   Bopp SK and Lettieri T. 2008. Comparison of four different colorimetric and fluorometric cytotoxicity assays in a zebrafish liver cell line. BMC Pharmacology 30: 8.    Boudreau M, Courtenay SC, MacLatchy DLCH, Hewitt LM, Van Der Kraak GJ. 2005. Morphological abnormalities during early-life development of the estuarine mummichog, Fundulus heteroclitus, as an indicator of androgenic and anti-androgenic endocrine disruption. Aquatic Toxicology 71:357-369.   Boyd CE, Tucker CS. 1998. Pond aquaculture water quality management. Norwell (MA): Kluwer Academic Publishers. p. 147-149.  Bozinovic G, Oleksiak MF. 2010. Embryonic gene expression among pollutant resistant and sensitive Fundulus heteroclitus populations. Aquatic Toxicology 98: 221-229.    147 Brennan LM, Widder MW, Lee LEJ, van der Schalie WH. 2012. Long-term storage and impedance-based water toxicity testing capabilities of fluidic biochips seeded with RTgill-W1 cells. Toxicology in Vitro 26: 736-745.   Brunner D, Frank J, Appl H, Schöff H, Pfaller W, Gstraunthaler G. 2010. Serum-free cell culture: the serum-free media interactive online database. Altex 27:53-62.  Bucking C, Wood CM, Grosell M. 2012. Diet influences salinity preference of an estuarine fish, the killifish Fundulus heteroclitus. The Journal of Experimental Biology. 215: 1965-1974.   Buddington RK, Kuz’mina V. Digestive system. In: Ostrander GK. The handbook of experimental animals: the laboratory fish. (UK): Academic Press; 2000. 178 p.   Bulger AJ. 1984. A daily rhythm in heat tolerance in the salt marsh fish Fundulus heteroclitus. Journal of Experimental Zoology. 230: 11-16.  Burnett KG, Bain LJ, Baldwin WS, Callard CV, Cohen S, Di Giulio RT, Evans DH, et al. 2007. Fundulus as the premier teleost model in environmental biology: Opportunities for new insights using genomics. Comparative Biochemistry and Physiology, Part D. 2: 257-286.  Burton M, McCurdy D. 1940. The effect of growth and nutrition on mitochondria in liver cells of Fundulus heteroclitus. Biological Bulletin 79: 1940.   Butt AM. Macroglial lineages. In: Lemke G. Developmental Neurobiology. London (UK): Academic Press; 2009. 218 p.   Cali A, Neafie R, Weiss LM, Ghosh K, Vergara RB, Gupta R, Takvorian PM. 2010. Human vocal cord infection with microsporidium Anncaliia algerae. Journal of Eukaryotic Microbiology. 57: 562-567.   Cali A, Weiss LM, Takvorian PM. 2004. An Analysis of the Microsporidian Genus Brachiola, with Comparisons of Human and Insect Isolates of Brachiola algerae. Journal of Eukaryotic Microbiology. 51: 678-685.   Cali A, Weiss LM, Takvorian PM. 2005. A review of the development of two types of human skeletal muscle infections from microsporidia associated with pathology in invertebrates and cold-blooded vertebrates. Folia Parasitology. 52: 51-61.   Calles K, Eriksson U, Häggström L. 2006. Effect of conditioned medium factors on productivity and cell physiology in Trichoplusia ni insect cell cultures. Biotechnology progress 22: 653-659.   Capela A, Temple S. 2002. LeX/ssea-1 is expressed by adult mouse CNS stem cells, identifying them as nonependymal. Neuron 35: 865-875.   Carotti S, Morini S, Corradini SG, Burza MA, Molinaro A, Carpino G, Merli M, De Santis Muda AO, Rossi M, Attili AF, Gaudio E. 2008. Glial fibrillary acidic protein as an early marker of  148 hepatic stellate cell activation in chronic and posttransplant recurrent hepatitis C. Liver Transplant 14: 806-814.    Castillo J, Le Bail PY, Paboeuf G, Navarro I, Weil C, Fauconneau B, Guitérrez. 2002. IGF-I binding in primary culture of muscle cells of rainbow trout: changes during in vitro development. American Journal of Physiology Regulatory, Integrative and Comparative Physiology. 283: R647-652.   Castro R, Zou J, Secombes CJ, Martin SAM. 2011. Cortisol modulates the induction of inflammatory gene expression in a rainbow trout macrophage cell line. Fish & Shellfish Immunology 30: 215-223.   Catrenich CE, Chestnut MH. 1992. Character and origin of vacuoles induced in mammalian cells by the cytotoxin Helicobacter pylori. Journal of Medical Microbiology 37: 389-395.   Chen H, Chan DC. 2009. Mitochondrial dynamics–fusion, #ssion, movement, and mitophagy–in neurodegenerative diseases. Human Molecular Genetics 18: R169–R176.  Chen TR. 1970. Fish chromosome preparation: air-dried displays of cultured ovarian cells in two killifishes (Fundulus). Journal of Fish Research 27: 158-161.   Chen QL, Luo Z, Zheng JL, Li XD, Liu CX, Zhao YH, Gong Y. 2012. Protective effects of calcium on copper toxicity in Pelteobagrus fulvidraco: copper accumulation, enzymatic activities, histology. Ecotoxicology and Environmental Safety. 76: 126-134.   Cheng S, Yang X, Zhang Y, Xiao C. 2013. Culture of major pelvic ganglion neurons from adult rat. Cytotechnology 65: 663-669.  Chey S, Claus C, Liebert UG. 2010. Validation and application of normalization factors for gene expression studies in rubella virus-infected cell lines with quantitative real-time PCR. Journal of Cellular Biochemistry 110: 118-128.   Chojkier M. 1986. Hepatocyte collagen production in vivo in normal rats. Journal of Clinical Investigation. 78: 333-339.   Chrousos GP, Gold PW. 1992. The concepts of stress and stress systems disorders. Overview of physical and behavioural homeostasis. Journal of American Medical Association. 267: 1244-1252.   Clark BW, Di Giulio RT. 2012. Fundulus heteroclitus adapted to PAHs are cross-resistant to multiple insecticides. Ecotoxicology 21: 465-474.   Clark CR, Taylor JD, Thcen TT. 1985. Unusual responses of cultured Fundulus heteroclitus melanophores to epinephrine and ions, paradox of K+ versus Na+. Journal of Experimental Zoology. 236: 361-364.   149 Claycomb WC, Lanson NA, Stallworth BS, Egeland DB, Delcarpio JB, Bahinski A, Izzo NJ. 1998. HL-1 cells: A cardiac muscle cell line that contracts and retains phenotypic characteristics of the adult cardiomyocyte. Proceedings of the National Academy of Sciences 95: 2979-2984.  Collier NC, Sheetz MP, Schlesinger MJ. 1993. Concomitant changes in mitochondria and intermediate filaments during heat shock and recovery of chicken embryo fibroblasts. Journal of Cellular Biochemistry 52: 297-307.   Connell DW, Lam P, Richardson B, Wu R. Introduction to Ecotoxicology. Oxford, England: Blackwell Science Ltd; 1999. 150 p.  Cooper GM. The cell: a molecular approach. 2nd edition. Sunderland (MA): Sinauer Associates; 2000.   Cotton P. 1993. Animals and science benefit from ‘replace, reduce, refine’ effort. The Journal of American medical Association. 270: 2905-2907.  Cover TL, Halter SA, Blaser MJ. 1992. Characterization of HeLa cell vacuoles induced by Helicobacter pylori broth culture supernatant. Human Pathology 23: 1004-1010.   Cover TL, Puryear W, Perez-Perez GI, Blaser MJ. 1991. Effect of urease on HeLa cell vacuolation induced by Helicobacter pylori cytotoxin. Infection and Immunity 59: 1264-1270.   Coyle CM, Weiss LM, Rhodes III LV, Cali A, Takvorian PM, Brown DF, Visvesvara GS, Xiao L, Naktin J, Young E, Gareca M, Colasante G and Wittner M. 2004. Fatal myositis due to the microsporidian Brachiola algerae, a mosquito pathogen. The New England Journal of Medicine.  351: 42- 47.  Craig BD, Anderson DS. Handbook of Corrosion Data. 2nd ed. Materials Park (OH): ASM International; 1995. 140 p.  da Costa KA, Badea M, Fischer LM, Zeisel SH. 2004. Elevated serum creatine phosphokinase in choline-deficient humans: mechanistic studies in C2C12 mouse myoblasts 1,2,3,4. The American Journal of Clinical Nutrition. 80: 163-170.   Dash SN, Routray P, Dash C, Guru BC, Swain P, Sarangi N. 2008. Use of the non-toxic cryoprotectant trehalose enhances recovery and function of fish embryonic stem cells following cryogenic storage. Current Stem Cell Research & Therapy 3: 277-287.   Dayeh VR, Lynn DH, Bols NC. 2005. Cytotoxicity of metals common in mining effluent to rainbow trout cell lines and to the ciliated protozoan, Tetrahymena thermophila. Toxicology In Vitro 19: 399–410.  Dayeh VR, Schirmer K, Bols NC. 2002. Applying whole-water samples directly to fish cell cultures in order to evaluate the toxicity of industrial effluent. Water Research 36: 3727-3738.    150 Dayeh VR, Schirmer K, Bols NC. 2009. Ammonia-containing Industrial Effluents, Lethal to Rainbow Trout, Induce Vacuolisation and Neutral Red Uptake in the Rainbow Trout Gill Cell Line, RTgill-W1. Alternatives to Laboratory Animals. 37: 77-87.   Dayeh VR, Schirmer K, Lee LEJ, Bols NC. 2005. Rainbow trout gill cell line microplate cytotoxicity test. Small-Scale Freshwater Toxicity Investigations 1: 473-503.   Dayeh VR, Bols NC, Tanneberger K, Schirmer K, Lee LEJ. 2013. The Use of Fish-Derived Cell Lines for Investigation of Environmental Contaminants: An Update Following OECD’s Fish Toxicity Testing Framework No. 171. Current Protocol in Toxicology 1.5.1-1.5.20.  Debacq-Chainiaux F, Erusalimsky JD, Campisi J, Toussaint O. 2009. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nature Protocols 4: 1798-1806.   Dederer PH. 1921. The behavior of cells in tissue culture of Fundulus heteroclitus with special reference to the ectoderm. Biological Bulletin. 41: 221-240.  del Peso A, Repetto G, Zurita JL. 2008. Neutral red uptake assay for the estimation of cell viability/cytotoxicity. Nature Protocols 3: 1125-1131.   Devoto SH, Melançon E, Eisen JS, Westerfield M. 1996. Identification of separate slow and fast muscle precursor cells in vivo, prior to somite formation. Development 122: 3371-3380.   DeWitte-Orr, S.J., Leong, J.A. and Bols, N.C. (2007) Induction of antiviral genes, Mx and vig-1, by dsRNA and Chum salmon reovirus in rainbow trout monocyte/macrophage and fibroblast cell lines. Fish and Shellfish Immunology. 23: 670-82.  Didier ES, Stovall ME, Green LC, Brindley PJ, Sestak K, Didier PJ. 2004. Epidemiology of microsporidosis: sources and modes of transmission. Veterinary Parasitology. 126: 145-166.   Didier ES. 2005. Microsporidiosis: an emerging and opportunistic infection in humans and animals. Acta Tropica. 94: 61-76.   Di Giulio RT, Hinton DE. 2008. The Toxicology of Fish. Boca Raton (FL): Taylor & Francis Group LLCC. 335-343, 498 p.   di Prisco G, Verde C. Adaptation and evolution in marine environments, volume 1: the impacts of global change on biodiversity. Berlin: Springer-Verlag; 2012. 130 p.   Dlugosz AA, Antin PB, Nachmias VT, Holtzer H. 1984. The relationship between stress fiber-like structures and nascent myofibrils in cultured cardiac myocytes. Journal of Cell Biology 99:2268-2278.    151 Dodd J, Jessell TM. 1986. Cell surface glycoconjugates and carbohydrate-binding proteins: possible recognition signals in sensory neuron development. The Journal of Experimental Biology 124: 225-238.   DPDx. 2012. Laboratory identification of parasites of public health concern. Available from http://dpd.cdc.gov/dpdx/HTML/Microsporidiosis.htm [accessed 6 December 2012].   Dunel-Erb S, Bailly Y, Laurent P. 1982. Neuroepithelial cells in fish gill primary lamellae. Journal of Applied Physiology: Respiratory, Environmental and Exercise Physiology 53: 1342-1353.   Eisenbrand G, Pool-Zobel B, Baker V, Balls M, Blaauboer BJ, Boobis A, Carere A, Kevekordes S, Lhuguenot J-C, Pieters R, Kleiner J. 2002. Methods of in vitro toxicology. Food and Chemical Toxicology. 40: 193-236.  Eisler R. 1986. Use of Fundulus heteroclitus in pollution studies. American Zoologist 26: 283-288.   Ekwall B, Silano V, Paganuzzi-Stammati A, Zucco F. Short-term toxicity tests for non-genotoxic effects: Toxicity tests with mammalian cell cultures. Hoboken (NJ): John Wiley & Sons Ltd; 1990. 75-97 p.   Elshenawy OH, Anwar-Mohamed A, Abdelhamid G, El-Kadi AOS. 2013. Murine atrial HL-1 cell line is a reliable model to study drug metabolizing enzymes in the heart. Vascular Pharmacology 58: 326-333.   Engel FB, Schebesta M, Duong MT, Lu G, Ren S, Madwed JB, Jiang H, Wang Y, Keating MT. 2005. p38 MAP kinase inhibition enables proliferation of adult mammalian cardiomyocytes. Genes & Development19: 1175-1187.   Erker L, Grompe M. 2008. Signaling networks in hepatic oval cell activation. Stem Cell Research 1: 90-102.   European Commission Environment [Internet]. [REACH] Registration evaluation authorization and restriction of chemical substances; c2007-2011 [cited 2013 Nov 8]. Available from: http://ec.europa.eu/environment/chemicals/reach/reach_intro.htm  Ezeonyejiaku CD, Obiakor MO, Ezenwelu CO. 2011. Toxicity of copper sulphate and behavioral locomotor response of tilapia (oreochromis niloticus) and catfish (clarias gariepinus) species. Online journal of animal and feed research. 1: 130-134.   Fangue NA, Hofmeister M, Schulte PM. 2006. Intraspecific variation in thermal tolerance and heat shock protein gene expression in common killifish, Fundulus heteroclitus. The Journal of Experimental Biology. 209: 2859-2872.   152 Fangue NA, Podrabsky JE, Crawshaw LI, Schulte PM. 2009. Countergradient variation in temperature preference in populations of killifish Fundulus heteroclitus. Physiological and Biochemical Zoology 82: 776-786.  Fenderson BA, De Miguel MP, Pyle AD, Donovan PJ. 2006. Staining embryonic stem cells using monoclonal antibodies to stage-specific embryonic antigens. Methods in Molecular Biology 325: 207-224.   Fent K. 2007. Permanent fish cell cultures as important tools in ecotoxicology. Alternatives to Animal Experiments 24: 26-28.   Festing S, Wilkinson R. 2007. The ethics of animal research: talking point on the use of animals in scientific research. EMBO reports 8: 526-530.   Field AS, Paik JY, Stark D, Qiu MR, Morey A, Plit ML, Canning EU, Glanville AR. 2012. Myositis due to the microsporidian Anncaliia (Brachiola) algerae in a lung transplant recipient. Transplant Infectious Disease. 14: 169-176.   Fisher PB, Rachlin JW. 1972. Karyotypic analysis of 2 sympatric species of fish, Fundulus heteroclitus L. and F. majalis. Journal of Fish Biology 4: 67-71.   Fox N, Damjanov I, Martinez-Hernandez A, Knowles BB, Solter D. 1981. Immunohistochemical localization of the early embryonic antigen (SSEA-1) in postimplantation mouse embryos and fetal adult tissue. Developmental Biology 83: 391-398.   France RL, Graham L. 1986. Increased microsporidian parasitism of the crayfish Orconectes virilis in an experimentally acidified lake. Aquatic Toxicology 9: 191-192.   Frank KT, Petrie B, Choi JS, Leggett WC. 2005. Trophic cascades in a formerly cod-dominated ecostytem. Science 308: 1621-1623.   Franzen C, Müller A. 2001. Microsporidiosis: human diseases and diagnosis. Microbes and Infection. 3: 389-400.   Freshney I. 2001. Application of cell cultures to toxicology. Cell Biology and Toxicology 17: 213-230.   Freshney RI. Culture of animal cells: a manual of basic technique. 5th ed. Hoboken (NJ): John Wiley & Sons, Inc; 2005 194; 199-216; 299-315 p.  Freshney RI. 2010. Culture of animal cells: a manual of basic technique and specialized applications. 6th ed. Hoboken (NJ): John Wiley & Sons, Inc. 2, 7, 17, 22, 274 p.   Freshney RI, Stacey GN, Auerbach JM. 2007. Cultures of human stem cells. Hoboken (NJ): John Wiley & Sons, Inc; 2007. 14, 63 p.   153 Funkenstein B, Balas V, Skopal T, Radaelli G, Rowlerson A. 2006. Long-term culture of muscle explants from Sparus aurata. Tissue and Cell. 38: 399-417.  Gagne D, Pons M, Philibert D. 1985. RU 38486: a potent antiglucocorticoid in vitro and in vivo. Journal of Steroid Biochemistry 23: 247-251.   Gagné N, MacKinnon AM, Boston L, Souter B, Cook-Versloot M, Griffiths S, Olivier G. 2007. Isolation of viral haemorrhagic septicaemia virus from mummichog, stickleback, striped bass and brown trout in eastern Canada. Journal of Fish Diseases 30: 213-223.   Gearhart J, Hogan B, Melton D, Pedersen R, Thomas ED, Thomson J, Wilmut SI. Essentials of stem cell biology. 2nd ed. San Diego (CA): Elsevier Inc; 2009. 424 p.   Geerts A. 2001. History, heterogeneity, developmental biology, and functions of quiescent hepatic stellate cells. Seminars in Liver Disease 21: 311-336.   Geerts A, Eliasson C, Niki T, Wielant A, Vaeyens F, Pekny M. 2001. Formation of normal desmin intermediate filaments in mouse hepatic cells vimentin. Hepatology 33: 177-188.   Geldmacher-Voss B, Reugels AM, Pauls S, Campos-Ortega JA. 2003. A 90° rotation of the mitotic spindle changes the orientation of mitoses of zebra'sh neuroepithelial cells. Development 130: 3767-3780.   Genz J, Grosell M. 2011. Fundulus heteroclitus acutely transferred from seawater to high salinity require few adjustments to intestinal transport associated with osmoregulation. Comparative Biochemistry and Physiology, Part A. 160: 156-165.  Ghosh C, Zhou YL, Collodi P. 1994. Derivation and characterization of a zebrafish liver cell line. Cell Biology and Toxicology 10: 167-176.   Gignac SJ. 2012. Development of a cell line from the common killifish, Fundulus heteroclitus, embryo with myogenic characteristics and applications in ecotoxicology. Honours Thesis. Wilfrid Laurier University.   Gillen AL. 2007. The genesis of germs: the origin of diseases and the coming plagues. Green Forest (AR): Master Books, Inc; 2007. 93 p.   Gomes LG, Di Benedetto G. Scorrano L. 2011. During autophagy mitochondria elongate, are spared from degradation and sustain cell viability. Nature Cell Biology 13: 589-598.  Gomes LG, Scorrano L. 2011. Mitochondrial elongation during autophagy: a stereotypical response to survive in difficult times. Autophagy 7: 1251-1253.   Goodrich HB. 1924. Cell behavior in tissue culture. Biological Bulletin. 46: 252-262.   154 Goodwin EC, Yang E, Lee CJ, Lee HW, DiMaio D, Hwang ES. 2000. Rapid induction of senescence in human cervical carcinoma cells. Proceedings of the National Academy of Sciences 97: 10978-10983.   Götz M, Huttner WB. 2005. The cell biology of neurogenesis. Nature Reviews: Molecular and Cell Biology 6: 777-789.   Green L. 1968. Mechanism of movements of granules in melanocytes of Fundulus heteroclitus. Physiology. 59: 1179-1186.  Greenlee AR, Dodson MV, Yablonka-Reuvenis Z, Kersten CA, Cloud JG. 1995. In vitro differentiation of myoblasts from skeletal muscle of rainbow trout. Journal of Fish Biology. 46: 731-747.   Gregorios JB, Mozes LW, Norenberg LOB, Norenberg MD. 1985. Morphologic effects of ammonia on primary astrocyte cultures: I. light microscope slides. Journal of Neuropathology and Experimental Neurology 44: 397-403.   Grillitsch B, Gans O, Kreuzinger N, Scharf S, Uhl M, Fuerhacker M. 2006. Environmental risk assessment for quaternary ammonium chlorides: a case study from Austria. Water Science and Technology 54: 111-118.   Grosell M. 2012. Homeostasis and toxicology of essential metals. Fish Physiology 31A: 53-133.   Grosell M, Blanchard J, Brix KV, Gerdes R. 2007. Physiology is pivotal for interactions between salinity and acute copper toxicity to fish and invertebrates. Aquatic Toxicology 84: 162-172.  Gstraunthaler G. 2003. Alternatives to the use of fetal bovine serum: serum-free cell culture. Altex 20: 275-281.   Gstraunthaler G, Hartung T. Good cell culture practice: good laboratory practice in the cell culture laboratory for the standardization and quality assurance of in vitro studies. In: Lehr CM. Cell culture models of biological barriers: in vitro test systems for drug absorption and delivery. New York (NY): Taylor & Francis Group; 2002. 114 p.   Guguen-Guillouzo C, Guillouzo A. 2010. General review on in vitro hepatocyte models and their applications. Methods in Molecular Biology 640: 1-40.  Gupte S. The short textbook of medical microbiology. New Delhi (India): Jaypee Brothers Medical Publishers Ltd; 2006. 300 p.  Hampton JA, Lantz RC, Hinton DE. 1989. Functional units in rainbow trout (Salmo gairdneri, Richardson) liver: III. Morphometric analysis of parenchyma, stroma, and component cell types. American Journal of Anatomy 185: 58-73.    155 Hara TJ, Zielinski B. Fish Physiology, sensory systems neuroscience, volume 25. San Diego (CA): Elsevier; 2007. 127 p.   Hargreaves T. Chemical Formulation: An overview of surfactant-based preparations used in everyday life. Cambridge (UK): The Royal Society of Chemistry; 2003. 68 p.   Harper C, Wolf JC. 2009. Morphologic effects of the stress response in fish. Institute for Laboratory Animal Research Journal. 50: 387-396.   Harrison R. 1907. Observations on the living developing nerve fiber. Anatomical Record. 1: 116- 128.  Hayflick L. 1983. Intracellular determinants of cell aging. Mechanisms of Ageing and Development. 28: 177-185.   Hayflick L, Moorhead PS. 1961. The serial cultivation of human diploid cell strains. Experimental Cell Research 25: 585-621.   Healy TM, Tymchuk WE, Osborne EJ, Schulte PM. 2010. Heat shock response of killifish (Fundulus heteroclitus): candidate gene and heterologous microarray approaches. Physiological Genomics 41:171-184.   Healy TM, Schulte PM. 2012. Thermal acclimation is not necessary to maintain a wide thermal breadth of aerobic scope in the common killifish (Fundulus heteroclitus). Physiological and Biochemical Zoology 85: 107-119.   Hebert PD, Gregory TR. 2005. The promise of DNA barcoding for taxonomy. Systematic Biology 54:852-859.   Hebert PD, Ratnasingham S and deWaard R. 2003. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society. 270: S96-S99  Hedtke JL, Norris LA. 1980. Effect of ammonium chloride on predatory consumption rates of brook trout (Salvelinus fontinalis) on juvenile chinook salmon (Oncorhynchus tshawytscha) in laboratory streams. Bulletin of Environmental Contamination and Toxicology 24: 81-89.   Henics T, Wheatley DN. 1999. Cytoplasmic vacuolation, adaptation and cell death: A view on new perspectives and features. Biology of the Cell 91: 485-498.   Hermann M, Foisner R, Schneider WJ, Ivessa NE. 2003. Regulation by estrogen of synthesis and secretion of apolipoprotein A-I in the chicken hepatoma cell line, LMH-2A. Biochimica et Biophysica Acta1641: 25-33.    156 Herrman H, Münick MD, Brettel M, Fouquet B, Markl J. 1996. Vimentin in a cold-water fish, the rainbow trout: highly conserved primary structure but unique assembly properties. Journal of Cell Science 109: 569-578.   Hilleman MR. 2000. Vaccines in history evolution and perspective: a narrative of vaccine discoveries. Vaccine. 18: 1436-1447.   Hiratsuka M, Uno N, Ueda K, Kurosaki H, Imaoka N, Kazuki K, Ueno E, Akakura Y, Katoh M, Osaki M, Kazuki Y, Nakagawa M, Yamanaka S, Oshimura M. 2011. Integration-free iPS cells engineered using human artificial chromosome vectors. PLoS ONE 6: e25961  Holmes JC. 1996. Parasites as threats to biodiversity in shrinking ecosystems. Biodiversity and Conservation 5: 975-983.   Hong JR, Lin TL, Hsu YL, Wu JL. 1998. Apoptosis precedes necrosis of fish cell line with infectious pancreatic necrosis virus infection. Virology 250: 76-84.   Hong Y, Winkler S, Schartl M. 1996. Pluripotency and differentiation of embryonic stem cell lines from the medakafish (Oryzias latipes). Mechanisms of Development 60: 33-44.   Horne MT and Dunson WA. 1995. Effects of low pH, metals, and water hardness on larval amphibians. Archives of Environmental Contamination and Toxicology. 29: 500-505.   Houle J, Fedoroff S. 1983. Temporal relationship between the appearance of vimentin and neural tube development. 285: 189-195.   Irwin, R. J. 1997. Environmental Contaminants Encyclopedia, 1-7. Copper Entry. National Park Service, Water Resources Divisions, Water Operations Branch. Fort Collins, Colorado.  Javitt NB. 1990. Hep G2 cells as a resource for metabolic studies: lipoprotein, cholesterol, and bile acids. The Journal of the Federation of American Societies for Experimental Biology 4: 161-168.   Jensen I, Steiro K, Sommer AI, Mennen S, Johansen A, Sandaker EK, Seppola M. 2013. Establishing a cell line from Atlantic cod as a novel tool for in vitro studies. Fish and Shellfish Immunology 34: 199-208.   Johanssen S, Allolio B. 2007. Mifepristone (RU 486) in Cushing’s syndrome. European Journal of Endocrinology. 157: 561-569.   Johnson LV, Walsh ML, Chen LB. 1980. Localization of mitochondria in living cells with rhodamine 123. Proceedings of the National Academy of Sciences in the United States of America 77: 990-994.   Johnston IA. 1987. Respiratory characteristics of muscle fibres in a fish (Chaenocephalus aceratus) that lacks haem pigments. Journal of Experimental Biology 133: 415-428.   157  Johnston IA. 1999. Muscle development and growth: potential implications for flesh quality in fish. Aquaculture 177: 99-115.    Johnston IA. Muscle development and growth. San Diego (CA): Academic Press; 2001. 96-97 p.  Johnston IA, Bower NI, Macqueen DJ. 2011. Growth and the regulation of myotomal muscle mass in teleost fish. Journal of Experimental Biology 214: 1617-1628.   Johnston IA, Camm JP, White M. 1988. Specialisations of swimming muscles in the pelagic antarctic fish Pleuragramma antarcticum. Marine Biology 100: 3-12.   Johnston IA, Guderley H, Franklin CE, Crockford T, Kamunde C. 1994. Are mitochondria subject to evolutionary temperature adaptation? Journal of Experimental Biology 195: 293-306.   Joplin R. 1994. Isolation and culture of biliary epithelial cells. Gut 35: 875-878.   Joseph J, Sharma S. 2009. In vitro culture of various species of microsporidia causing keratitis: evaluation of three immortalized cell lines. Indian Journal of Medical Microbiology 27: 35-39.   Kaighn ME and Prince AM. 1971. Production of Albumin and Other Serum Proteins by Clonal Cultures of Normal Human Liver. Proceedings of the National Academy of Sciences of the United States of America. 68: 2396-2400.    Kaneko T, Katoh F. 2004. Functional morphology of chloride cells in killifish Fundulus heteroclitus, a euryhaline teleost with seawater preference. Fisheries Science. 70: 723-733.  Kaplan J, Hukku B. 1998. Cell line characterization and authentication. Methods in Cell Biology 57: 203-216.   Keeling PJ, Fast NM. 2002. Microsporidia: biology and evolution of highly reduced intracellular parasites. Annual Review of Microbiology. 56: 93-116.   Keller G. 2005. Embryonic stem cell differentiation: emergence of a new era in biology and medicine. Genes & Development 19: 1129-1155.   Keynes RD, Aidley DJ, Huang CLH. Nerve and muscle. 4th ed. Cambridge (UK): Cambridge University Press; 2011. 106-111 p.   Kidder GW, Peterson CW, Preston RL. 2006. Energetics of osmoregulation: I. oxygen consumption by Fundulus heteroclitus. Molecular and Comparative Physiology. 305: 309-317.   Kintner C. 2002. Neurogenesis in embryos and in adult neural stem cells. The Journal of Neuroscience 22: 639-643.    158 Kitta K, Clément SA, Remeika J, Blumberg JB, Suzuki YJ. 2001. Endothelin-1 induces phosphorylation of GATA-4 transcription factor in the HL-1 atrial-muscle cell line. Biochemical Journal 359(Pt 2): 375-380.   Klapper W, Heidorn K, Kühne K, Parwaresch R, Krupp G. 1998. Telomerase activity in ‘immortal’ fish. FEBS Letters. 434: 409-412.   Klein K, Palefsky I. Shampoo formulation. In: Johansson I, Somasundaran P. Handbook for Cleaning/Decontamination of surfaces. Oxford (UK): Elsevier; 2007. 287-289 p.   Kne#evi$ M, Gledi$ D, Kukolj V, Kne#evi$ (, Jovanovi$ M, Bo#i$ T, Aleksi$-Kova)evi$ S. 2009. Expression of *-SMA, desmin and vimentin in canine liver with fibrosis. Acta Veterinaria 59: 361-370.   Kotler DP, Orenstein JM. 1998. Clinical syndromes associated with microsporidiosis. Advances in Parasitology. 40: 321-349.   Koudela B, Visvesvara GS, Moura H, Vávra J. 2001. The human isolate of Brachiola algerae (Phylum Microspora): development in SCID mice and description of its fine structure features. Parasitology. 123: 153-162.   Koumans JTM, Akster HA, Dulos GJ, Osse JWM. 1990. Myosatellite cells of Cyprinuscarpio (Teleostei) in vitro: isolation, recognition and differentiation. Cell Tissue Research. 261: 173-181.   Kramer NI, Hermens JLM, Schirmer K. 2009. The influence of modes of action and physicochemical properties of chemicals on the correlation between in vitro and acute fish toxicity data. Toxicology in Vitro 23: 1372-1379.   Krishan A, Dandekar PD. 2005. DAPI fluorescence in nuclei isolated from tumors. Journal of Histochemistry and Cytochemistry 53:1033-1036.   Kroemer G, Mariño G, Levine B. 2010. Autophagy and the integrated stress response. Molecular Cell 40: 280-293.   Kurosawa H. 2007. Methods for inducing embryoid body formation: in vitro differentiation system of embryonic stem cells. Journal of Bioscience and Bioengineering 103:389-398.   Langdon SP. Cancer Cell Culture: Methods and Protocols. Edinburgh (UK): Humana Press Inc; 2004a. 3-4 p.   Langdon SP. 2004b. Cell culture contamination. Cancer Cell Culture 88: 309-317.   Lannan CN. 1994. Fish cell culture: a protocol for quality control. Journal of Tissue Culture Methods 16: 95-98.    159 Lawson MA, Purslow PP. 2000. Differentiation of myoblasts in serum-free media: effects of modified media are cell-line specific. Cells Tissues Organs 167:130-137.   Lee LEJ, Bols NC. 1989a. Action of cortisol on the proliferation of rainbow trout fibroblasts. Cell and Tissue Kinetics 22: 291-301.    Lee LEJ, Bols NC. 1989b. The corticosteroid receptor and the action of various steroids in rainbow trout fibroblasts. General and Comparative Endocrinology 74: 85-95.   Lee LEJ, Dayeh VR, Schirmer K, Bols NC. 2008. Fish cell lines as rapid and inexpensive screening and supplemental tools for whole effluent testing. Integrated Environmental Assessment and Management 4: 372-374.   Lee LEJ, Clemons JH, Bechtel DG, Caldwell SJ, Han KB, Pasitschniak-Arts M. Mosser DD, Bols NC. 1993. Development and characterization of a rainbow trout liver cell line expressing cytochrome P450-dependent monooxygenase activity. Cell Biology and Toxicology 9: 279-294.   Leiden JM. 1999. Beating the odds: a cardiomyocyte cell line at last. The Journal of Clinical Investigation 103: 591-592.   Lester SM, Braunbeck TA, Teh SJ, Stegeman JJ, Miller MR, Hinton DE. 1993. Hepatic cellular distribution of cytochrome P-450 IA1 in rainbow trout (Oncorhynchus mykiss): an immunohisto- and cytochemical study. Cancer Research 53: 3700-3706.   Lewis LC. 2002. Protozoan control of pests. In: Pimentel D. 2002. Encyclopedia of pest management. New York (NY): Marcel Dekker, Inc. 673-676 p.   Lewis MA. 1991. Chronic and sublethal toxicities of surfactants to aquatic animals: a review and risk assessment. Water Research 25: 101-113.   Lewis MR. 1916. Sea water as a medium for tissue cultures. Anatomical Record. X: 287-299.  Lewis MR. 1921. The presence of glycogen in the cells of embryos of Fundulus heteroclitus studied in tissue culture. Biological Bulletin. 41: 241-247.  Life Technologies. 2013. Retrieved from http://www.lifetechnologies.com/ca/en/home.html [accessed 21 September 2013].   Lin HC, Dunson WA. 1993. The effect of salinity on the acute toxicity of cadmium to the tropical, estuarine, hermaphroditic fish, Rivulus marmoratus: a comparison of Cd, Cu, and Zn tolerance with Fundulus heteroclitus. Archives of Environmental Contamination and Toxicology 25: 41-47.   Lindholm JB, Auster PJ, Kauíman LS. 1999. Habitat-mediated survivorship of juvenile (0-year) Atland cod Gadus morhua. Marine Ecology Progress Series 180: 247-255.    160 Lindner H, Behrends U, Misumi Y, Kremmer E, Eißner G, Schultz-Hector. 1998. Loss of myocardial capillary endothelial-cell alkaline phosphatase (ALP) activity in primary endothelial cell culture. Cell Tissue Research 291: 497-505.   Lister AL, Van Der Kraak GJ, Rutherford R, MacLatchy D. 2011. Fundulus heteroclitus: ovarian reproductive physiology and the impact of environmental contaminants. Comparative Biochemistry and Physiology - Part C: Toxicology & Pharmacology. 154: 278-287.   Liu XJ, Luo Z, Xiong BX, Liu X, Zhao YH, Hu GF, Lv GJ. 2010. Effect of waterborne copper exposure on growth, hepatic enzymatic activities and histology in Synechogobius hasta. Ecotoxicology and Environmental Safety. 73: 1286-1291.   Loh PC, Lu Y, Brock JA. 1990. Growth of the penaeid shrimp virus infectious hypodermal and hematopoietic necrosis virus in a fish cell line. Journal of Virological Methods 28: 273-280.   Lom J. 2002. A catalogue of described genera and species of microsporidians parasitic in fish. Systematic Parasitology. 53: 81-99.   Lom J, Dyková I, Wang CH, Lo CF, Kou GH. 2000. Ultrastructural justification for the transfer of Pleistophora anguillarum Hoshina, 1959 to the genus Heterosporis Schubert, 1969. Diseases of Aquatic Organisms. 43: 225-231.   Loring JF, Schwartz P, Wesselschmidt R. Human stem cell manual: a laboratory guide. San Diego (CA): Elsevier Inc; 2007. 194 p.  Lucey BP, Nelson-Rees WA, Hutchins GM. 2009. Archives of Pathology & Laboratory Medicine. 133: 1463-1467.  Macleod MJ. 2012. In vitro study of the microsporidian parasite Loma morhua, using cod-derived cells and novel culture techniques. MSc Thesis. Wilfrid Laurier University.   Macqueen DJ. Bower NI. Johnston IA. 2010. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis. Biochemical and Biophysical Research Communications. 400: 599-605.   Malhão F, Urbatzka R, Navas JM, Cruzerio C, Monteiro RAF, Rocha E. 2013. Cytological, immunocytochemical, ultrastructural and growth characterization of the rainbow trout liver cell line RTL-W1. Tissue and Cell 45: 159-174.   Manabe N, Hirai S, Imai F, Nakanishi H. Takai Y. 2002. Association of ASIP/mPAR-3 with adherens junctions of mouse neuroepithelial cells. Developmental Dynamics 225: 61-69.   Manabe Y, Miyatake  S, Takagi M, Nakamura M, Okeda A, Nakano T, Hirshman MF, Goodyear LJ, Fujii NL. 2012. Characterization of an acute muscle contraction model using C2C12 myotubes. PLoS ONE 7: e52592.   161 Marceau N, Germain L, Goyette R, Noël M, Gourdeau H. 1986. Cell of origin distinct cultured rat epithelial cells, as typed by cytokeratin and surface component selective expression. Biochemistry and Cell biology. 64: 788-802.   Marone M, QuinonesJenab V, Meiners S, Nowakowski RS, Ho SY, Geller HM. 1995. An immortalized mouse neuroepithelial cell line with neuronal and glial phenotypes. Developmental Neuroscience 17: 311-323.   Marshall WS, Bryson SE, Midelfart A, Hamilton WF. 1995. Low-conductance anion channel activated by cAMP in teleost Cl- secreting cells. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology. 268: 963-969.  Masters JRW. 2000. Human cancer cell lines: fact and fantasy. Nature Reviews Molecular Cell Biology 1: 233-236.   Mather JP, Roberts PE. Introduction to cell and tissue culture: theory and techniques.  New York (NY): Plenum Press; 1998. 123 p.   Matschak TW, Stickland NC. 1995. The growth of Atlantic salmon (Salmo solar L.) myosatellite cells in culture at two different temperatures. Experientia. 51: 260-266.   Mazon AF, Cerqueira CCC, Fernandes MN. 2002. Gill cellular changes induced by copper exposure in the South American tropical freshwater fish Prochilodus scrofa. Environmental Research Section A. 88: 52-63.   McClean D. 1957. Section of comparative medicine. Discussion: Recent advances in the use of tissue culture methods in virus research. Proceedings of the Royal Society of Medicine. 50: 911.  McLusky DS, Elliot M. The estuarine ecosystem: ecology, threats, and management. Oxford (NY): Oxford University Press; 2004. 1-2 p.   MDIBL. 2014. Available from http://www.mdibl.org/cell_culture.php [accessed 7 January 2014].   Mescher AL. Junqueira’s basic histology. 12th ed. Columbus (OH): The McGraw-Hill Companies, Inc; 2010. 47 p.  Miura T, Mattson MP, Rao MS. 2004. Cellular lifespan and senescence signaling in embryonic stem cells. Aging Cell 3: 333-343.   Moeller T. Chemistry: with inorganic qualitative analysis. New York (NY): Academic Press, Inc; 1980. 909 p.   Mommsen TP. 2001. Paradigms of growth in fish. Part B: Biochemistry and Molecular Biology 129: 207-219.   162 Monaghan SRM. 2011. Use of fish cell cultures for the study and cultivation of microsporidia. PhD Thesis. University of Waterloo.   Monaghan SR, Kent ML, Watral VG, Kaufman RJ, Lee LE, Bols NC. 2009. Animal cell cultures in microsporidial research: their general roles and their specific use for fish microsporidia. In Vitro Cellular & Developmental Biology – Animal. 45: 135-147.   Monaghan SR, Rumney RL, Vo NTK, Bols NC, Lee LEJ. 2010. In vitro growth of microsporidia Anncaliia algerae in cell lines from warm water fish. In Vitro Cellular & Developmental Biology – Animal. 47: 104-113.   Morrison CM. 1983. The distribution of the microsporidian Loma morhua in tissues of the cod Gadus morhua L. Canadian Journal of Zoology. 61: 2155-2161.    Mothersill C, Austin B. In vitro methods in aquatic toxicology. Heidelberg, Germany: Springer-Praxis; 2003. 16, 312, 381 p.   Mulvaney DR, Cyrino JEP. 1995. Establishment of channel catfish satellite cell cultures. Basic and Applied Myology. 5: 65-70.   Nacci DE, Champlin D, Coiro L, McKinney R, Jayaraman S. 2002. Predicting the occurrence of genetic adaptation to dioxinlike compounds in populations of the estuarine fish Fundulus heteroclitus. Environmental Toxicology & Chemistry. 21: 1525-1532.  Nacci D, Huber M, Champlin D, Jayaraman S, Cohen S, Gauger E, Fong A, Gomez-Chiarri M. 2009. Evolution of tolerance to PCBs and susceptibility to a bacterial pathogen (Vibrio harveyi) in Atlantic killifish (Fundulus heteroclitus) from New Bedford (MA, USA) harbor. Environmental Pollution 157: 857-864.  Nardelli J, Catala M, Charnay P. 2003. Establishment of embryonic neuroepithelial cell lines exhibiting an epiplastic expression pattern of region speci'c markers. Journal of Neuroscience Research 73: 737-752.   Nakayama GR, Caton MC, Nova MP, Parandoosh Z. 1997. Assessment of the Alamar Blue assay for cellular growth and viability in vitro. Journal of Immunological Methods 204: 205-208.   Nakono T, Tomlinson N. 1967. Catechol-amine and carbohydrate concentrations in rainbow trout (Salmo gairdneri) in relation to physical disturbance. Journal of the Fisheries Research Board of Canada 24: 1701-15.  Naumann U, Wischhusen J, Weit S, Rieger J, Wolburg H, Massing U, Weller M. 2004. Alkylphosphocholine-induced glioma cell death is BCL-XL-sensitive, caspase-independent and characterized by massive cytoplasmic vacuole formation. Cell Death and Differentiation 11: 1326-1341.     163 Nielsen CV, Buchmann K. 2000. Prolonged in vitro cultivation of Ichthyophthirius multifiliis using an EPC cell line as substrate. Diseases of aquatic organisms. 42: 215-219.   Nemcsók JG, Hughes GM. 1988. The effect of copper sulphate on some biochemical parameters of rainbow trout. Environmental Pollution 49: 77-85.   Niki T, Pekny M, Hellemans K, Bleser PD, Berg KV, Vaeyens F, Quartier E, Schuit F, Geerts A. 1999. Class VI intermediate filament protein nestin is induced during activation of rat hepatic stellate cells. Hepatology 29: 520-527.   O’Brien J, Wilson I, Orton T, Pognan F. 2000. Investigation of the Alamar Blue (resazurin) fluorescent dye for the assessment of mammalian cell cytotoxicity. European Journal of Biochemistry. 267: 5421-5426.   O’Callaghan JP, Miller DB. 1990. The concentration of glial fibrillary acidic protein increases with age in the mouse and rat brain. Neurobiology of Aging 12: 171-174.   Ohkuma S, Poole B. 1981. Cytoplasmic Vacuolation of Mouse Peritoneal Macrophages and the Uptake into Lysosomes of Weakly Basic Substances. The Journal of Cell Biology 90: 656-664.   Ohmori K, Yoneda T, Ishihara G, Shigeta K, Hirashima K, Kanai M, Itai S, Sasaoki T, Arii S, Arita H, Kannagi R. 1989. Sialyl SSEA-1 antigen as a carbohydrate marker of human natural killer cells and immature lymphoid cells. Blood 74: 255-261.   Okamoto H. 2011. Hepatitis E virus cell culture models. Virus Research 161: 65-77.   Olivari FA, Hernández PP, Allende ML. 2008. Acute copper exposure induces oxidative stress and cell death in lateral line hair cells of zebrafish larvae. Brain Research. 1244: 1-12.   Ossum CG, Hoffman EK, Vijayan MM, Holt SE, Bols NC. 2004. Characterization of a novel fibroblast-like cell line from rainbow trout and responses to sublethal anoxia. Journal of Fish Biology 64: 1103-1116  Ownby DR, Newman MC, Mulvey M, Vogelbein WK, Unger MA, Arzayus LF. 2002. Fish (Fundulus heteroclitus) populations with different histories differ in tolerance of creosote-contaminated sediments. Environmental Toxicology and Chemistry. 9: 1897-1902.   Ozturk SS, Hu WS. Cell culture technology for pharmaceutical and cell-based therapies. Boca Raton (FL): Taylor and Francis Group (CRC press); 2006. 2-4 p.  Pan C, Gnad F, Olsen JV, Mann M. 2008. Quantitative phosphoproteome analysis of a mouse line reveals specificity of phosphatase inhibitors. Proteomics 8: 4534-4546.   PAN Pesticide Database. 2011. Retrieved from http://pesticideinfo.org/ [accessed 11 December 2013].   164 Peters REM, Courtenay SC, Cagampan S, Hewitt ML, MacLatchy DL. 2007. Effects on reproductive potential and endocrine status in the mummichog (Fundulus heteroclitus) after exposure to 17*-ethynylestradiol in a short-term reproductive bioassay. Aquatic Toxicology 85: 154-166.  Petrino TR, Greeley MS, Selman YK, Lin WP, Wallace RA 1989. Steroidogenesis in Fundulus heteroclitus. II. Production of 17 alpha-hydroxy-20 beta-dihydroprogesterone, testosterone, and 17 beta-estradiol by various components of the ovarian follicle. General and Comparative Endocrinology. 76: 230-240.  Petrulis JR, Chen G, Benn S, LaMarre J, Bunce NJ. 2001. Application of the ethoxyresorufin-O-deethylase (EROD) assay to mixtures of halogenated aromatic compounds. Environmental Toxicology 16: 177-184.   Pham PH, Lumsden JS, Tafalla C, Dixon B, Bols NC. 2013. Differential effects of viral hemorrhagic septicaemia virus (VHSV) genotypes IVa and IVb on gill epithelial and spleen macrophage cell lines from rainbow trout (Oncorhynchusmykiss). Fish & Shellfish Immunology 34: 632-640.   Phillips BE, Antonetti DA. Blood retinal barrier: blood-retinal barrier, retinal vascular leakage and macular edema. In: Joussen AM, Gardner TW, Kirchhof B, Ryan SJ. Retinal Vascular Disease. Heidelberg, Germany: Springer; 2007. 145 p.   Pickering AD, Duston J. 1983. Administration of cortisol to brown trout, Salmo trutta L., and its effects on the susceptibility to Saprolegnia infection and furunculosis. Journal of Fish Biology 23: 163-175.   Pittenger MF, Martin BJ. 2004. Mesenchymal stem cells and their potential as cardiac therapeutics. Circulation Research 95: 9-20.   Polisetty N, Fatima A, Madhira SL, Sangwan VS, Vemuganti GK. 2008. Mesenchymal cells from limbal stroma of human eye. Molecular Vision 14: 431-442.   Poortmans JR. Principles of Exercise Biochemistry, 3rd revised edition. Basal, Switzerland: Karger; 2004. 46-50 p.   Powell RL, Dodson MV, Cloud JG. 1989. Cultivation and differentiation of satellite cells from skeletal muscle of the rainbow trout Salmo gairdneri. Journal of Experimental Zoology. 250: 333-338.   Rachlin JW, Perlmutter A. 1968. Fish cells in culture for study of aquatic toxicants. Water Research 2: 409-414.   Radtke RL, Dean JM. 1979. Feeding, conversion efficiencies, and growth of larval mummichogs, Fundulus heteroclitus. Marine Biology 55: 231-237.    165 Rahman SM, Strüssman CA, Suzuki T, Watanabe M. 2013. Electroporation enhances permeation of cryoprotectant (dimethyl sulfoxide) into Japanese whiting (Sillago japonica) embryos. Theriogenology 79: 853-858.   Ramos-Vara JA. 2005. Technical aspects of immunohistochemistry. Veterinary Pathology 42:405-426.   Rampersad SN. 2012. Multiple applications of alamar blue as an indicator of metabolic function and cellular health in cell viability bioassays. Sensors 12: 12347-12360.  Rani EF, Elumalai M, Balasubramanian MP. 1998. Toxic and sublethal effects of ammonium chloride on a freshwater fish Oreochromis mossambicus. Water, Air and Soil Pollution 104: 1-8.   Ratledge C, Kristiansen B. Basic biotechnology. 2nd edition. New York (NY): Cambridge University Press; 2001. 450 p.  Regan KS, Jonz MG, Wright PA. 2011. Neuroepithelial cells and the hypoxia emersion response in the amphibious fish Kryptolebias marmoratus. The Journal of Experimental Biology 241: 2560-2568.  Restrepo RD. Cardiac output measurement. In: Heuer AJ, Scanlan CL. Wilkins’ clinical assessment in respiratory care. Maryland Heights (MO): Mosby, Inc; 2014. 382 p.   Reubinoff BE, Itsykson P, Turetsky T, Pera MF, Reinhartz E, Itzik A, Ben-Hur T. 2001. Neural progenitors from human embryonic stem cells. Nature Biotechnology 19: 1134-1140.   Richards JG, Sardella BA, Schulte PM. 2008. Regulation of pyruvate dehydrogenase in the common killifish, Fundulus heteroclitus, during hypoxia exposure. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 295: R979-990  Roark SA, Nacci D, Coiro L, Champlin D, Guttman SI. 2005. Population genetic structure of a nonmigratory estuarine fish (Fundulus heteroclitus) across a strong gradient of polychlorinated biphenyl contamination. Environmental Toxicology and Chemistry. 24: 717-725.   Rogers AD, Johnston NM, Murphy EJ, Clarke A. Antarctic ecosystems: an extreme environment in a changing world. Hoboken (NJ): Blackwell Publishing, Ltd; 2012. 386 p.  Rosen ED and MacDougald OA. 2006. Adipocyte differentiation from the inside out. Nature Reviews Molecular Cell Biology. 7: 885-896.   Rowe RWD, Goldspink G. 1969. Muscle fibre growth in five different muscles in both sexes of mice: I. normal mice. Journal of Anatomy 104: 519-530.   Rowlerson A, Veggetti A. 2001. Cellular mechanisms of post-embryonic muscle growth in aquaculture species. Fish Physiology 18: 103-140.    166 Rumney RL. 2011. Effects of steroidal hormones on the infectivity of microsporidia to fish cells. Honours Thesis. Wilfrid Laurier University.   Rutherford R, Lister A, MacLatchy D Hewitt M. 2011. Model androgen effects in mummichog (Fundulus heteroclitus). Canadian Technical Report of Fisheries and Aquatic Sciences 2949: 61.  Samaritan JM, Schmidt RE. 1982. Aspects of the life history of a freshwater population of the mummichog, Fundulus heteroclitus (Pisces: Cyprinodontidae), in the Bronx River, New York, U.S.A. Hydrobiologia. 94: 149-154.  Sambruy Y, Ferruzza S, Ranaldi G, Angelis, ID. 2001. Intestinal cell culture models: applications in toxicology and pharmacology. Cell Biology and Toxicology. 17: 301-317.   Sandbacka M, Christianson I, Isomaa B. 2000. The acute toxicity of surfactants on fish cells, Daphnia magna and fish—a comparative study. Toxicology in Vitro 14: 61-68.   Sander V, Suñe G, Jopling C, Morera C, Belmonte JCI. 2013. Isolation and in vitro culture of primary cardiomyocytes from adult zebrafish hearts. Nature Protocols 8: 800-809.  Sanger JW, Ayoob JC, Chowrashi P, Zurawski D, Sanger JM. Assembly of myofibrils in cardiac muscle cells. In: Granzier HL, Pollack GH. Elastic filaments of the cell. Volume 481. New York (NY): Kluwer Academic/Plenum Publishers; 2000. 92-95 p.  Sansom B. 2010. Toxicity assessment of oil sands process-affected water using fish cell lines. MSc Thesis. University of Waterloo.   Sansom B, Vo NTK, Kavanagh R, Hanner R, MacKinnon M, Dixon DG, Lee LEJ. 2013. Rapid assessment of the toxicity of oil sands process-affected waters using fish cell lines. In Vitro Cellular & Developmental Biology—Animal 49: 52-65.   Sarnat HB. 2008. Disorders of segmentation of the neural tube: agenesis of selective neuromeres. Handbook of Clinical Neurology 87: 105-113.   Sartor O, Cutler GB Jr. 1996 Mifepristone: treatment of Cushing’s syndrome. Clinical Obstetrics and Gynecology. 39: 506–510  Sasado T, Kani S, Washimi K, Ozato K, Wakamatsu Y. 1999. Expression of murine early embryonic antigens, SSEA-1 and antigenic determinant of EMA-1, in embryos and ovarian follicles of a teleost medaka (Oryzias latipes). Development, Growth & Differentiation 41: 293-302.   Sasakawa C. Molecular mechanisms of bacterial infection via the gut. Heidelberg, Germany: Springer; 2009. 17 p.   Schaeffer WI. 1990. Terminology associated with cell, tissue and organ culture, molecular biology and molecular genetics. In Vitro Cellular & Developmental Biology 26: 97-101.   167  Schiffer D. 2006. Brain tumor pathology: current diagnostic hotspots and pitfalls. Dordrecht, The Netherlands: Springer; 2006. 4 p.   Schindler R. 1969. Use of cell culture in pharmacology. Annual Review of Pharmacology. 9: 393-406.   Schirmer K. 2006. Proposal to improve vertebrate cell cultures to establish them as substitutes for the regulatory testing of chemicals and effluents using fish. Toxicology 224: 163-183.   Schirmer K, Chan AGJ, Greenberg BM, Dixon DG, Bols NC. 1997. Methodology for demonstrating and measuring the photocytoxicity of fluoranthene of fish cells in culture. Toxicology In Vitro 11: 107-113, 115-119.   Schirmer K, Chan AGJ, Greenberg BM, Dixon DG, Bols NC. 1998. Ability of 16 priority PAHs to be photocytotoxic to a cell line from the rainbow trout gill. Toxicology 127: 143-155.   Schirmer K, Dayeh VR, Bopp S, Russold S, Bols NC. 2004. Applying whole water samples to cell bioassays for detecting dioxin-like compounds at contaminated sites. Toxicology 205: 211–221.  Schnell S, Bols NC, Barata C, Porte C. 2009. Single and combined toxicity of pharmaceuticals and personal care products (PPCPs) on the rainbow trout liver cell line RTL-W1. Aquatic Toxicology 93: 244–252.  Schreck CB. Immunomodulation: endogenous factors. In: Iwama G, Nakanishi T. The fish immune system: organism, pathogen, and environment. San Diego (CA): Academic Press Inc; 1996. 311-313 p.   Schreck CB, Lorz HW. 1978. Stress response of coho salmon (Oncorhynchus kisutch) elicited by cadmium and copper of stress. Journal of the Fisheries Research Board of Canada 35: 1124-1129.  Schulte PM. 2014. What is environmental stress? Insights from fish living in a variable environment. The Journal of Experimental Biology 217: 23-34.   Schulte PM, Healy TM, Fangue NA. 2011. Thermal performance curves, phenotypic plasticity, and the time scales of temperature exposure. Integrative and Comparative Biology 51: 691-702.   Schulze-Horsel J, Schulze M, Agalaridis G, Genzel Y, Reichl U. 2009. Infection dynamics and virus-induced apoptosis in cell culture-based influenza vaccine production—flow cytometry and mathematical modeling. Vaccine. 27: 2712-2722.  Scott GR, Richards JG, Forbush B, Isenring P, Schulte PM. 2004. Changes in gene expression in gills of the euryhaline killifish Fundulus heteroclitus after abrupt salinity transfer. Cell Physiology - American Journal of Physiology 287: C300-C309.    168 Scott GR, Schulte PM, Wood CM. 2006. Plasticity of osmoregulatory function in the killifish intestine: drinking rates, salt and water transport, and gene expression after freshwater transfer. The Journal of Experimental Biology. 209: 4040-4050.  Scott I, Logan DC. 2008. Mitochondrial morphology transition is an early indicator of subsequent cell death in Arabidopsis. New Phytologist 177: 90-101.   Scott I, Youle RJ. 2010. Mitochondrial fission and fusion. Essays in Biochemistry 47: 85-98.   Sedivy JM. 1998. Can ends justify the means?: telomeres and the mechanisms of replicative senescence and immortalization in mammalian cells. Proceedings of the National Academy of Sciences. 95: 9078-9081.   Seglen PO, Reith A. 1976. Ammonia inhibition of protein degradation in isolated rat hepatocytes. Experimental Cell Research 100: 276-280.  Segner H. 1998. Fish cell lines as a tool in aquatic toxicology. Fish Ecotoxicology. 86: 1-38.   Segner, H. 2004. Cytotoxicity assays with fish cells as an alternative to the acute lethality test with fish. ATLA-Alternatives to Laboratory Animals 32: 375-382.  Sekiguchi S, Hashida Y, Yasukawa K, Inouye K. 2012. Stabilization of bovine intestine alkaline phosphatase by sugars. Bioscience, Biotechnology, and Biochemistry 76: 95-100.   Sharma S, Jackson PG, Makan J. 2004. Cardiac troponins. Journal of Clinical Pathology 57: 1025-1026.   Shaughnessy KS, Belknap AM, Hewitt LM, Dubé MG, MacLatchy DL. 2007. Effects of kraft pulp mill condensates on plasma testosterone levels in mummichog (Fundulus heteroclitus). Ecotoxicology and Environmental Safety 67: 140-148.   Shay JW, Wright WE. 2000. Hayflick, his limit, and cellular ageing. Nature Reviews Molecular Cell Biology. 1: 72-76.   Sidell BD, Johnston IA, Moerland TS, Goldspink G. 1983. The eurythermal myofibrillar protein complex of the mummichog (Fundulus heteroclitus): adaptation to a fluctuating thermal environment. Journal of Comparative Physiology B:Biochemical, Systemic, and Environmental Physiology 153:167-173.   Sigma-Aldrich. 2013. Available from http://www.sigmaaldrich.com/canada-english.html [accessed 21 September 2013].  Siliciano JD, Goodenough DA. 1988. Localization of the tight junction protein, ZO-1, is modulated by extracellular calcium and cell-cell contact in madin-darby canine kidney epithelial cells. The Journal of Cell Biology 107: 2389-2399.    169 Singh U, Quintanilla RH, Grecian S, Gee KR, Rao MS, Lakshmipathy U. 2012. Novel Live Alkaline Phosphatase Substrate for Identification of Pluripotent Stem Cells. Stem Cell Reviews. 8: 1021-1029.   Skinner MA. 2005. The site fidelity of mummichogs (Fundulus heteroclitus) in Atlantic Canadian estuary: implications for use as a sentinel species in environmental monitoring. Aquatic Sciences and Fisheries Abstracts 45: 123.   Slivac I, Blaji$ V, Rado+evi$ K, Kniewald Z, Sr)ek VG. 2010. In,uence of different ammonium, lactate and glutamine concentrations on CCO cell growth. Cytotechnology 62: 585-594.   Solangi MA, Overstreet RM. 1980. Biology and pathogenesis of the coccidium Eimeria funduli infecting killifishes. Journal of Parasitology 66: 513-526.  Stacey GN. 2011. Cell culture contamination. Methods in Molecular Biology 731: 79-91.   Stagaard M, Møllgård K. 1989. The developing neuroepithelium in human embryonic and fetal brain studied with vimentin-immunocytochemistry. Anatomy and Embryology 180: 17-28.   Stanfield CL, Germann WJ. Principles of human physiology. 3rd ed. San Francisco (CA): Pearson Education, Inc; 2009. 579-581 p.   Stentiford GD, Feist SW, Stone DM, Bateman KS, Dunn AM. 2013. Microsporidia: diverse, dynamic, and emergent pathogens in aquatic systems. Trends in Parasitology 29: 567-578.   Stierhoff KL, Targett TE, Grecay PA. 2003. Hypoxia tolerance of the mummichog: the role of access to the water surface. Journal of Fish Biology. 63: 580-592.   Sutherland JB. 1992. Detoxification of polycyclic aromatic hydrocarbons by fungi. Journal of Industrial Microbiology & Biotechnology. 9: 53-61.   Sutton DL, Blackburn RD. 1971. Uptake of copper in hydrilla. Weed Research 11: 47-53.    Tafalla C, Sanchez E, Lorenzen N, DeWitte-Orr SJ, NC Bols. 2008 Effects of viral hemorrhagic speticemia virus (VHSV) on the rainbow trout (Oncorhynchus mykiss) monocyte cell line RTS-11. Molecular Immunology 45: 1439-1448.  Tage-Jensen U, Permin H, Krogsgaard K. 1982. Characterization of liver membrane autoantibodies determined by indirect immunofluorescence. Journal of Clinical Pathology 35: 315-318.   Texier C, Vidau C, Viguès B, Alaoui HE, Delbac F. 2010. Microsporidia: a model for minimal parasite-host interactions. Eukaryotic Microbes. 13: 443-449.    170 Thomas RJ, Bhandari R, Barrett DA, Bennett AJ, Fry JR, Powe D, Thomson BJ, Shakesheff KM. 2005. The Effect of Three-Dimensional Co-Culture of Hepatocytes and Hepatic Stellate Cells on Key Hepatocyte Functions in vitro. Cells Tissues Organs 181: 67-79.   Trammer T, Dombrowski F, Doehring M, Maier WA, Seitz HM. 1997. Opportunistic properties of Nosema algerae (Microspora), a mosquito parasite, in immunocompromised mice. Journal of Eukaryotic Microbiology. 44: 258-262.   Trinkaus JP. 1963. The cellular basis of Fundulus epiboly. Adhesivity of blastula and gastrula cells in culture. Developmental Biology. 7: 513-532.  Tohyama T, Lee VM, Rorke LB, Marvin M, McKay RD, Trojanowski JQ. 1992. Nestin expression in embryonic human neuroepithelium and in human neuroepithelial tumor cells. Laboratory Investigation - Nature 66: 303-313.   Undeen AH. 1975. Growth of Nosema algerae in pig kidney cell cultures. Journal of Protozoology. 22: 107-110.  Uyama N, Zhao L, Van Rossen E, Reynaert H, Adams DH, Xue Z, Li Z, Robson R, Pekny M, Geerts A. 2006. Hepatic stellate cells express synemin, a protein bridging intermediate filaments. Gut 55: 1276-1289.   Varga VB, Hádinger N, Gócza E, Dulberg V, Demeter K, Madará Herberth B. 2008. Generation of diverse neuronal subtypes in cloned populations of stem-like cells. BMC Developmental Biology 8: 89.   Vieira VLA, Johnston IA. 1992. Influence of temperature on muscle fibre development in larvae of the herring Clupea harengus. Marine Biology 112: 333-341.  Visvesvara GS, Belloso M, Moura H, Da Silva AJ, Moura IN, Leitch GJ, Schwartz DA, Chevez-Barrios P, Wallace S, Pieniazek NJ, Goosey JD. 1999. Isolation of Nosema algerae from the cornea of an immunocompetent patient. Journal of Eukaryotic Microbiology. 46 :10S.   Visvesvara GS, Garcia LS. 2002. Culture of protozoan parasites. Clinical Microbiology Reviews 15:327-328.   Vo NTK, Sansom B, Kozlowski E, Bloch S, Lee LEJ. 2010. Development of a permanent cell line derived from fat head minnow testis and their applications in environmental toxicology. The Bulletin, Mount Desert Island Biological Laboratory V49: 83-86   Vrzal R, Frauenstein K, Proksch P, Abel J, Dvorak Z, Haarmann-Stemmann T. 2013. Khellin and Visnagin Differentially Modulate AHR Signaling and Downstream CYP1A Activity in Human Liver Cells. PLoS ONE 8: e74917.   Vutukuru SS, Suma C, Radha Madhavi K, Juveria, Smitha Pauleena J, Venkateswara Rao J, Anjaneyulu Y. 2005. Studies on the development of potential biomarkers for rapid assessment of  171 copper toxicity to freshwater fish using Esomus danricus as model. International Journal of Environmental Research and Public Health. 2: 63-73.   Walker JM, Rapley R. Molecular biomethods handbook, 2nd edition. Totowa (NJ): Humana Press. 2008. 861-872 p.  Webster HD, Åström KE. Gliogenesis: historical perspectives, 1839-1985. Berlin, Heidelberg: Springer-Verlag; 2009. 22-26 p.   Weidner E, Canning EU, Rutledge CR, Meek CL. 1999. Mosquito (Diptera: Culicidae) host compatibility and vector competency for the human myositic parasite Trachipleistophora hominis (Phylum Microspora). Journal of Medial Entomology. 36: 522-525.   Weis JS, Weis P. 1989. Tolerance and stress in a polluted environment: The case of the mummichog. BioScience. 39: 89-95.  Wetterauer B, Ricking M, Otte JC, Hallare AV, Rastall A, Erdinger L, Schwarzbauer J, Braunbeck T, Hollert H. 2012. Toxicity, dioxin-like activities, and endocrine effects of DDT metabolites-DDA, DDMU, DDMS, and DDCN. Environmental Science and Pollution Research 19: 403–415.  Williams C. 1996. Combatting marine pollution from land-based activities: Australian initiatives. Ocean and Coastal Management. 33: 87–112.  Witzeneder K, Lindenmair A, Gabriel C, Höller K, Theiß D, Redl H, Hennerbichler S. 2013. Human-derived alternatives to fetal bovine serum in cell culture. Transfusion Medicine and Hemotherapy 40: 417-423.   Whitehead A, Roah JL, Zhang S, Galvez F. 2011. Genomic mechanisms of evolved physiological plasticity in killifish distributed along an environmental salinity. Proceedings of the National Academy of Sciences. 108: 6193-6198.   Whyte JJ, Jung RE, Schmitt CJ, Tillitt DE. 2000. Ethoxyresorufin-O-deethylase (EROD) activity in fish as a biomarker of chemical exposure. Critical Reviews in Toxicology 30: 347-570.   Wolf K, Gravell M, Malsberger RG. 1966. Lymphocytis virus: isolation and propagation in centrarchid fish cell line. Science 151: 1004-1005.   Xing JG, Lee LEJ, Fan L, Collodi P, Holt SE, Bols NC. 2008. Initiation of a Zebrafish Blastula Cell Line on Rainbow Trout Stromal Cells and Subsequent Development Under Feeder-Free Conditions into a Cell Line, ZEB2J. Zebrafish 5: 49-63.   Yaffe D. 1968. Retention of differentiation potentialities during prolonged cultivation of myogenic cells. Proceedings of the National Academy of Sciences 61: 477-483.   172 Yaffe D, Saxel O. 1977. Serial passaging and differentiation of myogenic cells isolated from dystrophic mouse muscle. Nature 170: 725-727.   Yamashita M. 2013. From neuroepithelial cells to neurons: changes in the physiological properties of neuroepithelial stem cells. Archives of Biochemistry and Biophysics 534: 64-70.   Zhou J, Zhang Y, Lin Q, Liu Z, Wang H, Duan C, Wang Y, Hao T, Wu K, Wang C. 2010. Embryoid bodies formation and differentiation from mouse embryonic stem cells in collagen/Matrigel scaffolds. Journal of Genetics & Genomics 37: 451-460.     173 Appendices Appendix A: Hoechst staining for mycoplasma observation  Protocol adapted from Chen (1970).   1) Use a TC flask that has been incubated for at least one week 2) Remove most of the media leaving just enough covering the cells 3) Fix the cells by adding 3 mL Carnoy’s fixative directly to the flask 4) After 2 min, remove media-fixative and add 5 mL of fresh fixative 5) After 5 min, remove fixative and add 5 mL of fresh fixative 6) After 5 min, remove fixative and let flask air dry 7) Stain with Hoechst solution (enough to cover flask ~5 mL) for 10 min 8) Rinse 2x in distilled water (5 min each) 9) Observe cells under UV in fluorescent microscope (excitation/emission; 350/470)  Carnoy’s fixative: - 3:1 of absolute methanol: glacial acetic acid  Hoechst solution (100 ng/mL): - Make 10 mL of 100 !g/mL Hoechst (Sigma 33258) in PBS (1 mg in 10 mL PBS) – stock solution. Stable in fridge protected from light for up to 6 months. - Mix 100 !L of above into 100 mL of PBS – working solution.        174 Appendix B: May-Grünwald Giemsa Staining  1) Use confluent TC flasks 2) Remove media and rinse 2x with PBS  3) Fix for 20 min using a 1:1 mixture of methanol and acetone (prepare fixative in glass beaker to prevent acetone from dissolving/melting plastic containers) 4) Remove fixative and completely cover with May-Grünwald stain (Sigma MG-500) for 3 min 5) Remove May-Grünwald stain and add Giemsa stain (Sigma G-3032) (1:50, Giemsa: tap water)—completely cover flask for 5 min 6) Rinse flask with tap water and air dry 7) Observe with a phase contrast microscope       175 Appendix C: DAPI staining    1. Fix cells with methanol and glacial acetic acid (MGAA) fixative (3:1 absolute methanol:glacial acetic acid) for five min until media turns a consistent yellow colour—dispose of properly. 2. Cover cells again with MGAA for 5 min. Repeat—dispose of properly. 3. Leave to dry. 4. Stain with DAPI (Sigma 217085) (DAPI stock solution: 1 mg/mL in PBS). 5. Incubate for 1 hour in the dark at RT. 6. Remove DAPI and dispose of properly. Add tap water to rinse cells.  7. Observe cells under UV in fluorescent microscope (excitation/emission; 350/470 nm). 8. Cells can be stored for up to 1-2 months in the dark.    176 Appendix D: Rhodamine 123 stain  Protocol adapted from Johnson et al., (1980).   1) Dissolve 0.001 g rhodamine 123 in 1 mL sterile autoclaved Milli-Q water to make 1 !g/!L solution. Cover conical tube with tin foil. Vortex for 5 seconds.   2) Add 1 mL of the rhodamine 123 stock solution to 99 mL of L-15 media (no serum)—100 !g/ml working solution.  3) Add 1 mL of rhodamine 123 working solution to each well of a 12-well TC plate.  4) Incubate at RT for 30 min-1 hour.  5) After incubation, remove rhodamine 123 working solution.  6) Rinse 3x with L-15 media (no serum).  7) Take pictures with fluorescent microscope at 494 nm and 518 nm excitation and emission wavelength, respectively.              177 Appendix E: Immunocytochemistry  Plate cells:  1) Use either a 4-chamber slide, or slideflask for plating cells - Polystyrene vessel tissue culture treated glass slide (Falcon 4104); used for KFE-5 and KFE-3 cell lines - Polystyrene 1 chamber slideflask  (Nunc 170920); used for KFE-1  2) Plate cells at ~100 000 – 500 000 cells/chamber in regular media (cell concentration will depend on cell line) - KFE-5: 500 000 cells/chamber - KFE-1: 100 000 cells/chamber - KFE-3: 500 000 cells/chamber  3) Paraffin wrap the chamber slide to prevent desiccation   4) Incubate at optimal temperature over night (20-26°C for all killifish cell lines) Immunostaining: *The following protocol does not need to be sterile* 1) Wash slides 2x in 500 µL PBS for 2-3 min at RT  2) Fix cells for 20 min by applying 1 mL of ice cold absolute methanol or 3% paraformaldehyde  3) Wash slides with PBS 2x in 500 µL for 2-3 min at RT with rocking 4) Incubate for 1 hour in blocking buffer at RT 5) Remove blocking buffer by aspiration 6) Apply 1° ab diluted in fresh blocking buffer incubate for appropriate incubation time at RT with rocking  7) Remove 1° ab and wash coverslips in PBS 3x for 5 min each 8) Incubate at RT with 500 µL 2° ab diluted in PBS for appropriate incubation time in the dark  9) Wash coverslips in washing buffer [0.01% Tween (Sigma 9005-64-5) in PBS] 3x for 5 min each 10) Remove chambers from slide 11) Rinse in Milli-Q water to remove salts and apply DAPI (Sigma 217085) for 5-10 min [Appendix C or use Fluoroshield with DAPI (Sigma F6057)—if using Fluoroshield then add coverslip and skip to step 14] 12) Rinse 2x in washing buffer (quick rinse) to remove counterstain (e.g., DAPI) 13) Apply 1 drop of fresh mounting medium and add coverslip and allow to dry 14) Store slides protected from light at 4°C  178 Appendix F: Alkaline phosphatase staining     Figure A1. Phase contrast micrographs of killifish cell lines with ALP staining. Panel (A) Negative control, goldfish skin (GFSK) at passage 61; Panel (B) Positive control, zebrafish (ZEB2J) at passage 101; Panel (C) KFE-5 at passage 32; Panel (D) KFE-1 at passage 31; Panel (E) KFE3 at passage 21. ALP positive cells stain bright pink. Photomicrographs were taken with a phase contrast Olympus microscope. Scale bar = 100 µm.                      Figure A2. Representative data for percentage of cells staining positive for ALP. Cells were fixed and stained using components of the ALP staining kit (Sigma). Negative control: GFSK at passage 61; positive control: ZEB2J at passage 101; KFE-5 at passage 32; KFE-1 at passage 31; KFE-3 at passage 21. Percentage of stained cells is expressed as positive for ALP. The means ± standard deviation (n=5) are plotted. A one-way ANOVA was used to compare values between cell lines followed by a Tukey-Kramer multiple comparison test. Different letters indicate statistically significant difference (p<0.01).  179 Appendix G: Senescence staining             Figure A3. Phase contrast micrographs of killifish cell lines with "-galactosidase senescence staining. Panel (A) Positive control: eel brain at passage 67; Panel (B) KFE-1 at passage 20; Panel (C): KFE-5 at passage 28; Panel (D) KFE-3 at passage 14. Senescent positive cells stain blue. Photomicrographs were taken with a phase contrast Olympus microscope. Scale bar = 50 µm.                         Figure A4. Representative data for percentage of cells staining positive for "-galactosidase senescence marker. Cell lines were fixed and stained using components of the senescent cells staining kit (Sigma). Positive control cell line: eel brain at passage 67; KFE-3 at passage 14; KFE-1 at passage 20; KFE-5 at passage 28. Percentage of stained cells is expressed as positive for senescence. KFE-3 was the only killifish cell line that showed moderate positive staining for cellular senescence. The means ± standard deviation (n=9) are plotted. A one-way ANOVA followed by a post-hoc Dunnett test, was used to compare cell lines to the control (Eel brain) (p<0.001***).  180 Appendix H: AB and CFDA-AM assay protocol  The cytotoxicity assay protocols for Alamar Blue and CFDA-AM were adapted from Dayeh et al., 2013.  This should be conducted in the dark, aseptically.  1) Make AB CFDA-AM working solution by adding 525.5 !L of AB stock (Invitrogen DAL 1100) and 10.4 !L of CFDA-AM stock* (Sigma) to 10 mL of L-15/ex (Appendix I) *Note: a 4mM stock solution of CFDA-AM should be prepared by dissolving in sterile DMSO, aliquoted and kept in the dark at -20°C to avoid photo degradation 2) Add 100 !L of AB CFDA-AM working solution to the wells of a 96-well TC microplate and incubate in the dark for one hour—the wells with 0 !g/mL concentration of exposure (L-15/ex only) will be the row of blanks, used as a control 3) SpectraMAX microplate reader was used to measure relative fluorescence units (RFUs) with appropriate wavelengths for different fluorometric endpoints: • AB: Excitation wavelength 530 nm, Emission wavelength 590 nm  • CFDA-AM: Excitation wavelength 485 nm, Emission wavelength 530 nm     181 Appendix I: L-15 Exposure medium (L-15/ex)   Salt Solution A (add to 600 mL water):  80 g NaCl  4.0 g KCl  2.0 g MgSO4  2.0 g MgCl2  - autoclave  - store at RT  Salt Solution B (add to 100 mL water):  1.4 g CaCl2  - autoclave  - store at RT  Salt Solution C (add to 300 mL water):  1.9 g Na2HPO4  0.6 g KH2PO4  - autoclave  - store at RT  Sodium pyruvate solution (add to 300 mL water):  5.5 g sodium pyruvate  - filter-sterilize (0.2 !m)  - dispense in 12 mL amounts  - store at -20°C   Galactose solution (add to 100 mL water):  9.0 g galactose  - filter-sterilize (0.2 !m)  - dispense in 12 mL amounts  - store at -20°C     To make L-15/ex cell culture grade (add to 1000 mL TC sterile Milli-Q water aseptically):  - 68.0 mL Salt solution A  - 11.4 mL Salt solution B  - 34.0 mL Salt solution C  - 11.4 mL Sodium pyruvate  - 11.4 mL Galactose  - store at RT (durability ~3 months)    182 Appendix J: KFE-5 exposure to NH4Cl             Figure A5. Viability of KFE-5 at passage 33 after 24 hours exposure to NH4Cl. KFE-5 was exposed to varying concentrations of NH4Cl prepared in L-15/ex media. Chemical exposure lasted 24 hours at which point cellular viability was measured using fluorometric indicator dyes: AB and CFDA-AM. Results are expressed as a percent control of RFUs. Data points represent the mean of six wells per chemical ± standard deviation.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0103410/manifest

Comment

Related Items