Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Functionalization of cancer-associated mutant alleles of human CDC4 (FBXW7) Singh, Tejomayee 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2013_fall_singh_tejomayee.pdf [ 1.77MB ]
Metadata
JSON: 24-1.0103367.json
JSON-LD: 24-1.0103367-ld.json
RDF/XML (Pretty): 24-1.0103367-rdf.xml
RDF/JSON: 24-1.0103367-rdf.json
Turtle: 24-1.0103367-turtle.txt
N-Triples: 24-1.0103367-rdf-ntriples.txt
Original Record: 24-1.0103367-source.json
Full Text
24-1.0103367-fulltext.txt
Citation
24-1.0103367.ris

Full Text

 FUNCTIONALIZATION OF CANCER-ASSOCIATED MUTANT ALLELES OF HUMAN CDC4 (FBXW7)   by   Tejomayee Singh   B.Sc., University of Pune, 2001 M.B.A., University of Pune, 2004   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   MASTER OF SCIENCE   in   The Faculty of Graduate and Postdoctoral Studies   (Genome Science and Technology)    THE UNIVERSITY OF BRITISH COLUMBIA   (Vancouver)    October 2013    ? Tejomayee Singh, 2013        ii Abstract  Cancer is a leading cause of death worldwide. This somatic cell genetic disease is characterized by progressive accumulation of mutations in multiple genes. An important characteristic of cancer cells is an increased rate of gains and losses of chromosomes, termed Chromosomal Instability (CIN). One of the frequently mutated genes in a variety of cancers is FBXW7 (F-Box and WD repeat domain-containing 7), encoding the substrate-recognition component of a ubiquitin ligase complex. Fbxw7 targets a number of oncoproteins such as, Cyclin E, c-Myc, Notch1 and Aurora A for ubiquitin mediated degradation. Inactivation of FBXW7 has been linked to CIN in cancer cell lines. The majority of cancer-associated mutations in FBXW7 are monoallelic, missense substitutions whose phenotypic effects are difficult to predict. Interestingly, most of the mutations in FBXW7 cluster at three mutational hotspots, Arg465, Arg479 and Arg505. Located at ? propeller-tip, these residues are critical for interaction with the Fbxw7 substrates. This study investigates the functional consequences of the substitutions at these residues. We individually tested the functional status of the R465C, R479Q and R505C variants of FBXW7 in three colorectal cancer cell lines in an HCT116 background. These cell lines had both, one or none of the alleles of FBXW7 inactivated by homologous recombination. Our data shows that the cell lines producing R465C, R479Q or R505C variants of FBXW7 failed to degrade Cyclin E, one of the major targets of FBXW7. These cell lines also exhibited a CIN phenotype, observed as an increase in the frequency of abnormal anaphases. These results show that mutations R465C, R479Q and R505C occurring in FBXW7 cause loss of function of the protein and act as dominant negative mutations.       iii Preface  This dissertation is original, unpublished work by Tejomayee Singh. Dr. Phil Hieter conceptualized this project and, Dr. Melanie Bailey and Tejomayee Singh created the experimental design. Tejomayee Singh performed all the experiments, collected data and analyzed it, under the guidance of Dr. Melanie Bailey and Dr. Phil Hieter.                                              iv Table of Contents  Abstract .................................................................................................................................. ii Preface .................................................................................................................................. iii Table of Contents .................................................................................................................. iv List of Tables ........................................................................................................................ vi List of Figures ...................................................................................................................... vii List of Abbreviations .......................................................................................................... viii Acknowledgements............................................................................................................... ix Chapter 1: Introduction .......................................................................................................... 1 1.1  A general overview of cancer .................................................................................. 1 1.2 Fbxw7: a ubiquitin ligase with many oncogene targets ............................................ 4 1.3 FBXW7 is highly mutated in cancer ......................................................................... 9 1.4 Overview of thesis .................................................................................................. 13 Chapter 2: Materials and Methods ....................................................................................... 15 2.1 Cell lines and media ................................................................................................ 15 2.2 Cloning .................................................................................................................... 15 2.3 Site-directed mutagenesis of FBXW7 alpha isoform ............................................. 15 2.4 Lentivirus preparation and lentiviral transduction of the HCT116 cell lines ......... 16 2.5 Western blotting ...................................................................................................... 16 2.6 Abnormal anaphase count ....................................................................................... 17 2.7 Quantitative real-time PCR assay ........................................................................... 17 Chapter 3: Results ................................................................................................................ 19 3.1 Generation of cell lines expressing mutant alleles of FBXW7 ............................... 19 3.2 Cyclin E stabilization in cell lines expressing mutant alleles of FBXW7 .............. 21 3.3 Elevated frequencies of abnormal anaphases in cell lines expressing mutant alleles of FBXW7 ............................................................................................................... 23 3.4 RT-qPCR provides evidence for expression of the integrated FBXW7 gene in transduced cell lines ................................................................................................ 26 Chapter 4: Discussion .......................................................................................................... 29 Chapter 5: Conclusion, Therapeutic Implication and Future Directions ............................. 34      v Bibliography ........................................................................................................................ 36 Appendix.............................................................................................................................. 41 Appendix 1  Testing various anti-Fbxw7 antibodies ..................................................... 41                                               vi List of Tables  Table 1     Frequencies of abnormal anaphases observed in various cell lines of  HCT116 (FBXW7 +/+) background .................................................................................... 24 Table 2     Frequencies of abnormal anaphases observed in various cell lines of  HCT116 (FBXW7+/-) background ...................................................................................... 24 Table 3     Frequencies of abnormal anaphases observed in various cell lines of  HCT116 (FBXW7 -/-) background ...................................................................................... 25                                         vii List of Figures  Figure 1     Crystallographic and gene structure of Fbxw7 and a schematic of the Fbxw7 isoforms ........................................................................................................................................ 5 Figure 2     Substrate targets of Fbxw7 ...................................................................................................... 7 Figure 3     Incidence of FBXW7 mutations in various cancers ......................................................... 9 Figure 4     Summary of intragenic mutations in FBXW7 based on data form COSMIC ....... 10 Figure 5     The distribution of somatic mutations in FBXW7......................................................... 11 Figure 6     Model of the crystallographic structure of Fbxw7 in complex with a Cyclin E      peptide ........................................................................................................................................ 12 Figure 7     Schematic of lentiviral transduction to prepare various cell lines............................. 20 Figure 8     Western blot of whole cell lysates from the parental cell lines, probed with an antibody against Cyclin E ..................................................................................................... 21 Figure 9     Western blots of whole cell lysates from various cell lines probed with the Cyclin E antibody ................................................................................................................................. 22 Figure 10   Examples of images of Hoechst stained nuclei scored to estimate the percentages of abnormal anaphases .......................................................................................................... 23 Figure 11   Q-PCR analysis of Fbxw7 in HCT116 (FBXW7 +/+), HCT116 (FBXW7 +/-) and HCT116 (FBXW7 -/-) cell lines ......................................................................................... 27 Figure 12   Q-PCR analysis of Fbxw7 in various HCT116 derived cell lines ............................ 28 Figure 13   Speculative model of Fbxw7 dimer-dependent Cyclin E turnover .......................... 31                    viii List of Abbreviations  CIN: Chromosome Instability MIN: Microsatellite Instability MMR: Mismatch Repair SCF: Skp1/Cul1/F-box complex WT: Wild Type COSMIC: Catalog Of Somatic Mutations In Cancer PBS: Phosphate-Buffered Saline DAPI: 4?,6-diamidino-2-phenylindole PVDF: Polyvinylidene difluoride FBS: Fetal Bovine Serum DMEM: Dulbecco?s Modified Eagle Medium SDS-PAGE: Sodium dodecyl sulphate ? Polyacrylamide gel electrophoresis                                      ix Acknowledgements  Pursuing graduate studies has been one of my most coveted dreams and I wish to sincerely thank everyone who helped to make it a reality.  I want to say a big thank you to my supervisor Dr. Phil Hieter for giving me the opportunity to pursue this project in his laboratory.  Phil is a terrific scientist and a very nice person. I have always felt inspired by him during our meetings. His patient mentorship and experienced vision have been instrumental in making this research possible. I consider myself fortunate to be his student.   I am especially grateful to Melanie Bailey for training me and being an extremely kind and supportive mentor throughout my project. Her extensive knowledge and guidance with my experiments have helped me immensely during this project.   I would like to thank my thesis committee members Dr. Michel Roberge and Dr. Calvin Roskelley for their guidance with my project and the GSAT program and NSERC for providing research funding.   I am also thankful to Peter Stirling, Nigel O?Neil and Supipi Duffy for advising and providing help whenever I requested it.  I also thank Sean Minaker, Derek van Pel, Alina Chan, Noushin Moshgabadi, Hunter Li, Akil Hamza and Sidney Ang for being good lab mates. I thank Megan Filiatrault and Doris Vong for their support during my project. I also thank the GSAT   I thank my parents for inspiring me to pursue graduate studies and for morally supporting me during this time and always. The successful completion of this project would never have been possible without the unflinching support of my husband, Rahul. I am thankful to him for always being there for me, encouraging me and to my little daughter Avni for being a very understanding child, making graduate studies possible for me.                      1Chapter 1: Introduction 1.1 A general overview of cancer: Cancer is a genetic disease caused by changes in genomic structure and sequence (Hanahan and Weinberg 2011, Schvartzman, Sotillo, and Benezra 2010). Somatic cells progressively accumulate a series of mutations in multiple genes that contribute to the cancerous phenotype (Stratton 2011, Vogelstein and Kinzler 2004). Cancer cells have the ability to evade apoptosis, replicate in the absence of mitogenic signaling, ignore anti-proliferative signals, initiate and maintain angiogenesis and metastasize and invade distant tissues (Hanahan and Weinberg 2011). These attributes of cancer cells enable a tumor to grow much faster than surrounding normal cells. Progress in sequencing technologies has made it possible to identify genes altered in cancer at base-pair resolution. Pathways through which many of these important genes act have been characterized (Hanahan and Weinberg 2011, Vogelstein and Kinzler 2004).  Mutations in three classes of genes are responsible for tumorigenesis: oncogenes, tumor suppressors, and genome stability genes (Vogelstein and Kinzler 2004, Hanahan and Weinberg 2011). Oncogenes undergo gain-of-function mutations that render the gene constitutively active or active under conditions in which the wild type gene is not and drive the cell through the cell cycle. Oncogene activations can occur due to intragenic mutations affecting crucial residues that regulate the activity of the gene product, chromosomal translocations, or gene amplifications. Tumor-suppressor genes, on the other hand, undergo loss-of-function mutations that reduce the activity of the gene or render it inactive. Tumor suppressor genes are responsible for inhibiting cell growth      2either by preventing advancement of the cell cycle, or inducing apoptosis in response to cellular stress. Inactivations of tumor suppressor genes result due to missense mutations at residues that are essential for their activity, mutations that result in a truncated protein, deletions or insertions of various sizes, or epigenetic silencing. Oncogene and tumor-suppressor gene mutations drive the neoplastic process by increasing tumor cell number through the stimulation of cell birth or the inhibition of cell death or cell cycle arrest (Vogelstein and Kinzler 2004).   The third class of cancer genes is genome stability genes. Mutations in genome stability genes reduce the fidelity of DNA replication, chromosome stability, or chromosome segregation. One type of genome instability found in greater than 85% of solid tumors is chromosomal instability (CIN) (Lengauer, Kinzler, and Vogelstein 1997, Rajagopalan et al. 2003, Weaver and Cleveland 2006). CIN is a condition in which cancer cells gain or lose whole chromosomes or large parts thereof at elevated rates compared to normal cells during mitosis. Solid tumors with CIN show cytological abnormalities during mitosis, including abnormal centrosomes, multipolar spindles, micronuclei and lagging chromosomes (Weaver and Cleveland 2006). There is support for a causal link between aneuploidy and cancer development. For example, mutations in the mitotic checkpoint kinase hBub1B, which cause increased rates of aneuploidy, are associated with inherent predispositions to cancer (Park et al. 2013, Hanks et al. 2004). Studies of human tumors suggest that CIN correlates with tumor grade and prognosis (Kronenwett et al. 2006). CIN drives continually evolving karyotypes and leads to intratumor heterogeneity and therapeutic resistance (Rajagopalan and Lengauer 2004). Experimental evidence strongly      3supports the hypothesis that genetic changes responsible for CIN occur early in the development of cancer and are crucial for cancer initiation and progression (Shih et al. 2001, Rajagopalan et al. 2003). However, the molecular basis of CIN is still a mystery and the focus of major research efforts.   Databases that catalog somatic mutations found in cancer report a large number of genes that have been mutated (Forbes et al. 2011). Some of these mutations are ?driver? mutations that confer a selective growth advantage to the tumor cell, while others are ?passenger? mutations that confer no selective growth advantage (Stratton 2011). A major challenge in cancer research is to identify which mutations are drivers. Rapid means to ?functionalize? somatic mutations in protein coding sequences (meaning to test if a newly discovered gene mutation causes a gain or loss of function) will be critical to address this challenge. Studies in model organisms have led to the identification of a number of genes that cause the CIN phenotype when mutated. Comprehensive studies using knockout collections of non-essential genes and hypomorphic collections of essential genes of Saccharomyces cerevisiae, by our lab and others, have revealed 692 Saccharomyces cerevisiae CIN genes (Stirling et al. 2011, Yuen et al. 2007). Cross-referencing this list of yeast CIN genes to the human genome provides a set of human candidate CIN genes, hundreds of which are mutated in tumors (Stirling et al. 2011). However, candidate human CIN genes derived in this manner can be established as mutational targets in cancer only if: 1) they have been reported as mutated in human tumors, 2) they demonstrate the CIN phenotype when inactivated (or reduced in expression) in mammalian cells and 3) the somatic mutations reported in them are functional.      4Functional testing of mutated alleles is important because while nonsense mutations found in cancer genes lead to a truncated protein that can be predicted to be non-functional, the functional status of missense mutations is not easily predicted.   F-Box and WD repeat domain-containing 7 (Fbxw7 ? also known as Fbw7 or hCdc4), the human homolog of the essential yeast CIN gene CDC4, is one of the candidate human CIN genes in our data set. However, the association of Fbxw7 with CIN is not new. Previously, Rajagopalan et al. have implicated loss of Fbxw7 in the control of CIN (Rajagopalan et al. 2004). Barber et al. subsequently showed that chromatid cohesion defects may be a probable mechanism of CIN in FBXW7-inactivated colorectal cancer cell lines (Barber et al. 2008). FBXW7 is frequently mutated in a variety of cancers suggesting that it may play a significant role in tumorigenesis (Akhoondi et al. 2007, Kemp et al. 2005, Rajagopalan et al. 2004) (See 1.3 below).  1.2 Fbxw7: a ubiquitin ligase with many oncogene targets: Fbxw7 is an evolutionarily conserved subunit of the E3 ubiquitin ligase SCF (Complex of Skp1, Cul1 and F-box protein). The multi-subunit SCF complex is well studied and consists of a Cullin family scaffolding protein Cul1, a catalytic ring finger Rbx1, the bridging protein Skp1 and the E3 F-Box and WD-repeat domain-containing 7 (Fbxw7 ? also known as Fbw7 or hCdc4). Fbxw7 is the substrate recognition component of the SCF complex.         5 Figure 1. Crystallographic and gene structure of Fbxw7 and a schematic of Fbxw7 isoforms A) The crystallographic structure of Fbxw7 in complex with a Cyclin E peptide. B) Alternative splicingof different of Fbxw7 exons. C) Fbxw7 protein isoforms   The FBXW7 gene is located on chromosome 4 and undergoes alternative splicing, resulting in three protein isoforms - Fbxw7 alpha, beta and gamma (Figure 1B) (Spruck et al. 2002). Fbxw7 alpha is the most highly expressed isoform (Strohmaier et al. 2001). The protein consists of 707 amino acids and has a predicted molecular weight of 79kD. All isoforms of the Fbxw7 protein contain an F-Box domain that interacts with Skp1 in the SCF (Bai et al. 1996), a D domain that facilitates Fbxw7 dimerization (Welcker and Clurman 2007) and a WD40 domain consisting of eight WD40 repeats that interacts with the substrate (Hao et al. 2007, Orlicky et al. 2003, Welcker and Clurman 2008) (Figure 1C). Fbxw7 binding is highly specific and only occurs after substrates have been phosphorylated within conserved motifs called the Cdc4 phosphodegrons (CPDs). Crystallographic studies have shown that the C-terminal WD40 repeats form an eight-     6bladed, barrel-shaped beta propeller structure, with defined phosphodegron binding pockets (Hao et al. 2007) (Figure 1A).  Pooling data from several Fbxw7 substrates has defined the Fbxw7 Cdc4 phospho degron (CPD) sequence as ?-X- ?- ?- ?-pT/pS-P-P-X-pS/pT/E where ? stands for a hydrophobic residue and X stands for any amino acid (Hao et al. 2007). The affinity of Fbxw7 for any specific substrate is regulated by the sequence content of the substrate?s CPD (compared to that of the ideal CPD) and the number of CPDs present in the substrate (Tan, Sangfelt, and Spruck 2008). CPDs enable Fbxw7 to simultaneously regulate the ubiquitination of multiple substrates within the cell, but only after they have been phosphorylated by activated signaling pathways. The most common kinase that phosphorylates CPDs is Glycogen synthase kinase 3 (GSK3) (Busino et al. 2012, Inuzuka et al. 2011, Kitagawa et al. 2009, Kwon et al. 2012, Strohmaier et al. 2001, Welcker et al. 2004). The known substrates of Fbxw7 are shown in Figure 2.        7  Figure 2. Substrate targets of Fbxw7   The majority of the known substrates of Fbxw7 correspond to oncogenes, perturbed in a variety of cancers, including Cyclin E (Strohmaier et al. 2001), c-Myc (Welcker et al. 2004, Yada et al. 2004), Notch (Gupta-Rossi et al. 2001, Oberg et al. 2001, Wu et al. 2001), Jun B (Nateri et al. 2004), mTOR (Mao et al. 2008), Aurora B (Teng et al. 2012), SREBP (Sundqvist et al. 2005), Aurora A (Kwon et al. 2012) and Mcl-1 (Inuzuka et al. 2011, Wertz et al. 2011). Fbxw7 is classified as a tumor suppressor (Welcker and Clurman 2008). In addition to targeting substrates with oncogenic potential, Fbxw7 also targets several CIN-associated proteins including Cyclin E and Mcl-1 (Myeloid cell leukemia sequence 1).       8Rajagopalan et al. associated the CIN observed in FBXW7-inactivated human cells with the accumulation of Cyclin E (Rajagopalan et al. 2004). Cyclin E is the best-characterized substrate of Fbxw7. It is an important component of the cell cycle machinery and is frequently deregulated in cancer (Donnellan and Chetty 1999, Sandhu and Slingerland 2000). Cyclin E is a regulatory subunit of cyclin-dependent kinase 2 (Cdk2), which phosphorylates a number of substrates that promote cell cycle progression. In normally dividing cells, Cyclin E is expressed during the G1 phase and peaks at the G1/S boundary, where it is needed for G1/S transition. Cyclin E is gradually degraded as the cells progress through the S-phase (Reed 1996, 1997, Sauer and Lehner 1995). Cyclin E levels are controlled by cell-cycle-regulated transcription and ubiquitin-mediated proteolysis. This regulation is important and its disruption causes Cyclin E associated genomic instability characterized by aneuploidy, centrosome amplification, micronuclei and anaphase bridges (Rajagopalan et al. 2004, Spruck, Won, and Reed 1999).   Cyclin E has two CPDs: A C-terminal degron LLTPPQSGK (comprised of phosphorylated T380 and phosphorylated S384) and an N-terminal degron IPTPDKEDD comprised of phosphorylated T62 (Koepp et al. 2001, Moberg et al. 2001, Strohmaier et al. 2001). The T380 in the C-terminal CPD is phosphorylated by Cdk2 or GSK3 and is the primary residue responsible for binding to Fbxw7, while S384 phosphorylation by CDK2 provides a negative charge at the +4 position (Welcker et al. 2003, Ye et al. 2004). A negative charge at the +4 position, either by phosphorylation or by acidic amino acid residues, is conserved in all known Fbxw7 substrates. S384 phosphorylation increases the strength of the T380 degron and can determine whether monomeric or dimeric Fbxw7      9degrades Cyclin E (Welcker and Clurman 2007). The N?terminal degron centered on threonine 62 is weaker than the C-terminal degron and makes fewer contacts with the WD40 repeats (Hao et al. 2007). However, in the absence of T384 phosphorylation, Cyclin E degradation requires both T62 and T380 phosphorylation and Fbxw7 dimerization (Tang et al. 2007, Welcker and Clurman 2007, Hao et al. 2007).  1.3 FBXW7 is highly mutated in cancer: Mutations in FBXW7 occur in diverse human malignancies (Figure 3).   Figure 3. Incidence of FBXW7 mutations in various cancers (data from Catalog Of Somatic Mutations In Cancer (COSMIC)      10 FBXW7 exhibits an unusual mutational spectrum in tumors. Of the total number of mutations reported on the FBXW7 gene in COSMIC (Catalog of somatic mutations in cancer), 12 % are nonsense mutations that would lead to the truncation of the protein, around 7% are insertions and deletions, but the vast majority, 77.42%, are missense substitutions whose functional significance is unclear (Figure 4).   Figure 4. Summary of intragenic mutations in FBXW7 based on data form COSMIC   The large number of missense mutations in FBXW7 in cancer suggests that the mutated protein provides the tumor with some kind of advantage over a complete loss of the      11protein. It is also surprising that many of the missense mutations are not bi-allelic but heterozygous, based on the data available in COSMIC (Grim 2013). It is not well studied how missense mutations affect known Fbxw7 phenotypes in the cell. Accordingly, in order to understand the mechanisms of Fbxw7-linked tumorigenesis, it is crucial to examine the consequences of cancer-specific mutations in the gene.  In cancers, mutations in FBXW7 are found all along the length of the protein, but the majority of the mutations cluster at arginine residues Arg465, Arg479 and Arg505 (mutational hotspots), that lie in WD40 repeats 3 and 4 (Figure 5).          Figure 5. The distribution of somatic mutations in FBXW7       12Mutations in Arg465 and Arg479 contribute to 43% of the total mutations found in FBXW7. Arg465, Arg479 and Arg505 are well-conserved residues and have been shown to be responsible for interactions with substrates for Fbxw7 (Hao et al. 2007).  A model of the crystallographic structure of Fbxw7 in complex with a Cyclin E peptide  (Figure 6) shows that it is the WD40 domain of Fbxw7 that is responsible for binding with the CPD and Arg465, Arg479 and Arg505 of Fbxw7 form central contacts with the phosphodegron of Cyclin E (Hao et al. 2007).    Figure 6. Model of the crystallographic structure of Fbxw7 in complex with the Cyclin E peptide A) Crystallographic structure of Fbxw7 in complex with the Cyclin E peptide showing the mutational hotspot residues of Fbxw7 and the phospho degron of Cyclin E (B) A closer view of the Fbxw7 ? Cyclin E interaction (PDB 2OVR)        13Phosphorylated residues Thr380 and Ser384 of Cyclin E are negatively charged and interact with the critical arginines of Fbxw7, which are positively charged. At the mutational hotspots, an arginine residue is replaced with a Cysteine or a Glutamine, both of which are uncharged and polar. These biochemical changes may significantly affect the microenvironment of the substrate-binding pocket of Fbxw7, potentially lowering its affinity for Cyclin E (Hao et al. 2007). While Arg465, Arg479 and Arg505 of Fbxw7 are highly mutated in cancer, the effect of these mutations on Fbxw7 substrate levels and CIN is not well studied (Akhoondi et al. 2007, Inuzuka et al. 2011, Wertz et al. 2011). Functionalization of these missense mutations would help us to understand what role, if any, these FBXW7 mutations play in cancer.  1.4 Overview of thesis: Inactivation of FBXW7 has been shown to cause CIN in colorectal cancers, however the functional consequences of missense mutations commonly found in cancer are not clear. My project aims to establish a methodology for testing missense mutations in candidate CIN genes found mutated in tumors, for phenotypes associated with CIN in human cells. As a test case, we used the methodology to functionalize cancer-associated mutant alleles of FBXW7 to study their role in CIN. We hypothesized that FBXW7 mutations that frequently occur in tumors, cause the stabilization of the oncogenic Fbxw7 substrate Cyclin E and lead to CIN. To test this hypothesis, three of the frequent FBXW7 cancer mutations, R465C, R479Q and R505C were expressed ectopically in three colorectal cancer cell lines of HCT116 background:      14? HCT116 (FBXW7 +/+), which is a near diploid colorectal cancer cell line ? HCT116 (FBXW7 +/-), in which one allele of FBXW7 has been disrupted by targeted recombination  ? HCT116 (FBXW7 -/-), in which both alleles of FBXW7 have been disrupted by targeted recombination By expressing FBXW7 mutations in each of these cell lines containing different levels of endogenous protein, we can investigate whether the mutations are functional and relate their phenotypic consequences to the conditions of FBXW7-mutated tumors. The following assays were conducted on the prepared cell lines: ? Testing for stabilization of the Fbxw7 substrate Cyclin E by performing western blots on whole cell lysates ? Quantifying the incidence abnormal anaphases, which is a known Fbxw7-related phenotype that can lead to genomic instability               15Chapter 2: Materials and Methods 2.1 Cell lines and media: HCT116 cells were purchased from ATCC (CCL-247) and cultured in McCoy?s 5A medium (GIBCO 16600-082) supplemented with 10% FBS (GIBCO 12483) and 2mM L-Glutamine (Invitrogen). HEK293T cells were cultured in DMEM (Invitrogen 11995-07) supplemented with 10% FBS. HCT116 (FBXW7 +/-) and HCT116 (FBXW7 -/-) cell lines were a gift from Dr. Bert Vogelstein (Johns Hopkins University). All cell lines were grown at 37?C within a humidified, 5% CO2 atmosphere.  2.2 Cloning:  cDNA of the alpha isoform of Fbxw7 (in pCR4-TOPO) was purchased from Open Biosystems (MHS4426-99239216). The cDNA was PCR amplified and subcloned between Sal1 and EcoR1 sites of the Gateway entry vector pENTR4-FLAG (Campeau et al. 2009), a gift from the Kaufmann lab, Addgene plasmid 17423, with a N-terminal flag tag to obtain pENTR4-FLAG-Fbxw7.  2.3 Site-directed mutagenesis of FBXW7 alpha isoform: Site-directed mutagenesis of pENTR4-FLAG- FBXW7 using the QuikChange lightning site-directed mutagenesis kit (Agilent Technologies) was done to obtain mutants R465C using primers 5?ggcatacttccactgtgtgttgtatgcatcttcatg3? and 5?catgaagatgcatacaacacacagtggaagtatgcc3?, R479Q using primers 5?gttgttagcggttctcaagatgccactcttagggtttg3? and 5?caaaccctaagagtggcatcttgagaaccgctaacaac      163? and R505C using primers 5?ggtcatgttgcagcagtctgctgtgttcaatatg3? and 5? catattgaacacagcagactgctgcaacatgacc3?. The sequences of all the constructs were confirmed by sequencing. The mutated Gateway entry vectors, pENTR4-FLAG- FBXW7 and pENTR4-FLAG alone were recombined into the Gateway-based, lentiviral expression vector pLenti PGK Hygro DEST (Campeau et al. 2009), a gift from the Kaufmann lab, Addgene plasmid 19066.  2.4 Lentivirus preparation and lentiviral transduction of the HCT116 cell lines: Lentiviruses were produced by transiently transfecting HEK293T cells with the Mission lentiviral packaging mix (Sigma) and each of the expression vectors, using the transfection reagent Fugene 6 (Promega) as per the manufacturer?s guidelines. The three HCT116-based cell lines, HCT116 (FBXW7 +/+), HCT116 (FBXW7 +/-) and HCT116 (FBXW7 -/-), were each transduced with each of the five lentiviral preparations independently, to produce fifteen transduced cell lines. Polybrene (hexadimethrine bromide) (Sigma) was added at 8?g/ml to enhance the efficiency of lentiviral infection. Transduced cells were selected using Hygromycin B (Roche) at 600?g/ml for the HCT116 (FBXW7 +/+) based transduced lines and 250?g/ml for HCT116 (FBXW7 +/-) and HCT116 (FBXW7 -/-) based transduced lines.  2.5 Western blotting: Asynchronous, sub-confluent cells were collected and lysed in a lysis buffer containing 50mM Tris-HCl (pH 7.5) 150mM NaCl, 10% glycerol, 1% Triton X-100 and protease and phosphatase inhibitors. The cells were briefly sonicated followed by centrifugation at      1710,621 g for 15 minutes at 4? C. Protein levels of the cleared cell lysates were estimated using the Pierce Bicinchoninic Acid Assay (Thermo Scientific). Equal amounts of proteins were loaded onto polyacrylamide gels, separated by SDS-PAGE, and transferred onto PVDF membranes (Millipore Immobilon - P). Western blotting was performed as previously described (McManus et al. 2006), using antibodies against Cyclin E (HE12)(Abcam, ab3927) and GAPDH (Abcam, ab9485). Antibodies against Fbxw7 that were tested on western blots include: (PA5 ? 29193 Pierce Thermo Scientific, ab105752 Abcam, AB10620 Millipore, 40-1500 Invitrogen, ab12292 Abcam, F1930 (FB343) Sigma, F2055 (FB407) Sigma, NBP1-19371 Novus, A301-720A Bethyl laboratories, A301-721A Bethyl laboratories).  2.6 Abnormal anaphase count: Cells were seeded in 96-well optical bottom plates (Perkin Elmer) and were fixed on the third day following seeding in 3.7% paraformaldehyde (EMD Chemicals) in PBS for 10 minutes. DNA was counterstained with 500 ng/?L Hoechst 33342 (Invitrogen) in PBS. The plates were scanned using the Cellomics Arrayscan VTI fluorescence imager, at 20X magnification. Images were viewed and abnormal anaphases comprised of anaphase bridges and lagging chromosomes were manually counted.  2.7 Quantitative real-time PCR assay:  Total RNA from cell lines was isolated using the Qiagen RNeasy mini kit (Qiagen) and treated with DNase (Qiagen) as recommended by the manufacturer. RT-PCR was performed using SuperScript III Platinum two-step qRT-PCR Kit (Invitrogen).      18Quantitative PCR was done using Power SYBR green PCR Master Mix  (Applied Biosystems) using primers 5?TTCATTCCTGGAACCCAAAGA3? and 5?TCCTCAGCCAAAATTCTCCAGTA3? for Fbxw7 and 5?TGGAAGGACTCATGACCACAGT3? and 5?GCCATCACGCCACAGTTTC3? for GAPDH (Sancho et al. 2013). The reaction was performed in a 20?l volume, in the Applied Biosystems AB17500 real-time thermal cycler using the 7500 Fast Real-Time PCR System software v1.3.1.                       19Chapter 3: Results 3.1 Generation of cell lines expressing mutant alleles of FBXW7: In order to study the functional consequences of the FBXW7 mutations R465C, R479Q and R505C, found frequently in cancers, we developed a methodology to express them in genetically engineered HCT116-based cell lines expressing different levels of endogenous Fbxw7 (Rajagopalan et al. 2004). For this purpose, cDNA of the alpha isoform of Fbxw7 (in pCR4-TOPO) was PCR amplified and subcloned between Sal1 and EcoR1 sites of the Gateway entry vector pENTR4-FLAG with an N-terminal flag tag to obtain pENTR4-FLAG-FBXW7 (Campeau et al. 2009). Site-directed mutagenesis of pENTR4-FLAG- FBXW7 was done using QuikChange, to obtain mutants R465C, R479Q and R505C. The mutated Gateway entry vectors, pENTR4-FLAG-FBXW7 and pENTR4-FLAG were recombined into the Gateway-based, lentiviral expression vector pLenti PGK Hygro DEST, with a PGK promoter and the Hygromycin resistance gene (Campeau et al. 2009). Five kinds of lentiviruses were produced by transiently transfecting HEK293T cells with the lentiviral packaging mix and one of the five expression vectors. HCT116-based cell lines, HCT116 (FBXW7 +/+), HCT116 (FBXW7 +/-) and HCT116 (FBXW7 -/-), were each transduced separately with each of the five lentiviral preparations yielding a total of fifteen cell lines - nine cell lines expressing the mutant alleles of FBXW7 and six control cell lines, three expressing just the FLAG tag (vector alone) and the other three expressing FLAG-tagged wild type FBXW7 (Figure 7). The phenotypes of these cell lines were compared in subsequent experiments.      20 Figure 7. Schematic of lentiviral transduction to prepare various cell lines A) Cell lines of HCT116 (FBXW7 +/+) background B) Cell lines of HCT116 (FBXW7 +/-) background C) Cell lines of HCT116 (FBXW7 -/-) background         213.2 Cyclin E stabilization in cell lines expressing mutant alleles of FBXW7: Existing evidence showed that Cyclin E is stabilized when FBXW7 is inactivated in HCT116 cells and that Cyclin E stabilization correlates with CIN (Rajagopalan et al. 2004). We hypothesized that Cyclin E levels would be stabilized in cell lines expressing mutated alleles of FBXW7. As a preliminary experiment, we investigated the levels of Cyclin E in HCT116 (FBXW7 +/+), HCT116 (FBXW7 +/-) and HCT116 (FBXW7 -/-) cells. Western blots of whole cell lysates from the three cell lines showed that Cyclin E levels were increased in HCT116 (FBXW7 -/-) cells relative to HCT116 (FBXW7 +/+) and HCT116 (FBXW7 +/-) cells, presumably due to decreased degradation of Cyclin E (Figure 8).                              Figure 8. Western blot of whole cell lysates from the parental cell lines, probed with an antibody against Cyclin E. GAPDH is the loading control   To investigate whether Cyclin E was stabilized in cell lines expressing mutant alleles of FBXW7, western blots using whole cell lysates from all parental and transduced cell      22lines were performed and probed with an antibody against Cyclin E. The results are shown in Figure 9.   Figure 9. Western blots of whole cell lysates from various cell lines probed with the Cyclin E antibody. A) Cell lines of HCT116 (FBXW7 +/+) background B) Cell lines of HCT116 (FBXW7 +/-) background and C) Cell lines of HCT116 (FBXW7 -/-) background, probed with an antibody against Cyclin E. GAPDH is the loading control in the figures   Control cell lines, transduced with the vector alone did show a significant difference in Cyclin E turnover compared to parental cell lines. Complementation with the wild type Fbxw7 protein accentuated Cyclin E degradation in the cell lines with different endogenous levels of Fbxw7, consistent with the role of this protein in Cyclin E degradation. However, relative to the parental (non-transduced) cell lines, Cyclin E is stabilized in HCT116 (FBXW7 +/+) and HCT116 (FBXW7 +/-) cell lines expressing each of the three specific mutated alleles of FBXW7 tested (Figures 9 A, B). HCT116 (FBXW7 -/-) cell lines expressing these mutated alleles of FBXW7 did not show      23increased Cyclin E accumulation when compared with the parental cell line and the cell line expressing the vector alone (Figure 9 C). 3.3 Elevated frequencies of abnormal anaphases in cell lines expressing mutant alleles of FBXW7: Abnormal anaphases manifesting as lagging chromosomes and anaphase bridges are indicators of underlying CIN (Cimini, Cameron, and Salmon 2004, Hoffelder et al. 2004, Thompson and Compton 2011). To investigate whether the expression of mutated alleles of FBXW7 causes CIN, we manually scored high content images of Hoechst stained nuclei of each of the parental and transduced cell lines, for the occurrence of anaphase bridges and lagging chromosomes (Figure 10).    Figure 10. Examples of images of Hoechst stained nuclei scored to estimate the percentages of abnormal anaphases A) Normal anaphase   B) Anaphase bridge C) Lagging chromosomes   The results from the quantification are shown in Table 1, Table 2 and Table 3.   A) B) C)      24Table 1. Frequencies of abnormal anaphases in various cell lines of HCT116 (FBXW7 +/+) background Cell Line Percentage of abnormal anaphases Total number of anaphases counted HCT116 (FBXW7 +/+) 9.8 254 HCT116 (FBXW7 +/+) - Vector 10 106 HCT116 (FBXW7 +/+) - WT 7.9 78 HCT116 (FBXW7 +/+) - R465C 75 64 HCT116 (FBXW7 +/+) - R479Q 77 87 HCT116 (FBXW7 +/+) - R505C 67 81  Table 2. Frequencies of abnormal anaphases observed in various cell lines of HCT116 (FBXW7 +/-) background Cell Line Percentage of abnormal anaphases Total number of anaphases counted HCT116 (FBXW7 +/-) 18.8 64 HCT116 (FBXW7 +/-) - Vector 23.0 65 HCT116 (FBXW7 +/-) - WT 13.5 63 HCT116 (FBXW7 +/-) - R465C 76.1 176 HCT116 (FBXW7 +/-) - R479Q 67.9 159 HCT116 (FBXW7 +/-) - R505C 79.0 132      25Table 3. Frequencies of abnormal anaphases observed in various cell lines of HCT116 (FBXW7 -/-) background Cell Line Percentage of abnormal anaphases Total number of anaphases counted HCT116 (FBXW7 -/-) 17.7 248 HCT116 (FBXW7 -/-) - Vector 17.5 137 HCT116 (FBXW7 -/-) - WT 11.8 237 HCT116 (FBXW7 -/-) - R465C 15.6 179 HCT116 (FBXW7 -/-) - R479Q 18.4 148 HCT116 (FBXW7 -/-) - R505C 36.6 142   We observed that the parental (non-transduced) cell lines in which one or both copies of FBXW7 were knocked out by homologous recombination, showed much higher frequencies of abnormal anaphases (18.8% and 17.7% respectively) compared to the cell line in which both wild type copies of the gene were present (9.8%). In all transduced cell lines, the vector alone did not cause a significant elevation in the frequency of abnormal anaphases (10% vs 9.8%, 23.0% vs 18.8%, 17.7% vs 17.5%). The transduced cell lines expressing wild type FBXW7 showed a decline in abnormal anaphase frequency (7.92% vs 10%, 13.5% vs 23.0%, 11.8% vs 17.5%). Interestingly, HCT116 (FBXW7 +/+) and HCT116 (FBXW7 +/-) transduced cell lines expressing mutant alleles of FBXW7 showed a 3- to 6-fold increase in frequencies of abnormal anaphases compared to the respective parental transduced cell lines expressing the empty vector (Table 1,2).      26HCT116 (FBXW7 -/-) transduced cell lines expressing mutant alleles of FBXW7 showed no or small increases in the frequency of abnormal anaphases when compared with the parental transduced cell line expressing the vector alone (Table 3).    3.4 RT-qPCR provides evidence for expression of the integrated FBXW7 gene in transduced cell lines: In the absence of an effective antibody for Fbxw7 (Appendix 1), we conducted RT-PCR to gain evidence of FBXW7 mRNA expression. In a preliminary experiment, we performed RT-qPCR on the three parental cell lines HCT116 (FBXW7 +/+), HCT116 (FBXW7 +/-) and HCT116 (FBXW7 -/-) with different endogenous levels of Fbxw7 (Figure 11). We observed that, relative to the FBXW7 mRNA level in the HCT116 (FBXW7 +/+) cells, the HCT116 (FBXW7 +/-) cells showed marked reduction in FBXW7 mRNA levels (0.68 fold), while the HCT116 (FBXW7 -/-) cell line showed a negligible level of FBXW7 mRNA (0.04 fold).       27Figure 11. Q-PCR analysis of FBXW7 in HCT116 (FBXW7 +/+), HCT116 (FBXW7 +/-) and HCT116 (FBXW7 -/-) cell lines. Relative fold reduction after normalizing to GAPDH (3 technical replicates per cell line)   In order to verify expression of the FBXW7 gene constructs introduced and integrated into cell lines by lentiviral transduction, we performed RT-qPCR on HCT116 (FBXW7 -/-) cells and HCT116 (FBXW7 -/-) cells transduced with the wild type FBXW7 gene construct and compared the results. As shown in Figure 12, HCT116 (FBXW7 -/-) cells transduced with wild type FBXW7 showed an increase (3-fold) in FBXW7 mRNA expression relative to the parental (non-transduced) cells. Moreover, RT-qPCR analysis of HCT116 (FBXW7 +/+) and HCT116 (FBXW7 +/-) cells transduced to express wild type FBXW7 also showed an increase in mRNA expression compared to their parental (non-transduced) counterparts.       28 Figure 12. Q-PCR analysis of FBXW7 in various HCT116 derived cell lines. Relative fold induction after normalizing to GAPDH (3 technical replicates per cell line)   These findings provide evidence for the transcription of the integrated FBXW7 gene in transduced cells.            29Chapter 4: Discussion Monoallelic missense mutations dominate the mutational spectrum of FBXW7 in tumors (Figure 4) (Forbes et al. 2011, Kemp et al. 2005, Rajagopalan et al. 2004). As opposed to the biallelic inactivation of Fbxw7, the phenotypic consequences of such mutations are difficult to predict. In order to study the phenotypic effects of the frequent FBXW7 mutations R465C, R479Q and R505C, we developed a methodology to test phenotypes caused by expression of these alleles using lentiviral transduction in HCT116 colorectal cancer cells engineered to express different endogenous levels of the protein. Since the inactivation of FBXW7 in HCT116 cells is known to cause CIN and Cyclin E accumulation (Rajagopalan et al. 2004), we examined these phenotypes in cell lines expressing the specific mutated alleles of FBXW7.   In the prepared cell lines, we observed that while expression of the vector alone did not significantly affect Cyclin E turnover and CIN, the introduction of wild type FBXW7 led to a decline in the levels of Cyclin E and increased CIN. This suggests that the transgene is being expressed in the transduced cell lines. We found that expression of the R465C, R479Q and R505C FBXW7 mutant proteins in HCT116 (FBXW7 +/+) and HCT116 (FBXW7 +/-) cell lines, where endogenous Fbxw7 protein is present, led to the stabilization of Cyclin E and increased CIN above vector controls (Figure 8 A, B and Table 1, 2). Expression of these specific FBXW7 arginine mutants in HCT116 (FBXW7 -/-) cell lines, where endogenous protein is absent, resulted in similar levels of Cyclin E and CIN compared with the vector control (Figure 8 C and Table 3). These observations      30indicate that the Fbxw7 variants R465C, R479Q and R505C are non-functional on their own, but can act as dominant negatives when wild type Fbxw7 is present.   A model for how these mutations could be dominant negative has been presented previously (Hao et al. 2007, Welcker and Clurman 2008) (Figure 13).                      31   Figure 13. Speculative model of Fbxw7 dimer-dependent Cyclin E turnover. A) Cyclin E that is not phosphorylated at S384, is still a substrate for Fbxw7, but requires Fbxw7 dimerization and an additional phosphorylation of the N-terminal, Cyclin E T62 degron B) Each Cyclin E molecule, phosphorylated at T380 and S384 can bind to one monomer of Fbxw7 in the Fbxw7 dimer C) A mutation in one monomer of the Fbxw7 dimer abolishes binding with Cyclin E.      32This model suggests that Fbxw7 dimers form to degrade Cyclin E and dimers comprised of one wild type and one mutated monomer of Fbxw7 may be non-functional, leading to Cyclin E accumulation.  It has been shown that the Fbxw7 mutant R465C can dominantly interfere with the ability of wild type Fbxw7 to degrade Cyclin E (Akhoondi et al. 2007). We showed that the mutants R479Q and R505C also act in a dominant negative fashion, causing Cyclin E stabilization. Additionally, we also demonstrated that the three arginine mutants increase CIN in a dominant negative manner.  Since CIN and Cyclin E accumulation occur in HCT116 (FBXW7 +/-) cell lines expressing mutated alleles of FBXW7 we speculate that these phenotypes are the consequences of common FBXW7 mutations in tumors. Our observations support the theory that FBXW7 is not a classical tumor suppressor as a single hit in the critical arginine residues responsible for interaction of Fbxw7 with its substrates, causes sufficient functional derangement (Berger, Knudson, and Pandolfi 2011).  One limitation found in this study was that the older generations of HCT116 (FBXW7 -/-) cell lines expressing the mutated alleles R465C, R479Q and R505C showed lower Cyclin E accumulation than their early passage counterparts (data not shown). This observation suggests that the transduced cell lines are probably adapting during long-term outgrowth. To overcome this limitation, the parental cell lines can be re-infected with the lentiviral preparations to obtain fresh cell line populations expressing the FBXW7 constructs.        33Furthermore, we could not detect the FLAG tagged Fbxw7 protein by western blot of protein output from transduced cell lines (Data not shown). To address this, we tested several anti-Fbxw7 antibodies reported in literature (Appendix 1). However, none of the tested antibodies showed consistent results. One might argue that the transgene is not being expressed in the prepared cell lines. However, the rescue of CIN, observed as a decrease in the number of abnormal anaphases in the HCT116 (FBXW7-/-) cell line transduced to express wild type FBXW7 suggests that the transgene is being expressed (Table 3). The reduction in Cyclin E level in this cell line also supports this notion (Figure 8 C). FBXW7 mRNA quantification by RT-qPCR confirmed the presence of FBXW7 mRNA in the HCT116 cell lines transduced to express wild type FBXW7 (Figure 12). In summary, we have shown that heterozygous missense substitutions R465C, R479Q and R505C, frequently observed in FBXW7 mutated tumors, cause loss-of-function of the protein and act dominant negatively, leading to CIN and the accumulation of Cyclin E, in the cell lines expressing them.             34Chapter 5: Conclusion, Therapeutic Implication and Future Directions FBXW7 is a tumor suppressor gene mutated at different frequencies in a variety of cancers including 10% of colorectal cancers. The inactivation of FBXW7 has been shown to cause CIN in colorectal cancer cells, however, the functional consequences of the missense mutations commonly found in cancer are not clear. This project aimed to functionalize cancer-associated mutant alleles of FBXW7 to study their putative role in CIN. Our hypothesis was that FBXW7 mutations that frequently occur in tumors cause the stabilization of Cyclin E, an oncogenic FBXW7 substrate, and lead to CIN. To investigate whether expression of some of the most frequent cancer-associated mutations in FBXW7 is functionally deleterious, and to relate their phenotypic consequences to the conditions of FBXW7-mutated tumors, we individually tested R465C, R479Q and R505C variants of FBXW7, in three colorectal cancer cell lines of HCT116 background that express different levels of endogenous protein. Our data show that cell lines expressing these mutant alleles of FBXW7 fail to degrade Cyclin E. These cells lines also exhibit a CIN phenotype observed as an increase in the frequency of abnormal anaphases. These findings support the notion that FBXW7 propeller-tip mutations R465C, R479Q and R505C cause loss-of-function of the protein and can act as dominant negatives in the presence of endogenous Fbxw7, providing a mechanistic explanation for the missense mutational spectrum of FBXW7 in tumors. CIN is a hallmark of cancer cells. Since CIN is observed in these cell lines, we speculate that CIN may be a consequence of FBXW7 mutations in tumors.         35Our lab is particularly interested in finding genes that are somatically mutated in tumors and cause a CIN phenotype. The system and assays developed during this project can be used to design other projects to investigate mutations in other CIN genes in the future. Fbxw7 controls the degradation of multiple substrates. This study investigated variations in Cyclin E levels only, however the prepared cell lines can be used to probe other substrates of Fbxw7 and expand mechanisms of Fbxw7 mediated tumorigenesis. The synthetic lethal approach to specifically kill FBXW7 mutated cancer cells represents a possible strategy to treat patients with FBXW7 mutations. Cell lines expressing mutated alleles of FBXW7, created during this project, are a resource that can be harnessed in synthetic lethal screens to identify synthetic lethal partners of FBXW7. Inhibitors targeting the protein products of these synthetic lethal partner genes would specifically kill FBXW7 mutant cancer cells. Alternatively, cell lines expressing mutant alleles FBXW7 can be screened for sensitivity to known drugs and chemotherapeutics providing targeted therapies for patients with FBXW7 mutated cancers.                36Bibliography Akhoondi, S., D. Sun, N. von der Lehr, S. Apostolidou, K. Klotz, A. Maljukova, D. Cepeda, H. Fiegl, D. Dafou, C. Marth, E. Mueller-Holzner, M. Corcoran, M. Dagnell, S. Z. Nejad, B. N. Nayer, M. R. Zali, J. Hansson, S. Egyhazi, F. Petersson, P. Sangfelt, H. Nordgren, D. Grander, S. I. Reed, M. Widschwendter, O. Sangfelt, and C. Spruck. 2007. "FBXW7/hCDC4 is a general tumor suppressor in human cancer." Cancer Res no. 67 (19):9006-12. doi: 10.1158/0008-5472.CAN-07-1320. Bai, C., P. Sen, K. Hofmann, L. Ma, M. Goebl, J. W. Harper, and S. J. Elledge. 1996. "SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box." Cell no. 86 (2):263-74. Barber, T. D., K. McManus, K. W. Yuen, M. Reis, G. Parmigiani, D. Shen, I. Barrett, Y. Nouhi, F. Spencer, S. Markowitz, V. E. Velculescu, K. W. Kinzler, B. Vogelstein, C. Lengauer, and P. Hieter. 2008. "Chromatid cohesion defects may underlie chromosome instability in human colorectal cancers." Proc Natl Acad Sci U S A no. 105 (9):3443-8. doi: 10.1073/pnas.0712384105. Berger, A. H., A. G. Knudson, and P. P. Pandolfi. 2011. "A continuum model for tumour suppression." Nature no. 476 (7359):163-9. doi: 10.1038/nature10275. Busino, L., S. E. Millman, L. Scotto, C. A. Kyratsous, V. Basrur, O. O'Connor, A. Hoffmann, K. S. Elenitoba-Johnson, and M. Pagano. 2012. "Fbxw7alpha- and GSK3-mediated degradation of p100 is a pro-survival mechanism in multiple myeloma." Nat Cell Biol no. 14 (4):375-85. doi: 10.1038/ncb2463. Campeau, E., V. E. Ruhl, F. Rodier, C. L. Smith, B. L. Rahmberg, J. O. Fuss, J. Campisi, P. Yaswen, P. K. Cooper, and P. D. Kaufman. 2009. "A versatile viral system for expression and depletion of proteins in mammalian cells." PLoS One no. 4 (8):e6529. doi: 10.1371/journal.pone.0006529. Cimini, D., L. A. Cameron, and E. D. Salmon. 2004. "Anaphase spindle mechanics prevent mis-segregation of merotelically oriented chromosomes." Curr Biol no. 14 (23):2149-55. doi: 10.1016/j.cub.2004.11.029. Donnellan, R., and R. Chetty. 1999. "Cyclin E in human cancers." FASEB J no. 13 (8):773-80. Forbes, S. A., N. Bindal, S. Bamford, C. Cole, C. Y. Kok, D. Beare, M. Jia, R. Shepherd, K. Leung, A. Menzies, J. W. Teague, P. J. Campbell, M. R. Stratton, and P. A. Futreal. 2011. "COSMIC: mining complete cancer genomes in the Catalogue of Somatic Mutations in Cancer." Nucleic Acids Res no. 39 (Database issue):D945-50. doi: 10.1093/nar/gkq929. Grim, J. E. 2013. "Fbxw7 hotspot mutations and human colon cancer: mechanistic insights from new mouse models." Gut. doi: 10.1136/gutjnl-2013-305144. Gupta-Rossi, N., O. Le Bail, H. Gonen, C. Brou, F. Logeat, E. Six, A. Ciechanover, and A. Israel. 2001. "Functional interaction between SEL-10, an F-box protein, and the nuclear form of activated Notch1 receptor." J Biol Chem no. 276 (37):34371-8. doi: 10.1074/jbc.M101343200. Hanahan, D., and R. A. Weinberg. 2011. "Hallmarks of cancer: the next generation." Cell no. 144 (5):646-74. doi: 10.1016/j.cell.2011.02.013.      37Hanks, S., K. Coleman, S. Reid, A. Plaja, H. Firth, D. Fitzpatrick, A. Kidd, K. Mehes, R. Nash, N. Robin, N. Shannon, J. Tolmie, J. Swansbury, A. Irrthum, J. Douglas, and N. Rahman. 2004. "Constitutional aneuploidy and cancer predisposition caused by biallelic mutations in BUB1B." Nat Genet no. 36 (11):1159-61. doi: 10.1038/ng1449. Hao, B., S. Oehlmann, M. E. Sowa, J. W. Harper, and N. P. Pavletich. 2007. "Structure of a Fbw7-Skp1-cyclin E complex: multisite-phosphorylated substrate recognition by SCF ubiquitin ligases." Mol Cell no. 26 (1):131-43. doi: 10.1016/j.molcel.2007.02.022. Hoffelder, D. R., L. Luo, N. A. Burke, S. C. Watkins, S. M. Gollin, and W. S. Saunders. 2004. "Resolution of anaphase bridges in cancer cells." Chromosoma no. 112 (8):389-97. doi: 10.1007/s00412-004-0284-6. Inuzuka, H., S. Shaik, I. Onoyama, D. Gao, A. Tseng, R. S. Maser, B. Zhai, L. Wan, A. Gutierrez, A. W. Lau, Y. Xiao, A. L. Christie, J. Aster, J. Settleman, S. P. Gygi, A. L. Kung, T. Look, K. I. Nakayama, R. A. DePinho, and W. Wei. 2011. "SCF(FBW7) regulates cellular apoptosis by targeting MCL1 for ubiquitylation and destruction." Nature no. 471 (7336):104-9. doi: 10.1038/nature09732. Kemp, Z., A. Rowan, W. Chambers, N. Wortham, S. Halford, O. Sieber, N. Mortensen, A. von Herbay, T. Gunther, M. Ilyas, and I. Tomlinson. 2005. "CDC4 mutations occur in a subset of colorectal cancers but are not predicted to cause loss of function and are not associated with chromosomal instability." Cancer Res no. 65 (24):11361-6. doi: 10.1158/0008-5472.CAN-05-2565. Kitagawa, K., Y. Hiramatsu, C. Uchida, T. Isobe, T. Hattori, T. Oda, K. Shibata, S. Nakamura, A. Kikuchi, and M. Kitagawa. 2009. "Fbw7 promotes ubiquitin-dependent degradation of c-Myb: involvement of GSK3-mediated phosphorylation of Thr-572 in mouse c-Myb." Oncogene no. 28 (25):2393-405. doi: 10.1038/onc.2009.111. Koepp, D. M., L. K. Schaefer, X. Ye, K. Keyomarsi, C. Chu, J. W. Harper, and S. J. Elledge. 2001. "Phosphorylation-dependent ubiquitination of cyclin E by the SCFFbw7 ubiquitin ligase." Science no. 294 (5540):173-7. doi: 10.1126/science.1065203. Kronenwett, U., A. Ploner, A. Zetterberg, J. Bergh, P. Hall, G. Auer, and Y. Pawitan. 2006. "Genomic instability and prognosis in breast carcinomas." Cancer Epidemiol Biomarkers Prev no. 15 (9):1630-5. doi: 10.1158/1055-9965.EPI-06-0080. Kwon, Y. W., I. J. Kim, D. Wu, J. Lu, W. A. Stock, Jr., Y. Liu, Y. Huang, H. C. Kang, R. DelRosario, K. Y. Jen, J. Perez-Losada, G. Wei, A. Balmain, and J. H. Mao. 2012. "Pten regulates Aurora-A and cooperates with Fbxw7 in modulating radiation-induced tumor development." Mol Cancer Res no. 10 (6):834-44. doi: 10.1158/1541-7786.MCR-12-0025. Lengauer, C., K. W. Kinzler, and B. Vogelstein. 1997. "Genetic instability in colorectal cancers." Nature no. 386 (6625):623-7. doi: 10.1038/386623a0. Mao, J. H., I. J. Kim, D. Wu, J. Climent, H. C. Kang, R. DelRosario, and A. Balmain. 2008. "FBXW7 targets mTOR for degradation and cooperates with PTEN in tumor suppression." Science no. 321 (5895):1499-502. doi: 10.1126/science.1162981.      38McManus, K. J., V. L. Biron, R. Heit, D. A. Underhill, and M. J. Hendzel. 2006. "Dynamic changes in histone H3 lysine 9 methylations: identification of a mitosis-specific function for dynamic methylation in chromosome congression and segregation." J Biol Chem no. 281 (13):8888-97. doi: 10.1074/jbc.M505323200. Moberg, K. H., D. W. Bell, D. C. Wahrer, D. A. Haber, and I. K. Hariharan. 2001. "Archipelago regulates Cyclin E levels in Drosophila and is mutated in human cancer cell lines." Nature no. 413 (6853):311-6. doi: 10.1038/35095068. Nateri, A. S., L. Riera-Sans, C. Da Costa, and A. Behrens. 2004. "The ubiquitin ligase SCFFbw7 antagonizes apoptotic JNK signaling." Science no. 303 (5662):1374-8. doi: 10.1126/science.1092880. Oberg, C., J. Li, A. Pauley, E. Wolf, M. Gurney, and U. Lendahl. 2001. "The Notch intracellular domain is ubiquitinated and negatively regulated by the mammalian Sel-10 homolog." J Biol Chem no. 276 (38):35847-53. doi: 10.1074/jbc.M103992200. Orlicky, S., X. Tang, A. Willems, M. Tyers, and F. Sicheri. 2003. "Structural basis for phosphodependent substrate selection and orientation by the SCFCdc4 ubiquitin ligase." Cell no. 112 (2):243-56. Park, I., H. O. Lee, E. Choi, Y. K. Lee, M. S. Kwon, J. Min, P. G. Park, S. Lee, Y. Y. Kong, G. Gong, and H. Lee. 2013. "Loss of BubR1 acetylation causes defects in spindle assembly checkpoint signaling and promotes tumor formation." J Cell Biol no. 202 (2):295-309. doi: 10.1083/jcb.201210099. Rajagopalan, H., P. V. Jallepalli, C. Rago, V. E. Velculescu, K. W. Kinzler, B. Vogelstein, and C. Lengauer. 2004. "Inactivation of hCDC4 can cause chromosomal instability." Nature no. 428 (6978):77-81. doi: 10.1038/nature02313. Rajagopalan, H., and C. Lengauer. 2004. "Aneuploidy and cancer." Nature no. 432 (7015):338-41. doi: 10.1038/nature03099. Rajagopalan, H., M. A. Nowak, B. Vogelstein, and C. Lengauer. 2003. "The significance of unstable chromosomes in colorectal cancer." Nat Rev Cancer no. 3 (9):695-701. doi: 10.1038/nrc1165. Reed, S. I. 1996. "Cyclin E: in mid-cycle." Biochim Biophys Acta no. 1287 (2-3):151-3. Reed, S. I. 1997. "Control of the G1/S transition." Cancer Surv no. 29:7-23. Sancho, R., S. M. Blake, C. Tendeng, B. E. Clurman, J. Lewis, and A. Behrens. 2013. "Fbw7 repression by hes5 creates a feedback loop that modulates notch-mediated intestinal and neural stem cell fate decisions." PLoS Biol no. 11 (6):e1001586. doi: 10.1371/journal.pbio.1001586. Sandhu, C., and J. Slingerland. 2000. "Deregulation of the cell cycle in cancer." Cancer Detect Prev no. 24 (2):107-18. Sauer, K., and C. F. Lehner. 1995. "The role of cyclin E in the regulation of entry into S phase." Prog Cell Cycle Res no. 1:125-39. Schvartzman, J. M., R. Sotillo, and R. Benezra. 2010. "Mitotic chromosomal instability and cancer: mouse modelling of the human disease." Nat Rev Cancer no. 10 (2):102-15. doi: 10.1038/nrc2781. Shih, I. M., W. Zhou, S. N. Goodman, C. Lengauer, K. W. Kinzler, and B. Vogelstein. 2001. "Evidence that genetic instability occurs at an early stage of colorectal tumorigenesis." Cancer Res no. 61 (3):818-22.      39Spruck, C. H., H. Strohmaier, O. Sangfelt, H. M. Muller, M. Hubalek, E. Muller-Holzner, C. Marth, M. Widschwendter, and S. I. Reed. 2002. "hCDC4 gene mutations in endometrial cancer." Cancer Res no. 62 (16):4535-9. Spruck, C. H., K. A. Won, and S. I. Reed. 1999. "Deregulated cyclin E induces chromosome instability." Nature no. 401 (6750):297-300. doi: 10.1038/45836. Stirling, P. C., M. S. Bloom, T. Solanki-Patil, S. Smith, P. Sipahimalani, Z. Li, M. Kofoed, S. Ben-Aroya, K. Myung, and P. Hieter. 2011. "The complete spectrum of yeast chromosome instability genes identifies candidate CIN cancer genes and functional roles for ASTRA complex components." PLoS Genet no. 7 (4):e1002057. doi: 10.1371/journal.pgen.1002057. Stratton, M. R. 2011. "Exploring the genomes of cancer cells: progress and promise." Science no. 331 (6024):1553-8. doi: 10.1126/science.1204040. Strohmaier, H., C. H. Spruck, P. Kaiser, K. A. Won, O. Sangfelt, and S. I. Reed. 2001. "Human F-box protein hCdc4 targets cyclin E for proteolysis and is mutated in a breast cancer cell line." Nature no. 413 (6853):316-22. doi: 10.1038/35095076. Sundqvist, A., M. T. Bengoechea-Alonso, X. Ye, V. Lukiyanchuk, J. Jin, J. W. Harper, and J. Ericsson. 2005. "Control of lipid metabolism by phosphorylation-dependent degradation of the SREBP family of transcription factors by SCF(Fbw7)." Cell Metab no. 1 (6):379-91. doi: 10.1016/j.cmet.2005.04.010. Tan, Y., O. Sangfelt, and C. Spruck. 2008. "The Fbxw7/hCdc4 tumor suppressor in human cancer." Cancer Lett no. 271 (1):1-12. doi: 10.1016/j.canlet.2008.04.036. Tang, X., S. Orlicky, Z. Lin, A. Willems, D. Neculai, D. Ceccarelli, F. Mercurio, B. H. Shilton, F. Sicheri, and M. Tyers. 2007. "Suprafacial orientation of the SCFCdc4 dimer accommodates multiple geometries for substrate ubiquitination." Cell no. 129 (6):1165-76. doi: 10.1016/j.cell.2007.04.042. Teng, C. L., Y. C. Hsieh, L. Phan, J. Shin, C. Gully, G. Velazquez-Torres, S. Skerl, S. C. Yeung, S. L. Hsu, and M. H. Lee. 2012. "FBXW7 is involved in Aurora B degradation." Cell Cycle no. 11 (21):4059-68. doi: 10.4161/cc.22381. Thompson, S. L., and D. A. Compton. 2011. "Chromosome missegregation in human cells arises through specific types of kinetochore-microtubule attachment errors." Proc Natl Acad Sci U S A no. 108 (44):17974-8. doi: 10.1073/pnas.1109720108. Vogelstein, B., and K. W. Kinzler. 2004. "Cancer genes and the pathways they control." Nat Med no. 10 (8):789-99. doi: 10.1038/nm1087. Weaver, B. A., and D. W. Cleveland. 2006. "Does aneuploidy cause cancer?" Curr Opin Cell Biol no. 18 (6):658-67. doi: 10.1016/j.ceb.2006.10.002. Welcker, M., and B. E. Clurman. 2007. "Fbw7/hCDC4 dimerization regulates its substrate interactions." Cell Div no. 2:7. doi: 10.1186/1747-1028-2-7. Welcker, M., and B. E. Clurman. 2008. "FBW7 ubiquitin ligase: a tumour suppressor at the crossroads of cell division, growth and differentiation." Nat Rev Cancer no. 8 (2):83-93. doi: 10.1038/nrc2290. Welcker, M., A. Orian, J. Jin, J. E. Grim, J. W. Harper, R. N. Eisenman, and B. E. Clurman. 2004. "The Fbw7 tumor suppressor regulates glycogen synthase kinase 3      40phosphorylation-dependent c-Myc protein degradation." Proc Natl Acad Sci U S A no. 101 (24):9085-90. doi: 10.1073/pnas.0402770101. Welcker, M., J. Singer, K. R. Loeb, J. Grim, A. Bloecher, M. Gurien-West, B. E. Clurman, and J. M. Roberts. 2003. "Multisite phosphorylation by Cdk2 and GSK3 controls cyclin E degradation." Mol Cell no. 12 (2):381-92. Wertz, I. E., S. Kusam, C. Lam, T. Okamoto, W. Sandoval, D. J. Anderson, E. Helgason, J. A. Ernst, M. Eby, J. Liu, L. D. Belmont, J. S. Kaminker, K. M. O'Rourke, K. Pujara, P. B. Kohli, A. R. Johnson, M. L. Chiu, J. R. Lill, P. K. Jackson, W. J. Fairbrother, S. Seshagiri, M. J. Ludlam, K. G. Leong, E. C. Dueber, H. Maecker, D. C. Huang, and V. M. Dixit. 2011. "Sensitivity to antitubulin chemotherapeutics is regulated by MCL1 and FBW7." Nature no. 471 (7336):110-4. doi: 10.1038/nature09779. Wu, G., S. Lyapina, I. Das, J. Li, M. Gurney, A. Pauley, I. Chui, R. J. Deshaies, and J. Kitajewski. 2001. "SEL-10 is an inhibitor of notch signaling that targets notch for ubiquitin-mediated protein degradation." Mol Cell Biol no. 21 (21):7403-15. doi: 10.1128/MCB.21.21.7403-7415.2001. Yada, M., S. Hatakeyama, T. Kamura, M. Nishiyama, R. Tsunematsu, H. Imaki, N. Ishida, F. Okumura, K. Nakayama, and K. I. Nakayama. 2004. "Phosphorylation-dependent degradation of c-Myc is mediated by the F-box protein Fbw7." EMBO J no. 23 (10):2116-25. doi: 10.1038/sj.emboj.7600217. Ye, X., G. Nalepa, M. Welcker, B. M. Kessler, E. Spooner, J. Qin, S. J. Elledge, B. E. Clurman, and J. W. Harper. 2004. "Recognition of phosphodegron motifs in human cyclin E by the SCF(Fbw7) ubiquitin ligase." J Biol Chem no. 279 (48):50110-9. doi: 10.1074/jbc.M409226200. Yuen, K. W., C. D. Warren, O. Chen, T. Kwok, P. Hieter, and F. A. Spencer. 2007. "Systematic genome instability screens in yeast and their potential relevance to cancer." Proc Natl Acad Sci U S A no. 104 (10):3925-30. doi: 10.1073/pnas.0610642104.                     41Appendix Appendix 1 Testing various anti-Fbxw7 antibodies  During this project, we were unable to detect the FLAG tagged Fbxw7 protein in the transduced cell lines. To address this, we tested various anti-Fbxw7 antibodies described in literature. Fbxw7 has a predicted molecular weight of 79.6 kD. The results from the western blots and the conditions under which the antibodies were tested are described in the figures included in this appendix. 1. Bethyl 301-720-A anti-Fbxw7 antibody:                          422. Bethyl 301-721-A anti-Fbxw7 antibody:           3. Abcam ab12292 anti-Fbxw7 antibody:               434. Novus NBP1-19371 anti-Fbxw7 antibody:          5. Sigma F2055 (FB407) anti-Fbxw7 antibody:              446. Sigma F1930 (FB343) anti-Fbxw7 antibody:           7. Pierce Thermo Scientific (PA5-29193) anti-Fbxw7 antibody:               458. Abcam ab105752 anti-Fbxw7 antibody:           9. Millipore AB10620 anti-Fbxw7 antibody:                4610. Invitrogen 40-1500 anti-Fbxw7 antibody:     

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0103367/manifest

Comment

Related Items