UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The effect of dietary lipids on colitis DeCoffe, Daniella Caitlyn Shireen 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2015_may_DeCoffe_Daniella.pdf [ 8.98MB ]
Metadata
JSON: 24-1.0074407.json
JSON-LD: 24-1.0074407-ld.json
RDF/XML (Pretty): 24-1.0074407-rdf.xml
RDF/JSON: 24-1.0074407-rdf.json
Turtle: 24-1.0074407-turtle.txt
N-Triples: 24-1.0074407-rdf-ntriples.txt
Original Record: 24-1.0074407-source.json
Full Text
24-1.0074407-fulltext.txt
Citation
24-1.0074407.ris

Full Text

                        THE EFFECT OF DIETARY LIPIDS ON COLITIS                                                                      by                                            Daniella Caitlyn Shireen DeCoffe  B.Sc., The University of British Columbia Okanagan, 2012   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF                                 THE REQUIREMENTS FOR THE DEGREE OF      MASTER OF SCIENCE                                                                        in THE COLLEGE OF GRADUATE STUDIES                                                                   (Biology)    THE UNIVERSITY OF BRITISH COLUMBIA                             (Okanagan)     February 2015     © Daniella Caitlyn Shireen DeCoffe, 2015Abstract. Inflammatory Bowel Diseases (IBD) are a major concern in the developed world such as North America and Europe. It has been speculated that diet is an important risk factor in triggering IBD, as well as in inducing symptoms in IBD patients. However, to date no single nutrient has been confirmed empirically as either a contributing factor, or conversely, a preventative factor, that can protect against the disease.  The main objective of this project was to determine the effects of dietary lipids on intestinal inflammation in vivo and in vitro before and during colitis.  To achieve this, I studied high fat diets (HFD): n-6 PUFA, MUFA and SFA and studied each of these HFD supplemented with n-3 PUFA. The mice, after 5 weeks of eating the lipid diets, were orally gavaged with an enteric pathogen Citrobacter rodentium commonly used to induce intestinal inflammation found during colitis. I determined the effects of different dietary oils on the intestinal immune responses by quantifying infiltration of immune cells and examining colonic, serum cytokine and chemokine responses. Since I had previously found that intestinal alkaline phosphatase (IAP) played a role in survival during infection induced colitis, I examined expression and activity of IAP in vivo and in vitro using 264.7 RAW (Mouse leukaemic monocyte macrophage) and Caco-2 (human epithelial colorectal adenocarcinoma) cells stimulated with various fatty acids and lipopolysaccharides (LPS).  Overall my results showed that mice fed MUFA rich diets and inflicted with colitis were the most protected, whereas mice fed n-6 PUFA and SFA had exacerbated colitic responses compared to uninfected mice. Mice fed SFA diets and inflicted with colitis had increased compensating protective homeostatic responses such as: IL-10, IL-33, Reg3γ and T regulatory cells. The n-6 PUFA supplemented with n-3 PUFA diets resulted in a negative outcome on the host immune response in mice. In contrast, MUFA and SFA diets supplemented with n-3 PUFA had no effect on immune responses in mice. In conclusion, I recommend that people suffering from IBD should ii  not supplement n-6 PUFA diets with n-3 PUFA. IBD patients should consider a diet rich in MUFA and/or SFA diets.                       iii  Preface. Chapter 3 and 4 is partially based on previously published work.  Ghosh S, Decoffe D, Brown K, Rajendiran E, Estaki M, et al. (2013) Fish oil attenuates omega-6 polyunsaturated Fatty Acid-induced dysbiosis and infectious colitis but impairs LPS-dephosphorylation activity causing sepsis. PLoS One 8: e55468. For this manuscript Dr. Ghosh and myself were co-first authors. This work was also presented as a poster presentation entitled “Fish oil attenuates n-6 polyunsaturated fatty acid-induced dysbiosis and colitis but increases infection-induced sepsis via impaired intestinal alkaline phosphatase activity” at the 2013 CAG/CDDW Conference in Victoria, B.C and another poster entitled “Dietary oils affect immune responses and intestinal alkaline phosphatase activity during murine colitis” presented at the 2014 Keystone Symposia in Vancouver, BC. I conducted the research presented in this thesis, including all experimental data, analysis, writing and editing. All animal experiments were approved by UBC Animal Care Committee (certificate # A11-0367); Biosafety (certificate # B13-0122) and were performed at the Centre for Disease Modeling (CDM) in Vancouver, BC Canada by our laboratory technician Ben Dai with the supervision of Dr. Deanna Gibson. The mouse tissues were collected and transported to UBC Okanagan.  I was responsible for all mRNA extractions (both in vitro and in vivo), cDNA synthesis and qPCR for all in vitro and in vivo experiments. I also analyzed all histology and immunofluorescent slides, both LPS-dephosphorylating and total alkaline phosphatase enzymes assays. The serum for systemic cytokine analysis was collected by Ben Dai, processed by Eve Technologies in Calgary, AB and analyzed by myself. I conducted all the in vitro work for both RAW 264.7 and Caco-2 cell lines as well as all subsequent enzyme assays. Figure 1 presented in Chapter 1 was taken from Estaki, M., D. DeCoffe, and D.L. Gibson, Interplay between intestinal alkaline phosphatase, diet, gut microbes and immunity. iv  World J Gastroenterol, 2014. 20(42): p. 15650-15656. I have permision from the WJG to use this image in my thesis.                        v  Table of Contents. Abstract ………………………………………………………………………………………… ii Preface………………………………………………………………………………………...... iv Table of Contents………………………………………………………………………………. vi List of Tables………………………………………………………………………………….. xiii List of Figures…………………………………………………………………………………. xv Abbreviations ……………………………………………………………………………….. xviii Acknowledgments …………………………………………………………………………… xxii Dedications ………………………………………………………………………………….. xxiii Chapter 1 Introduction………………………………………………………………………… 1 1.1 Inflammatory Bowel Disease (IBD)……………………………………………….. 1 1.2 The cell types and immune responses involved in IBD disease pathology……… 3 1.2.1 IBD and the colonic epithelium……………………………………………. 3 1.2.2 IBD and macrophages……………………………………………………… 3 1.2.3 IBD and neutrophils………………………………………………………... 4 1.2.4 IBD and prostaglandin E2…………………………………………………. 5 1.2.5 IBD and T regulatory cells………………………………………………… 5 1.2.6 IBD and intestinal epithelial cells………………………………………….. 6 `1.3 Increased risk of IBD with increased consumption of fatty acid diets…………. 7 1.3.1 Polyunsaturated fatty acid………………………………………………….. 7 1.3.2 Monounsaturated fatty acid………………………………………………... 8 1.3.3 Saturated fatty acids……………………………………………………….. 9 1.3.4 n-3 PUFA………………………………………………………………….. 9 1.4 Intestinal alkaline phosphatase: role in gut health and dietary regulation…… 10 vi  1.4.1 Intestinal alkaline phosphatase: background……………………………... 10 1.4.2 IAP and infection…………………………………………………………. 11 1.4.3 IAP regulates inflammation………………………………………………. 12 1.4.4 IAP and chronic inflammatory disease…………………………………… 13 1.4.5 Connection between IAP and food……………………………………….. 14 1.5 Murine colitis models……………………………………………………………... 15 1.6 C. rodentium induced colitis………………………………………………………. 15 1.7 Cell culture models………………………………………………………………... 16  1.7.1 Caco-2 (human epithelial colorectal adenocarcinoma cells line)………… 16  1.7.2 RAW 264.7 (mouse leukaemic monocyte macrophage cell line)………... 17 1.8 Research overview and chapter hypotheses.…………………………………….. 17 Chapter 2 Experimental Techniques………………………………………………………… 19 2.1 Mice……………………………………………………………………………….. 19 2.2 Post-natal diet models………………………………………………………….... 19 2.3 C. rodentium induced infection………………………………………………….. 21 2.4 Clinical scores of mice during C. rodentium infection…………………………. 21 2.5 Histopathology scores: Identifying colon damage during C. rodentium      infection………………………………………………………………………….. 24 2.6 Immunofluorescence staining: Location and co-localization of immune   cells and IAP in the colon……………………………………………………….. 24 2.7 Bradford Protein Assay: To determine protein concentration for enzyme assays…………………………………………………………………………….. 25 2.8 LPS assay: To determine LPS-dephosphorylating activity…………………...  26 2.9 AP assay: Identify total AP activity in infected and uninfected conditions….. 28  vii  2.10 Quantitative Polymerase Chain Reaction (qPCR): Determining          expression of cytokine genes…………………………………………………… 30 2.10.1 mRNA extraction from colon tissues……………………………………. 30 2.10.2 Complimentary DNA synthesis from mRNA …………………………... 30 2.10.3 Primer design……………………………………………………………. 30 2.10.4 Balanced PUFA: The inter-run calibrator……………………………….. 31 2.10.5 q-PCR analysis…………………………………………………………... 31 2.11 Serum cytokine quantification to study the role of sepsis during C. rodentium infection…………………………………………………………….. 34 2.12 RAW 264.7 and Caco-2  cells incubated with different fatty acids          during LPS stimulation………………………………………………………….. 34 2.12.1 Cell culture models……………………………………………………… 34 2.12.2 RAW 264.7 and Caco-2 cell lines………………………………………. 34 2.12.3 FA preparation…………………………………………………………..  35 2.12.4 Plating and FA incubation………………………………………………. 35 2.12.5 LPS stimulation…………………………………………………………. 36 2.12.6 in vitro tissue homogenization…………………………………………... 36 2.13 mRNA extractions from RAW 264.7 and Caco-2 cells for gene expression….. 37 2.14 Fish oil analysis…………………………………………………………………... 37 2.15 Statistics…………………………………………………………………………... 38 2.15.1 In vivo studies …………………………………………………………... 38 2.15.2 In vitro studies…………………………………………………………... 39 Chapter 3 Results: The effects of HFD during infectious colitis.…………………………... 40       viii  3.1 Food intake was not significantly different for mice fed any HFD, while             mice fed MUFA diets were able to gain weight by day 35.……………………… 40 3.2 Survival, clinical scores and post-infection weights from mice infected       with C. rodentium…………………………………………………………………... 42 3.3 Both n-6 PUFA and SFA fed mice have severe colonic damage during        infectious colitis……………………………………………………………………. 44   3.3.1 Uninfected groups………………………………………………………… 44 3.3.2 Infected groups…………………………………………………………… 44 3.4 Mice fed n-6 PUFA and SFA diets showed increased infiltration of colonic immune cells during infectious colitis compared to mice fed MUFA diets………………………………………………………………………………... 47 3.4.1 Uninfected groups………………………………………………………… 47 3.4.2 Infected groups…………………………………………………………… 47 3.5 SFA diets fed to mice promoted an exacerbated pro-inflammatory cytokine response during infectious colitis………………………………………………… 50 3.5.1 Uninfected groups………………………………………………………… 50   3.5.2 Infected groups……………………………………………………………. 50 3.6 Mice fed SFA diets had increased responses important for inflammatory resolution during infectious colitis………………………………………………. 54 3.6.1 Uninfected groups………………………………………………………… 54   3.6.2 Infected groups……………………………………………………………. 54 3.7 SFA diets fed to mice induced increased expression of intestinal FA    receptors during infectious colitis……………………………………………….. 58 3.7.1 Uninfected groups………………………………………………………… 58 ix  3.7.2 Infected groups…………………………………………………………… 58 3.8 Mice fed n-6 PUFA diets had increased expression of serum cytokines   during infectious colitis…………………………………………………………... 61   3.8.1 Uninfected groups………………………………………………………… 61    3.8.2 Infected groups………………………………………………………......... 61 3.9 IAP’s ability to dephosphorylate LPS was increased in the MUFA fed mice…. 65   3.9.1 Uninfected groups………………………………………………………… 65   3.9.2 Infected groups……………………………………………………………. 65 3.10 Total AP activity during infectious colitis……………………………………… 67    3.10.1 Uninfected groups……………………………………………………….. 67   3.10.2 Infected groups…………………………………………………………... 67 3.11 IAP activity in RAW 264.7 macrophage cell lines……………………………... 69  3.12 IAP activity was increased in Caco-2 cells stimulated with OA and LPS……. 71       3.13 Summary of results………………………………………………………………. 73 Chapter 4 Results: The effects of supplementing HFDs with fish oil, rich in long    chain n-3 PUFA during infectious colitis………………………………………... 75 4.1 Mice fed n-6 PUFA diets supplemented with n-3 PUFA didn’t result in    weight gain unlike SFA and MUFA fed mice supplemented with n-3  PUFA.…………………………………………………………...............................  75 4.2 Unlike n-6 PUFA rich diets, MUFA and SFA protected mice from lethal   colitis when supplemented with n-3 PUFA……………………………………… 77 4.3 n-6 PUFA + n-3 PUFA supplemented mice have the lowest colonic damage during infectious colitis…………………………………………………………... 79   4.3.1 Uninfected groups………………………………………………………… 79 x    4.3.2 Infected groups……………………………………………………………. 79 4.4 Mice fed MUFA + n-3 PUFA diets had increased immune cell infiltration         during infectious colitis…………………………………………………………… 83  4.4.1 Uninfected groups………………………………………………………… 83   4.4.2 Infected groups………………………………………………………......... 83 4.5 Mice fed n-6 PUFA supplemented with n-3 PUFA resulted in impaired    pro-inflammatory cytokine responses during infectious colitis………………… 88   4.5.1 Uninfected groups………………………………………………………… 88   4.5.2 Infected groups……………………………………………………………. 88 4.6 Mice fed MUFA + n-3 PUFA diets had increased levels of   anti-inflammatory response during infectious colitis…………………………... 94   4.6.1 Uninfected groups………………………………………………………… 94   4.6.2 Infected groups……………………………………………………………. 94 4.7 There were no significant differences in the FA receptors during infectious colitis………………………………………………………………………………. 99   4.7.1 Uninfected groups………………………………………………………… 99   4.7.2 Infected groups……………………………………………………………. 99 4.8 Mice fed n-6 PUFA + n-3 PUFA had increased levels of IL-15, a key sepsis marker………………………………………………………………... 105   4.8.1 Uninfected groups……………………………………………………….. 105   4.8.2 Infected groups…………………………………………………………... 105 4.9 IAP’s ability to dephosphorylate LPS was increased in the mice fed        SFA + n-3 PUFA during infectious colitis……………………………………… 111   4.9.1 Uninfected groups……………………………………………………….. 111 xi    4.9.2 Infected groups…………………………………………………………... 111 4.10 Total AP activity was increased in the SFA + n-3 PUFA fed mice during infectious colitis………………………………………………………………… 114   4.10.1 Uninfected and infected groups………………………………………... 114 4.11 IAP activity in RAW 264.7 macrophage cell lines were unchanged in FA supplemented with DHA/EPA………………………………………………… 116 4.12 IAP activity was impaired in Caco-2 cells stimulated with OA + DHA          and EPA during LPS stimulation……………………………………………… 116 4.13 Summary of results……………………………………………………………... 118 Chapter 5 Discussion………………………………………………………………………… 119 5.1 The effects of HFD on infectious colitis…………………………………………. 119 5.2 The effects fish oil supplementation during infectious colitis…………………. 122 Chapter 6 Conclusion and future work…………………………………………………….. 124       6.1 Conclusion………………………………………………………………………... 124 6.2 Research limitations……………………………………………………………… 124 6.3 Future work………………………………………………………………………. 125 6.4 Significance of research………………………………………………………….. 125 References…………………………………………………………………………………….. 127         xii  List of Tables. Table 1. Composition of each HFD fed to mice………………………………………………... 20 Table 2. FA present in the HFD fed to mice……………………………………………………. 20 Table 3. Harlan Tekland® catalogue numbers associated with the HFD fed to mice……........... 21 Table 4. Clinical scoring used to analyze mice during C. rodentium infection……………........ 23 Table 5. Experimental primers for mouse gene qPCR analysis……………………..................  33 Table 6. Average food intake values for mice fed high fat and fish oil diets used in   Figure 17A. A student t-test was used to compare n-3 PUFA supplemented mice   to mice fed background diets (n=10); (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05………………………………………………………. 76 Table 7. Histology scores for mice fed high fat and fish oil diets used in Figure 19.   A student t-test was used to compare n-3 PUFA supplemented mice to mice fed background diets (n=10); (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05……………………….................................................................... 80 Table 8. Infiltrating immune cell values from the mice fed high fat and fish oil diets   used in Figure 20. A student t-test was used to compare n-3 PUFA supplemented   mice to mice fed background diets (n=10); (n=8 MUFA + n-3 PUFA). The   results were considered significant if p<0.05…………………………………………. 84 Table 9. Pro-inflammatory cytokine and chemokine values from mice fed high fat   and fish oil diets used in Figure 21. A student t-test was used to compare   n-3 PUFA supplemented mice to mice fed background diets  xiii   (n=10); (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05…………………………………………………………………………………. 89 Table 10. Anti-inflammatory mediator values from mice fed high fat and fish oil diets   used in Figure 22. A student t-test was used to compare n-3 PUFA   supplemented mice to mice fed background diets (n=10);   (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05……... 95 Table 11. Intestinal FA receptor values from the mice fed high fat and fish oil diets   used in Figure 23. A student t-test was used to compare n-3 PUFA   supplemented mice to mice fed background diets (n=10);   (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05……. 101 Table 12. Serum cytokine and chemokine values from mice fed high fat and fish oil   diets used in Figure 24. A student t-test was used to compare n-3 PUFA   supplemented mice to mice fed background diets (n=10);   (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05……. 106 Table 13. IAP LPS-dephosphorylating values from mice fed high fat and fish oil   diets used in Figure 25. A student t-test was used to compare n-3 PUFA   supplemented mice to mice fed background diets (n=10);   (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05……. 112 Table 14. Total AP activity values from mice fed high fat and fish oil diets used   in Figure 26. A student t-test was used to compare n-3 PUFA   supplemented mice to mice fed background diets (n=10);   (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05……. 114   xiv  List of Figures. Figure 1.IAP and gut homeostasis……………………………………………………………… 12 Figure 2. LPS-dephosphorylation assay mechanism…………………………………………… 27 Figure 3. Total AP assay mechanism…………………………………………………………... 29 Figure 4. All mice had similar food intake, while MUFA fed mice had gained   significantly more weight by day 35………………………………………………… 41 Figure 5. All mice had 100% survival during infectious colitis and showed similar levels   of morbidity…………………………………………………………………….......... 43 Figure 6. Colonic damage during C. rodentium was increased in mice fed n-6 PUFA   and SFA, while MUFA fed mice were protected from damage during   infectious colitis……………………………………………………………………... 46 Figure 7. Mice fed n-6 PUFA and SFA diets had induced colonic immune cell infiltration compared to MUFA fed mice……………………………………………………….. 49 Figure 8. Mice fed SFA diets had increased colitic responses…………………………………. 53 Figure 9. Mice fed SFA diets had increased anti-inflammatory responses that could   be important for resolution of damaging inflammatory responses during   infectious colitis……………………………………………………………………... 57 Figure 10. Mice fed SFA diets had increased FA receptor gene expression before and   during infectious colitis………………………………………………………......... 60 Figure 11. Serum cytokines were increased in mice fed n-6 PUFA during infectious        colitis………………………………………………………………………………… 64 Figure 12. IAP activity was increased in the MUFA fed mice during infectious colitis……….. 66 xv  Figure 13. Mice fed MUFA and SFA diets had increased levels of total AP activity   during infectious colitis……………………………………………………………. 68 Figure 14. Macrophages were not associated with increased IAP activity during   LPS stimulation in vitro……………………………………………………………. 70 Figure 15. Caco-2 epithelial cells have increased IAP activity in the OA group during   LPS stimulation…………………………………………………………………….. 72 Figure 16. The pH was the same in all Caco-2 cell homogenates stimulated with a                    particular FA and LPS…………………………………………………………….... 73 Figure 17. All mice had similar food intake while n-6 PUFA + n-3 PUFA fed mice                   did not gain weight………………………………………………………………….. 76 Figure 18. Mice fed n-6 PUFA + n-3 PUFA had an increase in morbidity and mortality……... 78 Figure 19. Colonic damage during infectious colitis was increased in mice fed                   SFA + n-3 PUFA……………………………………………………………………. 82 Figure 20. Mice fed n-3 PUFA supplemented to a n-6 PUFA diet resulted in impaired   infiltrating immune responses during infectious colitis……………………………. 87 Figure 21. Mice fed n-3 PUFA supplemented to n-6 PUFA resulted in impaired pro-inflammatory responses during infectious colitis………………………………….. 93 Figure 22. Mice fed SFA diets supplemented with n-3 PUFA had decreased   anti-inflammatory mediators during infectious colitis……………………………... 99 Figure 23. There were no significant changes in FA receptors during infectious   colitis in mice fed diets supplemented with n-3 PUFA…………………………... 104 Figure 24. Serum IL-15, a key marker for sepsis was significantly increased in mice   fed n-6 PUFA + n-3 PUFA during infectious colitis……………………………... 110  xvi  Figure 25. LPS-dephosphorylation was increased in the SFA + n-3 PUFA fed   mice during infectious colitis……………………………………………………... 113 Figure 26. Mice were not significantly different in total AP activity during   infectious colitis…………………………………………………………………... 115 Figure 27. Caco-2 epithelial cells had no significant difference in IAP activity   during LPS stimulation…………………………………………………………… 117               xvii  Abbreviations. AA   Arachidonic acid ANOVA   Analysis of variance AF    Animal fat AP    Alkaline phosphatase BSA   Bovine serum albumin Caco-2   Human epithelial colorectal adenocarcinoma cell line CD    Crohn`s Disease cDNA   Complementary DNA CFU   Colony forming units DMEM   Dulbecco’s Modified Eagle Medium DHA   Docosahexaenoic acid DSS   Dextran sodium sulfate Em    Emission EPA   Eicosapentaenoic acid EtOH   Ethanol Ex    Excitation F4/80   Macrophage receptor xviii  FA    Fatty acids FBS   Fetal bovine serum GI    Gastrointestinal H & E   Hematoxylin and eosin stain HFD(s)   High fat diet(s) IAP   Intestinal alkaline phosphatase IBD   Inflammatory Bowel Disease IDT   Integrated DNA technologies IECs   Intestinal epithelial cells IFN   Interferon IL    Interleukin iNOS   Inducible nitric oxide synthase LA    Linoleic acid LB    Luria-Bertani agar broth LPS   Lipopolysaccharide MCP-1   Monocyte Chemoattractant Protein-1 MIQE Minimum information for publication of quantitative real-time  PCR experiments MLN Mesenteric lymph nodes xix  MPO   Myeloperoxidase (expressed in neutrophils). MUFA   Monounsaturated fatty acids MUP   4-Methylumbelliferyl phosphate NCBI   National Centre for Biotechnology Information NFκB   Nuclear factor kappa-light-chain-enhancer of activated B cells NOD-2   Nucleotide-binding oligomerization domain-containing protein 2 OA   Oleic acid PA    Palmitic acid PBS   Phosphate buffered saline PGE2   Prostaglandin E2 PUFA   Polyunsaturated fatty acids qPCR   Quantitative polymerase chain reaction RAW 264.7  Mouse macrophage cell line RT    Room temperature SEM   Standard error of the mean SFA   Saturated fatty acids TLR   Toll-like receptors TJ    Tight junctions xx  TNF   Tumor necrosis factor UC    Ulcerative colitis UDP   Uridine diphosphate nucleotides                xxi  Acknowledgements. My greatest thanks go to my family: Vicki, Jim, Mikaela and Josh for always supporting and encouraging me and for helping me become the person and student I am today, and to my grandparents for being my guardian angels and watching over me.  My thanks and love also go to my boyfriend Brad for his love and support and for taking care of our puppy Kovu on those nights when I needed to be in the lab, for editing my papers and helping me practice my presentations. I also want to thank my best friends: Baillie, Braden, Cynthia and Tyler for their support and helping me de-stress after the long hours with research and papers. I want to thank my supervisor Dr. Deanna Gibson for her encouragement and support throughout my degree and for believing in me in both my undergraduate and graduate program. I also want to thank my committee members: Dr. Andis Klegeris, Dr. Mark Rheault and Dr. Sanjoy Ghosh for their time and advice throughout my graduate degree. To my lab mates: Kirsty Brown, Julianne Barry, Amy Botta, Mehrbod Estaki, Zahra Ahmad, Sandeep Gill, Nishat Tasnim and Brie Matier for their mentorship and friendship. Lastly, I want to thank Ben Dai, our lab technician, who made it possible for my research to be conducted.       xxii  Dedications. To my loving boyfriend, Brad. I cannot expresses how grateful I am for your love, support and for encouraging me to pursue my research.                      xxiii  Chapter 1 Introduction. 1.1 Inflammatory Bowel Disease (IBD). Inflammatory Bowel Disease (IBD) is a broad term which describes chronic inflammatory conditions such as Crohn's disease (CD) and ulcerative colitis (UC). Patients who suffer from IBD experience abdominal pain, urgent/bloody diarrhoea, weight loss and extreme fatigue [1]. UC and CD are both classified as inflammatory diseases; however, they each have their own symptoms, treatments and immune responses. CD is predominantly associated with the terminal ileum, but it can affect any location of the gastrointestinal (GI) tract and produces symptoms that include: diarrhoea, abdominal pain and cramps, anemia, fatigue, loss of appetite and weight loss and swelling in the joints [1,2]. In contrast, UC is localized to the colon and produces symptoms that include: bloody diarrhoea, fever, abdominal pain, cramps, anemia, fatigue and loss of appetite [1,2]. There are approximately 233,000 people in Canada suffering from a form of IBD with approximately 104,000 people suffering from UC with equal prevalence in males and females, and 129,000 suffering from CD with a higher prevalence in females [2]. These diseases cost Canadians $2.8 billion dollars in health care per year [2]. There is currently  no cure and no identified method for preventing IBD [3]; however there are short-term treatments that focus on maintaining remission or relieving symptoms. There are different courses of drug treatment for CD and UC since each manifests with different pathologies [2]. The drugs available for CD are: corticosteroids, immune modifiers, antibiotics, anti-inflammatory drugs such as 5-Aminosalicylates (5-ASA) and biological therapies such as Infliximab, an anti- tumor necrosis factor (TNF-α) [2,4]. If these drugs are unsuccessful, then surgery is required to remove the infected section of colon. The treatment options for UC include: 5-ASA, 5-ASA + VSL#3® (high potency probiotics) [5], immune modifiers, Infliximab [4] and surgery [2]. The most 1  effective and widely used drug against CD and UC is Infliximab which 50% of patients respond to favorably [6]. However this treatment is not suitable for long-term use [7] as it has been associated with an increased risk of opportunistic infections [8] and lymphoma [9]. Therefore, the current therapeutics are not sufficient, and there are no known methods of preventing IBD. The current hypothesis for the etiology of IBD is that there is an inappropriate and consistent activation of the GI tract immune system due to interactions with the microbiota. This over activation of the immune system occurs when the intestinal epithelium and barrier function is damaged or dysfunctional and unable to be repaired [10]. The etiology of IBD is complex and not clear; however, the pathogenesis has been linked to an individual’s genetics [11], has been associated with an altered microbiota known as dysbiosis [12,13], intestinal barrier dysfunction [14], immune [15] and environmental factors [16]. Studies have shown that genes implicated in childhood-onset and adult-onset of IBD overlap, indicating a similar genetic relationship between these two stages of the disease; however UC has a higher environmental component compared to CD [17]. In concordance studies of monozygotic twins show there is a 10-15% rate of UC compared to 30-35% seen in CD [17]. The key genes that are linked to IBD encode for nucleotide-binding oligomerization domain containing 2 (NOD-2), which leads to nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) activation [18], and toll-like receptor 5 (TLR-5), which is activated by bacterial flagellin [19]. The microbiota also plays a role in IBD; it is established that a decrease in biodiversity and abundance of Firmicutes, along with an increase in Gammaproteobacteria (Escherichia coli) is associated with an increased disease state [20].  Since there are many contributing factors driving IBD etiology, it is difficult for drug companies to find one target to create beneficial and effective therapeutics.  Thus, understanding how to prevent IBD in the first place is the premise of our research.  2  1.2 The cell types and immune responses involved in IBD disease pathology. 1.2.1 IBD and the colonic epithelium. The GI tract is a complex organ that consists of five main components: the lumen; location of food antigens and bacteria [21], the mucosa, the submucosa, the muscularis externa and the serosa [22]. The mucosa consists of a protective mucus layer [23], a single epithelial layer covering the outside of the intestinal crypts and loose connective tissues known as the lamina propria [22]. The lamina propria contains capillaries, lymph vessels and immune cells [24]. The submucosa consists of connective tissue and supports the mucosa, while the muscularis externa allows for peristalsis of food, and the serosa acts as a protective outer layer found in many body cavities that lubricates muscles to decrease friction [22]. Within the mucosa are branched invaginations known as crypts, which contain epithelial cells and goblet cells; the bottom or basal layer of the crypts contains the basement membrane, which is the origin of stem cells [25]. Higher in the crypts are progenitor cells that under normal conditions, proliferate and replace the old epithelial cells every 3-4 days [25,26].  All of the cells that compose these layers play unique and synergistic roles in the pathogenesis of IBD. This includes increased infiltration of immune cells such as macrophages [27], neutrophils [28], T cells [29] and increased expression of PGE2 [30], as well as a dysfunctional mucosal surface [31]. 1.2.2 IBD and macrophages. Macrophages are considered important inflammatory cells in IBD disease pathology and are classified into two phenotypes [32]. The first macrophage phenotype is the M1 macrophage, which is pro-inflammatory and uses cytosolic iNOS to create nitric oxide (NO). NO binds with superoxide radicals to create peroxynitrite, this product kills pathogens, though peroxynitrite also damages the tissues [33]. These macrophages are able to present the pathogenic antigen to T 3  cells, simulating them to release pro-inflammatory cytokines [34]. The second phenotype is the M2 macrophage, which is involved in tissue repair and anti-inflammatory cytokine release, such as IL-10 [35], allowing for a decrease in inflammation. There are also resident macrophages, located in the tissues in low concentrations, that are involved in antigen sampling, such as those from food and bacteria [36]. There are higher levels of macrophages present in colonic tissues in chronic UC and CD patients compared to healthy patients [27].  Macrophages are activated by dysbiosis [37] or by food antigens [38] in patients with IBD. It has been shown that the specific type of macrophage, M1 or M2, matters in this disease pathology [34].  M1 are involved in inflammation and thus have a damaging effect during IBD, while M2 help in repairing tissue damage. A group demonstrated that M1 activated macrophages lead to the activation of T cells as described above [34], and are a possible driving force behind IBD [34]. They also showed that if the proportion of M1: M2 is equal, there is a decrease in inflammation [34]. 1.2.3 IBD and neutrophils. Neutrophils are known for their pro-inflammatory effects in IBD; they are a marker for acute bowel inflammation as well as in infection induced colitis [39,40]. Neutrophils reach the surface of the mucosa and release epithelial damaging compounds, such as reactive oxygen species and cytokines. However, it has been shown that neutrophils are important in the early stages of epithelial healing [39].  It has been shown that blocking the transport of neutrophils, or depleting them, leads to an exacerbation in dinitrobenzene sulfonic acid  (DNBS)-induced colitis in rats compared to controls [39].  In chronic conditions neutrophils are also present, indicating their role in both acute and chronic disease pathologies [41]. Once activated, these immune cells release pro-inflammatory cytokines such as TNF-α [42]. These cytokines then stimulate naive CD4+T cells which differentiate into different T cell 4  subsets such as: Th1, Th2, Th17 and T regulatory cells (Treg) [43]. In CD, T-helper cells (Th1) and CD4+T cells (Th17) are responsible for the release of major pro-inflammatory cytokines such as TNF-α, IFN-γ, IL-22 and IL-17 [44]. These cytokines are released to further stimulate immune cells or  promote inflammation by acting directly on the epithelial wall [45]. In contrast, UC is characterized by Th2 immune responses, predominantly through IL-6, IL-1 and TNF-α [46]. IL-13, which is primarily secreted from T cells in the lamina propria, induces epithelial apoptosis and increases the development of ulcer-type lesions due to impaired epithelial healing [47]. 1.2.4 IBD and prostaglandin E2.  Inflammatory markers such as prostaglandin E2 (PGE2), which is one of the primary cyclooxygenase (COX) products of arachidonic acid (AA), are present in IBD [48]. PGE2 has important functions in inflammation, gastric mucosal integrity and immune modulation. PGE2 alters secretory and absorptive functions of immune cells and impairs cell mediated immunity [49]. The normal concentration of PGE2 is approximately 10 nM, but is increased 10-100 fold in inflamed intestinal mucosal [50]. Studies have also shown that high levels of PGE2 are expressed on dendritic cells and stimulate these cells to release a pro-inflammatory cytokine IL-23, which stimulates further downstream inflammatory responses [30]. 1.2.5 IBD and T regulatory cells. Macrophages, neutrophils and PGE2 markers are primarily pro-inflammatory, whereas Treg cells maintain homeostasis and tolerance to food antigens, commensal and pathogenic bacteria in the GI tract [51].  Treg cells create a homeostatic balance by initiating equilibrium between protective immune function and tolerance to self-antigens and commensal bacteria. A group showed that there is a decrease in Treg cells and an increase in Th17 cells in the peripheral 5  blood of IBD patients [29].  Functioning Treg cells are characterized by the expression of the transcription factor Foxp3 and show a CD4+ CD25 phenotype in humans [52]. These Treg cells have been shown to be decreased during active disease and increased during times of remission [52].  Depletion of these cells has been implemented in autoimmunity, including IBD, in both mice and humans [53]. A recent study showed that Treg dysfunction in IBD patients is associated with increased colonic mucosa apoptosis and can be reversed using anti-TNF-α therapy [54]. 1.2.6 IBD and intestinal epithelial cells.  While the immune cells are well known for their effects in IBD, it has become clear over the past decade that intestinal epithelial cells (IECs) also play an active role in IBD. This is because stimulation of toll-like receptors (TLRs) leads to immune responses that protect against chronic and damaging inflammation [55].  IECs form a tenuous single layer of cells joined together through tight junctions (TJ) and are critical for maintaining GI homeostasis by limiting the exposure to luminal bacteria and food antigens [21]. A specialized IEC type, known as goblet cells, are responsible for the continual secretion of mucins, which together form the mucus layer located on the outer border of the lumen [56]. This layer is the first line of defense against bacterial and food antigens [21,56]. The IEC is also called a non-professional antigen presenting system as it processes and presents antigens to the intestinal immune system, in particular, dendritic cells [57]. The immune system at the same time is responsible for the growth and differentiation of the IEC and therefore, there is a bi-direction cross-talk that occurs within the GI tract [57]. IBD diseases have been associated with increased IEC permeability as a result of  TJ disruption, as well as dysfunction and reduction of the goblet cells which causes a decrease in the protective mucus layer [58]. IECs are thus important factors in GI health. 6  The combination of IEC dysfunction through loss of TJ and/or the reduction of goblet cells allows for the interaction between luminal antigens and the immune system. This causes an over activation of the immune response, leading to the inflammatory state present in IBD. As mentioned earlier, each cell type plays a critical role in IBD and therefore targeting only one is not appropriate for solving the IBD disease burden. Thus, our focus should be on prevention of IBD and one way to accomplish this is through the regulation of diet. 1.3 Increased risk of IBD with increased consumption of fatty acid diets. 1.3.1 Polyunsaturated fatty acids.  Diet is an important environmental factor to consider in the pathogenesis of IBD.  While many IBD patients assert that certain diets can improve or exacerbate symptoms [59,60], few clinical studies have found a single nutrient as being detrimental or protective against the disease. Epidemiology studies identified polyunsaturated fatty acids (PUFA) as a risk factor for developing disease. In particular, diets low in n-3 PUFA and high in n-6 PUFA appear to increase incidence of UC [61].  Prospective cohort studies conducted for 5 years with an n= 260,686 showed that the only diet that was positively associated with UC risk was PUFA consumption. Retrospective case-control studies found pre-illness levels in patients consuming diets rich in n-6 PUFA [62]. Studies conducted using mice have also shown n-6 PUFA to increase intestinal muscosal damage [63] and colitis [64]. Linoleic acid (LA) is found in cellular lipids and is a precursor for the production of arachidonic acid (AA) [48]. AA is located in cellular membranes in the form of phospholipids and is cleaved from these membranes by phospholipase A2; the free form of AA is the main substrate for cyclooxygenase enzymes [48,65]. In inflammatory cells there is a higher proportion of AA compared to other 20-carbon molecules and therefore, AA is the main substrate used for the synthesis of eicosanoids such as 7  PGE2 [65]. PGE2 is responsible for inducing many pro-inflammatory responses, such as the up-regulation of IL-6 by macrophages [65]. It is believed that this pathway leads to the inflammation that is seen in patients suffering from IBD [66], while n-3 PUFA-derived eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) cause anti-inflammatory effects by blocking the production of eicosanoids [67]. In the last 30 years our consumption of n-6 PUFA has risen by 54% [68] due to our increased consumption of vegetable oils such as corn, soy and sunflower oils, which are rich in n-6 PUFA [69]. The sources of n-3 PUFAs are fish oils such as herring, tuna, salmon and cod as well as fish oil capsules. Historically, we consumed twice as much n-6 PUFA as n-3 PUFA;  however, today we consume as many as five to ten times n-6 PUFA as n-3 PUFA [70]. A diet high in n-6 PUFA increases susceptibility to dextran sodium sulfate (DSS)-induced inflammation and increased macrophage infiltration [71].   1.3.2 Monounsaturated fatty acids.  The Mediterranean diet, high in olive oil,  is popularized to have increased health benefits, help control weight [72] and decrease diseases such as metabolic syndrome [73].  However, the specific effects in the gut are relatively understudied. One study has shown that consumption of monounsaturated fatty acids (MUFA) rich in olive oil are anti-inflammatory in mice suffering from DSS-induced colitis [74]. Olive oil has also been shown to reduce colonic damage in rats induced by DSS compared to untreated groups [75]. These studies suggest that MUFAs may be beneficial during inflammatory diseases, but confirmatory studies using various models of colitis are needed.    8  1.3.3 Saturated fatty acids.  The effects of saturated fatty acids (SFA) such as animal fat (AF) are of interest because saturated fats have long been demonized as “bad fats”. While studies that show effects in the intestine are lacking, at least one study has indeed shown that AF results in conjugation of hepatic bile acids, increasing organic sulphur, which is utilized by Bilophila wadsworthia, a pathobiont. This organism promotes pro-inflammatory Th1 responses leading to increased spontaneous colitis in IL-10 knockout mice (KO) [76]. Clinical studies showed that 1 in 5 UC patients benefited when AF was removed from their diets [77].  However, it has also been shown that components of AF, such as butyric acid, lead to suppressed inflammatory responses generated by the interaction of adipocytes and macrophages [78]. A research group showed that during DSS-colitis, butryric acid stimulated a decrease in mucosal permeability and therefore, has been considered in the therapy of IBD in the colon [79]. AF is considered a short chain fatty acid; during colitis it is responsible for repairing colonic damage [80]. A prospective cohort study revealed no association between IBD development and dairy consumption [81]. Thus, clarification of the harmful or beneficial effects of saturated fats in the intestine is required. 1.3.4 n-3 PUFA.  Scientists have hypothesized that n-3 PUFAs, being potent anti-inflammatory lipids, would be beneficial to IBD patients[82]. However, studies have shown that n-3 PUFA supplementations to IBD patients have conflicting results. In randomized placebo-controlled trials involving CD patients (n=1039), the administration of enteric fish oil capsules placed patients in remission for one year compared to patients given a placebo [83]. On the other hand, two randomized, double blind, placebo-controlled studies conducted all over the world showed (n=375) that 4 g/day of n-3 PUFA supplementation from capsules consisting of DHA and EPA 9  was not effective in preventing a CD relapse [84]. UC patient studies also revealed that administration of fish oil liquid or capsules showed no difference in patient relapse compared to control groups [83]. Murine models further demonstrate beneficial results of n-3 PUFA, as it decreases spontaneous colitis in IL-10 KO mice [85] and protects fat-1 mice against DSS colitis [86]. In contrast to these findings, n-3 PUFA has been shown to exacerbate colitis in mice [87], increase intestinal permeability in piglets [88] and increase colitis susceptibility in maternal rats [89]. Similar to other dietary groups, there are conflicting results for n-3 PUFA and IBD and thus more clarification is needed to better understand the effects of fish oil consumption. 1.4 Intestinal alkaline phosphatase: role in gut health and dietary regulation. 1.4.1 Intestinal alkaline phosphatase: background.  Alkaline phosphatases (AP) are enzymes responsible for the breakdown of monophosphate esters by removing their phosphate groups. APs are grouped into two classes: the tissue non-specific alkaline phosphatases (TNAP) and tissue specific isozymes. TNAP are expressed in the bone, liver and kidney, while tissue specific isozymes include: germ cell alkaline phosphatase, placental alkaline phosphatase (PLAP) and intestinal alkaline phosphatase (IAP) [90].  IAP functions in alkaline conditions and has optimal function at a pH of 9.7 [91]. IAP is expressed by enterocytes in the duodenum [90], expressed to a lesser extent in the jejunum, ileum and colon [92,93], and is present but inactive in the stomach.  Luminal vesicles secreted by enterocytes on the brush border of the microvilli have a high concentration of IAP molecules. IAP is mostly membrane bound; however, small amounts of IAP are also released bidirectionally into the lumen and into the blood [94]. 10  The IAP enzyme in humans is encoded by the ALPI gene [95] , while the two isozymes identified in mice, duodenal IAP (dIAP) and global IAP (gIAP), are encoded by the Akp3 and Akp6 genes, respectively [96,97]. In general, most murine studies focus on IAP as a whole and as a result the specific function of each isozyme is poorly understood. 1.4.2 IAP and infection.  IAP plays a crucial role in preventing sepsis against enteric infection by dephosphorylating the endotoxin lipid A moiety of LPS (lipopolysaccharides) [98].  IAP is a mucosal defense factor that limits bacterial translocation across the mucosal barrier [99,100]. Administration of bovine IAP prevents translocation of bacteria in mice infected with Salmonella enterica serovar Typhimurium [101]. Our research group recently explored IAP’s role in survival during enteric infection[102]. Various high fat diets (HFD) were compared and it was found that n-6 PUFA had exacerbated colitic responses and increased IAP expression and activity, which protected the mice against sepsis during infection with Citrobacter rodentium [102]. In contrast, diets supplemented with n-3 PUFA had impaired IAP activity, resulting in increased sepsis associated mortality during infection [102]. Beyond IAP’s local activity at the gut mucosa, IAP is secreted into the bloodstream or into the intestinal lumen. This increases IAP’s action against both local and systemic infections [101]. IAP activity is high in stool samples during infection [99], suggesting a potential use as a marker of infection. Figure 1 below demonstrates the role of IAP during infection in the colon.  11   Figure 1.IAP and gut homeostasis. IAP secreted by the enterocytes has necessary physiological functions in and around the intestine. IAP dephosphorylates both lumenal and circulating LPS located on the cell wall of gram-negative bacteria, preventing LPS from activating the immune system. Preliminary work from our lab has shown IAP is expressed on infiltrated immunocytes in the lamina propria. IAP is also crucial in preventing the movement of bacteria across the epithelium layer, preventing downstream activation of immunocytes and the resulting inflammatory responses [103].  1.4.3 IAP regulates inflammation.  IAP is also responsible for the dephosphorylation of other pro-inflammatory ligands such as uridine diphosphate (UDP) nucleotides, a component released during the destruction of cells [104,105]; flagellin, a protein in bacterial flagellum which is used for locomotion [106] and unmethylated cytosine-guanosine dinucleotides, a component of bacterial DNA [107]. These 12  microbe-associated molecular patterns or ligands activate TLR 2, 3, 5 and 9 on immune and epithelial cells [108] inducing further downstream inflammatory responses. IAP gene expression and activity can also be regulated by inflammation, though the exact mechanism is not well understood [109]. A group showed that two pro-inflammatory cytokines, interleukin (IL)-1β and TNF-α, which are known cytokines involved in IBD, are involved in reducing IAP gene expression[110]. This subsequently alters the function and health of the intestinal epithelium. More research is required to understand how inflammatory mediators regulate IAP expression and activity. 1.4.4 IAP and chronic inflammatory disease.  Chronic inflammatory diseases such as IBD have irregular IAP expression. For example, patients have reduced IAP gene expression with a decrease in their inflamed tissues, potentially as a result of damage to the epithelium. Oral administration of IAP during murine colitis significantly reduced colonic inflammation [93] as evident by a decreased mRNA expression of key pro-inflammatory responses, iNOS and TNF-α. It has been reported that pH levels are significantly reduced in UC patients [111]. IAP remains functional despite these acidic conditions; however, the mechanisms are not currently understood. One study using chicken IAP showed that the enzyme is inactivated at pH 6, but was reactivated at a pH 4.5 as a result of the addition of Zn2+ ions [112].  Increased levels of UDP has been directly associated with intestinal inflammation, which is another factor important in IBD [104]. These extracellular nucleotides are released during cellular damage and death [105] that occurs during IBD, and bind to receptors on epithelial cells, macrophages and infiltrating T cells. By dephosphorylating UDP, IAP blocks the subsequent inflammatory responses [104].  13  1.4.5 Connection between IAP and food.  Diet has been reported as an important factor in many pathological conditions such as IBD, metabolic syndrome, diabetes and infection. IAP is regulated by various dietary macronutrients as well as fasting. Mice that fasted for two days showed a significant decrease in LPS-dephosphorylating activity as a result of a reduction in IAP expression, when compared to non-fasted mice [99]. This is important because starvation in mice might lead to IAP downregulation, and therefore an increased susceptibility to pathogenic infection [99]. Interestingly, they showed that the re-introduction of food resulted in the recovery of IAP expression. During high fat feedings, the rate-limiting step of fatty acid (FA) transport across the plasma membrane into the enterocytes involves IAP [97,113]. Another study showed that gIAP, but not dIAP, protein expression significantly increased in response to an HFD [96]. HFD increases the uptake of FA by enterocytes through a gIAP-dependent mechanism. In contrast, another study using a HFD consisting of high SFA caused increased TLR 4 activation and reduced IAP activity in diet-induced obese prone rats [114]. Therefore, increased consumption of HFD induces an inflammatory response and results in downregulation of IAP expression. The differences between these two studies suggest that the amount of fat in a diet influences IAP regulation in specific ways. Further studies are required to investigate the specific effects of SFA on IAP. I previously showed that mice fed diets high in n-6 PUFA (20% w/w) have increased IAP expression in the submucosae [102]. In an attempt to reduce colitic responses, n-3 PUFA was supplemented to an n-6 PUFA diet; this resulted in decreased IAP expression and activity [102]. These mice also suffered from increased sepsis-associated mortality. Taken together, these findings suggest that the particular fat and dietary FA can alter IAP expression and activity. Collectively, these results suggest that there is a complex interplay between diet and IAP activity, and that customized diets may be beneficial in regulating IAP levels. 14  1.5 Murine colitis models.  Animal models are critical for providing insight into human disease and allow for the creation of new ideas and research opportunities with the goal of finding cures. Understanding both environmental and genetic factors that contribute to IBD would not be possible without these animal models, and with the increased prevalence of IBD, these models are fundamental for identifying factors that contribute to the disease pathology.  There are currently many rodent models used to study IBD including:  1) Bacterial induced: C. rodentium [115],[116]  2) Chemical induced: DSS-induced murine colitis and 3) Spontaneous/genetic: Dominant-negative N-cadherin transgenic mice/keratin 8−/− mice; Inhibitor of κB kinase-gamma (NFκB essential modifier)/inhibitor of κB kinase-alpha/beta deficiency in intestinal epithelial cells;  senescence-accelerated prone  mice, signal transducer and activator of transcription-3(STAT3) deficiency in myeloid cells; A20 deficient mice, TNFΔARE mice; CD45RBHi transfer model; STAT4 transgenic mice, IL-10/CRF2-4 deficient mice and T cell receptor-α chain−/− mice [117]. Of these models for studying IBD, the most widely used are DSS-induced colitis [118] and C. rodentium induced colitis [119]. This project utilized C. rodentium to study dietary effects on host immunity and the contributing role of IAP. 1.6 C. rodentium induced colitis.   C. rodentium is a Gram-negative bacterium, which is a natural mouse pathogen that causes attaching and effacing lesions [120] similar to enteropathogenic Escherichia coli in humans [121]. This model has traditionally been used to study intestinal inflammatory responses in the context of infection, but also as a UC model since it gives similar pathologies as UC. This model produces consistent and reproducible intestinal inflammation in the distal colon that lasts 21 days with peak damage from 7-10 days post-infection in C57BL/6 mice. The infection 15  produces Th1 [121] and Th17 responses [122]. The Th1 response leads to an increase in IL-12, IFN-γ, TNF-α in the mucosa, and an increase in epithelial cell mitogen keratinocyte growth factor, while Th17 cells produce IL-17a (IL-17), IL-17F, IL-21 and IL-22 [123].  Tissues from mice show an increase in barrier disruption leading to infiltration of macrophages, neutrophils, T cells and natural killer cells as well as mucodepletion, ulceration, bleeding, goblet cell depletion and hyperplasia [124]. These responses are partially driven by TLRs which have a crucial role in innate cellular immunity, colonic homeostasis and mucosal integrity [55]. Gram-negative bacteria, such as C. rodentium, possess microbial ligands such as LPS that interact predominantly with TLR4, which through a number of complex reactions activates NFκB. The result of activating NFκB is an increased production of pro-inflammatory cytokines and chemokines [55]. When infected with C. rodentium, TLR4 from immune cells promoted pro-inflammatory induced damage, whereas TLR2 expressed on IECs maintained mucosal integrity during colitis [55,125]. Since the C. rodentium model has been well characterized, this makes it an accessible model for us to analyze the effects of dietary oils on intestinal immunity and IAP functionality. 1.7 Cell culture models 1.7.1 Caco-2 (human epithelial colorectal adenocarcinoma cell line).  Caco-2 cells are human epithelial colorectal adenocarcinoma cells derived from the large intestine [126]. However, when cultured in a specific manner the cell’s phenotype and function resemble the enterocytes of the small intestine. Caco-2 cells are used to study the epithelium of the gut because they form a monolayer of cells through spontaneous differentiation [127].The monolayer is composed of tight junctions and enzymes present in the small intestine, this includes IAP and digestive enzymes. Caco-2 cells have a doubling time of 32 hours and require 16  monitoring to determine when a confluent monolayer is created [128]. Caco-2 cells are the most widely used epithelial cell line because of their reliable and reproducible reactions to diet and LPS stimulation.  1.7.2 RAW 264.7 (mouse leukaemic monocyte macrophage cell line).   The RAW 264.7 cells are murine leukaemic monocyte macrophages derived from the blood of BALB/c mice (albino, laboratory-bred strain of the house mouse) [129]. RAW 264.7 cells are an adherent cell type with a doubling time of 15 hours, which yields a 3-fold increase in cells per day [130]. The cells are sensitive and require constant monitoring as they rapidly reach 80% confluency, potentially within 24 hours depending on the amount of starting cells. When working with the RAW 264.7 cells it is important to use proper aseptic technique as macrophages are sensitive to the endotoxins from Gram-negative bacteria [131]. LPS stimulated macrophages trigger the release of pro-inflammatory cytokines and chemokines and therefore are necessary for studying colitic responses in vitro [132]. As a result of the RAW 264.7 sensitivity to LPS it is an effective model for studying IAP, diet and LPS stimulation to allow for comparisons between the in vivo and in vitro models during colitis. 1.8 Research overview and chapter hypotheses.   I previously showed that diets high in n-6 PUFA had exacerbated intestinal damage, increased infiltration of macrophages, neutrophils, PGE2 expression and induction of cytokine responses. In contrast, the mice fed n-6 PUFA supplemented with n-3 PUFA showed reduced immune cell infiltration and had reduced cytokine induction during colitis[102]. However, these mice suffered from increased mortality due to increased sepsis serum markers such as IL-15. Associated with sepsis were a decreased expression of IAP and a resulting decreased dephosphorylation of LPS. The n-6 PUFA diets exacerbated immune responses, which also 17  included increased infiltration of IAP expressing cells; this resulted in increased LPS detoxification supporting survival during infection. This was in contrast to diets supplemented with fish oil, which did result in decreased inflammation as well as decreased IAP expression and activity resulting in mice dying from sepsis [102]. In light of these findings, I wanted to further investigate other diets such as MUFA and SFA and the effects of supplementing these diets with n-3 PUFA before and during colitis. The main hypothesis for chapter 3 is that MUFA diets have reduced colonic inflammation in vivo and in vitro during colitis. The main hypothesis for chapter 4 is that fish oil supplemented diets protect mice against increased colitic responses.   .           18  Chapter 2: Experimental Techniques. 2.1 Mice.  C57BL/6 female mice (Jackson Laboratories; Bar Harbor, Maine) were housed in specific pathogen-free conditions at the Center for Disease Modeling at the University of British Columbia (UBC) in Vancouver, BC. The mice were housed and caged in temperature controlled (22±2°C) rooms with a12hr light/dark cycles with free access to irradiated water and food. The protocols used were approved by the UBC’s Animal Care Committee and in direct accordance with guidelines drafted by the Canadian Council on the Use of Laboratory Animals. 2.2 Post-natal diet models.  Female offspring were weaned at 4 weeks of age onto isocaloric, isonitrogenous HFDs with 40% of energy from fats. HFDs containing 20% (w/w) of various oils were prepared by blending the particular oil with rodent basal diet mix from (Harlan Tekland®, Mississauga, Ontario) (Table 1), these diets were fed for 5 weeks. The Harlan Tekland® catalogue numbers associated with each diet are presented in Table 3.  The diet oil components included: corn oil (high n-6 PUFA) (Harlan Tekland®), corn oil + fish oil (n-3 PUFA supplemented diet) (Harlan Tekland®), olive oil (MUFA) (Harlan Tekland®), olive oil + fish oil (MUFA supplemented diet) (Harlan Tekland®), animal fat (SFA) (Harlan Tekland®) and animal fat + fish oil (SFA supplemented diet) (Harlan Tekland®). The FA used in preparing the above HFD is shown in Table 2. For n-3 PUFA supplementation, the guidelines outlined by the American Heart Association were followed, which states that 0.5-1.8 g of long chain n-3 PUFAs per day is required to offset high n-6 PUFA diets as previously reported [102]. DHA + EPA are 34% of fish oil by weight; 0.5 g of EPA + DHA is available in 1.5 g of fish oil. As 18 g of n-6 PUFA is present in 30 g of corn oil with the addition of 1% fish oil (w/w) with either: 19% (w/w) corn oil, 19  19% (w/w) olive oil, 19% (w/w) animal fat.  Food and water were provided ad libitum. Food intake was measured by weighing the initial amount of food given to each cage of mice subtracted by the amount of food remaining in each cage after the mice had consumed their particular diet. This was conducted every 3-4 days throughout the experiment. The mice were also weighed once a week for the duration of the 5 weeks of feeding to obtain pre-infection body weights of each mouse. Table 1. Composition of each HFD fed to mice.          Table 2. FA present in the HFD fed to mice. FA Corn Oil (%) Soybean Oil (%) Olive Oil (%) Milk Fat (%) Fish Oil (%) Saturated FA 11.5 13.8 12.7 28.7 31.4 Linoleic Acid 55.7 55.4 11.5 5.75 1.6 Arachidonic Acid 0 0 0.490 0.140 2.5 Alpha Linolenic Acid 1.33 7.7 1.24 0.830 0.3 Oleic Acid 26.1 22.4 66.5 22.1 22.1 DHA + EPA 0 0 0 0 34      Formula g/kg Casein 240.0 DL-Methionine 3.6 Corn Starch 75.0 Sucrose 298.7 Cellulose 50.0 Calcium carbonate 3.6 Mineral mix 42.0 Vitamin mix 12.0 Soybean oil 10.0 20  Table 3. Harlan Tekland® catalogue numbers associated with the HFD fed to mice. HFD Catalogue Numbers Corn oil TD.120025 Corn oil + Fish oil TD. 120025 RX 892555 Olive oil TD.120023 Olive oil + Fish oil TD. 130129 Animal Fat TD.120021 Animal Fat + Fish oil TD.120024 Basal Mix TD.88232    2.3 C. rodentium-induced infection.    Mice were infected by oral gavage using 0.1 mL of Luria-Bertani agar broth (LB) and 2.5 x 108 colony forming units of C. rodentium (DBS100). These mice were monitored throughout the 10 day course of infection for mortality/morbidity and were euthanized if they lost more than 20% of their initial body weight, or showed other signs of extreme distress. Survival data is presented as percentage of the initial mice still surviving at each time point and body weight data is presented as percentage of the initial body weight before infection. 2.4 Clinical scores of mice during C. rodentium infection.   Mice were examined for the 10 day course of infection and the following was recorded: activity, posture, coat, weight loss and hydration. The activity of the mice was analyzed by monitory their movement in the cage and the interactions with their cage mates. Posture was analyzed by monitoring the curvature of the spine of mice. The coat appearance was measured by monitoring the appearance; this included the color and texture. Weight loss was monitored by weighing the mice each day during the experiment. Hydration was monitored by analyzing the amount of water consumed by each mouse and the level of piloerection, a sign of dehydration.  The mice were scored on a scale from 1-5 as shown in Table 4. A “1” indicated that there was no 21  clinical damage, a “2” indicated mild damage, a “3” indicated moderate damage, a “4” indicated high damage and a “5” indicate extreme distress (critical). If any of the following conditions occurred the mice were considered at humane endpoint: if there was a score of 5 in a single category and if there was a score of 15 or greater before the end of the day.                     22  Table 4. Clinical scoring used to analyze mice during C. rodentium infection.   Clinical Score Categories Clinical Score Score =1 Score =2  Score =3  Score = 4 Score =5 Activity No change in activity compared to uninfected mice. Low change in activity compared to uninfected mice. Medium change in activity compared to uninfected mice. High change in activity compared to uninfected mice Critical change in activity compared to uninfected mice. Posture No change in posture compared to uninfected mice. Low change in posture compared to uninfected mice. Medium change in posture compared to uninfected mice. High change in posture compared to uninfected mice Critical change in posture compared to uninfected mice. Coat No change in coat appearance compared to uninfected mice. Low change in coat appearance compared to uninfected mice. Medium change in coat appearance compared to uninfected mice. High change in coat appearance compared to uninfected mice Critical change in coat appearance compared to uninfected mice. Weight Loss No change in weight compared to uninfected mice. Low change in weight compared to uninfected mice. Medium change in weight compared to uninfected mice. High change in weight compared to uninfected mice Critical change in weight compared to uninfected mice. Hydration No change in hydration compared to uninfected mice. Low change in hydration compared to uninfected mice. Medium change in hydration compared to uninfected mice. High change in hydration compared to uninfected mice Critical change in hydration compared to uninfected mice.   23  2.5 Histopathology scores: Identifying colon damage during C. rodentium infection.  Paraffin-embedded colon cross sections were stained using hematoxylin and eosin stain (H & E) and damage scores were measured. 4-5 colon sections were analysed at 1000x magnification for all factors except goblet cell depletion, which used 6000x magnification and hyperplasia 2000x. The histopathology scores were determined as follows: (0=no change, 1=<10%, 2= 10-40%, 3= >40%); hyperplasia (0=<control, 1=1-50% of control, 2=51-100% of control, 3=≥101% of control); epithelial integrity (0=control,1=1-10 epithelial cells shedding/crypt, 2=>10 epithelial cells shedding/crypt, 3=ulceration and 4=crypt destruction); immune cell infiltration (0=<21, 1=22-43, 2=44-86, 3= 87-217+) and goblet cell depletion (0>50, 1=25-50, 2= 10-25 and 3=<10). The infected samples were compared to uninfected samples to determine the colon damage present for each diet group. The scores for damage were determined by three blinded scorers. 2.6 Immunofluorescence staining: Location and co-localization of immune cells and IAP in the colon.  Paraffin embedded colon cross sections were washed twice with xylene (VWR® International, Edmonton, Alberta), then rehydrated with an ethanol gradient of 100%-70% with a final wash of dH20. Slides were then placed in phosphate buffered saline (PBS) solution. The cross sections were incubated with trypsin 50 μL/tissue section (1 mg/mL)(Sigma®, St. Louis, MO) for 30 min at 37oC then blocked with 50 μL/ tissue section using 5% bovine serum albumin (BSA)(Sigma®) for 20 minutes at room temperature (RT). Slides were incubated with 50 μL of desired primary antibody with a concentration for each antibody of (2 mg/mL) and 0.05 mg/mL of BSA using a dilution of 1:50. The solution was one part antibody and 50 parts 5% BSA. The slides were then placed in the 4 oC fridge overnight. The following primary antibodies were 24  used: rabbit polyclonal antibody-1 raised against myeloperoxidase (Neomarkers, Fremont, California) to examine neutrophils; rat monoclonal antibody raised against F4/80 (Cedarlane®, Burlington, Ontario) to examine macrophages; rabbit polyclonal antibody raised against  PGE2 (Abcam®, Toronto, Ontario); and rabbit polyclonal antibody raised against IAP (Abcam®). The slides were then washed with PBS and incubated with the following secondary antibodies, using 50 μL for each secondary with a starting concentration of 2 mg/mL for goat anti-rabbit IgG AlexaFluor®-conjugated 594-red antibody (Invitrogen™, Burlington, Ontario) or goat anti-rat IgG Alexafluor® 488-green labelled antibody (Santa Cruz®, Dallas, Texas) for 1 hour in a dark isolated container. After incubation the slides were again washed with PBS and mounted using 20 μL fluoroshield™ with 4',6-diamidino-2-phenylindole (Sigma®). The slides were observed using an Olympus® IX81 inverted microscope, analyzed using the MetaMorph® software and counted blindly. 2.7 Bradford Protein Assay: To determine protein concentration for enzyme assays.  25 mg of frozen tissue per treatment were cut and placed into a 2.0 mL homogenization tube. Tissues were homogenized in 500 μL of radioimmunoprecipitation assay homogenization buffer [(1% Triton™-X 100(Sigma®), 0.5% sodium deoxycholate (Sigma®), 0.1% sodium dodecyl sulfate (Sigma®), 150 mM sodium chloride (Sigma®) and 50 mM Tris (AMRESCO®, Solon, Ohio) pH 8.0] and 5 μL protease inhibitor cocktail (abm®, Richmond, British Colmbia), then homogenized at 30 Hz twice for 2 minutes using the Retsch® MM400 homogenizer. The mixture was then centrifuged at 1610 xg for 5 min; the supernatant was collected and placed into a new 2.0 mL tube. The resultant supernatant was used to determine the protein concentration and used in subsequent assays. The protein concentrations were determined using a Bradford assay, and a standard curve created using stock solution of 1 mg/mL BSA (Sigma®).  There were eight different standards created including: 0,0.05,0.1,0.2,0.3,0.4,0.5 and 0.6 mg/uL of BSA.  25  Standards were plated using 10 μL in triplicates and samples were plated in duplicate. Protein assay reagent (Bio-Rad, Mississauga, Ontario) was prepared using a 1:5 dilution and 200 μL were placed on all samples and standards. These plates were left at RT for 10 minutes then absorbance was read at 595 nm using Sunrise microplate reader to determine the absorbance values, which were then used to plot a standard curve and determine the protein concentrations. 2.8 LPS assay: To determine LPS dephosphorylating activity.   To measure LPS dephosphorylating activity, a protocol was produced from the work described by a previous group [99]. 15 μL of each homogenized tissue sample was added in duplicates directly to the 96 well plate, followed by 125 μL of double distilled water. Next 20 μL of the 5 mg/mL solution of LPS taken from E. coli 055:B5 LPS (Sigma®) was added to the lysate and left for two hours at RT. 40 μL of malachite green solution [0.01% malachite green, (Sigma®), 16% sulfuric acid (Fisher, Ottawa, Ontario), 1.5% ammonium molybdate (Sigma®) and 0.18% Tween®-20 (Sigma®)] was made according to detail from a previous group [133], and placed on the lysate for 10 min. Controls were created in triplicate and  consisted of: 140 μL of water, 20 μL of LPS and 40 μL of malachite green solution. The absorbance values for the controls were used to calculate the final values. Activity was determined from the expressed spectrophotometric readings taken at an absorbance of 620 nm using the Sunrise® microplate reader. Figure 2 below shows the mechanism of the assay.     26     Figure 2. LPS-dephosphorylation assay mechanism. The above Figure demonstrates how LPS on Gram-negative bacteria is dephosphorylated by IAP in step 1. The two phosphates that are removed in step 2 are then able to bind with ammonium molybdate in step 4. The resulting compound formed from the free phosphate and ammonium molybdate binds with malachite green in step 5 to produces a green solution that is measured at a wavelength of 620nm. The assay therefore is measuring the amount of phosphate that is free in solution to determine the activity of IAP.     27   2.9 AP assay: Identify total AP activity in infected and uninfected conditions.  Alkaline phosphatase activity fluorometric assay kit (BioVision, Milpitas, California) was used to determine AP activity. Lysate from the LPS assay was also used for this assay. To create a standard curve the 4-methylumbelliferyl phosphate (MUP) substrate (50 μM) was used to create the following concentrations 0, 0.1, 0.2, 0.3, 0.4 and 0.5nM. In triplicate 0, 2,4,6,8 and 10 μL of 50 μM MUP substrate was then added and made up to 120 μL with assay buffer. Next, 10 μL of sample was added in triplicate to a 96 well plate, with the first two wells for the assay and the last one for the background control. 100 μL of assay buffer was added to all sample wells to bring the volume to 110 μL. In the background control wells 20 μL of stop solution (aqueous K2HPO4) was added to inhibit AP activity. 20 μL of 0.5 mM MUP substrate was added to all wells containing samples and background controls. Plates were protected from light using tinfoil and incubated at 25oC for 30 min. Next 20 μL of stop solution was added to all wells except the background controls. Fluorescence intensity at excitation/emission (Ex/Em) 365/340 nm was measured using the GloMax® Multi Plus Detection System (Model# E9032, Promega, Madison, Wisconsin); background controls were taken into consideration for the final calculations. Figure 3 demonstrates the mechanism for the total AP assay.    28    Figure 3. Total AP assay mechanism. In step 1 the alkaline phosphatase (AP) in the tissue homogenate binds with MUP, a known substrate for AP. This interaction allows MUP to be dephosphorylated, producing 4-methylumbelliferone. This colorless compound can be measured at Ex/Em 360/440 nm (UV), allowing for AP activity to be measured for each sample. eIAP is the epithelial bound IAP while sIAP is the secreted IAP found in the submucosae.       29  2.10 Quantitative Polymerase Chain Reaction (qPCR): Determining expression of cytokine genes. 2.10.1 mRNA extraction from colon tissues. Colon tissues were stored in RNAlater® (QIAGEN, Toronto, Ontario) prior to homogenization. Approximately 1 mm length of colon was placed in a 2.0 mL homogenization tube with a sterile metal bead then homogenized at 30 Hz twice for 2 minutes using the Retsch® MM400 homogenizer in a solution with lysis buffer and β-mercaptoethanol (Sigma®). RNeasy® fibrous tissue mini kit (QIAGEN) was used to extract the RNA according to manufacturer’s instructions. These samples were run on a nanodrop (Thermo Scientific, Pittsburgh, Philadelphia) to determine RNA concentration. 2.10.2 Complimentary DNA synthesis from mRNA. Complimentary DNA (cDNA) was synthesized using the iScript™ cDNA synthesis kit (Bio-Rad). cDNA was synthesized by mixing 1000 ng of mRNA, 4 μL of iScript™ reaction mixture, 1 μL of iScript™ reverse transcriptase enzyme and made up to 20 μL using nuclease-free water. Each 0.5 mL tube was briefly vortexed, centrifuged and placed in a thermocycler (Model # S1000; Bio-Rad) under the following protocol: 5 min at 25°C, 30 min at 42°C, 5 min at 85°C and held at 4°C. 180 μL of nuclease-free water was added to each sample to make a 1:10 dilution, and then stored at -20ºC for further use in gene expression experiments. 2.10.3 Primer design. Primers were created using the Integrated DNA Technologies® (IDT) [134]. The specific primer sequences were obtained from National Centre for Biotechnology Information (NCBI) site. The primer nucleotide sequence was copied from the gene creation tool and analyzed using 30  the IDT® site. Specific primers were created and various parameters were analyzed including: proper annealing temperatures, self- dimers, heterodimers and hairpins. These parameters were determined acceptable based on the Minimum Information for Publication of Quantitative Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines [135]. 2.10.4 Balanced PUFA: The qPCR inter-run calibrator. In the qPCR experiments the inter-run calibrator used to normalize each plate was from mice fed a balanced PUFA diet which were later infected with C. rodentium. The mice fed balanced PUFA were used in preliminary experiments before the start of the research presented in this thesis and therefore are not present in the results section.  The balanced PUFA diet was composed of an equal ratio of n-6 PUFA: n-3 PUFA. The main dietary oil in the balanced PUFA diet was 20% (w/w) of canola oil and the main FA were oleic acid and α-linolenic acid. The balanced PUFA inter-run calibrator was used to normalize all the qPCR plates analyzed in this research. 2.10.5 q-PCR analysis. SsoFast™ EvaGreen® master mix (Bio-Rad) was used to preform q-PCR on cDNA samples. A reaction mixture was made using 3.6 μL of nuclease-free water/sample, 5 μL of SsoFast™ enzyme/sample and 0.4 μL of (10 μM) primers/sample; for a list of specific primers see Table 5. The reaction mixture was briefly vortexed and 19.8 μL was distributed into each 0.5 mL sample tube followed by 2.2 μL of cDNA template. The samples were then briefly mixed, centrifuged and plated into a 96 well plate, this was done using 10 μL of reaction mixture in duplicate. On each plate an inter-run calibrator (Balanced PUFA infected sample 1) and a no template control were used to normalize plates and verified no primer dimers, respectively. These plates were covered with clear PCR sealing film and spun for 1 min in a plate spinner. The 31  reaction was completed using CFX96™ Touch real-time detection system (Bio-Rad) using the following protocol: first denaturation step at 95ºC for 30 s, followed by 39 cycles of denaturation at 95ºC for 5 s and annealing at 58ºC for 5 s, flowed by the dissociation step of 95ºC for 10 s. The annealing temp for all primers was 58ºC and the reference gene used was 18S ribosomal RNA (18S rRNA). However, GAPDH and β-actin were also tried. 18S rRNA was the appropriate reference gene for this experiment. Primer efficiency was imputed into the Bio-Rad CFX™ software; each efficiency was within the appropriate values [135], these efficiencies were determined using standard curves and are listed in Table 5. Gene expression of each treatment was normalized using the 18S rRNA reference gene and n-6 PUFA uninfected sample 1 was used as the control (value of 1). Bio-Rad CFX™ manager was used to calculate the expression values using the ∆∆Ct method with the above assigned parameters. Graphpad Prism® 5.0 software was used to create gene expression graphs and run statistical analysis.            32    Table 5. Experimental primers for mouse gene qPCR analysis.       Primer Forward Sequence Reverse Sequence Primer Efficiency 18s RNA CGGCTACCACCCAAGGAA GCTGGAATTACCGCGGCT 100% TNF-α CATCTTCTCAAAATTCGAGTGACA TGGGAGTAGACAAGGTACAACCC 100% IFN-γ TCAAGTGGCATAGATGTGGAAGA TGGCTCTGCAGGATTTTCATG 100% IL-17a TCCCTCTGTGATCTGGGAAG CTCGACCCTGAAAGTGAAGG 100% GAPDH ACATCATCCCTGCATCC GGATGGAAATTGTGAGG 100% β-actin CAGCTTCTTTGCAGCTCCTT CTTCTCCATGTCGTCCCAGT 100% IL-10 AGGGCCCTTTGCTATGGTGT TGGCCACAGTTTTCAGGGAT 100% IL-22 TCCGAGGAGTCAGTGCTAAA AGAACGTCTTCCAGGGTGAA 100% IL-23a TGGCATCGAGAAACTGTGAGA TCAGTTCGTATTGGTAGT-CCTGTTA 100% MCP-1 TACTCATTAACCAGCAAGAT TTGAGGTGGTGGTGGAA 98% IL-33 TGCCTCCCTGAGTACATACA CTGGTCTTGCTCTTGGTCTTT 97% Reg3γ CCCGTATAACCATCACCATCAT GGCATCTTTCTTGGCAACTTC  98% iNOS CAGCTGGGCTGTACAAACCTT CATTGGAAGTGAAGCGGTTCG 96% Relm-β FGCTCTTCCCTTTCCTTCTCCAA AACACAGTGTAGGCTTCATGCTGA 100% GPR41 CAGTGGCTGTGGACTTACTTT GCAGAAGATGAAGGGCAGAA  97% GPR43 AGAGGAGAACCAGGTAGAAGAA GGAGCCCAGTAAGAAAGATGAG 94% GPR120 CGAGTGTCCCAACAAGACTAC CAAGATGAGGAGGATGGTGATG 94% GPR40 GGCATCAACATACCCGTGAA GATGACCAAGGGCAGAAAGAA 98% 33  2.11 Serum cytokine quantification to study the role of sepsis during C. rodentium infection. The mouse blood was collected via cardiac puncture. These samples were then spun at 1600 xg for 5 min at 4ºC; this was done to separate the serum and red blood cells. IL-15, IL-3, IL-12(70), M-CSF and RANTES was measured from sera by Eve Technologies [136]. 2.12 RAW 264.7 and Caco-2 cells incubated with different FA during LPS stimulation. 2.12.1 Cell culture models. In order to analyze the expression and activity of IAP in vitro I purchased adherent RAW 264.7 (Mouse leukaemic monocyte macrophage cell line) from (ATCC®, Manassas, Virginia) and  adherent Caco-2 (human epithelial colorectal adenocarcinoma cell line) from (ATCC®).  Cells were maintained in a T-75 flask using high glucose Dulbecco's Modified Eagle Medium (DMEM) (Thermo Scientific). The following were added to the RAW cell media: 4 mM GlutaGro® (Corning, Corning, New York), 20% fetal bovine serum (FBS) (Gibco®: Life Technology, Burlington, Ontario), 2% Penicillin/Streptomycin (Corning) and 1 mM sodium pyruvate (Corning). The following was added to the Caco-2 DMEM media: 20% FBS, 2% Penicillin/Streptomycin, 1mM sodium pyruvate, 4mM Glutagro® and 1x non-essential amino acids (Thermo Scientific).  Cells were kept at 37ºC and 5% CO2 (Air-Jacketed CO2 Symphony incubator (Model#5.3A, VWR®). 2.12.2 RAW 264.7 and Caco-2 cell lines.  All cell culture experiments were conducted in the lab culture reliant Class II, Type A2 biosafety cabinet (Model#LR2-6S2, ESCO, Hatboro, Pennsylvania). RAW cells were maintained in white capped (partial adherent) T-75 flasks (RAW) or red capped (full adherent) T-75 flasks (Caco-2). The cells were left for two days until the cells reached 70-80% confluency, 34  the old media was then removed and 3 mL of PBS was used to wash the cells. To lift cells from the flask 3 mL of 0.25% Trypsin + Ethylenediaminetetraacetic acid (Corning) was added and placed in 37ºC and 5% CO2 for 3 min. The trypsin was deactivated by adding 9 mL of fresh media then spun in the Accuspin™ (Model#400, Fisher Scientific) centrifuge for 2 min at 234 xg. The cell pellet collected was re-suspended in fresh media. A trypan blue (Corning) 1:1 cell solution was used with a hemocytometer to determine cell viability; cells were visualized with the A CKX41 (Olympus®) inverted microscope. 2.12.3 FA preparation.  The following FA were used: LA (Sigma®), 4) LA + DHA (Cayman Chemical, Ann Arbor, Michigan) and EPA (Cayman Chemical), 5) Oleic acid (OA) (Sigma®), 6) OA + DHA and EPA, 7) Palmitic acid (PA) (Sigma®) and 8) PA + DHA and EPA. The above FA were stored at -80ºC in 100 mM FA stocks. From these stocks 5 mM FA aliquots were created. The first step was to prepare 3% FA-free, low endotoxin BSA solution in PBS then heat solution to 37ºC. The 100 mM stocks solutions were preheated to 37ºC (oleic and linoleic) and 55ºC for (palmitic). Each FA was mixed with the 3% BSA solution to create 5 mM stocks. To supplement DHA and EPA into the above FA the following was added: 1.8 mL of 5 mM desired FA, 1.5 μL of EPA, 3.2 μL (1:10) DHA and 200 μL of BSA. All FA’s were kept at 37ºC for 3-4 hours with constant stirring at 1.61 xg. BSA stock solutions were also created by adding 50 μL of 70% Ethanol and 950 μL of 3% BSA solution. 2.12.4 Plating and FA incubation.  The plated cells were taken from flasks with the passage # 21-24 for both RAW and Caco-2 cell lines. RAW cells (20,000 cells/well) and Caco-2 cells (50,000 cells/well) were plated into 48 and 24 well plates respectively; one plate for LPS stimulated cells and one for un-35  stimulated cells. When the cells reached 70-80% confluency the media was changed and the following 0.25 mM FA were applied: 1) No FA (cells and media only), 2) 3% BSA, 3) LA, 4) LA + DHA/EPA, 5) OA, 6) OA + EPA/DHA, 7) PA, 8) PA +DHA/EPA. 2.12.5 LPS stimulation.  After 18 hours of FA incubation, E.coli O111:B4 LPS (Sigma®) stock solution (1 mg/mL) was diluted to make a 6% LPS solution, this was then added to simulate infection. The cells stimulated with FA and LPS were left to incubate for 4 and 7.5 hours for both Caco-2 and RAW cells. These plates were kept in the infected only incubator. At the end of the time point, cells were washed with PBS (Fisher Scientific) and stored in 200 μL of Ribozol™ for RAW cells, and 400 μL for Caco-2 cells (AMRESCO®). These cells were left on a shaker for 5 min at RT and stored at -80ºC. 2.12.6 in vitro tissue homogenization. After infection, the cells were washed with PBS (Lonza, Allendale, New Jersey) and 500 μL of homogenization buffer was added to each well with 5 μL of protease inhibitor (abm®). The cells were homogenized by pipetting up and down three times to bust open the cells and transferred into a new tube. The cells were spun down at 2415 xg for 5 min at 22oC. The supernatant was collected and protein concentration was determined by Bradford protein assay, and then was used in the LPS-dephosphorylation and alkaline phosphatase assay, as previously described, to determine IAP activity in vitro.    36  2.13 mRNA extractions from RAW 264.7 and Caco-2 cells for gene expression.  RNA was extracted using Ribozol™ (AMRESCO®) extraction was conducted according to manufacturer’s instructions. The frozen plates were allowed to thaw for 5 min at RT. The Ribozol™/ cell solution was transferred from the plate into a 1.5 mL tube and 0.2 mL of chloroform (Sigma®) (per 1 mL of Ribozol™) was added to each tube. Tubes were shaken vigorously for 15 s and left at RT for 3 min. Samples were centrifuged at 12, 000 xg for 15 min at 4ºC.  This resulted in the creation of 3 phases: a bottom red phenol-chloroform phase, an interphase, and a colorless aqueous phase. The RNA located in the aqueous phase was slowly removed and placed into a new 1.5 mL tube. In order to isolate RNA, 0.5 mL of 100% isopropanol (VWR) (per 1 mL of Ribozol™ used initially) was added to each sample and mixed via pipetting; these samples were then placed at -80ºC for 20 min. These samples were then centrifuged at 12, 000 xg for 10 min at 4º C and then the supernatant was removed. The next step was to wash the RNA; 1 mL of 75 % ethanol (per 1 mL of Ribozol™) was added, vortexed briefly, then centrifuged at 7500 xg for 5 min at 4ºC; the supernatant was again removed. All the lids of the tubes were opened and covered with a Kimwipe® to cover the samples for 6 min to help dry the RNA pellet. The RNA pellet was re-suspended in 20 μL of nuclease-free water and placed into a water bath (55ºC) for 15 min. The samples were then analyzed using the nanodrop as previously described, then the RNA was converted to cDNA as previously explained, and qPCR was used to determine gene expression of IAP for both cell lines.  2.14 Fish oil analysis.  The below equation demonstrates an example calculation for the results presented in chapter four. Ex. Step 1) MUFA macrophage cell count (2+ 4 + 2+ 7) = 3.8 average macrophage cell count. 37  Step 2) MUFA + n-3 PUFA macrophage cell count for each mouse. MUFA mouse 1 = 4 macrophage cells MUFA mouse 2 = 6 macrophage cells MUFA mouse 3 = 2 macrophage cells MUFA mouse 4 = 7 macrophage cells Step 3) MUFA + n-3 PUFA macrophage cell counts / MUFA macrophage cell counts = adjusted fish oil value used in chapter 4. 4/3.8 = 1.1 macrophage cells 6/3.8 = 1.6 macrophage cells 2/3.8 = 0.5 macrophage cells 7/3.8 = 1.8 macrophage cells The bolded values are example values used in chapter 4.  2.15 Statistics 2.15.1 In vivo studies.  The results were expressed as the mean +/- standard error of the mean (SEM), with an n=10 for both uninfected and infected diet groups and an n= 8 for the MUFA + n-3 PUFA uninfected and infected groups. Significance for survival data was determined using a log-rank test because it estimates the hazard function or hazard rate between groups at different time points throughout the experiment [137]. A One-Way Analysis of Variance (ANOVA) with a Tukey post-hoc test was used for weight loss, histology scoring, infiltrating immune cells, serum analysis, AP assay and LPS dephosphorylating assay data. A One-Way ANOVA was deemed appropriate because it compares the means of multiple groups within a study with a single variable, in this case diet, and because the data was normally distributed across all groups [138]. 38  The data was tested for normalcy using the Anderson-Darling test; this was done using Minitab 16. A Tukey post-hoc test was used because it assumes normal distribution of data when analyzing the difference between group means, and is appropriate to use with an ANOVA test [138]. The Tukey post-hoc test also works to correct experiment-wise errors that occur with multiple group comparisons, thus it decreases the risk of making a type-one error. For qPCR data, A One-Way ANOVA with a Tukey post-hoc test was performed for parametric data and a Kruskal- Wallis with Dunns post-hoc test for non-parametric data. A Kruskal-Wallis test evaluates differences between group means; however, it doesn’t assume normal distribution and thus can be used on skewed data values in an experiment, better known as non-parametric data [138]. The Dunn’s post-hoc test was used because it helps decrease the family-wise error rate that occurs with multiple comparisons in the data and is used in conjunction with the Kruskal-Wallis test. A student t-test was performed to determine significance between n-3 PUFA supplemented diets and their background HFD. This is the appropriate test because there is only one factor that changes between the groups, which is the supplementation of n-3 PUFA. It is also an acceptable method for statistical analysis in the field of gastroenterology [139]. The student t-test data is presented in Tables 6-14.   All statistics were performed using GraphPad® Prism5 (GraphPad® Software, La Jolla, California) where (*p<0.05) was considered significant. 2.15.2 In vitro studies.  The cell culture results were expressed as the mean +/- SEM, with an n=5 for the Caco-2 cells stimulated and unstimulated with LPS. The data was tested for normalcy using the Anderson-Darling test; this was done using Minitab 16. A One-Way ANOVA with a Tukey post-hoc test was performed and results were considered significant when (*p<0.05). These statistics were analysed using GraphPad Prism® 5.  39  Chapter 3 Results: The effects of HFD during infectious colitis. 3.1 Food intake was not significantly different for mice fed any HFD, while mice fed MUFA diets were able to gain weight by day 35.  Over the five week feeding period, to determine roughly the amount of food consumed by mice in a particular diet group, food intake was measured in (g) for each cage once per week by weighing the initial and final amount of food aliquoted into the feeding dish. The values over the five weeks were averaged and there was no significant difference in food intake measurements for any of the mice (Figure 4A). This indicates that all changes seen in the following data were not a result of inconsistent food consumption. Mice were weighed at various time points throughout the five week feeding period and these weights were used to determine the percent change from the starting body weight of each mouse consuming a particular HFD. Similarly, the pre-infection weights were not significantly different except in the MUFA fed mice, which by day 35 were significantly heavier than the other mice (Figure 4B).                     40         Figure 4. All mice had similar food intake, while MUFA fed mice had gained significantly more weight by day 35.  The diet groups used were n-6 polyunsaturated fatty acid (PUFA), monounsaturated fatty acid (MUFA) and saturated fatty acid (SFA). A) Average food intake was measured (g) for each of the diet groups. The results were expressed as means +/- SEM. The results were determined using a One-Way ANOVA with a Tukey post-hoc test; (n=10). No significance was found in this data. B) The % starting body weight of mice prior to infection measured in days (five weeks) was similar for all diet groups except on day 35, where MUFA mice were the heaviest. The results were expressed as means +/- SEM. The results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test conducted for each time point; (n=10).            41  3.2 Survival, clinical scores and post-infection weights from mice infected with C. rodentium.  Mice were inoculated with C. rodentium and then monitored for morbidity and potential mortality over the 10 days of infection. All mice had a 100% survival rate during infection (Figure 5A) and suffered similar morbidity including total clinical scores and weight loss (Figure 5B-C). The exception was the mice fed SFA, which had a drop in weight on day nine of infection, but recovered this weight loss by day 10 (Figure 5C).                   42      Figure 5. All mice had 100% survival during infectious colitis and showed similar levels of morbidity. The diet groups used were n-6 polyunsaturated fatty acid (PUFA), monounsaturated fatty acid (MUFA) and saturated fatty acids (SFA). A) C57BL/6 female mice were infected with C. rodentium for 10 days; during this period all diet groups had 100% survival rates. For all diet groups; (n=10), a log-rank test was used for analysis. These results produce no significance. B) Total clinical scores during infection with C. rodentium. The scores were comprised of: weight loss, dehydration, activity, coat and posture throughout the 10 days of infection.  The results were expressed as means +/- SEM. No significance was found using a One-Way ANOVA with a Tukey post-hoc; (n=10). C) Post-infection weights were calculated based on % starting body weights of mice. The mice were weighed at multiple time points during the 10 day infection and results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=10).  43  3.3 Both n-6 PUFA and SFA fed mice had severe colonic damage during infectious colitis. 3.3.1 Uninfected groups.  Colon sections removed from mice fed each particular diet were embedded onto slides, stained with H & E stain and analyzed for pathology by examining edema, crypt hyperplasia, immune cell infiltration, epithelial integrity and goblet cell depletion. The mice that were uninfected were used to determine baseline levels for their infected counterparts (Figure 6A). While the uninfected n-6 PUFA mice had low colonic histopathological scores similar to what is considered “normal”, both the MUFA and SFA fed mice had increased histopathological scores compared to n-6 PUFA fed mice. 3.3.2 Infected groups.  Colon sections taken from mice that had been fed a particular fat diet and then infected with C. rodentium for 10 days were embedded onto slides, stained with H & E stain and analyzed for pathology as above. Figure 6B demonstrates the infected values without the uninfected mouse value adjustments. The results showed that both the n-6 PUFA and SFA fed mice had similarly high pathology at scores ~10, while the MUFA fed mice had a low histopathological score. The n-6 PUFA and SFA fed mice had exacerbated colonic damage compared to uninfected counterparts. The uninfected mouse values were taken into account and the n-6 PUFA fed mice had the largest induction of damage (Figure 6C). The images of the colonic damage in mice showed increased levels of epithelial shedding and immune cell infiltration in the infected n-6 PUFA and SFA fed mice, while MUFA fed mice had less immune cell infiltration, epithelial shedding and increased mucous production (Figure 6D).    44                45  Figure 6. Colonic damage during C. rodentium was increased in mice fed n-6 PUFA and SFA, while MUFA fed mice were protected from damage during infectious colitis. The diet groups used were n-6 polyunsaturated fatty acid (PUFA), monounsaturated fatty acid (MUFA) and saturated fatty acid (SFA). A) The uninfected diet groups were analyzed for colon histopathology using H & E staining and scores for edema, hyperplasia, epithelial integrity, immune cell infiltration and goblet cell depletion were determined. The results were expressed using means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=10). B) Mice that had been infected (without uninfected mouse values) were analyzed using bright field imaging of H & E slides. The results were expressed using means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=10). C) Mice infected with C. rodentium were analyzed using bright field imaging of H & E slides to determine colonic damage. The results were determined by using the uninfected mice as the baseline, the percentage of damage was calculated for each diet group. The results were expressed using means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=10). The white bars represent uninfected mice and the black bars represent infected mice for each graph. D) H & E staining for each diet group was taken at 200x magnification with a focus on the epithelial cells and immune cell infiltration. The black scale bar = 46.5 μm. 46  3.4 Mice fed n-6 PUFA and SFA diets showed increased infiltration of colonic immune cells during infectious colitis compared to mice fed MUFA diets. 3.4.1 Uninfected groups.  Colon segments removed from mice were cut into sections and embedded onto slides followed by incubation with specific primary and secondary antibodies to count the number of infiltrating immune cells in the submucosae. The antibody specific for the F4/80 receptor was used to detect macrophages. The antibody specific for the myeloperoxidase (MPO) enzyme was used to detect neutrophils. Antibodies raised against PGE2 and IAP were used to detect the presence of these immune markers in immune cells in the lamina propria of mice. Across all immune cells examined, the n-6 PUFA fed mice had the lowest infiltration prior to infection, which would be considered “normal”. The uninfected SFA and MUFA fed mice had more macrophages (Figure 7Ai) and neutrophils (Figure 7Bi) compared to the n-6 PUFA fed mice. There was no detectable IAP in the submucosa of the n-6 PUFA fed mice prior to infection. 3.4.2 Infected groups.  During infection, n-6 PUFA and SFA fed mice displayed similar exacerbated infiltration of macrophages, while MUFA diets had few infiltrated macrophages (Figure 7Aii).  The levels of infiltrating neutrophils (Figure 7Bii) and PGE2 (Figure 7Cii) were highest in the SFA fed mice compared to both n-6 PUFA and MUFA mice during colitis, whereas IAP was the lowest in the MUFA fed mice (Figure 7Dii). Overall, mice fed SFA and n-6 PUFA had a large influx of immune cells in the colon during infectious colitis, whereas the mice fed the MUFA diet had fewer infiltrating immune cells.   47           48      Figure 7. Mice fed n-6 PUFA and SFA diets had induced colonic immune cell infiltration compared to MUFA fed mice. The diet groups used were n-6 polyunsaturated fatty acid (PUFA), monounsaturated fatty acids (MUFA) and saturated fatty acids (SFA). Colon sections from the uninfected and infected mice were embedded on slides and stained with antibodies specific for F4/80 (macrophages) 7Ai and 7Aii; MPO (neutrophils) 7Bi and 7Bii; PGE2  7Ci and 7Cii and IAP 7Di and 7Dii.The slides were counted at 200x magnification. The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=10). ND= no detection. The white bars represent uninfected mice and the black bars represent infected mice for all graphs. 49  3.5 SFA diets fed to mice promoted an exacerbated pro-inflammatory cytokine response during infectious colitis. 3.5.1 Uninfected groups.  The mice were analyzed for pro-inflammatory responses prior to infection. Both the SFA and MUFA fed mice had higher expression of TNF-α (Figure 8Ai), iNOS (Figure 8Di) and macrophage chemotactic protein-1 (MCP-1) (Figure 8Ei) compared to the n-6 PUFA fed mice.  Overall, MUFA and SFA fed mice had increased pro-inflammatory responses prior to infection. 3.5.2 Infected groups.  The SFA and n-6 PUFA fed mice had the highest colitic responses evident by the high levels of pro-inflammatory cytokine expression. The n-6 PUFA fed mice had increased levels of Relm-β (Figure 8Fii) while the SFA mice had increased expression of TNF-α (Figure 8Aii). The MCP-1 chemokine was the highest in the MUFA fed mice compared to n-6 PUFA mice (Figure 8Eii). Even though there was increased gene expression, this may not reflect actual protein values. Overall, n-6 PUFA and SFA fed mice had increased expression of pro-inflammatory responses compared to MUFA mice.    50       51         52    Figure 8. Mice fed SFA diets had increased colitic responses. The diet groups used were n-6 polyunsaturated fatty acid (PUFA), monounsaturated fatty acid (MUFA) and saturated fatty acids (SFA). The relative mRNA expression was examined by taking isolated RNA from colonic tissues and running qPCR with 18S rRNA as the reference gene. The following pro-inflammatory responses were analyzed: TNF-α 8Ai and 8Aii; IFN-γ 8Bi and 8Bii; IL-17a 8Ci and 8Cii; iNOS 8Di and 8Dii; MCP-1 8Ei and 8Eii and Relm-β Fi and Fii. The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test for parametric data and Kruskal- Wallis with Dunn’s post-hoc test for non-parametric data; (n=10). The white bars represent uninfected mice and the black bars represent infected mice for all graphs. 53  3.6 Mice fed SFA diets had increased responses important for inflammatory resolution during infectious colitis. 3.6.1 Uninfected groups.  In a healthy colon, there is a balance between pro and anti-inflammatory response, which includes the presence of Treg cells to promote balanced inflammation. To understand the role that dietary lipids played in balancing inflammatory responses, I examined some typical anti-inflammatory responses in mice prior to infection.  I found that SFA had the highest anti-inflammatory responses in uninfected mice evident from the high expression of IL-10 (Figure 9Ai), Reg3γ (Figure 9Ci), IL-23a (Figure 9Ei) and Treg cells (Figure 9Fi). The n-6 PUFA fed mice had reduced levels of anti-inflammatory mediators prior to infection except for Treg expression, which is similar to the SFA fed mice. These results revealed that SFA fed mice prior to infection appeared to promote the most balancing anti-inflammatory mechanism to maintain homeostasis in the gut. 3.6.2 Infected groups.  During colitis, anti-inflammatory processes are important for protection against the damaging effects of pro-inflammatory responses and often are a part of the normal restitution phase following damaging inflammation.  SFA fed mice had the highest anti-inflammatory mechanisms during colitis. SFA fed mice had increased expression of IL-10 (Figure 9Aii), IL-33 (Figure 9Bii), Reg3γ (Figure 9Cii), IL-23a (Figure 9Eii) and increased Treg cells (Figure 9Fii) in the lamina propria. Overall, SFA fed mice had increased important immune responses needed for inflammation resolution and for maintaining homeostatic responses during colitis. In contrast to the SFA fed mice, n-6 PUFA and MUFA mice had reduced levels of anti-inflammatory mediators except for IL-22 expression, which was similar for all mice.    54           55         56   Figure 9. Mice fed SFA diets had increased anti-inflammatory responses that could be important for resolution of damaging inflammatory responses during infectious colitis. The diet groups used were n-6 polyunsaturated (PUFA), monounsaturated fatty acid (MUFA) and saturated fatty acid diets (SFA). The following mRNA expression was analyzed: IL-10 9Ai and 9Aii; IL-33 9Bi and 9Bii; Reg3γ 9Ci and 9Cii, IL-22 9Di and 9Dii and IL-23a 9Ei and 9Eii and 18S rRNA was used as the reference gene. The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test for parametric data and Kruskal- Wallis with Dunn’s post-hoc test for non-parametric data; (n=10). Fi and Fii) Treg cells were analyzed by staining colonic sections from mice with the Foxp3 antibody. The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=10).  The white bars represent uninfected mice and the black bars represent infected mice for all graphs.  57  3.7 SFA diets fed to mice induced increased expression of intestinal FA receptors during infectious colitis. 3.7.1 Uninfected groups.  G protein coupled receptors are important FA receptors in the gut that bind particular lengths of FA chains, and have been reported to be important in inflammation resolution. These FA when stimulate mediate the release of inflammatory cytokines [140]. I examined the gene expression of several of these receptors and found that GPR41 gene expression was highest in the SFA fed mice prior to infection (Figure 10Ai).  There was no difference in expression of GPR43 (Figure 10Bi) and GPR40 (Figure 10Ci) or GPR120 (Figure 10Di), which had varying expression between diet groups. Overall, these FA receptors were stimulated by diets high in SFA compared to n-6 PUFA and MUFA. 3.7.2 Infected groups.  To investigate the role of FA receptors during C. rodentium infection, I examined gene expression during colitis. SFA diets increased the expression of GPR40 compared to the n-6 PUFA fed mice with a 100-fold difference between these two dietary oils (Figure 10Cii). GPR41 (Figure 10Aii) was increased in the SFA compared to n-6 PUFA mice. These results indicate that SFA were important for inducing expression of colonic epithelial FA receptors, an important factor during inflammation [140].        58         59   Figure 10. Mice fed SFA diets had increased FA receptor gene expression before and during infectious colitis. The diet groups used were n-6 polyunsaturated fatty acid (PUFA), monounsaturated fatty acid (MUFA) and saturated fatty acids (SFA). The following mRNA gene expressions were analyzed: GPR41 10 Ai and Aii; GPR43 10 Bi and 10 Bii; GPR40 10 Ci and Cii; GRP120 Di and Dii and18S rRNA was used as the reference gene. The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using One-Way ANOVA with a Tukey post-hoc test for parametric data and Kruskal- Wallis with Dunn’s post-hoc test for non-parametric data; (n=10). The white bars represent uninfected mice and the black bars represent infected mice for all graphs. 60  3.8 Mice fed n-6 PUFA diets had increased expression of serum cytokines during infectious colitis. 3.8.1 Uninfected groups.  To determine if there were any systemic inflammatory responses resulting from a particular fat fed diet, I examined the serum cytokine levels in mice prior to infection.  I found that cytokine levels varied amongst the fat fed groups of mice. Macrophage colony-stimulating factor (M-CSF) (Figure 11Di) and Regulated on activation normal T cell expressed and secreted (RANTES) (Figure 11Ei) were found increased in the mice fed n-6 PUFA diets. Overall, diets fed to uninfected mice resulted in similar levels of serum cytokine and chemokine expression. 3.8.2 Infected groups.  Damage to the epithelium occurs during colitis, resulting in bacterial transmigration; therefore, while low levels of serum cytokines are thought to prevent systemic infections, cytokine storms can also result and are indicative of sepsis. To determine how cytokine responses were affected by dietary lipids during infectious colitis, I examined cytokine responses in sera taken from mice post-infection.  The following serum cytokines were increased in the n-6 PUFA group: IL-3 (Figure 12Bii), IL-12(70) (Figure 12Cii), M-CSF (Figure 12Dii) and RANTES (Figure 12Eii); while IL-15 (Figure 12Aii) was similarly expressed in all diet groups. Overall, mice fed n-6 PUFA diets displayed exacerbated systemic inflammation during colitis.       61            62          63                  Figure 11. Serum cytokines were increased in mice fed n-6 PUFA during infectious colitis.  The diet groups used were n-6 polyunsaturated fatty acid (PUFA), monounsaturated fatty acid (MUFA) and saturated fatty acid (SFA). Cardiac puncture was used to collect the sera from mice for ELISA analysis; the analysis was conducted at Eve Technologies. A) The uninfected mice were analyzed for IL-15 (Ai), a sepsis marker measured in pg/mL sera. IL-3 (Bi), IL-12(70) (Ci), M-CSF (Di) and RANTES (Ei) B) The infected mice were analyzed for IL-15 (Aii), IL-3 (Bii), IL-12(70) (Cii), M-CSF (Dii) and RANTES (Eii). The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=10). The white bars represent uninfected mice and the black bars represent infected mice for all graphs.     64  3.9 IAP’s ability to dephosphorylate LPS was increased in the MUFA fed mice. 3.9.1 Uninfected groups.  I examined IAP because it had previously been found to be an important mucosal factor important for dephosphorylating LPS and detoxifying transmigrated bacteria. I found that all mice had similar LPS dephosphorylating activity for all three diet groups prior to infection (Figure 12A). 3.9.2 Infected groups.  Since I previously found IAP was playing a role in survival during C. rodentium infection [102], I examined its activity during infectious colitis. I found that the mice fed the MUFA diet had the highest level of activity in the colon during infection (Figure 12B), which was approximately two times higher compared to the activity of the uninfected mice (Figure 12A). Mice fed n-6 PUFA also had increased LPS dephosphoryltion; however, not to the same extent as MUFA diets (Figure 12B).  In contrast SFA fed mice had a reduction in LPS-dephosphorylation compared to MUFA fed mice. The average activity value for the n-6 PUFA fed mice prior to infection was 506961.5 activity/mg of protein compared to infected mice fed n-6 PUFA which was 768386.9 activity/mg of protein. The average activity value for the MUFA fed mice prior to infection was 658450.7 activity/mg of protein compared to the infected average activity value which was 1362451 activity/mg of protein. Lastly, the uninfected SFA fed mice had an average activity value of 584738.5 and the average activity value of mice post infection was 557547.7 activity/mg of protein. Overall, mice fed MUFA diets had increased IAP LPS-dephosphorylating activity during infection.   65      Figure 12. IAP activity was increased in the MUFA fed mice during infectious colitis. The diet groups used were n-6 polyunsaturated fatty acid (PUFA), monounsaturated fatty acid (MUFA) and saturated fatty acid diets (SFA). A) The uninfected tissues from mice were stored in liquid nitrogen, homogenized and analyzed using the LPS-dephosphorylation assay and malachite green solution. The activity of IAP was determined using LPS-dephosphorylation activity/mg of protein measured at 620 nm. B) Infected tissues from mice were also analyzed using the LPS-dephosphorylation assay to determine IAP activity. The results in Figure A and B were expressed using means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=10). The white bars represent uninfected mice and the black bars represent infected mice for all graphs.     66  3.10 Total AP activity during infectious colitis.  3.10.1 Uninfected groups.  To further understand IAP’s role in colitis, I examined the total dephosphorylating activity of this enzyme. Similar to the LPS-dephosphorylation activity found in the MUFA fed mice colons, I found that these MUFA fed mice had increased total activity of AP. There was activity difference between the MUFA and n-6 PUFA fed mice, while SFA fed mice were not significantly different than the MUFA fed mice (Figure 13A). 3.10.2 Infected groups.  During infection, total AP activity was the highest in the MUFA and SFA fed mice while n-6 PUFA fed mice resulted in low levels of total activity, (Figure 13B) compared to uninfected mice  (Figure 13A). These findings were different compared to IAP’s LPS dephosphorylating activity values, which showed increased IAP activity in the MUFA fed mice. In contrast IAP’s LPS dephosphorylating activity values were similar for both uninfected and infected SFA fed mice. Overall, AP’s total activity was increased in the MUFA and SFA fed mice during infection, while n-6 PUFA impaired this important enzyme’s function in mice.         67        Figure 13. Mice fed MUFA and SFA diets had increased levels of total AP activity during infectious colitis. The diets used were n-6 polyunsaturated fatty acid (PUFA), monounsaturated fatty acid (MUFA) and saturated fatty acid diets (SFA). A) The uninfected tissues from mice were stored in liquid nitrogen, homogenized and analyzed using the total AP assay. The activity of AP was determined using (AP activity/mg of protein measured at Ex/Em 360/440. B) The infected tissues from mice were also analyzed using the total AP kit to analyze AP activity. The results in figure A and B were expressed using means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=10). The white bars represent uninfected mice and the black bars represent infected mice for all graphs.      68  3.11 IAP activity in RAW 264.7 macrophage cell lines.  To further understand the role and cell types of IAP activity and the effect of diet, I used an in vitro model of intestinal epithelial cells, as well as macrophages in the presence of FA to examine IAP activity.  Preliminary results indicated that IAP positive cells were associated with macrophages in the gut of mice during infection (Figure 14A). After evaluation of IAP activity in a RAW 264.7 (mouse macrophage) cell line I found no significant differences between the FA groups with or without LPS stimulation. Various time points, including 4, 7.5 and 18 hours were utilized to determine the proper time at which IAP is activated. There were no changes in the FA groups indicating macrophages were not the main producer of IAP in vivo during colitis (Figure 14B).                69   Figure 14. Macrophages were not associated with increased IAP activity during LPS stimulation in vitro. The RAW cells analyzed were incubated with: BSA (vehicle control), LA, LA + DHA/EPA, OA, OA + DHA/EPA, PA and PA + DHA/EPA. A) Preliminary results indicate that macrophages co-localize with IAP (IAP red stain, macrophages green stain). B) The RAW 264.7 macrophage cell line was used to analyze cells incubated with a particular FA and left uninfected or stimulated with LPS for 4, 7.5 and 18 hour time points. The LPS-dephosphorylation assay and total AP assay described above were used to determine IAP activity. This was a trial experiment and was conducted only once using an n=2 and because of the lack of significance in the results the experiments were not further pursued. The LPS-dephosphorylating activity was measured at 620 nm and total AP activity was measured using Ex360/Em440.     70  3.12 IAP activity was increased in Caco-2 cells stimulated with OA and LPS.  Epithelial IAP expression in vivo during infection was increased in the MUFA fed mice compared to other mice (Figure 15A).  As a result, I examined a Caco-2 human epithelial cell line for IAP activity. IAP’s ability to dephosphorylate LPS was increased in the OA group with 7.5 hours of LPS stimulation (Figure 15B). This change was not seen in other FA groups or at other LPS stimulation time points. I used pH strips to measure the pH of the homogenates and I found the pH to be 7 for all samples (Figure 16A). Since the pH strips used were not sensitive to small changes in pH it is possible the changes in IAP activity were due to an altered pH.  Overall, IAP activity was increased in the OA group during LPS stimulation.                71                     Figure 15. Caco-2 epithelial cells have increased IAP activity in the OA group during LPS stimulation. A) Epithelial expression of IAP in the colon of mice infected with C. rodentium. The red stain shown with the arrow indicates IAP location in the gut. Images were taken at 200x magnification (white scale bar = 46.5 μm). B) The FA groups analyzed were: BSA (control), LA, OA and PA. The zero time point represents control values i.e. cells + FA without LPS. Caco-2 cells with a starting cell count of 50,000 cells/well were stimulated with LPS for 7.5 hours, this resulted in increased IAP activity in the OA group. The LPS-dephosphorylation assay was conducted as previously described and activity was measured at 620 nm. The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=5).  A 72         Figure 16. The pH was the same in all Caco-2 cell homogenates stimulated with a particular FA and LPS. A) The FA groups analyzed were: BSA (control), LA, OA and PA. B) The FA groups analyzed were: BSA (control), LA + DHA/EPA, OA + DHA/EPA and PA + DHA/EPA. In both graphs the zero time point represents control values i.e. cells + FA without LPS. Caco-2 cells used for both experiments began with a starting cell count of 50,000 cells/well were then stimulated with LPS for 7.5 hours. The LPS-dephosphorylation assay was conducted as previously described and activity was measured at 620 nm. The pH was measured using pH indicator strips and recorded for each FA. The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=5).    73  3.13 Summary of results.  Both n-6 PUFA and SFA rich diets fed to mice resulted in exacerbated colitis compared to MUFA rich diets. The SFA fed mice resulted in increased restitution and balancing anti-inflammatory responses, while both SFA and MUFA fed mice had high total IAP activity during infection. The MUFA fed mice had high LPS-dephosphorylating activity in vivo and OA induced high LPS-dephosphorylation in vitro (Caco-2 cells). This suggested that IAP LPS-dephosphorylating activity might have aided in the lack of colitis due to its ability to detoxify the bacterial pathogen at the epithelium surface. The above was supported by the results showing that mice fed MUFA diets had little systemic cytokine and chemokine expression.               74  Chapter 4 Results: The effects of supplementing HFDs with fish oil, rich in long chain n-3 PUFA during infectious colitis.  Since supplementation of diets with fish oil, rich in long chain n-3 PUFA, is thought to protect against colitis, the background lipid diets were supplemented with 1% fish oil, which is the amount that is recommended by the American Heart Institute as explained in the experimental techniques section of this thesis. Many studies have looked at n-3 PUFA; however, there are conflicting reports on n-3 PUFA supplementation and colitis. Some studies report it exacerbates colitis and others show it to be beneficial. Thus, this chapter focuses on the effects of supplementing particular HFD with n-3 PUFA and the consequence to the host during colitis.  4.1 Mice fed n-6 PUFA diets supplemented with n-3 PUFA didn’t result in weight gain unlike SFA and MUFA fed mice supplemented with n-3 PUFA.  The food intake was analyzed for each of the mice fed HFDs: PUFA, MUFA and SFA supplemented with n-3 PUFA (fish oil). There were no significant differences with regards to food intake (Figure 17A). The food intake data indicates that our findings are a result of treatment and not a consequence of underfeeding the mice in this study. Mice fed diets supplemented with fish oil had no significant effect on the mice fed background diets (Table 6).  The pre-infection weights were similar at the beginning of the high fat feeding and at the end of the five weeks in the n-6 PUFA + n-3 PUFA fed mice but not the MUFA + n-3 PUFA and SFA + n-3 PUFA fed mice (Figure 17B). These mice gained weight, similar to before supplementation with n-3 PUFA (Chapter 3 Figure 4B). Therefore, n-3 PUFA supplementation on a high fat n-6 PUFA background diet did not result in weight gain in mice  75  Table 6. Average food intake values for mice fed high fat and fish oil diets used in Figure 17A. A student t-test was used to compare n-3 PUFA supplemented mice to mice fed background diets (n=10); (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05.          Figure 17. All mice had similar food intake while n-6 PUFA + n-3 PUFA fed mice did not gain weight. The diet groups used were n-6 polyunsaturated fatty acid + n-3 PUFA (n-6 PUFA + n-3 PUFA), monounsaturated fatty acid + n-3 PUFA (MUFA + n-3 PUFA) and saturated fatty acid + n-3 PUFA (SFA + n-3 PUFA). A) Average food intake was measured for each cage of mice (g). The results were expressed as means +/- SEM. Results were analyzed using a One-Way ANOVA with a Tukey post-hoc test; (n=10); (n=8 MUFA + n-3 PUFA). No significance was found in this data. The above data was adjusted to reflect the effect of fish oil on the background diet. The raw values for HFD, fish oil and statistical analysis are presented in Table 6. B) The % starting body weight of mice prior to infection was measured in days (5 weeks) The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=10); (n=8 MUFA + n-3 PUFA). HFD (grams) HFD + n-3 PUFA (grams) Student t-test (p-value) Significance (S) or (N.S) n-6 PUFA 2.2 +/- 0.2 2.1 +/- 0.2  0.578 N.S MUFA 2.3 +/- 0.1 2.0 +/- 0.1 0.109 N.S SFA 2.1 +/- 0.1 2.1 +/- 0.1 0.629 N.S 76  4.2 Unlike n-6 PUFA rich diets, MUFA and SFA protected mice from a lethal colitis when supplemented with n-3 PUFA.  Mice that were fed diets high in n-6 PUFA and supplemented with n-3 PUFA resulted in 30% mortality (Figure 18A).  Mice fed MUFA and SFA diets supplemented with n-3 PUFA did not suffer any mortality during the ten day course of infection.  During colitis, weight loss is a sign of morbidity. I found that the mice fed n-6 PUFA + n-3 PUFA diets had suffered more weight loss, evident at day four and day nine of infection, compared to other mice (Figure 18C).  Overall, mice fed n-6 PUFA + n-3 PUFA diets resulted in increased morbidity and mortality during infection.            77     Figure 18. Mice fed n-6 PUFA + n-3 PUFA had an increase in morbidity and mortality. The diet groups used n-6 polyunsaturated fatty acid + n-3 PUFA (n-6 PUFA + n-3 PUFA), monounsaturated fatty acid + n-3 PUFA (MUFA + n-3 PUFA) and saturated fatty acids + n-3 PUFA (SFA+ n-3 PUFA). A) C57BL/6 mice were infected with C. rodentium for 10 days during this period the n-6 PUFA + n-3 PUFA had a 30% drop in survival. A log-rank test was used for analysis (n=10); (n=8 MUFA + n-3 PUFA); (*p<0.05). B) Total clinical scores during infection with C. rodentium. The scores were comprised of: weight loss, dehydration, activity, coat and posture throughout the 10 days of infection. The results were expressed as means +/- SEM. Results were determined using a One-Way ANOVA with a Tukey post-hoc test (n=10); (n=8 MUFA + n-3 PUFA). No significance was found in this data. C) Post-infection weights were calculated based on % starting body weights of mice. The mice were weighed at multiple time points during the 10 days of infection and results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=10); (n=8 MUFA + n-3 PUFA).                                                                                                                                              78  4.3 n-6 PUFA + n-3 PUFA supplemented mice have the lowest colonic damage during infectious colitis. 4.3.1 Uninfected groups.  There were no significant differences in the mice fed each diet. MUFA + n-3 PUFA fed mice had colonic damage scores slightly above “normal”. A total possible score for damage is 12, therefore these values in mice for the diets were considered low and relativity undetectable (Figure 19A). Overall, the addition of n-3 PUFA to n-6 PUFA diet resulted in a drop in colonic damage in mice (Figure 19A); (Table 7). 4.3.2 Infected groups.  The mice fed n-6 PUFA + n-3 PUFA had the lowest levels of colonic damage compared to the MUFA fed mice supplemented with n-3 PUFA (Figure 19B). The addition of n-3 PUFA to n-6 PUFA resulted in a reduction in colonic damage in mice (Figure 19C); (Table 7).  SFA and MUFA + n-3 PUFA fed mice had increased infiltration of immune cells, epithelial shedding and edema compared to n-6 PUFA + n-3 PUFA (Figure 19D). Overall, n-6 PUFA + n-3 PUFA fed mice had the lowest level of colonic damage during infection.              79  Table 7. Histology scores for mice fed high fat and fish oil diets used in Figure 19. A student t-test was used to compare n-3 PUFA supplemented mice to mice fed background diets (n=10); (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05.          Treatment HFD (Scores of Damage) HFD + n-3 PUFA (Scores of Damage) Student t-test (p-value) Significance (S) or (N.S) Uninfected n-6 PUFA 0.7 +/- 0.1 0.8 +/- 0.3 0.7390 N.S MUFA 3.5 +/- 0.2 5.3 +/- 0.1 0.0002 S SFA 7.1 +/- 0.2 5.5 +/- 0.3 0.0062 S Infected n-6 PUFA 10.2 +/- 0.3 7.8 +/- 0.6 0.0206 S MUFA 6.7 +/- 0.3 7.4 +/- 0.6 0.3223 N.S SFA 10.7 +/- 0.7 10.5 +/- 0.7 0.8415 N.S 80            81     Figure 19. Colonic damage during infectious colitis was increased in mice fed SFA + n-3 PUFA. The diet groups used were n-6 polyunsaturated fatty acid + n-3 PUFA (n-6 PUFA + n-3 PUFA), monounsaturated fatty acid + n-3 PUFA (MUFA + n-3 PUFA) and saturated fatty acid + n-3 PUFA (SFA + n-3 PUFA). A) The uninfected mice were analyzed for colon histopathology using bright field imaging of H & E slides and scores for edema, hyperplasia, epithelial integrity, immune cell infiltration and goblet cell depletion were determined. The results were expressed as means +/- SEM. Results were analyzed using a One-Way ANOVA with a Tukey post-hoc test (n=10); (n=8 MUFA + n-3 PUFA). No significance was found in this data. B) The histology scores of infected mice were analyzed using bright field imaging of the H & E slides. The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test (n=10); (n= MUFA + n-3 PUFA). C) The histology scores of infected mice with adjusted calculations taken from the HFD and fish oil mice. The colonic damage was analyzed using bright field imaging of H & E slides. The results were expressed as means +/- SEM. Results were analyzed using a One-Way ANOVA with a Tukey post-hoc test (n=10); (n= MUFA + n-3 PUFA). No significance was found in this data. The white bars represent uninfected mice and the black bars represent infected mice. A and C were adjusted to reflect the effect of fish oil on the background diet. The raw values for HFD, fish oil and statistical analysis are presented in Table 7. D) The bright field images of H & E slides for mice fed a particular diet. The images were taken at 200x magnification and focused on the epithelial cells and immune cell infiltration (black scale bar = 46.5μm). 82  4.4 Mice fed MUFA + n-3 PUFA diets had increased immune cell infiltration during infectious colitis. 4.4.1 Uninfected groups.  Mice fed HFDs supplemented with n-3 PUFA had various levels of infiltrating immune cells. Mice fed n-6 PUFA + n-3 PUFA had increased levels of infiltrating macrophages (Figure 20Ai); (Table 8).  The infiltrating levels of neutrophils (Figure 20Bi) and PGE2 (Figure 20Di) positive cells were increased in the MUFA + n-3 PUFA fed mice. IAP was increased in the MUFA + n-3 PUFA fed mice (Figure 20Ci), while n-6 PUFA + n-3 PUFA mice had no detectable IAP.  Mice fed n-3 PUFA supplemented to n-6 PUFA background diet resulted in an increase in macrophages and a decrease in neutrophils (Table 8). Overall, prior to infection there were varying levels of infiltrating immune cells amongst the mice fed particular diets. 4.4.2 Infected groups.  Mice fed n-3 PUFA supplemented to SFA background diets resulted in a reduction in macrophages (Figure 20Aii). Mice fed n-3 PUFA supplemented to both SFA and n-6 PUFA resulted in a reduction in neutrophils (Figure 20Bii). The mice fed a n-6 PUFA diet supplemented with n-3 PUFA resulted in a significant drop in both IAP (Figure 20Cii) and PGE2 (Figure 20Dii); (Table 8). Overall, the mice fed n-3 PUFA supplemented to n-6 PUFA and SFA background diets resulted in an impaired immune response while n-3 PUFA had no significant effects on MUFA fed mice.         83  Table 8. Infiltrating immune cell values from the mice fed high fat and fish oil diets used in Figure 20. A student t-test was used to compare n-3 PUFA supplemented mice to mice fed background diets (n=10); (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05.   Response Treatment HFD (Individual cells) HFD + n-3 PUFA (Individual cells) Student t-test (p-value) Significance (S) or (N.S) Macrophage Uninfected n-6 PUFA 1.7 +/- 0.5 5.4 +/- 1.2 0.0187 S MUFA 5.7 +/- 0.7 7.3 +/-1.2 0.2570 N.S SFA 6.0+/- 1.2 3.5+/- 0.6 0.0821 N.S Infected n-6 PUFA 27.3 +/- 6.5 17.2 +/- 2.5 0.1291 N.S MUFA 16.7 +/- 2.2 17.2 +/- 3.0 0.9030 N.S SFA 27.1 + / 1.7 20.8 +/ 2.0 0.0282 S Neutrophil Uninfected n-6 PUFA 1.3 +/ - 0.8 0.4 +/- 0.1 0.0067 S MUFA 4.8 +/- 1.0 5.1 +/- 0.5 0.8161 N.S SFA 5.4+/- 1.1 3.1 +/- 0.3 0.0514 N.S Infected n-6 PUFA 14.7 +/- 2.9 5.3 +/- 1.5 0.0155 S MUFA 12.1+/- 1.9 12.0 +/- 4.5 0.9785 N.S SFA 29.8 +/- 2.2 23.6+/- 1.5 0.0355 S IAP Uninfected n-6 PUFA ND ND ND ND MUFA 1.7 +/- 1.0 0.2 +/- 0.1 0.1715 N.S SFA 1.3+/- 0.5 1.1 +/- 0.4 0.7201 N.S Infected n-6 PUFA 53.5 +/- 4.0 9.3 +/-1.2 <0.0001 S MUFA 19.2 +/- 9.5 23.5 +/- 7.3 0.7880 N.S SFA 45.8 +/- 8.1 30.5 +/- 4.0 0.0926 N.S 84                  Response Treatment HFD (Individual cells) HFD + n-3 PUFA (Individual cells) Student t-test (p-value) Significance (S) or (N.S) PGE2 Uninfected n-6 PUFA 2.6+/- 0.6 1.2 +/- 0.4 0.0751 N.S MUFA 6.7 +/- 1.5 10.0+/- 2.0 0.1869 N.S SFA 10.8 +/- 3.0 7.2 +/- 1.6 0.2198 N.S Infected n-6 PUFA 12.2 +/- 1.9 6.7 +/- 1.0 0.0153 S MUFA 12.6 +/- 3.1 17.0 +/- 6.3 0.3463 N.S SFA 22.9 +/- 3.1 21.8 +/- 1.8 0.7502 N.S   # 85          86    Figure 20. Mice fed n-3 PUFA supplemented to a n-6 PUFA diet resulted in impaired infiltrating immune responses during infectious colitis. The diet groups used were n-6 polyunsaturated fatty acid + n-3 PUFA (n-6 PUFA + n-3 PUFA), monounsaturated fatty acids + n-3 PUFA (MUFA+ n-3 PUFA) and saturated fatty acids n-3 PUFA (SFA + n-3 PUFA). Colon sections from the uninfected and infected mice were embedded on slides and stained with antibodies specific for F4/80 (macrophages) 19Ai and 19Aii; MPO (neutrophils) 19Bi and 19Bii; IAP 19Ci and 19Cii and PGE2 19Di and 19Dii. The slide results were counted at 200x magnification. The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test (n=10); (n=8 MUFA + n-3 PUFA). The above data was adjusted to reflect the effect of fish oil on the background diet. The raw values for HFD, fish oil and statistical analysis are presented in Table 8. The white bars represent uninfected mice and the black bars represent infected mice. ND= no detection. 87  4.5 Mice fed n-6 PUFA supplemented with n-3 PUFA resulted in impaired pro-inflammatory cytokine responses during infectious colitis. 4.5.1 Uninfected groups.  The cytokine responses prior to infection were the highest in the n-6 PUFA + n-3 PUFA  fed mice with increased levels of  IFN-γ (Figure 21Bi), IL-17a (Figure 21Ci) and MCP-1 (Figure 21Ei) compared to the other mice.  In contrast Relm-β (Figure 21Fi) had varying results between the mice fed each diet. The addition of n-3 PUFA to MUFA resulted in a drop in MCP-1 (Table 9).  These findings indicated that prior to infection the n-6 PUFA + n-3 PUFA diet resulted in increased pro-inflammatory responses. 4.5.2 Infected groups.  The pro-inflammatory cytokines and chemokines are important during infection and their expression varies in mice fed each dietary oils. The MUFA + n-3 PUFA fed mice had decreased TNF-α (Figure 21Aii), IFN-γ (Figure 21Bii), and iNOS (Figure 21Dii) expression compared to SFA + n-3 PUFA fed mice.  The addition of n-3 PUFA to a SFA background diet resulted in a significant reduction in MCP-1 (Table 9). Overall, during infection n-6 PUFA + n-3 PUFA had impaired pro-inflammatory cytokines and chemokines.             88  Table 9. Pro-inflammatory cytokine and chemokine values from mice fed high fat and fish oil diets used in Figure 21. A student t-test was used to compare n-3 PUFA supplemented mice to mice fed background diets (n=10); (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05.        Response Treatment HFD (Gene expression) HFD + n-3 PUFA (Gene Expression) Student t-test (p-value) Significance (S) or (N.S) TNF-α Uninfected n-6 PUFA 0.8 +/- 0.1 2.0 +/- 1.5 0.4124 N.S MUFA 6.1 +/- 2.5 4.1 +/- 0.4 0.3351 N.S SFA 5.3 +/- 1.3 3.2 +/- 0.7 0.1590 N.S Infected n-6 PUFA 11.8 +/- 2.5 17.6 +/- 4.3 0.4841 N.S MUFA 24.0 +/- 10.2 7.8 +/- 1.9 0.1622 N.S SFA 121.6+/- 38.8 116.9 +/- 29.2 0.9188 N.S IFN-γ Uninfected n-6 PUFA 0.9 +/- 0.0 8.2 +/- 5.1 0.2755 N.S MUFA 18.7 +/- 13.1 12.3 +/- 2.5 0.6391 N.S SFA 15.5 +/- 3.8 8.1 +/- 1.7 0.0831 N.S Infected n-6 PUFA 91.2 +/- 44.0 67.1 +/- 18.9 0.5969 N.S MUFA 192.5 +/- 101.4 8.1 +/- 2.0 0.0983 N.S SFA 842.8 +/- 314.1 629.7 +/- 175.9 0.5401 N.S IL-17a Uninfected n-6 PUFA 0.4 +/- 0.2 5.6 +/- 4.4 0.2268 N.S MUFA 0.4 +/- 0.2 0.3 +/- 0.1 0.9299 N.S SFA 0.7 +/- 0.3 0.4 +/- 0.1 0.2986 N.S Infected n-6 PUFA 9.0 +/- 5.7 18.0 +/- 5.5 0.2456 N.S MUFA 3.0 +/- 0.9 3.7 +/- 0.7 0.5326 N.S SFA 11.6 +/- 2.8 10.5 +/- 2.7 0.7761 N.S 89  Response Treatment HFD (Gene expression) HFD + n-3 PUFA (Gene Expression) Student t-test (p-value) Significance (S) or (N.S) iNOS Uninfected n-6 PUFA 1.3 +/- 0.5 11.2 +/- 12.5 0.3930 N.S MUFA 25.3 +/- 19.4 12.0 +/- 1.5 0.5079 N.S SFA 11.6 +/- 6.1 5.1 +/- 1.1 0.2813 N.S Infected n-6 PUFA 165.5 +/- 67.6 112.0 +/- 44.3 0.4879 N.S MUFA 514.2 +/- 294.5 11.7 +/- 2.8 0.1295 N.S SFA 1859.4 +/- 780.1 3941.8 +/- 719.8 0.5366 N.S MCP-1 Uninfected n-6 PUFA 0.4 +/- 0.2 1.1 +/- 0.5 0.2273 N.S MUFA 10.6 +/- 2.5 4.6 +/- 0.4 0.0368 S SFA 6.2 +/- 1.0 7.7 +/- 2.1 0.4950 N.S Infected n-6 PUFA 0.3 +/- 0.3 0.5 +/- 0.3 0.7042 N.S MUFA 17.2 +/- 6.7 5.5 +/- 1.3 0.1305 N.S SFA 7.8 +/- 1.9 2.4 +/- 0.5 0.0080 S Relm-β Uninfected n-6 PUFA 3.6 +/- 2.6 0.4 +/- 0.4 0.2884 N.S MUFA 1.4 +/- 1.2 4.2 +/- 1.1 0.1200 N.S SFA 5.2 +/- 3.5 1.3 +/- 0.4 0.2309 N.S Infected n-6 PUFA 332.8 +/- 166.9 280.8 +/- 88.3 0.7714 N.S MUFA 52.4 +/- 23.4 32.7 +/- 10.4 0.4685 N.S SFA 114.8 +/- 31.2 58.5 +/- 14.9 0.0938 N.S          90         91        92   Figure 21. Mice fed n-3 PUFA supplemented to n-6 PUFA resulted in impaired pro-inflammatory responses during infectious colitis. The diet groups used were n-6 polyunsaturated fatty acid + n-3 PUFA (n-3 PUFA + n-6 PUFA), monounsaturated fatty acid + n-3 PUFA (MUFA + n-3 PUFA) and saturated fatty acids + n-3 PUFA (SFA + n-3 PUFA). The relative mRNA expression was determined by taking isolated RNA from colonic tissues and running qPCR with 18S rRNA as the reference gene. The following pro-inflammatory responses were analyzed: TNF-α 20Ai and 20Aii, IFN-γ 20Bi and 20Bii, IL-17a 20Ci and 20Cii, iNOS 20Di and 20Dii, MCP-1 20Di and 20Eii, and Relm-β 20Fi and 20Fii. The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test for parametric data and Kruskal- Wallis with Dunn’s post-hoc test for non-parametric data (n=10); (n=8 MUFA + n-3 PUFA). The above data was adjusted to reflect the effect of fish oil on the background diet. The raw values for HFD, fish oil and statistical analysis are presented in Table 9. The white bars represent uninfected mice and the black bars represent infected mice. 93  4.6 Mice fed MUFA + n-3 PUFA diets had increased levels of anti-inflammatory responses during infectious colitis. 4.6.1 Uninfected groups.  The mice fed MUFA + n-3 PUFA had the highest level of IL-10 (Figure 22Ai). In contrast n-6 PUFA + n-3 PUFA had highest levels of Reg3γ (Figure 22Ci) compared to mice fed n-3 PUFA supplemented to SFA. IL-23a (Figure 22Ei) was increased in mice fed SFA supplemented to n-3 PUFA (Table 10). Mice fed diets of n-3 PUFA supplemented to SFA resulted in a decrease in IL-10; while mice fed MUFA supplemented diets caused an increase in IL-10 (Table 10). Foxp3 positive Treg cells were increased when n-3 PUFA was placed on a MUFA background diet and decreased when n-3 PUFA was added to SFA (Figure 22Di); (Table 10). Overall, there was an increase in these anti-inflammatory mediators in the n-6 PUFA + n-3 PUFA group prior to infection. 4.6.2 Infected groups.  The infected groups had different responses when compared to the uninfected mice. There were no significant differences in the diet groups for IL-10 (Figure 22Aii), IL-33 (Figure 22Bii), Reg3γ (Figure 22Cii), IL-22 (Figure 22Dii) and Foxp3+ Treg cells (Figure 22Fii).  The addition of n-3 PUFA to a SFA diet resulted in a reduction in IL-10 and IL-33 (Figure 22Ei) expression, while the addition of n-3 PUFA to n-6 PUFA reduced infiltrating Treg cells (Table 10). Overall, the addition of n-3 PUFA to SFA diets resulted in a reduction of these important anti-inflammatory mechanisms in mice during infection.          94  Table 10. Anti-inflammatory mediator values from mice fed high fat and fish oil diets used in Figure 22. A student t-test was used to compare n-3 PUFA supplemented mice to mice fed background diets (n=10); (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05. Response Treatment HFD (Gene Expression) HFD + n-3 PUFA (Gene Expression) Student t-test (p-value) Significance (S) or (N.S) IL-10 Uninfected n-6 PUFA 0.8 +/- 0.2 1.4 +/- 0.3 0.3067 N.S MUFA 4.3 +/- 1.0 8.8 +/- 1.5 0.0193 S SFA 10.3 +/- 2.0 4.7 +/- 0.6 0.0134 S Infected n-6 PUFA 2.2 +/- 0.5 2.3 +/- 0.4 0.9180 N.S MUFA 5.7 +/- 1.3 5.3 +/- 1.4 0.8639 N.S SFA 10.0 +/- 1.4 5.4 +/- 0.7 0.0076 S IL-33 Uninfected n-6 PUFA 0.6 +/- 0.2 0.8 +/- 0.2 0.4756 N.S MUFA 3.5 +/ 0.9 4.7 +/- 1.0 0.3477 N.S SFA 6.1 +/- 2.4 2.4 +/- 0.7 0.2950 N.S Infected n-6 PUFA 3.4 +/- 1.8 2.4 +/- 1.3 0.6178 N.S MUFA 6.4 +/- 2.9 7.8 +/- 2.6 0.7013 N.S SFA 14.8 +/- 5.4 2.2 +/- 0.9 0.0391 S Reg3γ Uninfected n-6 PUFA 1.3 +/- 0.3 2.4 +/- 0.6 0.3508 N.S MUFA 1.2 +/- 0.5 2.6 +/- 0.7 0.1710 N.S SFA 8.4 +/- 2.3 1.4 +/- 0.3 0.0649 N.S Infected n-6 PUFA 287.6 +/- 104.6 144.8 +/- 86.5 0.3002 N.S MUFA 128.1 +/- 65.4 365.2 +/- 172.1 0.1710 N.S SFA 819.1 +/- 329.4 447.5 +/- 82.6 0.2432 N.S 95    Response Treatment HFD (Gene Expression) HFD + n-3 PUFA (Gene Expression) Student t-test (p-value) Significance (S) or (N.S) IL-22 Uninfected n-6 PUFA 1.0 +/- 0.2 1.4 +/- 0.6 0.5274 N.S MUFA 4.2 +/- 0.9 6.3 +/- 3.8 0.6093 N.S SFA 3.4 +/- 0.4 2.2 +/- 0.4 0.0329 S Infected n-6 PUFA 9.9 +/- 4.1 8.6 +/- 3.5 0.8050 N.S MUFA 11.0 +/- 2.6 5.7 +/- 1.5 0.1196 N.S SFA 12.4 +/- 1.8 15.5 +/- 5.5 0.5999 N.S IL-23a Uninfected n-6 PUFA 0.6 +/- 0.2 1.8 +/- 0.5 0.0635 N.S MUFA 5.0 +/- 1.4 9.2 +/- 2.7 0.1584 N.S SFA 10.3 +/- 2.8 3.9 +/- 0.9 0.0412 S Infected n-6 PUFA 3.7 +/- 2.8 5.0 +/- 2.0 0.6933 N.S MUFA 4.7 +/- 1.0 11.6 +/- 3.7 0.0641 N.S SFA 14.236 +/- 6.7 2.7 +/- 0.3 0.0736 N.S Response Treatment HFD (Cell Counts) HFD + n-3 PUFA (Cell Counts) Student t-test (p-value) Significance (S) or (N.S) Treg Uninfected n-6 PUFA 29.7 +/- 2.9 29.3 +/- 1.8 0.9192 N.S MUFA 13.1 +/- 1.3 18.4 +/- 0.6 0.0010 S SFA 32.1 +/- 1.3 26.7 +/- 1.8 0.0319 S Infected n-6 PUFA 12.2 +/- 0.7 9.4 +/- 1.1 0.0433 S MUFA 36.6 +/- 2.4 41.2 +/- 8.8 0.7132 N.S SFA 63.5 +/- 11.8 57.2 +/- 10.0 0.6545 N.S 96          97         98  Figure 22. Mice fed SFA diets supplemented with n-3 PUFA had decreased anti-inflammatory mediators during infectious colitis. The diet groups used were n-6 polyunsaturated + n-3 PUFA (n-6 PUFA + n-3 PUFA), monounsaturated fatty acid + n-3 PUFA (MUFA + n-3 PUFA) and saturated fatty acid diets + n-3 PUFA (SFA + n-3 PUFA). The following mRNA expressions were analyzed: IL-10 21 Ai and 21 Aii; IL-33 21 Bi and 21 Bii; Reg3γ 21 Ci and 21 Cii; IL-22 21 Di and Dii; IL-23a Ei and Eii and18S rRNA was used as the reference gene. The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test for parametric data and Kruskal- Wallis with Dunn’s post-hoc test for non-parametric data (n=10); (n=8 MUFA + n-3 PUFA). 21 Fi and 21 Fii Treg cells were analyzed by staining mouse colonic sections with the Foxp3 antibody (n=10); (n=8 MUFA + n-3 PUFA) and the results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test (n=10); (n=8 MUFA + n-3 PUFA). The above data was adjusted to reflect the effect of fish oil on the background diet. The raw values for HFD, fish oil and statistical analysis are presented in Table 10. The white bars represent uninfected mice and the black bars represent infected mice.   99  4.7 There were no significant differences in the FA receptors during infectious colitis. 4.7.1 Uninfected groups.  The FA receptors that are important during colitis: GPR41 (Figure 23Ai), GPR43 (Figure 23Bi), GPR40 (Figure 23Ci) and GPR120 (Figure 23Di), were not significantly different in mice prior to infection. Mice fed diets of n-3 PUFA supplemented to SFA resulted in a drop in GPR120 (Table 11). Overall, there are no major differences in these FA receptors in mice prior to infection between the diets. 4.7.2 Infected groups.  The level of the FA receptor GPR120 was the highest in the mice fed MUFA + n-3 PUFA compared to the mice fed the other two diets (Figure 23Dii). Mice fed n-3 PUFA supplemented to SFA resulted in a reduction in the GPR41 and GPR120 receptor during infection (Table 11). Overall, there were no major differences in the FA receptors in mice during infection.                      100  Table 11. Intestinal FA receptor values from the mice fed high fat and fish oil diets used in Figure 23. A student t-test was used to compare n-3 PUFA supplemented mice to mice fed background diets (n=10); (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05.   Response Treatment HFD (Gene Expression) HFD + n-3 PUFA (Gene Expression) Student t-test (p-value) Significance (S) or (N.S) GPR41 Uninfected n-6 PUFA 0.9 +/- 0.1 3.8 +/- 3.8 0.4908 N.S MUFA 10.9 +/- 3.2 11.0 +/- 3.3 0.9915 N.S SFA 13.4 +/- 1.9 7.9 +/- 2.0 0.0537 N.S Infected n-6 PUFA 7.9 +/- 3.8 8.2 +/- 3.6 0.9401 N.S MUFA 14.4 +/- 6.2 18.9 +/- 6.1 0.5915 N.S SFA 25.4 +/- 6.8 7.9 +/- 1.5 0.0133 S GPR43 Uninfected n-6 PUFA 1.9 +/- 0.7 1.1 +/- 0.8 0.4775 N.S MUFA 4.3 +/- 1.1 2.3 +/- 0.3 0.1105 N.S SFA 6.6 +/- 3.6 1.7 +/- 0.1 0.1776 N.S Infected n-6 PUFA 3.5 +/- 1.5 2.9 +/- 1.1 0.4475 N.S MUFA 6.7 +/- 1.5 7.2 +/- 2.8 0.8618 N.S SFA 9.1 +/- 3.7 6.2 +/- 1.5 0.4463 N.S GPR40 Uninfected n-6 PUFA 1.3 +/- 0.2 1.3 +/- 1.0 0.4446 N.S MUFA 10.6 +/- 6.1 7.3 +/- 2.1 0.5929 N.S SFA 19.9 +/- 8.6 6.5 +/- 1.6 0.1262 N.S Infected n-6 PUFA 7.8+/- 5.3 14.3 +/- 9.5 0.5180 N.S MUFA 10.8 +/- 3.9 5.6 +/- 2.4 0.5939 N.S SFA 71.8 +/- 28.4 18.7 +/- 12.2 0.0887 N.S 101                             Response Treatment HFD (Gene Expression) HFD + n-3 PUFA (Gene Expression) Student t-test (p-value) Significance (S) or (N.S) GPR120 Uninfected n-6 PUFA 2.4 +/- 1.9 1.7 +/- 1.1 0.7265 N.S MUFA 4.5 +/- 0.6 3.7 +/- 0.6 0.4122 N.S SFA 5.4 +/- 0.7 2.9 +/- 0.5 0.0128 S Infected n-6 PUFA 3.4 +/- 2.0 2.6 +/- 0.8 0.7303 N.S MUFA 4.1 +/- 0.6 6.4 +/- 1.2 0.0909 N.S SFA 4.5 +/- 1.0 2.0+/- 0.2 0.0152 S 102               103    Figure 23. There were no significant changes in FA receptors during infectious colitis in mice fed diets supplemented with n-3 PUFA. The diet groups used were n-6 polyunsaturated fatty acid + n-3 PUFA (n-6 PUFA + n-3 PUFA), monounsaturated fatty acid + n-3 PUFA (MUFA + n-3 PUFA) and saturated fatty acids + n-3 PUFA (SFA + n-3 PUFA). The mRNA gene expressions analyzed were: GPR41 22 Ai and Aii; GPR43 22 Bi and Bii, GPR40 22Ci and 22 Cii; GPR120 22 Di and 22Dii and18S rRNA was used as the reference gene. The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test for parametric data and Kruskal- Wallis with Dunn’s post-hoc test for non-parametric data (n=10); (n=8 MUFA + n-3 PUFA). The above data was adjusted to reflect the effect of fish oil on the background diet. The raw values for HFD, fish oil and statistical analysis are presented in Table 11. The white bars represent uninfected mice and the black bars represent infected mice.   104  4.8 Mice fed n-6 PUFA + n-3 PUFA had increased levels of IL-15, a key sepsis marker.  4.8.1 Uninfected groups.  The serum levels of IL-15 were significantly higher in mice fed SFA + n-3 PUFA compared to mice fed MUFA + n-3 PUFA (Figure 24Ai). IL-3 (Figure 24Bi), IL-12(70) (Figure 24Ci), M-CSF (Figure 24Di) and RANTES (Figure 24Ei) serum levels were also analyzed. Prior to infection RANTES was increased in mice fed MUFA + n-3 PUFA compared to mice fed n-6 PUFA + n-3 PUFA. RANTES was also increased in mice fed SFA+ n-3 PUFA compared to mice fed n-6 PUFA + n-3 PUFA (Figure 24Ei).  These results indicated that prior to infection serum cytokine expression was low for all diet groups. 4.8.2 Infected groups.  The serum levels of IL-15 were higher in the mice fed n-6 PUFA + n-3 PUFA compared to mice fed the other two diets (Figure 24Aii). Mice fed n-3 PUFA supplemented to n-6 PUFA resulted in a significant increase in this marker for sepsis (Table 12). There was no significance found between the diet groups for the following serum cytokines: IL-3 (Figure 24Bii), IL-12(70) (Figure 24Cii), M-CSF (Figure 24Dii) and RANTES (Figure 24Eii). Overall, n-3 PUFA supplemented to n-6 PUFA had no effect on serum cytokine expression in mice.           105  Table 12. Serum cytokine and chemokine values from mice fed high fat and fish oil diets used in Figure 24. A student t-test was used to compare n-3 PUFA supplemented mice to mice fed background diets (n=10); (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05.   Response Treatment HFD (Gene Expression) HFD + n-3 PUFA (Gene Expression) Student t-test (p-value) Significance (S) or (N.S) IL-15 Uninfected n-6 PUFA 53.0 +/- 31.5 30.0 +/- 8.0 0.4531 N.S MUFA 117.0 +/- 84.3 40.2 +/- 0.8 0.3337 N.S SFA 40.7 +/- 2.1 37.2 +/- 3.8 0.3979 N.S Infected n-6 PUFA 41.0 +/- 1.2 411.2 +/- 94.7 0.0171 S MUFA 59.7 +/- 15.0 35.0 +/- 4.3 0.1182 N.S SFA 41.5 +/- 4.1 33.0 +/- 1.6 0.0700 N.S IL-3 Uninfected n-6 PUFA 16.5 +/- 4.4 16.2 +/- 2.9 0.9589 N.S MUFA 28.5 +/- 3.8 29.5 +/- 1.5 0.7895 N.S SFA 31.5 +/- 7.0 23.5 +/- 3.3 0.2797 N.S Infected n-6 PUFA 47.2 +/- 3.6 51.2 +/- 0.7 0.2589 N.S MUFA 27.5+/- 5.2 32.5 +/- 6.5 0.5179 N.S SFA 23.5 +/- 2.7 24.2 +/- 2.6 0.8284 N.S IL-12(70) Uninfected n-6 PUFA 20.2 +/- 2.5 18.2 +/- 0.2 0.3961 N.S MUFA 24.5 +/- 3.5 20.2 +/- 3.6 0.3765 N.S SFA 24.7 +/- 4.5 33.5 +/- 12.2 0.4689 N.S Infected n-6 PUFA 100.5 +/- 13.0 79.7 +/- 18.4 0.3293 N.S MUFA 28.0 +/- 10.0 27.5 +/- 2.0 0.9565 N.S SFA 19.0 +/- 1.2 17.7 +/- 1.1 0.4345 N.S 106  Response Treatment HFD (Gene Expression) HFD + n-3 PUFA (Gene Expression) Student t-test (p-value) Significance (S) or (N.S) M-CSF Uninfected n-6 PUFA 26.2 +/- 1.4 19.5 +/- 5.0 0.1910 N.S MUFA 19.0 +/- 2.0 22.2 +/- 1.5 0.1923 N.S SFA 17.2 +/- 3.1 18.0 +/- 3.4 0.8592 N.S Infected n-6 PUFA 44.2 +/- 5.7 40.5 +/- 1.7 0.5013 N.S MUFA 24.0 +/- 3.1 19.7 +/- 2.1 0.2485 N.S SFA 18.7 +/- 1.2 19.2 +/- 1.5 0.7811 N.S RANTES Uninfected n-6 PUFA 148.0 +/- 57.2 49.0 +/- 6.7 0.0947 N.S MUFA 47.0 +/- 10.2 58.0 +/- 10.7 0.4256 N.S SFA 75.5 +/- 27.1 62.2 +/- 2.9 0.5953 N.S Infected n-6 PUFA 179.5 +/- 25.8 133.7 +/- 21.0 0.1643 N.S MUFA 49.5 +/- 13.1 45.7 +/- 2.9 0.7581 N.S SFA 31.5 +/- 2.8 46.5 +/- 10.1 0.1518 N.S            107           108             109               Figure 24. Serum IL-15, a key marker for sepsis was significantly increased in mice fed n-6 PUFA + n-3 PUFA during infectious colitis. The diet groups used were n-6 polyunsaturated fatty acid + n-3 PUFA (n-6 PUFA + n-3 PUFA), monounsaturated fatty acid + n-3 PUFA (MUFA + n-3 PUFA) and saturated fatty acid + n-3 PUFA (SFA + n-3 PUFA). Cardiac puncture was used to collect the sera of mice for ELISA analysis; the analysis was conducted at Eve Technologies. A) The uninfected mice were analyzed for IL-15 (Ai), sepsis marker measured in pg/mL sera. IL-3 (Bi), IL-12(70) (Ci), M-CSF (Di) and RANTES (Ei) B) The infected mice were analyzed for IL-15 (Aii), IL-3 (Bii), IL-12(70) (Cii), M-CSF (Dii), RANTES (Eii). The results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test (n=10); (n=8 MUFA + n-3 PUFA). The above data was adjusted to reflect the effect of fish oil on the background diet. The raw values for HFD, fish oil and statistical analysis are presented in Table 12. The white bars represent uninfected mice and the black bars represent infected mice.     110  4.9 IAP’s ability to dephosphorylate LPS was increased in the mice fed SFA+ n-3 PUFA during infectious colitis. 4.9.1 Uninfected groups.  LPS-dephosphorylation in the intestine following high fat feeding is higher in n-6 PUFA + n-3 PUFA mice compared to mice fed SFA and MUFA diets supplemented with n-3 PUFA (Figure 25A). Mice fed n-3 PUFA supplemented to MUFA resulted in a decrease in IAP activity. 4.9.2 Infected groups.  During infection LPS-dephosphorylation in the mice fed MUFA + n-3 PUFA and n-6 PUFA + n-3 PUFA diets remained low while increasing in SFA + n-3 PUFA fed mice (Figure 25B). Mice fed n-3 PUFA supplemented to a MUFA diet resulted in a decrease in IAP activity (Table 13). Overall, SFA + n-3 PUFA had increased LPS-dephosphorylation during infection.              111  Table 13. IAP LPS-dephosphorylating values from mice fed high fat and fish oil diets used in Figure 25. A student t-test was used to compare n-3 PUFA supplemented mice to mice fed background diets (n=10); (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05. Response Treatment HFD (Activity /mg of Protein) HFD + n-3 PUFA (Activity/mg of Protein) Student t-test (p-value) Significance (S) or (N.S) IAP LPS-dephosphorylat- ing activity Uninfected n-6 PUFA 506961.5 +/- 37044.3 567199.4 +/- 117912.5 0.5940 N.S MUFA 658450.7 +/- 171296.6 192969.0 +/- 38469.5 0.0180 S SFA 584738.5 +/- 227366.8 445110.7 +/- 97566.2 0.5578 N.S Infected n-6 PUFA 649926.0 +/- 95693.7 574826.3 +/- 51632.5 0.4772 N.S MUFA 1362451.1 +/- 335983.9 279297.9 +/- 38293.5 0.0110 S SFA 557547.7 +/- 73161.1 632544.7 +/- 84937.2 0.4910 N.S           112               Figure 25. LPS-dephosphorylation was increased in the SFA + n-3 PUFA fed mice during infectious colitis. The diet groups used were n-6 polyunsaturated fatty acid + n-3 PUFA (n-6 PUFA + n-3 PUFA), monounsaturated fatty acid + n-3 PUFA (MUFA + n-3 PUFA) and saturated fatty acid diets + n-3 PUFA (SFA + n-3 PUFA). A) The uninfected tissues from mice stored in liquid nitrogen were homogenized and analyzed using the LPS-dephosphorylation assay and malachite green solution. The activity of IAP was determined using LPS-dephosphorylation activity/mg of protein measured at 620 nm. B) Infected tissue samples from mice were also analyzed using the LPS-dephosphorylation assay to study IAP activity. The results in Figure A and B were expressed using means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test (n=10); (n=8 MUFA + n-3 PUFA). The above data was adjusted to reflect the effect of fish oil on the background diet. The raw values for HFD, fish oil and statistical analysis are presented in Table 13. The white bars represent uninfected mice and the black bars represent infected mice.   113  4.10 Total AP activity was not significantly different in mice during infectious colitis. 4.10.1 Uninfected and infected groups.  In order to further study the IAP enzyme and its role during colitis in the colon, I analyzed the total activity of mice. The total AP activity prior to infection (Figure 26A) was increased in mice fed n-6 PUFA and MUFA supplemented diets, compared to mice fed SFA. During infection (Figure 26B); (Table 14) AP activity was not significantly different in mice.  Table 14. Total AP activity values from mice fed high fat and fish oil diets used in Figure 26. A student t-test was used to compare n-3 PUFA supplemented mice to mice fed background diets (n=10); (n=8 MUFA + n-3 PUFA). The results were considered significant if p<0.05.   Response Treatment HFD (Activity/mg of Protein) HFD + n-3 PUFA (Activity/mg of Protein) Student t-test (p-value) Significance (S) or (N.S) Total AP activity Uninfected n-6 PUFA 59535.6 +/- 174.6 59981.7 +/- 643.4 0.4691 N.S MUFA 248286.1 +/- 32972.7 281749.0 +/- 18104.2 0.3765 N.S SFA 182070.2 +/- 37592.7 196746.4 +/- 35060.8 0.7659 N.S Infected n-6 PUFA 59433.6 +/- 155.4 59474.2 +/- 191.1 0.8647 N.S MUFA 606657.2 +/- 1590470.1 546469.5 +/- 76125.3 0.7541 N.S SFA 576049.0 +/- 44444.5 636096.1 +/- 57295.5 0.3954 N.S 114            Figure 26. Mice were not significantly different in total AP activity during infectious colitis.  The diet groups used were n-6 polyunsaturated fatty acid + n-3 PUFA (n-6 PUFA + n-3 PUFA), monounsaturated fatty acid + n-3 PUFA (MUFA + n-3 PUFA) and saturated fatty acid diets + n-3 PUFA (SFA + n-3 PUFA). A) The uninfected tissues from mice were stored in liquid nitrogen and homogenized and analyzed using the total AP assay. The activity of AP was determined using (AP activity/mg of protein measured at Ex/Em 360/440. B) The infected tissues from mice were also analyzed using the total AP kit to study AP activity. The results in Figure A and B were expressed using means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test (n=10); (n=8 MUFA + n-3 PUFA). No significance was seen in Figure B. The above data was adjusted to reflect the effect of fish oil on the background diet. The raw values for HFD, fish oil and statistical analysis are presented in Table 14. The white bars represent uninfected mice and the black bars represent infected mice. 115  4.11 IAP activity in RAW 264.7 macrophage cell lines were unchanged in FA supplemented with DHA/EPA.  RAW 264.7 macrophage cells with and without LPS stimulation, when analyzed at 4 and 7.5 hours, provided no significant information about the relationship between IAP and macrophages. There were no differences in IAP activity for any of the FA diets supplemented with both DHA and EPA (Figure 14B).  4.12 IAP activity was impaired in Caco-2 cells stimulated with OA + DHA and EPA during LPS stimulation.  Mice fed n-3 PUFA supplemented to a MUFA diet resulted in a decrease in intestinal epithelial expression of IAP (Figure 27A). Next Caco-2 human epithelial cells were stimulated with a particular FA and LPS. There was no increased difference at 7.5 hours of LPS stimulation for the OA + DHA and EPA and the BSA vehicle control had higher IAP activity compared to this FA group (Figure 16B). I used pH strips to measure the pH of the homogenates and I found the pH to be 7 for all samples (Figure 16B). Since the pH strips used were not sensitive to small changes in pH it is possible the changes in IAP activity were due to an altered pH. Overall, the addition of DHA and EPA to each FA resulted in no significant change in IAP activity.       116       Figure 27. Caco-2 epithelial cells had no significant difference in IAP activity during LPS stimulation. A) Epithelial expression of IAP in the colon of mice infected with C. rodentium. The red stain shown with the arrow indicates IAP’s location in the gut. Images were taken at 200x magnification (white scale bar = 56.5 μm).  B) The FA groups analyzed were: BSA (control), LA + DHA/EPA, OA+ DHA/EPA and PA + DHA/EPA. The zero time point represents control values i.e. cells + FA without LPS. Caco-2 cells with a starting cell count of 50,000 cells/well were stimulated with LPS for 7.5 hours. The LPS-dephosphorylation assay was conducted as previously described and activity was measured at 620 nm. There results were expressed as means +/- SEM. Results were considered significant when (*p<0.05), this was determined using a One-Way ANOVA with a Tukey post-hoc test; (n=5). 117  4.13 Summary of results.  The analyses of colonic damage, infiltration of immune cells, pro and anti-inflammatory responses were unchanged between the MUFA + n-3 PUFA and SFA + n-3 PUFA fed mice. In contrast, mice fed n-6 PUFA + n-3 PUFA had impaired colitic responses, and increased IL-15-, a key marker for sepsis and low IAP expression. Overall, mice fed n-3 PUFA + n-6 PUFA had detrimental effects to the host, while there were no beneficial or detrimental effects found in the MUFA + n-3 PUFA or SFA + n-3 PUFA fed mice during colitis.                  118  Chapter 5: Discussion. 5.1 The effects of HFD on infectious colitis.  MUFA, SFA and n-6 PUFA diets were tested for morbidity, mortality, immune cell infiltration, pro-inflammatory and anti-inflammatory mediators and IAP activity in mice infected with C. rodentium in vivo, and IAP activity in Caco-2 cells stimulated with LPS in vitro. I hypothesized that MUFA fed to mice reduces inflammation, while SFA and n-6 PUFA fed to mice are pro-inflammatory.  To address the first part of my hypothesis I analyzed the morbidity and mortality of mice undergoing colitis. It was determined that mice fed MUFA, SFA and n-6 PUFA diets had 100% survival during the 10 day course of infection, while mice fed  SFA diets had a drop in weight during colitis. However, by day 10 SFA fed mice were able to gain weight. Maintaining weight during colitis is critical for survival as colitis results in fluid loss through diarrhoea [141]. I also analyzed colonic damage during infection and found that the n-6 PUFA fed mice had increased damage, while MUFA fed mice were protective.  To further address my hypothesis I analyzed the level of infiltrating immune cells in the lamina propria and found that the SFA and n-6 PUFA fed mice had exacerbated inflammatory cell infiltration of macrophages and neutrophils compared to the uninfected mice. SFA are known to induce pro-inflammatory responses during colitis [76], which validates our results. SFA fed mice also had decreased levels of IAP, a known enzyme important in LPS-dephosphorylation [142] and homeostatic regulation in the gut [143]. Since SFA fed to mice induced infiltrating immune cells, I also analyzed pro-inflammatory cytokines.  SFA induced cytokines  implemented in IBD such as: TNF-α, IFN-γ and IL-17a [44]. These cytokine levels seen in SFA fed mice were similar in the n-6 PUFA fed mice. Unlike n-6 PUFA and SFA fed mice, MUFA diets fed to mice were protective during colitis as they resulted in dramatically 119  reduced levels of pro-inflammatory cytokines. Interestingly, MUFA fed mice had a significant increase in macrophage-chemotactic protein-1 (MCP-1). Since MUFA fed mice were low in inflammation these macrophages are potentially M2 macrophages, which are important for wound healing and repair [144], resulting in increased protection to the host during colitis [145]. This would also explain the reduction in colonic damage seen in MUFA fed mice during colitis.  Inflammation is an important response to rid the host of infection; however, anti-inflammatory mediators are vital to the host to maintain homeostasis. SFA diets fed to mice, unlike the n-6 PUFA fed mice, were able to stimulate factors important in inflammatory resolution.  SFA diets fed to mice stimulated increased levels of IL-23a, which is important for fighting bacterial infection [146]. IL-23a has also been shown to be necessary in the early induction of IL-22, a cytokine important in fighting C. rodentium infection [147]. The importance of IL-22 was demonstrated in IL-22 KO mice, which had increased colitic responses and mortality during C. rodentium infection [147]. IL-22 is also important for the induction of another important anti-inflammatory response, Reg3γ [147]. Reg3γ is an anti-microbial peptide that blocks bacterial translocation, resulting in mucosal protection [148], however, Reg3γ was unable to block all bacterial translocation.  Despite this, SFA fed mice didn’t succumb to bacterial sepsis because of increased serum cytokines such as IL-3, which stimulated further immune responses. IL-23a, IL-22 and Reg3γ were all increased in the SFA fed mice during colitis. These results demonstrated the potential benefit of consuming a diet high in SFA, a finding that is not largely accepted in the nutritional world. SFA have been demonized as “bad fats”, however during colitis they prove to be protective. SFA diets also promoted increased levels of IL-33, which is important for stimulating Treg cells in mice [149]. Treg cells are important for maintaining homeostasis and thus keep inflammation in check [150]. Our results confirm this as SFA fed mice have increased levels of Foxp3 positive cells, a marker for Treg 120  cells. MUFA diets fed to mice didn’t induce high levels of Treg cells because MUFA diets are protective under uninfected conditions.  Finally, to address the last part of my hypothesis, activity of IAP was analyzed in vivo and in vitro. As previously mentioned, IAP is important for regulating homeostasis in the gut by dephosphorylating anti-microbial peptides such as LPS [98]. IAP has also been previously shown to be important in preventing sepsis-induced mortality during colitis [102]. In our in vivo model I demonstrated that MUFA diets fed to mice promoted similar levels of IAP activity pre and post infection, which aided in its protection during infection.  IAP LPS dephosphorylating activity may have aided in the lack of colitis by detoxifying bacterial pathogens before they could interact with the epithelium and cause damage. It has also been shown that the microbiota is important in regulating IAP activity [143], and therefore the microbiota potentially aided in our increased IAP activity in MUFA fed mice. MUFA fed mice in vivo had increased epithelial expression of IAP. Epithelial expression of IAP during infection has been demonstrated in previous studies [151], which supported our findings; however, it has been shown that IAP is secreted into the colon [99]. Therefore, I analyzed Caco-2 epithelial cells and RAW 264.7 macrophages. Caco-2 cells had increased epithelial expression of IAP when stimulated with OA. I also analyzed IAP activity in RAW 264.7 macrophage cells and found no significant differences in activity between the FA. IAP activity is potentially occurring predominantly at the epithelium and not with macrophages in the submucosa during colitis.  This result again demonstrated the protective nature of MUFA diets fed to mice during colitis, as IAP is known for protecting the intestinal epithelium during IBD [152]. The results also demonstrated that n-6 PUFA diets when fed to mice are better during non-colitic conditions while MUFA and SFA diets are better during colitis.   121  5.2 The effects of fish oil supplementation during infectious colitis.  MUFA, SFA and n-6 PUFA diets all supplemented with n-3 PUFA were tested for morbidity, mortality, immune cell infiltration, pro-inflammatory and anti-inflammatory mediators and IAP activity in mice infected with C. rodentium in vivo. I also analyzed IAP activity in Caco-2 cells stimulated with LPS in vitro. My second hypothesis was that fish oil would improve the exacerbated colitic response in SFA and MUFA fed mice while having detrimental effects in n-6 PUFA fed mice. To answer the first part of this hypothesis mice survival rates and post-infection weights were analyzed. The supplementation of n-3 PUFA to n-6 PUFA in mice resulted in a 30% drop in survival during infection. The increased mortality rate potentially resulted from infection induced sepsis, indicated by the increased level of IL-15 [153]. IAP expression and activity was also low in this diet group and therefore could not dephosphorylate all the LPS and prevent downstream inflammatory responses. In support of this result, one group showed that the supplementation of n-3 PUFA in the diet did not help patients suffering with CD [84].  The administration of fish oil liquid or capsules showed no difference in UC patient relapse compared to control groups [83]. This potentially could be linked to the impairment of the immune response in diets supplemented with n-3 PUFA. The mice in this thesis also had significant weight loss during colitis, which as previously mentioned, is detrimental to the host during colitis. Other groups verify the detrimental effects of n-3 PUFA supplementation [87,89]. This result was not seen in other HFDs supplemented with fish oil.  Interestingly, mice fed n-6 PUFA + n-3 PUFA diets had low scores of colonic damage with decreased immune cell infiltration, edema and epithelial shedding compared to the other fish oil supplemented diets.  To further address this hypothesis, infiltration of immune cells, pro-inflammatory and anti-inflammatory responses were analyzed and showed no dramatic differences between the diet 122  groups. Mice fed n-3 PUFA supplemented to n-6 PUFA resulted in impaired infiltrating immune cells including: macrophages, neutrophils, PGE2 and IAP expression during colitis. Even though n-3 PUFA fed to mice was able to reverse the exacerbated colitic responses seen with an n-6 PUFA diet, this result may be detrimental to the host during colitis. Mice fed n-3 PUFA supplemented to SFA resulted in impaired anti-inflammatory mediators that were necessary for inflammatory resolution and maintaining homeostasis. The GPR41 receptor important for inflammation resolution [140] was also impaired in mice fed SFA supplemented to n-3 PUFA. Overall, the beneficial or detrimental effects of n-3 PUFA supplementation are still unclear and further investigation is required.            123  Chapter 6: Conclusion and future work. 6.1 Conclusion. Our results demonstrated that, when inflicted with colitis, mice fed diets rich in MUFA are the most protected, whereas n-6 PUFA and SFA mice have increased colitic responses. However, SFA diets resulted in compensating protective homeostatic responses in mice. In contrast, diets supplemented with fish oil can reverse the effects of n-6 PUFA. However, this may have consequences to the host during times of infection when the inflammatory responses are necessary for survival. The addition of supplemented fish oil had a negative outcome when added to a diet rich in n-6 PUFA and had no effect when added to a diet rich in either a MUFA or SFA background diet. 6.2 Research limitations.  I did not have animal facilities, which means that I didn’t have control over the animal experiments and was unable to gain experience working with the animals, since our technician did all the work in Vancouver. The second limitation of this study was that IAP was analyzed in Caco-2 epithelial cells in vitro; however, this is a human cell line and thus direct comparisons cannot be made between our in vivo and in vitro work. There are currently no appropriate mouse epithelial cell lines to utilize and thus Caco-2 cells are our best source to study the effect of diet on the epithelium during LPS stimulation. Another limitation in this study is the use of the C. rodentium model to extrapolate information for IBD. C. rodentium is an infection based model that stimulates an acute infection, whereas IBD is a chronic disease that results in low grade inflammation. Therefore, the inflammatory responses that I saw in the C. rodentium model may not be occurring to the same extent in IBD patients. Our study is also conducted in mice and thus making direct comparisons to humans is not possible. Therefore, human trials are needed to truly   124  understand the effect of diet during IBD. Another limitation with our mouse model is that mice do not normally consume fish; therefore, they may not be physiologically adapted to respond to n-3 PUFA in the same way as humans. Finally, the analysis of immune cells was conducted using immunohistochemistry. A more in depth analysis of infiltrating immune cells would be to use flow cytometry, which allows direct counts to be made and populations of cells to be determined for each sample. 6.3 Future work. Another aspect of the research that should be explored is the effect of knocking down the IAP gene in vitro in the Caco-2 cells. Since I demonstrated an increased activity of IAP in the OA group of Caco-2 cells, it would be interesting to see the result of knocking down the IAP gene in this FA group. Another study to be conducted would be to perform similar IAP experiments, as mentioned in this thesis, in IAP KO mice. Another project that should develop from this research is analyzing a different colitis model such as DSS, which induces a chemical colitis. This will allow us to validate the effects of diet on the host during colitis. Lastly, since I demonstrated earlier that IAP is associated with macrophages in vivo, another cell line besides RAW 264.7 should be analyzed to try and identify the association between macrophages and IAP. 6.4 Significance of research.  This research is important because it draws the attention to two main misconceptions: firstly that SFA diets are harmful and secondly, that n-3 PUFA supplementation is beneficial to mice during colitis. Our data does not support either of these popular assumptions. Another point made in this research is the importance of IAP during colitis. IAP is necessary for survival and is 125  currently being utilized in human clinical trials to help protect against inflammatory diseases. This study may support the use of IAP as a therapeutic for IBD.                       126  References. Canada CsaCFo (2008) The burden of inflammatory bowel disease. Toronto  (CCFC) CsaCFoC (2012) The impact of inflammatory bowel disease in canada 2012 final report and recommendations. Toronto: CCFC. 7 p. U.S. Department of Health and Human Services OoWsH (2005) Inflammatory bowel disease. Alzafiri R, Holcroft CA, Malolepszy P, Cohen A, Szilagyi A (2011) Infliximab therapy for moderately severe Crohn's disease and ulcerative colitis: a retrospective comparison over 6 years. Clin Exp Gastroenterol 4: 9-17. Tursi A, Brandimarte G, Papa A, Giglio A, Elisei W, et al. (2010) Treatment of relapsing mild-to-moderate ulcerative colitis with the probiotic VSL#3 as adjunctive to a standard pharmaceutical treatment: a double-blind, randomized, placebo-controlled study. Am J Gastroenterol 105: 2218-2227. Pearce CB, Lawrance IC (2007) Careful patient selection may improve response rates to infliximab in inflammatory bowel disease. J Gastroenterol Hepatol 22: 1671-1677. Cosnes J, Seksik P (2009) [Inflammatory bowel disease: from sulfasalazine to biologics]. Gastroenterol Clin Biol 33: 692-701. Carvalho R, Hyams JS (2007) Diagnosis and management of inflammatory bowel disease in children. Semin Pediatr Surg 16: 164-171. Siegel CA, Hur C, Korzenik JR, Gazelle GS, Sands BE (2006) Risks and benefits of infliximab for the treatment of Crohn's disease. Clin Gastroenterol Hepatol 4: 1017-1024; quiz 1976. Podolsky KD (2002) Inflammatory Bowel Disease. The New England Journal of Medicine 417-429. Leone V, Chang EB, Devkota S (2013) Diet, microbes, and host genetics: the perfect storm in inflammatory bowel diseases. J Gastroenterol. Trauner M, Fickert P, Tilg H (2013) Bile acids as modulators of gut microbiota linking dietary habits and inflammatory bowel disease: a potentially dangerous liaison. Gastroenterology 144: 844-846. Konstantinov SR, Peppelenbosch MP (2013) Fecal microbiota transfer may increase irritable bowel syndrome and inflammatory bowel diseases-associated bacteria. Gastroenterology 144: e19-20. 127  Hering NA, Fromm M, Schulzke JD (2012) Determinants of colonic barrier function in inflammatory bowel disease and potential therapeutics. J Physiol 590: 1035-1044. Su J, Chen T, Ji XY, Liu C, Yadav PK, et al. (2013) IL-25 Downregulates Th1/Th17 Immune Response in an IL-10-Dependent Manner in Inflammatory Bowel Disease. Inflamm Bowel Dis 19: 720-728. Bernstein CN, Rawsthorne P, Cheang M, Blanchard JF (2006) A population-based case control study of potential risk factors for IBD. Am J Gastroenterol 101: 993-1002. Cho JH (2008) The genetics and immunopathogenesis of inflammatory bowel disease. Nat Rev Immunol 8: 458-466. Hugot JP, Chamaillard M, Zouali H, Lesage S, Cezard JP, et al. (2001) Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn's disease. Nature 411: 599-603. Ivison SM, Himmel ME, Hardenberg G, Wark PA, Kifayet A, et al. (2010) TLR5 is not required for flagellin-mediated exacerbation of DSS colitis. Inflamm Bowel Dis 16: 401-409. Morgan XC, Tickle TL, Sokol H, Gevers D, Devaney KL, et al. (2012) Dysfunction of the intestinal microbiome in inflammatory bowel disease and treatment. Genome Biol 13: R79. Yu LC (2012) Intestinal epithelial barrier dysfunction in food hypersensitivity. J Allergy (Cairo) 2012: 596081. Feldman SaF (2010) Gastrointestinal and Liver Disease. Pathophysiology/Diagnosis/Management. 9th ed: Elsevier. Johansson ME, Larsson JM, Hansson GC (2011) The two mucus layers of colon are organized by the MUC2 mucin, whereas the outer layer is a legislator of host-microbial interactions. Proc Natl Acad Sci U S A 108 Suppl 1: 4659-4665. Varol C, Zigmond E, Jung S (2010) Securing the immune tightrope: mononuclear phagocytes in the intestinal lamina propria. Nat Rev Immunol 10: 415-426. Okamoto R (2011) Epithelial regeneration in inflammatory bowel diseases. Inflammation and Regeneration 31: 275-281. 128  Dekaney CM, Gulati AS, Garrison AP, Helmrath MA, Henning SJ (2009) Regeneration of intestinal stem/progenitor cells following doxorubicin treatment of mice. Am J Physiol Gastrointest Liver Physiol 297: G461-470. Sohn JJ, Schetter AJ, Yfantis HG, Ridnour LA, Horikawa I, et al. (2012) Macrophages, nitric oxide and microRNAs are associated with DNA damage response pathway and senescence in inflammatory bowel disease. PLoS One 7: e44156. Fournier BM, Parkos CA (2012) The role of neutrophils during intestinal inflammation. Mucosal Immunol 5: 354-366. Eastaff-Leung N, Mabarrack N, Barbour A, Cummins A, Barry S (2010) Foxp3+ regulatory T cells, Th17 effector cells, and cytokine environment in inflammatory bowel disease. J Clin Immunol 30: 80-89. Sheibanie AF, Yen JH, Khayrullina T, Emig F, Zhang M, et al. (2007) The proinflammatory effect of prostaglandin E2 in experimental inflammatory bowel disease is mediated through the IL-23-->IL-17 axis. J Immunol 178: 8138-8147. Fava F, Danese S (2011) Intestinal microbiota in inflammatory bowel disease: friend of foe? World J Gastroenterol 17: 557-566. Liu C, Li Y, Yu J, Feng L, Hou S, et al. (2013) Targeting the shift from M1 to M2 macrophages in experimental autoimmune encephalomyelitis mice treated with fasudil. PLoS One 8: e54841. Sindrilaru A, Peters T, Wieschalka S, Baican C, Baican A, et al. (2011) An unrestrained proinflammatory M1 macrophage population induced by iron impairs wound healing in humans and mice. J Clin Invest 121: 985-997. Wendelsdorf K, Bassaganya-Riera J, Hontecillas R, Eubank S (2010) Model of colonic inflammation: immune modulatory mechanisms in inflammatory bowel disease. J Theor Biol 264: 1225-1239. Sica A, Mantovani A (2012) Macrophage plasticity and polarization: in vivo veritas. J Clin Invest 122: 787-795. M.A. Vega ALC (2006) Human macrophage activation:  129  Too many functions and phenotypes for a single cell type. Immunolgoy 25: 248-272. Comito D, Romano C (2012) Dysbiosis in the pathogenesis of pediatric inflammatory bowel diseases. Int J Inflam 2012: 687143. Tuckova L, Flegelova Z, Tlaskalova-Hogenova H, Zidek Z (2000) Activation of macrophages by food antigens: enhancing effect of gluten on nitric oxide and cytokine production. J Leukoc Biol 67: 312-318. Kuhl AA, Kakirman H, Janotta M, Dreher S, Cremer P, et al. (2007) Aggravation of different types of experimental colitis by depletion or adhesion blockade of neutrophils. Gastroenterology 133: 1882-1892. Nikolaus S, Bauditz J, Gionchetti P, Witt C, Lochs H, et al. (1998) Increased secretion of pro-inflammatory cytokines by circulating polymorphonuclear neutrophils and regulation by interleukin 10 during intestinal inflammation. Gut 42: 470-476. D'Odorico A, D'Inca R, Mestriner C, Di Leo V, Ferronato A, et al. (2000) Influence of disease site and activity on peripheral neutrophil function in inflammatory bowel disease. Dig Dis Sci 45: 1594-1600. Sartor RB (2006) Mechanisms of disease: pathogenesis of Crohn's disease and ulcerative colitis. Nat Clin Pract Gastroenterol Hepatol 3: 390-407.  Maniati E, Soper R, Hagemann T (2010) Up for Mischief? IL-17/Th17 in the tumour microenvironment. Oncogene 29: 5653-5662. Strober W, Fuss IJ (2011) Proinflammatory cytokines in the pathogenesis of inflammatory bowel diseases. Gastroenterology 140: 1756-1767. Macdonald TT (2010) Inside the microbial and immune labyrinth: totally gutted. Nat Med 16: 1194-1195. Giulia Roda MM, Alessandro Sartini, and Enrico Roda (2010) Cytokine Networks in Ulcerative Colitis. Ulcers 2011. Heller F, Florian P, Bojarski C, Richter J, Christ M, et al. (2005) Interleukin-13 is the key effector Th2 cytokine in ulcerative colitis that affects epithelial tight junctions, apoptosis, and cell restitution. Gastroenterology 129: 550-564. 130  Rang HP DM, Ritter JM, et al (2010) Pharmacology: Churchhill:Elsevier. Goodwin JS, Messner RP, Bankhurst AD, Peake GT, Saiki JH, et al. (1977) Prostaglandin-producing suppressor cells in Hodgkin's disease. N Engl J Med 297: 963-968. Lejeune M, Leung P, Beck PL, Chadee K (2010) Role of EP4 receptor and prostaglandin transporter in prostaglandin E2-induced alteration in colonic epithelial barrier integrity. Am J Physiol Gastrointest Liver Physiol 299: G1097-1105. Himmel ME, Yao Y, Orban PC, Steiner TS, Levings MK (2012) Regulatory T-cell therapy for inflammatory bowel disease: more questions than answers. Immunology 136: 115-122. Maul J, Loddenkemper C, Mundt P, Berg E, Giese T, et al. (2005) Peripheral and intestinal regulatory CD4+ CD25(high) T cells in inflammatory bowel disease. Gastroenterology 128: 1868-1878. Cuadrado E, Alonso M, de Juan MD, Echaniz P, Arenas JI (2008) Regulatory T cells in patients with inflammatory bowel diseases treated with adacolumn granulocytapheresis. World J Gastroenterol 14: 1521-1527. Veltkamp C, Anstaett M, Wahl K, Moller S, Gangl S, et al. (2011) Apoptosis of regulatory T lymphocytes is increased in chronic inflammatory bowel disease and reversed by anti-TNFalpha treatment. Gut 60: 1345-1353. Gibson DL, Ma C, Rosenberger CM, Bergstrom KS, Valdez Y, et al. (2008) Toll-like receptor 2 plays a critical role in maintaining mucosal integrity during Citrobacter rodentium-induced colitis. Cell Microbiol 10: 388-403. Ou G, Baranov V, Lundmark E, Hammarstrom S, Hammarstrom ML (2009) Contribution of intestinal epithelial cells to innate immunity of the human gut--studies on polarized monolayers of colon carcinoma cells. Scand J Immunol 69: 150-161. Roda G, Sartini A, Zambon E, Calafiore A, Marocchi M, et al. (2010) Intestinal epithelial cells in inflammatory bowel diseases. World J Gastroenterol 16: 4264-4271. Gersemann M, Becker S, Kubler I, Koslowski M, Wang G, et al. (2009) Differences in goblet cell differentiation between Crohn's disease and ulcerative colitis. Differentiation 77: 84-94. 131  theveganforum (2013) IBD (Inflammatory Bowel Disease) diet. IBD (Inflammatory Bowel Disease) diet: DragonByte Technologies Ltd. Oliver J (2013) Cooking for people with Inflammatory Bowel Disease and IBS. Jamie Oliver Enterprises Limited. Tjonneland A, Overvad K, Bergmann MM, Nagel G, Linseisen J, et al. (2009) Linoleic acid, a dietary n-6 polyunsaturated fatty acid, and the aetiology of ulcerative colitis: a nested case-control study within a European prospective cohort study. Gut 58: 1606-1611. Sakamoto N, Kono S, Wakai K, Fukuda Y, Satomi M, et al. (2005) Dietary risk factors for inflammatory bowel disease: a multicenter case-control study in Japan. Inflamm Bowel Dis 11: 154-163. Andoh A, Tsujikawa T, Ishizuka I, Araki Y, Sasaki M, et al. (2003) N-3 fatty acid-rich diet prevents early response of interleukin-6 elevation in trinitrobenzene sulfonic acid-induced enteritis. Int J Mol Med 12: 721-725. Hekmatdoost A, Wu X, Morampudi V, Innis SM, Jacobson K (2013) Dietary oils modify the host immune response and colonic tissue damage following Citrobacter rodentium infection in mice. Am J Physiol Gastrointest Liver Physiol 304: G917-928. Calder PC (2006) n-3 polyunsaturated fatty acids, inflammation, and inflammatory diseases. Am J Clin Nutr 83: 1505S-1519S. Paiotti AP, Marchi P, Miszputen SJ, Oshima CT, Franco M, et al. (2012) The role of nonsteroidal antiinflammatory drugs and cyclooxygenase-2 inhibitors on experimental colitis. In Vivo 26: 381-393. Calder P (2006) n−3 Polyunsaturated fatty acids, inflammation, and inflammatory diseases. American Society for Clinical Nutrition 83: S1505-1519S. Canada S (2005-2006) Food Statistics. Ghosh S, Rodrigues B (2006) Cardiac cell death in early diabetes and its modulation by dietary fatty acids. Biochim Biophys Acta 1761: 1148-1162. 132  Ghosh S, Novak EM, Innis SM (2007) Cardiac proinflammatory pathways are altered with different dietary n-6 linoleic to n-3 alpha-linolenic acid ratios in normal, fat-fed pigs. Am J Physiol Heart Circ Physiol 293: H2919-2927. Kim IW, Myung SJ, Do MY, Ryu YM, Kim MJ, et al. (2010) Western-style diets induce macrophage infiltration and contribute to colitis-associated carcinogenesis. J Gastroenterol Hepatol 25: 1785-1794. de Lorgeril M, Salen P (2012) New insights into the health effects of dietary saturated and omega-6 and omega-3 polyunsaturated fatty acids. BMC Med 10: 50. Viscogliosi G, Cipriani E, Liguori ML, Marigliano B, Saliola M, et al. (2013) Mediterranean Dietary Pattern Adherence: Associations with Prediabetes, Metabolic Syndrome, and Related Microinflammation. Metab Syndr Relat Disord. Sanchez-Fidalgo S, Villegas I, Cardeno A, Talero E, Sanchez-Hidalgo M, et al. (2010) Extra-virgin olive oil-enriched diet modulates DSS-colitis-associated colon carcinogenesis in mice. Clin Nutr 29: 663-673. Camuesco D, Galvez J, Nieto A, Comalada M, Rodriguez-Cabezas ME, et al. (2005) Dietary olive oil supplemented with fish oil, rich in EPA and DHA (n-3) polyunsaturated fatty acids, attenuates colonic inflammation in rats with DSS-induced colitis. J Nutr 135: 687-694. Devkota S, Wang Y, Musch MW, Leone V, Fehlner-Peach H, et al. (2012) Dietary-fat-induced taurocholic acid promotes pathobiont expansion and colitis in Il10-/- mice. Nature 487: 104-108. Wright R, Truelove SC (1965) A Controlled Therapeutic Trial of Various Diets in Ulcerative Colitis. Br Med J 2: 138-141. Ohira H, Fujioka Y, Katagiri C, Mamoto R, Aoyama-Ishikawa M, et al. (2013) Butyrate Attenuates Inflammation and Lipolysis Generated by the Interaction of Adipocytes and Macrophages. J Atheroscler Thromb. Venkatraman A, Ramakrishna BS, Pulimood AB, Patra S, Murthy S (2000) Increased permeability in dextran sulphate colitis in rats: time course of development and effect of butyrate. Scand J Gastroenterol 35: 1053-1059. 133  Rabbani GH, Albert MJ, Hamidur Rahman AS, Moyenul Isalm M, Nasirul Islam KM, et al. (1999) Short-chain fatty acids improve clinical, pathologic, and microbiologic features of experimental shigellosis. J Infect Dis 179: 390-397. Jantchou P, Morois S, Clavel-Chapelon F, Boutron-Ruault MC, Carbonnel F (2010) Animal protein intake and risk of inflammatory bowel disease: The E3N prospective study. Am J Gastroenterol 105: 2195-2201. Calder PC (2013) Omega-3 polyunsaturated fatty acids and inflammatory processes: nutrition or pharmacology? Br J Clin Pharmacol 75: 645-662. Turner D, Zlotkin SH, Shah PS, Griffiths AM (2009) Omega 3 fatty acids (fish oil) for maintenance of remission in Crohn's disease. Cochrane Database Syst Rev: CD006320. Feagan BG, Sandborn WJ, Mittmann U, Bar-Meir S, D'Haens G, et al. (2008) Omega-3 free fatty acids for the maintenance of remission in Crohn disease: the EPIC Randomized Controlled Trials. JAMA 299: 1690-1697. Mane J, Pedrosa E, Loren V, Ojanguren I, Fluvia L, et al. (2009) Partial replacement of dietary (n-6) fatty acids with medium-chain triglycerides decreases the incidence of spontaneous colitis in interleukin-10-deficient mice. J Nutr 139: 603-610. Gravaghi C, La Perle KM, Ogrodwski P, Kang JX, Quimby F, et al. (2011) Cox-2 expression, PGE(2) and cytokines production are inhibited by endogenously synthesized n-3 PUFAs in inflamed colon of fat-1 mice. J Nutr Biochem 22: 360-365. Matsunaga H, Hokari R, Kurihara C, Okada Y, Takebayashi K, et al. (2008) Omega-3 fatty acids exacerbate DSS-induced colitis through decreased adiponectin in colonic subepithelial myofibroblasts. Inflamm Bowel Dis 14: 1348-1357. De Quelen F, Chevalier J, Rolli-Derkinderen M, Mourot J, Neunlist M, et al. (2011) n-3 polyunsaturated fatty acids in the maternal diet modify the postnatal development of nervous regulation of intestinal permeability in piglets. J Physiol 589: 4341-4352. 134  Innis SM, Dai C, Wu X, Buchan AM, Jacobson K (2010) Perinatal lipid nutrition alters early intestinal development and programs the response to experimental colitis in young adult rats. Am J Physiol Gastrointest Liver Physiol 299: G1376-1385. Narisawa S, Huang L, Iwasaki A, Hasegawa H, Alpers DH, et al. (2003) Accelerated fat absorption in intestinal alkaline phosphatase knockout mice. Mol Cell Biol 23: 7525-7530. Metwalli OM, Mourand FE (1980) Studies on organ-specific alkaline phosphatases in relation to their diagnostic value. Z Ernahrungswiss 19: 154-158. Molnar K, Vannay A, Szebeni B, Banki NF, Sziksz E, et al. (2012) Intestinal alkaline phosphatase in the colonic mucosa of children with inflammatory bowel disease. World J Gastroenterol 18: 3254-3259. Tuin A, Poelstra K, de Jager-Krikken A, Bok L, Raaben W, et al. (2009) Role of alkaline phosphatase in colitis in man and rats. Gut 58: 379-387. McConnell RE, Higginbotham JN, Shifrin DA, Jr., Tabb DL, Coffey RJ, et al. (2009) The enterocyte microvillus is a vesicle-generating organelle. J Cell Biol 185: 1285-1298. Buchet R, Millan JL, Magne D (2013) Multisystemic functions of alkaline phosphatases. Methods Mol Biol 1053: 27-51. Lynes M, Narisawa S, Millan JL, Widmaier EP (2011) Interactions between CD36 and global intestinal alkaline phosphatase in mouse small intestine and effects of high-fat diet. Am J Physiol Regul Integr Comp Physiol 301: R1738-1747. Narisawa S, Hoylaerts MF, Doctor KS, Fukuda MN, Alpers DH, et al. (2007) A novel phosphatase upregulated in Akp3 knockout mice. Am J Physiol Gastrointest Liver Physiol 293: G1068-1077. Beumer C, Wulferink M, Raaben W, Fiechter D, Brands R, et al. (2003) Calf intestinal alkaline phosphatase, a novel therapeutic drug for lipopolysaccharide (LPS)-mediated diseases, attenuates LPS toxicity in mice and piglets. J Pharmacol Exp Ther 307: 737-744. Goldberg RF, Austen WG, Jr., Zhang X, Munene G, Mostafa G, et al. (2008) Intestinal alkaline phosphatase is a gut mucosal defense factor maintained by enteral nutrition. Proc Natl Acad Sci U S A 105: 3551-3556. 135  Martinez-Moya P, Ortega-Gonzalez M, Gonzalez R, Anzola A, Ocon B, et al. (2012) Exogenous alkaline phosphatase treatment complements endogenous enzyme protection in colonic inflammation and reduces bacterial translocation in rats. Pharmacol Res 66: 144-153. Chen KT, Malo MS, Beasley-Topliffe LK, Poelstra K, Millan JL, et al. (2011) A role for intestinal alkaline phosphatase in the maintenance of local gut immunity. Dig Dis Sci 56: 1020-1027. Ghosh S, Decoffe D, Brown K, Rajendiran E, Estaki M, et al. (2013) Fish oil attenuates omega-6 polyunsaturated Fatty Acid-induced dysbiosis and infectious colitis but impairs LPS dephosphorylation activity causing sepsis. PLoS One 8: e55468.  Estaki M, DeCoffe D, Gibson DL (2014) Interplay between intestinal alkaline phosphatase, diet, gut microbes and immunity. World J Gastroenterol 20: 15650-15656.  Moss AK, Hamarneh SR, Mohamed MM, Ramasamy S, Yammine H, et al. (2013) Intestinal alkaline phosphatase inhibits the proinflammatory nucleotide uridine diphosphate. Am J Physiol Gastrointest Liver Physiol 304: G597-604.  Di Virgilio F, Chiozzi P, Ferrari D, Falzoni S, Sanz JM, et al. (2001) Nucleotide receptors: an emerging family of regulatory molecules in blood cells. Blood 97: 587-600. Chen KT, Malo MS, Moss AK, Zeller S, Johnson P, et al. (2010) Identification of specific targets for the gut mucosal defense factor intestinal alkaline phosphatase. Am J Physiol Gastrointest Liver Physiol 299: G467-475. Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, et al. (2000) A Toll-like receptor recognizes bacterial DNA. Nature 408: 740-745. Cario E (2005) Bacterial interactions with cells of the intestinal mucosa: Toll-like receptors and NOD2. Gut 54: 1182-1193. Alam SN, Yammine H, Moaven O, Ahmed R, Moss AK, et al. (2013) Intestinal Alkaline Phosphatase Prevents Antibiotic-Induced Susceptibility to Enteric Pathogens. Ann Surg. Malo MS, Moaven O, Muhammad N, Biswas B, Alam SN, et al. (2014) Intestinal alkaline phosphatase promotes gut bacterial growth by reducing the concentration of luminal nucleotide triphosphates. Am J Physiol Gastrointest Liver Physiol 306: G826-838. 136  Fallingborg J, Christensen LA, Jacobsen BA, Rasmussen SN (1993) Very low intraluminal colonic pH in patients with active ulcerative colitis. Dig Dis Sci 38: 1989-1993. Kunitz M (1960) Chicken intestinal alkaline phosphatase. I. The kinetics and thermodynamics of reversible inactivation. 2. Reactivation by zinc ions. J Gen Physiol 43: 1149-1169. Clark SB, Holt PR (1968) Rate-limiting steps in steady-state intestinal absorption of trioctanoin-1-14C. Effect of biliary and pancreatic flow diversion. J Clin Invest 47: 612-623. de La Serre CB, Ellis CL, Lee J, Hartman AL, Rutledge JC, et al. (2010) Propensity to high-fat diet-induced obesity in rats is associated with changes in the gut microbiota and gut inflammation. Am J Physiol Gastrointest Liver Physiol 299: G440-448. Borenshtein D, Nambiar PR, Groff EB, Fox JG, Schauer DB (2007) Development of fatal colitis in FVB mice infected with Citrobacter rodentium. Infect Immun 75: 3271-3281. Spahn TW, Ross M, von Eiff C, Maaser C, Spieker T, et al. (2008) CD4+ T cells transfer resistance against Citrobacter rodentium-induced infectious colitis by induction of Th 1 immunity. Scand J Immunol 67: 238-244. Wirtz S, Neurath MF (2007) Mouse models of inflammatory bowel disease. Adv Drug Deliv Rev 59: 1073-1083. Johansson ME, Gustafsson JK, Holmen-Larsson J, Jabbar KS, Xia L, et al. (2013) Bacteria penetrate the normally impenetrable inner colon mucus layer in both murine colitis models and patients with ulcerative colitis. Gut. Ibeakanma C, Miranda-Morales M, Richards M, Bautista-Cruz F, Martin N, et al. (2009) Citrobacter rodentium colitis evokes post-infectious hyperexcitability of mouse nociceptive colonic dorsal root ganglion neurons. J Physiol 587: 3505-3521. Petty NK, Feltwell T, Pickard D, Clare S, Toribio AL, et al. (2011) Citrobacter rodentium is an unstable pathogen showing evidence of significant genomic flux. PLoS Pathog 7: e1002018. Higgins LM, Frankel G, Douce G, Dougan G, MacDonald TT (1999) Citrobacter rodentium infection in mice elicits a mucosal Th1 cytokine response and lesions similar to those in murine inflammatory bowel disease. Infect Immun 67: 3031-3039. 137  Osborne LC, Joyce KL, Alenghat T, Sonnenberg GF, Giacomin PR, et al. (2013) Resistin-like molecule alpha promotes pathogenic Th17 cell responses and bacterial-induced intestinal inflammation. J Immunol 190: 2292-2300.  van de Veerdonk FL, Gresnigt MS, Kullberg BJ, van der Meer JW, Joosten LA, et al. (2009) Th17 responses and host defense against microorganisms: an overview. BMB Rep 42: 776-787. Baker J, Brown K, Rajendiran E, Yip A, DeCoffe D, et al. (2012) Medicinal lavender modulates the enteric microbiota to protect against Citrobacter rodentium-induced colitis. Am J Physiol Gastrointest Liver Physiol 303: G825-836. Gibson DL, Montero M, Ropeleski MJ, Bergstrom KS, Ma C, et al. (2010) Interleukin-11 reduces TLR4-induced colitis in TLR2-deficient mice and restores intestinal STAT3 signaling. Gastroenterology 139: 1277-1288. Hidalgo IJ, Raub TJ, Borchardt RT (1989) Characterization of the human colon carcinoma cell line (Caco-2) as a model system for intestinal epithelial permeability. Gastroenterology 96: 736-749. Sambuy Y, De Angelis I, Ranaldi G, Scarino ML, Stammati A, et al. (2005) The Caco-2 cell line as a model of the intestinal barrier: influence of cell and culture-related factors on Caco-2 cell functional characteristics. Cell Biol Toxicol 21: 1-26. (ATCC) ATCC (2012) Thawing, Propagating and Cryopreserving Protocol. In: Facility PS-OCNBC, editor. 1.0 ed. Manassas. Kuroda E, Kito T, Yamashita U (2002) Reduced expression of STAT4 and IFN-gamma in macrophages from BALB/c mice. J Immunol 168: 5477-5482. Rebres R (2004) Passage of RAW 264.7 Cells for FXM Experiments 1.0 ed. Meng F, Lowell CA (1997) Lipopolysaccharide (LPS)-induced macrophage activation and signal transduction in the absence of Src-family kinases Hck, Fgr, and Lyn. J Exp Med 185: 1661-1670. Galvez-Llompart M, Del Carmen Recio Iglesias M, Galvez J, Garcia-Domenech R (2013) Novel potential agents for ulcerative colitis by molecular topology: suppression of IL-6 production in Caco-2 and RAW 264.7 cell lines. Mol Divers 17: 573-593. 138  Baykov AA, Evtushenko OA, Avaeva SM (1988) A malachite green procedure for orthophosphate determination and its use in alkaline phosphatase-based enzyme immunoassay. Anal Biochem 171: 266-270. NAPS I (2014). Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, et al. (2009) The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55: 611-622. Technologies E (2014). Calgary, Alberta. Bland JM, Altman DG (2004) The logrank test. BMJ 328: 1073. McDonald. JH (2009) Handbook of Biological Statistics. Baltimore: Sparky House Publishing. Clare S, John V, Walker AW, Hill JL, Abreu-Goodger C, et al. (2013) Enhanced susceptibility to Citrobacter rodentium infection in microRNA-155-deficient mice. Infect Immun 81: 723-732. Kim MH, Kang SG, Park JH, Yanagisawa M, Kim CH (2013) Short-chain fatty acids activate GPR41 and GPR43 on intestinal epithelial cells to promote inflammatory responses in mice. Gastroenterology 145: 396-406 e391-310. Okayasu I, Hatakeyama S, Yamada M, Ohkusa T, Inagaki Y, et al. (1990) A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology 98: 694-702. Bates JM, Akerlund J, Mittge E, Guillemin K (2007) Intestinal alkaline phosphatase detoxifies lipopolysaccharide and prevents inflammation in zebrafish in response to the gut microbiota. Cell Host Microbe 2: 371-382. Malo MS, Alam SN, Mostafa G, Zeller SJ, Johnson PV, et al. (2010) Intestinal alkaline phosphatase preserves the normal homeostasis of gut microbiota. Gut 59: 1476-1484. Ploeger DT, Hosper NA, Schipper M, Koerts JA, de Rond S, et al. (2013) Cell plasticity in wound healing: paracrine factors of M1/ M2 polarized macrophages influence the phenotypical state of dermal fibroblasts. Cell Commun Signal 11: 29. 139  Weisser SB, Brugger HK, Voglmaier NS, McLarren KW, van Rooijen N, et al. (2011) SHIP-deficient, alternatively activated macrophages protect mice during DSS-induced colitis. J Leukoc Biol 90: 483-492. Sheikh SZ, Kobayashi T, Matsuoka K, Onyiah JC, Plevy SE (2011) Characterization of an interferon-stimulated response element (ISRE) in the Il23a promoter. J Biol Chem 286: 1174-1180. Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, et al. (2008) Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med 14: 282-289. Loonen LM, Stolte EH, Jaklofsky MT, Meijerink M, Dekker J, et al. (2014) REG3gamma-deficient mice have altered mucus distribution and increased mucosal inflammatory responses to the microbiota and enteric pathogens in the ileum. Mucosal Immunol 7: 939-947. Turnquist HR, Zhao Z, Rosborough BR, Liu Q, Castellaneta A, et al. (2011) IL-33 expands suppressive CD11b+ Gr-1(int) and regulatory T cells, including ST2L+ Foxp3+ cells, and mediates regulatory T cell-dependent promotion of cardiac allograft survival. J Immunol 187: 4598-4610. Shen S, Ding Y, Tadokoro CE, Olivares-Villagomez D, Camps-Ramirez M, et al. (2005) Control of homeostatic proliferation by regulatory T cells. J Clin Invest 115: 3517-3526. Lee C, Chun J, Hwang SW, Kang SJ, Im JP, et al. (2014) The effect of intestinal alkaline phosphatase on intestinal epithelial cells, macrophages and chronic colitis in mice. Life Sci 100: 118-124. Bol-Schoenmakers M, Fiechter D, Raaben W, Hassing I, Bleumink R, et al. (2010) Intestinal alkaline phosphatase contributes to the reduction of severe intestinal epithelial damage. Eur J Pharmacol 633: 71-77. Kim HC, Cho HY, Hah YS (2012) Role of IL-15 in Sepsis-Induced Skeletal Muscle Atrophy and Proteolysis. Tuberc Respir Dis (Seoul) 73: 312-319.   140  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0074407/manifest

Comment

Related Items