UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Salmonella-host interactions : the interplay between Salmonella, SPI2 and eicosanoids Buckner, Michelle M. C. 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2013_fall_buckner_michelle.pdf [ 10.53MB ]
Metadata
JSON: 24-1.0074014.json
JSON-LD: 24-1.0074014-ld.json
RDF/XML (Pretty): 24-1.0074014-rdf.xml
RDF/JSON: 24-1.0074014-rdf.json
Turtle: 24-1.0074014-turtle.txt
N-Triples: 24-1.0074014-rdf-ntriples.txt
Original Record: 24-1.0074014-source.json
Full Text
24-1.0074014-fulltext.txt
Citation
24-1.0074014.ris

Full Text

SALMONELLA-HOST INTERACTIONS: THE INTERPLAY BETWEEN SALMONELLA SPI2, AND EICOSANOIDS  by Michelle M C Buckner  B.Sc. Honours, The University of Calgary, 2008  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  July 2013  © Michelle M C Buckner, 2013  ii  Abstract Salmonella are Gram-negative facultative intracellular pathogens that cross the intestinal barrier, and are taken up by phagocytes where, they can replicate and spread to systemic sites. Salmonella encode two type III secretion systems, Salmonella pathogenicity island 1 and 2 (SPI1 and SPI2), which mediate the translocation of bacterial effectors into the host cell. SPI1 facilitates bacterial uptake into non-phagocytic cells and is involved in forming a special replicative niche, called the Salmonella containing vacuole (SCV). SPI2 is required for maintenance of the SCV, macrophage replication and systemic disease. A comprehensive study of the contribution of individual SPI2 effectors to virulence had not been previously done, and was therefore performed. Strains deficient in specific SPI2 genes were tested for alterations in virulence in a mouse model of typhoid fever, and in epithelial and macrophage cell infections. These experiments showed that many SPI2 effectors are required for replication in macrophages, and that ΔspvB, ΔssaR, and ΔspiC strains were attenuated in mice.  Salmonella infection causes many perturbations to the host, including changes in metabolites, specifically arachidonic acid metabolism, which leads to the production of eicosanoids. The effects of Salmonella infection of macrophages on eicosanoids were examined. Salmonella infection increased the expression of prostaglandin synthases, but decreased thromboxane and leukotriene synthases. The SPI2 deletion strains were tested to determine involvement of SPI2 in arachidonic acid metabolism. The SPI2 effectors SseF and SseG, which are largely uncharacterized in macrophage infections, were mainly responsible for the induction of prostaglandins.  The effects of prostaglandins on Salmonella infection were studied. It was found that 15- deoxy-Δ12,14-prostaglandin-J2 (15d-PGJ2) significantly reduced Salmonella colonization of iii  macrophages, but not epithelial cells. Furthermore, this occurs independently of SPI1, SPI2, and PPAR-γ. 15d-PGJ2 reduces cytokines and reactive nitrogen species produced by infected macrophages. A role for 15d-PGJ2 in Salmonella infection has not been previously demonstrated. This thesis examines the role of SPI2 in Salmonella virulence and arachidonic acid metabolism.  iv  Preface A version of Chapter 2 has been published. Buckner MM, Croxen MA, Arena ET, Finlay BB. A comprehensive study of the contribution of Salmonella enterica serovar Typhimurium SPI2 effectors to bacterial colonization, survival, and replication in typhoid fever, macrophage, and epithelial cell infection models. Virulence. 2011 May-Jun;2(3):208-16. Prof. Finlay provided insight and guidance for this project. With the supervision and assistance of Dr. Croxen I constructed the SPI2 deletion strains used in this chapter, and later in chapter 3. Dr. Arena assisted me with the mouse infections completed for this project. I completed all the cell culture infections. I wrote most of the manuscript with input from Prof. Finlay.  A version of chapter 4 is currently under review.  Buckner MM, Antunes LC, Gill N, Russell SL, Shames SR, Finlay BB. 15-deoxy-Δ12,14-prostaglandin J2 mediates macrophage interactions with Salmonella enterica serovar Typhimurium. Submitted. For this manuscript I completed all the experiments. Prof. Finlay assisted with the conceptual aspects of the study. Dr. Antunes assisted with a variety of experiments and provided project guidance. Dr. Gill assisted with the ELISAs, Ms. Russell assisted with the CBA and FACS analysis. Dr. Shames performed the LDH release assay. I wrote most of the manuscript with the input of Prof. Finlay.  Versions of the figures in Appendix A were published. Antunes LC, Arena ET, Menendez A, Han J, Ferreira RB, Buckner MM, Lolic P, Madilao LL, Bohlmann J, Borchers CH, Finlay BB. Impact of Salmonella infection on host hormone metabolism revealed by metabolomics. Infect Immun. 2011 Apr;79(4):1759-69. Under the supervision of Dr. Antunes I v  performed the qRT-PCR on liver samples to look at the expression of COX2, TBXAS1, and PTGES.  Publications arising from my PhD work: • Buckner MM, Antunes LC, Gill N, Russell SL, Shames SR, Finlay BB. 15-deoxy-Δ12,14- prostaglandin J2 mediates macrophage interactions with Salmonella enterica serovar Typhimurium. Submitted. • Ferreira RB, Buckner MM, Finlay BB. Genome plasticity in Salmonella enterica and its relevance to host-pathogen interactions. Genome Plasticity and Infectious Diseases. © 2012 ASM Press, Washington, DC ISBN: 81-708-4 Editors: J. Hacker, J. Kaper , R. Kurth, and U. Dobrindt. • Buckner MM, Croxen MA, Arena ET, Finlay BB. A comprehensive study of the contribution of Salmonella enterica serovar Typhimurium SPI2 effectors to bacterial colonization, survival, and replication in typhoid fever, macrophage, and epithelial cell infection models. Virulence. 2011 May-Jun;2(3):208-16. • Buckner MM, Finlay BB. Host-microbe interaction: Innate immunity cues virulence. Nature. 2011 Apr 14;472(7342):179-80. • Antunes LC, Arena ET, Menendez A, Han J, Ferreira RB, Buckner MM, Lolic P, Madilao LL, Bohlmann J, Borchers CH, Finlay BB. Impact of Salmonella infection on host hormone metabolism revealed by metabolomics. Infect Immun. 2011 Apr;79(4):1759-69. • Antunes LC, Buckner MM, Auweter SD, Ferreira RB, Lolic P, Finlay BB. Inhibition of Salmonella host cell invasion by dimethyl sulphide. Applied and Environmental Microbiology. 2010: 76(15), 5300-5304. • Antunes LC, Ferreira RB, Buckner MM, Finlay BB. Quorum sensing in bacterial virulence. Microbiology. 2010: 156, 2271-2282.  The mouse work presented in this thesis was approved by the UBC Animal Care Committee, certificate number: A09-0168 vi  Table of contents Abstract .......................................................................................................................................... ii Preface ........................................................................................................................................... iv Table of contents .......................................................................................................................... vi List of tables.................................................................................................................................. xi List of figures ............................................................................................................................... xii List of abbreviations .................................................................................................................. xiv Acknowledgements .................................................................................................................... xix Chapter  1: Introduction .............................................................................................................. 1 1.1 Disease relevance .......................................................................................................................... 1 1.1.1 Disease characteristics of Salmonellosis ................................................................................. 1 1.1.2 Salmonella prevalence ............................................................................................................. 2 1.1.3 Economic burden ..................................................................................................................... 3 1.1.4 Importance of studying Salmonella ......................................................................................... 3 1.2 Types of Salmonella ...................................................................................................................... 4 1.2.1 Salmonella classification ......................................................................................................... 4 1.2.2 Host range of Salmonella ......................................................................................................... 5 1.3 Genetic elements in Salmonella ................................................................................................... 5 1.3.1 Salmonella genomic islands .................................................................................................... 5 1.3.2 Salmonella pathogenicity islands ............................................................................................ 6 1.3.3 Salmonella phages ................................................................................................................... 8 1.3.4 Salmonella plasmids ................................................................................................................ 9 vii  1.4 Mechanisms of pathogenesis ...................................................................................................... 10 1.4.1 Disease progression ............................................................................................................... 10 1.4.2 Salmonella replication in the intestine ................................................................................... 11 1.4.3 Salmonella systemic spread ................................................................................................... 12 1.5 Virulence mechanisms ................................................................................................................ 13 1.5.1 Type III secretion systems ..................................................................................................... 13 1.5.2 Salmonella pathogenicity island 1 ......................................................................................... 14 1.5.3 Salmonella pathogenicity island 2 ......................................................................................... 16 1.6 Host response to Salmonella ...................................................................................................... 18 1.6.1 Mucosal defense .................................................................................................................... 18 1.6.2 Pattern recognition receptors ................................................................................................. 20 1.6.3 Inflammasome ....................................................................................................................... 22 1.6.4 Reactive oxygen intermediates .............................................................................................. 23 1.6.5 Reactive nitrogen species ...................................................................................................... 23 1.7 Conclusions .................................................................................................................................. 24 Chapter  2: The contribution of individual Salmonella pathogenicity island 2 effectors to virulence ....................................................................................................................................... 25 2.1 Abstract ....................................................................................................................................... 25 2.2 Introduction ................................................................................................................................. 26 2.3 Methods and materials ............................................................................................................... 29 2.3.1 Construction of bacterial strains, plasmids and growth conditions ....................................... 29 2.3.2 Epithelial cell infections ........................................................................................................ 32 2.3.3 Macrophage infections ........................................................................................................... 33 2.3.4 Typhoid fever model .............................................................................................................. 33 viii  2.3.5 Statistical analysis .................................................................................................................. 34 2.4 Results - Salmonella SPI2 mutant replication in epithelial cells ............................................ 34 2.4.1 Replication in HeLa epithelial cells ....................................................................................... 34 2.4.2 Replication in CaCo2 epithelial cells .................................................................................... 36 2.5 Salmonella SPI2 mutant replication in macrophages .............................................................. 37 2.5.1 Replication in RAW264.7 macrophages ............................................................................... 37 2.6 Salmonella SPI2 mutant replication in murine typhoid fever model ..................................... 39 2.6.1 Colonization of intestinal tract ............................................................................................... 39 2.6.2 Colonization of gallbladder ................................................................................................... 41 2.6.3 Colonization of systemic organs ............................................................................................ 42 2.6.4 Early colonization in the typhoid model ................................................................................ 45 2.7 Discussion .................................................................................................................................... 46 2.8 Summary ..................................................................................................................................... 49 Chapter  3: Arachidonic acid metabolism is altered during Salmonella infection of macrophages ................................................................................................................................ 51 3.1 Abstract ....................................................................................................................................... 51 3.2 Introduction ................................................................................................................................. 52 3.3 Methods and materials ............................................................................................................... 59 3.3.1 Chemical reagents .................................................................................................................. 59 3.3.2 Cell culture and Salmonella infections .................................................................................. 59 3.3.3 RNA extraction and cDNA synthesis .................................................................................... 60 3.3.4 Quantitative real-time PCR (qRT-PCR) ................................................................................ 60 3.3.5 CFU determination ................................................................................................................ 61 3.3.6 Hormone addition to Salmonella infection ............................................................................ 61 ix  3.3.7 Statistical analysis .................................................................................................................. 62 3.4 Results - Salmonella infection alters eicosanoid production ................................................... 62 3.4.1 Prostaglandin and thromboxane pathways are affected by Salmonella infection ................. 62 3.4.2 Leukotriene pathway is repressed during Salmonella infection ............................................ 63 3.5 The role of SPI2 in prostaglandin and thromboxane production .......................................... 66 3.5.1 Involvement of SPI2 effectors in TBXAS1 repression ......................................................... 66 3.5.2 Involvement of SPI2 effectors in PTGES expression ............................................................ 67 3.5.3 Involvement of SPI2 effectors in COX2 expression ............................................................. 69 3.6 The role of SseF and SseG in prostaglandin production ........................................................ 70 3.6.1 SseF and SseG induce COX2 expression during Salmonella infection ................................ 70 3.6.2 Effect on COX2 is not due to colonization defects ............................................................... 71 3.7 Arachidonic acid metabolites alter macrophage colonization by Salmonella ....................... 72 3.8 Discussion .................................................................................................................................... 74 3.9 Summary ..................................................................................................................................... 77 Chapter  4: 15d-PGJ2 inhibits colonization of macrophages by Salmonella ......................... 79 4.1 Abstract ....................................................................................................................................... 79 4.2 Introduction ................................................................................................................................. 80 4.3 Methods and materials ............................................................................................................... 86 4.3.1 Chemical reagents .................................................................................................................. 86 4.3.2 Tissue culture ......................................................................................................................... 86 4.3.3 Bone marrow macrophage collection and infection .............................................................. 87 4.3.4 Cytokine analysis and ELISAs .............................................................................................. 87 4.3.5 Quantitative real-time PCR .................................................................................................... 88 4.3.6 Immunofluorescence microscopy .......................................................................................... 88 4.3.7 Cell viability assays ............................................................................................................... 89 x  4.3.8 Salmonella growth in 15d-PGJ2 ............................................................................................. 89 4.3.9 hilA, phoP, ssrA reporter assays ............................................................................................ 89 4.3.10 Reactive nitrogen species production .................................................................................. 90 4.3.11 PPAR-γ inhibitor ................................................................................................................. 90 4.3.12 Statistical analysis ............................................................................................................... 90 4.4 Results - 15d-PGJ2 inhibits Salmonella colonization ............................................................... 90 4.4.1 Salmonella infection induces 15d-PGJ2 production .............................................................. 90 4.4.2 Addition of 15d-PGJ2 reduces Salmonella colonization of macrophages ............................. 91 4.4.3 15d-PGJ2 does not inhibit Salmonella growth directly .......................................................... 94 4.4.4 The effect of 15d-PGJ2 on Salmonella colonization is dependent on cell type ..................... 95 4.5 15d-PGJ2 affects the immune response of macrophages infected with Salmonella .............. 97 4.5.1 15d-PGJ2 reduces cytokine response to Salmonella .............................................................. 97 4.5.2 15d-PGJ2 reduces production of RNS ................................................................................... 99 4.6 15d-PGJ2 does not affect Salmonella virulence gene expression. ........................................... 99 4.7 15d-PGJ2 affects Salmonella colonization via a PPAR-γ independent mechanism. ........... 102 4.8 Discussion .................................................................................................................................. 103 4.9 Summary ................................................................................................................................... 107 Chapter  5: Conclusion ............................................................................................................. 109 5.1 Future directions ....................................................................................................................... 112 Bibliography .............................................................................................................................. 115 Appendix .................................................................................................................................... 142 Appendix A Arachidonic acid metabolism in mice infected with Salmonella ............................... 143   xi  List of tables Table 2.1 E. coli strains and plasmids used in this study .............................................................. 29	
   Table 2.2 Oligonucleotides used to construct SPI2 gene deletions .............................................. 30	
   Table 2.3 Salmonella Typhimurium strains constructed and used for this study ......................... 35	
   Table 2.4 Summary of SPI2 deletion strains contribution to virulence ........................................ 50	
   Table 3.1 qRT-PCR primers for eicosanoid pathways ................................................................. 61	
   Table 4.1 qRT-PCR primers used for cytokine genes .................................................................. 88	
       xii  List of figures Figure 1.1 SPI1 mediated effects .................................................................................................. 15	
   Figure 1.2 SPI2 mediate effects .................................................................................................... 17	
   Figure 2.1 Replication of SPI2 deletion strains in HeLa epithelial cells ...................................... 36	
   Figure 2.2 Replication of SPI2 deletion strains in CaCo2 epithelial cells .................................... 37	
   Figure 2.3 Replication of SPI2 deletion strains in RAW264.7 macrophages ............................... 38	
   Figure 2.4 Colonization of the intestinal tract by SPI2 deletion strains ....................................... 40	
   Figure 2.5 Colonization of gallbladder by SPI2 deletion strains .................................................. 42	
   Figure 2.6 Colonization of systemic organs by SPI2 deletion strains .......................................... 44	
   Figure 2.7 Colonization of select strains early during infection ................................................... 46	
   Figure 3.1 Arachidonic acid metabolism ...................................................................................... 56	
   Figure 3.2 Expression of enzymes involved in the prostaglandin and thromboxane pathways ... 63	
   Figure 3.3 Expression of enzymes involved in the leukotriene pathway ..................................... 65	
   Figure 3.4 SPI2 effectors affect TBXAS1 expression .................................................................. 67	
   Figure 3.5 SPI2 effectors affect PTGES expression ..................................................................... 68	
   Figure 3.6 SPI2 effectors affect COX2 expression ....................................................................... 70	
   Figure 3.7 SseF and SseG are required for full induction of COX2 ............................................. 71	
   Figure 3.8 Colonization of macrophages by ΔsseFG and complemented sseFG strain ............... 72	
   Figure 3.9 Addition of hormones to Salmonella infection of macrophages ................................. 73	
   Figure 4.1 Arachidonic acid metabolism ...................................................................................... 81	
   Figure 4.2 15d-PGJ2 produced in response to Salmonella ............................................................ 91	
   Figure 4.3 Salmonella colonization is reduced by 15d-PGJ2 ........................................................ 93	
   Figure 4.4 Macrophage viability ................................................................................................... 94	
   xiii  Figure 4.5 15d-PGJ2 does not affect Salmonella growth rate ....................................................... 95	
   Figure 4.6 15d-PGJ2 reduces colonization of bone marrow and J774 macrophages but not HeLa cells ............................................................................................................................................... 96	
   Figure 4.7 IFN-γ priming of macrophages does not alter the effect of 15d-PGJ2 on colonization ....................................................................................................................................................... 97	
   Figure 4.8 15d-PGJ2 treatment reduces cytokine production ....................................................... 98	
   Figure 4.9 15d-PGJ2 reduces the production of reactive nitrogen species ................................... 99	
   Figure 4.10 Expression of Salmonella virulence genes are unaffected by 15d-PGJ2 ................. 101	
   Figure 4.11 15d-PGJ2 does not alter ssrA expression after macrophage infection ..................... 102	
   Figure 4.12 PPAR-γ inhibitor has no effect on Salmonella colonization ................................... 103	
   Figure A.1 Metabolic pathways affected by Salmonella infection ............................................. 143	
   Figure A.2 Mouse fecal levels of eicosanoids ............................................................................ 144	
   Figure A.3 Expression of COX2, PTGES, and TBXAS1 in mouse livers ................................. 144	
     xiv  List of abbreviations  Abbreviation Meaning 15d-PGJ2 15-deoxy-Δ12,14-prostaglandin-J2 AA Arachidonic Acid ALOX5 Arachidonate 5-lipoxygenase ALOX5AP Arachidonate 5-lipoxygenase activating protein AMP Antimicrobial peptide AP1 Activator protein 1 ASC Apoptosis-associated speck-like protein containing a CARD BMMO Bone marrow macrophage CBA Cytometric bead array CD-18 Integrin β2 CDC Center for Disease Control cDNA Complementary DNA CFU Colony forming units COPD Chronic obstructive pulmonary disorder COX1 Cyclooxygenase 1 (also called PTGS1) COX2 Cyclooxygenase 2 (also called PTGS2) CRS peptide  Cryptdin-related sequence peptide CYP4F Cytochrome P450, family 4, subfamily F (leukotriene-B4 20- monooxygenase) xv  DAMP Danger associated molecular pattern DAPI 4',6-diamidino-2-phenylindole DC Dendritic cell DMEM Dulbecco's Modified Eagle Medium DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid ELISA Enzyme-linked immunosorbant assay EP2 Prostaglandin E2, receptor subtype 2 EP4 Prostaglandin E2, receptor subtype 4 ERK Extracellular signal-regulated kinases FACS Fluorescence-activated cell sorting FBS Fetal bovine serum GALT Gut-associated lymphoid tissue GFP Green fluorescent protein HIV/AIDS Human immunodeficiency virus/acquired immunodeficiency syndrome IF Immonofluorescence IL Interleukine iNOS Inducible nitric oxide synthase IRF3 interferon regulatory transcription factor 3 JAK/STAT Janus kinase/signal transducer and activator of transcription JNK c-Jun N-terminal kinases xvi  kb Kilobase LAMP (1,2,3) Lysosomal-associated membrane protein (1, 2, 3) LB Luria Bertani LDH Lactate dehydrogenase LPS Lipopolysaccharide LTA4H Leukotriene A4 hydrolase LTC4S Leukotriene C4 synthase M-cells Microfold cells MCP1 Monocyte chemotactic protein-1 MDR Multiple drug resistance MLN Mesenteric lymph nodes mRNA Messenger ribonucleic acid MyD88 Myeloid differentiation primary response 88 NADPH oxidase Nicotinamide adenine dinucleotide phosphate-oxidase NAIP2 Neuronal apoptosis inhibitory protein 2 NAIP5 Neuronal apoptosis inhibitory protein 5 NEAA Non-essential amino acids NF-κB nuclear factor kappa beta NK cells Natural killer cells NLR Nod-like receptor NLRC4 NOD-like receptor family, CARD-containing 4 xvii  NLRP3 NOD-like receptor family, pyrin domain containing 3 NRAMP1 Natural resistance-associated macrophage protein 1 ORF Open reading frame PAMP Pathogen associated molecular pattern PBS Phosphate buffered saline PCR Polymerase chain reaction PG Prostaglandin PGD2 Prostaglandin D2 PGE2 Prostaglandin E2 PLA2 Phospholipase A2 PLA2G4A Phospholipase A2, group IVA PPAR-γ Peroxisome proliferator-activated receptor γ PRR Pattern recognition receptor PTGDS Prostaglandin D synthase PTGES Prostaglandin E synthase PTGS2 Cyclooxygenase 2 (also called COX2) qRT-PCR Quantitative real-time polymerase chain reaction RFP Red fluorescent protein RNS Reactive nitrogen species ROI Reactive oxygen intermediates SCV Salmonella containing vacuole xviii  SDS Sodium dodecyl sulfate SGI Salmonella genomic island SIF Salmonella induced filaments SPI1 Salmonella pathogenicity island 1 SPI2 Salmonella pathogenicity island 2 STAT1 Signal transducer and activator of transcription 1 T3SS Type III secretion system TBXAS1 Thromboxane A synthase 1 TBXB2 Thromboxane B2 TGN Trans-Golgi network TH cell T helper cell TLR Toll-like receptor TM Trans-membrane TNFα Tumor necrosis factor α TRIF TIR-domain-containing adapter-inducing interferon-β V-ATPase Vacuolar ATPase   xix  Acknowledgements  I would like to thank Prof. Finlay for his patient support and guidance. His mentorship has been invaluable to my progress towards becoming a scientist. I would also like to thank the members of my committee, Prof. Erin Gaynor, Prof. Bruce Vallance, and Prof. Wayne Vogl, for their support and encouragement over the past 5 years. The critical advice and suggestions of these 4 scientists has been a vital component of my education and scientific improvement. In addition I would like to thank Prof. José Luis Puente for providing helpful suggestions and advice. I would like to extend my gratitude to the members of the Finlay Lab, both past and present, who have assisted and guided me in my scientific journey, and have been my close friends during my time in Vancouver. Thank-you for all your advice, and all the fun times we had together. I will always cherish the time I spent in Vancouver with all of you. In particular I would like to thank Dr. Caetano Antunes for being my mentor, and for putting up with working next to me. You have continually provided me with support, encouragement, and direction, which has been indispensible. I would also like to thank Dr. Matthew Croxen for teaching me everything I know about cloning, and to Dr. Hongbing Yu for teaching me all about tissue culture. I would also like to thank my family, for always being there for me, and offering me constant love and support. Particularly, my parents, Cheryl and Paul, my grandparents, and my brother Liam have been an immense encouragement. Thank-you for everything. I would also like to specifically thank my friends, Shannon, Lyn, Olivia, Kathy, and Kerensa - thanks for being on my team. 1  Chapter  1: Introduction  This Introduction section will cover general aspects of Salmonella biology, including information about Salmonella disease, prevalence, mechanisms of pathogenesis, and host response. Specific aspects of Salmonella and host biology that pertain to individual chapters will be discussed in more detail in the chapter introductions and discussions.  1.1 Disease relevance 1.1.1 Disease characteristics of Salmonellosis Within the family of Enterobacteriaceae is the genus Salmonella, which encompasses a group of bacteria that cause severe disease worldwide.  Salmonella cause two general categories of disease in humans: gastroenteritis, caused by non-typhoid Salmonella replicating in the intestine; and enteric fever, caused by the systemic spread of Salmonella.  The gastroenteritis associated with Salmonella infection includes severe diarrhea lasting between 3-13 days, abdominal pain and cramps, and in some cases a short fever (Onwuezobe, Oshun et al. 2012). Symptoms can start between 6-72 hours post-infection, and a high inoculum is usually required to cause disease (Onwuezobe, Oshun et al. 2012). Enteric fever, including typhoid and paratyphoid fever is a febrile illness commonly found in developing countries with inadequate sanitation and water services (Parry, Hien et al. 2002, Effa, Lassi et al. 2011). Symptoms can include fever, headache, diarrhea, abdominal pain, nausea, and vomiting (Effa, Lassi et al. 2011). Non-typhoidal Salmonella infection can lead to clinical complications that affect a variety of body systems including meninges, bones, joints, adrenal glands, aorta, heart, kidneys and lungs (Onwuezobe, Oshun et al. 2012). Complications associated with enteric fever include 2  intestinal perforation, intestinal bleeding, hepatitis, shock, pneumonia, pancreatitis, myocarditis, meningitis, and delirium (Parry, Hien et al. 2002, Effa, Lassi et al. 2011). Salmonella infection is very severe and life threatening in patients who are immunocompromised. Patients with HIV/AIDS in Malawi have a very high mortality rate (47%) and a very high recurrence rate (43%) from non-typhoidal Salmonella (Gordon, Banda et al. 2002). In addition to HIV/AIDS, immunosuppression leading to severe Salmonellosis can also be caused by malaria infections, severe anemia, malnutrition, malignancy, and immunosuppressive therapy (Hohmann 2001, Morpeth, Ramadhani et al. 2009). 1.1.2 Salmonella prevalence   In 2000, there were an estimated 21.7 million cases of typhoid fever, and 5.4 million cases of paratyphoid fever (Crump and Mintz 2010). Enteric fever is predominantly found in areas with poor sanitation. The greatest burden of disease is thought to affect children and adolescents in south central and south eastern Asia (Crump and Mintz 2010). In particular, China, India, Indonesia, Pakistan, and Vietnam have high levels of typhoid fever (Ochiai, Acosta et al. 2008).  In Sub-Saharan Africa the characterization of enteric fever has been difficult, but there is evidence of increasing systemic diseases caused by non-typhoidal Salmonella (Mweu and English 2008). The prevalence of enteric fever in Latin America has recently shown signs of decreasing, likely due to economic transitions and improved sanitation (Crump and Mintz 2010).  While enteric fever tends to be found in developing countries, there is still a large proportion of Salmonellosis caused by contaminated food and water in developed nations including the United States of America and Canada. The USA Center for Disease Control (CDC), reports that from 2009-2010 there were 1,527 foodborne disease outbreaks, and Salmonella was the second leading cause, causing 30% of outbreaks (CDC 2013). In addition, 3  Salmonella outbreaks were responsible for the most hospitalizations associated with foodborne diseases (CDC 2013). In Canada, in 2005 there were 30 Salmonella outbreaks reported, resulting in 6, 096 reported cases, which is likely an underestimate (Gill, Reilly et al. 2005). On a global scale, there are an estimated 93.8 million cases annually of gastroenteritis caused by Salmonella, associated with 155, 000 deaths (Majowicz, Musto et al. 2010). 1.1.3 Economic burden In addition to the serious detrimental affects on human life, there is also a significant financial burden associated with Salmonella induced disease. In the US, a retrospective study was done looking at 1993-2001, and found that the total economic burden of Salmonella associated disease was $2.8 billion US dollars per year (Bishwa, Angulo et al. 2004). In Canada, the annual cost of all food-borne illnesses, which includes Salmonella as well as other bacteria and viruses, was estimated to be around $3.7 billion Canadian dollars (Thomas 2008). For Salmonella specifically, it is estimated that the cost in Canada is around $640 million Canadian dollars per year based on underreporting, while in 2005 the cost of confirmed cases was $17 million Canadian dollars (Majowicz, McNab et al. 2006, Thomas, Majowicz et al. 2006). While there is some variation in estimated costs between sources, the fact remains that there is great economic costs associated with Salmonella induced disease. 1.1.4 Importance of studying Salmonella Salmonella is a globally relevant pathogen, which affects both the developed and developing countries. Salmonella species cause both intestinal and extra-intestinal infections that lead to morbidity and mortality. In places with inadequate sanitation, enteric fever is widespread, affecting mostly children in Asia, Africa, and Latin America. In North America, and Europe there continue to be outbreaks of foodborne Salmonella causing gastroenteritis. Taken together 4  Salmonella disease cause serious burdens on the population, both in sickness, death, and financial burden. The scientific community continues to explore the mechanisms that enable these bacteria to cause disease. Studies into host-pathogen interactions, antibiotic resistance, improved sanitation, co-infections, and food handling are all key to controlling this pathogen. This thesis presents new data on Salmonellas interactions with the host and host small molecule hormones. These data contribute to our understanding of how this bacterial pathogen manipulates the host and causes disease.  1.2 Types of Salmonella 1.2.1 Salmonella classification Salmonella are Gram negative, flagellated, facultative anaerobes that can grow either within host cells or independently of host cells. The Salmonella genus fits into the family of Enterobacteriaceae, along with commensals and other pathogens including E. coli, Shigella, and Yersinia (Sanderson 1976).  The Salmonella genus is generally divided into two species: S. bongori and S. enterica and recently a third species was proposed, S. subterranean, but does not seem to be widely accepted (Shelobolina, Sullivan et al. 2004, Su and Chiu 2007, Achtman, Wain et al. 2012). A number of evolutionary subspecies have emerged among S. enterica, including subspecies I, II, IIIa, IIIb, IV, VI, and VII (Boyd, Wang et al. 1996, Popoff 1997). These subspecies are further divided into serovars (Ferreira, Buckner et al. 2012). Over 1500 serovars have been classified as S. enterica subspecies I, including serovar Typhimurium, Typhi, Paratyphi A, and Paratyphi C (Popoff, Bockemuhl et al. 2004, Ferreira, Buckner et al. 2012). Comparative genomics revealed 96 to 99.5% identity between S. enterica serovars (Edwards, Olsen et al. 2002). Although closely related, these serovars differ in host range, the degree of 5  host adaptation and the nature of disease (Crosa, Brenner et al. 1973, Le Minor 1988, Ferreira, Buckner et al. 2012). 1.2.2 Host range of Salmonella S. enterica subspecies I colonizes a broad range of hosts, from reptiles to warm-blooded animals (Popoff 1992). The idea of host-adapted refers to the bacterium’s ability to cause disease, and circulate in a host population, without the need for reintroduction (Kingsley 2002). The specificity of Salmonella enterica serovars Typhi and Paratyphi are restricted to humans, while serovar Typhimurium has a broad host range, causing gastrointestinal disease in humans, and systemic disease in mice (Wick 2011). Because S. Typhimurium causes a systemic bacterial disease in mice, it has long been used as a model to study human enteric fever.  1.3 Genetic elements in Salmonella 1.3.1 Salmonella genomic islands Salmonella has a variety of genetic elements including genomic and pathogenicity islands, plasmids, and phages. Genomic Islands are distinct regions within the bacterial genome, which differ in G+C content, and arise from gene transfer events (Ferreira, Buckner et al. 2012). Genomic islands contribute to bacterial fitness, while a subset of genomic islands, termed pathogenicity islands, contribute to bacterial virulence (Dobrindt, Hochhut et al. 2004, Kelly 2009).  Salmonella Genomic Island 1, called SGI1, is an integrative mobilizable element associated with multiple drug resistance (MDR) (Doublet, Praud et al. 2009, Kelly 2009, Yang, Zheng et al. 2009). SGI1 is a complex class 1 integron that is 43 kilobases with 44 open reading frames (ORFs), and a cluster of MDR genes (Boyd, Peters et al. 2001, Doublet, Boyd et al. 2005, 6  Mulvey, Boyd et al. 2006, Doublet, Praud et al. 2009, Kelly 2009). SGI1 has been found in many S. enterica serovars including Typhimurium, Agona, Albany, Paratyphi B, Meleagridis, Newport, Kentucky, Kingston, Virchow, Derby, Ceero, Kiambu, Emek, Dusseldorf, Haifa, and Infantis (Boyd, Peters et al. 2001, Mulvey, Boyd et al. 2006, Doublet, Praud et al. 2009, Ferreira, Buckner et al. 2012). 1.3.2 Salmonella pathogenicity islands Salmonella Pathogenicity Islands (SPIs) are large regions of DNA that are associated with virulence (Bishop, Baker et al. 2005, Ferreira, Buckner et al. 2012). SPIs often have a mosaic-like structure, indicating that multiple insertion events lead to their formation (Bishop, Baker et al. 2005). SPI1 through 5 are fairly well characterized in S. Typhimurium (Ferreira, Buckner et al. 2012) and are briefly discussed here. At least 21 different pathogenicity islands have so far been identified (de Jong, Parry et al. 2012). SPI1 is around 40 kb, with 29-30 genes and a G+C content of 47%, while the Salmonella core genome has a G+C content that averages around 52% (Marcus, Brumell et al. 2000, Hensel 2005, Ellermeier and Slauch 2007). SPI1 is found in many strains of S. bongori and S. enterica (Hensel 2005). Interestingly, there have been Salmonella enterica strains identified that lack SPI1, but still cause human disease (Ginocchio, Rahn et al. 1997, Hu, Coburn et al. 2008). SPI1 encodes a type III secretion system (T3SS), its associated proteins, and an iron uptake system (Zhou, Hardt et al. 1999, Hensel 2005). The proteins associated with the SPI1-T3SS include the T3SS apparatus, some of the translocated proteins, termed effectors, and the regulators (Ellermeier and Slauch 2007, Kelly 2009). Some SPI1 effectors are encoded outside of SPI1, including sopA, sopB, sopD, and sopE2, interestingly, sopE is encoded by a phage found in some Salmonella strains (Hensel 2005). The SPI1 T3SS plays an important role during infection, as it 7  mediates bacterial uptake by non-phagocytic cells (Galan 2001, Schmidt and Hensel 2004, Hensel 2005, Ellermeier and Slauch 2007, Kelly 2009).  Salmonella have another T3SS, encoded by SPI2, which also encodes a two component regulatory system, and effectors (Bishop, Baker et al. 2005, Hensel 2005, Ellermeier and Slauch 2007, Kelly 2009). The SPI1 and SPI2 encoded T3SS are different and likely arose from separate gene transfer events (Hensel 2005, Kelly 2009, Ferreira, Buckner et al. 2012). SPI2 is around 40 kb, with 42 ORFs and is divided into two components, a 14.5 kb region encodes 5 ttr genes, which encode for tetrathionate respiration proteins, and a 25 kb region with 4 operons encoding the secretion system regulators (ssr), secretion system chaperones (ssc), secretion system apparatus (ssa), and the secretion system effectors (sse) (Hensel, Shea et al. 1997, Hensel, Nikolaus et al. 1999, Hensel 2005, Kelly 2009, Ferreira, Buckner et al. 2012). Many of the effectors secreted by the SPI2 T3SS are encoded outside of SPI2 (Figueroa-Bossi, Uzzau et al. 2001). SPI2 is important for the proliferation of the bacteria post-invasion and is required for intracellular survival within macrophages in a special vacuole called the Salmonella containing vacuole (SCV) (Santos, Tsolis et al. 2003, Ellermeier and Slauch 2007, Kelly 2009, Buckner, Croxen et al. 2011, van der Heijden and Finlay 2012). In general, SPI2 protects bacteria within the SCV by preventing the co-localization of the phagocyte oxidase and the inducible nitric oxide synthase with the SCV (Vazquez-Torres, Jones-Carson et al. 2000, Chakravortty, Hansen- Wester et al. 2002, Hensel 2005). SPI3 is a 17 kb region with a highly variable G+C content of on average 47.5% (Blanc- Potard, Solomon et al. 1999, Hensel 2005, Kelly 2009, Ferreira, Buckner et al. 2012). SPI3 is found in all serovars, but has extensive variation in structure and location (Blanc-Potard, Solomon et al. 1999, Fierer and Guiney 2001, Amavisit, Lightfoot et al. 2003, Kelly 2009). SPI3 8  encodes magnesium transport ATPase accessory proteins that are important for growth in magnesium-limiting conditions (Hensel 2005, Kelly 2009). SPI3 plays a role in bacterial survival within macrophages and in murine systemic disease (Blanc-Potard and Groisman 1997, Marcus, Brumell et al. 2000, Hensel 2005, van Asten and van Dijk 2005).  SPI4 is 25 kbs in length, with a G+C content of 44.8%, and is conserved between S. enterica serovars, with some variation in organization (Wong, McClelland et al. 1998, Amavisit, Lightfoot et al. 2003, Hensel 2005, Kelly 2009, Ferreira, Buckner et al. 2012). Encoded in SPI4 are a single-stranded DNA binding protein and superoxide response regulatory genes (soxSR) (Marcus, Brumell et al. 2000). It also encodes a type 1 secretion system, which may be important for survival within macrophages (Schmidt and Hensel 2004, van Asten and van Dijk 2005).  SPI5 is a 7.6 kb region with a G+C content of 43.6%, and is involved in enteropathogenesis, as mutations in SPI5 reduce enteritis (Marcus, Brumell et al. 2000, Hensel 2005, Kelly 2009, Ferreira, Buckner et al. 2012). SPI5 also encodes SopB and PipB, two effectors secreted by the SPI1 and SPI2-encoded T3SS respectively (Schmidt and Hensel 2004, McGhie, Brawn et al. 2009). SopB triggers fluid secretion leading to diarrhea, and is found in both S. bongori and S. enterica (Knodler, Celli et al. 2002). In contrast, pipAB are found in S. enterica, but not in S. bongori (Knodler, Celli et al. 2002). pipB2, is a homologue of pipB, and is associated with the formation of Salmonella-induced filaments within macrophages (Knodler and Steele-Mortimer 2005). 1.3.3 Salmonella phages Salmonella has many phages, which contribute to both fitness and virulence. Gifsy 1 and Gifsy 2 are lambdoid prophages discovered in S. enterica serovar Typhimurium (Figueroa-Bossi and Bossi 1999, Slominski, Calkiewicz et al. 2007). Gifsy 2 contributes directly to systemic 9  virulence, and encodes sodC, gtgE and gtgB/sseI, some of which are secreted by the SPI1 and SPI2-encoded T3SS (Figueroa-Bossi and Bossi 1999, Ho, Figueroa-Bossi et al. 2002, Coombes, Wickham et al. 2005, Slominski, Calkiewicz et al. 2007, Ferreira, Buckner et al. 2012). SodC is a periplasmic Copper/Zinc superoxide dismutase important for bacterial survival within macrophages and virulence in mice (De Groote, Ochsner et al. 1997, Figueroa-Bossi, Uzzau et al. 2001). Variations of SodC, SodCI and SodCII, have been identified in S. Typhimurium strain 14028 (Krishnakumar, Kim et al. 2007).  Gifsy 1 encodes virulence factors including gipA and gogB (Stanley, Ellermeier et al. 2000, Coombes, Wickham et al. 2005, Slominski, Calkiewicz et al. 2007, Ferreira, Buckner et al. 2012). GogB is secreted by both the SPI1 and SPI2-encoded T3SS, and was found to localize to the cytoplasm (Coombes, Wickham et al. 2005). GipA is induced in the small intestine, and is involved in Salmonella growth and survival in Payer’s patches (Stanley, Ellermeier et al. 2000).  Other phages have been identified in the Salmonella genome, including Gifsy3, and SopEΦ (Figueroa-Bossi, Uzzau et al. 2001, Chan, Baker et al. 2003, Ferreira, Buckner et al. 2012). Gifsy3 was found in S. Typhimurium strain 14028 and contains the SPI1 and SPI2- secreted effector SspH1 (Figueroa-Bossi, Uzzau et al. 2001).  SopEΦ is found in serovar Typhimurium and encodes SopE, a protein secreted by the SPI1-encoded T3SS, which contributes to bacterial invasiveness (Kropinski, Sulakvelidze et al. 2007). 1.3.4 Salmonella plasmids Salmonella serovars also contain plasmids. In particular, a virulence plasmid is found in serovars Abortusovis, Abortusequi, Choleraesuis, Dublin, Enteritidis, Gallinarum, Sendai and Typhimurium (Porwollik and McClelland 2003, Chu and Chiu 2006, Ferreira, Buckner et al. 2012). Frequently encoded on the virulence plasmid of Salmonella is the spv operon, which is 10  found on the chromosome in S. enterica subspecies I, II, IIIa, IV, and VII (Porwollik and McClelland 2003, Chu and Chiu 2006). This operon contains 5 genes important for the intracellular replication of the bacteria including SpvB, an ADP-ribosylating protein that modifies actin within the host cell and is secreted by the SPI2 T3SS (Matsui, Bacot et al. 2001, Hochmann, Pust et al. 2006, Browne, Hasegawa et al. 2008, McGhie, Brawn et al. 2009). In serovar Typhimurium, the spv operon is a major contributor to virulence (Matsui, Bacot et al. 2001, Buckner, Croxen et al. 2011).  1.4 Mechanisms of pathogenesis 1.4.1 Disease progression Salmonella are transmitted primarily by contaminated food or water or contact with animals that carry the bacteria (Mastroeni and Grant 2011, Chai, White et al. 2012, Lee and Greig 2012). After ingestion of S. enterica, bacteria cross the intestinal barrier, are taken up by phagocytes, replicate, and spread to systemic sites in cases of enteric fever (Kohbata, Yokoyama et al. 1986, Jones, Ghori et al. 1994, Vazquez-Torres, Jones-Carson et al. 1999, Kuhle and Hensel 2004, Haraga, Ohlson et al. 2008). Salmonella replicate in the liver and spleens of infected individuals forming foci of infection which progress to bacterial septicemia (Sheppard, Webb et al. 2003). Salmonella are excreted in the infected host’s feces, thus allowing for the completion of the infective cycle (Buchwald and Blaser 1984). After Salmonella induced gastroenteritis, humans usually excrete Salmonella for about 5 weeks (Buchwald and Blaser 1984). 11  1.4.2 Salmonella replication in the intestine When Salmonella first enter the gastrointestinal tract they must survive the acidic conditions in the stomach ensuring passage to the intestine. Salmonella have an acid tolerance response which, when activated allows for bacterial survival in low pH environments, such as that found in the stomach (Audia, Webb et al. 2001, Alvarez-Ordonez, Begley et al. 2011). The acid tolerance response in Salmonella involves a variety of mechanism including proton pumps, lysine and argenine decarboxylases, acid shock proteins, which are controlled by a variety of regulatory genes including RpoS, Fur, PhoP/Q, and OmpR (Alvarez-Ordonez, Begley et al. 2011). In addition, Salmonella is able to alter its membrane composition to maintain fluidity and prevent oxidative damage (Alvarez-Ordonez, Begley et al. 2011). Once Salmonella reach the intestine, the bacteria must interact with the host’s normal gut microflora. In the mouse, it has been shown that the composition of the microflora is a significant factor in determining Salmonella disease outcome (Sekirov, Tam et al. 2008, Ferreira, Gill et al. 2011). In fact, it has now become accepted practice to shift the mouse microflora by treatment with antibiotics to allow for a variety of mouse models of Salmonellosis using Salmonella enterica Typhimurium (Grassl, Valdez et al. 2008, Kaiser, Diard et al. 2012). Salmonella is able to use the inflammation it induces to outcompete the microbiota by using thetrathionate as a terminal electron acceptor and ethanolamine as a carbon source (Winter, Thiennimitr et al. 2010, Thiennimitr, Winter et al. 2011). Salmonella crosses the epithelial barrier of the host’s intestine (Haraga, Ohlson et al. 2008). A few mechanisms of bacterial uptake have been proposed including crossing the intestinal barrier through M-cells (Mastroeni and Grant 2011). M-cells, or microfold cells, are specialized epithelial cells found overlying Peyer’s patches in the intestine, and in the case of 12  Salmonella, provide an ideal entry point (Jones, Ghori et al. 1994, Haraga, Ohlson et al. 2008). Salmonella is able to mediate its own uptake and replication in epithelial cells in a SPI1 dependent manner (van der Heijden and Finlay 2012). A population of Salmonella has been found to replicate in the cytosol of epithelial cells, and these bacteria, when released into the intestinal lumen, are hyperinvasive (Knodler, Vallance et al. 2010). Beneath M-cells are resident gut phagocytes, which provide an opportunity for Salmonella uptake and systemic spread (Haraga, Ohlson et al. 2008). 1.4.3 Salmonella systemic spread Once inside the phagocyte, Salmonella replicates within a special SPI2 mediated phagocytic vacuole called the Salmonella-containing vacuole (SCV) (Kuhle and Hensel 2004, Browne, Hasegawa et al. 2008, Poh, Odendall et al. 2008). Replication within phagocytes allows the bacteria to disseminate through the reticuloendothelial system, moving primarily to the mesenteric lymph nodes, spleen, bone marrow and liver (Kuhle and Hensel 2004, Haraga, Ohlson et al. 2008, Mastroeni and Grant 2011). Salmonella continue to replicate within these phagocytes in systemic organs, creating foci of infection (Sheppard, Webb et al. 2003, Grant, Restif et al. 2008, Mastroeni and Grant 2011). The bacteria can also replicate inside specialized cells in the liver, termed Kupffer cells (Mastroeni and Grant 2011). From the liver, bacteria are able to gain access to the gallbladder through the ducts and vasculature (Parry, Hien et al. 2002, Gonzalez-Escobedo, Marshall et al. 2011). Salmonella can replicate within the bile, and can be found at high levels in the gallbladders of a portion of infected mice (Menendez, Arena et al. 2009, Antunes, Andersen et al. 2011, Buckner, Croxen et al. 2011). Menendez et. al. (2009) found that Salmonella are actually able to replicate within the gallbladder epithelium (Menendez, Arena et al. 2009). In 13  addition, Salmonella can form biofilms on gallstones in the presence of bile (Prouty, Schwesinger et al. 2002). It is thought that Salmonella in the gallbladder contribute to intestinal re-seeding, transmission, and asymptomatic carrier states (Menendez, Arena et al. 2009, Gonzalez-Escobedo, Marshall et al. 2011). Therefore, colonization of the gallbladder may be an important step in completing the infective cycle. However, there is still some debate among Salmonella experts as to the importance of the gallbladder as a bacterial reservoir.  1.5 Virulence mechanisms Salmonella has a variety of virulence mechanisms that allow this bacterium to cause such widespread disease. Perhaps the most well studied virulence mechanisms in Salmonella enterica Typhimurium are the two type 3 secretion systems encoded on Salmonella pathogenicity islands 1 and 2 (Kuhle and Hensel 2004, Geddes, Worley et al. 2005, Coombes, Lowden et al. 2007, Browne, Hasegawa et al. 2008, Haraga, Ohlson et al. 2008, van der Heijden and Finlay 2012). 1.5.1 Type III secretion systems Type III secretion systems (T3SS) are frequently referred to as molecular syringes that allow the translocation of proteins directly from the bacterial cytoplasm into the host cell cytosol. T3SSs play an essential role in S. enterica systemic spread and pathogenesis by transporting virulence proteins (effectors) from the bacteria into the host cell to promote bacterial survival and colonization (Freeman, Ohl et al. 2003, Kuhle and Hensel 2004, Geddes, Worley et al. 2005, Coombes, Lowden et al. 2007, Browne, Hasegawa et al. 2008, Haraga, Ohlson et al. 2008). The SPI1 T3SS is involved in bacterial uptake into non-phagocytic cells, such as epithelial cells, although evidence is mounting that the roles of SPI1 and SPI2 are not as segregated as was once thought (Lilic and Stebbins 2004, Patel and Galan 2005, Ly and Casanova 2007). SPI2 is 14  primarily activated within the phagosome and is required for survival within macrophages and consequently, systemic disease (Ochman, Soncini et al. 1996, Beuzon and Holden 2001, Freeman, Ohl et al. 2003, Geddes, Worley et al. 2005, Coombes, Lowden et al. 2007, Haraga, Ohlson et al. 2008, Buckner, Croxen et al. 2011). 1.5.2 Salmonella pathogenicity island 1 The SPI1 secretion system is essential for bacterial uptake into non-phagocytic cells. SPI1 secretion is under the control of the regulators HilA and InvF (Lee, Jones et al. 1992, Eichelberg and Galan 1999). SPI1 is important during the early phases of infection, and it is associated with bacterial internalization and early SCV formation (van der Heijden and Finlay 2012). Three of the genes associated with SPI1, sipB, sipC, and sipD encode translocases that are required for intimate association with host cells and secretion (Lara-Tejero and Galan 2009). Once the SPI1 T3SS is active, a variety of effectors are involved in mediating bacterial internalization. See Figure 1.1 for a schematic representation of SPI1 mediated effects and effectors. SipA, SipC, SopB, SopE, and SopE2 are all involved in the induction of actin rearrangements and membrane ruffling which allow internalization of Salmonella (Patel and Galan 2005). Once the bacteria are internalized, SptP is involved in restoration of the actin cytoskeleton to its normal state (Patel and Galan 2005). SPI1 is also involved in the early formation of the SCV. SopB, SipC, SopA, SopD, and SptP are all involved in mediating the recruitment of early SCV markers, fusion with vesicles, removal of late lysosome markers, and the formation of macropinosomes (Bakowski, Cirulis et al. 2007, McGhie, Brawn et al. 2009, van der Heijden and Finlay 2012). Thus the activities of the SPI1 T3SS are vital to the establishment of Salmonella in non-phagocytic cells. 15   Figure 1.1 SPI1 mediated effects SPI1 mediated bacterial entry into host cells and formation of early Salmonella containing vacuole. Reproduced from van der Heijden and Finlay, Future Microbiology, June 2012, Vol. 7, No. 6, Pages 685-703 with permission of Future Medicine Ltd. 16   1.5.3 Salmonella pathogenicity island 2 SPI2 effectors mediate many functions during Salmonella infection, including regulation of the vacuolar membrane, increasing the motility of infected cells, targeting the SCV to the trans-Golgi network (TGN), forming an actin meshwork surrounding the SCV, and inducing the formation of Salmonella Induced Filaments (SIF), which are long filamentous structures originating at the SCV (Brumell, Goosney et al. 2002, Kuhle and Hensel 2004, Haraga, Ohlson et al. 2008). For a schematic representation of SPI2 mediated effects, see Figure 1.2. SIFs are membranous structures that extend from the SCV along microtubules (Ruiz-Albert, Yu et al. 2002), and may be involved in maintaining the size of the SCV and the acquisition of nutrients (Poh, Odendall et al. 2008). SIFs also have similar content and markers to the SCV (Gorvel and Meresse 2001). Multiple SPI2 effectors are thought to be involved in the formation of SIFs, including SseF, SseG, SseJ, and SifA (Brumell, Goosney et al. 2002, Kuhle and Hensel 2002, Ruiz-Albert, Yu et al. 2002, McGhie, Brawn et al. 2009). SpiC is a cytoplasmic effector that is thought to induce an IL-10 response (Uchiya, Barbieri et al. 1999, Uchiya, Groisman et al. 2004, Browne, Hasegawa et al. 2008). SpiC may also play a role in vesicle trafficking and is required for the secretion of SseB, SseC and SseD (Uchiya, Barbieri et al. 1999, Freeman, Rappl et al. 2002, Browne, Hasegawa et al. 2008). SpiC is a component of a pH sensing complex which controls effector secretion (Yu, McGourty et al. 2010). The Salmonella T3SSs are vital to pathogenesis, and are therefore a very important topic to study. SPI2 effectors, and their role in Salmonella pathogenesis will be discussed in more detail in the introduction of Chapter 2. 17   Figure 1.2 SPI2 mediate effects SCV maturation and Salmonella replication. (VAP – Vacuole-associated actin polymerization). Reproduced from van der Heijden and Finlay, Future Microbiology, June 2012, Vol. 7, No. 6, Pages 685-703 with permission of Future Medicine Ltd.  18  1.6 Host response to Salmonella 1.6.1 Mucosal defense For Salmonella to establish systemic infection, the bacteria first have to cross the intestinal barrier. To do this, the bacteria must pass through the mucus layer, produced by goblet cells, and survive a battery of anti-microbial peptides (AMP), such as α- and β-defensins (cryptdins in mice), CRS peptides, lysozymes, cathelicidins, angiogenin, and Reg IIβ/γ (Broz, Ohlson et al. 2012). Paneth cells secrete many of the AMPs, but upon activation other epithelial cells can also produce AMPs (Broz, Ohlson et al. 2012). AMPs have been found to contribute to the control of Salmonella, but are not considered to be a major factor in prevention of infection or clearing of the bacteria (Dougan, John et al. 2011). Once Salmonella has crossed the epithelial barrier it must face the GALT (gut-associated lymphoid tissue), which is composed of T and B cells, dendritic cells, macrophages, and neutrophils (Broz, Ohlson et al. 2012).  The Peyer’s patches, a component of the GALT, are one of the major routes of entry for Salmonella. Peyer’s patches are aggregated lymphoid follicles covered by a special form of epithelium, called the follicle associated epithelium, which includes M-cells (Broz, Ohlson et al. 2012). M-cells transport antigens and bacteria, such as Salmonella, via transcytosis to lymphocytes or antigen presenting cells that wait beneath the M-cells (Haraga, Ohlson et al. 2008, Broz, Ohlson et al. 2012). Antigen presenting cells can then activate B cells and T cells and induce memory cells leading to the induction of the adaptive immune response (Broz, Ohlson et al. 2012).  Salmonella are taken up by macrophages, where they stimulate the production of IL-18 and IL-23, which amplify the immune response leading to increased IFN-γ, IL-22, and IL-17 production (Broz, Ohlson et al. 2012). IL-12 and IL-18 secretion by activated macrophages 19  contributes to the recruitment of NK cells and T helper cells, which secrete additional IFN-γ, leading to further activation of macrophages in a positive inflammatory feedback loop (Eckmann and Kagnoff 2001, Srinivasan, Salazar-Gonzalez et al. 2007, Dougan, John et al. 2011). IFN-γ performs a variety of functions, including leading to the activation of macrophages and making them more capable of clearing intracellular pathogens such as Salmonella (Monack, Bouley et al. 2004, Dougan, John et al. 2011). The production of IFN-γ and the subsequent activation of macrophages is crucial to macrophage clearance of Salmonella (Mittrucker and Kaufmann 2000, Eckmann and Kagnoff 2001). IL-23 stimulates further release of IL-17 and IL-22 from antigen experienced T cells, IL-22 then stimulates the production of AMPs and mucus from paneth and goblet cells respectively (Broz, Ohlson et al. 2012). IL-17 production can stimulate epithelial cells to produce CXC chemokines, which recruit neutrophils to the site of Salmonella invasion (Broz, Ohlson et al. 2012).  The increase in IL-22 and IL-23 also stimulates the production of AMPs and neutrophil recruitment (Broz, Ohlson et al. 2012). Neutrophils are crucial for the successful clearance of Salmonella, and are recruited to the site of infection by multiple factors including IL-1β (Broz, Ohlson et al. 2012). Neutrophils are able to successfully kill extracellular Salmonella (Broz, Ohlson et al. 2012). One of the mechanisms used by neutrophils to kill Salmonella is by the production of reactive oxygen species (Miao, Leaf et al. 2010). While neutrophils are effective at killing Salmonella, they also cause tissue damage and may stimulate chloride secretion, leading to diarrhea (Tsolis, Adams et al. 1999, Broz, Ohlson et al. 2012).  Dendritic cells (DC) can also be found beneath the M-cells in Peyer’s patches. DCs provide a link between the innate and the adaptive immune responses by migrating to lymph nodes and activating T cells (Bueno, Riquelme et al. 2012). Mature DCs also secrete cytokines 20  and influence the polarization and effector function of T cells (Bueno, Riquelme et al. 2012). Salmonella is unable to replicate in DCs, however it does survive and localize in a SPI2 dependent manner to the trans Golgi network, and its vacuole does not fuse with lysosomes (Jantsch, Cheminay et al. 2003, Petrovska, Aspinall et al. 2004, Tobar, Carreno et al. 2006, Halici, Zenk et al. 2008). S. Typhimurium actually prevents DC processing and presentation of its antigens in a SPI2 dependent manner, thus suppressing antigen presentation and T cell activation (Petrovska, Aspinall et al. 2004, Cheminay, Mohlenbrink et al. 2005, Alaniz, Cummings et al. 2006, Tobar, Carreno et al. 2006, Halici, Zenk et al. 2008). NRAMP1 (natural resistance-associated macrophage protein 1) is an important host factor that determines the outcome of Salmonella infection (Mittrucker and Kaufmann 2000). NRAMP1 is a proton/divalent cation transporter, involved in iron metabolism and ROS detoxification found in the vacuolar membrane (Kehres, Zaharik et al. 2000, Dougan, John et al. 2011). Mice lacking NRAMP1 are extremely susceptible to S. Typhimurium (Monack, Bouley et al. 2004, Valdez, Diehl et al. 2008). 1.6.2 Pattern recognition receptors Pattern recognition receptors (PRRs), such as the Toll-like receptors (TLRs) and NOD- like receptors (NLRs) play an important role in the recognition of Salmonella and help mediate the connection between the innate and adaptive immune responses of the host (Kawai and Akira 2010, de Jong, Parry et al. 2012). PRRs recognize signals called pathogen associated molecular patterns (PAMPs), and danger associated molecular patterns (DAMPs), PRRs then initiate signaling cascades that lead to the activation of the host immune response (Bueno, Riquelme et al. 2012, de Jong, Parry et al. 2012). In brief, in cases of Salmonellosis PRR signaling leads to the migration and activation of macrophages and neutrophils to the site of infection, and the 21  production of a variety of cytokines including IL-6, IL-1β, IL-12, IL-18, TNFα, and IFN-γ, and the activation of iNOS (Dougan, John et al. 2011, de Jong, Parry et al. 2012). In particular, the IFN-γ response has been found to be crucial for successful clearance of Salmonella (Muotiala and Makela 1990, Monack, Bouley et al. 2004). TNFα has also been found to be important throughout Salmonella infection, as mice lacking TNFα had worsened infections at early time points, and mice treated with anti-TNFα antibodies during later phases of infection lead to relapses (Mastroeni, Villarreal-Ramos et al. 1993, Everest, Roberts et al. 1998, Dougan, John et al. 2011).  The PAMPs produced by Salmonella include its T3SS, flagella, fimbrae, LPS, lipoproteins, curli, and bacterial DNA (Broz, Ohlson et al. 2012, de Jong, Parry et al. 2012). The S. Typhi Vi capsule prevents immune recognition by restricting PRR access to PAMPS (Wilson, Raffatellu et al. 2008). TLRs 1, 2, 4, 5, 6, and 10 are all found on the cell membrane, while TLRs 3, 7, 8, 9, 11, and 13 are found on early and late endosomes (Broz, Ohlson et al. 2012). Once TLRs bind their ligands, they associate with adaptor molecules, including MyD88 and TRIF, and then initiate signaling cascades leading to the activation of the NF-κB and IRF3 transcription factors, and the production of IL-8, IL-10, pro-IL-1β, pro-IL-18, and IFN-γ (Medzhitov 2001, Broz, Ohlson et al. 2012). TLR4, which recognizes LPS, and TLR5, which recognizes flagella, have been found to be important for Salmonella disease, as mice lacking these TLRs have increased susceptibility to Salmonella (Vazquez-Torres, Vallance et al. 2004, Coburn, Grassl et al. 2007, de Jong, Parry et al. 2012). Enterocytes express TLR5 on their basolateral sides, which allow them to recognize flagellin from invading Salmonella, while being unaffected by commensal bacteria in the intestinal lumen (Gewirtz, Navas et al. 2001). 22   Mice lacking TLR2, and/or TLR4 were more susceptible to Salmonella infection; however, when TLR2, 4 and 9 were all knocked out Salmonella was found to colonize poorly (Arpaia, Godec et al. 2011). This study showed that Salmonella required TLR signaling, which induces acidification of the vacuole, a signal Salmonella uses to initiate the expression of virulence genes (Arpaia, Godec et al. 2011). Taken together, it has become clear that PRRs are important for the successful clearance of the pathogen, primarily through initiating the immune response and the production of cytokines, such as IFN-γ and TNFα, which activate immune cells to kill Salmonella. It also seems that Salmonella has evolved mechanisms to exploit some aspects of these host responses to regulate its own virulence. 1.6.3 Inflammasome The inflammasome is comprised of a complex of Nod-like Receptors (NLRs), caspase-1, and ASC (apoptosis-associated speck-like protein containing a CARD), and is crucial for the host response against Salmonella (Broz, Ohlson et al. 2012, de Jong, Parry et al. 2012). The inflammasome, when active, cleaves pro-IL-1β and pro-IL-18 to their active forms, and can also lead to pyroptosis (Miao, Leaf et al. 2010, Broz, Ohlson et al. 2012). Pyroptosis is a pro- inflammatory form of programmed cell death which, in the case of Salmonella infection, leads to the release of intracellular bacteria into the extracellular milieu, providing an opportunity for neutrophils to kill Salmonella (Lara-Tejero, Sutterwala et al. 2006, Bergsbaken, Fink et al. 2009, Miao, Leaf et al. 2010). Salmonella Typhimurium induce the NLRC4- and NLRP3- inflammasomes to release IL-1β and IL-18, and mice lacking these NLRs are more susceptible to Salmonella infection (Broz, Newton et al. 2010, Bueno, Riquelme et al. 2012). In addition, mice lacking caspase-1 are also more susceptible to Salmonella infection (Lara-Tejero, Sutterwala et al. 2006). The Salmonella SPI1 rod-like protein PrgJ was found to bind to NAIP2, which 23  promotes NLRC4 inflammasome activation (Kofoed and Vance 2012). In addition, flagellin secreted by the SPI1 T3SS can bind NAIP5 and 6, leading to NLRC4 inflammasome activation, resulting in pyroptosis, IL-1β, and IL-18 secretion (Lightfield, Persson et al. 2008, Zhao, Yang et al. 2011, Bueno, Riquelme et al. 2012, Kofoed and Vance 2012). Thus Salmonella infection leads to increased inflammation via the induction of the inflammasome, resulting in the release of IL-1β and IL-18, and the initiation of the pyroptotic pathway. 1.6.4 Reactive oxygen intermediates Reactive oxygen intermediates (ROI) are able to rapidly clear Salmonella (Jantsch, Chikkaballi et al. 2011). The primary target of ROI is DNA (Fang 2011). Salmonella has evolved to avoid SCV association with NADPH oxidase, which forms ROI, in a SPI2 dependent mechanism (Vazquez-Torres, Xu et al. 2000). SPI2 prevents the NADPH oxidase subunit, Cytb558, from associating with the SCV (Gallois, Klein et al. 2001). In fact, one minute after phagocytosis, a difference in association with NADPH oxidase can be seen between wild-type Salmonella and Salmonella lacking SPI2 (Gallois, Klein et al. 2001). Additionally, SPI2 prevents the co-localization of Salmonella with hydrogen peroxide (Fang 2011). Salmonella has additional defenses, including three classes of proteins that are able to detoxify ROI, catalases, peroxiredoxins, and superoxide dismutases (Fang 2011). 1.6.5 Reactive nitrogen species Reactive nitrogen species (RNS) are also important for containing Salmonella infection (Henard and Vazquez-Torres 2011, Jantsch, Chikkaballi et al. 2011). RNS are cytotoxic to Salmonella through a variety of mechanisms, including arresting DNA replication, causing DNA damage, inhibiting SPI2 transcription, and inhibiting the PhoPQ regulated acid tolerance response (Bourret, Song et al. 2009). Salmonella LPS triggers the JAK/STAT signaling pathway, 24  and IFN-γ production, which mediate the upregulation of the inducible nitric oxide synthase (iNOS) (Henard and Vazquez-Torres 2011). IFN-γ activated macrophages produce high levels of RNS, which prevents SPI2 activation, allowing SCV association with phagolysosomes, and thus leading to increased antimicrobial activities of the macrophage (Mittrucker and Kaufmann 2000, McCollister, Bourret et al. 2005, Bourret, Song et al. 2009, Henard and Vazquez-Torres 2011). Furthermore, mice treated with iNOS inhibitors were found to have higher Salmonella counts in the liver and spleen (MacFarlane, Schwacha et al. 1999). At low pH, RNS can also interfere with the acid tolerance response by inhibiting the PhoPQ two-component regulator system (Henard and Vazquez-Torres 2011). NO also leads to the repression of SPI2 via PhoPQ independent mechanisms (Henard and Vazquez-Torres 2011). Salmonella has evolved ways to deal with the RNS produced by the host, including a NO2- transporter, and nitrate reductases (Henard and Vazquez-Torres 2011). Additionally, Salmonella avoids SCV association with iNOS containing vesicles in a SPI2 dependent matter (Henard and Vazquez-Torres 2011).  1.7 Conclusions In conclusion, Salmonella species and serovars cause disease in people all around the world. This pathogen has become a model organism for the study of bacterial-host interactions, and as such, the scientific community has gained a great deal of insight into pathogenicity from the study of this bacterium. Salmonella are able to survive within the host intestine, outcompeting the normal flora, and Salmonella are also able to survive and replicate within the host’s phagocytic immune cells. This versatile pathogen has successfully evolved to control the host’s response to infection, and represents an excellent system to probe and study many questions about bacterial pathogenicity. 25  Chapter  2: The contribution of individual Salmonella pathogenicity island 2 effectors to virulence  2.1  Abstract Salmonella enterica serovars are Gram-negative bacterial pathogens responsible for human diseases including gastroenteritis and typhoid fever. After ingestion, Salmonella cross the intestinal epithelial barrier, where they are phagocytosed by macrophages and dendritic cells, which then enables their spread to systemic sites during cases of typhoid fever. Salmonella use two type III secretion systems (T3SS) encoded by Salmonella pathogenicity islands (SPI) 1 and 2 to inject virulence proteins into host cells to modify cellular functions. SPI1 is involved in host cell invasion and inflammation, whereas SPI2 is required for intracellular survival and replication within phagocytes, and systemic spread. In this chapter the contribution of many known SPI2 effectors was examined in an in vivo model of murine typhoid fever and cell culture models of macrophage and epithelial cell infection.  Unmarked, in-frame deletions of SPI2 effectors were engineered in S. enterica serovar Typhimurium and the ability of the 16 different mutants to colonize and replicate was examined. In the typhoid model, we found that the ΔspvB and ΔspiC mutants were attenuated for colonization of intestinal and systemic sites, while the ΔsseF mutant was attenuated in systemic organs. In epithelial cells, all mutants replicated to the same extent as the wild type. In macrophages, ΔspiC, ΔsteC, ΔspvB, ΔssseK1/K2/K3, ΔsifA, and ΔsifB strains replicated poorly in comparison to wild-type Salmonella. This study provides the first thorough comparative screen of the majority of the known SPI2 effectors evaluated under 26  the same conditions in various models of infection, providing a foundation for comparative examination of the roles and interactions of these effectors.  2.2 Introduction Salmonella enterica are Gram-negative, facultative intracellular pathogens that can cause a wide range of human illness, from enteric/typhoid fever (caused by serovar Typhi or Paratyphi) to gastroenteritis (caused by serovar Typhimurium) (Freeman, Ohl et al. 2003, Kuhle and Hensel 2004). In cases of typhoid fever, after ingestion of S. enterica, the bacteria cross the intestinal barrier, predominantly through microfold cells (M-cells) in Peyer’s patches, where they are taken up by phagocytes. In these cells Salmonella replicates within a special phagocytic compartment termed the Salmonella-containing vacuole (SCV) (Kuhle and Hensel 2004, Browne, Hasegawa et al. 2008, Poh, Odendall et al. 2008). Within the phagocyte, the bacteria disseminate to systemic sites (Kohbata, Yokoyama et al. 1986, Jones, Ghori et al. 1994, Vazquez-Torres, Jones- Carson et al. 1999, Kuhle and Hensel 2004, Haraga, Ohlson et al. 2008) through the reticuloendothelial system, moving primarily to the mesenteric lymph nodes (MLNs), spleen, and liver (Kuhle and Hensel 2004, Haraga, Ohlson et al. 2008). Type 3 secretion systems (T3SS) play an essential role in S. enterica systemic spread and pathogenesis by transporting virulence proteins, termed effectors, from the bacteria into host cells to promote bacterial invasion and survival (Freeman, Ohl et al. 2003, Kuhle and Hensel 2004, Geddes, Worley et al. 2005, Coombes, Lowden et al. 2007, Browne, Hasegawa et al. 2008, Haraga, Ohlson et al. 2008). S. enterica serovar Typhimurium utilizes two T3SS, one encoded by Salmonella Pathogenicity Island (SPI) 1 and one by SPI2 (Kuhle and Hensel 2004, Geddes, Worley et al. 2005, Coombes, Lowden et al. 2007, Browne, Hasegawa et al. 2008, Haraga, 27  Ohlson et al. 2008). SPI1 is involved in bacterial uptake into non-phagocytic cells, such as epithelial cells, whereas SPI2 is activated within phagosomes and is required for survival within phagocytes and consequently, systemic disease (Ochman, Soncini et al. 1996, Beuzon and Holden 2001, Freeman, Ohl et al. 2003, Geddes, Worley et al. 2005, Coombes, Lowden et al. 2007, Haraga, Ohlson et al. 2008). Growing evidence suggests that the roles of SPI1 and SPI2 are not as segregated as previously thought, (Lilic and Stebbins 2004, Patel and Galan 2005, Ly and Casanova 2007) including the finding that SPI2 is also activated inside the intestinal lumen (Brown, Vallance et al. 2005). SPI2 effectors mediate many cellular functions during Salmonella infection, including regulation and maintenance of the vacuolar membrane, increasing the motility of infected cells, targeting the SCV to the trans-Golgi network, forming an actin meshwork surrounding the SCV, and inducing the formation of Salmonella Induced Filaments (SIFs), which are long filamentous structures originating at the SCV (Brumell, Goosney et al. 2002, Kuhle and Hensel 2004, Haraga, Ohlson et al. 2008). Known roles of SPI2 effectors have been extensively reviewed (See references (Kuhle and Hensel 2004, Haraga, Ohlson et al. 2008, McGhie, Brawn et al. 2009, van der Heijden and Finlay 2012)). SPI2 is regulated by the kinase SsrA, which activates the transcription factor SsrB, which in turn activates SPI2 gene transcription (Walthers, Carroll et al. 2007). SPI2 is also regulated by the PhoPQ two component regulatory system (Miller, Kukral et al. 1989). Once the T3SS is in place, effectors are secreted which mediate functions including maintenance of vacuolar membrane, SCV positioning, actin meshwork formation, and the formation of SIFs (van der Heijden and Finlay 2012). SifA targets SKIP and Rab7, and is involved in down regulating the recruitment of kinesin to the SCV, it plays an integral role in SIF formation, and in maintaining 28  the SCV (Stein, Leung et al. 1996, Beuzon, Meresse et al. 2000, Brumell, Rosenberger et al. 2001, Brumell, Goosney et al. 2002, Brown, Szeto et al. 2006, Haraga, Ohlson et al. 2008, Jackson, Nawabi et al. 2008, Dumont, Boucrot et al. 2010). SpiC is involved in maintaining the SCV position, as it interacts with TassC and Hook 3 to control trafficking (Shotland, Kramer et al. 2003, Haraga, Ohlson et al. 2008). SpiC also plays a role in sensing the environment and permitting effector secretion (Yu, McGourty et al. 2010). SseJ is another effector which is implicated in SCV positioning, it has acyl transferase activity, is involved in lipid and cholesterol metabolism, and is important for bacterial replication and SIF formation (Ruiz-Albert, Yu et al. 2002, Ohlson, Fluhr et al. 2005, Nawabi, Catron et al. 2008, van der Heijden and Finlay 2012).  SseF and SseG are involved in SCV positioning (van der Heijden and Finlay 2012), and are discussed in more detail in Chapter 3. An actin meshwork is formed around the SCV, and is important for bacterial replication (van der Heijden and Finlay 2012). A few effectors that are involved in the formation of this meshwork are SseI, SspH2, SpvB, and SteC (Haraga, Ohlson et al. 2008, van der Heijden and Finlay 2012). SseI and SspH2 both bind to filamin and localize with the actin cytoskeleton (Srikanth, Mercado-Lubo et al. 2011). In addition to filamin, SspH2 also binds to profilin and interacts with G-actin to enhance actin polymerization (Miao, Scherer et al. 1999, Miao, Brittnacher et al. 2003, Haraga, Ohlson et al. 2008, van der Heijden and Finlay 2012). SpvB is an ADP-ribosylating protein which ribosylates monomeric actin, reversing mesh formation (Lesnick, Reiner et al. 2001). SteC has kinase activity that is important for the formation of the actin meshwork (Poh, Odendall et al. 2008). The elucidation of the role of SPI2 effectors in pathogenesis is important for our understanding of how Salmonella manipulate the host to successfully replicate and cause disease. 29  Most of the information about SPI2 effectors comes from individual studies examining only one or a few effectors. In this chapter, the SPI2 effectors were systematically individually knocked- out, and tested in a variety of models. This enables a direct comparison of the contribution of individual SPI2 effectors to Salmonella’s ability to colonize and replicate in several different infection models. This work confirms the importance of SPI2 effectors in macrophage replication and systemic spread. The work presented in this chapter provides a basis for the systematic comparison of SPI2 effectors, and provides the foundation for this thesis.  2.3 Methods and materials 2.3.1 Construction of bacterial strains, plasmids and growth conditions Salmonella enterica serovar Typhimurium and Escherichia coli strains were routinely grown on Luria-Bertani (LB) agar at 37°C, supplemented with the appropriate antibiotics (100 µg/mL streptomycin, 30 µg/mL chloramphenicol, 50 µg/mL kanamycin). Overnight cultures were grown in LB broth at 37°C with aeration with the appropriate antibiotics. E. coli MC1061λpir was used for standard cloning, E. coli SM10λpir was used for conjugation, and S. Typhimurium SL1344 strain was used to construct all of the in-frame deletions (Table 2.1).  Table 2.1 E. coli strains and plasmids used in this study Strain  Description Source Escherichia coli: MC1061λpir hsdR mcrB araD139 Δ(araABC- leu)7679 ΔlacX74 gal1 galK rpsL thi λpir (Rubires, Saigi et al. 1997) SM10λpir thi thr leu tonA lacY supE recA::RP4-2-Tc::Mu pir+ (Miller and Mekalanos 1988) Plasmids: pRE112 cat sacB oriVR6Kγ oriTRP4 (Edwards, Keller et al. 1998) pZA23MCS neo p15a PA1LacO-1 (Lutz and Bujard 1997) 30  PCR was done with Pfu Turbo DNA Polymerase (Stratagene, 600252) to amplify ~500 bp flanking regions of each gene (Table 2.2). PCR products were then joined using overlapping PCR (Croxen, Sisson et al. 2006). Using restriction digestion with SacI and KpnI and T4 DNA ligation, this PCR product was cloned into the suicide vector pRE112, (Edwards, Keller et al. 1998) which was transformed into E. coli MC1061λpir (Rubires, Saigi et al. 1997). Following confirmation of the correct insert by DNA sequencing (BigDye Terminator v3.1 Cycle Sequencing, ABI, 4337456; NAPS unit, DNA Sequencing Laboratory, UBC), the suicide plasmids were transformed into E. coli SM10λpir (Miller and Mekalanos 1988) so that they could be mobilized into SL1344 by conjugation. Initial plasmid integration was identified by recovering chloramphenicol resistant colonies. Plasmid loss was selected for following growth for 4 hours without chloramphenicol, and by selecting for sucrose resistant colonies. The desired genotype was confirmed by PCR and DNA sequencing. Deletion strains were constructed to be unmarked, and therefore did not contain any additional antibiotic resistance markers.  Table 2.2 Oligonucleotides used to construct SPI2 gene deletions Gene Forward oligonucleotide Reverse oligonucleotide sifB 5’ flanking CTGAGCTCGCCGTCCACATTTCCTT A TCTCCCGATAGTAATTGGCAT  sifB 3’ flanking GCCAATTACTATCGGGAGAGAGGC TCATCACCAGAGTTGA GACTGGTACCGAGCCCTGAAG CGCTGATG spiC 5’ flanking CTGAGCTCGGTAAGCACAGATAGC AGC CATGAATCCCTCCTCAGACAT  spiC 3’ flanking ATGTCTGAGGAGGGATTCATGCAC CATAAACTTTATTCGGGT GACTGGTACCTTACACTCACCG CACTGTC sseF 5’ flanking GTACGGTACCGCGCATCCTGACAG TAATGG ACTTGCCGCTGACGGAATATG  sseF 3’ flanking CATATTCCGTCAGCGGCAAGTATG GACAGTTCTGATCATACA TAGAGCTCATCCCATCCATACC GAAGCGA sseG 5’ flanking GTACGGTACCGCAATACACTATTC GTGCGCT CTGAGCATTTGGGCTAACAGG  31  Gene Forward oligonucleotide Reverse oligonucleotide sseG 3’ flanking CCTGTTAGCCCAAATGCTCAGCCA GAACAACGTGCGCCG TAGAGCTCACGCAGCGCCATA GCCTCT sseF/G 5’ flanking GTACGGTACCGCGCATCCTGACAG TAATGG ACTTGCCGCTGACGGAATATG  sseF/G 3’ flanking CATATTCCGTCAGCGGCAAGTCCA GAACAACGTGCGCCG TAGAGCTCACGCAGCGCCATA GCCTCT sseI 5’ flanking CTAGGGTACCGCAGCGCAGCTTCG TCAGGCGG GATGGCGGGAAGACATCCGCT  sseI 3’ flanking AGCGGATGTCTTCCCGCCATCTAT TCCTTAATAGGTAAAATGTAAG CTGAGCTCCCGGCGTTCAGAT GCTCATCA sspH2 5’ flanking GTACGGTACCGCACCGGAACCAGA TGACACA GCTTCCAATATGAAAGGGCAT  sspH2 3’ flanking ATGCCCTTTCATATTGGAAGCGTT CAGTGGCGTCGTAACTGA TAGAGCTCGTGGCGCATGGTT GTCATCT slrP 5’ flanking CTGAGCTCGTTGCACCAGTTACGC GAG TGCCGTAGATTGTATATTAGT  slrP 3’ flanking ACTAATATACAATCTACGGCAAGC GCCTACTGGCGATAG GACTGGTACCGCCGCAGGAGA TCATGTTA steC 5’ flanking CTGAGCTCCGCTATCTCCGGCAGG TG GCAACTATGATTTCCGATCTG  steC 3’ flanking CAGATCGGAAATCATAGTTGCGAA GGGACTCTTGTGGCT GACTGGTACCGTGACCACTCC ACTTGATC spvB 5’ flanking CTGAGCTCGACAGGCAGAGCGTCG GC CAGCGCTAAAGTGGCAGATG  spvB 3’ flanking ACCTGGCCATCGTCAGACGAGGGT ACTCAACTCATAG GACTGGTACCATTCTCGACGA GCATGGATG sseA promoter CTCGAGTGTAGTGAGTGAGCAAGA GTA TACGAATTCACGATAGATAAT TAACGTGC sseF comple- ment GCACGTTAATTATCTATCGTGAAT TCCAGAACGAAATATGAAAATTC  TACGGATCCAGGTTTTATGGTT CTCCCCGAGATG    The ΔsseF strain was complemented by first PCR amplifying the sseA promoter region and the sseF gene (Table 2.2), then joining the products by overlapping PCR. BamH1 and Xho1 restriction digest followed by T4 DNA ligation was used to clone the fragment into pZA23MCS (Lutz and Bujard 1997). This plasmid (pZA23-sseF) was then electroporated into the ΔsseF Salmonella strain. The cloning was confirmed by restriction digest and DNA sequencing. 32  2.3.2 Epithelial cell infections HeLa cells  (American Type Culture Collection, ATCC; Manassas, VA) were seeded at 7x104 cells/well, and CaCo2 (ATCC) were seeded at 2.5x105 cells/well in 24-well plates and grown for 24 hours at 37°C, 5% CO2. All cells were grown in Dulbecco's modified Eagle medium (DMEM) with high glucose (Thermo Scientific, SH3024301) and 10% fetal bovine serum (FBS) (Thermo Scientific, SH3039603), 1% non-essential amino acids (NEAA)(Gibco,11140), and 1% GlutaMax (Gibco, 35050). For HeLa infections, bacteria were grown overnight, sub-cultured for 3 hours, then diluted and 105 bacteria were added to each well in DMEM for 10 min. Cells were then washed 3 times with phosphate buffered saline (PBS) +/+. DMEM with no bacteria was then added for 20 min. Cells were incubated with medium containing 50 µg/mL gentamicin for 90 minutes, then 10 µg/mL gentamicin for the remainder of the 2 and 6 hour time points. Bacterial counts at 2 hours post infection were used as measures of bacterial invasion. Counts at 6 hours were chosen to calculate the replication index as our group has found that HeLa cells begin to die at later time points due to bacterial load (Unpublished data). Bacteria were released from HeLa cells using lysis buffer containing 1% Triton X-100 (BDH, R06433) and 0.1% sodium dodecyl sulfate (SDS) (Sigma-Aldrich, 151213) in PBS, diluted in PBS and plated for colony counts on LB plates containing 100 µg/mL of streptomycin. For CaCo2 infections, overnight cultures were sub-cultured for 3 hours, then 106 bacteria were added to each well in DMEM for 20 minutes. Cells were then incubated with 100 µg/mL gentamicin in DMEM for the remainder of the 2-hour time point. Six hour samples were treated with 10 µg/mL gentamicin for the remainder of the time. Samples were washed and lysed with 33  lysis buffer, then diluted in PBS and plated for colony counts. Calculations were done the same way as for the HeLa cell infections. 2.3.3 Macrophage infections RAW264.7 cells (ATCC) were seeded at 1x105 cells/well in 24-well plates and grown for 24 hours at 37°C, 5% CO2. All cells were grown in DMEM with high glucose (Thermo Scientific, SH3024301) and 10% FBS (Thermo Scientific, SH3039603), 1% NEAA (Gibco,11140), and 1% GlutaMax (Gibco, 35050). For RAW264.7 infections, 106 bacteria from an overnight culture were added to each well in DMEM for 20 minutes. Cells were then incubated in medium containing 100 µg/mL gentamicin for 60 min, then 10 µg/mL gentamicin for the remainder of the 3 and 24 hour time points. Bacterial counts at 3 hours were used as measures of invasion, and the 24-hour time point was used to calculate the replication index, since it provided enough time for Salmonella to replicate, as we have found that Salmonella begin to replicate in RAW264.7 cells at 10 hours post infection. Bacteria were released from RAW264.7 cells using lysis buffer, diluted in PBS and plated for colony counts. 2.3.4 Typhoid fever model Overnight cultures of Salmonella were diluted in 100 mM HEPES with 0.9% sodium chloride (pH 8.0). Between 5 and 10 8-week-old female C57BL/6 mice (The Jackson Laboratory) were infected orally with 3-5x107 bacteria in 100 µl. All animal infections were performed in accordance with ethical requirements of the University of British Columbia’s Animal Care Committee. Mice were euthanized 3 and 5 days post infection and tissue samples, including the respective intestinal contents, were removed for bacterial quantification. The tissues that were collected for this study were: liver, spleen, mesenteric lymph nodes, cecum, 34  colon, and ileum. Samples were homogenized using a mixer mill (MM 301, Retsch, Haan Germany) for 10 minutes at a frequency of 30/s. Samples were diluted in PBS and plated for colony counts. Bile counts were obtained by extracting bile from the gallbladder, bile was diluted in PBS and plated for colony counts. 2.3.5 Statistical analysis Statistical analysis was performed using GraphPad Prism, version 4.0. (GraphPad Software). Data were analyzed by nonparametric Mann-Whitney t tests with 95% confidence intervals. For each figure, the term “measurements” refers to the combination of both technical and experimental replicates. Each experiment was repeated a minimum of two times, with multiple technical replicates. Thus, for example “8 measurements” would refer to two separate experiments with 4 technical replicates each.  2.4 Results - Salmonella SPI2 mutant replication in epithelial cells 2.4.1 Replication in HeLa epithelial cells S. enterica serovar Typhimurium actively invade and replicate within epithelial cells, causing multiple changes in cellular organization (Garcia-del Portillo, Zwick et al. 1993). The panel of SPI2 mutants (Table 2.3) was generated and examined for their ability to replicate in HeLa epithelial cells. The replication index was determined by comparing colony forming units (CFU) at 2 and 6 hours post infection. All SPI2 mutants showed no significant differences in intracellular replication when compared to the wild-type strain (Figure 2.1), confirming that SPI2 effectors are not necessary for bacterial replication in epithelial cells. The ΔssaR strain, which contains a mutation in the SPI2 apparatus that prevents translocation of SPI2 effectors (Brumell, Rosenberger et al. 2001), was used as a control. This strain has been used previously as a SPI2 35  control strain (Brumell, Rosenberger et al. 2001, Coombes, Wickham et al. 2005, Grassl, Valdez et al. 2008).  Invasion of Salmonella mutants was determined by enumerating CFU 2 hours post- infection. No significant differences were seen in CFU at this early time point (data not shown).   Table 2.3 Salmonella Typhimurium strains constructed and used for this study Strain  Description Source SL1344 Wild type; hisG (Hoiseth and Stocker 1981) ΔssaR  (Brumell, Rosenberger et al. 2001) ΔsifA  (Stein, Leung et al. 1996) ΔsifB  This study ΔspiC  This study ΔsseF  This study ΔsseG  This study ΔsseF/G  This study ΔsseI  This study ΔsseK1  (Kujat Choy, Boyle et al. 2004) ΔsseK2  (Kujat Choy, Boyle et al. 2004) ΔsseK1/K2/K3  (Brown, Coombes et al. 2011) ΔsspH2  This study ΔslrP  This study ΔsteC  This study ΔspvB  This study ΔgogB ΔgogB::aph (Coombes, Wickham et al. 2005) ΔsseF-pZA23-sseF  This study  36   Figure 2.1 Replication of SPI2 deletion strains in HeLa epithelial cells HeLa cells were infected with exponentially growing Salmonella enterica Typhimurium, with a multiplicity of infection of 14. Error bars represent standard errors of the means. Results shown are the averages of a minimum of 8 measurements. Fold replication was determined by comparing bacterial counts at 2 and 6 hours post-infection. 2.4.2 Replication in CaCo2 epithelial cells HeLa cells are widely used for Salmonella experiments, however, because they are cervical epithelial cells, CaCo2 intestinal epithelial cells were also used in this study. The ability of the SPI2 mutants to replicate in CaCo2 intestinal epithelial cells was examined. Similar to what was seen in HeLa cells, no significant differences were seen between the replication index of the SPI2 mutants and wild-type Salmonella (Figure 2.2). The ΔssaR strain was also used as a control in this model. Together, the HeLa and CaCo2 data confirm that SPI2 effectors are not required for Salmonella colonization of epithelial cells. 37   Figure 2.2 Replication of SPI2 deletion strains in CaCo2 epithelial cells CaCo2 epithelial cells were infected with exponentially growing Salmonella enterica Typhimurium, with a multiplicity of infection of 10. Results shown are the averages of a minimum of 8 measurements. Error bars represent standard errors of the means. Fold replication was determined by comparing bacterial counts at 2 and 6 hours post-infection.  2.5 Salmonella SPI2 mutant replication in macrophages 2.5.1 Replication in RAW264.7 macrophages S. Typhimurium exploit macrophages and dendritic cells for replication and transport within the host in a SPI2-dependent manner (Haraga, Ohlson et al. 2008). Therefore, the replication of the SPI2 effector mutants (Table 2.3) in the RAW264.7 macrophage cell line was examined. Macrophages were infected with S. Typhimurium strains and harvested for colony counts. The replication index was determined by comparing CFU at 3 and 24 hours post 38  infection. As expected, the ΔssaR strain, which is used as a control that has no SPI2 effector secretion, replicated significantly less than wild-type Salmonella (p=0.0118; Figure 2.3). Some SPI2 effector deletion strains were found to have lower levels of bacterial replication in the macrophages, whereas other mutations had little or no effect. The ΔsseFG double mutant, ΔsseF, ΔsseG, ΔslrP, ΔsteA, ΔsspH2, ΔsseI, and ΔgogB mutant strains did not affect bacterial replication. However, the ΔsifA, ΔsseK1/K2/K3, ΔsteC, ΔspiC, ΔsifB, and ΔspvB strains replicated at levels significantly lower than the wild type (p=0.0052, p=0.0279, p=0.0460, p=0.0048, p=0.0459, p=0.0248, respectively; Figure 2.3). These data show that SifA, SseK1, SseK2, SseK3, SteC, SpiC, SifB and SpvB are important for enabling bacterial replication within cultured macrophages.  Figure 2.3 Replication of SPI2 deletion strains in RAW264.7 macrophages Macrophages were infected with Salmonella enterica Typhimurium SPI2 deletion strains, with a multiplicity of infection of 10. Results shown are the averages of a minimum of 8 measurements. Fold replication was determined by comparing bacterial counts at 3 and 24 hours post-infection. Error bars represent standard errors of the means. (*p < 0.05). 39  2.6 Salmonella SPI2 mutant replication in murine typhoid fever model 2.6.1 Colonization of intestinal tract Because of the important role that SPI2 plays in macrophage replication and systemic spread (Haraga, Ohlson et al. 2008, McGhie, Brawn et al. 2009, van der Heijden and Finlay 2012), the SPI2 mutants (Table 2.3) were tested in a mouse model of typhoid fever. The CFU were examined in systemic and intestinal sites of C57BL/6 mice 5 days post oral infection. As expected, the ΔssaR strain was significantly less abundant in the intestine (p<0.0001) than the wild-type strain. Interestingly, colonization of the majority of SPI2 mutants was not significantly different from that of the wild type at intestinal sites (Figure 2.4). In the colon, the colonization of the ΔspiC and ΔspvB strains was significantly lower than that of the wild type (p=0.0024 and p=0.0009 respectively; Figure 2.4). In the cecum, the ΔspiC and ΔspvB strains also colonized at lower levels than the wild-type strain (p=0.0006, and p=0.0006 respectively; Figure 2.4). In the ileum, the ΔspiC, ΔsseI, and ΔspvB strains colonized at significantly lower levels than the wild- type strain (p=0.0166, p=0.0405, and p=0.0011 respectively; Figure 2.4).  Taken together, these data suggest that the SpiC and SpvB proteins are important for S. Typhimurium colonization of intestinal sites in the typhoid fever model, while SseI appears to play a role in colonization of the ileum. 40   Figure 2.4 Colonization of the intestinal tract by SPI2 deletion strains Bacterial counts of S. Typhimurium SPI2 mutants recovered from intestinal organs of C57BL/6 mice after oral infection. Mice were infected via oral gavage and sacrificed 5 days post-infection. Organs collected include ileum, cecum, colon. Counts are given as colony-forming units (CFU) per milligram of tissue. Error bars represent standard deviation from the means. A minimum of 5 mice was used for each SPI2 mutant. (**p < 0.001, *p < 0.05).   41  2.6.2 Colonization of gallbladder Salmonella has been shown to replicate in epithelial cells in the gallbladder, and these bacteria can be found in the luminal bile of murine gallbladders (Menendez, Arena et al. 2009). The role of SPI2 effectors in bile replication has not been previously determined. Therefore, bacterial counts in the bile of infected mice were examined by extracting bile from the gallbladders and determining CFU. No statistically significant differences were found among the SPI2 effector deletion strains in bile (Figure 2.5). Despite the lack of significance, the results show a similar trend where the ΔssaR, ΔsseF, and ΔspvB strains replicated at levels lower than wild-type Salmonella. Because oral infection was used for all gallbladder infections, it is interesting that these strains, which are attenuated in systemic sites, were not significantly attenuated in the bile. However, this apparent effect could be a result of the low proportion of gallbladders that are infected, even during wild-type infections (Menendez, Arena et al. 2009).  Because of the large variation in CFU within replicates in this model, statistical significance was not obtained, however the potential for biological significance is evident.  42   Figure 2.5 Colonization of gallbladder by SPI2 deletion strains Bacterial counts of S. Typhimurium SPI2 mutants recovered from bile of C57BL/6 mice after oral infection. Mice were infected  via oral gavage, sacrificed 5 days post-infection, gallbladders were removed, and bile was extracted. Counts are given as colony-forming units (CFU) per microliter of bile. Error bars represent standard errors of the means. A minimum of 5 mice was used for each SPI2 mutant.  2.6.3 Colonization of systemic organs Since SPI2 is required for systemic spread during typhoid fever, we examined bacterial burden at systemic locations, including the liver, spleen, and mesenteric lymph nodes (MLN). The ΔssaR strain colonized at significantly lower levels than the wild-type strain in the liver, spleen, and MLN (p=0.0002, p=0.0002, and p=0.0004, respectively; Figure 2.6). In the liver, the ΔspiC and ΔspvB strains colonized at levels lower than the wild-type-infected mice (p=0.0028 and p=0.0023, respectively; Figure 2.6). In the spleen, the ΔspiC, ΔsseF, and ΔspvB strains did not colonize as well as the wild type (p=0.0028, p=0.0253, and p=0.0018, respectively; Figure 2.6). In the MLN, the ΔspiC, ΔsseF, and ΔspvB strains colonized significantly less than the wild 43  type (p=0.0086, p=0.0107, and p=0.0102, respectively; Figure 2.6). Therefore, as seen in the intestinal tract, the ΔspiC and ΔspvB strains were attenuated in systemic organs. Interestingly we found that the ΔsseF strain was attenuated in the MLN and spleen, but not in the intestinal organs. This data suggests an important role for the SpiC, SpvB, and SseF proteins in S. Typhimurium virulence in mice. 44   Figure 2.6 Colonization of systemic organs by SPI2 deletion strains Bacterial counts of S. Typhimurium SPI2 mutants recovered from systemic organs of C57BL/6 mice after oral infection. Mice were infected via oral gavage and sacrificed 5 days post-infection. Organs collected include liver, spleen and mesenteric lymph nodes (MLN). Counts are given as colony-forming units (CFU) per milligram of tissue. Error bars represent standard deviation from the means. A minimum of 5 mice was used for each SPI2 mutant. (*p < 0.05).  45  2.6.4 Early colonization in the typhoid model To examine the early phases of Salmonella colonization in typhoid fever, we determined levels of colonization for three Salmonella strains, wild type, ΔsseF, and ΔspvB. The wild-type strain was used, which is invasive and replicates at high levels. At 3 days post-infection the wild- type strain colonized at moderate levels in all organs tested (Figure 2.7), the colonization at three days was lower than what we saw at five days post-infection (Figure 2.6). The ΔspvB strain was tested as this strain is known to be severely attenuated in systemic disease (McGhie, Brawn et al. 2009). We found that the ΔspvB strain colonized at significantly lower levels in the liver (p=0.0079), spleen (p=0.0159), colon (p=0.0317), and ileum (p=0.0317) (Figure 2.7). Finally, the ΔsseF strain was also examined, as the role of this effector in systemic disease is less well characterized and had a modest attenuation systemically at 5 days post-infection (Figure 2.6). We found that the ΔsseF strain only colonized at significantly lower levels in the colon (p=0.0317), while in the cecum, ileum and MLNs there is a trend for slightly lower levels of colonization (Figure 2.7). Therefore, these data generally support what was seen at 5 days post- infection, with ΔspvB strain being attenuated, and the ΔsseF strain colonizing at slightly lower levels than wild type. 46   Figure 2.7 Colonization of select strains early during infection Bacterial counts of S. Typhimurium SPI2 mutants recovered from systemic and intestinal organs of C57BL/6 mice 3 days post-infection. Mice were infected via oral gavage. Counts given represent colony forming units per milligram of tissue. Error bars represent standard errors from the means, each group contained 5 mice. (*p < 0.05). Mesenteric lymph nodes (MLN).   2.7 Discussion SPI2 effectors are known to be important for Salmonella replication within macrophages and systemic spread. This chapter provides a thorough and comparative analysis of SPI2 effectors in three different models of infection, namely an in vivo murine model for typhoid fever and three cell culture infection models, two using epithelial cells and the other macrophages. Many of the studies of Salmonella effectors published to date have focused on only one or a few SPI2 effectors, thus making comparisons between studies difficult. Therefore, the aim of this study was to test as many SPI2 deletion strains as possible under the same conditions, allowing for direct comparisons of the roles played by different SPI2 effectors during infection. The data 47  confirms previously identified phenotypes and further characterizes other previously untested effectors.  In this study the ΔspvB strain was attenuated in both the typhoid model and the macrophage replication model, which supports the well-characterized role of this effector as an ADP-ribosylating protein that transfers ADP-ribose onto monomeric actin, which is needed for virulence (Lesnick, Reiner et al. 2001, Browne, Hasegawa et al. 2008). The ΔspvB strain colonized at statistically higher levels than the ΔssaR strain in the systemic sites, but not in the intestinal sites. This study shows that the ΔsseK1/K2/K3 triple knock-out strain was attenuated in macrophages, but not in any sites in the murine model or in the cultured epithelial cell model. This confirms previous reports that SseK1 and SseK2 are not required for systemic infection in mice (Kujat Choy, Boyle et al. 2004). Our macrophage results with the ΔsseK1/K2/K3 strain correlates with that found previously (Brown, Coombes et al. 2011). Brown et. al.(Brown, Coombes et al. 2011) did see a slight attenuation of the ΔsseK1/K2/K3 strain using a competitive index. The model presented here uses mouse infections with only one bacterial strain, therefore it is possible that by using a competitive index, more subtle colonization differences may be seen. Because SpiC is thought to interact with proteins in the host cell, manipulating host cell function, (McGhie, Brawn et al. 2009) it was included in this screen. The ΔspiC strain was attenuated in both the typhoid and the macrophage replication model in this study. This information supports the model proposed by Yu et al. (Yu, McGourty et al. 2010), whereby SpiC is involved in sensing the pH of the environment and permitting effector translocation. The results of these screens support the current understanding that SpiC activity is needed for SPI2 effector secretion, and its importance during infection. It should also be noted that the ΔspiC strain replicated at levels significantly higher than the ΔssaR strain, which does not secrete any 48  SPI2 effectors (Brumell, Rosenberger et al. 2001). This work also highlights the importance of SpiC for bacterial replication in macrophages. SseF and SseG are involved in the formation of SIFs and may play a role in microtubule bundling (Guy, Gonias et al. 2000, Kuhle and Hensel 2002, Kuhle, Jackel et al. 2004). This work also provides evidence for the slight attenuation of the ΔsseF strain in the mouse typhoid fever model. However, the ΔsseF, ΔsseG, and ΔsseFG strains do not replicate significantly less than the wild-type strain in the macrophage model. It is striking that the ΔsseF strain was attenuated, but there was not a statistically significant attenuation in the ΔsseG and ΔsseFG strains in the typhoid model, as the SseF and SseG proteins have been shown by biochemical assays to directly interact with each other (Deiwick, Salcedo et al. 2006). However, it has also been shown that while SseF and SseG frequently co-localize, they are also found separately within the cell (Kuhle, Jackel et al. 2004). Because the ΔsseF strain was attenuated in systemic organs, this mutation was complemented, and was found to replicate at levels comparable to wild type.  It is interesting that the ΔspiC and ΔspvB strains were attenuated in both intestinal and systemic sites. This led us to speculate that these effectors may have roles in both anatomical sites. It is also possible that attenuation of these strains in the intestine influences their replication at systemic sites, or perhaps systemic attenuation leads to lower levels in the intestine due to low levels of intestinal re-seeding. In addition, we found that at 3 days post infection, the ΔsseF, and ΔspvB strains did not appear to be as attenuated as at 5 days, indicating these effectors may play an important role in replication at systemic sites. Salmonella counts in the bile were examined to determine if there were correlations with the systemic sites, which could support the concept that the gallbladder is involved in the re- seeding of the intestine by systemic bacteria (Everest, Wain et al. 2001, Lawley, Bouley et al. 49  2008, Menendez, Arena et al. 2009). After examining the SPI2 deletion strains in the gallbladder, no statistically significant differences in the number of bacteria in bile were seen when compared to wild type, likely due to the fact that only some mice had their gallbladders infected. Though not statistically significant, this data does suggest some interesting trends. Firstly, the ΔssaR strain does not effectively colonize systemic sites, and is also seen at low levels in the bile. The same pattern is seen for the ΔspvB and ΔsseF strains. This supports the notion that bacteria in the gallbladder correlate to the numbers of systemic bacteria, and a threshold of Salmonella must be reached before bacteria begin to colonize the gallbladder (Menendez, Arena et al. 2009). This study provides an overview of SPI2 effector contributions to Salmonella pathogenesis. Furthermore, it provides a tool to allow Salmonella researchers to compare and contrast the roles of SPI2 effectors tested under the same conditions in a Typhoid murine model, a macrophage replication model, and two epithelial cell replication models.  2.8 Summary In summary, these results confirm that SPI2 effectors are not required for epithelial cell replication and that multiple SPI2 effectors are required for macrophage replication. The in vivo studies show that some SPI2 effectors may in fact play a role in intestinal colonization, as well as systemic spread of the disease (Table 2.4). Interestingly, none of the mutants tested here were significantly attenuated for growth in bile, despite their attenuation in both systemic and intestinal sites. This study enables direct comparison between SPI2 effectors in various models of infection and provides groundwork for further studies on the roles of Salmonella SPI2 effectors, and the contribution of these SPI2 deletion strains to other aspects of infection.  50  Table 2.4 Summary of SPI2 deletion strains contribution to virulence In this table, (+++) indicates strains that replicated/colonized as well as wild-type Salmonella. (++) indicates significantly lower levels of replication with p<0.05. (+) indicates significantly lower levels of replication than the wild-type Salmonella with p<0.001. (nd) indicates data not determined. Strain HeLa CaCo2 RAW 264.7 Typhoid fever model     Gall- bladder Spleen MLN Liver Cecum Colon Ileum ΔssaR +++ +++ + +++ ++ ++ ++ + + + ΔsifA +++ +++ + nd nd nd nd nd nd nd ΔsifB +++ +++ ++ +++ +++ +++ +++ +++ +++ +++ ΔspiC +++ +++ ++ nd ++ ++ ++ ++ ++ ++ ΔsseF +++ +++ +++ +++ ++ ++ +++ +++ +++ +++ ΔsseG +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ ΔsseF/G +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ ΔsseI +++ +++ +++ +++ +++ +++ +++ +++ +++ ++ ΔsseK1 nd nd nd +++ +++ +++ +++ +++ +++ +++ ΔsseK2 nd nd nd +++ +++ +++ +++ +++ +++ +++ ΔsseK1/2/3 +++ +++ ++ +++ +++ +++ +++ +++ +++ +++ ΔsspH2 +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ ΔslrP +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ ΔsteC +++ +++ ++ +++ +++ +++ +++ +++ +++ +++ ΔspvB +++ +++ ++ +++ ++ ++ ++ ++ ++ ++ ΔgogB +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ 51  Chapter  3: Arachidonic acid metabolism is altered during Salmonella infection of macrophages  3.1 Abstract Salmonella enterica are Gram-negative bacterial pathogens responsible for enteric fever and gastroenteritis. Salmonella cross the intestinal epithelial barrier and are taken up by phagocytes, enabling their spread to systemic sites. Salmonella use two type three secretion systems encoded by Salmonella pathogenicity islands (SPI) 1 and 2 to inject effectors into the host cell. SPI1 is required for the invasion of non-phagocytic cells, whereas SPI2 is required for intracellular survival and replication within phagocytes, in a specialized phagosome called the Salmonella containing vacuole (SCV). There are still many aspects of Salmonella’s interactions with the host that are not fully characterized. In the host, arachidonic acid metabolism leads to the production of eicosanoids, a collection of small molecule hormones including the prostaglandins (PG), leukotrienes, and thromboxanes. Our group has previously found that arachidonic acid metabolism is increased and that the transcription of enzymes involved in eicosanoid synthesis is altered during Salmonella infection of mice. In this chapter, the interaction between eicosanoids, with a focus on the PGs, and Salmonella is examined more closely. PGs are produced by multiple cell types and are involved in many functions, including inflammation. PG synthesis begins through the activity of the cyclooxygenase (PTGS/COX) enzymes, COX1 and COX2, which mediate the rate-limiting step in the production of all PGs and thromboxanes. COX1 is constitutive, while COX2 is induced by inflammatory stimuli. This chapter demonstrates that Salmonella infection induces the production of COX2 and PGE 52  synthase (PTGES) transcripts in macrophages, while the expression of thromboxane B2 synthase (TBXAS1) is reduced. The enzymes involved in leukotriene synthesis in macrophages were decreased by Salmonella infection. In addition, the SPI2 deletion strains described in the previous chapter were tested for their ability to alter the expression of TBXAS1, PTGES, and COX2. Two of the effectors secreted by the SPI2 T3SS, SseF and SseG, were found to be partially responsible for the induction of COX2 seen during Salmonella infection. SseF and SseG are involved in the formation of tubular structures extending from the SCV, termed Salmonella induced filaments (SIF), and the localization of the SCV, but no role for these effectors in PG production has been identified to date. This chapter demonstrates not only the involvement of arachidonic acid metabolism in Salmonella infection, but also shows that Salmonella is able to modulate it in a SPI2 dependent manner.  3.2 Introduction Salmonella enterica are Gram-negative, facultative intracellular pathogens that can cause enteric (typhoid) fever and gastroenteritis. (Freeman, Ohl et al. 2003, Kuhle and Hensel 2004). After ingestion of S. enterica, the bacteria cross the intestinal barrier, are taken up by phagocytes, replicate, and in systemic disease spread to sites including the liver, and spleen. (Kohbata, Yokoyama et al. 1986, Jones, Ghori et al. 1994, Vazquez-Torres, Jones-Carson et al. 1999, Kuhle and Hensel 2004, Haraga, Ohlson et al. 2008). Salmonella replicates in a special vacuole called the Salmonella-containing vacuole (SCV) (Kuhle and Hensel 2004, Browne, Hasegawa et al. 2008, Poh, Odendall et al. 2008, van der Heijden and Finlay 2012). Salmonella use two type 3 secretion systems (T3SS) encoded by SPI1 and SPI2 to mediate bacterial uptake and replication (Haraga, Ohlson et al. 2008, van der Heijden and Finlay 2012). SPI2 is primarily 53  activated within the phagosome and is required for survival within macrophages and consequently, systemic disease (Ochman, Soncini et al. 1996, Beuzon and Holden 2001, Freeman, Ohl et al. 2003, Geddes, Worley et al. 2005, Coombes, Lowden et al. 2007, Haraga, Ohlson et al. 2008, Buckner, Croxen et al. 2011, van der Heijden and Finlay 2012). SPI2 effectors have many functions, including the formation of Salmonella induced filaments. (Brumell, Goosney et al. 2002, Kuhle and Hensel 2004, Haraga, Ohlson et al. 2008). SseF and SseG are two effectors translocated by the SPI2 T3SS and they contain 2 and 3 hydrophobic domains, respectively (Salcedo and Holden 2003, Abrahams, Muller et al. 2006, Muller, Chikkaballi et al. 2012). They are involved in the formation of SIFs and play a role in microtubule bundling (Guy, Gonias et al. 2000, Kuhle and Hensel 2002, Kuhle, Jackel et al. 2004, Muller, Chikkaballi et al. 2012). The first 127 amino acids of SseF, including the first transmembrane (TM) domain, are thought to contribute to the translocation of the protein, whereas the second TM domain has been found to be important for the recruitment of dynein, a microtubule motor protein, microtubule bundling, the intracellular positioning of the SCV, and SIF formation in epithelial cells (Abrahams, Muller et al. 2006). A 6 amino acid residue in the second transmembrane domain has recently been found to be required for the proper formation of SIFs, and for the localization of Salmonella microcolonies close to the microtubule organizing center in epithelial cells (Muller, Chikkaballi et al. 2012). Infection with Salmonella strains lacking SseF and SseG leads to the formation of pseudo-SIFs, which are non-continuous structures with punctuate association with LAMP1, LAMP2, LAMP3 and V-ATPase in epithelial cells (Kuhle and Hensel 2002). LAMPs (Lysosomal-associated membrane protein) are endosome markers, which associate with the SCV and SIFs during wild-type Salmonella infection (Steele-Mortimer, Meresse et al. 1999). SseF an SseG co-localize with LAMP, and the 54  distribution of SseF is dependent on a functional microtubule cytoskeleton (Kuhle, Jackel et al. 2004). SseF and SseG frequently colocalize in epithelial cells, but are occasionally found separately (Kuhle, Jackel et al. 2004). However, the functions of SseF and SseG can be completed by a fusion protein of both effectors, implying that the functions of these proteins are linked during normal Salmonella epithelial cell infection (Muller, Chikkaballi et al. 2012). When SseG was expressed via transfection in host cells, it was found to co-localize with the Golgi apparatus; however, when the protein was expressed via infection, it did not localize with the Golgi (Kuhle, Jackel et al. 2004). In another study, also completed in epithelial cells, SseG was involved in the localization of Salmonella with the Golgi apparatus in epithelial cells and was necessary, but not sufficient, for SCV localization with the trans-Golgi network (Salcedo and Holden 2003). Taken together, these data show that SseF and SseG play an important role in the formation of SIFs and SCV localization in epithelial cells; however little is known about their role in macrophages.   Our group has recently completed a metabolomics study of Salmonella infection in mice, which found that many host hormone pathways are affected by this pathogen (Antunes, Arena et al. 2011). Specifically, it was found that arachidonic acid (AA) metabolism is increased during Salmonella infection of mice (Appendix A Figure 1). AA metabolism leads to the production of eicosanoids, which are a class of lipid hormone mediators which can act via paracrine and autocrine mechanisms and can be produced by most cells (Funk 2001). They include the prostaglandins (PGs), thromboxanes, leukotrienes, and others (Matsuoka and Narumiya 2008). Among the diverse effects mediated by eicosanoids, PGs in particular, are the induction and resolution of acute inflammation induced by bacterial infection (Yoshikai 2001). Macrophages and dendritic cells are thought to secrete PGs in response to LPS (Bowman and Bost 2004). 55  PGs are derived from arachidonic acid (AA), which is released from cell membranes into the cytosol by phospholipase A2 (PLA2) (Figure 3.1) (Funk 2001). AA is then modified by the cyclooxygenase enzymes (COX), which is inserted into the membrane of the endoplasmic reticulum or nuclear envelope (Funk 2001, Wan and Coveney 2009). Two isoforms of COX have been identified, COX1 and COX2.  COX1 is constitutively expressed in most tissues, whereas COX2 is induced by pro-inflammatory agents, including bacterial components (Ghosh, Misukonis et al. 2001, Yoshikai 2001). Two waves of COX2 expression have been identified, the first is involved with inducing inflammation and high levels of PGE2, the second wave is much stronger and is associated with resolution of inflammation and high levels of PGD2 and 15d-PGJ2 levels (Gilroy, Colville-Nash et al. 1999). After AA is modified by COX, one of several PG synthase enzymes will act upon it to form different PGs. Prostaglandin D2 (PGD2) is formed by PGD synthase (PTGDS), PGE2 by PTGES, and so forth. Once PGs are made, they are released from the cell via PG transporters (Funk 2001). See Figure 3.1 for a schematic of arachidonic acid metabolism and the production of the prostaglandins.  56   Figure 3.1 Arachidonic acid metabolism Enzymes involved in the pathways that were examined in this study are printed in grey italics, and include: PLA2G4A, ALOX5, ALOX5AP, LTA4H, CYP4F, LTC4S, PTGS2/COX2, PTGES, and TBXAS1.   The role of PGs in inflammation is very complex, and not fully understood. PGs can play both anti- and pro-inflammatory roles depending on the context, and are important for multiple pathophysiological functions (Funk 2001, Matsuoka and Narumiya 2008). Both COX1 and COX2 were found to play a protective role in DSS induced colitis in mice (Morteau, Morham et al. 2000). A pro-inflammatory role is traditionally attributed to COX2; this can be seen in the pharmaceutical use of COX2-specific inhibitors. Among all PGs, the role of PGE2 in inflammation is perhaps the best studied. PGE2 is the most abundant PG and is traditionally thought to play an immunosuppressive role (Sakata, Yao et al. 2010). This is seen in its inhibition of IL-1 and TNF-α production and its induction of IL-6 and IL-10 production by macrophages (Strassmann, Patil-Koota et al. 1994, Kim and Hahn 2000, Treffkorn, Scheibe et al. 57  2004, Sakata, Yao et al. 2010). However, there is also evidence that PGE2 may play an immunoactivator role by facilitating TH1 differentiation and TH17 cell expansion in vitro, a process mediated by the PGE2 receptors 2 and 4 (Yao, Sakata et al. 2009, Sakata, Yao et al. 2010). PGE2 and PGI2 work in conjunction with histamine and bradykinin to increase vascular permeability and blood flow at the site of inflammation (Ikeda, Tanaka et al. 1975, Yoshikai 2001). However, high levels of PGE2 reduce vascular permeability, and therefore the effect of PGE2 may be concentration-dependent (Yoshikai 2001). The role of PGE2 in LPS-induced inflammatory responses remains uncertain as the addition of exogenous PGE2 leads to the expression of CD14 receptors, which augments cellular response to LPS (Iwahashi, Takeshita et al. 2000), while inhibiting LPS-induced TNF-α and TLR2 expression (Yoshikai 2001). PGE2 also enhances the production of IL-10 by macrophages stimulated by LPS (Strassmann, Patil- Koota et al. 1994, Yoshikai 2001). In acute inflammation, PGE2 is a central mediator of LPS- induced fever; it enhances IL-1β production by macrophages, and in conjunction with TNF-α stimulates the production of IL-12 by dendritic cells, which leads to the activation of NK cells and TH1 cell differentiation (Yoshikai 2001, Matsuoka and Narumiya 2008). PGE2 also inhibits the production of IL-12p70, while leading to reduced expression of the IL-12 receptor (Bowman and Bost 2004). Overall, PGE2 is thought to play a role in the early phases of inflammation (Yoshikai 2001). The role of PGs during Salmonella infection is beginning to emerge. Salmonella, among other entero-invasive bacteria, triggers the release of PGE2 (Bowman and Bost 2004). The activity of PLA2, which releases AA from membranes, is required for Salmonella invasion into epithelial cells (Pace, Hayman et al. 1993). The addition of a COX inhibitor had no effect on invasion of a wild-type Salmonella strain (Pace, Hayman et al. 1993). In bone marrow derived 58  macrophages, an increase in COX2 expression was seen in response to both live and killed Salmonella, but an increase in PGE2 was only seen with viable Salmonella, and this increase was blocked by COX2 inhibitors (Bowman and Bost 2004). Interestingly, Salmonella-derived LPS was not as potent of an inducer of PGE2 as live bacteria (Bowman and Bost 2004). Studies looking at PGs and Salmonella in vivo have shown that COX2 mRNA levels are increased in mouse lymph nodes three days post infection in comparison to mice treated with UV-inactivated bacteria (Bowman and Bost 2004). It has also been shown that macrophages and dendritic cells are responsible for the increased COX2 expression in mesenteric lymph nodes upon Salmonella infection (Bowman and Bost 2004). In addition proteomic analysis revealed an increase in COX2 production by macrophages in response to Salmonella (Shi, Chowdhury et al. 2009). Salmonella- infected mice survive for longer periods when treated with COX2 inhibitors, although Salmonella counts in the mesenteric lymph nodes are higher (Bowman and Bost 2004). Furthermore, our group has recently shown that the PG pathway is significantly altered by Salmonella infection of mice (Antunes, Arena et al. 2011). Specifically, we found that the production of PGE2, TXB2, and 15d-PGJ2 were increased in the feces of infected mice (Appendix A Figure 2). Uchiya and Nikai (2004) found that the SPI2 effector SpiC was responsible for part of the increase in COX2 caused by Salmonella infection of J774E macrophage cells (Uchiya and Nikai 2004). They showed that the increase in COX2 was dependent on ERK1/2 signaling and found a SPI2-dependent increase in the expression of EP2 (the PGE2 receptor) in response to Salmonella infection. In addition, they found a reduction in the growth of Salmonella in cells treated with a COX2 inhibitor. One major caveat of this work is that the authors did not address the possibility that a SpiC deletion strain does not translocate many SPI2 effectors (Yu, Ruiz-Albert et al. 59  2002). Recently it was found that SpiC is a component of a pH sensing complex which controls effector secretion (Yu, McGourty et al. 2010). In this study, the effect of Salmonella, and specifically the role of SPI2, in arachidonic acid metabolism was examined. The effect of Salmonella infection on the expression of a variety of enzymes involved in arachidonic acid metabolism was explored to define which pathways are involved in Salmonellosis. The panel of SPI2 deletion strains constructed in the previous chapter was used to explore the role of SPI2 in modulating PG synthesis. This was done in part to address the concerns with Uchiya and Nikai’s 2004 study (Uchiya and Nikai 2004), which indicated that SpiC was required for COX2 induction, and to further characterize the role of SPI2 during Salmonella infection. While studying the effect of multiple SPI2 mutants on PG gene expression in macrophages using quantitative real-time PCR, it was shown that SseF and SseG are responsible for a large portion of the induction of COX2 seen during Salmonella infection. Finally, the effect of the addition of specific eicosanoids to macrophage cultures on colonization by Salmonella was determined.  3.3 Methods and materials 3.3.1 Chemical reagents Streptomycin and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich (St. Louis, USA). 15-deoxy-Δ12,14-prostaglandin J2 (15d-PGJ2), thromboxane B2, prostaglandin E2, and aldosterone were purchased from Cayman Chemicals (Ann Arbor, USA). 3.3.2 Cell culture and Salmonella infections RAW264.7 cells (American Type Cell Culture, Manassas, USA) were seeded at 1x105 cells per well in 24-well plates and grown for 24 hours at 37°C, 5% CO2. All cells were grown in 60  Dulbecco’s modified Eagle medium (DMEM) with high glucose (HyClone, Waltham, USA) and 10% FBS (HyClone), 1% NEAA (Gibco, Carlsbad, USA), and 1% GlutaMax (Gibco). For infections, overnight cultures of Salmonella enterica serovar Typhimurium SL1344, grown in LB with streptomycin (Sigma-Aldrich) at 37°C with aeration, were diluted 1:100 in LB and sub-cultured for 3 hours at 37°C with aeration. Bacteria were pelleted and resuspended, and 106 bacteria were added to each well in DMEM for 30 minutes. Cells were washed 3 times with PBS, then incubated in DMEM containing 100 µg/mL gentamicin for 60 min, then 10 µg/mL gentamicin for the remainder of the 24 hour time point. The ΔsseFG deletion strain was complemented, as done previously in Chapter 2, section 2.3.1. 3.3.3 RNA extraction and cDNA synthesis  After 24 hours of infection, macrophage cells were washed 3x with PBS. RNA was purified using the RNeasy Mini Kit (Qiagen, Hilden, Germany), with the on-column DNA digestion (Qiagen). cDNA was synthesized using the QuantiTect Reverse Transcription Kit (Qiagen). All procedures were carried out according to the manufacturers instructions. RNA samples were all stored at -80°C, and cDNA samples were stored at -20°C. 3.3.4 Quantitative real-time PCR (qRT-PCR) For qRT-PCRs, the QuantiTect SYBR Green PCR Kit (Qiagen) and the Applied Biosystems (Foster City, USA) 7500 system was used. Reactions contained forward and reverse primers at 0.4 µM each. All results were normalized using the mRNA levels of the acidic ribosomal phosphoprotein PO as baseline (Antunes, Arena et al. 2011). Averages of the data obtained with untreated samples were normalized to 1 and the data from each sample was normalized accordingly. Primer sequences are listed in Table 3.1.  61  Table 3.1 qRT-PCR primers for eicosanoid pathways Target Forward Reverse PLA2G4A TTGGTCCCAGTTGCAGAAAT     GAAGGCACAGAGAAGCCTGA PTGS2 (COX2) GGGGTGTCCCTTCACTTCTTTCA TGGGAGGCACTTGCATTGA TBXAS1 ATGTCCAGATACGGCAGACC  GAGGCTTCTGAAAGAGGTGG PTGES ATGAGTACACGAAGCCGAGG CCAGTATTACAGGAGTGACCCAG ALOX5 ATATCTCGGGGCAGATCCTT  GTAAAGAACTGGAGGCACGG ALOX5AP CACAAGGAAAGTGGGGTACG     GGGAGAAGCTTCCAGAGGAC LTC4S2 CCTTCGTGCAGAGATCACCT     GGCAACATGAAGGACGAAGT LTC4S3 CCTTCGTGCAGAGATCACCT     CTAATTCTGCCTGTGGCTGG LTC4S4 TTACCTGGGCTCGGAAGAC      GCTCTTCTGGCTACCGTCAC LTA4H2 ACCTTGACTTTCTCCAAGGG CACAGGAGGAGAATCTGCG LTA4H3 CCTTGACTTTCTCCAAGGGT GGTCCAGTCACAGGAGGAGA LTA4H4 ATTTCCATCGGTGACCCTTT GGTCCAGTCACAGGAGGAGA CYP4F13 AGTCATTTCCTTGGGTGCAA  ACCTGTGTACCCAATCCTGC CYP4F14 GTCACCAGCACTCACCAAGA  TCCGATCTATCCTCAATGCC CYP4F16 CGGAGGAGGTCTATGACTGG  ACCGAGAGCCTGAGGAGATT CYP4F18 ACAGGAGTCCTTCCTCTGAGC  TGAGAACTCTCTTCGCCTCC  3.3.5 CFU determination To determine bacterial colonization, infected cells were lysed in 250 µL of 1% Triton X- 100 (BDH, Yorkshire, UK), 0.1% sodium dodecyl sulfate (Sigma-Aldrich). Serial dilutions were plated on LB plates containing 100 µg/mL of streptomycin (Sigma-Aldrich). Plates were incubated for approximately 15 hours at 37°C, then bacteria were enumerated. 3.3.6 Hormone addition to Salmonella infection Macrophages were seeded as above, with 20 µM aldosterone, PGE2, TBXB2, and 2 µM 15d-PGJ2 in medium, and incubated for 24 hours. Cells were checked for confluency, to ensure hormones were not causing significant cell lifting. Salmonella infections were carried out as above, with all DMEM media containing 20 µM or 2 µM of hormones, as above. 2 µM 15d-PGJ2 62  was used because 20 µM was found to cause increased cell lifting, while 2 µM had no effect. At 24 hours post-infection, macrophages were lysed and bacteria enumerated as above. 3.3.7 Statistical analysis Data were analyzed by nonparametric Mann-Whitney t tests with 95% confidence intervals using GraphPad Prism version 6.0 (GraphPad Software Inc., San Diego, USA). For each figure, the term “measurements” refers to the combination of both technical and experimental replicates. Each experiment was repeated a minimum of two times, with multiple technical replicates. Thus, for example “8 measurements” would refer to two separate experiments with 4 technical replicates each, “4 measurements” would refer to two separate experiments with two technical replicates each.  3.4 Results - Salmonella infection alters eicosanoid production 3.4.1 Prostaglandin and thromboxane pathways are affected by Salmonella infection  To begin to understand how arachidonic acid metabolism is affected by Salmonella infection, the expression of enzymes in this pathway was examined (See Chapter 3 Introduction, Figure 3.1). In the prostaglandin and thromboxane pathways, the expression levels of four enzymes were determined by quantitative real-time PCR (Figure 3.2). The expression of phospholipase A2 (PLA2G4A), which allows for the release of arachidonic acid from the membrane, was largely unaffected by Salmonella infection of macrophages. From this point arachidonic acid can enter either the prostaglandin/thromboxane pathway or the leukotriene pathway. Interestingly, the levels of TBXAS1 mRNA, leading to thromboxane synthesis, were significantly reduced during Salmonella infection. In contrast, the expression levels of COX2 63  and PTGES were both significantly increased (Figure 3.2). This data supports the idea that the prostaglandin pathway is induced during Salmonella infection.   Figure 3.2 Expression of enzymes involved in the prostaglandin and thromboxane pathways Expression levels from RAW264.7 macrophages infected with Salmonella at 24 hours post- infection were examined using qRT-PCR. Data was normalized to uninfected samples. Results shown are averages of a minimum of four measurements, with standard errors of the means shown. (**p<0.001, ***p<0.0001). (UI – uninfected, SL – wild-type Salmonella SL1344).  3.4.2 Leukotriene pathway is repressed during Salmonella infection  While the prostaglandin pathway is activated by Salmonella infection, the leukotriene pathways are inhibited by Salmonella infection of macrophages (Figure 3.3). The expression of ALOX5, the enzyme mediating the initial step in the leukotriene pathway, was unaffected by 64  Salmonella infection. However, its regulator, the ALOX5 activating protein (ALOX5AP), was significantly down regulated, implying a reduction in the activity of ALOX5 at the post- transcriptional level. The expression of the three isotypes of LTC4S that were tested (LTC4S2, LTC4S3, and LTC4S4) was reduced during Salmonella infection. The expression of two of the isotypes of LTA4H (isotypes 2 and 3) were not significantly different between infected and uninfected samples; however, isotype 4 was significantly reduced. In addition, 3 of the 4 isotypes of CYP4F were all down regulated by Salmonella infection. Together, this data shows that the expression of genes involved in the leukotriene pathway is reduced during Salmonella infection. 65   Figure 3.3 Expression of enzymes involved in the leukotriene pathway Expression levels from RAW264.7 macrophages infected with Salmonella at 24 hours post- infection were examined by qRT-PCR. Data was normalized to uninfected samples. Results shown are averages of a minimum of four measurements, with standard errors of the means shown. (**p<0.001). (UI – uninfected, SL – wild-type Salmonella SL1344). 66  3.5 The role of SPI2 in prostaglandin and thromboxane production 3.5.1 Involvement of SPI2 effectors in TBXAS1 repression  Nine of the SPI2 deletion strains used in the previous study and chapter (Buckner, Croxen et al. 2011) were tested for their effect on TBXAS1 expression in RAW264.7 macrophages (Figure 3.4). Interestingly, most of the deletion strains tested induced higher levels of TBXAS1 expression than the wild-type strain. The ΔspiC and ΔspvB strains induced significantly higher levels of TBXAS1 (p<0.001). This is not surprising, as previously it has been shown that these are significantly impaired in colonizing macrophages (Figure 2.3) (Buckner, Croxen et al. 2011). In addition, the ΔsteC strain was also found to colonize macrophages at lower levels than wild-type Salmonella. Therefore, the lower bacterial burden may be why these strains have similar levels of TBXAS1 transcripts to uninfected samples. The ΔsseFG, ΔsseG, ΔsspH2, ΔsteA, ΔsteC, and ΔslrP strains also caused an increase in the expression of the TBXAS1 transcript compared to wild-type Salmonella. Together, these data indicate that SPI2 effectors may have a role in the reduction of TBXAS1 transcripts seen during macrophage infection with Salmonella. 67   Figure 3.4 SPI2 effectors affect TBXAS1 expression The expression of TBXAS1 was determined by qRT-PCR after infection of RAW264.7 macrophages for 24 hours with Salmonella strains lacking individual SPI2 effectors. Data was normalized to uninfected samples. Results shown are averages of a minimum of four measurements, with standard errors of the means shown. All deletion strains were statistically compared to wild-type SL1344 expression. (*p<0.05**p<0.001, ***p<0.0001).  3.5.2 Involvement of SPI2 effectors in PTGES expression  Fifteen SPI2 deletion strains were tested for their effect on the induction of PTGES transcripts in RAW264.7 macrophages infected for 24 hours (Figure 3.5). Two of the deletion strains, ΔpipB2 and ΔgogB both had increased induction of PTGES when compared to wild-type Salmonella. Conversely, the ΔsifB, ΔsseK1/2/3, ΔsteC, and ΔspvB strains, all of which have previously shown reduced bacterial colonization of macrophages (Figure 2.3), showed no changes in PTGES induction when compared to wild-type Salmonella. However, the ΔspiC strain, which is thought to not secrete any SPI2 effectors (Yu, McGourty et al. 2010), and had 68  significantly reduced bacterial colonization of macrophages (Figure 2.3), showed reduced levels of PTGES mRNA. Thus, it is possible that SPI2 effectors, and not the mere presence of bacteria in the cells, may be responsible for the induction of PTGES. Potential SPI2 effector candidates for this role in PTGES induction include ΔsspH2, ΔsseF, ΔsseG, (ΔsseFG) and ΔslrP, as all of these strains colonize macrophages well but show reduced induction of PTGES. Together, these data raise the possibility that SPI2 effectors may function to control a portion of the expression of PTGES.  Figure 3.5 SPI2 effectors affect PTGES expression The expression of PTGES was determined by qRT-PCR after infection of RAW264.7 macrophages for 24 hours with Salmonella strains lacking individual SPI2 effectors. Data was normalized to uninfected samples. Results shown are averages of a minimum of four measurements, with standard errors of the means shown. All deletion strains were statistically compared to wild-type SL1344. (*p<0.05, **p<0.001, ***p<0.0001).  69  3.5.3 Involvement of SPI2 effectors in COX2 expression  Twelve of the SPI2 deletion strains were tested for their induction of COX2 expression during macrophage infection (Figure 3.6). Six of the twelve SPI2 deletion strains tested showed reduced levels of PTGS2/COX2 induction, including ΔsseFG, ΔsseF, ΔsseG, ΔspvB, ΔspiC, and ΔslrP. Of these strains, both the ΔspvB and the ΔspiC colonize at lower levels, which could account for the reduced induction of COX2. Following this logic, it is surprising that the ΔsseF, ΔsseG, ΔsseFG, and ΔslrP strains are all associated with reduced COX2 expression, despite colonizing macrophages at levels similar to wild-type Salmonella. Conversely, ΔsifB, ΔsseK1/2/3, and ΔpipB2 all had higher levels of COX2 mRNA expression than wild-type Salmonella. Both the ΔsifB and ΔsseK1/2/3 strains colonized macrophages poorly, but here show increased COX2 expression.  70   Figure 3.6 SPI2 effectors affect COX2 expression The expression of PTGS2 (COX2) was determined by qRT-PCR after infection of RAW264.7 macrophages for 24 hours with Salmonella strains lacking individual SPI2 effectors. Data was normalized to uninfected samples. Results shown are averages of a minimum of four measurements, with standard errors of the means shown. All deletion strains were statistically compared to wild-type SL1344. (*p<0.05, **p<0.001, ***p<0.0001).  3.6 The role of SseF and SseG in prostaglandin production 3.6.1 SseF and SseG induce COX2 expression during Salmonella infection  Because the ΔsseF, ΔsseG, and ΔsseFG strains showed interesting phenotypes in the eicosanoid SPI2 screen (Figures 3.5 and 3.6), these strains were examined more closely. To ensure there were no polar or un-accounted for effects of the deletions of the sseF and sseG genes on the induction of COX2, the complemented ΔsseFG double mutant strain, was tested in this macrophage infection model (Figure 3.7). Similar to what was seen previously, the ΔsseF, ΔsseG, and ΔsseFG strains all had significantly lower levels of COX2 induction, below 50% of what was seen with wild-type Salmonella. Furthermore, by complementing these mutations, the 71  level of COX2 mRNA was significantly increased. In fact, levels in the complemented strain were even higher than in wild-type Salmonella. Together, these data show that SseF and SseG are necessary for the full induction of COX2 that is seen during wild-type Salmonella infection of macrophages.  Figure 3.7 SseF and SseG are required for full induction of COX2 The ΔsseF, ΔsseG, and ΔsseFG deletion strains and the SseFG complemented strain were examined for their role in COX2 induction. RAW264.7 macrophages were infected with bacterial strains for 24 hours, after which RNA was extracted and qRT-PCR analysis was performed for COX2 expression. Results shown are displayed as a percentage of wild-type expression and are averages of a minimum of eight measurements, with standard errors of the means shown. Data was statistically compared to wild-type SL1344. (*p<0.05, **p<0.001).  3.6.2 Effect on COX2 is not due to colonization defects To ensure that the effect of the ΔsseF, ΔsseG and ΔsseFG deletions on COX2 expression was not due to any reductions in bacterial loads, CFUs of the double mutant and the complemented strain were closely examined (Figure 3.8). There were no differences in the numbers of the CFUs of the ΔsseFG double mutant when compared to the wild-type Salmonella 72  strain SL1344. The complemented strain did colonize the macrophages better than the wild-type, which may account for the level of COX2 induction that was even higher than wild-type Salmonella. In conjunction with the qRT-PCR study, this data indicates that the SPI2 effectors SseF and SseG are intricately involved in the induction of COX2 that is seen during macrophage infections.  Figure 3.8 Colonization of macrophages by ΔsseFG and complemented sseFG strain RAW264.7 macrophages were infected with a multiplicity of infection of 10 for 24 hours. Then, cells were lysed and bacteria were enumerated. Results shown are displayed as a percentage of wild-type colonization and are averages of a minimum of eight measurements, with standard errors of the means shown. (*p<0.05, N.S. not significant).  3.7 Arachidonic acid metabolites alter macrophage colonization by Salmonella  The above data indicates the prostaglandin pathway is altered during Salmonella infection. To further characterize these associations, some of the downstream products of COX2, TBXAS1, and PTGES were tested. Thromboxane B2 (TBXB2), prostaglandin E2 (PGE2), 15d- prostaglandin J2 (15d-PGJ2) and the steroid hormone aldosterone were all added to macrophages 73  prior to infection with Salmonella. After 24 hours of infection bacteria were enumerated. The addition of TBXB2, PGE2 and 15d-PGJ2 all caused reductions in bacterial counts (Figure 3.9), with 15d-PGJ2 being the most potent at reducing Salmonella colonization. This is particularly interesting because the concentration of 15d-PGJ2 used was 10x lower than the other hormones. Aldosterone, which was used as a control because it is from a different hormone pathway, had no significant effects on Salmonella colonization. Because 15d-PGJ2 had such a drastic effect on Salmonella colonization, its role was further explored in the upcoming chapter.  Figure 3.9 Addition of hormones to Salmonella infection of macrophages The effects of the addition of thromboxane B2, prostaglandin E2, and 15d-prostaglandin J2, all of which are downstream products of COX2, and the steroid hormone aldosterone to RAW264.7 macrophages during wild-type Salmonella SL1344 infection was studied. 24 hours post infection cells were lysed and bacteria were enumerated. Results shown are averages of a minimum of four measurements, with standard errors of the means shown. (*p<0.05).  74  3.8 Discussion This chapter provides evidence that arachidonic acid metabolism is altered during Salmonella infection of macrophages at the mRNA level. Specifically, the prostaglandin pathway is upregulated by Salmonella infection, whereas the thromboxane and leukotriene pathways are generally downregulated by infection. Many of the SPI2 deletion strains that were tested had different effects on TBXAS1, PTGES, and COX2 expression when compared to wild- type Salmonella. Specifically, the ΔsseF, ΔsseG, and the ΔsseFG deletion strains induce COX2 significantly less than wild-type Salmonella, despite colonizing at similar levels. The increased expression levels of COX2 and PTGES seen in macrophage infections correlate well with what was observed in the livers of Salmonella infected mice (Appendix A Figure 3) (Antunes, Arena et al. 2011). Furthermore, it fits with the established role of prostaglandins in inflammation and infection, as discussed in the introduction. Surprisingly, the expression of TBXAS1 was reduced in macrophages infected with Salmonella, whereas in mice we saw an increase in TBXAS1 expression in the liver (Appendix A Figure 3) (Antunes, Arena et al. 2011). This difference may be due to the fact that liver samples have a variety of cells, whereas the experiments presented here were performed in monoculture. The fact that this data shows no significant changes in PLA2G4A transcripts, which is the initial step in all the pathways examined here, leads to a few tentative conclusions. Firstly, it is possible that phospholipase A2 is being regulated at the post-transcriptional level. Cytosolic PLA2 can be regulated by phosphorylation and changes in calcium, which induce the proteins translocation to the membrane, thus allowing access to substrate (Ghosh, Tucker et al. 2006, Tucker, Ghosh et al. 2009). Secondly, it is possible that the release of arachidonic acid from the membrane by PLA2 is not increased, but that during infection the activity of pathways is shifted such that some are 75  shut down, while others are activated. This idea fits well with the data presented here, as the leukotriene and thromboxane pathways are down regulated, which would allow for the up regulation in prostaglandin production. In this chapter, I have focused on the pathways that were up regulated by Salmonella infection. However this should not discount the possibility that the down regulated pathways may also play an important role during infection. SPI2 has been implicated in the regulation of COX2 during Salmonella infection by other groups (Uchiya and Nikai 2004); however, no specific effector other than SpiC has been identified. To try to elucidate if and how SPI2 was involved, the panel of SPI2 deletion strains was tested for an effect on TBXAS1, PTGES, and COX2. As expected, the deletion strains that colonized macrophages at lower levels were generally found to have expression levels that were similar to uninfected samples. Of significant interest is the PTGES data, which shows that some of the strains that colonize at lower levels, such as ΔsifB, ΔsseK1/2/3, ΔsteC, and ΔspvB, still induced levels of PTGES similar to wild-type. Additionally, the ΔspiC strain, which does not secrete effectors (Yu, McGourty et al. 2010), had low levels of PTGES expression. Together, this implies that some of the SPI2 effectors may be responsible for inducing PTGES transcription. Because the ΔsspH2, ΔsseF, ΔsseG, ΔsseFG, and ΔslrP strains all had reduced levels of PGTES induction with high levels of bacterial colonization they are potential candidates for this role. The expression levels of COX2 induced by the SPI2 deletion strains revealed some interesting trends, namely the potential role of SseF and SseG in inducing COX2 expression during Salmonella infection. The data presented in Figures 3.7 and 3.8 show that SseF and SseG are responsible for a large portion of the induction of COX2 seen during Salmonella infection. Viewed in light of Uchiya and Nikai’s 2004 paper (Uchiya and Nikai 2004) showing that SPI2 is 76  responsible for COX2 induction, our data suggest that the effectors SseF and SseG contribute to this during infection. This novel role for these proteins in macrophage infection should be further explored.  A great deal of work has been done to structurally analyze SseF and SseG (Salcedo and Holden 2003, Abrahams, Muller et al. 2006, Muller, Chikkaballi et al. 2012). Also, work has been done looking at their function in the formation of SIFs and manipulation of microtubules (Guy, Gonias et al. 2000, Kuhle and Hensel 2002, Kuhle, Jackel et al. 2004, Abrahams, Muller et al. 2006). However, much of what we know about SseF and SseG comes from experiments in epithelial cells, not in macrophages. The data presented in this chapter provides a novel role for these effectors during Salmonella infection of macrophages. Finally, the role of exogenous hormones added to macrophages infected with Salmonella was studied. Both thromboxane B2 and prostaglandin E2 reduced bacterial counts to similar levels. It is interesting that PGE2 leads to a reduction in Salmonella counts, given that it has previously been shown (Bowman and Bost 2004) that live Salmonella induce the production and release of PGE2. Surprisingly, 15d-PGJ2 significantly reduced bacterial colonization of macrophages, and this phenomenon was studied more closely in the following chapter. It is interesting to note that Salmonella infection causes an induction of COX2, which is at least partially dependent on SPI2 effectors, and leads to an increase in the production of prostaglandins. Increasing the concentration of prostaglandins leads to a reduction in bacterial colonization, as shown in Figure 3.9. This leads to the question of why would Salmonella have evolved a SPI2 dependent way to increase prostaglandins if they prevent bacterial colonization? Recently there has been mounting evidence that Salmonella needs the inflammatory response to effectively colonize the host (Arpaia, Godec et al. 2011). It is possible that Salmonella induce COX2, and thus PG synthesis, to prevent uncontrolled bacterial replication, to avoid killing the 77  host too quickly. Alternatively, the host may be using a sseFG mediated process to induce COX2, to control bacterial replication and thus protect itself. The elucidation of how SseF and SseG are inducing COX2 expression may shed more light on these questions. The data presented in this chapter, and the following chapter may fit into this complex interplay of finding the ‘right’ balance of inflammation. Elucidation of the roles of SPI2 effectors in pathogenesis is important for the development of novel treatments and vaccines, as well as furthering our basic understanding of Salmonella biology and host interactions. While some Salmonella effectors have been studied extensively, little is known about many others. Understanding the role of SseF and SseG in Salmonella-induced PG production will be important for deciphering the interplay between the production of PGs in inflammation and Salmonella-host interactions.  3.9 Summary In this chapter, the role of arachidonic acid metabolism, specifically the production of prostaglandins, during Salmonella infection was examined. The data presented here show that Salmonella infection induces the production of the mRNA for enzymes involved in the production of the prostaglandins. Conversely, the expression of genes involved in the production of the thromboxanes and leukotrienes was downregulated by Salmonella infection. Pertaining to the prostaglandin pathway, the data shows that SPI2 effectors may be playing a role in its upregulation. Specifically, this chapter shows evidence that SseF and SseG are partially responsible for the induction of COX2 seen during Salmonella infection. Finally, the addition of products downstream of COX2 leads to a reduction in bacterial colonization, confirming the 78  notion that the arachidonic acid pathway is an important component of the interplay between Salmonella and its host. 79  Chapter  4: 15d-PGJ2 inhibits colonization of macrophages by Salmonella  4.1 Abstract 15-deoxy-Δ12,14-prostaglandin J2 (15d-PGJ2) is an anti-inflammatory downstream product of the cyclooxygenase enzymes. It has been implicated to play a protective role in a variety of inflammatory mediated diseases, including rheumatoid arthritis, neural damage, and myocardial infarctions. Here it is shown that 15d-PGJ2 also plays a role in Salmonella infection. Salmonella enterica Typhimurium is a Gram-negative facultative intracellular pathogen that is able to survive and replicate inside phagocytic immune cells, allowing for bacterial dissemination to systemic sites. Salmonella species cause a wide range of morbidity and mortality due to gastroenteritis and typhoid fever. The previous chapter and Appendix A show that in mouse models of typhoid fever and macrophage infections, Salmonella causes a major perturbation in the prostaglandin pathway. Specifically, that 15d-PGJ2 production was significantly increased in both liver and feces. This chapter shows that 15d-PGJ2 production is also significantly increased in macrophages infected with Salmonella. Furthermore, the addition of 15d-PGJ2 to Salmonella infected RAW264.7, J774, and bone marrow derived macrophages is sufficient to significantly reduce bacterial colonization. 15d-PGJ2 reduces the inflammatory response of these infected macrophages, as evidenced by a reduction in the production of cytokines and reactive nitrogen species. The inflammatory response of the macrophage is important for full Salmonella virulence, as it can provide the bacteria cues for virulence. The reduction in bacterial colonization is independent of the expression of Salmonella virulence genes SPI1 and SPI2, and is independent of the 15d-PGJ2 ligand PPAR-γ. In conclusion, this chapter shows that 15d-PGJ2 80  mediates the outcome of Salmonella infection of macrophages, a previously unidentified role for this prostaglandin.  4.2 Introduction Prostaglandins (PG) are a class of lipid hormones responsible for a wide range of functions within the body. PGs are synthesized from arachidonic acid that is released from the cell membrane by phospholipase A2 and then modified by the cyclooxygenase enzymes (COX1 and COX2) to enter the PG pathway (Figure 4.1) (Funk 2001, Yoshikai 2001). COX1 is constitutively active, whereas COX2 is induced under inflammatory conditions (Funk 2001). COX2-derived PGs are involved in a variety of pro- and anti-inflammatory processes (Funk 2001, Matsuoka and Narumiya 2008). The involvement of COX1 and COX2 in regulating inflammation is evidenced by the increased cardiovascular risk associated with the inhibition of COX2 (Cannon and Cannon 2012), and the increased susceptibility to colitis in mice lacking these two enzymes (Morteau, Morham et al. 2000). Two waves of COX2 activity have been identified: the first (early) activity is associated with the pro-inflammatory response, whereas the second wave mediates the resolution of inflammation (Gilroy, Colville-Nash et al. 1999), and is associated with high levels of PGD2 and 15-deoxy-Δ12,14-Prostaglandin J2 (hereafter referred to as 15d-PGJ2) (Gilroy, Colville-Nash et al. 1999, Yoshikai 2001).  81  Figure 4.1 Arachidonic acid metabolism Arachidonic acid metabolism and formation of prostaglandins and leukotrienes. 15d-PGJ2 is non- enzymatically produced from PGD2.   15d-PGJ2 has recently been identified as an anti-inflammatory PG. By forming adducts with various molecules within the cell, 15d-PGJ2 is able to modulate a variety of cellular signaling pathways (Kansanen, Kivela et al. 2009). 15d-PGJ2 is an endogenous ligand that activates the nuclear receptor peroxisome proliferator-activated receptor gamma (PPAR-γ) transcription factor, thus inhibiting the NF-κB, STAT, and AP1 signaling pathways, and reducing the production of inflammatory mediators such as iNOS, TNFα, and IL-6 (Ricote, Li et al. 1998, Zingarelli, Sheehan et al. 2003, Kielian, McMahon et al. 2004, Kansanen, Kivela et al. 2009, Waku, Shiraki et al. 2009). 15d-PGJ2 also modifies the production of reactive nitrogen species (RNS), the NF-κB pathway, heat shock proteins, JNK signaling, ERK signaling, and cytokine production (Negishi, Koizumi et al. 1995, Rossi, Elia et al. 1996, Jiang, Ting et al. 1998, Gilroy, Colville-Nash et al. 1999, Petrova, Akama et al. 1999, Castrillo, Diaz-Guerra et al. 82  2000, Hortelano, Castrillo et al. 2000, Rossi, Kapahi et al. 2000, Straus, Pascual et al. 2000, Ruiz, Kim et al. 2004, Crosby, Svenson et al. 2005, Waku, Shiraki et al. 2009, Liu, Yu et al. 2012).  Both RAW264.7 macrophages and HeLa epithelial cells do not produce quantifiable amounts of PPAR-γ (Ricote, Li et al. 1998, Rossi, Kapahi et al. 2000, Crosby, Svenson et al. 2005), which is not necessary for the anti-inflammatory effects of 15d-PGJ2 in these cells (Crosby, Svenson et al. 2005). In addition, for 15d-PGJ2 to activate PPAR-γ, it must be present at relatively high concentrations (Bell-Parikh, Ide et al. 2003). Several PPAR-γ independent functions of 15d-PGJ2 have recently been described (Petrova, Akama et al. 1999, Castrillo, Diaz- Guerra et al. 2000, Hortelano, Castrillo et al. 2000, Rossi, Kapahi et al. 2000, Straus, Pascual et al. 2000, Castrillo, Mojena et al. 2001, Ruiz, Kim et al. 2004, Crosby, Svenson et al. 2005, Abdo, Mahe et al. 2012, Han, Zhu et al. 2012, Liu, Yu et al. 2012, Napimoga, da Silva et al. 2012).  15d-PGJ2 inhibits the synthesis of iNOS in activated and peritoneal macrophages, which is at least partially dependent on NF-κB (Ricote, Li et al. 1998, Petrova, Akama et al. 1999, Castrillo, Diaz-Guerra et al. 2000). In RAW 264.7 and J774A.1 macrophages, 15d-PGJ2 increases ROS formation, which may inhibit phagocytosis and induce apoptosis at later time points (Castrillo, Mojena et al. 2001, Liu, Yu et al. 2012). Furthering its role as an anti- inflammatory mediator, 15d-PGJ2 reduces the production of cytokines (Jiang, Ting et al. 1998), and reduces the recruitment of bone marrow monocytes during liver inflammation (Han, Zhu et al. 2012). It was also found that 15d-PGJ2 reduces the phagocytic activities of bone marrow macrophages (BMMO) in vitro (Han, Zhu et al. 2012). Recently, the use of nanocapsules loaded with 15d-PGJ2 has proved an effective strategy to reduce neutrophil migration, IL-1β, TNF-α, and IL-12p70 production during inflammation (Alves, de Melo et al. 2011). In fact, 15d-PGJ2 is so vital to the resolution phase of the inflammatory process, that when it is added back to animals 83  treated with COX2 inhibitors, it is sufficient to restore the normal resolution that occurs after inflammation, which is prevented by COX2 inhibitors (Gilroy, Colville-Nash et al. 1999).  Since 15d-PGJ2 has been found to reduce inflammation in such a variety of models, it has been explored as a potential therapeutic in a number of inflammatory diseases. Liu and colleges (2012) concluded that since 15d-PGJ2 reduces the general activity of both RAW264.7 and J774A.1 macrophages, it has the potential to be an effective therapeutic for inflammatory diseases (Liu, Yu et al. 2012). More specifically, the role of 15d-PGJ2 and its potential applications in therapy have been explored in rheumatoid arthritis, atherosclerosis, myocardial infarctions, cerebral injury, and gastrointestinal inflammation  (Jiang, Ting et al. 1998, Ricote, Li et al. 1998, Surh, Na et al. 2011). 15d-PGJ2 has also been found to protect enteric glial cells from oxidative stress, to reduce hepatic inflammation and fibrosis, and to reduce symptoms of COPD in rats (Surh, Na et al. 2011, Abdo, Mahe et al. 2012, Han, Zhu et al. 2012). 15d-PGJ2 may also be useful in the treatment of cancers, as it has been found to inhibit cell growth and tumorigenicity (Bui and Straus 1998).  In a model of periodontitis, 15d-PGJ2 nanocapsules were found to reduce inflammation caused by infection with Actinobacillus actinomycetemcomitans, but no effect on bacterial colonization was seen (Napimoga, da Silva et al. 2012). 15d-PGJ2 has been studied in models of sepsis and septic shock. In models of polymicrobial sepsis, 15d-PGJ2 treatment leads to increases in blood pressure, reductions in vascular injury, neutrophil infiltration, cytokine production, renal and liver dysfunction and injury, resulting in increased survival (Zingarelli, Sheehan et al. 2003, Dugo, Collin et al. 2004). In rat macrophages treated with heat killed S. aureus and E. coli, 15d-PGJ2 treatment leads to reductions in NO production, TBXB2 production, and ERK1/2 and NF-κB activity (Guyton, Zingarelli et al. 2003). In bacterial sepsis, PMN migration is reduced, and this was found to be 84  mediated by PPARγ, and 15d-PGJ2 treatment reduced PMN adherence to fibrinogen, another aspect of PMN migration (Reddy, Narala et al. 2008). The role of 15d-PGJ2 in microglial inflammatory response to S. aureus was examined, and 15d-PGJ2 was found to inhibit a variety of cytokines including IL-1β, TNFα, IL-12p40, and MCP1, while in this model the levels of PPARγ were unaffected by either 15d-PGJ2 or S. aureus treatment (Kielian, McMahon et al. 2004). The role of 15d-PGJ2 in H. pylori infected epithelial cells was also studied, and it was found that 15d-PGJ2 treatment reduced JAK/STAT signaling, RANTES production, and NADPH oxidase activity (Cha, Lim et al. 2011). In this study, the involvement of PPARγ was not determined (Cha, Lim et al. 2011). Interestingly, 15d-PGJ2 treatment of mice one day after infection with the influenza virus was found to significantly reduce morbidity and mortality, in a PPARγ dependent fashion (Cloutier, Marois et al. 2012). In this study, 15d-PGJ2 reduced the production of chemokines and cytokines, as well as reducing viral titers (Cloutier, Marois et al. 2012). They also found that 15d-PGJ2 decreased inflammatory infiltrate in the lungs and reduced the production of IL-6, TNFα, CCL2, CCL3, CCL4, and CXCL10, but had no effect on IFNγ production (Cloutier, Marois et al. 2012). GW9662, a PPARγ specific inhibitor, was used, and this inhibitor abolished the protection afforded by 15d-PGJ2 treatment (Cloutier, Marois et al. 2012).  These studies show the potential use of 15d-PGJ2 in a variety of microbial associated disease conditions, however, it seems that there have not been any studies looking at the role of 15d-PGJ2 in Salmonella infection. Salmonella is a Gram-negative enteric pathogen that is transmitted by contaminated food or water (Haraga, Ohlson et al. 2008). Once ingested, the bacteria replicate in the small intestine, and in cases of systemic disease, such as typhoid fever, the bacteria cross the intestinal barrier and are taken up by phagocytes (Haraga, Ohlson et al. 2008, McGhie, Brawn et al. 2009).  By 85  means of the Salmonella Pathogenicity Island 2 (SPI2) type III-secretion system, Salmonella is able to replicate inside macrophages in a special vacuole termed the Salmonella containing vacuole (McGhie, Brawn et al. 2009, Buckner, Croxen et al. 2011, van der Heijden and Finlay 2012). From inside these macrophages, Salmonella is able to disseminate to systemic sites such as the spleen and liver, causing severe disease and bacteremia (Haraga, Ohlson et al. 2008). Our group has recently performed a high-throughput metabolomics study to determine the effect of Salmonella enterica serovar Typhimurium infection of mice on the chemical composition of the body (Antunes, Arena et al. 2011). We found that the PG pathway was greatly perturbed by Salmonella infection and that 15d-PGJ2 production was greatly increased in infected mice (Appendix A, Figure A.1 and Figure A.2) (Antunes, Arena et al. 2011). Additionally, 15d-PGJ2 was identified in the previous chapter as having a role in Salmonella infection of macrophages (Figure 3.9). Therefore, the impact of this hormone on the pathogenesis of Salmonella was examined. This chapter shows that 15d-PGJ2 production is increased during Salmonella infection of cultured macrophages. Additionally, the roles of individual PGs on bacterial colonization of macrophages was examined, and it was shown that 15d-PGJ2 causes a marked decrease in Salmonella colonization, despite its well-known role in reducing macrophage activity. Like many activities of 15d-PGJ2, this effect on colonization is PPAR-γ independent. Furthermore, this chapter presents evidence showing that this reduction in colonization is not due to inhibition of SPI2. Altogether, this data shows a novel role for 15d- PGJ2, and provides further evidence for the importance of inflammation to Salmonella pathogenesis.  86  4.3 Methods and materials 4.3.1 Chemical reagents Streptomycin and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich (St. Louis, USA). 15d-PGJ2 was obtained from Cayman Chemical (Ann Arbor, USA). 4.3.2 Tissue culture RAW264.7 and J774 macrophages, as well as HeLa epithelial cells, were obtained from the American Type Culture Collection (Manassas, USA). Cells were grown in Dulbecco’s Modified Eagle Medium (DMEM; HyClone, Waltham, USA) supplemented with 10% fetal bovine serum (FBS; HyClone), 1% non-essential amino acids (Gibco, Carlsbad, USA) and 1% GlutaMAX (Gibco). Cells were seeded approximately 20 hours before experiments in 24-well plates at a density of 105 cells per well. 15d-PGJ2 was dissolved in DMSO and concentrations of 2 µM were used, unless otherwise indicated. Controls without 15d-PGJ2 contained the same amounts of DMSO. Wild-type Salmonella strain SL1344 (hereafter refered to as Salmonella) were grown in LB with streptomycin at 37°C with aeration. For infection assays, bacterial cells grown in LB, in mid-logarithmic growth were spun down and resuspended in phosphate-buffered saline (PBS) and diluted in tissue culture medium. Cells were infected at a multiplicity of infection of 10 for 30 minutes at 37oC, 5% CO2. Subsequently, cells were washed with PBS and incubated at 37oC, 5% CO2 in growth medium containing 100 µg/mL gentamycin (Sigma- Aldrich) for 1 hour. Medium was replaced to decrease the gentamycin concentration to 10 µg/mL for later time points. All media contained (or did not contain for controls) the indicated concentration of 15d-PGJ2. At the appropriate times, supernatants were collected and cells were lysed in 250 µL of 1% Triton X-100 (BDH, Yorkshire, UK), 0.1% sodium dodecyl sulfate 87  (Sigma-Aldrich). Serial dilutions were plated on LB plates containing 100 µg/mL of streptomycin (Sigma-Aldrich) for bacterial enumeration. 4.3.3 Bone marrow macrophage collection and infection Age-matched C57BL/6 female mice were sacrificed and femurs were removed. Femurs were cleaned, and marrow was removed in Hank’s balanced salt solution (Gibco) with 2% FBS. Animal experiments were approved by the Animal Care Committee of the University of British Columbia and performed in accordance with institutional guidelines.  Cells were spun down and resuspended in BMMO media [DMEM (HyClone), 20% FBS, 2 mM Glutamax, 1 mM Sodium Pyruvate (Gibco), (5%) penicillin/streptomycin (Gibco), 20% L-conditioned media]. Cells were grown for 7-10 days before use. For infection, BMMO’s were seeded in 24-well plates at 1x106 cells/well in BMMO media without penicillin/streptomycin and L-conditioned media. BMMOs were infected with Salmonella at a multiplicity of infection of 10, and the gentamycin protection assay was completed as above. CFU was determined at 2, 6, and 10 hours post-infection. 4.3.4 Cytokine analysis and ELISAs Cytometric bead assay (CBA) for mouse inflammation (BD Biosciences) was performed following the recommended assay procedure. Supernatants from macrophages infected with or without 15d-PGJ2 were used for CBAs.  Enzyme-linked immunosorbent assays (ELISA) were performed on culture supernatants from uninfected and infected cells using commercially available ELISA kits to determine concentrations of 15d-PGJ2 (Assay Designs, Ann Arbor, USA). ELISAs (BD Biosciences) were also used to examine the concentrations of cytokines (TNF-α, MCP1, IL-10, IL-6) in the supernatants of infected, 15d-PGJ2-treated and untreated macrophages. Manufacturer’s recommendations and procedures were followed for all ELISAs. 88  4.3.5 Quantitative real-time PCR RNA was purified using the RNeasy Mini Kit (Qiagen, Hilden, Germany), with the on- column DNA digestion (Qiagen). cDNA was synthesized using the QuantiTect Reverse Transcription Kit (Qiagen). For qRT-PCRs, we used the QuantiTect SYBR Green PCR Kit (Qiagen) was used and the Applied Biosystems (Foster City, USA) 7500 system. Reactions contained forward and reverse primers at 0.4 µM each. All results were normalized using the mRNA levels of the acidic ribosomal phosphoprotein PO as baseline. Averages of the data obtained with untreated samples were normalized to 1 and the data from each sample (untreated or treated) was normalized accordingly. Primers used are listed in Table 4.1.  Table 4.1 qRT-PCR primers used for cytokine genes Target Forward Reverse IL-6 GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA IL-10 GGTTGCCAAGCCTTATCGGA ACCTGCTCCACTGCCTTGCT MCP-1 ATTGGGATCATCTTGCTGGT CCTGCTGTTCACAGTTGCC TNF-α AGGGTCTGGGCCATAGAACT CCACCACGCTCTTCTGTCTAC  4.3.6 Immunofluorescence microscopy Macrophages were seeded as mentioned previously, but on glass coverslips. Infections were carried out as above. Cells were fixed using 4% paraformaldehyde (Canemco Supplies, Quebec, Canada) overnight. Cells were then stained using a rabbit, polyclonal, anti-Salmonella LPS antibody (BD Biosciences). Prolong Gold containing DAPI (Invitrogen) was used to attach coverslips to the slides. The Zeiss Axioplan Fluorescence Microscope was then used to enumerate the bacteria in each infected macrophage for a total of 50 infected macrophages per sample. 89  4.3.7 Cell viability assays For Trypan blue exclusion assays, at the appropriate time points after infection, macrophages were released from the bottom of plates using cell scrapers, and stained with Trypan Blue (Gibco). The number of cells were then counted using the Countess automated cell counter (Invitrogen). CytoTox96 Non-Radioactive Cytotoxicity Assay (Promega) was performed on supernatants from infected or uninfected, 15d-PGJ2 treated or untreated macrophages to determine the amount of LDH released. The manufacturer’s protocol was followed. 4.3.8 Salmonella growth in 15d-PGJ2 Salmonella was grown in LB overnight with aeration at 37°C in the presence or absence of 15d-PGJ2. Salmonella was also grown in DMEM with or without 15d-PGJ2, without aeration, in 5% CO2 at 37°C for the indicated time points. Bacterial growth was monitored through measurements of absorbance at 600 nm. 4.3.9 hilA, phoP, ssrA reporter assays  Salmonella strains containing fusions between the promoters of hilA, ssrA or phoP and gfp, as previously described (Antunes, Buckner et al. 2010) were sub-cultured in liquid LB culture for 4 hours in the absence or presence of 2 µM 15d-PGJ2, and GFP production was analyzed through flow cytometry of bacterial cultures using a FACSCalibur (BD Biosciences, Franklin Lakes, NJ), as indicated. All cultures contained carbenicillin (100 µg/ml) and were incubated at 37°C with shaking (225 rpm). In each experiment, 50,000 events were collected per sample. Also, the ssrA reporter plasmid was introduced into Salmonella strain MCS004, which constitutively expresses the mKO red/orange protein. This strain was then used to infect RAW264.7 macrophages, as indicated above. Macrophages were lysed and bacteria were washed with PBS containing 2% 90  FBS. GFP and RFP production was analyzed through flow cytometry, performed using an LSR II (BD Biosciences), and data were analyzed with FlowJo 8.7 software (TreeStar, Ashland, OR). In each experiment, 100,000 events were collected per sample. 4.3.10 Reactive nitrogen species production  To determine reactive nitrogen species, the Griess reaction was performed on supernatants taken from macrophages infected as indicated above. 4.3.11 PPAR-γ inhibitor  RAW264.7 macrophages were seeded as above and GW9662 (Cayman Chemicals) was used at 4 µM, where indicated. Infections were carried out as above. 4.3.12 Statistical analysis Data were analyzed by nonparametric Mann-Whitney t tests with 95% confidence intervals using GraphPad Prism version 6.0 (GraphPad Software Inc., San Diego, USA). For each figure, the term “measurements” refers to the combination of both technical and experimental replicates. Each experiment was repeated a minimum of two times, with multiple technical replicates. Thus, for example “8 measurements” would refer to two separate experiments with 4 technical replicates each.  4.4 Results - 15d-PGJ2 inhibits Salmonella colonization 4.4.1 Salmonella infection induces 15d-PGJ2 production Our group has previously shown that the prostaglandin pathway is perturbed in mice infected with Salmonella (Appendix A) (Antunes, Arena et al. 2011). Specifically, the levels of 15d-PGJ2 were increased during infection in both liver and feces (Appendix A, Figure A.2) (Antunes, Arena et al. 2011). To further characterize the interactions between the anti- 91  inflammatory molecule 15d-PGJ2 and Salmonella, a simplified cell culture system was established. Because Salmonella actively replicates in macrophages, RAW264.7 macrophage cells infected with Salmonella were examined to determine if 15d-PGJ2 production was induced in these cells, as observed in mice. Similar to mice, a significant increase in the amount of 15d- PGJ2 produced by cultured macrophages in response to Salmonella was seen (Figure 4.2).  Figure 4.2 15d-PGJ2 produced in response to Salmonella 15d-PGJ2 is increased during Salmonella infection of RAW264.7 macrophages at 20 hours post- infection. Supernatants were collected at 2 and 20 hours post-infection and levels of 15d-PGJ2 were determined through ELISA. Results shown are averages of four measurements, with standard errors of means. (**p<0.001).  4.4.2 Addition of 15d-PGJ2 reduces Salmonella colonization of macrophages The previous chapter indicated a potential role of 15d-PGJ2 in bacterial colonization. To further characterize this increasing concentrations of 15d-PGJ2 was added to RAW264.7 macrophages prior to and during Salmonella infection and colonization was monitored through bacterial enumeration by selective plating. A dose-dependent decrease in Salmonella colonization of macrophages 24 hours post infection was clearly seen (Figure 4.3A). To 92  determine the effect of 15d-PGJ2 on Salmonella colonization throughout the course of infection and to understand the kinetics of this phenomenon, bacterial loads in macrophages were examined at 2, 6, 10, and 24 hours post infection in the absence or presence of 2 µM 15d-PGJ2, added prior to and during infection. This showed that 15d-PGJ2 reduces Salmonella colonization as early as 2 hours post infection, and continues to exert its effect until 24 hours post infection (Figure 4.3B). Immunofluorescence microscopy was also used to enumerate the Salmonella inside individual macrophages. By counting the bacteria inside 50 macrophages untreated or treated with 2 µM 15d-PGJ2 at 2, 4, and 8 hours post infection significantly fewer Salmonella were seen in the 15d-PGJ2 treated RAW264.7 macrophages (Figure 4.3C), confirming our CFU observations. 93   Figure 4.3 Salmonella colonization is reduced by 15d-PGJ2  (A) Salmonella colonization of RAW264.7 macrophages with the addition of increasing concentrations of 15d-PGJ2 at 24 hours post infection. (B) The effect of 2 µM 15d-PGJ2 on Salmonella colonization of RAW264.7 macrophages over time as determined by CFU analysis. (C) Immunofluorescence microscopy was used to enumerate bacterial colonization in individual macrophages at 2, 4 and 8 hours post-infection. Averages of at least 8 measurements are shown with standard errors of the means. (*p<0.05, **p<0.001).  To confirm that 15d-PGJ2 was not killing the macrophages, Trypan blue and LDH release assays were used to measure cell viability. The Trypan blue exclusion assay was used to count the number of cells in infected, 15d-PGJ2 treated and untreated, macrophage cultures.  No differences were seen between 15d-PGJ2 treated and untreated controls (Figure 4.4A). An LDH- release assay was also used to ensure that 15d-PGJ2 was not causing cell death at 24 hours post- infection. No significant difference was seen in the amount of LDH released by 15d-PGJ2 treated 94  cells as compared to untreated control cells (Figure 4.4B). Therefore, the reduction in Salmonella colonization is due to 15d-PGJ2 and not to increased macrophage cell death.   Figure 4.4 Macrophage viability (A) Enumeration of live RAW264.7 macrophages using Trypan Blue exclusion after treatment with 2 µM 15d-PGJ2 and infection with Salmonella. (B) LDH released from macrophages infected with Salmonella in the absence or presence of 15d-PGJ2.  4.4.3 15d-PGJ2 does not inhibit Salmonella growth directly The above results indicate that 15d-PGJ2 inhibits Salmonella colonization of macrophages. This could occur through a number of distinct mechanisms, the simplest of which would be direct inhibition of bacterial viability and growth. To determine if this was the case, the effect of 15d-PGJ2 on Salmonella growth in culture media in the absence of macrophages was tested. 15d-PGJ2 did not affect the growth of Salmonella alone in either LB or DMEM (Figure 4.5), suggesting that the effect of this hormone on Salmonella colonization of macrophages is not due to a direct inhibition of Salmonella viability and growth. 95   Figure 4.5 15d-PGJ2 does not affect Salmonella growth rate Salmonella growth in (A) LB and (B) DMEM, with and without 2 µM 15d-PGJ2 treatment. Averages of 4 measurements, with standard deviations are shown.  4.4.4 The effect of 15d-PGJ2 on Salmonella colonization is dependent on cell type To determine whether the effect of 15d-PGJ2 was dependent on cell type, both HeLa epithelial cells and J774 macrophages treated with and without 15d-PGJ2 were infected with Salmonella. 15d-PGJ2 had no effect on Salmonella colonization of HeLa epithelial cells (Figure 4.6A), but, like that observed with RAW macrophages, 15d-PGJ2 reduced colonization in J774 macrophages (Figure 4.6B). The original metabolomics study (Antunes, Arena et al. 2011) was done in mice, therefore a model that more closely resembled the murine infection model was devised. To do this, bone marrow derived macrophages taken from C57BL/6 mice, and were infected with Salmonella with or without 15d-PGJ2 treatment. At 2, 6, and 10 hours post infection there was a significant reduction in Salmonella in the 15d-PGJ2 treated samples (Figure 4.6C). Together this data shows that 15d-PGJ2 reduces Salmonella colonization of RAW264.7, J774, and bone marrow macrophages, while having no effect on HeLa cells.  96   Figure 4.6 15d-PGJ2 reduces colonization of bone marrow and J774 macrophages but not HeLa cells (A) Salmonella colonization of HeLa epithelial cells treated with 15d-PGJ2. (B) The effect of 15d-PGJ2 on Salmonella colonization of J774 macrophages cells, as determined by CFU analysis at 24 hours. (C) Salmonella colonization of bone marrow macrophages at 2, 6, and 10 hours post-infection, with 15d-PGJ2 treatment. Averages of at least 8 measurements are shown with standard errors of means. (*p<0.05, **p<0.001).  The effect of 15d-PGJ2 on activated, IFN-γ pre-treated, RAW264.7 macrophages was also tested. In these activated macrophages Salmonella colonization was also significantly reduced by 15d-PGJ2 treatment (Figure 4.7). This indicates that 15d-PGJ2 is potent even in macrophages activated to kill invading bacteria. Interestingly the addition of IFN-γ did not appear to have a significant affect on overall Salmonella replication in RAW264.7 macrophages. 97   Figure 4.7 IFN-γ priming of macrophages does not alter the effect of 15d-PGJ2 on colonization The effect of 15d-PGJ2 on Salmonella colonization of 2 ng/mL IFN-γ activated RAW264.7 macrophages 24 hours post infection. Averages of 8 measurements are shown with standard errors of means. (*p<0.05, N.S. indicates not significant).  4.5 15d-PGJ2 affects the immune response of macrophages infected with Salmonella 4.5.1 15d-PGJ2 reduces cytokine response to Salmonella As the effect of 15d-PGJ2 seemed to be restricted to macrophages, the effects of 15d- PGJ2 on the macrophage inflammatory response was examined. A cytometric bead assay (CBA) was performed on supernatants from Salmonella infected RAW264.7 macrophages. The CBA experiment showed that the 15d-PGJ2 treated macrophages produced significantly lower levels of TNF-α, MCP-1, IL-10, and IL-6, whereas levels of IFN-γ and IL-12 were unaffected (Figure 4.8A). This was confirmed using qRT-PCR (Figure 4.8B), and ELISA (Figure 4.8C). This indicates that 15d-PGJ2 is in fact reducing specific cytokines produced in response to Salmonella infection. 98   Figure 4.8 15d-PGJ2 treatment reduces cytokine production The effect of 2 µM 15d-PGJ2 treatment during Salmonella infection on cytokine production. RAW264.7 macrophages were examined at 24 hours post infection, cytokine production was determined by; (A) CBA assay, (B) quantitative real-time PCR, and (C) ELISA performed on supernatants from infected cells. Averages of 8 measurements are shown with standard errors of means. (*p<0.05, **p<0.001). 99   4.5.2 15d-PGJ2 reduces production of RNS Since 15d-PGJ2 reduces the cytokines produced during infection, the next question was whether 15d-PGJ2 would reduce other macrophage mechanisms aimed at responding to pathogens. To this end, the amount of RNS produced in response to Salmonella infection was tested. The data shows that RNS production was significantly reduced by the addition of 15d- PGJ2 (Figure 4.9).  Figure 4.9 15d-PGJ2 reduces the production of reactive nitrogen species The Griess reaction was used to determine the amount of reactive nitrogen species produced by RAW264.7 macrophages treated with 2 µM 15d-PGJ2 and infected with Salmonella. Averages of 8 measurements are shown with standard errors of means. (*p<0.05, N.S. indicates data was not significant).  4.6 15d-PGJ2 does not affect Salmonella virulence gene expression. There is a possibility that in addition to dampening the immune response, 15d-PGJ2 may also have an effect on Salmonella virulence gene expression thus affecting the ability of Salmonella to invade and replicate in macrophages. Therefore, Salmonella reporter strains were 100  used to determine if the regulation of virulence genes was directly affected by 15d-PGJ2 treatment. For these experiments, the SPI1 regulatory gene hilA, the SPI2 regulatory gene ssrA, and the two-component regulatory gene phoP were choosen to examine the expression of virulence genes in the presence of 15d-PGJ2, as these genes play major roles in the regulation of the SPI1 and SPI2 virulence regulons during the infection process. To study their expression, reporter fusions between the promoters of these genes and gfp were used as previously described (Antunes, Buckner et al. 2010). The expression of these genes was not affected by the addition of 15d-PGJ2 to LB (Figure 4.10A). Additionally, because SPI2 is highly induced inside the Salmonella containing vacuole, where it plays a major role in systemic virulence and the formation of a hospitable intracellular niche in phagocytes (Haraga, Ohlson et al. 2008, van der Heijden and Finlay 2012), the activity of SPI2 in 15d-PGJ2 treated macrophages was determined. First 15d-PGJ2 treated or untreated macrophages were infected with either the wild-type Salmonella strain, or the ΔssaR strain, which does not secrete any SPI2 effectors into the macrophage. Since 15d-PGJ2 might be affecting Salmonella colonization by inhibiting SPI2, it was anticipated that infecting host cells with a strain already missing a SPI2 component would abolish the colonization defect seen with 15d-PGJ2 treatment. Interestingly, this was not the case; in fact, macrophage colonization by the ΔssaR strain was inhibited to the same extent as the wild-type infections when compared to the samples that did not receive 15d-PGJ2 (Figure 4.10B). To test if the pathway by which Salmonella was taken up by the macrophages was being affected by 15d-PGJ2 treatment, macrophages were infected with a ΔinvA strain, an invasion mutant which does not secrete SPI1 effectors, and therefore bacterial uptake occurs through phagocytosis alone. The data shows that the ΔinvA strain’s colonization was inhibited by 15d- PGJ2 to the same extent as wild-type Salmonella. In Figure 4.10B the data are expressed as a 101  percentage of the respective control samples, to illustrate that the extent of the inhibition caused by 15d-PGJ2 is equivalent, even though the ΔssaR and ΔinvA strain colonized at a lower level than the wild-type Salmonella strain.  Figure 4.10 Expression of Salmonella virulence genes are unaffected by 15d-PGJ2 (A) Wild-type Salmonella carrying hilA-, phoP-, and ssrA-gfp reporter transcriptional fusions were used to analyze the effect of 15d-PGJ2 on virulence gene expression. Cultures were grown in LB for 4 hours. No changes in expression were seen. (B) 15d-PGJ2 reduced bacterial colonization of macrophages by the wild-type Salmonella strain, the ΔssaR strain, and the ΔinvA strain. Data are expressed as a percentage of the respective control samples, to illustrate that the extent of the inhibition caused by 15d-PGJ2 is equivalent in all strains. Averages of 8 measurements are shown with standard errors of means. (*p<0.05, **p<0.001, N.S. indicates data was not significantly different).  To further ensure that SPI2 expression was not affected in 15d-PGJ2 treated macrophages the ssrA reporter fusion was used in bacteria constitutively expressing the mKO red/orange protein, and ssrA expression was examined after macrophage infection. There were no differences in ssrA expression in untreated or 15d-PGJ2 treated macrophages (Figure 4.11). Therefore our data indicates that despite 15d-PGJ2 generally reducing the macrophage inflammatory response, the expression of Salmonella virulence genes is not affected. 102   Figure 4.11 15d-PGJ2 does not alter ssrA expression after macrophage infection Flow cytometry analysis of ssrA::gfp gene expression in Salmonella after infection of RAW264.7 macrophages with or without 15d-PGJ2 treatment. Averages of 8 measurements are shown with standard errors of means. (N.S. indicates data was not significant).  4.7 15d-PGJ2 affects Salmonella colonization via a PPAR-γ independent mechanism. 15d-PGJ2 is known to bind to and alter PPAR-γ activity, however, it is also not considered to be important in RAW264.7 macrophages. To ensure that PPAR-γ was not involved in this system, the PPAR-γ inhibitor GW9662 was added to RAW264.7 macrophages infected with Salmonella and treated with 15d-PGJ2. Bacterial colonization was determined, as above. The inhibitor was unable to restore the colonization defect seen with 15d-PGJ2 (Figure 4.12), indicating that the effect of 15d-PGJ2 on macrophage colonization by Salmonella is PPAR-γ independent. 103   Figure 4.12 PPAR-γ inhibitor has no effect on Salmonella colonization The effect of the addition of a PPAR-γ inhibitor to 15d-PGJ2 treated macrophages infected with Salmonella on bacterial colonization. Averages of 8 measurements are shown with standard errors of means. (*p<0.05, N.S. indicates data was not significant).   4.8 Discussion The potential role of 15d-PGJ2 during bacterial infection was initially considered because of the results of a metabolomics screen recently performed by our lab (Antunes, Arena et al. 2011). This study and the previous chapter indicate that the PG pathway is highly responsive to Salmonella infection. Therefore further experiments were designed to examine if this pathway played a role in the establishment of infection by Salmonella. This chapter shows that at 20 hours post-infection macrophages produce high levels of 15d-PGJ2 in response to Salmonella infection, which coincides with the previous data showing that 15d-PGJ2 is highly induced by Salmonella infection in mice. It was then hypothesized that the high level of 15d-PGJ2 production observed would likely have a significant effect during the course of infection. To test this, 15d-PGJ2 was added exogenously and its effects on Salmonella colonization of macrophages were monitored. 104  The data demonstrated a significant impact of 15d-PGJ2 on Salmonella burden and also showed a dose-dependent decrease in Salmonella colonization, clearly indicating that 15d-PGJ2 is sufficient to prevent bacterial colonization of macrophages. Some reports have claimed that 15d- PGJ2 treatment causes apoptosis in macrophages (Hortelano, Castrillo et al. 2000), and in fact at high concentrations of 15d-PGJ2 we did begin to see increased macrophage cell death (data not shown). Therefore, 2 µM 15d-PGJ2 was used in experiments because this was the lowest concentration at which a decrease in colonization was seen without an increase in cell death (Figure 4.4). The effect of 15d-PGJ2 on Salmonella colonization was not limited to RAW264.7 macrophages. In fact, 15d-PGJ2 reduced bacterial colonization in both J774 macrophages and bone marrow macrophages (BMMO) from C57BL/6 mice. BMMOs are considered more ‘physiologically relevant’, and are able to clear Salmonella more rapidly and effectively than RAW264.7 macrophages (data not shown). Surprisingly, 15d-PGJ2 did not affect Salmonella replication in HeLa epithelial cells. This could indicate that the 15d-PGJ2–induced resistance to Salmonella is cell type specific. It is possible that 15d-PGJ2 alters a macrophage specific response to bacteria, thus inhibiting bacterial infection.  It is interesting to note that Straus and colleagues (Straus, Pascual et al. 2000) found that 15d-PGJ2 had a dramatically different effect on NF-κB inhibition in RAW264.7 and HeLa cells. The Salmonella life cycle inside of these two cell types is also very different (Haraga, Ohlson et al. 2008) and this may be the reason for the significantly different responses. Previously published results indicate that 15d-PGJ2 is able to reduce the production of cytokines in response to LPS (Zingarelli, Sheehan et al. 2003, Surh, Na et al. 2011, Liu, Yu et al. 2012). Here, we show the same effect with live, replicating Salmonella. Specifically, we saw a 105  reduction in IL-10 production in 15d-PGJ2 treated cells. IL-10 is increased via a SPI2 dependent mechanism during Salmonella infection, and may inhibit ROS and RNS in macrophages (Eckmann and Kagnoff 2001, Uchiya, Groisman et al. 2004). A reduction in the amount of IL-6 and MCP-1 produced by macrophages treated with 15d-PGJ2 and infected with Salmonella was also seen. Interestingly, there was no change in IL-12, which can stimulate IFN-γ production (Eckmann and Kagnoff 2001). IFN-γ is very important for the defense against Salmonella, and is produced predominantly by NK cells and T cells (Eckmann and Kagnoff 2001). Since IFN-γ plays such an important role in anti-Salmonella defenses it was surprising to see that 15d-PGJ2 did not significantly alter either IL-12 or IFN-γ production. TNF-α, which is known to be important for anti-Salmonella defenses and is involved in triggering NO production (Eckmann and Kagnoff 2001, Coburn, Grassl et al. 2007), was decreased with 15d-PGJ2 treatment. Collectively, these data indicate a reduction in pro-inflammatory molecules. Similar to the results presented in this chapter, Cloutier et al. found that 15d-PGJ2 treatment reduced the production of IL-6, and TNFα in mice infected with the influenza virus, but also showed no effect on IFN-γ production (Cloutier, Marois et al. 2012). In addition, Kielian et al., showed that 15d-PGJ2 selectively inhibited the inflammatory response of microglia in response to S. aureus (Kielian, McMahon et al. 2004). This group showed 15d-PGJ2 dependent reduction in the production of IL-12p40, MCP1, and TNFα (Kielian, McMahon et al. 2004). Interestingly, there is increasing evidence that Salmonella induced inflammation can actually benefit the pathogen in both intestinal colonization and systemic disease. Stecher et al. showed that intestinal inflammation is both necessary and sufficient in allowing Salmonella to outcompete the microbiota (Stecher, Robbiani et al. 2007). More specifically, Winter and colleagues (2010) showed that Salmonella induced gut inflammation resulted in the production 106  of tetrathionate, which Salmonella is able to use as an electron acceptor, thus showing a mechanism by which inflammation benefits this pathogen (Winter, Thiennimitr et al. 2010). Salmonella also gains a growth advantage by the production of ethanolamine and nitrate, which Salmonella is able to utilize (Thiennimitr, Winter et al. 2011, Lopez, Winter et al. 2012). It was also recently shown that Salmonella induces the recruitment of neutrophils to the intestinal lumen (Gill, Ferreira et al. 2012). These neutrophils produce neutrophil elastase, which shifts the microbiota to favour Salmonella colonization (Gill, Ferreira et al. 2012).  At the systemic level, Arpaia and colleagues (2011) showed that TLR induced innate immunity in response to Salmonella induces virulence in the pathogen, allowing bacterial growth leading to systemic disease (Arpaia, Godec et al. 2011). These studies, like the one presented here, show that inflammation can actually be beneficial to Salmonella. Another immune mechanism generally considered to be critical to the host’s defense against Salmonella is the production of reactive nitrogen species (RNS). RNS are normally produced during Salmonella infection and are integral to bacterial killing as they modify components of the bacterial electron transport chain, metabolic enzymes, transcription factors, DNA, and DNA associated proteins (Bourret, Song et al. 2009, Shi, Chowdhury et al. 2009, Henard and Vazquez-Torres 2011). Furthermore, IFN-γ pretreated macrophages have a stronger RNS response to Salmonella than untreated macrophages (Henard and Vazquez-Torres 2011). Intriguingly, both a reduction in RNS as well as a reduction in Salmonella burden in 15d-PGJ2 treated macrophages was seen. In addition, this effect was seen in both untreated and IFN-γ treated macrophages, which is interesting given IFN-γ treated macrophages stronger RNS response. The reduction in RNS is also in line with the reduction in TNF-α that is caused by the addition of 15d-PGJ2. 107  The data presented here also indicates that the 15d-PGJ2 mediated changes in bacterial colonization are SPI2 independent. Initially the possibility of SPI2 involvement due to the apparent reduction in the inflammatory response of the macrophages was explored, but surprisingly SPI2 does not appear to be involved. The potential role of PPAR-γ in the 15d-PGJ2 mediated reduction in Salmonella colonization was examined. As expected, the effects of 15d- PGJ2 on bacterial colonization were PPAR-γ independent. Furthermore, RAW264.7 macrophages do not appear to produce physiologically relevant amounts of PPAR-γ (Ricote, Li et al. 1998). Research into the use of 15d-PGJ2 for the treatment of inflammatory diseases is already underway, and recently the use of nanocapsules as a mechanism of delivery has shown promise (Alves, de Melo et al. 2011, Napimoga, da Silva et al. 2012). In the future, the use of these or other delivery mechanisms may provide a way to effectively administer 15d-PGJ2 during Salmonella infection. Such research may provide insights into a novel mechanism of treating Salmonellosis and possibly other bacterial infections. This chapter suggests a new role of 15d- PGJ2, namely the control of Salmonella pathogenesis and replication within phagocytic immune cells. The role of 15d-PGJ2 in bacterial infections is poorly characterized, and this work lays the foundation for further research into this area.  4.9 Summary This chapter shows evidence for the role of 15d-PGJ2 in Salmonella infection of macrophages. 15d-PGJ2 is produced by macrophages in response to Salmonella infection. The addition of 15d-PGJ2 to infected macrophages results in reduced Salmonella colonization in RAW264.7, J774, and BMMO macrophages. Furthermore, the addition of 15d-PGJ2 reduces the 108  amount of IL-10, IL-6, TNF-α, MCP1, and RNS produced in response to infection. The reduction in colonization is independent of SPI1, SPI2, and PPAR-γ.   109  Chapter  5: Conclusion Since Salmonella cause morbidity and mortality in both developed and developing nations worldwide, as well as a major financial burden, the study of this bacterial pathogen is of great significance globally. Therefore, understanding the basic biology of Salmonella, and how it interacts with the host to cause disease is critical for developing new and more effective ways to combat this pathogen. Furthermore, Salmonella is a model organism, and much of what the scientific community has learned from studying Salmonella can be applied to other pathogens and diseases. Increased knowledge in this area will hopefully lead to improved treatments and vaccines for Salmonella, but also potentially for other pathogens and disease conditions.  In this thesis the interactions of Salmonella with the host were explored. This was done by constructing a panel of SPI2 mutants, and examining their effect on virulence in the murine typhoid model, epithelial cell culture model, and macrophage infection model. These SPI2 deletion strains were also studied for their effect on arachidonic acid metabolism. In addition, the involvement of 15d-PGJ2 in Salmonella infection was examined. A detailed discussion of the results from each of these studies is found at the ends of Chapters 2, 3, and 4. Therefore, this Conclusion explores the broader implications of this work.  In the literature, many studies have looked at SPI2 effectors; however most of these studies examine one or a few effectors in one or a few infection models. This makes comparison of effectors or models quite difficult. Therefore, the work presented in this thesis provides a tool for the Salmonella community to compare and contrast the roles of SPI2 effectors in both murine and cell culture models of infection. This information will be of use to researchers studying SPI2 and Salmonella pathogenesis. Already this work has been used by a variety of groups studying 110  the roles of SPI2 and Salmonella infection (Bueno, Riquelme et al. 2012, Malik-Kale, Winfree et al. 2012, Figueira, Watson et al. 2013).  The infectious disease community, and indeed much of the biology community, has for some time studied genomics and proteomics. Metabolomics, which is a growing field, enables researchers to determine how small molecules (the products and ligands of the proteome), are altered by infection. Metabolomics studies of Salmonella have revealed that many host metabolites are altered during infection (Antunes, Arena et al. 2011). These alterations have led to the identification of specific pathways that are affected by Salmonella infection.  In this thesis, the involvement of the arachidonic acid pathway in Salmonella infection, which was identified by metabolomics, was examined. Data is presented which confirms the involvement of arachidonic acid metabolism in Salmonella infection of macrophages. Specifically, the involvement of the leukotriene pathway was found to be down regulated in response to Salmonella infection, while the prostaglandin pathway was found to be upregulated. This finding is not surprising, as prostaglandins play a major role in inflammation and Salmonella causes significant inflammatory changes in the host. Salmonella has even evolved to induce and modulate the inflammatory response of the host for its own benefit. Since Salmonella SPI2-dependently modulates the host immune response, the effect of SPI2 deletion strains on the prostaglandin pathway were examined. Quite surprisingly, this study revealed that two of the SPI2 effectors, SseF and SseG, whose role in macrophage infection remains largely unknown, were found to modulate COX2 and PTGES expression, two proteins intricately involved in the production of all prostaglandins and prostaglandin E, respectively. This data, while surprising, is not without precedent, as another group found that COX2 induction was dependent on SPI2 (Uchiya and Nikai 2004), and the data presented in this thesis provides evidence that effectors 111  contributing to this are SseF and SseG. Some groups have seen a moderate decrease in replication of strains lacking sseF and sseG (Figueira, Watson et al. 2013); however, in the model and strains used in this thesis, no replication defect was seen.  Another area of this thesis showed that the addition of some of the downstream products of arachidonic acid metabolism were able to reduce bacterial colonization of macrophages. Specifically, 15d-PGJ2 was found to significantly reduce Salmonella colonization of macrophages. 15d-PGJ2, a relatively poorly studied member of the prostaglandin family, is associated with an anti-inflammatory response and the resolution of inflammation. It is currently even being studied as a treatment option for a variety of inflammatory diseases. However, the role of 15d-PGJ2 in bacterial infection is poorly studied. A small number of groups have looked at 15d-PGJ2 as a treatment option in reducing the extreme inflammatory response seen in sepsis (Guyton, Zingarelli et al. 2003, Zingarelli, Sheehan et al. 2003, Dugo, Collin et al. 2004, Reddy, Narala et al. 2008). Recently, the role of 15d-PGJ2 in H. pylori and influenza infection has been studied, and both groups found that this molecule reduced the inflammatory response to infection (Cha, Lim et al. 2011, Cloutier, Marois et al. 2012). In this thesis, the novel role of 15d-PGJ2 in modulating Salmonella infection was explored. This data indicates that 15d-PGJ2 is able to reduce Salmonella colonization in a concentration dependent manner, and that this occurs in macrophages, but not epithelial cells. Since 15d-PGJ2 reduces the inflammatory response, it is not surprising to see that it has an effect in macrophages, which play a critical role in Salmonella infection. The effect of 15d-PGJ2 appears to be independent of both SPI1 and SPI2. Taken together, the data presented in this thesis demonstrates a novel role for 15d-PGJ2 in Salmonella infection. This concept aligns with the prevailing thought that Salmonella controls the extent of inflammation it induces, as Salmonella infection leads to an increase in 15d-PGJ2 production, 112  which in turn reduces Salmonella colonization. Alternatively, it is possible that this is a mechanism that is successfully used by the host to control Salmonella replication.  Major findings from this thesis include providing a tool for direct comparison of SPI2 effectors, providing evidence for the role of SPI2 effectors in modulating the activity of the prostaglandin pathway, and a defining a previously unidentified role of a specific prostaglandin, 15d-PGJ2, in modulating Salmonella colonization.  5.1 Future directions This thesis addresses some of the aspects of Salmonella and specifically SPI2’s interactions with arachidonic acid metabolism, however many questions still remain. The work presented in Chapter 3 shows a novel phenotype for SseF and SseG. In the future, it would be interesting to characterize the mechanistic interactions of SseF and SseG with the prostaglandin pathway. Other groups have shown that deleting specific domains of SseF and SseG can alter their activities (Abrahams, Muller et al. 2006, Muller, Chikkaballi et al. 2012), therefore, these strains could be used in the COX2 induction model, to see which domains are responsible for the observed phenotype. The work in this thesis used relative expression levels as an indicator of PG pathway protein activity. Future experiments could look at the activity of these proteins, specifically COX2, during infection with the ΔsseF and ΔsseG strains. COX2 specific inhibitors may also prove beneficial in understanding the role of SseF and SseG in COX2 induction. It would also be interesting to look at the downstream products of COX2, and see how they are altered during infection with the ΔsseF and ΔsseG strains. In addition, it would be interesting to see if the SseF and SseG proteins are interacting with host proteins, specifically proteins in the 113  PG pathway. These experiments may help to reveal how SseF and SseG are inducing COX2 expression. In addition to following up the SseF and SseG phenotypes, it would be interesting to look more closely at some of the other metabolic pathways identified during the metabolomics screen performed in our lab. The work in Chapters 3 and 4 further characterizes what was seen in that initial screen. Our lab has also looked at another pathway identified in the metabolomics screen, and has published work characterizing the impact of bile and bile metabolism on Salmonella and Salmonella infection (Antunes, Andersen et al. 2011, Antunes, Wang et al. 2012). The multitude of other pathways identified should be carefully examined, first with literature and database searches, then experimentally. Chapter 4 describes a novel role for 15d-PGJ2 in Salmonella infection. To further characterize this, both mechanism and treatment options could be examined. To uncover more mechanistic aspects of the 15d-PGJ2 phenotypes, signaling pathways could be carefully examined. The NF-κB and Erk1/2 pathways have been shown to play a role in 15d-PGJ2 mediated effects (Castrillo, Diaz-Guerra et al. 2000, Rossi, Kapahi et al. 2000, Straus, Pascual et al. 2000, Guyton, Zingarelli et al. 2003, Zingarelli, Sheehan et al. 2003, Ruiz, Kim et al. 2004, Reddy, Narala et al. 2008, Cloutier, Marois et al. 2012). Therefore exploring the role of both NF- κB and ERK1/2 activity in the 15d-PGJ2 phenotypes identified here may provide excellent clues towards mechanism of action. Recent work has also shown the use of 15d-PGJ2 filled nanocapsules to be an efficacious delivery method (Alves, de Melo et al. 2011, Napimoga, da Silva et al. 2012). It would be interesting to perform mouse experiments using 15d-PGJ2 filled nanocapsules during Salmonella infection. A variety of mouse models of Salmonellosis are currently used in our lab, including 114  the typhoid model, the gastroenteritis model, and the chronic fibrosis model. It would be interesting to test 15d-PGJ2 nanocapsules in all of these models, and see what the outcome is. Bacterial counts, inflammation, and survival could all be used as read-outs. Because of 15d- PGJ2s anti-inflammatory role, it would be particularly interesting to see the effect in the fibrosis and gastroenteritis model, since these models are associated with extensive intestinal inflammation. In addition to work on Salmonella, it would be interesting to see if 15d-PGJ2 alters the outcome of infection using other bacteria. E. coli and C. rodentium  are pathogens commonly used in our lab, and the effect of 15d-PGJ2 could be examined with these other gastrointestinal pathogens. Hopefully future work will help to uncover the answers to many of the questions brought up by this thesis.    115  Bibliography  Abdo, H., M. M. Mahe, P. Derkinderen, K. Bach-Ngohou, M. Neunlist and B. Lardeux (2012). "The omega-6 fatty acid derivative 15-deoxy-Delta(1)(2),(1)(4)-prostaglandin J2 is involved in neuroprotection by enteric glial cells against oxidative stress." J Physiol 590(Pt 11): 2739-2750. Abrahams, G. L., P. Muller and M. Hensel (2006). "Functional dissection of SseF, a type III effector protein involved in positioning the salmonella-containing vacuole." Traffic 7(8): 950- 965. Achtman, M., J. Wain, F. X. Weill, S. Nair, Z. Zhou, V. Sangal, M. G. Krauland, J. L. Hale, H. Harbottle, A. Uesbeck, G. Dougan, L. H. Harrison, S. Brisse and S. E. M. S. Group (2012). "Multilocus sequence typing as a replacement for serotyping in Salmonella enterica." PLoS Pathog 8(6): e1002776. Alaniz, R. C., L. A. Cummings, M. A. Bergman, S. L. Rassoulian-Barrett and B. T. Cookson (2006). "Salmonella typhimurium coordinately regulates FliC location and reduces dendritic cell activation and antigen presentation to CD4+ T cells." J Immunol 177(6): 3983-3993. Alvarez-Ordonez, A., M. Begley, M. Prieto, W. Messens, M. Lopez, A. Bernardo and C. Hill (2011). "Salmonella spp. survival strategies within the host gastrointestinal tract." Microbiology 157(Pt 12): 3268-3281. Alves, C., N. de Melo, L. Fraceto, D. de Araujo and M. Napimoga (2011). "Effects of 15d- PGJ(2)-loaded poly(D,L-lactide-co-glycolide) nanocapsules on inflammation." Br J Pharmacol 162(3): 623-632. Amavisit, P., D. Lightfoot, G. F. Browning and P. F. Markham (2003). "Variation between pathogenic serovars within Salmonella pathogenicity islands." J Bacteriol 185(12): 3624-3635. Antunes, L. C., S. K. Andersen, A. Menendez, E. T. Arena, J. Han, R. B. Ferreira, C. H. Borchers and B. B. Finlay (2011). "Metabolomics reveals phospholipids as important nutrient sources during Salmonella growth in bile in vitro and in vivo." J Bacteriol 193(18): 4719-4725. Antunes, L. C., E. T. Arena, A. Menendez, J. Han, R. B. Ferreira, M. M. Buckner, P. Lolic, L. L. Madilao, J. Bohlmann, C. H. Borchers and B. B. Finlay (2011). "Impact of salmonella infection 116  on host hormone metabolism revealed by metabolomics." Infection and immunity 79(4): 1759- 1769. Antunes, L. C., E. T. Arena, A. Menendez, J. Han, R. B. Ferreira, M. M. Buckner, P. Lolic, L. L. Madilao, J. Bohlmann, C. H. Borchers and B. B. Finlay (2011). "The impact of Salmonella infection on host hormone metabolism revealed by metabolomics." Infect Immun. Antunes, L. C., M. M. Buckner, S. D. Auweter, R. B. Ferreira, P. Lolic and B. B. Finlay (2010). "Inhibition of Salmonella host cell invasion by dimethyl sulfide." Appl Environ Microbiol 76(15): 5300-5304. Antunes, L. C., M. Wang, S. K. Andersen, R. B. Ferreira, R. Kappelhoff, J. Han, C. H. Borchers and B. B. Finlay (2012). "Repression of Salmonella enterica phoP expression by small molecules from physiological bile." J Bacteriol 194(9): 2286-2296. Arpaia, N., J. Godec, L. Lau, K. E. Sivick, L. M. McLaughlin, M. B. Jones, T. Dracheva, S. N. Peterson, D. M. Monack and G. M. Barton (2011). "TLR signaling is required for Salmonella typhimurium virulence." Cell 144(5): 675-688. Audia, J. P., C. C. Webb and J. W. Foster (2001). "Breaking through the acid barrier: an orchestrated response to proton stress by enteric bacteria." Int J Med Microbiol 291(2): 97-106. Bakowski, M. A., J. T. Cirulis, N. F. Brown, B. B. Finlay and J. H. Brumell (2007). "SopD acts cooperatively with SopB during Salmonella enterica serovar Typhimurium invasion." Cell Microbiol 9(12): 2839-2855. Bell-Parikh, L. C., T. Ide, J. A. Lawson, P. McNamara, M. Reilly and G. A. FitzGerald (2003). "Biosynthesis of 15-deoxy-delta12,14-PGJ2 and the ligation of PPARgamma." J Clin Invest 112(6): 945-955. Bergsbaken, T., S. L. Fink and B. T. Cookson (2009). "Pyroptosis: host cell death and inflammation." Nat Rev Microbiol 7(2): 99-109. Beuzon, C. R. and D. W. Holden (2001). "Use of mixed infections with Salmonella strains to study virulence genes and their interactions in vivo." Microbes Infect 3(14-15): 1345-1352. 117  Beuzon, C. R., S. Meresse, K. E. Unsworth, J. Ruiz-Albert, S. Garvis, S. R. Waterman, T. A. Ryder, E. Boucrot and D. W. Holden (2000). "Salmonella maintains the integrity of its intracellular vacuole through the action of SifA." EMBO J 19(13): 3235-3249. Bishop, A. L., S. Baker, S. Jenks, M. Fookes, P. O. Gaora, D. Pickard, M. Anjum, J. Farrar, T. T. Hien, A. Ivens and G. Dougan (2005). "Analysis of the hypervariable region of the Salmonella enterica genome associated with tRNA(leuX)." J Bacteriol 187(7): 2469-2482. Bishwa, A., F. Angulo and M. Meltzer (2004). "Economic Burden of Salmonella Infections in the United States " American Agricultural Economics Association Annual Meeting, 2004. Blanc-Potard, A. B. and E. A. Groisman (1997). "The Salmonella selC locus contains a pathogenicity island mediating intramacrophage survival." EMBO J 16(17): 5376-5385. Blanc-Potard, A. B., F. Solomon, J. Kayser and E. A. Groisman (1999). "The SPI-3 pathogenicity island of Salmonella enterica." J Bacteriol 181(3): 998-1004. Bourret, T. J., M. Song and A. Vazquez-Torres (2009). "Codependent and independent effects of nitric oxide-mediated suppression of PhoPQ and Salmonella pathogenicity island 2 on intracellular Salmonella enterica serovar typhimurium survival." Infect Immun 77(11): 5107- 5115. Bowman, C. C. and K. L. Bost (2004). "Cyclooxygenase-2-mediated prostaglandin E2 production in mesenteric lymph nodes and in cultured macrophages and dendritic cells after infection with Salmonella." J Immunol 172(4): 2469-2475. Boyd, D., G. A. Peters, A. Cloeckaert, K. S. Boumedine, E. Chaslus-Dancla, H. Imberechts and M. R. Mulvey (2001). "Complete nucleotide sequence of a 43-kilobase genomic island associated with the multidrug resistance region of Salmonella enterica serovar Typhimurium DT104 and its identification in phage type DT120 and serovar Agona." J Bacteriol 183(19): 5725-5732. Boyd, E. F., F. S. Wang, T. S. Whittam and R. K. Selander (1996). "Molecular genetic relationships of the salmonellae." Appl Environ Microbiol 62(3): 804-808. Brown, N. F., B. K. Coombes, J. L. Bishop, M. E. Wickham, M. J. Lowden, O. Gal-Mor, D. L. Goode, E. C. Boyle, K. L. Sanderson and B. B. Finlay (2011). "Salmonella Phage ST64B Encodes a Member of the SseK/NleB Effector Family." PLoS One 6(3): e17824. 118  Brown, N. F., J. Szeto, X. Jiang, B. K. Coombes, B. B. Finlay and J. H. Brumell (2006). "Mutational analysis of Salmonella translocated effector members SifA and SopD2 reveals domains implicated in translocation, subcellular localization and function." Microbiology 152(Pt 8): 2323-2343. Brown, N. F., B. A. Vallance, B. K. Coombes, Y. Valdez, B. A. Coburn and B. B. Finlay (2005). "Salmonella pathogenicity island 2 is expressed prior to penetrating the intestine." PLoS Pathog 1(3): e32. Browne, S. H., P. Hasegawa, S. Okamoto, J. Fierer and D. G. Guiney (2008). "Identification of Salmonella SPI-2 secretion system components required for SpvB-mediated cytotoxicity in macrophages and virulence in mice." FEMS Immunol Med Microbiol 52(2): 194-201. Broz, P., K. Newton, M. Lamkanfi, S. Mariathasan, V. M. Dixit and D. M. Monack (2010). "Redundant roles for inflammasome receptors NLRP3 and NLRC4 in host defense against Salmonella." J Exp Med 207(8): 1745-1755. Broz, P., M. B. Ohlson and D. M. Monack (2012). "Innate immune response to Salmonella typhimurium, a model enteric pathogen." Gut Microbes 3(2): 62-70. Brumell, J. H., D. L. Goosney and B. B. Finlay (2002). "SifA, a type III secreted effector of Salmonella typhimurium, directs Salmonella-induced filament (Sif) formation along microtubules." Traffic 3(6): 407-415. Brumell, J. H., C. M. Rosenberger, G. T. Gotto, S. L. Marcus and B. B. Finlay (2001). "SifA permits survival and replication of Salmonella typhimurium in murine macrophages." Cell Microbiol 3(2): 75-84. Buchwald, D. S. and M. J. Blaser (1984). "A review of human salmonellosis: II. Duration of excretion following infection with nontyphi Salmonella." Rev Infect Dis 6(3): 345-356. Buckner, M. M., M. A. Croxen, E. T. Arena and B. B. Finlay (2011). "A comprehensive study of the contribution of Salmonella enterica serovar Typhimurium SPI2 effectors to bacterial colonization, survival, and replication in typhoid fever, macrophage, and epithelial cell infection models." Virulence 2(3): 208-216. 119  Bueno, S. M., S. Riquelme, C. A. Riedel and A. M. Kalergis (2012). "Mechanisms used by virulent Salmonella to impair dendritic cell function and evade adaptive immunity." Immunology 137(1): 28-36. Bui, T. and D. S. Straus (1998). "Effects of cyclopentenone prostaglandins and related compounds on insulin-like growth factor-I and Waf1 gene expression." Biochim Biophys Acta 1397(1): 31-42. Cannon, C. P. and P. J. Cannon (2012). "Physiology. COX-2 inhibitors and cardiovascular risk." Science 336(6087): 1386-1387. Castrillo, A., M. J. Diaz-Guerra, S. Hortelano, P. Martin-Sanz and L. Bosca (2000). "Inhibition of IkappaB kinase and IkappaB phosphorylation by 15-deoxy-Delta(12,14)-prostaglandin J(2) in activated murine macrophages." Mol Cell Biol 20(5): 1692-1698. Castrillo, A., M. Mojena, S. Hortelano and L. Bosca (2001). "Peroxisome proliferator-activated receptor-gamma-independent inhibition of macrophage activation by the non-thiazolidinedione agonist L-796,449. Comparison with the effects of 15-deoxy-delta(12,14)-prostaglandin J(2)." J Biol Chem 276(36): 34082-34088. CDC. (2013). "Tracking and reporting foodborne disease outbreaks." from http://www.cdc.gov/features/dsfoodborneoutbreaks/. Cha, B., J. W. Lim, K. H. Kim and H. Kim (2011). "15-deoxy-D12,14-prostaglandin J2 suppresses RANTES expression by inhibiting NADPH oxidase activation in Helicobacter pylori- infected gastric epithelial cells." J Physiol Pharmacol 62(2): 167-174. Chai, S. J., P. L. White, S. L. Lathrop, S. M. Solghan, C. Medus, B. M. McGlinchey, M. Tobin- D'Angelo, R. Marcus and B. E. Mahon (2012). "Salmonella enterica serotype Enteritidis: increasing incidence of domestically acquired infections." Clin Infect Dis 54 Suppl 5: S488-497. Chakravortty, D., I. Hansen-Wester and M. Hensel (2002). "Salmonella pathogenicity island 2 mediates protection of intracellular Salmonella from reactive nitrogen intermediates." J Exp Med 195(9): 1155-1166. Chan, K., S. Baker, C. C. Kim, C. S. Detweiler, G. Dougan and S. Falkow (2003). "Genomic comparison of Salmonella enterica serovars and Salmonella bongori by use of an S. enterica serovar typhimurium DNA microarray." J Bacteriol 185(2): 553-563. 120  Cheminay, C., A. Mohlenbrink and M. Hensel (2005). "Intracellular Salmonella inhibit antigen presentation by dendritic cells." J Immunol 174(5): 2892-2899. Chu, C. and C. H. Chiu (2006). "Evolution of the virulence plasmids of non-typhoid Salmonella and its association with antimicrobial resistance." Microbes Infect 8(7): 1931-1936. Cloutier, A., I. Marois, D. Cloutier, C. Verreault, A. M. Cantin and M. V. Richter (2012). "The prostanoid 15-deoxy-Delta12,14-prostaglandin-j2 reduces lung inflammation and protects mice against lethal influenza infection." J Infect Dis 205(4): 621-630. Coburn, B., G. A. Grassl and B. B. Finlay (2007). "Salmonella, the host and disease: a brief review." Immunol Cell Biol 85(2): 112-118. Coombes, B. K., M. J. Lowden, J. L. Bishop, M. E. Wickham, N. F. Brown, N. Duong, S. Osborne, O. Gal-Mor and B. B. Finlay (2007). "SseL is a salmonella-specific translocated effector integrated into the SsrB-controlled salmonella pathogenicity island 2 type III secretion system." Infect Immun 75(2): 574-580. Coombes, B. K., M. E. Wickham, N. F. Brown, S. Lemire, L. Bossi, W. W. Hsiao, F. S. Brinkman and B. B. Finlay (2005). "Genetic and molecular analysis of GogB, a phage-encoded type III-secreted substrate in Salmonella enterica serovar typhimurium with autonomous expression from its associated phage." J Mol Biol 348(4): 817-830. Coombes, B. K., M. E. Wickham, M. J. Lowden, N. F. Brown and B. B. Finlay (2005). "Negative regulation of Salmonella pathogenicity island 2 is required for contextual control of virulence during typhoid." Proc Natl Acad Sci U S A 102(48): 17460-17465. Crosa, J. H., D. J. Brenner, W. H. Ewing and S. Falkow (1973). "Molecular relationships among the Salmonelleae." J Bacteriol 115(1): 307-315. Crosby, M. B., J. L. Svenson, J. Zhang, C. J. Nicol, F. J. Gonzalez and G. S. Gilkeson (2005). "Peroxisome proliferation-activated receptor (PPAR)gamma is not necessary for synthetic PPARgamma agonist inhibition of inducible nitric-oxide synthase and nitric oxide." J Pharmacol Exp Ther 312(1): 69-76. Croxen, M. A., G. Sisson, R. Melano and P. S. Hoffman (2006). "The Helicobacter pylori chemotaxis receptor TlpB (HP0103) is required for pH taxis and for colonization of the gastric mucosa." J Bacteriol 188(7): 2656-2665. 121  Crump, J. A. and E. D. Mintz (2010). "Global trends in typhoid and paratyphoid Fever." Clin Infect Dis 50(2): 241-246. De Groote, M. A., U. A. Ochsner, M. U. Shiloh, C. Nathan, J. M. McCord, M. C. Dinauer, S. J. Libby, A. Vazquez-Torres, Y. Xu and F. C. Fang (1997). "Periplasmic superoxide dismutase protects Salmonella from products of phagocyte NADPH-oxidase and nitric oxide synthase." Proc Natl Acad Sci U S A 94(25): 13997-14001. de Jong, H. K., C. M. Parry, T. van der Poll and W. J. Wiersinga (2012). "Host-pathogen interaction in invasive Salmonellosis." PLoS Pathog 8(10): e1002933. Deiwick, J., S. P. Salcedo, E. Boucrot, S. M. Gilliland, T. Henry, N. Petermann, S. R. Waterman, J. P. Gorvel, D. W. Holden and S. Meresse (2006). "The translocated Salmonella effector proteins SseF and SseG interact and are required to establish an intracellular replication niche." Infect Immun 74(12): 6965-6972. Dobrindt, U., B. Hochhut, U. Hentschel and J. Hacker (2004). "Genomic islands in pathogenic and environmental microorganisms." Nat Rev Microbiol 2(5): 414-424. Doublet, B., D. Boyd, M. R. Mulvey and A. Cloeckaert (2005). "The Salmonella genomic island 1 is an integrative mobilizable element." Mol Microbiol 55(6): 1911-1924. Doublet, B., K. Praud, F. X. Weill and A. Cloeckaert (2009). "Association of IS26-composite transposons and complex In4-type integrons generates novel multidrug resistance loci in Salmonella genomic island 1." J Antimicrob Chemother 63(2): 282-289. Dougan, G., V. John, S. Palmer and P. Mastroeni (2011). "Immunity to salmonellosis." Immunol Rev 240(1): 196-210. Dugo, L., M. Collin, S. Cuzzocrea and C. Thiemermann (2004). "15d-prostaglandin J2 reduces multiple organ failure caused by wall-fragment of Gram-positive and Gram-negative bacteria." Eur J Pharmacol 498(1-3): 295-301. Dumont, A., E. Boucrot, S. Drevensek, V. Daire, J. P. Gorvel, C. Pous, D. W. Holden and S. Meresse (2010). "SKIP, the host target of the Salmonella virulence factor SifA, promotes kinesin-1-dependent vacuolar membrane exchanges." Traffic 11(7): 899-911. 122  Eckmann, L. and M. F. Kagnoff (2001). "Cytokines in host defense against Salmonella." Microbes Infect 3(14-15): 1191-1200. Edwards, R. A., L. H. Keller and D. M. Schifferli (1998). "Improved allelic exchange vectors and their use to analyze 987P fimbria gene expression." Gene 207(2): 149-157. Edwards, R. A., G. J. Olsen and S. R. Maloy (2002). "Comparative genomics of closely related salmonellae." Trends Microbiol 10(2): 94-99. Effa, E. E., Z. S. Lassi, J. A. Critchley, P. Garner, D. Sinclair, P. L. Olliaro and Z. A. Bhutta (2011). "Fluoroquinolones for treating typhoid and paratyphoid fever (enteric fever)." Cochrane Database Syst Rev(10): CD004530. Eichelberg, K. and J. E. Galan (1999). "Differential regulation of Salmonella typhimurium type III secreted proteins by pathogenicity island 1 (SPI-1)-encoded transcriptional activators InvF and hilA." Infect Immun 67(8): 4099-4105. Ellermeier, J. R. and J. M. Slauch (2007). "Adaptation to the host environment: regulation of the SPI1 type III secretion system in Salmonella enterica serovar Typhimurium." Curr Opin Microbiol 10(1): 24-29. Everest, P., M. Roberts and G. Dougan (1998). "Susceptibility to Salmonella typhimurium infection and effectiveness of vaccination in mice deficient in the tumor necrosis factor alpha p55 receptor." Infect Immun 66(7): 3355-3364. Everest, P., J. Wain, M. Roberts, G. Rook and G. Dougan (2001). "The molecular mechanisms of severe typhoid fever." Trends Microbiol 9(7): 316-320. Fang, F. C. (2011). "Antimicrobial actions of reactive oxygen species." MBio 2(5). Ferreira, R. B., M. M. Buckner and B. B. Finlay (2012). Genome plasticity in Salmonella enterica and its relevance to host-pathogen interactions. Genome Plasticity and Infectious Disease. J. Hacker, J. Kaper, R. Kurth and U. Dobrindt. Washington, DC, ASM Press. Ferreira, R. B., N. Gill, B. P. Willing, L. C. Antunes, S. L. Russell, M. A. Croxen and B. B. Finlay (2011). "The intestinal microbiota plays a role in Salmonella-induced colitis independent of pathogen colonization." PLoS One 6(5): e20338. 123  Fierer, J. and D. G. Guiney (2001). "Diverse virulence traits underlying different clinical outcomes of Salmonella infection." J Clin Invest 107(7): 775-780. Figueira, R., K. G. Watson, D. W. Holden and S. Helaine (2013). "Identification of Salmonella Pathogenicity Island-2 Type III Secretion System Effectors Involved in Intramacrophage Replication of S. enterica Serovar Typhimurium: Implications for Rational Vaccine Design." MBio 4(2). Figueroa-Bossi, N. and L. Bossi (1999). "Inducible prophages contribute to Salmonella virulence in mice." Mol Microbiol 33(1): 167-176. Figueroa-Bossi, N., S. Uzzau, D. Maloriol and L. Bossi (2001). "Variable assortment of prophages provides a transferable repertoire of pathogenic determinants in Salmonella." Mol Microbiol 39(2): 260-271. Freeman, J. A., M. E. Ohl and S. I. Miller (2003). "The Salmonella enterica serovar typhimurium translocated effectors SseJ and SifB are targeted to the Salmonella-containing vacuole." Infect Immun 71(1): 418-427. Freeman, J. A., C. Rappl, V. Kuhle, M. Hensel and S. I. Miller (2002). "SpiC is required for translocation of Salmonella pathogenicity island 2 effectors and secretion of translocon proteins SseB and SseC." J Bacteriol 184(18): 4971-4980. Funk, C. D. (2001). "Prostaglandins and leukotrienes: advances in eicosanoid biology." Science 294(5548): 1871-1875. Galan, J. E. (2001). "Salmonella interactions with host cells: type III secretion at work." Annu Rev Cell Dev Biol 17: 53-86. Gallois, A., J. R. Klein, L. A. Allen, B. D. Jones and W. M. Nauseef (2001). "Salmonella pathogenicity island 2-encoded type III secretion system mediates exclusion of NADPH oxidase assembly from the phagosomal membrane." J Immunol 166(9): 5741-5748. Garcia-del Portillo, F., M. B. Zwick, K. Y. Leung and B. B. Finlay (1993). "Intracellular replication of Salmonella within epithelial cells is associated with filamentous structures containing lysosomal membrane glycoproteins." Infect Agents Dis 2(4): 227-231. 124  Geddes, K., M. Worley, G. Niemann and F. Heffron (2005). "Identification of new secreted effectors in Salmonella enterica serovar Typhimurium." Infect Immun 73(10): 6260-6271. Gewirtz, A. T., T. A. Navas, S. Lyons, P. J. Godowski and J. L. Madara (2001). "Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression." J Immunol 167(4): 1882-1885. Ghosh, D. K., M. A. Misukonis, C. Reich, D. S. Pisetsky and J. B. Weinberg (2001). "Host response to infection: the role of CpG DNA in induction of cyclooxygenase 2 and nitric oxide synthase 2 in murine macrophages." Infect Immun 69(12): 7703-7710. Ghosh, M., D. E. Tucker, S. A. Burchett and C. C. Leslie (2006). "Properties of the Group IV phospholipase A2 family." Prog Lipid Res 45(6): 487-510. Gill, N., R. B. Ferreira, L. C. Antunes, B. P. Willing, I. Sekirov, F. Al-Zahrani, M. Hartmann and B. B. Finlay (2012). "Neutrophil elastase alters the murine gut microbiota resulting in enhanced Salmonella colonization." PLoS One 7(11): e49646. Gill, N., B. Reilly and J. Threfall (2005). "Surveillance of enteric pathogens in Europe and beyond." Enter-Net Annual Report 2005: 1-197. Gilroy, D. W., P. R. Colville-Nash, D. Willis, J. Chivers, M. J. Paul-Clark and D. A. Willoughby (1999). "Inducible cyclooxygenase may have anti-inflammatory properties." Nat Med 5(6): 698- 701. Ginocchio, C. C., K. Rahn, R. C. Clarke and J. E. Galan (1997). "Naturally occurring deletions in the centisome 63 pathogenicity island of environmental isolates of Salmonella spp." Infect Immun 65(4): 1267-1272. Gonzalez-Escobedo, G., J. M. Marshall and J. S. Gunn (2011). "Chronic and acute infection of the gall bladder by Salmonella Typhi: understanding the carrier state." Nat Rev Microbiol 9(1): 9-14. Gordon, M. A., H. T. Banda, M. Gondwe, S. B. Gordon, M. J. Boeree, A. L. Walsh, J. E. Corkill, C. A. Hart, C. F. Gilks and M. E. Molyneux (2002). "Non-typhoidal salmonella bacteraemia among HIV-infected Malawian adults: high mortality and frequent recrudescence." AIDS 16(12): 1633-1641. 125  Gorvel, J. P. and S. Meresse (2001). "Maturation steps of the Salmonella-containing vacuole." Microbes Infect 3(14-15): 1299-1303. Grant, A. J., O. Restif, T. J. McKinley, M. Sheppard, D. J. Maskell and P. Mastroeni (2008). "Modelling within-host spatiotemporal dynamics of invasive bacterial disease." PLoS Biol 6(4): e74. Grassl, G. A., Y. Valdez, K. S. Bergstrom, B. A. Vallance and B. B. Finlay (2008). "Chronic enteric salmonella infection in mice leads to severe and persistent intestinal fibrosis." Gastroenterology 134(3): 768-780. Guy, R. L., L. A. Gonias and M. A. Stein (2000). "Aggregation of host endosomes by Salmonella requires SPI2 translocation of SseFG and involves SpvR and the fms-aroE intragenic region." Mol Microbiol 37(6): 1417-1435. Guyton, K., B. Zingarelli, S. Ashton, G. Teti, G. Tempel, C. Reilly, G. Gilkeson, P. Halushka and J. Cook (2003). "Peroxisome proliferator-activated receptor-gamma agonists modulate macrophage activation by gram-negative and gram-positive bacterial stimuli." Shock 20(1): 56- 62. Halici, S., S. F. Zenk, J. Jantsch and M. Hensel (2008). "Functional analysis of the Salmonella pathogenicity island 2-mediated inhibition of antigen presentation in dendritic cells." Infect Immun 76(11): 4924-4933. Han, Z., T. Zhu, X. Liu, C. Li, S. Yue, X. Liu, L. Yang, L. Yang and L. Li (2012). "15-deoxy- Delta12,14 -prostaglandin J2 reduces recruitment of bone marrow-derived monocyte/macrophages in chronic liver injury in mice." Hepatology 56(1): 350-360. Haraga, A., M. B. Ohlson and S. I. Miller (2008). "Salmonellae interplay with host cells." Nat Rev Microbiol 6(1): 53-66. Henard, C. A. and A. Vazquez-Torres (2011). "Nitric oxide and salmonella pathogenesis." Front Microbiol 2: 84. Hensel, M. (2005). Pathogenicity islands and virulence of Salmonella enterica. 'Salmonella' Infections: Clinical, Immunological and Molecular Aspects. P. a. M. Mastroeni, D., Cambridge University Press: 146-167. 126  Hensel, M., T. Nikolaus and C. Egelseer (1999). "Molecular and functional analysis indicates a mosaic structure of Salmonella pathogenicity island 2." Mol Microbiol 31(2): 489-498. Hensel, M., J. E. Shea, A. J. Baumler, C. Gleeson, F. Blattner and D. W. Holden (1997). "Analysis of the boundaries of Salmonella pathogenicity island 2 and the corresponding chromosomal region of Escherichia coli K-12." J Bacteriol 179(4): 1105-1111. Ho, T. D., N. Figueroa-Bossi, M. Wang, S. Uzzau, L. Bossi and J. M. Slauch (2002). "Identification of GtgE, a novel virulence factor encoded on the Gifsy-2 bacteriophage of Salmonella enterica serovar Typhimurium." J Bacteriol 184(19): 5234-5239. Hochmann, H., S. Pust, G. von Figura, K. Aktories and H. Barth (2006). "Salmonella enterica SpvB ADP-ribosylates actin at position arginine-177-characterization of the catalytic domain within the SpvB protein and a comparison to binary clostridial actin-ADP-ribosylating toxins." Biochemistry 45(4): 1271-1277. Hohmann, E. L. (2001). "Nontyphoidal salmonellosis." Clin Infect Dis 32(2): 263-269. Hoiseth, S. K. and B. A. Stocker (1981). "Aromatic-dependent Salmonella typhimurium are non- virulent and effective as live vaccines." Nature 291(5812): 238-239. Hortelano, S., A. Castrillo, A. M. Alvarez and L. Bosca (2000). "Contribution of cyclopentenone prostaglandins to the resolution of inflammation through the potentiation of apoptosis in activated macrophages." J Immunol 165(11): 6525-6531. Hu, Q., B. Coburn, W. Deng, Y. Li, X. Shi, Q. Lan, B. Wang, B. K. Coombes and B. B. Finlay (2008). "Salmonella enterica serovar Senftenberg human clinical isolates lacking SPI-1." J Clin Microbiol 46(4): 1330-1336. Ikeda, K., K. Tanaka and M. Katori (1975). "Potentiation of bradykinin-induced vascular permeability increase by prostaglandin E2 and arachidonic acid in rabbit skin." Prostaglandins 10(5): 747-758. Iwahashi, H., A. Takeshita and S. Hanazawa (2000). "Prostaglandin E2 stimulates AP-1- mediated CD14 expression in mouse macrophages via cyclic AMP-dependent protein kinase A." J Immunol 164(10): 5403-5408. 127  Jackson, L. K., P. Nawabi, C. Hentea, E. A. Roark and K. Haldar (2008). "The Salmonella virulence protein SifA is a G protein antagonist." Proc Natl Acad Sci U S A 105(37): 14141- 14146. Jantsch, J., C. Cheminay, D. Chakravortty, T. Lindig, J. Hein and M. Hensel (2003). "Intracellular activities of Salmonella enterica in murine dendritic cells." Cell Microbiol 5(12): 933-945. Jantsch, J., D. Chikkaballi and M. Hensel (2011). "Cellular aspects of immunity to intracellular Salmonella enterica." Immunol Rev 240(1): 185-195. Jiang, C., A. T. Ting and B. Seed (1998). "PPAR-gamma agonists inhibit production of monocyte inflammatory cytokines." Nature 391(6662): 82-86. Jones, B. D., N. Ghori and S. Falkow (1994). "Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches." J Exp Med 180(1): 15-23. Kaiser, P., M. Diard, B. Stecher and W. D. Hardt (2012). "The streptomycin mouse model for Salmonella diarrhea: functional analysis of the microbiota, the pathogen's virulence factors, and the host's mucosal immune response." Immunol Rev 245(1): 56-83. Kansanen, E., A. M. Kivela and A. L. Levonen (2009). "Regulation of Nrf2-dependent gene expression by 15-deoxy-Delta12,14-prostaglandin J2." Free Radic Biol Med 47(9): 1310-1317. Kawai, T. and S. Akira (2010). "The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors." Nat Immunol 11(5): 373-384. Kehres, D. G., M. L. Zaharik, B. B. Finlay and M. E. Maguire (2000). "The NRAMP proteins of Salmonella typhimurium and Escherichia coli are selective manganese transporters involved in the response to reactive oxygen." Mol Microbiol 36(5): 1085-1100. Kelly, B. G. V., A.; Bolton, D.J. (2009). "Gene transfer events and their occurence in selected environments." Food Chem Toxicol 47(5): 978-983. Kielian, T., M. McMahon, E. D. Bearden, A. C. Baldwin, P. D. Drew and N. Esen (2004). "S. aureus-dependent microglial activation is selectively attenuated by the cyclopentenone 128  prostaglandin 15-deoxy-Delta12,14- prostaglandin J2 (15d-PGJ2)." J Neurochem 90(5): 1163- 1172. Kim, J. G. and Y. S. Hahn (2000). "IFN-gamma inhibits the suppressive effects of PGE2 on the production of tumor necrosis factor-alpha by mouse macrophages." Immunol Invest 29(3): 257- 269. Kingsley, R. A., Baumler, A.J. (2002). Pathogenicity Islands and Host Adaptation of Salmonella serovars. Pathogenicity Islands and the Evolution of Pathogenic Microbes. J. Hacker, Kaper, J.B., Springer. 1: 67-87. Knodler, L. A., J. Celli, W. D. Hardt, B. A. Vallance, C. Yip and B. B. Finlay (2002). "Salmonella effectors within a single pathogenicity island are differentially expressed and translocated by separate type III secretion systems." Mol Microbiol 43(5): 1089-1103. Knodler, L. A. and O. Steele-Mortimer (2005). "The Salmonella effector PipB2 affects late endosome/lysosome distribution to mediate Sif extension." Mol Biol Cell 16(9): 4108-4123. Knodler, L. A., B. A. Vallance, J. Celli, S. Winfree, B. Hansen, M. Montero and O. Steele- Mortimer (2010). "Dissemination of invasive Salmonella via bacterial-induced extrusion of mucosal epithelia." Proc Natl Acad Sci U S A 107(41): 17733-17738. Kofoed, E. M. and R. E. Vance (2012). "NAIPs: building an innate immune barrier against bacterial pathogens. NAIPs function as sensors that initiate innate immunity by detection of bacterial proteins in the host cell cytosol." Bioessays 34(7): 589-598. Kohbata, S., H. Yokoyama and E. Yabuuchi (1986). "Cytopathogenic effect of Salmonella typhi GIFU 10007 on M cells of murine ileal Peyer's patches in ligated ileal loops: an ultrastructural study." Microbiol Immunol 30(12): 1225-1237. Krishnakumar, R., B. Kim, E. A. Mollo, J. A. Imlay and J. M. Slauch (2007). "Structural properties of periplasmic SodCI that correlate with virulence in Salmonella enterica serovar Typhimurium." J Bacteriol 189(12): 4343-4352. Kropinski, A. M., A. Sulakvelidze, P. Konczy and C. Poppe (2007). "Salmonella phages and prophages--genomics and practical aspects." Methods Mol Biol 394: 133-175. 129  Kuhle, V. and M. Hensel (2002). "SseF and SseG are translocated effectors of the type III secretion system of Salmonella pathogenicity island 2 that modulate aggregation of endosomal compartments." Cell Microbiol 4(12): 813-824. Kuhle, V. and M. Hensel (2004). "Cellular microbiology of intracellular Salmonella enterica: functions of the type III secretion system encoded by Salmonella pathogenicity island 2." Cell Mol Life Sci 61(22): 2812-2826. Kuhle, V., D. Jackel and M. Hensel (2004). "Effector proteins encoded by Salmonella pathogenicity island 2 interfere with the microtubule cytoskeleton after translocation into host cells." Traffic 5(5): 356-370. Kujat Choy, S. L., E. C. Boyle, O. Gal-Mor, D. L. Goode, Y. Valdez, B. A. Vallance and B. B. Finlay (2004). "SseK1 and SseK2 are novel translocated proteins of Salmonella enterica serovar typhimurium." Infect Immun 72(9): 5115-5125. Lara-Tejero, M. and J. E. Galan (2009). "Salmonella enterica serovar typhimurium pathogenicity island 1-encoded type III secretion system translocases mediate intimate attachment to nonphagocytic cells." Infect Immun 77(7): 2635-2642. Lara-Tejero, M., F. S. Sutterwala, Y. Ogura, E. P. Grant, J. Bertin, A. J. Coyle, R. A. Flavell and J. E. Galan (2006). "Role of the caspase-1 inflammasome in Salmonella typhimurium pathogenesis." J Exp Med 203(6): 1407-1412. Lawley, T. D., D. M. Bouley, Y. E. Hoy, C. Gerke, D. A. Relman and D. M. Monack (2008). "Host transmission of Salmonella enterica serovar Typhimurium is controlled by virulence factors and indigenous intestinal microbiota." Infect Immun 76(1): 403-416. Le Minor, L. (1988). "Typing of Salmonella species." Eur J Clin Microbiol Infect Dis 7(2): 214- 218. Lee, C. A., B. D. Jones and S. Falkow (1992). "Identification of a Salmonella typhimurium invasion locus by selection for hyperinvasive mutants." Proc Natl Acad Sci U S A 89(5): 1847- 1851. Lee, M. B. and J. D. Greig (2012). "A review of nosocomial Salmonella outbreaks: infection control interventions found effective." Public Health 127(3): 199-206. 130  Lesnick, M. L., N. E. Reiner, J. Fierer and D. G. Guiney (2001). "The Salmonella spvB virulence gene encodes an enzyme that ADP-ribosylates actin and destabilizes the cytoskeleton of eukaryotic cells." Mol Microbiol 39(6): 1464-1470. Lightfield, K. L., J. Persson, S. W. Brubaker, C. E. Witte, J. von Moltke, E. A. Dunipace, T. Henry, Y. H. Sun, D. Cado, W. F. Dietrich, D. M. Monack, R. M. Tsolis and R. E. Vance (2008). "Critical function for Naip5 in inflammasome activation by a conserved carboxy-terminal domain of flagellin." Nat Immunol 9(10): 1171-1178. Lilic, M. and C. E. Stebbins (2004). "Re-structuring the host cell: up close with Salmonella's molecular machinery." Microbes Infect 6(13): 1205-1211. Liu, X., H. Yu, L. Yang, C. Li and L. Li (2012). "15-Deoxy-Delta(12,14)-prostaglandin J(2) attenuates the biological activities of monocyte/macrophage cell lines." Eur J Cell Biol 91(8): 654-661. Lopez, C. A., S. E. Winter, F. Rivera-Chavez, M. N. Xavier, V. Poon, S. P. Nuccio, R. M. Tsolis and A. J. Baumler (2012). "Phage-mediated acquisition of a type III secreted effector protein boosts growth of salmonella by nitrate respiration." MBio 3(3). Lutz, R. and H. Bujard (1997). "Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements." Nucleic Acids Res 25(6): 1203-1210. Ly, K. T. and J. E. Casanova (2007). "Mechanisms of Salmonella entry into host cells." Cell Microbiol 9(9): 2103-2111. MacFarlane, A. S., M. G. Schwacha and T. K. Eisenstein (1999). "In vivo blockage of nitric oxide with aminoguanidine inhibits immunosuppression induced by an attenuated strain of Salmonella typhimurium, potentiates Salmonella infection, and inhibits macrophage and polymorphonuclear leukocyte influx into the spleen." Infect Immun 67(2): 891-898. Majowicz, S. E., W. B. McNab, P. Sockett, T. S. Henson, K. Dore, V. L. Edge, M. C. Buffett, A. Fazil, S. Read, S. McEwen, D. Stacey and J. B. Wilson (2006). "Burden and cost of gastroenteritis in a Canadian community." J Food Prot 69(3): 651-659. 131  Majowicz, S. E., J. Musto, E. Scallan, F. J. Angulo, M. Kirk, S. J. O'Brien, T. F. Jones, A. Fazil, R. M. Hoekstra and S. International Collaboration on Enteric Disease 'Burden of Illness (2010). "The global burden of nontyphoidal Salmonella gastroenteritis." Clin Infect Dis 50(6): 882-889. Malik-Kale, P., S. Winfree and O. Steele-Mortimer (2012). "The bimodal lifestyle of intracellular Salmonella in epithelial cells: replication in the cytosol obscures defects in vacuolar replication." PLoS One 7(6): e38732. Marcus, S. L., J. H. Brumell, C. G. Pfeifer and B. B. Finlay (2000). "Salmonella pathogenicity islands: big virulence in small packages." Microbes Infect 2(2): 145-156. Mastroeni, P. and A. J. Grant (2011). "Spread of Salmonella enterica in the body during systemic infection: unravelling host and pathogen determinants." Expert Rev Mol Med 13: e12. Mastroeni, P., B. Villarreal-Ramos and C. E. Hormaeche (1993). "Effect of late administration of anti-TNF alpha antibodies on a Salmonella infection in the mouse model." Microb Pathog 14(6): 473-480. Matsui, H., C. M. Bacot, W. A. Garlington, T. J. Doyle, S. Roberts and P. A. Gulig (2001). "Virulence plasmid-borne spvB and spvC genes can replace the 90-kilobase plasmid in conferring virulence to Salmonella enterica serovar Typhimurium in subcutaneously inoculated mice." J Bacteriol 183(15): 4652-4658. Matsuoka, T. and S. Narumiya (2008). "The roles of prostanoids in infection and sickness behaviors." J Infect Chemother 14(4): 270-278. McCollister, B. D., T. J. Bourret, R. Gill, J. Jones-Carson and A. Vazquez-Torres (2005). "Repression of SPI2 transcription by nitric oxide-producing, IFNgamma-activated macrophages promotes maturation of Salmonella phagosomes." J Exp Med 202(5): 625-635. McGhie, E. J., L. C. Brawn, P. J. Hume, D. Humphreys and V. Koronakis (2009). "Salmonella takes control: effector-driven manipulation of the host." Curr Opin Microbiol 12(1): 117-124. Medzhitov, R. (2001). "Toll-like receptors and innate immunity." Nat Rev Immunol 1(2): 135- 145. 132  Menendez, A., E. T. Arena, J. A. Guttman, L. Thorson, B. A. Vallance, W. Vogl and B. B. Finlay (2009). "Salmonella infection of gallbladder epithelial cells drives local inflammation and injury in a model of acute typhoid fever." J Infect Dis 200(11): 1703-1713. Miao, E. A., M. Brittnacher, A. Haraga, R. L. Jeng, M. D. Welch and S. I. Miller (2003). "Salmonella effectors translocated across the vacuolar membrane interact with the actin cytoskeleton." Mol Microbiol 48(2): 401-415. Miao, E. A., I. A. Leaf, P. M. Treuting, D. P. Mao, M. Dors, A. Sarkar, S. E. Warren, M. D. Wewers and A. Aderem (2010). "Caspase-1-induced pyroptosis is an innate immune effector mechanism against intracellular bacteria." Nat Immunol 11(12): 1136-1142. Miao, E. A., C. A. Scherer, R. M. Tsolis, R. A. Kingsley, L. G. Adams, A. J. Baumler and S. I. Miller (1999). "Salmonella typhimurium leucine-rich repeat proteins are targeted to the SPI1 and SPI2 type III secretion systems." Mol Microbiol 34(4): 850-864. Miller, S. I., A. M. Kukral and J. J. Mekalanos (1989). "A two-component regulatory system (phoP phoQ) controls Salmonella typhimurium virulence." Proc Natl Acad Sci U S A 86(13): 5054-5058. Miller, V. L. and J. J. Mekalanos (1988). "A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR." J Bacteriol 170(6): 2575-2583. Mittrucker, H. W. and S. H. Kaufmann (2000). "Immune response to infection with Salmonella typhimurium in mice." J Leukoc Biol 67(4): 457-463. Monack, D. M., D. M. Bouley and S. Falkow (2004). "Salmonella typhimurium persists within macrophages in the mesenteric lymph nodes of chronically infected Nramp1+/+ mice and can be reactivated by IFNgamma neutralization." J Exp Med 199(2): 231-241. Morpeth, S. C., H. O. Ramadhani and J. A. Crump (2009). "Invasive non-Typhi Salmonella disease in Africa." Clin Infect Dis 49(4): 606-611. Morteau, O., S. G. Morham, R. Sellon, L. A. Dieleman, R. Langenbach, O. Smithies and R. B. Sartor (2000). "Impaired mucosal defense to acute colonic injury in mice lacking cyclooxygenase-1 or cyclooxygenase-2." J Clin Invest 105(4): 469-478. 133  Muller, P., D. Chikkaballi and M. Hensel (2012). "Functional dissection of SseF, a membrane- integral effector protein of intracellular Salmonella enterica." PLoS One 7(4): e35004. Mulvey, M. R., D. A. Boyd, A. B. Olson, B. Doublet and A. Cloeckaert (2006). "The genetics of Salmonella genomic island 1." Microbes Infect 8(7): 1915-1922. Muotiala, A. and P. H. Makela (1990). "The role of IFN-gamma in murine Salmonella typhimurium infection." Microb Pathog 8(2): 135-141. Mweu, E. and M. English (2008). "Typhoid fever in children in Africa." Trop Med Int Health 13(4): 532-540. Napimoga, M. H., C. A. da Silva, V. Carregaro, T. S. Farnesi-de-Assuncao, P. M. Duarte, N. F. de Melo and L. F. Fraceto (2012). "Exogenous administration of 15d-PGJ2-loaded nanocapsules inhibits bone resorption in a mouse periodontitis model." J Immunol 189(2): 1043-1052. Nawabi, P., D. M. Catron and K. Haldar (2008). "Esterification of cholesterol by a type III secretion effector during intracellular Salmonella infection." Mol Microbiol 68(1): 173-185. Negishi, M., T. Koizumi and A. Ichikawa (1995). "Biological actions of delta 12-prostaglandin J2." J Lipid Mediat Cell Signal 12(2-3): 443-448. Ochiai, R. L., C. J. Acosta, M. C. Danovaro-Holliday, D. Baiqing, S. K. Bhattacharya, M. D. Agtini, Z. A. Bhutta, G. Canh do, M. Ali, S. Shin, J. Wain, A. L. Page, M. J. Albert, J. Farrar, R. Abu-Elyazeed, T. Pang, C. M. Galindo, L. von Seidlein, J. D. Clemens and G. Domi Typhoid Study (2008). "A study of typhoid fever in five Asian countries: disease burden and implications for controls." Bull World Health Organ 86(4): 260-268. Ochman, H., F. C. Soncini, F. Solomon and E. A. Groisman (1996). "Identification of a pathogenicity island required for Salmonella survival in host cells." Proc Natl Acad Sci U S A 93(15): 7800-7804. Ohlson, M. B., K. Fluhr, C. L. Birmingham, J. H. Brumell and S. I. Miller (2005). "SseJ deacylase activity by Salmonella enterica serovar Typhimurium promotes virulence in mice." Infect Immun 73(10): 6249-6259. Onwuezobe, I. A., P. O. Oshun and C. C. Odigwe (2012). "Antimicrobials for treating symptomatic non-typhoidal Salmonella infection." Cochrane Database Syst Rev 11: CD001167. 134  Pace, J., M. J. Hayman and J. E. Galan (1993). "Signal transduction and invasion of epithelial cells by S. typhimurium." Cell 72(4): 505-514. Parry, C. M., T. T. Hien, G. Dougan, N. J. White and J. J. Farrar (2002). "Typhoid fever." N Engl J Med 347(22): 1770-1782. Patel, J. C. and J. E. Galan (2005). "Manipulation of the host actin cytoskeleton by Salmonella-- all in the name of entry." Curr Opin Microbiol 8(1): 10-15. Petrova, T. V., K. T. Akama and L. J. Van Eldik (1999). "Cyclopentenone prostaglandins suppress activation of microglia: down-regulation of inducible nitric-oxide synthase by 15- deoxy-Delta12,14-prostaglandin J2." Proc Natl Acad Sci U S A 96(8): 4668-4673. Petrovska, L., R. J. Aspinall, L. Barber, S. Clare, C. P. Simmons, R. Stratford, S. A. Khan, N. R. Lemoine, G. Frankel, D. W. Holden and G. Dougan (2004). "Salmonella enterica serovar Typhimurium interaction with dendritic cells: impact of the sifA gene." Cell Microbiol 6(11): 1071-1084. Poh, J., C. Odendall, A. Spanos, C. Boyle, M. Liu, P. Freemont and D. W. Holden (2008). "SteC is a Salmonella kinase required for SPI-2-dependent F-actin remodelling." Cell Microbiol 10(1): 20-30. Popoff, M. Y., J. Bockemuhl and L. L. Gheesling (2004). "Supplement 2002 (no. 46) to the Kauffmann-White scheme." Res Microbiol 155(7): 568-570. Popoff, M. Y., Le Minor, L. (1992). Antigenic formulas of the Salmonella serovars. Paris, Institute Pasteur. Popoff, M. Y. L. M., L. (1997). Antigenic formulas of the Salmonella serovars. Paris, WHO Collaborating Center for Reference and Research on Salmonella. Porwollik, S. and M. McClelland (2003). "Lateral gene transfer in Salmonella." Microbes Infect 5(11): 977-989. Prouty, A. M., W. H. Schwesinger and J. S. Gunn (2002). "Biofilm formation and interaction with the surfaces of gallstones by Salmonella spp." Infect Immun 70(5): 2640-2649. 135  Reddy, R. C., V. R. Narala, V. G. Keshamouni, J. E. Milam, M. W. Newstead and T. J. Standiford (2008). "Sepsis-induced inhibition of neutrophil chemotaxis is mediated by activation of peroxisome proliferator-activated receptor-{gamma}." Blood 112(10): 4250-4258. Ricote, M., A. C. Li, T. M. Willson, C. J. Kelly and C. K. Glass (1998). "The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation." Nature 391(6662): 79-82. Rossi, A., G. Elia and M. G. Santoro (1996). "2-Cyclopenten-1-one, a new inducer of heat shock protein 70 with antiviral activity." J Biol Chem 271(50): 32192-32196. Rossi, A., P. Kapahi, G. Natoli, T. Takahashi, Y. Chen, M. Karin and M. G. Santoro (2000). "Anti-inflammatory cyclopentenone prostaglandins are direct inhibitors of IkappaB kinase." Nature 403(6765): 103-108. Rubires, X., F. Saigi, N. Pique, N. Climent, S. Merino, S. Alberti, J. M. Tomas and M. Regue (1997). "A gene (wbbL) from Serratia marcescens N28b (O4) complements the rfb-50 mutation of Escherichia coli K-12 derivatives." J Bacteriol 179(23): 7581-7586. Ruiz, P. A., S. C. Kim, R. B. Sartor and D. Haller (2004). "15-deoxy-delta12,14-prostaglandin J2-mediated ERK signaling inhibits gram-negative bacteria-induced RelA phosphorylation and interleukin-6 gene expression in intestinal epithelial cells through modulation of protein phosphatase 2A activity." J Biol Chem 279(34): 36103-36111. Ruiz-Albert, J., X. J. Yu, C. R. Beuzon, A. N. Blakey, E. E. Galyov and D. W. Holden (2002). "Complementary activities of SseJ and SifA regulate dynamics of the Salmonella typhimurium vacuolar membrane." Mol Microbiol 44(3): 645-661. Sakata, D., C. Yao and S. Narumiya (2010). "Prostaglandin E(2), an immunoactivator." J Pharmacol Sci 112(1): 1-5. Salcedo, S. P. and D. W. Holden (2003). "SseG, a virulence protein that targets Salmonella to the Golgi network." EMBO J 22(19): 5003-5014. Sanderson, K. E. (1976). "Genetic relatedness in the family Enterobacteriaceae." Annu Rev Microbiol 30: 327-349. 136  Santos, R. L., R. M. Tsolis, A. J. Baumler and L. G. Adams (2003). "Pathogenesis of Salmonella-induced enteritis." Braz J Med Biol Res 36(1): 3-12. Schmidt, H. and M. Hensel (2004). "Pathogenicity islands in bacterial pathogenesis." Clin Microbiol Rev 17(1): 14-56. Sekirov, I., N. M. Tam, M. Jogova, M. L. Robertson, Y. Li, C. Lupp and B. B. Finlay (2008). "Antibiotic-induced perturbations of the intestinal microbiota alter host susceptibility to enteric infection." Infect Immun 76(10): 4726-4736. Shelobolina, E. S., S. A. Sullivan, K. R. O'Neill, K. P. Nevin and D. R. Lovley (2004). "Isolation, characterization, and U(VI)-reducing potential of a facultatively anaerobic, acid- resistant Bacterium from Low-pH, nitrate- and U(VI)-contaminated subsurface sediment and description of Salmonella subterranea sp. nov." Appl Environ Microbiol 70(5): 2959-2965. Sheppard, M., C. Webb, F. Heath, V. Mallows, R. Emilianus, D. Maskell and P. Mastroeni (2003). "Dynamics of bacterial growth and distribution within the liver during Salmonella infection." Cell Microbiol 5(9): 593-600. Shi, L., S. M. Chowdhury, H. S. Smallwood, H. Yoon, H. M. Mottaz-Brewer, A. D. Norbeck, J. E. McDermott, T. R. Clauss, F. Heffron, R. D. Smith and J. N. Adkins (2009). "Proteomic investigation of the time course responses of RAW 264.7 macrophages to infection with Salmonella enterica." Infect Immun 77(8): 3227-3233. Shotland, Y., H. Kramer and E. A. Groisman (2003). "The Salmonella SpiC protein targets the mammalian Hook3 protein function to alter cellular trafficking." Mol Microbiol 49(6): 1565- 1576. Slominski, B., J. Calkiewicz, P. Golec, G. Wegrzyn and B. Wrobel (2007). "Plasmids derived from Gifsy-1/Gifsy-2, lambdoid prophages contributing to the virulence of Salmonella enterica serovar Typhimurium: implications for the evolution of replication initiation proteins of lambdoid phages and enterobacteria." Microbiology 153(Pt 6): 1884-1896. Srikanth, C. V., R. Mercado-Lubo, K. Hallstrom and B. A. McCormick (2011). "Salmonella effector proteins and host-cell responses." Cell Mol Life Sci 68(22): 3687-3697. 137  Srinivasan, A., R. M. Salazar-Gonzalez, M. Jarcho, M. M. Sandau, L. Lefrancois and S. J. McSorley (2007). "Innate immune activation of CD4 T cells in salmonella-infected mice is dependent on IL-18." J Immunol 178(10): 6342-6349. Stanley, T. L., C. D. Ellermeier and J. M. Slauch (2000). "Tissue-specific gene expression identifies a gene in the lysogenic phage Gifsy-1 that affects Salmonella enterica serovar typhimurium survival in Peyer's patches." J Bacteriol 182(16): 4406-4413. Stecher, B., R. Robbiani, A. W. Walker, A. M. Westendorf, M. Barthel, M. Kremer, S. Chaffron, A. J. Macpherson, J. Buer, J. Parkhill, G. Dougan, C. von Mering and W. D. Hardt (2007). "Salmonella enterica serovar typhimurium exploits inflammation to compete with the intestinal microbiota." PLoS Biol 5(10): 2177-2189. Steele-Mortimer, O., S. Meresse, J. P. Gorvel, B. H. Toh and B. B. Finlay (1999). "Biogenesis of Salmonella typhimurium-containing vacuoles in epithelial cells involves interactions with the early endocytic pathway." Cell Microbiol 1(1): 33-49. Stein, M. A., K. Y. Leung, M. Zwick, F. Garcia-del Portillo and B. B. Finlay (1996). "Identification of a Salmonella virulence gene required for formation of filamentous structures containing lysosomal membrane glycoproteins within epithelial cells." Mol Microbiol 20(1): 151-164. Strassmann, G., V. Patil-Koota, F. Finkelman, M. Fong and T. Kambayashi (1994). "Evidence for the involvement of interleukin 10 in the differential deactivation of murine peritoneal macrophages by prostaglandin E2." J Exp Med 180(6): 2365-2370. Straus, D. S., G. Pascual, M. Li, J. S. Welch, M. Ricote, C. H. Hsiang, L. L. Sengchanthalangsy, G. Ghosh and C. K. Glass (2000). "15-deoxy-delta 12,14-prostaglandin J2 inhibits multiple steps in the NF-kappa B signaling pathway." Proc Natl Acad Sci U S A 97(9): 4844-4849. Su, L. H. and C. H. Chiu (2007). "Salmonella: clinical importance and evolution of nomenclature." Chang Gung Med J 30(3): 210-219. Surh, Y. J., H. K. Na, J. M. Park, H. N. Lee, W. Kim, I. S. Yoon and D. D. Kim (2011). "15- Deoxy-Delta(1)(2),(1)(4)-prostaglandin J(2), an electrophilic lipid mediator of anti-inflammatory and pro-resolving signaling." Biochem Pharmacol 82(10): 1335-1351. 138  Thiennimitr, P., S. E. Winter, M. G. Winter, M. N. Xavier, V. Tolstikov, D. L. Huseby, T. Sterzenbach, R. M. Tsolis, J. R. Roth and A. J. Baumler (2011). "Intestinal inflammation allows Salmonella to use ethanolamine to compete with the microbiota." Proc Natl Acad Sci U S A 108(42): 17480-17485. Thomas, K., S. E. Majowicz, P. Sockett, A. Fazil, F. Pollari, J. Dore, J. Flint and V. L. Edge (2006). "Estimated numbers of community cases of illnes due to Salmonella, Campylobacter and verotoxigenic Escherichia coli: Pathogen-specific community rates." Can J Infect Dis Med Microbiol 17: 229-234. Thomas, M. K., Majowicz, S.E., Pollari, F., Sockett, P.N. (2008). Burden of acute gastrointestinal illness in Canada, 1999-2007: Interim summary of NSAGI activities P. H. A. o. Canada, Goverment of Canada. 34. Tobar, J. A., L. J. Carreno, S. M. Bueno, P. A. Gonzalez, J. E. Mora, S. A. Quezada and A. M. Kalergis (2006). "Virulent Salmonella enterica serovar typhimurium evades adaptive immunity by preventing dendritic cells from activating T cells." Infect Immun 74(11): 6438-6448. Treffkorn, L., R. Scheibe, T. Maruyama and P. Dieter (2004). "PGE2 exerts its effect on the LPS-induced release of TNF-alpha, ET-1, IL-1alpha, IL-6 and IL-10 via the EP2 and EP4 receptor in rat liver macrophages." Prostaglandins Other Lipid Mediat 74(1-4): 113-123. Tsolis, R. M., L. G. Adams, T. A. Ficht and A. J. Baumler (1999). "Contribution of Salmonella typhimurium virulence factors to diarrheal disease in calves." Infect Immun 67(9): 4879-4885. Tucker, D. E., M. Ghosh, F. Ghomashchi, R. Loper, S. Suram, B. S. John, M. Girotti, J. G. Bollinger, M. H. Gelb and C. C. Leslie (2009). "Role of phosphorylation and basic residues in the catalytic domain of cytosolic phospholipase A2alpha in regulating interfacial kinetics and binding and cellular function." J Biol Chem 284(14): 9596-9611. Uchiya, K., M. A. Barbieri, K. Funato, A. H. Shah, P. D. Stahl and E. A. Groisman (1999). "A Salmonella virulence protein that inhibits cellular trafficking." EMBO J 18(14): 3924-3933. Uchiya, K., E. A. Groisman and T. Nikai (2004). "Involvement of Salmonella pathogenicity island 2 in the up-regulation of interleukin-10 expression in macrophages: role of protein kinase A signal pathway." Infect Immun 72(4): 1964-1973. 139  Uchiya, K. and T. Nikai (2004). "Salmonella enterica serovar Typhimurium infection induces cyclooxygenase 2 expression in macrophages: involvement of Salmonella pathogenicity island 2." Infect Immun 72(12): 6860-6869. Valdez, Y., G. E. Diehl, B. A. Vallance, G. A. Grassl, J. A. Guttman, N. F. Brown, C. M. Rosenberger, D. R. Littman, P. Gros and B. B. Finlay (2008). "Nramp1 expression by dendritic cells modulates inflammatory responses during Salmonella Typhimurium infection." Cell Microbiol 10(8): 1646-1661. van Asten, A. J. and J. E. van Dijk (2005). "Distribution of "classic" virulence factors among Salmonella spp." FEMS Immunol Med Microbiol 44(3): 251-259. van der Heijden, J. and B. B. Finlay (2012). "Type III effector-mediated processes in Salmonella infection." Future Microbiol 7(6): 685-703. Vazquez-Torres, A., J. Jones-Carson, A. J. Baumler, S. Falkow, R. Valdivia, W. Brown, M. Le, R. Berggren, W. T. Parks and F. C. Fang (1999). "Extraintestinal dissemination of Salmonella by CD18-expressing phagocytes." Nature 401(6755): 804-808. Vazquez-Torres, A., J. Jones-Carson, P. Mastroeni, H. Ischiropoulos and F. C. Fang (2000). "Antimicrobial actions of the NADPH phagocyte oxidase and inducible nitric oxide synthase in experimental salmonellosis. I. Effects on microbial killing by activated peritoneal macrophages in vitro." J Exp Med 192(2): 227-236. Vazquez-Torres, A., B. A. Vallance, M. A. Bergman, B. B. Finlay, B. T. Cookson, J. Jones- Carson and F. C. Fang (2004). "Toll-like receptor 4 dependence of innate and adaptive immunity to Salmonella: importance of the Kupffer cell network." J Immunol 172(10): 6202-6208. Vazquez-Torres, A., Y. Xu, J. Jones-Carson, D. W. Holden, S. M. Lucia, M. C. Dinauer, P. Mastroeni and F. C. Fang (2000). "Salmonella pathogenicity island 2-dependent evasion of the phagocyte NADPH oxidase." Science 287(5458): 1655-1658. Waku, T., T. Shiraki, T. Oyama and K. Morikawa (2009). "Atomic structure of mutant PPARgamma LBD complexed with 15d-PGJ2: novel modulation mechanism of PPARgamma/RXRalpha function by covalently bound ligands." FEBS Lett 583(2): 320-324. Walthers, D., R. K. Carroll, W. W. Navarre, S. J. Libby, F. C. Fang and L. J. Kenney (2007). "The response regulator SsrB activates expression of diverse Salmonella pathogenicity island 2 140  promoters and counters silencing by the nucleoid-associated protein H-NS." Mol Microbiol 65(2): 477-493. Wan, S. and P. V. Coveney (2009). "A comparative study of the COX-1 and COX-2 isozymes bound to lipid membranes." J Comput Chem 30(7): 1038-1050. Wick, M. J. (2011). "Innate immune control of Salmonella enterica serovar Typhimurium: mechanisms contributing to combating systemic Salmonella infection." J Innate Immun 3(6): 543-549. Wilson, R. P., M. Raffatellu, D. Chessa, S. E. Winter, C. Tukel and A. J. Baumler (2008). "The Vi-capsule prevents Toll-like receptor 4 recognition of Salmonella." Cell Microbiol 10(4): 876- 890. Winter, S. E., P. Thiennimitr, M. G. Winter, B. P. Butler, D. L. Huseby, R. W. Crawford, J. M. Russell, C. L. Bevins, L. G. Adams, R. M. Tsolis, J. R. Roth and A. J. Baumler (2010). "Gut inflammation provides a respiratory electron acceptor for Salmonella." Nature 467(7314): 426- 429. Wong, K. K., M. McClelland, L. C. Stillwell, E. C. Sisk, S. J. Thurston and J. D. Saffer (1998). "Identification and sequence analysis of a 27-kilobase chromosomal fragment containing a Salmonella pathogenicity island located at 92 minutes on the chromosome map of Salmonella enterica serovar typhimurium LT2." Infect Immun 66(7): 3365-3371. Yang, B., J. Zheng, E. W. Brown, S. Zhao and J. Meng (2009). "Characterisation of antimicrobial resistance-associated integrons and mismatch repair gene mutations in Salmonella serotypes." Int J Antimicrob Agents 33(2): 120-124. Yao, C., D. Sakata, Y. Esaki, Y. Li, T. Matsuoka, K. Kuroiwa, Y. Sugimoto and S. Narumiya (2009). "Prostaglandin E2-EP4 signaling promotes immune inflammation through Th1 cell differentiation and Th17 cell expansion." Nat Med 15(6): 633-640. Yoshikai, Y. (2001). "Roles of prostaglandins and leukotrienes in acute inflammation caused by bacterial infection." Curr Opin Infect Dis 14(3): 257-263. Yu, X. J., K. McGourty, M. Liu, K. E. Unsworth and D. W. Holden (2010). "pH Sensing by Intracellular Salmonella Induces Effector Translocation." Science. 141  Yu, X. J., J. Ruiz-Albert, K. E. Unsworth, S. Garvis, M. Liu and D. W. Holden (2002). "SpiC is required for secretion of Salmonella Pathogenicity Island 2 type III secretion system proteins." Cell Microbiol 4(8): 531-540. Zhao, Y., J. Yang, J. Shi, Y. N. Gong, Q. Lu, H. Xu, L. Liu and F. Shao (2011). "The NLRC4 inflammasome receptors for bacterial flagellin and type III secretion apparatus." Nature 477(7366): 596-600. Zhou, D., W. D. Hardt and J. E. Galan (1999). "Salmonella typhimurium encodes a putative iron transport system within the centisome 63 pathogenicity island." Infect Immun 67(4): 1974-1981. Zingarelli, B., M. Sheehan, P. W. Hake, M. O'Connor, A. Denenberg and J. A. Cook (2003). "Peroxisome proliferator activator receptor-gamma ligands, 15-deoxy-Delta(12,14)- prostaglandin J2 and ciglitazone, reduce systemic inflammation in polymicrobial sepsis by modulation of signal transduction pathways." J Immunol 171(12): 6827-6837.    142  Appendix  143  Appendix A   Arachidonic acid metabolism in mice infected with Salmonella  Figure A.1 Metabolic pathways affected by Salmonella infection Mice infected with Salmonella were sacrificed 5 days post infection, and livers and feces were collected. Masses of interest were searched against the KEGG database using the MassTrix software (http://masstrix.org). Bars indicate the percentage of metabolites from each KEGG 144  pathway that was affected by infection. Black bars indicate metabolites from feces, and gray bars indicate metabolites from livers. From (Antunes, Arena et al. 2011)   Figure A.2 Mouse fecal levels of eicosanoids Fecal levels of eicosanoids in uninfected (black bars) and infected (4 days; gray bars) samples, determined by ELISAs. Averages with standard errors of the means are shown. The numbers of uninfected mice used were 4 (15d-PGJ2) and 5 (TBX2 and PGE2). The number of infected mice used was 4 in all cases. All differences were statistically significant (P < 0.05). Outliers were detected using the Grubbs’ test and removed. From: (Antunes, Arena et al. 2011)  Figure A.3 Expression of COX2, PTGES, and TBXAS1 in mouse livers Relative transcript levels of enzymes involved in eicosanoid synthesis in uninfected (black bars) and infected (5 days; gray bars) livers. Averages of the results obtained from uninfected tissues were normalized to 1, and the levels for individual mice, uninfected and infected, were adjusted accordingly. Averaged results are shown. Bars indicate the standard errors of the means. Ten mice were used in all cases except for COX-2 determinations from uninfected mice (n = 7). All P values were <0.002. From: (Antunes, Arena et al. 2011)

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0074014/manifest

Comment

Related Items