UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Taxonomy and phylogeny of mitosporic Capnodiales and description of a new sooty mold species, Fumiglobus… Bose, Tanay 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2013_fall_bose_tanay.pdf [ 23.92MB ]
Metadata
JSON: 24-1.0074013.json
JSON-LD: 24-1.0074013-ld.json
RDF/XML (Pretty): 24-1.0074013-rdf.xml
RDF/JSON: 24-1.0074013-rdf.json
Turtle: 24-1.0074013-turtle.txt
N-Triples: 24-1.0074013-rdf-ntriples.txt
Original Record: 24-1.0074013-source.json
Full Text
24-1.0074013-fulltext.txt
Citation
24-1.0074013.ris

Full Text

TAXONOMY AND PHYLOGENY OF MITOSPORIC CAPNODIALES AND DESCRIPTION OF A NEW SOOTY MOLD SPECIES, FUMIGLOBUS PIERIDICOLA, FROM BRITISH COLUMBIA, CANADA. by Tanay Bose B.Sc. (Honours), University of Calcutta, 2007 M.Sc., Presidency College, University of Calcutta, 2009  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIRMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty of Graduate Studies (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) July 2013  © Tanay Bose, 2013  Abstract  Sooty molds from Capnodiaceae are epiphyllous saprotrophs that are often associated with sap-sucking insects. The honeydew exuded by these insects serves as the nutritive substrate for the molds. Through this study I identify an unknown sooty mold on Japanese andromeda, Pieris japonica, from northwestern North America. Morphological analysis of the pycnidial state suggested the fungus is a Fumiglobus species, but with substantial differences from the previously reported species from the genus. In this thesis, I illustrate and describe the epiphyllous mold as Fumiglobus pieridicola. I also provide partial 18S and 28S ribosomal gene sequence data for F. pieridicola. These are the first sequences determined for any species in the genus. Using my sequence dataset, I show that the genus Fumiglobus is within Capnodiaceae with considerable bootstrap support. I also furnish new sequences for the type species of the mitosporic genus Conidiocarpus, also in Capnodiaceae. I confirm that Conidiocarpus is the anamorph of Phragmocapnias. Following the rules of nomenclatural priority, I synonymize Phragmocapnias species under Conidiocarpus. Using ancestral character state reconstruction for Capnodiales, I find a high probability that the ancestor for Capnodiaceae was pycnidial. My analyses contribute to an improved molecular and morphological definition of Capnodiaceae.  !  ii!  Preface  This thesis describes the research conducted by me at the Department of Botany, University of British Columbia in collaboration with my supervisor Prof. Mary L. Berbee and Dr. Don R. Reynolds from Jepson Herbaria, University of California at Berkeley. Dr. D.R. Reynolds and Dr. G. R. Balali provided the herbarium specimens of Meliola niessleana and Conidiocarpus caucasicus respectively. I executed the collection, microscopic analysis, description and illustration of Fumiglobus pieridicola sp. nov. I also carried out DNA extractions, amplifications, purifications and sequencing for all the fungal species mentioned above. I performed all the phylogenetic analysis provided in this thesis. Prof. Berbee and Dr. Reynolds provided me with critical advice in this study. Prof. Berbee helped edit the thesis.  !  iii!  Table of Contents Abstract .................................................................................................................... ii Preface ..................................................................................................................... iii Table of Contents ................................................................................................... iv List of Tables ........................................................................................................... v List of Figures ......................................................................................................... vi Acknowledgements .............................................................................................. viii Dedication ................................................................................................................ x Chapter 1: Introduction ......................................................................................... 1 1.1 The Life of Molds .................................................................................... 1 1.2 Literature Review .................................................................................... 2 1.2.1 Capnodiales .............................................................................. 2 1.2.2 Capnodiaceae ........................................................................... 3 1.2.3 Asbolisiaceae ............................................................................ 5 1.3 Research Objectives ................................................................................ 8 Chapter 2: Taxonomy and Phylogeny of Mitosporic Capnodiales and Description of a New Sooty Mold Species, Fumiglobus pieridicola, from British Columbia, Canada ................................................................................... 10 2.1 Introduction ........................................................................................... 10 2.2 Materials and Methods ......................................................................... 13 2.3 Results ..................................................................................................... 19 2.4 Discussion ............................................................................................... 32 2.5 Tables ...................................................................................................... 38 2.6 Figures .................................................................................................... 44 Chapter 3: Concluding Chapter .......................................................................... 57 3.1 Outcomes of this Project in Light of Current Research .................... 57 3.2 Strengths and Limitations of this Project ........................................... 59 3.3 Application of These Findings and Future Research Directions .............................................................................................. 62 References .............................................................................................................. 62 Appendix ................................................................................................................ 72 Supplementary Tables ................................................................................. 72  !  iv!  List of Tables Table 1: Table1Primers used for amplification of LSU and SSU r-DNA in this study ................................................................................................................ 38 Table 2: The proportional likelihoods and most parsimonious reconstructions for types of asexual fruiting bodies, at specified ancestral branches, based on likelihood and parsimony ancestral state reconstruction, with unscored taxa coded as missing, ‘1’ or ‘0’ .......................................................................................................... 39 Table 3: Comparison of pycnidia and conidia of new species "Fumiglobus pieridicola" with previously described Fumiglobus species ............................................. 40 Table 4: Comparison of the morphological characters for the families in Capnodiales included in this study ...................................................................................... 41 Table 5: Asexual fruiting bodies reported from bitunicate Ascomycota by Sivanesan (1984) ........................................................................................... 43 Supplementary Table 1: List of taxa selected for the phylogenetic study. Taxon names in black font were included from the alignment of James et al. 2006. Taxa names in blue font were included for this study. Taxon names in bold font indicate new sequences generated in this study ..................................... 72 Supplementary Table 2: Summary of descriptions from literature on reproductive states for the capnodiaceous fungi included in this study .............................. 79 Supplementary Table 3: Sequences generated in this study, but not included in the phylogenetic analysis due to unavailability of ITS and 5.8S sequences for Capnodiaceae fungi on the database .............................................................. 91  !  v!  List of Figures Figure'1:!!Fumiglobus*pieridicola!and!Conidiocarpus*caucasicus,!indicated!in!blue! font,!represent!new!sequences!from!this!study!and!are!well!supported!as! members!of!the!Capnodiaceae.!This!maximum!likelihood!tree!was! generated!using!RAxML!for!concatenated!ribosomal!large!and!small! subunit!sequences.!Numbers!are!bootstrap!values!from!500!replicates.! The!scale!bar!indicates!the!number!of!substitutions!per!site!.....................!44! ! Figure'2:!The!maximum!likelihood!tree!from!the!ribosomal!large!subunit!dataset! (1305!bp),!analyzed!alone,!is!largely!congruent!with!the!tree!from!the! concatenated!data.!The!numbers!on!branches!are!bootstrap!values!from! 500!replicates.!Blue!font!indicates!new!sequences!from!this!study.!The! scale!bar!indicates!the!number!of!substitutions!per!site!!.............................!46! ! Figure'3:!Maximum!likelihood!tree!generated!using!RAxML!for!the!ribosomal!small! subunit!dataset!(1595!bp),!analyzed!alone.!The!numbers!on!branches!are! bootstrap!values!from!500!replicates.!Blue!font!indicates!new!sequences! from!this!study.!The!scale!bar!indicates!the!number!of!substitutions!per! site!!.......................................................................................................................................!48! ! Figure'4:!Production!of!conidia!within!pycnidia!was!the!most!likely!ancestralPstate! in!the!Capnodiaceae,!under!the!Mk1!likelihood!model!of!character! evolution.!Filled!boxes!next!to!species!names!indicate!a!pycnidial!asexual! state.!Empty!boxes!indicate!nonpycnidial!species.!Red!interrogation!marks! indicate!undescribed!or!unidentified!asexual!states.!Pie!charts!A!and!B! indicate!proportional!likelihood!of!a!pycnidial!ancestral!state!for!the! Capnodiaceae.!For!the!other!numbered!branches,!proportional!likelihood! of!a!pycnidial!ancestral!state!are!given!in!Table!2.5.2!...................................!50! ! Figure'5:!Pulvinaria!cf.!acericola,!the!scale!insect!on!Pieris*japonica!that!produced! the!honeydew!nourishing!the!mold!Fumiglobus*pieridicola.!A.!Female! insect!bodies,!B.!Close!up!of!the!female!insect!!.................................................!51! ' Figure'6:!Fumiglobus*pieridicola*sp.*nov.!growing!on!Pieris*japonica!(Japanese! andromeda).!C.!Close!up!of!the!mold!colony!on!the!adaxial!surface!of!the! host!leaf!!.............................................................................................................................!52! !  !  vi!  Figure'7:!Fumiglobus*pieridicola*sp.*nov.:!A.!Portion!of!a!moniliform!hypha,!B.! Mature!apical!pycnidium,!C.!Immature!apical!pycnidium,!D.!Mature! intercalary!pycnidium,!E.!Conidia!produced!in!chains!within!pycnidium,!! F.!Conidia!!..........................................................................................................................!53! ! Figure'8:!Habit!and!microscopic!structures!of!Fumiglobus*pieridicola*sp.*nov.!on! Pieris*japonica!(Japanese!andromeda).!A.!Portion!of!the!flowering!twig!of! the!host!with!the!sooty!mold.!The!white!patches!on!the!lower!leaves! represent!the!symbiotic!female!scale!insects,!Pulvinaria!cf.*acericola! (arrows);!B.!ClosePup!of!adaxial!surface!of!the!leaf!with!the!mold!F.! pieridicola:!C.!Mycelium,!D.!Mature!apical!pycnidium,!E.!Immature!apical! pycnidium,!F.!Mature!intercallary!pycnidium,!G.!Immature!intercalary! pycnidium!and!H.!Chains!of!conidia!from!pycnidium!!...................................!54! ! Figure'9:!Fumiglobus*didymopanacis!(Holotype!UC!1994100,!University!Herbarium,! University!of!California,!Berkeley):!A.!Pycnidium,!arrows!indicate!the! outline!of!the!pycnidium!B.!Mycelium,!composed!of!elongated!cells!......!55! ! Figure'10:!Conidiocarpus*caucasicus!(GUMH!937):!A.!Pycnidium!B.!Hyphae,! composed!of!cells!of!inconsistent!length!and!width!!......................................!56! ! !  !  vii!  Acknowledgements  This research wouldn’t have been possible without the help and guidance from several individuals. These people not only extended their unflinching help, but have also actively participated in this project. First, my utmost gratitude goes to my supervisor Prof. Mary L. Berbee. Prof. Berbee has been my inspiration in fungal systematics. I was fortunate to complete my research under her guidance. I thank her for keeping faith on me and also providing me with valuable suggestions when I was completely lost. Thanks to Dr. Don R. Reynolds, Research Botanist and Curator of Fungi, Jepson Herbaria, University of California at Berkeley for his encouraging words and providing me with an exhaustive collection of sooty molds. Thanks to Dr. G. Reza Balali, Department of Biology, Isfahan University, Isfahan, Iran for providing me with samples of Conidiocarpus caucasicus. Thanks to Dr. Seyed Akbar Khodaparast, College of Agriculture, University of Guilan, Rasht, Iran for translating the description of Conidiocarpus caucasicus from Persian to English. Thanks to Lola Millerman (née Bakhareva) for translating the descriptions of several sooty molds from Russian to English. Thanks to Dr. Gillian W. Watson, Senior Insect Biosystematist, California Department of Food & Agriculture, Sacramento, California for identifying the scale insect on Pieris japonica.  !  viii!  Thanks to Dr. Bryce Kendrick for initial identification of the sooty mold growing on Pieris japonica. Thanks to Dr. John L. Strother, University Herbarium, University of California, Berkeley for proof reading and correcting the Latin diagnosis for Fumiglobus pieridicola. Thanks to Karen Needham and Don Griffiths, Beaty Biodiversity Museum, UBC for allowing me to use the stereo microscope for taking photographs of the scale insects on Japanese andromeda. Thanks to Anna Bazzicalupo and Ludovic Le Renard for collecting sooty mold samples from Oregon, USA. Thanks to my research committee Prof. Sean W. Graham and Prof. Quentin C.B. Cronk for providing me with helpful suggestions. Their suggestions helped me design and execute my research better. Thanks to my parents who have worked hard to bring me to this point in life. Thanks to all my lab-mates for providing me with an excellent environment to work. Lastly I thank The Almighty, for answering my prayers.  Tanay Bose  !  ix!  Dedication  To my Mum and Bapi  !  x!  Chapter 1: Introduction  1.1 The Life of Molds: Ascomycota and Basidiomycota are two diverse fungal phyla that together form the subkingdom Dikarya (Hibbett et al. 2007). Ascomycota represent the largest of the two with around 32,739 identified species (Kirk et al. 2008). Ascomycota are ubiquitous in distribution and perform a wide variety of roles in the ecosystem as saprotrophs, parasites, and the fungal partners in lichens (Alexopoulos et al. 1996; Schoch et al. 2009b). Baker's yeast, morels, and most molds are in Ascomycota. Several antibiotics are priceless gifts from these humble organisms. Molds are among the most interesting and useful groups of organisms, although their value can be difficult to appreciate after discovering them decomposing a fruit or vegetable on a kitchen counter. Most common molds in genera such as Penicillium and Aspergillus represent the asexual phases of species with complex dimorphic life cycles. Although some molds are responsible for human and plant diseases, most are saprotrophs and simply graze on foods that would never interest bipeds like us. Sooty molds in the family Capnodiaceae are one such benign group of saprotrophic fungi and they are the main topic of my thesis. They produce darkly pigmented mycelium that colonizes the aerial system of plants. Most sooty molds feed on honeydew excreted by sap-sucking insects (Chomnunti et al. 2011; Hughes 1976). Some sooty molds can proliferate in the absence of sap-sucking insects, but they still use plant exudates for their nutrition (Hughes 1976). While tropical and sub-tropical regions account for the highest  !  1!  diversity of sooty molds, considerable diversity has also been reported from the temperate regions of Europe and North America. Sooty molds have received little scientific attention. Several mycologists have considered them useless and depressing due to their underwhelming appearance and the challenges they present to scientific investigation. Identifying sooty molds is challenging because several different species tend to grow together, and because some epiphyllous fungal colonies mimic sooty molds. Illustrating the problem, Persoon (1822) described 'Fumago vagans' as a single species, but later investigation proved it to be a mixture of two ascomycetous fungi, Cladosporium and Aureobasidium (Friend 1965; Hughes 1976). Most sooty molds have never been analyzed phylogenetically, leaving open numerous questions about their evolution and taxonomy (Crous et al. 2009a; Hyde et al. 2011; Lumbsch and Huhndorf 2010).  1.2 Literature Review: As the sooty molds are capnodiaceous fungi (Hughes 1976; Reynolds 1976) I will briefly discuss Capnodiales, Capnodiaceae and Asbolisiaceae (the form family for asexual members of Capnodiaceae) in the following sections.  1.2.1 Capnodiales: Dothideomycetes is a systemic assemblage of fungi within Ascomycota, which includes pathogens, saprobes, epiphytes and a few lichenized species (Schoch et al. 2009a). Dothideomycetes encompasses two sub-classes, Pleosporomycetidae and Dothideomycetidae (Schoch et al. 2009a; Schoch et al. 2006). Capnodiales Woronichin  !  2!  (1925) is included under the sub-class Dothideomycetidae along with Dothideales and Myrangiales (Crous et al. 2009a). Capnodiales include families Antennulariellaceae, Capnodiaceae, Metacapnodiaceae, Davidiellaceae, Dissoconiaceae, Mycosphaerellaceae, Schizothyriaceae, Teratosphaeriaceae and Piedraiaceae (Aptroot 2006; Crous 2009; Hughes 1976; Kirk et al. 2008; Lumbsch and Huhndorf 2010).  1.2.2 Capnodiaceae: The family Capnodiaceae (Saccardo) Höhnel ex Theissen (1915) is regarded as a monophyletic group of sooty molds. The term ‘sooty mold’ was initially coined for fungi in the family Capnodiaceae that are associated with sap-sucking insects. Later the term 'sooty mold' was used informally and much more broadly to include nearly all epiphyllous fungi from Ascomycota that have darkly pigmented mycelia, regardless of their nutritional traits. This broad use of the term was opposed by Stevens (1931). Stevens argued that Meliolales, although dark and sooty in appearance should not be considered sooty molds because they are plant parasites and are not associates of sapsucking insects. Reynolds (1976) also restricted 'sooty mold' to describing capnodiaceous fungi. I will follow Stevens (1931) and Reynolds (1976) in considering 'sooty molds' to refer to fungi in Capnodiaceae. In their development, sooty molds start off as a thin hyphal layer on the abaxial surface of leaves and branches of their host plants. They rapidly transform into a dense mycelial layer on the plants' outer surfaces, sometimes even forming a pseudoparenchymatous crust (Hughes 1976). These fungi possess a hydrophilic  !  3!  mucilaginous outer wall (Cheewangkoon et al. 2009; Hughes 1976; Manoharachary et al. 2004) that helps attach them to the leaf surface while creating a moist microenvironment necessary for survival and growth. The characteristic mucilaginous outer wall is retained even in old herbarium specimens (Hughes 1976). Sooty molds are dimorphic fungi, which means that they have an asexual or mitosporic (anamorphic) phase and a sexual or meiosporic (teleomorphic) stage in their life cycles. The two life cycle stages seldom grow together. Some sooty molds produce more than one type of asexual spores. In some species, fragments of mycelium act as propagules that mimic mitospores (Hughes 1976). The teleomorphic phase is characterized by ascomata bearing asci and the meiospores, or ascospores. Sooty molds seem to display low host specificity, possibly because they do not depend on the host plant for nutrition (Hughes 1976). For example, Trichopeltheca asiatica Batista et al. (1957), has been reported to grow on more than 80 host species, spanning all major lineages of vascular plants (Hughes 1976). Sooty molds rarely form a thick mat in the absence of sap-sucking insects. Batista and Ciferri (1963a) and Hughes (1976) predicted that the composition of honey dew excreted by the scale insects probably has some nutritional effect on the epiphyllous sooty mold diversity, although the hypothesis has yet to be proved. Historically, the family Capnodiaceae was described by Höhnel (1910) and was later revised by Theissen (1915). Batista and Ciferri (1963a) included 40 genera in Capnodiaceae. This number was reduced to 17 by Luttrell (1973) and Arx and Müller (1975). Currently the family includes 13 genera of fissitunicate ascomycetous fungi: Aithaloderma, Anopeltis, Callebaea, Capnodaria, Capnodium, Capnophaeum,  !  4!  Ceramoclasteropsis, Echinothecium, Hyaloscolecostroma, Phragmocapnias, Polychaeton, Scoriadopsis, Scorias (Lumbsch and Huhndorf 2010). Of these genera, only Capnodium, Phragmocapnias and Scorias have been analyzed using molecular systematics (Chomnunti et al. 2011; Crous et al. 2009a; Schoch et al. 2009a; Schoch et al. 2006). A series of molecular phylogenetic papers have further clarified the limits to the Capnodiaceae. Previously, Capnodiaceae included several divergent taxa. Fungi from the family Chaetothyriaceae were once regarded as a part of Capnodiaceae due to their gross morphological resemblance (Chomnunti et al. 2012; Hughes 1976). In his review of sooty molds Hughes (1976) commented on his discomfort in incorporating Chaetothyrina into Capnodiaceae due to their morphological differences. Molecular systematics studies starting in the late 1990s (Winka et al. 1998) and early 2000s (Lumbsch and Lindemuth 2001) showed that Hughes' unease was well placed because Capnodiaceae are in the Dothideomycetes, while Chaetothyriaceae belong in the Eurotiomycetes, in a different class.  1.2.3 Asbolisiaceae: It may be challenging to understand the systematics of mitosporic sooty molds without referring to Asbolisiaceae or without explaining the consequences of changes to the code of nomenclature, implemented in Jan 2013, which affect these asexual fungi. The family Asbolisiaceae was a product of the dual system of nomenclature for fungi. Before 2013, by the Code of Botanical Nomenclature (Article 59.1-59.7, ICBN, Vienna Code, McNeill and IAPT 2006), asexual species of fungi were classified separately into form taxa such  !  5!  as Asbolisiaceae instead of being classified phylogenetically based on their relationships. Spegazzini (1918) analyzed a collection of tropical sooty molds and concluded that Capnodiaceae was a “heterogeneous and irrational” group. He removed species that lacked a sexual state from the phylogenetic group “Capnódieas” (≡ Capnodiaceae) and put them in the form group “Deutocapnódieas”. The asexual Deutocapnódieas were then divided into two subgroups, Asbolisíeas (≡ Asbolisiaceae), which produced mitospores (conidia) within flask shaped, asexual fruiting bodies (pycnidia), and Hypasbolísieas (≡ Hypasbolisiaceae), which produced conidia without surrounding pycnidia. Well after Spegazzini (1918) first described Asbolisíeas, Batista and Ciferri (1963b) promoted Asbolisiaceae to the level of a form family that included 28 genera with 121 species. Among these fungi, asexual spores or conidia are produced in pycnidia. The morphology of pycnidia varies widely within the family, ranging from spheroidal to elongate hornshaped (Batista and Ciferri 1963b). Conidia are hyaline to brown and septate or aseptate, but are relatively small in size. Form genera in the asexual Capnodiaceae (=Asbolisiaceae) included Acanthorus, Apiosporium, Conidiocarpus, Conidioxyphium, Fumagospora, Fumiglobus, Leptoxyphium, Mycogelidium, Phaeoxyphiella, Polychaetella, Polychaeton, Scolecoxyphium, and Tripospermum (Hyde et al. 2011). With the updated International Code of Nomenclature for algae, fungi, and plants (Article 59, ICBN, Melbourne Code, McNeill et al. 2012), all of the names listed above compete for priority with names originally applied to teleomorphs, even though the names were traditionally applied only to anamorphs. Under the current code, the family Asbolisiaceae has been synonymized under Capnodiaceae (Hyde et al. 2011; Lumbsch and Huhndorf  !  6!  2010). The name Capnodiaceae has priority over Asbolisiaceae, as it is the older validly published name (Article No. 11.1, ICBN Melbourne code). Spegazzini (1918), while establishing Asbolisíeas, designated Asbolisia ampullula (Spegazzini) Spegazzini (1918) as the type of a genus that included 11 species of ostiolated, pycnidial sooty molds, all of which he had previously classified under the genus Chaetophoma. Petrak and Sydow (1935) considered A. ampullula to be misclassified and consequently transferred the fungus to Cicinnobella ampullula (Spegazzini) Petrak and Sydow (1935). Hughes (1976), after examining the holotype of A. ampullula, supported Petrak and Sydow's (1935) decision. Confusingly Batista and Ciferri (1963b) next tried to replace A. ampullula as the generic type by proposing an indigenous Brazilian species, Asbolisia citrina Batista and Ciferri (1963b), as a lectotype for the genus. Their goal was to conserve the genus name 'Asbolisia' (Batista and Ciferri 1963b), but their strategy was flawed. Strictly defined, a lectotype is one of the syntypes that serves as the nomenclatural type in a case where no holotype is indicated by the author during the publication of the taxon, or when the holotype is lost or consists of more than one taxon (Article No. 9.2, ICBN Melbourne code). None of these criteria for lectotypification were applicable in this case, especially since Asbolisia citrina was never a syntype of A. ampullula. I support Hughes (1976) in stating that this taxonomic modification of Asbolisia by Batista and Ciferri (1963b) was unacceptable and incorrect. Following Petrak and Sydow (1935) and Sutton (1977), Kirk et al. (2008) designated the genus Asbolisia as a nomen dubium. Recently Reynolds and Gilbert (2006) erected a new genus, Fumiglobus, for former Asbolisia species.  !  7!  I conclude this section by stating that the sooty mold family Capnodiaceae is one of the unique groups of foliicolous fungi within Ascomycota. Very few molecular phylogenetic studies have been conducted on this group. Hence, the family Capnodiaceae deserves more attention in the future regarding its taxonomy and phylogeny (Crous et al. 2009a).  1.3 Research Objectives: I initiated my survey of the capnodiaceous fungi by trying to identify sooty molds in Vancouver. One that particularly caught my attention was found on Pieris japonica (Thunb.) D. Don ex G. Don (1934) (Japanese andromeda), an introduced ornamental plant in our area. To identify the sooty mold on P. japonica I consulted two experts, Dr. Bryce Kendrick and Dr. Don R. Reynolds. Dr. Kendrick suggested the mold could be Conidiocarpus sp., whereas Dr. Reynolds putatively identified it as Fumiglobus didymopanacis. Although their identifications differed, both agreed on its capnodiaceous affinity. Both Conidiocarpus and Fumiglobus are tropical molds, and so finding either in a temperate region would be unexpected. For comparison with my specimens and these genera, I procured herbarium specimens for Conidiocarpus caucasicus Woronichin (1917) and borrowed specimens of type species of Fumiglobus, as well as specimens of local sooty molds found on Ericaceae. Against this background, I identified two objectives that could be addressed through the course of my thesis work. I first wanted to apply molecular systematics to locate the phylogenetic position of the sooty mold species on Pieris within Ascomycota and among the other Capnodiaceae. After comparisons with other species in Capnodiaceae, it  !  8!  became clear that the mold on Japanese andromeda is a new species and so I describe it, comparing it with related species by using morphological analysis of herbarium specimens. My comparisons with other Capnodiaceae species also provided DNA evidence to link the sexual and asexual components of the life cycle of Phragmocapnias/Conidiocarpus. Finally, I test whether pycnidia were likely to have been the ancestral fruiting structures for the sooty mold family Capnodiaceae.  !  9!  Chapter 2: Taxonomy and Phylogeny of Mitosporic Capnodiales and Description of a New Sooty Mold Species, Fumiglobus pieridicola, from British Columbia, Canada.  2.1 Introduction: Capnodiaceae (Saccardo) Höhnel ex Theissen (1915) is the family of 'sooty molds', named for their darkly pigmented mycelium, which forms a felt-like layer on plant leaves or stems (Hughes 1976; Reynolds 1976; Stevens 1931). Defined strictly, sooty molds are almost always associated with sap-sucking insects. The sooty molds use the honeydew produced by the insects as a nutritive substrate (Andrew 1992; Blakeman and Fokkema 1982; Chomnunti et al. 2011; Hughes 1976; James et al. 2007; Kelly 1990). Capnodiaceae is further characterized by superficial interwoven mycelium with mucilaginous outer walls (Chomnunti et al. 2011; Hughes 1976; Sivanesan 1984). Hyphae are composed of darkly pigmented cylindrical cells with constricted septa (Batista and Ciferri 1963b; Chomnunti et al. 2011; Hughes 1976). The epiphyllous colonies of sooty molds are often composed of several different species of capnodiaceous fungi (Chomnunti et al. 2011; Hughes 1976), making them a challenge for molecular analysis. Reproductive characters are needed for identification of fungi, but the asexual fruiting bodies are small and difficult to recognize among the somatic mycelium. The most important taxonomic monographs to identify Capnodiaceae molds were published by Batista and Ciferri (1963a; 1963b) and were only available in a few university libraries until their recent distribution via Cyberliber,  !  10!  (http://www.cybertruffle.org.uk/cyberliber/) (Minter and Tykhonenko 2013), an electronic library for mycology. My thesis focuses on an unidentified sooty mold that colonizes the introduced ornamental shrub Pieris japonica (Japanese andromeda). The fungus is one of the most common and striking fungi on plants of Vancouver, British Columbia, in western Canada. Nearly the entire population of Japanese andromeda within the University of British Columbia Vancouver campus and adjoining area is covered with this unidentified pycnidial sooty mold. The sooty mold on Japanese andromeda, according to Schread (1970), was reported from North America at least a century ago. The range of the fungus is unclear, possibly because it is underreported. Sooty molds on Japanese andromeda are mentioned in home gardening advice columns and extension pamphlets from North America (University of Idaho Extension Service 2006; Valchar 1993). Gardeners are advised to treat the 'unsightly' fungus using an insecticide to kill the insects that feed on the plant. Sooty mold fungi do not cause any direct harm to the plant, but the black sooty deposits on the leaves block sunlight. Decreased light lowers photosynthetic activity, which may lead to premature cholorosis and leaf fall (Buczacki et al. 2010). Identification of sooty mold on Japanese andromeda is possibly considered unessential because eradication of insects eventually restricts the sooty mold growth. The fungus has not yet been identified beyond its common name. Morphological identification of sooty molds is based on hyphal structure, the presence or absence of pseudoparaphyses, and characters of the asexual stage (Hughes 1976). The unknown sooty mold produces pycnidia, or closed, flask-like asexual structures. The morphology of the local sooty mold on Japanese andromeda suggests it could be a  !  11!  Fumiglobus or Conidiocarpus species. The genus Fumiglobus comprises nine saprotrophic species of tropical sooty molds (Reynolds and Gilbert 2006). Plants hosting Fumiglobus can include Rutaceae, Araliaceae, Apocynaceae, Cornaceae, Cupressaceae etc., and species have been reported from North America, South America, Africa, Australia, Asia (Batista and Ciferri 1963b), and India (Sharma and Agarwal 1977). Conidiocarpus in contrast is a small genus with only three identified species. Neither genus has been reported from a cold temperate region like Vancouver, and my species did not closely match other described species. In terms of resources for identification, Fraser (1935) published the first monograph for capnodiaceous sooty molds, encompassing both sexual and asexual taxa as the Eucapnodieae. Later, Batista and Ciferri (1963a) segregated the sooty molds into two groups, placing the sexual forms in Capnodiaceae while moving the mitosporic molds to the newly erected family Asbolisiaceae (Batista and Ciferri 1963b). Currently the family Capnodiaceae includes 12 genera and 117 species, mostly with uncertain phylogenetic placements (Chomnunti et al. 2011; Kirk et al. 2008; Lumbsch and Huhndorf 2010). Reynolds (1998) used small subunit (SSU) rDNA data in the first molecular phylogenetic analysis of sooty mold. Reynolds’ study included two sexual and three asexual species from Capnodiaceae. Schoch et al. (2009a; 2006) included a limited number of taxa from Capnodiaceae as part of their phylogenetic survey of Dothideomycetes, and Chomnunti et al. (2011) published the first multi-gene phylogeny of the family. Through this study, I identify the unknown sooty mold on Japanese andromeda as a new species of Fumiglobus, ‘Fumiglobus pieridicola,’ using comparisons with available herbarium specimens and published descriptions. Using a phylogeny from the nuclear  !  12!  ribosomal large and small subunit genes, I analyze the relationships of the unknown species to other species in the Capnodiaceae and Capnodiales. Lastly, I use ancestral-state reconstruction to test whether pycnidia qualify as the ancestral mitosporic fruiting type for Capnodiales.  2.2 Materials and Method: Fungal and Insect Specimens: I collected the sooty mold growing on Pieris japonica (Japanese andromeda) from the University of British Columbia, Point Grey Campus from February 2011 to July 2012. Ludovic Le Renard and Anna Bazzicalupo collected sooty mold on the same host from Oregon, USA in May 2013. I deposited all the collections in the UBC herbarium. I also looked for herbarium specimens of similar sooty molds and borrowed Capnodium walteri specimens from DAVFP, the herbarium of Pacific Forestry Centre, Canadian Forest Service, Victoria, British Columbia. I examined Conidiocarpus caucasicus (Gilan University Mycological Herbarium, GUMH 937 and University of British Columbia Herbarium, UBC F23755) collected from Nashtārūd, Māzandarān Province, Iran by F. Byrami, in June 2011. I borrowed holotypes of Fumiglobus species from the University Herbarium (UC), University of California, Berkeley. I collected the female scale insects that were associated with the mold on Japanese andromeda from Vancouver and preserved them in ethanol (70%) or dried them at 40°C. I forwarded samples to Dr. Gillian W. Watson, Senior Insect Biosystematist, California Department of Food & Agriculture, Sacramento, California, for identification.  !  13!  Light microscopy: I prepared slides for microscopic study of the unknown sooty mold, of Conidiocarpus caucasicus and of holotypes of Fumiglobus species. Fresh fungal tissues were mounted in water. Dried fungal materials (including holotypes) were placed in 5% aqueous KOH solution for 2-5 min and then mounted in water. Mean values of 50-100 measurements are indicated within parentheses with extreme values in brackets. I made freehand drawings, and took photographs using a Leica DFC420 Digital Color Camera and a Leitz® DMRB DIC Research Microscope. I used a Leica M205C with a DFC490 Digital Color Camera to photograph the scale insects associated with Japanese andromeda.  DNA Extraction, Amplification and Sequencing: I extracted the total genomic DNA from the fresh fungal tissue of the unknown sooty mold and from dried tissue of Conidiocarpus caucasicus and Capnodium walteri. I carried out DNA extraction using DNeasy® Plant Mini Kit (QIAGEN Inc., Canada) following the manufacturer’s protocol. I amplified the nuclear LSU and SSU r-DNA regions for all three fungal specimens using fungal specific primer pairs LROR/LR8, LR3R/LR9, LR7R/LR12, LR8R/LR11and NS1/NS4, NS3/NS8 and NS19/NS6, respectively (Table 1). I encountered some contamination while trying to sequence the SSU gene for the unknown sooty mold, apparently due to a mixed population of fungi on the leaf surface. To separate the different DNAs, I cloned the PCR product using TOPO® TA Cloning® Kits (Life Technologies, Canada) following the manufacturer’s protocol. I re-amplified the cloned DNA fragments using M13F/M13R primers. I used the following conditions  !  14!  for PCR reactions (including amplification of clones): initial denaturation 94°C for 5 min, followed by 40 cycles of 94°C for 10 s, 55°C for 20 s, 72°C for 3 min, and final elongation at 72°C for 7 min. I cleaned the PCR product using ethanol precipitation followed by sequencing using one of the primers mentioned above, with an ABI PRISM BigDye® Terminator Cycle Sequencing Kit V3.1 (Life Technologies-Applied Biosystems, Canada) following the manufacturer’s protocol. The Nucleic Acid-Protein Service Unit in the Biotechnology Laboratory, University of British Columbia performed the electrophoresis. If sequence ambiguities remained after alignment of the forward and reverse amplicons, I re-extracted DNA and re-sequenced it, as above. I used Sequencher V4.10.1 (Gene Codes, Ann Arbor, MI) to assemble the amplicons.  Taxon Selection and Alignment: I sampled fungi representing major clades of Ascomycota, using literature searches to help find sequences representing the diversity within the phylum, and sequence similarity searches to find sequences related to target taxa. I performed the sequence similarity search in GenBank using the BLAST algorithm (Altschul et al. 1990) (http://blast.ncbi.nlm.nih.gov/). To retrieve sequences for Capnodiales, I used query sequences from the unknown sooty mold and C. caucasicus, and eight published Conidiocarpus sequences by Chomnunti et al. (2011). I selected sequences for retrieval guided by the BLAST distance tree tool. I selected additional sequences for Capnodiales from Crous et al. (2007a; 2009a) and Schoch et al. (2009a, 2006). For outgroups, I chose DNA sequences for other groups of Ascomycota from the datasets used by James et al. (2006) available at (http://wasabi.lutzonilab.net/pub/alignments/download_alignments). I  !  15!  also included Basidiomycota among the outgroups, selecting one representative each from Pucciniales, Ustilaginales, Polyporales and Agaricales. I initially aligned the LSU and SSU r-DNA regions separately using MAFFT (Katoh et al. 2005) through the EMBL-EBI server (http://www.ebi.ac.uk/Tools/msa/mafft/). I manually improved the alignment using Se-Al Sequence Alignment Editor V2.0a11 (Rambaut 2002) and Mesquite V2.75 (Maddison and Maddison 2011). I excluded ~50 bp from the 5’ and 3’-region of each dataset due to variation that appeared to result from sequencing error. I then tried two alternative approaches to excluding data: (1) To retain as much data as possible, I performed a block-wise alignment of the highly variable regions within the LSU and SSU r-DNA datasets for closely related taxa and then manually excluded unaligned regions within the datasets. (2) For a more conservative approach, I eliminated poorly aligned and divergent regions using Gblocks V0.91b (available at http://molevol.cmima.csic.es/castresana/Gblocks_server.html), selecting the less stringent options (Talavera and Castresana 2007). I used RAxML V7.4.2 (Stamatakis 2006) to run several preliminary phylogenetic analyses using both manually aligned and Gblocks generated files. After preliminary analysis, I excluded the sequences for the following capnodiaceous fungi from my datasets: Devriesia americana (LSU: EU040227; SSU: AY251100), Brunneosphaerella protearum (LSU: GU214394; SSU: JN938706), Pseudocercospora vitis (LSU: GU253844; SSU: DQ289864) and Passalora vaginae (LSU: GQ852624; SSU: GU214561), because the phylogenetic positions of these taxa conflicted between the LSU and SSU trees and I could not rule out that one or both of the sequences from each species came from a contaminant. I also excluded a sequence that I had determined from a culture of Fumiglobus sp. (American Type Culture  !  16!  Collection ATCC#22041) because my preliminary phylogenetic trees showed the fungus to be a member of Pleosporales rather than Capnodiaceae, indicating that the culture was probably of a contaminant. I compared my preliminary trees from alignments where sites were excluded manually or with Gblocks with published trees by Chomnunti et al. (2011), Crous et al. (2007, 2009a) and Schoch et al. (2009a, 2006). The phylogenies from alignments from Gblocks showed an overall decrease in bootstrap support and resolution, especially within Capnodiales. The support for Capnodiaceae as monophyletic lineage decreased to 65%. Scorias spongiosa was depicted as the sister group to the rest of Capnodiales rather than Capnodiaceae. My manually edited datasets did not show such incongruences hence I selected these for further analysis. The final alignment included 150 taxa with 1305 characters from the LSU and 1595 from the SSU. I generated a concatenated dataset (LSU + SSU r-DNA) using Mesquite V2.75. For accession numbers of the sequences used for phylogenetic analysis, see Supplementary Table 1.  Phylogenetic Analysis: For analysis, I selected the general time reversible (GTR) model along with a gamma distribution using jModelTest 2.1 (Darriba et al. 2012; Guindon and Gascuel 2003). I used RAxML V7.4.2 (Stamatakis 2006) to perform three independent maximum likelihood searches for alignments of: (1) partial LSU r-DNA, (2) partial SSU r-DNA and (3) a concatenated dataset encompassing both partial LSU and SSU r-DNA genes. I performed 50 independent likelihood searches followed by 500 bootstrap replicates under the GTRGAMMA model for each dataset. I interpreted ≥70% bootstrap support value as  !  17!  moderate, while clades with ≥90% were considered to have strong support. I considered the clades with <70% support value as unreliable. The phylogenetic trees were rooted and modified using FigTree V1.4 (available at http://tree.bio.ed.ac.uk/software/figtree/) and Mesquite V2.75.  Reconstruction of Ancestral States: The maximum likelihood tree from RAxML V7.4.2 for the concatenated dataset served as input to trace the evolution of pycnidia within Capnodiales. I re-rooted the tree using Dothideales as the only outgroup, excluding other taxa. I used following coding for the analyses: 1 = pycnidium present; 0 = all other mitosporic fruit bodies. Unknown mitosporic states were coded as a missing data (-). Descriptions of the reproductive states for the capnodiaceous fungi included in this study are provided in Supplementary Table 2. I analyzed evolutionary gain and loss of pycnidia using parsimony and then with likelihood (Table 2). I performed a likelihood ratio test with Mesquite V2.75 to compare the fit of my data against two alternative models of character evolution. The Asymmetrical Markov k-state two parameter (AsymmMk) model assumed that gain and loss of pycnidia occurred at different rates, while the Markov k-state one parameter (Mk1) model assumed that gain and loss occur at the same rate. My null hypothesis was that a single rate of gain and loss best described evolution of the pycnidia. I would have rejected the null hypothesis if p ≤ 0.05. However, from the likelihood ratio test, p = 0.0993 and so the null hypothesis could not be rejected. For my dataset I therefore selected the simpler symmetrical model, Mk1 (Lewis 2001), with an identical rate for forward and backward change. However, the  !  18!  more complex AsymmMk model had a higher likelihood and it would have been significantly better had I used a p ≤ 0.1 cutoff. For this reason I explored reconstructions under the AsymmMk method as well (Table 2). To evaluate the consequences of missing data, I tested the results from coding all the missing data either as 1 or 0 (Table 2). I found the lowest estimate for rate of change between character states, 29.2, under Mk1 model when I coded unknown mitosporic states as missing data. Coding all the missing states as '1' increased the rate to 74.9 and coding missing states to '0' raised rates to 167.8. This was the expected result if reconstructions for the missing data were being carried out correctly to minimize change.  2.3 Results: Phylogenetic analysis The unknown species of Fumiglobus, described below as ‘Fumiglobus pieridicola’ is the first sequenced representative of its genus. ‘Fumiglobus pieridicola’ is within Capnodiaceae, in a clade that also includes Capnodium coffeae, with 94% bootstrap support from the concatenated dataset (Figure 1). Within Capnodiaceae, Scorias spongiosa is the earliest diverging taxon, although without substantial bootstrap support (Figures 1, 2 and 3). Fumiglobus pieridicola is then sister to the rest of the Capnodiaceae (Figures 1, 2 and 3). As predicted, the anamorphic type species Conidiocarpus caucasicus was part of a clade with three Conidiocarpus species, C. betlus, C. siamensus and C. asiaticus, with 85% bootstrap support from the concatenated dataset (Figure 1) and 89% support from the SSU dataset (Figure 3). All the Conidiocarpus species in the analysis except for C.  !  19!  caucasicus have a sexual state, and because of this, they had been placed in Phragmocapnias. Phragmocapnias betle is the type species for the teleomorph genus. The close relationship between the type species for the anamorph and the type species for the teleomorph supports Conidiocarpus Woronichin (1917) as the anamorph of Phragmocapnias Theissen and Sydow (1918). By the rules of nomenclatural priority (Article No. 59, ICBN Melbourne Code), the name of the holomorph genus is Conidiocarpus. This requires new combinations, given below. In the phylogeny of the Ascomycota, many of the same clades received support from the concatenated dataset (Figure 1) and individual analysis of LSU (Figure 2), and SSU dataset (Figure 3). I recovered strong support from the concatenated dataset for Capnodiales being monophyletic within Ascomycota and moderate support for it being the sister group to Dothideales (Figures 1). The same topology appeared, although with less support, for the individual datasets (Figure 2 and 3).  Ancestral state reconstruction Ancestral-state reconstruction for the evolution of pycnidia did not resolve the ancestral fruiting type for Capnodiales (Figure 4) under Mk1 model, but the pycnidium was the most likely ancestral mitosporic fruiting state for Capnodiaceae. The proportional likelihood of a pycnidial ancestor for the remaining Capnodiaceae after the divergence of Fumiglobus pieridicola is 95.2% (Figure 4, pie charts A and B). The parsimony reconstruction predicts at least four independent evolutionary origins of pycnidia within Capnodiales, when the unknown mitosporic states were coded as missing data. Evolutionary patterns of pycnidial gain and loss within Capnodiaceae or  !  20!  Mycosphaerellaceae were similar whether the missing data were coded as absent or present (Table 2). I observed a significant decrease in the proportional likelihood for a pycnidial ancestor for Capnodiaceae when the unknown mitosporic states were coded either 1 or 0, under both the likelihood reconstruction models AsymmMK and MK1 (Table 2).  Identification of Scale Insect on Pieris japonica: Dr. G. W. Watson identified the scale insect as Pulvinaria cf. acericola Walsh and Riley (1868) (Figure 5). While the generic identity was clear, the species is uncertain.  Taxonomy Description of the New Sooty Mold Species:  Fumiglobus pieridicola sp.nov., ined.  (Figures 6, 7 and 8)  MycoBank: MB 803877 Host: Pieris japonica (Ericaceae); common name Japanese andromeda, and Arbutus menziesii (Ericaceae); common name Pacific madrone. Insect Associated with Japanese andromeda: Pulvinaria cf. acericola Etymology: growing on Pieris japonica. Holotype: UBC F23788, 15 February 2011, University of British Columbia, Point Grey campus, near Chemistry building on the leaves of Pieris japonica (Ericaceae). Specimens examined: CANADA. BRITISH COLUMBIA: Vancouver, UBC, Vancouver Campus, near Chemistry building, 49°15!47.4078!!N 123°15!3.9162!!W, on Pieris  !  21!  japonica, 15 February 2011, UBC F23788, UBC F23789; 13 June 2011, UBC F23790, UBC F23791; UBC, Vancouver Campus, Near Cunningham building 49°15!53.046!!N 123°14!53.7478!!W, 13 June 2011, UBC F23792, UBC F23793, UBC F23794, UBC F23795; UBC, Vancouver Campus, near the Museum of Anthropology 49°16!11.0892!!N 123°15!27.4566!!W, 13 June 2011, UBC F23796, UBC F23797; UBC, Vancouver Campus, Wesbrook Mall, near UBC Bus Loop 49°16!5.9736!!N 123°14!49.9518!!W, 13 June 2011, UBC F23798. Victoria, 80 High Street, on Arbutus menziesii, 29 August 1978, DAVFP 21836, collected by J. A. Calder. DAVFP 21836 is a collection of Capnodium walteri on the leaves of Arbutus menziesii. Funiglobus peridicola was growing along with the mitosporic state of Capnodium walteri. Capnodium walteri was easily distinguished from F. pieridicola in having a flask-shaped pycnidium, liberating straight to fusiform pycnidiospores with 7-12 transverse septations. The measurements for pycnidia and mycelia for F. peridicola on A. menziesii match its counterpart on the leaves of Japanese andromeda. I did not observe pycnidiospores in the F. pieridicola on this specimen. UNITED STATES OF AMERICA. OREGON: Corvallis, Oregon State University, Monroe and 16th Avenue, south sidewalk, on P. japonica, 17 May 2013, UBC F23809, UBC F23810, collected by L. Le Renard and A. Bazzicalupo. Corvallis, Harrison Blvd., in Brian Atkinson Garden, on P. japonica, 17 May 2013, UBC F23808, collected by L. Le Renard and A. Bazzicalupo. Known distribution: West coast, N. America. Known from Vancouver BC, Victoria BC, Canada and Corvallis, OR, USA. Possibly widely distributed worldwide where Pieris japonica is cultivated, but under-reported.  !  22!  Description: Latin diagnosis Mycelium epiphyllum, saprophyticum, supificiare, mucilaginum, cribratum, patulum atrobrunneum vel nigerum. Hyphae dilutae atrobrunneae septatae, ad septa constricta, moniliformes, leves ramosae irregulariter apicibus acuta; cellulis x = 4.5 ✕ 6 µm (magnitudo = 4.5-10.5 ✕ 6.5-13.5 µm; N = 100). Hyphae immaturae hyalinae vel dilutae brunnae; cellulis x = 1.5 ✕ 3 µm (magnitudo = 1.5-3 ✕ 3-4.5 µm; N = 100). Pycnidia superficiaria, apicalis et intercalaria, pycnidia apicalia pyriformia, x = 30 ✕ 25 µm (magnitudo = 30-75 ✕ 25-67.5 µm; N = 75) stipitibus bulbosis, biseriatis (longitudine et latitudine plerumque variabilibus), x = 7.5 ✕ 8.5 µm (magnitudo = 6-10 ✕ 6-8.5 µm; N = 75), atrobrunnea, glabris, membranaceis, pseudoparenchymatis, cellulis parietis 4-6 lateribus, interstitiis cellulis absenti, osteolo fimbriati, x = 10.5 ✕ 12 µm (magnitudo = 6-12 ✕ 10.5-15 µm; N = 75), pycnidia intercalaria subglobosa, x = 30 ✕ 28 µm (magnitudo = 30-65 ✕ 28-68 µm; N = 75), stipites, lateralis x = 8 ✕ 10 µm (magnitudo = 6.5-9 ✕ 8-10 µm; N = 75). Pycnidiosporae globosae ad ovoidae, hyalinae, continuae, diametris x = 1.75 µm (magnitudo = 1.5-4.5 µm; N = 100), 1-4 guttulatae.  English diagnosis Mycelium epiphyllous, saprophytic, superficial, mucilaginous, cribriform, spreading, dark brown-black. Hyphae light-dark brown, septate, constricted at septum, moniliform, smooth walled, branched irregularly, hyphal tips acute, cells x = 4.5 ✕ 6 µm (4.5-10.5 ✕ 6.5 - 13.5 µm; N = 100); immature hyphae hyaline or with a light brown hue, cells x = 1.5 ✕ 3 µm (1.5-3 ✕ 3 - 4.5 µm; N = 100). Pycnidia superficial, apical and intercalary in !  23!  position; apical pycnidia pyriformis x = 30 ✕ 25 µm (30-75 ✕ 25 - 67.5 µm; N = 75), with bulbous, bi-seriate stalk (usually, variable in length and width), x = 7.5 ✕ 8.5 µm (6-10 ✕ 6-8.5 µm; N = 75), dark brown, glabrous, membranous, pseudoparenchymatous, wall made out of 4-6 sided cells, intercellular space absent, ostiole fimbriate, x = 10.5 ✕ 12 µm (6-12 ✕ 10.5-15 µm; N = 75); intercalary pycnidia sub-globose x = 30 ✕ 28 µm (30-65 ✕ 28-68 µm; N = 75) with lateral stalk (usually) x = 8 ✕ 10 µm (6.5-9 ✕ 8-10 µm; N = 75). Pycnidiospores round to slightly oval, hyaline, continuous, x= 1.75 µm (1.5 - 4.5 µm; N = 100) in diameter, 1-4 gutulate. Notes: Fumiglobus didymopanacis is the closest match to F. pieridicola although the morphology of pycnidia and pycnidiospores varies greatly within the two species (Table 3). Fumiglobus pieridicola has stalked pyriform pycnidia, apical or intercalary in position (apical pycnidia x = 30 X 25 µm; intercalary pycnidia x = 30 X 28 µm) with isodiametric pycnidiospores with a mean diameter of 1.75 µm, quite close to F. didymopanacis, where the both pycnidia (40-70 X 43-60 µm) and pycnidiospores (x = 1.5 X 2.2 µm) are slightly elongated along its long axis (Batista and Ciferri 1963b). Although the spore measurements for F. pieridicola fall within the range of F. didymopanacis, they do not fall within the range of other Fumiglobus species (Table 3) (Batista and Ciferri 1963b). The pycnidiospores of F. pieridicola are the smallest among all reported species of Fumiglobus. The hyphal cells of F. pieridicola are almost isodiametric, with a mean length-to-width ratio of 1.3 µm (1.16 – 1.44 µm; N = 100), while in F. didymopanacis the cells are elongate, with a mean length-to-width ratio of 3.3 µ (3.0 3.75 µm; N = 100). I failed to observe any bacillar pycnidiospores in the holotype of F. didymopanacis, as previously reported by Batista and Ciferri (1963b). !  24!  Fumiglobus didymopanacis has been reported from Brazil and Australia growing on Schefflera morototoni (  Didymopanax morototoni), Artocarpus, Eucalyptus and  Baccharis (Batista and Ciferri 1963b). Although the genus Fumiglobus had never been reported from a temperate region of the world, its wide host range does not rule out the possibility it might grow on Pieris japonica.  Additional Fumiglobus species examined from University of California, Berkeley herbarium (UC)  Fumiglobus didymopanacis (Batista, Nascimento & Ciferri) D.R. Reynolds & G.S. Gilbert, Cryptogamie Mycologie, 27(3): 254, 2006. [MycoBank MB522430] Specimen examined: UC1994100  (Figure 9)  Asbolisia didymopanacis Batista, Nascimento & Ciferri, Quaderno del Laboratorio Crittogamico del Istituto Botanico dell'Università di Pavia, 31:40, 1963. [MycoBank MB326505]  Fumiglobus ficinus (Batista, Nascimento & Ciferri) D.R. Reynolds & G.S. Gilbert, Cryptogamie Mycologie, 27(3): 253, 2006. [MycoBank MB520906] Specimens examined: UC1999506, UC1999511, UC1999512, UC1999513 = Fumiglobus ficina (Batista, Nascimento & Ciferri) D.R. Reynolds & G.S. Gilbert, Cryptogamie Mycologie, 27(3): 253, 2006. [MycoBank MB520906]  !  25!  Asbolisia ficina Batista, Nascimento & Ciferri, Quaderno del Laboratorio Crittogamico del Istituto Botanico dell'Università di Pavia, 31:41, 1963. [MycoBank MB326506]  Fumiglobus citrinus (Batista & Ciferri) D.R. Reynolds & G.S. Gilbert, Cryptogamie Mycologie, 27(3): 254, 2006. [MycoBank MB522431] Specimens examined: UC1999509, UC1999510 = Fumiglobus citrina (Batista & Ciferri) D.R. Reynolds & G.S. Gilbert, 2006. [MycoBank MB527992] Asbolisia citrina Batista & Ciferri, Quaderno del Laboratorio Crittogamico del Istituto Botanico dell'Università di Pavia, 31:38, 1963. [MycoBank MB326504] Fumiglobus citrina (Batista & Ciferri) D.R. Reynolds & G.S. Gilbert, 2006 [MycoBank MB527992]  Fumiglobus juniperinus (Baccarini) D.R. Reynolds & G.S. Gilbert, Cryptogamie Mycologie, 27(3): 254, 2006. [MycoBank MB522426] Specimens examined: UC1999514 = Fumiglobus juniperina (Baccarini) D.R. Reynolds & G.S. Gilbert, 2006. [MycoBank MB527995] Asbolisia juniperina (Baccarini) Cifferi & Batista, Quaderno del Laboratorio Crittogamico del Istituto Botanico dell'Università di Pavia, 31:43, 1963. [MycoBank MB326509]  !  26!  Capnodium juniperinum Baccarini, Annali di Botanica, 14(3): 117-140, 1917. [MycoBank MB169931]  Asbolisia inocarpi Batista, in Batista and Ciferri, Quaderno del Laboratorio Crittogamico del Istituto Botanico dell'Università di Pavia, 31:43, 1963. Specimens examined: UC1999515 Note: I agree with Reynolds and Gilbert (2006) in identifying this species (Holotype UC1999515 collected from Tongatapu island, Tonga, growing on Inocarpus sp.) as a Polychaeton.  Additional Fumiglobus species not examined Cicinnobella ampullula (Spegazzini) Petrak & Sydow, Annales Mycologici, 33(3-4): 191, 1935. [MycoBank MB256728] Fumiglobus ampullula (Spegazzini) D.R. Reynolds & G.S. Gilbert, Cryptogamie Mycologie, 27(3): 254, 2006. [MycoBank MB522432] Asbolisia ampullula (Spegazzini) Spegazzini, Physis Revista de la Sociedad Argentina de Ciencias Naturales, 4(17): 293, 1918. [MycoBank MB243823] Chaetophoma ampullula Spegazzini, Anales de la Sociedad Científica Argentina, 22(4): 190, 1886. [MycoBank MB183639] Note: Petrak and Sydow (1935) considered Asbolisia ampullula to be misclassified and transferred it into Cicinnobella as C. ampullula. By mistake, Reynolds and Gilbert (2006) placed this taxon in Fumiglobus when they first erected the new genus for former  !  27!  Asbolisia species. I agree with the classification of Petrak and Sydow (1935) and I am excluding this species from Fumiglobus.  Fumiglobus foedus (Saccardo) D.R. Reynolds & G.S. Gilbert, Cryptogamie Mycologie, 27(3): 254, 2006. [MycoBank MB522429] = Fumiglobus foeda (Saccardo) D.R. Reynolds & G.S. Gilbert, Cryptogamie Mycologie, 27(3): 254, 2006. [MycoBank MB527993] Capnodium foedum Saccardo, Sylloge Fungorum, 3:200, 1884. [MycoBank MB 175749]  Fumiglobus indicus (G.P. Agarwal & N.D. Sharma) D.R. Reynolds & G.S. Gilbert, Cryptogamie Mycologie, 27(3): 254, 2006. [MycoBank MB522427] = Fumiglobus indica (G.P. Agarwal & N.D. Sharma) D.R. Reynolds & G.S. Gilbert, 2006. [MycoBank MB527994] Asbolisia indica G.P. Agarwal & N.D. Sharma, Sydowia, 26(1-6): 260, 1974. [MycoBank MB283364]  Fumiglobus portoricensis (Spegazzini) D.R. Reynolds & G.S. Gilbert, Cryptogamie Mycologie, 27(3): 254, 2006. [MycoBank MB522425] Asbolisia portoricensis Spegazzini, Boletín de la Academia Nacional de Ciencias en Córdoba, 26(2-4), 1921. [MycoBank MB143659]  !  28!  Asteridiella glabroides (Stevens) Hansford, Beihefte zur Sydowia, 2: 71, 1961 [MycoBank MB482083] Fumiglobus glabroides (F. Stevens) D.R. Reynolds & G.S. Gilbert, Cryptogamie Mycologie, 27(3): 254, 2006. [MycoBank MB522428] Asteridiella glabroides (F. Stevens) Hansford, Sydowia, 10(1-6): 48, 1957. [MycoBank MB326688] Irene glabroides (F. Stevens) Toro, Mycologia, 17(4): 142, 1925. [MycoBank MB162034] Irenina glabroides (F. Stevens) F. Stevens, Annales Mycologici, 25(5-6): 463, 1927. [MycoBank MB266034] Meliola glabroides F. Stevens, Illinois Biology Monographs, 2: 486, 1916. [MycoBank MB201696] Asbolisia glabroides (F. Stevens) Spegazzini [MycoBank MB 454596] Notes: Fumiglobus glabroides is not a capnodiaceous mold. Stevens (1916) described this epiphyllous fungus as Meliola glabroides. Later Spegazzini re-classified the fungus as Asbolisia glabroides although I found no literature to support the shift. Along with other former Asbolisia, Reynolds and Gilbert (2006) transferred this species to Fumiglobus. However, Stevens (1916) description and image clearly support its identity as a member of Meliolaceae. Hansford (1961) reclassified the fungus as Asteridiella after examining the type. I support this reclassification because, consistent with an identification of Asteridiella, the fungus has no perithecial or mycelial setae (Hosagoudar and Agarwal 2008).  !  29!  Taxonomy of Conidiocarpus species Conidiocarpus caucasicus Woronichin in Jaczewski, Key to fungi (fungi imperfecti), Petrograd, 1917. [Mycobank MB803878]  (Figure 10)  Specimens examined: GUMH 937, UBC F23755 Notes: This is the type species of Conidiocarpus as discussed by Hughes (1976). Conidiocarpus penzigii Woronichin, Annales Mycologici, 24: 250, 1927. [Mycobank MB273921] Phragmocapnias penzigii (Woronichin) Chomnunti & KD Hyde, Fungal Diversity, 51:103-134, 2011. [Mycobank MB273921].  Conidiocarpus longicollus Matsushima, Matsushima Mycological Memoirs, 10: 85, 2003. [Mycobank MB 374479] Phragmocapnias longicollus (Matsushima) Chomnunti & KD Hyde, Fungal Diversity, 51:103-134, 2011. [Mycobank MB374479]  Conidiocarpus asiaticus (Chomnunti & KD Hyde) comb. nov. Phragmocapnias asiaticus Chomnunti & KD Hyde, Fungal Diversity, 51:103-134, 2011. [Mycobank MB563360]  Conidiocarpus betlus (Sydow, P Sydow & EJ Butler) comb.nov. Phragmocapnias betle (Sydow, P. Sydow & EJ Butler) Thiessen & Sydow, Annales Mycologici, 15(6): 480, 1918. [Mycobank MB151279]  !  30!  Capnodium betle Sydow, P Sydow & EJ Butler, Annales Mycologici, 9:384, 1911. [Mycobank MB157277]  Conidiocarpus callitrus (McAlpine) comb. nov. Phragmocapnias callitris (McAlpine) Ciferri & Batista, Quaderno del Laboratorio Crittogamico del Istituto Botanico dell'Università di Pavia, 31:43, 1963. [Mycobank MB336614] Limacinia callitris (McAlpine) Saccardo & P Sydow, Sylloge Fungorum, 14:476, 1899. [Mycobank MB157012] Capnodium callitris McAlpine, Proceedings of the Linnean Society of New South Wales, 21:722, 1896. [Mycobank MB165341]  Conidiocarpus fuliginoidus (Rehm) comb. nov. Phragmocapnias fuliginoides (Rehm) Ciferri & Batista, Saccardoa, Monographiae Mycologicae, 2:180, 1963. [Mycobank MB336616] Limacinia fuliginoides (Rehm) Saccardo, Hedwigia 36:20, 1897. [Mycobank MB172552] Capnophaeum fuliginoides (Rehm) W. Yamamota, Annals of the Phytopathological Society of Japan, 19:4, 1954. [Mycobank MB294092] Capnodium fuliginodes Rehm, Ascomyceten No. 245, 1874. [Mycobank MB122531] Meliola fuliginodes (Rehm) Saccardo, Sylloge Fungorum, 1:65, 1882. [Mycobank MB226739]  !  31!  Conidiocarpus heliconius (Ciferri & Batista) comb. nov. Phragmocapnias heliconiae Ciferri & Batista, Quaderno del Laboratorio Crittogamico del Istituto Botanico dell'Università di Pavia, 31:43, 1963. [Mycobank MB336617]  Conidiocarpus imperspicus (Saccardo) comb. nov. Phragmocapnias imperspicua (Saccardo) Ciferri & Batista, Saccardoa, Monographiae Mycologicae, 2:180, 1963. [Mycobank MB336618] Limacinia imperspicua Saccardo, Atti della Accademia Scientifica Veneto-TrentinoIstriana, 10:62, 1917 [Mycobank MB150678]  Conidiocarpus siamensus (Chomnunti & KD Hyde) comb. nov. Phragmocapnias siamensis Chomnunti & KD Hyde, Fungal Diversity, 51:103-134, 2011 [Mycobank MB563361]  2.4 Discussion The phylogeny of Capnodiales was mostly congruent with trees previously published by Chomnunti et al. (2011), Crous et al. (2009a) and Schoch et al. (2009a) where taxon sampling overlapped. The phylogenetic position of Scorias as the sister group of the rest of Capnodiaceae still remains poorly supported, as previously noted in the works of Chomnunti et al. (2011), Crous et al. (2009a) and Schoch et al. (2009a). Additional taxon sampling from Capnodiaceae in the future may help confirm the phylogenetic position of Scorias. The herbarium specimens for Fumiglobus species used in this study were too  !  32!  small and fragile for DNA extraction. I was unable to acquire any newer specimen desirable for DNA extraction. Availability of more sequences from Fumiglobus would have provided stronger phylogenetic evidence for its early divergence. Fissitunicate ascomycetes (Reynolds 1989) have a wide variety of asexual fruiting structures (Table 4, Table 5). My ancestral-state reconstructions support Sivanesan (1984) in showing that pycnidia are the most common asexual fruiting structure within Capnodiales and are most likely to be ancestral in Capnodiaceae (Table 5). In reconstructions, parsimony predicted repeated independent evolutions of pycnidia within Capnodiales in contrast to likelihood, which showed the ancestral character state as 'equivocal'. I believe that the likelihood reconstruction is more reasonable for my dataset because parsimony minimized the total number of evolutionary changes regardless of the branch lengths, whereas likelihood reconstruction predicted the ancestral states based on the probability that the character state would evolve under Mk1 model, for the recovered branch lengths and the topology. In the Capnodiaceae, Scorias, Conidiocarpus, Conidioxyphium, Microxyphium and Leptoxyphium share a pycnidial stage with a horn-shaped, elongated neck, and the pycnidium is usually elevated on a long black stalk (Batista and Ciferri 1963b; Hughes 1976). While Conidiocarpus caucasicus, the type species of Conidiocarpus, looks macroscopically similar to Fumiglobus on a leaf surface, it is phylogenetically distant and different morphologically. Fumiglobus Reynolds and Gilbert (2006) represents the simplest type of fruiting structures among all pycnidial anamorphs from Capnodiaceae with simple globose to pyriform pycnidia that lack the elongated stalk and neck.  !  33!  Phragmocapnias and Conidiocarpus represent sexual and asexual states, respectively, of the same genus. Chomnunti et al. (2011) placed fungi in this clade in Phragmocapnias probably because the rules for nomenclature of dimorphic fungi that were applicable at the time considered only the sexual state (Article 59, ICBN Vienna Code, McNeill and IAPT 2006). However, the revised rules (Article No. 59, ICBN Melbourne Code) allow anamorph and teleomorph names to compete for priority and Conidiocarpus is the oldest name. Woronichin (1917) described the form genus of Conidiocarpus for the single species C. caucasicus in Annales Mycologici volume 15, issue one, published 10 July 1917. Woronichin applied this new generic name to a mitosporic mold with pycnidia with a horn-shaped elongated neck, elevated on long black stalk, which was previously described by Zopf (1878) as a mitosporic fructification of Fumago. It was not until 30 April 1918 that Annales Mycologici published its sixth issue, in which Theissen and Sydow (1918) described Phragmocapnias betle. Batista and Ciferri (1963b) and Chomnunti et al. (2011) considered the date of publication of a different species, C. penzigii Woronichin (1926), as the starting point for Conidiocarpus, but Hughes (1976) pointed out that this was an error. Hence the name Conidiocarpus has priority and should be applied to the holomorph. The distribution of Fumiglobus pieridicola on Japanese andromeda may be primarily coastal, although this is difficult to determine, as it is not represented in herbaria. Batista and Ciferri (1963a) noted that sooty mold growth was heaviest near the coast in their report on the sooty mold diversity in Pernambuco, Brazil. Batista and Ciferri (1963a) predicted humidity could be a possibly reason for the heterogeneous distribution of sooty molds, as these molds are sensitive to humidity fluctuation.  !  34!  No specimens labeled as Fumiglobus or Asbolisia were available in regional herbaria, so I examined the only available specimens of Capnodiaceae on other ericaceous plants from our area, which were two specimens of Capnodium walteri on Arbutus menziesii from DAVFP. In one of these specimens, DAVFP21836, I found F. pieridicola along with the mitosporic state of C. walteri. Saccardo (1893) while describing C. walteri reported the occurrence of spermatogonia from this fungus. Spermatogonia are pycnidium-like structures, but differ functionally. Spermatogonia produce spore-like propagules that function as male gametes (Alexopoulos et al. 1996) in contrast to pycnidiospores that germinate into somatic mycelium. This raises the question of whether F. pieridicola could represent the spermatogonial stage of C. walteri that Saccardo illustrated, or alternatively, whether F. pieridicola and C. walteri are two separate taxa growing in close proximity. The illustration of spermatogonia provided by Saccardo (Table VI, Figure 1a, 1893) shows an obclavate sporulating body, elevated on a stout multicellular stalk several cells in diameter, and lacking fimbria around the ostiole. In contrast F. pieridicola has pyriform pycnidia attached to a slender stalk, 2-3 cells thick, with fimbriae around the ostiole. The ‘conidia’ produced by the putative spermatogonia of C. walteri were oblong, measuring 5 ✕ 2 µm (Table VI, Figure 1d, Saccardo 1893) whereas the conidia of F. pieridicola are more or less isodiametric, x = 1.75 µm. Saccardo’s description of C. walteri is confusing in several respects, and in addition to showing spermatogonia, he described and illustrated characters now recognized to be absent in C. walteri including pycnidia resembling Microxyphium (Fraser 1935) and an ascoma with an elongated neck (Batista and Ciferri 1963a; Fraser 1935; Hughes 1976; Sivanesan 1984). The spermatogonia seen by Saccardo were not reported again  !  35!  afterwards by Fraser (1935) in her descriptions of C. walteri, or by Hughes (1976), although neither Hughes nor Fraser examined the holotype. I believe Saccardo was analyzing a mixed colony of sooty molds and that the ‘spermatogonia’ were mitosporic fruiting bodies of a different sooty mold. Based of the descriptions of Capnodium species by Hughes (1976), Batista and Ciferri (1963a; 1963b) and Sivanesan (1984), it seems unlikely that a Capnodium would have either spermatogonia or two mitosporic states. It is most likely that F. pieridicola and C. walteri are two separate species that were growing closely together, as is common for sooty molds. Although this study was successful in establishing the phylogenetic position of Fumiglobus and significantly contributes towards the systematics of Capnodiaceae, the family still remains poorly sampled. Sequences for most capnodiaceous molds are currently unavailable. Contamination remains the major barrier in the molecular systematics of Capnodiales. This was evident when my sequencing showed that a culture of Fumiglobus sp. (from the American Type Culture Collection, ATCC#22041) was a member of the Pleosporales, not Capnodiales. The sequences in GenBank for Chaetasbolisia erysiphoides strain CBS 148.94 (LSU: EU754140; SSU: EU754041) similarly suggested that the fungal isolate was a contaminant. Chaetasbolisia erysiphoides is from Capnodiaceae and resembles Fumiglobus in having sub-globose pycnidia with hyaline conidia (Batista and Ciferri 1963b). In my phylogeny, C. erysiphoides nested within Pleosporales with high bootstrap support and not in the Capnodiales. I noticed similar phylogenetic problems in the tree published by de Gruyter et al. (2009) and Aveskamp et al. (2010). Ramichloridium anceps AFTOL-ID 659 (LSU: DQ823102; SSU: DQ823107) is yet another example of a misidentified taxon.  !  36!  Ramichloridium is a member of Dissoconiaceae, Dothideomycetes (Crous et al. 2009a). In my phylogeny, R. anceps appears as as an early diverging taxon within Chaetothyriales, Eurotiomycetes with 100% support whereas other Ramichloridium species in the datasets, R. musae and R. cerophilum nest within Dissoconiaceae as expected. I noticed a similar incongruence in the phylogeny published by James et al. (2006). More than once, 18S and 28S sequences supposedly from the same species from GenBank did not cluster consistently in the single gene phylogenies and their identity should be taken with a grain of salt. Rigorous sampling from Capnodiaceae in future will help in constructing a better resolved phylogeny for the family and clarify several taxonomic discrepancies similar to the one discussed here for Phragmocapnias and Conidiocarpus. Undoubtedly Capnodiaceae represent one of the most diverse groups of foliicolous fungi and a robust phylogeny will contribute to better understanding character evolution within the family.  !  37!  2.5 Tables: Table 1: Primers used for amplification of LSU and SSU r-DNA in this study.  1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14.  Primers LROR LR3R LR7R LR8 LR8R LR9 LR11 LR12 NS1 NS3 NS4 NS6 NS8 NS19  Gene Loci LSU r-DNA LSU r-DNA LSU r-DNA LSU r-DNA LSU r-DNA LSU r-DNA LSU r-DNA LSU r-DNA SSU r-DNA SSU r-DNA SSU r-DNA SSU r-DNA SSU r-DNA SSU r-DNA  Sequence ACCCGCTGAACTTAAGC GTCTTGAAACACGGACC AGATCTTGGTGGTAGTA CACCTTGGAGACCTGCT AGCAGGTCTCCA AGGTG AGAGCACTGGGCAGAAA GCCAGTTATCCCTGTGGTAA GACTTAGAGGCGTTCAG GTAGTCATATGCTTGTCTC GCAAGTCTGGTGCCAGCAGCC CTTCCGTCAATTCCTTTAAG GCATCACAGACCTGTTATTGCCTC TCCGCAGGTTCACCTACGGA CCGGAGAAGGAGCCTGAGAAAC  Reference Vilgalys unpublished1 Unpublished2 Vilgalys and Hester (1990) Unpublished2 Unpublished2 Unpublished2 Unpublished2 Vilgalys and Hester (1990) White et al. (1990) White et al. (1990) White et al. (1990) White et al. (1990) White et al. (1990) Gargas and Taylor (1992)  !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! 1!Available!at!http://www.botany.duke.edu/fungi/mycolab!! 2!Primer!sequences!available!at!http://www.lutzonilab.net/primers/page244.shtml!!  !  38!  Table 2: The proportional likelihoods and most parsimonious reconstructions for types of asexual fruiting bodies, at specified ancestral branches, based on likelihood and parsimony ancestral state reconstruction, with unscored taxa coded as missing, ‘1’ or ‘0’. Proportional likelihood or parsimony reconstruction of pycnidium/other mitosporic fruiting types for ancestors of selected clades* 1 Phaeophleospora plus Mycosphaerella walkeri Likelihood Markov k-state 1 parameter model  2 Ramularia plus Zymoseptoria  3 Phaeophleospora plus Ramularia  4 Conidiocarpus plus Scorias  5 Conidiocarpus plus Leptoxyphium  Coded as missing (?)  0.53  0.01  0.13  0.73  0.95  Coded as 1  0.63  0.22  0.38  0.57  0.71  Coded as 0  0.57  0.40  0.50  0.50  0.51  Likelihood Asymmetrical Markov k-state 2 parameter model Coded as missing (?)  0.60  0.05  0.21  0.62  0.89  Coded as 1  0.62  0.20  0.36  0.52  0.70  Coded as 0  0.41  0.22  0.30  0.30  0.32  Coded as missing (?)  Ambiguous  Not pycnidial  Not pycnidial  Pycnidium  Pycnidium  Coded as 1  Ambiguous  Not pycnidial  Not pycnidial  Pycnidium  Pycnidium  Coded as 0  Ambiguous  Not pycnidial  Not pycnidial  Pycnidium  Pycnidium  Parsimony  *  Each clade is the smallest monophyletic group that includes the specified taxa. Numerals are ancestral branch numbers and each is shown in the tree in Fig. 2.6.4.  !  39!  Table 3: Comparison of pycnidia and conidia of new species "Fumiglobus pieridicola" with previously described Fumiglobus species. Taxa  Dimension of pycnidium (µm)  Size of conidia (µm)  Shape of condia  Septation in conidia  60-70 diameter  5-6 X 2.5-3  Elliptic  Absent  160 X60-150  6.5 X 5.5  Elliptic  Absent  F. juniperinus  54-90 diameter  6.4 X 11.8  Elongated  2-3 septate  F. citrinus  50-55 X 36-40  2-4.5 X1  Filiform  Absent  F. foedus  ~ 50 diameter  3-4.5  Spherical  Absent  F. ficinus  85-100 diameter  3.5-4 X 1-1.5  Elliptical  Absent  F. portoricensis  75-120 diameter  8X3  Elongated  Absent  40-70 X 43-60  1.5 X 2.2  Ovoidal  Absent  F. glabroides*  -  -  -  -  F. pieridicola  30 X 25  1.75  Spherical  Absent  7-12.5 X 8.5-11  3.5-6.5 X 1-1.5  Cylindrical to filiform  Absent  Fumiglobus ampullula F. indicus  F. didymopanacis  Asbolisia inocarpi*  * Misclassified species excluded from Fumiglobus  !  40!  Table 4: Comparison of the morphological characters for the families in Capnodiales included in this study.  Taxa  Habit  Ascospore  Asexual State Fruit bodies Conidia  Mycelium  Position  Mycelium superficial with hydrophilic mucilaginous wall Mostly immersed within the host tissue  Superficial  Pseudothecium, ostiolar  Ovoid, fissitunicate.  Hyaline to dark, multiseptate or muriform  Pycnidium  One-celled, ellipsoidal, hyaline  Pseudothecium, having ostiolar periphyses, but lacking interascal tissue at maturity  Globose-oblong, fissitunicate.  Hyaline, slightly pigmented (rare), clavate, multiseptate  Solitary conidiophore, sporodochia or pycnidium  Multiseptate, elongated  Pseudothecium, ostiolar  Obovoid to broadly ellipsoid, fissitunicate.  Ramoconidia  Pseudothecium with ostiolar opening  Obovoid to broadly ellipsoid, fissitunicate.  Hyaline-pale brown, filiform, multiseptate, constricted at the septum Ellipsoid to ovoid, uniseptate sometime covered with mucilagenous sheath  Conidia elongatedovoid; septation, biseptate or multiseptate Pale brown, aseptate  Capnodiaceae  Epiphyllous saprobe associated with scale insects  Mycosphaerellaceae  Saprobes and plant pathogens  Davidiellaceae  Saprobes and plant pathogens  Mostly immersed  Immersed, superficial, embedded within the host tissue or erumpent Immersed, or erumpent  Teratosphaeriaceae  Saprobes and plant pathogens  Generally immersed within the host tissue  Superficial or immersed within the host tissue  !  Sexual State (Ascomata) Ascus Type morphology  Pycnidium or solitary, conidiophores  !  !  41!  Taxa  Sexual State (Ascomata) Ascus Type morphology  Habit  Mycelium  Piedraiaceae  Saprobe on mammalian hair  Superficial on hair; forming hard crust-like nodular colony  Erumpent  Ascomata, loculate, black, hard, nodular  Asci 1-3 per locule clavate, ovoid in shape, Fissitunicate.  Dissoconiaceae  Epiphytic Saprobe  Mycelium internal and external to the host tissue  Immersed in the host tissue  Pseudothecial  Fissitunicate.  Euantennariaceae  Epiphytic saprobe  Superficial  Superficial  Pseudothecial  Fissitunicate.  !  Position  Ascospore  Fasiculate, non-sepate, fusiform, hyaline with mucilaginous covering, having elongated extension at both apex Ellipsoidfusoid, uniseptate, hyaline, mucilaginous coating sometimes present Brown, transversely septate or muriform  Asexual State Fruit bodies Conidia  Unknown  Unknown  Solitary conidiophores  Solitary, globose to obclavte with one or no septum  Phialidic or phragmoconidia  Phialospore sub-globose, hyaline, minute; phragmoconidia fusiform or straight, brown  42!  Table 5: Asexual fruiting bodies reported from bitunicate Ascomycota by Sivanesan (1984). Orders of bitunicate Ascomycetes 3  Pycnidial 4  CAPNODIALES Capnodiaceae PLEOSPORIALES CHAETOTHYRIALES DOTHIDEALES HYSTERIALES MICROTHYRIALES MYRANGIALES  Solitary Conidiophores 5  ✔ ✔ Always ✔ ✔ ✔ ✔ -  Phragmoconidia 6  Phialidic 7  Acervular 8  Sporodochial 9  Pycnothyrial 10  ✔ -  ✔ -  -  -  -  -  ✔ ✔ ✔ ✔ ✔ ✔  -  ✔ -  ✔ ✔  ✔ -  ✔ -  !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! !W.  H. Hsieh & C. Y. Chen, (1993). Bot. Bull. Acad. Sinica 34: 53-54. http://www.cals.ncsu.edu/course/pp728/Phoma/pycnidium.html 5 http://www.apsnet.org/edcenter/intropp/LabExercises/Pages/PowderyMildew.aspx 6 http://www.mycology.adelaide.edu.au/Fungal_Descriptions/Hyphomycetes_(dematiaceous)/Curvularia/ 7 http://mycota-crcc.mnhn.fr/site/genreDetail.php?num=4&N = Aspergillus 8 http://lyonsfungiatlas.blogspot.ca/2012/10/10-03-2012-practice-summary.html 9 http://www.plantpath.cornell.edu/glossary/defs_s.htm 10 Sivanesan, A. (1984). The Bitunicate Ascomycetes and their Anamorphs. Vaduz, l. Cramer 3  4  !  43!  2.6 Figures:  (Concatenated dataset) 98  Mycosphaerellaceae  Dissoconiaceae  Euantennariaceae Piedraiaceae  Teratosphaeriaceae  CAPNODIALES  Phaeophleospora atkinsonii Mycosphaerella holualoana Mycosphaerella walkeri Mycosphaerella latebrosa Cercospora zebrina 94 Zasmidium anthuriicola Ramularia grevilleana Mycosphaerella punctiformis Zymoseptoria tritici Passalora fulva 85 Dissoconium commune Ramichloridium cerophilum Ramichloridium musae 100 Rasutoria tsugae Piedraia hortae 94100 99 Readeriella mirabilis Readeriella dimorphospora 93 Catenulostroma chromoblastomycosum Elasticomyces elasticus 100 Recurvomyces mirabilis 92 Xenomeris juniperi 84 87 Penidiella columbiana Batcheloromyces leucadendri Teratosphaeria stellenboschiana Teratosphaeria toledana 97 Capnobotryella renispora Microcyclospora pomicola Conidiocarpus siamensus MFLUCC10 - 0074 83 Conidiocarpus siamensus MFLUCC10 - 0064 Conidiocarpus siamensus MFLUCC10 - 0065 Conidiocarpus siamensus MFLUCC10 - 0063 Conidiocarpus siamensus MFLUCC10 - 0061 85 Conidiocarpus asiticus MFLUCC10 - 0062 86 Conidiocarpus caucasicus Conidiocarpus betlus MFLUCC10 - 0050 90 Conidiocarpus betlus MFLUCC10 - 0053 100 Conidioxyphium gardeniorum Capnodium coffeae 94 100 100 Microxyphium citri Leptoxyphium fumago Fumiglobus pieridicola Scorias spongiosa bruhnei 100 87 Cladosporium Davidiella tassiana 100 Sphaerulina polyspora Toxicocladosporium sp 73 99 Dothidea insculpta 100 Dothidea sambuci 100 Stylodothis puccinioides Sydowia polyspora 76 Pleospora herbarum 100 Cochliobolus heterostrophus 99 Pyrenophora phaeocomes Chaetasbolisia erysiphoides 100 Westerdykella cylindrica Trematosphaeria heterospora 100 Dendrographa leucophaea Roccella fuciformis 100 Peltula umbilicata Peltula auriculata 98 Stictis radiata Acarosporina microspora 70 Diploschistes ocellatus 100 Orceolina kerguelensis Trapelia placodioides Pertusaria dactylina Dibaeis baeomyces Umbilicaria mammulata Cladonia caroliniana 77 Lecanora hybocarpa Physcia aipolia Peltigera degenii 100 Acarospora laqueata Acarospora schleicheri Exophiala dermatitidis 73 Capronia pilosella 100 Ramichloridium anceps 97 Exophiala pisciphila 100 Staurothele frustulenta 100 Endocarpon pallidulum 100 Pyrenula pseudobufonia 100 Pyrgillus javanicus Aspergillus fumigatus 87 Monascus purpureus 100 Emericella nidulans Spiromastix warcupii 100 Botryotinia fuckeliana Monilinia laxa 85 Mollisia cinerea Erysiphe mori 91 Cudoniella clavus Potebniamyces pyri Coccomyces dentatus 95  Capnodiaceae  Davidiellaceae DOTHIDEALES  PLEOSPORIALES  0.07  Continued  !  44!  100  92  100  100  Sordaria fimicola Neurospora crassa Chaetomium globosum 100 Meliola niessleana Appendiculella sp 85 Ophiostoma ulmi Magnaporthe grisea 100 Gnomonia gnomon Diaporthe eres 97 Xylaria acuta Xylaria hypoxylon 100 Daldinia concentrica 78 Arthrinium sp 100 Nectria cinnabarina Hydropisphaera erubescens Myrothecium verrucaria 79 Hypocrea americana 100 Cordyceps sinensis Verticillium dahliae 95 Microascus trigonosporus 100 Lindra thalassiae Lulworthia grandispora Microthyrium microscopicum 100 Geoglossum nigritum Trichoglossum hirsutum 100 Orbilia auricolor Orbilia vinosa 97 Morchella esculenta 99 Disciotis venosa Gyromitra californica 85 Helvella cf. compressa Caloscypha fulgens 71 Aleuria aurantia 92 72 Cheilymenia stercorea 94 100 Scutellinia scutellata Pyronema domesticum Sarcoscypha coccinea 100 Peziza proteana f. sparassoides Peziza vesiculosa Ascobolus crenulatus 72 Kluyveromyces lactis Eremothecium gossypii 100 Saccharomyces castellii Saccharomyces cerevisiae 100 Lachancea waltii 100 Candida albicans 98 Candida tropicalis 94 Debaryomyces hansenii Meyerozyma guilliermondii Schizosaccharomyces pombe Pneumocystis carinii 100 Taphrina wiesneri Protomyces inouyei 100 Coprinus comatus Fomitopsis pinicola Puccinia graminis Ustilago maydis 84  100  0.07  Figure 1: Fumiglobus pieridicola and Conidiocarpus caucasicus, indicated in blue font, represent new sequences from this study and are well supported as members of the Capnodiaceae. This maximum likelihood tree was generated using RAxML for concatenated ribosomal large and small subunit sequences. Numbers are bootstrap values from 500 replicates. The scale bar indicates the number of substitutions per site.  !  45!  (28S r-DNA dataset) 99  Mycosphaerellaceae  Dissoconiaceae Euantennariaceae  Teratosphaeriaceae  Piedraiaceae Teratosphaeriaceae  CAPNODIALES  Phaeophleospora atkinsonii Mycosphaerella holualoana Mycosphaerella walkeri Cercospora zebrina 75 98 Mycosphaerella latebrosa Zymoseptoria tritici Ramularia grevilleana Mycosphaerella punctiformis Passalora fulva 96 Zasmidium anthuriicola 100 Dissoconium commune Ramichloridium musae 90 Ramichloridium cerophilum Rasutoria tsugae 99 Batcheloromyces leucadendri 97 100 Penidiella columbiana Teratosphaeria stellenboschiana Teratosphaeria toledana Elasticomyces elasticus Xenomeris juniperi Catenulostroma chromoblastomycosum 88 Recurvomyces mirabilis 100 Readeriella dimorphospora 91 Readeriella mirabilis Piedraia hortae 100 Capnobotryella renispora Microcyclospora pomicola Conidiocarpus siamensus MFLUCC10-0064 Conidiocarpus siamensus MFLUCC10-0074 78 Conidiocarpus siamensus MFLUCC10-0065 Conidiocarpus siamensus MFLUCC10-0063 Conidiocarpus siamensus MFLUCC10-0061 Conidiocarpus asiticus MFLUCC10-0062 74 Conidiocarpus caucasicus 100 Conidiocarpus betlus MFLUCC10-0050 Conidiocarpus betlus MFLUCC10-0053 90 Conidioxyphium gardeniorum Capnodium coffeae 100 100 Microxyphium citri Leptoxyphium fumago Fumiglobus pieridicola Scorias spongiosa 99 Davidiella tassiana 100 Cladosporium bruhnei 100 Sphaerulina polyspora Toxicocladosporium sp 73 98 Dothidea insculpta 100 Dothidea sambuci 100 Stylodothis puccinioides Sydowia polyspora Cochliobolus heterostrophus 100 100 Pleospora herbarum 95 Pyrenophora phaeocomes Chaetasbolisia erysiphoides 100 Westerdykella cylindrica Trematosphaeria heterospora 100 Dendrographa leucophaea Roccella fuciformis 100 Peltula auriculata Peltula umbilicata Exophiala pisciphila Exophiala dermatitidis 100 Capronia pilosella 100 Ramichloridium anceps 100 Staurothele frustulenta 100 Endocarpon pallidulum 100 Pyrgillus javanicus 100 Pyrenula pseudobufonia 80 Aspergillus fumigatus 78 Monascus purpureus 100 Emericella nidulans Spiromastix warcupii 91 Acarospora laqueata Acarospora schleicheri 96 Acarosporina microspora Stictis radiata 90 Diploschistes ocellatus 100 Trapelia placodioides Orceolina kerguelensis Peltigera degenii 94 Cladonia caroliniana Lecanora hybocarpa Physcia aipolia 78 Pertusaria dactylina Dibaeis baeomyces Umbilicaria mammulata 92  Capnodiaceae  Davidiellaceae DOTHIDEALES  PLEOSPORIALES  0.1  Continued  !  46!  96 Neurospora crassa 86 Sordaria fimicola Chaetomium globosum 100  Meliola niessleana Appendiculella sp. Magnaporthe grisea 100 Diaporthe eres Gnomonia gnomon Ophiostoma ulmi 83 Xylaria acuta Xylaria hypoxylon 100 Arthrinium sp Daldinia concentrica Nectria cinnabarina 100 Hypocrea americana Hydropisphaera erubescens Myrothecium verrucaria Cordyceps sinensis 98 Verticillium dahliae Microascus trigonosporus 82 Lindra thalassiae Lulworthia grandispora 72 Mollisia cinerea Erysiphe mori 71 76 88 100 Monilinia laxa 92 Botryotinia fuckeliana Cudoniella clavus 72 Coccomyces dentatus Potebniamyces pyri Microthyrium microscopicum 99 Geoglossum nigritum Trichoglossum hirsutum 96 Orbilia auricolor Orbilia vinosa 87 Cheilymenia stercorea 85 Aleuria aurantia 99 Scutellinia scutellata Pyronema domesticum Sarcoscypha coccinea Gyromitra californica 81 Disciotis venosa 79 Morchella esculenta Helvella cf. compressa 100 Caloscypha fulgens 100 Peziza vesiculosa Peziza proteana f. sparassoides Ascobolus crenulatus Lachancea waltii Saccharomyces castellii 74 Eremothecium gossypii 100 Kluyveromyces lactis 100 Saccharomyces cerevisiae 100 Candida tropicalis 82 Candida albicans Meyerozyma guilliermondii Debaryomyces hansenii 80 Schizosaccharomyces pombe 100 Protomyces inouyei Taphrina wiesneri Pneumocystis carinii 100 Coprinus comatus 81 Fomitopsis pinicola 100 Puccinia graminis Ustilago maydis  0.1  Figure 2: The maximum likelihood tree from the ribosomal large subunit dataset (1305 bp), analyzed alone, is largely congruent with the tree from the concatenated data. The numbers on branches are bootstrap values from 500 replicates. Blue font indicates new sequences from this study. The scale bar indicates the number of substitutions per site.  !  47!  (SSU r-DNA dataset)  CAPNODIALES  Phaeophleospora atkinsonii Mycosphaerella holualoana Mycosphaerella walkeri 77 Cercospora zebrina Mycosphaerella latebrosa Mycosphaerellaceae 79 Ramularia grevilleana Mycosphaerella punctiformis Zymoseptoria tritici Passalora fulva Zasmidium anthuriicola Dissoconium commune 91 Dissoconiaceae Ramichloridium musae Ramichloridium cerophilum Rasutoria tsugae Euantennariaceae Batcheloromyces leucadendri Penidiella columbiana Teratosphaeria stellenboschiana Teratosphaeria toledana Elasticomyces elasticus 96 Recurvomyces mirabilis Teratosphaeriaceae Catenulostroma chromoblastomycosum Xenomeris juniperi 100 Readeriella dimorphospora Readeriella mirabilis Piedraia hortae Piedraiaceae Microcyclospora pomicola Teratosphaeriaceae Capnobotryella renispora Conidiocarpus siamensus MFLUCC10-0064 Conidiocarpus siamensus MFLUCC10-0065 Conidiocarpus siamensus MFLUCC10-0061 Conidiocarpus asiaticus MFLUCC10-0062 Conidiocarpus siamensusMFLUCC10-0074 siamensus MFLUCC10-0063 89 Conidiocarpus Capnodiaceae Conidiocarpus caucasicus Conidiocarpus betlus MFLUCC10-0050 72 Conidiocarpus betlus MFLUCC10-0053 98 Conidioxyphium gardeniorum Capnodium coffeae 86 96 Microxyphium citri Leptoxyphium fumago Fumiglobus pieridicola Scorias spongiosa Davidiella tassiana 100 Sphaerulina polyspora Davidiellaceae Cladosporium bruhnei 91 Toxicocladosporium sp 86 99 Dothidea insculpta Dothidea sambuci DOTHIDEALES Stylodothis puccinioides Sydowia polyspora Cochliobolus heterostrophus 100 Pyrenophora phaeocomes 100 Pleospora herbarum PLEOSPORIALES 96 Chaetasbolisia erysiphoides 80 Westerdykella cylindrica Trematosphaeria heterospora 100 Peltula auriculata Peltula umbilicata Exophiala dermatitidis Exophiala pisciphila 100 Ramichloridium anceps Capronia pilosella 99 100 Pyrgillus javanicus Pyrenula pseudobufonia 100 Staurothele frustulenta Endocarpon pallidulum Aspergillus fumigatus Emericella nidulans 100 Monascus purpureus Spiromastix warcupii 98 Acarospora schleicheri Acarospora laqueata 98 Acarosporina microspora Stictis radiata Peltigera degenii Diploschistes ocellatus 100 Trapelia placodioides Orceolina kerguelensis Pertusaria dactylina Umbilicaria mammulata Cladonia caroliniana Dibaeis baeomyces Lecanora hybocarpa Phyasia aipolia  0.04  Continued !  48!  95  Neurospora crassa Sordaria fimicola Chaetomium globosum 100 Meliola niessleana Appendiculella sp Magnaporthe grisea 92 Ophiostoma ulmi 100 Diaporthe eres Gnomonia gnomon 89 Xylaria hypoxylon 92 Xylaria acuta 99 Daldinia concentrica Arthrinium sp 100 Nectria cinnabarina Hypocrea americana 89 Hydropisphaera erubescens 86 Myrothecium verrucaria Cordyceps sinensis 92 Microascus trigonosporus Verticillium dahliae 100 Lulworthia grandispora Lindra thalassiae 100 Dendrographa leucophaea Roccella fuciformis 100 Botryotinia fuckeliana Monilinia laxa Cudoniella clavus Mollisia cinerea Erysiphe mori Potebniamyces pyri Coccomyces dentatus Microthyrium microscopicum 98 Geoglossum nigritum Trichoglossum hirsutum 100 Orbilia vinosa Orbilia auricolor 80 97 Cheilymenia stercorea Aleuria aurantia 80 94 Pyronema domesticum Scutellinia scutellata 99 Sarcoscypha coccinea 70 93 Gyromitra californica 74 100 Morchella esculenta Disciotis venosa Caloscypha fulgens Helvella cf. compressa Ascobolus crenulatus 100 Peziza vesiculosa Peziza proteana f. sparassoides 83 95 Saccharomyces castellii 100 Saccharomyces cerevisiae Lachancea waltii 78 100 Eremothecium gossypii Kluyveromyces lactis 98 Candida albicans Candida tropicalis 97 Meyerozyma guilliermondii Debaryomyces hansenii 100 Protomyces inouyei 92 Taphrina wiesneri Pneumocystis carinii Schizosaccharomyces pombe 100 Coprinus comatus 100 Fomitopsis pinicola Puccinia graminis Ustilago maydis 82  100  0.04  Figure 3: Maximum likelihood tree generated using RAxML for the ribosomal small subunit dataset (1595 bp), analyzed alone. The numbers on branches are bootstrap values from 500 replicates. Blue font indicates new sequences from this study. The scale bar indicates the number of substitutions per site.  !  49!  ?  3  = present = equivocal  2  = absent  ?  = unknown ? ?  ?  B A  5  ? ? ?  4  ?  Phaeophleospora atkinsonii Mycosphaerella holualoana Mycosphaerella walkeri Mycosphaerella latebrosa Cercospora zebrina Mycosphaerellaceae Zasmidium anthuriicola Ramularia grevilleana Mycosphaerella punctiformis Zymoseptoria tritici Passalora fulva Dissoconium commune Ramichloridium cerophilum Dissoconiaceae Ramichloridium musae Euantennariaceae Rasutoria tsugae Piedraiaceae Piedraia hortae Readeriella mirabilis Readeriella dimorphospora Catenulostroma chromoblastomycosum Elasticomyces elasticus Recurvomyces mirabilis Xenomeris juniperi Teratosphaeriaceae Penidiella columbiana Batcheloromyces leucadendri Teratosphaeria stellenboschiana Teratosphaeria toledana Capnobotryella renispora Microcyclospora pomicola Conidiocarpus siamensus MFLUCC10-0074 Conidiocarpus siamensus MFLUCC10-0064 Conidiocarpus siamensus MFLUCC10-0065 Conidiocarpus siamensus MFLUCC10-0063 Conidiocarpus siamensus MFLUCC10-0061 Conidiocarpus asiticus MFLUCC10-0062 Conidiocarpus caucasicus Capnodiaceae Conidiocarpus betlus MFLUCC10-0050 Conidiocarpus betlus MFLUCC10-0053 Conidioxyphium gardeniorum Capnodium coffeae Microxyphium citri Leptoxyphium fumago Fumiglobus pieridicola Scorias spongiosa Cladosporium bruhnei Davidiella tassiana Davidiellaceae Sphaerulina polyspora Toxicocladosporium sp. Dothidea insculpta Dothidea sambuci DOTHIDEALES Stylodothis puccinioides Sydowia polyspora  CAPNODIALES  1  Figure 4: Production of conidia within pycnidia was the most likely ancestral-state in the Capnodiaceae, under the Mk1 likelihood model of character evolution. Filled boxes next to species names indicate a pycnidial asexual state. Empty boxes indicate non-pycnidial species. Red interrogation marks indicate undescribed or unidentified asexual states. Pie charts A and B indicate proportional likelihood of a pycnidial ancestral state for the Capnodiaceae. For the other numbered branches, proportional likelihood of a pycnidial ancestral state are given in Table 2.  !  50!  A. 0.5 mm  B.  0.5 mm  Figure 5: Pulvinaria cf. acericola, the scale insect on Pieris japonica that produced the honeydew nourishing the mold Fumiglobus pieridicola. A. Female insect bodies, B. Close up of the female insect.  !  51!  12 cm  A  B  2.5 cm  C  0.5 cm  Figure 6: A-C. Fumiglobus pieridicola sp. nov. growing on Pieris japonica (Japanese andromeda). C. Close up of the mold colony on the adaxial surface of the host leaf.  !  52!  A  B  "  C  D  E  F  Figure 7: Fumiglobus pieridicola sp. nov.: A. Portion of a moniliform hypha, B. Mature apical pycnidium, C. Immature apical pycnidium, D. Mature intercalary pycnidium, E. Conidia produced in chains within pycnidium, F. Conidia.  !  53!  B  A  1 cm 5 cm C  D  E  5 µm 10 µm  10 µm  F  H  G  10 µm  5 µm  5 µm  Figure 8: Habit and microscopic structures of Fumiglobus pieridicola sp. nov. on Pieris japonica (Japanese andromeda). A. Portion of the flowering twig of the host with the sooty mold. The white patches on the lower leaves represent the symbiotic female scale insects, Pulvinaria cf. acericola (arrows); B. Close-up of adaxial surface of the leaf with the mold F. pieridicola: C. Mycelium, D. Mature apical pycnidium, E. Immature apical pycnidium, F. Mature intercallary pycnidium, G. Immature intercalary pycnidium and H. Chains of conidia from pycnidium.  !  54!  A.  10 µm  B  10 µm  Figure 9: Fumiglobus didymopanacis (Holotype UC 1994100, University Herbarium, University of California, Berkeley): A. Pycnidium, arrows indicate the outline of the pycnidium B. Mycelium, composed of elongated cells.  !  55!  A  B  Figure 10: Conidiocarpus caucasicus (GUMH 937): A. Pycnidium B. Hyphae, composed of cells of inconsistent length and width.  !  56!  Chapter 3: Concluding Chapter  3.1  Outcomes of this Project in Light of Current Research:  The order Capnodiales is a monophyletic lineage of foliicolous fungi within Dothideomycetes, Ascomycota (Crous et al. 2009a). My current research contributes toward resolving the taxonomy of capnodiaceous fungi. The sooty mold family Capnodiaceae is a poorly studied taxon within Capnodiales and it encompasses several genera with uncertain phylogenetic placement (Lumbsch and Huhndorf 2010). Currently, very few sequences of sooty molds are available in GenBank. I combined my new sequences for Fumiglobus and Conidiocarpus with sequences already available from related taxa and generated a phylogeny of Capnodiales, encompassing all major lineages within the order. Through morphological study and comparison with closely related sooty molds, I described the common sooty mold on Pieris japonica (Japanese andromeda) as a new species, Fumiglobus pieridicola. This is the first report of a Fumiglobus species from a temperate region. Because the fungus is locally common and striking in its appearance, I initially assumed it would have been collected frequently and that I would be able to determine its distribution pattern through herbarium records. However, unidentified fungi are rarely accessioned into herbaria. Neither UBC nor DAVFP, the important west coast herbaria with digitized collections, have any specimens; nor does Canada's most important fungal collection, DAOM, the National Mycological Herbarium in Ottawa Ontario, Canada. Although Japanese andromeda is a common ornamental shrub in North America and United Kingdom, diseases of this plant are not well documented outside of  !  57!  gardening blogs and extension bulletins from United States of America (University of Idaho Extension Service 2006; Valchar 1993) and United Kingdom. Sooty molds are not listed among reported fungal and nematodal diseases of Japanese andromeda that include: Alternaria leaf-spot, Armillaria root rot, Botryosphaeria die-back, root-rot and tar-spot caused by Rhytisma andromede, leaf-spot and twig die-back caused by Pestalopsis sydowiana, Exobasidium vaccinii leaf-gall, Phytophthora root-rot and chlorosis caused by Tylenchorhynchus sp. (shunt nematode) from United states (Farr et al. 1989; Jones and Benson 2001; Partyka 1980; Sinclair and Lyon 2005). Phytophthora root-rot seems to be a common disease of this plant in United Kingdom (Inman et al. 2003). Scale insects like Pinnaspis aspidistrae (Miller and Davidson 2005), Florida wax, Cottony maple, Lantania, Nigra, Lace bugs have been reported from both North America and the United Kingdom (Partyka 1980; Schread 1970) colonizing on Japanese andromeda. Unfortunately none of the insect reports document sooty mold growth associated with them. The lack of information about this common local fungus brings to mind a quote used by Linnaeus “Nomina si nescis, perit et cognitio rerum” (Philosophia Botanica, VII Nomina, Aphorism 210, 1751). Now that the fungus has a name, I hope that it will become more widely collected and accessioned into herbaria, leading to a more complete understanding of its biology and geographical distribution. Most of the ascomycetous molds have dimorphic lifecycles. It is rare to encounter both the life cycle states together so the sexual and asexual states have traditionally been treated almost as separate taxa. To reduce the nomenclatural complexity involving dimorphic fungi, mycologists are supporting application of a “1 Fungus = 1 Name” approach (http://www.cbs.knaw.nl/News/NewsDetails.aspx?Rec=70). The idea of one  !  58!  organism one name was first proposed by Linnaeus “Unicum ubi genus, unicum erit nomen” (Philosophia Botanica, VII Nomina, Aphorism 210, 1751). According to this current application of fungal nomenclature, the oldest legitimate name for either of the life cycle states for a dimorphic fungus has priority over other names (Article No. 59, ICBN Melbourne code, McNeill et al. 2012). Applying this concept using molecular evidence, I confirmed Conidiocarpus as the anamorph of Phragmocapnias. I renamed the holomorph as Conidiocarpus, following rules of nomenclatural priority (Article No. 59, ICBN Melbourne Code).  3.2 Strengths and Limitations of this Research: Through this study I described and illustrated a new sooty mold Fumiglobus pieridicola growing on Japanese andromeda from Vancouver. I have also tried to determine the geographic range for F. pieridicola in North America. Fumiglobus pieridicola is the first sequenced representative of the genus. I conducted a genus-wide morphological study for Fumiglobus. I have examined five out of nine holotypes of Fumiglobus species. Unfortunately I was unable find the holotypes for three Fumiglobus species. Availability of all the holotypes would have helped me to recheck the descriptions for these taxa. I requested specimens from colleagues from eastern North America, UK and Asia, but failed to procure specimens of sooty molds, even though Japanese andromeda is widely distributed in these places as an ornamental. Having a collection of sooty mold on Pieris from different locations would have helped to trace the worldwide distribution of F. pieridicola and check whether the same species is colonizing different populations of Japanese andromeda around the world.  !  59!  My phylogeny included a broad range of taxon sampling from Ascomycota. I recovered strong support for the monophyly of Capnodiales and of Capnodiaceae, as previously shown in studies by Chomnunti et al. (2011), Crous et al. (2009a) and Schoch et al. (2009a; 2006). However, there are caveats to this analysis. Backbone relationships in my tree were not always well supported. While preparing my datasets I also observed several misidentified sequences of capnodiaceous fungi on the databases. I tried to eliminate misidentified sequences from my datasets through a series of phylogenetic analyses but could not completely eliminate the possibility that one was included within my final dataset. I was unable to find suitable samples to extract DNA for any other Fumiglobus species that would have helped me to confirm the phylogenetic position or confirm the monophyly of the genus. Chomnunti et al. (2011) through their molecular phylogeny concluded that Conidiocarpus is the asexual state of the sexual fungus Phragmocapnias, but they did not include the sequence for C. caucasicus, the type species for Conidiocarpus. Through this study I provided the sequence data for C. caucasicus and confirmed that Conidiocarpus is the anamorph of Phragmocapnias. Because Conidiocarpus has priority following the current rules of nomenclatural priority for dimorphic fungi (Article No. 59, ICBN Melbourne Code), I transferred Phragmocapnias species into Conidiocarpus. My ancestral-state reconstruction predicts an equivocal evolution of pycnidia within Capnodiales with a high probability of a pycnidial ancestor for Capnodiaceae. Because likelihood ancestral-state reconstruction relies on branch lengths and branching pattern, errors in phylogenetic inference could result in errors in the reconstruction. In addition, the ancestral-state reconstructions are based on a model of probability that accounts for  !  60!  the evolutionary transitions, and I am not sure if my selected parameters were the best-fit model to predict the pattern of evolution for pycnidia. Although the tree used for the reconstructions was well resolved, my model of character evolution may not stand the test of time due to lack of sampling and lack of availability of sequences for capnodiaceous fungi. Currently, sequences for around 10 identified species of sooty molds and a few environmental sequences are available at the GenBank, in contrast to 26 reported genera Batista and Ciferri (1963b). The total count of Capnodiaceae genera may be even higher than this reported number. Sooty mold diversity from the tropics is not well documented; neither is their diversity from the Nothofagus forest in New Zealand. In the Nothofagus forest sooty molds are known to colonize the entire length of the trunk along with the surrounding non-living objects such as rocks and forest floor (Hughes 1976). The gregarious growth of sooty molds in the Nothofagus forest directly links to the overwhelming diversity of the scale insects (Crozier 1982; Hughes 1976; James et al. 2007; Kelly 1990; Morales et al. 1988). Such dense colonies are often composed of several distinct species of sooty molds (Crozier 1982; Hughes 1976; Morales et al. 1988). Documentation of the sooty mold genera from Nothofagus forest could by itself elevate the total count for the family. I was able to trace the evolution of pycnidia for capnodiaceous fungi for which sequences were available at the database. In future I believe more sequences and phylogeny will be available for Capnodiales that will help test my interpretation for the evolution of pycnidia. As a part of my future investigations it would be possible to trace the evolutionary pattern of pycnidia and other asexual fruit bodies within Ascomycota as  !  61!  a whole. Such an attempt will help to clarify the evolutionary pattern of asexual fruiting structures within the phylum.  3.3 Applications of These Findings and Future Research Directions: I have the LSU, SSU and ITS11 sequences for Fumiglobus pieridicola and Conidiocarpus caucasicus. I was also successful in locating the phylogenetic position for both the taxa within Capnodiaceae. The next most important advancement from my side would be to find more samples for Fumiglobus species. Adding more Fumiglobus sequences and genes to my datasets will help me to test the phylogenetic position of the genus. I would also like to try to sequence more fungi from Capnodiaceae. An increased sampling from Capnodiaceae in future would help to show if the taxon is truly monophyletic within Capnodiales or whether it is an assemblage of paraphyletic fungus like Mycosphaerellaceae and Teratosphaeriaceae (Crous et al. 2007a; Crous et al. 2009a; Crous et al. 2009b; Crous et al. 2009c).  !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! 11!ITS1, 5.8S and ITS2 were not included in this study because sequences for these gene loci are not available for most of the Capnodiaceae fungi, see appendix section, Supplementary Table 3. !  62!  References Alexopoulos CJ, Mims CW, Blackwell M. 1996. Introductory Mycology. New York, U.S.A.: John Wiley & Sons, Inc. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol 215:403–410. Andrew JH. 1992. Biological control in the phyllosphere. Annu Rev Phytopathol 30:603635. Aptroot A. 2006. Mycosphaerella and its anamorphs: 2. Conspectus of Mycosphaerella. Utrecht, The Netherlands: CBS Biodiversity Series 5. 1-231. Arx JA von, Müller S. 1975. A re-evaluation of the bitunicate Ascomycetes with keys to families and genera. Stud Mycol 9:1-159. Arzanlou M, Groenewald JZ, Gams W, Braun U, Shin HD, Crous PW. 2007. Phylogenetic and morphotaxonomic revision of Ramichloridium and allied genera. Stud Mycol 58:57–93. Aveskamp MM, de Gruyter J, Woudenberg JHC, Verkley GJM, Crous PW. 2010. Highlights of the Didymellaceae: A polyphasic approach to characterise Phoma and related pleosporalean genera. Stud Mycol 65:1-60. Batista AC, Ciferri R. 1963a. Capnodiales. Saccardoa 2:1–296. Batista AC, Ciferri R. 1963b. The sooty-molds of the family Asbolisiaceae. Quaderni. Laboratorio Crittogamico, Istituto Botanico della Università di Pavia 31:1-216. Batista AC, Costa CAA, Ciferri R. 1957. Orgânogênese e sistemática dos fungos Trichopeltinaceae (Theiss.) emend. nobis. Publicações do Instituto de Micologia da Universidade do Recife 90:1-24. Blakeman JP, Fokkema NJ. 1982. Potential for biological control of plant diseases on the phylloplane. Annu Rev Phytopathol 20:162–192. Braun U. 1998. A Monograph of Cercosporella, Ramularia and Allied Genera (Phytopathogenic Hyphomycetes). Vol 12. Eching, Germany: IHW-Verlag. Buczacki S, Harris K, Hargreaves B. 2010. Pests, Diseases and Disorders of Garden Plants. United Kingdom: Harper Collins Publishers. Cheewangkoon R, Groenewald JZ, Summerell BA, Hyde KD, To-anun C, Crous PW. 2009. Myrtaceae, a cache of fungal biodiversity. Persoonia 23:55-85.  !  63!  Chomnunti P, Ko TWK, Chukeatirote E, Hyde KD, Cai L, Jones EBG, Kodsueb R, Hassan BA, Chen H. 2012. Phylogeny of Chaetothyriaceae in northern Thailand including three new species. Mycologia 104:382-395. Chomnunti P, Schoch CL, Aguirre-Hudson B, Ko-Ko TW, Hongsanan S, Jones EBG, Kodsueb R, Phookamsak R, Chukeatirote E, Bahkali AH, Hyde KD. 2011. Capnodiaceae. Fungal Divers 51:103-134. Chupp C. 1954. A Monograph of the Fungus Genus Cercospora. Ithaca, New York: Published by the author. Crous PW. 2009. Taxonomy and phylogeny of the genus Mycosphaerella and its anamorphs. Fungal Divers 38:1–24. Crous PW, Braun U, Groenewald JZ. 2007a. Mycosphaerella is polyphyletic. Stud Mycol 58:1-32. Crous PW, Braun U, Schubert K, Groenewald JZ. 2007b. Delimiting Cladosporium from morphologically similar genera. Stud Mycol 58:33-56. Crous PW, Groenewald JZ, Mansilla JP, Hunter GC, Wingfield MJ. 2004. Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs occurring on Eucalyptus. Stud Mycol 50:195-214. Crous PW, Schoch CL, Hyde KD, Wood AR, Gueidan C, de Hoog GS, Groenewald JZ. 2009a. Phylogenetic lineages in the Capnodiales. Stud Mycol 64:17-47. Crous PW, Summerell BA, Carnegie AJ, Mohammed C, Wingfield MJ, Himaman W, Groenewald JZ. 2007c. Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs occurring on Eucalyptus III. Fungal Divers 26:143-185. Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Groenewald JZ. 2009b. Novel species of Mycosphaerellaceae and Teratosphaeriaceae. Persoonia 23:119–146. Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Hunter GC, Burgess TI, Andjic V, Barber PA, Groenewald JZ. 2009c. Unravelling Mycosphaerella: Do you believe in genera? Persoonia 23:99–118. Crous PW, Wingfield MJ, Mansilla JP, Alfenas AC, Groenewald JZ. 2006. Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs occurring on Eucalyptus II. Stud Mycol 55:99-131. Crozier LR. 1982. Beech honeydew: forest produce. N Z J For Sci 26:200-209. Darriba D, Taboada GL, Doallo R, Posada D. 2012. jModelTest 2: more models, new heuristics and parallel computing. Nat Meth 9:772.  !  64!  de Gruyter J, Aveskamp MM, Woudenberg JH, Verkley GJ, Groenewald JZ, Crous PW. 2009. Molecular phylogeny of Phoma and allied anamorph genera: towards a reclassification of the Phoma complex. Mycol Res 113:508-519. de Hoog GS, Guarro JG, J. Figueras MJ. 2000. Atlas of clinical Fungi. 2nd Edn. Centraalbureau voor Schimmelcultures, Utrecht, Netherlands, and Universitat Rovira I Virgili, Reus, Spain. de Hoog GS, Hermanides-Nijhof EJ. 1977. The black yeasts and allied Hyphomycetes. Stud Mycol 15:1-222. Don G. 1934. A general history of the dichlamydeous plants. Vol 3 London, UK: Gilbert and Rivington Printers, St. John's Square. Farr DF, Bills GF, Chamuris GP, Rossman AY. 1989. Fungi on Plants and Plant Products in the United States. St. Paul, Minnesota, USA: APS Press. Frank J, Crous PW, Groenewald JZ, Oertel B, Hyde KD, Phengsintham P, Schroers H-J. 2010. Microcyclosporella and Microcyclospora: novel genera accommodating epiphytic fungi causing sooty blotch on apple. Persoonia 24:93-105. Fraser L. 1935. An investigation of the sooty moulds of New South Wales. IV. The species of the Eucapnodieae. Proc Linn Soc N S W 40:159–178. Friend RJ. 1965. What is Fumago vagans? Trans Br Mycol Soc 48:371-375. Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes application to the identification of mycorrhizae and rusts. Mol Ecol 2:113-118. Gargas A, Taylor JW. 1992. Polymerase chain reaction (PCR) primers for amplifying and sequencing nuclear 18S rDNA from lichenized Fungi. Mycologia 48:589-592. Guindon S, Gascuel O. 2003. A simple, fast and accurate method to estimate large phylogenies by maximum-likelihood. Syst Biol 52:696-704. Hansford CG. 1961. The Meliolineae, a monograph. Beih Sydowia 2:1-806. Hibbett DS, Binder M, Bischoff JF, Blackwell M, Cannon PF, Eriksson OE, Huhndorf S, James T, Kirk PM, Luecking R, Lumbsch HT, Lutzoni F, Matheny PB, Mclaughlin DJ, Powell MJ, Redhead S, Schoch CL, Spatafora JW, Stalpers JA, Vilgalys R, Aime MC, Aptroot A, Bauer R, Begerow D, Benny GL, Castlebury LA, Crous PW, Dai Y-C, Gams W, Geiser DM, Griffith GW, Gueidan C, Hawksworth DL, Hestmark G, Hosaka K, Humber RA, Hyde KD, Ironside JE, Koljalg U, Kurtzman CP, Larsson K-H, Lichtwardt R, Longcore J, Miadlikowska J, Miller A, Moncalvo J-M, Mozley-Standridge S, Oberwinkler F, Parmasto E, Reeb V, Rogers JD, Roux C, Ryvarden L, Sampaio JP, Schuessler A, Sugiyama J, Thorn RG, Tibell L, Untereiner WA, Walker C, Wang Z, Weir A, Weiss M,  !  65!  White MM, Winka K, Yao Y-J, Zhang N. 2007. A higher-level phylogenetic classification of the Fungi. Mycol Res 111:509-547. Hill CF, Schubert K. 2006. New species and new records of biotrophic micromycetes from Australia, Fiji, New Zealand and Thailand. Fungal Divers 22:13-35. Höhnel Fv. 1910. Fragmente zur Mykologie XI Mitteilung, (Nr. 527 bis 573). Sber. Akad. Wiss. Wien math.-naturw. Kl. Abt I 119:618–679. Holliday P, Mulder JL. 1976. Fulvia fulva. CMI Descriptions of Pathogenic Fungi and Bacteria 487. Hosagoudar VB, Agarwal DK. 2008. Taxonomic Studies of Meliolales : Identification Manual. India: International Book Distributors. Hughes SJ. 1976. Sooty Moulds. Mycologia 68:693-820. Hyde KD, McKenzie EHC, Ko-Ko TW. 2011. Towards incorporating anamorphic Fungi in a natural classification checklist and notes for 2010. Mycosphere 2:1-88. Inman AJ, Townend VC, Barnes AV, Lane CR, Hughes KJD, Griffin RL, Eales SJ. 2003. First report of ramorum dieback (Phytophthora ramorum ) on Pieris in England. Plant Pathology 52:785. James A, Dungan R, Plank M, Ito R. 2007. A dynamical model of honeydew droplet production by sooty-beech scale insects (Ultracoelostoma spp.) in New Zealand Nothofagus forest. Ecol Model 209:323-332. James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, Cox CJ, Celio G, Gueidan C, Fraker E, Miadlikowska J, Lumbsch HT, Rauhut A, Reeb V, Arnold AE, Amtoft A, Stajich JE, Hosaka K, Sung GH, Johnson D, O'Rourke B, Crockett M, Binder M, Curtis JM, Slot JC, Wang Z, Wilson AW, Schuszler A, Longcore JE, O'Donnell K, MozleyStandridge S, Porter D, Letcher PM, Powell MJ, Taylor JW, White MM, Griffith GW, Davies DR, Humber RA, Morton JB, Sugiyama J, Rossman AY, Rogers JD, Pfister DH, Hewitt D, Hansen K, Hambleton S, Shoemaker RA, Kohlmeyer J, Volkmann-Kohlmeyer B, Spotts RA, Serdani M, Crous PW, Hughes KW, Matsuura K, Langer E, Langer G, Untereiner WA, Lucking R, Budel B, Geiser DM, Aptroot A, Diederich P, Schmitt I, Schultz M, Yahr R, Hibbett DS, Lutzoni F, McLaughlin DJ, Spatafora JW, Vilgalys R. 2006. Reconstructing the early evolution of Fungi using a six-gene phylogeny. Nature 443:818-822. Jones RK, Benson DM. 2001. Diseases of Woody Ornamentals and Trees in Nurseries. St. Paul, Minnesota: APS Press. Katoh K, Kuma K, Toh H, Miyata T. 2005. MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res 33:511-518.  !  66!  Kelly D. 1990. Honeydew density in mixed Nothofagus forest, Westland, New Zealand. N Z J Bot 28:53-58. Khodaparast SA. 2006. A survey on citrus sooty mold Fungi in Gilan province, Iran. Rostaniha 7:59-65. Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the Fungi. CABI Bioscience UK. Lewis PO. 2001. A likelihood approach to estimating phylogeny from discrete morphological character data. Syst Biol 50:913-925. Linnaeus C. 1751. Philosophia Botanica in qua Explicantur Fundamenta Botanica cum Definitionibus Partium, Exemplis Terminorum, Oobservationibus Rariorum, Adjectis Figuris Aeneis Stockholm, Sweden: apud Godofr. Kiesewetter. Lumbsch HT, Huhndorf SM. 2010. Myconet Volume 14 Outline of Ascomycota-2009 Notes on Ascomycete Systematics. Nos. 4751-5113. Fieldiana Life Earth Sci 1:164. Lumbsch HT, Lindemuth R. 2001. Major lineages of Dothideomycetes (Ascomycota) inferred from SSU and LSU rDNA sequences. Mycol Res 105:901-908. Luttrell ES. 1973. Loculoascomycetes. In Ainsworth GC, Sparrow FK, Sussman AS. The Fungi, An Advanced Treatise, Vol. 4A. New York and London Academic Press. p. 135-219 Macauley BJ, Thrower LB. 1965. Readeriella, a little-known genus of Sphaeropsidales. Trans Br Mycol Soc 48:105-111. Maddison WP, Maddison DR. 2011. Mesquite: A modular system for evolutionary analysis. Version 2.75. http://mesquiteproject.org. (Retrived on 10 October 2010). Manoharachary C, Kunwar IK, Ramesh P. 2004. Microxyphispora, a new sooty mold genus (order Dothidiales) from India. Philipp J Sci 133:131-134. McNeill J, Barrie FR, Buck WR, Demoulin V, Greuter W, Hawksworth DL, Herendeen PS, Knapp S, Marhold K, Prado J, Prud'Homme van Reini WF, Smith GF, Wiersema JH, Turland NJ. 2012. Chapter VIII. Names of anamorphic fungi or fungi with a pleomorphic life cycle. International Code of Nomenclature for algae, fungi and plants (Melbourne Code) adopted by the Eighteenth International Botanical Congress Melbourne, Australia, July 2011. Koeltz Scientific Books. McNeill J, IAPT. 2006. International code of botanical nomenclature (Vienna Code) adopted by the seventeenth International Botanical Congress, Vienna, Austria, July 2005. Published for IAPT by A.R.G. Ganter.  !  67!  Miller DR, Davidson JA. 2005. Armoured Scale Insect Pests of Trees and Shrubs. Cornell University Press. Minter DW, Tykhonenko YY. 2013. Cyberliber, an Electronic Library for Mycology. http://www.cybertruffle.org.uk/cyberliber. (Retrived on 14 February 2013). Morales CF, Hill MG, Walker AK. 1988. Life history of the sooty beech scale (Ultracoelostoma assimile) (Maskell) (Hemiptera: Margarodidae) in New Zealand Nothofagus forests. N Z Entomol 11:24-37. Muthumary J. 1986. First Contribution to a Monograph of Septoria Species in India. Madras, India: University of Madras. Partyka RE. 1980. Woody Ornamentals: Plants and Problems. Chem Lawn Corp. Persoon CH. 1822. Mycologia Europaea. Sectio Prima. Erlangen, Germany: Impensibus I. I. Palmii. Petrak F, Sydow H. 1935. Kritisch-Systematische Originaluntersuchungen über Pyrenomyceten, Sphaeropsideen und Melanconieen VI. Ann Mycol 33:190-191. Rambaut A. 2002. Se-Al Sequence Alignment Editor, v2.0a11. University of Oxford, Oxford, UK. Reynolds DR. 1976. Observations on growth forms of sooty mold Fungi. Nova Hedwigia 26:179-193. Reynolds DR. 1989. The bitunicate ascus paradigm. Bot Rev 55:1-52. Reynolds DR. 1998. Capnodiaceous sooty mold phylogeny. Can J Bot 76:2125–2130. Reynolds DR, Gilbert GS. 2006. Epifoliar Fungi from Panama. Cryptogam Mycol 27:249-270. Saccardo PA. 1893. Mycetes aliquot Australienses. Series quarta. Hedwigia 32:56-59. Schoch CL, Crous PW, Groenewald JZ, Boehm EWA, Burgess TI, de Gruyter J, de Hoog GS, Dixon LJ, Grube M, Gueidan C, Harada Y, Hatakeyama S, Hirayama K, Hosoya T, Huhndorf SM, Hyde KD, Jones EBG, Kohlmeyer J, Kruys A, Li YM, Lucking R, Lumbsch HT, Marvanova L, Mbatchou JS, McVay AH, Miller AN, Mugambi GK, Muggia L, Nelsen MP, Nelson P, Owensby CA, Phillips AJL, Phongpaichit S, Pointing SB, Pujade-Renaud V, Raja HA, Plata ER, Robbertse B, Ruibal C, Sakayaroj J, Sano T, Selbmann L, Shearer CA, Shirouzu T, Slippers B, Suetrong S, Tanaka K, Volkmann-Kohlmeyer B, Wingfield MJ, Wood AR, Woudenberg JHC, Yonezawa H, Zhang Y, Spatafora JW. 2009a. A class-wide phylogenetic assessment of Dothideomycetes. Stud Mycol 64:1-15.  !  68!  Schoch CL, Shoemaker RA, Seifert KA, Hambleton S, Spatafora JW, Crous PW. 2006. A multigene phylogeny of the Dothideomycetes using four nuclear loci. Mycologia 98:1041-1052. Schoch CL, Sung G-H, Lopez-Giraldez F, Townsend JP, Miadlikowska J, Hofstetter V, Robbertse B, Matheny PB, Kauff F, Wang Z, Gueidan C, Andrie RM, Trippe K, Ciufetti LM, Wynns A, Fraker E, Hodkinson BP, Bonito G, Groenewald JZ, Arzanlou M, de Hoog GS, Crous PW, Hewitt D, Pfister DH, Peterson K, Gryzenhout M, Wingfield MJ, Aptroot A, Suh S-O, Blackwell M, Hillis DM, Griffith GW, Castlebury LA, Rossman AY, Lumbsch HT, Luecking R, Buedel B, Rauhut A, Diederich P, Ertz D, Geiser DM, Hosaka K, Inderbitzin P, Kohlmeyer J, Volkmann-Kohlmeyer B, Mostert L, O'Donnell K, Sipman H, Rogers JD, Shoemaker RA, Sugiyama J, Summerbell RC, Untereiner W, Johnston PR, Stenroos S, Zuccaro A, Dyer PS, Crittenden PD, Cole MS, Hansen K, Trappe JM, Yahr R, Lutzoni F, Spatafora JW. 2009b. The Ascomycota Tree of life: A phylum-wide phylogeny clarifies the origin and evolution of fundamental reproductive and ecological traits. Syst Biol 58:224-239. Schread JC. 1970. Control of Scale Insect and Mealy Bugs on Ornamentals. New Haven, Connecticut: Bulletin of the Connecticut Agricultural Experimental Station. Vol. 710. Schubert K, Groenewald JZ, Braun U, Dijksterhuis J, Starink M, Hill CF, Zalar P, de Hoog GS, Crous PW. 2007. Biodiversity in the Cladosporium herbarum complex (Davidiellaceae, Capnodiales), with standardisation of methods for Cladosporium taxonomy and diagnostics. Stud Mycol 58:105-156. Selbmann L, de Hoog GS, Zucconi L, Isola D, Ruisi S, Gerrits van den Ende AHG, Ruibal C, De Leo F, Urzi C, Onofri S. 2008. Drought meets acid: three new genera in a dothidealean clade of extremotolerant Fungi. Stud Mycol 61:1-20. Sharma ND, Agarwal GP. 1977. Fungi causing plant diseases at Jabalpur, Madhya Pradesh, India Part 15 some Sphaeropsidales. Sydowia 30:290-296. Sinclair WA, Lyon HL. 2005. Diseases of trees and shrubs. Ithaca, New York, USA: Cornell University Press. Sivanesan A. 1984. The bitunicate Ascomycetes and their Anamorphs. Vaduz, Liechtenstein: J. Cramer. Spegazzini C. 1918. Notas Micológicas. Physis Revista Soc Arg Cienc Nat 4:281-295. Srivastava RC. 1982. Notes on two interesting Fungi from India. Arch Protistenkunde 125:331-333. Stamatakis A. 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22:2688-2690.  !  69!  Stevens FL. 1916. The genus Meliola in Porto Rico. Illinois Biological Monographs 2:475-554. Stevens FL. 1931. A misnomer in the use of the term sooty mold. Philipp Agric 78:549. Sugiyama J, Amanao N. 1987. Two metacapnodiaceous sooty moulds from Japan: their identity and behaviour in pure culture. Elsevier, Amsterdam. Swart HJ, Walker J. 1988. Australian leaf-inhabiting fungi XXVIII. Hendersonia on Eucalyptus. Trans Br Mycol Soc 90:633-641. Talavera G, Castresana J. 2007. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst Biol 56:564-577. Taylor JE, Crous PW, Wingfield MJ. 1999. Batcheloromyces species occurring on Proteaceae in South Africa. Mycol Res 103:1478-1484. Theissen F. 1915. Mykologische Abhandlungen. Verh Zool Bot Ges Wien 66:296-400. Theissen F, Sydow H. 1918. Synoptische tafeln. Ann Mycol 15:389-491. Titze A, de Hoog GS. 1990. Capnobotryella renispora on roof tile. Antonie van Leeuwenhoek 58:265-269. Universiity of Idaho. 2006. University of Idaho Cooperative Extension Service. Pacific Northwest Insect Management Handbook. Oregon State University, University of Idaho, and the Washington State University. Valchar G. 1993. My Connecticut Garden: Personal Experiences of an Amateur Gardener. Timber Press, Incorporated. Verkley GJM, Crous PW, Groenewald JZ, Braun U, Aptroot A. 2004 Mycosphaerella punctiformis revisited: morphology, phylogeny, and epitypification of the type species of the genus Mycosphaerella (Dothideales, Ascomycota). Mycol Res 108:1271-1282. Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species J. Bacteriol. 172:4238-4246. Walsh BD, Riley CV. 1868. A new bark louse on the osage orange. Amer Ent 1:14. White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. New Yourk: Academic Press.  !  70!  Winka K, Eriksson OE, Bang A. 1998. Molecular evidence for recognizing the Chaetothyriales. Mycologia 90:822-830. Woronichin NN. 1917. In Jaczewski AA. Key to Fungi (Fungi imperfecti). Petrograd, Russia. Woronichin NN. 1925. Über die Capnodiales. Ann Mycol 23:174-178. Woronichin NN. 1926. Zur kenntnis der morphologie und systematik der russtaupilze transkaukasiens. Ann Mycol 24:250. Wu W, Sutton BC, Gange AC. 1996. Revision of Septoria species on Hebe and Veronica and description of Kiwamyces hebes sp. nov. Mycol Res 100:1207-1217.  !  71!  Appendix: Supplementary Tables: Supplementary Table 1: List of taxa selected for the phylogenetic study. Taxon names in black font were included from the alignment of James et al. 2006. Taxa names in blue font were included for this study. Taxon names in bold font indicate new sequences generated in this study. Taxon Phylum: Ascomycota (Ingroup) 1. Acarospora schleicheri 2. Acarospora laqueata 3. Orceolina kerguelensis 4. Trapelia placodioides 5. Roccella fuciformis 6. Dendrographa leucophaea f. minor 7. Scorias spongiosa 8. Fumiglobus pieridicola 9. Capnodium coffeae 10. Conidioxyphium gardeniorum 11. Leptoxyphium fumago 12. Microxyphium citri 13. Conidiocarpus caucasicus 14. Conidiocarpus asiaticus 15. Conidiocarpus betlus 16. Conidiocarpus betlus 17. Conidiocarpus siamensus  !  Order  Family  GenBank Accession Number LSU SSU  Acarosporales Acarosporales Agyriales Agyriales Arthoniales Arthoniales  Acarosporiaceae Acarosporiaceae Agyriaceae Agyriaceae Roccellaceae Roccellaceae  AY640945 AY640943 AY212830 AF274103 AY584654 AF279382  AY640986 AY640984 DQ366257 AF119500 AY584678 AF279381  Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales  Capnodiaceae Capnodiaceae Capnodiaceae Capnodiaceae Capnodiaceae Capnodiaceae Capnodiaceae Capnodiaceae Capnodiaceae Capnodiaceae Capnodiaceae  DQ678075 KC833052 DQ247800 GU301807 GU301831 AY004337 KC833050 JN832612 JN832606 JN832605 JN832607  DQ678024 KC833053 DQ247808 GU296143 GU214535 GU296177 KC833051 JN832597 JN832591 JN832590 JN832595  72!  Taxon 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45.  Conidiocarpus siamensus Conidiocarpus siamensus Conidiocarpus siamensus Conidiocarpus siamensus Ramichloridium cerophilum Ramichloridium musae Ramichloridium anceps Dissoconium commune Toxicocladosporium sp. Cladosporium bruhnei Davidiella tassiana Rasutoria tsugae Sphaerulina polyspora Zasmidium anthuriicola Mycosphaerella punctiformis Ramularia grevilleana Zymoseptoria tritici Passalora fulva Mycosphaerella walkeri Phaeophleospora atkinsonii Mycosphaerella holualoana Cercospora zebrina Mycosphaerella latebrosa Piedraia hortae Capnobotryella renispora Batcheloromyces leucadendri Xenomeris juniperi Teratosphaeria stellenboschiana  Order Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales  Family Capnodiaceae Capnodiaceae Capnodiaceae Capnodiaceae Dissoconiaceae Dissoconiaceae Dissoconiaceae Dissoconiaceae Davidiellaceae Davidiellaceae Davidiellaceae Euantennariaceae Mycosphaerellaceae Mycosphaerellaceae Mycosphaerellaceae Mycosphaerellaceae Mycosphaerellaceae Mycosphaerellaceae Mycosphaerellaceae Mycosphaerellaceae Mycosphaerellaceae Mycosphaerellaceae Mycosphaerellaceae Piedraiaceae Teratosphaeriaceae Teratosphaeriaceae Teratosphaeriaceae Teratosphaeriaceae  !  !  GenBank Accession Number LSU SSU JN832611 JN832593 JN832609 JN832596 JN832610 JN832594 JN832608 JN832592 GU214485 GU296190 EU041857 GU214577 DQ823102 DQ823109 GQ852589 NG_016521 FJ372420 JX273062 GU214408 AY251096 GU214410 JN939022 EF114705 EF114730 GU214501 AY251095 GQ852732 GU214595 NG_027571 DQ471017 GU214486 GU214578 JQ739857 GU214540 DQ008163 AY251109 DQ267574 GU214593 GU214463 JN938701 GU214440 GU214543 JQ739815 AY251104 GU214444 GU214546 AY016366 AY016349 GU214398 AF006723 EU019246 GU214515 EF114709 EF114734 GQ852715 GU214583  !  73!  Taxon 46. 47.  Teratosphaeria toledana Catenulostroma chromoblastomycosum Recurvomyces mirabilis Elasticomyces elasticus Penidiella columbiana Microcyclospora pomicola Readeriella mirabilis Readeriella dimorphospora Capronia pilosella Exophiala dermatitidis Exophiala pisciphila Diaporthe eres Gnomonia gnomon Dothidea sambuci Sydowia polyspora Dothidea insculpta Stylodothis puccinioides Erysiphe mori Aspergillus fumigatus Emericella nidulans Monascus purpureus Geoglossum nigritum Trichoglossum hirsutum Verticillium dahliae Cudoniella clavus Monilinia laxa Botryotinia fuckeliana Mollisia cineria Nectria cinnabarina  48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. 74.  !  Order  Family  Capnodiales Capnodiales  Teratosphaeriaceae Teratosphaeriaceae  GenBank Accession Number LSU SSU FJ493225 GU214618 EU019251 GU214516  Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Capnodiales Chaetothyriales Chaetothyriales Chaetothyriales Diaporthales Diaporthales Dothideales Dothideales Dothideales Dothideales Erysiphales Eurotiales Eurotiales Eurotiales Geoglossales Geoglossales Glomerellales Helotiales Helotiales Helotiales Helotiales Hypocreales  Teratosphaeriaceae Teratosphaeriaceae Teratosphaeriaceae Teratosphaeriaceae Teratosphaeriaceae Teratosphaeriaceae Herpotrichiellaceae Herpotrichiellaceae Herpotrichiellaceae Diaporthaceae Gnomoniaceae Dothidiaceae Dothidiaceae Dothidiaceae Dothidiaceae Erysiphaceae Trichocomaceae Trichocomaceae Elaphomycetaceae Geoglossaceae Geoglossaceae Plectosphaerellaceae Helotiaceae Sclerotiniaceae Sclerotiniaceae Dermatiaceae Nectriaceae  GU250372 GU250375 EU019274 GU570551 EU754209 EU019258 DQ823099 DQ823100 DQ823101 AF408350 AF408361 AY544681 AY544675 NG_027643 NG_027594 AB022418 AY660917 AF454167 DQ782908 AY544650 AY544653 DQ470945 DQ470944 AY544670 AY544651 DQ470990 U00748  GU250329 GU250333 GU214565 GU570559 EU754110 GU214521 DQ823106 DQ823107 DQ823108 DQ471015 DQ471019 AY544722 AY544718 DQ247810 NG_013130 AB033484 AB008401 U77377 DQ782881 AY544694 AY544697 AY489705 DQ470992 AY544714 AY544695 DQ470942 U32412  74!  Taxon 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99. 100. 101. 102.  Hydropisphaera erubescens Hypocrea americana Cordyceps sinensis Myrothecium verrucaria Cladonia caroliniana Lecanora hybocarpa Physcia aipolia Peltula umbilicata Peltula auriculata Lindra thalassiae Lulworthia grandispora Meliola niessleana12 Appendiculella sp. Microascus trigonosporus Microthyrium microscopicum Spiromastix warcupii Ophiostoma ulmi Orbilia vinosa Orbilia auricolor Stictis radiata Acarosporina microspora Diploschistes ocellatus Peltigera degenii Pertusaria dactylina Dibaeis baeomyces Cheilymenia stercorea Caloscypha fulgens Gyromitra californica  Order Hypocreales Hypocreales Hypocreales Hypocreales Lecanorales Lecanorales Lecanorales Lichinales Lichinales Lulworthiales Lulworthiales Meliolales Meliolales Microascales Microthyriales Onygenales Ophiostomatales Orbiliales Orbiliales Ostropales Ostropales Ostropales Peltigerales Pertusariales Pertusariales Pezizales Pezizales Pezizales  Family Bionectriaceae Hypocreaceae Cordycipitaceae Incertae sedis Cladoniaceae Lecanoraceae Physciaceae Peltulaceae Peltulaceae Lulworthiaceae Lulworthiaceae Meliolaceae Meliolaceae Microascaceae Microthyriaceae Ajellomycetaceae Ophiostomataceae Orbiliaceae Orbiliaceae Stictidaceae Stictidaceae Thelotramataceae Peltigeraceae Pertusariaceae Icmadophilaceae Pyronemataceae Caloscyphaceae Discinaceae  GenBank Accession Number LSU SSU AY545726 AY545722 AY544649 AY544693 AB067704 AY245670 AY489713 AY489681 AY584640 AY584664 DQ782910 DQ782883 DQ782904 DQ782876 DQ782887 DQ832334 DQ832332 DQ832330 DQ470947 DQ470994 DQ522856 DQ522855 KC833049 AF021794 DQ508302 DQ508301 DQ470958 DQ471006 GU301846 GU296175 DQ782909 DQ782882 DQ368627 M83261 DQ470952 DQ471000 DQ470953 DQ471001 AF356663 U20610 AY584643 AY584667 AY605077 AF038877 AY584657 AY584681 DQ782907 DQ782880 AF279385 AF113712 AY544661 AY544705 DQ247799 DQ247807 AY544673 AY544717  !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! 12!Only!the!partial!ribosomal!large!subunit!sequence!was!obtained!in!this!study.!  !  75!  Taxon 103. 104. 105. 106. 107. 108. 109. 110. 111.  Order  Family  Pezizales Pezizales Pezizales Pezizales Pezizales Pezizales Pezizales Pezizales Pezizales  Morchellaceae Ascoobolaceae Sarcoscyphaceae Pezizaceae Morchellaceae Pyronemataceae Pyronemataceae Helvellaceae Pezizaceae  112. 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 126.  Disciotis venosa Ascobolus crenulatus Sarcoscypha coccinea Peziza vesiculosa Morchella aff. esculenta Scutellinia scutellata Aleuria aurantia Helvella compressa Peziza proteana f. sparassoides Pyronema domesticum Trematosphaeria heterospora Westerdykella cylindrica Chaetasbolisia erysiphoides Pyrenophora phaeocomes Cochliobolus heterostrophus Pleospora herbarum Pneumocystis carinii Protomyces inouyei Pyrgillus javanicus Pyrenula pseudobufonia Coccomyces dentatus Potebniamyces pyri Debaryomyces hansenii Saccharomyces cerevisiae  Pezizales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pneumocystidiales Protomycetales Pyrenulales Pyrenulales Rhytismatales Rhytismatales Saccharomycetales Saccharomycetales  Pyronemataceae Trematosphaeriaceae Sporomiaceae Incertae sedis Pleosporaceae Pleosporaceae Pleosporaceae Pneumocystidiaceae Protomycetaceae Pyrenulaceae Pyrenulaceae Rhytismataceae Cryptomycetaceae Saccharomycetaceae Saccharomycetaceae  127.  Saccharomyces castellii  Saccharomycetales  Saccharomycetaceae  128.  Lachancea waltii  Saccharomycetales  Saccharomycetaceae  !  GenBank Accession Number LSU SSU AY544667 AY544711 AY544678 AY544721 AY544647 AY544691 DQ470948 DQ470995 AY544664 AY544708 DQ247806 DQ247814 AY544654 AY544698 AY544655 AY544699 AY544659 AY544703 DQ247805 AY016369 NG_027595 EU754140 DQ499596 AY544645 DQ247804 AF047831 AY548294 DQ823103 AY640962 AY544657 DQ470949 AF485980 U53879 Region: 24144-25525 AACF01000279 Region: 1595-2975 AADM01000465 Region: 1022-2407  DQ247813 AY016354 NG_016502 EU754041 DQ499595 AY544727 DQ247812 S83267 AY548295 DQ823110 AY641001 AY544701 DQ470997 AF485980 Z75578 Z75577 AADM01000401 Region: 1935-3527  76!  ! Taxon  Order  Family  129. 130.  Eremothecium gossypii13 Candida albicans  Saccharomycetales Saccharomycetales  Dipodascaceae Saccharomycetaceae  131.  Candida tropicalis  Saccharomycetales  Saccharomycetaceae  132.  Kluyveromyces lactis  Saccharomycetales  Saccharomycetaceae  133.  Meyerozyma guilliermondii  Saccharomycetales  Debaryomycetaceae  134. 135. 136. 137. 138. 139. 140. 141. 142. 143. 144. 145. 146.  Schizosaccharomyces pombe Neurospora crassa Sordaria fimicola Chaetomium globosum Magnaporthe grisea Taphrina wiesneri Umbilicaria mammulata Endocarpon pallidulum Staurothele frustulenta Xylaria hypoxylon Xylaria acuta Daldinia concentrica Arthrinium sp.  Schizosaccharomycetales Sordariales Sordariales Sordariales Magnaporthaceae Taphrinales Umbilicariales Verrucariales Verrucariales Xylariales Xylariales Xylariales Sordariomycetidae incertae sedis  Schizosaccharomycetaceae Sordariaceae Sordariaceae Chaetomiaceae Magnaporthaceae Taphrinaceae Umbilicariaceae Verrucariaceae Verrucariaceae Xylariaceae Xylariaceae Xylariaceae Apiosporaceae  GenBank Accession Number LSU SSU AF113137 AF113137 AACQ01000290 AACQ01000290 Region: 9209-10587 Region: 7072-8646 M55527 AAFN01000124 Region: 191890193271 NC_006040 Region: NC_006040 Region: 1494981-1496333 1514508-1516092 AB013587 AAFM01000051 Region: 270781272161 Z19136 X54866 AF286411 X04971 AY545728 AY545724 AY545729 AY545725 AB026819 AB026819 AY548292 AY548293 DQ782912 AY648114 DQ823097 DQ823104 DQ823098 DQ823105 AY544648 AY544692 AY544676 AY544719 DCU47828 U32402 FJ890366 JX273064  ! ! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! 13 Ribosomal large and small subunit region was used from the same sequence.  !  77!  Taxon Phylum: Basidiomycota (Outgroup) 147. Puccinia graminis 148. Ustilago maydis 149. Fomitopsis pinicola 150. Coprinus comatus  !  Order  Pucciniales Ustilaginales Polyporales Agaricales  Family  Pucciniaceae Ustilaginaceae Fomitopsidaceae Agaricaceae  GenBank Accession Number LSU SSU AF522177 AF453938 AY684164 AY635772  AY125409 X62396 AY705967 AY665772  78!  Supplementary Table 2: Summary of descriptions from literature on reproductive states for the capnodiaceous fungi included in this study.  Species  Pycnidium  ✔  Scorias spongiosa  Capnodiaceae  Name based on which reproductive state? Sexual  Fumiglobus pieridicola  Capnodiaceae  Asexual  Capnodium coffeae Conidioxyphium gardeniorum  Capnodiaceae  Sexual  Capnodiaceae  Asexual  ✔  Batista and Ciferri (1963b)  Leptoxyphium fumago  Capnodiaceae  Asexual  ✔  Srivastava (1982)  !  Family  Anamorph name  Polychaeton sp.  Citation for Description  Hughes (1976); Sivanesan (1984) In this study  Key characters of the asexual state quoted from cited description  Fruit body: elongated, flask-shaped pycnidia. Conidiospores: ellipsoidal, hyaline, continuous. Hypha: irregularly arranged brown, with mucilaginous coating and constricted septum. Fruit body: pycnidium, terminal and apical in position with well-defined short, stout stalk. Conidiospores: isodiametric, hyaline, minute, in continuous chain. Hypha: moniliform, composed of isodiametric cells, brown.  Unknown Fruit body: pycnidium with elongated neck Conidiospores: baccilar, continuous, hyaline, 1-guttulate. Hypha: made of cylindrical cells, constricted septum with mucilaginous sheath, brown. Fruit body: pycnidia elongated with a stout base and a long, narrow neck with an inflated end. Conidiospores: hyaline, continuous, 1-septate and pigmented. Hypha: composed of cylindrical cells, constricted septum with mucilaginous sheath, brown.  79!  Species  Family  Pycnidium  ✔  Batista and Ciferri (1963b)  Microxyphium citri  Capnodiaceae  Name based on which reproductive state? Asexual  Anamorph name  Conidiocarpus caucasicus  Capnodiaceae  Asexual  ✔  Khodaparast (2006); Woronichin (1917)  Conidiocarpus asiaticus  Capnodiaceae  Asexual  ✔  Chomnunti et al. (2011)  Conidiocarpus betle  Capnodiaceae  Sexual  Conidiocarpus sp.  Citation for Description  Chomnunti et al. (2011); Hughes (1976); Sivanesan (1984)  Key characters of the asexual state quoted from cited description  Fruit body: pycnidium ellipsoidal with long neck. Conidiospores: globose-elliptical, hyaline, continuous. Hypha: composed of cylindrical cells, constricted septum with mucilaginous sheath, brown. Fruit body: pycnidium ellipsoidal with long neck. Conidiospores: baccilar, continuous, hyaline. Hypha: composed of cylindrical cells, constricted septum with mucilaginous sheath. Fruit body: pycnidium, ellipsoidal with long neck. Conidiospores: oblong to ellipsoid, nonseptate, hyaline. Hyphae: composed of cylindrical cells, constricted septum with mucilaginous sheath. Fruit body: pycnidium ellipsoidal with long neck. Conidiospores: hyaline, ellipsoidal, continuous and non-septate. Hypha: branched, dark brown, composed of cylindrical cells, constricted septum with mucilaginous sheath.  ! ! ! ! !  !  80!  Species  Family  Conidiocarpus siamensis  Capnodiaceae  Name based on which reproductive state? Asexual  Ramichloridium cerophilum  Dissoconiaceae  Asexual  Ramichloridium musae  Dissoconiaceae  Asexual  Dissoconium commune  Dissoconiaceae  Asexual  Toxicocladosporiu m sp.  Davidiellaceae  Asexual  Pycnidium  ✔  Anamorph name  Citation for Description  Chomnunti et al. (2011)  de Hoog and HermanidesNijhof (1977) Arzanlou et al. (2007) de Hoog and HermanidesNijhof (1977); Arzanlou et al. (2007) Crous et al. (2004)  Crous et al. (2007b)  Key characters of the asexual state quoted from cited description  Fruit body: pycnidium ellipsoidal with long neck. Conidiospores: oblong to ellipsoid, nonseptate, hyaline. Hypha: cylindrical with septate, thick walled, constricted at the septum, dark brown with mucilaginous sheath. Fruit body: conidiogenous cells terminal, branched, rachis short and straight, pigmented. Conidiospores: solitary, fusiform-clavate. Hypha: pale olivaceous-brown, made of cylindrical cells. Fruit body: conidiogenous cells terminal, branched, rachis short and straight, pigmented. Conidiospores: solitary, fusiform-clavate. Hypha: pale olivaceous-brown, made of cylindrical cells. Fruit body: conidiogenous cells pale brown, sub-cylindrical, tapering, straight-curved. Conidiospores: terminal, olivaceous, obclavate 0-1-septate, constricted at the septum, straightcurved. . Secondary conidia present. Hypha: branched, septate, pale brownolivaceous, composed of cylindrical cells. Fruit body: conidiophores solitary, dimorphic, macronematous or micronematous. Conidiospores: in branched or unbranched chains, dark brown, thick-walled, sepatate. Hypha: branched, septate, dark brown.  !  !  81!  Species  Family  Pycnidium  Cladosporium bruhnei  Davidiellaceae  Name based on which reproductive state? Asexual  Anamorph name  Davidiella tassiana  Davidiellaceae  Sexual  Cladosporium herbarum  Rasutoria tsugae Sphaerulina polyspora Passalora vaginae  Euantennariaceae Mycosphaerellaceae  Sexual Sexual  Unknown Unknown  Mycosphaerellaceae  Asexual  Citation for Description  Key characters of the asexual state quoted from cited description  Schubert et al. (2007)  Fruit body: conidiophores macronematous and micronematous, arising as lateral or terminal branches erect, flexuous, geniculate, nodulose. Conidiospores: catenate, formed in branched chains, straight to slightly curved, small terminal conidia sub-globose, ovoid to obovoid or somewhat limoniform. Hypha: superficial, branched, usually slightly constricted at the septum, hyaline. Fruit body: conidiophores terminal with intercalary swellings and geniculate elongations, olivaceous green-brown, smoothwalled. Conidiospore: ellipsoidal to cylindrical, with rounded ends, with protuberant, brown scars, often 2- or more-celled rarely 1-celled. Hypha: septate, composed of elongated cells, olivaceous green-brown.  de Hoog et al. (2000)  Chupp (1954)  Fruit body: conidiophores are branches from procumbent threads, brown, slightly irregular in width, intertwined, septate, geniculate. Conidiospore: obclavato-cylindric, hyaline to olivaceous, straight, 0-5 septate. Hypha: epiphyllous, stromata or sclerotia present.  ! !  !  82!  Species  Family  Zasmidium anthuriicola  Mycosphaerellaceae  Name based on which reproductive state? Asexual  Mycosphaerella punctiformis  Mycosphaerellaceae  Sexual  Pycnidium  Anamorph name  Citation for Description  Hill and Schubert (2006)  Ramularia endophylla  Verkley et al. (2004 )  Key characters of the asexual state quoted from cited description  Fruit body: conidiophores solitary, arising from hyphae, lateral, sub-cylindrical or slightly attenuated towards the apex, pale olivaceous to olivaceous brown. Conidiospore: solitary, narrowly obclavatecylindrical, filiform, 0-6-septate, subhyaline to pale olivaceous, thin-walled, verruculose, apex obtuse to subacute, base short obconically, truncate. Hypha: rarely branched, straight, occasionally anastomosing, cylindric, septate, sub-hyaline to pale medium brown or olivaceous-brown, thin-walled. Fruit bodies: conidiophores simple, subcylindrical or cylindrical, straight or geniculate-sinuous, hyaline, without a basal septum. Conidiospores: hyaline, walls smooth to minutely roughened, hila conspicuous, thickened, darkened, refractive, wide; primary conidia solitary, ovoid, or ellipsoid to subcylindrical, aseptate, rounded at the top and somewhat attenuated towards the base. Hypha: description not provided.  ! ! ! ! !  !  83!  ! Species  Ramularia grevilleana  Mycosphaerellaceae  Name based on which reproductive state? Asexual  Zymoseptoria tritici  Mycosphaerellaceae  Asexual  !  Family  Pycnidium  ✔  Anamorph name  Citation for Description  Braun (1998)  Muthumary (1986)  Key characters of the asexual state quoted from cited description  Fruit body: conidiophores in small to moderately rich fascicles, loose to dense, arising through stomata, erect, straight, subcylindric to geniculate-sinuous, simple. Conidiospores: catenate, occasionally in branched chains, narrowly ellipsoid-ovoid, subcylindric-fusiform. Hypha: hyaline, septate, sparsely branched, forming small to moderately large stromata, substomatal to intraepidermal. Fruit body: pycnidium amphigenous, serially and parallely arranged, spherical, subepidermal, unilocular, ostiolate. Conidiogenous cells lining the base and sides of the pycnidia, blastic, simple, one-twocelled, ampulliform to cylindrical, hyaline, 517 x 3-8 µm, each producing a solitary terminal conidium at its tip. Conidiospores: elongate, filiform, straight to gently curved, truncate at the base, pointed at the tip, 3-7-septate, hyaline. Hypha: description not provided.  !  !  84!  Species  Passalora fulva  Mycosphaerellaceae  Name based on which reproductive state? Asexual  Mycosphaerella walkeri  Mycosphaerellaceae  Sexual  Phaeophleospora atkinsonii  Mycosphaerellaceae  Asexual  Mycosphaerella holualoana  Mycosphaerellaceae  Sexual  !  Family  Pycnidium  Anamorph name  Sonderhenia eucalypticola  ✔  Citation for Description  Key characters of the asexual state quoted from cited description  Holliday and Mulder (1976)  Fruit body: conidiophores in loose fascicles arising from the stroma, divergent, unbranched, flexuous, narrow at the base, becoming broader at the apex, unilateral nodose swellings present, pale brown to dark at the apex, septate. Conidiospores: pale to dark brown, cylindrical or ellipsoid, smooth, straight or mildly curved, in chains. Hypha: description not provided. Fruit body: pycnidia developing from the lower surface of the leaf, abundant, brown, thin walled. Conidiospores: dark brown, ellipsoidal-fusoidcylindrical, apex rounded base flattened, hilum thin, outer wall minutely rough. Hypha: description not provided. Fruit body: pycnidium, immersed, subepidermal, black, globose, unilocular, Conidiogenous cells discrete or integrated, indeterminate, terminal or sometimes intercalary, pale brown, lageniform, subcylindrical. Conidiospores: holoblastic, solitary, dry, pale brown, cylindrical-slightly fusiform, straight or slightly flexuous, slightly tapered towards the obtuse apex, base truncate. Hypha: immersed in the host tissue, pale brown, septate, branched, smooth.  Swart and Walker (1988)  Wu et al. (1996)  Unknown  85!  !  Species!  Pycnidium  Cercospora zebrina  Mycosphaerellaceae  Name based on which reproductive state? Asexual  Mycosphaerella latebrosa Piedraia hortae Capnobotryella renispora  Mycosphaerellaceae  Sexual  Unknown  Piedraiaceae Teratosphaeriaceae  Sexual Asexual  Unknown  Batcheloromyces leucadendri  Teratosphaeriaceae  Asexual  Xenomeris juniperi  Teratosphaeriaceae  Sexual  !  Family  Anamorph name  Citation for Description  Key characters of the asexual state quoted from cited description  Chupp (1954)  Fruit body: amphigenous; fascicles mostly 330 stalks; conidiophores light-dark olivaceous brown, attenuated, sparingly septate, not branched, straight, sinuous, or repeatedly and abruptly geniculate. Conidiospores: hyaline, acicular to almost linear, straight to curved, indistinctly multiseptate, base truncate, tip subacute to subobtuse. Hypha: immersed within the leaf tissue.  Sugiyama and Amanao (1987); Titze and de Hoog (1990) Taylor et al. (1999)  Fruit body: conidiogenous. Conidiospores: smooth, thin-walled, reniform, with a median septum. Hypha: irregularly branches, blackish brown, rough-and thick- walled hyphae, sepate. Fruit body: sporodochia present, brown. Tuft of hyphae emerging from the sporodochia. Conidiophores erect superficial. Conidiogenous cells doliiform to calyciform. Conidiospores: arising singly from blown out ends of the conidiogenous cells, solitary, separating from the conidiogenous cell by schizolytic secession, aseptate or multi-septate. Hypha: description not provided  Unknown  !  !  86!  Species  Teratosphaeria stellenboschiana  Teratosphaeriaceae  Name based on which reproductive state? Asexual  Teratosphaeria toledana  Teratosphaeriaceae  Sexual  Catenulostroma chromoblastomyco sum  Teratosphaeriaceae  Asexual  !  Family  Pycnidium  ✔  Anamorph name  ✔  Citation for Description  Crous et al. (2006)  Kirramyces toledana  Crous et al. (2004)  Crous et al. (2007a)  Key characters of the asexual state quoted from cited description  Fruit body: pycnidial, medium brown, globose, 80-120 µm diam; wall of 3-4 layers of brown textura angularis. Conidiogenous cells discrete, ampulliform to subcylindrical, pale to medium brown, finely verruculose, proliferating 1-3 times percurrently near the apex. Conidiospores: holoblastic, solitary, aseptate, ellipsoidal, with subobtuse apex and subtruncate base. Hypha: description not provided Fruit body: pycnidial, substomatal, amphigenous; conidiophores reduced to conidiogenous cells. Conidiogenous cells ampulliform to sub-cylindrical, pale brown. Conidiospores: fusoid with acutely rounded apices and truncate bases, medium brown. Hypha: internal, consisting of smooth, branched, septate, brown, 3–4 µm wide hyphae. Fruit body: sporodochial, brown, superficial, conidiophores inconspicuous. Conidiospores: occurring in branched chains, sub-cylindrical with sub-truncate ends, straight to slightly curved. Hypha: branched, septate, dark brown, thickwalled.  !  !  87!  Species  Family  Recurvomyces mirabilis  Teratosphaeriaceae  Name based on which reproductive state? Asexual  Elasticomyces elasticus  Teratosphaeriaceae  Asexual  Pycnidium  Anamorph name  Citation for Description  Selbmann et al. (2008)  Selbmann et al. (2008)  Key characters of the asexual state quoted from cited description  Fruit body: conidiogenous cells poly-blastic, integrated, terminal or intercalary, thin-walled, brown. Conidiospores: enteroblastic, dry, solitary, 0– 1-septate, sub-hyaline to yellowish brown, thin-walled, smooth, ellipsoidal to obovoidal. i long, smooth, yellowish brown and thickwalled, septate, branched, conidiophores erect, semi-macronematous, mononematous, short, septate, smooth, thick-walled, brown, and repeatedly branched. Fruit body: fertile hyphae more pigmented, thicker, repeatedly branched, septate, and smooth at first, then crenulate, forming numerous short segments and conidia by fragmentation. Conidiospores: arthroconidia catenate, mostly bicellular, rarely aseptate, smooth or crenulate, cylindrical, with thickened and truncated ends due to schizolytic secession, slightly constricted at the septum. Hyphae: composed of long, septate, branched, smooth, thin-walled, yellowish to pale brown hyphae.  ! ! ! ! !  !  88!  ! Species  Family  Penidiella columbiana  Teratosphaeriaceae  Name based on which reproductive state? Asexual  Microcyclospora pomicola  Teratosphaeriaceae  Asexual  Readeriella mirabilis  Teratosphaeriaceae  Asexual  Pycnidium  Anamorph name  Citation for Description  Crous et al. (2007a)  Frank et al. (2010)  ✔  Macauley and Thrower (1965); Crous et al. (2009b)  Key characters of the asexual state quoted from cited description  Fruit bodies: conidiophores arising from superficial mycelium, terminally penicillate, erect, brown, wall. Conidiospores: ramoconidia 0-1-septate, medium brown, smooth, ellipsoidal to obclavate or obovoid, with 1-3 apical hila, broadly truncate base, not or barely attenuated. Hypha: branched, septate, smooth, pale brown. Fruit bodies: conidiophores reduced to conidiogenous cells, integrated, mono- to poly-blastic, lateral on hyphae, subdenticulate, pale brown, smooth. Conidiospores: scolecosporous, cylindrical, straight to variously curved, flexuous, apex obtuse, base truncate, 1–multi-septate, somewhat constricted at septa, smooth, pale brown. Hypha: branched, septate, pale brown, smooth. Fruit body: Pycnidia are of two types: larger pycnidia devoid of spores and smaller ones consisting of tetraherdral spores. Conidiospores: solitary, brown, aseptate, base truncate, with three apical, lateral, obtuse projections. Hypha: Thallus consists dark brown stroma, embedded within the leaf tissue.  ! ! !  !  89!  Species  Readeriella dimorphospora  !  Family  Teratosphaeriaceae  Name based on which reproductive state? Asexual  Pycnidium  Anamorph name  Citation for Description  Crous et al. (2007c)  Key characters of the asexual state quoted from cited description  Conidiospores: Arthoconidia and pale brown, cylindrical conidia with obtusely rounded to sub-truncate ends; aseptate or 1(-3)-septate, brown, predominantly aseptate, ellipsoidal or subglobose or globose in shape. Hypha: pale brown, smooth, cylindrical, disarticulating at septa to form conidia.  90!  Supplementary Table 3: Sequences generated in this study, but not included in the phylogenetic analysis due to unavailability of ITS and 5.8S sequences for Capnodiaceae fungi on the database.  Primers  GenBank Taxon  Gene region Accession #  Forward  KF263961  ITS1  Reference  Reverse  Reference  ITS1, 5.8S Fumiglobus  and ITS2  1 pieridicola  (White et al.  complete  (White et al. ITS4  1990)  1990)  sequence ITS1, 5.8S Conidiocarpus  and ITS2  2  (Gardes and KF263962  caucasicus  complete  ITS1F  (White et al. TW13  Bruns 1993)  1990)  sequence  !  91!  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0074013/manifest

Comment

Related Items