UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Examination of microbiological quality of in-field leafy vegetables and identification of on-farm generic… Wood, Jayde Lian 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2013_fall_wood_jayde.pdf [ 11.02MB ]
Metadata
JSON: 24-1.0073924.json
JSON-LD: 24-1.0073924-ld.json
RDF/XML (Pretty): 24-1.0073924-rdf.xml
RDF/JSON: 24-1.0073924-rdf.json
Turtle: 24-1.0073924-turtle.txt
N-Triples: 24-1.0073924-rdf-ntriples.txt
Original Record: 24-1.0073924-source.json
Full Text
24-1.0073924-fulltext.txt
Citation
24-1.0073924.ris

Full Text

Examination of Microbiological Quality of In-field Leafy Vegetables and Identification of On-farm Generic Escherichia coli Transmission Dynamics  by Jayde Lian Wood  B.Sc., The University of British Columbia, 2011  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Food Science)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  June 2013  © Jayde Lian Wood, 2013  Abstract Fresh produce has increasingly been linked to foodborne outbreaks in North America. Although contamination of produce may occur at any point along the food continuum, significant risks are thought to occur at the farm level. Data illustrating bacterial transmission dynamics on farm, however, are lacking. The aim of this project was to produce baseline data describing the occurrence of indicator bacteria on in-field leafy vegetables; examine antimicrobial resistance (AMR) of recovered Escherichia coli; and identify on-farm microbiological reservoirs impacting leafy vegetables. In-field plants (n=1093) and environmental samples (irrigation water, compost, soil, and hand swabs; n=316) were collected from two production systems (conventional and organic) weekly between July-October during 2011 and 2012. Aerobic colony, coliform, and Escherichia coli counts were determined using 3M Petri-films. Escherichia coli prevalence was determined by enrichment with recovered isolates subjected to BOX-PCR and multiplex PCR phylogenetic typing. Mean coliform count for in-field plants was 1.2 ± 0.1 log10 CFU/g. The prevalence of E. coli was 0.8 and 7% for conventional and organic leafy vegetable samples, respectively. No AMR to therapeutically critical antibiotics was observed in E. coli recovered from in-field plants, though nine (13%, n=67) multi-drug resistant strains were identified. Escherichia coli was recovered from an irrigation water reservoir (27%, n = 15), sprinkler (40%, n = 35), soil (58%, n = 19), hand swabs (4%, n = 27), and compost (6%, n = 16) from the organic production system. Escherichia coli was recovered from ditch water (100%, n = 10), and soil (12%, n = 25) from the conventional production system. Four phylogenetic groups were recovered, with B1 E. coli being the predominant phylogroup (78%). Though 92% of recovered E. coli were unrelated, BOX-PCR revealed identical fingerprints for E. coli recovered from irrigation water or compost and in-field plants. In summary, based on E. coli levels (n=5, c=2, ii  m=100 CFU/g, M=1,000 CFU/g), the microbiological quality of leafy vegetables from both farms was acceptable. BOX-PCR data demonstrated transmission of E. coli from on-farm reservoirs to in-field plants, suggesting possible transmission routes for foodborne pathogens. The limitation of B1 E. coli as fecal indicators was highlighted.  iii  Preface  This thesis is original, unpublished, independent work by the author, Jayde L. Wood.  iv  Table of Contents  Abstract.......................................................................................................................................... ii! Preface ........................................................................................................................................... iv! Table of Contents ...........................................................................................................................v! List of Tables ................................................................................................................................ xi! List of Figures............................................................................................................................. xiii! List of Abbreviations ...................................................................................................................xv! Acknowledgements .................................................................................................................... xvi! Chapter 1: Introduction ...............................................................................................................1! 1.1! Microbiological Hazards and Emerging Issues Associated with Fresh Produce ............... 2! 1.2! Microbiological Quality of Leafy Vegetables ................................................................... 4! 1.2.1! Aerobic microorganisms on leafy vegetables ............................................................. 5! 1.2.2! Coliforms .................................................................................................................... 6! 1.2.3! Generic Escherichia coli ............................................................................................. 8! 1.2.4! Foodborne pathogen detection .................................................................................. 10! 1.2.4.1! Escherichia coli O157:H7.................................................................................. 10! 1.2.4.2! Salmonella.......................................................................................................... 11! 1.3! Microbiological Contamination of In-Field Leafy Vegetables ........................................ 12! 1.3.1! Irrigation water.......................................................................................................... 12! 1.3.1.1! Prevalence of enteric bacteria in irrigation water .............................................. 13! 1.3.1.2! Persistence of enteric bacteria in irrigation water .............................................. 16! v  1.3.1.3! Bacterial transmission dynamics from irrigation water to leafy vegetables ...... 16! 1.3.2! Soil ............................................................................................................................ 19! 1.3.2.1! Prevalence and persistence of enteric bacteria in soil ........................................ 19! 1.3.2.2! Bacterial transmission dynamics from soil to leafy vegetables ......................... 21! 1.3.3! Compost .................................................................................................................... 22! 1.3.3.1! Prevalence and persistence of enteric bacteria in compost ................................ 22! 1.3.3.2! Bacterial transmission dynamics from compost to leafy vegetables ................. 24! 1.3.4! Hands ........................................................................................................................ 25! 1.3.5! Wild animals ............................................................................................................. 25! 1.3.6! Insects ....................................................................................................................... 26! 1.4! Bacterial Fitness and Persistence on In-field Leafy Vegetables ...................................... 27! 1.4.1! Bacterial fitness/persistence on the surface of in-field leafy vegetables .................. 27! 1.4.1.1! Attachment to the surface of leafy vegetables ................................................... 27! 1.4.1.2! Persistence on plant surfaces of in-field leafy vegetables ................................. 29! 1.4.2! Internalization ........................................................................................................... 31! 1.4.2.1! Internalization through openings ....................................................................... 31! 1.4.2.2! Internalization through infiltration ..................................................................... 32! 1.5! Project Objectives ............................................................................................................ 33! Chapter 2: Field Study Examining the Microbiological Quality of Leafy Vegetables Grown in the Lower Mainland Region of British Columbia ................................................................50! 2.1! Introduction ...................................................................................................................... 50! 2.2! Materials and Methods ..................................................................................................... 51! vi  2.2.1! Participating farms .................................................................................................... 51! 2.2.2! Sampling of leafy vegetable samples ........................................................................ 51! 2.2.3! Microbiological analyses .......................................................................................... 52! 2.2.3.1! Enumeration of aerobic microorganisms, coliforms, and generic Escherichia coli…….. ........................................................................................................................... 52! 2.2.3.2! Detection of generic Escherichia coli ................................................................ 53! 2.2.3.3! Phylogenetic typing of Escherichia coli isolates ............................................... 54! 2.2.3.4! Virulence typing of Escherichia coli isolates .................................................... 55! 2.2.3.5! Antimicrobial resistance of Escherichia coli isolates ........................................ 55! 2.2.3.6! Statistical analyses ............................................................................................. 56! 2.3! Results .............................................................................................................................. 57! 2.3.1! Sample collection ...................................................................................................... 57! 2.3.2! Microbiological quality of leafy vegetables ............................................................. 57! 2.3.2.1! Aerobic microorganisms .................................................................................... 57! 2.3.2.2! Coliform bacteria ............................................................................................... 57! 2.3.2.3! Detection and phylogrouping of Escherichia coli ............................................. 58! 2.3.3! Antimicrobial resistance ........................................................................................... 59! 2.3.4! Factors associated with microbiological levels on leafy vegetables ......................... 60! 2.4! Discussion ........................................................................................................................ 61! 2.4.1! Microbiological quality ............................................................................................. 61! 2.4.2! Factors associated with elevated microbiological levels .......................................... 67! 2.4.3! Antimicrobial resistance ........................................................................................... 69! vii  2.5! Conclusion ....................................................................................................................... 70! Chapter 3: Identification of On-Farm Bacterial Reservoirs and Contamination Routes for In-Field Leafy Vegetables, Using BOX-PCR.............................................................................86! 3.1! Introduction ...................................................................................................................... 86! 3.2! Materials and Methods ..................................................................................................... 87! 3.2.1! Sample collection ...................................................................................................... 87! 3.2.1.1! In-field leafy vegetable samples ........................................................................ 87! 3.2.1.2! Environmental samples ...................................................................................... 87! 3.2.1.3! Survival of Escherichia coli during overhead irrigation.................................... 88! 3.2.2! Microbiological analyses .......................................................................................... 88! 3.2.2.1! Enumeration of aerobic microorganisms, generic Escherichia coli, and coliforms ........................................................................................................................... 88! 3.2.2.2! Detection of generic Escherichia coli ................................................................ 89! 3.2.2.3! Phylogenetic typing of Escherichia coli isolates ............................................... 89! 3.2.2.4! Virulence typing of Escherichia coli isolates .................................................... 89! 3.2.2.5! Genotypic characterization of Escherichia coli isolates .................................... 89! 3.2.2.6! BOX-PCR data analysis ..................................................................................... 90! 3.2.2.7! Statistical analyses ............................................................................................. 90! 3.3! Results .............................................................................................................................. 91! 3.3.1! Sample collection ...................................................................................................... 91! 3.3.2! On-farm Escherichia coli reservoirs ......................................................................... 91! 3.3.3! Bacterial transmission dynamics............................................................................... 92! viii  3.3.4! Irrigation water quality and its impact on microbiological profiles of leafy vegetable samples.................................................................................................................................. 93! 3.4! Discussion ........................................................................................................................ 93! 3.4.1! Bacterial reservoirs ................................................................................................... 94! 3.4.2! Bacterial transmission dynamics............................................................................... 98! 3.4.2.1! Irrigation water and its impact on microbiological quality of in-field leafy vegetables .......................................................................................................................... 98! 3.4.2.2! Soil and its impact on microbiological quality of in-field leafy vegetables .... 102! 3.4.2.3! Compost and its impact on microbiological quality of in-field leafy vegetables........................................................................................................................ 102! 3.4.2.4! Hygiene practice .............................................................................................. 103! 3.4.3! Limitations .............................................................................................................. 103! 3.5! Conclusion ..................................................................................................................... 104! Chapter 4: Microbiological Survey of British Columbia-Grown Leafy Vegetables Purchased from Farmers’ Markets in British Columbia .......................................................115! 4.1! Introduction .................................................................................................................... 115! 4.2! Material and methods ..................................................................................................... 115! 4.2.1! Sample collection .................................................................................................... 115! 4.2.2! Microbiological analyses ........................................................................................ 116! 4.2.2.1! Enumeration of aerobic microorganisms, generic Escherichia coli, and coliforms ......................................................................................................................... 116! 4.2.2.2! Detection of generic Escherichia coli .............................................................. 116! ix  4.2.2.3! Phylogenetic typing of Escherichia coli isolates ............................................. 116! 4.2.2.4! Virulence typing of Escherichia coli isolates .................................................. 116! 4.2.2.5! Statistical analyses ........................................................................................... 116! 4.3! Results and Discussion .................................................................................................. 117! 4.4! Conclusion ..................................................................................................................... 119! Chapter 5: Conclusions and Future Direction .......................................................................120! 5.1! Limitations and Future Direction ................................................................................... 121! References ...................................................................................................................................123! Appendix .....................................................................................................................................145! Appendix. BOX AR1-PCR banding patterns and similarity indices (UPGMA) of E. coli strains detected in vegetables and environmental samples. ............................................................... 145!  x  List of Tables Table 1.1 Produce-related outbreaks in Canada between 1990 and 2013. A produce-associated outbreak was defined as two or more cases linked to the same organism in which an epidemiologic investigation implicated the same uncooked produce item, such as fruit, vegetables (including fresh herbs), salad, or juice. (Table was constructed based on information presented in two publications (Sewell and Farber, 2001 and Kozak et al., 2013) and public health notices published on the Public Health Agency of Canada website, http://www.phac-aspc.gc.ca/fs-sa/phn-asp/index-eng.php) ........................... 36 Table 1.2 Summary of microbiological surveillance studies on the quality of leafy vegetables.. 41 Table 1.3 Microbiological guidelines for fresh fruits and vegetables .......................................... 45 Table 1.4 Microbiological guidelines for irrigation water applied to crops likely to be eaten raw ...................................................................................................................................... 47 Table 2.1 Summary of in-field leafy vegetable samples collected from conventional and organic production systems in 2011 and 2012 .......................................................................... 71 Table 2.2 Levels and prevalence of indicator bacteria recovered from in-field leafy vegetables collected from conventional and organic production systems in 2011 (p<0.05; comparison of E. coli and coliform prevalence using Χ2 goodness-of-fit; comparisons for E. coli and coliform counts using Wilcoxon test)................................................... 72 Table 2.3 Levels and prevalence of indicator bacteria recovered from in-field leafy vegetables collected from conventional and conventional and organic production systems in 2012 (p<0.05; comparison of E. coli and coliform prevalence using Χ2 goodness-of-fit; comparisons for ACCs using Tukey-Kramer; comparisons for E. coli and coliform counts using Wilcoxon test) ......................................................................................... 73 Table 2.4 Levels and prevalence of indicator bacteria recovered from in-field leafy vegetables collected from conventional and conventional and organic production systems in 2012 (p<0.05; comparison of E. coli and coliform prevalence using Χ2 goodness-of-fit; comparisons for ACCs using Tukey-Kramer; comparisons for E. coli and coliform counts using Wilcoxon test) ......................................................................................... 74 Table 2.5 Summary of phylogenetic grouping data of E. coli isolates recovered from in-field leafy vegetables collected from conventional and organic production systems in 2011 and 2012 (p<0.05; Χ2 goodness-of-fit) ......................................................................... 75 Table 2.6 Levels and prevalence of indicator bacteria recovered from leafy vegetables collected from conventional and organic, conventional production systems and BC Farmers’ Markets in 2012 (p<0.05; comparison of E. coli and coliform prevalence using Χ2 goodness-of-fit; comparisons for ACCs using Tukey-Kramer; comparisons for E. coli xi  and coliform counts using Wilcoxon test). Counts and prevalence with different letters are significantly different ............................................................................................. 76 Table 3.1 Summary of environmental samples collected from conventional and organic production systems in 2011 and 2012 ........................................................................ 106 Table 3.2 Prevalence and mean coliform and E. coli counts recovered from environmental samples collected from conventional and organic production systems in 2011 and 2012 .................................................................................................................................... 107 Table 3.3 Summary of phylogenetic grouping data of E. coli isolates recovered from environmental samples collected from conventional and organic production systems in 2011 and 2012. ........................................................................................................... 109  xii  List of Figures Figure 1.1 Produce-related outbreaks in the United States between 1990 and 2010. A produceassociated outbreak was defined as two or more cases linked to the same organism in which an epidemiologic investigation implicated the same uncooked produce item, such as fruit, vegetables (including fresh herbs), salad, or juice. (Information was collected from CDC Foodborne Outbreak Online Database, http://wwwn.cdc.gov/foodborneoutbreaks/Default.aspx) .......................................... 35 Figure 1.2 Produce-related outbreaks in Canada between 1990 and 2009. A produce-associated outbreak was defined as two or more cases linked to the same organism in which an epidemiologic investigation implicated the same uncooked produce item, such as fruit, vegetables (including fresh herbs), salad, or juice. (Figure was constructed based on information presented in two publications: Sewell and Farber, 2001 and Kozak et al., 2013) ..................................................................................................... 40 Figure 1.3 Schematic illustration of factors contributing to bacterial contamination of in-field leafy vegetables .......................................................................................................... 49 Figure 2.1 Sampling scheme for in-field leafy vegetables .......................................................... 77 Figure 2.2 Microbiological data describing in-field leafy vegetable quality in the conventional and organic production systems (*Student t-test, significant at p<0.05) ................... 78 Figure 2.3 Microbiological data describing in-field leafy vegetable quality collected from an organic production system throughout the 2012 growing season (* p<0.05; comparisons for ACCs using Tukey-Kramer; comparisons for coliform counts using Wilcoxon test) ............................................................................................................ 79 Figure 2.4 Microbiological data describing in-field leafy vegetable quality collected from a conventional production system throughout the 2012 growing season (* p<0.05; comparisons for ACCs using Tukey-Kramer; comparisons for coliform counts using Wilcoxon test) ............................................................................................................ 80 Figure 2.5 Microbiological data describing in-field leafy vegetable quality collected from three different locations within an organic production system (* p<0.05; comparisons for ACCs using Tukey-Kramer; comparisons for coliform counts using Wilcoxon test) 81 Figure 2.6 Microbiological data describing in-field leafy vegetable quality collected from three different locations within a conventional production system (* p<0.05; comparisons for ACCs using Tukey-Kramer; comparisons for coliform counts using Wilcoxon test) ............................................................................................................................. 82 Figure 2.7 Microbiological data describing in-field leafy vegetable quality collected at different levels of plant maturity; sample collected from an organic production system (p<0.05; comparisons for ACCs using Tukey-Kramer; comparisons for coliform xiii  counts using Wilcoxon test). Counts with differing letters are significantly different .................................................................................................................................... 83 Figure 2.8 Microbiological data describing in-field leafy vegetable quality collected at different levels of plant maturity; sample collected from a conventional system (p<0.05; comparisons for ACCs using Tukey-Kramer; comparisons for coliform counts using Wilcoxon test). Counts with differing letters are significantly different .................. 84 Figure 2.9 Percent of E. coli (n= 55 isolates from 18 in-field leafy vegetable samples) sensitive, intermediately resistant or resistant to various antimicrobial agents ......................... 85 Figure 3.1 Irrigation water experiment set up at the organic production system ...................... 111 Figure 3.2 Microbiological data describing in-field leafy vegetables irrigated with ditch or city water (* p<0.05; comparisons for ACCs were made using the Tukey-Kramer test; comparisons for coliform counts were made using the Wilcoxon test) ................... 112 Figure 3.3 Identified transmission routes of E. coli identified by BOX-PCR molecular typing technique. Solid line indicates identical fingerprints for E. coli recovered from environmental samples and in-field plants, whereas dotted line indicates otherwise .................................................................................................................................. 113 Figure 3.4 Examination of strain relatedness for E. coli recovered from an organic production system using molecular BOX PCR-typing. Similar DNA fingerprints were observed in between the E. coli isolates recovered from Romaine-1 location 1 and compost; and in between the E. coli isolates recovered from Red leaf-2 location 3 and soil location 3 .................................................................................................................. 114  xiv  List of Abbreviations ACC  -  aerobic colony count  AMR  -  antimicrobial resistance  BC  -  British Columbia  CFU  -  colony forming unit  HUS  -  haemolytic uraemic syndrome  MDP  -  Microbiological Data Program  PCR  -  polymerase chain reaction  PFGE  -  pulsed field gel electrophoresis  STEC  -  Shiga toxigenic Escherichia coli  T3SS  -  type three secretion system  TSA  -  tryptic soy agar  US  -  the United States  USDA -  the United States Department of Agriculture  UV  -  ultraviolet  WHO  -  World Health Organization  VTEC  -  verocytotoxin producing E. coli  xv  Acknowledgements  I offer my sincere gratitude to Dr. Kevin J. Allen and Ms. Elsie Friesen. Dr. Allen’s constant encouragement, motivation and guidance had helped me through the completion of my M.Sc. degree. Ms. Elsie Friesen whose dedication towards creating a food safety culture in BC inspired me to continue my work in this field.  In combination with the mentorship of Dr. Allen and Ms. Friesen, I am blessed to work with dynamic and intelligent committee members: Dr. Brent Skura and Dr. Pascal Delaquis.  Special thanks go to my friends who were my sources of laughter, joy and support: Daniel Wood, Mijie Li, Stephanie Nadya, Brandon Young, Ana Cancarevic, Jovana Kovacevic, and Dr. Lili R. Mesak,  This thesis is dedicated for my loving partner, Daniel Lawrence Wood, who offered me unconditional  love  and  support  throughout  the  course  of  my  Master’s  Degree.  xvi  Chapter 1: Introduction In recent years, fresh produce has increasingly been linked to recalls and outbreaks of foodborne disease in North America (Sewell and Farber, 2001; Sivapalasingam et al., 2004; McGlynn, et al., 2009; Painter et al., 2013). In the United States (US), the number of foodborne outbreaks caused by contaminated fresh produce increased significantly from 190 occurrences between 1973 and 1997 to 684 between 1998 and 2007 (Sivapalasingam et al., 2004; McGlynn, et al., 2009). Other US data in which a single foodborne vehicle was associated with an outbreak attributed fresh produce to 46% of the total foodborne illnesses occurring between 1998 and 2008 (Painter et al., 2013). Among fresh produce, leafy vegetables have noticeably been associated with more illnesses than any other commodity (Painter et al., 2013). The Environmental Health Specialists Network (2010) established that 265 outbreaks were associated with contaminated leafy vegetables between 1998 and 2007. Of these outbreaks, 86% were caused by norovirus, 10% by pathogenic Escherichia coli and the remaining 4% by Salmonella spp. Although contamination of produce may occur at any point along the food continuum, the most significant risks are thought to occur on-farm with soil, irrigation water, harvesting equipment, personnel, transport vehicles, and processing equipment identified as possible sources of pathogenic microorganisms (Beuchat, 1996; Beuchat, 2002; USDA, 2008). However, there exists a paucity of observational studies confirming these proposed routes of contamination in the natural environment (Park et al., 2012) and consequently, currently implemented produce intervention strategies minimizing contamination of fresh produce may be limited in their effectiveness. 1  The purpose of this literature review is to examine microbiological hazards associated with leafy vegetables and sources of farm-level bacterial contamination that may lead to public risk. Such knowledge is essential for identifying and addressing knowledge gaps associated with the production of leafy vegetables that is safe for public consumption. 1.1  Microbiological Hazards and Emerging Issues Associated with Fresh Produce Fresh fruits and vegetables are an essential component of a healthy diet. The nutritional  benefits derived from the consumption of fresh fruits and vegetables, such as reduced risks in developing stroke and cardiovascular disease, are well documented (Gillman et al., 1995; Lock et al., 2005; Pomerleau et al, 2005; Mente et al., 2009). Health Canada (2000) accepted the health claim that “a healthy diet [that is] rich in vegetables and fruit[s] [can] reduce [the] risk of some types of cancers”. To promote healthier lifestyles, Canada’s Food Guide recommends consuming between four and 10 servings of fruits and vegetables per day (Health Canada, 2011). Since the 1990s, the consumption of fresh fruits and vegetables has steadily increased (Statistics Canada, 2010b). From 1990 to 2009, Canadians’ annual consumption of fresh fruits and vegetables increased by 20% and by 7%, respectively (Statistics Canada, 2010b). Per capita, Canadians now consume the highest quantities of fresh fruits and vegetables in the world (USDA, 2004), approaching 150 kg of fresh vegetables and 74 kg of fresh fruits in 2009 (Statistics Canada, 2010b). This translates to six to seven serving of fruits and vegetables per day, which is twice the amount consumed in the US (Burfield, 2003). In British Columbia (BC), consumption of fresh fruits and vegetables has been increasing with 42.4% of British Columbians reported to consume more than five servings of fruit and vegetables per day (Statistics Canada, 2010a) and more than half of these vegetables are grown locally (BCMAL, 2006).  2  In parallel with increased consumption of fresh fruits and vegetables, produce has also been more frequently implicated as a vehicle for the transmission of disease-causing microorganisms (Figures 1.1 and 1.2). As discussed above, the number of US foodborne outbreaks caused by contaminated fresh produce increased significantly from 190 between 1973 and 1997 to 684 between 1998 and 2007 (Sivapalasingam et al., 2004; McGlynn, et al., 2009). Analysis of US data between 1998 and 2008 attributed 46% of total foodborne illness, in which a single foodborne vehicle was identified, to fresh produce (Painter et al., 2013). Factors contributing to the emergence of fresh produce as a significant cause of foodborne illness are complex and include: increased consumption, improved epidemiological surveillance, enhanced pathogen detection methods, emerging pathogens (e.g., E. coli O104:H4), changes in production/farming practices (i.e. intensification and centralization of production), wider distribution of produce over longer distances, introduction of minimally processed produce, and globalization of the food chain (i.e. increased importation of fresh produce) (Tauxe et al., 1997; Sivapalasingam et al., 2004; Brandl, 2006). Produce outbreaks associated with zoonotic bacteria highlight the fact that fresh produce is an important vehicle for the transmission of human pathogens that has traditionally been attributed to foods of animal origin (CDC, 2006; Grant el al., 2008; Wendel et al., 2009; Berger et al., 2010). For example, E. coli O157:H7 was the cause of a spinach outbreak in 2006 that resulted in 238 confirmed infections and three deaths (CDC, 2006). In addition, this highly virulent agent has been recovered from alfalfa sprouts, apple juice, cabbage, celery, cilantro, coriander, cress sprouts, and lettuce (Beuchat, 1996; Jablasone, et al., 2005). Contamination with Salmonella has been a recurring issue in tomatoes, seed sprouts, cantaloupe, apple juice, orange juice, and mangoes (Beuchat, 1996; Jablasone, et al., 2005). Furthermore, CDC foodborne 3  outbreak data reveal increasing numbers of multistate and international outbreaks associated with fresh produce. For example, mangoes grown in Mexico and shipped across Canada and the US were identified as the implicated vehicle in a 2012 outbreak of Salmonella, resulting in 148 confirmed infections. Multistate and international foodborne outbreaks highlight the challenges linked to maintaining a safe food supply in an increasingly globalized food supply. Between 1996 and 2005, a 9% increase in the global consumption of leafy vegetables was accompanied by a 40% increase in the number of outbreaks associated with this commodity (Herman et al., 2008). Leafy vegetables have noticeably been associated with more illnesses than any other foodborne vehicles (Tauxe et al., 1997; Sivapalasingam et al., 2004; Painter et al., 2013). Moreover, illnesses attributed to contaminated leafy vegetables ranked the second most likely to require hospitalization and the fifth most frequent cause of death (Painter et al., 2013). A study performed by the Environmental Health Specialists Network (2010) revealed that a total of 265 outbreaks linked to leafy vegetables occurred from 1998 to 2007. Of these, 86% were caused by norovirus, 10% were linked to Escherichia coli and the remaining 4% were associated with Salmonella. 1.2  Microbiological Quality of Leafy Vegetables The recognition of fresh produce including leafy vegetables as a significant vehicle for  the transmission of disease-causing microorganisms has led the scientific community to examine the frequency and means by which fresh produce may be contaminated. The US Department of Agriculture (USDA) initiated the Microbiological Data Program (MDP) in 2001, which collected annual information on the prevalence of foodborne pathogens on fresh produce (USDA, 2012b). In Canada, the Public Health Agency of Canada operates a surveillance system (C-EnterNet) with the goal of identifying food-related risk attributed to enteric pathogens (Public Health 4  Agency of Canada, 2010). In addition to research sponsored by the public sector, there have been a number of independent studies regarding the quality and/or the presence of pathogens in leafy vegetables (Table 1.2). 1.2.1  Aerobic microorganisms on leafy vegetables Aerobic microbiological populations on leafy vegetables have been reported to vary  between the range of 3 and 7 log10 CFU/g. Estimates of aerobic microbiological populations on leafy vegetables are obtained from the aerobic colony count (ACC). However, no association between the ACC of leafy vegetables and food safety risks (i.e. the presence of human pathogens) has been conclusively demonstrated. Among regulatory bodies worldwide only those in Singapore rely on the ACC to gauge the microbiological quality of fresh produce (Table 1.3). In Singapore, ready-to-eat fresh produce containing more than 100,000 CFU of aerobic microorganisms/g is deemed unacceptable (AVA, 2002). The mean ACC on pre-harvest leafy vegetables did not vary drastically among localities, ranging from 5.3 to 6.2 log10 CFU/g (Table 1.2) (Ailes et al., 2008; Johnston et al., 2005; Phillips and Harrison, 2005; Ruiz, et al., 1987). Ailes et al. (2008) reported that the average ACC of 69 in-field leafy vegetable samples grown in the southern US was 5.3 ± 0.21 log10 CFU/g, with no significant differences amongst sampled commodities (i.e. spinach, Swiss chard, and Turnip greens). In addition, Johnston et al. (2005) reported that ACCs ranged from 4.5 to 6.2 log10 CFU/g and no significant differences were observed among various leafy commodities (i.e. arugula, collards, mustard greens, and spinach). However, when compared with retail samples, pre-harvest CFU/g were 2 log10 CFU/g lower (Thunberg et al., 2002; Allen et al., 2013). Allen et al. (2013) noted a mean ACC of 6.1 log10 CFU/g and 7.4 log10 CFU/g in US and Mexican leafy vegetables imported into Canada, respectively. Moreover, Thunberg et al. (2002) reported an 5  average ACC of 8.6 ± 1.3 log10 CFU/g in lettuce samples purchased from retail markets in Washington, D.C. When considering the extended distribution chain of fresh produce, it is possible that the additional time required for transportation and distribution may permit bacterial growth, leading to elevated ACCs in retail samples (Monaghan and Hutchison, 2010). 1.2.2  Coliforms Coliforms are bile-tolerant, Gram-negative bacteria capable of producing gas and lactic  acid through the fermentation of lactose. This group of bacteria is commonly found in the environment (e.g., soil) and intestines of mammals. Coliforms are widely used as indicators of fecal contamination in potable water, foods (e.g., milk, raw meat), and to assess the efficacy of sanitation (Manafi, 2012). The definition of total coliforms and fecal coliforms (a.k.a. thermotolerant coliforms) has been based on methods of detection (Doyle and Erickson, 2006). In particular, total coliforms are Gram-negative bacilli that multiply in the presence of bile salts, and are able to ferment lactose with acid and gas production in 48 h at 37°C. In contrast, fecal coliforms are Gram-negative bacteria, capable of growth in the presence of bile salts that ferment lactose with acid and gas production in 48 h at 44°C. In the present work the term coliforms will refer to total coliforms, unless otherwise specified. Because coliforms of non-fecal origin including species of Enterobacter spp., Klebsiella spp., and Citrobacter spp. occur naturally on plants (Knittel et al., 1977; Liao and Fett, 2001; Bell et al., 2004; Doyle and Erickson, 2006; Mukherjee et al., 2006; Schwaiger et al., 2011), their value as indicators of fecal contamination of fresh produce is increasingly in doubt. Sagoo et al. (2003) found that 80 to 90% of coliforms recovered from minimally processed raw vegetables were species of Enterobacter, Erwinia, and Klebsiella. Amongst regulatory bodies, with the exception of South Africa and the United Kingdom (UK), coliform counts are not used to evaluate the microbiological quality of fresh 6  produce (Table 1.3). In South Africa, raw vegetables and fruits containing more than 200 CFU/g of coliform bacteria are deemed to be unacceptable (Department of Health of South Africa, 2011). In the UK, microbiologically acceptable ready-to-eat fresh fruits and vegetables should not possess more than 10,000 CFU/g of coliform bacteria (n=5, c=2, m=100 CFU/g, M=10,000 CFU/g) (Gilbert et al., 2000). At pre-harvest, coliform counts on leafy vegetables varied significantly among localities, seasons, and production practices (Table 1.2) (Mukherjee et al., 2004, Johnston et al., 2005; Mukherjee et al., 2006). Ailes et al. (2008) suggested that coliform counts on leafy vegetables were affected by season (i.e. variation in temperature, ultraviolet (UV) light intensity, and precipitation). They observed significantly higher coliform counts in the fall than in the spring or winter. Because weather conditions can vary drastically by region, it is not entirely unexpected that coliform counts would vary. Mukherjee et al. (2006) detected coliforms in 70% of in-field organic leafy vegetable samples (n = 162) grown in the Midwestern US and 64% of conventional samples (n=41). Coliform counts ranged from 2.7 to 4.1 log10 CFU/g for organic in-field leafy vegetable samples and ranged 1.5 to 3.0 log10 CFU/g for conventional samples (Mukherjee et al. 2006). Similarly, Johnston et al. (2005) reported a range of 1.5 to 3.4 log10 CFU/g. In contrast, Sagoo et al. (2003) detected coliforms in 76% (n = 3845) of retail bagged ready-to-eat salad vegetable samples, with coliforms observed at >4 log10 CFU/g in 37% of samples. Coliform counts on in-field leaf vegetable samples were lower than retail samples, suggesting that the additional time required for transportation and distribution may permit bacterial proliferation (Allen et al., 2013).  7  1.2.3  Generic Escherichia coli Escherichia coli are Gram-negative, facultative anaerobic bacteria that reside within the  intestinal tract of mammals. It has been reported that animal feces may contain 107 to 109 CFU E. coli /g (Szewzyk et al., 2000; Leclerc et al., 2001). Because E. coli is normally associated with the mammalian intestinal tract, it is commonly assumed that this species is transient in extraintestinal environments. Accordingly, it is widely relied upon as an indicator of fecal contamination for water and foods, including fresh produce (Savageau, 1983; Doyle and Erickson, 2006). Numerous studies have reported the presence of generic E. coli on leafy vegetables (De Roever, 1998; Little et al., 1999; Johannessen et al., 2000; Thunberg et al., 2002; Mukherjee et al., 2004; Johnston et al., 2005; Loncarevic et al., 2005; Phillips and Harrison, 2005; Johnston et al., 2006; Mukherjee et al., 2006; Arthur et al., 2007; Ailes et al., 2008; Bohaychuk et al., 2009; Schwaiger et al., 2011; Allen et al., 2013). Furthermore, most regulatory bodies use E. coli counts as risk indicators for fresh produce (Table 1.3). For example, in Canada and the European Union, the microbiological acceptability of ready-to-eat fresh produce is based on E. coli counts (n=5, c=2, m=100 CFU/g, M=1,000 CFU/g) (European Union, 2005; Health Canada, 2008). However, recent observations strongly hint that E. coli may have limited value as an indicator of fecal contamination. Of note is the discovery of an environmental clade of E. coli that has evolved without host contact and which can survive and proliferate in non-intestinal environments (e.g., water and soil) (Ishii et al., 2007; Ksoll et al., 2007). Perchec-Merien and Lewis (2012) characterized the fundamental genetic differences between environmental and commensal E. coli using multilocus sequence typing. They found that E. coli strains isolated from New Zealand wetland and stream environments were less genetically diverse than strains from human and cattle gastrointestinal tracts, indicating that environmental conditions may exert 8  selective pressures. Similarly, other studies observed significantly less diversity for E. coli strains recovered from the environment, with only a small proportion of E. coli being able to persist and multiply in a particular extra-intestinal niche (Gordon, 2001; Gordon et al., 2002; McLellan, 2004). Furthermore, Perchec-Merien and Lewis (2012) identified close genetic relationships between New Zealand aquatic E. coli isolates and strains from human and bovine origins, suggesting that environmental strains were originally derived from subpopulations of commensal enteric E. coli. Consequently, the existence of environmentally tolerant E. coli may limit the usefulness of generic E. coli as a universal fecal indicator, or at minimum require methods that permit sufficient discriminatory power to discern enteric from environmental E. coli (Field and Samadpour, 2007). Escherichia coli strains can be categorized into four major phylogenetic groups: A, B1, B2, and D (Selander et al, 1986; Herzer et al., 1990). Generally speaking, commensal enteric strains belong to phylogenetic groups A and B1, whereas the extra-intestinal pathogenic strains are placed into group B2, and to a lesser extent group D (Picard et al., 1999; Johnson and Stell, 2000; Duriez et al., 2001; Johnson et al, 2001). Escherichia coli strains of different phylogroups do not display the same level of environmental adaptability (Bergholz et al., 2011). For instance, Meric et al. (2013) noted a higher prevalence of B1 isolates present on plants than other phylogenetic groups. They explained this observation by the fact that E. coli strains belonging to phylogroup B1 were more likely to harbor traits, such as higher biofilm and extracellular matrix production, and higher frequency of utilization of sucrose, which can aid surface colonization (Meric et al., 2013). Being recovered from a wide variety of hosts (i.e. human, cow, chicken, pig, sheep, goat, and natural environments), B1 strains are considered host generalists (Carlos, et al. 2010; White et al., 2011). Because of their high environmental adaptability, their use as fecal 9  indicators may be limited. As strains other than the B1 isolates have not been reported to persist in the natural environment for prolonged periods, the detection of E. coli strains belonging to A, B2 or D phylogroups, may remain suggestive of fecal contamination. The counts and prevalence of generic E. coli on in-field leafy vegetables varied widely across regions, production practices, and levels of sanitation (Table 1.2). At pre-harvest, leafy vegetables grown in Minnesota and Wisconsin possessed higher E. coli counts ranging from 2.2 to 2.4 log10 CFU/g compared to Southern US samples (<1 to 1.25 log10 CFU/g) (Johnston et al., 2005; Mukherjee et al., 2006; Ailes et al., 2008). In Canada, provincial surveys of fresh produce obtained from farmers’ markets have been conducted (Arthur et al., 2007; Bohaychuk et al., 2009). An observed prevalence of 23% for E. coli on leafy vegetable samples from Alberta farmers’ markets was higher than that reported from Ontario farmers’ markets (6.5% to 11.6%) (Arthur et al., 2007; Bohaychuk et al., 2009). At retail, Sagoo et al. (2003) recovered E. coli in 1.3% (n = 3843) of bagged ready-to-eat salad packages. Furthermore, Mukherjee et al. (2006) noted that in-field organic leafy vegetable samples grown in Minnesota and Wisconsin had a lower E. coli prevalence (6.7% to 9.1%) than conventionally grown ones (20 to 25%). Other studies failed to detect significant differences in E. coli counts on conventional and organic leafy vegetables (Arthur et al., 2007; Bohaychuk et al., 2009). 1.2.4 1.2.4.1  Foodborne pathogen detection Escherichia coli O157:H7 Escherichia coli O157:H7 was first identified as a human pathogen in 1982 (Riley et al.,  1983) and is a significant health risk in fresh, minimally processed vegetables (Franz and Van Bruggen, 2008). Escherichia coli O157 infection may lead to severe complications, including hemorrhagic colitis, and haemolytic uraemic syndrome (HUS). The manure of ruminants is a 10  source of E. coli O157:H7 and fertilization with animal wastes is a potential source of contamination in fresh produce (Kearney et al., 1993; Wang et al., 1996; Chase-Topping et al., 2008). In Great Britain, Hutchison et al., (2005) recovered E. coli O157:H7 in 13% of fresh cattle manure, 21% of fresh sheep manure, and 12% of fresh swine manure. In Ontario, the prevalence of E. coli O157:H7 in cattle manure was 13% and 3% in 2010 and 2011, respectively (Public Health Agency of Canada, 2011). Contaminated sprouted seed, lettuce, apple cider, and spinach have caused outbreaks of Escherichia coli O157:H7 (Sivapalasingam et al., 2004; Warriner et al., 2009; Painter et al., 2013). Franz and Van Bruggen (2008) identified a strong association between lettuce-associated outbreaks and E. coli O157:H7, with 29% of all lettuceassociated outbreaks caused by E. coli O157:H7. Furthermore, they noted that 38% of all E. coli O157:H7 outbreaks implicated with fresh produce were related to lettuce. Despite this, contamination of fresh produce with E. coli O157:H7 occurs at low levels, as evidenced by the rarity of outbreaks associated with raw produce compared to the volume of consumption (Cooley et al., 2007). Furthermore, studies examining E. coli O157:H7 prevalence on fresh produce highlight difficulties in detecting its presence (Johannessen et al., 2000; Sagoo et al., 2001; Mukherjee et al., 2004; Arthur et al., 2007; Bohaychuk et al., 2009). Johannessen et al. (2000) failed to recover E. coli O157:H7 from 3,200 organic retail vegetable samples. Similarly, Sagoo et al. (2001) analyzed 890 fresh produce samples with no positive samples detected. 1.2.4.2  Salmonella Salmonella is a normal inhabitant of the intestinal tract of wild animals, poultry, pigs, and  humans (Warriner et al., 2009). In Great Britain, Hutchison et al. (2005) recovered Salmonella in 18% of poultry manure, 8% of fresh cattle manure, 8% of fresh sheep manure, and 8% of fresh swine manure samples. In Ontario, the prevalence of Salmonella in poultry manure was 63% and 11  61% in 2010 and 2011, respectively (Public Health Agency of Canada, 2011). Tomatoes, cantaloupes, sprouted seeds, and lettuce have been associated with outbreaks caused by Salmonella (Arthur et al., 2007; Warriner et al., 2009; Painter et al., 2013). Similar to E. coli O157:H7, the prevalence of Salmonella on fresh produce observed in microbiological surveillance studies remains low despite the frequent link to produce-associated disease (Cooley et al., 2007). 1.3  Microbiological Contamination of In-Field Leafy Vegetables Although the contamination of produce may occur at any point along the food continuum,  the most significant risks are thought to occur at the farm production level (Beuchat, 2002; USDA, 2008). The means by which contamination occurs, however, involves a complex and dynamic interplay of several key factors, including plant macro and micro-environments and sources of enteric bacteria and their survival characteristics (Figure 1.3). Soil, irrigation water, harvesting equipment, personnel, transport vehicles, and processing equipment have all been identified as possible sources of pathogenic microorganisms (Beuchat and Ryu, 1997; Beuchat, 2002; USDA, 2008). A discussion of literature relating to on-farm microbiological reservoirs follows. 1.3.1  Irrigation water Globally, concerns about water scarcity have been growing as the need for water  increases in relation to agricultural, industrial, and household demand (Blumenthal, 2000; WHO, 2009). Furthermore, a lack of fresh water has driven up the use of reclaimed wastewater for agricultural purposes (Scott et al., 2004; Mara et al., 2007). It has been estimated that more than 10% of the world population consumes food irrigated with reclaimed wastewater (WHO, 2009). In an effort to ensure the production of safe food and protect human health, a number of 12  regulatory agencies and organizations have established guidelines for the quality of water used for irrigating crops that are likely to be eaten raw (Table 1.4). These guidelines vary widely across countries and considerably for different sources of water (i.e. groundwater, surface water and reclaimed waste water) (Table 1.4). Guidelines for reclaimed-waste water quality used for irrigation are amongst the strictest (Steele and Odumeru, 2004). The US Environmental Protection Agency (EPA) recommends an absence of fecal coliforms in wastewater used to irrigate crops that are likely to be consumed raw (Anonymous, 1992). Similarly, the state of California specifies fewer than 2.2 coliforms and no fecal coliforms per 100 ml of treated wastewater (Blumenthal et al., 2000). These standards are comparable to guidelines set for drinking water. In contrast, guidelines for surface water used for irrigation are more lenient (Table 1.4), with the US EPA requiring fewer than 1000 CFU of fecal coliforms per 100 ml of surface water (Anonymous, 1992). In Canada, water from differing sources is not treated differentially. The Canadian Council of Ministers of the Environment recommends that there should be less than 1000 CFU of coliforms and no more than 100 CFU of fecal coliforms per 100 ml of irrigation water (Anonymous, 1999a). Although these recommendations have been widely accepted in Canada, some provinces have published their own irrigation water standards (Table 1.4). For example, in BC it has been recommended that there should be less than 1000 CFU of coliforms and no more than 77 CFU of E. coli per 100 ml of irrigation water (Anonymous, 1988). 1.3.1.1  Prevalence of enteric bacteria in irrigation water Irrigation water is generally recognized as the most significant concern regarding produce  safety (Park et al., 2012). Epidemiological and risk assessments have determined a link between poor quality irrigation water and risk in leafy vegetables (Shuval et al., 1997; Blumenthal et al., 13  2000; Stine et al., 2005a; Habtestelassie et al., 2010). For example, cattle located in an adjacent field were determined to be the source of E. coli O157:H7 in a multistate outbreak in 1996 that was associated with the consumption of mesclun lettuce (Hilborn et al., 1999). Irrigation water contaminated by cattle feces was suggested to be the vector for the transmission of E. coli O157:H7 to the lettuce (Hilborn et al., 1999). Park et al. (2012) suggested that reducing microbiological contamination of irrigation water was the most effective means to reduce microbiological risk at the farm level. Many studies have reported that of all environmental onfarm sample types (i.e. irrigation water, soil, compost, equipment swabs, etc.), irrigation water is the reservoir most frequently contaminated with enteric bacteria, including human pathogens (Duffy et al., 2005). Duffy et al. (2005) found that 16 of 170 (9.4%) irrigation water samples were contaminated with Salmonella. In the same study, E. coli was detected at a mean level of 0.4 log10 CFU/ml in 40% of irrigation water samples. The microbiological quality of irrigation water relies largely on source (i.e. reclaimedwaste water, surface water, and ground water) (Steele and Odumeru, 2004). As discussed in section 1.3.1, wastewater is usually of poor microbiological quality and requires treatment before being suitable for use as irrigation water (Steele and Odumeru, 2004). It has been estimated that every liter of municipal sewage contains approximately 5,000 enterovirus plaque-forming units, 7,000 CFU of Salmonella spp., 7,000 CFU of Shigella spp., and 1000 CFU of Vibrio cholera (Feachem et al., 1983). Surface water, which includes a variety of freshwater sources, such as ponds, lakes, rivers, and creeks is more likely to be of poor quality than ground water (Won et al., 2013). Sewage discharges, septic tank contamination, storm drains, wildlife, and industrial effluents can contaminate surface water with pathogenic microorganisms (Steele and Odumeru, 2004). For instance, Won et al. (2013) sampled two irrigation canals and four surface reservoirs 14  located in Ohio, USA. Coliforms were detected in all water samples, with a median count of 3.6 and 4.5 log10 MPN/100 ml observed for reservoirs and irrigation canals, respectively. Escherichia coli was detected in 97% (n = 226) of the water samples, with a median count of 1.5 and 2.5 log10 MPN/100 ml observed for reservoir and irrigation canal samples, respectively. Furthermore, surface water can be contaminated with enteric pathogens. There was a higher prevalence of enteric pathogens per 100 ml of surface water in regions with a high livestock density (Johnson et al., 1999; Michel et al., 1999; Johnson et al., 2003). Shedding of enteric pathogens in the feces of food-producing animals acts to disseminate these organisms into the environment, and frequently to surface water (Khaleel et al., 1908). Johnson et al. (2003) examined the prevalence of E. coli O157:H7 and Salmonella spp. in surface water in southern Alberta, a region possessing Canada’s largest population of cattle. They noted that the prevalence of E. coli O157:H7 and Salmonella spp. in water samples collected from the Oldman River watershed in southern Alberta was 0.9% and 6.2%, respectively. It is noteworthy that the Lethbridge region in Alberta, a region known for high cattle density, has one of the highest levels of gastroenteritis in Canada, resulting from infection by Salmonella and E. coli O157:H7 (Khakhria et al., 1996). In Canada, surface water and groundwater are commonly used for irrigation (Martin et al., 2000). Because the risk of contamination by sources of fecal materials is comparatively lower, enteric bacteria tend to be less prevalent, although not absent, in ground water. For example, Won et al. (2013) detected coliforms in 46% (n = 180) and E. coli in 9% (n = 180) of well water samples. Similarly, Rudolf and Goss (1993) noted that out of the 1,300 well water samples collected from Ontario, 17.6% contained E. coli.  15  1.3.1.2  Persistence of enteric bacteria in irrigation water In general, the viability of enteric bacteria gradually declines in extra-intestinal  environments (Anonymous, 1992; Steele and Odumeru, 2004). Parameters that influence this behavior include exposure to UV light, fluctuation in temperature, lack of nutrients, and the presence of predators such as protozoans (Feachem et al., 1983). Enteric bacteria including Salmonella spp. and Shigella spp. have been reported to persist for less than 30 days in water (Feachem et al., 1983). However, the long-term persistence of generic E. coli isolates and some strains of E. coli O157:H7 in well, reservoir, recreational, and municipal water has been documented (Wang and Doyle 1998; Chalmers et al., 2000; Lu et al., 2004; Avery et al., 2008). Although E. coli O157:H7 is not a good competitor compared to other bacteria found in aquatic environments, it has been reported to survive in reservoir water for 91 and 49 days when the water temperature was 8 and 25°C, respectively (Wang and Doyle, 1998). Furthermore, an environmental clade of E. coli, which has been observed to survive and proliferate in nonintestinal environments (e.g., water and soil), has recently been identified (Lu et al., 2004; Ishii et al., 2007; Ksoll et al., 2007; Perchec-Merien and Lewis, 2012). Even though E. coli are used as fecal indicators for water, it is important to note that the absence of E. coli is not indicative of the absence of enteric pathogens, such as E. coli O157:H7 and Salmonella (Schets et al., 2005, Won et al., 2013). Schets et al. (2005) recovered E. coli O157:H7 in well water samples in which coliforms, including generic E. coli were not recovered. 1.3.1.3  Bacterial transmission dynamics from irrigation water to leafy vegetables The ability of E. coli O157:H7 to survive for long periods in water may lead to increased  opportunity for transmission to irrigated crops (Solomon et al., 2003). Laboratory and field studies have demonstrated transmission of enteric bacteria from contaminated irrigation water to 16  leafy vegetables (Solomon et al., 2002a; Solomon et al., 2002b; Wachtel, et al., 2002a; Wachtel et al., 2002b). The transmission of E. coli O157:H7 from irrigation water to plant surfaces has been demonstrated using irrigation water inoculated with 2, 4, and 7 log10 CFU/ml of E. coli O157:H7 (Solomon et al., 2002a; Solomon et al., 2003). The irrigation method and time elapsed between the last application and harvest, termed the minimum harvest interval, can influence whether foodborne pathogens are found on the edible portions of fresh produce (National Advisory Committee on Microbiological Criteria for Foods, 1999; Solomon et al., 2002a). The WHO (2006) classified irrigation methods into three distinct categories: flood and furrow, spray and sprinkler, and localized irrigation methods (i.e. drip-and-trickle irrigation). The overhead spray irrigation method subjects leafy vegetables to direct contact with contaminated irrigation water, thereby increasing risk (National Advisory Committee on Microbiological Criteria for Foods, 1999; Solomon et al., 2002a; Solomon et al., 2003; WHO, 2006). Spray irrigation is widely used for lettuce production with 58% of annual lettuce produced in the US being irrigated with this method (Anonymous, 1998). Furrow irrigation involves application of water to the surface of soil and often results in direct contact of the aboveground portion of the plant with the irrigation water (WHO, 2006). Drip irrigation applies water directly to the root systems of the plants, minimizing contact of aboveground portions of the plant with irrigation water (WHO, 2006). Keraita et al. (2007b) assessed the relationship between irrigation methods (i.e. drip irrigation, furrow irrigation, and spray irrigation) and fecal coliform counts on lettuce. They noted that in both dry and wet seasons in Ghana, fecal coliform counts were highest on lettuce that was irrigated with spray irrigation and lowest on lettuce irrigated via drip irrigation. Similarly, Stine et al. (2005a) noted that E. coli contamination of lettuce was two to three orders of magnitude lower in drip irrigated lettuce than 17  furrow irrigation. Furthermore, when irrigated with artificially inoculated water (7 log10 CFU/ml of E. coli O157:H7), a larger number of E. coli O157:H7 positive lettuce plants was observed with spray irrigation compared with plants irrigated using a soil-surface method (Solomon et al., 2002a). Allowing sufficient time between irrigation application and harvest is a critical step in minimizing the risks linked to produce (Shuval et al., 1986; Yates et al., 1987; National Advisory Committee on Microbiological Criteria for Foods, 1999; Solomon et al., 2002a; Tyrrel et al., 2006). Inactivation of pathogens on plants occurs more rapidly under hot, sunny weather compared to cloudy, cool, rainy weather (WHO, 2006). The WHO (2006) established a rough estimate of 0.5 to 2 log10 CFU/g reduction of enteric bacteria per day, with more bacterial die-off expected in dry and hot conditions. Keraita et al. (2007a) observed an average daily reduction of 0.7 log10 CFU/g for fecal coliforms under field conditions in the dry season in Ghana. Moreover, Fattal et al. (2002) reported higher reduction rates of up to 3 log10 CFU/g per day for fecal coliforms. Hamilton et al. (2006) developed a quantitative microbiological risk assessment model to estimate the annual risk of enteric virus infection associated with consuming raw vegetables that had been overhead-irrigated with non-disinfected reclaimed water that had been subjected to secondary treatment. They found that the annual risk of infection was below the benchmark of ≤10-4, i.e. one infection or less per 10,000 people per year, when the last wastewater irrigation event was no less than 14 days prior to harvesting (Hamilton et al., 2006). Stine et al. (2005a) reported that contamination of produce by Salmonella was minimized if 14 days elapse before the harvest of fresh produce. According to the BC Ministry of Environment (Anonymous, 1988), 100 ml of irrigation water should contain less than 1,000 CFU of coliforms and less than 77 CFU of E. coli. If coliform or E. coli counts in irrigation water exceed these 18  recommended levels, producers should cease using irrigation water for a minimum of 14 days prior to harvest. 1.3.2 1.3.2.1  Soil Prevalence and persistence of enteric bacteria in soil In general, soil is not thought to be an important source of enteric pathogens (De Roever,  1998), though other human pathogens such as Aeromonas spp., Bacillus cereus, Clostridium botulinum, and Listeria monocytogenes can be isolated from soil (Coyne, 1999). If enteric bacteria are introduced to soil from sources such as animal manure, untreated compost, contaminated feces from wild animals, and contaminated irrigation water, these organisms may survive, persist, replicate, and be transported in or by soil (Watts and Wall, 1952; BergnerRabinowitz, 1956; Rice et al., 1995; Beuchat, 1999; Hilborn et al., 1999; Gagliardi and Karns, 2000). For example, Jones (1999) noted that E. coli O157 persisted in soil for at least 60 days at 25°C and for more than 100 days at 4°C. Furthermore, several studies reported that Salmonella was detected in soil for periods ranging from three to more than 200 days (Watts and Wall, 1952; Bergner-Rabinowitz, 1956; Zibilske and Weaver, 1978). The persistence of enteric pathogens in soil is dependent on several factors (Warriner et al., 2009). Soil characteristics and environmental field factors (e.g., moisture content, temperature, time, UV light, and the presence of manure) can influence survival of enteric bacteria in soil (Zibilske and Weaver, 1978). Soil type (i.e. silty clay loam and loamy sand) can affect survival of enteric bacteria such as E. coli and Salmonella, though contradictory observations have been reported (Zibilske and Weaver, 1978; Lau and Ingham, 2001; Natvig et al., 2002). For instance, the survival of E. coli was extended in clay soil compared to sandy soil (Lang and Smith, 2007). Similarly, Lau and Ingham (2001) reported that E. coli and enterococci 19  populations decreased significantly faster in loamy sand soil than in silty clay. In contrast, Natvig et al. (2002) noted that S. Typhimurium and E. coli survival did not differ significantly between loamy sandy soil and silty clay loam soil. In general, it has been observed that survival of enteric bacteria is prolonged in moist soil at cool temperatures (Kligler, 1921; Jones, 1999; Lang and Smith, 2007). Kligler (1921) noted that Salmonella survived up to 80 days in moist soil, but persisted in dry soil only for 20 days. Jones (1999) showed that E. coli could persist in soil for more than 60 days at 25°C and for longer than 100 days at 4°C. Various studies noted that native soil microflora had antagonistic effects on enteric pathogens (Schuenzel and Harrison 2002). Jiang et al. (2002) found that E. coli O157:H7 was inactivated more rapidly in un-autoclaved soil than autoclaved soil, suggesting that indigenous soil microorganisms contributed to the inactivation of E. coli O157:H7. Exposure to UV light shortens the survival of enteric pathogens (Rabinowitz, 1955). Rabinowitz (1955) observed that Salmonella and fecal coliforms present at the soil surface were reduced by 4 log10 CFU/g within 9 days. However, at depths of 4 and 8 inches, Salmonella populations were reduced by only 3 log10 CFU/g within the same time period. In addition, the presence of manure can affect the survival rate of enteric bacteria such as E. coli O157:H7 (Gagliardi and Karns, 2000). Gagliardi and Karns (2000) concluded that the presence of nitrogen in manure enhanced survival of E. coli O157:H7. Jiang et al. (2002) noted that E. coli O157:H7 could survive for prolonged periods of time, ranging between 42 to 193 days, in manure-amended soil. Similarly, Islam et al. (2004a) reported that E. coli O157:H7 persisted for 154 and 217 days in manure-amended soil on which lettuce and parsley were grown, respectively. In contrast, Zibilske and Weaver (1978) noted that Salmonella died off rapidly when artificially-inoculated manure slurry was added to soil. Fenlon et al. (2000) observed that E. coli O157:H7 persisted in manure-amended soil for 7 days. Ingham et al (2004) 20  found that levels of indigenous E. coli decreased rapidly in manure-fertilized soil. Within 90 days, E. coli counts decreased by 3 log10 CFU/g from an initial level of 4.2 log10 CFU/g, though low levels of E. coli persisted in manure-fertilized soil for over 100 days. Van Donsel et al. (1967) reported that fecal coliform counts in manure-fertilized soil decreased by 3 log10 CFU/g in two to four weeks. 1.3.2.2  Bacterial transmission dynamics from soil to leafy vegetables Soil types have been suggested to influence surface contamination of in-field leafy  vegetables (Natvig et al., 2002). Because higher clay content results in greater adherence to plant surfaces, contamination of leaf surfaces is more likely with silty clay loam soil than loamy sandy soil. Contamination of arugula was more likely in inoculated silty clay loam soil than in loamy sandy soil (Natvig et al., 2002). Keraita et al. (2007a) noted higher fecal (thermotolerant) coliform counts on the outer lettuce leaves, and this observation was hypothesized to be due to increased contact with soil than occured for inner leaves. Analysis revealed that outer lettuce leaves had 1.8 log10 CFU/100 g higher fecal coliforms than inner leaves. Growth of E. coli O157:H7 was restricted to the roots of seedlings (Habtestelassie et al., 2010). The observed spatial-bacterial proliferation near seedlings was most likely supported by nutrient-rich root exudates that are released during seed germination (Jablasone et al., 2005). Exudates released from root junctions attract rhizobacteria, permitting a symbiotic relationship with the plant (Andrew et al., 1982; Hari-Kudo et al.; 1997; Troxier et al., 1997; Lugtenberg et al., 2001; Jablasone et al., 2005). Jablasone et al. (2005) noted that E. coli O157:H7 preferentially colonized root junctions, suggesting E. coli O157:H7 can proliferate using nutrients contained in root exudates. Root junctions are sites where the exudates are released, but may also serve as potential openings for bacteria to become internalized in the plant (James and 21  Olivares, 1997; Lugtenberg et al., 2001). Metabolic activities of E. coli O157:H7 were downregulated on seedling roots by day 11 of seed germination (Lugtenberg et al., 2001; Jablasone et al., 2005). At the end of the cultivation period, internalized E. coli O157:H7 was not recovered from mature plants (Jablsone et al., 2005; Habteselassie et al., 2010). Furthermore, Erickson et al. (2010b) demonstrated that when internalization of E. coli O157 via plant roots occurs, O157 does not persist for more than 7 days. It has been concluded that internalization of human pathogens is restricted to seedlings in the field, and that the persistence of pathogens on the surface of plants poses a much greater food safety risk (Beuchat and Ryu, 1997; Van Ginneken and Oron, 2000; Jablasone et al., 2005). Growth of E. coli O157:H7 has been observed to be restricted to the roots of leafy vegetables, indicating that the bacteria are capable of metabolizing plant-derived carbon substrates (Gagliardi and Karns, 2002; Ibekwe et al., 2004; Habtestelassie et al., 2010). Ibekwe et al. (2004) found that the presence of plant root systems in contaminated soil enhanced the survival of E. coli O157:H7. Gagliardi and Karns (2002) also noted that E. coli O157:H7 persisted for 25 to 41 days in soil without plant root systems, but up to 92 to 96 days if alfalfa or rye were planted in the soil. These observations raise concerns regarding the contribution of the rhizosphere to the long-term survival of E. coli O157:H7 in soil (Habtestelassie et al., 2010). 1.3.3 1.3.3.1  Compost Prevalence and persistence of enteric bacteria in compost Manure and sewage waste represent the most significant sources of enteric pathogens  isolated in water, soil and consequently, fresh produce (Beuchat and Ryu, 1997; Warriner et al., 2009). Cattle and poultry manure can harbor foodborne pathogens such as E. coli O157:H7 and Salmonella (Kearney et al., 1993; Wang et al., 1996). Composted manure is often applied to soil 22  as crop fertilizer (Natvig et al., 2002). Composting is a natural decomposition process where microorganisms convert organic matter into a paste-like material (Larney et al., 2006). During this process, microorganisms utilize oxygen while consuming organic matter and generating carbon dioxide, heat, and water vapor (Larney et al., 2006). The heat generated during composting has an inactivation effect on enteric pathogens (Larney et al., 2006) and when done properly, should result in the elimination of vegetative enteric pathogens (Warriner et al., 2009). The US Environmental Protection Agency (2003) specifies that treated manure if applied as crop fertilizer should contain <1000 CFU of fecal coliforms /g, <3 MPN of Salmonella /4g, and <1 plaque forming units of enteric viruses /4g. Similarly, Canadian guidelines recommend that after composting, biosolids derived from manure should contain <1000 CFU of fecal coliforms /g and <3 MPN of Salmonella /4g (CCME, 2005). Wang et al. (1996) reported that E. coli O157:H7 could persist in bovine feces for 42 to 49 days at 37°C, from 49 to 66 days at 22°C and from 63 to 70 days at 5°C. Himathongkham et al. (1999) found that to achieve a 5 log10 CFU/g reduction of E. coli O157:H7 and S. Typhimurium, cattle manure should be held at 4°C for 105 days or at 37°C for 45 days. To minimize produce contamination from improperly treated compost, the USDA (2000) recommends that a minimum of 120 days lapse between the point of raw manure application and crop harvesting. However, the 120 days between application of non-composted manure and the harvesting of crops may not have the same effects on pathogen die-off in manure fertilized soil. A variety of environmental factors including weather conditions, desiccation, soil type, predatory protozoan populations, and the degree of manure incorporation have been determined to affect pathogen survival in manure-fertilized soil (Van Donsel et al., 1967; Zibilske and Weaver, 1978; Chandler and Craven, 1980; England et al., 1993; Gagliardi et al., 2001; Ogden et al., 2001; 23  Natvig et al., 2002; Ingham et al., 2004). Natvig et al. (2002) raised the concern of whether seasonal factors such as temperature and frost may limit the adequacy of the USDA 120 day recommendation. They found that applying non-composted bovine manure to soil in early spring and late fall when the daily average maximum temperature remained lower than 10°C and adhering to the 120 day limit can minimize contamination of fresh produce from contaminated soil. However, even if the 120-day recommendation is followed, S. Typhimurium may be present on leafy vegetables after an early summer manure application when the daily average maximum temperature is higher than 20°C (Natvig et al., 2002). Several studies have demonstrated that E. coli can be used as a reliable indicator organism for the potential presence of enteric bacteria (e.g., E. coli O157:H7 and Salmonella spp.) in compost (Lau and Ingham, 2001; Ogden et al., 2001; Natvig et al., 2002). 1.3.3.2  Bacterial transmission dynamics from compost to leafy vegetables As discussed in section 1.3.2.2, enteric bacteria present in incompletely composted  manure can be transferred to the surface of leafy vegetables via manure-amended soil (Solomon et al., 2002b; Ingham et al., 2004; Islam et al., 2004a). Specifically, leafy vegetables may become contaminated when plant root systems uptake enteric bacteria present in manureamended soil (Solomon et al., 2002b) and when external physical means, such as wind or rain, aid the transfer of enteric bacteria to leaf surfaces (Islam et al., 2004a). Solomon et al. (2002b) planted lettuce seeds in manure-amended soil and demonstrated that E. coli O157:H7 could migrate from manure-contaminated soil to internal locations within the seedlings. Similarly, Franz et al. (2005) transplanted lettuce seedlings into soil amended with artificially inoculated manure and detected E. coli O157:H7 in the roots. Furthermore, Islam et al. (2004a) noted that  24  edible portions of lettuce could become contaminated when lettuce was fertilized with artificially inoculated manure containing 106 CFU E. coli O157:H7 per g. In contrast, Johannessen et al. (2004) did not detect the presence of E. coli O157:H7 on outer leaves of lettuce grown in soil fertilized with slurry, solid manure or compost of bovine origin without experimental inculcation. Zhang et al. (2009) did not observe internalization of E. coli O157:H7 in lettuce leaves, when growing plants were fertilized with artificially inoculated cow manure containing 106 CFU E. coli O157:H7 per g. 1.3.4  Hands Hands can be a possible source of enteric bacteria, which may subsequently be  transferred to leafy vegetables during transplanting and harvest (Beuchat, 2002; USDA, 2008). Between 1990 and 1998, salad bars ranked as the leading cause of produce-related outbreaks in the US, suggesting that enteric bacteria can be transferred from hands to produce (Wachtel and Charkowski, 2002; Bihn et al., 2010). Because transplanting and harvesting of leafy vegetables involves contact with hands, this represents a significant route of transmission for enteric bacteria (Duffy et al., 2005). Kaferstein (1976) reported that E. coli was detected in 74% of commercially available parsley samples but only in 5% of aseptically harvested samples, highlighting the transfer of E. coli from employee hands to parsley. These observations indicate that good hygiene practices are essential in minimizing contamination risk for in-field leafy vegetables. 1.3.5  Wild animals Wildlife such as birds and rodents are known to harbor enteric pathogens. Wallace et al.  (1997) isolated E. coli O157:H7 from fecal samples of wild birds in the UK. Similarly, Schmidt et al. (2000) noted that the prevalence of STEC isolates in fecal samples of feral pigeons was 25  12.5% in Germany. Wildlife has been suggested to be a vector for dissemination of enteric pathogens in the environment (Rice et al., 1995; Ackers et al., 1998; Sagoo et al., 2003; Ingham et al, 2004; Duffy et al., 2005; Jay et al., 2007). Jay et al. (2007) pinpointed the possible involvement of feral swine in the contamination of agricultural fields and surface waterways with E. coli O157, which was suggested to be a possible cause of a US multistate E. coli O157:H7 spinach outbreak. Wildlife may contaminate fresh produce through fecal deposition directly onto the edible portions or through indirect fecal contamination of surface water or soil (Jay et al., 2007). For example, deer droppings found in an Oregon state strawberry field were the source of E. coli O157:H7 responsible for a strawberry outbreak in 2011, during which 14 confirmed infections and one death occurred (Rothschild, 2011). In a controlled experiment, Ingham et al. (2004) observed sporadic E. coli positive soil samples in controlled plots where no manure was applied. They hypothesized that birds and/or mammals were the source of E. coli. Duffy et al. (2005) observed a large population of birds in the vicinity of a packing shed where Salmonella was isolated from harvesting equipment. 1.3.6  Insects Insects may contaminate prepared foods by regurgitation, defecation, and mechanical  transfer from contaminated mouthparts and appendages (Kobayashi et al., 1999; Sasaki et al., 2000; Gracyk et al, 2001; Nichols, 2005; Beuchat, 2006). Similarly, insects such as filth flies can pick up and transfer E. coli O157:H7 to leafy vegetables (Talley et al., 2009). In general, filth flies develop in manure, compost, rotting vegetation, and decomposing carcasses (Talley et al., 2009). Alam and Zurek (2004) suggested that houseflies play a role in dissemination of E. coli O157:H7. The prevalence of E. coli O157:H7 in 3,440 flies collected from cattle farms was 2.9% (Alam and Zurek, 2004). Talley et al. (2009) collected 34 flies that were in direct contact with in26  field mature lettuce; of 18 flies tested, 11 carried E. coli O157:H7. Moreover, when these flies came into contact with spinach, all samples tested positive for the pathogen. Interestingly, Erickson et al. (2010a) noted that the plant immune/defense system might have an impact on pathogen internalization. They observed a significantly reduced internalization of E. coli O157:H7 in lettuce leaves that were previously exposed to thrips, aphids, and cabbage loopers than lettuce without exposure. 1.4  Bacterial Fitness and Persistence on In-field Leafy Vegetables After being disseminated to in-field leafy vegetables from the aforementioned  mammalian or environmental sources, enteric pathogens must be able to withstand stresses occurring in the natural environment to cause foodborne illness (Xicohtencatl-Cortes et al., 2009). 1.4.1 1.4.1.1  Bacterial fitness/persistence on the surface of in-field leafy vegetables Attachment to the surface of leafy vegetables Attachment is the first step in establishing colonization of the leaf surface (Brandl, 2006).  The surface of leafy vegetables is covered with a thick cuticle consisting of a waxy, multilayered hydrophobic material called cutin (Romberger et al., 1993). Cutin has been suggested to prevent desiccation of underlying tissues and to provide physical protection against injury (Romberger et al., 1993). Attachment of bacterial cells to the leaf surface is influenced by the biological and physical properties of the organism, which include biofilm formation, curli and cellulose production, flagella, hydrophobicity, and type three secretion system (T3SS) (Critzer and Doyle, 2010). The surface properties of bacteria (e.g., non-hydrophobic surface of E. coli O157:H7) play an important role in attachment (Seo and Frank, 1999; Takeuchi and Frank, 2000; Takeuchi et al., 2000). Several studies found that E. coli O157:H7 preferentially attached to damaged 27  lettuce tissues, which are reduced in overall hydrophobicity (Seo and Frank, 1999; Takeuchi and Frank, 2000; Takeuchi et al., 2000). Takeuchi and Frank (2000) also noted a higher level of attachment with prolonged exposure of lettuce surfaces to E. coli O157:H7. Moreover, it has been suggested that the presence of flagella, the production of biofilms and extracellular matrix, and the possession of a T3SS promote bacterial colonization on leafy vegetables (Shaw et al., 2008; Xicohtencatl-Cortes et al., 2009; Meric et al., 2013). Jeter and Mattysse (2005) noted that curli (i.e. adhesive, long, thin, aggregative amyloid fibers) are not necessary for E. coli O157:H7 to bind to plant surfaces, though the production of curli is sufficient to allow bacteria to attach to plant surfaces. Furthermore, Xicohtencatl-Cortes et al. (2009) found that E. coli O157:H7 can colonize surfaces of spinach and lettuce through flagella and T3SSs. In addition to their role in motility, flagella have been suggested to serve as adhesins facilitating the interaction of E. coli O157:H7 with the leaf surface (Xicohtencatl-Cortes et al. 2009). The deficient colonization of leaf surfaces of T3SS mutants compared to wild type indicates that T3SSs play an important role in plant colonization, though the exact mechanism has yet to be identified (Xicohtencatl-Cortes et al. 2009). It is noteworthy that variations in leaf surface colonization have been reported amongst E. coli strains (Wachtel et al., 2002). Wachtel et al. (2002a) observed that three of five tested generic E. coli strains possessed adherence levels similar to pathogenic stains, though the remaining two strains showed significantly lower levels of adherence. In a later study, Wachtel et al. (2002b) reported that non-pathogenic E. coli strains recovered from cabbage displayed significantly higher adherence levels to the lettuce seedlings than E. coli O157:H7. The association between bacterial attachment and plant maturity has also been examined (Bernstein et al., 2007; Mootian et al., 2009; Pu et al., 2009; Zhang et al., 2009; Erickson et al., 2010a; Erickson et al., 2010b). Some studies reported a significantly higher level of bacterial 28  attachment to young plants than mature plants (Mootian et al., 2009; Pu et al., 2009; Erickson et al., 2010b). Brandl and Amundson (2008) noted that enteric pathogens colonized the surface of young lettuce leaves at a level that was approximately 10-fold higher than mature leaves. However, other studies showed that no significant association exists between plant age and microbiological contamination (Erickson et al., 2010a). 1.4.1.2  Persistence on plant surfaces of in-field leafy vegetables To cause disease, foodborne pathogens must survive and persist on leafy vegetables until  the point of human consumption. The surface of in-field leafy vegetables can be hostile for transient bacteria, as they are subject to competition with epiphytic microflora, fluctuations in temperature, limited water availability, nutrient deprivation, and exposure to UV light (Aruscavage et al., 2006; Lindow and Leveau, 2002; Lindow and Brandl, 2003; Brandl, 2006). These conditions are not ideal for the proliferation and/or survival of enteric bacteria on the phyllosphere. Habtestelassie et al. (2010) noted transmission of E. coli O157:H7 to lettuce grown in soil when plants were irrigated with experimentally inoculated irrigation water. Despite this, it was not recovered from mature plants at harvest, suggesting that E. coli O157:H7 was not capable of long-term survival on the external portions of the leaves (Habtestelassie et al., 2010). Moreover, exposure to UV light and wind-mediated drying of the leaf surface have been identified as important factors influencing bacterial death on the phylloplane (Jones, 1986; Gras et al., 1994; Hutchison et al., 2008). The WHO (2006) established that enteric bacteria are reduced by approximately 0.5 to 2 log10 CFU/g per day, with increased reductions expected under dry and hot conditions. Increased pathogen inactivation is expected at higher ambient temperatures and longer daylight (i.e. UV exposure) than in cloudy, cool, and rainy weather (WHO, 2006). Barker-Reid et al. (2009) noted that harsh environmental conditions (i.e. warm 29  summer temperature, limited rainfall, and intense solar exposure) led to a 0.5 log10 CFU/g reduction in E. coli on lettuce leaves per day. Keraita et al. (2007b) observed an average daily reduction of 0.7 log10 for fecal coliforms under field conditions in the dry season in Ghana. Bezanson et al. (2012) noted that E. coli O157:H7 populations fell from 105 to <102 CFU/g on Romaine lettuce leaves within 7 days after inoculation. Erickson et al. (2010b) found that E. coli O157:H7 was only capable of persisting on in-field leaves for 7 days. The survival of E. coli O157:H7 on the plant surface is also a function of nutrient availability (Jablasone et al., 2005; Aruscavage et al. 2008; Barker-Reid et al., 2009). Aruscavage et al. (2008) compared the survival of E. coli O157:H7 on intact and damaged lettuce leaves. Over the 10 day experiment conducted in a greenhouse (22 to 25°C, 55% relative humidity), they observed a population of E. coli O157:H7 inoculated on the surface to decline rapidly on intact lettuce leaves, while cells inoculated onto damaged leaves were able to survive better. By day 10, they noted that E. coli O157 counts had decreased by 3 log10 CFU/g on intact lettuce leaves and decreased by less than 1 log10 CFU/g on damaged leaves. Aruscavage et al. (2008) attributed the enhanced survival of E. coli O157:H7 on damaged lettuce leaves to nutrient availability. Similarly, Barker-Reid et al. (2009) noted a 1.5 log10 CFU/g reduction in E. coli counts on damaged leaves and a 2.2 log10 CFU/g reduction on intact tissues over 5 days. Native competitors or antagonistic microbiota present on leaf surfaces (i.e. epiphytic bacteria) may restrict the growth of foodborne pathogens (Babic et al., 1997; Schuenzel and Harrison, 2002; Hutchison et al., 2008). Competition for nutrients plays a major role in the inhibitory properties of native microbiota on leafy vegetables (Janisiewicz et al., 1999; Schuenzel and Harrison, 2002). Babic et al. (1997) demonstrated that Pseudomonas fluorescens limited the growth of Listeria monocytogenes on fresh-cut spinach leaves. Moreover, Schuenzel 30  and Harrison (2002) reported that Aeromonas spp. and Pseudomonas spp. inhibit L. monocytogenes, E. coli O157:H7, S. Montevideo, and Staphylococcus aureus on minimally processed vegetables. 1.4.2  Internalization In general, internalized contamination of leafy vegetables is rare, whereas surface  contamination of leafy tissues is more frequently observed (Warriner et al., 2003; Hora et al., 2005; Pu et al., 2009). However, the possibility that enteric pathogens can invade plant tissues has received significant attention (Hari-Kudo et al., 1997; Seo and Frank, 1999; Takeuchi and Frank, 2000; Solomon et al, 2002b; Warriner et al., 2003; Johannessen et al., 2005; Franz et al., 2007; Mitra et al, 2009; Erickson et al., 2010a; Erickson et al., 2010b). Once internalized, enteric pathogens may be protected from post-harvest decontamination thereby limiting the efficacy of interventions designed to reduce the associated risk. 1.4.2.1  Internalization through openings Enteric pathogens may invade plant tissues through natural opening (i.e. stomata) and  wounds (created by blowing sand or insect feeding) (Hari-Kudo et al., 1997; Seo and Frank, 1999; Takeuchi and Frank, 2000; Franz et al., 2007; Mitra et al, 2009). It has been demonstrated using microscopic techniques that enteric pathogens can enter stomata and become internalized (Seo and Frank, 1999; Takeuchi et al., 2000; Takeuchi and Frank, 2000; Wachtel et al., 2002a; Wachtel and Charkowski, 2002). However, contradictory observations have been made regarding the preference of foodborne pathogens to attach to stomata. Takeuchi and Frank (2000) found that attachment of E. coli O157:H7 to lettuce leaf surfaces did not occur randomly, suggesting that active attachment mechanisms influence the interaction between microorganism and plant tissues; stomata were a preferred attachment site 31  for E. coli O157:H7. Similarly, Seo and Frank (1999), Takeuchi et al (2000), Wachtel et al. (2002a) and Wachtel and Charkowski (2002) observed attachment of E. coli O157:H7 to the stomata. In contrast, other studies have reported that attachment of enteric bacteria to plant surfaces is random and due to passive physicochemical forces (Delaquis et al., 2007). Foodborne pathogens may also penetrate plant tissues through wounds created by blowing sand, insect feeding, or industrial processing. Takeuchi and Frank (2000) reported that E. coli O157:H7 penetrated the cut edges of lettuce tissues and that internalized cells were located primarily at the cell junctions. Furthermore, they noted that incubation at 4°C permitted greater penetration into cut edges compared to higher incubation temperatures (i.e. 7, 22, and 37°C) over 24±1 h. They attributed this observation to differences in respiration rates, which are believed to produce a counterforce to internalization. They hypothesized that bacterial cells were more readily able to penetrate into tissues through cut edges when the incubation temperature was sufficiently low to minimize plant respiration 1.4.2.2  Internalization through infiltration Bacterial contamination of internal plant tissues can also occur via root systems. The  uptake of enteric bacteria by infiltration is influenced by plant maturity (i.e. whether the plant had reached the seedling stage of growth when enteric bacteria were introduced to the root systems) and the level of bacterial inoculum (Warriner et al., 2003; Johannessen et al., 2005). Solomon et al. (2002b) demonstrated that edible portions of lettuce could become contaminated without direct contact with a pathogen by growing lettuce from seed in soil amended with contaminated manure or by direct application of contaminated water to the soil surface. Escherichia coli O157:H7 migrated from the soil to internal locations within the seedlings. However, uptake was not observed when the pathogen was introduced to plant seedlings 32  (Johannessen et al., 2005). Furthermore, the inoculum level plays a role in bacterial uptake through infiltration. When soil was irrigated with water containing 108 CFU E. coli O157:H7 /ml, the bacterium entered the roots of mature lettuce plants and translocated to edible portions of the plants (Solomon et al., 2002b). However, uptake was not observed when a lower inoculum of E. coli O157:H7 (i.e. 102 CFU E. coli O157:H7 /ml) was used (Johannessen et al., 2005). Furthermore, Erickson et al. (2010b) demonstrated that internalization via plant roots in the field is rare and when it does occur, E. coli O157 does not persist for more than 7 days. 1.5  Project Objectives The literature review has summarized factors contributing to the contamination of leafy  vegetables with human pathogens and their survival. Evidence shows that enteric bacteria can be disseminated from contaminated irrigation water and soil to growing plants in laboratory settings. However, observational studies are necessary to assess the risk of contamination in commercial production systems. Leafy vegetable production systems and climate in BC are not similar to those found in other Canadian provinces. Consequently, contamination dynamics were examined in BC leafy vegetable production systems with a view to identify sources of contamination and routes of transmission that could affect the safety of these crops. To this end, several hypotheses were tested in this thesis: 1. The levels and prevalence of indicator bacteria (i.e. aerobic microorganisms, coliforms, and generic E. coli) present on in-field leafy vegetables (i.e. green leaf lettuce, red leaf lettuce, and Romaine lettuce) grown in the Lower Mainland region of BC are similar to previous reports from US studies; 2. On-farm environmental sources (e.g., soil, irrigation water, compost, and hands) are reservoirs of E. coli which can be transferred to in-field plants; 33  3. The farm environment is a reservoir of virulence and AMR genes in E. coli. To addresses these hypotheses, the following objectives were established: 1. Obtain baseline information on the levels and prevalence of indicator bacteria (i.e. aerobic microorganisms, coliforms, and generic E. coli) present on leafy vegetables (i.e. green leaf lettuce, red leaf lettuce, and Romaine lettuce) grown in the Lower Mainland region of BC at the pre-harvest level; 2. Identify E. coli reservoirs at the farm level, with particular focuses placed on irrigation water, soil, compost and hands; 3. Examine E. coli transmission dynamics using BOX-PCR molecular typing; 4. Examine recovered E. coli for the presence of virulence genes (eaeA, hlyA, stx1, and stx2) and clinically relevant AMR.  34  Leafy"greens/le4uce" Fresh"produce"other"than"leafy" 5000" greens/le4uce" illness"  No.$of$outbreaks$(cases)$  50"  4500" 4000" 3500"  40"  3000" 30"  2500" 2000"  20"  1500"  No.$of$Illnesses$(cases)$  60"  1000"  10"  500" 0"  0"  Year$ Figure 1.1 Produce-related outbreaks in the United States between 1990 and 2010. A produce-associated outbreak was defined as two or more cases linked to the same organism in which an epidemiologic investigation implicated the same uncooked produce item, such as fruit, vegetables (including fresh herbs), salad, or juice. (Information was collected from CDC Foodborne Outbreak Online Database, http://wwwn.cdc.gov/foodborneoutbreaks/Default.aspx). 35  Table 1.1 Produce-related outbreaks in Canada between 1990 and 2013. A produce-associated outbreak was defined as two or more cases linked to the same organism in which an epidemiologic investigation implicated the same uncooked produce item, such as fruit, vegetables (including fresh herbs), salad, or juice. (Table was constructed based on information presented in two publications (Sewell and Farber, 2001 and Kozak et al., 2013) and public health notices published on the Public Health Agency of Canada website, http://www.phac-aspc.gc.ca/fs-sa/phn-asp/index-eng.php). Year  Organism  Vehicle  Province  Additional outbreak information  1991  Salmonella Poona  Cantaloupe  1992 1995  Calicivirus Salmonella Stanley  Salad Alfalfa sprouts  1995-96  Salmonella Newport  Alfalfa sprouts  British Columbia, Quebec  1996  Cyclospora cayetanensis Cyclospora cayetanensis Salmonella Meleagridis Calicivirus  Guatemalan raspberries Guatemalan raspberries Alfalfa sprouts  Ontario, Quebec  Multiple provinces  Canada = 78 USA = 143 27 Canada – 30 Finland and USA -242 Canada – 121 USA and Denmark – 20,000 Canada – 195 USA – 1,270 Canada – 31 USA - 981 124  Imported Bosnian raspberries Guatemalan raspberries Imported chopped uncooked parsley Potato salad  Quebec  >200  2 separate events  Ontario  315  Multiple locations  Ontario, Alberta, Multistate Nova Scotia  Canada – 40 USA – 450 194  Fund-raising event  Cantaloupe  Ontario  22  1997 1997 1997 1998 1998 1998 1998  Cyclospora cayetanensis Shigella sonnei Escherichia coli O157:H7 Salmonella Oranienburg  Multistate Multi-province Ontario British Columbia  No. ill persons  Ontario, multistate  Catered event Seed contamination Seed contamination  36  Table 1.1. continued. Year  Organism  Vehicle  1999  Salmonella Paratyphi Bvar. Java  Alfalfa Sprouts  1999 2001  Calicivirus Cyclospora cayetanesis Shigella sonnei Salmonella Enteritidis  Salad Basil  Salmonella Newport Escherichia coli O157:H7 Salmonella sonnei Hepatitis A Salmonella Poona Cyclospora cayetanensis Cyclospora cayetanensis Cyclospora cayetanensis Salmonella Brandenberg Salmonella Javiana  Fruit (fruit trays) Salad and/or sandwiches Greek pasta salad Multiple produce Cantaloupe Cilantro (suspected)  2001 2001  2002 2002 2002 2002 2002 2003 2004 2004 2004 2004 2005 2005  Salmonella Enteritidis Hepatitis A  Province  No. ill persons  Additional outbreak information  Alberta, British Columbia, Saskatchewan Ontario British Columbia  46  Seed contamination  27 17  Imported from Thailand  British Columbia Alberta, British Columbia, Saskatchewan Ontario Prince Edward Island  31 84  Ontario Ontario Ontario British Columbia  >700 3 2 11  Mango or basil (suspected) Cilantro  British Columbia  17  British Columbia  8  Cucumber  British Columbia  12  On-farm contamination  Roma tomatoes (suspected) Mung bean sprouts  Ontario  7  Restaurant  Alberta  8  Ready-to-eat leafy greens (suspected)  Ontario  16  Restaurant. On-farm contamination Restaurant  Spinach Mung bean (suspected)  34 17  Private party  37  Table 1.1. continued. Year 2005  Organism  Vehicle  Province  No. ill persons  Cyclospora cayetanensis Cyclospora cayetanensis Cyclospora cayetanensis Salmonella Oranienburg Escherichia coli O157:H7 Escherichia coli O157:H7 Salmonella sonnei  Basil  Quebec  200  Basil  Ontario  44  Basil or garlic  British Columbia  28  Fruit salad  Ontario  2  Spinach  Ontario  Lettuce (suspected)  Ontario  Canada – 1 USA – 204 7  Carrots (suspected)  Alberta  4  2008  Salmonella Litchfield  Cantaloupe  British Columbic, Alberta, Manitoba, Ontario, New Brunswick  9  2008  Escherichia coli O157:H7 Escherichia coli O157:H7 Salmonella Cubana  Spanish onions (suspected) Iceberg lettuce  Ontario  235  Ontario  3  Onion sprouts  20  Salmonella Braenderup  Mango  Alberta, British Columbia, Nova Scotia, Ontario Alberta, British Columbia  2005 2006 2006 2006 2006 2007  2008 2009  2012  23  Additional outbreak information Restaurant  On-farm contamination  Restaurant  Imported from Mexico  38  Table 1.1. continued. Year  Organism  2012  Hepatitis A  2013  Escherichia coli O157:H7  Vehicle Pomeberry Blend frozen berries Lettuce  Province  No. ill persons  Additional outbreak information  British Columbia Nova Scotia, Ontario, New Brunswick  13  KFC and KFC-Taco Bell restaurants  39  6" Leafy"greens/le4uce"  No.$of$ourbreaks$(bases)$ $  5" Fresh"produce"other"than"leafy" greens/le4uce"  4"  3"  2"  1"  0"  Year$ Figure 1.2 Produce-related outbreaks in Canada between 1990 and 2009. A produce-associated outbreak was defined as two or more cases linked to the same organism in which an epidemiologic investigation implicated the same uncooked produce item, such as fruit, vegetables (including fresh herbs), salad, or juice. (Figure was constructed based on information presented in two publications: Sewell and Farber, 2001 and Kozak et al., 2013).  40  Table 1.2 Summary of microbiological surveillance studies on the quality of leafy vegetables. Sample quantity and origin 27 spinach samples, grown in the southern US 9 Swiss chard, grown in the southern US 33 turnip greens, grown in the southern US 128 lettuce samples, farmers’ markets, Alberta 15 arugula samples, grown in the southern US 12 collard samples, grown in the southern US 70 mustard green samples, grown in the southern US 27 spinach samples, grown in the southern US 201 lettuce and spinach samples, Bavaria, Germany 10 lettuce samples, retail markets, Washington, D.C.  ACCs  Coliforms  Generic E. coli  Presence of foodborne pathogens  Reference  Salmonella  Listeria monocytogenes  -1  E. coli O157:H7 -  -  -  Ailes et a.l, 2008  <1  -  -  -  -  Ailes et al., 2008  61%  <1  -  -  -  -  Ailes et al., 2008  -  -  1.25  23%  0%  0%  -  Bohaychuk, et al., 2009  5.8 ± 1.0  3.4 ± 1.2  -  <1  -  -  -  -  Johnston et al., 2005  4.5 ± 1.0  1.0 ± 0.7  -  <1  -  -  -  -  Johnston et al., 2005  6.2 ± 1.0  2.4 ± 1.3  -  1.0 ± 0.9  -  -  -  -  Johnston et al., 2005  5.8 ± 1.0  1.5 ± 0.8  -  <1  -  -  -  -  Johnston et al., 2005  -  -  71.1%  -  5%  -  0%  ? (0.5% Listeria  8.6 ± 1.3 (5.6 – 9.5)  5.6 ± 1.8 (0.0 – 6.5)  -  >3.0  10%  -  -  Mean count (log10 CFU/g) 5.8 ± 0.16  Mean count (log10 CFU/g) 1.5 ± 0.15  Prevalence  Prevalence  63%  Mean count (log10 CFU/g) <1  5.3 ± 0.21  <1  -  5.9 ± 0.13  1.5 ± 0.17  -  Schwaiger et al., 2011  spp.)  0%  Thunberg et al., 2002  41  Table 1.2. continued. Sample quantity and origin 110 in-field leafy greens samples, collected from Minnesota and Wisconsin, in 2003 72 in-field lettuce samples, collected from Minnesota and Wisconsin, in 2003 183 in-field leafy vegetable samples, collected from Minnesota and Wisconsin, in 2004 77 in-field lettuce samples, collected from Minnesota and Wisconsin, in 2004 142 lettuce 80 lettuce 263 leaf lettuce, Ontario-grown, farmers’ market 112 organic leaf lettuce, Ontariogrown, farmers’ market  ACCs Mean count (log10 CFU/g) -  -  -  -  Coliforms Mean count (log10 CFU/g) 2 O: 2.7 ± 0.4  Generic E. coli  Prevalence -  Mean count (log10 CFU/g) 2.2 – 2.4  Presenc of foodborne pathogens  Prevalence O2: 6.7%  3  S: 3.6 ± 0.3  S : 23.9%  4  C: 3.0 ± 0.4  C4: 25%  O: 3.1 ± 0.2  2.2 – 2.4  O:18.2%  S: 3.2 ± 0.4  S: 20%  C: 1.5 ± 0.2  C: 0%  O: 2.7 ± 0.2  -  2.2 – 2.4  O: 9.1%  S: 3.5 ± 0.2  S: 13.9%  C: 2.4 ± 0.4  C3: 20.0%  O: 4.1 ± 0.1  E. coli O157:H7 0%  Salmonella  Listeria monocytogenes  0%  -  Mukherjee et al., 2006  0%  0%  -  Mukherjee et al., 2006  0%  0%  -  Mukherjee et al., 2006  0%  0%  -  Mukherjee et al., 2006  USDA, 2013 Ruiz, et al., 1987 Arthur et al., 2007  3  -  -  2.2 – 2.4  O: 22.7%  S: 3.9 ± 0.5  S: 9.3%  C: 3.2 ± 0.5  C: 25%  Reference  (4-10)  -  -  -  -  0% -  0.7% 6%  -  -  -  -  <0.7 – 2.4  6.5%  0%  0%  -  -  -  -  <0.7 – 4.5  11.6%  0%  0.9%  -  Arthur et al. 2007  42  Table 1.2. continued. Sample quantity and origin  ACCs  Coliforms  Generic E. coli  Mean count (log10 CFU/g) -  Mean count (log10 CFU/g) -  Prevalence  1,159 organic lettuce  -  179 organical leaf lettuce, grown in Norway 84 organic leafy greens, grown in Minnesota (preharvest)  1,177 conventional lettue  Presenc of foodborne pathogens  Prevalence  -  Mean count (log10 CFU/g) Not reported  -  -  Not reported  Not reported  -  -  -  <2 – 3.7  9%  -  3.3 ± 1.8  -  ≈ 3.1 (only for positive samples)  4 organic leafy greens, grown in Minnesota (preharvest) 49 lettuce, grown in Minnesota (preharvest)  -  2.0 ± 0.1  -  ≈ 3.1 (only for positive samples)  -  4.0 ± 2.3  -  ≈ 3.1 (only for positive samples)  6 lettuce, grown in Minnesota (preharvest) 106 organic spring mix, California  -  3.5 ± 2.1  -  5.76  2.75  -  ≈ 3.1 (only for positive samples) <0.7  Not reported  Certified organic:  Reference  E. coli O157:H7 0.2% pathogenic E. coli 0.3% pathogenic E. coli 0%  Salmonella  Listeria monocytogenes  0.08%  -  USDA, 2012b  0%  -  USDA, 2012b  0%  1.1%  Loncarevic et al., 2005  0%  1%  -  Mukherjee et al., 2004  0%  0%  -  Mukherjee et al., 2004  0%  0%  -  Mukherjee et al., 2004  0%  0%  -  Mukherjee et al., 2004  -  0%  0%  0%; Non-certified organic:  13.8% 25%  Certified organic:  0%; Non-certified organic:  30.8% 17%  4%  Phillips and Harrison, 2005  43  Table 1.2. continued. Sample quantity and origin  ACCs Mean count (log10 CFU/g) 5.78  Coliforms Mean count (log10 CFU/g) 2.97  Prevalence  Generic E. coli Mean count (log10 CFU/g) <0.7  Prevalence  Presenc of foodborne pathogens E. coli O157:H7 -  107 conventional 8% spring mix, California -1, not tested. O2, organic leafy greens produced by USDA-accredited organic production systems. S3, semiorganic leafy greens produced by producers who reported using organic practices but not USDA-certified. C4, conventional leafy greens produced by operations that could use any type of farming practice.  Salmonella  Listeria monocytogenes  0%  0%  Reference  Phillips and Harrison, 2005  44  Table 1.3 Microbiological guidelines for fresh fruits vegetables. Country  Food  ACCs  Coliforms  commodity Australia and New Zealand  Ready-to-eat fresh produce  -1  -  Generic  E. coli  Other indicator  E. coli  O157:H7  microorganisms  n=5, c=2, m=3 CFU/g, M=100 CFU/g  -  Coagulase +ve staphylococci, C. perfringens, pathogenic Bacillus spp.: n=5, c=2,  Reference  FSANZ, 2001  m=100 CFU/g, M=10000 CFU/g;  V. parahaemolyticus: n=5, c=2, m=3 CFU/g, M=10000 CFU/g;  Absence of Campylobacter spp., Salmonella spp. and L. monocytogenes Canada  Fruit and vegetables  -  -  n=5, c=2, m=100 CFU/g, M=1000 CFU/g  European  Pre-cut fruit and vegetables (ready-to-eat) Ready-to-eat fresh produce  -  -  n=5, c=2, m=100 CFU/g, M=1000 CFU/g n=5, c=2, m=20 CFU/g, M=100 CFU/g  Union Hong Kong  Singapore  Ready-to-eat solid food  -  <100,000 CFU/g  -  -  n=5, c=0, m= 0CFU/g  -  Health Canada, 2008  -  -  The European Union, 2005  n=5, c=0, m= 0CFU/g  -  Absence of Campylobacter spp., Salmonella spp. and V. cholerae L. monocytogenes -  Centre for Food Safety, 2007  AVA, 2002  45  Table 1.3. continued. Country  Food  ACCs  Coliforms  commodity South Africa  United Kingdom  Raw vegetables and raw fruits, including fresh fruit salad, salad dressing and peanut butter Fresh fruits and vegetables, ready-to-eat  -  <200 CFU/g  -  n=5, c=2, m=100 CFU/g, M=10,000 CFU/g  Generic  E. coli  Other indicator  E. coli  O157:H7  microorganisms  0 CFU/g  -  Yeast and mould: <100,000 CFU/g Salmonella spp.: absent in 25 g of food samples  Department of Health South Africa, 2011  Absence of Campylobacter spp., Salmonella spp. and V. cholerae  Gilbert et al., 2000  n=5, c=2, m=20 CFU/g, M=100 CFU/g  n=5, c=0, m= 0CFU/g  Reference  -1, not tested.  46  Table 1.4 Microbiological guidelines for irrigation water applied to crops likely to be eaten raw. Country  Alberta Environment  Intestinal nematodes (no. of eggs/liter)  Coliforms 1 (CFU/100 ml)  Generic E. coli (CFU/100 ml)  -2  <1000 CFU/100 ml (Total coliforms)  -  Additional comments  Reference  Surface water  Anonymous, 1999b  <100 CFU/100 ml (Fecal coliforms) BC Ministry of Environment and Health Canada  -  ≤1,000 CFU/100 ml (Total coliforms)  <77 CFU/100 ml  If E. coli or coliform levels in irrigation water exceed these recommended levels, producers should cease using irrigation water for a minimum of 14 days prior to harvesting.  Anonymous, 1988  California Leafy Green Products Handler Marketing Agreement (LGMA) Canadian Council of Ministers of the Environment  -  -  <235 MPN/ 100 ml  -  LGMA, 2012  -  <1000 CFU/100 ml (Total coliforms)  -  If E. coli or coliform levels in irrigation water exceed these recommended levels, producers should cease using irrigation water for a minimum of 14 days prior to harvesting.  Anonymous, 1999a  <100 CFU/100 ml (Fecal coliforms) Food Safety Leadership Council on-Farm Produce Standards Manitoba Conservation  -  -  <126 MPN/ 100 ml  -  FSLC, 2007  -  <200 CFU/100 ml (Fecal coliforms)  <200 CFU/ 100 ml  -  Williamson, 2001  47  Table 1.4. continued. Intestinal nematodes (no. of eggs/liter)  Coliforms1 (CFU/100 ml)  Generic E. coli (CFU/100 ml)  Additional comments  Saskatchewan Environment  -  <1000 CFU/100 ml (Total coliforms)  <100 CFU/ 100 ml  -  Anonymous, 1997  World Health Organization  ≤1  ≤1,000 CFU/100 ml (Fecal coliforms)  -  WHO, 1989  US Environmental Protection Agency  -  <1000 CFU/100 ml (Fecal coliforms)  -  Treatment expected to achieve required microbiological guideline: a series of stabilization ponds designed to achieve the microbiological quality indicated or equivalent treatment (of treated wastewater) Surface water  US Environmental Protection Agency  -  0 CFU/100 ml (Fecal coliforms)  -  Wastewater, for crops eaten raw  Anonymous, 1992  Country  Reference  Anonymous, 1973  Coliform1, Total coliforms are Gram-negative bacilli, able to multiply in the presence of bile salts, and able to ferment lactose with acid and gas production in 48 h at 37°C. Fecal coliforms are Gram-negative bacteria, capable of proliferate in the presence of bile salts, and able to produce ferment lactose with acid and gas production in 48 h at 44°C. -2, no guidelines were established.  48  Figure 1.3 Schematic illustration of factors contributing to bacterial contamination of in-field leafy vegetables. 49  Chapter 2: Field Study Examining the Microbiological Quality of Leafy Vegetables Grown in the Lower Mainland Region of British Columbia  2.1  Introduction In Canada, the microbiological acceptability of ready-to-eat fresh produce is based on the  recovery and levels of generic E. coli (n=5, c=2, m=100 CFU/g, M=1000 CFU/g) and absence of E. coli O157:H7 (Health Canada, 2008). Two surveys focusing on pathogen detection and levels of E. coli on locally grown fresh produce were conducted in Ontario (Arthur et al., 2007) and Alberta (Bohaychuk et al., 2009). There is no information available regarding the microbiological quality of BC grown fresh produce. Because approximately half of the fresh produce consumed by British Columbians is grown locally (BCMAL, 2006), it is crucial to establish province-specific data evaluating the microbiological quality of BC produce. Despite the fact that fresh produce is now recognized as a significant vehicle for the transmission of pathogenic microorganisms, recovery of pathogens from fresh produce remains low, making detection challenging (Johannessen et al., 2000; Sagoo et al., 2001; Mukherjee et al., 2004; Arthur et al., 2007; Bohaychuk et al., 2009). Johanneseen et al. (2000) failed to recover E. coli O157:H7 from 3,200 organic retail vegetables. Similarly, Sagoo et al. (2001) analyzed 890 fresh produce samples with no sample tested positive for E. coli O157:H7. Consequently, baseline information regarding levels and prevalence of suitable indicators of fecal contamination (i.e. E. coli) as a proxy indicator of possible enteric pathogen contamination is essential to better understand and identify possible risks posed by fresh produce.  50  To this end, a microbiological survey of two different farm production systems was conducted to obtain baseline information on the levels and prevalence of indicator bacteria (i.e. aerobic microorganisms, generic Escherichia coli, and coliforms) present on leafy vegetables (i.e. green leaf lettuce, red leaf lettuce, and Romaine lettuce) grown in the Lower Mainland region of BC at the pre-harvest level. 2.2 2.2.1  Materials and Methods Participating farms Two independent vegetable farms located in the Lower Mainland region of BC were  examined in this study. The first farm is a 30-acre conventional production system while the second farm is a 25-acre certified organic production system. Both farms produce a variety of crops including leafy vegetables, tomatoes, herbs, corn, and pumpkins. The conventional production system used two water sources (i.e. municipal water and ditch water) to irrigate leafy vegetables. Furthermore, it applied ammonium nitrate to fertilize its soil. The organic production system used ground well water to irrigate leafy vegetables and applied a mixture of commercially available composted cattle and poultry manure as fertilizer. 2.2.2  Sampling of leafy vegetable samples The farms were visited weekly from August to October in 2011 and 2012. Pre-harvest  leafy vegetable samples (i.e. green leaf lettuce, red leaf lettuce and Romaine lettuce) were collected by cutting the stem approximately 3 cm from the soil surface. Samples were transferred aseptically into sterile Nasco Easy-to-Close Whirl-Pak sample bags (Fisher Scientific) without washing or removal of soil particles. Between samples, gloves and knives were disinfected with 70% ethanol and air-dried. To ensure sample collection was random and representative, at least 51  three areas were assessed for each production system. Samples were selected based on a “W” sampling pattern, with five samples of each commodity collected from respective areas per sampling interval (Figure 2.1). At both production systems, plants were hardened in a greenhouse for 4 weeks before being transplanted to the field. The number of plants comprising a sample varied based on plant maturity level. For mature leafy vegetables (i.e. > 20 days old), approximately 50 g of the second outer most layer of leaves were collected from individual plants. For younger plants (i.e. <20 days old), a sample comprised approximately 30 g of leaves of each commodity collected from multiple plants (e.g., up to 5 plants). Sample bags were marked on the exterior surface with the following information: produce type, farm identity, sample number, sample location, and date of collection. Samples were transported in refrigerated coolers containing ice packs and processed within 24 hours of collection. 2.2.3 2.2.3.1  Microbiological analyses Enumeration of aerobic microorganisms, coliforms, and generic Escherichia coli Unless otherwise specified, all media employed were purchased from Becton Dickinson  (Mississauga, Ontario, Canada). Populations of aerobic microorganisms, coliforms, and generic E. coli were measured in homogenates prepared by stomaching 25 g of plant tissues in 225 ml of sterile 1% (w/v) peptone water with a stomacher (260 rpm for 1 min). Serial dilutions were prepared in sterile 1% (w/v) peptone water for further analysis as described by Health Canada (i.e. MFHPB-33, MFHPB-34). For the enumeration of aerobic microorganisms (i.e. MFHPB-33; Health Canada, 2001), the dilutions were aseptically plated on 3M PetrifilmTM Aerobic Count Plates. All colonies were counted after 24 h incubation at 37°C. For the enumeration of coliforms 52  and E. coli (i.e. MFHPB-34; Health Canada, 2012), the dilutions were aseptically plated on 3M PetrifilmTM E. coli/Coliform Count Plates and characteristic colonies were counted after 48 h incubation at 37°C. Populations of aerobic microorganisms were only measured in leafy vegetable samples collected in 2012. Enumeration of aerobic microorganisms, coliforms, and generic E. coli was conducted by Maxxam Analytics Food Microbiology Lab (4606 Canada Way, Burnaby, BC). 2.2.3.2  Detection of generic Escherichia coli Because few samples collected in 2011 had detectable levels of E. coli, an enrichment  procedure was used in 2012 to increase the possibility of recovering E. coli. The detection of generic E. coli in leafy vegetable samples collected in 2012 was conducted following previously published E. coli enrichment methods (CIPARS, 2007). Briefly, 25 g of leafy vegetable sample were added to 225 ml of 1% peptone water (w/v) and homogenized using a stomacher (260 rpm for 1 min). Fifty milliliters of the 10-1 sample dilution were removed and combined with 50 ml of 2 x E. coli broth (EC). Following mixing, samples were incubated at 37°C for 24 h, after which a loopful of inoculum was streaked onto EMB agar. From each EMB plate, three typical E. coli colonies were inoculated into test tubes containing 5 ml EC-MUG medium and an inverted Durham tube, incubated at 44°C for 24 to 48 h, and examined for gas production and fluorescence. Presumptive E. coli isolates were further streaked onto tryptic soy agar (TSA) plates and confirmed by API 20E (Biomerieux, Saint-Laurent, Quebec). Three isolates per positive sample were frozen in 20% glycerol at -70°C. Escherichia coli K-12 (ATCC 25922) and Enterococcus faecalis (ATCC 29212) were run as positive and negative controls, respectively.  53  2.2.3.3  Phylogenetic typing of Escherichia coli isolates A quadruplex-PCR assay was employed to assign recovered E. coli isolates into one of  the four major phylogenetic groups (i.e. A, B1, B2, and D) using a previously published method (Doumith, et al., 2012). Template DNA was generated from cultures grown overnight at 37°C in LB broth. From this, 500 µl was centrifuged (13,000 x g for 1 min), washed three times with 500 µl of 1 x phosphate buffered saline (Sigma-Aldrich, Oakville, Ontario, Canada) and suspended in 400 µl of Qiagen Elution Buffer (Mississauga, Ontario, Canada). The sample was heated at 95°C for 20 min, cooled on ice for 5 min, and re-centrifuged. Supernatant was removed and placed into a new microfuge tube and stored at -20°C. DNA lysate (5μl) from each isolate was amplified in 25 μl reaction mixtures containing 12.5 μl Qiagen Multiplex PCR Master Mix (Mississauga, Ontario, Canada), 0.2 μM of each required primer: gadA-F 5’-GATGAAATGGCGTTGGCAAG-3’; gadA-R 5’-GGCGGAAGTCCCAGACGATATCC-3’; chuA-F 5’-ATGATCATCGCGGCGTGCTG-3’; chuA-R 5’-AAACGCGCTCGCGCCTAAT-3’; yjaA-F 5’-TGTTCGCGATCTTGAAAGCAAACGT-3’; yjaA-R 5’-ACCTGTGACAAACCGCCCTCA-3’; TSPE4.C2-F 5’-GCGGGTGAGACAGAAACGCG-3’; TSPE4.C2-R 5’-TTGTCGTGAGTTGCGAACCCG -3’; and 2.5 μl Qiagen Q-solution (Mississauga, Ontario, Canada). PCR was cycled as follows: 94°C for 4 min, followed by 35 cycles consisting of 94°C for 30 sec, 65°C for 30 sec and 72°C for 30 sec, with a final extension step at 72°C for 5 min. Expected amplicon sizes were 373 bp, 281 bp, 216 bp and 158 bp for gadA, chuA, yjaA, and TSPE4.C2, respectively. 54  2.2.3.4  Virulence typing of Escherichia coli isolates A quadruplex-PCR assay was employed to detect the presence of four virulence genes  (i.e. eaeA, hlyA, stx1, and stx2) in recovered E. coli isolates (Paton and Paton, 1998). Template DNA lysate was prepared as described in 2.2.2.3. DNA lysate (5μl) from each isolate was amplified in 25 μl reaction mixtures containing 12.5 μl Qiagen Multiplex PCR Master Mix (Mississauga, Ontario, Canada), 0.2 μM of each required primers: eaeA-F 5’- GACCCGGCACAAGCATAAGC-3’; eaeA-R 5’- CCACCTGCAGCAACAAGAGG-3’; hlyA-F 5’- GCATCATCAAGCGTACGTTCC-3’; hlyA-R 5’- AATGAGCCAAGCTGGTTAAGCT -3’; stx1-F 5’-ATAAATCGCCATTCGTTGACTAC-3’; stx1-R 5’- AGAACGCCCACTGAGATCATC-3’; stx2-F 5’- GGCACTGTCTGAAACTGCTCC-3’; stx2-R 5’- TCGCCAGTTATCTGACATTCTG-3’; and 2.5 μl Qiagen Q-solution (Mississauga, Ontario, Canada). PCR was cycled as follows: 94°C for 4 min, followed by 35 cycles each consisting of a denaturation step at 95°C for 1 min; an annealing step at 65°C for 2 min for the first 10 cycles, decrementing 1°C per cycle to 60°C by cycle 15; and an elongation step at 72°C for 1.5 min, incrementing to 2.5 min from cycles 25 to 35; with a final extension step at 72°C for 5 min. The sizes of the amplified fragments were 534 bp, 384 bp, 255 bp, and180 bp for hlyA, eaeA, stx2, and stx1 respectively. 2.2.3.5  Antimicrobial resistance of Escherichia coli isolates The antimicrobial resistance (AMR) profiles of E. coli were determined using a panel of  15 antibiotics and the Kirby-Bauer disc diffusion assay. Three hundred microlitres of overnight 55  culture grown at 37°C in Mueller Hinton (MH) broth (BD Diagnostics, Sparks, Maryland, USA) was inoculated into 30 ml of 0.75% pre-tempered (42°C) agar. From this, 7 ml of the inoculated overlay was applied to a MH agar (BD Diagnostics, Sparks, Maryland, USA) plate and incubated at ambient for 10 min. From each MH agar plate, four antimicrobial susceptibility discs (SensiDiscTM, BD Diagnostics) were applied with sterile forceps and subsequently incubated for 24 h at 35°C at which time zones of inhibition were measured in millimeters and interpreted according to the supplied manufacturer guidelines for E. coli. Antimicrobial discs (µg) used in the panel include: amikacin (AMK; 30), amoxicillin/clavulanic acid (AMC; 20/10), ampicillin (AMP; 10), ceftiofur (XLN; 30), cefoxitin (FOX; 30), ceftriaxone (CRO; 30), chloramphenicol (CHL; 10), ciprofloxacin (CIP; 5), gentamicin (GEN; 10), kanamycin (KAN; 30), nalidixic acid (NAL; 30), streptomycin (STR; 10), trimethoprim-sufamethoxazole (SXT; 1.25/23.75), tetracycline (TET; 30), and trimethoprim (TMP; 5). 2.2.3.6  Statistical analyses Data analyses were conducted using JMP version 10 statistical software (SAS Institute,  Inc, NC, USA). Prior to analyses of microbiological counts, a quantile plot was used to assess normality of the data distribution. When examining differences in ACCs between sampling years (i.e. 2011 vs. 2012), production systems (i.e. conventional vs. organic), and amongst commodities (i.e. green leafy lettuce, red leafy lettuce, and Romaine lettuce), the Tukey-Kramer test was used. When examining differences in coliform counts between sampling years, production systems, and amongst commodities, the Wilcoxon test was used to analyze nonparametric data. The Fisher’s exact test was used to compare the prevalence of coliforms and E. coli between production systems. Comparisons of coliform and E. coli prevalence among  56  commodities were performed using the Χ2 goodness-of-fit test. For all analyses, differences were considered significant if p<0.05. When populations were lower than the limit of detection afforded by the plating assay (i.e. 10 CFU/g), a halfway value between zero and the detection limit (i.e. 5 CFU/g) was assigned to permit statistical analyses. 2.3  Results  2.3.1  Sample collection Two independent farms using different production practices located in the Lower  Mainland region of BC were included in the study. In total, 649 and 444 pre-harvest plant samples were collected in 2011 and 2012, respectively (Table 2.1). 2.3.2 2.3.2.1  Microbiological quality of leafy vegetables Aerobic microorganisms Aerobic colony counts were performed only during the 2012 sampling season. There was  a wide range in ACCs observed on leafy vegetable samples, ranging from 3 to 6.6 log10 CFU/g for the conventional leafy vegetable samples and from 4.1 to 7.2 log10 CFU/g for the organic samples (Table 2.3). Leafy vegetables from the organic production system possessed higher ACCs than samples from the conventional production system (p<0.0001) (Table 2.3, Figure 2.2). Within the same production system, no significant differences were observed between average CFU/g amongst sampled commodities (Table 2.4). 2.3.2.2  Coliform bacteria For leafy vegetables produced using organic standards, coliforms were recovered from 48  and 44% of samples collected in 2011 and 2012, respectively; these differences were not significantly different (Tables 2.2 and 2.3). For the conventional production system, coliforms 57  were detected in 42 and 33% of leafy vegetable samples in 2011 and 2012, respectively and were significantly different (p = 0.003) (Tables 2.2 and 2.3). Overall, the coliform prevalence for organic leafy vegetable samples was significantly higher than that observed for conventional samples (p = 0.01). Overall, regardless of production system, a similar range in coliform counts was observed (Tables 2.2 and 2.3). In 2011, mean coliform counts were not significantly different between conventional and organic production systems. However, in 2012, coliform counts were higher in leafy vegetables from the organic production system than those from the conventional production system (p = 0.001) (Tables 2.2 and 2.3, Figure 2.2). Within the same production system, no significant differences were observed regarding coliform counts or prevalence among sampled commodities (Table 2.4). 2.3.2.3  Detection and phylogrouping of Escherichia coli In the two years of sampling, more than 98% of sampled in-field leafy vegetables  contained fewer than 10 CFU/g of E. coli (Tables 2.2 and 2.3). In 2011, seven samples from the organic production system (2%) showed detectable levels of E. coli while E. coli was not detected in any samples from the conventional system. A low occurrence of detectable levels of E. coli was similarly observed in 2012, with three organic samples (1%) and one conventional sample (0.4%) possessing detectable levels of E. coli. The percentage of samples positive for E. coli was not significantly different between sampling years or production systems. Because few in-field plant samples had detectable levels of E. coli, in 2012 an enrichment step was included to increase the probability of recovering E. coli. The enrichment step increased the recovery rate of E. coli. Besides the three organic samples possessing detectable levels of E. coli, 15 additional positive samples were identified using enrichment. Similarly, one additional 58  conventional sample contained E. coli. For both production systems E. coli was infrequently recovered from leafy vegetable samples (Table 2.3). However, significant differences were observed for the prevalence of E. coli between production systems with higher E. coli prevalence in samples from the organic production system (p = 0.01). Within the same production system, no significant differences were observed for E. coli prevalence amongst sampled commodities (Table 2.4). Sixty four E. coli isolates were recovered from 27 leafy vegetable samples and subjected to phylogenetic typing. The majority of recovered E. coli isolates belonged to phylogenetic group B1 while phylogenetic group D isolates were not recovered (Table 2.5). Based on phylogenetic grouping data, the composition of E. coli recovered from organic leafy vegetables did not vary significantly between sampling years. Considering only three E. coli isolates were recovered from conventional leafy vegetable samples, no analyses comparing E. coli phylogenetic composition between production systems were performed. No samples were positive for Shiga-toxin producing E. coli. However, one E. coli isolate possessed hlyA. 2.3.3  Antimicrobial resistance To determine whether local leafy vegetables may serve as a vehicle for the transmission  of clinically relevant AMR, 64 E. coli isolates recovered from 27 leafy vegetable samples (i.e. two conventional and 25 organic samples) samples were subjected to AMR typing. Considering the sample size, no analyses describing possible associations between production systems and AMR were performed. Overall, no resistance to AMC, FOX, CRO, CIP, STR, or CHL was observed (Figure 2.9). The prevalence of antimicrobial resistant E. coli recovered from in-field  59  leafy vegetable samples was low (Figure 2.9), though nine isolates (14%) showed resistance to more than 2 classes of antimicrobial agents. 2.3.4  Factors associated with microbiological levels on leafy vegetables Statistical analyses were conducted to identify the extent to which various factors, such as  sampling date, sampling location, and plant maturity contributed to the levels and prevalence of indicator bacteria. To determine whether sampling date was associated with levels of microbiological indicators within a production system, microbiological counts (i.e. ACCs and coliform counts) were compared across sampling dates (Figures 2.3 and 2.4). Within the same production system, ACCs remained stable (i.e. variation among ACCs did not exceed 1 log10 CFU/g). On the contrary, higher coliform counts were recovered from samples collected on Aug 7th 2012 for both production systems (p <0.0001). Within each production system, the mean coliform count was 2 log10 CFU/g higher than the coliform counts obtained at other sampling intervals. To assess the relationship between the prevalence of microbiological indicators (i.e. coliforms and E. coli) and sampling date, the Χ2 goodness-of-fit test was used. The prevalence differed significantly between different sampling dates. For both production systems, the prevalence of coliforms determined for samples collected on Aug 7th 2012 was significantly higher compared to other sampling dates (p < 0.0001). A higher prevalence of E. coli was recovered from the organic system on Jul 30th, Aug 7th, and Sept 26th 2012 (p < 0.0001). In order to determine whether sampling location was associated with the levels of microbiological indicators, counts (i.e. ACCs and coliform counts) were compared across sampling locations (Figures 2.5 and 2.6). ACCs and coliform counts varied significantly among sampling locations. The prevalence of E. coli did not differ significantly among sampling  60  locations. In both production systems, a significantly higher prevalence of coliforms corresponded with significantly higher coliform counts. To determine whether plant maturity impacted prevalence or levels of microbiological indicators, counts (i.e. ACCs and coliform counts) were compared among plant maturity levels (Figures 2.7 and 2.8). The ACCs remained stable. Coliform counts varied significantly with plant maturity. Specifically, the mean coliform count for organic samples collected on day 0 (i.e. transplanted) was 2 log10 CFU/g higher compared to that of 21-day old plants. In contrast, E. coli prevalence did not vary significantly with plant maturity. For both production systems, a higher coliform prevalence was correlated with a higher coliform count. 2.4  Discussion With increases in the number of foodborne outbreaks linked to consumption of  contaminated fresh, whole, cut and minimally processed vegetables (Beuchat, 2006), and an increasing self-reliance on locally grown fresh produce (BCMAL, 2006), this project was conducted to determine the microbiological quality of leafy vegetables grown in the Lower Mainland region of BC. Prior to this study, no data are available regarding the levels and prevalence of indictor bacteria on BC-grown leafy vegetables. To address this knowledge gap, the aim of this project was to produce baseline information describing the levels and prevalence of indicator bacteria for in-field leafy vegetables grown in the Lower Mainland region of BC. 2.4.1  Microbiological quality ACCs are used to estimate the overall population of aerobic microorganisms. Even  though no clear relationship between the ACC and pathogen risk has been established, ACCs can be used to estimate the microbiological quality of fresh produce when ACCs are determined at the point of harvest (Monaghan and Hutchison, 2010). The present study is the first in Canada to 61  report ACCs in leafy vegetables grown in Canada. In general, ACCs of in-field leafy vegetable samples were similar to those reported from other jurisdictions (Ruiz, et al., 1987; Johnston et al., 2005; Phillips and Harrison, 2005; Ailes et al., 2008). Ailes et al. (2008) reported an average ACC of 5.3 ± 0.21 log10 CFU/g in 69 in-field leafy vegetable samples grown in the southern US. They did not observe any significant differences between ACCs of the several sampled commodities (i.e. spinach, Swiss chard, and Turnip greens). In addition, Johnston et al. (2005) reported ACCs ranging from 4.5 log10 CFU/g to 6.2 log10 CFU/g, with no significant differences observed among sampled commodities (i.e. arugula, collards, mustard greens, and spinach). However, when compared with ACCs of leafy vegetable samples available at retail, the ACCs of in-field plants were 2 log10 CFU/g lower (Thunberg et al., 2002; Allen et al., 2013). Allen et al. (2013) noted a mean ACC of 6.1 log10 CFU/g and 7.4 log10 CFU/g in US leafy vegetable samples and Mexican samples, respectively. Moreover, Thunberg et al. (2002) reported an average ACC of 8.6 ± 1.3 log10 CFU/g in lettuce samples purchased from retail markets in Washington, D.C. When considering the extended distribution chain of fresh produce, it is possible that the additional time required for transportation and distribution may permit bacterial growth, leading to elevated ACCs in retail leafy vegetables (Monaghan and Hutchison, 2010). This explanation was further demonstrated when ACCs of in-field leafy vegetables were compared to those of leafy vegetables purchased from BC farmers’ markets during the summer of 2012 (Chapter 4). Leafy vegetables from farmers’ markets possessed higher ACCs (6.3 ± 0.09 log10 CFU/g) than in-field plants (p<0.0001) (Table 2.6).  In addition to time, variable post-harvest handling  practices (e.g., temperature abuse) may permit increased opportunity for bacterial proliferation and lead to elevated ACCs of leafy vegetable samples from farmers’ markets and retail establishments. 62  Coliforms, such as non-fecal origin Enterobacter spp. and Klebsiella spp., are naturally present on plants (Knittel et al., 1977; Liao and Fett, 2001; Bell et al., 2004; Mukherjee et al., 2006; Schwaiger et al., 2011). The relationship between coliform presence and the safety of leafy vegetables is not clear. Regardless, coliform counts may be used to assess the quality of leafy vegetables in a manner similar to ACC. It is noteworthy that the present study is the first in Canada to report coliform counts on domestically produced leafy vegetables. The observed mean coliform count is lower than counts reported by other studies (Mukherjee et al., 2004, Johnston et al., 2005; Mukherjee et al., 2006). Mukherjee et al. (2006) detected coliforms in 70% of tested in-field organic leafy vegetable samples (n = 162) grown in the Midwestern US and 64% of the conventionally grown samples (n=41). Coliform counts ranged from 2.7 log10 CFU/g to 4.1 log10 CFU/g for organic in-field samples and ranged from 1.5 log10 CFU/g to 3.0 log10 CFU/g for conventional samples (Mukherjee et al. 2006). Johnston et al. (2005) reported a range of 1.5 log10 CFU/g to 3.4 log10 CFU/g. Ailes et al. (2008) suggested that coliform counts on leafy vegetables were affected by the season of collection (i.e. variations in temperature, UV light intensity, and precipitation). Because weather conditions can vary drastically across regions, it may not be surprising that coliform counts observed in the present study are different from studies conducted in the US. Consequently it is crucial to establish BC-specific baseline data describing levels and prevalence of indicator bacteria present on leafy vegetables. Traditionally, E. coli are considered the most suitable indicator of fecal contamination. This rationale stems from their well-established niche in the intestines of mammals. Recently, however, the validity of this assumption has been questioned. Specifically, an environmental clade of E. coli has been reported that can proliferate in non-intestinal environments (e.g., water and soil). This observation is significant as it suggests that E. coli may be capable of prolonged 63  survival in extra-intestinal environments (Ishii et al., 2007; Ksoll et al., 2007; Perchec-Merien and Lewis, 2012). The presence of environmental E. coli may limit the usefulness of E. coli as an indicator of fecal contamination for fresh produce. Despite this, generic E. coli remain the most prudent indicator of fecal contamination currently available and have a long history of use (De Roever, 1998; Little et al., 1999; Johannessen et al., 2000; Thunberg et al., 2002; Mukherjee et al., 2004; Johnston et al., 2005; Loncarevic et al., 2005; Phillips and Harrison, 2005; Johnston et al., 2006; Mukherjee et al., 2006; Arthur et al., 2007; Ailes et al., 2008; Bohaychuk et al., 2009; Schwaiger et al., 2011; Allen et al., 2013). In Canada, the microbiological acceptability of ready-to-eat fresh produce is based on the recovery and levels of generic E. coli (n=5, c=2, m=100 CFU/g, M=1000 CFU/g) and absence of E. coli O157:H7 (Health Canada, 2008). The results reported here revealed that generic E. coli were present in 7% of organic in-field leafy vegetable samples and 0.8% of conventional samples. Furthermore, E. coli counts never exceeded the regulatory limit of 100 CFU/g. Based on the generic E. coli evaluation criterion, the microbiological quality of sampled leafy vegetables was acceptable, though the detection of E. coli O157 was not included in the present study. Mukherjee et al. (2006) noted a lower E. coli prevalence on organic produce samples compared to conventional samples. They found that in-field organic leafy vegetables grown in Minnesota and Wisconsin possessed a lower E. coli prevalence (ranging from 6.7 to 9.1%) than conventional samples (ranging from 20 to 25%). They also reported higher E. coli counts, ranging from 2.2 to 2.4 log10 CFU/g. In Canada, provincial surveys of fresh produce obtained from farmers’ markets were conducted (Arthur et al., 2007; Bohaychuk et al., 2009). The observed prevalence of E. coli on in-field leafy vegetables was lower compared to data from  64  farmers’ markets in Alberta (23%) (Bohaychuk et al., 2009) and data coming from Ontario (6.5% to 11.6%) (Arthur et al., 2007). An interesting observation from the current study is that E. coli were detected on only six out of 21 sampling occasions (i.e. Aug 11th, 27th, and Sept 10th 2011; Jul 30th, Aug 7th, and 20th 2012). Furthermore, 55% of E. coli positive samples (n = 25) were collected on Aug 7th 2012. As suggested by other studies (De Roever, 1998; Loncarevic et al. 2005; Park et al., 2012), this project highlights that random and sporadic E. coli dissemination events may occur at the preharvest level. Escobar-Paramo et al. (2006) suggested that E. coli isolates, which belong to phylogenetic group B1 and possess hly, were restricted to animal origin. One B1 E. coli isolate, which possessed hlyA was recovered from an organic in-field leafy vegetable sample collected on Aug 7th 2012. This suggests that domestic or wild animals may have been the cause of the observed random and sporadic E. coli dissemination event (on Aug 7th 2012), though this remains speculative. This observation may reflect how contamination events occur. It is noteworthy that E. coli strains belonging to phylogenetic group D were not detected on in-field leafy vegetable samples and that the majority of recovered E. coli belonged to phylogenetic group B1. The surface of leafy vegetables at the pre-harvest level can be hostile for enteric bacteria as they are subjected to fluctuations in temperature, lack of nutrients, limited water availability, and UV light exposure (Lindow and Leveau, 2002; Lindow and Brandl, 2003). The data from the present study suggest that the fitness of E. coli on in-field plants may vary among phylogenetic groups, and that B1 isolates may be more adaptable to non-intestinal environments than other phylogroups based on the observed incidence of recovery. Meric et al. (2013) noted a majority of plant-associated E. coli (48%, n=67) clustered in the B1 phylogroup. They explained this observation by the fact that E. coli strains belonging to phylogroup B1 were 65  more likely to harbor traits, such as higher biofilm and extracellular matrix production, and higher frequency of sucrose utilization, all of which may aid their ability colonize plant surfaces (Meric et al., 2013). In addition to plant surfaces, B1 strains have also been recovered from a wide variety of hosts (i.e. human, cow, chicken, pig, sheep, goat), suggesting that B1 strains possess high adaptability potential to their environments (Carlos, et al. 2010; White et al., 2011). Accordingly, their use as a fecal indicator may be limited. As phylogroups other than B1 may not be as capable at extra-intestinal survival, the detection of strains belonging to A, B2 or D phylogroups may be better suited for the purpose of fecal contamination indication. Further research is recommended to confirm this hypothesis. A limitation of this study was the exclusion of pathogen detection, specifically E. coli O157:H7 and Salmonella detection. Although the recovery of pathogenic bacteria from fresh produce remains challenging, screening for their presence would have provided an improved assessment of risk. In the present study, generic E. coli were used as a proxy indicator for the possible presence of enteric foodborne pathogens, their survival, and transmission within the farm system. Although no clear association between generic E. coli and foodborne pathogens on produce has been made, generic E. coli are still considered to be the most relevant indicator of fecal contamination for fresh produce (De Roever, 1998; Little et al., 1999; Johannessen et al., 2000; Thunberg et al., 2002; Mukherjee et al., 2004; Johnston et al., 2005; Loncarevic et al., 2005; Phillips and Harrison, 2005; Johnston et al., 2006; Mukherjee et al., 2006; Arthur et al., 2007; Ailes et al., 2008; Bohaychuk et al., 2009; Schwaiger et al., 2011; Allen et al., 2013). Furthermore, a PCR-based assay was used to detect the presence of virulence factors. None of the recovered E. coli possessed stx1 or stx2. In future studies, however, direct detection of relevant pathogens is recommended to better assess possible consumer risk. 66  2.4.2  Factors associated with elevated microbiological levels Statistical analyses were conducted to identify the extent to which various factors, such as  production practice (i.e. organic vs. conventional), sampling date, sampling location, and plant maturity contributed to the levels and prevalence of indicator bacteria. The present study found higher ACCs and coliform counts on organic in-field leafy vegetables than conventional samples (p<0.0001) (Figure 2.2). Considering that both ACCs and coliform counts were used to assess the extent of bacterial populations on in-field leafy vegetables, the issue of whether organic produce poses a higher risk for foodborne outbreaks cannot be settled directly based on ACCs or coliform counts. Due to the limitations in the number of farms participating in the present study, the observed differences may be attributed to variations in agriculture practices, rather than the types of farm operation (i.e. organic vs. conventional). Mukherjee et al. (2006) reported that coliform counts on in-field leafy vegetables were not significantly different among conventional, organic, and semi-organic production systems. If further studies were to be carried out to determine whether types of farm operation have an impact on ACCs and coliform counts, a higher number of conventional, and organic independent production systems within the same jurisdiction are required. When E. coli prevalence was compared between production systems, the prevalence was higher for in-field organic leafy vegetable samples (p = 0.01). It has been suggested that organically grown foods have a greater risk of fecal contamination than conventionally grown foods because organic producers primarily rely on the application of animal and plant waste for fertilization (Stephenson, 1997). The observed higher prevalence of E. coli, an indicator of potential fecal contamination, on in-field organic leafy vegetable samples may provide some support to this notion. However, Mukherjee et al. (2006) revealed that E. coli prevalence was not significantly different among conventional and organic in-field leafy 67  vegetable samples. Nevertheless, the issue of whether organic produce poses a higher risk for foodborne outbreaks remains unsolved (Mukherjee et al., 2006). Data in the present study revealed that regardless of production practices, the microbiological quality of sampled leafy vegetables was acceptable, though random and sporadic E. coli dissemination events were observed; it is likely pathogen contamination events can also occur in a similarly sporadic manner on-farm. No specific relationship was observed between microbiological counts and sampling date. Within the same production system, ACCs remained relatively stable (Figures 2.3 and 2.4). However, higher coliform counts and higher E. coli prevalence was recovered from samples collected on Aug 7th 2012 (p < 0.0001). This observation is not correlated with unusual humidity, temperature or UV exposure events between June 30th and August 20th 2012 (Environmental Canada, 2013). The average temperatures for the month of July, August and September in 2012 were 18°C, 19°C and 16°C, respectively (Environment Canada, 2013). Ailes et al. (2008) reported seasonal variations in microbiological counts on produce, with higher counts observed in the fall compared to spring and winter. Within a particular season, however, no significant differences were observed between microbiological counts and sampling dates (Ailes et al., 2008). Leafy vegetables are grown and harvested only during the summer (July, August and September) in the province of BC. Subtle climatologic changes during the restricted growing season did not seem to have an impact on microbiological counts. This present study noted differences in the ACCs and coliform counts among sampling locations, even within the same production system (Figures 2.5 and 2.6). To ensure the collection of a representative sample set, multiple areas were sampled from each farm. The present study is the first to demonstrate that microbiological profiles of in-field leafy vegetables may vary within 68  the same production system, highlighting the challenges of obtaining a representative sample collection. When implementing an individualized on-farm monitoring program, it is crucial to include a well-designed sampling plan. The microbiological quality of in-field leafy vegetables was monitored from the point where seedlings were transplanted to the field to the point of harvest. As such, the impact of plant maturity on levels and prevalence of microbiological indicators was assessed. Throughout the entire cultivation period, ACCs remained stable and no statistical significance was observed in E. coli prevalence. However, the mean coliform count on organic plants from day zero was 2 log10 CFU/g higher than that of 21-day old plants. Brandl and Amundson (2008) made a similar observation. They reported that leaf age was a risk factor in contamination of lettuce with E. coli O157:H7. When lettuce was grown in E. coli O157:H7 inoculated medium, levels of E. coli O157:H7 were 10-fold higher on younger leaves than older leaves (Brandl and Amundson, 2008). They correlated this observation with the fact that young leaves contain 2.5 times more total nitrogen and 1.5 times more carbon compared to mature leaves, suggesting that nutritional content of the plant tissues may have an impact on bacterial colonization. Among conventional samples, on the other hand, young leaves (i.e. in the field from 0 to 2 weeks) were not correlated with high microbiological levels. The coliform counts on conventional samples in the field for 14 days were 1 log10 CFU/g lower compared to plants of other maturity levels. 2.4.3  Antimicrobial resistance Exposure to antimicrobial resistant bacteria via food can be a major public health concern  (Harris et al., 2013). However, there is a lack of data on antimicrobial resistant generic E. coli isolated from fresh produce. This study showed that the prevalence of antimicrobial resistant E. coli was low, though nine isolates (14%) showed resistance towards more than two classes of 69  antimicrobial agents. More importantly, no E. coli showed resistance towards clinically relevant antimicrobial agents, such as ceftriaxone, ciprofloxacin, and trimethoprim-sulfamethoxazole. 2.5  Conclusion In summary, baseline information on levels and prevalence of indicator bacteria (i.e.  aerobic microorganisms, coliforms, and generic Escherichia coli) present on leafy vegetables grown in the Lower Mainland region of BC at the pre-harvest level was obtained. When comparing the data in this present study with observations from other studies, variations among localities were noted, indicating the importance of collecting region-specific data. The recovery of low levels of E. coli suggests that the microbiological quality of sampled leafy vegetables was acceptable and that random and sporadic E. coli dissemination events occurred at the pre-harvest level. The type of farm operation, sampling location and plant maturity was associated with significantly different levels of indicator bacteria, though no clear relationship between sampling dates and microbiological counts was identified. The limitation of phylogroup B1 E. coli as indicators of fecal contamination was highlighted.  70  Table 2.1 Summary of in-field leafy vegetable samples collected from conventional and organic production systems in 2011 and 2012. Year  2011  Production systems  Conventional  Organic  2012  Conventional  Organic  Total samples (n)  0  7  14  21  ≥28  Green leaf lettuce  85  10  5  15  10  45  Red leaf lettuce  75  5  5  10  10  45  Romaine lettuce  85  10  5  10  10  50  Green leaf lettuce  155  16  15  22  25  77  Red leaf lettuce  132  10  15  22  15  70  Romaine lettuce  117  10  10  17  20  60  Green leaf lettuce  95  5  15  20  25  30  Red leaf lettuce  45  5  5  10  15  10  Romaine lettuce  100  10  15  20  25  30  Green leaf lettuce  87  10  15  15  20  25 (+2 retail)  Red leaf lettuce  92  10  15  15  25  25(+2 retail)  Romaine lettuce  65  10  10  10  15  20  Commodity  Plant maturity measured as days being in the field  71  Table 2.2 Levels and prevalence of indicator bacteria recovered from in-field leafy vegetables collected from conventional and organic production systems in 2011 (p<0.05; comparison of E. coli and coliform prevalence using Χ2 goodness-of-fit; comparisons for E. coli and coliform counts using Wilcoxon test).  Organic  Coliforms  E. coli Enterococci  Conventional  Prevalence  Range (log10 CFU/g)  Mean (log10 CFU/g)  Prevalence (% positive)  Range (log10 CFU/g)  Mean (log10 CFU/g)  199/414 (48%)  ND1– 3.5  1.1±0.06  99/235 (42%)  ND – 3  1.2±0.03  7/414 (1.7%)  ND – 2.9  0.9±0.005  0/235 (0 %)  ND  0.7±0.001  169/169 (100%)  -2  -  85/111 (77%)  -  -  ND1, not detected -2, not tested.  72  Table 2.3 Levels and prevalence of indicator bacteria recovered from in-field leafy vegetables collected from conventional and conventional and organic production systems in 2012 (p<0.05; comparison of E. coli and coliform prevalence using Χ2 goodness-offit; comparisons for ACCs using Tukey-Kramer; comparisons for E. coli and coliform counts using Wilcoxon test).  Organic  ACCs  Coliforms E. coli Enterococci  Conventional  Prevalence (% positive)  Range (log10 CFU/g)  Mean (log10 CFU/g)  Prevalence (% positive)  Range (log10 CFU/g)  Mean (log10 CFU/g)  NA1  4.1 – 7.2  5.6±0.04  NA  3 – 6.6  4.4±0.05  107/244 (44%)  ND2 – 4.7  1.5±0.08  80/240 (33%)  ND – 4.5  1.2±0.06  18/244 (7%)  ND – 1.6  0.7±0.005  2/238 (0.84%)  ND – 1  0.7±0.001  184/204 (92%)  -3  -  76/240 (32%)  -  -  NA1, not applicable. ND2, not detected. -3, not tested.  73  Table 2.4 Levels and prevalence of indicator bacteria recovered from in-field leafy vegetables collected from conventional and conventional and organic production systems in 2012 (p<0.05; comparison of E. coli and coliform prevalence using Χ2 goodness-offit; comparisons for ACCs using Tukey-Kramer; comparisons for E. coli and coliform counts using Wilcoxon test). Production systems  Conventional  Organic  Commodity  E. coli prevalence (% positive)  Green leaf lettuce  E. coli Mean  Coliforms Mean  ACCs Mean  (log CFU/g)  Coliforms prevalence (% positive)  (log10 CFU/g)  (log10 CFU/g)  1/95 (1%)  0.7 ± 0.002  28/95 (30%)  1.1 ± 0.1  4.3 ± 0.08  Red leaf lettuce  0/45 (0%)  1.2 ± 0.003  16/45 (36%)  1.4 ± 0.1  5.3 ± 0.1  Romaine lettuce  1/100 (1%)  0.7 ± 0.002  34/100 (34%)  1.2 ± 0.1  4.4 ± 0.08  Green leaf lettuce  6/87 (7%)  0.7 ± 0.01  50/87 (57%)  1.6 ± 0.1  5.5 ±0.07  Red leaf lettuce  6/92 (7%)  0.7 ± 0.01  32/92 (35%)  1.5 ± 0.1  5.7 ± 0.06  Romaine lettuce  6/65 (9%)  0.7 ± 0.1  23/65 (35%)  1.5 ± 0.1  5.7 ± 0.08  74  Table 2.5 Summary of phylogenetic grouping data of E. coli isolates recovered from in-field leafy vegetables collected from conventional and organic production systems in 2011 and 2012 (p<0.05; Χ2 goodness-of-fit). Year  Production systems  Phylogenetic groups A  2011  2012  B1  B2  D  Conventional  -1  -  -  -  Organic  1/5 (20%)  3/5 (60%)  1/5 (20%)  0/5 (0%)  Conventional  1/3 (33%)  1/3 (33%)  1/3 (33%)  0/3 (0%)  Organic  7/51 (14%)  44/51 (86%)  0/51 (0%)  0/51 (0%)  -1, no E. coli was recovered from conventional leafy vegetable samples in 2011.  75  Table 2.6 Levels and prevalence of indicator bacteria recovered from leafy vegetables collected from conventional and organic, conventional production systems and BC Farmers’ Markets in 2012 (p<0.05; comparison of E. coli and coliform prevalence using Χ2 goodness-of-fit; comparisons for ACCs using Tukey-Kramer; comparisons for E. coli and coliform counts using Wilcoxon test). Counts and prevalence with different letters are significantly different. Commodity  E. coli prevalence (% positive)  Coliforms prevalence (% positive)  Coliforms Mean  ACCs Mean  (log10 CFU/g)  (log10 CFU/g)  2/238 (0.84%)a  80/240 (33%)a  1.2±0.06a  4.4±0.04a  Organic  18/244 (7%)b  107/244 (44%)b  1.5 ± 0.1b  5.6±0.05b  BC farmers’ markets  15/78 (19%)c  59/78 (76%)c  2.1±0.1c  6.3±0.09c  Conventional  76  Figure 2.1 Sampling scheme for in-field leafy vegetables.  77  6"  *"  Leafy"greens"from"an"organic" produc?on"system"  5" Leafy"greens"from"a"conven?onal" produc?on"system"  log$CFU/g$  4"  3"  2"  1"  0" ACC"  "coliforms"  "E."coli""  Figure 2.2 Microbiological data describing in-field leafy vegetables quality in the conventional and organic production systems (*Student t-test, significant at p<0.05). 78  8" 7"  log$CFU/g$  6" 5"  *"  4" ACC"  3"  coliform" 2" 1" 0"  Samlping$date$  Figure 2.3 Microbiological data describing in-field leafy vegetable quality collected from an organic production system throughout the 2012 growing season (* p<0.05; comparisons for ACCs using Tukey-Kramer; comparisons for coliform counts using Wilcoxon test).  79  6" 5"  log10$CFU/g$  4" *" 3" ACC" 2"  coliform"  1" 0"  Samlping$date$  Figure 2.4 Microbiological data describing in-field leafy vegetable quality collected from a conventional production system throughout the 2012 growing season (* p<0.05; comparisons for ACCs using Tukey-Kramer; comparisons for coliform counts using Wilcoxon test).  80  7"  """""""*"  6"  Leafy"greens"collected"Loca?on"1" Leafy"greens"collected"Loca?on"3"  5"  Log$CFU/g$  Leafy"greens"collected"Loca?on"4" 4"  3" *" 2"  1"  0" ACC"  Coliforms"  Figure 2.5 Microbiological data describing in-field leafy vegetable quality collected from three different locations within an organic production system (* p<0.05; comparisons for ACCs using Tukey-Kramer; comparisons for coliform counts using Wilcoxon test).  81  5"  *"  4.5" 4"  Leafy"greens"collected"Loca?on"2"  log$CFU/g$ $  3.5"  Leafy"greens"collected"Loca?on"3"  3"  Leafy"greens"collected"Loca?on"4"  2.5" 2" 1.5" *"  1" 0.5" 0" ACC"  "Coliforms"  Figure 2.6 Microbiological data describing in-field leafy vegetable quality collected from three different locations within a conventional production system (* p<0.05; comparisons for ACCs using Tukey-Kramer; comparisons coliform counts using Wilcoxon test).  82  7" 6"  A"  AB"  AB"  B"  AB"  log$CFU/g$  5" 4" ACC"  3"  coliform" C" C"  2"  C" C" D"  1" 0" 0"  7" 14" 21" Plant$maturity$(measured$as$days$being$in$the$field)$  27"  Figure 2.7 Microbiological data describing in-field leafy vegetable quality collected at different levels of plant maturity; sample collected from an organic production system (p<0.05; comparisons for ACCs using TukeyKramer; comparisons for coliform counts using Wilcoxon test). Counts with differing letters are significantly different. 83  6" 5"  A"  A"  A" B"  AB"  AB"  log$CFU/g$  4" 3"  ACC" coliform"  2" 1" 0" 0"  7" 14" 21" 27" Plant$maturity$(measured$as$days$being$in$the$field)$  34"  Figure 2.8 Microbiological data describing in-field leafy vegetable quality collected at different levels of plant maturity; sample collected from a conventional system (p<0.05; comparisons for ACCs using Tukey-Kramer; comparisons for coliform counts using Wilcoxon test). Counts with differing letters are significantly different. 84  100%" 90%" 80%" 70%" 60%" 50%" 40%"  Resistant" Intermediate" Suscep?ble"  30%" 20%" 10%" 0%"  Figure 2.9 Percent of E. coli (n=55 isolates from 18 in-field leafy vegetable samples) sensitive, intermediately resistant or resistant to various antimicrobial agents. 85  Chapter 3: Identification of On-Farm Bacterial Reservoirs and Contamination Routes for In-Field Leafy Vegetables, Using BOX-PCR  3.1  Introduction In Chapter 2, two production systems located in the Lower Mainland region of BC were  evaluated microbiologically to determine levels and prevalence of indicator bacteria present on in-field leafy vegetables. The recovery of low levels of E. coli suggests that the microbiological quality of sampled leafy vegetables was acceptable. However, random and sporadic E. coli dissemination events may have occurred at pre-harvest. Although contamination of produce may occur at any point along the food continuum, the most significant risks are thought to occur at the farm production level with soil, irrigation water, harvesting equipment, and personnel being identified as possible sources of pathogenic microorganisms, such as E. coli O157:H7 and Salmonella (Beuchat, 2002; USDA, 2008). Enteric pathogens can subsequently be transmitted from on-farm reservoirs to in-field leafy vegetables (Beuchat, 2002; USDA, 2008). In laboratory settings, artificial transmission of foodborne pathogens from these proposed environmental sources to leafy vegetables has been demonstrated (Shuval et al., 1997; Blumenthal et al., 2000; Barak et al., 2002; Charkowski et al., 2002; Natvig et al., 2002; Warriner et al., 2003; Jablasone et al., 2005; Stine et al., 2005b; Habteselassie et al., 2010). However, there exists a paucity of data confirming these proposed routes of contamination under natural conditions (Park et al., 2012). Consequently, currently implemented produce intervention strategies that aim to minimize the contamination of fresh produce may be limited in their effectiveness. 86  The objective of the experiments described in this chapter is to examine E. coli transmission dynamics on independently owned/operated commercial farms in BC. Specifically, microbiological data were used to identify on-farm microbiological reservoirs, and molecular typing data were employed to examine whether related E. coli could be recovered from unrelated sources present in each production system. 3.2  Materials and Methods  3.2.1 3.2.1.1  Sample collection In-field leafy vegetable samples Two independent farms, including a conventional and organic production system, located  in the Lower Mainland region of BC were microbiologically assessed as described in Chapter 2.2.1. 3.2.1.2  Environmental samples Environmental samples including compost, hand swabs, irrigation water, and soil were  collected during each sampling trip. Water samples were collected from irrigation sources and overhead sprinklers, one sample per source during each sampling trip. Samples were collected using sterile 250 ml plastic bottles (provided by Maxxam Analytics Food Microbiology Lab, Burnaby, BC). Prior to sampling, the exterior of sampling bottles and sampling equipment were disinfected with 70% ethanol. When collecting samples from the irrigation water reservoir, a golf ball retriever was used to obtain water samples from 2 meters beneath the water’s surface. Bottles were then sealed and transported in refrigerated coolers. One hundred grams of soil from random surface locations of each sampled field were collected and transferred aseptically into sterile Nasco Easy-to-Close Whirl-Pak sample bags. A shovel was used to dig through compost in the compost shed to obtain moist, subsurface compost samples. Approximately 100 grams of 87  compost were collected from each of two compost sheds per sampling trip. Hand swabs were collected using the 3MTM Sponge-Stick. At each visit, three workers who were farming in the field were randomly selected and swabs from their dominant hands were obtained. Samples were transported in refrigerated coolers and were processed within 24 hours of collection. 3.2.1.3  Survival of Escherichia coli during overhead irrigation To evaluate the survival of E. coli during overhead irrigation, an irrigation water  experiment was conducted at the organic production system on Aug 7th and repeated on Sept 19th, 2012. Five petri plates (100 mm x 15 mm, surface area 78.5 cm2) were placed in a straight line away from the sprinkler head, and were separated with equal distance three feet away from each other (Figure 3.1). Five sprinkler heads were randomly selected and included in each of the irrigation experiments. Irrigation water was collected in petri plates following a 20 min irrigation process, which was the normal duration of irrigation for this production system. Samples were then transferred into a sterile 250 ml bottles and sealed for transport. Collected irrigation water was tested for the presence of generic E. coli, as described in section 2.2.2.2. The volume of irrigation water collected during a 20 min irrigation process was estimated using sterile serological pipets. 3.2.2 3.2.2.1  Microbiological analyses Enumeration of aerobic microorganisms, generic Escherichia coli, and coliforms The enumeration of aerobic microorganisms, coliforms, and generic E. coli on leafy  vegetable samples were determined as described in section 2.2.2.1. Levels of coliforms and E. coli in 100 ml irrigation water were determined following a standard coliform membrane filter procedure (i.e. SM 9222B/G method; Anonymous, 1999c). Coliform and E. coli populations in 88  compost and soil were estimated using the most probable number (MPN) method (i.e. MFHPB19; Health Canada, 2002). Coliform and E. coli populations on hands were determined using 3M Petri-Films (MFHPC-34; Health Canada, 2012). Analyses were conducted by Maxxam Analytics Food Microbiology Lab (4606 Canada Way, Burnaby, BC). 3.2.2.2  Detection of generic Escherichia coli Generic E. coli were detected in leafy vegetable samples and environmental samples  collected in 2012 as described in section 2.2.2.2. 3.2.2.3  Phylogenetic typing of Escherichia coli isolates Phylogenetic typing of E. coli was conducted as described in section 2.2.2.3.  3.2.2.4  Virulence typing of Escherichia coli isolates Virulence typing of E. coli was conducted as described in section 2.2.2.4.  3.2.2.5  Genotypic characterization of Escherichia coli isolates Rep-PCR DNA fingerprinting using the BOX A1R primer was employed to characterize  recovered E. coli isolates. Template DNA was obtained using a Qiagen DNeasy Blood & Tissue Kit (Qiagen, USA) as recommended by the manufacturer. BOX-PCR was performed as described  by  Dombek  et  al.  (2000)  using  BOX  A1R  primer  (5’-  CTACGGCAAGGCGACGCTGACG-3’). DNA (5μl) from each isolate was amplified in 25μl reaction mixtures containing 12.5μl Multiplex PCR Master Mix (Qiagen, USA), 1.4 μM BOX A1R primer, 2.5 Q-solution (Qiagen, USA). PCR was cycled as follows: 95°C for 2 minutes, followed by 35 cycles consisting of 94°C for 3 seconds, 92°C for 30 seconds, 50°C for 1 minute and 65°C for 8 minutes, with a final extension step at 65°C for 8 minutes.  89  3.2.2.6  BOX-PCR data analysis Banding patterns obtained following BOX-PCR were digitalized using the Gel DocTM  XR+ System (Bio-Rad Laboratories, Inc., Philadelphia, US) and gel images analyzed using GelCompar II (Applied Maths, Texas, USA). Strain similarity was determined using the Pearson coefficient and a cut-off level set at 85%. Dendrograms were constructed using the UPGMA grouping method. 3.2.2.7  Statistical analyses Data analyses were conducted using JMP version 10 statistical software (SAS Institute,  Inc, NC, USA). Prior to analyses of microbiological counts, a quantile plot was used to assess the normality of data distribution. When examining whether irrigation water quality had an impact on ACCs on in-field leafy vegetables, the mean ACC of in-field leafy vegetable samples irrigated with municipal water was compared with samples irrigated with ditch water using the Tukey-Kramer test. When examining the influence of irrigation water quality on coliform counts, the mean coliform count of in-field leafy vegetable samples irrigated with municipal water was compared with samples irrigated with ditch water using the Wilcoxon test. When examining whether irrigation water quality impacted the prevalence of coliforms and E. coli, the Fisher’s exact test was used. For all analyses, differences were considered significant if p<0.05. When populations were lower than the limit of detection afforded by the plating assay (i.e. 10 CFU/g), a halfway value between zero and the detection limit (i.e. 5 CFU/g) was assigned to permit statistical analyses.  90  3.3 3.3.1  Results Sample collection A total of 129 environmental samples (e.g., compost, soil, irrigation water, hand swabs)  were collected and analyzed in 2011 (Table 3.1). In 2012, 187 environmental samples were collected and analyzed (Table 3.1). 3.3.2  On-farm Escherichia coli reservoirs The levels and prevalence E. coli in samples collected from the environment are  presented in Table 3.2. A number of E. coli reservoirs were identified at the farm level, including irrigation water, soil, compost and worker hands. Of all environmental sources assessed, E. coli was recovered at the highest frequency from irrigation water. In the organic production system, E. coli was recovered from the irrigation water reservoir (27%, n = 15), sprinkler (40%, n = 35), soil (58%, n = 19), hand swabs (4%, n = 27) and compost (6%, n = 16) samples (Table 3.2). In the conventional production system, E. coli was only detected in ditch water (100%, n = 10) and soil (12%, n = 25) (Table 3.2). Two water sources were used to irrigate leafy vegetables in the conventional production system. Escherichia coli were recovered from all ditch water samples, whereas no E. coli were recovered from municipal water samples. In addition, E. coli was detected in three of 25 (12%) soil samples obtained from the conventional production system, two of which were collected from an area of the field irrigated with municipal water and one from an area of the field irrigated with ditch water. Interestingly, E. coli was not detected on worker hands. A total of 117 E. coli isolates were recovered from 80 environmental samples and categorized based on their phylogenetic profile. The majority of recovered E. coli belonged to phylogenetic group B1 (Table 3.3). In both production systems, the phylogenetic composition of 91  E. coli was most diverse in irrigation water with all four phylogenetic groups (i.e. A, B1, B2 and D) recovered. However, the majority of E. coli recovered from water samples collected from overhead sprinklers were predominantly from phylogenetic group B1. Similarly, the majority of E. coli recovered from soil and compost also belonged to phylogenetic group B1. In contrast, E. coli isolates that belong to phylogenetic group B1 and B2 were not recovered from human hands in the organic production system (Table 3.3). Escherichia coli isolates recovered from hand swabs were from phylogenetic group A (65%) and D (35%), though no phylogenetic group D strains were recovered from in-field leafy vegetable samples. 3.3.3  Bacterial transmission dynamics To determine if recovered E. coli isolates were being disseminated in the farm  environment (i.e. from a reservoir to in-field plants), BOX-PCR typing was used to assess the relatedness of recovered E. coli. Specifically, DNA fingerprints of E. coli isolates recovered from environmental sources (n = 29 environmental samples) and leafy vegetable samples (n = 27 leafy vegetable samples) were generated. Strong genetic variability was observed among strains with 88 unrelated strains identified from 96 unique isolates (Appendix A). However, identical BOX-PCR patterns were observed for two pairs of E. coli isolates recovered from irrigation water and in-field plants in the organic production system, demonstrating dissemination from the reservoir to the field. Similarly, in the organic production system, identical banding patterns revealed for isolates recovered from compost and in-field plants confirm compost as a potential disseminator of enteric organisms. Furthermore, identical banding patterns for isolates recovered from soil and plants suggest that soil can disseminate E. coli to in-field plants. In contrast, all E. coli recovered from the conventional production system were unrelated.  92  3.3.4  Irrigation water quality and its impact on microbiological profiles of leafy  vegetable samples To determine whether irrigation water quality was associated with the levels of microbiological indicators within a given production system, the microbiological counts (i.e. ACCs and coliform counts) of in-field leafy vegetables were compared to counts observed in respective irrigation water sources (Figure 3.2). Higher ACCs and coliform counts were recovered from samples that were irrigated with ditch water compared to city water. To assess the relationship between E. coli prevalence on leafy vegetable samples and irrigation water quality, the Fisher’s exact test was used. E. coli was detected in one of 150 (0.6%) in-field leafy vegetable samples that were irrigated with city water, whilst one of 90 (1%) ditch water irrigated samples showed the presence of E. coli. Correspondingly, poor quality irrigation water quality was not correlated with elevated E. coli prevalence. In both production systems, similar E. coli counts were observed among samples collected from the irrigation water reservoir (i.e. ditch water reservoir and well reservoir) and overhead sprinklers, suggesting that E. coli can withstand the physical stress imposed by the spraying action of the overhead sprinklers. The average volume of irrigation water collected in petri plates during a 20 min irrigation cycle was 11.1 ± 0.7 ml/78.5 cm2. 3.4  Discussion Fresh produce has been identified as a significant vehicle for the transmission of  foodborne pathogens (Sivapalasingam et al., 2004; McGlynn, et al., 2009; Painter et al., 2013). Although bacterial contamination of produce may occur at any point along the food continuum, the most significant risks are thought to occur at the farm production level (Beuchat, 2002; USDA, 2008). Bacterial transmission of enteric bacteria from environmental sources (e.g., 93  irrigation water, compost, soil, and human hands) has been demonstrated in controlled laboratory settings (Shuval et al., 1997; Blumenthal et al., 2000; Barak et al., 2002; Charkowski et al., 2002; Natvig et al., 2002; Warriner et al., 2003; Jablasone et al., 2005; Stine et al., 2005b; Habtestelassie et al., 2010). However, observational studies assessing microbiological risk factors associated with produce contamination in the natural environment are lacking (Park et al., 2012). To this end, this study examined bacterial transmission dynamics at the farm level. 3.4.1  Bacterial reservoirs As discussed in Chapter 2, E. coli was infrequently recovered and low E. coli counts were  observed on in-field leafy vegetable samples, regardless of production system. However, a number of E. coli reservoirs were identified at the farm level, including irrigation water, soil, compost, and hands. The prevalence of E. coli in irrigation water samples varied significantly with irrigation water source. Escherichia coli was detected most frequently in samples obtained from ditch water (100%), followed by well water (38%) and was not detected in potable municipal water (0%). Similarly, Duffy et al. (2005) noted that E. coli prevalence differed among the types of irrigation water sources. They reported that E. coli was recovered more frequently in samples obtained from wells (100%), followed by furrows (75%), canals (50%), and rivers (30%). In addition to the types of irrigation water sources, other factors such as regional cattle density, weather variables, and geographical characteristics can influence the prevalence of enteric bacteria in surface water (Michel et al., 1999; Johnson et al., 2003). Prevalence of E. coli O157:H7 and Salmonella in the surface water of southern Alberta was 0.9% (n=1483) and 6.2% (n=1429), respectively (Johnson et al., 2003). Moreover, E. coli O157:H7 and Salmonella was recovered from 3% and 20% surface water samples collected from Ontario, respectively (Public Health Agency of Canada, 2011). Michel et al. (1999) demonstrated that the cattle density was 94  positively correlated with human verocytotoxin producing E. coli (VTEC) infections in Ontario. Cattle are recognized as the primary reservoir for E. coli O157:H7 (Dean-Nystrom et al., 1999). Cattle feces or runoff from cattle pastures can contaminate irrigation water, which subsequently may come into contact with edible portions of fresh produce (Jay et al., 2007; Cooley et al., 2007). The absence of cattle farms within a 25 km radius from the two farms in this present study may explain the low E. coli counts in water samples. The mean E. coli count in well and ditch water samples was 0.7 ± 0.4 and 1.6 ± 0.1 log10 CFU/100 ml, respectively. In contrast, Duffy et al. (2005) noted the mean E. coli count for water samples, including all sources of irrigation water was 40 log10 CFU/100 ml. A limitation of this study was the exclusion of pathogen detection, specifically E. coli O157:H7 and Salmonella. In this present study, generic E. coli were used as a proxy indictor for possible enteric pathogen presence, survival, and transmission. Geldreich and Bordner (1971) found that when 100 ml of irrigation water contained more than 1000 CFU of fecal coliforms, Salmonella was recovered in all samples. High coliform counts were recovered from ditch and well water with a mean level of 3.6 and 3.9 log10CFU/100 ml, respectively. These observations raise concerns about the possible presence of Salmonella in irrigation water, though Salmonella detection was not included in the present study. Furthermore, to evaluate the potential health and safety significance of recovered E. coli, a PCR-based assay was used to detect the presence of virulence factors. While this strategy did not directly assess the presence of VTEC, it did reveal that none of the recovered isolates were VTEC. The organic production system used a mixture of commercially available composted cattle and poultry manure to fertilize soil. Cattle and poultry manure can harbor foodborne pathogens, such as E. coli O157:H7 and Salmonella (Kearney et al., 1993; Wang et al., 1996). In 95  Ontario, the prevalence of E. coli O157:H7 in cattle manure was 13% and 3% in 2010 and 2011, respectively (Public Health Agency of Canada, 2011). The same survey also reported the prevalence of Salmonella in poultry manure was 63% and 61% in 2010 and 2011, respectively. To minimize transmission of enteric pathogens from compost to produce, the USDA (2000) recommends a minimum of 120 days lapse between the point of raw manure application and harvest of organic crops. The surveyed organic production system in the present study let the purchased compost sit for a duration of more than 6 months prior to incorporating compost into soil, which satisfies the USDA recommendation. Studies have demonstrated that E. coli could be used as a reliable indicator organism for the potential presence of enteric bacteria in compost (Lau and Ingham, 2001; Natvig et al., 2002). Escherichia coli was seldom detected in compost samples (8%, n=26); indicating that the compost had been properly treated. Consequently, compost was not a frequent source of E. coli at the sampled organic production system. Although E. coli was infrequently detected in compost samples collected from the organic production system, E. coli was recovered from 50% of tested soil samples (Table 3.2). In general, soil is not considered an important source of enteric pathogens (De Roever, 1998). However, if foodborne pathogens originated from sources such as untreated compost, feces from wild animals and contaminated irrigation water, they may survive, persist, replicate and be disseminated via soil (Watts and Wall, 1952; Bergner-Rabinowitz, 1956; Rice et al., 1995; Beuchat, 1999; Hilborn et al., 1999; Gagliardi and Karns, 2000). The phylogenetic composition of E. coli isolates recovered from soil at the organic production system, resembled E. coli recovered from irrigation water at the sprinkler head, suggesting that E. coli were disseminated from irrigation water to the field. Escherichia coli was detected in three out of 25 soil samples  96  (12%) from the conventional production system. The phylogenetic profiles of these E. coli isolates were unique, with no matches to any other environmental reservoirs. Escherichia coli was not detected on employee gloves or hands from the conventional production system (Table 3.2). In contrast, E. coli was recovered from hands of employees working at the organic production system (Table 3.2). In 2011, E. coli was detected from four of 27 (15%) hand swabs and in one of 27 (4%) swabs in 2012. Escherichia coli counts ranged from <10 to 60 CFU/hand. The phylogenetic profile of E. coli recovered from hands differed from the profiles of E. coli recovered from other environmental sources (Table 3.3). Escherichia coli recovered from hand swabs were from phylogenetic group A (65%) and D (35%). In contrast, the majority of E. coli recovered from other environmental samples belonged to phylogenetic group B1. This difference indicates that the E. coli recovered from employee hands may have been of human origin, and may be indicative of poor employee hygiene practices. It is well established that good hygiene practices are essential in limiting the levels and prevalence of E. coli present on hands. Because transplanting and harvesting of leafy vegetables involves handplant contact, enteric bacteria can be transferred to the plant during this handling (Kaferstein, 1976; Duffy et al., 2005). It is noteworthy that similar to the observations made on the phylogenetic profiles of E. coli recovered from in-field leafy vegetable samples, the majority of E. coli strains recovered from the environmental samples belonged to phylogenetic group B1. Bergholz et al. (2011) noted that E. coli strains from non-host environments such as rivers and soil have a different phylogenetic composition than isolates from intestinal environments with a higher prevalence of B1. This observation suggests indirectly that the fitness of E. coli in natural environments vary  97  among phylogenetic groups, and that B1 isolates were the most adaptable to non-intestinal environments. Further research is recommended to confirm this hypothesis. 3.4.2  Bacterial transmission dynamics In order to identify the transmission dynamics of E. coli at the farm level, BOX-PCR was  used to determine the genetic relatedness of E. coli isolates recovered from the two farm systems. Strong genetic variability was observed among strains with 88 of 96 (92%) possessing unique fingerprints. However, BOX-PCR data revealed identical fingerprints for E. coli recovered from irrigation water, compost or soil, and in-field plants, suggesting possible bacterial transmission routes (Figure 3.3). Minimizing the transfer of enteric bacteria from the farm environment (i.e. compost, soil, and irrigation water) to in-field plants is recognized as a fundamental step in producing safe leafy vegetables. 3.4.2.1  Irrigation water and its impact on microbiological quality of in-field leafy  vegetables As discussed previously, irrigation water is generally recognized as the most significant concern to produce safety (Park et al., 2012). Epidemiological and risk assessment research determined the existence of food safety risks associated with the consumption of fresh produce following irrigation with poor quality water (Shuval et al., 1997; Blumenthal et al., 2000; Stine et al., 2005a; Habtestelassie et al., 2010). In BC, it has been recommended that there should be less than 1000 CFU of coliforms and no more than 77 CFU of E. coli per 100 ml of irrigation water (Anonymous, 1988). Furthermore, when the levels of coliforms or E. coli exceed recommended levels, producers should cease irrigating with it 14 days prior to harvest (Anonymous, 1988). The data from the present study suggest that when 100 ml of irrigation water contains less than 100 CFU of E. coli and when the duration between the last irrigation application and harvesting is no 98  less than 14 days, the recovery of E. coli on in-field leafy vegetables is rare. The presence of E. coli in irrigation water did not correspond with the detection of E. coli on in-field leafy vegetable samples. One half of the conventional production system was irrigated with potable municipal water and the other half with ditch water. No E. coli or coliforms were recovered from the municipal water. However, E. coli was consistently recovered from ditch water samples, with E. coli counts ranging from 1.1 to 2 log10 CFU/100 ml. To determine whether irrigation water quality was associated with E. coli prevalence on leafy vegetables, E. coli prevalence on in-field leafy vegetable samples was compared based on their sources of irrigation water (Figure 3.2). Irrigation water quality was not associated with prevalence E. coli on in-field leafy vegetable samples. Escherichia coli was detected in only a single (n = 150; 0.6%) sample irrigated with city water, and interestingly, only one (n = 90; 1%) sample irrigated with ditch water. Methods of irrigation water application and the duration between the last irrigation application and harvest, termed the minimum harvest interval, may influence the presence of foodborne pathogens on edible portions of fresh produce (National Advisory Committee on Microbiological Criteria for Foods, 1999; Solomon et al., 2002a). Overhead spray irrigation subjects leafy vegetables to direct contact with contaminated irrigation water, thereby increasing contamination risk (National Advisory Committee on Microbiological Criteria for Foods, 1999; Solomon et al., 2002a; Solomon et al., 2003). The two farms included in this study utilized overhead spray irrigation (Figure 3.1). On both sampled farms, E. coli were consistently recovered from irrigation water reservoirs and irrigation over-heads. Furthermore, similar E. coli counts were observed among samples collected from the irrigation water reservoir and overhead sprinklers, suggesting that E. coli can survive the physical stress posed by the overhead sprinklers’ spraying motion. However, E. coli were infrequently recovered and when detected, 99  were present at low levels on in-field leafy vegetable samples. The surface of leafy vegetables at the pre-harvest level has been suggested to be an inhospitable environment for enteric bacteria, as they are subjected to fluctuations in temperature, lack of nutrients, limited water availability, and UV light exposure (Lindow and Leveau, 2002; Aruscavage et al., 2006; Lindow and Brandl, 2003). During field trails, Barker-Reid et al. (2009) noted that harsh environmental conditions (i.e. warm summer temperature, limited rainfall, and intense solar exposure) led to a 2.2 log10 CFU/g reduction in E. coli counts on lettuce leaves over 5 days. The data from the present study, along with other studies, suggest that allowing sufficient time between irrigation and harvest is a critical step in minimizing risks relating to produce contamination (National Advisory Committee on Microbiological Criteria for Foods, 1999; Solomon et al., 2002a; Tyrrel et al., 2006). Stine et al. (2005a) reported that Salmonella contamination was minimized, if 14 days are allowed to elapse before the harvest of fresh produce. Furthermore, Hamilton et al. (2006) found that the annual risk of enteric virus infections was below the benchmark of ≤10-4 (i.e. one infection or less per 10,000 people per year), when the last wastewater irrigation event was no less than 14 days prior to harvest (Hamilton et al., 2006). According to the BC Ministry of Environment and Health Canada (Anonymous, 1988), 100 ml of irrigation water should contain less than 1000 CFU of coliforms and less than 77 CFU of E. coli. If coliform or E. coli counts in irrigation water exceed these levels, producers should cease using irrigation water for a minimum of 14 days prior to harvest. The data from this study support these recommendations. Organisms originated from irrigation water were unable to survive well on plant surfaces. Therefore, the current policy recommending cessation of irrigation water 14 days prior to harvest, when shown to contain microbiological loads higher than the recommended levels, appears appropriate.  100  The average volume of irrigation water collected in petri plates during the 20 min irrigation process was 11.1 ± 0.7 ml/78.5 cm2. The surface area of the petri dish approximated the size of leafy vegetable samples after being in the field for two weeks (Figure 3.1). Due to the similarity in surface area between a petri dish and an in-field leafy vegetable sample, each leaf head is estimated to receive approximately 11 ml of irrigation water during the 20 min irrigation process. However, the surface area of individual leafy vegetables varies with their maturity levels. Mature leafy vegetable samples would receive more irrigation water than younger samples. A head of lettuce, depending on its maturity level, is estimated to receive between 10 and 50 ml of irrigation water during a 20 min irrigation cycle. This observation raises concerns regarding the soundness of the experimental design of some laboratory studies aiming to examine the impact of irrigation water as a contamination source to leafy vegetables. For instance, when examining the persistence of E. coli O157:H7 on lettuce plants following spray irrigation with contaminated water, Solomon et al. (2003) watered each lettuce plant with 100 ml of contaminated water. Furthermore, to determine the persistence of generic E. coli on injured iceberg lettuce in the field, Barker-Reid et al. (2009) irrigated each lettuce sample with 1 liter of contaminated water with a watering can. Though the impact of irrigation water quality on the microbiological quality of leafy vegetables may be amplified, large qualities of inoculum may create a false association between irrigation water quality and the quality of leafy vegetables. When conducting studies in a laboratory setting, it is recommended that researchers should mimic realistic farming practices with respect to the volume of water used to irrigate their assessed samples. Moreover, observational studies are necessary to accurately understand microbiological risk factors associated with produce contamination in the natural environment.  101  3.4.2.2  Soil and its impact on microbiological quality of in-field leafy vegetables The soil at the two sampled production systems was classified as silty clay loam (BC  Ministry of Environment, 2009). BOX-PCR data revealed an association between soil and infield leafy vegetables at the organic production system. In general, soil is not considered an important source of human pathogens (De Roever, 1998). However, if foodborne pathogens from sources such as untreated compost, feces from wild animals, and contaminated irrigation water are disseminated in soil, enteric bacteria can survive, persist, replicate, and move in soil (Watts and Wall, 1952; Bergner-Rabinowitz, 1956; Rice et al., 1995; Beuchat, 1999; Hilborn et al., 1999; Gagliardi and Karns, 2000). Several studies reported that enteric pathogens such as E. coli O157:H7 and Salmonella had the capacity to persist in soil for time periods ranging from 46 to more than 200 days (Watts and Wall, 1952; Bergner-Rabinowitz, 1956; Bryan, 1977). Plant surfaces can be contaminated by direct contact with contaminated soil and by soil splashes from rainfall or irrigation. Natvig et al. (2002) demonstrated that E. coli and S. Typhimurium could be transferred from silty clay loam soil and loamy sandy soil to arugula via direct contact between soil and produce. To minimize bacterial transmission from soil to in-field produce, producers are recommended to limit the introduction of enteric bacteria from any source to soil. 3.4.2.3  Compost and its impact on microbiological quality of in-field leafy vegetables Enteric bacteria present in incompletely composted manure can be transferred to the  surface of leafy vegetables via manure-amended soil (Solomon et al., 2002b; Ingham et al., 2004; Islam et al., 2004a). In the present study, identical BOX-PCR patterns between E. coli recovered in compost and on in-field leafy vegetable samples was observed, demonstrating that compost may serve as a source and reservoir of enteric bacteria. Producers are encouraged to purchase compost from reliable companies. Producers are recommended to inquire about a Certificate of 102  Analysis (COA) to ensure that the compost has been properly treated and free of pathogens. The COA should include information regarding the source and composition of the compost, the duration for which it was treated, and the absence of pathogens that are relevant to produce. To ensure compost has been properly treated, producers may also collect a representative compost sample set and test for the presence of E. coli O157:H7 and Salmonella. 3.4.2.4  Hygiene practice Using BOX-PCR, E. coli isolates obtained from hands were determined to be different  from the isolates recovered from in-field leafy vegetable samples. However, hands can be a possible source of enteric bacteria, which may subsequently be transferred to in-field leafy vegetables through direct contact (Beuchat, 2002; USDA, 2008). Transplanting and harvesting of leafy vegetables involves extensive hand contact, and consequently hands can be a vehicle for the transmission of enteric bacteria to leafy vegetables (Duffy et al., 2005). Kaferstein (1976) found that E. coli was detected in 74% of commercially available parsley samples but only in 5% of aseptically harvested samples, indicating transfer of E. coli from employee hands to parsley. Although no direct contamination link between hands and in-field leafy vegetables was established in the present study, it is clear that good hygiene practices are essential in minimizing the risk of bacterial contamination. 3.4.3  Limitations A limitation of this study was the exclusion of pathogen detection. Generic E. coli were  used as a proxy indicator for foodborne pathogen presence, survival, and transmission. In future studies, however, the direct detection of relevant pathogens, such as E. coli O157:H7 and Salmonella spp. is required to better assess possible consumer risk.  103  When identifying the transmission dynamics of E. coli at the farm level, BOX-PCR was used to determine the genetic relatedness of E. coli isolates recovered from the two farm systems. Although pulsed-field gel electrophoresis (PFGE) analysis is widely considered to be the gold standard for molecular typing, in recent years, BOX-PCR has increasingly been used to genetically subtype E. coli isolates (Dombek, et al., 2000; Hahm et al., 2003; Stoeckel et al., 2004; Cesaris et al., 2007; Klima et al., 2010; Carlos et al., 2012). Cesaris et al. (2007) demonstrated that BOX-PCR possessed discrimination power comparable to PFGE. Even though discriminatory power is often considered to be the most important factor when evaluating molecular typing methods, the repeatability of a protocol is also important to consider. Klima et al. (2010) found that PFGE was highly repeatable while BOX-PCR exhibited lower repeatability. It should also be pointed out that PFGE has extremely high resolution, which may not be suitable for source tracking of enteric bacterial isolates (Lu et al., 2004; Duffy et al., 2005). When cost, protocol simplicity, and time sensitivity are important considerations, BOX-PCR is valuable to genetically subtype E. coli isolates (Carlos et al., 2012). 3.5  Conclusion In summary, this aspect of the research was aimed at identifying on-farm E. coli  reservoirs and examining E. coli transmission dynamics. Both unrelated E. coli strains and, more importantly, genetically similar strains were recovered in the farming environment, demonstrating that irrigation water, soil, and compost may serve as dissemination sources for microbes that ultimately can be transferred to in-field leafy vegetables. By minimizing transfer from these reservoirs to in-field plants, producers may be able to manage risks and increase the microbiological safety and long-term competitiveness of BC local fresh produce through reduced potential of recalls or foodborne disease. The results of this work support several 104  recommendations made by Canada Good Agriculture Practices (GAPs), such as those pertaining to irrigation water quality and compost quality.  105  Table 3.1 Summary of environmental samples collected from conventional and organic production systems in 2011 and 2012. Year  2011  2012  Production systems  Environmental samples  Total Number (n) Irrigation water (reservoir)  Irrigation water (sprinkler)  Hand swabs  Soil  Compost  Others  -  Conventional  42  12  1  19  10  -1  Organic  87  19  6  27  14  10  Conventional  60  9  2  22  25  -  Organic  127  25  40  27  19  16  Knife swab: Box swabs:  11 2  -  - 1 , no samples were collected.  106  Table 3.2 Prevalence and mean coliform and E. coli counts recovered from environmental samples collected from conventional and organic production systems in 2011 and 2012. Year 2011  Production systems  Production systems  Organic  Irrigation water (reservoir)  Coliforms Prevalence 11/19 (58%)  E. coli Mean  Prevalence  2.0 ±0.5  6/19 (32%)  log10 CFU/100 ml  Irrigation water (sprinkler)  6/6 (100%)  3.2±0.7  21/27 (78%)  1.4±0.1  4/6 (67%)  14/14 (100%)  2.1±0.3  4/27 (15%)  10/10 (100%)  1.5±0.3  0.8±0.05 log10 CFU/hand  6/14 (43%)  0.5±0.2  1/10 (10%)  log10 CFU/g <1 log10 CFU/g  log10 CFU/g  Compost  0.7±0.1 log10 CFU/100 ml  log10 CFU/hand  Soil  0.7±0.2 log10 CFU/100 ml  log10 CFU/100 ml  Hand swabs  Mean  log10 CFU/g  Others  Knife swab:  8/11 (73%)  1.6±0.3  Knife swab:  0/11 (0%)  <1 log10 CFU/swab  log10 CFU/swab Conventional  Irrigation water (reservoir) Ditch water Irrigation water (sprinkler) Ditch water Irrigation water (reservoir) City water Irrigation water (sprinkler) City water Hand swabs  12/12 (100%)  4.0 ±0.2  12/12 (100%)  log10 CFU/100 ml  6/6 (100%)  4.0 ±0.1  6/6100%)  log10 CFU/100 ml  0/1 (0%)  <1 <1  0/1 (0%)  1.3±0.2  <1 CFU/100 ml  0/1 (0%)  CFU/100 ml  15/19 (79%)  2.5 ±0.2 log10 CFU/100 ml  CFU/100 ml  0/1 (0%)  2.0±0.2 log10 CFU/100 ml  <1 CFU/100 ml  0/19 (0%)  <1 log10 CFU/swab  0/10 (0%)  <1 log10 CFU/g  log10 CFU/hand  Soil  9/10 (90%)  2.4±0.5 log10 CFU/g  107  Table 3.2. continued. Year 2012  Production systems  Production systems  Organic  Irrigation water (reservoir)  Coliforms Prevalence 13/15 (87%)  E. coli Mean  Prevalence  3.9±0.5  4/15 (27%)  log10 CFU/100 ml  Irrigation water (sprinkler)  19/24 (79%)  3.6 ± 0.3  11/27 (41%)  1.4±0.2  15/35 (40%)  19/19 (100%)  2.4±0.2  1/27 (4%)  7/16 (44%)  1.1±0.5  11/19 (58%)  Irrigation water (reservoir) Ditch water Irrigation water (sprinkler) Ditch water Irrigation water (reservoir) City water Irrigation water (sprinkler) City water Hand swabs  9/9 (100%)  3.6±0.2  1/16 (6%)  3.3  9/9 (100%)  <1  1/1 (100%)  <1  0/1 (0%)  1.4±0.2  0/1 (0%)  Others  19/25 (76%) Box swab 1:  0/2 (0%)  1.7±0.2 log10 CFU/g <1 CFU/cm2  <1 CFU/100 ml  0/24 (0%)  <1  3/25 (12%)  CFU/hand <1.8 CFU/g  log10 CFU/hand  Soil  <1 CFU/100 ml  CFU/100 ml  12/24 (50%)  1.6 log10 CFU/100 ml  CFU/100 ml  0/1 (0%)  1.6±0.1 log10 CFU/100 ml  log10 CFU/100 ml  0/1 (0%)  0.3±0.3 log10 CFU/g  log10 CFU/100 ml  1/1 (100%)  0.2±0.1 log10 CFU/g  log10 CFU/g Conventional  0.7 ±0.01 log10 CFU/hand  log10 CFU/g  Compost  0.6±0.6 log10 CFU/100 ml  log10 CFU/hand  Soil  0.7±0.4 log10 CFU/100 ml  log10 CFU/100 ml  Hand swabs  Mean  Box swab:  0/2 (0%)  <1 CFU/cm2  1  Box swab , the inner surface of packaging boxes.  108  Table 3.3 Summary of phylogenetic grouping data of E. coli isolates recovered from environmental samples collected from conventional and organic production systems in 2011 and 2012. Year 2011  Production systems  Production systems  Organic  Irrigation water (reservoir)  5/18 (28%)  5/18 (28%)  6/18 (33%)  2/18(11%)  Irrigation water (sprinkler) Hand swabs Soil Compost Others Irrigation water (reservoir) Ditch water Irrigation water (sprinkler) Ditch water Irrigation water (reservoir) City water Irrigation water (sprinkler) City water Hand swabs Soil Irrigation water (reservoir) Irrigation water (sprinkler) Hand swabs Soil Compost  0/4 (0%) 11/17 (65%) 0/7 (0%) -1 3/56 (5%)  4/4 (100%) 0/17 (0%) 5/7 (71%) 43/56 (77%)  0/4 (0%) 0/17 (0%) 0/7 (0%) 8/56 (14%)  0/4 (0%) 6/17 (35%) 2/7 (29%) 2/56 (4%)  -  -  -  -  -  -  -  -  -  -  -  -  0/11 (0%) 3/26 (12%) 0/1 (0%) 4/23 (17%) 0/3 (0%)  11/11 (100%) 22/26 (85%) 1/1 (100%) 19/23 (83%) 2/3 (67%)  0/11 (0%) 1/26 (3%) 0/1 (0%) 0/23 (0%) 0/3 (0%)  0/11 (0%) 0/26 (0%) 0/1 (0%) 0/23 (0%) 1/3 (33%)  Conventional  2012  Organic  A  Phylogenetic groups B1 B2  D  109  Table 3.3. continued. Year 2012  Production systems  Production systems  Conventional  Irrigation water (reservoir) Ditch water Irrigation water (sprinkler) Ditch water Irrigation water (reservoir) City water Irrigation water (sprinkler) City water Hand swabs Soil Others  A  Phylogenetic groups B1 B2  D  7/21 (33%)  11/21 (52%)  1/21 (5%)  2/21 (10%)  0/3 (0%)  3/3 (100%)  0/3 (0%)  0/3 (0%)  -  -  -  -  -  -  -  -  1/8 (13%)  7/8 (87%) -  0/8 (0%)  0/8 (0%) -  -  -  1  - , no E. coli was recovered.  110  Figure 3.1 Irrigation water experiment set up at the organic production system.  111  5"  *"  4.5" 4" Leafy"greens"irrigated"by"ditch" water"  log$CFU/g$  3.5"  Leafy"greens"irrigated"by"city" water"  3"  2.5" 2"  1.5" 1" 0.5" 0" ACC"  Coliforms"  Figure 3.2 Microbiological data describing in-field leafy vegetables irrigated with ditch or city water (* p<0.05; comparisons for ACCs were made using the Tukey-Kramer test; comparisons for coliform counts were made using the Wilcoxon test).  112  Figure 3.3 Identified transmission routes of E. coli identified by BOX-PCR molecular typing technique. Solid line indicates identical fingerprints for E. coli recovered from environmental samples and in-field plants, whereas dotted line indicates otherwise.  113  Figure 3.4 Examination of strain relatedness for E. coli recovered from an organic production system using molecular BOX PCR-typing. Similar DNA fingerprints were observed in between the E. coli isolates recovered from Romaine-1 location 1 and compost; and in between the E. coli isolates recovered from Red leaf-2 location 3 and soil location 3.  114  Chapter 4: Microbiological Survey of British Columbia-Grown Leafy Vegetables Purchased from Farmers’ Markets in British Columbia 4.1  Introduction The microbiological quality of leafy vegetables derived from two independent producers  was presented in Chapter 2. Considering the limited sample size, it was unclear if the data were truly indicative of the microbiological quality of leafy vegetables originating from unrelated BC production systems. An additional survey was therefore conducted to compare levels and prevalence of indicator bacteria present on leafy vegetables available at BC farmers’ markets to those obtained at the pre-harvest level. 4.2 4.2.1  Material and methods Sample collection During the summer of 2012, two samples of each available commodity (i.e. green leaf  lettuce, red leaf lettuce, and Romaine lettuce) were purchased from produce vendors in five Vancouver farmers’ markets (i.e. Kitsilano Farmers’ Market, Kerridale Village Farmers’ Market, Granville Island Farmers’ Market, Oak Street Farmers’ Market, and Main Street Station Farmers’ Market) in Vancouver, BC. One farmers’ market was visited per week from August 13th to September 16th 2012. Information regarding whether the leafy vegetables were grown in BC and whether or not it was organically grown was obtained from each vendor. Samples were collected in the state in which they were available for consumer purchase and were collected inside Nasco Easy-to-Close Whirl-Pak sterile sample bags to prevent post-purchase contamination.  115  Sample bags were marked on the exterior surface with produce type, producers, sample number, sample location, and date of collection. Samples were transported in refrigerated coolers containing ice packs and were processed within 24 hours of collection. 4.2.2 4.2.2.1  Microbiological analyses Enumeration of aerobic microorganisms, generic Escherichia coli, and coliforms The enumeration of aerobic microorganisms, coliforms, and generic E. coli on leafy  vegetable samples was determined as described in section 2.2.2.1. Enumeration was conducted by Maxxam Analytics Food Microbiology Lab (4606 Canada Way, Burnaby, BC). 4.2.2.2  Detection of generic Escherichia coli Generic E. coli were detected in leafy vegetable samples as described in section 2.2.2.2.  4.2.2.3  Phylogenetic typing of Escherichia coli isolates Phylogenetic typing of E. coli was conducted as described in section 2.2.2.3.  4.2.2.4  Virulence typing of Escherichia coli isolates Virulence typing of E. coli was conducted as described in section 2.2.2.4.  4.2.2.5  Statistical analyses Data analyses were conducted using JMP version 10 statistical software (SAS Institute,  Inc, NC, USA). Prior to analyses of microbiological counts, a quantile plot was used to assess normality of the data distribution. When examining differences in ACCs between in-field samples and samples from farmers’ market, the Tukey-Kramer test was used. When examining differences in coliform counts between in-field samples and samples from farmers’ market, the Wilcoxon test was used to analyze nonparametric data. Fisher’s exact test was used to compare the prevalence of coliforms and E. coli between in-field samples and samples from farmers’ market. Differences were considered significant if p<0.05. 116  When populations were lower than the limit of detection afforded by the plating assay (i.e. 10 CFU/g), a halfway value between zero and the detection limit (i.e. 5 CFU/g) was assigned to permit statistical analyses. 4.3  Results and Discussion Five farmers’ markets located in Vancouver, BC were included in this survey. In total, 78  leafy vegetable samples were collected and analyzed. There was a wide range in ACCs, ranging from 4.8 to 7.8 log10 CFU/g. The mean ACC was 6.3 log10 CFU/g. ACCs on leafy vegetable samples from farmers’ markets were significantly higher than on in-field samples (p<0.0001). It is possible that the additional time required for transportation and distribution may permit bacterial growth, leading to elevated ACCs in farmers’ market samples than in-field samples (Monaghan and Hutchison, 2010). Coliforms were recovered from 72% (n = 78) of samples. Coliform counts ranged from not detected to 5.7 log10 CFU/g, with a mean of 2.1 log10 CFU/g. Similar to ACCs, the coliform counts in leafy vegetable samples from BC farmers’ markets were higher than in-field samples (p<0.001), which may be explained by additional handling (Beuchat, 2002; USDA, 2008), temperature abuse during transportation (De Roever, 1999), and time required for transportation and distribution (Monaghan and Hutchison, 2010). Furthermore, the mean coliform count for leafy vegetable samples from BC Farmers’ Markets (2.1±0.1 log10 CFU/g) was 3 log10 CFU/g lower than samples collected from Washington, DC’s Farmers’ Markets (Thunberg et al., 2001). Consequently, it is crucial to establish BC-specific baseline data describing levels and prevalence of indicator bacteria present on fresh produce. Moreover, the observed difference among localities may due to variable post-harvest handling practices (e.g. rinsing leafy vegetables with potable water). 117  Nine samples (13%) showed the presence of E. coli. Escherichia coli counts ranged from undetected to 3 log10 CFU/g, with a mean of 0.8 log10 CFU/g. A higher E. coli prevalence was noted on leafy vegetables purchased at farmers’ market than in the field (p<0.0001). Furthermore, the observed E. coli prevalence on leafy vegetables retailed in BC farmers’ markets was lower compared to data from farmers’ markets in Alberta (23%) (Bohaychuk et al., 2009) but higher than data coming from Ontario (6.5% to 11.6%) (Arthur et al., 2007). A total of 34 E. coli isolates recovered from nine samples were subjected to phylogenetic typing. Of these E. coli strains, 80% belonged to phylogenetic group B1, 12% were from group D and the remaining 8% were from group A; no group B2 isolates were recovered. An interesting observation is while no group D E. coli were recovered from in-field samples, four (12%) E. coli group D isolates were recovered from farmers’ market leafy vegetable samples. Considering this group includes E. coli associated with humans and some pathogenic variants (Duriez et al., 2001; Johnson et al, 2001), it is plausible that these isolates were introduced by post-harvest and pre-retail handling, though this remains speculative. Although none of the recovered E. coli showed the presence of virulence genes, the recovery of group D E. coli from farmers’ market samples underscores the risk of pathogen contamination and contrasts the observations at the pre-harvest level. The observed differences between in-field and farmers’ market samples may be attributed to the additional time and handling required for transportation and distribution, or it could be explained by the variations of agriculture practices existing among independent producers. If the latter is true, the data on levels and prevalence of indicator bacteria (i.e. aerobic microorganisms, coliforms, and generic Escherichia coli) present in Chapter 2 are not indicative of leafy vegetables deriving from other unrelated BC farms. However, this is cannot be determined from the data presented herein. 118  4.4  Conclusion In summary, significantly higher ACCs and coliform counts were observed in leafy  vegetable samples purchased from BC farmers’ markets than at the pre-harvest level. The distribution of phylogenetic groups of E. coli recovered from market samples was different than in-field samples. Furthermore, E. coli prevalence of leafy vegetable samples obtained from the markets was higher than in-field samples. Further research is required to determine whether variable production practices on BC farms and/or post-harvest handling are responsible for the observed differences.  119  Chapter 5: Conclusions and Future Direction Fresh produce has increasingly been implicated as a vehicle for the transmission of foodborne pathogens (Sivapalasingam et al., 2004; McGlynn, et al., 2009; Painter et al., 2013). In an effort to assess risk factors involved in contamination of leafy vegetables at the farm level and to establish baseline data on levels and prevalence of indicator bacteria (i.e. aerobic microorganisms, coliforms, and generic E. coli) relevant to BC-grown leafy vegetables, a total number of 1,093 in-field leafy vegetable samples (i.e. green leaf lettuce, red leaf lettuce and romaine lettuce) and 316 environmental samples (i.e. compost, hand swabs, irrigation water, and soil) were collected from two produce production systems (conventional and organic) weekly between July-October for 2011 and 2012. The recovery of low levels and prevalence of E. coli on in-field leafy vegetable samples suggest that the microbiological quality was acceptable. When comparing data from the present study with observations from other studies, it is clear that significant differences exist among differing localities and this lead to rejection of the hypothesis that the levels and prevalence of indicator bacteria on in-field leafy vegetables grown in the Lower Mainland region of BC are similar to US reports. The variation observed between the present study and US studies indicates the importance of collecting regional-specific data. Common occurrence of phylogroup B1 E. coli on in-field leafy vegetable samples may limit its use as an indicator of fecal contamination. Random and sporadic E. coli dissemination events can occur at the pre-harvest level. Both unrelated and more importantly, genetically similar strains of E. coli within the farming environments were recovered, demonstrating that irrigation water, soil, and compost may serve as reservoirs for the dissemination of enteric microorganisms of concern to in-field leafy vegetables. Accordingly, the hypothesis that on-farm environmental sources serve as reservoirs 120  and dissemination sources of E. coli to in-field plants are accepted. By minimizing this transfer, producers can better manage risks and increase the microbiological quality and long-term competitiveness of BC local fresh produce through reduced potential of recalls or foodborne disease. This project verified several recommendations made by Canada Good Agriculture Practices (GAPs) regarding the usage/cessation of poor quality irrigation water and compost. Consequently, this study supports current Canada GAP recommendations regarding the production of fresh produce. No verotoxigenic E. coli were recovered from in-field plants or environmental sources. Furthermore, the prevalence of antimicrobial resistant E. coli was low. As such, the hypothesis that the farm environment is a reservoir of virulence and AMR genes in E. coli is rejected, though low levels of resistance to clinically relevant antimicrobial agents were observed. The sampling methods used in this study can be utilized in future studies with similar objectives. Furthermore, these procedures can also be adapted by local producers to proactively identify risk factors associated with the production of fresh produce at the farm level. This approach would help producers to identify and reduce potential for microbiological quality issues. 5.1  Limitations and Future Direction One of the limitations of this study was the exclusion of direct pathogen detection,  specifically E. coli O157:H7 and Salmonella. Generic E. coli were used as a proxy indicator for foodborne pathogen presence, survival, and transmission. In future studies, however, the detection of relevant pathogens is recommended to better assess possible consumer risk, though it is noteworthy that pathogen contamination in fresh produce remains low, making detection challenging. 121  Another limitation was that samples were collected from only two producers. Accordingly, it is possible that the data established in this study are not indicative of leafy vegetables deriving from other unrelated BC farms. In future studies, a larger number of independent producers should be included. In order to determine whether fresh produce may serve as a vehicle for the transmission of clinically relevant AMR, future studies should include screening for AMR in microorganisms that are relevant to produce safety. Future studies should include differential and selective agar plates containing clinically relevant antibiotics, which will increase the probability of recovering resistant bacteria.  122  References Ackers, M.L., Mahon, B.E., Leahy, E., Goode, B., Damrow, T., Hayes, P.S., 1998. An outbreak of Escherichia coli O157:H7 infections associated with leaf lettuce consumption. Journal of Infectious Diseases 177, 1588-1593. Ailes, E.C., Leon, J.S., Jaykus, L., Johnston, L.M., Clayton, H.A., Blanding, S., Kleinbaum, D.G., Backer, L.C., Moe, C.L., 2008. Microbiological concentrations on fresh produce are affected by postharvest processing, importation, and season. Journal of Food Protection 71, 2389-2397. Alam, M.J., Zurek, L., 2004. Association of Escherichia coli O157:H7 with houseflies on a cattle farm. Applied and Environmental Microbiology 70, 814-822. Allen, K.J., Kovacevic, J., Cancarevic, A., Wood, J., Xu, J., Gill, B., Allen, J., Mesak, L.R., 2013. Microbiological survey of imported produce available at retail across Canada. International Journal of Food Microbiology 162, 135-142. Andrew, W.H., Mislivec, P.B., Wilson, C.R., Bruce, V.R., Poloma, P.L., Gibson, M.R., Truchsess, W., Young, K., 1982. Microbial hazards associated with been sprouting. Journal of AOAC International 65, 241-248. Anonymous, 1973. Water quality criteria. Ecological Research Serves. US Environmental Protection Agency. EPA R3-73-033 Anonymous, 1988. Water quality criteria for microbiological indicators: overview report. British Columbia, Ministry of Water, Land, and Air Protection, Resource Quality Section, Water Management Branch, Ministry of Environment and Parks. Anonymous, 1991. Multistate outbreak of Salmonella Poona infections - United States and Canada, 1991. Morbidity and Mortality Weekly Report 40, 551. Anonymous, 1992. Guidelines for water reuse. US Environmental Protection Agency. EPA/624/R-92/004. Anonymous, 1997. Surface water quality objectives. Saskatchewan Environment. Anonymous, 1998. Guide to minimize microbial food safety hazards for fresh fruits and vegetables. US Department of Health and Human Services, Food and Drug Administration, Center for Food Safety and Applied Nutrition, Washington, D.C. Anonymous, 1999a. Canadian Council of Ministers of the Environment, Canadian water quality guidelines for the protection of agricultural water uses, Canadian environmental quality guidelines. CCME Publications, Winnipeg, Manitoba, pp. 2. Anonymous, 1999b. Surface water quality guidelines for use in Alberta. Alberta Environment, 123  Environmental Service, Environmental Science Division and Natural Resources Service, Water Management Division. ISBN 0-7785-0897-8 T/483 Anonymous, 1999c. SM9222 B/G standard total coliform membrane filter procedure. Retrieved 05/23, 2013, from http://www.umass.edu/tei/mwwp/acrobat/9222b.PDF. Anonymous, 2012. 1997 census of agriculture: 1998 farm and ranch irrigation survey. Retrieved 04/13, 2013, from http://www.agcensus.usda.gov/Publications/1997/Farm_and_Ranch_Irrigation_Survey/. Arthur, L., Jones, S., Fabri, M., Odumeru, J., 2007. Microbiological survey of selected Ontariogrown fresh fruits and vegetables. Journal of Food Protection 70, 2864-2867. Aruscavage, D., Lee, K., Miller, S., Lejeune, J.T., 2006. Interactions affecting the proliferation and control of human pathogens on edible plants. Journal of Food Science 71, 89-99. Aruscavage, D., Miller, S.A., Lewis-Ivey, M.L., Lee, K., LeJeune, J.T., 2008. Survival and dissemination of Escherichia coli O157:H7 on physically and biologically damaged lettuce plants. Journal of Food Protection 71, 2384-2388. AVA, Agri-Food & Veterinary Authority of Singapore, 2002. Food regulations, eleventh schedule, microbiological standard for food. Sale of Food Act 283, 56 (1). Avery, L.M., Williams, A.P., Killham, K., Jones, D.L., 2008. Survival of Escherichia coli O157:H7 in waters from lakes, rivers, puddles and animal drinking troughs. Science of the Total Environment 389, 378-385. Barker-Reid F., Harapas, D., Engleitner, S., Kreidl, S., Holmes, R., Faggian, R., 2009. Persistence of Escherichia coli on injured iceberg lettuce in the field, overhead irrigated with contaminated water. Journal of Food Protection 72, 458-464. Babic, I., Watada, A.E., Buta, J.G., 1997. Growth of Listeria monocytogenes restricted by native microorganism and other properties of fresh-cut spinach. Journal of Food Protection 60, 912-917. Barak, J.D., Whitehand, L.C., Charkowski, A.O., 2002. Differences in attachment of Salmonella enterica serovars and Escherichia coli O157:H7 to alfalfa sprouts. Applied and Environmental Microbiology 71, 5685-5691. BCMAL, 2006. B.C.'s food self-refliance - can B.C.'s farmers feed our growing population, Retrieved on 05/23, 2013, from http://www.agf.gov.bc.ca/resmgmt/Food_Self_Reliance/BCFoodSelfReliance_Report.pdf. BC Ministry of Environment, 2009. Soils landscapes of BC. Retrieved on 06/02, 2013, from http://www.env.gov.bc.ca/soils/documents/soilsmap_bc.pdf. Bell, K.S., Sebaihia, M., Pritchard, L., Holden, M.T.G., Hyman, L.J., Holeva, M.C., Thomson, 124  N.R., Bentley, S.D., Churcher, L.J.C., Mungall, K., Atkin, R., Bason, N., Brooks, K., Chillingworth, T., Clark, K., Doggett, J., Fraser, A., Hance, Z., Hauser, H., Jagels, K., Moule, S., Norbertczak, H., Ormond, D., Price, C., Quail, M.A., Sanders, M., Walker, D., Whitehead, S., Salmond, G.P.C., Birch, P.R.J., Parkhill, J., Toth, I.K., Haselkorn, R., 2004. Genome Sequence of the Enterobacterial phytopathogen erwinia carotovora subsp. atroseptica and characterization of virulence Factors. Proceedings of the National Academy of Sciences of the United States of America 101, 11105-11110. Berger, C.N., Sodha, S.V., Shaw, R.K., Griffin, P.M., Pink, D., Hand, P., Frankel, G., 2010. Fresh fruit and vegetables as vehicles for the transmission of human pathogens. Environmental Microbiology 12, 2385-2397. Bergholz, P.W., Noar, J.D., and Buckley, D.H., 2011. Environmental patterns are imposed on the population structure of Escherichia coli after fecal deposition. Applied and Environmental Microbiology 77, 211-219. Bergner-Rabinowitz, S., 1956. The survival of coliforms, Streptococcus faecalis and Salmonella tennessee in the soil and climate of Israel. Applied Microbiology 4, 101-106. Bernstein, N., Sela, S., Neder-Lavon, S., 2007. Assessment of contamination potential of lettuce by Salmonella enterica serovar Newport added to the plant-growing medium. Journal of Food Protection 70, 1717-1722. Beuchat, L.R., 1996. Pathogenic microorganism associated with fresh produce. Journal of Food Protection 59, 204-216. Beuchat, L.R., Ryu, J., 1997. Produce handling and processing practices. Emerging Infectious Diseases 3, 459-465. Beuchat, L.R., 1999. Survival of enterohemorrhagic Escherichia coli O157:H7 in bovine faeces applied to lettuce and the effectiveness of chlorinated water as a disinfectant. Journal of Food Protection 62, 845-849. Beuchat, L.R., 2002. Ecological factors influencing survival and growth of human pathogens on raw fruits and vegetables. Microbes and Infection 4, 413-423. Beuchat, L.R., 2006. Vectors and conditions for preharvest contamination of fruits and vegetables with pathogens capable of causing enteric diseases. British Food Journal 108, 3853. Bezanson, G., Delaquis, P., Bach, S., McKellar, R., Topp, E., Gill, A., Blais, B., Gilmour, M., 2012. Comparative examination of Escherichia coli O157:H7 survival on romaine lettuce and in soil at two independent experimental sites. Journal of Food Protection 75, 480-487. Bihn, E.A., Rangarajan, A., Suslow, T., Gravani, R.B., Pritts, M.P., Worobo, R., 2010. Good agricultural practices - an overview for growers and packers. Retrieved 03/31, 2013, from 125  http://www.gaps.cornell.edu/Educationalmaterials/GAPsCDPPTS/GAPs_An_overview_for_ growers_and_packers.pdf. Blumenthal, U.J., Mara, D.D., Peasey, A., Ruiz-Palacios, G., Stott, R., 2000. Guidelines for the microbiological quality of treated wastewater used in agriculture: recommendations for revising WHO standards. Bulletin of the World Health Organization 78, 1104-1116. Bohaychuk, V.M., Bradbury, R.W., Dimock, R., Fehr, M., Gensler, G.E., King, R.K., Rieve, R., Romer Barrios, P., 2009. A microbiological survey of selected Alberta-grown fresh produce from farmers' markets in Alberta, Canada. Journal of Food Protection 72, 415-420. Brandl, M.T., 2006. Fitness of human enteric pathogens on plants and implications for food safety. Annual Review of Phytopathology 16, 367-392. Brandl, M.T., Amundson, R., 2008. Leaf age as a risk factor in contamination of lettuce with Escherichia coli O157:H7 and Salmonella enterica. Applied and Environmental Microbiology 74, 2298-2306. Bryan, F.L., 1977. Diseases transmitted by foods contaminated by wastewater. Journal of Food Protection 40, 45-56. Burfield, T., 2003. U.S. in catch-up mode: Canadians consume more produce than Americans. Produce Merchandising 16, 1-3. Carlos, C., Pires, M.M., Stoppe, N.C., Hachich, E.M., Sato, M.I.Z., Gomes, T.A.T., Amaral, L.A., Ottoboni, L.M.M., 2010. Escherichia coli phylogenetic group determination and its application in the identification of the major animal source of fecal contamination. BMC Microbiology 10, 161. Carlos, C., Alexandrino, F., Stoppe, N.C., Sato, M.I.Z., Ottoboni, L.M.M., 2012. Use of Escherichia coli BOX-PCR fingerprints to identify sources of fecal contamination of water bodies in the state of Sao Paulo, Brazil. Journal of Environmental Management 93, 38-43. CCME, Canadian Council of Ministers of the Environment, 2005. Guideline for compost management. Retrieved 05/22, 2013, from http://www.ccme.ca/assets/pdf/compostgdlns_1340_e.pdf. CDC. Centers for Disease Control and Prevention, 2006. Ongoing multistate outbreak of Escherichia coli serotype O157:H7 infections associated with consumption of fresh spinach - United States. Morbidity and Mortality Weekly Report 55, 1045-1046. Centre for Food Safety, 2007. Microbiological guidelines for ready-to-eat food (Hong Kong). Retrieved 03/25, 2013, from http://blpd.dss.go.th/micro/ready.pdf. Cesaris, L., Gillespie, B.E., Srinivasan, V., Almeida, R.A., Zecconi, A., Oliver, S.P., 2007. Discriminating between strains of Escherichia coli using pulsed-field gel electrophoresis and 126  BOX-PCR. Foodborne Pathogens and Disease 4, 473-480. Chalmers, R.M., Aird, H., Bolton, F.J., 2000. Waterborne Escherichia coli O157:H7. Journal of Applied Microbiology 88, 124-132. Chandler, D.S., Craven, J.A., 1980. Relationship of soil moisture to survival of Escherichia coli and Salmonella Typhimurium in soils. Australian Journal of Agricultural Research 31, 547-555. Charkowski, A.O., Barak, J.D., Sarreal, C.Z., Mandrell, R.E., 2002. Differences in growth of Salmonella enterica and Escherichia coli O157:H7 on alfalfa sprouts. Applied and Environmental Microbiology 68, 3114-3120. Chase-Topping, M., Gally, D., Low, C., Matthews, L., Woolhouse, M., 2008. Super-shedding and the link between human infection and livestock carriage of Escherichia coli O157. Nature Reviews Microbiology 6, 904-912. CIPARS, Canadian Integrated Program for Antimicrobial Resistance Surveillance, 2007. Retrieved 05/23, 2013, from http://www.phac-aspc.gc.ca/cipars-picra/2007_7-eng.php#a_2. Cooley, M., Carychao, D., Crawford-Miksza, L., Jay, M.T., Myers, C., Rose, C., Keys, C., Farrar, J., Mandrell, R.E., 2007. Incidence and tracking of Escherichia coli O157:H7 in a major produce production region in California. The Public Library of Science 2, 1159. Coyne, M.S., 1999. Soil microbiology: an exploratory approach. Delmar Publishers, New York, 1999. Critzer, F.J., Doyle, M.P., 2010. Microbiological ecology of foodborne pathogens associated with produce. Current Opinion in Biotechnology 21, 125-130. Dean-Nystrom, E.A., Bosworth, B.T., Moon, H.W., 1999. Pathogenesis of Escherichia coli O157:H7 in weaned calves. Advances in Experimental Medicine and Biology 473, 173-177. De Roever, C., 1998. Microbiological safety evaluations and recommendations on fresh produce. Food Control 9, 321-347. Delaquis, P., Bach, S., Dinu, L.D., 2007. Behavior of Escherichia coli O157:H7 in leafy vegetables. Journal of Food Protection 70, 1966-1974. Department of Heath (South Africa), 2011. Guidelines for environmental health officers on the interpretation of microbiological analysis data of food. Retrieved 03/25, 2013, from http://www.doh.gov.za/docs/foodcontrol/trainingmanuals/2011/Guidelines%20for%20enviro nmental%20health%20officers%20on%20the%20interpretation%20of%20microbiological% 20analysis%20data%20of%20food.pdf. Dombek, P.E., Johnson, L.K., Zimmerley, S.T., Sadowsky, M.J., 2000. Use of repetitive DNA sequences and the PCR to differentiate Escherichia coli isolates from human and animal 127  sources. Applied and Environmental Microbiology 66, 2572-2577. Doumith, D., Day, M.J., Hope, R., Wain, J., Woodford, N., 2012. Improved multiplex PCR strategy for rapid assignment of the four major Escherichia coli phylogenetic groups. Journal of Clinical Microbiology 50, 3108-3110. Doyle, M.P., Erickson, M.C., 2006. The fecal coliform assay, the results of which have led to numerous misinterpretations over the years, may have outlived its usefulness. Microbiology 1, 162-163. Duffy, E.A., Lucia, L.M., Kells, J.M., Castillo, A., Pillai, S.D., Acuff, G.R., 2005. Concentration of Escherichia coli and genetic diversity of antibiotic resistance profiling of Salmonella isolated from irrigation water, packing shed equipment, and fresh produce in Texas. Journal of Food Protection 68, 70-79. Duriez, P., Clermont, O., Bonacorsi, S., Bingen, E., Chaventre, A., Elion, J., Picard, B., Denamur, E., 2001. Commensal Escherichia coli isolates are phylogenetically distributed among geographically distinct human populations. Microbiology 147, 1671-1676. England, L.S., Lee, H., Tevors, J.T., 1993. Bacterial survival in soil: effect of clays and protozoa. Soil Biology and Biochemistry 25, 525-531. Erickson, M.C., Webb, C.C., Diaz-Perez, J.C., Phatak, S.C., Silvoy, J.J., Davey, L., Payton, A.S., Liao, J., Doyle, M.P., 2010a. Surface and internalized Escherichia coli O157:H7 on fieldgrown spinach and lettuce treated with spray-contaminated irrigation water. Journal of Food Protection 73, 1023-1029. Erickson, M.C., Webb, C.C., Diaz-Perez, J.C., Phatak, S.C., Silvoy, J.J., Davey, L., Payton, A.S., Liao, J., Ma, L., Doyle, M.P., 2010b. Infrequent internalization of Escherichia coli O157:H7 into field-grown leafy greens. Journal of Food Protection 73, 500-506. Environment Canada, 2013. The BC air data archive website: TEMP_Mean. Retrieved 04/01, 2013, from http://envistaweb.env.gov.bc.ca. Environmental Health Specialists Network, 2010. EHS-Net leafy greens handling study protocol. Retrieved 04/01, 2013, from http://www.cdc.gov/nceh/ehs/EHSNet/Study_Tools/EHS-Net-Leafy-Greens-Study.pdf. Escobar-Páramo, P., Le Menac'h, A., Le Gall, T., Amorin, C., Gouriou, S., Picard, B., Skurnik, D., Denamur, E., 2006. Identification of forces shaping the commensal Escherichia coli genetic structure by comparing animal and human isolates. Environmental Microbiology 8, 1975-1984. European Union, 2005. Commission Regulation (EC). Official Journal of the European Union 2073/2005, L338/1. Fattal, B., Lampert, Y., Shuval, H., 2002. A fresh look at microbiological guideline for 128  wastewater irrigation in agriculture: a risk-assessment and cost effectiveness approach, In C.A. Scott, N.I. Faruqui, L. Raschid-Sally (Eds.), Wastewater use in irrigated agriculture: confronting the livelihood and environmental realities. CABI Publishing, Oxfordshire, UK, pp. 59-68. Feachem, R.G., Bradley, D.J., Garelick, H., Mara, D.D., 1983. Sanitation and disease; health aspects of excreta and wastewater management: World Bank studies in water supply and sanitation volume 1. Retrieved 05/23, 2013, from http://econ.worldbank.org/external/default/main?pagePK=64165259&theSitePK=469372&p iPK=64165421&menuPK=64166093&entityID=000178830_98101911180473. Fenlon, D.R., Ogden, I.D., Vinten, A., Svoboda, I., 2000. The fate of Escherichia coli and Escherichia coli O157:H7 in cattle slurry after application to land. Journal of Applied Microbiology 88, 149-156. Field, K.G., Samadpour, M., 2007. Fecal source tracking, the indicator paradigm, and managing water quality. Water Research 41, 3517-3538. Food Standards Australia New Zealand, 2001. Guidelines for the microbiological examination of ready-to-eat foods. Retrieved 03/25, 2013, from http://www.foodstandards.gov.au/_srcfiles/Guidelines%20for%20Micro%20exam.pdf. Franz, E., Van Diepeningen, A.D., de Vos, O.J., van Bruggen, A.H., 2005. Effects of cattle feeding regimen and soil management type of the fate of Escherichia coli O157:H7 and Salmonella enterica serovar Typhimurium in manure, manure-amended soil, and lettuce. Applied and Environmental Microbiology 61, 6165-6174. Franz, E., Van Bruggen, A.H.C., 2008. Ecology of E. coli O157:H7 and Salmonella enterica in the primary vegetable production chain. Critical Reviews in Microbiology 34, 143-161. Franz, E., Visser, A.A., Van Diepeningen, A.D., Klerks, M.M., Termorshuizen, A.J., Van Bruggen, H.C., 2007. Quantification of contamination of lettuce by GFP-expressing Escherichia coli O157:H7 and Salmonella enterica serovar Typhimurium. Food Microbiology 24, 106-112. FSLC, Food Safety Leadership Council on-Farm Produce Standards, 2007. Food safety leadership council on-farm produce standards-irrigation water. Retrieved 05/23, 2013, from http://www.nationalwatermelonassociation.com/FSLC%20On-Farm%20Standard.pdf. Gagliardi, J.V., Angle, J.S., Germida, J.J., Wyndham, R.C., Chanway, C.P., Watson, R.J., Greer, C.W., McIntyre, T., Yu, H.H., Levin, M.A., Russek-Cohen, E., Rosolen, S., Nairn, J., Seib, A., Martin-Heller, T., Wisse, G., 2001. Intact soil-core microcosms compared with multi-site field releases for pre-release testing of microbes in diverse soils and climates. Canadian Journal of Microbiology 47, 237-252. Gagliardi, J.V., Karns, J.S., 2000. Leaching of Escherichia coli O157:H7 in diverse soils under 129  various agricultural management practices. Applied and Environmental Microbiology 66, 877-883. Gagliardi, J.V., Karns, J.S., 2002. Persistence of Escherichia coli O157:H7 in soil and on plant roots. Environmental Microbiology 4, 89-96. Geldreich, E.E., Bordner, R.H., 1971. Fecal contamination of fruits and vegetables during cultivation and processing for market: a review. Journal of Food Science and Technology 34, 184-195. Gilbert, R.j., De Louvois, J., Donovan, T., Little, C., Nye, K., Riberiro, C.D., Richards, J., Roberts, D., Bolton, F.J., 2000. Guidelines for the microbiological quality of some ready-toeat foods sampled at the point of sale. Communicable Disease and Public Health 3, 163-167. Gillman, M.W., Cupples, L.A., Gagnon, D., Posner, B.M., Ellison, R.C., Castelli, W.P., Wolf, P.A., 1995. Protective effect of fruits and vegetables on development of stroke in men. The Journal of the American Medical Association 273, 1113-1117. Gordon, D.M., 2001. Geographical structure and host specificity in bacteria and the implications for tracing the source of coliform contamination. Microbiology 147, 1079-1085. Gordon, D.M., Bauer, S., Johnson, J.R., 2002. The genetic structure of Escherichia coli population in primary and secondary habitats. Microbiology 148, 1513-1522. Gracyk, T., Knight, R., Gilman, R., Cranfield, M., 2001. The role of non-biting flies in the epidemiology of human infectious diseases. Microbes and Infection 3, 231-235. Grant, J., Wendelboe, A.M., Wendel, A., Jepson, B., Torres, P., Smelser, C., Rolfs, R.T., 2008. Spinach - associated Escherichia coli O157:H7 outbreak, Utah and New Mexico. Emerging Infectious Diseases 14, 1633-1636. Gras, M.H., Druetmichaud, C., Cerf, O., 1994. Bacterial flora of salad leaves. Sciences des Aliments 14, 173-188. Habtestelassie, M.Y., Bischoff, M., Applegate, B., Reuhs, B., Turco, R.F., 2010. Understanding the role of agriculture practices in the potential colonization and contamination by Escherichia coli in the rhizospheres of fresh produce. Journal of Food Protection 73, 2001-2009. Hahm, B., Maldonado, Y., Schreiber, E., Bhunia, A.K., Nakatsu, C.H., 2003. Subtyping of foodborne and environmental isolates of Escherichia coli by multiplex-PCR, rep-PCR, PFGE, ribotyping and AFLP. Journal of Microbiological Methods 53, 387-399. Hamilton, A.J., Stagnitti, F., Premier, R., Boland, A.M., Hale, G., 2006. Quantitative microbiological risk assessment models for consumption of raw vegetables irrigated with reclaimed water. Applied and Environmental Microbiology 72, 3284-3290. 130  Hari-Kudo, Y., Konuma, H., Iwaki, M., Kasuga, F., Sugita-Konishi, Y., Ito, Y., Kumagi, S., 1997. Potential hazard of radish sprouts as a vehicle of Escherichia coli O157:H7. Journal of Food Protection 60, 1125-1127. Harris, S., Morris, C., Morris, D., Cormican, M., Cummins, E., 2013. The effect of hospital effluent on antimicrobial resistant E. coli within a municipal wastewater system. Environmental Science Processes and Impacts, 13, 617-622. Health Canada, 2000. Health claim assessments – acceptable disease risk reduction or therapeutic claims. Retrieved 04/01, 2013, from http://www.hc-sc.gc.ca/fn-an/labeletiquet/claims-reclam/assess-evalu/index-eng.php. Health Canada, 2001. MFHB-33 enumeration of total aerobic bacteria in food products and food ingredients using 3M PetrifilmTM aerobic count plates. Retrieved 05/23, 2013, from http://www.hc-sc.gc.ca/fn-an/alt_formats/hpfb-dgpsa/pdf/res-rech/mfhpb33-eng.pdf. Health Canada, 2002. MFHPB-19 enumeration of coliforms, fecal coliforms and E. coli in foods using the MPN method. Retrieved 05/23, 2013, from http://www.hc-sc.gc.ca/fnan/alt_formats/hpfb-dgpsa/pdf/res-rech/mfhpb19-eng.pdf. Health Canada, 2008. Standards and guidelines for microbiological safety of food. Retrieved 05/22, 2013, from http://www.hc-sc.gc.ca/fn-an/alt_formats/hpfb-dgpsa/pdf/res-rech/intsumsomexp-eng.pdf. Health Canada, 2011. Canada's food guide. Retrieved 03/04, 2013, from http://www.hcsc.gc.ca/fn-an/food-guide-aliment/index-eng.php. Health Canada, 2012. MFHPB-34 enumeration of Escherichia coli and coliforms in food products and food ingredients using 3M PetrifilmTM E. coli count plates. Retrieved 23/05, 2013, from http://www.hc-sc.gc.ca/fn-an/alt_formats/pdf/res-rech/analymeth/microbio/volume2/mfhpb34-01-eng.pdf. Herman, K.M., Ayers, T.L., Lynch, M., 2008. Foodborne disease outbreaks associated with leafy greens 1973 - 2006. Presented at the International Conference on Emerging Infectious Diseases Herzer, P.J., Inouye, S., Inouye, M., Whittam, T.S., 1990, Phylogenetic distribution of branched RNA-linked multicopy single-stranded DNA among natural isolates of Escherichia coli. Journal of Bacteriology 172, 6175-6181. Hilborn, E.D., Mermin, J.H., Mshar, P.A., Hadler, J.L., Voetsch, A., Wojtkunski, C., Swartz, M., Mshar, R., Lambert-Fair, A., Glynn, M.K., Slutsker, L., 1999. A multistate outbreak of Escherichia coli O157:H7 infections associated with consumption of mesclun lettuce. Archives of Internal Medicine 159, 1758-1764. Himathongkham, S., Bahari, S., Riemann, H., Cliver, D., 1999. Survival of Escherichia 131  coli O157:H7 and Salmonella Typhimurium in cow manure and cow manure slurry. FEMS Microbiology Letters 178, 251-257. Hora, R., Warriner, K., Shelp, B.J., Griffiths, M.W., 2005. Internalization of Escherichia coli O157:H7 following biological and mechanical disruption of growing spinach plants. Journal of Food Protection 68, 2506-2509. Hutchison, M.L., Walters, L.D., Avery, S.M., Munro, F., Moore, A., 2005. Analyses of livestock production, waste storage, and pathogen levels and prevalence in farm manures. Applied and Environmental Microbiology 71, 1231-1236. Hutchison, M.L., Avery, S.M., Monaghan, J.M., 2008. The air-borne distribution of zoonotic agents from livestock waste spreading and microbiological risk to fresh produce from contaminated irrigation sources. Journal of Applied Microbiology 105, 848-857. Ibekwe, A.M., Watt, P.M., Shouse, P.J., Grieve, C.M., 2004. Fate of Escherichia coli O157:H7 in irrigation water on soils and plants as validated by culture method and real-time PCR. Canadian Journal of Microbiology 50, 1007-1014. Ingham, S.C., Losinki, J.A., Andres, M.P., Breuer, J.E., Breuer, J.R., Wood, T.M., Wright, T.H., 2004. Escherichia coli contamination of vegetables grown in soils fertilized with noncomposed bovine manure: garden-scale studies. Applied and Environmental Microbiology 70, 6420-6427. Ishii, S., Ksoll, W.B., Hicks, R.E., Sadowsky, M.J., 2007. Presence and growth of naturalized Escherichia coli in temperate soils from Lake Superior Watersheds. Applied and Environmental Microbiology 73, 3771-3778. Islam, M., Doyle, M.P., Phatk, S.C., Millner, P., Jiang, X., 2004a. Persistence of enterohemorrhagic Escherichia coli O157:H7 in soil and on leaf lettuce and parsley grown in fields treated with contaminated manure composts or irrigation water. Journal of Food Protection 67, 1365-1370. Islam, M., Morgan, J., Doyle, M.P., Jiang, X., 2004b. Fate of Escherichia coli O157:H7 in manure compost amended soil and on carrots and onions grown in an environmentally controlled growth chamber. Journal of Food Protection 67, 574-578. Jablasone, J., Warriner, K., Griffiths, M., 2005. Interactions of Escherichia coli O157:H7, Salmonella Typhimurium and Listeria monocytogenes plants cultivated in a gnotobiotic system. International Journal of Food Microbiology 99, 7-18. James, E.K., Olivares, F.L., 1997. Infection and colonization of sugar cane and other graminaceous plants by endophytic diazotrophes. Critical Reviews in Plant Sciences 17, 77119. Janisiewicz, W.J., Conway, W.S., Leverentz, B., 1999. Biological control of postharvest decays 132  of apple can prevent growth of Escherichia coli O157:H7 in apple wounds. Journal of Food Protection 62, 1372-1375. Jay, M.T., Cooley, M., Carychao, D., Wiscomb, G.W., Sweitzer, R.A., Crawford-Miksza, L., 2007. Escherichia coli O157:H7 in feral swine near spinach fields and cattle, central California coast. Emerging Infectious Diseases 13, 1908-1911. Jeter, C., Matthysse, A.G., 2005. Characterization of the binding of diarrheagenic strains of E. coli to plant surfaces and the role of curli in the interaction of the bacteria with alfalfa sprouts. Molecular Plant-Microbe Interactions 18, 1235-1242. Jiang, X., Morgan, J., Doyle, M.P., 2002. Fate of Escherichia coli O157:H7 in manure amended soil. Applied and Environmental Microbiology 68, 2605-2609. Johannessen, G.S., Froseth, R.B., Solemdal, L., Jarp, J., Wasteson, Y., Rorvik, L.M., 2004. Influence of bovine manure as fertilizer on the bacteriological quality of organic Icebery lettuce. Journal of Applied Microbiology 96, 787-794. Johannessen, G.S., Loncarevic, S., Kruse, H., 2000. Bacteriological analysis of fresh produce in Norway. International Journal of Food Microbiology 77, 199-204. Johannessen, G.S., Bengtsson, G.B., Heier, B.T., Bredholt, S., Wasteson, Y., Rorvik, L.M., 2005. Potential uptake of Escherichia coli O157:H7 from organic manure into crisphead lettuce. Applied and Environmental Microbiology 71, 2221-2225. Johnson, J.Y.M., Thomas, J.E., Graham, T.A., Townshend, I., Byrne, J., Selinger, L.B., Gannon, V.P.J., 2003. Prevalence of Escherichia coli O157:H7 and Salmonella spp. in surface waters of southern Alberta and its relation to manure sources. Canadian Journal of Microbiology 49, 326-335. Johnson, J.R., Stell, A.L., 2000. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. Journal of Infectious Diseases 181, 261-272. Johnson J.R., Delavari, P., Kuskowski, M., Stell, A.L., 2001. Phylogenetic distribution of extraintesinal virulence-associated traits in Escherichia coli. Journal of Infectious Diseases 183, 78-88. Johnson, R.P., Wilson, J.B., Michel, P., Rahn, K., Renwick, S.A., Gyles, C.L., Spika, J.S., 1999. Human infection with verocytotoxigenic Escherichia coli associated with exposure to farms and rural environments, In Stewart, C.S., Flint, H.J. (Eds), Escherichia coli O157:H7 in farm animals. CABI Publishing, New York, pp. 147-168. Johnston, L.M., Jaykus, L., Moll, D., Martinez, M.C., Anciso, J., Mora, B., Moe, C.L., 2005. A field study of the microbiological quality of fresh produce. Journal of Food Protection 68, 1840-1847. 133  Johnston, L.M., Jaykus, L., Moll, D., Anciso, J., Mora, B., Moe, C.L., 2006. A field study of the microbiological quality of fresh produce of domestic and Mexican origin. International Journal of Food Microbiology 112, 83-95. Jones, D.L., 1999. Potential health risks associated with the persistence of Escherichia coli O157 in agriculture environments. Soil Use and Management 15, 76-83. Jones, P.W., 1986. Sewage sludge as a vector of Salmonellosis, In J.C. Block, A.H. Haielaar, P. L'Hermite (Eds.), Epidemiological studies of risks associated with the agricultural use of sewage sludge. Elsevier, London, pp. 21-33. Kaferstein, F.K., 1976. The microflora of parsley. Journal of Milk and Food Technology 39, 837-840. Kearney, T.E., Larkin, M.J., Levett, P.N., 1993. The effect of slurry storage and anaerobic digestion on survival of the pathogenic bacterial. Journal of Applied Microbiology 74, 8693. Keraita, B., Konradsen, F., Drechsel, P., Abaidoo, R.C., 2007a. Effect of low-cost irrigation methods on microbiological contamination of lettuce irrigated with untreated wastewater. Tropical Medicine and International Health 12, 15-22. Keraita, B., Konradsen, F., Drechsel, P., Abaidoo, R.C., 2007b. Reducing microbiological contamination on wastewater-irrigated lettuce by cessation of irrigation before harvesting. Tropical Medicine and International Health 12, 8-14. Khakhria, R., Woodward, D., Johnson, W., 1996. Salmonella, Shigellae, pathogenic E. coli, Campylobacter and Aeromonas identified in Canada: annual summary 1994. National laboratory for enteric pathogens, LCDC, Health Canada. Khaleel, R., Reddy, K.R., Overcash, M.R., 1908. Transport of potential pollutants in runoff water from land areas receiving animal wastes: a review. Water Research 14, 421-436. Klerks, M.M., Franzm E., van Gent-Pelzer, M., Zijlstra, C., van Bruggen, A.H., 2007. Differential interaction of Salmonella enterica serovars with lettuce cultivars and plantmicrobe factors influencing the colonization efficiency. International Society of Microbial Ecology 1, 620-631. Kligler, I.J., 1921. Investigation on soil pollution and the relation of the various types of privies to the spread of intestinal infections. Monograph, Rockefeller Institute for Medical Research 15, 1-75. Klima, C.L., Alexander, T.W., Selinger, L.B., Read, R.R., Shewan, P.E., Gow, S.P., Booker, C.W., McAllister, T.A., 2010. Comparison of repetitive PCR and pulsed-field gel electrophoresis for genotyping of Mannheimia haemolytica. Journal of Microbiological Methods 81, 34-47. 134  Knittel, M.D., Seidler, R.J., Eby, C., Cabe, L.M., 1977. Colonization of the botanical environment by Klebsiella isolates of pathogenic origin. Applied and Environmental Microbiology 34, 557-563. Kobayashi, M., Sasaki, T., Saito, N., Tamura, K., Suzuki, K., Watanabe, H., Agui, N., 1999. House flies: not simple mechanical vectors of enterohemorrhagic Escheichia coli O157:H7. The American Journal of Tropical Medicine and Hygiene 61, 625-629. Kozak, G.K., MacDonald, D., Landry, L., Farber, J.M., 2013. Foodborne outbreaks in Canada linked to produce: 2001 through 2009. Journal of Food Protection 76, 173-183. Ksoll, W.B., Ishii, S., Sadowsky, M.J., Hicks, R.E., 2007. Presence and sources of fecal coliform bacteria in epilithic periphyton communities of Lake Superior. Applied and Environmental Microbiology 73, 3771-3778. Larney, F.J., Sullivan, D.M., Buckley, K.E., Eghball, B., 2006. The role of composting in recycling manure nutrients. Canadian Journal of Soil Science 86, 597-611. Lang, N.L., Smith, S.R., 2007. Influence of soil type, moisture content and biosolids application on the fate of Escherichia coli in agricultural soil under controlled laboratory conditions. Journal of Applied Microbiology 103, 2122-2131. Lau, M.M., Ingham, S.C., 2001. Survival of fecal indicator bacteria in bovine manure incorporated in soil. Letters in Applied Microbiology 33, 1-6. Leclerc, H., Mossel, D., Edberg, S., Struijk, C., 2001. Advances in the bacteriology of the coliform group: their suitability as markers of microbiological water safety. Annual Review of Microbiology 55, 201-234. LGMA, California Leafy Green Products Handler Marketing Agreement, 2012. LGMA accepted food safety practices 08/31/2012. Retrieved 05/23, 2013, from http://www.caleafygreens.ca.gov/food-safety-practices. Liao, C., Fett, W.F., 2001. Analysis of native microflora and selection of strains antagonistic to human pathogens on fresh produce. Journal of Food Protection 64, 1110-1115. Lindow, S.E., Brandl, M.T., 2003. Microbiology of the phyllosphere. Applied and Environmental Microbiology 69, 1875-1883. Lindow, S.E., Leveau, J.H., 2002. Phyllosphere microbiology. Current Opinion in Biotechnology 13, 238-243. Little, C., Roberts, D., Yongs, E., Louvoise, J., 1999. Microbiological quality of retail imported unprepared whole lettuces: a PHLS Food Working Group study. Journal of Food Protection 62, 325-328. Lock, K., Pomerleau, J., Causer, L., Altmann, D.R., McKee, M., 2005. The global burden of 135  disease attributable to low consumption of fruit and vegetables: implications for the global strategy on diet. Bulletin of the World Health Organization 83, 100-108. Loncarevic, S., Johannessen, G.S., Rorvik, L.M., 2005. Bacteriological quality of organically grown leaf lettuce in Norway. Letters in Applied Microbiology 41, 186-189. Lu, L., Hume, M.E., Sternes, K.L., Pillai, S.D., 2004. Genetic diversity of Escherichia coli isolates in irrigation water and associated sediments: implications for source tracking. Water Research 38, 3899-3908. Lugtenberg, B.J.J., Dekkers, L., Bloemberg, G.v., 2001. Molecular determinants of rhizosphere colonization by Pseudomonas. Annual Review of Phytopathology 39, 461-490. Manafi, M., 2012. Culture media for detection and enumeration of "total" Enterobacteriaceae, coliforms and Escherichia coli from Foods, In J.E.L. Corry, G.D.W. Curtis, R.M. Baird (Eds.), Handbook of culture media for food and water microbiology 3rd edition. The Royal Society of Chemistry, pp. 233-259. Manas, P., Castro, E., de La Heras, J., 2009. Irrigation with treated wastewater: effects on soil, lettuce (Lactuca sativa L.) crop and dynamics of microorganisms. Journal of Environmental Science and Health, Part A Toxic/Hazardous Substances and Environmental Engineering 44, 1261-1273. Mara, D.D., Sleigh, P.A., Blumenthal, U.J., Carr, R.M., 2007. Health risks in wastewater irrigation: comparing estimates from quantitative microbial risk analyses and epidemiological studies. Journal of Water and Health 5, 39-50. Martin, F.R.J., Bootsma, A., Coote, D.R., Fairley, B.G., Gregorich, L.J., Lebedin, J., Milburn, P.H., Stewart, B.J., Van der Gulik, T.W., 2000. Canada's rural water resources, In D.R. Coote, L.J. Gregorich (Eds.), The health of our water. Minister of Public Works and Government Services Canada publication, Ottawa, Ontario, pp. 5-14. McGlynn, W.G., Brandenberger, L.P., Castillo, A., 2009. CAST commentary - food safety and fresh produce: An update. Retrieved 03/04, 2013, from http://www.castscience.org/publications/index.cfm/food_safety_and_fresh_produce_an_update?show=produ ct&productID=2946. McLellan, S.L., 2004. Genetic diversity of Escherichia coli isolated from urban rivers and beach water. Applied and Environmental Microbiology 70, 4658-4665. McKellar, R.C., LeBlanc, D.I., Lu, J., Delaquis, P., 2012, Simulation of Escherichia coli O157:H7 behavior in fresh-cut lettuce under dynamic temperature conditions during distribution from processing to retail. Foodborne Pathogens and Disease 9, 239-244. Meric, G., Kemsley, E.K., Falush, D., Saggers, E.J., Lucchini, S., 2013. Phylogenetic distribution of traits associated with plant colonization in Escherichia coli. Environmental Microbiology 136  15, 487-501. Mente, A., de Koning, L., Shannon, H.S., Anand, S.S., 2009. A systematic review of the evidence supporting a causal link between dietary factors and coronary heart disease. Archives of Internal Medicine 169, 659-669. Michel, P.I., Wilson, J.B., Martin, S.W., Claurke, R.C., McEwen, S.A., Gyles, C.L., 1999. Temporal and geographical distributions of reported cases of E. coli O157:H7 infection in Ontario. Epidemiology & Infection 122, 193-200. Mitra, R., Cuestra-Alonso, E., Wayadande, A., Talley, J., Gilliland, S., Fletcher, J., 2009. Effect of route of introduction and host cultivar on the colonization, internalization, and movement of the human pathogen Escherichia coli O157:H7 in spinach. Journal of Food Protection 72, 1521-1530. Monagham, J., Hutchison, M., 2010. Monitoring microbial food safety of fresh produce. Retrieved 28/05, 2013, from http://www.food.gov.uk/multimedia/pdfs/microbial.pdf. Mootian, G., Wu, W.H., Matthews, K.R., 2009. Transfer of Escherichia coli O157:H7 from soil, water, and manure contaminated with low numbers of the pathogen to lettuce plants. Journal of Food Protection 72, 2308-2313. Mukherjee, A., Speh, D., Dyck, E., Diez-Gonzalez, F., 2004. Preharvest evaluation of coliforms, Escherichia coli, Salmonella, and Escherichia coli O157:H7 in organic and conventional produce grown by Minnesota farmers. Journal of Food Protection 67, 894-900. Mukherjee, A., Speh, D., Jones, A.T., Buesing, K.M., Diez-Gonzalez, F., 2006. Longitudinal microbiological survey of fresh produce grown by farmers in the upper Midwest. Journal of Food Protection 69, 1928-1936. National Advisory Committee on Microbiological Criteria for Foods, 1999. Microbiological safety evaluations and recommendations on fresh produce. Food Control 10, 117-143. Natvig, E.E., Ingham, S.C., Ingham, B.H., Cooperband, L.R., Roper, T.R., 2002. Salmonella enterica serovar Typhimurium and Escherichia coli contamination of root and leafy vegetables grown in soils with incorporated bovine manure. Applied and Environmental Microbiology 68, 2737-2744. Nichols, G.L., 2005. Fly transmission of Campylobacter. Emerging Infectious Diseases 11, 361364. Ogden, I.D., Fenlon, D.R., Vinten, A., Lewis, D., 2001. The fate of Escherichia coli O157:H7 in soil and its potential to contaminate drinking water. International Journal of Food Microbiology 66, 111-117. Painter, J.A., Heokstra, R.M., Ayers, T., Tauxe, R.V., Braden, C.R., Angulo, F.J., Griffin, P.M., 2013. Attribution of foodborne illness, hospitalization, and deaths to food commodities by 137  using outbreak data, United States, 1998-2008. Emerging Infectious Diseases 19, 3. Park, S., Szonyi, B., Gautam, R., Nightingale, K., Anciso, J., Ivanek, R., 2012. Risk factors for microbial contamination in fruits and vegetables at the preharvest level: a systematic review. Journal of Food Protection 75, 2055-2081. Paton, A.W., Paton, J.C., 1998. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA Enterohemoorrhagic E. coli hlyA, RFBO111 , and rfbO157. Journal of Clinical Microbiology 34, 598. Perchec-Merie, A., Lewis, G.D., 2012. Naturalized Escherichia coli from New Zealand wetland and stream environments. Federation of European Microbiological Societies Microbiology Ecology 83, 494-503. Phillips, C.A., Harrison, M.A., 2005. Comparison of the microflora on organically and conventionally grown spring mix from a California processor. Journal of Food Protection 68, 1143-1146. Picard, B., Garcia, J.S., Gouriou, S., Duriez, P., Brahimi, N., Bingen, E., Elion, J., Denamur, E., 1999, The link between phylogeny and virulence in Escherichia coli extraintestinal infection. Infection and Immunity 67, 546-553. Pomerleau, J., Lock, K., Knai, C., McKee, M., 2005. Interventions designed to increase adult fruit and vegetable intake can be effective: a systematic review of the literature. Journal of Nutrition 135, 2486-2495. Pu, S., Beaulieu, J.C., Prinyawiwatkul, W., Ge, B., 2009. Effects of plant maturity and growth media bacterial inoculum level on the surface contamination and internalization of Escherichia coli in growing spinach leaves. Journal of Food Protection 72, 2313-2320. Public Health Agency of Canada, 2011. 2011 short report C-ENTERNET Canada's national integrated enteric pathogen surveillance system. Infectious Disease Prevention and Control. Public Health Agency of Canada, 2010. C-EnterNet overview. Retrieved 03/24, 2013, from http://www.phac-aspc.gc.ca/c-enternet/overview-apercu-eng.php. Rabinowitz, S., 1955. The survival of coliforms, Streptococcus faecalis and Salmonella Tennessee in soil and climate of Israel. Applied Microbiology 4, 101. Rice, D.H., Hancock, D.D., Besser, T.E., 1995. Verotoxigenic E. coli O157 colonization of wild deer and range cattle. Veterinary Record 137, 524. Riley, L.W., Remis, R.S., Helgerson, S.D., McGee, H.B., Wells, J.g., Davis, B.R., Hebert, R.J., Olcott, E.S., Johnson, L.M., Hargrett, N.T., Blake, P.A., Cohen, M.L., 1983. Hemorrhagic colitis associated with a rare Escherichia coli serotype. New England Journal of Medicine 308, 681-685. 138  Rodrigues, D.M., Torres, F.E., Gutierrez, E.V., Lopez, M.P., Martinez, M.M., Carrascal, A.K., 2008. Salmonella Typhimurium determination in compost artificially inoculated in a lettuce crop. Acta Biogica Colombiana 13, 61-72. Romberger, J.A., Hejnowicz, Z., Hill, J.F., 1993. Plant structure: function and development, Springer-Verlag New York Inc., New York. Rothschild, M., 2011. Deer confirmed as source of strawberry outbreak. Retrieved 05/22 2013, from http://www.foodsafetynews.com/2011/08/deer-feces-confirmed-as-source-ofstrawberry-outbreak/. Rudolf, D., Goss, M., 1993. Ontario farm groundwater survey. Prepared for Agriculture Canada under the Federal-Provincial Land Management Assistance Program, 1992.ISBN 0-66220879-X. Ruiz, B.G., Vargas, R.G., Garcia-Villanova, R., 1987. Contamination on fresh vegetables during cultivation and marketing. International Journal of Food Microbiology 4, 285-291. Sagoo, S.K., Little, C.L., Mitchell, R.T., 2001. The microbiological examination of ready-to-eat organic vegetables from retail establishments in the United Kingdom. Letters in Applied Microbiology 33, 434-439. Sagoo, S.K., Little, C.L., Ward, L., Gillespie, I.A., Mitchell, R.T., 2003. Microbiological study of ready-to-eat salad vegetables from retail establishments uncovers a national outbreak of salmonellosis. Journal of Food Science 66, 403-409. Sasaki, T., Kobayashi, M., Agui, N., 2000. Epidemiological potential of excretion and regurgitation by Musca domestica (Diptera: Muscidae) in the dissemination of Escherichia coli O157:H7 to food. Journal of Medical Entomology 37, 945-949. Savageau, M.A., 1983. Escherichia coli habitats, cell types, and molecular mechanisms of gene control. The American Naturalist 122, 732-734. Schets, F.M., During, M., Italiaander, R., Heijnen, L., Rutjes, S.A., van der Zwaluw, W.K., de Roda Husman, A.M., 2005. Escherichia coli O157:H7 in drinking water from private water supplies in the Netherlands. Water Research 39, 4485-4493. Schmidt, H., Scheef, J., Morabito, S., Caprioli, A., Wieler, L.H., Karch, H., 2000. A new Shiga toxin 2 variant from Escherichia coli isolated from pigeons. Applied and Environmental Microbiology 66, 1205-1208. Schuenzel, K.M., Harrison, M.A., 2002. Microbial antagonists of foodborne pathogens on fresh, minimally processed vegetables. Journal of Food Protection 65, 1909-1915. Schwaiger, K., Helmke, K., Holzel, C.S., Bauer, J., 2011. Comparative analysis of the bacterial flora of vegetables collected directly from farms and from supermarkets in Germany. International Journal of Environmental Health Research 21, 161-172. 139  Scott, C.A., Faruqui, N.I., Raschid-Sally, L., 2004. Wastewater use in irrigated agriculture: management challenges in developing courtiers, In C.A. Scott, N.I. Faruqui, L. RaschidSally (Eds.), Wastewater use in irrigated agriculture: confronting the livelihood and environmental realities. CABI Publishing, Oxfordshire, UK, pp. 1-10. Sewell, A.M., and Farber, J.M., 2001. Foodborne outbreaks in Canada linked to produce. Journal of Food Protection 64, 1863–1877. Selander, R.K., Caugant, D.A., Ochman, H., Musser, J.M., Gilmour, M.N., Whittam, T.S., 1986, Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics. Applied and Environmental Microbiology 51, 873-884. Seo, K.H., Frank, J.F., 1999. Attachment of Escherichia coli O157:H7 to lettuce leaf surface and bacterial viability in response to chlorine treatment as demonstrated by using confocal scanning laser microscopy. Journal of Food Protection 62, 3-9. Shaw, R.K., Berger, C.N., Feys, B., Knutton, S., Pallen, M.J., Frankel, G., 2008. Enterohemorrhagic Escherichia coli exploits EspA filaments for attachment to salad leaves. Applied and Environmental Microbiology 74, 2908-2914. Shuval, H., Adin, A., Fattal, B., Rawitz, E., Yekutiel, P., 1986. Wastewater irrigation in developing countries: health effects and technical solutions. World Bank Technical Paper 51 Shuval, H., Lampert, Y., Fattal, B., 1997. Development of a risk assessment approach for evaluating wastewater reuse standards for agriculture. Water Science and Technology 35, 15-20. Sivapalasingam, S., Friedman, C.R., Cohen, L., Tauxe, R.V., 2004. Fresh produce: a growing cause of outbreaks of foodborne illness in the United States, 1973 through 1997. Journal of Food Protection 67, 2342-2353. Solomon, E.B., Potenski, C.J., Matthews, K.R., 2002a. Effect of irrigation method on transmission to and persistence of Escherichia coli O157:H7 on lettuce. Journal of Food Protection 68, 397-400. Solomon, E.B., Yaron, S., Matthews, K.R., 2002b. Transmission of Escherichia coli O157:H7 from contaminated manure and irrigated water to lettuce plant tissue and its subsequent internalization. Applied and Environmental Microbiology 68, 397-400. Solomon, E.B., Pang, H.J., Matthews, K.R., 2003. Persistence of Escherichia coli O157:H7 on lettuce plants following spray irrigation with contaminated water. Journal of Food Protection 66, 2198-2202. Statistics Canada, 2010a. Canadian community health survey, 2008. Retrieved 03/08, 2013, from http://www.statcan.gc.ca/pub/82-229-x/2009001/deter/fvc-eng.html. Statistics Canada, 2010b. The food statistics for 2009. Retrieved 03/08, 2013, from 140  http://www.statcan.gc.ca/pub/21-020-x/2009001/t002-eng.html. Steele, M., Odumeru, J., 2004. Irrigation water as a source of foodborne pathogens on fruits and vegetables. Journal of Food Protection 67, 2839-2849. Stephenson, J., 1997. New approaches for detecting and curtailing foodborne microbiological infections. The Journal of American Medical Association 277, 1337-1339. Stine, S.W., Song, I., Choi, C.Y., Gerba, C.P., 2005a. Application of microbiological risk assessment to the development of standards for enteric pathogens in water used to irrigate fresh produce. Journal of Food Protection 68, 913-918. Stine, S.W., Song, I., Choi, C.Y., Gerba, C.P., 2005b. Effect of relative humidity on preharvest survival of bacterial and viral pathogens on the surface of cantaloupe, lettuce, and bell peppers. Journal of Food Protection 68, 1352-1358. Stoeckel, D.M., Mathes, M.V., Hyer, K.E., Hagedorn, C., Kator, H., Lukasik, J., O'Brien, T.L., Fenger, T.W., Samadpour, M.l., Strickler, K.M., Wiggins, B.A., 2004. Comparison of seven protocols to identify fecal contamination sources using Escherichia coli. Environmental Science and Technology 38, 6109-6117. Szewzyk, U., Szewzyk, R., Manz, W., Schleifer, K.H., 2000. Microbiological safety of drinking water. Annual Review of Microbiology 54, 81-127. Takeuchi, K., Frank, J.F., 2000. Penetration of Escherichia coli O157:H7 into lettuce tissues as affected by inoculum size and temperature and effect of chlorine treatment on cell viability. Journal of Food Protection 63, 434-440. Takeuchi, K., Matute, C.M., Hassan, A.N., Frank, J.F., 2000. Comparison of the attachment of Escherichia coli O157:H7, Listeria monocytogenes, Salmonella Typhimurium, and Pseudomoas fluorescens to lettuce leaves. Journal of Food Protection 63, 1433-1437. Talley, J.L., Wayadande, A.C., Wasala, L.P., Gerry, A.C., Fletcher, J., DeSilva, U., Gilliland, S.E., 2009. Association of Escherichia coli O157:H7 with filth flies (Muscidae and Calliphoridae) captured in leafy greens fields and experimental transmission of E. coli O157:H7 to spinach leaves by houseflies (Diptera: Muscidae). Journal of Food Protection 72, 1547-1552. Tauxe, R., Kruse, H., Hedberg, C., Potter, M., Madden, J., Wachsmuth, K., 1997. Microbiological Hazards and Emerging Issues Associated with Produce - A Preliminary Report to the National Advisory Committee on Microbiologic Criteria for Food. Journal of Food Protection 60, 1400-1408. Thunberg, R.L., Tran, T.T., Bennett, R.W., Matthews, R.N., Belay, N., 2002. Microbiological evaluation of selected fresh produce obtained at retail markets. Journal of Food Protection 65, 677-682. 141  Troxier, J., Berling, C.H., Moene-Loccoz, Y., Kell, C., Defago, G., 1997. Interactions between the biocontrol agent Psudomonas fluorescens CHAO and Thielavisopsis basicola in tobacco roots observed by immonuoflurescent microscopy. Plant Pathology 46, 62-71. Tyrrel, S.F., Knox, J.W., Weatherhead, E.K., 2006. Microbiological water quality requirements for salad irrigation in the United Kingdom. Journal of Food Protection 69, 2029-2035. US Environmental Protection Agency, 2003. Environmental regulations and technology control of pathogens and vector attraction in sewage sludge. Retrieved 06/02, 2013, from http://www.epa.gov/nrmrl/pec/bsguidance.html. USDA, U.S. Food and Drug Administration, 2000. National organic program. Agriculture Marketing Service 7 CFR, 205-203. USDA, U.S. Food and Drug Administration, 2004. NAFTA trade in fruits and vegetables. Global trade patterns in fruits and vegetables. Retrieved 03/24, 2013, from http://www.ers.usda.gov/media/320480/wrs0406f_1_.pdf. USDA, U.S. Food and Drug Administration, 2008. Guidance for industry: guide to minimize microbial food safety hazards of fresh-cut fruits and vegetables. Retrieved 03/11, 2013, from http://www.fda.gov/Food/GuidanceRegulation/GuidanceDocumentsRegulatoryInformation/ ProducePlantProducts/ucm064458.html. USDA, U.S. Food and Drug Administration, 2012a. MDP - program data and reports. Retrieved 03/24, 2013, from http://www.ams.usda.gov/AMSv1.0/ams.fetchTemplateData.do?template=TemplateO&topN av=&leftNav=ScienceandLaboratories&page=MDPProgramReports&description=MDP+Pr ogram+Reports&acct=microbiodataprg. USDA, U.S. Food and Drug Administration, 2012b. Microbiological data program - progress update and 2009 data summary. Retrieved 03/11, 2013, from http://www.ams.usda.gov/AMSv1.0/getfile?dDocName=STELPRDC5088761. USDA, U.S. Food and Drug Administration, 2013. FDA survey of domestic fresh produce FY 2000/2001 field assignment. Retrieved 03/11, 2013, from http://www.fda.gov/Food/FoodSafety/ProductSpecificInformation/FruitsVegetablesJuices/GuidanceComplianceRegulatoryInformation/uc m118306.html. Van Donsel, D.J., Geldreich, E.E., Clarke, N.A., 1967. Seasonal variations in survival of indicator bacteria in soil and their contribution to storm water pollution. Applied Microbiology 15, 1362-1370. Van Ginneken, M., Oron, G., 2000. Risk assessment of consuming agricultural products irrigated with reclaimed wastewater: an exposure model. Water Resources Research 36, 10. 142  Wachtel, M.R., Whitehand, L.C., Mandrell, R.E., 2002a. Association of Escherichia coli O157:H7 with preharvest leaf lettuce upon exposure to contaminated irrigation water. Journal of Food Protection 65, 18-25. Wachtel, M.R., Whitehand, L.C., Mandrell, R.R., 2002b. Prevalence of Escherichia coli associated with a cabbage crop inadvertently irrigated with partially treated sewage wastewater. Journal of Food Protection 65, 471-475. Wachtel, M.R., Charkowski, A.O., 2002. Cross-contamination of lettuce with Escherichia coli O157:H7. Journal of Food Protection 65, 465-470. Wallace, J.S., Cheasty, T., Jones, K., 1997. Isolation of verocytotoxin-producing Escherichia coli O157 from wild birds. Journal of Applied Microbiology 82, 399-404. Wang, G., Doyle, M.P., 1998. Survival of enterohemhorrhagic Escherichia coli O157:H7 in water. Journal of Food Protection 61, 662-667. Wang, G., Zhao, T., Doyle, M.P., 1996. Fate of enterohemorrhagic Escherichia coli O157:H7 in bovine feces. Applied and Environmental Microbiology 62, 2567-2570. Warriner, K., Ibrahim, F., Dickinson, M., Wright, C., Waites, W.M., 2003. Interaction of Escherichia coli with growing salad spinach plants. Journal of Food Protection 66, 17901797. Warriner, K., Huber, A., Namvar, A., Fan, W., Dunfield, K., 2009. Recent advances in the microbiological safety of fresh fruits and vegetables. Advances in Food and Nutrition Research 57, 155-208. Watts, P.S., Wall, M.,1952. The 1951 Salmonella Typhimurium epidemic in sheep in South Australia. The Australian Veterinary Journal 28, 165-168. Wendel, A. M., Johnson, D.H., Sharapov, U., Grant, J., Archer, J.R., Monson, T., 2009. Multistate outbreak of Escherichia coli O157:H7 infection associated with consumption of packaged spinach, August - September 2006: the Wisconsin investigation. Clinical Infectious Diseases 48, 1079-1086. White, A.P., Sibley, K.A., Sibley, C.D., Wasmuth, J.D., Schaefer, R., Surette, M.G., Edge, T.A., Neumann, N.F., 2011. Intergenic sequence comparison of Escherichia coli isolates reveals lifestyle adaptations but not host specificity. Applied and Environmental Microbiology 77, 7620-7632. WHO, 1989. Health guidelines for the use of wastewater in agriculture and aquaculture. Report of a WHO Scientific Group, Geneva. WHO, 2006. Guidelines for the safe use of wastewater in agriculture. Report of a WHO Scientific Group, Geneva. 143  WHO, 2009. The 10 facts about water http://who.int/features/factfiles/water/en/.  scarcity.  Retrieved  04/10,  2013,  from  WHO, 2013. Guidelines of the safe use of wastewater, excreta and grey water: wastewater use in agriculture. Retrieved 04/10, 2013, from http://www.who.int/water_sanitation_health/wastewater/gsuweg2/en/. Williamson, D.A., 2001. Manitoba water quality objectives, standards, and guidelines. Manitoba Conservation, Water Quality Management Section. Technical draft. Won, J., Kline, T.R., Lejeune, J.T., 2013. Spatial-temporal variations of microbiological water quality in surface reservoirs and canals used for irrigation. Agricultural Water Management 116, 73-78. Xicohtencatl-Cortes, J., Sanchez-Chacon, E., Saldana, Z., Freer, E., Giron, J.A., 2009. Interaction of Escherichia coli O157:H7 with leafy green produce. Journal of Food Protection 72, 1531-1537. Yates, M.V., Yates, S.R., Wagner, J., Gerba, C.P., 1987. Modeling virus survival and transport in the subsurface. Journal of Contaminant Hydrology 1, 329-345. Zhang, G.D., Ma, L., Beuchat, L.R., Erickson, M.C., Phelan, V.H., Doyle, M.P., 2009. Lack of internalization for Escherichia coli O157:H7 in lettuce (Lactuca sativa L.) after leaf surface and soil inoculation. Journal of Food Protection 72, 2028-2037. Zibilske, L.M., Weaver, R.W., 1978. Effect of environmental factors on survival of Salmonella Typhimurium in soil. Journal of Environmental Quality 7, 593-597.  144  Appendix Appendix. BOX AR1-PCR banding patterns and similarity indices (UPGMA) of E. coli strains detected in vegetables and environmental samples. Strong genetic variability was observed among strains, with 88 unrelated strains identified from 96 unique isolates. The banding patterns of the following four pairs matched each other: E. coli recovered from a red leaf lettuce sample (Gel lane 9) and a compost sample (Gel 2 lane 14); E. coli recovered from a Romaine lettuce sample (Gel 2 lane 5) and a water sample (Gel 2 lane 11); E. coli recovered from a green leaf lettuce sample (Gel 4 lane 8) and a soil sample (Gel 7 lane 3); and E. coli recovered from a Romaine lettuce sample (Gel 7 lane 8) and a water sample (Gel 6 lane 4).  145  146  147  148  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073924/manifest

Comment

Related Items