UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Lipid nanoparticles encapsulating siRNAs against the androgen receptor to treat advanced prostate cancer Lee, Justin Barry 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2013_fall_lee_justin.pdf [ 7.24MB ]
Metadata
JSON: 24-1.0073915.json
JSON-LD: 24-1.0073915-ld.json
RDF/XML (Pretty): 24-1.0073915-rdf.xml
RDF/JSON: 24-1.0073915-rdf.json
Turtle: 24-1.0073915-turtle.txt
N-Triples: 24-1.0073915-rdf-ntriples.txt
Original Record: 24-1.0073915-source.json
Full Text
24-1.0073915-fulltext.txt
Citation
24-1.0073915.ris

Full Text

LIPID NANOPARTICLES ENCAPSULATING SIRNAS AGAINST THE ANDROGEN RECEPTOR TO TREAT ADVANCED PROSTATE CANCER  by Justin Barry Lee  B.Sc., University of Calgary, 2006  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Biochemistry and Molecular Biology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  June 2013  © Justin Barry Lee, 2013  Abstract The androgen receptor (AR) plays a critical role in the progression of prostate cancer. This thesis is focused on investigating the ability of lipid nanoparticle (LNP) formulations of small-interfering RNA (siRNA) to silence AR (LNP AR-siRNA) in human prostate tumor cells in vitro and in LNCaP xenograft tumors following intravenous (i.v.) injection. The first part of this thesis characterized the properties of LNP AR-siRNA systems that contained the ionizable cationic lipid DLin-KC2-DMA. Inclusion of DLin-KC2-DMA was found to exhibit the most potent AR silencing effects in LNCaP cells. This is attributed to an optimized ability of DLin-KC2-DMA-containing LNP to be taken up into cells and to release the siRNA into the cell cytoplasm following endocytotic uptake. Importantly, it is demonstrated that LNP AR-siRNA systems containing DLin-KC2-DMA can silence AR gene expression in distal LNCaP xenograft tumors and reduce serum prostate specific antigen (PSA) following i.v. injection at a dose level of 10 mg siRNA/kg body weight. The latter part of this thesis describes optimization of LNP AR-siRNA by stabilizing the AR-siRNA sequence through introduction of a phosphorothioate backbone and methylations of nucleotides at the 2’O position and also employing an optimized cationic lipid 3(dimethylamino)propyl(12Z,15Z)-3-[(9Z,12Z)-octadeca-9,12-dien-1-yl]henicosa-12,15-dienoate (DMAP-BLP). In addition, specific targeting to the prostate specific membrane antigen (PSMA) on LNCaP cells was made possible via chemical conjugation of a small molecule 2-[3-(1,3dicarboxypropyl)-ureido]pentanedioic acid (DUPA) to the PEG-lipid formulated into LNP ARsiRNA. With the incorporation of the DUPA-targeting moiety, a 5-fold increase in cellular uptake was observed in LNCaP cells in vitro, as well as a dramatic improvement in AR knockdown. The PEG-lipid employed in formulating the LNP was also optimized to produce ii  longer circulation lifetimes that result in improved accumulation at the distal tumor site. It is shown that as a result of these improvements the doses of siRNA employed in LNP-siRNA systems could be reduced by a factor of two as compared to previous systems. In addition improved reductions in serum PSA, cellular proliferation, and AR levels were also observed. These results support the potential clinical utility of LNP-siRNA systems to silence the AR for treatment of advanced prostate cancer.  iii  Preface Chapters two, three and four involve in vitro experiments using multiple prostate cancer cell lines and in vivo experiments using the LNCaP xenograft model. I was responsible for writing the entire thesis including all revisions. All of the in vitro studies were performed by myself other than FACS processing performed by Ms. Vanessa Y. Sung (Section 2.4). In vivo studies were designed and performed at the Vancouver Prostate Centre in collaboration with Prof. Paul S. Rennie, Dr. Kaixin Zhang and Dr. Eric LeBlanc. I was responsible for formulation and analysis of all LNP used for in vivo injections, as well as experimental design and analysis. Prof. Pieter R. Cullis, Dr. Yuen Yi C. Tam, Dr. Ying K. Tam, Dr. Paulo J.C. Lin, Dr. Marco A. Ciufolini, and Mr. Nathan M. Belliveau have all contributed experimental designs and ideas, and have been responsible for editing various versions of the thesis. Chapter two of this thesis has been published in a peer-reviewed journal, which involves AR gene silencing in vitro and in vivo using LNP AR-siRNA formulated with the DLin-KC2DMA cationic lipid. Lee, J. B., Zhang, K., Tam, Y. Y., Tam, Y. K., Belliveau, N. M., Sung, V. Y., Lin, P. J., LeBlanc, E., Ciufolini, M. A., Rennie, P. S., Cullis, P. R., 2012. Lipid nanoparticle siRNA systems for silencing the androgen receptor in human prostate cancer in vivo. International Journal of Cancer 131, 781-90. Animal Care Committee training program certificate number: 2835-08 Animal Care Protocol: A11-0359 (Pharmacokinetics and Biodistribution of LNPs) Animal Care Protocol: A12-0137 (siRNA Therapy)  iv  Table of Contents  Abstract.......................................................................................................................................... ii	
   Preface ........................................................................................................................................... iv	
   Table of Contents ...........................................................................................................................v	
   List of Tables ..................................................................................................................................x	
   List of Figures............................................................................................................................... xi	
   List of Abbreviations ................................................................................................................. xiv	
   Acknowledgements .................................................................................................................... xix	
   Chapter 1: Introduction ...............................................................................................................1	
   1.1	
   Prostate cancer statistics .................................................................................................... 1	
   1.2	
   The link between androgens and prostate cancer .............................................................. 1	
   1.3	
   Steroid hormones ............................................................................................................... 2	
   1.4	
   The androgen receptor ....................................................................................................... 4	
   1.4.1	
   The N-terminal domain of the AR .............................................................................. 7	
   1.4.2	
   The hinge region of the AR ........................................................................................ 8	
   1.4.3	
   The DNA-binding domain (DBD) of the AR ............................................................. 9	
   1.4.4	
   The ligand-binding domain (LBD) of the AR ............................................................ 9	
   1.5	
   The prostate anatomy ....................................................................................................... 11	
   1.6	
   Benign prostatic hyperplasia ............................................................................................ 12	
   1.7	
   Prostatic intraepithelial neoplasia .................................................................................... 13	
   1.8	
   Development of prostatic carcinoma ............................................................................... 14	
   1.9	
   Treatments for early stage (androgen-dependent) prostate cancer .................................. 17	
   v  1.10	
   Development of castration-resistant prostate cancer (CRPC) ....................................... 18	
   1.11	
   Treatments for castration-resistant prostate cancer........................................................ 20	
   1.12	
   RNA interference and gene silencing ............................................................................ 21	
   1.12.1	
   MicroRNA .............................................................................................................. 22	
   1.12.1.1	
   Dysfunctional endogenous miRNAs................................................................ 23	
   1.12.2	
   siRNA ..................................................................................................................... 25	
   1.12.2.1	
   Optimizing siRNA sequences .......................................................................... 28	
   1.12.2.2	
   Optimizing siRNA sequences for in vivo use .................................................. 29	
   1.12.3	
   shRNA .................................................................................................................... 30	
   1.12.4	
   RNAi treatments on non-AR therapeutic targets in prostate cancer ....................... 31	
   1.12.5	
   RNAi treatments on AR targets .............................................................................. 33	
   1.13	
   Liposomal nanoparticle delivery systems for conventional drugs ................................. 36	
   1.14	
   Liposomal nanoparticle delivery systems encapsulating genetic drugs ........................ 37	
   1.15	
   Liposomal nanoparticle delivery systems encapsulating siRNAs ................................. 38	
   1.16	
   Liposomal nanoparticle delivery systems used in the clinic for cancer treatments ....... 39	
   1.17	
   Cationic lipids ................................................................................................................ 39	
   1.18	
   Polyethylene glycol lipids .............................................................................................. 41	
   1.19	
   Methods for producing LNP encapsulating siRNA: pre-formed vesicles (PFV) .......... 41	
   1.20	
   Methods for producing LNP encapsulating siRNA: in-line T-tube approach ............... 43	
   1.21	
   Methods for producing LNP encapsulating siRNA: microfluidic mixing ..................... 43	
   1.22	
   Thesis objectives and hypothesis ................................................................................... 44	
   Chapter 2: Lipid Nanoparticle siRNA Systems for Silencing the Androgen Receptor in Human Prostate Cancer ..............................................................................................................47	
   vi  2.1	
   Introduction ...................................................................................................................... 47	
   2.2	
   Materials and methods ..................................................................................................... 48	
   2.2.1	
   Materials ................................................................................................................... 48	
   2.2.2	
   Cell culture, cell lines, and reagents ......................................................................... 49	
   2.2.3	
   siRNA sequences ...................................................................................................... 49	
   2.2.4	
   Encapsulation of siRNA into LNP (pre-formed vesicles) ........................................ 50	
   2.2.5	
   Western blotting and immunofluorescence .............................................................. 51	
   2.2.6	
   Confocal microscopy ................................................................................................ 51	
   2.2.7	
   Fluorescence microscopy .......................................................................................... 51	
   2.2.8	
   Flow cytometry ......................................................................................................... 52	
   2.2.9	
   Intraperitoneal injections of free siRNA in vivo....................................................... 52	
   2.2.10	
   Assessing effect of siRNA to knockdown AR in vivo ........................................... 52	
   2.2.11	
   5’RNA-linker-mediated rapid amplification of cDNA ends PCR .......................... 53	
   2.2.12	
   Statistical analyses .................................................................................................. 53	
   2.3	
   Results .............................................................................................................................. 54	
   2.3.1	
   Free AR-siRNA injections do not decrease tumor volume ...................................... 54	
   2.3.2	
   LNP AR-siRNA systems formulated with DLin-KC2-DMA exhibit maximum levels of gene silencing in LNCaP cells .......................................................................................... 55	
   2.3.3	
   The potency of LNP-siRNA systems containing DLin-KC2-DMA can be attributed to improved siRNA uptake and endosome release properties .............................................. 58	
   2.3.4	
   The species of PEG-lipid influences LNP-siRNA-induced AR silencing ................ 61	
   2.3.5	
   LNP AR-siRNA induced AR silencing in vitro in wild-type AR expressing LAPC-4 and variant AR expressing CWR22Rv1 cell lines ................................................................ 63	
   vii  2.3.6	
   Intravenous administration of LNP AR-siRNA can reduce serum PSA levels in mice bearing LNCaP tumors ......................................................................................................... 63	
   2.3.7	
   AR-induced specific cleavage of AR mRNA ........................................................... 67	
   2.4	
   Discussion ........................................................................................................................ 68	
   Chapter 3: Targeted LNP-siRNA Systems for Silencing the Androgen Receptor ...............71	
   3.1	
   Introduction ...................................................................................................................... 71	
   3.2	
   Materials and methods ..................................................................................................... 75	
   3.2.1	
   Materials ................................................................................................................... 75	
   3.2.2	
   Cell culture, cell lines and reagents .......................................................................... 76	
   3.2.3	
   siRNA sequences ...................................................................................................... 76	
   3.2.4	
   Encapsulation of siRNA into LNP using the microfluidic staggered herringbone micromixer ............................................................................................................................ 76	
   3.2.5	
   Characterization of LNP ........................................................................................... 77	
   3.2.6	
   Western blotting ........................................................................................................ 78	
   3.2.7	
   Confocal microscopy ................................................................................................ 78	
   3.2.8	
   Fluorescence microscopy .......................................................................................... 79	
   3.2.9	
   Pharmacokinetics of targeted and non-targeted LNP ............................................... 79	
   3.2.10	
   Assessing effect of AR knockdown in vivo............................................................ 80	
   3.2.11	
   Real-time reverse transcription PCR (qRT-PCR) ................................................... 81	
   3.2.12	
   Immunohistochemistry of tumor tissues ................................................................. 81	
   3.2.13	
   Statistical analyses .................................................................................................. 82	
   3.3	
   Results .............................................................................................................................. 82	
   3.3.1	
   DUPA-conjugated AR-siRNA is not an effective gene silencing system ................ 82	
   viii  3.3.2	
   LNP AR-siRNA systems containing the cationic lipid DMAP-BLP exhibit improved in vitro and in vivo gene silencing potency compared to LNP AR-siRNA systems containing DLin-KC2-DMA................................................................................................. 85	
   3.3.3	
   LNP containing AR21-siRNA exhibit improved in vitro and in vivo gene silencing potency as compared to LNP containing AR25-siRNA ....................................................... 89	
   3.3.4	
   LNP containing PEG-DSG exhibit long circulation times and improved tumor accumulation ......................................................................................................................... 91	
   3.3.5	
   Incorporation of DUPA-PEG-DSG into POPC-cholesterol LNP systems increases cellular uptake into LNCaP cells via a PSMA-dependent endocytotic mechanism ............. 94	
   3.3.6	
   Incorporation of DUPA-PEG-DSG into LNP-siRNA systems increase cellular uptake in LNCaP cells and enhances AR gene silencing via a PSMA-dependent endocytotic mechanism ............................................................................................................................ 97	
   3.3.7	
   LNP-siRNA systems containing the DUPA targeting ligand exhibit long circulation lifetimes............................................................................................................................... 101	
   3.3.8	
   DUPA targeted LNP AR-siRNA can enhance AR knockdown in mice bearing LNCaP tumors .................................................................................................................... 105	
   3.3.9	
   Intravenous administration of DUPA-LNP AR-siRNA reduces cellular proliferation but does not enhance apoptosis ........................................................................................... 108	
   3.4	
   Discussion ...................................................................................................................... 110	
   Chapter 4: Summarizing Discussion and Future Directions ................................................114	
   Bibliography ...............................................................................................................................119	
    ix  List of Tables Table 1.1  Non-AR genes involved in the development of prostate cancer ............................... 16	
    Table 1.2  Summary of gene silencing treatments using RNAi on non-AR targets in prostate  cancer ............................................................................................................................................ 33	
    x  List of Figures Figure 1.1  Production of testosterone and effects on the prostate ............................................... 3	
    Figure 1.2  Activation of the AR via androgen binding ............................................................... 6	
    Figure 1.3  Structure of the androgen receptor ............................................................................. 7	
    Figure 1.4  Ligand-binding pocket of the AR ............................................................................. 11	
    Figure 1.5  Cellular organization of a normal human prostate ................................................... 12	
    Figure 1.6  Overview of malignant transformation in the prostate ............................................. 14	
    Figure 1.7  RNA interference using miRNAs and siRNAs ........................................................ 27	
    Figure 1.8  Formulation of LNP with the pre-formed vesicle approach ..................................... 42	
    Figure 2.1  Free AR-siRNA injections do not decrease tumor volume ...................................... 54	
    Figure 2.2  Structures of the ionizable cationic and PEG-lipids employed ................................ 56	
    Figure 2.3  Silencing of the AR gene in LNCaP prostate cancer cells following incubation with  LNP AR-siRNA systems .............................................................................................................. 57	
   Figure 2.4  Influence of cationic lipid species on LNP uptake and knockdown in LNCaP and  LNCaP-eGFP ................................................................................................................................ 60	
   Figure 2.5  Influence of PEG-lipid species and concentration on silencing of the AR gene in  LNCaP, LAPC-4 and CWR22Rv1 cells ....................................................................................... 62	
   Figure 2.6  Systemic administration of LNP AR-siRNA results in decreased serum PSA levels  ....................................................................................................................................................... 66	
   Figure 2.7 AR-siRNA induces specific cleavages in AR mRNA ............................................... 67	
   Figure 2.8  Sequencing of 5'RLM-RACE PCR products produces a predicted cleavage site  within the AR siRNA .................................................................................................................... 68	
    xi  Figure 3.1  Monovalent (DUPA-) and trivalent (DUPA3-AR-siRNA) conjugates on cellular  uptake and AR gene knockdown in LNCaP cells in vitro ............................................................ 84	
   Figure 3.2  Influence of DMAP-BLP and DLin-KC2-DMA cationic lipid species on AR  knockdown in LNCaP cells in vitro .............................................................................................. 86	
   Figure 3.3  Systemic administration of LNP AR-siRNA containing DMAP-BLP reduces serum  PSA levels and enhances AR knockdown compared to LNP AR-siRNA containing DLin-KC2DMA ............................................................................................................................................. 88	
   Figure 3.4  LNP encapsulating AR21-siRNA results in enhanced AR knockdown in vitro and  further reduces serum PSA levels in vivo compared to LNP encapsulating AR25-siRNA ......... 90	
   Figure 3.5  Systemic administration of fluorescently labeled DiI-LNP AR-siRNA containing  5.0 mol% PEG-DSG results in greater accumulation in LNCaP tumors compared to LNP containing 2.5 mol% PEG-DSG ................................................................................................... 93	
   Figure 3.6  DUPA-LNP containing no ionizable cationic lipid enhances cellular uptake in  PSMA-positive LNCaP cells in vitro............................................................................................ 96	
   Figure 3.7  Structures of DMAP-BLP and PEG-DSG................................................................ 99	
    Figure 3.8  DUPA-LNP AR-siRNA enhances cellular uptake and AR gene silencing in PSMA-  positive LNCaP cells in vitro ...................................................................................................... 100	
   Figure 3.9  DUPA-LNP AR-siRNA does not enhance cellular uptake in PSMA-negative PC-3  cells in vitro................................................................................................................................. 101	
   Figure 3.10  DUPA-PEG-DSG exhibits 3 negative charges..................................................... 103	
    Figure 3.11  DUPA-LNP AR-siRNA and non-targeted DUPA-LNP AR-siRNA exhibit similar  pharmacokinetics ........................................................................................................................ 104	
    xii  Figure 3.12  Systemic administration of DUPA-LNP AR-siRNA lowers serum PSA levels and  enhances AR gene silencing ....................................................................................................... 107	
   Figure 3.13  Systemic administration of DUPA-LNP AR-siRNA decreases cellular proliferation  but does not induce apoptosis in tumor cells .............................................................................. 109	
    xiii  List of Abbreviations ApoE  apolipoprotein E  AR  androgen receptor  ARΔLBD  AR lacking a ligand-binding domain  ARA70  AR-associated protein 70  ARE  AR response element  ATP  adenosine triphosphate  Bcl-2  B-cell lymphoma 2  Bcl-xL  B-cell lymphoma extra large  BPH  benign prostatic hyperplasia  cDNA  complementary DNA  CHE  cholesteryl hexadecylether  Chol  cholesterol  clARE  classical AR response elements  COC  cyclin olefin copolymer  CRPC  castration-resistant prostate cancer  DBD  DNA-binding domain  DLinDAP  1,2-dilineoyl-3-dimethylammonium-propane  DLinDMA  1,2-dilinoleyloxy-N,Ndimethyl-3-aminopropane  DLinKDMA  1,2-dilinoleyloxy-keto-N,Ndimethyl-3-aminopropane  DLin-KC2-DMA  2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane  DLin-MC-3-DMA  dilinoleyl-methyl-4-dimethyl aminobutyrate  DMAP-BLP  3-(dimethylamino)propyl(12Z,15Z)-3-[(9Z,12Z)-octadeca-9,12xiv  dien-1-yl]henicosa-12,15-dienoate DMEM  Dulbecco’s modified Eagle medium  DNA  deoxyribonucleic acid  DGCR8  DiGeorge syndrome critical region 8  DHT  dihydrotestosterone  DUPA  2-[3-(1,3-dicarboxypropyl)-ureido]pentanedioic acid  EDTA  ethylenediaminetetraacetic acid  EGF  epidermal growth factor  eGFP  enhanced green fluorescent protein  EPR  enhanced permeability and retention  FDA  food and drug administration  FVII  factor VII  GFP  green fluorescent protein  GnRH  gonadotropin releasing hormone  HRE  hormone response element  Hsp  heat shock protein  IGF  insulin growth factor  i.p.  intraperitoneal  i.v.  intravenous  LBD  ligand-binding domain  LDL  low-density lipoprotein  LH  luteinizing hormone  LHRH  luteinizing hormone releasing hormone xv  LNP  lipid nanoparticles  MDV3100  enzalutamide/ 4-[3-[4-Cyano-3-(trifluoromethyl)phenyl]-5,5dimethyl-4-oxo-2-thioxo-1-imidazolidinyl]-2-fluoro-N-methylBenzamide  miRNA  micro RNA  mRNA  messenger RNA  NLS  nuclear localization signal  NTD  N-terminal domain  ODN  oligodeoxynucleotide  OGN  oligonucleotide  PAP  prostate specific acid phosphatase  PBS  phosphate buffered saline  PCR  polymerase chain reaction  PEG  polyethylene glycol  PEG-C-DOMG  (R-3-[( ω-methoxy-poly(ethyleneglycol)2000)carbamoyl)]-1,2dimyristyloxypropyl-3-amine)  PEG-S-DMG  (3-N-[(ω-methoxypoly(ethyleneglycol)2000)carbamoyl]-1,2dimyristyloxypropylamine)  PEG-DSG  (R)-2,3-bis(octadecyloxy)propyl-1-(methoxy poly(ethylene glycol)2000)carbamate  PIN  prostatic intraepithelial neoplasia  Plk I  polo-like kinase I  PMPA  2-(phosphonomethyl)-pentanedioic acid xvi  PSA  prostate specific antigen  PSMA  prostate specific membrane antigen  PSCA  prostate stem cell antigen  PTEN  phosphatase and tensin homolog  qRT-PCR  quantitative reverse transcriptase PCR  RACE  rapid amplification of cDNA ends  Raf-1  rapidly accelerated fibrosarcoma 1  RD162  4-[7-(4-cyano-3-trifluoromethyl-phenyl)-8-oxo-6-thioxo-5,7-diazaspiro[3.4]oct-5-yl]-2-fluoro-N-methyl-benzamide  RIPA  radioimmunoprecipitation assay  RISC  RNA-induced silencing complex  RLM  RNA-linked mediated  RNA  ribonucleic acid  RNAi  RNA interference  s.c.  subcutaneously  SC  scrambled siRNA control  selARE  selective AR response element  SHM  staggered herringbone micromixer  shRNA  short-hairpin RNA  siRNA  small-interfering RNA  SPLP  stabilized plasmid lipid particle  SRC1  steroid receptor coactivator 1  Stat3  signal transducer and activator of transcription 3 xvii  TE  transposable element  TIF2  ATP-dependent RNA helicase eIF4A  TLR  toll-like receptor  UTR  3’-untranslated region  xviii  Acknowledgements I would like to give many thanks to my supervisor, Prof. Pieter R. Cullis, for giving me the opportunity to perform research in his laboratory. Pieter is such a great person to work with, and it has been an absolute pleasure being a part of his laboratory throughout the years. I appreciate the skills he has taught me both inside and outside of the lab, especially with his strong ties in both academia and industry. I would also like to thank my committee members, Prof. Paul Rennie and Prof. Eric Jan, for their support, collaboration, and valuable experimental advice. There are so many members of the Cullis lab (both past and present) that I would like to thank, as you have truly made this project work! Dr. Chris Tam has been an extremely valuable resource to me throughout my entire time in graduate studies, as she has taught me many of the laboratory techniques, and helped me to optimize many of my laboratory protocols. She has been a great mentor and a great friend. Many special thanks to Dr. Barb Mui, Dr. Mick Hope, Dr. Paulo Lin, Dr. Ying Tam, Alex Leung, Nathan Belliveau, Sam Chen and Vanessa Sung who have all been with me throughout my entire time in the Cullis lab and have provided me with so much knowledge in the liposome field, as well as teaching me many of the laboratory protocols. I would also like to thank Dr. Chen Wan, Dr. Euan Ramsay, Dr. Genc Basha, Dr. Igor Zhigaltsev, Dr. Ismail Hafez, Dr. James Taylor, Dr. Kaley Wilson, Dr. Kim Wong, Dr. Rob Fraser, Dr. Theresa Allen, Ann Sun, Cayetana Schluter, Hans Zahn, Joslyn Quick, Mina Ordobadi, Nicole Rosin, Oleg Sannikov, Raymond Pan, Stuart Malcolm and Yan Liu for their support, instruction, discussion, assistance, and collaboration.  xix  I owe much gratitude to the talented collaborators I have worked with at the Vancouver Prostate Centre. Without their assistance, this work would not be possible. These individuals include Dr. Kevin Zhang, Dr. Eric Leblanc, Ms. Fariba Ghaidi and Ms. Jessica Firus. I would like to acknowledge the Canadian Institutes of Health Research (CIHR) and the UBC Four-Year Fellowship (4YF) for providing financial support in the form of studentships held over the course of my program. Special thanks to all of my Graduate Student friends and workmates in the BMB department. Thanks for all of the great times, especially Alina Chan, Alym Moosa, Anthony Khong, Dr. Daniel Horspool, Elizabeth Donohue, Dr. Jenna Riffell, Jennifer Leung, Dr. Jonathan Coleman, Kevin Du, Kelvin Lau, Kristina McBurney, Matt Solomonson, Nathan Belliveau and Stuart Malcolm. I would like to thank my family, Dr. Barry, Jeannie and Dr. Samantha Lee for their unconditional love and support. Thanks for always being there for me, and getting me through the tough times while I was away from home. Thank you to my cousins for encouraging me, and giving me the confidence to perform litmus testing on a daily basis: Adrienne Watson, Brianna Lee, Byron Lee, Evan Grant and Warren Tse. Finally, I would like to thank my friends back in Calgary for staying in close contact with me throughout my Ph.D. and making the trip out to Vancouver each year to visit: Elise MacDonald, Eoin Coll, Kevin Loose, Shaun McGuigan and Wendy Tsang.  xx  Chapter 1: Introduction 1.1  Prostate cancer statistics Prostate cancer is the second leading cause of cancer-related deaths (next to lung cancer)  in the United States as well as other Western countries and is the most frequently diagnosed cancer malignancy in males in the United States, accounting for 29% of all new cancer cases. Males have a 1 in 6 chance in developing this disease in their lifetime, 28,170 are expected to die from this disease in the United States alone and 241,740 new cases are diagnosed in 2012 (Siegel et al., 2012). 1.2  The link between androgens and prostate cancer In 1941, Huggins and Hodges first discovered a direct correlation between steroid  hormone levels (specifically androgens) and the development of prostate cancer. They found that two key serum enzyme markers, alkaline phosphatase and acid phosphatase, were upregulated in men diagnosed with prostate cancer (Gutman, 1936; Kay, 1929). Prostate cancer is largely hormonal-based, related to androgen levels in the bloodstream (Feldman and Feldman, 2001; Huggins and Hodges, 1941). However, the concentration of androgens in the bloodstream does not correlate with the extent or development of prostate cancer (Zhang et al., 2002). Huggins and Hodges were the first to develop hormonal therapies for prostate cancer in 1941, and discovered that they could reduce metastatic carcinoma of the prostate through castration (bilateral orchiectomy) or by administering the female sex hormone, estrogen (Huggins C., 1941). Conversely, levels of alkaline and acid phosphatase in the serum increased dramatically upon the addition of the male sex hormone, testosterone (Huggins C., 1941). In 1966, Huggins received the Nobel Prize in Medicine “for his discoveries concerning hormonal treatment of prostatic cancer.” 1  1.3  Steroid hormones Hormones are generally described as being either non-steroidal or steroidal hormones.  Non-steroidal hormones include polypeptides and those synthesized from modified amino acids. Examples of polypeptide hormones include two well-known metabolic hormones such as insulin (Banting et al., 1922) and glucagon (Behrens and Bromer, 1958). Examples of hormones synthesized from modified amino acids include thyroxine (made from iodinated tyrosine) (Episkopou et al., 1993) and epinephrine (made from hydroxylation of tyrosine) (Udenfriend and Wyngaarden, 1956). Steroidal hormones are subdivided into 5 groups including: androgens, estrogens, progestins, glucocorticoids and mineralocorticoids. The main focus for prostate cancer concerns androgens (testosterone), which affect sexual maturation and sexual behavior in males (Lehninger et al., 2005). Estrogens affect sexual maturation and behavior in females, glucocortiocoids influence the metabolism of carbohydrates, mineralocorticoids are used to regulate the concentrations of electrolytes in the blood and progestins are involved in the regulation of the female menstrual cycle (Lehninger et al., 2005). Prostate cancers rely heavily on androgenic steroid hormones for their growth and maintenance. Approximately 90% of testosterone is synthesized in the Leydig cells of the testis and the remaining 10% is synthesized in the adrenal cortex (Lonergan and Tindall, 2011). Testosterone production is largely controlled through a negative feedback loop (named the gonad-pituitary-hypothalamus axis) via activation with Luteinizing Hormone (LH) from the pituitary gland, which is controlled by Luteinizing Hormone Releasing Hormone (LHRH) from the hypothalamus (Figure 1.1). When testosterone enters the prostate, 90% of it is converted to dihydrotestosterone (DHT), a more potent form of testosterone that has a ten times greater affinity for the AR (Lonergan and Tindall, 2011).  2  Figure 1.1 Production of testosterone and effects on the prostate Testosterone is produced by the Leydig cells of the testes, which is controlled through the gonadpituitary-hypothalamus axis via LH and LHRH, respectively. Testosterone promotes the growth and function of the prostate. When testosterone enters the prostate 90% of it is converted to dihydrotestosterone (DHT), a more potent androgen. Adrenal glands can produce androstenedione and DHEA, which are weaker androgens, but can be converted to testosterone in other tissues. Figure adapted from (Rennie, 2008).  3  1.4  The androgen receptor The androgen receptor (AR) is a steroid hormone receptor that is responsible for the  growth and viability of the prostate gland (Lonergan and Tindall, 2011). Through immunohistochemical and RT-PCR studies, the AR has been primarily found in male reproductive tissues, including high expression in the prostate and lower expression in the testes (Ruizeveld de Winter et al., 1991). The AR is not found in significant levels in female reproductive tissues (Ruizeveld de Winter et al., 1991). In non-reproductive tissues in males, the AR is highly expressed in skin sebaceous glands, the thyroid gland, hypothalamus, Harderian gland, pituitary gland, adrenal glands and quadriceps (Chang et al., 1995; Ruizeveld de Winter et al., 1991). Lower levels of AR expression in males can be found in cardiac muscle, kidneys and hepatocytes (Chang et al., 1995; Ruizeveld de Winter et al., 1991). In humans, the AR gene is found on the X chromosome (q11-12) and codes for a polypeptide chain consisting of 919 amino acids with a mass of 110 kDa (Lonergan and Tindall, 2011). The AR has 3 domains including the N-terminal domain (NTD) (amino acids #1-584), DNA-binding domain (DBD) (585-612) containing two zinc fingers, the hinge region (not a domain) (613-662) and the C-terminal ligand-binding domain (LBD) (663-910) (Ing et al., 1992) (Figure 1.3). Before the ligand (testosterone or DHT) binds to the AR, it enters the cytoplasm and is bound to a series of molecular chaperone proteins, including heat shock protein 90 (Hsp90), Hsp70, Hsp40, Hop and p23 (Jenster et al., 1993). Initially, Hsp40 binds to the AR LBD, allowing for recruitment of Hsp70 (Smith and Toft, 2008). Hsp90 complexed with Hop, then forms a direct interaction with Hsp70 (Smith and Toft, 2008). The binding affinity of Hsp90 to the AR is enhanced when ATP is bound, and decreased when ATP is hydrolyzed (Ni et al., 2010). The cochaperone protein, p23, is able to interact with Hsp90, and promotes its “closed” (ATP-bound) state (Ni et al., 4  2010). Hsp90 must be present in order for the AR to maintain its ability to properly bind testosterone (Ni et al., 2010; Smith and Toft, 2008). In the absence of Hsp90, the AR cannot bind testosterone at temperatures above 25oC (Smith and Toft, 2008). The binding of testosterone or DHT causes a conformational change in the AR LBD (Smith and Toft, 2008). Subsequent release of Hsp90 is not dependent on this conformational change, but rather the rate of ATP hydrolysis at the nucleotide-binding domain of Hsp90 (Smith and Toft, 2008). When Hsp90 and the other molecular chaperones dissocate, the AR then forms an intramolecular interaction between the NTD and LBD, and is subsequently translocated into the nucleus via a nuclear localization signal (NLS) exposed on the hinge region at amino acids 613-662 (Gelmann, 2002; Zhou et al., 1994) (Figure 1.3). The dimerization of the AR is crucial for transcriptional activation to occur, however, the mechanism by which this occurs is not fully understood, many models currently exist (Centenera et al., 2008; van Royen et al., 2012). The current model for AR dimerization involves an intramolecular AR N/C-termini interaction between the NTD and LBD in the cytosol, followed by intermolecular homodimerization in the nucleus in a head-to-tail fashion (van Royen et al., 2012) (Figure 1.2). When the AR is dimerized and inside the nucleus, it is capable of interacting with the AR response element (ARE), in the promoter or enhancer regions of target genes (Mangelsdorf et al., 1995; van Royen et al., 2012) (Figure 1.2). Coactivators such as transcriptional mediators/intermediary factor 2 (TIF2) and steroid receptor coactivator-2 (SRC-2) bind to the LBD region, promoting transcriptional activity (Chan et al., 2012) (Figure 1.2). Many genes are activated via this pathway including those involved in cell proliferation and survival of the prostate, such as insulin-growth factor I (IGF-1), epidermal growth factor (EGF), cyclin-dependent kinase (Cdk) 1, Cdk2 and fibroblast growth factor (FGF) 8 (Clinckemalie et al., 2012; Feldman and Feldman, 2001; Jariwala et al., 2007). 5  Figure 1.2 Activation of the AR via androgen binding When the AR is not bound to its ligand, it is present in the cytoplasm bound to heat shock proteins (Hsp) that are subsequently moved to the nucleus following binding of androgens. The binding of androgen causes an intramolecular association of the NTD and LBD. The AR then enters the nucleus where receptor dimerization occurs in a head-to-tail fashion. Subsequent binding of the AR occurs on the androgen response element (ARE) found in promoter and enhancer regions of target DNA. Figure adapted from (van Royen et al., 2012).  6  Figure 1.3 Structure of the androgen receptor The AR consists of 910 amino acids with the N-terminal Domain (NTD) comprising more than half of the AR (amino acids 1-584). The NTD contains a polyglutamine region at residue 59, polyproline at residue 372, and polyglycine at residue 449. The NTD also contains the transcription activating function 1 domain (AF-1). The DNA-binding domain (DBD) is found between residues 584-612, the hinge region between amino acids 612-662. The ligand-binding domain (LBD) is found at the C-terminal end of the AR between residues 662-910. The LBD also contains an activating function 2 domain (AF-2), which binds to co-activators for transcriptional activity. Figure adapted from (Culig et al., 2002). 1.4.1  The N-terminal domain of the AR The NTD is the largest domain of the AR (amino acids 1-584) and consists of many  stretches of repeating amino acids that are essential for folding and structural integrity (Gelmann, 2002). This includes 17 to 29 repeating glutamine residues beginning at position 59, 9 proline residues beginning at residue 372, and 24 glycine residues at position 449 (Figure 1.3) (Davies et al., 2008). Shorter stretches of repeating glutamine residues have been shown to increase transcriptional activity of the AR (Davies et al., 2008). The NTD contains a ligand-independent transcription activating function 1 domain (AF-1) found between amino acids 101-370 and its presence is absolutely necessary for AR transcriptional activity (Haelens et al., 2007; Sadar, 2011). The NTD has been described as the “Achilles heel” of the AR, as no transcriptional 7  activity of AR-target genes exists in NTD deletion mutants (Sadar, 2011). Structure-based drug targeting to the AR NTD has been extremely challenging due to the AR NTD possessing a high degree of intrinsic disorder compared to the LBD (Gelmann, 2002; Sadar, 2011). Presently, a large majority of the drugs targeting the AR are directed towards the LBD (Sadar, 2011). The LBD and NTD of the AR act independently of each other, such that when the LBD is deleted from the AR, the NTD can still maintain transcriptional activity (Gelmann, 2002; Zhang et al., 2011). This constitutive activity of the AR NTD is thought to contribute to the progression of prostate cancer, some prostate cancer cell lines used extensively in the studies detailed in this thesis lack the LBD (ARΔLBD) (Chan et al., 2012). This includes highly passaged LNCaP and CWR22Rv1 cells (Haile and Sadar, 2011). 1.4.2  The hinge region of the AR The hinge region is a flexible region of the AR that is composed of approximately 50  amino acids at positions 613-662 (Figure 1.3) (Clinckemalie et al., 2012; Haelens et al., 2007). It aids in the translocation of the AR from the cytosol to the nucleus following dissociation of the chaperone heat shock proteins, as it is able to display the bipartite nuclear localization signal (NLS) (Chan et al., 2012; Kaku et al., 2008). The bipartite NLS consists of two clusters of basic amino acids, one in the DBD, and another in the hinge region. Nuclear localization is directed through binding of the AR to importin-α through residues 629-634 in the hinge region (Clinckemalie et al., 2012). The hinge region may also be important in distinguishing classical androgen response elements (clAREs) from selective androgen response elements (selAREs) (Clinckemalie et al., 2012). clAREs are recognized by other steroid hormone receptors, whereas selAREs are recognized only by the AR (Clinckemalie et al., 2012). Furthermore, the hinge region acts as a major site for post-translation modifications (Clinckemalie et al., 2012). This 8  can influence AR activity through acetylation, methylation, ubiquitylation and phosphorylation (Clinckemalie et al., 2012). Acetylation of the AR in the hinge region enhances AR transcriptional activity (Clinckemalie et al., 2012). Phosphorylation of Serine-650 in the hinge region downregulates AR transcriptional activity by enhancing AR export from the nucleus (Clinckemalie et al., 2012). Some mutations in the hinge region have been identified in prostate cancer patients including R629Q and K630T (Clinckemalie et al., 2012; Haelens et al., 2007). The K630T mutant has been well-characterized and exhibits enhanced responsiveness to lower hormone concentrations as compared to wild-type AR (Clinckemalie et al., 2012; Haelens et al., 2007). When this mutation is introduced into the well-known prostate cancer cell line LNCaP, cell survival and growth is promoted (Clinckemalie et al., 2012). 1.4.3  The DNA-binding domain (DBD) of the AR The DBD of the AR is a small region comprised of amino acids 584-612 (Figure 1.3)  (Verrijdt et al., 2006). It is the most conserved region of the AR amongst species possessing the AR (i.e. the human AR is 100% identical to the AR DBD found in rats) (Gelmann, 2002). There are 8 cysteine residues found in this region that coordinate 2 Zn2+ ions, which form two zinc finger motifs (Gelmann, 2002). The first zinc finger binds to the ARE through specific nucleotide pairings in the ARE consensus sequence: 5’-GGTACA-3’ (Gelmann, 2002). The second zinc finger contributes to the overall specificity of the AR to the ARE and assists in dimerization of the AR during DNA binding (Gelmann, 2002). 1.4.4  The ligand-binding domain (LBD) of the AR The LBD of the AR consists of ~250 amino acids (662-910) (Figure 1.3) (He et al.,  1999). As its name suggests, this domain is important for binding of androgens, which results in subsequent activation of the AR transcription pathway (Figure 1.2) (He et al., 1999; Verrijdt et 9  al., 2006). The LBD also contains activation function 2 (AF-2), which is important for interacting with co-activators to initiate gene transcription at the ARE (Figure 1.2) (Lonergan and Tindall, 2011). AF-2 is also important for interacting with amino acids 23-27 and 433-437 found in the NTD, and is of paramount importance for intramolecular activation (Figure 1.2) (Lonergan and Tindall, 2011). The crystal structure of the LBD has been solved and consists of 12 helices (Matias et al., 2000; Sack et al., 2001). Figure 1.4 shows the interaction of testosterone within the ligandbinding pocket of the AR (Gelmann, 2002). In prostate cancer, anti-androgens are used to competitively bind to the LBD, however, these anti-androgens (described in Section 1.9) begin to lose their effect as point mutations develop within the LBD (Lonergan and Tindall, 2011). These point mutations include changes in amino acids in the ranges of 670-676, 701-730 and 874-910 (Buchanan et al., 2001). As can be observed in Figure 1.4, many of these amino acid stretches have direct interaction with the testosterone ligand (Lonergan and Tindall, 2011). Specifically, this includes the residues N705, Q711, H874, F876, T877 (Lonergan and Tindall, 2011). Consequently, point mutations within the AR LBD can permit more “promiscuous” binding to other types of steroid ligands including progestagens, estrogens and various anti-androgens, which cause inappropriate activation of the AR (Buchanan et al., 2001). This is discussed in further detail in Section 1.10 as these point mutations can contribute to the development of castration-resistant prostate cancer. A commonly used cell line to study prostate cancer is LNCaP, which has a point mutation in the LBD region (T877A) (Gelmann, 2002). The LBD is especially important with regard to this thesis, as this is the region targeted by the siRNA used as a potential prostate cancer therapeutic.  10  Figure 1.4 Ligand-binding pocket of the AR Detailed view of the AR ligand-binding pocket. T877 is point-mutated in LNCaP cells and is important for direct interaction with the androgen ligand. Other important residues are highlighted as they directly interact with androgenic ligands. Figure used with permission from (Gelmann, 2002). 1.5  The prostate anatomy The prostate’s main role in the body is to produce seminal (or prostatic) fluid. It is a  tubuloaleveolar gland, composed of multiple secretory acini (Isaacs, 1999) (Figure 1.5). It is lined by glandular epithelial cells and contains a fibromuscular stroma (Feldman and Feldman, 2001; Isaacs, 1999) (Figure 1.5). The acini lumen is composed of prostatic fluid secreted from the glandular epithelial cells, which are specialized in protein synthesis and secretion (Isaacs, 1999). The glandular epithelium is where prostatic carcinoma mainly occurs, particularly in the luminal secretory cells, but in a smaller percentage of cases, in neuroendocrine and basal cells. Luminal secretory cells express the AR in high levels and require androgens in order to survive (English et al., 1987). In a healthy prostate, the majority of luminal epiethlial cells are quiescent and are long lived, with very little cell proliferation or cell death (Feldman and Feldman, 2001).  11  Figure 1.5 Cellular organization of a normal human prostate Note the glandular epithelial cells lining the acini lumen (white). The prostate has a loose fibromuscular stroma with widely spaced smooth muscle bundles. Figure used with permission from (Isaacs, 1999). 1.6  Benign prostatic hyperplasia The prostate is normally quiescent, but extensive growth of the prostate occurs in nine out  of ten males by the age of 80 (Kristal et al., 2010; Thorpe and Neal, 2003). This is caused by increased DHT presence in the prostate, which causes extensive cellular proliferation of glandular epithelial cells and stromal tissue (Thorpe and Neal, 2003). The increase in prostatic volume can result in symptoms such as frequent urination, sudden compelling desire to void, weak urinary stream, and nocturia (waking from sleep to void) (Thorpe and Neal, 2003). Many men visit their health care practitioner when these symptoms arise, to check for prostate cancer. To confirm whether the increased prostatic volume is due to BPH or prostatic carcinoma, cytologic evaluation is performed (Knudsen and Vasioukhin, 2010). If the cellular morphology 12  remains columnar and the nuclear cytology remain normal, the enlargement is considered benign and the condition is diagnosed as BPH (Knudsen and Vasioukhin, 2010; Thorpe and Neal, 2003). BPH is not generally regarded as a precursor for prostate cancer (Knudsen and Vasioukhin, 2010). To decrease prostatic volume, BPH can be remedied with 5α-reductase inhibitors such as finasteride or duasteride, which significantly reduce DHT concentrations in the prostate (Tacklind et al., 2010). Prostatectomy is another option that can alleviate the symptoms of BPH (Tacklind et al., 2010). 1.7  Prostatic intraepithelial neoplasia Extensive growth of the prostate can progress to a condition known as prostatic  intraepithelial neoplasia (PIN). PIN is classified as high or low grade depending on the severity (Bostwick, 2000). High grade PIN is generally considered a precursor for prostate cancer as 60 to 95% of malignant prostate cancers originate in this form (Ayala and Ro, 2007). In contrast to BPH the luminal epithelial cells proliferate but show different morphology and enlargement of the nucleus (Ayala and Ro, 2007). Upon further loss of integrity of the basal cell layer, and basement membrane, high grade PIN can evolve into prostatic carcinoma with subsequent metastasis (Figure 1.6) (Knudsen and Vasioukhin, 2010).  13  Figure 1.6 Overview of malignant transformation in the prostate Normal prostate epithelial cells can develop into malignant tumor cells, which can give rise to early tumor development known as PIN. This can then evolve into metastatic prostatic carcinoma. Figure used with permission from (Rennie, 2008). 1.8  Development of prostatic carcinoma Detection of prostate cancer can be determined through symptoms (including those  discussed in Section 1.6), physical examination (via digital rectal exam), serum PSA levels, and cytologic evaluation (Knudsen and Vasioukhin, 2010). Cytologic evaluation can confirm the presence of prostatic carcinoma (Knudsen and Vasioukhin, 2010). Prostatic carcinoma occurs when there are morphological changes to the luminal epithelial cells (Knudsen and Vasioukhin, 2010). This includes excessive cell branching, loss of the basal cell layer, and enlargement of the nucleus (Knudsen and Vasioukhin, 2010). Tumors usually present on the periphery of the prostate and are often multifocal (Ayala and Ro, 2007; Knudsen and Vasioukhin, 2010). Early stage prostate cancer treatments are discussed in Section 1.9, followed by a discussion of prostate cancer treatments used for advanced/metastatic disease in Section 1.11. Prostate cancer can progress through upregulation of a number of oncogenes, and downregulation of tumor suppressors (Isaacs and Kainu, 2001). These include, but are not  14  limited to PTEN, RB, p53, BRCA2, CDKN1B, ATBF1, and the AR (Isaacs and Kainu, 2001). Studies demonstrating dysregulation of these proteins are discussed in Table 1.1.  15  Table 1.1  Non-AR genes involved in the development of prostate cancer  Gene  Normal Gene Function  Effect on Prostate Cancer  References  PTEN  PTEN (phosphatase tensin homolog) is a phosphatase enzyme and acts as a tumor suppressor in the cell. It triggers cells to stop dividing and induces cellular apoptosis.  Many advanced prostate cancer specimens have revealed that PTEN is inactivated by hemi- and homozygous deletions, in addition to point mutations. Localized prostate cancers have abnormal PTEN expression; 1 out of 5 cases of localized prostate cancer have no PTEN expression. The RB1 gene locus is lost in a significant percentage of patients with advanced prostate cancer. Deletion of the gene locus for RB1 (13q14.2) is found in 5% of primary prostate tumors, and 37% in metastatic prostate tumors.  (Baker, 2007; McMenamin et al., 1999; Wang et al., 1998)  p53 mutations are rare in primary prostate tumors, but are more common in patients with metastatic prostate tumors. p53 mutations occur frequently in patients receiving radiation therapy. Families carrying BRCA2 mutations have increased risk of developing prostate cancer. In addition a 5-bp deletion of BRCA2 has been shown to result in an increased risk for developing prostate cancer. ATBF1 undergoes frequent frameshift/nonsense mutations in prostate cancer patients, often resulting in transcriptional downregulation.  (Grignon et al., 1997; Lane, 2005)  Single nucleotide polymorphisms have been determined in CDKN1B and found to increase the risk of prostate cancer in younger patients.  (Chang et al., 2004; Kibel et al., 2003)  RB1  RB (retinoblastoma) is a tumor suppressor protein that regulates cell growth and inhibits rapid cellular proliferation. It can interact with other proteins to influence both cell survival and apoptosis. p53 p53 (tumor protein 53) is a tumor suppressor and binds directly to damaged DNA. p53 activates DNA repair, and inhibits apoptosis if DNA damage is irreversible. BRCA2 BRCA2 (breast cancer 2, early onset) is a tumor suppressor and interacts with a number of other proteins that mend breaks in damaged DNA. ATBF1 ATBF1 (ZFHX3 – zinc finger homeobox 3) is a transcriptional factor that functions as a tumor supressor. It transactivates the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (p21CIP1). CDKN1B CDKN1B (cyclin-dependent kinase inhibitor 1B) is a protein that prevents the activation of the cell cycle.  (Sharma et al., 2010; Taylor et al., 2010)  (Edwards et al., 2003)  (Sun et al., 2005)  16  The genes discussed in Table 1.1 play a large role in the development of prostate cancer, but further characterization is required to pinpoint their exact molecular and biological roles in the progression of this disease (Dong, 2006). The AR is another gene that could be added to this list, details about the AR and its involvement in the development of advanced (castrationresistant) prostate cancer will be discussed in Section 1.10. 1.9  Treatments for early stage (androgen-dependent) prostate cancer When prostate cancer is diagnosed at an early stage, it may be confined to the prostate.  Localized prostate cancer can be treated through a prostatectomy or radiation therapy (Rennie, 2008). A problem is that many patients with early stage of prostate cancer do not present any symptoms, and those that do may have already experienced metastasis (Rennie, 2008). First line treatments for men with advanced prostate cancer or metastatic prostate cancer largely use androgen ablation techniques. Surgical castration can be an option, but is often not the preferred method of treatment. Medical castration can be achieved through administration of steroidal and non-steroidal antiandrogens and LHRH agonists/antagonists (Moul, 2009). In the 1960s and 1970s, many steroidal anti-androgens were used for treatment of prostate cancer including cyproterone acetate (Geller et al., 1968), megestrol acetate (Johnson et al., 1975), and medroxyprogesterone acetate (Nolten et al., 1976), all of which bind to the LBD on the AR. These steroidal anti-androgens caused significant libido loss and impotence. These unwanted side effects were resolved through the discovery of non-steroidal antiandrogens. These included flutamide (Sogani et al., 1975) and bicaluatamide (Casodex) (Furr, 1989; Iversen et al., 1996). LHRH agonists (or Gonadotropin releasing hormone agonists) such as leuprolide, goserelin, and buserelin became available in the United States in 1984 (Moul, 2009), which bind to GnRH receptors on the pituitary (Figure 1.1) (Droz et al., 2002). LHRH agonists cause a depression of 17  LH release through downregulation of LHRH receptors on the pituitary. LHRH agonists can cause an increased flare response (i.e. an increase in testosterone) upon administration with increased LH secretion, but this effect wears off quickly, and the GnRH receptors are downregulated, causing less testosterone to be released (Droz et al., 2002). Administration of an anti-androgen 30 days prior to treatment with LHRH agonists can inhibit the flare response (Droz et al., 2002). LHRH antagonists can also be used, and these tend to avoid the testosterone flare response (Crawford and Hou, 2009). The first LHRH antagonist (abarelix) was approved by the FDA in late 2003. Manufacturing ceased shortly afterwards as abarelix caused significant histamine release, and only worked at lowering testosterone levels in 62-71% of prostate cancer patients (Crawford and Hou, 2009). A more effective LHRH antagonist (degarelix) was produced in 2008, which blocked binding to the LHRH receptor (Crawford and Hou, 2009). Unlike LHRH agonists, no flare response was produced, and suppression of testosterone occurs much more rapidly than with LHRH agonists (Crawford and Hou, 2009). 1.10 Development of castration-resistant prostate cancer (CRPC) Androgen ablation therapy eventually fails, due to advancement of prostate cancer to castration-resistant (or androgen-independent) disease (Feldman and Feldman, 2001). Many patients that receive androgen ablation become castration-resistant in a median of 18-24 months (Petrylak et al., 2004). Once patients are diagnosed with metastatic CRPC, the disease is lethal with a median survival time of 10-12 months (Petrylak et al., 2004). Five possible mechanisms leading to CRPC are (1) The AR may become hypersensitive, due to increased copies of the AR, or increased co-activators of the AR (Feldman and Feldman, 2001; Gregory et al., 2001). The AR itself may also become more sensitive and have greater affinity for testosterone and DHT (Gregory et al., 2001). AR activation can also be enhanced by an overall increase in androgen 18  levels present in the prostate. This may due to an increase in 5α-reductase activity, resulting in higher levels of DHT (Labrie et al., 1986). There can also be over-expression of co-activators, which will lower the ligand threshold of the AR (Chmelar et al., 2007). (2) The AR itself may become more promiscuous, and undergo mutations in the LBD that result in an ability of other molecules to activate the AR pathway (Feldman and Feldman, 2001). For example, in prostate cancer patients who experience a tyrosine to alanine mutation at amino acid position 877 (T877A) in the LBD, oestrogens, progestins, and other anti-androgens can act as agonists (Veldscholte et al., 1992). This type of mutation exists in the LNCaP prostate cancer cell line. Over-expression of co-activator proteins such as ARA70, TIF2, and SRC1 can also cause enhanced AR signaling (Gregory et al., 2001). The AR may also be formed from alternatively spliced variants that lack a LBD entirely, resulting in a constitutively active AR (Hu et al., 2009). (3) The AR may become activated by a ligand-independent mechanism, referred to as an outlaw mechanism (Feldman and Feldman, 2001). Epidermal growth factors (EGF), keratinocyte growth factors (KGF) and insulin-like growth-factor-1 (IGF-1) can cause activation of the AR both directly and indirectly (Culig et al., 1994). Experiments have also been performed in castrated mice using androgen-independent cell lines. These androgen-independent cell lines showed that there was an increase in AKT (Protein Kinase B) activity and downregulation of p27 (a cell cycle inhibitor), all of which are conditions that would promote tumor growth and inhibit apoptosis (Feldman and Feldman, 2001). As well, the Her-2/neu receptor, which can directly activate the mitogen-activated protein kinase (MAPK) pathway, can also cause phosphorylation of the AR, which can promote survival and tumor growth (Feldman and Feldman, 2001). (4) There are other mechanisms and pathways that completely bypass the AR pathway (Feldman and Feldman, 2001). This includes activation of Bcl-2, a gene, which is not highly expressed in 19  healthy prostate epithelial cells (Liu et al., 1996). Over-expression of Bcl-2 blocks the process of apoptosis and is stimulated by androgen ablation therapies (Gleave et al., 1999). It has been shown that administration of Bcl-2 antisense olignonucleotides as an adjuvant can delay the progression to castration-resistant prostate cancer (Gleave et al., 1999). (5) Castration-resistant prostate cancer can also emerge from “lurker” androgen-independent stem cells (Isaacs, 1999). This hypothesis is based initially on healthy epithelial stem cells that differentiate into androgendependent prostate cancer cells. When androgen ablation occurs, these malignant androgendependent prostate cancer cells die, and the lurker androgen independent stem cells then emerge, which are castration-resistant. Eventually, this progression to castration-resistant disease results in a majority of the cancer cells with an androgen-independent phenotype (Isaacs, 1999). 1.11 Treatments for castration-resistant prostate cancer Treatment of CRPC is palliative, usually to treat bone pain due to bone and lymph node metastasis (Droz et al., 2002; Petrylak et al., 2004). Palliative care includes radiotherapy and has a response rate of 80%, but does not improve overall survival of patients (Droz et al., 2002). Administration of taxanes including docetaxel and mitoxantrone is a common CRPC treatment (Petrylak et al., 2004). As discussed above, many CRPCs are still dependent on AR activity, and therefore many of the therapeutics designed for CRPC will target the AR (Feldman and Feldman, 2001). First generation anti-androgen therapeutics such as bicalutamide and flutamide can actually produce an AR agonist effect upon treatment in CRPC patients with high AR expression levels (Tran et al., 2009). To alleviate this situation, second-generation antiandrogens have been developed including RD162 and MDV3100 (Medivation), which have a higher affinity towards the AR and prevent translocation of the AR into the nucleus (Tran et al., 2009). The result is that RD162 and MDV3100 can maintain AR antagonistic effects in castration-resistant prostate 20  cancer cell lines (Tran et al., 2009). MDV3100 was chosen for clinical trials in patients who were resistant to first-line antiandrogen treatments, and the results demonstrated that the drug was well-tolerated and caused a significant decrease in serum PSA levels in most patients (Tran et al., 2009). MDV3100 was recently approved by the FDA in August 2012 and is specifically used to treat “men who are castrate resistant after they have failed chemotherapy” (http://advancedprostatecancer.net/?cat=435). A cellular immunotherapy for CRPC has recently been developed known as sipuleucel-T (Higano et al., 2010). The drug exploits the prostate specific marker PAP, and elicits an antigenspecific response causing T-cell stimulation to destroy prostate tumor cells (Patel and Kockler, 2008). Sipuleucel-T is constructed as a recombinant fusion protein of PAP and granulocytemacrophage colony-stimulating factor (GM-CSF) (Higano et al., 2010). Three days prior to leukapheresis, peripheral blood mononuclear cells are withdrawn from each cancer patient, and then erythrocytes, granulocytes, platelets, lymphocytes and low-density monocytes are removed (Patel and Kockler, 2008). This leaves behind dendritic cells, T-cells, monocytes, B cells and natural killer cells, which are processed and cultured ex vivo with the recombinant fusion protein. The subsequent product is administered to the patient via leukapheresis (Higano et al., 2010; Patel and Kockler, 2008). 1.12 RNA interference and gene silencing As much of the progression to CRPC requires the AR, it would seem useful to develop a therapeutic that effectively silences the AR gene. Andrew Fire and Craig Mello first introduced the concept of gene silencing using RNA interference (RNAi) with administration of doublestranded RNA (dsRNA) into Caenohabditis elegans (Fire et al., 1998). When dsRNA against unc-22 (a gene that encodes for an abundant non-essential myofilament protein) was injected 21  into C. elegans, Fire and Mello observed twitching movements, similar to a phenotype in C. elegans with loss-of-function unc-22 mutants (Fire et al., 1998). This seminal paper sparked a new research field, as this novel technique could be exploited to silence genes in other organisms and provide the opportunity to discover the function of other genes that were previously unknown. From a therapeutic perspective, this provided a novel technique that could potentially silence disease-causing genes, including those that cause cancer. In 2006, Fire and Mello were awarded the Nobel Prize in Physiology or Medicine for their discovery of “RNA interference – gene silencing by double-stranded RNA.” RNAi pathways are triggered by 21-25 nt long noncoding RNAs which include small interfering RNAs (siRNAs) as well as single-stranded miRNA in many eukaryotes (Elbashir et al., 2001; Lin et al., 2005). MicroRNAs and siRNAs can both cause gene silencing and use a common set of proteins, as will be discussed further in the sections below. 1.12.1 MicroRNA The majority of this thesis focuses on the in vitro and in vivo delivery of siRNAs as a prostate cancer therapeutic, but it is also important to describe endogenously expressed miRNAs and their role in prostate cancer progression. MiRNAs are non-coding RNA structures that are ~20-22 nt in length (Ambros, 2001). They were first discovered as early as 1993 when studying developmental timing events in C. elegans (Ambros, 2001; Wightman et al., 1993). MiRNAs regulate mRNA transcripts through hybridization of the 3’untranslated region (UTR) (Sevli et al., 2010). Each miRNA has the potential to target hundreds of distinct genes (Guo et al., 2010). In animals, miRNAs do not require perfect complementary to their target mRNAs, but they do require a seed region of perfect complementary that is roughly 7-8 nt in length (Bartel, 2004; Sevli et al., 2010). In the canonical miRNA pathway, miRNAs are transcribed first as a primary 22  miRNA hairpin-like structure (pri-miRNA) in the nucleus and then processed by 2 proteins DGCR8/Drosha to form 70 nt hairpin pre-miRNAs (DeVere White et al., 2009; Gregory et al., 2006). However, there also exists intronic miRNAs (mirtrons), which act independently of Drosha cleavage and are spliced (via splicesome reactions) and de-branched enzymatically prior to forming pre-miRNAs (Okamura et al., 2007). Pre-miRNAs are exported from the nucleus via exportin-5 and then processed in the cytoplasm by the RNaseIII enzyme, Dicer, which yields an miRNA duplex ~20-22 nt in length (Filipowicz et al., 2008; Lund and Dahlberg, 2006). The resulting miRNA duplex associates with members of the Argonaute (Ago) protein family that are part of the miRNA-induced silencing complex (miRISC) (Hu et al., 2009). Only the guide strand is selected to associate with miRISC, and this strand is preferentially selected based on a uridine (U) nucleotide present at the 5’ end, in addition to possessing high overall purine nucleotide content (i.e. adenine and guanine) (Hu et al., 2009). The guide strand takes the miRISC complex to the specific mRNA sequence, and the argonautes associated with miRISC affect mRNA expression (Filipowicz et al., 2008) (Figure 1.7). Up until 2012, much controversy existed on the mechanism of how miRNAs enhanced translational repression. A recent breakthrough demonstrated that most miRNAs repress translation through repression of translation initiation (Janas et al., 2012). 1.12.1.1 Dysfunctional endogenous miRNAs Dysfunctional miRNAs can promote tumorigenesis as they can act as “oncomirs,” just as dysfunctional proteins can act as oncogenes in the progression of many cancers (DeVere White et al., 2009). MiRNAs that are overexpressed can act as inhibitors of tumor suppressors (DeVere White et al., 2009; Sevli et al., 2010). For instance, miR-17-92 encodes a cluster of six miRNAs that are over-expressed in prostate cancer tumors (Sevli et al., 2010). The miRNAs expressed 23  from the miR-17-92 gene cluster, inhibit gene expression of commonly know tumor suppressors such as PTEN and p21 (Sevli et al., 2010). MiRNAs can also downregulate the expression of proto-oncogenes that cause tumorigenesis (Zhang et al., 2009). An example of this is the downregulation of miR-17-3p, but when expression vectors containing miR-17-3p are administered, reduction in tumorigenesis is observed (Zhang et al., 2009). Progression to CRPC can be partially attributed to miRNA expression through a cause and effect relationship (DeVere White et al., 2009). Castration-resistant cell lines express 10 upregulated miRNAs and 7 downregulated miRNAs compared to androgen-dependent cell lines (DeVere White et al., 2009). For example, miR-221 and miR-222 are upregulated in androgenindependent cell lines, as they downregulate the tumor suppressor p27 (Sevli et al., 2010). Other examples include miR-15a/16-1, which when deactivated, promote prostate hyperplasia and cause enhanced cellular proliferation (Bonci et al., 2008). An extensive list of miRNAs that are dysregulated in prostate cancer is available (Sevli et al., 2010), and it is thought that some of these miRNAs can be used as a diagnostic tool for screening prostate cancer patients, as it has been shown that miRNAs can be released into cellular exosomes, which are small cellular secretory vesicles that can contain mRNAs and pre-miRNAs (Chen et al., 2010; Hu et al., 2012). Activation of endogenous miRNAs could potentially have therapeutic benefits for prostate cancer patients. Resveratrol (trans-3, 4’,5-trihydroxystilbene), which is an antioxidant found in grapes and red wine, has been shown to reduce prostate cancer growth and invasiveness by downregulating miR-21 (an anti-tumor suppressor) expression in PC-3M-MM2 cells (a highly invasive bone metastatic prostate cancer cell line) (Sheth et al., 2012).  24  1.12.2 siRNA Following the discovery of RNAi in 1998 by Fire et al., it was demonstrated that production of synthetic small interfering RNA (siRNA) could be used to knockdown specific genes in several mammalian cell lines (Elbashir et al., 2001). Since then, work involving siRNA knockdown has been published extensively aiming to treat human diseases ranging from viral infections, dominant genetic disorders, autoimmune disease and cancer (Miele et al., 2012). SiRNAs are initially derived from perfectly base-paired dsRNAs (Carthew and Sontheimer, 2009). In humans, three proteins (Dicer, TRBP, and Ago-2) form the RISC complex (Maniataki and Mourelatos, 2005). The RISC complex binds dsRNA, dices it into siRNA and loads the “guide strand” onto Ago-2 (Carthew and Sontheimer, 2009). The guide strand directs the RISC complex to the complementary mRNA while the “passenger strand” (complementary to the guide strand) is subsequently discarded (Carthew and Sontheimer, 2009; MacRae et al., 2008). The strand that is chosen as the guide strand is the strand that has the weakest base-pairing interaction at the 5’ terminus of the siRNA (Tomari and Zamore, 2005). Experimentally designed siRNAs will allow the RISC complex to bind with the guide strand and form perfect complementary with the target mRNA (Carthew and Sontheimer, 2009). The mRNA then undergoes an endonucleolytic cleavage between nucleotides 10 and 11 from the 5’ end, which is induced by Ago-2 (Tomari and Zamore, 2005). Exonucleases present in the cell perform complete degradation of the mRNA, after the initial cleavage by Ago-2 is made (Orban and Izaurralde, 2005). In eukaryotic cells, this occurs through initial deadenylation of the mRNA poly-A tail, followed by either decapping plus subsequent 5’ to 3’ exoribonuclease (Xrn1p) activity, or just 3’ to 5’ exonucleolytic degradation (Valencia-Sanchez et al., 2006). If perfect complementarity of the guide strand and mRNA do not match, endonucleolytic cleavage 25  is severely inhibited (Tomari and Zamore, 2005). Translational repression and exonucleolytic digestion of the mRNA may still exist in an miRNA-like fashion, if the siRNA guide strand is mismatched (Tomari and Zamore, 2005).  26  Figure 1.7 RNA interference using miRNAs and siRNAs miRNAs are transcribed in the nucleus into ~70 nt hairpin pri-mRNAs. Drosha/DGCR8 processes the pri-miRNAs into individual ~70 nt pre-miRNAs. They are then exported to the nucleus via Exportin 5. Dicer then processes the pre-miRNA into a miRNA:miRNA duplex. The anti-sense strand is assembled onto the RISC complex. The RISC complex binds to target mRNAs causing translational repression. dsRNA is processed by Dicer into an siRNA duplex. The anti-sense strand is loaded into RISC used to silence gene expression by mRNA cleavage via endonuclease activity. Figure used with permission from (He and Hannon, 2004). 27  1.12.2.1 Optimizing siRNA sequences The RNAi response exists as an innate defense mechanism from viruses and transposable elements (TE) (Obbard et al., 2009). Consequently, when exogenous siRNAs are introduced into an organism, they can elicit an immune response, which can be a major challenge to overcome in developing siRNA-based therapeutics (Peek and Behlke, 2007). However, exogenous siRNAs can be specifically tailored to promote optimal gene silencing and minimize stimulation of the immune system (Peek and Behlke, 2007). These siRNA modifications will be described in detail below: (1) The general location that siRNA targets to the mRNA does not appear to correlate with potency, as siRNAs complementary to the coding region or the 3’UTR are equally effective at gene silencing (Peek and Behlke, 2007). However, it is important to identify whether or not splice variants exist for the gene of interest, as this would disrupt siRNA complementary to target mRNAs (Peek and Behlke, 2007). (2) The 5’ end of the guide strand must be lower in stability (i.e. more A/U rich) and the 5’ end of the passenger strand must be more stable thermodynamically (i.e. more G/C rich) (Peek and Behlke, 2007). The 3’ end of the passenger strand should also have reduced complementary with the 5’end of the guide strand to further lower stability (Peek and Behlke, 2007). (3) Certain nucleotides in the guide strand at specific positions enhance gene silencing (Peek and Behlke, 2007). This includes an A or U at position 1, a G or C at position 19, an A or U in position 10, and overall A/U content in positions 1-7 (Peek and Behlke, 2007). It is also helpful to have homopolymeric runs (4 or more identical nucleotides) to improve specificity of guide strands to the target mRNA (Peek and Behlke, 2007). 28  (4) SiRNA sequences must be screened for homology to other target genes to prevent offtarget effects (Peek and Behlke, 2007). 1.12.2.2 Optimizing siRNA sequences for in vivo use SiRNAs are very prone to nuclease degradation in the serum. The 3’ ends of the siRNAs that contain single-stranded overhangs are particularly susceptible to degradation (Behlke, 2008). The half-life reported for unmodified/unprotected siRNAs in the serum is only several minutes to an hour (Dykxhoorn et al., 2006; Morrissey et al., 2005; Zimmermann et al., 2006). One of the approaches to stabilizing siRNAs in serum is to modify the phosphodiester backbone (Behlke, 2008). The non-bridging oxygen can be replaced with a sulfur atom (phosphorothioate), borate (BH3-), nitrogen (phosphoramide), or methyl groups, which prevent degradation by nucleases (Behlke, 2008). As well, the 2’oxygen (2’O) on the ribose sugar can be modified with the addition of a methyl group (2’OMe) or substituted with a fluoro group (2’-F) (Behlke, 2008; Czauderna et al., 2003). If all nucleotides present in the siRNA sequence are substituted with 2’OMe modifications, there is a significant loss of RNAi activity (Czauderna et al., 2003). However, if the nucleotides are alternating with the 2’OMe modification, the potency can be restored to that of the unmodified siRNA sequence (Czauderna et al., 2003). 2’OMe modifications are naturally occurring and do not cause any significant toxicity (Behlke, 2008). Studies have shown that alternating 2’-F pyrimidines and 2’OMe purines create very stable siRNAs in serum, and a dramatic improvement in in vivo potency (Morrissey et al., 2005). Another major problem with unmodified synthetic siRNAs is that they may activate an unwanted immune response. Toll-like receptors (TLRs) 3, 7 and 8, which are present in endosomal compartments may trigger a type I interferon (IFN) immune response when synthetic siRNAs enter the cell (Ma et al., 2005). This is particularly important for siRNAs encapsulated 29  in lipid nanoparticles (LNP) as these particles are taken up through cellular endocytotic pathways (Heidel et al., 2004). This immune response can be avoided in the same way siRNAs evade nuclease degradation, and that is through the incorporation of 2’OMe modifications (Judge et al., 2006). Introduction of 2’deoxy nucleotides (dT or dU) have also been reported as a method for evading the immune response (Eberle et al., 2008). SiRNAs used for in vivo purposes must also take into account unwanted participation within the miRNA pathway, leading to off-target gene repression (Behlke, 2008). Also, sequestering the factors involved in the miRNA pathway is required. As mentioned previously, miRNAs do not need to have perfect complementary base-pairing with their target mRNAs within the 3’UTR. The exception of course is within the seed region, which is generally found within a 6-7 nt region (Anderson et al., 2008). Because the seed region only requires complementary binding of a short 6-7 nt sequence, it is entirely possible that siRNAs may cause off-target repression of other genes. Anderson et al. has screened the entire human genome to identify how frequent certain hexamer sequences exist within the 3’UTR. As expected, siRNA sequences that had high seed complement frequencies (SCFs) gave the highest number of offtarget effects through microarray analysis (Anderson et al., 2008). Thus, it is very important to screen for off-target effects of siRNA sequences prior to using them as an in vivo therapeutic. Dharmacon (Thermo Scientific) has incorporated an siRNA evaluation tool in a web-based application that can evaluate siRNA strands for seed complement regions based on their frequency within the human genome (Anderson et al., 2008). 1.12.3 shRNA While most of this thesis focuses on small-interfering RNAs (siRNAs), it is important to introduce the concept of short-hairpin RNAs (shRNAs), as they were initially used to observe 30  gene silencing of the AR in vivo (Cheng et al., 2006). This method shares similarities with the canonical miRNA pathway, but also involve some very important differences (Rao et al., 2009). ShRNAs are transcribed in the cell nucleus, similar to miRNAs, but are transcribed from an exogenously transfected expression vector (Rao et al., 2009). To enable transcription of the expression vector, a promoter for RNA polymerase II or III must be available upstream of the shRNA sequence (Rao et al., 2009). Following the binding of RNA polymerase, the primary shRNA (pri-shRNA) transcript is produced followed by subsequent processing in the cell nucleus by Drosha/DGCR8 (Lee et al., 2003). Drosha generates the pre-shRNA (~70 nt), and is then transported to the cytoplasm via exportin-5 (Lee et al., 2003). In the cytoplasm, the preshRNA is cleaved by Dicer to remove the hairpin structure, and form double-stranded siRNA, with subsequent loading into Ago-2 associated with RISC (Rao et al., 2009). The mRNA target is then cleaved by Ago-2 in an identical fashion described in Section 1.12.3 with siRNAs. 1.12.4 RNAi treatments on non-AR therapeutic targets in prostate cancer A number of studies have used RNAi as a potential strategy for treating advanced prostate cancer, but many of these do not specifically target the AR. These potential therapeutics have been summarized in Table 1.2. Some strategies involve silencing metabolic de novo synthesis pathways, which include silencing of the Scavenger Receptor Class B Type I (SR-BI) to inhibit cellular synthesis of androgens due to the lack of cholesterol influx (Twiddy et al., 2012), as well as Fatty Acid Synthase (FAS) and Acetyl CoA Carboxylase (ACC) to prevent synthesis of cellular building blocks like triacylglycerols and phospholipids (Bandyopadhyay et al., 2005; Brusselmans et al., 2005; De Schrijver et al., 2003). However, silencing of these pathways may have detrimental effects on healthy cells. None of these targeting strategies have been tested in vivo with murine models as of yet. 31  Other potential non-AR targets included genes involved in cell development, cell division, signal transduction, and cell cycle progression such as the enzyme Polo-like kinase I (Plk I) (Reagan-Shaw and Ahmad, 2005), the SONIC HEDGEHOG(SHH)-GLI signaling pathway (Sanchez et al., 2004), Stat3 (Lee et al., 2004), and Raf-1 (Pal et al., 2005). Prevention of tumor angiogenesis has also been evaluated using RNAi against vascular endothelial growth factor (VEGF-A) (Wannenes et al., 2005). Combination therapies, involving the addition of a chemotherapeutic (paclitaxel) to a regular siRNA dosing regimen has been tested with gene silencing against midkine (MK) (a heparin-binding growth factor) (Takei et al., 2006).  32  Table 1.2 Summary of gene silencing treatments using RNAi on non-AR targets in prostate cancer Gene Target Experimental Outcome on Scope of Study Prostate Cancer Cells Scavenger Receptor Class Decreased cell proliferation, In vitro B Type I (SR-BI) Reduction in secreted PSA. Acetyl CoA Carboxylase Increased cellular apoptosis, In vitro (ACC) Decreased cell proliferation Fatty Acid Synthease Induced morphological changes, In vitro (FAS) Inhibition of cell proliferation, Induction of cell apoptosis Polo-like Kinase I Increased cell apoptosis, In vitro Decreased cell proliferation, Unseparated chromosomes, Failure of cytokinesis SONIC Decreased cell proliferation In vitro HEDGEHOG(SHH)-GLI Stat3 Decreased levels of PSA, In vitro Decreased cell proliferation, Induction of cell proliferation Midkine (MK) Decreased tumor weight and In vivo and In vitro tumor volume (Dose = ~0.2 mg/kg), Reduced cell proliferation (in vivo and in vitro) Raf-1 Downregulation of cyclin D1, In vivo Inhibition of tumor growth Vascular Endothelial Slowed tumor growth, In vivo Growth Factor (VEGF-A) Decreased angiogenesis, inhibition of VEGF secretion 1.12.5 RNAi treatments on AR targets Targeting AR may be the most promising approach using RNAi, which is the focus of my thesis. The progression to CRPC consistently involves the upregulation of the AR (Chen et al., 2004). Silencing of the AR through other methods have been performed using an anti-AR monoclonal antibody, an AR-mRNA hammerhead ribozyme (Zegarra-Moro et al., 2002), antisense AR oligodeoxynucleotides (ODNs) (Eder et al., 2000; Eder et al., 2002; Zhang et al., 2011) and antisense AR phosphorodiamidate morpholino oligomers (PMO) (Ko et al., 2004). All of these studies have summarized that gene silencing of the AR result in significant cellular 33  growth inhibition, reduced secretion of androgen-responsive PSA, and an increase in apoptotic cells in vitro (Eder et al., 2000; Ko et al., 2004; Zegarra-Moro et al., 2002). Eder et al. administered AR ODNs into athymic nude mice bearing LNCaP tumors via osmotic minipumps that were installed subcutaneously (Eder et al., 2002). The dosing regimen was high, with administration of 9 mg ODN/kg body weight per day for 7 weeks (a total of 343 mg ODN) (Eder et al., 2002). Administration of AR ODNs caused significant drops in tumor weight, as well as serum PSA levels, but they were unable to show decreased cellular proliferation or increased affects on apoptotic cell markers (Eder et al., 2002). Third-generation locked nucleic acid-based AR antisense ODNs (LNA-ASO), designated as EZN-4176 (Enzon Pharmaceuticals, Inc.), were used in an androgen-dependent in vivo tumor model, resulting in tumor regression and reduced expression of PSA mRNA (Zhang et al., 2011). Furthermore, a CRPC tumor model was also examined and administered EZN-4176. EZN-4176 showed similar inhibition potency to bicalutamide and MDV3100 at a dose ~10-fold lower (Zhang et al., 2011). EZN-4176 is now being tested in Phase Ia/b clinical trials (Zhang et al., 2011). AR knockdown experiments were demonstrated using RNAi and was confirmed as a viable therapeutic strategy. Liao et al. first examined this by transfecting AR-siRNAs into LNCaP cells, and demonstrated that AR knockdown correlated with an increase in CASP6 activation and a decrease in the anti-apoptotic protein Bcl-xL (Liao et al., 2005). This resulted in a significant increase in cellular apoptosis as a result of the AR knockdown, and was further verified that the knockdown proceeded through an RNAi-mediated mechanism (not through an interferon related mechanism) (Liao et al., 2005). Liao et al. did not encompass any in vivo murine studies.  34  The following three studies that will be discussed form the basis of this thesis. Cheng et al. performed a proof of principle study involving the knockdown of the AR in vivo. This was accomplished through using an LNCaP cell line that stably expressed an AR short-hairpin RNA (shRNA) (Cheng et al., 2006). When tested in vitro, cellular proliferation was significantly decreased upon expression of the AR shRNA (Cheng et al., 2006). In vivo, it was shown that tumor growth was severely impeded, serum PSA levels decreased significantly, and knockdown of the AR caused a delay in the progression to a castration-resistant phenotype (Cheng et al., 2006). A follow-up study utilized a C4-2 castration-resistant human prostate cell line, also with an inducible AR-shRNA expression vector (Snoek et al., 2009). Through gene expression profiling, it was revealed that AR knockdown caused downregulation of cellular proliferation genes, such as Ki67 (Snoek et al., 2009). Upregulation of genes used to regulate cell cycle control were also discovered (Snoek et al., 2009). In vivo, AR knockdown caused a significant regression in tumor volume and a reduction of serum PSA under androgen ablation conditions (Snoek et al., 2009). Unmodified AR-siRNAs have been reported to induce inhibition of tumor growth in the LNCaP tumor model, in addition to reduction in PSA and AR mRNA levels (Compagno et al., 2007). This was accomplished through daily intraperitoneal (i.p.) injections of 125 µg/kg of unmodified synthetic siRNAs for a two-week period (Compagno et al., 2007). As was discussed earlier, unmodified siRNAs risk degradation from serum nucleases (Behlke, 2008), have poor biodistribution, and are unable to target/penetrate cell membranes (Xie et al., 2006). Thus, we were skeptical of this study, and attempted to replicate the data through identical protocols. We were unable to confirm their protocols from this replicate experiment, as will be discussed in Chapter 2 of this thesis. 35  1.13 Liposomal nanoparticle delivery systems for conventional drugs The remainder of this chapter is devoted to a discussion of liposomal nanoparticles (LNP), as these systems are used in this thesis to deliver siRNA as a potential prostate cancer therapeutic. The original LNP are small bilayer “liposomal” systems comprised of one or more bilayers of amphipathic lipids (Cullis and de Kruijff, 1979; de Kruijff et al., 1975). Liposomes were first characterized in 1965 by Alex Bangham as “swollen phospholipid systems” (Bangham et al., 1965) and were initially used as model membrane systems to study the physical properties and functional roles of lipids in bilayer membranes as well as the collective properties of lipid bilayers such as membrane permeability. However, given the ability of liposomes to encapsulate biologically active agents in their aqueous interior, liposomes were soon used as drug delivery systems (Gregoriadis and Ryman, 1971) and are now the leading drug delivery systems for systemic applications. For conventional “small molecule” drugs such as anti-cancer drugs benefits of liposomal delivery include reduced toxicity and/or enhanced efficacy for liposomal systems that are small (diameter ~ 100 nm) and long-circulating (circulation lifetimes of hours or longer) (Allen and Cullis, 2004). Small long-circulating liposomes preferentially accumulate at sites of infection, inflammation and solid tumors compared to the free drug by a mechanism known as the enhanced permeability and retention (EPR) effect (Maeda et al., 2000). The EPR effect occurs in solid tumors due to their defective vascularization of the endothelial linings (Laginha et al., 2005) that results in increased permeability. As a result liposomes encapsulating conventional drugs can extravasate through the gaps in the endothelium, which can be as large as ~800 nm in diameter (Hashizume et al., 2000) resulting in a “passive targeting” effect. Currently, there are seven LNP formulations used for therapeutic purposes that are currently on the market in North America. These include liposomal formulations of anti-cancer 36  drugs (doxorubicin, daunorubicin and vincristine) as well as an antifungal agent (amphotericin B) (Allen and Cullis, 2004). Some of the most successful liposomal formulations to date are Doxil, an LNP encapsulating doxorubicin, and AmBisome, an LNP encapsulating amphotericin B (Allen and Cullis, 2004). Doxil is currently approved for treatment of AIDS-related Kaposi’s sarcoma, refractory ovarian cancer, refractory breast cancer, and metastatic breast cancer (Allen and Cullis, 2004). AmBisome is approved for the treatment of systemic fungal infections (Kelsey et al., 1999). Other liposomal formulated drugs include DaunoXome, an LNP encapsulating daunorubicin, which is also approved for the treatment of AIDS-related Kaposi’s sarcoma (Fassas and Anagnostopoulos, 2005) and the most recently approved is an LNP encapsulating vincristine for the treatment of leukemia (Roth et al., 2013). 1.14 Liposomal nanoparticle delivery systems encapsulating genetic drugs LNP have also been developed that contain macromolecular genetic drugs such as plasmid DNA, antisense oligonucleotides and siRNAs (Fenske and Cullis, 2008). In order to be suitable for systemic (intravenous) applications these systems must mirror the properties of LNP containing small molecule drugs in that they must be small and long-circulating in order to accumulate at disease sites such as tumor sites. Such systems were initially developed for LNP containing plasmid DNA (Monck et al., 2000) and subsequently antisense oligonucleotides (OGN) (Maurer et al., 2001; Semple et al., 2001). LNP encapsulating plasmid DNA (known as stabilized plasmid lipid particles; SPLP) been shown to accumulate at distal tumor sites and result in gene expression (Ambegia et al., 2005). In the case of LNP containing OGN novel ionizable cationic lipids with pKa values in the range of 6 were developed that allowed encapsulation of OGN at low pH (pH 4) where the cationic lipids were positively charged but resulted in a relatively neutral surface charge at physiological pH values (Maurer et al., 2001; 37  Semple et al., 2001). A low surface charge is important in order to achieve long circulation lifetimes and reduced toxic side effects. LNP encapsulating antisense oligonucleotides have potential utility for immunostimulatory purposes (Chikh et al., 2009; de Jong et al., 2007; Wilson et al., 2007). 1.15 Liposomal nanoparticle delivery systems encapsulating siRNAs LNP formulations of siRNA (LNP-siRNA) are the most advanced systems in terms of clinical development as compared to LNP formulations of other genetic drugs. LNP-siRNA systems are currently in the clinic for treating hypercholesterolemia and transthyretin (TTR) induced amyloidosis. Clinical trials are currently ongoing, and are showing encouraging results (see http://alnylam.com/Programs-and-Pipeline/index.php). The lipid components used for these LNP (cationic lipid, PEG-lipid, DSPC, cholesterol) are similar to those used in the prostate cancer studies detailed in this thesis. There are a number of additional studies performed by other groups who have developed various lipid nanoparticle siRNA systems. This includes lipid/protamine/DNA (LPD) complexes for the delivery of siRNA (Li and Huang, 2006) in addition to two generations of lipid calcium phosphate based nanoparticles (LCP-I and LCP-II) for the treatment of non-small cell lung cancer (Li et al., 2010; Yang et al., 2012). LCPs are PEGylated and include an anisamide targeting ligand to improve in vivo delivery to lung cancer cells (Li et al., 2010; Yang et al., 2012). Another group has also used liposomal siRNA formulations for the treatment of neuroblastoma. Di Paolo et al. used conjugated Fab’ fragments to produce anti-GD2 liposomes that improved gene silencing of anaplastic lymphoma kinase (ALK), an oncogenic receptor tyrosine kinase (Di Paolo et al., 2011; Di Paolo et al., 2011). Anti-GD2 liposomes significantly 38  improved tumor growth inhibition and inhibited angiogenesis in neuroblastoma xenografts (Di Paolo et al., 2011; Di Paolo et al., 2011). 1.16 Liposomal nanoparticle delivery systems used in the clinic for cancer treatments Alnylam Pharmaceuticals have developed ALN-VSP, an LNP-siRNA system for the treatment of hepatocellular carcinoma (HCC). ALN-VSP silences two key genes (kinesin spindle protein and vascular endothelial growth factor) to treat HCC and other solid tumors with liver involvement. Phase I clinical trials for ALN-VSP were initiated in April 2009. The Phase I clinical results indicated that the drug was generally well tolerated, and resulted in stable disease or better in 42% of patients treated with 0.4 to 1.5 mg siRNA/kg body weight. A Phase I extension study was also performed and indicated that chronic bi-weekly dosing up to 23 months was safe and well tolerated. A dose of 1 mg/kg is currently being recommended for Phase II clinical trials (see http://www.alnylam.com/Programs-and-Pipeline/Partner-Programs/LiverCancer.php). Tekmira Pharmaceuticals have developed TKM-PLK1, an LNP-siRNA system that silences the polo-like kinase 1 gene (PLK1) for the treatment of liver tumors. Phase I clinical trials were initiated in December 2010. Patients were treated with TKM-PLK1 at doses of 0.15 mg/kg to 0.90 mg/kg. The Phase I clinical results indicated that TKM-PLK1 was generally well tolerated and had signs of RNAi activity in tumor biopsies. A Phase I clinical extention study is currently ongoing. Tekmira is expected to initiate Phase II clinical trials for TKM-PLK1 in the second half of 2013 (see http://www.tekmirapharm.com/Programs/Products.asp). 1.17 Cationic lipids Cationic lipids are required in LNP formulations of genetic drugs in order to achieve efficient encapsulation. The positive charge facilitates association of the anionic nucleic acid 39  polymers with the LNP (Maurer et al., 2001; Monck et al., 2000; Semple et al., 2001) during the rapid mixing formulation processes used to form the LNP particles as described later in this Chapter. Major disadvantages of using permanently charged cationic lipids are that they are toxic and LNP formed from them are rapidly eliminated from the circulation (Senior et al., 1991). Ionizable cationic lipids that have pKa values below physiological pH can solve this problem. This enables encapsulation of nucleic acids at low pH values (e.g. pH 4), but can also allow the LNP to exhibit a near neutral surface charge at physiological pH values (Maurer et al., 2001; Semple et al., 2001). It has also been found that cationic lipids play an important role in promoting release from endosomes following uptake into target cells by endocytosis. Briefly, cationic lipids interact with negatively charged lipids such as those found in endosomal membranes to form membrane lytic “non-bilayer” structures that promote the intracellular release of the encapsulated nucleic acids (Hafez et al., 2001). It has been found that by optimizing the bilayer destabilizing and pKa properties of ionizable cationic lipids that the transfection properties of LNP-siRNA systems can be dramatically improved. For example, the ability of LNP-siRNA systems to silence target genes in hepatocytes following i.v. injection was improved by three orders of magnitude by moving from formulations containing DLinDMA to those containing DLin-KC2-DMA to DLin-MC-3-DMA (Jayaraman et al., 2012; Semple et al., 2010; Zimmermann et al., 2006). LNP systems containing DLin-MC-3-DMA are the current worldwide “gold standard” for potency of siRNA systems for gene silencing, and the cationic lipid DMAP-BLP, which has equivalent potency to DLin-MC-3-DMA is used extensively in Chapter 3.  40  1.18 Polyethylene glycol lipids For formulation of siRNA and other genetic drugs into LNP systems polyethylene glycol (PEG)-lipid conjugates are required in order to form small, monodisperse systems (Maurer et al., 2001; Semple et al., 2001). In the absence of PEG-lipids the cationic lipids form large aggregates on mixing with nucleic acid polymers (Maurer et al., 2001). Further investigations have shown that the LNP formed by mixing cationic lipids and PEG-lipids in ethanol exhibit a novel structure with a nanostructured core surrounded by a PEG-lipid coating (Leung et al., 2012) where the size of the LNP can be modulated by adjusting the PEG-lipid content (Belliveau et al., 2012). The types of PEG-lipids employed can have a strong influence on their biological properties. PEG-lipids with short acyl chain anchors (e.g. C14) will rapidly dissociate from the LNP following i.v. injection, leading to an ability to associate with target cells such as hepatocytes (Semple et al., 2010) and shorter circulation lifetimes. Alternatively, by employing longer acyl chain anchors (e.g. C18), the PEG-lipids remain associated with the LNP and engender long circulation lifetimes leading to greater accumulation at tumor sites as will be shown in Chapter 3 of this thesis. 1.19 Methods for producing LNP encapsulating siRNA: pre-formed vesicles (PFV) There are three main methods that will be discussed which are used to formulate LNPsiRNA systems. siRNAs are negatively charged, hydrophilic and of high molecular weight (e.g. MW~13,300) which means they cannot be encapsulated into LNP by methods used to encapsulate small molecule drugs, which can often be accumulated into liposomes by employing transmembrane pH gradients (Fenske et al., 2008). The first method is the pre-formed vesicle approach, which is the primary method used in Chapter 2 to produce LNP containing siRNA. In this method siRNA is added to preformed 100 nm diameter vesicles that contain cationic lipid in 41  the presence of 40% ethanol. In order to form the vesicles the cationic lipid, the PEG-lipid as well as the stabilizing lipids cholesterol and distearoyl phosphatidylcholine (DSPC), usually in the molar ratios 40/10/40/10 respectively, are dispersed in an aqueous buffer (pH 4.0, containing 40% ethanol) to produce multilamellar vesicles (MLV), which are large (micron size) structures (Semple et al., 2010). The MLV are then extruded through polycarbonate filters that have a pore size 0.08 µm. The resulting “pre-formed” vesicles are then combined with siRNA (in 40% ethanol), which is added dropwise under constant vortexing (Figure 1.8). Following addition of siRNA, LNP are incubated at 35oC for 30 minutes, dialyzed in PBS at pH 7.4 to raise the pH and remove ethanol and free siRNA, and filter sterilized. The siRNA encapsulation efficiency into the LNP is approximately 80% or higher using this method (Lee et al., 2012) and the LNP size is approximately 70-80 nm.  Figure 1.8  Formulation of LNP with the pre-formed vesicle approach 42  Lipids are dissolved in ethanol and added to an aqueous buffered solution (pH 4, 40% ethanol) under constant vortex. This forms MLV, which are then extruded to form LUV. SiRNA in 40% EtOH is added to the pre-formed LUV under constant vortex, incubated for 30 minutes at 35oC, and dialyzed. Sterile filtration is the final step prior to use in vitro or in vivo. 1.20 Methods for producing LNP encapsulating siRNA: in-line T-tube approach The in-line T-tube approach uses rapid mixing of two streams in a T-tube mixer, one stream contains the lipids dissolved in ethanol whereas the second stream contains siRNA in buffered aqueous solution (pH 4) (Jeffs et al., 2005). Encapsulation efficiencies can be greater than 80% (Jeffs et al., 2005). In the in-line mixing approach lipid nanoparticles are spontaneously formed as mixing proceeds because the ethanol is diluted below concentrations required to maintain the lipids in solution (Jeffs et al., 2005). This approach is not utilized for the LNP constructed in this thesis, but is used for the synthesis of other LNP-siRNA formulations described as stable nucleic acid lipid particles (SNALP) used in different in vivo applications (Judge et al., 2009; Zimmermann et al., 2006). 1.21 Methods for producing LNP encapsulating siRNA: microfluidic mixing The pre-formed vesicle approach and the in-line method rely on bulk mixing processes that can result in batch-to-batch variability of the LNP systems produced. A new method developed in the Cullis laboratory to formulate LNP-siRNA systems uses a microfluidic mixer, namely a staggered herringbone micromixer (SHM) (Belliveau et al., 2012). The SHM has two separate input streams: one with the lipid components dissolved in ethanol, and the other with the dissolved siRNA in buffered solution (pH 4). At flow rates of 2 ml/min the SHM induces rapid (millisecond) mixing of the aqueous and ethanol streams by chaotic advection at the tens of nanoliter scale (Belliveau et al., 2012). The rapid mixing causes a rapid increase in polarity, which results in the precipitation of lipids in the form of LNP 43  (Belliveau et al., 2012). As for the previous methods, LNP produced by microfluidic mixing are also dialyzed to raise the external pH and remove excess ethanol and free nucleic acids. LNP produced from this method have solid nanostructured core characteristics, where the internal lipids are organized as inverted micelles, some of which contain siRNA (Leung et al., 2012). The LNP utilized in Chapter 3 of this thesis were produced via this method. 1.22 Thesis objectives and hypothesis Castration-resistant prostate cancer is currently incurable. The most advanced therapeutics only provide survival extensions of 12-18 months (Kent and Hussain, 2003). The AR plays a central role in the progression of prostate cancer, as compared to the other potential target genes discussed in Table 1.1, the AR is the most obvious candidate to target for gene silencing. Many of the other genes are not as well characterized in the context of prostate cancer, and they act as tumor suppressors, and therefore should not be downregulated further. Common oncogenic proteins such as ras, Bcl-2 and c-myc are not found to be upregulated in the majority of prostate cancer patients (Isaacs and Kainu, 2001). As was discussed in Section 1.10, the AR also plays a large role in the development of CRPC, and is commonly found to be activated in many prostate cancers. Therefore it is a reasonable hypothesis that silencing the AR gene using siRNA could provide an effective treatment for CRPC. The Rennie laboratory has previously demonstrated that knockdown of the AR using shRNAs inhibits prostate tumor growth in mice and slows the progression to castration-resistant disease (Cheng et al., 2006; Snoek et al., 2009). From a therapeutic point of view, silencing the AR gene using siRNA is a more viable approach, however delivery of the siRNA to the tumor site is required. Recent work has shown that LNP-siRNA systems can effectively silence target genes in the liver following i.v. administration using LNP containing optimized ionizable 44  cationic lipids. This thesis investigates whether related LNP-siRNA systems can effectively deliver siRNA to distal tumor sites in animal models of prostate cancer and effectively silence the AR. A variety of approaches were investigated. In Chapter 2 the ability of systems optimized for gene silencing in the liver (hepatocytes) to also silence genes in the distal tumors was characterized, using higher doses of LNP-siRNA than are required for hepatocyte gene silencing. In Chapter 3 more sophisticated versions of these LNP were developed that exhibited longer circulation lifetimes and greater accumulation at the tumor site. In addition, the influence of targeting ligands to promote uptake into prostate cancer cells was investigated. In Chapter 2, LNP AR-siRNA systems containing four different cationic lipids were tested in vitro to determine which systems gave maximum AR gene silencing. An optimal LNP AR-siRNA formulation was determined from studies of cellular uptake, endosomal release assays and gene silencing in the human prostate cancer cell lines LNCaP, LAPC-4 and CWR22Rv1. The optimal LNP AR-siRNA formulation was then tested at high doses (10 mg siRNA/kg body weight) in an LNCaP xenograft tumor model to evaluate AR gene silencing effects and serum PSA levels. The optimal LNP AR-siRNA utilized in Chapter 2 contained the cationic lipid DLinKC2-DMA, a PEG-lipid containing C14 acyl chains and had a size of 86 ± 9 nm. In order to achieve improved LNP systems five variables were investigated in Chapter 3. First, a next generation cationic lipid, DMAP-BLP, was utilized that had been shown to result in improved gene silencing properties in vivo as compared to DLin-KC2-DMA. Second, an improved AR siRNA sequence was employed. Third, a PEG-lipid containing C18 acyl chains was incorporated into the LNP to increase the circulation lifetime and thus the tumor accumulation properties. Fourth, the microfluidic mixing formulation approach was utilized to achieve smaller LNP 45  systems to promote tumor accumulation and penetration. Fifth, the influence of an active targeting ligand specific to the prostate specific membrane antigen (PSMA) found on LNCaP cells to facilitate uptake into tumor cells was investigated. As in Chapter 2, cellular uptake, gene silencing and serum PSA levels were used to examine in vitro and in vivo potency. The active-targeting approach to target LNP AR-siRNA to prostate cancer tumors was investigated using the small molecule ligand 2-[3-(1,3dicarboxypropyl)-ureido]pentanedioic acid (DUPA) against prostate-specific membrane antigen (PSMA). Cellular uptake and gene silencing in vitro in PSMA-positive and PSMA-negative prostate cancer cell lines was investigated for the DUPA-targeted LNP AR-siRNA (DUPA-LNP AR-siRNA). Finally, DUPA-LNP AR-siRNA were examined in vivo to determine their potency on serum PSA levels, AR/PSA knockdown, pharmacokinetics in the blood, and effects on cellular proliferation and apoptosis.  46  Chapter 2: Lipid Nanoparticle siRNA Systems for Silencing the Androgen Receptor in Human Prostate Cancer 2.1  Introduction The design of LNP systems for in vivo delivery of siRNA is complicated by the need to  employ cationic lipids to achieve efficient encapsulation of negatively charged lipid polymers such as siRNA (Semple et al., 2010). The use of cationic lipids usually leads to a positive charge on the LNP carrier, which results in enhanced serum protein adsorption and rapid clearance from the circulation following i.v. injection, leading to lack of penetration to target tissue (Chonn et al., 1991). This problem has been addressed by designing ionizable cationic lipids that have pKa values of 7 or below, enabling encapsulation of nucleic acid polymers at low pH values (e.g. pH 4) but also allowing the LNP to exhibit a near neutral surface charge at physiological pH values (Maurer et al., 2001; Semple et al., 2001). Such LNP systems are of increasing utility for the in vivo delivery of siRNA (Semple et al., 2010; Zimmermann et al., 2006). Recent work has shown that the in vivo gene silencing potencies of LNP-siRNA systems following i.v. administration are sensitive to relatively small changes in the structure of the ionizable cationic lipids employed. For example, the in vivo (hepatocyte) gene silencing activity of LNP-siRNA systems containing 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dilinoleyloxy-ketal-N,N-dimethyl-3-aminopropane (DLinKDMA), 1,2dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLinDMA) and 1,2-dilineoyl-3dimethylammonium-propane (DLinDAP) varies according to the relationship DLin-KC2-DMA > DLinKDMA > DLinDMA >> DLinDAP (Semple et al., 2010). In this work, I compare levels of AR gene silencing induced in vitro employing LNP-siRNA systems containing DLin-KC247  DMA, DLinKDMA, DLinDMA and DLinDAP and show that LNP-siRNA systems containing DLin-KC2-DMA are the most effective systems for achieving intracellular delivery and gene silencing of AR in the LNCaP cell lines. They are also effective for silencing AR in LAPC-4 (expresses wild-type AR) and CWR22Rv1 (expresses variant AR) human prostate cancer cell lines. Furthermore, it is shown that LNP AR-siRNA systems containing DLin-KC2-DMA effectively silence the AR gene in distal LNCaP xenograft tumors following intravenous (i.v.) injection. 2.2 2.2.1  Materials and methods Materials Distearoylphosphatidylcholine (DSPC), and cholesterol (Chol) were purchased from  Avanti Lipids, 1,1’-dilinoleyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI) and 3,3’dioctadecyl-5,5’-di(4-sulfophenyl) oxacarbocyanine (SP-DiOC18) was obtained from Invitrogen. The ionizable cationic lipids 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLinKC2-DMA), 1,2-dilinoleyloxy-keto-N,N-dimethyl-3-aminopropane (DLinKDMA), 1,2dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLinDMA) and 1,2-dilineoyl-3dimethylammonium-propane (DLinDAP) were provided by Tekmira Pharmaceuticals (Burnaby, BC, Canada) or were synthesized using established methods (Semple et al., 2010). PEG-S-DMG (3-N-[(ω-methoxypoly(ethyleneglycol)2000)carbamoyl]-1,2-dimyristyloxy-propylamine), and PEG-C-DOMG (R-3-[(ω-methoxy-poly(ethyleneglycol)2000)carbamoyl)]-1,2dimyristyloxypropyl-3-amine) were provided by Alnylam Pharmaceuticals (Boston, MA). All other chemicals were of reagent or analytical grade.  48  2.2.2  Cell culture, cell lines, and reagents The LNCaP, LNCaP-eGFP, LAPC-4 and CWR22Rv1 human prostate cancer cell lines  were used in all in vitro experiments (Abdelbaqi et al., 2011; Horoszewicz et al., 1983; Klein et al., 1997; Tepper et al., 2002). LNCaP, LAPC-4 and CWR22Rv1 cells were originally obtained from ATCC and were not passaged beyond 6 months after receipt or resuscitation. Cells maintained in RPMI 1640 (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and incubated at 37oC and 5% CO2. The LNCaP and LNCaP-eGFP cell line was supplemented with 0.1 nM R1881 (Sigma-Aldrich). 2.2.3  siRNA sequences Sequence of the human AR gene (Genbank accession no. NM_000044) was extracted  from the NCBI Entrez nucleotide database. The 25-mer AR-siRNA was purchased as Stealth RNAi siRNA (Invitrogen): 5’-AGCACUGCUACUCUUCAGCAUUAUU-3’ (AR sense) and 5’AAUAAUGCUGAAGAGUAGCAGUGCU-3’ (AR anti-sense). SiRNA sequences were chosen based on the optimized shRNA sequences developed from our collaborators (Cheng et al., 2006). The 25-mer siRNA targets nucleotides 3542-3563 in the LBD of the AR. An additional scrambled (SC) LoGC negative control was purchased as a Stealth RNAi siRNA (Invitrogen). The SC-siRNA sequence is not homologous to any gene in the vertebrate transcriptome. Luciferase (LUC) siRNA was a gift from Alnylam Pharmaceuticals (Boston, MA): 5’cuuAcGcuGAGuAcuucGAdTsdT-3’ (LUC sense) and 5’-UCGAAGuACUcAGCGuAAGdTsdT3’ (LUC anti-sense). Lower case letters = 2’-OMe; Upper case = RNA; s = phosphorothioate backbone.  49  2.2.4  Encapsulation of siRNA into LNP (pre-formed vesicles) Lipid stocks (DSPC, PEG-S-DMG, PEG-C-DOMG, cholesterol, SP-DiOC18, and a  cationic lipid (DLin-KC2-DMA, DLinKDMA, DLinDMA, DLinDAP) were co-dissolved in ethanol at appropriate molar ratios (10 mol% DSPC, 10 mol% PEG-S-DMG, 39.8 mol% Chol, 0.2 mol% SPDiOC18 or DiI and 40 mol% cationic lipid). In some cases other molar ratios of lipids (10 mol% DSPC, 2.5 (or 10) mol% PEG-C-DOMG, 47.5 (or 40) mol% cholesterol, and 40 mol% DLin-KC2-DMA) were constructed to examine the effect of PEG on in vitro transfection. Multilamellar vesicles (MLV) were generated by adding the lipid in ethanol to an aqueous buffer (50 mM citrate, pH 4.0) to achieve a final concentration of 40% ethanol. Large unilamellar vesicles (LUV) were generated by extruding the MLVs through two Nuclepore polycarbonate filters (80 nm, 10 passes) using an extrusion device from Northern Lipids (Vancouver, BC, Canada) at ~300 psi. The siRNA was dissolved in 10 mM citrate, 30 mM NaCl, pH 6.0, quantified by measuring absorbance at OD260 and added to the LUV dispersion dropwise under constant vortex at an siRNA:lipid ratio of 1:10 (wt/wt). The resulting LNP-siRNA systems were then dialyzed in PBS overnight to increase the pH to ~7.4. The mean diameter of the vesicles was determined using a NICOMP370 particle sizer (Nicomp Particle sizing Inc., Santa Barbara, CA) using the intensity mode. For LNP containing PEG-S-DMG diameters were 75 nm ± 12 nm (DLinDAP), 73 ± 6 nm (DLinDMA), 71 ± 7 nm (DLinKDMA), 70 ± 8 nm (DLin-KC2-DMA). LNP containing PEG-C-DOMG had slightly larger diameters, 86 ± 9 nm (DLin-KC2-DMA, 2.5% PEG-C-DOMG) and 82 ± 10 nm (DLin-KC2-DMA, 10% PEG-C-DOMG). Lipid concentrations were measured by total cholesterol (T-CHO) using the Cholesterol E enzymatic assay from Wako Chemicals (Richmond, VA). Free siRNA was removed using VivaPureD MiniH columns 50  (Sartorius Stedim Biotech GmbH, Goettingen, Germany). The elutants were then dissolved in 75% ethanol and siRNA was quantified by measuring absorbance at OD260. The siRNA encapsulation efficiency was 80% or greater for all formulations. 2.2.5  Western blotting and immunofluorescence LNCaP, LAPC-4, and CWR22Rv1 cells were plated in twelve-well plates (2.0 x 105 cells  per well). Cells were washed in PBS and lysed in RIPA buffer (1% NP-40, 0.25% Deoxycholic Acid) with protease inhibitor tablets (Roche Diagnostics). Total protein (10 µg) quantified by Bradford Assay was analyzed by immunoblotting. Antibodies to AR from Santa Cruz Biotechnology (AR-441) (Santa Cruz, CA). Antibodies to GAPDH from Abcam (Cambridge, MA). Antigen-antibody complexes were detected using Millipore Immobilon Western Chemiluminescent HRP Substrate (Billerica, MA). 2.2.6  Confocal microscopy LNCaP cells were seeded onto poly-D-Lysine cover slips (2.0 x 105 cells) per well in a  12-well plate. Cells were treated with 5 µg/ml of AR-siRNA encapsulated in LNP containing DLin-KC2-DMA, DLinKDMA, DLinDMA and DLinDAP for 48 h. Cells were then fixed in 3% PFA with Hoechst's stain and examined under an Olympus FV1000 (Center Valley, PA) laser scanning microscope. 2.2.7  Fluorescence microscopy LNCaP cells were seeded (2.0 x 104 cells) per well in a 96-well plate. Cells were treated  with 1 µg/ml of AR-siRNA encapsulated in LNP containing DLin-KC2-DMA, DLinKDMA, DLinDMA and DLinDAP for 4, 12, 24 and 48 h. Cells were fixed in 3% PFA with Hoechst’s stain and examined using a Cellomics ArrayScan VTI HCS Reader (Thermo Scientific).  51  2.2.8  Flow cytometry LNCaP-eGFP cells were treated with DiI-labeled LNP encapsulating either AR- or LUC-  siRNA. Cellular uptake and AR knockdown were then assessed using a LSRII flow cytometer and FACS Diva Software (BD Bioscience) by measuring the fluorescence intensity of DiI and GFP, respectively. 2.2.9  Intraperitoneal injections of free siRNA in vivo LNCaP cells (2 x 106) were inoculated s.c. in 6-8 week old male athymic nude mice.  When tumors became palpable, volumes were measured (width x length x depth x 0.5236). When tumor volumes reached ~100 mm3, animals were randomized into 2 groups. Daily i.p. injections of 125 µg/kg AR siRNA or SC-siRNA were made. Tumor volume was measured daily. 2.2.10 Assessing effect of siRNA to knockdown AR in vivo LNCaP xenograft prostate tumors were established as described previously (Cheng et al., 2006). When tumors became palpable, volumes were measured (width x length x depth x 0.5236) and blood was collected from the tail vein to assess serum PSA by ELISA (ClinPro International, Union City, CA). Once PSA values reached 50-100 ng/mL, animals were randomized into 3 groups. LNP containing AR-siRNA or LNP scrambled siRNA (SC-siRNA) and DLin-KC2-DMA were i.v. administered through the lateral tail vein. PBS was injected as a baseline control. Doses of LNP-siRNA were administered 3 times on consecutive days at a dose level of 10 mg siRNA/kg of mouse body weight. Further injections were made an additional 3 times on days 7, 9 and 11. Animals were sacrificed at Day 14. Serum PSA and protein levels of AR in the xenograft tumors were analyzed. All animal procedures were done according to the guidelines of the Canadian Council of Animal Care with appropriate institutional certification. 52  2.2.11 5’RNA-linker-mediated rapid amplification of cDNA ends PCR 5’ RLM-RACE was performed using a GeneRacer Kit according to the manufacturer’s protocol (Invitrogen). LNCaP cells were transfected with 10 nM of AR-siRNA with oligofectamine (Zhang et al., 2010). After 72 h, LNCaP cells were harvested. Total RNA from LNCaP cells after siRNA treatment or from tumor tissues collected from mice treated with ARsiRNA, scrambled siRNA or PBS was isolated using the Trizol method (Invitrogen). 100 ng of total RNA was linked to an RNA oligonucleotide with T4 RNA ligase. Purified RNA after DNAse I digestion were reverse transcribed. PCR was performed with primers specific for the RNA linker and for the targeted gene with the following conditions: 94oC-2 min, 54oC-1 min, 72oC-1 min, then 35 cycles of 94oC-30 sec, 54oC-1 min, and 72oC-30 sec, and finally an extension period at 72oC-7 min. 5 µL of this product was taken for nested PCR using the same conditions, but with the annealing temperature decreased to 50oC. To use as a control, GAPDH primers were used to amplify the cDNA transcribed with random hexamers. 10 µL of each reaction was analyzed on a 2% agarose gel visualized with SybrSafe (Invitrogen). The band corresponding to the predicted size of the amplicon was excised and purified using QIAquick Gel Extraction Kit (Qiagen). Subsequently, the fragment was cloned using a TA Cloning Kit supplied with the GeneRacer Kit and sequenced. 2.2.12 Statistical analyses All statistical analyses were performed using GraphPad. Initially, a one-way ANOVA was used to statistically evaluate the differences between treatment groups. In the case of statistically significant results, the differences between treatment groups were assessed through the use of the Tukey-Kramer Multiple Comparisons Test unless otherwise stated. Probability (p) values less than 0.05 were considered significant. 53  2.3 2.3.1  Results Free AR-siRNA injections do not decrease tumor volume It has been reported that free AR-siRNA (daily i.p. injections of 125 µg/kg AR-siRNA)  can lower AR expression and inhibit prostate tumor growth (Compagno et al., 2007). We were unable to repeat these results following their exact protocols (Figure 2.1) (Section 2.2.9). This was not unexpected since in vivo therapy with free siRNA is problematic due to rapid clearance of siRNA from the bloodstream, degradation by serum nucleases, poor distribution to the target tumor tissue and an inability to penetrate target cell membranes (Xie et al., 2006). Thus, the remaining experiments discussed in this Chapter are designed to optimize delivery of AR-siRNA in vivo through encapsulation of AR-siRNA into LNP (LNP AR-siRNA).  Figure 2.1 Free AR-siRNA injections do not decrease tumor volume LNCaP cells (2 x 106) were inoculated s.c. in male athymic nude mice. Daily i.p. injections of 125 ug/kg AR-siRNA or scrambled (SC)-siRNA were performed in conjunction with tumor volume measurements. Data points represent mean tumor volume (n = 6-7). Plotted as mean ± SE.  54  2.3.2  LNP AR-siRNA systems formulated with DLin-KC2-DMA exhibit maximum levels  of gene silencing in LNCaP cells Previous studies have shown that upregulation of the AR occurs at both the mRNA and protein levels and causes hypersensitivity to androgens even at small concentrations (Kokontis et al., 1994). An siRNA sequence was selected based on its efficiency in silencing AR and halting tumor progression in a study using inducible plasmid shRNA to knockdown AR expression in vivo (Cheng et al., 2006). The AR-siRNA and SC-siRNA was encapsulated as indicated in Materials and methods using four species of LNP containing DLin-KC2-DMA, DLinKDMA, DLinDMA or DLinDAP (Figure 2.2). Essentially complete AR knockdown was seen in cells incubated with DLin-KC2-DMA LNP encapsulating AR-siRNA at a concentration of 5 µg/ml (Figure 2.3A). Significant AR knockdown was also detected when LNP AR-siRNA systems containing DLinKDMA or DLinDMA were used, however low amounts of protein still remained (Figure 2.3A-C). Cells treated with LNP containing SC-siRNA showed normal expression levels of AR. The results shown in Figure 2.3A suggest that LNP AR-siRNA containing DLin-KC2DMA are more potent than LNP containing DLinKDMA, DLinDMA or DLinDAP. However, the nearly complete knockdown of AR for the DLin-KC2-DMA system implies that saturating levels of LNP-siRNA are present, which makes comparative estimates of relative potency difficult. When the experiments were repeated using siRNA at a concentration of 1 µg/ml, there again was substantial knockdown of AR with the LNP AR-siRNA system containing DLin-KC2DMA, with LNP systems containing DLinKDMA or DLinDMA being less effective (Figure 2.3B). Quantification of the residual AR normalized to GAPDH expression and relative to the scrambled control (Figure 2.3C) revealed a dose-dependent drop in residual AR levels for DLin55  KC2-DMA and DLinKDMA. The relative potency of the LNP formulations was DLin-KC2DMA > DLinDMA > DLinKDMA >> DLinDAP (Figure 2.3C). DLin-KC2-DMA  DLinKDMA  DLinDMA  DLinDAP  PEG-S-DMG  PEG-C-DOMG  	
   Figure 2.2 Structures of the ionizable cationic and PEG-lipids employed Distinguishing features are that DLinDAP contains ester acyl chain linkages; DLinDMA contains ether linkages; DLin-KC2-DMA and DLinKDMA contains ketal linkages. Note that PEG-S-DMG contains ester linkages; PEG-C-DOMG contains ether linkages.  56  A)  C)  B)  Figure 2.3 Silencing of the AR gene in LNCaP prostate cancer cells following incubation with LNP AR-siRNA systems A) LNCaP cells were incubated with 5 µg/ml or B) 1 µg/ml of AR-siRNA or SC-siRNA encapsulated in either DLin-KC2-DMA, DLinKDMA, DLinDMA or DLinDAP LNP-siRNA systems for 48 h as described under methods. Protein expression was analyzed by Western immunoblotting. C) Quantification of AR in LNCaP prostate cancer cells. Data points are expressed as the residual percentage of AR, which was normalized to GAPDH as a ratio to the scrambled control and represent group mean (n = 3) ±	
 SE. Statistical significance is determined between DLin-KC2-DMA versus the other 3 cationic lipids (DLinKDMA, DLinDMA, and DLinDAP). *p < 0.05; *** p < 0.001.  57  2.3.3  The potency of LNP-siRNA systems containing DLin-KC2-DMA can be attributed  to improved siRNA uptake and endosome release properties The superior potency of LNP AR-siRNA systems containing DLin-KC2-DMA could arise due to increased uptake into cells and/or improved release from endosomes following uptake. To better understand how these factors contribute, we first compared the potency of these lipids with their uptake into cells. Higher positive surface charges would be expected to lead to greater uptake into cells due to enhanced potential for association with the negatively charged cell exterior. In this regard, LNP containing DLin-KC2-DMA, DLinKDMA, DLinDMA or DLinDAP will exhibit different surface charges due to the differing pKa values of these ionizable cationic lipids. Previous work (Semple et al., 2010) has shown that DLin-KC2DMA, DLinKDMA, DLinDMA or DLinDAP exhibit pKa values of 6.7, 5.9, 6.8, and 6.2 respectively. These results suggest that LNP containing DLin-KC2-DMA or DLinDMA should exhibit higher levels of uptake than those observed for LNP containing DLinKDMA or DLinDAP, which have lower pKa values. Uptake experiments employed LNCaP cells incubated with LNP AR-siRNA containing DLin-KC2-DMA, DLinKDMA, DLinDMA, or DLinDAP, as well as the SPDiOC18 fluorescent lipid label, for 4, 12, 24 and 48 h. Uptake was measured as the mean fluorescence intensity per cell as determined employing the Cellomics ArrayScan apparatus, which averaged fluorescent intensity of over ~400 LNCaP cells. LNP containing DLin-KC2-DMA exhibited the highest level of uptake at 48 h, followed closely by DLinDMA (Figure 2.4B). Confocal microscopy images taken at 48 h are consistent with increased uptake in LNCaP cells when DLin-KC2-DMA is used in the LNP formulation (Figure 2.4A). The cellular uptake data correlates with the extent of AR knockdown (Figure 2.3B-C), and suggests that 58  uptake is a major contributing factor to the differential knockdown profiles observed for the four cationic lipids (Figure 2.4). To further assess the correlation between knockdown, LNP uptake and endosomal release, flow cytometry studies were performed using an LNCaP cell line that stably expresses an AR-responsive promoter linked to an enhanced Green Fluorescent Protein (eGFP) reporter. As shown elsewhere, in the absence of AR expression no GFP expression is observed (Veldscholte et al., 1992) in this cell line. Cells were incubated (1 µg siRNA/ml for 48 h) with LNP containing DLin-KC2-DMA, DLinKDMA, DLinDMA or DLinDAP and the fluorescent lipid analogue (DiI). These LNP contained either AR-siRNA or control (Luc)-siRNA. Uptake was measured by quantifying DiI (red) fluorescence, and GFP expression was used as a surrogate for AR expression. The GFP expression was normalized to cellular uptake (i.e. the ratio of GFP fluorescence to DiI fluorescence) for both AR and control-siRNA sequences. The ratio of normalized GFP expression for LNP containing AR siRNA to normalized GFP expression for LNP containing control siRNA then gives a measure of the relative potencies of the different cationic lipids for inducing endosomal escape. As shown in Figure 2.4C, DLinKC2-DMA showed the highest potency, followed closely by DLinDMA, indicating that DLinKC2-DMA and DLinDMA have an increased ability to facilitate endosomal release of siRNA as compared to DLinKDMA or DLinDAP.  59  A)  B)  C)  Figure 2.4 Influence of cationic lipid species on LNP uptake and knockdown in LNCaP and LNCaP-eGFP A) LNCaP cells were incubated with 5 µg/ml of LNP AR- siRNA formulated using either DLinDAP, DLinDMA, DLinKDMA or DLin-KC2-DMA for 48 h. Representative images are shown. Nuclei were stained with Hoechst’s dye (blue) and SPDiO-C18 fluorescence (green). Scale bar = 30 µm. B) LNCaP cells were incubated with 1 µg siRNA/ml of LNP AR-siRNA formulated using either DLinDAP, DLinDMA, DLinKDMA or DLin-KC2-DMA for 4, 12, 24 and 48 h. Cellular uptake was quantified using Cellomics ArrayScan, expressed as mean fluorescent intensity per cell. ~400 cells were measured in 4 individual wells (n = 4) ±	
 SD. Statistical significance is determined between DLin-KC2-DMA or DLinDMA versus the other 2 cationic lipids (DLinKDMA and DLinDAP) ** p < 0.01; *** p < 0.001. Note that the quantification method in Figure 2.4B is performed by a Cellomics ArrayScan algorithm, and is not the same as the quantification technique used for confocal microscopy in Figure 2.4A. C) LNCaP-eGFP cells were incubated with 1 µg siRNA/ml of LNP AR-siRNA or LNP LUCsiRNA formulated using either DLinDAP, DLinDMA, DLinKDMA or DLin-KC2-DMA for 48 h and analyzed via flow cytometry. Bar graph shows the relative GFP expression compared to LUC-siRNA control normalized to uptake via DiI (red). Statistical significance is indicated between treatment groups (** p < 0.01). 60  2.3.4  The species of PEG-lipid influences LNP-siRNA-induced AR silencing The LNP-siRNA systems used above contain 10 mol% PEG-S-DMG, which contains  labile ester linkages between the acyl chains and the headgroup. In order to achieve more chemically stable systems on storage, and to make in vivo results more comparable with recent in vivo studies using related LNP systems (Semple et al., 2010), PEG-C-DOMG was employed in place of PEG-S-DMG for in vivo studies. PEG-C-DOMG is more chemically stable than PEGS-DMG due to the presence of ether bonds linking the acyl chains to the headgroup (Figure 2.2). This substitution required crossover studies to determine the relative effects of PEG-C-DOMG and PEG-S-DMG on LNP potency. As shown in Figure 2.5A, LNP AR-siRNA systems containing 10 mol% PEG-C-DOMG exhibited reduced silencing of the AR as compared to systems containing 10 mol% PEG-SDMG. These results could be explained by a slower rate of release of PEG-C-DOMG from the LNP surface as compared to PEG-S-DMG. As discussed elsewhere, the PEG-lipids have been engineered to exhibit rapid leaving rates from the LNP surface following intravenous injection as the presence of PEG-lipids can inhibit interaction with target cells (Ambegia et al., 2005). The inhibitory effects of a slower dissociation rate of PEG-C-DOMG from the LNP systems can be most easily corrected by starting with a lower PEG-lipid content in the LNP-siRNA system. Thus the in vitro AR silencing properties of AR-siRNA systems containing PEG-C-DOMG were tested at 2.5 mol% as opposed to 10 mol%. As shown in Figure 2.5A, substantial AR silencing is observed for systems containing 2.5 mol% PEG-C-DOMG. LNP that contained 2.5 mol% PEG-C-DOMG and the most potent cationic lipid, DLin-KC2-DMA, were used in all subsequent LNP formulations.  61  A)  B)  Figure 2.5 Influence of PEG-lipid species and concentration on silencing of the AR gene in LNCaP, LAPC-4 and CWR22Rv1 cells A) LNCaP cells were incubated with 5 µg/ml of LNP AR-siRNA encapsulated in DLin-KC2DMA formulated with different types and amounts of PEG-lipids (10 mol% PEG-S-DMG, 10 mol% PEG-C-DOMG, and 2.5 mol% PEG-C-DOMG) for 48 h. B) LNCaP, LAPC-4 and CWR22Rv1 cells were incubated with 5 µg/ml of LNP AR-siRNA encapsulated in DLin-KC2DMA and 2.5 mol% PEG-C-DOMG formulated with AR and SC-siRNA. AR expressed in LNCaP and LAPC-4 is 110 kDa, and CWR22Rv1 expresses AR at 114 kDa and an additional ARΔLBD at 80 kDa. Levels of AR protein were analyzed by Western immunoblotting with GAPDH (loading control).  62  2.3.5  LNP AR-siRNA induced AR silencing in vitro in wild-type AR expressing LAPC-4  and variant AR expressing CWR22Rv1 cell lines LNCaP cells contain a point-mutated AR within the ligand-binding domain. It is important to examine the potency of LNP AR-siRNA in other prostate cancer cell lines such as LAPC-4 (expressing wild-type AR), and CWR22Rv1 (expressing a variant AR) (Klein et al., 1997; Tepper et al., 2002; Veldscholte et al., 1992). The potency of LNP AR-siRNA systems (40 mol% DLin-KC2-DMA, 2.5 mol% PEG-C-DOMG) for silencing the AR in LNCaP, LAPC4 and CWR22Rv1 cell lines is shown in Figure 2.5B. Substantial knockdown is observed in both LNCaP and LAPC-4 cell lines as indicated by the reduced intensity in the band at 110 kDa when using LNP AR-siRNA compared to the LNP SC-siRNA and untreated controls. In the case of the CWR22Rv1 cell line (Abdelbaqi et al., 2011) the full-length AR band is located at 114 kDa and significant AR knockdown is also observed for this band in addition to some knockdown at 80 kDa, representing the truncated AR lacking the ligand-binding domain (ARΔLBD) (Figure 2.5B). Some knockdown of the AR at 80 kDa may have occurred due to knockdown of the fulllength AR pre-mRNA transcript (Figure 2.5B). 2.3.6  Intravenous administration of LNP AR-siRNA can reduce serum PSA levels in  mice bearing LNCaP tumors The results summarized to this point indicate that an LNP-siRNA system containing DLin-KC2-DMA and 2.5 mol% PEG-C-DOMG exhibits optimized activity in vitro. However, these systems are primarily designed to enable the long circulation lifetimes required to result in accumulation at tumor sites following i.v. injection (diameter < 100 nm and little positive surface charge). It is therefore of interest to determine the effectiveness of this formulation for in vivo AR knockdown. The LNCaP xenograft tumor model generated in athymic nude mice has 63  previously been shown to provide a reproducible in vivo experimental system for monitoring anti-tumor therapeutics (Cheng et al., 2006; Miyake et al., 2000; Sato et al., 1996; Snoek et al., 2009; Zhang et al., 2009). Although androgen ablation does not generally result in significant tumor regression in this model, it does result in a drop in serum PSA, which can serve as an index for impacting androgen signaling. Consistent with this, we have previously reported that AR knockdown in these tumors is correlated with the extent that serum PSA is reduced (Cheng et al., 2006; Snoek et al., 2009). A few weeks after inoculation with LNCaP cells, when serum PSA levels reached 50 to 75 ng/ml, mice were treated i.v. with 10 mg siRNA/kg of DLin-KC2-DMA LNP AR-siRNA or LNP SC-siRNA on Days 1, 2 and 3 (Figure 2.6) and then again on Days 7, 9 and 11. Serum PSA levels were measured daily to gauge the effectiveness of these treatments. While the serum PSA continued to increase in both control (PBS) and LNP SC-siRNAtreated mice, mice treated with LNP AR-siRNA showed no increase in serum PSA over levels observed at the initiation of treatment (Day 0) and at least 40% lower than that measured in the controls by Day 7 (p < 0.05) (Figure 2.6A). Significantly, the second round of treatment with LNP-AR-siRNA on Days 7, 9 and 11 was sufficient to maintain suppression of serum PSA whereas PSA levels continued to rise in animals treated with either LNP SC-siRNA or the PBS (Figure 2.6A). This result suggests that repeated LNP AR-siRNA injections could be used for long-term treatment. No obvious toxic side effects of such treatment were observed. Immunoblotting analyses revealed that protein levels of AR dropped in xenograft tumor tissues collected from mice treated with LNP AR-siRNA, whereas in tumor tissues from control mice  64  treated with LNP SC-siRNA or PBS, the AR levels remained relatively unchanged (Figure 2.6B).  65  A)  B)  C)  Figure 2.6 Systemic administration of LNP AR-siRNA results in decreased serum PSA levels Mice were i.v. injected via tail vein with LNP AR and SC-siRNA (10 mg/kg) as described in Materials and methods. A) Percentages of Serum PSA levels are relative to PSA levels at 1-day before treatment. *p < 0.05; ***p < 0.001. Bonferroni post-tests followed by 2 way ANOVA. Data points are the mean of one representative experiment (n = 12-14) ± SD. Note that there are two tumors per mouse. B) Western blot of AR from all tumor tissues in each group of animals with β-actin as loading control. Each lane represents an individual tumor. C) Western blot quantification of AR from all tumor tissues in each group of animals, normalized to levels of βactin (loading control). Protein extracts were isolated from tumor tissues at Day 14. Data points are the mean of 1 representative experiment (n = 12-14) ±	
 SE. **p < 0.01; ***p < 0.001. 66  2.3.7  AR-induced specific cleavage of AR mRNA To confirm that knockdown of the AR was RNAi mediated, a 5’RNA-linker-mediated  (RLM) RACE-PCR was conducted to amplify the mRNA cleaved by AR-siRNA in LNCaP cells treated with free AR-siRNA and in tumor tissues collected from mice treated with LNP ARsiRNA. As shown in Figure 2.7, there were amplifications of the cleaved mRNA with the predicted size in LNCaP cells treated with free AR-siRNA and also in tumor tissues collected from mice treated with LNP AR-siRNA. Sequencing of cDNAs reverse transcribed from cleaved mRNA confirmed that those cDNAs are authentic to the cDNA encoding AR. Further analysis demonstrated that the cleaved sites were within the sequence recognized by the siRNA against the AR (Figure 2.8).  Figure 2.7 AR-siRNA induces specific cleavages in AR mRNA Total RNA from LNCaP cells after siRNA transfection and from tumor tissues collected from mice treated with AR-siRNA (AR), scrambled siRNA (SC) and PBS. A 5’ RLM-RACE PCR was performed on RNAs collected using a GeneRacer Kit. 10 µL of each 5’ RLM-RACE PCR reaction was analyzed on a 2% agarose gel visualized with SybrSafe. The band corresponding to the predicted size of the amplicon is indicated (arrow).  67  Figure 2.8 Sequencing of 5'RLM-RACE PCR products produces a predicted cleavage site within the AR siRNA 5’RLM-RACE PCR products were sequenced and the determined cleavage site was found between 10-11 nt within the AR siRNA sequence. The cleavage site is also indicated on the complementary AR mRNA sequence. 2.4  Discussion The results presented here constitute the first demonstration of the feasibility and efficacy  of using a lipid nanoparticle siRNA delivery system to knockdown the AR in a human prostate tumor in vivo and thereby significantly inhibit any subsequent increase in serum PSA. Three points of interest concern the reasons why the LNP containing DLin-KC2-DMA are the most active in vitro, comparison to other systems for silencing AR in vivo and ways in which the potency of these LNP-siRNA systems may be improved. LNP containing DLin-KC2-DMA gave rise to the greatest level of gene silencing in human prostate cancer cells (Figure 2.3) of the four cationic lipids tested (Figure 2.2). To determine whether the superior activity was due to increased uptake of LNP, uptake experiments were performed in which LNCaP cells were incubated with LNP AR-siRNA containing DLinKC2-DMA, DLinKDMA, DLinDMA, or DLinDAP as well as a fluorescent label at 4, 12, 24, and 48 h time points (Figure 2.4B). As expected on the basis of surface charge, LNP containing 68  DLin-KC2-DMA or DLinDMA exhibited higher levels of uptake (Figure 2.4B). DLin-KC2DMA and DLinDMA were also found to have increased AR knockdown compared to DLinKDMA and DLinDAP when normalized to cell uptake (Figure 2.4C). As suggested elsewhere (Hafez et al., 2001), the ability of cationic lipids to facilitate intracellular delivery of nucleic acid polymers can be attributed to an ability to form ion pairs with endogenous anionic lipids in the endosome following uptake. These ion pairs promote endosomolytic non-bilayer hexagonal (HII) phase structures, potentially resulting in the cytoplasmic release of the RNA or DNA. An enhanced ability to disrupt endosomes would be consistent with a greater ability of DLin-KC2-DMA and DLinDMA to induce HII phase structure in the presence of anionic lipids as compared to DLinKDMA or DLinDAP as demonstrated elsewhere (Semple et al., 2010). Intravenous administration of the LNP AR-siRNA formulation containing DLin-KC2DMA is effective in knocking down the AR in distal LNCaP xenograft tumors, which is also reflected by reduced serum PSA levels as compared to controls (Figure 2.6). This provides a proof-of-principle for developing a therapeutic strategy to treat advanced prostate cancers. Furthermore, the results indicate that AR knockdown and inhibition of serum PSA increases is sustainable with repeat i.v. injections of these DLin-KC2-DMA siRNA formulations (Figure 2.6). These results are consistent with previous studies using a LNCaP-derived cell line engineered to express an inducible shRNA targeting the AR, which showed that extensive knockdown of the AR in all the cells inhibits tumor growth and decreases serum PSA levels (Cheng et al., 2006). Moreover, in a castration-resistant (hormone refractory) prostate cancer model, shRNA silencing of the AR was equally effective and even caused regression in 50% of the tumors (Snoek et al., 2009), suggesting that anti-AR therapy could be effective against both androgen-dependent and independent prostate cancers. To achieve a comparable impact on both 69  tumor volume and serum PSA levels may require a substantial increase in the potency of in vivo LNP-siRNA delivery systems. While the potential utility of the LNP AR-siRNA systems as agents to treat prostate cancer is supported by the clinical use of lipid-based delivery systems for small molecule applications (Allen and Cullis, 2004) and the early stage clinical development of LNP-siRNA systems aimed at hepatocyte targets (www.alnylam.com), improvements in in vivo potency are likely required before such systems can become viable therapies for prostate cancer therapy. That such improvements are possible is indicated by the potency of LNP-siRNA systems developed for silencing FVII in hepatocytes, where dose levels of approximately 30 µg siRNA/kg body weight are required to achieve 50% gene silencing (Semple et al., 2010). This contrasts with the 10 mg siRNA/kg body weight doses employed here. The remarkable potency of the hepatocyte LNP-siRNA system is a consequence of the targeting effects of ApoE, which becomes associated with the LNP following i.v. administration (Akinc et al., 2010) and leads to uptake into hepatocytes via the LDL receptor, the scavenging receptor and the “LDL-like” receptor (Mahley and Huang, 2007). Likewise, other in vivo studies have revealed that rHDL nanoparticles incorporated with siRNA are readily taken up into ovarian and colorectal cancer cells via the scavenger receptor type B1 (SR-B1) and are very effective at silencing cancer promoting genes at dose levels of 0.2 mg/kg (Shahzad et al., 2011). This clearly suggests that strategies to improve targeting to and uptake of LNP AR-siRNA systems into prostate cancer cells in vivo should lead to more efficient AR knockdown and potentially better therapeutic control of advanced prostate cancer.  70  Chapter 3: Targeted LNP-siRNA Systems for Silencing the Androgen Receptor 3.1  Introduction In Chapter 2 it was shown that AR-gene silencing and reduction of PSA serum levels in  mouse models of human prostate cancer can be achieved by intravenous administration of LNP AR-siRNA containing the ionizable cationic lipid DLin-KC2-DMA. However, relatively high doses of 10 mg siRNA/kg of body weight per injection (six injections) were required to see appreciable effects. This is in contrast to LNP-siRNA systems used for in vivo delivery to hepatocytes, which can achieve 50% gene silencing for a single dose (ED50) of 0.02 mg siRNA/kg (Akinc et al., 2010; Semple et al., 2010). This large dose difference can be attributed to the liver’s favorable physiology (i.e. well-fenestrated and vascularized) as well as endogenous processes that result in targeting of LNP to hepatocytes (Akinc et al., 2010; Longmuir et al., 2006). In particular it has been shown that LNP associate with apolipoprotein E (ApoE) (Akinc et al., 2010; Cullis et al., 1998) following i.v. administration resulting in uptake into hepatocytes through the LDL receptor, the scavenging receptor and the “LDL-like” receptor (Akinc et al., 2010; Mahley and Huang, 2007). While it is unlikely that potencies equivalent to those achieved for gene silencing in hepatocytes can be achieved for LNP-siRNA systems directed toward silencing the AR gene in localized and disseminated prostate cancer, improvements must be made on the dose levels of 10 mg siRNA/kg body weight. There are many reasons for this, two of which concern cost and toxicity. At a dose level of 10 mg siRNA/kg, six doses for an 80 kg man would cost ~$355,000 for the siRNA alone at current siRNA prices. With regard to toxicity, the cationic lipid employed can give rise to potentially hepatotoxic properties at dose 71  equivalents to ~20 mg siRNA/kg body weight (Semple et al., 2010). In order for LNP-siRNA systems to be potentially useful therapeutics they must be effective at dose levels of approximately 1 mg siRNA/kg body weight or below. As the goal of this thesis is to develop a potential siRNA-based therapeutic for treating prostate cancer, the objective of the work conducted in this Chapter is to improve the potency of the LNP-siRNA system developed in Chapter 2. The primary technique that will be explored concerns using a different PEG-lipid to achieve longer circulation lifetimes and facilitate higher levels of LNP accumulation at tumor sites and the use of targeting ligands attached to the LNPsiRNA system to specifically enhance uptake into prostate cancer cells following arrival at the tumor site. However, in order to build the most potent LNP system possible two other LNP variables will be explored first, namely using more potent cationic lipids and AR-siRNA than the materials used in Chapter 2. With regard to the improved cationic lipid, as noted in Chapter 2, the choice of ionizable cationic lipid can dramatically affect the potency of LNP-siRNA systems. The cationic lipid used in Chapter 2 (DLin-KC2-DMA) was identified in 2010 by screening a variety of ionizable cationic lipids in LNP-siRNA systems using a factor VII (FVII) gene silencing assay (Semple et al., 2010). More recent screening work using the FVII model has identified dilinoleyl-methyl-4dimethylaminobutyrate (DLin-MC-3-DMA) and 3-(dimethylamino)propyl(12Z,15Z)-3[(9Z,12Z)-octadeca-9,12-dien-1-yl]henicosa-12,15-dienoate (DMAP-BLP) as having improved gene silencing potency (by nearly a factor of 10) as compared to DLin-KC2-DMA (Jayaraman et al., 2012; Runtga, 2012). Both DLin-MC-3-DMA and DMAP-BLP have pKa’s of 6.4, which appears to result in maximum endosomal release following endocytosis (Jayaraman et al., 2012).  72  With regard to the choice of siRNA, the AR-siRNA used in Chapter 2 was a 25 nt siRNA purchased as a Stealth RNAi sequence from Invitrogen. This AR-siRNA is complementary to nucleotides 3542-3563 in the AR mRNA sequence (NM_000044) found in the LBD of the AR. Collaborators at Alnylam Pharmaceuticals provided an AR-siRNA exhibiting potentially greater potency that was identified through an AR knockdown screen. This 21 nt AR-siRNA (AR21siRNA) is complementary to nucleotides 3841-3860 in the LBD and includes a phosphorothioate backbone to reduce degradation by serum nucleases such as ribonuclease A (RNAse A)-like enzymes (Haupenthal et al., 2007). The AR21-siRNA sequence also contains 2’OMe modifications to enhance stability in the presence of nucleases and to prevent an immune response (as discussed in Section 1.12.2.1). With regard to the choice of the PEG-lipid, the PEG-lipids (PEG-C-DOMG) employed in Chapter 2 are anchored into the LNP by C14 chains and can rapidly exchange out of the LNP with halftimes on the order of minutes following i.v. injection (Ambegia et al., 2005) resulting in short (< 1 hr) circulation halftimes and substantial liver accumulation. In order to achieve longer circulation lifetimes and improved accumulation at distal tumor sites we examine here the properties of LNP systems containing PEG-DSG, a lipid that resides in the LNP for 24 h or longer and gives rise to extended circulation lifetimes. The type of targeting ligand to employ to actively target LNP-siRNA systems to prostate cancer cells is of interest. A large variety of targeting approaches have been explored for LNP delivery systems (Allen and Cullis, 2013). These include attachment of monoclonal antibodies, Fab fragments, targeting peptides and aptamers to name a few. Considerable difficulties have been experienced in achieving benefit from the inclusion of targeting ligands due to difficulties in manufacturing and characterization, immune responses, LNP aggregation, non-specific 73  binding events or recognition by immune cells, all of which result in rapid clearance of the targeted LNP system with the result that very little arrives at the target site. In addition, such systems are often expensive and difficult to manufacture and characterize, particularly those containing protein-based targeting ligands, which must be attached covalently to the LNP after the LNP has been made. The targeting approach employed therefore must be straightforward to manufacture and characterize, must be reasonably selective for target cells, must trigger endocytosis following binding to cell surface and must be compatible with long circulation lifetimes required to access target tissues such as tumors. Previous work (Tam et al., 2012) from this laboratory has employed a small molecule targeting ligand approach, whereby small molecules identified to bind to target cell epitopes are attached to the end of a PEG-lipid. Such molecules can be incorporated into LNP at the time of manufacture simply by inclusion in the lipid mixture used to form the LNP. This approach has been previously demonstrated for the targeting ligand anisamide, which improved nanoparticle specificity and potency for lung and prostate cancer cells expressing sigma receptors (Banerjee et al., 2004; Chono et al., 2008; Li et al., 2008). It has also been demonstrated that LNP-siRNA systems containing the cardiac glycoside strophanthidin (STR) as the targeting ligand showed improved uptake and gene knockdown in a number of cancer cell lines due to the ability of cardiac glycosides to bind to the Na+-K+ ATPase on the cell exterior and induce endocytosis (Tam et al., 2012). The prostate-specific membrane antigen (PSMA), a plasma membrane protein that is overexpressed in many prostate cancer cells as well as the neovasculature of many solid tumors (but not in healthy tissues) represents an attractive target for LNP systems (Ghosh and Heston, 2004). Binding to PSMA results in internalization through clathrin-mediated endocytosis and 74  thus can potentially carry LNP into the cell (Liu et al., 1998). Importantly, in silico small molecule screening studies have identified a small molecule, 2-[3-(1,3-dicarboxypropyl)ureido]pentanedioic acid (DUPA) (Kularatne et al., 2009), that binds specifically to the PSMA with an affinity in the nanomolar range (Kularatne et al., 2010; Kularatne et al., 2009; Thomas et al., 2009). DUPA has been conjugated to radiolabeled and optical imaging agents (Kularatne et al., 2009), chemotherapeutic agents (Kularatne et al., 2010), and siRNA (Thomas et al., 2009) resulting in diagnostics and therapeutics that have considerable therapeutic potential (He et al., 2008). In this Chapter I therefore first characterize potency improvements achieved by using an optimized cationic lipid and an improved siRNA oligonucleotide, characterize the effect of using PEG-DSG as opposed to PEG-C-DOMG, and then investigate the benefits of targeting LNP ARsiRNA systems using DUPA targeting agents incorporated into LNP AR-siRNA systems by way of a PEG-lipid tether. In this work an improved LNP-siRNA formulation technique (Belliveau et al., 2012) that allows creation of more homogeneous LNP dispersions using microfluidic mixing was employed to formulate the LNP AR-siRNA systems. 3.2 3.2.1  Materials and methods Materials Distearoylphosphatidylcholine (DSPC) was purchased from Avanti Lipids, Cholesterol  (Chol) was purchased from Sigma (St. Louis, MO), 1,1’-dilinoleyl-3,3,3’,3’tetramethylindocarbocyanine perchlorate (DiI) was purchased from Invitrogen (Burlington, ON, Canada). The ionizable cationic lipid 3-(dimethylamino)propyl(12Z,15Z)-3-[(9Z,12Z)-octadeca9,12-dien-1-yl]henicosa-12,15-dienoate (DMAP-BLP) and (R)-2,3-bis(octadecyloxy)propyl-1(methoxy poly(ethylene glycol)2000)carbamate (PEG-DSG) were provided by Alnylam 75  Pharmaceuticals (Boston, MA). The DUPA structural analog 2-(Phosphonomethyl)pentanedioic acid (2-PMPA) was purchased from Cedarlane (Burlington, ON, Canada). 3.2.2  Cell culture, cell lines and reagents The LNCaP and PC-3 human prostate cancer cell lines were used in all in vitro  experiments (Horoszewicz et al., 1983; Kaighn et al., 1979). LNCaP and PC-3 cells were originally obtained from ATCC and were not passaged beyond 6 months after receipt or resuscitation. LNCaP cells were maintained in RPMI 1640 (Invitrogen, Burlington, ON, Canada), supplemented with 10% heat-inactivated fetal bovine serum (FBS). PC-3 cells were maintained in DMEM (Invitrogen, Burlington, ON, Canada), supplemented with 5% heatinactivated FBS. Both cell lines were incubated at 37oC with 5% CO2. 3.2.3  siRNA sequences Sequence of the human AR gene (Genbank accession no. NM_000044) was extracted  from the NCBI Entrez nucleotide database. The 21-mer AR-siRNA (AR21-siRNA) was provided by Alnylam Pharmaceuticals (Boston, MA): 5’CUGGGAAAGUCAAGCCCAUTT -3’ (AR sense) and 5’-AUGGGCUUGACUUUCCCAGTT-3’ (AR antisense). AR21-siRNA targets the AR LBD. Note that this sequence differs from the 25 nt AR-siRNA sequence used in Chapter 2, which also targets the AR LBD. This siRNA sequence is a modified 21 nt AR-siRNA that contains phosphorothioate linkages between the 3’thymidines and includes 2’OMe substitutions. 3.2.4  Encapsulation of siRNA into LNP using the microfluidic staggered herringbone  micromixer LNP formulations for use in vitro and in vivo were constructed using a Microfluidic staggered herringbone micromixer (SHM) as described previously (Belliveau et al., 2012) with 76  the following modifications. The AR-siRNA solution was prepared in 25 mmol/L acetate buffer at pH 4.0. For neutral LNP systems, lipid stocks were co-dissolved in ethanol at the following molar ratios: 55 mol% POPC, 43.5 mol% Chol, (1 or 2) mol% PEG-DSG, (1 or 0) mol% DUPAPEG-DSG, 0.2 mol% DiI. For comparison studies between DMAP-BLP and DLin-KC2-DMA, lipid stocks were co-dissolved in ethanol at appropriate molar ratios: (40% DLin-KC2-DMA or DMAP-BLP, 17.5% DSPC, 37.5% Chol, 2.5% PEG-C-DOMG). For comparison studies of DUPA-targeted cationic LNP encapsulating AR-siRNA containing 2.5 mol% total PEG-lipid, lipid stocks were co-dissolved in ethanol at appropriate molar ratios: (1, 0.5 or 0) mol% DUPAPEG-DSG, (1.5, 2.0 or 2.5) mol% PEG-DSG, 10 mol% DSPC, 37.5 mol% Chol, 50 mol% DMAP-BLP, 0.2 mol% DiI. For cationic LNP encapsulating AR-siRNA containing 5.0 mol% total PEG used for in vivo studies, lipid stocks were co-dissolved in ethanol at the following molar ratios: (1 or 0) mol% DUPA-PEG-DSG, (4 or 5) mol% PEG-DSG, 10 mol% DSPC, 37.5 mol% Chol, 50 mol% DMAP-BLP, 0.2 mol%DiI. For in vitro formulations, two syringe pumps (PHD22/2000, Harvard Apparatus, Holliston, MA) were used to control the flow rate through the microfluidic device. The total flow rate was 3 ml/min. For in vivo formulations a cyclic olefin copolymer (COC) microfluidic mixer was used. 3.2.5  Characterization of LNP The mean diameter of the vesicles was determined using a NICOMP370 particle sizer  (Nicomp Particle Sizing, Santa Barbara, CA). Intensity-weighted size and distribution data was used. For LNP containing a total of 2.5 mol% PEG-lipid: DUPA-LNP-AR-siRNA (1 mol% DUPA) was 84.5 ± 32.5 nm, DUPA-LNP-AR-siRNA (0.5 mol% DUPA) was 77.5 ± 23.6 nm, and the non-targeted LNP-AR-siRNA (0 mol% DUPA) was 73.6 ± 31.6 nm. For LNP containing a total of 5.0 mol% PEG-lipid: DUPA-LNP-AR-siRNA (1 mol% DUPA-PEG-DSG) 77  was 55.9 ± 22.5 nm, and the non-targeted LNP-AR-siRNA (no targeting PEG-lipid) was 45.3 ± 16.5 nm. LNP were also measured for zeta potential with the Malvern Nano ZS (Worcestershire, UK). Lipid concentrations were measured by total cholesterol (T-CHO) using the cholesterol E enzymatic assay from Wako Chemcials (Richmond, VA). SiRNA concentrations were measured via Quant-iT RiboGreen RNA Reagent and Kit (Invitrogen, Burlington, ON) according to the manufacturer’s protocol. Encapsulation efficiency was determined by addition of 1% Triton-X100 (Sigma, St. Louis, MO) and measuring the total siRNA concentration subtracted from LNP not treated with Triton-X-100. 3.2.6  Western blotting LNCaP cells were plated in 12-well plates (2.0 x 105 cells per well). Cells were washed  in PBS and lysed in RIPA buffer (1% NP-40, 0.25% Deoxycholic Acid) with protease inhibitor tablets (Roche Diagnostics). Total protein (10 µg) quantified by Bradford Assay was analyzed by immunoblotting. Antibodies to AR were from Santa Cruz Biotechnology (AR-441) (Santa Cruz, CA). Antibodies to GAPDH were from Abcam (Cambridge, MA). Antigen-antibody complexes were detected using Millipore Immobilon Western Chemiluminescent HRP Substrate (Billerica, MA). 3.2.7  Confocal microscopy Excised LNCaP tumors were maintained in 10% buffered formalin and then cryo-  sectioned by Wax-IT Histology Services Inc. (University of British Columbia, Vancouver, BC). Tissue sections were fixed onto glass cover slips and examined under an Olympus FV1000 (Center Valley, PA) laser-scanning microscope. 20 fields of view were examined per mouse xenograft.  78  3.2.8  Fluorescence microscopy LNCaP cells were seeded at 2.0 x 104 cells per well in a 96-well plate. PC-3 cells were  seeded at 1.5 x 104 cells per well in a 96-well plate. For uptake of non-cationic particles: LNCaP cells were treated with an equivalent dose of 5 and 10 µg/ml of DUPA-LNP and non-targeted LNP. For uptake of cationic particles in LNCaP cells: 5 and 10 µg/ml of AR-siRNA encapsulated in DUPA-LNP AR-siRNA (1 mol% DUPA-PEG-DSG) and LNP AR-siRNA for 2, 8 and 24 h. 2-PMPA was added as a competitive reagent at 100X the concentration of DUPAPEG-DSG. For uptake of cationic particles in PC-3 cells 1, 5 and 10 µg/ml of (0.5 and 1 mol%) DUPA-LNP AR-siRNA and LNP AR-siRNA were used to treat PC-3 cells for 4, 8 and 24 h. Cells were fixed in 3% PFA with Hoechst’s stain and examined using a Cellomics ArrayScan VTI HCS Reader (Thermo Scientific, Pittsburgh, PA). 3.2.9  Pharmacokinetics of targeted and non-targeted LNP Female, 6- to 8-week old CD1 outbred mice were obtained from Charles River  Laboratories (Wilmington, MA, USA) and quarantined for 3 weeks prior to use. All procedures involving animals were performed in accordance with the guidelines established by the Canadian Council on Animal Care. CD1 mice were injected i.v. at an LNP AR-siRNA dose of 1 mg/kg via the lateral tail vein, at 5 separate time points (0.25, 0.5, 2, 8 and 24 h) with DUPA- and nontargeted LNP AR-siRNA. LNP were labeled with [3H]-cholesteryl hexadecylether (CHE) comprising 0.006 mol% of the LNP formulation. Mice were sacrificed by cervical dislocation. Blood was collected in Vacutainer (BD Biosciences, Canada) tubes containing EDTA. Blood was chemically digested at room temperature using Solvable (Perkin-Elmer, Wellesley, MA) followed by decolorization with hydrogen peroxide (30% w/w) and analysis by liquid scintillation counting in Pico-Fluor 40 (Perkin-Elmer). 79  3.2.10 Assessing effect of AR knockdown in vivo Xenograft prostate tumors were established as described elsewhere (Cheng et al., 2006). Briefly, LNCaP cells (5 × 106) in 0.1 ml Matrigel (Becton Dickinson Labware, Mississauga, Ontario, Canada) were inoculated subcutaneously (s.c.) in two flank regions of 6- to 8-week-old male athymic nude mice (Harlan Sprague Dawley, Inc., Indianapolis, IN) under halothane anesthesia using a 27-gauge needle. When the tumors became palpable, their volumes were measured and blood was collected from the tail vein to assess serum PSA by ELISA (ClinPro International, Union City, CA). Once PSA values reached 50-75 ng/ml, animals were randomized into 3 groups. For the comparison study between AR21-siRNA and AR25-siRNA, mice were i.v. injected through the tail vein with LNP AR-siRNA encapsulated with either AR21-siRNA or AR25-siRNA. The control group was injected with LNP SC-siRNA. Mice were injected at Day 1, 2, 3, 7, 9 and 11 at a dose of 10 mg siRNA/kg. Mice were sacrificed at Day 14 and serum PSA levels were examined. For the comparison study between DMAP-BLP and DLin-KC2-DMA, mice were i.v. injected through the tail vein with LNP AR-siRNA containing DMAP-BLP, and another group was injected with LNP AR-siRNA containing DLinKC2-DMA. The control group was injected with LNP SC-siRNA containing DMAP-BLP. Mice were injected at Day 1, 2, 3, 7, 9 and 11 at a dose of 10 mg siRNA/kg of mouse body weight. Mice were sacrificed at Day 14. Serum PSA levels, and AR knockdown levels were assessed via Western blotting. For DUPA-targeted in vivo studies: DUPA-LNP AR-siRNA, non-targeted LNP ARsiRNA and saline (PBS) were injected i.v. through the tail vein. PBS was injected as a baseline control. Targeted and non-targeted LNP AR-siRNA were injected at Day 1, 2, 3, 7, 9 and 11 at a dose of 5 mg siRNA/kg of mouse body weight. Mice were sacrificed at Day 14. Serum PSA 80  levels, mRNA levels of AR and PSA, and immunohistochemical analysis of xenograft tumors were performed. All animal procedures were done according to the guidelines of the Canadian Council of Animal Care and with appropriate institutional certification. 3.2.11 Real-time reverse transcription PCR (qRT-PCR) To assess the effect of siRNA to knockdown AR, serum PSA were first assayed by ELISA according to the standard manufacturer’s protocol. qRT-PCR was further conducted to assess the mRNA level of AR and PSA in xenograft tumors. Briefly, total RNA from mouse tissue was isolated using the Trizol method (Invitrogen). RNA extracts were reverse transcribed using random hexamers (Applied Biosystems, Foster City, CA) and MMLV reverse transcriptase (Invitrogen). Triplicates of the resulting cDNA were used as templates for quantitative real-time PCR on the Applied Biosystems 7900HT Fast Real-Time PCR System following the SYBR® Green PCR Master Mix protocol. 18S rRNA was used as an endogenous control. Primer sequences for AR: sense 5’-GCA GGC AAG AGC ACT GAA GAT A-3’ and anti-sense 5’-CCT TTG GTG TAA CCT CCC TTG A-3’. Primers for PSA: sense 5’TGTGCTTCAAGGTATCACGTCAT-3’ and anti-sense: 5’- TGTACAGGGAAGGCCTTTCG3’. Primers for 18S rRNA: sense 5’-CGA TGC TCT TAG CTG AGT GT-3’ and anti-sense 5’GGT CCA AGA ATT TCA CCT CT-3’. 3.2.12 Immunohistochemistry of tumor tissues Immunohistochemistry staining was conducted by a Ventana autostainer model Discover XT (Ventana Medical System) with an enzyme-labeled biotin streptavidin system and solvent resistant DAB Map kit. The antibody used for Ki67 was from Lab Vision Corporation and diluted 1:500 in 1X PBS. The TUNEL or apoptosis study was done using, a TdT enzyme kit (Roche, Indianapolis, IN). IHC slides were scanned by Leica Digital Imaging System. Images 81  were viewed using Digital Image Hub, Slide Path, digital pathology solution (Dublin, Ireland). The number of Ki67 positive cells per core or per section were averaged and calculated as the proliferation factor. The number of apoptotic positive cells per core or per section was averaged and calculated as the apoptotic factor. 3.2.13 Statistical analyses All statistical analyses were performed using GraphPad. Initially, a one-way ANOVA was used to statistically evaluate the differences between treatment groups. In the case of statistically significant results, the differences between treatment groups were assessed through the use of the Tukey-Kramer multiple comparisons test unless otherwise stated. Probability (p) values less than 0.05 were considered significant. 3.3 3.3.1  Results DUPA-conjugated AR-siRNA is not an effective gene silencing system Recent work has shown that the direct coupling of a GalNAc targeting ligand to siRNA  can result in effective gene silencing in hepatocytes following i.v. administration (personal communication). It is of interest to establish whether a similar system of DUPA-targeted ARsiRNA could be an effective gene silencing agent. Here the properties of an AR-siRNA sequence conjugated to a monovalent DUPA moiety (DUPA-AR-siRNA) as well as a trivalent DUPA moiety (DUPA3-AR-siRNA) are characterized in vitro (Figure 3.1A-B). Both DUPAAR-siRNA and DUPA3-AR-siRNA contained an Alexa-647 fluorescent label for monitoring cellular uptake. DUPA-AR-siRNA and DUPA3-AR-siRNA conferred similar cellular uptake profiles with an approximate 1.5 to 2-fold increase when normalized to the uptake of the nontargeted AR-siRNA sequence (Figure 3.1A). However, the increase in cellular uptake did not correlate with gene silencing, as no AR knockdown was observed when LNCaP cells were 82  treated with DUPA-AR-siRNA and DUPA3-AR-siRNA alone (Figure 3.1B). These are active gene silencing molecules as the addition of a transfection reagent (Lipofectamine 2000, Invitrogen) resulted in complete AR knockdown (Figure 3.1B). This suggests that while the DUPA-conjugated siRNA may have increased uptake into the cell via PSMA-dependent endocytosis, it does not escape the endosomal compartments. In turn this indicates the need for DUPA-targeted LNP systems containing cationic lipids such as DLin-MC-3-DMA or DMAPBLP optimized for endosomolytic properties (Hafez et al., 2001; Semple et al., 2010).  83  A)  B)  Figure 3.1 Monovalent (DUPA-) and trivalent (DUPA3-AR-siRNA) conjugates on cellular uptake and AR gene knockdown in LNCaP cells in vitro A) Monovalent DUPA-AR-siRNA, trivalent DUPA3-AR-siRNA and non-targeted AR-siRNA containing an Alexa-647 fluorescent label were added to LNCaP cells at 25, 100 and 500 nM for 24 h. Cellular uptake of DUPA-siRNA conjugates was measured as the fold-change in mean fluorescent intensity per cell via Cellomics ArrayScan normalized to uptake of a non-targeted AR-siRNA (i.e. mean fluorescent intensity of DUPA and DUPA3-AR-siRNA/non-targeted ARsiRNA). Approximately 400 cells were measured in four individual wells (n = 4) ± SD. B) LNCaP cells were incubated with 25, 100 and 500 nM of DUPA-AR-siRNA, DUPA3-ARsiRNA, and non-targeted AR-siRNA for 48 h as described in Materials and methods. Lipofectamine 2000 (L2000) (Invitrogen) was added to each treatment group at 100 nM siRNA as a positive control. LNP AR-siRNA was added at 5 µg/ml containing DLin-KC2DMA/DSPC/Cholesterol/PEG-C14 (50/10/38.5/1.5; mol:mol) was also added as a positive control. Protein expression was analyzed by Western immunoblotting.  84  3.3.2  LNP AR-siRNA systems containing the cationic lipid DMAP-BLP exhibit improved  in vitro and in vivo gene silencing potency compared to LNP AR-siRNA systems containing DLin-KC2-DMA LNP AR-siRNA systems with the lipid composition cationic lipid/DSPC/cholesterol/ PEG-C14 (40/17.5/40/2.5; mol:mol) containing AR21-siRNA at a ratio of siRNA/lipid of 0.067 (wt/wt) were prepared using the microfluidic mixer as described under Materials and methods. The cationic lipids employed were either DMAP-BLP or DLin-KC2-DMA. LNP containing a scrambled siRNA (SC-siRNA) and DMAP-BLP were used as a control. LNP AR-siRNA was incubated in vitro with LNCaP cells for 48 h at concentrations of 0.5, 1.0 and 5.0 µg/ml. AR knockdown was assessed via Western blotting (see Figure 3.2) and showed that greater AR knockdown was observed, at equivalent LNP-siRNA concentrations, with LNP containing DMAP-BLP encapsulating AR21-siRNA (LNP DMAP-AR) compared to LNP AR-siRNA containing DLin-KC2-DMA (LNP KC2-AR).  85  Figure 3.2 Influence of DMAP-BLP and DLin-KC2-DMA cationic lipid species on AR knockdown in LNCaP cells in vitro LNP AR-siRNA or LNP SC-siRNA formulated with the cationic lipid DMAP-BLP (DMAP) or DLin-KC2-DMA (KC2) was added to LNCaP cells at 0.5, 1.0 or 5.0 µg/ml for 48 h. The lipid compositions of the LNPs were cationic lipid/DSPC/cholesterol/PEG-C14 (40/17.5/40/2.5; mol:mol). Protein expression was analyzed by Western immunoblotting. GAPDH is used as a loading control. The LNCaP xenograft tumor model (the same model used in Chapter 2) generated in athymic nude mice was used to assess the potency of LNP AR-siRNA containing the DMAPBLP cationic lipid. Mice were inoculated with LNCaP cells and, when serum PSA levels reached 50-75 ng/ml, were randomized into three groups and LNP containing DLin-KC2-DMA (LNP KC2-AR), DMAP-BLP (LNP DMAP-AR) and LNP DMAP containing SC-siRNA (LNP DMAP-SC) were injected at doses of 10 mg siRNA/kg body weight on Days 1, 2, and 3 and then again on Days 7, 9 and 11 (total of 6 injections). Mice were sacrificed at Day 14. Serum PSA levels were assayed as described under Materials and methods. As shown in Figure 3.3A, LNP DMAP-AR systems caused a larger drop in serum PSA at Day 14 compared to LNP KC2-AR and the scrambled control (LNP DMAP-SC). When tumor tissues were assessed for protein  86  levels of AR via Western blotting, a significant decrease compared to the control was obtained following quantification of the Western blots (p < 0.01) (Figure 3.3B-C).  87  A)  C)  B)  Figure 3.3 Systemic administration of LNP AR-siRNA containing DMAP-BLP reduces serum PSA levels and enhances AR knockdown compared to LNP AR-siRNA containing DLin-KC2-DMA Mice were i.v. injected via tail vein with LNP AR and SC-siRNA (10 mg/kg) as described in Materials and methods. A) Percentages of serum PSA levels are relative to PSA levels at 1 day before treatment. No significance was confirmed following Bonferroni post-tests followed by two-way ANOVA. B) Western blot of AR from all tumor tissues in each group of animals with β-actin used as a loading control. Each lane represents an individual tumor. Note that there are two tumors per mouse. C) Western blot quantification of AR from all tumor tissues in each group of animals, normalized to levels of β-actin (loading control). Protein extracts were isolated from tumor tissues at Day 14. Data points are the mean of one representative experiment (n = 12-14) ± SE. **p < 0.01.  88  3.3.3  LNP containing AR21-siRNA exhibit improved in vitro and in vivo gene silencing  potency as compared to LNP containing AR25-siRNA AR21-siRNA (phosphorothioate and 2’OMe modified 21 nt AR-siRNA) and AR25siRNA (unmodified 25 nt AR-siRNA) were formulated into LNP containing DMAP-BLP using the SHM micromixer as described in Materials and methods using the cationic lipid/DSPC/cholesterol/PEG-C14 mixture (40/17.5/40/2.5; mol:mol) and an siRNA/lipid ratio of 0.067 (wt/wt). LNP containing AR21-siRNA and AR25-siRNA were incubated with LNCaP cells in vitro at siRNA concentrations of 0.5, 1.0, and 5.0 µg/ml. As observed in Figure 3.4A, LNP containing AR21-siRNA are more potent systems for silencing the AR gene in LNCaP cells in vitro as compared to LNP containing AR25-siRNA. As may be expected, LNP-siRNA systems containing AR21-siRNA also exhibited improved gene silencing in vivo using the LNCaP xenograft model. LNP AR21-siRNA, LNP AR25-siRNA and LNP SC-siRNA were injected at a dose of 10 mg siRNA/kg body weight using the dosing schedule described in Materials and methods (Section 2.2.10). The serum PSA levels are displayed in Figure 3.4B and normalized to serum PSA levels from mice treated with an LNP scrambled control (SC)-siRNA, following the sacrificing of mice at Day 14. As can be seen, there is a reduction in serum PSA levels when AR21-siRNA is encapsulated in LNP as compared to the AR25-siRNA (Figure 3.4B).  89  A)  B)  Figure 3.4 LNP encapsulating AR21-siRNA results in enhanced AR knockdown in vitro and further reduces serum PSA levels in vivo compared to LNP encapsulating AR25siRNA A) LNCaP cells in vitro were incubated with 0.5, 1.0 and 5.0 µg/ml of LNP AR-siRNA encapsulated with either AR25-siRNA or AR21-siRNA for 48 h as described in Materials and methods. The LNPs were composed of DMAP-BLP/DSPC/Cholesterol/PEG-C14 (40/17.5/40/2.5; mol:mol). Protein expression was analyzed by Western immunoblotting. βactin is used as a loading control. B) Mice were i.v. injected via tail vein with LNP AR21-, AR25- and SC-siRNA (10 mg/kg) as described in Materials and methods. Percentages of serum PSA levels are expressed as a normalized value to the scrambled control. **p < 0.01. Bonferroni post tests were performed followed by two-way ANOVA.  90  3.3.4  LNP containing PEG-DSG exhibit long circulation times and improved tumor  accumulation In all the studies to date the PEG-lipid used has been PEG-C-DOMG, which contains C14 chains to anchor the PEG-lipid into the LNP. The PEG-lipid is required to form the LNP systems, in the absence of PEG-lipid macroscopic aggregates are formed (Yoshioka, 1991). As noted elsewhere (Ambegia et al., 2005), PEG lipids with C14 chains can dissociate from the LNP in times of minutes or less, which, in the case of LNP-siRNA systems for delivery to the liver would be expected to be advantageous, facilitating adsorption of serum proteins such as ApoE that lead to uptake by hepatocytes. However, for LNP-siRNA systems intended to silence genes in distal tumors the dissociation of the PEG-coating and the short circulation lifetimes that result would be expected to lead to poor accumulation at tumor sites. In order to achieve LNP systems that exhibit improved circulation lifetimes it is logical to incorporate a PEG-lipid with longer acyl chains such as PEG-DSG, which contains C18 chains. Previous work has shown that PEG-lipids with C18 acyl chains remain associated with LNP for days or longer (Ambegia et al., 2005; Chen et al., 2013), leading to extended circulation lifetimes following i.v. administration (Ambegia et al., 2005; Chen et al., 2013). The large effect of incorporating 5 mol% PEG-DSG into LNP-siRNA systems on the circulation lifetimes is shown in Hope et al. (Hope, 2013). In order to show that this increase in circulation lifetime leads to significantly higher levels of LNP accumulation at the tumor site two fluorescently labeled LNP AR-siRNA (DiI-LNP AR-siRNA) containing 2.5 mol% PEG-DSG and 5.0 mol% PEG-DSG were formulated. DiI-LNP AR-siRNA were injected intravenously 3 times (once every day for three days) at an equivalent dose of 10 mg siRNA/kg body weight in athymic nude mice bearing LNCaP tumors. Mice were sacrificed 4 and 24 h following the final injection of DiI-LNP AR91  siRNA. Tumors were then harvested, stored in 10% formalin, cryo-sectioned, and analyzed for fluorescent LNP uptake (Figure 3.5A). Quantification of fluorescent images of tumor tissues showed a nearly four-fold increase in DiI-LNP AR-siRNA containing 5.0 mol% PEG-DSG versus mice treated with DiI-LNP AR-siRNA containing only 2.5 mol% PEG-DSG (Figure 3.5A-B).  92  A)  B)  Figure 3.5 Systemic administration of fluorescently labeled DiI-LNP AR-siRNA containing 5.0 mol% PEG-DSG results in greater accumulation in LNCaP tumors compared to LNP containing 2.5 mol% PEG-DSG A) Mice were i.v injected via tail vein with DiI LNP AR-siRNA (red) containing 5.0 or 2.5 mol% PEG-DSG (10 mg/kg) as described in Materials and methods. Mice were sacrificed 4 or 24 h following the final i.v. injection. LNCaP tumors were harvested, cryo-sectioned and analyzed under a confocal microscope. Representative images are shown. Nuclei were stained with Hoechst (blue). B) Quantification of fluorescent uptake into LNCaP tumor tissues was performed with ImageJ (n = 5) (http://rsb.info.nih.gov/ij/). Statistical significance is determined between 5.0 mol% PEG-DSG versus 2.5 mol% PEG-DSG. (*p < 0.05; **p < 0.01).  93  3.3.5  Incorporation of DUPA-PEG-DSG into POPC-cholesterol LNP systems increases  cellular uptake into LNCaP cells via a PSMA-dependent endocytotic mechanism The results to this stage detail improvements to LNP-siRNA systems with regard to the cationic lipid, the siRNA and the PEG-lipid to improve potency and enhance delivery to tumor sites. The presence of 5 mol% PEG-DSG results in long circulation lifetimes and enhanced tumor accumulation, however as noted elsewhere (Hope, 2013) the presence of a stable PEG coating above 1.5 mol% inhibits the activity of LNP-siRNA systems as such systems are not readily accumulated by target cells. Thus active targeting information, such as incorporation of DUPA-PEG-DSG, is required. As a first step to characterize the utility of DUPA as a targeting ligand for LNP AR siRNA systems, DUPA-PEG-DSG was incorporated into LNP consisting of POPC and cholesterol (55/43.5; mol:mol). The POPC/cholesterol lipid mixture, which has no net charge, was chosen for initial studies to avoid potentially confounding effects due to interaction of the negatively charged DUPA moiety and the cationic lipid during formulation. In addition, the ionizable cationic lipid results in a slight positive charge at neutral pH, which could also enhance uptake by associating with the negatively charged cell surface. The DUPA-PEGDSG (1 mol%) was dissolved in the ethanol solution with POPC, cholesterol and the fluorescently labeled lipid DiI and LNP were formed using the microfluidic mixing apparatus as indicated in Materials and methods. DUPA-LNP as well as non-targeted control LNP were then incubated with LNCaP cells at a concentration of 15 and 75 µg lipid/ml for 2, 8 and 24 hr. If these LNP had contained siRNA at a lipid to siRNA ratio of 0.067 (wt/wt) this would correspond to siRNA concentrations of 1 and 5 µg/ml (Figure 3.6). Uptake was measured as the mean fluorescent intensity per cell as determined employing the Cellomics ArrayScan. A nearly two-fold increase in cellular uptake of LNP was observed for 94  the systems containing 1% DUPA-PEG-DSG (DUPA-LNP) compared with the non-targeted LNP at all time points (Figure 3.6). The increase in cell uptake can be attributed to a PSMAdependent mechanism as uptake was substantially decreased by addition of a competitive DUPA structural analog (2-PMPA) at 100X the DUPA-PEG-DSG molar concentration (Figure 3.6). The presence of 2-PMPA did not cause any significant change in the cellular uptake profile of non-targeted LNP.  95  Figure 3.6 DUPA-LNP containing no ionizable cationic lipid enhances cellular uptake in PSMA-positive LNCaP cells in vitro LNCaP cells were incubated for 2, 8 and 24 h with DUPA-LNP (containing no AR-siRNA or ionizable cationic lipid) at a siRNA equivalent dose of 1 and 5 µg/ml as described in Materials and methods. Cellular uptake was quantified using Cellomics ArrayScan and expressed as mean fluorescent intensity per cell. Approximately 400 cells were measured in four individual wells (n = 4) ± SD. 2-PMPA was added as a competitive reagent to reduce PSMA-dependent uptake of DUPA-targeted LNP. Statistical significance is determined between DUPA-LNP treated groups versus DUPA-LNP treated with 2-PMPA plus all non-targeted controls. **p < 0.01  96  3.3.6  Incorporation of DUPA-PEG-DSG into LNP-siRNA systems increase cellular  uptake in LNCaP cells and enhances AR gene silencing via a PSMA-dependent endocytotic mechanism The results of the previous section indicate that incorporation of 1% DUPA-PEG-lipid into LNP-siRNA systems should increase LNP uptake into LNCaP cells by approximately twofold and should be significantly reduced in the presence of the competitive ligand 2-PMPA in the absence of complications arising from potential association of the DUPA with cationic lipid and/or LNP association with the cell surface due to the slight positive charge on the LNP. In order to test the effects of incorporating the DUPA-PEG-lipid in vitro an LNP AR-siRNA system containing a total of 2.5 mol% PEG-DSG was utilized. As noted previously, a total of 5 mol% PEG-DSG is required in order to achieve the long circulation lifetimes leading to maximum tumor accumulation, however the presence of high levels of PEG-lipid can reduce the potency of LNP systems in vitro (Ambegia et al., 2005), possibly by reducing cell association. Fluorescently-labeled LNP containing DMAP-BLP and a total PEG-lipid content (including both DUPA-PEG-DSG and PEG-DSG) of 2.5 mol% were formulated. DUPA-PEGDSG was present at either 0.5 or 1 mol% with additional PEG-DSG to make up the total amount of PEG-lipid present in the LNP to 2.5 mol%. Cellular uptake was analyzed using fluorescentlylabeled LNP in LNCaP cells (Figure 3.8A). At the 24 h time point, the cellular uptake at 10 µg/ml of 1% DUPA-LNP AR-siRNA was roughly 5-fold higher compared to the non-targeted LNP AR-siRNA (Figure 3.8B). To further verify that DUPA-LNP AR-siRNA were taken up via a PSMA-dependent mechanism, LNCaP cells were treated with 1 mol% containing DUPA-LNP AR-siRNA as well as a non-targeted LNP AR-siRNA at 5 and 10 μg siRNA/ml. The competitive reagent, 2-PMPA, was added at 100X the concentration of DUPA-LNP. The 97  addition of 2-PMPA caused a substantial decrease in DUPA-LNP AR-siRNA cellular uptake in LNCaP cells (Figure 3.8B), however 2-PMPA had little to no effect in the uptake of non-targeted LNP AR-siRNA (Figure 3.8B). LNP uptake was also measured in PC-3 cells, a prostate cancer cell line that is both PSMA and AR-negative (Kaighn et al., 1979). Since PC-3 is PSMA-negative, no increase in LNP AR-siRNA uptake should be observed when the DUPA ligand is present. This is indeed the case (Figure 3.9). Significantly greater LNP uptake was observed in PC-3 cells treated with non-targeted LNP AR-siRNA compared to DUPA-LNP AR-siRNA (Figure 3.9). This could be due to charge repulsion between the plasma membrane and the DUPA moiety. It would be expected that the increased uptake into LNCaP cells stimulated by the presence of the DUPA PEG-lipid would lead to enhanced target gene silencing in LNCaP cells. That this is the case is shown in Figure 3.8A which shows that LNCaP cells incubated with LNP AR-siRNA containing DUPA-PEG-DSG exhibited reduced AR protein levels as compared to cells incubated with non-targeted LNP (Figure 3.8A). Greater AR knockdown was observed with increased amounts of DUPA-PEG-DSG present in the formulation (i.e. 1.0 mol% DUPAPEG-DSG was more potent than 0.5 mol% DUPA-PEG-DSG), especially at the 5 and 10 μg/ml siRNA doses (Figure 3.8A).  98  A)  B)  Figure 3.7 Structures of DMAP-BLP and PEG-DSG A) Chemical structure of DMAP-BLP. DMAP-BLP consists of a single ester linkage between the acyl chains and the amino head group. B) Chemical structure of PEG-DSG. This PEG-lipid contains C18 acyl chain lengths.  99  A)  B)  Figure 3.8 DUPA-LNP AR-siRNA enhances cellular uptake and AR gene silencing in PSMA-positive LNCaP cells in vitro A) LNCaP cells were incubated with 1, 5, 10 and 15 µg/ml of DUPA-LNP AR-siRNA with the composition DMAP-BLP/DSPC/Chol/DUPA-PEG-DSG/PEG-DSG (50/10/37.5/[1 or 0.5 or 0]/[1.5 or 2 or 2.5]; mol:mol) for 48 h. Cells treated with LNP containing 1% PEG-C14 were used as a positive control. Levels of AR protein were analyzed by Western immunoblotting with β-actin (loading control). Note that AR knockdown did not occur as readily at 1 µg/ml due to the fact that these LNP containing PEG-DSG, which exchanges out of the LNP more slowly than PEG-C-DOMG. B) LNCaP cells were incubated with 5 and 10 µg/ml of DiI-fluorescent labeled DUPA-LNP AR-siRNA with the composition DMAP-BLP/DSPC/Chol/DUPA-PEG-DSG/PEGDSG (50/10/37.5/[1 or 0]/[1.5 or 2.5]; mol:mol) for 2, 8 and 24 h. Cellular uptake was quantified using Cellomics ArrayScan and expressed as mean fluorescent intensity per cell. Approximately 400 cells were measured in four individual wells (n = 4) ± SD. 2-PMPA was added as a competitive reagent to reduce PSMA-dependent uptake of DUPA-targeted LNP. Statistical significance is determined between DUPA-LNP AR-siRNA treated groups versus DUPA-LNP AR-siRNA treated with 2-PMPA plus all non-targeted controls. **p < 0.01  100  Figure 3.9 DUPA-LNP AR-siRNA does not enhance cellular uptake in PSMA-negative PC-3 cells in vitro PC-3 (PSMA-negative) prostate cancer cells were incubated with 1, 5 and 10 µg/ml with DiIfluorescent labeled DUPA-LNP AR-siRNA with the composition DMAPBLP/DSPC/Chol/DUPA-PEG-DSG/PEG-DSG (50/10/37.5/[1 or 0]/[1.5 or 2.5]; mol:mol) for 4, 8 and 24 h. Cellular uptake was quantified using Cellomics ArrayScan and expressed as mean fluorescent intensity per cell. Approximately 400 cells were measured in four individual wells (n = 4) ± SD. Statistical significance is determined between DUPA-LNP AR-siRNA treated groups versus non-targeted LNP AR-siRNA treated groups. **p < 0.01 3.3.7  LNP-siRNA systems containing the DUPA targeting ligand exhibit long circulation  lifetimes As indicated previously, it is important that LNP systems exhibit long circulation lifetimes in order to achieve maximum accumulation at tumor sites. In this context it is important to show that the presence of the DUPA-PEG-DSG does not materially reduce the circulation lifetime of the LNP AR-siRNA systems employed. The structure of DUPA-PEGDSG contains 3 carboxylic acid chemical groups at its hydrophilic terminal end (Figure 3.10). Estimation of the pKa values of these carboxylic acid groups have been determined using Marvin 101  (ChemAxon), which uses an algorithm to calculate the pKa of titratable chemical groups (http://www.chemaxon.com/products/marvin/). The predicted pKa values are 3.11, 3.69 and 3.99 (Figure 3.10) indicating that DUPA exhibits a strong negative charge at physiological pH. The zeta-potential of DUPA-LNP AR-siRNA was determined to be -14.97 ± 9.34 mV, nontargeted LNP AR-siRNA exhibited a zeta potential of -4.91 ± 11 mV. LNP exhibiting negative charges can be rapidly cleared from the bloodstream via opsonization by the reticuloendothelial system (RES) cells of the liver and spleen (Chonn et al., 1992; Park et al., 1992). The circulation lifetime of DUPA-targeted LNP was determined via i.v. administration of tritiated (3H)-LNP for a single injection at 1 mg siRNA/kg body weight using 3H-DUPA-LNP AR-siRNA, a non-targeted 3H-LNP AR-siRNA or saline (PBS). A cholesterol derivative, [3H]cholesterol-hexadecyl ether (CHE), is incorporated into all tritiated LNP. [3H]-CHE has been shown to be nonexchangeable and non-metabolizable (Stein et al., 1980). LNP were administered i.v. to three groups of mice and blood collected via cardiac puncture at 0.25, 0.5, 2, 8, 24 h. Figure 3.11 shows the % of the injected dose remaining in the circulation over time. It is clear by comparison of Figure 3.5 and Figure 3.11 that DUPA-LNP AR-siRNA and nontargeted LNP AR-siRNA exhibited very similar circulation lifetimes (t1/2 = 10-12 h) suggesting that the DUPA targeted LNP will exhibit the enhanced accumulation at distal tumor sites observed for the non-targeted systems due to the enhanced permeability and retention effect (Maeda et al., 2000).  102  Figure 3.10 DUPA-PEG-DSG exhibits 3 negative charges DUPA-PEG-DSG contains 3 carboxylic acid groups predicted to have pKa values of 3.11, 3.69 and 3.99 indicating that 3 negative charges would exist on the DUPA moiety at physiological pH. The pKa values were predicted by Marvin (http://www.chemaxon.com/products/marvin/), which uses a series of algorithms to calculate the pKa of titratable groups.  103  Figure 3.11 DUPA-LNP AR-siRNA and non-targeted DUPA-LNP AR-siRNA exhibit similar pharmacokinetics DUPA-LNP AR-siRNA and non-targeted LNP AR-siRNA were synthesized with a triatiated cholesterol derivative [3H]-Cholesteryl hexadecyl ether (CHE). The LNP formulations contained DMAP-BLP/DSPC/Cholesterol/DUPA-PEG-DSG/PEG-DSG (50/10/35/[1 or 0]/[4 or 5]; mol:mol). Mice were i.v. injected with 1 mg/kg of 3H-DUPA-LNP AR-siRNA and 3H-LNP ARsiRNA as described in Materials and methods. Mice were sacrificed 0.25, 0.5, 2, 8 and 24 h following the final injection, and blood was obtained via cardiac puncture, digested, decolorized and analyzed for 3H content with a scintillation counter. Pharmacokinetics were plotted as a percentage of the total injected dose into each mouse. A correction factor has been applied to account for the total amount of blood present in each animal as performed in (Wilson et al., 2007). Each data point represents the mean ± SD (n = 4).  104  3.3.8  DUPA targeted LNP AR-siRNA can enhance AR knockdown in mice bearing  LNCaP tumors To determine the potency of DUPA-LNP in vivo, athymic nude mice bearing LNCaP tumors were i.v. injected when serum PSA levels reached 50-75 ng/ml. Mice were randomly assigned to three experimental groups and were i.v. administered DUPA-LNP AR-siRNA, nontargeted LNP AR-siRNA or saline at a dose of 5 mg siRNA/kg body weight. This is a 2-fold reduction in the overall dosing regimen, as previous studies in Chapter 2 have used 10 mg siRNA/kg dose (6 injections total). A dose of 1 mg siRNA/kg of DUPA-LNP AR-siRNA did not show any significant impact of AR gene expression (data not shown). Injections took place at Days 1, 2 and 3, and then a second set of injections was made at Days 7, 9 and 11. Mice were sacrificed at Day 14. No obvious toxic side effects were observed during the 14-day period of treatments. Serum PSA levels continued to rise in the PBS control group to 40% above the baseline level at Day 14 (Figure 3.12A). PSA levels remained relatively close to the baseline with nontargeted LNP AR-siRNA (Figure 3.12A). This is already an improvement as the same result was obtained using double the dose in our previous study (Figure 2.6A) and may arise due to greater accumulation at the distal tumor site. Remarkably, the DUPA-targeted LNP AR-siRNA experimental group showed a 20% decrease in the serum PSA levels at Day 14 (Figure 3.12A). This is the first time a decrease in serum PSA levels has been observed using an LNP AR-siRNA delivery system. To further verify that specific AR gene silencing was occurring, mRNA transcript levels of AR and PSA were assessed from LNCaP tumors at Day 14 via qRT-PCR (Figure 3.12B-C). There was a significant reduction in AR mRNA transcript levels with the DUPA-LNP AR-siRNA treated group compared to mice treated with the non-targeted LNP AR105  siRNA or PBS (p < 0.01) (Figure 3.12B). Non-targeted LNP AR-siRNA did not cause a significant reduction in mRNA transcript levels compared to the PBS control (Figure 3.12B). Similar results were obtained with PSA mRNA transcript levels (Figure 3.12C). DUPA-LNP AR-siRNA treated group showed a significant decrease in PSA mRNA compared to mice treated with non-targeted LNP AR-siRNA (p < 0.01).  106  A)  C)  B)  Figure 3.12 Systemic administration of DUPA-LNP AR-siRNA lowers serum PSA levels and enhances AR gene silencing Mice were i.v. injected with 5 mg/kg of DUPA-LNP AR-siRNA or non-targeted LNP ARsiRNA or a PBS control. A) Percentages of serum PSA levels are relative to PSA levels at 1 day before treatment. Serum PSA levels were measured at Days 7 and 14 as described in Materials and methods. B) Quantitative real-time PCR was used to assess AR and C) PSA mRNA levels from all tumor tissues at Day 14 as described in Materials and methods. Data points are the mean of one representative experiment (n = 6-7) ± SD. **p < 0.01.  107  3.3.9  Intravenous administration of DUPA-LNP AR-siRNA reduces cellular  proliferation but does not enhance apoptosis A remaining question is whether DUPA-LNP AR-siRNA can cause a regression in tumor volume. Tumor regression has never been observed in the LNCaP xenograft model even with complete androgen ablation via castration, in conjunction with an inducible endogenous AR short-hairpin RNA (shRNA) (Cheng et al., 2006; Lee et al., 2012). Cellular proliferation within the tumor can be examined via immunohistochemical staining of Ki67. Ki67 is a marker that is detected during all phases of the cell cycle but is not present in quiescent cells (Scholzen and Gerdes, 2000). At Day 14, LNCaP tumors were sectioned and analyzed for Ki67 content (Figure 3.13A-B). There was an approximate 50% decrease in Ki67 positive cells suggesting that DUPA-LNP AR-siRNA caused a significant decrease in cellular proliferation (Figure 3.13A-B). The cell marker TUNEL was also used to detect any presence of apoptotic cells in LNCaP tumors. Upon quantification, it was observed that there was no significant apoptotic effect (Figure 3.13C-D). The lack of apoptotic cells may be due to the short duration of the study (14 days) with lack of repeat injections.  108  A)  B)  C)  D)  Figure 3.13 Systemic administration of DUPA-LNP AR-siRNA decreases cellular proliferation but does not induce apoptosis in tumor cells Mice were i.v. injected with 5 mg/kg of DUPA-LNP AR-siRNA or non-targeted LNP ARsiRNA or a PBS control. A) Representative images of Ki67 (cell proliferation marker) stained samples isolated from the same tumor tissues examined in Figure 3.12. B) Quantification of Ki67 stained tumor sections plotted as the mean ± SD. (n = 6). **p < 0.01 C) Representative images of TUNEL (cell apoptosis marker) stained samples isolated from the same tumor tissues examined in Figure 3.12. D) Quantification of TUNEL stained tumor sections plotted as the mean ± SD. (n = 6). No significance observed for TUNEL stained tumor sections.  109  3.4  Discussion The results of this study show that significant improvements in the in vivo gene silencing  potency of LNP AR-siRNA systems can be achieved by using long-circulating LNP AR-siRNA systems to achieve improved tumor accumulation in combination with the DUPA targeting ligand. There are two main items of interest for discussion, namely the improvements of the DUPA targeted LNP-siRNA formulation described here as compared to previous work and the extent to which further improvements can be made. In previous work we described the ability of non-targeted LNP AR-siRNA systems containing the cationic lipid DLin-KC2-DMA, AR25-siRNA and a PEG-lipid (PEG-C-DOMG) that could rapidly dissociate from the LNP following i.v. injection. Here we describe a DUPAtargeted LNP-siRNA system that contains an improved cationic lipid (DMAP-BLP), an improved siRNA (AR21-siRNA) and PEG-DSG, a PEG-lipid that does not readily dissociate from LNP systems and thus facilitates the longer circulation lifetimes required to access distal tumor sites. With regard to the improvements due to the cationic lipid DMAP-BLP and the siRNA AR21-siRNA, the improvements are trends and do not reach significance from a statistical point of view. Similarly, while the inclusion of 5 mol% PEG-DSG clearly results in increased delivery of LNP to the tumor site there is little evidence to suggest increased potency as compared to systems containing 2.5 mol% PEG-C-DOMG (Lee et al., 2012). Specifically, at a dose level of 10 mg siRNA/kg body weight (6 doses) Lee et al. reported serum PSA levels for PEG-C-DOMG systems at day 14 that were slightly below levels on day 0 whereas for doses of 5 mg siRNA/kg body weight for the LNP systems containing PEG-DSG slightly higher serum PSA levels are present at day 14 despite improved siRNA and cationic lipid components as well as improved delivery (Figure 3.12A). This illustrates the dilemma associated with the use of 110  long-lived PEG coatings that extend circulation lifetimes as the PEG coat also inhibits interactions with surrounding cells, inhibiting uptake. Thus while only a very small proportion of the LNP with a PEG-C-DOMG coating may arrive at the tumor site, those LNP systems may be taken up into target cells more efficiently than systems retaining a PEG-DSG coating. The benefits of incorporation of the DUPA targeting ligand are, however, substantial. Using the 5 mg siRNA/kg dosing regimen, significant reductions in AR and PSA mRNA as compared to non-targeted LNP systems are observed (see Figure 3.12), furthermore the reduction in serum PSA levels at day 14 were comparable to or superior to those observed at 10 mg siRNA/kg dose levels (six doses) for non-targeted systems containing PEG-C-DOMG (Lee et al., 2012) indicating the DUPA targeted formulation is a least a factor of two more potent than previously achieved for silencing the AR gene in distal tumors. Thus the results presented here provide the first clear validation that DUPA tethered to a PEG-lipid anchor can provide benefits for LNP targeting in vivo, which, in the case of an AR-siRNA payload, can result in enhanced gene silencing of the target gene. As indicated, there are many advantages to a small molecule targeting ligand as compared to larger entities such as antibodies, most notably the ability to formulate into LNP at the time of manufacture rather than after the LNP is formed. An interesting feature of the results presented is that the highly negatively charged DUPA appears to formulate well into LNP containing cationic lipid, resulting in an orientation towards the external medium. A potential difficulty during formulation would be that the DUPA interacts with cationic lipid during formulation, resulting in entrapment of the targeting ligand in the LNP interior. That this does not happen may be related to the pKa values of the DUPA carboxyl groups (3.11, 3.69 and 3.99) (Figure 3.10), which indicates that at pH 4 DUPA is  111  partially protonated and exhibits reduced negative charge. It is also possible that the PEG tether mitigates against an internal location of the DUPA-PEG-DSG due to steric effects. The next area of discussion concerns how the LNP-siRNA systems can be further improved. An increase in potency of at least a factor of five is required before clinical utility could be realized. There are a number of potential avenues to explore. Clearly the use of a targeting ligand such as DUPA brings improvements and it may be that higher levels of external DUPA or extending the DUPA targeting moieties beyond the PEG shield may bring improvements (Kawano and Maitani, 2011). It has been shown that by extending the targeting ligand beyond a PEG2000 shield by using a PEG5000 tether can result in a 160-fold improvement in targeting capability (measured by in vitro cellular uptake). In addition, the identification of new targeting ligands to cell surface factors such as the prostate stem cell antigen (PSCA) (Reiter et al., 1998) may prove useful. It is possible that further improvements in the potency of the ionizable cationic lipid can be made, however the considerable efforts made to this stage suggest that improvements will not be easily achieved (Jayaraman et al., 2012; Semple et al., 2010). It is possible that improved potencies can also be achieved by changing the size of the LNP-siRNA systems, as noted elsewhere nanoparticulate systems smaller than 50 nm exhibit significantly improved delivery to tumor sites by virtue of their ability to achieve improved tumor penetration (Cabral et al., 2011). As noted elsewhere (Belliveau et al., 2012), the microfluidic mixing technique does offer the possibility of manufacturing LNP with sizes as small as 20 nm diameter. The type of PEG-lipid employed is clearly critical, ideally the PEG-lipid would remain associated with the LNP until arrival at the tumor site, after which it would dissociate either before or, for actively targeted systems such as those containing DUPA PEG lipid, possibly after 112  uptake into target cells. In regard to the latter point, a factor that has not been determined is whether PEG-lipid that remains associated with LNP-siRNA systems following uptake mitigates against the endosomolytic properties of the cationic lipid associated with the LNP. In summary, the results of this investigation show that substantial improvements in the gene silencing potency of LNP AR-siRNA systems can be achieved by incorporation of the DUPAPEG-DSG targeting moiety in long-circulating LNP systems, resulting in systems that are at least a factor of two more potent than non-targeted systems containing a PEG-lipid that easily dissociates from the LNP surface. However the dose level of 5 mg siRNA/kg body weight to achieve reduced AR and PSA expression is still too high from the point of view of cost and toxicity concerns, thus further optimization of LNP components will be required before clinical development would be warranted.  113  Chapter 4: Summarizing Discussion and Future Directions The aim of the studies described in this thesis was to develop an LNP-siRNA formulation to silence the AR in prostate cancers following i.v. administration that could have potential clinical utility. This is an ambitious undertaking. The AR is perhaps the most validated therapeutic target for treatment of both primary prostate cancer and androgen independent prostate cancer as both forms usually require AR activation. However the challenges of enabling AR-siRNA to silence the AR in the prostate and disseminated tumor sites are considerable, as the siRNA not only has to be delivered to the tumor tissue but also must be delivered into the cytoplasm of target cells. In order to achieve this I have built on previous work showing that excellent gene silencing can be achieved in hepatocytes following i.v. injection of LNP-siRNA systems and that good tumor accumulation can be achieved for long-circulating LNP systems. Specifically, this previous work has shown that LNP systems with a PEG-lipid coating that rapidly dissociates following i.v. injection and that contains optimized ionizable cationic lipids can exhibit gene silencing in hepatocytes at doses as low as 0.005 mg siRNA/kg body weight. These LNP formulations depend on association with ApoE following administration, where the ApoE facilitates uptake into hepatocytes via ApoE receptors on the surface. The cationic lipid plays a role of destabilizing the endosomal membrane following uptake, resulting in release of the siRNA into the cytoplasm. The previous work on developing LNP-siRNA systems for silencing genes in hepatocytes indicates that to achieve gene silencing in distal prostate tumors three factors must be optimized. First, the LNP must actually get to the target tissue. Second, a targeting agent may be important to enhance LNP uptake into target tissue. Third, an optimized cationic lipid can greatly enhance gene silencing potency by facilitating endosomal escape following uptake. In Chapter 2 of this 114  thesis I attempted to solve these issues using the LNP AR-siRNA formulation optimized for delivery to the liver but where much higher doses were used than required for hepatocyte gene silencing. As noted elsewhere, these LNP systems are relatively non-toxic (Semple et al., 2010), allowing high dose levels of 10 mg siRNA/kg body weight to be administered to mice without undue toxic side effects. As has also been well-documented elsewhere (Abra et al., 1980; Kao and Juliano, 1981), high doses of LNP result in longer circulation lifetimes and correspondingly improved delivery to tumor sites due to “saturation of the reticuloendothelial system” (Kao and Juliano, 1981) and resulting slower rates of LNP removal from the circulation. The results obtained give proof-of-principle that i.v. administered LNP-siRNA systems can silence the AR gene and give rise to reduced PSA levels and that the optimized cationic lipids identified for hepatocyte gene silencing are also the best for AR gene silencing. However the doses required are too high for clinical utility. In Chapter 3, I have attempted to improve the potency of the LNP AR-siRNA systems by incorporating targeting information in the form of a DUPA-PEG-lipid into a long-circulating LNP containing PEG-DSG that gives improved delivery to distal tumors. It is shown that incorporation of 1 mol% DUPA-PEG-lipid into long-circulating LNP results in potent AR and PSA gene silencing at half the dose required for the short circulating LNP containing PEG-CDOMG. While this result is encouraging, at least a five-fold further improvement is required for the LNP AR-siRNA systems to have therapeutic potential. As discussed in Chapter 3 there are a number of ways in which the potency of the long circulating LNP AR-siRNA systems could be improved. These include improved targeting ligands, improved exposure of ligands such as the DUPA ligand, improved cationic lipids, smaller size and so on. However a fundamental problem with the development of improved LNP 115  AR-siRNA systems is the LNCaP tumor model employed, which effectively limits the number of experiments that can be performed to three or four per year. This is mainly attributed to the slow growth rate of LNCaP tumors, which can take up to 8-10 weeks to obtain pre-treatment serum PSA levels of 50-75 ng/ml. This can be contrasted to the FVII model used to optimize LNPsiRNA systems for gene silencing in the liver (Jayaraman et al., 2012; Semple et al., 2010), which allows two animal studies per week. Thus efforts to develop in vitro models, which will be predictive of in vivo behavior would be very useful. In this regard the results of Chapter 3 indicate that long circulating systems containing PEG-DSG and DUPA-PEG-DSG exhibit optimized distribution to tumor tissue. In vitro experiments optimizing these systems to silence the AR gene in LNCaP cells may be useful in this regard, and could be used to screen the influence of varying cationic lipid composition on potency, for example. Other methods of improving potency could include inclusion of small molecule drugs. For example, co-encapsulation into the LNP of chloroquine would be an interesting possibility, as it is a lysosomotropic agent that results in the swelling of endosomes causing endosomal destabilization (Khalil et al., 2006), resulting in an enhancement of siRNA release. Inclusion of other agents that act to disrupt the endosomal processing may also be interesting to pursue, such as monensin, bafilomycin A and nigricin (Khalil et al., 2006). Alternatively certain anticancer or other drugs may act in synergy with AR-siRNAs to enhance cytotoxic effects. A screen to identify such agents that can then be co-encapsulated into the LNP systems would be of considerable interest. There are some more general issues that require improvement. For example, a limitation of these studies is that the LNP AR-siRNA systems utilized here are not necessarily applicable to all patients suffering from prostate cancer. As discussed in Section 1.4.1, some prostate cancers 116  arise due to a constitutively active truncated AR lacking the LBD. As well, many NTD splice variants are known to exist. The current AR-siRNA sequence used in these studies only targets the LBD. Thus efforts should be made to incorporate additional AR-siRNA sequences targeted against the NTD as well as the LBD. An optimized LNP AR-siRNA system may contain siRNAs targeting both the NTD and LBD to treat a wider range of prostate cancer patients. The LNP AR-siRNA examined in vivo was only used in a single LNCaP xenograft model. While LNP AR-siRNA proved effective in this in vivo model, the LNP AR-siRNA should be tested in other prostate cancer models such as LAPC-4, C4-2, or the CWR22Rv1 model. LNP AR-siRNA could also be useful in a cancer cell model derived from patients who are resistant to potent anti-androgens such as MDV3100 such as the MR49F xenograft model (Kuruma et al., 2013). Toxicity issues were not addressed directly in the studies presented in this thesis. Through visual inspection, there were no major changes in body weight, or visible distress in mice treated with LNP AR-siRNA or DUPA-LNP AR-siRNA, however more detailed toxicological analyses will be required when a formulation with clinical potential has been achieved. Immunotoxic effects have been well-documented following i.v. administration of LNP-siRNA including induction of proinflammatory cytokines causing organ impairment of the liver, spleen and kidneys, in addition to thrombocytopenia and coagulopathy (Tao et al., 2011). Thus, future toxicological studies involving LNP AR-siRNA will need to assess serum levels of liver aminotransferase enzymes (AST/ALT), platelet counts, and levels of proinflammatory cytokines including interferon γ, interleukin-6, tumor necrosis factor-α and monocyte chemotactic protein-1 (Tao et al., 2011). If toxicity is apparent following systemic administration of LNP AR-siRNA, pretreatment with a Janus kinase (Jak) inhibitor or 117  dexamethasone may be necessary, as these compounds have been shown to abrogate LNPsiRNA related toxicities (Tao et al., 2011). Overall, the results presented in this thesis are the first step towards developing an effective siRNA-based therapeutic to treat prostate cancer. Given the flexibility of the LNP platform the results presented suggest that such a therapeutic should be possible in the near future.  118  Bibliography Abdelbaqi, K., Lack, N., Guns, E. T., Kotha, L., Safe, S., and Sanderson, J. T., 2011. Antiandrogenic and growth inhibitory effects of ring-substituted analogs of 3,3'diindolylmethane (ring-DIMs) in hormone-responsive LNCaP human prostate cancer cells. The Prostate 71, 1401-1412. Abra, R. M., Bosworth, M. E., and Hunt, C. A., 1980. Liposome disposition in vivo: effects of pre-dosing with liposomes. Res. Commun. Chem. Pathol. Pharmacol. 29, 349-360. Akinc, A., Querbes, W., De, S., Qin, J., Frank-Kamenetsky, M., Jayaprakash, K. N., Jayaraman, M., Rajeev, K. G., Cantley, W. L., Dorkin, J. R., Butler, J. S., Qin, L., Racie, T., Sprague, A., Fava, E., Zeigerer, A., Hope, M. J., Zerial, M., Sah, D. W., Fitzgerald, K., Tracy, M. A., Manoharan, M., Koteliansky, V., Fougerolles, A., and Maier, M. A., 2010. Targeted delivery of RNAi therapeutics with endogenous and exogenous ligand-based mechanisms. Molecular therapy : the journal of the American Society of Gene Therapy 18, 1357-1364. Allen, T. M., and Cullis, P. R., 2004. Drug delivery systems: entering the mainstream. Science 303, 1818-1822. Allen, T. M., and Cullis, P. R., 2013. Liposomal drug delivery systems: from concept to clinical applications. Advanced Drug Delivery Reviews 65, 36-48. Ambegia, E., Ansell, S., Cullis, P., Heyes, J., Palmer, L., and MacLachlan, I., 2005. Stabilized plasmid-lipid particles containing PEG-diacylglycerols exhibit extended circulation lifetimes and tumor selective gene expression. Biochim.Biophys.Acta 1669, 155-163. Ambros, V., 2001. microRNAs: tiny regulators with great potential. Cell 107, 823-826. Anderson, E. M., Birmingham, A., Baskerville, S., Reynolds, A., Maksimova, E., Leake, D., Fedorov, Y., Karpilow, J., and Khvorova, A., 2008. Experimental validation of the importance of seed complement frequency to siRNA specificity. RNA 14, 853-861. Ayala, A. G., and Ro, J. Y., 2007. Prostatic intraepithelial neoplasia: recent advances. Archives of pathology & laboratory medicine 131, 1257-1266. Baker, S. J., 2007. PTEN enters the nuclear age. Cell 128, 25-28. Bandyopadhyay, S., Pai, S. K., Watabe, M., Gross, S. C., Hirota, S., Hosobe, S., Tsukada, T., Miura, K., Saito, K., Markwell, S. J., Wang, Y., Huggenvik, J., Pauza, M. E., Iiizumi, M., and Watabe, K., 2005. FAS expression inversely correlates with PTEN level in prostate cancer and a PI 3-kinase inhibitor synergizes with FAS siRNA to induce apoptosis. Oncogene 24, 5389-5395. Banerjee, R., Tyagi, P., Li, S., and Huang, L., 2004. Anisamide-targeted stealth liposomes: a potent carrier for targeting doxorubicin to human prostate cancer cells. Int J Cancer 112, 693-700. 119  Bangham, A. D., Standish, M. M., and Watkins, J. C., 1965. Diffusion of univalent ions across the lamellae of swollen phospholipids. Journal of molecular biology 13, 238-252. Banting, F. G., Best, C. H., Collip, J. B., Campbell, W. R., and Fletcher, A. A., 1922. Pancreatic Extracts in the Treatment of Diabetes Mellitus. Canadian Medical Association journal 12, 141-146. Bartel, D. P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297. Behlke, M. A., 2008. Chemical modification of siRNAs for in vivo use. Oligonucleotides 18, 305-319. Behrens, O. K., and Bromer, W. W., 1958. Glucagon. Vitamins and hormones 16, 263301. Belliveau, N. M., Huft, J., Lin, P. J., Chen, S., Leung, A. K., Leaver, T. J., Wild, A. W., Lee, J. B., Taylor, R. J., Tam, Y. K., Hansen, C. L., and Cullis, P. R., 2012. Microfluidic Synthesis of Highly Potent Limit-size Lipid Nanoparticles for In Vivo Delivery of siRNA. Moleculary Therapy Nucleic Acids 1, 1-9. Bonci, D., Coppola, V., Musumeci, M., Addario, A., Giuffrida, R., Memeo, L., D'Urso, L., Pagliuca, A., Biffoni, M., Labbaye, C., Bartucci, M., Muto, G., Peschle, C., and De Maria, R., 2008. The miR-15a-miR-16-1 cluster controls prostate cancer by targeting multiple oncogenic activities. Nature medicine 14, 1271-1277. Bostwick, D. G., 2000. Prostatic intraepithelial neoplasia. Current urology reports 1, 6570. Brusselmans, K., De Schrijver, E., Verhoeven, G., and Swinnen, J. V., 2005. RNA interference-mediated silencing of the acetyl-CoA-carboxylase-alpha gene induces growth inhibition and apoptosis of prostate cancer cells. Cancer research 65, 6719-6725. Buchanan, G., Greenberg, N. M., Scher, H. I., Harris, J. M., Marshall, V. R., and Tilley, W. D., 2001. Collocation of androgen receptor gene mutations in prostate cancer. Clinical cancer research : an official journal of the American Association for Cancer Research 7, 1273-1281. Cabral, H., Matsumoto, Y., Mizuno, K., Chen, Q., Murakami, M., Kimura, M., Terada, Y., Kano, M. R., Miyazono, K., Uesaka, M., Nishiyama, N., and Kataoka, K., 2011. Accumulation of sub-100 nm polymeric micelles in poorly permeable tumours depends on size. Nature nanotechnology 6, 815-823. Carthew, R. W., and Sontheimer, E. J., 2009. Origins and Mechanisms of miRNAs and siRNAs. Cell 136, 642-655.  120  Centenera, M. M., Harris, J. M., Tilley, W. D., and Butler, L. M., 2008. The contribution of different androgen receptor domains to receptor dimerization and signaling. Molecular endocrinology 22, 2373-2382. Chan, S. C., Li, Y., and Dehm, S. M., 2012. Androgen receptor splice variants activate androgen receptor target genes and support aberrant prostate cancer cell growth independent of canonical androgen receptor nuclear localization signal. The Journal of Biological Chemistry 287, 19736-19749. Chang, B. L., Zheng, S. L., Isaacs, S. D., Wiley, K. E., Turner, A., Li, G., Walsh, P. C., Meyers, D. A., Isaacs, W. B., and Xu, J., 2004. A polymorphism in the CDKN1B gene is associated with increased risk of hereditary prostate cancer. Cancer Research 64, 1997-1999. Chang, C., Saltzman, A., Yeh, S., Young, W., Keller, E., Lee, H. J., Wang, C., and Mizokami, A., 1995. Androgen receptor: an overview. Critical reviews in eukaryotic gene expression 5, 97-125. Chen, C. D., Welsbie, D. S., Tran, C., Baek, S. H., Chen, R., Vessella, R., Rosenfeld, M. G., and Sawyers, C. L., 2004. Molecular determinants of resistance to antiandrogen therapy. Nature medicine 10, 33-39. Chen, S., Leung, A. K., Lin, P. J., Tam, Y. K., Tam, Y. Y., and Cullis, P. R., 2013. Influence of size and polyethylene glycol (PEG)-lipids on efficacy of lipid nanoparticle formulations of siRNA by intravenous administration. Unpublished. Chen, T. S., Lai, R. C., Lee, M. M., Choo, A. B., Lee, C. N., and Lim, S. K., 2010. Mesenchymal stem cell secretes microparticles enriched in pre-microRNAs. Nucleic Acids Research 38, 215-224. Cheng, H., Snoek, R., Ghaidi, F., Cox, M. E., and Rennie, P. S., 2006. Short hairpin RNA knockdown of the androgen receptor attenuates ligand-independent activation and delays tumor progression. Cancer research 66, 10613-10620. Chikh, G., de Jong, S. D., Sekirov, L., Raney, S. G., Kazem, M., Wilson, K. D., Cullis, P. R., Dutz, J. P., and Tam, Y. K., 2009. Synthetic methylated CpG ODNs are potent in vivo adjuvants when delivered in liposomal nanoparticles. International immunology 21, 757-767. Chmelar, R., Buchanan, G., Need, E. F., Tilley, W., and Greenberg, N. M., 2007. Androgen receptor coregulators and their involvement in the development and progression of prostate cancer. International journal of cancer. Journal international du cancer 120, 719-733. Chonn, A., Semple, S. C., and Cullis, P. R., 1991. Separation of large unilamellar liposomes from blood components by a spin column procedure: towards identifying plasma proteins which mediate liposome clearance in vivo. Biochimica et biophysica acta 1070, 215222. 121  Chonn, A., Semple, S. C., and Cullis, P. R., 1992. Association of blood proteins with large unilamellar liposomes in vivo. Relation to circulation lifetimes. J.Biol.Chem. 267, 1875918765. Chono, S., Li, S. D., Conwell, C. C., and Huang, L., 2008. An efficient and low immunostimulatory nanoparticle formulation for systemic siRNA delivery to the tumor. Journal of controlled release : official journal of the Controlled Release Society 131, 64-69. Clinckemalie, L., Vanderschueren, D., Boonen, S., and Claessens, F., 2012. The hinge region in androgen receptor control. Molecular and cellular endocrinology 358, 1-8. Compagno, D., Merle, C., Morin, A., Gilbert, C., Mathieu, J. R., Bozec, A., Mauduit, C., Benahmed, M., and Cabon, F., 2007. SIRNA-directed in vivo silencing of androgen receptor inhibits the growth of castration-resistant prostate carcinomas. PloS one 2, e1006. Crawford, E. D., and Hou, A. H., 2009. The role of LHRH antagonists in the treatment of prostate cancer. Oncology 23, 626-630. Culig, Z., Hobisch, A., Cronauer, M. V., Radmayr, C., Trapman, J., Hittmair, A., Bartsch, G., and Klocker, H., 1994. Androgen receptor activation in prostatic tumor cell lines by insulinlike growth factor-I, keratinocyte growth factor, and epidermal growth factor. Cancer research 54, 5474-5478. Culig, Z., Klocker, H., Bartsch, G., and Hobisch, A., 2002. Androgen receptors in prostate cancer. Endocrine-related cancer 9, 155-170. Cullis, P. R., Chonn, A., and Semple, S. C., 1998. Interactions of liposomes and lipidbased carrier systems with blood proteins: Relation to clearance behaviour in vivo. Advanced Drug Delivery Reviews 32, 3-17. Cullis, P. R., and de Kruijff, B., 1979. Lipid polymorphism and the functional roles of lipids in biological membranes. Biochimica et biophysica acta 559, 399-420. Czauderna, F., Fechtner, M., Dames, S., Aygun, H., Klippel, A., Pronk, G. J., Giese, K., and Kaufmann, J., 2003. Structural variations and stabilising modifications of synthetic siRNAs in mammalian cells. Nucleic acids research 31, 2705-2716. Davies, P., Watt, K., Kelly, S. M., Clark, C., Price, N. C., and McEwan, I. J., 2008. Consequences of poly-glutamine repeat length for the conformation and folding of the androgen receptor amino-terminal domain. Journal of molecular endocrinology 41, 301-314. de Jong, S., Chikh, G., Sekirov, L., Raney, S., Semple, S., Klimuk, S., Yuan, N., Hope, M., Cullis, P., and Tam, Y., 2007. Encapsulation in liposomal nanoparticles enhances the immunostimulatory, adjuvant and anti-tumor activity of subcutaneously administered CpG ODN. Cancer immunology, immunotherapy : CII 56, 1251-1264. 122  de Kruijff, B., Cullis, P. R., and Radda, G. K., 1975. Differential scanning calorimetry and 31P NMR studies on sonicated and unsonicated phosphatidylcholine liposomes. Biochimica et biophysica acta 406, 6-20. De Schrijver, E., Brusselmans, K., Heyns, W., Verhoeven, G., and Swinnen, J. V., 2003. RNA interference-mediated silencing of the fatty acid synthase gene attenuates growth and induces morphological changes and apoptosis of LNCaP prostate cancer cells. Cancer research 63, 3799-3804. DeVere White, R. W., Vinall, R. L., Tepper, C. G., and Shi, X. B., 2009. MicroRNAs and their potential for translation in prostate cancer. Urologic oncology 27, 307-311. Di Paolo, D., Ambrogio, C., Pastorino, F., Brignole, C., Martinengo, C., Carosio, R., Loi, M., Pagnan, G., Emionite, L., Cilli, M., Ribatti, D., Allen, T. M., Chiarle, R., Ponzoni, M., and Perri, P., 2011. Selective therapeutic targeting of the anaplastic lymphoma kinase with liposomal siRNA induces apoptosis and inhibits angiogenesis in neuroblastoma. Molecular therapy : the journal of the American Society of Gene Therapy 19, 2201-2212. Di Paolo, D., Brignole, C., Pastorino, F., Carosio, R., Zorzoli, A., Rossi, M., Loi, M., Pagnan, G., Emionite, L., Cilli, M., Bruno, S., Chiarle, R., Allen, T. M., Ponzoni, M., and Perri, P., 2011. Neuroblastoma-targeted nanoparticles entrapping siRNA specifically knockdown ALK. Molecular therapy : the journal of the American Society of Gene Therapy 19, 1131-1140. Dong, J. T., 2006. Prevalent mutations in prostate cancer. Journal of cellular biochemistry 97, 433-447. Droz, J. P., Flechon, A., and Terret, C., 2002. Prostate cancer: management of advanced disease. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO 13 Suppl 4, 89-94. Dykxhoorn, D. M., Palliser, D., and Lieberman, J., 2006. The silent treatment: siRNAs as small molecule drugs. Gene therapy 13, 541-552. Eberle, F., Giessler, K., Deck, C., Heeg, K., Peter, M., Richert, C., and Dalpke, A. H., 2008. Modifications in small interfering RNA that separate immunostimulation from RNA interference. Journal of immunology 180, 3229-3237. Eder, I. E., Culig, Z., Ramoner, R., Thurnher, M., Putz, T., Nessler-Menardi, C., Tiefenthaler, M., Bartsch, G., and Klocker, H., 2000. Inhibition of LncaP prostate cancer cells by means of androgen receptor antisense oligonucleotides. Cancer gene therapy 7, 997-1007. Eder, I. E., Hoffmann, J., Rogatsch, H., Schafer, G., Zopf, D., Bartsch, G., and Klocker, H., 2002. Inhibition of LNCaP prostate tumor growth in vivo by an antisense oligonucleotide directed against the human androgen receptor. Cancer gene therapy 9, 117-125. Edwards, S. M., Kote-Jarai, Z., Meitz, J., Hamoudi, R., Hope, Q., Osin, P., Jackson, R., Southgate, C., Singh, R., Falconer, A., Dearnaley, D. P., Ardern-Jones, A., Murkin, A., Dowe, 123  A., Kelly, J., Williams, S., Oram, R., Stevens, M., Teare, D. M., Ponder, B. A., Gayther, S. A., Easton, D. F., and Eeles, R. A., 2003. Two percent of men with early-onset prostate cancer harbor germline mutations in the BRCA2 gene. American journal of human genetics 72, 1-12. Elbashir, S. M., Martinez, J., Patkaniowska, A., Lendeckel, W., and Tuschl, T., 2001. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. The EMBO journal 20, 6877-6888. English, H. F., Santen, R. J., and Isaacs, J. T., 1987. Response of glandular versus basal rat ventral prostatic epithelial cells to androgen withdrawal and replacement. The Prostate 11, 229-242. Episkopou, V., Maeda, S., Nishiguchi, S., Shimada, K., Gaitanaris, G. A., Gottesman, M. E., and Robertson, E. J., 1993. Disruption of the transthyretin gene results in mice with depressed levels of plasma retinol and thyroid hormone. Proceedings of the National Academy of Sciences of the United States of America 90, 2375-2379. Fassas, A., and Anagnostopoulos, A., 2005. The use of liposomal daunorubicin (DaunoXome) in acute myeloid leukemia. Leukemia & lymphoma 46, 795-802. Feldman, B. J., and Feldman, D., 2001. The development of androgen-independent prostate cancer. Nature reviews. Cancer 1, 34-45. Fenske, D. B., Chonn, A., and Cullis, P. R., 2008. Liposomal nanomedicines: an emerging field. Toxicol.Pathol. 36, 21-29. Fenske, D. B., and Cullis, P. R., 2008. Liposomal nanomedicines. Expert opinion on drug delivery 5, 25-44. Filipowicz, W., Bhattacharyya, S. N., and Sonenberg, N., 2008. Mechanisms of posttranscriptional regulation by microRNAs: are the answers in sight? Nature reviews. Genetics 9, 102-114. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C., 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-811. Furr, B. J., 1989. "Casodex" (ICI 176,334)--a new, pure, peripherally-selective antiandrogen: preclinical studies. Hormone research 32 Suppl 1, 69-76. Geller, J., Vazakas, G., Fruchtman, B., Newman, H., Nakao, K., and Loh, A., 1968. The effect of cyproterone acetate on advanced carcinoma of the prostate. Surgery, gynecology & obstetrics 127, 748-758. Gelmann, E. P., 2002. Molecular biology of the androgen receptor. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 20, 3001-3015. 124  Ghosh, A., and Heston, W. D., 2004. Tumor target prostate specific membrane antigen (PSMA) and its regulation in prostate cancer. Journal of cellular biochemistry 91, 528-539. Gleave, M., Tolcher, A., Miyake, H., Nelson, C., Brown, B., Beraldi, E., and Goldie, J., 1999. Progression to androgen independence is delayed by adjuvant treatment with antisense Bcl-2 oligodeoxynucleotides after castration in the LNCaP prostate tumor model. Clinical cancer research : an official journal of the American Association for Cancer Research 5, 2891-2898. Gregoriadis, G., and Ryman, B. E., 1971. Liposomes as carriers of enzymes or drugs: a new approach to the treatment of storage diseases. The Biochemical journal 124, 58P. Gregory, C. W., Johnson, R. T., Jr., Mohler, J. L., French, F. S., and Wilson, E. M., 2001. Androgen receptor stabilization in recurrent prostate cancer is associated with hypersensitivity to low androgen. Cancer research 61, 2892-2898. Gregory, R. I., Chendrimada, T. P., and Shiekhattar, R., 2006. MicroRNA biogenesis: isolation and characterization of the microprocessor complex. Methods in molecular biology 342, 33-47. Grignon, D. J., Caplan, R., Sarkar, F. H., Lawton, C. A., Hammond, E. H., Pilepich, M. V., Forman, J. D., Mesic, J., Fu, K. K., Abrams, R. A., Pajak, T. F., Shipley, W. U., and Cox, J. D., 1997. p53 status and prognosis of locally advanced prostatic adenocarcinoma: a study based on RTOG 8610. Journal of the National Cancer Institute 89, 158-165. Guo, H., Ingolia, N. T., Weissman, J. S., and Bartel, D. P., 2010. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466, 835-840. Gutman, E. B., Sproul, E. E., Gutman, A. B., 1936. Significance of increased phosphatase activity of bone at the site of osteoplastic metastases secondary to carcinoma of the prostate gland. Am J Cancer 28, 485-495. Haelens, A., Tanner, T., Denayer, S., Callewaert, L., and Claessens, F., 2007. The hinge region regulates DNA binding, nuclear translocation, and transactivation of the androgen receptor. Cancer research 67, 4514-4523. Hafez, I. M., Maurer, N., and Cullis, P. R., 2001. On the mechanism whereby cationic lipids promote intracellular delivery of polynucleic acids. Gene therapy 8, 1188-1196. Haile, S., and Sadar, M. D., 2011. Androgen receptor and its splice variants in prostate cancer. Cellular and molecular life sciences : CMLS 68, 3971-3981. Hashizume, H., Baluk, P., Morikawa, S., McLean, J. W., Thurston, G., Roberge, S., Jain, R. K., and McDonald, D. M., 2000. Openings between defective endothelial cells explain tumor vessel leakiness. The American journal of pathology 156, 1363-1380.  125  Haupenthal, J., Baehr, C., Zeuzem, S., and Piiper, A., 2007. RNAse A-like enzymes in serum inhibit the anti-neoplastic activity of siRNA targeting polo-like kinase 1. International journal of cancer. Journal international du cancer 121, 206-210. He, B., Kemppainen, J. A., Voegel, J. J., Gronemeyer, H., and Wilson, E. M., 1999. Activation function 2 in the human androgen receptor ligand binding domain mediates interdomain communication with the NH(2)-terminal domain. The Journal of Biological Chemistry 274, 37219-37225. He, L., and Hannon, G. J., 2004. MicroRNAs: small RNAs with a big role in gene regulation. Nature reviews. Genetics 5, 522-531. He, W., Kularatne, S. A., Kalli, K. R., Prendergast, F. G., Amato, R. J., Klee, G. G., Hartmann, L. C., and Low, P. S., 2008. Quantitation of circulating tumor cells in blood samples from ovarian and prostate cancer patients using tumor-specific fluorescent ligands. International journal of cancer. Journal international du cancer 123, 1968-1973. Heidel, J. D., Hu, S., Liu, X. F., Triche, T. J., and Davis, M. E., 2004. Lack of interferon response in animals to naked siRNAs. Nature biotechnology 22, 1579-1582. Higano, C. S., Small, E. J., Schellhammer, P., Yasothan, U., Gubernick, S., Kirkpatrick, P., and Kantoff, P. W., 2010. Sipuleucel-T. Nature reviews. Drug discovery 9, 513-514. Hope, M., 2013. Influence of Polyethylene Glycol Lipid Desorption Rates on Pharmacokinetics and Pharmacodynamics of siRNA Lipid Nanoparticles. Unpublished. Horoszewicz, J. S., Leong, S. S., Kawinski, E., Karr, J. P., Rosenthal, H., Chu, T. M., Mirand, E. A., and Murphy, G. P., 1983. LNCaP model of human prostatic carcinoma. Cancer research 43, 1809-1818. Hu, G., Drescher, K. M., and Chen, X. M., 2012. Exosomal miRNAs: Biological Properties and Therapeutic Potential. Frontiers in genetics 3, 56. Hu, H. Y., Yan, Z., Xu, Y., Hu, H., Menzel, C., Zhou, Y. H., Chen, W., and Khaitovich, P., 2009. Sequence features associated with microRNA strand selection in humans and flies. BMC genomics 10, 413. Hu, R., Dunn, T. A., Wei, S., Isharwal, S., Veltri, R. W., Humphreys, E., Han, M., Partin, A. W., Vessella, R. L., Isaacs, W. B., Bova, G. S., and Luo, J., 2009. Ligand-independent androgen receptor variants derived from splicing of cryptic exons signify hormone-refractory prostate cancer. Cancer research 69, 16-22. Huggins, C., and Hodges, C. V., 1941. Studies on prostatic cancer: I. The effect of castration, of estrogen and of androgen injection on serum phosphatases in metastatic carcinoma of the prostate. Journal of urology 168, 9-12. 126  Ing, N. H., Beekman, J. M., Tsai, S. Y., Tsai, M. J., and O'Malley, B. W., 1992. Members of the steroid hormone receptor superfamily interact with TFIIB (S300-II). The Journal of biological chemistry 267, 17617-17623. Isaacs, J. T., 1999. The biology of hormone refractory prostate cancer. Why does it develop? The Urologic clinics of North America 26, 263-273. Isaacs, W., and Kainu, T., 2001. Oncogenes and tumor suppressor genes in prostate cancer. Epidemiologic reviews 23, 36-41. Iversen, P., Tveter, K., and Varenhorst, E., 1996. Randomised study of Casodex 50 MG monotherapy vs orchidectomy in the treatment of metastatic prostate cancer. The Scandinavian Casodex Cooperative Group. Scandinavian journal of urology and nephrology 30, 93-98. Janas, M. M., Wang, E., Love, T., Harris, A. S., Stevenson, K., Semmelmann, K., Shaffer, J. M., Chen, P. H., Doench, J. G., Yerramilli, S. V., Neuberg, D. S., Iliopoulos, D., Housman, D. E., Burge, C. B., and Novina, C. D., 2012. Reduced expression of ribosomal proteins relieves microRNA-mediated repression. Molecular cell 46, 171-186. Jariwala, U., Prescott, J., Jia, L., Barski, A., Pregizer, S., Cogan, J. P., Arasheben, A., Tilley, W. D., Scher, H. I., Gerald, W. L., Buchanan, G., Coetzee, G. A., and Frenkel, B., 2007. Identification of novel androgen receptor target genes in prostate cancer. Molecular cancer 6, 39. Jayaraman, M., Ansell, S. M., Mui, B. L., Tam, Y. K., Chen, J., Du, X., Butler, D., Eltepu, L., Matsuda, S., Narayanannair, J. K., Rajeev, K. G., Hafez, I. M., Akinc, A., Maier, M. A., Tracy, M. A., Cullis, P. R., Madden, T. D., Manoharan, M., and Hope, M. J., 2012. Maximizing the potency of siRNA lipid nanoparticles for hepatic gene silencing in vivo. Angewandte Chemie 51, 8529-8533. Jeffs, L. B., Palmer, L. R., Ambegia, E. G., Giesbrecht, C., Ewanick, S., and MacLachlan, I., 2005. A scalable, extrusion-free method for efficient liposomal encapsulation of plasmid DNA. Pharm.Res. 22, 362-372. Jenster, G., Trapman, J., and Brinkmann, A. O., 1993. Nuclear import of the human androgen receptor. The Biochemical journal 293 ( Pt 3), 761-768. Johnson, D. E., Kaesler, K. E., and Ayala, A. G., 1975. Megestrol acetate for treatment of advanced carcinoma of the prostate. Journal of surgical oncology 7, 9-15. Judge, A. D., Bola, G., Lee, A. C., and MacLachlan, I., 2006. Design of noninflammatory synthetic siRNA mediating potent gene silencing in vivo. Molecular therapy : the journal of the American Society of Gene Therapy 13, 494-505. Judge, A. D., Robbins, M., Tavakoli, I., Levi, J., Hu, L., Fronda, A., Ambegia, E., McClintock, K., and MacLachlan, I., 2009. Confirming the RNAi-mediated mechanism of action of siRNA-based cancer therapeutics in mice. J.Clin.Invest. 127  Kaighn, M. E., Narayan, K. S., Ohnuki, Y., Lechner, J. F., and Jones, L. W., 1979. Establishment and characterization of a human prostatic carcinoma cell line (PC-3). Investigative urology 17, 16-23. Kaku, N., Matsuda, K., Tsujimura, A., and Kawata, M., 2008. Characterization of nuclear import of the domain-specific androgen receptor in association with the importin alpha/beta and Ran-guanosine 5'-triphosphate systems. Endocrinology 149, 3960-3969. Kao, Y. J., and Juliano, R. L., 1981. Interactions of liposomes with the reticuloendothelial system. Effects of reticuloendothelial blockade on the clearance of large unilamellar vesicles. Biochimica Et Biophysica Acta 677, 453-461. Kawano, K., and Maitani, Y., 2011. Effects of polyethylene glycol spacer length and ligand density on folate receptor targeting of liposomal Doxorubicin in vitro. Journal of drug delivery 2011, 160967. Kay, H. D., 1929. Plasma Phosphatase in Osteitis Deformans and in other Diseases of Bone. Br J Exp Pathol 10, 253-256. Kelsey, S. M., Goldman, J. M., McCann, S., Newland, A. C., Scarffe, J. H., Oppenheim, B. A., and Mufti, G. J., 1999. Liposomal amphotericin (AmBisome) in the prophylaxis of fungal infections in neutropenic patients: a randomised, double-blind, placebo-controlled study. Bone marrow transplantation 23, 163-168. Kent, E. C., and Hussain, M. H., 2003. The patient with hormone-refractory prostate cancer: determining who, when, and how to treat. Urology 62 Suppl 1, 134-140. Khalil, I. A., Kogure, K., Akita, H., and Harashima, H., 2006. Uptake pathways and subsequent intracellular trafficking in nonviral gene delivery. Pharmacological reviews 58, 3245. Kibel, A. S., Suarez, B. K., Belani, J., Oh, J., Webster, R., Brophy-Ebbers, M., Guo, C., Catalona, W. J., Picus, J., and Goodfellow, P. J., 2003. CDKN1A and CDKN1B polymorphisms and risk of advanced prostate carcinoma. Cancer Research 63, 2033-2036. Klein, K. A., Reiter, R. E., Redula, J., Moradi, H., Zhu, X. L., Brothman, A. R., Lamb, D. J., Marcelli, M., Belldegrun, A., Witte, O. N., and Sawyers, C. L., 1997. Progression of metastatic human prostate cancer to androgen independence in immunodeficient SCID mice. Nature medicine 3, 402-408. Knudsen, B. S., and Vasioukhin, V., 2010. Mechanisms of prostate cancer initiation and progression. Advances in cancer research 109, 1-50. Ko, Y. J., Devi, G. R., London, C. A., Kayas, A., Reddy, M. T., Iversen, P. L., Bubley, G. J., and Balk, S. P., 2004. Androgen receptor down-regulation in prostate cancer with phosphorodiamidate morpholino antisense oligomers. The Journal of urology 172, 1140-1144. 128  Kokontis, J., Takakura, K., Hay, N., and Liao, S., 1994. Increased androgen receptor activity and altered c-myc expression in prostate cancer cells after long-term androgen deprivation. Cancer research 54, 1566-1573. Kristal, A. R., Price, D. K., Till, C., Schenk, J. M., Neuhouser, M. L., Ockers, S., Lin, D. W., Thompson, I. M., and Figg, W. D., 2010. Androgen receptor CAG repeat length is not associated with the risk of incident symptomatic benign prostatic hyperplasia: results from the Prostate Cancer Prevention Trial. The Prostate 70, 584-590. Kularatne, S. A., Venkatesh, C., Santhapuram, H. K., Wang, K., Vaitilingam, B., Henne, W. A., and Low, P. S., 2010. Synthesis and biological analysis of prostate-specific membrane antigen-targeted anticancer prodrugs. Journal of Medicinal Chemistry 53, 7767-7777. Kularatne, S. A., Wang, K., Santhapuram, H. K., and Low, P. S., 2009. Prostate-specific membrane antigen targeted imaging and therapy of prostate cancer using a PSMA inhibitor as a homing ligand. Molecular pharmaceutics 6, 780-789. Kuruma, H., Matsumoto, H., Bishop, J. L., Lamoureux, F., Thomas, C., Briere, D., Los, G., Gleave, M., Fanjul, A., and Zoubeidi, A., 2013. A novel anti-androgen, Compound 30, suppresses castration-resistant and MDV3100-resistant prostate cancer growth in vitro and in vivo. Molecular cancer therapeutics Epub ahead of print. Labrie, F., Dupont, A., Belanger, A., St-Arnaud, R., Giguere, M., Lacourciere, Y., Emond, J., and Monfette, G., 1986. Treatment of prostate cancer with gonadotropin-releasing hormone agonists. Endocrine reviews 7, 67-74. Laginha, K. M., Verwoert, S., Charrois, G. J., and Allen, T. M., 2005. Determination of doxorubicin levels in whole tumor and tumor nuclei in murine breast cancer tumors. Clinical cancer research : an official journal of the American Association for Cancer Research 11, 69446949. Lane, D. P., 2005. Exploiting the p53 pathway for the diagnosis and therapy of human cancer. Cold Spring Harbor symposia on quantitative biology 70, 489-497. Lee, J. B., Zhang, K., Tam, Y. Y., Tam, Y. K., Belliveau, N. M., Sung, V. Y., Lin, P. J., LeBlanc, E., Ciufolini, M. A., Rennie, P. S., and Cullis, P. R., 2012. Lipid nanoparticle siRNA systems for silencing the androgen receptor in human prostate cancer in vivo. International journal of cancer. Journal international du cancer 131, E781-790. Lee, S. O., Lou, W., Qureshi, K. M., Mehraein-Ghomi, F., Trump, D. L., and Gao, A. C., 2004. RNA interference targeting Stat3 inhibits growth and induces apoptosis of human prostate cancer cells. The Prostate 60, 303-309. Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Radmark, O., Kim, S., and Kim, V. N., 2003. The nuclear RNase III Drosha initiates microRNA processing. Nature 425, 415-419. 129  Lehninger, A. L., Nelson, D. L., and Cox, M. M., 2005. Lehninger principles of biochemistry. W.H. Freeman, New York. Leung, A. K., Hafez, I. M., Baoukina, S., Belliveau, N. M., Zhigaltsev, I. V., Afshinmanesh, E., Tieleman, D. P., Hansen, C. L., Hope, M. J., and Cullis, P. R., 2012. Lipid Nanoparticles Containing siRNA Synthesized by Microfluidic Mixing Exhibit an Electron-Dense Nanostructured Core. The journal of physical chemistry. C, Nanomaterials and interfaces 116, 18440-18450. Li, J., Chen, Y. C., Tseng, Y. C., Mozumdar, S., and Huang, L., 2010. Biodegradable calcium phosphate nanoparticle with lipid coating for systemic siRNA delivery. Journal of controlled release : official journal of the Controlled Release Society 142, 416-421. Li, S. D., Chono, S., and Huang, L., 2008. Efficient gene silencing in metastatic tumor by siRNA formulated in surface-modified nanoparticles. Journal of controlled release : official journal of the Controlled Release Society 126, 77-84. Li, S. D., and Huang, L., 2006. Surface-modified LPD nanoparticles for tumor targeting. Annals of the New York Academy of Sciences 1082, 1-8. Liao, X., Tang, S., Thrasher, J. B., Griebling, T. L., and Li, B., 2005. Small-interfering RNA-induced androgen receptor silencing leads to apoptotic cell death in prostate cancer. Molecular cancer therapeutics 4, 505-515. Lin, S. L., Chang, D., and Ying, S. Y., 2005. Asymmetry of intronic pre-miRNA structures in functional RISC assembly. Gene 356, 32-38. Liu, A. Y., Corey, E., Bladou, F., Lange, P. H., and Vessella, R. L., 1996. Prostatic cell lineage markers: emergence of BCL2+ cells of human prostate cancer xenograft LuCaP 23 following castration. International journal of cancer. Journal international du cancer 65, 85-89. Liu, H., Rajasekaran, A. K., Moy, P., Xia, Y., Kim, S., Navarro, V., Rahmati, R., and Bander, N. H., 1998. Constitutive and antibody-induced internalization of prostate-specific membrane antigen. Cancer Research 58, 4055-4060. Lonergan, P. E., and Tindall, D. J., 2011. Androgen receptor signaling in prostate cancer development and progression. Journal of carcinogenesis 10, 20. Longmuir, K. J., Robertson, R. T., Haynes, S. M., Baratta, J. L., and Waring, A. J., 2006. Effective targeting of liposomes to liver and hepatocytes in vivo by incorporation of a Plasmodium amino acid sequence. Pharmaceutical Research 23, 759-769. Lund, E., and Dahlberg, J. E., 2006. Substrate selectivity of exportin 5 and Dicer in the biogenesis of microRNAs. Cold Spring Harbor symposia on quantitative biology 71, 59-66.  130  Ma, Z., Li, J., He, F., Wilson, A., Pitt, B., and Li, S., 2005. Cationic lipids enhance siRNA-mediated interferon response in mice. Biochemical and biophysical research communications 330, 755-759. MacRae, I. J., Ma, E., Zhou, M., Robinson, C. V., and Doudna, J. A., 2008. In vitro reconstitution of the human RISC-loading complex. Proceedings of the National Academy of Sciences of the United States of America 105, 512-517. Maeda, H., Wu, J., Sawa, T., Matsumura, Y., and Hori, K., 2000. Tumor vascular permeability and the EPR effect in macromolecular therapeutics: a review. Journal of controlled release : official journal of the Controlled Release Society 65, 271-284. Mahley, R. W., and Huang, Y., 2007. Atherogenic remnant lipoproteins: role for proteoglycans in trapping, transferring, and internalizing. The Journal of clinical investigation 117, 94-98. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., and Evans, R. M., 1995. The nuclear receptor superfamily: the second decade. Cell 83, 835-839. Maniataki, E., and Mourelatos, Z., 2005. A human, ATP-independent, RISC assembly machine fueled by pre-miRNA. Genes & development 19, 2979-2990. Matias, P. M., Donner, P., Coelho, R., Thomaz, M., Peixoto, C., Macedo, S., Otto, N., Joschko, S., Scholz, P., Wegg, A., Basler, S., Schafer, M., Egner, U., and Carrondo, M. A., 2000. Structural evidence for ligand specificity in the binding domain of the human androgen receptor. Implications for pathogenic gene mutations. The Journal of biological chemistry 275, 2616426171. Maurer, N., Fenske, D. B., and Cullis, P. R., 2001. Developments in liposomal drug delivery systems. Expert opinion on biological therapy 1, 923-947. Maurer, N., Wong, K. F., Stark, H., Louie, L., McIntosh, D., Wong, T., Scherrer, P., Semple, S. C., and Cullis, P. R., 2001. Spontaneous entrapment of polynucleotides upon electrostatic interaction with ethanol-destabilized cationic liposomes. Biophys J 80, 2310-2326. McMenamin, M. E., Soung, P., Perera, S., Kaplan, I., Loda, M., and Sellers, W. R., 1999. Loss of PTEN expression in paraffin-embedded primary prostate cancer correlates with high Gleason score and advanced stage. Cancer Research 59, 4291-4296. Miele, E., Spinelli, G. P., Di Fabrizio, E., Ferretti, E., Tomao, S., and Gulino, A., 2012. Nanoparticle-based delivery of small interfering RNA: challenges for cancer therapy. International journal of nanomedicine 7, 3637-3657. Miyake, H., Nelson, C., Rennie, P. S., and Gleave, M. E., 2000. Acquisition of chemoresistant phenotype by overexpression of the antiapoptotic gene testosterone-repressed prostate message-2 in prostate cancer xenograft models. Cancer research 60, 2547-2554. 131  Monck, M. A., Mori, A., Lee, D., Tam, P., Wheeler, J. J., Cullis, P. R., and Scherrer, P., 2000. Stabilized plasmid-lipid particles: pharmacokinetics and plasmid delivery to distal tumors following intravenous injection. Journal of Drug Targeting 7, 439-452. Morrissey, D. V., Lockridge, J. A., Shaw, L., Blanchard, K., Jensen, K., Breen, W., Hartsough, K., Machemer, L., Radka, S., Jadhav, V., Vaish, N., Zinnen, S., Vargeese, C., Bowman, K., Shaffer, C. S., Jeffs, L. B., Judge, A., MacLachlan, I., and Polisky, B., 2005. Potent and persistent in vivo anti-HBV activity of chemically modified siRNAs. Nature biotechnology 23, 1002-1007. Moul, J. W., 2009. Twenty-five year evolution of medical hormonal therapy for prostate cancer. BJU international 103, 145-146. Ni, L., Yang, C. S., Gioeli, D., Frierson, H., Toft, D. O., and Paschal, B. M., 2010. FKBP51 promotes assembly of the Hsp90 chaperone complex and regulates androgen receptor signaling in prostate cancer cells. Molecular and cellular biology 30, 1243-1253. Nolten, W. E., Sholiton, L. J., Srivastava, L. S., Knowles, H. C., Jr., and Werk, E. E., Jr., 1976. The effects of diethylstilbestrol and medroxyprogesterone acetate on kinetics and production of testosterone and dihydrotestosterone in patients with prostatic carcinoma. The Journal of clinical endocrinology and metabolism 43, 1226-1233. Obbard, D. J., Gordon, K. H., Buck, A. H., and Jiggins, F. M., 2009. The evolution of RNAi as a defence against viruses and transposable elements. Philosophical transactions of the Royal Society of London. Series B, Biological sciences 364, 99-115. Okamura, K., Hagen, J. W., Duan, H., Tyler, D. M., and Lai, E. C., 2007. The mirtron pathway generates microRNA-class regulatory RNAs in Drosophila. Cell 130, 89-100. Orban, T. I., and Izaurralde, E., 2005. Decay of mRNAs targeted by RISC requires XRN1, the Ski complex, and the exosome. RNA 11, 459-469. Pal, A., Ahmad, A., Khan, S., Sakabe, I., Zhang, C., Kasid, U. N., and Ahmad, I., 2005. Systemic delivery of RafsiRNA using cationic cardiolipin liposomes silences Raf-1 expression and inhibits tumor growth in xenograft model of human prostate cancer. International journal of oncology 26, 1087-1091. Park, Y. S., Maruyama, K., and Huang, L., 1992. Some negatively charged phospholipid derivatives prolong the liposome circulation in vivo. Biochim. Biophys. Acta 1108, 257-260. Patel, P. H., and Kockler, D. R., 2008. Sipuleucel-T: a vaccine for metastatic, asymptomatic, androgen-independent prostate cancer. The Annals of pharmacotherapy 42, 9198. Peek, A. S., and Behlke, M. A., 2007. Design of active small interfering RNAs. Current opinion in molecular therapeutics 9, 110-118. 132  Petrylak, D. P., Tangen, C. M., Hussain, M. H., Lara, P. N., Jr., Jones, J. A., Taplin, M. E., Burch, P. A., Berry, D., Moinpour, C., Kohli, M., Benson, M. C., Small, E. J., Raghavan, D., and Crawford, E. D., 2004. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine 351, 1513-1520. Rao, D. D., Vorhies, J. S., Senzer, N., and Nemunaitis, J., 2009. siRNA vs. shRNA: similarities and differences. Advanced Drug Delivery Reviews 61, 746-759. Reagan-Shaw, S., and Ahmad, N., 2005. Silencing of polo-like kinase (Plk) 1 via siRNA causes induction of apoptosis and impairment of mitosis machinery in human prostate cancer cells: implications for the treatment of prostate cancer. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 19, 611-613. Reiter, R. E., Gu, Z., Watabe, T., Thomas, G., Szigeti, K., Davis, E., Wahl, M., Nisitani, S., Yamashiro, J., Le Beau, M. M., Loda, M., and Witte, O. N., 1998. Prostate stem cell antigen: a cell surface marker overexpressed in prostate cancer. Proceedings of the National Academy of Sciences of the United States of America 95, 1735-1740. Rennie, P. S. L., E.; Murphy, L.C., 2008. Chapter 20: Hormones and Cancer. Unpublished. Roth, B. J., Krilov, L., Adams, S., Aghajanian, C. A., Bach, P., Braiteh, F., Brose, M. S., Ellis, L. M., Erba, H., George, D. J., Gilbert, M. R., Jacobson, J. O., Larsen, E. C., Lichtman, S. M., Partridge, A. H., Patel, J. D., Quinn, D. I., Robison, L. L., von Roenn, J. H., Samlowski, W., Schwartz, G. K., and Vogelzang, N. J., 2013. Clinical cancer advances 2012: annual report on progress against cancer from the american society of clinical oncology. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 31, 131-161. Ruizeveld de Winter, J. A., Trapman, J., Vermey, M., Mulder, E., Zegers, N. D., and van der Kwast, T. H., 1991. Androgen receptor expression in human tissues: an immunohistochemical study. The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society 39, 927-936. Runtga, R. L. C., H.B.; Lin, P.J.C.; Ko, R.; Nair, J; Manoharan, M.; Cullis, P.R.; MacVicar, B.A., 2012. Lipid nanoparticle delivery of siRNA to silence gene expression in the brain. Unpublished. Sack, J. S., Kish, K. F., Wang, C., Attar, R. M., Kiefer, S. E., An, Y., Wu, G. Y., Scheffler, J. E., Salvati, M. E., Krystek, S. R., Jr., Weinmann, R., and Einspahr, H. M., 2001. Crystallographic structures of the ligand-binding domains of the androgen receptor and its T877A mutant complexed with the natural agonist dihydrotestosterone. Proceedings of the National Academy of Sciences of the United States of America 98, 4904-4909. Sadar, M. D., 2011. Small molecule inhibitors targeting the "achilles' heel" of androgen receptor activity. Cancer Research 71, 1208-1213. 133  Sanchez, P., Hernandez, A. M., Stecca, B., Kahler, A. J., DeGueme, A. M., Barrett, A., Beyna, M., Datta, M. W., Datta, S., and Ruiz i Altaba, A., 2004. Inhibition of prostate cancer proliferation by interference with SONIC HEDGEHOG-GLI1 signaling. Proceedings of the National Academy of Sciences of the United States of America 101, 12561-12566. Sato, N., Gleave, M. E., Bruchovsky, N., Rennie, P. S., Goldenberg, S. L., Lange, P. H., and Sullivan, L. D., 1996. Intermittent androgen suppression delays progression to androgenindependent regulation of prostate-specific antigen gene in the LNCaP prostate tumour model. The Journal of steroid biochemistry and molecular biology 58, 139-146. Scholzen, T., and Gerdes, J., 2000. The Ki-67 protein: from the known and the unknown. Journal of cellular physiology 182, 311-322. Semple, S. C., Akinc, A., Chen, J., Sandhu, A. P., Mui, B. L., Cho, C. K., Sah, D. W., Stebbing, D., Crosley, E. J., Yaworski, E., Hafez, I. M., Dorkin, J. R., Qin, J., Lam, K., Rajeev, K. G., Wong, K. F., Jeffs, L. B., Nechev, L., Eisenhardt, M. L., Jayaraman, M., Kazem, M., Maier, M. A., Srinivasulu, M., Weinstein, M. J., Chen, Q., Alvarez, R., Barros, S. A., De, S., Klimuk, S. K., Borland, T., Kosovrasti, V., Cantley, W. L., Tam, Y. K., Manoharan, M., Ciufolini, M. A., Tracy, M. A., de Fougerolles, A., MacLachlan, I., Cullis, P. R., Madden, T. D., and Hope, M. J., 2010. Rational design of cationic lipids for siRNA delivery. Nature biotechnology 28, 172-176. Semple, S. C., Klimuk, S. K., Harasym, T. O., Dos Santos, N., Ansell, S. M., Wong, K. F., Maurer, N., Stark, H., Cullis, P. R., Hope, M. J., and Scherrer, P., 2001. Efficient encapsulation of antisense oligonucleotides in lipid vesicles using ionizable aminolipids: formation of novel small multilamellar vesicle structures. Biochimica et biophysica acta 1510, 152-166. Senior, J. H., Trimble, K. R., and Maskiewicz, R., 1991. Interaction of positively-charged liposomes with blood: implications for their application in vivo. Biochimica et biophysica acta 1070, 173-179. Sevli, S., Uzumcu, A., Solak, M., Ittmann, M., and Ozen, M., 2010. The function of microRNAs, small but potent molecules, in human prostate cancer. Prostate cancer and prostatic diseases 13, 208-217. Shahzad, M. M., Mangala, L. S., Han, H. D., Lu, C., Bottsford-Miller, J., Nishimura, M., Mora, E. M., Lee, J. W., Stone, R. L., Pecot, C. V., Thanapprapasr, D., Roh, J. W., Gaur, P., Nair, M. P., Park, Y. Y., Sabnis, N., Deavers, M. T., Lee, J. S., Ellis, L. M., Lopez-Berestein, G., McConathy, W. J., Prokai, L., Lacko, A. G., and Sood, A. K., 2011. Targeted delivery of small interfering RNA using reconstituted high-density lipoprotein nanoparticles. Neoplasia 13, 309319. Sharma, A., Yeow, W. S., Ertel, A., Coleman, I., Clegg, N., Thangavel, C., Morrissey, C., Zhang, X., Comstock, C. E., Witkiewicz, A. K., Gomella, L., Knudsen, E. S., Nelson, P. S., and 134  Knudsen, K. E., 2010. The retinoblastoma tumor suppressor controls androgen signaling and human prostate cancer progression. The Journal of clinical investigation 120, 4478-4492. Sheth, S., Jajoo, S., Kaur, T., Mukherjea, D., Sheehan, K., Rybak, L. P., and Ramkumar, V., 2012. Resveratrol Reduces Prostate Cancer Growth and Metastasis by Inhibiting the Akt/MicroRNA-21 Pathway. PloS one 7, e51655. Siegel, R., Naishadham, D., and Jemal, A., 2012. Cancer statistics, 2012. CA: a cancer journal for clinicians 62, 10-29. Smith, D. F., and Toft, D. O., 2008. Minireview: the intersection of steroid receptors with molecular chaperones: observations and questions. Molecular endocrinology 22, 2229-2240. Snoek, R., Cheng, H., Margiotti, K., Wafa, L. A., Wong, C. A., Wong, E. C., Fazli, L., Nelson, C. C., Gleave, M. E., and Rennie, P. S., 2009. In vivo knockdown of the androgen receptor results in growth inhibition and regression of well-established, castration-resistant prostate tumors. Clinical cancer research : an official journal of the American Association for Cancer Research 15, 39-47. Sogani, P. C., Ray, B., and Whitmore, W. F., Jr., 1975. Advanced prostatic carcinoma: flutamide therapy after conventional endocrine treatment. Urology 6, 164-166. Stein, Y., Halperin, G., and Stein, O., 1980. Biological stability of [3H]cholesteryl oleyl ether in cultured fibroblasts and intact rat. FEBS Lett. 111, 104-106. Sun, X., Frierson, H. F., Chen, C., Li, C., Ran, Q., Otto, K. B., Cantarel, B. L., Vessella, R. L., Gao, A. C., Petros, J., Miura, Y., Simons, J. W., and Dong, J. T., 2005. Frequent somatic mutations of the transcription factor ATBF1 in human prostate cancer. Nature Genetics 37, 407412. Tacklind, J., Fink, H. A., Macdonald, R., Rutks, I., and Wilt, T. J., 2010. Finasteride for benign prostatic hyperplasia. Cochrane database of systematic reviews, CD006015. Takei, Y., Kadomatsu, K., Goto, T., and Muramatsu, T., 2006. Combinational antitumor effect of siRNA against midkine and paclitaxel on growth of human prostate cancer xenografts. Cancer 107, 864-873. Tam, Y. Y., Chen, S., Zaifman, J., Tam, Y. K., Lin, P. J., Ansell, S., Roberge, M., Ciufolini, M. A., and Cullis, P. R., 2012. Small molecule ligands for enhanced intracellular delivery of lipid nanoparticle formulations of siRNA. Nanomedicine : nanotechnology, biology, and medicine. Tao, W., Mao, X., Davide, J. P., Ng, B., Cai, M., Burke, P. A., Sachs, A. B., and SeppLorenzino, L., 2011. Mechanistically probing lipid-siRNA nanoparticle-associated toxicities identifies Jak inhibitors effective in mitigating multifaceted toxic responses. Molecular therapy : the journal of the American Society of Gene Therapy 19, 567-575. 135  Taylor, B. S., Schultz, N., Hieronymus, H., Gopalan, A., Xiao, Y., Carver, B. S., Arora, V. K., Kaushik, P., Cerami, E., Reva, B., Antipin, Y., Mitsiades, N., Landers, T., Dolgalev, I., Major, J. E., Wilson, M., Socci, N. D., Lash, A. E., Heguy, A., Eastham, J. A., Scher, H. I., Reuter, V. E., Scardino, P. T., Sander, C., Sawyers, C. L., and Gerald, W. L., 2010. Integrative genomic profiling of human prostate cancer. Cancer Cell 18, 11-22. Tepper, C. G., Boucher, D. L., Ryan, P. E., Ma, A. H., Xia, L., Lee, L. F., Pretlow, T. G., and Kung, H. J., 2002. Characterization of a novel androgen receptor mutation in a relapsed CWR22 prostate cancer xenograft and cell line. Cancer research 62, 6606-6614. Thomas, M., Kularatne, S. A., Qi, L., Kleindl, P., Leamon, C. P., Hansen, M. J., and Low, P. S., 2009. Ligand-targeted delivery of small interfering RNAs to malignant cells and tissues. Annals of the New York Academy of Sciences 1175, 32-39. Thorpe, A., and Neal, D., 2003. Benign prostatic hyperplasia. Lancet 361, 1359-1367. Tomari, Y., and Zamore, P. D., 2005. Perspective: machines for RNAi. Genes & development 19, 517-529. Tran, C., Ouk, S., Clegg, N. J., Chen, Y., Watson, P. A., Arora, V., Wongvipat, J., SmithJones, P. M., Yoo, D., Kwon, A., Wasielewska, T., Welsbie, D., Chen, C. D., Higano, C. S., Beer, T. M., Hung, D. T., Scher, H. I., Jung, M. E., and Sawyers, C. L., 2009. Development of a second-generation antiandrogen for treatment of advanced prostate cancer. Science 324, 787790. Twiddy, A. L., Cox, M. E., and Wasan, K. M., 2012. Knockdown of scavenger receptor class B type I reduces prostate specific antigen secretion and viability of prostate cancer cells. The Prostate 72, 955-965. Udenfriend, S., and Wyngaarden, J. B., 1956. Precursors of adrenal epinephrine and norepinephrine in vivo. Biochimica Et Biophysica Acta 20, 48-52. Valencia-Sanchez, M. A., Liu, J., Hannon, G. J., and Parker, R., 2006. Control of translation and mRNA degradation by miRNAs and siRNAs. Genes & development 20, 515-524. van Royen, M. E., van Cappellen, W. A., de Vos, C., Houtsmuller, A. B., and Trapman, J., 2012. Stepwise androgen receptor dimerization. Journal of cell science 125, 1970-1979. Veldscholte, J., Berrevoets, C. A., Brinkmann, A. O., Grootegoed, J. A., and Mulder, E., 1992. Anti-androgens and the mutated androgen receptor of LNCaP cells: differential effects on binding affinity, heat-shock protein interaction, and transcription activation. Biochemistry 31, 2393-2399. Veldscholte, J., Berrevoets, C. A., Ris-Stalpers, C., Kuiper, G. G., Jenster, G., Trapman, J., Brinkmann, A. O., and Mulder, E., 1992. The androgen receptor in LNCaP cells contains a mutation in the ligand binding domain which affects steroid binding characteristics and response to antiandrogens. The Journal of steroid biochemistry and molecular biology 41, 665-669. 136  Verrijdt, G., Tanner, T., Moehren, U., Callewaert, L., Haelens, A., and Claessens, F., 2006. The androgen receptor DNA-binding domain determines androgen selectivity of transcriptional response. Biochemical Society Transactions 34, 1089-1094. Wang, S. I., Parsons, R., and Ittmann, M., 1998. Homozygous deletion of the PTEN tumor suppressor gene in a subset of prostate adenocarcinomas. Clinical cancer research : an official journal of the American Association for Cancer Research 4, 811-815. Wannenes, F., Ciafre, S. A., Niola, F., Frajese, G., and Farace, M. G., 2005. Vector-based RNA interference against vascular endothelial growth factor-A significantly limits vascularization and growth of prostate cancer in vivo. Cancer gene therapy 12, 926-934. Wightman, B., Ha, I., and Ruvkun, G., 1993. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 75, 855-862. Wilson, K. D., Raney, S. G., Sekirov, L., Chikh, G., deJong, S. D., Cullis, P. R., and Tam, Y. K., 2007. Effects of intravenous and subcutaneous administration on the pharmacokinetics, biodistribution, cellular uptake and immunostimulatory activity of CpG ODN encapsulated in liposomal nanoparticles. International immunopharmacology 7, 1064-1075. Xie, F. Y., Woodle, M. C., and Lu, P. Y., 2006. Harnessing in vivo siRNA delivery for drug discovery and therapeutic development. Drug discovery today 11, 67-73. Yang, Y., Hu, Y., Wang, Y., Li, J., Liu, F., and Huang, L., 2012. Nanoparticle Delivery of Pooled siRNA for Effective Treatment of Non-Small Cell Lung Caner. Molecular pharmaceutics. Yoshioka, H., 1991. Surface modification of haemoglobin-containing liposomes with polyethylene glycol prevents liposome aggregation in blood plasma. Biomaterials 12, 861-864. Zegarra-Moro, O. L., Schmidt, L. J., Huang, H., and Tindall, D. J., 2002. Disruption of androgen receptor function inhibits proliferation of androgen-refractory prostate cancer cells. Cancer research 62, 1008-1013. Zhang, K. X., Matsui, Y., Hadaschik, B. A., Lee, C., Jia, W., Bell, J. C., Fazli, L., So, A. I., and Rennie, P. S., 2010. Down-regulation of type I interferon receptor sensitizes bladder cancer cells to vesicular stomatitis virus-induced cell death. International journal of cancer. Journal international du cancer 127, 830-838. Zhang, K. X., Moussavi, M., Kim, C., Chow, E., Chen, I. S., Fazli, L., Jia, W., and Rennie, P. S., 2009. Lentiviruses with trastuzumab bound to their envelopes can target and kill prostate cancer cells. Cancer gene therapy 16, 820-831. Zhang, P. L., Rosen, S., Veeramachaneni, R., Kao, J., DeWolf, W. C., and Bubley, G., 2002. Association between prostate cancer and serum testosterone levels. The Prostate 53, 179182. 137  Zhang, X., Ladd, A., Dragoescu, E., Budd, W. T., Ware, J. L., and Zehner, Z. E., 2009. MicroRNA-17-3p is a prostate tumor suppressor in vitro and in vivo, and is decreased in high grade prostate tumors analyzed by laser capture microdissection. Clinical & experimental metastasis 26, 965-979. Zhang, Y., Castaneda, S., Dumble, M., Wang, M., Mileski, M., Qu, Z., Kim, S., Shi, V., Kraft, P., Gao, Y., Pak, J., Sapra, P., Bandaru, R., Zhao, H., Vessella, R. L., Horak, I. D., and Greenberger, L. M., 2011. Reduced expression of the androgen receptor by third generation of antisense shows antitumor activity in models of prostate cancer. Molecular cancer therapeutics 10, 2309-2319. Zhou, Z. X., Sar, M., Simental, J. A., Lane, M. V., and Wilson, E. M., 1994. A liganddependent bipartite nuclear targeting signal in the human androgen receptor. Requirement for the DNA-binding domain and modulation by NH2-terminal and carboxyl-terminal sequences. The Journal of Biological Chemistry 269, 13115-13123. Zimmermann, T. S., Lee, A. C., Akinc, A., Bramlage, B., Bumcrot, D., Fedoruk, M. N., Harborth, J., Heyes, J. A., Jeffs, L. B., John, M., Judge, A. D., Lam, K., McClintock, K., Nechev, L. V., Palmer, L. R., Racie, T., Rohl, I., Seiffert, S., Shanmugam, S., Sood, V., Soutschek, J., Toudjarska, I., Wheat, A. J., Yaworski, E., Zedalis, W., Koteliansky, V., Manoharan, M., Vornlocher, H. P., and MacLachlan, I., 2006. RNAi-mediated gene silencing in non-human primates. Nature 441, 111-114.  138  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073915/manifest

Comment

Related Items