Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Dissecting plant innate immunity using SNC1 : a sensitive immune receptor Cheng, Yu Ti 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2013_spring_cheng_yuti.pdf [ 3.16MB ]
Metadata
JSON: 24-1.0073818.json
JSON-LD: 24-1.0073818-ld.json
RDF/XML (Pretty): 24-1.0073818-rdf.xml
RDF/JSON: 24-1.0073818-rdf.json
Turtle: 24-1.0073818-turtle.txt
N-Triples: 24-1.0073818-rdf-ntriples.txt
Original Record: 24-1.0073818-source.json
Full Text
24-1.0073818-fulltext.txt
Citation
24-1.0073818.ris

Full Text

DISSECTI G PLA T I ATE IMMU ITY USI G S C1 – A SE SITIVE IMMU E RECEPTOR by  Yu Ti Cheng  B. Sc., The University of British Columbia, 2004  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  The Faculty of Graduate Studies (Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  May 2013  © Yu Ti Cheng, 2013  Abstract Plants rely on innate immunity to fight pathogens. Among plant defence mechanisms, Resistance (R) proteins play essential roles in recognizing pathogens and mounting robust defence responses. snc1, a mis-regulated plant Resistance (R) gene mutant, exhibits distinctive morphological and autoimmune phenotypes. To identify the signalling components downstream of R proteinmediated defence, forward genetic screens were conducted in the snc1 background. From the screens, fifteen novel mos (modifier of snc1) mutants were identified, of which, I studied mos7 and mos9 for my PhD thesis. Both mos7 and mos9 partially suppress all snc1related autoimmune phenotypes. MOS7 is an Arabidopsis homolog of human and Drosophila Nucleoporin 88 (Nup88) required for protein nuclear retention. Partial loss-of-function alleles of up88 in Drosophila and mammalian cells fail to accumulate NF-κB in the nucleus and result in immune deficiency. We found that several defence related proteins have altered distribution/abundance in mos7, including snc1. This study highlights the importance of nucleocytoplasmic trafficking in plant immunity. mos9 contains a mutation in a gene encoding a protein of unknown function. Immunoprecipitation followed by mass spectrometry identified a SET domain-containing protein, ATXR7, as an interactor of MOS9. Previous studies showed that ATXR7 methylates lysine 4 of histone H3 (H3K4) and this methylation is required for proper transcriptional activation of Flowering Locus C (FLC). We found reduced expression of two R genes, S C1 and RPP4, in mos9 and atxr7. Also, H3K4 marks close to S C1 are reduced in mos9. My research on MOS9 illustrated the importance of histone modification in regulating plant immune receptor transcription. Serendipitously, I worked on an F-box protein, CPR1. From the genetic and biochemical data, we found that at least two R proteins, SNC1 and RPS2, are being regulated by CPR1. Our study is the first report with evidence suggesting how plant R proteins are negatively regulated by the ubiquitin-26S proteasome. Overall, my PhD thesis research provides evidence that plant immunity is under tight control at multiple levels. My work furthers our knowledge on how plant immune responses are regulated.  ii  Preface The work described in this thesis is the culmination of research from September 2006 through April 2013. Below is a list of manuscripts (published or in preparation) that comprise this thesis, and the contribution made by the candidate. Chapter 1, Section 3 – Ubiquitination in B-LRR R protein-mediated immunity was modified from the manuscript: Cheng Y.T. and Li X. (2012). Ubiquitination in NB-LRR-mediated immunity. Current Opinion in Plant Biology. 15(4):392–399. Edited by Pamela Ronald and Ken Shirasu. • X. Li conceived of, wrote and prepared the manuscript. The candidate prepared Figure 1.1 and Table 1.1 based on the text written by X. Li. Chapter 2 – uclear pore complex component MOS7/ up88 is required for innate immunity and nuclear accumulation of defence regulators in Arabidopsis was modified from the manuscript: Cheng Y.T., Germain H., Wiermer M., Bi D., Xu F., Garcia A.V., Wirthmueller L., Despres C., Parker J.E., Zhang Y., and Li X. (2009). Nuclear pore complex component MOS7/Nup88 is required for innate immunity and nuclear accumulation of defense regulators in Arabidopsis. Plant Cell 21(8): 2503-2516. • The mos7 mutant was generated and isolated by Y. Zhang and X. Li. The candidate performed the following experiments under the instruction and supervision of X. Li and Y. Zhang: map-based cloning of mos7 and single mutant characterization including morphology, abiotic responses and disease assays. Confocal microscopy of MOS7-GFP (transgenic line generated by Y. Zhang) and nuclear export/import assay system (Haasen et al., 1999) was conducted by D. Bi; confocal microscopy images of mos7-GFP (transgenic line generated by the candidate) were taken by the candidate with great help and advice from Dr. EunKyoung Lee. Protein fraction of snc1-GFP (transgenic line generated by Y. Zhang) was performed by H. Germain; protein fractionation of NPR1GFP and EDS1 was performed by M. Wiermer. F. Xu and A. Garcia performed protein fractionation experiments shown in Figure 2.11A and Figure 2.11B, respectively, and wrote the corresponding materials and methods sections. The candidate, H. Germain, M. Wiermer and X. Li wrote the manuscript. X. Li supervised the work done by the candidate and prepared the manuscript.  iii  Chapter 3 – Regulation of transcription of B-LRR-encoding genes S C1 and RPP4 via H3K4 tri-methylation was modified from the prepared manuscript: Xia S., Cheng Y.T., Huang S., Win J., Soards A., Jinn T-L, Jones J.D., Kamoun S., Chen S., Zhang Y., and Li X. Regulation of transcription of NB-LRR-encoding genes S C1 and RPP4 via H3K4 tri-methylation. Manuscript in preparation. • The mos9 mutant was generated and isolated by Y. Zhang and X. Li. S. Xia performed map-based cloning and the candidate conducted TAC clone and single gene transgene complementation. T-L Jinn provided a construct for single gene complementation of mos9. The candidate performed mutant characterization including morphology, salicylic acid analysis, disease assays and gene expression analysis and isolated the mos9 single mutant. The candidate performed disease assays using At1g56420 RNAi knock-down lines (generated by the candidate). The candidate, J. Win, A. Soards, S. Kamoun and X. Li analyzed the evolutionary trends of MOS9 and the MOS9 homolog, At1g56420. The candidate generated the MOS9-GFP transgenic line and conducted confocal microscopy and protein fractionation using the line. The candidate used the same MOS9-GFP transgenic line for immuno-purification of MOS9-GFP associated proteins and prepared samples for mass spectrometry. S. Chen performed the mass spectrometry and data analysis. The candidate generated atxr7 snc1 and atx1 snc1 double mutant plants and performed mutant characterization on these plants. The candidate, S. Xia and S. Huang performed chromatin immunoprecipitation (ChIP) experiments; the candidate and X. Li analyzed the ChIP data. The candidate and X. Li wrote the manuscript. X. Li supervised the work done by the candidate, S. Xia and S. Huang, and prepared the manuscript. Chapter 4 – Stability of plant immune receptor Resistance proteins is controlled by SCFmediated protein degradation was modified from the manuscript: Cheng Y.T., Li Y., Huang S., Huang Y., Dong X., Zhang Y., and Li X. (2011). Stability of plant immune-receptor resistance proteins is controlled by SKP1-CULLIN1-F-box (SCF)-mediated protein degradation. Proceedings of the National Academy of Sciences of the United States of America. 108 (35): 14694-14699. Edited by Paul Schulze-Lefert. • The candidate and Y. Li performed most of the experiments under the supervision of X. Li and Y. Zhang. S. Huang identified the mutation in the cpr1-1 allele isolated by X. Dong’s group. Y. Huang isolated the 35S:CPR1 in snc1 transgenic line used in this study and performed disease assays using Hyaloperonospora arabidopsidis. The candidate, X. Dong, Y. Zhang and X. Li wrote the manuscript. X. Li supervised the work done by the candidate and prepared the manuscript.  iv  Table of Contents ABSTRACT.................................................................................................................................ii PREFACE...................................................................................................................................iii TABLE OF CO TE TS ........................................................................................................... v LIST OF TABLES ..................................................................................................................... ix LIST OF FIGURES .................................................................................................................... x LIST OF ABBREVIATIO S ..................................................................................................xii CHAPTER 1: Literature Review – Introduction..................................................................... 1 1.1 Plant Immunity........................................................................................................................ 1 1.1.1 Non-Host Resistance .................................................................................................... 1 1.1.2 Host Immunity.............................................................................................................. 1 1.1.2.1 Recognition of Pathogens ............................................................................... 1 1.1.2.2 Signalling Downstream of PRR...................................................................... 2 1.1.2.3 Suppression of PAMP-Triggered Immunity by Pathogen Effectors .............. 2 1.1.2.4 Recognizing Effectors by Host Resistance Proteins....................................... 3 1.1.3 Plant R Proteins ............................................................................................................ 3 1.1.3.1 R Protein Structure and Regulation ................................................................ 4 1.1.3.2 R Protein Signalling........................................................................................ 5 1.2 Dissecting Plant Immunity Using snc1 and Modifiers of snc1 in Arabidopsis ...................... 7 1.2.1 snc1: A Unique Gain-of-Function Mutant of a TIR-Type NB-LRR R Protein ........... 7 1.2.2 The MOS Screen........................................................................................................... 7 1.2.3 Modifiers of snc1 (MOSes).......................................................................................... 8 1.2.3.1 Epigenetic Regulation of SNC1 Transcription: MOS1 .................................. 8 1.2.3.2 RNA Processing/Metabolism and Splicing Machinery: MOS2, MOS3, MOS4, MOS11, and MOS12 ........................................................................ 8 1.2.3.3 Nucleo-Cytoplasmic Trafficking: MOS6 and MOS14 ................................. 10 1.2.3.4 Transcriptional Repressor: MOS10 .............................................................. 11 1.2.3.5 Protein Modifications: MOS5 and MOS8 .................................................... 11  v  1.3 Ubiquitination in NB-LRR R Protein-Mediated Immunity ................................................. 12 1.3.1 Introduction ............................................................................................................... 12 1.3.2 E3s in R Protein-Mediated Immunity ....................................................................... 14 1.3.2.1 Light Regulation of R Protein Stability ....................................................... 14 1.3.2.2 F-Box Protein ACIF1 in R Protein-Mediated Immunity ............................. 14 1.3.2.3 MAC3A/MAC3B in the Splicing of R Genes.............................................. 14 1.3.2.4 Other E3s ..................................................................................................... 15 1.3.2.5 Components Associated with E3: SRFR1 and SGT1 in Stability Control of NB-LRR R Proteins .................................................................. 15 1.3.3 E1s and E2s in R Protein-Mediated Immunity.......................................................... 16 1.3.4 DUBs in R Protein-Mediated Immunity ................................................................... 16 1.3.5 Conclusions and Perspectives ................................................................................... 17 1.3.6 Manuscript Acknowledgements ................................................................................ 17 1.4 Thesis Objectives ................................................................................................................. 20 CHAPTER 2: uclear Pore Complex Component MOS7/ up88 is Required for Innate Immunity and uclear Accumulation of Defence Regulators in Arabidopsis .................................................................................................. 21 2.1 Introduction........................................................................................................................... 21 2.2 Results................................................................................................................................... 23 2.2.1 Identification of the mos7-1 Mutant ........................................................................... 23 2.2.2 Map-Based Cloning of mos7-1................................................................................... 25 2.2.3 mos7-1 Single Mutant Plants Exhibit Enhanced Disease Susceptibility.................... 29 2.2.4 MOS7 is Required for Resistance Mediated by Multiple R Proteins ......................... 29 2.2.5 mos7-1 is Compromised in SAR ................................................................................ 29 2.2.6 MOS7 Localizes to the Nuclear Rim ......................................................................... 32 2.2.7 Nuclear Accumulation of snc1 Resistance Protein is Reduced in mos7-1................. 32 2.2.8 Nuclear Accumulation of NPR1 is Reduced in mos7-1 ............................................. 35 2.2.9 EDS1 Nuclear Accumulation is Reduced in mos7-1.................................................. 36 2.2.10 Nuclear Accumulation of HDA19, CDC5, and TGA2 is Not Affected in mos7-1 .. 36 2.3 Discussion ............................................................................................................................. 40 2.4 Material and Methods ........................................................................................................... 42 2.4.1 Plant Growth Conditions, Gene Expression Analysis, and Mutant Phenotypic Characterization ..................................................................................... 42 2.4.2 Map-Based Cloning of mos7-1................................................................................... 42 2.4.3 Construction of Plasmids............................................................................................ 43 2.4.4 Systemic Acquired Resistance Experiments .............................................................. 44 2.4.5 Cellular Distribution of snc1-GFP ............................................................................. 44 2.4.6 NPR1 and EDS1 Protein Expression and Localization Analyses .............................. 44 2.4.7 Nuclear Protein Export Assay in Protoplast............................................................... 45 2.4.8 Accession Numbers.................................................................................................... 45 2.5 Manuscript Acknowledgements............................................................................................ 45  vi  CHAPTER 3: Regulation of Transcription of B-LRR Encoding Genes S C1 and RPP4 via H3K4 Tri-Methylation .................................................................. 46 3.1 Introduction.......................................................................................................................... 46 3.2 Results.................................................................................................................................. 47 3.2.1 Identification of the mos9 Mutant ............................................................................. 47 3.2.2 Map-Based Cloning of mos9 ..................................................................................... 48 3.2.3 Characterization of the mos9 Single Mutant ............................................................. 56 3.2.4 Subcellular Localization of MOS9............................................................................ 56 3.2.5 Identification of MOS9-Associated Proteins ............................................................ 57 3.3.6 Suppression of snc1 Mutant Phenotypes by atxr7-1 ................................................. 57 3.3.7 ATXR7 is Required for RPP4 Expression and RPP4-Mediated Immunity.............. 63 3.3.8 Analysis of H3K4me3 Levels in the Promoter Regions of S C1 and RPP4............ 63 3.4 Discussion ............................................................................................................................ 65 3.5 Material and Methods .......................................................................................................... 68 3.5.1 Plant Growth Conditions, Mutant Screen and Mutant Phenotypic Characterization ....................................................................................................... 68 3.5.2 Map-Based Cloning................................................................................................... 68 3.5.3 Construction of Plasmids........................................................................................... 69 3.5.4 Mutant Genotyping.................................................................................................... 69 3.5.5 Total Protein Extraction ............................................................................................ 69 3.5.6 Nuclear Fractionation ................................................................................................ 70 3.5.7 Nuclear Extraction and Immunoprecipitation ........................................................... 70 3.5.8 Chromatin Immunoprecipitation (ChIP) ................................................................... 71 3.5.9 Phylogenetic Analyses of MOS9 and Its Homologs ................................................. 71 3.6 Acknowledgements.............................................................................................................. 73  vii  CHAPTER 4: Stability of Plant Immune Receptor Resistance Proteins is Controlled by SCF-Mediated Protein Degradation ............................................................. 74 4.1 Introduction.......................................................................................................................... 74 4.2 Results.................................................................................................................................. 75 4.2.1 snc1 Mutation Affects the Stability of SNC1............................................................ 75 4.2.2 cul1-7 Exhibits Increased SNC1 Level and Constitutive Defence Responses.......... 77 4.2.3 SNC1 Protein Levels are Increased in cpr1 and cpr30 Mutants ............................... 77 4.2.4 cpr1 and cpr30 are Allelic Mutations........................................................................ 77 4.2.5 Constitutive Defence Responses in cpr1-3 are Largely Suppressed by Knocking Out S C1 ................................................................................................................. 78 4.2.6 Overexpression of CPR1 Results in Reduced snc1 Protein Levels and Suppression of snc1 Mutant Phenotypes ................................................................. 78 4.2.7 Overexpression of CPR1 Affects R Protein-Mediated Resistance ........................... 84 4.2.8 CPR1 Regulates the Stability of RPS2...................................................................... 84 4.2.9 CPR1 Interacts with SNC1 and RPS2 in vivo ........................................................... 88 4.3 Discussion ............................................................................................................................ 90 4.4 Material and Methods .......................................................................................................... 91 4.4.1 Plant Growth Conditions and Mutant Phenotypic Characterization ......................... 91 4.4.2 Construction of Plasmids and Arabidopsis Transformation...................................... 91 4.4.3 Generation of Arabidopsis Protoplasts...................................................................... 92 4.4.4 Plant Total Protein Extraction, Protein Immunoprecipitation, and Western Blot Analyses............................................................................................. 92 4.5 Manuscript Acknowledgements........................................................................................... 93 CHAPTER 5: Final Summary and Future Perspectives ..................................................... 94 5.1 Nuclear-Cytoplasmic Trafficking and Plant Immunity – MOS7......................................... 94 5.2 Epigenetic Regulation of Plant R Genes – MOS9 ............................................................... 96 5.3 Regulation of Plant R Protein Stability – SCFCPR1 .............................................................. 97 REFERE CES......................................................................................................................... 99  viii  List of Tables Table 1.1 List of E3 ubiquitin ligases from plants and pathogens that have been shown to play roles in plant immunity ................................................................................. 18 Table 2.1 Molecular markers used for map-based cloning of mos7-1 ....................................... 43 Table 3.1 Transgenic complementation of mos9 snc1 using overlaying JAtY clones covering the final mapped region containing mos9 mutation................................... 51 Table 3.2 Codeml analysis of MOS9 sequences from 75 Arabidopsis thaliana accessions...... 55 Table 3.3 Codeml analysis of MOS9 paralog sequences from 74 Arabidopsis thaliana accessions.................................................................................................................. 56 Table 3.4 Primer sequences used in the study of MOS9............................................................ 72 Table 4.1 List of primers used in constructing protoplast transient expression constructs........ 93  ix  List of Figures Figure 1.1 Signaling components downstream of TIR-type and CC-type NB-LRR R proteins ................................................................................................................. 6 Figure 1.2 Ubiquitination pathway and different classes of E3s ............................................... 13 Figure 2.1 mos7-1 suppresses the autoimmune responses in snc1 ............................................ 24 Figure 2.2 Map-based cloning of mos7-1 .................................................................................. 26 Figure 2.3 Amino acid alignment of MOS7, human Nup88, and Drosophila Nup88............... 27 Figure 2.4 Altered basal and R protein- mediated resistance in mos7-1 single mutant plants .. 30 Figure 2.5 Systemic acquired resistance is compromised in mos7-1......................................... 31 Figure 2.6 Subcellular localization of MOS7-GFP.................................................................... 33 Figure 2.7 Abundance and cellular distribution of snc1-GFP in mos7-1 snc1-r3 ..................... 34 Figure 2.8 NPR1 protein abundance and subcellular localization in mos7-1 ............................ 37 Figure 2.9 EDS1 protein abundance and subcellular localization in mos7-1 ............................ 38 Figure 2.10 CDC5, PEPC, HDA19, TGA2 and Histone H3 protein abundance and subcellular localization, and RPS4 nuclear abundance are unaltered in mos7-1 ... 39  x  Figure 3.1 Mutation in mos9 partially suppresses the autoimmune phenotypes of snc1.......... 48 Figure 3.2 Positional cloning of mos9 ...................................................................................... 50 Figure 3.3 Protein sequence analysis between MOS9 and its paralog At1g56420 and contribution of At1g56420 in defence .................................................................. 52 Figure 3.4 Evolutionary tree of MOS9 (At1g12530) and its paralog At1g56420 .................... 53 Figure 3.5 Characterization of the mos9 single mutant ............................................................ 58 Figure 3.6 Nuclear localization of MOS9-GFP ........................................................................ 59 Figure 3.7 Identification of proteins associated with MOS9-GFP............................................ 60 Figure 3.8 Mutation in ATXR7 suppresses snc1 ....................................................................... 61 Figure 3.9 Mutation in ATX1 does not affect snc1-mediated immunity................................... 62 Figure 3.10 Compromised RPP4-mediated resistance in atxr7 and mos9 plants, and reduced H3K4me3 levels in mos9 at S C1 and RPP4 loci .................................. 64 Figure 4.1 Increased snc1 protein levels in snc1 and snc1 pad4 double mutant ...................... 76 Figure 4.2 Increased accumulation of SNC1 proteins in cul1-7 mutant................................... 79 Figure 4.3 cpr1 and cpr30 are alleles of At4g12560................................................................. 80 Figure 4.4 Sequence analysis of cpr1........................................................................................ 81 Figure 4.5 CPR1 regulates SNC1-mediated defence responses ............................................... 82 Figure 4.6 Overexpression of CPR1 in snc1 alleviates the enhanced disease resistance phenotypes of snc1 and reduces the protein levels of snc1 .................................. 83 Figure 4.7 Analysis of basal resistance and resistance mediated by RPS5, RPS4, RPP2, and RPP4 in two independent transgenic lines overexpressing CPR1 in wild type Col background..................................................................................................... 85 Figure 4.8 Regulation of RPS2-mediated resistance and RPS2 protein accumulation by CPR1 ................................................................................................................ 86 Figure 4.9 RPS4 protein level is not affected by CPR1............................................................ 87 Figure 4.10 Interactions between CPR1 and SNC1 or RPS2 ................................................... 89  xi  List of Abbreviations 35S  a very strong constitutive promoter found in Cauliflower mosaic virus (CaMV); the coefficient of sedimentation of viral transcript whose expression is naturally driven by this promoter is 35S  ABA ABRC ACIF1/ACRE189  abscisic acid Arabidopsis Biological Resource Center Avr9/Cf-9–Induced F-Box 1 (or Avr9/Cf-9 Rapidly Elicited gene 189) in Nicotiana benthamiana Avr9/Cf-9 Rapidly Elicited gene 276 (in N. benthamiana); Plant UBox 17 (in A. thaliana); Arm Repeat Containing 1 (in B. napus) Actin 1 Argonaute 1 artificial microRNA Apoptotic protease activating factor 1 Anaphase-Promoting Complex or Cyclosome Arabidopsis thaliana Cell Division Cycle 5 Arabidopsis tóxicos en levadura 9 Arabidopsis homolog of trithorax 1 Arabidopsis Trithorax-Related 7 Auxin-responsive protein or Indoleacetic Acid-Induced protein 1 Auxin/Indole-3-Acetic Acid protein Indole-3-Acetic Acid avirulent or avirulence an avirulence effector from Phytophthora infestans an avirulence effector from Cladosporium fulvum an avirulence effector from Cladosporium fulvum Avirulence protein B; an avirulence effector from Pseudomonas syringae pv. Glycinea An avirulence effector from Pseudomonas syringae pv. phaseolicola an avirulence protein from Pseudomonas syringae an avirulence protein from Pseudomonas syringae An avirulence protein isolated from Pseudomonas syringae pv. maculicola strain M2 An avirulence protein isolated from Pseudomonas syringae pv. pisi An avirulence protein isolated from Pseudomonas syringae pv. tomato activator of Xa21-mediated immunity benzoic acid hypersensitive1 or NITROGEN LIMITATION ADAPTATION  ACRE276/PUB17/ARC1 ACT1 AGO1 amiRNA Apaf1 APC/C AtCDC5 ATL9 ATX1 ATXR7 AUS/IAA1 Aux/IAA IAA Avr Avr3a Avr4 Avr9 avrB avrPphB avrPto avrPtoB avrRpm1 avrRps4 avrRpt2 Ax21 BAH1/NLA  xii  BAT2 BBI1 BCAS2 BLAST BTB CC CEBiP CED4 CERK1 Cf-9 cfu ChIP CHS CIP29 Col COP1 CPR1/CPR30 CRM1 CTLH domain Cul1 DDB1 DDM1 DIC Dif DND1 DND2 Dorsal DRF1 DUB DWD E1 E2 E3 EDM2  HLA-B Associated Transcript 2 BLAST AND BTH-INDUCED-1 Breast Cancer-Amplified Sequence 2 Basic Local Alignment Search Tool BR-C, ttk and bab (also known as the POZ domain); a proteinprotein interaction motif coiled-coil Chitin Elicitor Binding Protein Cell death protein 4 CHITIN ELICITOR RECEPTOR KINASE 1 a tomato resistance gene that confers resistance to Cladosporium fulvum that expressing the Avr9 avirulence gene colony forming unit chromatin immunoprecipitation chalcone synthase; a cytosolic protein cytokine-induced protein 29 an Arabidopsis ecotype; it is also referred as wild type in this thesis work Constitutively photomorphogenic 1 Constitutive Expresser of PR Genes 1; also known as Constitutive Expresser of PR Genes 30 Chromosomal Region Maintenance 1; also named Exportin 1 (XPO1) C-terminal to LisH domain Cullin 1 UV-damaged DNA-binding protein 1 Decrease in DNA methylation 1 Differential interference contrast; a microscopy illumination technique to enhance the contrast in unstained, transparent samples Dorsal-related immunity factor Defense no Death 1 Defense no Death 2 a conserved eukaryotic transcription factor in Drosophila that binds to DNA sequence motif kappa-B defense-related F-box protein 1 deubiquitinating enzyme DDB1 binding WD40 protein ubiquitin-activating enzyme ubiquitin-conjugating enzyme ubiquitin ligase ENHANCED DOWNY MILDEW 2  xiii  EDS1 EFR EF-Tu EMS ETI Fen fH FLAG FLC FLS2 GFP G-patch GUS H3K4 H3K4me3 H3K9 H.a. HA HCF173 HDA19 HECT  HKMT HP1/DDB1 HR HRT HSP90 HUB1 ICS1 INA InDel Inf IP I-κB JAtY  Enhanced Disease Susceptibility 1 EF-Tu receptor bacterial Elongation Factor Tu Ethyl methanesulfonate; a chemical mutagen effector-triggered immunity fenthion-sensitivity gene free hyphae an epitope protein tag compose of a single or repeated DYKDDDDK sequence Flowering Locus C FLAGELLIN-SENSITIVE 2 green fluorescent protein glycine-rich nucleic acid binding domain beta-glucuronidase; a reporter gene system used in this thesis lysine 4 of histone H3 tri-methylation of H3K4 lysine 9 of histone H3 Hyaloperonospora arabidopsidis hemagglutinin; an epitope protein tag compose of a single or repeated YPYDVPDYA sequence High Chlorophyll Fluorescence Phenotype 173 HISTONE DEACETYLASE 19 Homologous to the E6-AP Carboxyl Terminus; an 40 kDa catalytic domain found at the C-terminus of HECT-class E3 ubiquitin protein ligases histone lysine methyl transferase high pigment-1; also known as UV-damaged DNA-binding protein-1 hypersensitive response HYPERSENSITIVE RESPONSE TO TCV HEAT SHOCK PROTEIN 90 HISTONE MONOUBIQUITINATION 1 Isochorismate Synthase 1 2,6-dichloro-isonicotinic acid; an SA analog insertion/deletion infestin; A 10 kDa elicitor protein produced by Phytopthora infestans Immunoprecipitation inhibitor of kappa B a TAC library consisting of 36,864 clones, constructed using pYLTAC17 as vector and providing 14x coverage of the Arabidopsis genome  xiv  KEG KOW LAZ2 LAZ5 Ler LisH domain LPS LRES LRR MAC3 MAC5 MAMP MAP Mbo MG132 Mla10  KEEP ON GOING Kyprides, Ouzounis, Woese LAZARUS 2; an H3K4 methyltransferase LAZARUS 5; a TIR-type NB-LRR protein Landsberg erecta; an Arabidopsis ecotype Lissencephaly type-1-like homology domain lipopolysaccharide Long Range Epigenetic Silencing leucine-rich repeat MOS4-ASSOCIATED COMPLEX SUBUNIT 3 MOS4-ASSOCIATED COMPLEX SUBUNIT 5 microbe-associated molecular pattern Mitogen-activated protein Members only a proteasome inhibitor a barley Mla allele that encodes CC-type NB-LRR protein that confers isolate-specific disease resistance against the barley powdery mildew fungus Blumeria graminis f sp hordei (Bgh)  MOS MOS1 MOS2  Modifier of snc1 Modifier of snc1, 1; a BAT2 domain containing protein Modifier of snc1, 2; a G-patch and KOW domains containing protein Modifier of snc1, 3; also known as AtNup96 or SAR3 Modifier of snc1, 4; a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2) Modifier of snc1, 5; also known as UBIQUITIN-ACTIVATING ENZYME 1 (UBA1), one of the two Arabidopsis Ubiquitinactivating enzymes Modifier of snc1, 6; also known as IMPORTIN ALPHA 3 (IMPA3) Modifier of snc1, 7; homologous to human and Drosophila Nup88 Modifier of snc1, 8; also known as ENHANCED RESPONSE TO ABA 1 (ERA1) Modifier of snc1, 9 Modifier of snc1, 10; also known as Topless-Related 1 (TPR1) Modifier of snc1, 11; homologous to the human RNA binding protein CIP29 Modifier of snc1, 12; an Arabidopsis cyclin L homolog Modifier of snc1, 14; a nuclear importer of serine-arginine rich (SR) proteins messenger ribonucleoprotein Murashige and Skoog medium; a plant growth medium  MOS3 MOS4 MOS5  MOS6 MOS7 MOS8 MOS9 MOS10 MOS11 MOS12 MOS14 mRNP MS medium  xv  NB-LRR NDR1 NES NF-kB NLR NLS NOD NPR1 NTC Nup107-160 Nup214 Nup88 Nup96  O OD P0  p50 PAD4 SDS-PAGE PAMP PEPC PM PR PRL1 PRR Psm ES4326 Pst DC3000 PTI PUB pv qRT-PCR QS R  nucleotide binding-leucine rich repeat Non-Race Specific Disease Resistance 1 nuclear export signal nuclear factor kappa-light-chain-enhancer of activated B cells Nod-like Receptor or nucleotide binding and leucine-rich repeatcontaining R protein nuclear localization signal or sequence Nucleotide oligomerization domain NONEXPRESSER OF PR GENES 1 PRP Nineteen Complex nuclear pore subcomplex contributes to proper kinetochore functions nucleoporin 214kDa that functions in CRM1-Dependent Nuclear Protein Export nucleoporin 88kDa that functions in CRM1-Dependent Nuclear Protein Export nucleoporin 96kDa (often known by the name of its yeast homolog Nup145C); its Arabidopsis homolog is MOS3 (also known as SAR3) oospores optical density a viral-coded F-box protein that function in suppressing PostTranscriptional Gene Silencing (PTGS; an important antiviral defence system in plants) a 50 kDa TMV helicase fragment that induces the N-mediated HR in tobacco Phytoalexin Deficient 4 sodium dodecyl sulfate polyacrylamide gel electrophoresis pathogen-associated molecular pattern Phosphoenolpyruvate carboxylase Plasma membrane pathogenesis-related Pleiotropic Regulatory Locus 1 pattern recognition receptor Pseudomonas syringae pv. maculicola strain ES4326 Pseudomonas syringae pv. tomato strain DC3000 PAMP-triggered immunity PLANT U-BOX Pathovar Quantitative reverse transcriptase PCR quorum sensing Resistance  xvi  RAR1 RBS RBX RGA1 RHC1 RIN2 RIN3 RING RING1 RLK RNAi RPM1 RPP2 RPP4 RPP7 RPS2 RPS4 RPS5 RRS1 RT-PCR Rx RxLR SA SAG101 SAR SAR3 SCF SET SGT1 SKP1 SNC1 snc1-r1 snc1-r3 SON1 SPL11  REQUIRED FOR MLA12 RESISTANCE 1 Rubisco Small Subunit terminator RING box protein 1; also known as Regulator of Cullin 1 (ROC1) REPRESSOR OF GA 1; a member of the DELLA protein family RING-H2 finger C1 RPM1-interacting protein 2 RPM1-interacting protein 3 Really Interesting New Gene a RING finger domain protein with E3 ligase activity receptor-like kinase RNA interference RESISTANCE TO P. SYRI GAE PV MACULICOLA 1 RECOGNITION OF PERO OSPORA PARASITICA 2 RECOGNITION OF PERO OSPORA PARASITICA 4 RECOGNITION OF PERO OSPORA PARASITICA 7 RESISTANT TO P. SYRI GAE 2 RESISTANT TO P. SYRI GAE 4 RESISTANT TO P. SYRI GAE 5 RESISTANT TO RALSTO IA SOLA ACEARUM 1; also known as AtWRKY52 or SENSITIVE TO LOW HUMIDITY 1 (SLH1) reverse transcriptase PCR Resistance against potato virus X a motif containing Arg, any amino acid, Leu, Arg, and is located on the N-terminal of secreted oomycete effectors Salicylic acid senescence-associated gene 101 systemic acquired resistance SUPPRESSOR OF AUXIN RESISTANCE 3; also known as MOS3 or AtNup96 Skp1-Cullin-F-box Drosophila Su(var)3-9, Enhancer of zeste [E(z)], and Trithorax Suppressor of G2 Allele of SKP1 Suppressor of Kinetochore Protein 1 suppressor of npr1, constitutive, 1 the revertant mutant of snc1 that has 10 nucleotides deleted in the first exon of S C1 the revertant mutant of snc1 that has the entire RPP4 cluster on chromosome 4 deleted suppressor of nim1-1 spotted leaf 11  xvii  SPX  SR protein SRFR1 STAND TAC clone TCV T-DNA TGA2 TGN TIR TIR1 TMV TN TPL TPR1 TREX TRN-SR Ub UBA1 UBC UBP UPS VIGS VIP1 VirE2 VirF WD40 repeat  WRKY domain WT Xa21 XB3 Xoo XPO1  SYG1/Pho81/XPR1; a protein domain usually exists at the Nterminal of a protein that has function in G-protein associated signal transduction serine-arginine rich proteins SUPPRESSOR OF RPS4-RLD 1 signal transduction ATPases with numerous domains transformation competent artificial chromosome; a modified version of bacterial artificial chromosome (BAC) Turnip crinkle virus transfer DNA TGACG Sequence-Specific Binding Protein 2 trans-Golgi network Toll/interleukin-1 receptor transport inhibitor response protein 1 Tobacco mosaic virus trailing necrosis TOPLESS TOPLESS-RELATED 1 TRanscription-EXport Transportin-SR ubiquitin E1 ubiquitin-activating enzyme 1 E2 ubiquitin-conjugating enzyme ubiquitin-specific protease ubiquitin-26S proteasome system virus-induced gene silencing VirE2-interacting protein a type IV secreted protein from Agrobacterium that binds to singlestranded DNA and facilitate delivery of T-DNA to plant cells an Agrobacterium type IV secreted F-box protein also known as the WD or beta-transducin repeat; a short structural motif of approximately 40 amino acids, often terminating in a tryptophan-aspartic acid (W-D) dipeptide a 60-amino acid-protein domain defined by the conserved sequence WRKYGQK together with a zinc-finger-like motif wild type A rice resistance locus that confers disease resistance to Xanthomonas oryzae pv. Oryzae XA21-binding protein 3 Xanthomonas oryzae pv. oryzae Exportin 1  xviii  1  Literature Review – Introduction  1.1  Plant Immunity  1.1.1  Non-Host Resistance  Plants are constantly confronting pathogen challenges in nature. However, most of the plants are healthy most of the time; fatal diseases that kill an entire plant species are rare. This is due to the fact that over the long evolutionary period, plants have evolved sophisticated mechanisms to fight against a broad spectrum of pathogens. The two types of plant-pathogen interactions are non-host and host. Non-host resistance is the resistance shown by an entire plant species against a specific pathogen. In the non-host interaction, plants have physical or chemical barriers, for example, the cuticle, plant cell walls, or antimicrobial secondary metabolites, present on the plant surface that prevent or stop pathogens from initiating an infection (Fan and Doerner, 2012). A number of studies also indicate that certain types of non-host defence might be active and involve vesicle trafficking (Collins et al., 2003; Lipka et al., 2005; Stein et al., 2006; Bednarek et al., 2009). The non-host defence, the molecular mechanisms of which remain largely unknown, provides robust protection to the entire plant species to all isolates of a pathogenic microbial species (Nurnberger and Lipka, 2005; Hardham et al., 2007).  1.1.2  Host Immunity  1.1.2.1 Recognition of Pathogens  In the host-pathogen interactions, pathogens are able to overcome and breach the physical or chemical barriers of the host plants. However, the attempted invasion can trigger a defence mechanism called the basal defence. The plants use trans-membrane pattern recognition receptors (PRRs), which are often receptor-like kinases (RLKs) to detect broadly conserved and indispensable components of microbe/pathogen-associated molecular patterns (MAMPs/PAMPs). Well-known examples of MAMPs are prokaryotic elongation factor-Tu (EF-Tu), flagellin, and lipopolysaccharide (LPS) of Gram-negative bacteria, glucans and glycoproteins from oomycetes, and chitin of fungal pathogens (Boller and Felix, 2009). Over the past ten years, knowledge has been accumulated on a few PAMPs from pathogens and cognate plant receptors that can recognize them (Segonzac and Zipfel, 2011). Well-known PRRs in plants include: the flagellin receptor FLS2 and EF-Tu receptor EFR from Arabidopsis, chitin receptor CERK1 and CEBiP from Arabidopsis and rice, respectively, and rice Xa21 that recognizes Ax21 (activator of Xa21-mediated immunity) from Xanthomonas species and related genera (Monaghan and Zipfel, 2012).  1  Rice Xa21 disease resistance locus that confers resistance to most strains of the Gramnegative bacterium Xanthomonas oryzae pv oryzae (Xoo) that causes bacterial blight has been identified almost 20 years ago (Song et al., 1995). Xa21 encodes a receptor-like kinase consisting of leucine-rich repeats (LRRs) in the extracellular domain and a serine/threonine kinase in the intracellular domain. Later it was found that Xa21 recognizes a type I secreted sulfated peptide derived from the Ax21 (activator of Xa21-mediated immunity) (Lee et al., 2009). Secreted mature Ax21 acts as a quorum sensing (QS) factor in Xoo that is important for motility, biofilm formation and virulence (Han et al., 2011). Another well-studied PRR-PAMP pair is FLS2 that has been identified in nearly all plant species tested so far, and flagellin, which is the building block of flagellum, an important structure for bacterial motility. FLS2 from the model plant Arabidopsis and rice Xa21 are both RLKs, and share sequence and structural similarities. FLS2 has extracellular LRR domain, a single membrane-spanning domain and an intracellular serine/threonine kinase domain. The extracellular LRR domain of FLS2 recognizes the presence of bacterial flagellin and activates defence responses through a series of mitogen-activated protein (MAP) kinase cascades via its kinase domain (Gomez-Gomez et al., 2001; Dunning et al., 2007).  1.1.2.2 Signalling Downstream of PRR  Perception of signature PAMPs by plant cell surface PRRs and activation of downstream defence responses is a quick process including ion fluxes across the plasma membrane (e.g. increase in Ca2+ influx) in 30 seconds to 2 minutes, oxidative burst within a few minutes, signal transduction via MAP kinase cascade and defence gene activation, callose deposition, stomatal closure and increased accumulation of plant defence hormone salicylic acid (Tsuda et al., 2008; Nicaise et al., 2009). Using flagellin, one of the best characterized PAMPs, more and more mechanistic details are unveiled about the signalling components and events downstream of PAMP-triggered immunity (PTI; [Block and Alfano, 2011; Segonzac and Zipfel, 2011]). The described receptor-PAMP recognition triggers the defence responses to stop pathogens from colonization. Although the responses are relatively quick, the resistance activated by plants is relatively weak. This type of defence response is exerted regardless of species or races of pathogens. Because of its weak defence response, plants may develop disease symptoms under some conditions (Ingle et al., 2006; Bittel and Robatzek, 2007; Ma and Berkowitz, 2007; Underwood et al., 2007).  1.1.2.3 Suppression of PAMP-Triggered Immunity by Pathogen Effectors  Over evolutionary time, successful pathogens have acquired the ability to overcome PAMPTriggered Immunity (PTI), a basal level of plant defence, by secreting virulent effectors and mounting successful invasion. For example, one of the studies on suppression of host PTI by a pathogen effector comes from the bacterial type III secreted effector, AvrPtoB (Munkvold and Martin, 2009). AvrPtoB is one of the effectors from Pseudomonas syringae. It contains a Cterminal E3 ligase domain that ubiquitinates plant PRRs FLS2 and CERK1, a fungal chitin  2  receptor that also plays a role in immunity against bacterial pathogens , and promotes their degradation (Gohre et al., 2008; Gimenez-Ibanez et al., 2009), leading to successful colonization.  1.1.2.4 Recognizing Effectors by Host Resistance Proteins  In the “arms race” between plants and pathogens, the selective pressure on host plants leads to the co-evolution of plant Resistance (R) proteins, which specifically recognize pathogen effectors, and trigger race-specific disease resistance, known as R protein-mediated resistance (the recognized effectors are also called Avirulent (Avr) factors as their presence can now trigger host immunity; [Chisholm et al., 2006; DeYoung and Innes, 2006; Jones and Dangl, 2006]). R protein-mediated resistance is believed to be an amplified version of the basal resistance (Tao et al., 2003; Thilmony et al., 2006; Truman et al., 2006). It exerts robust responses to fight against invading pathogens. In most cases, specific recognition of a pathogen attack triggers a series of local defence responses including generation of an oxidative burst, induction of ion exchange reaction, activation of defence gene expression, and ultimately culminates in a hypersensitive response (HR), a robust defence response that is caused by rapid programmed cell death at the site of infection (Nurnberger and Scheel, 2001; Greenberg and Yao, 2004). While the local plant tissue is battling against pathogens by R protein-mediated resistance, a danger signal is sent out to distal tissues to develop systemic resistance, known as systemic acquired resistance (SAR). As a result, the entire plant becomes more resistant to secondary infections (Durrant and Dong, 2004).  1.1.3  Plant R Proteins  R protein-mediated resistance is one of the most effective defence mechanisms in plants. The genetics of this kind of defence mechanism was first described by H. H. Flor in the 1940’s. Flor’s gene-for-gene model stated that the resistance phenotype can only be observed when the host plant carries a dominant Resistance (R) gene and the infecting pathogen carries a cognate dominant Avirulent (Avr) gene. The products of R genes probably recognize, either directly or indirectly, the presence of specific Avr gene products produced by the pathogen; this specific RAvr recognition event, in turn, through complex signal transduction, elicits defensive responses observed as the resistant response. Over time, plants evolved a large collection of structurally similar R proteins, which can recognize a wide array of Avr effectors (Bergelson et al., 2001). With a few exceptions, most plant R proteins belong to the intracellular nucleotide-binding leucine-rich repeat (NB-LRR) protein family. They are structurally very similar to animal Nucleotide Oligomerization Domain (NOD) immune receptors, and are referred to as Nod-like receptors (NLRs; or nucleotidebinding domain leucine-rich repeat containing proteins (Ting and Davis, 2005)). Genome sequence analyses revealed that there are 149 NB-LRR encoding genes in the Arabidopsis genome (Meyers et al., 2003). The presence of the NB domain suggests that R protein activity may require ATP/GTP binding and/or hydrolysis which could result in conformational changes that regulate downstream signalling (Jiang and Wang, 2000; Harton et  3  al., 2002). The variable 20-30 amino acids-long leucine-rich motifs, which are present in proteins ranging from viruses to eukaryotes, have been known for providing structural framework for protein-protein interactions (Kobe and Kajava, 2001). The amino-termini of plant NB-LRR proteins are thought to be involved in activating downstream signalling pathways. Plant NBLRR proteins can be divided into two subgroups based on their amino-termini. One group is the coiled-coil (CC) NB-LRR proteins that have an α-helix-rich N-terminus predicted to form coiled-coil structures. The other group is the TIR-NB-LRR class whose N-terminal domain has significant similarity to the Drosophila Toll and human interleukin-1 receptors (TIR) (Jebanathirajah et al., 2002; DeYoung and Innes, 2006). The wide range of the amino-terminal domains allows NB-LRR proteins to interact with different partners and to activate various signalling pathways (Aarts et al., 1998; Inohara et al., 2005).  1.1.3.1 R Protein Structure and Regulation  R protein-mediated plant immunity is a robust defence mechanism; however, an un-controlled defence response is detrimental to plant development and has a high fitness cost (Purrington, 2000; Heil and Baldwin, 2002; Heidel et al., 2004). Experimental evidence suggests that NBLRR proteins are held in an auto-inhibited state through intra-molecular interactions (Rairdan and Moffett, 2006; Takken and Tameling, 2009; Du et al., 2012). Furthermore, proper R protein folding and stability are critical for its function (Kadota et al., 2010; Zhang et al., 2010). The NB domain containing proteins are a subclass of the STAND superfamily proteins (Signal Transduction ATPases with Numerous Domains). Proteins of the STAND family are known to be involved in many biological processes including immunity, apoptosis (e.g. Apaf1 and CED4) and transcriptional regulation (Danot et al., 2009). At present, no crystal structure of a plant NB domain is available. With the help of structurally homologous proteins, Apaf1, CED4 and several STAND ATPases, it was predicted that plant NB domain forms a compact globular structure when the protein is in its resting state (Takken et al., 2006; Takken and Tameling, 2009). The C-terminal LRR domain of plant NB-LRR proteins is the most variable region of the protein (McHale et al., 2006). Because of its highly rich polymorphisms (e.g. repeat lengths and non-canonical LRR motifs) among homologous NB-LRR proteins, it is hard to construct an accurate structural model based on a single template. Fortunately, with the abundant plant LRR structures in the protein database, the composite model of LRR structure is deduced to form a horseshoe-like shape (Sela et al., 2012). Recently, the crystal structures of the CC domain for the NB-LRR R protein Mla10 from barley (Maekawa et al., 2011) and the TIR domain of the NB-LRR protein L6 from flax (Bernoux et al., 2011) have been solved. Each CC domain forms a helix-loop-helix structure and then two CC domains intertwine to form a tightly rod-shaped homodimer. The crystal structure of TIR domain of L6 shows a globular shape similar to the structure of the Arabidopsis protein consisting only of a TIR domain, AtTIR (At1g72930; Chan et al., 2010). Based on the crystal structures and the NB-LRR R protein mutant studies, it is believed that in the absence of pathogens, the NB-LRR proteins are kept in an auto-inhibited state by intra-molecular interactions between the different domains, but are, at the same time, exquisitely competent for detecting pathogen effectors. Release from inhibition by an effector or endogenous stress  4  stimulus triggers a series of conformational changes to initiate downstream defence signalling cascades (Takken et al., 2006; Takken and Tameling, 2009). Besides the auto-inhibition by the structural constraints of the R proteins, these immune receptors are also regulated at two levels: 1) chaperone-assisted protein folding/maturation, and 2) control of NB-LRR levels by targeted protein degradation. Genetic screens that looked for components that are essential for R protein-mediated resistance uncovered a protein complex with three core members, RAR1 (Required for Mla12 Resistance 1), SGT1 (Suppressor of the G2 allele of SKP1) and HSP90 (Heat Shock Protein 90) as key players in regulating NB-LRR protein stability and activity (Shirasu et al., 1999; Warren et al., 1999; Austin et al., 2002; Azevedo et al., 2002; Muskett et al., 2002; Tör et al., 2002; Hubert et al., 2003; Takahashi et al., 2003). However, the mechanistic functions of the RAR1-SGT1-HSP90 complex in maintaining NB-LRR protein stability and activity remain elusive. The involvement of SGT1 in R protein stability and the involvement of yeast SGT1 in Skp1-Cullin-F-box protein (SCF) ubiquitin ligases that target regulatory proteins for degradation (Kitagawa et al., 1999) suggest a route of R protein regulation through protein degradation.  1.1.3.2 R Protein Signalling  Several components have been shown to be involved in signalling downstream of an activated R protein. They are EDS1 (Enhanced Disease Susceptibility 1) and PAD4 (Phytoalexin Deficient 4) downstream of TIR-type R proteins (Wiermer et al., 2005) and NDR1 (Non-Race Specific Disease Resistance 1) in the CC-type R protein mediated resistance (Knepper et al., 2011) (Figure 1.1). EDS1 and its interacting partner PAD4 are essential components of both basal and TIRNB-LRR R proteins-mediated resistance in Arabidopsis (Feys et al., 2001). EDS1 encodes a protein whose amino-terminus has similarities to eukaryotic lipases and it functions upstream of plant defence hormone salicylic acid (SA; Falk et al., 1999). PAD4, identified in a screen for phytoalexin deficiency in response to pathogen attack, encodes another lipase-like protein. PAD4 was also shown to have an important function in SA signalling (Jirage et al., 1999). In addition to their roles in signal transduction, EDS1 and PAD4 interaction is important in the positive feedback regulation of SA accumulation (Feys et al., 2001; Wiermer et al., 2005). NDR1 was originally identified as a component in resistance against the virulent bacterial pathogen Pseudomonas syringae pv tomato DC3000 (Pst DC3000) in Arabidopsis (Century et al., 1997). Although the biochemical and cellular function of NDR1 remains elusive, several CCtype of NB-LRR proteins’ function require NDR1, including RPS2, RPMl, RPS5 (Century et al., 1997; Knepper et al., 2011).  5  Figure 1.1: Signaling components downstream of TIR-type and CC-type proteins.  B-LRR R  6  1.2  Dissecting Plant Immunity Using snc1 and Modifiers of snc1 in Arabidopsis  1.2.1  snc1: A Unique Gain-of-Function Mutant of a TIR-Type NB-LRR R Protein  Genetic analysis of Arabidopsis mutants with impaired SAR response has led to the identification of a positive regulator of SAR, PR1 ( on-Expresser of PR-1) (Cao et al., 1994; Cao et al., 1997). Mutations in the PR1 gene abolish SA-induced Pathogenesis-Related (PR)gene expression and resistance to pathogens, whereas overexpression of PR1 to enhance resistance to pathogens showed no obvious negative effects (Cao et al., 1998; Yuan et al., 2007). A unique gain-of-function mutant, suppressor of npr1-1, constitutive 1 (snc1) constitutively expresses PR genes and exhibits resistance against two virulent pathogens: the bacterial pathogen, Pseudomonas syringae pv maculicola ES4326 (Psm ES4326), and the oomycete pathogen, Ha Noco2 (Li et al., 2001) in the npr1 mutant background. SNC1, an R protein of the TIR-NB-LRR class, is a member of the Resistance to Peronospora parasitica 4 (RPP4) R gene cluster on chromosome IV in Arabidopsis ecotype Columbia. In snc1, a single amino acid substitution in the linker region between the NB and LRR domains renders the SNC1-mediated signal transduction constitutively active in the absence of pathogens (Zhang et al., 2003). Because snc1 plants direct most of their energy toward defending against a nonexisting pathogen, they have limited resources for other biological processes (Purrington, 2000; Heil and Baldwin, 2002; Heidel et al., 2004). As a result, the snc1 plants have very unique morphological phenotypes, including small stature and curly leaves. In addition, a high level of SA was also detected in snc1, and it is partially responsible for the snc1 phenotypes (Zhang et al., 2003a). Epistasis analysis of this dominant mutation showed that there are several important components of SNC1-mediated immunity, including EDS1 and PAD4 (Zhang et al., 2003). The first plant R gene was cloned about twenty years ago (Johal and Briggs, 1992; Martin et al., 1993), yet little is known about the signalling components downstream of activated R proteins. To gain more insights on how danger signals are transduced from an activated R protein to downstream defence activation, a snc1 suppressor screen was conducted.  1.2.2  The MOS Screen  Because of the distinct morphology of snc1 and constitutive activation of defence response in this mutant that mimics an activated R protein-mediated resistance in the absence of a pathogen, snc1 has become an extraordinary tool for dissecting the signalling required for defence activation. Genetic screens were performed to search for suppressors of snc1. Several mutagenesis methods including radiation mutagenesis by fast neutron bombardment, chemical mutagenesis by ethyl methanesulfonate (EMS) and Agrobacteria-mediated T-DNA mutagenesis were carried out in the snc1 mutant background to screen for mutants that suppress or block snc1 autoimmune phenotypes. In the primary screen, putative mutants that lost the snc1 small stature and stunted growth morphology, and restore close to wild type morphology, were selected. To validate that the  7  putative mutants that passed the primary screen are indeed defence-related mutants, the secondary screen was conducted to look for mutants that lost the enhanced PR gene expression and constitutive resistance against the virulent pathogen Ha Noco2. From these screens, several mutant alleles of PAD4 were obtained, suggesting that the screens were successful. A total of fifteen mos (modifier of snc1) mutants were identified from the screens. These mos lines resulted in the identification of genes/proteins with functions in: 1) epigenetic regulation of S C1 transcription, 2) RNA processing and splicing, 3) nucleo-cytoplasmic trafficking of RNA molecules and proteins, 4) transcriptional regulation of defence related genes, and 5) protein modifications. The diverse array of MOS proteins identified from the snc1 suppressor screens demonstrates the spatial and temporal complexity of plant defence signalling pathways required to activate robust and finely controlled resistance responses.  1.2.3  Modifiers of snc1 (MOSes)  1.2.3.1 Epigenetic Regulation of S C1 Transcription: MOS1  MOS1, the first MOS identified, is a HLA-B Associated Transcript 2 (BAT2) domain-containing protein that is conserved in plants and animals (Li et al., 2010b); none of the BAT2-containing proteins have been previously functionally characterized. Analysis of snc1 transcription level in mos1 revealed that snc1 transcript is greatly reduced when MOS1 is mutated, and this suppression of snc1 expression by mos1 can be released in the Decrease in D A methylation 1 (DDM1) mutant background. The ddm1 mutant has drastically reduced levels of DNA methylation, and a change of H3K9 methylation (the ninth lysine residue of histone H3; a transcription repression mark) with H3K4 methylation (transcription activation mark; [Gendrel et al., 2002]). Further analysis revealed that DNA methylation is altered in the upstream region of endogenous S C1 in mos1 mutant background; however, the expression level of snc1 transgene is not affected, suggesting that MOS1 may function in regulating gene expression through chromatin remodelling. The identification and functional studies of MOS1 show that the expression level of R genes is under tight regulation (Li et al., 2010b; Li et al., 2011). Like MOS1, BAT2-containing proteins in other systems could also function in regulating gene expression through chromatin modification.  1.2.3.2 R A Processing/Metabolism and Splicing Machinery: MOS2, MOS3, MOS4, MOS11, and MOS12  a) RNA processing: MOS2 mos2 is a partial suppressor of snc1. Unlike mos1, which has no defects in basal and R protein mediated resistance, mos2 mutant plants are more susceptible to virulent pathogens and are compromised in R protein resistance mediated by RPM1, RPS4, and RPP4 (Zhang et al., 2005). Map-based cloning revealed that MOS2 encodes a nuclear protein that contains a G-patch (glycine-rich nucleic acid binding domain) and two KOW (Kyprides, Ouzounis, Woese) domains.  8  G-patch is a conserved domain that has been shown to mediate RNA-protein interactions (Aravind and Koonin, 1999). KOW, another conserved domain, could function in protein-protein interactions (Steiner et al., 2002). The exact role that MOS2 plays in plant immunity remains elusive; however, the presence of G-patch and KOW domains suggests that MOS2 may function through binding to certain RNA molecules. b) RNA splicing machinery: MOS4 and MOS12 RNA splicing is a process in eukaryotes that modifies nascent pre-messenger RNA (premRNA) molecules by removing introns and adjoining exons to generate mature mRNA molecules for translation. Proper RNA splicing is not only essential for biological functions of a gene, but also generates alternative splice variants for proper spatial and temporal expression of a gene (Kelemen et al., 2013). MOS4 is a conserved nuclear protein in both plant and animal kingdoms (Palma et al., 2007). Its homolog in humans is Breast Cancer-Amplified Sequence 2 (BCAS2). BCAS2 is a member of spliceosome-associated PRP Nineteen Complex (NTC) (Neubauer et al., 1998). Like BCAS2, MOS4 associates with NTC through direct interaction with AtCDC5 (Arabidopsis Cell Division Cycle 5), a key component of the NTC. Like mutation in MOS4, mutation in AtCDS5 can also suppress the auto-immune phenotypes of snc1. Analyses of transcript variants in several alternatively spliced genes in mos4 and atcdc5 mutant backgrounds revealed that splicing patterns of S C1 and RPS4, two TIR-type NLR encoding genes, were altered, whereas the splicing patterns of several house-keeping genes were unaffected (Palma et al., 2007; Xu et al., 2012). This result suggests that MOS4 and AtCDC5 have specific roles in regulating splicing patterns of defence related genes. Another MOS found to be involved in RNA splicing is MOS12 (Xu et al., 2012). MOS12 is a protein with two conserved cyclin domains at the N terminus. Its closest homolog in humans is cyclin L, which is required for pre-mRNA splicing (Loyer et al., 2008). Analysis of transcript variants in mos12 mutant background found that the splicing patterns of S C1 and RPS4 are changed. These changes in splicing pattern are associated with suppression of snc1 autoimmune phenotypes and compromised RPS4-mediated immunity. Immunoprecipitation of MOS12 followed by western blot analysis showed that MOS12 associates with MOS4, consistent with the role of MOS12 in RNA splicing. c) mRNA export: MOS3 and MOS11 Once the transcript of a gene is fully processed, it needs to be translocated from the nucleus to the cytoplasm for translation. This translocation process through the nuclear pore complex, which is highly conserved across eukaryotes, plays an important role in regulation of gene expression (Chinnusamy et al., 2008). Two MOS proteins identified in the suppressor screen, MOS3 and MOS11, are involved in mRNA export from the nucleus. MOS3 (also known as NUP96 or SAR3) is a member of the Nup107-160 nuclear pore sub-complex (Zhang and Li, 2005; Parry et al., 2006). Mutations in MOS3 lead to partial suppression of snc1’s autoimmunity and compromised basal immunity, as well as RPP4-, RPM1-, and RPS4-mediated immunity. In vertebrate and yeast cells, defects in the Nup107-160 complex result in the accumulation of mRNA within the nucleus (Fabre et al., 1994; Dockendorff et al., 1997; Vasu et al., 2001). A similar defect was also observed in mos3/sar3 mutant plants (Parry et al., 2006; Germain et al., 2010).  9  MOS11 is a conserved eukaryotic protein; its homologous human protein is the RNA binding protein CIP29 (Germain et al., 2010). CIP29 is a member of the TREX (TRanscriptionEXport) mRNA export complex (Dufu et al., 2010), which was first identified as a complex that functions in messenger ribonucleoprotein (mRNP) export (Reed, 2003). Like MOS3, mutations in MOS11 lead to accumulation of mRNA within the nucleus (Germain et al., 2010). Epistasis analysis between mos3 and mos11 revealed that MOS3 and MOS11 might function in the same pathway (Germain et al., 2010). It is possible that MOS11 binds to mRNA molecules and facilitates their translocation from the nucleus, where they are generated, to the cytoplasm, where they are translated, through the Nup107-160 nuclear pore complex. Interestingly, although accumulation of poly(A) mRNAs was observed in the nucleus, null mutations of MOS3 and MOS11 are not lethal (Zhang and Li, 2005; Parry et al., 2006; Germain et al., 2010). This suggests that MOS3 and MOS11 may play roles in specifically exporting certain, likely defence related, mRNA molecules. The identification of a large number of MOS proteins with roles in RNA processing and splicing in the snc1 suppressor screen demonstrates the importance of RNA metabolism and translocation of mature mRNA molecules, from the nucleus to the cytoplasm, in plant defence signalling.  1.2.3.3 ucleo-Cytoplasmic Trafficking: MOS6 and MOS14  Another class of MOS proteins identified are those involved in nucleo-cytoplasmic trafficking. MOS6 (Palma et al., 2005) is an essential component of the nuclear import machinery. MOS6 encodes one of eight importin α homologs in Arabidopsis. The function of importin α is to recognize and facilitate the transport of proteins bearing nuclear localization signal (NLS) from the cytoplasm to the nucleus (Lange et al., 2007). One potential function of MOS6 is to recognize and import proteins involved in disease response signalling into the nucleus. An additional MOS that plays a role in nucleo-cytoplasmic trafficking and defence is MOS14 (Xu et al., 2011). MOS14 is a nuclear protein that has high homology to animal Transportin-SR (TRN-SR) proteins. TRN-SR shows amino acid sequence homology to members of the importin β superfamily, and it functions specifically as the nuclear import receptor for serine-arginine rich (SR) proteins, which are important components of the pre-mRNA splicing machinery (Reed and Cheng, 2005). In mos14 background, several SR proteins fail to properly localize inside the nucleus. Also, splicing patterns of two R genes, S C1 and RPS4, whose splicing patterns are important for their functions, are altered in mos14. Altered snc1 and RPS4 splicing patterns in snc1 mos14 and mos14, respectively, all correspond with compromised SNC1- and RPS4-mediated defence responses. Identification of essential components of the nuclear import machinery through the snc1 suppressor screen reveals the importance of nuclear-cytoplasmic trafficking in plant innate immunity.  10  1.2.3.4 Transcriptional Repressor: MOS10  One unique MOS gene identified in the snc1 suppressor screen was MOS10 (also known as TPR1; Topless-Related 1). MOS10 encodes a protein with an N-terminal Lissencephaly type-1-like homology (LisH) domain, a C-terminal to LisH (CTLH) domain and twelve WD (tryptophanaspartic acid)-40 repeat at the C terminus (Zhu et al., 2010). MOS10 is closely related to Topless (TPL). TPL together with TRPs (TOPLESS-related proteins) are thought to be involved in transcription repression of auxin-dependent genes during embryogenesis (Long et al., 2006; Szemenyei et al., 2008). SNC1 is found to associate with MOS10/TPR1, and MOS10/TPR1 represses the expression of negative regulators of immunity, including Defense no Death 1 (D D1) and Defense no Death 2 (D D2) (Zhu et al., 2010). The identification of MOS10/TRP1 suggests that the expression of negative immune regulators needs to be repressed in R proteinmediated immune responses.  1.2.3.4 Protein Modifications: MOS5 and MOS8  mos8, another suppressor of snc1 that completely abolishes resistance against virulent pathogens, identified a gene found to be allelic to Enhanced Resistance to Abscisic acid 1 (ERA1). ERA1 encodes the β subunit of plant farnesyl-transferase (Cutler et al., 1996). Protein farnesylation is a post-translational modification process that prenylates the carboxy-terminus of specific cellular signalling proteins (Sorek et al., 2009). The era1 mutant phenotypes, first described by Pei et al. (1998), have prolonged seed dormancy and stomatal closure due to an enhanced response to abscisic acid (ABA). mos8 plants have enhanced susceptibility to virulent bacterial pathogen Psm ES4326 and oomycete pathogen Ha Noco2, indicating the importance of prenylation in basal resistance. Responses to avirulent pathogens mediated by R proteins of RPM1, RPS4 and RPP4, are partially compromised in mos8, demonstrating the involvement of prenylation in the highly divergent pathogen-specific signalling pathways (Goritschnig et al., 2008). MOS5 encodes UBA1, one of two ubiquitin-activating (E1) enzymes in Arabidopsis (Goritschnig et al., 2007). mos5 mutant plants exhibit somewhat enhanced disease susceptibility, indicating a minor involvement of MOS5 in basal resistance against virulent bacterial pathogens. Also, mutations in MOS5 compromise the RPS2-mediated resistance but not resistance mediated by other R proteins tested (RPM1 and RPS4). This differential susceptibility to avirulent pathogens suggests that ubiquitination pathway mediated by MOS5 is required in activation and downstream signalling of certain R proteins (Goritschnig et al., 2007). The identification of MOS5 in the snc1 suppressor screen, as well as other defence related components of the ubiquitination pathway by other research groups, suggest that protein ubiquitination plays an important role in plant immunity.  11  1.3  Ubiquitination in B-LRR R Protein-Mediated Immunity1  1.3.1  Introduction  Ubiquitination is a common protein modification where the 76-amino-acid ubiquitin (Ub) moiety is covalently attached to the lysine (Lys) residues of a substrate protein. More than 5% of the Arabidopsis proteome is predicted to be involved in the ubiquitination-26S proteasome pathway (Smalle and Vierstra, 2004), suggesting that this pathway plays essential roles in diverse biological processes and cellular signalling. The consequences of ubiquitination vary and often depend on the ubiquitination site of the substrate, the position of the Lys in the Ub moiety being utilized, and the length of the Ub attachments. Monoubiquitination is usually associated with endocytosis or histone modification (Schnell and Hicke, 2003; Umebayashi, 2003; Weissman et al., 2011). By contrast, polyubiquitination with four or more Ubs typically results in the targeting of the substrate for degradation by the 26S proteasome, although it can occasionally activate the protein (Thrower et al., 2000; Pickart and Fushman, 2004; Sun and Chen, 2004). After degradation of the protein substrate by the proteasome, Ubs are recycled through deubiquitinating enzymes (DUBs). DUBs counteract ubiquitination and play a key role in determining the fate and activities of the target substrates. Thus, besides their housekeeping roles, DUBs may potentially regulate signal transduction through monitoring the balance of their ubiquitinated and non-ubiquitinated protein substrates (Komander et al., 2009). The covalent attachment of Ub is a multi-step biochemical reaction performed by an ATP-dependent conjugation cascade involving an E1 (Ub-activating enzyme, UBA), an E2 (Ubconjugating enzyme, UBC), and an E3 (Ub ligase) (Weissman, 2001; Smalle and Vierstra, 2004). Substrate specificity is mainly determined by the E3s, therefore it is not surprising that the Arabidopsis genome encodes only two E1s and 37 E2s, but 1415 E3s (Kraft et al., 2005). The E3s can be further subdivided into six classes depending on their different conserved domains and mode of action (Figure 1.2A and 1.2B). HECT, RING-type, and U-box proteins are simple E3s that can work alone with an E1 and an E2. The transfer of Ub by the RING or U-box E3s is direct and does not involve ubiquitination of the E3, while HECT E3s are ubiquitinated first before transferring the Ub to the substrate. There are also more elaborate E3s that are composed of protein complexes with multiple components that are often Cullin-based (Figure 1.2B) (Vierstra, 2009; Hua and Vierstra, 2011). The best known complex E3s in plant biology contain F-box proteins. In Arabidopsis, there are over 700 F-box protein-encoding genes, which function in almost all biological processes (Somers and Fujiwara, 2009).  1  A version of this section has been published. Yu Ti Cheng and Xin Li. (2012) Current Opinion in Plant Biology 15: 392–399  12  Figure 1.2: Ubiquitination pathway and different classes of E3s. (A) Diagrams of the simple E3s and their different modes of actions. HECT (Downes et al., 2003), RING-type (Kraft et al., 2005; Stone et al., 2005), and U-box (Yee and Goring, 2009) proteins can work alone with the E1 and E2. The transfer of Ub by the RING or Ubox E3s is direct, while that by HECT E3s is indirect. The RING finger (also called zinc finger) domain is stabilized by Zn2+ in coordination with its Cys and His residues, while the U-box is mostly stabilized through salt-bridges and hydrogen bonds. (B) Complex E3s, which are often Cullin-based. The number of different E3-encoding genes predicted in the Arabidopsis genome is in parentheses along with the E3 types (Capron et al., 2003; Gingerich et al., 2005; Lee et al., 2008; Hua et al., 2011).  13  1.3.2  E3s in R Protein-Mediated Immunity  E3s are the major specificity determinants in ubiquitination reactions. A number of E3s are implicated in the regulation of plant immunity (Table 1.1A). These E3s were typically identified from analysis of knockout or over-expression phenotypes of the encoding genes. In most cases, the target proteins of the E3s are unknown which makes it difficult to define the exact roles of these E3s in the regulation of plant defence.  1.3.2.1 Light Regulation of R Protein Stability  Light is required for resistance against turnip crinkle virus (TCV) mediated by the Arabidopsis NB-LRR R protein HRT (Jeong et al., 2010). Analysis of HRT protein levels under different light conditions showed that its stability is regulated by light. HRT proteins are degraded under dark or blue-light induction, resulting in susceptibility to TCV. Blue-light-dependent HRT degradation can be blocked by the proteasome inhibitor MG132, indicating that the degradation of HRT is 26S proteasome-specific. Although HRT interacts with the E3 ligase COP1, the exact role of COP1 in HRT1 degradation remains to be determined. Regulation of the HRT levels by protein degradation raises interesting questions on whether other plant growth parameters, such as humidity and temperature, could also affect the stability of NB-LRR R proteins.  1.3.2.2 F-Box Protein ACIF1 in R Protein-Mediated Immunity  ACRE189/ACIF1 is an F-box protein with LRR repeats identified from the Avr9/Cf-9 Rapidly Elicited (ACRE) screen in tomato. It was shown to be recruited to Skp1-Cullin-F-box (SCF) E3 ubiquitin ligase complexes. Silencing of tobacco ACIF1 suppresses the HR responses by various elicitors such as Avr9, Avr4, AvrPto, Inf and the p50 helicase of Tobacco mosaic virus. Silencing of ACIF1 in tomato attenuates Cf-9-dependent HR, but not Cf-9-mediated resistance, suggesting that ACIF1 targets a negative regulator of HR for degradation (van den Burg et al., 2008). Future identification of the target protein of ACIF1 may help us better understand how HR is activated during R protein-mediated defence responses.  1.3.2.3 MAC3A/MAC3B in the Splicing of R Genes  Arabidopsis MAC3A and MAC3B are two redundant U-box E3 ligases homologous to yeast and human PRP19, implicated in mRNA splicing. MAC3 is a core member of the MOS4-associated complex (MAC) containing MOS4, AtCDC5, PRL1, MAC5 and other proteins (Monaghan et al., 2009). Knocking out both MAC3A and MAC3B phenocopies mos4, and not only suppresses autoimmunity mediated by snc1, but also attenuates resistance mediated by other R proteins. The MAC was recently found to associate with MOS12, a cyclin L homolog that is critical for  14  splicing (Xu et al., 2012). Splicing patterns of TIR-NB-LRR-type R genes S C1 and RPS4 are altered in mos12-1, mos4, Atcdc5 mutants, as well as mac3a mac3b, indicating that MOS12 and the MAC regulate proper splicing of target R genes. How the MAC3 E3 controls R gene splicing remains unclear. Future identification of the MAC3 targets will help us illuminate its role in splicing regulation.  1.3.2.4 Other E3s  Arabidopsis BAH1 and Pepper RING1 (CaRING1) are two RING-type E3s recently shown to be involved in regulating plant immunity (Lin et al., 2008; Lee et al., 2011). However, their mode of action and therefore their contribution to R protein-mediated resistance remains to be determined. CaRING1 exhibits E3 ligase activity and localizes to the plasma membrane. It is induced by Xanthomonas infection. VIGS silencing of CaRI G1 causes enhanced susceptibility, reduced Pathogenesis-Related (PR) gene expression and decreased salicylic acid accumulation, while over-expression of CaRI G1 enhances resistance to both Pseudomonas and oomycete pathogens. These data suggest that the CaRING E3 probably targets a negative regulator of defence for degradation. When CaRI G1 is silenced, the negative regulator accumulates and causes enhanced susceptibility (Lin et al., 2008; Lee et al., 2011). BAH1 encodes an E3 ligase with RING and SYG1/Pho81/XPR1 (SPX) domains of unknown function. It was identified from a forward genetics screen searching for mutants hypersensitive to benzoic acid, which was suggested to contribute to Isochorismate Synthase 1 (ICS1)-independent SA synthesis. The bah1 mutant plants accumulate higher SA after bacterial infection and are more resistant to pathogen infections. SA accumulation in bah1 is only partly dependent on ICS1 (Yaeno and Iba, 2008). So far, there is no biochemical data supporting its E3 ligase role. Whether it targets a positive regulator of SA synthesis for degradation remains to be determined.  1.3.2.5 Components Associated with E3: SRFR1 and SGT1 in Stability Control of B-LRR R Proteins  SRFR1 is a protein involved in the regulation of NB-LRR R protein-mediated defence responses (Kim et al., 2010; Li et al., 2010a; Bhattacharjee et al., 2011). The srfr1 mutant plants display constitutive defence responses. The constitutive defence responses in srfr1 can be largely suppressed by loss-of-function mutations in S C1. SRFR1 associates with SNC1, RPS4 and RPS6 in planta (Kim et al., 2010; Li et al., 2010a; Bhattacharjee et al., 2011). In srfr1 mutants, levels of multiple NB-LRR R proteins, including SNC1, RPS2 and RPS4, are increased (Li et al., 2010a), suggesting that SRFR1 functions in the negative regulation of NB-LRR R protein accumulation. SGT1 was originally identified as a co-chaperone of HSP90. The HSP90-RAR1-SGT1 chaperone complex is required for proper folding and accumulation of NB-LRR R proteins (Shirasu, 2009). Surprisingly, a deletion mutant of SGT1b can suppress the reduced accumulation and loss of function of the NB-LRR R protein RPS5 in rar1 (Holt et al., 2005).  15  SGT1 also interacts with SRFR1 (Li et al., 2010a). Like in srfr1 mutants, the SNC1 protein level is similarly increased in sgt1b, suggesting that SRFR1 and SGT1 function together to negatively regulate the SNC1 protein levels (Li et al., 2010a). In yeast, SGT1 is a member of the SCF complex (Kitagawa et al., 1999). SGT1 was also found to associate with components of the SKP1-Cullin1-F-box (SCF) complex in plants (Liu et al., 2002). Thus, it is likely that SGT1 and SRFR1 serve as chaperones or scaffolds in the SCF complex to target a group of R proteins. They may also be critical in determining the substrate specificity of SCF complex through their protein-protein interaction interface.  1.3.3  E1s and E2s in R Protein-Mediated Immunity  Arabidopsis has two E1s, UBA1/MOS5 and UBA2. The mos5 mutant was identified in a suppressor screen of snc1 (Goritschnig et al., 2007). It is required for snc1-mediated defence responses. The mos5 mutant plants also have defects in resistance specified by the NB-LRR R protein RPS2, and display enhanced disease susceptibility. While uba2 single mutant plants have no obvious phenotypes, the mos5 uba2 double mutant is lethal, indicating that UBA1 and UBA2 have partially redundant functions. In the Arabidopsis genome, there are 37 E2s. No individual E2s have been identified to be required for the regulation of plant immunity, suggesting high levels of redundancy among these E2 enzymes. A requirement for MOS5 in resistance mediated by SNC1 suggests the existence of at least one E3 functioning as a positive regulator of defence responses in snc1. It either targets a key negative regulator(s) for degradation or activates a positive regulator by mechanisms like monoubiquitination. Since E1 participates in a large number of ubiquitination reactions, mos5/uba1 probably affects the stability of many proteins targeted by different E3s.  1.3.4  DUBs in R Protein-Mediated Immunity  In Arabidopsis, the 27 ubiquitin-specific proteases (UBPs) form one of the largest classes of deubiquitinating enzymes (DUBs) (Yan et al., 2000). Like the E2s, they fall into distinctive subfamilies of two to five members, suggesting a high level of redundancy. Only one pair of UBPs, UBP12 and UBP13, have been implicated in plant immunity (Ewan et al., 2011). Loss of both UBP12 and UBP13 leads to seedling lethality, indicating a crucial role for these proteins in plant growth and development. In Arabidopsis, the RNAi-co-silenced UBP12/UBP13 plants exhibit enhanced PR gene expression and disease resistance against virulent Pseudomonas bacteria. In tobacco, silencing the UBP12 homolog tUBP12 leads to increased Cf-9-mediated HR, while overexpression of AtUBP12 or tUBP12 suppresses the HR response. These data suggest that UBP12/13 has a conserved function in regulating plant defence responses. The targets of UBP12/13 that are involved in regulating plant defence remain to be determined. Since UBPs de-ubiquitinate their targets, reduction of the activity of UBP12/13 should lead to increased ubiquitination and degradation of target proteins. Thus, the target proteins of UBP12/13 are most likely negative regulators of plant immunity. Because the  16  ubiquitinated form of a target sometimes is the active form of the protein, it is also possible that UBP12/13 is involved in de-ubiquitination of a positive regulator of plant immunity.  1.3.5  Conclusions and Perspectives  In recent years, ubiquitination has emerged as one of the key mechanisms involved in regulating NB-LRR R protein-mediated plant defence responses. At the level of the immune receptor, control of the stability of NB-LRR proteins by SCF-mediated protein degradation appears to be critical for preventing over-accumulation of the receptors and constitutive activation of immune responses without the presence of pathogens. Downstream of plant R proteins, increasing evidence suggests that ubiquitin-26S proteasome system (UPS) is also critical for both positive and negative regulation of defence responses. As ubiquitination-mediated protein degradation leads to rapid changes in protein levels in response to stimuli, it could be used to regulate the stability of many downstream components of NB-LRR proteins. Among the 1415 E3s in Arabidopsis, most are still without an assigned biological function, perhaps due to redundancy and/or subtle E3 mutant phenotypes that are difficult to observe. Many of these E3s may potentially be involved in plant immunity. Future research using targeted reverse genetics approaches and carefully-designed novel forward genetic screens may enable us to find these elusive E3 regulatory components of plant immunity and decipher how they control the defence output in response to pathogen attack. As always, one of the biggest challenges is to find the protein substrates of the E3s involved in plant immunity. New methods, such as global protein stability profiling (Yen and Elledge, 2008), can potentially be adapted for use in plants to address this predicament.  1.3.6  Manuscript Acknowledgements  We cordially thank members of Dr. Jane Parker’s laboratory (Servane Baufumé, Katharina Heidrich and Dr. Jane Parker), Dr. Yuelin Zhang and Ms. Kaeli Johnson for careful reading of the manuscript. Research in the authors’ laboratory is supported by Natural Sciences and Engineering Research Council (NSERC) Discovery grant program from Canada and the William Dewar Cooper Endowment Fund of UBC Botany Department.  17  Table 1.1: List of E3 ubiquitin ligases from plants and pathogens that have been shown to play roles in plant immunity. a) Plant E3s that have been shown to be involved in ETI. PM: Plasma membrane, TGN: transGolgi network. Name  Type of E3  CMPG1/ACRE74  Substrates  Localization References  U-box  Positive (+) or negative (-) regulation +  RHC1  RING-type  +  PM  DRF1  F-box  +  ACIF1/ACRE189  F-box  +  RIN2/RIN3  RING-type  +  PM  RING1  RING-type  +  PM  PRP19/MAC3  U-box  +  HUB1  RING-type  ACRE276/PUB17/ ARC1 SON1  U-box  +  F-box  −  BAH1/NLA  RING-type  −  COP1  CUL4-RING HRT  −  Nucleus  SPL11  U-box  −  Entire cell  KEG  RING-type  − in ABA signaling  TGN  H2B  +  (GonzalezLamothe et al., 2006; Bos et al., 2010) (Cheung et al., 2007)  (Cao et al., 2008) (van den Burg et al., 2008) (Kawasaki et al., 2005) (Lin et al., 2008; Lee et al., 2011) (Monaghan et al., 2009) (Dhawan et al., 2009) (Yang et al., 2006) (Kim and Delaney, 2002) (Yaeno and Iba, 2008) (Jeong et al., 2010) (Zeng et al., 2004) (Stone et al., 2006; Gu and Innes, 2011)  18  b) Plant E3s that are involved in PTI. Name HP1/DDB1  Type of E3 CUL4-DDB1  Substrates  BBI1  RING-type  +  XB3  RING-type  +  ATL9  RING-type  +  ER  PUB22/PUB23/PUB24  U-box  −  cytosol  PUB12/PUB13  U-box  FLS2  Localization  +/− +  −  References (Liu et al., 2012) (Li et al., 2011)  (Wang et al., 2006) (Berrocal -Lobo et al., 2010) (Trujillo et al., 2008) (Lu et al., 2011)  c) Pathogen E3s or proteins from pathogen that target host E3s to promote disease in the host plant. Name Avr3a  Organism P. infestans  Type of E3/Protein RxLR containing secreted effector protein  AvrPtoB  P. syringae pv tomato  VirF  Agrobacterium  F-box  P0  Polerovirus  F-box  Substrates CMPG1  CERK1, Fen, FLS2  VIP1 VirE2 AGO1  References (Bos et al., 2010; Yaeno et al., 2011) (Gohre et al., 2008; GimenezIbanez et al., 2009) (Tzfira et al., 2004) (Baumberger et al., 2007)  19  1.4  Thesis Objectives  The snc1 suppressor screen has uncovered a number of novel players in plant immunity. The primary aim of this thesis research was to positionally clone and perform functional studies on two MOS mutants, mos7 and mos9, identified in the snc1 suppressor screen. mos7 and mos9 were identified from the same mutagenized snc1 population generated using fast neutron bombardment. By studying the functions that MOS7 and MOS9 play in plant immunity, we hope to gain better insights in how plants, which are sessile organisms, strive for survival by responding rapidly to pathogenic microbial invasions. While studying MOS7 and MOS9, a paper published in the Plant Journal by Dr. Guoying Wang’s group (Gou et al., 2009) attracted our attention. This study described an F-box protein encoding gene, CPR30, which plays a negative role in plant defence. Prior to this study little was known about how stability of plant R proteins is controlled, and there were very few reports on the relationship between ubiquitin-proteasome pathway and plant immunity. The data of Guo et al. (2009) suggested that SNC1 may be a target of CPR30. This interesting finding prompted me to further pursue the role CPR30 plays in plant immunity, and led to the third objective of my thesis research: to understand how S C1 stability is controlled and the function of CPR30 in plant immunity.  20  2  uclear Pore Complex Component MOS7/ up88 is Required for Innate Immunity and uclear Accumulation of Defence Regulators in Arabidopsis2  2.1  Introduction  Innate immunity in plants against microbial pathogen infection is a dynamic process that requires stimulus-dependent spatial and temporal action of its defence regulatory components. One of the most effective disease resistance mechanisms is mediated by resistance (R) proteins. Upon infection, an R protein recognizes a specific pathogen effector (termed Avirulence [Avr] protein) and mounts a fast and robust response leading to a local hypersensitive response, a form of programmed cell death, to restrict pathogen growth and spread (Jones and Dangl, 2006). Many R genes have been cloned and the majority encodes proteins containing NB-LRR domains in which the NB is a central nucleotide binding site and LRRs are C-terminal leucine-rich repeats. There are two subclasses of NB-LRR proteins, varying according to their N termini (Martin et al., 2003; Belkhadir et al., 2004; McHale et al., 2006). TIR-NB-LRR type R proteins carry an N-terminal Toll interleukin receptor (TIR) domain, while the CC-type has a predicted coiled-coil domain (also called leucine zipper domain) at its N terminus. These two NB-LRR classes differ in their initial mode of signalling since TIR-NB-LRR proteins activate resistance and cell death through EDS1/PAD4/SAG101 (for Enhanced Disease Susceptibility1/Phytoalexin-Deficient4/Senescence Associated Gene 101) complexes, whereas CC-NB-LRR proteins commonly use NDR1 (for Non Race-Specific Disease Resistance1) (Century et al., 1997; Aarts et al., 1998; Feys et al., 2005; Wiermer et al., 2005). NDR1 associates with the plasma membrane, while EDS1 interacts with PAD4 and SAG101 in distinct complexes in the cytosol and nucleus (Coppinger et al., 2004; Feys et al., 2005). Downstream of EDS1 and NDR1, pathways converge at the synthesis of the defense hormone salicylic acid (SA), a sufficient and necessary signal for systemic acquired resistance (SAR) (Vernooij et al., 1994). SAR represents systemic responses induced throughout the plant to enhance resistance. NPR1 (for Nonexpresser of PR genes 1) is a key positive regulator of SAR whose monomerization and nuclear accumulation is essential for its activity in stimulating defence gene expression (Cao et al., 1997; Mou et al., 2003; Tada et al., 2008). The detailed biochemical functions of NB-LRR proteins have started to emerge in recent years. They are normally under tight negative control, but upon infection, the release of repression seems to be the driving force for the resistance responses. For example, the Arabidopsis thaliana defence modulator RPM1-interacting protein 4 (RIN4) negatively regulates two different CC-NB-LRR type R proteins, RPM1 and RPS2 (Mackey et al., 2002; Axtell and Staskawicz, 2003; Mackey et al., 2003; Kim et al., 2005). Although most NB-LRR proteins are predicted to be cytosolic (Jones and Dangl, 2006), the CC-NB-LRR class proteins MLA1 and MLA6 localize partially to and function inside the nucleus (Shen et al., 2007). Upon infection, recognition of its cognate fungal effector induces MLA interaction with repressive WRKY 2  A version of this chapter has been published. Yu Ti Cheng, Marcel Wiermer, Hugo Germain, Dongling Bi, Fang Xu, Ana V. Garcia, Lennart Wirthmueller, Charles Despres, Jane E. Parker, Yuelin Zhang, and Xin Li. (2009) The Plant Cell 21:2503-2516.  21  transcription factors, leading to deregulation of downstream defense gene expression. Also, the TIR-type NB-LRR proteins, N in tobacco ( icotiana tabacum) and RPS4 in Arabidopsis, need to accumulate in nuclei to function (Burch-Smith et al., 2007; Wirthmueller et al., 2007). These recent discoveries suggest there may be a general requirement for nuclear localization of R proteins or their downstream signalling components in R-mediated resistance. Previous studies of MOS3 (for Modifier of snc1,3; Zhang and Li, 2005), MOS6 (Palma et al., 2005), and RanGAP2 (Sacco et al., 2007; Tameling and Baulcombe, 2007) reveal the importance of two nucleocytoplasmic trafficking pathways in plant innate immunity: mRNA export and nuclear localization signal (NLS)-dependent nuclear protein import. It is not known whether other nucleocytoplasmic trafficking machineries, such as the one governing nuclear export signal (NES)-mediated nuclear protein export, contribute to plant disease resistance. MOS3/NUP96/SAR3 is required for mRNA export (Dong et al., 2006; Parry et al., 2006), and mutations in MOS3 confer enhanced susceptibility to both virulent and avirulent pathogens. Also, mutations in MOS6, an Importin α homolog responsible for importing proteins with an NLS to the nucleus, compromise plant defense against pathogen infection. RanGAP2, another component of the protein nuclear import machinery, interacts with the NB-LRR protein Rx, and silencing of RanGap2 impairs Rx-mediated resistance (Sacco et al., 2007; Tameling and Baulcombe, 2007). Both MOS3 (Zhang and Li, 2005) and MOS6 (Palma et al., 2005) were identified in a forward genetic screen aimed at finding components that function downstream of R protein activation. In snc1 (for suppressor of npr1-1, constitutive 1), a point mutation resulting in an Eto-K change in the linker region between the NB and LRR of an RPP4 homolog, renders this TIR-type R protein constitutively active without pathogen recognition (Zhang et al., 2003a). As a consequence, snc1 mutant plants are dwarf, accumulate high levels of SA, and exhibit enhanced disease resistance against virulent pathogens (Li et al., 2001; Zhang et al., 2003a). As a TIR-NBLRR protein, snc1 was accordingly found to be fully dependent on EDS1/PAD4, whose nucleocytoplasmic partitioning and complex formation is probably under tight control (Feys et al., 2005; Wiermer et al., 2005). In this study, we report the isolation, positional cloning, and detailed functional analysis of MOS7. A partial loss-of-function mutation, mos7-1, suppresses snc1 autoimmune phenotypes, while complete loss of MOS7 in mos7-2 and mos7-3 mutants causes lethality. In the mos7-1 single mutant, basal defence against virulent pathogens, local resistance conditioned by several TIR- and CC-type NB-LRR R proteins, and SAR responses are impaired. MOS7 encodes a protein homologous to the human Nup88 nucleoporin. In Drosophila melanogaster and human, mutations in Nup88 enhance CRM1 (for Chromosomal Region Maintenance 1; also named Exportin 1; XPO1)-dependent nuclear export of activated NF-κB transcription factors (Roth et al., 2003; Xylourgidis et al., 2006). In this study, we establish that MOS7 is required for appropriate nuclear accumulation of the autoactivated R protein snc1, as well as the downstream defence signalling components EDS1 and NPR1.  22  2.2  Results  2.2.1  Identification of the mos7-1 Mutant  The mos7-1 mutant was identified from a MOS (modifier of snc1) forward genetic screen with fast neutrons, as described earlier (Zhang and Li, 2005). snc1 plants have a stunted stature and curly leaves due to constitutive defense activation (Zhang et al., 2003a). The suppressor screen was designed to search for mutants that resemble wild-type morphology and abolish constitutive pathogen resistance in snc1. mos7-1 snc1 double mutant plants are larger than snc1 plants (Figure 2.1A). In snc1 plants, several Pathogenesis Related (PR) defense marker genes are constitutively expressed. Analysis using RT-PCR showed that PR-1 and PR-2 expression was suppressed in mos7-1 snc1 compared with snc1 (Figure 2.1B). snc1 plants exhibit enhanced resistance against virulent pathogens, including the bacterium Pseudomonas syringae pv. maculicola (Psm) ES4326 and the oomycete pathogen Hyaloperonospora arabidopsidis (H.a.; previously named Peronospora parasitica or Hyaloperonospora parasitica) Noco2 (Zhang et al., 2003a). To determine whether the mos7-1 mutation alters the snc1 autoimmune response, we inoculated mos7-1 snc1 double mutant plants with these pathogens. As shown in Figures 2.1C and D, mos7-1 snc1 double mutants had lost enhanced resistance to both pathogens. Bacterial growth in mos7-1 snc1 was even higher than in wild-type plants (Figure 2.1D). SA levels are elevated in the snc1 mutant (Li et al., 2001). To determine whether mos7-1 affects SA accumulation in snc1, SA was extracted and measured from mos7-1 snc1 plants. As shown in Figures 2.1E and F, levels of free and total SA in mos7-1 snc1 were similar to those of wild-type plants and approximately fourfold lower than in snc1. Therefore, mos7-1 fully suppresses all known autoimmune phenotypes of snc1. When mos7-1 snc1 was backcrossed with snc1, the F1 progeny had snc1 morphology. Of 40 F2 plants, 28 were snc1-like, whereas 12 were wild type–like. The 1:3 wild type to snc1-like ratio (χ2 = 0.53; P > 0.1) together with the F1 phenotype are consistent with mos7-1 being a single, recessive nuclear mutation.  23  Figure 2.1: mos7-1 suppresses the autoimmune responses in snc1. (A) Morphology of five-week-old soil-grown plants of Col, snc1, and mos7-1 snc1. (B) PR gene expression in mos7-1 snc1. RNAs were prepared from three-week-old plants grown on MS media and reverse transcribed to obtain total cDNA. The cDNA samples were normalized by real-time PCR using Actin1. PR-1, PR-2, and Actin1 were amplified by 31 cycles of PCR using equal amounts of total cDNA, and the products were analyzed by agarose gel electrophoresis with ethidium bromide staining. (C) Two-week-old soil-grown seedlings were inoculated with Ha Noco2 at a concentration of 50,000 conidia per ml of water and the number of conidia was quantified 7 days post inoculation (dpi). Bars represent means of four replicates ± standard deviation (SD). (D) Five-week-old soil-grown plants were infiltrated with Psm ES4326 (OD600=0.0001) and colony forming units (cfu) were quantified at 0 and 3 dpi, respectively. Bars represent means of six replicates ± SD. All data were analyzed by one-way analysis of variance (one-way ANOVA). Different letters indicate statistically significant differences between genotypes (P<0.05). (E) Free and (F) total SA were extracted from five-week-old plants and analyzed by HPLC. Bars represent the average of four replicates ± SD.  24  2.2.2  Map-Based Cloning of mos7-1  A positional cloning approach was used to identify the mutation in mos7-1 leading to the suppression of snc1. To map mos7-1, mos7-1 snc1 in Columbia (Col) ecotype was crossed with Landsberg erecta (Ler) containing the introgressed snc1 mutation, Ler-snc1 (Zhang and Li, 2005). Linkage analysis was performed on 24 F2 plants that had lost the snc1 morphology. The mos7-1 locus was found to have linkage with markers on the top arm of chromosome 5 that unfortunately was not introgressed from Ler to Ler-snc1. Therefore, a population of 1056 F3 plants was generated for fine mapping from F2 progeny that were homozygous for snc1 and heterozygous for mos7-1 from another cross between mos7-1 snc1 and Ler. The mos7-1 mutation was narrowed to the region between markers MOP10 and MJJ3 on chromosome 5 (Figure 2.2A). To identify the molecular lesion in mos7-1, a set of overlapping PCR fragments covering coding sequences in this region were amplified from mos7-1 snc1 and sequenced. Comparing sequences from the mutant with the Arabidopsis genome sequence revealed a 12-bp deletion in the fourth exon of At5g05680 (Figure 2.2 B and C) that leads to an in-frame deletion of four amino acids at the N terminus of MOS7 (Figure 2.3). BLAST analysis showed that MOS7 is related to human Nup88 and Drosophila Mbo (Members only) proteins (Figure 2.3). MOS7 is the only Nup88 homolog in Arabidopsis. The homology between MOS7 and Nup88 and Mbo extends throughout the entire length of the protein. To confirm that MOS7 is At5g05680, a wild-type copy of At5g05680 under the control of its own promoter was transformed into mos7-1 snc1. Among 12 T1 transgenic plants obtained, all displayed snc1-like morphology (Figure 2.2D). Progeny of T1 plants carrying the MOS7 transgene were tested for resistance against Ha Noco2. Constitutive resistance to Ha Noco2 was restored in the transgenic plants (Figure 2.2E), indicating that At5g05680 is able to complement mos7-1 and that MOS7 is At5g05680. Two additional mutant alleles of MOS7 were obtained from the ABRC. mos7-2 (SALK_129301) contains a T-DNA insertion in the third intron and mos7-3 (SALK_085349) has a T-DNA inserted in the sixth exon of MOS7 (Figure 2.2B). We were unable to identify plants that are homozygous for either mos7-2 or mos7-3 from >200 progeny of plants heterozygous for the mutations, indicating that null mutations of MOS7 are lethal. This is consistent with the lethality phenotype of null mbo alleles in Drosophila (Uv et al., 2000). The viability and recessive nature of mos7-1 suggest that it is a partial loss-of-function allele of MOS7.  25  Figure 2.2: Map-based cloning of mos7-1. (A) Map position of the mos7-1 locus on chromosome 5. BAC clones and number of recombinants are indicated. Asterisk indicates the physical location of the mos7-1 locus. (B) Gene structure of At5g05680. The exons are indicated by boxes, and the introns are represented by solid lines. Locations of mos7-1 deletion and T-DNA insertions of mos7-2 (SALK_129301) and mos7-3 (SALK_085349) are indicated. (C) mos7-1 deletion site in the MOS7 gene. Lower and upper case letters indicate intron and exon, respectively. (D) Morphology of wild type Col, snc1, mos7-1 snc1, and a representative transgenic line containing MOS7 transgene driven by its native promoter in snc1 mos7-1. (E) Resistance of Col, snc1, mos7-1 snc1, and a MOS7 complementing line in snc1mos7-1 against Ha Noco2. The infection was rated as follows on 20 plants 7 days after infection by counting the number of conidiophores per infected leaf: 0, no conidiophores on the plants; 1, no more than 5 conidiophores per infected leaf; 2, 6 to 20 conidiophores on a few of the infected leaves; 3, 6 to 20 conidiophores on most of the infected leaves; 4, 5 or more conidiophores on all infected leaves; 5, 20 or more conidiophores on all infected leaves.  26  27  Figure 2.3: Amino acid alignment of MOS7, human up88, and Drosophila up88. Amino acid sequences from Arabidopsis MOS7 (accession number NP_196187), Drosophila DNup88 (Mbo; accession number NP_524330), and human hNup88 (accession number NP_002523) were aligned using ClustalW2 (Larkin et al. 2007). Sequence identities and similarities were shaded using Genedoc. Red bar indicates the 4 amino acids deleted in mos7-1. Identical amino acids are shaded in black, and amino acids with similar properties are shaded in grey.  28  2.2.3  mos7-1 Single Mutant Plants Exhibit Enhanced Disease Susceptibility  To test whether MOS7 contributes to basal defence against virulent pathogens, mos7-1 plants were challenged with Psm ES4326 at a concentration of OD600 = 0.0001. Wild-type plants usually develop no disease symptoms at this low dose; however, subtle disease symptoms were observed on mos7-1 plants 3 days after inoculation. When bacterial growth was determined, ∼10fold more bacteria accumulated in mos7-1 than in wild-type leaves (Figure 2.4A). Therefore, MOS7 contributes to basal resistance.  2.2.4  MOS7 is Required for Resistance Mediated by Multiple R Proteins  To determine whether MOS7 is involved in resistance mediated by other TIR-NB-LRR R proteins, we challenged the mos7-1 single mutant with Ha Emwa1 and P.s. tomato DC3000 carrying avrRps4 that are recognized by RPP4 (van der Biezen et al., 2002) and RPS4 (Hinsch and Staskawicz, 1996), respectively. As shown in Figures 2.4B and C, the mos7-1 mutation markedly reduced resistance mediated by RPP4. By contrast, RPS4 resistance was only slightly compromised. We then tested whether resistance mediated by CC-NB-LRR–type R proteins is also impaired in mos7-1 by inoculating plants with Psm ES4326 carrying avrB or Pst DC3000 carrying avrPphB that encode effector proteins recognized by RPM1 (Grant et al., 1995) and RPS5 (Simonich and Innes, 1995), respectively. The mos7-1 mutant supported ∼30-fold more bacterial growth compared with wild-type plants when challenged with Psm ES4326 carrying avrB (Figure 2.4D). Also, mos7-1 was highly susceptible to Pst DC3000 carrying avrPphB, the extent of bacterial growth being the same as in susceptible ndr1 plants (Figure 2.4E). These data show that mos7-1 compromises resistance mediated by both TIR- and CC-NB-LRR proteins, although the degree of its effect varies depending on the R protein tested.  2.2.5  mos7-1 is Compromised in SAR  Initiation of local R protein-mediated resistance primes uninfected tissues against subsequent infections by a broad range of pathogens, a process termed systemic acquired resistance (SAR). As a result, the entire plant becomes more resistant to secondary infections (Durrant and Dong, 2004). To test whether SAR is affected in mos7-1 plants, we first treated leaves locally with Psm ES4326 expressing avrB at a density of OD600 = 0.2 to trigger a hypersensitive response. A high dose of virulent Psm ES4326 (OD600 = 0.001) was then infiltrated into the distal leaves 24 hours after SAR induction. Wild-type plants showed a significant decrease in bacterial growth in avrB pretreated plants compared with mock-inoculated ones. By contrast, leaves of mos7-1 supported bacterial growth in systemic leaves of both avrB pretreated and untreated plants; this bacterial growth was similar to that seen in the SAR-defective npr1-1 mutant (Figure 2.5A). Therefore, the SAR response is abolished in mos7-1. A defect in SAR was also reflected by the inability of mos7-1 to boost PR-1 expression in systemic tissue after local avrB induction (Figure 2.5B).  29  Figure 2.4: Altered basal and R-protein mediated resistance in mos7-1 single mutant plants. (A) Enhanced disease susceptibility to Psm ES4326 in mos7-1. The plants were infiltrated with the bacteria at OD600 = 0.0001. Leaf discs within the infiltrated area were taken at Day 0 and Day 3 to measure the bacterial growth. Bars represent means of six replicates ± SD. Susceptibility toward Psm ES4326 in mos7-1 is significantly enhanced compared to Col as indicated by the asterisk (p<0.0001, t test). (B to E) mos7-1 mutant plants were challenged with the indicated avirulent pathogens carrying effectors that can trigger the cognate R protein-mediated resistance. (B) 50,000 conidia/ml was used for Ha Emwa1 inoculation. (C-E) For bacterial pathogens, an inoculation dose of OD600 = 0.002 was used. Bars represent means of six replicates ± SD. Statistical analyses of the bacterial growth assays in C, D, and E were done by using one-way ANOVA provided by StatsDirect statistical software (StatsDirect Ltd. http://www.statsdirect.com. England: StatsDirect Ltd. 2008). Statistical differences among the samples are labelled with different letters (P<0.05).  30  Figure 2.5: Systemic acquired resistance is compromised in mos7-1. (A) Growth of Psm ES4326 in five-week-old Col, npr1-1 and mos7-1 plants pre-inoculated with Psm ES4326 avrB in 10 mM MgCl2 (grey bars) or 10mM MgCl2 alone (mock; white bars). Bars represent means of four replicates ± SD. Different letters indicate statistically significant differences between genotypes (P<0.05). (B)RT-PCR for PR-1 on RNA extracted from local and systemic leaves of the indicated genotypes pre-treated with Psm ES4326 avrB. Actin1 was used as control.  31  2.2.6  MOS7 Localizes to the Nuclear Rim  To explore the roles of MOS7 in plant innate immunity further, we investigated its subcellular localization. Initially we used the native promoter of MOS7 to drive expression of MOS7 with green fluorescent protein (GFP) fused to its C terminus. Although MOS7-GFP expressed under the native promoter complemented the mos7-1 mutation in regards to all snc1-suppressing phenotypes, we did not observe any green fluorescence using confocal fluorescence microscopy, probably due to low abundance of the fusion protein. A construct containing MOS7 fused to a Cterminal GFP tag under the control of the constitutive 35S promoter was then made and transformed into the mos7-1 snc1 mutant. A green fluorescence signal was observed at the nuclear rim (Figures 2.6A and B). The nuclear rim localization was observed in all cell types examined, including root cells (Figures 2.6A and B) and leaf pavement cells (Figure 2.6A). Concentration of GFP signal at the nuclear envelope is consistent with MOS7 being a member of the nuclear pore complex, as predicted by its similarity to nuclear pore components human Nup88 and Drosophila Mbo. The 35S ∷ MOS7-GFP transgene not only complemented the morphological phenotypes of mos7-1 snc1 (Figure 2.6C) but also restored a constitutive defense response against virulent Ha Noco2 (Figure 2.6D), suggesting that the MOS7-GFP fusion protein localizes correctly inside the cell.  2.2.7  Nuclear Accumulation of snc1 Resistance Protein is Reduced in mos7-1  Recent studies on tobacco N and Arabidopsis RPS4, two TIR-type NB-LRR proteins, revealed that both are present in the cytoplasm and nucleus and that their nuclear pools are important for triggering immune responses (Burch-Smith et al., 2007; Wirthmueller et al., 2007). However, the mechanism that regulates their partitioning between the cellular compartments remains elusive. The TIR-type R protein SNC1 contains a predicted NLS and two NES motifs. Since mos7-1 was identified as a genetic suppressor of snc1, one obvious candidate protein whose cellular distribution could be affected by mos7-1 is snc1. We therefore made a snc1-GFP fusion gene construct driven by its own promoter and transformed this into snc1-r3 that contains a deletion of the entire RPP4 cluster. snc1-r3 was identified as an snc1 revertant allele from the MOS screen (Zhang et al., 2003a) and was used in this study to avoid potential interference by endogenous SNC1-related proteins. Of many transgenic plants obtained, we were unable to find lines that consistently exhibited green fluorescence, probably due to low levels of the fusion protein. We selected one line with a single insertion site that exhibits a snc1-like morphology and crossed it with mos7-1 to generate a mos7-1 snc1-r3 line expressing the identical snc1-GFP transgene. Homozygous snc1-GFP transgenic plants were much smaller than snc1 plants, probably due to overexpression of the transgene in this particular line. mos7-1 partially suppressed the morphological phenotypes of snc1-GFP in snc1-r3 (Figure 2.7A) and constitutive defence against virulent Ha Noco2 (Figure 2.7B). Immunoblot analysis showed that total snc1-GFP levels were similar in snc1-r3 and mos7-1 snc1-r3 (Figure 2.7C). Further fractionation revealed that snc1-GFP was present in both the nuclear-depleted and nuclear fraction (Figure 2.7D). When band intensities were measured by Quantity One 4.6.1 software (Bio-Rad), we estimated from repeated experiments that the majority of snc1 protein accumulates in the cytoplasmic  32  compartment with 5.6 to 11.5% in the nucleus (Figure 2.7D). In mos7-1, there was a significant increase of snc1-GFP protein in the cytoplasm, whereas the nuclear pool of snc1-GFP was reduced (Figure 2.7D), ranging between 2.5 and 2.9% of total snc1 protein. We reasoned that the altered cellular distribution of snc1-GFP likely contributes to the snc1-suppressing phenotype of mos7-1. In Drosophila and human, mutations in Nup88 enhance NES-mediated nuclear export (Roth et al., 2003; Xylourgidis et al., 2006). We further tested whether adding an NES to snc1GFP would affect snc1-mediated resistance. When a construct expressing snc1-GFP-NES driven by its native promoter was transformed into wild-type Col, none of the T1 transgenic plants showed snc1-like morphology, while 61% of the transgenic plants carrying the control snc1-GFP transgene in Col showed snc1-like morphology. The numbers here support that snc1 nuclear localization might be critical for its autoimmunity. Enhancing nuclear export of snc1-GFP results in reduced autoimmunity, a similar effect as observed in mos7-1.  Figure 2.6: Subcellular localization of MOS7-GFP. (A) MOS7-GFP fluorescence in leaf pavement and root cells of mos7-1 snc1 transgenic plants expressing MOS7-GFP under the control of 35S promoter. Plant cell walls were stained with 5mg/ml propidium iodine (red) in the left panel. (B) MOS7-GFP fluorescence, DAPI staining of the nucleus, bright-field, and merged fluorescence channels in root cells. Pictures in (A) and (B) were taken on 2-week-old plategrown plants. (C) Complementation of mos7-1 by MOS7-GFP expressed by the 35S promoter. (D) Restoration of enhanced disease resistance in mos7-1 snc1 transformed with MOS7-GFP driven by 35S promoter. The disease ratings are as described in Figure 2.2E. 33  Figure 2.7: Abundance and cellular distribution of snc1-GFP in mos7-1 snc1-r3. (A) Morphology of three-week-old plants of snc1-r3, mos7-1, snc1-GFP in snc1-r3, and snc1GFP in mos7-1 snc1-r3. (B) Ha Noco2 growth on the same genotypes as (A). (C) Immunoblot analysis of snc1-GFP expressed under its native promoter in total protein extracts of unchallenged leaf tissues in snc1-r3 and mos7-1 snc1-r3. Equal loading was monitored by probing the membrane with anti-PEPC. (D) Immunoblot analysis of snc1-GFP in nuclei-depleted (∆N) and nuclear (N) protein extracts of the indicated genotypes. Anti-PEPC was used as a cytosolic marker and anti-Histone H3 was used as a nuclear marker. Nuclear protein extracts (N) were 25x concentrated as compared to nuclei-depleted fractions (∆N)  34  2.2.8  Nuclear Accumulation of NPR1 is Reduced in mos7-1  In Drosophila, the MOS7 homolog DNup88/Mbo affects an immune response against bacterial infection through nuclear retention of master immune regulators of the NF-κB family (Uv et al., 2000; Xylourgidis et al., 2006). Upon infection, the I-κB homolog Cactus becomes degraded, allowing the Rel/NF-κB proteins Dorsal and Dif to translocate to the nucleus and activate gene expression. During this process, DNup88 attenuates CRM1-mediated nuclear export of Dorsal and Dif, leading to their nuclear accumulation, whereas nup88 mutant larvae exhibit enhanced nuclear export of the Rel/NF-κB proteins and fail to activate an immune response (Uv et al., 2000; Roth et al., 2003; Xylourgidis et al., 2006). The plant defence regulator NPR1 controls basal resistance and SAR downstream of the defence hormone SA and displays a somewhat analogous pattern of activation as NF-κB. Using 35S promoter-driven PR1-GFP, it was shown that under non-inducing conditions, NPR1 is sequestered in the cytoplasm as an oligomeric complex (Mou et al., 2003; Tada et al., 2008). Upon SA application, increased SA levels result in a change of the cellular redox state that in turn leads to monomerization of NPR1, allowing it to translocate from the cytosol to the nucleus to regulate downstream PR gene expression. The SAR defect observed in mos7-1 mutant plants (Figures 2.5) prompted us to investigate the contribution of MOS7 to NPR1 nuclear accumulation. To avoid artifacts that can result from overexpression from the 35S promoter, we constructed an PR1-GFP fusion gene driven by its native promoter. When the PR1-GFP transgene was transformed into the null npr1-3 mutant, none of the transgenic lines consistently exhibited green fluorescence even upon SAR induction, suggesting that levels of the fusion protein in the transgenic plants are very low. We selected one line that carried a single transgene insertion and complemented fully all npr1 phenotypes, suggesting that NPR1-GFP expressed by its own promoter functions similarly to wild-type NPR1 protein. The PR1-GFP transgenic line was then crossed with mos7-1 to create a mos7-1 npr1-3 double mutant expressing the same NPR1-GFP protein. As shown in Figure 2.8A, NPR1 total protein levels increased markedly in both the wild type and the mos7-1 mutant upon SAR induction by spraying plants with the SA analog 2,6-dichloroisonicotinic acid (INA). Lower amounts of NPR1 protein accumulated in mos7-1 before and after SAR induction compared with the wild type. No differences in PR1 transcript abundance were observed between uninduced npr1-3 and mos7-1 npr1-3 tissues determined by RT-PCR (Figure 2.8B), suggesting that reduced NPR1 accumulation in mos7-1 likely results from decreased protein synthesis or stability rather than reduced transcription. We further investigated the cellular distribution of NPR1-GFP in mos7-1 before and after INA induction by comparing NPR1-GFP levels in nuclear and nuclei-depleted protein extracts of untreated and INA-induced tissues. As shown in Figure 2.8C, lower levels of NPR1-GFP accumulated in nuclei of both healthy and INA-induced mos7-1 plants than in the wild type. In contrast with the preferential depletion of nuclear snc1 in mos7-1 tissues, lower amounts of NPR1-GFP were also observed in nuclei-depleted (cytosolic) extracts of INA-treated mos7-1 compared with the wild type (Figure 2.8C). Since mos7-1 plants exhibit a SAR defect and nuclear accumulation of NPR1 is required for SAR induction, these data suggest that NPR1 may not be able to attain sufficient abundance in the nucleus for activation of SAR in mos7-1. It is notable that NPR1-GFP expressed under its native promoter was detected in the nucleus of uninduced tissues (Figure 2.8C); this pattern was observed in multiple independent  35  PR1-GFP transgenic lines. This partitioning contrasts with data derived from PR1-GFP expressed under control of the 35S constitutive promoter that showed a cytoplasmic localization of NPR1 without SAR induction (Mou et al., 2003). To rule out the possibility that unchallenged plants were already stressed, causing increased nuclear translocation of NPR1-GFP, we analyzed the expression of the SAR marker gene PR-1 in the same uninduced tissues from which nuclear extracts were generated. No PR-1 transcripts were detected in uninduced tissues, whereas strong expression was detected after INA induction (Figure 2.8B), suggesting that the observed nuclear pool of NPR1 represents its uninduced state. These data suggest that NPR1 is present in the nucleus of both uninduced and INA-induced tissues.  2.2.9  EDS1 Nuclear Accumulation is Reduced in mos7-1  Another key plant immune regulator known to localize to both cytosol and nucleus is EDS1 (Feys et al., 2005). We investigated whether accumulation and cellular distribution of native EDS1 is affected by mos7-1. As with NPR1, EDS1 total protein was reduced in mos7-1 mutant plants compared with Col wild type (Figure 2.9A), although the wild type and mos7-1 have comparable EDS1 transcript levels (Figure 2.9B). In mos7-1, the ratio of EDS1 distributing in the cytosol and nucleus was not strongly affected. However, overall lower accumulation of EDS1 resulted in only very low levels being detected in mos7-1 nuclei (Figure 2.9C). We conclude that MOS7 is also necessary for EDS1 protein accumulation in the nucleus. The effect of mos7-1 on EDS1 nuclear accumulation may also contribute to the ability of mos7-1 to suppress snc1.  2.2.10 Nuclear Accumulation of HDA19, CDC5, and TGA2 is Not Affected in mos7-1  One enigma to mos7-1 is its specificity. Lethality of MOS7 null alleles indicates that wild-type MOS7 is probably required for general nuclear export. While mos7-1 appeared not to exhibit pleiotropic phenotypes, we could not rule out a global effect on protein export. To test this, we fractionated proteins from mos7-1 and the wild type and examined the localization and relative protein abundance of the known nuclear proteins CDC5, HDA19, and TGA2 using respective antibodies. CDC5 is a myb-like transcription factor, containing a strong NES and belonging to a nuclear MOS4-associated complex (Palma et al., 2007). HDA19 is a histone deacetylase, and TGA2 is a transcription factor that interacts with NPR1 (Zhang et al., 1999). Neither HDA19 nor TGA2 contains a strong NES. As shown in Figure 2.10A, nuclear accumulation of these proteins (as well as histone H3) is unaffected in mos7-1. These data suggest that the defects we observe in mos7-1 in nuclear retention of snc1, NPR1, and EDS1 are rather selective.  36  Figure 2.8: PR1 protein abundance and subcellular localization in mos7-1. (A) NPR1-GFP expressed by its native promoter in mos7-1. Immunoblot analysis of NPR1-GFP in total protein extracts of unchallenged leaf tissues (-) and leaf tissues harvested 24 h after spraying plants with 0.65 mM INA (+). Equal loading was monitored by staining the membrane with Ponceau S. (B)RT-PCR for PR1 on RNA extracted from 4-week old plants of the indicated genotypes treated with or without INA. Actin1 expression was used as control. (C) Immunoblot analysis of NPR1-GFP in nuclei-depleted (∆N) and nuclear (N) protein extracts of unchallenged (-) and INA treated (+) tissues of the indicated genotypes. Anti-PEPC was used as a cytosolic marker and anti-Histone H3 was used as a nuclear marker. Nuclear protein extracts (N) were 35x concentrated as compared to nuclei-depleted fractions (∆N).  37  Figure 2.9: EDS1 protein abundance and subcellular localization in mos7-1. (A) EDS1 in mos7-1. Immunoblot analysis of EDS1 in total protein extracts of unchallenged leaf tissues. Equal loading was monitored by staining the membrane with Ponceau S. (B)RT-PCR for EDS1A on RNA extracted from 4-week old unchallenged plants of the indicated genotypes. Actin1 expression was used as control. (C) Immunoblot analysis of EDS1 in nuclei-depleted (∆N) and nuclear (N) protein extracts of unchallenged leaf tissues. Anti-PEPC was used as a cytosolic marker and anti-Histone H3 was used as a nuclear marker. Nuclear protein extracts (N) were 35x concentrated as compared to nuclei-depleted fractions (∆N).  38  Figure 2.10: CDC5, PEPC, HDA19, TGA2 and Histone H3 protein abundance and subcellular localization, and RPS4 nuclear abundance are unaltered in mos7-1. (A) Immunoblot analysis of CDC5, PEPC, HDA19, TGA2 and Histone H3 in nuclei-depleted (∆N) and nuclear (N) protein extracts of unchallenged leaf tissues. Nuclear protein extracts (N) were 35x concentrated as compared to nuclei-depleted fractions (∆N). (B) Nuclear abundance of RPS4 is not altered in mos7-1. Immunoblot analysis of RPS4 in nuclear protein extracts of unchallenged leaf tissues. rps4-2 is a transcriptional null allele; it contains a T-DNA insertion in the second exon of RPS4. Equal loading was monitored by probing the membrane with anti-Histone H3.  39  2.3  Discussion  Several recent lines of evidence suggest that nucleocytoplasmic trafficking pathways play important roles in plant innate immunity through dynamic partitioning of signalling regulators between the nucleus and cytosol. Studies of MOS3/SAR3 indicate that mRNA export, regulated by nucleoporins of the Nup107-160 complex, is required for both basal defense and R proteinmediated resistance (Zhang and Li, 2005; Dong et al., 2006; Parry et al., 2006). Also, a requirement for MOS6 and RanGAP2 in R protein-triggered resistance points to import to the nucleus of protein regulators that have NLSs as an important process in plant immunity (Palma et al., 2005; Sacco et al., 2007; Tameling and Baulcombe, 2007). However, contributions of other nucleocytoplasmic trafficking pathways or components controlling nuclear protein export and retention are unclear. In this study, we identified mos7-1 as a genetic suppressor of the autoimmune mutant snc1. We isolated the MOS7 gene and found it to encode a plant homolog of human and Drosophila Nup88. Our analysis reveals that MOS7 contributes to several aspects of plant immunity. Importantly, resistance defects of mos7-1 mutants correlate specifically with reduced nuclear accumulation of the autoactivated TIR-NB-LRR immune receptor, snc1. Nuclear pools of the downstream signalling components NPR1 and EDS1 are also strongly depleted in mos7-1, although unlike snc1, reduced abundance in nuclei appears to reflect lower total steady state levels of these defence regulators. While only limited studies have been performed on nucleoporins in plants, nuclear pore complexes seem to be conserved among eukaryotes, in both structure and functionality (Terry et al., 2007). For example, Nup107-160 complex components in yeast and animals are critical for mRNA export (Dockendorff et al., 1997; Emtage et al., 1997). In Arabidopsis, mutations in homologs of Nup160 and Nup96, both belonging to the corresponding Nup107-160 complex, similarly affect mRNA export (Dong et al., 2006; Parry et al., 2006). Mutations in Arabidopsis MOS3/ up96/SAR3 partially disable innate immunity (Zhang and Li, 2005). In mice, although a complete knockout of up96 causes lethality, knockdown of Nup96 exhibits defects in both innate and adaptive immunity (Faria et al., 2006). Our studies on MOS7 suggest that the function of Nup88 is also conserved between plants and animals since Nup88s in Drosophila and human are critical for the regulation of innate immunity. Consistent with this idea, MOS7-GFP fusion protein resides mainly at the nuclear rim (Figures 2.6A and B). In animals, Nup88 interacts directly with CAN/Nup214 and Nup358/RanBP2. The major function of Nup88 is to anchor Nup214 and CRM1 on the nuclear envelope to attenuate NES-mediated nuclear export (Roth et al., 2003; Bernad et al., 2004; Xylourgidis et al., 2006). The lethality phenotype of null mos7 mutations agrees with its potential function in general NES-mediated nuclear export. Partial lossof-function mutations in Drosophila mbo or depletion of mammalian Nup88 lead to increased nuclear export, resulting in reduced retention of Drosophila Rel protein Dorsal and NF-κB, respectively (Uv et al., 2000; Xylourgidis et al., 2006; Takahashi et al., 2008). Our analysis suggests that nuclear accumulation of snc1, NPR1, and EDS1 is controlled in part by MOS7. mos7-1 affects nuclear levels of all three proteins but did not affect the NES-containing CDC5, indicating that the partial loss-of-function mutation in mos7-1 enhances NES-mediated nuclear export in plants with some degree of specificity. Previous studies revealed nuclear pools of the plant NB-LRR proteins MLA, N, and RPS4 and showed that their nuclear accumulation is required for disease resistance (Burch-Smith et al., 2007; Shen et al., 2007; Wirthmueller et al., 2007). Future in-depth nuclear partitioning  40  analysis of wild-type SNC1 should resolve whether SNC1 has nuclear activity, and if so whether the nuclear activity of SNC1 is essential for activation of defense responses. We find that snc1 (an autoactivated NB-LRR protein) localizes to both the cytosol and the nucleus. Nuclear accumulation of snc1 is disproportionately reduced in mos7-1, and adding an NES to snc1-GFP abolishes its autoimmunity, suggesting that MOS7/Nup88 promoting retention of snc1 in the nucleus is a critical process in defence activation. It is notable that resistance mediated both by CC (RPM1 and RPS5) and TIR-NB-LRR (RPP4) proteins was strongly compromised in mos7-1, suggesting that some R proteins may require MOS7 for nuclear retention. Whether these tested NB-LRR receptors have a nuclear activity remains to be characterized. On the other hand, RPS4 resistance was only marginally compromised in mos7-1, and no detectable change in RPS4 nuclear accumulation was observed in mos7-1 (Figure 2.10B). Further analysis should establish whether regulation of nucleocytoplasmic partitioning of NB-LRR proteins by MOS7 is a general phenomenon or whether MOS7 is selective for certain R proteins depending on their intracellular abundance, spatial dynamics, and activities. One striking phenotype of mos7-1 is its defect in SAR. Similar to the SAR-deficient npr1 mutants, mos7-1 plants had reduced PR gene expression and systemic resistance after SAR induction and exhibited reduced tolerance to high levels of SA. Since NPR1 nuclear accumulation is essential for SAR and lower NPR1 levels were observed in nuclei of mos7-1 plants after SAR induction, the SAR defects in mos7-1 are likely caused by the reduced nuclear NPR1 pool. Nuclear accumulation of EDS1 was also reduced in mos7-1. Reducing the nuclear EDS1 pool partially disables plant defences (A.V. García and J.E. Parker, unpublished data); therefore, lower amounts of nuclear EDS1 probably contribute to the enhanced disease susceptibility phenotype of mos7-1. For both EDS1 and NPR1, there is a general decrease in protein accumulation in both nonnuclear and nuclear compartments of the mos7-1 mutant. Thus, the influence of mos7-1 on these proteins is different to its effect on snc1. The data support selective retention of snc1 inside the nucleus by MOS7. By contrast, MOS7 may act more indirectly on EDS1 and NPR1. One scenario is that lower cellular accumulation of EDS1 and NPR1 reflects an indirect influence of MOS7 by lowering basal resistance and, thus, the flux through various positive feedback loops (Feys et al., 2001; Shah, 2003). However, mos7-1 did not affect expression of PR1 or EDS1 mRNAs, suggesting that such feedback mechanisms are not operating at the transcriptional level. Alternatively, MOS7 may act directly on these proteins, but they are subject to increased degradation after being exported from the nucleus, thereby reducing the amount in a cytosolic pool available for nuclear import. Plant defence responses rely on dynamic translocation of signalling components across the nuclear envelope, and nucleocytoplasmic trafficking might constitute a central regulatory node for the integration of distinct signalling pathways. Although mos7-1 exhibits strong immunity defects, overexpression of MOS7 did not lead to enhanced disease resistance, indicating that MOS7 itself is probably not a rate-limiting defence signalling component. The identification of MOS7 reveals how the nuclear protein export pathway contributes to cellular innate immune responses and provides us with a system to test the relevance of different cellular compartments in plant pathogen recognition and defence activation.  41  2.4  Material and Methods  2.4.1  Plant Growth Conditions, Gene Expression Analysis, and Mutant Phenotypic Characterization  All plants were grown at 22°C under 16-hour light/8-hour night or 10-hour light/14-hour night cycles. The snc1 suppressor screen was described previously (Zhang and Li, 2005). Gene expression analysis was done by extracting RNA from 3-week-old plate-grown or 4-week-old soil-grown plants using the Totally RNA kit (Ambion). The extracted RNA was then reverse transcribed using the RT-for-PCR kit (Clontech) or SuperScript II reverse transcriptase (Invitrogen). Expression analysis for PR-1, PR-2, and Actin1 was as previously described by Zhang et al. (2003a) with cDNA samples being normalized by real-time PCR using Actin1 and the QuantiTect SYBR Green PCR kit (Qiagen). For EDS1 and PR1 expression analysis, 0.5 µg of total RNA were reverse transcribed using SuperScript II reverse transcriptase and 0.5 µg of oligo(dT)18 primer at 42°C in a 20-µL reaction volume. Aliquots of 1 µL RT reaction products were subsequently used for PCR analysis with PCR conditions as follows: 94°C for 3 min and 29 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 45 s. Single-band PCR products were analyzed by agarose gel electrophoresis and ethidium bromide staining. Actin1 expression was used to standardize transcript levels in each sample. Gene-specific primers for RT-PCR analyses used in this study are as follows: PR-1F, 5'-GTAGGTGCTCTTGTTCTTCCC-3', PR-1R, 5'-CACATAATTCCCACGAGGATC-3'; PR-2F, 5'-GCTTCCTTCTTCAACCACACAGC-3', PR-2R 5'-CGTTGATGTACCGGAATCTGAC-3'; Actin1-F, 5'-CGATGAAGCTCAATCCAAACGA-3', Actin1-R, 5'-CAGAGTCGAGCACAATACCG-3'; Actin7-F, 5'-GGTGTCATGGTTGGTATGGGTC-3', Actin7-R, 5'-CCTCTGTGAGTAGAACTGGGTGC-3'; EDS1A-F, 5'-ATCATCATAGCTATGAGGAACTGG-3', EDS1A-R, 5'-CAGCTCTCTTGACGTTTGC-3'; and PR1-F, 5'-AGAAGACAAACGAGAACAAATTCC-3', PR1-R, 5'-TCAGCAGTGTCGTCTTCTCC-3'. Infection experiments with Pseudomonas syringae and Hyaloperonospora arabidopsidis (previously Hyaloperonospora parasitica) were performed as described (Li et al., 2001; Feys et al., 2005). Endogenous SA levels were determined as described by Li et al. (1999).  2.4.2  Map-Based Cloning of mos7-1  Positional cloning of mos7-1 was performed according to procedures described by Zhang and Li (2005). The markers used to map mos7-1 were derived from insertion-deletion polymorphisms (Table 2.1) identified from the genomic sequences of Col and Ler ecotypes provided by Monsanto on The Arabidopsis Information Resource homepage (Jander et al., 2002).  42  Table 2.1: Molecular markers used for map-based cloning of mos7-1. BAC Name K18I23 MOP10 MJJ3 K18J17 MHF15  2.4.3  Primer Name K18I23-F K18I23-R MOP10-F MOP10-R MJJ3-3F MJJ3-3R K18J17-F K18J17-R MHF15-F MHF15-R  Primer Sequence (5’ 3’) AGATTCCAGCTCCGACGATG ACGCGCCAAAAGTGCGTGTC CTACATGTCCATAGAACCTTC CAGTTCTATCATGTATCCACC TCTGACTCAATATGAGAGTCC ATAACTTTATGGGCTGCAGTG CGCGATTAAAGATCCGGTA TCGAGCAATAAGAGTGATTCC CAGAAAGGTCATGAAACCTAG GAGCACCAATAAGGTTTCCTC  Polymorphism (Col/Ler) 172bp/205bp 118bp/129bp 117bp/108bp 119bp/107bp 212bp/159bp  Construction of Plasmids  The construct used to complement the mos7-1 mutation was generated by PCR amplifying a genomic fragment containing the MOS7 coding region and its promoter 1.1 kb upstream of the ATG start codon. The primers MOS7 pro-F (5'-ccaatacacaaaatactctggc-3') and MOS7-3' (5'cgcGGATCCtgcgtccctgttacagtga-3') were used for PCR, and the fragment was subsequently cloned into pGreen0229 (Hellens et al., 2000) to obtain pG229-MOS7 for complementation analysis. To generate 35S-driven MOS7-GFP construct, full-length At5g05680 cDNA lacking a stop codon was cloned into the pBS-GFP5 vector with GFP in frame at the C terminus (Haseloff et al., 1997). The resulting MOS7-GFP fusion construct was subsequently excised and cloned into pBI1.4 containing the 35S promoter to obtain pBI-MOS7-GFP. To localize mos7-1, a 35Sdriven mos7-1-GFP construct was generated by cloning full-length At5g05680 cDNA lacking a stop codon from mos7-1 using the following primers: MOS7-CDS-F, 5'-CGGGGTACCATGAAATTTAACTTTAACGAGAC-3', MOS7-CDS-R, 5'-CGCGGATCCCATGAAACTGCTTTCTTGC-3' into the binary vector pCAMBIA-1300 (http://www.cambia.org.au) with GFP in frame at the C terminus. PR1-GFP construct was generated by PCR amplifying PR1 cDNA without a stop codon and a 1.6-kb genomic region upstream of the PR1 ATG start codon. These two fragments were subsequently cloned into a modified pGreen0229 vector that has a sequence encoding GFP in frame at the C terminus. To generate promS C1-snc1-GFP, pG229-snc1 (Zhang et al., 2003a) lacking a stop codon was used as the template for PCR amplification. The amplified fragment was subsequently cloned into pGreen0229-GFP vector with GFP in frame at the C terminus. All constructs were sequenced to ensure accuracy in PCR and cloning. All constructs were transformed into designated genotypes using the floral dip method (Clough and Bent, 1998) to generate transgenic lines for subsequent analysis.  43  2.4.4  Systemic Acquired Resistance Experiments  The infection experiment used to test SAR was performed as described by Cao et al. (1994) with minor modifications. In brief, two leaves of each 5-week-old soil-grown plant were infiltrated with Psm ES4326 expressing avrB at an OD600 = 0.2 in 10 mM MgCl2 to induce SAR or 10 mM MgCl2 without bacteria (mock). Twenty-four hours after inoculation, the upper uninoculated leaves were challenged with Psm ES4326 at OD600 = 0.001. Leaf discs within the infiltrated systemic area were taken immediately (day 0) and 3 days after inoculation (day 3) to measure the bacterial growth in those leaves.  2.4.5  Cellular Distribution of snc1-GFP  Three-week-old plants (0.5 g) were harvested and ground to a fine powder in liquid nitrogen and mixed with 2 volumes of lysis buffer (20 mM Tris-HCl, pH 7.4, 25% glycerol, 20 mM KCl, 2 mM EDTA, 2.5 mM MgCl2, 250 mM sucrose, and 1 mM PMSF). The homogenate was filtered through a 95- and 37-µm nylon netting successively. The flow-through was spun at 1500g for 10 min, and the supernatant consisting of the cytosolic fraction was collected and mixed with 5x Laemmli loading buffer and heated at 95°C for 5 min. The pellet was washed four times with 5 mL of nuclear resuspension buffer NRBT consisting of 20 mM Tris-HCl, pH 7.4, 25% glycerol, 2.5 mM MgCl2, and 0.2% Triton X-100. The final pellet was mixed with 50 µL of 1x Laemmli buffer and heated at 95°C for 5 min. Fifty microliters of each fraction was loaded on an 8% SDSPAGE gel for protein separation. Antibodies used for immunoblot analyses were as described: anti-Histone H3 (Feys et al., 2005), anti-GFP (Wirthmueller et al., 2007), and anti-PEPC (Noël et al., 2007). Band intensities were measured by Quantity One 4.6.1 software (Bio-Rad). The experiment was repeated five times; a figure representative of all repetitions is shown. Various exposure times on films were used to make sure that the exposure used was in the linear range.  2.4.6  NPR1 and EDS1 Protein Expression and Localization Analyses  For NPR1 protein extraction from INA-induced tissues, 4-week-old plants were sprayed to imminent runoff with an aqueous solution of 0.65 mM INA with 0.01% Silwett L-77 surfactant. Plants were harvested 24 h after being sprayed for the first time and 3 hour after being treated a second time with INA. Total protein extracts and preparation of nuclear/nuclei-depleted protein extracts were described previously (Feys et al., 2005). Anti-EDS1 antibody used for immunoblot analysis was described earlier (Feys et al., 2005).  44  2.4.7  Nuclear Protein Export Assay in Protoplast  Protoplast were prepared and transformed from 3- to 4-week-old Arabidopsis plants as previously described (Sheen, 2001; Yoo et al., 2007). Plasmid construct encoding NES, NLS variant of chalcone synthase were kindly provided by Thomas Merckle (Universitat Bielefeld, Germany; Haasen et al., 1999). Transformed protoplasts were kept in the dark overnight and observed using a confocal microscope the following day.  2.4.8  Accession Numbers  Sequence data from this article can be found in the GenBank/EMBL data libraries under the following accession numbers: At5g05680, NP_196187 (MOS7); NP_002523 (hNup88); NP_524330 (DNup88/Mbo); At4g16890 (S C1); At2g14610 (PR-1); At3g57260 (PR-2); At2g37620 (Actin1); At5g09810 (Actin7); At3g48090 (EDS1A); and At1g64280 ( PR1).  2.5  Manuscript Acknowledgements  We thank the ABRC for seeds of mos7-2 and mos7-3 and Roger Innes for Pst DC3000 carrying avrPphB. We also thank Fred Sack and EunKyoung Lee for their help with confocal microscopy. The research is supported by funds to X.L. from the Natural Sciences and Engineering Research Council of Canada, the Canadian Foundation for Innovation, the British Columbia Knowledge Development Fund, the University of British Columbia Blusson Fund, and the University of British Columbia Michael Smith Laboratories. We are thankful for a Feodor Lynen research fellowship of the Alexander von Humboldt Foundation to M.W., and Le Fonds Québécois de la Recherche sur la Nature et les Technologies to H.G. J.E.P. is grateful for an International Max Planck Research School PhD fellowship supporting A.V.G. and Deutsche Forschungsgemeinschaft SFB 670 funding of L.W.  45  3  Regulation of Transcription of B-LRR Encoding Genes S C1 and RPP4 via H3K4 Tri-Methylation  3.1  Introduction  Plants are constantly threatened by pathogens, yet they are healthy most of the time. During their long evolutionary history, plants have developed elegant mechanisms to fend off pathogen infections. Conceptually, plants possess two layers of innate immunity (Chisholm et al., 2006; Jones and Dangl, 2006). The first layer is dependent on membrane residing pattern recognition receptors (PRRs), which recognize conserved pathogen-associated molecular patterns (PAMPs; or MAMPs, microbe-associated molecular patterns) to activate defence responses termed PAMPtriggered immunity (PTI) (Boller and Felix, 2009). Successful pathogens have evolved effectors to suppress PTI in order to promote pathogen virulence. During the arms race between plants and pathogens, plants have developed a second layer of immunity that is mediated by Resistance (R) proteins. R proteins can specifically recognize the activities of pathogen effectors and effectortriggered immunity (ETI). ETI is a robust defence response that usually results in the induction of the hypersensitive response (HR), a type of localized cell death that may contribute to restriction of pathogen proliferation. Most R proteins have a central nucleotide binding (NB) domain and C-terminal leucine-rich repeats (LRRs). These nucleotide-binding domain leucinerich repeat-containing proteins (NLRs) share structural similarity with animal immune receptors such as Nod proteins, possibly due to convergent evolution (Ausubel, 2005). NB-LRR R proteins can be further grouped into the TIR-type (Toll/Interleukin-1-receptor-like) or the CC-type (coiled-coil) based on their different N-termini. Although resistance mediated by plant R proteins is rapid and robust, and effectively restricts pathogen growth, the molecular events surrounding R protein activation are largely unknown. An Arabidopsis gain-of-function autoimmune mutant snc1 (suppressor of npr1-1, constitutive 1) constitutively expresses defence marker PR genes and exhibits enhanced disease resistance against the virulent bacterial pathogen Pseudomonas syringae pv. maculicola (Psm) ES4326 and the oomycete pathogen Hyaloperonospora arabidopsidis (H.a.) Noco2 (Li et al., 2001). As a consequence, snc1 plants are severely dwarfed. The autoimmune phenotypes in snc1 are caused by a point mutation that results in a glutamic acid (E) to lysine (K) substitution in the linker region between the NB and LRR domains of a TIR-type NB-LRR protein (Zhang et al., 2003). This unique mutation renders the NLR protein more stable, leading to autoimmunity of the mutant plants (Cheng et al., 2011). To identify components required for TIR-type NLR protein-mediated immunity, forward genetic screens were employed to identify mutants that can suppress the autoimmune phenotypes of snc1. From these MOS (modifier of snc1) screens, important cellular and molecular processes were found to be critical for R protein-mediated resistance. These include RNA processing, nucleo-cytoplasmic trafficking, transcriptional reprogramming and protein modifications (Palma et al., 2005; Zhang and Li, 2005; Zhang et al., 2005; Goritschnig et al., 2007; Palma et al., 2007; Goritschnig et al., 2008; Cheng et al., 2009; Germain et al., 2010; Li et al., 2010b; Zhu et al., 2010; Xu et al., 2011; Xu et al., 2012). The diverse components identified from the MOS screens suggest that NLR activities are regulated at multiple levels to achieve appropriate immune response. 46  R gene transcription is an early regulatory node in the modulation of NLR activities. The example of S C1 illustrates the importance and delicacy of transcriptional regulation of R genes. Less than two-fold increase or decrease in S C1/snc1 gene expression can dramatically alter the outcome of the immune response. The homozygous snc1 mutant is severely dwarfed, while the heterozygous snc1/S C1 plant with 50% transcriptional activity of the snc1 allele, is morphologically wild-type-like (Li et al., 2001). Conversely, a duplication of the S C1 locus in bal that leads to a one-fold increase in the transcriptional activity of S C1 results in autoimmunity (Yi and Richards, 2009). Adequate R gene transcription is required to mount an appropriate degree of resistance, whereas excessive R gene transcription results in an overaccumulation of R proteins leading to autoimmunity, which is detrimental to development and growth. Although the transcriptional regulation of R genes is a critical step in plant immunity, little is known about the details of the mechanisms controlling this process. Here we report the identification, characterization, and functional study of mos9 (modifier of snc1, 9). MOS9 is a plant-specific nuclear protein that plays an important role in regulating the expression level of S C1 and RPP4, both TIR-type NLR-encoding genes. MOS9 was found to associate with Arabidopsis Trithorax-Related, 7 (ATXR7), a histone methyl transferase that activates FLC expression through tri-methylation of the fourth lysine of histone H3 (H3K4me3), close to the start codon of FLC (Tamada et al., 2009). We show that ATXR7 is also required for the regulation of S C1 and RPP4 expression, suggesting that MOS9 functions together with ATXR7 to regulate the expression of these R genes.  3.2  Results  3.2.1  Identification of the mos9 Mutant  The mos9 (modifier of snc1, 9) mutant was identified from a suppressor screen of snc1 single mutant (Zhang and Li, 2005). The size of the mos9 snc1 double mutant plant is much bigger than that of snc1, but still exhibits snc1-like twisted leaves (Figure 3.1A). Quantitative RT-PCR analysis showed that the elevated PR1 and PR2 expression in snc1 is largely reduced by mos9, although not to wild-type levels (Figure 3.1B and 3.1C). The free and total salicylic acid (SA) content in mos9 snc1 double mutant plants was noticeably lower when compared to that of snc1 plants (Figure 3.1D and 3.1E), but still significantly higher than those of wild type. When mos9 snc1 double mutant plants were challenged with the virulent oomycete pathogen Ha Noco2 or the bacterial pathogen Psm ES4326, they produced more spores and supported more bacterial growth than snc1 plants but not to the level of wild-type (Figure 3.1F and 3.1G). Taken together, mos9 partially suppresses all autoimmune phenotypes of snc1.  47  Figure 3.1: Mutation in mos9 partially suppresses the autoimmune phenotypes of snc1. (A) Morphology of four-week old soil-grown Col wild type (WT), snc1 and mos9 snc1 plants. (B and C) Relative PR1 (B) and PR2 (C) expression in WT, snc1 and mos9 snc1 plants. Twoweek-old seedlings grown on ½ MS were collected for total RNA extraction and reverse transcribed to obtain cDNA. The cDNA amounts were quantified with real-time PCR as described in Zhang et al., 2003. (D and E) Free (D) and total (E) SA levels in leaves of WT, snc1 and mos9 snc1 plants. SA was extracted and measured from 4-week-old soil-grown plants using a previously described procedure (Li et al., 1999). (F) Growth of Ha Noco2 on WT, snc1 and mos9 snc1 plants. Two-week-old seedlings were sprayed with Ha Noco2 at a concentration of 100,000 spores per ml of water. The infection was scored 7 days after inoculation. The values presented are averages of four replicates ± standard deviation. (G) Psm ES4326 bacterial growth in WT, snc1 and mos9 snc1 plants. Leaves were infiltrated with a bacterial suspension at OD600 = 0.0001 (Day 0). Bacterial growth was measured 3 days after infiltration (Day 3) as previously described (Zhang et al., 2003).  48  3.2.2  Map-Based Cloning of mos9  To identify the molecular lesion in mos9 that leads to the suppression of snc1, mos9 snc1 (in Columbia [Col] accession) was crossed with Landsberg erecta (Ler) with snc1 introgressed (Lersnc1; (Zhang and Li, 2005)). Linkage analysis on 24 F2 plants that had lost the snc1 morphology revealed that the mos9 locus is located on the top arm of chromosome 1 between markers T28P6 and F3F19 (Figure 3.2A). Further mapping with over 1,000 F2 plants narrowed the mos9 mutation to the region between markers T28K15 and T12C24. Unfortunately, with this population, we could not narrow the region beyond this 250 kb interval. To further resolve the position of the mos9 mutation, we transformed mos9 snc1 plants with a set of overlapping TAC clones (JAtY, John Innes Center) covering the 250kb region. Only one clone, JAtY51H02, complemented the mos9 phenotype (Figure 3.2B and Table 3.1). By subtracting the regions covered by the non-complementing clones from JAtY51H02, the mos9 lesion could be confined to a small interval containing 6 candidate genes (Figure 3.2C). Since mos9 was identified from a fast neutron-mutagenized population and fast neutron induces deletion mutations, the coding sequences of these candidate genes were amplified from mos9 snc1 to test whether any of them has been deleted in the mutant. Two genes, At1g12520 and At1g12530, could not be PCR-amplified from mos9 snc1, suggesting that mos9 contains a deletion mutation affecting both genes. Direct transgenic complementation using the genomic region of At1g12520 or At1g12530 driven by their native promoters was used to test which gene is MOS9 (Chu et al., 2005). As shown in Figures 3.2D and 3.2E, only mos9 snc1 transgenic plants carrying At1g12530 exhibited snc1-like morphology and enhanced resistance against Ha Noco2, indicating that MOS9 is At1g12530. Sequence analysis of MOS9 revealed that it encodes a plant-specific protein of 193 amino acids with no discernible motifs or domains. In Arabidopsis, MOS9 has a remote paralog, At1g56420 (Figures 3.3A and 3.4). MOS9 and At1g56420 seem to have evolved at different rates (Figure 3.4). MOS9 homologs in other plant species, including A. lyrata, are more divergent, while those of At1g56420 are highly conserved. A survey of coding regions of MOS9 in 75 A. thaliana accessions revealed that there are at least 11 alleles present in the population containing 24 polymorphic sites, 15 of which are non-synonymous changes resulting in amino acid substitutions. In contrast, At1g56420 shows 7 alleles with 6 polymorphic sites, only two of which lead to amino acid substitutions. Codeml analysis (Yang, 2007) indicates that two of the individual amino acid residues (39D and 156 K) in MOS9 could be positively selected under Positive Selection Model 8 with posterior probabilities 0.703 and 0.707, respectively (Table 3.2). However, there was no indication of positive selection in At1g56420 (Table 3.3).  49  Figure 3.2: Positional cloning of mos9. (A) The rough position of mos9 locus on chromosome 1 between markers T28P6 (3.77 Mb) and F3F19 (4.48 Mb) determined by using a small mapping population. Positions of the markers used for mapping are indicated. The more defined position between markers T28K15 and T12C24 was achieved using a larger mapping population with over 1,000 plants. (B) Overlapping JAtY clones used to transform mos9 snc1 for complementation. (C) Candidate genes in the final interval containing mos9. Arrows indicate transcription direction. Black arrows are genes that can be PCR-amplified whereas dashed arrows indicate genes which failed to be amplified using PCR. (D) Morphology of WT, snc1, mos9 snc1, and mos9 snc1 transformed with genomic sequences of At1g12520 or At1g12530 driven by their native promoters. (E) Disease ratings of plants of the indicated genotypes infected with Ha Noco2. Two-week-old seedlings were sprayed with Ha Noco2 at a concentration of 100,000 spores per ml of water. The infection was scored 7 days after inoculation. A total of 20 plants were scored for each genotype. Disease rating scores are as follows: 0, no conidiophores on the plants; 1, one leaf infected with no more than five conidiophores; 2, one leaf infected with more than five conidiophores; 3, two leaves infected, but with no more than five conidiophores on each infected leaf; 4, two leaves infected with more than five conidiophores on each infected leaf; 5, more than two leaves infected with more than five conidiophores (Jing et al., 2011).  50  Table 3.1: Transgenic complementation of mos9 snc1 using overlaying JAtY clones covering the final mapped region containing mos9 mutation (see Figure 3.2B for details).  51  A  Figure 3.3: Protein sequence analysis between MOS9 and its paralog At1g56420 and contribution of At1g56420 in defence. (A) Protein sequence alignment of MOS9 (At1g12530) and its paralog At1g56420. Similar amino acids are highlighted. (B) Psm ES4326 bacterial growth in WT, snc1 and mos9 snc1 and four independent transgenic lines of mos9 snc1 carrying artificial microRNA that targets At1g56420 (At1g56420 amiRNA).  52  53  Figure 3.4: Evolutionary tree of MOS9 (At1g12530) and its paralog At1g56420. Amino acid sequences of the proteins were used to generate the tree (bootstrap = 1000).  54  Table 3.2: Codeml analysis of MOS9 sequences from 75 Arabidopsis thaliana accessions.  Model Comparison  χ2 Critical value  codeml (w = 0.4)  Model  75 seqs  M0  -976.52  Not allowed  M1  -974.70  Not allowed  M2  -974.63  39D (0.598); 156K (0.603)  M2 Vs. M1  0.139398  9.21  M3  -975.23  N/A  M3 Vs. M0  2.582882  13.28  2 4  M7  -975.35  Not allowed  M8  -974.63  39D (0.703); 156 K(0.707)  M8 Vs. M7  1.440424  9.21  2  LnL3  Positively selected sites (Bayes Empirical Bayes analysis)4  2∆L5  Degrees of freedom  Table 3.3: Codeml analysis of MOS9 paralog sequences from 74 Arabidopsis thaliana accessions. codeml (w = 0.4) 74 seqs  Model  LnL  Positively selected sites (Bayes Empirical Bayes (BEB) analysis)  Model Comparison  2∆L  χ2 Critical value  Degrees of freedom  M0  -784.39  Not allowed  M1  -784.70  Not allowed  M2  -784.39  None  M2 Vs. M1  0.605296  9.21  M3  -784.39  N/A  M3 Vs. M0  0.000266  13.28  2 4  M7  -785.00  Not allowed  M8  -784.70  None  M8 Vs. M7  0.606448  9.21  2  3  InL 1/4 log likelihood value. Amino acid sites inferred to be under diversifying selection (Posterior probabilities are shown in parenthesis). 5 Likelihood ratio test: 2∆L 1/4 2(InL alternative hypothesis-InL null hypothesis). 4  55  3.2.3  Characterization of the mos9 Single Mutant  To obtain the mos9 single mutant, mos9 snc1 was crossed with wild-type Col-0 plants. Lines homozygous for mos9 and wild type for S C1 were selected as the mos9 single mutant. As shown in Figure 3.5A, mos9 is morphologically indistinguishable from wild-type plants. To test whether MOS9 contributes to basal defence against virulent pathogens, mos9 plants were challenged with Psm ES4326 at a concentration of OD600 = 0.0001. Wild-type plants usually develop no disease symptoms at this low dose. Like wild-type plants, mos9 plants support similar bacterial growth 3 days after inoculation, whereas the susceptible control, Coleds1, carries 1000-time more bacteria (Figure 3.5B). Therefore, MOS9 does not seem to contribute to basal resistance. To determine whether MOS9 is required for resistance mediated by other TIR-type R proteins, we challenged mos9 single mutant plants with H.a. isolates Emwa1 and Cala2, and P.s.tomato (Pst) DC3000 carrying avrRps4 that can be recognized by TIR-type RPP4 (van der Biezen et al., 2002), RPP2 (Sinapidou et al., 2004), and RPS4 (Hinsch and Staskawicz, 1996), respectively. Resistance mediated by RPP4 is compromised in mos9 plants (Figure 3.5C). mos9 supported growth of ~1500 spores per seedling, while less than 200 spores were observed on wild type. However, resistance mediated by RPS4 (Figure 3.5D) and RPP2 (data not shown) is not affected in mos9 plants. Another large class of plant NLRs is the CC-type. To test whether MOS9 contributes to resistance mediated by CC-type NLRs, we challenged mos9 single mutant plants with Pst DC3000 carrying the avirulent effectors, avrRpt2, avrRpm1, or avrPphB that can be recognized by plant CC-type NLRs RPS2 (Kunkel et al., 1993; Yu et al., 1993), RPM1 (Debener et al., 1991), and RPS5 (Simonich and Innes, 1995), respectively. As shown in Figures 3.5E to 3.5G, mos9 single mutant plants were as resistant as wild-type Col-0 plants when challenged with bacterial pathogens carrying these avirulent effectors. These data suggest that MOS9 does not contribute to resistance mediated by these CC-type NLR R proteins. Because mos9 only affects resistance responses mediated by snc1 and RPP4, we tested whether the expression of snc1 and RPP4 is affected in the mos9 mutant background. As shown in Figure 3.5H, the expression level of snc1 is about half in the mos9 snc1 double mutant as that in snc1. In addition, RPP4 transcript is also similarly reduced in the mos9 single mutant (Figure 3.5I). These data suggest that MOS9 affects the expression levels of snc1 and RPP4.  3.2.4  Subcellular Localization of MOS9  Since protein sequence analysis of MOS9 yielded very little information, we first investigated its subcellular localization. MOS9 was expressed by its native promoter and with green fluorescent protein (GFP) fused to its C-terminus. MOS9-GFP fully complemented phenotypes associated with the mos9 mutation, and mos9 plants carrying the MOS9-GFP construct restored resistance against Ha Emwa1 (Figure 3.6A). This suggests that the construct expressing MOS9-GFP fusion protein localizes and functions as the wild-type MOS9 in planta. Very weak GFP signal was observed inside the nuclei in both root cells and leaf pavement cells (Figure 3.6B).  56  Because we could not exclude the possibility that MOS9 also localizes to other cellular compartments, we also carried out subcellular fractionation on complementing mos9 mutant plants expressing MOS9-GFP. As shown in Figure 3.6C, MOS9-GFP signal can be detected in both nuclear and nuclei-depleted fractions. Taken together, MOS9 seems to be a protein predominantly localizing to the nucleus.  3.2.5  Identification of MOS9-Associated Proteins  To better understand how MOS9 affects the expression levels of snc1 and RPP4, we searched for MOS9-associating proteins by affinity purification and mass spectrometry analysis. Because a large portion of MOS9-GFP protein is located inside the nucleus, the affinity purification experiments were carried out on the nuclear fractions of MOS9-GFP plants using anti-GFP microbeads. A nuclear fraction of wild type plants was used as negative control. SDS-PAGE followed by silver staining showed that two proteins, one about 150 kD and the other about 65 kD co-purified with the MOS9-GFP bait protein (Figure 3.7A). Mass spectrometry analysis showed that the large protein is Arabidopsis Trithorax-Related 7 (ATXR7), a nuclear Set1 class H3K4 methylase of 159 kD and the smaller protein is High Chlorophyll Fluorescence Phenotype 173 (HCF173; 66 kD), a protein with weak similarities to the shortchain dehydrogenases/reductases (Figure 3.7B). Neither protein was detected in the wild type control sample. Because HCF173 localizes to the chloroplasts (Schult et al., 2007), it is likely a false positive interactor. We therefore focused our further analysis on ATXR7. 3.3.6  Suppression of snc1 Mutant Phenotypes by atxr7-1  H3K4 methyl transferases ATXR7 and ATX1 are required for proper activation of FLC through H3K4 methylation (Tamada et al., 2009). The identification of ATXR7 as a protein associated with MOS9 prompted us to test whether ATXR7 is required for snc1 mutant phenotypes. We first introduced atxr7-1 into snc1 to determine whether a mutation in ATXR7 can suppress snc1 like mos9. As shown in Figure 3.8, atxr7-1 not only partially suppresses the stunted growth morphology of snc1 (Figure 3.8A), but also suppresses the enhanced disease resistance of snc1 against the virulent oomycete pathogen, Ha Noco2 (Figure 3.8B). The suppression of enhanced disease resistance of snc1 is also reflected by reduced S C1 and PR gene expression in atxr7-1 snc1 double mutant plants (Figure 3.8C to 3.8E). Unlike mos9 and atxr7, a mutation in the ATXR7 paralog, ATX1, cannot suppress the stunted growth morphology or the autoimmune phenotypes of snc1 (Figure 3.9). These data suggest that both MOS9 and ATXR7 are required for full expression of S C1 and snc1-mediated autoimmunity. Consistent with reduced transcripts of S C1, SNC1 protein levels were reduced in both mos9 and atxr7 single mutants when compared with that of wild type (Figure 3.8F).  57  Figure 3.5: Characterization of the mos9 single mutant. (A) Morphology of four-week old soil-grown WT and mos9 plants. (B) Psm ES4326 bacterial growth in WT, mos9, and Col-eds1 plants. Leaves were infiltrated with a bacterial suspension at OD600 = 0.0001 (Day 0). Bacterial growth was measured 3 days after infiltration (Day 3) as previously described in Zhang et al., 2003. (C) Growth of Ha Emwa1 on seedlings of the indicated genotypes. Two-week-old soil-grown plants were sprayed with Ha Emwa1 at spore suspension 100,000 spores per ml of water. At least 20 plants were collected for spore counting 7 days after inoculation. (D to G) Bacterial growth of Pseudomonas strains carrying avirulent effectors avrRPS4 (D), avrRpm1 (E), avrRpt2 (F), and avrPphB (G) on the indicated genotypes. Plants from each genotype were infiltrated with a bacterial suspension at OD600 = 0.002. Wild type Col (WT) and Col-eds1 or ndr1 plants were used as controls. (H) Relative S C1 and snc1 expression level in the indicated genotypes. (I) Relative RPP4 expression levels in WT and mos9. 58  Figure 3.6: uclear localization of MOS9-GFP. (A) Growth of Ha Emwa1 on seedlings of WT, mos9, and mos9 transformed with MOS9-GFP. Two-week-old soil-grown plants were sprayed with Ha Emwa1 at a spore suspension 100,000 spores per ml of water. At least 20 plants were collected for spore counting 7 days after inoculation. (B) Confocal microscopy images of MOS9-GFP localization in root and leaf pavement cells. Propidium iodide (PI) was used as cell wall stain. (C) Western blot analysis of fractioned protein samples from WT and MOS9-GFP transgenic plants. PEPC and Histone H3 were used as cytosolic and nuclear protein markers, respectively. N: nuclear fraction; ∆N: nuclei-depleted fraction. 59  Figure 3.7: Identification of proteins associated with MOS9-GFP. (A) Silver-stained SDS-PAGE gel of the anti-GFP microbeads-immunoprecipitated protein samples from WT and MOS9-GFP transgenic plants. Two specific protein bands shown in MOS9-GFP IP sample are indicated with arrows. (B) List of the specific proteins identified from the MOS9-GFP immuneprecipitated sample.  60  Figure 3.8: Mutation in ATXR7 suppresses snc1. (A) Morphology of WT, snc1, mos9 snc1, and atxr7 snc1 plants. The picture shows four-weekold soil-grown plants. (B) Growth of H. a. Noco2 on the indicated genotypes. Two-week-old seedlings were sprayed with H. a. Noco2 at a concentration of 100,000 spores per ml of water. The infection was scored 7 days after inoculation. The values presented are averages of four replicates ± standard deviation. (C) Relative S C1 transcript levels in the indicated genotypes. (D and E) Relative expression of PR1 (D) and PR2 (E) levels in the indicated genotypes. (F) SNC1 protein levels in the indicated genotypes as detected by western blot analysis using a SNC1-specific antibody (Li et al., 2010a).  61  Figure 3.9: Mutation in ATX1 does not affect snc1-mediated immunity. (A) Morphology of WT, snc1, mos9 snc1, and atx1 snc1 plants. The picture was taken on 4week-old soil-grown plants. (B) Growth of H. a. Noco2 on the above genotypes. Two-week-old seedlings were sprayed with H. a. Noco2 at a concentration of 100,000 spores per ml of water. The infection was scored 7 days after inoculation. The values presented are averages of four replicates ± standard deviation.  62  3.3.7  ATXR7 is Required for RPP4 Expression and RPP4-Mediated Immunity  We further tested whether ATXR7 is required for RPP4-mediated disease resistance toward Ha Emwa1. As shown in Figure 3.10A, atxr7 mutant plants supported much higher growth of Ha Emwa1 than wild type. Similar as with S C1, expression of RPP4 is also reduced in atxr7 (Figure 3.10B), suggesting that reduced expression of RPP4 results in compromised resistance to Ha Emwa1 in atxr7-1.  3.3.8  Analysis of H3K4me3 Levels in the Promoter Regions of S C1 and RPP4  Because H3K4 methylation is correlated with transcriptional activation and ATXR7 functions as a H3K4 tri-methyl transferase, we further investigated whether MOS9 plays a role in the regulation of H3K4me3 levels in the promoter regions of S C1 and RPP4 by chromatin immunoprecipitation (ChIP) assays using an antibody that specifically recognizes H3K4me3 marks. Real-time PCR was carried out on the DNA samples from the ChIP assays using primers specific to DNA close to the start codon of S C1 and RPP4. As shown in Figure 3.10C, mos9 plants have reduced H3K4me3 levels in RPP4 and S C1 compared to wild type, suggesting that MOS9 functions together with ATXR7 to regulate H3K4 tri-methylation.  63  Figure 3.10: Compromised RPP4-mediated resistance in atxr7 and mos9 plants, and reduced H3K4me3 levels in mos9 at S C1 and RPP4 loci. (A) Growth of Ha Emwa1 on WT, mos9, and atxr7 mutant plants. Two-week-old soil-grown plants were sprayed with Ha Emwa1 at spore suspension 100,000 spores per ml of water. At least 20 plants were collected for spore counting 7 days after inoculation. (B) Relative RPP4 expression level in the indicated genotypes. (C) Relative levels of H3K4me3 at S C1 and RPP4 as determined by ChIP-PCR analysis in WT and mos9 mutant seedlings. The y axis indicates relative levels of modifications. Each experiment was normalized to no antibody treatment. Bars indicate standard deviations. (D) A conceptual model on the regulation of S C1 or RPP4 expression by MOS9 and ATXR7. MOS9 associates with ATXR7 in a multi-protein complex. This association is probably responsible for the specificity of the target genes, such as S C1 and RPP4, for H3K4 bulk methylation by ATXR7.  64  3.4  Discussion  From the MOS forward genetics screens intended to isolate positive regulators of snc1-mediated immunity, we have identified mos9. This modifier partially suppresses the autoimmune phenotypes of snc1, including dwarfism, constitutive PR gene expression, elevated SA levels, and enhanced resistance against bacterial and oomycete pathogens. Positional cloning followed by transgene complementation revealed that MOS9 encodes a small plant-specific protein with no known conserved domain or function. More detailed analysis on the mos9 single mutant uncovered that MOS9 is not only required for snc1-mediated autoimmunity, it is also essential for RPP4-mediated resistance against the oomycete Ha Emwa1. MOS9 is not required for basal resistance. Further expression analysis of S C1 and RPP4 in the mos9 background revealed that, in mos9 plants, the expression of both TIR-NB-LRR-encoding genes is significantly reduced, leading to attenuated resistance mediated by the encoded NLR proteins. Thus, MOS9 seems to be a nuclear regulator specifically required for proper transcription of S C1 and RPP4. The regulation of R protein-mediated immunity is very complex. However, stringent control has to be imposed at R gene and R protein levels to ensure appropriate degree of immunity outcome conferred by these receptors. Despite the importance of R gene transcriptional regulation, its mechanisms are poorly understood. From past expression analysis and various microarray experiments, it has been taken for granted that most R genes are expressed at low level without pathogen interaction. Upon infection, many R genes, but not all, are moderately up-regulated, presumably to amplify immune signals and enhance immunity against pathogen attack (de Torres et al., 2003; Navarro et al., 2004). From the RPP7 suppressor screen, EDM2 was identified as a transcriptional regulator of RPP7 (Eulgem et al., 2007). EDM2 is a plant-specific nuclear protein with plant homeodomain (PHD)-finger-like domains. Loss of EDM2 renders plants more susceptible to Ha Hiks1 due to reduced RPP7 expression (Tsuchiya and Eulgem, 2010). MOS1, identified in the same screen as MOS9, encodes a conserved nuclear protein with a BAT2 domain of unknown function (Li et al., 2010b). Mutations in MOS1 attenuate the expression of S C1. The exact mechanism of how EDM2 and MOS1 regulate R gene transcription is unclear; however, regulation at the chromatin level is speculated for both proteins. MOS9 is annotated as an unknown protein. Its only Arabidopsis paralog is At1g56420, which shares 39% identity and 60% similarity at amino acid level with MOS9 throughout the protein sequence (Figure 3.3A). As shown by phylogenetic analysis (Figure 3.4), MOS9 and At1g56420 are both plant-specific proteins although, curiously, they belong to two separate clades. The cluster including MOS9 exhibits longer branches, suggesting that MOS9 has evolved faster compared to its paralog. This was confirmed by the maximum likelihood analysis implemented in the CODEML package (Yang, 2007) which shows at least two amino acid residues in MOS9 may be positively selected whereas there is no indication of positive selection in the paralogs (Table 3.2 and 3.3). Faster evolving genes are often under positive selection such as biotic stresses. The evolution pattern of MOS9 somewhat mimics the fast-evolving NB-LRRencoding R genes. It is possible that as a transcriptional regulator, MOS9 has coevolved with its target R genes to properly regulate their transcription. The biological function of the MOS9 paralog At1g56420 is unclear. It seems to be highly conserved in higher plants (Figure 3.4). Unfortunately, there is no null knockout line available from the public resources. RNAi lines for At1g56420 did not exhibit any obvious defects with  65  regards to plant morphology, growth or development. When the RNAi construct was transformed into the mos9 snc1 double mutant, no enhanced or suppressed snc1-mediated autoimmunity was observed either (Figure 3.3B). These data suggest that At1g56420 does not share redundancy with MOS9. Conceivably, like MOS9, At1g56420 may be specifically involved in the regulation of proper transcription of unknown target genes. MOS9 is a nuclear protein associating with SET domain-containing protein, ATXR7 (Figure 3.7). Although we did not detect direct protein-protein interaction between MOS9 and ATXR7 in our yeast-two-hybrid analysis (data not shown), it is possible that there exist additional intermediates between the two proteins in the same protein complex (Figure 3.10D). The SET domain was named after Drosophila Su(var)3-9, Enhancer of zeste [E(z)], and Trithorax. Highly conserved amongst eukaryotes, most of the SET domain-containing proteins exhibit histone lysine methyl transferase (HKMT) activity. In recent years, histone modifications, in particular histone methylation marks, have been shown to be associated with different transcriptional activities of their target genes. For example, H3K4, H3K36, and H3K79 methylation is correlated with transcriptional activation, whereas methylation at H3K9, H3K20 and H4K27 is associated with transcriptional silencing or repression. In addition, each lysine residue of H3 can be mono-, di-, or trimethylated, and each methylation status may have a different biological relevance (Liu et al., 2010). These add more complexity to fine-tune the expression of a target gene at various developmental stages or during different cellular responses such as an immune response. Specifically, SET1/COMPASS/ATXR7 proteins are H3K4 methyl transferases, where H3K4me3 are most often histone marks for actively transcribed genes. There are three SET1/COMPASS orthologs in Drosophila and six in human. They serve diverse roles in regulating gene expression in various biological processes such as development, diseases including cancer, aging, and pathogenesis (Shilatifard, 2012). In Arabidopsis, ATXR7 is the only homolog of yeast SET1/COMPASS, which regulates flowering time by modifying the methylation status of histones close to the ATG start codon of the master flowering time repressor FLOWERI G LOCUS C (FLC) (Tamada et al., 2009). Like mos9, atxr7 suppresses the stunted growth and autoimmune phenotypes of snc1 (Figure 3.8). The expression level of S C1 and RPP4 is also lower in both mos9 and atxr7 mutant backgrounds (Figure 3.5H, 3.8C and 3.10B). These data suggest that both MOS9 and ATXR7 are required for full expression of S C1 and RPP4, which is crucial for providing the appropriate level of immunity mediated by these TIR-NB-LRR-encoding genes. Such transcriptional control is probably brought about through ATXR7 by H3K4 bulk methylation. Since mos9 does not exhibit any flowering time defects (data not shown), and MOS9 does not have obvious DNA-binding motifs, it is possible that MOS9 is responsible for directing ATXR7 specifically to its target genes such as S C1 and RPP4. Agreeing with this hypothesis, less H3K4me3 was detected around the promoter region of S C1 and RPP4 in mos9 mutant plants (Figure 3.10C). One intriguing fact about S C1 and RPP4 is that they are highly homologous TIR-type NLR-encoding genes residing in the RPP4 cluster on chromosome 4 (Noel et al., 1999). We speculate that MOS9 could co-regulate these two R genes through histone modification due to close proximity. Such speculation is supported by an independent study of LAZARUS 5 (LAZ5; (Palma et al., 2010)). While searching for mutations that can suppress the autoimmunity and spontaneous cell death phenotype of acd11, Palma et al. found that acd11 is suppressed by mutations in LAZ2 and LAZ5. Further studies revealed that the expression of LAZ5, a TIR-NBLRR-encoding gene, is under the control of LAZ2, which encodes another SET domain protein,  66  SDG8. SDG8 is responsible for H3K36 di- and tri-methylation, also a histone mark for actively transcribing genes. Interestingly, it was found that not all R genes tested are affected by the laz2 mutation. Besides LAZ5, the expression level of another TIR-NB-LRR-encoding gene, At5g45230, located very close to LAZ5 (At5g44870), is also affected by the laz2 mutation. Thus, co-expression regulation through histone modifications could be a common theme in regulating R gene activity, especially when they are in close proximity. This type of regulation shares resemblance with a phenomenon observed in cancer cells where tumor suppressor genes are coordinately silenced during carcinogenesis – a process called Long Range Epigenetic Silencing (LRES). LRES can affect megabases of DNA, and can result in heterochromatin formation and hypermethylation of contiguous CpG islands inside the region (Clark, 2007; Coolen et al., 2010). Recent cancer epigenomics studies revealed that LRES might be achieved through a combination of reinforcement of repressive histone marks in genomic regions that are normally silenced and gain of repressive marks in regions that are transcriptionally active in normal cells. In addition, exchange of repressive marks on genes that are inactive or expressed at low levels in normal cells was also observed. It can be speculated that co-activation of R genes in close proximity may be achieved through coordinated opposite types of histone modifications such as H3K4, H3K36, and H3K79 methylations that are associated with transcriptional activation. This type of coordination probably involves protein factors such as MOS9. Due to the nature of R protein-mediated responses, it is essential that the proper level of R gene expression is achieved with or without pathogen infection. Without infection, R genes are expressed at low levels – presumably to be prepared for immunity and take part in basal defence. With pathogen attack, proper expression has to be maintained to ensure the production of enough R protein molecules to take care of pathogen recognition, defence activation, and defence amplification and maintenance. Excessive R gene expression would lead to autoimmunity while insufficient expression would lead to disease. Our study of MOS9 revealed that it is required for full expression of S C1 and RPP4. This positive regulation of expression likely involves H3K4me3 histone modifications by ATXR7, which associates with MOS9 (Figure 3.10D). We anticipate that there are other regulators in addition to H3K4 and H3K36 methylation events involved in R gene expression, and that there must also be repressive forces that hold the R genes under check to prevent autoimmunity. Future in-depth studies on these mechanisms will reveal the full picture of the intricate epigenetic regulation of expression of R genes.  67  3.5  Material and Methods  3.5.1  Plant Growth Conditions, Mutant Screen and Mutant Phenotypic Characterization  All plants were grown at 22°C under a 16-hour light/8-hour dark regime. mos9 snc1 was identified from a fast neutron-treated snc1 mutant population previously described (Zhang and Li, 2005). In brief, the M2 population of fast neutron treated snc1 (carrying pPR2::GUS reporter gene system) was first screened for suppression of snc1’s dwarf and stunted growth morphology. These putative mutants were further tested for suppression of constitutive defence phenotype of snc1 by carrying out GUS staining. Mutants that showed reduced or no GUS staining were studied further. Gene expression analysis was carried out by extracting RNA from 2-week-old plategrown or 4-week-old soil-grown plants using the Totally RNA kit (Ambion). The extracted total RNA (~0.4µg) was then reverse transcribed using SuperScript II reverse transcriptase (Invitrogen). Expression analysis for PR1, PR2, and Actin1 was performed as previously described by Zhang et al., 2003, with cDNA samples being normalized by real-time PCR using Actin1 and the QuantiTect SYBR Green PCR kit (Qiagen). Gene-specific primers for RT-PCR analyses used in this study are listed in Table 3.4. Infection experiments with Pseudomonas and Hyaloperonospora strains were performed as described (Li et al., 2001). In brief, infection of Ha Noco2 was performed on 2-week-old seedlings by spraying with an Ha Noco2 spore suspension at a concentration indicated in figure legends. Plants were maintained at 18°C under 12-hour light/12-hour dark cycles with 80% humidity, and the infection was scored 7 days after inoculation by counting the number of conidiospores per gram of tissue (when plants of different treatments are of different sizes) or per plant (when plants of different treatments are of similar sizes) using a haemocytometer or using a 0 to 5 disease rating system as previously described (Jing et al., 2011).  3.5.2  Map-Based Cloning  Positional cloning of mos9 was performed as previously described (Zhang and Li, 2005). The markers used to map mos9 were designed according to the insertion-deletion (InDel) polymorphisms between the genomic sequences of Col and Ler ecotypes provided by Monsanto on The Arabidopsis Information Resource homepage (https://www.arabidopsis.org/Blast/cereon.jsp). Primer sequences for these markers are listed in Table 3.4.  68  3.5.3  Construction of Plasmids  For the construction of pGreen0229-pMOS9::MOS9 which was used for transgene complementation of mos9 snc1, the genomic sequence covering the MOS9 coding region plus 1.8 kb 5’-upstream and ~0.4 kb 3’-dowstream sequence was PCR amplified using primers 5’-CGCGGATCCGACGTGGAGACGATCGGGAG-3’ and 5’-CCGGAATTCCATCCGACACTAGGTTCTTG-3’. The amplified fragment was digested with BamHI and EcoRI and the digested fragment was cloned into pGreen0229 vector. For construction of pCambia1305-pMOS9::MOS9-GFP which was used for subcellular localization of MOS9-GFP and immunoprecipitation of MOS9-GFP experiments, the genomic sequence covering the MOS9 coding region without the stop codon plus 1.8 kb 5’-upstream sequence was PCR-amplified using primers 5’-ccgGAATTCcatccgacactaggttcttg-3’ and 5’-CGCggatccGCCAAAGCCAGGAGGGAGTTC-3’. The amplified fragment was digested with BamHI and EcoRI and the digested fragment was cloned into a modified pCAMBIA1305 vector that contained a GFP tag. All constructs were transformed into designated genotypes using the floral dip method (Clough and Bent, 1998) to generate transgenic lines for subsequent analysis.  3.5.4  Mutant Genotyping  Mutants described in this study were PCR genotyped using the following primers. For genotyping mos9, which was generated using fast neutron bombardment, primer pairs 4269391_F: GGCGTAGACGGATTGAACGG and At1g12530_R: TGATGCATCATGAAGCCCTG were used. A fragment with ~1.4 kb can be amplified from wild-type MOS9 but not from homozygous mos9 mutant. Seeds of ATX1 and ATXR7 mutants were obtained from Dr. Amasino (Tamada et al., 2009); they are T-DNA insertional mutant alleles and were genotyped by using the primer pairs listed in Table 3.4.  3.5.5  Total Protein Extraction  For total protein extraction, 0.1 g leaf tissue of 4-week-old soil grown plants was harvested in liquid nitrogen and ground into fine powder. Samples were homogenized in extraction buffer (100mM Tris-HCl pH8, 0.2% SDS, 2% β-mercaptoethanol). After 5 min of centrifugation at 4°C at 13,200 rpm, the supernatant was transferred to a new tube containing 4x Laemmli loading buffer and heated at 95°C for 5 min. Protein samples were loaded onto SDS-PAGE and followed by western blot analysis.  69  3.5.6  Nuclear Fractionation  Approximately 3g of 2-week-old plate-grown plants were frozen in liquid nitrogen, ground to fine powder and homogenized in 1.5V of lysis buffer (20mM Tris-HCl, pH 7.4, 25% glycerol, 20mM KCl, 2mM EDTA, 2.5mM MgCl2, 250mM sucrose) at 4°C. The homogenate was sequentially filtered through a 100- and 30-µm nylon mesh. The nuclei were pelleted by centrifugation at 1500 g for 10 minutes. The nuclei pellet was washed three times with nuclei resuspension buffer with Triton X-100 (NRBT; 20 mM Tris-HCl, pH 7.4, 25% glycerol, 2.5 mM MgCl2, 0.2% Triton X-100) at 4°C, and then washed once with nuclei resuspension buffer without Triton X-100 (NRB). The final nuclei pellet was resuspended in 300µl 2x Laemmli loading buffer and heated at 95°C for 5 min. For western blot analysis, the nuclear fraction was loaded 20x more than the nuclei-depleted fraction.  3.5.7  Nuclear Extraction and Immunoprecipitation  Approximately 20 g of 2-week-old plate-grown plants were frozen in liquid nitrogen, ground to fine powder and homogenized in lysis buffer (20mM Tris-HCl, pH 7.4, 25% glycerol, 20mM KCl, 2mM EDTA, 2.5mM MgCl2, 250mM sucrose) at 4°C. Two samples were prepared simultaneously. Wild-type Col plants were used as negative control, and MOS9-GFP transgenic plants were used for immunopurification. Nuclei were purified as above and then resuspended in 2 mL ice-cold buffer NE-2 (20mM HEPES-KOH, pH 7.9, 2.5mM MgCl2, 250mM NaCl, 20% glycerol, 0.2% Triton X-100, 0.2mM EDTA, 1mM DTT and protease inhibitor cocktail (Sigma) and then subjected to sonication for 4 minutes with 5 seconds ON and 10 seconds OFF intervals to completely release nuclear proteins. The supernatant was mixed with 50 µL of anti-GFP MicroBeads (Miltenyi Biotec) and incubated at 4°C for one hour; the MicroBeads-bound target protein was magnetically precipitated on columns according to the manufacturer’s instructions (µMACs; Miltenyi Biotec). The columns were then washed 8 times, each time with 1mL NE-3 buffer (20mM HEPES-KOH, pH 7.9, 2.5mM MgCl2, 150mM NaCl, 20% glycerol, 0.2% Triton X-100, 0.2mM EDTA, 1mM DTT and protease inhibitors) before proteins were eluted with 60 µL 95°C pre-heated 1xSDS loading buffer. The samples were subsequently analyzed by SDSPAGE followed by silver staining using ProteoSilverTM Plus Silver Stain Kit (Sigma). The protein bands specific to MOS9-GFP were excised for MS analysis. Gel bands at the same positions of the Col treatment were also excised. The MS data from MOS9-GFP were compared with that of Col to rule out false-positive identifications.  70  3.5.8  Chromatin Immunoprecipitation (ChIP)  ChIP was performed as described previously (Lee et al., 2007) with some modifications. In brief, ~8g of two-week-old seedlings grown on MS plate were collected and cross-linked with 1% formaldehyde for 20 min and the cross-linking was terminated by adding 2M glycine to final concentration of 0.125M and vacuumed for 5 min. After rinsing seedlings with distilled water for 5 times, tissues were ground into fine power using liquid nitrogen and nuclei purified as described above. Nuclei pellet was re-suspended in 1mL ChIP lysis buffer (50 mM Tris-HCl, pH 8.0, 10mM EDTA, pH 8.0, 1% SDS, 1x Protease inhibitor, 1 mM PMSF) and sonicated with a Fisher 550 Sonic Dismembrator for 2 min (15 sec ON and 60 sec OFF , power 4.0) to yield DNA of an average fragment size of ~0.5 to 1.0kb. Sonicated chromatin was centrifuged at 13000 rpm at 4°C for 5 min to pellet the debris and the supernatant was collected into a new 1.5ml eppendorf tube. The soluble chromatin solution was diluted 10-fold with ChIP dilution buffer (16.7 mM Tris-HCl, pH8.0, 167mM NaCl, 1.1% Triton X-100, 1.2 mM EDTA, 1x Protease inhibitor, 1mM PMSF) to decrease the SDS concentration to 0.1%. Chromatin solution was pre-cleared with no antibody conjugated Protein A Sepharose (GE Healthcare ; 17-1279) at 4°C for 1 hour with gentle rotation and 1 µL of α-H3K4me3 (Abcam, ab8580) antibody was added to ~2.5 mL of diluted chromatin solution and incubated at 4°C overnight. 30µl pre-washed Protein A Sepharose beads (GE Healthcare; 17-1279) were added to each sample to pull down the antibody for 2 hours at 4 °C. After washing with different washing buffers, immunocomplex was eluted twice from the beads with 250 µL of elution buffer (0.1M NaHCO3, 1% SDS). Eluted immunocomplex was reverse cross-linked by adding 5M NaCl to a final concentration of 200mM at 65°C overnight. Protein was removed by adding proteinase K and DNA was extracted using phenol/chloroform/isoamyl alcohol (25:24:1) followed by chloroform/isoamyl alcohol (24:1) extraction methods and precipitated by ethanol. The immunoprecipitated DNA was resuspended in TE buffer and subjected to real-time PCR analysis with primers listed in Table 3.4.  3.5.9  Phylogenetic Analyses of MOS9 and Its Homologs  To identify whether MOS9 or MOS9 paralogs have been positively selected due to selection pressure such as biotic stress, we used maximum likelihood models of codon substitution that allow for heterogeneous selection pressures among amino acid residues along the protein (Nielsen and Yang, 1998; Yang and Bielawski, 2000; Yang et al., 2000). Analyses were performed with the computer program ‘codeml’ in the PAML package (Yang, 2007).  71  Table 3.4: Primer sequences used in the study.  72  3.6  Acknowledgements  We thank Dr. Richard M. Amasino (University of Wisconsin, Madison) for seeds of atxr7 and atx1, and Dr. Kristoffer Palma and Ms. Kaeli Johnson for careful reading of the manuscript. The work described here was funded by the Canadian National Science and Engineering Research Council (NSERC) Discovery grant program, Michael Smith Laboratories, and the UBC Department of Botany William Cooper Endowment Fund.  73  4  Stability of Plant Immune Receptor Resistance Proteins is Controlled by SCF-Mediated Protein Degradation6  4.1  Introduction  Plants and animals rely on innate immunity to defend against microbial pathogen infections. Although plant surface-residing receptors often recognize common features of the microbes, intracellular receptors detect specific effectors from pathogens to initiate a downstream defense cascade (Jones and Dangl, 2006). Remarkably, plants and animals use immune sensors with similar structural features, such as nucleotide-binding (NB) and leucine rich repeats (LRR) domains (Eitas and Dangl, 2010). These immune receptors are commonly named Nod-like Receptors (NLRs; or nucleotide binding and leucine-rich repeat-containing) after the human innate immunity receptor Nod1 and Nod2 (Magalhaes et al., 2011). In plants, they are designated as NB-LRR resistance proteins (NLR R proteins). Upon detection of specific pathogen effectors, R proteins mount a quick and robust reaction, usually culminating in a hypersensitive response, a type of programmed cell death, to defend against and restrict further spread of the pathogen (Jones and Dangl, 2006). Because of the detrimental effects of R protein activation on plant cell growth and development, normally R protein-mediated immunity has to be under multiple levels of tight negative control. Overaccumulation of R proteins often leads to autoimmunity, implying the importance of stability control of R protein levels. In addition, gain-of-function mutants of NLRs, such as snc1 (suppressor of npr1-1, constitutive 1) and ssi4 (suppressor of salicylic acid insensitivity of npr1-5, 4), can render the NLR proteins constitutively active without pathogen interaction (Li et al., 2001; Shirano et al., 2002). These mutations are speculated to enhance the stability or activities of the NLRs. Constitutive expression of defense marker Pathogenesis Related (PR) genes, enhanced pathogen resistance, and altered plant development, such as dwarfism, are general features of plant autoimmunity. The Arabidopsis genome contains about 170 genes encoding NLRs (Tan et al., 2007), with either Toll/IL-1 receptor (TIR) or coiled-coil (CC) domains at their N terminus. The detailed activation mechanism of NLR R proteins is unclear. During the past decade, intensive studies on RAR1, SGT1, and HSP90 using genetic and biochemical approaches established these components as members of fold and stabilize NLR R proteins (Shirasu, 2009; Zhang et al., 2010). Interestingly, mammalian SGT1 and HSP90 were also shown to be required for NLR mediated immune responses. Some NLRs, including Nod1 and Nod2, form complexes with HSP90 and SGT1 (Mayor et al., 2007). Aside from the positive roles SGT1 plays in R protein folding, it is also involved in the negative regulation of R protein stability. A loss-of-function mutation in SGT1b restores reduced accumulation of CC-type NLR RPS5 in rar1 mutant plants (Holt et al., 2005). In addition, level of SNC1 is increased in sgt1b mutant plants. Recently, the evolutionarily conserved SRFR1 was shown to interact directly with SGT1 (Li et al., 2010). Loss-of-function of SRFR1 results in increased accumulation of SNC1 and activation of SNC1-mediated defence responses (Kim et al.,  6  A version of this chapter has been published. Yu Ti Cheng, Yingzhong Li, Shuai Huang, Yan Huang, Xinnian Dong, Yuelin Zhang and Xin Li. (2011) Proceedings of the ational Academy of Sciences USA 108(35):14694-9.  74  2010; Li et al., 2010). However, the mechanism on how SGT1 and SRFR1 negatively regulate the accumulation of R proteins is unclear. Besides interactions with HSP90 and RAR1, SGT1 was also shown to associate with SKP1 and CULLIN1 (CUL1) (Azevedo et al., 2002; Shirasu, 2009), members of the SCF (SKP1-CUL1-F-box protein) E3 ubiquitin ligase complex that targets specific substrate proteins for ubiquitination and most often subsequent protein degradation. The F-box protein usually interacts directly with the protein substrate and serves as the substrate determinant of SCF. The association between SGT1 and SCF suggests potential connections between SCF and R proteinmediated immunity. Here we provide experimental evidence that Arabidopsis F-box protein CPR30/CPR1 targets NLR proteins SNC1 and RPS2 for degradation, revealing how some NLR R protein levels are controlled mechanistically.  4.2  Results  4.2.1  snc1 Mutation Affects the Stability of SNC1  The gain-of-function mutant snc1 carries a mutation in S C1, an NLR R-like gene that leads to constitutive activation of defense responses in Arabidopsis (Li et al., 2001; Zhang et al., 2003). Like other TIR-type R proteins, snc1 signals through PAD4 (Wiermer et al., 2005). Mutations in PAD4 can completely suppress the dwarfism of snc1 caused by autoimmunity (Figure 4.1A). To investigate how the E552 to K552 change in the linker region causes constitutive activation of SNC1, we first examined the snc1 transcript level in the mutant and found only a moderate increase (Figure 4.1B). This increase is fully suppressed when PAD4, an essential signaling component downstream of S C1, is mutated (Figure 4.1B), indicating that the increased snc1 transcription is caused by feedback up-regulation from downstream defense signaling. With the availability of an antibody specific to the endogenous SNC1 protein (Li et al., 2010), we analyzed snc1 protein levels in snc1 and snc1 pad4 plants. To our surprise, snc1 protein levels are still considerably higher in the snc1 pad4 double mutant plants than in the wild-type (Figure 4.1C), suggesting that the snc1 mutation renders the R protein more stable.  75  Figure 4.1: Increased snc1 protein levels in snc1 and snc1 pad4 double mutant. (A) Morphology of wild-type Col (WT), snc1 (gain-of-function allele of S C1), and snc1 pad4 double-mutant plants (Zhang et al., 2003). The picture was taken with 4-week-old soil-grown plants. (B) qRT-PCR analysis of SNC1 transcript levels in WT, snc1, and snc1 pad4 plants. (C) Western blot analysis of SNC1/snc1 protein levels in snc1-r1 (a loss-of-function deletion allele of S C1), WT, snc1, and snc1 pad4 plants (Zhang et al., 2003). Rubisco levels serve as loading control.  76  4.2.2  cul1-7 Exhibits Increased SNC1 Level and Constitutive Defence Responses  Because a mutation in SGT1b also results in increased SNC1 protein level and SGT1 associates with SKP1 and CUL1 (Azevedo et al., 2002; Shirasu, 2009; Li et al., 2010), two shared members of the SCF E3 ubiquitin ligase complex, we asked whether the stability of SNC1 could be controlled by SCF-mediated protein degradation. In Arabidopsis, null mutations in CUL1 are lethal (Shen et al., 2002). A partial loss-of-function allele of CUL1, cul1-7, was found to exhibit a dwarf phenotype similar to snc1 (Gilkerson et al., 2009) (Figure 4.2A). In cul1-7, the T510 to I510 substitution seems to affects the C terminus of the protein, as well as the stability of CUL1, thus resulting in the misregulation of SCFs. The mutant exhibited accumulation of target proteins of many known SCF complexes, including AUS/IAA1 and RGA1 for auxin and gibberellic acid signaling, respectively (Gilkerson et al., 2009). Additionally, cul1-7 plants express high levels of defence-marker PR genes, PR1 and PR2 (Figure 4.2B and C), suggesting that the mutation causes activation of defence responses. The dwarfism of cul1-7 is more severe than that of snc1 and can be partially complemented by a transgene expressing the CUL1-FLAG fusion protein (Gilkerson et al., 2009) (Figure 4.2A). Although the transcript level of S C1 in cul1-7 is not significantly different from that of wild-type (Figure 4.2D), Western blot analysis showed that the SNC1 protein level in cul1-7 was much higher than that in wild-type and this increased accumulation of SNC1 can be partially complemented by the CUL1-FLAG transgene (Figure 4.2E), indicating that CUL1 contributes to the control of SNC1 levels.  4.2.3  SNC1 Protein Levels are Increased in cpr1 and cpr30 Mutants  The substrate specificity of the SCF complexes is most often determined by the F-box proteins. Previously it was shown that mutations in the F-box protein, CPR30 [At4g12560; Constitutive PR gene expression, 30 (cpr30)], lead to constitutive activation of PR genes, accumulation of the defence hormone salicylic acid, and a dwarf phenotype strikingly similar to that of snc1 (Gou et al., 2009) (Figure 4.3A). Western blot analysis revealed that SNC1 overaccumulates in the cpr30 mutant plants (Figure 4.3B). Another well-known mutant with constitutive defence responses and snc1-like morphology is cpr1 (Bowling et al., 1994) (Figure 4.3A). Although cpr1 was isolated over 15 years ago, its identity was unknown. Interestingly, similar to the cpr30 alleles, the SNC1 protein level in cpr1 was much higher than that in wild type (Figure 4.3B). The levels of SNC1 in cpr1 and two alleles of cpr30 are very similar.  4.2.4  cpr1 and cpr30 are Allelic Mutations  Because cpr1 and cpr30 are both recessive mutations mapped to chromosome 4 (Bowling et al., 1994; Gou et al., 2009), we crossed cpr1 and cpr30-2 to test for allelism. As shown in Figure 4.3C, cpr1 and cpr30-2 failed to complement in F1, indicating that they are allelic to each other. Because cpr1 was identified as the founding member of the cpr-type mutants, for simplicity and to avoid confusion in the literature, we renamed cpr1 as cpr1-1, the allele obtained by Gou et al.  77  (Gou et al., 2009) (previously named cpr30-1) as cpr1-2, and the T-DNA allele (SALK_045148; previously named cpr30-2) as cpr1-3. Further sequence analysis of cpr1-1 revealed a G to A point mutation in At4g12560. This mutation is located at an intron-exon junction (Figure 4.4), leading to a shift of the splicing site which results in a reading frame change in the gene. When a construct expressing At4g12560 under the control of a 35S promoter was transformed into cpr1-1, all transgenic plants exhibited wild-type morphology (Figure 4.3D); this confirms that the cpr1-1 mutant phenotype was caused by the mutation in At4g12560.  4.2.5  Constitutive Defence Responses in cpr1-3 Are Largely Suppressed by Knocking Out S C1  To test whether the increased SNC1 protein accumulation contributes to the activation of defence responses in the cpr1 mutants, we crossed snc1-r1, a loss-of-function deletion allele of S C1 (Zhang et al., 2003), into cpr1-3. As shown in Figure 4.5A, the snc1-r1 mutation reverted cpr1-3 to wild-type morphology. Analysis of PR gene expression showed that constitutive expression of both PR1 and PR2 was reduced in snc1-r1 cpr1-3 (Figure 4.5B and C). In addition, enhanced resistance against the virulent oomycete pathogen Hyaloperonospora arabidopsidis Noco2 in cpr1-3 was also attenuated by the snc1-r1 mutation (Figure 4.5D). These data suggest that overaccumulation of SNC1 in cpr1-3 is one of the main factors leading to the cpr1 autoimmune mutant phenotypes.  4.2.6  Overexpression of CPR1 Results in Reduced snc1 Protein Levels and Suppression of snc1 Mutant Phenotypes  Increased accumulation of SNC1 protein in cpr1 mutants and suppression of cpr1-3 phenotypes by snc1-r1 suggest that CPR1 might target SNC1 for degradation. Because the F-box proteins are usually the limiting factor in SCF-mediated target protein degradation, we tested whether overexpression of CPR1 would reduce the accumulation of SNC1 by overexpressing CPR1 in the snc1 mutant background. As shown in Figure 4.6A, snc1 transgenic lines T1-5 and T1-6 carrying 35S::CPR1 exhibit wild type-like morphology. Both lines expressed high levels of CPR1 (Figure 4.6B) and modestly reduced level of S C1 (Figure 4.6C) because of reduced feedback up-regulation in snc1. In addition, enhanced resistance against H. arabidopsidis Noco2 (Figure 4.6E) and constitutive PR gene expression (Figure 4.6F and G) in snc1 were completely suppressed in the CPR1 overexpression lines. Western blot analysis revealed that snc1 protein accumulation was clearly reduced even below the wild-type level in the two CPR1 overexpression lines (Figure 4.6D). These data support that CPR1 is the F-box protein targeting SNC1 for degradation.  78  Figure 4.2: Increased accumulation of S C1 proteins in cul1-7 mutant. (A) Morphology of WT, snc1, cul1-7 and cul1-7 carrying the partially complementing transgene CUL1-FLAG. The picture was taken with five-week-old soil-grown plants. (B-C) qRT-PCR analysis of the expression of PR1 (B) and PR2 (C) in the indicated genotypes. (D) Western blot analysis of SNC1/snc1 protein levels in snc1-r1, wild type (WT), snc1, cul1-7 and a transgenic line expressing CUL1-FLAG in cul1-7 (CUL1-FLAG in cul1-7) (Gilkerson et al., 2009).  79  Figure 4.3: cpr1 and cpr30 are alleles of At4g12560. (A) Morphology of WT, cpr1 (later renamed to cpr1-1), cpr30-1 (renamed to cpr1-2), cpr30-2 (renamed to cpr1-3), and snc1. (B) Western blot analysis of SNC1 protein levels in cpr1 (renamed cpr1-1), cpr30-1 (renamed cpr1-2) and cpr30-2 (renamed cpr1-3). snc1-r1, wild type (WT) and snc1 plants were used as controls. (C) Allelism test between cpr30-2 and cpr1. Morphology of two F1 plants from the cross between cpr30-2 and cpr1, with WT, cpr30-2 and cpr1 plants as controls. (D) Complementation of cpr1-1 by the CPR1 transgene under 35S promoter. Morphologies of two independent transgenic lines (T1-2 and T1-4) are shown.  80  Figure 4.4: Sequence analysis of cpr1. (A) Gene structure of At4g12560. Gray boxes indicate untranslated regions, black boxes are exons, and black lines are either intergenic region or introns. Uppercase letters are exons and lowercase letters are introns. Letters with underline are predicted splicing acceptor sites. (B) Protein alignment of wild-type CPR1 and cpr1-1. The asterisks at the end of the amino acid sequences indicate stop codons. 81  Figure 4.5: CPR1 regulates S C1-mediated defense responses. (A) Morphology of WT, snc1-r1, cpr1-3 and snc1-r1 cpr1-3 mutant plants. (B-C) qRT-PCR analysis of PR1 (B) and PR2 (C) expression in snc1-r1, cpr1-3 and snc1-r1 cpr1-3. (D) Growth of H. a. Noco2 spores on the indicated genotypes.  82  Figure 4.6: Overexpression of CPR1 in snc1 alleviates the enhanced disease resistance phenotypes of snc1 and reduces the protein levels of snc1. (A) Morphology of WT, snc1 and two independent transgenic lines (T1-5 and T1-6) overexpressing CPR1 in the snc1 mutant background. (B) Expression levels of CPR1 in the indicated genotypes. (C) Expression levels of S C1 in the indicated genotypes (D) Western blot analysis of snc1/SNC1 protein levels in the transgenic lines overexpressing CPR1. snc1-r1, wild type (WT) and snc1 plants were used as controls. (E) Growth of oomycete H. a. Noco2 spores on the indicated genotypes. (F-G) Expression levels of PR1 (F) and PR2 (G) in snc1 transgenic lines overexpressing CPR1.  83  4.2.7  Overexpression of CPR1 Affects R Protein-Mediated Resistance  Although snc1-r1 completely suppresses the dwarfism of cpr1-3, constitutive PR gene expression and enhanced resistance against H. arabidopsidis Noco2 in cpr1-3 is only partially attenuated by snc1-r1 (Figure 4.5), suggesting that CPR1 may also target R proteins other than SNC1 for degradation. The residual enhanced resistance in snc1-r1 cpr1-3 is probably caused by increased accumulation of the other R proteins. To test this hypothesis, we generated transgenic lines overexpressing CPR1 in the wild-type Columbia (WT) background (Figure 4.7A) and challenged the transgenic plants with pathogens carrying different effectors that activate specific R protein-mediated resistance. The two CPR1 overexpression lines were slightly more susceptible to the virulent bacterial pathogen Pseudomonas syringae pv. tomato DC3000 (Figure 4.7B). Overexpression of CPR1 also has modest effects on resistance mediated by RPS5, RPS4, RPP2, and RPP4 (Figure 4.7C to F). In contrast, resistance mediated by RPS2 and RPM1 is severely compromised when CPR1 is expressed at high levels (Figure 4.8A and B), suggesting that CPR1 may also target R proteins, such as RPS2 and RPM1, for degradation. Because the expression levels of RPS2 and RPM1 are not significantly affected in these transgenic plants, the defects in RPS2- and RPM1-mediated resistance in CRP1 overexpressing lines are not likely caused by reduced RPS2 and RPM1 transcription (Figure 4.8C and D).  4.2.8  CPR1 Regulates the Stability of RPS2  RPS2 and RPM1 are both CC-type NLR R proteins. RPS2 was chosen for further testing because the RPS2-HA transgenic line was available to us (Axtell and Staskawicz, 2003) (a kind gift of B. Staskawicz, University of California at Berkeley). To test whether over-expression of CPR1 affects the accumulation of RPS2, we transformed plants expressing the RPS2-HA fusion protein with a construct expressing CPR1 with a C-terminal 3×FLAG tag, under its own promoter. As shown in Figure 4.8E, increased expression of CPR1-FLAG protein correlated with reduced accumulation of RPS2-HA. Next we tested whether loss of CPR1 function leads to increased accumulation of RPS2 by crossing cpr1-3 into the RPS2-HA transgenic line. Western blot analysis showed that RPS2-HA protein level dramatically increased in cpr1-3 (Figure 4.8F). Because RPS2 transcript level in cpr1-3 was only moderately higher than in wild-type (Figure 4.8G), the increase in RPS2-HA protein level is most likely due to increased stability of RPS2HA in cpr1-3. A similar approach was used to test for the correlation between CPR1 and RPS4, where minor effect was observed for RPS4-mediated immunity in CPR1 overexpression lines (Figure 4.7D). When we transformed the RPS4-HA transgenic line (Wirthmueller et al., 2007) (a gift of Jane Parker, MPI, Köln) with the same CPR1-3×FLAG construct. As shown in Figure 4.9, the RPS4-HA level remains the same in cpr1 and CPR1 overexpression backgrounds as in wild type. In contrast, when the same samples were probed with anti-SNC1 antibody, reverse correlation between CPR1 and SNC1 levels was observed (Figure 4.9). Thus CPR1 does not seem to regulate RPS4 stability.  84  Figure 4.7: Analysis of basal resistance and resistance mediated by RPS5, RPS4, RPP2, and RPP4 in two independent transgenic lines (T1-4 and T1-5) overexpressing CPR1 in wild type Col background. (A) qRT-PCR analysis of the transcript levels of CPR1 in WT, T1-4 and T1-5. (B) Growth of Pseudomonas syringae pv. tomato DC3000 in WT, T1-4 and T1-5; eds1-2 plants were used as susceptible controls. (C-D) Growth of Pseudomonas syringae pv. tomato DC3000 carrying avrPphB (C), and avrRps4 (D) in T1-4 and T1-5. WT, eds1-2, and ndr1-1 plants were used as controls. (E and F) Growth of Hyaloperonospora arabidopsidis Cala2 (E) and H. arabidopsidis Emwa1 (F) on T1-4 and T1-5 plants. WT and eds1-2 plants were used as controls. fH, free hyphae; HR, hypersensitive response; O, oospores; and TN, trailing necrosis.  85  Figure 4.8: Regulation of RPS2-mediated resistance and RPS2 protein accumulation by CPR1. (A-B) Growth of Pst DC3000 carrying avrRpm1 (A) and avrRpt2 (B) that is recognized by RPM1 and RPS2, respectively, in two independent transgenic lines (T1-4 and T1-5) overexpressing CPR1 in wild type Col background. Wild type (WT) and ndr1-1 plants were used as controls. (C-D) Expression analysis of RPM1 and RPS2 in the indicated genotypes using qRT-PCR (E) Western blot analysis of RPS2-HA protein levels in two CPR1-FLAG transgenic lines (T1-7 and T1-18) expressing CPR1-FLAG under its own promoter. (F) Western blot analysis of RSP2-HA protein levels in cpr1-3. The RPS2-HA transgene was crossed into cpr1-3 from a previously described RPS2-HA transgenic line (Axtell and Staskawicz, 2003). (G) Expression analysis of RPS2-HA in the indicated genotypes using qRT-PCR  86  Figure 4.9: RPS4 protein level is not affected by CPR1. RPS4-HA and SNC1 levels in two independent RPS4-HA lines (T1-2 and T1-3) transformed with CPR1-FLAG (A) and in cpr1-3 with RPS4-HA transgene (Wirthmueller et al., 2007) crossed into it (B). Total proteins were extracted from the indicated genotypes and probed with the specific antibodies to detect levels of CPR1-FLAG, RPS4-HA, and SNC1. Rubisco bands were used as loading controls.  87  4.2.9  CPR1 Interacts with SNC1 and RPS2 in vivo  F-box proteins are known to form SCF complexes with their substrates. The genetic interaction between CPR1 and S C1, plus the negative correlations between CPR1 protein level and accumulation of SNC1 and RPS2, prompted us to test whether CPR1 associates with SNC1 and RPS2 in vivo. Constructs expressing SNC1-HA and CPR1-FLAG fusion proteins were cotransformed into Arabidopsis mesophyll protoplasts and immunoprecipitation was subsequently performed on the protein extracts using anti-FLAG agarose beads. As shown in Figure 4.10A, SNC1-HA coimmunoprecipitated with the CPR1-FLAG protein. When RPS2-HA and CPR1-FLAG were coexpressed in Arabidopsis mesophyll protoplasts, RPS2-HA also coimmunoprecipitated with CPR1-FLAG (Figure 4.10B). These data suggest that CPR1 does associate with SNC1 and RPS2 in vivo, probably in SCF complexes, to target SNC1 and RPS2 for degradation. Because the point mutation in snc1 stabilizes the SNC1 protein, we asked whether it caused a reduction of affinity with CPR1. As shown in Figure 4.10C, in Arabidopsis mesophyll protoplasts coexpressing CPR1-FLAG and SNC1-HA or snc1-HA, when immunoprecipitation was performed on the protein extracts using anti-HA microbeads, SNC1HA and snc1-HA are both able to pull down CPR1. The snc1 mutation does not seem to have any obvious effect on interactions between CPR1 and SNC1 in this assay. However, when the immunoprecipitated samples were probed with an anti-ubiquitin (Ub) antibody, much less ubiquitination was observed in the immunoprecipitated snc1-HA, suggesting that SNC1 is a better substrate for ubiquitination than snc1.  88  Figure 4.10: Interactions between CPR1 and S C1 (A) or RPS2 (B). (A) In vivo pull-down of SNC1-HA by CPR1-FLAG. (B) In vivo pull-down of RPS2-HA by CPR1-FLAG. (C) Immunoprecipitation of SNC1-HA or snc1-HA and ubiquitination levels of SNC1-HA or snc1-HA proteins. Arabidopsis mesophyll protoplasts were transfected with the indicated constructs. Total protein extracts were subjected to immunoprecipitation with anti-FLAG agarose beads. Crude lysates (Input) and immunoprecipitated proteins (Elute) were detected with anti-FLAG or anti-HA antibodies.  89  4.3  Discussion  In plants, SCF-mediated protein degradation is involved in the regulation of diverse biological processes. The most well studied examples are from auxin signaling. SCFTIR1 and its homologous F-box proteins serve as auxin receptors and modulate Aux/IAA proteins for degradation (Santner and Estelle, 2009). There is evidence that SCFs are also involved in the regulation of plant immunity. In tobacco, N mediated resistance response to TMV was compromised when SKP1 was silenced (Liu et al., 2002). In addition, the tobacco F-box protein ACIF1 is required for the Cf-9- and Cf-4-mediated hypersensitive response, whereas the Arabidopsis F-box protein SON1 plays a negative role in defence (Kim and Delaney, 2002; van den Burg et al., 2008). Recently it was shown that mutations in the F-box protein CPR30/CPR1 lead to constitutive expression of PR genes and enhanced pathogen resistance (Gou et al., 2009), but the mechanism of how CPR1 regulates plant defence responses was unclear. In this study, we provide strong evidence that SCFCPR1 targets the NLR R-like protein SNC1 for degradation to prevent overaccumulation of SNC1 and autoimmunity. Loss-of-function mutations in CPR1 result in increased SNC1 accumulation, and the constitutive defence responses in cpr1 are largely dependent on S C1. In addition, overexpression of CPR1 reduces the accumulation of SNC1 protein and suppresses the autoimmunity phenotype in snc1. Previously it was shown that SRFR1 and SGT1b are also involved in the negative regulation of SNC1 accumulation (Li et al., 2010). Because SRFR1 interacts with SGT1 and SGT1 associates with SKP1 and CUL1 in vivo (Azevedo et al., 2002; Shirasu, 2009; Li et al., 2010), SRFR1 and SGT1b may regulate the stability of SNC1 through modulating the activity of SCFCPR1. In support of this hypothesis, association of SNC1 and SRFR1 was detected from coimmunoprecipitation experiments in transient expression system in tobacco (Kim et al., 2010). In addition to SNC1, SCFCPR1 also negatively regulates the stability of RPS2. Loss of CPR1 function leads to increased RPS2 levels, whereas overexpression of CPR1 reduces the accumulation of RPS2 and severely compromises RPS2-mediated immunity. Furthermore, overexpression of CPR1 abolishes immunity mediated by RPM1 and slightly compromises resistance specified by several other R proteins, such as RPP2 and RPP4, suggesting that SCFCPR1 may also target these R proteins for degradation. In contrast, overexpression of CPR1 hardly affects the resistance mediated by RPS4 and RPS5. Whether the stability of these R proteins is controlled by other F-box proteins remains to be determined. It was surprising to us that CPR1 targets SNC1 and RPS2, two quite different NLR proteins, yet doesn’t target RPS4, which is more closely related to SNC1. It is possible that CPR1 may recognize a common feature shared between SNC1 and RPS2, but not with RPS4. Previous studies on RAR1-SGT1-HSP90 demonstrated that correct folding and maintaining NLR R proteins above a threshold level are required for quick induction of defence responses when under pathogen attack. Meanwhile, the activities and protein levels of NLR R proteins need to be tightly controlled to prevent activation of defence responses without the presence of pathogens because constitutive activation of defence responses is detrimental to growth and development (Shirasu, 2009). Our study identified SCF-mediated protein degradation as a critical mechanism for regulating the stability of plant NLR R proteins, suggesting that NLR R proteins are maintained at proper levels by balanced activities from the RAR1-SGT1-HSP90mediated assembly and proteasome-mediated degradation. Because overexpression of NLR  90  immune receptors also results in autoactivation of immune responses in animals, and plant and animal NLRs are structurally similar, it will be interesting to test whether the stability of NLR proteins in animals is also controlled by a similar SCF-mediated mechanism.  4.4  Material and Methods  4.4.1  Plant Growth Conditions and Mutant Phenotypic Characterization  All plants were grown at 22 °C under a long-day (16-hour light/8-hour night) regime. Gene expression analysis was carried out by extracting total RNA from 2-week-old plate-grown plants. The extracted RNA was then reverse-transcribed to obtain cDNA. Real-time PCR was performed and the expression levels of Actin1, PR1, and PR2 were determined as described previously (Zhang et al., 2003). Infection experiments with P. syringae and H. arabidopsidis (previously Hyaloperonospora parasitica) were performed as previously described (Li et al., 2001). H. arabidopsidis infection details were visualized under a light microscope after staining leaves with lactophenol Trypan blue (Koch and Slusarenko, 1990).  4.4.2  Construction of Plasmids and Arabidopsis Transformation  The coding sequence of At4g12560 (CPR1/CPR30) was PCR-amplified using primers 5’ cggGGTACCATGGCGACGATTCCAATGGA 3’ and 5’ CGCggatccTTATAAGACCAGCTTGAATC 3’ from wild-type Col cDNA. The amplified fragment was then digested with KpnI and BamHI and cloned into pHA -35S to generate pHA -35S::CPR1. For the construction of pCAMBIA1305-pCPR1::CPR1-3×FLAG, the fragment containing 1,914 bp upstream of the start codon of CPR1 and the CPR1 genomic sequence was amplified by using primers 5’ cggGGTACCaaatcacaagtcacctgacc 3’ and 5’ CGCggatccTAAGACCAGCTTGAATCCTTTGG 3’ from wild-type Col genomic DNA. The fragment was digested with KpnI and BamHI and cloned into pCAMBIA-3×FLAG to generate pCAMBIA1305-pCPR1::CPR1-3×FLAG. The above plasmids were electroporated into Agrobacterium and subsequently transformed into the appropriate Arabidopsis genotypes by floral dipping method (Clough and Bent, 1998). Transient expression vectors pUC19-35S-FLAG-RBS and pUC19-35S-HA-RBS (kindly provided by Dr. Jian-Min Zhou, National Institute of Biological Sciences, Beijing, People’s Republic of China) containing the cauliflower mosaic virus 35S promoter, 3×FLAG or 3×HA, and a Rubisco Small Subunit terminator were used for transient expression of CPR1 and R protein-coding genes in protoplasts. CPR1, S C1, and RPS2 coding sequences were PCRamplified using primers listed in Table 4.1. The amplified fragments were digested with restriction enzymes indicated in the same table and ligated into pUC19-35SFLAG-RBS or pUC19-35S-HA-RBS. The resulting constructs were used in the Arabidopsis mesophyll protoplasts transient expression system (Yoo et al., 2007).  91  Table 4.1: List of primers used in constructing protoplast transient expression constructs  Primer Name CPR1-KpnI-F CPR1-BstBI-R SNC1-KpnI-F SNC1-SalI-R RPS2-KpnI-F RPS2-SalI-R  4.4.3  primer sequence (5'-->3') cggGGTACCaaatcacaagtcacctgacc gccGGATCCTTCGAATAAGACCAGCTTGAATCCTTT ccgGGTACCATGGAGATAGCTTCTTCTTC gccGGATCCgtcgacGTTACCAGAAACAGGAAACA ccgGGTACCATGGATTTCATCTCATCTCTTAT gccGGATCCgtcgacATTTGGAACAAAGCGCGGTA  restriction enzyme used for cloning KpnI and BstBI KpnI and SalI KpnI and SalI  Generation of Arabidopsis Protoplasts  Arabidopsis mesophyll protoplasts were generated by following the protocol from Yoo et al. (Yoo et al., 2007), with minor modifications. Leaf strips were digested in enzyme solution (0.4 M mannitol, 20 mM KCl, 20 mM Mes pH 5.7, 10 mM CaCl2 and 0.1% BSA) with 1.3% cellulose R10 (Yakult Pharmaceutical Ind. Co., Ltd.) and 0.3% Macerozyme R10 (Yakult Pharmaceutical Ind. Co., Ltd.) for 2.5 hours with gentle shaking. The protoplast solution was filtered through a 100 µm nylon mesh and washed once with W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, and 2 mM Mes pH 5.7). Isolated protoplasts were resuspended in W5 solution and incubated on ice for 30 minutes. After incubation, protoplasts were pelleted down and resuspended in MMG solution (0.4 Mmannitol, 15 mM MgCl2, and 4 mM Mes pH 5.7). For coimmunoprecipitation, we used 2 mL of protoplasts (in MMG solution), 100 µL of plasmid A (1 µg/µL), 100 µL of plasmid B (1 µg/µL; or H2O for controls), and 2.2 mL PEG solution [40% PEG4000 (Fluka; cat. no. 81240), 0.2 M mannitol and 100 mM CaCl2]. The resulting transfection mix was well mixed and allowed to react for 10 minutes. The mix was then diluted with 8 mL W5 solution to stop the reaction.  4.4.4  Plant Total Protein Extraction, Protein Immunoprecipitation, and Western Blot Analyses  Plant total protein was extracted from 100 mg of 12-day-old plate-grown plants using extraction buffer (100 mM Tris-HCl pH 8.0, 0.2% SDS and 2% β-mercaptoethanol). Laemmli buffer (4×) was added to each protein sample and boiled for 5 to 10 minutes. The resulting protein samples were subjected to Western blot analyses. For protein immunoprecipitation, proteins in the tranfected protoplasts were extracted using 1.5 mL grinding buffer [50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 150 mM NaCl, 0.1% Nonidet P-40, 1 mM PMSF, 1× Protease Inhibitor Coctail (Roche; Cat. #11873580001), and 100 µM MG132]. The sample was spun at 16,000 × g for 10 min at 4 °C to remove cellular debris. 40µL of the supernatant was saved as input. The rest of the supernatant was transferred to a tube containing 35 µL anti-FLAG M2 beads (Sigma; Cat. #A2220) and incubated for 2 hours at 4 °C with gentle rotation. After incubation, the beads were spun down at 1,500 × g for 30 seconds at 4 92  °C. The beads were washed thoroughly with 1 mL of grinding buffer three times before immunoprecipitated proteins were eluted with 60 µL 3 × FLAG peptide (150 µg/mL; Sigma, Cat. #F4799). The anti-SNC1 antibody was generated against a SNC1-specific peptide in rabbit (Li et al., 2010). The anti-HA antibody was from Roche (Cat. #11867423001). The anti-FLAG antibody and the anti-Ubiquitin antibody were both from Sigma (Cat. # F1804 and U0508, respectively).  4.5  Manuscript Acknowledgements  We thank our colleagues around the globe who kindly provided us with materials: Dr. Judy Callis for seeds of the cul1-7 and transgenic CUL1-FLAG in cul1-7; Dr. Jian-Min Zhou for pUC19-35S-FLAG-RBS and pUC19-35S-HA-RBS; Dr. Brian Staskawitz for seeds of the RPS2HA transgenic line; Dr. Jane Parker for seeds of the RPS4-HA transgenic line; Dr. Guoying Wang for seeds of cpr1-2 (previously cpr30-1) and cpr1-2 pad4; Dr. Mary Berbee and Dr. Sean Graham for their help with phylogenetic analysis of CPR1 and its homologs; Kaeli Johnson and Virginia Woloshen for careful reading of the manuscript; and Yan Li for assistance with making figures. Work described is supported by funds from Natural Sciences and Engineering Research Council of Canada (to X.L.) and the Chinese Ministry of Science and Technology (to Y.Z.).  93  5  Final Summary and Future Perspectives  Land plants, which are sessile organisms, rely entirely on the innate immune system to protect themselves against pathogen invasions. Among host-pathogen interactions, the R proteinmediated resistance is the most effective defence mechanism. Most of the R proteins are intracellular nuclear-binding (NB) and leucine-rich repeat (LRR) containing proteins (Chisholm et al., 2006; DeYoung and Innes, 2006; Jones and Dangl, 2006). These NB-LRR proteins often recognize the presence of pathogen effectors and activate a series of defence responses that usually culminate in localized programmed cell death, hypersensitive response (HR), to restrict spreading of pathogens to unaffected tissues (Nurnberger and Scheel, 2001; Greenberg and Yao, 2004). snc1, which carries a gain-of-function mutation in a TIR-type NB-LRR R protein, exhibits constitutive defence responses in the absence of pathogens (Li et al., 2001; Zhang et al., 2003). Interestingly, unlike other gain-of-function R protein mutants, which often show uncontrollable cell death/HR (Hwang et al., 2000; Bendahmane et al., 2002; Shirano et al., 2002; Palma et al., 2010), snc1 plants do not exhibit any macroscopic or microscopic HR (Li et al., 2001). Beside autoimmune phenotypes, snc1 mutant plants also show very distinctive morphological phenotypes, including stunted growth and curled leaves. The autoimmune phenotypes of snc1 with no HR and its distinctive morphological phenotypes make snc1 a unique tool for identifying signalling components downstream of the R protein. To search for these signalling components, snc1 suppressor screens were conducted. From the screens, fifteen extragenic mos (modifier of snc1) mutants were found. The MOS genes identified by mos mutations encode proteins that participate in various cellular functions including epigenetic regulation (MOS1 [Li et al., 2010; Li et al., 2011]), transcriptional repression (MOS10 [Zhu et al., 2010]), nucleo-cytoplasmic trafficking (MOS6 [Palma et al., 2005] and MOS14 [Xu et al., 2011]), protein modifications (MOS5 [Goritschnig et al., 2007] and MOS8 [Goritschnig et al., 2008]), and a large class of MOS proteins involved in RNA processing/metabolism (MOS2 [Zhang et al., 2005], MOS3 [Zhang and Li, 2005], MOS4 [Palma et al., 2007], MOS11 [Germain et al., 2010], and MOS12 [Xu et al., 2012]).  5.1  uclear-Cytoplasmic Trafficking and Plant Immunity – MOS7  mos7-1, a mutant generated by fast neutron bombardment, partially suppresses all snc1 associated defence and morphological phenotypes (Figure 2.1). Positional cloning followed by direct single gene sequencing identified an in-frame twelve-base-pair deletion in the fourth exon of At5g05680 in mos7-1 (Figure 2.2). The predicted MOS7 protein shows amino acid sequence homology to human and Drosophila nuclear porin 88 (Nup88 or Mbo [members only]; Figure 2.3). In humans and Drosophila, Nup88 is required for binding and sequestering the exportin CRM1/XPO1, which is an export receptor for proteins with leucine-rich nuclear export signals (NES), at the nuclear rim. Failure to sequester CRM1/XPO1 would result in insufficient retention of nuclear proteins bearing NES (Roth et al., 2003; Bernad et al., 2004; Xylourgidis et al., 2006). While knock-out of Nup88 results in lethality, knock-down studies in these two  94  systems showed that NFκB, a key immune regulator in animal cells, failed to accumulate inside the nucleus and resulted in impaired defence activation (Uv et al., 2000). Consistent with its homology with Nup88, MOS7 localizes to the nuclear rim (Figure 2.6). Like its animal homologs, null mutations in MOS7 are lethal; the partial loss-of-function allele mos7-1 showed compromised basal resistance and resistance mediated by several R proteins (Figure 2.4). Further investigation of nuclear-cytoplasmic distribution of EDS1 and NPR1, two important plant immune receptors, revealed that in mos7-1 mutant background, the overall levels of EDS1 and NPR1 are markedly reduced (Figure 2.8 and 2.9). Interestingly, while studying the mechanistic function that MOS7 plays in plant innate immunity, we found that the majority of SNC1 localizes in the cytoplasm, whereas a small portion (~5-10%) of SNC1 protein resides in the nucleus. In mos7-1, this nuclear-cytoplasmic distribution of SNC1 is altered (Figure 2.7). The suppression of snc1 autoimmune and morphological phenotypes by mos7-1 is likely a combined effect of altered SNC1 nuclear-cytoplasmic distribution and markedly reduced protein levels of EDS1 and NPR1. Nuclear-cytoplasmic trafficking plays essential roles in immunity in animals (Ting et al., 2006). However, its roles in plant immunity remain elusive. This study highlights NES-mediated nuclear export as a component in regulating defence outputs. Identification of MOS7, together with previous studies on MOS6, from the same snc1 suppressor screen, reveals the importance of nuclear-cytoplasmic trafficking in plant innate immunity. The striking similarity of the roles that nuclear-cytoplasmic trafficking plays in plant and animal immunity suggests a conserved function of Nup88/MOS7 in regulating innate immunity in both kingdoms. The intracellular NB-LRR R proteins serve as immune receptors to recognize pathogens and activate disease resistance. However, the site of pathogen effector recognition and the signaling transducing mechanisms employed by R proteins are largely unknown. Several recent studies suggested that the nuclear pool of numerous plant NB-LRR R proteins are important in defence activation, including the TIR-type RPS4 (Wirthmueller et al., 2007), RRS1 (Tasset et al., 2010) and N (Burch-Smith et al., 2007), and the CC-type MLA10 (Shen et al., 2007) and Rx (Sacco et al., 2007; Tameling and Baulcombe, 2007); however, the exact role that these NB-LRR immune receptors play inside the nucleus is not clear. Besides RRS1, which is predicted to have the ability to bind to DNA molecules because of its C-terminal WRKY domain, none of the above mentioned NB-LRR R proteins are annotated to have the ability to bind to DNA (Meyers et al., 2003). Although a number of studies suggested that nucleo-cytoplamisic trafficking is important for R protein function, this is not to restrict the cellular compartment of where NB-LRR proteins function. A recent study on the CC-type NB-LRR R protein RPM1 suggested that RPM1 is activated on the plasma membrane and does not relocalize to the nucleus (Gao et al., 2011). This study adds the diversity of the sites of R protein recognition and signaling transduction mechanisms to achieve the final outcome as immunity. During the investigation of MOS7, we found that a sub-pool of snc1 also localizes inside the nucleus (Figure 2.7). Similar to most of the nuclear localized R proteins, SNC1 lacks DNA binding ability judging by its predicted protein sequence. Like its name suggests, MOS7/Mbo (members only) acts as the doorkeeper controlling the molecular traffic across the nuclear pore. It would be interesting to know how the NB-LRR proteins gain access to the nucleus, and what the dynamics of these R proteins in response to pathogen invasion is. Do they travel alone or are they shuttled in as a complex, and what are their functions inside the nucleus? A combination of  95  genetic and biochemical approaches may help to decipher the molecular functions of SNC1 inside the nucleus, and enhance our understanding on how plants achieve immunity.  5.2  Epigenetic Regulation of R Genes – MOS9  Like mos7-1, mos9 was identified from the same snc1 suppressor screen generated using fast neutron bombardment. mos9 partially suppresses all snc1-associated autoimmune and morphological phenotypes (Figure 3.1). Crude mapping followed by Agrobacteria-mediated transformation of overlapping TAC clones covering the region of interest suggested that mos9 mutation is in an interval containing six genes on the top arm of chromosome I (Figure 3.2). Direct single gene complementation indicated that MOS9 is At1g12530. MOS9 encodes a plant specific protein with no known domains and previously unknown function. Subcellular localization of MOS9 using MOS9-GFP fusion protein construct revealed that it localizes to both nucleus and cytoplasm (Figure 3.6). Immunoprecipitation using MOS9-GFP complemented transgenic plants, followed by mass spectrometric analysis showed that one of the MOS9 interacting proteins is a SET domain containing protein, ATXR7 (Arabidopsis trithorax-related protein 7). Like mos9, mutation in ATXR7 partially suppresses all snc1-associated autoimmune and morphological phenotypes (Figure 3.8). Studies of ATXR7 showed that it is required for tri-methylation of lysine 4 of histone H3 (H3K4me3) and for transcriptional activation of Flowering locus C (FLC; Tamada et al., 2009). Identification of ATXR7 as an interacting partner of MOS9 led us to ask whether MOS9 role in plant immunity is to regulate methylation status of histone proteins. Supporting our hypothesis, the transcription levels of S C1 and a neighbouring R protein-encoding gene RPP4 are reduced in mos9 and atxr7 mutant backgrounds (Figure 3.5H, 3.8C and 3.10). The reduced RPP4 expression level in mos9 and atxr7 is associated with compromised RPP4mediated resistance against Ha Emwa1 (Figure 3.10). A chromatin immunoprecipitation (ChIP) experiment using specific antibodies against H3K4me3 revealed that H3K4me3 levels around the S C1 and RPP4 genes are remarkably reduced (Figure 3.10). MOS1, the first MOS gene cloned from the snc1 suppressor screen, encodes a protein with a BAT2 domain at its N terminus. Studies of MOS1 found that it is involved in epigenetic transcriptional regulation of S C1 (Li et al., 2010). In the absence of pathogen infections, R genes are expressed at low levels (Tan et al., 2007), presumably to maintain plants’ competency to prepare for immunity and take part in basal defence. When they encounter pathogens, plants must achieve and maintain proper R gene expression to ensure the production of enough R protein molecules in the battle for pathogen recognition, defence activation, and defence amplification and maintenance. Excessive R gene expression would lead to autoimmunity and fitness loss, while insufficient expression would lead to disease. Hitherto, little was known on how epigenetic regulation plays a role in plant immunity (Berr et al., 2012; Gutzat and Mittelsten Scheid, 2012). The identification of two MOS proteins, MOS1 and MOS9, from snc1 suppressor screens that function in epigenetic regulation of S C1 transcription emphasizes the importance of epigenetic regulation in plant immunity. It would be interesting to know if MOS1 and MOS9 function co-ordinately in regulating R gene expression. MOS9 localizes both in the cytoplasm and in the nucleus. MOS9 interactor ATXR7 functions as chromatin remodelling protein and it is  96  believed that ATXR7 is a nuclear-localized protein; however, there is no experimental evidence that the subcellular localization of ATXR7 is solely nuclear. It would also be interesting to know the dynamics of MOS9 and ATXR7 during defence responses. Do they stably associate as a protein complex, or do they form a “defensome” in response to pathogenic cues? Future in-depth studies should reveal the complete picture of the intricate epigenetic regulation of expression of R genes.  5.3  Regulation of R Protein Stability – SCFCPR1  The activity of R proteins, how R proteins are structurally regulated, and how danger signals are transduced from activated R proteins to downstream components have been the focus of R protein-mediated resistance studies in the past decade. Detailed studies in the HSP90-SGT1RAR1 complex suggested that these three highly conserved eukaryotic proteins are involved in the following three aspects of NB-LRR R protein quality control: 1) assembly/folding of R proteins, 2) preparing R proteins in the effector recognition competent state and 3) regulating the stability/turnover of these proteins (Kadota et al., 2010; Kadota and Shirasu, 2012). However, negative regulation of NB-LRR immune sensors through disassembly/degradation has long been the missing piece in both animal and plant immunity (Coll and O'Neill, 2010). Serendipitously, we came across the data published by Dr. Guoying Wang’s group on CPR1 (previously named CPR30 [Gou et al., 2009]). This publication describes positional cloning and genetic characterization of the mutant cpr1-2. CPR1 encodes an F-box containing protein, a member of the SCF E3 ubiquitin ligase that functions in recognizing protein substrates for 26S proteasomemediated degradation (Ho et al., 2006; Hua and Vierstra, 2011). cpr1-2 phenocopies snc1 in all aspects. Also, like snc1, the phenotypes of cpr1-2 depend on EDS1 and PAD4 (Gou et al., 2009). While mapping the cpr1-2 locus, the recombinant frequencies flanking the mapping region (chromosome IV; 7.4-7.5Mb) were skewed, suggesting that a locus close to cpr1-2 is affecting the mutant phenotype. Indeed, S C1 (chromosome IV; 9.5Mb) is located very close to cpr1-2 locus. These interesting data led us to hypothesize that SNC1 may be a target of the F-box protein, CPR1. Supporting our hypothesis, overexpression of CPR1 is able to suppress all snc1associated phenotypes (Figure 4.6), whereas cpr1 autoimmune phenotypes can be largely suppressed by S C1 loss-of-function mutation (Figure 4.5). In addition to our genetic data, we were able to demonstrate that CPR1 physically associates with SNC1 (Figure 4.10). Our study on CPR1 was the first to report how plant NB-LRR immune receptors are negatively regulated by the ubiquitin-26S proteasome. The identification of RPS2, a CC-type NB-LRR R protein, as another target of CPR1 but not RPP4 or RPS4, which are TIR-type NB-LRR proteins highly homologous to SNC1, was unexpected. This finding led us to ask what determines substrate specificity of CPR1 for NBLRR proteins. Future in-depth mutational analysis on SNC1 and RPS2 may help us pinpoint the domain/consensus amino acid sequence of NB-LRR proteins being recognized by CPR1. Knowing how substrate specificity is determined by CPR1 could also help us identify other NBLRR proteins that are potential substrates of CPR1. Overall, my studies on MOS7, MOS9 and CPR1 have increased our understanding of the importance of nucleo-cytoplasmic trafficking, epigenetic regulation and protein stability in SNC1-mediated immunity. By using the autoimmune mutant, snc1, in the model plant  97  Arabidopsis thaliana, my thesis work provides new insights and a starting point for dissecting the intricate and sophisticated regulatory mechanisms plants employ in protecting themselves against diverse pathogenic attacks.  98  References Aarts ., Metz M., Holub E., Staskawicz B.J., Daniels M.J., and Parker J.E. (1998). Different requirements for EDS1 and DR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis. Proc Natl Acad Sci 95, 10306-11. Aravind L. and Koonin E.V. (1999). G-patch: a new conserved domain in eukaryotic RNAprocessing proteins and type D retroviral polyproteins. Trends Biochem. Sci. 24, 342-344. Austin M.J., Muskett P., Kahn K., Feys B.J., Jones J.D., and Parker J.E. (2002). Regulatory role of SGT1 in early R gene-mediated plant defenses. Science 295, 2077-80. Ausubel F.M. (2005). Are innate immune signaling pathways in plants and animals conserved? Nat. Immunol. 6, 973-979. Axtell, M.J., and Staskawicz, B.J. (2003). Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112: 369–377. Azevedo C., Sadanandom A., Kitagawa K., Freialdenhoven A., Shirasu K., and SchulzeLefert P. (2002). The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science 295, 2073-6. Baumberger ., Tsai C.H., Lie M., Havecker E., and Baulcombe D.C. (2007). The Polerovirus silencing suppressor P0 targets ARGONAUTE proteins for degradation. Curr. Biol. 17, 1609-1614. Bednarek P., Pislewska-Bednarek M., Svatos A., Schneider B., Doubsky J., Mansurova M., Humphry M., Consonni C., Panstruga R., Sanchez-Vallet A., Molina A., and SchulzeLefert P. (2009). A glucosinolate metabolism pathway in living plant cells mediates broadspectrum antifungal defense. Science 323, 101-106. Belkhadir, Y., Subramaniam, R., and Dangl, J.L. (2004). Plant disease resistance protein signaling: NBS-LRR proteins and their partners. Curr. Opin. Plant Biol. 7: 391–399. Bendahmane A., Farnham G., Moffett P., and Baulcombe D.C. (2002). Constitutive gain-offunction mutants in a nucleotide binding site-leucine rich repeat protein encoded at the Rx locus of potato. Plant J. 32, 195-204. Bergelson J., Kreitman M., Stahl E.A., and Tian D. (2001). Evolutionary dynamics of plant R-genes. Science 292, 2281-2285. Bernad, R., van der Velde, H., Fornerod, M., and Pickersgill, H. (2004). Nup358/RanBP2 attaches to the nuclear pore complex via association with Nup88 and Nup214/CAN and plays a supporting role in CRM1-mediated nuclear protein export. Mol. Cell. Biol. 24: 2373–2384.  99  Bernoux M., Ve T., Williams S., Warren C., Hatters D., Valkov E., Zhang X., Ellis J.G., Kobe B., and Dodds P. . (2011). Structural and functional analysis of a plant resistance protein TIR domain reveals interfaces for self-association, signaling, and autoregulation. Cell. Host Microbe 9, 200-211. Berr A., Menard R., Heitz T., and Shen W.H. (2012). Chromatin modification and remodelling: a regulatory landscape for the control of Arabidopsis defence responses upon pathogen attack. Cell. Microbiol. 14, 829-839. Berrocal-Lobo M., Stone S., Yang X., Antico J., Callis J., Ramonell K.M., and Somerville S. (2010). ATL9, a RING zinc finger protein with E3 ubiquitin ligase activity implicated in chitinand NADPH oxidase-mediated defense responses. PLoS One 5, e14426. Bhattacharjee S., Halane M.K., Kim S.H., and Gassmann W. (2011). Pathogen effectors target Arabidopsis EDS1 and alter its interactions with immune regulators. Science 334, 14051408. Bittel P. and Robatzek S. (2007). Microbe-associated molecular patterns (MAMPs) probe plant immunity. Curr. Opin. Plant Biol. 10, 335-341. Block A. and Alfano J.R. (2011). Plant targets for Pseudomonas syringae type III effectors: virulence targets or guarded decoys? Curr. Opin. Microbiol. 14, 39-46. Boller T. and Felix G. (2009). A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu. Rev. Plant. Biol. 60, 379-406. Bos J.I., Armstrong M.R., Gilroy E.M., Boevink P.C., Hein I., Taylor R.M., Zhendong T., Engelhardt S., Vetukuri R.R., Harrower B., Dixelius C., Bryan G., Sadanandom A., Whisson S.C., Kamoun S., and Birch P.R. (2010). Phytophthora infestans effector AVR3a is essential for virulence and manipulates plant immunity by stabilizing host E3 ligase CMPG1. Proc Natl Acad Sci 107, 9909-9914. Bowling S.A., Guo A., Cao H., Gordon A.S., Klessig D.F., and Dong X. (1994). A mutation in Arabidopsis that leads to constitutive expression of systemic acquired resistance. Plant Cell 6, 1845-1857. Burch-Smith, T.M., Schiff, M., Caplan, J.L., Tsao, J., Czymmek, K., and Dinesh-Kumar, S.P. (2007). A novel role for the TIR domain in association with pathogen-derived elicitors. PLoS Biol. 5: e68. Cao H., Bowling S.A., Gordon A.S., and Dong X. (1994). Characterization of an Arabidopsis Mutant That Is Nonresponsive to Inducers of Systemic Acquired-Resistance. Plant Cell 6, 15831592.  100  Cao H., Glazebrook J., Clarke J.D., Volko S., and Dong X. (1997). The Arabidopsis PR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88, 57-63. Cao H., Li X., and Dong X. (1998). Generation of broad-spectrum disease resistance by overexpression of an essential regulatory gene in systemic acquired resistance. Proc Natl Acad Sci 95, 6531-6. Cao Y., Yang Y., Zhang H., Li D., Zheng Z., and Song F. (2008). Overexpression of a rice defense-related F-box protein gene OsDRF1 in tobacco improves disease resistance through potentiation of defense gene expression. Physiol. Plant. 134, 440-452. Capron A., Okresz L., and Genschik P. (2003). First glance at the plant APC/C, a highly conserved ubiquitin-protein ligase. Trends Plant Sci. 8, 83-89. Century K.S., Shapiro A.D., Repetti P.P., Dahlbeck D., Holub E., and Staskawicz B.J. (1997). DR1, a pathogen-induced component required for Arabidopsis disease resistance. Science 278, 1963-1965. Chan S.L., Mukasa T., Santelli E., Low L.Y., and Pascual J. (2010). The crystal structure of a TIR domain from Arabidopsis thaliana reveals a conserved helical region unique to plants. Protein Sci. 19, 155-161. Cheng Y.T., Germain H., Wiermer M., Bi D., Xu F., Garcia A.V., Wirthmueller L., Despres C., Parker J.E., Zhang Y., and Li X. (2009). Nuclear pore complex component MOS7/Nup88 is required for innate immunity and nuclear accumulation of defense regulators in Arabidopsis. Plant Cell 21, 2503-2516. Cheng Y.T., Li Y., Huang S., Huang Y., Dong X., Zhang Y., and Li X. (2011). Stability of plant immune-receptor resistance proteins is controlled by SKP1-CULLIN1-F-box (SCF)mediated protein degradation. Proc. Natl. Acad. Sci. U. S. A. 108, 14694-14699. Cheung M.Y., Zeng .Y., Tong S.W., Li F.W., Zhao K.J., Zhang Q., Sun S.S., and Lam H.M. (2007). Expression of a RING-HC protein from rice improves resistance to Pseudomonas syringae pv. tomato DC3000 in transgenic Arabidopsis thaliana. J. Exp. Bot. 58, 4147-4159. Chinnusamy V., Gong Z., and Zhu J.K. (2008). Nuclear RNA export and its importance in abiotic stress responses of plants. Curr. Top. Microbiol. Immunol. 326, 235-255. Chisholm S.T., Coaker G., Day B., and Staskawicz B.J. (2006). Host-microbe interactions: shaping the evolution of the plant immune response. Cell 124, 803-814. Chu C.C., Lee W.C., Guo W.Y., Pan S.M., Chen L.J., Li H.M., and Jinn T.L. (2005). A copper chaperone for superoxide dismutase that confers three types of copper/zinc superoxide dismutase activity in Arabidopsis. Plant Physiol. 139, 425-436.  101  Clark S.J. (2007). Action at a distance: epigenetic silencing of large chromosomal regions in carcinogenesis. Hum. Mol. Genet. 16 Spec o 1, R88-95. Clough, S.J., and Bent, A.F. (1998). Floral dip: A simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant J. 16: 735–743. Coll R.C. and O' eill L.A. (2010). New insights into the regulation of signalling by toll-like receptors and nod-like receptors. J. Innate Immun. 2, 406-421. Collins .C., Thordal-Christensen H., V L., Bau S., Kombrink E., Qiu J.L., Huckelhoven R., Stein M., Freialdenhoven A., Somerville S.C., and Schulze-Lefert P. (2003). SNAREprotein-mediated disease resistance at the plant cell wall. Nature 425, 973-977. Coolen M.W., Stirzaker C., Song J.Z., Statham A.L., Kassir Z., Moreno C.S., Young A. ., Varma V., Speed T.P., Cowley M., Lacaze P., Kaplan W., Robinson M.D., and Clark S.J. (2010). Consolidation of the cancer genome into domains of repressive chromatin by long-range epigenetic silencing (LRES) reduces transcriptional plasticity. Nat. Cell Biol. 12, 235-246. Coppinger, P., Repetti, P.P., Day, B., Dahlbeck, D., Mehlert, A., and Staskawicz, B.J. (2004). Overexpression of the plasma membrane-localized NDR1 protein results in enhanced bacterial disease resistance in Arabidopsis thaliana. Plant J. 40: 225–237. Cutler S., Ghassemian M., Bonetta D., Cooney S., and McCourt P. (1996). A protein farnesyl transferase involved in abscisic acid signal transduction in Arabidopsis. Science 273, 1239-1241. Danot O., Marquenet E., Vidal-Ingigliardi D., and Richet E. (2009). Wheel of Life, Wheel of Death: A Mechanistic Insight into Signaling by STAND Proteins. Structure 17, 172-182. de Torres M., Sanchez P., Fernandez-Delmond I., and Grant M. (2003). Expression profiling of the host response to bacterial infection: the transition from basal to induced defence responses in RPM1-mediated resistance. Plant J 33, 665-676. Debener T., Lehnackers H., Arnold M., and Dangl J.L. (1991). Identification and molecular mapping of a single Arabidopsis thaliana locus determining resistance to a phytopathogenic Pseudomonas syringae isolate. Plant J. 1, 289-302. DeYoung B.J. and Innes R.W. (2006). Plant NBS-LRR proteins in pathogen sensing and host defense. Nat. Immunol. 7, 1243-1249. Dhawan R., Luo H., Foerster A.M., Abuqamar S., Du H. ., Briggs S.D., Mittelsten Scheid O., and Mengiste T. (2009). HISTONE MONOUBIQUITINATION1 interacts with a subunit of the mediator complex and regulates defense against necrotrophic fungal pathogens in Arabidopsis. Plant Cell 21, 1000-1019.  102  Dockendorff T.C., Heath C.V., Goldstein A.L., Snay C.A., and Cole C. . (1997). C-terminal truncations of the yeast nucleoporin Nup145p produce a rapid temperature-conditional mRNA export defect and alterations to nuclear structure. Mol. Cell. Biol. 17, 906-920. Dong, C.H., Hu, X., Tang, W., Zheng, X., Kim, Y.S., Lee, B.H., and Zhu, J.K. (2006). A putative Arabidopsis nucleoporin, AtNUP160, is critical for RNA export and required for plant tolerance to cold stress. Mol. Cell. Biol. 26: 9533–9543. Downes B.P., Stupar R.M., Gingerich D.J., and Vierstra R.D. (2003). The HECT ubiquitinprotein ligase (UPL) family in Arabidopsis: UPL3 has a specific role in trichome development. Plant J. 35, 729-742. Du X., Miao M., Ma X., Liu Y., Kuhl J.C., Martin G.B., and Xiao F. (2012). Plant programmed cell death caused by an autoactive form of Prf is suppressed by co-expression of the Prf LRR domain. Mol. Plant. 5, 1058-1067. Dufu K., Livingstone M.J., Seebacher J., Gygi S.P., Wilson S.A., and Reed R. (2010). ATP is required for interactions between UAP56 and two conserved mRNA export proteins, Aly and CIP29, to assemble the TREX complex. Genes Dev. 24, 2043-2053. Dunning F.M., Sun W., Jansen K.L., Helft L., and Bent A.F. (2007). Identification and mutational analysis of Arabidopsis FLS2 leucine-rich repeat domain residues that contribute to flagellin perception. Plant Cell 19, 3297-3313. Durrant W.E. and Dong X. (2004). Systemic acquired resistance. Annu Rev Phytopathol 42, 185-209. Eitas T.K. and Dangl J.L. (2010). NB-LRR proteins: pairs, pieces, perception, partners, and pathways. Curr. Opin. Plant Biol. 13, 472-477. Emtage, J.L., Bucci, M., Watkins, J.L., and Wente, S.R. (1997). Defining the essential functional regions of the nucleoporin Nup145p. J. Cell Sci. 110: 911–925. Eulgem T., Tsuchiya T., Wang X.J., Beasley B., Cuzick A., Tor M., Zhu T., McDowell J.M., Holub E., and Dangl J.L. (2007). EDM2 is required for RPP7-dependent disease resistance in Arabidopsis and affects RPP7 transcript levels. Plant J. 49, 829-839. Ewan R., Pangestuti R., Thornber S., Craig A., Carr C., O'Donnell L., Zhang C., and Sadanandom A. (2011). Deubiquitinating enzymes AtUBP12 and AtUBP13 and their tobacco homologue NtUBP12 are negative regulators of plant immunity. New Phytol. 191, 92-106. Fabre E., Boelens W.C., Wimmer C., Mattaj I.W., and Hurt E.C. (1994). Nup145p is required for nuclear export of mRNA and binds homopolymeric RNA in vitro via a novel conserved motif. Cell 78, 275-289.  103  Falk A., Feys B.J., Frost L. ., Jones J.D.G., Daniels M.J., and Parker J.E. (1999). EDS1, an essential component of R gene-mediated disease resistance in Arabidopsis has homology to eukaryotic lipases. Proc Natl Acad Sci 96, 3292-3297. Fan J. and Doerner P. (2012). Genetic and molecular basis of nonhost disease resistance: complex, yes; silver bullet, no. Curr. Opin. Plant Biol. 15, 400-406. Faria, A.M., Levay, A., Wang, Y., Kamphorst, A.O., Rosa, M.L., ussenzveig, D.R., Balkan, W., Chook, Y.M., Levy, D.E., and Fontoura, B.M. (2006). The nucleoporin Nup96 is required for proper expression of interferon-regulated proteins and functions. Immunity 24: 295–304. Feys B.J., Moisan L.J., ewman M.A., and Parker J.E. (2001). Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. Embo J 20, 5400-5411. Feys, B.J., Wiermer, M., Bhat, R.A., Moisan, L.J., Medina-Escobar, ., eu, C., Cabral, A., and Parker, J.E. (2005). Arabidopsis SENESCENCE-ASSOCIATED GENE101 stabilizes and signals within an ENHANCED DISEASE SUSCEPTIBILITY1 complex in plant innate immunity. Plant Cell 17: 2601–2613. Gao Z., Chung E., Eitas T., and Dangl J. (2011). Plant intracellular innate immune receptor Resistance to Pseudomonas syringae pv. maculicola 1 (RPM1) is activated at, and functions on, the plasma membrane. Proc Natl Acad Sci 108, 7619-7624 Gendrel A.V., Lippman Z., Yordan C., Colot V., and Martienssen R.A. (2002). Dependence of heterochromatic histone H3 methylation patterns on the Arabidopsis gene DDM1. Science 297, 1871-1873. Germain H., Qu ., Cheng Y.T., Lee E., Huang Y., Dong O.X., Gannon P., Huang S., Ding P., Li Y., Sack F., Zhang Y., and Li X. (2010). MOS11: a new component in the mRNA export pathway. PLoS Genet. 6, e1001250. Gilkerson J., Hu J., Brown J., Jones A., Sun T.P., and Callis J. (2009). Isolation and characterization of cul1-7, a recessive allele of CULLIN1 that disrupts SCF function at the C terminus of CUL1 in Arabidopsis thaliana. Genetics 181, 945-963. Gimenez-Ibanez S., Hann D.R., toukakis V., Petutschnig E., Lipka V., and Rathjen J.P. (2009). AvrPtoB targets the LysM receptor kinase CERK1 to promote bacterial virulence on plants. Curr. Biol. 19, 423-429. Gingerich D.J., Gagne J.M., Salter D.W., Hellmann H., Estelle M., Ma L., and Vierstra R.D. (2005). Cullins 3a and 3b assemble with members of the broad complex/tramtrack/bric-a-brac (BTB) protein family to form essential ubiquitin-protein ligases (E3s) in Arabidopsis. J. Biol. Chem. 280, 18810-18821.  104  Gohre V., Spallek T., Haweker H., Mersmann S., Mentzel T., Boller T., de Torres M., Mansfield J.W., and Robatzek S. (2008). Plant pattern-recognition receptor FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. Curr. Biol. 18, 1824-1832. Gomez-Gomez L., Bauer Z., and Boller T. (2001). Both the extracellular leucine-rich repeat domain and the kinase activity of FSL2 are required for flagellin binding and signaling in Arabidopsis. Plant Cell 13, 1155-1163. Gonzalez-Lamothe R., Tsitsigiannis D.I., Ludwig A.A., Panicot M., Shirasu K., and Jones J.D. (2006). The U-box protein CMPG1 is required for efficient activation of defense mechanisms triggered by multiple resistance genes in tobacco and tomato. Plant Cell 18, 10671083. Goritschnig S., Zhang Y., and Li X. (2007). The ubiquitin pathway is required for innate immunity in Arabidopsis. Plant J. 49, 540-551. Goritschnig S., Weihmann T., Zhang Y., Fobert P., McCourt P., and Li X. (2008). A novel role for protein farnesylation in plant innate immunity. Plant Physiol. 148, 348-357. Gou M., Su ., Zheng J., Huai J., Wu G., Zhao J., He J., Tang D., Yang S., and Wang G. (2009). An F-box gene, CPR30, functions as a negative regulator of the defense response in Arabidopsis. Plant J. 60, 757-770. Grant, M.R., Godiard, L., Straube, E., Ashfield, T., Lewald, J., Sattler, A., Innes, R.W., and Dangl, J.L. (1995). Structure of the Arabidopsis RPM1 gene enabling dual specificity disease resistance. Science 269: 843–846. Greenberg J.T. and Yao . (2004). The role and regulation of programmed cell death in plantpathogen interactions. Cell. Microbiol. 6, 201-211. Gu Y. and Innes R.W. (2011). The KEEP ON GOING protein of Arabidopsis recruits the ENHANCED DISEASE RESISTANCE1 protein to trans-Golgi network/early endosome vesicles. Plant Physiol. 155, 1827-1838. Gutzat R. and Mittelsten Scheid O. (2012). Epigenetic responses to stress: triple defense? Curr. Opin. Plant Biol. 15, 568-573. Haasen, D., Kohler, C., euhaus, G., and Merkle, T. (1999). Nuclear export of proteins in plants: AtXPO1 is the export receptor for leucine-rich nuclear export signals in Arabidopsis thaliana. Plant J. 20: 695–705. Han S.W., Sriariyanun M., Lee S.W., Sharma M., Bahar O., Bower Z., and Ronald P.C. (2011). Small protein-mediated quorum sensing in a Gram-negative bacterium. PLoS One 6, e29192.  105  Hardham A.R., Jones D.A., and Takemoto D. (2007). Cytoskeleton and cell wall function in penetration resistance. Curr. Opin. Plant Biol. 10, 342-348. Harton J.A., Linhoff M.W., Zhang J., and Ting J.P. (2002). Cutting edge: CATERPILLER: a large family of mammalian genes containing CARD, pyrin, nucleotide-binding, and leucine-rich repeat domains. J. Immunol. 169, 4088-4093. Haseloff, J., Siemering, K.R., Prasher, D.C., and Hodge, S. (1997). Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proc. Natl. Acad. Sci. USA 94: 2122–2127. Heidel A.J., Clarke J.D., Antonovics J., and Dong X. (2004). Fitness costs of mutations affecting the systemic acquired resistance pathway in Arabidopsis thaliana. Genetics 168, 21972206. Heil M. and Baldwin I.T. (2002). Fitness costs of induced resistance: emerging experimental support for a slippery concept. Trends Plant Sci. 7, 61-67. Hellens, R.P., Edwards, E.A., Leyland, .R., Bean, S., and Mullineaux, P.M. (2000). pGreen: A versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol. Biol. 42: 819–832. Hinsch, M., and Staskawicz, B. (1996). Identification of a new Arabidopsis disease resistance locus, RPS4, and cloning of the corresponding avirulence gene, avrRps4, from Pseudomonas syringae pv. pisi. Mol. Plant Microbe Interact. 9: 55–61. Ho M.S., Tsai P.I., and Chien C.T. (2006). F-box proteins: the key to protein degradation. J. Biomed. Sci. 13, 181-191. Holt B.F.,3rd, Belkhadir Y., and Dangl J.L. (2005). Antagonistic control of disease resistance protein stability in the plant immune system. Science 309, 929-32. Hua Z. and Vierstra R.D. (2011). The cullin-RING ubiquitin-protein ligases. Annu. Rev. Plant. Biol. 62, 299-334. Hua Z., Zou C., Shiu S.H., and Vierstra R.D. (2011). Phylogenetic comparison of F-Box (FBX) gene superfamily within the plant kingdom reveals divergent evolutionary histories indicative of genomic drift. PLoS One 6, e16219. Hubert D.A., Tornero P., Belkhadir Y., Krishna P., Takahashi A., Shirasu K., and Dangl J.L. (2003). Cytosolic HSP90 associates with and modulates the Arabidopsis RPM1 disease resistance protein. Embo J 22, 5679-5689. Hwang C.F., Bhakta A.V., Truesdell G.M., Pudlo W.M., and Williamson V.M. (2000). Evidence for a role of the N terminus and leucine-rich repeat region of the Mi gene product in regulation of localized cell death. Plant Cell 12, 1319-1329.  106  Ingle R.A., Carstens M., and Denby K.J. (2006). PAMP recognition and the plant-pathogen arms race. Bioessays 28, 880-889. Inohara, Chamaillard, McDonald C., and unez G. (2005). NOD-LRR proteins: role in hostmicrobial interactions and inflammatory disease. Annu. Rev. Biochem. 74, 355-383. Jander, G., orris, S.R., Rounsley, S.D., Bush, D.F., Levin, I.M., and Last, R.L. (2002). Arabidopsis map-based cloning in the post-genome era. Plant Physiol. 129: 440–450. Jebanathirajah J.A., Peri S., and Pandey A. (2002). Toll and interleukin-1 receptor (TIR) domain-containing proteins in plants: a genomic perspective. Trends Plant Sci. 7, 388-391. Jeong R.D., Chandra-Shekara A.C., Barman S.R., avarre D., Klessig D.F., Kachroo A., and Kachroo P. (2010). Cryptochrome 2 and phototropin 2 regulate resistance protein-mediated viral defense by negatively regulating an E3 ubiquitin ligase. Proc Natl Acad Sci 107, 1353813543. Jiang X. and Wang X. (2000). Cytochrome c promotes caspase-9 activation by inducing nucleotide binding to Apaf-1. J. Biol. Chem. 275, 31199-31203. Jing B., Xu S., Xu M., Li Y., Li S., Ding J., and Zhang Y. (2011). Brush and spray: a highthroughput systemic acquired resistance assay suitable for large-scale genetic screening. Plant Physiol. 157, 973-980. Jirage D., Tootle T.L., Reuber T.L., Frost L. ., Feys B.J., Parker J.E., Ausubel F.M., and Glazebrook J. (1999). Arabidopsis thaliana PAD4 encodes a lipase-like gene that is important for salicylic acid signaling. Proc Natl Acad Sci 96, 13583-13588. Johal G. and Briggs S. (1992). Reductase activity encoded by the HM1 disease resistance gene in maize. Science 258, 985-987. Jones J.D. and Dangl J.L. (2006). The plant immune system. Nature 444, 323-9. Kadota Y., Shirasu K., and Guerois R. (2010). NLR sensors meet at the SGT1-HSP90 crossroad. Trends Biochem. Sci. 35, 199-207. Kadota Y. and Shirasu K. (2012). The HSP90 complex of plants. Biochim. Biophys. Acta 1823, 689-697. Kawasaki T., am J., Boyes D.C., Holt B.F.,3rd, Hubert D.A., Wiig A., and Dangl J.L. (2005). A duplicated pair of Arabidopsis RING-finger E3 ligases contribute to the RPM1- and RPS2-mediated hypersensitive response. Plant J. 44, 258-270. Kelemen O., Convertini P., Zhang Z., Wen Y., Shen M., Falaleeva M., and Stamm S. (2013). Function of alternative splicing. Gene 514, 1-30.  107  Kim H.S. and Delaney T.P. (2002). Arabidopsis SON1 is an F-box protein that regulates a novel induced defense response independent of both salicylic acid and systemic acquired resistance. Plant Cell 14, 1469-1482. Kim M.G., da Cunha L., McFall A.J., Belkhadir Y., DebRoy, S., Dangl, J.L., and Mackey, D. (2005). Two Pseudomonas syringae type III effectors inhibit RIN4-regulated basal defense in Arabidopsis. Cell 121: 749–759. Kim S.H., Gao F., Bhattacharjee S., Adiasor J.A., am J.C., and Gassmann W. (2010). The Arabidopsis resistance-like gene SNC1 is activated by mutations in SRFR1 and contributes to resistance to the bacterial effector AvrRps4. PLoS Pathog. 6, e1001172. Kitagawa K., Skowyra D., Elledge S.J., Harper J.W., and Hieter P. (1999). SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol. Cell 4, 21-33. Knepper C., Savory E.A., and Day B. (2011). Arabidopsis NDR1 is an integrin-like protein with a role in fluid loss and plasma membrane-cell wall adhesion. Plant Physiol. 156, 286-300. Kobe B. and Kajava A.V. (2001). The leucine-rich repeat as a protein recognition motif. Curr. Opin. Struct. Biol. 11, 725-732. Koch E. and Slusarenko A. (1990). Arabidopsis is susceptible to infection by a downy mildew fungus. Plant Cell 2, 437-445. Komander D., Clague M.J., and Urbe S. (2009). Breaking the chains: structure and function of the deubiquitinases. Nat. Rev. Mol. Cell Biol. 10, 550-563. Kraft E., Stone S.L., Ma L., Su ., Gao Y., Lau O.S., Deng X.W., and Callis J. (2005). Genome analysis and functional characterization of the E2 and RING-type E3 ligase ubiquitination enzymes of Arabidopsis. Plant Physiol. 139, 1597-1611. Kunkel B. ., Bent A.F., Dahlbeck D., Innes R.W., and Staskawicz B.J. (1993). RPS2, an Arabidopsis disease resistance locus specifying recognition of Pseudomonas syringae strains expressing the avirulence gene avrRpt2. Plant Cell 5, 865-875. Lange A., Mills R.E., Lange C.J., Stewart M., Devine S.E., and Corbett A.H. (2007). Classical nuclear localization signals: definition, function, and interaction with importin alpha. J. Biol. Chem. 282, 5101-5105. Lee D.H., Choi H.W., and Hwang B.K. (2011). The pepper E3 ubiquitin ligase RING1 gene, CaRING1, is required for cell death and the salicylic acid-dependent defense response. Plant Physiol. 156, 2011-2025.  108  Lee J., He K., Stolc V., Lee H., Figueroa P., Gao Y., Tongprasit W., Zhao H., Lee I., and Deng X.W. (2007). Analysis of transcription factor HY5 genomic binding sites revealed its hierarchical role in light regulation of development. Plant Cell 19, 731-749. Lee J.H., Terzaghi W., Gusmaroli G., Charron J.B., Yoon H.J., Chen H., He Y.J., Xiong Y., and Deng X.W. (2008). Characterization of Arabidopsis and rice DWD proteins and their roles as substrate receptors for CUL4-RING E3 ubiquitin ligases. Plant Cell 20, 152-167. Lee S.W., Han S.W., Sririyanum M., Park C.J., Seo Y.S., and Ronald P.C. (2009). A type Isecreted, sulfated peptide triggers XA21-mediated innate immunity. Science 326, 850-853. Li W., Zhong S., Li G., Li Q., Mao B., Deng Y., Zhang H., Zeng L., Song F., and He Z. (2011). Rice RING protein OsBBI1 with E3 ligase activity confers broad-spectrum resistance against Magnaporthe oryzae by modifying the cell wall defence. Cell Res. 21, 835-848. Li, X., Zhang, Y., Clarke, J.D., Li, Y., and Dong, X. (1999). Identification and cloning of a negative regulator of systemic acquired resistance, SNlI1, through a screen for suppressors of npr1–1. Cell 98: 329–339. Li X., Clarke J.D., Zhang Y., and Dong X. (2001). Activation of an EDS1-mediated R-gene pathway in the snc1 mutant leads to constitutive, NPR1-independent pathogen resistance. Mol Plant Microbe In 14, 1131-1139. Li Y., Li S., Bi D., Cheng Y.T., Li X., and Zhang Y. (2010a). SRFR1 negatively regulates plant NB-LRR resistance protein accumulation to prevent autoimmunity. PLoS Pathog. 6, e1001111. Li Y., Tessaro M.J., Li X., and Zhang Y. (2010b). Regulation of the expression of plant resistance gene SNC1 by a protein with a conserved BAT2 domain. Plant Physiol. 153, 14251434. Li Y., Dong O.X., Johnson K., and Zhang Y. (2011). MOS1 epigenetically regulates the expression of plant Resistance gene SNC1. Plant. Signal. Behav. 6, 434-436. Lin S.S., Martin R., Mongrand S., Vandenabeele S., Chen K.C., Jang I.C., and Chua .H. (2008). RING1 E3 ligase localizes to plasma membrane lipid rafts to trigger FB1-induced programmed cell death in Arabidopsis. Plant J. 56, 550-561. Lipka V., Dittgen J., Bednarek P., Bhat R., Wiermer M., Stein M., Landtag J., Brandt W., Rosahl S., Scheel D., Llorente F., Molina A., Parker J., Somerville S., and Schulze-Lefert P. (2005). Pre- and postinvasion defenses both contribute to nonhost resistance in Arabidopsis. Science 310, 1180-1183. Liu C., Lu F., Cui X., and Cao X. (2010). Histone methylation in higher plants. Annu. Rev. Plant. Biol. 61, 395-420.  109  Liu J., Li H., Miao M., Tang X., Giovannoni J., Xiao F., and Liu Y. (2012). The tomato UVdamaged DNA-binding protein-1 (DDB1) is implicated in pathogenesis-related (PR) gene expression and resistance to Agrobacterium tumefaciens. Mol. Plant. Pathol. 13, 123-134. Liu Y., Schiff M., Serino G., Deng X.W., and Dinesh-Kumar S.P. (2002). Role of SCF ubiquitin-ligase and the COP9 signalosome in the gene-mediated resistance response to Tobacco mosaic virus. Plant Cell 14, 1483-1496. Long J.A., Ohno C., Smith Z.R., and Meyerowitz E.M. (2006). TOPLESS regulates apical embryonic fate in Arabidopsis. Science 312, 1520-1523. Loyer P., Trembley J.H., Grenet J.A., Busson A., Corlu A., Zhao W., Kocak M., Kidd V.J., and Lahti J.M. (2008). Characterization of cyclin L1 and L2 interactions with CDK11 and splicing factors: influence of cyclin L isoforms on splice site selection. J. Biol. Chem. 283, 77217732. Lu D., Lin W., Gao X., Wu S., Cheng C., Avila J., Heese A., Devarenne T.P., He P., and Shan L. (2011). Direct ubiquitination of pattern recognition receptor FLS2 attenuates plant innate immunity. Science 332, 1439-1442. Ma W. and Berkowitz G.A. (2007). The grateful dead: calcium and cell death in plant innate immunity. Cell. Microbiol. 9, 2571-2585. Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R., and Dangl, J.L. (2003). Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Cell 112: 379–389. Mackey, D., Holt, B.F., Wiig, A., and Dangl, J.L. (2002). RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 108: 743–754. Maekawa T., Cheng W., Spiridon L. ., Toller A., Lukasik E., Saijo Y., Liu P., Shen Q.H., Micluta M.A., Somssich I.E., Takken F.L., Petrescu A.J., Chai J., and Schulze-Lefert P. (2011). Coiled-coil domain-dependent homodimerization of intracellular barley immune receptors defines a minimal functional module for triggering cell death. Cell. Host Microbe 9, 187-199. Magalhaes J.G., Sorbara M.T., Girardin S.E., and Philpott D.J. (2011). What is new with Nods? Curr. Opin. Immunol. 23, 29-34. Martin G., Brommonschenkel S., Chunwongse J., Frary A., Ganal M., Spivey R., Wu T., Earle E., and Tanksley S. (1993). Map-based cloning of a protein kinase gene conferring disease resistance in tomato. Science 262, 1432-1436 Martin, G.B., Bogdanove, A.J., and Sessa, G. (2003). Understanding the functions of plant disease resistance proteins. Annu. Rev. Plant Biol. 54: 23–61.  110  Mayor A., Martinon F., De Smedt T., Petrilli V., and Tschopp J. (2007). A crucial function of SGT1 and HSP90 in inflammasome activity links mammalian and plant innate immune responses. Nat. Immunol. 8, 497-503. McHale L., Tan X., Koehl P., and Michelmore R.W. (2006). Plant NBS-LRR proteins: adaptable guards. Genome Biol. 7, 212. Meyers B.C., Kozik A., Griego A., Kuang H.H., and Michelmore R.W. (2003). Genomewide analysis of NBS-LRR-encoding genes in Arabidopsis. Plant Cell 15, 809-834. Monaghan J., Xu F., Gao M., Zhao Q., Palma K., Long C., Chen S., Zhang Y., and Li X. (2009). Two Prp19-like U-box proteins in the MOS4-associated complex play redundant roles in plant innate immunity. PLoS Pathog. 5, e1000526. Monaghan J. and Zipfel C. (2012). Plant pattern recognition receptor complexes at the plasma membrane. Curr. Opin. Plant Biol. 15, 349-357. Mou, Z., Fan, W.H., and Dong, X. (2003). Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113: 935–944. Munkvold K.R. and Martin G.B. (2009). Advances in experimental methods for the elucidation of Pseudomonas syringae effector function with a focus on AvrPtoB. Mol. Plant. Pathol. 10, 777-793. Muskett P.R., Kahn K., Austin M.J., Moisan L.J., Sadanandom A., Shirasu K., Jones J.D., and Parker J.E. (2002). Arabidopsis RAR1 exerts rate-limiting control of R gene-mediated defenses against multiple pathogens. Plant Cell 14, 979-92. avarro L., Zipfel C., Rowland O., Keller I., Robatzek S., Boller T., and Jones J.D. (2004). The transcriptional innate immune response to flg22. Interplay and overlap with Avr genedependent defense responses and bacterial pathogenesis. Plant Physiol. 135, 1113-1128. eubauer G., King A., Rappsilber J., Calvio C., Watson M., Ajuh P., Sleeman J., Lamond A., and Mann M. (1998). Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex. Nat. Genet. 20, 46-50. icaise V., Roux M., and Zipfel C. (2009). Recent advances in PAMP-triggered immunity against bacteria: pattern recognition receptors watch over and raise the alarm. Plant Physiol. 150, 1638-1647. ielsen R. and Yang Z. (1998). Likelihood models for detecting positively selected amino acid sites and applications to the HIV-1 envelope gene. Genetics 148, 929-936. oel L., Moores T.L., van Der Biezen E.A., Parniske M., Daniels M.J., Parker J.E., and Jones J.D. (1999). Pronounced intraspecific haplotype divergence at the RPP5 complex disease resistance locus of Arabidopsis. Plant Cell 11, 2099-2112.  111  oël, L.D., Cagna, G., Stuttmann, J., Wirthmuller, L., Betsuyaku, S., Witte, C.P., Bhat, R., Pochon, ., Colby, T., and Parker, J.E. (2007). Interaction between SGT1 and cytosolic/nuclear HSC70 chaperones regulates Arabidopsis immune responses. Plant Cell 19: 4061–4076. urnberger T. and Scheel D. (2001). Signal transmission in the plant immune response. Trends Plant Sci. 6, 372-379. urnberger T. and Lipka V. (2005). Non-host resistance in plants: new insights into an old phenomenon. Molecular Plant Pathology 6, 335-345. Palma K., Zhang Y., and Li X. (2005). An importin α homolog, MOS6, plays an important role in plant innate immunity. Curr Biol 15, 1129-35. Palma K., Zhao Q., Cheng Y.T., Bi D., Monaghan J., Cheng W., Zhang Y., and Li X. (2007). Regulation of plant innate immunity by three proteins in a complex conserved across the plant and animal kingdoms. Genes Dev. 21, 1484-1493. Palma K., Thorgrimsen S., Malinovsky F.G., Fiil B.K., ielsen H.B., Brodersen P., Hofius D., Petersen M., and Mundy J. (2010). Autoimmunity in Arabidopsis acd11 is mediated by epigenetic regulation of an immune receptor. PLoS Pathog. 6, e1001137. Parry G., Ward S., Cernac A., Dharmasiri S., and Estelle M. (2006). The Arabidopsis SUPPRESSOR OF AUXIN RESISTANCE proteins are nucleoporins with an important role in hormone signaling and development. Plant Cell 18, 1590-1603. Pei Z.M., Ghassemian M., Kwak C.M., McCourt P., and Schroeder J.I. (1998). Role of farnesyltransferase in ABA regulation of guard cell anion channels and plant water loss. Science 282, 287-290. Pickart C.M. and Fushman D. (2004). Polyubiquitin chains: polymeric protein signals. Curr. Opin. Chem. Biol. 8, 610-616. Purrington C.B. (2000). Costs of resistance. Curr. Opin. Plant Biol. 3, 305-308. Rairdan G.J. and Moffett P. (2006). Distinct domains in the ARC region of the potato resistance protein Rx mediate LRR binding and inhibition of activation. Plant Cell 18, 20822093. Reed R. (2003). Coupling transcription, splicing and mRNA export. Curr. Opin. Cell Biol. 15, 326-331. Reed R. and Cheng H. (2005). TREX, SR proteins and export of mRNA. Curr. Opin. Cell Biol. 17, 269-273.  112  Roth, P., Xylourgidis, ., Sabri, ., Uv, A., Fornerod, M., and Samakovlis, C. (2003). The Drosophila nucleoporin DNup88 localizes DNup214 and CRM1 on the nuclear envelope and attenuates NES-mediated nuclear export. J. Cell Biol. 163: 701–706. Sacco, M.A., Mansoor, S., and Moffett, P. (2007). A RanGAP protein physically interacts with the NB-LRR protein Rx, and is required for Rx-mediated viral resistance. Plant J. 52: 82–93. Santner A. and Estelle M. (2009). Recent advances and emerging trends in plant hormone signalling. Nature 459, 1071-1078. Schnell J.D. and Hicke L. (2003). Non-traditional functions of ubiquitin and ubiquitin-binding proteins. J. Biol. Chem. 278, 35857-35860. Schult K., Meierhoff K., Paradies S., Toller T., Wolff P., and Westhoff P. (2007). The nuclear-encoded factor HCF173 is involved in the initiation of translation of the psbA mRNA in Arabidopsis thaliana. Plant Cell 19, 1329-1346. Segonzac C. and Zipfel C. (2011). Activation of plant pattern-recognition receptors by bacteria. Curr. Opin. Microbiol. 14, 54-61. Sela H., Spiridon L. ., Petrescu A.J., Akerman M., Mandel-Gutfreund Y., evo E., Loutre C., Keller B., Schulman A.H., and Fahima T. (2012). Ancient diversity of splicing motifs and protein surfaces in the wild emmer wheat (Triticum dicoccoides) LR10 coiled coil (CC) and leucine-rich repeat (LRR) domains. Mol. Plant. Pathol. 13, 276-287. Shah, J. (2003). The salicylic acid loop in plant defense. Curr. Opin. Plant Biol. 6: 365–371. Shen, Q.H., Saijo, Y., Mauch, S., Biskup, C., Bieri, S., Keller, B., Seki, H., Ülker, B., Somssich, I.E., and Schulze-Lefert, P. (2007). Nuclear activity of MLA immune receptors links isolate-specific and basal disease-resistance responses. Science 315: 1098–1103. Shen W.H., Parmentier Y., Hellmann H., Lechner E., Dong A., Masson J., Granier F., Lepiniec L., Estelle M., and Genschik P. (2002). Null mutation of AtCUL1 causes arrest in early embryogenesis in Arabidopsis. Mol. Biol. Cell 13, 1916-1928. Sheen, J. (2001). Signal transduction in maize and Arabidopsis mesophyll protoplasts. Plant Physiol. 127: 1466–1475. Shirano Y., Kachroo P., Shah J., and Klessig D.F. (2002). A gain-of-function mutation in an Arabidopsis Toll Interleukin-1 Receptor-Nucleotide Binding Site-Leucine-Rich Repeat type R gene triggers defense responses and results in enhanced disease resistance. Plant Cell 14, 31493162. Shirasu K., Lahaye T., Tan M.W., Zhou F., Azevedo C., and Schulze-Lefert P. (1999). A novel class of eukaryotic zinc-binding proteins is required for disease resistance signaling in barley and development in C. elegans. Cell 99, 355-366.  113  Shirasu K. (2009). The HSP90-SGT1 chaperone complex for NLR immune sensors. Annu. Rev. Plant. Biol. 60, 139-164. Shilatifard A. (2012). The COMPASS family of histone H3K4 methylases: mechanisms of regulation in development and disease pathogenesis. Annu. Rev. Biochem. 81, 65-95. Sinapidou E., Williams K., ott L., Bahkt S., Tor M., Crute I., Bittner-Eddy P., and Beynon J. (2004). Two TIR:NB:LRR genes are required to specify resistance to Peronospora parasitica isolate Cala2 in Arabidopsis. Plant J. 38, 898-909. Simonich M.T. and Innes R.W. (1995). A disease resistance gene in Arabidopsis with specificity for the avrPph3 gene of Pseudomonas syringae pv. phaseolicola. Mol. Plant Microbe Interact. 8, 637-640. Smalle J. and Vierstra R.D. (2004). The ubiquitin 26S proteasome proteolytic pathway. Annu. Rev. Plant. Biol. 55, 555-590. Somers D.E. and Fujiwara S. (2009). Thinking outside the F-box: novel ligands for novel receptors. Trends Plant Sci. 14, 206-213. Song W.Y., Wang G.L., Chen L.L., Kim H.S., Pi L.Y., Holsten T., Gardner J., Wang B., Zhai W.X., Zhu L.H., Fauquet C., and Ronald P. (1995). A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21. Science 270, 1804-1806. Sorek ., Bloch D., and Yalovsky S. (2009). Protein lipid modifications in signaling and subcellular targeting. Curr. Opin. Plant Biol. 12, 714-720. Stein M., Dittgen J., Sanchez-Rodriguez C., Hou B.H., Molina A., Schulze-Lefert P., Lipka V., and Somerville S. (2006). Arabidopsis PEN3/PDR8, an ATP binding cassette transporter, contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration. Plant Cell 18, 731-746. Steiner T., Kaiser J.T., Marinkovic S., Huber R., and Wahl M.C. (2002). Crystal structures of transcription factor NusG in light of its nucleic acid- and protein-binding activities. EMBO J. 21, 4641-4653. Stone S.L., Hauksdottir H., Troy A., Herschleb J., Kraft E., and Callis J. (2005). Functional analysis of the RING-type ubiquitin ligase family of Arabidopsis. Plant Physiol. 137, 13-30. Stone S.L., Williams L.A., Farmer L.M., Vierstra R.D., and Callis J. (2006). KEEP ON GOING, a RING E3 ligase essential for Arabidopsis growth and development, is involved in abscisic acid signaling. Plant Cell 18, 3415-3428. Sun L. and Chen Z.J. (2004). The novel functions of ubiquitination in signaling. Curr. Opin. Cell Biol. 16, 119-126.  114  Szemenyei H., Hannon M., and Long J.A. (2008). TOPLESS mediates auxin-dependent transcriptional repression during Arabidopsis embryogenesis. Science 319, 1384-1386. Tada, Y., Spoel, S.H., Pajerowska-Mukhtar, K., Mou, Z., Song, J., and Dong, X. (2008). Plant immunity requires conformational changes of NPR1 via S-nitrosylation and thioredoxins. Science 321: 952–956. Takahashi A., Casais C., Ichimura K., and Shirasu K. (2003). HSP90 interacts with RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc Natl Acad Sci 100, 11777-11782. Takahashi, ., van Kilsdonk, J.W., Ostendorf, B., Smeets, R., Bruggeman, S.W., Alonso, A., van de Loo, F., Schneider, M., van den Berg, W.B., and Swart, G.W. (2008). Tumor marker nucleoporin 88 kDa regulates nucleocytoplasmic transport of NF-κB. Biochem. Biophys. Res. Commun. 374: 424–430. Takken F.L., Albrecht M., and Tameling W.I. (2006). Resistance proteins: molecular switches of plant defence. Curr. Opin. Plant Biol. 9, 383-390. Takken F.L. and Tameling W.I. (2009). To nibble at plant resistance proteins. Science 324, 744-746. Tamada Y., Yun J.Y., Woo S.C., and Amasino R.M. (2009). ARABIDOPSIS TRITHORAXRELATED7 is required for methylation of lysine 4 of histone H3 and for transcriptional activation of FLOWERING LOCUS C. Plant Cell 21, 3257-3269. Tameling, W.I., and Baulcombe, D.C. (2007). Physical association of the NB-LRR resistance protein Rx with a Ran GTPase-activating protein is required for extreme resistance to Potato virus X. Plant Cell 19: 1682–1694. Tan X., Meyers B.C., Kozik A., West M.A., Morgante M., St Clair D.A., Bent A.F., and Michelmore R.W. (2007). Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis. BMC Plant. Biol. 7, 56. Tao Y., Xie Z.Y., Chen W.Q., Glazebrook J., Chang H.S., Han B., Zhu T., Zou G.Z., and Katagiri F. (2003). Quantitative nature of Arabidopsis responses during compatible and incompatible interactions with the bacterial pathogen Pseudomonas syringae. Plant Cell 15, 317330. Tasset C., Bernoux M., Jauneau A., Pouzet C., Briere C., Kieffer-Jacquinod S., Rivas S., Marco Y., and Deslandes L. (2010). Autoacetylation of the Ralstonia solanacearum effector PopP2 targets a lysine residue essential for RRS1-R-mediated immunity in Arabidopsis. PLoS Pathog. 6, e1001202. Terry, L.J., Shows, E.B., and Wente, S.R. (2007). Crossing the nuclear envelope: hierarchical regulation of nucleocytoplasmic transport. Science 318: 1412–1416.  115  Thilmony R., Underwood W., and He S.Y. (2006). Genome-wide transcriptional analysis of the Arabidopsis thaliana interaction with the plant pathogen Pseudomonas syringae pv. tomato DC3000 and the human pathogen Escherichia coli O157:H7. Plant J. 46, 34-53. Thrower J.S., Hoffman L., Rechsteiner M., and Pickart C.M. (2000). Recognition of the polyubiquitin proteolytic signal. EMBO J. 19, 94-102. Ting J.P. and Davis B.K. (2005). CATERPILLER: a novel gene family important in immunity, cell death, and diseases. Annu. Rev. Immunol. 23, 387-414. Ting J.P., Kastner D.L., and Hoffman H.M. (2006). CATERPILLERs, pyrin and hereditary immunological disorders. Nat. Rev. Immunol. 6, 183-195. Tör M., Gordon P., Cuzick A., Eulgem T., Sinapidou E., Mert-Türk F., Can C., Dangl J.L., and Holub E.B. (2002). Arabidopsis SGT1b is required for defense signaling conferred by several downy mildew resistance genes. Plant Cell 14, 993-1003. Trujillo M., Ichimura K., Casais C., and Shirasu K. (2008). Negative regulation of PAMPtriggered immunity by an E3 ubiquitin ligase triplet in Arabidopsis. Curr. Biol. 18, 1396-1401. Truman W., de Zabala M.T., and Grant M. (2006). Type III effectors orchestrate a complex interplay between transcriptional networks to modify basal defence responses during pathogenesis and resistance. Plant J. 46, 14-33. Tsuchiya T. and Eulgem T. (2010). The Arabidopsis defense component EDM2 affects the floral transition in an FLC-dependent manner. Plant J. 62, 518-528. Tsuda K., Sato M., Glazebrook J., Cohen J.D., and Katagiri F. (2008). Interplay between MAMP-triggered and SA-mediated defense responses. Plant J. 53, 763-775. Tzfira T., Vaidya M., and Citovsky V. (2004). Involvement of targeted proteolysis in plant genetic transformation by Agrobacterium. Nature 431, 87-92. Umebayashi K. (2003). The roles of ubiquitin and lipids in protein sorting along the endocytic pathway. Cell Struct. Funct. 28, 443-453. Underwood W., Melotto M., and He S.Y. (2007). Role of plant stomata in bacterial invasion. Cell. Microbiol. 9, 1621-1629. Uv, A.E., Roth, P., Xylourgidis, ., Wickberg, A., Cantera, R., and Samakovlis, C. (2000). members only encodes a Drosophila nucleoporin required for Rel protein import and immune response activation. Genes Dev. 14: 1945–1957.  116  van den Burg H.A., Tsitsigiannis D.I., Rowland O., Lo J., Rallapalli G., Maclean D., Takken F.L., and Jones J.D. (2008). The F-box protein ACRE189/ACIF1 regulates cell death and defense responses activated during pathogen recognition in tobacco and tomato. Plant Cell 20, 697-719. van der Biezen, E.A., Freddie, C.T., Kahn, K., Parker, J.E., and Jones, J.D. (2002). Arabidopsis RPP4 is a member of the RPP5 multigene family of TIR-NB-LRR genes and confers downy mildew resistance through multiple signalling components. Plant J. 29: 439–451. Vasu S., Shah S., Orjalo A., Park M., Fischer W.H., and Forbes D.J. (2001). Novel vertebrate nucleoporins Nup133 and Nup160 play a role in mRNA export. J Cell Bio 155, 33954. Vernooij, B., Friedrich, L., Morse, A., Reist, R., Kolditz-Jawhar, R., Ward, E., Uknes, S., Kessmann, H., and Ryals, J. (1994). Salicylic acid is not the translocated signal responsible for inducing systemic acquired resistance but is required in signal transduction. Plant Cell 6: 959– 965. Vierstra R.D. (2009). The ubiquitin-26S proteasome system at the nexus of plant biology. Nat. Rev. Mol. Cell Biol. 10, 385-397. Wang Y.S., Pi L.Y., Chen X., Chakrabarty P.K., Jiang J., De Leon A.L., Liu G.Z., Li L., Benny U., Oard J., Ronald P.C., and Song W.Y. (2006). Rice XA21 binding protein 3 is a ubiquitin ligase required for full Xa21-mediated disease resistance. Plant Cell 18, 3635-3646. Warren R.F., Merritt P.M., Holub E., and Innes R.W. (1999). Identification of three putative signal transduction genes involved in R gene-specified disease resistance in Arabidopsis. Genetics 152, 401-412. Weissman A.M. (2001). Themes and variations on ubiquitylation. Nat. Rev. Mol. Cell Biol. 2, 169-178. Weissman A.M., Shabek ., and Ciechanover A. (2011). The predator becomes the prey: regulating the ubiquitin system by ubiquitylation and degradation. Nat. Rev. Mol. Cell Biol. 12, 605-620. Wiermer M., Feys B.J., and Parker J.E. (2005). Plant immunity: the EDS1 regulatory node. Curr Opin Plant Biol 8, 383-389. Wirthmueller, L., Zhang, Y., Jones, J.D., and Parker, J.E. (2007). Nuclear accumulation of the Arabidopsis immune receptor RPS4 is necessary for triggering EDS1-dependent defense. Curr. Biol. 17: 2023–2029. Xu F., Xu S., Wiermer M., Zhang Y., and Li X. (2012). The cyclin L homolog MOS12 and the MOS4-associated complex are required for the proper splicing of plant resistance genes. Plant J. 70, 916-928.  117  Xu S., Zhang Z., Jing B., Gannon P., Ding J., Xu F., Li X., and Zhang Y. (2011). Transportin-SR is required for proper splicing of resistance genes and plant immunity. PLoS Genet. 7, e1002159. Xylourgidis ., Roth P., Sabri ., Tsarouhas V., and Samakovlis C. (2006). The nucleoporin Nup214 sequesters CRM1 at the nuclear rim and modulates NFkappaB activation in Drosophila. J. Cell. Sci. 119, 4409-4419. Yaeno T. and Iba K. (2008). BAH1/NLA, a RING-type ubiquitin E3 ligase, regulates the accumulation of salicylic acid and immune responses to Pseudomonas syringae DC3000. Plant Physiol. 148, 1032-1041. Yaeno T., Li H., Chaparro-Garcia A., Schornack S., Koshiba S., Watanabe S., Kigawa T., Kamoun S., and Shirasu K. (2011). Phosphatidylinositol monophosphate-binding interface in the oomycete RXLR effector AVR3a is required for its stability in host cells to modulate plant immunity. Proc Natl Acad Sci 108, 14682-14687. Yan ., Doelling J.H., Falbel T.G., Durski A.M., and Vierstra R.D. (2000). The ubiquitinspecific protease family from Arabidopsis. AtUBP1 and 2 are required for the resistance to the amino acid analog canavanine. Plant Physiol. 124, 1828-1843. Yang C.W., Gonzalez-Lamothe R., Ewan R.A., Rowland O., Yoshioka H., Shenton M., Ye H., O'Donnell E., Jones J.D., and Sadanandom A. (2006). The E3 ubiquitin ligase activity of Arabidopsis PLANT U-BOX17 and its functional tobacco homolog ACRE276 are required for cell death and defense. Plant Cell 18, 1084-1098. Yang Z. and Bielawski J.P. (2000). Statistical methods for detecting molecular adaptation. Trends Ecol. Evol. 15, 496-503. Yang Z., ielsen R., Goldman ., and Pedersen A.M. (2000). Codon-substitution models for heterogeneous selection pressure at amino acid sites. Genetics 155, 431-449. Yang Z. (2007). PAML 4: phylogenetic analysis by maximum likelihood. Mol. Biol. Evol. 24, 1586-1591. Yee D. and Goring D.R. (2009). The diversity of plant U-box E3 ubiquitin ligases: from upstream activators to downstream target substrates. J. Exp. Bot. 60, 1109-1121. Yen H.C. and Elledge S.J. (2008). Identification of SCF ubiquitin ligase substrates by global protein stability profiling. Science 322, 923-929. Yi H. and Richards E.J. (2009). Gene duplication and hypermutation of the pathogen Resistance gene SNC1 in the Arabidopsis bal variant. Genetics 183, 1227-1234. Yoo, S.D., Cho, Y.H., and Sheen, J. (2007). Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis. Nat. Protoc. 2: 1565–1572.  118  Yu G.L., Katagiri F., and Ausubel F.M. (1993). Arabidopsis mutations at the RPS2 locus result in loss of resistance to Pseudomonas syringae strains expressing the avirulence gene avrRpt2. Mol. Plant Microbe Interact. 6, 434-443. Yuan Y., Zhong S., Li Q., Zhu Z., Lou Y., Wang L., Wang J., Wang M., Li Q., Yang D., and He Z. (2007). Functional analysis of rice NPR1-like genes reveals that OsNPR1/NH1 is the rice orthologue conferring disease resistance with enhanced herbivore susceptibility. Plant. Biotechnol. J. 5, 313-324. Zeng L.R., Qu S., Bordeos A., Yang C., Baraoidan M., Yan H., Xie Q., ahm B.H., Leung H., and Wang G.L. (2004). Spotted leaf11, a negative regulator of plant cell death and defense, encodes a U-box/armadillo repeat protein endowed with E3 ubiquitin ligase activity. Plant Cell 16, 2795-2808. Zhang M., Kadota Y., Prodromou C., Shirasu K., and Pearl L.H. (2010). Structural basis for assembly of Hsp90-Sgt1-CHORD protein complexes: implications for chaperoning of NLR innate immunity receptors. Mol. Cell 39, 269-281. Zhang, Y., Fan, W., Kinkema, M., Li, X., and Dong, X. (1999). Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene. Proc. Natl. Acad. Sci. USA 96: 6523–6528. Zhang, Y., Goritschnig, S., Dong, X., and Li, X. (2003a). A gain-of-function mutation in a plant disease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1-1, constitutive 1. Plant Cell 15: 2636–2646. Zhang, Y., Tessaro, M.J., Lassner, M., and Li, X. (2003b). Knockout analysis of Arabidopsis transcription factors TGA2, TGA5, and TGA6 reveals their redundant and essential roles in systemic acquired resistance. Plant Cell 15: 2647–2653. Zhang Y., Cheng Y.T., Bi D., Palma K., and Li X. (2005). MOS2, a protein containing Gpatch and KOW motifs, is essential for innate immunity in Arabidopsis thaliana. Curr. Biol. 15, 1936-1942. Zhang Y. and Li X. (2005). A Putative Nucleoporin 96 Is Required for Both Basal Defense and Constitutive Resistance Responses Mediated by suppressor of npr1-1, constitutive 1. Plant Cell 17, 1306-1316. Zhu Z., Xu F., Zhang Y., Cheng Y.T., Wiermer M., Li X., and Zhang Y. (2010). Arabidopsis resistance protein SNC1 activates immune responses through association with a transcriptional corepressor. Proc Natl Acad Sci 107, 13960-13965.  119  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073818/manifest

Comment

Related Items