UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The contribution of different domains of connexin 43 to cytoskeletal rearrangements in B-lymphocytes Falk, Letitia Louise Elizabeth 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2013_spring_falk_letitia.pdf [ 43.91MB ]
Metadata
JSON: 24-1.0073756.json
JSON-LD: 24-1.0073756-ld.json
RDF/XML (Pretty): 24-1.0073756-rdf.xml
RDF/JSON: 24-1.0073756-rdf.json
Turtle: 24-1.0073756-turtle.txt
N-Triples: 24-1.0073756-rdf-ntriples.txt
Original Record: 24-1.0073756-source.json
Full Text
24-1.0073756-fulltext.txt
Citation
24-1.0073756.ris

Full Text

!!!!!THE!CONTRIBUTION!OF!DIFFERENT!DOMAINS!OF!CONNEXIN!43!TO!CYTOSKELETAL!REARRANGEMENTS!IN!B8LYMPHOCYTES!!!by!!Letitia!Louise!Elizabeth!Falk!!B.Sc.,!The!University!of!British!Columbia!Okanagan,!2008!!!! !!! ! ! ! MASTER!OF!SCIENCE!! in!! THE!FACULTY!OF!GRADUATE!STUDIES! !(Zoology)!!!!!!THE!UNIVERSITY!OF!BRITISH!COLUMBIA!!(Vancouver)!!!!!!April!2013! !©!Letitia!Louise!Elizabeth!Falk,!2013!!!! A!THESIS!SUBMITTED!IN!PARTIAL!FUFILMENT!OF!THE!REQUIREMENTS!FOR!THE!DEGREE!OF!! ! ii! ! ABSTRACT! ! !B8cells!change!shape!in!response!to!crosslinking!of!the!B8cell!antigen!receptor!(BCR).!BCR!signaling!induces!cytoskeletal!rearrangements!that!result!in!cell!spreading!to!improve!antigen!accumulation!and!B8cell!activation.!It!has!previously!been!shown!that!the!gap!junction!protein!connexin43!(Cx43)!is!both!necessary!and!sufficient!for!BCR8mediated!B8cell!spreading,!as!well!as!other!B8cell!responses!that!depend!upon!cytoskeletal!rearrangement.!Since!it!was!found!that!the!C8terminal!domain!(CT)!of!Cx43!was!required!for!these!effects,!we!hypothesized!that!the!molecular!mechanism!by!which!the!CT!influences!BCR8mediated!spreading!may!be!due!to!regulation!of!channel!permeability!or!alternately,!by!acting!as!an!adaptor!for!cytoskeletal!organization.!!!To!address!the!role!of!Cx43!in!forming!channels,!we!blocked!channel!function!both!pharmacologically!with!channel8blocking!drugs!(carbenoxolone,!probenecid,!and!lanthanum)!and!genetically!by!expressing!Cx43!mutant!Cx43T154A!in!a!Cx438null!plasmacytoma!cell!line!that!had!been!previously!transduced!to!express!the!BCR!(J558µm3)!for!use!in!spreading!assays.!Treatment!with!channel!blocking!drugs!did!not!prevent!BCR8mediated!B8cell!spreading,!and!hemichannel!(HC)!activity!was!not!detected!in!B8cells!as!measured!by!a!dye8uptake!assay.!Thus!we!conclude!that!Cx43!influences!B8cell!spreading!by!a!channel8independent!mechanism!and!that!the!Cx43!CT!may!act!as!a!scaffold!for!protein!interactions!involved!in!cytoskeletal!rearrangement!downstream!of!BCR!signaling.!In!support!of!this!idea,!the!channel8blocking!point!mutation!Cx43T154A!caused!B8cell!spreading!defects!even!in!the!absence!of!functional!HCs.!Further!characterization!of!this!mutation!suggests!that!it!impedes!normal!BCR8mediated!cell!spreading!due!to!a!distorted!conformation!of!the!Cx43!CT!domain.!!! ! iii! !To!further!investigate!the!importance!of!the!Cx43!CT!domain,!the!putative!Src8binding!residue!tyrosine!265!was!mutated.!J558µm3!cells!expressing!Cx43!with!the!single!point!mutation!Cx43Y265F!or!Cx43Y265D!were!unable!to!spread,!highlighting!the!importance!of!a!single!residue!of!Cx43!for!BCR8mediated!B8cell!spreading.!These!findings!highlight!the!CT!domain!as!important!for!Cx43’s!influence!on!B8cell!spreading,!and!pave!the!way!for!further!experiments!on!the!CT!tail!with!the!goal!of!better!understanding!the!molecular!mechanism!underlying!the!role!of!Cx43!in!B!cells!and!in!the!immune!response!in!general.!!! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! iv! ! ! PREFACE! ! ! ! I!!!!!Collaboration! !Data!from!Figure!3.2!was!collected!in!collaboration!with!Dr.!Jose!Luis!Vega!Pizarro,!visiting!Postdoctoral!Fellow,!Universidad!de!Catolica!de!Chile,!Santiago!Chile,!with!Dr.!Christian!Naus!lab,!Department!of!Cellular!and!Physiological!Sciences,!UBC.!Data!from!Figure!3.9!was!collected!by!May!Dang8Lawson.!! II!!!!!UBC!research!ethics!board!certificates!! !UBC!Animal!license!and!breeding!program!#A1080384!!Matsuuchi!Lab!animal!license!#A1180317.!! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! v! TABLE!OF!CONTENTS! !Abstract!..............................................................................................................................................................................!ii!Preface!...............................................................................................................................................................................!iv!Table!of!Contents!............................................................................................................................................................!v!List!of!Tables!................................................................................................................................................................!viii!List!of!Figures!..................................................................................................................................................................!ix!List!of!Abbreviations!....................................................................................................................................................!xi!Acknowledgements!.....................................................................................................................................................!xv!CHAPTER!1!!!!!INTRODUCTION!................................................................................................................................!1!1.1 The!immune!system!........................................................................................................................!1!1.2!!!!!!!!!!!!!!!!!!!!!!B8lymphocytes!...................................................................................................................................!3!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1.2.1!!!!!B8lymphocytes!in!the!immune!response!................................................................!3!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1.2.2!!!!!Structure!of!the!BCR!........................................................................................................!4!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1.2.3!!!!!BCR8mediated!cell!spreading!......................................................................................!7!!!1.3!!!!!!!!!!!!!!!!!!!!!!Connexins!.........................................................................................................................................!11!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1.3.1!!!!!Structure!and!formation!of!gap!junctions!and!hemichannels!....................!11!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1.3.2!!!!!The!role!of!connexins!in!the!immune!response!................................................!17!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1.3.3!!!!!Non8channel!functions!of!connexins!.....................................................................!19!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1.4!!!!!!!!!!!!!!!!!!!!!!Connexin!43!.....................................................................................................................................!21!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1.4.1!!!!!Regulation!of!Cx43!through!phosphorylation!...................................................!21!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1.4.2!!!!!The!role!of!Cx43!in!cell!migration!..........................................................................!23!!1.5!!!!!!!!!!!!!!!!!!!!!!The!role!of!Cx43!in!B8lymphocytes!........................................................................................!25!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1.5.1!!!!!Cx43!in!BCR8mediated!spreading!...........................................................................!25!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1.5.2!!!!!Cx43!in!B8cell!adhesion!and!migration!.................................................................!27!!1.5!!!!!!!!!!!!!!!!!!!!!!Purpose!of!thesis!study!...............................................................................................................!27!1.6!!!!!!!!!!!!!!!!!!!!!!Summary!of!findings!....................................................................................................................!30!CHAPTER!2!!!!!MATERIALS!AND!METHODS!....................................................................................................!34!2.1!!!!!!!!!!!!!!!!!!!!!!Materials!and!Reagents!..............................................................................................................!34! ! vi! !!!!!!!!!!!!!!!!!!!!!!!!!!!!2.1.1!!!!!Plasmids!.............................................................................................................................!34!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.1.2!!!!!Antibodies!.........................................................................................................................!37!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.1.3!!!!!Cell!lines!.............................................................................................................................!38!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.1.4!!!!!Mice!......................................................................................................................................!39!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.2!!!!!!!!!!!!!!!!!!!!!!Molecular!biology!techniques!..................................................................................................!39!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.2.1!!!!!Bacterial!transformation!............................................................................................!39!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.2.2!!!!!DNA!preparation!............................................................................................................!40!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.2.3!!!!!Restriction!endonuclease!digestion!.......................................................................!41!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.2.4!!!!!Polymerase!chain!reaction!........................................................................................!41!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.2.5!!!!!Agarose!gel!electrophoresis!......................................................................................!41!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.2.6!!!!!Site8directed!mutagenesis!.........................................................................................!42!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.3!!!!!!!!!!!!!!!!!!!!!!Tissue!culture!..................................................................................................................................!43!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.3.1!!!!!Cell!culture!........................................................................................................................!43!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.3.2!!!!!DNA!transfection!and!enrichment!..........................................................................!44!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.3.3!!!!!Cell!stimulation!...............................................................................................................!45!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.3.4!!!!!Drug!treatment!to!block!hemichannel!function!...............................................!46!!2.4!!!!!!!!!!!!!!!!!!!!!!Biochemical!procedures!.............................................................................................................!46!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.4.1!!!!!Cell!lysis!and!preparation!of!samples!...................................................................!46!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.4.2!!!!!SDS8PAGE!and!western!blotting!..............................................................................!47!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.4.3!!!!!Phosphatase!treatment!...............................................................................................!49!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.4.4!!!!!Biotinylation!of!surface!proteins!............................................................................!50!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.4.5!!!!!Immunoprecipitation!...................................................................................................!51!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.4.6!!!!!Rap!activation!assay!.....................................................................................................!51!!2.5!!!!!!!!!!!!!!!!!!!!!!Flow!cytometry!..............................................................................................................................!52!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.5.1!!!!!Sample!preparation!and!staining!............................................................................!52!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.5.2!!!!!Data!collection!and!analysis!......................................................................................!53!!2.6!!!!!!!!!!!!!!!!!!!!!!In#vitro!B!cell!assays!.....................................................................................................................!53!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.6.1!!!!!BCR8mediated!cell!spreading!...................................................................................!53!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.6.2!!!!!Cell!proliferation!............................................................................................................!55!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.6.3!!!!!Hemichannel!assay!.......................................................................................................!56!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.6.4!!!!!Cell!aggregation!..............................................................................................................!56!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.6.5!!!!!Bead!clearing!cell!motility!assay!.............................................................................!58!!2.7!!!!!!!!!!!!!!!!!!!!!!Confocal!microscopy!....................................................................................................................!58!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.7.1!!!!!Sample!preparation!and!staining!............................................................................!58!!!!!!!!!!!!!!!!!!!!!!!!!!!!!2.7.2!!!!!Image!acquisition!and!analysis!................................................................................!59!!2.8!!!!!!!!!!!!!!!!!!!!!!Statistics!............................................................................................................................................!60! ! vii! !CHAPTER!3!!!!!RESULTS!............................................................................................................................................!61!!3.1!!!!!!!!!!!!!!!!!!!!BCR8mediated!B8cell!spreading!is!independent!of!Cx43!channel!!!!!!!!!!!!!!!!!!!!!!!!!!!!function!................................................................................................................................................!62!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!3.1.1!!!!!Rationale!..............................................................................................................................!62!!!!!!!!!!!!!!!!!!!!!!!!!!!3.1.2!!!!!Channel8blocking!drugs!did!not!prevent!B8cell!spreading!............................!63!!!!!!!!!!!!!!!!!!!!!!!!!!!3.1.3!!!!!Overexpressed!Cx43!forms!hemichannels!that!are!not!actively!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!regulated!by!removal!of!divalent!cations!or!BCR8mediated!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!spreading!in!B8cells!........................................................................................................!65!!!!!!!!!!!!!!!!!!!!!!!!!!!3.1.4!!!!!Expression!of!Cx43T154A!in!a!B8cell!line:!J558µm3!........................................!68!!!!!!!!!!!!!!!!!!!!!!!!!!!3.1.5!!!!!EGFP8fused!Cx43!is!expressed!at!the!cell!surface!in!transduced!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!J558µm3!...............................................................................................................................!73!!!!!!!!!!!!!!!!!!!!!!!!!!!3.1.6!!!!!Expression!of!Cx43T154A!caused!non8radial!BCR8mediated!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!spreading!in!a!B8cell!line:!J558µm3!.........................................................................!75!!!!!!!!!!!!!!!!!!!!!!!!!!!3.1.7!!!!!Cx43T154A!had!a!dominant!negative!effect!on!BCR8mediated!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!cell!spreading!in!a!B8cell!line:!Wehi231!................................................................!77!!!!!!!!!!!!!!!!!!!!!!!!!!!3.1.8!!!!!Rap1!activation!is!required!for!Cx43’s!affect!on!BCR8mediated!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!spreading!in!the!J558µm3!B8cell!line!and!is!impeded!by!expression!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!of!Cx43T154A!....................................................................................................................!79!!!!!!!!!!!!!!!!!!!!!!!!!!!3.1.9!!!!!Removal!of!the!cytoplasmic!CT!tail!of!Cx43T154A!prevented!non8!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!radial!cell!spreading!completely!...............................................................................!85!!!!!!!!!!!!!!!!!!!!!!!!!!!3.1.10!!!Preliminary!experiments!to!test!the!effect!of!Cx43T154A!on!B8cell!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!migration!............................................................................................................................!86!!!!!!!!!!!!!!!!!!!!!!!!!!!!3.2!!!!!!!!!!!!!!!!!!!!!The!importance!of!tyrosine!265!of!the!Cx43!cytoplasmic!CT!tail!to!B8!!!!!!!!!!!!!!!!!!!!!!!!!!!!lymphocyte!spreading!..................................................................................................................!90!!!!!!!!!!!!!!!!!!!!!!!!!!!!!3.2.1!!!!!Rationale!.............................................................................................................................!90!!!!!!!!!!!!!!!!!!!!!!!!!!!!3.2.2!!!!!Expression!of!Cx43!cytoplasmic!CT!tail!mutants!in!a!B8cell!line:!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!J558µm3!.............................................................................................................................!92!!!!!!!!!!!!!!!!!!!!!!!!!!!!3.2.3!!!!!Phoshorylation!of!Cx43!in!response!to!BCR8signaling!...................................!94!!!!!!!!!!!!!!!!!!!!!!!!!!!!3.2.4!!!!!Importance!of!Cx43Y265!for!BCR8mediated!B8cell!spreading!....................!98!!!!!!!!!!!!!!!!!!!!!!!CHAPTER!4!!!!DISCUSSION!....................................................................................................................................!101!!REFERENCES!...............................................................................................................................................................!127!!APPENDIX!!!!!!!A1!!!!!!!!Cx43!extracellular!cysteine!residues!are!required!for!proper!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!trafficking!to!the!plasma!membrane!....................................................................!144!!!!!!!!!!!!!!!!!!!!!!!!!!!!!A2!!!!!!!!Mutation!of!Cx43!extracellular!cysteine!residues!prevents!B8cell!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!aggregation!......................................................................................................................!148!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! ! ! ! viii! ! ! LIST!OF!TABLES! !!!Table!2.1!!!!!Primer!sets!custom!ordered!for!site8directed!mutagenesis!.............................................!36!Table!2.2!!!!!Transduced!cell!lines!used!in!study!............................................................................................!45!Table!2.3!!!!!List!of!antibodies!used!in!western!blotting!.............................................................................!49!Table!A1!!!!!Cys8less!(CL)!Cx43!mutants!generated!by!site8directed!mutagenesis!.......................!145! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ix! ! ! LIST!OF!FIGURES! ! ! !Figure!1.1!!!!!Structure!of!the!B8cell!antigen!receptor!(BCR)!in!the!plasma!membrane!..................!6!Figure!1.2!!!!!BCR8mediated!B8cell!spreading!leads!to!formation!of!the!immune!synapse!.............!8!Figure!1.3!!!!!Activities!of!the!Rap1!GTPase!......................................................................................................!10!Figure!1.4!!!!!Structure!of!gap!junction!protein!connexin!43!....................................................................!14!Figure!2.1!!!!!Schematic!of!B8cell!spreading!assay!.........................................................................................!55!Figure!2.2!!!!!Schematic!of!quantification!of!B8cell!aggregation!..............................................................!57!!Figure!3.1!!!!!BCR8mediated!B8cell!spreading!is!not!affected!by!hemichannel8blocking!!!!!!!!!!!!!!!!!!!!!!!!!!drugs!.......................................................................................................................................................!64!!Figure!3.2!!!!!Hemichannel!activity!in!B8cell!lines!..........................................................................................!66!Figure!3.3!!!!!Characterization!of!J558µm3!cells!expressing!Cx43T154A!...........................................!70!Figure!3.4!!!!!Expression!of!Cx43T154A!by!J558µm3!does!not!affect!cell!size!or!!!!!!!!!!!!!!!!!!!!!!!!!!proliferation!.........................................................................................................................................!72!Figure!3.5!!!!!Surface!expression!of!Cx43!in!B8cells!.......................................................................................!74!!Figure!3.6!!!!!Spreading!of!J558µm3!cells!expressing!Cx43T154A!.........................................................!76!Figure'3.7'!!!!Cx43T154A!acts!as!a!dominant!negative!of!BCR8mediated!cell!spreading!!!!!!!!!!!!!!!!!!!!!!!!!!in!Wehi231!..........................................................................................................................................!78!!Figure!3.8!!!!!Rap1%activation%is%important%for%BCR8mediated'spreading'in'J558µm3!!!!!!!!!!!!!!!!!!!!!!!!!!plasmacytoma*cells..........................................................................................................................80!!Figure'3.9'!!!!Rap1!activation!in!the!J558µm3!B8cell!line!is!less!sustained!when!!!!!!!!!!!!!!!!!!!!!!!!!!!expressing!Cx43T154A!..................................................................................................................!82!!Figure!3.10!!!!!Involvement!of!the!CT!in!non8radial!spreading!phenotype!of!Cx43T154A!!!!!!!!!!!!!!!!!!!!!!!!!!!!expressing!cells!...............................................................................................................................!84!!Figure!3.11!!!!!Preliminary!experiments!for!testing!the!effect!of!Cx43T154A!on!B8cell!!!!!!!!!!!!!!!!!!!!!!!!!!!!migration!...........................................................................................................................................!87!!Figure!3.12!!!!!Characterization!of!J558µm3!cells!expressing!Cx43Y265F!and!Cx43Y265D!......!93! ! x! !!Figure!3.13!!!!!Mutation!of!Cx43!residue!Y265!does!not!prevent!band8shift!in!response!!!!!!!!!!!!!!!!!!!!!!!!!!!!!to!BCR!stimulation!.........................................................................................................................!95!!Figure!3.14!!!!!Tyrosine!phosphorylation!is!not!responsible!for!Cx43!band8shift!in!!!!!!!!!!!!!!!!!!!!!!!!!!!!!response!to!BCR!signaling!..........................................................................................................!96!!Figure!3.15!!!!!Y265!is!necessary!for!BCR8mediated!B8cell!spreading!..................................................!99!Figure!4.1!!!!!!!A!model!showing!how!the!CT!domain!of!Cx43!mutants!may!have!a!!!!!!!!!!!!!!!!!!!!!!!!!!!!dominant!negative!effect!on!B8cell!spreading!by!interfering!with!WT!!!!!!!!!!!!!!!!!!!!!!!!!!!Cx43!by!forming!heteromeric!hemichannels!....................................................................!110!!Figure!4.2!!!!!!A!model!showing!how!Cx43!influences!BCR8mediated!Rap1!activation!!!!!!!!!!!!!!!!!!!!!!!!!!!and!B8cell!spreading!......................................................................................................................!118!!!Figure!A1!!!!!!Expression!of!Cx43CL!mutants!in!a!B8cell!line:!J558µm3!.............................................!146!!Figure!A2!!!!!!Effect!of!Cx43!mutants!on!B8cell!aggregation!....................................................................!149!! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! xi! LIST!OF!ABBREVIATIONS: α!aa!Ab!Ag!!Amp!APC!!Arp2/3!ATP!BCR!BSA!Ca2+!CBX!CIP!CK81!CL!CO2!CT!cSMAC!Cx!D!DCFS!DMSO!DN!DNA!E!ECM! E.#coli#EDTA!EL!ER!ERK!!EtBr! Anti8!Amino!acid!Antibody!Antigen!Ampicillin!Antigen!presenting!cell!Actin8related!protein82/3!Adenosine!triphosphate!B!cell!antigen!receptor!Bovine!serum!albumin!Calcium!Carbenoxolone!Calf!intestinal!phosphatase!Casein!kinase!1!Cytoplasmic!loop!Carbon!dioxide!Carboxyl8terminal!Central!supermolecular!activation!complex!Connexin!Aspartic!acid!Divalent!cation!free!solution!Dimethyl!sulfoxide!Dominant!negative!Deoxyribonucleic!acid!Extracellular!Extracellular!matrix! Escherichia#coli#Ethylene!diamine!tetraacetic!acid!Extracellular!loop!Endoplasmic!reticulum!Extracellular!signal8regulated!kinase!Ethidium!bromide! ! xii! F!FACS!FBS!FITC!GAP!GDP!GEF!!GJ!GJIC!GTP!HC!HRP!h!!!HS1!IFN8γ!Ig!IP!ITAM!Ix!KCl!kDa!La3+!LAMP81!!LB!LFA81!LPS!MAPK!MEF!MFI!Mg2+!MgSO4!MHC!min! Phenylalanine!Fluorescent8activated!cell!sorting!Fetal!bovine!serum!Fluorescein!isothiocyanate!GTPase!activating!protein!Guanosine!diphosphate!Guanine!exchange!factor!Gap!junction!Gap!junction!intercellular!communication!Guanosine!triphosphate!Hemichannel!Horseradish!peroxidase!Hours!Hematopoietic!lineage!cell8specific!protein!1!Interferon8γ!Immunoglobuln!Immunoprecipitation!Immunoreceptor!tyrosine8based!activation!motif!Innexin!Potassium!chloride!Kilodalton!!Lanthanum!Lysosome!associated!membrane!protein!1!Lysogeny!broth!Lymphocyte!associated!antigen!1!Lipopolysaccharide!Mitogen8activated!protein!kinase!Mouse!Embryonic!Fibroblast!Mean!Fluorescence!Intensity!Magnesium!Magnesium!sulphate!Major!histocompatibility!complex!Minutes! ! xiii! mIg!mRNA!MW!Na2HPO4!Na3VO4!NaCl!NMR!NT!ODDD!Pbn!PBS!PCR!PE!PI3K!PKA!PKC!PLCγ!PM!PMSF!pSMAC!pY!Panx!rpm!RPMI!!SCAM!SDS8PAGE!sec!SH2!siRNA!T!TBS!TBST!TCR! Membrane!Ig!Messenger!RNA!Molecular!weight!Sodium!phosphate!Sodium!pervanadate!Sodium!chloride!Nuclear!Magnetic!Resonance!!Amino8terminus!Occulodentodigital!dysplasia!Probenecid!Phosphate!buffered!saline!Polymerase!chain!reaction!Phycoerythrin!Phosphoinositol83!kinase!Protein!kinase!A!Protein!kinase!C!Phospholipase!C!γ!Plasma!membrane!Phenylmethylsulfonyl!fluoride!Peripheral!supermolecular!activation!complex!Phospho8tyrosine!Pannexin!Revolutions!per!minute!Roswell!Park!Memorial!Institute!Substituted!cysteine!accessibility!method!Sodium!dodecylsulfate!polyacrylamide!gel!electrophoresis!Seconds!Src!homology!2!Small!interfering!RNA!Threonine!Tris8buffered!saline!TBS!+!0.1%!Tween820!T8cell!antigen!receptor! ! xiv! TLR!TM!UTR!WEHI!WT!Y!ZO81!! Toll8like!receptor!Transmembrane!Untranslated!region!Walter!and!Eliza!Hall!Institute!Wild!type!Tyrosine!Zona!occludens81!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! ! xv! ACKNOWLEDGEMETS! !!!I!would!like!to!thank!my!supervisor!Dr.!Linda!Matsuuchi!for!the!opportunity!to!do!my!MSc,!and!for!all!of!her!support!and!patience!during!my!studies!and!personal!development!as!a!graduate!student.!As!well,!I’d!like!to!thank!my!committee!members!Dr.!Christian!Naus!and!Dr.!Ninan!Abraham!for!their!advice!and!guidance!regarding!my!project.!Thank!you!to!Dr.!Mike!Gold!for!many!helpful!suggestions!and!collaborations!and!to!lab!members!both!past!and!present!for!their!assistance,!feedback,!and!for!making!my!experience!in!the!lab!a!lot!of!fun.!Lastly!I!would!like!to!dedicate!this!thesis!to!my!parents,!who!instilled!in!me!a!passion!for!learning!with!their!own!college!textbooks.!Thank!you!for!going!back!to!school!while!raising!me!because!it!set!the!best!example!of!work!ethic!I!have!learned!anywhere.!!!!!!!!!!!! ! 1! CHAPTER!1! INTRODUCTION! ! ! 1.1!!!!!The!immune!system!! ! ! !The!defining!characteristic!of!immunity!is!the!discrimination!between!self!and!non8self.!The!immune!system!is!evolutionarily!conserved!among!metazoans!since!multicellular!organisms!need!to!protect!themselves!from!invasion!by!disease8causing!viruses,!bacteria,!fungi!and!parasites,!known!collectively!as!pathogens.!In!addition,!multicellularity!requires!a!great!degree!of!coordination,!and!immunity!allows!for!the!recognition!of!aberrant!self!when!cells!become!dysregulated!such!as!in!cancer.!In!mammals,!the!immune!system!has!evolved!to!have!two!branches:!the!quick!responding!innate!immune!response!and!the!slower!and!more!specific!adaptive!immune!response.!!!The!innate!immune!system!is!evolutionary!ancient!and!faster!acting!than!the!adaptive!immune!system!and!acts!as!the!first!line!of!defense!against!infection.!Innate!immunity!includes!mechanical,!proteinaceous,!and!cellular!mechanisms!to!prevent!infection!from!occurring!in!the!first!place,!and!to!trap!and!clear!pathogens!that!successfully!invade!the!host.!Mechanical!barriers!include!the!epithelium!and!the!resident!flora!that!line!it,!the!continuous!flushing!of!surfaces!by!fluids!like!tears,!urine,!and!mucous,!and!actions!that!clear!trapped!pathogens!like!coughing!and!sneezing.!Proteinaceaous!factors!are!non8cellular!macromolecules!found!in!the!blood!plasma,!interstitial!fluid,!and!lymph,!including!proteins!of! ! 2! the!complement!system,!cytokines,!and!anti8microbial!peptides!secreted!by!cells!of!the!innate!immune!response.!Innate!immune!cells!(neutrophils,!eosinophils,!basophils,!and!macrophages)!recognize!common!pathogenic!patterns!such!as!bacterial!cell!compounds!like!lipopolysaccharide!(LPS),!peptidoglycan,!flagellin,!double!stranded!RNA,!and!unmethylated!CpG!sites!of!DNA,!as!well!as!nuclear!and!cytosolic!components!of!host!cells!exposed!by!necrotic!damage!through!evolutionarily!conserved!pattern!recognition!receptors!such!as!toll8like!receptors!(TLRs),!and!C8type!lectin!receptors!(CTLRs)!and!kill!pathogens!by!phagocytosis!or!by!the!release!of!anti8microbial!factors!from!cytotoxic!granules!(Akira!et!al.,!2006).!!!Unlike!the!innate!immune!response,!which!is!limited!to!recognition!of!commonly!occurring!pathogenic!patterns!by!non8specific!receptors,!the!adaptive!immune!response!has!the!ability!to!recognize!a!nearly!unlimited!variety!of!pathogens!by!the!generation!of!specialized!receptors!through!genetic!recombination.!The!main!players!in!the!adaptive!response!are!a!specialized!group!of!leukocytes,!or!white!blood!cells,!called!lymphocytes.!T8!and!B8lymphocytes!each!bear!a!receptor!on!their!cell!surface!with!a!unique!receptor!specificity,!which!upon!recognition!of!its!cognate!ligand!or!“antigen”!(Ag)!leads!to!activation!and!clonal!expansion!of!that!single!T8!or!B8cell.!Clonal!expansion!leads!to!proliferation!and!to!somatic!hypermutation!of!the!B8cell!antigen!receptor!(BCR)!to!fine8tune!its!specificity!through!affinity!maturation.!Mature!plasma!B8cells!secrete!Abs!that!neutralize!or!opsonize!pathogens!for!destruction!and!mature!T8cells!kill!targeted!cells!and!regulate!the!immune!response!by!secreting!cytokines!that!regulate!the!activities!of!cells!of!both!the!innate!and!adaptive!immune!response.!Clonal!expansion!also!leads!to!the!generation!of!memory!cells,!which!can! ! 3! be!retained!for!years!and!contribute!to!a!quicker!response!in!the!case!of!re8infection!by!the!same!pathogen!(Murphy!et!al.,!2011).!!! 1.2!!!!!BLlymphocytes!! ! ! ! 1.2.1!!BLlymphocytes!in!the!immune!response! ! ! !B8lymphocytes!develop!in!the!bone!marrow!from!hematopoietic!stem!cells!through!interaction!with!stromal!and!reticular!cells.!B8cell!development!is!largely!categorized!based!upon!maturation!state!of!the!BCR.!Naïve!or!“immature”!B8cells!released!from!the!bone!marrow!express!membrane!bound!BCR!of!the!Immunoglobulin!M!(IgM)!isotype!on!their!cell!surface!(Yuan!and!Witte,!1988).!These!cells!migrate!through!the!blood,!lymph,!and!secondary!lymphoid!organs!where!they!perform!the!role!of!immune!surveillance!by!sampling!environments!searching!for!Ags!(Murphy!et!al.,!2011).!!!Recognition!of!Ag!by!BCR!leads!to!B8cell!activation,!proliferation!and!differentiation!through!altered!gene!expression.!Activated!B8cells!undergo!somatic!hypermutation!which!leads!to!affinity!maturation!of!the!BCR,!during!which!class8switching!may!also!take!place.!During!class8switching,!the!BCR!heavy!chain,!which!is!the!isotype8!determining!component,!may!be!changed!from!the!immature!IgM!to!another!type!(Pascual!et!al.,!1994).!There!are!five!different!BCR!heavy!chains:!IgM,!IgD,!IgG,!IgA,!and!IgE,!which!differ!primarily!in!their!properties!in!secreted!form,!however!this!discussion!will!focus!mainly!on!IgM!(Chapter!1.2.2).!Clonal!expansion!leads!to!two!functionally!distinct!populations!of!mature!B8cells:!plasma!cells!and! ! 4! memory!cells.!Plasma!cells!secrete!antibodies!(Abs)!that!harbor!the!same!Ag!specificity!as!the!BCR!and!are!derived!from!a!splice!variant!of!the!same!gene!that!lacks!the!transmembrane!domain!that!anchors!the!BCR!on!the!cell!surface.!Secreted!Abs!coat!pathogens,!which!opsonizes!them!for!destruction!by!the!complement!system!or!by!effector!cells!that!can!bind!Abs!through!Fc!receptors.!Memory!B8cells,!expressing!BCRs!on!their!cell!surfaces,!are!retained!in!the!bone8marrow!and!can!be!quickly!re8activated!by!their!cognate!Ag!binding!to!the!BCRs,!leading!to!differentiation!into!Ab8secreting!plasma!cells!once!more.!!!B8cell!activation!also!leads!to!Ag8internalization.!The!affinity!and!amount!of!Ag8binding!determines!the!likelihood!of!B8cell!activation!(Batista!and!Neuberger,!2000),!but!internalized!antigen!is!also!processed!for!cross8presentation!on!major!histocompatibility!complex!II!(MHC!II)!molecules!for!the!stimulation!of!helper!T!cells!(Lanzavecchia,!1985).!Helper!T!cells!prime!the!immune!response!by!secreting!cytokines!that!act!on!many!immune!cells!and!assist!in!B8cell!class8switching.!!! ! 1.2.2!!Structure!of!the!BCR! ! !!While!secreted!Abs!have!been!studied!for!over!a!century,!the!surface!bound!form!(the!BCR)!was!not!identified!on!B8lymphocytes!until!the!1970’s.!That!the!BCR!was!a!cell!surface8bound!immunoglobulin!(Ig)!was!determined!by!experiments!showing!the!transformative!potential!of!anti8Ig!antisera!to!stimulate!rabbit!lymphocytes!(Sell!and!Gell,!1965)!and!by!immunofluorescent!labeling!of!membrane!Ig!(mIg)!(MC!RAFF!and!Taylor,!1970;!Pernis!et!al.,!1971).!! ! 5! Structurally,!the!BCR!consists!of!an!Ag8binding!subunit!and!a!signaling!subunit!(for!review!see!(Reth,!1995)).!The!Ag8binding!subunit!is!composed!of!two!Ig!chains!linked!through!disulfide!bonds.!The!Ig!chains!are!a!heavy!chain!and!a!light!chain!named!for!their!relative!molecular!weights.!There!are!two!types!of!light!chain,!lambda!(λ)!and!kappa!(κ),!which!have!a!molecular!weight!of!approximately!25828!kDa!and!whose!variable!region!genes!are!recombined!to!create!the!unique!specificity!of!each!BCR.!There!are!five!heavy!chain!isotypes,!IgM,!IgD,!IgA,!IgG!and!IgE.!This!discussion!will!focus!only!on!the!IgM!isotype!which!is!67878!kDa!(Vitetta!et!al.,!1971).!The!variable!region!of!the!genes!encoding!the!heavy!chains!are!also!recombined!to!generate!unique!binding!sites!that!generate!the!BCR!specificity!when!combined!with!the!light!chains!that!have!gone!through!the!same!process.!!!Early!studies!in!B8cell!lines!showed!that!mIgM!was!not!the!entire!BCR!but!that!the!Ag8binding!subunit!formed!a!complex!with!a!signaling!subunit!that!was!required!for!trafficking!of!BCR!to!the!cell!surface!(Matsuuchi!et!al.,!1992).!The!signaling!subunit!is!a!disulfide8linked!heterodimer!composed!of!two!Ig!protein!superfamily!members:!Igα!and!Igβ.!Igα!is!a!34!kDa!protein!encoded!by!the!gene!mb81!(Hombach!et!al.,!1988),!and!Igβ!is!a!39!kDa!protein!encoded!by!the!gene!B29!(Hermanson!et!al.,!1988).!!Igα!and!Igβ!have!cytoplasmic!carboxy8terminal!tails!which!contain!immunoreceptor!tyrosine8based!activation!motifs!(ITAMs)!which!are!phosphorylated!upon!BCR!stimulation!and!initiate!the!BCR!signaling!cascade.!The!Ag8binding!and!signaling!subunits!oligomerize!in!the!ER!and!are!trafficked!to!the!cell!surface!as!a!protein!complex!(Figure!1.1).!! !! ! 6! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! ! Figure!1.1!Structure!of!the!BLcell!antigen!receptor!(BCR)!in!the!plasma!membrane.!BCR!of!the!J558µm3!cell!line!used!most!commonly!throughout!this!project,!composed!of!the!Ag8binding!subunit:!mIgM,!composed!of!heavy!chain!Igμ!(green)!and!light!chain!Igλ!(orange)!held!together!by!disulfide!bonds!shown!in!black!bars,!and!the!signaling!subunit!composed!of!Igα!(red)!and!Igβ!(blue)!which!contain!ITAMs!(purple)!and!tyrosine!residues!(yellow!circles).!!!!! Igα$ Igβ$ Igμ$Igμ$ Igλ$ Igλ$ mIgM$ ! 7! 1.2.3!!BCRLmediated!cell!spreading! ! !!The!BCR!is!divalent!so!crosslinking!of!BCR!molecules!into!larger!aggregates!by!Ag8binding!activates!the!BCR!and!leads!to!the!formation!of!BCR!signaling!clusters!in!the!membrane!(Depoil!et!al.,!2007;!Fleire!et!al.,!2006).!BCR!crosslinking!leads!to!the!phosphorylation!of!ITAMs!within!the!Igα!and!Igβ!cytoplasmic!domains,!likely!by!nearby!Src!family!kinases!such!as!Lyn,!Fyn,!Blk,!and!Lck!(Gold!et!al.,!1990).!Phosphorylated!tyrosine!residues!in!these!ITAM!domains!recruit!non8receptor!tyrosine!kinase!Syk!which!can!bind!these!residues!through!its!SH2!domain!(Takata!et!al.,!1994).!This!leads!to!subsequent!phosphorylation!events!that!activate!a!cascade!of!kinases!leading!to!three!main!signaling!pathways!mediated!by!the!following!enzymes:!PLCγ,!Ras/MAPK,!and!PI3K!(for!review!of!BCR!signaling!see!(Defranco!et!al.,!2006).!These!pathways!lead!to!changes!in!gene!expression!resulting!in!either!B8cell!proliferation,!or!to!cell!death!if!the!B8cell!is!at!a!specific!stage!of!development.!!!!In!addition!to!activating!transcription!factors!that!cause!changes!to!gene!expression,!BCR!signaling!results!in!more!immediate!and!proximal!modifications!to!the!actin!cytoskeleton.!While!early!studies!of!BCR8signaling!were!performed!biochemically,!advances!in!microcopy!techniques!have!allowed!for!the!visualization!of!early!events!at!the!plasma!membrane!during!BCR8Ag!binding.!F.D.!Batista!and!others!have!shown!that!the!B8cell!undergoes!a!dynamic!spreading!and!contraction!response!upon!BCR!stimulation!which!facilitates!the!formation!of!the!immune!synapse!(Fleire!et!al.,!2006).!The!immune!synapse!forms!between!the!B8cell!and!APC!and!consists!of!a!central!cluster!of!Ag8BCR!called!the!central!supermolecular!activation!!! ! 8! !!!!!!!!!!!!!!!!!!!!!!!!! ! ! ! ! ! ! ! ! ! ! Figure!1.2!BCRLmediated!BLcell!spreading!leads!to!formation!of!the!immune!synapse.!BCR!stimulation!by!recognition!of!its!ligand/Ag!results!in!B8cell!spreading!and!then!contraction!which!allows!the!B8cell!to!accumulate!Ag!(red!dot),!form!BCR!micro8clusters!(green),!and!form!an!immune!synapse!which!consists!of!a!signaling!center!containing!BCR!and!Ag!called!the!central!supramolecular!activation!cluster!(cSMAC),!surrounded!by!the!peripheral!supramolecular!activation!cluster!(pSMAC)!which!is!composed!of!adhesion!molecules!such!as!integrins!(purple).!The!B8cell!surface!is!depicted!independently!of!antigen!presenting!cell!surface!or!lipid!bilayer!upon!which!the!B8cell!spreads.!The!immune!synapse!facilitates!prolonged!BCR!signaling!and!Ag8internalization.!! pSMAC& cSMAC& ! 9! complex!(cSMAC),!surrounded!by!a!ring!of!integrins!called!the!peripheral!supermolecular!activation!complex!(pSMAC)!(Figure!1.2).!The!immune!synapse!facilitates!prolonged!BCR8signaling!and!Ag8internalization!(Carrasco!et!al.,!2004).!!!This!B8cell!spreading!response!depends!upon!a!wave!of!actin!depolymerization!that!is!required!for!the!reorganization!of!the!cytoskeleton!within!lamellopodia!for!cell!spreading.!Breakdown!of!the!cortical!actin!cytoskeleton!was!also!recently!demonstrated!to!be!sufficient!to!increase!BCR!mobility!and!lead!to!BCR!cluster8formation!and!signaling!(Treanor!et!al.,!2011).!!Our!knowledge!of!the!signaling!pathway!leading!from!BCR!activation!to!cytoskeletal!rearrangement!is!incomplete,!however!the!Rap1!GTPase!has!emerged!as!a!key!effector!for!regulation!of!cytoskeletal!dynamics!downstream!of!the!BCR.!Rap1!activity!is!important!for!B8cell!spreading!and!formation!of!the!immune!synapse!(Lin!et!al.,!2008a;!McLeod!et!al.,!1998;!McLeod!et!al.,!2004).!The!GTPase!activity!of!Rap1!allows!it!to!act!as!a!molecular!switch!and!regulate!the!activity!of!a!variety!of!actin8binding!and!regulating!proteins.!The!GTP!bound!form!of!Rap1!is!active!but!can!be!converted!to!Rap18GDP!by!GTPase!activating!proteins!(GAPs),!which!help!catalyze!the!hydrolysis!of!GTP.!Guanine!exchange!factors!(GEFs)!convert!Rap18GDP!back!into!active!Rap18GTP!(Figure!1.3).!Overexpression!of!a!constitutively!active!Rap8specific!GAP!(RapGAPII)!in!the!A20!B8cell!line!prevented!BCR8mediated!B8cell!spreading,!demonstrating!Rap1’s!importance!in!this!process!(Lin!et!al.,!2008b).!!! !! ! 10! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Figure!1.3!Activities!of!the!Rap1!GTPase.!The!Rap1!GTPase!acts!as!a!molecular!switch!to!control!rearrangements!of!the!cytoskeleton!by!activating!various!actin!binding!or!actin!regulating!proteins!(colored!rectangles).!Rap1!activity!is!controlled!by!guanine!exchange!factors!(GEFs)!and!GTPase!activating!proteins!(GAPs)!that!facilitate!the!addition!of!a!phosphate!group!or!hydrolysis!of!GTP!respectively.!Rap1!is!activated!by!signaling!cascades!that!result!from!BCR!crosslinking,!chemokine!receptor!ligand!binding,!and!integrin!engagement.!Rap1!also!contributes!to!inside8out!signaling:!causing!integrins!to!adopt!an!activated!conformation!and!resulting!in!breakdown!of!the!cortical!actin!cytoskeleton!to!enhance!BCR!mobility!and!therefore!BCR!cluster!formation!independently!of!BCR!signaling.! GAP$ BCR$Chemokine$ Cofilin$ RIAM$ AF46$ VAV2$ TIAM$ Talin$ RAP1$ RAP1$ OFF# ON# Integrin$ Ac?n$Filament$ Disassembly$ Ac?n$ Polymeriza?on$ Scaffolding/ Priming$Ac?n$ Monomers$ Links$Ac?n$to$ Plasma$ Membrane$ GEF$ In sid e' ('O ut ' ! 11! 1.3!!!!!Connexins!!!! 1.3.1!!Structure!and!formation!of!gap!junctions!and!hemichannels! !!!Cell8cell!communication!is!important!to!all!multicellular!organisms!for!the!coordination!of!cellular!processes!and!propagation!of!signals!through!tissues.!The!“gap!junction”!(GJ)!is!a!plaque!of!protein!channels!that!connects!adjacent!cells!whose!membranes!remain!separated!by!a!2!nm!“gap”.!GJ!plaques!were!first!identified!in!electron!micrographs!of!the!axons!of!goldfish!(Robertson,!1963)!and!were!first!referred!to!as!“Gap!Junctions”!by!Revel!and!Karnovsky!(Revel!and!Karnovsky,!1967)!to!differentiate!them!from!other!junction!types!like!adherens!and!tight!junctions.!In!vertebrates,!each!GJ!channel!is!made!up!of!twelve!protein!subunits!called!“connexins”!(Cxs),!a!name!that!was!first!used!to!describe!the!protein!family!by!D.!A.!Goodenough!in!1987.!!!GJ!channels!allow!for!the!passive!diffusion!of!small!ions!and!metabolites!of!up!to!1!kDa!in!size!between!coupled!cells.!This!communication!is!important!for!many!physiological!processes!ranging!from!myocardial!contraction!(Barr!et!al.,!1965),!vasomotor!tone!(Christ!et!al.,!1996),!and!smooth!muscle!contraction!(Campos!et!al.,!1993;!Daniel!et!al.,!2001;!Garfield!et!al.,!1988),!to!cell!cycle!regulation!(Kardami!et!al.,!2007)!and!cellular!differentiation!(Trosko!et!al.,!2000).!GJs!can!also!suppress!defects!resulting!from!somatic!mutations!and!may!act!as!tumor!suppressors,!although!GJs!have!conflicting!roles!in!tumorogenesis,!acting!as!both!tumor!suppressors!(Mesnil,!2002;!Naus!and!Laird,!2010)!but!also!increasing!tumor!invasion!of!some!cancer!cell!types!(Ezumi!et!al.,!2008;!Li!et!al.,!2007;!Lin!et!al.,!2002).!!! ! 12! !Strategies!for!cell8cell!communication!have!evolved!independently!in!different!multicellular!organisms.!Plant!cells!communicate!through!plasmodesmata,!which!differ!structurally!from!GJs!due!to!the!presence!of!cell!walls!in!plants.!Fungal!cells!sometimes!connect!through!“pores”!though!they!frequently!form!fused!cell!structures!since!fungi!form!less!organized!tissues!in!general.!Within!the!animal!kingdom,!GJ!proteins!evolved!in!at!least!two!independent!events!by!convergent!evolution,!giving!rise!to!the!innexin!(Ix)!family!of!GJ!proteins!in!invertebrates!and!the!connexin!(Cx)!family!in!vertebrates,!which!share!structural!but!not!sequence!homology!(Scemes!et!al.,!2009).!A!more!recently!discovered!pannexin!(Panx)!family!of!proteins!found!in!vertebrates!share!sequence!homology!with!the!invertebrate!Ixs,!providing!further!support!that!the!Ixs!are!the!more!ancestral!GJ8forming!protein!family,!and!that!they!have!been!adapted!to!hemichannel!(HC)!function!in!vertebrates.!Panxs!function!exclusively!as!HCs!in!vertebrates!due!to!the!glycosylation!of!the!extracellular!loops.!These!modifications!may!sterically!hinder!docking!of!HCs!into!GJs!in!vertebrates!since!no!other!GJ!proteins!are!found!to!be!glycosylated!on!the!extracellular!loops,!and!since!close!proximity!is!required!for!disulfide!linkage!of!GJs,!these!types!of!modifications!inhibit!proper!GJ!formation!(Sosinsky!et!al.,!2011).!!!There!are!20!different!Cx!proteins!in!mice!and!21!in!humans,!named!for!their!molecular!weight!as!determined!by!mobility!using!SDS8gel!electrophoresis!since!these!proteins!differ!markedly!in!length,!especially!of!their!cytoplasmic!carboxyl8terminal!(CT)!domains!(for!review!see!(Sosinsky!and!Nicholson,!2005).!Predictions!based!on!sequences!of!isolated!Cx!cDNAs,!proteolysis,!and!mapping!using!antisera!of!different!specificities,!has!led!to!models!of! ! 13! GJ!structure!that!have!since!been!confirmed!by!crystallography!(Unger!et!al.,!1999)!and!nuclear!magnetic!resonance!(NMR)!experiments!(Sorgen!et!al.,!2004).!Cx!family!members!all!share!a!high!degree!of!conservation!in!their!four!transmembrane!domains!(TM184).!These!TM!domains!are!connected!by!two!extracellular!loops!E1!and!E2.!Each!extracellular!loop!contains!three!conserved!cysteine!residues!that!form!disulfide!bonds!with!opposing!Cxs!on!the!adjacent!cell!and!together!they!form!conduits!between!cells!by!forming!an!impenetrable!β8barrel!structure!(Foote!et!al.,!1998).!These!cysteines!appear!in!a!highly!conserved!sequence:!E1:!C8X68C8X38C!and!E2:!C8X58C8X58C!and!the!degree!of!sequence!conservation!between!Cx!types!allows!heterogeneous!GJs!to!form!(Cottrell!and!Burt,!2005).!The!formation!of!heterogeneous!GJs!may!serve!to!increase!variability!in!channel!permeability!and!conductance!due!to!combinations!of!Cx!types!expressed!by!the!same!cells!(Zhang!and!Nicholson,!1994).!!!Cx!proteins!have!three!cytoplasmic!domains:!a!short!amino8terminus!(NT),!a!cytoplasmic!loop!(CL)!and,!of!particular!importance,!some!Cx!proteins!contain!a!long!carboxyl8terminal!tail!(CT)!that!varies!considerably!in!both!sequence!and!length!between!Cx!proteins!(Figure!1.4).!All!three!cytoplasmic!domains!are!flexible,!containing!short!α8helices!separated!by!hinge!domains!(Sorgen!et!al.,!2004).!Regions!of!all!three!cytoplasmic!domains!have!been!implicated!in!channel8gating!which!may!be!regulated!by!a!ball8and8chain!method,!by!protein8interactions,!or!by!sensitivity!of!these!domains!to!voltage!(Evans!and!Martin,!2002).!Of!the!four!TM!domains,!TM3!is!the!most!amphipathic!and!was!therefore!predicted!to!line!the!aqueous!channel!(Zimmer!et!al.,!1987).!This!has!been!confirmed!by!the!Substituted!Cysteine!Accessibility!Method!(SCAM)!and!structural!studies!(Bogdanov!et!al.,!2005).!!! ! 14! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Figure!1.4!Structure!of!gap!junction!protein!connexin!43.!Schematic!tertiary!structure!of!a!single!Cx43!protein!in!a!lipid!bilayer.!Cylinders!represent!α8helices.!Cytoplasmic!domains!are!indicated!in!green!(NT!stands!for!the!N8terminus,!CL!for!the!cytoplasmic!loop!and!CT!for!the!C8terminus),!transmembrane!domains!(TM)!in!orange,!and!extracellular!domains!(E)!in!blue.!Circles!represent!relevant!amino!acid!residues,!numbered!according!to!their!sequence!from!N8!to!C8terminus.!Yellow!circles!represent!tyrosine!(Y)!residues,!red!circles!cysteine!(C)!residues!and!purple!circles!threonine!(T)!residues.!The!sequence!of!a!proline!(P)8rich!sequence!hypothesized!to!be!a!SH3!domain!binding!site!is!shown!in!grey.!The!position!where!the!CT!(ΔCT/246)!domain!is!commonly!truncated!in!Cx43!mutant!constructs!is!indicated!by!the!red!line.!(Not!drawn!to!scale).! NH3$ COOH$ 247$ 265$ ΔCT$(246)$$$ 17$ 54$ 187$ NT$ CL$ CT$ E1$ E2$ TM 1$ TM 2$ TM 3$ TM 4$ 154$ 61$ 65$ 198$ 192$ Extracellular$ Transmembrane/$ Channel$ Cytoplasmic$ 1$ 2$ 3$ 4$ PTAPLSPMSP$ ! 15! The!Cx!genes!are!divided!into!three!subgroups!(α,!β,!and!γ)!based!on!sequence!identity!and!tail!length!(for!review!see!(Söhl!and!Willecke,!2004)).!Most!have!two!exons!flanked!by!a!5’8!and!a!3’8untranslated!region!(UTR)!and!separated!by!a!single!intron!of!varying!length.!The!3’8most!exon!contains!the!coding!region.!Knockout!mice!have!been!made!for!13!of!the!20!Cx!types!resulting!in!a!range!of!phenotypes.!In!addition,!human!diseases!such!as!oculodentodigital!dysplasia!(ODDD),!Charcot8Marie!tooth!disease,!non8syndromic!hereditary!deafness,!and!erythrokeratodermis!variabilis!have!been!linked!to!mutations!in!Cx43,!Cx32,!Cx26,!and!Cx31!genes!and!specific!regions!of!the!proteins!have!been!linked!with!the!disease!state!(Paznekas!et!al.,!2009).!!!Cx!proteins!are!co8translationally!inserted!into!the!endoplasmic!reticulum!(ER)!where!inter8loop!disulfide!bonds!form!between!E1!and!E2!and!where!miss8foldings!are!recognized!by!resident!chaperone!proteins.!Chaperone!proteins!such!as!ERp29!have!also!been!shown!to!prevent!oligomerization!from!occurring!prematurely!in!the!ER!(Das!et!al.,!2009).!!Oligomerization!into!six8membered!rings!called!“hemichannels”!(HCs)!or!“connexons”!occurs!in!the!trans8golgi!prior!to!trafficking!to!the!plasma!membrane.!Microtubule8binding!and!caveolin!are!required!for!transport!to!the!plasma!membrane!and!possibly!into!lipid!raft!domains.!Delivery!to!the!plasma!membrane!is!followed!by!lateral!diffusion!of!HCs!and!incorporation!into!the!periphery!of!existing!GJ!plaques!(Lauf!et!al.,!2002).!!!HCs!are!transported!to!the!plasma!membrane!in!their!closed!conformation!and!open!upon!GJ!docking!(Bukauskas!et!al.,!1995),!although!increasing!evidence!shows!that!HCs!may!open!under!certain!conditions!and!exchange!molecules!between!the!cytoplasm!and!the! ! 16! extracellular!space!(for!review!see!(Evans!et!al.,!2006)).!!Cx!HCs!were!proposed!after!a!large!increase!in!conductance!was!noticed!in!cells!that!had!been!caused!to!overexpress!Cx40!(Bukauskas!et!al.,!1995).!While!HCs!have!now!been!measured!for!many!Cx!types,!the!physiological!relevence!of!Cx!HCs!is!still!debated.!HCs!may!play!a!role!in!autocrine/paracrine!signaling!by!allowing!the!release!of!adenosine!triphosphate!(ATP)!to!locally!activate!purinergic!receptors!(Baroja8Mazo!et!al.,!2012).!!GJ!plaque!size!and!location!are!determined!by!scaffolding!proteins!that!bind!to!cytoplasmic!regions!of!Cx!proteins!and!link!them!to!the!cytoskeleton.!Cx!proteins!have!a!relatively!short!half8life!for!junction!proteins,!being!turned!over!every!few!hours.!Old!GJs!are!removed!from!the!plaque!interior!whole!in!double8membrane!structures!called!“annular!junctions”!or!“connexosomes”!which!fuse!with!lysozymes!for!degradation.!!Cxs!are!targeted!for!internalization!and!degradation!by!phosphorylation,!as!well!as!mono8!and!poly8ubiquitination!(Solan!and!Lampe,!2009b).!!!Although!GJs!are!much!less!voltage8sensitive!than!other!ion!channels,!they!can!be!regulated!by!changes!in!potential!across!the!GJ!connecting!two!cell!membranes!(Vj)!or!across!a!single!membrane!(Vm)!in!the!case!of!HC!gating.!GJ!channels!and!HCs!are!also!gated!by!pH,!concentration!of!divalent!cations!(especially!Ca2+),!and!phosphorylation.!Phosphorylation!is!likely!the!most!relevant!method!of!gating!GJ!channels!in!physiological!settings!(Solan!and!Lampe,!2009b)!(Chapter!1.4.1)!although!other!methods!of!channel8gating!have!been!important!for!studies!of!GJ!and!HC!properties!and!for!the!identification!of!residues!or!protein!domains!relevant!to!gating!of!these!channels.!! ! 17! ! 1.3.2!!The!role!of!connexins!in!the!immune!response!!!! ! ! !Connexins!are!expressed!by!immune!cells!themselves,!as!well!as!cell!types!found!in!immune!cell!niches!such!as!lymph!nodes,!bone!marrow,!endothelial!cells,!and!the!thymus!(Alves!et!al.,!2005;!Dorshkind!et!al.,!1993;!Krenacs!and!Rosendaal,!1995;!Larson!et!al.,!1997).!B8lymphocytes!have!been!shown!to!express!Cx40!and!Cx43!at!both!the!protein!and!the!messenger!RNA!(mRNA)!level,!and!not!to!express!Cx26,!Cx32,!Cx37,!or!Cx45!(Oviedoorta!et!al.,!2008),!although!expression!has!not!be!tested!for!all!20!Cx!proteins.!GJs!are!important!for!normal!hematopoiesis!by!facilitating!communication!between!bone!marrow!and!stromal!cells,!and!likely!between!stromal!cells!and!developing!blood!cells!(Montecino8Rodriguez!and!Dorshkind,!2001).!Cx438/8!mice!are!postnatal!lethal!making!them!an!inefficient!tool!for!studying!the!role!of!Cx43!in!the!immune!response,!however!heterozygous!Cx43+/8!mice!have!reduced!numbers!of!T8!and!B8cells!as!measured!using!markers!IgM!and!CD19!for!B8cells!and!CD4!and!CD3!for!T8cells!(Montecino8Rodriguez!et!al.,!2000).!Therefore!Cx43!likely!plays!a!role!in!development!of!lymphocytes!at!the!least,!although!the!importance!of!Cxs!is!likely!undervalued!since!other!Cx!types!probably!compensate!in!individual!Cx8kockdown!experiments.!!!!Cx43!expression!is!up!regulated!at!both!the!mRNA!and!protein!level!in!response!to!lipopolysaccharide!(LPS)8induced!inflammation!in!leukocytes!and!endothelial!cells!both!in!vitro!and!in#vivo!(Jara!et!al.,!1995),!as!well!as!in!macrophages!(Eugenín!et!al.,!2003).!!Inflammation!caused!by!lysozyme!injection!into!mouse!footpad!caused!increased!expression! ! 18! of!Cx43!in!lymph!nodes!and!particularly!in!the!light!zone!of!germinal!centers!where!B!cell!fate!decisions!are!made!(Krenacs!et!al.,!2005),!suggesting!that!Cx43!may!play!a!role!in!germinal!center!organization!and!B8cell!differentiation.!!!!!GJ!coupling!in!lymphocytes!was!first!demonstrated!in!1974!by!microelectrode!studies!of!isolated!human!peripheral!blood!lymphocytes!(Oliveira8Castro!and!Barcinski,!1974).!GJ!coupling!has!been!reported!between!B8cells!and!T8cells,!with!other!B8cells!(Oviedoorta!et!al.,!2008),!and!with!follicular!dendritic!cells!(FDCs)!(Krenacs!et!al.,!2005).!!Blocking!GJ!channel!function!in!mixed!T8!and!B8lymphocytes!cultures!with!drugs!or!mimetic!peptides!reduced!Ig!and!cytokine!secretion!in#vitro!(Oveido8Orta!et!al.,!2001).!!!While!GJ!intracellular!communication!(GJIC)!is!difficult!to!study!in!leukocytes!due!to!their!highly!migratory!behavior!and!formation!of!relatively!transient!cell8cell!contacts,!increasing!evidence!suggests!that!HCs!may!play!a!role!in!various!immune!responses.!ATP!release!through!HCs!is!emerging!as!a!mechanism!for!signal!amplification!and!has!been!implicated!in!neutrophil!and!macrophage!chemotaxis!(Chen!et!al.,!2006),!T8cell!activation!(Mendoza8Naranjo!et!al.,!2011),!and!macrophage8induced!cell!killing.!!ATP!released!through!HCs!can!act!as!an!autocrine!and!paracrine!signal,!stimulating!purinergic!receptors!on!nearby!cells.!Purinergic!receptor!signaling!leads!to!opening!of!both!Panx!and!Cx!HCs!and!to!Ca2+!influx!(for!review!see!(Baroja8Mazo!et!al.,!2012)).!While!the!effects!of!HC!activity!have!mostly!been!attributed!to!Panxs,!which!exclusively!form!HCs!(Bruzzone!et!al.,!2003),!the!increasing!evidence!for!Cx!HCs!should!make!us!aware!that!Cx!HCs!may!play!a!role!in!these!responses!as!well.!!!! ! 19! ! !Communication!between!B8cells!and!other!immune!cell!types!is!essential!for!cross8presentation!and!co8stimulation,!though!whether!Cxs!play!a!role!in!these!responses!has!yet!to!be!studied.!A!role!for!GJs!in!cross8presentation!of!Ag!from!infected!cells!to!professional!APCs!like!dendritic!cells!has!been!hypothesized!by!experiments!showing!the!direct!transfer!of!small!linear!peptides!between!cells!expressing!Cx43!and!exhibiting!GJIC!(Neijssen!et!al.,!2005).!!These!peptides!were!subsequently!presented!on!MHC!I!molecules!and!lead!to!cytotoxic!T8cell!activation!as!measured!by!interferon8γ!(IFN8γ)!production.!B!cells!are!professional!antigen!presenting!cells!(APCs)!therefore!it!may!be!expected!that!Cx43!may!contribute!to!Ag!transfer!and!presentation!in!these!cells!as!well.!For!a!review!of!GJ!mediated!Ag8presentation!see!(Handel!et!al.,!2007).!!!!!!!!!!!!!!!!! 1.3.3!!NonLchannel!functions!of!connexins! ! ! !Over!the!past!decade,!a!number!of!studies!have!shown!that!Cxs!have!effects!independent!of!GJ!channel!function.!These!studies!have!taken!advantage!of!pharmacological!agents!to!block!channels!(Guan!et!al.,!1996;!Silverman!et!al.,!2008),!mimetic!peptides!(Leybaert!et!al.,!2003)!and!antibody!neutralization!of!specific!regions!of!the!Cx!protein!(Hofer!and!Dermietzel,!1998),!as!well!as!mutations!known!to!block!channel!function!(Beahm!et!al.,!2006)!or!to!prevent!trafficking!to!the!cell!surface!where!GJs!are!able!to!form!(Tong!et!al.,!2007).!!While!some!effects!of!Cx!expression!may!be!attributed!to!HC!activity!rather!than!GJ!formation,!many!effects!are!independent!of!channel!activity!altogether.!Channel8blocking!studies!suggest!an! ! 20! alternate!mechanism!of!Cx’s!action!such!as!protein8protein!interactions!involving!cytoplasmic!regions!like!the!CT!that!could!participate!in!scaffolding!or!propagation!of!signaling!cascades.!!Two!functions!of!Cxs!are!frequently!reported!to!be!independent!of!GJ!function:!firstly!the!role!of!Cxs!on!cell!cycle!progression!and!viability,!and!secondly,!on!cell!motility!and!migration.!Initially!the!effect!of!Cxs!on!cell!growth!was!presumed!to!be!a!by8stander!effect!where!GJs!facilitate!the!diffusion!of!pro8survival!or!pro8death!signals!to!neighboring!cells!(Mesnil!and!Yamasaki,!2000).!However!many!techniques!have!been!used!to!demonstrate!that!growth!effects!are!independent!of!GJ!communication.!As!an!example!Cx37!slows!cell!cycle!progression!in!rat!insulinoma!cells!(Burt!et!al.,!2008),!and!this!effect!is!reproducible!with!Cx43!mutant!T154A!which!does!not!form!functional!channels!(Good!et!al.,!2011).!A!pair!of!Cx26!mutants!that!either!blocked!channel!function,!or!both!trafficking!to!the!plasma!membrane!and!channel!function!still!caused!reversion!of!tumor!phenotype!in!breast!cancer!cells!(Kalra!et!al.,!2006).!!!Glioma!cells!expressing!Cx43!mutant!C61S!were!protected!from!apoptosis!even!though!this!mutation!prevented!proper!trafficking!to!the!plasma!membrane!and!therefore!channel!formation!(Lin,!Yang!et!al.!2003).!Similarly,!the!Cx43!CT!alone!is!sufficient!to!suppress!growth!of!HeLa!cells!even!though!this!peptide!remains!cytoplasmic!and!can!not!form!GJs!(Dang!et!al.,!2003).!Cx43!regulates!growth!independently!of!GJ!formation!since!serine!point8mutants!block!growth!effects!of!Cx43!but!not!channel!formation!in!N2A!cells!(Moorby!and!Patel,!2001),!indicating!that!serine!residues!in!the!CT!region!of!Cx43!may!not!only!regulate!GJ!turnover,!but!also!participate!in!signaling!pathways!leading!to!regulation!of!cell!growth.! ! 21! !Interestingly,!Cx43!overexpressing!glioma!cells!also!exhibited!cytoskeletal!effects,!namely!flattening!of!cells!and!stress8fiber!formation,!and!these!reorganizations!of!the!cytoskeleton!were!actually!required!for!Cx43’s!protective!effect!against!apoptosis!(Lin,!Yang!et!al.!2003).!Cytoskeletal!changes!are!often!noted!with!up8!or!down8regulation!of!Cx43!which!leads!us!to!the!next!effect!of!Cxs!that!is!often!channel8independent:!cellular!motility!and!migration.!This!discussion!will!focus!exlusively!on!Cx43!which!has!been!the!subject!of!the!most!Cx!research!and!is!praticularly!well8studied!for!its!role!in!cell!motility!and!migration.!!!! ! ! 1.4!!!!!Connexin!43!!! 1.4.1!!Regulation!of!Cx43!through!phosphorylation! ! ! !Cx43!is!the!most!widely!expressed!Cx!protein,!having!been!detected!in!over!40!different!cell!types!and!tissues!(Oyamada!et!al.,!2005).!Cx43!was!first!isolated!from!myocardial!GJs!in!1980!(Kensler!and!Goodenough,!1980)!and!sequenced!in!1987!(Nicholson!et!al.,!1987).!Cx43!has!one!of!the!longest!CT!tails!of!the!Cx!proteins!(155!amino!acids!long),!containing!multiple!sites!for!protein!interactions!and!regulation!by!phosphorylation.!! !Different!forms!of!Cx43!can!be!separated!based!on!mobility!by!gel8electrophoresis!commonly!resulting!in!two!phosphatase8sensitive!and!one!insensitive!band.!The!non8phosphorylated!form!of!Cx43!(P0)!runs!at!approximately!42!kDa,!P1!at!44!kDa!and!P2!which!is!the!form!most!commonly!associated!with!GJ!plaques!at!46!kDa!(Solan!and!Lampe,!2009a).!These!mobility! ! 22! shifts!are!likely!the!result!of!conformational!changes!to!the!Cx43!protein!caused!by!phosphorylation!of!structurally!important!aa!side!chains!or!due!to!altered!protein8interactions!affecting!Cx43!conformation,!since!the!addition!of!a!single!inorganic!phosphate!group!is!not!sufficient!to!account!for!a!2!kDa!shift!in!molecular!weight!(Solan!and!Lampe,!2009a).!!!The!CT!domain!of!Cx43!is!the!target!of!phosphorylation!and!contains!multiple!serine,!threonine,!and!tyrosine!residues.!Cx43!phosphorylation!has!been!shown!to!regulate!protein!trafficking,!assembly!and!disassembly!of!GJ!plaques,!internalization,!and!channel!gating.!Some!examples!of!kinases!that!have!been!shown!to!phosphorylate!Cx43!include!serine!kinases!such!as!protein!kinase!A!(PKA)!which!affects!Cx43!trafficking,!protein!kinase!C!(PKC)!which!influences!GJ!channel!conductance!and!cell8cycle!progression,!casein!kinase!1!(CK1)!which!is!involved!in!assembly!of!Cxs!into!GJ!plaques,!and!mitogen8activated!protein!kinase!(MAPK)!which!causes!GJ!internalization.!The!tyrosine!kinases!v8Src!and!c8Src!can!also!decrease!GJ!conductance!by!phosphorylation!of!serine!residues!(Lampe!and!Lau,!2004).!!!In!addition!to!phosphorylation!sites,!the!Cx43!CT!domain!contains!binding!sites!for!protein8protein!interactions.!A!proline!rich!domain!located!between!amino!acids!(aa)!2748283!may!bind!SH38domain!containing!proteins!such!as!Src!kinases.!This!motif!has!been!hypothesized!to!bind!v8Src,!bringing!it!into!sufficient!proximity!with!Cx43!to!facilitate!the!phosphorylation!of!Y265!and!Y247!(Lin!et!al.,!2001a).!The!CT!also!has!a!microtubule8binding!domain!(aa!2348243)!that!is!necessary!for!trafficking!of!Cx43!to!the!plasma!membrane!(Shaw!et!al.,!2007)!and!cell!polarity!(Francis!et!al.,!2011a).!Cx43!also!contains!a!PDZ8binding!domain!near!its! ! 23! carboxyl8terminus!(aa!3798382)!which!can!bind!the!scaffolding!protein!zona!occludens81!(ZO81)!which!anchors!Cx43!to!the!cytoskeleton!and!stabilizes!GJ!plaques!(Palatinus!et!al.,!2011).!!! 1.4.2!!The!role!of!Cx43!in!cell!migration! ! !!Cx438/8!mice!die!a!few!hours!after!birth!from!cardiac!failure!resulting!from!outflow!tract!obstructions!and!malformations!of!the!right!ventricle!(Reaume!et!al.,!1995).!!These!malformations!arise!unexpectedly,!not!because!of!a!defect!in!cardiac!communication,!but!because!of!reduced!cardiac!neural!crest!cell!migration!from!the!somites!to!the!outflow!tract!during!embryogenesis!(for!review!see!(Lo!et!al.,!1999)).!Experiments!on!neural!crest!cells!in# vitro!have!shown!that!Cx438/8!cells!are!less!effective!at!directional!migration!due!to!an!inability!to!polarize!and!form!a!leading!edge!due!to!altered!cytoskeletal!organization!(Xu!et!al.,!2006).!Cx43!has!since!been!shown!to!influence!polarization!and!motility!of!mouse!embryonic!fibroblasts!(MEFs)!isolated!from!Cx438/8!mice!as!well!(Francis!et!al.,!2011a)!and!this!effect!is!channel8independent!since!the!defect!can!be!mimicked!by!forced!expression!of!a!dominant!negative!(DN)!Cx43!mutant!with!a!truncated!CT!tail!in!Cx43+/+!MEFs,!but!not!with!Cx43!mutant!Y17S!which!does!not!form!functional!channels!(Francis!et!al.,!2011a).!Increasingly,!evidence!shows!a!non8channel!role!of!Cx43!in!motility!of!many!cell!types.!!!While!knockout!mice!make!invaluable!tools!for!looking!at!the!role!of!individual!genes,!high!throughput!screens!can!identify!many!possible!genes!responsible!for!regulating!a!common!phenotype.!Cx43!was!identified!in!an!unbiased!small!interfering!RNA!(siRNA)!knockdown! ! 24! screen!for!genes!involved!in!migration!using!an!in#vitro!epithelial!wound8healing!assay!(Simpson!et!al.,!2008).!Cx43!expression!was!shown!to!enhance!migration!of!Cx438null!HeLa!cells!independently!of!channel!function!since!the!CT!alone!which!doesn’t!get!expressed!at!the!plasma!membrane!or!make!channels!was!sufficient!to!enhance!migration,!yet!the!NT!capable!of!forming!channels!was!not!sufficient!(Behrens!et!al.,!2010).!!!!!!The!role!of!Cx43!on!cell!migration!has!been!well!characterized!in!neural!cell!types.!Neuronal!migration!along!radial!glia!in!the!developing!mouse!neocortex!is!enhanced!by!Cx43!and!is!not!blocked!by!mutant!Cx43T154A!which!does!not!make!channels!(Elias!et!al.,!2007).!In!addition!to!its!role!during!normal!development,!Cx43!can!enhance!tumor!cell!migration.!Gliomas!are!highly!invasive!astrocyte!tumors,!whose!invasiveness!is!enhanced!by!Cx43!expression!(Lin!et!al.,!2002;!Zhang!et!al.,!2003).!Channel!blocking!drug!carbenoxolone!(CBX)!did!not!block!glioma!migration!in#vitro!indicating!that!this!is!a!channel8independent!phenomenon!(Bates!et!al.,!2007).!Since!Cxs!have!largely!been!considered!tumor!suppressors,!recognition!of!their!potential!to!increase!tumor!invasiveness!is!an!important!consideration!for!understanding!the!cell!biology!of!tumor!cells!and!for!the!development!of!possible!anti8cancer!therapeutics.!!!!!GJs!also!form!between!lymphocytes!and!endothelial!cells!during!transmigration,!suggesting!a!role!for!Cxs!in!lymphocyte!migration!(Oviedo8Orta!et!al.,!2002).!Transmigration!occurs!when!lymphocytes!cross!the!endothelium!lining!post8capillary!venules!and!exit!into!the!interstitial!tissue!in!response!to!inflammatory!cues.!Signaling!cross8talk!between!endothelial!cells!and!lymphocytes!during!this!process!facilitate!adhesion!and!shape!changes!to!the!lymphocyte!(accomplished!by!reorganization!of!the!actin!cytoskeleton)!in!order!for!these!cells!to!squeeze! ! 25! through!gaps!between!endothelial!cells.!In!experiments!by!Oveido8Orta!et!al.!dye!transfer!could!be!blocked!using!mimetic!peptides!against!Cx!but!transmigration!occurred!normally,!suggesting!that!migration!is!independent!of!GJ!channel!function!(Oviedo8Orta!et!al.,!2002).!! 1.5!!!!!The!role!of!Cx43!in!BLlymphocytes! ! 1.5.1!!Cx43!in!BCRLmediated!spreading!! ! ! !BCR!signaling!in!the!immature!B!cell!line!Wehi231!stimulated!with!anti8IgM!resulted!in!a!time8dependent!shift!in!Cx43!molecular!weight!by!gel!electrophoresis.!The!resulting!Cx43!band8shift!was!phosphatase8sensitive,!and!therefore!probably!due!to!phosphorylation!(Bruzzone!et!al.,!2003;!Machtaler!et!al.,!2011).!Cx43!has!a!long!cytoplasmic!CT!tail!with!potential!phosphorylation!sites.!Phosphorylation!of!tyrosine!and!serine!residues!of!the!Cx43!CT!have!been!implicated!in!regulation!of!Cx43!turnover,!channel!conductance,!and!cell!growth,!leading!us!to!investigate!this!protein!in!B8cells!further.!!!Cx43!is!involved!in!BCR8mediated!spreading!as!shown!by!both!loss8of8function!(LOF)!and!gain8of8function!(GOF)!approaches.!!Knockdown!of!Cx43!by!siRNA!in!the!Wehi231!cell!line!resulted!in!reduced!spreading!on!anti8IgM!coated!glass,!whereas!expression!of!EGFP!tagged!Cx43!in!a!Cx438null!plasmacytoma!cell!line!that!had!previously!been!transfected!with!the!BCR!(J558µm3)!caused!these!cells!to!spread.!J558µm3!cells!usually!fail!to!spread!on!ant8IgM!coated!glass,!merely!extending!and!retracting!small!membrane!protuberances!on!their!upper!surface!(Bruzzone!et!al.,!2003;!Machtaler!et!al.,!2011).!! ! 26! !BCR8mediated!spreading!of!the!mature!B8cell!line!A20!requires!the!activation!of!the!Rap1!GTPase!(Lin!et!al.,!2008a),!therefore!B8cells!expressing!different!levels!of!Cx43!were!assessed!for!Rap1!activity.!While!Rap18GTP!was!detected!initially!after!BCR!stimulation,!lower!levels!of!active!Rap1!were!detected!in!Wehi231!cells!expressing!siRNA!against!Cx43.!Additionally,!sustained!activation!of!Rap1!was!detected!in!J558µm3!cells!expressing!EGFP!fused!Cx43!but!only!transient!Rap1!activation!was!induced!by!BCR!stimulation!of!J558µm3!cells!expressing!EGFP!alone!(Bruzzone!et!al.,!2003;!Machtaler!et!al.,!2011).!!!A!Cx43!mutant!with!the!CT!domain!truncated!immediately!after!the!microtubule8binding!site!(Δ246)!has!been!used!previously!to!examine!the!role!of!the!Cx43!tail!and!has!been!shown!to!have!normal!trafficking!to!the!plasma!membrane!(Bates!et!al.,!2007).!Expression!of!this!mutant!in!J558µm3!cells!was!not!sufficient!to!cause!rapid,!radial!BCR8mediated!spreading!or!Rap1!activation,!demonstrating!the!importance!of!the!Cx43!CT!domain!in!BCR8mediated!spreading!response!(Bruzzone!et!al.,!2003;!Machtaler!et!al.,!2011).!While!these!experiments!demonstrate!the!importance!of!the!CT!domain,!the!mechanism!underlying!these!effects!remains!unknown.!The!requirement!of!Cx43!for!sustained!Rap1!activation!suggests!a!role!for!the!CT!domain!in!propagating!BCR!signaling,!but!other!possibilities!include!a!scaffolding!role!where!Cx43!stabilizes!the!actin!cytoskeleton!through!protein8interactions!with!its!CT!domain,!or!channel!gating!by!the!CT!tail.!!!!!!!!! ! 27! !! 1.5.2!!Cx43!in!BLcell!adhesion!and!migration! ! ! !Since!Cx43!expression!was!found!to!improve!activation!of!the!Rap1!GTPase,!the!influence!of!Cx43!was!investigated!in!other!processes!that!are!controlled!by!Rap1.!Rap1!also!regulates!B8cell!adhesion!to!endothelial!cell!layers!and!transmigration!(McLeod!et!al.,!2002a;!McLeod!et!al.,!2004).!The!effects!of!Rap1!on!adhesion!and!migration!are!also!relevant!in!the!case!of!lymphoma!invasion!as!shown!by!competitive!homing!experiments!in!mice!(Lin!et!al.,!2009).!!Cx43!expression!caused!more!sustained!Rap1!activation!in!response!to!integrin!engagement!by!anti8lymphocyte!associated!antigen!1!(LFA81)!as!well!as!stimulation!with!chemokine!CXCL12/SDF81.!!Cx43!knockdown!impaired!Wehi231!adhesion!to!an!endothelial!monolayer!as!well!as!motility!and!transmigration!of!Wehi231!cells!towards!a!chemokine!gradient!(Bruzzone!et!al.,!2003;!Machtaler!et!al.,!2011).!These!results!are!consistent!with!the!role!of!Cx43!in!enhanced!migration!of!other!cell!types.!!! ! 1.6!!!!!Purpose!of!thesis!study! !B8cell!adhesion,!spreading,!and!migration!are!influenced!by!expression!of!the!protein!Cx43!by!a!mechanism!involving!the!CT!domain,!yet!the!exact!mechanism!by!which!the!CT!is!involved!remains!unclear.!Mutational!studies!of!Cx43!in!neural!migration!have!returned!conflicting!results!regarding!the!mechanism!of!Cx43’s!influence.!The!CT!domain!of!Cx43!has!been!implicated!in!glioma!and!neuronal!migration!since!CT8truncation!of!Cx43!destroys!its! ! 28! migration8enhancing!effects!(Bates!et!al.,!2007;!Cina!et!al.,!2009).!Yet!glioma!migration!was!unaffected!by!treatment!with!channel8blocking!drug!carbenoxolone!(CBX)(Bates!et!al.,!2007),!so!it!is!unlikely!that!migration!is!affected!by!the!ability!of!the!CT!to!regulate!GJ!channel!conductance.!The!CT!domain!presumably!influences!glioma!migration!by!acting!as!a!scaffold!for!protein8protein!interactions!involved!in!either!signaling!cascades!or!by!anchoring!cytoskeletal!components!to!the!plasma!membrane.!!!An!alternative!hypothesis!that!comes!from!experiments!in#vivo!is!that!the!extracellular!domains!of!Cx43!may!provide!dynamic!adhesive!contacts!by!GJ!formation!between!the!migrating!cell!and!the!cellular!substratum.!Experiments!using!antibodies!against!the!extracellular!domains!of!Cx43!to!block!GJ!adhesion!showed!that!blocking!GJ!formation!prevented!neuronal!migration,!as!did!expression!of!mutant!C61S!which!are!unable!to!form!the!disulfide!bonds!required!for!GJ!docking!(Elias!et!al.,!2007).!Expression!of!channel8mutant!Cx43T154A!had!no!affect!on!neuronal!migration,!so!both!studies!agree!that!Cx43’s!affect!on!neural!migration!is!channel8independent.!!!While!Cx43’s!effect!on!neural!migration!appears!to!be!channel8independent,!it!is!important!to!rule8out!the!possibility!that!Cx43!influences!adhesion,!spreading,!and!migration!through!channel!formation!in!B8cells!since!channel!formation!is!the!canonical!function!of!GJ!proteins.!The!function!of!Cx43!in!forming!HCs!has!been!unexplored!in!B8lymphocytes.!Increasing!evidence!for!HC!function!in!communication!in!the!immune!system!(Junger,!2011)!makes!addressing!the!possible!involvement!of!Cx!HCs!in!B8cell!processes!an!important!area!of!study.!! ! 29! !Given!the!role!of!Cx43!in!B8cell!adhesion,!spreading!and!migration,!the!goals!of!this!project!have!been!to!investigate!the!contribution!of!different!domains!of!Cx43!to!B8cell!cytoskeletal!rearrangements.!This!project!investigated!the!contributions!of!different!domains!of!Cx43!in!more!detail.!Specifically,!we!investigated!the!role!of!cysteine!residues!in!the!extracellular!loops,!a!threonine!residue!lining!the!channel,!and!a!potential!tyrosine!phosphorylation!site!in!the!tail!of!Cx43.!!This!was!done!by!using!a!gain8of8function!approach!by!expressing!a!panel!of!Cx43!mutants!in!a!tissue!culture!B8cell!line!that!does!not!express!endogenous!Cx43:!the!plasmacytoma!cell!line!J558µm3.!!The!different!transfected!cells!were!tested!using!a!BCR8mediated!B8cell!spreading!assay!as!a!readout!for!B8cell!processes!that!are!dependent!on!cytoskeletal!rearrangements.!These!studies!will!help!to!define!the!important!regions!of!Cx43!that!affect!B8cell!spreading,!as!well!as!identify!which!region!we!should!focus!on!for!future!studies.!These!results!will!be!useful!in!understanding!the!potential!role!of!the!motifs!of!Cx43!in!normal!B8cell!functions!important!for!the!immune!response.!! Overarching!aim:! !To!identify!the!functional!domains!of!Cx43!(extracellular,!channel8lining,!or!cytoplasmic)!that!contribute!to!its!importance!in!BCR8mediated!B8cell!spreading!through!mutational!studies!of!the!Cx43!protein!by!targeting!specific!amino!acids!for!mutation.!!!!!!! ! 30! Hypotheses:! !1)!The!effect!of!Cx43!on!BCR8mediated!B8cell!spreading!is!independent!of!adhesion!!!!!!!mediated!through!the!formation!of!GJs!between!cells.!!2)!The!effect!of!Cx43!on!BCR8mediated!B8cell!spreading!is!independent!of!channel!!!!!!!activity.!!!3)!The!effect!of!Cx43!on!BCR8mediated!B8cell!spreading!depends!on!protein8protein!!!!!!!!interactions!between!Cx43!and!effectors!involved!in!BCR8signaling!! ! 1.7!!!!!Summary!of!findings!!1)!The!extracellular!domains!of!Cx43!were!targeted!by!mutation!of!the!cysteine!residues!involved!in!GJ!docking!and!we!discovered!that!substitution!of!these!residues!drastically!altered!the!ability!of!the!protein!to!traffic!to!the!cell!surface.!After!initial!characterization!of!the!mutated!Cx43!proteins!expressed!in!J558µm3,!they!were!not!pursued.!The!data!obtained!appears!in!the!Appendix.!!2)!The!TM!region!was!examined!by!using!the!Cx43T154A!mutant,!which!blocks!Cx43!channel!function!(Beahm!et!al.,!2006).!To!assess!this!a!dye8uptake!assay!of!HC!activity!adapted!for!B8cells!showed!that!Cx43!expressing!B8cell!lines!A20!and!Wehi231!fail!to!form!functional!HCs!upon!stimulation!by!the!common!HC!activator:!removal!of!divalent!cations.!Consistent!with!other!overexpression!studies,!a!Cx438null!plasmacytoma!B8cell!line!(J558µm3)!transduced! ! 31! with!EGFP!fused!Cx43!showed!some!dye8uptake!even!in!the!presence!of!Ca2+/Mg2+!containing!medium.!This!uptake!was!not!seen!in!J558µm3!expressing!EGFP!alone,!and!was!selectively!blocked!by!CBX,!showing!that!dye8uptake!occurred!through!Cx43HCs.!While!Cx!overexpression!was!sufficient!to!lead!to!some!HC!activity!in!B8cells,!these!channels!probably!do!not!account!for!the!effect!of!Cx43!expression!on!BCR8mediated!B8cell!spreading!since!treatment!with!HC!blocking!drugs!carbenoxolone!(CBX),!probenecid!(Pbn),!and!lanthanum!(La)!had!no!effect!on!B8cell!spreading!of!A20,!Wehi231,!J558µm3+Cx438EGFP,!or!primary!splenic!B8cells!isolated!from!mice.!These!results!suggest!that!Cx43!influences!BCR8mediated!B!cell!spreading!by!non8channel!mechanisms,!perhaps!by!acting!as!a!scaffolding!for!protein!interactions!through!binding!sites!found!in!the!Cx43!cytoplasmic!CT!domain.!!!In!support!of!this!idea,!we!found!that!point!mutant!Cx43T154A!caused!a!non8radial!spreading!phenotype!in!J558µm3!cells!characterized!by!the!formation!of!actin!and!Cx438rich!projections!when!plated!on!anti8BCR!coated!glass!coverslips.!This!phenotype!was!ablated!by!truncation!of!the!CT!tail!(Δ246),!indicating!that!this!phenotype!was!not!exclusively!the!product!of!reduced!channel8conductance,!but!depended!upon!the!CT!domain,!which!is!consistent!with!our!lab’s!previous!finding!that!the!CT!domain!of!Cx43!is!necessary!for!BCR8mediated!B8cell!spreading.!!!We!have!previously!found!that!Cx43!expression!improves!the!sustained!activation!of!the!Rap1!GTPase!in!response!to!BCR!stimulation!using!a!biochemical!assay!of!Rap1!activation.!!In!this!study,!we!further!demonstrated!that!Cx43!expression!leads!to!BCR8mediated!J558µm3!cell!spreading!through!the!activation!of!Rap1!because!forced!expression!of!a!Rap18specific! ! 32! GAP!(RapGAPII)!which!converts!Rap1!into!its!inactive,!GDP8bound!state,!was!sufficient!to!prevent!spreading!by!J558µm3+Cx438EGFP!cells.!Conversely,!expression!of!a!constitutively!active!form!of!Rap1!(Rap1V12)!by!J558µm3!caused!cell!spreading.!!Unlike!expression!of!WT!Cx43,!the!expression!of!Cx43T154A!and!Cx43Δ246!do!not!result!in!sustained!Rap1!activation!following!BCR!stimulation,!suggesting!that!both!mutants!influence!Rap1!activation!through!a!similar!mechanism.!We!hypothesize!that!point!mutation!of!T154!may!result!in!a!conformational!defect!that!specifically!affects!the!Cx43!CT!domain,!in!addition!to!its!well8characterized!effect!on!GJ!channel!conductance.!!!3)!To!further!investigate!the!role!of!the!Cx43!CT!domain,!point!mutants!of!a!putative!Src8kinase!binding!site!were!made!by!site8directed8mutagenesis!Y265F!and!Y265D.!Tyrosine!265!has!been!hypothesized!to!be!both!phosphorylated!and!then!bound!by!Src8kinase!through!its!SH2!domain!for!subsequent!phosphorylation!of!tyrosine!247!(Lin!et!al.,!2001a).!Both!point!mutants!of!Y265!were!sufficient!to!block!BCR8mediated!B8cell!spreading!in!J558µm3!cells,!highlighting!the!importance!of!a!single!residue!for!Cx43’s!influence!on!cell!spreading.!!!BCR!stimulation!results!in!a!phosphatase8sensitive!shift!of!Cx43!mobility!by!gel!electrophoresis!(Bruzzone!et!al.,!2003;!Machtaler!et!al.,!2011).!J558µm3!cells!expressing!Cx43Y265F!and!Cx43Y265D!exhibit!a!comparable!shift!to!WT!Cx43!in!response!to!BCR8stimulation,!which!suggests!that!Cx43!is!phosphorylated!at!other!residues!besides!Y265,!in!spite!of!the!importance!of!this!residue!in!BCR8mediated!spreading.!In!fact,!BCR!stimulation!does!not!appear!to!result!in!tyrosine!phosphorylation!of!Cx43!as!shown!biochemically!by!immunoprecipitation!(IP)!of!either!endogenous!Cx43!from!Wehi231!or!overexpressed!Cx438 ! 33! EGFP!from!J558µm3!followed!by!detection!with!a!phospho8tyrosine!antibody!(pY).!The!Cx43!CT!domain!contains!a!far!greater!number!of!serine!residues!than!tyrosine!residues!and!these!may!be!targets!of!phosphorylation!as!well.!!!Our!lab’s!on8going!goals!are!to!determine!the!type!of!phosphorylation!responsible!for!Cx43!band8shift!in!response!to!BCR8stimulation!as!well!as!to!further!uncover!the!mechanism!explaining!the!importance!of!the!CT!domain!of!Cx43!to!BCR8mediated!B8cell!spreading.!Because!of!the!expansive!nature!that!a!phosphorylation!study!would!entail,!this!part!was!considered!by!us!and!by!the!supervisory!committee!as!being!beyond!the!scope!of!the!MSc!thesis!and!that!the!role!of!phosphorylation!of!the!CT!tail!will!be!carried!out!by!MSc!student!Farnaz!Pournia!who!is!using!a!series!of!Cx43!truncations!to!determine!the!functionally!important!regions!of!the!CT!domain.!!!!!!!!!!!!! ! 34! CHAPTER!2! MATERIALS!AND!METHODS! ! 2.1!!!!!Materials!and!reagents! ! 2.1.1!!Plasmids!!The!AP2!and!NAP2!expression!vectors!were!gifts!from!Dr.!Christian!Naus!(Dept.!Cellular!and!Physiological!Sciences,!UBC).!AP2!is!a!bicistronic!murine!retroviral!vector!containing!a!multiple!cloning!site!for!insertion,!under!a!CMV!promoter!and!EGFP!under!an!IRES!promoter!(Mao!et!al.,!2000).!The!IRES!and!EGFP!were!removed!from!NAP2!for!expression!of!EGFP8fusion!constructs!(Galipeau!et!al.,!1999).!NAP2!containing!cDNA!encoding!Wild8Type!(WT)!Cx43!with!EGFP!fused!to!the!C8terminal!(CT)!tail!in8frame!(Cx438EGFP)!as!well!as!mutated!Cx43!with!a!truncated!CT!tail!(Cx43Δ2468EGFP)!have!been!described!previously!(Bates!et!al.,!2007).!!Additional!plasmids!containing!mutated!Cx43!cDNA!were!created!by!performing!site8directed!mutagenesis!(Section!2.2.6)!on!the!above8mentioned!WT!or!truncated!Cx43!constructs!by!using!custom!designed!primer!pairs!(Table!2.1).!Two!tyrosine!(Y)!residues!found!in!the!Cx43!cytoplasmic!CT!tail!have!been!described!as!putative!Src8binding!sites!(Lin!et!al.,!2001a).!The!first!of!these,!Y265!was!substituted!with!either!phenylalanine!(Y265F)!or!aspartic!acid!(Y265D)!using!site8directed!mutagenesis!(see!Section!2.2.6)!performed!on!WT!Cx438EGFP!in!the!NAP2!expression!vector.!! ! 35! !The!channel8blocked!mutant!Cx43T154A!was!generated!using!previously!published!primers!(Beahm!et!al.,!2006).!Site8directed!mutagenesis!was!performed!on!both!WT!Cx438EGFP!and!Cx43Δ2468EGFP,!both!in!the!NAP2!expression!vector.!!!To!study!the!role!of!the!Cx43!extracellular!loops,!and!specifically!at!disulfide!bonding,!successive!cysteine!residues!were!substituted!with!alanine!using!WT!Cx438EGFP!in!the!NAP2!vector.!Initially!a!single!primer!pair!containing!three!substitutions!was!used!for!each!loop.!However,!due!to!the!spacing!between!residues,!the!most!5’!substitution!was!found!to!be!too!close!to!the!end!of!the!primer!and!was!not!incorporated!into!the!final!sequence.!An!additional!two!primer!pairs!were!designed!to!mutate!the!most!5’!cysteine!residue!of!each!loop,!resulting!in!one!mutant!lacking!all!six!cysteine!residues!(CL6)!and!three!intermediates!(CL2,!CL3,!CL5).!Mutants!were!named!for!the!number!of!cysteine!residues!substituted!with!alanine.!!!!! ! ! ! ! ! ! ! ! ! ! ! ! ! ! 36! Table!2.1!Primer!sets!custom!ordered!for!site!directed!mutagenesis.!Primers!were!ordered!through!integrated!DNA!technologies!(Integrated!DNA!Technologies,!Coralville!Iowa).!!!! !!!! Resulting! mutation! Primer! names! Primer!sequence!(5’L3’)! Description! WT#Cx43# Cx43#f# ATGGGTGACTGGAGTGCCTTGGGG# Binds#coding#strand#of#Cx43# for#sequencing#Cx43#r# AATCTCCAGGTCATCAGGCCGAGG# Y265F! Y265F!f! GCGGATCTCCAAAATTCGCCTACTTC! Binds!Cx43!template,!exchanges!tyrosine!265!for!phenylalanine!Y265F!r! GCAGCCATTGAAGTAGGCGAATTTTG! Y265D! Y265D!f! GCGGATCTCCAAAAGACGCCTACTTC! Binds!Cx43!template,!exchanges!tyrosine!265!for!aspartic!acid!Y265D!r! GCAGCCATTGAAGTAGGCGTCTTTTG! T154A! T154A!f! GGCGGCTTGCTGAGAGCCTACATCAT! Binds!Cx43!template,!exchanges!threonine!154!for!alanine!T154A!r! GGATGCTGATGATGTAGGCTCTCAGC! T154AΔ246! T154A!f! GGCGGCTTGCTGAGAGCCTACATCAT! Binds!Cx43ΔCT!template,!exchanges!threonine!154!for!alanine!T154A!r! GGATGCTGATGATGTAGGCTCTCAGC! CL2! C54,61,65A!f! CGCGCTAACACTCAACAACCTGGCGC! Binds!to!Cx43!template,!exchanges!cysteines!61!and!65!for!alanine!(C54!was!too!close!to!5’!end)!C54,61,65A!r! GTCATAGGCGACGTTTTCGGCGCCA! CL3! C54A!f! GGTGATGAACAGTCTGCCTTTCGCGC! Binds!to!Cx43CL2!template,!exchanges!cysteine!54!for!alanine!C54A!r! GCCAGGTTGTTGAGTGTTAGCGCGAA! CL5! C187,192,!198A!f! CCGCCAAGAGAGATCCCGCGCCGCA! Binds!to!Cx43CL3!template,!exchanges!cysteines!192!and!198!for!alanine!(C187!was!too!close!to!5’!end)!C187,192,!198A!r! GGAAGGCGTCTACCTGGTGCGGCGC! CL6! C187A!f! GCGCGGTCTACACCGCCAAGAGAGA! Binds!to!Cx43CL5!template,!exchanges!cysteine!187!for!alanine!C187A!r! CGCGGGATCTCTCTTGGCGGTGTAG! ! 37! 2.1.2!!Antibodies!!The!polyclonal!goat!α8mouse!IgM!used!for!cell!stimulation!(Section!2.3.3),!immunoblotting!(Section!2.4.2),!staining!(Section!2.7.1),!and!for!coating!glass!coverslips!for!cell!spreading!assays!(Section!2.6.1),!was!purchased!from!Jackson!Immuno!Research!Laboratories!(West!Grove,!Pennsylvania,!#11580058020)!and!was!specific!to!the!µ!heavy!chain.!For!staining!surface!membrane!IgM!(mIgM)!and!analysis!by!flow8cytometry!(Section!2.5.1),!monoclonal!phycoerythrin!(PE)8conjugated!rat!α8mouse!IgM!was!purchased!from!eBiosciences!(San!Diego,!California,!#1285790881).!!For!immunoblotting,!the!polyclonal!rabbit!α8mouse!antibody!against!the!CT!tail!of!Cx43!was!purchased!from!Sigma8Aldrich!(Oakville,!Ontario,!#C6219).!!The!polyclonal!mouse!α8mouse!antibody!against!the!N8terminal!region!of!Cx43!was!purchased!from!the!Fred!Hutchinson!Cancer!Research!Institute!(Seattle,!Washington).!The!monoclonal!rabbit!α8mouse!antibody!specific!for!Cx43!phosphorylated!at!Y265!was!obtained!from!Dr.!Paul!D.!Lampe!(Fred!Hutchinson!Cancer!Research!Institute)!(Solan!and!Lampe,!2008).!Polyclonal!rabbit!α8mouse!Akt!and!rabbit!α8mouse!Rap1!were!purchased!from!Cell!Signaling!Technologies!(Santa!Cruz,!California,!#9272!and!#23995!respectively).!The!polyclonal!mouse!α8mouse!antibody!against!actin!was!purchased!from!Fisher!Scientific!(Fair!Lawn,!New!Jersey,!#ICN691001).!!The!monoclonal!mouse!antibody!capable!of!binding!all!species!of!phospho8tyrosine!(pY)!was!prepared!in8house!as!has!been!described!previously!(Richards!et!al.,!1996).!The!4G10!hybridoma!cells!(Morrison!et!al.,!1989)!were!grown!to!confluency,!the!cells!left!to!die!to! ! 38! promote!concentrated!antibody!in!the!growth!medium,!and!the!supernatants!containing!monoclonal!antibodies!were!filter!sterilized,!aliquoted!and!stored!at!820°C.!!!Secondary!antibodies!were!conjugated!to!horseradish!peroxidase!(HRP)!enzyme!for!detection!with!chemiluminescence.!Polyclonal!goat!α8mouse!and!goat!α8rabbit!IgG!(κ!chain!specific)!was!purchased!from!Bio8Rad!(Mississauga,!Ontario,!#17086516!and!#17086515!respectively).!Polyclonal!donkey!α8goat!IgG!(κ!chain!specific)!was!purchased!from!Santa!Cruz!Biotechnology!Inc.!(Santa!Cruz,!California,!#SC2020)(Table!2.3).!!! 2.1.3!!Cell!lines!!The!J558µm3!B!cell!line!which!expresses!a!full!4!chain!(IgM,!Igα!and!Igβ)!B!cell!antigen!receptor!(BCR)!at!the!plasma!membrane!was!a!gift!from!Dr.!Louis!Justement!(University!of!Alabama,!Birmingham,!(Justement!et!al.,!1990))!and!BOSC!23!retroviral!packaging!cell!line!was!a!gift!from!Dr.!Warren!S!Pear!(Massachusetts!Institute!of!Technology,!Cambridge!(Pear!et!al.,!1993)).!Wehi231!and!A20!B!cells!were!obtained!from!the!American!Type!Culture!Collection!(ATCC)(Rockville,!Maryland).!Primary!murine!B!cells!were!isolated!from!Black86!mice!spleens!by!negative!selection!using!the!EasySep®!Mouse!B!Cell!Enrichment!Kit!from!Stem!Cell!Technologies!(Vancouver,!British!Columbia,!#19754).!!!!!! ! 39! 2.1.4!!Mice! !C57BL/6!mice!were!obtained!by!UBC!Animal!license!and!breeding!program!#A1080384!and!spleens!were!removed!and!B8cells!prepared!as!described!and!approved!as!according!to!the!Matsuuchi!Lab!animal!license!#A1180317.!Astrocyte!cultures!from!both!wild8type!mice!were!obtained!from!081!day!old!pups.!Neocortices!were!dissected!in!PBS!and!placed!in!culture!medium!consisting!of!high!glucose!DMEM!with!10%!FBS.!Tissue!was!triturated!through!a!serological!pipette!and!passed!through!a!70!μm!cell!strainer!(BD!Falcon,!Bedford,!MA).!Cells!were!re8suspended!in!culture!medium!and!plated!on!either!plastic!culture!dishes!or!laminin!coated!coverslips!and!stored!in!a!humidified!incubator!in!95%!air/5%!CO2!at!37°C.!!Medium!changes!were!performed!every!4!days!and!astrocytes!were!used!between!14821!days!in!vitro!or!when!30%!confluent!for!the!hemichannel!experiments!described!below!(~5!days).!! 2.2!!!!!Molecular!biology!techniques!! 2.2.1!!Bacterial!transformation!!#!Transformation!was!carried!out!as!per!manufacturer’s!instructions.!Sub8cloning!competent!and!ultra8competent!strains!of!E.coli,!DH5α!and!XL108GOLD!were!purchased!from!Invitrogen!(Burlington,!Ontario,!#18265017)!and!Stratagene!(Agilent!Technologies,!Mississauga,!Ontario,!#200314)!respectively.!Briefly,!DNA!was!added!to!bacteria!which!were!incubated!on!ice!for!30!min,!heat!shocked!at!42°C!for!30!sec,!incubated!an!additional!hour!in!1!ml!pre8warmed!lysogeny!broth!(LB,!also!referred!to!as!“Luria!broth”!or!“Luria8Bertani”!medium! ! 40! (Bertani,!2004))!medium!(10!g/L!bacto8tryptone!(BD!Biosciences,!Mississauga,!Ontario,!#211705),!5!g/L!bacto8yeast!extract!(BD!Biosciences,!#212750),!10!g/L!NaCl!(Fisher,!#BP3588212),!pH!7)!while!shaking!at!250!rpm!and!then!plated!on!LB!agar!plates!(LB!media!containing!20!g/L!bacto8agar!(BD!Biosciences,!#214010),!autoclaved!and!poured!into!petri!dishes)!containing!100!µg/ml!ampicillin!(Amp)(Sigma,!#A9518)!for!selection.!Colonies!were!isolated!from!plates!18836!hours!after!incubation!at!37°C.!!!!!!! ! 2.2.2!!DNA!preparation!!#!A!single!bacterial!colony!was!used!to!inoculate!88200!ml!of!LB!broth!containing!100!µg/ml!Amp!for!selection,!and!was!incubated!overnight!in!14!mL!round!bottom!polypropylene!tubes!(BD!Falcon,!Franklin!Lakes,!New!Jersey,!#352059)!at!37°C!shaking!at!250!rpm!on!a!Lab!Line!Orbit!Environ8Shaker!(Melrose!Park,!Illinois).!DNA!was!purified!from!overnight!bacteria!cultures!using!the!Sigma8Aldrich!GeneElute!Miniprep!kit!(#NA0160)!or!Invitrogen!PureLink!HiPure!Maxiprep!kit!(#K210017)!according!to!the!manufacturer’s!instructions.!Briefly,!bacteria!were!pelleted!from!overnight!cultures!by!centrifugation!at!3000!rpm!for!20!min!in!an!IEC!Centra88R!centrifuge!(International!Equipment,!Nashville,!Tennessee),!bacteria!were!lysed,!and!DNA!was!isolated!by!either!passage!through!a!column!or!precipitation!and!collection!by!centrifugation.!Isolated!DNA!was!re8suspended!in!distilled!water!and!DNA!concentration!and!purity!was!assessed!by!a!Nanodrop!1000!spectrometer!(Thermo!Scientific,!Nepean,!Ontario).!!!! ! 41! 2.2.3!!Restriction!endonuclease!digestion!!#!Restriction!enzymes!were!purchased!from!New!England!BioLabs!(Whitby,!Ontario)!and!added!to!DNA!according!to!manufacturers!instructions!for!1!h!at!37°C.!The!resulting!digested!DNA!was!run!by!agarose!gel!electrophoresis!for!identification!(see!Section!2.2.5).!!!! 2.2.4!!Polymerase!chain!reaction!!!#!Polymerase!chain!reaction!(PCR)!was!performed!using!PuReTaq!Ready8To8Go!PCR!beads!(GE!Healthcare,!Piscataway,!New!Jersey,!#2789558801)!according!to!the!manufacturer’s!instructions.!To!each!bead,!25!pmol!of!each!primer!and!5!µg!template!DNA!was!added!and!reactions!were!run!at!95°C!for!45!sec,!55°C!for!2!min!and!72°C!for!2!min,!for!35!cycles!on!a!PTC8100!programmable!thermal!controller!from!MJ!Research!Inc.!(Watertown,!Massachusetts).!The!resulting!amplified!DNA!was!run!by!agarose!gel!electrophoresis!for!identification!(see!Section!2.2.5).!!! 2.2.5!!Agarose!gel!electrophoresis!!#!Agarose!(Invitrogen,!#155108027)!was!dissolved!to!1%!in!Tris8buffered!ethylene!diamine!tetraacetic!acid!(EDTA:!90!mM!Tris8HCl!(Fisher,!#BP15285)!pH!8.2,!90!mM!boric!acid!(Fisher,!#A738500)),!boiled!and!poured!into!a!Horizon!58!horizontal!gel!electrophoresis!apparatus!(Gibco!Life!Technologies,!Invitrogen)!with!0.1%!SYBERsafe!(Molecular!Probes,!Invitrogen,!#533102)!for!labeling!DNA.!Whole!undigested!plasmid,!restriction!endonuclease!digested! ! 42! (see!Section!2.1.3),!or!PCR8amplified!(see!Section!2.1.4)!DNA!samples!were!mixed!with!an!appropriate!volume!of!DNA!sample!buffer!(0.04%!bromophenol!blue!(Bio8Rad,!#16180404),!0.04%!xylene!cyanol,!10%!sucrose!(Fisher,!#BP2208212))!for!loading,!and!the!1!kb!Plus!DNA!ladder!(Invitrogen,!#107878018)!was!used!as!a!size!standard.!DNA!was!run!at!100!V!for!approximately!1!h!and!imaged!with!an!Alpha!Imager!EC!MultiImage!Light!Cabinet!(Alpha!Innotech,!San!Leandro,!California)!using!Alpha!Imager!software!(Alpha!Innotech).!!! 2.2.6!!SiteLdirected!mutagenesis#!Site8directed!mutagenesis!was!performed!using!the!QuickChange!Lightning!Site8Directed!Mutagenesis!kit!(Stratagene,!#210518)!according!to!the!manufacturer’s!instructions.!PCR!was!run!at!95°C!for!20!sec,!60°C!for!20!sec,!and!68°C!for!3!min!and!45!sec!for!17!cycles!using!primers!(Table!2.1)!custom!ordered!through!integrated!DNA!technologies!(Integrated!DNA!Technologies,!Coralville,!Iowa).!Resulting!DNA!was!either!run!by!agarose!gel!electrophoresis!(see!Section!2.1.5)!to!confirm!amplification!by!PCR!or!purified!from!transformed!XL8GOLD!super8competent!cells!(see!Sections!2.2.1!and!2.2.2).!The!UBC!DNA!sequencing!laboratory,!(NAPS,!Vancouver,!British!Columbia;!www.msl.ubc.ca/services/naps)!was!used!to!sequence!plasmid!DNA!in!order!to!check!for!the!presence!of!the!desired!mutations!by!using!primers!flanking!the!coding!sequence!of!wild8type!(WT)!Cx43!(Table!2.1).!! ! ! ! ! ! 43! 2.3!!!!!Tissue!culture!! 2.3.1!!Cell!culture!!Suspension!cells!were!maintained!in!10!cm!polystyrene!tissue!culture!dishes!(BD!Falcon,!#353003)!in!10!ml!of!Roswell!Park!Memorial!Institute!(RPMI)!medium!(Gibco,!Invitrogen,!218708076)!supplemented!with!10%!Fetal!bovine!serum!(FBS)(Bio8Rad,!#16180404),!4.5!g/L!glucose!(Fisher,!#D168500),!2!mM!L8glutamine!(Sigma,!#C8540),!1!mM!sodium!pyruvate!(Sigma,!#P5280),!50 µg/ml!penicillin8streptomycin!(Invitrogen,!#15140122),!and!50!µM!β8mercaptoethanol!(Bio8Rad,!#1781317801).!Cells!were!passaged!every!283!days!as!required!to!be!kept!at!1810x105!cells/ml!in!an!direct!heat!incubator!(ThermoForma,!Champaign,!Illinois)!in!an!environment!of!37°C!with!5%!CO2.!Suspension!cells!were!passaged!by!centrifugation!at!1,500!rpm!for!5!min!in!an!IEC!Centra8CL3R!refrigerated!centrifuge!(Thermo!Electron!Corporation,!Gormley,!Ontario)!and!re8suspension!in!fresh!media.!Adherent!cells!were!incubated!1!min!in!trypsin!(Gibco,!Invitrogen,!25200072)!to!first!detach!cells!from!tissue!culture!dish.!Adherent!cells!(BOSC!23)!were!cultured!in!Dulbecco’s!Modified!Eagle!Medium!(DMEM)(Gibco,!Invitrogen,!#11960)!supplemented!as!described!above!for!RPMI.!For!long8term!storage,!5x106!cells!were!frozen!in!liquid!nitrogen!in!1ml!of!FBS!containing!10%!dimethyl!sulfoxide!(DMSO,!MP!Biomedicals,!Solon,!Ohio,!#191418).!!!!! ! 44! 2.3.2!!DNA!transduction!and!enrichment!!!J558µm3!or!Wehi231!cells!were!transduced!with!mutated!or!WT!Cx438EGFP!plasmid!DNA!(Table!2.1)!using!the!retroviral!packaging!cell!line,!BOSC!23.!DNA!was!introduced!into!BOSC!23!cells!by!calcium!phosphate!precipitation!as!has!previously!been!described!(Krebs!et!al.,!1999).!Viral!supernatant!was!collected!at!24,!48,!and!72!hrs!post8transfection,!filtered!through!a!0.2!µm!syringe!filter!(VWR,!Edmonton,!Alberta,!#281458501)!and!used!to!infect!0.5x106!J558µm3!or!Wehi231!cells!(Table!2.2).!Transduced!B!cells!were!sorted!by!fluorescence8activated!cell!sorting!(FACS)!by!selection!of!EGFP!positive!(+)!cells.!Cell!populations!were!periodically!re8sorted!to!maintain!high!levels!of!expression!(see!Section!2.5.1).!!!J558µm3!cells!were!transfected!with!mutant!Rap!constructs!using!Nucleofection!®.!Cells!were!re8suspended!in!the!appropriate!solutions!from!the!Amaxa!Nucleofection!Kit!T!(Amaxa!Biosystems,!Gaithersburg,!Maryland,!#VCA1002)!containing!2µg!DNA!according!to!the!manufacturer’s!instructions.!The!parameters!from!the!G816!program!in!the!Amaxa!Nucleofector!Device!(Amaxa!Biosystems)!were!used.!! ! ! ! ! !! ! 45! Table!2.2!Transduced!cell!lines!used!in!study.!!!!!! Cell!line! Expressing! Retroviral!vector! Promoter! Bacterial! resistance! Eukaryotic! resistance! J558µm3!! 8! AP2! CMV!! AmpR!! 8!!Cx438EGFP! NAP2!! Cx43CL28EGFP!Cx43CL38EGFP!Cx43CL58EGFP!Cx43CL68EGFP!Cx43T154A8EGFP!Cx43T154AΔ2468EGFP!Cx43Δ2468EGFP!Cx43Y265F8EGFP!Cx43Y265D8EGFP!Wehi231!! EGFP!Cx438EGFP!Cx43T154A8EGFP! ! ! 2.3.3!!Cell!stimulation!!!For!stimulation!of!cells!by!cross8linking!the!BCR,!cells!were!washed!once!and!suspended!in!0.5!ml!quinsaline!(25!mM!sodium!Hepes!pH!7.4!(Sigma,!#H3375),!125!mM!NaCl,!5!mM!KCl!(Fisher,!#P217),!1!mM!CaCl2!(Sigma,!#C1016),!1!mM!Na2HPO4!(Fisher,!#S374),!0.5!mM!MgSO4!(Fisher,!#M63),!1!g/L!glucose,!2!mM!L8glutamine!(Sigma,!#C8540),!1!mM!sodium!pyruvate,!50!µM!β8mercaptoethanol).!For!each!time8point!in!the!given!time8course,!5x106!cells!were!aliquoted!into!a!1.7!ml!microcentrifuge!tube!(Axygen!Inc,!Union!City,!California,!#MCT81758C)!and!were!stimulated!by!crosslinking!the!cell!surface!BCR!with!20!µg/ml!goat!α8mouse!IgM!and!incubating!the!cells!in!a!37°C!water8bath.!Reactions!were!stopped!by!addition!of!0.5!ml!of! ! 46! 1:100!sodium!pervanadate!(Sigma,!#1372183986)!and!cells!were!lysed!for!biochemical!detection!(Section!2.4)!of!changes!downstream!of!stimulation!through!the!BCR.!! 2.3.4!!Drug!treatment!to!block!hemichannel!function!!J558µm3,!Wehi231,!A20,!or!primary!murine!B!cells!were!incubated!15830!min!at!37°C!with!5%!CO2!in!RPMI!medium!containing:!100!µM!HC8blocking!drug!carbenoxolone!(CBX)(carbenoxolone!disodium!salt,!Sigma,!#C4790),!1!mM!Panx!HC8blocking!drug!probenecid!(Pbn)(Alfa!Aesar,!Ward!Hill,!Massachusetts,!#B20010),!or!200!µM!Cx!HC8blocking8ion!lanthanum!(La3+)(LaCl3,!Sigma,!#211605).!!Stimulated!cells!were!either!added!directly!to!anti8BCR!coated!coverslips!for!spreading!assay!(see!Section!2.5.1),!or!washed!once!in!1x!phosphate!buffered!saline!(PBS)(Gibco,!Invitrogen,!#100108023)!for!assay!of!HC!activity!(see!Section!2.6.3).!!! 2.4!!!!!Biochemical!procedures! ! 2.4.1!!Cell!lysis!and!preparation!of!samples!!For!western!blotting,!cell!lysis!was!performed!as!has!previously!been!described!(Machtaler!et!al.,!2011).!Briefly,!5X106!cells!were!lysed!in!2008300!µl!cold!lysis!buffer!(1x!PBS,!1%!Triton8X!100!(Fisher,!#BP15),!1%!IGEPAL!(Sigma,!#CA8630),!50!mM!CaCl2,!!(Troxell!et!al!1999)!containing!protease!inhibitors!(10!µg/ml!leupeptin!(Sigma,!#L2884),!1!µg/ml!aprotinin!(Roche,!Mississauga,!Ontario,!#981532),!1!mM!pepstatin!A!(Sigma,!#P4265),!1!mM!sodium! ! 47! vanadate,!1!mM!phenylmethylsulfonyl!fluoride!(PMSF)(Roche,!#837091)).!Samples!were!sonicated!10!sec!with!a!Misonix!XL!sonicator!ultrasonic!cell!processor!(Misonix!Incorporated,!Farmingdale,!New!York)!and!incubated!on!ice!for!10!min.!To!remove!cellular!debris,!cell!lysates!were!centrifuged!10!min!at!4°C!15,000!g!and!pellets!were!discarded.!!To!determine!protein!concentration,!10!µl!of!lysate!was!measured!using!a!bicinchoninic!acid!(BCA)!kit!according!to!the!manufacturers!instructions!(Pierce!Biotechnologies,!Rockford,!Illinois,!#23225).!Five8times!concentrated!reducing!sample!buffer!(62.5!mM!Tris8HCl!pH!6.8,!4%!glycerol!(Fisher,!#BP22981),!2.5%!sodium!dodecyl!sulfate!(SDS)(Bio8Rad,!#16180301),!0.02%!bromophenol!blue,!100!mM!diothiothreitol!(Sigma,!#D0632))!was!added!1:5!to!samples!and!were!incubated!1!h!in!a!37°C!water!bath.!Samples!were!immediately!analyzed!by!SDS8polyacrylamide!gel!electrophoresis!(SDS8PAGE)!(see!Section!2.4.2).!!! 2.4.2!!SDSLpolyacrylamide!gel!electrophoresis!(PAGE)!and!western!blotting!!Incubation!with!reducing!sample!buffer!was!used!to!denature!proteins!and!coat!them!with!a!net!negative!charge.!From!each!sample,!30!µg!of!protein!was!loaded!as!determined!by!the!BCA!assay,!(see!Section!2.3.1)!and!separated!at!200!V!for!approximately!1!h,!through!an!8812%!SDS8polyacrylamide!gel!using!a!dual!vertical!min8gel!apparatus!with!at!water8cooling!system!(CBS!Scientific,!Del!Mar,!California),!in!running!buffer!(50!mM!Tris,!0.4%!glycine,!0.1%!SDS).!Precision!Plus!Protein!Kaleidoscope!standard!(Bio8Rad,!#16180375)!or!BlueEye!Prestained!Protein!Ladder!(FroggaBio,!GeneDireX,!Toronto,!Ontario,!#PM00780500)!was!loaded!beside!the!samples!and!used!to!estimate!molecular!weight.!Separated!proteins!were!transferred!to!nitrocellulose!membrane!(Bio8Rad,!#16280115)!using!a!Bio8Rad!Mini!Trans8 ! 48! Blot®!transfer!apparatus!and!running!a!current!of!20!V!overnight!in!transfer!buffer!(20!mM!Tris8HCl,!50!mM!glycine,!20%!methanol!(Fisher,!#A41284)).!!!!!After!transfer!was!complete,!the!nitrocellulose!membrane!was!blocked!30!min!in!Tris8buffered!saline!(TBS)(2.5!g/L!Tris,!8.8!g/L!NaCl,!pH!8)!containing!5%!skim!milk!powder!or!5%!bovine!serum!albumin!(BSA)(Fisher,!#BP1600)!at!room!temperature,!on!a!Lab!Line!Orbit!Shaker!(Lab!Line!Instruments!Inc.,!Melrose!Park,!Illinois).!Membranes!were!incubated!overnight!at!4°C!in!TBS!containing!5%!milk!or!5%!BSA,!and!primary!antibody!(Table!2.2),!after!which,!excess!primary!antibody!was!removed!by!three!successive!10!min!washes!in!TBS!containing!0.1!%!Tween!(Fisher,!#BP337).!Horseradish!peroxidase!(HRP)8conjugated!secondary!antibody!(Table!2.2)!was!added!in!TBS!containing!5%!milk!for!1!h!at!room!temperature,!with!shaking.!Excess!secondary!antibody!was!removed!by!another!three!10!min!washes!in!TBST.!Nitrocellulose!membranes!were!incubated!for!1!min!in!a!minimum!volume!of!1!ml!Amersham!ECL!Western!Blotting!Detection!Reagent!(GE!Heathcare,!#RPN2106VV1/2),!and!were!then!exposed!for!various!time!periods!in!a!darkroom!using!8!x!11”!Classic!Blue!Autoradiography!Film!BX!(Mandel!Scientific,!Guelph,!Ontario,!#EBA45)!and!developed!with!a!Kodak!X8OMAT!1000A!processor!(MedTec!Marketing!Group,!Burnaby,!British!Columbia).!Re8probing!was!performed!after!stripping!membranes!by!three!20!min!washes!in!TBS!pH!2.!!!!! ! ! 49! Table!2.3!List!of!antibodies!used!in!western!blotting.!!!!! Specificity! Conjugation! Concentration! Host! Company! Primary!Antibodies:!Cx43!C8terminus! 8! 1:1000! Rabbit! Sigma!(C6219)!Cx43!N8terminus! 8! 1:250! Mouse! Fred!Hutchinson!(Seattle!Washington)!Cx43!pY265! 8! 1:1000! Rabbit!monoclonal! (Solan!and!Lampe,!2008)!IgM!(µ!chain)! 8! 1:3000! Goat! Jackson!Immuno!Research!(11580058020)!!Akt! 8! 1:1000! Rabbit! Cell!Signaling!(9272)!Actin! 8! 1:1000! Mouse! Fisher!(ICN691001)!pY!(4G10)! 8! 1:2000! Mouse!monoclonal! In8house!(Morrison!et!al.,!1989)!!Rap1!A/B! 8! 1:1000! Rabbit! Cell!Signaling!(2399S)! Secondary!Antibodies:!Mouse!IgG! HRP! 1:3000! Goat! Bio8Rad!(17086516)!Rabbit!IgG! HRP! 1:3000! Goat! Bio8Rad!(17086515)!Goat!IgG! HRP! 1:3000! Donkey! Santa!Cruz!(SC82020)!!! 2.4.3!Phosphatase!treatment!!J558µm3!cells!expressing!WT!or!mutated!Cx438EGFP!were!stimulated!for!various!lengths!of!time!with!goat!α8mouse!IgM!and!lysed!as!described!previously!(see!Sections!2.3.3!and!2.4.1!respectively).!For!each!time8point,!30!µg!of!protein!was!aliquoted!each,!one!for!phosphatase8treatment!and!one!for!an!untreated!control.!Thirty!units!of!calf8intestinal!phosphatase!(CIP,!New!England!BioLabs,!Ipswich,!Massachusetts,!#M02905)!were!added!to!phosphatase8treated!samples!and!NEB!buffer!was!added!to!all!samples,!followed!by!1!h!incubation!in!a!37°C!water!bath.!Reducing!sample!buffer!was!added!after!phosphatase!treatment!and! ! 50! samples!were!incubated!an!additional1!h!at!37°C.!!!Samples!were!analyzed!immediately!by!SDS8PAGE!and!western!blotting!(Section!2.4.2).!!!!! 2.4.4!!Biotinylation!of!surface!proteins!!To!detect!cell!surface!proteins,!biotinylation!was!performed!as!has!been!described!previously!(Condon!et!al.,!2000).!For!each!sample,!2.585x107!cells!were!washed!twice!with!1x!PBS!and!re8suspended!in!either!3!ml!of!1x!PBS!containing!0.5!mg/ml!sulfo8NHS8biotin!(Pierce,!#21217)!or!1x!PBS!alone!in!15!ml!polypropylene!tubes!(BD!Falcon,!#430791)!and!rocked!for!1!h!at!room!temperature.!Unbound!biotin!was!removed!by!three!successive!washes!with!3!ml!of!1x!PBS!containing!2!mg/ml!lysine.!Cells!were!lysed!as!described!above!(see!Section!2.4.1)!and!40!µl!of!lysate!was!set!aside!as!a!control.!The!remaining!lysate!was!pre8cleared!of!non8specific!binding!by!1!h!incubation!with!un8conjugated!beads.!Beads!were!prepared!by!pelleting!30!µl!of!agarose!beads!(Vector!Laboratories,!Burlingame,!California,!#94010)!by!centrifugation!1!min!at!14,000!g!in!1.7!ml!micro8centrifuge!tubes!and!by!two!successive!washes!with!300!µl!1x!PBS.!Lysates!were!added!to!the!washed!beads!and!rocked!for!30!min!at!room!temperature.!Following!centrifugation!to!remove!beads,!cleared!supernatant!was!collected!and!added!to!30!µl!washed!avidin8conjugated!agarose!beads!(Peirce,!#20219).!Avidin8beads!were!rocked!for!1!h!at!room!temperature!with!pre8cleared!lysates!to!bind!biotin,!after!which!beads!were!washed!three!times!in!300!µl!lysis!buffer,!dried!completely,!and!suspended!in!30!µl!of!1x!reducing!sample!buffer!to!remove!protein!from!beads!and!to!prepare!them!for!SDS8PAGE!and!western!blotting.!Samples!were!either!boiled!for!5!min!or! ! 51! incubated!in!a!37°C!water!bath!for!1!h!depending!on!whether!Cx43!or!other!surface!proteins!were!being!detected!respectively.!Samples!were!analyzed!by!western!blot!(Section!2.4.2).!!!!! 2.4.5!!Immunoprecipitation!!!Cells!were!stimulated!and!lysed!as!previously!described!(Sections!2.3.3!and!2.4.1!respectively).!To!prevent!non8specific!binding,!lysates!were!pre8cleared!by!1!h!of!rocking!at!4°C!with!30!µl!of!protein!A8conjugated!sepharose!beads!(Sigma,!#P9424).!Beads!were!discarded!after!pelleting!by!centrifugation!at!14,000!g!for!2!min.!!!For!IP,!3!µg!of!rabbit!α8mouse!Cx43!(Sigma,!#C6219)!was!added!to!cleared!lysates!and!rocked!gently!at!4°C!for!1!h!in!a!total!volume!of!1!ml!to!ensure!sufficient!mixing.!Another!30!µl!of!protein!A8conjugated!sepharose!beads!were!washed!once!in!200!µl!lysis!buffer!and!added!to!lysates!to!bind!the!antibody8bound!Cx43!protein.!Bead/antibody/lysate!mixture!was!rocked!at!4°C!overnight!and!then!centrifuged!for!2!min!at!14,000!g!to!collect!beads.!Beads!were!washed!three!times!in!200!µl!lysis!buffer,!dried!well,!and!re8suspended!in!30!µl!of!1x!reducing!sample!buffer.!Samples!were!incubated!1!h!in!a!37°C!water!bath!to!detach!proteins!from!antibodies!and!beads!and!to!prepare!protein!for!SDS8PAGE!and!western!blotting!(Section!2.4.2).!! 2.4.6!!Rap!activation!assay!!!!!!!!Rap!activation!was!performed!as!has!been!described!previously!(McLeod!et!al.,!1998).!Briefly,!0.5x106!cells/time8point!were!stimulated!(Section!2.3.3)!and!lysed!in!500!µl!radioimmunoprecipitation!assay!(RIPA)!lysis!buffer!(30!mM!Tris8HCl!pH!7.4,!150!mM!NaCl,! ! 52! 1%!IGEPAL,!0.5%!deoxycholate!(Sigma,!#D6750),!0.1%!SDS,!2!mM!EDTA)!containing!protease!inhibitors!(10!µg/ml!leupeptin,!1!µg/ml!aprotinin,!1!mM!pepstatin!A,!1!mM!Na3VO4,!1!mM!PMSF).!The!Rap1!binding!domain!of!the!Ral8GDS!protein!was!used!to!pull!down!only!the!active,!GTP8bound!form!of!Rap.!Ral8GDS!was!purified!using!the!pGEX8RalGDS!(RBD)!plasmid!as!has!been!described!previously!(McLeod!et!al.,!1998).!Ral8GDS!beads!were!made!fresh!by!adding!20!µl!of!Ral8GDS!and!30!µl!of!washed!glutathione8sepharose!4B!beads!(GE!Healthcare,!#178C756801).!30!µl!lysate!was!set!aside!for!measuring!total!Rap!and!remaining!lysates!were!added!to!beads!for!pull8down.!After!boiling!in!reducing!sample!buffer,!samples!were!loaded!immediately!or!frozen!at!820°C.!!Samples!were!analyzed!by!western!blot!(Section!2.4.2)!and!probed!with!an!antibody!against!total!Rap!(Table!2.3).!!! 2.5!!!!!Flow!cytometry! ! 2.5.1!!Sample!preparation!and!staining!!For!surface!staining,!1x106!J558µm3!cells!expressing!WT,!mutant!Cx438EGFP!or!empty!vector!were!washed!1x!in!PBS!by!centrifugation!at!1500!rpm!for!5!min,!and!re8suspended!in!50!µl!of!FACS!buffer!(1x!PBS!containing!2%!FBS)!in!a!968well!round8bottomed!plate!(BD!Biosciences,!#353917).!PE8conjugated!α8IgM!(1.25!µg/ml)!was!added!and!cells!were!incubated!for!30!min!on!ice,!protected!from!light.!To!wash!cells,!100!µl!of!FACS!buffer!was!added!for!a!final!volume!of!150!µl!and!the!plate!was!spun!at!1,500!rpm!for!5!min!in!a!H8103N!series!silencer!plate!spinner!(Western!Scientific,!Valencia,!California).!The!plate!was!inverted!to!discard!supernatant!and!pelleted!cells!were!washed!an!additional!two!times!in!150!µl!FACS!buffer! ! 53! before!re8suspending!in!300!µl!FACS!buffer!in!polystyrene!or!polypropylene!FACS!tubes!(BD!Falcon,!#352054!or!#352063!respectively).!Stained!cells!were!transported!on!ice,!protected!from!light!to!the!UBC!Flow!Cytometry!Facility!(www.ubcflow.ca)!! 2.5.2!!Data!collection!and!analysis!!Flow!cytometry!was!performed!regularly!to!check!cell!lines!(Table!2.2)!for!expression!of!transduced!constructs!(WT!or!mutant!Cx438EGFP!and!IgM).!!!Igα!expression!was!found!to!be!stable!and!did!not!need!re8sorting,!and!Igβ!is!endogenously!expressed!by!J558!cell!lines.!!Cells!were!analyzed!on!a!BD!LSRII!Flow!Cytometer!(BD!Biosciences)!using!BD!FACS!Diva!software!(BD!Biosciences).!Expression!of!Cx438EGFP!and!IgM!were!determined!by!measuring!the!percentage!of!the!population!EGFP+!and!PE+!respectively.!Gating!was!used!to!exclude!debris!and!dead!cells!based!on!forward!scatter/side!scatter!plot!generated!using!FlowJo!Flow!Cytometry!Analysis!Software!(Tree!Star!Inc.,!Ashland,!Oregon).!Cells!were!re8sorted!by!the!UBC!FLOW!FACS!facility!to!prevent!periodic!loss!of!either!Cx438EGFP!or!IgM!expression.!!! 2.6!!!!!In#vitro!BLCell!assays! ! 2.6.1!!BCRLmediated!cell!spreading!!To!prepare!the!spreading!assay,!the!appropriate!number!of!12!mm!glass!coverslips!(Fisher,!#128545880)!were!sterilized!in!100%!methanol!in!a!248well!polystyrene!tissue!culture!dish!(BD!Falcon,!#353047),!dried!completely,!and!coated!overnight!shaking!in!500!µl!of!1x!PBS! ! 54! with!40!µg/ml!of!goat!α8mouse!IgM.!Coverslips!were!washed!three!times!in!1x!PBS!and!283x105!cells!were!added!in!1!ml!RMPI!and!incubated!at!37°C!with!5%!CO2!for!the!given!time8point.!!Cells!were!fixed!in!250!µl!4%!paraformaldehyde!(Cedar!Lane!Labs,!Burlington,!North!Carolina,!#15710)!for!10!min,!washed!once!in!1x!PBS!and!then!permeabilized!in!0.5%!Triton8X!100!for!10!min.!Cells!were!washed!once!in!1x!PBS!and!then!a!30!min!incubation!in!200!µl!of!1:40!rhodamine8phalloidin!(Molecular!Probes,!Invitrogen,!#R415)!was!used!to!stain!actin.!Coverslips!were!washed!a!final!three!times!and!mounted!onto!3!x!1”!glass!microscope!slides!(Fisher,!#1285508123)!using!ProLong!Gold!anti8fade!reagent!supplemented!with!DAPI!(Molecular!Probes,!Invitrogen,!#P36935)!to!stain!the!nucleus.!Samples!were!dried!overnight,!immobilized!with!nail!polish,!and!slides!were!stored!at!820°C.!The!contact!area!between!the!adhered!or!spreading!cells!and!the!coverslip!was!imaged!using!an!Olympus!Fluoview!1000!confocal!microscope!viewed!using!the!60x!objective.!Contact!area!was!quantified!using!Image!Pro!Plus!6.2!analysis!software!(Media!Cybernetics,!Rockville,!Maryland)!and!expressed!as! µm2.!!!!!!!!! ! ! ! ! 55! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! Figure!2.1!Schematic!of!BLcell!spreading!assay.!J558µm3!cells!do!not!express!Cx43!and!were!used!as!a!gain!of!function!model!to!study!the!ability!of!WT!versus!mutant!Cx43!to!allow!B!cell!spreading!on!glass!coverslips!coated!with!α8IgM!(the!BCR!type!expressed!by!J558µm3).!The!contact!site!between!cells!and!coated!coverslips!was!imaged!with!a!confocal!microscope!and!contact!areas!were!measured!via!actin!(rhodamine8phalloidin)!staining.!!!!!! 2.6.2!!Cell!proliferation!!An!aliquot!per!day!of!1x103!cells!in!50!µl!of!RPMI!were!incubated!for!four!days!in!a!3848well!plate!(BD!Falcon,!#353962)!at!37°C!with!5%!CO2.!To!stain!live!cells,!5!µl!of!0.01%!alamar!blue!(resazurin!sodium!salt,!Sigma,!#R7017)!was!added!each!day,!and!colour!change!was!measured!at!A590!after!a!four8hour!incubation!using!a!SPECTRAmax!Gemini8XS!spectrophotometer!(Molecular!Devices,!Sunnydale,!California).!Live!cells!were!measured!over!a!48day!period.!! Cx43%EGFP* N" C"GFP* J558μm3* 0me* Mutants'Expressed:' Cx43Y265F* Cx43Y265D* Cx43T154A* Cx43T154AΔ246* Cx43Δ246* * ! 56! 2.6.3!!Hemichannel!assay!!Channel!activity!was!measured!using!the!procedure!described!by!(Contreras!et!al.,!2002)!and!adapted!by!Dr.!Jose!Luis!Vega!Pizarro!(Universidad!de!Catolica!de!Chile,!Satiago!Chile,!visiting!Postdoctoral!Fellow!with!Dr.!Christian!Naus!lab,!Department!of!Cellular!and!Physiological!Sciences,!UBC)!and!myself.!For!measuring!dye8uptake,!5!million!cells!were!centrifuged!at!1500!rpm!5!min!and!washed!once!in!1x!PBS.!Cells!were!re8suspended!in!2!ml!of!Locke’s!buffer!(9!g/L!NaCl,!0.4!g/L!KCl,!0.2!g/L!NaHCO3)!with!or!without!divalent!cations!(0.25!g/L!CaCl2)!in!a!poly8D8lysine!coated!35!mm!glass!bottom!microwell!dish!(MatTek,!Ashland!Massachusetts,!#P35GC818148C)!and!focused!on!with!a!Zeiss!Axioplan!2!Imaging!!microscope!(MicrOptik,!Deursen!Netherlands)!(16x!objective).!To!begin!HC!assay,!1!ml!of!Locke’s!buffer!containing!3x!concentrated!(15!µM)!ethidium!bromide!(Invitrogen,!#15585011)!was!added!for!a!final!concentration!of!5!µM!and!images!were!collected!every!30!sec!for!15!min!using!Image!J!software.!!! 2.6.4!!Cell!aggregation!!To!coordinate!cell!density!between!cell!types,!5x105!cells/ml!were!grown!overnight!in!10!cm!tissue!culture!dishes.!To!measure!aggregation,!2.5x105!cells!from!each!dish!were!transferred!to!one!well!of!a!68well!tissue!culture!dish!containing!2!ml!of!RMPI!media!containing!reduced!serum!(1%!FBS)!to!prevent!cell!division.!Cells!were!dispersed!by!pipetting!up!and!down,!and!were!rocked!at!150!rpm!at!37°C.!Images!were!taken!at!0,!5,!24,!and!48!h.!Cell!aggregation!was!measured!by!quantifying!the!area!of!each!object!(aggregate!of!cells),!dividing!by!the!diameter! ! 57! of!a!single!cell,!in!order!to!calculate!the!number!of!cells/clump!(Figure!2.2).!Quantification!was!performed!using!Image!Pro!6.2.!!!!!!!!!!!!!!!!!! ! ! ! ! Figure!2.2!Schematic!of!quantification!of!cell!aggregation.!Each!clump!of!cells!was!counted!as!an!object.!Object!areas!were!divided!by!the!smallest!object!area!measured!at!time!zero,!which!corresponded!to!the!area!of!a!single!cell,!giving!the!number!of!cells/object.!A!sample!calculation!is!given.!!!! Maximum'Object'Area' ' Minimum'Object'Area' ' ='#'Cells/Clump' (=1$cell/clump)$ (=17$cells/clump)$ Non:aggrega<ng'cells:' Aggrega<ng'cells:' ! 58! 2.6.5!!Bead!clearing!cell!motility!assay!!18!mm!glass!coverslips!(VWR,!#483808046)!were!coated!overnight!at!4°C!with!20!µg/ml!(2.5! µg/cm2)!bovine!fibronectin!(Invitrogen,!#F1141)!in!1X!PBS.!The!coverslips!were!washed!once!with!1X!PBS!and!coated!with!6!µl!of!fluorescent!blue!FluoSpheres!(Molecular!Probes,!Invitrogen,!#F8815)!suspended!in!100!µl!1X!PBS!per!coverslip.!Complete!media!containing!either!100!ng/ml!SDF81!or!no!cytokine!and!1500!cells!were!added!to!the!coated!coverslip!and!incubated!for!18!h!at!37°C!in!5%!CO2.!Cells!were!fixed!and!stained!as!described!for!the!cell!spreading!assay!(Section!2.6.1).!Images!were!obtained!using!an!Olympus!BX61!microscope!(Olympus)!with!the!20X!objective,!and!the!area!of!the!beads!that!were!cleared!were!quantified!using!cellSens!Dimension!image!analysis!software!(Olympus).!!!! ! 2.7!!!!!Confocal!microscopy! ! 2.7.1!!Sample!preparation!and!staining!!For!intracellular!staining,!cells!were!immobilized!on!12!mm!glass!coverslips!that!had!been!sterilized!with!100%!methanol!and!coated!for!30!min!with!500!µl!of!1:10!poly8L8lysine!(Sigma,!#P4707).!!Coverslips!were!washed!three!times!in!1x!PBS!and!3x105!cells!were!added!and!allowed!to!settle!and!adhere!to!the!coated8glass!for!5!min.!Cells!were!fixed!in!250!µl!of!4%!paraformaldehyde!in!1x!PBS!for!10!min.!Excess!paraformaldehyde!was!removed!by!washing!coverslips!once!in!1x!PBS.!Cells!were!permeabilized!for!intracellular!staining!in!0.5%!Triton8X!100!for!10!min!and!washed!once!in!1x!PBS.!For!staining!of!the!BCR,!cells!were! ! 59! blocked!by!30!min!incubation!in!1x!PBS!containing!3%!BSA.!Primary!antibody!(200!µl!of!1:200!goat!α8mouse!IgM)!was!added!for!30!min!in!1x!PBS+3%!BSA,!was!washed!away!three!times,!followed!by!a!30!min!incubation!with!200!µl!of!1:200!Alexa647!rabbit!α8goat!IgG!(Molecular!Probes,!Invitrogen,!#A21446).!!!For!staining!of!the!endoplasmic!reticulum!(ER),!3x105!cells!were!centrifuged!5!min!at!1,500!rpm!and!re8suspended!in!500!µl!of!1x!PBS!containing!0.5!µl!ER!Tracker!(Molecular!Probes,!Invitrogen,!#E12353)!in!a!248well!polystyrene!tissue!culture!plate.!Cells!were!incubated!30!min!at!37°C!at!5%!CO2!for!labeling!of!the!ER,!5!min!in!1x!PBS!to!wash!away!excess!stain,!and!a!final!5!min!in!500!µl!RPMI,!and!then!added!to!poly8L8lysine8coated!coverslips!for!5!min.!Poly8L8lysine8coated!coverslips!were!prepared!as!described!above.!!Cells!were!fixed!as!described!above!and!mounted!onto!glass!slides!in!anti8fade!reagent.!Slides!were!stored!at!820°C.!! 2.7.2!!Image!acquisition!and!analysis!!For!confocal!microscopy,!cells!and!coverslip!were!imaged!using!an!Olympus!Fluoview!1000!confocal!microscope!with!the!60x!objective.!The!contact!area!was!quantified!using!Image!Pro!6.2!analysis!software!(Media!Cybernetics,!Rockville,!Maryland).!Microscope!and!imaging!software!were!part!of!the!Life!Sciences!Institute!Imaging!Facility!(http://facilities.lsi.ubc.ca/core8facilities/imaging).!!! ! 60! HC!assays!were!performed!in!collaboration!with!Dr.!Jose!Luis!Vega!Pizarro!and!the!Naus!lab.!!Live!cell!imaging!was!performed!on!a!Zeiss!Axioplan!2!microscope!with!the!16x!objective.!Dye8uptake!was!quantified!using!Image!J!analysis!software.!!! 2.8!!!!!Statistics! !To!analyze!significance,!a!student’s!two8tailed,!unpaired!t8test!was!used!to!compare!the!means!to!either!a!positive!or!negative!control!using!Microsoft!Excel.!Asterixes!(*)!represent!significance!based!on!a!95%!confidence!interval!(P<0.05).!Error!bars!on!graphs!show!standard!error!of!the!mean.!!!! ! ! !!!!!!!!! ! ! 61! CHAPTER!3! RESULTS!!This!thesis!project!is!based!on!previous!results!in!the!lab!that!demonstrated!the!importance!of!Cx43!in!B8cell!processes!that!depend!on!cytoskeletal!rearrangement!such!as!cellular!adhesion,!spreading,!and!migration.!It!is!unclear!whether!Cx43!influences!these!processes!by!acting!1)!as!an!adhesive!protein!using!its!extracellular!domains,!2)!as!a!constituent!of!functional!GJs/HCs,!or!3)!as!a!scaffold!to!promote!protein8protein!interactions!through!its!CT!tail.!To!differentiate!between!these!possible!explanations,!regions!of!the!Cx43!amino!acid!sequence!were!targeted!by!mutating!1)!the!extracellular!loops,!2)!the!transmembrane!domain!that!lines!the!GJ!or!HC!pore,!and!3)!the!cytoplasmic!CT!tail.!!!The!first!target:!the!extracellular!loops!were!investigated!by!making!mutations!of!conserved!cysteine!residues!that!are!thought!to!be!involved!in!cell!adhesion!events!including!those!in!forming!GJ!pores.!These!mutations,!when!expressed!in!B8lymphocytes,!resulted!in!intracellular!accumulation!of!Cx43!probably!due!to!defective!trafficking!of!Cx43!proteins!harboring!these!mutations!through!the!secretory!pathway.!Due!to!the!severity!of!these!trafficking!defects!and!the!importance!of!surface!expression!for!our!assays,!that!rely!on!interactions!with!the!BCR!on!the!plasma!membrane,!it!was!decided!to!abandon!further!work!on!this!panel!of!mutants,!and!instead,!to!focus!on!the!channel8lining!(Chapter!3.1)!and!cytoplasmic!CT!(Chapter!3.2)!domains!of!Cx43!which!when!mutated,!both!appeared!to!traffic!normally!to!the!cell!surface.!The!work!performed!making!the!extracellular!domain!mutants!and!their!characterization!are!summarized!in!Appendix!1.1.!! ! 62! 3.1!!!!!BCRLmediated!BLcell!spreading!is!independent!of!Cx43!channel!function.#!The!second!target!was!the!channel!domain,!and!was!investigated!using!the!Cx43!closed8channel!mutant!Cx43T154A.!!Our!results!suggest!that!this!mutation!may!influence!BCR8mediated!cell!spreading!through!a!yet!undefined!conformational!defect!to!the!CT!tail.!! ! 3.1.1!!Rationale! !Connexins!(Cxs)!have"traditionally"been"considered"building(blocks'of'GJ'channels,"whose$purpose'is'to'facilitate'cell8cell$communication)(Evans&and&Martin,&2002).""Although(mature(B8cells%only%make%relatively%transient%GJ%contacts%such%as%those%formed%during%transmigration%through'endothelium'(Oviedo8Orta%et%al.,%2002)!and!during'immune'synapse'formation'with'antigen'presenting'cells!like%follicular%dendritic%cells%(Krenacs(et(al.,(2005)!or#T8cells!(Oviedoorta!et!al.,!2008),"a"number"of"reports"show"that"Cxs"may"form"HCs!that$connect$the$cell$with$the$extracellular$environment."These"studies,"however,"are"often"criticized"due"to"the"difficulty)in)measuring)GJ)communication)and)the)difficulty)in)linkage)to)relevant!physiological+processes+(Spray&et&al.,&2006)."!!We#have#previously#found#that"the"Cx43"CT"tail"is"important"for"B8cell$adhesion,$spreading,$and$motility$(Bruzzone)et)al.,)2003;)Machtaler)et)al.,)2011)."Truncation"of"the"CT"domain"of"Cx43%at%aa%246!(Δ246)!leaves&the&microtubule8binding&domain$intact$and$does$not$appear$to$alter&trafficking*of*the*mutated*Cx43*to*the*plasma*membrane*nor*its*ability!to#form#GJs#(Bates&et&al.,&2007),"however&truncation&of&the&CT&domain&has&been&shown&to&reduce&GJ& ! 63! conductance)in)some)cases)(Behrens'et'al.,'2010;"Crespin(et(al.,(2010)."We"propose"that"the"Cx43%CT!tail%may%play%a%role%in%gating%HC%activity%or%selectivity%and%that%point%mutations%of%the%CT#domain#may#alter#the#ability#of#the#Cx43#CT#domain#to#influence#either#opening#or#closing#of#HCs,#either#by#its#contribution)to)the)structure)of)Cx43,)or)by)influencing&the&binding&of&proteins)to)the)CT)tail)which)then)can)regulate!HC#activity.#!!To#address#the#importance#of#the#channel#in#BCR8mediated'B8cell$spreading,$we!used%two%approaches:*First*a*pharmacological*approach*was$utilized,)and)B8cells%were%treated%during'BCR8mediated'spreading'with'drugs'that'are'known'to'block'channel'activity.'These'drugs'allow%us%to%impede%the%function%of%endogenous%or%overexpressed%HCs!in#various#B8cell$types,&but$lack$specificity)and)can)block)other)types)of)HCs,)therefore)we)also$used$a$genetic!approach'by'expressing'a'Cx43'mutant'that$was$unable$to!form%functional%channels%in%both%a%Cx438null!B8cell$line$(plasmacytoma$cell$line:!J558µm3,$expressing$a$mIgM$BCR)"and"a"Cx43"expressing!B8cell$line$(B8lymphoma(cell(line:!Wehi231).!!! ! ! 3.1.2!!ChannelLblocking!drugs!did!not!prevent!BLcell!spreading! !!To#test#the#importance#of#HC!function(of#Cx43#in#B8cell$spreading,!three%channel%blocking%agents!were$used."The"ion"lanthanum"(La3+)!blocks'Cx'HCs!whereas'the#drug!probenecid*(Pbn)"blocks"Panx"HCs,"and"the"drug"carbenoxolone"(CBX)"blocks"both"types"of"HCs."!Wehi231!cells,&A20&cells,&and&primary&splenic&B8cells%isolated%from%C57BL/6"mice"were"pre8!!!! ! 64! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Figure!3.1!BCRLmediated!B!cell!spreading!is!not!affected!by!hemichannelLblocking! drugs.!BCR8mediated'cell'spreading'on#α8IgM!(BCR)!coated'glass'coverslips!for$0$or$30$min$by#A)#A20#cells#B)#Wehi231!cells%and%C)%Primary%splenic%B%cells%isolated%from%C57BL/6"mice"D)#J558µm3#cells#expressing)Cx438EGFP!(J558µm3+Cx438EGFP%cell%spreading*shown*in*E)."Contact!area!between!cells!and!the!coverslip!were!quantified!from!images!of!rhodamine8phalloidin!stained!actin!(red)!to!visualize!the!spreading!cell!periphery!taken!using!an!Olympus!Fluoview!1000!confocal!microscope!using!a!60x!objective.!(Error!bars!represent!standard!error!of!the!mean).!Data$is$representative)of)three)(A8C)#or#one#(D#and#E)#independent'replicates'where'>100'cells'were'quantified'per'sample."Asterix!denotes!significance!between!treatments!as!determined!by!P8value!<0.05!by!a!Student’s!two8tailed,!unpaired!t8test!calculated!by!Excel!(no!significant!differences).!! 0 50 100 150 200 250 untreated  CBX Pbn La M ea n C on ta ct  A re a (µ m 2 )  A20 Spreading 0 min 30 min 0 50 100 150 200 250 300 350 400 untreated CBX La Pbn M ea n C on ta ct  A re a (µ m 2 )  Wehi231 Spreading 0 10 20 30 40 50 60 70 untreated CBX Pbn La M ea n C on ta ct  A re a (µ m 2 )  Primary Splenic B-cell Spreading 0 20 40 60 80 100 120 140 160 180 200 Untreated CBX Pbn La M ea n C on ta ct  A re a (µ m 2 )  J558µm3+Cx43 Spreading 0 50 100 150 200 250 u tr t    Pbn La M ea n C on ta ct  A re a (µ m 2 )  A20 Spreading 0 min 30 min !!!!!!!!!!!!Untreated!!!!!!!!!!!!!!!!!!!!!!!!!!!CBX!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Pbn!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!La! Cx432EGFP! Ac8n! 0! m in  30 !m in  A" B" C" D" E" ! 65! treated&with%these%blocking%agents!to#induce#closure#of#HCs#prior#to#incubation)on)anti8IgM$(anti8BCR)%coated%glass"coverslips"(for"detailed"methods,"see"Chapter"2.3.4).""For"all"B8cell$types,"cells"treated"with"HC8blockers)spread'as'well'as'untreated'cells!(Figure(3.1)!and$remained(viable(based&on&the$absence$of$nuclear$fragmentation+detected%by%staining!with%DAPI,"which%would%indicate%apoptosis!(Data$not$shown).#!!Because'the$majority$of!studies'of'HC'activity'have'been'performed'in'adherent'cell'types,'we'collaborated*with!an!expert&in&HC&research,"Dr."Jose!Luis%Vega%Pizzaro%(Universidad!de!Catolica!de!Chile,!Santiago!Chile,!and!a!visiting!Postdoctoral!Fellow!in!Dr.!Christian!Naus’s!lab,!Department!of!Cellular!and!Physiological!Sciences,!UBC)!to#adapt#an#assay#of#HC#activity#used#for$adherent$cells$for$use$in$B8lymphocytes.""!! 3.1.3!Overexpressed!Cx43!forms!hemichannels!that!are!not!actively!regulated! by!removal!of!divalent!cations!or!BCRLmediated!spreading!in!BLcells! !Ethidium!bromide!(EtBr)!uptake!was!used!to!measure!HC!activity!in!B8cells!(for!method!see!Chapter!2.6.3).!EtBr!was!used!over!other!fluorophores!because!it!is!a!nucleic!acid!intercalating!agent!and!fluoresces!only!after!binding!to!DNA.!This!allows!us!to!measure!dye8uptake!into!the!nucleus!as!a!measure!of!HC!internalization,!without!washing!cells!since!the!dye!will!only!fluoresce!in!cells!where!it!binds!DNA,!and!not!when!in!solution.!!!! ! 66! !!!!!!!!!!!!!!!!!!!!!!!! ! ! Figure!3.2!Hemichannel!activity!in!BLcell!lines.!Rate!of!dye!uptake!was!calculated!by!taking!the!slope!of!fluorescence!over!time!for!each!set!of!conditions!(basal!uptake!in!white,!activation!by!divalent!cation8free!solution!(DCFS)!in!black,!treatment!with!HC8blocking!drug!carbenoxolone!(CBX)!in!grey,!and!spreading!on!anti8IgM!(BCR)!in!checkered).!Error!bars!represent!standard!error!of!the!mean.!Data!is!represents!one!to!four!replicates!per!condition.!(Data#by#Dr.#Jose#Luis#Vega#Pizarro,#visiting#Postdoctoral#Fellow,#Universidad#de#Catolica#de# Chile,#Santiago#Chile,#with#Dr.#Christian#Naus#lab,#Department#of#Cellular#and#Physiological# Sciences,#UBC).!! 0 50 100 150 200 250 Ra te of  D ye  U pt ak e (%  co ntr ol)  J558µm3 eGFP J558µm3 Cx43-eGFP A20 Astrocytes DCFS (- Ca2+/Mg2+) - CBX (100 µm) - + - - - + - + + - - + - - - + - + + - - IgM - - - - - - - - - -+ 0 50 100 150 200 250 Ra te of  D ye  U pt ak e (%  co ntr ol)  J558µm3 eGFP J558µm3 Cx43-eGFP A20 Astrocytes DCFS (- Ca2+/Mg2+) - CBX (100 µm) - + - - - + - + + - - + - - - + - + + - - IgM - - - - - - - - - -+ J μ 3+EGFP,,,,,,,,,,,J558μm3+Cx430EGFP,,,,,,,,,,,,,,,,,,,,,,,,A20,,,,,,,,,,,,,,,,,,Astrocy es,(control),, ! 67! This!modification!of!the!assay!was!essential!for!working!with!cells!in!suspension!since!it!allowed!us!to!measure!the!same!cells!before!and!after!EtBr!addition,!whereas!washing!would!have!required!centrifugation!and!re8suspension!of!the!cells,!making!it!impossible!to!compare!the!same!cells!before!and!after!addition!of!the!dye!(EtBr).!!!!The!mean!of!the!slope!of!dye!uptake/time!was!plotted!to!show!the!rate!of!dye8uptake!(Figure!3.2).!Primary!C57BL/6!murine!astrocytes,!which!are!adherent!cells,!were!used!as!a!positive!control!of!HC!activity!(for!review,!see!(Bennett!et!al.,!2003))!in!our!assay,!and!compared!with!various!B8cell!lines.!A20!cells!(another!B8lymphoma!cell!line)!and!J558µm3+EGFP!(vector!control!cells!only!transfected!with!the!EGFP!tag)!cells!had!similar!rates!of!dye!uptake!as!astrocytes!in!basal!conditions!(no!uptake),!and!were!not!activated!by!removal!of!divalent!cations!(divalent!cation!free!solution:!DCFS!(no!Ca2+Mg2+)).!In!contrast,!J558µm3+Cx438EGFP!cells!had!high!levels!of!dye8uptake!in!basal!conditions!but!this!uptake!was!not!further!activated!by!DCFS.!Dye8uptake!by!J558µm3+Cx438EGFP!was!blocked!by!pre8treatment!with!100!µM!CBX,!a!HC!blocker,!showing!that!dye8uptake!occurs!specifically!through!HCs!in!these!cells.!Comparison!with!J558µm3+EGFP!confirmed!that!dye!uptake!was!specific!to!Cx43!HCs.!!!Overexpression!of!Cx438EGFP!seemed!to!cause!formation!of!Cx43!HCs,!yet!dye8uptake!is!not!enhanced!by!the!removal!of!divalent!cations,!which!is!a!common!HC!activator!used!in!astrocytes!and!other!cell!types!(Verselis!and!Srinivas,!2008;!Ye!et!al.,!2003).!One!possibility!explaining!this!lack!of!response!is!that!the!overexpression!of!Cx43!caused!a!“maxed8out”!HC!response!that!could!not!be!enhanced!by!further!activation,!another!could!be!that!removal!of!divalent!cations!does!not!activate!HCs!in!B8cells.!While!removal!of!divalent!cations!is!one!of! ! 68! the!most!widely!used!activators!of!HCs,!other!conditions!have!been!shown!to!regulate!HC!activity!in!specific!cell!types.!Fluid!flow!shear!stress!has!been!shown!to!activate!HCs!in!fibroblasts!through!integrin!signaling,!for!example!(Batra!et!al.,!2012).!!!Since!cell!spreading!creates!tension!on!the!plasma!membrane,!we!asked!whether!the!force!generated!during!B8cell!spreading!might!be!sufficient!to!cause!activation!of!Cx43!HCs.!J558µm3+Cx438EGFP!cells!spreading!on!α8IgM!coated!glass!dishes!did!not!take!up!more!dye!than!cells!in!basal!conditions!(Figure!3.2),!indicating!that!HC!activity!in!J558µm3+Cx438EGFP!cells!is!not!dependent!on!cell!spreading!or!BCR!signaling,!but!is!a!result!of!Cx43!overexpression.!!!While!J558µm3+Cx438EGFP!cells!form!HCs,!this!seems!to!be!an!overexpression!phenotype!since!dye8uptake!was!not!observed!in!HC!assays!with!un8transduced!J558µm3!cells!or!in!the!other!B8cell!lines!A20!and!Wehi231!(Wehi231#data#not#shown).!!! 3.1.4!!Expression!of!Cx43T154A!in!a!BLcell!line:!J558µm3! !To#investigate!the$importance$of#channel#activity#to#B#cell#spreading,#we#decided#to#use#the#well8studied'Cx43'point'mutation'T154A.'The'Cx43T154A'mutation'was'characterized'by'Dr.'Gina%E.%Sosinsky’s%lab%(Department%of%Neurosciences,%University%of%California,%San%Diego;!(Beahm&et&al.,&2006))"as#a#point8mutation&within&the&third&(TM3)&region&of&Cx43!and!was$identified'by'a'larger'mutagenesis'study'(Skerrett&et&al.,&2002)."This"mutated"Cx43"can"still"form%GJ%plaques%but%prevents&dye8transfer(in(between&Xenopus!oocytes!(Beahm&et&al.,&2006)." ! 69! Other&mutations!of#this!conserved)threonine,"for"example"Cx26T135A,"shows!structural'anomalies)in)GJ)plaque)formation)and)stability)of)oligomers)(Beahm&et&al.,&2006).""!!With%regard%to%the%Cx43T154A%mutation,%preliminary%experiments(were(performed(in(B8cells%by#previous#MSc#student#Caren#Jang,#and#I#extended#these#studies.#We#both#used#an#expression)vector)containing)a)cDNA)encoding!Cx43%with%the%T154A%mutation%(Chapter%2.1.1)%from%Dr.%Gina%E.%Sosinsky’s%lab%(Beahm&et&al.,&2006)."In"addition,"site8directed'mutagenesis'was$performed$on$WT$Cx43$in$order$to$generate$the$T154A$mutation$in$Cx438EGFP%expressed'in'the'NAP2'expression'vector'(Bates&et&al.,&2007)!for$consistency$with!other&Cx43&constructs(that(had(the(EGFP(tag."To#investigate#the#role#of#the#channel#mutant#on#B8cell$spreading,+this+plasmid+was+expressed+in+J558µm3#cells#by#retroviral#infection.##Populations#of#cells#were#enriched#for$those$expressing$Cx43T154A8EGFP%by!FACS%sorting%for%the%EGFP+%cells,&and&Cx43&expression&was&confirmed&by&western&blotting!(Figure(3.3(B).(!!To#ensure#that$the$Cx43T154A!mutation(did(not(alter(trafficking(and(localization(of(Cx43(to(the$plasma$membrane$in$J558µm3#cells,#confocal#images#were"taken"and"WT"or"mutant"Cx43"were$compared$(Figure$3.3$C).$WT$and$mutant$Cx43$were$visualized$via$their$EGFP$tag,$and$co8localization)with)both)a)live)ER)tracker)and)immunostained)IgM)(part)of)the)BCR)on)the)cell$surface$of$J558µm3#cells).#These#immunofluorescence'studies'showed'that'the'Cx43T154A)mutation)has)no)major)deleterious!effects&on&Cx43&trafficking&from&the&ER&to&the&plasma&membrane,&or&co8localization)at)the)plasma)membrane)with%the$BCR!(containing)IgM)! #! ! 70! !!!!!!!!!! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! Figure!3.3!Characterization!of!J558µm3!cells!expressing!Cx43T154A.!A)!Schematic!showing!point!mutation!of!threonine!154!to!alanine.!B)!Western!blot!showing!expression!of!Cx43T154A!in!the!J558μm3!cell!line!populations!stably!transduced!by!retroviral!infection!(Blot!was!stripped!and!re8probed!for!actin!as!a!loading!control).!C)!Localization!of!EGFP8fused!WT!Cx43!or!Cx43T154A!expressed!by!J558µm3!cells!viewed!by!an!Olympus!Fluoview!1000!confocal!microscope!using!a!60x!objective.!Green=WT!or!mutant!Cx438EGFP,!red=ER!(middle!panel)!or!IgM!(BCR)!(bottom!panel),!yellow=merge,!blue=DAPI!stained!nuclei.!Scale!bars!represent!10!µm.!Data!shown!is!representative!of!three!independent!replicates.!!! X6# 66"kda&" 45"kda&" 45"kda&" W eh i" J5 58 μm 3" J5 58 μm 3+ G FP " J5 58 μm 3+ Cx 43 " J5 58 μm 3+ T1 54 A" α"Cx43' α"Ac*n' #####J558μm3+Cx43############J558μm3+Cx43T154A# N" C" T154A& GFP$ M ol ec ul ar )W ei gh t)( kD a) # 66"kda&" 45"kda&" 45"kda&" W eh i" J5 58 μm 3" J5 58 μm 3+ G FP " J5 58 μm 3+ Cx 43 " J5 58 μm 3+ T1 54 A" α"Cx43' α"Ac*n' Cx43T154A#A) B) C) W eh i2 31 ( J5 58 μm 3( J5 58 μm 3+ EG FP ( J5 58 μm 3+ Cx 43 ( J5 58 μm 3+ Cx 43 T1 54 A( ! 71! heavy&chain).##This#was#further#confirmed#using#biochemical#methods#(see#Section$3.1.5$below).! #To!ensure!that!Cx43T154A!mutation!didn’t!alter!cell!size!or!proliferation,!J558µm3!cells!expressing!Cx43T154A,!WTCx43,!and!EGFP!alone!were!compared!(Figure!3.4).!Loss!of!Cx43!has!been!associated!with!increased!tumorigenicity!(Rose!et!al.,!1993),!whereas!overexpression!of!Cx43!in!C6!rat!glioma!cell!line!caused!a!significant!reduction!in!proliferation!(Zhu!et!al.,!1991).!Proliferation!using!a!live8cell!dye,!alamar!blue!uptake,!was!measured!by!a!fluorescent!plate!reader!(for!detailed!methods!see!Chapter!2.6.2),!and!we!found!that!J558µm3!cells!expressing!Cx43T154A!proliferated!at!the!same!rate!over!a!48day!period!as!cells!expressing!WT!Cx43!or!EGFP!alone!(Figure!3.4!A).!!!Since!Cx43!was!overexpressed!in!the!J558µm3!B8cell!line,!we!wanted!to!ensure!that!excess!Cx43!at!the!plasma!membrane!didn’t!cause!an!increase!in!cell!size,!which!could!confound!the!results!of#the!spreading!assay!by!influencing!the!cell!area.!Relative!cell!size!was!compared!by!flow!cytometry!(Chapter!2.5)!using!the!forward!scatter!measurement!(FSC).!WTCx43!and!Cx43T154A!expression,!when!compared!to!EGFP!expression!by!J558µm3!cells,!did!not!affect!cell!size!when!cells!were!not!stimulated!by!the!BCR!(Figure!3.4!B),!thus!confirming!that!any!differences!that!may!arise!between!EGFP,!Cx43,!and!Cx43T154A!during!the!cell!spreading!assay,!can!be!attributed!to!the!BCR8stimulated!spreading!response!itself!and!not!an!unexpected!affect!on!overall!cell!size.!!! ! ! 72! ! ! !!!!!!!!!!!!!!!!!!! ! ! ! ! ! ! Figure!3.4!Expression!of!Cx43T154A!by!J558µm3!does!not!affect!cell!size!or! proliferation.!A)!Cx43T154A!expression!did!not!affect!proliferation!over!a!48day!period,!measured!by!Alamar!blue!uptake!and!quantified!using!a!fluorescent!plate!reader.!Error!bars!represent!standard!error!of!the!mean.!(Data!is!representative!of!three!separate!experiments,!each!done!in!triplicate).!B)!Cell!size,!measured!by!forward!scatter!(FSC)!using!flow!cytometry.!Data!is!representative!of!three!separate!experiments,!each!measuring!20,000!cells.!Asterix!denotes!significance!as!determined!by!P8value!<0.05!by!a!Student’s!two8tailed,!unpaired!t8test!calculated!by!Excel!(no!significant!differences).!! 0" 2000" 4000" 6000" 8000" 10000" 12000" 1" 2" 3" 4" Fl uo re sc en cc e* U ni ts * Days* GFP" Cx43" T154A" FSC$ Co un t$ EGFP* Cx43* Cx43T154A* FSC" Co un t" EGFP" Cx43" Cx 3T154A" A* B* ! 73! ! 3.1.5!!Cx43LEGFP!is!expressed!at!the!cell!surface!in!transduced!J558µm3!!!It!was!important!to!confirm!proper!trafficking!of!the!overexpressed!Cx438EGFP!to!the!cell!surface!of!J558µm3.!Fusion!of!EGFP!to!the!Cx43!cytoplasmic!terminus!has!previously!been!shown!to!not!impair!trafficking!or!gap!junction!formation!in!NRK,!MDCK,!HeLa,!and!N2A!cell!types!(Jordan!et!al.,!1999;!Laird!et!al.,!2001)!but!it!was!important!to!confirm!that!Cx43!was!present!at!the!cell!surface!in!a!B8cell!system.!Confocal!microscopy!of!EGFP8tagged!Cx43!showed!expression!at!what!appears!to!be!the!plasma!membrane!(Figure!3.5!A),!as!well!as!in!an!intracellular!aggregate!that!has!previously!been!shown!to!co8localize!with!the!ER!as!well!as!with!early!endosomes!(Machtaler!et!al.,!2011;!Silverman!et!al.,!2008).!!!To!confirm!whether!Cx43!was!expressed!at!the!cell!surface,!intact!cells!were!biotinylated!to!label!surface!proteins.!The!biotinylated!cell!surface!proteins!were!isolated!using!avidin8coated!beads!under!conditions!in!which!intracellular!proteins!could!not!be!further!biotinylated!(for!detailed!methods!see!Chapter!2.4.4).!Next!SDS8PAGE!and!western!blotting!were!used!to!separate!the!lysed!samples!and!proteins!of!interest!were!detected!with!antibodies!(Table!2.2).!As!a!positive!control!for!this!method!surface!IgM!was!detected!from!biotinylated,!but!not!buffer8treated!cells!(data#not#shown).#Cx43!was!detected!in!biotinylated!! ! ! ! ! ! ! ! ! 74! ! ! ! ! ! ! ! ! ! Figure!3.5!Surface!expression!of!Cx43LEGFP!in!BLcells.!Surface!expression!of!A)!Cx438EGFP!overexpressed!by!J558µm3!cells%and%B)%α8IgM!stained(endogenous(BCR(shown(using!an#Olympus(Fluoview(1000(confocal(microscope!using&a&60x&objective.&Green=Cx438EGFP,&blue=DAPI*stained*nuclei,*red=IgM$(BCR)."Scale"bar"represents"10"µm.#(Localization#has#also#been$published,$Caren$Jang$MSc$thesis$UBC$2008,$Machtaler$et$al.,$2011).$Confirmation*that*Cx43%can%be%biotinylated%on%the%cell$surface!using&sulfo8NHS8biotin&and&pulled&down&using&avidin8coupled(beads(as(a(method(for(isolating(plasma(membrane8bound&proteins.&Biotinylated+proteins)were)isolated)using)avidin)beads)and)then!protein!was$denatured$and$removed'from'beads,'immunoblotted$and$probed$for$Cx43$or$Akt$as$a$negative"control"(cytosolic"protein)"in"the"following"cell"lines:!C)"Wehi231"cell"line,"which"has"endogenous"Cx43,&was&used&as"a"positive"control."D)"Overexpressed"Cx438EGFP#stably#introduced#into#J558µm3#cells#by#retroviral&infection&is&also&expressed&at&the&cell&surface.!Data$shown$represents%one%or%two%experiments%(C%or%D!respectively).! 48## 63## α"Cx43' α"Akt' Bio.nylated' Control' α"Cx43' α"Akt' 75## 50## M ol ec ul ar 'W ei gh t'( kD a) # A 10#μm# C! D! To ta l&c el l&l ys at e& To ta l&c el l&l ys at e& IP :&A vi di n& IP :&A vi di n& IgM#(BCR)#B ! 75! Wehi231!which!expresses!endogenous!Cx43,!as!well!as!from!transfected!J558µm3+Cx438EGFP.!!This!shows!that!Cx438EGFP!is!trafficking!to!the!cell!surface!in!J558µm3!cells.!The!cytosolic!protein!Akt/protein!kinase!B!was!used!as!a!negative!control!for!biotinylation!since!it!should!not!be!accessible!to!the!biotinylation!reagent!during!the!process!of!labeling!and!was!not!found!in!biotinylated!or!buffer8treated!samples!that!were!precipitated!with!avidin,!but!was!detected!in!total!cell!lysates!(Figure!3.5).!!Akt!was!also!useful!as!a!gel8loading!control.!The!MW!of!Cx438EGFP!from!J558µm3!cells!was!larger!due!to!its!EGFP!tag!(Figure!3.5!D).!!!! 3.1.6%!Expression*of*Cx43T154A&causes&nonLradial&BCRLmediated'spreading'in#a#BLcell$ line:&J558µm3! !Expression*of*the*Cx43*mutant*T154A*had*no*effect*on*the*average*contact*area*as*compared*to#expression#of#WT#Cx43#in#J558µm3#cells!spreading*on*anti8IgM$coated%glass%coverslips%(Figure(3.6(B)."However,"Cx43T154A!expressing)cells)would)often)extend)a)single)long)actin&and$EGFP8containing!projection!rather&than$spreading$radially$(Figure$3.6$A,"arrows).#(This&spreading*phenotype*was*also*observed*in*preliminary*spreading'experiments'performed'by'previous)MSc)student)Caren)Jang)and)myself,)by#J558µm3!cells!expressing)an)untagged!Cx43T154A)from)Dr.)Gina)E.)Sosinsky,)data$not$shown).$$When%quantified,%a%significantly%higher&percentage&of&Cx43T154A8expressing)cells)formed#these#single!projections,#which#were$counted(if(the(projection’s(length!measured(at(minimum,(half(the"diameter"of"the"cell"(Figure(3.6(C,(Caren(Jang(found(that(50860%$of$J558µm3#expressing)Cx43T154A)formed)polarized*protrusions*in*four*additional*independent%experiments,%data$not$shown).#!! ! 76! Cx 43 T1 54 A) ))) ))) ))) ))) ))) ))) ))) )C x4 3) ))) ))) ))) ))) ))) ))) ))) ))) ))) ))) EG FP ) J558μm3+EGFP))))J558μm3+Cx43))))))))J558μm3+Cx43T154A) J558μm3+EGFP))))J558μm3+Cx43))))))))J558μm3+Cx43T154A) J558μm3+EGFP))))J558μm3+Cx43))))))))J558μm3+Cx43T154A) !!!!!!!!!!!!!!!!! Figure!3.6!Spreading!of!J558µm3!cells!expressing!Cx43T154A.!!A)!Confocal!images!taken!of!the!contact!between!cells!and!anti8IgM!coated!coverslips.!Green=WT!or!mutant!T154A!Cx438EGFP,!red=rhodamine!phalloidin!stained!actin,!yellow=merge.!Scale!bars!represent!10! µm.!B)!Quantification!of!the!contact!area!between!the!cells!and!the!coverslip.!!C)!Percentage!of!cells!exhibiting!a!non8radial!spreading!phenotype!(arrows#shown!in!A).!Protrusions!were!considered!if!they!exceeded!a!minimum!length!of!half!the!cell!diameter.!D)!Non8radial!spreading!was!also!quantified!by!a!roundness!measurement!(length/width)!1=round,!>1=non8round.!Error!bars!represent!standard!error!of!the!mean.!Data!is!representative!of!five!independent!replicates!in!which!>100!cells!were!counted!per!sample.!Asterix!(*)!denotes!significant!difference!between!cell!types!as!compared!to!EGFP8expression!alone!as!determined!by!P8value!<0.05!by!a!student’s!two8tailed,!unpaired!t8test!calculated!by!Excel.! *!!*!!*!!!*! !!*!!!!*! *!!*! ! 77! Cx43T154A8expressing)J558µm3#cells#were#on#average,#significantly#less!round&than!Cx438!or#EGFP8expressing)cells)as)determined!by#length/width#ratio#(Figure#3.6#D).#Since#this#assay$!was$performed$on$glass$coated$coverslips,$as#opposed#to#on#a"monolayer"of"cells!with%which%the$J558µm3!cells%could%form%GJs%with,%this%suggests%that%this%B8cell$spreading!phenotype!depends&upon&either&a&molecule&transported*through*HCs*(as#opposed#to#GJs),"or"is"due"to"a"region'of'Cx43'that'may'be'altered'structurally'by'the'Cx43T154A"mutation.! ! 3.1.7!!Cx43T154A!had!a!dominant!negative!effect!on!BCRLmediated!BL!cell!spreading!in! a!BLcell!line:!Wehi231! !Evidence(from(the(literature(suggests"that"T154A&mutated&Cx43&can&have&dominant8negative!(DN)%affects!by#forming#heteromeric#channels#with#WT#Cxs#and#interfering#with#normal#functions.*Cx37T154A!blocks'GJ!communication(by(forming(heteromeric!channels(with(Cx43$and$presumably$with$WTCx37%(Good$et$al.,$2011)."Interestingly,"Cx37T154A&also&causes&cell&cycle%arrest%in!a!DN#fashion;#a#process#that#depends#on#Cx37#binding#to#cell#cycle#regulatory#machinery,+not+GJ#communication#(Good$et$al.,$2011)."The"authors"hypothesize"that"the"Cx43T154A)mutation)changes)the)configuration)of)Cx37)such)that)interaction)with)adaptor)proteins)is"no"longer"possible,"and"suggesting"that"Cx43T154A"may!have%affects%not%exclusively*due*to*its*channel8blocking)properties.!!!!In#order#to#determine#if#Cx43T154A#can#act#as#a#DN#when#interacting#with#WT#Cx43#proteins#in#B8cells,&Wehi231&cells&(which&express"endogenous"Cx43)"were"transduced"with"Cx43T154A"and$sorted$for$EGFP$expression$as$described$previously$(Chapters$2.3.2$and$2.5).$Wehi231$! ! 78! !!!!!!!!!!!!!! ! ! ! ! ! ! ! ! Figure'3.7'Cx43T154A!acts!as!a!dominant!negative!of!BCRLmediated!cell!spreading!in! Wehi231.!A)!Images!of!the!contact!site!between!cells!and!anti8IgM!(BCR)!coated!coverslips!taken!on!an!Olympus!Fluoview!1000!confocal!microscope.!Green=EGFP8fused!WT!Cx43!or!Cx43T154A!red=rhodamine!phalloidin!stained!actin;!merge!=!yellow.!!Scale!bars!represent!20! µm.!B)!Quantification!of!contact!area!between!the!cells!and!the!anti8BCR!coated!coverslip.!Error!bars!indicate!standard!error!of!the!mean.!Data!is!representative!of!three!independent!replicates!in!which!>100!cells!were!quantified!per!sample.!Asterixes!(*)!denote!significant!difference!between!cell!types!compared!to!untransfected!cells!as!determined!by!P8value!<0.05!by!a!student’s!two8tailed,!unpaired!t8test!calculated!by!Excel.!Double!asterix!(**)!indicates!significant!increase!in!contact!area,!as!compared!to!decrease!(*).# 0 50 100 150 200 250 300 350 400 450 500 Wehi Wehi+Cx43 Wehi+T154A M ea n  C o n ta ct  A re a (µ m 2 )  0 min 30 min 120 min B! 0! m in  30 !m in  A! !!!!!!!!!Wehi231!!!!!!!!!!!!!!!!!!!!!!!!!!Wehi231+Cx43!!!!!!!!!!!!!!Wehi231+Cx43T154A! Wehi231!!!!!!!!!!!!!!!!!!!Wehi231+Cx43!!!!!!!!!!Wehi+Cx43T154A! *!*! !**! ! 79! !cells%un8transduced*or*expressing*WT*Cx43*spread*on*anti8IgM$coated$glass$coverslips$(Figure(3.7).(However,(Wehi231(cells(expressing(Cx43T154A(were(inhibited(from(spreading,(!and$thus$the$mutated$Cx43$acted$as$a$DN$and"prevented!B"cell"spreading.!While&some&(~5%)&of#cells#exhibited#protruberances#at#30#and#120#min#time#points,#roundness#was#not#quantified*due*to*insufficient*numbers*of*cells*exhibiting*this*phenotype*as*compared*to*J558µm3#cells#(Figure#3.6).#We#next#consider(the(mechanism(by(which(this(mutation(influences)Cx43’s)effect)on)BCR8mediated'cell'spreading.''!! 3.1.8%!Rap1%activation%is%required%for%Cx43’s%affect%on%BCRLmediated'spreading)in)the) J558µm3'BLcell$line$and$is$impeded"by"expression"of"Cx43T154A&! !Rap1%is!a"GTPase!responsible*for*regulating*cytoskeletal*rearrangement*involved*in*processes*such%as%spreading%in%B8cells%(Lin$et$al.,$2009)."We"have"previously"shown"that"Cx43"is"important)for)Rap1)activation,)and)in)particular,)that)expression)of)the#Cx43Δ246!mutation!reduced&the&length&of&time&that&Rap1!remains(activated(following(BCR(or(chemokine$stimulation*(Machtaler)et)al.,)2011).""While"Cx43"is"required"for"sustained"Rap1!activation,)we)could&not&be&certain(that!Cx43’s'role'in'sustaining'BCR8mediated!Rap1!activation(leads&to&the$spreading*seen*in*Cx43*overexpressing8transduced!cells."Spreading*of*J558µm3!cells!forced'to'express&Cx43!is#still#much#lower#in#magnitude#than#Wehi231#or#A20#cells,"both"of!which%express!Cx43%endogenously.%!!! ! 80! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! ! Figure'3.8!Rap1%activation%is%important%for%BCRLmediated'spreading'in'J558µm3' plasmacytoma*cells.!BCR8mediated'cell'spreading'of'A)'J558μm3!transiently!transfected!with!constitutively!active!Rap!(Rap1V128FLAG)!or!B)!J558μm3+Cx438EGFP!transiently!transfected!with!RapGAPII8FLAG,!which!causes!conversion!of!Rap1!into!its!inactive,!GDP8bound!form.!Expression!of!Rap!constructs!was!verified!by!anti8FLAG!staining!using!an!Olympus!Fluoview!1000!confocal!microscope!using!the!60x!objective.!Red=rhodamine!phalloidin!staining!of!actin;!green=Alexa488!α8FLAG!stained!Rap1V12!(merge=yellow);!blue=Alexa405!α8FLAG!stained!RapGAPII!(merge=white).!Contact!area!between!the!cell!and!anti8IgM!(BCR)!coated!coverslip!was!quantified!(C!and!D).!Error!bars!represent!standard!error!of!the!means.!Scale!bars!represent!10!µm.!Data!representative!of!three!independent!replicates.!Asterix!(*)!denotes!significant!difference!between!cell!types!as!determined!by!P8value!<0.05!by!a!student’s!two8tailed,!unpaired!t8test!calculated!by!Excel.! J558μm3+Rap1V12..............J558μm3. . J558μm3+RapGAPII//////////////J558μm3/ / *! *! ! 81! !To#confirm#that!Cx43%expression%influences%spreading%through%Rap%activation,%rather%than%by%increasing)contact)area)non8specifically,"J558µm3!cells%stably'expressing'Cx43'were$transiently*transfected*with*FLAG8tagged&RapGAPII&which&coverts&Rap1!into%its%inactive,%GDP8bound&form&(McLeod(et(al.,(2002b)."FLAG8tagged&RapGAPII&positive&cells&were&stained&with&!anti8FLAG%and%did#not#spread,(indicating(that(the(BCR8mediated!spreading*response!of#J558µm3'cells'expressing'Cx43'depends'on!Rap1!activation((Figure%3.8%B).#In#addition,!expression)of#a#FLAG8tagged&Rap1V12,&a&constitutively&active!form%of%Rap1%(McLeod'et'al.,'2002b),"caused"J558µm3"cells"to"spread"to"a"similar"magnitude%as%the%spreading%caused%by%Cx43%expression%(Figure%3.8%A).#! !Since!Rap1!activation!is!involved!in!BCR8mediated!spreading,!we!hypothesized!that!the!impaired!spreading!phenotype!exhibited!by!B8cells!expressing!Cx43T154A!may!be!a!result!of!altered!Rap1!activation,!as!is!the!case!with!Cx43!mutant!Δ246!(Machtaler!et!al.,!2011).!A!Rap1!activation!assay!was!performed!as!described!in!Chapter!2.4.6!on!J558µm3!cells!expressing!EGFP,!Cx43,!or!Cx43T154A.!In!contrast!to!Cx438expressing!J558µm3,!which!showed!sustained!Rap1!activation!up!to!30!min,!Cx43T154A!or!EGFP8expressing!J558µm3!had!a!reduced!level!of!active!Rap1!at!the!15!min!time8point!and!almost!no!Rap1!activation!after!30!min!(Figure!3.9).!!!!! ! 82! !!!!!!!!!!!!!!!!!! ! ! Figure!3.9!Rap1!activation!in!the!J558µm3!BLcell!line!is!less!sustained!when!expressing! Cx43T154A.!Rap1!activation!in!J558µm3!cells!expressing!EGFP,!Cx438EGFP!or!Cx43T154A8EGFP.!Cells!were!stimulated!for!the!indicated!times!with!20!µg/ml!of!α8IgM!(BCR)!and!activated!Rap1!was!precipitated!using!a!GST8RalGDS!fusion!protein!and!total!Rap1!detected!by!blotting!with!α8Rap!(for!detailed!method!see!Chapter!2.4.6).!Blot!is!representative!of!three!independent!replicates.!(Data#by#May#DangNLawson).!!!!! 0"""5"""15""30"""""0"""5""15"""30"""""0"""5""15"""30""" J558µm3 EGFP+ J558µm3++ Cx43T154A2EGFP+ J558µm3++ Cx432EGFP+ 21"kDa" 21"kDa" IP:+Rap1+ Total+Rap1+ 0"""5"""15""30"""""0"""5""15"""30"""""0"""5""15"""30""" J558µm3 EGFP+ J558µm3++ Cx43T154A2EGFP+ J558µm3++ Cx432EGFP+ 21"kDa" 21"kDa" IP:+Rap1+ Total+Rap1+ 0"""5"""15""30"""""0"""5""15"""30"""""0"""5""15"""30""" J558µm3 EGFP+ J558µm3++ Cx43T154A2EGFP+ J558µm3++ Cx432EGFP+ 21"kDa" 21"kDa" IP:+Rap1+ Total+Rap1+ J μ ' +EGFP' J 58μm3' +Cx43' J μ ' +Cx43T154A' !me$(min)$a*er$$ !$s!mula!on$with$α4IgM$ M ol ec ul ar )W ei gh t)( kD a) ' ! 83! Cx43!influences!Rap1!activation!downstream!of!BCR!crosslinking!but!it!is!not!clear!how.!Both!truncation!of!the!CT!tail!(Cx43Δ246)!and!point!mutation!(Cx43T154A)!that!could!cause!permanently!closed!Cx43!channels!resulted!in!a!similar!phenotype:!decreased!Rap1!activation!at!15!and!30!min!after!BCR!stimulation,!and!impaired!spreading!in!response!to!BCR!crosslinking.!One!possibility!is!that!Cx43!influences!B8cell!spreading!and!the!activation!of!Rap1!through!channel!activity!by!allowing!entry!or!exit!of!some!small!molecule!or!ion!essential!for!BCR!signaling!or!cytoskeletal!rearrangement,!and!that!the!CT!region!of!Cx43!is!important!for!regulating!HC!gating.!The!CT!tail!contains!sites!for!phosphorylation!which!controls!Cx43!trafficking,!GJ!assembly,!conductance,!and!GJ!turnover!(Shin!et!al.,!2001;!Solan!and!Lampe,!2009a).!!The!CT!tail!also!contains!binding!sites!for!proteins!that!regulate!GJ!conductance!(Lampe!and!Lau,!2004;!Lin!et!al.,!2001b;!Solan!and!Lampe,!2009a),!and!may!be!able!to!conformation!ally!interact!with!other!regions!of!the!Cx43!protein.!For!example,!the#CT#has$been$proposed$to$influence$GJ$channel8gating&by&binding&the&intracellular&loop&(Ponsaerts)et#al.,#2010).!It!remains!to!be!determined!whether!the!CT!tail!regulates!HCs!as!it!does!GJ!channels.!!!!A!second!possibility!is!that!the!CT!of!Cx43!acts!as!a!binding!site!for!interactions!with!proteins!either!involved!in!the!propagation!of!BCR!signaling!or!cytoskeletal!rearrangement.!It!is!possible!that!the!point!mutation!Cx43T154A!causes!a!conformational!change!to!the!Cx43!structure!specifically!to!the!tail.!To!investigate!this!possibility!we!used!two!approaches:!One!was!to!create!a!Cx43!mutant!with!both!the!Cx43T154A!point!mutation!and!truncation!of!the!cytoplasmic!CT!tail!(Cx43T154AΔ246),!and!the!second!was!to!pharmacologically!block!the!channel.! ! 84! !!!!!!!!!!!!! ! ! ! ! ! ! ! ! ! ! ! ! ! Figure!3.10!Involvement!of!the!CT!in!nonLradial!spreading!phenotype!of!Cx43T154A! expressing!cells.!A)#Cell#spreading#on#α8IgM!(BCR)!coated'glass'coverslips.'Images'represent'cell$spreading$at$30$minutes.!One$representative$cell$is$enlarged$showing$the$protrusions$formed'by'cells'expressing'Cx43T154A8EGFP!(arrow)."Red=rhodamine"phalloidin"stained"actin.'Scale'bars'represent'10'µm.#B)!Quantification!of!the!contact!area!between!the!cells!and!the!coverslip.!Error!bars!represent!standard!error!of!the!mean.!C)!Percentage!of!cells!exhibiting!a!non8radial!spreading!phenotype!(arrow#shown!in!A).!Protrusions!were!counted!if!they!exceeded!a!minimum!length!of!half!the!cell!diameter.!D)!Western$blot$analysis'showing'the$expression$of$Cx43T154AΔ246!in#the#J558µm3#cell#line.#Membrane#was#stripped#and#re8probed'for'actin'as'a'loading'control.'Data'is'representative)of)three)independent)replicates!in!which!>100!cells!were!quantified!per!sample."Asterixes!(*)!denote!significant!difference!between!cell!types!compared!to!cells!expressing!WT!Cx43!as!determined!by!P8value!<0.05!by!a!student’s!two8tailed,!unpaired!t8test!calculated!by!Excel.!!(**)!denotes!significant!increase.!! +EGFP&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&+Cx43&&&&&&&&&&&&&&&&&&&&&&&&&&&&&+Cx43Δ246&&&&&&&&&&&&&&&&&&&&+Cx43T154A&&&&&&&&&&&&&&&&+Cx43T154AΔ246& J558μm3&&&&&&&&&&&&&&&&&&&&&&&&&J558μm3&&&&&&&&&&&&&&&&&&&&&&&&&&&J558μm3&&&&&&&&&&&&&&&&&&&&&&&&&J558μm3&&&&&&&&&&&&&&&&&&&&&&&&&&J558μm3& EGFP%%%%%%%%%%%%%%%Cx43%%%%%%%%%%%%Cx43Δ246%%%%%%%Cx43T154A%%%%Cx43T154A% %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%Δ246% EGFP%%%%%%%%%%%%%%%Cx43%%%%%%%%%%%%%%%Cx43Δ246%%%%%%%Cx43T154A%%%%%%Cx43T154A% %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%Δ246% J5 58 μm 3+ EG FP , , J5 58 μm 3+ Cx 43 , , J5 58 μm 3+ Cx 43 T1 54 A, , J5 58 μm 3+ Cx 43 T1 54 AΔ 24 6, , , *! !!!*! *! !*! !!!!**! *! !!*! *! ! 85! ! 3.1.9!!Removal!of!the!cytoplasmic!CT!tail!of!Cx43T154A!prevented!nonLradial!BLcell! spreading!completely! !A"single"round!of#site#directed#mutagenesis#using#the!EGFP8fused&Δ246!Cx43%construct%from%the$Dr.$Christian$Naus’!lab$(Bates$et$al$2007)"as#a#template#resulted#in#the#generation#of#Cx43#mutant&Cx43T154AΔ246$(Table$2.1).$Cx43T154AΔ246$was$introduced$into$J558µm3$cells,$which%were%infected%with%supernatant%collected%from%the%retroviral%packaging%cell%line%BOSC23.(Populations(of(Cx43T154AΔ2468EGFP%expressing%cells%were%selected%for%EGFP%expression)by)FACS)sorting)and)periodically!re8sorted&to&maintain&high&levels&of"Cx43T154AΔ2468EGFP!expression."Expression*was*confirmed&by&western&blotting&(Figure&3.10%D).! #J558µm3$cells%expressing)Cx43T154AΔ246!did#not#spread&and&appeared&similar&to!cells%expressing)either&Cx43Δ246!or#EGFP#alone#(Figure#3.10#B#and#C).#This#confirmed#that#BCR8mediated'spreading'was'dependent'on'the'Cx43'cytoplasmic!CT!tail%and%that%the%non8radial&spreading*phenotype*of*cells*expressing*Cx43T154A&was&not!a"result"of"closed"HCs"alone,"but"must%be%caused"either"by"involvement)of)the)tail)in)HC)gating!or#disruption#of#a#tail#domain#caused'by'this'upstream'mutation.'!! ! ! ! ! 86! 3.1.10!!Preliminary!experiments!to!test!the!effect!of!Cx43T154A!on!BLcell!migration! !BCR8mediated!spreading!was!used!as!a!readout!for!B8cell!processes!that!rely!on!reorganization!of!the!cytoskeleton!in!general.!B8cell!migration!involves!a!polarized!breakdown!of!the!existing!actin!cytoskeleton!to!generate!a!leading!front!and!formation!of!the!lamellopodia!(Ridley!et!al.,!2003).!This!process!has!many!similarities!to!as!those!controlling!B8cell!spreading.!Many!of!the!same!players!become!activated!by!signaling!initiated!by!integrin!engagement!and!by!BCR!stimulation,!such!as!the!master!cytoskeletal!regulator!Rap1!(Lin!et!al.,!2010).!!!!Cx43!expression!as!been!shown!to!affect!the!migration!of!neural!crest!cells,!epithelial!cell,!fibroblasts,!neural!cell!types,!and!B8cells,!and!appears!to!do!so!through!influencing!cytoskeletal!organization!and!cell!polarity!(for!review!see!(Matsuuchi!and!Naus,!2012)).!The!intermediate!non8radial!spreading!phenotype!exhibited!by!J558µm3!cells!expressing!Cx43T154A!suggests!that!Cx43!may!influence!polarity!of!B8cells!as!well.!!!EGFP8fused!Cx43T154A!co8localized!with!actin!in!the!protrusions!formed!by!B8cells!spreading!non8radially!on!anti8BCR!coated!glass!(Figure!3.6!A!arrows).!Cx43T154A!localization!was!predictive!of!the!dominant!branch!of!the!bifurcated!leading!edge!of!neurons!migrating!along!radial!glia!(Elias!et!al.,!2007),!suggesting!that!Cx43T154A!may!have!affects!on!cell!polarity.!It!would!be!interesting!to!determine!whether!B8cell!expressing!Cx43!mutant!Cx43T154A!would!exhibit!defects!in!directional!migration,!in!addition!to!BCR8mediated!spreading.!! ! 87! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! ! ! Figure!3.11!Preliminary!experiments!for!testing!the!effect!of!Cx43T154A!on!BLcell! migration.!Three!different!B8cell!lines!(A20,!Wehi231,!and!J558µm3)!were!compared!in!the!presence!and!absence!of!chemokine!SDF81!(CXCL12),!A)!Fluorescence!microscopy!showing! tracks!made!my!migrating!cells.!Red=rhodamine!phalloidin!stained!cells!(actin),!blue=FluoroSpheres!(Molecular!Probes).!Scale!bars!represent!30!µm.!Error!bars!represent!standard!error!of!the!means.!Data!is!representative!of!two!pilot!experiments.!B)!Mean!distance!was!quantified!and!asterixes!(*)!denote!significant!difference!between!untreated!and!SDF81!treatment!as!determined!by!P8value!<0.05!by!a!student’s!two8tailed,!unpaired!t8test!calculated!by!Excel.!!C)!Rap1!activation!in!J558µm3!cells!expressing!EGFP,!Cx438EGFP!or!T154A!Cx438EGFP!(see!Chapter!2.4.6).!Cells!were!stimulated!for!the!indicated!times!with!100ng/ml!SDF81/CXCL12.!Data!is!representative!of!three!independent!replicates.!! !!!!!!!!A20!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Wehi231!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!J558.um3! SDF41! A20""""""""""""""""""""""""""""""""""""""""Wehi231"""""""""""""""""""""""""""""""""""""J558µm3" 0" 100" 200" 300" 400" 500" 600" A20"" Wehi" J558.um3" M ea n% Le ng th %(u m )% SDF61" A20!!!!!!!!!!!!!!!!Wehi231!!!!!!!!!!!!!!J558µm3! M ea n" Di st an ce "µ m 2 " A" B" C" 0"""5"""15""30"""""0"""5""15"""30"""""0"""5""15"""30""" J558µm3 EGFP+ J558µm3++ Cx43T154A2EGFP+ J558µm3++ Cx432EGFP+ 21"kDa" 21"kDa" IP:+Rap1+ Total+Rap1+ 0"""5"""15""30"""""0"""5""15"""30"""""0"""5""15"""30""" J558µm3 EGFP+ J558µm3++ Cx43T154A2EGFP+ J558µm3++ Cx432EGFP+ 21"kDa" 21"kDa" IP:+Rap1+ Total+Rap1+ 0"""5"""15""30"""""0"""5""15"""30"""""0"""5""15"""30""" J558µm3 EGFP+ J558µm3++ Cx43T154A2EGFP+ J558µm3++ Cx432EGFP+ 21"kDa" 21"kDa" IP:+Rap1+ Total+Rap1+ J μ ' +EGFP' J 58μm3' +Cx43' J558μ 3' +Cx43T154A' !me$(min)$a*er$$ !$s!mula!on$with$ SDF61$ M ol ec ul ar )W ei gh t)( kD a) ' 0" 5" 15" 30" 0" 5" 15" 30" 0" 5" 15" 30" J558µm3 EGFP+ µm + Cx43T154A2EGFP+ J558µm3+ Cx432EGFP+ 21"kDa" 21"kDa" IP:+Rap1+ Total+Rap1+ *! ! 88! !Our!lab!has!previously!shown!that!Cx43!expression!increases!B8cell!adhesion,!spreading,!and!migration!(Machtaler!et!al.,!2011).!Migration!was!measured!using!two!different!assays:!firstly!a!two8dimensional!bead8clearing!assay!(see!Chapter!2.6.5),!and!secondly!a!transwell!assay!that!mimics!transmigration!and!measures!migration!of!cells!across!an!endothelial!monolayer,!towards!a!chemokine!source.!We!have!yet!to!look!at!the!role!of!Cx43!on!B8cell!polarization!or!at!directional!migration!towards!a!chemokine!source.!!!!Cx43!expression!improves!the!activation!of!Rap1!in!response!to!stimulation!of!the!BCR,!integrin!LFA81,!and!also!chemokine!SDF81/CXCL12!(Machtaler!et!al.,!2011).!!Cx43T154A!may!be!expected!to!cause!defects!in!directional!migration!since!expression!of!Cx43T154A!resulted!in!less!Rap1!activation!than!expression!of!WT!Cx43!by!J558µm3!cells!(Figure!3.11!A).!!Although!J558µm3!cells!made!an!excellent!GOF!system!to!study!the!importance!of!Cx43!in!BCR8mediated!B8cell!spreading,!plasmacytoma!cells!are!derived!from!highly!specialized!antibody8secreting!plasma!cells!that!have!lost!much!of!their!ability!to!interact!with!cells!and!extracellular!matrix!and!do!not!perform!well!in!migration!assays!in#vitro.!Since!Cx43T154A!had!a!DN!effect!on!WT!Cx43!function!in!BCR8mediated!cell!spreading!(Chapter!3.1.7),!B8cell!lines!with!endogenous!expression!may!be!used!as!alternatives!to!this!cell!line.!!!In!order!to!determine!the!best!cell!line!to!use!in!a!study!of!the!effect!of!Cx43T154A!on!B8cell!migration,!three!different!cell!lines!were!compared!for!their!ability!to!migrate!and!their!responsiveness!to!SDF81.!The!A20!mouse!B8cell!lymphoma!line!migrated!the!furthest!distance!and!was!the!most!responsive!to!SDF81!out!of!the!cell!lines!tested!(Figure!3.11!A!and!B).!The! ! 89! response!of!A20!in!this!assay!makes!them!the!best!choice!for!investigating!the!effect!of!Cx43T154A!in!the!future.!!! Chapter!3.1!in!summary! !Our!finding!that!Cx43!was!important!for!BCR8mediated!B8cell!spreading!through!a!non8channel!mechanism!is!consistent!with!a!growing!list!of!non8channel!functions!of!the!Cx!proteins.!We!developed!a!dye8uptake!assay!of!HC!activity!and!showed!that!B8cells!did!not!form!HCs!unless!Cx43!was!overexpressed!(Section!3.1.2),!and!that!blocking!HC!activity,!using!drugs!had!no!effect!on!BCR8mediated!B8cell!spreading!(Section!3.1.3).!In!addition,!we!predicted!that!the!commonly!used!closed8channel!mutant!Cx43T154A!may!result!in!conformational!changes!to!Cx43,!that!affect!the!CT!domain!particularly,!in!light!of!the!necessity!of!this!region!for!the!production!of!non8radial!projections!on!anti8BCR!coated!glass!by!expression!of!Cx43T154A!(Section!3.1.9).!!!Because!of!the!importance!of!the!CT!tail!in!Cx43’s!influence!on!BCR8mediated!B8cell!spreading,!as!shown!by!both!Cx43Δ246!and!Cx43T514AΔ246!mutations,!we!next!turned!our!attention!to!investigating!the!specific!region!responsible!for!the!importance!of!this!domain.!A!more!detailed!investigation!of!this!region!through!mutation!of!specific!residues!will!hopefully!allow!us!to!understand!Cx43’s!effect!on!cytoskeletal!organization!in!B8cell!processes!that!are!important!for!their!immune!function!and!contribute!to!an!understanding!of!Cx43’s!non8channel!functions!in!general.!!! ! 90! 3.2!!!!!The!importance!of!tyrosine!265!of!the!Cx43!cytoplasmic!CT!tail!for! !!!!!!!!!!!!BLlymphocyte!spreading! ! 3.2.1!!Rationale!!Cx43%is!phosphorylated,in,response,to!BCR$stimulation%(Guan&et"al.,"1996;"Machtaler"et"al.,"2011),"but"in"this!system&it&is&unclear&if&the&phosphorylation,occurs,on,serine,,threonine,,tyrosine)residues)or#on#all#three.""Over"the"past"15"years,"the"Cx43"literature"has"discussed"the$importance+of+both+forms+of+phosphorylation,-in-particular-in-the-role-of-these-modified-amino&acids&as&potential&binding!sites%for%other%proteins%(Hervé&et&al.,&2004;"Palatinus)et)al.,)2012;"Shin%et%al.,%2001),"in#regulating*GJ*formation!(Shin%et%al.,%2001;%Solan%and%Lampe,%2009a),!or#in#gating#channel#function#(Lampe'and'Lau,'2004;'Lin'et'al.,'2001a;'Solan'and'Lampe,'2009a)."Given&Steve&Machtaler’s&previous&work&in&the&lab&showing!the$importance$of$the$Cx43!CT#tail#for#BCR8mediated'spreading,'cell'adhesion'and'migration,'as'well'as'the'lab’s'historical!interest'in'the'importance'of'tyrosine'phosphorylation'of'the'BCR'itself'and'downstream+targets,+we+first+explored+the+importance!of#tyrosine%phosphorylation%of%the%Cx43%tail.!!The$Cx43$cytoplasmic!CT!tail%contains%two%tyrosine%residues%that%could%serve%as"docking"sites"for$the$Src8family"protein"kinases,!and$potentially$phosphorylated$them:!tyrosine)247)(Y247))and$tyrosine$265$(Y265)$(Giepmans"et"al.,"2001)."Src"kinase"activity"is"required"for"Src"binding&to&Cx43&as&measured&by&Co8IP,$and$the$presence$of$active$Src$is$required$for$Y265$phosphorylation,in#vitro!(Giepmans)et)al.,)2001),"therefore!it#seemed#likely#that#Src#kinase#or# ! 91! a"Src"kinase"family"member%was%responsible%for%some%Cx43%phosphorylation!and$its$subsequent(ability(to(interact(with(Src.(A!model&of&Src&kinase!interaction$with$Cx43$has$been$proposed!by#Lin#et#al#(Lin$et$al.,$2001b)."In"this"model,"the$SH3!domain'of'Src!kinase'binds'to'a'proline8rich%region%of%the%Cx43%tail!(located)between)aa)2748283),"giving"it"the"proximity"to"phosphorylate+Y265.+Following&phosphorylation,&Src&could&bind!Y265%through%its%SH2%domain,(facilitating)subsequent)phosphorylation)of!Y247.&These&phosphorylation&steps&are$proposed'to'lead%to%closure%of%GJ#channels!(Lin$et$al.,$2001b).""!!!It#remains!unclear!however,!if#Cx43#phosphorylation,is,important,in!B8cells.&Considering!our$lab’s&previous&finding&that&the$phosphorylation$of$Cx43!is#a#target#of#BCR#signaling#(Machtaler)et#al.,#2011),!we"are"interested"in"the$Cx43%phosphorylation!and$its$possible$role$in$regulating$$the$effect$of$Cx43$expression$on$B8cell$spreading.!This%would&make&sense&if&the&phosphorylated,residues,served,as,binding,sites,for,cytoskeletal,adaptors,or,other,proteins,involved(in(regulating(cell(shape(and(movement.(Based(upon(historically(well8documented)studies!of!Cx43’s'protein8protein(interactions!(Hervé&et&al.,&2004),!we#decided#to#focus#on#the#proposed!Src$kinase$phosphorylation/binding&site!of#Cx43:#Y265#in#our#first#detailed#look#at#the#function#of#the#Cx43#tail.#!!Tyrosine)phosphorylation)is)an)initial%step%in%propagating%signaling%after%BCR%stimulation,!and!downstream+signaling%activates%Src%kinase%family%members%Lyn,%Fyn,%Blk%and%Lck%in%B8cells"(for#review,#see#(Defranco,*1997))."Src$family$kinases$activated$by$the$BCR$may$be$responsible$for$the!Cx43%phosphorylation%in%response%to%BCR!stimulation.!Activation(of(Src(or(Src(kinase( ! 92! family'members'expressed'by'B8cells%could&link%the%influence%that%Cx43%has$on$BCR8mediated'spreading(with!Cx43%phosphorylation!downstream+of+BCR+stimulation.!!!!To#explore#this!possibility,"we"took"two"approaches,"first,"to"make"mutations"in"the"tyrosines"in#the#tail#of#Cx43#and#see#if#this#point#mutation#affected#J558μm3!responses'in#one#of#our#assays$of!cytoskeletal*rearrangements.!Second,!we#used#biochemical#methods#including#phospho8tyrosine8specific'antibodies!to#see#if#BCR#stimulation)resulted)in)phosphorylated)tyrosine)(pY))on)either&the$endogenous$Cx43$expressed$by$Wehi231$B8lymphoma(cells!or#Cx438EGFP%overexpressed%by!J558μm3.!We!then!determined!if!mutation!of!an!important!tyrosine!residue!in!the!Cx43!CT!tail!affected!the!phosphatase!sensitive!Cx43!band8shift!in!response!to!BCR!stimulation.!! 3.2.2!!Expression!of!Cx43!cytoplasmic!CT!tail!mutants!in!a!BLcell!line:!J558µm3!!Y265%was%targeted!because'of'its'proposed'role'in'Src'kinase'binding'as'a'prerequisite'for'Y247%phosphorylation,(Lin$et$al.,$2001a)."Tyrosine"265"was$substituted$with$either$phenylalanine)(F)!or"aspartic"acid"(D)"(Figure"3.12!A)"by"site"directed"mutagenesis!(Chapter)2.2.6)!using&primer&pairs!(Table'2.1)!containing#a#single#base8pair%substitution%to%mutate!WT#Cx438EGFP%in%plasmid%NAP2%(Bates&et&al.,&2007)!as!a"template"for"mutagenesis.""""!!Cx43Y265F*(F=*phenylalanine*in*single*aa*code)*tagged*with*EGFP*and*Cx43Y265D*(D=*aspartic(acid(in(single'aa'code)'tagged'with'EGFP'were'introduced'into'the'J558µm3'cell'line'which%lacks%endogenous%Cx43%expression%and%which%had%previously!been$transfected$with$the$BCR$(Dylke&et&al.,&2007).""Cells!were$infected$with$supernatant$collected$from$the$retroviral$! ! 93! !!!!!!!!!!!!!!!!! ! ! ! ! ! Figure!3.12!Characterization!of!J558µm3!cells!expressing!Cx43Y265F!and!Cx43Y265D.!A)!Schematic!showing!point!mutation!of!tyrosine!265;!one!of!two!potential!pY!sites!in!the!CT.!B)!Western!blot!showing!expression!of!Cx43Y265F!and!Cx43Y265D!in!the!J558μm3!cell!line!stably!transduced!by!retroviral!infection!(Blot!was!stripped!and!re8probed!for!actin!as!a!loading!control).!C)!Localization!of!EGFP8fused!Cx43Y265F!and!Cx43Y265D!at!the!plasma!membrane!of!J558µm3!cells!viewed!using!an!Olympus!Fluoview!1000!confocal!microscope!using!a!60x!objective!(enlarged!image!shown!on!the!left).!Green=mutant!Cx438EGFP,!blue=DAPI!stained!nuclei.!Scale!bars!represent!10!µm.!Data!shown!is!representative!of!three!experiments.! Cx 43 Y2 65 D* Cx 43 Y2 65 F* 75#kDa'# 50#kDa'# 37#kDa'# A2 0# J5 58 μm 3+ GF P# J5 58 μm 3+ Cx 43 # J5 58 μm 3+ Y2 65 F# J5 58 μm 3+ Y2 65 D# 50#kDa'# α"Cx43' α"ac*n' Cx43Y265F*EGFP* DAPI* 1* N" C" Y265F/D( GFP$ COOH$Y$!!!!!!!!!!!Y! 247$$$$$$$$$265$ COOH$Y$$$$$$$$$$$!F! COOH$Y$$$$$$$$$$$!D! Cx43* 10*μm* A1 B1 C1 75#kDa'# 50#kDa'# 37#kDa'# A2 0# J5 58 μm 3+ GF P# J5 58 μm 3+ Cx 43 # J5 58 μm 3+ Y2 65 F# J5 58 μm 3+ Y2 65 D# 50#kDa'# α"Cx43' α"ac*n' M ol ec ul ar 1W ei gh t1( kD a) * Cx43Y265D*EGFP* DAPI* 1* 10*μm* ! 94! packaging(cell(line(BOSC(23!(Chapter)2.3.2).""Populations+of+Cx43Y265F+or+Cx43Y265D!expressing)cells#were#selected#by#isolating!EGFP+!cells!by#FACS#sorting!(Chapter)2.5).)Populations+were+periodically+re8sorted!to!maintain&high&levels&of&Cx43&expression.**Expression*was*confirmed*by*western&blot&analysis&(Figure&3.12!B).!!Expression*of*tyrosine*mutants*has*been*used*to*study*tyrosine*phosphorylation*in*the*literature((Lin$et$al.,$2001a)."While&Cx43Y265F"has!been$shown$to$prevent$GJ$conductance,$it$did#not#disrupt#the#assembly#of#Cx43#into#GJ#plaques#based#on#localization#by#immunofluorescence,(Lin$et$al.,$2001a)."Expression*of!mutants'Cx43Y265F&and&Cx43Y265D&on#the#plasma#membrane#of#J558µm3!was$verified$by$confocal$microscopy$via$fused$EGFP$tag$(Figure'3.12!C),"which"we"found"to"accurately"predict"surface"expression"by"biotinylation"(Chapter)3.1.2).! ! 3.2.3!!Phosphorylation!of!Cx43!in!response!to!BCRLsignaling!!While!the!apparent!increase!in!molecular!weight!of!Cx43!in!response!to!BCR!stimulation!was!not!due!to!phosphorylation!of!Cx43!tyrosine!residues!(Section!3.1.5),!It!remains!possible!that!Y265!structurally!affects!Cx43!CT!tail!conformation!and!influences!the!availability!of!other!sites!for!phosphorylation.!To!determine!the!importance!of!Cx43!residue!Y265!for!BCR8!mediated!phosphorylation!of!Cx43,!J558µm3!cells!expressing!these!mutants!were!stimulated!with!anti8IgM!and!then!analyzed!by!SDS8PAGE!and!western!blot!(Chapter!2.4.2)!to!look!for!Cx43!band8shift.!Mutation!of!Cx43Y265!did!not!abrogate!BCR8mediated!band8shift!(Figure!3.13),!suggesting!that!the!importance!of!Y265!for!BCR8mediated!spreading!can!be!accounted!! ! 95! !!!!!!!!!!!!!!! Figure!3.13!Mutation!of!Cx43!residue!Y265!does!not!prevent!bandLshift!in!response!to! BCR!stimulation.!Western!blot!showing!a!phosphate8specific!shift!in!Cx43!molecular!weight!in!response!to!stimulation!with!20!µg/ml!of!α8IgM!(BCR)!for!the!time8course!shown.!Cx43!band!shift!was!abrogated!by!treatment!of!samples!with!3!units/30!µg!calf!intestinal!phosphatase!(CIP).!Membrane!was!stripped!and!re8probed!for!actin!as!a!loading!control.!Data!shows!one!pilot!experiment.!!!!for!by!a!mechanism!other!than!phosphorylation,!or!that!the!phosphorylation!of!Cx43Y265!is!at!too!low!a!level!or!is!too!transient!to!be!detected!by!our!methods.!Possible!reasons!why!phosphorylated!Y265!may!not!have!been!detected!even!if!it!was!present!will!be!discussed!in!Chapter!4.!Another!possibility!is!that!the!phosphatase8sensitive!Cx43!band!shift!was!caused!by!phosphorylation!of!serine!or!threonine!residues.!The!lysates!of!J558µm3!cells!expressing!Cx43!will!be!shipped!to!the!laboratory!of!Dr.!Paul!Lampe!(Fred!Hutchinson!Cancer!Research!Centre,!Seattle)!for!western!blotting!and!detection!using!precious!monoclonal!serine8specific!anti8Cx43!antibodies.!!! # 0""""5""""30""""60""""0""""5""""30""""60" CIP$ 63"kDa")" 48"kDa")" 48"kDa")" 35"kDa")" α&Cx43$ α&ac,n$ 0""""5""""30""""60""""0""""5""""30""""60" CIP$ 63"kDa")" 48"kDa")" 48"kDa")" 35"kDa")" α&Cx43$ α&ac,n$ !me$(min)$a*er$$ !$s!mula!on$with$α4IgM$0""""5" 30" 60""""0""""5" 30" ""60" CIP$ 63"kDa")" 48"kDa")" 48"kDa")" 35"kDa")" α&Cx43$ α&ac,n$ M ol ec ul ar )W ei gh t)( kD a) ! ! 96! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Figure!3.14!Tyrosine!phosphorylation!is!not!responsible!for!Cx43!bandLshift!in! response!to!BCR!signaling.!A)!Schematic!of!Cx43!CT!showing!potential!tyrosine!phosphorylation!sites!and!specificity!of!antibodies!used!in!western!blot!analysis!of!Wehi231!or!J558µm3+Cx438EGFP!cells!stimulated!with!soluble!α8IgM!(BCR).!Cells!were!lysed!after!stimulation!and!either!immunoprecipitated!with!α8Cx43!(Sigma)!(C!and!E!for!Wehi231!and!J558µm3+Cx438EGFP!respectively),!or!loaded!without!purification!(B!and!D!for!Wehi231!and!J558µm3+Cx438EGFP!respectively).!Blots!were!probed!with!α8pY:!4G10!(Cell!Signaling),!α8Cx43!(Fred!Hutchinson),!or!α8pY265!Cx43!(Solan!et!al!2008).!Data!is!representative!of!one!pilot!experiment!for!Wehi231!and!two!experiments!for!J558µm3+Cx438EGFP.!! A" NH3$ COOH$ Y$247$ Y$265$ Phosphoryla6on?$ ΔCT$$ Connexin43$ Y$ Y$ Fred%Hutchinson%α0Cx43% Sigma%α0Cx43% Y$ %α0pY%(4G10)% 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0##5##15##30# ! α#pY! (4G10)! 50#kDa#'# 37#kDa#'# α#Cx43! 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0##5##15##30# IP:!Cx43! ! α#pY! (4G10)! 50#kDa#'# 37#kDa#'# ! α#pY265! B! C! 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0###5###15###30# 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 50#kDa#'# 75#kDa#'# 0###5###15##30# α"Cx43' 75#kDa#'# 50#kDa#'# ' α"pY265' α"pY' (4G10)' α"pY' (4G10)' ' IP:'Cx43' D! E! 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0##5##15##30# ! α#pY! (4G10)! 50#kDa#'# 37#kDa#'# α#Cx43! 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0##5##15##30# IP:!Cx43! ! α#pY! (4G10)! 50#kDa#'# 37#kDa#'# ! α#pY265! B! C! 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0###5###15###30# 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 50#kDa#'# 75#kDa#'# 0###5###15##30# α"Cx43' 75#kDa#'# 50#kDa#'# ' α"pY265' α"pY' (4G10)' α"pY' (4G10)' ' IP:'Cx43' D! E! 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0## ##15##30# ! α#pY! (4G10)! 50#kDa#'# 37#kDa#'# α#Cx43! 0## ##15##30# IP:!Cx43! ! α#pY! (4G10)! 50#kDa#'# 37#kDa#'# ! α#pY265! B! C! 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0### # 15# #30# 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 50#kDa#'# 75#kDa#'# 0### # 15 #30# α"Cx43' 75#kDa#'# 50#kDa#'# ' α"pY265' α"pY' (4G10)' α"pY' (4G10)' ' IP:'Cx43' D! E! 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0##5##15##30# ! α#pY! (4G10)! 50#k a#'# 37#kDa#'# α#Cx43! 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0##5##15##30# IP:!Cx43! ! α#pY! (4G10)! 50#kDa#'# 37#kDa#'# ! α#pY265! B! C! 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0###5###15###30# 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 50#kDa#'# 75#kDa#'# 0###5###15##30# α"Cx43' 75#kDa#'# 50#kDa#'# ' α"pY265' α"pY' (4G10)' α"pY' (4G10)' ' IP:'Cx43' D! E! 75# # # 50# # # 37#kDa#'# 25#kDa#'# 0##5##15##30# ! α#pY! (4G10)! 50# # # # #'# α#Cx43! 75# # # 50# # # 37#kDa#'# 25#kDa#'# 0##5##15##30# IP:!Cx43! ! α#pY! (4G10)! 50#kDa#'# 37#kDa#'# ! α#pY265! B! C! 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0###5###15###30# 75# #'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 50#kDa#'# 75# #'# 0###5###15##30# α"Cx43' 75#kDa#'# 50#kDa#'# ' α"pY265' α"pY' (4G10)' α"pY' (4G10)' ' IP:'Cx43' D! E! 75#kDa#'# # # # 37#kDa#'# 25#kDa#'# 0##5##15##30# ! # ! (4 10)! 50#kDa#'# 37#kDa#'# α#Cx43! 75#kDa#'# # # 37 25#kDa#'# 0##5##15##30# IP:!Cx43! ! α#pY! (4G10)! 50#kDa#'# 37#kDa#'# ! α#pY265! B! C! 7 #kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0###5 #15###30# 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 50#kDa#'# 75#kDa#'# 0###5###15##30# α"Cx43' 75#kDa#'# 50#kDa#'# ' α"pY265' α"pY' (4G10)' α"pY' (4G10)' ' IP:'Cx43' D! E! 75#kDa#'# 50#kDa#'# 25#kDa#'# 0##5##15##30# ! α#pY! (4G10)! 50# #'# 37# #'# α#Cx43! # # 50#kDa#'# # # # # # 0# 5##15##30# IP:!Cx43! ! α#pY! (4G10)! 50#k #'# 37#kDa#'# ! α#pY265! B! C! 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 0###5###15###30# 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 50#kDa#'# 75#kDa#'# 0###5###15##30# α"Cx43' 75#kDa#'# 50#kDa#'# ' α"pY265' α"pY' (4G10)' α"pY' (4G10)' ' IP:'Cx43' D! E! # # # # # # # #'# # # # # # # # ! ! ! # # # ! # #'# # # # # '# # #'# ## ## ## # ! ! ! ! ! # # # ! ! # # # # # # # # # # # # ### ### ### # # # # # # # # # # # # # # # # # # # ### ### ## # ' # # # # # # ' ' ' ' ' ' ' ' ' 75#k a#'# # #'# # #'# # #'# 0##5##15##30# ! α#pY! (4G10)! 50#k a#'# 37#kDa#'# α#Cx43! 75#k a#'# # #'# # #'# # #'# 0##5##15##30# IP:!Cx43! ! # ! ( )! 50#kDa#'# 37#kDa#'# ! # ! B! C! #k a#'# # #'# # #'# #k a#'# 0###5###15###30# 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 50#k a#'# 75#k a#'# 0###5###15##30# α"Cx43' 75#kDa#'# 50#kDa#'# ' α"pY265' α"pY' (4G10)' α"pY' (4G10)' ' IP:'Cx43' D! E! 75#kDa#'# 50#kDa#'# 37#k a#'# 25#kDa#'# 0 15##30# ! α#pY! (4G10)! 50# #'# 37 α#Cx43! 75#kDa#'# 50#kDa#'# 37#k a#'# 25#kDa#'# 0##5##15##30# IP:!Cx43! ! α#pY! (4G10)! 50# # # 37#k a#'# ! α#pY265! B! C! # #'# 37#k a#'# # #'# ### ### ### # 75#kDa#'# 50#kDa#'# 37#kDa#'# 25#kDa#'# 50#k a#'# 75#k a#'# 0###5###15##30# α"Cx43' 75#kDa#'# 50#kDa#'# ' α"pY265' α"pY' (4G10)' α"pY' (4G10)' ' IP:'Cx43' D! E! #k a#'# #k a#'# #kDa#'# #k a#'# ## ## ## # ! # ! ( )! #kDa#'# # #'# # x ! #k a#'# #k a#'# #kDa#'# #k a#'# ## ## ## # I :! ! ! # ! ( )! # #'# ! # ! ! ! # #'# 50#kDa#'# #kDa#'# # #'# ### ### ### # #k a#'# #k a#'# #k a#'# #k a#'# #kDa#'# #kDa#'# ### ### ## # " x ' #k a#'# #k a#'# ' " ' " ' ( )' " ' ( )' ' I :' x ' ! ! M ol ec ul ar )W ei gh t)( kD a) ! time!(min)!after!α8IgM!stimulation! ! ! 97! Since!BCR8stimulation!leads!to!Cx43!phosphorylation!(Machtaler!et!al.,!2011),!and!since!mutation!of!Y265!prevents!BCR8mediated!cell!spreading!(see!Section!3.1.4),!we!hypothesized!that!this!tyrosine!residue,!located!in!the!Cx43!CT!region,!may!be!an!important!phosphorylation!target!downstream!of!BCR!signaling.!The!antibody!4G10!was!used!to!detect!phospho8tyrosine!(pY)!by!western!blot!in!Wehi231!or!Cx438expressing!J558µm3!cells!that!had!been!stimulated!with!anti8IgM!(Figure!3.14!B8D!upper!panels)!as!well!as!with!phospho8tyrosine!antibodies!from!BD!Biosciences!(#610009)!and!Cell!Signaling!(#9411)!(Data#not# shown).!!Since&Src&kinase&family&members&phosphorylate&tyrosine)residues)found)in)the$ITAMs$of$Igα!and$β!following(BCR(stimulation)(Defranco,*1997),"BCR$signaling$results$in$high$levels$of$tyrosine)phosphorylation)that)obscure)the)ability)to)discern)a)band)of)Cx43’s)molecular)weight'with'certainty'(Figure(3.14!B"and"D,"upper"panels)."Stimulation!of!Cx438expressing!J558µm3!cells!resulted!in!a!lower!level!of!total!tyrosine!phosphorylation!compared!to!Wehi231!cells!(Figure!3.14!D).!Since!the!amount!of!tyrosine!phosphorylation!in!response!to!BCR!stimulation!made!it!difficult!to!distinguish!single!proteins!accurately!based!on!molecular!weight,!Cx43!was!immunoprecipitated!using!an!antibody!against!the!cytoplasmic!CT!tail!(Sigma).!A!second!antibody!against!the!amino8terminal!domain!of!Cx43!(Fred8Hutchinson)!was!used!to!detect!Cx43!in!the!pull8down!and!total!cell!lysate,!which!confirmed!presence!of!Cx43!as!well!as!characteristic!band8shift!in!response!to!stimulation!(Figure!3.14!B!and!D,!lower!panels).!No!band!at!Cx43’s!molecular!weight!was!detected!with!4G10!(Figure!3.4!C!and!E),!nor!with!phospho8tyrosine!specific!antibodies!for!Cx43!(Solan!and!Lampe,!2008).!!! ! 98! 3.2.4!Importance!of!Cx43Y265!for!BCRLmediated!BLcell!spreading!!!!BCR8mediated'cell'spreading(is(important(for(Ag!gathering)and)B8cell$activation,$but$this$process'is'also'commonly'used'as'a'read8out$for$processes$that$depend$upon$rapid$cytoskeletal*rearrangement*(Lin$et$al.,$2008b)."Since"the"Cx43"cytoplasmic!CT!tail%has%been%found&to&be&necessary'for'B8cell$spreading$via$expression$of$a$truncated$form$of$Cx43$(Machtaler)et)al.,)2011),"we"decided"to"take"a"more"detailed"look"at"a"tyrosine"residue"(Y265)"of#the#tail#in#order#to#better#understand#the#mechanism#of#Cx43’s#affect#on#these#B8cell$processes.!!Neither'J558µm3'cells'expressing'Cx43'mutant:'Cx43Y265F'or'Cx43Y265D'spread'on"anti8IgM$coated#glass#coverslips#(Figure#3.15!A,#quantified#in#B).#The#contact#area#of#mutant8expressing)cells)was)not)significantly)different)from)Cx43Δ246$expressing!cells!which%do%not%spread'effectively'by'30'min,"whereas"WT"Cx43"expressing"cells"spread#normally,"and"to"a"significantly+greater+extent+than,"Cx43Δ246,%Cx43Y265F%and%Cx43Y265D%expressing%cells%based&on&a&two8tailed't8test$using$a$95%$confidence$interval."!!This%shows%that%tyrosine%residue%265%of%the%Cx43%tail%is%required%for%effective'B8cell"spreading"and$highlights$a$single$residue,$Y265$as$the$possible$cause$for$the$defect$in$spreading$observed(with(Cx43(mutant(Δ246.!We#are#still#uncertain#of#the#mechanism#underlying)Y265’s)importance+in+B8cell$spreading$however;$therefore$the$next$step$will$be$to$determine$whether$Y265%acts%as%a%phosphorylation%site%for%Src%kinase!or#another#kinase."These%questions%form%the$basis$of$a$new$graduate$student’s$project$in$the$Matsuuchi$lab.! ! 99! !!!!!!!!!!!!!!!!!!! ! ! ! ! ! ! ! ! ! ! ! ! ! ! Figure!3.15!Y265!is!necessary!for!BCRLmediated!spreading!in!the!BLcell!line:!J558µm3.!A)!Confocal!images!of!spreading!of!J558μm3!cells!expressing!Cx43!tyrosine!mutants!Y265D!(D=Aspartic!Acid)!and!Y265F!(F=Phenylalanine),!and!the!CT!truncation!mutant!(ΔCT!at!aa!246=Δ246)!on!40!µg/mL!α8IgM!coated!coverslips!(red=rhodamine8phalloidin!stained!actin,!green=WT!or!mutant!Cx438EGFP,!merge=yellow).!B)!Spreading!was!quantified!by!measuring!the!contact!area!between!cells!and!the!glass!coverslips!after!the!indicated!minutes!after!BCR!stimulation!by!crosslinking!with!α8IgM.!Images!were!obtained!using!an!Olympus!Fluoview1000!confocal!microscope!using!a!60x!objective.!Scale!bars!represent!20!µm!(10!µm!for!enlargement).!Data!is!representative!of!three!experiments!in!which!>100!cells!were!quantified!per!sample.!Asterix!(*)!denotes!significance!between!cell!types!compared!to!WT!Cx43!as!defined!as!P8value!>0.05!by!a!student’s!two8tailed,!unpaired!t8test!calculated!by!Excel.!! B 0" 20" 40" 60" 80" 100" 120" 140" Cx43" ∆246" Y265D" Y265F" M ea n% Co nt ac t%A re a% (μ m 2 ) % 0"min" 30"min" *! *! !!*! !!!!!!!!!!Cx43!!!!!!!!!!!!!!!!!!!!!!Cx43Δ246!!!!!!!!!!!!!!!!Cx43Y265D!!!!!!!!!!!!!!Cx43Y265F! Cx43 0& m in  30 &m in  Δ246 Y265D Y265F Cx430EGFP& Ac6n& A Cx43 0& m in  30 &m in  Δ246 Y265D Y265F Cx430EGFP& Ac6n& Δ2460EGFP& Ac6n& Y265D0EGFP& Ac6n& Y265F0EGFP& Ac6n& Cx43Δ246( Cx43Y265D( Cx43Y265D(Cx43 Cx43Δ246 Cx43Y265D Cx43Y265F ! 100! Chapter!3.2!in!summary!!A!single!tyrosine!residue,!Y265!located!in!the!cytoplasmic!CT!tail!domain!of!Cx43!was!found!necessary!for!BCR8mediated!B8cell!spreading!of!the!J558µm3!cell!line,!as!shown!by!expression!of!two!different!mutant!constructs!containing!point!mutations!at!this!aa!(Cx43Y265F!and!Cx43Y265D)!(Section!3.2.4).!Since!this!residue!is!a!target!of!phosphorylation!in!other!systems,!Cx43!phosphorylation!was!measured!in!response!to!B8cell!stimulation!with!antibodies!used!to!crosslink!the!BCR.!BCR!stimulation!lead!to!a!phosphatase8sensitive!increase!in!Cx43!MW!by!gel8electrophoresis!(indicating!phosphorylation),!but!it!is!still!unclear!which!target!aa!of!Cx43!are!responsible!for!this!shift.!Expression!of!Cx43Y265F!did!not!prevent!BCR8mediated!Cx43!MW!shift.!However!the!effect!of!single!amino!acid!substitution!at!this!site!may!have!been!masked!by!phosphorylation!elsewhere!in!the!Cx43!protein,!or!difficult!to!detect!with!the!methods!used.!!!!!!!!!!!!!!!! ! ! ! ! ! 101! ! CHAPTER!4! ! DISCUSSION!! !!B8lymphocytes!are!key!players!of!the!adaptive!immune!response!since!they!contribute!to!both!humoral!and!cellular!immunity.!B8cells!act!as!APCs!by!displaying!peptides!internalized!through!the!BCR!on!MHC!II!molecules!to!activate!helper!T8cells.!As!well,!B8cell!activation!leads!to!their!proliferation!and!differentiation!into!plasma!cells!that!secrete!antibodies!that!are!highly!effective!at!neutralizing!and!opsonizing!pathogens!and!toxins.!B8cell!activation!depends!upon!the!likelihood!of!any!given!B8cell!coming!into!contact!with!an!Ag!that!matches!its!unique!BCR8specificity.!Therefore!a!high!degree!of!motility!and!migration!are!essential!for!naïve!B8cells!to!enter!and!exit!the!vasculature,!survey!inflamed!tissues,!and!move!within!different!niches!found!in!lymphoid!organs!such!as!the!spleen!and!lymph!nodes!as!well!as!in!the!bone!marrow.!!While!it!is!clear!that!rearrangements!of!the!cytoskeletal!architecture!of!B8lymphocytes!must!be!regulated!in!order!to!orchestrate!these!cellular!events,!much!remains!to!be!discovered!about!how!sequential!breakdown!and!reformation!of!the!cytoskeleton!is!controlled!and!how!regions!of!the!cell!are!targeted!differentially.!!It!is!attractive!to!propose!that!other!families!of!molecules!work!in!concert!with!signaling!receptors!to!regulate!these!processes.!!In!fact,!the!GJ!protein!family,!the!Cxs,!share!many!structural!similarities!with!the!tetraspanin!protein!family,!which!have!no!intrinsic!signaling!activity,!but!have!been!shown!to!be!important!for!the!polarization,!motility!and!migration!of!various!cell!types!(For!review!see!(Kameritsch!et!al.,!2011;!Maecker!et!al.,!1997;!Matsuuchi!and!Naus,!2012;!Olk!et!al.,!2009)).!!# ! 102! !In!B8lymphocytes,!Cx43!knockdown!using!an!shRNA!strategy,!was!shown!to!reduce!in#vitro!spreading!in!response!to!BCR8crosslinking!in!the!Wehi231!murine!lymphoma!cell!line!which!was!derived!from!B8cells!at!a!naïve!stage!of!development!(Machtaler!et!al.,!2011)!and!to!decrease!adhesion!to!endothelium,!impair!transmigration!and!motility!on!fibronectin,!as!well!as!inhibit!extravasation!through!endothelial!cell!layers!(Bruzzone!et!al.,!2003).!Expression!of!Cx43!in!B8cells!is!dependent!on!the!stage!of!differentiation!and!is!lost!in!terminally!differentiated!plasma!B8cells!(Machtaler!et!al.,!2011).!As!well,!differentiated!plasma!cells!don’t!express!surface!BCR,!instead!secreting!antibodies!exclusively.!This!observation!is!meaningful!since!B8lymphocytes!in!earlier!stages!of!differentiation!interact!with,!and!move!across!and!through!cells!in!the!bone!marrow,!lymph!node!and!blood!vessels!as!they!travel!throughout!the!body!during!normal!development!and!during!immune!responses.!!In!contrast,!terminally!differentiated!B8cells!whose!job!is!to!secrete!antibodies!no!longer!need!to!interact!with!other!cells!and!have!less!need!to!be!actively!motile.!!Nevertheless,!this!difference!in!the!properties!of!B8cells!at!different!stages!of!development!has!been!exploited!in!the!studies!in!Machtaler!et!al.,!(Choi,!MSc!thesis,!UBC,!2012)!and!in!this!thesis.!!The!terminally!differentiated,!murine!plasmacytoma!B8cell!line!J558,!normally!secrete!IgA!and!it!has!been!immortalized!in!tissue!culture!and!used!for!over!45!years!as!a!tool!to!study!B8cell!function!and!antibody!production.!!A!version!of!J558,!has!been!previously!transfected!with!the!membrane!bound!BCR!(mIgM,!Igα!and!Igβ),!resulting!in!a!tissue!culture!cell!line!called!J558µm3!but!has!been!used!to!study!BCR!signaling!(Hombach!et!al.,!1988).!!J558µm3!with!cell!surface!BCR,!does!not!normally!spread!(McLeod!et!al.,!2004)!in!response!to! ! 103! BCR8stimulation,!however!overexpression!of!Cx438EGFP!was!sufficient!to!restore!BCR8mediated!spreading!in!these!cells!(Machtaler!et!al.,!2011),!a!phenomenon!that!normally!occurs!after!BCR!signaling!in!immature!and!mature!B8cell!lines!(ie,!Wehi231!and!A20).!!!Expression!of!a!mutated!form!of!Cx43!with!the!CT!domain!truncated!(ΔCT!at!aa!246,!=Δ246)!was!not!sufficient!to!cause!J558µm3!spreading!or!adhesion!to!endothelium!(Machtaler!et!al.,!2011),!suggesting!that!there!are!regions!of!the!CT!domain!of!Cx43!important!for!these!effects.!!The!exact!role!of!the!CT!domain!is!unclear!and!there!has!been!much!speculation!as!to!why!this!occurs.!!!While!the!CT!domain!of!Cx43!was!shown!to!be!important!for!B8cell!adhesion!and!spreading!(Machtaler!et!al.,!2011)!and!is!responsible!for!the!effects!of!Cx43!on!migration!of!other!cell!types!(Bates!et!al.,!2007;!Behrens!et!al.,!2010;!Francis!et!al.,!2011b),!the!mechanism!responsible!for!its!importance!is!currently!being!explored!in!a!number!of!labs,!including!ours.!Many!explanations!of!the!role!of!the!Cx43!CT!domain!in!cellular!migration!have!focused!on!its!potential!binding!to!the!cytoskeleton!or!to!cytoskeletal!adaptors,!perhaps!by!phosphorylated!residues!in!the!CT.!!!However,!the!majority!of!the!phosphorylation!sites!in!the!CT!region!and!reported!protein!interactions!of!Cx43!have!been!shown!to!regulate!GJIC!channel!activity!(Hervé!et!al.,!2004)!and!do!not!yet!specifically!target!a!cytoskeletal!adaptor!binding!site.!!Although!most!CT!truncations!do!not!appear!to!impair!Cx43!trafficking!or!formation!of!GJ!plaques,!the!Δ246!mutation!resulted!in!reduced!GJ!conductance!in!HeLa!(Behrens!et!al.,!2010)!and!C6!glioma!cells!(Lin!et!al.,!2003),!suggesting!that!expression!of!mutant!Cx43!missing!the!CT!domain!after!aa!246,!may!have!effects!through!influencing!channel!conductance.!!!! ! 104! The!mechanism!of!channel!gating!is!complex!and!may!involve!all!three!cytoplasmic!domains!(Evans!and!Martin,!2002)!which!may!act!as!voltage!sensors,!pH!sensors,!or!sites!of!phosphorylation!that!effect!channel!function.!In!particular,!serine!and!tyrosine!residues!found!in!the!CT!domain!act!as!sites!for!phosphorylation!by!MAPK,!and!Src!kinases.!Phosphorylation!of!the!CT!domain!of!Cx43!has!been!shown!to!regulate!GJ!conductance!and!may!do!so!1)!by!targeting!the!Cx/GJ!for!internalization!and!reducing!overall!levels!of!the!channel!on!the!cell!surface,!2)!by!changing!the!conformation!of!the!protein!such!that!channel!activity!is!altered/blocked,!or!3)!by!resulting!in!protein8protein!interactions!that!influence!the!accessibility!of!the!GJ!channel’s!pore.!While!few!studies!have!investigated!the!gating!of!HCs!due!to!their!difficulty!to!activate!and!measure,!it!is!likely!that!the!CT!domain!may!regulate!both!classical!GJ!channel!conductance!and!HC!conductance!in!a!similar!way!(Bukauskas!et!al.,!2005).!BCR!stimulation!results!in!the!phosphorylation!of!Cx43!in!Wehi231!B8cells!(Machtaler!et!al.,!2011)!and!in!other!B8cell!lines!that!have!been!subsequently!tested!(unpublished#data).!!One!way!that!phosphorylation!of!Cx43!could!influence!B8cell!spreading,!is!through!changing!the!conductance!of!Cx43!channels.!!!!!Although,!many!of!the!studies!done!to!investigate!the!role!of!Cx43!on!cellular!migration!have!concluded!that!its!effects!are!channel8independent,!channel!blocking!strategies!are!typically!only!confirmed!by!their!ability!to!block!GJIC,!leaving!HC!function!untested.!While!B8cell!spreading!and!migration!were!assayed!on!coated!glass!or!plastic!(ruling!out!the!possibility!of!GJ!formation!and!cell8cell!communication),!there!is!a!possibility!that!Cx!proteins!form!HCs!that!can!open!under!certain!conditions!that!promote!activation.!HCs!can!facilitate!the!release!into!the!extracellular!space!of!small!molecules!and!ions!that!have!been!shown!to!have! ! 105! autocrine!and!paracrine!actions!through!purinergic!signaling!(Baroja8Mazo!et!al.,!2012),!and!this!may!contribute!to!T8cell!activation!through!the!amplification!of!TCR!signaling!(Mendoza8Naranjo!et!al.,!2011),!and!to!cross8presentation!of!Ag!peptides!to!professional!APCs!(Neijssen!et!al.,!2005).!The!possible!involvement!of!HCs!at!immune!synapses!makes!it!important!to!determine!if!Cx43!affects!BCR8mediated!spreading!through!HC!function,!since!spreading!contributes!to!formation!of!the!B8cell8APC!immune!synapse!(Fleire!et!al.,!2006).!The!possibility!that!the!CT!domain!of!Cx43!may!regulate!the!conductance!or!selectivity!of!HCs!caused!us!to!follow!up!on!the!finding!that!the!CT!domain!of!Cx43!is!important!for!B8cell!spreading!by!determining!1)!if!B8cells!make!HCs!and!2)!if!the!activity!of!Cx43!HCs!contributes!to!BCR8mediated!B8cell!spreading.!The!effect!of!Cx43!channel8function!on!B8cell!spreading!was!addressed!using!two!different!approaches:!a!pharmacological!strategy!to!block!HCs,!and!a!genetic!strategy!using!a!mutant!Cx43!that!does!not!form!functional!GJ!channels.!!!!!BCR8mediated!cell!spreading!was!unaffected!by!treatment!with!agents!that!block!Cx!HCs!(La3+),!Panx!HCs!(Pbn),!or!both!(CBX)!(Figure!3.1).!These!results!were!found!for!B8cell!lines!expressing!endogenous!Cx43!(A20!and!Wehi231!cell!lines)!that!did!not!form!HCs!upon!activation!by!the!removal!of!divalent!cations.!!The!regulation!(removal)!of!cations,!which!is!a!typical!HC!activator!and!effective!for!opening!HCs!in!astrocytes,!was!used!as!a!positive!control!(Figure!3.2).!However!the!J558µm3!cell!line!overexpressing!Cx438EGFP!was!found!to!exhibit!a!high!level!of!HC!activity!even!in!media!containing!concentrations!of!Ca2+/Mg2+!that!are!sufficient!to!block!HCs!normally.!!This!means!that!the!divalent!cation!containing!solution!(DCFS!8),!as!opposed!to!divalent!cation!free!solution!(DCFS!+),!prevented!dye8uptake!by!astrocytes.!This!dye8uptake!was!specific!to!Cx43!HCs!and!can!be!inferred!from!the!blocking!of! ! 106! dye!uptake!by!CBX!pre8treatment!and!by!the!lack!of!HC!activity!detected!in!J558µm3!overexpressing!EGFP!alone.!High!basal!HC!conductance!is!typical!of!cells!overexpressing!Cxs.!In!fact,!overexpression!is!one!of!the!few!experimental!systems!where!Cx!HCs!can!be!effectively!evaluated!since!HCs!typically!exist!in!a!constitutively!closed!state!and!are!only!opened!by!specific!activating!conditions!(Bukauskas!et!al.,!1995).!The!spreading!of!J558µm3!cells!expressing!Cx43!when!treated!with!HC!blockers!(Figure!3.1)!suggests!that!BCR8mediated!spreading!is!independent!of!HC!activity!and!that!spreading!is!not!a!product!of!the!increased!HC!activity!exhibited!by!Cx438expressing!J558µm3!cells.!!!Given!the!most!likely!conclusion!(based!upon!the!lack!of!effect!that!HC!blocking!agents!had!on!B8cell!spreading!(Figure!3.1),!that!Cx43!influences!BCR8mediated!B8cell!spreading!by!a!channel8independent!mechanism,!it!was!initially!surprising!that!expression!of!Cx43!closed8channel!mutant!Cx43T154A!resulted!in!an!unusual!spreading!phenotype!by!both!Cx438null!J558µm3!cells!(Figure!3.6)!and!Cx43+!Wehi231!cells!(Figure!3.7).!Unlike!WT!Cx438expressing!cells!which!spread!radially!on!anti8BCR!coated!glass,!populations!of!B8cells!overexpressing!Cx43T154A!frequently!formed!a!single!membrane!protrusion!per!cell!that!extended!from!the!cell!surface!and!attached!to!the!coated!glass!at!the!tip!of!the!protrusion!(Figure!3.6!A!arrows).!This!phenotype!did!not!appear!to!be!due!to!a!reduction!in!cell!surface!expression!of!the!Cx43!mutant!(Figure!3.3).!In!addition,!EGFP!fusion!with!Cx43!has!been!characterized!in!other!papers!in!the!literature!(Laird!et!al.,!2001)!and!did!not!appear!to!prevent!expression!of!Cx43!at!the!cell!surface!in!our!J558µm3!cell!expression!system!(Figure!3.5).!Therefore!proper!trafficking!and!cellular!localization!of!Cx43T154A!probably!does!not!contribute!to!the!non8radial!spreading!phenotype!observed.!! ! 107! !The!Cx43T154A!mutation!could!act!as!a!DN!by!forming!heteromeric!HCs!with!WT!Cx!(Good!et!al.,!2011).!This!is!consistent!with!our!finding!that!the!expression!of!Cx43T154A!prevented!radial!spreading!and!in!some!cases,!caused!the!formation!of!unidirectional!membrane!protruberances!in!the!Wehi231!cell!line!that!expresses!Cx43!endogenously!similar!to!those!unidirectional!processes!found!in!Cx43T154A8expressing!J558µm3!plasmacytoma!cells!(Figure!3.7).!These!processes!originated!from!the!surface!of!the!cell!not!in!contact!with!the!antibody8coated!coverslip!which!could!explain!why!only!~5850%!of!cells!exhibited!this!phenotype.!The!formation!of!membrane!protrusions!on!the!dorsal!side!of!spreading!cells!that!were!long!enough!to!reach!the!coverslip!may!result!from!an!inability!of!Cx43T154A!expressing!cells!to!polarize!into!a!spreading!side!with!actin!polymerization!and!branching!and!a!non8spreading!side!without.!The!formation!of!actin8rich!membrane!protuberances!away!from!the!site!of!BCR8stimulation!may!demonstrate!Cx43’s!importance!in!regulating!polarized!actin!dynamics!in!B8cells.!!!Since!BCR8mediated!B8cell!spreading,!adhesion!and!migration!share!in!common!their!reliance!on!reorganization!of!the!cytoskeleton,!we!next!looked!at!the!activation!of!the!master!regulator!of!the!actin!cytoskeleton!in!B8lymphocytes!(among!other!cell!types):!the!Rap1!GTPase.!Rap1!has!emerged!as!a!regulator!of!the!activities!of!actin!binding!proteins!in!B8cells!(McLeod!and!Gold,!2001),!and!has!been!shown!to!be!involved!in!B8cell!adhesion,!spreading,!migration,!and!invasion!by!the!expression!of!mutated!constructs!(Lin!et!al.,!2009;!Lin!et!al.,!2008b;!McLeod!et!al.,!2002a;!McLeod!et!al.,!2004).!Cx43!expression!has!been!linked!to!sustained!activation!of!Rap1!since!shRNA!knockdown!of!Cx43!resulted!in!less!Rap1!activation! ! 108! in!the!Wehi231!B8cell!line!and!overexpression!of!Cx43!resulted!in!more!sustained!Rap1!activation!in!the!Cx438null!B8cell!line!J558µm3!(Machtaler!et!al.,!2011).!!!Forced!expression!of!the!Rap1!specific!GAP!(RapGAPII)!in!J558µm3!cells!stably!transfected!with!WTCx43!was!sufficient!to!prevent!BCR8mediated!spreading!on!anti8BCR!coated!glass!coverslips!(Figure!3.8!B!and!D),!suggesting!that!Cx43!expression!influences!spreading!through!a!Rap18dependent!pathway.!In!addition,!the!overexpression!of!a!constitutively!active!form!of!Rap1!(Rap1V12)!caused!J558µm3!cell!spreading!even!in!the!absence!of!Cx43!(Figure!3.8!A!and!C).!These!results!provide!strong!evidence!for!a!mechanism!of!Cx43!involvement!where!expression!of!this!GJ!protein!influences!a!pathway!leading!from!BCR8signaling!to!Rap1!activation.!!!Since!the!expression!of!mutant!Cx43T154A!altered!BCR8mediated!spreading!(Figures!3.6!and!3.7)!we!looked!to!see!if!Cx43T154A!expression!also!altered!Rap1!activation!in!response!to!BCR8stimulation!and!found!that!the!expression!of!Cx43T154A!had!a!similar!effect!on!Rap1!activation!as!truncation!of!the!CT!domain!did.!Cells!expressing!Cx43T154A!or!EGFP!alone!produced!an!initial!spike!in!Rap1!activation!following!BCR8stimulation,!but!much!less!active!Rap1!was!detected!at!later!time8points!compared!to!cells!expressing!WT!Cx43!!(Figure!3.9).!!!!One!possibility!for!this!is!that!both!the!CT!domain!and!the!channel!function!of!Cx43!are!essential!for!the!activation!of!the!Rap1!GTPase,!either!through!two!separate!mechanisms,!or!because!the!CT!domain!is!involved!in!channel!gating.!It!seemed!unlikely!however,!that!the!tail!of!Cx43!influenced!BCR8mediated!B8cell!spreading!through!gating!Cx43!channel!activity!given! ! 109! the!lack!of!effect!that!channel8blocking!drugs!has!on!B8cell!spreading!(Figure!3.1).!Another!possibility!to!explain!the!similarities!between!Cx43Δ246!and!Cx43T154A!on!Rap1!activation!is!that!the!Cx43T154A!mutation!results!in!a!conformational!defect!to!Cx43!tertiary!structure!of!the!cell!surface!Cx438containing!connexons!that!alters!the!functionality!of!the!CT!domain.!!!The!Cx43T154A!point!mutation!was!chosen!out!of!a!larger!mutagenesis!study!as!a!tool!to!study!the!role!of!Cx43!channel!function!because!of!the!ability!of!this!mutant!to!traffic!to!the!plasma!membrane!and!form!GJ!plaques,!while!inhibiting!dye8transfer!between!expressing! Xenopus!oocytes!(Beahm!et!al.,!2006).!However!the!effects!of!the!Cx43T154A!point!mutation!to!the!tertiary!structure!of!Cx43!are!unclear!and!could!result!in!protein!miss8folding!due!to!substitution!of!a!non8polar!aa!in!place!of!a!polar!aa!in!the!hydrophilic!channel8lining!TM3!domain.!HCs!made!of!Cx26!mutated!at!an!analogous!conserved!threonine!residue:!T135A,!resulted!in!less!tightly!packed!hexomers!in!GJ!plaques!and!increased!dissociation!of!oligomers!in!detergent!(Beahm!et!al.,!2006).!These!observations!seem!to!indicate!that!Cx43T154A!or!Cx26T135A!containing!proteins!may!have!a!slightly!altered!conformation!from!WT!Cx43!resulting!in!instability!and!altered!packing!of!mutant8containing!hexamers/HCs.!!!!While!the!mechanism!causing!the!mutated!Cxs’!DN!effects!were!originally!proposed!to!be!due!to!reduced!communication!by!heteromeric!channels!(Willecke!et!al.,!1999),!an!alternative!interpretation!of!the!data!suggests!that!mutated!Cxs!could!have!DN!effects!on!WT!Cx!proteins!in!channel8independent!ways!as!well.!For!example,!Cx37T154A!acted!as!a!DN!on!the!channel8independent!influence!of!Cx37!slowing!proliferation!(Good!et!al.,!2011).!If!the!CT!region!of!Cx43!is!involved!in!protein8protein!interactions!leading!to!Rap1!activation!and!B8cell!! ! ! 110! !!!!!!!!!!!!!!!! Figure!4.1!A!model!showing!how!the!CT!domain!of!Cx43!mutants!may!have!a!dominant! negative!effect!on!BLcell!spreading!by!interfering!with!WT!Cx43!by!forming! heteromeric!hemichannels.!Cxs!(shown!as!cylinders)!oligomerize!into!hexameric!HCs!prior!to!trafficking!to!the!cell!surface.!Heteromeric!HCs!can!form!in!B8cells!that!have!been!transfected!with!Cx43!mutants!(mutation!of!threonine!T154!to!alanine!shown!in!green;!truncation!of!the!CT!at!Δ246!shown!in!purple),!but!which!also!express!endogenous!WT!Cx43!(shown!in!orange).!The!cytoplasmic!C8terminal!(CT)!tail!of!Cx43!is!necessary!for!BCR!signaling!(BCR!signaling=red!arrow;!thickness!of!the!arrow!indicates!relative!effectiveness!of!signaling),!leading!to!B8cell!spreading!(tan!colored!cells!below)!and!is!predicted!to!interact!with!either!an!effector!downstream!of!the!BCR!signaling!cascade,!or!an!adaptor!of!the!cytoskeleton!(red!circle).!The!Cx43!point!mutant!T154A!is!predicted!to!cause!a!conformational!defect!to!the!CT!tail,!resulting!in!reduced!ability!to!bind!interacting!proteins!and!this!results!in!the!generation!of!long!membrane!protuberances!instead!of!radial!spreading!when!plated!on!anti8BCR!coated!glass.!!!!!!! T1 54 A& Δ2 46 & W T& Cx 43 & Spreading*No#Spreading#Non-radial# Spreading# T1 54 A& Δ2 46 & W T& Cx 43 & BCR& ! 111! spreading!downstream!of!BCR8signaling,!then!one!possibility!is!that!oligomers!containing!Cx43T154A!are!altered!in!their!ability!to!influence!these!processes!by!the!presence!of!the!proteins!containing!mutations.!For!example,!the!CT!tails!of!WTCx43!that!are!exposed!in!the!cytoplasm!could!interact!with!other!cytoplasmic!proteins!might!be!interfered!with!by!the!presence!of!Cx43T154A!tails!that!could!be!miss8folded!and!in!close!proximity!(Figure!4.1).!This!could!result!in!the!increased!space!between!HCs!as!well!as!the!decreased!stability!of!oligomers!made!up!of!Cx43!containing!the!T154A!mutation,!similar!to!the!proposal!for!Cx26!containing!the!T135A!mutation!(Beahm!et!al.!2006).!!!Structural!defects!in!the!CT!domain!could!result!in!the!DN!effect!of!Cx43T154A!expression!if!heteromeric!channels!are!formed!between!mutant!and!WT!Cx43.!In!addition,!altered!conformation!of!Cx43!CT!domains!could!also!explain!why!B8cells!expressing!Cx43T154A!extend!unidirectional!protuberances!in!many!cases!(Figure!3.6!A!arrows)!instead!of!failing!to!spread!at!all.!It!is!possible!that!an!intermediate!amount!of!protein!interaction!with!defective!CT!tails!of!Cx43!is!still!able!to!occur!and!result!in!spreading!as!shown!by!increased!contact!are!of!cells!plated!on!anti8BCR!(Figure!3.6!B)!although!the!cellular!polarization!or!ability!to!sustain!the!spreading!response!until!radial!spreading!is!achieved!is!altered!by!this!point!mutation.!It!would!be!interesting!to!determine!if!truncation!of!the!CT!domain!can!act!as!a!DN!in!Wehi231!cells,!which!would!support!this!hypothesis.!Additional!truncation!of!the!CT!domain!of!Cx43T154A!(Cx43T154AΔ246)!completely!prevented!BCR8mediated!spreading!of!J558µm3!and!formation!of!membrane!protuberances!(Figure!3.10),!emphasizing!the!importance!of!the!CT!domain!of!Cx43!for!B8cell!spreading!and!demonstrating!that!the!protuberances!formed!by!Cx43T154A8expressing!cells!is!not!due!to!the!effect!of!this!mutation! ! 112! on!channel!activity!alone,!in!which!case!Cx43T154AΔ246–expressing!cells!could!be!expected!to!exhibit!the!same!phenotype.!!!Cx43T154A!is!by!far!the!most!well!used!mutant!to!rule!out!channel!formation!as!the!mechanism!behind!functions!of!Cx!proteins!owing!to!its!extensive!characterization!and!DN!effects.!Recently,!an!alternate!closed8channel!Cx43!mutation:!Cx43Y17S!was!used!in!a!comparison!with!WT!Cx43!to!rescue!migration!in!MEFs!isolated!from!Cx438/8!mice!(Francis!et!al.,!2011b).!This!mutation!was!identified!from!a!study!of!patients!with!ODDD!(a!human!syndrome!caused!by!mutations!in!the!Cx43!gene:!GJA1!(Paznekas!et!al.,!2003)).!Since!this!mutation!is!located!in!the!NT!of!Cx43,!further!away!from!the!CT!domain,!it!is!more!likely!that!this!mutation!would!be!free!of!the!kinds!of!conformational!defects!to!the!CT!region!that!we!suspect!may!be!present!in!Cx43!containing!the!mutation!Cx43T154A.!This!mutant!may!make!an!alternative!genetic!tool!for!differentiating!the!role!of!Cx43!in!forming!channels!from!the!role!of!the!Cx43!CT!domain!to!act!as!a!scaffold!for!protein!interactions.!!Preliminary!experiments!are!underway!in!the!lab!but!it!is!too!premature!to!comment!at!this!time.!!Experiments!in!our!lab!show!that!BCR!signaling!leads!to!a!time8dependent!and!signaling8dependent!increase!in!Cx43!MW!by!gel!electrophoresis!(Machtaler!et!al.,!2011).!The!sensitivity!of!these!bands!to!decreases!in!MW!after!digestion!with!calf!intestinal!phosphatase!(CIP),!which!cleaves!off!all!phosphates,!suggests!that!BCR!signaling!leads!to!phosphorylation!of!Cx43.!Cx43!has!been!shown!inNvitro#and#inNvivo!to!be!phosphorylated!at!multiple!serine!and!tyrosine!residues!(Solan!and!Lampe,!2009a).!These!phosphorylation!events!may!change!the!conformation!of!Cx43’s!structure!or!change!its!ability!to!interact!with!adaptor!proteins.!Cx43! ! 113! phosphorylation!has!been!studied!mostly!for!its!effect!on!GJ!gating,!but!phosphorylation!could!regulate!non8channel!functions!as!well.!!!Unlike!WT!Cx43,!the!mutant!Cx43T154A!did!not!appear!to!increase!its!MW!to!the!same!extent!as!WT!Cx43,!suggesting!that!its!phosphorylation!is!altered!upon!BCR8stimulation!(data#not# shown).!These!results!provide!further!support!for!the!idea!that!Cx43T154A!could!cause!a!conformational!defect!to!other!regions!besides!the!pore,!since!the!CT!domain!is!the!only!region!of!Cx43!known!to!be!phosphorylated!(Solan!and!Lampe,!2009a).!These!results!suggested!to!us!that!phosphorylation!of!the!CT!domain!of!Cx43!in!response!to!BCR8signaling,!may!change!the!ability!of!Cx43!to!interact!with!proteins!involved!in!the!activation!of!Rap1!and!B8cell!spreading!and!will!be!further!studied!by!future!graduate!student’s!in!the!lab.!!!Given!the!importance!of!tyrosine!phosphorylation!in!response!to!BCR8signaling!(Gold!et!al.,!1990)!as!well!as!the!recruitment!of!Src!family!kinases!such!as!Lyn,!Fyn,!Lck!and!Blk!by!BCR!activation!(Gold!et!al.,!1990),!we!decided!to!investigate!the!potential!of!tyrosine!residues!found!in!the!Cx43!CT!domain!to!act!as!targets!of!phosphorylation,!that!could!be!important!for!BCR8mediated!B8cell!spreading.!Two!tyrosine!residues!(Y265!and!Y247)!found!in!the!Cx43!CT!have!been!shown!to!be!targets!of!v8Src!phosphorylation!and!Y265!is!proposed!to!be!bound!by!v8Src!following!phosphorylation!(Lin!et!al.,!2001a).!These!tyrosines!are!reported!to!be!phosphorylated!sequentially,!therefore!the!first!of!them,!Y265,!was!chosen!as!our!target,!being!both!the!first!of!the!two!tyrosines!to!be!phosphorylated!and!because!of!its!potential!to!act!as!a!binding!site!for!v8Src!through!its!SH2!domain!(Lin!et!al.,!2001a).!! ! 114! Mutation!of!Y265!did!not!prevent!CIP8sensitive!band!shift!of!Cx43!in!response!to!BCR!stimulation!(Figure!3.12).!In!addition,!tyrosine!phosphorylation!of!Cx43!was!not!detected!in!response!to!BCR8stimulation!using!phospho8tyrosine!specific!antibodies!(Figure!3.13).!One!possibility!is!that!Cx43!is!abundantly!phosphorylated!at!serine!or!threonine!and!more!rarely!at!tyrosine!residues.!Another!is!that!phosphorylation!at!Y265!is!not!sufficient!to!change!the!mobility!of!Cx43!by!gel!electrophoresis!since!the!addition!of!a!single!inorganic!phosphate!group!(~80!kDa)!can!not!account!for!the!284!kDa!shift!of!Cx43!between!P0,!P1!and!P2!states.!Lastly,!a!third!possibility!is!that!phosphorylation!of!Y265!only!occurs!on!a!subset!of!Cx43!in!the!cell!and!that!the!detergent!used!to!isolate!Cx43!does!not!retrieve!a!sufficient!enough!pool!of!Cx43!phosphorylated!on!tyrosine!residues!to!be!sensitive!to!differences!between!WT!and!mutant!forms.!!!Many!experiments!looking!at!Cx43!phosphorylation,!and!especially!studies!of!Cx43!and!v8Src!interaction,!have!used!GST8fusion!proteins!and!overexpression!of!both!Cx43!and!v8Src,!or!constitutively!active!forms!of!v8Src!(Filson!et!al.,!1990;!Giepmans!et!al.,!2001;!Kanemitsu!et!al.,!1997;!Lin!et!al.,!2001a,!b;!Loo!et!al.,!1995).!Overexpression!of!Cx43!in!our!system,!may!overload!the!capacity!of!endogenous!Src!family!kinases!to!phosphorylate!Cx43!resulting!in!an!undetectable!pool!of!Cx43!with!phosphorylated!tyrosine!residues.!This!overexpression!would!be!consistent!with!the!increased!ER!aggregate!of!Cx438EGFP!found!in!transduced!cells!(Machtaler!et!al.,!2011),!and!it!would!also!explain!the!basal!HC!activity!of!J558um3!cells!expressing!Cx43!(Figure!3.2).!Normally!HCs!are!very!tightly!regulated!and!exist!in!a!closed!conformation!(Bukauskas!et!al.,!1995).!Phosphorylation!of!Cx43!has!been!shown!to!decrease!GJ!channel!conductance,!and!while!phosphorylation!of!Cx43!has!been!less!documented!as!a! ! 115! regulator!of!HC!conductance,!HCs!may!be!regulated!by!similar!mechanisms.!!If!overexpressed!Cx43!overloads!the!capacity!of!endogenous!kinases!to!regulate!Cx43!gating!and!turnover!then!this!could!explain!the!high!basal!activity!by!these!cells.!!!!!While!we!could!not!show!that!tyrosine!phosphorylation!accounts!for!the!Cx43!shift!in!molecular!weight!following!BCR8stimulation,!point!mutation!of!Y265!to!both!phenylalanine!(F)!or!aspartic!acid!(D)!prevented!spreading!of!expressing8J558µm3!cells!(Figure!3.14),!highlighting!the!importance!of!this!residue!for!BCR8mediated!spreading.!Mutation!of!Y265!may!alter!Cx43!function!by!interfering!with!CT!conformation!in!some!way!that!is!independent!of!phosphorylation,!or!which!prevents!phosphorylation!at!other!sites.!Alternately,!phosphorylation!of!Y265!may!be!required!for!B8cell!spreading!but!our!biochemical!methods!of!detection!may!not!be!sensitive!enough!to!detect!the!loss!of!a!single!inorganic!phosphate!due!to!this!mutation,!in!light!of!the!many!other!phosphorylation!sites!in!the!CT!tail!which!may!mask!any!MW!changes!that!tyrosine!phosphorylation!would!cause.!!!HC!activity!did!not!influence!spreading,!so!the!question!remains!how!phosphorylation!of!Cx43!affects!BCR8mediated!B8cell!spreading!by!a!non8channel!mechanism.!Phosphorylation!could!change!the!conformation!of!Cx43!thereby!influencing!its!interactions!with!adaptor!proteins!by!making!binding!sites!more!accessible,!or!less!accessible.!There!are!two!ways!in!which!Cx43!could!influence!BCR8mediated!B8cell!spreading!through!interactions!of!its!CT!domain!with!other!proteins.!One!is!that!Cx43!acts!as!an!adaptor!with!the!cytoskeleton,!and!the!second!is!that!Cx43!influences!BCR!signaling!directly!by!binding!to!effectors!involved!in!the!BCR8signaling!cascade.!! ! 116! !The!cytoskeleton!is!often!linked!to!the!plasma!membrane!by!transmembrane!proteins!and!their!adaptors!at!junctions.!GJ!protein!Cx43!contains!binding!sites!in!its!CT!tail!for!tubulin!(aa!2348243)!as!well!as!putative!domains!that!may!bind!adaptors!of!the!actin!cytoskeleton!such!as!the!cortactin!homologue!HS1!(Hao!et!al.,!2004;!Van!Rossum!et!al.,!2005;!Vitale!et!al.,!2009)!and!the!drebrin!homologue!HIP855!(Butkevich!et!al.,!2004;!Ensenat!et!al.,!1999).!Cx43!also!contains!a!PDZ!binding!domain!that!has!been!shown!to!bind!ZO81!in!other!cell!types!(Toyofuku!et!al.,!1998),!however,!B8cells!do!not!express!ZO81!or!make!tight!junctions,!and!this!region!of!the!Cx43!CT!tail!is!impeded!by!the!fused!EGFP!tag!in!our!expression!system.!Loss!of!Cx43!expression!or!overexpression!are!often!linked!with!changes!to!the!cytoskeleton!and!cellular!morphology.!The!influence!of!Cx43!on!cytoskeletal!dynamics!would!explain!how!its!expression!influences!processes!as!diverse!as!B8cell!adhesion,!spreading,!motility,!and!migration,!which!share!in!common!a!requirement!for!cytoskeletal!rearrangement.!!!Cx43!has!been!shown!to!influence!the!migration!of!many!cell!types!(Kameritsch!et!al.,!2011;!Matsuuchi!and!Naus,!2012;!Olk!et!al.,!2009)!and!appears!to!do!so!through!the!effects!of!Cx43!on!cellular!morphology!and!the!ability!of!cells!to!form!polarized!protrusions!of!the!membrane;!probably!due!to!reorganization!of!the!underlying!cytoskeleton.!In!addition!to!its!importance!on!mediating!dynamic!cell!processes!like!spreading!and!migration,!the!cytoskeleton!also!provides!support!to!the!plasma!membrane!and!can!restricts!the!mobility!of!embedded!proteins!through!attachment!to!membrane!proteins!with!cytosolic!domains!capable!of!binding!cytoskeletal!proteins!or!their!adaptors!(Kusumi!and!Sako,!1996).!There!are!two!ways!that!Cx43!scaffolding!with!the!cytoskeleton!could!influence!BCR8mediated! ! 117! spreading:!1)!By!stabilizing!cytoskeletal!dynamics!during!actin!polymerization!and!branching!leading!to!cell!spreading,!by!linking!the!cytoskeleton!to!the!plasma!membrane!(Figure!4.2!B! i),!or!2)!By!influencing!the!composition!or!stability!of!plasma!membrane!micro8domains!through!stabilization!of!the!cortical!actin!cytoskeleton!underlying!the!plasma!membrane!through!a!picket8fence!mechanism!(Figure!4.2!B!ii).!!!Changes!to!cellular!morphology!and!motility!are!achieved!by!combining!adhesion!with!cytoskeletal!reorganization.!B8lymphocytes!adhere!to!many!cell8types:!stromal!cells!during!development!(Hardy!et!al.,!1991;!Simmons!et!al.,!1992),!endothelial!cells!during!transmigration!(Carlos!et!al.,!1990;!Shimizu!et!al.,!1992),!and!follicular!dendritic!cells!within!the!spleen!and!lymph!nodes!(Koopman!et!al.,!1991;!Kosco!et!al.,!1992);!as!well!as!to!deposited!extracellular!matrix!proteins!like!fibronectin!(Chan!et!al.,!1992;!Stupack!et!al.,!1991).!In!addition,!it!has!been!shown!in#vitro!using!an!artificial!lipid!bilayer!to!model!an!APC,!that!B8cells!spread!in!response!to!BCR8crosslinking!(Fleire!et!al.,!2006).!B8cells!bind!to!other!cell!types!and!to!the!extracellular!matrix!via!adhesion!proteins!expressed!on!their!cell!surface.!Adhesion!proteins!classically!include!members!of!the!integrin,!cadherin,!selectin,!!and!immunoglobulin!superfamilies!(Albelda!and!Buck,!1990;!Springer,!1990),!although!evidence!shows!that!the!Cx!family!of!proteins!may!also!produce!cell8cell!adhesion!through!the!disulfide!bonds!formed!between!adjacent!HCs!during!GJ!formation!(Cotrina!et!al.,!2008;!Elias!et!al.,!2007;!Yamane!et!al.,!1999)!in!addition!to!their!more!well8known!role!in!cellular!communication.!!!! ! 118! !!!!!!!!!!!!!!!! Figure!4.2!A!model!showing!how!Cx43!influences!BCRLmediated!Rap1!activation!and!BL cell!spreading.!A)!BCR!(green)!crosslinking!by!anti8BCR!or!Ag!(red!dot)!results!in!the!recruitment!of!Src!family!kinases!(such!as!Lyn,!pink!oval;!and!Syk,!purple!oval)!which!phosphorylate!tyrosine!residues!of!the!BCR!to!initiate!BCR!signaling!(blue!arrows).!BCR!signaling!leads!to!phosphorylation!of!Cx43!(orange),!as!well!as!activation!of!Rap1!(red!rectangle)!which!causes!actin!(red!lines)!severing!leading!to!increased!mobility!of!BCRs!that!results!in!B)!formation!of!BCR!micro8clusters!that!generate!more!Rap1!activation!and!B8cell!spreading!(Freeman!et!al.,!2011).!Cx43!prolongs!Rap1!activation!and!enhances!B8cell!spreading!through!a!mechanism!involving!its!CT!domain,!(and!more!specifically,!tyrosine!residue!Y265!may!act!as!a!phosphorylation!site).!The!Cx43!CT!domain!may!bind!to!adaptors!of!the!cytoskeleton!that!i)!stabilize!cytoskeletal!dynamics!leading!to!cell!spreading,!ii)!stabilize!the!formation!of!BCR!micro8clusters!or!membrane!micro8domains!important!for!prolonged!BCR8signaling,!or!iii)!the!CT!domain!may!bind!to!effectors!of!the!BCR!signaling!cascade,!recruiting!them!to!localized!regions!of!the!plasma!membrane.!!! RAP$ Syk$ Lyn$ N" C" *$P" A" B" N" C" *$P" N" C" *$P" B" N" C" *$P" N" C" *$P" RAP$ B" i" ii" B" #me" N" C" !"P" Syk" Lyn" RAP" iii" !me$ ! 119! Adhesion!proteins!are!typically!transmembrane!proteins!that!contain!an!extracellular!domain!capable!of!binding!to!extracellular!matrix!or!cellular!ligands,!paired!with!a!cytoplasmic!domain!that!connects!to!the!cytoskeleton!directly!or!through!binding!to!adaptor!proteins.!This!link!between!the!cytoskeleton!and!the!extracellular!substratum!is!important!for!adhesion,!and!contributes!to!dynamic!processes!like!spreading!and!migration!by!generating!tension!that!opposes!the!retrograde!force!generated!by!actin!polymerization!during!the!pushing!forward!of!the!leading!edge!of!a!migrating!or!spreading!cell!(Parsons!et!al.,!2010).!!!We!found!the!effects!of!Cx43!expression!to!be!independent!of!GJ!coupling!in!our!system!by!using!an!in#vitro!assay!that!excluded!cell8cell!contact.!This!suggests!that!Cx43!does!not!function!as!an!adhesion!protein!itself,!however!Cx43!may!facilitate!adhesion!by!linking!the!cytoskeleton!to!the!plasma!membrane!at!micro8domains!where!they!associate!with!adhesion!proteins!that!are!able!to!connect!the!cell!with!the!substratum!(Figure!4.2!B!i).!!!One!caveat!of!this!model!is!that!it!fails!to!explain!how!Cx43!expression!prolongs!Rap1!activation!in!response!to!BCR!stimulation.!BCR!crosslinking!induces!a!signaling!cascade!that!leads!to!activation!of!the!Rap1!GTPase.!B8cell!spreading!increases!the!surface!area!of!the!cell!that!is!in!contact!with!Ag!(or!in!this!case!anti8BCR)!leading!to!increased!BCR!engagement!and!signaling!leading!to!Rap1!activation.!However,!since!Rap1!activation!was!measured!in!response!to!stimulation!with!soluble!anti8BCR,!cell!spreading!itself!probably!did!not!play!a!role!in!enhancing!BCR!signaling!leading!to!the!activation!of!Rap1.!!! ! 120! A!second!way!that!scaffolding!with!the!cytoskeleton!could!explain!the!effects!of!Cx43!expression,!is!if!Cx43!enhances!BCR8signaling!through!the!stabilization!of!BCR!micro8clusters!or!by!altering!the!composition!of!plasma!membrane!micro8domains!by!regulating!the!proteins!associated!with!the!BCR.!BCR!signaling!leads!to!the!activation!of!the!Rap1!GTPase!(McLeod!et!al.,!1998).!Rap1!regulates!the!activity!of!proteins!that!modify!actin!dynamics,!leading!to!cell8spreading!(McLeod!and!Gold,!2001),!as!well!as!the!actin8severing!protein!cofilin,!which!is!necessary!for!the!breakdown!of!the!cortical!actin!cytoskeleton!restricting!the!movement!of!BCRs!within!the!plasma!membrane!(Freeman!et!al.,!2011).!Breakdown!of!the!actin!cytoskeleton!frees!up!actin!monomers!for!actin!polymerization!driving!spreading.!It!also!increases!BCR!clustering,!which!amplifies!Rap1!activation!through!positive!feedback!(Freeman!et!al.,!2011)!(Figure!4.2!A).!Cx43!could!influence!BCR8mediated!cell!spreading!by!regulating!the!activity!of!Rap1!if!Cx43!could!link!to!the!cortical!actin!cytoskeleton!underlying!the!plasma!membrane!and!restrict!the!movement!of!the!BCR!or!associated!proteins.!By!enhancing!BCR!signaling,!Cx43!could!prolong!the!activation!of!Rap1,!which!regulates!the!activity!of!cytoskeletal!binding!proteins,!leading!to!B8cell!spreading!(Figure!4.2!B!ii).!!!BCR!signaling!is!initiated!by!BCR!crosslinking!and!the!formation!of!BCR!micro8clusters!that!act!as!the!functional!units!of!signaling!(Harwood!and!Batista,!2009).!Initial!activation!of!Rap1!downstream!of!BCR!signaling!leads!to!actin!severing!that!enhances!mobility!of!BCR!in!the!plasma!membrane!and!facilitates!the!formation!of!BCR!micro8clusters,!enhancing!BCR!signaling!and!further!Rap1!activation.!The!importance!of!the!cytoskeleton!on!the!regulation!of!BCR!signaling!can!be!inferred!from!the!discovery!that!disruption!of!the!actin!cytoskeleton!alone!is!sufficient!to!induce!BCR!clustering!and!signaling!(Treanor!et!al.,!2011).!! ! 121! !Since!there!is!no!defect!in!initial!Rap1!activation!by!B8cells!lacking!Cx43!expression!(Machtaler!et!al.,!2011),!it!seems!that!Cx43!is!not!required!for!initial!BCR!signaling!itself,!but!rather!for!a!sustained!signaling!response.!By!binding!to!the!cytoskeleton!through!its!CT!domain,!Cx43!may!generate!“picket!fences”!that!restrict!the!mobility!of!proteins!like!the!BCR!in!the!plasma!membrane!(Kusumi!and!Sako,!1996).!After!BCR8mediated!cell!spreading,!BCR!microclusters!aggregate!into!a!well!organized!immune!synapse!arrangement!with!BCR!in!the!center!and!adhesion!proteins!surrounding!the!periphery!of!this!cluster!(Figure!1.2).!These!events!indicate!that!a!massive!reorganization!of!protein!distribution!in!the!plasma!membrane!takes!place!in!response!to!BCR!signaling,!and!one!possibility!is!that!Cx43!expression!improves!B8cell!spreading!by!helping!to!sustain!BCR!signaling!leading!to!Rap1!activation!through!the!stabilization!of!signaling!BCR!clusters.!!!In!addition!to!adhesion!proteins!that!bind!extracellular!ligands!directly,!cell!surface!proteins!can!influence!adhesion!indirectly!by!contributing!to!micro8domains!in!the!plasma!membrane,!thereby!stabilizing!the!interactions!of!adhesion!protein!with!the!substratum.!These!plasma!membrane!domains!can!be!restricted!by!the!interactions!of!embedded!proteins!themselves!or!by!their!proximity!to!cytoskeletal8anchoring!membrane!proteins!that!restricting!the!movement!of!neighboring!proteins!by!association.!The!tetraspanin!family!of!transmembrane!proteins,!which!share!some!similarities!structurally!with!Cxs!(four!TM!domains,!a!cytoplasmic!NT!and!CT),!have!been!shown!to!act!as!facilitators!in!processes!such!as!cellular!activation,!proliferation,!adhesion,!and!motility!(Hemler,!2005),!and!to!do!so,!not!through!ligand8binding!or!enzymatic!activity,!but!through!their!interactions!with!other!cell!surface! ! 122! proteins!and/or!through!acting!as!scaffolding!proteins!via!their!cytoplasmic!CT!domains!(Hemler,!2005).!!!Cx43!may!be!acting!on!BCR!signaling!or!the!spreading!resulting!from!its!stimulation,!through!a!mechanism!similar!to!the!tetraspanin!family:!namely!by!influencing!either!micro8domain!stability/composition,!or!by!interactions!with!the!cytoskeleton!or!other!proteins!through!its!CT!domain.!Many!tetraspanins!have!been!shown!to!co8localize!with!integrins!and!CD151!has!been!shown!to!bind!integrins!directly,!in!a!mechanism!involving!the!CT!domain!(Tejera!et!al.,!2013).!It!has!been!suggested!that!CD151!influences!cellular!adhesion!and!motility!by!interactions!with!integrins!that!influence!Rho!GTPases,!which!are!major!regulators!of!actin!dynamics!in!cytoskeletal!reorganization.!As!another!example,!CD81’s!importance!in!B8cell!activation!has!been!demonstrated!by!experiments!in!CD818/8!mice.!It!has!been!shown!that!CD818/8!results!in!less!surface!expression!of!CD19,!a!co8stimulatory!molecule!involved!in!BCR!signaling!(Shoham!et!al.,!2003),!as!well!as!reduced!recruitment!of!CD19!to!BCR!signaling!micro8clusters!in!stimulated!B8cells!(Cherukuri!et!al.,!2004).!!!Cx43!could!act!like!a!tetraspanin!in!this!way:!anchoring!to!the!cytoskeleton!and!influencing!BCR!mobility!or!interaction!with!other!components!required!for!BCR!signaling.!Alternately,!Cx43!could!act!as!an!adaptor!to!the!cytoskeleton!influencing!actin!dynamics!directly!through!protein8interaction!motifs!located!in!its!CT!region.!!!While!this!model!of!Cx43!binding!to!cytoskeletal!proteins!or!adaptors!explains!the!influence!that!Cx43!has!on!Rap1!activation!in!response!to!BCR!stimulation,!work!by!MSc!student!Kate! ! 123! Choi!has!shown!that!Cx43!knockdown!specifically!affects!BCR!signaling!pathways!leading!to!proximal!events!like!cytoskeletal!remodeling,!but!not!pathways!that!lead!to!translocation!to!the!nucleus!of!transcription!factors!that!regulate!the!expression!of!genes!involved!in!survival,!growth,!and!proliferation!(Guan!et!al.,!1996).!Considering!the!specificity!of!BCR!signaling!pathways!affected,!Cx43!may!act!downstream!of!BCR!stimulation,!rather!than!on!BCR!clustering!itself.!!!!!!Although!Cx43!has!been!shown!to!bind!directly!to!cytoskeletal!adaptors,!the!CT!domain!contains!sites!for!interactions!with!kinases!and!potentially!for!other!adaptors!as!well,!that!may!serve!to!recruit!proteins!to!the!plasma!membrane!at!GJ!plaques,!or!other!Cx438enriched!membrane!micro8domains.!Cx43!could!interact!with!proteins!that!are!directly!involved!in!the!BCR!signaling!cascade!by!recruiting!effectors!to!the!plasma!membrane!or!to!specific!plasma!membrane!domains.!Localized!recruitment!of!effectors!could!account!for!the!effects!of!Cx43!knockdown!and!overexpression!on!cellular!polarity!(Francis!et!al.,!2011a).!As!an!example!of!recruitment,!the!BCR!co8receptor!CD19!lowers!the!threshold!for!signal!transduction!by!recruiting!Src!family!kinase!Lyn!and!Syk!to!micro8domains!containing!the!BCR!(Depoil!et!al.,!2007;!Wang!et!al.,!2012).!Cx43!may!also!be!able!to!bind!Src!family!kinases!involved!in!BCR!signaling!through!its!proline8rich!domain!or!tyrosine!residues,!recruiting!them!to!sites!at!the!plasma!membrane!where!they!are!better!able!to!phosphorylate!tyrosine!residues!of!the!BCR!ITAMs!upon!BCR8stimulation!(Figure!4.2!B!iii).!!!!!!!Understanding!the!role!of!Cx43!in!B8cell!spreading!and!on!cytoskeletal!rearrangement!in!general!have!implications!for!understanding!B8cell!normal!function!and!during!an!immune! ! 124! response.!Cytoskeletal!dynamics!control!B8cell!morphology!and!motility,!which!are!required!for!B8cell!interactions!with!their!environment!throughout!development,!immune!surveillance,!and!the!generation!of!an!immune!response.!!In!particular,!the!process!of!B8cell!spreading!increases!the!formation!of!BCR8micro8clusters,!leading!to!immune!synapse!formation!and!B8cell!activation!by!membrane8bound!Ag!(Carrasco!et!al.,!2004;!Fleire!et!al.,!2006).!In!our!system,!B8cells!were!stimulated!by!treatment!with!either!soluble!anti8IgM!(Chapter!2.3.3)!or!by!plating!on!glass!coated!with!anti8IgM!(Chapter!2.6.1),!which!served!to!crosslink!the!BCR!and!result!in!BCR!signaling!and!B8cell!spreading.!Although!B8cell!spreading!was!initiated!by!anti8IgM!coated!glass,!B8cells!most!commonly!recognize!membrane8bound!Ag!on!an!APC!that!may!contain!many!other!adhesion!and!co8stimulatory!molecules!on!its!surface.!To!more!closely!model!B8cell!activation,!the!effect!of!Cx43!on!BCR8mediated!cell!spreading!could!be!tested!in!B8cells!cultured!on!an!artificial!lipid!bilayer!loaded!with!Ag!and!other!proteins!involved!in!B8cell!spreading!and!activation.!To!look!at!later!events!in!B8cell!activation!such!as!immune!synapse!formation!and!B8cell!activation,!B8cells!could!be!co8cultured!with!either!surrogate!APCs!that!have!been!loaded!with!Ag!or!with!actual!APCs!such!as!primary!dendritic!cells.!!!!!!!! In#vivo!studies!of!the!role!of!Cx43!in!the!adaptive!immune!system!have!been!limited!to!the!importance!of!Cx43!for!lymphocyte!development!(Montecino8Rodriguez!et!al.,!2000),!since!Cx438/8!mice!are!perinatal!lethal!and!Cx43+/8!mice!have!few!phenotypes.!A!possible!strategy!to!investigate!the!importance!of!Cx43!in!the!immune!response!of!adult!mice!would!be!to!adoptively!transfer!bone!marrow!from!Cx438/8!mice!into!an!irradiated!Cx43+/+!host!(Nguyen!and!Taffet,!2009).!A!more!specific!approach!would!be!to!make!B8cell!specific!conditional! ! 125! knockout!mice!by!crossing!Cx438floxed!mice!(Liao!et!al.,!2001)!with!mb81/Cre!mice!(Hobeika!et!al.,!2006).!!!!!!!!!In!summary,!this!project!explored!three%possible%functional%domains%of%Cx43:%The%extracellular)loops,)the)channel,)and)the)cytoplasmic!CT!tail.&The&six&cysteine&residues&in&the!extracellular)loops)of#Cx43#were#shown#to#be!important)for)trafficking)of)Cx43)to)the)plasma)membrane'since'mutations'of'two'or'more'cysteine'residues'resulted'in'a'larger'intracellular'pool$of$Cx43.$B8cells%did%not%form%HCs%except%upon%overexpression%of%Cx43,%which%may%overload$the$ability$of$endogenous$cellular$machinery$to$regulate$HC$conductance.$The$influence(of(Cx43(on(BCR8mediated'B8cell$spreading$was$shown$to$be$channel8independent'by#treatment#with#channel#blocking#agents,#which#has#no#effect#on#spreading,#even#in#Cx438overespressing*cells*with*measurable*HC*activity.*!!!The$well8studied'Cx43'channel'mutant&Cx43T154A&prevented&normal&B8cell$spreading$in$a$dominant(negative(manor,(but(we(suspect(that(it(may(do(so(because(of(a(conformational(change'to'the'cytoplasmic!CT!tail%or%due,%at%least,%to%a%combined%role%of%the%tail%in%channel%gating&since&Cx43&mutants&Cx43T154A&and&Cx43Δ246!both%abrogate%BCR8mediated'Rap1'activation,)and)since)the)added)insult)of)a)Cx43Δ246$truncation$to$the$mutant$Cx43T154A$prevents(an(intermediate$non8radial&spreading&phenotype&that&may!otherwise)have)been)attributed)to)channel)conductance)alone.)!!In#further#investigating#the#importance#of#the#Cx43#tail,#we#found#that#mutation#of#a#single#tyrosine)residue)of)the)cytoplasmic)tail)Y265)is)sufficient$to$block$spreading,$and$hypothesize$ ! 126! that$this$site$is$bound$by$a$Src$kinase$family$member$downstream$of$BCR$signaling,$following$this%residue’s%phosphorylation.%Cx43’s%influence%on%B8cell$spreading$seems$linked$to$activation(of(the(master(regulator(of(the$B8cell$cytoskeleton:$Rap1!GTPase.(However,(it(remains(to(be(determined(whether(Src(kinases(play(a(role(in(Cx43(effect(on(Rap1!activation,)and$whether$Cx43$participates$in$signaling$cascades$or$anchors$the$cytoskeleton$through$adaptor'proteins.'! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! 127! REFERENCES!!Akira,!S.,!Uematsu,!S.,!and!Takeuchi,!O.!(2006).!Pathogen!recognition!and!innate!immunity.!Cell#124,!7838802.!Albelda,!S.M.,!and!Buck,!C.A.!(1990).!Integrins!and!other!cell!adhesion!molecules.!The!FASEB!Journal#4,!286882880.!Alves,!L.A.,!de!Carvalho,!A.C.C.,!Lima,!E.O.C.,!Souza,!C.M.R.E.,!Dardenne,!M.,!Spray,!D.C.,!and!Savino,!W.!(2005).!Functional!gap!junctions!in!thymic!epithelial!cells!are!formed!by!connexin!43.!European!Journal!of!Immunology#25,!4318437.!Baroja8Mazo,!A.,!Barberà8Cremades,!M.,!and!Pelegrín,!P.!(2012).!The!participation!of!plasma!membrane!hemichannels!to!purinergic!signaling.!Biochimica!et!Biophysica!Acta8Biomembranes.!Barr,!L.,!Dewey,!M.,!and!Berger,!W.!(1965).!Propagation!of!action!potentials!and!the!structure!of!the!nexus!in!cardiac!muscle.!The!Journal!of!General!Physiology#48,!7978823.!Bates,!D.C.,!Sin,!W.,!Aftab,!Q.,!and!Naus,!C.!(2007).!Connexin43!enhances!glioma!invasion!by!a!mechanism!involving!the!carboxy!terminus.!Glia#55,!155481564.!Batista,!F.D.,!and!Neuberger,!M.S.!(2000).!B!cells!extract!and!present!immobilized!antigen:!implications!for!affinity!discrimination.!The!EMBO!Journal#19,!5138520.!Batra,!N.,!Burra,!S.,!Siller8Jackson,!A.J.,!Gu,!S.,!Xia,!X.,!Weber,!G.F.,!DeSimone,!D.,!Bonewald,!L.F.,!Lafer,!E.M.,!and!Sprague,!E.!(2012).!Mechanical!stress8activated!integrin!α5β1!induces!opening!of!connexin!43!hemichannels.!Proceedings!of!the!National!Academy!of!Sciences#109,!335983364.!Beahm,!D.L.,!Oshima,!A.,!Gaietta,!G.M.,!Hand,!G.M.,!Smock,!A.E.,!Zucker,!S.N.,!Toloue,!M.M.,!Chandrasekhar,!A.,!Nicholson,!B.J.,!and!Sosinsky,!G.E.!(2006).!Mutation!of!a!conserved!threonine!in!the!third!transmembrane!helix!of!α8and!β8connexins!creates!a!dominant8negative!closed!gap!junction!channel.!Journal!of!Biological!Chemistry#281,!799488009.!Behrens,!J.,!Kameritsch,!P.,!Wallner,!S.,!Pohl,!U.,!and!Pogoda,!K.!(2010).!The!carboxyl!tail!of!Cx43!augments!p38!mediated!cell!migration!in!a!gap!junction8independent!manner.!European!Journal!of!Cell!Biology#89,!8288838.!Bennett,!M.V.L.,!Contreras,!J.E.,!Bukauskas,!F.F.,!and!Sáez,!J.C.!(2003).!!New!roles!for!astrocytes:!Gap!junction!hemichannels!have!something!to!communicate.!Trends!in!Neurosciences#26,!6108617.! ! 128! Bertani,!G.!(2004).!Lysogeny!at!mid8twentieth!century:!P1,!P2,!and!other!experimental!systems.!Journal!of!Bacteriology#186,!5958600.!Bogdanov,!M.,!Zhang,!W.,!Xie,!J.,!and!Dowhan,!W.!(2005).!Transmembrane!protein!topology!mapping!by!the!substituted!cysteine!accessibility!method!(SCAM):!Application!to!lipid8specific!membrane!protein!topogenesis.!Methods#36,!1488171.!Bruzzone,!R.,!Hormuzdi,!S.G.,!Barbe,!M.T.,!Herb,!A.,!and!Monyer,!H.!(2003).!Pannexins,!a!family!of!gap!junction!proteins!expressed!in!brain.!Proceedings!of!the!National!Academy!of!Sciences# 100,!13644813649.!Bukauskas,!F.F.,!Elfgang,!C.,!Willecke,!K.,!and!Weingart,!R.!(1995).!Biophysical!properties!of!gap!junction!channels!formed!by!mouse!connexin40!in!induced!pairs!of!transfected!human!HeLa!cells.!Biophysical!Journal#68,!228982298.!Burt,!J.M.,!Nelson,!T.K.,!Simon,!A.M.,!and!Fang,!J.S.!(2008).!Connexin!37!profoundly!slows!cell!cycle!progression!in!rat!insulinoma!cells.!American!Journal!of!Physiology8Cell!Physiology#295,!110381112.!Butkevich,!E.,!Hülsmann,!S.,!Wenzel,!D.,!Shirao,!T.,!Duden,!R.,!and!Majoul,!I.!(2004).!Drebrin!is!a!novel!connexin843!binding!partner!that!links!gap!junctions!to!the!submembrane!cytoskeleton.!Current!Biology#14,!6508658.!Campos,!d.C.A.,!Roy,!C.,!Moreno,!A.,!Melman,!A.,!Hertzberg,!E.,!Christ,!G.,!and!Spray,!D.!(1993).!Gap!junctions!formed!of!connexin43!are!found!between!smooth!muscle!cells!of!human!corpus!cavernosum.!The!Journal!of!Urology#149,!156881575.!Carlos,!T.,!Schwartz,!B.,!Kovach,!N.,!Yee,!E.,!Rosa,!M.,!Osborn,!L.,!Chi8Rosso,!G.,!Newman,!B.,!and!Lobb,!R.!(1990).!Vascular!cell!adhesion!molecule81!mediates!lymphocyte!adherence!to!cytokine8activated!cultured!human!endothelial!cells.!Blood#76,!9658970.!Carrasco,!Y.R.,!Fleire,!S.J.,!Cameron,!T.,!Dustin,!M.L.,!and!Batista,!F.D.!(2004).!LFA81/ICAM81!interaction!lowers!the!threshold!of!B!cell!activation!by!facilitating!B!cell!adhesion!and!synapse!formation.!Immunity#20,!5898599.!Chan,!B.,!Elices,!M.,!Murphy,!E.,!and!Hemler,!M.!(1992).!Adhesion!to!vascular!cell!adhesion!molecule!1!and!fibronectin.!Comparison!of!alpha!4!beta!1!(VLA84)!and!alpha!4!beta!7!on!the!human!B!cell!line!JY.!Journal!of!Biological!Chemistry#267,!836688370.!Chen,!Y.,!Corriden,!R.,!Inoue,!Y.,!Yip,!L.,!Hashiguchi,!N.,!Zinkernagel,!A.,!Nizet,!V.,!Insel,!P.A.,!and!Junger,!W.G.!(2006).!ATP!release!guides!neutrophil!chemotaxis!via!P2Y2!and!A3!receptors.!Science!Signalling#314,!179281795.! ! 129! Cherukuri,!A.,!Shoham,!T.,!Sohn,!H.W.,!Levy,!S.,!Brooks,!S.,!Carter,!R.,!and!Pierce,!S.K.!(2004).!The!tetraspanin!CD81!is!necessary!for!partitioning!of!coligated!CD19/CD218B!cell!antigen!receptor!complexes!into!signaling8active!lipid!rafts.!The!Journal!of!Immunology#172,!3708380.!Christ,!G.J.,!Spray,!D.C.,!El8Sabban,!M.,!Moore,!L.K.,!and!Brink,!P.R.!(1996).!Gap!Junctions!in!Vascular!Tissues!Evaluating!the!Role!of!Intercellular!Communication!in!the!Modulation!of!Vasomotor!Tone.!Circulation!Research#79,!6318646.!Cina,!C.,!Maass,!K.,!Theis,!M.,!Willecke,!K.,!Bechberger,!J.F.,!and!Naus,!C.C.!(2009).!Involvement!of!the!cytoplasmic!C8terminal!domain!of!connexin43!in!neuronal!migration.!The!Journal!of!Neuroscience#29,!200982021.!Condon,!C.,!Hourihane,!S.L.,!Dang8Lawson,!M.,!Escribano,!J.,!and!Matsuuchi,!L.!(2000).!Aberrant!Trafficking!of!the!B!Cell!Receptor!Ig8αß!Subunit!in!a!B!Lymphoma!Cell!Line.!The!Journal!of!Immunology#165,!142781437.!Contreras,!J.E.,!Sánchez,!H.A.,!Eugenín,!E.A.,!Speidel,!D.,!Theis,!M.,!Willecke,!K.,!Bukauskas,!F.F.,!Bennett,!M.V.L.,!and!Sáez,!J.C.!(2002).!Metabolic!inhibition!induces!opening!of!unapposed!connexin!43!gap!junction!hemichannels!and!reduces!gap!junctional!communication!in!cortical!astrocytes!in!culture.!Proceedings!of!the!National!Academy!of!Sciences#99,!4958500.!Cotrina,!M.,!Lin,!J.C.,!and!Nedergaard,!M.!(2008).!Adhesive!properties!of!connexin!hemichannels.!Glia#56,!179181798.!Cottrell,!G.T.,!and!Burt,!J.M.!(2005).!Functional!consequences!of!heterogeneous!gap!junction!channel!formation!and!its!influence!in!health!and!disease.!Biochimica!et!Biophysica!Acta8Biomembranes#1711,!1268141.!Crespin,!S.,!Bechberger,!J.,!Mesnil,!M.,!Naus,!C.C.,!and!Sin,!W.C.!(2010).!The!carboxyterminal!tail!of!connexin43!gap!junction!protein!is!sufficient!to!mediate!cytoskeleton!changes!in!human!glioma!cells.!Journal!of!Cellular!Biochemistry#110,!5898597.!Dang,!X.,!Doble,!B.W.,!and!Kardami,!E.!(2003).!The!carboxy8tail!of!connexin843!localizes!to!the!nucleus!and!inhibits!cell!growth.!Molecular!and!Cellular!Biochemistry#242,!35838.!Daniel,!E.,!Thomas,!J.,!Ramnarain,!M.,!Bowes,!T.,!and!Jury,!J.!(2001).!Do!gap!junctions!couple!interstitial!cells!of!Cajal!pacing!and!neurotransmission!to!gastrointestinal!smooth!muscle?!Neurogastroenterology!&!Motility#13,!2978307.!Das,!S.,!Smith,!T.D.,!Sarma,!J.D.,!Ritzenthaler,!J.D.,!Maza,!J.,!Kaplan,!B.E.,!Cunningham,!L.A.,!Suaud,!L.,!Hubbard,!M.J.,!and!Rubenstein,!R.C.!(2009).!ERp29!restricts!Connexin43!oligomerization!in!the!endoplasmic!reticulum.!Molecular!Biology!of!the!Cell#20,!259382604.! ! 130! Defranco,!A.L.!(1997).!The!complexity!of!signaling!pathways!activated!by!the!BCR.!Current!Opinion!in!Immunology#9,!2968308.!Defranco,!A.L.,!Richards,!J.D.,!Blum,!J.H.,!Stevens,!T.L.,!Law,!D.A.,!Chan,!V.W.F.,!Datta,!S.K.,!Foy,!S.P.,!Hourihane,!S.L.,!and!Gold,!M.R.!(2006).!Signal!Transduction!by!the!B8Cell!Antigen!Receptor.!Annals!of!the!New!York!Academy!of!Sciences#766,!1958201.!Depoil,!D.,!Fleire,!S.,!Treanor,!B.L.,!Weber,!M.,!Harwood,!N.E.,!Marchbank,!K.L.,!Tybulewicz,!V.L.,!and!Batista,!F.D.!(2007).!CD19!is!essential!for!B!cell!activation!by!promoting!B!cell!receptor–antigen!microcluster!formation!in!response!to!membrane8bound!ligand.!Nature!Immunology#9,!63872.!Dorshkind,!K.,!Green,!L.,!Godwin,!A.,!and!Fletcher,!W.!(1993).!Connexin8438type!gap!junctions!mediate!communication!between!bone!marrow!stromal!cells.!Blood#82,!38845.!Dylke,!J.,!Lopes,!J.,!Dang8Lawson,!M.,!Machtaler,!S.,!and!Matsuuchi,!L.!(2007).!Role!of!the!extracellular!and!transmembrane!domain!of!Ig8α/β!in!assembly!of!the!B!cell!antigen!receptor!(BCR).!Immunology!Letters#112,!47857.!Elias,!L.A.B.,!Wang,!D.D.,!and!Kriegstein,!A.R.!(2007).!Gap!junction!adhesion!is!necessary!for!radial!migration!in!the!neocortex.!Nature#448,!9018907.!Ensenat,!D.,!Yao,!Z.,!Wang,!X.S.,!Kori,!R.,!Zhou,!G.,!Lee,!S.C.,!and!Tan,!T.8H.!(1999).!A!novel!src!homology!3!domain8containing!adaptor!protein,!HIP855,!that!interacts!with!hematopoietic!progenitor!kinase!1.!Journal!of!Biological!Chemistry#274,!33945833950.!Eugenín,!E.A.,!Brañes,!M.C.,!Berman,!J.W.,!and!Sáez,!J.C.!(2003).!TNF8α!plus!IFN8γ!induce!connexin43!expression!and!formation!of!gap!junctions!between!human!monocytes/macrophages!that!enhance!physiological!responses.!The!Journal!of!Immunology# 170,!132081328.!Evans,!W.H.,!De!Vuyst,!E.,!and!Leybaert,!L.!(2006).!The!gap!junction!cellular!internet:!connexin!hemichannels!enter!the!signalling!limelight.!Biochemical!Journal#397,!1814.!Evans,!W.H.,!and!Martin,!P.E.M.!(2002).!Gap!junctions:!structure!and!function.!Molecular!Membrane!Biology#19,!1218136.!Ezumi,!K.,!Yamamoto,!H.,!Murata,!K.,!Higashiyama,!M.,!Damdinsuren,!B.,!Nakamura,!Y.,!Kyo,!N.,!Okami,!J.,!Ngan,!C.Y.,!and!Takemasa,!I.!(2008).!Aberrant!expression!of!connexin!26!is!associated!with!lung!metastasis!of!colorectal!cancer.!Clinical!Cancer!Research#14,!6778684.! ! 131! Filson,!A.,!Azarnia,!R.,!Beyer,!E.,!Loewenstein,!W.,!and!Brugge,!J.!(1990).!Tyrosine!phosphorylation!of!a!gap!junction!protein!correlates!with!inhibition!of!cell8to8cell!communication.!Cell!growth!&!differentiation#1,!6618668.!Fleire,!S.,!Goldman,!J.,!Carrasco,!Y.,!Weber,!M.,!Bray,!D.,!and!Batista,!F.!(2006).!B!cell!ligand!discrimination!through!a!spreading!and!contraction!response.!Science!Signalling#312,!7388741.!Foote,!C.I.,!Zhou,!L.,!Zhu,!X.,!and!Nicholson,!B.J.!(1998).!The!pattern!of!disulfide!linkages!in!the!extracellular!loop!regions!of!connexin!32!suggests!a!model!for!the!docking!interface!of!gap!junctions.!The!Journal!of!Cell!Biology#140,!118781197.!Francis,!R.,!Xu,!X.,!Park,!H.,!Wei,!C.8J.,!Chang,!S.,!Chatterjee,!B.,!and!Lo,!C.!(2011).!Connexin43!modulates!cell!polarity!and!directional!cell!migration!by!regulating!microtubule!dynamics.!PLoS!ONE#6,!e26379.!Freeman,!S.A.,!Lei,!V.,!Dang8Lawson,!M.,!Mizuno,!K.,!Roskelley,!C.D.,!and!Gold,!M.R.!(2011).!Cofilin8mediated!F8actin!severing!is!regulated!by!the!Rap!GTPase!and!controls!the!cytoskeletal!dynamics!that!drive!lymphocyte!spreading!and!BCR!microcluster!formation.!The!Journal!of!Immunology#187,!588785900.!Galipeau,!J.,!Li,!H.,!Paquin,!A.,!Sicilia,!F.,!Karpati,!G.,!and!Nalbantoglu,!J.!(1999).!Vesicular!stomatitis!virus!G!pseudotyped!retrovector!mediates!effective!in!vivo!suicide!gene!delivery!in!experimental!brain!cancer.!Cancer!Research#59,!238482394.!Garfield,!R.,!Blennerhassett,!M.,!and!Miller,!S.!(1988).!Control!of!myometrial!contractility:!role!and!regulation!of!gap!junctions.!Oxford!reviews!of!reproductive!biology#10,!4368490.!Giepmans,!B.N.G.,!Hengeveld,!T.,!Postma,!F.R.,!and!Moolenaar,!W.H.!(2001).!Interaction!of!c8Src!with!gap!junction!protein!connexin843.!Journal!of!Biological!Chemistry#276,!854488549.!Gold,!M.R.,!Law,!D.A.,!and!DeFranco,!A.L.!(1990).!Stimulation!of!protein!tyrosine!phosphorylation!by!the!B8lymphocyte!antigen!receptor.!Letters!to!Nature!345,#8108813.!Good,!M.E.,!Nelson,!T.K.,!Simon,!A.M.,!and!Burt,!J.M.!(2011).!A!functional!channel!is!necessary!for!growth!suppression!by!Cx37.!Journal!of!Cell!Science#124,!244882456.!Guan,!X.,!Wilson,!S.,!Schlender,!K.K.,!and!Ruch,!R.J.!(1996).!Gapjunction!disassembly!and!connexin!43!dephosphorylation!induced!by!188glycyrrhetinic!acid.!Molecular!Carcinogenesis#16,!1578164.! ! 132! Handel,!A.,!Yates,!A.,!Pilyugin,!S.S.,!and!Antia,!R.!(2007).!Gap!junction8mediated!antigen!transport!in!immune!responses.!Trends!in!Immunology#28,!4638466.!Hao,!J.8J.,!Carey,!G.B.,!and!Zhan,!X.!(2004).!Syk8mediated!tyrosine!phosphorylation!is!required!for!the!association!of!hematopoietic!lineage!cell8specific!protein!1!with!lipid!rafts!and!B!cell!antigen!receptor!signalosome!complex.!Journal!of!Biological!Chemistry#279,!33413833420.!Hardy,!R.,!Carmack,!C.,!Shinton,!S.,!Kemp,!J.,!and!Hayakawa,!K.!(1991).!Resolution!and!characterization!of!pro8B!and!pre8pro8B!cell!stages!in!normal!mouse!bone!marrow.!The!Journal!of!Experimental!Medicine#173,!121381225.!Harwood,!N.E.,!and!Batista,!F.D.!(2009).!Early!events!in!B!cell!activation.!Annual!Review!of!Immunology#28,!1858210.!Hemler,!M.E.!(2005).!Tetraspanin!functions!and!associated!microdomains.!Nature!Reviews!Molecular!Cell!Biology#6,!8018811.!Hermanson,!G.G.,!Eisenberg,!D.,!Kincade,!P.W.,!and!Wall,!R.!(1988).!B29:!a!member!of!the!immunoglobulin!gene!superfamily!exclusively!expressed!on!beta8lineage!cells.!Proceedings!of!the!National!Academy!of!Sciences#85,!689086894.!Hervé,!J.C.,!Bourmeyster,!N.,!and!Sarrouilhe,!D.!(2004).!Diversity!in!protein–protein!interactions!of!connexins:!emerging!roles.!Biochimica!et!Biophysica!Acta8Biomembranes# 1662,!22841.!Hobeika,!E.,!Thiemann,!S.,!Storch,!B.,!Jumaa,!H.,!Nielsen,!P.,!Pelanda,!R.,!and!Reth,!M.!(2006).!Testing!gene!function!early!in!the!B!cell!lineage!in!mb18cre!mice.!Proceedings!of!the!National!Academy!of!Sciences#103,!13789813794.!Hofer,!A.,!and!Dermietzel,!R.!(1998).!Visualization!and!functional!blocking!of!gap!junction!hemichannels!(connexons)!with!antibodies!against!external!loop!domains!in!astrocytes.!Glia# 24,!1418154.!Hombach,!J.,!Leclercq,!L.,!Radbruch,!A.,!Rajewsky,!K.,!and!Reth,!M.!(1988).!A!novel!348kd!protein!co8isolated!with!the!IgM!molecule!in!surface!IgM8expressing!cells.!The!EMBO!Journal# 7,!3451.!Jara,!P.I.,!Boric,!M.P.,!and!Saez,!J.C.!(1995).!Leukocytes!express!connexin!43!after!activation!with!lipopolysaccharide!and!appear!to!form!gap!junctions!with!endothelial!cells!after!ischemia8reperfusion.!Proceedings!of!the!National!Academy!of!Sciences#92,!701187015.! ! 133! Jordan,!K.,!Solan,!J.L.,!Dominguez,!M.,!Sia,!M.,!Hand,!A.,!Lampe,!P.D.,!and!Laird,!D.W.!(1999).!Trafficking,!assembly,!and!function!of!a!connexin438green!fluorescent!protein!chimera!in!live!mammalian!cells.!Molecular!Biology!of!the!Cell#10,!203382050.!Junger,!W.G.!(2011).!Immune!cell!regulation!by!autocrine!purinergic!signalling.!Nature!Reviews!Immunology#11,!2018212.!Justement,!L.,!Wienands,!J.,!Hombach,!J.,!Reth,!M.,!and!Cambier,!J.!(1990).!Membrane!IgM!and!IgD!molecules!fail!to!transduce!Ca2+!mobilizing!signals!when!expressed!on!differentiated!B!lineage!cells.!The!Journal!of!Immunology#144,!327283280.!Kalra,!J.,!Shao,!Q.,!Qin,!H.,!Thomas,!T.,!Alaoui8Jamali,!M.A.,!and!Laird,!D.W.!(2006).!Cx26!inhibits!breast!MDA8MB8435!cell!tumorigenic!properties!by!a!gap!junctional!intercellular!communication8independent!mechanism.!Carcinogenesis#27,!252882537.!Kameritsch,!P.,!Pogoda,!K.,!and!Pohl,!U.!(2011).!Channel8independent!influence!of!connexin!43!on!cell!migration.!Biochimica!et!Biophysica!Acta8Biomembranes.!Kanemitsu,!M.Y.,!Loo,!L.W.M.,!Simon,!S.,!Lau,!A.F.,!and!Eckhart,!W.!(1997).!Tyrosine!phosphorylation!of!connexin!43!by!v8Src!is!mediated!by!SH2!and!SH3!domain!interactions.!Journal!of!Biological!Chemistry#272,!22824822831.!Kardami,!E.,!Dang,!X.,!Iacobas,!D.A.,!Nickel,!B.E.,!Jeyaraman,!M.,!Srisakuldee,!W.,!Makazan,!J.,!Tanguy,!S.,!and!Spray,!D.C.!(2007).!The!role!of!connexins!in!controlling!cell!growth!and!gene!expression.!Progress!in!Biophysics!and!Molecular!Biology#94,!2458264.!Kawano,!M.M.,!Huang,!N.,!Tanaka,!H.,!Ishikawa,!H.,!Sakai,!A.,!Tanabe,!O.,!Nobuyoshi,!M.,!and!Kuramoto,!A.!(2008).!Homotypic!cell!aggregations!of!human!myeloma!cells!with!ICAM81!and!LFA81!molecules.!British!Journal!of!Haematology#79,!5838588.!Kensler,!R.W.,!and!Goodenough,!D.A.!(1980).!Isolation!of!mouse!myocardial!gap!junctions.!The!Journal!of!Cell!Biology#86,!7558764.!Koopman,!G.,!Parmentier,!H.K.,!Schuurman,!H.,!Newman,!W.,!Meijer,!C.,!and!Pals,!S.T.!(1991).!Adhesion!of!human!B!cells!to!follicular!dendritic!cells!involves!both!the!lymphocyte!function8associated!antigen!1/intercellular!adhesion!molecule!1!and!very!late!antigen!4/vascular!cell!adhesion!molecule!1!pathways.!The!Journal!of!Experimental!Medicine#173,!129781304.!Kosco,!M.,!Pflugfelder,!E.,!and!Gray,!D.!(1992).!Follicular!dendritic!cell8dependent!adhesion!and!proliferation!of!B!cells!in!vitro.!The!Journal!of!Immunology#148,!233182339.! ! 134! Krebs,!D.L.,!Yang,!Y.,!Dang,!M.,!Haussmann,!J.,!and!Gold,!M.R.!(1999).!Rapid!and!efficient!retrovirus8mediated!gene!transfer!into!B!cell!lines.!Methods!in!Cell!Science#21,!57868.!Krenacs,!T.,!and!Rosendaal,!M.!(1995).!Immunohistological!detection!of!gap!junctions!in!human!lymphoid!tissue:!connexin43!in!follicular!dendritic!and!lymphoendothelial!cells.!Journal!of!Histochemistry!&!Cytochemistry#43,!112581137.!Krenacs,!T.,!van!Dartel,!M.,!Lindhout,!E.,!and!Rosendaal,!M.!(2005).!Direct!cell/cell!communication!in!the!lymphoid!germinal!center:!connexin43!gap!junctions!functionally!couple!follicular!dendritic!cells!to!each!other!and!to!B!lymphocytes.!European!Journal!of!Immunology#27,!148981497.!Kusumi,!A.,!and!Sako,!Y.!(1996).!Cell!surface!organization!by!the!membrane!skeleton.!Current!Opinion!in!Cell!Biology#8,!5668574.!Laird,!D.W.,!Jordan,!K.,!Thomas,!T.,!Qin,!H.,!Fistouris,!P.,!and!Shao,!Q.!(2001).!Comparative!analysis!and!application!of!fluorescent!protein8tagged!connexins.!Microscopy!Research!and!Technique#52,!2638272.!Lampe,!P.D.,!and!Lau,!A.F.!(2004).!The!effects!of!connexin!phosphorylation!on!gap!junctional!communication.!The!International!Journal!of!Biochemistry!&!Cell!Biology#36,!117181186.!Lanzavecchia,!A.!(1985).!Antigen8specific!interaction!between!T!and!B!cells.!Letters!to!Nature! 314,#5378539.!Larson,!D.,!Wrobleski,!M.,!Sagar,!G.,!Westphale,!E.,!and!Beyer,!E.!(1997).!Differential!regulation!of!connexin43!and!connexin37!in!endothelial!cells!by!cell!density,!growth,!and!TGF8beta1.!American!Journal!of!Physiology8Cell!Physiology#272,!4058415.!Lauf,!U.,!Giepmans,!B.N.,!Lopez,!P.,!Braconnot,!S.,!Chen,!S.8C.,!and!Falk,!M.M.!(2002).!Dynamic!trafficking!and!delivery!of!connexons!to!the!plasma!membrane!and!accretion!to!gap!junctions!in!living!cells.!Proceedings!of!the!National!Academy!of!Sciences#99,!10446810451.!Leybaert,!L.,!Braet,!K.,!Vandamme,!W.,!Cabooter,!L.,!Martin,!P.E.,!and!Evans,!W.H.!(2003).!Connexin!channels,!connexin!mimetic!peptides!and!ATP!release.!Cell!Communication!and!Adhesion#10,!2518257.!Li,!Q.,!Omori,!Y.,!Nishikawa,!Y.,!Yoshioka,!T.,!Yamamoto,!Y.,!and!Enomoto,!K.!(2007).!Cytoplasmic!accumulation!of!connexin32!protein!enhances!motility!and!metastatic!ability!of!human!hepatoma!cells!in!vitro!and!in!vivo.!International!Journal!of!Cancer#121,!5368546.! ! 135! Li,!Z.,!Zhou,!Z.,!and!Donahue,!H.J.!(2008).!Alterations!in!Cx43!and!OB8cadherin!affect!breast!cancer!cell!metastatic!potential.!Clinical!and!Experimental!Metastasis#25,!2658272.!Liao,!Y.,!Day,!K.,!Damon,!D.,!and!Duling,!B.!(2001).!Endothelial!cell8specific!knockout!of!connexin!43!causes!hypotension!and!bradycardia!in!mice.!Proceedings!of!the!National!Academy!of!Sciences#98,!998989994.!Lin,!J.H.8C.,!Yang,!J.,!Liu,!S.,!Takano,!T.,!Wang,!X.,!Gao,!Q.,!Willecke,!K.,!and!Nedergaard,!M.!(2003).!Connexin!mediates!gap!junction8independent!resistance!to!cellular!injury.!The!Journal!of!Neuroscience#23,!4308441.!Lin,!J.H.C.,!Takano,!T.,!Cotrina,!M.L.,!Arcuino,!G.,!Kang,!J.,!Liu,!S.,!Gao,!Q.,!Jiang,!L.,!Li,!F.,!and!Lichtenberg8Frate,!H.!(2002).!Connexin!43!enhances!the!adhesivity!and!mediates!the!invasion!of!malignant!glioma!cells.!The!Journal!of!Neuroscience#22,!430284311.!Lin,!K.,!Tan,!P.,!Freeman,!S.,!Lam,!M.,!McNagny,!K.,!and!Gold,!M.!(2009).!The!Rap!GTPases!regulate!the!migration,!invasiveness!and!in!vivo!dissemination!of!B8cell!lymphomas.!Oncogene#29,!6088615.!Lin,!K.B.,!Freeman,!S.A.,!and!Gold,!M.R.!(2010).!Rap!GTPase8mediated!adhesion!and!migration:!A!target!for!limiting!the!dissemination!of!B8cell!lymphomas?!Cell!Adhesion!&!Migration#4,!3278332.!Lin,!K.B.,!Freeman,!S.A.,!Zabetian,!S.,!Brugger,!H.,!Weber,!M.,!Lei,!V.,!Dang8Lawson,!M.,!Tse,!K.W.,!Santamaria,!R.,!and!Batista,!F.D.!(2008a).!The!rap!GTPases!regulate!B!cell!morphology,!immune8synapse!formation,!and!signaling!by!particulate!B!cell!receptor!ligands.!Immunity#28,!75887.!Lin,!K.B.L.,!Freeman,!S.A.,!Zabetian,!S.,!Brugger,!H.,!Weber,!M.,!Lei,!V.,!Dang8Lawson,!M.,!Tse,!K.W.K.,!Santamaria,!R.,!and!Batista,!F.D.!(2008b).!The!rap!GTPases!regulate!B!cell!morphology,!immune8synapse!formation,!and!signaling!by!particulate!B!cell!receptor!ligands.!Immunity#28,!75887.!Lin,!R.,!Warn8Cramer,!B.J.,!Kurata,!W.E.,!and!Lau,!A.F.!(2001a).!v8Src!phosphorylation!of!connexin!43!on!Tyr247!and!Tyr265!disrupts!gap!junctional!communication.!The!Journal!of!Cell!Biology#154,!8158828.!Lin,!R.,!Warn8Cramer,!B.J.,!Kurata,!W.E.,!and!Lau,!A.F.!(2001b).!v8Src8mediated!phosphorylation!of!connexin43!on!tyrosine!disrupts!gap!junctional!communication!in!mammalian!cells.!Cell!Communication!and!Adhesion#8,!2658269.!Lo,!C.W.,!Waldo,!K.L.,!and!Kirby,!M.L.!(1999).!Gap!junction!communication!and!the!modulation!of!cardiac!neural!crest!cells.!Trends!in!Cardiovascular!Medicine#9,!63869.! ! 136! Loo,!L.W.M.,!Berestecky,!J.M.,!Kanemitsu,!M.Y.,!and!Lau,!A.F.!(1995).!pp608mediated!phosphorylation!of!Connexin!43,!a!gap!junction!protein.!Journal!of!Biological!Chemistry#270,!12751812761.!Machtaler,!S.,!Dang8Lawson,!M.,!Choi,!K.,!Jang,!C.,!Naus,!C.C.,!and!Matsuuchi,!L.!(2011).!The!gap!junction!protein!Cx43!regulates!B8lymphocyte!spreading!and!adhesion.!Journal!of!Cell!Science# 124,!261182621.!Maecker,!H.,!Todd,!S.,!and!Levy,!S.!(1997).!The!tetraspanin!superfamily:!molecular!facilitators.!The!FASEB!Journal#11,!4288442.!Mao,!A.J.,!Bechberger,!J.,!Lidington,!D.,!Galipeau,!J.,!Laird,!D.W.,!and!Naus,!C.C.G.!(2000).!Neuronal!differentiation!and!growth!control!of!neuro82a!cells!after!retroviral!gene!delivery!of!connexin43.!Journal!of!Biological!Chemistry#275,!34407834414.!Matsuuchi,!L.,!Gold,!M.R.,!Travis,!A.,!Grosschedl,!R.,!DeFranco,!A.L.,!and!Kelly,!R.B.!(1992).!The!membrane!IgM8associated!proteins!MB81!and!Ig8beta!are!sufficient!to!promote!surface!expression!of!a!partially!functional!B8cell!antigen!receptor!in!a!nonlymphoid!cell!line.!Proceedings!of!the!National!Academy!of!Sciences#89,!340483408.!Matsuuchi,!L.,!and!Naus,!C.C.!(2012).!Gap!Junction!Proteins!on!the!Move:!Connexins,!the!Cytoskeleton!and!Migration.!Biochimica!et!Biophysica!Acta8Biomembranes.!McLeod,!S.J.,!and!Gold,!M.R.!(2001).!Activation!and!function!of!the!Rap1!GTPase!in!B!lymphocytes.!International!Reviews!of!Immunology#20,!7638789.!McLeod,!S.J.,!Ingham,!R.J.,!Bos,!J.L.,!Kurosaki,!T.,!and!Gold,!M.R.!(1998).!Activation!of!the!Rap1!GTPase!by!the!B!cell!antigen!receptor.!Journal!of!Biological!Chemistry#273,!29218829223.!McLeod,!S.J.,!Li,!A.H.,!Lee,!R.L.,!Burgess,!A.E.,!and!Gold,!M.R.!(2002).!The!Rap!GTPases!regulate!B!cell!migration!toward!the!chemokine!stromal!cell8derived!factor81!(CXCL12):!potential!role!for!Rap2!in!promoting!B!cell!migration.!The!Journal!of!Immunology#169,!136581371.!McLeod,!S.J.,!Shum,!A.J.,!Lee,!R.L.,!Takei,!F.,!and!Gold,!M.R.!(2004).!The!Rap!GTPases!regulate!integrin8mediated!adhesion,!cell!spreading,!actin!polymerization,!and!Pyk2!tyrosine!phosphorylation!in!B!lymphocytes.!Journal!of!Biological!Chemistry#279,!12009812019.!Mendoza8Naranjo,!A.,!Bouma,!G.,!Pereda,!C.,!Ramírez,!M.,!Webb,!K.F.,!Tittarelli,!A.,!López,!M.N.,!Kalergis,!A.M.,!Thrasher,!A.J.,!and!Becker,!D.L.!(2011).!Functional!gap!junctions!accumulate!at!the!immunological!synapse!and!contribute!to!T!cell!activation.!The!Journal!of!Immunology# 187,!312183132.! ! 137! Mesnil,!M.!(2002).!Connexins!and!cancer.!Biology!of!the!Cell#94,!4938500.!Mesnil,!M.,!and!Yamasaki,!H.!(2000).!Bystander!Effect!in!Herpes!Simplex!Virus8Thymidine!Kinase/Ganciclovir!Cancer!Gene!Therapy:!Role!of!Gap8junctional!Intercellular!Communication1.!Cancer!Research#60,!398983999.!Montecino8Rodriguez,!E.,!and!Dorshkind,!K.!(2001).!Regulation!of!hematopoiesis!by!gap!junction8mediated!intercellular!communication.!Journal!of!Leukocyte!Biology#70,!3418347.!Montecino8Rodriguez,!E.,!Leathers,!H.,!and!Dorshkind,!K.!(2000).!Expression!of!connexin!43!(Cx43)!is!critical!for!normal!hematopoiesis.!Blood#96,!9178924.!Moorby,!C.,!and!Patel,!M.!(2001).!Dual!functions!for!connexins:!Cx43!regulates!growth!independently!of!gap!junction!formation.!Experimental!Cell!Research#271,!2388248.!Morrison,!D.K.,!Kaplan,!D.R.,!Escobedo,!J.A.,!Rapp,!U.R.,!Roberts,!T.M.,!and!Williams,!L.T.!(1989).!Direct!activation!of!the!serine/threonine!kinase!activity!of!Raf81!through!tyrosine!phosphorylation!by!the!PDGF!beta8receptor.!Cell#58,!649.!Murphy,!K.,!Travers,!P.,!and!Walport,!M.!(2011).!Janeway's!immunobiology!(Taylor!&!Francis).!Naus,!C.C.,!and!Laird,!D.W.!(2010).!Implications!and!challenges!of!connexin!connections!to!cancer.!Nature!Reviews!Cancer#10,!4358441.!Neijssen,!J.,!Herberts,!C.,!Drijfhout,!J.W.,!Reits,!E.,!Janssen,!L.,!and!Neefjes,!J.!(2005).!Cross8presentation!by!intercellular!peptide!transfer!through!gap!junctions.!Nature#434,!83888.!Nguyen,!T.D.,!and!Taffet,!S.M.!(2009).!A!model!system!to!study!Connexin!43!in!the!immune!system.!Molecular!Immunology#46,!293882946.!Nicholson,!B.,!Dermietzel,!R.,!Teplow,!D.,!Traub,!O.,!Willecke,!K.,!and!Revel,!J.8P.!(1987).!Two!homologous!protein!components!of!hepatic!gap!junctions.!Letters!to!Nature!329,#7328734.!Oliveira8Castro,!G.M.,!and!Barcinski,!M.A.!(1974).!Calcium8induced!uncoupling!in!communicating!human!lymphocytes.!Biochimica!et!Biophysica!Acta8Biomembranes#352,!3388343.!Olk,!S.,!Zoidl,!G.,!and!Dermietzel,!R.!(2009).!Connexins,!cell!motility,!and!the!cytoskeleton.!Cell!Motility!and!the!Cytoskeleton#66,!100081016.! ! 138! Oveido8Orta,!E.,!Gasque,!P.,!and!Evans,!W.H.!(2001).!Immunoglobulin!and!cytokine!expression!in!mixed!lymphocyte!cultures!is!reduced!by!disruption!of!gap!junction!intercellular!communication.!The!FASEB!Journal#15,!7688774.!Oviedo8Orta,!E.,!Errington,!R.J.,!and!Evans,!W.H.!(2002).!Gap!junction!intercellular!communication!during!lymphocyte!transendothelial!migration.!Cell!Biology!International#26,!2538263.!Oviedoorta,!E.,!Hoy,!T.,!and!Evans,!W.!(2008).!Intercellular!communication!in!the!immune!system:!differential!expression!of!connexin40!and!43,!and!perturbation!of!gap!junction!channel!functions!in!peripheral!blood!and!tonsil!human!lymphocyte!subpopulations.!Immunology#99,!5788590.!Oyamada,!M.,!Oyamada,!Y.,!and!Takamatsu,!T.!(2005).!Regulation!of!connexin!expression.!Biochimica!et!Biophysica!Acta8Biomembranes#1719,!6823.!Palatinus,!J.A.,!O'Quinn,!M.P.,!Barker,!R.J.,!Harris,!B.S.,!Jourdan,!J.,!and!Gourdie,!R.G.!(2011).!ZO81!determines!adherens!and!gap!junction!localization!at!intercalated!disks.!American!Journal!of!Physiology8Heart!and!Circulatory!Physiology#300,!5838594.!Palatinus,!J.A.,!Rhett,!J.M.,!and!Gourdie,!R.G.!(2012).!The!connexin43!carboxyl!terminus!and!cardiac!gap!junction!organization.!Biochimica!et!Biophysica!Acta8Biomembranes#1818,!183181843.!Parsons,!J.T.,!Horwitz,!A.R.,!and!Schwartz,!M.A.!(2010).!Cell!adhesion:!integrating!cytoskeletal!dynamics!and!cellular!tension.!Nature!Reviews!Molecular!Cell!Biology#11,!6338643.!Pascual,!V.,!Liu,!Y.8J.,!Magalski,!A.,!De!Bouteiller,!O.,!Banchereau,!J.,!and!Capra,!J.D.!(1994).!Analysis!of!somatic!mutation!in!five!B!cell!subsets!of!human!tonsil.!The!Journal!of!Experimental!Medicine#180,!3298339.!Paznekas,!W.A.,!Boyadjiev,!S.A.,!Shapiro,!R.E.,!Daniels,!O.,!Wollnik,!B.,!Keegan,!C.E.,!Innis,!J.W.,!Dinulos,!M.B.,!Christian,!C.,!and!Hannibal,!M.C.!(2003).!Connexin!43!(GJA1)!mutations!cause!the!pleiotropic!phenotype!of!oculodentodigital!dysplasia.!The!American!Journal!of!Human!Genetics#72,!4088418.!Paznekas,!W.A.,!Karczeski,!B.,!Vermeer,!S.,!Lowry,!R.B.,!Delatycki,!M.,!Laurence,!F.,!Koivisto,!P.A.,!Van!Maldergem,!L.,!Boyadjiev,!S.A.,!and!Bodurtha,!J.N.!(2009).!GJA1!mutations,!variants,!and!connexin!43!dysfunction!as!it!relates!to!the!oculodentodigital!dysplasia!phenotype.!Human!Mutation#30,!7248733.! ! 139! Pear,!W.S.,!Nolan,!G.P.,!Scott,!M.L.,!and!Baltimore,!D.!(1993).!Production!of!high8titer!helper8free!retroviruses!by!transient!transfection.!Proceedings!of!the!National!Academy!of!Sciences# 90,!839288396.!Pernis,!B.,!Forni,!L.,!and!Amante,!L.!(1971).!Immunoglobulins!as!cell!receptors.!Annals!of!the!New!York!Academy!of!Sciences#190,!4208431.!Ponsaerts,!R.,!De!Vuyst,!E.,!Retamal,!M.,!D'hondt,!C.,!Vermeire,!D.,!Wang,!N.,!De!Smedt,!H.,!Zimmermann,!P.,!Himpens,!B.,!and!Vereecke,!J.!(2010).!Intramolecular!loop/tail!interactions!are!essential!for!connexin!438hemichannel!activity.!The!FASEB!Journal#24,!437884395.!Raff,!M.C.,!Sternberg,!M.S.,!and!Taylor,!R.!(1970).!Immunoglobulin!determinants!on!the!surface!of!mouse!lymphoid!cells.!Letters!to!Nature!225,#5538554.!Reaume,!A.G.,!de!Sousa,!P.A.,!Kulkarni,!S.,!Langille,!B.,!Zhu,!D.,!Davies,!T.C.,!Juneja,!S.C.,!Kidder,!G.M.,!and!Rossant,!J.!(1995).!Cardiac!malformation!in!neonatal!mice!lacking!connexin43.!Science#267,!183181834.!Reth,!M.!(1995).!Antigen!receptors!on!B!lymphocytes.!Immunoglobulin!Genes.!Academic!Press,!Toronto.!!Revel,!J.,!and!Karnovsky,!M.J.!(1967).!Hexagonal!array!of!subunits!in!intercellular!junctions!of!the!mouse!heart!and!liver.!The!Journal!of!Cell!Biology#33,!7812.!Richards,!J.D.,!Gold,!M.R.,!Hourihane,!S.L.,!DeFranco,!A.L.,!and!Matsuuchi,!L.!(1996).!Reconstitution!of!B!cell!antigen!receptor8induced!signaling!events!in!a!nonlymphoid!cell!line!by!expressing!the!Syk!protein8tyrosine!kinase.!Journal!of!Biological!Chemistry#271,!645886466.!Ridley,!A.J.,!Schwartz,!M.A.,!Burridge,!K.,!Firtel,!R.A.,!Ginsberg,!M.H.,!Borisy,!G.,!Parsons,!J.T.,!and!Horwitz,!A.R.!(2003).!Cell!migration:!integrating!signals!from!front!to!back.!Science#302,!170481709.!Robertson,!J.D.!(1963).!The!occurrence!of!a!subunit!pattern!in!the!unit!membranes!of!club!endings!in!Mauthner!cell!synapses!in!goldfish!brains.!The!Journal!of!Cell!Biology#19,!2018221.!Rose,!B.,!Mehta,!P.P.,!and!Loewenstein,!W.R.!(1993).!Gap8junction!protein!gene!suppresses!tumorigenicity.!Carcinogenesis#14,!107381075.!Scemes,!E.,!Spray,!D.C.,!and!Meda,!P.!(2009).!Connexins,!pannexins,!innexins:!novel!roles!of!“hemi8channels”.!Pflügers!Archiv!European!Journal!of!Physiology#457,!120781226.! ! 140! Sell,!S.,!and!Gell,!P.!(1965).!Studies!on!rabbit!lymphocytes!in!vitro!I.!Stimulation!of!blast!transformation!with!an!antiallotype!serum.!The!Journal!of!Experimental!Medicine#122,!4238440.!Shaw,!R.M.,!Fay,!A.J.,!Puthenveedu,!M.A.,!von!Zastrow,!M.,!Jan,!Y.8N.,!and!Jan,!L.Y.!(2007).!Microtubule!plus8end8tracking!proteins!target!gap!junctions!directly!from!the!cell!interior!to!adherens!junctions.!Cell#128,!5478560.!Shimizu,!Y.,!Newman,!W.,!Tanaka,!Y.,!and!Shaw,!S.!(1992).!Lymphocyte!interactions!with!endothelial!cells.!Immunology!Today#13,!1068112.!Shin,!J.L.,!Solan,!J.L.,!and!Lampe,!P.D.!(2001).!The!regulatory!role!of!the!C8terminal!domain!of!connexin43.!Cell!Communication!and!Adhesion#8,!2718275.!Shoham,!T.,!Rajapaksa,!R.,!Boucheix,!C.,!Rubinstein,!E.,!Poe,!J.C.,!Tedder,!T.F.,!and!Levy,!S.!(2003).!The!tetraspanin!CD81!regulates!the!expression!of!CD19!during!B!cell!development!in!a!postendoplasmic!reticulum!compartment.!The!Journal!of!Immunology#171,!406284072.!Silverman,!W.,!Locovei,!S.,!and!Dahl,!G.!(2008).!Probenecid,!a!gout!remedy,!inhibits!pannexin!1!channels.!American!Journal!of!Physiology8Cell!Physiology#295,!7618767.!Simmons,!P.J.,!Masinovsky,!B.,!Longenecker,!B.M.,!Berenson,!R.,!Torok8Storb,!B.,!and!Gallatin,!W.M.!(1992).!Vascular!cell!adhesion!molecule81!expressed!by!bone!marrow!stromal!cells!mediates!the!binding!of!hematopoietic!progenitor!cells.!Blood#80,!3888395.!Simpson,!K.J.,!Selfors,!L.M.,!Bui,!J.,!Reynolds,!A.,!Leake,!D.,!Khvorova,!A.,!and!Brugge,!J.S.!(2008).!Identification!of!genes!that!regulate!epithelial!cell!migration!using!an!siRNA!screening!approach.!Nature!Cell!Biology#10,!102781038.!Skerrett,!I.,!Aronowitz,!J.,!Shin,!J.,!Cymes,!G.,!Kasperek,!E.,!Cao,!F.,!and!Nicholson,!B.!(2002).!Identification!of!amino!acid!residues!lining!the!pore!of!a!gap!junction!channel.!The!Journal!of!Cell!Biology#159,!3498360.!Söhl,!G.,!and!Willecke,!K.!(2004).!Gap!junctions!and!the!connexin!protein!family.!Cardiovascular!Research#62,!2288232.!Solan,!J.L.,!and!Lampe,!P.D.!(2008).!Connexin43!in!LA825!Cells!with!Active!v8src!Is!phosphorylated!on!Y247,!Y265,!S262,!S279/282,!and!S368!via!Multiple!Signaling!Pathways.!Cell!Communication!and!Adhesion#15,!75884.!Solan,!J.L.,!and!Lampe,!P.D.!(2009).!Connexin!43!Phosphorylation8Structural!Changes!and!Biological!Effects.!The!Biochemical!Journal#419,!261.! ! 141! Sorgen,!P.L.,!Duffy,!H.S.,!Sahoo,!P.,!Coombs,!W.,!Delmar,!M.,!and!Spray,!D.C.!(2004).!Structural!changes!in!the!carboxyl!terminus!of!the!gap!junction!protein!connexin43!indicates!signaling!between!binding!domains!for!c8Src!and!zonula!occludens81.!Journal!of!Biological!Chemistry# 279,!54695854701.!Sosinsky,!G.E.,!Boassa,!D.,!Dermietzel,!R.,!Duffy,!H.S.,!Laird,!D.W.,!MacVicar,!B.,!Naus,!C.C.,!Penuela,!S.,!Scemes,!E.,!and!Spray,!D.C.!(2011).!Pannexin!channels!are!not!gap!junction!hemichannels.!Channels#5,!1938197.!Sosinsky,!G.E.,!and!Nicholson,!B.J.!(2005).!Structural!organization!of!gap!junction!channels.!Biochimica!et!Biophysica!Acta8Biomembranes#1711,!998125.!Spray,!D.C.,!Ye,!Z.C.,!and!Ransom,!B.R.!(2006).!Functional!connexin!“hemichannels”:!a!critical!appraisal.!Glia#54,!7588773.!Springer,!T.A.!(1990).!Adhesion!receptors!of!the!immune!system.!Nature#346,!4258434.!Stupack,!D.,!Stewart,!S.,!Carter,!W.,!Wayner,!E.,!and!Wilkins,!J.!(1991).!B!lymphocyte!fibronectin!receptors:!expression!and!utilization.!Scandinavian!Journal!of!Immunology#34,!7618769.!Takata,!M.,!Sabe,!H.,!Hata,!A.,!Inazu,!T.,!Homma,!Y.,!Nukada,!T.,!Yamamura,!H.,!and!Kurosaki,!T.!(1994).!Tyrosine!kinases!Lyn!and!Syk!regulate!B!cell!receptor8coupled!Ca2+!mobilization!through!distinct!pathways.!The!EMBO!journal#13,!134181349.!Tejera,!E.,!Rocha8Perugini,!V.,!López8Martín,!S.,!Pérez8Hernández,!D.,!Bachir,!A.I.,!Horwitz,!A.R.,!Vázquez,!J.,!Sánchez8Madrid,!F.,!and!Yáñez8Mo,!M.!(2013).!CD81!regulates!cell!migration!through!its!association!with!Rac!GTPase.!Molecular!Biology!of!the!Cell#24,!2618273.!Tong,!D.,!Li,!T.Y.,!Naus,!K.E.,!Bai,!D.,!and!Kidder,!G.M.!(2007).!In!vivo!analysis!of!undocked!connexin43!gap!junction!hemichannels!in!ovarian!granulosa!cells.!Journal!of!Cell!Science#120,!401684024.!Toyofuku,!T.,!Yabuki,!M.,!Otsu,!K.,!Kuzuya,!T.,!Hori,!M.,!and!Tada,!M.!(1998).!Direct!association!of!the!gap!junction!protein!connexin843!with!ZO81!in!cardiac!myocytes.!Journal!of!Biological!Chemistry#273,!12725812731.!Treanor,!B.,!Depoil,!D.,!Bruckbauer,!A.,!and!Batista,!F.D.!(2011).!Dynamic!cortical!actin!remodeling!by!ERM!proteins!controls!BCR!microcluster!organization!and!integrity.!The!Journal!of!Experimental!Medicine#208,!105581068.! ! 142! Trosko,!J.E.,!Chang,!C.8C.,!Wilson,!M.R.,!Upham,!B.,!Hayashi,!T.,!and!Wade,!M.!(2000).!Gap!junctions!and!the!regulation!of!cellular!functions!of!stem!cells!during!development!and!differentiation.!Methods#20,!2458264.!Unger,!V.M.,!Kumar,!N.M.,!Gilula,!N.B.,!and!Yeager,!M.!(1999).!Three8dimensional!structure!of!a!recombinant!gap!junction!membrane!channel.!Science#283,!117681180.!Van!Rossum,!A.G.,!Schuuring8Scholtes,!E.,!Seggelen,!V.B.,!and!Kluin,!P.M.!(2005).!Comparative!genome!analysis!of!cortactin!and!HS1:!the!significance!of!the!F8actin!binding!repeat!domain.!BMC!Genomics#6,!15.!Verselis,!V.K.,!and!Srinivas,!M.!(2008).!Divalent!cations!regulate!connexin!hemichannels!by!modulating!intrinsic!voltage8dependent!gating.!The!Journal!of!General!Physiology#132,!3158327.!Vitale,!M.L.,!Akpovi,!C.D.,!and!Pelletier,!R.!(2009).!Cortactin/tyrosinephosphorylated!cortactin!interaction!with!connexin!43!in!mouse!seminiferous!tubules.!Microscopy!Research!and!Technique#72,!8568867.!Vitetta,!E.S.,!Baur,!S.,!and!Uhr,!J.W.!(1971).!Cell!surface!immunoglobulin!II.!Isolation!and!characterization!of!immunoglobulin!from!mouse!splenic!lymphocytes.!The!Journal!of!Experimental!Medicine#134,!2428264.!Wang,!K.,!Wei,!G.,!and!Liu,!D.!(2012).!CD19:!a!biomarker!for!B!cell!development,!lymphoma!diagnosis!and!therapy.!Experimental!Hematology!&!Oncology#1,!187.!Willecke,!K.,!Kirchhoff,!S.,!Plum,!A.,!Temme,!A.,!Thonnissen,!E.,!and!Ott,!T.!(1999).!Biological!functions!of!connexin!genes!revealed!by!human!genetic!defects,!dominant!negative!approaches!and!targeted!deletions!in!the!mouse.!Paper!presented!at:!Novartis!Found!Symp.!Xu,!H.,!Li,!Q.,!Zhang,!Y.,!Zhao,!Y.,!Liu,!Y.,!Yang,!Z.,!and!Wang,!E.!(2008).!Connexin!43!recruits!E8cadherin!expression!and!inhibits!the!malignant!behaviour!of!lung!cancer!cells.!Folia!Histochemica!et!Cytobiologica#46,!3158314.!Xu,!X.,!Francis,!R.,!Wei,!C.J.,!Linask,!K.L.,!and!Lo,!C.W.!(2006).!Connexin!438mediated!modulation!of!polarized!cell!movement!and!the!directional!migration!of!cardiac!neural!crest!cells.!Development#133,!362983639.!Yamane,!Y.,!Shiga,!H.,!Asou,!H.,!Haga,!H.,!Kawabata,!K.,!ABE,!K.,!and!Ito,!E.!(1999).!Dynamics!of!astrocyte!adhesion!as!analyzed!by!a!combination!of!atomic!force!microscopy!and!immunocytochemistry.!The!involvement!of!actin!filaments!and!connexin!43!in!the!early!stage!of!adhesion.!Archives!of!Histology!and!Cytology#62,!3558361.! ! 143! Ye,!Z.C.,!Wyeth,!M.S.,!Baltan8Tekkok,!S.,!and!Ransom,!B.R.!(2003).!Functional!hemichannels!in!astrocytes:!a!novel!mechanism!of!glutamate!release.!Science!Signalling#23,!358883596.!Yu,!S.C.,!Xiao,!H.L.,!Jiang,!X.F.,!Wang,!Q.L.,!Li,!Y.,!Yang,!X.J.,!Ping,!Y.F.,!Duan,!J.J.,!Jiang,!J.Y.,!and!Ye,!X.Z.!(2012).!Connexin!43!Reverses!Malignant!Phenotypes!of!Glioma!Stem!Cells!by!Modulating!E8Cadherin.!Stem!Cells#30,!1088120.!Yuan,!D.,!and!Witte,!P.L.!(1988).!Transcriptional!regulation!of!mu!and!delta!gene!expression!in!bone!marrow!pre8B!and!B!lymphocytes.!The!Journal!of!Immunology#140,!280882814.!Zhang,!J.8T.,!and!Nicholson,!B.!(1994).!The!topological!structure!of!connexin!26!and!its!distribution!compared!to!connexin!32!in!hepatic!gap!junctions.!Journal!of!Membrane!Biology# 139,!15829.!Zhang,!W.,!Nwagwu,!C.,!Le,!D.M.,!Yong,!V.W.,!Song,!H.,!and!Couldwell,!W.T.!(2003).!Increased!invasive!capacity!of!connexin438overexpressing!malignant!glioma!cells.!Journal!of!Neurosurgery#99,!103981046.!Zhu,!D.,!Caveney,!S.,!Kidder,!G.,!and!Naus,!C.!(1991).!Transfection!of!C6!glioma!cells!with!connexin!43!cDNA:!analysis!of!expression,!intercellular!coupling,!and!cell!proliferation.!Proceedings!of!the!National!Academy!of!Sciences#88,!188381887.!Zimmer,!D.,!Green,!C.,!Evans,!W.,!and!Gilula,!N.!(1987).!Topological!analysis!of!the!major!protein!in!isolated!intact!rat!liver!gap!junctions!and!gap!junction8derived!single!membrane!structures.!Journal!of!Biological!Chemistry#262,!775187763.!!!!!!!!!!!!!!!!!!!! ! 144! APPENDIX! ! A1!!Cx43!extracellular!cysteine!residues!are!required!for!proper!trafficking!to!the! plasma!membrane!! !Initially,)the)purpose)of)this)project(was$to$study!the$role$of$the"Cx43"extracellular"loops"on"B8cell$spreading.$Conflicting$reports$suggested$that$either$the$Cx43$cytoplasmic$tail$(Bates'et'al.,'2007)!or#extracellular#loops#(Elias'et'al.,'2007)!were$responsible$for$neuronal$migration$since$mutations)of)these)domains)were)shown)to)prevent)GOF)in)their)respective)study.)Both)studies'agreed'that'Cx43’s'importance'for'neuronal'migration'was'independent'of'the'channel'since'channel8blocking)drug)CBX)(Bates'et'al.,'2007)!and$channel8blocking!mutant&Cx43T154A%(Elias'et'al.,'2007)!did#not#impair#migration.#Previous!work%had%shown%that%the#CT#domain#was#required#for#B8cell$spreading!(Machtaler*et*al.,*2011)!and$so$we$wondered$if$the$extracellular$domains'would'be'required'since'both'spreading'and'migration'depend'upon%cytoskeletal%rearrangement%and%anchorage%to%a%substrate%through%adhesion.%Each%extracellular)loop)of)Cx43)contains)three)cysteine)residues)that)form)disulphide)bonds$with$adjacent(connexons,"connecting"neighboring!cells%via%GJs.#Elias#et#al.!hypothesized%that%GJs"formed'between'cells'could'provide'traction'for'migration.'We'expected'that'the'CT!and$the$extracellular)domains)might)be)important)if)they)worked)together)to)transmit)tension)from%the$extracellular$environment$via$the$disulphide$bonds$to$the$cytoskeleton!via$the$Cx43$cytoplasmic+tail.!!! ! 145! Table&A1.&CysLless$(CL)$mutants$generated$by$site$directed$mutagenesis.*Data$is$summarized*from*three*independent*experiments*with*RV8transduced"J558µm3#cells#expressing)CL)Cx438EGFP.&Localization&was&taken&from&cells&immobilized&on&poly8L8lysine'coated'coverslips'using'confocal'microscopy.'Green=WT'or'mutant'Cx438EGFP.%Scale%bars%represent'10'µm.#Molecular"weight"was"estimated"from"western"blot#verification+of+expression)(Figure)A1).#!!! ! ! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! 10#μm# EGFP# Abbreviation+ Mutation+ Found+at+the+ Plasma+ Membrane?+ Localization+ Molecular+ Weight++ EGFP+ + =+ + 27+kDa+ Cx43+ + ++++++ + 72+kDa+ CL2+ C61=65A+ ++ + 45=80+kDa+ + (smear)+ CL3+ C54=61=65A+ =+ + 72+kDa+ CL5+ C54=61=65=192=198A+ ++ + 72+kDa+ CL6+ C54=61=65=187=192=198A+ =+ + 72+kDa+ ! GFP$ GFP$ GFP$ GFP$ GFP$ GFP$ ! 146! !!!!!!!!!!!!!! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! Figure!A1.!Expression!of!CL!mutants!in!a!BLcell!line.!Western!blot!showing!expression!of!“cys8less”(CL)!Cl2,!CL3,!CL5!and!CL6!in!the!J558μm3!cell!line!stably!transduced!by!retroviral!infection!(Blot!was!stripped!and!re8probed!for!actin!as!a!loading!control).!Data!is!representative!of!three!independent!replicates.!!! W eh i% A2 0% J5 58 μm 3+ GF P% J5 58 μm 3% J5 58 μm 3+ Cx 43 % J5 58 μm 3+ CL 2% J5 58 μm 3+ CL 3% J5 58 μm 3+ CL 5% J5 58 μm 3+ CL 6% 50%kDa%% 37%kDa%% 50%kDa%% !!! !α #C x4 3! α# Ac *n !  ! α-Cx43!  ! α-actin! W eh i2 31 ( M ol ec ul ar )W ei gh t)( kD a) ( ! 147! Site%Directed%Mutagenesis%was%performed&in&successive&rounds&on!EGFP8fused#Cx43!in#the#NAP2%plasmid!(Bates'et'al.,'2007)."Mutants"were"named!for$the$number$of$cysteine$to$alanine$substitutions(they(contained(in(order(from(the(N(to(the(C(terminus:!“Cys8less”(CL):"Cx43CL2,#Cx43CL3,%Cx43CL5,%and%Cx43CL6!(Table'A1)."All"four"mutants"were"expressed"in"the"J558µm3!cell$line$by$retroviral$transduction!(Chapter)2.3.2)."Cells"were"periodically"re8sorted'for'EGFP$to#maintain#expression!(Chapter)2.5).))Expression)was)confirmed)by)western&blot!(Figure(A1),"however'immunofluorescence'showed'that'CL'Cx43'was'mostly'retained'intracellularly!(Table'A1)."Trafficking"defects"have"been"noted"for"cysteine"mutations"of"Cx43"in"the"literature((Tong&et&al.,&2007)!and$since$our$In#vitro!assays$depend$heavily$on$good$surface$expression)of)Cx43,)the)decision)was)made,!with%the%help%of%my%committee,!to#abandon#this!portion&of&the&project&in&favor"of"the"channel"and"tail"domains"which"had"been"unavailable"to"study&when&I&started&(these&domains&were&under&investigation&by&previous&lab&members).&!! ! ! ! ! ! ! ! ! ! ! ! 148! A2##Mutation(of(Cx43(extracellular%cysteine%residues%prevents!BLcell!aggregation! !!Based!on!the!observation!that!the!expression!of!different!Cx43!mutants!affected!the! clumpiness!of!B8cell!lines!in!tissue,!an!assay!was!developed!to!measure!the!aggregation!of!B8cells!in!suspension!(Chapter!2.4.6).!B8cells!were!cultured!at!low!densities!in!low!serum!media!to!prevent!cell!division!over!a!48!h!time8course.!Images!of!cultured!cells!were!collected!and!then!all!objects!per!field!were!quantified!and!their!areas!divided!by!the!area!of!a!single!cell,!to!estimate!the!number!of!cells/clump!(Figure!2.2).!!!!!!!!!!!!!!!!!! ! 149! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Figure!A2.!Cx43!expression!leads!to!J558µm3!cell!aggregation!and!is!dependent!on! Cx43!extracellular!cysteine!residues.!A)!Images!of!J558µm3!cells!in!suspension!after!dispersing!into!single!cells!(0!h),!and!after!aggregation!(48!h).!!Wehi231!cells!were!used!as!a!positive!control!for!aggregation,!and!un8transfected!J558µm3!as!a!negative!control.!B)!Quantification!of!cell!aggregation!by!#cells/aggregate!(see!Chapter!2.6.4).!Error!bars!represent!standard!error!of!the!mean.!Data!is!representative!of!three!independent!experiments,!in!which!10!fields!of!cells!were!quantified!for!each!sample.!!! 0 10 20 30 40 50 60 70 80 90 0 h 5 h 24 h 48 h #c el ls /c lu m p J558µm3 J558µm3+EGFP J558µm3+Cx43 J558µm3+Cx43T154A J558µm3+Cx43CL6 Wehi231 (+ control) J558µm3 J558µm3 +EGFP J558µm3 +Cx43 J558µm3 +Cx43CL6 0 h  48  h  J558µm3 +Cx43T154A A! B! ! 150! Samples!were!pipetted!up!and!down!at!the!start!of!the!experiment!to!dissociate!any!aggregates!into!dispersed!single!cells.!Although!J558µm3!cells!do!not!normally!aggregate!in!tissue!culture,!by!5hs!J558µm3!cells!expressing!WT!Cx43!and!Cx43T154A!had!started!to!form!small!clumps!of!283!cells.!By!24!hs,!aggregates!of!as!many!as!20!cells!had!been!formed!by!the!cells!expressing!Cx43T154A,!which!had!diverged!significantly!from!the!WT!Cx43!expressing!cells!which!formed!smaller!aggregates!of!about!15!cells.!By!48!hrs,!EGFP8expressing!or!Cx43CL68expressing!cells!still!had!not!aggregated!at!all,!whereas!WT!Cx43!expression!induced!B8cell!aggregation,!resulting!in!the!formation!of!~20!cell!aggregates,!and!expression!of!closed8channel!mutant!Cx43T154A!increased!aggregation!significantly!as!compared!to!WT!Cx43!by!forming!aggregates!of!as!many!as!80!cells!(Figure!A2).!!Cx43!expression!has!been!reported!to!influence!the!aggregation!of!other!cell!types.!For!example,!overexpression!of!Cx43!in!C6!glioma!cells!increases!their!aggregation!in#vitro!(Lin!et!al.,!2002).!Expression!of!Cx43!cysteine!mutant!Cx43C61S!was!not!sufficient!to!cause!C6!aggregation,!however!expression!of!a!closed8channel!Cx40/43!chimera!increased!aggregation!(Lin!et!al.,!2002),!consistent!with!our!findings!regarding!the!expression!of!cysteine8less!Cx43CL6!and!closed8channel!mutant!Cx43T154A!respectively.!!!Aggregation!is!predictive!of!the!adhesivity!and!invasion!of!C6!glioma!in#vivo.!While!J558µm3!cells!do!not!normally!aggregate!in#vitro,!blood!cell!homotypic!aggregation!is!diagnostic!of!myelomas!(Kawano!et!al.,!2008)!and!could!demonstrate!effects!of!Cx43!expression!on!B8cell!adhesivity.!It!is!unclear!from!this!data,!whether!Cx43!expression!results!in!aggregation!due!to!GJ!formation!between!B8cells!or!due!to!altered!expression!of!some!other!adhesion!protein!on! ! 151! the!cell!surface.!Knockdown!of!Cx43!has!no!effect!on!integrin!LFA81!surface!expression!as!measured!by!FACS!(Kate#Choi,#data#not#shown),!however!loss!of!Cx43!and!E8cadherin!expression!are!correlated!in!many!cancer!tissues!and!cancer!cells!lines!(Li!et!al.,!2008;!Xu!et!al.,!2008)!and!GJIC!may!influence!the!expression!of!E8cadherin!(Yu!et!al.,!2012),!suggesting!that!Cx43!could!influence!aggregation!through!non8Cx!adhesion!proteins!as!well.!!!!!!!! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !!

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0073756/manifest

Comment

Related Items