Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Uncovering the mechanisms involved in regulating cuticular wax biosynthesis in Arabidopsis thaliana Lam, Patricia 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2013_spring_lam_patricia.pdf [ 4.21MB ]
Metadata
JSON: 24-1.0073736.json
JSON-LD: 24-1.0073736-ld.json
RDF/XML (Pretty): 24-1.0073736-rdf.xml
RDF/JSON: 24-1.0073736-rdf.json
Turtle: 24-1.0073736-turtle.txt
N-Triples: 24-1.0073736-rdf-ntriples.txt
Original Record: 24-1.0073736-source.json
Full Text
24-1.0073736-fulltext.txt
Citation
24-1.0073736.ris

Full Text

UNCOVERING THE MECHANISMS INVOLVED IN REGULATING CUTICULAR WAX BIOSYNTHESIS IN ARABIDOPSIS THALIANA by Patricia Lam  B.Sc., The University of British Columbia, 2003  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2013  © Patricia Lam, 2013  Abstract The cuticle is a protective layer that coats the primary aerial surfaces of land plants, and mediates plant interactions with the environment. It is synthesized by epidermal cells and is composed of a cutin polyester matrix that is embedded and covered with cuticular waxes. My overall interest in this thesis is to uncover the mechanisms in how cuticular wax biosynthesis is regulated in developing stems of Arabidopsis thaliana.  Previous work  proposed that the CER7 exoribonuclease degrades an mRNA specifying a repressor of CER3 transcription thereby activating cuticular wax biosynthesis via the alkane pathway. In this thesis, I investigated the mechanisms of CER7-mediated silencing of CER3, and how this contributes to regulating cuticular wax biosynthesis. Specifically, I wanted to uncover the putative repressor of CER3 and to unravel the mechanism of CER7 mediated regulation of wax production. To do this, I performed a genetic screen to isolate suppressors of cer7-1 which restore cer7-related stem wax deficiency to wild-type wax levels. The screen resulted in the isolation of components of the RNA silencing machinery, implicating RNA silencing in the control of cuticular wax deposition during inflorescence stem development in Arabidopsis. Using a reverse genetics approach, I have also identified AGO1 in this pathway. Overall, I demonstrate that in the wild type, the CER7 exoribonuclease degrades a precursor of a small RNA that acts as a repressor of CER3, allowing for expression of CER3, and thus production of alkanes.  However, in the cer7 mutant, this small RNA is not  degraded and is used for the production of a small RNA silencing via a pathway. The generated small RNA silences CER3, leading to the wax deficient phenotype.  ii  Preface A version of chapters 3 and 4 has been published. [Patricia Lam], Lifang Zhao, Heather E. McFarlane, Mytyl Aiga, Vivian Lam, Tanya S. Hooker, and Ljerka Kunst. (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiology 159: 1385-1395. In chapter 3, I performed the suppressor screen and analysis with the assistance of Lifang Zhao, Vivian Lam, Mytyl Aiga, and Tanya Hooker. In chapter 4, I designed and performed all the experiments. Map-based cloning of war2 was assisted by Donald Yung. Next generation sequencing of war2 was performed by Data2Bio. I wrote the manuscript that these chapters were based on. Published data including figures and tables are reprinted with the permission of the American Society of Plant Biologists.  In chapter 5, genotyping of argonaute mutants was assisted by Nathan Eveleigh. Small RNA library construction and deep sequencing was done in collaboration with Yu Yu, Dr. Lei Gao and Dr. Xuemei Chen (University of California, Riverside).  iii  Table of Contents  Abstract .................................................................................................................................... ii Preface ..................................................................................................................................... iii Table of Contents ................................................................................................................... iv List of Tables ........................................................................................................................ viii List of Figures ......................................................................................................................... ix List of Abbreviations ............................................................................................................. xi Acknowledgements .............................................................................................................. xvi  Chapter 1: Introduction .........................................................................................................1 1.1  The Plant Cuticle....................................................................................................... 1  1.2  Cuticular Wax Biosynthesis ...................................................................................... 2  1.2.1  Fatty Acid Elongation ........................................................................................... 2  1.2.2  Biosynthesis of Primary Alcohols and Wax Esters .............................................. 7  1.2.3  Biosynthesis of Alkanes, Secondary Alcohols and Ketones ................................ 8  1.3  Transport of Wax Molecules .................................................................................. 10  1.4  Regulation of Wax Biosynthesis ............................................................................. 13  1.5  The Exosome .......................................................................................................... 17  1.6  Research Objectives ................................................................................................ 19  iv  Chapter 2: Materials and Methods .....................................................................................25 2.1  Plant Material and Growth Conditions ................................................................... 25  2.2  Transformation of Arabidopsis ............................................................................... 25  2.3  Molecular Complementation of cer7 with the CER3 Transgene ............................ 26  2.4  Mutagenesis of cer7-1 sti ........................................................................................ 26  2.5  Genotyping .............................................................................................................. 27  2.6  Cuticular Wax Extraction and Analysis .................................................................. 28  2.7  Quantitative RT-PCR .............................................................................................. 28  2.8  Positional Cloning of Suppressor Lines .................................................................. 29  2.8.1  Isolation of DNA................................................................................................. 29  2.8.2  Rough Mapping .................................................................................................. 29  2.8.3  Fine Mapping ...................................................................................................... 30  2.9  Molecular Complementation and Subcellular Localization of RDR1 .................... 30  2.10  RDR1 Promoter:GUS Fusion and GUS Activity Assay ......................................... 31  2.11  Isolation of RNA for RNA-seq ............................................................................... 31  2.12  Small RNA Extraction and Library Construction ................................................... 32  Chapter 3: A Screen for Suppressors of cer7 .....................................................................37 3.1  Introduction ............................................................................................................. 37  3.2  ProCER6:CER3 Transgene Complements the cer7-3 Wax Deficiency ................. 37  3.3  Initial Screening of Suppressor Lines ..................................................................... 38  3.4  Secondary Screening of Suppressor Lines .............................................................. 39  3.5  Tertiary Screen of Suppressor Lines ....................................................................... 40 v  3.5.1  Wax Analysis ...................................................................................................... 40  3.5.2  CER3 Transcript Levels ...................................................................................... 41  3.6  Allelism Tests ......................................................................................................... 41  3.7  Rough Genetic Mapping ......................................................................................... 42  3.8  Discussion ............................................................................................................... 43  Chapter 4: Characterization of war2 and war3 mutants and cloning of the WAR2 and WAR3 genes ............................................................................................................................63 4.1  Introduction ............................................................................................................. 63  4.2  Confirmation of war2 and war3 as Suppressors of cer7 ........................................ 63  4.3  Identification of war2 ............................................................................................. 64  4.3.1  A Map-based Cloning Approach ........................................................................ 64  4.3.2  Complementation With JAtY Clones ................................................................. 66  4.3.3  Next Generation Sequencing .............................................................................. 67  4.4  Positional Cloning of war3 ..................................................................................... 68  4.5  RDR1 Expression Analysis ..................................................................................... 69  4.6  Role of RDR1 in Regulating CER3 Expression in Developing Inflorescence  Stems… ............................................................................................................................... 70 4.7  Discussion ............................................................................................................... 71  vi  Chapter 5: Identification of Additional Components Involved in CER7-Mediated Silencing of CER3...................................................................................................................91 5.1  Introduction ............................................................................................................. 91  5.1.1  ARGONAUTE (AGO) Proteins ......................................................................... 92  5.1.2  HUA ENHANCER 1 (HEN1) ............................................................................ 94  5.2  A Reverse Genetic Approach to Identify the AGO Involved in Regulating Wax  Biosynthesis ........................................................................................................................ 95 5.3  Determining if HEN1 is Required for Biogenesis of the Small RNA Repressor of  CER3… ............................................................................................................................... 96 5.4  Identification of the Small RNA Species Which Controls CER3 Expression ........ 96  5.5  Discussion ............................................................................................................... 97  Chapter 6: Conclusions and Future Directions................................................................106 6.1  Research Summary ............................................................................................... 106  6.2  Identification of Additional Components Downstream of CER7 Involved in  Regulation of CER3 .......................................................................................................... 108 6.3  Other Methods of Regulating CER3 Expression .................................................. 109  6.4  The Role of SERRATE ......................................................................................... 111  6.5  Additional Biological Functions of the AtRRP45B (CER7) Subunit of the  Exosome............................................................................................................................ 112  References .............................................................................................................................114  vii  List of Tables  Table 2.1 Primers used for genotyping, cloning and qRT-PCR. ............................................ 33 Table 2.2 Primers used in rough mapping of war2 and war3 ................................................. 35 Table 2.3 Primers used in fine mapping of war2 and war3 .................................................... 36  Table 3.1 The number of suppressors identified in each of the 64 batches ............................ 47 Table 3.2 After secondary screening, 100 putative suppressor lines were retained. .............. 48 Table 3.3 Summary of analyses performed on all 100 identified suppressor lines. ............... 62  Table 4.1 39 genes in the war2 mapping interval. .................................................................. 81 Table 4.2 Nomenclature and description of the rdr1 alleles. .................................................. 86  Table 5.1 ago mutants used in this chapter. .......................................................................... 102  viii  List of Figures  Figure 1.1 Pathway for cuticular wax biosynthesis. ............................................................... 21 Figure 1.2 Current model for wax transport ........................................................................... 22 Figure 1.3 Current model illustrating CER7-mediated regulation of wax biosynthesis ......... 23 Figure 1.4 The Arabidopsis exosome is composed of 9 core subunits ................................... 24  Figure 3.1 CER3, under control of the CER6 promoter can complement cer7-3 .................. 46 Figure 3.2 The cer7-1 mutant has approximately 25% of the wild-type wax load. .............. 49 Figure 3.3 The wax components generated by the alkane-forming pathway are greatly reduced in cer7-1 .................................................................................................................... 50 Figure 3.4 The contribution of the two wax biosynthetic pathways to stem wax load of the cer7-1 mutant differs from that of wild-type .......................................................................... 51 Figure 3.5 Network of complementation crosses performed on suppressor lines ................. 52  Figure 4.1 Stem wax loads of war2 and war3 ........................................................................ 76 Figure 4.2 Wax composition of war2 and war3. .................................................................... 77 Figure 4.3 Quantitative RT-PCR showing that CER3 transcript levels are restored to wildtype levels in the war2 and war3 mutants. ............................................................................. 78 Figure 4.4 Positional cloning of WAR2................................................................................... 79 Figure 4.5 4 JAtY clones span the interval in which war2 lies as determined by positional cloning..................................................................................................................................... 82 Figure 4.6 Positional cloning of WAR3 and RDR1 gene structure ........................................ 83 ix  Figure 4.7 Wax levels are restored in the rdr1-7 cer7-3 double mutant................................. 84 Figure 4.8 The RDR1 transgene can complement war3-1 cer7-1 .......................................... 85 Figure 4.9 Expression analysis of RDR1 in different organs and tissues of wild type Arabidopsis (Columbia) as determined by quantitative RT-PCR........................................... 87 Figure 4.10 Tissue-specific expression of ProRDR1:GUS in Arabidopsis stems, showing expression throughout the plant .............................................................................................. 88 Figure 4.11 CER3 expression levels in the top 3cm and the bottom 3cm of a 10cm stem as measured by quantitative RT-PCR. ........................................................................................ 89 Figure 4.12 Model illustrating the role of RDR1 and SGS3, components of RNA silencing, in regulating cuticular wax biosynthesis at the top of the stem. ................................................. 90  Figure 5.1 Phylogenetic tree of the 10 Arabidopsis AGO proteins ...................................... 101 Figure 5.2 The cer7-1 ago1-11 double mutant has a wild-type-like stem wax phenotype. . 103 Figure 5.3 The hen1-8 cer7-3 double mutant has a wax deficient phenotype. ..................... 104 Figure 5.4 Model integrating all the identified components of small RNA silencing that are required for regulation of cuticular wax. .............................................................................. 105  x  List of Abbreviations  ABA  abscisic acid  ABC  ATP-binding cassette  ABRC  Arabidopsis biological resource center  AGO  ARGONAUTE  ARF  auxin response factor  BDG  BODYGUARD  BSTFA  N,O-bis(trimethylsilyl) trifluoroacetamide  CER  ECERIFERUM  CFL  CURLY FLAG LEAF  Col-0  Columbia-0  CSL  CEP1 synthetic lethal  CYPB5  cytochrome b5  DCL  DICER-LIKE  DGAT  Diacylglycerol acyltransferase  DNA  deoxyribonucleic acid  DSO  DESPERADO  dsRNA  double-stranded RNA  ECR  enoyl-CoA reductase  EDTA  ethylenediaminetetraacetic acid  EIN5  ETHYLENE INSENSITIVE 5  xi  EMS  Ethyl Methanesulphonate  ER  endoplasmic reticulum  FAE  fatty acid elongase  FAR  fatty acyl-CoA reductase  FAS  fatty acid synthase  FAT  fatty acyl-ACP thioesterase  FDH  FIDDLEHEAD  FLP  FACELESS POLLEN  GC  gas-liquid chromatography  GC-FID  gas chromatography with flame ionization detection  GFP  green fluorescent protein  GUS  β-glucuronidase  HCD  β-hydroxyacyl-CoA dehydratase  HD-ZIP  homeodomain-leucine zipper  HEN  HUA ENHANCER  HR  hypersensitive response  HYL  HYPNOSTATIC LEAVES  KCR  β-ketoacyl-CoA reductase  KCS  β-ketoacyl-CoA synthase  LACS  long-chain acyl-CoA synthetase  LB  Lysogeny broth  LCR  LACERATA  xii  Ler  Landsberg erecta  LTP  lipid transfer protein  MAH  mid-chain alkane hydroxylase  miRNA  micro-RNA  mRNA  messenger RNA  MTR  mRNA transport regulator  MYB  myeloblastosis  NGS  next-generation sequencing  PAS  PASTICCINO  PAZ  PIWI/Argonaute/Zwille  PCR  polymerase chain reaction  PEG  polyethylene glycol  PIWI  P-element-induced whimpy testes  PM  plasma membrane  PTGS  posttranscriptional gene silencing  RDR  RNA-dependent RNA polymerase  RISC  RNA-induced silencing complex  RNA  ribonucleic acid  RNAi  RNA interference  RNase  ribonuclease  RRP  ribosomal RNA processing  SAM  S-adenosyl methionine  xiii  SE  SERRATE  SEM  scanning electron microscopy  SGS  SUPPRESSOR OF GENE SILENCING  SHN  SHINE  siRNA  short interfering RNA  smRNA  small RNA  snoRNA  small nucleolar RNA  SNP  small nucleotide polymorphisms  snRNA  small nuclear RNA  SOV  SUPPRESSOR OF VARICOSE  SSLP  simple sequence length polymorphism  ssRNA  single-stranded RNA  STI  STICHEL  T-DNA  transfer-DNA  TAC  transformable artificial chromosome  TAG  triacylglycerol  ta-siRNA  trans-acting short-interfering RNA  TEM  transmission electron microscopy  VLCFA  very long-chain fatty acid  WAR  WAX RESTORER  WBC  WHITE-BROWN COMPLEX  WIN  WAX INDUCER  xiv  WS  wax synthase  WS/DGAT  wax synthase/Diacylglycerol acyltransferase  WSD  wax synthase/Diacylglycerol acyltransferase  YFP  yellow fluorescent protein  YRE  YORE-YORE  XRN4  EXORIBONUCLEASE 4  xv  Acknowledgements I am eternally grateful to my supervisor Dr. Ljerka Kunst. Her wisdom and guidance over the course of my degree has taught me how to be a good scientist. I also wish to thank my committee members: Dr. Carl Douglas for helpful advice on my project, Dr. George Haughn for teaching me genetics and Dr. Xin Li for teaching me molecular biology when I was an undergraduate.  I thank Natural Sciences and Engineering Research Council of  Canada for funding me for three years during my Ph.D. I would like to thank past and present members of the Kunst and Haughn Lab for sharing lab expertise. Thank you to Dr. Mark Smith for taking me under his wing when I joined the lab, Dr. Owen Rowland and Dr. Xuemin Wu for teaching me how to study wax biosynthesis. Special thanks to Dr. Gill Dean and Jonathan Griffiths for their kindness and friendship. I could not have made it through without the coffee breaks. I am also thankful for having the pleasure of mentoring two wonderful undergraduates, Donald Yung and Nathan Eveleigh, who worked so hard to help me with my project. Also many thanks to other researchers who have contributed to my project: Dr. Tanya Hooker, Lifang Zhao, Mytyl Aiga, Vivian Lam and Shelly Gershuni. Thank you to my collaborators at University of California Riverside Yu Yu, Dr. Lei Gao and Dr. Xuemei Chen. Thanks to Dr. Lacey Samuels and members of the Samuels lab: Heather McFarlane, Dr. Mathias Schuetz, Rebecca Smith and Yoshi Watanabe. Their support during my degree will not be forgotten. Finally, thank you to all my friends and family. They showed me how important it is to enjoy life outside of the lab.  xvi  Chapter 1: Introduction  1.1  The Plant Cuticle The acquisition of the cuticle, a hydrophobic structure that covers the surface of  primary aerial plant tissues, represents one of the key evolutionary adaptations that allowed plants to successfully colonize land. The cuticle is synthesized by the epidermal cells and it protects the plant from non-stomatal water loss (Riederer and Schreiber, 2001), ultraviolet radiation (Reicosky and Hanover, 1978), pathogen invasion (Barthlott and Neinhuis, 1997), insect attack (Eigenbrode and Espelie, 1995), and other environmental stresses (Riederer and Muller, 2006). The hydrophobic nature of the waxes of the cuticle causes water to bead up on the surface of plants allowing for dust, pollen and pollutants to be washed away (Kunst and Samuels, 2003). Additionally, the cuticle has been reported to mediate osmotic stress signalling (Wang et al., 2011), and have a role in preventing organ fusions during development by limiting the contact of neighbouring epidermal cells (Sieber et al., 2000; Wang et al., 2011). The cuticle is composed of two types of lipids: cutin, a plant-specific polyester of 16and 18-carbon (C16 and C18) long hydroxy- and epoxy-fatty acids and glycerol (Nawrath, 2006; Pollard et al., 2008), and wax, a mixture of very long-chain fatty acids (VLCFAs) and their derivatives and variable amounts of triterpenoids and phenylpropanoids (Jetter et al., 2006; Nawrath, 2006). Wax compounds that are embedded within the cutin matrix are referred to as intracuticular waxes, whereas those that coat the surface of the cutin framework are referred to as epicuticular waxes. In some plants, such as the model plant Arabidopsis thaliana, the wax also contains secondary alcohols, ketones, triterpenoids and minor 1  secondary metabolites, such as sterols and flavonoids (Jenks et al., 1995; Kunst and Samuels, 2003). Stem wax in Arabidopsis is composed of aldehydes, alkanes, primary and secondary alcohols, ketones, esters and fatty acids.  The alkanes, secondary alcohols and ketones  comprise the majority of the wax compounds in stems. Equally, leaf wax in Arabidopsis include the same compounds, however, alkanes form the major class of compounds, and there is little secondary alcohol and ketone compared to the stem (Jenks et al., 1995). Epicuticular wax forms light-scattering crystals on the surface of Arabidopsis stems. Various plant species have different wax crystalline shapes which can be related to the specific compounds abundant in the wax (Jetter et al., 2006). For example, β-diketones, diols and secondary alcohols are associated with tube structures, whereas primary alcohols are associated with platelet-type wax forms. Other crystalline forms that are present include tubules and rods (Jeffree, 2006).  1.2 1.2.1  Cuticular Wax Biosynthesis Fatty Acid Elongation Cuticular wax biosynthesis takes place in several cellular compartments and involves  pathways for the synthesis of VLCFA wax precursors and their subsequent modification to diverse wax constituents. The precursors for the synthesis of wax, C16 and C18 fatty acids, are synthesized de novo in the stroma of leucoplasts in epidermal cells by the soluble enzymes of the fatty acid synthase complex (FAS) (Samuels et al., 2008). Synthesis of fatty acids begins with the condensation of acetyl-CoA with a 2-carbon moiety from malonyl-acyl carrier protein (ACP) to form a β-ketoacyl-ACP. The β-ketoacyl-ACP then goes through a series of reactions beginning with the reduction to a β-hydroxyacyl-ACP, dehydration to a 2  trans-Δ2-enoyl-ACP, followed by another reduction step to yield an acyl-ACP two carbons longer (Kunst et al., 2006). Condensing enzymes of the FAS have a unique chain length specificities so three different FAS complexes exist with different ketoacyl ACP synthases (KAS): KASIII (C2 to C4), KASI (C4 to C16) and KASII (C16 to C18). The two reductases and the dehydratase do not exhibit chain length specificities so they are shared by all three forms of FAS complexes (Stumpf, 1984) The elongation cycle can be repeated six or seven times to yield C16 and C18 acylACPs, respectively. To target the C16 and C18 acyl-ACPs for export out of the plastid, a thioesterase hydrolyses the acyl group from ACP, resulting in a free acyl fatty acid and free ACP. Two classes of acyl-ACP thioesterases (FAT) have been identified in plants: FATA and FATB (Voelker et al., 1997). The FATA class preferentially targets unsaturated 18:1ACP, whereas the FATB class is more active against saturated 16:0-ACP and 18:0-ACP. Analysis of the fatb mutant in Arabidopsis shows a 50% reduction in stem wax load and a 20% reduction in leaf wax load, indicating that FATB is required for providing some of the saturated fatty acids necessary for wax biosynthesis (Bonaventure et al., 2003). To prepare 16:0 and 18:0 fatty acids for export out of the plastid to the endoplasmic reticulum (ER) for VLCFA elongation, they need to be attached to CoA by a long-chain acylCoA synthetase (LACS). This allows the fatty acid to be more soluble in the aqueous environment and prevents its resorption into the plastid membranes (Kunst et al., 2006). Nine LACS genes have been identified in Arabidopsis (Shockey et al., 2002). LACS1/CER8 was recently identified as the long-chain acyl-CoA synthetase required for wax biosynthesis (Lü et al., 2009). The lacs1 mutants show a reduced cuticular stem wax load, characterized by a reduction in C29 alkanes and their derivatives, but an increase in C24-C30 VLCFAs (Lü 3  et al., 2009). Previous studies on the lacs2 mutant showed that LACS2 is involved in cutin biosynthesis (Schnurr et al., 2004), however the lacs1 lacs2 double mutant shows a greater reduction in wax compounds than either the lacs1 or lacs2 single mutants, indicating an additive relationships between LACS1 and LACS2 (Lü et al., 2009; Weng et al., 2010). The process of export from the plastid to the ER has remained a mystery until a recent study by Kim et al. (2013). They initially hypothesized that an ATP-binding cassette (ABC) transporter from the ABCA family could be responsible for the transport of lipids from the plastid to the ER as defects in animal ABCA family transporters result in accumulation of lipids in various tissues (Kim et al., 2013; Oram and Vaughan, 2006). Using a reverse genetics approach, ABCA9 was identified as a transporter of fatty acids required for seed oil, specifically triacylglycerol (TAG), biosynthesis.  Analysis of abca9 mutants showed a  reduction in TAG content in seeds, whereas overexpression of ABCA9 resulted in a 40% increase in TAG (Kim et al., 2013). The expression profile of ABCA9 showed that it is highly expressed in seeds and is localized to the ER, supporting the role for ABCA9 as a plastid to ER transporter of fatty acids (Kim et al., 2013). Null abca9 mutants are not lethal, suggesting that other ABCAs are involved in transfer of lipids from the plastid to the ER. ABCA9 is lowly expressed in the stem, and there was no reported stem wax phenotype, indicating that there might be another ABCA family transporter that is required to transport the fatty acids required for stem cuticular wax production. Once in the ER, these long chain fatty acids are elongated to C24-C36 VLCFAs that serve as the precursors for wax compounds (Figure 1.1). This elongation process is catalyzed by the fatty acid elongase complex (FAE) comprised of four enzymes: a β-ketoacyl-CoA synthase (KCS), a β-ketoacyl-CoA reductase (KCR), a β-hydroxyacyl-CoA dehydratase 4  (HCD), and an enoyl-CoA reductase (ECR). Each cycle of the 4 reactions in the elongation cycle results in the addition of 2 carbons to the growing fatty acid chain. There are 21 annotated KCS enzymes in Arabidopsis, however, each condensing enzyme is acyl chain length and process specific (Samuels et al., 2008). The condensation reaction involves condensation of malonyl-CoA with an acyl-CoA, resulting in a β-ketoacylCoA, and is thought to be the rate limiting step in elongation (Millar and Kunst, 1997). For wax biosynthesis, ECERIFERIUM 6 (CER6) has been implicated as the major condensing enzyme, as cer6 mutants display severely reduced cuticular wax on the stem surface, with reductions in wax components longer than C24 (Millar et al., 1999). Expression of CER6 is restricted to the epidermis indicating its exclusive role in wax biosynthesis (Hooker et al., 2002). The role of ECERIFERUM 2 (CER2) in elongation is a topic ripe for investigation. Previous studies of the cer2 mutant showed a decrease in all stem waxes longer than C28 and increased accumulation of waxes C28 or shorter, suggesting that CER2 has a role in the final steps of VLCFA elongation (Negruk et al., 1996; Xia et al., 1996). Cloning of CER2 showed that it encodes a protein homologous to a BAHD acyltransferase. To determine if CER2 is indeed an acyltransferase, Haslam et al. (2012) used site-directed mutagenesis to disrupt the acyltransferase catalytic residues of the CER2 protein and expressed it in the cer2 mutant. The mutated versions of the CER2 protein were able to complement cer2, indicating that the classification of CER2 as a BAHD acyltransferase does not fit with CER2 catalytic activity (Haslam et al., 2012).  Expression of CER2 in yeast does not change the fatty acid profile,  indicating CER2 acts on longer chain fatty acids (such as C28) that are not found in yeast. The Lesquerella fendleri KCS45 (LfKCS45) is able to generate C28 and trace C30 fatty acids when expressed in yeast (Moon et al., 2004), however, when co-expressed with CER2, no 5  difference in VLFCAs could be found, indicating that CER2 is not sufficient for elongation past C28 (Haslam et al., 2012). Heterologous expression in yeast has shown that CER6 is able to elongate acyl chain lengths up to C28, but when expressed in conjunction with CER2, C30 VLCFAs are detected (Haslam et al., 2012). These results indicate that CER2 may act as a cofactor with CER6 in elongation of VLCFAs, but its exact role requires further investigation. Other KCS enzymes that may be involved in cuticular wax biosynthesis include KCS1, KCS2/DAISY and KCS20 (Todd et al., 1999; Lee et al., 2009). In contrast to the KCS, the subsequent reactions in VLCFA elongation are thought to involve enzymes that are not substrate and process specific (Millar and Kunst, 1997). After condensation, the next step in elongation is catalyzed by KCR which reduces a β-ketoacylCoA to a β-hydroxyacyl-CoA. Isolation of the yeast KCR mutant, ybr159w, has led to the identification of the Arabidopsis KCR ortholog (Beaudoin et al., 2002). A survey of the Arabidopsis genome showed that there are 2 genes that have sequence homology to the yeast KCR (designated KCR1 and KCR2), but only KCR1 is able to complement the yeast KCR mutant (Beaudoin et al., 2009). As mutants in KCR1 are embryo lethal, RNAi lines targeting KCR1 were generated to suppress KCR1 gene expression. Analysis of plants expressing the RNAi targeting KCR1 shows a decrease in cuticular wax loads, which can be attributed to a decrease in VLCFA derivatives (Beaudoin et al., 2009). The Arabidopsis PASTICCINO 2 (PAS2) gene was identified as the β-hydroxyacyl-CoA dehydratase (HCD) involved in elongation (Bach et al., 2008). The pas2 mutant showed decreased levels of VLCFAs and an accumulation of hydroxyacyl-CoA intermediates. Arabidopsis PAS2 can also complement the yeast phs1 mutant which has a mutation in the yeast HCD gene. The final step in elongation is a reduction of the enoyl-CoA by an enoyl-CoA reductase (ECR).  The 6  ECERIFERUM 10 (CER10) gene was shown to encode an ECR based on mutant analysis (Zheng et al., 2005). cer10 mutants exhibit severe morphological abnormalities, such as downward curling cotyledons and reduced size of aerial organs. There is also a reduction in cuticular wax load, and changes in VLCFA composition in seed oil and sphingolipids. Following elongation, VLCFAs are processed by enzymes in two distinct pathways to generate the wax components (Figure 1.1). Primary alcohols and alkyl esters are formed via the acyl reduction, or alcohol-forming pathway, whereas aldehydes, alkanes, secondary alcohols and ketones are formed via the decarbonylation, or alkane-producing pathway.  1.2.2  Biosynthesis of Primary Alcohols and Wax Esters The first step of the alcohol-forming pathway is the conversion of fatty acyl-CoAs to  primary alcohols. Biochemical studies in jojoba (Simmondsia chinensis) and pea (Pisum sativum) showed that a fatty acyl-CoA reductase (FAR) converts VLCFAs to alcohols (Kunst et al., 2006). The Arabidopsis genome encodes eight FAR-like genes (Rowland et al., 2006). eceriferum 4 (cer4) mutants show severely decreased levels of primary alcohols and wax esters and slightly higher levels of the components in the alkane-forming pathway (aldehydes, alkanes, secondary alcohols and ketones). Analysis of the cer4 mutant showed that CER4 encodes the FAR required for generating the majority of the primary alcohols necessary for wax production (Rowland et al., 2006).  In a yeast heterologous system,  expression of CER4 resulted in the generation of C24 and C26 primary alcohols, which corresponds with the reduction of these compounds in the mutant (Rowland et al., 2006). However, C30 primary alcohols make up a small proportion of the primary alcohols found in stem wax, so there must exist another FAR that is responsible for their synthesis. 7  These primary alcohols generated by CER4 also serve as the substrates to produce wax esters (Lai et al., 2007). The production of wax esters was thought to be mediated by the action of jojoba-type wax synthases (WS), or by bifunctional wax synthase/diacylglycerol acyltransferase (WS/DGAT) enzymes similar to those of Acinetobacter (Li et al., 2008). Examination of microarray data showing genes up-regulated in the epidermis during active wax synthesis (Suh et al., 2005) indicated the potential involvement of a bifunctional wax synthase/DGAT, termed WSD1.  Reverse genetic analysis has shown that WSD1 is  responsible for the synthesis of wax esters from primary alcohols and fatty acids (Li et al., 2008). Mutants in wsd1 have severely reduced amounts of alkyl esters in their stems. Expression of WSD1 in a yeast heterologous system resulted in ester, but not TAG production indicating that WSD1 primarily functions as a wax ester synthase and not a DGAT (Li et al., 2008). It is still unclear what role jojoba-type WS enzymes may have in wax ester synthesis in Arabidopsis.  1.2.3  Biosynthesis of Alkanes, Secondary Alcohols and Ketones In contrast to the well-characterized alcohol-forming pathway, the enzymes of the  decarbonylation or alkane-forming pathway have not been fully characterized. Investigation of the eceriferum 3 (cer3) and eceriferum 1 (cer1) mutants indicates that CER3 and CER1 are components of the alkane-forming pathway. Stem wax analysis shows that the cer3 mutant has a decrease in aldehydes, alkanes, secondary alcohols and ketones, with an increase in primary alcohols and esters (Chen et al., 2003).  The substantial decrease of  aldehydes, alkanes, secondary alcohols and ketones, the products of the alkane pathway, suggests that CER3 function is required in the first step of this pathway. Initial cloning of 8  CER3 indicated that it encodes an E3-ubiquitin ligase (Hannoufa et al., 1996), however an error was made, and it was later discovered that CER3 is allelic to WAX2, YORE-YORE (YRE1), and FACELESS POLLEN 1 (FLP1) (Rowland et al., 2007), which have previously been independently identified (Ariizumi et al., 2003; Chen et al., 2003; Kurata et al., 2003). The different alleles of CER3 also exhibit other phenotypes in addition to wax-deficiency. The stronger alleles of cer3 have an organ fusion phenotype in the flower buds and leaves. As well, cer3 shows conditional male sterility as indicated by small siliques with very reduced seed set that can be rescued when plants are gown under high humidity conditions. Examination of the pollen grains in cer3/flp1 using scanning electron microscopy (SEM) showed a change in pollen structure (Ariizumi et al., 2003). Wild type pollen has a reticulate pattern on its surface, whereas the cer3 pollen grain has a smooth surface due to excess tryphine deposition. cer1 mutants show a decrease in alkanes, secondary alcohols and ketones, and an accumulation in aldehydes in stems (Jenks et al., 1995). Various alleles of cer1 show differences in stem wax load accumulation; the cer1-1 allele, which is a strong allele, has approximately 17% of the wild-type wax load, whereas cer1-6 has approximately 33% of the wild-type wax load (Sakuradani et al., 2013). Overexpression of CER1 leads to an increase in very-long chain alkane products in stems (Bourdenx et al., 2011), supporting the role of CER1 in alkane formation. In order to elucidate the role of CER1 in alkane formation, Bernard et al. (2012) sought out to find interacting partners for CER1. Though a yeast twohybrid assay, they found that CER1 physically interacts with CER3 and cytochrome b5 isoforms (CYPB5s). Coexpression of CER1, CER3 and CYPB5s in a yeast heterologous system is able to generate very long chain alkanes, specifically C29 alkane. Based on these 9  results, Bernard et al. (2012) proposed a new model for alkane production. According to this model, CER1 and CER3 form an enzymatic complex that catalyzes the conversion of VLCacyl-CoAs to VLC alkanes in a two-step reaction.  The first step creates an aldehyde  intermediate that is decarbonylated to generate the alkane and potentially a carbon monoxide or formate molecule. The CYPB5 interacts with the CER1 core of the CER1-CER3 heterodimer, acting as an electron donor required for the decarbonylation reaction. Furthermore, site-directed mutagenesis of the histidine residues on the CER1 and CER3 proteins showed that only the histidine residues of CER1, and not CER3, are essential for alkane synthesis (Bernard et al., 2012). The final step of the alkane-forming pathway, formation of secondary alcohols and ketones, was hypothesized to occur by hydroxylation of alkanes to secondary alcohols and the oxidation of the secondary alcohols to ketones. Using a reverse genetics approach, a cytochrome P450, designated mid-chain alkane hydroxylase 1 (MAH1) was shown to be responsible for the oxidation of alkanes to secondary alcohols and likely also to ketones (Greer et al., 2007). mah1 mutants showed a reduction in secondary alcohols and ketones with an increase in alkanes. Ectopic expression of MAH1 in leaves showed accumulation of secondary alcohols and ketones similar to those found in stems.  1.3  Transport of Wax Molecules Like the VLCFA elongation enzymes, all the characterized wax modification  enzymes reside in the ER (Samuels et al., 2008). Once wax molecules are synthesized, they must somehow get from the ER to the plasma membrane (PM), across the plasma membrane, and through the cell where they are deposited on the surface (Figure 1.2). Currently, the 10  mechanism of transport from the ER to the PM is unknown. Several hypotheses have been put forth on a possible mechanism of export. Wax molecules could be exported through the secretory pathway via the Golgi apparatus, carried out via acyl carrier proteins, or through physical contact between the ER and PM. In contrast, our understanding of stem wax export across the plasma membrane has advanced due to the identification of two ATP-binding cassette (ABC) transporters, from the ABCG WHITE-BROWN COMPLEX (WBC) subfamily: ABCG12 and ABCG11 (Pighin et al., 2004; Bird et al., 2007; Panikashvili et al., 2007). The ABCG family of transporters are half-transporters, meaning they require a binding partner in order to form a functional transporter. Binding can occur by homodimerization, or heterodimerization. Mutants in cer5 showed a 55% reduction in stem wax load compared to the wild type. This reduction in wax load was not due to a defect in synthesis as whole cell extractions showed no significant differences in lipid accumulation (Pighin et al., 2004). Transmission electron microscopy (TEM) of cer5 revealed linear inclusions distinct from organelles in the cytoplasm and large protrusions of cytoplasm into the vacuole exclusively in epidermal cells. These inclusions were confirmed to be lipidic in nature by Nile red staining. Expression of CER5 is restricted to the epidermis, and GFP-CER5 localizes to the PM. Molecular cloning of CER5 showed that it encodes the ABC transporter ABCG12. These data indicate that the CER5/ABCG12 half transporter is required to export cuticular lipids out of the cell (Pighin et al., 2004). Loss-of-function cer5 mutants still have trace amounts of wax accumulation; therefore additional wax transporter(s) must be required. In order to identify other ABC transporters that may be involved in wax export, genes that had similar expression patterns to 11  ABCG12, and are strongly expressed in stem epidermis were surveyed (Suh et al., 2005; Bird et al., 2007). Mutants for ABCG11/DESPERADO (DSO) displayed reduced cuticular wax loads and showed lipid inclusions inside epidermal cells, (Bird et al., 2007; Panikashvili et al., 2007). The abcg12 abcg11 double mutant does not have an additional decrease in cuticular wax loads compared to the single mutant (Bird et al., 2007). Unlike abcg12, abcg11 mutants have post-genital organ fusions and decreased cutin levels. These data indicate that ABCG11 is required for both wax and cutin export (Bird et al., 2007; Panikashvili et al., 2007). As ABCG12 and ABCG11 are half-transporters, they need to dimerize in order to be functional transporters. Using bimolecular fluorescence complementation, ABCG11 was shown to be able to homodimerize, whereas ABCG12 and ABCG11 are able to heterodimerize (McFarlane et al., 2010). In the absence of ABCG11, ABCG12 is retained in the ER of epidermal cells, indicating ABCG12 can only dimerize with ABCG11. These data suggest that export of wax requires the ABCG11/ABCG12 heterodimer, whereas cutin export requires ABCG11 homodimers (McFarlane et al., 2010). After wax components pass through the plasma membrane and out of the epidermal cell, they must get across the cell wall. The transport of wax through the cell wall to the cuticle is still an unknown process. Hydrophobic wax components must somehow pass through the aqueous environment of the cell wall to get to the cuticle. It has been suggested that lipid transfer proteins (LTPs) could potentially help transport wax across the cell wall, as LTPs are highly expressed in the epidermis during cuticle development (Suh et al., 2005). Investigation into the glycosylphosphatidylinositol-anchored lipid transfer protein designated LTPG showed that disruptions in LTPG resulted in a 25% decrease in stem wax load, 12  primarily alkanes (DeBono et al., 2009). YFP:LTPG localized to the plasma membrane and is highly expressed in the stem epidermis. LTPG is able to bind lipids in vitro, indicating that LTPG has the capacity to bind lipids such as waxes to mediate their transport (DeBono et al., 2009). Disruptions in another LTP, LTPG2, shows a less severe reduction in stem wax load (Kim et al., 2012). Mutants disrupted in both LTPG1 and LTPG2 show an increased reduction in cuticular wax levels compared to the single mutants indicating that LTPG1 and LTPG2 function redundantly and are both involved in cuticular wax export (DeBono et al., 2009; Kim et al., 2012).  1.4  Regulation of Wax Biosynthesis Even though a number of key wax biosynthetic enzymes and their cellular  compartmentations have been established, relatively little is known about the regulation of wax biosynthesis. During development and epidermal cell elongation in the stem, wax load and composition are constant along the stem (Suh et al., 2005). As seen from microarray data, the expression of many known wax-related genes is up-regulated in the stem epidermis, the site of wax biosynthesis (Suh et al., 2005). Regulation of wax production is affected by both developmental and environmental cues, but only a small number of genes involved in this process have been identified to date. The CER6 promoter sequence contains motifs that are found in light-inducible promoters and cis-regulatory elements that are involved in abscisic acid (ABA)-regulated gene expression, suggesting that light and osmotic stress may induce expression of CER6 (Hooker et al., 2002). When subjected to light, CER6 mRNA abundance increased, and in the absence of light, CER6 mRNA levels decreased after 24 hours of light deprivation, and after 96 hours in 13  dark, CER6 transcript was not detected. These results indicate that light is required for transcription of CER6 (Hooker et al., 2002). Additionally, osmotic stress caused by drought, and polyethylene glycol (PEG) or salt treatment can elicit expression of wax biosynthetic genes. When subjected to drought and salt, the wax load on rosette leaves of Arabidopsis increased 80% and 75%, respectively (Kosma et al., 2009). This increase in wax load was due to largely to an increase in alkanes. Consequently, the expression of CER1 and CER5 was found to be most significantly upregulated after drought and salt stress, which corresponds with the increase in alkanes (Kosma et al., 2009). CER6 mRNA levels were also found to be increased in response to drought, PEG and salt treatments (Hooker et al., 2002). Furthermore, osmotic stress can also induce the expression of transcription factors that in turn activate expression of wax biosynthetic genes. The MYB41 transcription factor was proposed to play a role in cuticle development in response in drought stress (Cominelli et al., 2008). Under normal conditions, MYB41 is not expressed. However, upon overexpression of MYB41, a discontinuous and more permeable cuticle forms and there is differential expression of genes involved in wax and cutin biosynthesis (Cominelli et al., 2008). Finally, drought stress triggers ABA production which activates drought-responsive genes. The MYB96 transcription factor was shown to mediate an ABA signalling pathway that helps regulate plant responses to drought stress (Seo et al., 2009). Overexpression of MYB96 using an activation tagged line (myb96-1D) resulted in a 8.6-fold increase in wax load in leaves and a 1.6-fold increase in stems, whereas myb96 mutants had a 34% and 25% decrease in wax load in leaves and stems, respectively (Seo et al., 2011). In the myb961-D mutant, the expression of many characterized wax biosynthetic and transport genes (such as 14  CER6, KCR1, PAS2, CER10, CER3, MAH1, CER4, WSD1 and ABCG12) is induced. MYB96 is able to directly bind to the conserved sequences in the promoters of KCS1, KCS2, CER6, KCR1, CER3 and WSD1 (Seo et al., 2011). It was thus proposed that MYB96 acts as a master regulator of cuticular wax biosynthesis in response to drought. In response to pathogen attack, MYB30 was shown to be a positive regulator of hypersensitive response (HR) and programmed cell death (Daniel et al., 1999). A microarray performed to identify putative targets of MYB30 post-bacterial inoculation revealed that genes involved in VLCFA elongation and CER3 were up-regulated (Raffaele et al., 2008). It was proposed that VLCFAs or their derivatives could be used as signalling molecules to activate HR and cell death. Nevertheless, it remains to be determined to what extent this transcription factor participates in wax biosynthesis under normal conditions. Other transcription factors known to regulate cuticle formation are WAX INDUCER1 (WIN1)/SHINE1 (SHN1) and its homologs (SHN2, SHN3). Overexpression of WIN1/SHN1 resulted in a dramatic increase in wax load on leaves, and a slight increase in stems. Other phenotypes include a brilliant green shiny leaves, leaf curling, increased cuticle permeability and increased drought resistance (Broun et al., 2004; Aharoni et al., 2004). WIN1/SHN1 primarily induces expression of cutin biosynthetic genes, and indirectly wax accumulation (Kannangara et al., 2007). The subsequent induction of wax accumulation by overexpression of WIN1 was shown to influence stomatal development, thereby enhancing drought resistance (Yang et al., 2011). Recently, Wu et al. (2011) reported the isolation of the CURLY FLAG LEAF 1 (CFL1) gene and demonstrated that it encodes a WW domain protein involved in cuticle development in Arabidopsis and rice. Overexpression of CFL1 (35S:AtCFL1) resulted in 15  cuticle development defects such as organ fusions and increased permeability. 35S:AtCFL1 also had reduced cuticular wax crystals on the stem surface which corresponds to a 70% decrease in wax load, but an increase in cutin (Wu et al., 2011). cfl1 mutants only show increased wax loads on trichomes. Biochemical evidence shows that CFL1 interacts with HDG1, a class IV homeodomain-leucine zipper transcription factor, which regulates two cuticle development-related genes, BODYGUARD (BDG) and FIDDLEHEAD (FDH). These data indicate that CFL1 negatively regulates cuticle development through regulation of HDG1, which in turn regulates BDG and FDH (Wu et al., 2011). Besides direct activation of wax biosynthetic genes by transcription factors, work on the wax-deficient cer7 mutant revealed that wax production in Arabidopsis stems is also controlled by the CER7 ribonuclease, a core subunit of the exosome that is responsible for the 3′ to 5′ degradation of RNA (Hooker et al., 2007). Functional characterization of the CER7 enzyme demonstrated that it positively regulates mRNA levels of CER3, a wax biosynthetic gene whose protein product is required for wax formation via the alkaneforming pathway (Hooker et al., 2007; Rowland et al., 2007). Based on analysis of cer3 mutants, CER3 is predicted to function at the start of the alkane-forming pathway (Rowland et al., 2007), and has been shown to interact with CER1 to generate alkanes in a yeast heterologous system (Bernard et al., 2012). Because CER7 is a ribonuclease, it has been proposed that it acts indirectly by degrading the mRNA specifying a repressor of CER3 transcription. A prediction of the model is that inactivation of this putative repressor would bypass the requirement of CER7 in wax biosynthesis (Figure 1.3).  16  1.5  The Exosome The exosome was first identified in yeast as a multi-enzyme RNA-processing  complex  containing proteins that are highly homologous to archaeal 3′ 5′  exoribonucleases (Mitchell et al., 1997). The main function of the exosome is to degrade and process RNA via 3′5′ exoribonuclease activity.  The individual subunits are dubbed  ribosomal RNA processing (RRP), based on their role in RNA processing (Allmang et al., 1999). Similar to the proteasome, the subunits of the core exosome are arranged in a cylindrical structure, creating a cavity for the site of RNA degradation. The six RNase PHlike subunits form a ring structure and the three S1 RNA-binding domain subunits cap the top of the ring. The high sequence similarity between the subunits of the archaeal exosome and the subunits of the eukaryotic exosome suggests that their structures are likely to be similar. The different forms of the exosome, nuclear and cytoplasmic, serve different roles in RNA processing and degradation. The nuclear form of the exosome performs the majority of the RNA processing in the cell and targets more types of RNA (Jensen and Moore, 2005). It is involved in the 3′ processing of RNA molecules such as 5.8S rRNA, small nuclear RNA (snRNA), and small nucleolar RNA (snoRNA), and the degradation of the 5′ transcribed spacer of pre-mRNA transcript (Butler, 2002). mRNA (Houseley et al., 2006).  The cytoplasmic exosome only processes  By regulating the levels of mRNA in the cell, the  cytoplasmic exosome also indirectly regulates protein levels. The cytoplasmic exosome also targets aberrant mRNA that contains structural defects such as a premature stop codon or no termination codon. As well, it is thought to have a role in the 3′ degradation of products of the RNAi pathway (Chekanova et al., 2007). 17  In Arabidopsis, nine core subunits of the exosome have been identified: AtRRP4, AtRRP40, and AtCSL4 which represent the S1 binding domain subunits, and AtRRP41, AtRRP42, AtRRP43, AtRRP45, AtRRP46 and AtMTR3 which are the RNase PH-like subunits (Figure 1.4) (Chekanova et al., 2007). The RNase PH-like core subunits of the Arabidopsis exosome are arranged in three heterodimers: RRP41-RRP45, RRP42-MTR3 and RRP43-RRP46, and the three S1/KH domain proteins, RRP4, RRP40 and CSL4 are bound to the core as a cap (Lange and Gagliardi, 2010). In Arabidopsis, 2 copies of the subunits RRP45 (RRP45A and RRP45B) and RRP40 (RRP40A and RRP40B) are encoded (Hooker et al., 2007; Chekanova et al., 2007). All core subunits of the exosome are essential in yeast. Disruption in any of the core subunits results in growth delays or lethality. Unlike the yeast and human exosome, the core subunits of the plant exosome have specialized and diverse function in plant development. The subunit AtRRP45B corresponds to CER7 (Hooker et al., 2007). Expression of CER7 was able to rescue the yeast rrp45 mutant, though expression of RRP45A resulted in partial rescue of the rrp45 mutant. Disruption in the AtRRP45A subunit does not lead to a waxdeficient phenotype as seen in cer7 mutants, and expression of AtRRP45A under the CER7 promoter is able to complement the cer7 wax-deficient phenotype (Hooker et al., 2007). Double mutants of AtRRP45A and CER7 are lethal (Hooker et al., 2007). These data suggest that AtRRP45A and CER7 are partially redundant and can both mediate wax deposition. However, when either CER7 or RRP45A were expressed under the control of the epidermis-specific CER6 promoter in cer7 plants, only expression of CER7 was able to rescue the wax-deficient phenotype (P. Lam, unpublished data). AtRRP41 is required for female gametogenesis (Chekanova et al., 2007).  Loss of AtRRP41 activity resulted in 18  heterozygous rrp41/RRP41 plants producing viable seeds and aborted ovules in a 1:1 ratio (Chekanova et al., 2007). AtRRP4 is necessary for embryo development and loss of AtRRP4 activity results in growth arrest at an early stage of embryogenesis. No phenotype was observed in mutants of AtCSL4 (Chekanova et al., 2007). In yeast and humans, the RNaseH-PH domain subunits that form the core of the exosome have lost catalytic activity, however, these domains are still active in plants (Lange and Gagliardi, 2010).  A number of cofactors have been isolated that aid in exosome  function: an RRP44-like protein, termed SUPPRESSOR OF VARICOSE (SOV), that plays a role in cytoplasmic 3′  5′ mRNA degradation, MTR4, a putative RNA helicase, and 3 RRP6-like proteins, one of which functions in degradation of a polyadenylated RNA (Zhang et al., 2010; Lange et al., 2011; Lange et al., 2008).  1.6  Research Objectives The proposed target of the CER7 exoribonuclease is an mRNA specifying a repressor  of CER3, a wax biosynthetic gene whose gene product is required for wax production via the alkane pathway (Rowland et al., 2007; Bernard et al., 2012). In the cer7 mutant, the levels of CER3 transcript are reduced, suggesting that CER7 is a positive regulator of CER3 transcription (Hooker et al., 2007). Transcriptional regulation of CER3 by CER7 was further examined by using the β-glucuronidase (GUS) reporter gene under the control of the CER3 promoter. In wild type plants, CER3pro::GUS activity is seen in the stems and siliques (Kurata et al., 2003). However, when CER3pro::GUS is introduced into the cer7-1 mutant plant by crossing, GUS activity is restricted to the abscission zone subtending the siliques, and is greatly reduced in the stem (Hooker et al., 2007). Since CER7 is a ribonuclease, it 19  cannot positively regulate levels of CER3, and therefore it must act indirectly. It has thus been proposed that the CER7 exoribonuclease degrades the mRNA specifying a repressor of CER3 transcription thereby activating cuticular wax biosynthesis via the alkane pathway The overall aim of my PhD was to identify the putative repressor and the target of the CER7 exoribonuclease, which would contribute to our overall understanding of how cuticular wax biosynthesis is regulated in developing Arabidopsis inflorescence stems. My specific research objectives were to: 1. Perform a genetic screen for mutations that suppress the stem wax deficiency of cer7-1.  Such suppressors will have waxy stems, indicating restored  cuticular wax levels, and were therefore named war mutants (wax restorer) (Chapter 3). 2. Carry out genetic and molecular analysis of the isolated war mutants (Chapter 4). 3. Clone and characterize a number of WAR genes, examine the cell and tissue specificity of their expression and determine their role in CER7-mediated regulation of CER3 transcription (Chapter 4).  20  Figure 1.1 Pathway for cuticular wax biosynthesis. Very long chain fatty acids (VLCFAs) are generated by a series of 4 reactions catalyzed by the enzymes of the fatty acid elongase. One round of elongation will add 2 carbons donated by malonyl-CoA to the growing fatty acyl chain. After elongation, VLCFAs are used to generate the aliphatic compounds that make up wax via 2 distinct pathways.  21  Figure 1.2 Current model for wax transport Once wax components are made in the ER, they are exported out of the plasma membrane by ABC transporters (ABCG11/WBC11 and ABCG12/CER5). Export out of the cell wall to the surface of the plant is through lipid transfer protein (LPTs; LTPG and LTPG2) (from Samuels et al., 2008. Reprinted with permission).  22  Figure 1.3 Current model illustrating CER7-mediated regulation of wax biosynthesis. In wild type, the exosome degrades the mRNA specifying a repressor of CER3. In the absence of the repressor, CER3 is expressed which leads to the production of the wax components generated by the alkane-forming pathway. In the cer7 mutant, the CER7 exosomal ribonuclease is not able to degrade the mRNA specifying the repressor. The repressor is translated and represses CER3 expression. Without expression of CER3, the synthesis of wax compounds via the alkane-forming pathway does not occur, leading to the glossy stem phenotype seen in the cer7 mutant.  23  Figure 1.4 The Arabidopsis exosome is composed of 9 core subunits. The 6 RNase PH-like core subunits of the Arabidopsis exosome are arranged in three heterodimers and form the barrel of the exosome. Three S1/KH domain proteins bind to the core as a cap. The RRP45 subunit corresponds to CER7.  24  Chapter 2: Materials and Methods  2.1  Plant Material and Growth Conditions cer7-1 sti and cer7-3 are in the Landsberg erecta genetic background and the  Columbia-0 (Col-0) genetic background, respectively. T-DNA insertion lines rdr1-1, rdr1-5 (SALK_109922), rdr1-6 (SALK_112300), rdr1-7 (SALK_125022), rdr1-8 (SALK_007638) and all ago insertion lines listed in Table 5.1 are in the Col-0 genetic background, and were obtained from the Arabidopsis Biological Resource Center (ABRC) (www.arabidopsis.org). hen1-8 seeds were a gift from Dr. Xuemei Chen (UC Riverside) and are in the Col-0 genetic background. Seeds were germinated on AT-agar plates (Somerville and Ogren, 1982) for 710 days and transplanted to soil (Sunshine Mix 4, SunGro). All plants were grown in an environmental chamber at 19-21°C under continuous light (90-110 µE m-2 s-1 of photosynthetically active radiation).  2.2  Transformation of Arabidopsis Transgenes were introduced into Arabidopsis plants using the floral dip method  (Clough and Bent, 1998). Briefly, a 5mL culture of Agrobacterium containing the construct was grown overnight at 30°C in Lysogeny Broth (LB) containing the appropriate antibiotics. 1mL of the overnight culture was then transferred to 200mL of LB containing the appropriate antibiotics and then allowed to grow overnight at 30°C. The culture was then centrifuged at 5000rpm for 10 minutes and the pellet was resuspended in a 200mL solution containing 5% table sugar and 0.02% silwet.  Flowers of Arabidopsis plants were immersed in the  25  Agrobacterium solution for 5-10 seconds. Dipped plants were then covered with a plastic dome overnight to maintain humidity.  2.3  Molecular Complementation of cer7 with the CER3 Transgene The 1899bp CER3 coding region was excised from the plasmid pESC-  TRP:ProGAL1:CER3 (P. Lam unpublished results) using BamHI and NheI. This fragment was cloned into the plasmid pBluescriptII:ProCER6 (P. Lam, unpublished results) into the corresponding restriction enzyme sites to generate pBluescriptII:ProCER6:CER3.  The  ProCER6-CER3 fragment was then excised using XhoI and SstI and cloned into pRD400 (Datla et al., 1992) that was excised with SalI and SstI (SalI and XhoI form compatible ends). The resulting plasmid, pRD400:ProCER6:CER3 was transformed into Agrobacterium tumefaciens strain GV3101, pMP90 (Koncz and Schell, 1986) via electroporation. Cer7-3 plants were transformed using the floral dip method as described above.  2.4  Mutagenesis of cer7-1 sti Approximately 12,000 cer7-1 sti seeds were soaked in a solution of 0.1M Na3PO4,  5% DMSO and 100mM Ethyl Methanesulphonate (EMS) for 5 hours. After mutagenesis, the seeds were washed twice with 100mM Na2S2O3 and then twice with distilled water for 15 minutes per wash. Seeds were allowed to dry overnight before planting directly in soil in 64 total pots. Plants were grown until maturity and M2 seeds were harvested collectively from each pot, yielding 64 batches. In the primary screen, M2 seeds from each of the 64 batches were grown up and scored for a waxy stem phenotype. Plants that did not have a waxy phenotype were discarded. Those plants that were waxy were grown to maturity and seeds 26  were harvested individually. These plants were then subjected to a secondary screen to confirm that they indeed have a waxy stem, the stichel trichome and that the cer7-1 mutation was still present.  2.5  Genotyping DNA was extracted according to Berendzen et al. (2005). Briefly, a young rosette  leaf was ground with a pestle in a microcentrifuge tube in 200µL of buffer containing 50 mM Tris-HCl pH 7.5, 300 mM NaCl and 300 mM sucrose. Ground tissue samples were heated at 90-95°C for 10 minutes, and then centrifuged in a microcentrifuge for 1 minute to pellet the leaf tissue. Samples were then stored at 4°C. 1µL of the supernatant was used as template for PCR analysis. To genotype cer7-1, dCAPS primers cer7-1_AflII-F and cer7-1_AflII-R were used to amplify a 210bp fragment. The PCR product was then digested with AflII and run on a 1.5% agarose gel. The mutation in cer7-1 allows for the cleavage of the PCR product after AflII digestion resulting in an 185bp and a 25bp product. To genotype hen1-8, primers hen1-2_F and hen1-2_R were used to amplify a 585 bp PCR product. The mutation in hen1-8 allows for the cleavage of the PCR product after HpaI digestion. To genotype ago1-11, primers ago1-11_F and ago1-11_R were used to amplify a 385 bp fragment. The PCR product was then subjected to BsrI digestion, which yields an extra band for the mutant allele. T-DNA insertion lines were genotyped using LBb1.3 and gene specific primers as listed in Table 2.1.  27  2.6  Cuticular Wax Extraction and Analysis Cuticular waxes were extracted from 4-6 week old Arabidopsis stems. Stems were  immersed for 30 seconds in chloroform containing 10µg n-tetracosane which was used as an internal standard. After extraction, samples were subjected to a gentle stream of nitrogen until dry and redissolved in 10µL N,O-bis(trimethylsilyl) trifluoroacetamide (BSTFA) (Sigma) and 10µL pyridine (Fluka). Samples were derivatized for 60 minutes at 80°C. After derivatization, excess BSTFA and pyridine were removed under a stream of nitrogen, and samples were dissolved in 30µL of chloroform. The samples were analyzed by gas chromatography (GC) on a HP 6890 series gas chromatograph equipped with flame ionization detection and a 30m HP-1 column with helium as the carrier gas. GC was carried out with temperature-programmed on-column injection and oven temperature set at 50°C for 2 min, raised by 40°C min–1 to 200°C, held for 2 min at 200°C, raised by 3°C min–1 to 320°C, and held for 30 min at 320°C. Quantification of wax loads were determined by comparing the flame ionization detector peak areas to the internal standard. Stem surface area was calculated by photographing stems prior to wax extraction, measuring the number of pixels, converting them to cm2, and multiplying by π.  2.7  Quantitative RT-PCR RNA was extracted from plant tissue using TRIzol (Invitrogen) as per manufacturer’s  protocol. RNA quantification was performed using a NanoDrop 8000 (Thermo Scientific). 500ng of total RNA was treated with DNaseI (Fermentas) and then used for first strand cDNA synthesis using iScript RT supermix (Bio-Rad). Quantitative RT-PCR was performed 28  using gene-specific primer sets from Table 2.1, in 20µL reactions using iQ SYBR green supermix (Bio-Rad) and run on the iQ5 real-time PCR detection system (Bio-Rad). Data were analyzed using the Pfaffl method (Pfaffl, 2001), and control samples were normalized to 1. Statistical significance was measured with a student’s T-test.  2.8  Positional Cloning of Suppressor Lines  2.8.1  Isolation of DNA To map the position of suppressor lines, each suppressor line was crossed to cer7-3  and grown to the F2 generation. DNA from leaves was collected on FTA cards (Whatman) by pressing leaf samples overlaid with parafilm onto the FTA card with the conical end of a glass tube.  Leaf pressings were allowed to dry at room temperature for a day before  processing. To process leaf samples prior to PCR, 0.1mm leaf discs were taken from the leaf pressings by using a single hole punch. The leaf discs were transferred to a 0.2mL PCR tube and soaked with 50µL FTA wash solution [10 mM Tris HCl pH 8.3; 2 mM EDTA; 0.1 % Tween 20 (v/v); dH2O] for 5 minutes. The FTA buffer was removed and the leaf punches were rinsed twice by adding 200µL TE-1 buffer [10 mM Tris HCl pH 8.0; 0.1 M EDTA; dH2O].  2.8.2  Rough Mapping 30-40 plants with the wild-type waxy stem phenotype (plants homozygous for the  suppressor mutation) were subjected to PCR using simple sequence length polymorphism (SSLP) markers to determine linkage. Markers used for rough mapping are outlined in Table 2.2. PCR conditions are as followed: Initial denaturation at 94°C for 2 minutes, followed by 29  35 cycles of denaturation at 94°C for 1 minute, annealing at the primer-specific temperature for 1 minute, extension at 68°C for 1 minute and concluding with a final extension at 68°C for 10 minutes.  2.8.3  Fine Mapping To further pinpoint the location of each suppressor loci, over 1000 plants were  screened with SSLP markers until a narrow interval was found. Markers used for fine mapping are outlined in Table 2.3  2.9  Molecular Complementation and Subcellular Localization of RDR1 A 5252bp DNA fragment containing 1754bp of the upstream region of RDR1 and the  coding region minus the STOP codon was amplified from wild type Col-0 plants with primers RDR1p-attB1 and RDR1-attB2_noSTOP using Phusion polymerase (Finnzymes). Gateway adapters were added using the adapter protocol (Invitrogen). This 5252bp fragment was  cloned  into  pDONR221  using  BP  Clonase  II  (Invitrogen)  to  create  pDONR221:ProRDR1:RDR1ΔSTOP and was sequenced to confirm that no mutations were introduced during PCR. The fragment was then recombined into the destination vector pGWB4 (Nakagawa et al., 2007) using LR Clonase II (Invitrogen) to generate pGWB4:ProRDR1:RDR1:GFP. This construct was introduced into rdr1-2 cer7-1 plants via Agrobacterium-mediated transformation as described above. Spinning disk confocal microscopy was performed on a Perkin Elmer Ultraview VoX Spinning Disk Confocal mounted on a Leica DMI6000 inverted microscope. GFP was 30  detected using a 488nm laser and 528/38-nm emission filters.  Acquired images were  processed using Volocity (Improvision) and ImageJ.  2.10 RDR1 Promoter:GUS Fusion and GUS Activity Assay To generate ProRDR1:GUS, a 1754bp region upstream of the RDR1 initiation codon was amplified from genomic DNA using the primers RDR1pro_EcoRI-F and RDR1_XbaI-R with Phusion polymerase (Finnzymes). The PCR product was digested with EcoRI and XbaI and cloned into the corresponding restriction enzyme sites of pBluescriptIISK(+) (Stratagene). After confirmation that no errors were induced from PCR, the ProRDR1 region was excised using SalI and BamHI and cloned into the corresponding sites of pBI101 (Clontech) to generate pBI101:ProRDR1:GUS. Stems from transgenic plants containing the ProRDR1p:GUS construct were removed and immersed in GUS staining buffer containing 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide, 100 mM Na2HPO4, 100 mM NaH2PO4, 0.2% Triton-X-100, and 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-Gluc) overnight at 37° C. Stems were then cleared of chlorophyll by overnight incubation in 75% ethanol. Stained and cleared samples were examined by compound light microscopy.  2.11 Isolation of RNA for RNA-seq 300mg of tissue from the top 3cm of Arabidopsis WT Col-0, cer7-3, rdr1-7 cer7-3, sgs3-13 cer7-3 stem was collected and frozen in liquid nitrogen. These tissues were then ground to a fine powder with a pestle. 5mL of TRIzol (Invitrogen) was added to each sample and allowed to incubate at room temperature for 5 minutes. 1 mL of chloroform was added and samples were mixed by shaking and incubated at room temperature for 2-3 minutes. 31  Samples were centrifuged at 4000rpm at 4°C for 30 minutes. After centrifugation, 3.5mL of the top phase was transferred to a fresh tube containing 5mL isopropanol. The RNA was allowed to precipitate at room temperature for 10 minutes before being spun at 4000rpm at 4°C for 30 minutes. The pellet was then washed with a 75% solution of ethanol and spun at 4000rpm at 4°C for 15 minutes. The pellet was allowed to dry at room temperature for 10 minutes and the RNA was suspended in 50µL of water. To help dissolve the pellet, the RNA was placed at 60°C for 10 minutes. Concentration and purity of RNA was measured on a NanoDrop.  2.12 Small RNA Extraction and Library Construction 20-25 µg of purified total RNA was denatured in 2X small RNA loading dye (80% Formamide, 0.1% xylene FF, 0.1% bromophenol blue) at 70°C for 10 minutes. The RNA was then separated on a 15% polyacrylamide gel run in 0.5X TBE buffer. Small RNAs equal to approximately 15-40 nt in length were excised from the gel using a clean razor blade. RNA was recovered by breaking the gel fragments in 0.4M NaCl and incubating overnight at 4°C, then precipitating with 1µL glycogen, 1/10 volume 3M NaOAc (pH5.2) and 2 volumes of ethanol at -20°C for 6 hours. The RNA was centrifuged at 13200rpm at 4°C for 15 minutes, washed with 70% ethanol and then air-dry. The pellet was dissolved in 6µL DEPCtreated water. Small RNA library construction was done using the Illumina Tru-Seq Small RNA Sample Prep Kit as per manufacturer’s protocol.  32  Primer LBb1.3 cer7-1_AflII-F cer7-1_AflII-R cer7-3_LP2 cer7-3_RP2 SALK_109922-LP2 SALK_109922-RP2 SALK_112300-LP3 SALK_112300-RP3 SALK_125022-LP2 SALK_125022-RP2 SALK_007638C-LP2 SALK_007638C-RP2 hen1-2_F hen1-2_R ago1-11_F ago1-11_R RDR1pro_EcoRI-F RDR1_XbaI-R RDR1p-attB1 RDR1-attB2_noSTOP CER3-qPCR-F CER3-qPCR-R RDR1-RT-F RDR1-RT-R ACTIN2-F ACTIN2-R  Sequence 5′-ATTTTGCCGATTTCGGAAC-3′ 5′-CTGCACTGTAGGAGGAGAGAATGCT-3′ 5′-CAAACGTGAAGGCTATTGGG-3′ 5′-CTGGCTGTTCTGGTTGGAGT-3′ 5′-CATTTCCAGAGCCGTTCATT-3′ 5′-CAACAGGGCAGTGACTGAAA-3′ 5′-GTTCCCTCAGTTTCCGATGA-3′ 5′-CGTGGAGCAAGTACCAACCT-3′ 5′-ATGGGTCACTAAACGCCTTG-3′ 5′-GCTTGATGTGGCCTCAAAGT-3′ 5′-GATTGGCCCATTCAGAGAAA-3′ 5′-GCTTGATGTGGCCTCAAAGT-3′ 5′-GATTGGCCCATTCAGAGAAA-3′ 5′-GAATGGAGGCGGCTTTTT-3′ 5′-ACGTTGCAAGCTTCCTTGTT-3′ 5′- TAGGCAGGAGCTCATTCAGG-3′ 5′- CGGATGGCATCAAGTTCATA-3′ 5′-CGCGAATTCTTTCAGAGTGTGTAATATTTTC-3′ 5′-AGATCTAGATCAACCGAAACGCAGAACATGG-3′ 5′-AAAAAGCAGGCTTTTCAGAGTGTGTAATATTTT-3′ 5′-AGAAAGCTGGGTAACCGAAACGCAGAACATGGTCTA3′ 5′-CTCATCTCCTGTTCCACATCC-3′ 5′-TCAATGGAACACCAGCTACG-3′ 5′-TATGGTGGACTGCGTTGTGT-3′ 5′-TTCGCGATGATCCCTAAACT-3′ 5′-TCCCTCAGCACATTCCAGCAGAT-3′ 5′-AACGATTCCTGGACCTGCCTCATC-3′  Table 2.1 Primers used for genotyping, cloning and qRT-PCR.  33  Primer F16J7-TRB F3F19 F10B6I-5 F3O9 F20D23 LUGSSLP887 CIW12 CIW1 NF5I14 CIW3 NGA168 CIW11 LUGSSLP08 T21P20-SP6 LUGSSLP815 T32N15 PvuII MnlI T6H20-2 F1P2 T24C20  Sequence TGATGTTGAGATCTGTGTGCAG GTGTCTTGATACGCGTCGAT TGAAACCCTGCCGGAGGAAG TCATCCCAAGGTCATGCTCG TGTGCATGGTATTATAGGTGG AATCGCCTACTATATCTTTCAG GCCCTTCGTTTTTGTCGAT TTGAGGAACTTACAATTCTTGTCG GCAATTTGAAGCGTTTTGTT GGTTTCCTTTTCAGGCAATTC ATTTTGGATTAACTTATGTTTATGCGT CATATACTGTCATAGTAAATGGTCCTTATCT AGGTTTTATTGCTTTTCACA CTTTCAAAAGCACATCACA ACATTTTCTCAATCCTTACTC GAGAGCTTCTTTATTTGTGAT GGCATCACAGTTCTGATTCC CTGCCTGAAATTGTCGAAAC GAAACTCAATGAAATCCACTT TGAACTTGTTGTGAGCTTTGA GAGGACATGTATAGGAGCCTCG TCGTCTACTGCACTGCCG CCCCGAGTTGAGGTATT GAAGAAATTCCTAAAGCATTC ATTTGCACTCAAGAAAAACAAAGA AACGTATAACGTAATGAAAGTAGGTGA CAAGCTTCATGGGGACTAG TAATACGGGACAATCTACAACAC ATCTATCAAAAGAAATGCAACGAGA TTCATGTACGATATTGTTTTCCCA TTGTGACGAATAGTGAAAGGAGA TTCTAAAAACCATCTGAAAATCCTT ACATTCCTCTAATCTTACCTTAAACCA CTCGCCGTGAAAATAACCAA TGGTCGATTATTTGAAGGGAAC CATCCTTTGGATCCCACTTG TGCATTGGTTTCTCTGCTTG GGGAAACCTCCATACTCGAA CAGCATCAGCATATCTGTAT CGACTTGAACTATCAACCTA CCGAACAATATCGTGTGTGTG GCTTGCACTTTCTTTCCTTGA 34  Primer ALS T4D2 nga6 JAERI-20 T27E11 SGCSNP216 CIW4 F18A5 T30C3 F19B15 MWD9V-7F/R CIW9 MRI1  Sequence GGCAACACATGTTCTTGGTG ATCACAGGACAAGTCCCTCG CATAAAGAACTGGTTGGAGT GGTTCAAGTTCAACAGTAGC ATGGAGAAGCTTACACTGATC TGGATTTCTTCCTCTCTTCAC TCCAAATGAGGAATCACTTC CCTCGGTCTACCATACAAAG ACTCACTATGATGCTGAAGG GCAGCCACTTCGATTCAAGG GTGACTCAGGCCCAGTCCAC AAGGTCTTCGTCTGGCGCTT GTTCATTAAACTTGCGTGTGT TACGGTCAGATTGAGTGATTC ATAACAAGGGGGCATCATCC CGTCCTTCGAATCTGTTTCC GCGTTTATGTCCTAATTTGG TCATCAGGGTAAGTGTATCC ACTAGCATGCAACAGTGATC CTTTTGTGGATGGTAACACG GCAAGAAAAATGCTTACATGTT CAACGAAATCCAAATCCTCTC CAGACGTATCAAATGACAAATG GACTACTGCTCAAACTATTCGG TACATAACCGCAAACCTTTT ATATGCGTATTTCTGCAAGC  Table 2.2 Primers used in rough mapping of war2 and war3  35  Primer F17A19 F14L17 T5E21 F9L1 F18L15 PL1344 J3_17160019 PL1867 PL217  Sequence TAACAAGACTCGCGCAGTTG CGAGAAGAGAGATCGCTGGA AATACTATCTCAGCAGAAATGCAG AAACGAAAAGATAATGAAACTTTACCA AAAAACAATCTAAATGTTCACTACGC TGATCTTAATCTTAATCTCTCCTTTTC AGAAATGAACAGGAGAATTGACTT TTTGACTCACTTTCACCACTTTG TCATTTTGCGACTACGACCA TCGTTTCTTTTCTGGGCTTG CACTGGAAATGTATTTGATGTGTTC GAACAAATATGTCTCCAAGCACA GAACAAATATGTCTCCAAGCACA TCGAACTTTAGATTTCATAACTTTGTT CCACAACCAAAGAAAGATCCA CTTGTTGAAATTGATGAGTCTGA TGGAGCAACGAAGTTGATGA GCCGAATAAACTTTCTTTAA  Table 2.3 Primers used in fine mapping of war2 and war3  36  Chapter 3: A Screen for Suppressors of cer7  3.1  Introduction CER7 was previously shown to encode a ribonuclease that forms part of the RNA  processing and degrading complex, the exosome (Hooker et al., 2007). Expression analysis of other wax-related genes in the cer7 mutant showed that CER7 is a positive regulator of CER3 a key wax biosynthetic gene which is involved in alkane biosynthesis (Hooker et al., 2007; Bernard et al., 2012). Since CER7 is not a transcription factor, but a ribonuclease, it must work indirectly to regulate CER3. Therefore, it was hypothesized that CER7 regulates cuticular wax biosynthesis by degrading a repressor of CER3. The objective of the work described in this chapter was to search for the putative CER3 repressor and try to identify additional components involved in CER7-mediated regulation of cuticular wax biosynthesis. To do this, in collaboration with another graduate student in the Kunst Lab, L. Zhao, we performed a genetic screen for extragenic mutations that suppress the cer7 glossy (wax-deficient) stem phenotype.  3.2  ProCER6:CER3 Transgene Complements the cer7-3 Wax Deficiency A key assumption in finding the target of the CER7 exosomal ribonuclease is that it  acts on an mRNA encoding a repressor that binds the promoter of the CER3 gene to control its transcription during development. Presumably, the mRNA of this putative repressor is not degraded in the cer7 mutant, and the presence of the repressor inhibits CER3 transcription. Consequently, the CER3 protein and all the wax components downstream of CER3 in the wax biosynthetic pathway are not synthesized. To test our proposed model, I attempted to 37  rescue the cer7 phenotype by expressing the CER3 coding region behind the epidermisspecific CER6 promoter (Millar et al., 1999) to which the predicted repressor should not bind. As expected, the transformants that received the ProCER6:CER3 transgene were waxy (Figure 3.1A) and had restored CER3 transcript levels as detected by quantitative real time PCR (Figure 3.1B). As a negative control, I also introduced the ProCER3:CER3 transgene into cer7-3, but this construct failed to complement the cer7-3 phenotype and increased CER3 transcript was not detected (Figure 3.1B). These data provide direct evidence that the cer7 phenotype is related to reduced CER3 transcription, and that the CER3 promoter sequence is relevant to CER7-mediated control of CER3 transcript levels.  3.3  Initial Screening of Suppressor Lines For the initial screen, approximately 12,000 cer7-1 sti double mutant seeds were  mutagenized with Ethyl Methanesulphonate (EMS) (M1 population), which induces point mutations. The sti mutation, which results in a single-pronged trichome (Ilgenfritz et al., 2003), was introduced into the cer7 background to rule out false positives caused by wild type seed contamination. For ease of screening, the M1 population was grown in 64 batches. The M1 population was grown to maturity for bulk harvest of each batch of the M2 seeds. Visual inspection of the M2 population resulted in the identification of 824 putative cer7 suppressors with waxy inflorescence stems (Table 3.1). These suppressors were named war mutants (for wax restorer).  38  3.4  Secondary Screening of Suppressor Lines The M3 progeny of all the war lines identified in the primary screen were then  subjected to more rigorous analyses. Each of the putative suppressor lines was again visually inspected to confirm the presence of the wild-type glaucous stem phenotype and the sti trichome phenotype. Plant lines that were not waxy or did not contain the sti trichome were discarded. The remaining putative suppressor lines were then genotyped using a PCR-based assay to ensure that the original cer7-1 mutation was still present, and not corrected in the mutagenesis. Second site mutations in the same gene can also often restore the wild-type phenotype. However, it is not likely that these putative suppressor lines have a second site mutation in CER7 since cer7-1 causes a premature stop codon (Hooker et al., 2007). The mutation in cer7-1 allows for the cleavage of the PCR product with AflII digestion resulting in a smaller fragment, whereas the wild-type PCR product will not digest. Upon completion of these tests, the number of putative suppressor lines was reduced from 824 to 100 (Table 3.2). Thus, the restored stem wax loads in these lines were due to mutations at sites distinct from the original cer7-1 mutation. The 100 lines retained after the secondary screen fell into two general groups: group one including plants with completely waxy, wild-type-looking stems, and group two including plants with waxy stem bases, but glossy tops. There was also variability in the growth and morphology of the recovered suppressor lines. Some lines grew like wild type plants, whereas others were stunted and bushy.  39  3.5 3.5.1  Tertiary Screen of Suppressor Lines Wax Analysis One of my qualifiers for identifying a true suppressor of cer7 was that it suppresses  the cer7 wax deficient phenotype. The cer7 wax deficiency is characterized by a 75% reduction in total wax on the stem (Figure 3.2). Stem wax in Arabidopsis is mainly (90%) comprised of aldehydes, alkanes, secondary alcohols and ketones, which are generated by the decarbonylation or alkane-forming pathway. The remaining components (10%), primary alcohols and wax esters, are generated by the acyl reduction or alcohol-forming pathway. Compositional analysis of the individual wax components in the cer7 revealed that there was a significant decrease in aldehydes, alkanes, secondary alcohols and ketones, all the components of the alkane-forming pathway (Figure 3.3). Due to the decrease of components found in the alkane-forming pathway, there is a slight increase of primary alcohols in cer7. Therefore, the reduction in the amount of cuticular wax on the stems of cer7 mutant plants is a result of a decrease in the products of the alkane-forming pathway. Consequently, instead of only 10% of the wax components being derived from the alcohol-forming pathway, the composition is shifted so that the alcohol-forming pathway contributes 45% of the wax components (Figure 3.4). Gas chromatography with flame ionization detection (GC-FID) was performed on all 100 putative suppressor lines to determine if the stem wax levels, as well as the composition of wax components were restored to that of the wild type. Analyses were performed on plants that were 4 weeks old and sampled from a 10cm stem. The data are summarized in Table 3.3. There was much variability in the wax loads of the suppressor lines. Wax loads ranged from 20% to 150% restoration. Group two plants, that showed waxy bottoms and 40  shiny tops generally, were lines that did not have increased wax loads. Lines that had wildtype-like wax composition and wax loads restored to at least 75% of wild type were taken for further analysis. This cutoff was arbitrarily set in order to assay a broad spectrum of mutants, but to still eliminate false positives.  3.5.2  CER3 Transcript Levels In the cer7 mutant, there is an approximately 80% decrease in CER3 transcript  abundance, indicating that CER7 is a positive regulator of CER3. It also suggests that the cer7 wax deficient phenotype is a result of decreased CER3 expression, as CER3 is proposed to be a key gene in the alkane-forming pathway (Bernard et al., 2012). I therefore proposed that a suppressor of cer7 should have restored CER3 transcript levels if the repressor of CER3 is mutated in the cer7 suppressor line.  Quantitative realtime PCR analysis was  performed on the 100 putative suppressor lines. The data are summarized in Table 3.3. Lines that had at least 75% restored CER3 transcript levels were prioritized for further analysis.  3.6  Allelism Tests Based on analysis of wax load and composition and CER3 transcript levels, I selected  lines that had completely waxy stems, wild-type wax composition and at least 75% wild-type wax load, and 75% CER3 transcript levels. This allowed me to narrow down the number of suppressor lines on which to focus to 30 lines. I performed reciprocal crosses with all 30 lines to determine the number of possible complementation groups I had, which would indicate how many unique suppressor lines were present. If the F1 progeny of a cross 41  between different suppressor lines yielded a wax-deficient plant, it would indicate that those lines contained a mutation in different genes. Conversely, if the F1 progeny of a cross between different suppressor lines yielded waxy plants, then it failed to complement and there was a mutation in the same gene (i.e. they were allelic). When the F1 generation of all these crosses was analyzed, the results were ambiguous and I was not able to confidently sort them into distinct complementation groups. However, I could group them into several defined clusters (Figure 3.5).  3.7  Rough Genetic Mapping Since the complementation crosses did not result in defined complementation groups,  candidate lines from each cluster were selected for rough genetic mapping to determine the location of each mutation. These candidates were selected based on two criteria: First, they were lines that were sorted as group one mutants: suppressors with stems that were completely waxy at the top and bottom. Second, these lines had no other morphological or growth defects, indicating that there were no secondary mutations affecting their wax phenotype. Seven lines in total were chosen for rough mapping (3-1, 14-1, 31-6, 34-6, 50-5, 51-1 and 55-5). To map the war mutations, war cer7-1 in the Landsberg erecta (Ler) background, was crossed to cer7-3 in the Columbia ecotype to create a mapping population. F2 plants exhibiting a waxy phenotype were used to establish linkage, and preliminary analysis revealed at least 4 distinct loci, war1 through war4. War1 was mapped to the bottom of chromosome 1; war2 was located in the middle of chromosome 3, war3 to the top of chromosome 1, and war4 to the top of chromosome 4.  42  3.8  Discussion An extensive screen to isolate suppressors of cer7 was performed to identify  additional components downstream of CER7 that are involved in CER7-mediated control of wax biosynthesis. The primary objective was to isolate the putative suppressor of CER3, a key wax biosynthetic gene at the start of the alkane-forming pathway. Screening of putative suppressor lines began with a visual screen to identify plants that had a restored waxy stem phenotype. Subsequently, putative suppressor lines were named wax restorer (war) mutants. 824 individual plants in the M2 generation showed a restored waxy stem phenotype and were collected for further analysis. The large number of putative suppressor lines were recovered due to the limited stringency of the primary screen, as I erred on the side of caution and wanted to isolate all possible suppressors. Additionally, there were many plants grown in each pot, so due to overcrowding, all plants grew thin, short stems that were hard to examine for the waxy phenotype. Each of the 824 lines were then subjected to a more rigorous secondary phenotypic screen in the next generation to confirm the waxy stem phenotype. Individuals from each line were grown in separate pots to optimize growth conditions for each plant. The stichelstyle trichome is described as a single-pronged trichome (Ilgenfritz et al., 2003) and was crossed into the cer7-1 background before mutagenesis.  I had incorporated the stichel  trichome into the screen as an internal marker to rule out wild type contamination, since any putative suppressor lines recovered would have a wild-type waxy phenotype. The secondary phenotypic screen reduced the number of suppressor lines down to 100 from 824. Some of the lines were still difficult to identify as they had additional phenotypes, such as bushy leaves, or stunted growth. The stunted or bushy plant phenotype could be due to an unrelated 43  mutation induced by the mutagenesis event, or it could be a pleiotropic effect of the second site mutation. Furthermore, there were two classes of suppressor lines: those that had completely waxy stems indicating complete suppression, and those that had waxy stem bases, but shiny stem tops. Stem wax deposition occurs during stem development, and the cue to stop making wax is currently unknown, but is somehow affected in those lines with the waxy bases and shiny tops. However, I was more interested in focusing on lines that exhibited complete suppression, but those with the variable stem phenotype were kept, as they can be weaker alleles. The 100 recovered war lines were genotyped to confirm that the original cer7-1 mutation was still present and not corrected in the mutagenesis, and subjected to wax analysis to determine the wax profile and assayed for CER3 transcript levels. I arbitrarily set a threshold level of 75% wax and CER3 transcript level recovery as the minimum acceptable level for suppression of the cer7-1 phenotype. This limit allowed me to decrease the total number of war lines to 30 from 100. Thirty putative suppressor lines was unexpectedly high as I did not anticipate so many genes to be involved in the CER7-mediated regulation of wax biosynthesis; however, some of these lines could be allelic. To determine how many unique suppressor lines were present, I performed complementation crosses between all the 30 lines. I expected to be able to separate the 30 lines into distinct complementation groups based on the results of these crosses, but instead ran into a problem where discrete groups could not be formed. One explanation for this problem may be that some of these suppressor lines are dominant, in which case a complementation cross would not work. To definitively ascertain the number of unique suppressor lines, a map-based cloning approach was taken, and initially, seven lines were rough mapped to determine approximate locations of the genes 44  responsible for the cer7-1 suppression. Of these seven lines, four unique lines, named war1 through war4, were isolated.  45  Figure 3.1 CER3, under control of the CER6 promoter can complement cer7-3 (A) Stems from 5-week-old wild type (Columbia), cer7-3, and cer7-3 transformed with the ProCER6:CER3 transgene showing restored wax in the transgenic plant. (B) Quantitative RT-PCR showing that CER3 expression levels are restored to wild-type levels in plants carrying the ProCER6:CER3 transgene. ACTIN2 was used as an internal control and control samples were normalized to 1. Values represent means ± SD (n=4). Statistically significant differences from cer7-3 (p<0.05) are indicated by *.  Reprinted with permission from Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiol 159: 1385–1395. www.plantphysiol.org. Copyright American Society of Plant Biologists.  46  Batch  1  2  3  4  5  6  7  8  9  10  11  12  Number  24  82  47  18  16  30  14  8  6  13  19  13  Batch  13  14  15  16  17  18  19  20  21  22  23  24  Number  19  16  21  11  4  6  12  19  22  22  15  11  Batch  25  26  27  28  29  30  31  32  33  34  35  36  Number  9  17  14  14  8  13  12  7  12  9  9  5  Batch  37  38  39  40  41  42  43  44  45  46  47  48  Number  5  7  2  9  27  44  5  8  5  4  7  8  Batch  49  50  51  52  53  54  55  56  57  58  59  60  Number  8  8  12  12  1  3  9  3  4  5  7  4  Batch  61  62  63  64  Number  8  6  4  2  Table 3.1 The number of suppressors identified in each of the 64 batches. suppressors were isolated in the primary screen of the M2 generation.  824 total  47  Batch  1  2  3  4  5  6  7  8  9  10  11  12  Number  -  8  4  1  4  3  7  -  -  1  3  -  Batch  13  14  15  16  17  18  19  20  21  22  23  24  Number  1  2  -  2  -  -  3  -  1  -  -  -  Batch  25  26  27  28  29  30  31  32  33  34  35  36  Number  -  6  1  -  1  -  1  -  2  7  -  -  Batch  37  38  39  40  41  42  43  44  45  46  47  48  Number  1  1  -  5  1  8  -  1  -  -  -  -  Batch  49  50  51  52  53  54  55  56  57  58  59  60  Number  3  1  3  4  1  -  2  -  2  -  2  -  Batch  61  62  63  64  Number  5  2  -  -  Table 3.2 After secondary screening, 100 putative suppressor lines were retained.  48  18 16 Wax Load (µg cm-2)  14 12 10 8 6 4 2 0 WT Ler  cer7-1  Figure 3.2 The cer7-1 mutant has approximately 25% of the wild-type wax load. Stem wax loads of wild type and cer7-1 were determined by GD-FID. Values represent means ± SD (n=3).  49  Wax Load (µg·cm-2)  9 8  Ler WT  7  cer7-1  6 5 4 3 2 1 0 Aldehyde  Alkane  Ketone  Alkane-forming pathway  2° Alcohol  Acid  1° Alcohol  Ester  Alcohol-forming pathway  Figure 3.3 The wax components generated by the alkane-forming pathway are greatly reduced in cer7-1. Analyses of stem wax show a reduction in aldehydes, alkanes, ketones and 2° alcohols in the cer7-1 mutant compared to the wild type. Consequently, there is an increase in 1° alcohols in the cer7-1 mutant. Values represent means ± SD (n=3).  50  Ler WT  cer7-1  Aldehyde Alkane  Alkane-forming pathway  Ketone 2 Alcohol Acids 1 Alcohol  Alcohol-forming pathway  Ester  Figure 3.4 The contribution of the two wax biosynthetic pathways to stem wax load of the cer7-1 mutant differs from that of wild-type. There is a greater proportion of the components generated from the alcohol-forming pathway in the cer7-1 mutant in comparison to the wild-type (as indicated by shades of orange).  51  Figure 3.5 Network of complementation crosses performed on suppressor lines. Failure to complement would indicate that the suppressor lines are allelic (i.e. have a mutation in the same gene). Red lines linking suppressor lines indicate that 2 reciprocal crosses were performed between the two, and that they are allelic. Blue lines linking suppressor lines indicate that only one cross was performed between the lines and that they failed to complement. Definitive distinct complementation groups could not be made, but there appear to be clusters of lines that group together.  52  Line  Stem phenotype  Trichome  cer7-1 mutation  CER3 Transcript Level (% of WT)  Wax Load Level (% of WT)  Ler WT  waxy  Tri-prong  WT  WT  WT  cer7-1  shiny  sti    20% of WT  27% of WT  2-2  waxy bottoms  sti    75%  75%  2-3  waxy bottoms  sti    20%  55%  5-6  waxy  sti    200%  59%  14-1  waxy  sti    100%  92%  3-1  waxy  sti    125%  85%  3-7  waxy  sti    75%  90%  3-18  waxy  sti    50%  102%  4-14  waxy bottoms  sti    20%  70%  5-2  waxy  sti    200%  109%  war1  war2  Wax Composition  53  Line  Stem phenotype  Trichome  cer7-1 mutation  CER3 Transcript Level (% of WT)  Wax Load Level (% of WT)  Ler WT  waxy  Tri-prong  WT  WT  WT  cer7-1  shiny  sti    20% of WT  27% of WT  16-1  waxy  sti    250%  112%  26-1  waxy  sti    200%  69%  33-1  waxy  sti    75%  82%  33-6  waxy; stunted  sti    140%  127%  34-3  waxy  sti    75%  76%  34-4  waxy  sti    50%  76%  34-5  semi-glaucous  sti    60%  77%  37-2  waxy bottoms  sti    75%  83%  38-1  waxy; stunted  sti    165%  102%  40-4  waxy  sti    180%  141%  53-1  waxy  sti    250%  93%  Wax Composition  54  Line  Stem phenotype  Trichome  cer7-1 mutation  CER3 Transcript Level (% of WT)  Wax Load Level (% of WT)  Ler WT  waxy  Tri-prong  WT  WT  WT  cer7-1  shiny  sti    20% of WT  27% of WT  55-1  waxy  sti    260%  77%  57-1  waxy  sti    125%  75%  59-2  waxy bottoms  sti    20%  58%  5-1  waxy  sti    200%  76%  6-21  waxy  sti    200%  52%  7-10  waxy  sti    75%  76%  7-12  waxy  sti    200%  76%  11-9  waxy bottoms  sti    45%  91%  14-4  waxy  sti    225%  83%  16-5  waxy bottoms  sti    20%  90%  war3  Wax Composition  55  Line  Stem phenotype  Trichome  cer7-1 mutation  CER3 Transcript Level (% of WT)  Wax Load Level (% of WT)  Ler WT  waxy  Tri-prong  WT  WT  WT  cer7-1  shiny  sti    20% of WT  27% of WT  19-1  waxy bottoms  sti    300%  71%  19-4  waxy  sti    75%  51%  26-6  waxy  sti    50%  61%  31-6  waxy  sti    175%  84%  34-1  waxy  sti    40%  77%  34-9  waxy bottoms  sti    110%  59%  40-1  waxy  sti    20%  122%  40-5  waxy  sti    180%  120%  41-15  waxy  sti    275%  109%  42-5  waxy  sti    325%  104%  42-6  waxy  sti    300%  122%  Wax Composition  56  Line  Stem phenotype  Trichome  cer7-1 mutation  CER3 Transcript Level (% of WT)  Wax Load Level (% of WT)  Ler WT  waxy  Tri-prong  WT  WT  WT  cer7-1  shiny  sti    20% of WT  27% of WT  42-15  waxy; stunted  sti    200%  123%  42-16  waxy  sti    200%  123%  42-30  waxy  sti    225%  99%  44-1  waxy  sti    20%  43%  49-3  waxy  sti    20%  50%  50-5  waxy  sti    325%  121%  59-1  waxy bottoms  sti    20%  64%  61-1  waxy  sti    125%  96%  61-2  waxy  sti    100%  121%  61-3  waxy  sti    150%  108%  61-7  waxy  sti    75%  121%  Wax Composition  57  Line  Stem phenotype  Trichome  cer7-1 mutation  CER3 Transcript Level (% of WT)  Wax Load Level (% of WT)  Ler WT  waxy  Tri-prong  WT  WT  WT  cer7-1  shiny  sti    20% of WT  27% of WT  61-8  waxy  sti    175%  107%  2-8  waxy  sti    60%  81%  2-69  waxy  sti    20%  78%  6-4  waxy  sti    75%  78%  21-3  waxy  sti    225%  63%  34-6  waxy  sti    150%  95%  42-2  waxy  sti    125%  113%  52-3  waxy  sti    160%  146%  52-6  waxy  sti    270%  121%  62-4  waxy bottoms  sti    60%  77%  war4  Wax Composition  58  Line  Stem phenotype  Trichome  cer7-1 mutation  CER3 Transcript Level (% of WT)  Wax Load Level (% of WT)  Ler WT  waxy  Tri-prong  WT  WT  WT  cer7-1  shiny  sti    20% of WT  27% of WT  2-6  waxy  sti    20%  64%  2-32  waxy  sti    20%  48%  2-43  waxy  sti    400%  47%  2-56  waxy bottoms  sti    20%  47%  3-2  waxy  sti    75%  112%  5-3  waxy, small bushy flowers  sti    n.d.  n.d.  6-29  waxy; stunted  sti    n.d.  n.d.  7-2  waxy bottoms  sti    20%  68%  7-5  waxy  sti    400%  48%  7-8  waxy; stunted  sti    n.d.  n.d.  not identified  Wax Composition  59  Line  Stem phenotype  Trichome  cer7-1 mutation  CER3 Transcript Level (% of WT)  Wax Load Level (% of WT)  Ler WT  waxy  Tri-prong  WT  WT  WT  cer7-1  shiny  sti    20% of WT  27% of WT  7-9  waxy;stunted  sti    n.d.  29%  7-13  waxy  sti    70%  65%  10-2  waxy bottoms  sti    20%  37%  11-1  waxy  sti    200%  97%  11-2  waxy  sti    n.d.  n.d.  13-2  waxy; stunted  sti    n.d.  n.d.  19-2  waxy bottoms  sti    20%  29%  22-4  waxy; stunted  sti    n.d.  n.d.  26-2  waxy bottoms  sti    20%  58%  26-3  waxy  sti    20%  54%  26-5  waxy  sti    175%  88%  Wax Composition  60  Line  Stem phenotype  Trichome  cer7-1 mutation  CER3 Transcript Level (% of WT)  Wax Load Level (% of WT)  Ler WT  waxy  Tri-prong  WT  WT  WT  cer7-1  shiny  sti    20% of WT  27% of WT  26-9  waxy bottoms  sti    20%  38%  27-4  waxy bottoms  sti    100%  39%  29-6  waxy  sti    70%  52%  34-8  semi-glaucous  sti    60%  56%  40-3  waxy bottoms  sti    20%  50%  40-9  waxy  sti    230%  122%  42-1  waxy  sti    110%  115%  42-4  waxy bottoms  sti    20%  52%  sti    n.d.  n.d.  sti    n.d.  n.d.  sti    150%  122%  49-2 49-5 51-5  waxy; delayed growth waxy bottoms; stunted waxy  Wax Composition  61  Line  Stem phenotype  Trichome  cer7-1 mutation  CER3 Transcript Level (% of WT)  Wax Load Level (% of WT)  Ler WT  waxy  Tri-prong  WT  WT  WT  cer7-1  shiny  sti    20% of WT  27% of WT  51-10  waxy  sti    250%  64%  52-5  waxy  sti    360%  102%  52-8  waxy  sti    60%  58%  55-5  waxy  sti    230%  93%  57-3  waxy; stunted  sti    20%  43%  62-1  waxy bottoms  sti    20%  43%  Wax Composition  Table 3.3 Summary of analyses performed on all 100 identified suppressor lines. When describing the wax composition, the products of the alkane-forming pathway are in cream, whereas the products of the alcohol-forming pathway are in purple. n.d. not determined  62  Chapter 4: Characterization of war2 and war3 mutants and cloning of the WAR2 and WAR3 genes 4.1  Introduction A screen for suppressors of cer7 was performed to find the putative repressor of  CER3 and other components downstream of CER7 involved in regulating cuticular wax biosynthesis. Putative suppressor lines show a waxy stem phenotype, and were therefore named wax restorer (war) mutants. My screen of 12,000 mutagenized seeds resulted in the isolation of 30 war mutants representing at least four unique loci, named war1 through war4. Besides having their stem wax levels and composition restored to wild-type, war mutants also have CER3 transcript levels similar to wild type. This chapter focuses on the characterization of two war mutants: war2 and war3, and the cloning of the genes identified by mutations in these lines. These two lines were selected since their stem wax phenotype was easy to discern.  First, I confirm that war2 and war3  both have wild-type wax profiles and restored CER3 transcript levels. Next, I use a mapbased cloning approach to pinpoint the location of both war2 and war3, and isolate the WAR2 and WAR3 genes.  After identification of WAR2 and WAR3, based on their identity I  determine their expression pattern and subcellular localization and propose a new model of regulating wax biosynthesis.  4.2  Confirmation of war2 and war3 as Suppressors of cer7 Using gas chromatography with flame ionization detection, stem wax analysis was  repeated on war2 and war3 in order to confirm their wax profiles. Three technical replicates were performed for both war2 and war3 wax analysis. The cer7 wax deficiency results in a 63  75% reduction in the amount of stem wax when compared to the wild type plants. I expected a suppressor of cer7 to have increased amounts of stem wax compared to cer7, as the wax deficient phenotype should be suppressed. The analysis showed that stem wax was restored to approximately 70% of wild-type levels in war2, whereas war3 showed 110% levels of restoration (Figure 4.1). When the composition of the individual wax components was assessed, war2 and war3 exhibited a wild-type-like wax profile, characterized by a greater proportion of constituents generated from the alkane-forming pathway (i.e. aldehydes, alkanes, secondary alcohols and ketones) as opposed to those of the alcohol-forming pathway as seen in the cer7 mutant (Figure 4.2). war2 and war3 were also analyzed for the expression of CER3. Quantitative real time PCR measurements demonstrated that CER3 transcript accumulation was completely restored to wild-type levels, and paralleled the restoration of wax loads in each suppressor line (Figure 4.3). war2 and war3 were genotyped again and confirmed that the original cer7 mutation was still present. The restoration of wax amounts and composition, as well as CER3 transcript levels confirms that war2 and war3 contain a secondary mutation that suppresses the cer7 wax deficient phenotype, indicating their potential involvement in CER7-mediated wax regulation.  4.3 4.3.1  Identification of war2 A Map-based Cloning Approach Genetic analysis of the F2 progeny from a backcross of war2 cer7-1 suppressor line to  cer7-1 showed an approximate 3:1 segregation of the glossy mutant to the waxy wild type 64  (891:333; χ2=3.176, p>0.05), indicating that wax restoration was due to a recessive mutation in a single nuclear gene. To map the war2 mutation, war2 cer7-1 in the Landsberg erecta (Ler) background, was crossed to cer7-3 in the Columbia ecotype to create a mapping population. 37 F2 plants exhibiting a waxy phenotype were used to establish linkage of war2 to markers T32N15 and T24C20 located in the middle of chromosome 3. To further narrow down the region, 1224 F2 plants were screened and recombination events between markers T32N15 and T24C20 were scored. War2 was fine mapped to an interval between 17.12Mbp and 17.24Mbp (approximately 140kb) flanked by markers PL1334 and T6H20-2 (Figure 4.4) of chromosome 3. There are 39 annotated genes in this region (Table 4.1). As war2 did not have a phenotype outside the cer7-1 background, I could not use TDNA insertion lines from the ABRC stock center to identify the WAR2 gene. I would have had to locate a homozygous T-DNA insertion line for each gene, cross it into cer7-1 and wait until the F2 generation of this cross to determine if war2 had been disrupted by the T-DNA. This approach would be too time-consuming and there was no guarantee that the T-DNA insertion would even result in a phenotype. Therefore, my strategy to determine the location of WAR2 was to sequence candidate genes via Sanger sequencing to find a mutation. Since cer7-1 and war2 are in the Ler ecotype, both cer7-1 and war2 require sequencing to compare sequences to find a possible mutation, as there is no curated Arabidopsis genome sequence in the Ler background. The top candidates for sequencing include annotated transcription factors, and genes of unknown function.  AT3G46600, AT3G46620, AT3G46630,  AT3G46750, and AT3G46770 were deemed the best candidates for initial sequencing. Of the 39 genes in the interval determined by fine-mapping, I have so far sequenced 28 genes,  65  and no mutations were found. Sequencing was performed using genomic DNA as the template to include introns and exons as well as the 5′ and 3′ UTR regions.  4.3.2  Complementation With JAtY Clones Since sequencing the best candidate genes yielded no results, I employed another  approach to determine the identity of WAR2. Complementation of the war2 mutant line, either by transformation with a single gene, or a group of genes can help discern the identity of war2. As complementation with individual genes would be too time consuming, JAtY clones were used in an attempt to complement war2. JAtY clones, generated by the John Innes Centre, are part of a transformable artificial chromosome (TAC) library constructed using pYLTAC17 as a vector that covers the Arabidopsis genome. There are four JAtY clones that overlap the region to which war2 was fined mapped: JAtY63N19 (17.097-17.172 Mbp; 74.447 kb), JAtY58D07 (17.108-17.144 Mbp; 35.424 kb), JAtY73F08 (17.148-17.244 Mbp; 95.677 kb), and JAtY75I12 (17.241-17.324 Mbp; 82.501 kb) (Figure 4.5).  The  rationale behind complementation with JAtY clones was that I could further restrict the region where war2 is located based on whether or not a certain JAtY clone can complement the war2 phenotype. If a JAtY clone is able to complement war2, the expected phenotype is that of cer7, a wax deficient plant. Of the four JAtY clones, I have only been able to get one successfully transformed into plants: JAtY75I12, which lies at the very end of the mapping interval. Only five genes overlap the JAtY clone and the mapping interval (AT3G46780AT3G46820).  JAtY75I12 was not able to complement war2 suggesting that the gene  responsible for the war2 phenotype is not one of these five genes. However, with this  66  negative result, I still cannot eliminate this region, as I cannot confirm that the entire JAtY clone was inserted into the recovered transformants.  4.3.3  Next Generation Sequencing As it was not possible to determine the identity of war2 by using map-based cloning  and complementation with JAtY clones, I had to investigate other methods to identify war2. With the advancement of sequencing technology, it is possible to sequence whole genomes in a relatively rapid and inexpensive manner. The use of next-generation sequencing (NGS) technology has been shown to be an effective method to identify the causative genetic lesion in a mutant line (Schneeberger et al., 2009; Austin et al., 2011). Bulked pools of F2 plants homozygous for the mutation of interest from a mapping population were used for deep sequencing to eliminate background noise, and the sequenced pool was compared to the wild type population.  Thousands of individual small nucleotide polymorphisms (SNPs) are  discernible in the sequencing tract, one of which is the mutation responsible for the mutant phenotype. The location of the mutation can be determined based on the occurrence of little to no recombination events in a specific region. I sent war2 for NGS in hopes of finding the causative mutation. NGS revealed that war2 is located in the interval of 16.001-17.624 Mbp on chromosome 3, which agrees with my previous mapping data. However, within this interval, there are 170 reported SNPs in 80 genes. These SNPs represent G to A (or C to T) conversions that result in non-synonymous changes to the amino acid sequence within coding regions. As war2 is in the Landsberg ecotype, these polymorphisms that are reported are a result of differences to the reference Columbia genome. Therefore, these reported SNPs could simply be polymorphisms between 67  the two ecotypes. I am currently filtering out these polymorphisms by scanning through the Landsberg genome sequence deposited by Monsanto and by Detlef Weigel’s lab.  4.4  Positional Cloning of war3 Genetic analysis of the F2 progeny from a backcross of war3-1 cer7-1 suppressor line  to cer7-1 showed an approximately 3:1 segregation ratio of the glossy mutant to the waxy wild type (620:232; χ2 = 2.26; p>0.1), indicating that wax restoration was due to a recessive mutation in a single nuclear gene. To map the war3-1 mutation, war3-1 cer7-1 in the Landsberg erecta (Ler) background, was crossed to cer7-3 in the Columbia ecotype to create a mapping population. 35 F2 plants exhibiting a waxy phenotype were used to establish linkage of war3-1 to markers F3F19 and F20D23 on chromosome 1 (Figure 4.6A). The map position of war3-1 was further delineated to a 150 kb genomic region between markers T5E21 and F10B6I-5 by screening 852 individuals from the F2 mapping population for recombination events (Figure 4.6B). This 150 kb interval is located between 5.001-5.151 Mb on chromosome 1 and includes 39 genes. Sequencing of several candidate genes in this region revealed a point mutation in the third exon of At1g14790 at position 3171 (G to A transition), which is predicted to cause a premature stop codon in the war3-1 mutant. At1g14790 was also sequenced in war3-2 and war3-3, two additional alleles of war3 found in the suppressor screen, and in both cases missense mutations were detected (Figure 4.6B), confirming that WAR3 is indeed At1g14790. At1g14790 encodes RNA-dependent RNA polymerase 1 (RDR1) (Yu et al., 2003). RNA-dependent RNA polymerases convert singlestranded RNA (ssRNA) to double-stranded RNA (dsRNA) that serves as the substrate for DICER. In Arabidopsis, there are 6 known RDRs. While RDR2 and RDR6 have been 68  shown to be involved in silencing of endogenous transcripts during development, RDR1 has not yet been demonstrated to play a role in this process (Dalmay et al., 2000; Mourrain et al., 2000; Xie et al., 2004). Instead, RDR1 has been reported to be involved in anti-viral defense, and shown to promote turnover of viral RNAs in infected plants (Yu et al., 2003). Four additional alleles of war3 were identified from the T-DNA insertional mutant collection (Alonso et al., 2003): SALK_109922, SALK_112300, SALK_125022, SALK_007638 (Figure 4.6B). Single homozygous war3 mutants do not have a visible wax phenotype, or any other morphological phenotypes. However, when homozygous war3 TDNA mutants were crossed into the cer7-3 background, double mutants showed wild-type wax accumulation on inflorescence stems (Figure 4.7), indicating that these war3 alleles were also able to suppress the cer7-related wax deficiency.  No other morphological  phenotypes were detected in the war3 cer7 double mutants. To verify that the mutation identified in war3 is responsible for the wax restoration of cer7-1, the region encompassing At1g14790, and including the 1754 bp of the 5′ fragment upstream of ATG was transformed into the war3-1 cer7-1 double mutant. Resulting transformants had wax-deficient glossy stems confirming that WAR3 is RDR1 (Figure 4.8). Therefore, the war3 alleles described here will be subsequently referred to as rdr1 (Table 4.2).  4.5  RDR1 Expression Analysis Quantitative RT-PCR was used to assess expression levels of RDR1 in various  organs. Aerial tissues were harvested from 4 to 6 week old plants, whereas seedling and roots were collected from 14-day-old plants. RDR1 expression was detected in all tissues (Figure 4.9), but at varying levels. RDR1 showed high expression levels in seedlings, cauline 69  leaves, rosette leaves and flowers. Moderate levels were detected in the stem top and base. Low levels of RDR1 expression were detected in roots and siliques. To determine cell-type specific expression patterns of RDR1, I examined βglucuronidase (GUS) activity in transgenic plants transformed with constructs in which the promoter region of RDR1 was fused to the GUS reporter gene (ProRDR1:GUS). Crosssections of the top of the stem show that ProRDR1:GUS is expressed in all stem tissues (Figure 4.10). ProRDR1:GUS is also expressed throughout the plant in flowers, siliques and roots. I attempted to also determine the subcellular localization of RDR1. For this purpose, the RDR1:GFP transgene was expressed under control of the native promoter, and transgenic rdr1-2 cer7-1 plants carrying ProRDR1:RDR1:GFP were wax-deficient like the cer7-1 mutant, indicating that the RDR1:GFP fusion protein was functional. However, I was unable to detect strong fluorescent signal by confocal microscopy in any of the complemented lines. Low RDR1:GFP expression levels may be due to the weak RDR1 promoter. In silico analysis using the Arabidopsis Cell eFP browser predicts that RDR1 is expressed in the cytosol (Winter et al., 2007).  4.6  Role of RDR1 in Regulating CER3 Expression in Developing Inflorescence Stems The suppressor screen resulted in the identification of several alleles of RDR1  suggesting that an RNA-based regulatory mechanism involving small RNAs, controls CER3 expression during cuticular wax deposition in developing inflorescence stems. During development, cuticular wax is synthesized predominantly at the top of the stem where the stem is actively elongating, and waxes are deposited evenly along the stem (Suh et al., 2005). 70  This requires higher expression of wax biosynthetic genes, including CER3, at the top of the stem than at the stem base. To determine if CER3 transcription is developmentally regulated in Arabidopsis inflorescence stems, and investigate whether RNA silencing is involved in modulating CER3 expression, I monitored CER3 transcript levels in elongating stems by real-time PCR. As expected, CER3 transcript levels were considerably greater at the stem top than at the base of wild type stems (Figure 4.11). As shown previously, cer7-1 mutant plants displayed reduced CER3 transcript accumulation (Hooker et al., 2007) that did not significantly differ between the stem top and stem base. By contrast, an introduction of rdr1-2 mutations in the cer7-1 background resulted in a major surge in CER3 transcript accumulation, with the CER3 transcript levels reaching several fold greater levels than those detected in the wild type stem top and stem base (Figure 4.11). These data indicate that RDR1, which is implicated in small RNA biogenesis, is necessary for down-regulation of CER3 during development of Arabidopsis inflorescence stems.  4.7  Discussion A novel mechanism of regulating cuticular wax biosynthesis in developing  Arabidopsis inflorescence stems, which involves the CER7 exosomal ribonuclease was discovered by Hooker et al. (2007).  These authors hypothesized that CER7 controls the  transcription of CER3, a key wax biosynthetic gene, via degradation of an mRNA encoding a negative regulator of CER3. To identify the proposed negative regulator and other factors required for CER7mediated control of CER3 expression, I performed a screen for suppressors of cer7-1, which 71  restore cer7-related stem wax deficiency to wild-type wax levels. I isolated four classes of suppressors designated war1 to war4. In this chapter, I attempted to characterize war2 and war3 and the gene disrupted by these mutations. Multiple approaches were utilized in an attempt to identify the causal lesion in war2 including traditional map-based cloning, complementation by TAC clones, and next generation sequencing. The data for war2 indicates that WAR2 is located on chromosome 3 in a 140 kb interval between 17.12Mbp and 17.24Mbp. However, the identity of war2 remains unknown at this point. WAR3 encodes RNA-DEPENDENT RNA POLYMERASE 1 (RDR1), one of the six RDR proteins described in Arabidopsis. RDR proteins have been found in diverse eukaryotes, and are considered to be core members of the RNA silencing machinery. They catalyze the conversion of a single-stranded RNA template into double-stranded RNA (dsRNA), which serves as a substrate for dicer-like enzymes in the production of a type of small RNAs termed small interfering RNAs (siRNAs). It is well documented that RDR2 and RDR6 participate in siRNA mediated gene silencing in Arabidopsis (Peragine et al., 2004; Vazquez et al., 2004; Xie and Qi, 2008), but my work for the first time demonstrated such a role for RDR1. To date, RDR1 has only been reported to be involved in antiviral defense by promoting turnover of viral RNAs in infected plants (Yu et al., 2003). In parallel with my identification of WAR3, map-based cloning of the war4 suppressor of cer7 by another graduate student in the Kunst lab, L. Zhao, revealed that WAR4 encodes SUPPRESSOR OF GENE SILENCING 3 (SGS3), a plant-specific protein suggested to bind and stabilize RNA template to initiate RDR-catalyzed dsRNA synthesis. SGS3 is essential for the synthesis of dsRNA in transgene silencing, viral silencing and the 72  synthesis of trans-acting short-interfering (ta-siRNAs) involved in the regulation of gene expression during normal plant development (Peragine et al., 2004), and has been shown to directly interact with RDR6 in cytoplasmic punctae (Kumakura et al., 2009). The identification of RDR1 and SGS3 in the screen for the cer7-1 suppressors demonstrates that in addition to RDR6, RDR1 function also requires participation of SGS3. Furthermore, even though RDR1 has not been reported to be involved in endogenous gene silencing, based on our results it seems reasonable to speculate that RDR1 and SGS3 are involved in the production of an as yet uncharacterized small RNA species that directly or indirectly mediates transcriptional gene silencing of CER3 to control wax deposition over the length of the stem. At the top of the stem where the stem is actively growing, wax biosynthetic genes are highly expressed (Suh et al., 2005). Conversely, at the base of the stem where growth has terminated, the expression of wax biosynthetic genes is reduced. As expected, in the wild type we found higher levels of the CER3 transcript in the stem top compared to the stem base (Figure 4.11). In the cer7-1 mutant, CER3 expression is significantly decreased, with CER3 transcript levels being similarly low in both the top and bottom of the stem, which results in the wax-deficient phenotype. In contrast to the cer7-1 mutant, CER3 transcript levels in rdr1-2 cer7-1 double mutants are considerably higher in both the top and the stem base than CER3 levels detected in the wild type (Figure 4.11), resulting in restoration of stem wax loads. The simplest model that integrates all our findings is presented in Figure 4.12. Small RNA precursors are known targets of the exosomal RNA ribonucleases (Chekanova et al., 2007). We hypothesize that in the wild type stem tops where CER7 is highly expressed, and the CER7 activity is presumably high, this exosomal ribonuclease degrades a precursor of a 73  small RNA species that acts as a repressor of CER3 expression. This results in enhanced CER3 transcription and wax production via the alkane-forming pathway. CER7 expression progressively decreases from the top towards the base of the stem, causing a gradual increase in small RNA accumulation. This is associated with down-regulation of CER3 expression in the epidermal cells and cessation of wax production at the stem base. In the cer7 mutant, where the CER7 exosomal subunit is not functional, buildup of small RNA causes CER3 silencing and stem wax deficiency. The biogenesis of small RNAs involved in silencing of CER3 requires RDR1 and SGS3 activities. In the absence of RDR1 or SGS3 in the rdr1 cer7 or sgs3 cer7 double mutant, respectively, the small RNA species responsible for CER3 repression will not be generated, abolishing the need for CER7 in wax biosynthesis. The fact that I have thus far been unable to locate the causative mutation leading to the war2 phenotype can be due to the possibility that WAR2 does not encode a protein, but a small RNA that is involved in the silencing of CER3. Sequence complementarity guides small RNAs to their target, and changes in sequence can affect their ability to bind to their target genes. In an attempt to verify this model and identify the potential small RNA species that repress CER3 expression, I identified 33 small RNAs that map to the region upstream of CER3 (Arabidopsis Small RNA Project 2010; http://asrp.cgrb.oregonstate.edu/). However, none of these RNAs map to the fragment of the CER3 promoter that was used in our previous experiments to demonstrate that CER7 is required for transcription of the CER3 gene during stem wax deposition (Hooker et al., 2007). This suggests that the regulation of CER3 expression by small RNAs may be indirect and could involve another component, perhaps a positive regulator of CER3 transcription, which is controlled by post-transcriptional gene 74  silencing (PTGS). In this scenario, in wild type stem tops, the precursor of the small RNA repressor is degraded by CER7 allowing the putative positive regulator to activate CER3 transcription. At the bottom of the stem where the CER7 activity is lower, the small RNA repressor silences the positive regulator of CER3, causing down-regulation of CER3 expression. In the cer7 mutant, there is a large accumulation of the small RNA repressor throughout the stem, silencing the positive regulator of CER3 and resulting in very low levels of CER3 transcription. In the rdr1 cer7 or sgs3 cer7 double mutants that lack the small RNA repressor, the positive regulator of CER3 is continuously expressed causing high levels of CER3 transcription and wax biosynthesis. The work described in this chapter resulted in the identification of RDR1, an enzyme involved in small RNA formation.  Thus, CER7-mediated regulation of cuticular wax  biosynthesis during stem elongation, involves small RNA production that is required for CER3 silencing. This intricate system of regulation may be utilized by the plant to control lipid metabolism in epidermal cells to ensure optimal partitioning of carbon between membrane and cuticular lipids during cuticle synthesis. Small RNA silencing of CER3 expression requires SGS3 and RDR1, providing evidence that RDR1 plays a role in gene regulation in addition to its role in antiviral defense. Identifying other components involved in this process, the small RNA species responsible, and its target are important objectives for future research.  75  Figure 4.1 Stem wax loads of war2 and war3 Stem wax loads of war2 and war3 compared to wild type and cer7-1. Values represent means ± SD (n=3). Statistically significant differences between samples (p<0.05) are indicated by *.  Reprinted with permission from Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiol 159: 1385–1395. www.plantphysiol.org. Copyright American Society of Plant Biologists.  76  Figure 4.2 Wax composition of war2 and war3. Stem wax composition of war2 and war3 compared to wild type and cer7-1. Wax compositions for both war mutants are restored to near wild-type-like ratios of major wax components. Reprinted with permission from Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiol 159: 1385–1395. www.plantphysiol.org. Copyright American Society of Plant Biologists.  77  Figure 4.3 Quantitative RT-PCR showing that CER3 transcript levels are restored to wild-type levels in the war2 and war3 mutants. ACTIN2 was used as an internal control and control samples were normalized to 1. Values represent means ± SD (n=4). Statistically significant differences between samples (p<0.05) are indicated by *.  Reprinted with permission from Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiol 159: 1385–1395. www.plantphysiol.org. Copyright American Society of Plant Biologists.  78  Figure 4.4 Positional cloning of WAR2. Schematic representation of the chromosomal location of war2 as determined by fine mapping. The markers used for mapping and number of recombinants are indicated.  79  Locus  Gene Description  Sequenced?  AT3G46510 AT3G46520 AT3G46530  PLANT U-BOX 13 (PUB13) ACTIN-12 (ACT12) RECOGNITION OF PERONOSPORA PARASITICA13 (RPP13) unknown protein SALT OVERLY SENSITIVE5 (SOS5) EMBRYO DEFECTIVE 2474 (EMB2474)  yes yes yes  Glycosyl hydrolase superfamily protein; METHYL-CPG-BINDING DOMAIN PROTEIN 05 (MBD05) pre-tRNA; tRNA-Gly TRF-LIKE 1 (TRFL1 GRAS family transcription factor; Pentatricopeptide repeat (PPR-like) superfamily protein ROTUNDIFOLIA LIKE 4 (RTFL4) unknown gene unknown protein ARABIDOPSIS THALIANA RING AND DOMAIN OF UNKNOWN FUNCTION1 (ATRDUF1) unknown protein PHYTOCLOCK 1 UDP-Glycosyltransferase superfamily protein Potential natural antisense gene, locus overlaps with AT3G46660 UDP-GLUCOSYL TRANSFERASE 76E12 unknown protein Unknown gene UDP-GLUCOSYL TRANSFERASE 76E11 (UGT76E11) UDP-Glycosyltransferase superfamily protein UDP-Glycosyltransferase superfamily protein UDP-Glycosyltransferase superfamily protein NB-ARC domain-containing disease resistance protein UDP-Glycosyltransferase superfamily protein NB-ARC domain-containing disease resistance protein; MODIFIER OF ARG1 1 (MAR1) TRANSLOCON AT THE OUTER ENVELOPE MEMBRANE OF CHLOROPLASTS 75-III (TOC75-III) unknown protein Protein kinase superfamily protein AP2/B3-like transcriptional factor family protein  yes yes  AT3G46540 AT3G46550 AT3G46560 AT3G46570 AT3G46580 AT3G46585 AT3G46590 AT3G46600 AT3G46610 AT3G46613 AT3G46614 AT3G46616 AT3G46620 AT3G46630 AT3G46640 AT3G46650 AT3G46658 AT3G46660 AT3G46666 AT3G46668 AT3G46670 AT3G46680 AT3G46690 AT3G46700 AT3G46710 AT3G46720 AT3G46730 AT3G46740  AT3G46750 AT3G46760 AT3G46770  yes yes yes  yes yes yes yes yes yes yes yes yes  yes yes  yes yes  yes yes yes 80  Locus AT3G46780  Gene Description  PLASTID TRANSCRIPTIONALLY ACTIVE 16 (PTAC16) AT3G46790 CHLORORESPIRATORY REDUCTION 2 (CRR2) AT3G46800 Cysteine/Histidine-rich C1 domain family protein AT3G46810 Cysteine/Histidine-rich C1 domain family protein AT3G46820 TYPE ONE SERINE/THREONINE PROTEIN PHOSPHATASE 5 (TOPP5) Table 4.1 39 genes in the war2 mapping interval. Genes that have been Sanger sequenced are indicated in the last column.  Sequenced? yes yes yes yes yes  81  Figure 4.5 4 JAtY clones span the interval in which war2 lies as determined by positional cloning. Attempts to complement war2 using each JAtY clone yielded no results.  82  Figure 4.6 Positional cloning of WAR3 and RDR1 gene structure. (A) Schematic representation of the chromosomal location of war3 as determined by fine mapping. The markers used for mapping and number of recombinants are indicated. (B) Schematic representation of the RDR1 gene structure. 5′ and 3′ UTRs are indicated as gray boxes, exons as white boxes and introns as black lines. The translational start site is represented by the bent arrow. The position and types of the mutations in rdr1 mutant alleles are also shown. Reprinted with permission from Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiol 159: 1385–1395. www.plantphysiol.org. Copyright American Society of Plant Biologists.  83  Figure 4.7 Wax levels are restored in the rdr1-7 cer7-3 double mutant. (A) Stems of 6-week-old WT Col, cer7-3, and rdr1-7 cer7-3 double mutants showing that TDNA insertion allele rdr1-7 can suppress the cer7-3 wax deficient phenotype. (B) Stem wax loads of rdr1-7 cer7-3 compared to wild type and cer7-3. Error bars represent means ± SD (n=4).  Reprinted with permission from Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiol 159: 1385–1395. www.plantphysiol.org. Copyright American Society of Plant Biologists.  84  Figure 4.8 The RDR1 transgene can complement war3-1 cer7-1. Complementation of war3-1 cer7-1 by RDR1 is expected to yield a plant with the waxdeficient cer7-1 phenotype if RDR1 is indeed WAR3. The wax-deficient stem in the transformed war3-1 cer7-1 line carrying ProRDR1:RDR1 therefore demonstrates successful complementation.  Reprinted with permission from Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiol 159: 1385–1395. www.plantphysiol.org. Copyright American Society of Plant Biologists.  85  rdr1 allele rdr1-1  Alternate name CS66077  Ecotype  Mutagen  Description of mutation  Reference  Col  T-DNA  Insertion in first exon  rdr1-2  war3-1  Ler  EMS  rdr1-3  war3-2  Ler  EMS  rdr1-4  war3-3  Ler  EMS  rdr1-5 rdr1-6 rdr1-7 rdr1-8  SALK_109922 SALK_112300 SALK_125022 SALK_007638  Col Col Col Col  T-DNA T-DNA T-DNA T-DNA  Nonsense, Trp to stop at amino acid 1057 Missense, Arg to His at amino acid 369 Missense, Ala to Val at amino acid 856 Insertion in promoter Insertion in first exon Insertion in third exon Insertion in third exon  Xie et al. 2004 This study This study This study This study This study This study This study  Table 4.2 Nomenclature and description of the rdr1 alleles. Reprinted with permission from Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiol 159: 1385–1395. www.plantphysiol.org. Copyright American Society of Plant Biologists.  86  Figure 4.9 Expression analysis of RDR1 in different organs and tissues of wild type Arabidopsis (Columbia) as determined by quantitative RT-PCR. ACTIN2 was used as an internal control and control samples were normalized to 1. Values represent means ± SD (n=4). Reprinted with permission from Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiol 159: 1385–1395. www.plantphysiol.org. Copyright American Society of Plant Biologists.  87  Figure 4.10 Tissue-specific expression of ProRDR1:GUS in Arabidopsis stems, showing expression throughout the plant. (A) ProRDR1:GUS activity from a cross-section of the top 3cm of the stem. Scale bar = 0.1mm. (B-D) ProRDR1:GUS activity is also found in flowers, stem, siliques (B), roots (C) and leaves (D). Scale bar = 3mm.  88  Figure 4.11 CER3 expression levels in the top 3cm and the bottom 3cm of a 10cm stem as measured by quantitative RT-PCR. ACTIN2 was used as an internal control and control samples were normalized to 1. Values represent means ± SD (n=4) and statistically significant differences (p<0.05) are indicated by *. Reprinted with permission from Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiol 159: 1385–1395. www.plantphysiol.org. Copyright American Society of Plant Biologists.  89  Figure 4.12 Model illustrating the role of RDR1 and SGS3, components of RNA silencing, in regulating cuticular wax biosynthesis at the top of the stem. (A) In the wild type, the precursor of the small RNA (smRNA) that regulates expression of CER3 is degraded by CER7, therefore CER3 is expressed and cuticular wax production ensues. (B) In the cer7 mutant, the smRNA precursor is not degraded and is used for the production of a smRNA species by a pathway which involves RDR1 and SGS3. smRNA functions to silence CER3, leading to decreased cuticular wax biosynthesis. (C) In either rdr1 or sgs3 suppressors of cer7, the smRNA species responsible for CER3 silencing will not be synthesized, resulting in CER3 expression and wax production in the absence of CER7 activity. Reprinted with permission from Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiol 159: 1385–1395. www.plantphysiol.org. Copyright American Society of Plant Biologists.  90  Chapter 5: Identification of Additional Components Involved in CER7Mediated Silencing of CER3 5.1  Introduction CER7 was previously hypothesized to regulate deposition of wax by degrading a  repressor of CER3, a key gene involved in the production of alkanes (Hooker et al., 2007; Bernard et al., 2012). To identify the putative repressor, a screen for suppressors of cer7-1 was performed. The screen revealed that components of RNA silencing, RDR1 and SGS3, are required for the CER7-mediated regulation of CER3 expression. These results implicate a small RNA silencing pathway that controls deposition of wax along the Arabidopsis inflorescence stem during development. It was proposed that in the wild type, the CER7 exoribonuclease degrades a precursor of a small RNA that acts as a repressor of CER3, allowing for expression of CER3, and thus production of alkanes. However, in the cer7 mutant, this small RNA is not degraded and is used for the production of a small RNA silencing via a pathway involving RDR1 and SGS3. The generated small RNA silences CER3, leading to the wax deficient phenotype (Lam et al., 2012). Even though the suppressor screen has only identified RDR1 and SGS3 thus far, there are many other enzymes required for small RNA biogenesis including the RNase III endonuclease DICER-LIKE (DCL) proteins, the RNA methyltransferase HUA ENHANCER 1 (HEN1), and ARGONAUTE (AGO) proteins (Chen, 2009). Additionally, the exosome has been shown to be vital in the ARGONAUTE-dependent biogenesis and processing of small RNAs (Xue et al., 2012). In this chapter, I will discuss my attempts to identify other components involved in the production of the small RNA repressor responsible for CER3  91  silencing. Specifically, using a reverse genetics approach, I tried to determine which AGO protein is involved in this process, and investigate the involvement of HEN1. Ultimately, I am also interested in isolating the exact RNA species that regulates CER3 expression. To do this, I have sequenced the small RNA populations of wild type, cer7, cer7 rdr1 and cer7 sgs3 using next generation sequencing (RNA-seq). Comparisons of small RNA populations from cer7, cer7 rdr1 and cer7 sgs3 double mutants with the wild type should allow me to identify the small RNA responsible for CER3 silencing. Furthermore, knowing the identity of the small RNA should make it possible to determine if CER3 is silenced directly, or indirectly  5.1.1  ARGONAUTE (AGO) Proteins Small RNAs are bound by ARGONAUTE (AGO) proteins to form a RNA-induced  silencing complex (RISC), which is directed to a target gene to regulate its expression. AGO proteins contain a variable N-terminal domain, and a conserved C-terminal domain composed of the PIWI/Argonaute/Zwille (PAZ), middle (MID) and P-element-induced whimpy testes (PIWI) domains (Vaucheret, 2008). The PAZ domain binds the 3′ end of the small RNA, and the MID domain binds the 5′ phosphate of the small RNA. The PIWI domain forms a catalytic domain similar to that of the folded structure of RNase H enzymes, and functions in cleaving small RNA-directed target mRNAs (Song et al., 2004). Arabidopsis contains 10 AGO proteins which can be sorted into three clades based on protein similarity, not functional similarity (Mallory and Vaucheret, 2010). AGO1, AGO5 and AGO10 form clade 1, AGO2, AGO3 and AGO7 form clade 2, and AGO4, AGO6, AGO8 and AGO9 form clade 3 (Figure 5.1). The loading of small RNAs into AGO complexes is 92  determined by the 5′ nucleotide and the length of the small RNA. For example, AGO1 preferentially loads small RNAs with a 5′ uracil that are 21 or 22 nucleotides in length, whereas AGO2, AGO4, AGO6, and AGO9 favor small RNAs with a 5′ cytosine (Mi et al., 2008). The specific functions of all the 10 Arabidopsis AGO proteins are not yet determined, but much progress has been made in elucidating their roles in small RNA silencing. AGO1 was the first identified AGO and is involved in posttranscriptional gene silencing (PTGS) of transgenes in the micro-RNA (miRNA) pathway, posttranscriptional silencing of sense transgenes through short interfering RNA (siRNA) production, and viral resistance (Bohmert et al., 1998; Vaucheret, 2008). AGO10 controls shoot apical meristem development by sequestering miR66/165, thereby preventing their loading into AGO1 to silence class III homeodomain-leucine zipper (HD-ZIP) family genes (Zhu et al., 2011). AGO7 controls leaf development and polarity via the ta-siRNA pathway (Adenot et al., 2006).  The  AGO7/miR390 complex triggers production of ta-siRNAs from TAS3 that target auxin response factors (ARF3 and ARF4) involved in leaf development (Montgomery et al., 2008). AGO4 was isolated in a screen for suppressors of SUPERMAN, a floral development gene (Zilberman et al., 2003).  AGO4 binds 24 nucleotide heterochromatic siRNAs to  transcriptionally regulate genes via RNA-directed DNA methylation (Zilberman et al., 2003). AGO6 is partially redundant with AGO4 and also transcriptionally regulates gene expression via heterochromatic siRNA involved in DNA methylation (Zheng et al., 2007). Finally, AGO2 is required for antiviral defense and repairing DNA double-strand breaks (Jaubert et al., 2011; Wei et al., 2012). AGO2 binds small RNAs derived from DNA breakage sites (diRNA) and the AGO2/diRNA complex helps recruit proteins necessary for DNA repair, or 93  facilitates double strand break repair (Wei et al., 2012). Among all the ago mutants, only ago1 and ago7 have clear phenotypes. ago1 mutants possess organ polarity defects, and severe alleles of ago1 are dwarf and sterile (Vaucheret, 2008).  Ago7 mutants show  downward curling leaf margins due to precocious juvenile-to-adult transition (Hunter et al., 2003).  5.1.2  HUA ENHANCER 1 (HEN1) HUA ENHANCER1 (HEN1) was initially identified from a genetic screen in the  hua1-1 hua2-1 double mutant background to isolate additional components involved in floral organ identity (Chen et al., 2002). hua1-1 hua2-1 hen1-1 mutants show an enhanced hau1 hau2 floral homeotic phenotype. hen1 single mutants have reduced organ sizes, altered leaf shape, reduced fertility and delayed growth compared to the wild type (Chen et al., 2002). The strong hen1-1 allele exhibited phenotypes similar to carpel factory 1 (later determined to be allelic to dicer-like 1) mutants, suggesting that HEN1 is required for small RNA metabolism (Park et al., 2002). Analysis of hen1 mutants showed that hen1 has reduced accumulation of endogenous miRNAs, thus HEN1 contributes to endogenous miRNA and siRNA accumulation (Park et al., 2002; Boutet et al., 2003). The predicted protein structure of HEN1 revealed that it contains a putative double stranded RNA-binding motif at the Nterminus, and an S-adenosyl methionine (SAM)–binding motif at the C-terminus, which suggests that HEN1 may be a miRNA methyltransferase (Yu et al., 2005). In vitro assays showed that HEN1 is indeed a 2′ O-methytransferase that acts on the 3′ terminal ribose of small RNA duplexes generated by Dicer (small RNAs with 2-3 nucleotide overhangs that are  94  21-24 nucleotides long) (Yu et al., 2005). This methylation protects the miRNAs and siRNAs from degradation and from 3′ uridylation (Yu et al., 2005; Li et al., 2005).  5.2  A Reverse Genetic Approach to Identify the AGO Involved in Regulating Wax  Biosynthesis In order to identify additional components of the biogenesis pathway required for the production of a small RNA repressor of CER3, I employed a reverse genetic approach. First, I wanted to investigate which of the 10 Arabidopsis AGO paralogs are involved in regulation of wax deposition. As seen in rdr1 cer7 and sgs3 cer7 double mutants, a secondary mutation in the small RNA biogenesis pathway downstream of cer7 that abolishes small RNA production results in wax restoration. Using this reasoning, I generated double mutants of cer7 ago1 to cer7 ago10 to determine which AGO family member restores wax on the plant surface. All ago mutants were obtained from the T-DNA insertional mutant collection and are in the Columbia ecotype except for ago1-11 which is an EMS mutation in the Ler background (Alonso et al., 2003; Kidner and Martienssen, 2005). Homozygous ago mutants were isolated and confirmed by genotyping PCR. Table 5.1 summarizes which alleles of ago1 through ago10 were used in my analyses. Double mutants were generated by crossing isolated homozygous alleles of ago2 through ago10 with cer7-3. Since homozygous ago1 are dwarf and sterile, ago1 cer7 double mutants were generated by crossing heterozygous ago1 mutants with cer7. The F2 progeny from each cross were genotyped by PCR to identify double mutants.  95  Isolated double mutants were visually inspected to assess their cuticular wax phenotype. Double ago2 cer7-3 through ago10 cer7-3 mutants were indistinguishable from the cer7-3 mutant in that they have a bright green glossy stem phenotype. Only ago1-11 cer7-1 mutants exhibited a wild-type waxy stem phenotype (Figure 5.2). These results demonstrate that AGO1 is the ARGONAUTE required in for the production of a small RNA involved in regulation of CER3.  5.3  Determining if HEN1 is Required for Biogenesis of the Small RNA Repressor of  CER3 If HEN1 is required for the formation of the small RNA species involved in CER3 silencing during cuticular wax deposition on developing Arabidopsis inflorescence stems, then a hen1 cer7 double mutant is predicted to have a waxy stem phenotype. The hen1-8 mutant is a weak allele of HEN1 resulting from a missense mutation altering an aspartic acid to an asparagine (Yu et al., 2010).  Homozygous hen1-8 lines were verified by PCR  genotyping and crossed with cer7-3. The F2 progeny of the cross was genotyped by PCR to isolate hen1-8 cer7-3 double mutants. Confirmed double mutants have a shiny wax-deficient phenotype (Figure 5.3), indicating that the production of small RNA that controls CER3 expression during wax biosynthesis is HEN1 independent.  5.4  Identification of the Small RNA Species Which Controls CER3 Expression The discovery that cuticular wax depositions on Arabidopsis stems is controlled by a  small RNA species (Lam et al., 2012) has led me to enquire about the nature of this RNA  96  species and the mechanism of CER3 silencing. In other words, what is the exact RNA species involved in this process, and does it silence CER3 directly, or indirectly? To address the first of these questions, small RNA populations were prepared from wild type, cer7, cer7 rdr1 and cer7 sgs3 stems and subjected to next generation sequencing (RNA-seq). The data are currently being analyzed. Nevertheless, I expect to find an enrichment of different RNA species in each of the populations. In cer7-3, I predict that there will be an abundance of the small RNA that regulates CER3 that will not be present in the wild type, or cer7 rdr1 and cer7 sgs3 double mutants. Isolating this small RNA will tell us the type of the small RNA species based on nucleotide length, and its target gene since small RNAs regulate genes based on sequence homology. In the cer7-3 rdr1-7 or cer7-3 sgs3-13 mutants, I predict an accumulation of the small RNA precursor that is normally degraded by CER7 in the wild type. If none of the small RNAs that accumulate in cer7 show homology to the promoter of the CER3 gene, that would suggest that regulation of CER3 transcription by small RNAs is indirect and involves another component, perhaps a positive regulator of CER3 transcription. In this case, the gene encoding this positive regulator could be detected by searching for sequence complementarity to the identified small RNAs, and its function in CER3 silencing verified by reverse genetics (T-DNA insertional mutants, RNAi), and by determining its binding site on the CER3 promoter using a yeast-1-hybrid assay.  5.5  Discussion The biogenesis of many classes of small RNAs involves the same conserved pathway  and enzymes (Vazquez et al., 2010). Long double-stranded RNA (dsRNA) precursors are 97  generated by RNA-dependent RNA polymerases (RDRs). These dsRNAs are processed by DCL proteins into small RNA duplexes, methylated by HEN1 and the loaded into AGO to form the RNA-induced silencing complex (RISC). The RISC can regulate gene expression either at the transcriptional or the post-transcriptional level. There are 6 RDR proteins, 4 DCL proteins and 10 AGO paralogs in Arabidopsis. Thus far, only RDR1 and SGS3 have been implicated in the biogenesis of a small RNA involved in regulating CER3 expression required for cuticular wax deposition (Lam et al., 2012).  In this chapter, I deal with  experiments aimed at identifying additional components of the pathway for the production of this small regulatory RNA. Specifically I address which of the 10 AGO proteins are required for regulation of CER3 expression, whether CER3 expression is HEN1-dependent or independent, and I describe my attempt to determine the identity of the small RNA repressor molecule that controls the expression of CER3. To determine which AGO paralog functions in regulation of stem wax deposition, I created double mutants of hen1 cer7 and ago1 cer7 through ago10 cer7. Analyses of these double mutants revealed that only ago1-11 cer7-1 had a wild-type stem wax phenotype, indicating that AGO1 participates in regulation of CER3 (Figure 5.2). AGO1 has previously been implicated in the biogenesis of miRNAs and ta-siRNAs (Baumberger and Baulcombe, 2005) and is the prinicpal AGO in small RNA biogenesis (Vaucheret, 2008). Methylation at the 3′ end of the dsRNA duplex by HEN1 prior to loading into AGO protects the dsRNA duplex from degradation and 3′ uridylation. Analysis of hen1-8 cer7-3 mutants revealed that hen1-8 cer7-3 has a shiny wax deficient phenotype (Figure 5.3). This result indicates that regulation of cuticular wax biosynthesis via CER3 silencing is HEN1independent. This result is surprising because HEN1 has been shown to be a conserved 98  component required in the biogenesis of all small RNAs and gene silencing. It is possible that this result is due to the fact that the weak allele of hen1, which is a partial loss of function, was used in this analysis (Yu et al., 2010). Partial HEN1 function may be sufficient for small RNA biosynthesis, which will affect CER3 expression and consequently stem wax deposition. Wax analysis of the hen1-8 cer7-3 mutants should be performed to determine if wax levels on the double mutant stems are only partially restored to amounts that are not discernible by visual inspection. Another hypothesis is that the lesion in CER7 in the hen1-8 cer7-3 double mutant makes the requirement for functional HEN1 irrelevant. HEN1 methylated the 3′ end of the dsRNA to protect it from degradation and uridylation. It may not be necessary to protect the dsRNA from degradation in the cer7 background since the exosome in nonfunctional, and therefore cannot mediate 3′  5′ degradation of the small RNA. Additionally, 3′ uridylation has been shown to trigger degradation of miRNAs and siRNAs by the exosome in Chlamydomonas (Ibrahim et al., 2010). In hen1-8 cer7-3 mutants, even though the small RNA is not methylated and can undergo 3′ uridylation, the compromised exosome is not able to degrade the small RNA even when triggered by uridylation. To completely resolve this question and fully address the requirement for HEN1 in CER3 regulation during stem wax biosynthesis, the strong hen1-1 allele, which is caused by a missense mutation, resulting in a premature STOP codon should be used in a cross with cer7-1. The central component still missing to complete the model of CER3 silencing is the RNA species responsible for the regulation. AGO1 preferentially loads small RNAs with a 5′ uracil that are 21 or 22 nucleotides in length (Mi et al., 2008). Therefore, in the deep sequencing analysis, I would expect to see an enrichment of this sort of small RNA. 99  Ultimately, I hope to identify the exact RNA species involved in regulating CER3, and determine whether CER3 regulation by this small RNA is direct or indirect. In summary, the results described in this chapter have demonstrated that AGO1 is required for the production of the small RNA involved in regulation of cuticular wax biosynthesis. Additional work done by L. Zhao, another graduate student in the Kunst Lab, has shown that DCL4 is the DCL that is involved in this pathway. Taken together, these data show that the components of the small RNA biogenesis pathway involved in regulation of wax deposition include SGS3, RDR1, DCL4 and AGO1 (Figure 5.4). Three of these proteins (SGS3, DCL4, and AGO1) are required for ta-siRNA biogenesis (Vazquez et al., 2004), suggesting that the small RNA species controlling stem cuticular wax production is a tasiRNA.  Confirmation of this prediction awaits completion of the analysis of the next  generation sequencing data.  100  Figure 5.1 Phylogenetic tree of the 10 Arabidopsis AGO proteins. The 10 AGO paralogs can be grouped into 3 clades. Some of the function of 7 of the 10 AGO proteins have been revealed. PAM = point accepted mutations. Reprinted from Trends in Plant Science, 13(7), Vaucheret, H., Plant ARGONAUTES, pp. 350-358, © 2008, with permission from Elsevier.  101  ARGONAUTE name AGO1 - AT1G48410  Mutant allele ago1-11 ago1-36 - SALK_087076 SALK_039910 SALK_14149 AGO2 - AT1G31280 ago2-1 – SALK_003380 SALK_037548 SALK_026811 AGO3 - AT1G31290 ago3-1 – SM_3_31520 ago3-2 – SALK_005335 SALK_001761 AGO4 - AT2G27040 SALK_007523 SALK_071772 SAIL_248_E07 SALK_027933C AGO5 - AT2G27880 ago5-1 – SALK_063806 ago5-2 – SALK_118422 SAIL_100_C09 AGO6 - AT2G32940 ago6-2 – SALK_031553C ago6-3 – SALK_106607 SALK_106605 SAIL_678_D07 AGO7 - AT1G69440 ago7-1 – SALK_037458 SAIL_618_D07 SALK_095997 SALK_080533 SAIL_182_E11 AGO8 - AT5G21030 ago8-1 – SALK_139894 SALK_029708C SALK_060402C SALK_010058 AGO9 - AT5G21150 ago9-1 – SALK_127358 ago9-2 –SALK_112059 SALK_116786 AGO10 - AT5G43810 ago10-1 – SALK_000457 ago10-2 – SALK_047336 SALK_076299 SALK_117555 Table 5.1 ago mutants used in this chapter.  Type of mutation EMS T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA T-DNA  102  Figure 5.2 The cer7-1 ago1-11 double mutant has a wild-type-like stem wax phenotype. (A) Morphology of the cer7-1 mutant (left) compared to the cer7-1 ago1-11 double mutant (right). (B) Close-up of cer7-1 ago1-11 double mutant. The double mutant is dwarf and sterile with short broad leaves like the ago1-11 single mutant and has a waxy stem. (C) Stems of 6-week-old cer7-1 (top) and cer7-1 ago1-11 (bottom) stems showing that the cer71 ago1-11 double mutant has a restored stem wax phenotype.  103  Figure 5.3 The hen1-8 cer7-3 double mutant has a wax deficient phenotype. (A) The hen1-8 cer7-3 double mutant has the phenotypes of both hen1 and cer7, characterized by smaller organs, delayed flowering and a shiny wax deficient stem. (B) Close-up of 6-week-old stems of WT Col, cer7-3, hen1-8 and hen1-8 cer7-3 showing that hen1-8 cer7-3 does not suppress the cer7-3 wax-deficient phenotype.  104  Figure 5.4 Model integrating all the identified components of small RNA silencing that are required for regulation of cuticular wax. A forward genetics screen identified RDR1 and SGS3, whereas a reverse genetics screen identified DCL4 and AGO1. The role of HEN1 is still under investigation.  Modified and reprinted with permission from Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiol 159: 1385–1395. www.plantphysiol.org. Copyright American Society of Plant Biologists.  105  Chapter 6: Conclusions and Future Directions  6.1  Research Summary Overall, I am interested in uncovering how cuticular wax biosynthesis is regulated in  developing Arabidopsis inflorescence stems. This is important as plants need to control their lipid metabolism in epidermal cells to ensure optimal partitioning of carbon between membrane and cuticular lipids during cuticle development. Previous work by Hooker et al. (2007) revealed that this process is, at least in part, controlled by the CER7 exoribonuclease, a core subnit of the RNA processing and degrading exosome that controls the expression of the CER3 gene. According to the model proposed by Hooker et al. (2007), the CER7 exoribonuclease degrades an mRNA specifying a repressor of CER3 transcription thereby activating cuticular wax biosynthesis via the alkane pathway. In this thesis, I investigated the mechanisms of CER7-mediated silencing of CER3, and how this contributes to regulation of cuticular wax biosynthesis. Specifically, I wanted to identify the putative repressor of CER3. To do this, I performed a genetic screen to isolate suppressors of cer7-1 which restore cer7-related stem wax deficiency to wild-type wax levels (Chapter 3). I isolated four classes of suppressors designated war1 to war4. I decided to focus on the characterization of war2 and war3 mutants and cloning of the WAR2 and WAR3 genes (Chapter 4). Cloning of WAR2 proved to be unsuccessful and the identity of WAR2 is still unknown. However, cloning of WAR3 revealed that it encodes RNA-DEPENDENT RNA POLYMERASE 1 (RDR1), one of the six RDR proteins described in Arabidopsis. RDR proteins catalyze the conversion of a single-stranded RNA template into double-stranded RNA (dsRNA), which serves as a substrate for dicer-like 106  enzymes in the production of a type of small RNAs termed small interfering RNAs (siRNAs). In parallel with my identification of WAR3, map-based cloning of the war4 suppressor of cer7 by another graduate student in the Kunst lab, L. Zhao, revealed that WAR4 encodes SUPPRESSOR OF GENE SILENCING 3 (SGS3), a plant-specific protein suggested to bind and stabilize RNA template to initiate RDR-catalyzed dsRNA synthesis. SGS3 is essential for the synthesis of dsRNA in transgene silencing, virus silencing and the synthesis of trans-acting siRNAs involved in the regulation of gene expression during normal plant development. The previous model suggested that CER3 expression is regulated by a transcription factor, whose mRNA is degraded by the CER7 exoribonuclease. Our discovery of RDR1 and SGS3 as suppressors of cer7 implicates small RNA silencing in control of wax deposition along the Arabidopsis inflorescence stem during development. Based on this discovery, I propose that a small RNA species acts as a repressor of CER3. In the wild type, the CER7 exoribonuclease degrades a precursor of this small RNA repressor, allowing for expression of CER3, and thus production of alkanes. However, in the cer7 mutant, the precursor of this small RNA is not degraded by the CER7 exoribonuclease and is used for the production of a small RNA via a pathway involving RDR1 and SGS3. The generated small RNA silences CER3, leading to the wax deficient phenotype. I next wanted to identify additional components of the small RNA pathway involved in regulating CER3 expression for cuticular wax deposition (Chapter 5). Using a reverse genetics approach, I identified AGO1 as the ARGONAUTE required for the production of a small RNA involved in regulation of CER3.  107  Taking these data together, our work on the cer7 suppressors has demonstrated that RDR1, SGS3, AGO1 and DCL4 are required for the biogenesis of a small RNA that regulates CER3 expression during cuticular wax deposition (Figure 5.4).  Deep RNA  sequencing (RNA-seq) was performed from RNA taken from wild type, cer7, cer7 rdr1 and cer7 sgs3 populations to identify the exact RNA species involved in silencing, and to determine if this small RNA silences CER3 directly, or indirectly. Analysis of the RNA-seq data, which is currently in progress, will give us additional information to generate a more complete story of the CER7-mediated regulation of cuticular wax deposition. However, there are still more questions that can be asked. Such questions include: 1. What other components are involved in small RNA silencing of CER3? 2. Are there other mode of regulation of CER3?  3. Does the putative role of SERRATE as a mediator of cuticle  integrity influence regulation of cuticular wax biosynthesis?  4. What other biological  functions does the RRP45B (CER7) subunit of the exosome mediate?  6.2  Identification of Additional Components Downstream of CER7 Involved in  Regulation of CER3 In Chapter 3, a screen for suppressors of cer7 resulted in the isolation of 4 wax restorer (war) genes: war1 through war4. Chapter 4 described the characterization and identification of WAR3 as RDR1, and WAR4 as SGS3. However, the identity of WAR1 and WAR2 are still unknown. It would be revealing to ascertain the identity of these genes to develop a more complete model of small RNA-mediated silencing of CER3. Much work has already been done on cloning WAR2, and combing through the next-generation sequencing data should reveal its identity. 108  Additionally, there still are many putative suppressor lines that are not allelic to any of the war genes that have not yet been mapped. Several of these lines still fall within the cutoff threshold of 75% restoration of wax load and CER3 transcript levels, and would therefore be good candidates for future investigation.  Lines that didn’t reach the 75%  threshold can also be interesting to study. Furthermore, some lines had restored wax levels, but not CER3 transcript levels, suggesting an alternate pathway for synthesizing wax independent of CER3. This is an intriguing notion, so this line of investigation may be particularly fruitful and rewarding.  6.3  Other Methods of Regulating CER3 Expression CER7 has been shown to be involved in the production of a small RNA which  controls CER3 expression (Hooker et al., 2007; Lam et al., 2012). In the cer7 mutant, reduced expression of CER3 leads to reduced cuticular wax deposition on the inflorescence stems. However, CER3 transcript is still detectable in cer7, suggesting that there are other modes of regulating CER3, possibly by transcription factors that bind to the regulatory region of the CER3 promoter. In order to identify such transcription factors, a yeast 1-hybrid assay using the CER3 promoter as bait can be performed. To date, two transcription factors, MYB30 and MYB96, have been implicated in regulating expression of CER3 (Raffaele et al., 2008; Seo et al., 2011).  The MYB30  transcription factor was initially characterized as a positive regulator of hypersensitive response (HR) following pathogen infection (Daniel et al., 1999). To determine which genes are regulated by MYB30, microarray analysis of wild type, MYB30 overexpression lines and MYB30 knockout lines before and following inoculation with pathogens was performed. The 109  results showed an induction of genes involved in wax synthesis, specifically VLCFA biosynthetic genes, as well as CER1, CER3, and CER4 in MYB30 overexpression lines and down-regulation of these genes in MYB30 knockouts before pathogen inoculation (Raffaele et al., 2008). It was therefore proposed that MYB30 regulates HR response by activating VLCFA synthesis and their derivatives to act signalling molecules. Interestingly, MYB30 was later found to be post-transcriptionally regulated by a small RNA silencing pathway (Froidure et al., 2010). MYB30 expression in dcl1, dcl2/3/4, rdr2, rdr6 and hen1 was elevated, indicating a role for small RNAs in regulating MYB30. Since MYB30 regulates CER3, and MYB30 is regulated by a small RNA silencing pathway, it is conceivable that CER7-mediated small RNA regulation of CER3 is indirect. It is intriguing to speculate that the small RNA species identified in the cer7 suppressor screen may in fact regulate MYB30 expression, which in turn regulates CER3. This hypothesis can be tested through analysis of the RNA-seq data. Whether MYB30 is able to directly bind to the promoter of CER3 to regulate its expression also needs to be ascertained. The MYB96 transcription factor was shown to regulate the expression of wax biosynthetic genes in response to drought stress.  MYB96 is able to directly bind the  promoter of CER3 and activate its expression (Seo et al., 2011). Therefore, in a yeast-one hybrid assay to find proteins which interact with the promoter of CER3, we would expect to find MYB96. Once transcription factors have been identified from the yeast-one hybrid screen and validated, their role in regulating cuticular wax biosynthesis can be tested.  These  transcription factors can be genetically manipulated so that they are either constitutively overexpressed or repressed, followed by assessment of the resulting phenotypes. 110  6.4  The Role of SERRATE A group of Arabidopsis mutants, fiddlehead (fdh), lacerata (lcr) and bodyguard  (bdg), exhibit organ fusion phenotypes and increased cuticle permeability (Voisin et al., 2009), suggesting a reduction in cutin or wax in the cuticle. Surprisingly, analysis of cutin and wax levels of fdh, lcr and bdg show that these mutants have increased levels of cutin and wax (Kurdyukov et al., 2006; Voisin et al., 2009). As well, fdh, lcr and bdg have increased resistance to pathogen infection. Expression analysis to identify differentially expressed genes in fdh, lcr and bdg shows an up-regulation of genes involved in cell wall biosynthesis, cuticular lipid biosynthesis and defense responses. This suggests that fdh, lcr and bdg compensate for their defects by remodelling their cell walls and cuticles and activating defenses (Voisin et al., 2009). An in silico genetic screen was performed by Voisin et al. (2009) on fdh, lcr and bdg to determine additional genes that could be involved in mediating cuticle integrity. SERRATE (SE) was found to be a suppressor. The serrate mutant has serrated leaf margins, atypical phyllotaxy and altered floral development (Prigge and Wagner, 2001). SERRATE encodes a zinc-finger protein that has been shown to participate in miRNA processing (Yang et al., 2006; Lobbes et al., 2006). SE forms a complex with the dsRNA-binding protein HYPNOSTATIC LEAVES 1 (HYL1) and DCL1. This complex processes pre-miRNAs into the miRNA/miRNA* duplex. Proper SE function is also required to generate ta-siRNAs (Yang et al., 2006). To confirm the in silico results, double se-1 lcr and se-1 bdg mutants were generated. They were shown have serrated leaves, but no organ fusion or leaf permeability phenotypes associated with single lcr or bdg mutants, indicating that SE suppresses the lcr and bdg  111  phenotypes (Voisin et al., 2009). They proposed that SE is involved in a signalling pathway needed for maintenance of cuticle integrity. Is there a link between maintaining cuticle integrity and regulation of cuticular wax biosynthesis? SE participates in the processing of pre-miRNAs to produce miRNAs, and these miRNAs can trigger gene silencing through ta-siRNA production.  I previously  proposed that regulation of CER3 for cuticular wax biosynthesis is probably through a tasiRNA pathway. Therefore, SE might be required to generate the ta-siRNAs that regulate CER3.  To investigate if there is an interplay between SE and CER3 regulation, one could  make a se cer7 double mutant to see if SE can suppress the cer7 wax deficient phenotype.  6.5  Additional Biological Functions of the AtRRP45B (CER7) Subunit of the  Exosome The eukaryotic exosome is an evolutionary conserved multimeric complex involved in RNA metabolism. It is composed of nine core subunits, some of which have documented 3′  5′ exoribonuclease activity. In Arabidopsis, several exosomal subunits appear to have specialized functions. For example, AtRRP41 is required for female gametogenesis, and AtRRP4 is necessary for embryo development (Chekanova et al., 2007). The AtRRP45B subunit, which was identified as CER7, is responsible for regulation of wax biosynthesis (Hooker et al., 2007; Lam et al., 2012). Whether the RRP45B subunit has other functions is currently unknown. This could be assessed by next-generation RNA sequencing (RNA-seq) to profile the small RNA population accumulating in cer7 compared to the wild type. In yeast, the exosome has been shown to degrade RNAs to prevent them from entering and interfering with the siRNA-silencing pathway (Bühler et al., 2008). As well, in 112  Arabidopsis, 5′  3′ degradation of RNA by EXORIBONUCLEASE 4/ETHYLENE INSENSITIVE 5 (XRN4/EIN5) was demonstrated to assist in RNA surveillance to prevent RNAs from entering the silencing pathway (Gregory et al., 2008). Perhaps the exosome has a role in controlling which RNAs enter the silencing pathway? The RNA-seq analysis could also indicate what kinds of small RNAs the CER7 subunit possibly controls via degradation. Changes in the small RNA profile, such as lengths of small RNAs or the identity of the 5′ terminal nucleotide can indicate the types of small RNAs that are processed by CER7. Also enrichments in different small RNAs can indicate other genes that CER7 may control. We can map differentially expressed RNAs to their corresponding genes to isolate genes that may be controlled by CER7.  113  References  Adenot X, Elmayan T, Lauressergues D, Boutet S, Bouché N, Gasciolli V, Vaucheret H (2006) DRB4-Dependent TAS3 trans-Acting siRNAs Control Leaf Morphology through AGO7. Curr Biol 16: 927–932 Aharoni A, Dixit S, Jetter R, Thoenes E, Van Arkel G, Pereira A (2004) The SHINE Clade of AP2 Domain Transcription Factors Activates Wax Biosynthesis, Alters Cuticle Properties, and Confers Drought Tolerance when Overexpressed in Arabidopsis. Plant Cell 16: 2463–2480 Allmang C, Petfalski E, Podtelejnikov A, Mann M, Tollervey D, Mitchell P (1999) The yeast exosome and human PM–Scl are related complexes of 3′ → 5′ exonucleases. Genes Dev 13: 2148–2158 Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-Wide Insertional Mutagenesis of Arabidopsis thaliana. Science 301: 653 –657 Ariizumi T, Hatakeyama K, Hinata K, Sato S, Kato T, Tabata S, Toriyama K (2003) A novel male-sterile mutant of Arabidopsis thaliana, faceless pollen-1, produces pollen with a smooth surface and an acetolysis-sensitive exine. Plant Mol Biol 53: 107–116 Austin RS, Vidaurre D, Stamatiou G, Breit R, Provart NJ, Bonetta D, Zhang J, Fung P, Gong Y, Wang PW, et al (2011) Next-generation mapping of Arabidopsis genes. The Plant Journal 67: 715–725 Bach L, Michaelson LV, Haslam R, Bellec Y, Gissot L, Marion J, Da Costa M, Boutin J-P, Miquel M, Tellier F, et al (2008) The very-long-chain hydroxy fatty acyl-CoA dehydratase PASTICCINO2 is essential and limiting for plant development. Proc Natl Acad Sci USA 105: 14727–14731 Barthlott W, Neinhuis C (1997) Purity of the sacred lotus, or escape from contamination in biological surfaces. Planta 202: 1–8 Baumberger N, Baulcombe DC (2005) Arabidopsis ARGONAUTE1 is an RNA Slicer that selectively recruits microRNAs and short interfering RNAs. PNAS 102: 11928– 11933 Beaudoin F, Gable K, Sayanova O, Dunn T, Napier JA (2002) A Saccharomyces cerevisiae Gene Required for Heterologous Fatty Acid Elongase Activity Encodes a Microsomal β-Keto-reductase. J Biol Chem 277: 11481–11488  114  Beaudoin F, Wu X, Li F, Haslam RP, Markham JE, Zheng H, Napier JA, Kunst L (2009) Functional Characterization of the Arabidopsis β-Ketoacyl-Coenzyme A Reductase Candidates of the Fatty Acid Elongase. Plant Physiol 150: 1174–1191 Berendzen K, Searle I, Ravenscroft D, Koncz C, Batschauer A, Coupland G, Somssich IE, Ulker B (2005) A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta. Plant Methods. doi: doi:10.1186/1746-4811-1-4 Bernard A, Domergue F, Pascal S, Jetter R, Renne C, Faure J-D, Haslam RP, Napier JA, Lessire R, Joubès J (2012) Reconstitution of Plant Alkane Biosynthesis in Yeast Demonstrates That Arabidopsis ECERIFERUM1 and ECERIFERUM3 Are Core Components of a Very-Long-Chain Alkane Synthesis Complex. Plant Cell 24: 3106– 3118 Bird D, Beisson F, Brigham A, Shin J, Greer S, Jetter R, Kunst L, Wu X, Yephremov A, Samuels L (2007) Characterization of Arabidopsis ABCG11/WBC11, an ATP binding cassette (ABC) transporter that is required for cuticular lipid secretion. Plant J 52: 485–498 Bohmert K, Camus I, Bellini C, Bouchez D, Caboche M, Benning C (1998) AGO1 defines a novel locus of Arabidopsis controlling leaf development. The EMBO Journal 17: 170–180 Bonaventure G, Salas JJ, Pollard MR, Ohlrogge JB (2003) Disruption of the FATB Gene in Arabidopsis Demonstrates an Essential Role of Saturated Fatty Acids in Plant Growth. Plant Cell 15: 1020–1033 Bourdenx B, Bernard A, Domergue F, Pascal S, Léger A, Roby D, Pervent M, Vile D, Haslam RP, Napier JA, et al (2011) Overexpression of Arabidopsis ECERIFERUM1 Promotes Wax Very-Long-Chain Alkane Biosynthesis and Influences Plant Response to Biotic and Abiotic Stresses. Plant Physiol 156: 29 –45 Boutet S, Vazquez F, Liu J, Béclin C, Fagard M, Gratias A, Morel J-B, Crété P, Chen X, Vaucheret H (2003) Arabidopsis HEN1: A Genetic Link between Endogenous miRNA Controlling Development and siRNA Controlling Transgene Silencing and Virus Resistance. Curr Biol 13: 843–848 Broun P, Poindexter P, Osborne E, Jiang C-Z, Riechmann JL (2004) WIN1, a transcriptional activator of epidermal wax accumulation in Arabidopsis. Proc Natl Acad Sci USA 101: 4706–4711 Bühler M, Spies N, Bartel DP, Moazed D (2008) TRAMP-mediated RNA surveillance prevents spurious entry of RNAs into the Schizosaccharomyces pombe siRNA pathway. Nat Struct Mol Biol 15: 1015–1023 115  Butler JS (2002) The yin and yang of the exosome. Trends in Cell Biology 12: 90–96 Chekanova JA, Gregory BD, Reverdatto SV, Chen H, Kumar R, Hooker T, Yazaki J, Li P, Skiba N, Peng Q, et al (2007) Genome-Wide High-Resolution Mapping of Exosome Substrates Reveals Hidden Features in the Arabidopsis Transcriptome. Cell 131: 1340–1353 Chen X (2009) Small RNAs and Their Roles in Plant Development. Annu Rev Cell Dev Biol 25: 21–44 Chen X, Goodwin SM, Boroff VL, Liu X, Jenks MA (2003) Cloning and Characterization of the WAX2 Gene of Arabidopsis Involved in Cuticle Membrane and Wax Production. Plant Cell 15: 1170–1185 Chen X, Liu J, Cheng Y, Jia D (2002) HEN1 functions pleiotropically in Arabidopsis development and acts in C function in the flower. Development 129: 1085–1094 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743 Cominelli E, Sala T, Calvi D, Gusmaroli G, Tonelli C (2008) Over-expression of the Arabidopsis AtMYB41 gene alters cell expansion and leaf surface permeability. The Plant Journal 53: 53–64 Dalmay T, Hamilton A, Rudd S, Angell S, Baulcombe DC (2000) An RNA-Dependent RNA Polymerase Gene in Arabidopsis Is Required for Posttranscriptional Gene Silencing Mediated by a Transgene but Not by a Virus. Cell 101: 543–553 Daniel X, Lacomme C, Morel J-B, Roby D (1999) A novel myb oncogene homologue in Arabidopsis thaliana related to hypersensitive cell death. The Plant Journal 20: 57–66 Datla RSS, Hammerlindl JK, Panchuk B, Pelcher LE, Keller W (1992) Modified binary plant transformation vectors with the wild-type gene encoding NPTII. Gene 122: 383–384 DeBono A, Yeats TH, Rose JKC, Bird D, Jetter R, Kunst L, Samuels L (2009) Arabidopsis LTPG Is a Glycosylphosphatidylinositol-Anchored Lipid Transfer Protein Required for Export of Lipids to the Plant Surface. Plant Cell 21: 1230–1238 Eigenbrode SD, Espelie KE (1995) Effects of Plant Epicuticular Lipids on Insect Herbivores. Ann Rev Ent 40: 171–194 Froidure S, Roby D, Rivas S (2010) Expression of the Arabidopsis transcription factor AtMYB30 is post-transcriptionally regulated. Plant Physiol Biochem 48: 735–739  116  Greer S, Wen M, Bird D, Wu X, Samuels L, Kunst L, Jetter R (2007) The Cytochrome P450 Enzyme CYP96A15 Is the Midchain Alkane Hydroxylase Responsible for Formation of Secondary Alcohols and Ketones in Stem Cuticular Wax of Arabidopsis. Plant Physiol 145: 653–667 Gregory BD, O’Malley RC, Lister R, Urich MA, Tonti-Filippini J, Chen H, Millar AH, Ecker JR (2008) A Link between RNA Metabolism and Silencing Affecting Arabidopsis Development. Developmental Cell 14: 854–866 Hannoufa A, Negruk V, Eisner G, Lemieux B (1996) The CER3 gene of Arabidopsis thaliana is expressed in leaves, stems, roots, flowers and apical meristems. The Plant Journal 10: 459–467 Haslam TM, Mañas-Fernández A, Zhao L, Kunst L (2012) Arabidopsis ECERIFERUM2 Is a Component of the Fatty Acid Elongation Machinery Required for Fatty Acid Extension to Exceptional Lengths. Plant Physiol 160: 1164–1174 Hooker TS, Lam P, Zheng H, Kunst L (2007) A core subunit of the RNAprocessing/degrading exosome specifically influences cuticular wax biosynthesis in Arabidopsis. Plant Cell 19: 904–913 Hooker TS, Millar AA, Kunst L (2002) Significance of the Expression of the CER6 Condensing Enzyme for Cuticular Wax Production in Arabidopsis. Plant Physiol 129: 1568–1580 Houseley J, LaCava J, Tollervey D (2006) RNA-quality control by the exosome. Nature Reviews Molecular Cell Biology 7: 529–539 Hunter C, Sun H, Poethig RS (2003) The Arabidopsis Heterochronic Gene ZIPPY Is an ARGONAUTE Family Member. Curr Biol 13: 1734–1739 Ibrahim F, Rymarquis LA, Kim E-J, Becker J, Balassa E, Green PJ, Cerutti H (2010) Uridylation of mature miRNAs and siRNAs by the MUT68 nucleotidyltransferase promotes their degradation in Chlamydomonas. PNAS 107: 3906–3911 Ilgenfritz H, Bouyer D, Schnittger A, Mathur J, Kirik V, Schwab B, Chua N-H, Jürgens G, Hülskamp M (2003) The Arabidopsis STICHEL Gene Is a Regulator of Trichome Branch Number and Encodes a Novel Protein. Plant Physiol 131: 643 –655 Jaubert M, Bhattacharjee S, Mello AFS, Perry KL, Moffett P (2011) ARGONAUTE2 Mediates RNA-Silencing Antiviral Defenses against Potato virus X in Arabidopsis. Plant Physiol 156: 1556–1564 Jeffree CE (2006) The Fine Structure of the Plant Cuticle. In M Riederer, C Müller, eds, Biology of the Plant Cuticle. Blackwell Publishing Ltd, pp 11–125  117  Jenks MA, Tuttle HA, Eigenbrode SD, Feldmann KA (1995) Leaf Epicuticular Waxes of the Eceriferum Mutants in Arabidopsis. Plant Physiol 108: 369–377 Jensen TH, Moore C (2005) Reviving the Exosome. Cell 121: 660–662 Jetter R, Kunst L, Samuels L (2006) Composition of Plant Cuticular Waxes. Biology of the Plant Cuticle. Blackwell Publishing Ltd, pp 145–181 Kannangara R, Branigan C, Liu Y, Penfield T, Rao V, Mouille G, Hofte H, Pauly M, Riechmann JL, Broun P (2007) The Transcription Factor WIN1/SHN1 Regulates Cutin Biosynthesis in Arabidopsis thaliana. Plant Cell 19: 1278–1294 Kidner CA, Martienssen RA (2005) The role of ARGONAUTE1 (AGO1) in meristem formation and identity. Developmental Biology 280: 504–517 Kim H, Lee SB, Kim HJ, Min MK, Hwang I, Suh MC (2012) Characterization of Glycosylphosphatidylinositol-Anchored Lipid Transfer Protein 2 (LTPG2) and Overlapping Function between LTPG/LTPG1 and LTPG2 in Cuticular Wax Export or Accumulation in Arabidopsis thaliana. Plant Cell Physiol 53: 1391–1403 Kim S, Yamaoka Y, Ono H, Kim H, Shim D, Maeshima M, Martinoia E, Cahoon EB, Nishida I, Lee Y (2013) AtABCA9 transporter supplies fatty acids for lipid synthesis to the endoplasmic reticulum. PNAS 110: 773–778 Koncz C, Schell J (1986) The promoter of TL-DNA gene 5 controls the tissue-specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector. Mol Gen Genet 204: 383–396 Kosma DK, Bourdenx B, Bernard A, Parsons EP, Lü S, Joubès J, Jenks MA (2009) The Impact of Water Deficiency on Leaf Cuticle Lipids of Arabidopsis. Plant Physiol 151: 1918–1929 Kumakura N, Takeda A, Fujioka Y, Motose H, Takano R, Watanabe Y (2009) SGS3 and RDR6 interact and colocalize in cytoplasmic SGS3/RDR6-bodies. FEBS Lett 583: 1261–1266 Kunst L, Jetter R, Samuels AL (2006) Biosynthesis and Transport of Plant Cuticular Waxes. In M Riederer, C Müller, eds, Biology of the Plant Cuticle. Blackwell Publishing Ltd, pp 182–215 Kunst L, Samuels A. (2003) Biosynthesis and secretion of plant cuticular wax. Progress in Lipid Research 42: 51–80 Kurata T, Kawabata-Awai C, Sakuradani E, Shimizu S, Okada K, Wada T (2003) The YORE-YORE gene regulates multiple aspects of epidermal cell differentiation in Arabidopsis. Plant J 36: 55–66 118  Kurdyukov S, Faust A, Nawrath C, Bär S, Voisin D, Efremova N, Franke R, Schreiber L, Saedler H, Métraux J-P, et al (2006) The Epidermis-Specific Extracellular BODYGUARD Controls Cuticle Development and Morphogenesis in Arabidopsis. Plant Cell 18: 321–339 Lai C, Kunst L, Jetter R (2007) Composition of alkyl esters in the cuticular wax on inflorescence stems of Arabidopsis thaliana cer mutants. Plant J 50: 189–196 Lam P, Zhao L, McFarlane HE, Aiga M, Lam V, Hooker TS, Kunst L (2012) RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis. Plant Physiol 159: 1385–1395 Lange H, Gagliardi D (2010) The Exosome and 3′–5′ RNA Degradation in Plants. In TH Jensen, ed, RNA Exosome. Springer New York, New York, NY, pp 50–62 Lange H, Holec S, Cognat V, Pieuchot L, Ret ML, Canaday J, Gagliardi D (2008) Degradation of a Polyadenylated rRNA Maturation By-Product Involves One of the Three RRP6-Like Proteins in Arabidopsis thaliana. Mol Cell Biol 28: 3038–3044 Lange H, Sement FM, Gagliardi D (2011) MTR4, a putative RNA helicase and exosome co-factor, is required for proper rRNA biogenesis and development in Arabidopsis thaliana. The Plant Journal 68: 51–63 Lee S-B, Jung S-J, Go Y-S, Kim H-U, Kim J-K, Cho H-J, Park OK, Suh M-C (2009) Two Arabidopsis 3-ketoacyl CoA synthase genes, KCS20 and KCS2/DAISY, are functionally redundant in cuticular wax and root suberin biosynthesis, but differentially controlled by osmotic stress. The Plant Journal 60: 462–475 Li F, Wu X, Lam P, Bird D, Zheng H, Samuels L, Jetter R, Kunst L (2008) Identification of the Wax Ester Synthase/Acyl-Coenzyme A:Diacylglycerol Acyltransferase WSD1 Required for Stem Wax Ester Biosynthesis in Arabidopsis. Plant Physiol 148: 97–107 Li J, Yang Z, Yu B, Liu J, Chen X (2005) Methylation Protects miRNAs and siRNAs from a 3′-End Uridylation Activity in Arabidopsis. Current Biology 15: 1501–1507 Lobbes D, Rallapalli G, Schmidt DD, Martin C, Clarke J (2006) SERRATE: a new player on the plant microRNA scene. EMBO reports 7: 1052–1058 Lü S, Song T, Kosma DK, Parsons EP, Rowland O, Jenks MA (2009) Arabidopsis CER8 encodes LONG-CHAIN ACYL-COA SYNTHETASE 1 (LACS1) that has overlapping functions with LACS2 in plant wax and cutin synthesis. The Plant Journal 59: 553–564 Mallory A, Vaucheret H (2010) Form, Function, and Regulation of ARGONAUTE Proteins. Plant Cell 22: 3879–3889 119  McFarlane HE, Shin JJH, Bird DA, Samuels AL (2010) Arabidopsis ABCG Transporters, Which Are Required for Export of Diverse Cuticular Lipids, Dimerize in Different Combinations. Plant Cell 22: 3066 –3075 Mi S, Cai T, Hu Y, Chen Y, Hodges E, Ni F, Wu L, Li S, Zhou H, Long C, et al (2008) Sorting of Small RNAs into Arabidopsis Argonaute Complexes Is Directed by the 5’ Terminal Nucleotide. Cell 133: 116–127 Millar AA, Clemens S, Zachgo S, Giblin EM, Taylor DC, Kunst L (1999) CUT1, an Arabidopsis Gene Required for Cuticular Wax Biosynthesis and Pollen Fertility, Encodes a Very-Long-Chain Fatty Acid Condensing Enzyme. Plant Cell 11: 825–838 Millar AA, Kunst L (1997) Very-long-chain fatty acid biosynthesis is controlled through the expression and specificity of the condensing enzyme. The Plant Journal 12: 121–131 Mitchell P, Petfalski E, Shevchenko A, Mann M, Tollervey D (1997) The Exosome: A Conserved Eukaryotic RNA Processing Complex Containing Multiple 3′→5′ Exoribonucleases. Cell 91: 457–466 Montgomery TA, Howell MD, Cuperus JT, Li D, Hansen JE, Alexander AL, Chapman EJ, Fahlgren N, Allen E, Carrington JC (2008) Specificity of ARGONAUTE7miR390 Interaction and Dual Functionality in TAS3 Trans-Acting siRNA Formation. Cell 133: 128–141 Moon H, Chowrira G, Rowland O, Blacklock B, Smith M, Kunst L (2004) A rootspecific condensing enzyme from Lesquerella fendleri that elongates very-long-chain saturated fatty acids. Plant Molecular Biology 56: 917–927 Mourrain P, Béclin C, Elmayan T, Feuerbach F, Godon C, Morel J-B, Jouette D, Lacombe A-M, Nikic S, Picault N, et al (2000) Arabidopsis SGS2 and SGS3 Genes Are Required for Posttranscriptional Gene Silencing and Natural Virus Resistance. Cell 101: 533–542 Nawrath C (2006) Unraveling the complex network of cuticular structure and function. Curr Opin Plant Biol 9: 281–287 Negruk V, Yang P, Subramanian M, McNevin JP, Lemieux B (1996) Molecular cloning and characterization of the CER2 gene of Arabidopsis thaliana. The Plant Journal 9: 137–145 Oram JF, Vaughan AM (2006) ATP-Binding Cassette Cholesterol Transporters and Cardiovascular Disease. Circulation Research 99: 1031–1043 Panikashvili D, Savaldi-Goldstein S, Mandel T, Yifhar T, Franke RB, Höfer R, Schreiber L, Chory J, Aharoni A (2007) The Arabidopsis DESPERADO/AtWBC11 Transporter Is Required for Cutin and Wax Secretion. Plant Physiol 145: 1345 –1360 120  Park W, Li J, Song R, Messing J, Chen X (2002) CARPEL FACTORY, a Dicer Homolog, and HEN1, a Novel Protein, Act in microRNA Metabolism in Arabidopsis thaliana. Current Biology 12: 1484–1495 Peragine A, Yoshikawa M, Wu G, Albrecht HL, Poethig RS (2004) SGS3 and SGS2/SDE1/RDR6 are required for juvenile development and the production of trans-acting siRNAs in Arabidopsis. Gene Dev 18: 2368 –2379 Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT– PCR. Nucleic Acids Res 29: 2002–2007 Pighin JA, Zheng H, Balakshin LJ, Goodman IP, Western TL, Jetter R, Kunst L, Samuels AL (2004) Plant Cuticular Lipid Export Requires an ABC Transporter. Science 306: 702 –704 Pollard M, Beisson F, Li Y, Ohlrogge JB (2008) Building lipid barriers: biosynthesis of cutin and suberin. Trends Plant Sci 13: 236–246 Prigge MJ, Wagner DR (2001) The Arabidopsis SERRATE Gene Encodes a Zinc-Finger Protein Required for Normal Shoot Development. Plant Cell 13: 1263–1280 Raffaele S, Vailleau F, Léger A, Joubès J, Miersch O, Huard C, Blée E, Mongrand S, Domergue F, Roby D (2008) A MYB Transcription Factor Regulates Very-LongChain Fatty Acid Biosynthesis for Activation of the Hypersensitive Cell Death Response in Arabidopsis. Plant Cell 20: 752 –767 Reicosky DA, Hanover JW (1978) Physiological Effects of Surface Waxes: I. Light Reflectance for Glaucous and Nonglaucous Picea pungens. Plant Physiol 62: 101 – 104 Riederer M, Muller C (2006) Biology of the Plant Cuticle. Blackwell Publishing Ltd, Oxford, UK Riederer M, Schreiber L (2001) Protecting against water loss: analysis of the barrier properties of plant cuticles. J Exp Bot 52: 2023 –2032 Rowland O, Lee R, Franke R, Schreiber L, Kunst L (2007) The CER3 wax biosynthetic gene from Arabidopsis thaliana is allelic to WAX2/YRE/FLP1. FEBS Lett 581: 3538–3544 Rowland O, Zheng H, Hepworth SR, Lam P, Jetter R, Kunst L (2006) CER4 encodes an alcohol-forming fatty acyl-coenzyme A reductase involved in cuticular wax production in Arabidopsis. Plant Physiol 142: 866–877 Sakuradani E, Zhao L, Haslam TM, Kunst L (2013) The CER22 gene required for the synthesis of cuticular wax alkanes in Arabidopsis thaliana is allelic to CER1. Planta 237: 731–738 121  Samuels L, Kunst L, Jetter R (2008) Sealing Plant Surfaces: Cuticular Wax Formation by Epidermal Cells. Annu Rev Plant Biol 59: 683–707 Schneeberger K, Ossowski S, Lanz C, Juul T, Petersen AH, Nielsen KL, Jørgensen J-E, Weigel D, Andersen SU (2009) SHOREmap: simultaneous mapping and mutation identification by deep sequencing. Nature Methods 6: 550–551 Schnurr J, Shockey J, Browse J (2004) The Acyl-CoA Synthetase Encoded by LACS2 Is Essential for Normal Cuticle Development in Arabidopsis. Plant Cell 16: 629–642 Seo PJ, Lee SB, Suh MC, Park M-J, Go YS, Park C-M (2011) The MYB96 Transcription Factor Regulates Cuticular Wax Biosynthesis under Drought Conditions in Arabidopsis. Plant Cell 23: 1138 –1152 Seo PJ, Xiang F, Qiao M, Park J-Y, Lee YN, Kim S-G, Lee Y-H, Park WJ, Park C-M (2009) The MYB96 Transcription Factor Mediates Abscisic Acid Signaling during Drought Stress Response in Arabidopsis. Plant Physiol 151: 275–289 Shockey JM, Fulda MS, Browse JA (2002) Arabidopsis Contains Nine Long-Chain AcylCoenzyme A Synthetase Genes That Participate in Fatty Acid and Glycerolipid Metabolism. Plant Physiol 129: 1710–1722 Sieber P, Schorderet M, Ryser U, Buchala A, Kolattukudy P, Metraux J-P, Nawrath C (2000) Transgenic Arabidopsis Plants Expressing a Fungal Cutinase Show Alterations in the Structure and Properties of the Cuticle and Postgenital Organ Fusions. Plant Cell 12: 721–738 Somerville CR, Ogren WL (1982) Isolation of photorespiratory mutants of Arabidopsis. Methods in Chloroplast Molecular Biology. Elsevier, New York, pp 129–139 Song J-J, Smith SK, Hannon GJ, Joshua-Tor L (2004) Crystal Structure of Argonaute and Its Implications for RISC Slicer Activity. Science 305: 1434–1437 Stumpf PK (1984) Fatty acid biosynthesis in higher plants. In S Numa, ed, Fatty Acid Metabolism and Its Regulation. Elsevier, Amsterdam, pp 155–179 Suh MC, Samuels AL, Jetter R, Kunst L, Pollard M, Ohlrogge J, Beisson F (2005) Cuticular Lipid Composition, Surface Structure, and Gene Expression in Arabidopsis Stem Epidermis. Plant Physiol 139: 1649 –1665 Todd J, Post-Beittenmiller D, Jaworski JG (1999) KCS1encodes a fatty acid elongase 3ketoacyl-CoA synthase affecting wax biosynthesis inArabidopsis thaliana. The Plant Journal 17: 119–130 Vaucheret H (2008) Plant ARGONAUTES. Trends Plant Sci 13: 350–358  122  Vazquez F, Legrand S, Windels D (2010) The biosynthetic pathways and biological scopes of plant small RNAs. Trends Plant Sci 15: 337–345 Vazquez F, Vaucheret H, Rajagopalan R, Lepers C, Gasciolli V, Mallory AC, Hilbert JL, Bartel DP, Crété P (2004) Endogenous trans-Acting siRNAs Regulate the Accumulation of Arabidopsis mRNAs. Mol Cell 16: 69–79 Voelker TA, Jones A, Cranmer AM, Davies HM, Knutzon DS (1997) Broad-Range and Binary-Range Acyl-Acyl-Carrier-Protein Thioesterases Suggest an Alternative Mechanism for Medium-Chain Production in Seeds. Plant Physiol 114: 669–677 Voisin D, Nawrath C, Kurdyukov S, Franke RB, Reina-Pinto JJ, Efremova N, Will I, Schreiber L, Yephremov A (2009) Dissection of the Complex Phenotype in Cuticular Mutants of Arabidopsis Reveals a Role of SERRATE as a Mediator. PLoS Genet. doi: 10.1371/journal.pgen.1000703 Wang Z-Y, Xiong L, Li W, Zhu J-K, Zhu J (2011) The Plant Cuticle Is Required for Osmotic Stress Regulation of Abscisic Acid Biosynthesis and Osmotic Stress Tolerance in Arabidopsis. Plant Cell 23: 1971 –1984 Wei W, Ba Z, Gao M, Wu Y, Ma Y, Amiard S, White CI, Rendtlew Danielsen JM, Yang Y-G, Qi Y (2012) A Role for Small RNAs in DNA Double-Strand Break Repair. Cell 149: 101–112 Weng H, Molina I, Shockey J, Browse J (2010) Organ fusion and defective cuticle function in a lacs1 lacs2 double mutant of Arabidopsis. Planta 231: 1089–1100 Winter D, Vinegar B, Nahal H, Ammar R, Wilson GV, Provart NJ (2007) An “Electronic Fluorescent Pictograph” Browser for Exploring and Analyzing LargeScale Biological Data Sets. PLoS ONE 2: e718 Wu R, Li S, He S, Waßmann F, Yu C, Qin G, Schreiber L, Qu L-J, Gu H (2011) CFL1, a WW Domain Protein, Regulates Cuticle Development by Modulating the Function of HDG1, a Class IV Homeodomain Transcription Factor, in Rice and Arabidopsis. Plant Cell 23: 3392 –3411 Xia Y, Nikolau BJ, Schnable PS (1996) Cloning and Characterization of CER2, an Arabidopsis Gene That Affects Cuticular Wax Accumulation. Plant Cell 8: 1291– 1304 Xie Z, Johansen LK, Gustafson AM, Kasschau KD, Lellis AD, Zilberman D, Jacobsen SE, Carrington JC (2004) Genetic and Functional Diversification of Small RNA Pathways in Plants. PLoS Biol 2: 642–652 Xie Z, Qi X (2008) Diverse small RNA-directed silencing pathways in plants. BBA-Gene Regul Mech 1779: 720–724 123  Xue Z, Yuan H, Guo J, Liu Y (2012) Reconstitution of an Argonaute-Dependent Small RNA Biogenesis Pathway Reveals a Handover Mechanism Involving the RNA Exosome and the Exonuclease QIP. Molecular Cell 46: 299–310 Yang J, Isabel Ordiz M, Jaworski JG, Beachy RN (2011) Induced accumulation of cuticular waxes enhances drought tolerance in Arabidopsis by changes in development of stomata. Plant Physiology and Biochemistry 49: 1448–1455 Yang L, Liu Z, Lu F, Dong A, Huang H (2006) SERRATE is a novel nuclear regulator in primary microRNA processing in Arabidopsis. The Plant Journal 47: 841–850 Yu B, Bi L, Zhai J, Agarwal M, Li S, Wu Q, Ding S-W, Meyers BC, Vaucheret H, Chen X (2010) siRNAs compete with miRNAs for methylation by HEN1 in Arabidopsis. Nucl Acids Res 38: 5844–5850 Yu B, Yang Z, Li J, Minakhina S, Yang M, Padgett RW, Steward R, Chen X (2005) Methylation as a Crucial Step in Plant microRNA Biogenesis. Science 307: 932–935 Yu D, Fan B, MacFarlane SA, Chen Z (2003) Analysis of the Involvement of an Inducible Arabidopsis RNA-Dependent RNA Polymerase in Antiviral Defense. Mol Plant Microbe In 16: 206–216 Zhang W, Murphy C, Sieburth LE (2010) Conserved RNaseII domain protein functions in cytoplasmic mRNA decay and suppresses Arabidopsis decapping mutant phenotypes. PNAS 107: 15981–15985 Zheng H, Rowland O, Kunst L (2005) Disruptions of the Arabidopsis Enoyl-CoA Reductase Gene Reveal an Essential Role for Very-Long-Chain Fatty Acid Synthesis in Cell Expansion during Plant Morphogenesis. Plant Cell 17: 1467–1481 Zheng X, Zhu J, Kapoor A, Zhu J-K (2007) Role of Arabidopsis AGO6 in siRNA accumulation, DNA methylation and transcriptional gene silencing. The EMBO Journal 26: 1691–1701 Zhu H, Hu F, Wang R, Zhou X, Sze S-H, Liou LW, Barefoot A, Dickman M, Zhang X (2011) Arabidopsis Argonaute10 Specifically Sequesters miR166/165 to Regulate Shoot Apical Meristem Development. Cell 145: 242–256 Zilberman D, Cao X, Jacobsen SE (2003) ARGONAUTE4 Control of Locus-Specific siRNA Accumulation and DNA and Histone Methylation. Science 299: 716–719  124  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0073736/manifest

Comment

Related Items